<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.

DARK ITEM
Permanent Link: http://ufdc.ufl.edu/UFE0043885/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.
Physical Description: Book
Language: english
Creator: Taparia, Yogesh
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Yogesh Taparia.
Thesis: Thesis (M.S.)--University of Florida, 2011.
Local: Adviser: Altpeter, Fredy.
Local: Co-adviser: Gallo, Maria.
Electronic Access: INACCESSIBLE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043885:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043885/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.
Physical Description: Book
Language: english
Creator: Taparia, Yogesh
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Yogesh Taparia.
Thesis: Thesis (M.S.)--University of Florida, 2011.
Local: Adviser: Altpeter, Fredy.
Local: Co-adviser: Gallo, Maria.
Electronic Access: INACCESSIBLE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043885:00001


This item has the following downloads:


Full Text

PAGE 1

1 ACCELERATING GENETIC TRANSFORMATION IN SUGARCANE By Y OGESH TAPARIA A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNI VERSITY OF FLORIDA 2011

PAGE 2

2 2011 Yogesh Taparia

PAGE 3

3 To my parents and my teachers for the ir encouragement and faith in me

PAGE 4

4 ACKNOWLEDGMENTS I profusely thank Dr Fredy Altpeter, my research supervisor, for his unfaltering patience and guidance in completing my m aster s education here, at the University of Florida in Gainesville. His amazing work ethic and attention to detail has been crucial in the development and completion of my m appreciate the co operation an d support of the members of my research committee Dr. Maria Gallo ( c o chair), Dr. Wilfred Vermerris and Dr Christine D Chase, for lending their expertise and time in the successful conclusion of research. I would also like to extend thanks to Dr Robert Gilbert at EREC, Belle Glade, FL and Dr Neil Glynn at USDA ARS, Canal Point FL for facilitating the collection of samples for tissue culture and Dr. James Colee, IFAS Statistics Department, University of Florida, Gai nes ville, FL for statistical analysis of data presented in this thesis My work in the lab has been greatly enjoyable, thanks to all the lab members, who have been supportive and are now my close friends and colleagues. Dr Walid Fouad and Dr Jae Yoon Kim, the p ost doctoral fellows, who lent their technical expertise and guidance and from whom I have learnt many techniques that I have used towards the completion of this thesis Elizabeth Mayers, Je Hyeong Jung, Sabr i na Stomp Tenisha Phipps and Yuan Xiong whose friendship I will always cheris h. I am grateful to Jeff Seib who trained me to use radiological techniques and whose assistance has been crucial for the upkeep of a safe lab space for radiological work This work could not have been possible without the gracious funding provided by USDA NIFA and Syngen ta Biotechnology Inc Research Triangle Park NC. I would also like to thank the Conrad Fafard Inc. Apopka FL for donation of plant growing media.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 ABSTRACT ................................ ................................ ................................ ................... 10 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 12 Sugarcane and Its Importance ................................ ................................ ................ 12 Origin, Breeding and Cyt ogenetics of Modern Sugarcane ................................ ...... 14 Limitations of Sugarcane Improvement through Breeding ................................ ...... 16 Sugarcane Tissue Culture ................................ ................................ ...................... 17 Types of Cell Culture in Sugarcane ................................ ................................ .. 18 Media Composition and Sugarcane Tissue Culture ................................ ......... 18 Explants in Sugarcane Tissue Culture ................................ ............................. 19 Morphogenic Routes in Sugarcane ................................ ................................ .. 19 Genetic Transformation in Sugarcane ................................ ................................ .... 20 Somaclonal Variation in Sugarcane ................................ ................................ ........ 23 Objectives ................................ ................................ ................................ ............... 27 2 RAPID PRODU CTION OF TRANSGENIC SUGARCANE WITH THE INTRODUCTION OF SIMPLE LOCI FOLLOWING BIOLISTIC TRANSFER OF MINIMAL EXPRESSION CASSETTES AND DIRECT EMBRYOGENESIS .......... 39 Rationale for Biolistic Transformat ion of Sugarcane Immature Leaf Cross section Explants Following Direct Somatic Embryogenesis ................................ 39 Materials and Methods ................................ ................................ ............................ 41 Media C omposition ................................ ................................ ........................... 41 Explant Preparation and Culture Initiation ................................ ........................ 42 Preparation of the Minimal Expression Cassette (MC) ................................ ..... 42 Biolistic Transformation ................................ ................................ .................... 42 Culture, Selection, Regeneration and Rooting of Plants ................................ .. 43 Neomycin phosphotransferase II Enzyme Linked Immunosorbent Assay ......... 44 Southern Blot Analysis ................................ ................................ ..................... 44 Results ................................ ................................ ................................ .................... 45 Tissue Culture and Selection ................................ ................................ ............ 45 Characterization of the Transgenic Plants and their Vegetative Progeny ......... 46 Discussion ................................ ................................ ................................ .............. 46

PAGE 6

6 3 COMPARISON BETWEEN DIRECT AND INDIRECT EMBRYOGENESIS PROTOCOLS, BIOLISTIC GENE TRANSFER AND SELECTION PARAMETERS FOR RAPID GENETIC TRANSFORMATION OF SUGARCANE .. 55 Rationale for Optimization of Sugarcane Biolistic Transformation .......................... 55 Materials and Methods ................................ ................................ ............................ 58 Media Composition and Growth Regulators ................................ ..................... 58 Explant Preparation and Culture Conditions ................................ ..................... 58 Excision and Purification of Minimal Expression Cassette ............................... 59 Biolistic Transformation ................................ ................................ .................... 59 Experimental Design, Randomization an d Factor Combinations ...................... 60 Culture, Selection, Regeneration and Rooting of Plants ................................ .. 60 Neomycin phosphotransferase II Enzyme Linked I mmunosorbent Assay (NPTII ELISA) ................................ ................................ ............................... 61 Neomycin phosphotransferase II Immunostrip Immuno Chromatography Assay ................................ ................................ ................................ ............ 62 Southern Blot Anal ysis ................................ ................................ ..................... 62 Statistical Analysis ................................ ................................ ............................ 63 Results ................................ ................................ ................................ .................... 63 Induction of Somatic Embryogenesis and the Effect of Preculture Period on Transformation Efficiency ................................ ................................ .............. 63 Direct embryogenesis media ................................ ................................ ...... 63 Indirect embryog enesis media ................................ ................................ ... 64 Comparison of Selective Agents ................................ ................................ ...... 64 Effect of Microprojectile Size, Morphogenic Route and Preculture Period on Tra nsformation Efficiency ................................ ................................ .............. 65 Molecular Characterization of Transgenic Plants ................................ ............. 66 Discussion ................................ ................................ ................................ .............. 66 4 CONCLUSIONS ................................ ................................ ................................ ..... 77 Future Research ................................ ................................ ................................ ..... 78 Estimation of DNA Based Variation in Transgenic Plants Developed by Rapid Transformation Procedures ................................ ................................ 78 Introduction of Transgenic Traits of Interest and Estimation of Co transformation Efficiencies ................................ ................................ ............ 78 Application of the Rapid Transformation Procedures to a Range of Genotypes ................................ ................................ ................................ ..... 78 APPENDIX: LABORATORY PROTOCOLS USED FOR BIOLISTIC TRANSFORMATION, TISSUE CULTURE AND CHARACTERIZATION OF T RANSGENIC SUGARCANE PLANTS ................................ ................................ .. 79 Protocols for Molecular Cloning ................................ ................................ .............. 79 Protocol for Biolistic Gene Delivery using PDS 1000/He ................................ ...... 81 Molecular Techniques used in the Confirmation of Putative Transgenic Plants ...... 83 Buffers and Solutions ................................ ................................ .............................. 88

PAGE 7

7 LIST OF REFERENCES ................................ ................................ ............................... 94 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 112

PAGE 8

8 LIST OF TABLES Table page 1 1 Tissue culture research in sugarcane. ................................ ................................ 28 1 2 Reports of genetic transformation in sugarcane ................................ ................. 31 2 1 NPTII protein levels in leaf extracts of vegetative progeny plants from transgenic sugarcane lines ................................ ................................ ................. 51 3 1 Effect of morphogenic path and preculture duration on transformation efficiency. ................................ ................................ ................................ ........... 70 3 2 Eff ect of selective agent on transformation efficiency. ................................ ........ 71

PAGE 9

9 LI ST OF FIGURES Figure page 2 1 Transformation of sugarcane and regeneration through direct somatic embryogenesis ................................ ................................ ................................ ... 52 2 2 Flowchart for the rapid sugarcane transformation protocol ................................ 53 2 3 Southern blot analysis for stable integration of the minimal expression cassette of npt II ................................ ................................ ................................ .. 54 3 1 Transformation of and regeneration of sugarcane ................................ .............. 72 3 2 Timeline of sugarcane transformation following indirect somatic embryogenesis ................................ ................................ ................................ ... 73 3 3 Effect of selective agent on transformation efficiency ................................ ......... 74 3 4 Effect of gold microprojectile size on transformation efficiency and nu mber of hybridization signals in Southern blot ................................ ................................ 75 3 5 Analysis for stable integration and expression of the minimal expression cassette of npt II ................................ ................................ ................................ .. 76

PAGE 10

10 Abstract o f Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science ACCELERATING GENETIC TRANSFORMATION IN SUGARCANE By Yogesh Taparia December 2011 Chai r: Fredy Altpeter Cochair: Maria Gallo Major: Agronomy T wo morphogenic pathways, indirect somatic embryogenesis and direct somatic embryogenesis were compared and optimized for the accelerated production of transgenic sugarcane plants Transgenic plants were ready for transfer to soil within three months for direct somatic embryogenesis and four and a half months for indirect somatic embryogenesis from the initiation of culture s The described protocols allowed reproducible, stable genetic transformation of the commercially important sugarcane cultivar CP 88 1762. Accelerating the production of transgenic sugarcane plants not only saves time and effort but may also minimize somaclonal variation and improve plant performance. Southern blot analysis reveal ed simple transgene integration patterns with an average of 3.64 hybridization products. N eomycin phosphotransferase II E nzyme linked immunosorbent assay confirmed that most of the transgenic plants expressed the transgene stably in vegetative progeny. Usin g a minimal, linear expression cassette (MC) without vector backbone sequences for the biolistic gene transfer and reducing the amount of MC to 10 ng per shot may have contributed to simple transgene integration and stable transgene expression. Therefore,

PAGE 11

11 th e optimized protocol s will likely support stable transgene expression and good agronomic performance of transgenic sugarcane plants.

PAGE 12

12 CHAPTER 1 INTRODUCTION Sugarcane and Its Importance Cultivated sugarcane ( Saccharum spp. hybrids ) shares the andropogonia e tribe of the poaceae family with other agronomically important genera such as Coix Cymbopogon Iseilema Sorghum Themeda and Zea (Heinz 1987) As is common to the members of the adropogoniae tribe, sugarcane follows the C 4 pathway (NADP + malic enzyme v ariant) to fix CO 2 (Vermerris 2008) and accumulates an annual world average of 65 tonnes h a 1 fresh weight (Tew and Cobill 2008) At maturity sugarcane attains a height of 1.5 to 4 m with a stem thickness of 15 to 60 mm (Blume 1985). It is successfully cu ltivated in the tropical and adjacent subtropical regions o f nearly 80 nations spanning 37 N to 31 S latitude with an ambient growt h temperature range of 30 34 C (Blume 1985). In the United States sugarcane is cultivated in the states of Florida, Louisian a, Texas and Hawaii. Each season, sugarcane is plant ed using sugarcane stem sections bearing axillary buds called setts or seedcane which germinate and produce shoots. Disease free seedlings for transplanting are asexually propagated using in vitro t echniques. At the end of first season, sugarcane stems are harvested, and the next sugarcane crop sprouts from stubbles of the harvested cane, also called the first ratoon. Similarly, second ratoon grows from the stubbles of the previous crop. Ratooning of sugarcane beyond the third season is not feasible due to the decline is yield and susceptibility of the crop to diseases and pests. Historically sugarcane has been cultivated for its sweet chewy internodes that is still the most important economic product

PAGE 13

13 derived from it. Table sugar is also produced from sugar beet, but owing to the higher cost of cultivation and a requirement for temperate climate, sugar beet contributes only 30% to the total world sugar productio n, and the larger share (70%) comes from sugarcane (FAO 2011) Brazi l (23.5%) and India (16.8%) contribute most to sugar production all of which is derived from sugarcane (USDA 2011). Florida is the largest producer of sugarcane in the US and accounted fo r 13.7 million tons in 2010 which is equivalent to 49.1% of national cane production (NASS 2011). The United States contributed 4.4% to the 2011 12 total world sugar production, 57.7% of which was derived from sugar beet and the rest from sugarcane (USDA 2 011). Processing sugarcane to crystallized sugar yields 38 other byproducts (Paturau 1986) of which bio ethanol is of great economic importance. Crushed sugarcane stalks is used in boilers for the generation of pressurized ste am which produces electricity, a p (Tew and Cobill 2008) Brazil is the world leader in sugarcane based bioethanol production technology producing 25 billion liters of ethanol during 2009 10 (CONAB 2009) accounting for near ly 50% of the national transportation fuel requirement and 16% of the total energy consumption in Brazil (Dante et al. 2010). The implementation of the Energy Independence and Securities Act of 2007 in the US has increased the renewable fuel standard to 36 billion gallons by 2022 (EPA 2011) of which 21 billion gallons are expected to c ome from cellulosic biomass (Agbogbo and Coward Kelly 2008) Advances in sugarcane breeding, cultural practices and biotechnology will be key for achieving these goals in the future.

PAGE 14

14 Origin Breeding and Cytogenetics of Modern Sugarcane T he earliest cultivated sugarcane, ( S. officinarum L. ) originated in the New Guinea and the northern India Burma China region (Sleper and Poehlman 2006). Present cultivars grown worldwide are c omplex hybrids between previously cultiva ted sugarcane species S. officinarum L., S. barberi Jesw., and S. sinense Roxb. and wild species S. robustum L. and S. spontaneum L (Sleper and Poehlman 2006 ) The earliest attempts at breeding of sugarcane were in 1888 by Dutch breeders in response to widespread susceptibility to sereh disease in Java (Stevenson 1965). Major contribution to sugarcane improvement came from the crosses made between S. officinarum and S. spontaneum that led to the development of mo dern cultivated sugarcane, Saccharum spp hybrids S. officinarum clones have thick, juicy stems with high sucrose and low fiber con tent but are prone to diseases S. spontaneum has a tough rind, thin stems, are low in sucrose levels but high fiber conten t, with hollow internodes, a weedy growing habit and are resistant to major sugarcane diseases. C ombining of genetic traits such as high sucrose content, low fiber disease resistance and drought tolerance was accomplished by interspecific hybridization us ing S. officinarum as the female parent and S. spontaneum as the pollen donor followed by recurrent backcrossing of the resultant F 1 clone to S. officinarum a (Tew and Cobill 2008) I mprovement of modern s ugarcane cultivars through breeding is accomplished by crossing diverse, sexually compatible fertile parents followed by selection of desirable recombinant progen ies Extensive field testing and multilocation tr ia ls are conducted to ensure clonal stability yield stability, disease and pest resistance and environmental

PAGE 15

15 adaptability. A clone may be released for general cultivation 12 to 15 years from the time of initial hybridization (James 2004) The earliest S. officinarum clones used as parents in crosses had 2n= 80 and S. spontaneum clones had 2n= 40 to 128 chromosomes A s a result the modern cultivars have a variable chromosome number varying from 2n= 100 to 130 and are frequently aneuploid (Grivet and Arruda 2002) The use of genomic in situ hybridizat ion and fluorescent in situ hybridization has revealed that the elite cultivars contain 10 to 23% intact chromosome s derived from S. spontaneum and 8 to 13% recombinant chromosomes derived from S. officinarum and S. sponta neum (Piperid i s et al. 2010). A p eculiar and well documented phenomenon in sugarcane cytogenetics is the 2n+n 1 F 2 and BC 2 generations when S. officinarum is crossed as female to other Saccharum species (except S. robustum ) which results from unreduced egg during meiosis. Furthermore as noted by Bhat and Gill (1985), the unreduced egg s may be the result of either endoreduplication or second division restitution, which is characteristic of a clone and would affect the degree of heterozygosity in the following gener ation. Most of the elite clones and generations succeeding BC 2 n+n chromosome inheritance (Burner 1997). B ie l i g et al. (2003) have reported the formation of 2n male gametes in cultivated sugarcane; such cultivars may be classified according to the frequency at which unreduced male gametes are formed. Due to the presence of aneuploidy, irregular chromosome pairing behavior (Jannoo et al. 2004) mosaicism (Tlaskal et al. 1970) and meiotic anomalies like anaphase bridges, laggards, micronuclei and pseudo bivalents are observed and further add to genomic instability i n succeeding generations (B urner and Legendre 1994).

PAGE 16

16 Limitations of Sugarcane Improvement through Breeding Sugarcane improvement requires dedicated facilities and breeding programs for the production of a large number of crosses followed by selection of desirable plants that are tested in multilocation trials. It has been estimated that nearly 250,000 seedlings are screened in the initial generation f or the commercial release of a single cultivar ( Cheavegatti Gianotto et al. (2011). Most of the sugarcane breeding programs utilize some modification of the recurrent selection scheme. Genetic gains made through selection for a given trait is determined by genetic variability in the base popu lation from which selections are being made, heritability of the trait and its correlation with other traits being selected for ( Jackson 2005 ). Since the majority of elite clones being currently used for sugarcane improvement have common ancestry, there is concern that improvement of traits for sugarcane productivity may reach a plateau ( Lima et al. 2002 ) Yield traits, agronomic traits, and disease and pest resistance are governed by quantitative inheritance. The gain in sugarcane productivity through bree ding in the recent years has been between 1 1.5% ( Waclawovsky et al. 2010). Breeding for these traits is further complicated due to the polyploid nature of S accharum spp hybrid clones. Therefore, cultivar improvement requires extensive efforts in backcros sing and outcrossing followed by selection. Genetic hybridization of sugarcane is often hindered due to the sterility in clones or due to asynchrony in sugarcane flowering. Synchronization of flowering may be achieved by dark period interruption at the tim e of flowering initiation of early season canes or by the photoperiod reduction of clones flowering later in the season (Midmore 1980) In addition to photoperiod requirement for flowering, temperature plays an

PAGE 17

17 important role too. Flowering induction requi res warm nights (over 18.3 C), which can be maintained by planting clones in pots that can be moved into t emperature regulated growth houses at night (James 1969). Sugarcane breeding ca n only improve traits for which genetic variation exists. Additional tr aits like resistance to herbicides insects production of recombinant proteins and biopolymers can only be introduced via genetic transformation. Although, transgenic sugarcane lines have not yet been released for commercial cultivation several field tri als are underway in Brazil, Australia and USA ( Cheavegatti Gianotto et al. 2011, Hotta et al. 2010) containing genes for altering source sink relationships, which might contribute to significant improvement in sugarcane cultivation in the future (Dal Bian co et al. 2011). Sugarcane Tissue Culture Initially tissue culture was included in the sugarcane breeding programs worldwide with the hope that it would contribute to the rapid establishment of disease free clones, improvement through colchicine induced ch romosome doubling (He inz et al. 1970; Liu et al. 1977 ) and in vitro maintenance of germplasm (Maretzki 1987). Over the years, research on sugarcane tissue culture has progressed and cleared several hurdles to make it a v aluable tool for the improvement of sugarcane by providing a rapid means for clonal multiplication (Grisham and Boug 1989; Lorenzo et al. 2001; Mordocco et al. 2009) the creation of variation (Jalaja et al. 1 987; Larkin and Scowcroft 1981, 1983; Leal et al. 1996) development of artificial propagules (Biradar 2008; Nieves et al. 2003), cryopreservation (Gnanapragasam and Vasil 1990; Gonzales Arnao et al. 1999 ; Paulet et al. 1993; Taylor and Dukic 1993) and genetic transformation (Altpeter and Oraby 2010)

PAGE 18

18 Types of Cell Culture in Sugarcane D e d ifferentiated somatic tissues of sugarcane have been maintained in vitro as cell suspensions, protoplast culture s and calli on solid media. The source of cell suspensions and protoplast cultures is sugarcane callus. Cell suspension cultures are obtained when young morphogenic callus is cultured in liquid nutrient medium with rotatory motion to facilitate aeration and release of single cells into culture medium. Cell suspensions may then be used for the production of sugarcane protoplasts by enzymatic trea tment to facilitate removal of cell walls or alternately, calli may be treated directly with enzymes for the release of protoplasts. Extensive investigations in biochemistry (Gold ner et al. 1991; Lesley et al. 1980; Maretzki et al. 1969) cell culture (Che n et al. 1988; Nickell and Maretzki 1969, 1970) cytogenetics (Krishnamurthi 1976; Tabaeizadeh et al. 1986) plant pathology (Jalaja et al. 1987; Oropeza et al. 1995; Singh et al. 2008) and physiology (Thom et al. 1981; Wyse and Komor 1984) have been under take n using sugarcane cell cultures Media Composition and Sugarcane Tissue Culture Tissue culture media support s cell growth by providing macro nutrients, micro nutrients source of energy, and vitamins Majority of reports in sugarcane tissue culture have used Murashige and Skoog (1962) medium or its modifications for callus culture (Table 1 maintenance and proliferation of long term cultures which have been initiated on Murashige and Skoog (1 962) medium ( Brisibe et al. 1994; Fitch and Moore 1993). Organic additives like coconut water (Ahloowalia and Maretzki 1983; Ho and Vasil 1983; Nadar and Heinz 1977), myo inositol (Fitch and Moore 1990, 1993) and casein

PAGE 19

19 hydrolysate (Brisibe et al. 1994; G arcia et al. 2007) have been often used in cultures to enhance the c a llogenic response (Table 1 1 ) Explants in Sugarcane Tissue Culture In contrast to self pollinating or apomictic monocots, sugarcane is cross pollinating and requires vegetative tissues f or initiation of genetically uniform, regenerable tissue cultures (Heinz 1987) T he exp l ants used in sugarcane tissue culture are derived from totipotent somatic tissues Explants like immature inflorescences (Liu 1993; de los Blanco et al. 1997; Gallo Mea gher et al. 2000 ) immature leaf cross sections (Ahloowalia and Maretzki 1983; Brisibe et al. 1994; Chen et al. 1988; Fitch and Moore 1990; Ho and Vasil 1983; Hoy et al. 2003) apical meristems (Ahloowalia and Maretzki 1983; Hoy et al. 2003) and axillary b uds (Garcia et al. 2007) have been successfully used for inducing embryogen esis or organogenesis Morphogenic Routes in Sugarcane Two princip al routes of morphogenesis have been observed in sugarcane : organogenesis and somatic embryogenesis, both of which are influenced by auxin cytokinin concentration and light intensity (Lakshmanan et al. 2006; Garcia et al. 2007). Organogenesis, as the name suggests involves the development of shoot or root primordia without the development of somatic embryos and is b elieved to have a multicellular origin. Shoot organogenesis in sugarcane is induced when explants are cultured under illumination and in the presence of high concentrations of auxins, mainly 1 napthaleneacetic acid (Garcia et al. 2007; Lakshmanan et al. 20 06). It is routinely used in the clonal propagation of sugarcane for mass production of disease free seedlings from apical meristems ( Burner and Grisham 1995 ; Hendre et al. 1983; Lee 1987) or axillary buds (Sauvaire and Galzy 1978)

PAGE 20

20 Somatic embryogenesis comprises the development of structures resembling zygotic embryos arising from somatic tissues, originating from a single cell and capable of regenerating into a complete plant. Use of 2,4 dichlorophenoxyacetic acid at varying concentrations has been wid ely employed for the initiation of somatic embryogenesis in sugarcane (Ahloowalia and Maretzki 1983; Gallo Meagher et al. 2000; Ho and Vasil 1983 ; Snymnan et al. 200 1 ). Extensive research on sugarcane embryogenesis has revealed the presence of alternate re generation pathways: direct and indirect embryogenesis Direct embryogenesis is induced by the use of low concentrations (0.2 0.3 mg L 1 ) of 2,4 dichlorophenoxyacetic acid ( Ho and Vasil 1983; Snyman et al. 2001; Van Der Vyver 2010) which results in the dev elopment of somatic embryos without a callus phase. Indirect somatic embryogenesis results from the use of 2,4 dichlorophenoxyacetic acid (2.5 3.0 mg L 1 ) which leads to development of callus followed by the formation of somatic embryos on the surface of t he callus or from the growth of somatic embryo itself Apart from the presence or absence of a callus phase prior to the development of somatic embryos, these routes differ greatly in the duration in which shoots are regenerated. Development of direct som atic embryos occurs earlier than indirect somatic embryos, which allows earlier regeneration from direct somatic embryos, reduces tissue culture duration and facilitates the reduction of somaclonal effects in the regenerated plants. Genetic Transformation in Sugarcane Another major application of sugarcane in vitro culture is the development of transgenic plants. The advantage of transgenic technology is the ability to rapidly

PAGE 21

21 improve sugarcane by the introduction of a foreign gene The probability of trans gene escape for sugarcane through pollen or seeds is minimal due to the short viability of pollen and absence of flowering or seed set in commercial setting s (Bonnett et al. 2008; Cheavegatti Gianotto et al. 2011). Transgenic sugarcane plants have been dev eloped via biolistic transformation (Bower and Birch 1992) intact cell electroporation (Arencibia et al. 1992 ) and Agrobacterium mediated transformation (Arencibia et al. 1998 ) (Table 1 2 ) B iolistic transformation is largely genotype independent, allows the simultaneous introduction of several unlinked minimal expression cassettes and is the most frequently used method for the introduction of DNA in sugarcane (Altpeter and Oraby 2010 ; Jakob et al. 2009 ). Optimization of genetic transformation techniques h as been largely possible due to the availability of a large repertoire of selectable markers and reporter genes. Selectable marker genes encode enzymes that are capable of metabolizing the toxic selective agent in culture medium and are used in selecting t issues t hat have been stably transformed. The most frequently used selectable marker gene for sugarcane transformation is the antibiotic resistance gene neomycin phosphotransferase II ( npt II) with geneticin sulfate The other selectable markers that have be en used in sugarcane include phosphinothricin resistance gene bar hygromycinB resistance gene hpt II, and phosphomannose isomerase gene man A. Reporter genes encode products that can be visualized when expressed in the recipient cell. The most routinely use d reporter gene in sugarcane transformation is the uidA gene encoding glucuronidase that catalyze s the formation of glucuronic acid which can be visualized after GUS stain ing It has been used for the optimization of

PAGE 22

22 transformation parameters and in the relative comparison of promoter strength s Other reporter genes inclu de the green fluorescent protein encoding gene gfp and the luciferase gene luc both of which produce fluorescent signal when excited with light. Several promoters for driving transgene expression in sugarcane are available, most routinely used being, Zea mays Ubiquitin promoter (Ubi 1 ) rice actin promoter ( Act I) Emu 35S and Cauliflower Mosaic Virus constitutive promoter ( 35SCaMV) Several traits of agronomic and industrial importance have been introduced in to sugarcane such as herbicide resistance (Enriq uez Obregon et al. 1998; Falco et al. 2000; Gallo Meagher and Irvine 1996; Leibbrandt and Snyman 2003; Manikasavagam et al. 2004), insect resistance ( Bt gene: Arencibia et al. 1997; Weng et al. 2006; Galanthus nivialis a gglutenin: Setamou et al. 2002; Zhan gsun et al. 2007 ), disease resistance (Gilbert et al. 2005; Ingelbrecht et al. 1999; Joyce et al. 1998 ) and resistance to drought (Molinari et al. 2007; Zhang et al. 2006). To further improve sugarcane as a biofuel crop modification of cell wall composit ion of lignocellulosic biomass is an important area for biotechnolog ical research (Ranalli and Candilo 2007). Additionally, transgenic sugarcane with modification of plant architecture, and genes which potentially improve water or nitrogen use efficiency are being tested under field conditions ( OGTR 2007). P roduction of cell wall degrading enzymes (Harrison et al. 2011), phytoceuticals (Wang et al. 2005) modification of source sink relationship (Hamerli and Birch 2010; Wu and Birch 2007) and production of biopolymers (McQualter et al. 2005; Petrasovits et al. 2007) have been reported and may add value to sugarcane (Table 1 2 )

PAGE 23

23 S ugarcane genome sequencing will likely be completed soon, providing additional information for characterization of genes contribu ting to developmental or physiological responses (Molinari et al. 2007). Additional i nformation about genome organization (Manners and Casu 2011), regulatory elements (Mann et al. 2011 ) and tissue specific promoters (Govender 2008) w ill advance the develop ment of a more targeted approach for the genetic engineering of sugarcane. Somaclonal Variation in S ugarcane omaclonal variation 1981 ). Kaeppler et al. (2000) defined somaclonal variation as notypic variation Heinz and Mee (1969, 1971) were among the first to report deviation in both, morphology and somatic chromosome number in sugarcane plants regenerated from callus or cell suspensio n s when compared to the parental clone. Since then there have been several reports about somaclonal variation in sugarcane describing mostly the development of deleterious phenotypes and in rare cases the use of in vitro techniques for the creation of va riation for traits such as disease resistance (Leal et al. 1996; Oropeza et al. 1995; Singh et al. 2008) Investigation s on the cause of somaclonal variation have indicated that, chromosome deletions or rearrangements, polyploidization, changes in organell ar DNA, activation of transposons DNA methylation and in rare cases point mutations are involved Development of such muta tions in plants regenerated from tissue culture is known to be influenced by several factors which include explant source genotype, culture medium (type and concentration of growth regulators) period in tissue culture and the transformation procedure

PAGE 24

24 Apical meristems are considered the best explants for rapid production of true to type sugarcane plantlets (Hoy et al. 2003; Lal et a l. 2008; Lee 1987; Lourens and Martin 1987). E mbryogenesis followi ng a callus phase has been found to reduce the agronomic performance of in vitro propagated plants in contrast to direct organogenesis The s talk diameter of plants regenerated from immature leaf derived callus was reduced in contrast to plants developed from direct regenerat ion of apical meristems, or bud explants (Hoy et al. 2003). Although, r educed stalk diameter and increase in tillering frequency of first generation plants developed fro m callus has been reported some of these aber r ant phenotypes revert to wild type phenotype in the subsequent planting generations ( Bailey and Bechet 19 89 ; Hoy et al. 2003; Lourens and Martin 1987 ) Sugarcane genotypes have been known to influence and c on tribut e to the development of somaclonal variation For example, i n field trials Hoy et al. (2003) observed decline in stem diameter and weight of one of the three cultivars derived from callus cultures. In comparison to clonal progenies derived from callu s cultures, H 50 7209 which was a chromosomal mosaic produced greater variation in morphological and isozyme studies (He i nz and Mee 1971). Lorens and Martin (1987) concluded that of two cultivars CP 72 356 was more stable in in vitro culture than CP 65 3 57. Tissue culture medium consists of mineral or organic nutrients, energy sources, growth regulators and other supplements that aid the proliferation and growth of cells. However components of medium such as growth regulators and antibiotics may induc e mutagenesis. Comparison of Murashige and Skoog (1962) media vs. White (1943) media by Barba and Nickell (1969) revealed the irreversible loss of regenerability in

PAGE 25

25 sugarcane cultures when callus was either initiated and maintained for 3 to 4 wks or transf erred to White media from the Murashige and Skoog media. Use of auxins at elevated concentrations in the tissue culture medium has been reported to produce polyploids in Haplopappus gracilis callus cultures (Singh 1976). The type and concentration of auxin s used in tissue culture can influence the morphogenic route in sugarcane. Plants generated by indirect somatic embryogenesis revealed greater variability in Ac like transposon insertion profiles when compared with plants from direct somatic embryogenesis (Suprasanna et al. 2010). Random a mplified p olymorphic DNA (RAPD) based polymorphism analysis of direct somatic embryogenesis derived sugarcane plants revealed no variation (Suprasanna et al. 2007). A transient dose dependent hypermethylation in tobacco cu ltures was observed when kanamycin, hygromycin or cefotaxime was included in cell cultures (Schmitt et al. 1997) Increased tissue culture duration is believed to favor the development of somaclonal variation. Fitch a nd Moore (1993 ) observed the reduction in the number of regenerating plants in sugarcane callus culture and development of pale shoots with increase d time in tissue culture A reduction in tissue culture duration may lead to the reduction of somaclonal variation in regenerat ing sugarcane (Irvi ne and Benda 1987 ; Burner and Grisham 1995) Several reports indicate that the development of somaclonal variation in transgenic plants may be attributed to the transformation process Vickers et al. (2005) compared the agronomic performance of transgenic sugarcane plants developed by the biolistic process with tissue cultured non transgenic and axillary bud propagated plants and reported the lowest yields from transgenic plants. Carmona et al. (2005) studied the

PAGE 26

26 development of genetic variation in transgen ic plants developed by Agrobacterium mediated transformation using Amplified fragment length polymorphism (AFLP) analysis and detected limited variation which likely is a consequence of the tissue culture and transformation procedure employed T he less th an optimal agronomic performance of transgenic sugarcane yellow leaf virus (ScYLV) resistant sugarcane plants was associated with greater genetic distance between the donor cultivar and transgenic lines analyzed by s imple sequence repeat (SSR ) markers (Gil bert et al. 2009) Arencibia et al. (1999) detected minor genetic changes in transgenic insect resistant plants generated by electroporation which they believed was the basis for variation in morpholog y physiolog y and disease susceptibility Recently it has been shown that the use of intact plasmid DNA, containing bacterial sequences, into recipient cells facilitates the rearrangement of transgenic loci, affects transgene expression stability and initiates transgene silencing. Stable expression of transg ene in the target genome may be facilitated by the use of minimal expression cassettes (MC). MCs are obtained when bacterial backbone sequences from the plasmid DNA are removed by the restriction enzymes that cut at the borders of the eukaryotic transgene sequence. The use of MCs was first reported in rice by Fu et al. (2000). Use of minimal cassettes in biolistic transformation has been reported to facilitate stable gene expression in other plant species as well. Lower DNA quantity for biolistic gene trans fer facilitates the development of simpler transgene integration pattern (Maize: Lowe et al. 2009; Wheat: Yao et al. 2006) which may also contributes to the stability of transgene expression (Bentgrass: Jayaraj et al. 2008; Rice: Thi Loc et al. 2002). Rece ntly, Kim et al. (2011) introduced npt II MCs

PAGE 27

27 at lower DNA quantity in sugarcane and observed simpler transgene insertion pattern of the regenerated transgenic plants, but lower transgene expression when 12.5 ng DNA per shot was used in biolistic transforma tion experiments. Objectives Saccharum spp hybrids are routine ly transformed by the biolistic technique (Table 1 2 ) However the long tissue culture duration of the contemporary protocols induces somaclonal variation in regenerated transgenic plants Use of minimal expression cassettes at lower quantities in sugarcane may help in developing simpler transgene integration patterns and support stable transgene expression. The specific objectives of this research were : To develop accelerated sugarcane genetic transformation protocols following biolistic transfer of minimal expression cassettes and direct or indirect somatic embryogenesis. To adjust biolistic transformation parameters for optimizing transformation efficiency. To compare alternat ive selective age nts for the selectable marker nptII and to evaluate their effect on selection and transformation efficiency.

PAGE 28

28 Table 1 1 Tissue culture research in sugarcane. References Explant Type/ Target Tissue Basal Media Additional components Aim of Investigation Re sults Nadar and Heinz (1977) Immature leaf whorl explant MS Coconut water 10% (v/v) Influence of phytohormones on shoot induction and rooting of shoots from callus. 2,4 D (3 mg per L 1 ) induced callus regenerated shoots when cultured on medium containing NAA (5 mg per L 1 ). Inclusion of 2,4 D (0.2 mg per L 1 ) hindered shoot elongation. Rooting could be achieved by culture in the presence of NAA or trimming of leafs. Larkin (1981 ) Immature leaf whorl explant Various Various Tissue culture for initiation, maintenance and regeneration from long term cultures. Callus induction occurred on CS medium with 2,4 D (3 mg per L 1 ) and kinetin (0.25 mg per L 1 ). Regeneration occurred on MS medium with IAA (0.5 mg per L 1 ) and BAP (1 mg L 1 ). Rooting occurred on MS medium with NAA (5 mg per L 1 ) and sucrose (7% w/v). Ahloowalia and Maretzki (1983) Immature leaf whorl explant and apical meristems MS Coconut water 10% (v/v) Effect of growth regulators on callus induction and regeneration from callus and cell suspens ions. Nodular callus developed 2 weeks after culture initiation on 2,4 D (3 mg per L 1 ). Somatic embryos appeared after 10 wk. Shoot regeneration occurred 2 4 wk after transfer of callus or cell suspensions to hormone free media. Ho and Vasil (1983) Imm ature leaf whorl explant MS Coconut water 5% (v/v) Ontogeny of somatic embryogenesis and factors affecting callus formation. Higher concentration of 2,4 D (3 mg per L 1 ) is suitable for the induction of embryogenic callus. Transfer of callus to lower 2,4 D concentrations (0.25 to 0.5 mg L 1 ) led to rapid proliferation of embryoids. Callus formation occurred from the mesophyll cells in abaxial side and vascular parenchyma. Chen et al. (1988) Immature leaf whorl explant M odified MS None Culture conditions for maintenance or regenerable callus cultures Alternate subcultures in dark on high low 2,4 D concentration with selection of white compact callus allowed the maintenance of regenerability of callus culture over 30 months after callus induction.

PAGE 29

29 Table 1 1. Continued. References Explant Type/ Target Tissue Basal Media Additional components Aim of Investigation Results Fitch and Moore (1990) Immature leaf whorl explant MS Myo inositol (100 mg L 1 ) and Glycine (10 mg L 1 ) Comparison of 2,4 D and Piclora m for selection of green calli that retain regenerability for long culture durations. Callus induced on 2,4 D (3 mg L 1 ) when transferred to picloram (0.5 mg L 1 ) and selected for green calli, retained totipotency for over 19 months. Fitch and Moore (1 993) Immature leaf whorl explant MS and Chu's N6 Myo inositol (100 mg L 1 ) and Glycine (10 mg L 1 ) Maintenance of regenerability in callus cultures. More callus was formed on MS medium containing 2,4 D (3 mg L 1 ) however calli retained regenerability long er when cultured subsequently on N6 medium. Inclusion of kinetin or coconut water impaired embryogenic response. Brisibe et al. (1994) Immature leaf whorl explant Various Casein hydrolysate (1 g L 1 ) Effect of growth regulators, media type and strength, and sugar source on callus induction and, maintenance of long term regenerability. Best callus proliferation occurred on N6 medium supplemented with dicamba (6.6 mg L 1 ). Long term embryogenic competence was maintained when calli were alternately culture d at weekly intervals with ABA (2.64 mg L 1 ) or sorbitol (5%) and dicamba. Embryogenic response improved with the inclusion of maltose or corn syrup (6%). Gallo Meagher et al. (2000) Immature inflorescence derived callus M odified MS None Effect of cytoki nin combination on regeneration from callus. Sugarcane callus induced on 2,4 D (3 mg L 1 ) produc es most shoots with thidiazuron (0.22 mg L 1 ). Chengalrayan and Gallo Meagher (2001) Immature leaf whorl explant derived callus M odified MS None Effect of g rowth regulators on regeneration from callus. Thidiazuron (0.55 mg L 1 ) produced greatest number of shoots, with lowest frequency of elongated shoots. Desai et al. (2004) Immature inflorescence MS Glutamine (0.1 g L 1 ) Induction of direct somatic embryog enesis and regeneration. Medium containing kinetin (2.5 mg L 1 ) and 1 napthaleneacetic acid (0.5 mg L 1 ) produced somatic embryos within 4 weeks of culture, which germin ated on hormone free medium 1 w k after transfer.

PAGE 30

30 Table 1 1. Continued. References E xplant Type/ Target Tissue Basal Media Additional components Aim of Investigation Results Chengalrayan et al. (2005) Sugarcane seeds M odified MS None Effect of growth regulators on seed germination, callus formation and regeneration from callus. Thidiazur on (10 mg L 1 ) significantly improved seed germination. Picloram (1 mg L 1 ) produced greatest amount of callus as compared to 2,4 D (1, 3, 5 or 10 mg L 1 ). Highest number of shoot regeneration from callus developed on media containing picloram (1 or 3 mg L 1 ) or 2,4 D (3 mg L 1 ). Franklin et al. (2006) Immature leaf midrib explant MS None Effect of auxin pretreatment on regeneration frequency from midrib sections. Transfer of midrib explants to medium containing 6 BAP (1 mg L 1 ) and NAA (0.1 mg L 1 ) 8 d after culture with 2,4 D (3 mg L 1 ) resulted in highest regeneration frequency from direct somatic embryos. Lakshmanan et al. (2006) Immature leaf whorl explant MS None Factors affecting somatic embryogenesis and regeneration frequency. Induction of som atic embryos is enhanced when 1 2 mm thick explant sections, obtained from region closest to stem node, are cultured with distal face in contact with medium. Culture of explants on medium containing NAA (1.86 mg L 1 ) and 6 BAP (1 mg L 1 ) induced direct reg eneration. Garcia et al. (2007) Shoot apices of in vitro propagated plants M odified MS Various Influence of auxins and light on induction of morphogenic pathway Incubation of cultures with high concentrations of 2,4 D or Picloram under light produced or ganogenic callus and did not produce later stages of proembryo development in contrast to cultures incubated in dark. Cultures with NAA under low light produced direct shoot organogenesis. Desiccation of calli resulted in improvement of regeneration effici ency. 2,4 D= 2,4 dichlorophenoxyacetic acid; ABA= Abscisic acid; BAP= 6 benzyladenine; IAA= Indole 3 acetic acid; Kinetin= 6 furfurylaminopurine; MS= Murashige and Skoog (1962) medium; NAA= 1 napthaleneacetic acid; Picloram= 4 amino 3,5,6 trichloropicolin ic acid ; Thidiazuron= 1 phenyl 3 (1,2,3 thidiazol 5 yl) urea.

PAGE 31

31 Table 1 2 Reports o f genetic transformation in sugarcane References Target Tissue Selectable Marker/ Selection Gene of interest Transformation efficiency Results Polyethylene glycol induced d irect DNA uptake Chen et al. (1987) Protoplasts a ph (3') II on linearized pABD1 plasmid / Kanamyc i n ( 80 mg L 1 ) None 8 in 10 7 protoplasts 60% of protoplasts survived PEG procedure. No plants were regenerated Electroporation Rathus and Birch (1992) Prot oplasts npt II on supercoiled plasmid / Kanamycin ( 100 mg L 1 ) None 0.01 to 1% (micro calli per treated protoplasts) 5 to 7 pulses of 385 V/cm EFS led to highest transient expression. One out of all lines displayed de tecta ble GUS expression. No plants were regenerated. Choudhury and Vasil (1992) Protoplasts bar glucuronidase (GUS) reporter gene on pBARGUS plasmid / basta (30 mg L 1 ) None One colony per plate Selection was started 48 h after electroporation. Rathus et al. (1993) Protoplasts None None Not reported Nopaline synthase and 35S CaMV promoters are of equal strength. 35S CaMV expression strength can be enhanced by the inclusion of OCS enhancer upstream of it. Double stacking of 35S CaMV promoter led to approximately 2 fold increase in tra nsient expression. Arencibia et al (1995) Cell suspension glucuronidase (GUS) reporter gene / Visual selection None 3.3 transgenic plants per c m 2 Absence of selection led to the development of chimeric plants. 800 V/cm EFS and 800 F capacitor produced maximum number of plants.

PAGE 32

32 Table 1 2. Continued. Refe rences Target Tissue Selectable Marker/ Selection Gene of interest Transformation efficiency Results Arencibia et al. (1997) Cell suspension g lucuronidase (GUS) reporter gene / Visual selection cryIA(B) 15.2% of all electroporated clusters. CryIA(B) expression was low but effective in reducing sugarcane stem borer damage. Russow et al. (2010) Cell suspensions Not reported A ntisense neutral invertase Not reported Reduction of neutral invertase activity in transgenic plants may have led to the increas e in sucrose synthase activity and the reduction of sucrose diversion to respiratory processes in the culm. Biolistic transformation Franks and Birch (1991) Cell suspension and embryogenic callus glucuronidase (GUS) reporter gene None Not reported Transient expression of GUS was higher with the EmuGN promoter as compared to 35S promoter. Size of GUS expressing locus increased with time. Choudhury and Vasil (1992) Cell suspension bar glu curonidase (GUS) reporter gene on pBARGUS plasmid / basta (1 mg L 1 ) None 1 microcallus in four bombarded filters Highest transient expression was recorded with cell suspensions 3 d after subcluture Bower and Birch (1992) Embryogenic callus npt II and glucuronidase (GUS) reporter gene on pEmuGN and pEmuKN plasmids / Geneticin (25 mg L 1 ) None 1 to 3 transgenic plants per treated plate Geneticin is more suitable than kanamycin for selection of transformed calli. Biolistic gene delivery to calli twic e greatly improves transient expression of GUS. Transgenic plants were regenerated 20 to 30 wk after start of cultures from calli bombarded twice.

PAGE 33

33 Table 1 2. Continued. References Target Tissue Selectable Marker / Selection Gene of interest Transform ation efficiency Results Gallo Meagher and Irvine (1993) Immature leaf whorl segments None None Not reported The order of promoter strength was maize Ubi 1> Emu > rice Act l > 35SCaMV. Younger leaves cultured for 3 6 d, and bombarded on proximal surface pr oduced highest number of GUS foci. Gambley et al. (1994) Meristematic tissues of in vitro propagated sugarcane plants luc / visible selection None Not reported Inclusion of BAP (0.5 mg L 1 ) in the induction and recovery medium increased the transformati on efficiency by recovery of more transgenic shoots. Bower et al. (1996) Embryogenic callus Maize anthocyanin regulatory elements (ANT) R and Cl None Not reported Transient expression of ANT could be seen as early as 8 h which intensified till 48 h. No t ransgenic plants greater than 3 cm survived. uidA / GUS sta i ning and visible selection None Not reported Transient expression improved with osmotic treatment of calli on media containing 0.2 M mannitol and 0.2 M sorbitol, 4 h before and 4 h after bioli stic gene delivery. luc / visible selection None 1.4 transgenic plants per shot Expression analysis done 8 d after gene delivery. Fluorescence intensity was measured using a CCD camera. aphA / Geneticin (45 mg L 1 ) luc 19.8 transgenic plants per s hot Selection started 4 d after biolistic gene delivery. No escapes observed. Co transformation efficiency of > 90 % and co expression efficiencies of 67 79%. bar / Phosphinothricin (10 80 mg L 1 ) None Not reported Two putative transgenic callus lines developed that failed to regenerate plants.

PAGE 34

34 Table 1 2. Continued. References Target Tissue Selectable Marker/ Selection Gene of interest Transformation efficiency Results Gallo Meagher and Irvine (1996) Embryogenic callus bar / Bialaphos (1 mg L 1 ) b ar 2.59 to 2.61 transgenic plants per shot Rooting was induced on medium containing 3 mg L 1 bialaphos. 47% of transgenic plants developed normal roots. 41% of regenerated plants were e scapes Clonally propagated transgenic plants displayed stable bar expr ession. Ingelbrecht et al. (1999) Embryogenic callus bar / Bialaphos (1 mg L 1 ) SrMV SCH CP Not reported Untranslatable coat protein RNA from the transgene leads to post transcriptional gene silencing, resulting in resistance to sugarcane mosaic virus in transgenic plants npt II / Geneticin (15 mg L 1 ) SrMV SCH CP Not reported Falco et al. (2000) Embryogenic callus neo on pHA9 plasmid and bar on pAHC20 plasmid / Geneticin (30 mg L 1 ) bar 1 plant per shot More than 90% of plants integrated both th e genes. Only 3% of the plants were designated escapes. Expression of neo gene was confirmed by kanamycin application to leafs. Screening for bar integration was done by the spraying of ammonium gluphosinate (60 mg per m 2 ) Pompermayer et al. (2003 ) Embry ogenic callus npt II / Geneticin (30 mg L 1 ) cDNA of Soy bean Kunitz trypsin inhibitor Not reported Feeding neonate larvae of Diatraea saccharalis with transgenic tissue reduced their growth, but was not sufficient for preventing 'dead heart' symptoms in g reen house trials. npt II / Geneticin (30 mg L 1 ) cDNA of Soy bean Bowman Birk inhibitor Not reported McQualter et al. (2004) Embryogenic callus npt II / Geneticin (60 mg L 1 ) Untranslatable FDV segment 9 ORF 1 Not reported One out of 64 transgenic pl ants developed displayed resistance to Fiji Disease Virus.

PAGE 35

35 Table 1 2. Continued. References Target Tissue Selectable Marker/ Selection Gene of interest Transformation efficiency Results Wang et al. (2005) Embryogenic callus npt II / Geneticin (100 mg L 1 ) hGM CSF 0.68 p l ants per shot hGM CSF protein accumulation required endoplasmic reticulum retention tag. Transgenic hGM CSF from sugarcane displayed similar activities as from native source. npt II / Geneticin (70 mg L 1 ) hGM CSF 8.0 plants per sh ot Snyman et al. (2006) Immature leaf whorl cross sections npt II / Geneticin (45 mg L 1 ) CP4 0.05 plants per shot Optimum time for biolistic gene delivery to direct somatic embryogenesis explants is 7 d after culture initiation. Immature leaf whorl cross sections with inflorescence npt II / Geneticin (45 mg L 1 ) CP4 1.2 plants per shot Jain et al. (2007) Embryogenic callus manA / M annose (3 g L 1 ) Untranslatable SRMV strain E coat protein Not reported Mannose at 1.5 g L 1 allows permissive growth ; Selection at 3 g L 1 reduces escape rate and improves transformation efficiency. Molinari et al. (2007) Embryogenic callus bar / Glufosinate ammonium (5 mg L 1 ) Heterologous P5CS gene Not reported By day 9 of drought, transgenic plants displayed 2.5 ti mes proline content than wild type. By the end of water deficit period transgenic plants had 65% higher photochemical efficiency. Petrasovits et al. (2007) Embryogenic callus npt II / Geneticin (45 mg L 1 ) Ralstonia eutropha PHAA, PHAB and PHAC Not repor ted Polyhydroxybutyrate accumulated to 1.88% of dry wt. in plastidic lines without obvious deleterious effects to the plant.

PAGE 36

36 Table 1 2. Continued. References Target Tissue Selectable Marker/ Selection Gene of interest Transformation efficiency Resu lts Chong et al. (2007) Embryogenic callus npt II / Paromomycin (150 mg L 1 ) Malus domestica mds6pdh and Zymomonas mobilis zmglk Not reported Transgenic lines producing sorbitol accumulated 30 40% less above ground biomass and displayed 10 30% reduced heig ht as compared to WT plants. Wu and Birch (2007) Embryogenic callus npt II / Geneti cin ( 45 mg L 1 ) Pantoea dispersa sucrose isomerase gene Not reported SI gene with vacuolar targeting led u pto double total sugar content accumulation in harvested juice w ithout affecting the sored sucrose content. Groenwald and Botha (2008) Embryogenic callus npt II / Geneticin A ntisense or untranslatable forms of PFP Not reported Sucrose concentration in immature tissues of transgenic plants was increased than WT plants. Christy et al. (2009) Embryogenic callus hpt II / Hygromycin (30 mg L 1 ) Aprotinin 10 plants per 100 calli bombarded Higher aprotinin expression in transgenic plants was correlated with reduced weight of borer larvae. Basnay a ke et al. (2011) Embryogenic callus npt II / Geneticin (45 mg L 1 ) Pantoea dispersa sucrose isomerase gene Not reported Mature stems of transgenic sugarcane accumulated isomaltulose up to 33% of total sugars. Total sugar yield was unaffected. Transgenic plants after a few cycles of propagation did not display any adverse phenotypes. Harrison et al. (2011) Embryogenic callus npt II / Genet icin (45 mg L 1 ) F ungal CBHI, CBHII and bacterial EG Not reported Maximum accumulation of CBHs and EG was facilitated by vacuolar sorting and ER retention signal fusions respectively.

PAGE 37

37 Table 1 2 Continued References Target Tissue Selectable Marker / Selection Gene of interest Transformation efficiency Results Agrobacterium mediated Elliot e t al. (1998) Embryogenic callus sgfpS65T and bar / early visual screening followed by Phosphinothricin (1 mg L 1 ) treatment of selected calli. bar 5.3% of c alli treated (based on GFP screening). Visual screening was done 6 weeks after cocultivation. Silencing of visual marker under the control of 35S promoter suggested it is unsuitable for transgene expression. Timentin is effective in controlling bacterial o vergrowth. Manickavasagam et al. (2004) Axillary buds npt II, bar glucuronidase (GUS) reporter gene / Geneticin (50 mg L 1 ) or Phosphinothricin (5 mg L 1 ) respectively. bar 49.6% of the treated explants. Cocultivation of explants beyond 3 days adversely affected transformation efficiency. Five subcultures with se lection led to the reduction of chimeric plants to 0.6%. Agrobacterium strain EHA105 and LBA4404 resulted in similar transformation efficiency. Wang et al. (2005) Embryogenic callus bar / Phosphinothricin (0.75 mg L 1 ) Grifola frondosa trehalose synthase 4.5 plants per 100 cocultivated calli Osmotic treatment of transgenic and wild type (WT) plants with PEG delayed chlorosis in transgenic plants to day 7, by when all WT plants had wilted and died. Zhang et al. (2006) Embryogenic callus bar / Phosphinoth ricin (0.75 mg L 1 ) Grifola frondosa trehalose synthase Not reported Transgenic plants accumulated trehalose to high levels and displayed improved productivity under drought conditions. Zhangsun et al. (2007) Embryogenic callus npt II / Geneticin (30 mg L 1 ) Galanthus nivialis agglutenin (GNA) 0.8% of agroinfected calli Transgenic plants displayed a reduction in wooly aphid numbers by 60 80% when compared to the wild type controls. Order of Agrobacterium strain efficiency to produce transgenic plants EH A105 > A281 > LBA4404.

PAGE 38

38 Table 1 2. Continued References Target Tissue Selectable Marker/ Selection Gene of interest Transformation efficiency Results bar / Phosphinothricin (0.75 mg L 1 ) Galanthus nivialis agglutenin (GNA) 2.0% of agroinfected calli hpt II / Hygromycin (30 mg L 1 ) Galanthus nivialis agglutenin (GNA) 2.4% of agroinfected calli W ang et al. (2009 ) Embryogenic callus npt II / Geneticin (40 mg L 1 ) ACC oxidase anti sense gene 10.5 plants per 100 cocultivated calli Transgenic plan ts displayed reduced stature and growth. 35S CaMV= 35S cauliflower mosaic virus promoter; ACC oxidase= 1 aminocyclopropane carboxylic acid oxidase gene; a ph 3' phosphotransferaseII gene; 6 BAP= 6 benzyladenine; bar = phosphinothricin acetyl transferase encoding enzyme ; CCD= charge coupled device; cry IA(B)= Bacillus thuringiensis delta endotoxin encoding gene; CBHII= cellobiohydrolaseII gene; CP4= 5 enolpyruvoyl shikimate 3 phosphate synthetase gene from Agrobacterium strain CP4; EG= en doglucanase gene; FDV segment 9 ORF 1= Fiji Disease virus segment 9 open reading frame 1; EFS= electric field strength; GUS= beta glucuronidase histochemical staining; hGM CSF= Human granulocyte macrophage colony stimulating factor; luc = firefly luciferase gene; man A= phosphomannose isomerase gene; mds6pdh = sorbitol 6 phosphate dehydrogenase gene ; npt II= neomycin phosphotransferaseII gene; P5CS= pyrroline 5 carboxylate synthetase gene; PEG= polyethylene glycol; PHAA= Polyhydroxyalkanoic acid synthaseA; PHAB = Polyhydroxyalkanoic acid synthaseB; PHAC= Polyhydroxyalkanoic acid synthaseC; sgfpS65T = synthetic green fluorescent protein gene; SrMV SCH CP= sorghum mosaic potyvirus strain SCH coat protein gene ; SRMV= sorghum mosaic potyvirus; zmglk = Zymomonas mobilis glucokinase gene.

PAGE 39

39 CHAPTER 2 RAPID PRODUCTION OF TRANSGENIC SUGARCANE WITH THE INTRODUCTIO N OF SIMPLE LOCI FOLLO WING BIOLISTIC TRANS FER OF MINIMAL EXPRE SSION CASSETTES AND DIRECT EMBRYOGENESIS Rationale for Biolistic T ransf orma tion of Sugarcane Immature Leaf Cross section Explants Following Direct Somatic Embryogenesis Sugarcane ( Saccharum officinarum ) is g rown worldwide on over 23.7 million hectares generating 1.66 billion tons of harvested cane (FAO 2009). Cultivated sugarcane is a highly polyploid and aneuploid species (Simmonds 1976), making sugarcane improvement through breeding a challenging task. Breeding programs have been able to improve sugarcane yield and disease resistance through interspecific hybridization and back crossing (Liu et al. 1984) but development of improved cultivars requires on an average 12 to 15 years (Butterfield and Thomas 1996). Sugarcane is one of the most photosynthetically efficient C 4 plants (Alexander 1973) and is an important biofuel feedstock due to its ability to ac cumulate high quantities of biomass and sucrose. Further improvement of sugarcane as feedstock for fuels and chemicals will greatly benefit from genetic transformation of this crop. Under most field conditions sugarcane does not produce viable pollen or se ed and thus provides a high level of transgene containment. Biolistic gene transfer is the most frequently used method for sugarcane transformation (Altpeter and Oraby 2010). In contrast to Agrobacterium mediated transformation, biolistic gene transfer fac ilitates co transfer of multiple unlinked transgenes and is less genotype dependent (Altpeter et al. 2005). Several traits have Re printed with permission from Taparia Y, Fouad W, Gallo M, Altpeter F (2011) Rapid production of transgenic sugarcane with the introduction of simple loci followi ng biolistic transfer of a minimal expression cassette and direct embryoge nesis. In Vitro Cell Dev Pl. doi: 10.1007/s11627 011 9389 9

PAGE 40

40 been successfully introduced in sugarcane using biolistic transformation (Altpeter and Oraby 2010) but compared to other importa nt crops, sugarcane biotechnology lags behind. Sugarcane biolistic transformation has typically been achieved using indirect somatic embryogenesis (ISE) (Bower and Birch 1992; Gallo Meagher and Irvine 1996). Improvement of sugarcane transformation should target the development of an improved tissue culture system for production of regenerable target tissues and the optimization of gene transfer and selection protocols. An extended tissue culture period is required for the standard sugarcane transformation protocol, in which embryogenic callus is the target tissue for gene transfer. Consequently, these protocols may promote development of somaclonal variation and less than optimal performance of many of the regenerated transgenic plants has been reported (Ar encibia et al. 1999; Gi lbert et al. 2005, 2009 ; Vickers et al. 2005). Direct somatic embryogenesis (DSE) (Desai et al. 2004; Snyman et al. 2006; Van Der Vy v er 2010) from explants such as immature inflorescence, immature leaf whorl cross sections containing immature inflorescence and immature leaf whorl cross sections have also been reported following biolistic gene transfer, but convincing molecular evidence for the transgenic nature of the regenerated plants was not provided and whole plasmids were used fo r gene transfer. Our study utilized a minimal expression cassette (MC) which is a linear DNA fragment that contains the regulatory and coding regions of the transgene and no vector backbone. Studies in rice which compared the use of MCs with plasmids for biolistic transformation indicated that transgenic plants generated using MCs have a simpler gene integration pattern (Fu et al. 2000; Breitler et al. 2002). This may be because of

PAGE 41

41 the absence of prokaryotic backbone sequences which can contribute to DNA r ecombination (Kohli et al. 1999). Earlier studies suggest that bacterial sequences may induce methylation at the transgene loci causing transcriptional gene silencing (Clark et al 1997; Jakowitsch et al 1999). Alternately, recombination in the backbone sequences prior to integration may result in concatameric loci capable of being transcribed into double stranded RNA, leading to post transcriptional gene silencing (Plasterk and Ketting 2000; Hammond et al. 2001). In addition, prokaryotic vector backbone sequences in transgenic organisms may negatively impact regulatory approval (Zhao et al. 2007). CP 88 1762 is a preferred sugarcane cultivar in Florida, covering more than 20% (Rice et. al. 2009) of the total sugarcane production area in the state. It is a fast growing cultivar with high tonnage and has higher than average sugar content (Schueneman et al. 2008). In this report, we describe a rapid genetic transformation protocol for this commercially important cultivar employing biolistic gene transfer of a MC followed by DSE. Materials and Methods Media Composition Modified Murashige and Skoog (1962) medium (Chengalrayan and Gallo Meagher 2001), containing 2% sucrose, p c hlorophenoxyacetic acid (C, 1.86 mg L 1 ), 1 n apthaleneacetic acid (N, 1.86 mg L 1 ) a nd 6 b enzylaminopurine (B, 0.09 mg L 1 ) and 0.6% a garose (Sigma A ldrich St. Louis, MO ) was prepared with deionized and distilled water and the pH adjusted to 5.8 prior to autoclaving at 121C and 15 psi for 20 min. Culture initiation media contained C+N+ B, regeneration medium contained N+B and rooting medium contained no phytohormones. Gamborg vitamins (Gamborg et al. 1968)

PAGE 42

42 and the selection agent geneticin sulfate (PhytoTechnology Laboratories Overland Park, USA) were added to media post autoclave as f ilter sterilized and concentrated (1000 ) solutions. Selection media had a final concentration of 30 mg L 1 geneticin sulfate. Explant Preparation and Culture Initiation Tops of sugarcane cultivar CP 88 1762 were collected from the Everglades Research and Education Center, University of Florida, Belle Glade, Florida during the early grand growth phase when six to eight above ground nodes were visible. The outermost leaves were wiped with 70% ethanol prior to being stripped under aseptic conditions. Immatur e leaf whorl cross sections of approximately 2 mm thickness were cut under aseptic conditions with a scalpel from the 1 to 10 cm region above the apical node. Cross sections were placed on initiation culture medium and incubated under 30 mol m 2 s 1 light intensity with a 16: 8 h (light: dark ) photoperiod at 28C. On day 7 after culture initiation, tissues were subcultured to select the most responsive expla nts and to select contamination free cultures for the gene transfer. Preparation of the M inimal Expre ssion Cassette (MC) pHZ35S::nptII (Agharkar et al. 2007) was restriction digested using Alw NI and Not I and the fragment corresponding to 2 ,562 bp was gel eluted with QIAquick Gel Extraction Kit (Qiagen Inc Valencia CA ) to obtain a MC and then it was quantified using a NanoDrop ND 1000 spectrophotometer ( Thermo Fisher Scientific Inc Wilmington, DE). Biolistic Transformation Leaf disks were placed on medium containing all of the constituents of C+N+B medium in addition to 0.4 M sor bitol, 4 h before gene transfer. The npt II gene MC (200

PAGE 43

43 ng) was precipitated onto 1.8 mg gold particles (1.0 m diameter from Analytical Scientific Industries, El Sobrante, CA) following a previously described protocol (Altpeter and Sandhu 2010). MC coated gold particles ( 10 ng per shot) were accelerated toward leaf whorl cross sections using the Biolistic PDS 1000/He appara tus (Bio Rad Hercules CA) 10 d after culture initiation. Parameters for transformation were 1100 psi rupture d isks, chamber vacuum at 26.5 mm Hg and a shelf distance of 6 cm (from macrocarrier assembly). Transformation efficiency has been calculated by dividing number of plants generated by the total number of shots performed. For each shot explants covered the area of a circle with 2.5 cm diameter (Fi g. 2 1A). Culture, Selection, Reg eneration and Rooting of Plants After biolistic gene transfer, leaf whorl cross sections were transferred to C+N+B medium and cultured for 4 d before the start of selection. Before selection explants were separated into 1 2 cm segments. Selection was carried out using 30 mg L 1 geneticin sulfate (PhytoTechnology Laboratories L.L.C. Overland Park, USA) which was maintained until rooted plants were obtained. Sub culturing was done at a 10 day intervals (Fig. 2 3). Followi ng two cycles of selection on C+N+B medium, cultures were transferred to N+B medium under 100 mol m 2 s 1 light intensity with a 16h:8h (light: dark) photoperiod at 28C. By the end of the selection period on N+B media, small shoots, approximately 0.5 cm in length were observed (Fig. 2 1B). Leaf segments with small shoots were transferred to selection medium without phytohormones to enhance rooting and to select plants that formed roots in the presence of 30 mg L 1 geneticin sulfate (Fig. 2 1D). Roots of plantlets were washed with deionized water and dipped into a commercial root promoting powder (RooTing, Valent BioSciences Corporation, Libertyville IL) before being transfer red to a professional soil mix Fafard #2 ( Conrad

PAGE 44

44 Fafard Inc., Apopka FL ). The plants were grown in an air conditioned greenhouse under natural photoperiod at 28C during daytime and 22C at night. N eomycin phosphotransferase II E nzyme L inked I mmunosorbent A ssay Evaluation of npt II expression was carried out with a commercially avail able ELISA kit (Agdia Inc., Elkhart, IN ). Two vegetatively propagate d progeny plants per line (Fig 2 1 F) were obtained from nodal cuttings of the T 0 culm (Fig 2 1E). Protein was extracted from the youngest fully expanded leaf in two biological replications Prior to loading, all protein samples were quantified by Bradford assay using Coomassie Plus Protein Assay reagent (Thermo Fisher Scientific Inc., Rockfort IL) and bovine serum albumin as a standard. ELISA was performed with 20 g of total soluble pro tein of transgenic or non transgenic plants per well in comparison to NPTII standard (Fig. 2 1G). Qualitative evaluation of NPTII expression was performed with the VersaMax PLUS ROM v1.21 ELISA plate reader (Molecular Devices Sunnyvale, CA) measuring ab sorbance at 450 nm. Southern Blot Analysis Total genomic DNA was extracted from leaf tissue following a modified CTAB protocol (Porebski et al. 1997). DNA (30 g) was digested with Bam HI (New England Biolabs Ipswich MA) and electrophoresed on agarose g el (agarose 1% w/v ; TBE 0.5 ) and blotted onto Hybond N+ membrane (Amersham Biosciences, Piscataway open reading frame was amplified using forward primer 5' GGAGAGGCTATT CGGCTATGACTG 3' and reverse primer 5' ATCGGGAGCGGCGATACCGTAAAG 3' (PCR conditions denaturation 95C 30 s, annealing 61C 30 s, extension 72C 90 s

PAGE 45

45 32 P] dCTP 800 mCi/mM (Perkin Elmer Inc, Waltham MA) with a Prime a Gene random labeling kit (Promega Inc Madison WI). Pre hybridization and hybridization reactions were performed as described earlier by Jeff reys and Flavell ( 1977 ) and Van Rijs et al. ( 1985). Following hybridization, the membrane was rinsed once in 0.1 SSC and 0.1% SDS for 30 s, followed by two washes with 50 mL of 0.1 SSC and 0.1% SDS at 65C for 20 min each. Hybridization signals were visu alized by autoradiography on X ray film following two days exposure to the membrane at 80C. Results Tissue Culture and Selection Immature leaf cross sections at the time of culture initiation were pale to light yellow in color and turned green within 7 d a ys of incubation in light. By day 10 cell proliferation was observed on the cut surface of responsive leaf disks. Cell proliferation at the cut surfa ce was observed in 68% of the cultured leaf whorl cross sections. Tissues with this response were used as target for biolistic transformation 10 d after culture initiation (Fig. 2 1A). The use of C+N+B medium, promoted the initiation of DSE. First embryos were observed 14 to 21 d after culture initiation (Fig. 2 1B). With the start of selection, leaf disks t urned dark brown and the majority of embryos and pro embryos became necrotic and eventually died. Geneticin resistant embryos gave rise to plantlets (Fig. 2 1C) or secondary embryos. Continuing selection during the regeneration process was necessary to sup press escapes. Embryos were regenerated into shoots (Fig 2 1C) at the end of the second selection cycle by transfer to selection medium containing N+B at a light intensity of 100 mol m 2 s 1 By the end of the fifth selection cycle, shoots were detached from leaf segments. The use of DSE resulted in the development of rooted transgenic plants (Fig. 2 1D) which were transferred to soil in

PAGE 46

46 < 3 months (Fig 2 2). Transgenic plants were grown in the greenhouse (Fig. 2 1E) to maturity and vegetative progeny pl ants (Fig. 2 1F) were produced from cu ttings of mature node segments. Characterization of the Transgenic Plant s and their Vegetative Progeny Eight independent transgenic plants were produced following 14 shots. Southern blot analysis confirmed the stable i ntegration of the npt II MC (Fig. 2 3A) into the sugarcane genome and the independent nature of the transgenic plants (Fig 2 3B) with 1 to 5 hybridization products. Among the eight regenerated lines two displayed single hybridization products of low intens ity (line 5 and 7, Fig. 2 2) likely representing single copy insert None of the hybridization products were smaller in size than the theoretical minimum of 1 022 bp for an intact MC (Fig 2 3A). The T 0 plants grew vigorously and did not show phenotypic d ifferences to non transgenic sugarcane. ELISA of the transgenic progeny plants for NPTII revealed that seven of the eight transgenic lines displayed detectable levels of NPT II ranging from 0.020 ng NPTII per g protein to 0.106 ng NPTII /g protein (Table 2 1). Discussion We describe a biolistic transformation procedure for a commercially i mportant sugarcane cultivar (CP 88 1762) which prevents the integration of vector backbone sequences into the sugarcane genome through use of a minimal expression cassett e (MC). Leaf whorl cr oss sections were used after a 10 d pre culture time as target for gene transfer. This protocol allows the rapid recovery of transgenic plants with simple transgene integr ation patterns including single copy events with stable transgen e expression in vegetative progeny.

PAGE 47

47 Irvine and Benda (1987) and Burner and Grisham (1995) reported that rapid regeneration form leaf whorl cross sections of sugarcane was beneficial for reduction of somaclonal variation. Hoy et al. (2003) observed no diff erence in the agronomic performance of plants derived from leaf whorl cross sections, buds or meristems. However, plants derived from callus showed reduced stem diameter and increased tillering. Recent marker based evaluation of sugarcane plants regenerate d through DSE for clonal multiplication has validated that DSE causes minimal to no somaclonal variation (Suprasanna et al. 2007). In contrast, transposition and transcriptional activation of retrotransposons and DNA based transposons has been reported in callus cultures of sugarcane (de Araujo et al. 2005). Indirect somatic embryogenesis (ISE) offers a greater chance for the movement of Ac like transposable elements, whereas no polymorphism for Ac like transposable elements were detected in DSE generated p lants (Suprasanna 2010). This may explain why the standard sugarcane transformation protocol involving callus as target for gene transfer (Bower and Birch 1992; Gallo Meagher and Irvine 1996) frequently results in transgenic plants with less than optimal p erformance (Arencibia et al. 1999; Gilbert et al. 2005 2009 ; Vickers et al. 2005). The use of backcrossing to eliminate somaclonal effects is successful with sexually propagated crops (Bregitzer et al. 2008). However, backcrossing sugarcane is not feasibl e due to the complex polyploid genome. Reducing the tissue culture period during the establishment of target tissues, rapid selection and regeneration of accelerates the production of transgenic plants; also, it will likely minimize somaclonal variation an d may therefore improve the performance of the transgenic plants as described for several monocots including wheat (Altpeter et al. 1996), rice (Toki 1997),

PAGE 48

48 barley (Kihara et al. 1998), ryegrass (Altpeter et al. 2000), bermudagrass and bentgrass (Wang and Ge 2005). We were able to generate rooted transg enic plants in soil within 12 w k; this is considerably less in comparison to 36 wk required for conventional protocols employing ISE (Bower et al. 1996; Birch 1997; Snyman et al. 2000) and earlier reported D SE techniques requiring 18 20 wk (Snyman 2006) or 15 18 wk (Van Der Vyer 2010) from tissue culture initiation to transfer of plants to soil. Immature leaf whorls are the most abundantly available sugarcane tissue for initiation of regenerable tissue cultur es throughout the growing season. The protocol described here employs immature leaf whorl cross sections as target for biolistic gene transfer and plant regeneration through direct embryogenesis. This protocol allows transformation to be carried out throug hout the year. Earlier DSE protocols favored inflorescence containing leaf whorl cross sections (Snyman et al. 2006) or immature inflorescences (Desai et al. 2004) which are only seasonally available. Adaptation of the protocol described here to other cult ivars will be facilitated by identification of cultivars with high frequency of direct embryogenesis following culture of immature leaf whorl cross sections on C+N+B media. Adjustments of the cytokinin to auxin ratio of the direct embryogenesis media may b e necessary for specific genotypes. Previous research on the optimum pre culture time before gene transfer suggested that 7 d pre culture of the immature explant supported the highest transformation efficiency (Snyman et al. 2006; Van Der Vy v er 2010). In t his s tudy, DNA transfer was done 10 d after culture initiation with a prior subculture at day 7. A subculture prior to transformation allowed exclusion of leaf disks that were contaminated or show ed necrosis and no initial cell proliferation at the cut sur face.

PAGE 49

49 Therefore, we did not evaluate shorter pre culture times and the observed transformation efficiency of 0.57 transgenic lines per shot is ten times higher than the 0.05 transgenic lines per shot reported earlier (Snyman et al. 2006). Introduction of large amounts of DNA into plant cells produces high transient expression but has been known to lower transformation efficiency (Christou and Ford 1995). The u se of whole plasmid with the backbone sequences has been associated with transgene rearrangement w hich can lead to gene silencing (Kohli et al. 1999). Complex transgene integration was reported when w hole plasmids were used in the micro g ram range for preparing the DNA coated particles for biolistic gene transfer into sugarcane callus (Ingelbrecht et al 1999; Jain et al. 2005; Weng et al. 2011). Those lines had more than six copies (Weng et al. 2011) and individual lines even more than 15 copies (Ingelbrecht et al. 1999). Using minimal expression cassettes without vector e transgene integration in rice (Fu et al. 2000) and grape (Vidal et al. 2006) C ontrasting reports describing complex transgene integration despite the use of MCs were also published (Breitler et al. 2002; Romano et al. 2003). For the generation of transg enic plants with simple transgene integration pattern the MC amount per shot is critical (Sandhu and Altpeter 2008; Lowe 2009). We used 10 ng npt II MC per shot in transformation resulting in simple integration patterns with the five out of eight lines havi ng one to three hybridization products and the most complex integration resulting in five hybridization products. Earlier reports using plasmids for gene transfer followed by regeneration through direct embryogenesis did not provide convincing evidence for transgene integration into the sugarcane genome in form of a Southern blot (Snyman et al. 2006; and Van Der Vyer 2010).

PAGE 50

50 T he development of a rapid genetic transformation protocol for sugarcane that has reduced the time for developing transgenic plants to 12 wk from the time of initiation of cultures. For the first time molecular evidence is provided for transgene integration into the sugarcane genome following biolistic gene transfer and direct embryogenesis. The majority of transgenic lines displayed sim ple transgene integration patterns with one to three hybridization products in the southern blot The u se of low DNA quantity and minimal expression cassette might have led to this result. The performance of the transgenic plants was indistinguishable from wildtype and the transgene was stably expressed in the vegetative progeny suggesting that this protocol has great potential for the generation of commercial transgenic sugarcane lines

PAGE 51

51 Table 2 1. N PT II protein levels in leaf extracts of vegetative proge ny plants from transgenic sugarcane lines Transgenic line number a ng NPTII /g crude protein (Mean SE) b Number of Hybridization Signals in the Southern blot 1 0.075 0.02 5 2 0.106 0.01 3 3 0.079 0.08 2 4 0.075 0.05 3 5 0.102 0.01 1 6 0.077 0.11 5 7 0.020 0.00 1 8 0.000 0.00 3 a The plant identification number as listed in the Southern blot figure. b Average of two biological replications reported as mean standard error.

PAGE 52

52 Fig ure 2 1. Transformation of sugarcane and regenera tion through direct somatic embryogenesis A) Immature leaf whorl cross sections immediately before gene transfer, B) Development of direct embryos on immature leaf segments, C) Shoot regeneration on culture medium with 30 mg L 1 geneticin, D ) Rooted plant s on culture medium with 30 mg L 1 geneticin, ready to be transferred to soil, E) Mature transgenic sugarcane plants, F) Vegetative progeny of transgenic sugarcane. Bars in images A D represent 1cm.

PAGE 53

53 Figure 2 2. Flowchart for the rapid sugarcane transfo rmation protocol. The day of commencement of each step is indicated in the box. DEM= Direct Embryogenesis Medium containing p Chlorophenoxyacetic acid ( 1.86 mg L 1 ) +, ERM= Embryo Regeneration Medium containing 1 Napthaleneacetic acid (1.86 mg L 1 ) + 6 Ben zylaminopurine (0.09 mg L 1 )

PAGE 54

54 Figure 2 3. Southern blot analysis for stable integration of the minimal expression cassette of npt II. A) To detect integration of the minimal npt II expression cassette (released from vector backbone by Not I digestion) a 796 bp PCR product of the open reading frame of npt II was used as a probe. 30 g of T 0 sugarcane genomic DNA was digested with Bam HI. B) Southern blot analysis following restriction digest with Bam HI, electrophoresis on 1% agarose gel and hybridization wi t h a 796 bp probe of the npt II gene. WT: non transgenic sugarcane; 1 to 8: independent transgenic sugarcane plants; P: npt II expression cassette (50 pg) used as a positive control.

PAGE 55

55 CHAPTER 3 COMPARISON BETWEEN D IRECT AND INDIRECT E MBRYOGENESIS PROTOCOLS, BIOLISTIC GENE TRANS FER AND SELECTION PA RAMETERS FOR RAPID GENETIC TRANSF ORMATION OF SUGARCAN E Rationale for Optimization of Sugarcane Biolistic Transformation Cultivated sugarcane ( Saccharum spp hybrid ) is a tropical crop that is grown on 23.7 million h ectares in nearly 90 nations (FAO 2009) and contributes around 70% of the table sugar. Sugarcane is a C4 plant with one of the highest photosynthetic efficiencies (Zhang et al. 2007) assimilating nearly 10 to 28 t ha 1 yr 1 of atmospheric CO 2 (Bajay 2011) and capable of storing 0.7 M sucrose in internodes (Moore 199 5 ). Modern sugarcane has a highly polyploid and aneuploid genome with a somatic chromosome number ranging from 100 to 130 and a monoploid genome size of ~ 930 Mbp which is comparable to the si (Grivet and Arruda 2002) It is predicted that a complete set of homeologous alleles in the polyploid sugarcane genome may have between 8 to 10 copies As a result sugarcane improvement through traditional breeding methods of sex ual hybridization and recurrent back crossing is a slow process that usually takes 12 to 15 years to release an improved cultivar (James 2007). Sugarcane improvement is further hampered by the narrow genetic variability available in the present day clones (Jackson 2005). Nevertheless, significant improvement in the agronomic traits contributing to yield of sugarcane cultivars can be attributed to the advancement in breeding and cultural practices. Introduction of monogenic transgenic traits or entire pathwa ys through genetic engineering will make significant contributions in sugarcane improvement for both sucrose production or as bio based feedstock for fuel and chemicals (Altpeter and

PAGE 56

56 Oraby 2010; Jakob et al. 2009). Several traits of agronomic and industria l importance have been introduced in sugarcane (Altpeter and Oraby 2010). The first successful regeneration of transgenic sugarcane following biolistic gene transfer was reported by Bower and Birch (1992). Genetic transformation of sugarcane by electropora tion (Arencibia et al. 1992) and Agrobacterium mediated gene transfer (Arencibia et al. 1998) were also reported. Of these techniques, biolistic transformation is most frequently used for sugarcane transformation (Altpeter and Oraby 2010) as it is highly reproducible, adaptable to new explant types, less genotype dependent and allows introduction of multiple unlinked minimal expression cassettes (MC) for stacking of traits (Altpeter et al. 2005). Genetic transformation of most plant species requires the es tablishment of dedifferentiated cell cultures which are capable of regenerating to plants following stable integration of transgenes into their genome (Vasil and Vasil 1980, 1981). The induction of explant dedifferentiation can be achieved by the exogenous application of auxins and cytokinins (Lakshmanan et al. 2006; Garcia et al. 2007). Two major routes of regeneration have been reported for production of transgenic sugarcane : direct somatic embryogenesis (DSE) (Snyman et al. 2006; Taparia et al. 2011; Van der Vyver 2010) and indirect somatic embryogenesis (ISE) (Birch et al. 1992; Gallo Meagher et al. 1996). Development of vigorously performing transgenic plants with minimal somaclonal variation depends on several factors, of which tissue culture duration contributes significantly (Burner and Grisham 1995; Fukui 1983; Kaeppler et al. 2000) and is the most amenable to modification for minimizing undesirable effects.

PAGE 57

57 Microprojectile size is one of the physical parameters which may affect stable transformatio n efficiency and transgene integration pattern following biolistic transformation (Klein and Jones 1999). Smaller microprojectiles have been associated with reduced injury to bombarded explants and higher transformation efficiency (Randolph Anderson et al 1995 ). Minimal expression cassettes (MC) ensure the integration of the desired transgene free of the bacterial sequences from the cloning plasmid and has been termed the a eukaryotic genome can provide hotspots for recombination leading to transgene re arrangement (Kohli et al. 1999). Use of MC is expected to contribute to stable transgene expression. The n eomycin phosphotransferase II gene ( npt II) derived from the Tn5 transposon of E. coli is the most reliable and frequently used selectable marker gene for plant transformation, encoding resistance to antibiotics such as kanamycin sulfate (dicots), geneticin sulfate and paromomycin sulfate (monocots) (Libiakova et al. 2001). Although, u se of antibiotic resistance genes as selectable markers is discouraged for developing transgenic plants due to the possibility of horizontal transfer of such genes to soil and intestinal microbes, extensive research on the npt II gene has established that s uch an event is only likely under artificially facilitated conditions (Libiakova et al. 2001). To our knowledge a comparison of geneticin sulfate and paromomycin sulfate to determine concentration and suitability for selection of transformed cells has not been performed in sugarcane. The objectives for this study were: (1) to compar e ISE with DSE regarding transformation efficiency and transgene expression of regenerated plants (2) to

PAGE 58

58 e valuat e the duration of explant pre culture on transformation efficienc y (3) to s tudy the effect of microprojectile size and its effect on transformation efficiency and transgene insertion and (4) to c ompar e selective agents and their concentration regarding transformation efficiency and rate of transgen ic plants no t expre ssing the transgene Materials and Methods Media Composition and Growth Regulators Modified Murashige and Skoog (1962) medi um (Chengalrayan and Gallo Meagher 2001), containing 2% sucrose, and 0.6% agarose (Sigma Aldrich St. Louis MO) was prepared with d eionized and distilled water and the pH adjusted to 5.8 prior to autoclaving at 121C and 15 psi for 20 min. B5 vitamins (Gamborg et al. 1968) and selective agent (filter sterilized; 1000 solutions) were added to media post autoclaving. DSE was induced by the use of direct embryogenesis medi um (DEM) which contained p chlorophenoxyacetic acid (C, 1.86 mg L 1 ), 1 napthaleneacetic acid (N, 1.86 mg L 1 ) and 6 benzyl adenine (B, 0.09 mg L 1 ). Indirect somatic embryogenesis was induced by the use of 2,4 dichloro phenoxyacetic acid (2,4 D, 3 mg L 1 ; IEM). Plant regeneration from embryogenic tissues was induced by transfer to regeneration media (ERM) containing N+B. Explant Preparation and Culture Conditions Sugarcane tops were harvested from cultivar CP 88 1762 p l anted at the Everglades Research and Education Center, University of Florida, Belle Glade, Florida, USA when six to eight nodes were visible. The outermost leaf sheaths were wiped with 70% ethanol and removed under aseptic conditions. Immature leaf whorl c ross sections 2 mm thick were excised from a 1 to 10 cm region above the apical meristem, placed on

PAGE 59

59 DEM or IEM media and incubated under 30 mol m 2 s 1 light intensity with 16h:8 h (light/dark) photoperiod at 28C. Subcultures were performed at weekly int ervals prior to transformation. Excision and Purification of Minimal Expression Cassette pHZ35S:: npt II plasmid containing the npt II gene under control of the 35S CaMV promoter (Agharkar et al. 2007) was digested with Alw NI and Not I overnight, electrophores ed (70V, 180 min) on agarose gel (1% w/v ) and the 2 562 bp npt II MC fragment was gel eluted using QIAquick Gel Extraction Kit (Qiagen Inc.,Valencia, CA). The purified fragment was quantified on NanoDrop ND 1000 spectrophotometer (Thermo Fisher Scientifi c Inc., Wilmington, DE). Biolistic Transformation Four hours before transformation, explants were collected to cover a circle of 2.5 cm 2 diameter on media containing 0.4 M sorbitol in addition to all the components of DEM or IEM. The npt II MC (200 ng) was coated on 1.8 mg gold microprojectiles following a protocol previously described (Altpeter and Sandhu 2010). Gene delivery (10 ng of npt II MC DNA coated on 90 ng microprojectiles) was carried out with the biolistic PDS 1000/He apparatus (Bio Rad Hercule s, CA) with 1100 psi rupture d isks, chamber vacuum at 26.5 mm Hg, shelf distance of 6 cm and gold microprojectile size 0.3 m (Crescent C hemical Co., Islandia, NY) or 1 m (Analytical Scientific Instruments, Richmond, CA). Transformation efficiency was calc ulated by dividing the number of independent transgenic plants regenerated by the number of shots performed for a treatment.

PAGE 60

60 Experiment al Design, Randomization and Factor Combinations Experiment 1 was performed to optimize transformation efficiencies of al ternate morphological routes in a multifactorial experiment that compared the effect of explant preculture duration (DEM: 1, 2 and 3 wk; IEM: 3, 4 and 5 wk) with alternate microprojectile size (0.3 or 1 m). Immature leaf roll explant cultures (on DEM or I EM ) were synchronized so that b iolistic transformation of wk 1 2 and 3 DEM explants could be carried out on the same day as wk 3 4 and 5 IEM explants respectively Cultures for DSE or ISE were started from donor material collected in field visits space d 1 wk apart. Five shots per treatment combination and a total of 60 shots were performed for this experiment. Plates within the same pre culture and media group were randomly chosen for biolistic transformation with the different particle sizes. Experimen t 2 tested the selection strength of two selective agents at two concentrations each, paromomycin sulfate (20 and 40 mg L 1 ) and geneticin sulfate (15 and 30 mg L 1 ) for DSE induced immature leaf whorl cross section explants bombarded 10 days after culture initiation using 0.3 m gold microprojectiles, with 8 shots per treatment and a total of 32 shots. Four stacks of eight plates each were randomly selected and assigned to a selective agent at the specified strength. Culture Selection, Regeneration and Rooting o f Plants Following biolistic transformation the leaf whorl cross sections were separated into individual leaf segments and transferred to their respective non selective media for recovery. Cultures on DEM were cultured on non selective media for 3 4 days while those on IEM were cultured on non selective media for 2 wk before selection started. During the recovery period callus developed on ISE explants and was carefully detached from the leaf segments with the help of forceps and transferred to se lection

PAGE 61

61 medium. Subcultures were done at 10 d interval after transformation. In order to initiate regeneration, embryo bearing explants from either media were placed on ERM under 100 mol m 2 s 1 light intensity with 16h : 8h (light/dark) photoperiod at 28 C. Regenerated shoots (approximately 1 cm) in size were transferred to selection media free of phytohormones for rooting and shoot elongation. Selection was maintained till the rooted shoots were ready to be transferred to soil. Potted transgenic plants w ere acclimated in a growth chamber with 80% humidity; 4 00 mol m 2 s 1 light intensity with 16h:8h (light/dark) photoperiod at 28C. Post acclimation plants were grown in greenhouse with diurnal temperature range of 28 22 o C (day night) under natural photo period. Neomycin p hosphotransferase II Enzyme Linked Immunosorbent Assay ( NPTII ELISA ) A commercially available NPTII ELISA kit (Agdia Inc., Elkhart, USA) was used for expression analysis. Samples were loaded onto the ELISA plate and incubated at room tempe Total soluble protein was extracted from the youngest fully expanded leaves of two different tillers of each T 0 plant to constitute two replications. Protein concentration of each sample was determined by Brad ford assay (Bradford 1976) using Coomassie Plus Protein Assay reagent (Thermo Fisher Scientific Inc., Rockfort, IL) and bovine serum albumin standards. Equal loading of total soluble protein (20 g) facilitated relative expression quantification of each p lant sample against the NPTII standard provided with the kit. Absorbance values of samples were read at 450 nm with VersaMax PLUS ROM version 1.21 plate reader (Molecular Devices Sunnyvale, CA).

PAGE 62

62 Neomycin p hosphotransferase II Immunostrip Immuno Chromato graphy Assay Young leaves of putative transgenic lines were excised 3 cm from the tip and ground in 1 mL of diluted extraction buffer provided with the NPTII ImmunoStrip kit (Agdia Inc., Elkhart, USA). Samples were centrifuged at room temperature for 5 m in at 16,100g and the supernatant transferred to a clean microfuge tube where it was absorbed by ImmunoStrip to test the presence of NPTII. A positive reaction for NPTII was indicated by the development of two purple lines on the immuno chromatography st rip. Results were recorded 30 min after reaction beginning. Southern B lot A nalysis Extraction of total genomic DNA from leaf tissues was carried out following a modified c etyltrimethyl ammonium bromide (CTAB) protocol (Porebski et al. 1997). Genomic DNA (3 0 g) digested with Bam HI (New England Biolabs Ipswich, MA) was electrophoresed through agarose gel (TBE 0.5; agarose 1% w/v ) and blotted to Hybond N+ membrane (Amersham Biosciences, Piscataway, NJ) following the t 796 bp in length covering the npt II open reading frame was amplified using forward primer 5' GGAGAGGCTATTCGGCTATGACTG 3' and reverse primer 5' ATCGGGAGCGGCGATACCGTAAAG 3' (PCR conditions : denaturation 95C 30s, annealing 61C 30s, extension 72C 90s) ra 32 P] dCTP 800 mCi mM 1 (Perkin Elmer Inc, Waltham MA) by Prime a Gene random labeling kit (Promega Inc., Madison, WI). Probe DNA hybridization, membrane washing and visualization of membrane bound radioactive probe were done following an established protocol ( Vandenplas et al. 1984 )

PAGE 63

63 Statistical Analysis Data from experiments one and two were analyzed using PROC GLM function in SAS software (SAS Institute Inc., Cary, NC). Treatment differences were tested at =0.05 using LSD means Results Induction of Somatic Embryogenesis and the Effect of Preculture Period on Transformation Efficiency Direct embryogenesis media Weekly preculture of immature leaf whorl cross sections on DEM (Fig. 3 1A ) resulted in the proliferation of cells on the proximal surface that was first visible between day seven to ten and the cultured explants turned green in color in response to being cultured under illuminated conditions. Somatic embryos were first obser ved on DEM between 14 21 d (Fig. 3 1B ). Bas ed on this observation the effect of explant preculture period (DEM: 1, 2 and 3 wk ) on transformation efficiency was investigated. Germination of somatic embryos initiated (Fig 3 1C ) between day 31 34, 38 39 or 44 45 for explants that were bombarded 7, 14 or 21 d respectively after culture initiation. Shoots larger than 0.5 cm in size (Fig. 3 1E ) were observed 45 49 d, 53 57 d, or 65 69 d for explants that were bombarded 7, 14 or 21 d respectively after culture initiation Transgenic plants rooted in the pr esence of hormone free media (Fig 3 1I ) and were transferred to soil (Fig. 3 1 J ) 85, 92 or 99 d after culture initiation for explants bombarded at day 7, 14 or 21 respectively A trend for higher transformation efficiency (0.6 0 transgenic lines per shot ) of DSE induced explants was observed when bombarded at 1 or 2 wk after culture initiation compared to 3 wk after culture initiation (0.10 transgenic lines per shot Table 3 1 ).

PAGE 64

64 Indirect embryogenesis media Immature leaf whorl c ross sections showed swelling of the explant tissues after 3 1 0 d of culture on IEM (Fig 3 1E ). C alli developing on the explant surface were observed by day 21 (Fig. 3 1F ) of culture and somatic embryos developed at 6 7 wk of culture (Fig. 3 1G ). Therefo re, three set of biolistic experiments each spaced a week apart beginning at 3 wk of culture initiation were performed to investigate its effect on transformation efficiency. A pre experiment (data not shown) determined that initiation of selection 3 4 day s after gene transfer resulted in necrosis of the explants and failure to obtain transgenic callus or shoots. Therefore, the recovery period on non selective IEM following gene transfer was extended to 2 wk. Putative transgenic embryos were regenerated on ERM on day 75, 78 and 85 respectively for shots performed 3, 4 or 5 wk after culture initiation (Fig. 3 1G, H ). Selection was maintained until shoot elongation and root formation occurred and plants were transferred to soil. ISE induced explants when bom barded at 3, 4 or 5 wk after culture initiation resulted in 0.3, 1.1 and 0.9 plants per shot respectively (Table 3 1). Since the highest transformation efficiency (not and least tissue culture duration was observed with biolistic gene transfer 4 wk after culture initiation the work flow for this protocol is described in figure 3 2. Comparison of S elect ive Agent s Experiment 1 and 2 utilized gen eticin sulfate at 30 mg L 1 for selection of DSE and ISE somatic embryos. Use of geneticin (30 mg L 1 ) in DEM following gene transfer resulted in necrosis of both explants and majority of somatic embryos. All embryos that were no t necrotic regenerated pla nts in the presence of geneticin. A total of 48 lines were confirmed by Southern blotting (Fig. 3 5C ) (Table 3 1) for transgene integration

PAGE 65

65 while six lines were non transgenic escapes. An additional experiment was carried out to compare selection with paro momycin sulfate (20 or 40 mg L 1 ) against geneticin sulfate (15 or 30 mg L 1 ) for the selection of bombarded explants on DEM. The transformation efficiency was significantly higher when geneticin was used instead of paromomycin. In contrast to geneticin su lfate at 15 or 30 mg L 1 paromomycin sulfate at 20 mg L 1 or 40 mg L 1 concentrations did not result in partial necrosis of the DSE explants. However, NPTII immuno chromatography identified the same number of non expressing plants per shot following genet icin or paromomycin selection. More non the lower concentrations of both paromomycin and geneticin (Table 3 2). However, the concentration of the selection agent di d not affect the transformation efficiency significantly. Based on the number of putative transgenic plants confirmed positive by NPTII immune chromatography (Fig. 3 3B ), the average transformation efficiency following DSE and selection with paromomycin s ulfate and geneticin sulfate were 0.31 and 1.5, respectively (Table 3 2). Effect of Microprojectile Size, Morphogenic Route and Preculture Period on Transformation Efficiency Analysis of experiment 1 for the effect of morphogenic route on transformation ef transgenic lines per shot) for IEM grown explants was observed when bombarded at 4 wk after culture initiation with 0.3 m microprojectiles. The highest transformation efficienc y (1.2 transgenic lines per shot ) for D EM grown explants was observed w hen bombard ed 1 wk after culture initiation with 0.3 m microprojectiles (Table 3 1) The effect of microprojectile size on transformation efficiency was statistically significant.

PAGE 66

66 The 0.3 m microprojectiles produced on average 1.00 transgenic plants per shot while 1 m microprojectiles produced 0.20 transgenic plants per shot (Fig 3 4 B ). Molecular Characterization of Transgenic Plants A total of 48 independent transgenic plants with s table integration of npt II MC were confirmed by Southern blot analysis (26 lines shown in Fig. 3 5C ) from pre experiment and experiment 1. A total of 19 % of the transgenic lines displayed a single hybridization signal and 58% of the transgenic lines displa yed less than 4 signals with the overall average being 3.65. On an average the transgenic plants generated from 0.3 and 1.0 m microprojectiles displayed 3.2 0. 4 and 4. 9 0.7 hybridization signals respectively which was statistically 3 4 A ). The NPTII expression in transgenic plants averaged 0.0087 0.0039 ng NPTII per g of total soluble protein for DSE and 0.0176 0.0051 ng NPTII per g of total soluble protein for ISE derived plants (Table 3 1) There was no correlation between transgene expression and the number of hybridization signals. Discussion The comparison of direct and indirect somatic embryogenesis (DSE and ISE) for biolistic transformation of sugarcane cultivar CP 88 1762 indicated t he highest transformation efficiency with ISE (2.2 lines per shot) and the most rapid production of transgenic plants with DSE (12 wk from explant to plants in soil). The particle size and the type of the selective agent significantly affected the transfor mation efficiency. M icroprojectiles of 0.3 m diameter produced 5 times more transgenic lines than 1 m microprojectiles. Improved transformation efficiency by using submicron sized microprojectiles was also reported for maize (Frame et al. 20 00; Rando l ph Anderson et al. 1995 ) and orchids (Yang et al. 1999). This improvement may be due to the reduction

PAGE 67

67 in tissue damage when using smaller microprojectiles (Kausch et al. 19 95; Rando l ph Anderson et al. 1995 ). We also observed a significant reduction of the num ber of hybridization signals in the Southern blot with 0.3 m microprojectiles when compared to 1.0 m microprojectiles This suggests that the lower DNA carrying capacity and greater number of the smaller microprojectiles contributes to more transgenic li nes with less complex transgene integration as suggested by Klein and Jones (1999). Geneticin sulfate has a 4,6 dis ubstituted deoxystreptamine ring while paromomycin sulfate has a 4,5 disubstituted deoxystreptamine ring (Padilla and Burgos 2010) Both a minoglycoside antibiotics are routinely used for selection in combination with the npt II gene for transforming monocot species. When geneticin sulfate was used for selection, significantly more (4.8 times) transgenic plants were produced than paromomycin sulfate and an equal number of non expressing plants were produced with both selective agents following DSE. The reason for the observed difference in selection efficiency of paromomycin and geneticin may be due to the difference in their chemical structur e which affects their affinity for a range of tissue culture components such as cellulose, DNA, RNA and cell surfaces (Hancock 1981) Among the selectable marker/selective agent combinations used for genetic transformation of sugarcane, npt II / geneticin co mbination has been reported to generate the lowest rate of non transgenic escapes (3%, Falco et al. 2000) versus bar/ bialaphos (42%, Gallo Meagher and Irvine 1996) or phosphomannose isomerase/ mannose (44%, Jain et al. 2007). Reports in other members of th e gramineae family on the selection of npt II transformed explants vary from p a romomycin being superior to geneticin ( Oat Torbert et al. 1995 ;

PAGE 68

68 Wheat, Witrzens et al. 1998 ), both being equally effective (S orghum, Howe et al. 2006), or geneticin being super ior to paromomycin (Banana, Huang et al. 2007). Embryogenic callus (ISE) induced with 2.5 to 3 mg L 1 2 ,4 dichlorophenoxyacetic acid (Ahloowalia and Maretzki 1983; Brisibe et al. 1994; Ho and Vasil 1983; Snyman et al. 2001) is routinely used for biolistic transformation of sugarcane and produces rooted transgenic plants within 24 to 36 wk after culture initiation (Birch 1997; Bower and Birch 1992; Snyman et al. 2001). If ISE derived callus was bombarded 4 wk after culture initiation rooted transgenic plan ts were obtained within 18 wk from the time of start of culture. A similar ISE protocol was recently published for different sugarcane cultivars by Basnay a ke et al. ( 2011 ). Sweby et al. (1994) reported no genetic variation from sugarcane callus 3 months af ter culture initiation according to molecular marker analysis. Reduction in the stalk diameter of T 0 transgenic sugarcane plants has also been reported from tissue culture periods exceeding 23 wk (Basnay a ke et al. 2011). A reduction in tissue culture durat ion to 18 or 12 wk was observed with ISE or DSE, respectively, which may contribute to reducing somaclonal variation and improved performance of the transgenic plants as suggested by Burner and Grisham (1995). Initiation of DSE using immature leaf whorl cr oss sections has been reported by Snyman et al. (2006) and Van Der Vyver (2010). The highest transformation efficiency reported by Snyman et al. (2006) using leaf disks was 0.05 transgenic lines per shot which is lower than the 1.63 transgenic plants per s hot reported here under optimal conditions (Table 3 2). Van der Vyver (2010) did not report a ny transformation efficiency.

PAGE 69

69 The type and concentration of auxin used for inducing dedifferentiation determines the morphogenic route and also affects regenerabi lity of the target tissue. Chlorophenoxyacetic acids have been reported to be superior to other auxins for induction of direct somatic embryogenesis (DSE) (Lakshmanan et al. 2006; Taparia et al. 2009). 2,4 dichlorophenoxyacetic acid is the most frequently used auxin for the induction of ISE in sugarcane and other monocots (Ahloowalia and Maretzki 1983; Chen et al. 1988; Fitch and Moore 1990; Liu 1993; Gallo Meagher et al. 2000). Sugarcane cv. CP 88 1762 transformed in this study is cultivated on 20.3% of th e sugarcane growing area in Florida (Rice et al. 2009) and displays a high regeneration frequency following DSE (Taparia et al. 2009), ISE (Joshi 2009; Kim et al. 2011) and direct organogenesis (Joshi 2009). Adjustment in auxin to cytokinin ratios, use of antioxidants (Enriquez Obregon et al. 1998), reducing sub culture intervals and improved management of donor plants (Basnay a ke at al. 2011) could contribute to adaptation of the protocols reported here for other sugarcane cultivars. In conclusion, optimiz ation of two alternative morphogenic routes for regeneration (DSE and ISE) supported reproducible and rapid genetic transformation of a commercially important sugarcane cultivar. Smaller microprojectiles of 0.3 m diameter produced more transgenic plants t han 1 m microprojectiles. Geneticin sulfate at 30 mg L 1 was the most effective selective agent for regeneration of npt II expressing plants.

PAGE 70

70 Table 3 1 Effect of morphogenic path and preculture duration on transformation efficiency. Morphogenic path a Preculture duration ( wk ) Particle size (m) Transformation efficiency b Mean SE Hybridization signals d Mean SE NPTII f (ng/g) Mean SE DSE 1 0.3 1.20 1.20 2.50 0.67 0.0121 0.0077 g 1 .0 Mean 0.60 0.60 2.50 0.67 0.0121 0.00 77 2 0.3 0.80 0.80 3.75 0.85 0.0041 0.0041 g 1 .0 0.40 0.40 4.50 0.50 0.0019 0.0019 g Mean 0.60 0.43 4.00 0.58 0.0034 0.0027 3 0.3 0.20 0.20 3.00 0.00 0.0198 0.0000 g 1 .0 Mean 0.10 0.10 3.00 0.00 0.0198 0. 0000 DSE Overall 0.43 0.27 c 3.23 0.44 e 0.0087 0.0039 ISE 3 0.3 0.60 0.60 3.67 2.19 0.0344 0.0175 g 1 .0 Mean 0.30 0.30 3.67 2.19 0.0344 0.0175 4 0.3 2.20 1.28 2.72 0.47 0.0041 0.0031 g 1 .0 Mean 1.10 0.71 2.72 0.47 0.0041 0.0031 5 0.3 1.00 0.63 3.60 1.66 0.0364 0.0143 e 1 .0 0.80 0.49 4.75 1.10 0.0183 0.0118 g Mean 0.90 0.38 4.11 1.01 0.0284 0.0095 ISE Overall 0.77 0.24 c 3.39 0.52 e 0.0176 0.0051 a Morphogenic pa th Direct somatic embryogenesis (DSE), Indirect somatic embryogenesis (ISE). b Transformation efficiency was calculated as number of transgenic plants per shot; n= 5. d Number of signals as observed in the S outhern blot. f Values of NPTII were estimated f rom protein extract of fully expanded leafs of two tillers per line and reported as categorized me an SE, SE= Standard error; represents zero values for plates that did not produce any transgenic plants.

PAGE 71

71 Table 3 2 Effect of selective agent on trans formation efficiency. Selective agent Concentration (mg L 1 ) Number of transgenic plants expressing NPTII Transformation efficiency a (Mean SE) Number of non expressing plants Non expressing plants per shot d (Mean SE) Geneticin sulfate 15 11 1.375 0.263 b 6 0.750 0.25 e 30 13 1.625 0.263 b 1 0.125 0.13 e Mean 1.500 0.172 0.438 0.16 Paromomycin sulfate 20 2 0.250 0.164 c 5 0.625 0.61 e 40 3 0.375 0.183 c 2 0.250 0.32 e Mean 0.313 0.113 0.438 0.18 a Transforma tion efficiency was calculated as number of transgenic plants expressing NPTII (Immuno chromatography) per shot; n=8. d Non expressing plants per shot were calculated by dividing the number of plants that did not express detectable levels of NPTII (Immuno chromatography) by the number of shots performed. SE= Standard error. Values marked with the different letters in the same column are statis 0.05).

PAGE 72

72 Fig ure 3 1. Transformation of and regeneration of sugarcane A, Immature leaf whorl cross section initiated on direct somatic embryogenesis medium at 7 d of preculture. B, Development of direct embryos on immature leaf se gments 18 d after culture initiation. C, Regeneration of direct embryos on regeneration medium (ERM) with 30 mg L 1 geneticin D, Regenerated shoots attached to explants on culture medium with 30 mg L geneticin 46 d after culture initiation. E, Immature leaf whorl cross section 7 d after culture initiation on indirect somatic embryogenesis media. F, Development of calli on explants 21 d after culture initiation. G, Initiation of regeneration on ERM with 30 mg L geneticin. H, Regenerated shoots from indi rect somatic embryos 90 d after culture initiation. I, Regenerated shoots on rooting media with 30 mg L geneticin. J, Mature transgenic sugarcane plants.

PAGE 73

73 Fig ure 3 2 Timeline of sugarcane transformation following indirect somatic embryogenesis (ISE) .The timing (days) of commencement of each step is indicated in bold in the box ERM= Embryo Regeneration M edi um, IEM= I ndirect Embryogenesis M edia.

PAGE 74

74 Fig ure 3 3 Effect of selective agent on transformation efficiency. Selection on either geneticin sulfate or paromomycin sulfate on direct somatic embryogenesis media are compared regarding the number of transgenic plants per shot expressing NPTII (immmuno chromatography). Error bars depict standard error values. Different letters indicate statistical signifi 0.05).

PAGE 75

75 Figure 3 4. Effect of gold microprojectile size on transformation efficiency and number of hybridization signals in Southern blot. A, Mean of hybridization signals in southern blot vs. microprojectile size B, Transformation efficiency vs. microprojectile size. Values are reported as number of transgenic plants per shot. Error bars represent standard error values. Different letters indicate 0.05).

PAGE 76

76 Fig ure 3 5 Analysis for stable integration and expressi on of the minimal expression cassette of npt II. A, The npt II minimal expression cassette was excised with Not I and Alw N I prior biolistic gene transfer. For Southern blot analysis a 796 bp PCR product of the open reading frame of npt II was used as a probe. B, NPTII Immuno chromatography. C: control line, T: test line with purple color indicates positive NPTII reaction G: geneticin sulfate, P: paromomycin sulfate C, Southern blot analysis of T 0 sugarcane g following restriction digestion with Bam HI E lectrophoresis on 1% agarose gel, and hybridization with a 796 bp probe of the npt II gene. WT non transgenic sugarcane, 1 48 Line numbers of independent transgenic lines. Line numbers in blue were generated using 1.0 m and green numbers using 0.3 m gold microprojectiles, P = npt II expression cassette (50 pg) used as a positive control.

PAGE 77

77 CHAPTER 4 CONCLUSION S Two alternative protocols for the rapid g enetic transformation of the commercially important sugarcane cultivar CP 88 1762 by biolistic transfer of minimal expression cassettes were developed The optimized protocols involved two alternative morphogenic pathways direct somatic embryogenesis (DSE) or indirect somatic embryogenesis (ISE) which produced transgenic plants in soil within 12 or 18 wk after culture initiation, respectively The h ighest transformation efficiency was observed if biolistic gene transfer was performed 10 d after culture initiation for DSE induced explants or 28 d after culture initiation for ISE induced explants Transformation efficiencies of 1.6 or 2.2 independent transgenic plants per shot for DSE or ISE respectively compare well with earlier reported transformation efficienc ies for this sugarcane cultivar using the standard transformation protocol Submicron particles (0.3 m) produced significantly more transgenic lines with simpler integration pattern than particles with 1.0 m diameter Simple transgene integration patterns following biolistic transformation may also be associated with the reduced DNA quantity per shot Of the two selective agents used for recovery of npt II expressing plants geneticin sulfate produced more transgenic plants than paromomycin sulfate per shot and a similar number of escapes pe r shot

PAGE 78

78 Future Research Estimation of DNA Based Variation in Transgenic Plants Developed by Rapid Transformation Procedures The reduction in tissue culture duration coupled with the use lower DNA quantities of npt II MC may have led to the reduction of soma clonal effects on the transgenic sugarcane plants. Evaluation of field performance of transgenic plants and the use of molecular markers may help in confirming which of the alternative protocols and particle sizes minimiz es the occurrence of phenotypic and genomic changes. Introduction of Transgenic Traits of Interest and Estimation of Co transformation Efficiencies The developed transformation protocol will be utilized to introduc e one or multiple transgenes for genetic improvement of single or multiple t raits C o transformation efficiencies of trait gene and selectable marker should be determined when multiple unlinked minimal expression cassettes are used for biolistic transformation. High co transformat ion efficiency in biolistic experiments should vali date the usefulness of the protocols developed, for the stacking of traits. Application of the Rapid Transformation Procedures to a Range of Genotypes It is desirable to utilize this protocol for a number of sugarcane genotypes. An i nitial screening of sui table genotypes should be based on the ability to induce regenerable direct or indirect embryos from immature leaf roll cros s sections. T he timing of bombardment, concentration of selective agents and subculture intervals may need to be adjusted for specif ic genotypes. In conclusion rapid genetic transformation of sugarcane can be obtained with the developed protocols resulting in considerable saving in time and labor and likely improved performance of the transgenic plants

PAGE 79

79 APPENDIX LABORATORY PROTOCOLS USED FOR BIOLISTIC T RANSFORMATION, TISSU E CULTURE AND CHARACTE RIZATION OF TRANSGEN IC SUGARCANE PLANTS Protocols for Molecular Cloning Preparation of Glycerol Stocks 1. Initiate E. coli culture containing desired plasmid in 2 mL sterile LB broth containing th e appropriate antibiotic (spectinomycin for plasmid pHZ35sNptII). Incubate overnight at 37C 2. Add 0.8 5 mL of the bacterial culture and 0.1 5 mL sterile glycerol into a sterile microfuge tub e 3. Mix by vortexing and immediately freeze using liquid nitrogen. Store at 80C. Prepare several tubes for plasmid. Avoid successive freeze thaw cycles. Amplification and Purification of Plasmid DNA Using the QIAGEN Plasmid Midi Kit QIAGEN plasmid purification protocol a s provided by the manufacturer All buffers (P1, P2, P3, QBT, QC, QF, TE) are supplied with the QIAGEN kit 1. I noculate a starter culture of 2 5 mL LB medium containing the 1g/ mL of the appropriate antibiotic. Frozen glycerol stocks or freshly streaked selec tive plate can be used for inoculation. Incubate for ~8h at 37C with vigorous shaking (~22 0 rpm Use a tube or flask with a volume of at least 4 times the volume of the culture 2. Use the starter culture to initiate an ov ernight culture. Use 100l of the starter culture in 50 mL LB medium containing the appropriate antibiotic. For low copy plasmids, inoculate 10 0 mL medium. Incubate at 37C for 12 1 6 h on an orbital shaker. The vessel used should have a capacity at least 4 times the volume of the culture 3. Harvest bacteria l cells by centrifugation at 600 0 g for 1 5 min at 4C. Remove all traces of supernatant by pipetting. 4. Resuspend the bacterial pellet in 4 mL b uffer P1. The bacteria should be resuspended completely by vortex ing or pipetting up and down until no cell clumps remain. 5. Add 4 mL Buffer P2. M ix gently but thoroughly by inverting 4 6 times I ncubate at room temperature for 5 min. Contents should not be vortexed at this stage. 6. Add 4 mL of chilled buffer P3 Immediatel y m ix immediately b y gently inverting the tubes 4 6 times I ncubate on ice for 15 to 2 0 min. After the addition of buffer P3, a fluffy white material forms and the lysate becomes less viscous. If the material still appears viscous and brownish, more mixing is required to completely neutralize the solution. 7. Centrifuge at 20,000 g for 3 0 min at 4C. Remove supernatant containing plasmid DNA promptly. Before loading the centrifuge, the sample should be mixed again 8. Centrifuge the supernatant again at 20,000 g f or 1 5 min at 4C. Remove supernatant containing plasmid DNA promptly. 9. Equilibrate a QIAGEN tip 100 by applying 4 mL Buffer QBT, and allow the column to empty by gravity flow.

PAGE 80

80 10. Apply the supernatant from step 8 to the QIAGEN tip and allow it to enter the res in by gravity flow. 11. Wash the QIAGEN tip with 2 times 1 0 mL Buffer QC. 12. Elute DNA with 5 mL buffer QF. Collect the eluate in a 1 0 mL tube. 13. Precipitate DNA by adding 3. 5 mL isopropanol to the eluted DNA. Mix and centrifuge immediately at 150 0 g for 3 0 min at 4 C. Carefully decant the supernatant. All solutions should be at room temperature in order to minimize salt precipitation. 14. Wash DNA pellet with 2 mL 70% ethanol, and centrifuge at 150 0 g for 1 0 min. Carefully decant the supernatant without disturbing the p ellet. 15. Air dry the pellet for 5 1 0 min, and redissolve the DNA in a 20 0 l TE buffer Allow the pellet to resuspend in TE buffer overnight at 4C before transferring to a sterile micorfuge tube Preparation of Minimal Linear Expression Cassettes 1. Digest 1 00 g of plasmid DNA using restriction enzymes which excise the gene expression cassette (promoter, gene, poly A) and have no restriction site within the cassette. 2. Check for com plete digestion by running a 1L aliquot of the digest on a 1.0 % agarose gel. Complete digestion will be indicated by the exact number of bands as expected. (eg. if two enzymes cutting one at each side of the expression cassette have single site in the plasmid, it will give two bands. The yield of fragment of interest will depend on the relative size of the expression cassette to the whole plasmid. 3. Load 10 15 g per well on a 0.8% agarose gel and electrophorese at 70 V for 3 h to achieve good separation of bands. 4. Stain the gel for three hours with ethidium bromide (60 L in 1L of wat er). 5. Excise the band corresponding to the expression cassette using a UV transilluminator. 6. Purify the excised band with the QIAquick gel purification kit (Qiagen Inc., Valencia, CA) following the instructions manual. 7. Check quality by electrophoresing 2 L of the fragment DNA (expression cassette). 8. Qua ntify the fragment yield using NanoD rop (ND 1000 spectrophotometer, Nanodrop Technologies, Wilmington, DE). Restriction Digestion to Prepare Minimal Expression Cassette pHZ35sNptII digestion Restriction Enz yme NotI + AlwNI (New England Biolabs ) pH Z35sNptII plasmid (100 g) 40 L Buffer 4 10 10 L BSA 10 10 L Enzyme Not I 1 L Enzyme Alw NI 1 L ddH 2 O 30 L

PAGE 81

81 Final volume 100 L Digest overnight at 37C Gel Extraction Using QIAquick Gel Extraction Kit Prepare Buffer PE by adding 4 0 mL 100% ethanol to the provided concentrate. Always use pro tective wear to protect skin and eyes from harmful UV radiation. When running a gel ensure that all buffers were made fresh, when staining a gel make sure to use a fresh batch of ethidium bromide so as to not contaminate your plasmid with foreign DNA or DN ase. 1. Visualize DNA bands under a UV transilluminator. 2. Excise the DNA fragment precisely from the agarose gel using a clean sharp scalpel. Avoid excess agarose. Proceed quickly to avoid long UV exposure 3. Weigh the excised agarose gel and distribute approxim ately 400 mg per microfuge tube. 4. Add 3 volumes of Buffer QG to 1 volume of gel. 5. Incubate at 50C in a water bath for 1 0 min or until the gel has completely dissolve d Vortex every 2 min during incubation to ensure complete dissolution of gel. After incubat ion check that the color of the mixture remains similar to Buffer QG (yellow), indicating that the pH has not changed. 6. Add 1 gel volume of isopropanol to the mixture and mix by inverting the tube several times. 7. Place a QIAquick spin column in a provided 2 mL collection tube and apply the sample to the column. 8. Centrifuge at 16,100 g for 1 min using table top centrifuge. Repeat this step if the volume of the mixture is more than 80 0 L the maximum capacity of the QIAquick column. 9. Discard the flow through an d place the column in the same collection tube. 10. Wash the QIAquick column by adding 75 0 L Buffer PE to the column and centrifuging for 1 min at 15,700 g. 11. Discard the flow through, place the column back in the same collection tube and spin for an additional 1 min at 15,700 g to remove residual ethanol from Buffer PE. 12. Place the QIAquick column in a clean, sterile 1. 5 mL microcentrifuge tube. 13. Add 50 l Buf fer EB (1 0 mM Tris Cl, pH 8.5) to the center of the QIAquick membrane to elute DNA, let stand for 1 min and then centrifuge for 1 min at 15,700 g. 14. Store DNA at 20C. Protocol for Biolistic Gene Delivery using PDS 1000/He Preparation of Gold Stock (60 mg mL 1 ) 1. Weigh 60 mg of 1.0 m gold particles in a sterile 1.5 mL microfuge tube. 2. Vortex for 3 5 min after adding 1 mL of 70% ethanol. 3. Centrifuge briefly (5 s) to pellet the microparticles. 4. Discard the supern atant, follow by 3 washes with 1 mL autoclaved dd H20

PAGE 82

82 5. Vortex for 1 min. 6. Centrifuge briefly (3 5 s) and again remove the supernatant. 7. Add 1 mL sterile 50% v/v glycerol. 8. Store the gold stock at 20C. Preparation of DNA Coated Microparticles 1. Add gene expression cassette (200 ng) and sterilized ddH 2 O to a final volume of 30 L in 1.5 mL sterile microfuge tube. 2. Transfer 30 L of the gold stock suspension to the tube above while vortexing at a low speed. Continue vortexing for 60 s. 3. Dispense 20 L 0.1 M freshly prepared spermidine and 50 L 2.5 M CaCl 2 in c lose succession into the vortexing mixture above and continue vortexing for another 60 s. 4. At the end of the vortexing period centrifuge briefly (3 5 s) to pellet the gold. 5. Discard the supernatant without disturbing the pellet and add 250 L absolute ethan ol for washing 6. D iscard the supernatant alcohol 7. Repeat step 5, once more. 8. Resuspend the pellet in 10 0 L absolute ethanol by sonication for 1 s. 9. Keep the DNA coated microprojectiles on ice Biolistic Bombardment 1. Turn on PDS 1000/He Particle Delivery Sy stem and vacuum pump ; ensure the helium supply is at least 200 psi above the pressure rating of the rupture disks being used. 2. P lace the rupture disk in the center of the rupture disk holder and secure it properly inside the chamber. 3. Place macrocarriers in to holders with forceps and push down with a sterile blunt object to secure it in holders 4. Prior to use resuspend the DNA coated microparticles by briefly vortexing. 5. Apply 5 L of the suspension of DNA coated microparticles into the center (inner 5mm dia meter) of the macrocarrier; allow for complete evaporation of ethanol before use. 6. Place stopping screen into the macrocarrier plate and insert the inverted macrocarrier assembly on top. Secure the lid on top of the shelf assembly. 7. Place macrocarrier plate containing the macrocarrier at the highest level of the inner chamber 8. Place tissue culture plate on shelf 2 below the macrocarrier plate ( 6 cm below ) 9. Initiate a vacuum to 2 6 .5 mm Hg ; press and hold the fire button until the disc ruptures at 1100psi. Eye protection must be worn. 10. Vent the vacuum and remove petri dish. 11. Dismantle the assembly and prepare for the next shot.

PAGE 83

83 Molecular Techniques used in the Confirmation of Putative Transgenic Plants Immunochromatographic NPTII ImmunoStrip NPT II ImmunoStrip (Agdia, Elkhart IN ) k it for as provided by the manufacturer NPTII ImmunoStrip test sticks must be allowed to come to room temperature before use. 1. Harvest 50 mg leaf segments in a centrifuge tube 2. Add 600 L of the diluted PEB1 extraction buffer suppli ed with the kit. 3. Grind the tissue until the buffer turns green 4. Centrifuge for 5 min at 4 C at 5000 rpm. 5. Remove the supernatant into fresh 1.5 mL microfuge tube without disturbing the leaf debris. 6. At this step, the total protein may be quantified or the Qui ck Stix may be directly used. (for protein estimation, please see NPTII ELISA protocol). 7. Place the strip into the extraction tube. The sample will travel up the strip. Use a rack to support multiple tubes if needed. 8. Allow the strip to develop for 30 min be fore making final assay interpretations. Positive sample results may become obvious much more quickly. Development of the control line within 1 0 min indicates that the strip has functioned properly. The sample extract containing nptII will develop a second line (test line) on the membrane strip between the control line and the protective tape, within 5 6 min of sample addition NPTII ELISA Assay Protein Extraction 1. Harvest 600 mg of young fresh leaf tissue. Store samples on ice. 2. Add 10 mg polyvinyl pyrrol idone (PVP) and 600 L 10x PEB1 buffer (supplied with the nptII Agdia ELISA kit) to each sample. 3. Grind the leaf samples using a micro pestle. Keep the samples on ice. 4. Centrifuge the samples at 20,800 g at 4C for 15 min. 5. Transfer the supernatant to a new micro centrifuge tube and store on ice. Protein Estimation 1. Dilute Protein Determination Reagent (USB Corporation, product code 30098) 1:1 using sterile ddH 2 O. Prepare enough to use 1 mL per sample including standards and blank. 2. Prepare a standard dilution series using BSA (0 20 g). 3. Add 1 mL diluted Protein Determination Reagent to each cuvette. Add 5 L of sample to each cuvette and mix by vortexing. 4. Incubate at room temperature while preparing t he remaining samples. 5. Measure OD 595 of each sample (ideally these should be between 0.2 and 0.8). 6. Plot a standard curve using BSA and use it to estimate total protein concentration of the samples. 7. Calculate the volume of each sample required for 20 g tot al protein per well.

PAGE 84

84 Assay 1. Prepare the samples, including wild type using 22 g protein and the volume of buffer PEB1 required to make the total volume 110 L 2. Prepare standards as follows: 110 L buffer PEB1 (negative control) and 110 L of the provid ed positive control. 3. Prepare a humid box by putting damp paper towel in a box with a lid. 4. Add 100 L of each sample and standard in the ELISA microplate provided with the kit. The order of samples should be noted at this time. 5. Place the plate in the humid box and incubate for 2 hours at room temperature. 6. Prepare the wash buffer PBST by diluting 5 mL to 100 mL (20 ) with ddH 2 O. 7. Prepare the enzyme conjugate diluent by mixing 1 part MRS 2 with 4 parts 1 buffer PBST. Make enough to add 100 L per well. 8. A fe w minutes before the incubation ends, add 10 L from bottle A and 10 L from bottle B per 1 mL of enzyme conjugate diluent to prepare the enzyme conjugate. 9. When incubation is complete, remove plate from humid box and empty wells. 10. Fill all wells with 1 buf fer PBST and then empty them again. Repeat 5 times 11. Ensure complete removal of wash solution by tapping the frame firmly upside down on paper towels. 12. Add 100 L of the prepared enzyme conjugate into each well and incubate the plate in the humid box for 2 h at room temperature. 13. In the meanwhile, aliquot sufficient TMB substrate (100 L per well) and allow it to warm to room temperature. 14. When the incubation is complete, wash the plate with 1 buffer PBST as before. 15. Add 100 L of room temperature TMB substrate solution to each well and place the plate back in the humid box for 15 min. A blue color will develop, the intensity of which will be directly proportional to the amount of NPTII protein in the sample, while negative samples will remain white. 16. To stop the reaction, add 50 L 3M sulphuric acid to each well. The substrate color will change from blue to yellow. 17. The results must be recorded within 15 min after addition of the stop solution o therwise the reading will decline. 18. Color development can be visually scored or recorded with the help of an ELISA plate reader. DNA Extraction CTAB Method 1. Autoclave mortars, pestles and spatulas for 20 min and dry in an incubator oven at 60C. 2. Prepare enough CTAB buffer (5 mL g 1 mercaptoethanol fresh (200 L mercaptoethanol per 100 mL buffer or 30 L in 15 mL ). Heat to 65C in a water bath. 3. Harvest 3 g young leaf material and store on ice or freeze in liquid nitrogen 4. Cool mortar and pestle by adding liquid nitrogen. Chop fresh leaf into the liquid nitrogen using scissors or add leaf and then cut into small slices. Grind to a fine powder under nitrogen approximately 3 times.

PAGE 85

85 5. Add frozen leaf powder to 15 mL pre heated buffer in a 50 mL disposable polypropylene tube and mix well to remove lumps using a spatula or glass rod. 6. Incubate at 65C, 1 hour. Mix the contents thoroughly 1 3 times during incubation. 7. Add 3 L RNAse A to each sample at the start of incubation. 8. Cool t o room temperature. 9. Add equal volume (15 mL ) chloroform: iso amyl alcohol (24:1) and mix gently to form an emulsion for approximately 30 min. Mix with hand by gently inverting the tubes and then again put it on the shaker for another 10 15 min. 10. Spin, 4000 rpm, 30 min. Transfer top layer to a fresh 50 mL tube using a wide bore 10 mL pipet tip. 11. Repeat step 8 through 9 once again. 12. Repetition of step 8 for a third time may depend on the quantity of precipitate visible at the organo qaueous interface. 13. Add volumes chilled isopropanol and mix gently by inverting. The DNA will precipitate. 14. Use a blue pipette tip with wide bore to suck the DNA out of the aqueous mixture. 15. Transfer DNA to a clean 15 mL tube containing 10 mL of 70% ethanol. 16. Wash one more time in 70% ethanol by inverting the tube several times. 17. Transfer washed DNA pellet to a clean 1.5 mL microfuge tube and air dry and resuspend in 200 L TE. 18. Prepare 10x dilution of the DNA stock. Use 1 L to check concentration and quality using the Nano D rop spec trophotometer and by gel electrophoresis of samples in a 0.8% agarose gel (80V, 4 0 min). 19. Store the dilutions and stocks at 4 C. Southern Blotting Gel electrophoresis 1. Extract genomic DNA from transgenic lines as well as wild type using the CTAB method as described above. 2. D igest 30 g DNA from each sample with the restriction enzyme to be used for Southern blotting. Run the digested DNA on a 1% agarose gel to ensure complete restriction digestion. 3. Use 30 g genomic DNA to set up restriction digests for Sout hern blotting. First, estimate the volume of each sample required to get 15 g DNA and pipet it into a sterile 1.5 mL micro centrifuge tube. Add sterile ddH 2 O to make up the volume to 30 L 4. Set up the digestion as follows: DNA ( 30 g DNA + sterile ddH 2 O) Calculate volumes 10 Bam H I buffer 3 .0 L 100 BSA 0.3 L BamHI (1000U/l) 1.5 L Sterile ddH 2 O ~15.2 L Final volume 3 0.0 L

PAGE 86

86 5. Prepare a master mix for all samples that includes the buffer, BSA (if required for the enzyme chosen), enzyme and w ater. Mix by pipetting and add 30 L DNA. Mix well, centrifuge briefly and incubate in a waterbath at 37 C over night. 6. Run 2 L from each digest on a 1% agarose gel to ensure complete digestion. 7. Prepare a 1 cm thick 1% agarose gel for Southern blotting usi ng 0.5 TB E. 8. Concentrate all the digests to reduce the volume by half (30 L ) in a Speed Vac. 9. Centrifuge the samples briefly and add 6 L loading dye ( 6 ) Mix well by pipetting L oad samples on the gel. Also load a molecular weight marker (1 kb ladder, Ne w England Biolabs ) for estimating band size following hybridization. 10. Dilute the plasmid containing the transgene and load 50 pg as a positive control. 11. Run the gel at 15 V over night ( 750 min ) in 0.5 TB E. Remove the gel from the electrophoresis and cut exc ess gel using a scalpel M easure the dimensions of the gel. 12. Stain the gel for one hour using freshly prepared ethidium bromide stain (0.05 g L 1 13. Wash the gel five times using de ionized water (DI H 2 O). 14. Visualize the gel on a g el documentation system to c heck complete digestion of all samples. Also measure and record the distance of the bands of the molecular weight marker from the top of the gel. 15. DNA transfer blotting alkaline transfer procedure 16. Prepare 500 mL 0. 1 25 N hydrochloric acid (HCl) and 3 L 0.4N sodium hydroxide (NaOH) solution per blot 17. Treat the gel with 0. 1 25 N HCl on a shaker with gentle shaking for 1 0 min for depurination. Wash the gel three times with DI H 2 O. 18. Cut three pieces of filter paper to match the size of the gel and two pieces for t he bridge (24 18 cm) Also cut a piece of the Hybond N + membrane (Amersham Biosciences, Piscataway, NJ ) to match the size of the gel. 19. Treat the gel with 0.4 N NaOH on a shaker with gentle shaking for 30 min. 20. Assemble the tray and the platform on which the blot is to b e set up. Place the filter paper bridg e on top of each other on the platform and fold them so that it dip s into the tray on both sides. 21. Pour 0.4 N NaOH on the bridge to wet it completely. Roll a glass rod over it several times to remove air bubbles. Pour m ore NaOH onto the bridge. 22. Place the gel in the center of the bridge, pour NaOH over it and remove air bubbles. 23. Mark the membrane to determine the orientation of the gel following blotting. 24. Wet the membrane using 0.4 N NaOH place the membrane on the gel; p our NaOH onto it and remove air bubbles. 25. Place three pieces of Whatman n filter paper on the membrane; remove air bubbles after placing each piece. Pour more NaOH over the top to avoid drying of the filter papers. 26. Place pieces of parafilm all around the gel to cover the bridge to ensure that the movement of the transfer buffer (0.4 N NaOH) takes place only through the gel. 27. Fill the tray with the transfer buffer to the top and cover the tray with Saran wrap to prevent evaporation of the buffer during blottin g. 28. Place a stack of absorbent paper towels on the gel and place another piece of plexi glass on top. On this, place a small weight ( ca. 750 g) to ensure uniform blotting and leave over night (16 18 h).

PAGE 87

87 29. Disassemble the blot Wrap the membrane in a cling fil m and expose it to UV for 2 min to fix the DNA on the membrane. Store the membrane in a zip loc bag at 4 C. 30. Visualize the gel using a gel documentation system to make sure the transfer was complete. 31. Follow the hybridization protocol described below. neutral transfer procedure, 2 0 SSC is used as transfer buffer in place of 0.4 N NaOH. Treatment of the gel includes 10 min depurination treatment with 0.125 N HCl, followed by 30 min treatment with denaturation buffer and 30 min treatment with neutralizat ion buffer. All other steps are same as described above. Hybridization using the Prime a Gene Labeling System (Promega ) 1. Check the radioactive working area for previous contamination before working. Thaw blocking DNA (sheared salmon sperm DNA), labeling buffer, dNTPs (dATP, dGTP, dTTP), BSA and probe on ice. Place [ 32P] dCTP behind the plexiglass shield to thaw. 2. Pre heat the hybridization oven and water bath to 65 C. Place the hybridization buffer in the water bath. 3. Roll the membrane and place it inside the hybridization tube. Add 50 mL 5 SSC to the tube and pre w et the membrane for 5 10 min. Make sure that there are no leaks. 4. Estimate the volume of probe required to get 25 ng of the probe and pipette it into a clean microcentrifuge tube. Make up the volume to 30 L using the nuclease free water provided with the l abeling kit. 5. Close the tube tightly and boil the probe for 5 min. Also boil 500 L of salmon sperm DNA in a separate tube. Place on ice for 5 min immediately after boiling. 6. Discard the 5 SSC into the sink and invert the hybridization tubes on a paper tissue to drain. 7. Prepare the dNTP mix by mixing equal parts of dTTP, dATP and dGTP. Prepare enough to use 2 L per labeling reaction. 8. Set up the labeling reaction as follows: 9. Add the followi ng to the denatured probe 5 labelling buffer 10 L Unlabeled dNTP mix 2 L BSA 2 L Klenow (5U/L ) 1 L Total volume 45 L 10. Move the mixture behind the plexiglass shield; add 5 L [ 32P] dCTP and mix well by pipetting. Final volume of the re action is 50 L 11. Incubate the mixture behind the plexiglass shield at room temperature for 4 h. 12. For pre hybridization, add 15 mL pre heated (65 C) hybridization buffer and 500 L denatured salmon sperm DNA in the hybridization tube. 13. Place the tubes in the hybridization oven and i ncubate at 65 C for 4 h. 14. Add 500 L salmon sperm DNA to the labeled probe and boil for 5 min behind the plexiglass shield.

PAGE 88

88 15. Discard the pre hybridization solution into the sink and drain the tube on a paper towel. 16. Just before the pro be is ready, add 8 mL pre heated hybridization buffer in the hybridi zation tube and move the tube behind the plexiglass shield. 17. Immediately after boiling, add the probe mixture to the hybridization tube. Take care to avoid any spills. 18. Place the hybridizati on tube in the hybridization oven and incubate over night at 65 C (18 h). 19. Prepare the wash solution (0.1 SSC + 0.1% SDS). Prepare enough to use 5 0 mL per wash for three washes per blot. 20. Heat the solution to 65 C using the water bath. 21. Remove hybridization tubes from the oven and place behind the plexiglass shield. 22. Working behind the plexiglass shield, dispose the hybridization solution into the hazardous waste container using a funnel taking care to avoid any spills. 23. Pour 70 mL pre heated wash solution (65 C) into the hybridization tube; replace the lid tightly and perform a quick wash by shaking the tube for a few seconds. 24. Dispose the wash solution into the hazardous waste container and add another 70 mL pre heated wash solution into the tube. 25. Place the tub es in the oven for 20 min. Work behind the plexiglass shield, dispose the wash solution into the hazardous waste container and add 70 mL preheated wash solution into the tube for the final wash. 26. Place the tube in the oven for 20 min. Remove the tubes from the oven and place them behind the plexiglass shield. Dispose the wash solution into the hazardous waste container and wrap the membrane in Saran wrap. 27. Check for radioactivity on the membrane using a Geiger counter. Also check the working area for any radi oactive contamination. 28. Place the membrane with an X ray film (Kodak) in an autoradiography cassette and allow 16 18 h for exposure depending on the intensity of the signal from the Geiger counter. Place t he cassette at 80 C during exposure Buffers and S olutions Stock Solutions Macro stock solution dd H 2 O 800 mL Ammonium Nitrate 16.5 g Potassium Nitrate 19.0 g Calcium Chloride dihydrate 4.4 g Magnesium Sulfate heptahydrate 3.7 g Potassium Phosphate, monobasic 1.7 g Mix all ingredients un der constant stirring. Bring final solution up to 1 Liter and store in bottle in refrigerator. Micro stock solution dd H 2 O 400 mL Potassium Iodide 0.0415 0 g

PAGE 89

89 Boric Acid 0.31 000 g Manganese Sulfate 0.64 000 g Zinc Sulfate heptahydrate 0.43 000 g Sodium Molybdate dihydrate 0.0125 0 g Cupric Sulfate pentahydrate 0.00125 g Cobalt Chloride hexahydrate 0.00125 g Mix all ingredients under constant stirring. Bring final solution up to 500 mL and store at 4 o C in refrigerator. Iron stock solution dd H 2 O 400 mL Na 2 EDTA 0.93 g FeSO 4 7H 2 O 0.65 g dd H 2 O Fill up to 500 mL Heat 400 mL dd H 2 O in beaker, but do not boil water. Add Na 2 EDTA to hot water under constant stirring. Once it dissolves, remove f rom heat before adding Ferrous s ulfate but continue s tirring. Bring final solution up to 500 mL and store in bottle wrapped in aluminum foil (to protect from light) in refrigerator. CuSO 4 (12.45 mg/ mL ) 0.6225g of CuSO 4 .5H 2 O dissolved in 50 mL ddH 2 O Store in aliquots at 20 C. Use 100 L per liter of media. B5G Vitamin Stock solution/filter sterilized: dd H 2 O 90 mL Nicotinic Acid 0.1 0 g Thiamine HC l 1.0 0 g Pyridoxine HC l 0.1 0 g Glycine 0.2 0 g Myo Inositol 10.0 g Bring final solution up to 100 mL Bring to clean bench and filter sterilize with s yringe into prepared sterile Eppendorf tubes. Freeze tubes in 20C freezer and only open them in clean bench when preparing media. Before adding to media thaw tube completely and vortex. P aromomycin sulfate ( 40 mg per mL ) Dissolve 0.4 g paromomycin sulp hate in 10 mL ddH 2 O. Filter sterilize and store in aliquots at 20 C Geneticin sulfate (30 mg per mL ) Dissolve 0.3 g Geneticin sulphate in 10 mL ddH 2 O. Filter sterilize and store in aliquots at 20 C Timentin (250 mg/ mL ) Dissolve 5g Timentin in 12 mL w ater. Make final volume to 20 mL Filter sterilize and store in aliquots at 20 C

PAGE 90

90 BAP (0.1 mg/ mL ) 0.0 0 25 1N NaOH. Make up to 25 mL with ddH 2 O S tore in aliquots at 20 C. Use 1 mL /L media. 2,4 D ichlorophenoxyacetic acid (3 mg / mL ) 0.15 g powder dissolved in 500 1N NaOH. Make up to 50 mL with ddH 2 O S tore in aliquots at 20 C. Use 1 mL /L media. p Chlorophenoxyacetic acid (1.86 mg/ mL ) 0.093 g powder dissolved in 1 mL 1N NaOH. Make up to 50 mL with ddH 2 O S tore in aliquots at 20 C. Use 1 mL /L media. 1 Napthaleneacetic acid (1.86 mg/ mL ) 0.093 g powder dissolved in 1 mL 1N NaOH. Make up to 50 mL with ddH 2 O S tore in aliquots at 20 C. Use 1 mL /L media. Media Indirect Embryogenesis Media (IEM) Pre Autoclave dd H O 400 mL Su crose 10 g Macro stock 50 mL Micro stock 5 mL Fe stock 10 mL 2,4 Dichlorophenoxyacetic acid stock 500 l CuSO 50 l dd H O Fill up to 500 mL pH Measurement 5.8 for each bottle Phytagel (Gelrite) 1.5 g per bottle Post Autoclave B5G Vit amin stock 500 l per bottle (Timentin stock 500 l per bottle) Direct Embryogene sis Media (DEM) (500 mL ) Pre Autoclave dd H O 400 mL Sucrose 10 g Macro Stock 50 mL Micro Stock 5 mL Fe Stock 10 mL CuSO 50 L NAA 500 L CPA 5 00 L BAP 45 L dd H O Fill up to 500 mL

PAGE 91

91 pH Measurement 5.8 for each bottle Phytagel (Gelrite) 1.5 g per bottle Post Autoclave B5G Vitamin Stock 500 L per bottle Osmotic Pretreatment for Particle Bombardment (500 mL ) Pre Autoclave dd H O 400 mL Sucrose 10 g Macro Stock 50 mL Micro Stock 5 mL Fe Stock 10 mL Phytohormone stock solution 500 l CuSO 50 L Sorbitol 36.44 g dd H O Fill up to 500 mL pH Measurement 5.8 for each bottle Phytagel (Gelrite) 1.5 g per bottle P ost Autoclave B5G Vitamin Stock 500 L per bottle (Timentin Stock 500 L per bottle) Regeneration Medium (500 mL ) Pre Autoclave dd H O 400 mL Sucrose 10 g Macro Stock 50 mL Micro Stock 5 mL Fe Stock 10 mL CuSO 50 L NAA 500 L BA P 500 L dd H O Fill up to 500 mL pH Measurement 5.8 for each bottle Phytagel (Gelrite) 1.5 g per bottle Post Autoclave B5G Vitamin Stock 500 L per bottle (Timentin Stock 500 L per bottle) Rooting Media (500 mL ) Pre Autoclave dd H O 400 m L Sucrose 10 .0 g Macro Stock 50 mL Micro Stock 5 mL Fe Stock 10 mL

PAGE 92

92 CuSO 50 l dd H O Fill up to 500 mL pH Measurement 5.8 for each bottle Phytagel (Gelrite) 1 .5 g per bottle Post Autoclave B5G Vitamin Stock 500 L per bottle (Timent in Stock 500 l per bottle) Buffers CTAB buffer (500 mL ) 1M Tris HCl 50 mL 0.5M Na 2 EDTA 20 mL NaCl 40.91 g CTAB 15.00 g Make up the volume to 500 mL with autoclave d, warm ddH 2 O 6x Loading dye (100 mL ) B romophenol blue 0.25% X ylene cy anol FF 0.25% Ficoll 15 .0 % Dissolve 15 g Ficoll in 60 mL ddH 2 O while stirring constantly. Add 20 mL ddH 2 O and warm the mixture. Add 0.25 g of both dyes, dissolve completely and make up volume to 100 mL with ddH 2 O. Autoclave fo r 20 min and st ore at room temperature. 5X TBE (1L) Tris base 54 .0 g B oric acid 27.5 g 0.5M EDTA (pH 8.0) 20 .0 mL Combine all components in ddH 2 O, make the final volume to 1000 mL A utoclave for 20 min. Use 0.5 TBE as running buffer. Hybridization Buffer (500 mL ) 1M Na 2 HPO 4 (pH 7.4) 125 mL 0.5M EDTA (pH 8.0) 1 .00 mL BSA 5.00 g 20% SDS 175 mL Make up the volume to 500 mL with ddH 2 O. S tore at 4 C. 1M Na 2 HPO 4 pH 7.4 (1L). Dissolve 142 g Na 2 HPO 4 in 800 mL dd H 2 0 Adjust the pH to 7.4 with phosphoric acid and m ake up the volume to 1L. 20 SSC, pH 7.0 (1 L) NaCl 175.3 g S odium citrate 88.2 g Dissolve in 800 mL ddH 2 O. Adjust pH to 7.0 with 1N HCl, make up the volume to 1 L and autoclave for 20 min.

PAGE 93

93 Depurination Buffer (0.125N HCl) conc HCl 11 mL dd H 2 0 898 mL Denturation Buffer NaCl 87.66 g NaOH 20 g Dissolve in 800 mL dd H 2 0 and make final volume to 1000 mL Neutralization Buffer NaCl 87.66 g Trizma base 60.5 g Dissolve in 800 mL dd H 2 0. Adjust pH to 7.5 with conc. HCl. Make final volume to 1 000 mL with dd H 2 0

PAGE 94

94 LIST OF REFERENCES Agharkar M, Lomba P, Altpeter F, Zhang H, Kenworthy K, Lange T (2007) Stable expression of AtGA2ox1 in a low input turfgrass ( Paspalum notatum Flugge) reduces bioactive gibberellin levels and improves turf quality u nder field conditions. Plant Biotechnol J 5: 791 801 Ahloowalia BS, Maretzki A (1983) Plant regeneration via somatic embryogenesis in sugarcane. Plant Cell Rep 2: 21 25 Alexander AG (1973) Sugarcane physiology: A comprehensive study of the Saccharum source to sink system. Elsevier, Amsterdam London New York Altpeter F, Baisakh N, Beachy R, Bock R, Capell T, Christou P, Daniell H, Datta K, Datta S, Dix PJ, Fauquet C, Huang N, Kohli A, Mooibroek H, Nicholson L, Nguyen TT, Nugent G, Raemakers K, Romano A, Some rs DA, Stoger E, Taylor N, Visser R (2005) Particle bombardment and the genetic enhancement of crops: M yths and realities. Mol Breeding 15: 305 327 Altpeter F, Oraby H (2010) Sugarcane. In: K empken F, Jung C (eds) Genetic modification of p lants. Springer Berlin, pp 453 472 Altpe ter F, Sandhu S (2010) Genetic t ransformation Biolistics. In: Davey MR, Anthony P (eds) Plant cell c ulture: e ssential methods. John Wiley & Sons Ltd Chichester, pp 217 239 Altpeter F, Vasil V, Srivastava V, Stger E, Vasil IK (1 996) Accelerated production of transgenic wheat ( Triticum aestivum L.) plants. Plant Cell Rep 16: 12 17 Altpeter F, Xu J, Ahmed S (2000) Generation of large numbers of independently transformed fertile perennial ryegrass ( Lolium perenne L.) plants of forag e and turf type cultivars. Mol Breeding 6: 519 528 Arencibia A, Carmona ER, Cornide MT, Castiglione S, O'Relly J, Chinea A, Oramas P, Sala F (1999) Somaclonal variation in insect resistant transgenic sugarcane ( Saccharum hybrid) plants produced by cell ele ctroporation. Transgenic Res 8: 349 360 Arencibia A, Molina P, de la Riva G, Selman Housein G (1995) Production of transgenic sugarcane ( Saccharum officinarum L.) plants by intact cell electroporat ion. Plant Cell Rep 14: 305 309 Arencibia A, Molina P, Guti errez C, Fuentes A, Greenidge V, Menendez E, De La Riva G, Selman Houssein G (1992) Regeneration of transgenic sugarcane ( Saccharum officinarum L.) plants from intact meristematic tissue transformed by electroporation. Biotecnologia Aplicada 9: 156 165

PAGE 95

95 Are ncibia A, Vazquez RI, Prieto D, Tallez P, Carmona ER, Coego A, Hernandez L, De la Riva GA, Selman Housein G (1997) Transgenic sugarcane plants resistant to stem borer attack. Mol Breeding 3: 247 255 Arencibia AD, Carmona ER, Tellez P, Chan MT, Yu SM, Truji llo LE, Oramas P (1998) An efficient protocol for sugarcane ( Saccharum spp. L.) transformation mediated by Agrobacterium tumefaciens Transgenic Res 7: 213 222 Bailey R, Bechet G (19 89 ) A comparison of seedcane derived from tissue culture with conventional seedcane Proc S Afr Sug ar Tech nol Ass oc 63 : 125 129 Bajay SV (2011) Food, fuels, electricity and materials from sugarcane in Brazil: costs, benefits and challenges. Int J Environ Stud 68: 145 159 Barba R, Nickell LG (1969) Nutrition and organ differentia tion in tissue cultures of sugarcane, a monocotyledon. Planta 89: 299 302 Basnayake SWV, Morgan TC, Wu L, Birch RG (2011) Field performance of transgenic sugarcane expressing isomaltulose synthase. Plant Biotechnol J. doi: 10.1111/j.1467 7652.2011.00655.x Basnayake SWV, Moyle R, Birch RG (2011) Embryogenic callus proliferation and regeneration conditions for genetic transformation of diverse sugarcane cultivars. Plant Cell Rep 30: 439 448 Bhat SR, Gill SS (1985) The implications of 2n egg gametes in nobiliz ation and breeding of sugarcane. Euphytica 34: 377 384 Bielig LM, Mariani A, Berding N (2003) Cytological studies of 2n male gamete formation in sugarcane, Saccharum L. Euphytica 133: 117 124 Biradar S (2008) Development and evaluation of synthetic seed in sugarcane. Thesis, Unive rsity of Agricultural Sciences Dharwad Birch RG (1997) Plant transfo rmation: p roblems and strategies for practical application. Annu Rev Plant Physiol Plant Molec Biol 48: 297 326 Blume H (1985) Geography of sugar cane : environmen tal, structural and economical aspects of cane sugar production. Verlag Dr. Albert Bartens, Berlin Bonnett G, Nowak E, Olivares Villegas J, Berding N, Morgan T, Aitken K (2008) Identifying the risks of transgene escape from sugarcane crops to related speci es, with particular reference to Saccharum spontaneum in Australia. Trop Plant Biol 1: 58 71 Bower R, Birch RG (1992) Transgenic sugarcane plants via microprojectile bombardment. Plant J 2: 409 416

PAGE 96

96 Bower R, Elliott AR, Potier BAM, Birch RG (1996) High effi ciency, microprojectile mediated cotransformation of sugarcane, using visible or selectable markers. Mol Breeding 2: 239 249 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem 72: 248 254 Bregitzer P, Dahleen LS, Neate S, Schwarz P, Manoharan M (2008) A single backcross effectively eliminates agronomic and quality alterations caused by somaclonal variation in transgenic barley. Crop Sci 48: 471 479 Breitler JC, Labeyrie A, Meynard D, Legavre T, Guiderdoni E (2002) Efficient microprojectile bombardment mediated transformation of rice using gene cassettes. Theor Appl Genet 104: 709 719 Brisibe EA, Miyake H, Taniguchi T, Maeda E (1994) Regulation of somatic embryogenesis in long term callus cultures of sugarcane ( Saccharum officinarum L.). New Phytol 126: 301 307 Burner DM (1997) Chromosome transmission and meiotic behavior in various sugarcane crosses. J Am Soc Sug ar Technol 17: 38 50 Burner DM, Gri sham MP (1995) Induction and stability of phenotypic variation in sugarcane as affected by propagation procedure. Crop Sci 35: 875 880 Burner DM, Legendre BL (1994) Cytogenetic and fertility characteristics of eli te sugarcane clones. Sugar Cane 1994(1): 6 10 Butterfield MK, Thomas DW (1996.) Sucrose, yield and disease resistance characteristics of sugarcane varieties under test in the SASEX selection programme. Proc S Afr Sug ar Tech nol Ass oc 70: 103 105 Carmona ER, Arencibia AD, Lopez J, Simpson J, Vargas D, Sala F (2005) Analysis of genomic variability in transgenic sugarcane plants produced by Agrobacterium tumefaciens infection. Plant Breeding 124: 33 38 Cheavegatti Gianotto A, de Abreu H, Arruda P, Bespalhok Filho J, Burnquist W, Creste S, di Ciero L, F erro J, de Oliveira Figueira AV, de Sousa Filgueiras T, Grossi de S MdF, Guzzo E, Hoffmann H, de Andrade Landell M, Macedo N, Matsuoka S, de Castro Reinach F, Romano E, da Silva W, de Castro Silva Filho M, Caesar Ulian E (2011) Sugarcane ( Saccharum X offi cinarum ): A reference study for the regulation of genetically modified cultivars in Brazil. Trop Plant Biol 4: 62 89 Chen WH, Davey MR, Power JB, Cocking EC (1988) Control and maintenance of plant regeneration in sugarcane callus cultures. J Exp Bot 39: 25 1 261

PAGE 97

97 Chen WH, Gartland KMA, Davey MR, Sotak R, Gartland JS, Mulligan BJ, Power JB, Cocking EC (1987) Transformation of sugarcane protoplasts by direct uptake of a selectable chimeric gene. Plant Cell Rep 6: 297 301 Chengalrayan K, Abouzid A, Gallo Meacher M (2005) In vitro regeneration of plants from sugarcane seed derived callus. In Vitro Cell Dev Biol Pl ant 41: 477 482 Chengalrayan K, Gallo Meagher M (2001) Effect of various growth regulators on shoot regeneration of sugarcane. In Vitro Cell Dev Biol Pl a nt 37: 434 439 Chong BF, Bonnett GD, Glassop D, O'Shea MG, Brumbley SM (2007) Growth and metabolism in sugarcane are altered by the creation of a new hexose phosphate sink. Plant Biotechnol J 5: 240 253 Chowdhury MKU, Vasil IK (1992) Stably transformed her bicide resistant callus of sugarcane via microprojectile bombardment of cell suspension cultures and electroporation of protoplasts. Plant Cell Rep 11: 494 498 Christou P, Ford T (1995) Parameters influencing stable transformation of rice immature embryos and recovery of transgenic plants using electric discharge particle acceleration. Ann Bot 75: 407 413 Christy L, Arvinth S, Saravanakumar M, Kanchana M, Mukunthan N, Srikanth J, Thomas G, Subramonian N (2009) Engineering sugarcane cultivars with bovine pan creatic trypsin inhibitor (aprotinin) gene for protection against top borer ( Scirpophaga excerptalis Walker). Plant Cell Rep 28: 175 184 Clark AJ, Harold G, Yull FE (1997) Mammalian cDNA and prokaryotic reporter sequences silence adjacent transgenes in tra nsgenic mice. Nucleic Acids Res 25: 1009 1014 CONAB (2009) Cana de acar primeiro levantamento s afra. Compa nhia Nacional de Abastecimento. http://www.conab.gov.br/ Accessed 30 October 2011 Dal Bianco M, Carneiro MS, Hotta CT, Chapola RG, Hoffmann HP, Garcia AAF, Souza GM (2011) Sugarcane improvement: how far can we go? Curr Opin Biotech doi: 10.1016/j.copbio.2011.09.002 Dante RA Cristofoletti PT, Gerhardt IR (2010) Engineering advantages, challenges and status of sugarcane and other sugar based biomass resources In: Mascia PN, Scheffran J, Widholm JM (eds) Plant biotechnology for sustainable production of energy and c o products. Springer Berlin pp 87 109 de Araujo PG, Rossi M, de Jesus EM, Saccaro NL, Kajihar a D, Massa R, de Felix JM, Drummond RD, Falco MC, Chabregas SM, Ulian EC, Menossi M, Sluys M AV (2005) Transcriptionally active transposable elements in recent hybrid sugarcane. Plant J 44: 707 717

PAGE 98

98 de los Blanco M, Nieves N, Sanchez M, Borroto C, Castillo R, Gonzalez J, Escalona M, Baez E, Hernandez Z (1997) Protein changes associated with plant regeneration in embryogenic calli of sugarcane ( Saccharum sp.). Plant Cell Tiss Org 51: 153 158 Desai NS, Suprasanna P, Bapat VA (2004) Simple and reproducible prot ocol for direct somatic embryogenesis from cultured immature inflorescence segments of sugarcane ( Saccharum spp.). Curr Sci 87: 764 768 Elliott AR, Campbell JA, Brettell RIS, Grof CPL (1998) Agrobacterium mediated transformation of sugarcane using GFP as a screenable marker. Funct Plant Biol 25: 739 743 Enriquez Obregon GA, Vazquez Padron RI, Prieto Samsonov DL, De la Riva GA, Selman Housein G (1998) Herbicide resistant sugarcane ( Saccharum officinarum L.) plants by Agrobacterium mediated transformation. Pl anta 206: 20 27 EPA (2011) Renewable fuel s tandard. United States Environmental Protection Agency. http://www.epa.gov/otaq/fuels/renewablefuels/index.htm Accessed 30 October 2011 Fal co MC, Tulmann Neto A, Ulian EC (2000) Transformation and expression of a gene for herbicide resistance in a Brazilian sugarcane. Plant Cell Rep 19: 1188 1194 FAO (2009) Food and agricultural commodities production. Food and Agriculture Organization. http://faostat.fao.org/site/567/DesktopDefault.aspx?PageID=567#ancor Accessed 15 June 2009 FAO (2011) Food and agricultural commodities production. Food and Agriculture O rganization. http://faostat.fao.org/site/567/DesktopDefault.aspx?PageID=567#ancor Accessed 30 October 2011 Fitch MMM, Moore PH (1990) Comparison of 2,4 D and picloram fo r selection of long term totipotent green callus cultures of sugarcane. Plant Cell Tiss Org 20: 157 163 Fitch MMM, Moore PH (1993) Long term culture of embryogenic sugarcane callus. Plant Cell Tiss Org 32: 335 343 Frame B, Zhang H, Cocciolone S, Sidorenko L, Dietrich C, Pegg S, Zhen S, Schnable P, Wang K (2000) Production of transgenic maize from bombarded type II callus: Effect of gold particle size and callus morphology on transformation efficiency. In Vitro Cell Dev Biol Pl ant 36: 21 29 Franklin G, Arvin th S, Sheeba C, Kanchana M, Subramonian N (2006) Auxin pretreatment promotes regeneration of sugarcane ( Saccharum spp. hybrids) midrib segment explants. Plant Growth Regulation 50: 111 119

PAGE 99

99 Franks T, Birch R (1991) Gene transfer into intact sugarcane cells using microprojectile bombardment. Funct Plant Biol 18: 471 480 Fu X, Duc LT, Fontana S, Bong BB, Tinjuangjun P, Sudhakar D, Twyman RM, Christou P, Kohli A (2000) Linear transgene constructs lacking vector backbone sequences generate low copy number transg enic plants with simple integration patterns. Transgenic Res 9: 11 19 Fukui K (1983) Sequential occurrence of mutations in a growing rice callus. Theor Appl Genet 65: 225 230 Gallo Meagher M, English R, Abouzid A (2000) Thidiazuron stimulates shoot regener ation of sugarcane embryogenic callus. In Vitro Cell Dev Biol Pl ant 36: 37 40 Gallo Meagher M, Irvine JE (1993) Effects of tissue type and promoter strength on transient GUS expression in sugarcane following particle bombardment. Plant Cell Rep 12: 666 670 Gallo Meagher M, Irvine JE (1996) Herbicide resistant transgenic sugarcane plants containing the bar gene. Crop Sci 36: 1367 1374 Gambley R, Bryant J, Masel N, Smith G (1994) Cytokinin enhanced regeneration of plants from microprojectile bombarded sugarca ne meristematic tissue. Funct Plant Biol 21: 603 612 Gamborg OL, Miller RA, Ojima K (1968) Nutrient requirements of suspension cultures of soybean root cells. Exp Cell Res 50: 151 158 Garcia R, Cidade D, Castellar A, Lips A, Magioli C, Callado C, Mansur E (2007) In vitro morphogenesis patterns from shoot apices of sugar cane are determined by light and type of growth regulator. Plant Cell Tiss Org 90: 181 190 Gilbert RA, Gallo Meagher M, Comstock JC, Miller JD, Jain M, Abouzid A (2005) Agronomic evaluation of sugarcane lines transformed for r esistance to strain E. Crop Sci 45: 2060 2067 Gilbert RA, Glynn NC, Comstock JC, Davis MJ (2009) Agronomic performance and genetic characterization of sugarcane transformed for resistance to sugarcane yellow leaf virus. Field Crop Res 111: 39 46 Gnanapragasam S, Vasil IK (1990) Plant regeneration from a cryopreserved embryogenic cell suspension of a commercial sugarcane hybrid ( Saccharum sp.). Plant Cell Rep 9: 419 423 Goldner W, Thom M, Maretzki A (1991) Sucrose metaboli sm in sugarcane cell suspension cultures. Plant Science 73: 143 147

PAGE 100

100 Gonzalez Arnao MT, Urra C, Engelmann F, Ortiz R, de la Fe C (1999) Cryopreservation of encapsulated sugarcane apices: E ffect of storage temperature and storage duration. Cryo Lett 20: 347 352 Govender C (2008) Stem specific promoters from sorghum and maize for use in sugarcane. Dissertation, University of Stelle nbosch Grisham MP, Bourg D (1989) Efficiency of in vitro propagation of sugarcane plants by direct regeneration from leaf tissue an d by shoot tip culture. J Am Soc Sug ar Technol 9: 97 102 Grivet L, Arruda P (2002) Sugarcane genomics: depicting the complex genome of an important tropical crop. Curr Opin Plant Biol 5: 122 127 Groenewald J H, Botha F (2008) Down regulation of pyrophospha te: fructose 6 phosphate 1 phosphotransferase (PFP) activity in sugarcane enhances sucrose accumulation in immature internodes. Transgenic Res 17: 85 92 Hamerli D, Birch RG (2010) Transgenic expression of trehalulose synthase results in high concentrations of the sucrose isomer trehalulose in mature stems of field grown sugarcane. Plant Biotechnol J 9: 32 37 Hammond SM, Caudy AA, Hannon GJ (2001) Post transcriptional gene silencing by double stranded RNA. Nat Rev Genet 2: 110 119 Hancock REW (1981) Aminogly coside uptake and mode of action with special reference to streptomycin and gentamicin. J Antimicrob Chemoth 8: 429 445 Harrison MD, Geijskes J, Coleman HD, Shand K, Kinkema M, Palupe A, Hassall R, Sainz M, Lloyd R, Miles S, Dale JL (2011) Accumulation of recombinant cellobiohydrolase and endoglucanase in the leaves of mature transgenic sugar cane. Plant Biotechnol J. doi: 10.1111/j.1467 7652.2011.00597.x Heinz DJ (1987) Sugarcane improvement through breeding. Elsevier, Amsterdam Heinz DJ, Mee GWP (1970) Co lchicine induced polyploids from cell suspension c ultures of Sugarcane1. Crop Sci 10: 696 699 Heinz DJ, Mee GWP (1971) Morphologic, cytogenetic, and enzymatic variation in Saccharum species hybrid clones derived from callus tissue Am J Bot 58: 257 262 Hei nz DJ, Mee GWP, Nickell LG (1969) Chromosome numbers of some Saccharum species hybrids and their cell suspension cultures Am J Bot 56: 450 456 Hendre RR, Iyer RS, Kotwal M, Khuspe SS, Mascarenhas AF (1983) Rapid multiplication of sugarcane by tissue cultu re. Sugarcane May/June: 5 8

PAGE 101

101 Ho W J, Vasil IK (1983) Somatic embryogenesis in sugarcane ( Saccharum officinarum L.) I. The morphology and physiology of callus formation and the ontogeny of somatic embryos. Protoplasma 118: 169 180 Hotta C, Lembke C, Domingue s D, Ochoa E, Cruz G, Melotto Passarin D, Marconi T, Santos M, Mollinari M, Margarido G, Crivellari A, dos Santos W, de Souza A, Hoshino A, Carrer H, Souza A, Garcia A, Buckeridge M, Menossi M, Van Sluys M A, Souza G (2010) The biotechnology roadmap for su garcane improvement. Trop Plant Biol 3: 75 87 Howe A, Sato S, Dweikat I, Fromm M, Clemente T (2006) Rapid and reproducible Agrobacterium mediated transformation of sorghum. Plant Cell Rep 25: 784 791 Hoy JW, Bischoff KP, Milligan SB, Gravois KA (2003) Effe ct of tissue culture explant source on sugarcane yield components. Euphytica 129: 237 240 Huang X, Huang X L, Xiao W, Zhao J T, Dai X M, Chen Y F, Li X J (2007) Highly efficient Agrobacterium mediated transformation of embryogenic cell suspensions of Musa acuminata cv. Mas (AA) via a liquid co cultivation system. Plant Cell Rep 26: 1755 1762 Ingelbrecht IL, Irvine JE, Mirkov TE (1999) Posttranscriptional gene silencing in transgenic sugarcane. Dissection of homology dependent virus resistance in a monocot t hat has a complex polyploid genome. Plant Physiol. 119: 1187 1197 Irvine J, Benda G (1987) Transmission of sugar cane diseases in plants derived by rapid regeneration from diseased leaf tissue. Sugar Cane 6: 14 16 Jackson PA (2005) Breeding for improved su gar content in sugarcane. Field Crop Res 92: 277 290 Jain M, Chengalrayan K, Abouzid A, Gallo M (2007) Prospecting the utility of a PMI/mannose selection system for the recovery of transgenic sugarcane ( Saccharum spp. hybrid) plants. Plant Cell Rep 26: 581 590 Jain R, Srivastava S, Singh J, Gupta P (2005) Assessment of genetic purity of micropropagated plants of sugarcane by isozyme and RAPD analysis. Sugar Tech 7: 15 19 Jakob K, Zhou F, Paterson A (2009) Genetic improvement of C4 grasses as cellulosic biof uel feedstocks. In Vitro Cell Dev Biol Pl ant 45: 291 305 Jakowitsch J, Papp I, Moscone Eduardo A, Van Der Winden J, Matzke M, Matzke Antonius JM (1999) Molecular and cytogenetic characterization of a transgene locus that induces silencing and methylation o f homolo gous promoters intrans. Plant J 17: 131 140

PAGE 102

102 Jalaja S, Sreenivasan TV, Alexander KC (1987) Somaclonal variation for rust resistance in sugarcane. Indian J Genet Pl Br 47 Jame s G (2007) Sugarcane. Blackwell, Oxford James NI (1969) Delayed flowering a nd pollen production in male sterile sugarcane subjected to extended day length. Crop Sci 9: 279 282 Jannoo N, Grivet L, David J, D'Hont A, Glaszmann JC (2004) Differential chromosome pairing affinities at meiosis in polyploid sugarcane revealed by molecul ar markers. Heredity 93: 460 467 Jayaraj J, Liang G, Muthukrishnan S, Punja Z (2008) Generation of low copy number and stably expressing transgenic creeping bentgrass plants using minimal gene cassette bombardment. Biol Plantarum 52: 215 221 Jeffreys AJ, F globin gene. Cell 12: 429 439 Joshi S (2009) Molecular improvement for fall armyworm resistance in sugarcane, TifEagle and Tifton 85. Dissertation, University of Florida Joyce PA, McQ ualter RB, Bernard MJ, Smith GR (1998) Engineering for resistance to SCMV in sugarcane. Acta Hort 46: 385 391 Kaeppler SM, Kaeppler HF, Rhee Y (2000) Epigenetic aspects of somaclonal variation in plants. Plant Mol Biol 43: 179 188 Kausch AP, Adams TR, Mang ano M, Zachwieja SJ, Gordon Kamm W, Daines R, Willetts NG, Chambers SA, Adams W, Anderson A, Williams G, Haines G (1995) Effects of microprojectile bombardment on embryogenic suspension cell cultures of maize ( Zea mays L.) used for genetic transformation. Planta 196: 501 509 Kihara M, Saeki K, Ito K (1998) Rapid production of fertile transgenic barley ( Hordeum vulgare L.) by direct gene transfer to primary callus derived protoplasts. Plant Cell Rep 17: 937 940 Kim JY, Gallo M, Altpeter F (2011) Analysis of transgene integration and expression following biolistic transfer of different quantities of minimal expression cassette into sugarcane ( Saccharum spp. hybrids). Plant Cell Tiss Org doi: 10.1007/s11240 011 0043 3 Klein TM, Jones T (1999) Methods of genetic transformation: The Gene Gun. In: Vasil IK (ed) Molecular improvement of cereal crops. Kluwer Academic Publishers, The Netherlands, pp 21 42

PAGE 103

103 Kohli A, Griffiths S, Palacios N, Twyman Richard M, Vain P, Laurie DA, Christou P (1999) Molecular characterizatio n of transforming plasmid rearrangements in transgenic rice reveals a recombination hotspot in the CaMV 35S promoter and confirms the predominance of microhomology mediated recombination. Plant J 17: 591 601 Krishnamurthi M (1976) Isolation, fusion and mul tiplication of sugarcane protoplasts and comparison of sexual and parasexual hybridization. Euphytica 25: 145 150 Lakshmanan P, Geijskes R, Wang L, Elliott A, Grof C, Berding N, Smith G (2006) Developmental and hormonal regulation of direct shoot organogen esis and somatic embryogenesis in sugarcane ( Saccharum spp. interspecific hybrids) leaf culture. Plant Cell Rep 25: 1007 1015 Lal M, Singh R, Srivastava S, Singh N, Singh S, Sharma M (2008) RAPD marker based analysis of micropropagated plantlets of sugarca ne for early evaluation of genetic fidelity. Sugar Tech 10: 99 103 Larkin P (1981) Sugarcane tissue and protoplast culture. Plant Cell Tiss Org 1: 149 164 Larkin P, Scowcroft W (1981) Somaclonal variation a novel source of variability from cell cultures f or plant improvement. Theor Appl Genet 60: 197 214 Larki n PJ, Scowcroft WR (1983) Somacl onal variation and eyespot toxin tolerance in sugarcane. Plant Cell Tiss Org 2: 111 121 Leal MR, Maribona RH, Ruiz A, Korneva S, Canales E, Dinkova TD, Izquierdo F, Got o O, Rizo D (1996) Somaclonal variation as a source of resistance to eyespot disease of sugarcane. Plant Breeding 115: 37 42 Lee TSG (1987) Micropropagation of sugarcane ( Saccharum spp.). Pl ant Cell Tiss Org 10: 47 55 Leibbrandt NB, Snyman SJ (2003) Stabil ity of gene expression and agronomic performance of a transgenic herbicide resistant sugarcane line in South Africa. Crop Sci 43: 671 677 Lesley SM, Maretzki A, Nickell LG (1980) Incorporation and degradation of 14 C and H labeled thymidine by sugarcane ce lls in su spension culture. Plant Physiol 65: 1224 1228 Lima MLA, Garcia AAF, Oliveira KM, Matsuoka S, Arizono H, de Souza Jr CL, de Souza AP (2002) Analysis of genetic similarity detected by AFLP and coefficient of parentage among genotypes of sugar cane ( Saccharum spp.). Theor Appl Genet 104: 30 38

PAGE 104

104 Libiakova G, Jorgensen B, Palmgren G, Ulvskov P, Johansen E (2001) Efficacy of an intron containing kanamycin resistance gene as a selectable marker in plant transformation. Plant Cell Rep 20: 610 615 Liu MC (1 984) Sugarcane. In: Sharp WH, Evans DA, Ammirato PV, Yamada Y (eds) Handbook of plant cell culture Macmillan, New York, pp 572 605 Liu MC (1993) Factors affecting induction, somatic embryogenesis and plant regeneration of callus from cultured immatu re inf lorescences of sugarcane. J Plant Physiol 141: 714 720 Liu MC, Shang KC, Chen WH, Shih SC (1977) Tissue and cell culture as aids to sugarcane breeding. III. Aneuploid cells and plants induced by treatment of cell suspensio n culture with colchicine. Proc Co ngr Int Soc Sugar Cane Technol (Brazil) 16: 1 13 Lorenzo J, Ojeda E, Espinosa A, Borroto C (2001) Field performance of temporary immersion bioreactor derived sugarcane plants. In Vitro Cell Dev Biol Pl ant 37: 803 806 Lourens AG, Martin FA (1987) Evaluation of in vitro propagated sugarcane hybrids for somaclonal variation. Crop Sci 27: 793 796 Lowe B, Shiva Prakash N, Way M, Mann M, Spencer T, Boddupalli R (2009) Enhanced single copy integration events in corn via particle bombardment using low quantities of DNA. Transgenic Res 18: 831 840 Manickavasagam M, Ganapathi A, Anbazhagan VR, Sudhakar B, Selvaraj N, Vasudevan A, Kasthurirengan S (2004) Agrobacterium mediated genetic transformation and development of herbicide resistant sugarcane ( Saccharum species hy brids) using axillary buds. Plant Cell Rep 23: 134 143 Mann D, King Z, Liu W, Joyce B, Percifield R, Hawkins J, LaFayette P, Artelt B, Burris J, Mazarei M, Bennetzen J, Parrott W, Stewart C (2011) Switchgrass ( Panicum virgatum L.) polyubiquitin gene ( PvUbi 1 and PvUbi2 ) promoters for use in plant transformation. BMC Biotechnol 11: 74 Manners J, Casu R (2011) Transcriptome analysis and functional genomics of sugarcane. Trop Plant Biol 4: 9 21 Maretzki A (1987) Tissue culture: its prospects and proble ms. In: H einz D (ed) Sugarcane i mprovement through breeding. Elsevier, Amsterdam pp 343 384 Maretzki A, Thom M, Nickell LG (1969) Products of arginine catabolism in growing cells of sugarcane. Phytochemistry 8: 811 818

PAGE 105

105 McQualter RB, Chong BF, Meyer K, Van Dyk DE, O'Shea MG, Walton NJ, Viitanen PV, Brumbley SM (2005) Initial evaluation of sugarcane as a production platform for p hydroxybenzoic acid. Plant Biotechnol J 3: 29 41 McQualter RB, Dale JL, Harding RM, McMahon JA, Smith GR (2004) Production and evaluat ion of transgenic sugarcane containing a Fiji disease virus (FDV) genome segment S9 derived synthetic resistance gene. Aust J Agr Res 55: 139 145 Midmore DJ (1980) Effects of photoperiod on flowering and fertility of sugarcane ( Saccharum spp.). Field Crop Res 3: 65 81 Molinari HBC, Marur CJ, Daros E, De Campos MKF, De Carvalho JFRP, Filho JCB, Pereira LFP, Vieira LGE (2007) Evaluation of the stress inducible production of proline in transgenic sugarcane ( Saccharum spp.): osmotic adjustment, chlorophyll fluo rescence and oxidative stress. Physiol Plantarum 130: 218 229 Moore P (1995) Temporal and spatial regulation of sucrose accumulation in the sugarcane stem. Funct Plant Biol 22: 661 679 Mordocco A, Brumbley J, Lakshmanan P (2009) Development of a temporary immersion system (RITA) for mass production of sugarcane ( Saccharum spp. interspecific hybrids). In Vitro Cell Dev Biol Pl ant 45: 450 457 Murashige T, Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Pl antarum 15: 473 497 Nadar HM, Heinz DJ (1977) Root and shoot development from sugarcane callus tissue. Crop Sci. 17: 814 816 NASS (2011) Crop p roduction a nnual summary. National Agricultural Statistics Service. http://usda.mannlib.cornell.edu/MannUsda/viewDocumentInfo.do?documentID=10 47 Accessed 30 October 2011 Nickell LG, Maretzki A (1969) Growth of suspension cultures of sugarcane cells in chemically defined med ia. Physiol Plantarum 22: 117 125 Nickell LG, Maretzki A (1970) The utilization of sugars and starch as carbon sources by sugarcane cell suspension cultures. Plant and Cell Physiology 11: 183 185 Nieves N, Zambrano Y, Tapia R, Cid M, Pina D, Castillo R (20 03) Field performance of artificial seed derived sugarcane plants. Plant Cell Tiss Org 75: 279 282 OGTR (2007) Limited and controlled release of sugarcane genetically modified for altered sugar production Office of the Gene Technology Regulator. http://www.ogtr.gov.au/internet/ogtr/publishing.nsf/Content/DIR078 2007 Accessed 30 October 2011

PAGE 106

106 Oropeza M, Guevara P, de Garcia E, Ramirez J (1995) Identification of somaclon al variants of sugarcane ( Saccharum spp.) resistant to sugarcane mosaic virus via RAPD markers. Plant Mol Biol Rep 13: 182 191 Padilla I, Burgos L (2010) Aminoglycoside antibiotics: structure, functions and effects on in vitro plant culture and genetic tra nsformation protocols. Plant Cell Rep 29: 1203 1213 Paturau J (1986) Alternative uses of sugarcane and its byproducts in agroindustries. In: Sansoucy R, Aarts G, Preston TR (eds) Sugarcane as feed, FAO Expert Consultation, Santo Domingo Paulet F, Engelmann F, Glaszmann J C (1993) Cryopreservation of apices of in vitro plantlets of sugarcane ( Saccharum sp. hybrids) using encapsulation/dehydration. Plant Cell Rep 12: 525 529 Petrasovits LA, Purnell MP, Nielsen LK, Brumbley SM (2007) Production of polyhydroxyb utyrate in sugarcane. Plant Biotechnol J 5: 162 172 Piperidis G, Piperidis N, Hont A (2010) Molecular cytogenetic investigation of chromosome composition and transmission in sugarcane. Mol Genet Genomics 284: 65 73 Plasterk RHA, Ketting RF (2000) The silen ce of the genes. Curr Opin Genet Dev 10: 562 567 Pompermayer P, Falco MC, Parra JRP, Silva Filho MC (2003) Coupling diet quality and Bowman Birk and Kunitz type soybean proteinase inhibitor effectiveness to Diatraea saccharalis development and mortality. E ntomol Exp Appl 109: 217 224 Porebski S, Bailey L, Baum B (1997) Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Mol Biol Rep 15: 8 15 Ranalli P, Candilo MD (2007) Genetic improvemen t of crops for energy generation: comparison of different provision chains with respect to biomass and biofuel production. In: Ranalli P (ed) Improvement of Crop Plants for Industrial End Uses Springer Netherlands, pp 307 334 Randolph Anderson B, Boynto n JE, Dawson J (1995) Sub micron gold particles are superior to larger particles for efficient biolistic transformation of organelles and some cell types. Bio rad Literature On Line. www.bio rad.com/44684.h tml Rathus C, Birch RG (1992) Stable transformation of callus from electroporated sugarcane protoplasts. Plant Science 82: 81 89

PAGE 107

107 Rathus C, Bower R, Birch RG (1993) Effects of promoter, intron and enhancer elements on transient gene expression in sugar ca ne and carrot protoplasts. Plant Mol Biol 23: 613 618 Rice R, Baucum L, Glaz B (2009) Sugarcane variety census Florida 2008. Sugar J 72: 6 12 Romano A, Raemakers K, Bernardi J, Visser R, Mooibroek H (2003) Transgene organisation in potato after particle bombardment mediated (co )transformation using plasmids and gene cassettes. Transgenic Res 12: 461 473 Rossouw D, Kossmann J, Botha FC, Groenewald J (2010) Reduced neutral invertase activity in the culm tissues of transgenic sugarcane plants results in a d ecrease in respiration and sucrose cycling and an increase in the sucrose to hexose ratio. Funct Plant Biol 37: 22 31 Sandhu S, Altpeter F (2008) Co integration, co expression and inheritance of unlinked minimal transgene expression cassettes in an apomict ic turf and forage grass ( Paspalum notatum Flugge). Plant Cell Rep 27: 1755 1765 Sauvaire D, Galzy R (1978) Multiplication vgtative de canne sucre ( Saccharum sp.) par bouturage in vitro CR Acad Sc Paris Srie D: 467 470 Schmitt F, Oakeley EJ, Jost JP (1997) Antibiotics induce genome wide hypermethylation in cultured Nicotiana tabacum plants. J Biol Chem 272: 1534 1540 Schueneman TJ, Miller JD, Gilbert RA, Harrison NL (2008) Sugarcane cultivar CP 88 1762 descriptive fact sheet. In: Rice R (ed) Florida s ugarcane handbook. University of Florida, Gainesville http://edis.ifas.ufl.edu/sc054 Setamou M, Bernal JS, Legaspi JC, Mirkov TE, Legaspi BC (2002) Evaluation of lectin expressing transgenic sugarcane agains t stalkborers (lepidoptera: pyralidae): effects on life history parameters. J Econ Entomol 95: 469 477 Simmonds NW (1976) Sugarcane. In: Simmonds NW (ed) Evolution o f crop plants. Longmans, London pp 104 108 Singh BD (1976) Comparison of cytogenic effects of IAA, NAA and 2,4 D in callus cultures of Haplopappus gracilis (N utt) Gray. Indian J Exp Biol 14 : 524 526 Singh G, Sandhu S, Meeta M, Singh K, Gill R, Gosal S (2008) In vitro induction and characterization of somaclonal variation for red rot and other a gronomic traits in sugarcane. Euphytica 160: 35 47 Sleper DA, Poehlman JM (2006) Breeding field crops. Blackwell, Ames

PAGE 108

108 Snyman S, Meyer G, Richards J, Haricharan N, Ramgareeb S, Huckett B (2006) Refining the application of direct embryogenesis in sugarcane: effect of the developmental phase of leaf disc explants and the timing of DNA transfer on transformation efficiency. Plant Cell Rep 25: 1016 1023 Snyman S, Watt M, Huckett B, Botha F (2000) Direct somatic embryogenesis for rapid, cost effective production of transgenic sugarcane ( Saccharum spp. hybrids). Proc S Afr Sugar Tech nol Ass oc 74:186 187 Snyman SJ, Huckett BI, Botha FC, Watt MP (2001) A comparison between direct and indirect somatic morphogenesis for the production of transgenic sugarcane ( Sacchar um spp. hybrids). Acta Hort 560: 105 108 Stevenson GC (1965) Genetics and b reeding of sugar cane. Longmans London Suprasanna P, Desai NS, Sapna G, Bapat VA (2007) Monitoring genetic fidelity in plants derived through direct somatic embryogenesis in sugar cane by RAPD analysis. J New Seeds 8: 1 9 Suprasanna P, Manjunatha B, Patade V, Desai N, Bapat V (2010) Profiling of culture induced variation in sugarcane plants regenerated via direct and indirect somatic embryogenesis by using transposon insertion polym orphism. Sugar Tech 12: 26 30 Sweby DL, Huckett BL, Botha FC (1994) Minimizing somaclonal variation in tissue culture of sugarcane. Proc S Afr Sug ar Tech nol Ass oc 68: 46 50 Tabaeizadeh Z, Ferl RJ, Vasil IK (1986) Somatic hybridization in the gramineae: Sac charum officinarum L. (sugarcane) and Pennisetum americanum (L.) K. Schum. (pearl millet). Proc Natl Acad Sci USA 83: 5616 5619 Taparia Y, Fouad W, Gallo M, Altpeter F (2009) Plant regeneration from sugarcane leaf roll explants in response to different gro wth regulators. In Vitro Cell Dev Biol An imal 45: S67 S68 Taparia Y, Fouad W, Gallo M, Altpeter F (2011) Rapid production of transgenic sugarcane with the introduction of simple loci following biolistic transfer of a minimal expression cassette and direct embryogenesis. In Vitro Cell Dev Biol Pl ant doi : 10.1007/s11627 011 9389 9 Taylor PWJ, Dukic S (1993) Development of an in vitro culture technique for conservation of Saccharum spp. hybrid germplasm. Plant Cell Tiss Org 34: 217 222 Tew TL, Cobill RM (2008 ) Genetic improvement of sugarcane ( Saccharum spp.) as an energy crop. In: Vermerris W (ed) Genetic Improvement of Bioenergy Crops. Springer, New York, pp 273 294

PAGE 109

109 Thi Loc N, Tinjuangjun P, Gatehouse AMR, Christou P, Gatehouse JA (2002) Linear transgene con structs lacking vector backbone sequences generate transgenic rice plants which accumulate higher levels of proteins conferring insect resistance. Mol Breeding 9: 231 244 Thom M, Maretzki A, Komor E, Sakai W (1981) Nutrient uptake and accumulation by sugar cane cell cultures in relation to the growth cycle. Plant Cell Tiss Org 1: 3 14 Tlaskal J, Hutchinson PB, Roach BT (1970) Variation in chromosome numbers within tissues of sugarcane clones. Int Soc Sugar Cane Technol Breeders Newsl 25: 20 24 Toki S (1997) Rapid and efficient Agrobacterium mediated transformation in rice. Plant Mol Biol Rep 15: 16 21 Torbert K, Rines H, Somers D (1995) Use of paromomycin as a selective agent for oat transformation. Plant Cell Rep 14: 635 640 USDA (2011) World produ ction, sup ply, and distribution of centrifugal sugar. United States Department of Agriculture http://www.ers.usda.gov/Briefing/Sugar/Data.htm Accessed 15 Oct ober 2011 Van Der Vyver C (2010) Genetic tr ansformation of the euploid Saccharum officinarum via direct and indirect embryogenesis. Sugar Tech 12: 21 25 van Rijs J, Giguere V, Hurst J, van Agthoven T, Geurts van Kessel A, Goyert S, Grosveld F (1985) Chromosomal localization of the human Thy 1 gene. Proc Natl Acad Sci 82: 5832 5835 Vandenplas S, Wiid I, Grobler Rabie A, Brebner K, Ricketts M, Wallis G, Bester A, Boyd C, Mathew C (1984) Blot hybridization analysis of genomic DNA. J Med Genet 21: 164 172 Vasil V, Vasil IK (1980) Isolation and culture o f cereal protoplasts. Theor Appl Genet 56: 97 99 Vasil V, Vasil IK (1981) Somatic embryogenesis and plant regeneration from tissue cultures of Pennisetum americanum and P. americanum x P. purpureum hybrid. Am J Bot 68: 864 872 Vermerris W (2008) Genetic i mprovement of bioe nergy crops. Springer, New York Vickers JE, Grof CPL, Bonnett GD, Jackson PA, Morgan TE (2005) Effects of tissue culture, biolistic transformation, and introduction of PPO and SPS gene constructs on performance of sugarcane clones in the field. Aust J Agr Res 56: 57 68 Vidal J, Kikkert J, Donzelli B, Wallace P, Reisch B (2006) Biolistic transformation of grapevine using minimal gene cassette technology. Plant Cell Rep 25: 807 814

PAGE 110

110 Waclawovsky AJ, Sato PM, Lembke CG, Moore PH, Souza GM (201 0) Sugarcane for bioenergy production: an assessment of yield and regulation of sucrose content. Plant Biotechnol J 8: 263 276 Wang A Q, Dong W Q, Wei Y W, Huang C M, He L F, Yang L T, Li Y R (2009) Transformation of sugarcane with ACC oxidase antisense ge ne. Sugar Tech 11: 39 43 Wang M L, Goldstein C, Su W, Moore PH, Albert HH (2005) Production of biologically active GM CSF in sugarcane: a secure biofactory. Transgenic Res 14: 167 178 Wang Z, Ge Y (2005) Rapid and efficient production of transgenic bermuda grass and creeping bentgrass bypassing the callus formation phase. Funct Plant Biol 32: 769 776 Weng L X, Deng H H, Xu J L, Li Q, Zhang Y Q, Jiang Z D, Li Q W, Chen J W, Zhang L H (2011) Transgenic sugarcane plants expressing high levels of modified cry1Ac provide effective control against stem borers in field trials. Transgenic Res 20 : 759 772 Weng L X, Deng H, Xu J L, Li Q, Wang L H, Jiang Z, Zhang HB, Li Q, Zhang L H (2006) Regeneration of sugarcane elite breeding lines and engineering of stem borer resi stance. Pest Manag Sci 62: 178 187 White PR (1943) Nutrient deficiency studies and an improved inorganic nutrient medium for cultivation of excised tomato roots. Growth 7: 53 Witrzens B, Brettell RIS, Murray FR, McElroy D, Li Z, Dennis ES (1998) Comparison of three selectable marker genes for transformation of wheat by microprojectile bombardment. Funct Plant Biol 25: 39 44 Wu L, Birch RG (2007) Doubled sugar content in sugarcane plants modified to produce a sucrose isomer. Plant Biotechnol J 5: 109 117 Wys e RE, Komor E (1984) Mechanism of amino acid uptake by sugarcane suspension cells. Plant Physiol 76: 865 870 Yang J, Lee HJ, Shin DH, Oh SK, Seon JH, Paek KY, Han KH (1999) Genetic transformation of Cymbidium orchid by particle bombardment. Plant Cell Rep 18: 978 984 Yao Q, Cong L, Chang JL, Li KX, Yang GX, He GY (2006) Low copy number gene transfer and stable expression in a commercial wheat cultivar via particle bombardment. J Exp Bot 57: 3737 3746 Zhang L, Weng L, Jiang Z (2007) Sugarcane. In: Pua E C, D avey MR (eds) Transgenic Crops V Biotechnology in Agriculture and Forestry. Springer Berlin, pp 537 551

PAGE 111

111 Zhang S Z, Yang B P, Feng C L, Chen R K, Luo J P, Cai W W, Liu F H (2006) Expression of the Grifola frondosa trehalose synthase gene and improvement of drought tolerance in Sugarcane ( Saccharum officinarum L.). J Integar Plant Biol 48: 453 459 Zhangsun D, Luo S, Chen R, Tang K (2007) Improved Agrobacterium mediated genetic transformation of GNA transgenic sugarcane. Biologia 62: 386 393 Zhao Y, Qian Q, W ang H, Huang D (2007) Hereditary behavior of bar gene cassette is complex in rice mediated by particle bombardment. J Genet Genomics 34: 824 835

PAGE 112

112 BIOGRAPHICAL SKETCH Yogesh Taparia was born in Mumbai, India to, parents Hari Shobhachand Taparia and Seema Ta paria. He graduated from Modern Senior Secondary School, Kota in 2003 and pursued Bachelor of Science in Agriculture (Hons.) form College of Agriculture, Punjab Agricultural University, Ludhiana, India. Immediately after graduation in 2008, he came to Univ ersity of Florida to pursue M aster of Science in Agronomy, with which he graduated in 2011.