<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.

DARK ITEM
Permanent Link: http://ufdc.ufl.edu/UFE0043782/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.
Physical Description: Book
Language: english
Creator: Baber, Ori R
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: Environmental Engineering Sciences -- Dissertations, Academic -- UF
Genre: Environmental Engineering Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Ori R Baber.
Thesis: Thesis (M.S.)--University of Florida, 2011.
Local: Adviser: Jang, Myoseon.
Electronic Access: INACCESSIBLE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043782:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043782/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.
Physical Description: Book
Language: english
Creator: Baber, Ori R
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: Environmental Engineering Sciences -- Dissertations, Academic -- UF
Genre: Environmental Engineering Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Ori R Baber.
Thesis: Thesis (M.S.)--University of Florida, 2011.
Local: Adviser: Jang, Myoseon.
Electronic Access: INACCESSIBLE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043782:00001


This item has the following downloads:


Full Text

PAGE 1

1 A MAGNETIC PRECIPITA TOR EXPOSURE DEVICE TO INVESTIGATE THE I N VITRO RESPIRATORY EF FECTS OF AEROSOLS By ORI RYAN BABER A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 O r i R y an B a ber

PAGE 3

3 To the Gator Nation

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my advisor, Dr. Myoseon Jang; my committee members, Dr. Tara Sabo Attwood and Dr. Chang Yu Wu; Dr. David Barber; the Health Effects Institute, for funding my resear ch; my colleagues, Jiaying Li, Yunseok Im, Min Zhong, Ross Beardsley, and Tianyi Chen; and my family and friends.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 LIST OF ABBREVIATIONS ................................ ................................ ........................... 10 ABSTRA CT ................................ ................................ ................................ ................... 11 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 13 Introduction to Inhalation Toxicology ................................ ................................ ....... 13 Epidemiological Studies ................................ ................................ ................... 13 In Vivo and Clinical Studies ................................ ................................ .............. 14 In Vitro Studies ................................ ................................ ................................ 15 Research Objectives ................................ ................................ ............................... 16 2 CRITICAL CONSIDERATIONS FOR USING MAGNETIC NANOPARTICLES ...... 18 Why Magnetic Nanoparticles? ................................ ................................ ................ 18 Device Design Considerations ................................ ................................ ................ 19 Dose Model ................................ ................................ ................................ ............. 20 3 DETERMINATION OF A SUITABLE MAGNETIC NANOPARTICLE ...................... 24 Experiments ................................ ................................ ................................ ............ 25 Quantitative Determination of Soluble Iron ................................ ....................... 25 Cell Culture ................................ ................................ ................................ ....... 26 Cytotoxic Effects of Iron Oxide MNPs w ith and w ithout Silica Coating ............. 26 Growing Cells at Air liquid Interface and Exposure to Aerosolized MNPs ........ 27 Determination of Sub Lethal Response to MNPs ................................ ............. 28 Confirmation of P article S ize D elivery using S canning T ransmission E lectron M icroscopy ................................ ................................ ...................... 30 Results ................................ ................................ ................................ .................... 30 Chemical S tability of MNPs against A cidic E rosion ................................ .......... 30 Airborne and D elivered P article S ize D istrib ution ................................ ............. 32 Cellular I nfluence of MNPs on BEAS 2B C ells ................................ ................. 33 Conclusions ................................ ................................ ................................ ............ 37

PAGE 6

6 4 MULTIPLE EXPOSURE DEVICE ................................ ................................ ........... 45 De sign ................................ ................................ ................................ ..................... 45 Testing ................................ ................................ ................................ .................... 46 5 FUTURE APPLICATIONS ................................ ................................ ...................... 53 Indoor Air Pollution Exposure Study ................................ ................................ ....... 53 Automobile Combustion Particle Exposure ................................ ............................. 54 6 CONCLUSION AND SUMMARY ................................ ................................ ............ 57 LIST OF REFERENCES ................................ ................................ ............................... 58 BIOGRAPHICAL SKET CH ................................ ................................ ............................ 63

PAGE 7

7 LIST OF TABLES Table page 3 1 Magnetic and physical properties of the magnetic nanoparticles investigated in this study ................................ ................................ ................................ ......... 38 3 2 Indoor chamber experimental design for airborne MNP delivery to BEAS 2B cells grown at an air liquid interface using MPED ................................ ............... 39 3 3 Primers and genes used to investigate the cellular influence of magnetic nanoparticles on in vitro human airway epithelial cells. ................................ ...... 40 3 4 Concentrations of ferric and ferrous iron after nanoparticles were exposed to various aqueous acidic solutions. Displayed values are 95% confide nce intervals (n=3) for the mean concentration of soluble iron [ng] per nanoparticle concentration [g] at a given acid exposure. In the control experiment, nanoparticles were not exposed to acid before quantification of soluble iron. ................................ ................................ ................................ ........ 41 4 1 Testing Magnetic Precipitator Multiple Exposure Device. ................................ ... 50

PAGE 8

8 LIST OF FIGURES Figure page 2 1 Conceptual illustration of magnetic nanoparticle delivery to in vitro human lung cells. ................................ ................................ ................................ ............ 23 3 1 Indoor Teflon chamber set up and magnetic precipitator single exposure device (MPSED) to study the exposure effects of airborne MNPs. ..................... 38 3 2 Concentration of total soluble iron (Fe II/III) associated with each nanoparticle after one hour exposure to aqueous organic and inorganic ac ids (n=3). ................................ ................................ ................................ .................. 42 3 3 HAADF (left) and Brightfield (right) images of the Fe containing particles in the BEAS 2B cells. The particles are on the order of 20 50 nm in diameter. ...... 42 3 4 Cytotoxicity of uncoated iron oxide nanoparticles and amorphous silica coated ma gnetic nanoparticles on BEAS 2B cells (n=8). Nanoparticles were exposed to 2% sulfuric acid or 20% sulfuric acid or 2% citric acid to examine the effects of acidic erosion on nanoparticle cytotoxicity. A no acid treatment was conducted to examine the tox icity of original non degraded magnetic nanoparticles. Cytotoxicity examination conducted using XTT cell viability assay. (p<0.05 indicated by *) ................................ ................................ ............ 43 3 5 mRNA response of BEAS 2B cells grown at an air liquid interface to airborne MNP delivered the cell surface using the MPED (n=2). Interleukin 8 (IL 8), interleukin 6 (IL 6), and tumor necrosis factor in flammatory response. Heme oxygenase (HMOX) is a marker for oxidative stress. Transferrin receptor protein 1 (TfR1) is involved in iron homeostasis. Significant changes are indicated (*, p<0.05). ................................ .................... 44 4 1 The Magnetic Precipitator Multiple Exposure Device (MPMED). View from the bottom (left) and view from the top (right). ................................ .................... 49 4 2 Experimental design used to test the Magnetic Precipitator Multiple Exposure Device (MPMED). ................................ ................................ ............................... 51 4 3 Delivery efficiency for the three types of magnetic nanoparticles used in this study, uncoated iron oxide, MagSilica 85, and MagSilica 50. Efficiencies are presented for both the singl e and multiple exposure devices. The multiple exposure device uses larger disk magnets, thereby increasing delivery efficiency as compared to the single exposure device. ................................ ....... 52 5 1 Possible experimental design to investigate the in vitro respiratory effects of indoor air pollution generated from d limonene. ................................ ................. 55

PAGE 9

9 5 2 Possible experimental design to investigate the in vitro respiratory effects of automobile combustion particulate matter. ................................ ......................... 55 5 3 University of Florida Atmospheric Photochemical Reactor (UF APHOR), located on the roof of Black Hall, Gainesville FL. ................................ ............... 56

PAGE 10

10 LIST OF ABBREVIATION S DNA Deoxyribonucleic Acid HPLC High Performance Liquid Chromatography LPM Liters per Minute MNP Magnetic nanoparticle MP S ED Magnetic Precipitator Single Exposure Device MPMED Magnetic Precipitator Multiple Exposure Device NIEHS National Institute of Environmental Health Sciences PCR Polymerase Chain Reaction PM (Airborne) Particulate Matter qRT PCR Quantitative Reverse Transcription Polymerase Chain Reaction RNA R ibonucleic Acid SMPS Scanning Mobility Particle Sizer SOA Secondary organic aerosol UF APHOR University of Florida Atmospheric Photochemical Outdoor Reactor VOC Volatile Organic Compound

PAGE 11

11 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science A MAGNETIC PRECIPITA TOR EXPOSURE DEVICE TO INVESTIGATE THE I N VITRO RESPIRATORY EF FECTS OF AEROSOLS By Ori Ryan Baber December 2 011 Chair: Myoseon Jang Major: Environmental Engineering Sciences Investigations into the toxicity of airborne particulate matter (PM) commonly employ in vitro techniques (the exposure of cell cultures to air pollutants) as methods to provide rapid and cost efficient insight before more extensive research. However, there are currently limitations associated with in vitro methodologies in regards to delivery effi ciency, physiological relevance, and preservation of the chemical and physical composition of the pollutant under investigation. The purpose of this research was to develop an innovative exposure technique that can overcome these limitations by using airb orne magnetic nanoparticles (MNPs) to deliver PM to cells grown at an air liquid interface. A specially fabricated M agnetic P recipitator Single Exposure D evice (MPSED) was used to deliver MNPs to cultures of human airway epithelial cells. Our research ind icates that use of magnetic nanoparticles coated in amorphous silica is advantageous in this delivery system due to their stability against acidic erosion and negligible cellular influence on the cultured cells. Using a series of derived dose models, it is possible to estimate the amount of nanoparticle delivered to the cell cultures when using this system, which is beneficial to establish dose response relationships. Finally, a

PAGE 12

12 Magnetic Precipitator Multiple Exposure Device (MPMED) was fabricated to facili tate toxicity assessment and strengthen statistical analysis by conducting multiple exposures simultaneously. Coupled with the MPMED, a specially designed aerosol generation system provides a constant and uniform distribution of MNPs to the deli very devic e. This novel system has unique advantages including 1) short exposure time, 2) high delivery efficiency, and 3) in situ particle delivery. In future studies, the MPMED can be used to investigate the inhalation toxicity associated with secondary organic ae rosol or airborne particulate matter.

PAGE 13

13 CHAPTER 1 INTRODUCTION Introduction to Inhalation Toxicology The field of inhalation toxicology is concerned with the respiratory system and the effects of contaminants on its function and health. The origin of the stu dy of respiratory a combination of meteorological circumstances and particularly poor ambient air quali ty cause d by coal combustion le d to thick smog that engulfed London, UK for less than a week. While the event lasted only a few days, its effects were drastic, claiming the lives of an estimated 4,000 people and sickening more than 100,000 people (Boubel et al. 1994) The Great Smog and subsequent health complications dr ew considerable attention f rom scientists, physicians, politicians, and the public, mark ing the conception of the field of inhalation toxicology. Over half a century later, inhalation toxicology as a research field has progressed tremendously, providing immense insight into the cau ses and sources of respiratory afflictions. Although there is much more to be understood, the following methods, procedures, and toxicological assessments form the bedrock of inhalation toxicology scholarship Epidemiological Studies Epidemiological studies have been critically important to understanding relationship between air pollution and respiratory health. This level of investigation is observational in nature, analyzing and interpreting the trends in population health indicators (mortality, morbidity, etc.) compared to air quality indices (ozone concentration, particulate matter concentration, etc.). Epidemiological studies have

PAGE 14

14 been widely used to study the Great Smog event (Wilkins 1954; Bell et al. 2008) O ne most well known epidemiological investigations to link air pollution with respiratory health was the NIEHS funded Six C ities Study This study began in 1974 and followed a large cohort in six US cities (Dockery et a l. 1993) Although epidemiological studies have provided invaluable information on air pollution health effects, this type of study is limited to observing events that occurred in the past and for which data is available In Vivo and Clinical Studies In vivo and clinical studies are experimental in design in contrast to the observational nature of epidemiological studies. In vivo research by definition uses live intact organisms as test subjects, including rodents, primates, an d humans and exposes t he test subjects to a substance of interest under a controlled environment. This level of toxicity assessment is often the preferred method when the test substance is a newly synthesized product ( i.e. drug) and a large body of observational data does not yet exist. Numerous in vivo studies have been conducted on the health effects associated with the inhalation of air pollution using humans, primates, and rodents as test subjects (Oberdrster et al. 1995; Coggins 2001) This level of toxicity assessment has numerous advantag es including the relevance to human exposure and effects, especially when the test subjects are humans (Pope 2000) However, extrapolating data to predict toxic responses in humans become s more complicated and concerning when the test subjects are rodents, primates or other lower organisms. Disadvantages of in vivo research include 1) the need for a dedicated, highly specialized research facility, 2) the costs associated with maintaining live test subjects, 3) human and animal welfare concerns, and 4) ethical considerations.

PAGE 15

15 In Vitro Studies Investigations into the toxicity of airborne particulate matter (PM) commonly employ in vitro techniques (the exposure of cell cultures to air pollutants) as screening methods to provide fundamental insight before more e xtensive, often in vivo research is conducted. Multiple methods have been developed to investigate the effects of air contaminants on the cultures of human cells (Volckens and Leith 2002; Paur et al. 2011) Conducting research at the in vitro level provides the ability to control numerous factors and experiment al conditions in each toxicity assessment (Castell et al. 1997) The use of respiratory, pulmonary, and nervous system cells allows researchers to investigate the toxic effects of air pollutants on numerous organ systems. After exposure, there are many diffe rent ways to analyze the effects of the air pollutant on the cell culture. Endpoint analysis can include quantifying the expression of genes associated with inflammation and oxidative stress, measuring the extent to which the pollutant causes cell death, a nd effect of the air pollutant on cell morphology and structural integrity (Gad 1994) The cost of conducting in vitro research can be substantially less than in vivo and clinical a studies. However, a major limitation of in vitro studies is the lack of methodology to efficiently expose cell cultures to PM in a physiologically relevant manner without chemical ly or physical ly changing the pollutant under investigation. For example, a common method currently used to investigate the toxicity associated w ith airborne PM requires the collection of PM onto fiber filters, the extraction the collected material and the application of a solution of suspended material to cell cultures. This system has several deficiencies 1) the process of extraction neglects any insoluble components of collected particulate matter (Soukup and Becker 2001) and 2) applying a liquid

PAGE 16

16 suspension is not r epresentative of how airborne particles deposit to the human lung during normal respiration. Although in vitro techniques have the ability to provide rapid results, the multiple associated disadvantages of contemporary methods detract from the significanc e of collected information. Therefore, the development of an in vitro technique that can overcome these obstacles and efficiently deliver PM to cell cultures is critically important. Research Objectives The ultimate objective of the discussed research project is to elucidate the complex connection s between particulate air pollution from any source and human respiratory health by significantly increasing the ability of in vitro exposure studies to assess PM toxicity. More specifically, the immediate goal of conducted research was to develop a novel exposure method that is both physiologically and environmentally similar to the way that air pollution interacts with the human lung under realistic conditions. The exposure system designed in this study uses aerosolized magnetic nanoparticles (MNPs) to efficiently deliver airborne pollutant particles to cultured human lung cells grown at the air liquid interface on a membranous support. Relevance to the mechanisms of inhalation that amass air pollution in the lung, preservation of the chemical and physical structure of PM, and the ability to accurately quantify the delivered dose are perhaps the most important and defining characteristics of this novel in vitro exposure technique. The fundamental feasibility of this type of in vitro exposure system was first in 2006 (Jang and Cao 2006a) This research showed that aerosolized magnetic nanoparticles could be directly deposited to a target

PAGE 17

17 s urface and established equations by which to predict the MNP deposition efficiency (these equations will be discussed in more detail in the Chapter 2 in the context of silica coated magnetic nanoparticles). Subsequent research (Jang et al. 2006a; Ghio et al. 2009) examined the ability of the system to deliver secondary organic aerosol to in vitro lung cells. While the results of these preliminary investigations provided p romising outlooks for the in vitro exposure system, there were several unresolved issues involving the effects of the magnetic nanoparticles themselves on cellular health, the chemical stability of the nanoparticles and possible MNP pollutant interaction, and the statistical significance of the collected data. The investigations presented in this thesis sought to address and rectify these issues and to successfully devise a magnetic precipitator multiple exposure device (MPMED) capable of achieving the ultimate objective of understanding the inhalation toxicity of air pollution.

PAGE 18

18 CHAPTER 2 CRITICAL CONSIDERATIONS FOR U SING MAGNETIC NANOPA RTICLES Why Magnetic Nanoparticles ? An increase in the use and application of nanoparticles in the fields of engineering, science, and medicine has occurred recently in part due to the ability to synthesize nano sca le materials with unique physical and chemical properties (Ok et al. 2009) Biological and medical research ha s benefitted from the advent of nanotechnology/ nanoparticle manufacturing and has dynamically incorporated such materials into numerous biomedical (Pankhurst and et al. 2003) drug delivery (Koo et al. 2005) protein detection (Cheng et al. 2006) tissue engineering (Ph am 2006) pathogen detection (Guo 2005) DNA probing (Park et al. 2002) and fluorescent la beling (He 2004) applications. As a class of nano material, magnetic nanoparticles (MNPs) ha ve proven particularly useful in these fields due to the ability to control their spatial distribution with external magnetic fields (Yellen et al. 2005) and the ability to map their location within biological systems using magnetic imaging techniques. For example, MNPs are currently employed as contrast agents for magnetic resonance imaging (MRI) (Lee et al. 2007) colloidal mediators for induced hyperthermia cancer treatments (Jordan et al. 2001) and in drug/gene delivery (Duguet et al. 2006) Recent advances in magnetic imaging techniques include magnetic partic le imaging (MPI) which has the potential to rapidly image 3D tracer materials in vivo (Gleich and Weizenecker 2005) and has been applied to visualize a beating mouse heart (Weizenecker et al. 2009) Applications for MNPs extend beyond medicine and biology as evidenced by their use in separation techniques for catalysts nuclear waste and environmental contaminants (Tartaj et al.

PAGE 19

19 2002; Moeser et al. 2004) and as heating agents in shape memory polymers (SMP) and adhesives (Weigel 2009; Kroell et al. 2005) Magnetic nanoparticle stability is a critical consideration in all aspects of their design, synthesis and application. MNPs are generally made of metals such as Fe, Co, Ni, a nd their alloys and are susceptible to oxidation, which can degrade the magnetic tendencies of the metal. The ability for MNPs to endure pH changes without particle erosion and the resistance to agglomeration or precipitation are also ap pealing characteri stics, which req uire specialized production techniques to increase particle stability. For example, stabilization methods include the synthesis of MNPs with protective outer coatings around inner magnetic cores, or the embedding of magnetic domains within carbon, polymer, or silica matrices which envelop and isolate the magnetic material from the environment. Such protection strategies have increased the popularity, functionality, and use of magnetic nanoparticles. The increased use of magnetic nanoparticl es served as partial motivation for their inclusion in this in vitro exposure system. Device Design Considerations As mentioned in Chapter 1, there have been numerous attempts to create a realistic in vitro model to examine the inhalation toxicity of airbo rne particles but unfortunately these systems have had certain disadvantages. Therefore the attempts of the current research to develop a more realistic and efficient in vitro model must address these shortcomings as well as other factors. Included within these design considerations are delivery efficiency, exposure time, and in situ particle delivery. Particle delivery efficiency and exposure time are inversely related in the sense that as efficiency increase it takes a shorter amount of time to deliver a dose high enough to

PAGE 20

20 elicit an observable cellular response. Short exposure times are critical in order to reduce the effects of the delivery system itself on the cell cultures For example, some systems use a strong vertical airstream to deposit particles to the cell surface. This method has poor delivery efficiency, which increases the necessary exposure time. Cells exposed to strong vertical airstreams for an extended amount of time may begin to dry out and suffer physical stress that could affect observed cellular response. Hence, this research focused on developing a system with high delivery efficiency, short exposure times, and minimal impact on the cell cultures To minim ize the effects of the exposure system on the cell cultures air flows were kept below 1 L min 1 which is considerably lower than other contemporary systems. Related to the concept of minimizing the effects of the delivery system on the cells, Chapter 3 di scusses in detail the research that was conducted to ensure that the magnetic nanoparticles used in the devised delivery system were appropriate and did not adversely affect cellular health. Finally, in situ delivery is an important consideration for a rep resentative in vitro model. A popular in vitro method includes the collection of atmospheric particulate matter on filters, the extracti on of the materia l using solvents, and then application of the extract to cell cultures. This system does not provide to xicity information on the intact aerosol, but instead only the extractable portion in solution. To address this issue, the devised delivery system presented in this paper delivers airborne PM directly from the air suspended phase to the surface of cell gro wn at an air liquid interface, more similar to the way that PM is deposited in in vivo systems (Fig ure 2 1) Dose Model A dose model was recently established to estimate the mass of airborne magnetic nanoparticles delivered to the surface of cells grown at a n air liquid interface using a

PAGE 21

21 horizontal airstream Magnetic Precipitator Single Exposure Device (MP S ED) (Jang et al. 2006a) The model calculations were originally formulated for unc oated iron oxide nanoparticles and in this study have been modified to account for the MNPs coated with different thicknesses of amorphous silica (MagSilica 50 & MagSilica 50 85 ) The silica layer surrounding the magnetic core affects particle mobility and the resulting dose. The dose model was tested by delivering MNPs to a filter using the MP S ED and measuring filter mass before and after delivery. The delivery dose predicted using the dose model and actual dose mass measured on the filter were in agre ement for each of the three particles, confirming the utility of the dose model. The detailed mathematical derivation of the dose model associated with MP S ED and its application are discussed in previous works (Jang and Cao 2006a; Jang et al. 2006a; Ghio et al. 2009) but an abridged overview is provided subsequently. The predicted mass deposited to the cell surface (Mass pre, flow) is d escribed as ( 2 1 ) where p is the particle density (g/cm3), Q is the air stream flow rate (Lmin 1) through the MP S ED, t is exposure time (min), N (Dp) is the particle number concentration at a given particle diameter (D p ) and p ) is particle delivery efficiency. Delivery efficiency depends on magnetic properties specific to each nanoparticle that govern particle velocity ( ), the surface area of the disk magnet used in the MP S ED ( S M ) and the air flow through the device according to the following equation: ( 2 2 ) The velocity of the MNP traveling within the applied external magnetic field can be calculated as follows:

PAGE 22

22 ( 2 3 ) where is the magnetic energy gradient, is the magnetization of the magnetic material, is the diameter (nm) of the MNP core, is the Cunningham correction factor, is the is the magnetocrystalline anisotropy energy density, i s the viscosity of air (1.8210 5 N s/m2), and is the diameter (nm) of the total particle as measured by the SMPS. The average velocity ( ) of the MNP is calculated by integrating equation 2 3. The mobility of the magnetic nanoparticle is different for superparamagnetic and paramagnetic nanoparticles. The respective mobility can be calculated according to the following equations [Superparamagnetic] ( 2 4 ) [Paramagnetic] ( 2 5 ) w here is the permeability of free space (1.2610 6 Vs/Am), is the Boltzman constant (1.38*10 23 J/K) and is the magnetocrystalline anisotropy energy density (kJ/m3). In summary, the mass of MNP deposited to the cell surface depends upon the magnetic characteristics of the nanoparticle. Using the dose model allows cellular responses to be expressed in relatio n to estimated dose mass and dose response relationships to be established.

PAGE 23

23 Figure 2 1. Conceptual illustration of magnetic nanoparticle delivery to in vitro human lung cells. Disk Magnet Cell Culture Media Airstream inlet Airstream outlet Magnetic Nanoparticle Cells Membrane

PAGE 24

24 CHAPTER 3 DETERMINATION OF A S UITABLE MAGNETIC NAN OPARTICLE The purpose of this portion of the study was to investigate the physical and chemical properties of uncoated and surface coated MNPs in relation to their influence on in vitro human airway epithelial cells. Specifically, uncoated iron oxide nanoparticles were compared to magnetic iron oxide domains embedded within amorphous silica matrices. Iron oxide was chos en as the magnetic material due to its greater stability and lower toxicity compared with other magnetic metals like cobalt and nickel, which have demonstrated toxicity (Vatta 2006) It was hypothesized that embeddi ng the magnetic domains in amorphous silica would provide chemical stability against indigenous atmospheric oxidants and acids and maintain a protective layer around the magnetic iron oxide, thereby diminishing any possible cellular responses due to change s in soluble iron concentration and/or oxidative stress. The physical properties and the influence on in vitro cell cultures of three different magnetic nanoparticles were investigated in this study: uncoated iron oxide nanoparticles (Aldrich, Milwaukee, W I), AdNano MagSilica 50 and AdNano MagSilica 50 85 (Degussa Advanced Materials, Degussa AG, Hanau Germany). Table 3 1 outlines the magnetic properties of the three nanoparticles. Both types of MagSilica nanoparticles contain magnetic iron oxide domains embedded into an amorphous silica matrix. The two silica coated nanoparticles differ in regards to their fraction of internal iron oxide MagSilica 85 with higher magnetization (more Fe3O4/Fe2O3 internal domain) than MagSilica 50. MagSilica85 and MagSili ca 50 are of similar size and therefore MagSilica 50 has a comparatively larger fraction of amorphous silica coating.

PAGE 25

25 Experiments Quantitative Determination of Soluble Iron A colorimetric method was used to quantify and compare the amount of soluble iron ( II/III) associated with each type of magnetic nanoparticle. Ferrozine iron reagent, 3 ( 2 pyridyl) 5.6 bis(4 phenylsulfonic acid) 1,2,4 triazine, monosodium salt, monohydrate, forms a purple colored complex exclusively with ferrous (II) iron, which can be detected using spectrophotometry (Stookey 1970) Before soluble iron quantification, nanoparticles were exposed to solutions of organic and inorganic acids (2% citric acid, 2% and 20% sulfuric acid and 2% ammonium bisulfate) for one hour Acid exposures were conducted in a 1 to 1 mass ratio with the nanoparticles ( e.g. a slurry was created with 2 mg of nanoparticles and 100 mg of 2% H 2 SO 4 ) in microcentrifuge tubes. T he slurries were diluted to a final concentration of 500 g/mL with HPLC water. Control experiments were conducted with high performanc e liquid chromatography ( HPLC ) water to quantify soluble iron concentrations associated with the particles without acidic erosion. Nanoparticle suspensions were centrifuged at 12000g for 2 minute s (Eppendorf MiniSpin, Eppendorf North America, Inc., Westbu ry, NY), 1 mL of supernatant was passed through a 0.45 m nylon membrane filter (Pall Life Sciences, Aerodisc ) to remove excess suspended MNPs, and the filtered solution was transferred to a new microcentrifuge tube. Ferrozine solution (1 gL 1 ) in 50mM H EPES buffer (pH 7) was added and the solution was transferred to a UV photometer quartz tube. The absorbance at 560 nm was measured using an UV Visible photometer (Lambda 35 UV, PerkinElmer, Shelton, CT ) The absorbance was re measured after 0.25 mL of h ydroxylamine hydrochloride solution (10% by weight) was added to reduce all ferric iron to ferrous iron. The c oncentration of ferric iron ([FeIII]) is calculated by

PAGE 26

26 subtracting ferrous iron concentration ([FeII]) from total iron concentration [FeII+FeIII] (Roden 1996) Cell Culture BEAS 2B cells, which are immortalized normal human bronchial epithelium derived from the transfection of primary cells with SV40 early region genes, were used in this study (a gracious donation from Dr. Andrew Ghio Clinical Research Branch, National Healt h and Environmental Effects Research Laboratory, USEPA). Cells were grown in HyClone Thermo Scientific, Logan, UT) supplemented with 5% by volume penicillin streptomycin solution (Mediatech, Inc., Manassas, VA) and 10% by volume fetal bovine serum (Mediatech, Inc., Manassas, VA). The BEAS 2B cells were maintained in a temperature (37C), humidity, and carbon dio xide (5%) controlled incubator Cytotoxic Effects of Iron Oxide MNPs With and Without Silica Coating BEAS 2B c ells were plated in 96 well plates (Corning Inc.; Corning, NY ), with 8 10 3 cells per well in 200 l media. Cells were incubated in the above mentioned incubator for 24 hours prior to exposure. Stock suspensions of nanoparticles were made in cell cultur e media and suspended nanoparticles were dosed to cells w ith final concentrations of 10, 50, 100, and 250 g/ mL. Twenty four hours after exposure, cell proliferation was examined using XTT (sodium 3 [1 (phenylaminocarbonyl) 3,4 tetrazolium] bis (4 meth oxy 6 nitro) benzene sulfonic acid hydrate) ( American Type Culture Collection; Manassas VA ). w as followed for the assay (Hansen et al. 19 89; Jost et al. 1992)

PAGE 27

27 Growing Cells at Air liquid Interface and Exposure to Aerosolized MNPs The procedure to culture BEAS 2B cells at an air liquid interface has been reported previously (Jang et al. 2006a; Ghio et al. 2009) Briefly, 110 5 cells were plated on the apical side of collagen coated (PurCol, Adva nced BioMatrix, San Diego, CA ) raised cell culture insert (31.5mm OD: Millipore Corp, Ballierica, MA) placed within individual 3510mm covered Petri dishes (Fisher Scientific, Pittsburg, PA ). Cells were grown to confluence in approximately 2 4 days while changing culture medium in the apical and basolateral chambers every 48 hours. An air liquid interface was induced 12 hours prior to exposure by removing the medium in the apical chamber. Cells grown at the air liquid interface were exposed to the airbor ne magnetic nanoparticles using an innovative delivery technique previously reported (Jang et al. 2006b) An indoor 0.4m 3 Teflon film chamber constructed of a nonmagnetic external frame was used to contain the aerosolized MNPs. The chamber set up is illustrated in Figure 3 1 Before each exposure experiment the chamber was flushed with clean air from a medical clean air generator ( Pure Air Generator AADCO 737; Rockville, MD ). The introduction of airborne MNPs into the chamber was accomplished using a commercially available medical nebulizer (LC STAR; Pari Re spiratory Equipment, Inc., Midlothian, VA) to nebulize aqueous suspensions of the MNPs into the chamber. To examine the influence of indigenous atmospheric acid on the potential toxicity of the MNPs, the nanoparticles were subjected to a 2% aqueous sulfur ic acid solution for 1 hour prior to aerosolization and exposure to cells. MNP+ acid slurries were diluted in HPLC water to a final concentration suitable for nebulization (~500 g/mL). A Scanning Mobility Particle Sizer (SMPS 3936 TSI, Shoreview, MN) cou pled with a condensation nuclei counter (3025A, TSI) was used to monitor total particle number and size of the

PAGE 28

28 airborne MNPs within the chamber. The indoor chamber r elative humidity and temperature were between 28 34 % and 34 35C respectively for all expos ure experiments. Table 3 2 shows experimental conditions for the MNP exposures. A novel magnetic precipitator single exposure device (MP S ED) was used to deposit airborne MNPs to the surface of BEAS 2B cells grown at an air liquid interface. The specifications of the device have been previously reported (Jang et al. 2006a; Jang and Cao 2006b) This specially fabricated single exposure device is constructed of aluminum and is approximately 6.56.54.5 cm in length, width, and height respectively and is separated into two sect ions along its height. The MP S ED holds a cell culture dish within an internal 35 mm cylindrical chamber that is accessible when the two halves of the device are detached (Fig ure 3 1). The two halves of the device are connected and secured using screws and t he cell culture becomes sealed within the internal chamber. The device directly attaches to the Teflon film indoor chambers containing aerosolized magnetic nanoparticles. A gentle airstream (0.8 Lmin 1 ) provided by a pump located after the device pulls t he MNPs into the internal flow chamber that holds the cell culture grown at an air liquid interface. A magnetic field provided by a disk magnet (ND064N 35, Master Magnetics East, Marietta, OH) under the cell culture dish directs the deposition of the part icles to the cell surface. Cells cultures exposed to chamber clean air using this device were used as blanks and cells cultures that remained within the incubator were used as controls when analyzing exposure data. Determination of Sub Lethal Response to MNPs Twenty four hours after the exposure, the cells were disrupted in 1 mL of TRIzol ensure homogenization and complete dissociation of nucleoprotein complexes. RNA

PAGE 29

29 isolati Austin, TX). Isolated total RNA was purified using Deoxyribonuclease I, Amplification Grade (Invitrogen). Final RNA quantity and quality were assessed using UV visible spectrome try (NanoDrop, Thermo Scientific). All OD260/280 readings were around 2.0. A one step reverse transcription (RT) quantitative real time polymerase chain reaction (PCR) procedure (Power SYBR Green RNA to Step Kit, Applied Biosystems) was used to assess changes in mRNA concentrations indicative of inflammation, oxidative stress, cell health, and iron homeostasis after exposure to airborne MNPs. Table 3 3 lists each gene examined in this study and the primer sequences used for qRT PCR. Reverse tra nscription and SYBR green qRT PCR was performed using a Rad; Hercules, CA ). Fluorescein calibration dye (BioRad, Hercules, CA ) was added to each master mix such that a final concentration of 10 nM in each PCR reaction was achieved. RPL13A was chosen as the reference gene for normalization of mRNA expression due to its retained stability across exposures and recent recognition as a suitable housekeeping gene (Mane et al. 2008) Fold changes in mRNA conce Ct method (Livak and Schmittgen 2001) Statistical analysis of fold changes in mRNA was conducted using SAS a single step multiple comparison procedure, was used to identify mRNA expression fold changes that significantly increased (p < 0.05) in BEAS 2B cells due to MNP exposure.

PAGE 30

30 C onfirmation of particle size delivery using scanning transmission electron microscopy Scanning transmission electron microscopy (STEM) images (JEOL 200CX TEM) were collected to confirm delivery and assess the deposition of airborne MNPs to the BEAS 2B cell s using the MPED. After exposure, the cells were left attached to the insert membranes for the TEM sample preparation. Some sections of the membrane were postfixed with osmium tetraoxide to enhance visualization of cellular structures. The cells and membra ne were dehydrated, embedded in epoxy, and ultramicrotomed. The ultramicrotomed samples were 50 70 nm thick. Each slice contained the membrane and cells. Results The aim of this research was to determine whether an amorphous silica coating on magnetic nano particles conferred stability against acidic erosion, diminished the mobilization of soluble iron, and reduced adverse cellular effects on in vitro BEAS 2B cells. The BEAS 2B cell line represents the bronchiole epithelium of the human respiratory tract that may interact with inhaled particles or soluble particle constituents under in vivo conditions. The BEAS 2B cell line was chosen because it is commonly used for in vitro respiratory health research and a substantial amount of literature exists by which to compare the results collected in this study. The data indicate that the coated particles display beneficial characteristics in regards to stability and toxicity compared with the uncoated iron oxide nanoparticles. Chemical stability of MNPs against aci dic erosion The MNPs were exposed to various strengths of organic and inorganic acids to assess chemical stability against pH change. The dissolution of iron oxide is

PAGE 31

31 significantly accelerated in the presence of a strong acid (Ghio et al.,2009). In this ca se, H 2 SO 4 is chosen not only because it is ubiquitous in the ambient air but also because it represents the most extreme situation in regards to acidity and likelihood to cause erosion. Sulfuric acid and ammonium bisulfate were compared with citric acid to assess effects of inorganic versus organic acid, respectively, on the degradation of MNPs. Atmospheric organic acids that originate from anthropogenic and biogenic emissions and the oxidation of atmospheric hydrocarbons significantly contribute to ambient particle composition (Kawamura et al., 1985; Chebbi and Carlier, 1996). Table 3 4 and Figure 3 2 provide the concentrations of soluble iron associated with each nanoparticle subsequent to aqueous acid exposure. The silica coated particles demonstrated enh anced resistance to acidity compared with the uncoated iron oxide. Sulfuric acid at both concentrations significantly increased the concentrations of soluble iron associated step multiple comparison m ethod (Dunnett, 1955, 1964), was used to identify significant increases (p < 0.05) in soluble iron concentrations from each acid treatment compared with the intact, noneroded nanoparticles (Fig ure 3 2). Changes in total soluble iron concentrations for the si lica coated nanoparticles were not significant after exposure to any of the acids. This result indicates that the amorphous silica matrix provides a sufficient barrier against degradation to the inner iron domains and limits the mobilization of soluble iro n. Iron ions, along with several other transition metal ions, have exhibited the ability to generate reactive oxygen species (ROS) and to stimulate the peroxidation of cell membrane lipids (Stohs and Bagchi, 1995). Chelated iron serves as a catalyst in the Fenton reactions, which generates adverse hydroxyl radicals. Therefore, the toxicity

PAGE 32

32 associated with iron ions (FeII/III) may be attributable to oxidative tissue damage. Indications of lung injury after exposure to iron oxide particles have been attribute d to the soluble iron ion fractions in both the human lung after intrapulmonary instillation (Lay et al., 1999) and in vitro after exposure to aqueous suspensions (Hussain et al., 2005). The stability of the silica coated MNPs prevented concentrations of soluble iron from escalating after exposure to 2% sulfuric acid. Therefore, even after being subject to strong acids, the silica coated MNPs delivered significantly less catalytically available iron to the cells used in the toxicity assessment described be low. This information suggests that the stability of MagSilica 50 and MagSilica 50 85 against acidic erosion should translate into reduced cellular influence by decreasing the opportunity for reactive oxygen species (ROS) generation, oxidative stress, and cell lipid damage. Airborne and delivered particle size distribution A scanning mobility particle sizer linked to a condensation nuclei counter was used to monitor the size distribution of the aerosolized magnetic nanoparticles. The particle median diamete rs and the geometric standard deviation are shown in Table 3 2. The initial particle median diameter of silica coated magnetic nanoparticle ranges between 35 and 60 nm, whereas that of uncoated iron oxide MNP ranges from 70 90 nm. When sulfuric acid is pre sent, the particle diameter can be greater because of the hygroscopic nature of coexisting sulfuric acid. The silica coated magnetic nanoparticles retained nanoscale dimensions after being nebulized into the chamber (Table 3 2). Indications of greater aggl omeration were observed for the airborne uncoated iron oxide MNPs compared with nonmagnetic aerosol such as sea salt aerosol or organic aerosol. The agglomeration of the uncoated nanoparticles can be attributed to their higher remnant magnetization (Table 3 1). The uncoated iron oxide MNPs are classified as

PAGE 33

33 paramagnetic, whereas the amorphous silica coated MNPs are superparamagnetic. In the absence of an external magnetic field, the average magnetization of a superparamagnetic nanoparticle is negligible. Th erefore, excess agglomeration due to magnetic interactions between airborne silica coated magnetic nanoparticles is minimal. After the MNPs were delivered to the surface of cells grown at an air liquid interface using the MPSED, STEM images were collected to verify deposition and delivered particle size. There are brightfield images of the sample, in which the dark areas are the stained membrane or areas of higher electron density. These images confirm that the airborne particle size distribution was preser ved throughout the delivery process. The observation of nanosized iron oxide particles with diameters 20 100 nm indicates the particles do not agglomerate once delivered to the cell culture (Fig ure 3 3). Cellular influence of MNPs on BEAS 2B cells In vitro B EAS 2B cell cultures were monitored for indications of cytotoxicity and sub lethal responses after exposure to the magnetic nanoparticles. Cytotoxicity assays were conducted using aqueous suspensions of nanoparticles exposed or unexposed to various organi c and inorganic acids. Results indicate that at concentrations up to 250 g/ml of both the coated and uncoated MNP treatments without acid did not significantly decrease cell viability (Fig ure 3 4 ). These results complement several investigations into the comparative toxicity of metal oxides which indicate that even at relatively high concentrations iron oxide alone does not significantly affect cell viability (Hussain et al. 2005; Karlsson et al. 2008; Jeng and Swanson 2006) However, the uncoated iron oxide MNPs demonstrated significant cytotoxicity after exposure to 20% sulf uric at dose concentrations of 50 g/ml and higher. Exposure to 2% citric acid resulted in a significant cytotoxic effect for the uncoated iron oxide particles at the 250 g/ml dose.

PAGE 34

34 Both MagSilica 50 and 50 85 were not cytotoxic even after acid exposure u p to the highest concentration tested (250 g/ml). Airborne MNPs were delivered to the surface of BEAS 2B cell grown at an air liquid interface using a fabricated magnetic precipitator single exposure device. A dose model ( 2 1) associated with the MP S ED was used to estimate the mass of particles delivered to the cells. The resulting doses were between 8 and 59 g for all exposures (Table 3 2). The dose mass of MNPs depends on variations in aerosolized magnetic nanoparticle size distribution, cumulati ve volume concentration, chemical composition due to co existing sulfuric acid and aerosol water content which is governed by chamber humidity and the amount of sulfuric acid, and the magnetic properties of airborne MNPs (Table 3 1 and Eqs 2 4 and 2 5). MNP dose mass was corrected for aerosol water content using the inorganic thermodynamic model ISORROPIA (Nenes et al. 1998) In this study, we have chosen to present RNA expression levels as the percent increase above control (which were exposed to clean air) and then normalize biological expressions by dose mass (% control/ g MNP). A common ch aracteristic of numerous lung complications like chronic obstructive pulmonary disease (COPD), asthma, and adult respiratory distress syndrome is airway inflammation. Inflammation is a result of the recruitment of both immune and inflammatory cells to the location of stress. The recruitment processes is mediated by a battery of pro inflammatory cytokines including interleukin 8 (IL 8), interleukin 6 (IL 6), and tumor necrosis factor ( Rahman 2002) Analysis of IL 8 and IL 6 mRNA expression is a common endpoint in both in vitro and in vivo respiratory research as a marker for inflammatory response induced by various forms of air contaminants. Tumor

PAGE 35

35 necrosis factor a widely accept ed inflammatory marker in phagocytes, monocytes, and T cells has also been shown to be produced in a variety of endothelial and epithelial airway cell lines (Cooper et al. 2001) One study using normal human bronchial epithe lial cells hypothesized that IL 8, IL be induced by the metal present in air pollution particles (Ghio and Cohen 2005; Carter et al. 1997) We originally hypothesized that the uncoated iron oxide nanoparticles exposed to acidic condition might deliver increased concentrations of soluble iron to the cells as compared to the amorphous silica coated particles. Therefore, it was beneficial the del ivery of MNPs, but also soluble iron. Transferrin receptor (TfR1) expression was also examined at the mRNA level. The intent of monitoring TfR1was to assess the effects of the potential delivery of soluble iron by the MNPs to the cell cultures, especia lly after acidic erosion. As previously mentioned, increased soluble iron can generate adverse ROS via the Fenton reactions (Chen and Lippmann 2009) To control intracellular levels of iron, cells engage in regulated mechanisms that bind iron to the storage protein ferritin or the transport protein transferrin (Ghio and Cohen 2005; Ghio et al. 2008) To maintain iron h omeostasis, the transferrin receptor translocates transferrin across the cell membrane, upon which the iron and the transport protein dissociate to provide soluble iron for cellular demands. Transferrin and ferritin represents non reactive bound iron and when concentration of soluble iron exceeds these protective proteins oxidant generation may ensue.

PAGE 36

36 At the delivered dose mass, the silica coated magnetic nanoparticles did not increase the expression RNA markers indicative of the induction of inflammatory response. However, uncoated iron oxide nanoparticles exposed to 2% sulfuric acid significantly increased the RNA concentrations of interleukin 8 (Fig ure 3 5 ) Across treatments, no significant changes in transferrin receptor (TfR1) occurred, which may be r eflective of post transcriptional control. Heme oxygenase, a marker of oxidative stress, significantly increased after exposure to airborne uncoated iron oxide nanoparticles with sulfuric acid. Oxidative stress may be attributable to the increased solubl e iron concentrations delivered to the cells exposed to uncoated iron oxide and acid, which can contribute to the generation of oxidants via the Fenton reactions. Although statistical analysis revealed significant changes in mRNA concentrations as a result of MNP dosage, the precision of collected information is limited by the small sample size per MNP treatment (n=2). A recent study indicated that the sub lethal responses of BEAS 2B cells to micron sized and nanoparticles of iron oxide are significantly lo wer than responses to naturally occurring soil dusts (Veranth et al. 2007) However, iron oxide nanoparticles exposed to acidic conditions have been shown to increase cytotoxicity and inflammatory response of BEAS 2B cells (Ghio et al. 2009) The conclusions of these studies indicate that iron oxide nanoparticles in moderate concentrations do not adversely affect in vitro cell cultures unless the particles are subject to acidic erosion, which is in accord w ith our present results. Establishing the toxicity of amorphous silica nanoparticles has received attention recently due to the incorporation of such nanoparticles into cosmetics, food additives,

PAGE 37

37 and numerous other commercial products. Although a limited number of examinations indicate toxicity at high doses, several studies have concluded that at low to moderate doses amorphous silica nanoparticles are neither cytotoxic nor genotoxic (Johnston et al. 2000; Barnes et al. 2008) The results of the present study are in agreement with these conclusions that at low concentrations amorphous silica does not adversely cause acute cellular effects. Conclusions This study used a unique in vitro exposure system to deliver airborne magnetic nanoparticles directly to the surface of BEAS 2B cells grown at an air liquid interface. The benefits of this method include the ability to directly deliver PM to the surface of in vitro cells, estimate and co ntrol applied dose using the derived dose model, and conduct numerous exposures in a short time frame. O ur study found that embedding iron oxide magnetic domains within amorphous silica matrices sufficiently protects the metal from the acidic erosion to w hich uncoated particles are vulnerable. Correspondingly, the increased particle stability translates into reduced cytotoxicity and cellular influence on human airway epithelial cells.

PAGE 38

38 Table 3 1. Magnetic and physical properties of the magnetic nanoparti cles investigated in this study MagSilica 85 MagSilica 50 Uncoated Fe 3 O 4 Density (g/cm 3 ) 3.72 2.83 5.0 Diameter (nm) 3211 3512 255 M s (kA/m) 1791 51.90.2 450.0 m (%) 40 11.5 100 M s : saturation magnetization, m : volume fraction of magnetite Figure 3 1. Indoor Teflon chamber set up and magnetic precipitator single exposure device (MPSED) to study the exposure effects of airborne MNPs.

PAGE 39

39 Table 3 2. Indoor chamber experimental design for airborne MNP delivery to BEAS 2B cells grown at an air liquid interface using MPED Number System Flow Rate Duration Aerosolized MNP Concentration Particle Median Diameter Geometric Stndrd Dev. Estimate d Dose Mass a (MNP/Acid/Cntrl) (L/min) (min) (nm 3 /cm 3 ) (nm) (nm) (g) A1 Control Incubator b 0.8 45 N.A. N.A. N.A. N.A. A2 Blank Clean Air c 0.8 45 N.A. N.A. N.A. N.A. A3 MagSilica 50 0.8 45 4.54E+11 86.22 2.06 23.8 A4 MagSilica 50 + 2% H 2 SO 4 0.8 45 5.02E+11 64.70 2.10 11.5 A5 MagSilica 85 0.8 45 3.71E+11 61.27 2.71 31.8 A6 MagSilica 85 + 2% H 2 SO 4 0.8 45 4.27E+11 79.27 2.08 10.8 A7 Uncoated 0.8 45 5.11E+11 90.47 1.99 59.9 A8 Uncoated + 2% H 2 SO 4 0.8 45 4.86E+11 178.13 2.76 9.0 B1 Control Incubator 0.8 45 N.A. N.A. N.A. N.A. B2 Blank Clean Air 0.8 45 N.A. N.A. N.A. N.A. B3 MagSilica 50 0.8 45 5.03E+11 38.78 2.85 44.7 B4 MagSilica 50 + 2% H 2 SO 4 0.8 45 4.14E+11 58.29 2.08 13.9 B5 MagSilica 85 0.8 45 3.35E+11 56.96 2.13 30.6 B6 MagSilica 85 + 2% H 2 SO 4 0.8 45 4.82E+11 65.01 2.15 10.4 B7 Uncoated 0.8 45 3.98E+11 76.761 1.99 27.2 B8 Uncoated + 2% H 2 SO 4 0.8 45 4.73E+11 136.78 2.83 8.2 N.A.= Not Applicable, a. Estimated according to delivery dose model (Eqs. 2 1 thru 3). The water content in aerosol is estimated based on the aerosol composition (mass ratio of MNP to sulfuric acid), SMPS data, and the inorganic thermodynamic model (ISOROPPIA); b. T he cell cultures that remained within the incubator were used as the control for mRNA response calculations; c. Cells exposed only to clean chamber air using the exposure system were used as blanks.

PAGE 40

40 Table 3 3. Primers and genes used to investigate the cellular influence of magnetic nanoparticles on in vitro human airway epithelial cells. Symbol Gene Name Function Forward Primer Sequence Reverse Primer Sequence Accession number IL8 Interleukin 8 Inflammatory response CTGGCCGTGGCTCTCTT G CCTTGGCAAAACTGCACCTT NM_000584.2 IL6 Interleukin 6 Inflammatory response TACCCCCAGGAGAAGATT CC TTTTCTGCCAGTGCCTCTTT NM_000600.3 TfR1 Transferrin receptor protein 1 Iron homeostasis CAGGAACCGAGTCTCCA GTGA CTTGATGGTGCCGGTGAAGT NM_001128148 TNF Tumor necrosis factor Inflammatory response CGTCTCCTACCAGACCAA GG GGAAGACCCCTCGATAG NM_000594.2 HMOX1 Heme oxygenase Oxidative stress TTCTCCGATGGGTCCTCC TTACACT GGCATAAAGCCCTACAGCAA CT NM_002133.2 RPL13A Ribosomal protein L13A Reference gene CCTGGAGGAGAAGAGGA AAGAGA TTGAGGACCTCTGTGTATTTG TCAA NM_012423.2

PAGE 41

41 Table 3 4. Concentrations of ferric and ferrous iron after nanoparticles were exposed to various aqueous acidic solutions. Displayed values are 95% confidence intervals (n=3) for the mean concentration of soluble iron [ng] per nanoparticle concentration [ g] at a given acid exposure In the control experiment, nanoparticles were not exposed to acid before quantification of soluble iron. MagSilica 50 MagSilica 85 Uncoated Iron Oxide Iron II Iron (III) Iron (II) Iron (III) Iron (II) Iron (III) Treatment (ng Fe 2+ / g MNP) (ng Fe 3+ / g MNP) (ng Fe 2+ / g MNP) (ng Fe 3+ / g MNP) (ng Fe 2+ / g MNP) (ng Fe 3+ / g MNP) Control 0.044 0.016 0.006 0.007 0.046 0.016 0.011 0.006 0.039 0.013 0.005 0.008 (NH 4 )H 2 SO 4 0.112 0.023 0.007 0.019 0.182 0.024 0.005 0.017 0.350 0.210 0.008 0.137 Citric acid 0.202 0.399 0.114 0.099 0.309 0.180 0.013 0.021 0.506 0.135 0.262 0.404 2% H 2 SO 4 0.239 0.290 0.081 0.111 0.180 0.180 0.100 0.249 0.662 0.600 0.356 0.823 20% H 2 SO 4 0.401 0.401 0.342 0.332 0.244 0.079 0.283 0.614 1.391 0.673 0.598 0.658

PAGE 42

42 Figure 3 2. Concentration of total soluble iron (Fe II/III) associated with each nanoparticle after one hour exposure to aqueous organic and inorganic acids (n=3). Figure 3 3. HAADF (left) and Brightfield (right) images of the Fe containing particles in the BEAS 2B cells. The particles are on the order of 20 50 nm in diameter.

PAGE 43

43 Figure 3 4. Cytotoxicity of uncoated iron oxide nanoparticles and amorphous silica coated magnetic nanoparticles on BEAS 2B cells (n=8). Nanoparticles were exposed to 2% sulfuric acid or 20% sulfuric acid or 2% citric acid to examine the effects of acidic erosion on nanoparticle cytotoxicity. A no acid treatment was conducted to examine the toxicity of original non degraded magnetic nanoparticles. Cytotoxicity examination conducted using XTT cell viability assay. (p<0.05 indicated by *)

PAGE 44

44 Figure 3 5 mRNA response of BEAS 2B cells grown at an air liquid interface to airborne MNP delivered the cell surface using the MPED (n=2). Interleukin 8 (IL 8), interleukin 6 (IL 6), and tumor necrosis factor markers of inflammatory response. Heme oxygenase (HMOX) is a marker for oxidative stress. Transferrin receptor protein 1 (TfR1) is involved in iron homeostasis. Signif icant changes are indicated (*, p<0.05).

PAGE 45

45 CHAPTER 4 M ULTIPLE EXPOSURE DEV ICE The research conducted on magnetic nanoparticle suitability, as discussed in the previous chapter, used a single exposure device coupled with a batch reactor type nanoparticle generation system. Although the use of the MPSED proved successful, there were several limitations in the experime ntal design and implementation. For example, in the previous experiments magnetic nanoparticles were nebulized into a Teflon fil m chamber and contained for the duration of the exposures without the addition of new particles The effects of particle agglomeration and particle loss to the wall after nebulization influence d the particle size distribution in the chamber as well as the distribution of particles delivered to the cells across the various exposures. In other w ords, the use of this system le d to changes in particle size distribution beyond the control of the researchers. Secondly, the MPSED is limited by its ability to cond uct only a single exposure at a time, necessitating sequential exposures for appropriate statistical analysis. This chapter outlines the work that was conduct ed to improve upon not only the exposure device design but also the method by which the aerosoliz ed magnetic nanoparticles were generated. Design The objectives of thi s portion of the study were to 1) improve the design of the exposure system to provide the ability to conduct multiple e xposures simultaneously and to 2) devise as system to generate co nstant and uniform aerosolized magnetic nanoparticles. The conception of the multiple exposure device was based off of the design principles of the single exposure device, including the features described in the cally important consideration for the multiple

PAGE 46

46 exposure system was the equal distribution of airflow to all cell cultures, to ensure identical dosage. Figure 4 1 i llustrates the design features of the Magnetic Precipitator Multiple Exposure Device (MPMED) including the three primary components: the distributor manifold, the cell culture plate, and the exhaust manifold. The distributor manifold has a single airstream inlet on the top. Internally the inlet airstream is divided into six air streams radially, l eading to the enclosed exposure chambers. The cell culture plate holds a total of six 35mm petri dishes. An o ring is placed around each cell culture dish to make the exposure chamber airtight when the distributor manifold and the cell culture plate are se aled together with clamps. The air stream passes over the cell culture grown at an air liquid interface and the disk magnets ( ND048N 35 Master Magnetics East, Marietta, OH ) located beneath the petri dishes direct the deposition of the MNPs to the surface of the cells. The air stream exits the exposure chamber and converges within the exhaust manifold. A single airstream exhaust is attached to a pump downstream the MPMED. This pumps provides the gentle airstream through the multiple exposure device (~6LPM t hrough the system, 1 LPM through each cell chamber) The second objective was achieved using a constant output atomizer (TSI Aerosol Generator 3076 Shoreview, MN) to generate aerosolized magnetic nanoparticles. The aerosol generation system was coupled with a specially designed aluminum dilution chamber. This chamber is 0.06 m 3 and was designed to facilitate with exposure experiments as discussed in the subsequent section. Testing After the MPMED and aluminum dilution chamber were fabricated, the deliver y system was tested to assess its ability to efficiently deliver MNPs To test the MP M ED

PAGE 47

47 and aerosol generation system, uncoated iron oxide nanoparticles and MagSilica 50 85 were aerosolized using the constant output atomizer. The experimental conditions, including aqueous MNP suspension concentration used in the aerosol generator, are presented in Table 4 1 The airstream with aerosolized MNPs was attached to the aluminum dilution chamber (Fig ure 4 2 ). The MPMED and a scanning mobility particle sizer were at tached downstream the mixing chamber. A pump attached to the mixing chamber provided constant flow through the system (~10 LPM without MPMED, adjusted to 4 LPM with MPMED flow). It took approximately 30 minutes depending on the overall flow through the mi xing chamber, for the system to become stable and the size distribution to become constant. After 45 mins the pump downstream the MPMED was turned on to provide airflow through the exposure system. Quartz fiber fil ters were placed in the MPMED and t hese f ilters were weighed before and after MNP delivery. Actual delivered MNP mass was compared to theoretical delivery mass calculated using the dose model presented in Chapter 2. Since the disk magnets used in the MPMED are larger than those in the MPSED the dose model was adjusted to reflect the stronger external magnetic field provided by the magnets. The theoretical delivery efficiency is presented in Fig ure 4 3 The results indicate that the constant output atomizer can generate aerosolized magnetic nanopar ticles with a stable particle size distribution. This is an improvement to the batch reactor type system previously employed. Secondly, the results show that the MPMED successfully delivers MNPs to the filters and that the deposition is statistically simil ar for all six exposure chambers. Finally, the ability for the dose models to accurately predict dose mass was verified by delivering MNPs to filters within the

PAGE 48

48 MPMED. Therefore, this aerosol generation system coupled with the multiple exposure device has the potential to significantly increase the statistically significance of collected toxicity data and to streamline the exposure procedures by conducting six simultaneous exposures.

PAGE 49

49 Figure 4 1. The Magnetic Precipitator Multiple Exposure Device (MPMED). View from the bottom (left) and view from the top (right). Distributor Manifold O rings Cell Culture Plate Disk Magnets Exhaust Manifold

PAGE 50

50 Table 4 1. Testing Magnetic Precip itator Multiple Exposure Device. MNP Cumulative Volume Conc Median Particle Diameter Delivery Time MPMED Flow Total Chamber Flow Nebulizing Concentration Theoretical Dose Mass Actual Dose Mass (nm 3 /cm 3 ) (nm) (min) (L/min) (L/min) g/mL g g 1 UC 1.36E+10 44.14 1.0 6.0 16.0 26.67 2.24 2.9 2 UC 1.28E+10 43.87 2.0 6.0 16.0 26.67 4.36 4.6 3 UC 5.61E+10 46.54 2.0 6.0 10.0 53.33 19.47 21.5 4 UC 8.94E+10 49.15 1.5 6.0 10.0 106.67 26.54 27.0 5 85 1.64E+10 37.59 2.0 6.0 16.0 26.67 1.88 1.7 6 85 1.37E+10 40.95 2.0 6.0 16.0 53.33 1.31 1.4

PAGE 51

51 Figure 4 2. Experimental design used to test the Magnetic Precipitator Multiple Exposure Device (MPMED).

PAGE 52

52 Figure 4 3. Delivery efficiency for the three types of magnetic nanoparticles used in this study, uncoated iron oxide, MagSilica 85, and MagSilica 50. Efficiencies are presented for both the single and multiple exposure devices. The multiple exposure device uses larger disk magnets, thereby increasing delivery efficiency as compared to the single expos ure device.

PAGE 53

53 CHAPTER 5 FUTURE APPLICATIONS The previous chapter established the efficiency of the multiple exposure device and the aerosol generation system. This chapter briefly introduces possible applications for the MPMED system. The potential future ap plications include the assessment of the toxicity associated with a secondary organic aerosol generated from a common household air contaminant s and the investigation of the inhalation toxicity associated with automobile combustion particle exposure. Indoo r Air Pollution Exposure Study The MPMED system could be used to investigate the respiratory health effects of secondary organic aerosols. For example, d limonene, a volatile organic compound, is found in numerous commercial and household products includin g cleaners, air fresheners, and paint removers. The identifiable citrus scent associated with d limonene is a general indication of its use. D limonene can react with ozone to form less volatile products that condense to generate secondary organic aerosol. This process and associated health effects could be investigated using the MPMED. Figure 5 1 illustrates a possible experimental design used to assess the effects d limonone SOA on in vitro human lung cells. T he aerosol generator aerosolizes MNPs followe d by an ozone generator. A VOC injector system could be used to provide a constant concentration of d limonene. Within the aluminum mixing chamber, the oxidation of d limonene by ozone would create less volatile products that would condense onto and coat t he aerosolized MNPs. The MNPs coated with SOA could be delivered to the cell cultures and cellular toxicity assessment could follow. Preliminary investigations show that this system can

PAGE 54

54 be used to generate stable concentrations of MNP, ozone, and precursor VOC. The dose model can be used to predict the mass of SOA delivered to the cells. Automobile Combustion Particle Exposure The MPMED system could also be used to investigate the respiratory health effects of automobile combustion particulate matter (PM). Figure 5 2 illustrates a potential experimental setup to accomplish this goal. Automobile combustion PM could be injected into the large University of Florida Atmospheric Photochemical Reactor (Fig ure 5 3 ). A sampling line directly connected to the UF APHOR could be used to introduce PM into the aluminum mixing chamber. Within the chamber, the aerosolized MNPs and PM would coagulate. The coagulant could then be delivered to the cells in the MPMED. A delivery dose model would need to be established to adequat ely predict the dose when the MNPs and PM coagulate. The short exposure times afforded by the MPMED would provide a considerable advantage over other systems. For example, it would be possible to conduct multiple exposure throughout the day to assess the h ealth effects of aged automobile exhaust.

PAGE 55

55 Figure 5 1. Possible experimental design to investigate the in vitro respiratory effects of indoor air pollution generated from d limonene. Figure 5 2. Possible experimental design to investigate the in vitro respiratory effects of automobile combustion particulate matter.

PAGE 56

56 Figure 5 3. University of Florida Atmospheric Photochemical Reactor (UF APHOR), located on the roof of Black Hall, Gainesville FL.

PAGE 57

57 CHAPTER 6 CONCLUSION AND SUMMA R Y The field o f inhalation toxicology uses numerous tools and methodologies to derive information from complex sources. Each of the methodologies has associated merits and limitations. In general, in vitro exposure systems are quick, cost efficient, provide control led e xperimental conditions, and reduce the need for animal or human test subjects. However, concerns regarding the ability to extrapolate in vitro results to the in vivo level have limited the acceptance of this type of toxicity assessment. The focus of this r esearch was to improve the use of in vitro exposure systems by reducing deficiencies while retaining the numerous benefits. The research conducted in this study showed that using magnetic nanoparticles to increase the delivery efficiency of air contaminan ts to the surface of human lung cells is a viable alternative to contemporary in vitro methods. The study showed that MNPs coated with amorphous silica are not only chemically stable, but are also a suitable material for the novel exposure system, as evidenced by their reduce cytotoxicity and cellular influence. The prototype design used in the first series of investigations was improved upon to include a multiple exposure device and a constant aerosol generation system to provide a uniform output of aerosolized magnetic nanoparticles. The Magnetic Precipitator Multiple Exposure Device provi des numerous advantages, including high delivery efficiency, short exposure time, low air flow through the system, cost effectiveness, and ease of use. The devised system has the prospect to successfully study the respiratory health effects of a variety of different air pollutants, including secondary organic aerosol, combustion particulate matter, industrial emissions, etc.

PAGE 58

58 LIST OF REFERENCES alvati, A., McKerr, G., Lynch, I., Dawson, K. A. and Howard, C. V. (2008). Reproducible Comet Assay of Amorphous Silica Nanoparticles Detects No Genotoxicity. Nano Letter s 8:3069 3074. Bell, M. L., Davis, D. L. and Fletcher, T. (2008). A Retrospective Assessment of Mortality from the London Smog Episode of 1952: The Role of Influenza and Pollution Urban Ecology, J. M. Marzluff, E. Shulenberger, W. Endlicher, M. Alberti G. Bradley, C. Ryan, U. Simon and C. ZumBrunnen, eds., Springer US, 263 268. Boubel, R. W., Fox, D. L., Turner, D. B. and Stern, A. C. (1994). Fundamentals of air pollution. Third edition Carter, J., Ghio, A., Samet, J. and Devlin, R. (1997). Cytokine production by human airway epithelial cells after exposure to an air pollution particle is metal dependent. Toxicology and Applied Pharmacology ,180 188. Castell, J. V., Gmez Lechn, M. J. a nd ScienceDirect (1997). In vitro methods in pharmaceutical research Academic Press, San Diego. Chen, L. C. and Lippmann, M. (2009). Effects of Metals within Ambient Air Particulate Matter (PM) on Human Health. Inhalation Toxicology 21:1 31. Cheng, M M. C., Cuda, G., Bunimovich, Y. L., Gaspari, M., Heath, J. R., Hill, H. D., Mirkin, C. A., Nijdam, A. J., Terracciano, R., Thundat, T. and Ferrari, M. (2006). Nanotechnologies for biomolecular detection and medical diagnostics. Current Opinion in Chemic al Biology 10:11 19. Coggins, C. R. E. (2001). Review Article: A Review of Chronic Inhalation Studies with Mainstream Cigarette Smoke, in Hamsters, Dogs, and Nonhuman Primates. Toxicologic Pathology 29:550 557. Cooper, P., Potter, S., Mueck, B., Yousefi, S. and Jarai, G. (2001). Identification of genes induced by inflammatory cytokines in airway epithelium. American Journal of Physiology Lung Cellular and Molecular Physiology 280:L841 L852. Dockery, D. W., P ope, C. A., Xu, X., Spengler, J. D., Ware, J. H., Fay, M. E., Ferris, B. G. and Speizer, F. E. (1993). An Association between Air Pollution and Mortality in Six U.S. Cities. New England Journal of Medicine 329:1753 1759. Duguet, E., Vasseur, S., Mornet, S. and Devoisselle, J. M. (2006). Magnetic nanoparticles and their applications in medicine. Nanomedicine 1:157 168.

PAGE 59

59 Gad, S. C. (1994). In vitro toxicology Raven Press, New York. Ghio, A. J. and Cohen, M. D. (2005). Disruption of Iron Homeostasis as a Mechanism of Biologic Effect by Ambient Air Pollution Particles. Inhalation Toxicology 17:709 716. Ghio, A., Stonehuerner, J., Richards, J., Crissman, K., Roggli, V., Piantadosi, C and Carraway, M. (2008). Iron homeostasis and oxidative stress in idiopathic pulmonary alveolar proteinosis: a case control study. Respiratory Research : Ghio, A. J., Dailey, L. A., Richards, J. H. and Jang, M. (2009). Acid and organic aerosol coatings on magnetic nanoparticles increase iron concentrations in human airway epithelial cells. Inhalation Toxicology 21:659 667. Gleich, B. and Weizenecker, J. (2005). Tomograp hic imaging using the nonlinear response of magnetic particles. Nature 43 5:1214 1217. Guo, P. (2005). RNA Nanotechnology: Engineering, Assembly and Applications in Detection, Gene Delivery and Therapy. Journal of N anoscience and N anotechnology 5:1964 1982. Hansen, M. B., Nielsen, S. E. and Berg, K. (1989). Re examination an d further development of a precise and rapid dye method for measuring cell growth/cell kill. Journal of Immunological Methods ,119:203 210. He, X. (2004). A Novel Fluorescent Label Based on Organic Dye Doped Silica Nanoparticles for HepG Liver Cancer Ce ll Recognition. Journal of N anoscience and N anotechnology 4:585 589. Hussain, S. M., Hess, K. L., Gearhart, J. M., Geiss, K. T. and Schlager, J. J. (2005). In vitro toxicity of nanoparticles in BRL 3A rat liver cells. Toxicology in Vitro 19:975 983. Jang, M. and Cao, G. (2006 ). Deposition of Magnetic Nanoparticles Suspended in the Gas Phase on a Specific Target Area. Environmental Science & Technology 40:6730 6737. Jang, M. Ghio, A. J. and Cao, G. (2006 ). Exposure of BEAS 2B Cells to Secondary Organic Aerosol Coated on Magnetic Nanoparticles. Chemical Research in Toxicology 19:1044 1050. Jeng, H. A. and Swanson, J. (2006). Toxicity of Metal Oxide Nanoparticles in Mammalian Cells. Journal of Environmental Science and Health, Part A: Toxic/Haza rdous Substances and Environmental Engineering 41:2699 2711.

PAGE 60

60 Johnston, C. J., Driscoll, K. E., Finkelstein, J. N., Baggs, R., O'Reilly, M. A., Carter, J., Gelein, R. and Oberdrster, G. (2000). Pulmonary Chemokine and Mutagenic Responses in Rats after Subchronic Inhalation of Amorphous and Crystalline Silica. Toxicological Sciences 56:405 413. Jordan, A., Scholz, R., Maier Hauff, K., Johannsen, M., Wust, P., Nadobny, J., Schirra, H., Schmidt, H., Deger, S., Loening, S., Lanksch, W. and Felix, R. (200 1). Presentation of a new magnetic field therapy system for the treatment of human solid tumors with magnetic fluid hyperthermia. Journal of Magnetism and Magnetic Materials 225:118 126. Jost, M., L., Kirkwood, M., J., Whiteside and L., T. (1992). Improv ed short and long term XTT based colorimetric cellular cytotoxicity assay for melanoma and other tumor cells Elsevier, Amsterdam, PAYS BAS. Nanoparticles Are Highly Tox ic: A Comparison between Metal Oxide Nanoparticles and Carbon Nanotubes. Chemical Research in Toxicology 21:1726 1732. Koo, O. M., Rubinstein, I. and Onyuksel, H. (2005). Role of nanotechnology in targeted drug delivery and imaging: a concise review. Nanomedicine: Nanotechnology, Biology and Medicine ,1:193 212. Kroell, M., Pridoehl, M., Zimmermann, G., Pop, L., Odenbach, S. and Hartwig, A. (2005). Magnetic and rheological characterization of novel ferrofluids. Journal of Magnetism and Magnetic Materials 289:21 24. Lee, J. H., Huh, Y. M., Jun, Y. w., Seo, J. w., Jang, J. t., Song, H. T., Kim, S., Cho, E. J., Yoon, H. G., Suh, J. S. and Cheon, J. (2007). Artificially engineered magnetic nanoparticles for ultra sensitive molecular imaging. Nat Med 13:95 99. Livak, K. J. and Schmittgen, T. D. (2001). Analysis of Relative Gene Expression Data Using Real Time Quantitative PCR and the 2 [Delta][Delta]CT Method. Methods 25:402 408. Mane, V. P., Heuer, M. A., Hillyer, P., Navarro, M. B. and Rabin R. L. (2008). Systematic Method for Determining an Ideal Housekeeping Gene for Real Time PCR Analysis, The Association of Biomolecular Resource Facilities. Moeser, G. D., Roach, K. A., Green, W. H., Alan Hatton, T. and Laibinis, P. E. (2004). High gra dient magnetic separation of coated magnetic nanoparticles. AIChE Journal 50:2835 2848.

PAGE 61

61 Nenes, A., Pandis, S. N. and Pilinis, C. (1998). ISORROPIA: A New Thermodynamic Equilibrium Model for Multiphase Multicomponent Inorganic Aerosols. Aquatic Geochem istry 4:123 152 152. Oberdrster, G., Celein, R. M., Ferin, J. and Weiss, B. (1995). Association of Particulate Air Pollution and Acute Mortality: Involvement of Ultrafine Particles? Inhalation Toxicology 7:111 124. Ok, Z. D., Benneyan, J. C. and Isaacs, J. A. (2009). Nanotechnology environmental, health, and safety issues: Brief literature review since 2000. IEEE International Symposium on Sustainable Systems and Technology :1 5. Pankhurst, Q. A. and et al. (2003). Applications of magnetic nanoparticles in biomedicine. Journal of Physics D: Applied Physics 36:R167. Park, S. J., Taton, T. A. and Mirkin, C. A. (2002). Array Based Electrical Detection of DNA with Nanoparticle Prob es. Science 295:1503 1506. Paur, H. R., Cassee, F. R., Teeguarden, J., Fissan, H., Diabate, S., Aufderheide, M., Kreyling, W. G., Hnninen, O., Kasper, G., Riediker, M., Rothen Rutishauser, B. and Schmid, O. (2011). In vitro cell exposure studies for th e assessment of nanoparticle toxicity in the lung -A dialog between aerosol science and biology. Journal of Aerosol Science 42:668 692. Pham, Q. P. (2006). Electrospinning of Polymeric Nanofibers for Tissue Engineering Applications: A Review. Tissue eng ineering 12. Pope, C. A. (2000). Review: Epidemiological Basis for Particulate Air Pollution Health Standards. Aerosol Science and Technology 32:4 14. Rahman, I. (2002). Oxidative stress, transcription factors and chromatin remodelling in lung inflammation. Biochemical Pharmacology 64:935 942. Roden, E. E. (1996). Microbial reduction of crystalline iron (III) oxides: Influence of oxide surface area and potential for cell growth. Environmental S cience & T echnology 30. Soukup, J. M. and Becker, S. (2001). Human Alveolar Macrophage Responses to Air Pollution Particulates Are Associated with Insoluble Components of Coarse Material, Including Particulate Endotoxin. Toxicology and Applied Pharmacology 171:20 26. Stookey, L. L. (1970). Ferro zine --a new spectrophotometric reagent for iron. Analytical Chemistry 42:779 781.

PAGE 62

62 Tartaj, P., Gonzlez Carreo, T. and Serna, C. J. (2002). Synthesis of Nanomagnets Dispersed in Colloidal Silica Cages with Applications in Chemical Separation. Langmuir 18:4556 4558. Vatta, L. L. (2006). Magnetic nanoparticles: Properties and potential applications. Pure and applied chemistry 78:1793. Veranth, J. M., Kaser, E. G., Veranth, M. M., Koch, M. and Yost, G. S. (2007). Cytokine responses of human lung cells (BEAS 2B) treated with micron sized and nanoparticles of metal oxides compared to soil dusts, BioMed Central Ltd. Volckens, J. and Leith, D. (2002). Filter and electrostatic samplers for semivolatile aerosols: Physical artifacts. Environmental Science & Technology :4613 4617. Weigel, T. (2009). Investigation of parameters to achieve temperatures required to initiate the shape memory effect of magnetic nanocomposites by inductive heating. Smart materials and structures 18. Weizenecker, J., Gl eich, B., Rahmer, J., Dahnke, H. and Borger, J. (2009). Three dimensional real time in vivo magnetic particle imaging. Physics in Medicine and Biology 54:L1 L10. Wilkins, E. T. (1954). Air pollution aspects of the London fog of December 1952. Quarterly Journal of the Royal Meteorological Society 80:267 271. Yellen, B. B., Hovorka, O. and Friedman, G. (2005). Arranging matter by magnetic nanoparticle assemblers. Proceedings of the National Academy of Sciences of the United States of America 102:8860 8864.

PAGE 63

63 BIOGRAPHICAL SKETCH Ori Baber graduate d Summa Cum Laude in December 2009 with a Bachelor of Science in biology from the University of Florida He entered graduate school in January 2010 with the Department of Envir onmental Engineering, under the guidance of Dr. Myoseon Jang. Upon completion of his m the field of air quality and inhalation toxicology.