<%BANNER%>

Comparative Efficiency of Different Real-Time PCR Platforms and Chemistries for the Detection of Animal, Avian, and Huma...

Permanent Link: http://ufdc.ufl.edu/UFE0043771/00001

Material Information

Title: Comparative Efficiency of Different Real-Time PCR Platforms and Chemistries for the Detection of Animal, Avian, and Human Influenzas
Physical Description: 1 online resource (115 p.)
Language: english
Creator: Prakoso, Dhani
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: influenza -- pcr -- realtimepcr -- swine
Veterinary Medicine -- Dissertations, Academic -- UF
Genre: Veterinary Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The goal of this research was to determine if PCR protocols can be standardized between laboratories for influenza testing. First, 25 influenza viruses, consisting of five organisms each from five animal species were tested with two primer/probe assays used by health laboratories compared as side-by-side reactions. There was no difference in the mean Ct values for each protocol; all strains were detected at all dilutions except one avian strain. Significant differences were observed between strains. Second, the performance of two real-time PCR machines and four master mixes was compared using a pandemic (H1N1) 2009 influenza virus isolate. No differences were detected with these variables based on the average Ct's, CV's, slopes, and reaction efficiencies. Third, a swine influenza typing protocol which was developed for typing pandemic influenza viruses was tested to determine if this could be used for typing other species' isolates. This protocol is only specific for H1N1 and it should be validated for use against influenza viruses of various origins. Fourth, sampling of swine was performed to determine if swine H1N1 is commonly shed nasally from Florida pigs. A total of 526 swine were tested and no swine influenza was detected in healthy swine. In conclusion, the protocols tested are robust over wide range of Influenza A isolates and are interchangeable between chemistries and platforms tested. Finally, we are 95% confident that if the prevalence of swine influenza was = 0.4%, then the swine influenza disease would have been detected using the number of animals which we tested.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Dhani Prakoso.
Thesis: Thesis (M.S.)--University of Florida, 2011.
Local: Adviser: Long, Maureen T.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-06-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043771:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043771/00001

Material Information

Title: Comparative Efficiency of Different Real-Time PCR Platforms and Chemistries for the Detection of Animal, Avian, and Human Influenzas
Physical Description: 1 online resource (115 p.)
Language: english
Creator: Prakoso, Dhani
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: influenza -- pcr -- realtimepcr -- swine
Veterinary Medicine -- Dissertations, Academic -- UF
Genre: Veterinary Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The goal of this research was to determine if PCR protocols can be standardized between laboratories for influenza testing. First, 25 influenza viruses, consisting of five organisms each from five animal species were tested with two primer/probe assays used by health laboratories compared as side-by-side reactions. There was no difference in the mean Ct values for each protocol; all strains were detected at all dilutions except one avian strain. Significant differences were observed between strains. Second, the performance of two real-time PCR machines and four master mixes was compared using a pandemic (H1N1) 2009 influenza virus isolate. No differences were detected with these variables based on the average Ct's, CV's, slopes, and reaction efficiencies. Third, a swine influenza typing protocol which was developed for typing pandemic influenza viruses was tested to determine if this could be used for typing other species' isolates. This protocol is only specific for H1N1 and it should be validated for use against influenza viruses of various origins. Fourth, sampling of swine was performed to determine if swine H1N1 is commonly shed nasally from Florida pigs. A total of 526 swine were tested and no swine influenza was detected in healthy swine. In conclusion, the protocols tested are robust over wide range of Influenza A isolates and are interchangeable between chemistries and platforms tested. Finally, we are 95% confident that if the prevalence of swine influenza was = 0.4%, then the swine influenza disease would have been detected using the number of animals which we tested.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Dhani Prakoso.
Thesis: Thesis (M.S.)--University of Florida, 2011.
Local: Adviser: Long, Maureen T.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-06-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043771:00001


This item has the following downloads:


Full Text

PAGE 1

1 COMPARATIVE EFFICIENCY OF DIFFERE NT REAL-TIME PCR PLATFORMS AND CHEMISTRIES FOR THE DETECTION OF ANIMAL, AVIAN, AND HUMAN INFLUENZAS By DHANI PRAKOSO A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Dhani Prakoso

PAGE 3

3 To my wife and parents, for their love and continuous support throughout the years

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank the members of Dr. Longs lab, including Sally Beachboard, Junjie Liu, Nanny Wenzlow, and especia lly to Dr. Maureen Long for her constant support, assistance, and mentoring. I also thank our collaborator laboratory Global Pathogens Laboratory, Dr. Gregor y Gray and Dr. Gary Heil. Many thanks would be dedicated for my committee members Dr. Maureen Long, Dr. Gregory Gray, Dr. Jorge Hernandez, and Dr. Paul Gibbs for their val uable insight and help in the preparation of the thesis. My masters study would not be accomplished without fe llowship from United States Department of State (Fulbright fellowship program) and Office of Research and Graduate Studies (University of Florida, College of Veterinar y Medicine) and I would like to thank and acknowledge this assistance. I am especially thankful for my parents and family for their help and prayers. A specia l thanks and dedication to my wife, Helen for her support and patience throughout my graduate study. The technical support for this project was funded by the Unit ed States Department of Agri culture (T-star Program).

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDG MENTS..................................................................................................4LIST OF TABLES............................................................................................................8LIST OF FIGURE S........................................................................................................10ABSTRACT...................................................................................................................11 CHAPTER 1 INTRODUCTION....................................................................................................132 LITERATURE BACKGRO UND OF INFL UENZA....................................................16Virus Charac teristics...............................................................................................16Genes.....................................................................................................................17Disease in Humans an d Major Outbreaks..............................................................18Symptomo logy..................................................................................................18Spanish Flu......................................................................................................19Asian Flu..........................................................................................................20Hong Kong Flu.................................................................................................20Russian Flu......................................................................................................20High Pathogenicity Avian Flu............................................................................21Pandemic (H1N 1) 2009....................................................................................21Disease in Animals.................................................................................................22Swine...............................................................................................................22Birds.................................................................................................................24Horses..............................................................................................................26Canine..............................................................................................................26Diagnos tics.............................................................................................................27Reassortment of Infl uenza......................................................................................28PCR Tech nology .....................................................................................................29PCR Platform Technol ogy................................................................................29PCR Chem istry.................................................................................................30PCR and Influenz a Diagnos tics........................................................................32Current Status of Swine Surv eillance.....................................................................333 TESTING THE PERFORMANCE (SENSITIVITY) OF INFLUENZA A CDC AND INFLUENZA A RICHT DETECTION PROTOCOLS AGAINST VARIOUS INFLUENZA ISOLATES.........................................................................................35Backgr ound.............................................................................................................35Materials and Methods............................................................................................40Virus St ocks.....................................................................................................40

PAGE 6

6 Hemagglutinat ion Assay...................................................................................40Final PCR Protocol...........................................................................................41Analys is............................................................................................................42Result s.............................................................................................................42Discuss ion........................................................................................................444 USE STANDARDIZED PROTOCOLS TO COMPARE THE PERFORMANCE OF TWO REAL-TIME PCR PLATFORMS USING FOUR DIFFERENT MASTER MIXES.....................................................................................................................57Backgr ound.............................................................................................................57Materials and Methods............................................................................................60Real-Time PCR Platforms and Master Mixes...................................................60Primer and Probe Se ts.....................................................................................61One-Step PCR Protocol...................................................................................62Two-Step PCR Protocol...................................................................................62Viruse s.............................................................................................................63Analys is............................................................................................................63Results....................................................................................................................64One-Step PCR Protocol...................................................................................64Two-Step Pr otocols..........................................................................................64Discuss ion..............................................................................................................655 GENOTYPING ANIMAL INFLUENZA ISOLATES USING MAK PROTOCOL........74Backgr ound.............................................................................................................74Materials and Methods............................................................................................76Screening Me thodology....................................................................................76PCR Prot ocol....................................................................................................77Influenza Vi ruses..............................................................................................78Analysis and In terpretation.....................................................................................78Results....................................................................................................................78First Sc reening.................................................................................................78Second Sc reening............................................................................................79Third Sc reening................................................................................................79Discuss ion..............................................................................................................806 SURVEILLANCE OF SWINE INFLUENZA IN FLORIDA........................................93Backgr ound.............................................................................................................93Materials and Methods............................................................................................95Sampling St rategy............................................................................................95PCR Prot ocol....................................................................................................96Results....................................................................................................................97Discuss ion..............................................................................................................98LIST OF RE FERENCES.............................................................................................103

PAGE 7

7 BIOGRAPHICAL SKETCH..........................................................................................115

PAGE 8

8 LIST OF TABLES Table page 3-1 Influenza isolates, species of origin, laboratory source, and HA titer used to compare the reaction efficienc ies of two PC R protoc ols.....................................473-2 Primer and probe sequences for detec tion of swine influenza from nasal swabs.................................................................................................................473-3 Average R2, slopes, and PCR efficiencies of all isolates using INFA CDC and INFA Richt pr imer sets.......................................................................................483-4 Average cycle threshold (Ct), stan dard deviation (SD), and median for all isolates using INFA CDC and INFA Richt pr imer sets........................................494-1 Primer and probe sequences for detection of pandemic (H1N1) 2009 influenz a.............................................................................................................704-2 Comparing Cts, SDs and CV of T aqMan chemistries master mixes. Data represents three replications; well s with CVs more than 10% are not analyzed in the data...........................................................................................714-3 Comparing Cts, SDs and CV of SYBR Green chemistries master mixes. Data represents three replications; we lls with CVs more than 10% are not analyzed in the data...........................................................................................724-4 Comparing iScript One-Step RT PCR Kit for Probes and TaqMan Fast Virus 1-Step Master Mix ...............................................................................................734-5 Comparing iTaq Fast SYBR Gr een Supermix with ROX and Fast SYBR Green Master Mix...............................................................................................735-1 Table List of Primer-Probe sets targeting for t he Mak pr otocol...........................865-2 List of isolates tested in the Mak prot ocol for typing and identification of triple reassortant Infl uenza viru ses..............................................................................865-3 Melt Curve Results of Screen Round 3 of the Mak Protocol for Swine and Human In fluenza................................................................................................875-4 Melt Curve Results of Screen Round 3 Mak Protoc ol for Avian, Canine and Equine In fluenza.................................................................................................885-5 Interpretation of PCR Test using Mak protocol against Matrix, HA, NA, and PB2 genes ..........................................................................................................90

PAGE 9

9 5-6 Results of the first (INFA CDC Protocol), second (probe based PCR Protocol), and third screeni ng (SYBR pr otocol)..................................................916-1 Primer and probe sequences for detecti on of swine influenza from nasal swabs...............................................................................................................1026-2 Results of convenience sampling to detect influenza in Florida swine.............102

PAGE 10

10 LIST OF FIGURES Figure page 3-1 Comparison Cts of INFA CDC and INFA Richt primer sets for swine influenza is olates................................................................................................543-2 Comparison Cts of INFA CDC and INFA Richt primer sets for swine influenza is olates................................................................................................543-3 Comparison Cts of INFA CDC and INFA Richt primer sets for human influenza is olates................................................................................................553-4 Comparison Cts of INFA CDC and INFA Richt primer sets for canine influenza is olates................................................................................................553-5 Comparison Cts of INFA CDC and INFA Richt primer sets for equine influenza is olate..................................................................................................565-1 Testing Algorithm for Genotyp ing Animal Infl uenza Isol ates..............................855-2 Melting Curve of Canine Influenz a......................................................................92

PAGE 11

11 Abstract of Thesis Pres ented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for t he Degree of Master of Science COMPARATIVE EFFICIENCY OF DIFFERE NT REAL-TIME PCR PLATFORMS AND CHEMISTRIES FOR THE DETECTION OF ANIMAL, AVIAN, AND HUMAN INFLUENZAS By Dhani Prakoso December 2011 Chair: Maureen T. Long Major: Veterinary Medical Sciences The goal of this research was to determi ne if PCR protocols can be standardized between laboratories for influenza testing. Firs t, 25 influenza viruses, consisting of five organisms each from five animal species were tested with two primer/probe assays used by health laboratories compared as side-by-side reactions. There was no difference in the mean Ct values for each pr otocol; all strains were detected at all dilutions except one avian stra in. Significant differences were observed between strains. Second, the performance of tw o real-time PCR machines and four master mixes was compared using a pandemic (H1N1) 2009 influenz a virus isolate. No differences were detected with these variables based on t he average Cts, CVs, slopes, and reaction efficiencies. Third, a swine influenza typi ng protocol which was developed for typing pandemic influenza viruses was tested to determine if this could be used for typing other species isolates. This protocol is onl y specific for H1N1 and it should be validated for use against influenza viruses of various origins. Fourth, sampling of swine was performed to determine if swine H1N1 is co mmonly shed nasally from Florida pigs. A

PAGE 12

12 total of 526 swine were tested and no swine in fluenza was detected in healthy swine. In conclusion, the protocols tested are robust over wide range of Influenza A isolates and are interchangeable between chemistries and pl atforms tested. Finally, we are 95% confident that if the preval ence of swine influenza was 0.4%, then the swine influenza disease would have been detected using t he number of animals which we tested.

PAGE 13

13 CHAPTER 1 INTRODUCTION Since the start of the 2009 influenza pandemic, domestic and international swine surveillance has been limited to regulator y processes. While testing has been standardized under the guidelines of international organiza tions, there are many new polymerase chain reaction (PCR) methods and many new platforms. This variety of methods and technology has made these standar ds essentially only recommendations because little is known how these standar d protocols compare using different technology, chemistries and, more importantly multiple lineages of Influenza. Current cutting edge science is capable of worldwide real-time influenza virus reassortment surveillance, which combined with high perfo rmance computing and publicly available resources, can forecast changes in virul ence and host adaptation before a pandemic, if proper validation techniques ar e applied to these evolving scientific resources. This research is a needs study to understand how di fferent real-time techniques affect our ability to detect influenzas across spec ies and with different technologies. These tools provide real time surve illance of the evolution and new species adaptation of influenza. Howeve r, between labs, there must also have consensus on adequate surveillance. Currently, there is limited information r egarding the incidence of shedding of influenza in swine populations in the Southeastern United States (US). Several reasons for this include limited re sources for animal testing compared to humans, focus in government funded laboratorie s on regulated diseases of interest, use of passive surveillance which minimizes succe ssful collection of actively circulating swine influenza virus (SIV) isolates, and conc ern by stakeholders that identification of infected swine will lead to severe repercussions for the industry. This latter issue cannot

PAGE 14

14 be minimized especially for vulnerable swine markets in developing countries. This project is a needs study to build regional expertise in the detection and characterization of SIV in subtropical U.S. (Florida). As su ch, two overall goals will be accomplished which has been supported by the United States Department of Agriculture (USDA Tstar) funding: 1) compare the reaction efficiencies of differ ent real-time PCR platforms and chemistries for the detection of animal, avian and human influenzas, and 2) sample populations of production and non-production managed swine in Florida for SIV. The data from this research are presented in four chapters. In Chapter 3, we tested the performance (sensit ivity) of Influenza A CDC (Centers for Disease Control and Prevention) (referred to herein as IN FA CDC) and Influenza A Richt (referred to herein as INFA Richt) detection protocols agai nst various influenza isolates. The INFA CDC primer set is a protocol which com ponent of it was designed to detect the pandemic (H1N1) 2009 influenza fr om human while the INFA Richt set was designed to detect swine influenza from animal, mainly s wine. The goal of these experiments is to determine if standardized protocols are in terchangeable and comparatively efficient between various influenza isolates isolat ed from horses, humans, swine, birds and dogs. In Chapter 4, we used st andardized protocols to comp are the performance of two real-time PCR platforms using four different master mixes. Laborator ies are set all over the world, and depending on funding, different machines are used. Each real-time PCR machine has different technology based on li ght source, signal detector, and ramping speed. The master mixes also have different chemistries. Two of the most commonly used chemistries in real-time PCR master mixes are TaqMan probes and SYBR Green

PAGE 15

15 I. Each of them has advantages and disadvantages. This specific aim determines if the two most commonly used real-time PCR pl atforms for influenza diagnostic have comparable performance. In Chapter 5 we investi gated a genotyping protocol recently described in the literature. This protocol was designed to detect gene reasso rtment of pandemic (H1N1) 2009 influenza in swine isolates.1 This protocol is highly specific for pandemic (H1N1) 2009 isolates. A different aspect of this protoc ol compared to the other protocols is that of genotyping the pandemic (H1N1) 2009 based on each of the genes belonging to influenza virus. In Chapter 6, we performed a small pilot study surveying for swine influenza in Florida hogs. Little information is known about the swine infl uenza status in the swine herd populations in Florida. Nasal swabs collected from s wine at slaughter, 4-H shows, and a research facility in Florida. The objec tive was to see if triple reassortant and pandemic (H1N1) 2009 influenza viruses are det ected in swine popul ation in Florida. Data from this research will allow initial assessment of the status of swine influenza in Florida swine herds. If swine influenza is detected, further hypotheses can be investigated in a formalized case-control research design to determine the risk-factors associated with swine influenza in Florida and these can be used to develop mitigation efforts. This information will also indicate the possible need for pre-sale or pre-event testing of swine.

PAGE 16

16 CHAPTER 2 LITERATURE BACKGROUND OF INFLUENZA Virus Characteristics Influenza is a disease which is caused by a virus from a family member of Orthomyxoviridae. Orthomyxov iridae viruses have negative sense ssRNA type nucleic acid. Orthomyxoviridae comes from Greek orthos meaning correct and myxa meaning mucus.2 This family contains five genera which are genus Influenzavirus A, genus Influenzavirus B, genus Influenzavirus C, genus Isavirus and genus Thogotovirus. The genuses Influenzavirus A, B, and C infect vertebrates causing influenza. The genus Isavirus is known to infect salmon fis hes, while the genus Thogotovirus infects ticks.3 The genus Influenzavirus A is divided bas ed on the hemagglutinin (HA or H) and neuraminidase (NA or N) types There are 16 subtypes of hemagglutinin (H1-H16) and 9 subtypes of neuraminidase (N1-N9). These HA and NA subtypes can assort together in any combination, so they can form 144 po ssible combinations. All of the Influenza A HA and NA subtypes (16 and 9 respective ly) have been isolated from wild waterfowl and seabirds.4 The influenza A viruses are known to infect birds and mammals including humans, swine, horses, dogs, cats, w hales, and seals. Certain subtypes of HA are likely to be found in certain species, fo r example H3, H4 and H6 subtypes are most likely to be found in ducks in North America, H5 and H7 in chickens, H1 and H3 in swine, and H3 in horses.5;6 Some of these subtypes are highly pathogenic within the natural host species and to other hosts s pecies, and some are non-pathogenic to their natural host species.7

PAGE 17

17 Genes The Orthomyxoviridae viruses have 8 segments which encode 10 polypeptides, and are assigned with numbers from 1 to 8. The first segment encodes polymerase basic 2 (PB2) protein which is a component of RNA polymerase for cap recognition. Segment 2 encodes polymerase basic 1 (PB1) protein for endonuclease activity and elongation. Segment 3 encodes polymerase ac id (PA) protein which has proteolytic activity and also has functions in transcr iption and replication. Segment 4 encodes hemagglutinin (HA) protein. This protein is a major antigen; it serves as surface glycoprotein, responsible to bind the virus to the cellular sialic acid receptors, and has fusion activity. Segment 5 encodes the nucl eoprotein (NP) and it has roles in RNA binding, synthesis, and nuclear import. Segment 6 encodes the neuraminidase (NA) protein and it is also part of surface glyc oproteins and has neuraminidase activity. This protein cleaves sialic acid residues from glycoproteins or glycolipids; and helps to discharge virus from infected cells. Antivira l drugs such as oseltamivir and zanavir target this protein for thei r activity. Segment 7 encodes ma trix 1 (M1) and matrix 2 (M2) proteins. M1 protein involves in interacti on with viral ribonucleoprotein (vRNPs), nuclear export, and budding; it is also one of the surface glycopr oteins. The M2 protein has roles in ion channel activity and assembly. The M2 protein is targeted by antiviral drugs amantadine and rimantadine. Segment 8 encodes NS1 (nonstructural 1) and NEP/NS2 (nuclear export protein/nonstructu ral) proteins. The NS1 protei n is viral IFN (interferon) antagonist while the NS2 protein has f unction in nuclear export of vRNPs.2;3;8 Influenza virus is composed of a s egmented genome which r eassorts frequently between two different influenza viruses.9;10 It is hypothesized t hat genetic reassortment phenomenon occurs when two different influenza viruses simultaneously infect one

PAGE 18

18 cell.6;8 The receptors on the cell surface have a crit ical role in virus binding. Specifically, the viral HA gene binds to sialic acid residues on glycolipids on the cell surface.11 Human influenza viruses preferentially bind to sialic acid attached to galactose, as a 2.6 linkage, whereas avian influenza viruses tend to bind to sialic acid attached to galactose, as a 2.3 linkage.12 Pigs have both 2.3 galactose and 2.3 galactose linkages on epithelial cells of their trachea, which makes them susceptible to both human influenza and avian influenza. The presence of multiple receptors is the basis for the concern that the pig is the actual mixing vessel in which influenza viruses reassert.12 Disease in Humans and Major Outbreaks Symptomology This overview of disease in humans mainly focuses upon major outbreaks. Briefly, influenza is a highly contagious virus that is spread from humans to humans via respiratory secretions (called large droplets).13 After an incubation period of 1-4 days, shedding begins about 24 hours bef ore the onset of clinical signs and usually persists for 5-10 days. In children, shedding can occur several days before illness and can persist for 10 or more days.13 In uncomplicated human cases of influenza, there is rapid onset of both upper respiratory infection and systemic signs consisting of dry cough, sore throat, and rhinitis, accompanies by high fever, muscle pain, headache and malaise. Gastrointestinal signs are not as common in adults but children often have nausea and vomiting and concurrent otitis. The duration is sh ort, 3-7 days; however the cough and fatigue can persist. The primary co mplication of influenza is bacterial pneumonia, sinusitis, and otitis. Syndromes post-influenza can also occur and these

PAGE 19

19 include encephalopathy, transverse myelitis, my ositis, myocarditis, pericarditis and Reye syndrome.14 Annual localized epidemics of seasonal in fluenza occur world-wide and in the US, the winter months represent the peak of flu season.15 The death loss varies, but the average death loss in the US during the 1990s was 36,000/y ear with highest risk of mortality among persons >65, young childr en, and medically compromised people. During the 1990s, the estimated influenza as sociated deaths per 100,000 persons was 0.4-0.6 in persons up to 49 years, 7l5 among persons between 50 and 64 years and 98.3 in persons 65 years of age or older.16 Spanish Flu An outbreak which could have been due to influenza was reported as early as 412 BC by Hippocrates.8 but one of the best recorded gr eat outbreaks of influenza was Spanish Flu from 1918-1920. Deaths occurred in 40-50 million people around the world, exceeding the total number of caus alities of World War I (1914-1918).17-26 The Spanish Flu was caused by Influenza A strain H1N1.18;27 The Spanish flu started in Madrid between May and June 1918, and then spread to Portugal on June and July. The outbreak spread with tremendous virulence in September 1918, and in October 1918 it reached South Western European countries.22 Retrospective phylogenetic analysis of NA, NP and polymerase genes demonstrated a close relationship to the avian consensus gene, suggesting t hat the 1918 pandemic was through introduction of avian influenza virus into human population.28;29 The death toll worldwide was about 50 million people, with approx imately 26 36 million deaths occurring in Asia.30

PAGE 20

20 Asian Flu Asian influenza first occurred in the S outhern Chinese province of Guizhou in February 1957. The pandemic then spread to Hunan province, Hong Kong, and also Japan.6 During May 1957, it spread to Indonesia Australia, and India, and that summer to Europe, Africa, North America, and S outh America.8 First isolation of this influenza isolate was in Japan on May 1957 and ov er one million people were reported dead.18;27;31;32 This pandemic was caused by influenz a virus H2N2 subtype, and it originated from reassortment between human and Eurasian avian influenza lineages.6;33 The HA, NA and PB1 genes of this subtype virus were derived from avian influenza virus.34;35 An Influenza pandemic on 1957 caused 70,000 deaths in the United States and approximately one million worldwide. 6;8;32 Hong Kong Flu The Hong Kong pandemic influenza origin ated from China and spread to Hong Kong in July 1968.8 This influenza pandemic was caused by influenza virus H3N2 subtype.27;36 Sequence analysis of the genome re vealed that the HA and PB1 genes originated from avian influenza virus 34;35, and that avian influenza subtype virus was from the Eurasian avian lineage.6 The death toll reached 33,800 in the United States and from 700,000 to one million worldwide.8;32 Russian Flu The Russian flu outbreak first appeared in Tianjin, China, in May 1977 and spread to Russia by December 1977.6;8;32 The etiology of this outbreak was influenza virus H1N1 subtype, and this strain was closely related to the strain isolated in 1950.6;37 The majority of affected people were young age u nder 25 years old, indicating that older

PAGE 21

21 people were protected by pre-existing imm unity because of its close relation to influenza H1N1 strain circulated earlier.6;37;38 High Pathogenicity Avian Flu The Avian flu outbreak in humans occu rred in Hong Kong on 1997 with spread to other countries in Asia since then.39-41 The outbreak was caused by H5N1 influenza strain and millions of poultry died because of this disease with millions more culled.42-44 The influenza H5N1 virus also infe cted humans and caused 323 deaths from 553 reported cases.45 This avian influenza outbreak in As ia did not actually develop into a pandemic although it was predicted to be the next pandemic. Phylogenetic studies show that all HA and NA subtypes of influenza A vi rus are present in the avian species, which led to a hypothesis that the origin of a ll mammalian influenza viruses are derived from avian influenza virus.6;10;29;46-48 Pandemic (H1N1) 2009 The recent influenza outbreak, the Pandemic H1N1, started in North America in April, 2009 in 49;50 Influenza virus strain H1N1 was the causative agent of this pandemic and this outbreak was given the misnomer, S wine Flu. The reason why it was called Swine Flu was because the H1N1 virus was be lieved come from swine since five of its eight genes were derived from the swine origin viruses.51-54 On August 10, 2011, the World Health Organization (WHO) announc ed this pandemic had entered a postpandemic period.55 In April 2009, the Centers for Diseas e Control and Prevention (CDC) reported case of a new H1N1 subtype influenza vi rus in human. Within a few days after the report, thousands of similar cases emerged in Me xico with many fatalities. Based on the data from WHO, as of 1 August 2010, 214 countries worldwide have confirmed

PAGE 22

22 pandemic influenza H1N1 2009 with 18449 deaths.56 The Food and Agriculture Organization (FAO) guidelines for surveillance of pandemic H1N1/2009 state that this influenza A/H1N1 virus has genetic reassortment of four different types of influenza strain viruses never previously reported for pigs and humans.57 This recombination includes a human influenza gen e segment, avian gene segmen t from North America, swine influenza segment from North Am erica, and Eurasian avian-like swine gene segment. The pandemic H1N1/2009 virus c ontains PB1 gene from human influenza virus; PB2 and PA genes from avian influenza virus; HA, NP and NS genes from North American swine influenza virus; and NA and M genes from Eurasian swine influenza virus.47;51;56 Disease in Animals Swine Swine influenza is an acute respiratory dis ease in pigs. The pigs infected with this disease show signs of coughing, sneezin g, nasal discharge, increased rectal temperature, lethargy, difficult y in breathing, and loss of appetite.56;58 There are four subtypes of swine influenza which are predomi nantly found in pigs in the United States including H1N1, H1N2, H3N2, and H3N1.25;59-61 Before 1998 only classical swine influenza (H1N1) were isolated from swine in North America.62-64 In 1998, the double reassortant H3N2 was isolated from a farm in North Carolina. Genetic analysis showed that this strain was a reassortment of classical swine influenza (NS, NP, M, PB2, and PA) and human influenza virus (HA, NA, and PB1).64 Triple reassortant genetic influenza H3N2 was found in the swine herds of Texas, Minnesota, and Iowa in 1998.65 Genetic analysis from these viruses revealed that the NS, NP, and M genes were derived fr om classical swine influenza virus; the

PAGE 23

23 HA, NA, and PBI were from human influenza virus; while the PB2 and PA genes came from avian influenza virus.64 This triple reassorted H3N2 then evolved through genetic drift and reassorted with swine classical in fluenza H1N1, and making novel reassortant H1N1, H1N2, and H3N1.62 There was a commonality be tween these novel reassortant influenza virus where the internal genes (P B1, PB2, PA, NP, M, and NS) were always maintained, and derived fr om the original triple reassortant H3N2.62 This constellation then was called triple reassortant internal gene cassette (TRIG).62;66 Thus, TRIG is a combination of reassortment between human influenza virus, swine influenza virus and avian influenza virus.62;67 The TRIG constellation consist of PB1 gene is of human virus origin; PA and PB2 genes are of avian viru s origin; M, NS and NP genes are derived from classical swine virus origin.62;64;66;68 According to the previous study, the HA and NP genes of this isolate were derived fr om classical H1N1 swine influenza virus.69 Animals suffering with swine influenza, in cluding pandemic (H1N1)/2009 should be separated from the healthy ones. They should be given supportive care and allowed to recover, culling is not necessary nor cost effective for control on farms.57;70 Influenza A infection in swine usually occu rs most often in nursery pigs and they display fever, sneezing, nasal discharge and diarrhea. Shedding after experimental infection is rapid, within 1-3 days, and swi ne become seropositive wit hin one week postinfection. The swine H1N1 of 2009 demonstrates the same general course of infection, except that even in nursery pigs, it is fair ly mild. In the studies in Manitoba, Canada wherein, H1N1 was detected in swine herds, surveillance testing in swine herds with a history of influenza-like disease demonstrat ed no shedding of H1N1 when tested 10-20 days after clinical signs began.71 Pigs appear to cease excretion from influenza and

PAGE 24

24 H1N1 within 5-6 days post-infect ion. Interestingly, in a st udy where oral fluids were tested for sampling efficacy compared to nas al swabs, PCR was more sensitive than viral isolation for detection.72 In this study, 382/910 (41.9% ) of clinical swine were detected as positive by oral sampling. In th is technique, groups of swine were allowed to chew on a rope for 20-30 minutes or t he buccal mucosa was swabbed in individual swine.72 Thus far, swine H1N1 viruses have been detected throughout the world, yet actually appear to have limited divergences of the avian and human influenza A strains that reassorted with SIV A lineages solely of North American and Eurasian origin.60;62;67;68 However, evidence indicates that in swine these reassorted viruses are changing and developing lineages that are unique according to geography 9;60 An analysis of swine origin s equencing of influenza shows severe bias in sampling from intense swine production locales in the U.S. reflecting the need for vaccine development in these operations. Thus large areas of the Americas where swine are raised contribute little to our understanding of the evolution of SIV and the phenomenon of reassortment in the field. Birds Avian influenza viruses, based on the pathogenicity in chicken, are categorized in to two types, highly pathogenic avian in fluenza (HPAI) and low pathogenic avian influenza (LPAI).6 One of the deadliest HPAI viru ses is H5N1. The first HPAI H5N1 virus was isolated from geese in Guangdong province China in 1996.73 This virus became widespread in Hong Kong on 1997 result ing in many poultry depopulations and cases of human infection.6;74 After the depopulation, the outbreak stopped but the virus still circulated in southern China causing di sease in poultry. The H5N1 outbreak spread

PAGE 25

25 to Southeast Asia and Europe infecting millions of poultry in 2003.32;75 These avian influenza H5N1 outbreaks have occurred in 63 countries, causing more than 262 million bird to be depopulated and almost $20 billion in economic losses.76 In humans, this virus has infected 553 people with 323 of them fatal.45 An HPAI infection in poultry will cause syst emic infections such as ocular and nasal discharges, coughing, swelling of t he head and/or the sinus, and cyanosis of the unfeathered skin such as wattles and combs. 6;77 In layer chickens, the symptoms could also cause a decrease in egg production as well as egg quality.78-80 A high morbidity and high mortality rates follow onset of thes e symptoms in flocks. The LPAI viruses usually causes symptoms that are less seve re than those observed in the HPAI. Since all of these symptoms are not pathognomonic for avian influenza, laboratory tests should be done to confirm the diagnosis.79 A criteria to determine the pathogenicity of avian influenza is based on the intravenous pathogenicity index (IVPI) and an IVPI index gr eater than 1.2 is considered consistent with HPAI. Alternativel y, if injection of infective a llantoic fluid in 4 to 8 week old chickens intravenously is fatal within ten days following inoculation, the virus will be considered HPAI.79 Beside those procedures, for any H5 and H7 that are of low pathogenicity in chickens, the connecting pe ptide of the hemagglutinin gene must be sequenced. If the sequence is similar to thos e observed in the HPAI, then the isolate will be considered HPAI79. For sequence data refer to: http://www.offlu.net/index.php?id=123 .79 Due to high morbidity and mortality, selective culling would be a standard procedure to control disease spreading of HPAI.78 Depending to the policy of each

PAGE 26

26 country, the selective culling usually conduc ted to infected birds, birds which show clinical symptoms, and birds in t he same pens/flocks with infected birds.78 Horses Equine influenza outbreak first occurred in 1956 among horses in Eastern Europe 81 and this was influenza virus subtype H7N7, strain A/Eq/Prague/56.82 Later, in 1963 another equine influenza subtype H3N8 subt ype, strain A/Eq/Miami/63, caused an outbreak in the United States.83 These two viruses were called Influenza equine 1 and equine 2, respectively.6 Horses infected with equine influenza virus demonstrate lethargy, fever, and anorexia, followed by a nonproductive cough.84;85 Treatment for infected horses is mainly symptomatic and antim icrobials are used if there is a risk of a secondary bacterial pneumonia.84 Antivirals such as amantadine and rimantadine have little benefit to already infected horses and ar e expensive, but thes e may be useful to protect valuable horses during an outbreak.84 Vaccination is recommended to prevent horses against equine influenz a infection. Vaccination is conducted with vaccine containing the H7N7 and H3N8 subtypes.80 Office International des Epizooties (OIE) and WHO recommendations that vaccine manufac turers include A/Eq/Suffolk/1989 or A/Eq/Newmarket/1/93 to represent the Eu rasian lineage and A/Eq/SouthAfrica/4/03 or A/Eq/Ohio/03 to represent American lineage for the H3 N8 equine influenza vaccines.85 Canine Canine influenza was first identified in 2004 from greyhound dogs in Florida, and it was the H3N8 subtype.86;87 The A/Canine/Florida/43/2004 was an example of interspecies transmission of influenza viru s, wherein this case was between horses and dogs.86 This transmission could have occured as a result of close contact between infected horses with dogs or from feeding dogs infected horse meat.88;89 Dogs can also

PAGE 27

27 be infected with other strains of influenza. In 2007, dogs we re reported with H3N2 avian influenza infection in South Korea. Experim ental and natural dog-to-dog infection has been reported, as well as serologic evi dence of transmission in pet dogs and dog kennels.90-92 Diagnostics The gold standard of influenza diagnosis is vi rus isolation takes at least 5 days to isolate the virus and then to type the virus.93;94 Many serological tests such as hemagglutination inhibition (HI) are availa ble, but these methods lack specificity because they cannot disti nguish between new infect ion and prior vaccination.95 Molecular methods such as PCR offer rapid detection with high sensitivity and specificity. Real-time PCR methodology is now technologically emphasized because of speed, standardization, and the ability to mult iplex detection of multiple pathogens and strains in a single tube. Results presented by real-time PCR are qua ntitative, whereas the conventional PCR are qualit ative. Although, real-time PCR is more robust, simple, and accurate, problems associated its use in clude increased expense for machine and reagents, need for technical training, and lack of standardization amongst laboratories and laboratory personnel. Some PCR protocols are recommended by WHO, FAO and OFFLU (Network of Expertise of An imal Influenza) on their guidelines.57;96 Most of them were mainly developed for human samples. One of the recommended protocols is a method which was developed by CDC.97 This method is widely used in diagnostic laboratories and is recommended as the uni versal method for detection of pandemic influenza outbreaks.98

PAGE 28

28 Reassortment of Influenza Influenza virus is composed of a segm ented genome which reassort frequently between two different influenza viruses.9;10 It is hypothesized that the reassortment phenomenon occurs when two different influenza viruses simultaneously infect one cell.8;99 At the heart of this pheno menon are the host respirator y cell surface receptors which allow virus binding and if several differ ent receptors are present this allows for simultaneous infection of different viruses from different specie s. Since swine have receptors for both avian and human influenza vi ruses, viruses from different species can infected swine and recombine more frequently than in other species.100 Numerous isolates have been isolated from swine which originated from avian influenza viruses as well as human influenza viruses.6;62 Influenza viruses origin ating from avian and equine are more likely to bind to SA 2,3 Gal, whereas the human influenza viruses and classical swine influenza viruses bind preferentially to the SA 2,6 Gal. In human, SA 2,6 Gal oligosaccharides are found on epit helial cells in nasal mucosa, paranasal sinuses, pharynx, trachea and bronchi, while SA 2,3 Gal oligosaccharides are dominant on nonciliated cuboidal bronchiolar cells at the junction betw een the respiratory bronchiole, alveolus, and type II cell lining t he alveolar wall. This finding likely explains the limited transmission between humans with avian influenza virus H5N1. Replication of H5N1 in the upper respiratory tract of hum an is not efficient due to the different type of binding receptor. The SA 2,3 Gal binding receptor is al so found on the epithelial cells of duck intestine and in horse trachea.6 On the other hand, swine have both SA 2,3 Gal and SA 2,6 Gal in the epithelial cells of trachea, which may explain why s wine are susceptible to both avian influenza and human influenza viruses.12 This factor makes the pig become a mixing vessel for

PAGE 29

29 influenza, because conversion to preferential recognition of the binding receptor is essential for transmission within the same species. Before 1998, the swine influenza isolates wh ich were isolated in pigs in the United States were only classical swine infl uenza H1N1. Since then, double reassortant (human and swine) influenza subtype H3N2 and triple reassortant (avian, human and swine) influenza subtypes H1N1, H1N2 H3N1 and H3N2 have been isolated from outbreaks in US and Canada.6;9;62;101 This evidence also supports the theory that the pig is a mixing vessel for influenza virus. PCR Technology PCR Platform Technology A PCR machine is designed to heat up and cool down for each of the cycles during which the nucleic acid target of interest is generated by a log2. Technological advances have focused upon shorter cycles for generation of each new nucleic acid itself and also for shorter, faster ramping sp eeds. The latter being the time it takes for the machine to heat up and cool down. If the ramping between reactions is too fast or too slow and not matched to the chemistry, then the reaction can become less efficient through inactivation of the enzymes in the reac tion or inappropriate nucleic acid binding. Currently, the real-time PCR machines hav e two different ramping speeds, standard and fast. The fast ramping speed allows t he heating and cooling process to change in fast speed; therefore the r un process could be less than one hour. Fast ramping speed mode and this requires the appropriate polym erases and their respective salts and buffers in the chemical mix (Master Mix) to be matched to these very rapid changes in temperature. Master mixes compatible fo r fast ramping speed can be used for either fast ramping mode or standard ramping mode. However, master mixes compatible for

PAGE 30

30 standard ramping speed are usually only co mpatible for standard or slower ramping mode. Historically once a PCR machine generated new nucleic acids, the product was visualized by the use of dyes that in tercolate into DNA with generation of a corresponding band of appropriate sized on an agarose gel with ultraviolet light. With the advent of real-time PCR, each machi ne detects product during the generation of each cycle with some type of fluorescent tec hnology. Most of the older real-time PCR machines use a tungsten-halogen lamp as th e light source while the newer version of real-time PCR platforms use lower maintenanc e light emitted diodes (LED) as the light source. These lights cause emission from va rious fluorescence dyes and these must be captured in real-time, whic h could either be a charge coupled device (CCD) camera, photo-multipliers (PMT) or a photodiode. Ma nufacturers claim adv antages for their various technologies, however depending on the color of fluorescence there are differences in the range of detecti on for each combination of these.102 PCR Chemistry Finally, PCR technology differs by the chemis try that is used to emit fluorescence. The two most commonly used chemistries in real-time PCR master mixes are based on generation of fluorescence by either hydr olysis of a separately binding DNA probe (TaqMan) or through the intercalation of a dye within the tar get (SYBR Green I). The TaqMan probes detect the complementary s pecific PCR product as it accumulates during PCR cycles.103 The amount of fluorescence dete cted is directly related to the amount of PCR targets am plified during the PCR cycles. The TaqMan probe based chemistry can be used for RNA quantitation, DNA quantitation, alle lic discrimination, and other types of assays. An advantage of t he TaqMan probe is that it can be labeled

PAGE 31

31 with different dyes, so it allo ws amplification of multiple target sequences in a single tube reaction.103 This chemistry while more specif ic than SYBR, but it is five to ten times more expensive per well. As the dyes come off patent and other companies develop variations of flourogenic probes, t he expense has been declining in recent years. SYBR Green I chemistry uses SYBR Green I dye, which will bind to double stranded DNA as the nascent strands are formed and the PCR products are detected as they accumulate during PCR cycles. These dyes emit in relatively low fluorescence when free in a solution, but the fluorescence will increase logarit hmically as they bind to the newly forming double stranded DNA.104 Since the dyes bind to all double stranded DNA, the increase of fluorescence intensit y is proportionate to the amount of PCR product produced. The SYBR Green I chemistry can be applied to RNA quantitation and DNA quantitation.103 The SYBR Green I chemistry is ex ceptionally cost effective and can be used for a variety of applications su ch as melting temperature experiments and genotyping. Also it is less specific which can be desirable when screening for emerging organisms that are as yet unknow n. It also can be used to monitor the amplification of any double stranded DNA sequence. Major probl em of SYBR Green I ch emistry is that it may generate false positive signal due to the binding to non-sp ecific double stranded DNA sequences.103 Because the SYBR Green I dye will bind to any double stranded DNA, this will make reaction specificity onl y determined by the primers. Consequently, the primers should be designed to avoid non-specific bindi ng such as primer dimer formation. In addition, the user must be familiar with proper PCR chemistry and machine output formats to accurately optimize all reactions.104

PAGE 32

32 PCR and Influenza Diagnostics Different PCR protocols are recommended by World Health Organization (WHO), the United Nations Food and Agriculture Or ganization (FAO) and the Network of Expertise of Animal Influenz a (OFFLU) on their guidelines.57;96 In the current literature, more recent protocols generated from 2009 on, were mainly developed for and validated on human samples. O ne of the recommended protoc ols is a method which was developed by CDC.97 This method is widely used in diagnostic laboratories and is recommended as the universal method for de tection of pandemic influenza outbreaks by the World Health Organization.98 The literature regarding nonhuman species is not as straight forward. Many protocols we re developed during t he high pathogen avian influenza outbreaks. There are several geogr aphically developed assays and then these avian protocols have been modified to det ect swine influenza. For equine and canine influenzas, multiple assays have been dev eloped which detect these subtypes. There is no single PCR reaction that can di stinguish all differ ent subtypes that commonly infect swine and newer highly r eassorted SIV H and N ge nes, but there are several PCR methods that target the M gene that have been validated mostly for intraspecies influenza A detection.9;105-107 PCR protocols that target the M gene (segment 7) of influenza A have been reliably reactive with influenza A viruses from birds, humans, pigs, horses, and marine mammals since 2000.108;109 Even conventional PCR procedure targeting this gene have demons trated up to 100X more sensitivity than virus isolation. However, limited studies recently have been performed which compares the sensitivity of the differ ent primers and probes across species since 2000 and there are scattered reports that the sequences of the reverse primers even within the highly conserved M gene have selective sensitivit y for these recent TRIG H1N1 viruses.105;107

PAGE 33

33 Current Status of Swine Surveillance There is in fact limited dat a on the nasal shedding rate of influenza A and H1N1 as detected by PCR in North American swine. Li terature searches performed as of June 2011 from 2009 to 2010 search years demonstr ate less than 20 publications which specifically survey influenza s hedding in nasal secretions by swine worldwide. Most of these studies were performed in Canada, Japan, and a few in Europe. The use of serology to retrospectively assess exposure of swine to H1N1 demonstrates that once in a herd, most of the herd sero converts to the H1N1 subtype.110 This is not surprising since influenza in swine is a ubiquitous organism and most swine are exposed to influenza by nursery age.111 In addition farrowing sows are likely reservoirs for recirculation of most swine respiratory viruses.71;110 In finishing swine, serology only indicates retrospective exposure to field or vaccine strains; this does not indicate the actual infection status or risk that a pig poses for pig-human transmission. Indeed, current studies published in Canada indica te the human-pig transmission can occur.112 Swine influenza surveillance conducted at Minnesota State Fair and South Dakota State Fair on 2009 showed prevalence of swine in fluenza disease in swine were 19.3% and 2.2% respectively.113;114 Regionally based diagnostics and surveillance are essential components for biosecurity, outbreak detection and containment.115 While there are immense organizational support systems in place with the United States Department of Agriculture (USDA), the Food and Agricultur e Organization of the United Nations, (FAO), and Office Internati onal des Epizooties (OIE), and the regional centers of excellence, there exists limited respons e network for collection, screening, and identification of TRIG in swine that are not part of the production industry. Logically, it is

PAGE 34

34 these types of studies that provide the ri ch ecological information to study viral evolution. Thus, regional res earch institutions offer an opportunity to contribute genomic information to with these organizations in t heir quest to assess the global occurrence and implications of TRIG in SIV. While the central United States has large production housing units, Florida and Caribbean has divers e populations of swine including some containment production farms, but the majori ty consists of transitional and small operations with two to three la rge containment facilities. Swine consist of domestic, exotic, and feral swine population. In addition t here are 3 large slaught er plants Florida that commingle swine from t he southeast, processing 1000s of hogs at a time that are commingled from several fa rms throughout the Southeast.

PAGE 35

35 CHAPTER 3 TESTING THE PERFORMANCE (SENSITIVITY) OF INFLUENZA A CDC AND INFLUENZA A RICHT DETECTION PROTOCOLS AGAINST VARIOUS INFLUENZA ISOLATES Background Four worldwide pandemic influen za outbreaks occurred in the 20th century, namely the Spanish flu (1918), the Asian flu (1957) the Hong Kong flu (1968), and the influenza pandemic (H1N1) 2009 (2009).36 The influenza pandemic 2009 first occurred in Mexico on April 2009. This influenza was caused by influenza strain H1N1 and it was thought to be from swine. No clear evidence that this influenza strain was first transmitted from swine to humans except t hat five of eight of its genes are derived from swine.51 Influenza virus is composed of a s egmented genome which r eassorts frequently between two different influenza viruses.9;10 It is hypothesized that a genetic reassortment phenomenon occurs when two di fferent influenza viruses simultaneously infect one cell.8;99 The receptors on the cell surfac e play roles in virus binding. Specifically, the viral HA gene binds to sia lic acid residues on glycolipids on the cell surface.116 Human influenza viruses preferentially bind to sialic acid attached to galactose, as a 2.6 linkage, whereas avian influenza viruses tend to bind to sialic acid attached to galactose, as a 2.3 linkage.12 Pigs have both 2.3 galactose and 2.3 galactose linkages on epithelial cells of thei r trachea, which makes them susceptible to both human influenza and avian influenza. The pr esence of multiple receptors is the basis for the concern that the pig is the act ual mixing vessel in which influenza viruses reassert.12 Although likely common bef ore identification, s wine-origin influenza (Orthomyxoviridae) became notable for its role during the human influenza pandemic of

PAGE 36

36 1918.117 Swine influenza is a ubiquitous upper re spiratory infection of pigs causing high morbidity and low mortality and is common worldwide in hogs. Like movement of influenza through a classroom, SIV prevalence is highest in production farms where there are farrow-to-finishing operations, affecting growing swine and causing widespread disease when new subtypes are introduced.118 Young swine usually have seroconverted by sale or slaughter and se roprevalence rates vary between 30% and 85% depending on locale. Because of the mutati onal nature of RNA viruses, SIV quickly attains its own genomic character once estab lished within a locale as is common with other influenza viruses.9 Until recently, H1N1 was more common in the U.S., specifically in production oper ations of the Midwest, while H3N2 viruses predominated in Europe.118-120 However, H3N2, H1N1, and H1N2 are all highly endemic in North America, circulating since the late 1990s.60;68 Limited information is available regarding circulating viruses throughout t he Caribbean and Central America. The gold standard of influenza di agnosis is virus isolation.93 However it takes at least 5 days to obtain results from this method. Serological tests such as HI (haemmaglutination inhibition) can be used as a diagnostic tool for influenza, but this method has a lack of sensitivity and cannot di stinguish between that antibody which is generated by infection and that by vaccination.95 Molecular methods such as detection of short segments of genetic ma terial with polymerase chain reaction (PCR) offers rapid detection with high sensitivity and specificit y. Conventional PCR relies on agarose gels for visualization post-amplific ation whereas real-time PCR methodology uses some sort of fluorescent technology to generate a signal at the time of amplification. The latter is now technologically emphasized because of speed, potential for standardization, and

PAGE 37

37 the ability to multiplex detection of multip le pathogens and strains in a single tube. Results presented by real-tim e PCR are quantitative, wher eas the conventional PCR are qualitative. Although, real -time PCR is more robust, simp le, and accurate, problems associated its use include increased expense for ma chine and reagents, need for technical training, and lack of standardi zation amongst laborat ories and laboratory personnel. Different PCR protocols are recommended by World Health Organization (WHO), the United Nations Food and Agriculture Or ganization (FAO) and the Network of Expertise of Animal Influenz a (OFFLU) on their guidelines.57;96 In the current literature, more recent protocols generat ed from 2009 on were mainly developed for and validated on human samples. One of the recommended protocols is a method which was developed by the CDC (INFA CDC).97 This method is widely used in diagnostic laboratories and is recommended as the uni versal method for detection of pandemic influenza outbreaks by the World Health Organization.98 The literature regarding nonhuman species is not as straight forward. Many protocols were developed dur ing the high pathogen avian influenza outbreaks. There are several geographically developed assays and then these avian protocols have been modified to detect swine influenza. In t he literature, the detection methods for equine and canine influenzas are unique for these influenza As, although the same conserved sequences of the Matrix target c ould theoretically be used for all influenza A viruses.121;122 The INFA CDC primer and probe set was mainly developed to detect influenza A from human samples and targets t he Matrix gene of influenza virus. One of the earliest protocols to detect SIV in clin ical swine samples was developed by Richt et

PAGE 38

38 al. in 2004 (INFA Richt). This protocol was modified to detect swine origin influenza viruses more efficiently by Dr. Richt. There is no single PCR reaction that can di stinguish all differ ent subtypes that commonly infect swine and newer highly r eassorted SIV H and N ge nes, and there are several PCR methods that target the M gene that have been validated mostly for intraspecies influenza A detection.9;105-107 PCR protocols that target the M gene (segment 7) of influenza A have been reliably reactive with influenza A viruses from birds, humans, pigs, horses, and marine mammals since 2000.108;109 Even conventional PCR procedures targeting this gene have dem onstrated up to 100X more sensitive than virus isolation. However, limited studies recently have been performed that compares the sensitivity of the diffe rent primers and probes across species since 2000 and there are scattered reports that the sequences of the reverse primers ev en within the highly conserved M gene have selective sensitivit y for these recent TRIG H1N1 viruses.105;107 The work performed by Hollman et al (2009) has tested human and animal influenza A isolates with the M primers and probes of Ward et al 2004. Hollman et al .(2009) also developed a set of primers and pr obes specific for H1N1 isolates that only reacted with human derived samples using lightcycler technol ogy. In order to reliably detect swine infected with TRIG H1N1, several M gene protocols may need to be combined as WHO has, only with less degeneracy based on current sequence information. In an effort to standardize for the purposes of broad surveillanc e efforts in animals, the sensitivity of several real time reagents that have been defi ned in the literature to detect the matrix gene across isolates from multiple species an d their subtypes. We assume that several matrix gene assays will be needed including the WHO/CDC degenerate primers, so the

PAGE 39

39 final goal will be to determine if these assays ar e best run in parallel or as a multiplex. It is our experience that multip lex assays lose sensitivity and our goal is to develop the most sensitive and broadly reactive assa ys in order to detect TRIG influenza A. This recent rapid viral evolution of SI V creates its own diagnostic morass. Basic standard serological tests will not detect these TRIG reassortments.123 Profound virus host cell can change but no overt change in thes e serological determi nants is detected. Rapid diagnostic methods such as antigen EL ISA, conventional P CR, and especially real-time PCR can either miss the TR IG or if H and N genes are targeted for subtyping.105;107;124 If there are major genetic changes, the virus can be missed completely. Without sequencing of severa l segments (HA, NA, PB) the TRIG will be missed.125;126 In order to robustly subtype thes e reassorted viruses by bench real-time reverse-transcription PCR (real-time rt-PCR), a whole exquisitely sensitive single tube format becomes essentially complex and expens ive. Also this complexity rapidly overwhelms the often limited tr aining of laboratory personnel. Much of the current literature focuses on protocol developm ent for one species. Validation and modifications of the INFA CD C have utilized influenza A viruses from humans, while animal derived protocols have been validated using primarily animals. The goal of these experiments are to det ermine if two standardized protocols are interchangeable and comparatively efficient bet ween various influenza isolates derived from horses, humans, swine, birds and dogs. Spec ifically, we tested both the INFA CDC and Richt protocols against 25 separate isolates from 5 different species, including human.

PAGE 40

40 Materials and Methods Virus Stocks Viruses were obtained from the laborator ies of Dr. Gregory Gray, Dr. Gabriele Landolt, Dr. Cynda Crawford, Dr. William Ca stleman, and Dr. Maureen Long (Table 3-1) consisting of various avian (5) isolates, c anine isolates (5), equine isolates(5), swine isolates (5), and human isolates (5). There we re total 25 influenza isolates were tested for this specific aim, consists of influenza isolates came from fi ve different species (swine, avian, equine, human, and canine), eac h species had five different isolates. These isolates were previously grown in the Madin-Darby Canine Kidney (MDCK) cell culture and stored in -80oC freezer. They were thawed and tested with hemagglutination assay (HA) to check the antigen titer. The is olates then were diluted to make the HA titer 64, except for eq uine influenza isolate A/Equine/NY/99 which already started with HA titer 32. Hemagglutination Assay Initial stocks of viruses were t hawed after long term storage at -80oC. For each virus 100 l was removed after vortexing and then serially diluted in PBS by 2-fold between 2 and 1024. Each of these dilutions wa s mixed with 50 l of 0.5% turkey red blood cells. This mixture was incubated for 1 hour at room temperature and agglutination was measured by turning each plate 90 degrees for detection of lattice formation. Once the titer was determined, each virus stock was dilute d for an HA titer of 64. One of the equine isolates ha d lower initial HA titers and this served as the initial dilution of virus for extraction.

PAGE 41

41 Final PCR Protocol In order to prepare the RNA samples from isolates, 100 L of each 64 dilution of virus was extracted using RNEasy Mini Kit (Qiagen, Valencia, CA) according to the protocol provided by manufacturer. This st ock RNA was then serial diluted 10-fold for five final dilutions of each virus. A T aqMan Fast Virus 1-Step RT-PCR Master Mix (Applied Biosystems, Foster City, CA) was used with a 20 L reaction volume targeting matrix gene of influenza virus. The two different protocols were run side-by-side on the same plates for each viral dilution. A reference positive was run on each plate for standardization. Wells consisting of water as a target was used as the no target control. These used primer/probe sequences that de tect the Matrix gene (Table 3-2) and these were developed by the Center for Disease Control 97 and researchers at Kansas State University and the National Veterinary Serv ices Laboratory (Dr. Juergen Richt, Kansas State University, Manhattan KS and Ames, Iowa). Optimization for the primers and probe dilutions were performed by varying t he amount of each primer, probe, in a SYBR green reaction. Once the SYBR green reac tion was optimized for primer dimer formation and melting temperature each Ta qMan reaction was developed. The final optimization of these protocols consisted of varying the amount of each respective probe and performing standard curves to achieve maximal efficiencies of each protocol. For the final INFA CDC protocol, the reaction mix consisted of 5 L of master mix, 400 nM forward primer, 400 nM reverse prim er, 175 nM probe, 2 L RNA template and RNAse-free water ad 20 L. For t he final INFA Richt protocol the reaction mix consisted of 5 L of master mix, 500 nM forward primer, 500 nM revers e primer, 175 nM probe, 2 L RNA template and RNAse-free water ad 20 L. The real-time RT-PCR assay was performed on 7500 Fast Real-tim e PCR System (Applied Bio systems, Foster City, CA)

PAGE 42

42 using thermo cycling conditions as follows: 50oC for 5 minutes, 95oC for 20 seconds, then 40 cycles of 95oC for 3 seconds and 60oC for 30 seconds. The primers and probe sequences are provided in Tabl e 3-2. The RNA samples were diluted five times with ten folds each dilution Analysis The logarithmic data was transformed for inverse of log2 and graphed for each different influenza strain comparing the INFA CDC and INFA Richt protocol. For all of the comparisons, the slope and the R2 of each curve generated by the average of each separate well for each dilution was computed.127 Each experiment was repeated three to four times and two of t he experiments with the highest R2 ( > 0.90) were used for further analysis. The Ct data from each experiment consisti ng of the 25 isolates was compared separated for the INFA CDC and the INFA Richt protocols via an ANOVA on ranks (SigmaPlot/SigmaStat 12). These were found to be not significantly different and the respective data was pooled. A repeat ed measures ANOVA was then used to compare the CDC and Richt protocols (P < 0.05). Results INFA CDC and INFA Richt provided relative ly the same slope values. The best average slope from the sample s was generated by A/Mexico/4108/2009 (H1N1) isolate using INFA Richt. The average slope for this isolate was -3.3 and the average PCR efficiency was 100.751%. The same isolat e also generated a robust slope using the INFA CDC primer set with t he average slope value was -3.212 and the average PCR efficiency was 104.8045% (Table 3-3) The slopes ranged from -2.18 to -3.91 and the R2 ranged from 0.85 to 1.

PAGE 43

43 Using the data from the CDC and Richt protocols that had the two highest R2 and two lowest coefficients of variations (CVs) from at least 3 repeat ed experiments, there was no significant difference in the average threshold cycle (Ct) values for each respective protocol and t he data was pooled for these tw o experiments. The average Ct for each dilution for each isolate was t hen analyzed. A two repeated measures analysis with strain as the main effect demonstrat ed significant interaction between the two factors dilution and method (p<0.001). A th ree way ANOVA was used as a balance design with pair-wise comparisons performed using the Holm-Sidak method. There was a significant difference between strains and the respective Cts generated at each dilution. These differences had a P>0.001 in 248 cross comparisons. Irrespective, this variation did not affect the ability of the assays to detect the viruses over a wide range of dilutions between 101 and 105. Both the INFA CDC and INFA Richt detected all isolates at all dilu tions from HA 64 to 640,000 except for avian influenza isolate A/Mallard/NY/6750/78 whic h is an H2N2. This isolate was only detected up a dilution of HA = 6400 (Table 3-4) Comparing the average of the threshold values, the Cts of the results for most of th e isolates were slightly lower using the INFA Richt primer set and these were found to be significant (P<0.001) (Table 3-4). For swine influenza isolates, the lowest and the highest Cts were generated by A/Swine/Wisconsin/238/97 (H1N1) and A/Swi ne/MO/Richt/07 (H2N3), respectively. The avian influenza isolate A/Ma llard/NY/6750/78 (H2N2) generated the highest Cts from all of the avian influenza isolates, while avian influenza isolate A/Duck/Czech Republic/1/1956 (H4N6) using the INFA Richt protocol generated t he lowest Cts among avian influenza isolates (Figure 3-1).

PAGE 44

44 For the human influenza isolates, the A/ Mexico/4108/2009 (H1N1) generated the lowest Cts using both primer sets while A/Brisbane/59/2007 (H1N1) generated the highest Cts using INFA protocols. Overa ll, the lowest Cts were obtained for A/Swine/Wisconsin/238/97 (H1N1) with the INFA Richt protocol. The highest Cts were obtained with the A/Mallard/NY/6750/78 (H2N2) with INFA CDC protocol. Discussion After the RNAs were extracted from each isolate, they were tested for influenza using two real-time RT-PCR protocols. T he INFA CDC and INFA Richt protocols sets were used to test these isolates and these primers and probes were designed for detecting pandemic (H1N1) 2009 influenza. The INFA CDC protocol was mainly designed for human origin samples while the INFA Richt prootocol was mainly designed for swine origin influenza samples. Both protocols detected the matrix gene of influenza virus. Validation testing has been conduct ed on the INFA CDC protocol against human influenza A samples, swine influenza isolat es, avian influenza isolates, as well as influenza B isolates.98 However, only limited testing has been performed for the equine and canine influenza isolates. Overall, both protocols detected all sa mples with all diluti ons, except avian influenza isolate A/Mallard/NY/ 6750/78 (H2N2). In this isol ate, both there was limited detection the next highest dilutions. The IN FA CDC protocol generated higher Cts than the INFA Richt protocol for the avian infl uenza isolates (Figure 3-2). The INFA CDC protocol may be less efficient than INFA Richt pr otocol for avian influenza virus isolate. In order to determine this fully, these ta rgets may need to be cloned and run as exact copy numbers.

PAGE 45

45 The lowest Ct was generated by swine influenza isolate A/Swine/Wisconsin/238/97 (H1N1) using INFA Richt primer set. This isolate was categorized with the classical swine infl uenza virus group, because before 1998 only classical swine influenza virus isol ates were found in North America.62-64 Since the INFA Richt protocol was designed for detecti ng influenza A in swine influenza samples, these results are consistent. If we compare between the Ct values of all swine influenza isolates in this research tested with INFA CDC and INFA Richt, we could see that INFA Richt generated slightly lower Cts than the IN FA CDC primer set (F igure 3-1). We could infer that the INFA Richt pr otocol may be more sensitive for swine influenza isolate than INFA CDC protocol. All human influenza isolates were detected at all dilutions using both protocols. The Ct values for the INFA Richt protocol had were lower compared to the same isolates using INFA CDC protocol. On ly the A/Mexico/4108/2009 (H1N1) and A/Panama/2007/99 (H3N2) could have Ct values similar to those of human influenza isolates using the INFA Richt primer prot ocol. These findings ar e not unexpected given that both protocols were designed for pandemic (H1N1) 2009 isolates. Regard the canine and equine isolates, both protocols worked well for these isolates and are interchangeable. The INFA Ric ht protocol had consistently lower Cts than INFA CDC protocol, except for A/ Canine/Iowa/13628/2005 which had lower Cts than the INFA Richt protocol. The equine influenza isolates demonstrat ed more variability between the INFA CDC and INFA Richt protocols. The lowest Cts were still generated by INFA Richt protocol, but also the INFA CDC protocol generated low Cts in other isolates.

PAGE 46

46 Although we detected statistically significant lower Cts in one protocol versus the other, this should not be construed as a true test of sensitivity. In order to truly compare the sensitivity of these two protocols, 1) a more quantit ative measurement of virus should be used such as the TCID50 method instead of hemagglutination assay method or an 2) actual gene copies using a plasmid fo r the dilutions could be used. Irrespective, each of these have issues with their own inher ent issues in accuracy. We chose the HA in order to reflect native virus and not to reflect differences in cell culture permissiveness. Using DNA plasmids as gene c opies does not account for differences in secondary RNA structure which could affect differences in reverse transcription and primer binding. Additional research could in clude the testing of high numbers of isolates from the same species and from different lineages. Nonetheless, this research demonstrates th at these two protocols are robust over wide range of influenza A isolates and c ould be optimized across laboratories as essential first screening assays for the detection of all species influenza viruses in an unknown sample. A negative result from either these primer sets would indicate that a sample is negative for influenza A and ther eby should not be run for further step (typing). Choosing one of thes e primer sets would reduce test cost significantly, however, these sets could be used in tandem fo r confirmatory detection in the absence of virus isolation.

PAGE 47

47 Table 3-1. Influenza isolates, species of or igin, laboratory source, and HA titer used to compare the reaction efficienc ies of two PCR protocols Species Code Number Isolate Name Source HA Titer Swine SW 1 A/Swine/Wisconsin/238/97 (H1N1) GPL 64 Swine SW 2 A/Swine/Italy/10659-1/2007 (H3N2) GPL 64 Swine SW 3 A/Swine/Lutol/3/00 (H1N1) GPL 64 Swine SW 4 A/Swine/MO/Richt/07 (H2N3) GPL 64 Swine SW 5 A/Swine/Gent/7625/99 (H1N2) GPL 64 Avian AV 1 A/Duck/Alberta/35/1976/ (H1N1) GPL 64 Avian AV 2 A/Mallard/NY/6750/78 (H2N2) GPL 64 Avian AV 3 A/Duck/Czech Republic/1/1956 (H4N6) GPL 64 Avian AV 4 A/Chukar/MN/14951-7/1998 (H5N2) GPL 64 Avian AV 5 A/TY/VA/4529/2002 (H7N2) GPL 64 Equine EQ 1 A/Equine/Ohio/1/2003 (H3N8) GPL 64 Equine EQ 2 A/Equine/PA/01/07 (H3N8) GPL 64 Equine EQ 3 A/Equine/Mongolia/1/2008 (H3N8) GPL 64 Equine EQ 4 A/Equine/New Market (H3N8) GPL 64 Equine EQ 5 A/Equine/NY/99 (H3N8) Castleman 32 Human HU 1 A/Mexico/4108/2009 (H1N1) GPL 64 Human HU 2 A/Brisbane/59/2007 (H1N1) GPL 64 Human HU 3 A/New Caledonia/20/99 (H1N1) GPL 64 Human HU 4 A/Panama/2007/99 (H3N2) GPL 64 Human HU 5 A/Nanchang/933/95 (H3N2) GPL 64 Canine CN 1 A/Canine/Iowa/13628/2005 GPL 64 Canine CN 2 A/Canine/Florida/2004 (H3N8) Crawford 64 Canine CN 3 A/Canine/ColoSp/09 (H3N8) Landolt 64 Canine CN 4 A/Canine/FtCollins/3/06 Landolt 64 Canine CN 5 A/Canine/Boulder/06 Landolt 64 *GPL = Global Pathogens Laboratory Table 3-2. Primer and probe sequences for detection of swine influenza from nasal swabs Forward (5-3) Reverse (5-3) Probe (5-3) CDC Protocol GACCRATCCTGTCAC CTCTGAC AGGGCATTYTGGACAAA KCGTCTA FAMTGCAGTCCTCGCTCAC TGGGCACGBHQ Richt Protocol AGATGAGTCYTCTAAC CGAGGTCG TGCAAARACAYYTTCMA GTCTCT FAMTCAGGCCCCCTCAAA GCCGA-BHQ-1

PAGE 48

48 Table 3-3. Average R2, slopes, and PCR efficiencies of all isolates using INFA CDC and INFA Richt primer sets INFA CDC Primer Set INFA Richt Primer Set Isolates Average R2 Average Slope Average PCR Efficiency Average R2 Average Slope Average PCR Efficiency A/Swine/Wisconsin/238/97 (H1N1) 1.00 -3.20 108.00 1.00 -3.42 97.83 A/Swine/Italy/10659-1/2007 (H3N2) 0.95 -3.64 89.02 0.96 -3.67 87.91 A/Swine/Lutol/3/00 (H1N1) 0.87 -2.65 138.27 0.90 -2.68 136.91 A/Swine/MO/Richt/07 (H2N3) 0.85 -2.25 178.68 0.86 -2.53 148.78 A/Swine/Gent/7625/99 (H1N2) 0.97 -2.18 188.30 0.97 -2.22 184.85 A/Duck/Alberta/35/1976/ (H1N1) 0.85 -2.54 148.52 0.92 -2.91 122.86 A/Mallard/NY/6750/78 (H2N2) 0.93 -3.54 92.01 0.91 -2.78 147.25 A/Duck/Czech Republic/1/1956 (H4N6) 0.99 -3.06 116.92 0.99 -3.19 109.92 A/Chukar/MN/14951-7/1998 (H5N2) 0.96 -2.91 121.94 0.96 -2.98 118.94 A/TY/VA/4529/2002 (H7N2) 0.99 -3.19 109.86 0.99 -3.37 100.63 A/Mexico/4108/2009 (H1N1) 0.99 -3.21 104.80 0.99 -3.30 100.75 A/Brisbane/59/2007 (H1N1) 0.98 -3.86 81.74 0.98 -3.83 82.68 A/New Caledonia/20/99 (H1N1) 1.00 -3.55 91.19 0.99 -3.70 86.48 A/Panama/2007/99 (H3N2) 0.96 -3.60 89.67 0.95 -3.69 86.72 A/Nanchang/933/95 (H3N2) 0.98 -3.52 92.65 0.99 -3.60 89.54 A/Canine/Iowa/13628/2005 0.98 -3.67 87.29 0.99 -3.89 80.77 A/Canine/Florida/2004 0.99 -3.80 83.28 0.99 -3.91 80.30 A/Canine/ColoSp/09 0.96 -3.69 66.66 0.98 -3.87 64.65 A/Canine/FtCollins/3/06 1.00 -3.53 92.09 1.00 -3.68 86.99 A/Canine/Boulder/06 1.00 -3.50 92.91 1.00 -3.62 88.86 A/Equine/Ohio/1/2003 (H3N8) 0.98 -3.59 90.04 0.96 -3.76 84.57 A/Equine/PA/01/07 (H3N8) 0.99 -3.42 96.17 0.99 -3.69 86.76 A/Equine/Mongolia/1/2008 0.94 -2.83 126.01 0.96 -2.88 123.88 A/Equine/New Market 1.00 -3.49 93.34 1.00 -3.63 88.74 A/Equine/NY/99 0.97 -2.96 118.21 0.98 -3.09 111.25

PAGE 49

49 Table 3-4. Average cycle threshold (Ct), standard deviation (SD), and median for all isolates using INFA CDC and INFA Richt primer sets INFA CDC Primer Set INFA Richt Primer Set Isolates Dilution Average Ct SD Median Average Ct SD Median Neat 17.34 0.50 17.30 15.15 1.34 15.22 10-1 20.31 0.24 20.32 18.00 1.43 18.18 10-2 23.97 0.09 23.98 21.91 0.98 21.96 10-3 27.11 0.56 27.16 25.34 0.47 25.37 A/Swine/Wisconsin/238/ 97 (H1N1) 10-4 29.94 1.15 30.13 28.67 0.25 28.57 Neat 17.85 1.98 17.83 17.59 1.22 17.58 10-1 22.94 3.87 22.97 22.32 2.97 22.58 10-2 26.98 3.28 27.24 26.41 2.51 26.46 10-3 29.98 2.80 29.99 29.80 1.79 29.66 A/Swine/Italy/10659-1 /2007 (H3N2) 10-4 32.43 1.38 32.51 32.37 0.45 32.42 Neat 21.70 1.30 21.67 19.65 1.39 19.59 10-1 26.11 2.72 25.13 24.45 3.16 24.11 10-2 29.26 2.25 28.32 27.65 2.47 27.35 10-3 31.54 2.62 30.72 29.09 1.92 28.70 A/Swine/Lutol/3/00 (H1N1) 10-4 32.26 1.52 31.56 30.75 1.39 30.27 Neat 22.79 0.22 22.79 23.97 0.74 23.94 10-1 27.15 1.87 26.98 26.59 1.96 26.43 10-2 29.69 1.96 29.04 29.14 0.74 29.03 10-3 31.74 1.88 31.41 33.45 2.26 32.95 A/Swine/MO/Richt/07 (H2N3) 10-4 31.76 0.51 31.69 33.91 1.61 33.85 Neat 22.26 0.15 22.23 19.85 0.85 19.90 10-1 24.11 0.56 24.11 22.89 1.01 22.85 10-2 26.73 0.47 26.52 25.37 1.69 25.48 10-3 28.54 0.97 28.03 27.14 1.96 27.14 A/Swine/Gent/7625/99 (H1N2) 10-4 30.97 0.20 31.03 28.84 1.20 28.75 Neat 22.73 0.32 22.86 20.69 0.79 20.71 10-1 27.62 1.63 27.11 25.70 1.57 25.01 10-2 30.73 1.64 30.12 29.32 1.06 29.20 10-3 32.52 1.28 31.83 30.69 0.21 30.71 A/Duck/Alberta/35/1976 (H1N1) 10-4 32.96 1.23 32.80 32.72 1.09 32.46

PAGE 50

50 Table 3-4. Continued. INFA CDC Primer Set INFA Richt Primer Set Isolates Dilution Average Ct SD Median Average Ct SD Median Neat 29.57 0.53 29.45 30.10 0.46 30.16 10-1 25.13 0.60 33.74 21.66 0.62 32.46 10-2 36.53 1.43 36.07 36.80 0.88 36.59 10-3 N/D N/D N/D 39.47 N/D 39.47 A/Mallard/NY/6750/78 (H2N2) 10-4 N/D N/D N/D N/D N/D N/D Neat 21.58 1.06 21.56 17.96 0.69 18.06 10-1 25.13 1.18 25.19 21.66 0.96 21.63 10-2 28.25 0.94 28.16 25.09 0.56 24.89 10-3 30.84 0.43 31.02 27.76 0.80 27.91 A/Duck/Czech Republic/1/1956 (H4N6) 10-4 33.93 0.72 33.89 30.79 0.95 30.76 Neat 19.25 0.81 19.27 18.69 0.65 18.65 10-1 23.00 1.59 23.31 22.93 0.60 23.03 10-2 26.57 1.22 26.65 26.64 0.48 26.71 10-3 29.27 2.24 29.24 28.78 0.28 28.76 A/Chukar/MN/14951-7 /1998 (H5N2) 10-4 30.51 1.63 30.53 31.13 0.41 31.10 Neat 21.20 0.45 21.17 18.56 0.58 18.53 10-1 24.80 0.71 24.50 22.09 0.92 21.72 10-2 28.01 0.20 27.93 25.40 0.21 25.35 10-3 31.02 0.69 31.05 28.76 0.74 29.11 A/TY/VA/4529/2002 (H7N2) 10-4 34.05 1.47 33.74 31.91 0.92 31.84 Neat 16.25 0.10 16.29 16.17 0.10 16.17 10-1 19.56 0.16 19.55 19.87 0.12 19.85 10-2 23.52 0.16 23.51 23.66 0.23 23.73 10-3 26.27 0.12 26.23 26.59 0.11 26.58 A/Mexico/4108/2009 (H1N1) 10-4 28.91 0.26 28.86 29.31 0.73 29.54 Neat 20.22 0.90 20.10 18.12 0.40 18.02 10-1 24.56 0.57 24.42 22.04 0.25 22.06 10-2 27.69 1.11 27.67 25.02 0.62 24.98 10-3 33.01 0.54 32.88 30.50 0.74 30.43 A/Brisbane/59/2007 (H1N1) 10-4 35.29 0.63 35.33 32.77 0.29 32.75

PAGE 51

51 Table 3-4. Continued. INFA CDC Primer Set INFA Richt Primer Set Isolates Dilution Average Ct SD Median Average Ct SD Median Neat 20.77 0.13 20.75 19.23 0.40 19.15 10-1 23.97 0.24 24.09 22.23 0.61 22.25 10-2 27.67 0.21 27.73 25.94 0.73 25.94 10-3 31.32 0.20 31.41 29.80 0.82 29.73 A/New Caledonia/20/99 (H1N1) 10-4 34.86 0.59 34.71 33.93 0.53 33.85 Neat 16.38 0.18 16.35 15.48 0.19 15.45 10-1 20.22 0.38 20.29 20.02 0.69 20.19 10-2 24.93 0.12 24.96 24.95 0.21 24.91 10-3 29.18 0.44 29.42 28.87 0.40 28.98 A/Panama/2007/99 (H3N2) 10-4 29.79 0.87 30.19 29.55 0.69 29.34 Neat 20.11 0.13 20.12 18.21 0.21 18.32 10-1 23.78 0.17 23.75 22.44 0.27 22.46 10-2 27.81 0.34 27.87 25.91 0.20 25.81 10-3 32.13 0.51 31.98 30.18 0.54 30.11 A/Nanchang/933/95 (H3N2) 10-4 33.54 0.48 33.64 32.32 0.60 32.57 Neat 15.69 0.25 15.67 13.87 0.18 13.86 10-1 19.81 0.22 19.82 18.33 0.35 18.43 10-2 23.58 0.22 23.64 22.07 0.15 22.15 10-3 28.20 0.48 28.29 26.96 0.36 26.87 A/Canine/Iowa/13628 /2005 10-4 29.84 0.35 29.79 28.80 0.20 28.78 Neat 18.17 1.32 18.07 16.34 1.24 16.13 10-1 22.37 1.46 22.40 20.35 1.20 20.50 10-2 26.78 0.89 26.91 24.95 0.39 25.08 10-3 30.45 0.91 30.42 28.66 0.64 28.67 A/Canine/Florida/2004 (H3N8) 10-4 33.13 1.66 33.21 31.71 1.12 32.19 Neat 17.81 0.77 17.82 16.00 0.14 15.97 10-1 22.74 0.72 22.70 20.92 0.33 20.91 10-2 27.75 0.91 27.78 25.56 0.38 25.51 10-3 30.17 1.05 29.86 28.49 0.48 28.61 A/Canine/ColoSp/09 (H3N8) 10-4 32.50 0.95 32.56 30.84 0.38 31.04

PAGE 52

52 Table 3-4. Continued. INFA CDC Primer Set INFA Richt Primer Set Isolates Dilution Average Ct SD Median Average Ct SD Median Neat 21.51 0.21 21.48 17.84 0.20 17.80 10-1 24.67 0.21 24.69 21.27 0.27 21.25 10-2 28.38 0.05 28.38 24.94 0.25 25.01 10-3 32.11 0.13 32.12 28.75 0.24 28.68 A/Canine/FtCollins/3/06 10-4 35.40 0.27 35.46 32.39 0.34 32.38 Neat 21.26 0.17 21.31 18.78 0.11 18.79 10-1 24.30 0.17 24.31 21.94 0.27 21.86 10-2 28.13 0.08 28.13 25.85 0.20 25.86 10-3 31.62 0.12 31.60 29.60 0.13 29.58 A/Canine/Boulder/06 10-4 35.08 0.53 35.05 33.04 0.12 33.01 Neat 18.96 0.70 19.02 17.21 0.61 17.24 10-1 22.65 0.81 22.82 20.83 1.46 21.40 10-2 27.11 1.43 27.38 25.34 1.71 25.59 10-3 29.40 2.09 29.42 28.13 2.32 28.23 A/Equine/Ohio/1/2003 (H3N8) 10-4 31.91 1.36 32.24 30.68 1.88 31.98 Neat 22.25 0.39 22.15 20.66 1.19 20.60 10-1 25.25 0.66 25.12 23.97 1.71 23.78 10-2 29.38 1.02 29.17 27.98 1.78 27.99 10-3 32.65 0.72 32.53 31.28 1.44 31.22 A/Equine/PA/01/07 (H3N8) 10-4 35.64 0.48 35.79 35.44 1.63 35.16 Neat 19.24 0.55 19.12 17.80 0.30 17.78 10-1 24.28 0.87 24.08 22.13 0.46 22.31 10-2 24.98 0.90 24.76 23.31 0.43 23.42 10-3 27.32 0.77 27.22 26.32 0.36 26.20 A/Equine/Mongolia/1 /2008 (H3N8) 10-4 31.91 0.39 31.89 30.21 1.58 30.71 Neat 20.68 0.11 20.72 18.74 0.09 18.75 10-1 23.41 0.18 23.43 21.68 0.15 21.66 10-2 27.24 0.11 27.25 25.51 0.09 25.52 10-3 30.96 0.09 30.97 29.32 0.17 29.27 A/Equine/New Market (H3N8) 10-4 34.37 0.30 34.32 33.04 0.26 32.97

PAGE 53

53 Table 3-4. Continued. INFA CDC Primer Set INFA Richt Primer Set Isolates Dilution Average Ct SD Median Average Ct SD Median Neat 23.26 0.29 23.18 21.43 0.37 21.51 10-1 26.77 1.32 26.73 24.96 0.88 25.30 10-2 28.52 0.67 28.26 26.81 0.46 26.99 10-3 32.21 0.89 31.78 30.73 0.28 30.63 A/Equine/NY/99 (H3N8) 10-4 35.35 0.85 35.43 33.98 0.88 33.94

PAGE 54

54 Figure 3-1. Comparison Cts of INFA CDC and INFA Richt primer sets for swine influenza isolates Figure 3-2. Comparison Cts of INFA CDC and INFA Richt primer sets for swine influenza isolates

PAGE 55

55 Figure 3-3. Comparison Cts of INFA CDC and INFA Richt primer sets for human influenza isolates Figure 3-4. Comparison Cts of INFA CDC and INFA Richt primer sets for canine influenza isolates

PAGE 56

56 Figure 3-5. Comparison Cts of INFA CDC and INFA Richt primer sets for equine influenza isolate

PAGE 57

57 CHAPTER 4 USE STANDARDIZED PROTOCOLS TO COMPARE THE PERFORMANCE OF TWO REAL-TIME PCR PLATFORMS USIN G FOUR DIFFERENT MASTER MIXES Background Laboratories are funded through international organizations and their respective countries all over the world for rapid surveillance by genomic techniques such as polymerase chain reaction (PCR) of infl uenza and depending on funding, different machines are used. The platforms of these machines are technologically different and with accompanying differences in their respec tive chemical methodology. As such, there are distinct differences in the underlying physics and chemistry of these PCR machines that may be underappreciated by a biologic al community undergoing a rapid expansion into this biology. Whether or not these diffe rent technologies translate into different levels of accuracy for detection of pat hogens and whether or not the chemistries involved in the reactions are in terchangeable are largely unknown. Remarkable progress in detection and di fferentiating influenza virus has been made even within the last two years in all of the genomic techniques including reversetranscriptase PCR (rt-PCR), real-time rt -PCR, microarrays, and genetic sequencing.128 Regarding real-time PCR, mo st of the protocols for influenza detection have been designed using a single chemistry and its associated real-time machine.9;51;107;124;129-140 Very few recommended protocols include va rious different platforms and their respective chemistries.57;96;97 A PCR machine is designed to heat up and cool down for each of the cycles during which the nucleic acid target of interest is generate by a log2. Technological advances have focused upon shorter cycles for generation of each new nucleic acid itself and also for shorter, faster ramping sp eeds. Ramping speed is the time it takes for

PAGE 58

58 the machine to heat up and cool down. If the ramping between reactions is too fast or too slow and not matched to the chemistry, then the reaction can become less efficient through inactivation of the enzymes in the reac tion or inappropriate nucleic acid binding. Currently, the real-time PCR machines have two different ramping speeds, standard and fast. The fast ramping speed allows t he heating and cooling process to change in fast speed; therefore the r un process could be less than one hour. Fast ramping speed mode requires the appropriate pol ymerases and their respective salts and buffers in the chemical mix (Master Mix) to be matched to these very rapid changes in temperature. Master mixes compatible for fast ramping speed can be us ed for either fast ramping mode or standard ramping mode. However, master mixes compatible for standard ramping speed are usually only compatible for standard or slower ramping mode. Historically once a PCR machine generated new nucleic acids, the product was visualized by the use of dyes that in tercolated into the nascent DNA generating appropriately sized bands on an agarose gel with ultraviolet light. With the advent of real-time PCR, each machine detects prod uct during the generation of each cycle with some type of fluorescent technology. Most of the older real-time PCR machines use a tungsten-halogen lamp as light source wh ile the newer versi on of real-time PCR platforms use lower maintenance light emitt ed diodes (LED) as the light source. These lights cause emission from various fluore scence dyes and these must be captured in real-time, which could ei ther be a charge coupled device (CCD) camera, photomultipliers (PMT) or a photodi ode. Manufacturers claim advantages for their various technologies, however depending on the color of fluorescence, there are differences in the range of detection for eac h combination of these.102 For instance, real-time PCR

PAGE 59

59 machines such as the iQ5 (Bio-Rad, Hercules, CA) and the 7500 Fast (Applied Biosystems, Foster City, CA ) use the combination of tungsten-halogen lamp and CCD as light/detection, the Mastercycler ep realplex (Eppendorf, Hamburg) uses LED and PMT as light/detection and the CFX96 (Bio-Rad, Hercules, CA) has an LED/photodiode as its light/detector system. Finally, PCR technology differs by the chemis try that is used to emit fluorescence. The two most commonly used chemistries in real-time PCR master mixes are based on generation of fluorescence by either hydr olysis of a separately binding DNA probe (TaqMan) or through the intercalation of a dye within the target (SYBR Green I). The TaqMan probes detect the complementary s pecific PCR product as it accumulates during PCR cycles.103 The amount of fluorescence dete cted is directly related to the amount of PCR targets am plified during the PCR cycles. The TaqMan probe based chemistry can be used for RNA quantitation, DNA quantitation, alle lic discrimination, and other types of assays. An advantage of t he TaqMan probe is that it can be labeled with different dyes, so it allo ws amplification of multiple target sequences in a single tube reaction.103 This chemistry while more specif ic than SYBR, but it is five to ten times more expensive per well. As the dyes come off patent and other companies develop variations of flourogenic probes, t he expense has been declining in recent years. SYBR Green I chemistry uses SYBR Green I dye, which will bind to double stranded DNA as the nascent strands are formed and the PCR products are detected as they accumulate during PCR cycles. These dyes emit in relatively low fluorescence when free in a solution, but t he fluorescence will increase logar ithmically as they bind to

PAGE 60

60 the newly forming double stranded DNA.104 Since the dyes bind to all double stranded DNA, the increase of fluorescence intensit y is proportionate to the amount of PCR product produced. The SYBR Green I chemistry can be applied to RNA quantitation and DNA quantitation.103 The SYBR Green I chemistry is exceptionally co st effective and can be used for a variety of applications such as melting temperature experiments and genotyping. Also it is less specific which can be desirable when screening for emerging organisms that are as yet unknow n. It also can be used to monitor the amplification of any double stranded DNA sequence. A major problem of SYBR Green I chemistry is that it may generate a false positive signal due to the bi nding to non-specific double stranded DNA sequences.103 Because the SYBR Green I dye will bind to any double stranded DNA, this will make reaction spec ificity only determined by the primers. Consequently, the primers s hould be designed to avoid non-s pecific binding such as primer dimer formation. In addition, the us er must be familiar with proper PCR chemistry and machine output formats to accu rately optimize all reactions.104 The objective of this specific aim is to determine if the two most commonly used real-time PCR platforms for influenza dia gnostics have comparable performance. The four master mixes which were used in these experiments also have relatively different chemistries. Ultimately, we would like to assess the overall interchangeability between master mixes and real-time PCR platforms. Materials and Methods Real-Time PCR Platforms and Master Mixes Influenza viruses are composed of RNA. Thus when RNA is extracted, it must be reverse transcribed into cDNA for the PCR reaction. This can be done as either a twostep reaction or a one-step reaction. In t he two-step reaction, all RNA is reverse

PAGE 61

61 transcribed into cDNA and then the PCR reaction is set up separately. In the one-step reaction, the first strand primer is added to a master mix which contains the reverse transcription enzyme and the polymerase and new targets are generated in a single PCR reaction. Thus, we co mpared both oneand two-step r eactions with two different master mixes and with two diffe rent machines. We compar ed TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems, Foster City, CA) (referred to herein as Fast Virus) with iScript One-Step RT PCR Kit for Probes (Bio -Rad, Hercules, CA) (referred to herein as iScript). In addition we compared Fast SYBR Green Master Mix (Applied Biosystems, Foster City, CA) (referred to herein as Fast SYBR) with iTaq Fast SYBR Green Supermix with ROX (Bio-Rad, Hercules, CA) (referred to herein as iTaq). The two machines for comparison consisted of the CFX96 (Bio-Rad, Hercules, CA) and 7500 Fast Real-time PCR System (7500 Fast) (Applied Biosystems, Foster City, CA) machines. Primer and Probe Sets Standard curves were generated to compar e between the slope, efficiency, and Ct difference between CFX96 (Bio-Rad, Hercules, CA) and 7500 Fast (Applied Biosystems, Foster City, CA) machines. Th ree different primer and probe sets against matrix gene (Influenza A CDC, Influenza A Ric ht and Matrix Mak) were used. The Mak protocol was designed to detect influenz a from pandemic influenza H1N1/2009 with very high specificity.1 Sequences of Influenza A CDC (INFA CDC) and Influenza A Richt (INFA Richt) used the same sequences as described in Chapter 3. Sequences of primer and probe sets ar e in the Table 4-1. A modified probe was used in the Mak protocol consisting of a Locked Nuclei c Acid (LNA) to avoid compromising the annealing temperature due to t he use of short oligonucleotide in this protocol.1

PAGE 62

62 One-Step PCR Protocol The protocols had been optimized and standar dized for all the primer and probe sets.1 Each assay was performed on each samp le three times to ensure it met the experimental design for comparing two diffe rent machines. The samples consisted of ten-fold dilutions of H1N1 influenza A virus. The Fast Virus (Applied Biosystems, Fo ster City, CA) and iScript (Bio-Rad, Hercules, CA) are master mixes for one-st ep RT-PCR. A total volume of 20 L perreactions was used for iScript master mix (Bio-Rad, Hercules, CA) which consist of 10 L of 2X RT-PCR Reaction, 0. 4 L of iScript RT for onestep RT-PCR, 175 nM probe, 400 nM of INFA CDC forward primer, 400 nM of INFA CDC reverse primer, 2 L RNA template, and RNAse-free water ad 20 L. The Fast Virus master mix (Applied Biosystems, Foster City, CA) used the same amount of prim er, probe, and RNA template; 5 L of the master mix and RNA se free water ad 20 L. The INFA Richt primer set also used the same amount of reagents, however the amount of forward and reverse primers were 500 nM each, and t he probe was 175 nM. The Matrix Mak used the same amount of reagents wit h forward primer; reverse primer and probe were 500 nM each. Thermal cycling conditions comprised 50oC for 5 minutes, 95oC for 20 seconds, 40 cycles of 95oC for 3 seconds and 60oC for 30 seconds. Two-Step PCR Protocol Fast SYBR (Applied Biosystem s, Foster City, CA) and iTaq (Bio-Rad, Hercules, CA) are master mixes for tw o-step RT-PCR reaction. Re verse-transcription reaction was done using High Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, Foster City, CA) combined with Anchored Oligo dT Primers (Thermo Scientific, Waltham, MA). The reaction mix consists of 1 L of Anchored Oligo

PAGE 63

63 dT Primers, 2 L 10X RT Buffer, 0.8 L 25X dNTP Mix (100 mM), 2 L of 10X RT Random Primers, 1 L of Multicribe Reverse Transcriptase, 1 L of RNase Inhibitor, 3.2 L of RNase-free water, 10 L of RNA template. Incubation was performed in 37oC for 30 minutes, followed by heating to 95oC for 5 minutes to st op the reaction, and then hold at 4C. Both Fast SYBR and iTaq master mixes used the same amount of reagents in a 20 uL reaction. The INFA CDC assay used 200 nM of forward pr imer and 300 nM of reverse primer. INFA Richt assay used 450 nM of forward primer and 550 nM of reverse primer, whereas Matrix Mak used 500 nM for each forward and reverse primer. Amplification cycles were performed at 95oC for 20 seconds followed by 40 cycles of 95oC for 3 seconds and 60oC for 30 seconds for INFA CDC and INFA Richt primer set; and 95oC for 20 seconds followed by 40 cycles of 95oC for 3 seconds and 62oC for 30 seconds for Matrix Mak primer set. Viruses This experiment used the pandemic (H1N 1) 2009 isolate A/Mexico/4108/09 which has been demonstrated to be positive using a ll primers and probes sets with all master mixes. RNA extraction utilized MagMAX 96 Total RNA Isolation Kit (Ambion, Austin, TX) in KingFisher (Thermo, Waltham, MA) autom ated extraction platform. Analysis The logarithmic data was transformed for inverse of log2 and graphed for each different experiment comparing the Cts of the CDC, Richt, and Mak protocols. For all of the comparisons, the slope and the R2 of each curve was generated by the average of each separate well for each dilution.127 Each experiment was repeated three times and all three experiments were pooled for fu rther analysis. The Ct data from each

PAGE 64

64 experiment consisting of the one influenza is olate was compared for the PCR protocol, with machine and mastermix representing va riables and this data was analyzed by ANOVA (SigmaPlot/SigmaStat 12) (P < 0.05). Results One-Step PCR Protocol Both the INFA CDC and Richt PCR protocol s performed over the range of dilutions with exceptional performance in terms of slopes -3.32 to -3.54 and R2 values between 0.99 and 1.0. The Mak protocol was considerabl y less efficient with slopes from -2.79 to -3.46 with R2 values between 0.83 and 0.99. The INFA CDC protocol generated some variation in the Cts dependi ng on the master mix when performed with the 7500 Fast platform. However, using the Fast Virus ma ster mix, the result s were similar between the two machine platforms. And the Cts were generally lower using the Bio Rad machine irrespective of master mix. Also the Fast Virus master mix had lower Cts overall on both the CFX96 and 7500 Fast mach ines. None of these differences were statistically significant. Repeated attempts to obtain a standard curve with the Mak protocol and the iScript master mix were unsuccessful usi ng either the 7500 Fast or CFX96 platforms. This was dropped from further stat istical analysis. Although the R2 values were different for the Mak protocol depending on machine and master mix there was no significant difference between Ct values using the Fast virus master mix. Two-Step Protocols In general, the SYBR Green master mixe s did not performed as well as the TaqMan master mixes, based on the slopes, the R2 and the CV values (Table 4-5). However, all three protocols detected infl uenza A overall dilutions. Compared to the

PAGE 65

65 one-step protocol, the Cts were significantly higher, however, there was no difference in significance between all three of the two-st ep protocols. Com pared to the one-step protocol the SYBR had different (less negativ e slopes). The iTaq master mix generated slopes closest to -3.3 and this was reflected in the efficiency of the reaction. Although this slope was the most efficient, there was not statistical significance when comparing the CVs of this protocol and ch emistry with that of the others. Discussion The objective of this specific aim was to find out if protocols are interchangeable between master mixes and real-time PCR mach ines. We tested an isolate of influenza pandemic (H1N1) 2009 which was the A/Mexi co/4108/09 using INFA CDC, INFA Richt, and Matrix Mak using four different mast er mixes and two different real-time PCR machines. All of the primer probe sets were developed to detect influenza A strain from its Matrix gene. The INFA CDC was mainly developed for human samples, while the INFA Richt was mainly developed for animal samples, particularly swine. The Matrix Mak was developed to detect pandemic influenza (H1N1) 2009 with high specificity. In terms of master mix chemistry technologies, we tested two different chemistries. Two master mixes were using TaqMan probe chem istries (iScript One-Step RT PCR Kit for Probes and TaqMan Fast Virus 1-Step Master Mix) and the other two were using SYBR Green chemistries ( iTaq Fast SYBR Green Supermix with ROX and Fast SYBR Green Master Mix). The main diffe rences in these two types of master mix besides the chemistries are the TaqMan master mix needs a probe and this is a one-step RT-PCR master mix. The SYBR Green ma ster mix does not need a probe, and this master mix is a two-step RT-PCR master mix.

PAGE 66

66 The INFA CDC primer probe set is interchangeable between TaqMan master mixes and real-time PCR platforms The performance of this assay did not greatly differ between TaqMan master mixes and real-time ma chines, indicated by the average Cts, CVs, slopes, and reaction efficiencies which we re almost the same for each master mix on each machine. The only difference was wit h the Fast Virus master mix in CFX96 machine. The greatest difference was in the CVs with the INFA CDC primer set using Fast Virus in CFX96. However, even though there were high CVs, the other parameters such as Cts, slopes, SDs and reaction effi ciencies were good. Based on the original protocol from CDC, this primer probe has been validated against several real-time PCR machines such as Applied Biosystems (7 000, 7300, 7500, etc), Bio Rad (iQ, iQ5, and CFX96), and Stratagene QPCR instruments (MX4000, MX3000, and MX3005) using only Invitrogen S uperScriptIII Platinum One-Step Quantitative Kit master mix.97;98 By conducting this research, now we know that this primer probe set could be used with other TaqM an master mixes without compromising the detection performance. The INFA Richt primer probe set was validated by Dr. Juergen Richt using OneStep RT-PCR Kit from Qiagen (Qiagen, Valencia, CA) on the Smartcycler (Cepheid, Sunnyvale, CA) and ABI PRISM 7900 HT (Applied Biosystems, Foster City, CA) machines. Based on our findings, this primer probe set could be used with both 7500 Fast and CFX96 platform using iScript and Fast Virus master mixes also. If the 7500 Fast real-time PCR platform is going to be used, the master mi x of choice would be Fast Virus, considering lower Cts whic h was generated by this master mix, but the other master mix (iScript) would also give comparable results. The iScript master mix

PAGE 67

67 would be a master mix of choice for this pr imer probe set if the real-time PCR machine is the Bio Rad CFX96. Different results were obtained from Matr ix Mak primer probe set. Since this set did not work with 7500 Fast using iScript ma ster mix and gave poor results by using the same master mix on CFX96 platform, further protocol validation was not pursued. Even though this primer probe set showed results by using Fast Virus master mix, the performance was inferior compared to the ot her two primer probe sets. The Matrix Mak primer probe set was designe d to be used in multiplex setting with SYBR Green master mix.1 And, the primary analysis of the real-t ime PCR results was using melt curve, instead of Cts. Another factor why the per formance of this primer probe was not satisfactory with iScript master mix is becaus e of this master mix uses fluorescein as passive reference, instead of ROX. The 7500 Fast is a ROX de pendent real-time PCR machine. The 7500 Fast uses tungsten hal ogen lamp as light source and CCD as detector, while the CFX96 uses LED as light source and photodiodes as detector. ROX is usually be used for 7500 Fast machine to normalize the fluorescence light captured by the detector. ROX will not interfere the PCR reaction.141 Lowering the ROX concentration will give different Ct values and standard deviations, however it does not have effect on the true sens itivity of the reaction.141 Normalization by ROX could cause lower Ct values, thus differences of Ct values between the two machines could happen even though template amounts are the sa me. This should not be confused since comparing the reaction performance between the two machines could be analyzed by looking at the slope, the standard deviation and the CV.142

PAGE 68

68 This variation of light path lengt hs produces different fluorescence measurement.142 In order to use master mix which does not contain ROX in the reaction, such as the iScript master mix, this machine must be se t not to use passive reference. The setting like this sometimes will work perfectly or can sometimes will fail, like the case of this Matrix Mak primer pr obe with the iScript master mix. In contrast, real-time PCR machines which do not utiliz e single-light source, usually use LED as light source, will scan the plate right abov e the sample plate and will individually illuminates and detects fluorescence for each well.142 Real-time PCR platforms which adopt this technology do not need passive re ference to normalize the well-to-well fluorescence signal differences. We can s ee the difference in the CFX96 which it showed results using the same master mix, even though it was not satisfactory. This primer probe set was not optim ized with the iScript master mix and Fast Virus master mix. It should be re-optimized for each of t he master mixes and machine this primer probe will use. The INFA CDC and INFA Richt are interchangeable using SYBR Green based master mixes. Interesting results were obtained for these runs, based on the CVs, slopes, R2 and reaction efficiencies these prim er probe sets tend to show better performance if the master mixes used different brand as the real-time platforms. So, the primer probe sets which used the iTaq perform ed better in the 7500 Fast rather than in CFX96. On the other hand, the same prim er probe sets which us ed Fast SYBR master mix would perform better in the CFX96 ra ther than in 7500 Fast. But, an exception would be given to INFA Richt primer set, wh ich it would perform better in CFX96 using iTaq master mix rather than using Fast SYBR in the same platform.

PAGE 69

69 Since the Matrix Mak primer probe set was mainly design for SYBR Green chemistry master mix, it per formed relatively well in all of the master mixes and realtime PCR machines. It was also interc hangeable for different SYBR Green master mixes and real-time platforms The only problem was on t he slope of the run when it was used in CFX96 with iTaq master mix. It showed a very unsatisfactory slope which was -1.05, due to plate to plate va riations on high dilutions factor. Many references consist of the developmen t of diagnostic protocols for influenza using real-time PCR and how to differentiate between various influenza strains rapidly. Most of these are new protocols (in-house adapted); and different bet ween institutions and research groups.9;51;107;124;129-140 Very few publications compare performance of available protocols and differences betw een real-time PCR mach ines. One of these publications compared the perfo rmance of available commerc ial kits, primer probe set sequences from research institutes, and then run them in different machines.132 However, this research was only limited to small number of isolates and the discussion was emphasized to the different results of different kits.

PAGE 70

70 Table 4-1. Primer and probe sequences for detection of pandemic (H1N1) 2009 influenza Forward (5-3) Reverse (5-3) Probe (5-3) CDC Protocol GACCRATCCTGTCACCTC TGAC AGGGCATTYTGGACAAAKC GTCTA FAMTGCAGTCCTCGCTCACTGG GCACGBHQ Richt Protocol AGATGAGTCYTCTAACCG AGGTCG TGCAAARACAYYTTCMAGT CTCT FAMTCAGGCCCCCTCAAAGCCG A-BHQ-1 Matrix Mak Protocol GGTCTCACAGACAGATGG CT GATCCCAATGATATTTGCT GCAATG FAMACCA AT CCAC TA AT CAG GBHQ1* *The LNA bases are underlined

PAGE 71

71 Table 4-2. Comparing Cts, SDs and CV of TaqMan chemistries master mixes. Da ta represents three replications; wells with CVs more than 10% ar e not analyzed in the data INFA CDC INFA Richt Matrix Mak Realtime PCR Platform Master Mix Dilutions Ct Mean SD CV Ct Mean SD CV Ct Mean SD CV Neat 17.52 0.402.2618.87 0.25 1.30N/D* N/D N/D 1/10 21.03 0.241.1421.73 0.18 0.83N/D N/D N/D 1/100 24.43 0.140.5625.15 0.17 0.69N/D N/D N/D 1/1000 28.09 0.110.4028.84 0.20 0.71N/D N/D N/D iScript OneStep RT PCR Kit for Probes 1/10000 31.85 0.130.4032. 65 0.21 0.66N/D N/D N/D Neat 14.91 0.090.6114.95 0.36 2.3919.12 0.874.53 1/10 18.23 0.100.5618.41 0. 33 1.7922.09 1.828.24 1/100 21.60 0.090.4121.99 0. 30 1.3629.15 1.826.24 1/1000 24.99 0.090.3725.39 0. 36 1.4129.15 1.956.67 AB 7500 TaqMan Fast Virus 1Step Master Mix 1/10000 28.42 0.130.4728.69 0. 31 1.0932.91 1.996.06 Neat 14.37 0.211.4417.45 0.68 3.8929.07 0.893.06 1/10 17.47 0.211.1819.68 0. 43 2.2030.73 0.802.59 1/100 21.06 0.100.4823.18 0. 37 1.5835.11 2.787.92 1/1000 24.54 0.110.4726.84 0. 34 1.2836.93 1.113.00 iScript OneStep RT PCR Kit for Probes 1/10000 28.33 0.230.8130. 47 0.28 0.93N/D N/D N/D Neat 14.99 0.674.5019.33 0.20 1.0319.92 0.793.95 1/10 18.47 0.170.9122.01 0. 11 0.5222.99 0.512.21 1/100 22.04 0.160.7225.54 0. 05 0.2026.17 0.572.19 1/1000 25.45 0.190.7529.08 0. 11 0.3829.98 0.381.28 Bio Rad CFX96 TaqMan Fast Virus 1Step Master Mix 1/10000 29.06 0.190.6533.63 0.89 2.6633.11 1.644.95 *N/D=Not detected

PAGE 72

72 Table 4-3. Comparing Cts, SDs and CV of SYBR Green chemistries master mixes. Data represents three replications; wells with CVs more than 10% are not analyzed in the data. INFA CDC INFA Richt Matrix Mak Realtime PCR Platform Master Mix Dilutions Ct Mean SD CV Ct Mean SD CV Ct Mean SD CV 1/10 21.99 1.024.66 20.08 1.135.6320.03 0.341.72 1/100 24.77 0.963.86 23.03 1.014.3923.55 0.552.33 1/1000 27.48 1.224.45 26.01 0.863.3227.12 0.562.07 1/10000 30.92 1.073.45 29.47 0.832.8330.88 0.511.65 iTaq Fast SYBR Green Supermix with ROX 1/100000 34.89 1.042.98 33.48 1.233.6834.13 0.892.60 1/10 21.53 1.376.36 19.43 1.387.0921.32 0.763.55 1/100 23.89 1.415.90 21.95 1.416.4324.22 0.843.45 1/1000 26.58 1.465.51 24.62 1.415.7327.66 0.782.80 1/10000 29.98 1.525.09 28.11 1.475.2431.01 0.802.58 AB 7500 Fast SYBR Green Master Mix 1/100000 34.02 1.444.24 32.30 1.655.1235.04 1.574.48 1/10 21.41 0.321.50 20.25 0.311.5421.82 0.180.84 1/100 23.57 0.120.50 22.50 0.271.2124.72 0.763.08 1/1000 26.91 0.220.82 25.80 0.351.3527.80 0.220.79 1/10000 28.45 3.8013.3829.35 0.431.4631.34 0.551.75 iTaq Fast SYBR Green Supermix with ROX 1/100000 34.49 0.310.90 33.24 0.250.7534.43 0.932.70 1/10 23.30 0.863.67 21.92 0.743.3824.64 1.104.46 1/100 24.58 0.592.40 22.75 0.170.7425.58 0.170.66 1/1000 27.80 0.260.93 26.06 0.150.5928.79 0.250.86 1/10000 31.26 0.210.68 29.56 0.120.3932.79 0.631.93 Bio Rad CFX96 Fast SYBR Green Master Mix 1/100000 35.21 0.762.16 33.50 0.361.0836.54 1.082.95

PAGE 73

73 Table 4-4. Comparing iScript One-Step RT PCR Kit for Probes and TaqMan Fast Virus 1-Step Master Mix AB Fast 7500 Bio Rad CFX96 Master Mix Criteria INFA CDC INFA Richt Matrix Mak INFA CDC INFA Richt Matrix Mak CV 0.950.84 N/D 0.881.97 4.14 Slope -3.52-3.47 N/D -3.49-3.32 -2.79 R2 1.001.00 N/D 1.000.99 0.83 iScript OneStep RT PCR Kit for Probes Efficiency 92.3994.33 N/D 93.60100.00 130.70 CV 0.49 1.61 6.35 1.51 0.57 2.46 Slope -3.38 -3.45 -3.47 -3.54 -3.38 -3.46 R2 1.00 1.00 0.99 0.99 1.00 0.99 TaqMan Fast Virus 1-Step Master Mix Efficiency 97.79 95.15 95.36 91.80 97.70 94.83 *N/D=not detected Table 4-5. Comparing iTaq Fast SYB R Green Supermix with ROX and Fast SYBR Green Master Mix AB Fast 7500 Bio Rad CFX96 Master Mix Criteria INFA CDC INFA Richt Matrix Mak INFA CDC INFA Richt Matrix Mak CV 3.883.972.07 3.421.26 1.83 Slope -3.19-3.32-3.54 -3.09-3.27 -1.05 R2 0.990.991.00 0.860.99 0.99 iTaq Fast SYBR Green Supermix with ROX Efficiency 105.7599.9091.65 113.20102.27 107.33 CV 5.425.923.37 1.971.24 2.17 Slope -3.12-3.19-3.44 -3.08-3.09 -3.23 R2 0.990.990.99 0.970.97 0.97 Fast SYBR Green Master Mix Efficiency 109.41105.8695.67 111.53110.93 104.13

PAGE 74

74 CHAPTER 5 GENOTYPING ANIMAL INFLUENZA ISOLATES USING MAK PROTOCOL Background Four worldwide pandemic influen za outbreaks occurred in the 20th century, namely the Spanish flu (1918), the Asian flu (1957) the Hong Kong flu (1968), and the influenza pandemic 2009 (2009).36 The influenza pandemic 2009 fi rst occurred in Mexico on April 2009. This influenza was caused by influenza strain H1N1 and it was thought to be from swine. No clear evidence that this influenz a strain was first transmitted from swine to humans except that five of eight of its genes are der ived from swine.49;51 Influenza virus is composed of a segm ented genome which reassorts frequently between two different influenza viruses.9;10 It is hypothesized t hat genetic reassortment phenomenon occurs when two different influenza viruses simultaneously infect one cell.6;8 The receptors on the cell surface have a crit ical role in virus binding. Specifically, the viral HA gene binds to sialic acid residues on glycolipids on the cell surface.11 Human influenza viruses preferentially bind to sialic acid attached to galactose, as a 2.6 linkage, whereas avian influenza viruses tend to bind to sialic acid attached to galactose, as a 2.3 linkage.12 Pigs have both 2.3 galactose and 2.6 galactose linkages on epithelial cells of their trachea, which makes them susceptible to both human influenza and avian influenza. The presence of multiple receptors is the basis for the concern that the pig is the actual mixing vessel in which influenza viruses reassort.12 The gold standard of influenza di agnosis is virus isolation 93 which at least 5 days to isolate the virus and then to type the virus. Simple serological tests such as HI can be used as diagnostic tool for influenza, but this method has a lack sensitivity and it cannot

PAGE 75

75 distinguish between antibody which generated by virus infection and vaccination.95 Molecular methods such as PCR offer rapid detection with high sensitivity and specificity. Real-time PCR methodology is now technologically emphasized because of speed, standardization, and the ability to mu ltiplex detection of multiple pathogens and strains in a single tube. Results presented by real-time PCR are qua ntitative, whereas the conventional PCR are qualit ative. Although, real-time PCR is more robust, simple, and accurate, problems associated its use include increased expense for machine and reagents, need for technical training, and lack of standardization amongst laboratories and laboratory personnel. Some PCR protocols are recommended by WHO, FAO and OFFLU on their guidelines.57;96 Most of them were mainly dev eloped for human samples. One of the recommended protocols is a method which wa s developed by CDC (referred to herein as INFA CDC).97 This method is widely used in diagnostic laboratories and is recommended as the universal method for de tection of pandemic influenza outbreaks.98 The INFA CDC primer and probe set was mainly developed to detect influenza A from human samples and it also has been test ed against some human and swine origin influenza virus isolates.98 This primer and probe set target s the Matrix gene of influenza virus. The problem with this protocol is t hat typing does not dist inguish subtypes based on the H and N surface markers. There are two issues rela ted to using PCR technology to distinguish between strains of influenza. O ne must be able to 1) accurately identify all of the H and N genes and 2) detect a reassortment event. For typing by PCR, a sample is first identified as influenza A based on a PCR protocol targeting the Matrix gene. Once identified as influenza A, the hemagglutinin

PAGE 76

76 (HA) gene is then identified for which there are 16 HA possibilities across species. The next step is to type the sample for neuramin idase (NA) gene which has nine types. Most of the typing method basically type the isolate based on the HA and NA genes. A newly published protocol describes a technique for rapid subtyping based on type of the eight influenza genes (HA, NA, M1-2 protein, polymerase basic 1 protein, polymerase basic 2 protein, polymerase ac id protein, nucleocapsid protein, and nonstructural protein) and then genotyping is based on their definition of a lineage of each influenza group. This protocol is a variation of an earlier method 143 developed for detection of reassortment. Th is more recent variation 1 was shown to type pandemic (H1N1) 2009 influenza isolates, and could di stinguish between swi ne Eurasian-avianlike isolates, swine triple reassortant isol ates, and human seasonal H1 and H3 isolates. However, in terms of lineage the Mak et al (2011) protocol was specifically developed to detect pandemic (H1N1) 2009 gene reasso rtment from swi ne isolates and not developed to detect pandemic (H1N1) 2009 gene reassortment from isolates of other species.1 According to the paper, this prot ocol was tested with swine and human influenza viruses.1 The objective of this specific aim was to test the robustness of this typing scheme for identification of isolates from other s pecies such as birds, dogs and horses and to also include additional swine and human isolates. Materials and Methods Screening Methodology Three levels of screening were used to ty pe and detect different influenza isolates (Figure 5-1). The first screening utilized t he IFNA CDC primer and probe set to confirm the presence of influenza A. In the second r ound of PCR, positive samples from the first

PAGE 77

77 screening were further tested for matrix, HA, NA, and polym erase basic 2 (PB2) genes to identify pandemic (H1N1) 2009 reassortant. In the third round of PCR, samples that were negative for at least one of the genes in the second round were then tested without the lineage specific probe in a SYBR green protocol. PCR Protocol Table 5-1 provides the primers and probe comb inations utilized in this experiment. The master mix used TaqMan Fast Viru s 1-Step RT-PCR Mast er Mix (Applied Biosystems, Foster City, CA ), the amount other reagents and protocol were the same as described in Chapter 3. The RNA template was a 10-fold dilution of the original RNA concentration starting at an HA titer of 64. The real-time PCR platform used the7500 Fast Real-time PCR System (Applied Biosyst ems, Foster City, CA). For the second round of reactions, TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems, Foster City, CA) master mix was used. Two L RNA samples (with 10 fold dilutions) were amplified in a 20 L reaction c ontaining 5 L of ma ster mix, RNase-free water ad 20 L, and the corresponding primer-probe set (500 nM each). The real-time RT-PCR assays were performed in a 7500 Fast Real-time P CR System (Applied Bi osystems, Foster City, CA) platform with the following conditions: 50oC for 5 minutes, 95oC for 20 seconds, 40 cycles of 95oC for 3 seconds and 62oC for 30 seconds. All probes of Matrix, HA, NA, and PB2 used LNA modified bases, so they could be used in these reactions.1 The final round of reactions was tested using 7500 Fast Real-time PCR System (Applied Biosystems, Foster City, CA) platform. This scr eening used two step RT-PCR method with SYBR Green based master mix. T he reverse-transcriptase reaction used the same reagents and protocol as in Chapter 4. RNA template for reverse-transcription also used 10-fold dilution of the original RN A concentration. The reaction mix consisted

PAGE 78

78 of 10 L of Fast SYBR Green Mast er Mix (Applied Biosystems, Fo ster City, CA), 2 L of cDNA template, the corresponding primer set (500 nM each), and RNase-free water ad 20 L. Amplification cycles were performed at 95oC for 20 seconds followed by 30 cycles of 95oC for 3 seconds and 62oC for 30 seconds. Influenza Viruses This protocol was developed for swine influenza isolates and we tested this strategy against 15 different viruses consisti ng of three subtypes each affected species including swine, human, avian, horse and dog (Table 5-2). Each virus was titrated by HA and a ten-fold dilution was run. Most vi ruses were run at an HA titer of 64. All samples were run in triplicate on each 96 we ll plate and each plate was run three times. Analysis and Interpretation Descriptive statistics were performed for each assay comparing each virus and mean Ct and standard deviations were com puted on each plate and then for each run (Tables 5-3 and 5-4). The main analysis for this experiment centered on the interpretation of each screening level as outli ned in Table 5-5. In addition, the third screen run was a specific SYBR green requiring interpretation based on melting temperature (Tm). A positive result was a reaction with a melt ing temperature (Tm) value within 2 SDs of positive controls mean Tm.143 Results First Screening Consistent with previous findi ngs in Chapter 3, all samples were positive using the INFA CDC primer set confirming that all were influenza A viruses (Table 5-6).

PAGE 79

79 Second Screening Using the one-step RT-PCR in which a probe was specific for Matrix, HA, NA, and PB2 genes, almost all viruses were negative. The only positive at this step was the human isolate, A/Mexico/4108/ 2009 (H1N1). The influenz a isolate A/Mexico/4108/2009 (H1N1) was positive for all four genes te sted via probes specific for pandemic H1N1 and this was consistent genetic reassortment. Third Screening All of samples which were negative in t he second screening, were tested with the two-step RT-PCR using this new typing prot ocol for Matrix, HA, NA, and PB2 genes as a SYBR reaction. For this assay interpreta tion was based on the melt curve (Figure 51and Figure 5-2). Specifically, for the ma trix gene, all swine isolates demonstrated derivation from a TRIG lineage (Table 5-6). Other interpretations consistent with a triple TRIG derivation included A/Chukar/M N/14951-7/1998 (H5N2), A/TY/VA/4529/2002 (H7N2), A/Equine/Ohio/1/2003 (H3N8), and A/Equine/PA/01/07 (H 3N8). All other isolates indicated derivation from t he Eurasian lineage for matrix gene. For the HA gene, all equine viruses, A/Swine/Wisconsin/238/97 (H1N1), A/Swine/MO/Richt/07 (H2N 3), A/TY/VA/4529/2002 (H7N2) and A/Canine/Florida/2004 (Table 5-6). HA genes were consistent with a TRIG lineage while all the others were of Eurasian lineage. The NA genes of A/Brisbane/59/2007 (H1N1) and all the canine influenza isolates were derived from Eurasian lin eage. On the other hand, NA genes of the other virus samples tested as though derived from a TRIG lineage (Table 5-6).

PAGE 80

80 For PB2 gene, only the A/Swine/MO/Ric ht/07 (H2N3) and A/Panama/2007/99 (H3N2) isolates demonstrated derivation fr om the Eurasian lineage, while the others were derived from TRIG lineage. Discussion The Mak et al. (2011) protocol is a further dev elopment of a protocol by Poon et al. (2010). This latter protocol only detects t he reassortment of pandemic (H1N1) 2009 in influenza isolate. The Mak protocol not only detects pandemic (H1N1) 2009 in an influenza isolate, but also genotypes samples to interpret the lineage of an isolate as either a pandemic (H1N1) 2009, swine Eurasianavian like, swine triple reassortant, or human seasonal H1 and H3 derivation. The ot her strength of this protocol is the provision of additional probes and primers for each gene of the influenza virus. The point of the first screening run was to verify that an isolate was influenza A. This run was a one-step RT-PCR method us ing INFA CDC primer probe set that we confirmed was robust for a wide variety of influenza viruses. Therefore, any sample which showed negative in this run would lo gically be dropped from further testing with this protocol. The second screening was in tended to confirm if an influenza gene segment was pandemic (2009) H1N1 reassortment. In the original Mak protocol this is multiplexed with Cy5 as t he fluorescent marker and BHQ2 for the quencher.1 For this work, we used singleplex reactions, as a one-step RT-PCR method. The TaqMan Fast Virus 1-Step Master Mix (Applied Bi osystems, Foster City, CA) was used for master mix with lineage specific probes. The third screening was the step wherein the isolate was genotyped to genetic lineages. The protocol used in this step was si milar to the protocol described by Poon et al (2010). This step utilized two-step RT-PCR method, so the run used master mix with

PAGE 81

81 SYBR Green chemistry. The usual method fo r determining positive and negative is by looking at the cycle threshold (Ct) values.143 This step also required interpretation by subjecting the reaction to a melt ing temperature (Tm) protocol.143 PCR products in this reaction are subjected to gr adual increase of temperature.104 As the temperature increases, the real-time PCR instrument records the decrease of SYBR Green dye fluorescence which is caused by dissociation of double-stranded DNA.127 Result interpretations were done by comparing Tm of the samples with aver age Tm of positive controls.143 Using this modified scheme, we could correctly identify when swine influenza isolates such as A/Swine/Wisconsin/238/97 (H1N1) possessed a TRIG in all four genes (matrix, HA, NA, and PB2). TRIG is a comb ination of reassort ment between human influenza virus, swine influenza virus and avian influenza virus.62;67 The TRIG constellation consist of PB1 gene from human virus origin; PA and PB2 genes from avian virus origin; M, NS and NP genes from classical swine virus origin.64 According to the previous study by Olsen et al (2000), the HA and NP genes of this isolate were derived from classical H1N1 swine influenza virus.69 Before 1998, only classical swine (H1N1) were isolated from swine in North America.62-64 With the limited number of samples for testing, the li neage genotyping of t he Mak protocol did not distinguish between classical swine (H1N1) and the other lineages. However, the HA gene of the TRIG H1N1 was actually derived from cl assical H1N1 swine influenza virus 9, so there is a possibility that portions of classical swine (H1N1) are amplified. Sequencing of several non-reassorted classical swine viruses would verify this.

PAGE 82

82 Genes of swine influenza isolate A/S wine/Italy/10659-1/2007 (H 3N2) are reported to be derived from Eurasian lineage. But, in this genotyping protocol, only the H gene was detected as a Eurasian lineage while the other three genes (matrix, NA, and PB2) were derived from TRIG lineage. The only sequence of HA gene is available from GeneBank, and the other gene sequenc es are not available; as well as no publication has been published regarding this isolate. S equencing of this gene s egment from this isolate would be an important confirmation of this result. The pattern of detection of all of the targets obtained for A/Mexico/4108/2009 (H1N1) were consistent with the pandemic (H1N1) 2009 lineage as would be expected since this isolate was one of the pandemic (H1N1) 2009 reference isolate by the Influenza Reagent Resource, a joint cooperation between CDC and ATCC.144 The basic origin of pandemic (H1N1) 2009 vi rus was TRIG lineage for HA, NP, NS, PB1, PB2, PA genes; and the NA and M genes were from swine Eurasian lineage.47 This protocol is supposed to be highly specific fo r detecting this reasso rtant of the pandemic (H1N1) 2009. However our results consist ently did not detect the TRIG for HA and PB2 genes and the NA and M genes did not show Eurasian lineage. The human influenza virus isolate A/ Brisbane/59/2007 (H1N1) was one of the seasonal human influenza isolat e. This protocol showed that the HA was derived human seasonal/Eurasian lineage, c onsistent with expectations.47 On the other hand, the M, NA, and PB2 genes results were varied between the Eurasian and TRIG lineage. Another human isolate A/Panama/2007/99 (H 3N2) was supposed to be seasonal human isolate. The typing results for HA, NA, and PB2 genes showed that they were

PAGE 83

83 derived from human seasona l lineage while the M gene wa s derived from Eurasian lineage. Direct sequencing again is necessa ry for validation of these results. This typing protocol has never been test ed with avian derived influenza. Avian influenza viruses have different lineages with swine and human. Some phylogenetic evidences show that all HA and NA subtypes are present in the avian species, which then led to a hypothesis that the origin of mammalian influenza viruses were from avian influenza virus.6;10;29;46-48 The results of the typing sh owed that most of the observed genes were derived from TRIG lineage and some of the genes were from Eurasian lineage. Equine influenza virus has two different subtypes. They are H7N7, referred as equine 1; and H3N8, referred as equine 2.6 The results of this typing showed that their genes were mainly derived from TRIG lineage. Equine influenza H3N8 has a phylogeneticaly distinct relation with swine influenza and human influenza.86 There is only one report in which equine influenza cases were caused by a virus that was not an equine lineage. The influenza strain A/Equi ne/Jilin/1/89 (H3N8) caused an outbreak on March 1989 in China and genetic analysis of this strain revealed that four of the eight genes were directly rela ted with avian influenza.145 Since equine influenza and swine influenza has distinct relation phylogenetical y and no report associated swine influenza incidence with equine influenza in cidence at the same time, it is advisable to do further validation of this protocol against equine influenza. Canine influenza virus isolates which were used in this experiment had same subtype as equine influenza, H3N8. T he A/Canine/Florida/2004 was an example of interspecies transmission of influenza virus, where in this case was between horses and

PAGE 84

84 dogs.86 This transmission could occur as a re sult of close contact between infected horses with dogs.88 Thus we would expect to see t he equine and canine isolates typing similarly in this scheme. However, we have different results for M, HA, and NA genes. The canine influenza isolates aligned by this protocol as a Eurasian lineage while equine influenza isolates aligned with TR IG/human seasonal lineages for those three genes. Future work for validation of this protocol includes testing more isolates from more species and this should be expanded to inclu de all of the eight genes like the original protocol of Mak. Utilization of one portion of the protocol did not allow us to detect a typing scheme that was discriminatory for avi an, canine and horse influenza. Any of the isolates tested and used for validation of genetically based typing scheme MUST be completely sequenced. The lack of identity of some our isolates that were tested made interpretation very difficult. Phylogenetic tree analysis is critical and should be based on complete sequencing if accurate lineages are to be built from which to base a more inclusive genotyping scheme.

PAGE 85

85 Figure 5-1. Testing Algorithm for Genotyping Animal Influenza Isolates

PAGE 86

86 Table 5-1. Table List of Primer-Pr obe sets targeting for the Mak protocol Gene Primer & Probe Sequence (5 3) Matrix Forward Primer GGTCTCACAGACAGATGGCT Reverse Primer GATCCCAATGATATTTGCTGCAATG Probe FAM-ACCA AT CCAC TA AT CAG G-BHQ1 HA Forward Primer GAGCTCAGTGTCATCATTTGAA Reverse Primer TGCTGAGCTTTGGGTATGAA Probe FAM-CAA AGGT GTA ACG GCA-BHQ1 NA Forward Primer CATGCAATCAAAGCGTCATT Reverse Primer ACGGAAACCACTGACTGTCC Probe FAM-AG CAG CAA AG TTG GTG-BHQ1 PB2 Forward Primer AACTTCTCCCCTTTGCTGCT Reverse Primer GATCTTCAGTCAATGCACCTG Probe TEXAS RED-AA CT GTA AGT CG TTTG GT-BHQ2 *The LNA bases are underlined Table 5-2. List of isolates tested in the Ma k protocol for typing and i dentification of triple reassortant Influenza viruses Species Code Number Isolate Name Source HA Titer Swine SW 1 A/Swine/Wiscons in/238/97 (H1N1) GPL 64 Swine SW 2 A/Swine/Italy /10659-1/2007 (H3N2) GPL 64 Swine SW 4 A/Swine/MO/ Richt/07 (H2N3) GPL 64 Avian AV 1 A/Duck/Alberta/35/1976/ (H1N1) GPL 64 Avian AV 4 A/Chukar/MN/14591-7/1998 (H5N2) GPL 64 Avian AV 5 A/TY/VA/4529/2002 (H7N2) GPL 64 Equine EQ 1 A/Equine/Ohio/1/2003 (H3N8) GPL 64 Equine EQ 2 A/Equine/PA/01/07 (H3N8) GPL 64 Equine EQ 3 A/Equine/Mongolia/1/2008 GPL 64 Human HU 1 A/Mexico/4108/2009 (H1N1) GPL 64 Human HU 2 A/Brisbane/ 59/2007 (H1N1) GPL 64 Human HU 4 A/Panama/2007/99 (H3N2) GPL 64 Canine CN 1 A/Canine/Iowa/13628/2005 GPL 64 Canine CN 2 A/Canine/Florida/2004 Crawford 64 Canine CN 3 A/Canine /ColoSp/09 Landolt 64

PAGE 87

87 Table 5-3. Melt Curve Results of Scr een Round 3 of the Mak Protocol for Swine and Human Influenza Gene (Mak) Ct Mean Tm SD Tm Diff Tm* A/Swine/Wisconsin/238/97 H1 N1Matrix 34.7169.273.81 3.59 HA 22.9276.340.10 -0.07 NA 36.6169.274.58 4.44 PB2 28.6375.770.17 -0.04 A/Swine/Italy/10659-1/2007 H3N2Ma trix 34.7570.132.96 2.74 HA 36.6063.312.77 2.60 NA 27.4367.416.51 6.37 PB2 28.9572.000.28 0.08 A/Swine/MO/Richt/07 H2N3Ma trix 34.9370.513.36 3.14 HA N 62.801.19 1.03 NA 35.9264.403.84 3.69 PB2 28.4275.362.63 2.42 A/Mexico/4108/2009 H1N1Matrix 15.8279.740.16 -0.06 HA 16.5476.710.19 0.02 NA 16.1274.970.07 -0.07 PB2 15.0977.220.13 -0.07 A/Brisbane/59/2007 H1N1Matrix 32.8471.380.58 0.36 HA 33.5068.617.60 7.43 NA 34.4472.541.71 1.56 PB2 27.2371.900.16 -0.05 A/Panama/2007/99 H3N2Matrix 33.3770.920.94 0.72 HA 33.1565.446.28 6.12 NA 32.8467.175.20 5.05 PB2 27.2071.940.23 0.02 A/Duck/Alberta/35/1976/ H1N1Ma trix 34.7671.651.01 0.79 HA 37.3564.164.81 4.64 NA 36.0864.383.99 3.84 PB2 23.0878.460.16 -0.05 *Diff Tm = (SD Tm sample) (SD Tm positive control)

PAGE 88

88 Table 5-4. Melt Curve Results of Screen Round 3 Mak Protocol fo r Avian, Canine and Equine Influenza Gene (Mak) Ct Mean Tm SD Tm Diff Tm* A/Duck/Alberta/35/1976/ H1N1Matr ix 34.76 71.65 1.01 0.79 HA 37.35 64.16 4.81 4.64 NA 36.08 64.38 3.99 3.84 PB2 23.08 78.46 0.16 -0.05 A/Chukar/MN/14951-7/1998 H5N2Matr ix 34.34 70.69 3.18 2.96 HA 37.04 64.61 5.10 4.94 NA 34.10 64.43 3.91 3.76 PB2 19.98 77.83 0.11 -0.10 A/TY/VA/4529/2002 H7N2Matrix 34.72 69.25 4.07 3.85 HA N 62.32 1.10 0.93 NA 34.88 66.08 4.77 4.62 PB2 28.81 72.06 0.37 0.16 A/Equine/Ohio/1/2003 H3N8Matr ix 33.34 69.76 3.08 2.87 HA N 62.18 0.42 0.25 NA 34.00 70.01 2.93 2.78 PB2 27.31 71.56 0.17 -0.03 A/Equine/PA/01/07 H3N8Matr ix 33.55 70.20 3.05 2.83 HA N 62.49 0.52 0.35 NA 36.71 67.13 4.94 4.79 PB2 27.38 71.83 0.27 0.06 A/Equine/Mongolia/1/2008 H3N8Matr ix 33.84 71.20 1.05 0.83 HA N 62.74 0.80 0.63 NA 34.25 70.45 2.75 2.60 PB2 27.33 71.94 0.18 -0.02 A/Canine/Iowa/13628/2005 H3N8Matrix 33.69 70.10 0.79 0.57 HA 37.96 63.59 2.36 2.20 NA 34.09 70.61 1.38 1.23 PB2 26.29 71.13 0.25 0.04 A/Canine/Florida/2004 H3N8Matrix 33.93 70.86 0.78 0.57 HA N 62.02 0.62 0.45 NA 34.08 70.92 0.46 0.32 PB2 26.16 71.42 0.24 0.03

PAGE 89

89 *Diff Tm = (SD Tm sample ) (SD Tm positive control) Table 5-4. Continued. Gene (Mak) Ct Mean Tm SD Tm Diff Tm* A/Canine/ColoSp/09 H3N8Matr ix 33.04 70.86 0.62 0.40 HA 34.16 64.95 5.00 4.83 NA 33.88 71.08 1.52 1.38 PB2 26.10 71.44 0.26 0.05 *Diff Tm = (SD Tm sample) (SD Tm positive control)

PAGE 90

90 Table 5-5. Interpretation of PCR Test us ing Mak protocol agains t Matrix, HA, NA, and PB2 genes Matrix HA NA PB2 One Step Two Step One Step Two Step One Step Two Step One Step Two Step Pandemic (H1N1) 2009 N P N P N P N P Swine Eurasian avianlike N P N N N P N N Swine triple reassortant N N N P N N N P Human seasonal H1 and H3 N N N N N N N N *P=Positive; N=Negative

PAGE 91

91 Table 5-6. Results of the first (I NFA CDC Protocol), second (probe based PCR Protocol), and third screening (SYBR protocol) P = positive; N = negative; TG = swine triple reassortant; HS = human seasonal H1 and H3; EA = swine Eurasian avian-like INFA CDC Matrix Mak HA Mak NA Mak PB2 Mak Virus Isolates 1 Step PRO BE SYBR INT PRO BE SYBR INT PRO BE SYBR INT PRO BE SYBR INT A/Swine/Wisconsin/238/97 (H1N1) P N N TG/HS N P TG N N TG/HS N P TG A/Swine/Italy/10659-1/2007 (H3N2) P N N TG/HS N N EA/HS N N TG/HS N P TG A/Swine/MO/Richt/07 (H2N3) P N N TG/HS N P TG N N TG/HS N N EA/HS A/Duck/Alberta/35/1976/ (H1N1) P N P EA N N EA/HS N N TG/HS N P TG A/Chukar/MN/14951-7/1998 (H5N2) P N N TG/HS N N EA/HS N N TG/HS N P TG A/TY/VA/4529/2002 (H7N2) P N N TG/HS N P TG N N TG/HS N P TG A/Equine/Ohio/1/2003 (H3N8) P N N TG/HS N P TG N N TG/HS N P TG A/Equine/PA/01/07 (H3N8) P N N TG/HS N P TG N N TG/HS N P TG A/Equine/Mongolia/1/2008 P N P EA N P TG N N TG/HS N P TG A/Mexico/4108/2009 (H1N1) P P P PAN P P PAN P P PAN P P PAN A/Brisbane/59/2007 (H1N1) P N P EA N N EA/HS N P EA N P TG A/Panama/2007/99 (H3N2) P N P EA N N EA/HS N N TG/HS N N EA/HS A/Canine/Iowa/13628/2005 P N P EA N N EA/HS N P EA N P TG A/Canine/Florida/2004 P N P EA N P TG N P EA N P TG A/Canine/ColoSp/09 P N P EA N N EA/HS N P EA N P TG

PAGE 92

92 Figure 5-2. Melting Curve of Canine Influenza

PAGE 93

93 CHAPTER 6 SURVEILLANCE OF SWINE INFLUENZA IN FLORIDA Background Swine influenza (SI) is an acute respirator y disease in pigs characterized by nasal discharge, coughing, sneezing, elevated rect al temperature, lethargy, dyspnea, and depression.58;146 This disease is caused by a virus from a family member of Orthomyxoviridae, and is categorized as infl uenza A. There are three subtypes of swine influenza which are predominantly found in pigs throughout the world (H1N1, H1N2, and H3N2).9;59;60;66;68;147 However, an H3N1 subtype has also been reported in Taiwan, the US, Korea and Italy. In April 2009, a new s wine H1N1 subtype (swine-like: swH1N1) of influenza virus (IV) was reported in a hum an by the Centers for Disease Control and Prevention (CDC).60;148-150 Within days after the repor t, thousands of similar cases emerged in Mexico associated with illness and fatalities.151 Thus far, these swH1N1 viruses hav e been detected throughout the world, yet actually appear to have lim ited divergences from the avian and human influenza A strains that reassorted wit h SIV A lineages solely of North American and Eurasian origin.60;62;67;68 However, evidence indicates that in swine these reassorted viruses are changing and developing lineages that are unique according to geography.9;60 An analysis of swine origin s equencing of influenza shows severe bias in sampling from intense swine production locales in the U.S. reflecting the need for vaccine development in these operations. Thus large areas of the Americas where swine are raised contribute little to our understanding of the evolution of SIV and t he phenomenon of reassortment in the field. The research seeks to study the epidemiology of SIV on Florida farms in order to make industry changes that benefit the producer.

PAGE 94

94 Although Florida is celebrated fo r its leisure activities, most of this state is actually dependent upon agriculture. Also, this part of North America represents a model for the majority of swine management operations worl dwide in terms of nu mbers of operations vs. pounds of pork. The swine herds in Florida consist of small individual producers that provide a model of sustenance farm of local pastoral and rural economies. Understanding the health of swine in t hese operations has wo rldwide applicability because of limited veterinary intervention, cont act of swine with multiple people, comingling events at sales and slaughter, and c ontact of these swi ne with the natural environment.152 A primary limitation for building of predictive genetic models of SIV reassortment is lack of SIV genome data from multiple geographic sites .153 This limitation is an impediment to gathering essential data for risk factor analyses of swine (management conditions, breeding and swine geneti cs, infection control, exposure to other Influenza viruses) that translates in to evidence-based mitigation efforts. These small, multiple sites offer an opportunity to collect samples from different sources. Regionally based diagnostic testing and surv eillance are essential components for biosecurity, outbreak detection and containment.115 While there are immense organizational support systems in place with the United States Department of Agriculture (USDA), the Food and Agricultur e Organization of the United Nations, (FAO), and Office Internati onal des Epizooties (OIE), and the regional centers of excellence, there exists limited respons e network for collection, screening, and identification of TRIG in swine that are not part of the production industry. Logically, it is these types of studies that provide the ri ch ecological information to study viral evolution. Thus, regional res earch institutions offer an opportunity to contribute genomic

PAGE 95

95 information to with these organizations in t heir quest to assess the global occurrence and implications of TRIG in SIV. While t he central US has large production housing units, Florida and Caribbean has diverse populations of swine including some containment production farms, but the majori ty consists of transitional and small operations with two to three la rge containment facilities. Swine consist of domestic, exotic, and feral swine population. In addition there are three large slaughter plants in Florida that commingle swine from the sout heast, processing 1,000s of hogs at a time that are commingled from severa l farms throughout the Southeast. The objective of this work is to determi ne the prevalence of nasal shedding of SIV in Florida swine. The scope of this parti cular chapter was to perform an initial convenience sampling of various groups of healthy swine in North Florida that are undergoing co-mingling events as would occur in a local 4-H county show, a typical small to moderate small sized Florida swi ne farm operation, and a production facility. Materials and Methods Sampling Strategy Sampling commenced in the Fall of 2010 and continued through June of 2011 in order to obtain samples during the Florida influenza season from three main sources. The first was the University of Florida (UF) slaughter facility where sampling was conducted under IACUC #201004142 on swine imm ediately after slaughter. Swine weighed 110 to 150 kg and 9 to 12 months of age. All swine except one slaughter group were from the UF swine farm in Gainesv ille, Florida. The m anagement and housing of this farm is typical of Florida small to moderate size swine operat ions where swine are managed in open air housing facilities. Second, the Swine board of the Marion County Fair granted permission to sample swine during weigh-in and backfat upon facility

PAGE 96

96 entrance and these swine were sampl ed under IACUC #201004142. Swine were placed in small pen and nasal sampling of the swine was performed. These swine weighed110 to 120 kg and swine were owned by individual owners having been provided by one producer for this county thr ee months prior to the fair. Swine were approximately 9 to 10 months of age. The third group of swi ne were sampled at the UF quarantine facility for swine uti lized for medical training purposes. The facility provides groups of 50 kg swine weekly to medical tr aining programs in Cent ral Florida. These swine are shipped via truck from a high cont ainment facility in Tampa to Gainesville. Sampling of these swine was per formed 48 hours after the swine arrived. For this initial sampling, we estimated that we could obtain 400-500 samples: 250 fair swine, 100 small farm swine, and 100 production swine. Na sal swabs of swine were collected from slaughter house, swine shows, and Animal Care Service. All samples were collected using nasal swabs and transported in viral tr ansport media. Upon arrival to the lab, the samples were extracted immediately. PCR Protocol In order to prepare the RNA samples from isolates, approximately 50 L of total RNA was extracted using kit extraction met hod (RNeasy Mini Kit, Qiagen, Valencia, CA) from 100 L of sample according to the pr otocol provided by m anufacturer. A TaqMan Fast Virus 1-Step RT-PCR Master Mix (Appli ed Biosystems, Foster City, CA) was used with a 20 L reaction volume targeting matrix gene of influenza virus. Two different protocols were used for detection. Optimiza tion for the primers and probe dilutions used in this protocol were performed as descri bed in Chapter 3. T he same assays developed by Centers for Disease Control and Prevention 97 and researchers at Kansas State University and the National Veterinary Servic es Laboratory were us ed that detect the

PAGE 97

97 Matrix gene. For the CDC prot ocol (INFA CDC), the reaction mix consisted of 5 L of master mix, 400 nM forwar d primer, 400 nM reverse pr imer, 175 nM probe, 2 L RNA template and RNAse-free water ad 20 L. For the Richt protocol (INFA Richt) reaction mix of INFA Richt contained 5 L of mast er mix, 500 nM forw ard primer, 500 nM reverse primer, 175 nM probe, 2 L RNA template and RNA se-free water ad 20 L. The real-time RT-PCR assay was performed on 7500 Fast Real-time PCR System (Applied Biosystems, Foster City, CA) using t hermo cycling condition as follows: 50oC for 5 minutes, 95oC for 20 seconds, then 40 cycles of 95oC for 3 seconds and 60oC for 30 seconds. Testing with these primers and probe was performed simultaneously. An internal control was performed on all sa mples to detect the G3PDH gene of swine.154 The primers and probe sequences ar e provided in Table 6-1. Results A total of 526 swine were tested and the results shown in Table 6-2 demonstrate that no swine influenza was detected in heal thy swine. At the Marion County show, approximately 300 swine were presented for weigh-in and 203 swine were tested. According to the collected sample number, if the prevalence of swine influenza was 0.9%, we have 95% confidence that the swine influenza at the Marion County show would have been detected using the number of samples (203) we collected.155 Samples were collected from the UF swi ne slaughter facility fr om September 2010 to November 2011 (Table 6.2). There were approximately 292 swine during that period, and 243 samples were collected. If the prevalence of swine influenza was 0.6%, we have 95% confidence that the swine influenza in the UF swine slaughter facility would have been detected using the number of samples (243) we collected.155

PAGE 98

98 Samples were collected from the UF An imal Care facility from April 2011 to November 2011. During that period, 80 sample s were collected from 123 swine at that facility. Therefore, if the pr evalence of swine influenza was 2.1%, we have 95% confidence that the swine influenza in the UF Animal Care facility would have been detected using the number of samples (80) we collected.155 Irrespective of the location we tested, we are 95% confident that if the prevalence of swine influenza was 0.4%, then the swine infl uenza disease would have been detected using the number of animals which we tested.155 Discussion The goal of this work was to perform a sm all survey in healthy swine to determine the carriage rate of swine influenza in fa cilities that have a high degree of human contact. The UF Swine Farm is accessed by several researchers and students in addition to basic swine personnel. Marion County Fair has one of the large swine shows. Finally, we had the opportunity to sample swine from one of three large high production units in Florida, after shipping. These swine come into contact with medical students which may come into contact wit h another high risk group, hospitalized patients. In this small convenience sampling of healthy swine, we did not detect any influenza A. This is not surprising given t he fact that these swine were in general, healthy, although we did see some swine wit h nasal discharge. Also a minimal number of swine presented at the swine show exhibi ted some nasal deformity consistent with rhinitis. There is limited data on t he nasal shedding rate of influenza A and H1N1 as detected by PCR in North American swine. Li terature searches performed as of June

PAGE 99

99 2011 from 2009 to 2010 search years demonstr ate less than 20 publications which specifically survey influenza shedding in nasal secretions by PCR worldwide. Most of these studies were performed in Canada, Japan, and a few in Europe. The use of serology to retrospectively assess exposure of swine to H1N1 demonstrates that once in a herd, most of the herd seroconverts to the H1N1 subtype. This is not surprising since influenza in swine is a ubiquitous organism and most swine are exposed to influenza by nursery age.111 In addition farrowing sows are likely reservoirs for recirculation of most swine respiratory viruses.71;110 In finishing swine, serology only indicates retrospective exposure to field or vaccine strains; this does not indicate the actual infection status or risk that a pig poses for pi g-human transmission. Current studies published in Canada indicate the human-pig transmission can occur.112 We collected 406 swine nasal swabs from Marion County swine show, UF swine slaughter facility, and UF Animal Care fac ility, and none of the samples were positive. We are 95% confident that if t he prevalence of swine influenza was 0.4%, then SIV would have been detected during the collection period.155 This prevalence, with 95% confidence is actually lower than the FAO gui delines for surveillance of influenza in swine populations.57 And also, swine influenza surveillance conducted at Minnesota State Fair and South Dakota State Fair on 2009 showed prevalence of swine influenza disease in swine were 19.3% and 2.2% respectively.113;114 Influenza A infection in swine usually occurs most often in nursery pigs in which they develop fever, sneezing, nasal discharge and diarrhea. Shedding after experimental infection is rapid, within 1-3 days, and swine become seropositive within one week post-infection. The human swH1N1 of 2009 demonstrates the same general

PAGE 100

100 course of infection, except that even in nursery pigs, it is fairly mild. In the studies in Manitoba, Canada wherein, H1N1 was detected in swine herd s, surveillance testing in swine herds with a history of influenza lik e disease demonstrated no shedding of H1N1 when tested 10-20 days after clinical signs began.71 Pigs appear to cease excretion from influenza and H1N1 within 5-6 days post-infe ction. Interestingly, in a study where oral fluids were tested for sampling effi cacy compared to nasal swabs, PCR was more sensitive than viral isolation for detection of influenza A.72 In this study, 382/910 (41.9%) of clinical swine were detected as positive by oral sampling. In this technique, groups of swine were allowed to chew on a rope for 20-30 minutes or the buccal mucosa is swabbed in individual swine.72 Further studies regarding the status of Florida swine herds should focus on swine from all age groups. In particular, a sampling strategy must include some type of crosssection of nursery swine. In addition, sa mpling of sick swine and pen mates would be ideal. Continued testing of co -mingling events is also import ant for the industry. First, demonstration that Florida swine arrive at fair grounds and slaughter facilities free of virus is important. Second, longitudinal te sting would determine whether or not swine have an increased chance of swine influenza infe ction after the stress of shipping and new housing. This small study will be utilized to demonstr ate in the form of white papers through the Florida swine indust ry that testing of swine in high contact with humans is actually of benefit to the industry. The housing of swine in Florida is conducive to respiratory health and the smaller operations likely have less am plification within the herds. Through our continued efforts working with show managers, swine boards and producers we expect

PAGE 101

101 to sample the Florida State Fair, most county fairs in North Florida, and nursery swine at the large swine production farms in Florida during the 2011-2012 years.

PAGE 102

102 Table 6-1. Primer and probe sequences for detection of swine influenza from nasal swabs Forward (5-3) Reverse (5-3) Probe (5-3) CDC Protocol GACCRATCCTGTCAC CTCTGAC AGGGCATTYTGGACAAA KCGTCTA FAMTGCAGTCCTCGCTCAC TGGGCACGBHQ Richt Protocol AGATGAGTCYTCTAAC CGAGGTCG TGCAAARACAYYTTCMA GTCTCT FAMTCAGGCCCCCTCAAA GCCGA-BHQ-1 G3PDH gene TCAACGGATTTGGCC GTATTGG TGAAGGGGTCATTGATG GCG TAMRACAGGGCTGCTTTTAAC TCTGGCAAAGTGGABHQ-2 Table 6-2. Results of convenience sampli ng to detect influenza in Florida swine INFA CDC Primer INFA Richt Primer Sample Source Positive Negative Positive Negative Marion County Swine Show 0 203 0 203 UF Animal Science (Slaughter House) 0 243 0 243 UF Animal Care Facility 0 80 0 80 Total 0 526 0 526

PAGE 103

103 LIST OF REFERENCES 1. Mak PW, Wong CK, Li OT et al. Rapi d genotyping of swine influenza viruses, Emerg.Infect.Dis. 2011;17: 691-694 2. Krug RM, Lamb RA.Ort homyxoviridae: The Viruses and Their Replication. In: Knipe DM and Howley PM eds. Fundamental Virology. 4 ed. Philadelphia: Lippincott Williams & Wilkins, 2001;725-769. 3. Palese P, Shaw ML.Orthomyxoviri dae:The Viruses and Their Replication. In: Knipe DM and Howley PM eds. Fields Virology. 5 ed. Philadelphia: Lippincott Williams & Wilkin s, 2007;1648-1689. 4. Webster RG, Peiris M, Chen H et al. H5N1 outbreaks and enzootic influenza, Emerg.Infect.Dis. 2006;12: 3-8 5. Spackman E.A Brief Introduction to the Avian Influenza Virus. In: Spackman E ed. Avian Influenza Virus. Totowa: Humana Press, 2008;1-6. 6. Wright PF, Neumann G, Kawaoka Y .Orthomyxoviruses. In: Knipe DM and Howley PM eds. Fields Virology. 5 ed. Philadelphia: Wolters Kluwer, Lippincot Williams & Wilkin s, 2007;1692-1740. 7. Webby RJ, Webster RG, Richt JA Influenza viruses in animal wildlife populations, Curr.Top.Microbiol.Immunol. 2007;315: 67-83 8. Wilschut JC, McElhaney JE, Palache AM Influenza Philadelphia: Elsevier, 2006. 9. Ma W, Vincent AL, Lager KM et al. I dentification and characterization of a highly virulent triple reassortant H1N1 swi ne influenza virus in the United States, Virus Genes 2010;40: 28-36 10. Webster RG, Bean WJ, Gorman OT et al. Evolution and ecology of influenza A viruses, Microbiol.Rev. 1992;56: 152-179 11. Weis W, Brown JH, Cusack S et al. Structure of the influenza virus haemagglutinin complexed with it s receptor, sialic acid, Nature 1988;333: 426431 12. Ito T, Couceiro JN, Kelm S et al. Molecular basis for the generation in pigs of influenza A viruses with pandemic potential, J.Virol. 1998;72: 7367-7373 13. CDC. How Flu Spreads. 2011. Available at: www.cdc.gov/flu/about/disease/spread.htm Accessed Jul 29, 2011. 14. CDC. Flu Symptoms and Severity. 2011. Available at: www.cdc.gov/flu/about/d isease/symptoms.htm Accessed Jul 29, 2011.

PAGE 104

104 15. CDC. The Flu Season. 2011. Available at: www.cdc.gov/flu/about/season/fluseason.htm Accessed Jul 29, 2011. 16. CDC. Estimating Seasonal InfluenzaAssociated Deaths in the United States: CDC Study Confirms Variability of Flu. 2011. Available at: www.cdc.gov/flu/about/disease/us_flu-related_deaths.htm Accessed Jul 29, 2011. 17. Fangerau H. [Paleopat hology and the history of medicine: the example of influenza pandemics], Urologe A 2010;49: 1406-1410 18. Matsumoto K. [History of pandemic influenza in Japan], Nippon Rinsho 2010;68: 1595-1601 19. Jimenez-Clavero MA. [Influenza, flu, "Spanish flu", "swine flu" and other controversies in the naming of viruses: the "politically incorrect" side of virology], Enferm.Infecc.Microbiol.Clin. 2010;28: 662-663 20. Rosner D. "Spanish flu, or whatever it is...": The paradox of public health in a time of crisis, Public Health Rep. 2010;125 Suppl 3: 38-47 21. Azizi MH, Raees Jalali GA, Azizi F. A history of the 1918 Spanish influenza pandemic and its impact on Iran, Arch.Iran Med. 2010;13: 262-265 22. Erkoreka A. The Spanish influenza pandemic in occidental Europe (1918-1920) and victim age, Influenza.Other Respi.Viruses. 2010;4: 81-89 23. Zhang S, Yan P, Winchester B et al. Transmissibility of the 1918 pandemic influenza in Montreal and Winnipeg of Canada, Influenza.Other Respi.Viruses. 2010;4: 27-31 24. Shimao T. [Spanish flu related data], Kekkaku 2009;84: 685-689 25. Szocs K. [History of the Span ish flu: atropa belladonna and quarantine], Orv.Hetil. 2009;150: 1043-1047 26. Juozapaitis M, Antoniukas L. [Influenza virus], Medicina (Kaunas.) 2007;43: 919929 27. Hsieh YC, Wu TZ, Liu DP et al. Influenza pandemics: past, present and future, J.Formos.Med.Assoc. 2006;105: 1-6 28. Reid AH, Fanning TG, Janczewski TA et al. Novel origin of the 1918 pandemic influenza virus nucleoprotein gene, J.Virol. 2004;78: 12462-12470 29. Reid AH, Taubenberger JK, Fanning TG. Evidence of an absence: the genetic origins of the 1918 pandemic influenza virus, Nat.Rev.Microbiol. 2004;2: 909-914

PAGE 105

105 30. Johnson NP, Mueller J. Updating the accounts: global mortality of the 1918-1920 "Spanish" influenza pandemic, Bull.Hist Med. 2002;76: 105-115 31. Du N, Yang XX, Yang L et al. [R eview on the etiological property of 1957 Asian flu virus (H2N2)], Bing.Du Xue.Bao. 2009;25 Suppl: 12-16 32. Rajagopal S, Treanor J. Pandemic (avian) influenza, Semin.Respir.Crit Care Med. 2007;28: 159-170 33. Webster RG, Sharp GB, Claas EC. Interspecies transmission of influenza viruses, Am.J.Respir.Crit Care Med. 1995;152: S25-S30 34. Kawaoka Y, Krauss S, Webster R G. Avian-to-human tran smission of the PB1 gene of influenza A viruses in the 1957 and 1968 pandemics, J.Virol. 1989;63: 4603-4608 35. Scholtissek C, Rohde W, Von H, V et al. On the origin of the human influenza virus subtypes H2N2 and H3N2, Virology 1978;87: 13-20 36. Kilbourne ED. Influenza pandem ics of the 20th century, Emerg.Infect.Dis. 2006;12: 9-14 37. Nakajima K, Desselberger U, Pale se P. Recent human influenza A (H1N1) viruses are closely related genetica lly to strains isolated in 1950, Nature 1978;274: 334-339 38. Gregg MB, Hinman AR, Craven RB. The Russian flu. Its history and implications for this year's influenza season, JAMA 1978;240: 2260-2263 39. Loeffelholz MJ. Avian influenza A H5N1 virus, Clin.Lab Med. 2010;30: 1-20 40. Lahariya C, Sharma AK, Pradhan SK. Avian flu and possible human pandemic, Indian Pediatr. 2006;43: 317-325 41. Kruy SL, Buisson Y, Buchy P. [Asia: avian influenza H5N1], Bull.Soc.Pathol.Exot. 2008;101: 238-242 42. Koh G, Wong T, Cheong S et al. Avian In fluenza: a global threat needing a global solution, Asia Pac.Fam.Med. 2008;7: 5 43. Landman WJ, Schrier CC. [Avian influenza: eradication from commercial poultry is still not in sight], Tijdschr.Diergeneeskd. 2004;129: 782-796 44. Basuno E, Yusdja Y, Ilham N. Socio-economic impacts of avian influenza outbreaks on small-scale producers in Indonesia, Transbound.Emerg.Dis. 2010;57: 7-10

PAGE 106

106 45. WHO. Cumulative Number of Co nfirmed Human Cases of Avian Influenza A/(H5N1) Reported to WH O. 2011. Available at: www.who.int/csr/disease/avian_influenza/ country/cases_table_2011_05_13/en/in dex.html Accessed May 25, 2011. 46. Anhlan D, Grundmann N, Makalowski W et al. Origin of the 1918 pandemic H1N1 influenza A virus as studied by codon usage patterns and phylogenetic analysis, RNA. 2011;17: 64-73 47. Garten RJ, Davis CT, Russell CA et al. Antigenic and genetic characteristics of swine-origin 2009 A(H1N1) influenza viruses circulating in humans, Science 2009;325: 197-201 48. Taubenberger JK, Reid AH, Krafft AE et al. Initial genetic characterization of the 1918 "Spanish" influenza virus, Science 1997;275: 1793-1796 49. Dawood FS, Jain S, Finelli L et al. Em ergence of a novel swine-origin influenza A (H1N1) virus in humans, N.Engl.J.Med. 2009;360: 2605-2615 50. Peiris JS, Poon LL, Guan Y. Emergence of a novel swine-origin influenza A virus (S-OIV) H1N1 virus in humans, J.Clin.Virol. 2009;45: 169-173 51. Ma W, Oberst R, Li X et al. R apid detection of the pandemic 2009 H1N1 virus M gene by real-time and gel-based RT-PCR assays, Influenza.Other Respi.Viruses. 2010;4: 397-403 52. Lange E, Kalthoff D, Blohm U et al. Pathogenesis and transmi ssion of the novel swine-origin influenza virus A/H1N1 a fter experimental infection of pigs, J.Gen.Virol. 2009;90: 2119-2123 53. Dawood FS, Jain S, Finelli L et al. Em ergence of a novel swine-origin influenza A (H1N1) virus in humans, N.Engl.J.Med. 2009;360: 2605-2615 54. Smith GJ, Vijaykrishna D, Bahl J et al. Origins and evolutionary genomics of the 2009 swine-origin H1N1 influenza A epidemic, Nature 2009;459: 1122-1125 55. WHO. H1N1 in post-pandemic period. 2011. Available at: www.who.int/mediacentre/news/stat ements/2010/h1n1_vpc_20100810/en/index. html Acessed May 25, 2011. 56. WHO. Pandemic (H1N1) 2009 update 112. 2010. Available at: www.who.int/csr/don/2010_0 8_06/en/index.html Accessed May 25, 2011. 57. FAO FAO Guidelines for Surveillance of Pandemic H1N1 /2009 and Other Influenza Viruses in Swine Populations Rome: Food and Agriculture Organization of the United Nations, 2010.

PAGE 107

107 58. OIE. Swine Influenza. OIE Terrest rial Manual 2009. 2010. Available at: www.oie.int/fileadmin/Home/eng/Healt h_standards/tahm/2.08.08_SWINE_INFLU ENZA.pdf Accessed Jul 5, 2011. 59. Lekcharoensuk P, Lager KM, Vemulapal li R et al. Novel swine influenza virus subtype H3N1, United States, Emerg.Infect.Dis. 2006;12: 787-794 60. Vincent AL, Ma W, Lager KM et al Characterization of a newly emerged genetic cluster of H1N1 and H1N2 swine influenza virus in the United States, Virus Genes 2009; 61. Karasin AI, Landgraf J, Swenson S et al. Genetic characterization of H1N2 influenza A viruses isolated from pi gs throughout the United States, J.Clin.Microbiol. 2002;40: 1073-1079 62. Ma W, Kahn RE, Richt JA. The pig as a mixing vessel for influenza viruses: Human and veterinary implications, J.Mol.Genet.Med. 2008;3: 158-166 63. Webby RJ, Rossow K, Erickson G et al. Multiple lineages of antigenically and genetically diverse influenza A virus co-c irculate in the United States swine population, Virus Res. 2004;103: 67-73 64. Zhou NN, Senne DA, Landgraf JS et al. Genetic reassortment of avian, swine, and human influenza A viruses in American pigs, J.Virol. 1999;73: 8851-8856 65. Zhou NN, Senne DA, Landgraf JS et al. Emergence of H3N2 reassortant influenza A viruses in North American pigs, Vet.Microbiol. 2000;74: 47-58 66. Ma W, Lager KM, Vincent AL et al. T he Role of Swine in t he Generation of Novel Influenza Viruses, Zoonoses.Public Health 2009; 67. Vincent AL, Ma W, Lager KM et al. Swine influenza viruses a North American perspective, Adv.Virus Res. 2008;72: 127-154 68. Ma W, Vincent AL, Gramer MR et al Identification of H2N3 influenza A viruses from swine in the United States, Proc.Natl.Acad.Sci.U.S.A 2007;104: 2094920954 69. Olsen CW, Carey S, Hinshaw L et al. Virologic and serologic surveillance for human, swine and avian influenza virus in fections among pigs in the northcentral United States, Arch.Virol. 2000;145: 1399-1419 70. FAO. Influenza A H1N1 Guidance. 2010. Available at: www.fao.org/ag/againfo/programmes/ en/empres/AH1N1/Guidance.html Accessed Oct 2, 2011. 71. Pereda A, Cappuccio J, Quiroga MA et al. Pandemic (H1N1) 2009 outbreak on pig farm, Argentina, Emerg.Infect.Dis. 2010;16: 304-307

PAGE 108

108 72. Detmer SE, Patnayak DP, Jiang Y et al Detection of Influenza A virus in porcine oral fluid samples, J.Vet.Diagn.Invest 2011;23: 241-247 73. Xu X, Subbarao, Cox NJ et al. Genetic characteri zation of the pathogenic influenza A/Goose/Guangdong/1/96 (H5N1) viru s: similarity of its hemagglutinin gene to those of H5N1 viruses fr om the 1997 outbrea ks in Hong Kong, Virology 1999;261: 15-19 74. Capua I, Alexander DJ. Avian influenza and human health, Acta Trop. 2002;83: 1-6 75. Lam TT, Hon CC, Pybus OG et al. Evolutionary and transmission dynamics of reassortant H5N1 influenza virus in Indonesia, PLoS.Pathog. 2008;4: e1000130 76. FAO MC. FAO Calls for Sustained Action on H5N1 and Emerging Infections. 2010. Available at: www.fao.org/news/sto ry/en/item/41276/icode/ Accessed Jul 27, 2011. 77. Spackman E. A brief introducti on to the avian influenza virus, Methods Mol.Biol. 2008;436: 1-6 78. Martin V, Forman A, Lubroth J. Pr eparing for Highly Pathogenic Avian Influenza. 3. 2009. Rome, Food And Agriculture Or ganization Of The United Nations. FAO Animal Production and Health Manual 7-27-2011. Serial (Book,Monograph) 79. OIE. Avian Influenza. OIE Terre strial Manual 2009 2009. Available at: www.oie.int/fileadmin/Home/eng/Heal th_standards/tahm/2.03.04_AI.pdf Accesed Jul 27, 2011. 80. Murphy F, Gibbs P, Horzinek M et al. Veterinary Virology 3 ed. San Diego: Academic Press, 1999. 81. Sovinova O, Tumova B, Pouska F et al Isolation of a virus causing respiratory disease in horses, Acta Virol. 1958;2: 52-61 82. Daly JM, Newton JR, Mumford JA. Current perspectives on control of equine influenza, Vet.Res. 2004;35: 411-423 83. Waddell GH, Teigland MB, Sigel MM. A new influenza virus associated with equine respiratory disease, J.Am.Vet.Med.Assoc. 1963;143: 587-590 84. Myers C, Wilson WD Equine Influenza Virus, Clinical Techniques in Equine Practice 2006;5: 187-196 85. Daly JM, Macrae S, Newton JR et al. Equine influenza: A review of an unpredictable virus, Vet.J. 2011;189: 7-14

PAGE 109

109 86. Crawford PC, Dubovi EJ, Castleman WL et al. Transmission of equine influenza virus to dogs, Science 2005;310: 482-485 87. Yoon KJ, Cooper VL, Schwartz KJ et al. Influenza virus infection in racing greyhounds, Emerg.Infect.Dis. 2005;11: 1974-1976 88. Yamanaka T, Nemoto M, Tsujimura K et al. Interspecies transmission of equine influenza virus (H3N8) to dogs by clos e contact with experimentally infected horses, Vet.Microbiol. 2009;139: 351-355 89. Jirjis FF, Deshpande MS, Tubbs AL et al. Transmission of canine influenza virus (H3N8) among susceptible dogs, Vet.Microbiol. 2010;144: 303-309 90. Lee C, Song D, Kang B et al. A serological survey of avian origin canine H3N2 influenza virus in dogs in Korea, Vet.Microbiol. 2009;137: 359-362 91. Song D, Lee C, Kang B et al. Experim ental infection of dogs with avian-origin canine influenza A virus (H3N2), Emerg.Infect.Dis. 2009;15: 56-58 92. Song D, Kang B, Lee C et al. Transmi ssion of avian influenza virus (H3N2) to dogs, Emerg.Infect.Dis. 2008;14: 741-746 93. WHO. WHO Recommendations On The Use of Rapid Testing for Influenza Diagnosis. 2005. Available at: www.who.int/csr/disease/avian_infl uenza/guidelines/rapid_testing/en/ Accessed Jun 21, 2005. 94. Swenson SL, Vincent LL, Lute BM et al. A comparison of diagnostic assays for the detection of type A swine influenza virus from nasal swabs and lungs, J.Vet.Diagn.Invest 2001;13: 36-42 95. Eichelberger M, Golding H, Hess M et al. FDA/NIH/WHO public workshop on immune correlates of protection against influenza A viruses in support of pandemic vaccine development, Bethesda, Maryland, US, December 10-11, 2007, Vaccine 2008;26: 4299-4303 96. WHO. WHO Information for Laborat ory Diagnosis of Pandemic (H1N1) 2009 Virus in Humans-Revised. 2009. Available at: www.who.int/csr/resources/ publications/swineflu/WHO_Diagnostic_Recommend ationsH1N1_20090521.pdf Accessed May 30, 2011. 97. CDC. CDC protocol of realtime RT PCR for swine influenza A (H1N1). 2009. World Health Organization. Available at: www.who.int/csr/resources/publications/s wineflu/CDCrealtimeRTPCRprotocol_2 0090428.pdf Accessed May 25, 2011.

PAGE 110

110 98. Shu B, Wu KH, Emery S et al. Design and Performance of the CDC Real-Time Reverse Transcriptase PCR Swine Flu P anel for Detection of 2009 A (H1N1) Pandemic Influenza Virus, J.Clin.Microbiol. 2011;49: 2614-2619 99. NIAID. Antigenic Sh ift. 2011. Available at: www.niaid.nih.gov/topics/flu/research/bas ic/pages/antigenicshiftillustration.aspx Accessed Jun 13, 2011. 100. Scholtissek C, Burger H, Kistner O et al. The nucleoprotein as a possible major factor in determining host specific ity of influenza H3N2 viruses, Virology 1985;147: 287-294 101. Ma W, Lager KM, Lekcharoensuk P et al. Viral reassortment and transmission after co-infection of pigs with classica l H1N1 and triple-reassortant H3N2 swine influenza viruses, J.Gen.Virol. 2010;91: 2314-2321 102. Eppendorf AG. Features of Mastercycl er ep Realplex, Real-T ime Thermal Cycler. 2011. Available at: www.eppendorfna.com/int/index.php?l=1 31&sitemap=2.3&pb=8dbcd71b5502789 e&action=products&contentid=1&c atalognode=22330&productpage=2# Accessed Jun 20, 2011. 103. Applied Biosystems. Real-Time PCR Systems : Chemistry Guide. 2006. Available at: www3.appliedbiosystems.co m/cms/groups/mcb_support/ documents/generaldocu ments/cms_042681.pdf Accessed Jun 22, 2011. 104. Agilent Technologies. Introduction to Quantitative PCR. 2010. Available at: www.chem.agilent.com/Library/brochur es/Brochure_Guide%20to%20QPCR_IN7 0200C.pdf Accessed Jun 22, 2011. 105. Carr MJ, Gunson R, Maclean A et al. Development of a real -time RT-PCR for the detection of swine-lineage influenza A (H1N1) virus infections, J.Clin.Virol. 2009;45: 196-199 106. Mahony JB, Hatchette T, Ojkic D et al. Multiplex PCR tests sentinel the appearance of pandemic influenza viruses including H1N1 swine influenza, J.Clin.Virol. 2009;45: 200-202 107. Panning M, Eickmann M, Landt O et al. Detection of influenza A(H1N1)v virus by real-time RT-PCR, Euro.Surveill 2009;14: 108. Spackman E, Senne DA, Bulaga LL et al. Development of real-time RT-PCR for the detection of avian influenza virus, Avian Dis. 2003;47: 1079-1082 109. Spackman E, Senne DA, Bulaga LL et al Development of mult iplex real-time RTPCR as a diagnostic tool for avian influenza, Avian Dis. 2003;47: 1087-1090

PAGE 111

111 110. Sreta D, Tantawet S, Na Ayudhya SN et al. P andemic (H1N1) 2009 virus on commercial swine farm, Thailand, Emerg.Infect.Dis. 2010;16: 1587-1590 111. Sreta D, Kedkovid R, Tuamsang S et al. Pathogenesis of swine influenza virus (Thai isolates) in weanling pigs: an experimental trial, Virol.J. 2009;6: 34 112. Forgie SE, Keenliside J, Wilkinson C et al. Swine outbreak of pandemic influenza A virus on a Canadian research farm supports human-to-swine transmission, Clin.Infect.Dis. 2011;52: 10-18 113. Gray GC. Surveillance for Influenz a among Swine Populations. 2010. Slide 114. USDA. 2009 Pandemic H1N1 Influenz a Presumptive and Confirmed Results. 2010. Available at: www.usda.gov/documents/CHARTSAMPLES_FOR_CY2009_011910.pdf Accessed Aug 1, 2011. 115. Anonymous. National Laboratory Anim al Health Laboratory Network Classical Swine Influenza Testing. 2011. 111-2009. Internet Communication 116. Weis W, Brown JH, Cusack S et al. Structure of the influenza virus haemagglutinin complexed with it s receptor, sialic acid, Nature 1988;333: 426431 117. Weingartl HM, Albrecht RA, Lager KM et al. Experimental infection of pigs with the human 1918 pandemic influenza virus, J.Virol. 2009;83: 4287-4296 118. Loeffen WL, Hunneman WA, Quak J et al. Population dynamics of swine influenza virus in farrow-to-finish and specialised finishing herds in the Netherlands, Vet.Microbiol. 2009;137: 45-50 119. Van RK, Brown IH, Durrwald R et al Seroprevalence of H1N1, H3N2 and H1N2 influenza viruses in pigs in seven European countries in 2002-2003, Influenza.Other Respi.Viruses. 2008;2: 99-105 120. Vicente J, Leon-Vizcaino L, Gortazar C et al. Antibodies to selected viral and bacterial pathogens in European wild boars from southcentral Spain, J.Wildl.Dis. 2002;38: 649-652 121. Bryant NA, Rash AS, Woodward AL et al. Isolation and characterisation of equine influenza viruses (H3N8) from Europe and North America from 2008 to 2009, Vet.Microbiol. 2011;147: 19-27 122. Lu Z, Dubovi EJ, Zylich NC et al. Diag nostic application of H3N8-specific equine influenza real-time reverse transcription polymerase chain reaction assays for the detection of Canine influenza vi rus in clinical specimens, J.Vet.Diagn.Invest 2010;22: 942-945

PAGE 112

112 123. Vincent AL, Lager KM, Ma W et al. Evaluation of hemagglutin in subtype 1 swine influenza viruses from the United States, Vet.Microbiol. 2006;118: 212-222 124. Richt JA, Lager KM, Clouser DF et al. Real-time reverse transcriptionpolymerase chain reaction assays for the detection and differentiation of North American swine influenza viruses, J.Vet.Diagn.Invest 2004;16: 367-373 125. Deyde VM, Gubareva LV. Infl uenza genome analysis using pyrosequencing method: current applications for a moving target, Expert.Rev.Mol.Diagn. 2009;9: 493-509 126. Hoper D, Hoffmann B, Beer M. Si mple, sensitive, and swift sequencing of complete H5N1 avian influenza virus genomes, J.Clin.Microbiol. 2009;47: 674679 127. Applied Biosystems. Absolute Quant itation Using Standard Curve Getting Started Guide. 2010. Available at: www3.appliedbiosystems.co m/cms/groups/mcb_support/ documents/generaldocu ments/cms_041436.pdf Accesed Jul 14, 2011. 128. Wang R, Taubenberger JK. Methods fo r molecular surveillance of influenza, Expert.Rev.Anti.Infect.Ther. 2010;8: 517-527 129. Whiley DM, Bialasiewicz S, Bletchly C et al. Detection of novel influenza A(H1N1) virus by real-time RT-PCR, J.Clin.Virol. 2009;45: 203-204 130. Wang R, Sheng ZM, Taubenberger JK. De tection of novel (swine origin) H1N1 influenza A virus by quantitative real -time reverse transcription-PCR, J.Clin.Microbiol. 2009;47: 2675-2677 131. Poon LL, Chan KH, Smith GJ et al Molecular detection of a novel human influenza (H1N1) of pandemic potent ial by conventional and real-time quantitative RT-PCR assays, Clin.Chem. 2009;55: 1555-1558 132. Pol F, Queguiner S, Gorin S et al Validation of commerc ial real-time RT-PCR kits for detection of influenza A viruses in porcine samples and differentiation of pandemic (H1N1) 2009 virus in pigs, J.Virol.Methods 2011;171: 241-247 133. Panning M, Baumgarte S, Laue T et al. Singleplex r eal-time RT-PCR for detection of influenza A virus and simultaneous differentiation of A/H1N1v and evaluation of the RealStar influenza kit, J.Clin.Virol. 2011;50: 171-174 134. Lorusso A, Faaberg KS, Killian ML et al. One-step real-time RT-PCR for pandemic influenza A virus (H1N1) 2009 matr ix gene detection in swine samples, J.Virol.Methods 2010;164: 83-87

PAGE 113

113 135. Liu S, Hou G, Zhuang Q et al. A SYBR Green I real-time RT-PCR assay for detection and differentiation of influenza A( H1N1) virus in swine populations, J.Virol.Methods 2009;162: 184-187 136. LeBlanc JJ, Li Y, Bastien N et al Switching gears for an influenza pandemic: validation of a duplex reverse tran scriptase PCR assay for simultaneous detection and confirmatory identificat ion of pandemic (H1N1) 2009 influenza virus, J.Clin.Microbiol. 2009;47: 3805-3813 137. Jiang T, Kang X, Deng Y et al. Deve lopment of a real-time RT-PCR assay for a novel influenza A (H1N1) virus, J.Virol.Methods 2010;163: 470-473 138. He J, Bose ME, Beck ET et al. Rapi d multiplex reverse transcription-PCR typing of influenza A and B virus, and subtyping of in fluenza A virus into H1, 2, 3, 5, 7, 9, N1 (human), N1 (animal), N2, and N7, including typing of novel swine origin influenza A (H1N1) virus, during the 2009 outbreak in Milwaukee, Wisconsin, J.Clin.Microbiol. 2009;47: 2772-2778 139. Dong H, Zhang Y, Xiong H et al. Detection of human novel influenza A (H1N1) viruses using multi-fluore scent real-time RT-PCR, Virus Res. 2010;147: 85-90 140. Beck ET, Jurgens LA, Kehl SC et al. Development of a rapid automated influenza A, influenza B, and respiratory syncytia l virus A/B multiple x real-time RT-PCR assay and its use during the 2009 H1N1 swi ne-origin influenza virus epidemic in Milwaukee, Wisconsin, J.Mol.Diagn. 2010;12: 74-81 141. Applied Biosystems. Real-time PCR : Understanding Ct. 2011. Available at: www3.appliedbiosystems.com/cms/groups/m cb_marketing/documents/generaldo cuments/cms_053906.pdf Accessed Jun 22, 2011. 142. Jordan L, Kurtz R. Optical Design of CFX96 Real-Time PCR Detection System Eliminates the Requirement of a Passive Reference Dye. 2010. Available at: www.bio-rad.com/webroot/web/pdf/l sr/literature/ Bulletin_6047A.pdf Accessed Jun 22, 2011. 143. Poon LL, Mak PW, Li OT et al. R apid detection of reas sortment of pandemic H1N1/2009 influenza virus, Clin.Chem. 2010;56: 1340-1344 144. ATCC. Product, Viruses. 2011. Available at: www.influenzareagentresource.org/tabid/159 1/CollectionLinkID/605/Default.aspx Accessed Jul 15, 2011. 145. Webster RG, Guo YJ. Ne w influenza virus in horses, Nature 1991;351: 527 146. Ardans AA.Orthomyxoviri dae. In: Hirsch DC and Zee YC eds. Veterinary Microbiology. : Blackwell Science, 1999;396-402.

PAGE 114

114 147. Richt JA, Lager KM, Janke BH et al. Pathogenic and antigenic properties of phylogenetically distinct reassortant H3N2 swine influenza viruses cocirculating in the United States, J.Clin.Microbiol. 2003;41: 3198-3205 148. Chang LY, Shih SR, Shao PL et al. No vel swine-origin influenza virus A (H1N1): the first pandemic of the 21st century, J.Formos.Med.Assoc. 2009;108: 526-532 149. Cutler J, Schleihauf E, Hatchette TF et al. Investigation of the first cases of human-to-human infection with the new swin e-origin influenza A (H1N1) virus in Canada, CMAJ. 2009;181: 159-163 150. Smith GJ, Vijaykrishna D, Bahl J et al. Origins and evolutionary genomics of the 2009 swine-origin H1N1 influenza A epidemic, Nature 2009;459: 1122-1125 151. Anonymous. WHO Pandemic (H 1N1) 2009. 2011. 11-6-2009. Internet Communication 152. Anonymous. Current Pseudorabies Outbreak and Fiscal Impact. 2011. 7-252008. Internet Communication 153. Anonymous. Search Flu Database. 2009. 11-1-2009. Internet Communication 154. Peeters D, Peters IR, Farnir F et al. Real-time RT-PCR quantification of mRNA encoding cytokines and chemokines in histologically normal canine nasal, bronchial and pulmonary tissue, Vet.Immunol.Immunopathol. 2005;104: 195-204 155. de Blas N, Ortega C, Frankena K et al. Win Ep iscope 2. [2.0]. 2000. 2007. Available at: www.clive.ed.ac.uk/cliveCatalo gueItem.asp?id=B6BC9009-C10F4393-A22D-48F436516AC4 Accessed Sep 19, 2011. Computer Program

PAGE 115

115 BIOGRAPHICAL SKETCH Dhani Prakoso attended veterinary school at Airlangga University, Indonesia on 1997 and received a Doctor of Veterinary Medi cine degree in 2004. After finishing his DVM degree, he opened a small animal clinic with his colleagues. On 2005, he began to work for Indonesian government as a gov ernment employee. He was awarded with Fulbright fellowship from United States Department of States and admitted to the University of Florida for his masters study in 2009.