<%BANNER%>

Inorganic Polyphosphate Modulates the MglA/SspA Complex Interaction in Francisella tularensis

Permanent Link: http://ufdc.ufl.edu/UFE0043744/00001

Material Information

Title: Inorganic Polyphosphate Modulates the MglA/SspA Complex Interaction in Francisella tularensis
Physical Description: 1 online resource (2 p.)
Language: english
Creator: Wrench, Algevis P
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: francisella -- mgla-sspa -- polyphosphate -- quinacrine
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre: Microbiology and Cell Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The transcription factors MglA and SspA of the highly virulent bacterium Francisella tularensis form a heterodimer complex and interact with the RNA polymerase and other transcription factors. These protein-protein interactions regulate the expression of hundreds of genes that are essential for the pathogen's virulence and survival within host cells. In order to evade the host defense mechanisms, F. tularensis needs to sense signals from the environment and respond accordingly by differentially expressing the appropriate genes. However, limited information is available on the environmental cues that trigger the regulatory network mediated by MglA and SspA. In this study, a fluorescence-based screening assay comprising 1152 small molecules was used to uncover quinacrine hydrochloride as a thermal stabilizing compound of purified MglA and SspA proteins from F. tularensis SCHU S4. The effect of the small molecule was analyzed in vivo using a bacterial two-hybrid system. The results obtained showed that quinacrine modified the interaction between MglA and SspA. In addition, in F. tularensis subsp. novicida, quinacrine affected the intramacrophage survival capabilities via a decrease in the transcription of the Francisella pathogenicity island genes. Structure-guided site-directed mutagenesis experiments indicated that quinacrine makes contact with the amino acid residues tyrosine 63 of MglA and lysine 97 of SspA, both located in the "cleft region" of the interacting surface. It was determined that inorganic polyphosphate (polyP) functions as a biological effector molecule that stabilizes the interaction of the MglA and SspA complex. A biophysical characterization determined that polyP binds with high affinity (KD = 300 nM) to the MglA/SspA complex in the "cleft region" of the heterodimer. Moreover, the interactions between the MglA/SspA complex and the transcription factor FevR (PigR) were significantly impaired when the intracellular polyP concentrations were reduced as determined in the bridge and two-hybrid systems. Taken together, this study describes the identification and use of a chemical as a probe to understand the mechanisms involved in the interplay between intracellular ligands and transcriptional regulators. The molecular probe could be, in the future, further engineered for its use as therapeutics against Francisella infections.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Algevis P Wrench.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Lorca, Graciela Liliana.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043744:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043744/00001

Material Information

Title: Inorganic Polyphosphate Modulates the MglA/SspA Complex Interaction in Francisella tularensis
Physical Description: 1 online resource (2 p.)
Language: english
Creator: Wrench, Algevis P
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: francisella -- mgla-sspa -- polyphosphate -- quinacrine
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre: Microbiology and Cell Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The transcription factors MglA and SspA of the highly virulent bacterium Francisella tularensis form a heterodimer complex and interact with the RNA polymerase and other transcription factors. These protein-protein interactions regulate the expression of hundreds of genes that are essential for the pathogen's virulence and survival within host cells. In order to evade the host defense mechanisms, F. tularensis needs to sense signals from the environment and respond accordingly by differentially expressing the appropriate genes. However, limited information is available on the environmental cues that trigger the regulatory network mediated by MglA and SspA. In this study, a fluorescence-based screening assay comprising 1152 small molecules was used to uncover quinacrine hydrochloride as a thermal stabilizing compound of purified MglA and SspA proteins from F. tularensis SCHU S4. The effect of the small molecule was analyzed in vivo using a bacterial two-hybrid system. The results obtained showed that quinacrine modified the interaction between MglA and SspA. In addition, in F. tularensis subsp. novicida, quinacrine affected the intramacrophage survival capabilities via a decrease in the transcription of the Francisella pathogenicity island genes. Structure-guided site-directed mutagenesis experiments indicated that quinacrine makes contact with the amino acid residues tyrosine 63 of MglA and lysine 97 of SspA, both located in the "cleft region" of the interacting surface. It was determined that inorganic polyphosphate (polyP) functions as a biological effector molecule that stabilizes the interaction of the MglA and SspA complex. A biophysical characterization determined that polyP binds with high affinity (KD = 300 nM) to the MglA/SspA complex in the "cleft region" of the heterodimer. Moreover, the interactions between the MglA/SspA complex and the transcription factor FevR (PigR) were significantly impaired when the intracellular polyP concentrations were reduced as determined in the bridge and two-hybrid systems. Taken together, this study describes the identification and use of a chemical as a probe to understand the mechanisms involved in the interplay between intracellular ligands and transcriptional regulators. The molecular probe could be, in the future, further engineered for its use as therapeutics against Francisella infections.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Algevis P Wrench.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Lorca, Graciela Liliana.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043744:00001


This item has the following downloads:


Full Text

PAGE 2

EMD Chemicals, 10394 Pacific Center Court, San Diego, CA 92121 Date 9/27/2011 From Jason Fawcett Phone 858.450.5695 Fax 858.453.3552 E mail Jason.Fawcett@ merckgroup.com Page 1 of 1 Dear Dr. Wrench, I hereby give you permission to use the pCDF 1b vector map (catalogue # 71330) per your request We also request that in conjunction with the figure you include the following text : EMD Chemicals Inc., an Affiliate of Merck KGaA, Darmstadt, Germany. Reprinted with permission Please do not hesitate to contact me if you require additional information or help with the vector map in different file formats. Best regards, Jason Fawcett Senior Manager, Marketing EMD Millipore EMD Chemicals Inc. 10394 Pacific Center Ct. Sand Diego, CA. 92121



PAGE 1

1 INORGANIC POLYPHOSPHATE MODULATES T HE MGLA/SSPA COMPLEX INTERACTION IN Francisella tularensis By ALGEVIS PATRICIA WRENCH A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Algevis Patricia Wrench

PAGE 3

3 To my husband, James Wrench f or his unlimited love and patience. To my parents, Oscar Inciarte and Algevis Larreal, my sister, Andreina, and my brother Oscar for their endless encouragement and support

PAGE 4

4 ACKNOWLEDGMENTS I owe thanks to many people, whose assistance was indispensable in completing this project First, I wish to thank my advisor, Dr. Graciela Lorca for her guidance, caring, patience, and providing me with an excellent atmosphere for doing research. I appreciate all her contributions of time, ideas, and funding to make my Ph.D. experience productive and stimulating. I am thankful for the excellent example she has provided as a successful professor and woman in science. I also thank Dr. Claudio Gonzalez, I am deeply grateful for his in valuable insights and discussions that helped me understand details of my work and for giving me the opportunity to learn more about research as an undergraduate student. To my other committee members Dr. Val rie de Crcy Lagard, Dr. Peter Kima, and Dr. Paul Gulig, thank you for always taking time to meet with me and giving helpful feedback. Additionally, many thanks to Dr. Eric Triplet t, the faculty and staff of the Microbiology and Cell Science for their support and assistance. Much of the data generated in this thesis would not have been possible without the support and generous contribution of past and present members of the Lorca and Gonzalez lab, especially Chris Gardner for and the in dispensabl e time he spend doing all the biophysical experiments analyzing data and reading over the manuscript His help and suggestions have made a difference. I would like to express my appreciation for t he help of scientist Fernando Pagliai, Dr. Santosh Pande, Dr. Kin Kwan Lai ; grad uate student Ricardo Valladares; undergraduate student s Sara Siegel, Jonathan Pavlinec and Frank Sun; and lab technician Beverly Driver. I would like to acknowledge Dr. S imon Dove, (Harvard University) and Dr. Bryce Nickels (The State University of New Jersey) for the plasmids and strains used in the twohybrid system. Dr. John Gunn

PAGE 5

5 (The Ohio State University) for generously providing the F. novicida strains. Dr. Tara Wherl y (Rocky Mountain Labs/NIAID/NIH) for providing the F. tularensis SCHU S4 chromosomal DNA. Dr. Blaise Ndjame and Jonathan Canton for their assistance with the macrophage cell line. Lastly, I would like to thank my family for all their encouragement. I than k m y parents who have supported me in all my career pursuits and my husband for his understanding and love through the duration of these studies.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 9 LIST OF FIGURES ........................................................................................................ 10 LIST OF ABBREVIATIONS ........................................................................................... 12 ABSTRACT ................................................................................................................... 18 CHAPTER 1 INTRODUCTION .................................................................................................... 20 Francisella tularensis .............................................................................................. 20 History and Potential as a Biological Weapon .................................................. 21 Epidemiology .................................................................................................... 21 Intracellular Life Cycle ...................................................................................... 23 Vaccination against Tularemia ......................................................................... 24 Francisella Response to Host Defenses ........................................................... 25 Oxidative stress ......................................................................................... 25 Iron acquisition ........................................................................................... 27 The Francisella Pathogenicity Island ................................................................ 28 Regulation of the Virulence Genes ................................................................... 32 Francisella tularensis RNA polymerase ..................................................... 33 Transcriptional regulators ........................................................................... 34 SspA Family of Transcription Regulators ................................................................ 38 Mechanism of SspA mediated Gene Regulation .............................................. 40 SspA Orthologs in Pathogenic Bacteria ........................................................... 42 Effector molecules .................................................................................................. 43 Project Rationale and Design ................................................................................. 45 2 IDENTIFICATION OF SMALL MOLECULES THAT BIND MGLA AND SSPA ........ 54 Background ............................................................................................................. 54 Results and Discussion ........................................................................................... 56 Identification of Small Molecules that Modify MglA and SspA Thermal Stability .......................................................................................................... 56 Effect of Selected Compounds in the MglA/SspA Interaction ........................... 58 Biological Relevance of Quinacrine .................................................................. 59 Quinacrine Induced Structural Modifications in the MglA/SspA Complex ......... 61 Identification of Critical Residues Involved in Ft MglA/Ft SspA Quinacrine Interaction ..................................................................................................... 63 Summary ................................................................................................................ 67

PAGE 7

7 3 INORGANIC POLYPHOSPHATE IS THE EFFECTOR MOLECULE THAT MEDIATES THE MGLA AND SSPA INTERACTION .............................................. 94 Background ............................................................................................................. 94 Results and Discussion ........................................................................................... 96 In vivo Analysis of ppGpp on the Interaction between MglA and SspA ............ 96 Determination of Polyphosphate (PolyP) as Mediator of the MglA and SspA Interaction ..................................................................................................... 98 Polyphosphate Binds with High Affinity to the MglA/SspA Complex ................. 99 Effect of PolyP on the interaction between MglA/SspA and FevR (PigR) ....... 100 Summary .............................................................................................................. 103 4 MATERIALS AND METHODS .............................................................................. 115 Chemicals, Bacterial Strains, and Culture Conditions ........................................... 115 Chemicals ....................................................................................................... 115 Bacterial Strains and Growth Conditions ........................................................ 116 Growth conditions of F. novicida strains .................................................. 118 Prepar ation of Competent Cells ..................................................................... 119 DNA Procedures ................................................................................................... 120 E. coli Transformation .................................................................................... 120 Cloning of mglA and sspA Genes for Protein Purification .............................. 120 Bacterial TwoHybrid System ......................................................................... 123 Bacterial BridgeHybrid S ystem ...................................................................... 125 Construction of Reporter Strains for the Bacterial Hybrid Systems ................ 125 Generation of the sspA relA spoT and ppK and ppX knockout mutants 125 Genetic transfer of the F episome by conjugation ................................... 127 Site Directed Mutagenesis ............................................................................. 128 DNA Gel Electrophoresis ................................................................................ 129 Protein Procedures ............................................................................................... 129 Protein Purification and Quantif ication ........................................................... 129 Sodium Dodecyl SulfatePolyacrylamide Gel Electrophoresis (SDS PAGE) .. 130 Small Molecules Screening by Differential S canning Fluorometry (DSF) ....... 130 Determination of Protein Oligomeric State using Size Exclusion Chromatography ......................................................................................... 131 Thermal Unfolding Properties of the MglA/SspA Complex using Differential Scanning Calorimetry (DSC) ....................................................................... 132 Analysis of Protein Secondary Structure by Circular Dichroism (CD) ............. 133 Binding of Small Molecules using Isothermal Titration Calorimetry (ITC) ....... 134 Francisella novicida Experiments ......................................................................... 134 RNA Isolation and Quantitative RT PCR ........................................................ 134 Intracellular Growth Assays ............................................................................ 135 Macrophage cell line growth conditions ................................................... 135 Infection assays ....................................................................................... 137 Enzymatic Assays ................................................................................................. 138 galactosidase Activity .................................................................................. 138 Polyphosphate Measurements ....................................................................... 138

PAGE 8

8 Bioinformatics ....................................................................................................... 139 Sequence Analysis ......................................................................................... 139 Structure Modeling and Analysis .................................................................... 141 Statisti cal Analysis ................................................................................................ 141 5 SUMMARY AND CONCLUSION .......................................................................... 156 LIST OF REFERENCES ............................................................................................. 158 BIOGRAPHICAL SKETCH .......................................................................................... 181

PAGE 9

9 LIST OF TABLES Table page 1 1 Summary of the FPI genes and their proposed functions ................................... 48 2 1 Effect of sma ll molecules on the thermal stability of MglA or SspA .................... 69 2 2 Effect of small molecules on proteinprotein interaction ..................................... 71 2 3 Str uctural prediction of the F. tularensis MglA/SspA complex ............................ 73 4 1 Strains and plasmids used for protein purification and sitedirected mutagenesis ..................................................................................................... 142 4 2 Strains and plasmids used for the twohybrid system ....................................... 143 4 3 Strains and plasmids used for the bridgehybrid system .................................. 145 4 4 Strains and plasmids used for construction of the bacterial hybrid systems reporter strains ................................................................................................. 146 4 5 Primes used for protein purification .................................................................. 147 4 6 Primes used for the hybrid system cloning and reporter strains construction ... 148 4 7 Primers used for site directed mutagenesis ...................................................... 150 4 8 Primers used for qRT PCR ............................................................................... 151

PAGE 10

10 LIST OF FIGURES Figure page 1 1 Model of the Francisella intracellular cycl e ......................................................... 49 1 2 Organization of the Francisella pathogenicity island ........................................... 50 1 3 Multiple sequence alignment of selected SspA orthologs ................................... 51 1 4 Genomic context of SspA orthologs. .................................................................. 52 1 5 Model for regulation of the Francisella pathogenicity island genes ..................... 53 2 1 Purified transcription factors on SDS PAGE ....................................................... 74 2 2 Determination of the molecular weight of the Ft MglA/Ft SspA complex ............ 75 2 3 Quinacrine increases the thermal stability of MglA and SspA ............................ 76 2 4 Transcriptional activation of the lacZ gene upon interaction of the Ft M glA and Ft SspA fusion proteins ............................................................................... 77 2 5 Quinacrine modifies the Ft MglA/Ft SspA interaction ......................................... 78 2 6 Effect of increasing concentra tions of quinacrine on the growth of F. novicida .. 79 2 7 The addition of quinacrine decreased the mRNA levels of the FPI genes. ......... 80 2 8 The intramacrophage survival of F. novicida is impaired at high quinacrine concentrations .................................................................................................... 81 2 9 Quinacrine decreases F. novicida intramacrophage survival ............................. 82 2 10 Quinacrine does not interfere with MglA/SspA dimer formation ......................... 83 2 11 Quinacrine increases the midpoint transition temperature of the MglA/SspA complex .............................................................................................................. 84 2 12 Quinacrine induces conformational c hanges in the MglA/SspA complex ........... 85 2 13 Quinacrine binds with low af finity to the Mgl A/SspA complex ............................. 86 2 14 Representation of the Y. pestis SspA and the F. tularensis MglA/SspA complex structures ............................................................................................. 87 2 15 Structu ra l comparison of SspA proteins ............................................................. 88

PAGE 11

11 2 16 Illustration of the dimer interface and surface exposed region of the MglA/SspA complex ........................................................................................... 89 2 17 Detail of the amino acids located in the dimer interface of the modeled F. tularensis MglA/SspA complex ........................................................................... 90 2 18 Identification of critical amino acids for protein ligand interaction ....................... 91 2 19 Quinacrine does not bind the K101 residue of MglA. .......................................... 92 2 20 MglA Y63 is required for quinacrine binding. A) DSC scans of the Ft M glAY63A/Ft SspA complex .............................................................................. 93 3 1 The absence of ppGpp increases the interaction between MglA and SspA ..... 105 3 2 PolyP stabilized the MglA and SspA interaction ............................................... 106 3 3 PolyP does not affect the dimer state of the MglA/SspA complex .................... 107 3 4 PolyP binds to the MglA/SspA complex ............................................................ 108 3 5 PolyP induces structural modifications on the MglA/SspA complex ................. 109 3 6 PolyP binds to the MglA/SspA complex with high affinity ................................. 110 3 7 The change in the MglAY63 residue to alanine does not affect the dimer state of the MglA/SspA complex ....................................................................... 111 3 8 Transcriptional activation of lacZ mediated by the interaction between PigR with the MglA/SspA complex ............................................................................ 112 3 9 In absence of polyP, the interaction between FevR (PigR), MglA and SspA is impaired ............................................................................................................ 113 3 10 Multiple sequence alignment of FevR (PigR) with two members of MerR family of transcriptional regulators .................................................................... 114 4 1 p15TV L expression vector map. ...................................................................... 152 4 2 pCDF 1b expression vector map ...................................................................... 153 4 3 Schematic representation of the twoh ybrid system used to study proteinprotein interactions ........................................................................................... 154 4 4 Schematic representation of the bridgehybrid system used to study proteinprotein interactions ........................................................................................... 155

PAGE 12

12 LIST OF ABBREVIATION S g microgram l microliter M micromolar A alanine Amp ampicillin Ampr ampicillin resistance APS ammonium persulfate AU arbitrary units BLAST Basic Local Alignment Search Tool bp base pair BSA bovine serum albumin CaCl2 calcium c hloride CD circular dichroism CDC Centers for Disease Control and Prevention CFU colony forming units CHOC II chocolate II agar plates cm centimeter Cm chloramphenicol Cmr chloramphenicol resistance CR3 complement receptor 3 CRPG chlorophenol redD galactopyranoside D aspartic acid DNA deoxyribonucleic acid dNTPs deoxyribonucleotide triphosphates

PAGE 13

13 DSC differential scanning calorimetry DSF differential scanning fluorometry E glutamic acid EDTA ethylenediaminetetraacetic acid EEA early endosomal antigen EK enterokinase FCP Francisella containing phagosome FCV Francisella containing vacuole FDA Food and Drug Administration FevR Francisella effector of virulence regulation FLP f lippase recombination enzyme FPI Francisella pathog enicity island FPLC fast protein liquid chromatography Fur ferric uptake regulator GST glutathione S transferase HCl hydrochloric acid Hfq host factor for bacteri His histidine H NS histonelike nucleoid structuring IFN interferon gamma Igl intramacrophage growth locus IL 10 interleukin 10 IPTG D 1 thiogalactopyranoside ITC isothermal titration calorimetry K lysine

PAGE 14

14 Kb kilobase pai r KCl potassium chloride KD dissociation constant kDa kilodalton Km kanamycin Km Michaelis constant Kmr kanamycin resistance L liter LAMP lysosomal associated membrane protein LB LuriaBertani LD50 median lethal dose LIC ligation independent cloning LVS live vaccine strain M molar MCS multiple cloning sites MerR mercury resistance regulator mg milligram MgCl magnesium chloride MglA macrophage growth locus A MgSO4 magnesium sulfate MIC minimal inhibitory concentration MigR macrophage intracellular growth reg ulator min minutes ml milliliter mM milimolar

PAGE 15

15 MnCl2 manganese(II) chloride MOI multiplicity of infection MOPS 3 (N Morpholino)propanesulfonic acid, 4Morpholinepropanesulfonic acid mRNA messenger RNA N asparagines Na2HPO4 d isodium hydrogen phosphate NaCl sodium chloride NADPH nicotinamide adenine dinucleotide phosphate NaH2PO4 sodium dihydrogen phosphate NCBI National Center for Biotechnology Information ng nanogram NiNTA nickel nitriloacetic acid nm nanometer NmlR N eisseria m erR like r egulator C degree Celsius OD570 optical density at 570 nm OD600 optical density at 600 nm ORF open reading frame PCR polymerase chain reaction PDB Protein Data Bank Pdp pathogenicity determinant protein PigR pathogenicity island gene regulator PMSF phenylmethylsulfonylfluor ide PolyP inorganic polyphosphate ppGpp guanosine tetraphosphate

PAGE 16

16 (p)ppGpp guanosine pentaphosphate PPK polyphosphate kinase PPK polyphosphate kinase PPX exo polyphosphatase PPX polyphosphatase QN quinacrine dihydrochloride qRT PCR quantitative real time PC R R arginine RNA ribonucleic acid RNAP RNA polymerase RNS reactive nitrogen species ROS reactive oxygen species rpm revolutions per minute rpsD 30S ribosomal subunit protein S4 rRNA ribosomal RNA s second SDS PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis Spec spectinomycin Specr spectinomycin resistance sRNA small non coding RNAs SspA stringent starvation protein A Str streptomycin Strr streptomycin resistance Subsp. subspecies T3SS type 3 secretion system

PAGE 17

17 T6SS type 6 secretion system TAE t ris acetateEDTA TCS two component regulatory system TEMED t etramethylethylenediamine Tet tetracycline Tetr tetracycline resistance TEV tobacco etch virus TF transcription factor TFs transcription factors TNF tumor necrosis factor alpha Tris tris(hydroxy methyl)aminomethane tRNA transfer RNA TSB tryptic soy broth UV ultraviolet v / v volume to volume w / v weight to volume WT wild type Y tyrosine Zif zinc finger DNA binding domain of the murine Zif268 protein mercaptoethanol change in Gibbs free e nergy change in enthalpy change in entropy

PAGE 18

18 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy INORGANIC POLYPHOSPH ATE MODULATES THE MGLA/SSPA COMPLEX INTERACTION IN Francisella tularensis By Algevis Patricia Wrench December 2011 Chair: Graciela L Lorca Major: Microbiology and Cell Science The transcription factors MglA and SspA of the highly virulent bacterium Fran cisella tularensis form a heterodimer complex and interact with the RNA polymerase and other transcription fact ors. These proteinprotein inter actions regulate the expression of hundreds of genes that are essential for the pathogens virulence and survival within host cells. In order to evade the host defense mechanism s, F. tularensis needs to sense signals from the environment and respond accordingly by differentially expressing the appropriate genes. However, limited information is available on the environmental cues that trigger the regulatory network mediated by MglA and SspA. In this study, a fluorescencebased screening assay comprising 1152 small molecules was used to uncover quinacrine hydrochloride as a thermal stabilizing compound of purified MglA and SspA proteins from F. tularensis SCHU S4 The effect of the small molecule was analyzed in vivo using a bacterial twohybrid system. The results obtained showed that quinacrine modified the interaction between MglA and SspA. In addition, in F tularens is subsp. novicida quinacrine affected the intramacrophage survival capabilities via a decrease in the transcription of the F rancisella pathogenicity island genes. Structureguided sitedirected mutagenesis

PAGE 19

19 experiments indicated that quinacrine makes cont ac t with the amino acid residues tyrosine 63 of MglA and lysine 97 of SspA, both located in the c left region of the interacting surface. It was determined that inorganic polyphosphate (polyP) functions as a biological effector molecule that stabilizes the interaction of the MglA and SspA complex. A biophysical characterizat ion determined that polyP binds with high affinity ( KD = 300 n M) to the MglA/SspA complex in the cleft region of the heterodimer. Moreover the interactions between the MglA/ SspA comp lex and the transcription factor FevR ( PigR ) were significantly impaired when the intrac ellular polyP concentrations were reduced as determined in the bridg e and twohybrid system s. Taken together, this study describes the identification and use of a chemi cal as a probe to understand the mechanisms involved in the interplay between intracellular ligands and transcriptional regulators. The molecular probe could be, in the future, fur t her engineered for its use as therapeutics against Francisella infections.

PAGE 20

20 CHAPTER 1 INTRODUCTION Francisella tularensis Francisella tularensis is a Gram negative cocobacillus, capsulated, facultative intracellular pathogen, and the causative agent of tularemia. Francisella is the only genus within the family Francisellacease an proteobacteria. The organism most closely related to Francisella is the arthropod endosymbiont Wolbachia persica (Forsman et al 1994) The 16S rRNA sequence suggests that i t is distantly related to the human pathogens Coxiella burnetii and Legionella pneumophila (Larsson et al 2005) There are four subs pecies of F. tularensis They include subsp. tularensis, holarctica, mediasiatica, and novicida They share 95 98% identity at the 16S rRNA nucleotide level. (Forsman et al ., 1994, Svensson et al 2005, Champion et al 2009) The s ubspecies tularensis ( F tularensis ) and holarctica ( F holarctica) are responsible for the majority of human illness es ; however, F. tularensis is the most virulent (Saslaw & Carlisle, 1961) Most research into th e biology of F. tularensis has been conducted using an attenuated strain of F holarctica, called the live vaccine strain (LVS), which is attenuated in humans but retains virulence in mice. F. tularensis subsp. novicida (F. novicida) is also an avirulent strain in humans but causes severe illness in mice, similar to the human tularemia. D ue to lower biocontaiment requirements for F. novicida thi s subspecie is often used as a research surrogate for F tularensis (Baro n & Nano, 1998, Brotcke & Monack, 2008, McRae et al 2010)

PAGE 21

21 History and Potential as a Biological Weapon In 1911 an outbreak of a plaguelike disease mainly affecting ground squirrels occurred in Tulare County, California, USA (McCoy & Chapin, 1912) Research conducted by Edward Francis led to the conclusion that the Bacterium tularensis (now F. tularensis) was the common cause of the outbreak in the ground squirrels and a variety of human illnesses including rabbit fever, tick fever and deer fly fever (Francis, 1925) The diseases were subsequently recognized as tularemia with the first official case occurring in Ohio in 1914 (Wherry & Lamb, 1914) In the 1930s and 1940s the t ularemias epidemic p otential became apparent when waterborne outbreaks occurred in Europe and the former Soviet Union (Karpoff & Antonoff, 1936, Silchenko, 1957) while epizootic and laboratory associated cases occurred in the United States (Jellison & Kohls, 1955, Lake & Francis, 1922) Before World War II, Japan, France, Germany, the Soviet Union, and Great Britain had active biological weapons programs. The United States began its biological weapons developments in the 1940s, which was terminat ed by an executive order in 1970 (Christopher et al 1997) Nevertheless, the Soviet Union continued its efforts until the 1990s, resulting in production of F. tularensis strains engineered to be resistant to antibiotics and vaccines (Alibek, 1999) The Centers for Disease Control and Prevention (CDC) classifies F. tularensis as a category A bioterrorism agent because of its extreme virulence, low infectious dose, ease of aerosol dissemination, and capacity to cause severe illness and death. Epidemiology Francisella has a broad host and habitat distribution It can infect mammals, insects, arthropods and protozoa, and it can be recovered from contaminated water,

PAGE 22

22 soil, and vegetation (Mrner, 1992, Berdal et al 2000, Abd et al 2003, Keim et al 2007) F. tularensis is primarily found in North America and it is most often isolate d from ticks, deerflies, lagomorphs and rodents (Hopla, 1955, Boyce, 1975) It is the most virulent of the four subspecies It has been determined that contact with as few as 10 colony forming units ( CFU) via the re spiratory route can cause disease, and if left untreated, 30 to 60% of the infections can be fatal (Saslaw et al 1961a, Dienst, 1963, Gurycov, 1998) F. holarctica causes the majority of human illness and is foun d throughout the Northern Hemisphere (Ohara et al 1991, Trnvik et al 1996) This subspecies is less virulent than F tularensis ( the median lethal dose ( LD50) < 103 CFU) and causes milder forms of tularemia (Olsufiev et al 1959, Eigelsbach et al 1962) It can commonly be found in hares, semi aquatic rodents and mosquitoes, and seems to have a strong association with water (Elias son et al 2002, Willke et al 2009) F. tularensis subsp. mediasiatica ( F mediasiatica) is found in central Asia and is rarely associated with human disease (McLendon et al 2006) F. novicida is found in North America and recently in Australia. (Whipp et al 2003) It is avirulent in humans, except in immunocompromised individuals (Hollis et al 1989, Clarridge et al 1996) The reason behind this at tenuation in humans is unclear, given its similar traffic king and replication mechanisms to F. tularensis and F. holarctica Tularemia is more common in the months of June through September (Dennis et al 2001) Bi tes from infected ticks or deer flies usually occur in the summer months, but illness due to animal handling and hunting can occur at any time of the year (Dennis, 1998) In the United States, approximately 126 cases of tularemia are reported each year, most commonly in Arkansas, Missouri, Okl ahoma, and Massachusetts

PAGE 23

23 (Kugeler et al 2009) The most recent incident in the United States occurred on Marthas Vineyard in 2000 ( Massachusetts ) and involved 15 patients with one fatality. They developed primari ly pulmonary tularemia (Feldman et al 2003) In Europe, most reported tularemia cases are from northern and central countries, particularly Finland and Sweden. The d isease in many of these countries occurs in localized rural regions. The outbreaks are associated with arthropod and water borne transmissions (Trnvik et al ., 1996) Today, the worldwide occurrence of human tularemia is likely underestimated due to the generic nature of the disease symptoms. Intracellular Life Cycle Francisella h as the ability to enter and replicate within a variety of cell types. These include non phagocytic cells such as alveolar epithelial cells and hepatocytes as well as phagoc ytic cells such as neutrophils and dendritic cells (Conlan & North, 1992, McCaffrey & Allen, 2006) However, it is believed that macrophages serve as Francisella s primary replicative niche (Hall et al 2007) The uptake of Francisella appears to occur via phagocytosis using a unique mechanism involving the formation of asymmetric pseudopod loops (Figure 1 1) T his process has been termed looping phagocytosis (Clemens et al 2005) The uptake is dependent on complement receptor 3 (CR3) and the complement factor C3 (Clemens & Horwitz, 2007) The use of this receptor pathway is common among pathogens as this form of entry prevents the oxidative burst. Other receptors involved are the mannose and scavenger recept ors (Pierini, 2006, Schulert & Allen, 2006) Following internalization into host cells, Francisella resides within a vacuole named Francisella containing phagosome (FCP) (Clemens et al ., 2005) The FCP matures to an early endosome that acquires the early endosomal antigen 1 (EEA1 ) marker foll owed by the late endosomal markers LAMP 1

PAGE 24

24 (lysosomal associated membrane protein 1 ), LAMP 2, CD63 and the Rab7 GTPase within 1530 min after the bacterial uptake (Clemens et al 2004, Santic et al 2005b) The FCP f ails to acquire the acid hydrolase cathepsin D a nd does not fuse with lysosomes. As a result, the bacterium actively degrades the phagosomal membrane by hydrolysis of the surrounding lipi d s bilayers (Clemens et al ., 2004) There is some debate as to whether the phagosome acquires the lysosomal vacuolar ATPase pump and becomes acidified (Chong et al 2008, Santic et al 2008, Clemens et al 2009) Thus, F rancisella is either able to prevent phagosomal lysosomal fusion or is able to trigger escape from the phagosome quickly following acidification via a vacuolar ATPase proton pump, but before fusing with the lysosome. Once free in the cytosol Francisella replicates extensively using available nutrients and triggering host cell death. This process releases bacterial cells that can reinfect nearby host cells (Santic et al 2007, Wehrly et al 2009) Francisella has also been shown to r eenter the endocytic pathway via autophagy and reside in vesicles named Francisella containing infection prior to host cell death (Checroun et al 2006) A model of the Francisella intracellular cycle is shown in Figure 11 Vaccination against Tularemia The live vaccine strain (LVS) derived from F holarctica was selected via multiple passages on peptone cysteine plates followed by repeated inoculation of mice (Tigertt, 1962) The US Food and Drug Administration (FDA) approved this strain as an investigational new drug for evaluation. The US Army tested its use as a vaccine on human volunteers in the late 1950 s The immunized subjects were challenged with F. tularensis SCHU S4. It was reported that the F. holarctica LVS vaccine was protec tive against a high dose (1,000 CFU) of bacteria delivered subcutaneous ly and against a

PAGE 25

25 low dose (10 to 100 CFU) of bacteria in the aerosol form (Saslaw et al ., 1961a, Saslaw et al 1961b) H owever, when F. tularensis SCHU S4 was administered at a high dose (1,000 CFU) in the aerosol form ( dose necessary to confer immunity ), a subset of volunteers developed tularemia (Hornick & Eigelsbach, 1966) Consequently, t he FDA denied the licens e of the F. holarctica LVS vaccine due to the unknown level of attenuation, residual virulence foll owing vaccination, and variability with in vaccine lots (Sandstrm, 1994) The efforts toward developing vaccines against tularemia have continued throughout the years (Pechous et al 2009) However, t hese candidate vaccines offer limited protection and variable effectiveness. Francisella Response to Host Defenses In order to evade the host defense mechanism s, intracellular pathogens need to sense signals from the surr ounding environments and respond accordingly by inducing the appropriate set of genes. Some of the environmental cues that Francisella encounters during macrophage infection are oxidative stress, limited iron availability and nutritional starvation. Oxidat ive stress Some of the early responses of the host s innate immune system to microbial invaders are the production of reactive oxygen species (ROS) and reactive nitrogen species (RNS) (Fang, 2004) These anions are essential for bacterial killing and to amplify inflammatory responses (Nauseef, 2007) Pathogens that survive inside phagocytes have developed methods to avoid or inhibit ROS producti on. For example, Francisella is able to inhibit the host s cell defense mechanism by preventing NADPH oxidase assembly on a forming phagosome (McCaffrey & Allen, 2006, Mohapatra et al 2010) A similar mechanism has been observed in Legionella pneumophila ( L.

PAGE 26

26 pneumophila) and Coxiella burnetii (Harada et al 2007, Siemsen et al 2009) T he host NADPH oxidase complex is a multicomponent enzyme that catalyzes the conversion of molecular oxygen into superoxide anions The NADPH oxidase protein complex consist of several phox subunits; the cytosolic p40, p47, and p67 in addition to p22 and gp91, which localize to the membrane (Vignais, 2002) A type of Rho GTPase, called Rac, also ass ociates with the complex and mediates NADPH oxidase activity (Petry et al 2010) NADPH oxidase induction requires the translocation of phosphorylated p40, p47, and p67 phox proteins from the cytoplasm to the phagosomal membrane (Appelberg, 2007) Experimental data have shown that F. tularensis F. novicida and F. holarctica LVS prevent NADPH oxidase assembly during intracellular infection. Specifically, the recruitment of the phox proteins p40, p47, and p 67 to the phagosome were prevented, thus attenuating the oxidative burst mechanism utilized by neutrophils. The mechanism by which Francisella species inhibits NADPH assembly is thought to involve the acid phosphatases AcpA, AcpB and AcpC, and the histidin e acid phosphatase (Hap) by dephosphorylation of the phox proteins (McCaffrey & Allen, 2006, Mohapatra et al ., 2010, McCaffrey et al 2010) The combined deletion of the phosphatases and inhibiton of AcpA and AcpB resulted in reduction of phosphatase activity and virulence (Mohapatra et al 2008, McRae et al ., 2010) Moreover, Francisella responds to oxidative stress conditions by upregulating the expression of general stress and specific oxidative stress response genes. The identified proteins include the general stress proteins : HtpG, ClpP, ClpX, the Lon protease, DnaJ, DnaK, GroEL, GroES, ClpB, and Hsp (Ericsson et al 1994, Lenco et

PAGE 27

27 al 2005, Wehrly et al ., 2009) The oxidative stress response proteins included NADPH quinone reductase, Dyptype peroxidase, deaminase (HemC), glutaredoxin (GrxA), peroxiredoxin, superoxide dismutases (SodC and SodB), and methionine sulfoxide reductases (MsrA and MsrB) (Bakshi et al 2006, Guina et al 2007, Wehrly et al ., 2009) Iron acquisition Iron is an essential nutrient that plays a role in many vital microbial cellular processes and metabolic pathways. Its acquisition is viewed as an important virulence trait for many bacterial pathogens since the availability of iron in the host cell is limited (Skaar, 2010) To ove rcome the ironrestricted environment, pathogens can quickly adapt to this environmental cue by triggering expression of not only the iron acquisi tion machinery but also virulence determinants (Skaar, 2010) Gram negative bacteria sense low levels of free iron through the ferric uptake regulator (Fur). Fur acts as a transcriptional repressor by forming a complex with ferrous iron and binding to the Fur box located upstream the ironregulated genes. Under iron limiting conditions, these genes are expressed and lead to the acquisition of iron (Payne, 1993) Francisella species encode for an iron acquisition operon ( fsl for Francisella Siderophore Locus or fig for Francisella Iron Genes) involved in the synthesis and secretion of a rhizoferrinlike siderophore, which chelates extracellular ferric iron (Sullivan et al 2006) This operon is located downstream of a fur gene homolog and a canonical Fur binding site, sug gesting that it is subject ed to Fur mediated regulation in response to iron (Sullivan et al ., 2006, Kiss et al 2008, Ramakrishnan et al 2008) In addition, this operon was induced under ironrestricted conditions in a Fur dependent manner. Microarray and proteomic analysis in F. holarctica LVS confirmed that approximately 80 genes are

PAGE 28

28 differentially expressed under iron limiting conditions (Deng et al 2006, Lenco et al 2007) Similar results were obtained d uring cytosolic replication of F. tularensis SCHU S4 in macrophages (Wehrly et al ., 2009) The Francisella Pathogenicity Island Random transposon mutagenesis and microarray bas ed studies have identified a number of genes required for Francisella to survive intracellularly and to replicate within the host (Qin & Mann, 2006, Tempel et al 2006, Maier et al 2007, Weiss et al 2007) The fact that all these m utants are defect ive for intracellular growth and unable to cause disease highlighted the importance of these genes in the intracel lular survival of this pathogen. Despite the progress in identifying virulence determinants, the biologi cal role of many of these genes has not been determined yet. The Francisella pathogenicity island (FPI) was first identified in 2004 (Nano et al 2004) using transposon mutagenesis Two loci encoding for the genes iglB and iglC were shown to reduce the ability of F. novic ida to grow in macr ophages (Gray et al 2002) Subsequent bioinformatic analysis of this region revealed the ex istence of an approximately 33 k b region with the characteristics of a pathogenicity island (Nano et al ., 2004, Larsson et al ., 2005) (see Figure 12 ). The FPI consists of 16 19 open reading frames (ORFs) arranged into two major transcriptional units, one containing 67 ORFs including those coding for the I ntracellular Growth L ocus ( igl) proteins, and the second containing 12 ORFs including the P athogenicity D eterminant P roteins ( p dp). This operon has a G+C content of 30.6% in contrast to the average 33 % G+C content for the Francisella chromosome, which is indicative of horizontal gene transfer (Nan o et al ., 2004) Interestingly the FPI is found in duplicate in F. tularensis F. holarctica, and, F. mediasiatica, but it is present as a single copy in F. novicida (Nano et al ., 2004, Larsson

PAGE 29

29 et al 2009) The majority of the FPI genes are high ly conserved between subspecies, although there are differences in the genes present in region upstream of iglA which contains the anmK and pdpD genes (Figure 1 2 ). The F. novicida FPI differs from the F. holarctica in ha ving anmK and pdpD The F. tularensis FPI has pdpD and two different sized anmK genes. A large number of studies have identified the FPI as the key player in Francisella s ability to survive and replicate inside the host cell. All these studies have shown that these genes are essential for Francisella virulence both in macrophage cell lines and in mouse models (Gray et al ., 2002, Twine et al 2005, Nano et al ., 2004, Brotcke et al 2006, de Bruin et al 2007, Santi c et al ., 2007) The proposed function of some of the FPI genes is summarized on Table 11. The t ype VI secretion system (T6SS) is broadly distributed amog Gram negative bacteria. This system is used to transport effector proteins to the cytosol of infect ed host cells (Pukatzki et al 2009) Recent evidence indicates that many of the FPI proteins share homology wit h type VI secretion system (T6SS) described in Vibrio cholera e ( V. cholerae ) and Pseudomonas aeruginosa ( P. aeruginosa) In these gene clusters, the products of icmF clpV and dotU genes are required for the secretion of Hcp and VgrG into the culture supernatants (Mougous et al 2006, Pukatzki et al 2006) F. tularensis contains homologues of all these, which are described below. The AnmK and PdpD proteins are required for virulence in animal infections performed with F. novicida but not for intracellular growth (Weiss et al ., 2007, Ahlund et al 2010) AnmK shows high sequence identity to COG2377 (HSP70 chaperone) (Nano & Schmerk, 2007) while PdpD localizes in the outer membrane, similarly to homologues of T6SS. More importantly, IglA, IglB, P dpB, and DotU are

PAGE 30

30 required to localize PdpD to the outer membrane (Ludu et al 2008) The IglA and IglB are homologues to VipA and VipB from V. cholerae and form tubular structures predicted to be involved in effector protein secretion (de Bruin et al ., 2007, Bnemann et al 2009) IglC is well characterized. It plays an important role modulating biogenesis of the phagoso me to avoid lysosomal fusion, mediates escape of the bacteria into the host cytosol, and is involved in induction of apoptosis in J774 cells (Lindgren et al 2004, Santic et al 2005a, Santic et al ., 2005b, Bnquist et al 2008) Less information is available on the IglD protein. Studies in strains suggest that iglD is important for phagosomal escape (Bnquist et al ., 2008) PdpE localizes to the outer membrane however, it has no direct role in the phagosomal escape, intramacrophage replication, or virulence of the F. holarctica LVS (Brms et al 2011) PdpE is a putative H cp homolg, yet still t here is no evidence that this protein is secreted (Barker et al 2009) In the F. holarctica LVS and mutant strains exhibited delayed phagosomal escape, delayed activation of the inflammasome, and virulence attenuation in mice. The localization of IglI and IglG is different. While IglI is found primarily in the inner membrane ( but also present in both the outer membrane and the cytosol ), IglG was found only in the outer membrane (Brms et al ., 2011) DotU (Defective in Organelle Trafficking protein U) from F. tularensis exhibits homology to a member of COG3455, an outer m embrane protein DotU homologues often display a periplasmic OmpA like domain that contains a peptidoglycanbinding motif, suggesting that they are linked to the out er membrane via the cell wall (Ma et al 2009) DotU interac ts with IcmF to maintain the stability of the membrane embedded components that form the structure spanning the inner membrane and outer membrane of the T6SS secretion system

PAGE 31

31 (Bnemann et al 2010) IglF is required for virulence in mice and is the Cl pV homolog. ClpV is the energizing component of T6SS e ssential for T6SS in P. aeruginosa (Bnemann et al ., 2009) However, IglF does not possess the characteristic Walker A and B boxes involved in the ATPase activity indicating that it may not be functional (Mougous et al ., 2006, Barker et al ., 2009) VgrG is secreted into culture supernatants and macrophages without the requirements of any other genes in the FPI. I t is also required for phagosomal escape (Barker et al ., 2009) PdpB [ Intracellular Multiplication protein F ( IcmF ) homolog] is required for replication in the host cell cytosol (Tempel et al ., 2006) Typically, the IcmF protein is localized in the inner membrane and contain a Walker A box (Zheng & Leung, 2007) Although P dpB is localized in the inner membrane, it is missing the Walker A motif (Ludu et al ., 2008) The P dpA protein is required for phagosomal escape and has been shown to be soluble and upregulated in iron limiting conditions. It is predicted t o be a secreted effector protein (Schmerk et al 2009) PdpC, IglJ, IglH, and IglE are required for virulence in mice but their direct role i n virulence in not clear (Weiss et al ., 2007) Despite the fact that the Francisella secretion system is not considered similar enough to other T6SSs there is no doubt that it shares a strong resemblance at the amino acid level This suggests that the proteins encoded within the FPI may not function in an identical fashion to those within the T6SS of V. cholerae and P. aeruginosa. F. tularensis may have evolved these T6SS homologues to facilitate secretion of effector proteins in a related, but not identical manner, which may be adapted to its location within the host p hagosomal compartment.

PAGE 32

32 Regulation of the Virulence Gene s Most research on regulation of virulence determinants in F. tularensis has been performed on the FPI genes (Gray et al ., 2002, Nano et al ., 2004, Santic et al ., 2005b, Brotcke et al ., 2006, Weiss et al ., 2007, de Bruin et al ., 2007, Santic et al ., 2007, Bnquist et al ., 2008, Ludu et al ., 2008, Schmerk et al ., 2009) The regulation of the FPI and other virulence genes is controlled at the transcriptional and post transcriptional levels. Post tran scriptionally, b acterial small noncoding RNAs (sRNA) carry out both positive and negative regulation of g ene expression by pairing with messenger RNAs (mRNAs) This mode of regulation often requires the RNA chaperone Hfq (host factor (Papenfort & Vogel, 2010) Hfq is a post trancriptional regulator that facilitates RNA RNA interactions between sRNA and their mRNA targets (Mller et al 2002) Hfq dependent sRNAs usually act on trans encoded target mRNAs to repress translation and promote mRNA deg radation (Storz et al 2004) Hfq is an important regulator of gene expression in a number of bacterial pathogens including Yersinia pseudotuberculosis Neisseria meningitidis and Salmonella enterica ( S. enterica) (Sittka et al 2007, Schiano et al 2010, Mellin et al 2010) Mutation of hfq in the F. holarctica LVS and F. novicida strains resulted in pleiotropic effects including sensitivity to elevated salt concentration, detergents, high t e mperature, pH, peroxide stressors, early entry into stationary phase, decreased virulence in mice, slight growth defect in macrophages and biofilm formation (Meibom et al 2009, Chambers & Bender, 2011) Microarra y analysis of the mutant strain revealed the defective expression of 104 genes, including the entire FPI. A recent study identified several sRNA expressed in the F. holarctica LVS using in silico and experimental assays. These included members of

PAGE 33

33 structura l and housekeeping RNAs and others unique to Francisella that share no sequence similarity or conserved genomic context with any previously annotated regulatory transcripts (Postic et al 2010) Hfq negatively regulates only a subset of genes in the FPI ( pdpD to iglJ ) (Meibom et al ., 2009) The regulation at the level of transcriptional initiation in Francisella is a complex mechanism that involves a cascade of at least five transcription factors (MglA, SspA, FevR ( PigR ) PmrA and MigR) and a unique RNAP All t hese components work in concert to regulate a myr iad of genes including the FPI. Francisella tularensis RNA p olymerase The process of transcription is performed by a complex of proteins that form the RNA polymerase (RNAP) holoenzyme. In most bacteria, the RNAP consists of two identical (Larsson et al ., 2005) The binding of RNAP to DNA requires the recognition of specific sequences in the promoter region r In addition, the affinity of RNAP binding to the promoter can be enhance d by sequences upstream of the promoter called UP (upstream) element s to which the carb binds. The Francisella RNAP is unique, as it contains two disti separate genes ( rpoA1 and rpoA2) encode for these proteins and both are incorporated into the holoenzyme. The two subunits are only 32% identical at the amino acid level. This difference suggests that the subunits could potentially have different mechanisms for promoter recognition, dimer formation, and interaction with transcriptional regulators. The factor is present in the enzyme. This allows the cell to respond to a range of environmental conditions and regulate the expression of specific sets of genes. Unlike

PAGE 34

34 other Gram negative bacteria like Escherichia coli ( E. coli) t factors, Francisella 70 and one 32 (Grall et al 2009) The fact that the Francisella RNAP differs to other bacterial RNAPs could have a significant impact on the control of expression of virulence genes. Transcriptional r egulators Baron and Nano (1998) isolated a spontaneous F. novicida mutant in a screen for suppressor s of acid phosphatases. The mutant showed altered colony morphology on plates containing a chromogenic phosphatase substrate, which suggested that the strain was a spontaneous phosphatase mutant. Further studies demonstrated that the mutant strain was not able to replicate in macrophages, and the mutated locus was identified by complementation and named mglAB for macrophage growth locus AB (Baron & Nano, 1998) The mglA and mglB genes form an operon that encodes for proteins that exhibit homology to sspA and sspB from E. coli and Haemophilus species. Whole transcriptome analysis using m icroarrays have characterized MglA as a global transcription al re gulator. It is responsible for the regulation of more than 100 genes, including the entire FPI with the majority being positively regulated (Brotcke et al ., 2006) It has also been determined that the mglA trans cript is highly up regulated upon infection of macrophages (Brotcke et al ., 2006) The deletion of either mglA or mglB genes attenuates the growth of Francisella inside macrophages rendering them unable to escape from the phagosome (Baron & Nano, 1998, Lauriano et al 2004, Santic et al ., 2005b, Brotcke et al ., 2006, Vonkavaara et al 2008) It was proposed that the disruption of mglA attenuates virulence by modifying the expression of the FPI genes. In

PAGE 35

35 fact, the FP I genes pdpD iglA iglC, iglD and pdpA are reduced in a mglA mutant (Lauriano et al ., 2004) Other genes in the MglA regulon include those important in general metabolism, general stress response, oxidative and nitrosative stress, genetic and environmental processing, macrophage cytotoxicity, and many of hypothetical genes with no known or characterized homologs (Brotcke et al ., 2006) MglB is a homolog to SspB, it s exact function is still undetermined but, it is also important in Francisella virulence (Baron & Nano, 1998) The Francisella genome encodes for a second protein that exhibits homology to MglA annotated as SspA. MglA and SspA are members of the SspA protein f amily (Baron & Nano, 1998) In E. coli SspA is a transcription factor involved in the regulation of genes for stringent starvation responses (Williams et al 1994b) Unlike other pathogens where SspA is functional as a homodimer, the functional unit in Francisella is a MglA/ SspA heterodimer (Charity et al 2007) The complex makes direct contact with the RNAP and the association of MglA to RNAP occurs in a SspA dependent manner (Charity et al ., 2007) Global gene expression studies using F. holarctica LVS A and ssp A strain s indicated that they regulate the same set o f genes, including the FPI (Charity et al ., 2007) FevR ( Francisella Effector of Virulenc e Regulation), also known as the Pathogenicity Island Gene Regulator (PigR) is a putative DNA binding transcription factor of the FPI It was identified in F. novicida during a screen of genes requiring MglA and SspA for their expression (Brotcke & Mon ack, 2008) The FevR ( PigR ) protein has weak homology to the MerR family of transcription factors. The sequence identity is restricted to a putative helix turn helix DNA binding domain, however, the C terminal

PAGE 36

36 metal binding domain that usually modulates M erR function is not present in FevR ( PigR ) (Brown et al 2003) It has not been demonstrated that FevR (PigR) can bi nd to any specific DNA sequence (Brotcke & Monack, 2008) Fev R (PigR) is essential for intramacrophage replication and virulence in the mouse model. F. holarctica LVS and F. novicida strains deficient in the transcription factor [ ( pigR )] remained within the phagosome and were not able to inhibit the activity of the NADPH oxidase (Buchan et al 2009, Charity et al 2009, Brotcke & Monack, 2008) FevR (PigR) is a positive regulator of the MglA/SspA regulated genes, however, FevR (PigR) alone is not sufficient to induce the MglA/SspA regulon (Brotcke & Monack, 2008, Charity et al ., 2009) MglA and SspA positively regulate the transcripts level of fevR ( pigR ) (Brotcke et al ., 2006, Charity et al ., 2007) while the transcript levels of mglA or sspA were unaffected in a R ( pigR ) strain Moreover, FevR ( PigR) has been shown to physically interact with the MglA / SspA complex (Charity et al ., 2009) The Macrophage Intracellular G rowth R egulator (MigR) has been identified as a transcriptional activator of iglB in the F. holarctica LVS (Buchan et al ., 2009) A strain is defect ive in growth and intracellular trafficking in macrophages However, these phenotypes were not reproduced in the F. tularensis SCHU S4 strain (Buchan et al ., 2009) MigR positively regulates fe vR ( pigR ) the operons iglABCD (in the FPI) and fslABCD (for iron acquisition) (Buchan et al ., 2009) MigR shares some similarity with acyl coenzyme A ligases and contains a conserved AMP binding domain. Proteins wi th this domain are commonly involved in fatty acid modification (Klein et al 1971) Fo r example, in E. coli the product of the fadD gene (FACS: fatty acyl CoA synthetase/coenzyme A ligase) a MigR homolog modifies specific fatty acids, allowing

PAGE 37

37 them to interact with DNA binding proteins (DiRusso et al 1999, Dirusso & Black, 2004) Interestingly MigR lacks a DNA binding domain, which questions its role as a transcriptional regulator. It still remains unclear if the regulatory function of MigR is due to direct binding to DNA or indirect ly through the modulation of the transcriptional regulator FevR ( PigR ) PmrA and KdpD are the members of a two component system (TCS) In t hese regulatory systems the membranebound sensor kinase (KdpD) is autophosphorylated at a conserved histidine residue in response t o an environmental signal. T he cytoplasmic response regulator (PmrA) is then phosphorylated at a conserved aspartate resid u e by the sensor kinase. As a consequence, t he phosphorylated response regulator binds to the promoter region of several genes causin g activation of transcription (Beier & Gross, 2006) Usually the genes that encode for TCS are clustered and expressed as a single transcriptional unit; however, Francisella species have no complete paired TCS in their genome (Larsson et al ., 2005) PmrA was first described as an orphan response regulator that shares homology with the S enterica serovar Typhimurium response regulator PmrA (Mohapatra et al 2007) In S. enterica, PmrA PmrB are involved in the induction of genes that mediate LPS modification and AMP polymyxin B resistance (Kraus & Peschel, 2006) The F. novicida strain is attenuated for virulence in mice, is unable to escape from phagosomes in macrophages and is more s ensitive to antimicrobial peptides (Mohapatra et al ., 2007) DNA microarrays carried out with this mutant strain indicated that PmrA positively regulates its own transcription as well as the expression of 65 genes including those in the FPI (Mohapatra et al ., 2007, Sammons Jackson et al 2008) PmrA is phosphoryl ated at

PAGE 38

38 aspartate 51 by the sensor kinase KdpD, and once phosphorylated it efficiently binds to the pmrA and pdpD operons (Bell et al 2010) Microarray analysis of F. novicida kdpD strain confirmed that kdpD modulates the same group of genes identified for PmrA (Bell et al ., 2010) The environmental signals that are required for KdpD and PmrA activation remain to be identified. Important ly, co immunoprecipitation experiments revealed that PmrA physi cally interact s with the MglA/ SspA complex suggesting that the three proteins are part of the same protein complex that regulates gene expression (Bell et al ., 2010) PmrA does not affect the transcript levels of mgl A or ssp A but it positively regulates the levels of the fevR ( pigR ) transcripts (Mohapatra et al ., 2007) SspA F amily of Transcription Regulators The first step in gene expression is the transcription initiation event, a process catalyzed by RNAP at specific DNA sequences (promoter region) (deHaseth et al 1998) An important mean by which gene expression can be controlled is through the regulation of transcription initiation. This modulation can be accomplished through the binding of proteins called transcr iption factors (TFs). In general, negative regulators bind to the promoter, interfering directly with RNAP; in contrast, positive regulators in most cases bind to the promoters upstream region, helping to recruit the polymerase and start transcription (ColladoVides et al 1991, Madan Babu & Teichmann, 2003) TFs are classified in several families based on sequence identity. In most cases TFs can be divided in two domains which allow them to function as regulatory switches. Classically, one domain functions as an effector binding domain, which in many cases is a metabolite that conducts the environmental information (Martnez Antonio et al 2006) The other domain directly interacts with a target DNA sequence. In bacteria, the helix -

PAGE 39

39 turn helix domain is the most common fold found (Seshasayee et al 2006) However, there are families of TFs that do not contain a typical DNA binding domain; instead, they regulate gene expression through proteinprotein interactions with RNAP. This is the case of the CarD protein of Mycobacterium tuberculosis ( M. tuberculosis ) and the members of the S tringent S ta rvation Protein A (SspA) family (I shihama & Saitoh, 1979, Stallings et al 2009) The SspA proteins are part of the glutathione S transferase (GST) C SspA family (conserved domain accession #: cd03186) within the GST C terminal domain superfamily (cluster ID #: cl02776) The GST superfam ily is a large, diverse group of cytosolic dimeric proteins involved in the detoxification process of xenobiotics These proteins catalyze the nucleophilic addition of the sulfur atom of glutathione to the electrophilic groups of a large variety of hydrophobic molecules, making them less reactive. These molecules include organic halides epoxides, unsaturated carbonyl s, arene oxides, nitrate esters, and thiocyanates (Mannervik & Danielson, 1988, Coles & Ketterer, 1990) GST also catal yzes the GSH dependent reduction of organic hydroperoxidases and biosynthesis of prostaglandins and leukotrienes (Jensson et al 1986) The GST fold contains an N terminal thioredoxinfold domain and a C terminal alpha hel ical domain GSH binds to the N terminal domain while the hydrophobic substrate occupies a pocket in the C terminal domain (Dirr et al 1994, Nishida et al 1998) D ifferent classes of GSTs have been identified, which display varying substrate specificities (Sheehan et al 2001) Some GST family members contain the GST fold but lack GST activity These include the hematopoietic prostaglandin D synthase, the cephalod major lens protein S crystallin, the prion protein Ure2p, and the stri ngent

PAGE 40

40 starvation protein A (SspA) (Kanaoka et al 1997, Chuang et al 1999, Umland et al 2001, Hansen et al 2005a) The E coli SspA protein was originally identified as a protein whose expression was increased during stationary phase (Reeh et al 1976) as well as during starvation for carbon, amino acid, nitrogen and phosphate (Williams et al ., 1994b) In addition, this pr otein was identified in purifications of the RNAP. This direct interaction indicated that like component of a form of RNAP expressed during the transition from exponential to stationary phase growth (Ishihama & Saitoh, 1979, Williams et al 1994a) The sspA gene is the first of two genes in the sspAB operon. Inactivation of sspA interferes with expression of sspB Add itionally, this mutation alters the expression of at least 11 genes and showed less viability than the wildtype during prolonged starvation or extended stationary phase (Williams et al ., 1994b) Mechanism of SspA mediated Gene Regulation E. coli is able to change gene expression as a consequence of cells entering in stationary phase or to respond rapidly to environmental stresses including nutrient limitation and decrease in pH (Hengge Aronis, 1996) The histonelike nucleoid structuring (H NS) pro tein is a global regulator of many genes involved in oxidative and osmotic stress, cold shock, motility, and acid tolerance (Atlung & Ingmer, 1997, Hommais et al 2001) H NS acts as a repressor by affecting the topology of the DNA upon binding (Hulton et al 1990) One of the many genes modulated by H NS is rpoS s subunit of RNAP (Barth et al 1995) s is an alternative sig ma factor that recognizes the promote r of genes expressed during stationary phase and/or osmotic and acid stress responses in E. coli (Hengge Aronis, 1993) H NS mediated repression of rpoS is one of the mechanism s s

PAGE 41

41 (Barth et al ., 1995) SspA, on the contrary, inhibits the stationary phase accumulation of H NS, resulting in the expression of acid stress and nutrient starvation responses including those in the s regulon. In summary, SspA and H NS have antagonic roles in controlling acid resistance and other stress responses associated with stationary phase (Hansen et al 2005b) Another function attributed to SspA is th e activation of expression of the late genes of the bacteriophage P1. The initiation of transcription from the P1 late genes promoters requires E. coli 70, SspA and the phageencoded activator Lpa (late promoter activator) (Hansen et al 2003) The SspB protein was discovered during a purification of the E. coli ClpXP protease associated to ribosomes During the purification, the wash of partially purified ribosomes was higher in protease activity ( by ten times or more) than ribosomes without SspB The stimulatory factor was purified an d sequencing identified the protein as SspB (Levchenko et al 2000) Further studies determined that SspB functions as a specificity enhancing factor that recognizes ssrA tagged proteins and directs them to the ClpXP prot ease but not to other proteases (Levchenko et al ., 2000) The sspB gene is encoded downstream of sspA in an operon arrangement. The sspAB operon is induced during limited nutrition conditions (Williams et al ., 1 994b) Therefore, SspB may function d uring nutrient starvation, where ribosome stalling is likely to increase resulting in a decrease in protein synthesis. Under these conditions the ssrA tagging machinery is activated, which adds an 11residue peptide to the carboxyl terminus of the nascent polypeptide (Gottesman et al 1997) As a consequence, SspB enhances recognition of the ssrA tagged substrates by the ClpXP protease for degradation (Kim et al 2000)

PAGE 42

42 SspA Orthologs in Pathogenic Bacteria SspA orthologs are found in a wide r ange of bacteria including animal, plant and insect pathogens, with the majority being present in human pathogens ( Hansen et al ., 2005b) SspA is highly conserved in more than 50 Gram negative bacteria. Besides the characterization performed in E. coli s SspA protein, functional studies have only been performed in a few of these orthologs. These include Yersinia pesti s, ( Y. pestis ), V cholerae P aeruginosa, Neisseria gonorrhoeae ( N gonorrhoeae) and all subspecies of F tularensis They display 28 to 83% identity at the amino acid level (Figure 13). The first indication that SspA is associated with the regulation o f expression of virulence factors was observed in N. gonorrhoeae. In this organism the RegF protein, which is 42% identical to the E. coli SspA was found to act as a negative regulator of pilE transcription (De Reus e & Taha, 1997) PilE protein, a type IV pilin, is the major subunit of the N. gonorrhoeae pilus. The pilus is an essential virulence factor during gonococcal infection, expressed only during certain environmental conditions (Taha et al 1991) The Y. pestis SspA is 83 % identical to E. coli SspA and functions as a positive and negative regulator of the expression of invasin and flagellin, respectively (Badger & Miller, 1998) The expression of these virulence determinants are highly influenced by growth phase and temperature, which change during different infection stages (Pepe et al 1994) The V. cholerae SspA (VC0576) shares 72% identity to E. coli SspA. In a largescale signaturetagged mutagenesis screen it was found to be essential in colonization in a mouse model and acid tolerance (Merrell et al 2002) Additionally, Y. pestis V cholerae and P. aeruginosa (53 % identical to E. coli SspA) expressed in trans in a n E. coli sspA m utant strain were able to restore acid resistance in the mutant str ain These results indicated that these orthologs are functional in E. coli

PAGE 43

43 (Hansen et al 2005a) In F. tularensis two SspA orthologs are encoded in the genome (Larsson et a l ., 2005) One of them is annotated as MglA and the second is annotated as S spA. They share 31% and 32 % identity to E. coli SspA, respectively. Interestingly, the gene encoding MglA is part of the mglAB operon similar to the SspA arrangement found in other pathogens. F. tularensis Ssp A does not have the same operon arrangement as shown in Figure 14. MglA and SspA are global regulators of the genes encoded in FPI which are required for virulenc e and intramacrophage survival. Effector m olecules The binding ability of m any transcriptional regulators to its cognate DNA sequence is modulated by the binding of small molecules called effec tors These small molecules act by modifying the structural conformation of the TFs or by affecting the oligomeric status of the protein. Many c ellular metabolites have been identified as effector molecules in bacteria. For example, during catabolite repression, where the preferred carbon source is not present in sufficient amounts for optimum growth, the second messenger cyclic AMP (cAMP) binds to the transcription factor CAP (catabolite gene activator protein) or CRP (cAMP receptor protein) allowing it to bind to the promoter region of the operons under its control (de Crombrugghe et al 1984, Ihssen & Egli, 2005, Polit et al 2003) This regulatory system allows for activation of genes encoding the enzymes necessary for the transport and metabolism of less favorable carbon sources present in the medium (Busby & Ebright, 1999, Gosset et al 2004, Zheng et al 2004) Additionally, Guanosine tetraphosphate (ppGpp) is a mediator of the regulatory system involved in adaptation under nutrient starvation and stress conditions (Srivatsan & Wang, 2008) During amino acid starvation, the binding of uncharged tRNA to the

PAGE 44

44 ribosome stalls protein synthesis, which results in the activation of the ribosomeassociated RelA (ppGpp synthase) protein. RelA synthesizes guanosine pentaphosphate ((p)ppGpp), which is subsequently converted to ppGpp. (Balsalobre, 2011) This alarmone binds to th e secondary chan nel of RNAP to regulate transcription of genes involved in amino acid metabolism, ribosomal RNA ( r RNA ) and transfer RNA (t RNA ) genes (Artsimovitch et al 2004, Srivatsan & Wang, 2008) In addition, the DksA protein augment ppGpp regulatory signal s through binding to RNAP (Perederina et al 2004) The degrada tion of ppGpp is mediated by SpoT, which is a bifunctional enzyme and can also synthesize ppGpp. SpoT is thought to respond to conditions of fatty acid, carbon, and iron limitation (Seyfzadeh et al 1993, Vinella et al 2005) ppGpp plays an important rol e in the virulence in many pathogenic bacteria, including M tuberculosis L pneumophila, V cholerae S enterica, and in the enterohaemorrhagic E. coli (Primm et al 2000 Hammer & Swanson, 1999, Haralalka et al 2003, Thompson et al 2006, Nakanishi et al 2006) Francisella species contain both relA and spoT genes. The inactivation of the relA gene in F. tularensis SCHU S4 resulted in impaired replication in macrophages and attenuation of mice virulence (Dean et al 2009) In the F. holarctica LVS relA spo T strain a similar phenotype was observed (Charity et al ., 2009) Furthermore, microarray analysis of this mutant strain showed that the genes regulated by ppGpp overlap with those modulated by the MglA / SspA complex However, ppGpp does not a ffect the association of MglA and SspA with RNAP, neither their transcript levels. Conversely ppGpp positively regulates fevR ( pigR ) expression (Charity et al ., 2009) These findings suggest ed that FevR ( PigR ) and the MglA / SspA complex function in parallel to regulate the expression of

PAGE 45

45 virulence genes and that ppGpp might be necessary for the optimal FevR ( PigR ) activity (Charity et al ., 2009) However, the direct interaction between ppGpp and any transcrip tional regulator of Francisella has yet to be experiment ally proved. The regulation of v irulence genes in Francisella is unique in that it involves a number of proteins (MglA, SspA, FevR ( PigR ) MigR, PmrA, KdpD, Hfq) t hat cooperate to control their expression. A proposed model for the regul ation of the FPI genes is depictured in Figure 15 KdpD is activated by an unknown environmental signal, which in turn phosphorylates PmrA at aspartate 51. PmrA binds to the promoter recruiting free or RNAP bound MglA / SspA complex to initiate FPI transcri ption. Additionally, PmrA binding may help in the assembly of the MglA / SspA / FevR (PigR) complex, which directly interacts with RNAP. D uring stress and starvation conditions FevR ( PigR) can associate with the MglA /SspA complex before or after it makes contact with the RNAP to activate FPI genes expression. However, fevR ( pigR ) expression requires the presence of MglA, SspA, MigR, P mrA and ppGpp in order to efficiently be activated. At an unknown signal, the Hfq repressor specifically inhibits the expression of a subset of genes ( pdpA to iglJ ) in the FPI by binding to the putative promoter upstream pdpA (Brms et al 2010) I n summary, although the main players of this regulatory circuitry have been identified, the identification of small molecules that modulate these complex interactions is an important gap from the mechanistic point of view. Project Rationale and Design Afte r the anthrax attack in 2001, the increase in r esearch against b attling bioterrorism threats resulted in the identification of several virulence traits in Francisella tularensis It was determined that this intracellular pathogen differentially expressed

PAGE 46

46 h undreds of genes, which are required for intracellular survival during the infection cycle. However, scarce information is available on the environmental conditions that trigger the response. In F tularensis the main components of regulation at the level of transcription initiation are the heterodimer formed by the transcription factors MglA and SspA and its interactions with the RNA polymerase and other DNA binding transcription factors [FevR (PigR) or PmrA] Because c omplex i nteractions between proteins can be frequently modified by metabolites, we hypothesized that the MglA/SspA complex can bind small molecules that modify the interaction between the heterodimer and the RNA polymerase and/or DNA binding transcription factor s [ such as FevR ( PigR) ] The purpose of this study was to analyze the proteinprotein interactions between the F. tularensis transcriptional regulators and to identify effector metabolites that modify the m. The first goal of this project was to identify compounds that bind to the trans cription factors. Therefore, a fluorescencebased screening assay comprising of 1152 small molecules was used with the purified MglA, SspA and the MglA/SspA complex An in vivo bacterial twohybrid system was used to study the effect of the chemicals on pr oteinprotein interaction. A structural model of the MglA/SspA heterodimer was constructed and used to study the proteinprotein interaction surface as well as binding of the small molecule. The identified small molecule was used as a chemical probe to ide ntify specific amino acids in the cleft regi on formed between MglA and SspA that mediate these interactions. Since the disruption of interactions between MglA and SspA may lead to impaired pathogenicity, the effect of the small molecules on intramacrophage survival was tested

PAGE 47

47 in a murine macrophage cell line. F. tularensis subspecie s novicida strain U112 was used as research surrogate for subsp tularensis in the experiments presented. F. novicida is an avirulent strain in humans but causes severe illness i n mice, similar to the human tularemia. The second goal of this project was to identify intracellular metabolites or environmental signals that modified the interactions within the MglA/SspA complex or to other transcription factors. To this end, the twoh ybrid and bridgehybrid system s were tested using reporter strains with different genetic backgrounds. Several thermoanalytical, spectroscopy and chromatography techniques were employed to characterize the changes of the MglA/SspA complex upon the binding of the effector metabolite. This work was designed to determine the mechanisms involved in the interplay between intracellular l igands and transcriptional regulators. Using a molecular probe to understand these specific interactio ns is significant since c hemicals with similar scaffolds might be synthesized for use as therapeutics. Moreover, a similar approach can be used for other pathogenic bacteria that have similar regulation mechanism of pathogenicity determinants.

PAGE 48

48 Table 11. Summary of the FPI genes and their proposed functions F tularensis SCHU S4 F novicida U112 Gene Names Proposed Functions Reference Locus 1 Locus 2 Locus 1 FTT1699 FTT1344 FTN1309 pdpA Phagosome escape (Schmerk et al ., 2009) FTT1700 FTT1345 FTN1310 pdpB / icmF Cytosol replication (Tempel et al ., 2006) FTT1701 FTT1346 FTN1311 iglE Unknown (Weiss et al ., 2007) FTT1702 FTT1347 FTN1312 vgrG Phagosome escape (Barker et al ., 2009) FTT1703 FTT1348 FTN1313 iglF / clpV Unknown (Barker e t al ., 2009) FTT1704 FTT1349 FTN1314 iglG Phagosome escape, inflammasome inactivation (Brms et al ., 2011) FTT1705 FTT1350 FTN131 5 iglH Unknown (Weiss et al ., 2007) FTT1706 FTT1351 FTN1316 dotU Unknown (Weiss et al ., 2007) FTT1707 FTT1352 FTN1317 iglI Phagosome escape, inflammasome inactivation (Brms et al ., 2011) FTT1708 FTT1353 FTN1318 iglJ Unknown (Weiss et al ., 2007) FTT1709 FTT1354 FTN1319 pdpC Unknown (Weiss et al ., 2007) FTT1710 FTT1355 FTN1320 pdpE / hcp Unknown (Barker et al ., 2009, Brms et al ., 2011) FTT1711 FTT1356 FTN1321 iglD Phagosome escape (Bnquist et al ., 2008) FTT1712 FTT1357 FTN1322 iglC Avoid lysosomal fusion, phagosome escape, apoptosis induction (Lindgren et al ., 2004, Santic et al ., 2005a, Santic et al 2005b, Bnquist et al ., 2008) FTT1713 FTT1358 FTN1323 iglB Effector protein secretion (de Bruin et al ., 2007) FTT1714 FTT1359 FTN1324 iglA FTT1715 FTT1360 FTN1325 pdpD Unknown (Ludu et al ., 2008) FTT1716 FTT1361 FTN1326 anmK Unknown (Ahlund et al ., 2010, Weiss et al ., 2007)

PAGE 49

49 Figure 11. Model of the Francisella intracellular cycle. Francisella is phagocytized into macrophages through looping phagocytosis into a phagosome (FCP) The FCP then acquires early (EE) and late (LA) endosomal markers and does not fuse with lysos omes (Lys). Then, bacteria exit the phagosomal compart ment and replicate in the host cell cytosol. Prior to cell lysis Francisella reenters a vacuole (FCV) via autophagy Figure as originally published in Chong A and Celli J (2010) The Francisella intracellular life cycle: toward molecular mechanisms of intracellular survival and proliferation. Front Microbiol 1: 138. d oi: 10.3389/fmicb.2010.00138.

PAGE 50

50 Figure 12. Organization of the Francisella pathogenicity island. Schematic representation of the FPI of F. tularensis SCHU S4, F. holarctica LVS and F. novicida U112 The F. tularensis SCHU S4 FPI contains two anmK genes in comparison to F. novicida U112 which has only one. In the F. holarctica LVS FPI, both the anmK and pdp D genes are missing. Figure adapted from original publication in Brms JE, Sjstedt A and Lavander M (2010) The role of the Francisella tularensis pathogenicity island in type VI secretion, intracellular survival, and modulation of host cell signaling. Fro nt Microbiol 1: 136. doi: 10.3389/fmicb.2010.00136.

PAGE 51

51 Figure 13 Multiple sequence alignment of selected SspA orthologs. Residues conserved in all sequences (*), with a conserved substitution (:), or with a semi conserved substitution (). Abbreviations : Ec, E. coli ; Yp, Y. pestis ; Vc, V. cholerae; Pa, P. aeruginosa; Ng, N. gonorrhoeae; F. tularensis SspA; FtM, F. tularensis MglA

PAGE 52

52 Figure 14 Genomic context of SspA orthologs. The genomic arrangement around the F. tularensis mglAB operon is similar to the E. coli and Y. pestis sspAB operon, as they contain the rplM and rpsI genes encoded upstream The F. tularensis sspA gene is not arranged as the sspA genes from the other species.

PAGE 53

53 Figure 15. Model for regulation of the Francisella pathogenicity island genes. An unknown environmental signal in sensed by KdpD kinase, which activates the response regulator PmrA by phosphorylation. PmrA activates gene expression by binding with the MglA / SspA / RNAP complex. FevR (PigR) is activated or upregulated by M glA, SspA, PmrA, MigR, and ppGpp. Then, FevR (PigR) makes contact with free or RNAP bound MglA / SspA complex to initiate transcription of the FPI genes. On the contrary, Hfq represses the genes pdpA to iglJ Genes regulated by PmrA only include (shown in this figure): pmrA : DNA binding response regulator ; lepB : signal peptidase I; rnc : ribonuclease III; truB : tRNA pseudouridine synthase B, and rnr: ribonuclease R. Figure adapted from original publication in Brms JE, Sjstedt A and Lavander M (2010) The role of the Francisella tularensis pathogenicity island in type VI secretion, intracellular survival, and modulation of host cell signaling. Front Microbiol 1: 136. doi: 10.3389/fmicb.2010.00136.

PAGE 54

54 CHAPTER 2 IDENTIFICATION OF SMALL MOLECULES THAT BIND MGLA AND SSPA Background Transcriptional control is a key factor in the regulati on of virulence gene expression in nearly all known bacterial pathogens. Although many mechanisms of such regulation are known, the major level of control is initiation of transcription, where transcription fact ors interact with RNAP to modulate its accessibility to specific gene promoters. Members of the SspA family are transcription regulators that interact with RNAP, to modulate the expression of genes required for both pathogenesis and survival during stationary phaseinduced stress (Reeh et al ., 1976, Ishihama & Saitoh, 1979, Williams et al 1991) Many pathogens encode for proteins orthologous to SspA, including Y pestis N gonorrhoeae, F tularensis and V cholerae (Badger & Miller, 1998, De Reuse & Taha, 1997, Larsson et al ., 2005, Merrell et al ., 2002) In F tularensis however, a unique mechanism of interaction occurs, where two SspA protein mem bers (annotated as SspA and MglA) form a heterodimer complex and bind to RNAP to alter the expression of 100 genes (Brotcke et al ., 2006, Charity et al ., 2007) Furthermore, additional transcriptional factors make c ontact with the MglA/SspA/RNAP complex to alter gene expression and promote pathogenesis. These include the putative DNA binding protein FevR (Pig R) and the response regulator PmrA (Charity et al ., 2009, Brotcke & Mo nack, 2008, Bell et al ., 2010) These proteinprotein interactions positively regulate the expression of genes clustered in the Francisella pathogenicity island (FPI), which are required for virulence and intracellular growth (Brotcke et al ., 2006, Baron & Nano, 1998, Lauriano et al ., 2004, Barker et al ., 2009) Currently, there

PAGE 55

55 is a lack of knowledge regarding the molecular details and signal molecules involved in the modulation of these interactions. F tularensis is a Category A bioterrorism threat and is the causative agent of a rare but severe zoonotic disease known as tularemia (Oyston & Griffiths, 2009, McLendon et al ., 2006) F. tularensis is remarkable in that it is b oth highly infectious and capable of infecting a very broad array of animal species (Santic et al 2010, Ellis et al 2002, Pechous et al ., 2009) Inhalation of F. tularensis subspecies tularensis, the most virule nt subspecies, results in the pneumonic form of tularemia, a fulminating disease in humans. Currently, tularemia can be treated with antibiotics such as streptomycin and gentamicin (Dennis et al ., 2001) The identif ication of new therapeutics, however, is very significant since Francisella can easily be genetically modified and therefore its sensitivity to known antibiotics could be compromised (McRae et al ., 2010, Brocklehurst et al 1999, Tyeryar & Lawton, 1969) The manipulation of proteinprotein interactions as targets for therapeutics is a new and expanding field of research (Wells & McClendon, 2007, Nishimura et al 2010, Tran et al 2010, Workman & Collins, 2010) In this regard, the Francisella MglA/SspA complex is a very attractive system that offers at least three usable interactions: i) with each other, ii) with the RNAP, and iii) with the DNA binding transcription factors FevR (PigR) and PmrA. Each of these interactions could potentially be manipulated by the action of small molecules and influence the ability of MglA or SspA to interact with the RNA P or transcription factors that recognize their specific promoters. In this chapter, the identification and characterization of a small molecule that specifically modifies the interaction between MglA and SspA is described. The

PAGE 56

56 experiments provide biochemical and genetic evidence showing that the small molecule makes contact with specific amino acid residues located in the interface between MglA and SspA. The conformational change induced upon binding of the small molecule affect ed the ability of F. novicida to induce transcription of the FPI genes and therefor e, survival within m acrophages was attenuated. Results and Discussion Identification of Small Molecules that Modify MglA and SspA Thermal S tability A small molecule screening was performed to identify small molecules that may modify the MglA/SspA heterodimer interactions. Dif ferential scanning fluorometry (DSF) was used to screen purified MglA and SspA proteins. The principle of this screening technique is that favorable proteinligand interactions can be detected by following the kinetics of protein unfolding in presence or absence of a specific ligand. A strong proteinligand interaction is evidenced by an increase in thermal stability, which could be translated into a change in the functionality of the protein in vivo (Lorca et al 20 07, Pagliai et al 2010) The Prestwick Chemical Library was selected as source of chemicals since it offers a manageable size ( 1152 compounds ), it is FDA approved ( for use in humans) and offers chemical structure diversity (Vedadi et al 2006, Pagliai et al 2010) The mglA and sspA genes from F. tularensis SCHU S4 were clon ed and overexpressed, and the proteins were purified (Figure 2 1) The F. tularensis SspA (Ft SspA) was obtained at very low concentrati ons (0.09 mg ml1) when expressed individually while it could be copurified at high concentrations in the presence of the F. tularensis MglA ( Ft MglA ) In ord er to screen the proteins individual ly the SspA from E. coli (Ec SspA) was tested and purified at high concentrations (0.72 mg ml1). Based on

PAGE 57

57 these results, the Ec SspA and Ft MglA were chosen to test the effect of the small molecules on each protein. The midpoint transitions were determined to be 48.7C for Ft MglA, and 42.4C for Ec SspA The compou nds that induced a shift in the midpoint transition temperature ( expressed as Tm ) of the proteins by more than 2.0 C were considered hits Using this technique, compounds that interacted with Ft MglA (13 chemicals) and Ec SspA (10 chemicals) were identified ( for a complete list see Table 21). Proparacaine hydrochloride and retinoic acid were identified as t he strongest thermo stabilizing compounds for Ft MglA with a of 24.5 4.4 C and 24.5 3.9 C, respectively. Additional compounds inducing significant stabilization of Ft MglA included pamoic acid (20.4 2.9 C), flumequi ne (17.9 2.4 C), and ursolic acid (16.3 3.2 C). The strongest thermostabilizing compound for SspA was benzbromarone with a of 30.0 1.6 C. Additional compounds inducing significant stabilization of SspA included benzethonium chloride (25.9 5 .2 C), meclofenamic acid (22.9 3.8 C), and quinacrine dihydrochloride (15.2 1.7 C). Because the Ec SspA and Ft MglA share 31% sequence identity, it was expected that some chemicals would bind both proteins. Indeed, four chemicals (benzethonium chlor ide, proparacaine hydrochloride, retinoic acid and quinacrine dihydrochloride) all with strong thermal stabilization effect, overlapped between the two proteins. These results obtained were confirmed by analyzing the dose dependency using increasing concentrations (01 mM) of each chemical. The compounds that overlapped between Ft MglA and Ft SspA were validated using a copurified preparation of F. tularensis MglA and SspA proteins (Ft MglA/Ft SspA) The formation of the complex was verified by size exclusion

PAGE 58

58 chromatography. The chromatograms on Figure 22 display the expected molecular weight of the Ft MglA/Ft SspA complex (54.9 kDa). The Tm was established at 53.8 C for the complex Qui nacrine dihydrochloride (QN) had the major effect on the Tm and it wa s observed that the Tm for the proteins ( Ft MglA, Ec SspA, and Ft MglA/ Ft SspA complex) increased proportionally to the concentration of quinacrine present as shown in Figure 23 Effect of Selected Compounds in the MglA/SspA Interaction The thermal stabil ity observed from the binding of small molecules in vitro might result from interactions with the chemicals at locations that may or may not be functionally relevant. To identify the molecules that specifically modify the heterodimer interface, an in vivo assay using an E. coli two hybrid system modified from Charity et al (2007) was used. The plasmid pBR GP F. tularens is SCHU S4 mglA APZif was used to fuse the F. tularensis SCHU S4 sspA gene to the Zif protein. The reporter strain AW23 was constructed by deleting the E. coli sspA homolog in the FW102 strain (Nickels, 2009) to avoid unspecific interactions and conjugated with the (Charity et al ., 2007) galactosidase reporter gene as previously described (Charity et al ., 2007) Figure 24 shows the increase of galactosidase activity only when both proteins are present and not when the plasmids contain one or none of the fusion proteins S eventeen compounds were individually tested epending on the minimal inhibitory concentration (MIC) determined in E. coli (Table 22). Upon addition of the galactosidase activity

PAGE 59

59 would indicate that the compound affected the interaction between the MglA and SspA proteins. Most of the compounds that were originally identified by screening individual proteins, failed to modify the interaction between the Ft MglA and Ft SspA. Diethylcarbamazine citrate and haloperidol had a mild effect and were found to galacto sidase activity by 19.3 7.2% and 18.0 3.2 % respectively. Interestingly three out of the four compounds that interacted with both Ft MglA and Ec SspA in vitro also resulted in decreased interactions between Ft MglA and Ft galactosidase activi ty decreased between 18.9 4.8% and 61.0 1.4% ) Since quinacrine was the small molecule with the strongest effect (61.0 1.4% decrease) on the interaction between Ft MglA and Ft SspA (Figure 25 ) ( P <0.05) further in vitro characterizations were perfor med using this chemical. Biological Relevance of Quinacrine A set of bioassays was performed to validate the biological relevance of quinacrine as a tool to modify the heterodimer interface of the MglA/SspA complex. F. tularensis subspecie novicida ( F. nov icida ) was used as the model strain to establish a proof of principle. To determine if quinacrine affected the growth/survival of Francisella growth inhibition assays were performed in liquid culture in the presence of the selected chemical compound. F. n ovicida was able to grow with concentrations up to 2 5 0 M, albeit at slower rate (Figure 26 ). The doubling time of the microorganism was not this concentration was therefore used for the subsequent studies. Subsequently, the modifications in the MglA/SspA complex induced by quinacrine were evaluated by measuring the express ion of genes controlled by the MglA/SspA complex. RNA was isolated from exponential phase cells of F. novicida iglA, iglD,

PAGE 60

60 pdpA, and pdpD in the FPI was measured by quantitative RT PC R (qRT PCR). The expression of rspD and uvrD was used as the internal control and negative control, respectively, since the latter is not under MglA/SspA regulation (Brotcke et al ., 2006) Under these conditions, a decrease in the expression of the FPI genes iglA, ig lD, pdpA and pdpD was observed (2.1; 1.5; 2.2 and 5 fold, respectively) with P <0.01 for iglA and iglD and P <0.0005 for pdpA and pdpD (Figure 2 7 ). During infection, MglA and SspA directly regulate the capability of F. novicida to activate the genes required to enter and survive within the host phagocytic cells (Mohapatra et al ., 2008) The effect of quinacrine on the ability of F. novicida to survive within a macrophage cell line (RAW 264.7) was evaluated using increasing concentrations of the chemical ( were confirmed to remain viable by vital staining with trypan blue. The ability of F. novicida to survive within macrophages was first studied by adding quinacrine to the macrophages 2 h post infection (an d kept throughout the experiment). At 25 quinacrine, a 2.6log decrease in viability was observed af ter 8 h of treatment (Figure 28 A ). Pre treating the macrophages with the same concentration of quinacrine for 30 min prior to infection also resulted in a decrease in viable cells. This effect proved to be dose dependent as shown by a corresponding decrease in F. novicida (CFU/ml) with increasing concentrations of quinacrine ( Figure 28 B log decrease in viability. At lower concentrations, bacterial counts were similar to those seen in the control group. The combination of treatments (pre and post infection) resulted in the absence of viable F. novicida cells within macrophages following 8 h of i n cu bation, as shown in Figure 29 ( P <0.05) These

PAGE 61

61 findings suggest that the presence of quinacrine impairs the ability of F. novicida to survive within RAW 264.7 cells. Collectively, these results indicate that chemicals (such as quinacrine), that modify the MglA/SspA heterodimer interface, may act to modulate further interactions with other transcription factors [such as PmrA or FevR (PigR)] or the RNAP, affecting virulence gene expression in vivo Quinacrine has been used as an anti malarial agent in humans (Talisuna et al 2004) in vitro as an anti prion agent (Korth et al 2001) and as a neutralizing agent for Bacillus anthracis ( B. anthracis ) (Comer et al 2006) At the molecular level, quinacrine has been reported to affect or disrupt proteinprotein interactions in the anti apoptotic member Bcl xl (Orzez et al 2009) Quinacrine was shown to specifically bind in the hydrophobic grove, competing with the regulatory peptide BH3 (Petros et al 2006, Orzez et al ., 2009) As a desired result, apoptosis was induced in cancer cells. Quinacrine Induced Structural Modifications in the MglA/SspA Complex galactosidase activity observed in the in vivo two hybrid system upon the addition of quinacrine may result from disruption of the heterodimer or structural modifications of the dimer interface. To determine the effect of the small molecule on the heterodimer complex, the oligomeric state was determined by size exclusion chromatography in both the presence and absence of quinacrine. Ft MglA was used as a control, which elutes as a monomer under the same experimental conditions (Figure 2 2 ) A similar profile of monomers and dimers was observed for Ft MglA/Ft SspA in the chromatograms (Figure 2 10) under both conditions, indicating that the interaction with quinacrine does not affect the oligomeric state of the complex.

PAGE 62

62 The thermal unfolding properties of the Ft MglA/Ft SspA complex were then established, in both the presence and absence of quinacrine, using differential scanning calorimetry (DSC). The calorimetric scans (Figure 211) showed that the proteins undergo a typical twostate endot hermic unfolding transition in solution. The lower transition peak has a transition midpoint temperature ( Tm ) of 35.7 C, while the higher transition peak has a Tm of 54.2 C. The lower and higher transition temperatures were assigned Tm1 and Tm2, respecti vely. In the presence of quinacrine, the MglA/SspA complex displayed a positive shift in the thermogram (Figure 2quinacrine, Tm1 was 40.6 C and Tm2 was 57.7 Tm1 was 59.7 C and Tm2 was 69.3 C. These results indicate that quinacrine binds to the complex as evidenced by an increase in the thermal stability of the MglA/SspA complex. To monitor the structural/conformational changes that the protein undergoes during quinacrine binding, circular dichroism (CD) measurements were performed. helical structures occur typically at 208 and 222 nm, and the bands observed for the Ft MglA/Ft SspA complex at ~208 and ~220 nm are indicative of a high helical content (Figure 212). These results are in agreement wit helix content of the cleft region in the modeled Ft MglA/Ft SspA structure (See below, Figure 2 14B ). A secondary structure conformational change was induced by the addition of quinacrine, at concentrations as low as 1 nM. In summary, the results of these analyses helix co ntent of the heterodimer. The direct binding of quinacrine was tested in vitro by isothermal titration calorimetry (ITC). It was determined that quinacrine binds with a low affinity (KD = 847.5

PAGE 63

63 0.05 M) (Figure 21 3 ). The chemical structure of quinacrine is composed of a t ricycle acridine scaffold with a side chain extending from the middle ring Because of the low affinity determined further engineer ing based on the quinacrine chemical scaffold would be required for its use as a therapeutic agent. Identification of Critical Residues Involved in Ft MglA/Ft SspA Quinacrine Interaction To determine the specificity and location of quinacrine binding, a st ructural model of the F. tularensis MglA/ SspA complex was constructed. The model was built using SWISS MODEL (Ar nold et al 2006) SWISS MODEL is a n online structure homology based modeling server, which allows users to predict the structure of a protein with the simple input of the amino acid sequence. The quality of the modeling is estimated by the E value, QMEA N Z Score, and QMEANscore4 (Benkert et al 2011) The E value is a parameter that descr ibes the number of hits that are expect ed to be found in a protein by chance when searching the database. The lower the E value, th e more structurally significant the hit is. The QMEAN Z Score measures the absolute quality of a model A strongly negative value indicates a model of low quality. The QMEANscore4 represents the probability that the input protein matches the predicted model. The value ranges between 0 an d 1, where the probability of matching is higher as the value approaches to 1. Using the SWISS MODEL automated template search, the amino acid sequences of F. tularensis SCHU S4 MglA (GI# 56708335) and SspA (GI# 56707600) were used as the input proteins an d their structure was modeled. Both MglA and SspA were predicted to be similar to the SspA protein from Y pestis (PDB: 1YY7) (Hansen et al ., 2005a) The F. tularensis SspA and MglA share a 32 % and 28% identity with Y. pestis SspA, respectively, at the amino acid level. Table 23 summarizes the results obtained from

PAGE 64

64 the SWISS MODEL structure prediction. The E value obtained for SspA (1.40x45 was lower than for MglA (1.20x32) Generally, E values between x10 and x50 indicate that the structures are c losely related with the same or similar domain. The QMEAN Z Score and QMEANscore4 were similar in both cases. The QMEAN Z Score for MglA was 2.92 and for SspA was 2.75. This number is not a very strong negative value, indicating that the predicted models have good quality. The QMEANscore4 for MglA and SspA were 0.57 and 0.58, respectively. These values are midrange from the QMEANscore4 (0 to1), which gives a 57% and 58% probability that M glA and SspA protein structures macth the predicted models. The predicted structure of the MglA/SspA complex show ed a similar overall folding to the Y. pestis SspA ( Figure 214). As predicted from the linear sequence, the Y. pestis SspA protein adopts the glutathione S t ransferase (GST ) fold The GST enzymes are, in general, functional as dimers, where each subunit is composed of two domains, a small N terminal 3terminal updown helix bundle (Hansen et al ., 2005a) Functional studies performed in Y. pestis SspA protein suggested that it does not have GST activity (Hansen et al 2005a) According to amino acid sequence alignment s the lack of GST activity is due to a replac ement of the catalytic residue cysteine10 in E. coli with phenylalanine21 in Y. pestis (Hansen et al ., 2005a) In Francisella the SspA and MglA proteins h ave a tyrosine residue in place of the functional cysteine i n the linear sequence alignment The modeled structure of the MglA/SspA complex from F. tularensis shown in Figure 214 was compared to three other SspA protein structures available in the Protein Data Bank (PDB) The structural alignment to Pseudomonas putida ( P putida) (3MDK), Pseudomonas fluorescens ( P.

PAGE 65

65 fluorescens ) (3LYP) and Haemophilus influenzae ( H. influenzae) (3LYK) showed that their structures are very similar (Figure 215). These observations validate the predicted F. tularensis MglA/SspA comple x structure. Functional studies with E. coli SspA (83 % identical to Y. pestis SspA) have shown that the surface exposed region is involved in transcriptional activation, probably through interactions with RNAP (Figure 2 16) (Hansen et al ., 2005a) In the homolog Ure2p (Umland et al 2001) these residues are not conserved, but the formation of a c left between the two monomers has been suggested as the dimer interface site (Umland et al ., 2001) Based on in silico analyses, we performed sitedirected mutagenesis on various residues located within the interaction surf ace (cleft) between the monomers. As a guide, we used a molecule of citric acid present in the Y. pestis Figure 21 7 illustrates the model of the Mg l A/SspA complex structure superimposed with the citric acid molecule found in the dimer interface of the Y. pestis SspA structure The dimer interface region is formed by residues N51, Y63 and R64 from MglA, and residues D96, K97 and E101 from SspA (Figur e 21 7 ). To assess the i mportance of these amino acids each was mutated to alanine in the pBR mglA or the pACTR sspA Zif plasmids, and the effect of the mutations was then tested in vivo in the two hybrid system in the absence of small molecules. As a control, a residue that is not located in the heterodim er interface, K101 of MglA, was included Interestingly, all mutations located in the heterodimer interface resulted in lower proteinprotein interactions in the absence of quinacrine, as evidenced by a galactosidase activ ity (betwe en 800 and 1900 arbitrary units,

PAGE 66

66 Figure 2 1 8 ). On the other hand, the MglA K101A mutant behaved as the wild type protein (2193 156 arbitrary units). The effect of quinacrine in the MglA/SspA interaction was then assessed in all mutants. As expected, the MglA K101A muta nt showed a similar decrease (63.5% galactosidase activity (801 73 arbitrary units) as previously observed with the w ild type protein (Figure 2 19) ( P <0. 0 5) The mutants MglA N51A, MglA R64A, SspA K97A, SspA D96A and SspA E101A showed different degrees of effects, ranging from a 59.1 % to 98.7 % galactosidase activity ( P <0.05) (Figure 2 1 8 A and 2 1 8 B ). The mutations on SspA K97A and MglA Y63A showed the smallest changes, with a reduction in enzymatic activity of 41.1% and 28.2% ( P >0.05) respectively. These resul ts indicate that in the heterodimer interface, MglA Y63 and SspA K97 are the two primary residues involved in t he interaction with quinacrine. The specific effect of quinacrine on the complex was tested on the Ft MglAY63A/Ft SspA mutant by DSC. The scans performed using the Ft MglAY63A/Ft SspA complex showed that unfolding occurred in two events, similar to the wild type complex. However, no significant changes in either Tm1 or Tm2 were detected after incubation with quinacrine (Figure 2 20A ). Resulting Tm1 values were 32.7 C, 32.4 C and 32.7 Tm2 values obtained were 51.8 C, 53.4 C and 52.1 respectively. On gel filtration experiments, the Ft MglAY63A/Ft SspA complex showed a profile of monomers and dimers similar to the Ft MglA/Ft SspA complex indicating that mutation of Y63 in Ft MglA or addition of quinacrine does not affect the oligomeric state of this complex (Figure 2 2 0B ).

PAGE 67

67 Summary In the present work, a fluorescencebased thermal screening assay of 1152 small molecules uncover ed a small molecule (quinacrine) that binds in the F. tularensis MglA/SspA heterodimer interface. In vivo studies performed in an E. coli two hybrid system demonstrated that quinacrine affects the MglA/SspA interaction, shown by the galactosidase activity. Since Francisella tularensis is capable of growing inside macrophages and the biological relevanc e of quinacrine was assayed on the ability of this Gram negativ e bacterium to survive within macrophages. Quinacrine was able to impair F. novicida intramacrophage survival possibly by affecting the expression of FPI genes T o determine the specific residues involved in the binding to quinacrine, a model of the terti ary structure of the SspA/MglA complex was built. The predicted structure confirmed a similar GST fold as found in the Y. pestis SspA homolog. Subsequently, site directed mutagenesis was performed in the heterodimer interface, where several residues were i dentified that affected the binding of quinacrine. Mutations to residues Y63 in MglA, and K97 in SspA had the greatest effect on the binding of quinacrine, as determined in the twohybrid system. These results indicate that these residues mediate the inter actions of quinacrine with the MglA/SspA complex. The elution profiles obtained from size exclusion chromatography revealed that in the presence of quinacrine MglA/SspA is still a dimer, suggesting that quinacrine may act through modifications of the conformation of the complex. This hypothesis was tested performing helices content of the proteins were modified. These results are in agreement with the high content of helices within the dimer interface region of the modeled M glA/SspA structure. Furthermore, DSC

PAGE 68

68 experiments confirm ed the binding of quinacrine to the MglA/SspA complex albeit with low affinity as determined by ITC. The location of quinacrine binding was defined in the heterodimer interface by sitedirected mutagenesis Mutation of MglA Y63 residue to alanine resulted in unaltered transition temperature in the presence of quinacrine during DSC experiments. In addition, the oligomeric state of the MglAY63A/SspA complex was similar to the wild type complex, suggesting tha t this mutation does not alter dimer formation but impairs quinacrine binding. In summary, a lthough the determined binding affinity for quinacrine was low, the results of these analyses reveal that quinacrine binds to the MglA/SspA complex, mediating a conformational change. The evidence that quinacrine is involved in specific interactions with the MglA/SspA complex, indicates that quinacrine can be used as a molecular probe to uncover effector metabolites in Francisella tularensis The putative use of quinacrine as a therapeutic agent for the treatment of tularemia however, would require further chemical engineering to improve the affinity for the MglA/SspA complex.

PAGE 69

69 Table 21. Effect of small molecules on the thermal stability of MglA or SspA Chemical Structure (C) 1 Ft MglA Arecoline hydrobromide 2.8 0.1 Carbamazepine 3.1 1.0 Diethylcarbamazine citrate 2.1 0.1 Flumequine 17.9 2.4 Haloperidol 4.6 1.7 Nabumetone 13.8 0.1 Pamoic acid 20.4 2.9 Theophylline monohydrate 2.3 0.1 Ursolic acid 16.3 3.2 The thermal stabilization of each protein was evaluated using fluorometry with an average of 40 M of ligand. 1 was calculated as the difference in the transition temperature between the proteins in the absence (MglA = 48.7 C) and presence of a given chemical. The results were averaged from duplicates.

PAGE 70

70 Table 21. Continued Chemical Structure (C) 1 Ft SspA Benzbromarone 30.0 1.6 Captopril 9.2 1.9 Dipyrone 8.9 1.5 Harmalol hydrochloride 16.6 2.6 Meclofenamic acid 22.9 4.1 Tolfenamic acid 11.6 2.7 Ft MglA and Ec SspA Ft MglA Ec SspA Benzethonium chloride 8.5 1.7 25.9 5.2 Proparacaine hydrochloride 24.5 4.4 27.9 4.3 Quinacrine dihydrochloride 2.1 0.9 15.2 1.7 Re tinoic acid 24.5 3.9 23.3 3.2 The thermal stabilization of each protein was evaluated using fluorometry with an average of 40 M of ligand. 1 Tm was calculated as the difference in the transition temperature between the proteins in the absence (Mgl A = 48.7 C; SspA = 42.4 C) and presence of a given chemical. The results were averaged from duplicates.

PAGE 71

71 Table 22. Effect of small molecules on proteinprotein interaction Chemical Structure galactosidase Activity (%)2 E. coli MIC (mM) Ft MglA Ar ecoline hydrobromide 7.8 0.9 0.1 Carbamazepine Not tested Not tested Diethylcarbamazine citrate 19.3 7.2 1.0 Flumequine 12.0 4.2 0.1 Haloperidol 18.0 3.2 0.1 Nabumetone 17.1 4.7 1.0 Pamoic acid 15.5 4.0 0.25 Theophylline mo nohydrate 6.5 2.1 0.1 Ursolic acid 16.5 1.2 1.0 The chemicals were tested in vivo using the twohybrid system at concentrations between 0.05250 M. 2 galactosidase activity (arbitrary units) as a result of pBR mglA and pACTR sspA Zif interaction is expressed as the decrease in the activity in the presence of the chemicals, compared to the control without chemicals after 180 min. The assay was perfo rmed three times, each in duplicates.

PAGE 72

72 Table 22. Continued Chemical Structure galactosida se Activity (%)2 E. coli MIC (mM) Ft SspA Benzbromarone 5.8 1.4 1.0 Captopril 16.2 3.0 1.0 Dipyrone 10.3 3.4 1.0 Harmalol hydrochloride Not te sted Not tested Meclofenamic acid 13.2 3.8 1.0 Tolfenamic acid 7.7 1.7 1.0 Ft MglA and Ec SspA Benzethonium chloride 18.9 4.8 0.05 Proparacaine hydrochloride 9.8 2.2 0.5 Quinacrine dihydrochloride 61.0 1.4 0.2 Retinoic acid 31.0 1.6 0.5 The chemicals were tested in vivo using the twohybrid system at concentrations between 0.05250 M. 2 galactosidase activity (arbitrary units) as a result of pBR mglA and pACTR sspA Zif interaction is expressed as the decrease in the activity in the presence of the chemicals, compared to the control without chemicals after 180 min. The assay was perfor med three times, each in duplicates.

PAGE 73

73 Table 23. Structural prediction of the F. tularensis MglA/SspA complex Input Peptide PDB match 1 Organism Annotation Sequence Identity (%) E value QMEAN Z score QMEAN score4 MglA 1yy7A (2.02 ) Yersinia pestis Strin gent starvation protein A 28 1.20x32 2.92 0.57 SspA 1yy7B (2.02 ) Yersinia pestis Stringent starvation protein A 32 1.40x45 2.75 0.58 1The automated template search was used.

PAGE 74

74 Figure 21. Purified transcription factors on SDS PAGE. The proteins were purified using nickel affinity chromatography. Lane 1: EZrun molecular weight marker (Fisher Scientific). Lane 2: Ft MglA ( predicted molecular weight (MW) : 24.5 kDa). Lane 3: Ft SspA ( predicted MW : 25.5 kDa). Lane 4: Ec SspA ( predicted MW : 25.5 kDa). Lane 5: Ft MglA/Ft SspA. 1 2 3 4 5

PAGE 75

75 Figure 22. Determination of the molecular weight of the Ft MglA/Ft SspA complex. The size exclusion chromatograms were used to determine the molecular weight of the Ft MglA/Ft SspA complex (blue line) and the Ft MglA monomer (green line). The i nset shows a closeup of the Ft MglA monomer elution profile. The assay was carried out using a Superose 12 10/300 GL column in a Pharmacia FPLC system according to the protocol described in materials and m ethods. The molecular weights for the Ft MglA/Ft SspA complex and Ft MglA monomer were determined to be 54.9 kDa and 26.3 kDa, respectively. The molecular weight of the eluted proteins was determined using a standard curve constructed based on the retention time of the molecular weight standards, fitted by linear regression as described in materials and methods. 26.3 kDa 26.3 kDa 54.9 kDa

PAGE 76

76 Figure 23 Quinacrine increases the thermal stability of MglA and SspA. Melting curves of purified (A) Ft MglA (B) Ec SspA and (C) Ft MglA/Ft SspA complex in a bsence or presence of increasing concentrations of quinacrine (125, 250 or radually increasing temperatures in the presence of the fluorophore SYPRO Orange. Fluorescence intensities were plotted against temperature and the transition curves were fitted using the B oltzmann equation.

PAGE 77

77 Figure 24 Transcriptional activation of the lacZ gene upon interaction of the Ft MglA and Ft SspA fusion proteins. Different combinations of empty vector s and fused proteins were transformed in the E. coli sspA ) and the galactosidase activity was determined as described in material and methods. The plasmid constructs tested were: pBR GP pACTR APZif (red square: W+Zif ), pBR mglA pACTRsspA Zif (green circle : MglA W+SspA Zif ), pBR mglA pACTRAPZif (or ange diamond: MglA W+Zif ), pBR GP pACTRsspA Zif (blue triangle: W+SspA Zif ). The galactosidase activity (expressed in arbitrary units, AU) was determined as described in material and methods.

PAGE 78

78 Figure 25 Quinacrine modifies the Ft MglA/ Ft SspA i nteraction. The plasmids constructs pBR mglA sspA Zif were transformed in the E. coli reporter strain AW23. Cells were grown in presence (open square) or galactosidase activity (ex pressed in Arbitrary units, AU). The basal AU was determined from assays performed with the empty plasmids (pACTR APZif and pBR GP ) (Figure 24) For ease of presentation, the basal AU has already been subtracted from pBR mglA and pACTR sspA Zif ac tiv ity indicates significant difference ( P <0. 05) between activity measured in the presence and absence of quinacrine.

PAGE 79

79 Figure 26 Effect of increasing concentrations of q uinacrine on the growth of F. novicida. The bacterial cells were inoculated in mo dified TSB containing increasing concentrations of quinacrine ran ging from 10 M to 250 M in duplicates and grown for 24 hours. The OD600 was recorded and the minimal inhibitory concentration ( MIC ) was determined.

PAGE 80

80 Figure 27. The addition of q uinac rine decreased the mRNA levels of the FPI genes. The t ranscript levels of iglA, iglD, pdpA, and pdpD were determined in F. novicida grown in modified tryptic broth media in presence ( grey bars) or absence ( dark grey amplification values obtained were corrected for those obtained using rpsD as internal control. The values obtained with quinacrine are relative to the ones obtained without quinacrine. P <0.01; ** P <0.0005 indicates significant differences between relative expression of cells treated and not treated with quinacrine. P >0.05 indicates no significant difference. iglA iglD pdpA pdpD uvrD *

PAGE 81

81 Figure 28. The i ntramacrophage survival of F. novicida is impaired at high quinacrine co ncentrations. (A) Infected macrophages were incubated in the presence and absence of quinacrine. Macrophages were lysed at different time points and colonies were enumerated o n CHOC II plates. Symbols: 0 M quinacrine (orange square Pre treatment of macrophages with quinacrine. Macrophages were treated with increasing concentrations of quinacrine for 30 min prior F. novicida infection. Cells were plated in CHOC II plates immediately after infection.

PAGE 82

82 Figure 29 Quinacrine decreases F. novicida intramacrophage survival. RAW264.7 macrophages were infected at a MOI of ~ 15. Cells were lysed at time 0 (dark grey bars), 4 (grey bars), and 8 (light grey bars) hours post infection. Where bacterial infection and kept throughout the experiment. For the pretreatment, The assay was performed in duplicates in three different experiments. No colonies observed. ** indicates significant difference ( P <0.0005) between the No Pre T (time 8 hr) and No Pre T +QN ( time 8 hr) groups. # indicates significant difference ( P <0.0001) between the No Pre T (time 0 hr) and Pre T (time 0 hr) groups. indicates significant difference ( P <0.05) between the Pre T (time 0 and 8 hr) and Pre T +QN (time 8 hr) groups. ** #

PAGE 83

83 Figure 210. Quinacrine does not interfere with MglA/SspA dimer formati on. Size exclusion c hromatogram of Ft MglA/Ft SspA complex in the absence (black Proteins were separated using a prepacked Superose 12 10/300 GL gel filtration column. The molecular weight of the eluted proteins was determined using a standard curve constructed based on retention time of the molecular weight standards, fitted by linear regression as described in materials and methods. 56.8 kDa

PAGE 84

84 Figure 211. Quinacrine increases the midpoi nt transition temperature of the MglA/SspA complex. DSC scans of the Ft MglA/Ft SspA complex. The effect of quinacrine on the thermal profile of the MglA/SspA complex was determined in the absence (black line) and presence of 10

PAGE 85

85 Figure 212. Quinacrine induces conformational changes in the MglA/SspA complex. Circular Dichroism (CD) spectra of the Ft MglA/Ft SspA complex The CD Tris (pH 8.0), 150 mM NaCl. The data was collected at 10 C.

PAGE 86

86 Figure 213. Quinacrine binds with low affinity to the MglA/SspA complex. Isotherm al titration calorimetric (ITC) data for the binding of quinacrine to the Ft MglA/ Ft SspA complex Measurement of heat changes (upper panel) and integrated n solution, prepared in 10 mM Tris (pH 8.0), 150 mM NaCl. Experiments were carried out at 20 C.

PAGE 87

87 A B C Figure 214. Representation of the Y. pestis SspA and the F. tularensis MglA/SspA complex structures. A) Ribbon diagram showing the Y. pestis SspA (PDB: 1YY7) dimer. B) Ribbon diagram of the predicted MglA/SspA complex. C) Superposition of Y. pestis SspA dimer, F. tularensis MglA monomer and F. tularensis SspA monomer. The in silico modeling was performed using SWISS MODEL workspace. The structure of S spA from Y. pestis (green) was used as the template to model MglA (pink) and SspA (blue). The predicted structure was analyzed using PyMol.

PAGE 88

88 A B C D Figure 21 5 Structural comparison of SspA proteins. The proteins illustrated display similar dimer confo rmation. A) Ribbon diagram of the predicted F. tularensis MglA/SspA complex (MglA colored in pink, SspA colored in blue). B) Ribbon diagram of P. putida SspA dimer (colored in orange) (PDB: 3MDK). C) Ribbon diagram of P. fluorescens SspA dimer (colored in purple) (PDB: 3LYP). D) Ribbon diagram of H. influenzae SspA dimer (colored in teal) (PDB: 3LYK).

PAGE 89

89 A B Figure 21 6 Illustration of the dimer interface and surface exposed region of the MglA/SspA complex A) Ribbon diagram and B) surface representa tion of the Ft MglA/ Ft SspA complex structure. The citric acid molecule (colored in green) is located within the dimer interface. MglA and SspA are shown in pink and blue, respectively. Surface exposed region Dimer interface Citric Acid Citric Acid Dimer interface

PAGE 90

90 A B Figure 21 7 Detail of the a mino acids located in the di mer interface of the modeled F. tularensis MglA/SspA c o mplex. A) Close up view of the MglA/SspA interface residues (shown as sticks) from MglA (yellow) and SspA (orange) within distance from the citric acid molecule (cit, green) found in the Y. pesti s SspA (PDB 1YY7). B) Surface representation of the MglA/SspA complex structure displaying the location and interaction of the interface residues (shown as spheres). MglA residues are colored in yellow, SspA residues are colored in orange, and the citric a cid (cit) is shown in green). E101 K97 D96 N51 R64 Y63 Cit E101 K97 D96 N51 R64 Y63 Cit

PAGE 91

91 Figure 21 8 Identification of critical amino acids for proteinligand interaction. A) Residues mutated in MglA: N51 (green triangle), Y63 (orange diamond), and R64 (blue circle). B) Residues mutated in SspA: D96 (purple triangle), K97 ( black diamond), E101 ( red circle). The galactosidase activity levels (expressed as Arbitrary units) from cells carrying the pBR mglA pACTRsspA Zif with the shown mutations in either mglA or sspA in the absence (closed symb galactosidase activity was determined as described in materials and methods The basal AU was determined from assays performed with the empty plasmids (pACTR APZif and pBR GP ) (Figure 2 4) Fo r ease of presentation, the basal AU has already been subtracted from pBR mglA and pACTR sspA Zif. indicates significant difference ( P <0.05) and indicates no significant difference ( P > 0.05) between activity measured in the presence and absence of quinacrine. * *

PAGE 92

92 Figure 21 9 Quinacrine does not bind the K101 residue of MglA The t ranscriptional activation of the lacZ reporter mediated by the interaction of Ft MglA and Ft SspA is impaired in the presence of quinacrine in both the wild type (WT blac k square) and the MglAK101A (blue circle) proteins. The plasmid constructs pBR mglA sspA Zif were transformed in the E. coli reporter strain AW23. Cells were grown in presence (open sq uare) or absence (closed square galactosidase activity (expressed in Arbitrary units, AU). The basal AU was determined from assays performed with the empty plasmids (pACTR APZif and pBR GP ) (Figure 24) For ease of presentation, the basal AU has already been subtracted fr om pBR mglA and pACTR sspA Zif indicates significant difference ( P <0.05) between activity measured in the presence and absence of quinacrine.

PAGE 93

93 A B Figure 220. MglA Y63 is required for quinacrine binding. A) DSC scans of the Ft MglAY63A/ Ft S spA complex. The effect of quinacrine on the thermal profile of the MglAY63A/SspA complex was determined in the absence (black line) and presence of 10 B) Size exclusion chromatogram of Ft MglAY63A/Ft SspA complex in the absence quinacrine. Proteins were separated using a prepacked Sup erose 12 10/300 GL gel filtration column. The molecular weight of the eluted proteins was determined using a standard curve constructed based on retention time of the molecular weight standards, fitted by linear regression as described in materials and met hods. 56.8 kDa

PAGE 94

94 CHAPTER 3 I NORGANIC POLYPHOSPHA TE IS THE EFFECTOR MOLECULE THAT MEDIATES THE MGLA AND SSPA INTERACTION Background Upon entry into host cell tissues pathogenic bacteria have to evade the attack launched by the immune system which is directed to el iminate i nvaders via the oxid ative burst. Microorganisms must also cope with unfavorable environmental conditions such as quick changes in pH and limited amount of essential nutrients. To adapt to these conditions pathogens alter their metabolism and induc e expression of virulence genes that promote survival. The modulation of such expression is mostly mediated by global transcriptional regulators. The activity of many transcriptional regulators is modulat ed by the amount of the alarmone ppGpp and the linear polymer inorganic polyphosphate (polyP) thus coupling pathogenesis to environmental conditions in the host (Nakanishi et al 2006, Yang et al 2010) PolyP is a linear polymer of variable length raging from ten to hundreds of orthophosphate residues linked by highenergy phosphoanhydride bonds (Kulaev & Vagabov, 1983) Most organisms encode in their genome both polyphosphate kinase 1 ( PPK1 ) and PPK2. A few exce ptions occur where they have only PPK1 or PPK2 (Zhang et al 2002) PPK is the enzyme responsible for the synthesis of polyP. The intracellular level of polyP is controlled by the activity of t he polyphosphatase (PPX) (Kuroda et al 1997) The regulatory roles of polyP in the ability to respond and resist environmental stresses have been extensively studied in E. coli (Ault Rich et al 1998, Schurig Briccio et al 2009, Crooke et al 1994) PolyP is required for the activation of the rpoS gene. In E. coli t S or RpoS specifically induces ~50 genes during the transition to stationary phase and under diverse stress conditions (Shiba et al 1997)

PAGE 95

95 Similar results have been reported in the intracellular pathogens Shigella flexneri ( S. flexneri ) and S. enterica (Kim et al 2002) In these microorganisms, Rpo S positively regulates the expression of proteins required to alleviate oxidative stress such as superox ide dismutase, peroxidases and catalases during host invasion (Schellhorn et al 1998, Patten et al 2004) A nother molecule that plays an important role during nutritional stress is the alarmone ppGpp. In Y. pestis ppGpp induces the expression of at least three effectors that are injected in the host through the type IIII secretion system (T3SS) : YopE, YopH and LcrV. These effectos have been shown to disrupt the host cell cytoskeleton, to facilitate the resistance to phagocytosis (Sory & Cornelis, 1994, Persson et al 1995) to trigger interleukin 10 (IL 10) release suppressing the proinflammatory cytokines tumor necrosis factor alpha (TNF ) and interferon gamma (IFN (Nakajima & Brubaker, 1993) Similarly, after phagocytosis, S. enterica serovar Typhimurium activates the PhoP response regulator, which in turn induces the expression of the DNA binding SylA Then, ppGpp interacts with SylA, inducing expression of the genes encoded in the Salmonella Pathogenicity Island 2 (SPI2) (Shi et al 2004, Zhao et al 2008) In F. tularensis the importance of ppGpp and polyP in virulence has been documented. The inactivation of the relA gene in F. tularensis SCHU S4 revealed that the lack of ppGpp decreased the intramacrophage replication and the virulence in mice wa s attenuated (Dean et al ., 2009) A t the transcriptional level Charity et al (2009) were first to establish a link between the presence of ppGpp and the ability of the MglA/SspA complex to interact with FevR (PigR) to control the expression of pathogenicity determinants. The authors showed that ppGpp does not affect the mRNA

PAGE 96

96 levels of MglA or SspA, nor does it affect the interaction of the MglA/SspA complex with the RNAP. It did however promote the interaction between the MglA/SspA complex and FevR (PigR), as ppGpp is required for FevR (PigR) activation (Charity et al ., 2009) The gene encoding for polyphosphate kinase ( ppk ) was identified in a screening of F. novicida proteins that were highly expressed in macrophages but not when grown in vitro (Richards et al 2008) Mutation in the ppk gene in both F. novicida and F. tularensis rendered these strains defective for intracellular survival and virulence in mice (Richards et al 2008) As a result, polyP is thought to play an important role in Francisella pathogenesis, but the mechanism is still unknown. In this chapter, the effect of ppGpp and polyP as signal molecules on the inte raction between MglA and SspA was studied. The experiments provide in vivo and in vitro evidence of t he eff ector molecule that mediates the interaction of MglA and SspA, which in turn affects the interaction of the complex with other transcription factors These proteinprotein interactions are required for the intracellular survival and virulence of Francisell a species In addi ti on, quinacrine hydrochloride was used as a chemical probe to determine that the metabolite binds in the cleft region of the dimer interface of the MglA/SspA complex. Results and Discussion In v ivo A nalysis of ppGpp on the I nteraction be tween MglA and SspA Charity et al (2009) proposed that ppGpp could control expression of MglA/SspA regulated genes by promoting the interaction of FevR (PigR) with the MglA/SspA complex However, in their experiments using a F. holarctica LVS relA spoT mutant strain no effects wer e observed on the association between the MglA/SspA complex and RNAP. Ther efore, it was hypothesized that ppGpp action on gene regulation might

PAGE 97

97 be related to the interaction surface directly between MglA and SspA T o test if ppGpp influences the interaction between MglA and SspA a new reporter strain for the twohybrid system was constructed. The relA and spoT genes were deleted in the AW18 strain sspA ) and t he resulting strain (AW20) was conjugated with the strai n KDZif Z, to obtain the reporter strain AW24 ( sspA relA spoT ) The deletion of relA and spoT genes in E. coli results in complete disappearance of ppGpp production (Xiao et al 1991) The plasmids pBR mglA sspA Zif as well as the respec tive controls were then co transformed in the AW24 strain. The interaction of Ft MglA and Ft SspA was determined by following galactosidase activity. galactosidase activities from the control strains are shown in Figure 31B, the basal arbitrary units obtained by testing the interaction with empty plasmids (pBR GP and pACTR APZif) were subtracted from those with pBR mglA and pACTR sspA Zif. Figure 3 1 A shows that the levels of galactosidase increased from 2419 156 arbitrary units in the wil d type strain (AW23) to 26384 53 arbitrary units in the AW24 reporter strain after 300 minutes of induction ( P <0.0005 ) These results suggest that the levels of ppGpp may directly or indirectly act to modulate the physical interaction of MglA and SspA I n E.coli ppGpp strains exhibit a relaxed phenotype continuing stable RNA synthesis even after exhaustion of amino acids (Stent & Brenner, 1961) Other phenotypes include no growth on m inimal media without amino acid supplementa tion, filament formation, decreased survival, virulence, and biofilm formation, decreased S32 54 function, and increased mistranslation during amino acid starvation (C ashel et al 1996, Xiao et al 1991, Nystrm, 2004, Balzer & McLean, 2002, Kvint et al 2000, Kvint et al 2003, Sze &

PAGE 98

98 Shingler, 1999, Traxler et al 2008) Since strains that lose the ability to synthetize ppGpp show many pleiotropic effects, it was hypothesized that in the AW24 strain, a physiologically relevant metabolite that mediates the SspA/MglA interaction is upregulated under these conditions. Determination of Polyphosphate (PolyP) as Mediator of the MglA and SspA Interaction Many research g roups have indicated the essential role that polyP plays on stress responses and stationary phase survival (Rao et al 1998, Li et al 2007, Schurig Briccio et al 2009) In F. tularensis polyP is required for i ntracellular growth and virulence (Richards et al 2008) galactosidase activity observed in the AW24 strain ( ) was directly related to higher intracellular concentrations of polyP. To test this hypothesis, an E. coli strain with a deletion in the ppKppX operon was constructed since in E. coli, polyP is produced by the activity of polyphosphate kinase (PPK) (Kuroda et al 1997) The ppKppX operon was deleted in the AW18 strain ( sspA ) resulting in strain AW21, which was then conjugated with the strain KDZif Z, to obtain the strain AW26 ( sspA ppKppX ) The plasmids pBR mglA sspA Zif as well as the respective controls were then cotransformed in the AW26 reporter strain The intracellular concentrations of polyP were confirmed using DAPI fluorescence. The polyP in strain AW23, while only 61.3 4.1 were quantified in AW26. The effect of polyP on the interaction of Ft MglA and Ft galactosidase activity. It was obs erved that in strain AW26, Ft MglA and Ft SspA were not able to interact, as evidenced by the reduction of galactosidase activity (Figure 32) ( P <0. 005 ) Since higher galactosidase activity

PAGE 99

99 was observed in the ppGpp deficient strain (AW24), the level o f polyP was determined. than in the AW23 reporter strain. These results suggest that in vivo, high concentrations of polyP are necessary to stabilize the interaction between Ft MglA and Ft SspA. Polyphosphate B inds with High Affinity to the MglA/SspA C omplex To determine the effect of polyP on the heterodimer, the oligomeric state was determined by gel filtration. A similar profile of dimers was observed in the chromatograms (Figure 33) in both the absence and presence (10 indicating that further addition of polyP does not affect the dimeric state of the complex. These results may also indicate that during coexpression of Ft MglA and Ft SspA, the polyP concentrations are sufficient for the formation of stabl e heterodimers. The thermal unfolding properties of the Ft MglA/Ft SspA complex in the presence of polyP was then established by DSC. The calorimetric scans (Figure 34) showed that MglA/Ft SspA complex displayed a s hift in the transition midpoint temperature indicate that polyP binds the Ft MglA/Ft SspA complex and stabilizes the interaction of the heterodimer. To determine if conformational changes occur in the Ft Mg lA/Ft SspA comp l ex upon polyP binding, CD measurements were performed. In the presence of 100 M helix content was observed. The changes were visualized as a shift in the bands at ~208 and ~220 nm in the CD spectra ( Figure 35). T he direct binding of polyP was tested in vitro by isothermal titration calorimetry (ITC). It was determined that polyP binds with high affinity ( KD Ft MglA/Ft SspA complex (Figure 3 6 ). The binding of polyP was an exerg onic reaction

PAGE 100

100 ( = 4482.2 kcal/mol) driven by favorable entropy changes ( = 4512.2 kcal/mol) and unfavorable enthalpy changes ( = 29.7 kcal/mol). Other phosphate compounds such as NaPO4, pyrophosphate or triphosphate did not bind to the Ft MglA/Ft SspA complex (data not shown). To determine if the cleft region (where quinacrine binds) is the place for polyP binding, DSC, ITC and gel filtration experiments were performed using the Ft MglAY63A/Ft SspA complex. PolyP did not modify the thermal stability of the Ft MglAY63A/Ft SspA complex and neither the heat changes in the ITC (data not shown) nor the oligomeric state (Figure 3 7) Taken together, these in vitro experiments suggest that polyP is an intracellular metabolite that modulates the Ft Mg lA/Ft Ssp A complex interactions by binding in the cleft region of the heterodimer interface. Effect of P olyP on the interaction between MglA/SspA and FevR (PigR) The putative DNA binding transcription factor FevR (PigR) was identified in F. novicida during a screen of genes requiring MglA and SspA for their expression (Brotcke & Monack, 2008) FevR (PigR) physically interact s with the MglA/SspA complex and regulates the same set of genes (Charity et al ., 2009) However, FevR (PigR) alone is not sufficient to induce the MglA/SspA regulon (Brotcke & Monack, 2008, Charity et al ., 2009) This transcription factor is essential for intramacrophage replication and virulence in the mouse model (Buchan et al 2009, Charity et al 2009, Brotcke & Monack, 2008) Thus, FevR (PigR) works in parallel with the MglA/SspA complex to activate virulence gene expression. T o study the effect of polyP in the presence of FevR (PigR) an E. coli br idge hybrid system, obtained from Charity et al (2009) was used In this system, the sspA gene from F. holarctica LVS is provided in a replicative plasmid (pCLsspA ), while the

PAGE 101

101 pigR gene of F. holarctica LVS is fused to the Zif protein (pACTR p igR Z if), and t he mglA gene of F. tularensis SCHU S4 is fused pBR mglA ) The plasmids were cotransformed into the AW23, AW24 and AW26 reporter strains and the proteinprotein interactions were determined in vivo galactosidase activity. No problems were anticipated in the use of heterologous proteins since the MglA, SspA, and PigR proteins from F. tularensis SCHU S4 and F. holarctica LVS share a 100% 99 % and 100% identity, respectively, at th e amino acid level As described by Charity et al (2009) the interac tion of PigR with the MglA/SspA complex stimulated the galactosidase reporter gene (Figure 3 8 ) In the AW23 strain, the galactosidase activity after 300 min was measured to be 1068 17 arbitrary units while in t he AW26 strain th e galactosidase activity was only 141 77 arbitrary units (Figure 3 9 ) ( P <0.001) galactosidase activity of 1299 37 arbitrary units (Figure 3 9 ) ( P > 0.0 5 ) In summary, a similar trend to the interaction between MglA and SspA was obtained. These results indicate that FevR (PigR) can interact with the MglA/SspA complex only when polyP is available to stabilize the interaction between the MglA/SspA heterodimer. The putative DNA binding trans cription factor FevR (PigR) show s homology to the large and diverse MerR family of transcription regulators. Members of this family are mainly activators in response to metal ions. They show sequence similarity at the N terminal helix turn helix DNA binding region and at the C terminal e ffector binding regions that are specific to the effector molecule. Some examples are MerR, ZntR, SoxR, CueR, PbrR, PmtR, CadR and ZccR (Summers, 1992, Brocklehurst et al 1999, Stoyanov et al 2001, Borremans et a l 2001, Noll et al 1998, Lee et al 2001, Solioz

PAGE 102

102 & Vulpe, 1996) Oth er members of the family that are larger in size are BltR, BmrR and Mta that are involved in i nduction of drug efflux systems (Pomposiello & D emple, 2001, Ahmed et al 1994, Ahmed et al 1995, Baranova et al 1999) SoxR is the only MerR member described that functions as a sensor of oxidative stress (Hidalgo et al 1995) Recently NmlR ( Neisseria M erR like Regulator) from N gonorrhoeae was shown to have a different arrangement of cysteine (Kidd et al 2005) In E. coli the sensing domain of SoxR is made of C119, C122, C124 and C130, while in NmlR th e sensing domain is made of C40, C54, C71 and C95 (Hidalgo et al ., 1995, Kidd et al ., 2005) NmlR regulates four g enes (including itself): adhC (glutathionedependent formaldehyde dehydrogenase), trxB (thioredoxin reduc tase), and copA (P type ATPase). The predicted function of the NmlR regulon is to defend the bacterial cell against carbonyl and nitrosative stress es (Kidd et al 2005, Staab et al 2008, McEwan et al 2011) In Streptococcus pneumonia, NmlR is involved in response to carbonyl stress and modulation of hydrogen peroxide production. Although it is not known how N mlR is activated it is suggested that conserved cysteine residues may be involved in thiol based signaling (Potter et al 2010) FevR (PigR) contains four cysteine residues C19, C28, C83 and C97, arranged in a similar manner as NmlR although these proteins do not share sequence identity (Figure 3 1 0). Based o n these observations, it was hypothesized that FevR (PigR) is involved in the sensing of reactive oxygen and nitric oxide species through the redox state of the cysteine residues The modifications of these residues would modify further interactions of Fev R (PigR) with the Mgl A/SspA/polyP complex to induce gene expression and survive inside the macrophages.

PAGE 103

103 Summary In this chapter, t hrough in vivo and in vitro experimentation, it was show n that inorganic polyphosphate is an effector molecule that mediates t he interaction between MglA and SspA. T he effect of the alarmone ppGpp on the MglA/SspA complex was studied and it was determined that its effect may be indirect, possibly through the modulation of polyP levels The use of the twohybrid and bridgehybrid systems confirm ed that polyP is required for the interaction of MglA and SspA. A reporter strain with a deletion in the ppK ppX galactosidase activity ( 86.8% ) in the bridgehybrid system. These findings indicate that the stabi lity of interactions of the MglA/ SspA heretoduplex allow further contact with other transcription factors such as FevR (PigR) The results obtained here are supported and explain at the molecular level a previous report by Richards et al (2008) The ir studies revealed that mutations in the FTN1472/FTT1564, a region encoding for a putative polyP kinase (PPK2), resulted in impaired intracellular growth and virulence. This phenotype was correlated with lower intracellular polyP concentrations (Rich ards et al ., 2008) P olyP binds to the MglA/SspA complex with high affinity ( KD= 300 nM). This KD value is comparable to enzymes that bind polyP with a very low Km, such as the polyP glucokinase ( Km =2.9 to 5 M) (Clark et al 1986) The affinity values obtained for the MglA/SspA complex are biologically relevant, since the concentrations of polyP required for stress survival in E. coli are as low as 0.1 mM (Rao & Kornberg, 1999) The polyP accumulated during stationary phase, however, can reach as high as 50 mM (Wood & Clark, 1988) PolyP as a signal molecule has been extensively studied in E. coli (Brown & Kornberg, 2008, Rao & Kornberg, 1999) The direct binding of polyP to proteins,

PAGE 104

104 however, was only observed in a few cases, such as the Lon protease in E.coli (Nomura et al 2004) and 80 from Helicobacter pylori ( H pylori ) (Yang et al 2010) In this stud y, it was also determined that the binding of polyP is located within the heterodimer interface of the MglA/SspA complex at specific amino acid residues such as Y63 in MglA DSC and ITC experiments using the MglAY63A/SspA complex showed impaired polyP binding. In contrast, i n H. pylori 80 polyP binds in a patch of lysines (19 residues over 59 residues) (Yang et al ., 2010) The analysis of the MglA/SspA complex interface surface area revealed several positively charged and hydrophobic residues althoug h, their relevance in polyP was not pursued in this study Also of relevance, is that the oligomeric form of the MglA/SspA heterodimer was not modified by the presence of the large polyP polymer, which can vary in size from 3 to ov er 1,000 phosphate residues (Ault Rich et al 1998) Furthermore, PolyP may play an important role during Francisella s intracellular life cycle. Once it is internalized by the host cell, F. tularensis resides within the Francisella containing phagosome, where nutrients are limited (Clemens et al ., 2005) Nevertheless, F. tularensis is cap able of surviving under this condition. PolyP stabilizes the MglA/SspA complex and allows the interaction with DNA binding transcription factors and therefore activation of genes required for uptake of nutrients, metabolism and phagosome membrane degradati on. Then, Francisella can replicate in the host cell cytosol and continue its infectious intracellular cycle.

PAGE 105

105 Figure 31. The a bsence of ppGpp increases the interaction between MglA and SspA. A) galactosidase was determined in the E. coli reporter strains AW23 ( square) and AW24 ( circle ) carrying th e pBR mglA sspA Zif. The basal level enzym e activity has been substracted. indicates significant difference ( P <0.0005) between activity measured in the A W23 and AW24 strains. B) Different combinations of empty vector s and fused proteins were transformed in the E. coli reporter strain AW2 4 The plasmid constructs tested were : pBR GP APZif (red square: W+Zi f), pBR mglA sspA Zif (green circle: MglA W+SspA Zif), pBR mglA APZif (orange diamond: MglA W+Zif), pBR GP sspA Zif (blue triangle: W+SspA Zif). The galactosidase activity (expressed in arbitrary units, AU) was determined as desc ribed in material and methods.

PAGE 106

106 Figure 32. PolyP stabilized the MglA and SspA interaction. A) Assays were performed with cells of the E. coli reporter strains AW23 ( square) and AW26 ( triangle ) carrying the pBR mglA R sspA Zif. The basal level enzym e activity has been substracted. indicates significant difference ( P <0.005) between activity measured in the A W23 and AW26 strains. B) Different combinations of empty vectors and fused proteins were transformed in the E. coli reporter strain AW26. The plasmid constructs tested were : pBR GP APZif (red square: W+Zif), pBR mglA sspA Zif (green circle: MglA W+SspA Zif), pBR mglA APZif (orange diamond: MglA W+Zif), pBR GP sspA Zif (blue triangle: W+SspA Zif). The galactosidase activity (expressed in arbi trary units, AU) was determined as described in material and methods.

PAGE 107

107 Figure 33. P olyP does not affect the dimer state of the MglA/SspA complex Chromatogram of the Ft MglA/ Ft SspA complex in the absence (black line) blueline polyP The m olecular weight was determined from a standard curve as described in materials and methods 100 l protein samples in 10 mM Tris (pH 8), 500 mM NaCl were injected onto a prepacked Superose 12 10/300 GL gel filtration col umn after incubation with polyP 56.8 kDa

PAGE 108

108 Figure 34. P olyP binds to the MglA/SspA complex. The effect of polyP on the thermal unfolding of the Ft MglA/ Ft SspA complex was determined by DSC in absence and presence of P DSC experiments were performe d in 10 mM phosphate (pH 7.9), 500 mM NaCl in the absence (black line) or with

PAGE 109

109 Figure 35. PolyP induces structural modifications on the MglA/SspA compl ex. The Circular Dichroism (CD) spectra of the Ft MglA/ Ft SspA complex indicated a ch ange of the helices content upon polyP binding. The CD spectra were line) or in presence of in 10 mM Tris (pH 8.0), 150 mM NaCl. The data was collected at 10 C

PAGE 110

110 Figure 36. PolyP binds to the MglA/SspA complex with high affinity. ITC data for the binding of polyP to the Ft MglA/ Ft SspA complex. Measurement of heat changes (upper panel) and integrated peak areas (lower panel) of a series of (MglA/SspA) protein solution, prepared in 10 mM Tris (pH 8.0), 150 mM NaCl. Experiments were carried out at 20 C.

PAGE 111

111 Figure 37 The change in the MglAY63 residue to alanine does not affect the dimer state of the MglA/Ss pA complex. Chromatogram of the Ft MglAY63A/ Ft SspA The m olecular weight was determined from a standard curve as described in materials and methods 100 l protein samples in 10 m M Tris (pH 8), 500 mM NaCl were injected onto a prepacked Superose 12 10/300 GL gel filtration column after incubation with polyP. 56.8 kDa

PAGE 112

112 Figure 38 Transcriptional activation of lacZ me diated by the interaction between PigR with the MglA/SspA complex D ifferent combinations of empty vectors and fused proteins were transformed in the E. coli reporter strains : A) AW23 sspA ), B) sspA ppKppX ), and sspA relA spoT ). The plasmid constructs tested were: pBR GP APZif+pCL sspA (red square: W+Zif+SspA), pBR mglA pigR Zif+pCL sspA (green circle: MglA W+PigR Zif+SspA), pBR mglA APZif+pCL sspA (orange diamond: MglA W+Zif+SspA), pBR GP pigR Zif+pCL sspA (blue triangle: W+PigR Zif+SspA). The galactosidase activity (expressed in arbitrary units, AU) was determined as described in material and methods.

PAGE 113

113 Figure 39 In a bsence of polyP the interaction between FevR ( PigR ), MglA and SspA is impaired Assays were performed with cells of the E. coli reporter strains AW23 ( squaresspA relA spoT circle ) and AW26 ( triangle ) carrying the pBR m glA pigR Zif+ pCL sspA The galactosidase activity (expressed in arbitrary units, AU) was determined as described in material and methods. The basal level enzyme activity has been substracted. indicates significant difference ( P <0.001) between activity measured in the AW23 and AW26 strains. ** indicates nosignificant difference ( P >0.05) between activity measured in the AW23 and AW24 strains. **

PAGE 114

114 Figure 3 10. Multiple sequence alignment of FevR (PigR) with two members of MerR family of transcri ptional regulator s. Residues conserved in all sequences (*), with a conserved substitution (:), or with a semi conserved substitution (). Abbreviations: Ec SoxR E. coli SoxR ; Ng NmlR, N. gonorrhoeae NmlR; Ft FevR, F. tularensis FevR (PigR) Arrows repres ent cysteine residues as follows: blue: Ec SoxR C119, C122, C124, C130; red: Ng NmlR C40, C54, C71, C95; black: Ft FevR C19, C29, C83, C97.

PAGE 115

115 CHAPTER 4 MATERIALS AND METHODS Chemicals, Bacterial Strains, and Culture Conditions Chemicals All analytical grade chemicals, antibiotics, RPMI 1640 media, 10 % fetal bovine serum solution, and desalted oligonucleotides (primers) were purchased from SigmaAldrich (St. Louis, MO, USA). Chemicals for buffer s preparation and culture medium, reagents, and EZrunTM Protein M arker were purchased from Fisher Scientific (Atlanta, GA, USA). Tryptic soy broth (TSB) and cysteine heart agar were purchased from Difco Laboratories (Detroit, MI, USA). The 1 % hemoglobin solution was purchased from BD Diagnostics (Sparks, MD, USA). Restr iction enzymes, T4 DNA ligase, Quick Load Taq 2X Master Mix DNA polymerase, LongAmp Taq 2X Master Mix DNA polymerase, Quick Load 100 bp molecular weight standards, Quick Load 1 kb molecular weight standards, and deoxyribonucleotide triphosphates (dNTPs ) were purchased from New England Biolabs (Ipswich, MA, USA). QuikChange site directed mutagenesis kit was purchased from Stratagene Agilent Technologies (La Jolla, CA, USA). InFusionTM Dry Down Mix was purchased from Clontech (Mountain View, CA, USA). Q IAGEN Plasmid Mini Kit, QIAquick PCR Purification Kit, and nickelnitroacetic acid resin (Ni NTA Superflow) were purchased from QIAGEN (Valencia, CA, USA). RiboPureTM Bacteria kit was purchased from Ambion (Austin, TX, USA). SuperscriptTM first strand synt hesis kit and Platinum SYBR Green qPCR SuperMix were purchased from InvitrogenTM (Carlslab, CA, USA). Molecular biology assays were performed using ultrapure water (Synergy UV Millipore Water Purification System).

PAGE 116

116 Bacterial Strain s and Growth Conditions The bacterial strains used for cloning, protein purification, twohybrid system, and bridgehybrid system are summarized in Tables 41, 4 2, 4 3 and 44. The E. coli TM, and E. coli BL21 Star(DE3) strains were purchased from Invitrogen. The E. coli BL21Rosetta(DE3) strain was purchased from Novagen (Gibbstown, NJ USA ). E. coli XL1 Blue and JM109 strains were purchased from Stratagene Agilent Technologies. E. coli FW102 strain was kindly provided by Dr. Bryce Nickels (The State University of New Jersey). E. coli strain KDZif Z was kindly provided by Dr. Simon Dove (Harvard University). The strain used to purify the E. coli His SspA (SspA ASKA) w as obtained from the ASKA library (Kitagawa, 2005) S trains DH5 XL1 Blue and JM109 were used to propagate the plasmids for protein purification, poin t mutations and twohybrid system, respectively. BL21Star(DE3) strain was used for protein over expression and subsequent protein purification of individual cloned proteins, while the BL21Rosetta(DE3) strain was used when proteins were coexpressed. The FW102 strain was used to delete the sspA gene. The KDZif Z strain was used as the donor of the F episome. E. coli strains AW23, AW24, and AW26 were used as the reporter strains for the bacterial twohybrid experiments (See DNA procedures for detailed cons truction of these strains) Wild type E. coli strains were routinely grown in LuriaBertani mediun (LB) at 37 C with agitation at 250 rpm. For protein purification of N terminally labeled His6tagged proteins, E. coli strains carrying recombinant plasmid( s) were freshly inoculated from glycerol stocks kept at 80 C into 15 ml LB medium. The medium was supplemented with ampicillin 100 g ml1 for clones in the p15TV L vector; streptomycin 50 g ml1 for

PAGE 117

117 clones in the pCDF 1b plasmid; both ampicillin 100 g ml1 and streptomycin 50 g ml1 for co expression of clones in the p15TV L and pCDF 1b vectors; and chloramphenicol 12.5 g ml1 for the SspA clone from the ASKA Library. The cells were grown for 16 hours at 37 C, 250 rpm. Then, the cells were subcultu re d (0.5 % by volume) into 2 L of LB medium and grown 30 C, 250 rpm. When the optical density at 600 nm (OD600) of D 1 thiogalactopyranoside (IPTG) was added to the final concentration of 1 mM to induce expression of the recombinant proteins. The induction was carried out for 16 hours at 17 C, 250 rpm. The cells were harvested by centrifugation and the cell mass was immediately used for protein purification or stored at 80 C until purification. To assay the galactosidase activity in the twohybrid and bridgehybrid systems, the reporter strains carrying recombinant plasmids were freshly inoculated from 80 C glycerol stocks into 5 ml of LB medium. The medium was supplemented with ampicillin 100 g ml-1, kanamycin 50 g ml1, and tetracycline 10 g ml1 for the two hybrid system, and ampicillin 100 g ml-1, kanamycin 50 g m l1, tetracycline 10 g ml1, and spectinomycin 100 g ml1, for the br idge hybrid system (See Tables 42 and 43 for details of each strain) The cells were grown for 16 hours at 37 C, 250 rpm. Then, the cells were subcultured ( to a final OD600 of 0.025 ) into 15 ml of LB medium and grown 37 C, 250 rpm for 2 hours. Lactose was added to a final concentration of 0.5 mM to i nduce expression of the recombinant proteins and assay galactosidase activity every 30 minutes. To test the toxicity of small m olecules, the twohybrid system reporter strains were freshly inoculated from glycerol stocks kept at 80 C into 5 ml of LB medium. The

PAGE 118

118 medium was supplemented with kanamycin 50 g ml1and the cells were grown for 16 hours at 37 C, 250 rpm. Then, the cel ls were subcultured ( to a final OD600 of 0.05) into 5 ml of LB medium containing increasing concentrations of chemicals ran ging from 0.01 mM to 1 mM in duplicates. The cells were grown at 37 C, 250 rpm for 8 hours. The OD600 was measured and the minimal inhibitory concentration (MIC) was determined. Growth c onditions of F. novicida s trains F tularensis subsp. novicida strain U112 ( F. novicida) was provided by Dr. Gunn (The Ohio State University). All manipulations with F. novicida were performed in a cla ss II biological safety laboratory. F novicida was routinely grown on modified tryptic soy broth (TSB) supplemented with 135 g ml1 ferric pyrophosphate and 0.1% cysteine hydrochloride at 37 C with aeration. For colony forming unit (CFU) enumeration, cy steine heart agar medium supplemented with 1% hemoglobin solution (chocolate II agar plates CHOC II) was used. To activate F. novicida cells from the glycerol stocks kept at 80 C a CHOC II plate was streaked with cells and grown at 37 C for 16 hours. A single colony was isolated and grown on 5 ml of modified TSB at 37 C with aeration (200 rpm) for 16 hours and then used for different experiments. To test the toxicity of quinacrine dihydrochloride (QN) in F. novicida cells, the cells were subculture d i nto 5 ml of modified TSB to an OD600 of 0.05 and different concentrations of quinacrine were added ( from 10 M to 25 0 M ) in duplicates and g rown for 24 hours. OD600 readings were taken and the MIC was determined. For RNA extractions, F. novicida cells wer e grown from the 80 C glycerol stock and subcultured into 5 ml of modified TSB to an OD600 of 0.05 containing 25 M QN in duplicates When the cells reached an OD600 of 0.3 (exponential phase), the cells were harvested by centrifugation and the cell mas s was use d to extract RNA.

PAGE 119

119 For CFU enumeration, F. novicida cells were inoculated into 25 ml of modified TSB to an OD600 of 0.05 and grown for 8 hours. OD600 readings were taken every hour and 100 l aliquots were serially diluted and plated onto CHOC II plates. Plates were incubated for 24 hours at 37 C prior colony counting. CFU/ ml were calculated using the following equation: CFU/ ml = Colony Number / (Vol) (Dilution Factor) Equation 4 1 Vol is the volume of cells plated in ml. For macrophage infection, F. novicida cells were grown, sub culture d into 5 ml of modified TSB to an OD600 of 0.05 and incubated for 3 hours. The cells were harvested by centrifugation and the cell mass was resuspended in 1X phosphate saline buffer (PBS) to an OD600 of 1.0 (5.2x9 CFU/ml) The cell suspen sion was use for the macrophage experiments. Preparation of Competent C ells Chemically competent cells. The following procedure was used to prepare competent E. coli W102, JM109, XL1Blue, AW23, AW2 4, and AW26 cells. A single colony was isolated from a LB agar plat e supplemented with 10 mM MgCl and inoculated into 5 ml of TyM broth (2 % trypteine, 0.5 % yeast extract, 0.58% NaCl, 0.2 % MgC l) and incubated for 2 hours at 37 C, 250 rpm. The cells were then inoculated into 300 ml TyM broth and incubated 37 C, 250 rpm until OD600 reached 0.5. The cell mass was collected through centrifugation at 3000 rpm (1600 x g) for 12 min at 4 C. The cel l s were resuspended in 120 ml of TfbI buffer (100 mM KCL, 50 mM MnCl2, 10 mM CaCl2, 30 mM potassium acetate, 15% glycerol, pH 5.8). The resuspended cells were incubated on ice for 90 min. Then, the cell mass was collected by centrifugation at 3000 rpm (160 0 xg) for 8 min at 4 C. The cells were

PAGE 120

120 resuspended in 12 ml of TfbII (10 mM MOPS. 10 mM KCl, 75 mM CaCl2, 15 % glycerol, pH 7) and stored at 80 C in 100 l aliquots until further needed. Electrocompetent cells. The cells were grown in LB medium until they reached an OD600 of 0.5 0.6. A 1 ml aliquot was washed four times using ultra pure chilled water. The pellet was resuspended in 100 l of the same water and used immediately for transformation. DNA Procedures E. coli Transformation H eat shock transformat ion was started by thawing 50 l of chemically competent cells (stored at 80 C ) on ice for 10 minutes along with the plas mids. R ecombinant plasmids ( 1 2 l ) were mixed with the competent cells. The mixture was incubated on ice for 15 min, followed by 5 m in in the 37 C water bath, and 2 min on ice. Then, 950 l of LB medium was added to the mixture and incubated for one hour at 37 C. Cells were plated on LB agar plate supplemented w ith the required antibiotic to select for the plasmids used. For electrotransformation, the plasmids or PCR products (12 l) were mixed with 30 l of cells. Transformation by electroporation was performed using a Gene Pulser Xcell (Bio Rad Hercules, CA, USA ) The pulse controller was set at 200 ohms, capacitance at 250 microfarads, and voltage at 25 kV After the pulse 970 l of LB medium was immediately added to the mixture and incubated for one hour at 37 C. Cells were plated as previously described. Cloning of mglA and sspA G enes for Protein Purification The mglA and sspA genes of F. tularensis S C HU S4 were amplified by PCR using genomic DNA provided by Dr. Tara Wherly (Rocky Mountain Labs/NIAID/NIH). The

PAGE 121

121 DNA amplification was done using Taq 2 X master mix DNA polymerase. DNA amplification by PCR was performed using a MyCyc lerTM Personal Thermal Cycler (BioRa d ). Two plasmids were used for protein overexpression, p15TV L and pCDF 1b. Plasmid p15TV L (Figure 41) contains the bla (ampicillin resistance) gene, which serves as a selectable marker. Using this vector only recom binant clones should be obtained since it contains the sacB gene, which encodes levansucrase. This enzyme catalyzes hydrolysis of sucrose and synthesis of levans. In E. coli expression of sacB in the presence of sucrose is lethal. Thus, the growth of E. c oli transformed with p15TV L will be inhibited when grown in LB medium supplemented with 5% sucrose Additionally, l igation independent cloning (LIC) sequences are located on the flanking regions of the sacB gene. Primers with the complementary LIC sequenc e at the 5 end were used during the amplification of the genes of interest. The cloning of the PCR fragments int o p15TV L plasmid was done by recombination in the LIC sequence using InFusionTM Dry Down Mix (Clontech, Mountain View, CA, USA) (Pagliai et al ., 2010) Each infusion pellet was resuspended in 8.5 l of p15TV L pl asmid (75 ng l1) Then, 0.5 l (~ 1 g l1) of PCR fragment was mixed with 2 l of the plasmid suspension to initiate DNA recombination. The mixture was incubated at room temperature for 30 min. After the transformation using chemically competent cells, LB agar plates containing 5 % sucrose and 100 g ml1 ampicillin were used for positive selection. The cloned gene resulted in the fusion of a His6tag at the N terminus followed by a TEV protease cleavage site. Transcription of the cl oned gene was induced with IPTG.

PAGE 122

122 The p lasmid pCDF 1b (Figure 42) contains the aadA (streptomycin resistance) gene, which serves as a selectable marker. Additionally, pCDF 1b carries the CloDF13 origin of replication, which makes it compatible for coexpression with the p15TV L (ColE1 replicon) for purification of protein complexes. The multiple cloning sites (MCS) provide a variety of rest riction sites that can be used to obtain a His6tagged protein at the N terminus followed by an enterokinase (EK) cleavage site. Primers wit h BamHI and NotI restriction site at 5 end were used to amplify by PCR the sspA gene of F. tularensis SHU S4. The primers used are listed in Table 45. The insert and plasmid were prepared by restriction digestion in separate reactions by adding 46 l of insert (71 ng l1) or plasmid (38 ng l1) 6 l of 10X BSA, 6 l of 10X NEB Buffer 3 and 1 l of each enzyme, BamHI (20 units l1) and NotI (10 units l1) The plasmid reaction was incubated at 37 C for 2 hours, while the insert reaction was incubated for 3 hours. After incubation, each reaction was confirmed cut by DNA electrophoresis and purified using QIAquick PCR Purification Kit (QIAGEN) The PCR fragment was then ligated to the pCDF 1b vector using the T4 DNA ligase in the following reaction: 9 l of insert (42 ng l1) 3 l of plasmid ( 25 ng l1) 2 l of T4 ligase buffer and 1 l of T4 DNA ligase were mixed and incubated at 16 C for 16 hours. The ligation reaction was transformed by heat shock into competent E. coli B agar containing 50 g ml1 streptomycin. Colony PCR was used to screen for recombinant clones in both p15TV L and pCDF 1b plasmids C olonies (510) were resuspended in 50 l of sterile water and 7.5 l of the cell suspension was used in a PCR reaction containing Taq 2X master mix DNA polymerase and T7 primers (Table 45) Colonies with the correct fragment size

PAGE 123

123 were grown overnight for plasmid extraction using the QIAGEN Plasmid Mini Kit. The sequences of the clones were confirmed by sequencing using T7 u niversal primers (DNA L ab, Arizona State University) The plasmids with the correct inserts were further transformed into the protein expression strains as follows: t he p15TV mglA and p15TV sspA plasmids were introduced in to E. coli BL21 Star cells. T he E. coli BL21Rosetta strain was used to transform the pCDF sspA plasmid and cotransform the p15TV mgl A and pCDF sspA plasmids E. coli BL21 Rosetta cells were used in this case since it is streptomycin sensitive The strains and plasmids used are summarized in Table 41. Bacterial Two Hybrid System The system described here is based on the findings that any strong interaction between two proteins can induce transcription of a reporter gebne in E. coli provided that one protein is tethered to the DNA by a DNA binding domain and the other is tethered to a subunit of the RNA polymerase (RNAP) (Dove & Hochschild, 2004) The p lasmid pBRGP ynthesis of the Ga11P ampicillin resistance, and carries a ColE1 origin of replication. This plasmid can be use d to create fusions to the N E. coli RNAP. Fusions are made through a small linker made of three alanine residues specified in part by the NotI restriction site. In the plasmid pACTR APZif the zinc finger DNA binding domain of the murine Zif268 protein (Zif) is present it confers tetracycline resistance, and harbors the p15A origin of replication. This plasmid is use d to create fusions to the N terminus of the Zif protein t h rough a nine amino acid linker (AlaAla Ala Pro Arg Val Arg Thr Gly) specified in part by the NotI restriction site. Both plasmids have the IPTG inducible promoter lac UV5 t hat drives the expression of the fusion proteins (Charity et al ., 2007) Both plasmids were kindly provided by Dr. Dove (Harvard University).

PAGE 124

124 Primers with t he NdeI and NotI restriction sites at the 5 end were used to amplify the mglA and sspA genes of F. tularensis S C HU S4 from the genomic DNA. The p rimers used are listed in Table 46 The plasmids and inserts were prepared by restriction digestion in separate reactions by adding 47 l of insert ( 84 ng l1) or plasmid ( 37 ng l1) 6 l of 10X BSA, 6 l of 10X NEB Buffer 3 and 1 l of NotI (10 units l1) The plasmid reaction was incubated at 37 C for 2 hours, while the insert reaction was incubated for 3 hours. After incubation, each reaction was purified using QIAquick PCR Purification Kit (QIAGEN) A second reaction was carried out that included 53 l of insert ( 47 ng l1) or plasmid (25 ng l1) 6 l of 10X NEB Buffer 4 and 1 l of NdeI (20 units l1) The reactions were incubated for their respective times at 37 C and purified. Cloning of the PCR fragments into the plasmids was done by ligation as previously described. As a result, t he mglA gene was fused to the subunit of the RNAP in the pBR GP plasmid, while the sspA gene was fused to the Zif protein in the pACTR APZif plasmid. Because the plasmids used here contain the lac UV5 promoter, they were propagated in strains that contain lacIq. Then, recombinant clones were transformed by heat shock in chemically competent E. coli JM109 cells and plated in LB agar containing ampicillin 100 g ml1 or tetracycline 10 g ml1. Recombinant plasmids were screened by colony PCR and confirmed by sequencing. The plasmids with the correct clone were co transf ormed into the different reporter strains for detection of proteinprotein interactions in vivo (Figure 43). Refer to Table 42 for a complete list of the strains transformed and plasmid combinations used including the respective controls.

PAGE 125

125 Bacterial Brid ge Hybrid System Similarly to the two hybrid system previously described, the bridgehybrid system was use d to detect protein protein interactions. In this system, one protein is fused to E. coli RNAP, a second protein is fused to the Zif protein, and a third protein is expressed from a replicating modified pCL1920 plasmid (Charity et al ., 2009) Plasmids pCL sspA ( from strain F. holarctica LVS) and pACTR pigR Zif ( F. holarctica LVS) were provided by Dr. Simon Dove (Harvard University ). Plasmid pCLsspA confers resistance to spectinomycin, harbors the pSC101 origin of replication, and the lac UV5 promoter. The addition of IPTG induces the synthesis of F. holarctica LVS SspA protein. In the p lasmid pACTR pigR Zif ( from strain F. holarcti ca LVS) the pigR gene is fused to the Zif protein. The pBR mglA hybrid system and it direct synthesis of F. tularensis SCHU S4 MglA protein fused to the subunit In this system, SspA interact s complex. T he t ranscription of the repo rter gene is induced when the PigR Zif fusion makes contact with the MglA/SspA complex (Figure 44). The plasmids were cotransformed into the different reporter strains for detection of proteinprotein interactions in vivo Table 43 summarizes the strains that were transformed with the bridgehybrid system plasmids. Construction of Reporter Strains for the Bacterial Hybrid Systems Generation of the sspA relA spoT and p pK and ppX knockout mutants Since E. coli encodes a copy of the sspA gene in its chro mosome, the reporter strain obtained from Dr Simon Doves laboratory (Charity et al ., 2007) was modified by deleting the sspA gene to avoid unspecific interaction s. The E. coli FW102 strain was used to delete the sspA resulting in the AW18 strain ( ). This strain

PAGE 126

126 was used to delete the relA gene to obtain AW19 ( ), which was then used to delete the spoT gene, resulting in the AW20 st rain ( ). To construct the AW21 strain, AW18 ( ) was used to disrupt the ppKppX operon, resulting in the AW21 strain ( The deletion mutants of E. coli genes were generated by the method described by Datsenko and Wanner (2000) Descriptions of the plasmids and strains us ed in this protocol are summarized in Table 44. The kanamycin cassette was amplified by PCR from the pKD4 plasmid by using specific primers for the sspA relA and spoT genes, and the ppKppX operon (Table 46 ). These primers included 50 bp homology extensi on and 20 bp priming sequences for the pKD4 plasmid. The PCR product s were treated with DpnI purified and used to transform ( by electroporation) the following E. coli strain s containing the pKD46 plasmid: FW102 (for sspA ), AW18 (for relA and ppKppX ), and AW19 (for spoT ). The pKD46 plasmid expresses the R ed system under the control of an arabinose inducible promoter, and it has temperature sensitive origin of replication (over 30 C ) Electrocompetent cells wer e prepared as described earlier, with the exception that they were grown at 30 C on LB medium containing 1 mM arabinose t o induce the recombination proteins The purified PCR fragments were combined with competent cells, pulsed and 0.9 ml of SOC media was added. The cells were incubated at 37 C for 2 hours. Cells were plated on LB agar plat es containing 25 g ml1 kanamycin. The insertion of the recombinant cassette was confirmed by colony PCR using a set of primers complementary to a region upstream and downstream of each target gene (Table 46) The plasmid pKD46 was eliminated during the incubation of the cells at 37 C. The mutagenesis process was completed by removing the kanamycin

PAGE 127

127 cassette using the helper plasmid, pCP20. This plasmid shows temperaturesensitive origin of replication (over 30 C ) and encodes the flippase recombination enzyme (FLP). The pCP20 plasmid was used to transform ( by electroporation) the mutant strains. Ampicillin resistant clone s were selected from LB agar plates grown at 30 C overnight A few colonies were grown on LB medium nonselectively at 43 C for 5 hours after which they streaked on LB plates for isolation and grown overnight at the same temperature. The colonies were tested for loss of kanamycin and ampicillin resistance on liquid medium A ll the mutations were confirmed by PCR with specific primers com plementary to a region upstream and downstream of each mutated gene ( Table 46 ) Genetic transfer of the F episome by c onjugation The reporter strain KDZif1 Z harbors an F episome containing the kanamycin resistance gene, and the lac promoter derivative p lac Zif1 61, driving expression of a linked lacZ reporter gene (Charity et al ., 2007) KDZif1 Z was used as donor for conjug ation of the recombinant F epis ome into the strains AW18, AW20 and AW21 resulting in the reporter strains AW23, AW24 and AW26, respectively. The conjugation procedures were modified from previously described by Whipple (1998) as follows: The recipient strain was inoculated on LB medium supplemented with 100 g ml1 streptomycin and the donor strain was inoculated on LB medium supplemented with 100 g ml1 kanamycin. Both were grown at 37 C, 250 rpm for 16 hours. The strains were subcultured (1% by volume) into 5 ml of LB medium without supplementation of antibiotics. The recipient strain was grown at 37 C, 250 rpm for 3 hours, while the donor strain was grown at 37 C without shaking for 3 hours. Then, 1 ml of each culture were mixed together and incubated at 37 C without shaking for 30 min. The cells were

PAGE 128

128 serially diluted and 100 l was plated onto LB agar plates supplemented with 100 g ml1 streptomycin and 50 g ml1 kanamycin. Only cells that acquired the F episome will grow in the presence of these antibiotics. Colony PCR was used to confirm the chromosomal inactivation of the sspA relA spoT genes and the ppKppX operon in the conjugated strains Primers annealing to regions outside each target gene were used to amplify the small fragment of the mutated gene. The primers used are listed in Table 46 The strains AW23, AW24, and AW26 were used as the reporter s and transform ed with the plasmids for the bacterial twohybrid and bridgehybrid systems experiments as summarized in Tables 42 and 43. Site Directed Mutagenesis The p15TV mglA pBR mglA sspA Zif clones were used as the wild type plasmids for site directed mutagenesis experiments The 39 nucleotide long complementary primers containing the desired mutation were used to introduce individual mutations. The primers used are list ed in Table 47. The amino acids selected for mutagenesis were replaced by alanine due to its small, simple chemical structure (alanine scanning). The inert alanine methyl functional group would not introduce further interactions within the protein. The mutants were constructed by PCR using the PfuTurbo DNA polymerase contained in the QuikChange site directed mutagenesis kit (Stratagene Agilent Technologies) according to the manufacturers protocol. The PCR amplified plasmids were then treated with 10 unit s of DpnI restriction enzyme at 37 C for 1 hour ( twice ) to digest the methylated wildtype plasmid template. The recombinant plasmids were transformed into E. coli XL1 Blue cells. The incorporation of the desired mutation was confirmed by DNA sequencing ( DNA, Lab, Arizona State University).

PAGE 129

129 DNA Gel Electrophoresis DNA was separated by gel electrophoresis using 1% weight to volume (w / v) agarose gel in 1X TAE electrophoresis buffer [ 40 mM tris(hydroxymethyl)aminomethane (Tris) acetate pH 8.5, 2 mM ethylenediaminetetraacetic acid (EDTA) ] Gels images were capture d using ImageQuant 400 imaging system (GE Healthcare, Sweden) after staining with 0.5 g ml1 ethidium bromide. Protein Procedures Protein Purification and Quantification The collected cells mass was resuspended in 30 ml of binding buffer (5 mM imidazole, 500 mM NaCl, 50 m M Tris pH 8.0, 5% glycerol). The cell suspension was treated with the protease inhibitor phenylmethylsulfonyl fluoride (PMSF) to a final concentration of 1 mM and then disrupted by F rench Press at a pressure of 10 000 psi. The cell free extract was collected by centrifugation at 4 C, 17500 rpm for 25 min. The soluble His6tagged proteins were purified by affinity chromatography at 25 C as follows : the Ni NTA column was first washed w ith 30 ml of ultrapure water to remove any unbound nickel ions. It was then preequilibrated with 30 ml of binding buffer. The cell free extract was applied to the column. During this step, the His6tagged proteins were bound to nickel ions that were immobilized by NTA. T he resin was washed with 30 ml of binding buffer Then, 200 ml of wash buffer (15 mM imidazole, 500 mM NaCl, 50 mM Tris pH 8.0, 5% glycerol), which contains a higher concentration of imidazole, was used remove unspecific proteins that were bound to the resin. Imidazole is a competitive molecule that displaces the nickel ions bound to His6tagged protein. The His6tagged proteins were eluted using 15 ml elution buffer (250 mM imidazole, 500 mM NaCl, 50 mM Tris pH 8.0, 5 % glycerol). The purif ied proteins were dialyzed at 4 C for

PAGE 130

130 16 hours. The dialysis buffer was composed of 50 mM Tris pH 8.0, 500 mM NaCl, and 2.5 % glycerol. After dialysis, protein concentration was quantified using Bradford reagent (Bradford, 1976) The calibration of Bradford reagent was done using bovine serum albumin as a standard. Absorbance at 595 nm (A595) was determined using UV01700 PharmaSpec U C VIS Spectrophotometer (Shimadzu, Portland, Oregon, US ). The proteins were aliquoted, flash frozen and preserved at 80 C until needed. Sodium D odecyl S ulfate Polyacrylamide Gel Electrophoresis (SDS PAGE) SDS PAGE was used to determine the purity of prot eins after purification. The gels prepared as follows. The r unning gel contained: 12.5% 30/ 8 % ( w/ v) acrylamide/bis acrylamide, 0.37 M Tris HCL pH 8.8, 0.1% (w/ v) SDS, 0.05% (w/ v) ammonium persulfate (APS), 0.2 % (v/ v) tetramethylethylenediamine (TEMED). The stacking gel contained: 4% 30/8% ( w/v) acrylamide/bis acrylamide, 0. 20 M Tris HCL pH 6.8, 0.2 % (w/ v) SDS, 0.1 % (w/ v) APS, 0.2 % (v / v) TEMED Proteins samples were mixed with 1 X loading dye ( 6X = 100 mM Tris HCL pH 6.8, 2% (w/ v) SDS, 10 % (v /v) glycerol, 10% (v/ 1 bromophenol blue). The samples were boiled at 95 C for 5 min prior loading to the gel. Electrophoresis was performed at 120 V for 65 70 min in buffer composed of 25 mM Tris buffer, 192 mM glycine, and 0.1% SDS. Gels were stained with Coomassi e Blue (PhastGel Blue R 350 ) for two hours and destained for 5 hours in destaining solution (50% water, 40 % ethanol, 10 % acetic acid). I mages were capture d using HP Scanjet G3010 Scanner (Hewlett Packard). Small Molecules Scr eening by Differential Scanning Fluorometry (DSF) An iCycler, IQ device (Bio Rad) was used to monitor the unfolding of the proteins by the increase in fluorescence of the fluorophore SYPRO Orange (Invitrogen). Before performing the screening of the chemica l library, the thermal melting conditions were

PAGE 131

131 established to determine the protein concentration required to generate a signal. Purified F. tularensis MglA, E. coli SspA, and F. tularensis MglA/SspA complex proteins were screened against The Prestwick Chemical Library of 1152 compounds (Prestwick Chemical, France) at a final concentration of 20 g ml1. The MglA and E. coli SspA protein samples were prepared in 100 mM Hepes pH 7.5, 150 mM NaCl buffer, while the MglA/SspA complex was prepared in 50 mM Tris pH 8.0, 150 mM NaCl. The proteins were thawed from 80 C and 25 l (20 M) was added to each well containing the chemical compound. The reactions were carried out (in duplicate) in 96well microplates (Bio Rad) and heated from 25 to 80 C at the rate of 1 C m1. Fluorescence intensities were plotted against temperature for each sample and transition curves were fitted with the Boltzmann equation using Origin 8 software (Northampton, MA, USA). The midpoint of each transition curve was calculated and compa red to the midpoint calculated for the reference sample. If the difference bet ween them was greater than 2.0 C, the corresponding compound was considered to be a hit and the experiment was repeated to confirm the effect in a dosedependent manner with c oncentrations raging from 1 to 0.003 mM. Determination of Protein Oligomeric State using Size Exclusion Chromatography The native molecular weight of the studied proteins was determined by size exclusion chromatography These studies were performed in coll aboration with Chris Gardner from Dr. Lorca Lab. The assays were performed in a LCC 501 Plus FPLC System (Pharmacia Biotech, Piscataway, NJ, USA) with a prepacked Superose 12 10/300 GL column (GE Healthcare). Filtration was carried out at 4 C, using a flow rate of 0.5 ml min1. The eluted proteins were monitored continuously for absorbance at 280 nm using a UV M II monitor. Data was analyzed using FPLCdirectorTM (Pharmacia

PAGE 132

132 Biotech). The mobile phase was composed of 10 mM Tris pH 8.0 and 500 mM NaCl. The pr otein samples (100 l) consisted of 20 M of MglA, 24 M MglA/SspA or 30 M MglAY63A/SspA complexes. Where indicated, 10 and 100 M quinacrine or 100 M polyphosphate (polyP) prepared in 10 mM Tris pH 8.0, 500 mM NaCl were incubated with the proteins sampl es for 30 minutes on ice prior injection onto the column. The molecular weight of the eluted proteins was determined using a standard curve constructed based on retention time of the molecular weight standard, fitted by linear regression. Immunoglobin G (150 kDa), BSA (66 kDa), albumin (45 kDa), trypsinogen (24 kDa), cytochrome C (12.4 kDa), and vitamin B12 (1.36 kDa) were used as molecular weight standards. Blue dextran 2000 was used to determine the void volume of the column. Thermal Unfolding Properties of the MglA/SspA Complex using Differential Scanning Calorimetry (DSC) DSC studies were performed in collaboration with Chris Gardner from Dr. Lorca Lab. DSC measurements were carried using a MicroCal VP DSC differential scanning microcalorimeter (MicroCal LLC, Northampton, MA). The proteins samples (16.7 M MglA/SspA and 22.0 M MglAY63A/SspA complexes) were thawed from 80 C and extensively redialyzed against a buffer with 10 mM phosphate pH 7.9, 500 mM NaCl. Quinacrine and polyphosphate solutions were prepared in dialysis buffer. Prior to loading, all samples were degassed for 30 min at 4 C using a ThermoVac degassing station (MicroCal). Fresh dialysis buffer was used in the reference cell. Samples treated with quinacrine (10 or 100 M) or polyphosphat e (100 M) were incubated at 4 C for 30 min, prior to DSC analysis. Quinacrine or polyphosphate were also added to the reference buffer at equal concentrations. A scan rate of 45 C h1 was used for all

PAGE 133

133 experiments, with constant pressure (25 psi) applied to both cells throughout each run. Buffer scans, recorded in the presence or absence of quinacrine or polyphosphate were subtracted from the corresponding thermograms before analysis. Data was analyzed using the Origin software supplied by the manufactur er (MicroCal). Curves were fit to the data using the nontwo state transition model Analysis of Protein Secondary Structure by Circular Dichroism (CD) CD studies were performed in collaboration with Chris Gardner from Dr. Lorca Lab. The UV CD spectra (180300 nm) were recorded on a Circular Dichroism Spectrometer Model 400 (Biomedical, Inc. Lakewood, NJ) with 0.1 cm quartz cuvette a t 10 C.The MglA/SspA protein complex sample was thawed from 80 C and redialyzed against 10 mM Tris pH 8.0, 150 mM NaCl dur ing 16 hours. After dialysis, samples were adjusted to 9.6 M in the same buffer. Samples treated with quinacrine (0.001, 0.1 or 100 M) or polyphosphate (100 M) were incubated at 4 C for 30 min, prior to analysis. A 1 mm path length cell was used for the measurement, and parameters were set as follows: bandwidth, 1 nm; step resolution, 1 nm; scan speed, 50 nm min1; response time, 1 s. Each spectrum was obtained from an average of 10 scans. Spectra were recorded every 9 min after equilibration. All spect ra were corrected by subtracting buffer (with or without corresponding quinacrine or polyphosphate concentrations). The final spectra was expressed in molar ellipticity (ME) using the following equation: quation 42 protein, and l is the pathlength of the cuvette.

PAGE 134

134 B inding of Small Molecules using Isothermal Titration Calorimetry (ITC) ITC studies were performed in collaboration with Chris Gardner from Dr. Lorca Lab. ITC measurements were performed on a VP Microcalorimeter (MicroCa l, Northampton, MA, USA) at 18 C or 20 C MglA/SspA and 22.0 M MglAY63A/SspA complexes) were thawed from 80 C and thoroughly redialyzed against 10 mM Tris pH 8.0, 150 mM NaCl during 16 hours. Solutions of quinacrine and polyphosphate were directly prepared in dialysis buffer. Each titration involved a series of 1 0 l injections of quinacrine (2 mM) or 5 l injections of polyphosphate (100 M) into the protein solution. The mean enthalpies measured from injection of the ligand into the buffer were subtracted from raw titration data before data analysis with ORIGIN software (MicroCal). Titration curves w ere fitted by a nonlinear least squares method to a function for the binding of a ligand to a macromolecule (Wiseman et al 1989) From the curve thus fitted, the parameters H (reaction enthalpy), KA (binding constant, KA = 1/ KD ), and n (reaction stoichiometry) were determined. From the values of KA and H the changes in free energy (G ) and in entropy (S ) were calculated with the equation: = RT ln KA = Equation 43 R is the universal molar gas constant and T is the absolute temperature Francisella novicida Experiments RNA Isolation and Quantitative RTPCR F. novicida cells were grown in the prese nce (25 M) and absence of quinacrine and the cells mass was harvested by centrifugation at 8000 rpm for 5 min. Total RNA was isolated using RiboPureTM Bacteria kit (Ambion) in accordance with the

PAGE 135

135 manufacturer's protocol. RNA concentration was measured usi ng a ND 1000 Spectrophotometer nanodrop (ThermoScientific, DE, USA). RNA was normalized to 2.7 g. cDNAs were synthesized with the SuperscriptTM first strand synthesis kit (Invitrogen) in accordance with the manufacturer's recommended protocol and stored at 80 C until needed. Quantitative RT PCR (qRT PCR) was carried out in the iCycler, IQ device (BioRad) using Platinum SYBR Green qPCR SuperMix for iCycler (Invitrogen) in accordance with the manufacturer's recommended protocol. Internal primers for the genes of interest were designed to measure the transcript levels as listed in Table 48. The genes encoded inside the FPI ( iglA iglD, pdpA and pdpD ) and genes not regulated by the MglA/SspA transcriptional regulators ( gyrA ) were then quantified. The rpsD gene was used as the internal control. Intracellular Growth Assays Macrophage c ell line growth c onditions The mouse macrophage cell line RAW264.7 was kindly provided by Dr. Kima (University of Florida). This cell line was used since Francisella infects p rimarily phagocytes in the host. Cells were routinely cultured in RPMI 1640 medium complemented with 10 % heat inactivated fetal bovine serum and 1% streptomycin/penicillin solution (Sigma). The cells were maintained at 37 C in a humidified incubator containing 5% CO2 in 75 cm2 tissue culture flasks (Cellstar Brand, VWR, West Chester, PA, USA) and subcultured every 2 to 3 days. Before subculturing the monolayer was examined under an IN200A trinocular inverted microscope (American Scope, Irvine, CA, USA) f or homogeneity, cell morphology, and

PAGE 136

136 contamination. Subcultures were prepared by removing the culture medium from the flask with a sterile Pasteur pipette to eliminate dislodged (death) cells. Then, 2 ml of pre warmed complete medium was added to the monol ayer, and scrapped to d etach cells. The culture was checked in the microscope to verify the detachment from the surface. 1 ml of cell suspension was drawn and added to a new fl ask containing 9 ml of complete medium. The flask was placed in the CO2 incubator at 37 C. The viability of the macrophages was determined by Trypan blue staining as follows: 50 l of cells suspension was mixed with 50 l of 0.4% of trypan blue dye and incubated at 25 C for 10 min. 10 l was then placed in each side of the hemacytom eter slide grid (Hausser Scientific, Horsham, PA, USA). The cells that were able to release the dye shown as clear were counted under a BX41 Compound light microscope (Olympus, Center Valley, PA, USA). The number of cells was calculated using the following equation: CFU/ ml = [ (N / 4) / (Dilution Factor)(104) ] Equation 44 N is the total number of cells. To test the toxicity of quinacrine in the macrophage cell line, cells were harvested from a 75 cm2 tissue culture flask and 2.5 X 105 cells /w ell were plated in 1 ml of medium in three 24well flat bottom tissue culture plates (Costar Brand) and allowed to adhere for 24 hours. Then, the medium was replaced with fresh medium containing quinacrine with concentrations raging from 0.5 to 100 M Eac h concentration was done in triplicate. Plates were incubated for 0, 4 and 8 hours and the number of viable cells was estimated by Trypan blue staining as previously described.

PAGE 137

137 Infection a ssays RAW 264.7 macrophages were seeded into 24well flat bottom tis sue culture plates at 2.5 X 105 cells / well in complete medium. The plates were incubated at 37 C, in a 5 % CO2 atmosphere for 24 hours. F. novicida was grown for 3 hours in 5 ml of modified TSB at 37 C with aeration. The cells were harvested by centrifugation and the cell mass was resuspended in 1X PBS to an OD600 of 1.0 (~ 109 CFU / ml). Monolayers were infected with F. novicida at a multiplicity of infection (MOI) of 15:1. The plates were centrifuged at 800 X g for 15 min to facilitate infection and incubated for 2 h at 37 C After two hours of infection, monolayers were washed and treated with fresh media ml1) for 30 min to remove extracellular bacteria. Cells were washed twice with 1X PBS and replenished with fresh media c ontaining ml1). The assay was divided into 4 groups (three wells per group) : 1) Pre treatment: macrophages were pretreated with 25 M quinacrine for 30 min prior to infection. 2) Pretreatment + QN: macrophages were both pretreated wit h 25 M quinacrine for 30 min prior to infection and 25 M qu inacrine after infection and kep t through the rest of the experiment. 3) No pretreatment: quinacrine was not added during the experiment. 4) No pretreatment + QN: 25 M quinacrine was only added after infection. The cells were incubated for 0, 4, and 8 hours after infection and lysed with 0.01% sodium deoxycholate in 1X PBS. The ly sates were serially diluted and plated onto CHOC II plates for determination of viable counts. Plates were incubated at 37 C for 24 hours prior to colony counting. Experiments were performed in triplicate.

PAGE 138

138 Enzymatic Assays galactosidase A ctivity The reporter strains carrying the twohybrid or the bridgehybrid plasmids were inoculated in 15 ml of LB medium and grown 37 C, 250 rpm for 2 hours. Then, l actose (0.5 mM) was added to induce expression of the recombinant proteins. Samples were drawn every 30 min for 300 min and t he OD600 was measured galactosidase activity, at each time point, 40 l of cell culture w as permeabilized with 6 l of 0.15% SDS, 6 l of 1.5% chloroform, and 448 l of Z buffer (60 mM Na2HPO47H2O, 40 mM NaH2PO4H2O, 10 mM KCl, 1 mM MgSO4, 50 mM ME). Then, 100 l of permeabilized cells was added to 200 l of Z buffer with 6 l of the substrate in a 96 well microplate galactosidase activity was assayed by following the catalytic hydrolysis of the chlorophenol red D galactopyranoside (CRPG) substrate. The absorbance at 570 nm was read continuously every 30 seconds for 10 min at 37 C using a Synergy HT 96well plate reader (BioTek Instruments Inc., Winooski, VT, USA). Assays were performed in galactosidase activity is expressed in arbitrary units (AU), and it was calculated using the following equation: Arbitrary Units = [ m / (OD600)(Vol)] x 1000 Equation 45 m is the slope of the linear curve, OD600 is the optical density at 600 nm of the culture, and Vol is the volume of cells used in the assay in ml (accounted for cell dilutions). Polyphospha te Measurements P o lyphosphate (polyP) was quantified using DAPI (4,6diamidino2 phenylindole) as previously described (Schurig Briccio et al ., 2009) PolyP concentration was measured from strains AW23, AW24, and AW26. One ml of cell culture was taken

PAGE 139

139 during late exponential phase and harvested by centrifugation. The cell mass was washed twice with 100 mM Tris HCl pH 7.5 buffer and diluted to an OD600 of 0.02. DAPI incubation at 37 C with agitation for 5 min, the samples were loaded to a 96well fluorescence plate (ThermoScientific), and the DAPI fluorescence spectra (exci tation, 420 nm; emission, 445 nm) was recorded in a Synergy HT 96well plate reader (BioTek Instruments Inc). The fluorescence was normalized to the optical density of the cells. A standard curve using sodium polyphosphate was used to calculate the concen tration of polyP in the cell samples. Bioinformatics Sequence Analysis All DNA and amino acid sequences were retrieved from the National Center for Biotechnology Information (NCBI) Database. The SspA h omologs were identified by BLAST P search ( Altschul et al 1997) Multiple sequence alignments were performed using CLUSTAL X2 (Larkin et al 2007) Accession number, locus tag, and gene identification numbers used for the figures are listed below. Gene identification numbers for Figure 13 (Multiple sequence alignment of selected SspA orthologs) are as follows: Ec: E. coli, stringent starvation protein A, GI# 856760 22; Yp: Y. pestis stringent starvation protein A, GI# 61680863; Vc: V. cholerae, stringent starvation protein A GI# 15640598; Pa: P. aeruginosa, stringent starvation protein A, GI# 15599624; Ng: N. gonorrhoeae, regulator of pilE expression, GI# 59802427; FtS: F. tularensis SCHU S4, stringent starvation protein A, GI# 56707600; FtM: F. tularensis SCHU S4, macrophage growth locus A, GI# 56708335.

PAGE 140

140 Accessi on number locus tag and gene symbol for Figure 14 (Genomic context of SspA orthologs) are as follows: E. coli: AP_003773 rplM; AP_003772, rpsI ; AP_003771, sspA ; AP_003770, sspB ; AP_003769, dcuD Y. pestis : NP_667477, y01 34, rplM; NP_667476, y0133, rpsI ; NP_667475, y0132 sspA ; NP_667474, y0131 sspB ; NP_667473, y013 0 V. cholerae : NP_230226 VC0575; NP_230227, VC0576 sspA ; NP_230228, VC0577, sspB ; NP_230229, VC057 8. P. aeruginosa: NP_253119, PA4429; NP_253118, PA4428, sspA ; NP_253117, PA4427, sspB ; NP_253116, PA4426. N. gonorrhoeae: YP_209138, NGO2128, YP_209139, NGO2130, sspA ; YP_209140, NGO2131, sspB ; YP_20 9141, NGO2132. F. tularensis SCHU S4 : YP_170229, FTT1273, rplM; YP_170230, FTT1274, rpsI ; YP_170231, FTT1275, mglA ; YP_170232, FTT1276, mglB ; YP_170233, FTT1277c; YP_169494, FTT0456c; YP_169495, FTT0457, yccK ; YP_169496, FTT0458, sspA ; YP_169497, FTT0459, sohB ; YP_169498, FTT0460, holB ; YP_169499, FTT0461, yhbY ; YP_169500, FTT0462, hemB ; YP_169501, FTT0463, yibK ; YP_169502, FTT0464, ansB Gene identification numbers for Figure 21 5 (Struct ural comparison of SspA proteins) are as follows: F. tularensis SCHU S4, stringent starvation protein A, GI# 56707600; F. tularensis SCHU S4, macrophage growth locus A, GI# 56708335; P. putida, stringent starvation protein A, GI# 26988055; P. fluorescens stringent starvation protein A, GI# 70732400; H. influenza, stringent starvation protein A, GI# 345430263. Gene identification numbers for Figure 3 10 ( Multiple sequence alignment of FevR (PigR) with two members of MerR family of transcriptional regulator s) are as follows: Ec SoxR : E. coli, superoxide response protein, GI# 61923 ; Ng NmlR: N. gonorrhoeae, Neisseria merR like regulator GI# 59801030; Ft FevR : F. tularensis SCHU S4,

PAGE 141

141 Francisella Effector of Virulenc e Regulation, also known as the Pathogenicity Island Gene Regulator (PigR) GI# 56707532. Structure Modeling and Analysis In silico modeling was performed using SWISS MODEL workspace automated template search (Arnold et al ., 2006) The structure of SspA f rom Y pestis (PDB 1YY7) (Hansen et al ., 2005a) was used as the template to build a model of MglA and SspA structure from F. tularensis SCHU S4. All the structures were analyzed and images were generated using PyMol (DeLano, 2002) Statisti c al Analysis Statistical analysis for significant differences was performed according to the t test fo r unpaired data or by the nonparametric one way ANOVA Differences with P <0.05 and lower were considered significant. Data was analyzed by GraphPad Prism (GraphPad Software, San Diego, USA).

PAGE 142

142 Table 41. Strains and plasmids used for protein purification and sitedirected mutagenesis Strains Genotype / Description Source or Reference E. coli F lac lac ZYA arg F) U169 rec A1 end A1 hsd R17 (r K m K + ) pho A sup thi 1 gyr A96 rel A1 Invitrogen BL21 Star(DE3) F omp T hsd S B (r B m B ) gal dcm r ne 131 (DE3); Str r Invitrogen BL21 Rosetta(DE3) F ompT hsdS B (r B m B ) gal dcm (DE3) pRARE Novagen XL1 Blue recA1 endA1 gyrA96 thi 1 hsdR17 supE44 relA1 lac [F proAB lacI Tn10 (Tetr)] Stratagene Ft MglA BL21 Star(DE3) carrying p15TV 6XHis mglA ; Am p r This work Ft SspA BL21 Star(DE3) carrying p15TV 6XHis sspA ; Amp r This work Ft MglA/SspA BL21 Rosetta(DE3) carrying compatible vectors p15TV 6XHis mglA and pCDF 6XHis sspA ; Amp r Str r This work Ft MglAY63A/SspA BL21 Rosetta(DE3) carrying compatible vec tors p15TV 6XHis mglA Y63A and pCDF 6XHis sspA ; Ampr Strr This work Ec SspA E. coli K 12, strain W3110 carrying pCA24N sspA ; Cm r (Kitagawa, 2005) Plasmids p15TV L T7 promoter driven expression, LIC sequence for DNA recombination cloning, N terminal 6X His fusion tag followed by a TEV cleavage site; Ampr (Guthrie et al 2007) p15TV mglA p15TV L carrying mglA gene from F. tularensis SCHU S4 This work p15TV mglA Y63A p15TV mglA with MglA Y63 A This work p15TV sspA p15TV L carrying sspA gene from F. tularensis SCHU S4 This work pCDF 1b T7 promoter driven expression, N terminal 6X His fusion tag followed by a EK cleavage site; Strr Novagen pCDF sspA pCDF 1b carrying sspA gene from F. tularensis SCHU S4 This work Ampr: ampicillin resistance. Strr: streptomycin resistance. Cmr: chloramphenicol resistant. TEV: tobacco etch virus. EK: enterokinase

PAGE 143

143 Table 42. Strains and plasmids used for the twohybrid system Strains Genotype / Description Source or Reference E. coli JM109 e14 (McrA ) recA1 endA1 gyrA96 thi 1 hsdR17 ( r K m K + ) supE44 relA1 lac proAB ) [F traD36 proAB lacIqZ M15 ] Stratagene AW23 F lacproA+, B+(lacI q lacPL8)/araD(gpt lac)5 ; Str r Km r This work AW23 1 AW23 carrying pBR mglA and pACTR sspA Zif This work AW23 2 AW23 carrying pBR GP and pACTR APZif This work AW23 3 AW23 carrying pBR mglA and pACTR AP Zif This work AW23 4 AW23 carr ying pBR GP and pACTR mglA Zif This work AW23 5 AW23 carrying pBR sspA and pACTR AP Zif This work AW23 6 AW23 carrying pBR GP and pACTR sspA Zif This work AW23 7 AW23 carrying pBR mglA N51A and pACTR sspA Zif This work AW23 8 AW23 carrying pBR m glA Y63A and pACTR sspA Zif This work AW23 9 AW23 carrying pBR mglA R64A and pACTR sspA Zif This work AW23 10 AW23 carrying pBR mglA K101A and pACTR sspA Zif This work AW23 11 AW23 carrying pBR mglA and pACTR sspA D96A Zif This work AW23 12 AW23 c arrying pBR mglA and pACTR sspA K97A Zif This work AW23 13 AW23 carrying pBR mglA and pACTR sspA E101A Zif This work AW24 F lacproA+,B+(lacI q lacPL8)/araD(gpt lac)5 ; Str r Km r This work AW24 1 AW24 carrying pBR mglA and pACTR sspA Zif This work AW24 2 AW24 carrying pBR GP and pACTR APZif This work AW24 3 AW24 carrying pBR mglA and pACTR AP Zif This work AW24 4 AW24 carrying pBR GP and pACTR sspA Zif This work AW26 F lacproA+,B+(lacI q lacPL8)/araD(gpt lac)5 ; Str r Km r This work AW26 1 AW26 carrying pBR mglA and pACTR sspA Zif This work AW26 2 AW26 carrying pBR GP and pACTR APZif This work Strr: streptomycin resistance. Kmr: kanamycin resistance.

PAGE 144

144 Table 42. Continued Strains Genotype / Description Sour ce or Reference AW26 3 AW26 carrying pBR mglA and pACTR AP Zif This work AW26 4 AW26 carrying pBR GP and pACTR sspA Zif This Work Plasmids pBR GP Plasmid used to create fusions to the N terminus of the subunit of E. coli RNA polymerase; A mpr (Charity et al ., 2007) pBR mglA pBRGP carrying mglA gene from F. tularensis SCHU S4 at Nde I and Not I sites This work pBR mglA N51A pBR mglA wit h MglA N51 A This work pBR mglA Y63A pBR mglA with MglA Y63 A This work pBR mglA R64A pBR mglA with MglA R64 A This work pBR mglA K101A pBR mglA with MglA K101 A This work pACTR AP Zif Plasmid used to create fusions to the N terminus o f the Zif protein; Tet r (Charity et al ., 2007) pACTR sspA Zif pACTR AP Zif carrying sspA gene from F. tularensis SCHU S4 at Nde I and Not I sites This work pACTR sspA D96A Zif pACTRsspA Zif with SspA D96 A This work pACTR sspA K97A Zif pACTRsspA Zif with SspA K97 A This work pACTR sspA E101A Zif pACTRsspA Zif with SspA E101 A This work Ampr: ampicillin resistance. Tetr: tetracycline resistance. Amino acid abbreviations: N: asparagine, Y: tyrosine, R: arginine, K: lysine, D:aspartic acid, E: glutamic acid.

PAGE 145

145 Table 43. Strains and plasmids used for the bridgehybrid system Strains Genotype / Description Source or Reference E. coli JM109 e14 (McrA ) recA1 endA1 gyrA96 thi 1 hsdR17 ( r K m K + ) supE44 relA1 lac proAB ) [F traD36 proAB lacIqZ M15 ] Stratagene AW23 F lacproA+,B+(lacI q lacPL8)/araD(gpt lac)5 ; Str r Km r This work AW23 14 AW23 carrying pBR mglA pACTRPigRZif and pCLsspA This work AW23 15 AW23 carrying pBR GP pACTR AP Zif and pCL sspA This work AW23 16 AW23 carrying pBR mglA pACTRAPZif and pCLsspA This work AW23 17 AW23 carrying pBR GP pACTRpigR Zif and pCLsspA This work AW26 F lacproA+,B+(lacI q lacPL8)/araD(gpt lac)5 ; Str r Km r This work AW26 5 AW26 ca rrying pBR mglA pACTRPigRZif and pCLsspA This work AW26 6 AW26 carrying pBR GP pACTRAPZif and pCL sspA This work AW26 7 AW26 carrying pBR mglA pACTRAPZif and pCLsspA This work AW26 8 AW26 carrying pBR GP pACTRpigR Zif and pCLsspA T his work Plasmids pBR GP Plasmid used to create fusions to the N terminus of the subunit of E. coli RNA polymerase; Ampr (Charity et al ., 2007) pBR mglA pBRGP carrying mglA gene from F. tularensis SCHU S4 at Nde I and Not I sites This work pACTR AP Zif Plasmid used to create fusions to the N terminus of the Zif protein; Tet r (Charity et al ., 2007) pACTR pigR Zif pACTR AP Zif carrying pigR gene from F. holarctica LVS at Nde I and Not I sites (Charity et al ., 2009) pCL sspA Modified pCL1920 carrying sspA gene from F. holarctica LVS; Spec r (Charity et al ., 2009) Strr: streptomycin resistance. Kmr: kanamycin resistance. Ampr: ampicillin resistance. Tetr: tetracycline resistance. Specr: spectinomycin resistance

PAGE 146

146 Table 44. Strains and plasmids used for construction of the bacterial hybrid systems reporter strains Strains Genotype / Description Source or Reference E. coli FW102 [F / araD(gpt lac)5 ( rpsl ::Str )]; Str r (Nickels, 2009) AW18 [F / araD(gpt lac)5 ( rpsl ::Str ) sspA ]; Str r This work AW19 [F / araD(gpt lac)5 ( rpsl ::Str ) sspA relA ]; Str r This work AW20 [F / a raD(gpt lac)5 ( rpsl ::Str ) sspA relA spoT ]; Str r This work AW21 [F / araD(gpt lac)5 ( rpsl ::Str ) sspA ppKppX ]; Str r This work KDZif Z [F lacproA+,B+(lacI q lacPL8)/araD(gpt lac)5 ( D spoS3 ::cat )]; Km r (Charity et al ., 2007) AW23 AW18 conjugated with KDZif Z; Str r Km r This work AW24 AW20 conjugated with KDZif Z; Str r Km r This work AW26 AW21 conjugated with KDZif Z; Str r Km r This work Plasmids pKD46 red expression vector, thermosensitive 30 C; Amp r (Datsenko & Wanner, 2000) pKD4 Plasmid used as the source of the kanamycin resistance marker; Km r pCP20 Helper plasmid, FLP recombinase, thermosensitive 30 C; Amp r Cm r Strr: streptomycin resistance. Kmr: kanamycin resistance. Ampr: ampicillin resistance. Cmr: chloramphenicol resistant.

PAGE 147

147 Table 45. Primes used for protein purification Primer Name s Sequences (5 3) Description mglA p15TV L Forward TTGTATTTCCAGGG CATGCTTTTATACACAAAAAAAGATGATATCTATAGC Generate coding region mglA using template genomic DNA of F. tularensis SCHU S4 mglA p15TV L Reverse CAAGCTTCGTCATCA TTAAGCTCCTTTTGCTTTGATAG sspA p1 5TV L Forward TTGTATTTCCAGGGC ATGATGAAAGTTACATTATATACAACG Generate coding region sspA using template genomic DNA of F. tularensis SCHU S4 sspA p15TV L Reverse CAAGCTTCGTCATCA CTATCTGAGTTCTTAGAGTTTTGAG sspA pCDF 1b BamHI Forward CC GGATCC CATGATGAAAGTTACATTA TATACAACG Generate coding region sspA using template genomic DNA of F. tularensis SCHU S4 sspA pCDF 1b BamHI Reverse GCGGCCGC ATTATCTATGAGTTCTTAGAGTTTTGAG T7 Forward TTAATACGACTCACTATAGGG Confirm gene insertion in p15TV L and pCDF 1b plasmids and sequenc ing T7 Reverse GCTAGTTATTGCTCCAGCGG LIC sequences for DNA recombination are underlined. Restriction sites are in italic with boldface.

PAGE 148

148 Table 46. Primes used for the hybrid system cloning and reporter strains const ruction Prime Names Sequences (5 3) Description mglA NdeI Forward GGAATTC CATATG ATGCTTTTATACACAAAAAAAGATG Generate coding region mglA using template genomic DNA of F. tularensis SCHU S4 mglA NotI Reverse TATAT GCGGCCGC AGCTCCTTTTGCTTTGATAG sspA NdeI Forward GGAATTC CATATG ATGATGATGAAAGTTACATT ATATACAACG Generate coding region sspA using template genomic DNA of F. tularensis SCHU S4 sspA NotI Reverse TATAT GCGGCCGC TCTATGAGTTCTTAGAGTTTTG mglA Forward CAAAGCCCTGATTTGGATGA To sequence gene fusions in pBR GP APZif sspA Forward GATCAA ATTCGCAAACACAG sspA Kan Forward TTAACTCCGGCCCAGACGCA TTTCACGTTCTGCTTCAGTT AAAGAAGCAA GTGTAGGCTGGAGCTGCTTC G Generate kanamycin cassette from pKD4 plasmid to delete sspA sspA Kan Reverse ATGGCTGTCGCTGCCAACAAACGTTCGGTAATGACGCTGTTTTCCGGTCC CATATGAATATCCTCCTTA G relA Kan Forward ATGGTTGCGGTAAGAAGTGCACATATCAATAAGGCTGGTGAATTTGATCC GTGTAGGCTGGAGCTGCTTCG Generate kanamycin cassette from pKD4 plasmid to delete relA relA Kan Reverse CTAACTCCCGTGCAACCGACGCGCGTCGATAACATCCGGCACCTGGTTGA CATATGAATATCCTCCTTAG spoT Kan Forward TTGTATCTGTTTGAAAGCCTGAATCAACTGATTCAAACCTACCTGCCGGA GTGTAGGCTGGAGCTGCTTCG Generate kanamycin cassette from pKD4 plasmid to delete spoT spoT Kan Reverse TTAATTTCGGTTTCGGGTGACTTTAATCACGTCTGGCATCACGCGGATTT CATATGAATATCCTCCTTAG ppKppX Kan Forward AT GGGTCAGGAAAAGCTATACATCGAAAAAGAGCTCAGTTGGTTATCGTT GTGTAGGCTGGAGCTGCTTCG Generate kanamycin cassette from pKD4 plasmid to delete ppKppX ppKppX Kan Reverse TTAAGCGGCGATTTCTGGTGTACTTTCTTCTTCAATTTTCAACCGCCAGC CATATGAATATCCTCCTTAG Restriction sites are in ita lic with boldface. Priming sites are underlined with boldface

PAGE 149

149 Table 46. Continued Primer Names Sequences (5 3) Description sspA Ver Forward CAACTTCTGACTGGCCACCT Verify kanamycin cassette was removed from deleted sspA gene sspA Ver Reverse GCGCATATTC CATAGGAACC relA Ver Forward GAATCGATGGTACTTTTCTC Verify kanamycin cassette was removed from deleted relA gene relA Ver Reverse CATAACCCTTTCCTCAAACC spoT Ver Forward GCAAGAGCAGGAAGCCGCTG Verify kanamycin cassette was removed from deleted spoT gene sp oT Ver Reverse CTCCATGCAGACGGTCAGATC ppKppX Ver Forward AATATTGCTCGCCATAATATC Verify kanamycin cassette was removed from deleted sppKppX operon ppKppX Ver Reverse ACCCATTCGCGAAAGTGCCTG

PAGE 150

150 Table 47. Primers used for site directed mutagenesis Primer Name s Sequences (5 3) Description MglA N51A Forward ATTACACCTAATGGT GCT ATACCTACGCTTAGC Generate mutation in the asparagine residue at position 51 to alanine using pBR mglA as template MglA N51A Reverse GCTAAGCGTAGGTAT AGC ACCATTAGGTGTAAT MglA Y63A Forward GATGATTTTGCAGTG GCT AGGCTTAGTGTGATT Generate mutation in the tyrosine residue at position 63 to alanine using p15TV mglA and pBR mglA templates MglA Y63A Reverse AA TCACACTAAGCCT AGC CACTGCAAAATCATC MglA R64A Forward GATGATTTTGCAGTGTAT GCG CTTAGTGTGATTATAGAA Generate mutation in the arginine residue at position 64 to alanine using pBR mglA MglA R64A Reverse TTCTATAATCACACTAAG CGC ATACACTGCAAAATCATC MglA K 101A Forward TTAGAATATGTTAAT GCA ACGTTTCTGCAAAAT Generate mutation in the lysine residue at position 101 to alanine using pBR mglA MglA K101A Reverse ATTTTGCAGAAACGT TGC ATTAACATATTCTAA SspA D96A Forward AAGATACGCTTATCGCTT GCT AAAATTGATAATGAGTGG Generate mutation in the aspartic acid residue at position 96 to alanine using pACTRsspA Zif as template SspA D96A Reverse CCACTCATTATCAATTTT AGC AAGCGATAAGCGTATCTT SspA K97A Forward CGCTTATCGCTTGAT GCA ATTGATAATGAGTGG Generate mutation in the lysine resi due at position 97 to alanine using pACTR sspA Zif as template SspA K97A Reverse CCACTCATTATCAAT TGC ATCAAGCGATAAGCG SspA E101A Forward GATAAAATTGATAAT GCG TGGTATCCAGTATTA Generate mutation in the glutamic acid residue at position 101 to alanine using pACTRsspA Zif as template SspA E101A Reverse TAATACTGGATACCA CGC ATTATCAATTTTATC Mutation sites are boldface.

PAGE 151

151 Table 48. Primers used for qRT PCR Primer Names Sequences (5 3) Description iglA Forward AATGTCCTTAGCAAACGATGC Measure transcript levels of the F. novicida iglA gene iglA Reverse CTTTTGATTTTGAGGCACCA iglD Forward GCCCTATTAGATTCCGCAAA Measure transcript levels of the F. novicida iglD gene iglD Reverse GAGGGCGATTAGTACCAGAAA pdpA Forward CAACCCGTTTTATAGCCATTG Measure transcript levels of the F novicida pdpA gene pdpA Reverse GGATGGTTTGTGCTTAGTCCA pdpD Forward ATCTGCCCCAACACTACCAG Measure transcript levels of the F. novicida pdpD gene pdpD Reverse GCTCAGCAGGATTTTGATTTG rpsD Forward TGTCGAAGCTAGCAGAAGAAA Measure transcript levels of the F. novicida rpsD gene rpsD Reverse GCCAGCTTTTACTTGAGCAGA uvrD Forward ACCGCCATAAATCCGATATG Measure transcript levels of the F. novicida uvrD gene uvrD Reverse CAGCAGCTGAAGATGGTGAA

PAGE 152

152 Figure 41. p15TV L expression vector map.

PAGE 153

153 Figure 42. pCDF 1b expression vector map EMD Chemicals Inc., an Affiliate of Merck KGaA, Darmstadt, Germany. Reprinted with permission.

PAGE 154

154 Figure 43. Schematic representation of the twohybrid system used to study proteinprotein interactions. (A) Plasmid pBRGP used to create the fusion of the F. tularensis SCHU S4 mglA ; plasmid pACTRAPZif was used to fuse the sspA gene to the zinc finger DNA binding protein of the murine Zif268 protein (Zif). Compatible vectors were introduced into the E. coli reporter strains (AW23, AW24, AW26) carrying the test promoter lacZ fusion on an F episome. (B) Contact between the fused proteins activates transcription from the test promoter, driving expression of lacZ which can be detected by measu galactosidase activity.

PAGE 155

155 Figure 44. Schematic representation of the bridgehybrid system used to study proteinprotein interactions. (A) Plasmid pBR mglA F. tularensis SCHU S4 mglA pACTR pigR Zif harbors the F. holarctica LVS pigR gene fused to the murine Zif268 protein (Zif), and plasmid pCLsspA harbors the F. holarctica LVS sspA gene. Compatible vectors were introduced into the E. coli reporter strains (AW23 AW24, AW26 ) carrying the test promoter lacZ fusion on an F episome. (B) Contact between the fused proteins activates transcription from the test promoter, driving expression of lacZ galactosidase activity.

PAGE 156

156 CHAPTER 5 SUMMARY AND CONCLUSION In Francisella tularensis the expression of genes involved in pathogenesis is regulated by the g lobal transcriptional regulators MglA and SspA two proteins t hat do not bind to the DNA directly (Brotcke et al ., 2006) This mechanism is unique in the sense that MglA/SspA interaction is only found in the Francisella genus. These proteins modulate transcription by first interacting with the RNA polymerase as a heterodimer and then to DNA binding transcription factors FevR (PigR) or to the response regulator PmrA to form a major transcriptional complex (Charity et al ., 2007, Charity et al ., 2009, Bell et al ., 2010) L im ited information is available regarding the events and conditions that promote these proteinprotein interactions. The elucidation of the environmental conditions that modulate these interactions is significant since the formation of this complex is a critical step in t he expression of hundreds of genes including those required to support Francisella int ramacrophage survival. This dissertation focused on the identification of molecules that modulate the interaction between MglA and SspA. A thermo melting screening assay was us ed to identify potential ligands with purified MglA, SspA and MglA/SspA complex against a library of small molecules Quinacrine was identified as the best hit molecule that decreased the F. tularensis MglA/SspA interaction in a bacterial twohybrid system These results were confirmed i n vivo and showed that quinacrine decreased the expression of virulence determinants, as well as the F. novicida intramacrophage survival. A structureguided site directed mutagenesis approach was taken to elucidate t he relevant amino acids that mediate the interaction of the MglA/SspA complex with quinacrine. These studies demonstrated that t yrosine 63 of MglA and lysine 97 of SspA

PAGE 157

157 located in the cleft region, play an important role in the interaction of these two pr oteins with quinacrine. Once the cleft region within the MglA/SspA complex was identified as a potential place where the interaction with small molecules occurs it was hypothesized that biological molecules that modulate the MglA/ SspA interactions bind there as well The second part of this work was directed to identify those thus far hypothetical biological ligands. Since polyP and ppGpp have been shown to play a role in Francisella pathogenesis, their involvement as signal molecules was studied. The results obtained in the two hybrid system indicated that polyP and not ppGpp mediate the interaction between MglA and SspA. The absence of polyP impairs the interaction of the heterodimer in the twohybrid system used. In addition, it was determined that polyP binds to the MglA/S spA complex with high affinity ( Kd = 300 nM) within the heterodimer interface. Moreover, the effect of polyP on the interaction of the MglA/SspA complex with FevR (PigR) was determine d in vivo using a bridgehybrid system. It was found that polyP is also required for interactions of the transcription factor FevR with the MglA/SspA complex. In summary, this work describes the identification and biochemical characterization of a chemical probe (quinacrine) and the biological effector molecule (polyP) that modulate the interaction of the global transcriptional regulators MglA and SspA of F. tularensis The molecules identified could be used in the future to direct the rational design of new antimicrobials for the treatment of tularemia.

PAGE 158

158 LI ST OF REFERENCES Abd, H., T. Johansson, I. Golovliov, G. Sandstrm & M. Forsman, (2003) Survival and growth of Francisella tularensis in Acanthamoeba castellanii Appl Environ Microbiol 69: 600606. Ahlund, M. K., P. Rydn, A. Sjstedt & S. Stven, (2010) Directed screen of Francisella novicida virulence determinants using Drosophila melanogaster Infect Immun 78: 31183128. Ahmed, M., C. M. Borsch, S. S. Taylor, N. Vzquez Laslop & A. A. Neyfakh, (1994) A protein that activates expressi on of a multidrug efflux transporter upon binding the transporter substrates. J Biol Chem 269: 2850628513. Ahmed, M., L. Lyass, P. N. Markham, S. S. Taylor, N. Vzquez Laslop & A. A. Neyfakh, (1995) Two highly similar multidrug transporters of Bacillus su btilis whose expression is differentially regulated. J Bacteriol 177 : 39043910. Alibek, K., (1999) The Soviet Union's anti agricultural biological weapons. Ann N Y Acad Sci 894 : 18 19. Altschul, S. F., T. L. Madden, A. A. Schffer, J. Zhang, Z. Zhang, W. Miller & D. J. Lipman, (1997) Gapped BLAST and PSI BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 33893402. Appelberg, R., (2007) Neutrophils and intracellular pathogens: beyond phagocytosis and killing. Trends Microbiol 15 : 87 92. Arnold, K., L. Bordoli, J. Kopp & T. Schwede, (2006) The SWISS MODEL workspace: a web based environment for protein structure homology modelling. Bioinformatics 22: 195201. Artsimovitch, I., V. Patlan, S. Sekine, M. N. Vassylyeva, T. Hosaka, K. Ochi, S. Yokoyama & D. G. Vassylyev, (2004) Structural basis for transcription regulation by alarmone ppGpp. Cell 117 : 299 310. Atlung, T. & H. Ingmer, (1997) H NS: a modulator of environmentally regulated gene expression. Mol Microbiol 24 : 7 17. Ault R ich, D., C. D. Fraley, C. M. Tzeng & A. Kornberg, (1998) Novel assay reveals multiple pathways regulating stress induced accumulations of inorganic polyphosphate in Escherichia coli J Bacteriol 180: 18411847. Badger, J. & V. Miller, (1998) Expression of invasin and motility are coordinately regulated in Yersinia enterocolitica J Bacteriol 180 : 793 800.

PAGE 159

159 Bakshi, C. S., M. Malik, K. Regan, J. A. Melendez, D. W. Metzger, V. M. Pavlov & T. J. Sellati, (2006) Superoxide dismutase B gene ( sodB ) deficient mutants of Francisella tularensis demonstrate hypersensitivity to oxidative stress and attenuated virulence. J Bacteriol 188 : 64436448. Balsalobre, C ., (2011) Concentration matters. ppGpp, from a whispering to a strident alarmone. Mol Microbiol 79: 827 829. Ba lzer, G. J. & R. J. McLean, (2002) The stringent response genes relA and spoT are important for Escherichia coil biofilms under slow growth conditions. Can J Microbiol 48: 675680. Baranova, N. N., A. Danchin & A. A. Neyfakh, (1999) Mta, a global MerR type regulator of the Bacillus subtilis multidrug efflux transporters. Mol Microbiol 31 : 15491559. Barker, J., A. Chong, T. Wehrly, J. Yu, S. Rodriguez, J. Liu, J. Celli, B. Arulanandam & K. Klose, (2009) The Francisella tularensis pathogenicity island encodes a secretion system that is required for phagosome escape and virulence. Mol Microbiol 74: 14591470. Baron, G. & F. Nano, (1998) MglA and MglB are required for the intramacrophage growth of Francisella novicida Mol Microbiol 29: 247259. Barth, M., C. M arschall, A. Muffler, D. Fischer & R. HenggeAronis, (1995) Role for the histonelike protein H NS in growth phasedependent and osmotic regulation of sigma S and many sigma S dependent genes in Escherichia coli J Bacteriol 177: 34553464. Beier, D. & R. Gross, (2006) Regulation of bacterial virulence by two component systems. Curr Opin Microbiol 9 : 143 152. Bell, B., N. Mohapatra & J. Gunn, (2010) Regulation of virulence gene transcripts by the Francisella novicida orphan response regulator PmrA: role of phosphorylation and evidence of MglA/SspA interaction. Infect Immun 78: 21892198. Benkert, P., M. Biasini & T. Schwede, (2011) Toward the estimation of the absolute quality of individual protein structure models. Bioinformatics 27: 343 350. Berdal, B. P., R. Mehl, H. Haaheim, M. Lksa, R. Grunow, J. Burans, C. Morgan & H. Meyer, (2000) Field detection of Francisella tularensis Scand J Infect Dis 32: 287291. Bnemann, G., A. Pietrosiuk, A. Diemand, H. Zentgraf & A. Mogk, (2009) Remodelling of VipA/VipB tu bules by ClpV mediated threading is crucial for type VI protein secretion. EMBO J 28 : 315325.

PAGE 160

160 Bnemann, G., A. Pietrosiuk & A. Mogk, (2010) Tubules and donuts: a type VI secretion story. Mol Microbiol 76 : 815 821. Bnquist, L., H. Lindgren, I. Golovliov, T. Guina & A. Sjstedt, (2008) MglA and Igl proteins contribute to the modulation of Francisella tularensis live vaccine strain containing phagosomes in murine macrophages. Infect Immun 76: 35023510. Borremans, B., J. L. Hobman, A. Provoost, N. L. Brown & D. van Der Lelie, (2001) Cloning and functional analysis of the pbr lead resistance determinant of Ralstonia metallidurans CH34. J Bacteriol 183 : 56515658. Boyce, J. M., (1975) Recent trends in the epidemiology of tularemia in the United States. J Infect Dis 131 : 197 199. Bradford, M. M., (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteindye binding. Anal Biochem 72: 248254. Brocklehurst, K. R., J. L. Hobman, B. Lawley, L. Blank S. J. Marshall, N. L. Brown & A. P. Morby, (1999) ZntR is a Zn(II) responsive MerR like transcriptional regulator of zntA in Escherichia coli Mol Microbiol 31: 893 902. Brms, J. E., A. Sjstedt & M. Lavander, (2010) The Role of the Francisella t ularens is Pathogenicity Island in Type VI Secretion, Intracellular Survival, and Modulation of Host Cell Signaling. Front Microbiol 1 : 136. Brms, J. E., M. Lavander, L. Meyer & A. Sjstedt, (2011) IglG and IglI of the Francisella Pathogenicity Island Are Important Virulence Determinants of Francisella tularensis LVS. Infect Immun 79: 36833696. Brotcke, A. & D. Monack, (2008) Identification of f evR a novel regulator of virulence gene expression in Francisella novicida Infect Immun 76: 34733480. Brotcke, A., D. Weiss, C. Kim, P. Chain, S. Malfatti, E. Garcia & D. Monack, (2006) Identification of MglA regulated genes reveals novel virulence factors in Francisella tularensis Infect Immun 74: 66426655. Brown, M. R. & A. Kornberg, ( 2008) The long and short of it: polyphosphate, PPK and bacterial survival. Trends Biochem Sci 33: 284 290. Brown, N. L., J. V. Stoyanov, S. P. Kidd & J. L. Hobman, (2003) The MerR family of transcriptional regulators. FEMS Microbiol Rev 27: 145 163. Buchan, B. W., R. L. McCaffrey, S. R. Lindemann, L. A. Allen & B. D. Jones, (2009) Identification of migR a regulatory element of the Francisella tularensis live

PAGE 161

161 vaccine strain iglABCD virulence operon required for normal replication and trafficking in macrophages. Infect Immun 77: 25172529. Busby, S. & R. H. Ebright, (1999) Transcription activation by catabolite activator protein (CAP). J Mol Biol 293 : 199213. Cashel, M., D. Gentry, V. Hernandez & D. Vinella, (1996) The stringent response. In Escherichia coli and Salmonella: Cellular and molecular biology ASM Press, Washington, DC. Chambers, J. R. & K. S. Bender, (2011) The RNA chaperone Hfq is important for growth and stress tolerance in Francisella novicida. PLoS One 6 : e19797. Champion, M. D., Q. Zeng, E. B. Nix, F. E. Nano, P. Keim, C. D. Kodira, M. Borowsky, S. Young, M. Koehrsen, R. Engels, M. Pearson, C. Howarth, L. Larson, J. White, L. Alvarado, M. Forsman, S. W. Bearden, A. Sjstedt, R. Titball, S. L. Michell, B. Birren & J. Galagan, (2009) Comparative genomic characterization of Fr ancisella tularensis strains belonging to low and high virulence subspecies. PLoS Pathog 5 : e1000459. Charity, J., L. Blalock, M. Costante Hamm, D. Kasper & S. Dove, (2009) Small molecule control of virulence gene expression in Francisella tularensis PLoS Pathog 5 : e1000641. Charity, J., M. Costante Hamm, E. Balon, D. Boyd, E. Rubin & S. Dove, (2007) Twin RNA polymeraseassociated proteins control virulence gene expression in Francisella tularensis PLoS Pathog 3 : e84. Checroun, C., T. D. Wehrly, E. R. Fis cher, S. F. Hayes & J. Celli, (2006) Autophagy mediated reentry of Francisella tularensis into the endocytic compartment after cytoplasmic replication. Proc Natl Acad Sci U S A 103 : 1457814583. Chong, A. & J. Celli, (2010) The F rancisella intracellular life cycle: toward molecular mechanisms of intracellular survival and proliferation. Front Microbiol 1 : 138. Chong, A., T. D. Wehrly, V. Nair, E. R. Fischer, J. R. Barker, K. E. Klose & J. Celli, (2008) The early phagosomal stage of Francisella tularensis de termines optimal phagosomal escape and Francisella pathogenicity island protein expression. Infect Immun 76: 5488 5499. Christopher, G. W., T. J. Cieslak, J. A. Pavlin & E. M. Eitzen, (1997) Biological warfare. A historical perspective. JAMA 278 : 412 417. Chuang, C. C., S. H. Wu, S. H. Chiou & G. G. Chang, (1999) Homology modeling of cephalopod lens S crystallin: a natural mutant of sigmaclass glutathione transferase with diminished endogenous activity. Biophys J 76 : 679 690.

PAGE 162

162 Clark, J. E., H. Beegen & H. G. Wood, (1986) Isolation of intact chains of polyphosphate from Propionibacterium shermanii grown on glucose or lactate. J Bacteriol 168 : 12121219. Clarridge, J. E., T. J. Raich, A. Sjsted, G. Sandstrm, R. O. Darouiche, R. M. Shawar, P. R. Georghiou, C. Osting & L. Vo, (1996) Characterization of two unusual clinically significant Francisella strains. J Clin Microbiol 34: 19952000. Clemens, D. L. & M. A. Horwitz, (2007) Uptake and intracellular fate of Francisella tularensis in human macrophages. Ann N Y Acad Sci 1105: 160 186. Clemens, D. L., B. Y. Lee & M. A. Horwitz, (2004) Virulent and avirulent strains of Francisella tularensis prevent acidification and maturation of their phagosomes and escape into the cytoplasm in human macrophages. Infect Immun 72 : 32043217. Clemens, D. L., B. Y. Lee & M. A. Horwitz, (2005) Francisella tularensis enters macrophages via a novel process involving pseudopod loops. Infect Immun 73: 58925902. Clemens, D. L., B. Y. Lee & M. A. Horwitz, (2009) Francisella tularensis pha gosomal escape does not require acidification of the phagosome. Infect Immun 77 : 17571773. Coles, B. & B. Ketterer, (1990) The role of glutathione and glutathione transferases in chemical carcinogenesis. Crit Rev Biochem Mol Biol 25 : 47 70. Collado Vides, J., B. Magasanik & J. D. Gralla, (1991) Control site location and transcriptional regulation in Escherichia coli Microbiol Rev 55: 371 394. Comer, J., D. Noffsinger, D. McHenry, D. Weisbaum, B. Chatuev, A. Chopra & J. Peterson, (2006) Evaluation of the protective effects of quinacrine against Bacillus anthracis Ames. J Toxicol Environ Health A 69: 10831095. Conlan, J. W. & R. J. North, (1992) Early pathogenesis of infection in the liver with the facultative intracellular bacteria Listeria monocytogenes Francisella tularensis and Salmonella typhimurium involves lysis of infected hepatocytes by leukocytes. Infect Immun 60: 5164 5171. Crooke, E., M. Akiyama, N. N. Rao & A. Kornberg, (1994) Genetically altered levels of inorganic polyphosphate in Escherichi a coli J Biol Chem 269: 62906295. Datsenko, K. & B. Wanner, (2000) Onestep inactivation of chromosomal genes in Escherichia coli K 12 using PCR products. Proc Natl Acad Sci U S A 97: 66406645.

PAGE 163

163 D e Bruin, O. M., J. S. Ludu & F. E. Nano, (2007) The Franci sella pathogenicity island protein IglA localizes to the bacterial cytoplasm and is needed for intracellular growth. BMC Microbiol 7 : 1. D e Crombrugghe, B., S. Busby & H. Buc, (1984) Cyclic AMP receptor protein: role in transcription activation. Science 22 4 : 831838. De Reuse, H. & M. Taha, (1997) RegF, an SspA homologue, regulates the expression of the Neisseria gonorrhoeae pilE gene. Res Microbiol 148: 289 303. Dean, R. E., P. M. Ireland, J. E. Jordan, R. W. Titball & P. C. Oyston, (2009) RelA regulates v irulence and intracellular survival of Francisella novicida. Microbiology 155: 41044113. D eHaseth, P. L., M. L. Zupancic & M. T. Record, (1998) RNA polymerasepromoter interactions: the comings and goings of RNA polymerase. J Bacteriol 180: 30193025. DeL ano, W. L., (2002) The PyMol Molecular Graphics System, version 1.00. Schrodinger, LLC. Deng, K., R. J. Blick, W. Liu & E. J. Hansen, (2006) Identification of Francisella tularensis genes affected by iron limitation. Infect Immun 74: 42244236. Dennis, D., T. Inglesby, D. Henderson, J. Bartlett, M. Ascher, E. Eitzen, A. Fine, A. Friedlander, J. Hauer, M. Layton, S. Lillibridge, J. McDade, M. Osterholm, T. O'Toole, G. Parker, T. Perl, P. Russell, K. Tonat & W. G. o. C. Biodefense, (2001) Tularemia as a biological weapon: medical and public health management. JAMA 285 : 27632773. Dennis, D. T., (1998) Tularemia. Appleton & Lange, Stamford, CT, USA. Dienst, F. T., (1963) Tularemia: a perusal of three hundred thirty nine cases. J La State Med Soc 115 : 114127. D irr, H., P. Reinemer & R. Huber, (1994) X ray crystal structures of cytosolic glutathione S transferases. Implications for protein architecture, substrate recognition and catalytic function. Eur J Biochem 220 : 645 661. Dirusso, C. C. & P. N. Black, (2004) Bacterial long chain fatty acid transport: gateway to a fatty acidresponsive signaling system. J Biol Chem 279: 4956349566. Dir usso, C. C., P. N. Black & J. D. Weimar, (1999) Molecular inroads into the regulation and metabolism of fatty acids, lessons fr om bacteria. Prog Lipid Res 38: 129 197.

PAGE 164

164 Dove, S. & A. Hochschild, (2004) A bacterial twohybrid system based on transcription activation. Methods Mol Biol 261 : 231 246. Eigelsbach, H. T., J. J. Tulis, M. H. McGavran & J. D. White, (1962 ) Live Tularemia Va ccine I. : HostParasite Relationship in Monkeys Vaccinated Intracutaneously or Aerogenically. J Bacteriol 84: 10201027. Eliasson, H., J. Lindbck, J. P. Nuorti, M. Arneborn, J. Giesecke & A. Tegnell, (2002) The 2000 tularemia outbreak: a casecontrol study of risk factors in diseaseendemic and emergent areas, Sweden. Emerg Infect Dis 8 : 956 960. Ellis, J., P. C. Oyston, M. Green & R. W. Titball, (2002) Tularemia. Clin Microbiol Rev 15: 631646. Ericsson, M., A. Trnvik, K. Kuoppa, G. Sandstrm & A. Sjstedt, (1994) Increased synthesis of DnaK, GroEL, and GroES homologs by Francisella tularensis LVS in response to heat and hydrogen peroxide. Infect Immun 62: 178183. Fang, F. C., (2004) Antimicrobial reactive oxygen and nitrogen species: concepts and contr oversies. Nat Rev Microbiol 2 : 820 832. Feldman, K. A., D. Stiles Enos, K. Julian, B. T. Matyas, S. R. Telford, M. C. Chu, L. R. Petersen & E. B. Hayes, (2003) Tularemia on Martha's Vineyard: seroprevalence and occupational risk. Emerg Infect Dis 9 : 350 354. Forsman, M., G. Sandstrm & A. Sjstedt, (1994) Analysis of 16S ribosomal DNA sequences of Francisella strains and utilization for determination of the phylogeny of the genus and for identification of strains by PCR. Int J Syst Bacteriol 44: 38 46. Fran cis, E., (1925) Tularemia. JAMA 84: 1243 1250. Gosset, G., Z. Zhang, S. Nayyar, W. A. Cuevas & M. H. Saier, (2004) Transcriptome analysis of Crp dependent catabolite control of gene expression in Escherichia coli. J Bacteriol 186 : 35163524. Gottesman, S., S. Wickner & M. R. Maurizi, (1997) Protein quality control: triage by chaperones and proteases. Genes Dev 11 : 815 823. Grall, N., J. Livny, M. Waldor, M. Barel, A. Charbit & K. L. Meibom, (2009) Pivotal role of the Francisella tularensis heat shock sigma factor RpoH. Microbiology 155 : 25602572. Gray, C. G., S. C. Cowley, K. K. Cheung & F. E. Nano, (2002) The identification of five genetic loci of Francisella novicida associated with intracellular growth. FEMS Microbiol Lett 215 : 53 56.

PAGE 165

165 Guina, T., D. Radul ovic, A. J. Bahrami, D. L. Bolton, L. Rohmer, K. A. Jones Isaac, J. Chen, L. A. Gallagher, B. Gallis, S. Ryu, G. K. Taylor, M. J. Brittnacher, C. Manoil & D. R. Goodlett, (2007) MglA regulates Francisella tularensis subsp. novicida ( Francisella novicida) r esponse to starvation and oxidative stress. J Bacteriol 189: 65806586. Gurycov, D., (1998) First isolation of Francisella tularensis subsp. tularensis in Europe. Eur J Epidemiol 14: 797 802. Guthrie, J., L. P., I. Kozieradzki, A. Savchenck & C. Arrowamit h, (2007) Expression vectors for highthroughput Inf usion cloning. Unpublished. Hall, J. D., R. R. Craven, J. R. Fuller, R. J. Pickles & T. H. Kawula, (2007) Francisella tularensis replicates within alveolar type II epithelial cells in vitro and in vivo f ollowing inhalation. Infect Immun 75: 10341039. Hammer, B. K. & M. S. Swanson, (1999) Coordination of L egionella pneumophila virulence with entry into stationary phase by ppGpp. Mol Microbiol 33: 721731. Hansen, A., Y. Gu, M. Li, M. Andrykovitch, D. Wau gh, D. Jin & X. Ji, (2005a) Structural basis for the function of stringent starvation protein a as a transcription factor. J Biol Chem 280: 1738017391. Hansen, A. M., H. Lehnherr, X. Wang, V. Mobley & D. J. Jin, (2003) Escherichia coli SspA is a transcrip tion activator for bacteriophage P1 late genes. Mol Microbiol 48: 16211631. Hansen, A. M., Y. Qiu, N. Yeh, F. R. Blattner, T. Durfee & D. J. Jin, (2005b) SspA is required for acid resistance in stationary phase by downregulation of H NS in Escherichia col i Mol Microbiol 56: 719 734. Harada, T., M. Miyake & Y. Imai, (2007) Evasion of Legionella pneumophila from the bactericidal system by reactive oxygen species (ROS) in macrophages. Microbiol Immunol 51: 11611170. Haralalka, S., S. Nandi & R. K. Bhadra, ( 2003) Mutation in the relA gene of Vibrio cholerae affects in vitro and in vivo expression of virulence factors. J Bacteriol 185: 46724682. Hengge Aronis, R., (1993) Survival of hunger and stress: the role of rpoS in early stationary phase gene regulation in E. coli. Cell 72: 165168. Hengge Aronis, R., (1996) Regulation of gene expression due to entry into stationary phase, p. 1497 1549. American Society for Microbiology, Washington, D.C.

PAGE 166

166 Hidalgo, E., J. M. Bollinger, T. M. Bradley, C. T. Walsh & B. Dempl e, (1995) Binuclear [2Fe 2S] clusters in the Escherichia coli SoxR protein and role of the metal centers in transcription. J Biol Chem 270: 20908 20914. Hollis, D. G., R. E. Weaver, A. G. Steigerwalt, J. D. Wenger, C. W. Moss & D. J. Brenner, (1989) Franci sella philomiragia comb. nov (formerly Yersinia philomiragia) and Francisella tularensis biogroup novicida (formerly Francisella novicida) associated with human disease. J Clin Microbiol 27: 16011608. Hommais, F., E. Krin, C. Laurent Winter, O. Soutourina, A. Malpertuy, J. P. Le Caer, A. Danchin & P. Bertin, (2001) Largescale monitoring of pleiotropic regulation of gene expression by the prokaryotic nucleoidassociated protein, H NS. Mol Microbiol 40: 20 36. Hopla, C. E., (1955) The multiplication of tul aremia organisms in the lone star tick. Am J Hyg 61: 371 380. Hornick, R. B. & H. T. Eigelsbach, (1966) Aerogenic immunization of man with live Tularemia vaccine. Bacteriol Rev 30 : 532 538. Hulton, C. S., A. Seirafi, J. C. Hinton, J. M. Sidebotham, L. Wadd ell, G. D. Pavitt, T. Owen Hughes, A. Spassky, H. Buc & C. F. Higgins, (1990) Histonelike protein H1 (H NS), DNA supercoiling, and gene expression in bacteria. Cell 63: 631 642. Ihssen, J. & T. Egli, (2005) Global physiological analysis of carbonand energy limited growing Escherichia coli confirms a high degree of catabolic flexibility and preparedness for mixed substrate utilization. Environ Microbiol 7 : 1568 1581. Ishihama, A. & T. Saitoh, (1979) Subunits of RNA polymerase in function and structure. IX Regulation of RNA polymerase activity by stringent starvation protein (SSP). J Mol Biol 129 : 517 530. Jellison, W. L. & G. M. Kohls, (1955) Tularemia in sheep and in sheep industry workers in western United States. Public Health Monogr 28 : 1 19. Jensson, H., C. Guthenberg, P. Alin & B. Mannervik, (1986) Rat glutathione transferase 8 8, an enzyme efficiently detoxifying 4hydroxyalk 2 enals. FEBS Lett 203 : 207 209. Kanaoka, Y., H. Ago, E. Inagaki, T. Nanayama, M. Miyano, R. Kikuno, Y. Fujii, N. Eguchi, H. Toh, Y. Urade & O. Hayaishi, (1997) Cloning and crystal structure of hematopoietic prostaglandin D synthase. Cell 90: 10851095. Karpoff, S. P. & N. I. Antonoff, (1936) The Spread of Tularemia through Water, as a New Factor in Its Epidemiology. J Bacteriol 32 : 243 258.

PAGE 167

167 Keim, P., A. Johansson & D. M. Wagner, (2007) Molecular epidemiology, evolution, and ecology of Francisella Ann N Y Acad Sci 1105: 30 66. Kidd, S. P., A. J. Potter, M. A. Apicella, M. P. Jennings & A. G. McEwan, (2005) NmlR of Neisseria gonorrhoeae: a novel redox responsive transcription factor from the MerR family. Mol Microbiol 57 : 16761689. Kim, K. S., N. N. Rao, C. D. Fraley & A. Kornberg, (2002) Inorganic polyphosphate is essential for long term survival and virulence factors in Shigell a and Salmonella spp. Proc Natl Acad Sci U S A 99 : 76757680. Kim, Y. I., R. E. Burton, B. M. Burton, R. T. Sauer & T. A. Baker, (2000) Dynamics of substrate denaturation and translocation by the ClpXP degradation machine. Mol Cell 5 : 639 648. Kiss, K., W. Liu, J. F. Huntley, M. V. Norgard & E. J. Hansen, (2008) Characterization of fig operon mutants of Francisella novicida U112. FEMS Microbiol Lett 285 : 270 277. Kitagawa, M., Ara, T., Arifuzzaman, M., IokaNakamichi, T., Inamoto, E., Toyonaga, H. and Mori, H., (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete S et of E. coli K 12 ORF A rchive): Unique Resources for Biological Research. In : DNA Research pp. 291299. Klein, K., R. Steinberg, B. Fiethen & P. Overath, (1971) Fatty acid degradation in Escherichia coli An inducible system for the uptake of fatty acids and further characterization of old mutants. Eur J Biochem 19: 442450. Korth, C., B. C. May, F. E. Cohen & S. B. Prusiner, (2001) Acridine and phenothiazine derivativ es as pharmacotherapeutics for prion disease. Proc Natl Acad Sci U S A 98: 98369841. Kraus, D. & A. Peschel, (2006) Molecular mechanisms of bacterial resistance to antimicrobial peptides. Curr Top Microbiol Immunol 306: 231 250. Kugeler, K. J., P. S. Mead A. M. Janusz, J. E. Staples, K. A. Kubota, L. G. Chalcraft & J. M. Petersen, (2009) Molecular Epidemiology of Francisella tularensis in the United States. Clin Infect Dis 48: 863 870. Kulaev, I. S. & V. M. Vagabov, (1983) Polyphosphate metabolism in micr oorganisms. Adv Microb Physiol 24 : 83 171. Kuroda, A., H. Murphy, M. Cashel & A. Kornberg, (1997) Guanosine tetraand pentaphosphate promote accumulation of inorganic polyphosphate in Escherichia coli J Biol Chem 272: 21240 21243.

PAGE 168

168 Kvint, K., A. Farewell & T. Nystrm, (2000) RpoS dependent promoters require guanosine tetraphosphate for induction even in the presence of high levels of sigma(s). J Biol Chem 275: 1479514798. Kvint, K., L. Nachin, A. Diez & T. Nystrm, (2003) The bacterial universal stress pr otein: function and regulation. Curr Opin Microbiol 6 : 140 145. Lake, G. C. & E. Francis, (1922) Six cases of tularemia occuring in laboratory workers. Public Health Rep. 37 : 392413. Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan H. McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R. Lopez, J. D. Thompson, T. J. Gibson & D. G. Higgins, (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947 2948. Larsson, P., D. Elfsmark, K. Svensson, P. Wikstrm, M. Forsman, T. Bretti n, P. Keim & A. Johansson, (2009) Molecular evolutionary consequences of niche restriction in Francisella tularensis a facultative intracellular pathogen. PLoS Pathog 5 : e1000472. Larsson, P., P. Oyston, P. Chain, M. Chu, M. Duffield, H. Fuxelius, E. Garc ia, G. Hlltorp, D. Johansson, K. Isherwood, P. Karp, E. Larsson, Y. Liu, S. Michell, J. Prior, R. Prior, S. Malfatti, A. Sjstedt, K. Svensson, N. Thompson, L. Vergez, J. Wagg, B. Wren, L. Lindler, S. Andersson, M. Forsman & R. Titball, (2005) The complet e genome sequence of Francisella tularensis the causative agent of tularemia. Nat Genet 37 : 153 159. Lauriano, C., J. Barker, S. Yoon, F. Nano, B. Arulanandam, D. Hassett & K. Klose, (2004) MglA regulates transcription of virulence factors necessary for F rancisella tularensis intraamoebae and intramacrophage survival. Proc Natl Acad Sci U S A 101: 42464249. Lee, S. W., E. Glickmann & D. A. Cooksey, (2001) Chromosomal locus for cadmium resistance in Pseudomonas putida consisting of a cadmium transporting A TPase and a MerR family response regulator. Appl Environ Microbiol 67: 14371444. Lenco, J., M. Hublek, P. Larsson, A. Fuckov, M. Brychta, A. Macela & J. Stulk, (2007) Proteomics analysis of the Francisella tularensis LVS response to iron restriction: induction of the F. tularensis pathogenicity island proteins IglABC. FEMS Microbiol Lett 269 : 11 21. Lenco, J., I. Pavkova, M. Hubalek & J. Stulik, (2005) Insights into the oxidative stress response in Francisella tularensis LVS and its mutant by proteomics analysis. FEMS Microbiol Lett 246 : 47 54.

PAGE 169

169 Levchenko, I., M. Seidel, R. T. Sauer & T. A. Baker, (2000) A specificity enhancing factor for the ClpXP degradation machine. Science 289 : 23542356. Li, L., N. N. Rao & A. Kornberg, (2007) Inorganic polyphosphate essential for lytic growth of phages P1 Proc Natl Acad Sci U S A 104 : 17941799. Lindgren, H., I. Golovliov, V. Baranov, R. K. Ernst, M. Telepnev & A. Sjstedt, (2004) Factors affecting the escape of Francisella tularensi s from the phagolysosome. J Med Microbiol 53 : 953 958. Lorca, G., A. Ezersky, V. Lunin, J. Walker, S. Altamentova, E. Evdokimova, M. Vedadi, A. Bochkarev & A. Savchenko, (2007) Glyoxylate and pyruvate are antagonistic effectors of the Escherichia coli IclR transcriptional regulator J Biol Chem 282: 1647616491. Ludu, J. S., O. M. de Bruin, B. N. Duplantis, C. L. Schmerk, A. Y. Chou, K. L. Elkins & F. E. Nano, (2008) The Francisella pathogenicity island protein PdpD is required for full virulence and associates with homologues of the type VI secretion system. J Bacteriol 190: 45844595. Ma, L. S., J. S. Lin & E. M. Lai, (2009) An IcmF family protein, ImpLM, is an integral inner membrane protein interacting with ImpKL, and its walker a motif is required for type VI secretion system me diated Hcp secretion in Agrobacterium tumefaciens J Bacteriol 191 : 43164329. Madan Babu, M. & S. A. Teichmann, (2003) Functional determinants of transcription factors in Escherichia coli : protein families and binding sites. Trends Genet 19 : 7579. Maier, T. M., M. S. Casey, R. H. Becker, C. W. Dorsey, E. M. Glass, N. Maltsev, T. C. Zahrt & D. W. Frank, (2007) Identification of Francisella tularensis Himar1 based transposon mutants defective for replication in macrophages. Infect Immun 75: 53765389. Mannervik, B. & U. H. Danielson, ( 1988) Glutathione transferases: structure and catalytic activity. CRC Crit Rev Biochem 23: 283337. Martnez Antonio, A., S. C. Janga, H. Salgado & J. ColladoVides, (2006) Internal sensing machinery directs the activity of the regulatory network in Escherichia coli. Trends Microbiol 14: 22 27. McCaffrey, R. L. & L. A. Allen, (2006) Francisella tularensis LVS evades killing by human neutrophils via inhibition of the respiratory burst and phagosome escape. J Leukoc Biol 80: 1224 1230.

PAGE 170

170 McCaffrey, R. L., J. T. Schwartz, S. R. Lindemann, J. G. Moreland, B. W. Buchan, B. D. Jones & L. A. Allen, (2010) Multiple mechanisms of NADPH oxidase inhibition by type A and type B Francisella tularensis J Leukoc Biol 88: 791 805. McCoy, G. W. & C. W. Chapin, (1912) Further observations on a plague like disease of rodents with a preliminary note on the causative agent B acterium tularense. J. Infect. Dis. 10 : 61 72. McEwan, A. G., K. Y. Djoko, N. H. Chen, R. L. Couago, S. P. Kidd, A. J. Potter & M P. Jennings, (2011) Novel bacterial MerR like regulators their role in the response to carbonyl and nitrosative stress. Adv Microb Physiol 58 : 1 22. McLendon, M. K., M. A. Apicella & L. A. Allen, (2006) Francisella tularensis : taxonomy, genetics, and Imm unopathogenesis of a potential agent of biowarfare. Annu Rev Microbiol 60: 167185. McRae, S., F. Pagliai, N. Mohapatra, A. Gener, A. Abdelgeliel Mahmou, J. Gunn, G. Lorca & C. Gonzalez, (2010) Inhibition of AcpA Phosphatase Activity with Ascorbate Attenuates Francisella tularensis Intramacrophage Survival. J Biol Chem 285: 5171 5177. Meibom, K. L., A. L. Forslund, K. Kuoppa, K. Alkhuder, I. Dubail, M. Dupuis, A. Forsberg & A. Charbit, (2009) Hfq, a novel pleiotropic regulator of virulenceassociated genes in Francisella tularensis Infect Immun 77: 18661880. Mellin, J. R., R. McClure, D. Lopez, O. Green, B. Reinhard & C. Genco, (2010) Role of Hfq in iron dependent and independent gene regulation in Neisseria meningitidis Microbiology 156 : 23162326. Merrell, D., D. Hava & A. Camilli, (2002) Identification of novel factors involved in colonization and acid tolerance of Vibrio cholerae. Mol Microbiol 43: 14711491. Mohapatra, N., S. Soni, B. Bell, R. Warren, R. Ernst, A. Muszynski, R. Carlson & J. Gunn, (20 07) Identification of an orphan response regulator required for the virulence of Francisella spp. and transcription of pathogenicity island genes. Infect Immun 75: 3305 3314. Mohapatra, N., S. Soni, T. Reilly, J. Liu, K. Klose & J. Gunn, (2008) Combined deletion of four Francisella novicida acid phosphatases attenuates virulence and macrophage vacuolar escape. Infect Immun 76: 36903699. Mohapatra, N. P., S. Soni, M. V. Rajaram, P. M. Dang, T. J. Reilly, J. El Benna, C. D. Clay, L. S. Schlesinger & J. S. Gu nn, (2010) Francisella acid phosphatases inactivate the NADPH oxidase in human phagocytes. J Immunol 184: 51415150.

PAGE 171

171 Mller, T., T. Franch, P. Hjrup, D. R. Keene, H. P. Bchinger, R. G. Brennan & P. ValentinHansen, (2002) Hfq: a bacterial Sm like protein that mediates RNA RNA interaction. Mol Cell 9 : 23 30. Mrner, T., (1992) The ecology of tularaemia. Rev Sci Tech 11 : 1123 1130. Mougous, J. D., M. E. Cuff, S. Raunser, A. Shen, M. Zhou, C. A. Gifford, A. L. Goodman, G. Joachimiak, C. L. Ordoez, S. Lory, T. Walz, A. Joachimiak & J. J. Mekalanos, (2006) A virulence locus of Pseudomonas aeruginosa encodes a protein secretion apparatus. Science 312 : 1526 1530. Nakajima, R. & R. R. Brubaker, (1993) Association between virulence of Yersinia pestis and suppressi on of gamma interferon and tumor necrosis factor alpha. Infect Immun 61: 23 31. Nakanishi, N., H. Abe, Y. Ogura, T. Hayashi, K. Tashiro, S. Kuhara, N. Sugimoto & T. Tobe, (2006) ppGpp with DksA controls gene expression in the locus of enterocyte effacement (LEE) pathogenicity island of enterohaemorrhagic Escherichia coli through activation of two virulence regulatory genes. Mol Microbiol 61: 194205. Nano, F. E. & C. Schmerk, (2007) The Francisella pathogenicity island. Ann N Y Acad Sci 1105: 122137. Nano, F. E., N. Zhang, S. C. Cowley, K. E. Klose, K. K. Cheung, M. J. Roberts, J. S. Ludu, G. W. Letendre, A. I. Meierovics, G. Stephens & K. L. Elkins, (2004) A Francisella tularensis pathogenicity island required for intramacrophage growth. J Bacteriol 186: 6 430 6436. Nauseef, W. M., (2007) How human neutrophils kill and degrade microbes: an integrated view. Immunol Rev 219: 88 102. Nickels, B., (2009) Genetic assays to define and characterize proteinprotein interactions involved in gene regulation. Methods 4 7 : 53 62. Nishida, M., S. Harada, S. Noguchi, Y. Satow, H. Inoue & K. Takahashi, (1998) Threedimensional structure of Escherichia coli glutathione S transferase complexed with glutathione sulfonate: catalytic roles of Cys10 and His106. J Mol Biol 281 : 135147. Nishimura, A., K. Kitano, J. Takasaki, M. Taniguchi, N. Mizuno, K. Tago, T. Hakoshima & H. Itoh, (2010) Structural basis for the specific inhibition of heterotrimeric Gq protein by a small molecule. Proc Natl Acad Sci U S A

PAGE 172

172 Noll, M., K. Petrukhin & S. Lutsenko, (1998) Identification of a novel transcription regulator from Proteus mirabilis PMTR, revealed a possible role of YJAI protein in balancing zinc in Escherichia coli J Biol Chem 273: 2139321401. Nomura, K., J. Kato, N. Takiguchi, H. Ohtake & A. Kuroda, (2004) Effects of inorganic polyphosphate on the proteolytic and DNA binding activities of Lon in Escherichia coli. J Biol Chem 279: 3440634410. Nystrm, T., (2004) Stationary phase physiology. Annu Rev Microbiol 58: 161 181. Ohara, Y., T. Sato, H. Fujita, T. Ueno & M. Homma, (1991) Clinical manifestations of tularemia in Japan: analysis of 1,355 cases observed between 1924 and 1987. Infection 19: 14 17. Olsufiev, N. G., O. S. Emelyanova & T. N. Dunayeva, (1959) Comparative study of strains of B. tularense in the old and new world and their taxonomy. J Hyg Epidemiol Microbiol Immunol 3 : 138 149. Orzez, M., L. Mondragn, A. GarcaJareo, S. Mosuln, A. Pineda Lucena & E. Prez Pay, (2009) Deciphering the antitumoral activity of quinacrine: Binding to and inhibition of Bcl xL. Bioorg Med Chem Lett 19 : 15921595. Oyston, P. C. & R. Griffiths, (2009) Francisella virulence: significant advances, ongoing challenges and unmet needs. Expert Rev Vaccines 8 : 15751585. Pagliai, F., C. Gardner, S. Pande & G. Lorca, (2010) LVIS553 Transcriptional Regulator Specifically Recognizes Novobiocin as an Effector Molecule. J Biol Chem 285: 1692116930. Papenfort, K. & J. Vogel, (2010) Regulatory RNA in bacterial pathogens. Cell Host Microbe 8 : 116127. Patten, C. L., M. G. Kirchhof, M. R. Schertzberg, R. A. Morton & H. E. Schellhorn, (2004) Microarray analysis of RpoS mediated gene expression in Escherichia coli K 12. Mol Genet Genomics 272: 580 591. Payne, S. M., (1993) Iron acquisition in microbial pathogenesis. Trends Microbiol 1 : 66 69. Pechous, R. D., T. R. McCarthy & T. C. Zahrt, (2009) Working toward the future: insights into Francisella tularensis pathogenesis and vaccine development. Microbiol Mol Biol Rev 73: 684711. Pepe, J. C., J. L. Badger & V. L. Mill er, (1994) Growth phase and low pH affect the thermal regulation of the Yersinia enterocolitica inv gene. Mol Microbiol 11: 123135.

PAGE 173

173 Perederina, A., V. Svetlov, M. N. Vassylyeva, T. H. Tahirov, S. Yokoyama, I. Artsimovitch & D. G. Vassylyev, (2004) Regulat ion through the secondary channel: structural framework for ppGppDksA synergism during transcription. Cell 118: 297 309. Persson, C., R. Nordfelth, A. Holmstrm, S. Hkansson, R. Rosqvist & H. Wolf Watz, (1995) Cell surfacebound Yersinia translocate the protein tyrosine phosphatase YopH by a polarized mechanism into the target cell. Mol Microbiol 18 : 135 150. Petros, A. M., J. Dinges, D. J. Augeri, S. A. Baumeister, D. A. Betebenner, M. G. Bures, S. W. Elmore, P. J. Hajduk, M. K. Joseph, S. K. Landis, D. G. Nettesheim, S. H. Rosenberg, W. Shen, S. Thomas, X. Wang, I. Zanze, H. Zhang & S. W. Fesik, (2006) Discovery of a potent inhibitor of the antiapoptotic protein Bcl xL from NMR and parallel synthesis. J Med Chem 49: 656663. Petry, A., M. Weitnauer & A. Grlach, (2010) Receptor activation of NADPH oxidases. Antioxid Redox Signal 13: 467487. Pierini, L. M., (2006) Uptake of serum opsonized Francisella tularensis by macrophages can be mediated by class A scavenger receptors. Cell Microbiol 8 : 13611370. Po state and timeresolved fluorescence studies of conformational changes induced by cyclic AMP and DNA binding to cyclic AMP receptor protein from Escherichia coli Eur J Biochem 270: 14131423. Pomposiell o, P. J. & B. Demple, (2001) Redox operated genetic switches: the SoxR and OxyR transcription factors. Trends Biotechnol 19: 109114. Postic, G., E. Frapy, M. Dupuis, I. Dubail, J. Livny, A. Charbit & K. L. Meibom, (2010) Identification of small RNAs in Fr ancisella tularensis. BMC Genomics 11: 625. Potter, A. J., S. P. Kidd, A. G. McEwan & J. C. Paton, (2010) The MerR/NmlR family transcription factor of Streptococcus pneumoniae responds to carbonyl stress and modulates hydrogen peroxide production. J Bacter iol 192 : 4063 4066. Primm, T. P., S. J. Andersen, V. Mizrahi, D. Avarbock, H. Rubin & C. E. Barry, (2000) The stringent response of Mycobacterium tuberculosis is required for long term survival. J Bacteriol 182 : 48894898. Pukatzki, S., A. T. Ma, D. Sturte vant, B. Krastins, D. Sarracino, W. C. Nelson, J. F. Heidelberg & J. J. Mekalanos, (2006) Identification of a conserved bacterial protein secretion system in Vibrio cholerae using the Dictyostelium host model system. Proc Natl Acad Sci U S A 103 : 15281533.

PAGE 174

174 Pukatzki, S., S. B. McAuley & S. T. Miyata, (2009) The type VI secretion system: translocation of effectors and effector domains. Curr Opin Microbiol 12: 11 17. Qin, A. & B. J. Mann, (2006) Identification of transposon insertion mutants of Francisella tu larensis tularensis strain Schu S4 deficient in intracellular replication in the hepatic cell line HepG2. BMC Microbiol 6 : 69. Ramakrishnan, G., A. Meeker & B. Dragulev, (2008) fslE is necessary for siderophoremediated iron acquisition in Francisella tula rensis Schu S4. J Bacteriol 190 : 53535361. Rao, N. N. & A. Kornberg, (1999) Inorganic polyphosphate regulates responses of Escherichia coli to nutritional stringencies, environmental stresses and survival in the stationary phase. Prog Mol Subcell Biol 23 : 183 195. Rao, N. N., S. Liu & A. Kornberg, (1998) Inorganic polyphosphate in Escherichia coli: the phosphate regulon and the stringent response. J Bacteriol 180 : 21862193. Reeh, S., S. Pedersen & J. Friesen, (1976) Biosynthetic regulation of individual proteins in relA + and relA strains of Escherichia coli during amino acid starvation. Mol Gen Genet 149 : 279 289. Richards, M. I., S. L. Michell & P. C. Oyston, (2008) An intracellularly inducible gene involved in virulence and polyphosphate production in Fr ancisella J Med Microbiol 57: 11831192. Sammons Jackson, W. L., K. McClelland, J. N. Manch Citron, D. W. Metzger, C. S. Bakshi, E. Garcia, A. Rasley & B. E. Anderson, (2008) Generation and characterization of an attenuated mutant in a response regulator gene of Francisella tularensis live vaccine strain (LVS). DNA Cell Biol 27 : 387 403. Sandstrm, G., (1994) The tularaemia vaccine. J Chem Technol Biotechnol 59 : 315 320. Santic, M., S. Al Khodor & Y. Abu Kwaik, (2010) Cell biology and molecular ecology of Francisella tularensis Cell Microbiol 12: 129139. Santic, M., R. Asare, I. Skrobonja, S. Jones & Y. Abu Kwaik, (2008) Acquisition of the vacuolar ATPase proton pump and phagosome acidification are essential for escape of Francisella tularensis into the m acrophage cytosol. Infect Immun 76: 26712677. Santic, M., M. Molmeret & Y. Abu Kwaik, (2005a) Modulation of biogenesis of the Francisella tularensis subsp. novicida containing phagosome in quiescent human macrophages and its maturation into a phagolysosom e upon activation by IFN gamma. Cell Microbiol 7 : 957 967.

PAGE 175

175 Santic, M., M. Molmeret, J. R. Barker, K. E. Klose, A. Dekanic, M. Doric & Y. Abu Kwaik, (2007) A Francisella tularensis pathogenicity island protein essential for bacterial proliferation within the host cell cytosol. Cell Microbiol 9 : 23912403. Santic, M., M. Molmeret, K. E. Klose, S. Jones & Y. A. Kwaik, (2005b) The Francisella tularensis pathogenicity island protein IglC and its regulator MglA are essential for modulating phagosome biogenesis an d subsequent bacterial escape into the cytoplasm. Cell Microbiol 7 : 969 979. Saslaw, S. & H. N. Carlisle, (1961) Studies with tularemia vaccines in volunteers. IV. Brucella aggiutinins in vaccinated and nonvaccinated volunteers challenged with Pasteurella tularensis Am J Med Sci 242 : 166 172. Saslaw, S., H. T. Eigelsbach, J. A. Prior, H. E. Wilson & S. Carhart, (1961a) Tularemia vaccine study. II. Respiratory challenge. Arch Intern Med 107 : 702 714. Saslaw, S., H. T. Eigelsbach, H. E. Wilson, J. A. Prior & S. CarhartT, (1961b) Tularemia vaccine study. I. Intracutaneous challenge. Arch Intern Med 107 : 689 701. Schellhorn, H. E., J. P. Audia, L. I. Wei & L. Chang, (1998) Identification of conserved, RpoS dependent stationary phase genes of Escherichia coli. J Bacteriol 180: 62836291. Schiano, C. A., L. E. Bellows & W. W. Lathem, (2010) The small RNA chaperone Hfq is required for the virulence of Yersinia pseudotuberculosis Infect Immun 78: 20342044. Schmerk, C. L., B. N. Duplantis, D. Wang, R. D. Burke, A. Y. Chou, K. L. Elkins, J. S. Ludu & F. E. Nano, (2009) Characterization of the pathogenicity island protein PdpA and its role in the virulence of Francisella novicida Microbiology 155 : 14891497. Schulert, G. S. & L. A. Allen, (2006) Differential infection of mononuclear phagocytes by Francisella tularensis : role of the macrophage mannose receptor. J Leukoc Biol 80: 563571. Schurig Briccio, L. A., R. N. Faras, M. R. Rintoul & V. A. Rapisarda, (2009) Phosphateenhanced stationary phase fitness of Escherichia coli is related to inorganic polyphosphate level. J Bacteriol 191: 44784481. Seshasayee, A. S., P. Bertone, G. M. Fraser & N. M. Luscombe, (2006) Transcriptional regulatory networks in bacteria: from input signals to output responses. Curr Opin Microb iol 9 : 511 519.

PAGE 176

176 Seyfzadeh, M., J. Keener & M. Nomura, (1993) spoT dependent accumulation of guanosine tetraphosphate in response to fatty acid starvation in Escherichia coli. Proc Natl Acad Sci U S A 90 : 1100411008. Sheehan, D., G. Meade, V. M. Foley & C. A. Dowd, (2001) Structure, function and evolution of glutathione transferases: implications for classification of nonmammalian members of an ancient enzyme superfamily. Biochem J 360 : 1 16. Shi, Y., T. Latifi, M. J. Cromie & E. A. Groisman, (2004) Transc riptional control of the antimicrobial peptide resistance ugtL gene by the Salmonella PhoP and SlyA regulatory proteins. J Biol Chem 279: 3861838625. Shiba, T., K. Tsutsumi, H. Yano, Y. Ihara, A. Kameda, K. Tanaka, H. Takahashi, M. Munekata, N. N. Rao & A Kornberg, (1997) Inorganic polyphosphate and the induction of rpoS expression. Proc Natl Acad Sci U S A 94: 11210 11215. Siemsen, D. W., L. N. Kirpotina, M. A. Jutila & M. T. Quinn, (2009) Inhibition of the human neutrophil NADPH oxidase by Coxiella burn etii. Microbes Infect 11 : 671 679. Silchenko, V., (1957) Epidemiological and clinical features of tularemia casued by waterborne infection. Zh Mikrobiol Epidemiol Immunobiol 28: 788795. Sittka, A., V. Pfeiffer, K. Tedin & J. Vogel, (2007) The RNA chaperone Hfq is essential for the virulence of Salmonella typhimurium Mol Microbiol 63: 193217. Skaar, E. P., (2010) The battle for iron between bacterial pathogens and their vertebrate hosts. PLoS Pathog 6 Solioz, M. & C. Vulpe, (1996) CPx type ATPases: a class of P type ATPases that pump heavy metals. Trends Biochem Sci 21: 237 241. Sory, M. P. & G. R. Cornelis, (1994) Translocation of a hybrid YopE adenylate cyclase from Yersinia enterocolitica into HeLa cells. Mol Microbiol 14: 583 594. Srivatsan, A. & J. D Wang, (2008) Control of bacterial transcription, translation and replication by (p)ppGpp. Curr Opin Microbiol 11: 100105. Staab, C. A., M. Hellgren & J. O. Hg, (2008) Medium and short chain dehydrogenase/reductase gene and protein families: Dual func tions of alcohol dehydrogenase 3: implications with focus on formaldehyde dehydrogenase and S nitrosoglutathione reductase activities. Cell Mol Life Sci 65: 39503960. Stallings, C. L., N. C. Stephanou, L. Chu, A. Hochschild, B. E. Nickels & M. S. Glickman (2009) CarD is an essential regulator of rRNA transcription required for Mycobacterium tuberculosis persistence. Cell 138: 146 159.

PAGE 177

177 Stent, G. S. & S. Brenner, (1961) A genetic locus for the regulation of ribonucleic acid synthesis. Proc Natl Acad Sci U S A 47: 2005 2014. Storz, G., J. A. Opdyke & A. Zhang, (2004) Controlling mRNA stability and translation with small, noncoding RNAs. Curr Opin Microbiol 7 : 140144. Stoyanov, J. V., J. L. Hobman & N. L. Brown, (2001) CueR (YbbI) of Escherichia coli is a Mer R family regulator controlling expression of the copper exporter CopA. Mol Microbiol 39: 502511. Sullivan, J. T., E. F. Jeffery, J. D. Shannon & G. Ramakrishnan, (2006) Characterization of the siderophore of Francisella tularensis and role of fslA in siderophore production. J Bacteriol 188: 37853795. Summers, A. O., (1992) Untwist and shout: a heavy metal responsive transcriptional regulator. J Bacteriol 174 : 30973101. Svensson, K., P. Larsson, D. Johansson, M. Bystrm, M. Forsman & A. Johansson, (2005) Evolution of subspecies of Francisella tularensis J Bacteriol 187: 39033908. Sze, C. C. & V. Shingler, (1999) The alarmone (p)ppGpp mediates physiological responsive control at the sigma 54dependent Po promoter. Mol Microbiol 31 : 12171228. Taha, M. K., B. Dupuy, W. Saurin, M. So & C. Marchal, (1991) Control of pilus expression in Neisseria gonorrhoeae as an original system in the family of twocomponent regulators. Mol Microbiol 5 : 137 148. Talisuna, A. O., P. Bloland & U. D'Alessandro, (2004) History, dynamics, and public health importance of malaria parasite resistance. Clin Microbiol Rev 17: 235254. Tempel, R., X. H. Lai, L. Crosa, B. Kozlowicz & F. Heffron, (2006) Attenuated Francisella novicida transposon mutants protect mice against wildtype chal lenge. Infect Immun 74 : 50955105. Thompson, A., M. D. Rolfe, S. Lucchini, P. Schwerk, J. C. Hinton & K. Tedin, (2006) The bacterial signal molecule, ppGpp, mediates the environmental regulation of both the invasion and intracellular virulence gene program s of Salmonella. J Biol Chem 281: 30112 30121. Tigertt, W. D., (1962) Soviet viable Pasteurella tularensis vaccines. A review of selected articles. Bacteriol Rev 26: 354373. Tran, H., S. Bongarzone, P. Carloni, G. Legname & M. Bolognesi, (2010) Synthesis and evaluation of a library of 2,5bisdiamino benzoquinone derivatives as probes to

PAGE 178

178 modulate proteinprotein interactions in prions. Bioorg Med Chem Lett 20 : 18661868. Traxler, M. F., S. M. Summers, H. T. Nguyen, V. M. Zacharia, G. A. Hightower, J. T. Smi th & T. Conway, (2008) The global, ppGppmediated stringent response to amino acid starvation in Escherichia coli Mol Microbiol 68: 11281148. Twine, S., M. Bystrm, W. Chen, M. Forsman, I. Golovliov, A. Johansson, J. Kelly, H. Lindgren, K. Svensson, C. Z ingmark, W. Conlan & A. Sjstedt, (2005) A mutant of Francisella tularensis strain SCHU S4 lacking the ability to express a 58kilodalton protein is attenuated for virulence and is an effective live vaccine. Infect Immun 73: 8345 8352. Tyeryar, F. J. & W. D. Lawton, (1969) Transformation of Pasteurella novicida. J Bacteriol 100: 11121113. Trnvik, A., G. Sandstrm & A. Sjstedt, (1996) Epidemiological analysis of tularemia in Sweden 19311993. FEMS Immunol Med Microbiol 13 : 201 204. Umland, T., K. Taylor, S. Rhee, R. Wickner & D. Davies, (2001) The crystal structure of the nitrogen regulation fragment of the yeast prion protein Ure2p. Proc Natl Acad Sci U S A 98: 14591464. Vedadi, M., F. Niesen, A. AllaliHassani, O. Fedorov, P. J. Finerty, G. Wasney, R. Y eung, C. Arrowsmith, L. Ball, H. Berglund, R. Hui, B. Marsden, P. Nordlund, M. Sundstrom, J. Weigelt & A. Edwards, (2006) Chemical screening methods to identify ligands that promote protein stability, protein crystallization, and structure determination. P roc Natl Acad Sci U S A 103 : 1583515840. Vignais, P. V., (2002) The superoxidegenerating NADPH oxidase: structural aspects and activation mechanism. Cell Mol Life Sci 59 : 14281459. Vinella, D., C. Albrecht, M. Cashel & R. D'Ari, (2005) Iron limitation i nduces SpoT dependent accumulation of ppGpp in Escherichia coli Mol Microbiol 56: 958 970. Vonkavaara, M., M. V. Telepnev, P. Rydn, A. Sjstedt & S. Stven, (2008) Drosophila melanogaster as a model for elucidating the pathogenicity of Francisella tularensis Cell Microbiol 10: 13271338. Wehrly, T., A. Chong, K. Virtaneva, D. Sturdevant, R. Child, J. Edwards, D. Brouwer, V. Nair, E. Fischer, L. Wicke, A. Curda, J. r. Kupko, C. Martens, D. Crane, C. Bosio, S. Porcella & J. Celli, (2009) Intracellular biol ogy and virulence determinants of Francisella tularensis revealed by transcriptional profiling inside macrophages. Cell Microbiol 11: 1128 1150.

PAGE 179

179 Weiss, D. S., A. Brotcke, T. Henry, J. J. Margolis, K. Chan & D. M. Monack, (2007) In vivo negative selection s creen identifies genes required for Francisella virulence. Proc Natl Acad Sci U S A 104 : 60376042. Wells, J. & C. McClendon, (2007) Reaching for highhanging fruit in drug discovery at proteinprotein interfaces. Nature 450 : 10011009. Wherry, W. B. & B. H. Lamb, (1914) Infection of a man with Bacterium tularense. J. Infect. Dis. 15 : 331 340. Whipp, M. J., J. M. Davis, G. Lum, J. de Boer, Y. Zhou, S. W. Bearden, J. M. Petersen, M. C. Chu & G. Hogg, (2003) Characterization of a novicida like subspecies of F rancisella tularensis isolated in Australia. J Med Microbiol 52 : 839 842. Whipple, F., (1998) Genetic analysis of prokaryotic and eukaryotic DNA binding proteins in Escherichia coli Nucleic Acids Res 26: 37003706. Williams, M., J. Fuchs & M. Flickinger, (1991) Null mutation in the stringent starvation protein of Escherichia coli disrupts lytic development of bacteriophage P1. Gene 109: 21 30. Williams, M. D., T. X. Ouyang & M. C. Flickinger, (1994a) Glutathione S transferasesspA fusion binds to E. coli R NA polymerase and complements sspA mutation allowing phage P1 replication. Biochem Biophys Res Commun 201: 123127. Williams, M. D., T. X. Ouyang & M. C. Flickinger, (1994b) Starvation induced expression of SspA and SspB: the effects of a null mutation in sspA on Escherichia coli protein synthesis and survival during growth and prolonged starvation. Mol Microbiol 11: 10291043. Willke, A., M. Meric, R. Grunow, M. Sayan, E. J. Finke, W. Splettstsser, E. Seibold, S. Erdogan, O. Ergonul, Z. Yumuk & S. Gediko glu, (2009) An outbreak of oropharyngeal tularaemia linked to natural spring water. J Med Microbiol 58 : 112 116. Wiseman, T., S. Williston, J. Brandts & L. Lin, (1989) Rapid measurement of binding constants and heats of binding using a new titration calori meter. Anal Biochem 179: 131 137. Wood, H. G. & J. E. Clark, (1988) Biological aspects of inorganic polyphosphates. Annu Rev Biochem 57: 235 260. Workman, P. & I. Collins, (2010) Probing the probes: fitness factors for small molecule tools. Chem Biol 17: 5 61577.

PAGE 180

180 Xiao, H., M. Kalman, K. Ikehara, S. Zemel, G. Glaser & M. Cashel, (1991) Residual guanosine 3',5' bispyrophosphate synthetic activity of relA null mutants can be eliminated by spoT null mutations. J Biol Chem 266: 59805990. Yang, Z. X., Y. N. Zhou Y. Yang & D. J. Jin, (2010) Polyphosphate binds to the principal sigma factor of RNA polymerase during starvation response in Helicobacter pylori Mol Microbiol 77: 618627. Zhang, H., K. Ishige & A. Kornberg, (2002) A polyphosphate kinase (PPK2) widely conserved in bacteria. Proc Natl Acad Sci U S A 99 : 1667816683. Zhao, G., N. Weatherspoon, W. Kong, R. Curtiss & Y. Shi, (2008) A dual signal regulatory circuit activates transcription of a set of divergent operons in Salmonella typhimurium Proc Natl Aca d Sci U S A 105 : 2092420929. Zheng, D., C. Constantinidou, J. L. Hobman & S. D. Minchin, (2004) Identification of the CRP regulon using in vitro and in vivo transcriptional profiling. Nucleic Acids Res 32: 58745893. Zheng, J. & K. Y. Leung, (2007) Dissec tion of a type VI secretion system in Edwardsiella tarda. Mol Microbiol 66: 11921206.

PAGE 181

181 BIOGRAPHICAL SKETCH Algevis P Wrench was born in Venezuela i n 1985. She moved to the United States in 2000 and graduated from high school in 2002. She attended Browar d Colle ge from 2004 to 2006 earning an Associate in Arts on biology with the hig h est honor. Algevis then attended Florida Atlantic University and, eventually transferred to the University of Florida. She graduated in 2008 cum laude with a Bachelor of Scien ce in microbiology and animal biology As an undergraduate student Algevis research interest expanded while working in Dr. Claudio Gonzalez Lab oratory She then started in the University of Florida graduate program in August 2008 under the guidance of Dr. Graciela Lorca. As a graduate student, she has attended research symposiums such as the Florida Genetics Institute Annual Symposium (2008, 2010), the Graduate Student Council Interdisciplinary Research Conference (2010), the NSF Research Day (2009), the E merging Pathogens Institute Research Day (2010, 2011), the America Society of Microbiology (ASM) Conference on Antimicrobial Resistance in Zoonotic Bacteria and Foodborne Pathogens in Animals, Humans and the Environment (2010), and the ASM General and Bran ch Meetings (2011) She received the Graduate Student Council Travel Award in 2010 and the ASM General Meeting Travel Grant in 2011. In addition, she has served as a mentor for three undergraduate students, Jonathan Pavlinec, Frank Sun, and Sara Siegel. Sh e has served as the secretary (20092010) and the department representative (20092011) for the University of Florida Graduate Student Council. She has assi sted as the graduate student representative for the departments Administrative Council Committee t he Microbiology and Cell Science

PAGE 182

182 Seminar Series, the 2010 P. K. Yonge 8th grade Science Fair and the 2011 Undergraduate M icrobiology Research Symposium. The work presented in this document has generated one manuscript which in under review. Upon completion of her degree, Algevis plans to pursue a career in microbiology with a government agency or a biotechnology company.