<%BANNER%>

In Vitro Human T Cell Development and The Effect of Interleukin-7

Permanent Link: http://ufdc.ufl.edu/UFE0043726/00001

Material Information

Title: In Vitro Human T Cell Development and The Effect of Interleukin-7
Physical Description: 1 online resource (155 p.)
Language: english
Creator: Patel, Ekta S
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: cell -- interleukin-7 -- t
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: T cell develops from hematopoietic precursor cells (HPCs) in thymus. The earliest precursors are CD8-CD4- (DN), the next stage is CD4+CD8+ double positive (DP), and finally differentiate to t cell receptor (TCR) bearing CD4 or CD8 single positive (SP). A retroviral modified OP9 cell line expressing Notch ligand, Delta-like 1(DL1), when supplemented with Fms like tyrosine kinase-3 ligand (Flt3L) and Interleukin-7 (IL-7) can support murine and human T cell development. Here we established a lentiviral vector-engineered OP9 stromal cell line expressing the DL1 (LmDL1), to circumvent retrovirus silencing issue. Next, we evaluated T-cell development from human HPCs with various origins including fetal thymus (FT), fetal liver (FL), cord blood (CB) and adult bone marrow (BM). Consequently, the LmDL1 culture system illustrated diverse T-cell development potentials of pre- and post-natal and adult human BM HPCs as assessed by fold expansion and stages of T cell differentiation. BM HPCs are an ideal candidate for immunotherapy; however these cells show poor proliferation do not differentiate to efficient differentiation to CD3hiTCRaßhi DP stage a precursor to mature T cells. First, we modified LmDL1 cells to express IL-7 and Flt3L (LmDL1-FL7) and observed enhanced T cell precursor expansion of adult BM HPCs. Notch and pre-TCR signaling promotes and IL-7 DN to DP transition during murine T cell development in vitro. Prolonged coculture on in presence of notch did not promote differentiation to CD3hiTCRaßhi DP, so we evaluated if IL-7 had an inhibitory effect in this process. We deprived T cell precursors of IL-7 during the DN stage of T cell development. IL-7 removal promoted a slight increase in DP population but no significant CD3hiTCRaßhi DP was observed. In humans pre-TCR signaling occurs during CD3low DP stage and allows transit to CD3hi DP stage. Finally, we introduced anti-CD3 stimulation to mimic pre-TCR signaling. We found that IL-7 deprived T cell precursors when stimulated with anti-CD3 antibody differentiated into CD3+TCRaß+DP cells and eventually to functionally mature CD4 T cells. Thus we report for the first time functional maturation of human BM HPCs to CD4 T cells in vitro. Our data show IL-7 inhibits transition of DN to DP CD3low stage and not of DP CD3low to DP CD3hi stage. As pre-TCR signaling occurs in DPCD3low stage, our results contradict the previous theory of IL-7 inhibiting pre-TCR signaling. In order to evaluate the direct effect of IL-7 on pre-TCR signaling, we overexpressed IL-7Ra in T-ALL T cell precursor cell line Molt3. Here, we demonstrate IL-7 enhanced pre-TCR activation as shown by expression of CD25 activation marker in response to anti-CD3 stimulation in Akt and Erk1/2 dependent pathways. Thus, our study demonstrates a co-operative role of IL-7 in pre-TCR signaling. Findings, from this study will advance the understanding of human T-cell development as it occurs in vitro and has implications for immunotherapy.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Ekta S Patel.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Chang, Lung-Ji.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043726:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043726/00001

Material Information

Title: In Vitro Human T Cell Development and The Effect of Interleukin-7
Physical Description: 1 online resource (155 p.)
Language: english
Creator: Patel, Ekta S
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: cell -- interleukin-7 -- t
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: T cell develops from hematopoietic precursor cells (HPCs) in thymus. The earliest precursors are CD8-CD4- (DN), the next stage is CD4+CD8+ double positive (DP), and finally differentiate to t cell receptor (TCR) bearing CD4 or CD8 single positive (SP). A retroviral modified OP9 cell line expressing Notch ligand, Delta-like 1(DL1), when supplemented with Fms like tyrosine kinase-3 ligand (Flt3L) and Interleukin-7 (IL-7) can support murine and human T cell development. Here we established a lentiviral vector-engineered OP9 stromal cell line expressing the DL1 (LmDL1), to circumvent retrovirus silencing issue. Next, we evaluated T-cell development from human HPCs with various origins including fetal thymus (FT), fetal liver (FL), cord blood (CB) and adult bone marrow (BM). Consequently, the LmDL1 culture system illustrated diverse T-cell development potentials of pre- and post-natal and adult human BM HPCs as assessed by fold expansion and stages of T cell differentiation. BM HPCs are an ideal candidate for immunotherapy; however these cells show poor proliferation do not differentiate to efficient differentiation to CD3hiTCRaßhi DP stage a precursor to mature T cells. First, we modified LmDL1 cells to express IL-7 and Flt3L (LmDL1-FL7) and observed enhanced T cell precursor expansion of adult BM HPCs. Notch and pre-TCR signaling promotes and IL-7 DN to DP transition during murine T cell development in vitro. Prolonged coculture on in presence of notch did not promote differentiation to CD3hiTCRaßhi DP, so we evaluated if IL-7 had an inhibitory effect in this process. We deprived T cell precursors of IL-7 during the DN stage of T cell development. IL-7 removal promoted a slight increase in DP population but no significant CD3hiTCRaßhi DP was observed. In humans pre-TCR signaling occurs during CD3low DP stage and allows transit to CD3hi DP stage. Finally, we introduced anti-CD3 stimulation to mimic pre-TCR signaling. We found that IL-7 deprived T cell precursors when stimulated with anti-CD3 antibody differentiated into CD3+TCRaß+DP cells and eventually to functionally mature CD4 T cells. Thus we report for the first time functional maturation of human BM HPCs to CD4 T cells in vitro. Our data show IL-7 inhibits transition of DN to DP CD3low stage and not of DP CD3low to DP CD3hi stage. As pre-TCR signaling occurs in DPCD3low stage, our results contradict the previous theory of IL-7 inhibiting pre-TCR signaling. In order to evaluate the direct effect of IL-7 on pre-TCR signaling, we overexpressed IL-7Ra in T-ALL T cell precursor cell line Molt3. Here, we demonstrate IL-7 enhanced pre-TCR activation as shown by expression of CD25 activation marker in response to anti-CD3 stimulation in Akt and Erk1/2 dependent pathways. Thus, our study demonstrates a co-operative role of IL-7 in pre-TCR signaling. Findings, from this study will advance the understanding of human T-cell development as it occurs in vitro and has implications for immunotherapy.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Ekta S Patel.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Chang, Lung-Ji.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043726:00001


This item has the following downloads:


Full Text

PAGE 1

1 IN VITRO HUMAN T CELL DEVELOPMENT AND THE EFFECT OF INTERLEUKIN 7 By EKTA PATEL A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DO CTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Ekta Patel

PAGE 3

3 To Samir, Khushee and Yash

PAGE 4

4 ACKNOWLEDGMENTS I thank my p arents Rajendrakumar Patel and Pushpa Patel for their unconditional love unwavering support and their tremendous he lp with raising my children I am eternally grateful to my husband Samir Patel for always believing in me and for being by my side I thank my daughter Khushee and my son Yash, for always brightening my day with their smiles. Special thanks to my mentor Dr Lung Ji Chang, who gave me the opportunity to work in his lab. My gratitude also goes to Dr. Nao Terada, Dr. Lijun Yang, and Dr Gulig for serving on my committee and helping me shape up my project. My deepest gratitude also goes to my lab mates, who hav e become very close friends, and the best group of people I could ever hope to work with. I would like to thank Dr. Shuhong Han Dr. Matthew cotter and Wayne Chou for their help and guidance with my first attempt at f low c ytometry. I am thankful to Dr. Cha ng for imparting his wisdom in designing of complex cloning strategies. I thank Daniel Silver who helped me learn immunofluorescence techniques. Thank you, Star for always being by my side. Without your ears and thoughtful advice, I would be so lost in gra duate school. My friends have been of up most importance I thank Mansi Parekh, for helping me with everything and anything from qualifying exam to dissertation defense Thank you Rabia for bringing so much humor into my life and for always being a phone call away f rom car troubles to emotional support I could not have done any of this without

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LI ST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRA CT ................................ ................................ ................................ ................... 13 CHAPTER 1 OVERVIEW ................................ ................................ ................................ ............ 15 Characterization of the T cell Development in Men and Mice ................................ 15 Hematopoietic Progenitor Cells ................................ ................................ ........ 18 Lymphoid Precursors ................................ ................................ ........................ 19 Early T cell Development Events ................................ ................................ ...... 21 Early stages of T cell development ................................ ............................ 21 T lineage commitment ................................ ................................ ................ 22 cell lineage commitment ................................ ......................... 23 selection ................................ ....................... 23 ................................ ................................ ................ 25 Late T cell Development Events ................................ ................................ ....... 26 T cell positive and negative selection ................................ ......................... 26 CD4 versus CD8 lineage comm itment ................................ ....................... 27 IL 7 and T cell Development ................................ ................................ ................... 27 Models for Studying Human T cell Development ................................ .................... 29 Mouse Models ................................ ................................ ................................ .. 29 In vitro Models ................................ ................................ ................................ .. 30 Fetal thymus organ culture ................................ ................................ ......... 30 OP9 culture system ................................ ................................ .................... 31 2 ASSESSMENT OF T CELL DEVELOPMENT OF HUMAN FL, FT, CB AND BM IN VITRO USING LMDL1 CELL LINE ................................ .............................. 33 Introduction ................................ ................................ ................................ ............. 33 Material and Methods ................................ ................................ ............................. 34 Cells ................................ ................................ ................................ ................. 34 In vitro T cell Development ................................ ................................ ............... 35 Monoclonal Antibodies and Flow Cytometry ................................ ..................... 35 Results ................................ ................................ ................................ .................... 35 Expression of DL1 in LmDL1 Stromal Cells ................................ ...................... 35 Proliferation of CD34 + HPCs of FT, FL, CB and Adult BM on LmDL1 .............. 36

PAGE 6

6 FT Derived and FL Derived HPCs on LmDL1 ................................ .................. 37 CB HPCs on LmDL1 ................................ ................................ ......................... 38 Adult BM Derived CD34 HPCs on LmDL1 ................................ ....................... 39 T cell Development Potential of Various HPCs ................................ ................ 39 Discussion ................................ ................................ ................................ .............. 40 3 REGULATION OF IN VIT RO ADULT HUMAN T CELL DEVELOPMENT THROUGH INTERLEUKIN 7 DEPRIVATION AND ANTI CD3 STIMULATION ...... 48 Introduction ................................ ................................ ................................ ............. 48 Materials and Me thods ................................ ................................ ............................ 50 Human CD34 + HPCs and Cell Lines ................................ ................................ 50 LmDL1 Stromal Cell CD34 + HPC Co culture ................................ .................. 50 Monoclonal Antibodies and Flow Cytometry ................................ ..................... 51 T cell Stimulation and Effector Function Analysis ................................ ............. 52 RT PCR ................................ ................................ ................................ ............ 52 TREC Analysis ................................ ................................ ................................ 53 DC:T cell Co Culture ................................ ................................ ........................ 54 Results ................................ ................................ ................................ .................... 54 T cell Precursor Expansion on LmDL1 FL7 Cell Line ................................ ....... 54 Adult BM CD34 + HPCs T cell Differentiation on LmDL1 FL7 ............................ 55 Effect of IL 7 Deprivation on DN to DP Transition ................................ ............ 56 Effect of IL 7 Withdraw on T Cell Receptor Excision Circle (TREC) ................. 57 Effect of Anti CD3 Stimulation on IL 7 Primed and on IL 7 Deprived T cell Precursors ................................ ................................ ................................ ..... 58 in vitro Generated CD4 T cells .......................... 59 CD8 Lineage Commitment in vitro ................................ ................................ .... 60 Antigen Specificity in vitro ................................ ................................ ................. 61 Discussion ................................ ................................ ................................ .............. 62 4 IL 7 ENHANCES PRE TCR SIGNALING BY ACTIVATING ERK1/2 AND AKT PATHWAYS IN HUMAN THYMOCYTE CELL LINE ................................ ............... 83 Introduction ................................ ................................ ................................ ............. 83 Materials and Methods ................................ ................................ ............................ 85 Flow Cytometry and Antibodies ................................ ................................ ........ 85 Lentiviral Vector Construction and Transduction ................................ .............. 86 Inhibitors ................................ ................................ ................................ ........... 88 RT PCR and Real Time PCR ................................ ................................ ........... 88 Intracellular Ca2 + Measurements ................................ ................................ ..... 89 Western Blot ................................ ................................ ................................ ..... 90 Statistical Analysis ................................ ................................ ............................ 90 Immunofluorescence ................................ ................................ ........................ 90 Results ................................ ................................ ................................ .................... 91 Characterization of T ALL Cell Lines ................................ ................................ 91 Response to IL 7 and Anti CD3 Stimulation in Molt3 Cell Line Overexpressing IL ................................ ................................ ................. 92

PAGE 7

7 Effect of IL 7 on Pre TCR Signal ................................ ................................ ...... 93 Identi fication of Pre TCR Signaling Pathway in Molt3 ................................ ...... 93 Effect of IL 7 on Pre TCR Mediated Erk1/2 and Akt Activation ........................ 94 Dynamics of IL 7R and CD3 ................................ ................................ ......... 95 Role of IL 7R in pre TCR signaling ................................ ................................ 96 Discussion ................................ ................................ ................................ .............. 96 5 CONCLUSIONS ................................ ................................ ................................ ... 10 9 Findings and Future Directions ................................ ................................ ............. 109 Highlights in T cell Development How Far We Have Come? .............................. 112 Lymphoid Precursors ................................ ................................ ...................... 112 Early Events: selection and DN to DP Transition ................................ ........ 113 Positive and Negative selection ................................ ................................ ...... 114 CD4 versus CD8 Lineage Commitment ................................ .......................... 115 Advances in T cell Development Culture System ................................ ........... 117 IL 7/IL 7R in T cell Development ................................ ................................ .......... 118 Knockout/Transgenic Mice Compared to Patients with Mutations ........................ 119 IL 7 ................................ ................................ ................................ ................. 119 ZAP70 ................................ ................................ ................................ ............ 120 MHC ................................ ................................ ................................ ............... 120 Clinical Implications ................................ ................................ .............................. 121 In vitro T cell Development ................................ ................................ ............. 121 Interleukin 7 ................................ ................................ ................................ .... 122 APPENDIX A ANALYSIS OF T CELL DEVELOPMENT OF HPC EXPANDED BY CULTURING ON OP9KFT63KF ................................ ................................ ........... 123 B GENERATION OF DC PRECURSOR/LMDL1 FL7 FUSION CELL LINE ............. 125 C LENTIVIRAL INFECTION OF DIFFERENTIATING T CELL PRECURSORS ....... 127 D INTRINSIC DIFFERENCES IN CD34 + HPCS FROM DIFFERENT DONORS ..... 128 LIST OF REFERENCES ................................ ................................ ............................. 131 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 155

PAGE 8

8 LIST OF TABLES Table page C 1 Lentivector infection of differentiating T cell precursors ................................ .... 127

PAGE 9

9 LIST OF FIGURES Figure page 2 1 Proliferation and survival potential of fetal thymus, fetal liver, cord blood and adult bone marrow derived CD34 + HSC. ................................ ..................... 43 2 2 T cell development kinetics of CD34 + HPCs derived from FT and FL in the LmDL1 co culture. ................................ ................................ .............................. 44 2 3 T cell development kinetics of CD34 + HPCs derived from CB.. .......................... 45 2 4 T cell development kinetics of CD34 + HPCs derived from adult BM.. ................. 46 2 5 Paralleled overview of T cell development kinetics of CD34 + HPCs derived f rom FT, FL, CB and adult BM. ................................ ................................ ........... 47 3 1 Establishment of LmDL1 FL7 cell line and evaluation of growth of CD34 + HPC of adult BM origin. ................................ ................................ ............ 67 3 2 T cell development kinetics of adult BM CD34 + HPC on LmDL1+IL 7+Flt3L or LmDL1 FL7 co culture condition. ................................ ................................ ... 68 3 3 T cell development kinetics of adult BM CD34 + HPC on LmDL1+IL 7+Flt3L o r LmDL1 FL7 co culture condition. ................................ ................................ ... 69 3 4 The effect of IL 7 withdrawal on T cell differentiation. ................................ ......... 70 3 5 Titration curves of clo ned Rag2 and TREC templates of known concentrations. ................................ ................................ ................................ ... 71 3 6 The effect of IL + HPC in the LmDL1 co cultures. ................................ ................................ ................... 72 3 7 Effect of anti CD3/CD28 co stimulation on IL 7 primed and IL 7 deprived precursors. ................................ ................................ ................................ .......... 73 3 8 Effect of IL 7 deprivation and anti CD3/CD28 co stimulation on T cell maturation. ................................ ................................ ................................ .......... 74 3 9 Evaluation of NK cell markers on in vi tro differentiated CD4 T cells. .................. 75 3 10 Analysis of effector functions of the in vitro derived CD4 T cells. ....................... 76 3 11 in vitro derived CD4 T cells. .......................... 77 3 12 Effect of ionomycin and IL 7 on CD8 versus CD4 lineage commitment. ............ 78 3 13 Effect of duration of TCR stimulation on CD8 or CD4 lineage commitment. ....... 79

PAGE 10

10 3 14 Dendritic cell precursor development for BM HPCs. ................................ ........... 80 3 15 Antigen recall assay for in vitro derived T cells. ................................ .................. 81 3 16 Summary of human T cell development in vitro ................................ .................. 82 4 1 Pre TCR and IL 7 Receptor expression in T ALL cell lines. ............................... 99 4 2 Response to IL 7 and anti CD3 stimulation in lentivirus modified T ALL cell lines. ................................ ................................ ................................ ................. 100 4 3 SupT1 does not respond to anti CD3 or IL 7 stimulation. ................................ 101 4 4 IL 7 enhances anti CD3 induced pre TCR signaling as assessed by CD25 expression. ................................ ................................ ................................ ....... 102 4 5 Pre TCR signals via ERK1/2 and AKT pathway. ................................ ............. 103 4 6 Kinetics of STAT5, AKT and Erk1/2 activation in IL hi Molt3. ..................... 104 4 7 IL 7 activates STAT5, Akt and Erk1/2. ................................ .............................. 105 4 8 IL hinge mApple fusion protein. ................................ ................................ 106 4 9 Dynamics of IL ................................ ...................... 107 4 10 IL TCR signaling. ................................ ................... 108 A 1 Evaluation of T cell development of BM CD34 + HPCs expanded on OP9KFT63KF ................................ ................................ ................................ ... 124 B 1 Generation of in vitro derived DC precursor and LmDL1 FL7 fusion cell line.. ................................ ................................ ................................ .................. 126 D 1 CD34 + HPCs obtained from AllCells and ReachBio ................................ .......... 129 D 2 T cell development of CD34 + HPCs obtained from AllCells and ReachBio. ...... 130

PAGE 11

11 LIST OF ABBREVIATION S BM Bone marrow FT Fetal thymus FL Fetal liver CB Cord blood HPC Hematopoietic precursor c ell DL1 Delta like 1 Flt3L Fms like tyrosine kinase 3 ligand IL 7 Interleukin 7 IL 2 Interleukin 2 IL 6 Interleukin 6 IL 3 Interleukin 3 IL 15 Interleukin 15 TPO Thrombopoietin SCF Stem cell factor MCSF Macrophage colony stimulating factor LmDL1 Lentivirus expressing mouse Delta like 1 in OP9 LmDL1 FL Lentivirus expressing mouse Delta like 1, human Flt3L in OP9 LmDL1 FL7 Lentivirus expressi ng mouse Delta like1, human Flt3L IL 7 in OP9 OP9KFt63KF Lentivirus expressing SCF, Flt3L IL 6, IL 3 in OP9 OP9GM15 Lentivirus expressing GMCSF and IL 15 in OP9 DN Double negative for CD8 and CD4 DP Double positive for CD8 and CD4 ISP Immature single pos itive SP Single positive

PAGE 12

12 FTOC Fetal thymic organ culture TREC T cell receptor excision circle RAG R ecomb ination activating gene 1 MHC Major H istocompatibility com p lex HLA Human leukocyte antigen DC Dendritic cell NK Natural killer cell TCR T cell receptor Pre TCR Precursor T cell receptor CD Cluster of differentiation AKT Phosphatidylinositol 3 kinase and protein k inase B JAK 3 Janus activated kinase 3 ERK Extracellular regulated k inase STAT Signal t ransducer and a ctivator of t ranscription PCR Polymerase ch ain reaction RT PCR Reverse transcriptase polymerase chain reaction PTEN Phosphatase and Tensin Homolog eGFP Enhanced green fluorescent protein mApple Monomeric apple fluorescent protein

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy IN VITRO HUMAN T CELL DEVELOPMENT AND THE EFFECT OF INTERLEUKIN 7 By E kta P atel December 2011 Chair: Lung Ji Chang Major: Medical S ciences Immunology & Microbiology Hematopoietic precursor cells (HPCs) migrate from bone marrow (BM) to thymus where they differentiate into T cells Successful large scale ex vivo production of mature T cells will be of great use for reconstitution or enhancement of the immune system in immune compromised patients. Recently, an in vitro T cell development cultu re system employing murine bone marrow stromal cells (OP9) engineered to express the Notch ligand Delta like 1 (DL1), supplemented with IL 7 and Flt3L has been described to support early T cell differentiation from HPCs. HPCs with T cell differentiation potential are found in cord blood (CB), fetal liver (FL), fetal thymus (FT) and BM. Of these sources, BM HPCs are an ideal candidate for adoptiv e immunotherapy due to ease of obtaining autologous HLA matched HPCs from patients' BM. However, adult BM T cell differentiation in the OP9 in vitro culture system is not well studied. Human T cell development stages in thymus are characterized in the foll owing order: CD8 CD4 (DN), CD4 + CD8 CD3 (ISP), CD4 + CD8 + (DP) CD3 lo DP CD3 hi + CD4 + CD3 hi + or CD8 + CD3 hi + Here, we demonstrate that HPCs of CB, FL, FT, or adult BM origin differ in their T cell development potential in the OP9 in vitro culture system.

PAGE 14

14 Adult BM HPCs yielded limited DP cells in the in vitro culture system. IL 7 was reported to inhibit DN to DP precursor T cell transition in mice, likely by inhibiting pre TCR signaling. Consistent with previous findings we observed that IL 7 withdrawal enhanced DN to DP differentiation. Surprisingly, we found that IL 7 had no inhibitory effect on pre TCR signaling as measured by the formation of T cell receptor excision circles (TREC). To directly evaluate the role of IL 7 on pre TCR signaling we modified a T A LL precursor T cell line Molt3. We report that IL 7 enhanc ed human pre TCR signaling by activating Erk1/2 and Akt signaling pathways. Thus, we conclude that IL 7 inhibition of DN to DP transition is mediated by factors other than pre TCR signaling. Our findings from this study help clarify the role of IL 7 and pr e TCR signaling, and advance the understanding of adult human T cell development in vitro

PAGE 15

15 CHAPTER 1 OVERVIEW Characterization o f t he T c ell D evelopment i n M en a nd M ice T cells have an essential role in an adaptive immune system Yet the necessary sign als directing human hematopoietic precursor cells (HPCs) differentiation to mature T cells remains poorly understood. Further understanding of human T cell development can contribute greatly to establishing in vitro culture systems that induce donor matche d HPCs to develop into mature T cells. Such in vitro derived T cells could be used for cancer immunotherapies, and enhancement or reconstitution of the immune system in HIV patients. Thus successful development and large scale production of ex vivo antige n specific T cells ha ve gained tremendous interest due to its clinical potential However, currently there is no established culture system that allow s for large scale production of T cells in vitro T cells can be first classified in to two broad categori es based on the type of dimerized T cell receptor (TCR ) subunits, expressed on the cell surface namely T cells and T cells expressing and The majority of mature T cell s in lymphoid organs are T cells which are MHC restricted, meaning that they only respond to peptides presented by specific MHC class I or class II molecules. On the other hand, are involved in the surveillance of microbial and non microbial tissue stress without MHC restrictions and only constitute about 1 10% of the total mature T cells ( 1 ) Here we will f ocus on T cell development from HPCs, as they are the dominant and most studied T cell category as well as play a major role in adaptive immune system Expression of either CD8 or CD4 co recepto r separates the mature T cells into the conventionally accepted CD8 +

PAGE 16

16 cytotoxic lymphocytes (CTL) and CD4 + helper T cells (Th) subsets. Both CD8 and CD4 T cells can differentiate into memory T cells and provide long term immunity against a specific anti gen. CD4 + helper T cells are divided into more specific functional subsets, namely Th1, Th2, T regulatory, and Th17 based on their effector cytokine response Another minor subset of T cells are the natural killer T (NKT) cells that express surface mole cules attributed with natural killer (NK) and T cells but will not be discussed further. Due to advances in the developed assay systems such as fetal thymus organ cultures (FTOC), which allow monitoring of T cell differentiation from human precursors, our knowledge about human thymic T cell development has increased considerably. In mic e and humans H P Cs are derived from fetal liver in the pre natal phase and from the bone marrow (BM) after birth. BM HPCs migrate to thymus, where they assemble receptor and develop into mature T cells ( 2 3 ) Successful T cell development requires interaction between the thym ocytes and mixture of thymic stroma consisting of epithelial cells, macrophages, follicular dendritic cells and fibroblasts arrayed in a complex three dimensional architecture ( 4 6 ) As the thymocytes travel through the thymus during T cell development, these individual stromal components play specialized roles at the different stages of differentiation ( 7 8 ) The thymus consists of distinctive cortical and medullary areas, which can be demarcated by the presence of particular stromal cell types and maturation stage s of t hymocy te precursors found in the region. T cell development can be characterized in four steps ( 4 6 9 ) In t he first s tep is hematopoietic stem cell giv ing rise to lymphoid pr ecursor cells a process that occurs

PAGE 17

17 in bone marrow The thymus consists of many lobules, each of which has an inner medullary region which is surrounded by an outer cortex. For the second step, lymp hoid progenitors enter thymus at the junction between the medulla and cortex At the cortico medullary junction the progenitors interact with fibroblasts and epithelial cell s and differentiate from CD8 CD4 double negative (DN) to CD8 + CD4 + double positive (DP) cells During th e DN to DP transition the cells rearrange gene locus, expres s pre TCR complex formed of chain, pre T Signaling via pre TCR complex selects for the cells that have successfully to progress to the next stage, and this process is termed selection The cells that have undergone selection initiate rearrangement at the locus while migrat ing from the medulla to outer cortex In the third step, DP T cells expressing the TCR complex undergo two more selection procedures called positive and negative selection, in which the immature/developing T cells expressing TCR complexes with weak affinity for self antigens survive and high affinity autoreactive cells undergo cell death. DP cells migrate b ack to the cortex medulla junction, w h ere they interact with thymic epithelial cells and dendritic cells. Thymic epithelial cells play a major role in positive selectio n by providing low avidity TCR/ MHC peptide complex interactions. Follicular dendritic ce lls mediate negative selection; however they may not be solely responsible for this process. The fourth and final stage of T cell development is commitment to either CD4 + or CD8 + T cell lineage as the DP cells permanently down regulates one of the two co r eceptors In the end mature T cells migrate to medulla in the thymus from where they enter the blood stream. This migration process, which facilitates T cell development is guided by chemokine

PAGE 18

18 gradients secreted by the region specific thymic stromal cell s ( 10 ) Thus, the need for differentiating T cells to establish physical contact with an uncharacterized thymic st oma cell mix, along with the complexity of multiple thymic microenvironment s makes it difficult to design and successfully establish an in vitro cell culture mo del to support HPC to T cell development. Our u nderstanding of human T cell development is base d on studies done using SCID mouse model ( 11 14 ) excised human thymic tissues ( 15 17 ) by reconstitution of human HPCs in murine FTOC ( 18 22 ) and short term in vitro suspension cultures ( 23 24 ) Although m ice and human s have similar T cell differentiation stages critical differences exist such as, the difference in surface markers used to ch aracterize these stages, timing of selection process and physical differences between the expression and fun ction of key T cell development related receptors such as pre T and IL 7R This chapter includes a paralleled overview of characterization of T cell development stages in mice and humans Hematopoietic Progenitor Cells Initially it was unclear if hematopoietic precursors from bone marrow or resident intrathymic precursors were responsible for generating mature T cells and maintain ed thymopoiesis in post natal life. A study done us ing a parabiotic mouse model confirmed that p rogenitors in the thymus lack self renewing capabilities and have to be constantly imported from bone marrow ( 25 26 ) H ematopoietic progenitor cells were first defined in mice, as Lin Thy 1 lo Lin negative refers to the cells negative for B220 (B cell antigen), CD4 CD8 ( TCR complex co receptor s ), Gr 1 ( g ranulocyte marker), Mac 1 ( M yelomonocytic cell marker ) and Thy 1 lo refers to the cells expressing low levels of thymocyte antigen/CD90 The Lin Thy 1 lo cells were able to

PAGE 19

19 reconstitute all blood cell types when transplanted into bone marrow of sub lethally irradiated m ic e ( 27 ) However, Lin Thy 1 lo expression profile did not distinguish between the true hematopoietic stem cells and the committed progenitor cells. Weissman et al. f urther characterized these cells by utilizing expr ession of stem cell antigen 1( S ca1) and c kit as a dditional differential marker s They further established that a small portion of cells a re Lin Thy 1 lo Sca lo c kit + which represent true hematopoietic stem cells and the Lin Thy 1 lo Sca c kit cells are committed progenitors ( 28 29 ) In humans CD34 + Lin precursors a re defined as early thymic progenitors. Fur ther studies have fractionated the CD34 + Lin adult bone marrow cells based on the expression of CD45RA, Thy 1(CD90), CD38, and HLA DR and showed that the population of CD34 + Lin CD45RA + CD38 + HLA DR + Thy 1 cells is able to differentiate int o granulocyte macr ophage progenitor cells and T cells but not erythroid cells ( 14 ) On the other hand CD34 + Lin CD45RA Thy 1 + cells a re shown to possess T, B, myeloid and erythroid lineage potential. Lymphoid Precursors It is clear that HSCs undergo some differentiation i n bone marrow before entering the thymus. This is based on the evidence that the thymic progenitors are CD7 + CD45RA + Thy 1 and HSCs are CD7 lo/ CD45RA Thy 1 + ( 11 22 30 ) This raise s a question, whether the progenitor cells entering thymus a re already committed to lymphoid li neage at the time of entrance in thymus. The first model of T cell lineage commitment propose s that the common lymphoid progenitor s (CLP) g i ve rise to T, B and NK cells and the common myeloid progenitor (CMP), g i ve rise to myeloid cells ( 31 ) This was based on the studies done by Ak a shi and W eissman in 1997, they

PAGE 20

20 demonstrated that Lin IL 7R + Thy 1 Sca 1 lo c k it lo population from adult mouse bone marrow differentiated in to T, B and NK but not myeloid ce lls in either in vivo reconstitution assay s or methylcellulose assays ( 31 32 ) More recently a revised T cell lineage commitment model is proposed in which, the first lineage commitment step in hematopoiesis is the production of common myelolymphoid progenitors and common myeloerythroid progenitors from HSCs This model suggests that lymphoid progenitors still ret ain myeloid potential but the erythroid potential is lost. This model is based on three studies T he first report showed a common lympho myeloid progenitor in various populations of Lin c kit + cells derived from fetal liver ( 33 ) The s econd study identified Lin Sca 1 lo c Kit lo Flt3 + l ym pho myeloid stem cells lacking e rythro cyte and m egakaryocytic p otential ( 34 ) The thir d study showed that committed T cell progenitors could be reprogrammed to become macrophages and dendritic cells by transcription factors ( 35 ) The above revised murine model is also applicable to human T cell progenitors. In fetal life, progenitor cells that will seed the thymus are derived from the feta l liver and later in adult life are derived from bone marrow ( 36 ) It is now clear that the precursors that seed the human thymus are not exclusively T cell precursors, and can give rise to NK cells and DCs. Thus, common myelolymphoid progenitors giv e rise to T cells and myeloid cells in humans as well. The CD34 antigen is expressed on pluripotent stem cells, lineage committed precursors but is lost upon differentiation ( 21 37 ) Another study isolated CD4 CD8 CD3 thymocytes from postnatal human thymuses and determined their capacity to differentiate into lymphoid and

PAGE 21

21 non lymphoid lineages in vitro This study showed that both CD34 + and CD34 populations were able to give rise to T cell and myeloid precursors as assessed by their ability to form clonal T cell progenitor colonies or clonal non lymphoid hematopoietic progenitor colonies ( 38 ) In summary HSCs give rise to lymphomyeloid precursors which then differentiate to lymphoid precursors and subsequently to T cell precursors. Early T c ell Development Events Early events in T cell development include commitment of HPCs to lymphoid proge nitors, to T lineage, followed by versus lineage diversification, and then selection in case of T cells and are characterized as follows: Early stages of T cell development The earliest thymic progenitors are defined as double negative (DN) thym ocytes, which do not express CD4 or CD8. In murine T cell development DN thymocytes are further separated into four sequential phenotypic stages (DN1 to DN4) on the basis of CD44 and CD25 expression CD44 + CD25 (DN1), CD44 + CD25 + (DN2), CD44 CD25 + (DN3) and CD44 CD25 (DN4) ( 39 ) In humans early thymic progenitors are characterized by surface markers distinct from that of mouse an d are described as follows : CD1 CD8 CD4 CD3 CD1 + CD8 CD4 CD3 CD1 + CD4 + CD8 and CD1 + CD4 + CD8 + ( 38 ) Further, analysis showed that these subpopulations expressed decreasing levels of CD34 suggesting that the cells are becoming more differentiated The CD1 CD3 population expresses the highest levels of CD34 and the CD1 + CD4 + CD8 + cells did not express CD34. It was concluded that CD34 + cells differentiated into CD3 + cells via CD1 and

PAGE 22

22 CD4 + CD8 intermediates which present s a useful sur face marker model for early stages of human intra thymic development. T lineage commitment One early c heckpoint is the induction of T cell commitment, it involves the loss of capacity to develop into NK cells and DC and the initiation of TCR gene rearrang ements In mice, T lineage commitment occurs at DN2 stage but in humans it happens at CD7 + CD1a + DN stage ( 40 ) One of the key factors that drive T cell lineage commitment is No tch signaling. Radtke et al first demonstrated that the loss of function in the Notch 1 gene resulted in a marked decrease in the size of the thymus that lacked T cells but had an excess of B cells ( 41 ) This was further supported by the fact that constitutive overexpres sion of Notch 1 in HSC s resulted in extrathymic T cell development and suppression of the B cell development ( 42 ) Notch 1 inactivation completely blocked T lineage development in vivo and other Notch family members were unable to compensate for the los s ( 41 ) Notch signaling induces expression of g enes such as pre T Hes 1 and other genes critical for T cell development ( 43 44 ) Although Notch singling i s necessary for T cell lineage commitment, a dditional transcription factors such as Gata3, Runx1 and E box proteins are required to work in synergy with Notch to drive T cell lineage and suppress alternative lineage fates ( 45 ) Additionally, i n lat er stages of T cell development Notch signaling subsides and is no longer required to maintain T lineage integrity in mature T cells ( 46 47 ) Another player in murine T lineage commitmen t is IL 7, as it was reported that the i nterplay between Notch and IL 7 suppressed non T cell fates ( 48 )

PAGE 23

23 and T cell lineage commitment How and lineage T cells are generated from common thymocyte progenitors is not yet fully understood. Initially two models were proposed an instructive and a pre commitment model ( 49 ) The i nstructive model proposed that pre TCR and TCR mediated signal ing directs versus lineage choice. On the other hand the pre commitment model proposed that versus lineage was pre determined. A variant of instructive model has recently been proposed in which TCR signal strength determines lineage fate ( 5 0 ) The molecular signaling factors that play a role in promoting lineage commitment are D elta Notch signaling BC11b, E2A and HEB. The factors important for lineage diversification are STAT5, IL 7R, IL 15R, IRF, E 2A, Jagged2 Notch signaling Id3 and Egr. However the upstream regulators of versus lineage hav e not been identified. rearrangement and selection In mice T cell precursors rearrange the TCR subunit chains in that listed order ( 51 ) A study done by Blom et al. analyzed the TCR gene loci rearrangements during early stages of T cell development ( 52 ) They utilized normal human thymocytes obtained from thymus fragments removed during cardiac surgery of pediatric patients. The precursor populations of the following phenotype were isolated; CD34 + CD1a CD34 + CD1a + CD4 ISP, CD4 + + They reported that in the human thymus the TCR fixed succession; TCR locus rearrange s first and then TCR loci rearrange The TCR rearrangement w as detected in CD34 + CD1a cells, and TCR lo ci rearrangement occurred in CD34 + CD1a + cells.

PAGE 24

24 The cells that adopt TCR lineage undergo selection checkpoint, a process that allows only the cells with a productive rearrangement of the TCR proceed to the next stage of development In mice t he crucial rearrangement of the variable gene segments of the locus occurs in T cell lineage committed DN3 cells ( 53 ) This newly rearranged is expressed as a heterodimer with pre T and assembles with CD3 to form a pre TCR complex ( 54 57 ) The fir st study to evaluate chain rearrangement in human T cell development was done by Ramiro et al ( 58 ) To determine at which development stage selection occurs in humans cytoplasmic expression of and surface CD3 on thymocytes that lack a mature w ere analyzed About 25% of the CD4 + CD8 + cell s expressed cytoplasmic and low level of CD3, whereas only 5% of the CD4 + ISP cells were stained positive with the anti antibody. This study concluded that selection in humans is initiated at the transition of the CD3 CD4 + CD8 into the CD 3 + CD4 + CD8 + stage ( 59 ) The exact mechanism of pre TCR signaling is not well understood It is proposed that pre TCR cannot recognize a specific ligand, and tran sduces signal through oligomerization, using intracellular intermediates similar to those triggered by the TCR complex in mature T cells ( 60 65 ) The pathways ac tivated by TCR signaling are Erk1/2, NF B, calcineurin, and A kt in mice and will be discussed later in chapter 4. selection will proliferate and i nduce CD4 and CD8 expression to become DP thymocytes, and initiate rearrangement leading to

PAGE 25

25 expression of complex es. rearrangement results in formation of T cell receptor excision circles (TREC), and the process is described in the next section. rearrangement T cell receptor and chain are expressed after the respective rearrangement of loci of the in dividual gene segments variable, diversity and junction (V, D, and J) ( 66 ) TCR undergoes V, D, J rearrangement and the TCR locus undergoes V, J rearrangement. One V, J, or D gene segment is randomly selected recombined together to become a single gene transcript by creating and then excising a loop of the intervening DNA. The ex cised loops persist inside cells as a circular extra chromosomal DNA fragment that is neither transcribed nor replicated, called TREC. TREC can be used as a biomarker to assess the percentage of nave T cell s that have recently exited the thymus and thu s indicating thymic function ( 67 ) Measuring TREC + nave T cells can be used for clinically evaluating human thymic output ( 68 ) The formation of TREC is a complex process and occurs as follows: w hen the TCR locus is rearranged, a crucial conserved segment for TCR locus is excised from the genome which prevents the TCR gene from being transcribed There are two DNA excision circles produced when TCR rearranges, called signal joint TREC and coding joint TREC. Signal joint TREC is produced by end to end ligation of the conserved recombination signal sequences flanking the rec and the J locus as the TCR locus is excised. Coding joint TREC is produced when TCR Because the recombination signal sequences are conserved in these TRECs, it is possible to quantitate TREC using PCR.

PAGE 26

26 L ate T cell Development Events La te events of T cell development include positive and negative selection of CD3 hi + DP thymocytes, and CD4 versus CD8 lineage commitment which are characterized as follows: T c ell p ositive and n egative s election The pr oductive rearrangement of chain does not trigger the termination of recombination at locus. The termination of rearrangement is triggered by pairing of an with a chain that forms a TCR complex and recognizes peptide MHC ( 69 70 ) This process is known as positive selection. DP t hymocytes interact with pep tide MHC complexes expressed on thymic epithelial cells and DCs This was first evident first by visualization of GFP expressing thymocytes in FTOC via two photon las er fluorescence microscopy ( 71 ) This process selects for the T cells that are potentially reactive to foreign antigens, but not to self antigens when presented by self MHC molecules. Most (95%) DP cells fail to productively interact with peptide MHC, thus lack the necessary TCR signaling, and hence die by neglect within a few days. In mice the cells that have undergone p ositive selec tion stage are characterized by down regulation of CXCR4 ( 72 ) and simulta neous up regulation of CCR7 and CCR4 ( 73 74 ) Transient expression of CD69 on DP thymocytes is also observed immediately post positive selection ( 75 77 ) Studies done using FTOC showed that i n humans CD27 CD1 + CD45RA cells first acquire CD69, then upregulate CD27, down regulate CD1 and later gain CD45RA as they undergo positive selection and terminal differentiation ( 78 79 )

PAGE 27

27 Next, the c ells that react strongly to self peptide MHC complex are eliminated by a process called negative selection ( 80 ) Direct evidence for apoptosis induced by negativ e selection was demonstrated in transgenic mice ( 81 ) However, currently there are no markers associated with this process as the cells receiving neg ative selection signals undergo cell death. CD4 v ersus CD8 l ineage c ommitment Further differentiation of DP T cell s results in terminating o ne of the co receptor expression and initiating of gene expression programs characteristic of helper (CD4 + ) or cytot oxic (CD8 + ) cells. In mice the CD4 versus CD8 lineage commitment occurs after the DP stage when CD8 is down regulated in CD4 + CD8 lo cells ( 82 ) In humans lineage commitment step was characterized by evaluating CD4 and CD8 expression on CD69 + cells cultured in FTOC s An early post selection population CD69 + CD27 CD4 + SP gave rise to both CD4 + and CD8 + T cells. On the other hand CD69 + CD27 + cells only gave rise to CD8 T cells ( 78 ) The exact mechanism regulating the precursor cells to commit to either CD4 or CD8 lineage has not been determined. However, considerable evidence now supports that the CD4 versus CD8 lineage choice is controlled by the relative strength or length of TCR s ignaling. Several transcription factors have also been identified to be important in this process such as Runx3, Gata3, and ThPOK ( 83 85 ) IL 7 and T c ell Develop ment All thymic cells including thymic epithelial cells, fibroblasts, DCs, and thymocytes, produce a variety of cytokines ( 86 ) The biological eff ect of such cytokines during T cell development is regulated by expression of the cytokine receptors on cell surface of the thymocytes Cytokines secreted by thymic epithelial

PAGE 28

28 cells work in a paracrine fashion and the ones secreted by thymocytes work in an autocrine fashion to regulate thymocyte survival, proliferation and differentiation Stem cell factor ( SCF or c kit ligand ) is one of the factors that promotes survival and growth of the earliest hematopoietic stem cells which express c kit receptor on t heir surface. SCF operates synergistically with IL 7. Another cytokine reported to enhance early T cell proliferation in conjunction with IL 7 is Flt3 ligand ( 34 ) However, IL 7 is a cytokine, whose function cannot be replaced by othe r cytokines as it supports the survival and proliferation of DN T cells in both mice and human s ( 87 ) The mice deficient for IL 7 / or IL 7R / show greatly reduced T and B cells numbers and absen ce of ( 88 ) Patients with mutation in IL show a more severe SCID phenotype as these patients are deficient in both B and T cells ( 89 ) Significant advances have been made in understanding the biology of IL 7. IL 7 signals via a heterodimer comprised of IL 7 rece ptor and the common cytokine receptor chain ( c) ( 90 91 ) An alternative ligand that binds to IL 7R is thymic stromal lymphopoietin (TSLP) however, its deficiency has no effect on T cell development and hence will not be discussed further ( 92 ) IL 7R expression is negatively regulated by IL 7 stimulation and T cell activation ( 93 ) During T cell development IL 7 provides si gnals necessary for the survival and proliferation of DN thymocytes and is directly involved in rearrangement ( 94 95 ) IL 7 binding to its receptor activates PI3K, JAK STAT pathway and down regulates cyclin dependent kinase inhibitor p27, and modulates BCL 2 expression ( 96 ) During T cell development IL 7R dynamically regulated in mice ( 97 ) It is present on DN and absent on DP thymocytes, and is re expressed by SP

PAGE 29

29 thymocytes. Recent evidence shows that IL 7R is expressed throughout T cell development in humans, but its bin ding partner c is down regulated at DP stage rendering the DP thymocytes unresponsive to IL 7 as assessed by STAT5 phosphorylation ( 98 ) T he reason for such dynam ic regulation of IL 7 signaling during T cell development is not well understood. Additionally inhibitory role of IL 7 during DN to DP transition has been described and will be discussed in detail in chapter 3. Models f or Studying Human T cell Development Mouse M o dels SCID (severe combined immune deficient ) mice were initially used to study human T cell development. However, this model was limited by low levels of engraftment and failure of the engrafted human bone marrow HSCs to differentiate into fully functional T cells ( 99 ) Human fetal thymus or fetal liver d erived HPCs showed improved engraftment, over BM HPCs, but due to the ethical reasons fetal sources of HPCs are not readily available ( 100 101 ) To overcome the engraftment issues in the SCID model, non obese diabetic ( NOD ) SCID and later NOD SCID 2 m null mice were used ( 102 ) However, these mice develop lymphomas and ha ve a relatively short er life span. Recently, a mouse model more suitable for human H P C engraftment has been developed. These mice lack a functional common IL chain (IL null ) and are deficient in NK cells ( 103 104 ) These mice were used to generate NOD SCID IL 2 R null mice ( 105 ) NOD SCID IL 2R null mice are currently the best model to study T cell development becau s e they lack mature lymphocytes NK cells, do not develop lymphomas and are long lived. These mice were shown to support development of human CD3 + CD4 + CD3 + CD8 + T cells, Ig + B cells, m yeloid

PAGE 30

30 cells, NK cells, and plasmacytoid DCs from H P C of cytokine mobilized peripheral blood origin. Even though murine models for the study of human T cell differentiation have significantly improved over the last two decades, there are limitations that s till prevents them from serving as realistic model s for human hematopoiesis ( 106 ) One of the major limitatio ns is that mice express only murine MHC molecules and lack the expression of human MHC class I namely human leukocyte antigen (HLA A, B, C), and class II namely HLA DR, DQ, DP. The size and the complexity of HLA ge ne rearrangement and expression make it impossible to introduce the entire human MHC loci into a single murine model. While single human HLA can be introduced to a murine model this approach will limit the diversity of the HLA alleles and reduces the potential capacity for clinica l translation research. Additionally, it will be difficult to perform large scale production of T cells in m ic e. However, these mice can be used to study human T cell development and for preclinical evaluation of novel vaccines and therapeutic agents. In vitro Models Fetal t hymus o rgan c ulture C ompl ete thymus was thought to be necessary for the generation of T cells from progenitor cells FTOC was the first in vitro system that was established to study T cell development ( 107 108 ) Briefly, generating one FTOC require s a total of 15 16 thymic lobes from thoracic cavities of mur ine day 14 mouse embryos The lob es a re deplet ed of endogenous thymocytes by deoxyguanosine treatment This allow s for the reconstitution of these empty thymic lobes with the desired defined subsets of stem cells or progenitors ( 109 ) This system al so allow s for addition al manipulation of

PAGE 31

31 the differentiating T cells by introducing antibodies, cytokines, peptides, and retroviral vectors to the culture system ( 110 111 ) However, the yields of total number of T cells or thymocytes are very low in FTOC system and cannot be scaled up for clinical operations. OP9 culture system Stromal cells in the BM support development of most hematopoietic lineages, including myeloid, erythrocyte, and B and NK cell lineages but T cell development requires thymus Recent advances have led to the establishment of m ouse b one marrow stromal cell lines that can support robust hematopoietic differentiation which include S17, MS 5, and OP9 cell lines ( 112 114 ) The OP9 was reported to be superior in supporting hematopoiesis of human embryonic stem c ells when compared to MS 5 and S17 ( 115 ) The OP 9 cell li ne is derived from a macrophage colony stimulating factor (M CSF) deficient mouse. M CSF plays an important role in promoting myeloid lineage differentiation as the OP9 cell line lacks M CSF, it cannot support myeloid differentiation ( 116 ) H owever the OP9 cell line can be used for studying lympho id development ( 117 ) Radtke et al. creat ed Notch 1 knockout m ice and demonstrated that B cell development was normal in these mice but T cell development was severely impaired. A s ubsequent report by Pear et al. showed r eported that BM cells transduced with a constitutively active intracellular Notch when injected i nto mice failed to differentiate into B cells, but rather these cells gave rise to DP T cells in the BM of recipient mice ( 41 42 ) Additionally, Notch receptor ligands were reported to be expressed at high levels by thymic stroma but only at low levels o n OP9 cells ( 118 ) This report showed that OP9 transduced with Notch ligand Delta like 1 ( OP9 DL1) supported early T cell development at the expense of B cell

PAGE 32

32 development. Later reports demonstrated OP9 DL1 cell line wa s able to support early stages of human T cell development of BM and cord blood derived HPCs ( 115 119 120 )

PAGE 33

33 CHAPTER 2 ASSESSMENT OF T CELL DEVELOPMENT OF HUMAN FL, FT, CB AND BM IN VITRO USING LMDL1 CELL LIN E Introduction HPCs from bone marrow (BM) migrate to the thymus, where they undergo a serie s of lineage commitment events and developmental checkpoints before adopting a T cell fate. A common in vivo model to study human T cell development is based on humanized SCID mice ( 121 122 ) However, these mice are not a convenient tool for evaluating intrinsic molecular signaling pathways involved in T cell lineage commitment. An alternative in vitro system t o study T cell differentiation is based on FTOC ( 20 21 107 123 124 ) FTOC support s differentiation of HPCs to CD8 + and CD4 + T lymphocytes. However, FTOC faces numerous challenges including being cumberso me to set up and having a limited T cell yield. The strong evidence that Notch signaling promotes T cell development rather than B cells has led to the establishment of a mouse OP9 stromal cell line over expressing the murine DL1 (OP9 DL1) to study T cell development ( 42 125 127 ) The OP9 cell line is derived from bone marrow of a m ouse deficient in M CSF and thus d oes not support myeloid and erythroid cell development. OP9 was reported to support T cell differentiation from mouse HPCs and human cord blood ( CB ) and adolescent BM, although with limited T cell maturation potential ( 119 125 128 129 ) There have b een reported differences in lymphopoiesis of murine fetal and adult origin, yet, comparable studies for human T cell development are still lacking ( 130 ) Here we overexpressed mDL1 in the OP 9 cell line using lentivirus ( LmDL1 ) for the study of thy mopoiesis of human fetal thymus ( FT ) fetal liver ( FL ) CB and adult BM. The HPCs first differentiate into CD8 CD4 DN T cells, and undergo T CR

PAGE 34

34 selection checkpoint, then promotes transition to CD8 + CD4 + DP stage, and finally they mature after positive and negative selections ( 131 ) In this chapter w e report that HPCs derived from human FL, FT, CB and adult BM go through the established T cell differentiation pathway under LmDL1 in vitro culture conditions. However, striking differences exist in timing and T cell development f or human HPCs of different origins. These include proliferation, survival and maturation kinetics such as the ability to reach the TCR + CD3 + CD8 + CD4 + stage of T cells. Material and Methods Cells OP9 cells were purchased from American Type Culture Collecti on (Manassas, VA). To establish LmDL1 and L GFP cell lines, OP9 cells were transduced with lentiviral vectors encoding mouse DL1 ( L mDL1) and green fluorescent protein (GFP), respecti vely. OP9 minimal essentia l medium (Gibco, Invitrogen) supplemented with 20% fetal bovine serum and 1% penicillin streptomycin. The adult BM and CB CD34 + cells were purchased from AllCells, LLC, and Cambrex Corp. Aborted fetal liver and thymus tissues were purchased from Ad vanced B ioscience Resources Inc ., and processed with a tissue grinder and pressed through cell dissociation mesh sieves (Sigma Aldrich ). Single cell suspensions were labeled with anti CD34 micro beads and purified using magnetic antibody cell sorting columns The purity was determined using phycoerythrin (PE ) conjugated anti CD34 (Clone 8G12; BD Biosciences) and analyzed via flow cytometry

PAGE 35

35 In vitro T cell D evelopment The purified CD34 + progenitors were seeded at 2 10 4 cells per well into 24 well plates containing a confluent monolayer of LmDL1 or L GFP cells. The co culture w as minimal essential medium with 20% fetal bovine serum 1% penicillin streptomycin, 5 ng /mL interleukin 7 (PeproTech Inc.) and 5 ng /mL Flt3L (PeproTech Inc.) and were fed with complete medium every 2 to 3 days. The co culture was transferred to a new well once the monolayer became over differentiated. Cells were harvested at the indicated time points for analysis. Monoclonal Antibodies and Flow Cytometry Antibodies for CD4 ( C lone RPA T4, conjugated with PE and fl uorescein isothiocyanate (FIT C ) ) CD8 ( C lone RPA T8, PE), CD7 ( C lone M T701, FITC, PE), CD1a ( C lone HI149, with allophycoc yanin (APC)) CD3 ( C lone SK7, PE Cy7), TCR C lone T10B9.1A 31, FITC) and TCR C lone B1, FITC) were obtained from BD Biosciences. The antibody for CD28 ( C lone CD28.2, APC) was from eB ioscience Cells were first washed with phosphate buffered saline with 2% fetal bovine serum and blocked with m ouse and human serum at 4 o C for 30 min utes For each antibody instructions. Data were acquired using cell quest software by BD FACS c alibur flow cytometer (Becton Dickinson I mmuno cytometry Systems) and w ere analyzed by using Flowjo software (Tree Star Inc.). Results E xpression of DL1 in LmDL1 Stromal Cells Murine OP9 cell s transduced with an r etroviral vector expressing DL1 have been shown to support T cell development ( 125 ) Our lab has previously reported

PAGE 36

36 that lentiviral vectors mediate high levels of transgene expression ( 132 ) LmDL1 cell line was previously g enerated by our lab and verified for DL1 expression ( 133 ) P roliferation of CD34 + HPCs of FT, FL, CB and A dult BM on LmDL1 To see if LmDL1 could support T cell development, CD34 + cells were purified from human FT, FL, CB and adult BM. The four sources of CD34 + HPCs show ed a purity of >99%, as determined by post sort flow cytometry analysis ( D ata not shown) Purified CD34 + cells were co cultured with L GFP or LmDL1 stromal cells in the presence of recombinant interleukin 7 and Flt3L The HPCs co cultured with L GFP showed very limited proliferation and a short survival period (data not shown). In contrast, HPCs co cultured with LmDL1 exhibited exponential proliferation and prolonged survival ( Figure 2 1) This suggests that Notch signaling not only promotes T lineage commi tment, but also supports progenitor cell survival. CD34 + cells derived from FT and FL displayed similar proliferation and survival kinetics on LmDL1 with an approximately 1000 fo ld increase in cell number in two weeks, followed by a decrease in proliferat ion and cell death after three weeks. The CB derived CD34 + cells expanded about 100 000 fold and survived for about 90 days on LmDL1 ( Figure 2 1) The adult BM derived HPCs showed <1000 fold increase in cell number, which was lower than FT de rived and FL de rived HPCs, and CB derived HPCs. The BM derived HPCs survived for longer than those from FT and FL and for a shorter time than those from CB on LmDL1 Therefore, T he CB derived HPCs had the most expansion and survival potential when compared with FT, FL an d adult BM in LmDL1 co culture Note that fold expansion varied with individual donors but the overall trend of CB showing the highest proliferation and BM showing the lowest proliferation was consistent.

PAGE 37

37 FT D erived and FL D erived HPCs on LmDL1 The FL is a primary site of hematopoietic development until birth ( 134 ) T cell differentiation has been illustrated using HPCs isolated from mouse FL ( 125 ) However, the T cell development potential of human FT or FL in a stromal c ell based culture system has not been demonstrated. Here we report for the first time that HPCs of human FT and FL could develop into T cells on LmDL1 in vitro ( Figure 2 2) The FT derived CD34 + cells were able to rapidly differentiate into CD8/CD4 DP cell s after just one week of co culture with LmDL1 ( Figure 2 2A) The number of DP cells increased over time and peaked at three weeks. About 90% of the cells were arrested in the DP stage on day 21 and did not differentiate further. These DP cells did not sur vive beyond three weeks and the population collapsed after day 21 of the co culture ( Figure 2 1) Around 60% of the CD8 + cells expressed CD3; however, the ex pression of fully assembled TCR ers was only a marginal 6%. TCR expression was slightly higher, about 17% ( Figure 2 2A) As the TCR was specific for a monomorphic determinant of heterodime r, only the fully assembled TCR All of the cells expressed high levels of CD7, a receptor expressed in early T cells (data not shown). Our results indicate that the FT derived CD34 + HPCs rapidly differentiated into and then arrested at DP stage when cultured on LmDL1 In addition, thes e cells could differentiate into The differentiation kinetics of human FL HPCs on LmDL1 w ere similar to t hose of their murine counterpart on the stromal cell line OP9DL1 ( 125 ) However, the T cell developmental kinetics of FL derived HPCs differed from those of FT derived HPCs. The FL HPCs developed to DP stage after 1 week but the majority of cells remai ned

PAGE 38

38 in CD8 + immature single positive stage (ISP), and only about 18% of the cells progressed to DP stage by day 14 ( Figure 2 2B) The DP population vanished on day 21 in the culture, leaving a population of cells arrested in the CD8 + ISP stage. All of the differentiating FL precursors were CD7 + on day 21 (not shown). A low percentage of CD8 + cells co expressed CD3, and only 3% expressed TCR expressed TCR ( Figure 2 2B) Overall, FT and FL HPCs could rapidly differentiate to DP cells, with a v ery small percentage expressing TCR derived and FL derived HPCs differed in their potential to adopt TCR CB HPCs on LmDL1 Human CB derive d HPCs can differentiate to TCR bearing DP T cells on OP9DL1 stromal cells ( 129 ) On LmDL1 we found that CB HPCs rapidly differentiated to DP stage with a marked increase in cell number ( Figure 2 1) C B CD34 + H PCs developed into DP stage in two weeks and remai ned i n DP stage for approximately 70 days ( Figure 2 2) whereas the CD8 + ISP population gradually declined. The CB resembled FT in its loss of the CD8 + ISP population and accumulation of DP stage over time. The percentage of CD4 + ISP cells showed a slight increase, from 15 to 25% The expression of CD3 and TCR and 26%, respectively on day 56, suggesting a more mature phenotype ( Figure 2 3, bottom panel) Additionally, expression of TCR cell lineage pathway when cultured on LmDL1 In summary, cord blood CD34 + HPCs rapidly developed into DP stage and advanced further, as show n by the expression of CD3, TCR

PAGE 39

39 A dult BM D erived CD34 HPCs on LmDL1 In adult life, BM serves as a primary site of hematopoiesi s In vitro development of T cells from adult BM derived HPCs in the stromal culture system has not been reported. Here, we examined the T cell differentiation potential of adult BM CD34 + HPCs on LmDL1 The BM HPC derived T cells we re able to survive for a bout 60 days and showed a delayed differentiation to DP stage compared to HPCs derived from FT, FL and CB ( Figure 2 4) However, the DP cells peaked around day 56 and were short lived as they were undetected in just one week The maximal expression of TCR arrested in the CD8 + ISP stage ( Figure 2 2, bottom panel) Similar to FL derived HPCs, adult BM derived HPCs did not differentiate toward the TCR Hence, when cultured on LmDL1 adult BM derived HPCs developed to the DP stage with very li mited potential of entering TCR T cell D evelopment P otential of Various HPCs We compared the T cell development potential of four different sources of human CD34 + H PCs in the LmDL1 co culture Both FT and CB resembled each other compared with FL and adult BM. The HPCs derived from FT and CB differentiated to the DP T cell stage quickly, and the majority of cells remained arrested at the DP stage ( Figure 2 5) Moreove r, both FT and CB progenitors had the ability to differentiate into TCR CB derived HPCs generated a signifi cantly higher percentage of TCR bearing T cells than did FT derived HPCs. Furthermore, FT derived HPCs exhibited much shorter differentiation kinet ics and survi val term (about 21 days) in the LmDL1 co culture as opposed to CB c ells that survived for about 70 days ( Figure 2 1)

PAGE 40

40 Adult BM derived HPCs resembled FL derived HPCs in their differentiation patterns; however, they differed in their survival ability in the LmDL1 co culture ( Figure 2 1 and 1 5) Both precursors differentiated to short lived DP cells, of which only 5 6% matured to TCR bearing T cells. The transition to DP stage from adult BM derived HPCs occurred at a much later time point than from FL derived HPCs. Both precursors showed a decrease in CD7 + CD1a + DP T cells before cell death, and both had an ending population of CD8 + ISP T cells, as opposed to FT derived and CB derived HPCs being arrested in the DP stage ( Figure 2 5). These four sources of human hematopoietic progenitors differed in T cell differentiation potential, with some similarities between CB and FT, and between FL and adult BM. Discussion In vitro culture is a great tool for the study of the cellular mechanisms that mediate T lymphocyte development. Here we establish ed a lentiviral modified murine OP9 stromal cell culture system, LmDL1 to study T cell developme nt, similar to the retroviral OP9DL1 culture system ( 125 ) We found quantitative and qualitative differences in the T cell development potential of four different source s of human CD34 HPCs on LmDL1 ( Figure 2 5 ) Our finding is consistent with previous observations that the hematopoietic system has different developmental potentials in fetal and postnatal life ( 135 136 ) There are some differences in lymphoid development kinetics among the FT FL CB and adult BM derived HPCs. A striking difference was noted in the proliferatio n of the various HPCs before they reach ed the CD8 + CD4 + DP stage The HPCs derived from CB expanded more than that derived from FT, FL and adult BM before reaching DP stage ( Figure 2 1 ) Apparently, the intrinsic differences of these

PAGE 41

41 different sources of CD 34 + progenitors contribute to their different expansion and developmental potentials. The FT derived HPCs differentiated to DP within the first week of the co culture followed by CB derived and finally BM derived HPCs. The robust expansion of CB HPCs is p robably the result of the ability of such progenitors to generate large clones of progeny ( 137 ) There was a time difference in thymocyte development for FT, FL and CB compared with adult BM. The FT progenitors reached CD8 + CD4 + DP stage in the first week of the LmDL1 co cu lture Both FL derived and CB derived HPCs took about two weeks to reach the DP stage. The adult BM derived HPCs were able to reach the DP stage in about 6 weeks. This could be because adult BM derived HPCs may undergo sequential proliferation and migratio n before they reach the thymus and differentiate into T cells. On the other hand, HPCs of embryonic origin can differentiate into T cells without self renewal ( 138 ) Adult BM derived HPCs take longer to reach the DP stage than embryonic and fetal HPCs. The delay in differentiation of adult BM derived HPCs is longer than that observed in a previous report using pediatric BM derived HPCs ( 129 ) This difference could be linked to the difference in the age of the donor, as Smedt et al used BM from a 1 2 to 14 year old donor, in our case the BM donors were over 20 years of age. It is evident that donor age contributes significantly to the kinetics of T cell development ( 135 139 140 ) An additional difference is the percentage of cells that reach DP stage and their ability to proliferate and survive. The HPCs derived fro m CB and FT produced a high er percentage of DP cells, than those derived from FL and BM As the DP lineage decision is closely linked to the strength and duration of cytokine, Notch and

PAGE 42

42 TCR signaling the expression levels of various re gulatory factors in the different progenitors may contribute to their different kinetics of development. After reaching the DP stage, the proliferation rate of FT FL and ad ult BM derived T cells declined. The final difference was in the elevated potenti al of the CB HPCs to differentiate into both and cells. The role of Notch 1 signaling and its influence on commitment to and cells have been controversial. Some have reported that sustained Notch 1 signaling cells ( 129 141 ) w hile others found it favoring ( 142 144 ) Apparently, Notch 1 signaling supports the development of HPCs derived from murine FL and BM into ( 125 145 ) Again, it is conceivable that the various expression levels of Notch receptors and their ligands may influence the cell fate decisions ( 146 147 ) Our report provides a paralleled overview of early T cell development from different sources of human HPCs. It is clea r that the in vitro stromal cell culture system is still limited in supporting the progression of T cells from DN to DP stage and maturing into functional single positive CD4 and CD8 T cells. The latter requires optimal negative and positive selections eng aging TCR signaling and major histocompatibility complex interactions between the developing thymocytes, thymic epithelial cells and various antigen presenting cells entering the thymus. Although the current in vitro model may not fully recapitulate the in vivo thymic niche, future modifications may bring us closer to a more efficient system for the understanding and exploitation of developing T cells.

PAGE 43

43 Figure 2 1. Proliferation and survival potential of fetal thymus, fetal liver, cord blood and adult bone marrow derived CD34 + HSC The CD34 + HPCs from 4 different sources were seeded onto LmDL1 cells in the presence of IL 7 ( 5 ng /mL ) and Flt3L ligand ( 5 ng /mL ) an d cell numbers were plotted against days in co culture.

PAGE 44

44 Figure 2 2. T cell developme nt kinetics of CD34 + HPCs derived from FT and FL in the LmDL1 co culture. A ) CD4 and CD8 expression on different iating CD34 + HPCs from FT B ) CD34 + HPCs from FT Highest expression of CD3, and w as observed on day 21 in both cases as assessed by flow cytometric analysis

PAGE 45

45 Figure 2 3. T cell development kinetics of CD34 + HPCs derived from CB. CD4 and CD8 expression on different iating CD34 + HPCs from CB was monitored and the highest expression of CD3, and was observed on day 7 7 as assessed by flow cytometric analysis

PAGE 46

46 Figure 2 4. T cell development kinetics of CD34 + HPCs derived from adult BM. CD4 and CD8 expression on different iating CD34 + HPCs from adult BM was monitored and the highest expression of CD3, and TC was observed on day 77 as assessed by flow cytometric analysis

PAGE 47

47 Figure 2 5 P aralleled overview of T cell development kinetics of CD34 + HPCs derived from FT, FL, CB and adult BM. The expression of T cell development markers namely CD 8, CD4, CD7 CD1a, CD3, by CD34 + HPCs of FT, FL, CB and adult BM origin upon co culture with LmDL1 was assessed over time by flow cytometric analysis.

PAGE 48

48 CHAPTER 3 REGULATION OF IN VITRO ADULT HUMAN T CELL D EVELOPMENT THROUGH INTERLEUKIN 7 DEPRIVATION AND AN T I CD3 STIMULATION Introduction CD34 + HPCs from BM migrate to the thymus where in response to factors present in the thymic environment they differentiate into T cell precursors and eventually into mature T cells ( 148 149 ) The human T cell developmental stages are best characterized by expression of the co receptor molecules CD8, CD4, CD7, and CD1a. CD34 + HP Cs go through CD8 CD4 ( DN ) T cell precursor stage, express p re T and rearrange chain. T cell precursors that have rearranged CD1a along with CD7 ( 15 150 ) Next, the DN cells adopt a CD4 ISP phenotype in human or a CD8 ISP in mouse The CD4 or CD8 ISP stage is followed by CD8 + CD4 + DP transition where the rearranged and heter odimer complex is expressed. DP cells exp ressing undergo negative and positive selection and differentiate to mature CD4 + or CD8 + T cells ( 80 151 152 ) Generation of mature T cells from adult human BM CD34 + HPCs in vitro may overcome two major limitation s in adoptive T cell therapy, namely HLA dispari ty and immune tolerance ( 153 154 ) Currently the only in vitro culture system that can support functional T cell maturation from BM CD34 + HPCs is the fetal t hymus organ culture (FTOC) ( 18 111 ) A convenient in vitro T cell development culture system established by the Zuniga Pflucker group can support early T cell differentiation but not terminal T cell maturation of human BM CD34 + HPCs ( 120 155 157 ) In addition we have demonstrated in vitro T cell development of fetal cord blood versus adult BM derived CD34 + HPCs reveals a defic iency of the adult HPCs, which yield s a low er number o f T cell precursors than CB ( 158 )

PAGE 49

49 T cell development from HPCs is controlled by various ligand and receptor interactions in the thymus and the detailed regulation of this lengthy process is still not well understood There are two critical checkpoints during T cell differentiation and maturation: DN to DP transition and positive/negative selection. Our lab has previously demonstrated OP9 cell line s expressing various cytokines and growth factors support enhanced HPC and dendritic ce ll precursor expansion and differentiation ( 159 ) A s adult human T cells yield limited number of T cell precursors, we modified a previou sly defined LmDL1 cell line ( 158 ) to express T cell developmental factors IL 7 and Flt3L and established LmDL1 FL7 cell line. We found that the LmDL1 FL7 i ncreased expans ion of T cell precursors during CD7 to CD7 + transition com pared with the LmDL1 cell line supplemented with soluble r ecombinant h uman (rh) IL 7 and r h Flt3L The T cell development al progression to CD4 ISP and DP cells were comparable for both co culture systems. However, differentiation to DP stage was inefficient and neither system supported terminal T cell differentiation. The key regulatory factors for DN to DP transition in human T cell development ha ve not been characterized, but both IL 7 cytokine signaling and pre TCR signaling appear to play a n important ro le IL 7 is an important survival factor during the early stage of T cell development ( 94 ) but inhibits DN to DP transition in mice ( 160 164 ) In addition, signaling via pre TCR promotes DN to DP transition ( 54 165 ) Here we report that IL 7 withdrawal at DN and ISP stage increased CD4 surface expression but was uncoupled with CD3 and expression Importantly, t aking a combination approach of IL 7 withdrawal and activating pre TCR signaling using anti CD3/CD28 antibodies, we demonstrate for the first time efficient functional maturation to + CD3 hi DP and

PAGE 50

50 subsequently to SP CD4 T cells from adult BM CD34 + HPCs in the in vitro culture system. M aterials and Methods Human CD34 + HPCs and C ell L ines The adult BM CD34 + HPCs from normal donors were purchased from AllCell s Inc. The mouse fetal stromal cells (OP9) were purchased from the American Type Culture Collection (ATCC, Manassas, VA) and was main tained as previously described ( 166 ) The engineered LmDL1 and LmDL1 FL7 cell lines were generated by tra nsducing cells with lentivectors encoding D L1, Flt3L and IL 7, respectively. The stromal cells were MEM (Gibco BRL Invitrogen ) supplemented with 20% fetal bovine serum (Gibco BRL Invitrogen ) and 1% p enicillin s treptomycin (Mediatech Inc. ). IL 7 cytokine secretion was measured by using h uman IL 7 E LISA kit (Ray Biotech, Inc. ) Cell free supernatants were obtained from LmDL1 and LmDL1 FL7 cells cultured for 48 h ours (80 90% confluent) in a 12 well plate containing 1 mL of media. The samples were read on model 680 micro plate reader (Bio Rad). The sur face expression of mouse DL1 and Flt3L was analyzed by flow cytometry with Alexa Fluor 647 conjugated anti DL1 Ab (Biolegend) and purified anti Flt3L Ab (Abcam Inc ) conjugated with zenon LmD L1 S tromal C ell CD34 + HPC C o culture The CD34 + HPCs were seeded into 24 well plate at 1X10 5 cells per well containing a confluent monolayer of LmDL1 or LmDL1 FL7 cells. The co culture s were MEM wi th 20% FBS and 1% Penicillin Streptomycin, supplemented with 5 ng /mL IL 7 (PeproTech, Inc. ) and 5 ng /mL Flt3L (PeproTech, Inc.) as indicated. The co cultures were replenished with new media

PAGE 51

51 every 2 3 days. The cells in suspension were transferred to a new confluent stromal monolayer once the monolayer began to differentiate or when developing cells reach 80 90% confluent. The cells wer e transferred by vigorous pipetting, followed by filtering lter (BD Biosciences ) and centrifugation at 250 RCF at room temperature for 10 mi nutes The cell pellet was transferred to a fresh confluent monolayer. The cells were harvested a t the indicated time points during the T cell development for analysis. Monoclonal Antibodies and Flow Cytometry The surface expression of mouse DL1 and Flt3L w ere analyzed by flow cytometry with Alexa Fluor 647 conjugated anti DL1 Ab (Biolegend) and puri fied anti Flt3L Ab (Abcam Inc.) conjugated with zenon (Invitrogen). The antibodies used for surface staining of T cell development included CD4 (clone RPA T4 Pacific blue), CD8 (clone RPA T8 PE), CD3 (clon e UCHT1, Pacific Blue, clone SK7, PE Cy7), (clone T10B9.1A 31, FITC), CD1a (clone HI149, APC), CD7 (clone M T701, FITC, PE), and intracellular staining for Ki67 (clone B56, Ant i CD127 (clone 40131 FITC ) was from R&D systems (Minneapolis, MN). repertoire analysis was performed using IO ATest beta m repertoire k it according to the first washed with PBS plus 2% FBS and blocked with mouse and human serum at 4C for 30 min utes For each fluorochrome labeled Ab used, appropriate isotype control was included. After an tibody staining, the cells were washed twice and fixed with 2% para formaldehyde. Intracellular staining was performed using BD cytofix/cytoperm kit, according to the

PAGE 52

52 ere acquired using BD FACS Diva software (version 5.0.1) o n a BD FACSAria or a BD LSR and were analyzed using the Flowjo software (Tree Star, Inc.). T cell Stimulation and Effector Function Analysis To stimulate nave T cells, a protocol for long term stimulation was followed using anti CD3/CD28 beads (D ynal, In the beads were mixed and plated into a 96 well plate at 37 o C for 2 to 3 days in X vivo 20 media (Gibco) O n day 3 12.5U of IL 2, 5 ng /mL of IL 7 and 20 ng /mL of IL 15 were added and the cells were c ultured for additional 11 to 12 days. To determine intracellular cytokine production t he in vitro expanded CD4 T cells were stimulated with PMA and Ionomycin (Sigma Aldrich), and analyzed for the release of IFN 4 and IL 17. Briefly, the cells were inc ubated with 25 ng /mL PMA and 1 /mL i onomycin for one hour followed by the addition of 6 /mL monen sin (Sigma Aldrich) to inhibit g olgi mediated cytokine secretion. After 4 to 5 hours of incubation, the cells were harvested and surface stained for CD4 (c lone RPA T4, Pacific blue), CD8 (clone SK1, APC Cy7), CD3 (clone SK7 PE Cy7), CD25 (clone M A251, PE) and intracellular stained for IFN 4 (clone MP425D2, APC), FOXP3 (clone PCH101, Alex a 647) ; the above antibodies were from BD Biosciences, and IL 17 (clone 64CAP17, PE) antibody was from eBioscience The data were collected by flow cytometry using BD FACSAria and analyzed using Flowjo. RT PCR RNA was harvested from cells using TRI Reagent (Sigma Aldrich). 1 RNA was reverse tr anscribed into cDNA by using Two step AMV RT PCR kit (Gene Choice ). The following primers were used for the PCR reaction: m GAPDH, F(Forward)

PAGE 53

53 TCACCACCATGGAGAAGG C (Reverse) GCTAAGCAGTTGGTGGTGCA GCTCTTCCCCTTGTTCTAACG and R CACATT GTCCTCGCAGTACC Flt3L F AAGGATCCGCAGGAT GAGGCCTTG CGGCGACAGGAGGCATGAG 7, F TTCTCGAGTTATCAGTGTTCTTTAGTG R AAGCG GCCGCCACCATGTTCCATGTTTC T GAPDH, F TCCCC hLEF 1, F 5' CGACGCCAAAGGAACACTGACATC 3' and R 5' GCACGCAGATATGGGGGGAGAAA 3'; hTCF 1, F 5' CGGGACAGAGGACCATTACAACTAGATCAAGGAG 3', and R 5' CCACCTGCCTCGGCCTGCCAAAGT 3'; Rag 1, F 5' CAGCGTTTTGCTGAGCTCCT 3' and R 5' GGCTTTCCAGAGAGTCCTC 3'; Rag 2 F 5' GCAACATGGGAAATGGAACTG 3' and R 5' GGTGTCAAATTCATCATCACCATC 3'. After 30 cycles of amplification (95C for 30 seconds, 55C for 30 seconds, and 72C for 60 seconds), PCR products were separated on a 2% agarose gel. TREC Analysis Plasmid DNA containi ng cloned TREC and RAG2 was used as positive control. Cell lysates were prepared by proteinase K digestion (100 /mL ) at 56 o C for 1 hour followed by heat inactivation at 95 o C for 10 minutes. In brief, 1.5 of cell lysates equivalent to 100 ng DNA or 15 ,000 cells were used as template for PCR amplification. The following primers were used for the PCR reaction for TREC F CAGAGG GGT GCCTCTGTCA CTGTGAAACACTCCCCAGC RAG2 F TCTTGGCATACCAGGAGACA

PAGE 54

54 R AGT GGAATCCCCTGG ATC TT PCR conditions were 95C for 10 minutes, followed by 35 cycles of 95C for 30 seconds, 55C (RAG2) 59C (TREC) for 60 seconds, 72C for 60 seconds, with a final extension at 72C for 10 minutes. PCR products were analyzed on 1% agarose gel. DC : T cell C o C ultu re Mature DCs were prepared as described previously ( 159 ) Briefly BM CD34 + HPCs were co cultured on OP9KFT63KF for 15 days, followed by co culture on OP9GM15 for additional 5 to 10 days. Maturation was induced by adding 5 ng /mL TNF 10 ng /mL IL 6, 10 ng /mL IL 1 1 M PGE 2 50 ng /mL GMCSF and 100 ng /mL IL 15 to DC precursors in 24 well low attachment plates The cells were incubated for 48 hours at 37 o C. DC :T cell co cultures were set up in a 96 well U bottom plate at a ratio of 1 :10, DC : T cells for initial stimulation and 1:20 DC : T cells for re stimulation. The cells were incubated with 25 ng /mL /mL ionomycin for one hour followed by the /mL berfaldin A (Sigma Aldrich) to inhibit golgi mediated cytok ine secretion. Intracellular cytokine staining was performed using BDcytofix/ctyoperm kit according to instructions. Results T c ell P re cursor E xpansion on LmDL1 FL7 Cell Line The previously established mouse OP9 DL1 cell line, LmDL1 ( 167 ) was infected with lentivectors expressing human Flt3L or both Flt3L and IL 7, to generate LmDL1 FL and LmDL1 F L7 cell lines, respectively ( Figure 3 1A). RNA was harvested from these cell lines and analyzed by semi quantitative RT PCR to confirm transgene expression ( Figure 3 1B). We confirmed surface expression of DL1 on all three cell lines (LmDL1, LmDL1 FL and LmDL1 FL7; Figure 3 1C). Both LmDL1 F L and LmDL1 FL7 expressed

PAGE 55

55 high levels of Flt3L on cell surface ( Figure 3 1D). The secretion of IL 7 by LmDL1 FL7 as measured by EL ISA was in the range of 10 to 14 ng /mL after 48 h ou r s of culture ( Figure 3 1E). Next, we examine d the differentiation and exp ansion potential of adult human BM CD34 + HPCs co cultured with LmDL1 exogenously supplemented with recombinant Flt3L IL 7 or co cultured with LmDL1 FL7. W e determined the proliferation rate of the incubated cells by counting the total number of suspensio n cells at a series of time points in three independent experiments. The result s showed that CD34 + HPCs, when co cultured with LmDL1 FL7 for 35 days, could expand up to 5 fold more than those co cultured with LmDL1 supplemented with soluble Flt3L and IL 7 (LmDL1+ Flt3L +IL 7) ( Figure 3 1F). The exact fold of T cell precursor expansion varied among donors but in all cases, LmDL1 FL7 was superior to LmDL1 plus soluble IL 7 and Flt3L in supporting T cell precursor proliferation. Adult BM CD34 + HPCs T c ell D iffe rentiation on LmDL1 FL7 Next, we compared the surface expression of CD8, CD4, CD7, CD1a, CD3, TCR and o n the differentiating cells in the two co culture systems Kinetics of CD8, CD4, CD7 and CD1a expression patterns were comparable between the two systems. We observed CD4 ISP population is detectable from day 5 (not shown) to day 15, and then the percentage of CD4 ISP wanes as the CD8 ISP cells becomes the dominant population after day 20 ( Figure 3 2). T cell lineage commitment from HPCs is defi ned by up regulation of CD7 expression followed by induction of CD1a expression, and CD1a is decreased upon further maturation. A schematic illustration of the predicted key events and phenotypes of developing T cell precursors is shown ( Figure 3 2) CD7 + CD1a cells were initially detected on day 15 The highest percent of

PAGE 56

56 C D7 + CD1a + cells were seen on day 42, which was followed by a gradual decrease of CD1a + Due to the low er precursor cell number in the LmDL1+ Flt3L +IL 7 co culture we had limited number o f precursor cells available for analysis in the earlier time points. In both systems, DP cells were detected around day 35 and the cell population decreased by day 56. The exact day in culture that CD8 ISP and DP populations were detect able in both of the co culture systems being compared varied among the donors The rapid ex pansion of T cell precursors in the co culture with LmDL1 FL7 was acc ompanied by a slower development of the DP cell population. Additionally, CD3 surface expression w as detected at lo wer levels in LmDL1 FL7 co culture than in LmDL1+ Flt3L +IL 7 co culture ( Figure 3 3). Nevertheless, neither system produced the desired CD3 hi TCR hi CD4 or CD8 cell population s ( Figure 3 2 and 2 3). The analysis of T cell surface markers suggested that did not occur in the precursor cells cultured on LmDL1 FL7 but some were identified in those from the LmDL1+ Flt3L +IL 7 co culture system ( Figure 3 3 ). Thus, we conclude that no functionally mature T cells could be obtained from the adult BM derived CD34 + HPCs in the in vitro cultures. Effect of IL 7 D eprivation on DN to DP T ransition In murine T cell development in vitro IL 7 plays a negative role during transition of DN to DP T cells ( 160 164 ) Human thymocytes have been reported to lose IL 7 dependency upon reaching CD7 + CD1a + stage in vitro ( 162 ) We found that day 21 cells were always expressed CD7 and lacked CD1a Thus, we chose this time point for IL 7 deprivation to ensure that the differentiating ce lls were in IL 7 dependent phase of development. To assess the effect of IL 7 deprivation on DN to DP transition, we cultured adult CD34 + BM HPCs on LmDL1 FL7 for 21 days, then the cells were

PAGE 57

57 harvested, washed and then either continued to be co cultured wi th LmDL1 FL7 (IL 7 present ) or with LmDL1 FL/ LmDL1+ Flt3L without IL 7 (IL 7 deprived) The cells were cultured in IL 7 primed or IL 7 deprived condition for additional 10 to 15 days and were analyzed for the expression of CD7, CD1a, CD4, CD8, CD3, a nd TCR We observed a decline in cell survival after IL 7 withdrawal indicating IL 7 dependence of the precursor cells ( Figure 3 4 A open circles). In the IL 7 deprived co culture system we observed the expected increase in IL 7R expression that occurs following IL 7 withdrawal ( Figure 3 4B and 3 4 C). Additionally, we observed a n increase d percentage of DP T cells H owever, these cells lacked the CD3 hi hi phenotype a precursor stage to mature T cells ( Figure 3 4B and 1 4 C ). Thus, IL 7 deprivati on alone i s not sufficient to induce transition to CD3 hi hi DP stage in stage of adult human T cell precursors on the OP9 culture system. Effect of IL 7 W ithdraw on T C ell R eceptor E xcision C ircle (TREC) During T cell development, DN T cell precurso rs rearrange their chain first, which is expressed with pre TCR alpha to form a pre TCR complex ( 56 ) Signaling via p re TCR complex results in allelic exclusion at locus, but initiates rearrangement at the locus and promotes DP transition ( 168 ) Rearrangement at the locus can be evaluated by the presence of TREC, an episomal circular piece of DNA formed due to excision of TCR locus upon rearrangement ( 169 ) As IL 7 was reported to inhibit pre TCR signaling, we analyzed TREC content in the developing T cell precursors cultured in pr esence or absence of IL 7 The results showed that cells from day 0 and day 25 were negative, but from day 30 were positive for TREC ( Figure 3 6A ). We quantified TREC via quantitative PCR analysis using cloned TREC and RAG2 as standards ( Figure 3 5 ) ( 170 ) Our results showed that < 1% cells were positive

PAGE 58

58 for TREC on d ay 30, and IL 7 deprivation had no effect on TREC content ( Figure 3 6B ). RT PCR analysis of RNAs showed that this was not due to the lack of RAG or TCF1, LEF gene expression ( Figure 3 6C ). This result s hows that only a small percent of cells underwent rearrangement at locus in the in vitro system and that IL 7 did not ha v e an inhibitory effect on TREC formation. Effect of A nti CD3 S timulation on IL 7 P rimed and on IL 7 D eprived T c ell P recursors Signaling via pre TCR complex, composed of pre and CD3 is ( 168 171 ) Pre TCR signal s in a ligand independent manner, possibly through oligomerization ( 64 172 ) Pre TCR signaling can be mimicked by anti CD3 antibody stimulation, as i n vivo administration of anti CD3 antibody induces DN to DP transition in Rag2 / pre / mice ( 173 174 ) Also, treatment of FTOC from / Rag2 / or SCID mice with anti CD3 antibody induces DN to DP transition ( 54 173 ) Thus, we tested if anti CD3 stimulation of T cell precursors obtained from LmDL 1 co cultures can induce differentiation to DP stage. In order to maximize cell cell contact for efficient stimulation, we transferred cells of both IL 7 present and IL 7 deprived groups to U bottom 96 well plates, in a stromal cell free environme nt and supplemented with anti CD3/CD28 antibody conjugated beads. We found that IL 7 deprived precursors proliferated upon anti CD3 engagement but IL 7 present group did not, as demonstrated by the fold increase in cell number and intracellular Ki67 staini ng ( Figure 3 7A and 3 7B ). On the other hand, TCR activation of the IL 7 present group of cells induced growth arrest and subsequent cell death (not shown). Additionally, percentage of TREC positive cells increased to ~13% in the IL 7

PAGE 59

59 deprived, anti CD3 st imulated group of cells, indicating increased rearrangement ( Figure 3 7C ). We next examined T cell maturation markers 2 weeks post stimulation after deprivation of IL 7. We observed low CD3 expression and no expression in IL 7 present and ant i CD3 stimulated group ( Figure 3 8A and 3 8C ). Interestingly, anti CD3 stimulated cells from the IL 7 deprived group displayed a robust transition from CD3 lo lo DP to CD3 + + DP and CD4 + SP T cells ( Figure 3 8B and 3 8D ). Additionally, we found tha t the cells were mostly negative for CD56 expression, a NK cell marker ( Figure 3 9 ). The timing of IL 7 deprivation and anti CD3 stimulation was critical, as IL 7 deprivation post day 35 and subsequent anti CD3 simulation did not induce T cell differentiat ion and maturation (data not shown). Thus, we conclude that IL 7 deprivation is necessary but not sufficient to induce DP transition and subsequent anti CD3 stimulation plays a critical role in T cell maturation. We further demonstrated that the in vitro d erived CD4 T cells displayed effector T cell functions similar to that of peripheral blood CD4 T cells as assessed by IFN 17 and IL 4 secretion in response to PMA and i onomycin stimulation ( Figure 3 10 ). R epertoire A nalysis of the i n v itro G enerat ed CD4 T c ells To evaluate the TCR diversity of the in vitro derived T lymphocytes, we performed v v in vitro derived CD4 + SP T cells were stained with the IOTest panel of antibodies The majority o f the in vitro differentiated T cells from adult BM HPCs (four of five donors) displayed a skewed v TCR v and 8, families, respectively, ( Indicated families marked by in donors 1 to 4 Figure 3 11 ) as compared with the control PBMCs, which showed an evenly distributed pattern

PAGE 60

60 (a representative donor PBMC, Figure 3 11 ). The quantitative analysis of multiple samples is summarized in Figure 3 11 B. In all we found that the v family reper toires of the in vitro derived T lymphocytes, to be more restricted than those of normal adult CD4 T cell s. CD8 Lineage C ommitment i n v itro The upstream regulators that determine CD8 or CD4 lineage commitment are not yet identified ( 83 131 175 1 76 ) However it is clear that both TCR signal strength and duration of TCR signaling influence commitment to become CD4 + or CD8 + T cells In our system, we always observed differentiating cell exhibit the CD8 lo CD4 hi phenotype which are precursors to CD 4. On the other hand, CD8 hi CD4 lo DP cells are the precursors to CD8 T cells ( 177 178 ) Another alternat ive was to induce CD8 gene transcription and thus CD8 expression by attempting to stimulate the CD8 gene enhancer activity. Since the CD8 gene enhancer is regulated by calcium flux we s timulated the calcium signaling in IL 7 deprived T cell precursors usin g ionomycin IL 7 has also been reported to influence CD8 lineage commitment. Precursors from day 27, day 33 and day 38 that contained a mixture of DN, CD8 ISP and CD8 lo CD4 lo w ere cultured overnight with ionomycin both in presence or absence of IL 7 and t hen CD8 expression was evaluated A representative experiment from day 38 stimulated with ionomycin shows a marked increase in CD8 expression and occurrence of CD8 hi CD4 lo DP after overnight culture with ionomycin alone or ionomycin and IL 7 ( Figure 3 12). However, these CD8 were negative for the expression of CD3 and Additional experiment s with changing the duration of anti CD3CD28 stimulation did not cause the

PAGE 61

61 differentiating cell to become committed to the CD8 lineage, and both long and short duration stimulation gave rise to only CD4 T cells (Figure 3 13). A ntigen Specificity i n vitro In order to evaluate w hether antigen specific CD4 T cells can be derived in vitro w e attempted to provide HLA peptide complex to the developing T cells utilizing a DC T cell co culture approach. To avoid HLA mismatch BM derived CD34 + HPCs from the same donor were used to derive both DC precurs ors and T c ells in vitro Generation of DC s from CD34 + HPCs has been described previously by our lab ( 159 ) DC precursors were generated by co culturing BM CD34 + HPCs with OP9KFT63KF stromal cells that constitutively express stem cell factor (SCF) Flt3L Thrombopoietin ( TPO ) IL 6 and IL 3 (Figure 3 14A) After expanding the d eveloping myeloid cells on the OP9KFTT63KF cell line, they are further differentiated by co culturing them on OP9GM15 stromal cells that constitutively express GMCSF and IL 15 DC precursors were matured and DC surface markers were evaluated (Figure 3 1 4 B ) DC s were matured using maturation cocktail as indicated in material method section of this chapter. Antigen uptake assay was performed using DQ OVA (Figure 3 14C) DCs were loaded with human cytomegalovir us (HCMV) peptide mix pp 65 then, co cultured with in vitro derived CD4 T cells in 96 well U bottom plate for two weeks (Figure 3 15A) After two weeks of initial stimulation the T cells were re stimulated by culturing for two additional weeks to induce pr imary immune response of the newly generated CD4 T cells against PP65 novel antigen At the end of the four weeks an antigen recall assay was performed. DCs loaded with F16 peptide mix (Peptide derived from a protein expressed by Aspargillus) was used as a negative non specific antigen control for intracellular cytokine staining PMA+ Ionomycin w as used as a positive

PAGE 62

62 control. A t otal of five group s were set up as indicated (Figure 3 15B). The cells in all five groups were cultured in presence of BFA to bloc k golgi mediated secretion for 5 6 hours. Surface staining for CD3, CD107a (a perforin degranulation marker), and intracellular staining for IFN and TNF show any increase in CD107a expression, IFN and TNF pp65 stimulated T cells. Thus, no antigen specific response was observed. Discussion In vitro adult human HPC derived functional T cells have great potential for therapeutic application s as this approach provides donor HLA matched T cells t hat may be genetically engineered to fight infections, cancer or to treat immunodeficiencies. Additionally, a culture system that can support functional maturation of T cells will serve as a useful tool to study human T cell development. Although murine HP Cs undergo full maturation in the OP9 DL1 culture system this culture system does not support differentiation of adult hu man BM CD34 + HPCs to mature T cells ( 120 179 ) In this report, we demonstrated for the first time in vitro development of mature CD4 T cells from adult human BM CD34 + HPCs. This was accomplish ed by concomitant control of IL 7/IL 7R and p re TCR signaling LmDL1 FL7 was superior in supporting T cell precursor proliferation when compared to LmDL1 supplemented with exogenous Flt3L and IL 7. The enhanced precursor proliferation on LmDL1 FL7 could be a consequence of higher concentration of cy tokines in the LmDL1 FL7. However, the possibility of this effect being a consequence of cell based modification of cytokines cannot be ruled out. Flt3L is expressed as a soluble as well as membrane bound form ( 180 ) and glycosylated form of IL 7 has also been reported ( 181 ) While the T cell development potential such as

PAGE 63

63 occurrence of CD8 ISP and DP cells were comparable for both culture systems, some differences exist, such as CD3 expression and development of cells. Cell free or cell cell signaling of the cytokines may account for the differences in proliferation and differentiation of the two systems. Nevertheless, differentiation to DP stage was inefficient and neither system supported terminal T cell maturation. Under both culture conditions, precursor proliferation rate declined beyond 30 to 35 days suggesting a discontinued dependence for IL 7 and Notch signals, consistent with previous reports ( 48 182 ) Thus th e OP9 culture system alone does not support continued differentiation of adult human T cell precursors to CD3 and bearing DP cells. Signaling through IL 7/IL 7R supports survival and proliferation through DN3 stage in murine T cell development and the same is true for human T cell development ( 162 183 ) Lck is a protein tyrosine kinase expressed DN3 stage onwards during murine T cell development, is associated with CD4 and CD8 co receptors and plays a major role in pre TCR and TCR signaling. In transgenic mice, expression of IL 7 under the control of Lck levels, it reduces proliferation and displays a marked block in DP transition ( 163 ) Recent studies further support that IL 7R signals impair differentiation of CD8 ISP to DP cells in ZAP70 / and IL ( 164 ) IL 7 inhibi t s the expression of high mobility group ( HMG ) domain transcription factors TCF 1, LEF 1 and ROR important for pre T to DP transition in the ZAP70 / IL ( 164 ) In addition, IL 7 suppresses anti CD3 antibody induced differentiation to DP stage in FTOC of Rag1 / mice ( 161 ) Thus, we hypothesize d that IL 7 withdrawal prior to ISP might be necessary for efficient DP transition. While IL 7 has been reported to display

PAGE 64

64 an inhibitory role in DP transition in murine T cell development, our results showed that the removal of IL 7 in the in vitro co cul ture increased transition to DP T cells but did not promote further differentiation to CD3 hi + DP and SP T cells The m echanism by which IL 7 inhibits T cell development is unclear. We observed abundant transcripts for TCF, LEF in T cell precursors at various time points (data no shown) Thus it seems unlikely that IL 7 withdraw promotes T cell development by de repressing transcription of the above factors. Our data suggest that IL 7 does not inhibit TREC formation Hence, IL 7 does not directly inhi bit pre TCR signaling. It is possible that an increase in CD4 surface expression post IL 7 withdraw may play a role in how these cells respond to anti CD3 stimulation. I n human T cell development, CD4 ISP stage precedes the DP developmental stage I t is p ossible that increased CD4 surface expression may account of increased responsiveness to anti CD3 stimulation due to the increased number of Lck kinases that become available to phosphorylate down stream TCR signaling proteins Alternative possibility is t hat IL 7 mediates its effect through STAT5 activation which suppresses transcription of genes necessary for pre TCR expression and function ( 184 ) IL 7 has also been reported to negatively regul ate TGF signaling pathway which may play a role in T cell development ( 185 ) Detailed evaluation of the effect of IL 7 on pre TCR si gnaling is described in chapter 4. During T cell development, the appearance of ISP T cell population is dominated by the CD4 ISP cells in human and CD8 ISP cells in m ic e P re TCR signals drive proliferation, rearrangement, and the appearance of CD8 ISP i n mouse and CD4 ISP in hu man s Intere stingly we observed CD8 ISP derived from human CD34 + HPCs in

PAGE 65

65 vitro ; we found a lack of proliferative burst and minimal rearrangement on the locus. Thus, the CD8 ISP may not be true ISP generated by pre TCR signals, rather they may be a result of cyto kine mediated CD8 expression ( 186 ) T cell development is a complex process that involves multiple checkpoints and three di mensional architecture composed of multiple cell types and compartments ( 6 86 149 151 ) Our results showed that signaling via CD3 and cell cell contact was sufficient to drive differentiation to DP and subsequent CD4 lineage commitment in the absence of thymic environment. As OP9 cells do not express MHC class II but the developing human thymocytes do express HLA class II (data not shown), the resulting CD4 cells are most likely selected by self MHC of the developing thymocytes. This alternat ive pathway of CD4 T cell development has been reported previously, especially in human T cell development ( 187 188 ) Our study is in agreement with recent reports demonstrating that human HPCs transplanted in immune compromised m ic e can develop into CD4 T cells ( 103 189 191 ) Such T cell development can occur via thymocyte mediated selection, and does not require the presence of professional antigen presenting cells o r epithelial cells expressing MHC class II. Additionally the CD4 lineage commitment differences have been observed be tween fetal and adult DN cells, f etal DN cells produced 1:1 ratio, and adult DN cells produced 3:1 ratio of CD4 to CD8 cells ( 192 ) The human CD 4 T cells derived from NOD/SCID/ c / mice receiving transplanted human HPCs display diverse TCR family repertoire ( 190 191 ) However, w e found reduced TCR diversity in our in vitro three dimensional environment in vivo and the HLA expression on thymocytes may

PAGE 66

66 account for such differences. Thus, even though lineage commitment to CD4 lineage c an be achieved independent of thymic microenvironment, the latter could play a central role in establishing a balanced TCR repertoire diversity, inducing negative selection, as well as promoting CD8 lineage commitment. Another possibility is that rea system and the small population of cells with proper ly expressed TCR complexes get selected upon anti CD3 stimulation ( 54 165 193 ) Finally, our attempt to induce antigen specificity by priming in vitro derived CD4 T cells with HLA matched in vitro der ived DCs was unsuccessful. Most likely this wa s due to the narrow range of TCR expressed by the in vitro derived T cells which may not express the necessary TCR that can properly recognize the presented peptide. In conclusion IL 7 withdraw is necessary but not sufficient for further differentiation of the developing human T cells from the DN to DP stage, and anti CD3 stimulation plays a key role in inducing DP as well as subsequent maturation to CD4 T cells (Figure 3 16) Our findings simplify the experimental approaches required for in vitro modeling of adult human T cell differen tiation, and will help develop novel approaches for T cell immunotherapy employing adult BM HPCs.

PAGE 67

67 Figure 3 1. Establishment of LmDL1 FL7 cell line and evaluation of growth of CD34 + HPC of adult BM origin. A) Schematic of l entivector constructs expres sing mDL1, hu IL 7 and hu Flt3L B) PCR analysis for mDL 1, hu Flt3L and huIL 7 mRNA expression C ) Surface expression of mDL 1 D ) Surface expression of hu Flt3L D) S urface express ion in various OP9 cell lines. E) ELISA for IL 7 production. F) Growth kineti cs of CD34 + HPC of adult BM origin during co culture on LmDL1 +IL 7+ Flt3L and on LmDL1 FL7.

PAGE 68

68 Figure 3 2. T cell development kinetics of adult BM CD34 + HPC on LmDL1+IL 7+ Flt3L or LmDL1 FL7 co culture condition Expression of CD8, CD4, CD7, and CD1a o n p recursors under LmDL1+IL 7+ Flt3L o r LmDL1 FL7 co culture over time was assessed by flow cytometric analysis ND is not determined, due to insufficient cell number at indicated time point. Data represents three independent experiments.

PAGE 69

69 Figure 3 3 T cell development kinetics of adult BM CD34 + HPC on LmDL1+IL 7+ Flt3L or LmDL1 FL7 co culture condition E xpression kinetics of CD3, TCR and TCR 7+ Flt3L or L mDL1 FL7 co culture condition was assessed by flow cytometric analysis. ND is not determined due to insufficient cell number at indicated time point. Data represents three independent experime nts.

PAGE 70

70 Figure 3 4 The effect of IL 7 withdrawal on T cell differentiation. A) Adult BM CD34 + HPCs were co cultured on LmDL1 FL7 for 21 days and continued on LmDL1 FL7 (IL 7 present) or transferred to LmDL1 + Flt3L (IL 7 deprived) for an additional 9 da ys. Growth curves for the developing T cells in the presence or absence of IL 7 after day 21. B) Analysis of T cell markers in T cell development cultures with or without IL 7 withdrawal after day 21. C) Summary for percentage of the DP, CD4 and IL 7R positive cells n=5

PAGE 71

71 Figure 3 5 Titration curves of cloned Rag2 and TREC temp lates of known concentrations. A ) The cloned plasmid for Rag2 and TREC were used to generate standard curves by performing a log dilution series B) The Ct value was plot ted against the plasmid copy number calculated from plasmid weight, to determine slope.

PAGE 72

72 Figure 3 6 The effect of IL 7 on gene rearrangement in adult BM CD34 + HPC in the LmDL1 co cultures. A) PCR analysis for TREC and Rag2 was performed using genomic DNA harvested T cell precursors that were first cultured on LmDL1 FL7 for 25 days and then transferred to LmDL1 FL or LmDL1 FL7 condition for additional five days (day 30) B) SYBR q uantitative PCR analysis of the samples shown in A, n=3 C) RNA w as harvested from T cell precursors that were first cultured on LmDL1 FL7 for 25 days and then transferred to LmDL1 FL or LmDL1 FL7 condition for additional five days (day 30). 1 g mRNA was reverse transcribed to cDNA and subjected to PCR using primers specific for Rag1, Rag2, TCF1 and LEF

PAGE 73

73 Figure 3 7 Effect of anti CD3/CD28 co stimulation on IL 7 primed and IL 7 deprived precursors A) Adult human HPCs were co cultured o n LmDL1 FL7 for 21 days and continued on LmDL 1 FL7 (IL 7 p resent ) or transferred to LmDL 1 FL (IL 7 deprived) for an additional 9 days and stimulated using anti CD3/CD28 beads The fold increases in cell number were determined by cell enumeration and analyz ed by non parametric students T test (n =5, P = 0.006). B) Increase in cell proliferation was confirmed by i ntracellular sta ining for proliferation marker Ki67 as assessed by flow cytometric analysis compared to the isotype control (grey line) C) SYBR gre en qu antitative PCR analysis for TREC was performed on genomic DNA isolated from proliferating cells in antiCD3/CD28 stimulated IL 7 deprived group and PBMC was used as control.

PAGE 74

74 Figure 3 8 Effect of IL 7 deprivation and anti CD3/CD28 co stimulatio n on T cell maturation Adult HPCs were co cultured with stromal cells for 21 days and continued on with IL 7 (IL 7 present ) or transferred to culture without IL 7 (IL 7 deprived) for an additional 17 days. The cells were then transferred to 96 well U bott om plates and stimulated with anti CD3/CD28 beads for an additional 14 days. Flow cytometr ic analysis of indicated T cell surface markers was performed n=4

PAGE 75

75 Figure 3 9 Evaluation of NK cell markers on in vitro differentiated CD4 T cells. Flow cy tometry analysis of additional surface markers for the in vitro differentiated T cells, n=2

PAGE 76

76 Figure 3 10 Analysis of effector functions of the in vitro derived CD4 T cells. Healthy in vitro derived CD4 T cells were stimulated using anti CD3/CD28 beads in the presence of IL 2, IL 7 and IL 15 for two weeks. Intracellular effector cytokine and surface marker expression of m onensin treated non stimulated or PMA and ionomycin stimulated cells was analyzed by antibody staining and flow cytometry n=2

PAGE 77

77 Figure 3 11 TCR v in vitro derived CD4 T cells. A) After anti CD3/28 stimulation, the in vitro derived CD4 T cells were surface Kit. CD3 gated population s were evaluated fo r the expression of the various v F from the in vitro differentiated CD4 T cells from the 5 donors and a representative normal PBMC donor healthy donor PBMC s ( n=4 ) versus in vitro derived CD4 T cells ( n= 7)

PAGE 78

78 Figure 3 12 Effect of ionomycin and IL 7 on CD8 versus CD4 lineage commitment. BM HPCs were culture on LmDL1 FL7 for 33 days and deprived of IL 7 for 5 days. These cells were stimulated as indicate d, for 24 hours and surface phenotype was evaluated. T cell surface markers were re evaluated after additional 2 weeks of stimulation by flow cytometry Data represents two independent experiments.

PAGE 79

79 Figure 3 13 Effect of duration of TCR stimulation on CD8 or CD4 lineage commitment. IL 7 deprived cells on day 30 were further stimulated with anti CD3 beads f or <10 h ou r or for >10 h ou r and T cell surface markers were analyzed after 1 week of culture.

PAGE 80

80 Figure 3 1 4 Dendritic cell precursor develop ment for BM HPCs. A) BM derived CD34 + HPCs were co cultured on OP9KFT63KF cell line for 15 days and the indicated surface markers were analyzed using flow cytometry. B) Dendritic cell markers were analyzed by flow cytometry, post co culture on OP9GM15 cell line at indicated time points. C) DC precursors were matured using maturation cocktail and analyzed for antigen uptake by using DQ OVA antigen uptake assay, grey histograms are isotype controls.

PAGE 81

81 Figure 3 15 Antigen recall assay for in vitro derived T cells A) S c hematic of the in vitro co cultures for DC and T cell generation an d antigen recall assay set up. B) T cells stimulated for a total of four weeks were re stimulated, B erfaldin A treated, permeabilized and the intracellular cytokine was asses sed by flow cytometry.

PAGE 82

82 Figure 3 16 Summary of human T cell development in vitro

PAGE 83

83 CHAPTER 4 IL 7 ENHANCES PRE TCR SIGNALING BY ACT IVATING ERK1/2 AND A KT PATHWAYS IN HUMAN TH YMOCYTE CELL LINE Introduction HPCs is a progressive and multistep process. T cell development can be characterized by the expression of CD4 and CD8 co receptors. The CD8 CD4 double negative (DN) thymocytes differentiate through CD8 immature single positive ( ISP ) in m ic e and CD4 ISP in human s followed by CD8 + CD4 + double positive ( DP ) and then CD4 + and CD8 + single positive ( 6 45 149 152 ) The earliest DN stages in mice are characterized by the expression of CD25 and CD44 and are subdivided into CD44 + CD25 DN1, CD44 + CD25 + DN2, CD44 CD25 + DN3 and CD44 CD25 DN4 ( 194 ) The first step in T cell development is the assembly of pre TCR complex. The pre TCR complex is made up of the newly rearranged pre T and low levels of CD3. Pre TCR complex is highly expressed during DN3 stage in mice and during DP CD3 lo stage in humans ( 52 195 ) Signaling via pre TCR initiates rearrangement at the locus, and induc es allelic exclusion at the locus ( 196 197 ) IL 7 signaling promotes DN cell survival, proliferation and rearrangement at TCR and locus ( 94 198 199 ) However during the later stage where the pre TCR mediated signaling drives DN to DP transition, IL 7 was reported to be an inhibitory factor as it suppressed DN to DP transition in a dose dependent manner ( 200 ) Detailed analysis showed that IL 7 arrest ed the precursors in DN3 stage and thus prevent ed further differentiation to DP stage in fetal thymus organ culture (FTOC) ( 160 ) IL 7 also suppresse d anti CD3 mediated DN to DP stage transition of recombination activating gene 1 (RAG 1) deficient pre T cells in FTOC ( 201 ) Inhibitory effect of IL 7 was

PAGE 84

84 reported to be med iated by IL 7s ability to reduce transcription of TCF, LEF and ROR proteins that play a major role in TCR gene rearrangement ( 202 ) However, the possibility that IL 7 exerts its effect by inhibiting pre TCR signaling has not been ruled out. IL / ( 95 203 ) In humans, mutation in IL 7R causes severe combined immunodeficiency ( 89 ) Anti IL expression in human CD34 cells in FTOC ( 96 204 ) Thus, accordi ng to these studies IL 7 signaling play s a supportive role in DN to DP transition, which contradicts the mouse studies. Moreover, i n chapter 3 we observed that IL 7 inhibited transition to DP stage but did not inhibit TREC formation, an indicator of pre TC R signaling. Insights into the direct interaction of IL 7 and pre TCR signaling pathways could he lp clarify the role of IL 7 with respect to pre TCR signaling IL 7 binds to the IL 7R and c heterodimer leading to Jak3, Jak1 activation ( 205 ) In humans IL 7 activate s STAT5 signaling pathway in DN CD4 ISP and in mature T cells, but not in DP CD3 lo or DP CD3 hi thymocyte subsets ( 98 ) IL 7 was reported to activate the Pi3K /Akt pathway in CD3 + human thymocytes and in B cell precursor cell line but not in mature T cells ( 206 ) A nother report showed that IL 7 activates STAT5 Erk1/2 and Akt in CD34 + human thymocyte but only STAT5 in the CD34 fraction which included CD4SP, CD8SP, and DP population ( 207 ) Pr e TCR signals in an autonomous fashion independent of extracellular ligands and is thought to activate pathways similar to that of TCR signaling pathways ( 61 64 196 ) A nti CD3 antibody stimulation has been used to mimic pre TCR signaling ( 54

PAGE 85

85 165 ) deficient Jurkat cell line has been used to study pre TCR signaling ( 65 208 209 ) However, Jurkat cells are considered mature T cells, and do not recapitulate T cell precursor stage of development. Here, we evalu ated different T ALL cell lines and used Molt3 as a model pre T cell system Molt3 is a CD4 + CD8 + CD3 lo IL 7R cell line, hence responds to anti CD3 stimulation but not IL 7 stimulation. Next we over expressed IL 7R in Molt3 and demonstrate d IL 7 responsiveness in the Molt3 cell line. Finally we evaluated the effect of IL 7 on pre TCR signaling and identified t hat IL 7 enhances pre TCR signaling through Erk1/2 and Akt pathways. Materials and Methods Flow C ytometry a nd A ntibodies The antibodies used for surface and intracellular staining are as follows : CD3PE cy7 clone SK7, CD4 Pacific blue, clone RPA T4, CD8 A PC Cy7 clone SK1 (BD biosciences), CD127 clone 40131 (R&D systems, Minneapolis, MN), pre 14 (Santa Cruz biotechnology, Inc. Santa Cruz CA) Anti STAT5 (pY694) FITC, clone 47, anti Akt (pS473) PE, clone M89 61, anti Erk1/2(pT202/pY204) Alexa 647, clone 20A (BD biosciences, San Jose, CA). For flow cytometric staining, cells were first was hed with PBS plus 2% FBS and blocked with mouse and human serum at 4C for 30 min utes fluorochrome labeled antibody used, appropriate isotype control was included. After antibo dy staining, the cells were washed twice in FACS buffer and fixed with 2% para formaldehyde. Intracellular staining was performed using BD cytofix/cytoperm kit, phosphorylated prot eins cells were stimulated using indicated stimulus for 15 minutes. The cells were then fixed by adding equal amount of pre warmed 2%

PAGE 86

86 para formaldehyde, and permeabilized with 90% methanol 30 min ute s on ice or 20 o C overnight. Next, the cells were washed a nd incubated with indicated antibodies for 1hr at room temperature, followed by two washes in FACS buffer. Data was acquired using BD FACS Diva software (version 5.0.1), on a BD LSR and analyzed using the Flowjo software (version 7.1.3.0, Tree Star, Inc. P asadena, TX). Lentiviral Vector Construction and Transduction The IL ( 210 ) The RNA was isolated from SupT1 cell line and reverse transcribed into cDNA using reverse transcriptase ( P romega) and oligo dT primers ( P romega) The cDNA was amplified by PCR using the following primers 5' AAAGATCTCCACCATGACAATTCTAGGTACAA C 3' and 5' AAACTAGTTCACTGGTTTTGGTAGAAG CTG 3' The PCR product was subjected to agarose gel electrophoresis, and the band corresponding to the desired PCR product size was purified using QIAquick Gel Extraction Kit ( Qiagen ). The purified product was ligat ed into pST Blue 1 Acceptor vector ( Novagen) and transformed in to NEB 5 alpha c ompetent E. coli ( New England Bio Lab ). The IL 7R into the self inactivating pTYF lentiviral vector by using NheI and KpnI restriction sites For creating IL 7R monomer Apple (mApple) fusion protein, a total of three fragments spanning the IL 7R were isolated from pTYF EF1 CD127 vector using NsiI to SalI, SalI to HindIII, and HindIII to NheI restriction sites. A n adapter fragment CTAGTACTAGTGCGC with flanking N heI and A sc I restriction sites (I ntegrated DNA Technologies ) along with the above mentioned three f ragments were ligated into a pTYF EF1 mWasabi vector The resulting vector pTYF IL7R mWasabi contained

PAGE 87

87 human EF1 driven human IL 7R fused with monomer Wasabi. The monomer Wasabi fragment was replaced by m Apple using BamH I and SpeI restriction sites. T his created a pTYF EF1 IL 7R mApple construct, which contained EF1 driven human IL 7R fused with monomer Wasabi. To generate a fusion protein with a hinge motif between IL 7R and the reporter, a 20 L reaction mixture was prepared using 200 oligo nucleotides CTAGTGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCG GATCCGCTGCCGCCGCCGCCGCTGCCGCCGCCGCCGCTGCCGCCGCCGCCA (Integrated DNA Technologies) with flanking SpeI and BamHI sites, 1 L of T4 polynucleotide kinase (New England Bio labs Inc.), and 2 L of the 10X T4 kinase buffer. The above reaction was incubated for 30 minutes at 37 o C and for additional 20 minutes at 65 o C for annealing the complementary oligonucleotides. The above annealed helix turn helix spacer (hinge) was inserte d between the IL 7R and monomer Apple using SpeI and BamHI sites to create a pTYF EF1 IL 7R hinge mApple fusion protein expression vector. The IL 7R s iRNA construct was prepared by using complementary pairs of six synthetic oligonucleotides as followi ng: 1 GATCCCGCT GACACTC 2 CTGCAGAGAAATTCAAGAGATT 3 TCTCTGCAGGAGTGTCAGCTTTTTTGGAAA 3', 4 CTAGTTTCCAAAAAAGCTGACAC TCCTGCAGAGAAATCTCTTGAA 6 TTTCTCTGCAGGAGTGTCAGCGG We first treated these oligonucleotides using T4 polynu cleotide kinase; t wo 10 L reaction mixtures were prepared by adding 5

PAGE 88

88 M of the 1 3 oligonucleotides and 4 6 oligonucleotides. 1 L of the 10X T4 DNA ligase buffer (Promega), and 0.5 L of T4 polynucleotide kinase (New England Biolabs Inc.) was added to each tube. The above reac tion mixtures were incubated at 37 o C for one hour and 30 minutes, followed by 20 minute incubation at 65 o C. The 10 L of mixture containing kinase treated oligonucleotides 1 3 was mixed with the complementary oligonucleotides 4 6. This mixture was heated t o 70 75 o C for 2 minutes and was allowed to cool to room temperature in order to anneal the complementary oligonucleotides. The annealed s iRNA fragment was cloned into NEP U6rPuro vector using BamHI and SpeI cloning sites The resulting vector PGK Puro U6 IL 7R siRNA contained U6 promoter driving the expression of siRNA against IL 7R a nd PGK promoter driving the expression of puromycin resistance gene. Inhibitors Jak3 inhibitor V was purchased from C al biochem, MEK1/2 inhibitor U0126 and PI3 Kinase Inhibitor LY294002 w ere purchased from C ell S ignaling T echnology I nc. RT PCR and Real Time PCR RNA was harvested from cells using TRI Reagent (Sigma Aldrich). 1 RNA was reverse transcribed into cDNA by using Two step AMV RT PCR kit (Gene Choice, MD). The followin g primers were used for the PCR reactions: GAPDH F (Forward ) CCGATGGCAAATTCGATGGC (Reverse) GATGACCCTTTTGGCTCCCC F R AATGCTCCAAGACTGGAGGAAGGA F TGAAGCATCAT CAGTAGTCACAC R GGCCTCTGTCAACATTTACC IL 7 TCGCAGCACTCACTGACC 3' and R

PAGE 89

89 GTCATTGGCTCCTTCCCG 55C for 30 seconds, and 72C for 60 seconds), PCR products were separated on a 2% aga rose gel. For Real Time PCR analysis of IL 7R the following primer pairs were used: 18S r RNA F 5' GGACAACAAGCTCCGTGAAGA 3' and18S r RNA R 5' CAGAAGTGACGCAGCCCTCTA 3' and IL 7 TCGCAGCACTCACTGACC 3' GTCATTGGCTCCTTCCCG using SYBR green PCR master mix (Invitrogen) The p rimer amplification efficiency was established by 7 log serial dilution of cDNA for both 18SrRNA and IL 7R Q PCR reaction was performed using 95C for 10 minutes followed by 40 cycles of amplification (95C for 30 seconds, 55C for 30 seconds, and 72C for 60 seconds ). Intracellular Ca2 + M easurements Molt3 and Jurkat cells were resuspended at a density of 2X10 6 cells per mL in PBS containing 1 mM calcium, 1mM magnesium, and 0.5% BSA. The cells were the n loaded with 4 Ca2 + indicator dye Indo 1 AM (Molecular Probes) by incubating for 30 minutes at 37 o C. The cells were washed twice with PBS containing 1mM calcium, 1mM magnesium, and 0.5% BSA. The tube containing the cell suspension was warmed to 37 o C and was pla ced onto LSR II flow cytometer (Becton Dickinson). Baseline measurements were collected for 1 min ute After 1 minute the tube was removed from the flow cytometer and anti CD3 clone /mL ), anti mouse IgG (0.15 mg /mL ) antibodies were added and meas urement was continued for another 5 minutes After 5 minutes the tube was again removed from the flow cytometer and ionomycin /mL ) was added to induce the release of maximum intracellular calcium and serve as a positive control. The maximum intracellu lar calcium levels were measured for the final

PAGE 90

90 1 2 minutes. Stimulus induced changes in the intracellular Ca2 + concentration were determined over time by monitoring the fluorescence emission ratio of the Ca2 + bound versus free form of indo 1 AM at 405 and 495 nm, respectively; data were analyzed and plots were generated using kinetics tool in the Flowjo software program (Tree Star S ystem Inc ). Western Blot For Western blot analysis, cells were collected at spec ific time points post treatment and washed in cold PBS buffer before being lysed in Blue Loading buffer with dTT (Cell S ignaling T echnology Inc.) and supplemented with protease inhibitor mixture (Roche Diagnostics, Mannheim, Germany). Protein was separated on 10% SDS page gel and then transferred to PVDF membranes (Millipore). The membrane was blocked and probed with antibodies against phosphorylated Erk1/Erk2 (Thr202/Tyr204) (clone, D13.14.4E) and Erk1/Erk2 (clone, 137F5) (Cell Signaling Technology Inc.). Next, the membrane was incubated with horse r adish peroxidase conjugated secondary antibody ( C ell S ignaling T echnology Inc.). Bound proteins were visualized by Super Signal West Pico Chemiluminescent Substrate (Thermo Scientific). Statistical Analysis Statistical analysis was performed by applying Wilcoxon matched pairs signed rank test using Graph Pad Prism 5 software. Immunofluorescence C ells were fixed with 4% paraformaldehyde and the nuclei were stained using DAPI and imaged using Olympus IX81 DSU Confocal Microscope equipped with 63X water imme rsion lens for Molt3. HeLa cells were imaged by using a Leica fluorescent microscope at 40X using a spot camera (Diagnostic Inc. ) For live cell imaging,

PAGE 91

91 CD3 eGFP and IL 7R hinge mApple transduced cells were suspended in RPMI containing 10% FBS and 25 mM HEPES. The cells were allowed to settle just before imaging in chambered cover glass slides coated with poly D Lysine solution. Cells were imaged by using an Olympus IX81 DSU Spin Disk Confocal Microscope equipped with a 60X water immersion lens. For t ime lapse, images were taken at the mid plane of the cell for ever y 30 seconds for 20 minutes. Representative images for every 1 minute are shown. Images were acquired with the attached CCD camera. Results Characterization of T ALL C ell L ines H uman T cell de velopment is characterized by DN, DP CD3 lo DP CD3 hi TCR + CD8 SP or CD4 SP stages as illustrated at the top of Figure 4 1 Full length transcripts of and pre lo stage and pre TCR signaling drives progression to DP CD3 hi and induces allelic exclusion at locus, followed by locus rearrangement ( 58 ) To study the effect of IL 7 on p re TCR signaling we examined several profiles of several candidate precursor T cell ALL cell line s ( 211 ) Out of the T ALL cell lin es that are found to be arrested in stages of T cell development that are depicted by cortical thymocytes, Molt3 and SupT1 resembled cells that are have initiated pre TCR signaling but have do not express mature Molt3 has a rearranged chain a nd is positive for intracellular expression ( 211 212 ) we evaluate d Molt3 for the expression of CD3, Pre and IL RT PCR analysis of Molt3 RNA showed comparable levels of CD3 and pre but reduced IL transcripts when compared to S up T1 and Jurkat ( Figure 4 1A). Surface marker analysis by flow cytometry showed that Molt3 is CD4 lo CD8 lo DP with low CD 3 surface expression ( Figure 4 1B) but intracellular staining revealed that cytoplasmic CD3 expression in

PAGE 92

92 Molt3 was similar to SupT1 and Jurkat (Fig. 1B) In addition, we detected higher levels of cytoplasmic pre expression in Molt3 than in SupT1 and Jurkat ( Figure 4 1B). Furthermore Molt3 showed CD7 + CD1a low expression (not shown). These results suggest that Molt3 is arrested in the DP CD3 lo preT development stage during which the pre TCR signaling occurs ( 213 ) However, it lacks surface IL 7 requirement for IL 7 signaling ( 90 91 214 ) Response to IL 7 a nd A nti CD3 S timulation in Molt3 Cell Line O verexpressing IL 7 To study IL 7 signaling in Molt3, we constructed a lentivector encoding IL 7R and established an IL 7R hi M olt3 cell line IL 7 RT PCR and flow cyto metry analyses confirmed IL 7R RNA and surface expression in the IL hi Molt3 cell line. We evaluated IL 7 responsiveness by assessing phosphorylation of STAT5 ; the result illustrated that IL 7 induced STAT5 activation in IL hi Molt3 but not the unmo dified Molt3 cell line (Fig ure 3 2 A ). Next, we evaluated the response to anti CD3 stimulation by analyzing the T cell activation markers CD25 and CD69 ( 215 ) Molt3 up regulated CD25 and CD69 in response to anti CD3 stimula tion (Fig. 3 2B ) Induction of calcium flux was evaluated using Indo 1 AM dye, and the results showed a low level of response to anti CD3 stimulation of both unmodified Molt3 and IL hi Molt3 when compared to i onomycin induced calcium flux or anti CD3 st imulated J urkat. Note that, despite of high CD3 expression and IL both IL 7 and anti CD3 stimulation (Fig. 3 3 ). Th e above results demonstrate that IL hi Molt3 and not SupT1 cell line wa s responsive to bo th IL 7 and anti CD3 mediated pre TCR signaling Thus, IL hi Molt3 can be used to evaluate the role of IL 7 on pre TCR signaling

PAGE 93

93 Effect of IL 7 on P re TCR S ignal To assess the effect of IL 7 on anti CD3 mediated activation, we tested four conditions: no treatment, anti CD3 Ab, anti CD3 Ab plus IL 7 and IL 7, using IL 7 R hi M olt3 cells ( Figure 4 4 A ) Our results show ed a consistent increase (n=10, p=0.002) in the expression of CD25 in the anti CD3 Ab plus IL 7 group. Interestingly, IL 7 alone also induc ed a slight increase of CD25 ( p=0.002, Figure 4 4 A and 3 4 B). Induction of calcium flux was evaluated using Indo 1 AM dye. Intensity of TCR stimulation directly corresponds to calcium flux, as measured by Indo 1 AM v iolet/ b lue ratio, and duration of TCR si mulation can be visualized over time. Evaluation of the effect of IL 7 on anti CD3 induced calcium flux showed no change both in the intensity and the duration of calcium flux ( Figure 4 4 C and 3 4 D). Identification of P re TCR S ignaling P athway in Molt3 P re TCR signaling drives DN to DP transition, but the signaling partners of the cytoplasmic tail of the human pre TCR complex have not yet been identified ( 197 ) Additionally, critical differences exist between mouse and human cytoplas mic domain of Pre ( 55 62 196 216 ) There are three candidate pathways for human pre TCR signaling: Erk1/2, PI3K and mediated signaling. Pre TCR signaling is thought to occur through pathways that are similar to th ose of TCR signaling pathways, based on th e knock out and transgenic mice studies ( 61 197 217 221 ) A lternatively possibility is pre c chain of IL 2 receptor complex, as pre / c / double knockout mice display a profound defect in early T cell development ( 60 ) T o identify the mechanism by which IL 7 enhance s pre TCR signal ing we first examined the candidate pathways involved in pre TCR signaling in IL hi Molt3. For the PI3K pathway, we tested the PI3K inhibitor Ly294002. For the Erk1/2 signaling

PAGE 94

94 pathway we utilized the U0126 inhibitor ( 222 ) c we utilized Jak3 inhibitor V a c chain signal transduction begins with binding of Jak3 ( 223 225 ) M olt3 was pretreated with the indicated inhibitors for two hours followed by anti CD3 stimulation and overnight incubation Analysis of CD25 and CD69 shows that Erk1/2 and P I 3K Akt pathway s were required for pre TCR signaling c signaling pathway was dispensable ( Figure 4 5 A and 3 5 B) Effect of IL 7 on Pre TCR M ediated Erk1/2 and Akt A ctivation As Erk1/2 and PI3K Akt pathways were identified to play a central role in pre TCR signaling, we evaluated the effect of IL 7 on these two pathways using IL hi Molt3 Activation of STAT5 served as a control for IL 7 signaling. We used phosph orylation specific antibodies and flow cytometry analysis for quantitative assessment of STAT5 Akt and Erk1/2 activations. Preliminary flow cytometry analyses of these target proteins at 5, 15, 30 and 60 min utes post stimulation established that all three proteins were optimally phosphorylated at 15 min ute s and thus we used this time point for the following experiment ( Figure 4 6 ). The results showed no STAT5 activation in response to anti CD3 stimulation, and almost the entire population was positive for tyrosine phosphorylated p STAT5 in resp onse to IL 7 stimulation ( Figure 4 7 A). Molt3 is a g amma secretase inhibitor (GSI) resistant cell line and has PTEN deficiency and therefore, has constitutively active Akt ( 226 ) Pre TCR signaling enhanced Akt activation in some cases, however statistical analysis did not show significance. IL 7 alone significantly increased Mean F luorescence I n tensity (MFI) for activated Akt ( Figure 4 7 B). Anti CD3 stimulation activated Erk1/2 in a small percent of cells (from 0.8 to 9.8%, Fig. 4 7 C); interestingly, IL 7 alone was able to activate Erk1/2 (8%) and had a

PAGE 95

95 significant additive effect on anti CD3 med iated Erk1/2 activation (28%, n=10, Figure 4 7 C), which was further confirmed by Western blot ( Figure 4 7 D). Dynamics of IL 7R and CD3 As IL 7 increased pre TCR signaling we wanted to evaluate the dynamics of IL 7R with respect to a central compo nent of the pre TCR signaling complex. We engineered an IL 7R mApple ( M onomeric a pple r ed fluorescent protein) fusion protein construct to evaluate the dynamics of IL Jurkat cells infected with this construct were una ble to activate STAT5 in response to IL 7 (Data not shown). Hence, we redesigned the construct and included a helix turn helix spacer between IL (Figure3 8A). HeLa cells or Molt3 cells infected with the IL hinge mApple construct showed l ocalization of the protein mainly in perinuclear compartments, with very l ittle protein on the membrane ( Figure 4 8B). Next, we assessed IL 7 responsiveness in the Mol t 3 infected with IL hinge mApple by evaluating STAT5 activation. Our data show ed that IL hinge mApple can function normally as the cells were able to phosphorylate STAT5 in response to IL 7 ( Figure 4 8C) Next, we evaluated the dynamics of IL with respect to by live cell imaging using a spin disk confocal microscope ( Figu re 4 9A) eGFP construct has been described previously by Krummel et al ( 227 ) We found that IL micro clusters inside the cells and often surfaced. Interestingly IL ten was found to be moving in close proximity with een in time lapse images ( Figure 4 9B ). However this effect was less apparent in Jurkat cells ( n ot shown)

PAGE 96

96 Role of IL 7R in pre TCR signaling To assess if IL 7R is required for pre TCR signaling we infected Molt3 with l entivirus expressing IL 7R s iRNA driven by the U6 promoter and selected for transduced cells using puromycin. SupT1 naturally express IL 7R was used as control ( Figure 4 10 A). IL 7R regulation at mRNA level was assessed by SYBR Green Real T ime quantitative PCR ( Figure 4 10 B). I L 7R down regulation at the protein level was confirmed at intracellular and surface leve ls by flow c ytometry ( Figure 4 10 C). Non t reated and IL 7R s iRNA treated Molt3 cells were stimulated overnight using anti CD3/CD28 beads. Surface expression of CD25 was assessed ( Figure 4 10D and 3 10 E). Our data show that intracellular IL 7R required for pre TCR signaling and s urprisingly, s iRNA treated M olt3 showed higher activation as assessed by CD25. Discussion IL 7 inhibits pre TCR signaling, both in vi tro and in transgenic mice ( 160 200 202 ) On the other hand studies done using human HPCs or patients with mutation in IL show the importance of IL 7 signaling in early T cell development ( 89 96 ) In this study we evaluate the r ole of IL 7 during pre TCR signaling pathway activation to understand how these two pathways interact in humans. For this purpose we over expressed IL 7R in Molt3 cell line and demonstrate d both, anti CD3 and IL 7 responsiveness. W e report that in additi on to STAT5 and Akt, IL 7 can also activate Erk1/2 pathway in IL hi Molt3. Thus, the previous observation reporting IL 7 inhibition on the generation of DP population could have been a result of IL CD4 gene rat her than a direct consequence of pre TCR signaling. Additionally IL 7 is

PAGE 97

97 known to enhance the expression and activity of CD4 silencer binding factors, namely c myb ( 228 ) We detected mRNA for CD3, p re the Molt3 cell line. Molt3 expressed CD3 at levels comparable to SupT1 and Jurkat, however intracellular and surface protein expression were dramatically different suggesting post transcriptional and post translational regulation of thes e proteins. Molt3 was previously characterized as a CD 3 negative cell line, however this m ay be a result of the anti CD3 antibody clone used ( 229 ) Our data show abundant mRNA expression for pre and intracellular protein expression in Molt3 cell line. H owever the surface pre in the Molt3 cell line The lack of surface expression of pre T u nlike murine pre T human pre T has endoplasmic ret iculum ( ER ) retention signals in the cytoplasmic domain and hence is retained in the cytoplasm ( 55 62 ) In terestingly, IL s were present at extremely low levels in Molt3 when compared to SupT1 and Jurkat cell lines however intracellular protein expression was comparable. Again, surface protein expression was dramatica lly different. Our data suggest that at low levels of mRNA transcription, IL higher levels of mRNA are required for subsequent surface expression. Next, we showed that IL 7 significantly activates Akt and STAT5 and low level of Erk1/2. IL 7 can activate the Erk1/2 pathway in pre B cells, but not in mature T cells ( 205 230 ) Our data are in line with the reported ability of the IL 7 to activate Erk1/2 in the IL 7 dependent immature T cell line TAIL 7 ( 231 232 ) Interestingly, IL 7 activated Erk1/2 only in a small percent age of cells unlike STAT5 and Akt activation. This correlates with the amount of increase in CD25 expression in response to IL 7. How

PAGE 98

98 IL 7 activates Erk1/2 is not understood. Our data raise a possibility that IL 7 activates Erk1/2 in a pathway distinct from the STAT activation. The IL ail is associated with Lck and Fyn, kinases normally associated with T cell co receptor CD4 and CD8 ( 233 234 ) IL it is expressed in DN stage shuts down in DP stage and it is re expressed in mature T cells ( 87 97 ) In contrast to regulation in mouse thymocytes, IL T cell development, but its binding partner is down regulated during DPCD3 lo and DPCD3 hi stages resulting in a loss of STAT5 activation ( 98 ) However, activation of the P I 3K and Erk1/2 pathway in respo nse to IL 7 was not evaluated ( 207 ) Nevertheless, the stringent requirement for shutdown of IL 7 signaling during pre TCR signaling is still puzzling. Here we found that IL 7 delivers signals similar to the pre TCR signal. This may allow the precurso rs to bypass TCR beta selection and allow progression to next stage with improperly rearranged TCR hus, t his may explain the stringent requirement of IL 7 signal shutdown during pre TCR stage. Finally, we assessed whether IL 7R TCR signaling. Our data showed that IL 7R TCR signaling. Surprisingl y, the IL 7R s iRNA treated group showed higher activation compared to the non infected control. This is important as targeting T cells with high IL 7R for human inflammatory bowel disease ( 235 ) Our results raise a possibility that down regulation of IL 7R

PAGE 99

99 Figure 4 1 Pre TCR and IL 7 Receptor expression in T ALL cell lines A) schematic of human T cell development. cDNA was synthesized from RNA and subjected to PCR analysis for CD3 epsilon, Pre an d IL control. B) Flow cytometric analysis of surface expression of CD8, CD4, CD3, Pre p re Molt3, SupT1 and Jurkat cell lines.

PAGE 100

100 Figure 4 2 Response to IL 7 and anti CD3 stimulation in l enti virus modified T ALL cell lines. A) Flow cytometric analysis of IL infected or infected with lentivirus consisting of IL hi Molt3). B) STAT5 activation in response to IL 7 in Molt3 and IL hi Molt3. C) CD25 and CD69 in Molt3, IL hi Molt3 and Jurkat after overnight incubation with anti CD3/CD28 beads. D) Intracellular free c alcium measurement in i ndo1AM loaded Molt3, IL hi Molt3 and Jurkat in response to anti CD3 (clone Hit3a) and i onomycin.

PAGE 101

101 Figure 4 3 SupT1 does not respond t o anti CD3 or IL 7 stimulation. A) Flow cytometric analysis of STAT5 activation in response to IL 7 in SupT1 and IL hi Molt3. B) CD25 and CD69 in SupT1 and IL overnight incubation with anti CD3/CD28 beads. C ) Intracellular free c alcium measurement in i ndo1AM loaded SupT1 and IL hi Molt3 in response to anti CD3 (clone Hit3a) and i onomycin.

PAGE 102

102 Figure 4 4 IL 7 enhances anti CD3 induced pre TCR signal ing as assessed by CD25 expression A) Flow cytometric analysis of CD25 and CD69 in IL hi Molt3 after overnight incubatio n in the indicated conditions. B) Statistical analysis using Wilcoxon matched pairs signed rank test, n=10 C) Intracellular free c alcium measurement in Indo1AM loaded IL hi Molt3 in res ponse to anti CD3 (clone Hit3a) and or IL 7, using i onomycin as control. D) Area under curve was quantified by using Flowjo software and data w ere analyzed using G raph Pad Prism 5, n=6.

PAGE 103

103 Figure 4 5 P re TCR signals via ERK1/2 and AKT pathway A) Flo w cytometric analysis of CD25 and CD69 in IL hi Molt3 after overnight incubation in the indicated conditions. (B) % CD25 in non treated and inhibitor treated anti CD3 stimulated minus non stimulated control, data represents at least three independent experiments.

PAGE 104

104 Figure 4 6 Kinetics of STA T 5, AKT and Erk1/2 activation in IL hi Molt3 IL hi Molt3 were stimulated using 100 ng /mL IL 7 or anti CD3/CD28 beads where indicated for 5, 15, 30 and 60 minutes. Cells were fixed, permeabilized, stained with antibodies against activated STAT 5, Akt, and Erk1 /2 and subjected to flow cytometric analysis. Non stimulated stained cells were used as control.

PAGE 105

105 Figure 4 7 IL 7 activates STAT5, Akt and Erk1/2 A) IL hi Molt3 were left unstimuated or stimulated using 100 ng /mL IL 7 and/or anti CD3/CD 28 beads for 15 minutes and analyzed for STAT 5 activation. B) Akt activation. C) Erk1/ 2 activation. Mean fluorescence intensity for STAT5 and Akt and percentage for Erk1/2 from 10 experiment s are reported. Data was analyzed using Wilcoxon matched pairs sig ned rank test, n=10. D) Erk1/2 activation in response to indicated treatments was verified using western blot.

PAGE 106

106 Figure 4 8 IL 7 hinge mApple fusion protein A) Schematic of the IL 7 mApple fusion protein with a helix turn helix hinge t o allow for receptor function. B) Immunofluorescence image of HeLa cells and Molt3 cells expressing IL 7 hinge mApple (red) fusion construct stained with DAPI (blue) C) STAT 5 activation in response to IL 7 in Molt3 infected with lentivirus containing IL 7 hinge mApple.

PAGE 107

107 Figure 4 9 Dynamics of IL interaction A) Confocal images of Molt3 and Jurkat infected with lenti viru s containing IL hinge mApple and eGFP B ) Time lapse images of Molt3 cells expressing IL 7 hinge eGFP fusion proteins.

PAGE 108

108 Figure 4 10 IL is dispensable for pre TCR signaling. A) SupT 1 and Molt3 were infected with l entivi rus containing IL 7 s iRNA and puromycin resistance gene The cells were subjected to puromycin selection for three days and evaluated by PI staining. B) cDNA was prepared from 1 g RNA harvested from indicated cells and subjected to SYBR Green Real Time PCR. C) Surface and i ntracellular IL 7 f low cytometric D) Non infected and s iRNA treated cells were simulated overnight using anti CD3/CD28 beads, and surface staining fo r CD25 and CD69 was performed. E) CD25 m ean fluorescence i ntensity after overnight stimulation by anti CD3/CD28 beads, n=6

PAGE 109

109 CHAPTER 5 CONCLUSIONS Findings and Future D irections The importance of the thymus in immune function was discovered 50 years ago by J Miller ( 2 236 ) Following the discovery of the thymus, intensive investigations have been made to decipher its complexities and thymocyte development HPCs that seed the thymu s were defined by the presence of a surface marker CD34. It is now known that CD34 + HPCs can be found in fetal liver, fetal thymus, bone marrow and cord blood. However, i t was not known if these HPCs w ould have similar T cell development potential. There h ave been reported differences in lymphopoiesis of murine fet us versus adult ( 130 ) yet comparable studies for human T cell development were lacking. Unlike FTOC, t he OP9 in vitro culture sy stem has great potential for immunotherapeutic applications and use in clinical settings; hence we compared T cell development of each CD34 + HPC source using the OP9 culture system. We concluded that out of the four CD34 + HPCs, CB HPCs showed the highest pro liferation, followed by comparable proliferation of BM, FT and FL during the DN to DP transition phase. The FT HPCs required approximately one week BM HPCs took approximately 4 6 weeks and both FL and CB HPCs took approximately 2 3 weeks to reach the DP stage. Nevertheless, all of the T cells developed in vitro were stalled at the double positive or immature single positive stage with the exception for CB HPCs from which some CD3 + + T cells were generated Thus, we have presented for the first time a paralleled overview of T cell development of four different sources of HPCs in OP9 in vitro culture system and demonstrated diverse T cell development potentials of pre and post natal and adult human BM HPCs (Chapter 2)

PAGE 110

110 From adoptive immunotherapy standpoint, FT and FL are not ideal sources of HPCs due to ethical issues. On the other hand CB is easily available and has shown superior proliferation and T cell development potenti al but still, will face the problem of immune rejection caused by allograft transplant and HLA disparity ( 237 ) An ideal candidate for adoptive immunotherapy will be T cells derived from patient s own BM that are HLA matched and available for autologous transplant. However, our data and others showed that the current in vitro T cell development was hampered by low proliferation, delayed kinetics to reach DP stage and low percentage of DP cells. In our quest to better understand T cell development of BM HPCs as it occurs in vitro we first wanted to overcome the limit ed proliferation potential of BM HPCs In this study, we report that a modified OP9 DL1 cell line (LmDL1 FL7) ectopically expressing IL 7 and Fms like tyrosine kinase 3 ligand ( Flt3L ) supported an enhanced early adult human BM HPC derived T cell precursor expansion. Continued co culture of BM HPCs on LmDL1 FL7 did not result in efficient DN to DP transition. Hence, we further investigated the role of IL 7 and pre TCR signaling during T cell development in vitro as IL 7 inhibit s and pre TCR signaling promot e s DN to DP transition ( 56 160 161 164 ) We first evaluated the effect of depriving T cell precursors of IL 7 at various time points during the development of T cells. IL 7 removal promoted a slight increase of DP population with no increased expression of TCR As pre TCR signaling rescues DN c ells from programmed cell death induces allelic exclusion at locus and initiate s TCR rearrangement we mimicked pre TCR signaling by anti CD3 stimulation ( 56 ) Interestingly IL 7 deprived T cell precursors differentiated into CD3 + + DP cells upon anti CD3 stimulation and further matured into functional CD4 T cells, albeit they

PAGE 111

111 displayed a skewed TCR V repertoire Thus, we conclud e that concomitant deprivation of IL 7 and increased pre TCR signaling is required for in vitro dif ferentiation and maturation of adult human T cells from BM HPCs (Chapter 3) Pre TCR signaling precedes expression and IL 7 has been reported to inhibit pre TCR signaling ( 56 160 161 164 ) If this was true, we should have observed an increase in upon IL 7 withdraw al but our data showed enhanced expression of CD4 co receptor but not Additionally, our results demonstrated that the presence of IL 7 did not inhibit TREC formation a direct measure of pre TCR signaling. Thus, our data pointed to the need for a re evaluation of the previous theory of IL 7 inhibiting pre TCR signaling This theory was based on the observation that DP T cells were reduced in the presence of IL 7. Thus, d irect evaluation of the effect of IL 7 on human pre TCR signa ling will help clarify the role of IL 7 in pre TCR signaling H ence we evaluated the T ALL cell line Molt3 as a model system to study pre TCR signaling. As the native Molt3 cells lack IL 7R w e overexpressed IL the evaluated the effect of IL 7 on pre TCR signaling. IL 7 enhanced pre TCR activation as shown by the expression of CD25 activation marker in response to anti CD3 stimulation. Furthermore, we demonstrated that the a nti CD3 mediated activation of Molt3 was dependent on Akt and Erk1/2 pathways and IL 7 enhanced the activation of both of these pathways. In conclusion o ur study demonstrates a cooperative role of IL 7 in pre TCR signaling during T cell development (Cha pter 4) Future direction includes understanding the dynamics of IL 7R with respect to pre TCR complex on developing T cells To this end, we constructed a chimeric gene encoding IL 7R and monomer a pple fluorescent fusion protein and further

PAGE 112

112 demonstrated its IL 7 signaling functions The IL 7R mApple fusion protein w ould serve as a great tool for future monitoring of IL 7R g the basic biology of the IL 7 receptor It is also necessary to evaluate the effect of IL 7 on T cell development related gene expression using commercially available PCR arra ys. Additionally, we p lan to optimize protocol of HPC gene transfer using both oncoretro and lenti viral vectors, for knock in or knock down genes of interest. Highlights in T cell Development How Far We Have Come? Significant advances have been made in the past decade in understanding of thymic T cell development which are summarized a s follows: Lymphoid Precursors HPCs that give rise to lymphoid precursors were defined by the expr ession of CD34. Earlier studies have shown that human CD34 + CD38 + cells h ave T lineage ca pacity in vitro as assessed by BM engraftment and proliferation kinetics into sub lethally irradiated NOD/SCID mice ( 238 ) However, the latest study defines T cell lineage precursors as CD34 + CD38 / lo CD10 + CD1a CD7 as assessed by T cell potential using the OP9 in vitro culture system ( 239 ) The differences in the model system used and the ir read out to assess T cell potential may account for the discrepancies in the use of CD38 as a marker for T lineage poten tial. The difference in the source of CD34 used also could make a difference in T lineage potential. C onsistent with our finding in chapter 2, a recent study by Jean Plum et al. demonstrated that CB was superior to BM in T lymphoid differentiation in the O P9 in vitro culture system ( 240 ) In conclusion the conventional use of CD34 as a marker for HPCs does not take in to account of the intrinsic differences that exist among CB, FT, FL and BM H PCs Thus, further

PAGE 113

113 consideration and identification of additional markers that could account for such differences is required. Early E vents : selection and DN to DP T ransition TCR selection is defined by pairing of pre T chain with chain, initiat ion of pre TCR signaling, induction of allelic exclusion at locus and initiation of rearrangement at locus In mice selection occurs in absence of co receptors during the DN 3 (CD44 CD25 + ) stage to the DN 4 (CD44 CD25 ) transition ( 51 ) However, selection is still controversial in human s due to contradictory reports of selection related events in the CD34 + CD1a + stage and in the CD4 ISP stage ( 52 241 ) Perhaps the simultaneous evaluation of pre TCR complex proteins, activation of pre TCR signaling pathways, and TCR rearrangement status will help pinpoint the selection stag e in human T cell development. The p re TCR is thought to have different capabilities compare d to the TCR and the TCR, due to its unique structure ( 197 ) However, pre T / mice do not lack DP cells and only show a reduction in DP cells ( 174 ) Interestingly pre T / and common cytokine receptor c / double knockout mice show a profound block in DP transition ( 56 60 ) The p re TCR and initiate signal transduction as both p re TCR and TCR complex is associated with the same Mouse pre TCR signaling has recently been studied, however studies on human pre TCR signaling are still lacking. It is important to identify the key differences in human and mouse pre TCR complex es ( 55 62 242 ) The first difference is in the cytoplasmic domain; the human cytoplasmic domain is much longer than that of mice and possesses intracellular retention signals ( 55 63 ) Thus mouse pre TCR complex is readily expressed on the surface, and yet human pre TCR complex is barely detectable.

PAGE 114

114 A n a dditional difference exists in the abi lity of pairing of pre pre trongly as a result, differential activation of the downstream pathways in mice versus humans may be observed. ( 209 ) The p re T / mice showed only a partial block in DN to DP transition, however, both CD3 / and CD3 / knockout mice showed a complete block in DN to DP transition ( 243 ) Additionally, signaling via pre TCR is thou ght to be a requirement for initiation of rearrangement however positive cells are present in pre mice ( 244 ) T ogether the above observations demand a careful reevaluation of the unique function of pre T in T cell development. Positive and Negative selection Thymocytes with rearranged are rescued f rom cell death by a low affinity interaction of the heterodimer with self peptide MHC complexe s that are expressed on thymic epithelial cells (positive selection) ( 6 ) Thymocytes with high affinity receptors for self peptide MHC expressed on thymic DCs undergo cell death (negative selection) ( 81 ) After going through positive and negative selection the CD3 + / CD4 + CD8 + DP cells differentiate to CD8 SP or CD4 SP. The positive selection stage has been defined by up regulation of CD69, CD27, and down regulation of CD1a and Rag1 ( 79 245 246 ) Positive selection is affected in MHC class I or class II knockout mice, resulting in a markedly decreased number of mature CD8 and CD4 cells respectively. In patients with MHC class II deficiency, the development of CD4 T cells is affected, but to a lesser ext ent than in mice, and the TCR V and V usage is diverse ( 247 ) Thus, the development of CD4 T cells in humans might be less stringently dependent on positive selection than in mice.

PAGE 115

115 Ligation of the TCR complex to the peptide MHC complex results in recruitment and activation of the immediate downstream kinase ZAP70 which binds to the phosphorylated ITAMS on CD3 and initiates the TCR signaling cascade ( 57 80 ) Interestingly, ZAP70 / deficient mice lack both CD4 and CD8 T cells whereas ZAP70 deficient patients lack CD8 T cells only ( 248 ) It is possible that ZAP70 deficiency is compensated by high expression of S yk in humans which is only expressed at low level s in mice ( 248 249 ) Thus additional studies need to be done to clarify the role of ZAP70 in positive selec tion in human T cell development. CD4 versus CD8 Lineage C ommitment cell development, cells diverge into CD4 + and CD8 + T cell lineage E stabl ishing the underlying mechanism for commitment to CD4 v ersu s CD8 lineage has remained a focus of inten se study. Initially two models have been proposed : instructive and stochastic ( 250 ) In 1991 Robey et al proposed the i nstructive model, in which qualitatively distinct signals are initiated upon TCR engagement by MHC class I or class II liga tions and th eir qual itative differences in signaling drive CD4 or CD8 lineage commitment ( 251 ) Two years later the stochastic model was proposed which highlights that the synthesis of the inappropriate co receptor CD4 or CD8 was randomly terminated ( 250 ) The stochastic model was based on C D4 transgenic m ouse studies, as the transgene was expressed through out the development, the data was not compelling and the model fell out of favor. The instructive model proposed that the CD4 and CD8 co receptors are essential for lineage commitment. This was supported by the study showing forced expression of CD4 on DN thymocytes can mediate development to the DP stage in RAG deficient mice ( 252 ) However, later studies using CD4 deficient mice showed that the co receptor was not essential for lineage commitment ( 253 254 )

PAGE 116

116 Thus, the instructive model also fell apart as the co receptor requirement was a central premise of this model. However, the a bove data tend to support that lineage commitment might be determined by relative TCR signal strength. Signal strength model proposed stronger or weaker TCR signals would lead to the CD4 or CD8 lineage commitment, respectively ( 255 ) This model is suppor ted by the fact that Lck a kinase required for T cell activation, has higher affinity for CD4 than CD8 ( 233 256 ) C onsistent with the above model, a study has shown that when the cytoplasmic domain of the CD8 co receptor was replace d by the cytoplasmic domain of CD4 resulted in to CD4 lineage T cells ( 257 ) Further s tudies have illustrated that reducing Lck activity by using an inducible system le a d s to CD8 commitment, and increasing Lck activity led to CD4 lineage commitment ( 175 ) However, how these quantita tive differences are translated downstream o f Lck and ZAP70 remains undefined. Ablation of S OCS 1, a negative regulator of cytokine signaling favor s commitment to CD8 lineage, suggesting a regulatory role of cytokine signaling in CD8 commitment ( 258 259 ) Another model of lineage commitment is kinetic signaling model T his model came forward as a resul t of a surprising discovery of the C D4 + CD8 lo subset that was followed by CD4 + CD8 + DP and was a precursor to CD8 or CD4 T cells ( 260 ) This model proposes that selective down modulation of CD8 at the CD4 + CD 8 lo stage specifically impairs TCR signaling in class I but not in class II restricted cells and that interruption or persistence of TCR signaling promotes CD8 and CD4 commitment, respectively Thus, this model introduced duration as a factor determining lineage commitment It is difficult to reconcile that instructive or kinetic signaling models act in a mutually

PAGE 117

117 exclusive fashion t o instruct lineage choice. Hence, the current theory favors that the two models can complement each other in directing CD4 versus CD8 lineage choice. Recently, a dvances have been made in identifying downstream transcr iption factors that play a key role in lineage commitment, namely ThPOK, Runx, Gata3 and Tox ( 261 ) However, the upstream pathway that controls the expression of these factors remains to be identified. Thus our current understanding of CD4 or CD8 lineage commitment is still incomplete. Advanc es i n T cell Development Culture System More recently the u se of three dimensional matrices to mimic the thymic microenvironment for T cell development has been demonstrated. Generation of mature T cells from human BM HPCs using a t antalum coated carbon ba sed cell foam matrix ha s been reported ( 262 ) Another study demonstrates T cell development in a cell foam matrix coated by human skin cells mainly keratinocytes and fibroblasts ( 263 ) However c ontaminating T cells from the skin used for coating the cell foam matrix poses an issue As HLA required for positive selection is mainly expressed by thymic epithelial cells, recently a human thymic epithelial cell line was evaluated for its ability to support DP to SP maturation of T cell in vitro ( 264 ) CB CD34 + CD38 CD45RA + HPCs were co cul tured in presence of Flt3L and IL 7 with immortalized human thymic epithelial cells expressing mouse D elta like 1 T cell d ifferentiation to CD3 lo DP stage but not to TCR + CD4 or CD8 SP w as observed. Th e above study suggest s that HLA expression by thymic epithelial cells is not sufficient to support late T cell development events and functional T cell maturation. However, f unctional maturation to CD4 and CD8 T cells from human CD34 + HPCs of post natal thymic origin was recently reported in the OP9 DL1 c ell line expressing HLA A1, HLA A2 and 2 microglobulin ( 265 ) This could

PAGE 118

118 be a r esult of the source of CD34 + HPCs used in the study. This study utilized CD34 + HPCs from post natal thymus a s it is known that CD34 is also expressed on T lineage committed progenitors in the thymus, this could facilitate the T cell development in the OP9 c o culture. Additionally, CD4ISP has been reported to have rearranged TCR this may contribute to attaining functional maturation of these cells in the OP9 culture system as the early T cell development events could have already taken place. IL 7/IL 7R in T cell D evelopment IL 7 is an important survival and proliferation factor during early stages of T cell development ( 90 91 162 266 ) IL during the stages where selection takes place, it is expressed up to the DN3 stage, is shut down DN3 onwards and is re expressed after positive selection ( 87 97 ) On the other hand in humans IL 3 low and DPCD3 hi stages and this results in loss of STAT5 activation ( 98 ) Why such dynamic regulation of IL 7 signaling is required during T cell development is p uzzling. A n egative roles of IL 7 has been reported as the expression of IL 7 under the control of a Lck promoter at low levels enhances but at high levels blocked DN to DP transition ( 163 ) Additionally IL 7R signals impair differentiation of CD8 ISP to DP cells in ZAP70 / and IL ( 164 ) and IL 7R s ignals inhibit the expression of HMG domain transcription factors TCF 1, LEF 1 and ROR DN to DP transition ( 164 ) In addition, IL 7 suppres ses anti CD3 antibody induced differentiation to DP stage in FTOC of Rag1 deficient mice ( 161 ) These studies led to the conclusion that IL 7 inhibits pre TCR si gnaling and /or the factors required for DN to DP transition, thus signals must be down regulated at DN3 stage. The results present ed

PAGE 119

119 in chapter 4 rule out the possibility of IL 7 being inhibitory in pre TCR signaling, at least in human system. Even though evaluation of the direct role of IL 7 in mouse pre TCR signaling remains to be done similar results can be expected Interestingly, the phenotype of the IL 7 / and c / mouse is different from IL 7R / mouse ( 203 ) In IL 7 / mice the cell number of thymocytes is reduced, however the ratio of DN to DP to SP remains the same. In c / cells are reduced, the most severe phenotype is displayed by IL / mice as they completely lack T and B cells. The patients with mutation in IL domain, show complete absence of T cells but have B cells. Taken together it appears that IL mediated Jak STAT signaling pathway activation. Lck is a kinase normally associated with CD4 and CD8 T cell co receptors, and is al so found to be bound to IL and is constitutively activated ( 90 ) It would be intere sting to see the effect of mutation in Lck binding domain of IL development. Knockout/Transgenic Mice Compared to Patients with Mutations Although the mouse model s have provided useful insights in T cell development, key differences from humans Additionally, phenotypes from gene deletions and mutations in T cell and IL 7 cytokine signaling components differ between mice and humans and are discussed as follows: IL 7 IL 7 knockout mice show a 20 fold reduction in thymic cellularity, with normal percentage of DP T cells and normal ratio of CD4 to CD8 perce ntage ( 183 ) Analysis of B c ells, NK cells, and T cell s revealed normal NK cells and lack of B cells and T

PAGE 120

120 cells in these mice ( 88 ) The p atients with a null m utation in IL 7 show a block T and NK cell dev elopment but B cell numbers are normal ( 267 ) The c knockout mice shows severe reduction in the thymus size due to reduced survival, however the T cell development is not affected in these mice ( 268 ) Interestingly the NK cells and the cells are absent in these mice c, mature T cells and NK cells are absent ( 269 ) IL 7R knockout mice show normal T cell development a nd normal ratio of CD4 to CD8 T cells. The overall T cell and B cell number s are reduced, NK cells are not affected and cells are absent ( 95 ) In terestingly, in cont rast to the phenotype found in mice, a mutation in the IL (P132S) in severe combined immuno deficiency patients reveal normal mRNA and protein expression but a compromi sed affinity to IL 7 ( 199 ) These patients showed marked reduction in T and B cells, and NK cells were not affected. Thus patients with deficiency in IL 7R show a more severe phenotype than the one observed in IL 7R / mice. ZAP70 ZAP70 is a kinase that binds to the phosphorylated CD3 d initiates downstream signal cascade. A missense mutation that affects the catalytic domain, and hence impairs function of ZAP70 results in a distinct phenotype in mice and humans ( 270 ) Mice with a mutation in the catalytic domain of ZAP70 lack both CD8 and CD4 T cells. In contrast, patient s with similar mutation s show abundant nonf unctional CD4 + T cells but lack CD8 + T cells. MHC In MHC class I or class II knockout mice the number of mature CD8 and CD4 is markedly reduced. In patients with MHC class II deficiency, the development of CD4 T

PAGE 121

121 cells is affected, but to a lesser extent t han in mice, and the TCR V and V usage is diverse ( 247 ) Thus, the development of CD4 T cells in humans might be less stringently dependent on positive selection than in mice. C linical I mplications In v itro T c ell D evelopment Thymic ou tput is highest during fetal and prenatal development but then declines with age ( 68 ) In mice an aged thymus shows a collapsed thymic epithelium and loss of distinct cortico medullary junction. Only about 5% of the original thymus size is observed in adult mice. Howe ver the ratio of total epithelial cells to thymocytes is not affected, suggesting that both co mponents are equally affected ( 271 ) Similar to mice, t hymic involution is also observed in humans as assessed by TREC analysis ( 68 ) Decrease in TREC levels has been associated with increase in age. The abnorm alities in thymic microenvironment can disrupt T cell selection events, permitting autoreactive thymocytes to escape. For example, NOD mice develop spontaneous diabetes; in these mice the development of severe abnormalities in thymic architecture precedes spontaneous autoimmunity. On the other hand chronic thymic involution does not normally cause disease in adult human s. However, in cases of chemotherapy or radiotherapy, adults have limited capacity for restoring immune competence ( 272 ) Hence, therapies that can rejuvenate thymic function would allow increased dosage levels and wider patient selection for treatments. A fe w strategies have demonstrated significant promise for reconstitution or enhancement of the T cell compartment and are discussed as follows. In a mouse model of allogeneic HSC transplant, adoptive transfer of both HSCs and T cell precursors generated from OP9 DL1 co culture was able to speed up and enhance T

PAGE 122

122 cell recovery ( 273 ) Another application of progenitor T cell t herapy is for treatment of HIV. T cell precursors can be genetically modified such that CD4 + T cells derived from these cells become resistant to HIV infection. Genetic modification of T cell precursors by using RNAi, ribozyme and TAR decoys, if successful can significantly advance HIV therapy ( 274 ) An a lte rnative approach that utilized retroviral transduction of CD8 T cells with genes in specific to HIV 1 p ol protein also showed promising results ( 275 ) The latter demonstrated that retroviral engineered CD8 T cells were able to maintain cytotoxic activity against HIV infected cells in the absence of CD4 T cells, thus this study represents another potenti al precursor T cell therapeutic modality. For application in cancer immunotherapy, one can envision the generation of tumor reactive T cells in vitro that can be adoptively transferred back into a patient. Recently, Zhao et al. demonstrated that tumor spe cific T cells derived from CB HSCs when transduced with a p53 ( tumor antigen ) specific TCR were able to kill tumor antigen peptide pulsed APCs in vitro ( 276 ) However, validation of this study in vivo has not been performed. Even though the above approach seems promising, caution must be taken as most tumor antigens are non mutated self antigen s I nterleukin 7 IL 7 has been demonstrated to inc rease T cell numbers, enhance proliferation and to maintain homeostasis of mature T cells ( 277 ) We have demonstrated that IL 7 activates pathways such as Erk1/2, AKT, and JAK STAT (Chapter 4) that promote proliferation and survival of T ALL ( 278 ) Thus IL 7 could potentially mediate therapeutic benefits in clinical settings. Indeed, IL 7 has been utilized in recent clini cal trials to improve out comes in patients receiving chemotherapy, HIV patients and bone marrow tran splant patients ( 185 277 )

PAGE 123

123 APPENDIX A ANALYSIS OF T CELL D EVELOPMENT OF HPC EX PANDED BY CULTURING ON OP9KFT63KF Our lab previously established the OP9KFT63KF cell line for HPC expansion ( 159 ) CD34+HPCs can be expanded on this cell line for 10 days, followed by co culture on OP9GM15 cell line to generate dendritic cells. We further asked if BM CD34+HPCs after expansion on OP9KFT63KF can differentiate to T cell precursors upon subsequent co culture on LmDL1 FL7 cell line as described in Ch apter 3 (previous conditi on is illustrated in Figure A 1 A). As such, we cultured BMCD34 + HPCs on OP9KFT63KF for 10 days and transferred the expanded cells to LmDL1 FL7 (Figure A 1, B). As Delta like 1 and IL 7 play a major role in T cell lineage commitment, we included a third condition in which OP9KFT63KF and LmDL1 FL7 were mixed at a 1:1 ratio and plated for co cult ure (Figure A 1 C). The results showed that both conditions greatly enhanced precursor expansion but the cells mainly remained CD8 CD4 DN. Furt her analysis revealed that these cells were highly diverted to NK cell lineage as majority of the cells expressed NK cell marker CD56 (Figure A 1 B & 1 C). Thus, we conclude that BM CD34 + HPCs when exposed to OP9KFT63KF lost their T lineage potential, expande d rapidly and differentiated toward NK cell lineage. A cell line expressing Kit ligand in conjunction with IL 7 and Flt3L may be used in future, as Kit ligand was recently demonstrated to increase HPC expansion.

PAGE 124

124 Figure A 1 Evaluation of T cell develo pment of BM CD34 + HPCs expanded on OP9KFT63KF (A, B, C) by f low cytometric analysis for the indicated surface markers (D) Growth curve for the three culture conditions.

PAGE 125

125 APPENDIX B GENERATION OF DC PRECURSOR/ LMDL 1 FL7 FUSION CELL LINE Additional attempt to induce CD8 lineage included introduction to the coculture system HLA class I and HLA class II present on DCs. Our lab previously established OP9KFT63KF cell line and OP9GM15 for HPC expansion and DC precursor generation ( 159 ) Here we attempted to fuse adherent LmDL1 FL7 stromal cell line and suspension primary DC precursor (DCp) cells to generate a fusion cell line, which would display bo th human MHC class I and II molecules. We first labeled LmDLFL7 cell line with a green dye (PKH67, Sigma), and in vitro derived DCp with a red dye (PKH26GL) and performed cell cell fusion using PEG 8000. Initially we found about 25% cells were double posit ive for both green and red dye indicat ive of fused cells (Figure B 1 A). However, after one round of passage, the flu orescence was lost (Figure B 1 B). Hence we analyzed the expression of DCp markers on the attached stromal cells to see if any of the cells w ere successfully fused. We did not detect any DCp markers on the adherent cells (Figure B 1 C). Thus, we conclude that PEG fusion was not an effective method to generate stable fusion cell line and that alternative approaches will be needed in the future to create hybrid cells.

PAGE 126

126 Figure B 1 Generation of in vitro derived DC precursor and LmDL1 FL7 fusion cell line. (A) Flow cytometric analysis for membrane labeled LmDL1 FL7 and DCp, before and after fusion. (B) Fluorescence microscopic image of the fused cells before passage (left panel) and after passage (right panel) in both green and red channels. (C) Flow cytometric analysis of DCp markers on fusion cells after passage.

PAGE 127

127 APPENDIX C LENTIVIRAL INFECTION OF DIFFERENTIATING T CELL PRECURSORS We infected differentiating T cells with lentivirus containing fluorescent protein, to establish a protocol for future marking of the T cells or to over express or knock down specific target proteins. As indicated in Table C 1 we used various amounts of concentrated v irus and performed infections at various time points during T cell development The infection condition included, culturing cells in a 96 well flat bottom plate in presence of condition media and 5 g /mL polybrene the 96 well plates was spinoculated at 1000RCF for 90 min utes at room temperature. In conclusion only high concentration of virus resulted into infection; however the infection efficiency was very poor. In future, other retro viruses may b e used to evaluate infection potential. Table C 1 Lentiv ector i nfection of d ifferentiating T cell p recursors Time point of infection Cell number Infection condition (>10 8 infectious units/ mL ) Lentivector reporter Result: as assessed by flow cytometry Day 2 on LmDL1 FL7 5X10 4 Exp Volume ( L) #1 1.6 1.6 #2 1.6 TYF eGFP No green cells Day 3 on LmDL1 FL7 5X10 4 Exp Volume ( L) #1 12 12 #2 12 TYF Wlox DS red express 2 No red cells Day 6 on LmDL1 FL7 5X10 4 Exp Volume ( L) #1 15 15 15 #2 10 20 #3 30 TYF Rh GFP Few faint green af ter one week followed by cell death Day 20 on LmDL1 FL7 5X10 4 Exp Volume ( L) #1 50 TYF e GFP 1.5% Green cells Day 20 on LmDL1 FL7 5X10 4 Exp Volume ( L) #1 25 25 TYF mApple 3.3% Red cells

PAGE 128

128 A PPENDIX D INTRINSIC DIFFERENCE S IN CD34 + HPCS FROM DIFFERENT DONORS We have noticed that HPCs of certain donors did not differentiate to CD7 + CD1a + T precursor cells and further maturation to CD4 single positive T cells was not observed. This is more likely due to intrinsic differences in the CD34HPCs rather than variations in culture condition or experimental handling. We initiated T cell development cultures as described in chapter 3, using CD34 + HPCs obtained from two commercial sources, AllCells and ReachBio. Surface marker analysis a ssessed by flow cytometry showed similar expression profile of the two sources of HPCs (Figure D 1). However, the cells from AllCells but not from ReachBio were able to differentiate to CD7 + CD1a + (Figure D 2A & 2 B). T cell precursors from day 28 from IL 7 deprived condition, upon anti CD3/CD28 stimulation differentiated to CD3 + CD4 + + However, a small percentage of CD3 + CD4 + + cells were observed in IL 7 present condition. Notably, the cells from ReachBio did not appear healthy post stimulation and underwent cell death. Thus, we conclude that CD34 + HPCs may vary from donor t o donor or from vendor to ven dor, and caution must be taken while interpreting the results.

PAGE 129

129 Figure D 1 CD34 + HPCs obtained from AllCells and ReachBio

PAGE 130

130 Figure D 2 T cell development of CD34 + HPCs obtained from AllCells and ReachBio. CD34 + HPCs fr om (A)AllCells (B) ReachBio, were cultured on LmDL1 FL7 up to day 21 and then on day 28 either left on LmDL1 FL7 or transferred to LmDL1+Flt3L. (C) Day 28 cells from AllCells were stimulated using anti CD3/CD28 beads for two weeks and surface markers were analyzed by flow cytometry.

PAGE 131

131 LIST OF REFERENCES 1. Hayday, A. C. 2009. T Cells and the Lymphoid Stress Surveillance Response. Immunity 31:184 196. 2. Miller, J. F. A. P. 2002. The discovery of thymus function and of thymus derived l ymphocytes. Immunol. Rev. 185:7 14. 3. Petrie, H. T. 2002. Role of thymic organ structure and stromal composition in steady state postnatal T cell production. Immunol. Rev. 189:8 20. 4. Anderson, G., N. C. Moore, J. J. T. Owen, and E. J. Jenkinson. 1996. C ellular Interactions in Thymocyte Development. Annu. Rev. Immunol. 14:73 99. 5. Zuniga Pflucker, J. C. 2004. T cell development made simple. Nat. Rev. Immunol. 4:67 72. 6. Takahama, Y. 2006. Journey through the thymus: stromal guides for T cell development and selection. Nat. Rev. Immunol. 6:127 135. 7. Lind, E. F., S. E. Prockop, H. E. Porritt, and H. T. Petrie. 2001. Mapping Precursor Movement through the Postnatal Thymus Reveals Specific Microenvironments Supporting Defined Stages of Early Lymphoid Devel opment. J. Exp. Med. 194:127 134. 8. Prockop, S. E., S. Palencia, C. M. Ryan, K. Gordon, D. Gray, and H. T. Petrie. 2002. Stromal Cells Provide the Matrix for Migration of Early Lymphoid Progenitors Through the Thymic Cortex. J. Immunol. 169:4354 4361. 9. Spits, H. 2002. Development of alphabeta T cells in the human thymus. Nat. Rev. Immunol. 2:760 772. 10. Norment, A. M., and M. J. Bevan. 2000. Role of chemokines in thymocyte development. Semin. Immunol. 12:445 455. 11. Baum, C. M., I. L. Weissman, A. S. Tsukamoto, A. M. Buckle, and B. Peault. 1992. Isolation of a candidate human hematopoietic stem cell population. Proc. Natl. Acad. Sci. U. S. A. 89:2804 2808. 12. DiGiusto, D., S. Chen, J. Combs, S. Webb, R. Namikawa, A. Tsukamoto, B. Chen, and A. Galy. 1 994. Human fetal bone marrow early progenitors for T, B, and myeloid cells are found exclusively in the population expressing high levels of CD34. Blood 84:421 432. 13. Galy, A., S. Webb, D. Cen, L. Murray, J. Condino, R. Negrin, and B. Chen. 1994. Generat ion of T cells from cytokine mobilized peripheral blood and adult bone marrow CD34+ cells. Blood 84:104 110.

PAGE 132

132 14. Galy, A., D. Cen, M. Travis, S. Chen, and B. Chen. 1995. Delineation of T progenitor cell activity within the CD34+ compartment of adult bone m arrow. Blood 85:2770 2778. 15. Barcena, A., M. Muench, A. Galy, J. Cupp, M. Roncarolo, J. Phillips, and H. Spits. 1993. Phenotypic and functional analysis of T cell precursors in the human fetal liver and thymus: CD7 expression in the early stages of T an d myeloid cell development. Blood 82:3401 3414. 16. Galy, A., S. Verma, A. Brcena, and H. Spits. 1993. Precursors of CD3+CD4+CD8+ cells in the human thymus are defined by expression of CD34. Delineation of early events in human thymic development. J. Exp. Med. 178:391 401. 17. Brcena, A., A. H. Galy, J. Punnonen, M. O. Muench, D. Schols, M. G. Roncarolo, J. E. de Vries, and H. Spits. 1994. Lymphoid and myeloid differentiation of fetal liver CD34+lineage cells in human thymic organ culture. J. Exp. Med. 1 80:123 132. 18. Fisher, A. G. 1990. Human thymocyte development in mouse organ cultures. Int. Immunol. 2:571 578. 19. Merkenschlager, M., and A. Fisher. 1992. Human postnatal thymocytes generate phenotypically immature CD3dim, CD5dim, CD1abright progeny in organ culture. J. Immunol. 148:1012 1015. 20. Yeoman, H., R. E. Gress, C. V. Bare, A. G. Leary, E. A. Boyse, J. Bard, L. D. Shultz, D. T. Harris, and D. DeLuca. 1993. Human bone marrow and umbilical cord blood cells generate CD4+ and CD8+ single positive T cells in murine fetal thymus organ culture. Proc. Natl. Acad. Sci. U. S. A. 90:10778 10782. 21. Plum, J., M. De Smedt, M. P. Defresne, G. Leclercq, and B. Vandekerckhove. 1994. Human CD34+ fetal liver stem cells differentiate to T cells in a mouse thymic microenvironment. Blood 84:1587 1593. 22. Res, P., E. Martinez Caceres, A. Cristina Jaleco, F. Staal, E. Noteboom, K. Weijer, and H. Spits. 1996. CD34+CD38dim cells in the human thymus can differentiate into T, natural killer, and dendritic cells but are distinct from pluripotent stem cells. Blood 87:5196 5206. 23. Hori, T., J. Cupp, N. Wrighton, F. Lee, and H. Spits. 1991. Identification of a novel human thymocyte subset with a phenotype of CD3 CD4+ CD8 alpha + beta 1. Possible progeny of the CD3 CD4 C D8 subset. J. Immunol. 146:4078 4084. 24. Mrquez, C., C. Trigueros, J. M. Franco, A. R. Ramiro, Y. R. Carrasco, M. Lpez Botet, and M. a. L. Toribio. 1998. Identification of a Common Developmental Pathway for Thymic Natural Killer Cells and Dendritic Cel ls. Blood 91:2760 2771.

PAGE 133

133 25. Scollay, R., J. Smith, and V. Stauffer. 1986. Dynamics of Early T Cells: Prothymocyte Migration and Proliferation in the Adult Mouse Thymus. Immunol. Rev. 91:129 158. 26. Donskoy, E., and I. Goldschneider. 1992. Thymocytopoiesis is maintained by blood borne precursors throughout postnatal life. A study in parabiotic mice. J. Immunol. 148:1604 1612. 27. Miller, B. A. 1985. Thy 1 is a differentiation antigen that characterizes immature murine erythroid and myeloid hematopoietic pro genitors. J. Cell. Physiol. 123:25 32. 28. Spangrude, G. J., S. Heimfeld, and I. L. Weissman. 1988. Purification and Characterization of Mouse Hematopoietic Stem Cells. Science 241:58 62. 29. Lkuto, K., D. E. Inglia, J. Friedman, I. L. Weissman, and S. Hei mfeld. 1991. Mouse hematopoietic stem cells and the interaction of c kir receptor and steel factor. Int. J. Cell Cloning 9:451 460. 30. Craig, W., R. Kay, R. L. Cutler, and P. M. Lansdorp. 1993. Expression of Thy 1 on human hematopoietic progenitor cells. J. Exp. Med. 177:1331 1342. 31. Kondo, M., I. L. Weissman, and K. Akashi. 1997. Identification of Clonogenic Common Lymphoid Progenitors in Mouse Bone Marrow. Cell 91:661 672. 32. Akashi, K., T. Reya, D. Dalma Weiszhausz, and I. L. Weissman. 2000. Lymphoid precursors. Curr. Opin. Immunol. 12:144 150. 33. Lu, M., H. Kawamoto, Y. Katsube, T. Ikawa, and Y. Katsura. 2002. The Common Myelolymphoid Progenitor: A Key Intermediate Stage in Hemopoiesis Generating T and B Cells. J. Immunol. 169:3519 3525. 34. Adolfss on, J., R. Mnsson, N. Buza Vidas, A. Hultquist, K. Liuba, C. T. Jensen, D. Bryder, L. Yang, O. J. Borge, L. A. M. Thoren, K. Anderson, E. Sitnicka, Y. Sasaki, M. Sigvardsson, and S. E. W. Jacobsen. 2005. Identification of Flt3+ Lympho Myeloid Stem Cells L acking Erythro Megakaryocytic Potential: A Revised Road Map for Adult Blood Lineage Commitment. Cell 121:295 306. 35. Laiosa, C. V., M. Stadtfeld, H. Xie, L. de Andres Aguayo, and T. Graf. 2006. Reprogramming of Committed T Cell Progenitors to Macrophages and Dendritic Immunity 25:731 744. 36. Gale. 1987. Development of the immune system in human fetal liver. Thymus 10:45 56. 37. Mrquez, C., C. Trigueros, E. Fernndez, and M. L. Toribio. 1995. The development of T and non T cell lineages from CD34+ human thymic precursors can be traced by the differential expression of CD44. J. Exp. Med. 181:475 483.

PAGE 134

134 38. Kurtzberg, J., S. M. Denning, L. M. Nycum, K. H. Singer, and B. F. Haynes. 1989. Immature human thymocytes can be driven to differentiate into nonlymphoid lineages by cytokines from thymic epithelial cells. Proc. Natl. Acad. Sci. U. S. A. 86:7575 7579. 39. Chi, A. W., J. J. Bell, D. A. Zlotoff, and A. Bhandoola. 2009. Untangling the T branch of the hematopoiesi s tree. Curr. Opin. Immunol. 21:121 126. 40. Spits, H., B. Blom, A. C. Jaleco, K. Weijer, M. C. M. Verschuren, J. J. M. van Dongen, M. H. M. Heemskerk, and P. C. M. Res. 1998. Early stages in the development of human T, natural killer and thymic dendritic cells. Immunol. Rev. 165:75 86. 41. Radtke, F., A. Wilson, G. Stark, M. Bauer, J. van Meerwijk, H. R. MacDonald, and M. Aguet. 1999. Deficient T Cell Fate Specification in Mice with an Induced Inactivation of Notch1. Immunity 10:547 558. 42. Pui, J. C., D. Allman, L. Xu, S. DeRocco, F. G. Karnell, S. Bakkour, J. Y. Lee, T. Kadesch, R. R. Hardy, J. C. Aster, and W. S. Pear. 1999. Notch1 expression in early lymphopoiesis influences B versus T lineage determination. Immunity 11:299 308. 43. Maillard, I., T. Fa ng, and W. S. Pear. 2005. Regulation of Lymphoid Development, Differentiation, and Function by the Notch Pathway. Annu. Rev. Immunol. 23:945 974. 44. Reizis, B., and P. Leder. 2002. Direct induction of T lymphocyte specific gene expression by the mammalian Notch signaling pathway. Genes Dev. 16:295 300. 45. Rothenberg, E. V., J. E. Moore, and M. A. Yui. 2008. Launching the T cell lineage developmental programme. Nat. Rev. Immunol. 8:9 21. 46. Fiorini, E., E. Merck, A. Wilson, I. Ferrero, W. Jiang, U. Koch, F. Auderset, E. Laurenti, F. Tacchini Cottier, M. Pierres, F. Radtke, S. A. Luther, and H. R. MacDonald. 2009. Dynamic Regulation of Notch 1 and Notch 2 Surface Expression during T Cell Development and Activation Revealed by Novel Monoclonal Antibodies. J. Immunol. 183:7212 7222. 47. Yashiro Ohtani, Y., Y. He, T. Ohtani, M. E. Jones, O. Shestova, L. Xu, T. C. Fang, M. Y. Chiang, A. M. Intlekofer, S. C. Blacklow, Y. Zhuang, and W. S. Pear. 2009. Pre TCR signaling inactivates Notch1 transcription by antagoniz ing E2A. Genes Dev. 23:1665 1676. 48. Garca Peydr, M., V. G. de Ybenes, and M. L. Toribio. 2006. Notch1 and IL 7 Receptor Interplay Maintains Proliferation of Human Thymic Progenitors while Suppressing Non T Cell Fates. J. Immunol. 177:3711 3720.

PAGE 135

135 49. Ha yday, A. C., D. F. Barber, N. Douglas, and E. S. Hoffman. 1999. Signals involved in gamma/delta T cell versus alpha/beta T cell lineage commitment. Semin. Immunol. 11:239 249. 50. Hayes, S. M., and P. E. Love. 2007. A retrospective on the requirements for cell development. Immunol. Rev. 215:8 14. 51. Dudley, E. C., H. T. Petrie, L. M. Shah, M. J. Owen, and A. C. Hayday. 1994. T development in adult mice. Immunity 1:83 93. 52. Blom, B., M. C. M. Verschuren, M. H. M. Heemskerk, A. Q. Bakker, E. J. van Gastel Mol, I. L. M. Wolvers Tettero, J. J. M. van Dongen, and H. Spits. 1999. TCR Gene Rearrangements and Expression of the Pre T Cell Receptor Complex During Human T Cell Differentiati on. Blood 93:3033 3043. 53. Krangel, M. S. 2009. Mechanics of T cell receptor gene rearrangement. Curr. Opin. Immunol. 21:133 139. 54. Jacobs, H., D. Vandeputte, L. Tolkamp, E. De Vries, J. Borst, and A. Berns. 1994. CD3 components at the surface of pro T cells can mediate pre T cell development in vivo. Eur. J. Immunol. 24:934 939. 55. Del Porto, P., L. Bruno, M. G. Mattei, H. von Boehmer, and C. Saint Ruf. 1995. Cloning and comparative analysis of the human pre T cell receptor alpha chain gene. Proc. Natl Acad. Sci. U. S. A. 92:12105 12109. 56. Fehling, H. J., A. Krotkova, C. Saint Ruf, and H. von Boehmer. 1995. Crucial role of the pre T cell receptor gene in development of but not T cells. Nature 375:795 798. 57. Michie, A. M., and J. C. Ziga P flcker. 2002. Regulation of thymocyte differentiation: pre selection. Semin. Immunol. 14:311 323. 58. Ramiro, A. R., C. Trigueros, C. Mrquez, J. L. San Milln, and M. L. Toribio. 1996. Regulation of pre T cell receptor (pT alpha TCR bet a) gene expression during human thymic development. J. Exp. Med. 184:519 530. 59. Res, P., and H. Spits. 1999. Developmental stages in the human thymus. Semin. Immunol. 11:39 46. 60. Di Santo, J. P., I. Aifantis, E. Rosmaraki, C. Garcia, J. Feinberg, H. J. Fehling, A. Chain and the Pre T Cell Receptor Provide Independent but Critically Overlapping J. Exp. Med. 189:563 574.

PAGE 136

136 61. Aifantis, I., F. Gounari, L. Scorrano, C. Borowski, and H. von Boehmer. 2001. Constitutive pre TCR signaling promotes differentiation through Ca2+ mobilization and activation of NF Nat Immunol 2:403 409. 62. Carrasco, Y. R., M. N. Navarro, V. G. de Ybenes A. R. Ramiro, and M. L. Toribio. 2002. Regulation of surface expression of the human pre T cell receptor complex. Semin. Immunol. 14:325 334. 63. Panigada, M., S. Porcellini, E. Barbier, S. Hoeflinger, P. A. Cazenave, H. Gu, H. Band, H. von Boehmer, and F. Grassi. 2002. Constitutive Endocytosis and Degradation of the Pre T Cell Receptor. J. Exp. Med. 195:1585 1597. 64. Yamasaki, S., E. Ishikawa, M. Sakuma, K. Ogata, K. Sakata Sogawa, M. Hiroshima, D. L. Wiest, M. Tokunaga, and T. Saito. 2006. Mechanistic basis of pre T cell receptor mediated autonomous signaling critical for thymocyte development. Nat Immunol 7:67 75. 65. Navarro, M. N., G. Nusspaumer, P. Fuentes, S. Gonzlez Garca, J. Alcain, and M. L. Toribio. 2007. Identification of CMS as a cytosolic chain involved in pre TCR function. Blood 110:4331 4340. 66. Davis, M. M., and P. J. Bjorkman. 1988. T cell antigen receptor genes and T cell recognition. Nature 334:395 402. 67. Kong, F. k., C. l. H. Chen, and M. D. Cooper. 1998. Thymic Function Can Be Accurately Monitored by the Level of Recent T Cell Emigrants in the Circulation. Immunity 8:97 104. 68. Douek, D. C., R. D. McFarland, P. H. Keiser, E. A. Gage, J. M. Massey, B. F. Haynes, M. A. Polis, A. T. Haase, M. B. Feinberg, J. L. Sullivan, B. D. Jamieson, J. A. Zack, L. J. Picker, and R. A. Koup. 1998. Changes in thymic function with age and during the treatment of HIV infection. Nature 396:690 695. 69. Borgulya, P., H. Kishi, Y. Uematsu, and H. von Boehmer. 1992. Exclusion and Cell 69:529 537. 70. Brndle, D., C. Mller, T. Rlicke, H. Hengartner, and H. Pircher. 1992. Engagement of the T cell receptor during positive selection in the thymus down regulates RAG 1 expression. Proceedi ngs of the National Academy of Sciences 89:9529 9533. 71. Bousso, P., N. R. Bhakta, R. S. Lewis, and E. Robey. 2002. Dynamics of Thymocyte Stromal Cell Interactions Visualized by Two Photon Microscopy. Science 296:1876 1880. 72. Suzuki, G., Y. Nakata, Y. D an, A. Uzawa, K. Nakagawa, T. Saito, K. Mita, and T. Shirasawa. 1998. Loss of SDF 1 receptor expression during positive selection in the thymus. Int. Immunol. 10:1049 1056.

PAGE 137

137 73. Kwan, J., and N. Killeen. 2004. CCR7 Directs the Migration of Thymocytes into t he Thymic Medulla. J. Immunol. 172:3999 4007. 74. Campbell, J. J., J. Pan, and E. C. Butcher. 1999. Cutting Edge: Developmental Switches in Chemokine Responses During T Cell Maturation. J. Immunol. 163:2353 2357. 75. Uehara, S., K. Song, J. M. Farber, and P. E. Love. 2002. Characterization of CCR9 Expression and CCL25/Thymus Expressed Chemokine Responsiveness Thymocytes Preferentially Respond to CCL25. J. Immunol. 168:134 142. 76. Swat, W., M. De ssing, H. V. Boehmer, and P. Kisielow. 1993. CD69 expression during selection and maturation of CD4+8+ thymocytes. Eur. J. Immunol. 23:739 746. 77. Yamashita I, N. T., Tada T, Nakayama T. 1993. CD69 cell surface expression identifies developing thymocytes which audition for T cell antigen receptor mediated positive selection. Int. Immunol. 5:1139 1150. 78. Vanhecke, D., B. Verhasselt, M. De Smedt, G. Leclercq, J. Plum, and B. Vandekerckhove. 1997. Human thymocytes become lineage committed at an early postse lection CD69+ stage, before the onset of functional maturation. J. Immunol. 159:5973 5983. 79. Vanhecke, D., G. Leclercq, J. Plum, and B. Vandekerckhove. 1995. Characterization of distinct stages during the differentiation of human CD69+CD3+ thymocytes and identification of thymic emigrants. J. Immunol. 155:1862 1872. 80. Starr, T. K., S. C. Jameson, and K. A. Hogquist. 2003. Positive and Negative Selection of T cells. Annu. Rev. Immunol. 21:139 176. 81. Surh, C. D., and J. Sprent. 1994. T cell apoptosis de tected in situ during positive and negative selection in the thymus. Nature 372:100 103. 82. Chan, S., M. Correia Neves, A. Dierich, C. Benoist, and D. Mathis. 1998. Visualization of CD4/CD8 T Cell Commitment. J. Exp. Med. 188:2321 2333. 83. Kappes, D. J., X. He, and X. He. 2005. CD4 CD8 lineage commitment: an inside view. Nat Immunol 6:761 766. 84. Wang, L., and R. Bosselut. 2009. CD4 CD8 Lineage Differentiation: Thpok ing into the Nucleus. J. Immunol. 183:2903 2910. 85. He, X., K. Park, and D. J. Kappes. 2010. The Role of ThPOK in Control of CD4/CD8 Lineage Commitment. Annu. Rev. Immunol. 28:295 320.

PAGE 138

138 86. Yarilin, A. A., and I. M. Belyakov. 2004. Cytokines in the Thymus: Production and Biological Effects. Curr. Med. Chem. 11:447 464. 87. Akashi, K., M. Kond o, and I. L. Weissman. 1998. Role of interleukin 7 in T cell development from hematopoietic stem cells. Immunol. Rev. 165:13 28. 88. Moore, T., U. von Freeden Jeffry, R. Murray, and A. Zlotnik. 1996. Inhibition of gamma delta T cell development and early t hymocyte maturation in IL 7 / mice. J. Immunol. 157:2366 2373. 89. Puel, A., S. F. Ziegler, R. H. Buckley, and W. J. Leonard. 1998. Defective IL7R expression in T B+NK + severe combined immunodeficiency. Nat. Genet. 20:394 397. 90. Jiang, Q., W. Q. Li, F B. Aiello, R. Mazzucchelli, B. Asefa, A. R. Khaled, and S. K. Durum. 2005. Cell biology of IL 7, a key lymphotrophin. Cytokine Growth Factor Rev. 16:513 533. 91. Mazzucchelli, R., and S. K. Durum. 2007. Interleukin 7 receptor expression: intelligent desi gn. Nat. Rev. Immunol. 7:144 154. 92. He, R., and R. S. Geha. 2010. Thymic stromal lymphopoietin. Ann. N. Y. Acad. Sci. 1183:13 24. 93. Park, J. H., Q. Yu, B. Erman, J. S. Appelbaum, D. Montoya Durango, H. L. Grimes, and A. Singer. 2004. Suppression of IL7 7 and Other Prosurvival Cytokines: A Novel Mechanism for Maximizing IL 7 Dependent T Cell Survival. Immunity 21:289 302. 94. Peschon, J. J., P. J. Morrissey, K. H. Grabstein, F. J. Ramsdell, E. Maraskovsky, B. C. Gliniak, L. S. Park, S. F. Ziegler, D. E. Williams, C. B. Ware, J. D. Meyer, and B. L. Davison. 1994. Early lymphocyte expansion is severely impaired in interleukin 7 receptor deficient mice. J. Exp. Med. 180:1955 1960. 95. Maki, K., S. Sunaga, Y. Komagata, Y. Kodaira, A. Mab uchi, H. Karasuyama, K. Yokomuro, J. I. Miyazaki, and K. Ikuta. 1996. Interleukin 7 receptor deficient mice lack gammadelta T cells. Proc. Natl. Acad. Sci. U. S. A. 93:7172 7177. 96. Pallard, C., A. P. A. Stegmann, T. van Kleffens, F. Smart, A. Venkitarama n, and H. Spits. 1999. Distinct Roles of the Phosphatidylinositol 3 Kinase and STAT5 Pathways in IL 7 Mediated Development of Human Thymocyte Precursors. Immunity 10:525 535. 97. Munitic, I., J. A. Williams, Y. Yang, B. Dong, P. J. Lucas, N. El Kassar, R. E. Gress, and J. D. Ashwell. 2004. Dynamic regulation of IL 7 receptor expression is required for normal thymopoiesis. Blood 104:4165 4172.

PAGE 139

139 98. Marino, J. H., C. Tan, A. A. Taylor, C. Bentley, C. J. Van De Wiele, R. Ranne, M. Paliotta, T. A. Broughan, and T. K. Teague. 2010. Differential IL 7 responses in developing human thymocytes. Hum. Immunol. 71:329 333. 99. Dick, J. E., T. Lapidot, and F. Pflumio. 1991. Transplantation of Normal and Leukemic Human Bone Marrow into Immune Deficient Mice: Development of Animal Models for Human Hematopoiesis. Immunol. Rev. 124:25 43. 100. Namikawa, R., K. N. Weilbaecher, H. Kaneshima, E. J. Yee, and J. M. McCune. 1990. Long term human hematopoiesis in the SCID hu mouse. J. Exp. Med. 172:1055 1063. 101. Yurasov, S., T. R. Kollmann, A. Kim, C. A. Raker, M. Hachamovitch, F. Wong Staal, and H. Goldstein. 1997. Severe Combined Immunodeficiency Mice Engrafted With Human T Cells, B Cells, and Myeloid Cells After Transplantation With Human Fetal Bone Marrow or Liver Cells and Impl anted With Human Fetal Thymus: A Model for Studying Human Gene Therapy. Blood 89:1800 1810. 102. Shultz, L., P. Schweitzer, S. Christianson, B. Gott, I. Schweitzer, B. Tennent, S. McKenna, L. Mobraaten, T. Rajan, and D. Greiner. 1995. Multiple defects in i nnate and adaptive immunologic function in NOD/LtSz scid mice. J. Immunol. 154:180 191. 103. Traggiai, E., L. Chicha, L. Mazzucchelli, L. Bronz, J. C. Piffaretti, A. Lanzavecchia, and M. G. Manz. 2004. Development of a Human Adaptive Immune System in Cord Blood Cell Transplanted Mice. Science 304:104 107. 104. Ito, M., H. Hiramatsu, K. Kobayashi, K. Suzue, M. Kawahata, K. Hioki, Y. Ueyama, Y. Koyanagi, K. Sugamura, K. Tsuji, T. Heike, and T. Nakahata. 2002. human cells. Blood 100:3175 3 182. 105. Shultz, L. D., B. L. Lyons, L. M. Burzenski, B. Gott, X. Chen, S. Chaleff, M. Kotb, S. D. Gillies, M. King, J. Mangada, D. L. Greiner, and R. Handgretinger. 2005. Human Lymphoid and Myeloid Cell Development in NOD/LtSz Engraft ed with Mobilized Human Hemopoietic Stem Cells. J. Immunol. 174:6477 6489. 106. Macchiarini, F., M. G. Manz, A. K. Palucka, and L. D. Shultz. 2005. Humanized Mice Are We there Yet? J. Exp. Med. 202:1307 1311. 107. Kamarck, M. E., and P. D. Gottlieb. 1977. Expression of thymocyte surface alloantigens in the fetal mouse thymus in vivo and in organ culture. J. Immunol. 119:407 415. 108. DeLuca, D., T. Mandel, G. Luckenbach, and M. Kennedy. 1980. Tolerance induction by fusion of fetal thymus lobes in organ cult ure. J. Immunol. 124:1821 1829.

PAGE 140

140 109. Anderson, G., E. J. Jenkinson, N. C. Moore, and J. J. T. Owen. 1993. MHC class II positive epithelium and mesenchyme cells are both required for T cell development in the thymus. Nature 362:70 73. 110. Jenkinson, E. J., and G. Anderson. 1994. Fetal Thymic Organ Cultures. Curr. Opin. Immunol. 6:293 297. 111. Takahama, Y. 2000. Differentiation of mouse thymocytes in fetal thymus organ culture. Methods Mol. Biol. 134:37 46. 112. Collins, L., and K. Dorshkind. 1987. A stroma l cell line from myeloid long term bone marrow cultures can support myelopoiesis and B lymphopoiesis. J. Immunol. 138:1082 1087. 113. Suzuki J, F. J., Taniquchi S, Sugimoto K, Mori KJ. 1992. Characterization of murine hemopoietic supportive (MS 1 and MS 5) and non supportive (MS K) cell lines. Leukemia 6:452 458. 114. Kodama H, N. M., Niida S, Nishikawa S, Nishikawa S. 1994. Involvement of the c kit receptor in the adhesion of hematopoietic stem cells to stromal cells. Exp. Hematol. 10:979 984. 115. Vodyani k, M. A., J. A. Bork, J. A. Thomson, and I. I. Slukvin. 2005. Human embryonic stem cell derived CD34+ cells: efficient production in the coculture with OP9 stromal cells and analysis of lymphohematopoietic potential. Blood 105:617 626. 116. Sachs, J. L. a. L. 2002. Cytokine control of developmental programs in normal hematopoiesis and leukemia. Oncogene 21:3284 3294. 117. Nakano, T., H. Kodama, and T. Honjo. 1994. Generation of Lymphohematopoietic Cells from Embryonic Stem Cells in Culture. Science 265:1098 1101. 118. Schmitt, T., and J. Zuniga Pflucker. 2002. Induction of T cell development from hematopoietic progenitor cells by delta like 1 in vitro. Immunity 17:749 756. 119. De Smedt, M., I. Hoebeke, and J. Plum. 2004. Human bone marrow CD34+ progenitor cells mature to T cells on OP9 DL1 stromal cell line without thymus microenvironment. Blood Cells. Mol. Dis. 33:227 232. 120. La Motte Mohs, R., E. Herer, and J. Zuniga Pflucker. 2005. Induction of T cell development from human cord blood hematopoietic st em cells by Delta like 1 in vitro. Blood 105:1431 1439. 121. Galic, Z., S. G. Kitchen, A. Kacena, A. Subramanian, B. Burke, R. Cortado, and J. A. Zack. 2006. T lineage differentiation from human embryonic stem cells. Proc. Natl. Acad. Sci. U. S. A. 103:1 1742 11747.

PAGE 141

141 122. McCune JM, R. R., Kaneshima H, Shultz LD, Lieberman M, Weissman IL. 1988. The scid hu mouse: murine model for the analysis of human hematolymphoid differentiation and function. 241:1632 9. Science 241:1632 1639 123. Jenkinson, E. J., L. L. Franchi, R. Kingston, and J. J. Owen. 1982. Effect of deoxyguanosine on lymphopoiesis in the developing thymus rudiment in vitro: application in the production of chimeric thymus rudiments. Eur. J. Immunol. 12:583 587. 124. Poznansky, M. C., R. H. Ev ans, R. B. Foxall, I. T. Olszak, A. H. Piascik, K. E. Hartman, C. Brander, T. H. Meyer, M. J. Pykett, K. T. Chabner, S. A. Kalams, M. Rosenzweig, and D. T. Scadden. 2000. Efficient generation of human T cells from a tissue engineered thymic organoid. Nat. Biotechnol. 18:729 734. 125. Schmitt, T. M., and J. C. Zuniga Pflucker. 2002. Induction of T cell development from hematopoietic progenitor cells by delta like 1 in vitro. Immunity 17:749 756. 126. Pear, W. S., and F. Radtke. 2003. Notch signaling in lymph opoiesis. Semin. Immunol. 15:69 79. 127. JC., Z. P. 2004. T cell development made simple. Nat. Rev. Immunol. 4:67 72. 128. Jaleco, A. C., H. Neves, E. Hooijberg, P. Gameiro, N. Clode, M. Haury, D. Henrique, and L. Parreira. 2001. Differential effects of No tch ligands Delta 1 and Jagged 1 in human lymphoid differentiation. J. Exp. Med. 194:991 991002. 129. La Motte Mohs, R. N., E. Herer, and J. C. Zuniga Pflucker. 2005. Induction of T cell development from human cord blood hematopoietic stem cells by Delta l ike 1 in vitro. Blood 105:1431 1439. 130. Kincade, P. W., J. J. T. Owen, H. Igarashi, T. Kouro, T. Yokota, and M. I. D. Rossi. 2002. Nature or nurture? Steady state lymphocyte formation in adults does not recapitulate ontogeny. Immunol. Rev. 187:116 125. 1 31. Bosselut, R. 2004. CD4/CD8 lineage differentiation in the thymus: from nuclear effectors to membrane signals. Nat. Rev. Immunol 4:529 540. 132. Zaiss, A. K., S. Son, and L. J. Chang. 2002. RNA 3' readthrough of oncoretrovirus and lentivirus: implicatio ns for vector safety and efficacy. J. Virol. 76:7209 7219. 133. Patel, E., B. Wang, L. Lien, Y. Wang, L. J. Yang, J. S. Moreb, and L. J. Chang. 2009. Diverse T cell differentiation potentials of human fetal thymus, fetal liver, cord blood and adult bone ma rrow CD34 cells on lentiviral Delta like 1 modified mouse stromal cells. Immunology 128:e497 e505. 134. Cumano, A., and I. Godin. 2001. Pluripotent hematopoietic stem cell development during embryogenesis. Curr. Opin. Immunol. 13:166 171.

PAGE 142

142 135. Offner, F., T. Kerre, M. De Smedt, and J. Plum. 1999. Bone marrow CD34 cells generate fewer T cells in vitro with increasing age and following chemotherapy. Br. J. Haematol. 104:801 808. 136. C., G. 2006. Thymus and T lymphocyte development: what is new in the 21st ce ntury? Immunol Rev. 209:5 9. 137. Theunissen, K., and C. M. Verfaillie. 2005. A multifactorial analysis of umbilical cord blood, adult bone marrow and mobilized peripheral blood progenitors using the improved ML IC assay. Exp. Hematol. 33:165 172. 138. L ing KW, D. E. 2002. Ontogeny and genetics of the hemato/lymphopoietic system. Curr Opin Immunol. 14:186 191. 139. Morrison, S. J., A. M. Wandycz, K. Akashi, A. Globerson, and I. L. Weissman. 1996. The aging of hematopoietic stem cells. Nat. Med. 2:1011 101 6. 140. Chidgey, A., J. Dudakov, N. Seach, and R. Boyd. 2007. Impact of niche aging on thymic regeneration and immune reconstitution. Semin. Immunol. 19:331 340. 141. Washburn, T., E. Schweighoffer, T. Gridley, D. Chang, B. J. Fowlkes, D. Cado, and E. Robe y. 1997. Notch activity influences the alphabeta versus gammadelta T cell lineage decision. Cell 88:833 843. 142. Jiang, R., Y. Lan, H. D. Chapman, C. Shawber, C. R. Norton, D. V. Serreze, G. Weinmaster, and T. Gridley. 1998. Defects in limb, craniofacial, and thymic development in Jagged2 mutant mice. Genes Dev. 12:1046 1057. 143. De Smedt, M., K. Reynvoet, T. Kerre, T. Taghon, B. Verhasselt, B. Vandekerckhove, G. Leclercq, and J. Plum. 2002. Active form of Notch imposes T cell fate in human progenitor cel ls. J. Immunol. 169:3021 3029. 144. Garcia Peydro, M., V. G. de Yebenes, and M. L. Toribio. 2003. Sustained Notch1 signaling instructs the earliest human intrathymic precursors to adopt a gammadelta T cell fate in fetal thymus organ culture. Blood 102:2444 2451. 145. Schmitt, T. M., R. F. de Pooter, M. A. Gronski, S. K. Cho, P. S. Ohashi, and J. C. Zuniga Pflucker. 2004. Induction of T cell development and establishment of T cell competence from embryonic stem cells differentiated in vitro. Nat. Immunol. 5: 410 417. 146. Karanu, F. N., B. Murdoch, T. Miyabayashi, M. Ohno, M. Koremoto, L. Gallacher, D. Wu, A. Itoh, S. Sakano, and M. Bhatia. 2001. Human homologues of Delta 1 and Delta 4 function as mitogenic regulators of primitive human hematopoietic cells. Bl ood 97:1960 1967.

PAGE 143

143 147. Walker, L., A. Carlson, H. T. Tan Pertel, G. Weinmaster, and J. Gasson. 2001. The notch receptor and its ligands are selectively expressed during hematopoietic development in the mouse. Stem Cells 19:543 552. 148. Takahama, Y. 2006. Journey through the thymus: stromal guides for T cell development and selection. Nat Rev Immunol 6:127 135. 149. Carpenter, A. C., and R. Bosselut. 2010. Decision checkpoints in the thymus. Nat Immunol 11:666 673. 150. Spits, H. 1994. Early stages in human and mouse T cell development. Curr. Opin. Immunol. 6:212 221. 151. Germain, R. N. 2002. T cell development and the CD4 CD8 lineage decision. Nat. rev. Immunol. 2:309 322. 152. Dervovic, D., and J. C. Ziga Pflcker. 2010. Positive selection of T cells, a n in vitro view. Semin. Immunol. 22:276 286. 153. Sioud, M. 2009. Does our Current Understanding of Immune Tolerance, Autoimmunity, and Immunosuppressive Mechanisms Facilitate the Design of Efficient Cancer Vaccines? Scand. J. Immunol. 70:516 525. 154. Hen g, T. S. P., A. P. Chidgey, and R. L. Boyd. 2010. Getting back at nature: understanding thymic development and overcoming its atrophy. Curr. Opin. Pharmacol. 10:425 433. 155. Balciunaite, G., R. Ceredig, H. J. Fehling, J. C. Ziga Pflcker, and A. G. Roli nk. 2005. The role of Notch and IL 7 signaling in early thymocyte proliferation and differentiation. Eur. J. Immunol. 35:1292 1300. 156. Schmitt, T. M., and J. C. Zuniga Pflucker. 2006. T cell development, doing it in a dish. Immunol. Rev. 209:95 102. 157. Radtke, F., N. Fasnacht, and H. R. MacDonald. 2010. Notch Signaling in the Immune System. Immunity 32:14 27. 158. Patel, E., B. Wang, L. Lien, L. J. Yang, J. S. Moreb, and L. J. Chang. 2009. Diverse T cell differentiation potentials of human fetal thymus, fetal liver, cord blood and adult bone marrow CD34 cells on lentiviral Delta like 1 modified mouse stromal cells. Immunology 128:e497 e505. 159. Han, S., Y. Wang, B. Wang, E. Patel, S. Okada, L. J. Yang, J. Moreb, and L. J. Chang. 2010. Ex vivo developmen t, expansion and in vivo analysis of a novel lineage of dendritic cells from hematopoietic stem cells. Journal of Immune Based Therapies and Vaccines 8:8.

PAGE 144

144 160. Plum, J., M. De Smedt, and G. Leclercq. 1993. Exogenous IL 7 promotes the growth of CD3 CD4 CD8 CD44 + CD25 +/ precursor cells and blocks the differentiation pathway of TCR alpha beta cells in fetal thymus organ culture. J. Immunol. 150:2706 2716. 161. Yasuda, Y., A. Kaneko, I. Nishijima, S. Miyatake, and K. Arai. 2002. Interleukin 7 inhibits pre T cel l differentiation induced by the pre T cell receptor signal and the effect is mimicked by hGM CSF in hGM CSF receptor transgenic mice. Immunology 106:212 221. 162. Napolitano, L. A., C. A. Stoddart, M. B. Hanley, E. Wieder, and J. M. McCune. 2003. Effects of IL 7 on Early Human Thymocyte Progenitor Cells In Vitro and in SCID hu Thy/Liv Mice. J. Immunol. 171:645 654. 163. El Kassar, N., P. J. Lucas, D. B. Klug, M. Zamisch, M. Merchant, C. V. Bare, B. Choudhury, S. O. Sharrow, E. Richie, C. L. Mackall, and R. E. Gress. 2004. A dose effect of IL 7 on thymocyte development. Blood 104:1419 1427. 164. Yu, Q., B. Erman, J. H. Park, L. Feigenbaum, and A. Singer. 2004. IL 7 receptor signals inhibit expression of transcription factors TCF 1, LEF 1, and RORgammat: impa ct on thymocyte development. J. Exp. Med. 200:797 803. 165. Levelt, C. N., P. Mombaerts, A. Iglesias, S. Tonegawa, and K. Eichmann. 1993. Restoration of early thymocyte differentiation in T cell receptor beta chain deficient mutant mice by transmembrane si gnaling through CD3 epsilon. Proc. Natl. Acad. Sci. U. S. A. 90:11401 11405. 166. Schmitt, T. M., and J. C. Ziga Pflcker. 2002. Induction of T Cell Development from Hematopoietic Progenitor Cells by Delta like 1 In Vitro. Immunity 17:749 756. 167. Patel E., W. Bei, L. Lily, W. Yichen, Y. Li Jun, J. S. Moreb, and C. Lung Ji. 2009. Diverse T cell differentiation potentials of human fetal thymus, fetal liver, cord blood and adult bone marrow CD34 cells on lentiviral Delta like 1 modified mouse stromal cell s. Immunology 128:e497 e505. 168. Michie, A. M., and J. C. Ziga Pflcker. 2002. Regulation of thymocyte differentiation: pre selection. Semin Immunol 14:311 323. 169. Takeshita S, T. M., Yamagishi H. 1989. Excision products of the T cel l receptor gene support a progressive rearrangement model of the alpha/delta locus. EMBO J. 8:3261 3270. 170. Ponchel, F., C. Toomes, K. Bransfield, F. Leong, S. Douglas, S. Field, S. Bell, V. Combaret, A. Puisieux, A. Mighell, P. Robinson, C. Inglehearn, J. Isaacs, and A. Markham. 2003. Real time PCR based on SYBR Green I fluorescence: An alternative to the TaqMan assay for a relative quantification of gene rearrangements, gene amplifications and micro gene deletions. BMC Biotechnology 3:18.

PAGE 145

145 171. von Boehm er, H. 2005. Unique features of the pre T cell receptor [alpha] chain: not just a surrogate. Nat. rev. Immunol 5:571 577. 172. Panigada, M., S. Porcellini, E. Barbier, S. Hoeflinger, P. A. Cazenave, H. Gu, H. Band, H. von Boehmer, and F. Grassi. 2002. Cons titutive Endocytosis and Degradation of the Pre T Cell Receptor. J Exp Med 195:1585 1597. 173. mediated signals rescue the development of CD4 + CD8 + thymocytes in RAG 2 / expression. Int. Immunol. 6:995 1001. 174. Fehling, H. J., B. M. Iritani, A. Krotkova, K. A. Forbush, C. Laplace, R. M. Perlmutter, and H. von Boehmer. 1997. Restoration of Thymopoiesis in pT / Mice by Anti CD3 Antibody Treatment or with Transgenes Encoding Activated Lck or Tailless pT Immunity 6:703 714. 175. Hernndez Hoyos, G., S. J. Sohn, E. V. Ro thenberg, and J. Alberola Ila. 2000. Lck Activity Controls CD4/CD8 T Cell Lineage Commitment. Immunity 12:313 322. 176. Germain, R. N. 2002. T cell development and the CD4 CD8 lineage decision. Nat Rev Immunol 2:309 322. 177. Ellmeier, W., M. J. Sunshine, R. Maschek, and D. R. Littman. 2002. Combined Deletion of CD8 Locus cis Regulatory Elements Affects Initiation but Not Maintenance of CD8 Expression. Immunity 16:623 634. 178. Ellmeier, W., M. J. Sunshine, K. Losos, and D. R. Littman. 1998. Multiple Develo pmental Stage Specific Enhancers Regulate CD8 Expression in Developing Thymocytes and in Thymus Independent T Cells. Immunity 9:485 496. 179. Schmitt, T. M., and J. C. Zuniga Pflucker. 2002. Induction of T cell development from hematopoietic progenitor cel ls by delta like 1 in vitro. Immunity 17:749 756. 180. Alsheikhly, A. R., J. Zweiri, A. J. Walmesley, A. J. M. Watson, and S. E. Christmas. 2004. Both soluble and membrane bound forms of Flt3 ligand enhance n a murine colon carcinoma model. Cancer Immunol. Immunother. 53:946 954. 181. Opdenakker, G., P. Rudd, M. Wormald, R. Dwek, and J. Van Damme. 1995. Cells regulate the activities of cytokines by glycosylation. FASEB J. 9:453 457. 182. Xiong, J., M. A. Arma to, and T. M. Yankee. 2011. Immature single positive CD8+ thymocytes represent the transition from Notch dependent to Notch independent T cell development. Int. Immunol. 23:55 64. 183. von Freeden Jeffry, U., P. Vieira, L. A. Lucian, T. McNeil, S. E. Burda ch, and R. Murray. 1995. Lymphopenia in interleukin IL 7 gene deleted mice identifies IL 7 as a nonredundant cytokine. J. Exp. Med. 181:1519 1526.

PAGE 146

146 184. Yu, Q., B. Erman, J. H. Park, L. Feigenbaum, and A. Singer. 2004. IL 7 Receptor Signals Inhibit Expressi on of Transcription Factors TCF 1, LEF J. Exp. Med. 200:797 803. 185. Pellegrini, M., T. Calzascia, A. R. Elford, A. Shahinian, A. E. Lin, D. Dissanayake, S. Dhanji, L. T. Nguyen, M. A. Gronski, M. Morre, B. Assouline, K. Lahl, T. Sparwasser, P. S. Ohashi, and T. W. Mak. 2009. Adjuvant IL 7 antagonizes multiple cellular and molecular inhibitory networks to enhance immunotherapies. Nat. Med. 15:528 536. 186. Suda, T., and A. Zlotnik. 1992. In vitro induction of CD8 expression on thymic pre T ce lls. I. Transforming growth factor beta and tumor necrosis factor alpha induce CD8 expression on CD8 thymic subsets including the CD25+CD3 CD4 CD8 pre T cell subset. J. Immunol. 148:1737 1745. 187. Li, W., M. G. Kim, T. S. Gourley, B. P. McCarthy, D. B. Sant'Angelo, and C. H. Chang. 2005. An Alternate Pathway for CD4 T Cell Development: Thymocyte Expressed MHC Class II Selects a Distinct T Cell Population. Immunity 23:375 386. 188. Bell, E. 2007. T Cell development: Thymocyte selected CD4+ T cells. Nat. r ev. Immunol. 7:748 749. 189. Saito, Y., Y. Kametani, K. Hozumi, N. Mochida, K. Ando, M. Ito, T. Nomura, Y. Tokuda, H. Makuuchi, T. Tajima, and S. Habu. 2002. The in vivo development of human T cells from CD34+ cells in the murine thymic environment. Int. I mmunol. 14:1113 1124. 190. Yahata, T., K. Ando, Y. Nakamura, Y. Ueyama, K. Shimamura, N. Tamaoki, S. Kato, and T. Hotta. 2002. Functional Human T Lymphocyte Development from Cord Blood CD34+ Cells in Nonobese Diabetic/Shi scid, IL J Immunol. 169:204 209. 191. Hiramatsu, H., R. Nishikomori, T. Heike, M. Ito, K. Kobayashi, K. Katamura, and T. Nakahata. 2003. Complete reconstitution of human lymphocytes from cord blood Blood 102:873 880 192. Adkins, B. 1991. Developmental regulation of the intrathymic T cell precursor population. J. Immunol. 146:1387 1393. 193. mediated signals rescue the development of CD4+CD8+ thymocytes in RAG expression. Int. Immunol. 6:995 1001. 194. Godfrey, D., J. Kennedy, T. Suda, and A. Zlotnik. 1993. A developmental pathway involving four phenotypically and functionally distinct subsets of CD3 CD4 CD8 triple negative adult mouse thy mocytes defined by CD44 and CD25 expression. J. Immunol. 150:4244 4252.

PAGE 147

147 195. Godfrey, D., J. Kennedy, P. Mombaerts, S. Tonegawa, and A. Zlotnik. 1994. Onset of TCR beta gene rearrangement and role of TCR beta expression during CD3 CD4 CD8 thymocyte differ entiation. J. Immunol. 152:4783 4792. 196. von Boehmer, H., and H. J. Fehling. 1997. Structure and Function of the Pre T Cell Receptor. Annu. Rev. Immunol. 15:433 452. 197. von Boehmer, H. 2005. Unique features of the pre T cell receptor chain: not just a surrogate. Nat Rev Immunol 5:571 577. 198. Ye, S. K., K. Maki, T. Kitamura, S. Sunaga, K. Akashi, J. Domen, I. L. Weissman, Locus by Stat5: Implications for Accessibility Contr ol by the IL 7 Receptor. Immunity 11:213 223. 199. Roifman, C. M., J. Zhang, D. Chitayat, and N. Sharfe. 2000. A partial deficiency of interleukin cell development and cause severe combined immunodeficiency. Blood 96:2803 28 07. 200. El Kassar, N., P. J. Lucas, D. B. Klug, M. Zamisch, M. Merchant, C. V. Bare, B. Choudhury, S. O. Sharrow, E. Richie, C. L. Mackall, and R. E. Gress. 2004. A dose effect of IL 7 on thymocyte development. Blood 104:1419 1427. 201. Yasuda, Y., A. Kan eko, I. Nishijima, S. Miyatake, and K. i. Arai. 2002. Interleukin 7 inhibits pre T cell differentiation induced by the pre T cell receptor signal and the effect is mimicked by hGM CSF in hGM CSF receptor transgenic mice. Immunology 106:212 221. 202. Yu, Q. B. Erman, J. H. Park, L. Feigenbaum, and A. Singer. 2004. IL 7 Receptor Signals Inhibit Expression of Transcription Factors TCF 1, LEF The Journal of Experimental Medicine 200:797 803. 203. Peschon, J. J., P. J. Morrissey, K. H. Grabstein, F. J. Ramsdell, E. Maraskovsky, B. C. Gliniak, L. S. Park, S. F. Ziegler, D. E. Williams, C. B. Ware, J. D. Meyer, and B. L. Davison. 1994. Early lymphocyte expansion is severely impaired in interleukin 7 receptor deficient mice. The Journal of Experimenta l Medicine 180:1955 1960. 204. Plum, J., M. De Smedt, G. Leclercq, B. Verhasselt, and B. Vandekerckhove. 1996. Interleukin 7 is a critical growth factor in early human T cell development. Blood 88:4239 4245. 205. Hofmeister, R., A. R. Khaled, N. Benbernou, E. Rajnavolgyi, K. Muegge, and S. K. Durum. 1999. Interleukin 7: physiological roles and mechanisms of action. Cytokine Growth Factor Rev. 10:41 60.

PAGE 148

148 206. Dadi, H., S. Ke, and C. Roifman. 1994. Activation of phosphatidylinositol 3 kinase by ligation of the interleukin 7 receptor is dependent on protein tyrosine kinase activity. Blood 84:1579 1586. 207. Johnson, S. E., N. Shah, A. A. Bajer, and T. W. LeBien. 2008. IL 7 Activates the Phosphatidylinositol 3 Kinase/AKT Pathway in Normal Human Thymocytes but Not Normal Human B Cell Precursors. J. Immunol. 180:8109 8117. 208. Ramiro, A. R., M. N. Navarro, A. Carreira, Y. R. Carrasco, V. G. de Ybenes, G. Carrillo, J. L. San Milln, B. Rubin, and M. L. Toribio. 2001. Differential Developmental Regulation and Functi onal Effects on Pre TCR Surface Expression J. Immunol. 167:5106 5114. 209. Arnaud, J., A. Huchenq, M. C. Vernhes, S. Caspar Bauguil, F. Lenfant, J. Sancho, C. Terhorst, and B. Rubin. 1997. The interchain disulfide b ond between TCR alpha beta heterodimers on human T cells is not required for TCR CD3 membrane expression and signal transduction. Int. Immunol. 9:615 626. 210. Chang, L. J., X. Liu, and J. He. 2005. Lentiviral siRNAs targeting multiple highly conserved RNA sequences of human immunodeficiency virus type 1. Gene Ther. 12:1133 1144. 211. Burger, R., T. E. Hansen Hagge, H. G. Drexler, and M. Gramatzki. 1999. Heterogeneity of T acute lymphoblastic leukemia (T ALL) cell lines: Suggestion for classification by imm unophenotype and T cell receptor studies. Leuk. Res. 23:19 27. 212. Hu, H. Z., R. A. De Weger, K. Bosboom Kalsbeek, M. G. J. Tilanus, J. Rozing, and human peripheral blood lymphoc ytes at the mRNA and membrane protein level. Clin. Exp. Immunol. 88:335 340. 213. Plum, J., M. De Smedt, G. Leclercq, T. Taghon, T. Kerre, and B. Vandekerckhove. 2008. Human intrathymic development: a selective approach. Semin. Immunopathology 30:411 423. 214. Henriques, C. M., J. Rino, R. J. Nibbs, G. J. Graham, and J. T. Barata. 2010. IL 7 induces rapid clathrin mediated internalization and JAK3 dependent degradation of IL 7R{alpha} in T cells. Blood 115:3269 3277. 215. Biselli, R., P. M. Matricardi, R. D Amelio, and A. Fattorossi. 1992. Multiparametric Flow Cytometric Analysis of the Kinetics of Surface Molecule Expression after Polyclonal Activation of Human Peripheral Blood T Lymphocytes. Scand. J. Immunol. 35:439 447.

PAGE 149

149 216. Cheng, A. M., I. Negishi, S. J. Anderson, A. C. Chan, J. Bolen, D. Y. Loh, and T. Pawson. 1997. The Syk and ZAP 70 SH2 containing tyrosine kinases are implicated in pre Proc. Natl. Acad. Sci. U. S. A. 94:9797 9801. 217. Cantrell, D. A. 2002. Transgenic anal ysis of thymocyte signal transduction. Nat. Rev. Immunol. 2:20 27. 218. Juntilla, M. M., and G. A. Koretzky. 2008. Critical roles of the PI3K/Akt signaling pathway in T cell development. Immunol. Lett. 116:104 110. 219. Xue, L., L. Chiang, C. Kang, and A. Winoto. 2008. The role of the PI3K AKT kinase pathway in T Eur. J. Immunol. 38:3200 3207. 220. Yang, L., G. Qiao, H. Ying, J. Zhang, and F. Yin. 2010. TCR induced Akt serine 473 phosphorylation is regulated by prot ein kinase C alpha. Biochem. Biophys. Res. Commun. 400:16 20. 221. Mao, C., E. G. Tili, M. Dose, M. C. Haks, S. E. Bear, I. Maroulakou, K. Horie, G. A. Gaitanaris, V. Fidanza, T. Ludwig, D. L. Wiest, F. Gounari, and P. N. Tsichlis. 2007. Unequal Contributi on of Akt Isoforms in the Double Negative to Double Positive Thymocyte Transition. J. Immunol. 178:5443 5453. 222. Crompton, T., K. C. Gilmour, and M. J. Owen. 1996. The MAP Kinase Pathway Controls Differentiation from Double Negative to Double Positive Th ymocyte. Cell 86:243 251. 223. Baird, A., D. Thomis, and L. Berg. 1998. T cell development and activation in Jak3 deficient mice. J. Leukoc. Biol. 63:669 677. 224. Suzuki, K., H. Nakajima, Y. Saito, T. Saito, W. J. Leonard, and I. Iwamoto. 2000. Janus kina deficient mice. Int. Immunol. 12:123 132. 225. Hofmann, S. R., A. Q. Lam, S. Frank, Y. J. Zhou, H. L. Ramos, Y. Kanno, D. Agnello, R. J. Youle, and J. J. O'Shea. 2004. Jak3 Independent Trafficking of the Mol. Cell. Biol. 24:5039 5049. 226. Medyouf, H., X. Gao, F. Armstrong, S. Gusscott, Q. Liu, A. L. Gedman, L. H. Matherly, K. R. Schultz, F. Pflumio, M. J. You, and A. P. Weng. 2010. Acute T cell leukemias remain dependent on Notch signaling despite PTEN and INK4A/ARF loss. Blood 115:1175 1184.

PAGE 150

150 227. Yudushkin, I. A., and R. D. Vale. 2010. Imaging T cell receptor activation reveals accumulation of tyrosine Proc. Natl. Acad. Sci. U. S. A. 107:22128 22133. 228. Qin, J. Z., C. L. Zhang, J. Kamarashev, R. Dummer, G. Burg, and U. Dbbeling. 2001. Interleu kin 7 and interleukin 15 regulate the expression of thebcl 2 and c myb genes in cutaneous T cell lymphoma cells. Blood 98:2778 2783. 229. Salmeron, A., F. Sanchez Madrid, M. Ursa, M. Fresno, and B. Alarcon. 1991. A conformational epitope expressed upon ass ociation of CD3 epsilon with either CD3 delta or CD3 gamma is the main target for recognition by anti CD3 monoclonal antibodies. J. Immunol. 147:3047 3052. 230. Fleming, H. E., and C. J. Paige. 2002. Cooperation between IL 7 and the pre B cell receptor: a key to B cell selection. Semin. Immunol. 14:423 430. 231. Barata, J. T., V. A. Boussiotis, J. A. Yunes, A. A. Ferrando, L. A. Moreau, J. P. Veiga, S. E. Sallan, A. T. Look, L. M. Nadler, and A. A. Cardoso. 2004. IL 7 dependent human leukemia T cell line as a valuable tool for drug discovery in T ALL. Blood 103:1891 1900. 232. Barata, J. T., A. Silva, J. G. Brandao, L. M. Nadler, A. A. Cardoso, and V. A. Boussiotis. 2004. Activation of PI3K Is Indispensable for Interleukin 7 mediated Viability, Proliferation Glucose Use, and Growth of T Cell Acute Lymphoblastic Leukemia Cells. J. Exp. Med. 200:659 669. 233. Veillette, A., M. A. Bookman, E. M. Horak, and J. B. Bolen. 1988. The CD4 and CD8 T cell surface antigens are associated with the internal membrane tyros ine protein kinase p56lck. Cell 55:301 308. 234. Page, T. H., F. V. Lali, and B. M. J. Foxwell. 1995. Interleukin 7 activates p56lck and p59fyn, two tyrosine kinases associated with the p90 interleukin 7 receptor in primary human T cells. Eur. J. Immunol. 25:2956 2960. 235. Yamazaki, M., T. Yajima, M. Tanabe, K. Fukui, E. Okada, R. Okamoto, S. Oshima, T. Nakamura, T. Kanai, M. Uehira, T. Takeuchi, H. Ishikawa, T. Hibi, and M. Watanabe. 2003. Mucosal T Cells Expressing High Levels of IL 7 Receptor Are Potent ial Targets for Treatment of Chronic Colitis. J. Immunol. 171:1556 1563. 236. J.F.A.P, M. 1961. Immunological Function of The Thymus. The Lancet 278:748 749. 237. Muranski, P., A. Boni, C. Wrzesinski, D. E. Citrin, S. A. Rosenberg, R. Childs, and N. P. Res tifo. 2006. Increased intensity lymphodepletion and adoptive immunotherapy -how far can we go? Nature clinical practice. Oncology 3:668 681.

PAGE 151

151 238. Kerre, T. C. C., G. De Smet, M. De Smedt, F. Offner, J. De Bosscher, J. Plum, and B. Vandekerckhove. 2001. Bot h CD34+38+ and CD34+38 Cells Home Specifically to the Bone Marrow of NOD/LtSZ scid/scid Mice but Show Different Kinetics in Expansion. J. Immunol. 167:3692 3698. 239. Hao, Q. L., A. A. George, J. Zhu, L. Barsky, E. Zielinska, X. Wang, M. Price, S. Ge, and G. M. Crooks. 2008. Human intrathymic lineage commitment is marked by myeloid thymic progenitors. Blood 111:1318 1326. 240. De Smedt, M., G. Leclercq, B. Vandekerckhove, T. Kerre, T. Taghon, and J Plum. 2011. T lymphoid differentiation potential measured in vitro is higher in bone marrow and is an intrinsic property of the cells. Haematologica 96:646 654. 241. Dik, W. A., K Pike Overzet, F. Weerkamp, D. de Ridder, E. F. E. de Haas, M. R. M. Baert, P. van der Spek, E. E. L. Koster, M. J. T. Reinders, J. J. M. van Dongen, A. W. Langerak, and F. J. T. Staal. 2005. New insights on human T cell development by quantitative T cell receptor gene rearrangement studies and gene expression profiling. J. Exp. Med. 201:1715 1723. 242. Pan, Q., J. F. Brodeur, K. Drbal, and V. P. Dave. 2006. Different role for mouse and h deficient mice. Mol. Immunol. 43:1741 1750. 243. Brodeur, J. F., S. Li, M. d. S. Martins, L. Larose, and V. P. Dave. 2009. Critical and Positive Thymocyte Differentiation. J. Immunol. 182:4844 4853. 244. Mancini, S. J. C., S. M. Candias, J. P. Di Santo, P. Ferrier, P. N. Marche, and E. Jouvin Marche. 2001. TCRA Gene Rearrangement in Immature Thymocytes in Absence of CD3, Pre TCR, and TCR Signaling. J. Immunol. 167:4485 4493. 245. Vanhecke, D., B. Verhasselt, M. De Smedt, B. De Paepe, G. Leclercq, J. Plum, and B. Vandekerckhove. 1997. MHC class II molecules are required for initiation of positive selection but not during terminal differentiation of human CD4 single positive thymocytes. J. Immunol. 158:3730 3737. 246. Brndle, D., S. Mller, C. Mller, H. Hengartner, and H. Pircher. 199 4. Regulation of RAG 1 and CD69 expression in the thymus during positive and negative selection. Eur. J. Immunol. 24:145 151. 247. M. Lambert, M. v. E., F. Mascart, E. Dupont, and P. van den Elsen. 1992. TCR V and V Gene Segment Use in T Cell Subcultu res Derived from a Type III Bare Lymphocyte Syndrome Patient Deficient in MHC Class II Expression. Clinical and Developmental Immunology 2:227 236.

PAGE 152

152 248. Noraz, N., K. Schwarz, M. Steinberg, V. Dardalhon, C. Rebouissou, R. Hipskind, W. Friedrich, H. Yssel, K. Bacon, and N. Taylor. 2000. Alternative Antigen Receptor (TCR) Signaling in T Cells Derived from ZAP 70 deficient Patients Expressing High Levels of Syk. J. Biol. Chem. 275:15832 15838. 249. Arpaia, E., M. Shahar, H. Dadi, A. Cohen, and C. M. Rolfman. 1 994. Defective T cell receptor signaling and CD8+ thymic selection in humans lacking Zap 70 kinase. Cell 76:947 958. 250. Davis, C. B., N. Killeen, M. E. C. Crooks, D. Raulet, and D. R. Littman. 1993. Evidence for a stochastic mechanism in the differentiat ion of mature subsets of T lymphocytes. Cell 73:237 247. 251. Robey, E. A., B. J. Fowlkes, J. W. Gordon, D. Kioussis, H. von Boehmer, F. Ramsdell, and R. Axel. 1991. Thymic selection in CD8 transgenic mice supports an instructive model for commitment to a CD4 or CD8 lineage. Cell 64:99 107. 252. Norment, A. M., K. A. Forbush, N. Nguyen, M. Malissen, and R. M. Perlmutter. 1997. Replacement of Pre T Cell Receptor Signaling Functions by the CD4 Coreceptor. J. Exp. Med. 185:121 130. 253. Tyznik, A. J., J. C. Su n, and M. J. Bevan. 2004. The CD8 Population in CD4 deficient Mice Is Heavily Contaminated with MHC Class II restricted T Cells. J. Exp. Med. 199:559 565. 254. Kao, H., and P. M. Allen. 2005. An antagonist peptide mediates positive selection and CD4 lineag e commitment of MHC class II restricted T cells in the absence of CD4. J. Exp. Med. 201:149 158. 255. Matechak, E. O., N. Killeen, S. M. Hedrick, and B. J. Fowlkes. 1996. MHC Class II Specific T Cells Can Develop in the CD8 Lineage When CD4 Is Absent. Immu nity 4:337 347. 256. Ravichandran, K. S., and S. J. Burakoff. 1994. Evidence for differential intracellular signaling via CD4 and CD8 molecules. J. Exp. Med. 179:727 732. 257. Itano, A., P. Salmon, D. Kioussis, M. Tolaini, P. Corbella, and E. Robey. 1996. The cytoplasmic domain of CD4 promotes the development of CD4 lineage T cells. J. Exp. Med. 183:731 741. 258. Catlett, I. M., and S. M. Hedrick. 2005. Suppressor of cytokine signaling 1 is required for the differentiation of CD4+ T cells. Nat Immunol 6:715 721. 259. Chong, M. M. W., A. L. Cornish, R. Darwiche, E. G. Stanley, J. F. Purton, D. I. Godfrey, D. J. Hilton, R. Starr, W. S. Alexander, and T. W. H. Kay. 2003. Suppressor of Cytokine Signaling 1 Is a Critical Regulator of Interleukin 7 Dependent CD8+ T Cell Differentiation. Immunity 18:475 487.

PAGE 153

153 260. Bosselut, R., T. I. Guinter, S. O. Sharrow, and A. Singer. 2003. Unraveling a Revealing Paradox:Why Major Histocompatibility Complex I signaled Thymocytes + 8 lo Transitional Cell s During Positive Selection of CD8 + T Cells J. Exp. Med. 197:1709 1719. 261. He, X., K. Park, H. Wang, Y. Zhang, X. Hua, Y. Li, and D. Kappes. 2008. CD4 CD8 lineage commitment is regulated by a silencer element at the ThPOK transcription factor locus. Immu nity 28:346 358. 262. Poznansky, M. C., R. H. Evans, R. B. Foxall, I. T. Olszak, A. H. Piascik, K. E. Hartman, C. Brander, T. H. Meyer, M. J. Pykett, K. T. Chabner, S. A. Kalams, M. Rosenzweig, and D. T. Scadden. 2000. Efficient generation of human T cel ls from a tissue engineered thymic organoid. Nat Biotech 18:729 734. 263. Clark, R. A., K. i. Yamanaka, M. Bai, R. Dowgiert, and T. S. Kupper. 2005. Human skin cells support thymus independent T cell development. J. Clin. Invest. 115:3239 3249. 264. Beaude tte Zlatanova, B. C., K. L. Knight, S. Zhang, P. J. Stiff, J. C. Ziga Pflcker, and P. T. Le. 2011. A human thymic epithelial cell culture system for the promotion of lymphopoiesis from hematopoietic stem cells. Exp. Hematol. 39:570 579. 265. Van Coppern olle, S., G. Verstichel, F. Timmermans, I. Velghe, D. Vermijlen, M. De Smedt, G. Leclercq, J. Plum, T. Taghon, B. Vandekerckhove, and T. Kerre. 2009. Functionally Mature CD4 and CD8 Cells Are Generated in OP9 DL1 Cultures from Human CD34+ Hematopoietic Cells. J. Immunol. 183:4859 4870. 266. Mazzucchelli, R. I., S. Warming, S. M. Lawrence, M. Ishii, M. Abshari, A. V. Washington, L. Feigenbaum, A. C. Warner, D. J. Sims, W. Q. Li, J. A. Hixon, D. H. D. Gray, B. E. Rich, M. Morrow, M. R. Anver, J. Cherry, D. Naf, L. R. Sternberg, D. W. McVicar, A. G. Farr, R. N. Germain, K. Rogers, N. A. Jenkins, N. G. Copeland, and S. K. Durum. 2009. Visualization and Identification of IL 7 Produci ng Cells in Reporter Mice. PLoS ONE 4:e7637. 267. Fischer, A., M. Cavazzana Calvo, G. D. S. Basile, J. P. DeVillartay, J. P. Di Santo, C. Hivroz, F. Rieux Laucat, and F. Le Deist. 1997. Naturally Occuring Primary Deficiencies of the Immune System. Annu. Re v. Immunol. 15:93 124. 268. Cao, X., E. W. Shores, J. Hu Li, M. R. Anver, B. L. Kelsail, S. M. Russell, J. Drago, M. Noguchi, A. Grinberg, E. T. Bloom, W. E. Paul, S. I. Katz, P. E. Love, and W. J. Leonard. 1995. Defective lymphoid development in mice lack ing expression of the Immunity 2:223 238. 269. Disanto, J. P., S. Certain, A. Fischer, G. D. S. Basile, and A. Dautry Varsat. 1994. Interleukin 2 (IL linked severe combined immunodeficien cy disease result in the loss of high affinity IL 2 receptor binding. Eur. J. Immunol. 24:475 479.

PAGE 154

154 270. Elder, M. E., S. Skoda Smith, T. A. Kadlecek, F. Wang, J. Wu, and A. Weiss. 2001. Distinct T Cell Developmental Consequences in Humans and Mice Expressi ng Identical Mutations in the DLAARN Motif of ZAP 70. J. Immunol. 166:656 661. 271. Bleul, C. C., T. Corbeaux, A. Reuter, P. Fisch, J. S. Mnting, and T. Boehm. 2006. Formation of a functional thymus initiated by a postnatal epithelial progenitor cell. Nat ure 441:992 996. 272. Hakim, F. T., S. A. Memon, R. Cepeda, E. C. Jones, C. K. Chow, C. Kasten Sportes, J. Odom, B. A. Vance, B. L. Christensen, C. L. Mackall, and R. E. Gress. 2005. Age dependent incidence, time course, and consequences of thymic renewal in adults. J. Clin. Invest. 115:930 939. 273. Zakrzewski, J. L., A. A. Kochman, S. X. Lu, T. H. Terwey, T. D. Kim, V. M. Hubbard, S. J. Muriglan, D. Suh, O. M. Smith, J. Grubin, N. Patel, A. Chow, J. Cabrera Perez, R. Radhakrishnan, A. Diab, M. A. Perales, G. Rizzuto, E. Menet, E. G. Pamer, G. Heller, J. C. Zuniga Pflucker, O. Alpdogan, and M. R. M. van den Brink. 2006. Adoptive transfer of T cell precursors enhances T cell reconstitution after allogeneic hematopoietic stem cell transplantation. Nat. Med. 12:1039 1047. 274. Wolkowicz, R., and G. P. Nolan. 2005. Gene therapy progress and prospects: Novel gene therapy approaches for AIDS. Gene Ther. 12:467 476. 275. Ueno, T., M. Fujiwara, H. Tomiyama, M. Onodera, and M. Takiguchi. 2004. Reconstitution of anti by transfer of HIV Eur. J. Immunol. 34:3379 3388. 276. Zhao, Y., M. R. Parkhurst, Z. Zheng, C. J. Cohen, J. P. Riley, L. Gattinoni, N. P. Restifo, S. A. Rosenberg, and R. A. Morgan. 2007. Extrathymic Generation of Tumor Specific T Cells from Genetically Engineered Human Hematopoietic Stem Cells via Notch Signaling. Cancer Res. 67:2425 2429. 277. Mackall, C. L., T. J. Fry, and R. E. Gress. 2011. Harnessing the biology of IL 7 f or therapeutic application. Nat. Rev. Immunol. 11:330 342. 278. Barata, J., A. Cardoso, and V. Boussiotis. 2005. Interleukin 7 in T cell acute lymphoblastic leukemia: An extrinsic factor supporting leukemogenesis? Leuk. Lymphoma 46:483 495.

PAGE 155

155 BIOGRAPHIC AL SKETCH Ekta Patel was born in Gujarat, India in 1982. She resided in Gujarat till completion of high school at Fertilizernagar School in 1999. She attended Sardar Patel University Gujarat for the freshman year, majoring in Microbiology. Ekta moved to U SA in 2000 and continued her education a t Quinnipiac University, Connecticut. Ekta was involved in undergraduate research laboratory, were she learned basic microbiology and molecular biology techniques. Here she received an Interdisciplinary research gran t award in 2004 Ekta graduated magna cum laude in 2005 after obtaining a Bachelor of Science in microbiology with a minor in chemistry. She also worked as a research Immunology and microbiology concentration of the Interdisciplinary Program in Biomedical Sciences for a Doctor of Philosophy in 2005. In 2006, she joined Dr. Lung ji Chang to study human T cell development using in vitro model. S he received a T 32 training grant award in 2009. from the University of Florida in the fall of 2011.