<%BANNER%>

Functional Analysis of Mir-K12-11, a Kaposi's Sarcoma-Associated Herpesvirus Encoded Mirna, and Its Role in Viral Pathog...

Permanent Link: http://ufdc.ufl.edu/UFE0043691/00001

Material Information

Title: Functional Analysis of Mir-K12-11, a Kaposi's Sarcoma-Associated Herpesvirus Encoded Mirna, and Its Role in Viral Pathogenesis
Physical Description: 1 online resource (141 p.)
Language: english
Creator: Boss, Isaac Wayne
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: b-cell -- kshv -- mir-155 -- mir-k12-11 -- mirna
Genetics (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Kaposi's sarcoma-associated herpesvirus (KSHV), a B cell-tropic virus associated with Kaposi's sarcoma (KS) and the B cell lymphomas, primary effusion lymphoma (PEL) and multicentric Castleman's disease (MCD), encodes 12 miRNA genes that are highly expressed in these tumor cells. MicroRNAs are small non-coding RNA molecules that function as post-transcriptional regulators of gene expression. One viral miRNA, miR-K12-11, shares 100% seed sequence homology with hsa-miR-155, an oncogenic human miRNA that functions as a key regulator of hematopoiesis and B cell differentiation. In vitro studies have shown that both miRNAs can regulate a common set of cellular target genes suggesting that miR-K12-11 may mimic miR-155 function. To comparatively study miR-K12-11 and miR-155 function in vivo, we used a foamy virus vector to express the miRNAs in human hematopoietic progenitors and performed immune reconstitutions in NOD/LtSz-scid IL2R?null mice. We found that ectopic expression of miR-K12-11 or miR-155 leads to a significant expansion of the CD19+ B cell population in the spleen. Subsequent qPCR analyses of these splenic B cells revealed that C/EBPß, a transcriptional regulator of IL-6 that is linked to B cell lymphoproliferative disorders, is downregulated when either miR-K12-11 or miR-155 is ectopically expressed. In addition, inhibition of miR-K12-11 function, using antagomirs in KSHV infected human primary effusion lymphoma (PEL) B cells, resulted in derepression of C/EBPß transcript levels. Both PEL and MCD resemble B cells that are frozen at a plasmablast stage of differentiation. While the aeitology of these B cell malignancies is unclear, we propose that miR-K12-11 mimics miR-155 function to promote plasmablast differentiation and potentially block plasma cell differentiation. To study the role of miR-K12-11 in B cell differentiation, we utilized an in vitro model of human plasma cell differentiation and searched for B cell regulatory genes that can be regulated by both miRNAs. In our model system, transfection of synthetic miR-K12-11 or miR-155 mimics into purified human B cells did not induce plasmablast differentiation or inhibit plasma cell differentiation. However, we identified the B cell genes MYB, IgJ, and SHIP1 as valid targets of both miRNAs, whose regulation may influence B cell maturation and function during de novo KSHV infection. Together, these studies indicate that miR-K12-11 phenocopies miR-155 function in human hematopoiesis by mimicking miR-155 regulation of B cell targets, and provides important insights into the role of this KSHV miRNA in B cell pathogenesis.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Isaac Wayne Boss.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Renne, Rolf.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043691:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043691/00001

Material Information

Title: Functional Analysis of Mir-K12-11, a Kaposi's Sarcoma-Associated Herpesvirus Encoded Mirna, and Its Role in Viral Pathogenesis
Physical Description: 1 online resource (141 p.)
Language: english
Creator: Boss, Isaac Wayne
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: b-cell -- kshv -- mir-155 -- mir-k12-11 -- mirna
Genetics (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Kaposi's sarcoma-associated herpesvirus (KSHV), a B cell-tropic virus associated with Kaposi's sarcoma (KS) and the B cell lymphomas, primary effusion lymphoma (PEL) and multicentric Castleman's disease (MCD), encodes 12 miRNA genes that are highly expressed in these tumor cells. MicroRNAs are small non-coding RNA molecules that function as post-transcriptional regulators of gene expression. One viral miRNA, miR-K12-11, shares 100% seed sequence homology with hsa-miR-155, an oncogenic human miRNA that functions as a key regulator of hematopoiesis and B cell differentiation. In vitro studies have shown that both miRNAs can regulate a common set of cellular target genes suggesting that miR-K12-11 may mimic miR-155 function. To comparatively study miR-K12-11 and miR-155 function in vivo, we used a foamy virus vector to express the miRNAs in human hematopoietic progenitors and performed immune reconstitutions in NOD/LtSz-scid IL2R?null mice. We found that ectopic expression of miR-K12-11 or miR-155 leads to a significant expansion of the CD19+ B cell population in the spleen. Subsequent qPCR analyses of these splenic B cells revealed that C/EBPß, a transcriptional regulator of IL-6 that is linked to B cell lymphoproliferative disorders, is downregulated when either miR-K12-11 or miR-155 is ectopically expressed. In addition, inhibition of miR-K12-11 function, using antagomirs in KSHV infected human primary effusion lymphoma (PEL) B cells, resulted in derepression of C/EBPß transcript levels. Both PEL and MCD resemble B cells that are frozen at a plasmablast stage of differentiation. While the aeitology of these B cell malignancies is unclear, we propose that miR-K12-11 mimics miR-155 function to promote plasmablast differentiation and potentially block plasma cell differentiation. To study the role of miR-K12-11 in B cell differentiation, we utilized an in vitro model of human plasma cell differentiation and searched for B cell regulatory genes that can be regulated by both miRNAs. In our model system, transfection of synthetic miR-K12-11 or miR-155 mimics into purified human B cells did not induce plasmablast differentiation or inhibit plasma cell differentiation. However, we identified the B cell genes MYB, IgJ, and SHIP1 as valid targets of both miRNAs, whose regulation may influence B cell maturation and function during de novo KSHV infection. Together, these studies indicate that miR-K12-11 phenocopies miR-155 function in human hematopoiesis by mimicking miR-155 regulation of B cell targets, and provides important insights into the role of this KSHV miRNA in B cell pathogenesis.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Isaac Wayne Boss.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Renne, Rolf.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043691:00001


This item has the following downloads:


Full Text

PAGE 1

1 FUNCTIONAL ANALYSIS OF MIR K12 SARCOMA ASSOCIATED HERPESVIRUS ENCODED MIRNA AND ITS ROLE IN VIRAL PATHOGENESIS By ISAAC WAYNE BOSS A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Isaac Wayne Boss

PAGE 3

3 To my family, especially my parents, Harold and Sonja Boss, and the loves of my life, Natasha Moningka and Mochi

PAGE 4

4 ACKNOWLEDGMENTS I would like to acknowledge the people who made an impact on this work either through direct contributions or personal direction. First, I would like to thank the current and past members of the Renne lab: Dr. Jianhong Hu, Dr. Ma rk Samols, Dr. Rebecca Skalsky, Dr. Soo Jin Han, Dr. Irina Haecker, Karlie Plaisance Hong Seok Choi Nonhlanhla Dlamini Yajie Yang for their support in making the laboratory a great working environment. I would particularly like to thank Rebecca Skalsky whose initial findings inspired this project. I would also like to thank my thesis committee members: Dr. Brian Harfe, Dr. Ayalew Mergia, and Dr. Laurence Morel for their helpful advice. Thanks also to my collaborators Peter Nadeau, Dr. Jeffrey Abbott, and Steve McClellan for their expertise and hard work. And I need to thank the BEID and BMID training grants for supporting my work while at the University of Florida. A special thank you to my love Natasha Moningka for keeping me grounded and offering m e unwavering support. Finally, much thanks goes to my advisor Rolf Renne, for his endless ideas, creativity, and dedication to mentoring. He has shown me that success in scientific research is measured by the success of your trainees.

PAGE 5

5 TABLE OF CONTE NTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 ABSTRACT ................................ ................................ ................................ ................... 10 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 12 Associat ed Herpesvirus ........... 12 KSHV is a Lymphotropic Virus ................................ ................................ ................ 14 KSHV Lifecycle ................................ ................................ ................................ ....... 17 The KSHV Genome, Latency, and MiRNA Production ................................ ........... 17 MiRNA Discovery and Function ................................ ................................ .............. 20 MiRNA Biogenesis and Mechanisms of Gene Re gulation ................................ ...... 21 Viral MiRNAs ................................ ................................ ................................ .......... 23 Herpesvirus MiRNAs Closely Resemble Their Host Cellular Counterparts ............. 27 KSHV MiRNA Targets and Function ................................ ................................ ....... 28 KSHV MiR K12 11 is an Ortholog of Human MiR 155 ................................ ............ 36 MiR 15 5 in Hematopoietic Development and Disease ................................ ............ 38 Does MiR K12 11 Share a Homologues Function with MiR 155? .......................... 42 2 A KSHV ENCODED ORTH OLOG OF MIR 155 INDUCES HUMAN SPLENIC B CELL EXPANSION IN NOD/LTSZ SCID IL2R NULL MICE ................................ ...... 48 Results ................................ ................................ ................................ .................... 51 Discussion ................................ ................................ ................................ .............. 58 Materials and Methods ................................ ................................ ............................ 63 3 DEFINING THE ROLE OF KSHV MIR K12 11 ON TERMINAL B CELL DIFFERENTIATION ................................ ................................ ................................ 78 Introduction to KSHV and terminal B cell differentiation ................................ .......... 78 In vitro model of plasma cell differentiation ................................ ............................. 81 Ectopic miR K12 11 expression during plasma cell differentiaton .......................... 83 Identification and validation of miR K12 11 targets involved in B cell regulatory pathways ................................ ................................ ................................ ............. 85 4 CONCLUSIONS AND FUTURE DIRECTIONS ................................ ...................... 97 KSHV miR K12 11 functions as a miR 155 ortholog in vivo ................................ ... 97

PAGE 6

6 MiR K12 ................................ ................................ .. 100 KSHV miR K12 11 does not inhibit in vitro plasma cell differentiation .................. 103 KSHV miR K12 11 did not affect human B cell activation, proliferation, or apoptosis in vitro ................................ ................................ ................................ 106 Recombinant KSHV and miRNA knockouts ................................ .......................... 108 KSHV miR K12 11 targets and the future for miRNA target mining ...................... 109 Future prospective on KSHV miRNAs ................................ ................................ .. 1 11 A PP ENDIX : PROTOC OLS AND PRIMERS ................................ ................................ 114 Isolation of Peripheral Blood Mononuclear Cells (PBMCs) ................................ ... 114 Human B cell Enrichment ................................ ................................ ..................... 115 B cell medium ................................ ................................ ................................ ....... 116 In vitro plasma cell differentiation ................................ ................................ .......... 116 MiRNA mimic transfection ................................ ................................ ..................... 117 B cell proliferation assay ................................ ................................ ....................... 117 Primers for qPCR ................................ ................................ ................................ .. 118 LIST OF REFERENCES ................................ ................................ ............................. 119 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 141

PAGE 7

7 LIST OF TABLES Table page 1 1 KSHV miRNA targ ets ................................ ................................ ......................... 44

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Th e KSHV Genome. ................................ ................................ .......................... 45 1 2 KSHV miRNAs are enc oded in the KSHV late ncy associated region (KLAR). .. 46 1 3 Biogenesis of miRNAs. ................................ ................................ ....................... 47 2 1 Foamy virus vectors ................................ ................................ ........................... 69 2 2 Engraftment of transduced CB CD34+ cells. ................................ ..................... 70 2 3 Ectopic miR K12 11 and miR 155 expression in engrafted mice ....................... 71 2 4 Cell lineage differentiat ion of human progenitors in the bone marrow ................ 72 2 5 B cell subsets in the bone marrow are mostly CD10+ precursors. ..................... 72 2 6 Ectopic expression of miR K12 11 or miR 155 in human leukocytes during hematopoiesis leads to increased CD19+ B cell expansion in the spleen .......... 73 2 7 GFP positive (miRNA expressing) accounted for the overall increase in human CD45+ leukocytes and CD19+ B cells ................................ ................... 74 2 8 Ectopic expression of miR K12 11 or miR 155 did not affect B cell d ifferentiation in the spleen. ................................ ................................ ............... 75 2 9 Immunohistochemical analysis of spleens. ................................ ......................... 76 2 10 K12 11 and miR 155. ................................ ...... 77 3 1 Phenotype analysis of freshly purified human B cells. ................................ ........ 89 3 2 Plasma cell phenotype analysis before stimu lation. ................................ ........... 89 3 3 Stimulated B cells undergo plasma cell differentiation. ................................ ....... 90 3 4 Stimulated B cells secrete class switched IgG anti body. ................................ .... 90 3 5 MiRNA transfection of human B cells is more efficient and less toxi c than foamy virus transduction ................................ ................................ .................... 91 3 6 MiR K12 11 and miR 155 does not inhibit in vitro plasma cell differentiation.. ... 92 3 7 MiR K12 11 and miR 155 does not inhi bit IgG class switching ......................... 93 3 8 MiR K12 11 and miR 155 does not promote plasmablast proliferation. ............. 93

PAGE 9

9 3 9 MiR K12 11 and miR 155 do not induce activation in resting nave or memory B cells ................................ ................................ ................................ ... 94 3 10 MiR K12 11 and miR 155 do not inhibit B cell apoptosis ................................ .... 94 3 11 MiR K12 11 and miR d in B cell regulatory pathways ................................ ................................ .......................... 95 3 12 MiR K12 ...................... 96

PAGE 10

10 Abstract of Dissertation Presented to the Graduate School of the University o f Florida in Partial Fulfillment of the Requirements for the Degree of Doctor o f Philosophy FUNCTIONAL ANALYSIS OF MIR K12 SARCOMA ASSOCIATED HERPESVIRUS ENCODED MIRNA AND ITS ROLE IN VIRAL PATHOGENESIS By Isaa c Wayne Boss December 2011 Chair: Rolf Renne Major: Medi cal Sciences Genetics associated herpesvirus (KSHV), a B cell tropic virus associated the B cell lymphomas, primary effusion lymphoma (PEL) and multi encodes 12 miRNA genes that are highly expressed in these tumor cells. MicroRNAs are small non coding RNA molecules that function as post transcriptional regulators of gene expression. One viral miRNA, miR K12 11, share s 100% seed sequence homology with hsa miR 155, an oncogenic human miRNA that functions as a key regulator of hematopoiesis and B cell differentiation. I n vitro studies have show n that both miRNAs can regulate a common set of cellular target genes suggest ing that miR K12 11 may mimic miR 155 function. To comparatively study miR K12 11 and miR 155 function in vivo we used a foamy virus vector to express the miRNAs in human hematopoietic progenitors and performed immune reconstitutions in NOD/LtSz scid IL 2R null mice. We found that ectopic expression of miR K12 11 or miR 155 leads to a significant expansion of the CD19+ B cell population in the spleen. Subsequent qPCR analyses of these splenic B cell s re 6 that is linked to B cell lymphoproliferative disorders, is downregulated when either miR K12 11 or miR 155 is

PAGE 11

11 ectopically expressed. In addition, inhibition of miR K12 11 function using antagomirs i n KSHV infected human primary effusion lymphoma (PEL) B cell s, resulted in Both PEL and MCD resemble B cells that are frozen at a plasmablast stage of differentiat i on. While t he aeitology of these B cell maligna ncies is unclear we propose that miR K12 11 mimics miR 155 function to promote plasmablast differentiation and potentially block plasm a cell differentiation. To study the role of miR K12 11 in B cell differentiation, we utiliz ed an in vitro model of huma n plasma cell differentiation and searched for B cell regulatory genes that can be regulated by both miRNAs In our model system, t ransfection of sy nthetic miR K12 11 or miR 155 m imics into purified human B cells did not induce plasmablast differentiation or inhi bit plasma cell differentiation. However, we identified the B cell genes MYB, IgJ, and SHIP1 as valid targets of both miRNAs whose regulation may influence B cell maturation and function during de novo KSHV infection Together, these studies ind icate that miR K12 11 phenocopies miR 155 function in human hematopoiesis by mimic k ing miR 155 regulatio n of B cell targets, and provid es important insights into the role of this KSHV miRNA in B cell pathogenesis.

PAGE 12

12 CHAPTER 1 INTRODUCTION Discovery and C lassification o Associated Herpesvirus associated herpesvirus (KSHV) was first discovered as the (Chang et al., 1994) KS was originally described in 1872 by the preeminent Hungarian dermatologist, (Kaposi 1872). Kaposi characterized KS as brown red or blue red nodules that develop first on the skin of hands and feet, and later spread to other external and internal areas of the body, leading to skin deformation. Because Kaposi failed to notice any spread in the lymph vessels he believed that the cause of KS was a pre existing systemic disease (Sanders, 1997) an observation later proven i naccurate (Chang et al., 1994) While the classical form of KS, described by Kaposi, is a rare disease, KS was later found to be endemic in areas of sub Saharan Africa and is now separated into 4 clinical subtypes: classical KS; endemic; iatrogenic, associated with organ transplantation and immunosuppressive therapy; and epidemic or AIDS related (Antman and Chang, 20 00) Each subtype of KS shares a similar histopathology, with lesions containing a mixture of spindle cells, representing the main proliferating cell type, and inflammatory cells (lymphocytes and monocytes) (Ganem, 2006) While the histop atho logy of all subtypes are similar the target population and severity of disease differs. Classical KS i s normally displayed as an indolent skin tumor, mainly affecting elderly men of Eastern European, Mediterranean, Italian, or Jewish descent. Endemic KS, in sub Saharan Africa, not only affects the elderly as an indolent disease, but is frequently seen in young children as an aggressive lymphadenopathic

PAGE 13

13 tumor with high mortality rates (Ziegler and Katongole Mbidde, 1996) Iatrogenic KS affects mostly men from the same ethnic groups which are found in classical KS, but is much more aggressive than the classical form, spreading into the lymph nodes, mucosal surfaces, and internal organs (Antman and Chang, 2000) In the United States, AIDS related KS mainly affects homosexual men infected with HIV and its progression can vary from indolent to aggressive (Sanders et al., 2004) After the description of KS by Kaposi, the causative agent of KS was widely debated as being of infectious origin (Sanders, 1997) Inoculation studies with KS tissues in 1910 induced tumors in mice, and in 1938, similar studies in a human patient resulted in a bright red plaque similar to early KS; however these results were controversial (Sanders, 1997) When endemic KS was discovered in Africa (1940 1960), it was further suggested, based on its geographical restriction, that the disease was caused by an infectious agent (Mesri et al., 201 0) In 1981, a dramatic increase of KS tumors, observed in HIV positive men from New York and Los Angeles, brought awareness to the AIDS epidemic, leading many scientist to believe that KS was caused by HI V (CDC, 1 981; Gottlieb et al., 1981) Later evidence showed tha t the incidence of KS was highest in homosexual and bisexual men who contracted HIV through sexual contact versus other means (intravenous drug use or blood transfusion) indicating that a virus unrel ated to HIV could be the agent (Beral et al., 1990) Then in 1994, biopsies of KS taken from AIDS patients, were studied by representational difference analysis (RDA), a technique that compares DNA sequences from d iseased and normal tissues, leading to the discovery of unique genetic material of viral origin (Chang et a l., 1994) Closer analysis showed that the unique sequences were similar to members of

PAGE 14

14 Gammaherpesvirinae: the human Epstein Barr virus (EBV) and the primate virus herpesvirus saimiri (HVS) (Chang et al., 1994) Phylogenetic analyses of KSHV open reading frames (ORFs) placed it into the genus rhadinovirus, along with HVS, making it the first human pathogen o f this genus (Moore et al., 1996) Since the implementation of highly reactive antiretroviral therapy (HAART) for the treatment of AIDS, the rate of KSHV induced disease has dropped in most of the Western World. H owever, in underdeveloped countries, the incidence of KS and KSHV associated lymphomas still remains a serious health risk (Mbulaiteye and Engels, 2006; Mosam et al., 2009) KSHV is a Lymphotropic V irus A hallmark o f gammaherpesviruses is their ability to infect lymphocytes (B cells or T cells). The human gammaherpesviruses, EBV and KSHV, are lymphotropic for B cells. Both viruses most likely utilize B cell compartments as reservoirs for persistent infection and in a small percentage of individuals infection sometimes leads to lymphoproliferative disorders (LPDs). In addition to KS, KSHV has now been associated with two LPDs, primary effusion lymphoma (PEL) and multicentric (Cesarman and Knowles, 1999; Soulier et al., 1995) These KSHV associated neoplasms predominantly occur in immunocompromised patients that are also co infected with HIV (Boshoff and Weiss, 2002; Cesarman, 2011) The association of KSHV and PEL was made soon after the initial finding of KSHV in lymphoma samples from AIDS patients (Cesarman et al., 1995; Chang et al., 1994) These B cell lymphoma s are normally found as effusions within pleural, peritoneal, and pericardial body cavities, usually with no solid tumor mass. They have been classified as a distinct subgroup of AIDS related non Hodgkin lymphomas (NHL), and are extremely rare, only accou nting for 4% of AIDS related NHLs and 0.3% in HIV negative

PAGE 15

15 patients (Carbone and Gloghini, 2008) KSHV is present in all PEL cells, with the majority also harboring EBV (Cesarman et al., 1995; Nador et al., 1996) Based on their large cell size and other common morphologic features, PEL cells bridge immunoblastic and anaplastic large cell lymphomas (Brimo et al., 2007; Cesarman et al., 1995; Nador et al., 1996) Phenotypically, PELs are hard to characterize because they generally lack expression of surface B cell associated antigens and immunoglobulin (Ig). However, they do express the hemato poietic marker CD4 5, as well as markers linked to plasma cell differentiation (CD138/syndecan 1 and MUM/IRF4) and activation (CD30, CD38, CD71), suggesting a late B cell origin (Carbone et al., 2000; Cesarman et al., 1995; Nador et al ., 1996) In addition, sequence analysis of PEL cell Ig genes show high levels of somatic mutation, in comparison to the germline, and also show evidence of antigen selection, indicating that these cells have already transited through the germinal center (GC) (Fais et al., 1999; Matolcsy et al., 1998) Lastly, gene expression by PEL is more similar to a post GC or plasma cell, than a nave or GC B cell (Jenner et al., 2003; Klein et al., 2003) Based on these immunophenotypic and immunogenotypic properties, it is believed that PELs represent a mature B cell that has exited the GC and is arrested at a stage of post GC development (Carbone et al., 2010) Before the discovery of KSHV, it was observed that ~13% of patients with MCD developed KS for unexplained reasons (Peterson and Frizzera, 1993) When the association between KS and KSHV was uncovered, the link between MCD and KSHV infection was quickly made (Soulier et al., 1995) In 100% of HIV positive patients with MCD, KSHV infection is found; this is reduced to 50% when MCD patients are HIV

PAGE 16

16 negative (Gessain, 1997; Luppi et al., 1996) MCD is a rare atypical lymphoproliferative disorder consisting of two separate subtypes: the hyaline vascular type and the more common plasma cell type. Both types have been s hown to involve KSHV, but the majority of KSHV positive cases involve the plasma cell variant (Larroche et al., 2002) In KSHV positive cases of MCD, large plasmablasts containing KSHV genomes are located in the ma ntle zones of GCs, a feature absent from KSHV negative cases (Dupin et al., 2000) Based upon these morphological differences it has been proposed that KSHV positive MCD is a separate plasmablastic variant of the d isease (Dupin et al., 2000) Unlike PEL cells, which resemble a mature B cell origin, plasmablasts from MCD represent a nave B cell origin. This is based on the lack of somatic mutations in their rearranged Ig ge nes, suggesting that they have not undergone Ig selection in the GC (Du et al., 2001) Interestingly, MCD plasmablasts have a mature phenotype based on expression of the memory B cell marker CD27 and high expressio n of cytoplasmic IgM, two features absent in PEL cells (Du et al., 2001; Dupin et al., 2000) This mature phenotype may suggest that KSHV infection might be driving nave B cells to mature without a GC reaction. MCD plasmablasts do not express the plasma cell associated marker CD138 and the activation marker CD30, two markers commonly expressed by PEL (Du et al., 2001) Additionally, unlike the majority of PEL cells, KSHV infection in MCD is not associated with EBV co infection (Du et al., 2001; Dupin et al., 2000) These differences highlight the fact that PEL and MCD represent two distinct types of B cell lymphomas associated with KSHV.

PAGE 17

17 KSHV Lifecycle Like all herpesviruses, KSHV is an enveloped DNA virus that exists in t wo distinct phases of infection termed latent and lytic. During latency the viral genome is found in the nucleus of the host cell as multiple circularized episome s, which do not undergo productive replication and whose expression is limited to a small subset of viral genes that modulate host cell growth and inhibit immune recognition. In contrast, the lytic phase of KSHV infection is characterized by the regulated expression of the entire viral genome, leading to productive replication of the viral episomes into linear genomes, which are packaged into progeny virions and released by cell lysis resulting in cell death While latency is the default pathway in most KSHV infected cells, a small percentage undergo lytic replication (Lieberman et al., 2007) Transmission of KSHV is believed to occur mainly via saliva fro m infected individuals (Koelle et al., 1997; Mayama et al., 1998) Once inside the new host, KSHV establishes lifelong persistent infection by remaining hidden from the host immune response, mainly through latent g ene expression. The interplay between the host immune response and KSHV associated disease is highlighted by the fact that, while 2% 7% of the North American population is seropositive for KSHV, only a small fraction will ever develop KSHV associated dise ase (Ganem, 2006) Furthermore, KSHV tumorigenesis is strongly correlated with compromised immune systems, as tumors regress with immune restoration by HAART (Pellet et al., 2001; Wilkinson et al., 2002) The KSHV Genome, L atency and MiRNA P roduction KSHV shares a common genome structure with all known r hadinoviruse s including a genome size of ~170 kbp that contains a uniqu e internal sequence (~140 kbp) encoding 87 open reading frames (ORFs), which is flanked by GC rich terminal repeats

PAGE 18

18 (TR) (Russo et al., 1996) The KSHV internal sequence encodes 66 ORFs that have homol og ues in the closely related New World primate rhadinovirus, HVS (Russo et al., 1996) KSHV also encodes at least twenty genes with homology to cellular genes, a common characteristic of rhadinoviruses. The high number of cellular homologues is believed to give KSHV an advantage in hi jacking host cellular pathways without eliciting an immune response (Neipel et al., 1997) Additionally, KSHV encodes a number of unique genes designated K1 K15, not found in other rhadinoviruses (Russo et al., 1996) (Fig ure 1 1). Early studies showed that KSHV has limited gene expression in PEL and KS tumors (Renne et al., 1996; Zhong et al., 1996) Furthermore, whe n virus infected cells were isolated from these tumors and treated with the phorbol ester 12 O tetradecanoyl phorbol13 acetate (TPA), a known inducer of lytic replication in EBV, there was a dramatic increase in gene expression, indicating that the majorit y of virus is latent in these tumors (Renne et al., 1996; Zhong et al., 1996) TPA induction in PEL cells was also used to analyze latent/lytic gene expression, and revealed a cluster of three latently expressed g enes: LANA (ORF73), v cyclin (ORF72), and vFLIP (ORF71/K13) (Sarid et al., 1998) These three ORFs were found to be expressed from two major polycistronic mRNAs, latent transcript 1 and 2 (LT1 and LT2) (Dittmer et al., 1998; Sarid et al., 1999; Talbot et al., 1999) The region in which these transcripts are encoded is designated the KSHV latency associated region (KLAR). KLAR i s under the control of two promoter s LTc and LTd which are constitutively active. The two mRNAs expressed from KLAR are splic ed into a 5.4 kbp transcript (LT1), which encodes LANA, and a 1.7 kb transcript (LT2) that encodes two

PAGE 19

19 homologues of cellular proteins v cyclin and vFLIP (Dittmer et al., 1998; Sarid et al., 1999; Talbot et al., 1999 ) Functional studies have demonstrated that these latent proteins promote cell growth, either through inhibiting apoptosis (v Flip and LANA) or inducing cell cycle progression (v cyclin and LANA). LANA also plays an essential role in the establishment of latency by replicating KSHV DNA, acting as a transcriptional activator of the LTc promoter, inhibiting expression of the reactivation transcriptional activator (RTA), and maintaining viral episomes by tethering them to host chromsomes during mitosis (Ballestas et al., 1999; Hu et al., 2002; Lan et al., 2004; Renne et al., 2001) The o ther latent proteins expressed from KLAR consist of the unique kaposin family of proteins (kaposin A, B, and, C). The kaposin pro teins have varying functions, with kaposin A having transforming potential and kaposin B promoting increased secretion of pro proliferative cytokines (McCormick and Ganem, 2005; Muralidhar et al., 1998) Together, the function of these latently expressed proteins, to stimulate proliferation and inhibit apoptosis indicate that they play a major role in KSHV induced pathogenesis. In addition to latent proteins encoded in KLAR, non coding miRNAs have also been disco vered (Cai et al., 2005; Pfeffer et al., 2005; Samols et al., 2005) (Figure 1 2). In total, 12 miRNA genes were identified, all of them within the major latency associated region of the genome, giving rise to at le ast 17 mature miRNAs. Ten of the 12 genes were fo und in a single cluster and mapped to a 3.6 kbp intragenic region between K12 and ORF 71 whereas the remaining two were located within the kaposin/K12 locus (Cai et al., 2005; Pfeffer et al., 2005; Samols et al., 2005) Expression of the primary

PAGE 20

20 miRNA transcripts (pri miRNAs) is controlled by three promoters, one latent and two lytic In PEL cells all miRNAs are highly expressed during latency, and induction of lyt ic replication has only moderate effects on miRNA expression with the exception of miR K10 (Cai and Cullen, 2006; Pearce et al., 2005) These miRNAs, like the other latent gene products, function to modulate host cell growth, immunity, and maintain latent infection. MiRNA Discovery and Function MicroRNAs (miRNAs) are short RNAs of about 22 nucleotides in length that post mRNAs, t hereby inducing translational silencing. The first discovered microRNA (miRNA), lin 4 of Caenorhabditis elegans was found because of its role in a developmental timing defect (Lee et al., 1993; Wightman et al., 199 3) Functional analysis of the lin 4 gene revealed that it does not encode a protein, but instead produces two short transcripts ( 60 and 24 nucleotides in length ) (Lee et al., 1993) It was demonstrated that the lin 4 RNA induced post translational s ilencing of lin 14 a developmental control gene whose protein product is involved in the temporal regulation of cell lineage patterning in C. elegans Further work showed that the mechanism of this post transcriptional regulation was mediated through comp lementary binding of the lin 4 (untranslated region) of lin 14 (Lee et al., 1993; Ruvkun et al., 1991; Wightman et al., 1993) This novel RNA based inhibition was thought to be s pecific to C. elegans until the discovery that the let 7 miRNA was conserved in many metazoans, including humans and flies (Pasquinelli et al., 2000; Reinhart et al., 2000; Slack et al., 2000) MicroRNAs have now been isolated from

PAGE 21

21 every metazoan and plant species examined thus far, and t o date, more than 900 human miRNAs have been identified (Ambros, 2004; Griffiths Jones, 2004) In mammalian species, it has been estimate d that greater than half of all protein coding genes contain a miRNA target site, indicating their heavy impact on gene regulation (Friedman et al., 2009) Functionally, miRNAs are known to play key regulatory roles in many biological processes including, but not limited to, hematopoiesis, immune response, and apoptosis. They have also been associated with tumor formation, where their aberrant expression can be used as a signature for the clinical diagnosis of differ ent types of leukemia and lymphomas (Garzon et al., 2008) Sequences of miRNAs are highly conserved through evolution, leading to shared miRNA homologs between vastly different animal lineages. For example, a thir d of the miRNAs expressed by C. elegans have homologs found in humans (Lim et al., 2003) Recent discoveries have also shown that human miRNAs can be mimicked by viral miRNA orthologs, leading to the regulation of identical target genes (Gottwein et al., 2007; Skalsky et al., 2007) MiRNA B iogenesis and Mechanisms of Gene Regulation The first step of miRNA biogenesis occurs in the nucleus, where RNA polymerase II transcribe s miRNA coding genes into primary miRNAs (pri miRNAs) (Fig ure 1 3) Structurally, the pri miRNA consists of a double end cap structure and a polyA tail sequence. Following transcription, the pri miRNA is processed in t he nucleus by Drosha, an RNase III endonuclease, along with its cofactor DiGeorge syndrome critical region gene 8 (DGCR8). Processing occurs when the Drosha DGCR8 complex binds to and cleaves the pri miRNA, leaving a ~70nt pre miRNA hairpin loop that cont (Lee et al.,

PAGE 22

22 2003) The pre miRNA is exported out of the nucleus and into the cytoplasm by the export receptor Exportin 5 (Yi et al., 2003) Once in the cytoplasm processing of the pre miRNA i s carried out by the enzyme Dicer, a cytoplasmic RNase III endonuclease. Dicer cleaves the double stranded portion of the pre miRNA close to the base of the stem loop, thereby removing the terminal loop, and leaving a ~22nt miRNA imperfect duplex with a 5 consists of the mature miRNA, or guiding strand, while the opposite strand is considered the passenger strand and is normally not used in targeting. Generally, the strand in the duplex that incorporation into the RNA induced silencing complex (RISC), which is composed of Argonaute proteins (Schwarz et al., 2003; Tomari et al., 2004) Targeting of mRNA by RISC is mediated through Watson Crick base pairing (Lewis et al., 2005; Sta rk et al., 2003) Other parameters that influence targeting and silencing include: the anking of the target site by adenosines (Grimson et al., 2007) Unlike siRNA s, which mediate target cleavage and degradation, miRNA silencing is believed to occur through translational inhibition. The difference b etween siRNA and miRNA mediated silencing is based on the level of complementarity between the small non coding RNAs sequence and its target, with full complementarity leading to cleavage (siRNA) and partial leading to translation inhibition (miRNA) (Hutvagner and Zamore, 2002) Metazoan miRNA

PAGE 23

23 mediated translation inhibition is believed to occur by one of four separate mechanisms: inhibition of translation initiation; inhibition of translation elongation; co transla tional protein degradation; or premature termination of translation (Huntzinger and Izaurralde, 2011) While much debate still exists on the exact mechanism of translation inhibition, increasing evidence indicates th at, like siRNAs, miRNAs predominately induce target degradation (Baek et al., 2008; Guo et al., 2010; Selbach et al., 2008) Mass spectrometry studies showed that regulation of miRNA target proteins and degradation of target mRNAs are strongly correlated, with only a small number of targets showing a change in protein level without a reduction in mRNA (Baek et al., 2008; Selbach et al., 2008) Furthermore, ribosomal profilin g of target mRNAs was used to measure target protein abundance, during ectopic and endogenous miRNA targeting, results indicated that reduced target mRNAs are associated with decreased protein production indicating that mRNA destabilization and not transl ation inhibition is the predominant mechanism (Guo et al., 2010) Viral M iRNAs In 2004 Tuschl and colle agues reported the molecular cloning of five EBV (Pfeffer et al., 2004) Since then, more than 140 herpesvirus miRNAs have b e en identified Initially, three EBV miRNAs were found located within the BHRF gene (BamHI fragment H rightward open reading frame 1), and two within the BART gene (BamHI A region rightward transcript). Bioinformatic approaches, in combination with the u se of tiled arrays and molecular cloning, revealed 17 additional miRNA genes in the BART region of EBV; these genes are located within a 12 kbp region that was

PAGE 24

24 absent in the EBV strain studied in the original report (Cai and Cullen, 2006; Grundhoff et al., 2006) Recently, two additional BART miRNA genes were identified in EBV positive nasopharyngeal carcinoma (NPC) tissue samples, bringing the total number of miRNA genes to 25 (Zhu et al., 2009) BART and BHRF miRNAs are differentially expressed in lymphoid and epithelial cells and furthermore under different programs of viral latency. In epithelial cells BART miRNAs are expressed more abundantly than in B cells while BHRF miRNAs have only been detected during type III latency, when all known latency associated genes are expressed. Induction of lytic replication in latently infected BL cell lines leads to induction of a subset of EBV miRNAs. (Cai and Cullen, 2006; Cosmopoulos et al., 2009; Edwards et al., 2008; Xing and Kieff, 2007) EBV miRNAs are also expressed early after de novo infection of primary B cells, which might suggest roles in the establishment of latency (Pr att et al., 2009) In the EBV related lymphocryptovirus (LCV) of the rhesus macaque, 16 miRNAs were identified, eight of which show sequence homology to EBV miRNAs, suggesting conservation of miRNAs in this subfamily (Cai et al., 2006) After the identification of EBV miRNAs, other members of the gammaherpesvirus subfamily were found to encode miRNAs. In KSHV, four independent groups cloned 12 miRNAs from PEL derived cell l ines (as discussed in the above section). The genome of the closely related rhesus rhadinovirus (RRV), was found to encode seven miRNAs (Schafer et al., 2007) Like KSHV miRNAs, the RRV miRNAs are encoded within the latency associated region of the genome; however, their sequences are not homologous to those of KSHV. Another related gammaherpesvirus, Murine gammaherpesvirus type 68 (MHV68) encodes fifteen miRNA genes, most of which are

PAGE 25

25 embedded within tRNA suggested to be transcribed by RNA polymera se III (polIII) (Pfeffer et al., 2005) The presence of miRNA genes in betaherpesviruses has, so far, been restricted to cytomegalov iruses (CMV). Nine miRNA genes were ini tially found in human cytomegalovirus (HCMV) scattered throughout the viral genome and all being expressed from multiple promoters (Pfeffer et al., 2005) This number was la ter expanded to 11, when two additional miRNAs were identified both by cloning and bioinformatic prediction of conserved hairpins between HCMV and chimpanzee CMV (Dunn et al., 2005; Grey et al., 2005) HCMV miRNAs are readily detectable by Northern blot after de novo infection of epithelial, endothelial, and neuronal cells, even in the presence of cycloheximide, indicating that HCMV miRNAs are expressed as immediate early gene transcripts (Dunn et al., 2005) The genome of murine cytomegaloviru s (MCMV) encodes 18 miRNA genes. Quantitative analysis of viral miRNA expression after MCMV infection revealed that at early time points post infection the majority of expressed miRNAs were of viral origin (Pfeffer, 2007) CMV latency in vivo affects multiple tissues, including bone marrow. U nfortunately, due to the lack of latent tissue culture models, miRNA expression during CMV latency has not been investigated. Among alphaherpesviruses, miRNAs ha ve been identified in herpes simplex viruses 1 and 2 (HSV 1 and 1 and 2) (Burnside et al., 2006; Cui et al., 2006; Morgan et al., 2008; Tang et al., 2008; Tang et al., 2 009; Umbach et al., 2008; Yao et al., 2007; Yao et al., 2008) Interestingly, like in KSHV, alphaherpesvirus miRNA genes are located within a region expressed during

PAGE 26

26 latency. HSV latency is characterized b y the expression of the latency associated transcr ipt (LAT), a non coding transcript that is antisense to two lytic genes: ICP0, a transcriptional regulator, and ICP34.5, a neurovirulence factor (see (Bloom et al., 2010) for a review on LAT). Recently, four miRNAs (miR H2 to miR H5) were cloned fro m a variety of sources: (i) human endothelial kidney (HEK) 293 cells that ectopically express LAT, (ii) productively infected Vero cells (a cell line derived from African green monkey kidney), and (iii) latently infected trigeminal ganglia in mice (Umbach et al., 2008) One additional miRNA gene (miR H6) was located upstream of LAT in HSV 1, and 11 miRNAs were predicted to be encoded elsewhere in the viral genome but to date have not been cloned (Cui et al., 2006; Umbach et al., 2008) Most recently, Umbach and colleagues confirmed the expression of miR H2 to miR H6 in human trigeminal ganglia, and also identified two novel miRNAs (miR H7 and miR H8) als o located within LAT (Umbach et al., 2009) The genome of HSV 2 encodes three miRNAs within LAT that are positionally conserved, as compared to its close relative, HSV 1 (Tang et al., 2008; Tang et a l., 2009) Burnside and colleagues used 454 deep sequencing to identify 13 miRNAs expressed from the genome of MDV 1 (Burnside et al., 2006) These miRNAs were mapped to the inverted repeat short and long regions (IR s and IR L ) of the MDV 1 genome. Eight of these miRNA gen es are located within the meq oncogene region, whereas the others map to the LAT region (Burnside et al., 2006; Morgan et al., 2008) In the closely related MDV 2 virus, conventional cloning techniques identified 17 miRNAs which, like MDV 1, were mapped to the IR s and IR L genomic regions (Yao et al., 2007; Yao et al., 2008)

PAGE 27

27 With the exception of v ar icella zoster virus (VZV) (Umbach et al., 2009) all herpesviruses examined to date expre ss miRNAs However, the use of mass parallel sequencing to analyze small RNA libraries from virus infected cells might uncover new, less abundantly expressed, miRNAs. Despite high throughput sequencing attempts, RNA viruses (e.g. Influenza, HIV, and HCV) and cytoplasmic replica ting DNA viruses (Poxviruruses) have not been found to encode miRNAs. The absence of viral miRNAs from these viruses may reflect their inability to access nuclear Drosha and the requirement for RNA viruses to protect their genome from Drosha/Dicer processing. Herpesvirus MiRNAs Closely Resemble Their Host Cellular C ounterparts With respect to gene organization, viral miRNA genes recapitulate their cellular counterparts. They ar e organized either as single genes (e.g. in CMV) or in clusters (e.g. in alphaherpesviruses and gammaherpesviruses), the latter allowing for co regulated expression To date there is no evidence that herpesviral proteins are involved in viral miRNA maturat ion, which is strictly dependent on Drosha/DGCR8 and Dicer processing ( Fig ure 1 3 ). Viral miRNA and host miRNA sequences can be located within introns or exons of protein encoding genes. The relative genomic location of the pre miRNA and surrounding spli ce donor/acceptor sites might lead to competition between miRNA maturation and mRNA splicing, like it occurs for cellular genes. For example, the EBV BART miRNAs, which are located within introns of a multiple spliced transcript, are processed prior to sp licing, thereby suppressing the usage of surrounding exons. It is not clear whether a single BART transcript can give rise to an intron encoded miRNA and a fully processed mRNA (Edwards et al., 2008)

PAGE 28

28 One hallmark of cellular miRNAs is that ~30% are highly conserved across species. For in stance, eight of 29 EBV miRNAs showed sequence similarity to those of its close relative LCV (Cai et al., 2006) In contrast, no homology was noted between KSHV and RRV miRN As (Schafer et al., 2007) In this case, one possible ex planation is that, in rhesus macaques and chimpanzees two different rhadinoviruses (RRV1 and RRV2) exist, while to date only one human rhadinovirus strain (KSHV) has been identified. If miRNA function is important for viral biology then the corresponding sequ ences would likely co evolve with their respective host target sequences (Sood et al., 2006) Hence, answering the question whether viral miRNAs are conserved will be greatly aided by understanding their targets and function. Thus far, sequence analysis of both EBV and KSHV miRNA gene loci from a large number of cell lines and primary isolates revealed very few polymorphisms, which suggest in vivo selection for intact miRNA genes; albeit indirect, this constitutes a genetic argument for biological function (Marshall et al., 2007) KSHV MiRNA Targets and F unction The majority of identified viral miRNAs are encoded by herpesviruses, suggesting that they play an essential role in the herpesvirus lifecycle. Because KSHV miRNAs are nonimmunogenic and have the capacity to regulate a large number of targets, they represent ideal tools for hijacking the host cellular responses to viral infection. Understanding the functions of KSHV miRNAs requires the determination of target genes, which can be viral and/or cellular. To identify a valid target, bioinformatic approaches are usually used in combination with experimental functional assays. However, targets for KSHV miRNAs have largely been determined by unbiased gene

PAGE 29

29 expression profiling studies rather than bioinformatic prediction (Gottwein et al., 2007; Samols, 2007; Skalsky et al., 2007; Ziegelbauer et al., 2009) While the initial reports identifying KSHV miRNAs predicted many gene targets (Cai et al., 2005; Gottwein et al., 2007; Pfeffer et al., 2005; Samols, 2007; Skalsky et al., 2007; Ziegelbauer et al., 2009) the number of experimentally validated targets is still modest (Table 1 1). Based on the current list of v alidated targets for KSHV miRNAs, it is apparent that they function to modulate several fundamental cellular processes: angiogenesis, cell cycle, immunity, apoptosis, and key steps in the herpesvirus life cycle; latency and the switch from latent to lytic replication. The first published host cell target for KSHV miRNAs was the gene coding for thrombospondin 1 (THBS1), a tumor suppressor and antiangiogenic factor that is reported to be down regulated in KS lesions (Samols, 2007) Samols and colleagues ge nerated HK 293 cells expressing 10 KSHV miRNAs and found 65 genes that showed regulated genes had a high frequency of seed that contained luciferase reporter assays and Western blot analysis, direct targeting and repression of THBS1 expression by several KSHV miRNAs (miR K12 1, miR K12 3 3p, miR K12 6 3p and miR K12 11) wa s demonstrated. This was the first example of multiple viral miRNA repression of THBS1 translate angiogenesis is a hallmark of KS, the finding that KSHV miRNAs target a strong

PAGE 30

30 inhibitor of angiogenesis suggests that KSHV miRNAs contribute to pathogenesis (Samols, 2007) To promote cell viability and prolife ration during infection, herpesviruses not only inhibit apoptosis but also modulate cell cycle regulation. The first evidence for KSHV miRNA cell cycle regulation was the finding that KSHV miR K1 targets p21, a p53 inducible gene that functions as a cell c ycle inhibitor and tumor suppressor (Gottwein and Cullen, 20 10) Knockdown of endogenous miR K1, with miRNA sponges in KSHV infected cells, resulted in a modest increase of p53 mediated cell cycle arrest, implicating miR K1 in cell cycle regulation and pathogenesis. The ability of KSHV to repress host immune resp onses is essential for persistent infection. The importance of immune regulation is underscored by the fact that almost a quarter of the KSHV genome (22 ORFs) ha s an immune modulatory function (Areste and Blackbourn, 2009) Experimental evidence now suggests that KSHV miRNAs also play an important role in immune modulation by directly inhibiting cytokine expression, the antiviral interferon response, and immune cell reco gnition. KSHV miRNAs miR K12 3 and miR K12 7, when ectopically expressed in human myelomonocytic and murine macrophage cell lines can increase secretion of host cytokines IL 6 and IL 10, which are highly expressed in KS lesions (Qin et al., 2010) Bioinformatic analysis in com bination with antagomir based derepression assays demonstrated that miR K12 3 and miR K12 that functions as a negative transcriptional regulator of IL 6. Although these cytokines have broad functions in suppressin g the activity of multiple immune cell types including

PAGE 31

31 T cells, NK cells, and dendritic cells, their impact during natural KSHV infection needs to be further tested (Cirone et al., 2008; Moore et al., 2001; Mosmann, 1994) An additional study demonstrated that ectopic expression of KSHV miR K10a, in primary endothelial cells, markedly reduced productio n of the pro inflammatory cytokine IL 8 and monocyte che moattractant protein 1 (MCP 1) by targeting tumor necrosis factor (TNF) like weak inducer of apoptosis receptor (TWEAKR) (Abend et al., 2010) Curiously, these pro inflammatory cytokines are induced by KSHV proteins (vFLIP and vGPCR) and may promote tumorigenesis (Schwarz and Murphy, 2001; Sun et al., 2006) To integrate these paradoxical observations, the au thors hypothesize that miR K10a dependent regulation of IL 8 and MCP 1 may provide a mechanism that fine tunes cytokine expres sion to levels beneficial for the virus, without eliciting a strong immune response (Abend et al., 2010) Recently, it was shown that KSHV miR K12 11 targets I kappa B kinase epsilon olecule in the antiviral interferon response pathway (Liang et al., 2011) K12 11 without any confounding effects of other KSHV immune regulatory p roteins, miR K12 11 transduced lung cancer cells were infected with two RNA viruses, Sendai virus (SeV) and vesicular stomatitis virus (VSV), which strongly induce the interferon response. Results showed that upon infection, miR K12 11 expressing cells had markedly attenuated interferon signaling and enhanced VSV titers. Elimination of virally infected cells by NK cells or CD8+ T cells involves cell receptor recognition of ligands expressed by KSHV infected target cells. KSHV miR K12 7 was shown to target the major histocompatibility complex class I r elated chain B

PAGE 32

32 (MICB), a stress induced ligand recognized by the NKG2D receptor expressed by NK cells and CD8+ T cells (Nachmani et al., 2009) The functional impact of this regulation was tested using a miRNA sponge to inhibit miR K12 7 targeting in virally infected cells, which resulted in increased NK cell killing. Interestingly, it has also been shown that miRN As encoded by HCMV and EBV regulate MICB expression to i nhibit NK cell killing (Nachmani et al., 2009; Stern Ginossar et al., 2007) These data strongly suggest that miRNA dependent regulation of MICB is important for herpesviral persistence, which is further underscore d by the fact that both HCMV and KSHV encode proteins that inhibit MICB surface expression (Dunn et al., 2003; Thomas et al., 2008) In addition, the observation that HCMV EBV and KSHV encoded miRNAs target th e MICB gene by completely different sequences raises a very interesting question about the co evolution of viral miRNAs and their corresponding cellular targets. Recently, Ganem and colleagues reported a highly comprehensive tandem array approach to identi fy miRNA targets, utilizing gene expression profiling in endothelial cells after de novo infection, and in B cells that ectopically expressed individual, or various sets of, miRNAs (Ziegelbauer et al., 2009) For a gene to be recognized as a potential target, its expression had to be reduced in the cells expressing ectopic miRNA, but increased in latently infe cted PEL cells transfected with the corresponding antagomir (Ziegelbauer et al., 2009) For each KSHV miRN A, about 10 to 30 host genes fulfilled these criteria. Analysis of miR K5 revealed 11 gene targets, including Bcl 2 associated factor (BCLAF1), and this was studied in more detail. BCLAF1 functions as a transcriptional repressor and can mediate apoptosis when over expressed (Kasof et al., 1999) In addition to miR K5, both miR K12 9 and miR K12 10b were also found to

PAGE 33

33 target and regulate the expression of BCLAF1 (Ziegelbauer et al., 2009) Ziegelbauer and colleagues demonstrated that miR K5, miR K12 9 or miR K12 10b transfected into human umbilical vein endothelial cell s (HUVEC) were able to inhibit etoposide induced caspase activation, thereby suggesting that miRNA repression of BCLAF1 inhibits apoptosis. Interestingly, increased etoposide induced apoptosis was observed when HUVEC cells were plated at a lower density a nd then transfected with the same KSHV miRNAs, indicating that BCLAF1 can have anti apoptotic activity under particular growth conditions. Although the suggestion that BCLAF1 might have an anti apoptotic function was at first counterintuitive, the researc hers went on to find that BCLAF1 expression in latently infected PEL cells could inhibit lytic virus replication. In addition, inhibiting KSHV miRNA targeting of BCLAF1 with antagomirs resulted in decreased lytic reactivation in KSHV infected endothelial c ells (SLK). Together, these data suggest that targeting BCLAF1 sensitizes latently infected cells to signals that induce reactivation from latency. Hence, miR K5 provides the first example by which targeting of a host gene contributes to latency control. In contrast to a lytic role, KSHV miRNAs have also been reported to promote latency. T he viral replication and transcription activator (RTA), a master regulator of lytic reactivation, has been shown to be regulated either directly or indirectly by multi ple viral miRNAs. Two independent studie s, using similar KSHV bacmid 36 derived recombinant viruses that lack 10 of 12 miRNA genes, reported elevated expression of lytic genes, including RTA, during de novo infection in separate cell lines (Lei et al., 2010; Lu et al., 2010b) To determine the mechanism leading to increased lytic gene expression Lu et al. screened the individual KSHV miRNAs, using miRNA expression

PAGE 34

34 plasmids, for their ability to target a RTA lucifer ase construct and found that miR K5 can K5 seed sequence. Additionally, Lu et al. carried out genome wide epigene tic analysis of the miRNA knock out virus and found drastically reduced r epressive marks on histones along with a global reduction of DNA methylation, suggesting that epigenetic modifications induced by viral miRNAs may contribute to the maintenance of latency. Searching for a mechanism to explain these modifications, Lu et al. found that miR K12 5p targets retinoblastoma (Rb) like protein 2 (Rbl2), a negative regulator of DNA methyltransferases, thereby leading to an increase in DNA methylation. This is the first reported evidence that viral miRNAs can directly impact the epige netic status of herpesvirus genomes during latency. In the second study, Lei et al. also found an increase in RTA mRNA expression in cells infected with a very similar KSHV miRNA knockout virus, but they did not identify y miR K12 5p or any other KSHV miRNA (Lei et al., 2010; Lu et al., 2010b) Instead, Lei et al. showed that miR K1 targets the host gene hibit lytic reactivation and, in the case of PELs, contributes to cell survival (de Oliveira et al., 2010) reactivation can be regulated by KSHV miR K12 I/B (NFIB) (Lei et al., 2010; Lu et al., 2010a) As mentioned before miR K12 11 targeting (Lei et al., 2010) This same study found that inhibiting miR K12 11, with an anti miR K12 11 sponge, leads to an

PAGE 35

35 increa se in lytic gene expression (RTA and ORF65) in bac mid infected A549 cells. The chemical agent that triggers lytic reactivation, was used. Using lentiviruses to express in dividual KSHV miRNAs in BC3 cells, Lu et al. found that miR K1, K3, K7, and K11 were all capable of moderately decreasing RTA mRNA levels (Lu et al., 2010a) MiR K3 showed the greatest effect on RTA, and further investigation found that it directly targets NFIB, a cellular transcription factor that had previously been shown to reactivate KSHV when overexpressed (Yu et al., 2007) Further analysis identified that the promoter of RTA contains a putative NFIB binding site and that ectopic NFIB expression could activate an RTA promoter construct. Additionally, shRNA knockdown of NFIB res ulted in decreased RTA expression. This study provides indirect evidence that miR K3 maintains latency by targeting NFIB, but further experiments using anti miR K3 antagomirs or a miR K3 knockout virus are needed to prove this mechanism. In addition to i ndirectly regulating RTA expression two separate studies have demonstrated that miR K12 9* and miR K12 7 5p can directly target and regulate RTA expression through seed match binding (Bellare and Ganem, 2009; Lin et al., 2011) Using luciferase constructs, contai and KSHV miRNA mimics, Bellare et al. identified that miR K9* directly targets RTA through a canonical 6mer seed match site. Furthermore, when miR K9* function in latently infected cel ls was inhibited with specific antagomirs a moderate increase in lytic reactivation, was observed. In a separate study by Lin et al., which used KSHV miRNA expression plasmids instead of miRNA mimics, miR K9* and miR K12 7 5p were also found to target RTA (Lin et al.,

PAGE 36

36 2011) Lin et al. further show that miR K12 7 5p targeting of RTA is mediated through a 7mer seed match site and that ectopic expression of miR K12 7 5p in latently infected cell lines reduces the amount of progeny virus produced. In summary, these studies len d further credence that KSHV miRNAs directly regulate RTA expression during latency. However, while some studies hypothesize that KSHV miRNAs function as major regulators of latency, Bellare et al. suggest that these miRNAs may provide a mechanism for fin e tuning and/or sensitizing latently infected cells to stimuli that trigger lytic replication. KSHV miRNA regulation is an emerging component of the complex relationship that governs viral host interactions. From the targets identified to date (Table 1 1) it is apparent that viral miRNAs play an important role in the biology of the virus and contribute to overall pathogenesis associated with KSHV infection. However, determining the targets of these miRNAs is only one step in understanding their function Because KSHV miRNA regulation is likely dependent on the context of infection (i.e. cell type and viral genome expression), future studies using recombinant viruses, appropriate cell lines, and where available animal models are needed to further underst and their impact on viral pathogenesis in vivo KSHV MiR K12 11 is an Ortholog of Human M iR 155 The ability of herpesviruses to pirate host cellular genes into their genome for biological benefit is a hallmark of herpesvirus evolution. Although only on e example of a herpesvirus pirating a host pre miRNA has been reported (Waidner et al., 2009) statistical analysis of seed sharing between human herp esvirus miRNAs and human miRNAs revealed a high probability of co nservation (Grundhoff and Sullivan, 2011) Because the seed sequence is the most important parameter for miRNA target binding,

PAGE 37

37 it is n ot surprising that herpesvirus miRNAs may co evolve their seeds with host miRNAs i n order to hijack their function. Currently, the only functional evidence of this seed sharing exists for the human miR 155 and KSHV miR K12 11. Data from our lab and the Cullen grou p revealed that KSHV miR K12 11 shares 100% seed sequence homology with h uman miR 155 (Gottwein et al., 2007; Skalsky et al., 2007) Because the seed sequence is the most important parameter in mRNA target recognition (Grimson et al., 2007) it wa s predicted that both miRNAs might target an overlapping set of host genes. Gene expression profiling in two separate cell lines, express either miR 155 or miR K12 11 identif ied a common set of downregulated gene targets. Further computational analysis found that one gene, BACH1, contained four (Gottwein et al., 2007; Skalsky et al., 2007) Targeting and i mutagenesis and Western blot analysis. Importantly, PEL derived cell lines that express high levels of miR K12 11, but not miR 155, expressed very low BACH1 levels. BACH1 is a transc riptional repressor that has been shown to repress expression of heme oxygenase 1 (HMOX1), a protein that enhances cell survival and proliferation (Igarashi and Sun, 2006) Because KSHV has been reported to directly increase HMOX1 levels during endothelial cell infection, these studies suggest that miR K12 11 could contribute to HMOX1 upregulation by inhibiting the expression of its transcriptional repressor BACH1. The other potential targets found in the computatio nal analysis include genes involved in cell signaling, cell division, T cell activation, and apoptosis. While the impact

PAGE 38

38 of miR K12 11 regulation on these targets needs further investigation, it is apparent that miR K12 11 can hijack cellular pathways reg ulated by miR 155. While many metazoan miRNAs share complete sequence homology across closely related species, viral miRNAs do not appear to share this conservation (Grundhoff and Sullivan, 2011) However, in additio n to KSHV miR K12 11, the lymphotropic alphaherpesvirus, MDV, also encodes a miRNA (mdv1 miR M4) that functions as a miR 155 ortholog. I n vivo functional analysis of mutant MDV viruses which contain a non functional or deleted miR M4 revealed that this mi RNA plays an essential role in the induction of T cell lymphomas in birds (Zhao et al., 201 1) Based on these separate findings, in two unrelated herpesviruses, it appears that the development of herpesvirus miR 155 orthologs is an important adaption How miR K12 11 phenocopies miR 155 function during KSHV B cell infection and how it promotes pathogenesis will be further discussed in Chapters 2 and 3. MiR 155 in Hematopoietic Development and D isease Systematic analysis of miRNA expression, using microarrays and high throughput sequencing, has revealed insights into the expression patterns of s pecific miRNAs during hematopoiesis (Chen et al., 2004; Georgantas et al., 2007) One miRNA in particular, miR 155, has been shown to be differentially expressed during lineage specific cell differentiation. Mir 1 55 is processed from the non protein coding gene bic ( B cell integration cluster), which is a common retroviral integration site originally identified in chicken B cell lymphomas (Tam et al., 1997) Moderate expres sion of miR 155 was detected in early human CD34+ hematopoietic stem progenitor cells (HSPCs) analyzed by microarray (Georgantas et al., 2007) In mature peripheral B cell s, T cells, monocytes, and granulocytes the expression of miR 155 is detected at much lower

PAGE 39

39 levels compared to their progenitors (Merkerova et al., 2008; Ramkissoon et al., 2006) In vitro colony forming assays revealed that overexpression of miR 155 in hum an CD34+ progenitor cells, using lentiviral transduction, can cause a decrease in myeloid and erythroid colony formation (Georgantas et al., 2007) Based on miR differential expression during hematopoiesis an d its ability to influence cell lineage specification, it appears that miR 155 plays an important role at different stages of hematopoiesis. Recent studies have shown that miR 155 is an important component of immune activation and function in mature B cell s. Bic expression was originally detected in human germinal center (GC) B cell s and activated T cells by Northern blot and RNA in situ hybridization (RNAish) (Tam, 2001; van den Berg et al., 2003) Studies investi gating the mechanisms for bic /miR 155 induction revealed that murine B cell s, activated by in vitro BCR, CD40, or Toll like receptor (TLR) stimulation, show increased transient production of this miR 155 (Thai et al. 2007) An increase in miR 155 was also detected in primary murine macrophages, after in vitro stimulation of their antigen receptors (O'Connell et al., 2007) This enhanced upregulation of bic/miR 155, in response to events mimicking innate or adaptive immune activation, points to a cellular role for miR 155 in which its expression might be needed to regulate imm une pathways. However, to date the re are no studies that have examined this pattern of miR 155 upregulat ion in human B cells or macrophages. To further define the in vivo function of miR 155 during these immune responses, loss of function experiments using miR 155 germline deficient mice and B cell specific miR 155 knockout mice were developed (Rodriguez et al., 2007; Thai et al., 2007;

PAGE 40

40 Vigorito et al., 2007) Both mouse models appeared to have normal B cell development during steady state (non in flammatory) conditions, but after immunization with either T cell dependent (TD) or T cell independent (TI) antigen, B cell s were impaired in their ability to form germinal centers (GC) and to produce class switched antibodies (Rodriguez et al., 2007; Thai et al., 2007) In order to define the cellular mechanisms that were contributing to these defects, gene expression profiling was performed on activated B cell s isolated from these transgenic mice (Vigorito et al., 2007) Approximately 60 upregulated genes were identified that contained a miR 155 binding site (Vigorito et al., 2007) The authors of this study predicted that direct ta rgets of miR 155 are those which have higher mRNA expression in the absence of miR 155. However, this prediction does not eliminate the possibility that some of these upregulated genes could actually be indirect targets, whose expression is not regulated by the miRNA itself, but by other proteins that are direct targets of miR 155. Regardless of this fact, further analysis of two miR 155 targets identified by this study, PU.1 and activation induced deaminase ( AID ) has provided insight into the B cell gen e regulatory pathways regulated by miR 155. Based on its overexpression pattern i n a number of B cell lymphomas and its ability to induce both myeoloproliferative and B cell lymphoproliferative malignancies in separate mouse models; miR 155 has been ch aracterized as an on comir, a miRNA with tumorigenic activity (Costinean et al., 2006; Eis et al., 2005; Kluiver et al., 2005; O'Connell et al., 2008; van den Berg et al., 2003) Insights into the mechanisms of miR 155 induced tumorigenesis have been provided by studies that identified CCAAT enhancer ( Src homology 2 domain containing inositol 5

PAGE 41

41 phosphotase (SHIP 1) as miR 155 targets in tumor cells (Costinean et al., 2009; O'Connell et al., 2009) In both studies, miR 155 was shown to reduce expression of in vitro which correlat 1 protein levels in leukemic B cells. 6, a cytokine that promotes B cell proliferation and is involved in p lasma cell differentiation (Jego et al., 2001) IL 6 has also been shown to promote the growth of malignant B cells in PEL, MCD, and multi ple myeloma (Asou et al., 1998; Foussat et al., 1999; Klein et al., 1995; Oksenhendler et al., 2000) isoforms: two separate liver enrich ed transcriptional activator proteins (LAP 1 and 2) and the negative repressor liver inhibitory protein (LIP). Regulation of IL 6 expression 6 promoter by LAP and transcrip tional repression by LIP (Zahnow et al., 1997) Deregulated IL 6 dependent B cell lymphomagenesis (Screpanti et al., 1996; Screpanti et al., 1995) SHIP 1 also negatively regulates IL 6 expression in hematopoietic cells, but only one study has examined this function in B cells (Khaled et al., 1998) The ability of miR 155 to target two regulators of IL 6 expression and signaling, suggests that one component of miR 6 activity. Because IL 6 also play s an essential role in KSHV associated PEL and MCD, IL 6 deregulation initiated by KSVH miR K12 11 hijacking of miR 155 in these malignancies is an intriguing premise.

PAGE 42

42 Subsequent studies have also identified and val idated the following miR 155 targets : SMA D2, SOCS1, Ets 1, and Meis1 (Ceppi et al., 2009; Jiang et al., 2010; Louafi et al., 2010; Lu et al., 2008; Romania et al., 2008) From these targets only the tumor suppressor SOCS1 has been implicated in tumorigene sis, with the other targets playing roles in cell signaling and differentiation pathways in macrophages and dendritic cells. While these target genes are also expressed in B cells, the impact of their regulation by miR 155 has not been reported. From the increasing amount of validated miR 155 targets, it is apparent that miR 155 exerts its function by regulating a large set of gene targets, leading to the modulation of a variety of B cell development, pro growth, and anti apoptotic pathways. It still rem ains to be seen if these targets involved in normal cell function are also involved in promoting tumorigenesis. Nonetheless, miR 155 has a heavy impact on the regulation of the cellular transcriptome during hematopoiesis suggesting that miR K12 11 hijack ing of miR 155 function may be an invaluable tool for KSHV during B cell infection. Does MiR K12 11 Share a Homologues Function with M iR 155? Based upon miR B cell activation and differentiation as well as its oncogenic po tential, we hypothesize that miR K12 11 can play a similar role during KSHV B cell infection, thereby contributing to PEL and MCD pathogenesis and potential transformation. To investigate the oncogenic potential of miR K12 11 as a functional mimic of miR 155, I have developed an in vivo approach discussed in Chapter 2. Because miRNA function is dictated by their targets, I have used a combination of in vitro approaches discussed in Chapter 2 and 3, to identified overlapping miR 155 and miR K12 11 targets whose dysregulation during B cell d ifferentiation might directly contribute to KSHV pathogenesis. The ability of miR K12

PAGE 43

43 11 to directly inhibit B cell differentiation is investigated using in vitro B cell models of plasma cell differentiation discussed in Chapter 3. Lastly, in Chapter 4, I will discuss ongoing studies to examine how miR K12 11 manipulates IL 6 production to promote KSHV pathogenesis.

PAGE 44

44 Table 1 1 KSHV miRNA targets miRNA Target Function miR K12 11 miR K12 7 miR K12 3 miR K12 7 miR K1 2 11 miR K12 5 miR K12 9 miR K12 10b miR K12 1 miR K12 3 3p miR K12 6 3p miR K12 11 miR K1 miR K1 miR K10a miR K12 11 miR K12 4 5p miR K3 miR K5 miR K9* miR K12 7 5p Host BACH1 Host MICB Host BCLAF1 Host THBS1 Host p21 Host Host TWEAKR Host Rbl2 Host NFIB Viral RTA Transcriptional regulator NK cell ligand Inhibits IL6 and IL10 expression Promotes Lytic reactivation Tumor Suppressor Cell cycle inhibitor Inhibits NF Tumor necr osis factor receptor Interferon signaling molecule Transcriptional repressor Transcriptional activator Master lytic switch

PAGE 45

45 Figure 1 1. The KSHV Genome Open reading frames (ORFS) are labeled in color based on their expression pattern during latent, immediate early, early, or late infection. The KSHV latency associated region (KLAR) is underlined in blue and the miRNA genes are labeled in orange.

PAGE 46

46 Figure 1 2. KSHV miRNAs are encoded in the KSHV latency associated region (KLAR). The late nt genes in KLAR are in orange with the direction of latent transcription denoted by orange arrows. Latent p romoters are indicated by the black directional arrows. The miRNA cluster contains 10 miRNA genes and downstream of the cluster are 2 additional m iRNA genes are encoded.

PAGE 47

47 Figure 1 3. Biogenesis of miRNAs. Genes encoding miRNAs are generally transcribed from polII promoters. The majority of miRNAs are encoded in introns, but a small percentage are encoded in exons of protein coding genes. MiRNA g enes can occur either as (i) clusters of multiple hairpins or as a (ii) single hairpin structure. The hairpins in primary transcripts (pri miRNAs) are recognized by Drosha/DGCR8, a RNase III type endonuclease, which 80 nt hairpin, termed pre miRNA, is rapidly exported from the nucleus to the cytoplasm via the Exportin5/RAN GTPase pathway. The pre miRNA is now recognized by a cytoplasmic RNase III type endonuclease, Dicer, which i s also known to cleave dsRNA to create siRNA. Dicer cleaves off the bulged end of the hairpin now forming a short dsRNA with each end having a two incorporation of one strand of the short RNA duplex into the RNA Induced Silencing Complex (RISC) to form a mature miRNA. Both strands can be incorporated into RISC and as a consequence many miRNA genes encode two mature miRNAs. Once the mature miRNA is incorporated into RISC, it UTR of mRNAs that contain complementary sequences. It has been observed that positions 2 8 of the miRNA are most important for targeting of mRNAs; this site is referred to as the miRNA seed sequence.

PAGE 48

48 CHAPTER 2 A KSHV ENCODED ORTHOLOG OF MIR 155 INDUCES H UMAN SPLENIC B CELL EXPANSION IN NOD/LTSZ SCID IL2R NULL MICE MicroRNAs (miRNAs) are small non coding RNAs, 22 24 nucleotides in length, that mediate post transcriptional gene repression by binding to the 3' untranslated region (UTR) of target mRNAs (Bartel, 2009) MiRNAs are expressed by a diverse range of organisms which include all metazoa and many plant species (Grimson et al., 2007) Functionally, miRNAs are key regulators of many biological process es including but not limited to embryonic development, hematopoie sis, immunity, and apoptosis. Their importance in regulating these processes is further underscored by their association with oncogenesis; for example, aberrant expression of miR 155 and members of the miR 17 92 family contribute to tumor formation in mul tiple types of leukemia and lymphomas (Garzon et al., 2008) Recently, DNA viruses were found to encode miRNAs, including all three families of herpesviruses ( ) (for review see (Boss et al., 2009) ). Our group and others identified that the gammahe rpesvirus KSHV encodes a total of 12 miRNA genes all located within the KSHV latency associated region (KLAR) (Cai et al., 2005; Grundhoff et al., 2006; Pfeffer et al., 2005; Samols et al., 2005) KSHV is lymphotr opic, establishes latency in B cells (Whitby et al., 1995) and is associated with the vascular tumor KS and two B cell lymphoproliferative malignacies: prima ry effusion lymphoma (PEL) and m isease (MCD) (Cesarman and Knowles, 1999; Chang et al., 1994; Du et al., 2002; Soulier et al., 1995) The majority of cells in these malignancies are latently infected, and during this stage the viral genome expres ses only a limited number of genes, including the viral miRNAs (Dittmer et al., 1998;

PAGE 49

49 Staskus et al., 1997) KSHV latent proteins regulate cellular pathways to inhibit apoptosis, induce cellular proliferation, and modulate cytokine responses, but the roles of KSHV miRNAs in pathogenesis are still being characterized (for review see (Dourmishev et al., 20 03) ). Insights into the pathogenic nature of these viral miRNAs have been provided by findings that they target host genes involved in tumorigenesis, cellular differentiation, immunity and apoptosis (Hansen et al., 2010 ; Nachmani et al., 2009; Qin et al., 2010; Samols, 2007; Ziegelbauer et al., 2009) The most essential parameter for miRNA regulation of mRNA expression is 7) and the t arget transcript (Bartel, 2009) Recently, we and oth ers reported that KSHV miR K12 11 shares 100% seed sequence homology with the human oncomir miR 155 and can regulate an overlapping set of genes in cell lines engineered to express miR 155 or miR K12 11 (Gottwein et al., 2007; Skalsky et al., 2007) This was an important finding because miR 155 dependent regulation is important during hematopoiesis of different lineages, including B cells (for review see (Baltimore et al.) ), and deregulated miR 155 expression has been implicated in the formation of B cell tumors (Costinean et al., 2006) virus (MDV), also encodes a miRNA (mdv1 miR M4) that shares seed sequence homology with miR 155 and, like miR K12 11, is capable of regulating an overlapping set of miR 155 mRNA targets (Morgan et al., 2008; Zhao et al., 2009) Moreover, in vivo functional analysis of mutant MDV viruses which contain a non functional or deleted miR M4 revealed that this miRNA plays an essential role in the induction of T cell lymphomas in birds (Zhao et al., 2011) Interestingly, two separate viruses that

PAGE 50

50 cause B cell lymphomas; Epstein Barr virus (EBV), a transforming human gammaherpesvirus closely related to KSHV, and the oncogenic retrovirus, reticuloendotheliosis virus strain T (REV T), do not encode miR 155 orthologs but induce miR 155 expression during infection (Bolisetty et al., 2009; Cameron et al., 2008; Gatto et al., 2008; Jiang et al., 2006; Mrazek et al., 2007) Furthermore, a recent study found that inhibiting miR 155 function in two EBV positive B cell lines resulted in decreased proliferation and increased apoptosis, providing evidence that miR 155 plays a n important role during B cell immortalization (Linnstaedt et al., 2010) While these studies have confirmed the oncogenic potential of miR 155 and miR M4 during viral i nfection, the miRNA targets responsible for these phenotypes have not been reported. Based on the roles of miR 155 and its ortholog miR M4 in virally induced immortalization and lymphomagenesis we hypothesize that KSHV miR K12 11 also plays a similar rol e in promoting KSHV pathogenesis. To directly address this, we examined the effects of ectopic miR K12 11 and miR 155 expression in human hematopoietic stem cells (HSCs) during immune reconstitution using the NOD/LtSz scid IL2R null mouse model. This is the first in vivo study using a humanized mouse model to examine the function of miR K12 11 during hematopoiesis. In brief, human cord blood (CB) derived CD34+ progenitors were retrovirally transduced with miRNA/GFP expression vectors and transplanted int o sublethally irradiated mice. FACS and histology results show that ectopic expression of either miR K12 11 or miR 155, leads to a significant expansion of the hCD19+ B cell population in the spleen. To gain further insight into the mechanisms contribut ing to this expansion we analyzed RNA from harvested splenocytes for expression of validated miR 155 targets involved in

PAGE 51

51 lymphomagenesis and B cell development and found that CCAAT enhancer binding 6, is repre ssed (Costinean et al., 2009) Moreover, inhibiting miR K12 11 function with specific antagomirs in two separate PEL that miR K12 1 1 contributes to human B cell expansion in part by regulating the miR role in promoting KSHV B cell pathogenesis. Results Transduction of human CB CD34+ cells with miR K12 11 and miR 155 expressing foamy virus vectors and their engraftment into NOD/LtSz scid IL2R null mice. To ectopically express the miRNAs in human CB CD34+ progenitors, we constructed foamy virus vectors that contain miR K12 11 or miR 155 pri miRNA se quences downstream of EGFP ( Figure 2 1 A ). MiRNA expression from these vectors was analyzed in 293 cells by performing luciferase reporter assays, as previously described (Skalsky et al., 2007) Transfection of the miR K12 11 or miR 155 expression vectors resulted in a dose dependent inhibition of luciferase activity, while transfection of a control vector did not, confirming that miR K12 11 and miR 155 pre miRNAs are efficiently processed into mature miRNAs ( Figure 2 1C ). Human CB CD34+ progenitors were retrovirally transduced and monitored for GFP expression in colony forming assays. GFP expressing colonies were detected 14 days later indicating successful transduction in vitro For immune reconstitution, 2 x 10 5 transduced CB progenitors were transplanted by tail vein injection into groups of sublethally irradiated NOD/LtSz scid IL2R null mice (8 mice for each miRNA and 4 for

PAGE 52

52 EGFP vector control). At 14 weeks post reconstitution bone marrow (BM) and spleen were harvested from mice for fluorescence activated cell sorting (FACS) and histological analysis. GFP expression was detected in hCD45+ leukocytes harvested from both the bone marrow and spleen, indicating successful human hematopoietic engraftment of transduced cells in all mice ( Figure 2 2 ). Ectopic expression of miR K12 11 and miR 155 in cells harvested from BM and spleen To validate miR K12 11 and miR 155 expression in the BM and spleen of engrafted mice total RNA was analyzed by stem loop qRT PCR assays. As expected, miR K12 11 was only detected in the BM and spleen of miR K12 11 engrafted mice ( Figure 2 3A), while ectop ic miR 155 expression was highest in the BM and spleens of miR 155 engrafted mice ( Figure 2 3B). Interestingly, the relative increase in ectopic miR 155 expression in the spleen was higher (1 1.5 fold) than the increase detected in the BM (0.4 1.2 fol d), possibly indicating that the majority of cells ectopically expressing miR 155 had already migrated to the spleen at this time point. We next compared the absolute levels of miR K12 11 expression in splenocytes (hCD19+ GFP positive) versus PEL cells. MiR K12 11 miRNA expression was at similar or lower levels than those observed in BCBL1 ( Figure 2 3C). These data confirm ectopic expression of miR K12 11 and miR 155 in the engrafted mice and furthermore, demonstrate that we are not overexpressing these miRNAs in our model system. Expression of either miR 155 or miR K12 11 does not affect cell lineage populations in the bone marrow at 14 weeks post transplantation. To ask whether ectopic expression of miR 155 or miR K12 11 affects hematopoiesis in the bon e marrow we performed cell lineage analysis by FACS. Results indicated that the

PAGE 53

53 majority of cells in all mice were human CD45+ leukocytes indicating successful engraftment. Although we observed a modest increase of hCD45+ leukocytes in miR K12 11 (80.2 + 10.6%) and miR 155 (83.7 + 4.5%) expressing mice when compared to vector controls (70.8 + 18.3%), these differences were not statistically significant across all animals ( Figure 2 4A). We further characterized the various subpopulations of human leukocy tes based on cell surface expression of hCD19 (B cells), hCD33 (myeloid cells), and hCD3 (T cells) ( Figure 2 4 B, C, and D). The hCD19+ B cell population represented the predominant lineage with higher levels found in mice expressing miR K12 11 (61 + 12.6 %) and miR 155 (62.1 + 4.9%) as compared to the vector control (52.2 + 17.4%), but again this trend was not statistically significant across all animals ( Figure 2 4B) In contrast to the large number of hCD19+ B cells in the BM, the fraction of hCD33+ mye loid cells in the miR K12 11 (14 + 5.7%), miR 155 (13.4 + 3%), and empty vector control mice (12.7 + 3.1%) were much lower, regardless of miRNA expression ( Figure 2 4C) Across all animals we detected less than 1% of hCD3+ T cells ( Figure 2 4D) Except f or the modest, but non significant, increase of hCD45+ leukocytes and hCD19+ B cell populations in the miR K12 11 and miR 155 expressing mice, these values represent a normal distribution of hematopoietic cell lineages as previously reported after engraftm ent of human CB CD34+ progenitors into NOD/LtSz scid IL2R null mice (Giassi et al., 2008; Shultz et al., 2005) Because miR 155 has been implicated in B cell development (Co stinean et al., 2009; Costinean et al., 2006) we also analyzed B cells for expression of CD10 (B cell precursors) and surfac e IgM (mature B cells) ( Figure 2 5) In all animals the majority of

PAGE 54

54 hCD19+ cells expressed CD10+ [miR K12 11 (98.5 + 0.9%), miR 1 55 (97.5 + 1.0%), and vector control (97.7 + 1.2%)] compared to lower levels of IgM expression [miR K12 11 (66.2 + 11.2%), miR 155 (55.7 + 11.6%), and vector control (63.5 + 11.6%)]. These data indicate that the majority of hCD19+ B cells in the BM repres ent an immature phenotype whose differentiation was not affected by ectopic miRNA expression. Ectopic expression of miR K12 11 and miR 155 induces B cell proliferation in the spleen To further evaluate human hematopoietic development in the engrafted mic e we removed the spleens for histology and harvested splenocytes for cell lineage analysis by FACS. Results indicated a significant increase of hCD45+ leukocytes in the miR K12 11 (49.6 + 8.7%) and miR 155 (46.3 + 9.5%) expressing mice compared with the e mpty vector control (33.6 + 5.7%) ( Figure 2 6 A). Furthermore, splenocytes were significantly enriched for hCD19 (B cells) in the miR K12 11 (45.7 + 12.6%) and miR 155 (42.6 + 10.1%) expressing mice compared to the vector control (29.3 + 6.1%) ( Figure 2 6 A ). In contrast, the hCD33+ monocyte and hCD3+ T cell populations were not significantly altered in the presence of miRNA expression ( Figure 2 6 A). The increased percentages observed in the hCD45+ and hCD19+ populations were due to an increase in the abso lute cell numbers for these populations and not a reduction in the absolute cell numbers of the hCD33+ and hCD3+ populations (data not shown). Based on these observations the increased hCD45+ leukocyte counts in the spleen are caused by an expansion of th e hCD19+ B cell population. This was further supported by the observation that the percentage of GFP positive miRNA expressing cells in the hCD45+ and hCD19+ populations represented a significantly higher fraction of the total cell population in mice expr essing miR K12 11 (14.4 + 5.2% CD45+ and 14.3 + 4.0%

PAGE 55

55 CD19+) and miR 155 (17.0 + 5.4% CD45+ and 17.1 + 5.4% CD19+) as compared to the empty vector control (6.5 + 0.9% CD45+ and 7.9 + 1.2% CD19+) ( Figure 2 7 ). Interestingly, there was also an increase in th e GFP negative hCD45+ and hCD19+ populations in mice ectopically expressing miR K12 11 or miR 155 but this increase was not statistically significant (data not shown). Together these data show that ectopic miR K12 11 and miR 155 expression during hematopo iesis in NOD/LtSz scid IL2R null mice lead to a marked increase in B cell proliferation within the spleen. Next, we asked whether the observed expansion of hCD19+ B cells in the spleen was due to increased frequencies of B cell subsets expressing CD10 or s urface IgM. In all animals, regardless of ectopic miRNA expression, the hCD19+ B cell population was significantly enriched for IgM expression [miR K12 11 (84.8 + 4.4%), miR 155 (87.9 + 4.1%), and vector control (88.1 + 3.4%)] indicating that the majority of cells had differentiated into a more mature phenotype after migrating fro m the BM to the spleen ( Figure 2 8A ). Furthermore, when hCD19+ cells were gated for GFP (miRNA expressing) and analyzed for IgM expression there was no significant difference bet ween the groups [miR K12 11 (86.9 + 3.6%), miR 155 (86.7 + 3.5%), and empty vector control (89.8 + 3.1%)] ( Figure 2 8B ). Compared to IgM, expression of CD10 was lower in the hCD19+ B cells, but again there was no difference between groups [miR K12 11 (67. 9 + 6.6%), miR 155 (69.7 + 8.1), and vector control mice (68.2 + 8.8%)] ( Figure 2 8C ). Gating for GFP also revealed no significant difference in CD10 expression between the miR K12 11 (67.3 + 9.6%), miR 155 (73.6 + 8.2%), and empty vector control mice (76 .0 + 7.1%) ( Figure 2 8D ). Together these data suggest that while ectopic expression of both miR K12 11 and miR 155 had a significant effect on B cell

PAGE 56

56 proliferation, B cell differentiation as assessed by the distribution of CD10 and IgM expressing cells wa s not affected in this model. MiR 155 and miR K12 11 expression leads to hCD19+ B cell infiltrates in splenic red pulp Histopathological examination of bone marrow from femurs and tibias after hematoxylin eosin (H&E) staining revealed no major difference s in cellularity, with the majority of animals displaying large numbers of nucleated cells. We also found no significant differences in the hCD19+ B cell population in the BM of mice when examined by immunohistochemistry (IHC) using an hCD19 antibody, whi ch supports the FACS data Initial gross analysis of the spleen did not indicate any abnormalities in weight or size in any of the mice examined. However, H&E and IHC staining of the spleen for hCD19+ B cells confirmed the significant expansion of human B cells in the miRNA expressing mice ( Figure 2 9 ), as observed by FACS analysis ( Figure 2 5A). Furthermore, we observed peculiar differences in the splenic localization of hCD19+ B cells in the miRNA expressing mice. While the majority of B cells from th e empty vector control mice were localized interior to the periarteriolar lymphoid sheaths (PALS), reflecting normal spleen architecture, we observed large numbers of hCD19+ cells from the miR K12 11 and miR 155 expressing mice infiltrating and expanding i nto the splenic red pulp regions outside the PALS ( Figure 2 9 ). These B cell infiltrates appear to disrupt the normal architecture of the PALS and may indicate either a homing defect or are a direct result of aberrant B cell proliferation. Interestingly a similar immunophenotype of splenic red pulp B cell infiltrates was previously reported for studies where miR 155 was overexpressed in the E miR 155 transgenic mouse model (Costinean et al., 2009; Costinean et al ., 2006)

PAGE 57

57 K12 11 in splenocytes and PEL cells A number of miR involved in B cell lymphomagenesis (Costinean et al ., 2009) regulator of IL 6, a cytokine associated with proliferation of KSHV infected B cell malignancies (Asou et al., 1998; Foussat et al., 1999; Hassman et al., 2011; Oksenhendler et al., 20 00; Sin et al., 2007) Hence, we investigated whether miR K12 splenic B cell expansion. h miR K12 11 and miR 15 5 ( Figure 2 10 A). Previous studies have shown that miR 155 can directly target 155 binding site (Costinean et al., 2009; O'Connell et al., 2008; Yin et al., 2008) To test the ability of miR K12 with either miR K12 11 or miR 155 expression vectors in 293 cells resulted in a 50% repression of luciferase activity ( Figure 2 10 B). Next, we wanted to determine if ectopic miR 155 and miR K12 11 expression Using qRT K12 11 (0.4 fold) and miR 155 (0.5 fold)] compared to empty vector control mice indicating that these miRNAs regulate C/EB Figure 2 10 C). To investigate the

PAGE 58

58 ability of endogenous miR K12 K12 11 function with specific antagomirs. Inhibition of miR K12 11, in two PEL cell lines (0.25 fold) and BC3 (0.26 fold)] measured by qRT PCR ( Figure 2 10 D). These K12 11 target and suggest one possible mechanism to explain the observed splenic B cell expansion. Discussion MiR activity) based on its aberrant expression in B cell lymphomas (Eis et al., 2005) Within this context, the finding that miR K12 11 and miR 155 have identical seed sequences immediately lead to the hypothesis that miR K12 11 could mimic miR 155, thereby contributing to KSHV tumorigenesis (Gottwein et al., 2007; Skalsky et al., 2007) To determine whether miR K12 11 can phenocopy miR 155 activity in vivo we utilized the humanized NOD/LtSz scid IL2R null mouse model. In summary, we demonstrate that ectopic expression, of miR K12 11 or miR 155 lead to an increased expansion of human B cells in the spleen. Furthermore, this increase was accompanied by B cel l infiltrates within the splenic red pulp, a phenotype which was previously described in miR 155 overexpressing mice using the E miR 155 transgenic mouse model (Costinean et al., 2009; Costinean et al., 2006) Th is study describes the first phenotype for a KSHV encoded miRNA in the context of human hematopoiesis and more specifically B cell development. The ability of miR 155 to induce lymphoproliferative diseases when overexpressed in hematopoietic cells during d ifferentiation has been previously documented in studies

PAGE 59

59 using non humanized mouse models (Costinean et al., 2006; O'Connell et al., 2008) Interestingly, the observed phenotypes in these studies differed depending on the type of progenitor cell, and mouse model used. MiR 155 overexpression in a B cell restricted manner induced B cell proliferation, while ubiquitous expression in adult murine HSCs induced deregulated myeloproliferation (Costinean et al., 2006; O'Connell et al., 2008) suggesting that miR 155 plays a role in regulating several differentiation pathways during hematopoiesis (for review see (Baltimore et al.) ). In our NOD/LtSz scid IL2R null mouse model, ectopic miR 155 or miR K12 11 expression, but not overexpression, in human CB CD34+ progenitors induced a splenic expansion of mature B cells without a marked inhibition of myeloid lineages. Our observations resemble the splenic B cell prolif eration reported in the E miR 155 transgenic mouse but do not correlate with the reduction of mature IgM+ B cells seen in that model (Costinean et al., 2009; Costinean et al., 2006) We also observed no increase i n myelopoeisis, which was previously reported during inflammatory responses and during ectopic expression of miR 155 in murine bone marrow derived HSCs (O'Connell et al., 2009; O'Connell et al., 2008) In our model the absence of an increased B cell population in the BM may suggest that the cells ectopically expressing either miR K12 11 or miR 155 had already migrated from the bone marrow at this point of differentiation and/or that the miRNAs in our system might on ly be affecting later time points of differentiation in the spleen. Since KSHV is a human pathogen, we chose to transduce human CB CD34+ progenitors and not murine BM derived adult HSCs. Furthermore, the context of our experiment was carried out under steady state conditions without the use of either

PAGE 60

6 0 inflammatory inducers or IL 6, which has been shown to increase myelopoiesis and suppress lymphopoiesis at early stages of differentiation in the bone marrow (Nakamur a et al., 2004) Importantly, in our system, miR K12 11 and miR 155 were not overexpressed but expressed at levels similar to those in the PEL cell line BCBL1, eliminating potential off target consequences due to miRNA oversaturation. Although the conse quences of miR 155 expression on the hematopoietic system vary depending on the model system used, our study clearly demonstrates that miR K12 11 can phenocopy the lymphoproliferative activity of miR 155 during hematopoiesis in vivo The ability to induce B cell proliferation strongly indicates a role for miR K12 11 in promoting KSHV lymphomagenesis and provides supporting evidence to previous studies in MDV, EBV and REV T that targeting of the miR 155 regulatory pathway is conserved among transforming her pesviruses (Bolisetty et al., 2009; Linnstaedt et al., 2010; Lu et al., 2008; Morgan et al., 2008; Yin et al., 2008; Zhao et al., 2011; Zhao et al., 2009) To delineate the underlying molecular mechanisms contribut ing to the observed B cell expansion/proliferation we searched for miR 155 targets that could also be regulated by miR K12 11 in B potential candidate based on its regulation by miR 155 in B cell lymphop roliferation (Costinean et al., 2009) K12 in splenocytes ectopically expres sing miR K12 11 or miR 155. Lastly, regulation of K12 11 with antagomirs,

PAGE 61

61 6 and its deficiency in mice has been shown t o induce a B cell lymphoproliferative disorder that closely resembles human MCD, a malignancy closely associated with KSHV infection (Screpanti et al., 1995; Soulier et al., 1995) deficient mice has been linked to dysregulated IL 6 production (Screpanti et al., 1995) ; while the clinical presentation of KSHV associated MCD is correlated with high plasma levels of IL 6 and IL 10 (Oksenhendler et al., 2000; Yoshizaki et al., 1989) Both IL 6 and IL 10 are cytokines that function in an autocrine and paracrine fashion to promote proliferation and survival of B cells, including PEL (Asou et al., 1998; Foussat et al., 1999; Hassman et al., 2011; Jego et al., 2001; Oksenhendler et al., 2000; Rousset et al., 1992; Sin et al., 2007) To our knowledge, there has been no reported correlation between KSHV B cell lymphomagene K12 11 (Qin et al., 2010) Qin et al also showed that these KSHV miRNAs induce IL 6 and IL 10 production in monocytes and macrophages but did not confirm that this was due to to deregulated IL 6 in MCD, we believe that miR K12 11 induces IL 6 exp ression in KSHV infected B cell proliferation. The ability of IL 6 to stimulate B cell proliferation may also explain the increase of GFP negative CD19+ cells that we observed in our mice. Further studies a re ongoing to determine the potential role of miR K12 11 induction of IL 6 in B cell proliferation. In K12 11 and

PAGE 62

62 further establish a direct correlation between KSHV miRNA regulation of KSHV B cell lymphomagenesis in vivo 155 targets that play roles in hematopoietic malignancies and B cell function have been identified (Bolisetty et al., 20 09; Gottwein et al., 2007; Lu et al., 2008; O'Connell et al., 2009; Rai et al., 2010; Skalsky et al., 2007; Teng et al., 2008; Yin et al., 2010) While we have identified one gene regulated by miR K12 11 in both our mouse model and in PEL cells it is hig hly probable that this is not the only miR 155 gene deregulated by miR K12 11 that contributes to KSHV B cell lymphomas. Additional work is still needed to identify those targets which have functional relevance in KSVH associated malignancies. During lat ency KSHV expresses a small set of viral genes including V cyclin, a cyclin D homolog, V Flip, a potent inducer of NFkB, LANA, a modulator of host gene expression, and Kaposin, which stabilizes cytokine mRNAs (for reviews see (Dourmishev et al., 2003) ). While ectopic expression has unmasked limited transforming potential for each of these genes, in vitro KSHV infection of either lymphoid or en dothelial cells rarely leads to outgrowth of transformed cells (Flore et al., 1998; Watanabe et al., 2003) Since all KSHV miRNAs and the above proteins are co expressed during latency it is plausible that they wor k synergistically to deregulate host transcriptional networks promoting cell proliferation and transformation (Boss et al., 2009; Hassman et al., 2011) Here, we show that miR K12 11 expression alone induces human B cell proliferation in the context of hematopoiesis. Other KSHV miRNAs have been found to repress pro apoptotic, anti angiogenic, and immune stimulatory factors, thereby potentially contributing to lymphomagenesis, a notion that is

PAGE 63

63 testable using our NOD /LtSz scid IL2R null mouse model (Gottwein et al., 2007; Hansen et al., ; Nachmani et al., 2009; Qin et al., 2010; Samols, 2007; Skalsky et al., 2007; Ziegelbauer et al., 2009) In summary, this in vivo study further validates miR K12 11 as a functional mimic of miR 155. The discovery that miR K12 11 can promote B cell proliferation suggests a novel mechanism by which a KSHV miRNA contributes to lymphomagenesis. This work was published in October 2011. Boss, I .W., Nadeau, P.E., Abbott, J.R., Yang, Y., Mergia. A., and Renne, R. (2011). A Kaposi's sarcoma associated herpesvirus encoded ortholog of microRNA miR 155 induces human splenic B cell expansion in NOD/LtSz Journal of virology 8 5 9 877 86. Materials and Methods Cell c ulture The 293T cell line (human embryonic kidney fibroblasts) was obtained from American Type Culture Collection (Rockville, Md.). Cryogenically preserved primary human cord blood CD34+ cells were purchased from Stem Cell Technologies, Vancouver, BC. The 293T cells were grown in Dulbecc o's modified Eagle's medium (DMEM) supplemented with streptomycin (100 (100 1 0% FBS containing 1ug/ml each human stem cell factor, human thrombopoietin (Tpo), human Flt 3 ligand, and IL 11 (Peprotech, Rocky Hill, NJ). Foamy virus vector construction To produce miR 155 or miR K12 11 vector constructs we first amplified the miR K 12 11 or miR 155 miRNA sequences containing

PAGE 64

64 a region of approximately 200nts surrounding each pre miRNA hairpin from pCDNA3.1/V5/HisA expression vectors that were previously described (Samols, 2007) We inserted individual miRNA cassettes downstream of EG FP into an SFV 1 simian foamy virus vector backbone (pCCEGFPL) previously described (Gartner et al., 2009; Zucali et al., 2002) Luciferase assays and reporter construction MiRNA sensor vectors were created usin g the pGL3 promoter vector from Promega (http://www.promega.com). Synthetic oligonucleotides containing two complete complementary copies of a miRNA sequence separated by a 9 bp luciferase gene upstream of t he poly adenylation signal as previously described (Skalsky et al., 2007) To construct a luciferase reporter plasmid containing the full Vector NTI (Invitrogen), the forward primer contained an Nde1 site and the reverse an Fse1 site : CATAT GGAACTTGTTCAAGCAGCTGC GGCCGGCCGGCTTTG TAACCATTCTC Fse1 sites. All constructs were confirmed by sequencing. 293 cel ls were co transfected with luciferase reporter constructs, foamy virus vectors, and/or miRNA expression vectors in 24 well plates for 72 h using Mirus TransIT 293 reagent (Madison WI) ntified using the transfected 293 cells were lysed in cell culture lysis reagent (Promega), and 20% of

PAGE 65

65 each cell lysate was assayed for firefly luciferase activity. Light units were normalized to Renilla luciferase, using a dual luciferase reporter kit (Promega). Foamy virus production, human cord blood CD34+ cell transduction To generate infectious viral particles we co transfected 293T cells with the individual miRNA e xpression vectors and the packaging plasmid pCIenv previously described (Gartner et al., 2009) Transfe ctions were carried out in T75 cell culture flasks (5 X 10 6 293T cells per flask) by the calcium phosphate method. Viral supernatants were harvested 4 days post transfection and clarified by centrifugation at 5000 rpm for 20 min then by passaging through a 0.45 Am filter. The vector particles were further concentrated 100 fold by using the Apollo Centrifugal Spin Concentrators, 70 kDa (Orbital Biosciences, Topsfield, MA). The amounts of SFV 1 vector produced were titered on fresh 293T cells plated at a den sity of 2.5 X 10 4 per well in 24 well plates. Seventy two hours after infection, cells were monitored and scored for GFP fluorescence under a microscope with UV light source. Transduction of CD34+ cells was carried out by spin inoculation as previously d escribed (Zucali et al., 2002) Briefly, 3 X 10 6 CD34+ cells (a heterogeneous mixture from two separate donors) were seeded into 15 wells of a 24 well Human Fibronectin plate (BD Biosciences, San Jose, CA ) at a de nsity of 1.5 X 10 5 cells per well. 24 hours after initial seeding, viral supernatant was added to cells at a multiplicity of infection of 50. The plates were then spun at 1200 rpm for 1.5 hours and the infection procedure was repeated 24 hours later. Fo llowing the last transduction, 2 X 10 5 transduced CD34+ cells were transplanted by lateral tail vein injection into each of 4 8 sublethally irradiated (250 rads from Cesium 137 source at 65.7 rads/minute) NOD/LtSz scid IL2R null mice. For colony forming a ssays transduced

PAGE 66

66 cells were plated in serum free methylcellulose culture (Methocult 04236, StemCell Technologies, Vancouver, BC) in the presence of 1ug/ml each human Flt 3 ligand, human stem cell factor, human GM CSF, human IL 3, and human erythropoietin ( Epo) for 14 days. Mice NOD/LtSz scid IL2R null mice were obtained from The Jackson Laboratory. All experiments involved male mice and were performed according to IACUC approved protocols. M iRNA detection and absolute quantification of miR K12 11 RNA was extracted from samples using the RNA Biotechnology, Milton, UK). cDNA was synthesized from 10ng total RNA using the TaqMan MicroRNA Reverse Transcription Kit (AppliedBiosystems, Foster City, CA). To detect miR 155 and miR K12 11 the TaqMan miRNA detection assay was run in triplicates using human miR 155 and KSHV miR K12 11 TaqMan probes according to expression was determined u sing the Applied Biosystems Relative Quantification (RQ) Manager Software v2.1 with human miR 16 set as the endogenous control. The absolute copy number of miR K12 11 in both splenocytes and BCBL1 was calculated by using a standard curve of known quantit ies of a miR K12 11 synthetic miRNA mimic (ThermoScientific, Lafayette, CO). To determine miR K12 11 copy number in GFP positive CD19+ splenocytes we assumed that 10 ng of total RNA equals 10,000 cells. Furthermore, we expressed the absolute copy number p er GFP positive CD19+ splenocyte by taking into account the percentage of GFP positive CD19+ cells as determined by FACS.

PAGE 67

67 Flow Cytometry Cell lineage analysis GFP expression and phenotypic markers were analyzed by flow cytometry using a LSR II cytometer and FacsDiva software (BD Biosciences, San Jose, CA). Fluorophor conjugated monoclonal antibodies specific for human CD45, CD19, CD33, and CD3 (BD Biosciences, San Jose, CA BD) were used to stain RBC depleted splenocytes and bone marrow cells. Backgroun d staining was determined using a murine monoclonal IgG1 isotype control (BD Biosciences, San Jose, CA ). Necropsy, histology and immunohistochemistry Mice were necropsied and all tissues were evaluated for gross lesions. Portions of the spleen, liver, and femur were fixed in 10% buffered formalin for 18 to 24 hours, dehydrated, and embedded in paraffin. Sections were cut at 5 microns for routine hematoxylin and eosin (H&E) staining and 3 microns onto positively charged slides (Probe On Plus, Fisher Sc ientific, Springfield, NJ) for immunohistochemistry (IHC) against CD19, a marker for human B lymphocytes. Deparaffinized tissue sections were subjected to heat induced antigen retrieval by microwaving in citrate buffer solution (Antigen Unmasking Solution Vector Laboratories, Burlingame, CA). The primary antibody for IHC was mouse monoclonal anti human CD19 (BIOCARE Medical, LLC; Concord, CA) used at a dilution of 1:150. Sites of primary antibody binding were identified by high affinity immunocytochemist ry STAT Q (Innovex Biosciences; Richmond, CA) using a secondary antibody and strept avidin horseradish peroxidase. The chromagen was diaminobenzidine (DAB) with Mayer's hematoxylin counterstain. Antagomir de repression assays and real time qRT PCR analysis For inhibition of miR K12 (Skalsky et al.,

PAGE 68

68 2007) were used. PEL cells (1x10 6 ) were transfected with 25nM of antagomir in 24 well plates using Mirus TransIT TKO (9u l / 250ml total media). After 6 h of incubation cells were pelleted, transfection media was removed, and cells were plated in fresh RPMI 1640 supplemented with 10% fetal bovine serum and 5% penicillin streptomycin (Gibco) for 48 h before RNA was harvested RNA from splenocytes, BC 3, and BCBL1 cells was reverse transcribed using SuperScript III Reverse Transcriptase (Invitrogen) in was carried out using an ABI StepOne Plus sys tem along with ABI Fast SYBR (Applied boundaries and were previously described (Lu et al., 2010c) Primer pair efficiencies for GAPDH, actin to check for accuracy and reported as relative quantitation (RQ) values using StepOne software. Statistics All statistical tailed t test performed on Microsoft Excel software.

PAGE 69

69 Figure 2 1. Foamy virus vectors express miR K12 11, miR 155, or empty vector control. A Foamy virus vectors were constructed by inserting the pri miRNA sequence down stream of a GFP cassette and CMV promoter. B Schematic of miRNA sensor vectors containing two perfectly complementary binding sites. C MiRNA expression and sensor vectors were co transfected into 293 cells and luciferase activity was measured 72 hours p ost transfection. Results show that both miR K12 11 and miR 155 expression vectors repressed luciferase activity >2 fold compared to no repression by the control.

PAGE 70

70 Figure 2 2 Engraftment of transduced CB CD34+ cells. Cells harvested from the bone m arrow were analyzed by FACS using a human CD45 specific antibody. Human CD45+ cells were detected in all mice reconstituted with human CB CD34+ progenitors expressing either miR K12 11, miR 155, or empty vector control. A large percentage of the CD45+ ce lls also expressed GFP, shown in the upper right quadrant of each histogram. Shown are representative dot plots for one animal from each group.

PAGE 71

71 Figure 2 3. Ectopic miR K12 11 and miR 155 expression in engrafted mice. A. Ectopic miR K12 11 was only de tected in the miR K12 11 engrafted anima ls in both the BM and spleen. B. Ectopic miR 155 was detected above endogenous levels in the miR 155 engrafted anima ls in both the BM and spleen. C. Absolute miR K12 11 copy number in the GFP positive CD19+ splenoc yte populations from engrafted mice is comparable to or lower than endogenous miR K12 11 expression in the PEL cell line BCBL1 and therefore is not overexpressed.

PAGE 72

72 Figure 2 4. Cell lineage differentiation of human progenitors was not significantly alter ed by miRNA expression in the bone marrow. Cells harvested from the bone marrow of mice expressing empty vector (n=4), miR K12 11 (n=7), and miR 155 (n=8) were stained with antibodies specific for human ( A) CD45+ leukocytes, (B) CD19+ B cells, (C) CD33+ m onocytes, and (D) CD3+ T cells and analyzed by FACS. Each dot represents FACS analysis of one animal from each group and the mean score for each group is shown as the solid horizontal line. Figure 2 5. B cell subsets in the bone marrow are mostly CD10+ precursors. Cells harvested from the bone marrow of mice expressing emp ty vector (n=4), miR K12 11 (n=6 ), and miR 155 (n=8) were stained with antibodies specific for human CD19+ and then analyzed for surface expression of (A) CD10 (precursor B cells) an d (B) IgM (mature B cells). Each dot represents FACS analysis of one animal from each group and the mean score for each group is shown as the solid horizontal line.

PAGE 73

73 Figure 2 6 Ectopic expression of miR K12 11 or miR 155 in human leukocytes during hemat opoiesis leads to increased CD19+ B cell expansion in the spleen. Splenocytes harvested from mice expressing empty vector (n=4), miR K12 11 (n=5), and miR 155 (n=7) were stained with antibodies specific for human CD45+ leukocytes, CD19+ B cells, CD3+ T ce lls, and CD33+ mo nocytes and analyzed by FACS. A. The fraction of human CD45+ leukocytes and CD19+ B cells was significantly higher (*p<0.05) in mice expressing either miR K12 11 or miR 155 compared to empty vector control. No change was detected in the CD33+ monocyte or CD3+ T cell populations when either miRNA was expressed. Each dot represents FACS analysis of one animal from each group and the mean score for each group is shown as the solid horizontal line. A p value (*) of 0.05 or less after a Stu tailed t test was consider ed statistically significant. B. Representative dot plots for flow cytometry analysis of splenocytes using hCD45+ and hCD19+ antibodies.

PAGE 74

74 Figure 2 7 GFP positive (miRNA expressing) accounted for the overall increa se in human CD45+ leukocytes and CD19+ B cells. Splenocytes harvested from mice expressing empty vector (no miRNA control, n=4), miR K12 11 (n=5), and miR 155 (n=7) were stained with antibodies specific for human CD45+ leukocytes or CD19+ B cells and anal yzed for GFP positive expression by FACS. A. The fraction of GFP positive CD45+ human leukocytes was significantly higher (*p<0.05) in mice expressing either miR K12 11 or miR 155 compared to empty vector control. B. The fraction of GFP positive CD19+ human B cells was significantly higher (*p<0.05) in mice expressing either miR K12 11 or miR 155 compared to empty vector control. Each dot represents FACS analysis of one animal from each group and the mean score for each group is shown as the solid hori zontal line. A p value (*) of tailed t test was considered statistically significant.

PAGE 75

75 Figure 2 8. Ectopic expression of miR K12 11 or miR 155 did not affect B cell differentiation in the spleen. Cells harvested fro m the spleens of mice expressing emp ty vector (n=4), miR K12 11 (n=6 ), and miR 155 (n=8) were stained with antibodies specific for human CD19+, (A) IgM (mature B cells), and (C ) CD10 (germinal center B cells). MiRNA expressing cells were gated by GFP expre ssion and analyzed for surface expression of (B) IgM and (D) CD10. Each dot represents FACS analysis of one animal from each group and the mean score for each group is shown as the solid horizontal line.

PAGE 76

76 Figure 2 9 Immunohistochemical analysis of spl eens revealed an increase in human CD19+ B cell infiltrates in the splenic red pulp of mice expressing miR K12 11 or miR 155. For immunohistochemistry, spleens were fixed, sectioned, and stained with a monoclonal antibody against human CD19. Photomicrogr aphs of splenic sections at 40X magnification are shown in the panel of pictures at the top. The splenic red pulp regions are further magnified (200X) in the bottom panels to show the increased hCD19+ B cell infiltrates (red staining) in the miRNA express ing animals versus the no miRNA control. Shown are representative sections from one animal from each group.

PAGE 77

77 Figure 2 10 C/E K12 11 and miR 155 in splenocytes and is regulated by miR K12 11 in PEL. A. match site for miR K12 11 and miR 155. B. was cloned (nt 1233 1836) downstream of luci ferase (pGL3 transfected into 293 cells with increasing amounts (400ng and 800ng) of miR 155 or miR K12 11 expression plasmids and a renilla luciferase control vector. Transfection was normalized to renilla values and firefly values were gr a phed as relative light units. C. RNA harvested from splenocytes from two separate animals from each group (empty vector control, miR K12 11, and miR 155) was analyzed by qRT mRNA and normalized to GAPDH. D. miR K12 11 funct ion in the PEL cell lines BCBL1 K12 11. analyzed by qPCR and normalized to GAPDH. Mock transfected cells were used as a control. All experiments represent the average of three independent replicates and were repeated at least two times.

PAGE 78

78 CHAPTER 3 DEFINING THE ROLE OF KSHV MIR K12 11 ON TERMINAL B CELL DIFFERENTIATION KSHV is a lymphotropic virus that infects B cells i n vivo and can promote the B cell lymphoporliferative diseases PEL and MCD. While PEL and MCD differ morphologically and phenotypically, they both resemble B cells that are arrested at a pre plasma stage of differentiation Because suitable models to stu dy KSHV B cell infection have been extremely limited, the mechanisms governing KSHV inhibition of plasma cell differentiation are not well understood. We have previously found that the KSHV miRNA, miR K12 11, functions as a homolog of miR 155, a human miR NA that regulates B cell differentiation. To determine if miR K12 11 can hijack miR 155 function to inhibit plasma cell differentiation, we transfected human nave B cells with synthetic miRNAs and stimulated them in vitro with IL 21, anti CD40, and anti IgM to induce plasma cell differentiation. While the results of this experiment did not show any miRNA mediated inhibition of differentiation, we identified a number of B cell terminal differentiation targets regulated by both miRNAs. These results indic ate that miR K12 11 can regulate miR 155 B cell targets, but this regulati on alone does not inhibit IL 21 induced plasma cell differentiation in vitro Introduction to KSHV and terminal B cell differentiation KSHV infection of B cells in some immunocompro mised individuals can induce two types of B cell tumors, PEL and MCD (Cesarman et al., 1995; Soulier et al., 1995) PEL cells are believed to be derived from a late stage of B cell differentiation based on somatic mutations in their immunoglobulin genes and the expression of the plasma cell marker CD138. In contrast, MCD carries no immunoglobulin somatic mutations and does not express CD138, indicating that these tumors are derived from a nave B cell

PAGE 79

79 origin. Alth ough the tumors differ phenotypically, both express PR domain containing 1 with zinc finger domain /B lymphocyte induced maturation protein 1 (PRDM1/BLIMP1), considered the master regulator of plasma cell differentiation (Chadburn et al., 2008; Shaffer et al., 2002; Turner et al., 1994) So it appears that KSHV infects different subtypes of B cells, either at early or late stages of differentiation, and somehow manipulates the B cell differentiation program to under go terminal differentiation but stalling at a pre terminal stage. The precise mechanisms governing KSHV control of B cell differentiation programs are largely unknown. In addition to B cell tumors, KSHV genomes are detected in circulating CD19 positive B cells from infected individuals, suggesting that B cells represent the reservoir for persistent KSHV infection (Ambroziak et al., 1995; Mesri et al., 1996) Although KSHV infects B cells in vivo B cells are resis tant to infection in vitro (Bechtel et al., 2003; Blackbourn et al., 2000; Renne et al., 1998) This limitation has restricted study on the mechanisms governing KSHV B cell infection Very recently, two separate g roups have shown that tonsillar B cells can be infected in vitro but without any immortalizing or transformation events (Hassman et al., 2011; Myoung and Ganem, 2011) In one study it was found that KSHV specifica and that infection drives these cells to proliferate and express CD27, IgM, and IL 6R, an immunophenotype closely related to MCD (Hassman et al., 2011) These studies suggest tha t KSHV may target a tonsillar B cell subtype for infection, inducing proliferation and differentiation. More work is needed to examine how changes in B cell differentiation programs might contribute to this process during in vitro infection.

PAGE 80

80 Potential in sight into KSHV regulation of B cell differentiation comes from studies on closely related EBV which is believed to establish persistent infection by driving nave B cell s to activate and undergo germinal center reactions where the virus to induce differentiation into resting memory B cells (Thorley Lawson, 2001) This expression programme consists of three viral proteins that mimic B cell host proteins including ; LMP1 which shares functi onal homology with CD40, allowing for the activation of anti apoptotic and proliferation signals ; and LMP2 which enhances B cell receptor (BCR) signaling (Caldwell et al., 1998; Panagopoulos et al., 2004) EBV also induces miR 155 expression during in vitro B cell infection, which contributes to immortalization by inhibiting apoptosis and promoting episomal maintenance of the EBV genome (Linnstaedt et al., 2010; Lu et al., 200 8) In contrast to EBV, no KSHV latent protein has been identified that can activate re sting B cells and promote their differentiation However, KSHV expresses two lytic proteins, K1 and K15, which share structural homology to LMP1 and LMP2 respectively and can activate similar cell signaling pathways (Brinkmann and Schulz, 2006; Lagunoff et al., 1999) Additionally KSHV expresses miR K12 11 during latent B cell infection, which we have shown is a functional or tholog of miR 155. Based on miR during EBV infection, we speculate that miR K12 11 may play a similar role during KSHV infection. In normal B ce lls, activation of BCR and toll like receptor (TLR) signaling induces transient miR 155 expressi on (Thai et al., 2007) E xpression profiling of miR 155 in human tonsillar B cell s indicates that upon activation resting nave B cells increase miR 155 expression, hitting a peak in the GC, followed by a decrease in the memory B cells

PAGE 81

81 and plasma cell populations (Basso et al., 2009; Malumbres et al., 2009; Tan et al., 2009) It is possible that after leaving the GC, B cell s must shut down expression of miR 155 in order to switch on a transcription program for memory B cell or plasma cell differentiation. However no targets of miR 155 have been found which repress the terminal differentiation program in B cell s. The PEL and MCD phenotype of an arrested post G C plasmablast suggests that the B cell terminal differentiation program is being blocked. Because we have shown that miR K12 11 is a functional homolog of miR 155 (discussed in Chapter 1 and 2) i t is possible that KSHV constitutively expresses miR K12 11 during B cell infection to promote ac tivation, differentiation, and immortalization At the same time, miR K12 11 expression after germinal center transit could prevent plasma cell differentiation This would be advantageous for the virus because it could disrupt a n anti viral humoral response by inhibiting plasma cell differentiation Additionally, KSHV episome replication has been shown to occur only in dividing cells, in which the host DNA replication machinery is accessible for viral replication (Grundhoff and Ganem, 2003) Be cause p lasma cells no longer divide KSHV may drive infected cells into proliferating plasmablasts and freeze them at this stage to establish a pool of blasting cells for persistent infection To further explore the ability of miR K12 11 to regulate B cel l differentiation and inhibit plasma cell differentiation I designed the following in vitro differentiation system and also identified targets that may play important roles in these differentiation pathways. In vitro model of plasma cell differentiation To study miR K12 designed an in vitro system that uses human nave and memory B cells purified from peripheral blood (Appendix 1) This system was previously developed to study the

PAGE 82

82 ability of IL 21, a T cell cytokine, to drive B cell proliferation and plasma cell differentiation (Ettinger et al., 2005) B c ell differentiation is controlled by a complex series of transcription programs which are turned on and off by regulatory networks as the B cell transits into and out of the germinal center (Lin et al., 2003; Schebes ta et al., 2002) In the germinal center, c ytokines play an important role in orchestrating B cell differentiation by activating JAK STAT signaling pathways which control the regulatory networks (Shuai and Liu, 2003) IL 21 drives plasma cell differentiation by activating STAT 3, which in turn activates BLIMP1 expression, the master regulator of terminal differenti ation (Diehl et al., 2008) In addition to IL 21, contact dependent BCR and CD40 activation are also essential for resting B cell proliferation and differentiation (Ettinger et al., 2008) In vitro differentiation of resting nave B cells to plasma cells is induced by activation signals from IL 21, a nti IgM (to mimic BCR antigen cr oss linking), and anti CD40 (to mimic T cell CD40L interaction), while differentiation of memory B cells only requires IL 21 and anti CD40 (Bryant et al., 2007) To measure the capacity of differentiation using thes e signals, cells are analyzed for increased expression of CD38 and loss of IgD, the immunophenotype of a terminally differentiated plasma cell. Additionally, because plasma cells are characterized by their ability to produce class switched antibodies (IgM to IgG), supernatant is analyzed for secreted IgG. To verify our ability to recapitulate plasma cell differentiation using this system, we first purified nave and memory B cells from human peripheral blood by negative selection. Flow cytometry analysis indicated that our enriched CD19+ B cell population was at least 95% pure ( Figure 3 1). These cells were further analyzed for surface expression of IgD and CD38, indicating that the majority (95%) represented a mixture of

PAGE 83

83 nave (IgD+CD38 low/int ) and memor y B cells (IgD CD38 /low ) ( Figure 3 2). To confirm the ability of this system to produce fully differentiated plasma cells, we cultured the purified CD19+ B cells with or without IL 21, anti CD40, and anti IgM. After seven days the cells were analyzed b y flow cytometry for expression of CD38 and IgD. B cells cultured without the stimulatory factors resulted in very few IgD CD38 high plasma cells (3.4%) ( Figure 3 3). In contrast, B cells cultured with the factors exhibited a significantly higher fraction of IgD CD38 high plasma cells (14.6%) ( Figure 3 3). This indicated that phenotypically these cells resembled fully differentiated plasma cells. Further anal ysis of the culture supernatant for secreted IgG indicated that the stimulated B cells produced dr amatically more IgG than the unstimulated B cells (Fig ur e 3 4). These data indicate that in vitro plasma cell differentiation was successful. Ectopic miR K12 11 expression during plasma cell differentiaton To deliver miR K12 11 into the purified B cells, I needed to determine the most efficient and non toxic method. Transduction of B cells using the foamy virus miRNA vectors, previously described in Chapter 2, resulted in high cell death and low transduction rates (<8.6%) (Fig ure 3 5). In comparison, transie nt transfection of synthetic miRNA mimics was less toxic and resulted in a high percentage of successfully transfected cells (44.8%) (Fig ure 3 5), therefore I used transfection for miR K12 11 delivery. To test the ability of miR K12 11 and miR 155 mimics to inhibit plasma cell differentiation, B cells were stimulated for 3 days and then transfected with miR K12 11, miR 155, or a non specific miRNA control, and analyzed 4 days post transfection for changes in phenotype and IgG secretion. Phenotype analysis by flow cytometry did not indicate any significant inhibition of plasma cell differentiation by miR K12 11 or miR

PAGE 84

84 155 (Fig ure 3 6). Analysis of the culture supernatant for IgG indicated no significant differences between the control miRNA, miR K12 11, or mi R 155 transfected B cells (Fig ure 3 7). Although there was a slight increase of IgG secretion in the non transfected B cells, this difference is likely due to a decrease in viable antibody producing B cells caused by the transfection. Lastly, to determine i f miR K12 11 or miR 155 promoted plasmablast proliferation we measured the proliferation capacity of the stimulated B cells at day 6 by EdU incorporation, using the Click IT Edu flow cytometry assay kit. Results showed low proliferation rates in all condi tions, indicating that the miRNAs alone were not promoting the differentiation of proliferating plasmablasts (Fig ure 3 8). To investigate miR K12 n or proliferation independent of other stimulation factors, unstimulated B cel ls were transfected with miR K12 11, miR 155, or a non specific miRNA control 24 hours after plating. Activation of resting B cells was analyzed by measuring CD38 expression, a marker for activation, with flow cytometry 24, 48, and 72 hours post transfect ion. No significant increase of CD38 expression was observed in the miR K12 11 or miR 155 transfected B cells at either time point, indicating that these miRNAs were not inducing activation (Fig ure 3 9). Furthermore there was no significant proliferation in the transfected B cells, measured by EdU incorporation 48 hours after miRNA transfection (Fig ure 3 9). Without BCR and anti CD40 co stimulation purified B cells rapidly die in culture. While miR 155 was reported to inhibit apoptosis in B cells newly infect ed with EBV (Linnstaedt et al., 2010) we did not observe any anti apoptotic affect in miR K12 11 or miR 155 transfected B cells 5 days post transfection (Fig ure 3 10). The se results indicate that,

PAGE 85

85 at least in vitro, miR K12 11 and miR 155 alone do not affect resting B cell activation or proliferation and also do not promote resistance to apoptosis. It still remains possible that miR K12 11 contributes to B cell activation and proliferation while inhibiting terminal differentiation during KSHV infection in vivo However, based on the results in this model system, the mechanisms contributing to miR K12 appear to be complex and may require additio nal viral factors and/or other model systems for adequate investigation. Two possible viral proteins that may also contribute to KSHV B cell regulation are K1 and K15 based on their similiarity to the EBV B cell reg ulatory proteins LMP1 and LMP2. Futur e experiments designed to co express these proteins along with miR K12 11 in primary B cells may reveal important phenotypes. Identification and validation of miR K12 11 targets involved in B cell regulatory pathways To identify potential miR K12 11 cell ular gene targets involved in B cell activation, proliferation, and differentiation I utilized published reports of validated miR 155 B cell targets The first g ene profiling arrays from miR 155 deficient B cells identified 60 upregulated genes with miR 155 (Vigorito et al., 2007) Subsequent studies found that two candidate genes from this list, Pu.1 and AID, are indeed regulated by miR 155 and that this regulation is impo rtant for germinal center formation (Dorsett et al., 2008; Teng et al., 2008; Vigorito et al., 2007) This set of genes also included; Jarid2, a cell cycle regulator; Bach1, a transcriptional regulator and target o f miR K12 11; MYB, an important regulator of hematopoiesis; and SMAD5, a transcription factor; all of which are now experimentally validated miR 155 targets (Bolisetty et al., 2009; Rai et al., 2010; Skalsky et al., 2007; Yin et al., 2008) Seperate

PAGE 86

86 studies have identified and validated and SHIP 1 as miR 155 targets that play a crucial role in B cell tumorigenesis (Costinean et al., 2009; O'Connell et al., 2009) Based on their functions in B cells I choose to further analyze PU.1, MYB, CEB and SHIP 1 for functional targeting by miR K12 11. In addition, I have also identified three potential novel miR K12 transducing kinase essential for B cell activation; immunoglobulin J chain (IgJ ), which is essential for secretory IgA and IgM production; and IFN regulatory factor (IRF)8, a transcription factor inv olved in B cell development. To contained miR K12 11 target s ites I used miR target finder, a bioinformatic program designed by Dr. Alberto Riva. This program utilizes a set of previously defined miRNA binding parameters to ( Grimson et al., 2007) SHIP 1, NIK, IgJ, and IRF8 all contained one miR K12 11 binding site two. To confirm that both miR 155 and miR K12 11 can target a nd repress these genes we carried out in vitro luciferase reporter assays, using vector constructs that contained construct was co transfected into HEK293 cells with increasing a mounts of miR 155 or miR K12 11 expression vectors. Results of the assay demonstrated that both miRNAs mediated a dose dependent knockdown of luciferase expression for all reporter targeting for PU.1 MYB, SHIP 1, and IgJ ( Figure 3 11 ).

PAGE 87

87 To confirm that miR K12 11 can regulate expression of PU.1 MYB, SHIP 1, and IgJ in the latently infected PEL cell lines, BCBL 1 and BC3, I carried out antagomir de repression assays. This assay utili zes antagomirs to specifically inhibit miR K12 11 function, resulting in de repression of targets that can be measured by RT qPCR. Results indicated modest de repression for MYB [BCBL1 (0.3 fold) and BC3 (0.35 fold)], [BCBL1 (0.25 fold) and BC3 (0. 2 fold)], SHIP 1 [BCBL (0.26 fold) and BC3 (0.3 fold)], and IgJ [BCBL1 (0.3 fold) and BC3 (0.4 fold)] ( Figure 3 12). In contrast, PU.1 transcript levels remained unchanged in response to miR K12 11 inhibition. Interestingly, a previous study revealed that PEL cells do not express the PU.1 B cell specific transactivator Oct 2, possibly explaining the low levels of PU.1 transcript and lack of derepression observed in PEL cells (Arguello et al., 2003) However, Oct 2 is expressed in MCD, so it remains plausible that PU.1 is a target for miR K12 11 in this context of KSHV infection These findings confirm that miR K12 11 can target an overlapping set of miR 155 targets involved in diverse B cell regulatory pathways. A s discussed in Chapter 2, the functional relevance of miR K12 regulation of IL 6 expression suggests a possible mechanism for promoting B cell proliferat ion in KSHV pathogenesis. SHIP 1, which was implicated in miR 155 induced B cell lymphomas, is also targeted by miR K12 11 and may contribute to KSHV lymphomagenesis, a link that will need to be further examined. MiR K12 11 targeting of IgJ may inhibit the ability of KSHV infected B cells to produce secreted antibody and will n eed to be further examined. While the function of MYB targeting in B cell development is unclear, a recent study showed that MYB can activate the KSHV lytic switch transactivator RTA

PAGE 88

88 (Lacoste et al., 2007) This s uggest s that miR K12 11 regulation of MYB may be important for prevent ing lytic reactivation a role currently being investigated by another graduate student in the lab, Karlie Plaisance Based on the modest levels of target derepression in PEL cells show n in these experiments, miR K12 11 may function as a fine tuning mechanism, instead of a strong repressor to regulate protein expression, an observation that has been made for many miRNAs (Baek et al., 2008; Selbach et al., 2008) However, it is apparent from our in vivo study discussed in Chapter 2, as well as the growing list of validated miR K12 11 targets, that this miRNA can impact the biology of virally infected cells by regulating multiple cellular pathways.

PAGE 89

89 Figure 3 1. Phenotype analysis of freshly purified human B cells. Human purified B cells were negatively enriched from peripheral blood and analyzed for CD19+ surface expression by flow cytometry. Enrichment of B cells resulted in at least a 95% pure population of CD19+ B cells. Figure 3 2. Plasma cell phenotype analysis before stimulation. Freshly purified B cells were analyzed for surface expression of CD38 and IgD by flow cytometry. 95.3% of the B cells were nave (IgD+CD38 low/int ) or memory B cells (IgD CD38 /low ).

PAGE 90

90 Figure 3 3. Stimulated B cells undergo plasma cell differentiation. Purified B cells were stimulated with (A) no activators or (B) with the combination of IL 21, anti IgM, and anti CD40 for 7 days and analyzed for expression o f CD38 and IgD by flow cytometry. A. Unstimulated B cells showed very little plasma cell differentiation (IgD CD38 high ) in the lower right quadrant. B. 14.6% of stimulated B cells fully differentiated into plasma cells. Figure 3 4. Stimulated B cells secrete class switched IgG antibody. Cell supernatant was removed from unstimulated and stimulated B cells after 7 days in culture and analyzed for the presence of IgG with the BD Cytometric Bead Array (CBA) for Human Immunoglobulin assay. The stimulated B cells produced large quantities of IgG compared to unstimulated B cells. We note this e xperiment was carried out one time.

PAGE 91

91 Figure 3 5. MiRNA transfection of human B cells is more efficient and less toxic than foamy virus transduction. A. Purified B cells were stimulated with IL 21, anti IgM, and anti CD40 for 48 hours and then infected with foamy virus at an MOI of 50. 4 days post infection transduction was measured by GFP expression using flow cytometry. 8.6% of infected cells were GFP+. B. Pur ified B cells were stimulated with IL 21, anti IgM, and anti CD40 for 24 hours and then transfected with a Cy3 labeled siRNA control. 44.8% of B cells were successfully transfected after 24 hours.

PAGE 92

92 Figure 3 6. MiR K12 11 and miR 155 does not inhibit in vitro plasma cell differentiation. Purified B cells were stimulated with IL 21, anti IgM, and anti CD40 for 3 days and then transfected with miRNA control, miR K12 11, or miR 155. 4 days post transfection the B cells were analyzed for expression of CD38 and IgD by flow cytometry. There was no significant difference in plasma cell differentiation when comparing the miR K12 11 and miR 155 transfected cells to the miRNA control or untransfected cells.

PAGE 93

93 Figure 3 7. MiR K12 11 and miR 155 does not inhibi t IgG class switching. Cell supernatant was removed from three wells of unstimulated, stimulated, control miRNA, miR K12 11, and miR 155 transfected B cells after 7 days in culture and analyzed for the presence of IgG with the BD Cytometric Bead Array (CB A) for Human Immunoglobulin assay. The stimulated B cells produced larger quantities of IgG compared to the unstimulated B cells and miRNA transfected cells but there was no difference in IgG secretion between the cells transfected with miR K12 11, miR 15 5, or the control miRNA We note this e xperiment was carried out one time. Figure 3 8. MiR K12 11 and miR 155 does not promote plasmablast proliferation. B cells were stimulated to differentiate with IL 21, anti IgM, and anti CD40 for 3 days and then transfected with miRNA control, miR K12 11, or miR 155. Edu was added to the culture 2 days post transfection and Edu incorporation was measured by the BD Click IT assay by flow cytometry. There were no significant differences in proliferation in the B cells transfected with either miR K12 11 or miR 155 when compared to the control miRNA and non transfected conditions.

PAGE 94

94 Figure 3 9. MiR K12 11 and miR 155 do not induce activation in resting nave or memory B cells. Unstimulated B cells were transfected 48 hours after plating with miRNA control, miR K12 11, and miR 155. CD38 expression was analyzed by flow cytometry 24 and 48 hours after transfection. There was no significant induction in CD38 expression in the B cells transfected with either miR K12 11 or miR 155 when compared to the control miRNA and non transfected conditions. Figure 3 10. MiR K12 11 and miR 155 do not inhibit B cell apoptosis. Unstimulated B cells were transfected 48 hours after plating with miRNA control, miR K12 11, and miR 155 B cell apoptosis was measured 5 days post transfection with BD via probe and flow cytometry. There was no observed increase in viable cells (gate P8) in either the miR K12 11 or miR 155 conditions compared to the control miRNA or a decrease in early ap optotic cells (gate P11) in either the miR K12 11 or miR 155 conditions compared to the control miRNA.

PAGE 95

95 Figure 3 11. MiR K12 11 and miR IgJ, NIK, and IRF8 were cloned downstream of firefly luciferase (pGL3) and co transfected into 293 cells with increasing amounts (400ng and 800ng) of miR 155 or miR K12 11 expression plasmids and a renilla luciferase control vector. Transfection was normalized to renilla values and firefly values were graphed as relative light units. A dose dependen t decrease in luciferase was

PAGE 96

96 Figure 3 12. MiR K12 Antagomir de repression assays were carried out in the PEL cell lines BC3 and BCBL1 using 25nM of 2 K12 11. 48 hours post transfection RNA was harvested from the PEL cell lines and derepression of each target was analyzed by qPCR and normalized to GAPDH. Mock transfected cells were used as a control. All experiments rep resent the average of three independent replicates and were repeated at least two times.

PAGE 97

97 CHAPTER 4 CONCLUSIONS AND FUTU RE DIRECTIONS KSHV miR K12 11 is a latently expressed miRNA that shares seed sequence homology with the human miRNA, miR 155. KSHV miR NAs have been shown to regulate a number of cellular processes including immune evasion, apoptosis, angiogenesis, and cell cycle regulation indicating that these miRNAs play an important function in modulating the cellular environment during infection. Th e focus of my studies in Chapter two was to evaluate miR K12 miR 155 during hematopoiesis in vivo Findings from this study revealed that miR K12 11 promotes splenic B cell proliferation, phenocopying miR 155 funct ion, and identifying an important role for this miRNA in KSHV B cell pathogenesis. To determine functional 6 and IL 10 regulator, as a target in both splenic B cells and PEL cells. In Chapter three I examined the ability of miR K12 11 to phenocopy miR 155 function in the processes of B cell activation and differentiation in vitro While I did not observe any functional consequences of miR K12 11 or miR 155 on human B cell activati on or differentiation, I did identify a number of targets that could contribute to de regulation of B cell regulatory pathways. Together these results prove that miR K12 11 is a functional mimic of miR 155 and provide further insights into the role of miR K12 11 on KSHV B cell pathogenesis. KSHV miR K12 11 functions as a miR 155 ortholog in vivo To determine whether miR K12 11 can phenocopy miR 155 activity in vivo we utilized the humanized NOD/LtSz scid IL2R null mouse model. This was the first function al study of a KSHV miRNA in the context of in vivo human hematopoietic cell

PAGE 98

98 development. Results showed that ectopic expression of either miR K12 11 or miR 155 during hematopoiesis induced an increase in the human CD19+ B cell population in the spleens of mice, without altering the CD33+ monocyte or CD3+ T cell populations. The finding that a single viral miRNA may promote B cell pathogenesis is an important discovery because KSHV is a B cell tropic virus associated with B cell lymphomas. For this study it was important that miR K12 11 and miR 155 was expressed at similar levels to endogenous expression in latently infected PEL cells in order to eliminate any potential off target consequences due to miRNA oversaturation. Interestingly, we did not observ e B cell tumor formation in our mouse model, a phenotype previously reported when miR 155 is overexpressed in the E miR 155 transgenic mouse (Costinean et al., 2006) It is possible that miR K12 11 overexpression can lead to oncomir addiction; a process where the miRNA alone is essential for the initiation, maintenance, and survival of tumors in vivo ; which has been shown for human miRNAs miR 155 and miR 21 (Costinean et al., 2009; Medina et al., 2010) While studies measuring the expression levels of miR K12 11 in PEL were done with a population of infected cells (Cai et al., 2005; Pfeffer et al., 2005; Samols et al., 2005) individu al KSHV infected B cells within the population may express significantly more miR K12 11, thus becoming sensitive to oncomir addiction. Based on differences in DNA methylation patterns found on latent and lytic promoters within a population of latently in fected B cells, it appears that differential patterns of gene expression exist (unpublished work by Irina Haeker). Determining if there is a threshold of expression where miR K12 11 becomes an oncomir in some infected cells, but not others, is important a nd can be further investigated using stronger promoters in our mouse model.

PAGE 99

99 While we observed a splenic B cell expansion induced by ectopic miRNA expression, we did not analyze B cells for increased proliferation capacity or reduced apoptosis. Both of t hese functions are promoted by miR 155 expression in EBV infected B cells, suggesting that miR K12 11 may play a similar role (Linnstaedt et al., 2010) To further exami ne this potential role we could purify transduced B cells from mice spleens, culture them ex vivo and analyze them for changes in cell cycle and apoptosis. In addition to the splenic B cell expansion, we observed abnormal B cell infiltrates in the sple nic red pulp regions of mice expressing either miR K12 11 or miR 155. This phenotype was also observed in the E miR 155 transgenic mouse model and suggests that aberrant miR 155 or miR K12 11 expression may produce homing defects in these B cells. Addit ionally, the miRNAs may be inducing pre plasma cell differentiation while inhibiting the final stage of differentiation, thereby stimulating them to leave the PALS but blocking their exit from the spleen into circulation Interestingly, miRNAs have been s hown to influence tumor invasion and metast asis (Asangani et al., 2008; Zhu et al., 2008) One potential target of miR K12 11, MYB, is a tra nscriptional activator of CXCR4, a chemokine receptor specific for stromal cell derived factor 1 that is involved in normal cell migration which is also downregulated by the latent protein v FLIP (Liu et al., 2006; Punj et al., 2010) Repression of CXCR4 expression, mediated by miR K12 11 targeting of MYB, could be one component of dysfunctional homing and will need to be further investigated. Future studies examining additional miR K12 11 targets in volved in B cell migration may help to explain the abnormal splenic infiltration.

PAGE 100

100 In t his study, we focused on the impact of a single KSHV miRNA on human hematopoiesis. Because KSHV expresses additional miRNAs, future studies are needed to examine the impact of all viral miRNAs, independently and co dependently, on human immune development Additionally, investigating the synergistic activity of these miRNAs with other KSHV latent gene products, such as the pro proliferative v Cyclin and anti apoptotic v FLIP, may reveal stronger impacts on human B cell biology, leading to a better unders tanding of how KSHV latency promotes pathogenesis. Because systems to study the direct impact of KSHV pathogenesis on human cells are lacking, this model represents an important tool for further examining the impact of KSHV miRNAs in vivo MiR K12 11 tar To identify the mechanisms contributing to the splenic B cell expansion, I examined possible miR K12 ytokine IL 6, a potent inducer of human plasmablast proliferation and survival, I proposed that its repression by miR K12 11 or miR 155 may lead to increased production and secretion of IL 6 (Jego et al., 2001) 10, another inflammatory cytokine that induces B cell proliferation and differentiation (Jego et al., 2001; Liu et al., 2003; Rousset et al., 1992) Based on the pro proliferative properties of these cytokines it is not surprising that they have also been found to promote KSHV pathogenesis. Studies of cytokine expression in PEL cells, in vitro and in vivo indicate that they produce high levels of IL 6 and IL 10 (Asou et al., 1998; Drexler et al., 1998; Jones et al., 1999; Sin et al., 2007) Moreover, both cytokines were found to promote PEL cell growth activity in an autocrine fashion (Foussat et al., 1999;

PAGE 101

101 Sin et al., 2007) While the autocrine e ffect of IL 6 on PEL cell growth appears to be dependent on the cell line (BC1 and BC3 are affected but not BCBL1) or culture condition used, IL 6 and IL 10 overproduction in patien ts with MCD is directly correlated with disease manifestation (inflammatory symptoms) and progression (Beck et al., 1994; Oksenhendler et al., 2000; Yoshizaki et al., 1989) More recently, it was found that HIV+ K SHV infected patients who exhibited inflammatory symptoms of MCD, but do not display clinical MCD, produce high levels of circulating IL 6 and IL 10 (Uldrick et al., 2010) These studies suggest that KSHV directly influences overproduction of these cytokines to promote pathogenesis. The mechanisms that KSHV utilizes to induce IL 6 and IL 10 in PEL and MCD are still unclear. In KS tumors IL 6 expression is induce d in part by the latent protein v FLIP and the lytic p rotein v GPCR (Montaner et al., 2004; Sakakibara and Tosato, 2009) The lytic protein vIL 6, a poorly secreted homologue of human IL 6, has also been shown to induce IL 6 expression in non KSHV infected cell lines (Mori et al., 2000) Evidence that KSHV miRNAs induce IL 6 expression was first provided by studies using human myelomonocytic and murine macrophage cell lines (Qin et al., 2 010) While a role for miR 155 in the regulation of cytokines was initially indicated by observations that miR 155 deficient CD4+ T cells express increased levels of IL 4, IL 5, and IL 10 (Vigorito et al., 2007) To further investigate if miR K12 cells leads to aberrant IL 6 and/or IL 10 expression, we could analyze purified transduced B cells ex vivo for cytokine expression and secretion. Serum levels from transduced mice could also be analyzed for increased levels of circulating IL 6 and IL 10. To examine if miR K12 11 affects IL 6 and IL 10 expression in PEL, we could

PAGE 102

102 inhibit miR K12 11 function with antagomirs and then analyze for changes in cytokine expression and secretion. Interestingly, two other KSHV miRNA s, miR K12 3 and miR K12 7, were shown to increase IL 6 and IL 10 secretion when ectopically expressed in human myelomonocytic and murine macrophage cell lines (Qin et al., 2010) Therefore, testing the synergistic impact of multiple KSHV miRNAs, on cytokine production in B cells, will also be important. In the centrocyte region of the germinal center, B cells receive stimulation from IL 21, IL 10, or IL 6 in order to activate STAT3, leading to increased BLIMP1 exp ression which induces plasmablast differentiation (Diehl et al., 2008; Ettinger et al., 2005; Jourdan et al., 2009) Because I have shown that miR K12 11 may induce IL 6 and IL 10 expression, it is possible that th is action may contribute to plasmablast differentiation in KSHV infected B cells. Furthermore, it has been shown that miR 155 can promote STAT3 activity by targeting SOCS1 in breast cancer cells (Jiang et al., 2010) Further investigation is needed t o determine if miR K12 11 can also promote plasmablast differentiation either by activating STAT3 through induction of IL 6 production, or by directly targeting SOCS1. In order for IL 6 to promote plasmablast differen tiation B cells must express the IL 6R (receptor). Interestingly, KSHV positive plasmablasts in PEL and MCD express high levels of hIL 6R (Asou et al., 1998; Du et al., 2001) Recently, it was found that KSHV infe ction o 6R expression (Hassman et al., 2011) Furthermore, adding exogenous IL 6 to the culture of these infected B cells promoted a blasting phenotype (Hassman et al., 2011) To investigate if miR K12 11 induction of IL 6 contributes to plasmablast differentiation we could infect purified IgM memory B

PAGE 103

103 cells with miR K12 11 KO recombinant viruses and analyze these cells for reductions in IL 6 prod uction and plasmablast differentiation. KSHV miR K12 11 does not inhibit in vitro plasma cell differentiation KSHV infected B cells in PEL and MCD appear to be stalled in a plasmablast stage of differentiation. Currently, no viral mechanism has been unco vered to explain how KSHV inhibits B cell terminal differentiation in these malignancies. Because miR 155 plays essential roles in B cell differentiation and activation, I examined miR K12 155 function, potentially blocking plas ma cell differentiation while promoting proliferation and survival of human plasmablasts. To differentiate purified resting B cells in vitro I utilized a system that is dependent on the cytokine IL 21 to drive differentiation. Results indicated no inhib ition of plasma cell differentiation based on phenotype (expression of CD38 and loss of IgD) and IgG secretion. Although I observed no inhibition of differentiation in this model system, it is possible that it does not recapitulate the type of differentia tion that occurs during KSHV infection in vivo and is therefore not influenced by miR K12 11. For example, miR K12 11 may only be capable of regulating differentiation at specific stages or in certain B cell subtypes, when its targets are expressed. Dur ing latency it is believed that KSHV miRNAs are constitutively expressed and processed, therefore the miRNAs are most likely present during most stages of KSHV B cell latent infection. In our model system, miR K12 11 is not constitutively expressed throug hout the differentiation process; therefore we may not be reproducing what occurs during natural KSHV infection. Moreover, we transfected B cells with miR K12 11 3 days after differentiation was initiated, thus missing any potential regulatory functions e arly during differentiation. To address these issues, lentiviral transductions

PAGE 104

104 of B cells with miRNA vectors, before stimulation, could allow for sustained miRNA expression throughout differentiation. This system has been successfully used to express B c ell specific proteins during plasma cell differentiation (Diehl et al., 2008) B cell differentiation into plasma cells is defined by several different stages (activation, germinal center reaction, post germinal c enter differentiation, and terminal differentiation) and sometimes does not involve a germinal center reaction These stages are determined by the expression patterns of various sets of transcription factors and transcriptional regulators, including miRNA s. The impact of a miRNA on differentiation, either as a fine tune regulator or molecular switch, is dependent on the miRNAs abundance, as well as the abundance of its target (Mukherji et al., 2011) Because an increase in target transcript abundance has been shown to saturate miRNA repression, miRNA regulation at some stages of B cell differentiation is likely redundant (Mukherji et al., 2011) Therefore, the impact of miR 155 and miR K12 11 on B cell pathway regulation may only be significant during specific points of developmental transition, when the pool of available targets i s low and miRNA expression is high. In turn, other latently expressed proteins and miRNAs could also inhibit expression of miR K12 11 targets, therefore increasing the pool of available miR K12 11 that is free to regulate other targets. Overall, host cel l gene regulation during KSHV infection is a complex and dynamic process, especially in the context of B cell differentiation pathways. Because we have only tested the affects of miR K12 11 on B cell differentiation in a static manner (one time point and one stage of differentiation), pinpointing the exact stage when miR K12 11 targeting affects differentiation requires more investigation.

PAGE 105

105 In my differentiation experiments, a heterogeneous population of purified B cells was used that consisted mostly of na ve B cells and a smaller percentage of memory B cells. While both memory and nave B cells respond to IL 21 stimulation and undergo plasma cell differentiation in vitro differentiation differs for these two subsets in vivo (Ettinger et al., 2005) To undergo plasma cell differentiation in vivo nave B cells are first activated and either undergo a GC reaction fo r selection and further differentiation into a memory or plasma B cell or differentiate into short lived plasma cells without a GC reaction. I n contrast to nave B cells memory B cells are already preactivated and can rapidly differentiate without going into a GC response (Carsetti et al., 2004) Recently, i t for latent infection ex vivo (Hassman et al., 2011; Myoung and Ganem, 2011) These cells are hypothesized to be memory B cells based on c ytoplasmic expression of IgM and variable levels of surface CD27, a phenotype very similar to KSHV infected B cells in MCD (Hassman et al., 2011) Because of the increasing evidence that KSHV may specifically targe t memory B cells, rather than nave B cells, this subset may be more sensitive to miR K12 11 regulation. Interestingly, a recent study examining human memory B cell differentiation in vitro reported that IL 21 did not affect differentiation of these cells into plasmablasts, instead IL 6 and IL 10 in combination with IL 2 and IL 15 promoted their differentiation (Jourdan et al., 2009) Therefore it is plausible that KSHV infection of memory B cells may promote plasm ablast differentiation through induction of IL 6 and IL 10. Future experiments using purified memory B cells should be used to examine the affects of miR K12 11 on the differentiation of this subset, without IL 21,

PAGE 106

106 and to further explore any functional di fferences miR K12 11 may have on nave B cell differentiation. Interestingly, PEL cells do not express miR 155 but do express miR K12 11. Currently the mechanisms of miR 155 inhibition and its importance are unclear, but it is possible that KSHV inhibitio n of miR 155 is required for the hijacking of miR 155 regulatory pathways. In our model system endogenous miR 155 is still present and is most likely induced during BCR and CD40 co stimulation, this may affect miR K12 ability to mimic miR 155. In or der to recapitulate miR K12 11 hijaking of miR 155 we would need to use B cells with miR 155 gene deletions, or possibly use antagomirs specific for miR 155 to block its function. Future studies using recombinant KSHV viruses, discussed below, are needed to further examine the importance of KSHV inhibition of miR 155 and its impact on miR K12 11 function during B cell infection. KSHV miR K12 11 d id not affect human B cell activation, proliferation, or apoptosis in vitro To further investigate miR K12 and miR analyzed their ability to induce activation and proliferation. Transfection of synthetic miRNAs into resting or stimulated B cells did not indicate any changes in activation or proliferation, when measured by CD 38 expression and Edu incorporation respectively. While miR 155 overexpression in murine models can induce both B cell and myeloproliferative disorders, ex vivo studies of miR 155 deficient murine nave B cells; stimulated with anti BCR, anti CD40, IL 4, and IL 5 have indicated no e ffects on proliferation (Thai et al., 2007; Vigorito et al., 2007) This suggests that, at least in normal resting nave B cells, miR 155 is not directly involved in promoting activation or proliferation, which correlates with our results.

PAGE 107

107 The ability of miR 155, when overexpressed, to promote B cell lymphomagenesis is not well understood. Recently, it was shown that inhibiting miR 155 function in EBV infected B cells, LCLs and DBLCLs resulted in a significant reduction of proliferation (Linnstaedt et al., 2010) However, inhibiting miR 155 function in other establ ished EBV+ B cell lines had no e ffe ct on proliferation. In a separate study, miR 155 was also shown to impart a proliferative advantage in DLBCLs by regulating a non canonical pathway that is absent in normal B cells (Rai et al., 2010) This indica tes that miR e ffect on proliferation is likely dependent on the overall cellular environment, including target expression and appropriate signaling pathways. It is possible that miR K12 11 only enhances proliferation in the context of viral infec tio n, when other viral products, li ke the pro proliferative vFLIP and the cell signaling regulators K1 and K15, are co expressed. Current studies by Karlie Plaisance, a graduate student in our lab, have shown that BJAB cells, an EBV negative BL cell line, i n fected with a miR K12 11 knock out recombinant KSHV, displays a reduction in proliferation compared to wt KSHV infected cells. Although these results require more detailed analysis with the click it EDU proliferation assay, it appears that miR K12 11 may a lso enhance proliferation in the context of KSHV infection. MiR 155 has also been shown to inhibit apoptosis in EBV infected LCLs early during infection, in our model miR K12 11 and miR 155 did not inhibit apoptosis of resting B cells in culture (Linnstaedt et al., 2010) During infection EBV expresses a number of proteins which modulate the cellular environment by turning on or repressing cellular gene expression. Th is suggests that the ability of either miRNA to inhibit apoptosis and promote cell survival may require other viral factors or is dependent on a

PAGE 108

108 specific stage of B cell activation/differentiation. Because our model system exami nes miRNA function independ ent of other viral factors, we would miss any potential synergistic activity of miR K12 11. Future studies using recombinant viruses will help to overcome this limitiation. Recombinant KSHV and miRNA knockouts To fully examine the impact of miR K12 11 on KSHV B cell infection and pathogenesis appropriate model systems are needed. Recombinant miRNA knockout viruses are currently available in our lab and will be an important tool that can be used to decipher viral miRNA function during de novo infection. R ecently, Karlie Plaisance designed a KSHV miR K12 11 knockout virus, and has begun to produce infectious virus for future experiments. The ability to create and use this virus opens the possibility of many new functional studies for miR K12 11 in the cont ext of viral de novo infection. Direct evidence that KSHV promotes B cell transformation is lacking, mostly due to the lack of appropriate in vitro models to study this process. With the recent development of in vitro B cell infection models, it is now possible to examine KSHV transformation potential (Hassman et al., 2011; Myoung and Ganem, 2011) Usi ng recombinant miR K12 11 knock out viruses combined with these B cell infection systems may reveal phenotypes re lating to transformation, including decreased proliferation and increased apoptosis. Other unanswered questions that can be st udied with this system include what B cell subtypes does KSHV target, does KSHV directly regulate cytokine expression, and how do es KSHV affect B cell differentiation? While these model systems have yet to reproduce KSHV induced B cell transformation, they offer an

PAGE 109

109 invaluable tool to examine how individual viral products, including miR K12 11, may contribute to overall pathogenesis Currently, the KSHV miRNA expression profile during de novo B cell infection is unknown because until very recently, there have been no systems to recapitulate B cell infection in vitro With the development of B cell infection systems, it should now be possible to determine patterns of KSHV miRNA expression. Determining miR K12 expression pattern in B cells can provide insights into its functional relevance at different stages of B cell differentiation. Overcoming the challenges of non existent model systems to study KSHV B cell infection and potential transformation has been a major hurdle for answering basic questions regarding KSHV miRNA regulation of B cell biology. With these new model systems and the creation of recombinant KSHV viruses, the aetiology of events that promote KSHV pathogenesis can be further understood. KSHV miR K12 11 target s and the future for miRNA target mining I have shown that miR K12 11 phenocopies miR 155 to produce a splenic human B cell expansion, indicating that m iR K12 11 targets genes involved in the growth and development of these cells. Using a combination of bioinformatic and in vitro approaches I identified several genes involved in B cell function that can be regulated by both miRNAs including PU.1, MYB, C/ EBP SHIP 1, and IgJ. Analysis of transcript abundance for PU.1, MYB, C/EBP and SHIP 1 in splenocytes, by qPCR, indicated that only C/EBP is significantly reduced. However, inhibition of miR K12 11 by antagomirs in PEL cell lines revealed a modest dere pression for all targets, except PU.1, suggesting that MYB, SHIP 1, and IgJ are valid miR K12 11 targets. The apparent inability of miR K12 11 to reduce target transcripts in harvested splenocytes could be

PAGE 110

110 due to increased expression of these genes, leadin g to an over abundance of target transcripts, thus limiting the level of miR K12 11 repression. Because B cells express genes at varying levels throughout differentiation, determining the valid miR K12 11 targets at specific points of differentiation an d latent infection remains a challenge. In addition to the six miR K12 11 targets I have identified, other miR 155 validated targets have now been found including SOCS1, SMAD5, and ETS 1, which play roles in B cell regulatory pathways. While no functiona l implications for miR K12 11 regulation of these targets were revealed by the in vitro model of plasma cell differentiation, other models, such as miR K12 11 knockout recombinant viruses, may be better suited to elucidate the mechanisms of miR K12 11 targ eting. To definitively define the KSHV miRNA targetome in PEL cells, Irina Haecker, a post doc in the laboratory, is using new techniques that combine in vivo UV crosslinking with RISC specific immunoprecipitation to probe for miRNA/mRNA interactions. H ITS CLIP (High throughput sequencing UV cross linking Immunoprecipitation) uses 254 nm UV to directly cross link RNA protein complexes prior to immunoprecipitation (Chi et al., 2009) In a second method, PAR CLIP (Photoactivatable Ribonucleoside Enhanced Crosslinking and Immunoprecipitation), c ells are first labeled with photoreactive nucleoside analogs that are incorporated into nascent mRNAs in living cells (Hafner et al., 2010) An advantage of PAR CLIP over conventional HITS CLIP is that upon cDNA cl oning of the recovered RNA, the cross linking induces base transition, which creates a RISC footprint within the recovered mRNA tag (Hafner et al., 2010) Analyzing RISC complexes from virus infected cells will hel p to catalogue the miRNA/target gene

PAGE 111

111 interaction s within specific cell types K12 11 targets a large set of gene transcripts in PEL One major limitation to these stra tegies is that the targets iden tified in PEL only represent a static picture of miRNA regulation. For example PEL cells are cultured cell lines which have undergone many cellular changes and have already undergone transformation. The process of PEL transformation is most likely a multistep process that includes miRNA regulation of targets early during infection, which would be missed by PAR CLIP/HITS CLIP analysis of PEL. To better analyze the dynamic process of KSHV miRNA targeting, these techniques, in combination with de novo KSHV B cell infections with recombinant viruses, may help to reveal miRNA targets that promote early transformation events. In summary, m y studies have shown that miR K12 11 can hijack miR 155 to regulate an overlapping set of genes involved in B cell regulatory path ways. Determining the functional relevance of miR K12 11 mimicing miR 155 target regulation requires the identification of phenotypes, which I have shown in the NOD/SCID mouse model. Future work using new models of infection and miR K1 2 11 knock out virus es should also reveal functional phenotypes for miR K12 11. Together with new methods of miRNA data mining, the functional rol es for miR K12 11 and all other viral miRNAs in t he processes underlying KSHV pathogenesis can be further elucidated. Future pro spective on KSHV miRNAs KSHV miRNAs have been shown to target a diverse list of genes that play roles in latency, proliferation, immunity, cell signaling, and transcription (Table 1 1). In addition, the data from my work shows that miR K12 11 alone can re gulate a number of genes involved in B cell biology (discussed in Chapter 3). From this ever expanding list of

PAGE 112

112 targets it appears that KSHV miRNAs play important functions in promoting KSHV infection and possibly pathogenesis. However, it is still unclea r if these miRNAs are utilized merely as an auxiliary tool or if they are essential for the lifecycle and pathogenesis of the virus Furthermore, while most studies have focused on individual miRNAs, the synergistic impact that all KSHV miRNAs have on the biology of the virus is unknown. A recent study using recombinant EBV, in which the BHRF1 miRNA cluster was deleted, revealed that these miRNAs enhance B cell transformation potential but are not absolutely required for this process (Feederle et al., 2011) Because EBV and KSHV are closely related, it is possible that the KSHV miRNAs behave in a similar manner to enhance transformation potential. If this is indeed th e case, KSHV miRNAs may represent a novel therapeutic target for the treatment of KSHV tumors. Future recombinant KSHV viruses with miRNA cluster deletions are currently being developed in our lab and will be useful in understanding the combined impact of viral miRNAs. In addition to viral miRNAs, it has been shown that many cellular miRNAs are upregulated in PEL (O'Hara et al., 2008) Some of the cellular miRNAs identified include members of the oncogenic miR 17 92 family. Th erefore, it is possible that these host miRNAs also contribute to KSHV pathogenesis. Future studies are needed to determine the functional relevance of these host miRNAs and how they may work together with viral miRNAs to regulate the host transcriptome. Because miRNAs have been linked to the formation of many human tumors, t he use of miRNA antagomirs as a possible cancer treatment are being extensively developed. The potential of this therapy has shown some promise in pre clinical

PAGE 113

113 studies, where tumor gr owth was suppressed by specific antagomirs delivered into mice (Fontana et al., 2008; Ma et al., 2010) Inhibiting viral miRNA function using this strategy may also offer a potential therapy to treat KSHV associate d tumors. However, for this strategy to work it will be important to define the KSHV miRNAs which directly promote tumorgenesis. Based on my work, miR K12 11 appears to be a good candidate for anti miR therapy because it functions as an orthologue of the oncomir miR 155. While studies in non human primates have shown that anti miR strategies can work to inhibit miRNA function (Elmen et al., 2008) limit ations still exist, mainly effective delivery into specific target cells or tissue. So, while the future of anti miR therapy to treat KSHV associated malignancies offers tantalizing potential, many questions still remain. Future experiments using newly d eveloped recombinant viruses in combination with appropriate models to test the efficacy of these treatments, will provide a strong platform to better understand and treat KSHV pathogenesis.

PAGE 114

114 A PPENDIX PROTOCOLS AND PRIMER S Isolation of Peripheral Blood Mononuclear Cells (PBMCs) Aliquot 15 ml room temperature Ficoll Paque Plus (StemCell Technologies) into 4 50 ml conical tubes. Aliquot 10ml of buffy coat using a 30 ml sterile syringe into 4 new 50 ml conical tubes. With room temperature 1x PBS (w/o Ca an d Mg) bring the volume up to 30 ml and mix by inverting tube several times. Carefully overlay the diluted buffy coat onto the Ficoll using the slowest speed on the autopipette. Centrifuge samples @ 423 RCF with the brake off for 30 minutes. With the autopi pette, remove the top layer (containing most of the platelets) very carefully within about 1 cm of the interphase (white fluffy band that contains B cells). Make sure not to disturb the interphase. With the autopipette and a sterile 1ml stripette slowly r emove the interphase (white fluffy band) while making sure that you are not sucking up any material below the interphase. Once all lymphocytes have been collected split the cells evenly into two 50 ml conical tubes. Wash 1: Bring the volume of both tubes up to 40 ml with 1xPBS (w/o Ca and Mg)/1 mM EDTA/2% FBS. Centrifuge @ 311 RCF for 10 minutes. Aspirate off as much supernatant as possible without disturbing the cell pellet. The supernatant will be cloudy at this point. Wash 2: Separate the pellet by hi tting the tube on a table top. Bring the volume of each tube up to 40 ml with 1xPBS (w/o Ca and Mg)/1 mM EDTA/2% FBS and carefully resuspend the pellet. Centrifuge @ 311 RCF for 10 minutes. Wash 3: Wash 2: Separate the pellet by hitting the tube on a tabl e top. Bring the volume of each tube up to 40 ml with 1xPBS (w/o Ca and Mg)/1 mM EDTA/2% FBS and carefully resuspend the pellet. Centrifuge @ 216 RCF for 10 minutes.

PAGE 115

115 Again carefully remove as much supernatant as possible without disturbing the pellet. Sep arate the pellet by hitting the tube on a table top. Resuspend both pellets in 2.5 ml 1xPBS (w/o Ca and Mg)/1mM EDTA/2% FBS and combine into one 50 ml concial tube (so cells will be in 5 ml total PBS). PBMCs are now ready for counting and B cell enrichment Human B cell Enrichment Count PBMCs with a hemocytometer (I usually dilute cells 100X before counting). Prepare PBMCs at a concentration of 5 x 10 7 cells/ml in room temperature 1xPBS (w/o Ca and Mg)/1 mM EDTA/2% FBS. Place 2 ml of PBMCs in 5 ml polystyre ne round bottom tubes to properly fit into the purple EasySep magnet (STEMCELL Tech. Catalog #18000). Using the Human B cell enrichment kit (STEMCELL Tech. Catalog #19054) add 100 ul (50 ul/ml of cells) Human B cell enrichment cocktail. Mix well and incub ate at room temperature for 10 minutes. Vortex EasySep D Magnetic Particles to ensure that they are in a uniform suspension. Add 150ul (75 ul/ml of cells) D Particles. Mix well and incubate at room temperature for 5 minutes. Add 250 ul 1xPBS (w/o Ca and Mg)/1 mM EDTA/2% FBS (Brings total volume to 2.5 ml). Mix cells by gently pipetting up and down 2 3 times. Place the tube (without the cap) into the magnet. Set aside for 5 minutes. Pick up the EasySep Magnet, and in one continuous motion invert the mag net and tube, pouring off the desired fraction (B cells) into a new 5ml polystyrene tube. The magnetically unwanted cells will remain bound inside the original tube, held by the magnetic field of the magnet. Leave the magnet and the tube inverted for 2 3 seconds (do not shake or blot off any drops that remain hanging from the mouth of the tube!!!) and then return to upright position. The negatively selected B cells are now ready to analyze. Count B cells with a hemocytometer (I usually dilute cells 10X be fore counting). Analyze purity of B cells (50,000 cells/facs tube) using 5ul V450 Mouse Anti Human CD19 antibody (BD Biosciences Catalog #560353). B cells should be a 95 98% pure population.

PAGE 116

116 You can also analyze cells for IgD expression (20 ul PE Mouse An ti Human IgD BD Biosciences Catalog #555779) and CD38 expression (5 ul APC clone HB7 Catalog #340439). Keep the cells for analysis in 1xPBS (w/o Ca and Mg)/1 mM EDTA/2% FBS. Pellet the remaining cells @311 RCF for 10 min utes Resuspend pellet in enough B cell medium (described in protocol below) to keep the concentration around 6 x 10 6 cells/ml for B cell differentiation. B cell medium 500 ml 1640 RPMI 5 ml 100 mM Sodium Pyruvate (1 mM final concentration) 50 ml FBS (10% final concentration) 5 ml Penicilli n/Streptomycin (1% final concentration) In vitro plasma cell differentiation Count purified B cells with a hemocytometer. Prepare B cell media with the following: 15 ng/well IL 21 (Peprotech Recombinant Human IL 21 Catalog #200 21), 500 ng/well anti IgM (J ackson ImmunoResearch 2 Fragment Goat Anti Human IgM Catalog #109 006 129) 10 ng/well anti CD40 (R&D Systems anti human CD40/TNFRSF5 Antibody Catalog#AF632) Plate cells in 96 well round bottom plates (BD Falcon clear tissue culture treate d with lid Catalog #353227) at a density of 5 x 10 4 cells/well in 100 ul room temperature B cell medium + stimulatory factors (IL 21, anti CD40, and anti IgM). Anti CD40 removal: 3 days post stimulation harvest cells into 1.5 ml eppendorf tubes, pellet @ 5 00 RCF for 5 min, remove media, and replate in 100 ul room temperature B cell media with 15 ng/well IL 21 and 500 ng/well anti IgM but without anti CD40. 7 days post stimulation harvest cells, pellet @ 500 RCF for 5 min, resuspend in 100 ul 1xPBS (w/o Ca a nd Mg) and add to facs tubes. Add 20 ul anti IgD and 5ul anti CD38 to facs tubes with cells, mix, and protect tubes from light until you analyze them by flow. For flow analysis add ~1 ml 1xPBS (w/o Ca and Mg) to the tube, vortex, and analyze.

PAGE 117

117 MiRNA mimic transfection Transfection is carried out in 96 well round bottom plates (BD Falcon clear tissue culture treated with lid Catalog #353227) containing 100 ul total media/well. 1 st make transfection mixture containing: 9 ul/well room temperature Opti MEM Re duced Serum Medium (Invitrogen Catalog #31985 062). 0.35 ul/well room temperature Mirus TransIT TKO transfection reagent (Mirus Bio LLC Catalog #MIR 2152). Vortex transfection mixture and incubate 10 min utes @ room temperature. Add 125 nM/well miRNA mimic (Thermo Scientific miRIDIAN microRNA mimic), for a transfection control use Dy547 conjugate mimic (Catalog #CP 004500 01 05), to the transfection mixture and mix by gentle pipetting, incubate 10 min utes @ room temperature. Add transfection mixture dropwis e to cells. If worried about toxicity of transfection mixture (especially for primary B cells) change media 6 hours post transfection B cell proliferation assay Proliferation is measured using the Click iT Edu Flow Cytometry Assay Kit with Alexa Fluor 647 azide (Invitrogen Catalog #C10424). To measure rapidly proliferating cell types (PEL and BJAB) cells should be incubated with 10 uM Edu for 2 hours. For slowly proliferating cells, longer incubations with lower concentrations of Edu may be required. I fo llowed the protocol for the assay with the following minor adjustments: The amounts of all components can be reduced by half, for example instead of 500 ul of the Click IT reaction cocktail you can use 250 ul, therefore you will get twice the number of rea ctions from each kit. Wash the cells with 1ml of 1% BSA in PBS (w/o Ca and Mg) instead of 3 ml. After fixing the cells and washing them in 1 ml of 1% BSA in PBS (w/o Ca and Mg) you can store the fixed cells up to one week @ 4 C in 100 ul 1% BSA in PBS (w/o Ca and Mg).

PAGE 118

118 Primers for qPCR BACH1 Forward primer: CACCGAAGGAGACAGTGAATC BACH1 Reverse primer: TGTTCTGGAGTAAGCTTGTGC SHIP1 Forward primer: AGTACAACTTGCCTTCCTGG SHIP1 Reverse primer: TGACTCCTGCCTCAAATGTG MYB Forward primer: TCAGGAAACTTCTTCTGCTCACA MYB Reverse primer: AGGTTCCCAGGTACTGCT

PAGE 119

119 LIST OF REFERENCES Abend, J.R., Uldrick, T., and Ziegelbauer, J.M. (2010). Regulation of tumor necrosis factor like weak inducer of apoptosis receptor protein (TWEAKR) expressi on by Kaposi's sarcoma associated herpesvirus microRNA prevents TWEAK induced apoptosis and inflammatory cytokine expression. Journal of virology 84 12139 12151. Ambros, V. (2004). The functions of animal microRNAs. Nature 431 350 355. Ambroziak, J.A., B lackbourn, D.J., Herndier, B.G., Glogau, R.G., Gullett, J.H., McDonald, A.R., Lennette, E.T., and Levy, J.A. (1995). Herpes like sequences in HIV infected and uninfected Kaposi's sarcoma patients. Science 268 582 583. Antman, K., and Chang, Y. (2000). Kap osi's sarcoma. N Engl J Med 342 1027 1038. Areste, C., and Blackbourn, D.J. (2009). Modulation of the immune system by Kaposi's sarcoma associated herpesvirus. Trends Microbiol 17 119 129. Arguello, M., Sgarbanti, M., Hernandez, E., Mamane, Y., Sharma, S ., Servant, M., Lin, R., and Hiscott, J. (2003). Disruption of the B cell specific transcriptional program in HHV 8 associated primary effusion lymphoma cell lines. Oncogene 22 964 973. Asangani, I.A., Rasheed, S.A., Nikolova, D.A., Leupold, J.H., Colburn N.H., Post, S., and Allgayer, H. (2008). MicroRNA 21 (miR 21) post transcriptionally downregulates tumor suppressor Pdcd4 and stimulates invasion, intravasation and metastasis in colorectal cancer. Oncogene 27 2128 2136. Asou, H., Said, J.W., Yang, R., Munker, R., Park, D.J., Kamada, N., and Koeffler, H.P. (1998). Mechanisms of growth control of Kaposi's sarcoma associated herpes virus associated primary effusion lymphoma cells. Blood 91 2475 2481. Baek, D., Villen, J., Shin, C., Camargo, F.D., Gygi, S. P., and Bartel, D.P. (2008). The impact of microRNAs on protein output. Nature 455 64 71. Ballestas, M.E., Chatis, P.A., and Kaye, K.M. (1999). Efficient persistence of extrachromosomal KSHV DNA mediated by latency associated nuclear antigen. Science 284 641 644. Baltimore, D., Boldin, M.P., O'Connell, R.M., Rao, D.S., and Taganov, K.D. (2008). MicroRNAs: new regulators of immune cell development and function. Nature immunology 9 839 845. Bartel, D.P. (2009). MicroRNAs: target recognition and regulatory functions. Cell 136 215 233. Basso, K., Sumazin, P., Morozov, P., Schneider, C., Maute, R.L., Kitagawa, Y., Mandelbaum, J., Haddad, J., Jr., Chen, C.Z., Califano, A., and Dalla Favera, R. (2009). Identification of the human mature B cell miRNome. Immunit y 30 744 752.

PAGE 120

120 Bechtel, J.T., Liang, Y., Hvidding, J., and Ganem, D. (2003). Host range of Kaposi's sarcoma associated herpesvirus in cultured cells. Journal of virology 77 6474 6481. Beck, J.T., Hsu, S.M., Wijdenes, J., Bataille, R., Klein, B., Vesole, D ., Hayden, K., Jagannath, S., and Barlogie, B. (1994). Brief report: alleviation of systemic manifestations of Castleman's disease by monoclonal anti interleukin 6 antibody. N Engl J Med 330 602 605. Bellare, P., and Ganem, D. (2009). Regulation of KSHV l ytic switch protein expression by a virus encoded microRNA: an evolutionary adaptation that fine tunes lytic reactivation. Cell host & microbe 6 570 575. Beral, V., Peterman, T.A., Berkelman, R.L., and Jaffe, H.W. (1990). Kaposi's sarcoma among persons wi th AIDS: a sexually transmitted infection? Lancet 335 123 128. Blackbourn, D.J., Lennette, E., Klencke, B., Moses, A., Chandran, B., Weinstein, M., Glogau, R.G., Witte, M.H., Way, D.L., Kutzkey, T. et al. (2000). The restricted cellular host range of hum an herpesvirus 8. Aids 14 1123 1133. Bloom, D.C., Giordani, N.V., and Kwiatkowski, D.L. (2010). Epigenetic regulation of latent HSV 1 gene expression. Biochim Biophys Acta 1799 246 256. Bolisetty, M.T., Dy, G., Tam, W., and Beemon, K.L. (2009). Reticuloe ndotheliosis virus strain T induces miR 155, which targets JARID2 and promotes cell survival. Journal of virology 83 12009 12017. Boshoff, C., and Weiss, R. (2002). AIDS related malignancies. Nat Rev Cancer 2 373 382. Boss, I.W., Plaisance, K.B., and Ren ne, R. (2009). Role of virus encoded microRNAs in herpesvirus biology. Trends Microbiol 17 544 553. Brimo, F., Michel, R.P., Khetani, K., and Auger, M. (2007). Primary effusion lymphoma: a series of 4 cases and review of the literature with emphasis on cy tomorphologic and immunocytochemical differential diagnosis. Cancer 111 224 233. Brinkmann, M.M., and Schulz, T.F. (2006). Regulation of intracellular signalling by the terminal membrane proteins of members of the Gammaherpesvirinae. J Gen Virol 87 1047 1074. Bryant, V.L., Ma, C.S., Avery, D.T., Li, Y., Good, K.L., Corcoran, L.M., de Waal Malefyt, R., and Tangye, S.G. (2007). Cytokine mediated regulation of human B cell differentiation into Ig secreting cells: predominant role of IL 21 produced by CXCR5+ T follicular helper cells. J Immunol 179 8180 8190. Burnside, J., Bernberg, E., Anderson, A., Lu, C., Meyers, B.C., Green, P.J., Jain, N., Isaacs, G., and Morgan, R.W. (2006). Marek's disease virus encodes MicroRNAs that map to meq and the latency associa ted transcript. Journal of virology 80 8778 8786.

PAGE 121

121 Cai, X., and Cullen, B.R. (2006). Transcriptional origin of Kaposi's sarcoma associated herpesvirus microRNAs. Journal of virology 80 2234 2242. Cai, X., Lu, S., Zhang, Z., Gonzalez, C.M., Damania, B., an d Cullen, B.R. (2005). Kaposi's sarcoma associated herpesvirus expresses an array of viral microRNAs in latently infected cells. Proceedings of the National Academy of Sciences of the United States of America 102 5570 5575. Cai, X., Schafer, A., Lu, S., B ilello, J.P., Desrosiers, R.C., Edwards, R., Raab Traub, N., and Cullen, B.R. (2006). Epstein Barr virus microRNAs are evolutionarily conserved and differentially expressed. PLoS Pathog 2 e23. Caldwell, R.G., Wilson, J.B., Anderson, S.J., and Longnecker, R. (1998). Epstein Barr virus LMP2A drives B cell development and survival in the absence of normal B cell receptor signals. Immunity 9 405 411. Cameron, J.E., Fewell, C., Yin, Q., McBride, J., Wang, X., Lin, Z., and Flemington, E.K. (2008). Epstein Barr virus growth/latency III program alters cellular microRNA expression. Virology 382 257 266. Carbone, A., Cesarman, E., Gloghini, A., and Drexler, H.G. (2010). Understanding pathogenetic aspects and clinical presentation of primary effusion lymphoma throug h its derived cell lines. Aids 24 479 490. Carbone, A., and Gloghini, A. (2008). KSHV/HHV8 associated lymphomas. Br J Haematol 140 13 24. Carbone, A., Gloghini, A., Cozzi, M.R., Capello, D., Steffan, A., Monini, P., De Marco, L., and Gaidano, G. (2000). Expression of MUM1/IRF4 selectively clusters with primary effusion lymphoma among lymphomatous effusions: implications for disease histogenesis and pathogenesis. Br J Haematol 111 247 257. Carsetti, R., Rosado, M.M., and Wardmann, H. (2004). Peripheral de velopment of B cells in mouse and man. Immunological reviews 197 179 191. CDC (1981). Kaposi's sarcoma and Pneumocystis pneumonia among homosexual men New York City and California. In Mmwr, pp. 305 308. Ceppi, M., Pereira, P.M., Dunand Sauthier, I., Barr as, E., Reith, W., Santos, M.A., and Pierre, P. (2009). MicroRNA 155 modulates the interleukin 1 signaling pathway in activated human monocyte derived dendritic cells. Proceedings of the National Academy of Sciences of the United States of America 106 273 5 2740. Cesarman, E. (2011). Gammaherpesvirus and lymphoproliferative disorders in immunocompromised patients. Cancer Lett 305 163 174.

PAGE 122

122 Cesarman, E., Chang, Y., Moore, P.S., Said, J.W., and Knowles, D.M. (1995). Kaposi's sarcoma associated herpesvirus lik e DNA sequences in AIDS related body cavity based lymphomas. N Engl J Med 332 1186 1191. Cesarman, E., and Knowles, D.M. (1999). The role of Kaposi's sarcoma associated herpesvirus (KSHV/HHV 8) in lymphoproliferative diseases. Semin Cancer Biol 9 165 174 Chadburn, A., Hyjek, E.M., Tam, W., Liu, Y., Rengifo, T., Cesarman, E., and Knowles, D.M. (2008). Immunophenotypic analysis of the Kaposi sarcoma herpesvirus (KSHV; HHV 8) infected B cells in HIV+ multicentric Castleman disease (MCD). Histopathology 53 513 524. Chang, Y., Cesarman, E., Pessin, M.S., Lee, F., Culpepper, J., Knowles, D.M., and Moore, P.S. (1994). Identification of herpesvirus like DNA sequences in AIDS associated Kaposi's sarcoma [see comments]. Science 266 1865 1869. Chen, C.Z., Li, L., Lodish, H.F., and Bartel, D.P. (2004). MicroRNAs modulate hematopoietic lineage differentiation. Science 303 83 86. Chi, S.W., Zang, J.B., Mele, A., and Darnell, R.B. (2009). Argonaute HITS CLIP decodes microRNA mRNA interaction maps. Nature 460 479 486. Cirone, M., Lucania, G., Aleandri, S., Borgia, G., Trivedi, P., Cuomo, L., Frati, L., and Faggioni, A. (2008). Suppression of dendritic cell differentiation through cytokines released by Primary Effusion Lymphoma cells. Immunology letters 120 37 41. Cosm opoulos, K., Pegtel, M., Hawkins, J., Moffett, H., Novina, C., Middeldorp, J., and Thorley Lawson, D.A. (2009). Comprehensive profiling of Epstein Barr virus microRNAs in nasopharyngeal carcinoma. Journal of virology 83 2357 2367. Costinean, S., Sandhu, S .K., Pedersen, I.M., Tili, E., Trotta, R., Perrotti, D., Ciarlariello, D., Neviani, P., Harb, J., Kauffman, L.R. et al. (2009). Src homology 2 domain containing inositol 5 phosphatase and CCAAT enhancer binding protein beta are targeted by miR 155 in B ce lls of Emicro MiR 155 transgenic mice. Blood 114 1374 1382. Costinean, S., Zanesi, N., Pekarsky, Y., Tili, E., Volinia, S., Heerema, N., and Croce, C.M. (2006). Pre B cell proliferation and lymphoblastic leukemia/high grade lymphoma in E(mu) miR155 transg enic mice. Proceedings of the National Academy of Sciences of the United States of America 103 7024 7029. Cui, C., Griffiths, A., Li, G., Silva, L.M., Kramer, M.F., Gaasterland, T., Wang, X.J., and Coen, D.M. (2006). Prediction and identification of herpe s simplex virus 1 encoded microRNAs. Journal of virology 80 5499 5508. de Oliveira, D.E., Ballon, G., and Cesarman, E. (2010). NF kappaB signaling modulation by EBV and KSHV. Trends Microbiol 18 248 257.

PAGE 123

123 Diehl, S.A., Schmidlin, H., Nagasawa, M., van Hare n, S.D., Kwakkenbos, M.J., Yasuda, E., Beaumont, T., Scheeren, F.A., and Spits, H. (2008). STAT3 mediated up regulation of BLIMP1 Is coordinated with BCL6 down regulation to control human plasma cell differentiation. J Immunol 180 4805 4815. Dittmer, D., Lagunoff, M., Renne, R., Staskus, K., Haase, A., and Ganem, D. (1998). A cluster of latently expressed genes in Kaposi's sarcoma associated herpesvirus. Journal of virology 72 8309 8315. Dorsett, Y., McBride, K.M., Jankovic, M., Gazumyan, A., Thai, T.H., Robbiani, D.F., Di Virgilio, M., Reina San Martin, B., Heidkamp, G., Schwickert, T.A. et al. (2008). MicroRNA 155 suppresses activation induced cytidine deaminase mediated Myc Igh translocation. Immunity 28 630 638. Dourmishev, L.A., Dourmishev, A.L., Pa lmeri, D., Schwartz, R.A., and Lukac, D.M. (2003). Molecular genetics of Kaposi's sarcoma associated herpesvirus (human herpesvirus 8) epidemiology and pathogenesis. Microbiol Mol Biol Rev 67 175 212, table of contents. Drexler, H.G., Uphoff, C.C., Gaidan o, G., and Carbone, A. (1998). Lymphoma cell lines: in vitro models for the study of HHV 8+ primary effusion lymphomas (body cavity based lymphomas). Leukemia 12 1507 1517. Du, M.Q., Diss, T.C., Liu, H., Ye, H., Hamoudi, R.A., Cabecadas, J., Dong, H.Y., H arris, N.L., Chan, J.K., Rees, J.W. et al. (2002). KSHV and EBV associated germinotropic lymphoproliferative disorder. Blood 100 3415 3418. Du, M.Q., Liu, H., Diss, T.C., Ye, H., Hamoudi, R.A., Dupin, N., Meignin, V., Oksenhendler, E., Boshoff, C., and Isaacson, P.G. (2001). Kaposi sarcoma associated herpesvirus infects monotypic (IgM lambda) but polyclonal naive B cells in Castleman disease and associated lymphoproliferative disorders. Blood 97 2130 2136. Dunn, C., Chalupny, N.J., Sutherland, C.L., Dos ch, S., Sivakumar, P.V., Johnson, D.C., and Cosman, D. (2003). Human cytomegalovirus glycoprotein UL16 causes intracellular sequestration of NKG2D ligands, protecting against natural killer cell cytotoxicity. J Exp Med 197 1427 1439. Dunn, W., Trang, P., Zhong, Q., Yang, E., van Belle, C., and Liu, F. (2005). Human cytomegalovirus expresses novel microRNAs during productive viral infection. Cell Microbiol 7 1684 1695. Dupin, N., Diss, T.L., Kellam, P., Tulliez, M., Du, M.Q., Sicard, D., Weiss, R.A., Isaac son, P.G., and Boshoff, C. (2000). HHV 8 is associated with a plasmablastic variant of Castleman disease that is linked to HHV 8 positive plasmablastic lymphoma. Blood 95 1406 1412.

PAGE 124

124 Edwards, R.H., Marquitz, A.R., and Raab Traub, N. (2008). Epstein Barr vi rus BART microRNAs are produced from a large intron prior to splicing. Journal of virology 82 9094 9106. Eis, P.S., Tam, W., Sun, L., Chadburn, A., Li, Z., Gomez, M.F., Lund, E., and Dahlberg, J.E. (2005). Accumulation of miR 155 and BIC RNA in human B ce ll lymphomas. Proceedings of the National Academy of Sciences of the United States of America 102 3627 3632. Elmen, J., Lindow, M., Schutz, S., Lawrence, M., Petri, A., Obad, S., Lindholm, M., Hedtjarn, M., Hansen, H.F., Berger, U. et al. (2008). LNA med iated microRNA silencing in non human primates. Nature 452 896 899. Ettinger, R., Kuchen, S., and Lipsky, P.E. (2008). The role of IL 21 in regulating B cell function in health and disease. Immunological reviews 223 60 86. Ettinger, R., Sims, G.P., Fairh urst, A.M., Robbins, R., da Silva, Y.S., Spolski, R., Leonard, W.J., and Lipsky, P.E. (2005). IL 21 induces differentiation of human naive and memory B cells into antibody secreting plasma cells. J Immunol 175 7867 7879. Fais, F., Gaidano, G., Capello, D. Gloghini, A., Ghiotto, F., Roncella, S., Carbone, A., Chiorazzi, N., and Ferrarini, M. (1999). Immunoglobulin V region gene use and structure suggest antigen selection in AIDS related primary effusion lymphomas. Leukemia 13 1093 1099. Feederle, R., Linn staedt, S.D., Bannert, H., Lips, H., Bencun, M., Cullen, B.R., and Delecluse, H.J. (2011). A viral microRNA cluster strongly potentiates the transforming properties of a human herpesvirus. PLoS Pathog 7 e1001294. Flore, O., Rafii, S., Ely, S., O'Leary, J. J., Hyjek, E.M., and Cesarman, E. (1998). Transformation of primary human endothelial cells by Kaposi's sarcoma associated herpesvirus. Nature 394 588 592. Fontana, L., Fiori, M.E., Albini, S., Cifaldi, L., Giovinazzi, S., Forloni, M., Boldrini, R., Donfr ancesco, A., Federici, V., Giacomini, P. et al. (2008). Antagomir 17 5p abolishes the growth of therapy resistant neuroblastoma through p21 and BIM. PloS one 3 e2236. Foussat, A., Wijdenes, J., Bouchet, L., Gaidano, G., Neipel, F., Balabanian, K., Galana ud, P., Couderc, J., and Emilie, D. (1999). Human interleukin 6 is in vivo an autocrine growth factor for human herpesvirus 8 infected malignant B lymphocytes. European cytokine network 10 501 508. Friedman, R.C., Farh, K.K., Burge, C.B., and Bartel, D.P. (2009). Most mammalian mRNAs are conserved targets of microRNAs. Genome research 19 92 105. Ganem, D. (2006). KSHV infection and the pathogenesis of Kaposi's sarcoma. Annual review of pathology 1 273 296.

PAGE 125

125 Gartner, K., Wiktorowicz, T., Park, J., Mergia, A., Rethwilm, A., and Scheller, C. (2009). Accuracy estimation of foamy virus genome copying. Retrovirology 6 32. Garzon, R., Volinia, S., Liu, C.G., Fernandez Cymering, C., Palumbo, T., Pichiorri, F., Fabbri, M., Coombes, K., Alder, H., Nakamura, T. et al. (2008). MicroRNA signatures associated with cytogenetics and prognosis in acute myeloid leukemia. Blood 111 3183 3189. Gatto, G., Rossi, A., Rossi, D., Kroening, S., Bonatti, S., and Mallardo, M. (2008). Epstein Barr virus latent membrane protein 1 tr ans activates miR 155 transcription through the NF kappaB pathway. Nucleic Acids Res 36 6608 6619. Georgantas, R.W., 3rd, Hildreth, R., Morisot, S., Alder, J., Liu, C.G., Heimfeld, S., Calin, G.A., Croce, C.M., and Civin, C.I. (2007). CD34+ hematopoietic stem progenitor cell microRNA expression and function: a circuit diagram of differentiation control. Proceedings of the National Academy of Sciences of the United States of America 104 2750 2755. Gessain, A. (1997). [Human herpesvirus 8 and associated dis eases: Kaposi's sarcoma, body cavity based lymphoma and multicentric Castleman disease: clinical and molecular epidemiology]. Bulletin de l'Academie nationale de medecine 181 1023 1034. Giassi, L.J., Pearson, T., Shultz, L.D., Laning, J., Biber, K., Kraus M., Woda, B.A., Schmidt, M.R., Woodland, R.T., Rossini, A.A., and Greiner, D.L. (2008). Expanded CD34+ human umbilical cord blood cells generate multiple lymphohematopoietic lineages in NOD scid IL2rgamma(null) mice. Experimental biology and medicine (Ma ywood, N.J 233 997 1012. Gottlieb, G.J., Ragaz, A., Vogel, J.V., Friedman Kien, A., Rywlin, A.M., Weiner, E.A., and Ackerman, A.B. (1981). A preliminary communication on extensively disseminated Kaposi's sarcoma in young homosexual men. The American Journ al of dermatopathology 3 111 114. Gottwein, E., and Cullen, B.R. (2010). A human herpesvirus microRNA inhibits p21 expression and attenuates p21 mediated cell cycle arrest. Journal of virology 84 5229 5237. Gottwein, E., Mukherjee, N., Sachse, C., Frenze l, C., Majoros, W.H., Chi, J.T., Braich, R., Manoharan, M., Soutschek, J., Ohler, U., and Cullen, B.R. (2007). A viral microRNA functions as an orthologue of cellular miR 155. Nature 450 1096 1099. Grey, F., Antoniewicz, A., Allen, E., Saugstad, J., McShe a, A., Carrington, J.C., and Nelson, J. (2005). Identification and characterization of human cytomegalovirus encoded microRNAs. Journal of virology 79 12095 12099. Griffiths Jones, S. (2004). The microRNA Registry. Nucleic Acids Res 32 D109 111.

PAGE 126

126 Grimson, A., Farh, K.K., Johnston, W.K., Garrett Engele, P., Lim, L.P., and Bartel, D.P. (2007). MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell 27 91 105. Grundhoff, A., and Ganem, D. (2003). The latency associated nuclear a ntigen of Kaposi's sarcoma associated herpesvirus permits replication of terminal repeat containing plasmids. Journal of virology 77 2779 2783. Grundhoff, A., and Sullivan, C.S. (2011). Virus encoded microRNAs. Virology 411 325 343. Grundhoff, A., Sulliv an, C.S., and Ganem, D. (2006). A combined computational and microarray based approach identifies novel microRNAs encoded by human gamma herpesviruses. Rna 12 733 750. Guo, H., Ingolia, N.T., Weissman, J.S., and Bartel, D.P. (2010). Mammalian microRNAs pr edominantly act to decrease target mRNA levels. Nature 466 835 840. Hafner, M., Landthaler, M., Burger, L., Khorshid, M., Hausser, J., Berninger, P., Rothballer, A., Ascano, M., Jr., Jungkamp, A.C., Munschauer, M. et al. (2010). Transcriptome wide identi fication of RNA binding protein and microRNA target sites by PAR CLIP. Cell 141 129 141. Hansen, A., Henderson, S., Lagos, D., Nikitenko, L., Coulter, E., Roberts, S., Gratrix, F., Plaisance, K., Renne, R., Bower, M. et al. (2010). KSHV encoded miRNAs ta rget MAF to induce endothelial cell reprogramming. Genes Dev 24 195 205. Hassman, L.M., Ellison, T.J., and Kedes, D.H. (2011). KSHV infects a subset of human tonsillar B cells, driving proliferation and plasmablast differentiation. J Clin Invest 121 752 768. Hu, J., Garber, A.C., and Renne, R. (2002). The latency associated nuclear antigen of Kaposi's sarcoma associated herpesvirus supports latent DNA replication in dividing cells. Journal of virology 76 11677 11687. Huntzinger, E., and Izaurralde, E. (2 011). Gene silencing by microRNAs: contributions of translational repression and mRNA decay. Nat Rev Genet 12 99 110. Hutvagner, G., and Zamore, P.D. (2002). A microRNA in a multiple turnover RNAi enzyme complex. Science 297 2056 2060. Igarashi, K., and Sun, J. (2006). The heme Bach1 pathway in the regulation of oxidative stress response and erythroid differentiation. Antioxidants & redox signaling 8 107 118. Jego, G., Bataille, R., and Pellat Deceunynck, C. (2001). Interleukin 6 is a growth factor for n onmalignant human plasmablasts. Blood 97 1817 1822.

PAGE 127

127 Jenner, R.G., Maillard, K., Cattini, N., Weiss, R.A., Boshoff, C., Wooster, R., and Kellam, P. (2003). Kaposi's sarcoma associated herpesvirus infected primary effusion lymphoma has a plasma cell gene ex pression profile. Proceedings of the National Academy of Sciences of the United States of America 100 10399 10404. Jiang, J., Lee, E.J., and Schmittgen, T.D. (2006). Increased expression of microRNA 155 in Epstein Barr virus transformed lymphoblastoid cel l lines. Genes, chromosomes & cancer 45 103 106. Jiang, S., Zhang, H.W., Lu, M.H., He, X.H., Li, Y., Gu, H., Liu, M.F., and Wang, E.D. (2010). MicroRNA 155 functions as an OncomiR in breast cancer by targeting the suppressor of cytokine signaling 1 gene. Cancer Res 70 3119 3127. Jones, K.D., Aoki, Y., Chang, Y., Moore, P.S., Yarchoan, R., and Tosato, G. (1999). Involvement of interleukin 10 (IL 10) and viral IL 6 in the spontaneous growth of Kaposi's sarcoma herpesvirus associated infected primary effusio n lymphoma cells. Blood 94 2871 2879. Jourdan, M., Caraux, A., De Vos, J., Fiol, G., Larroque, M., Cognot, C., Bret, C., Duperray, C., Hose, D., and Klein, B. (2009). An in vitro model of differentiation of memory B cells into plasmablasts and plasma cell s including detailed phenotypic and molecular characterization. Blood 114 5173 5181. Kasof, G.M., Goyal, L., and White, E. (1999). Btf, a novel death promoting transcriptional repressor that interacts with Bcl 2 related proteins. Mol Cell Biol 19 4390 44 04. Khaled, A.R., Butfiloski, E.J., Sobel, E.S., and Schiffenbauer, J. (1998). Functional consequences of the SHP 1 defect in motheaten viable mice: role of NF kappa B. Cellular immunology 185 49 58. Klein, B., Zhang, X.G., Lu, Z.Y., and Bataille, R. (199 5). Interleukin 6 in human multiple myeloma. Blood 85 863 872. Klein, U., Gloghini, A., Gaidano, G., Chadburn, A., Cesarman, E., Dalla Favera, R., and Carbone, A. (2003). Gene expression profile analysis of AIDS related primary effusion lymphoma (PEL) sug gests a plasmablastic derivation and identifies PEL specific transcripts. Blood 101 4115 4121. Kluiver, J., Poppema, S., de Jong, D., Blokzijl, T., Harms, G., Jacobs, S., Kroesen, B.J., and van den Berg, A. (2005). BIC and miR 155 are highly expressed in Hodgkin, primary mediastinal and diffuse large B cell lymphomas. J Pathol 207 243 249. Koelle, D.M., Huang, M.L., Chandran, B., Vieira, J., Piepkorn, M., and Corey, L. (1997). Frequent detection of Kaposi's sarcoma associated herpesvirus (human herpesviru s 8) DNA in saliva of human immunodeficiency virus infected men: clinical and immunologic correlates. J Infect Dis 176 94 102.

PAGE 128

128 Lacoste, V., Nicot, C., Gessain, A., Valensi, F., Gabarre, J., Matta, H., Chaudhary, P.M., and Mahieux, R. (2007). In primary ef fusion lymphoma cells, MYB transcriptional repression is associated with v FLIP expression during latent KSHV infection while both v FLIP and v GPCR become involved during the lytic cycle. Br J Haematol 138 487 501. Lagunoff, M., Majeti, R., Weiss, A., an d Ganem, D. (1999). Deregulated signal transduction by the K1 gene product of Kaposi's sarcoma associated herpesvirus. Proceedings of the National Academy of Sciences of the United States of America 96 5704 5709. Lan, K., Kuppers, D.A., Verma, S.C., and R obertson, E.S. (2004). Kaposi's sarcoma associated herpesvirus encoded latency associated nuclear antigen inhibits lytic replication by targeting Rta: a potential mechanism for virus mediated control of latency. Journal of virology 78 6585 6594. Larroche, C., Cacoub, P., Soulier, J., Oksenhendler, E., Clauvel, J.P., Piette, J.C., and Raphael, M. (2002). Castleman's disease and lymphoma: report of eight cases in HIV negative patients and literature review. American journal of hematology 69 119 126. Lee, R. C., Feinbaum, R.L., and Ambros, V. (1993). The C. elegans heterochronic gene lin 4 encodes small RNAs with antisense complementarity to lin 14. Cell 75 843 854. Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., Radmark, O., Kim, S., and Kim, V.N. (2003). The nuclear RNase III Drosha initiates microRNA processing. Nature 425 415 419. Lei, X., Bai, Z., Ye, F., Xie, J., Kim, C.G., Huang, Y., and Gao, S.J. (2010). Regulation of NF kappaB inhibitor IkappaBalpha and viral replication by a KSHV microRNA. Nat Cell Biol 12 193 199. Lewis, B.P., Burge, C.B., and Bartel, D.P. (2005). Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 120 15 20. Liang, D., Gao, Y., Lin, X ., He, Z., Zhao, Q., Deng, Q., and Lan, K. (2011). A human herpesvirus miRNA attenuates interferon signaling and contributes to maintenance of viral latency by targeting IKKvarepsilon. Cell research 21 793 806. Lieberman, P.M., Hu, J., and Renne, R. (2007 ). Maintenance and replication during latency. In Human Herpesviruses: Biology, Therapy, and Immunoprophylaxis, A. Arvin, G. Campadelli Fiume, and E. Mocarski, eds. (Cambridge University Press). Lim, L.P., Lau, N.C., Weinstein, E.G., Abdelhakim, A., Yekta, S., Rhoades, M.W., Burge, C.B., and Bartel, D.P. (2003). The microRNAs of Caenorhabditis elegans. Genes Dev 17 991 1008.

PAGE 129

129 Lin, K.I., Tunyaplin, C., and Calame, K. (2003). Transcriptional regulatory cascades controlling plasma cell differentiation. Immunol ogical reviews 194 19 28. Lin, X., Liang, D., He, Z., Deng, Q., Robertson, E.S., and Lan, K. (2011 ). miR K12 7 5p encoded by Kaposi's sarcoma associated herpesvirus stabilizes the latent state by targeting viral ORF50/RTA. PloS one 6 e16224. Linnstaedt, S.D., Gottwein, E., Skalsky, R.L., Luftig, M.A., and Cullen, B.R. (2010). Virally induced cellular microRNA miR 155 plays a key role in B cell immortalization by Epstein Barr virus. Journal of virology 84 11670 11678. Liu, F., Lei, W., O'Rourke, J.P., an d Ness, S.A. (2006). Oncogenic mutations cause dramatic, qualitative changes in the transcriptional activity of c Myb. Oncogene 25 795 805. Liu, Y.W., Tseng, H.P., Chen, L.C., Chen, B.K., and Chang, W.C. (2003). Functional cooperation of simian virus 40 p romoter factor 1 and CCAAT/enhancer binding protein beta and delta in lipopolysaccharide induced gene activation of IL 10 in mouse macrophages. J Immunol 171 821 828. Louafi, F., Martinez Nunez, R.T., and Sanchez Elsner, T. (2010). MicroRNA 155 targets SM AD2 and modulates the response of macrophages to transforming growth factor {beta}. J Biol Chem 285 41328 41336. Lu, C.C., Li, Z., Chu, C.Y., Feng, J., Feng, J., Sun, R., and Rana, T.M. (2010a). MicroRNAs encoded by Kaposi's sarcoma associated herpesvirus regulate viral life cycle. EMBO Rep 11 784 790. Lu, F., Stedman, W., Yousef, M., Renne, R., and Lieberman, P.M. (2010b). Epigenetic regulation of Kaposi's sarcoma associated herpesvirus latency by virus encoded microRNAs that target Rta and the cellular Rbl2 DNMT pathway. Journal of virology 84 2697 2706. Lu, F., Weidmer, A., Liu, C.G., Volinia, S., Croce, C.M., and Lieberman, P.M. (2008). Epstein Barr virus induced miR 155 attenuates NF kappaB signaling and stabilizes latent virus persistence. Journal o f virology 82 10436 10443. Lu, G.D., Leung, C.H., Yan, B., Tan, C.M., Low, S.Y., Aung, M.O., Salto Tellez, M., Lim, S.G., and Hooi, S.C. (2010c). C/EBPalpha is up regulated in a subset of hepatocellular carcinomas and plays a role in cell growth and proli feration. Gastroenterology 139 632 643, 643 e631 634. Luppi, M., Barozzi, P., Maiorana, A., Artusi, T., Trovato, R., Marasca, R., Savarino, M., Ceccherini Nelli, L., and Torelli, G. (1996). Human herpesvirus 8 DNA sequences in human immunodeficiency virus negative angioimmunoblastic lymphadenopathy and benign lymphadenopathy with giant germinal center hyperplasia and increased vascularity. Blood 87 3903 3909.

PAGE 130

130 Ma, L., Reinhardt, F., Pan, E., Soutschek, J., Bhat, B., Marcusson, E.G., Teruya Feldstein, J., B ell, G.W., and Weinberg, R.A. (2010). Therapeutic silencing of miR 10b inhibits metastasis in a mouse mammary tumor model. Nature biotechnology 28 341 347. Malumbres, R., Sarosiek, K.A., Cubedo, E., Ruiz, J.W., Jiang, X., Gascoyne, R.D., Tibshirani, R., a nd Lossos, I.S. (2009). Differentiation stage specific expression of microRNAs in B lymphocytes and diffuse large B cell lymphomas. Blood 113 3754 3764. Marshall, V., Parks, T., Bagni, R., Wang, C.D., Samols, M.A., Hu, J., Wyvil, K.M., Aleman, K., Little, R.F., Yarchoan, R. et al. (2007). Conservation of virally encoded micrornas in Kaposi sarcoma -associated herpesvirus in primary effusion lymphoma cell lines and in patients with Kaposi sarcoma or multicentric castleman disease. J Infect Dis 195 645 659 Matolcsy, A., Nador, R.G., Cesarman, E., and Knowles, D.M. (1998). Immunoglobulin VH gene mutational analysis suggests that primary effusion lymphomas derive from different stages of B cell maturation. Am J Pathol 153 1609 1614. Mayama, S., Cuevas, L.E. Sheldon, J., Omar, O.H., Smith, D.H., Okong, P., Silvel, B., Hart, C.A., and Schulz, T.F. (1998). Prevalence and transmission of Kaposi's sarcoma associated herpesvirus (human herpesvirus 8) in Ugandan children and adolescents. International journal of c ancer 77 817 820. Mbulaiteye, S.M., and Engels, E.A. (2006). Kaposi's sarcoma risk among transplant recipients in the United States (1993 2003). International journal of cancer 119 2685 2691. McCormick, C., and Ganem, D. (2005). The kaposin B protein of KSHV activates the p38/MK2 pathway and stabilizes cytokine mRNAs. Science 307 739 741. Medina, P.P., Nolde, M., and Slack, F.J. (2010). OncomiR addiction in an in vivo model of microRNA 21 induced pre B cell lymphoma. Nature 467 86 90. Merkerova, M., Bel ickova, M., and Bruchova, H. (2008). Differential expression of microRNAs in hematopoietic cell lineages. European journal of haematology 81 304 310. Mesri, E.A., Cesarman, E., Arvanitakis, L., Rafii, S., Moore, M.A., Posnett, D.N., Knowles, D.M., and Asc h, A.S. (1996). Human herpesvirus 8/Kaposi's sarcoma associated herpesvirus is a new transmissible virus that infects B cells. J Exp Med 183 2385 2390. Mesri, E.A., Cesarman, E., and Boshoff, C. (2010). Kaposi's sarcoma and its associated herpesvirus. Nat Rev Cancer 10 707 719.

PAGE 131

131 Montaner, S., Sodhi, A., Servitja, J.M., Ramsdell, A.K., Barac, A., Sawai, E.T., and Gutkind, J.S. (2004). The small GTPase Rac1 links the Kaposi sarcoma associated herpesvirus vGPCR to cytokine secretion and paracrine neoplasia. B lood 104 2903 2911. Moore, K.W., de Waal Malefyt, R., Coffman, R.L., and O'Garra, A. (2001). Interleukin 10 and the interleukin 10 receptor. Annual review of immunology 19 683 765. Moore, P.S., Gao, S.J., Dominguez, G., Cesarman, E., Lungu, O., Knowles, D.M., Garber, R., Pellett, P.E., McGeoch, D.J., and Chang, Y. (1996). Primary characterization of a herpesvirus agent associated with Kaposi's sarcomae. Journal of virology 70 549 558. Morgan, R., Anderson, A., Bernberg, E., Kamboj, S., Huang, E., Lagasse G., Isaacs, G., Parcells, M., Meyers, B.C., Green, P.J., and Burnside, J. (2008). Sequence conservation and differential expression of Marek's disease virus microRNAs. Journal of virology 82 12213 12220. Mori, Y., Nishimoto, N., Ohno, M., Inagi, R., Dhe pakson, P., Amou, K., Yoshizaki, K., and Yamanishi, K. (2000). Human herpesvirus 8 encoded interleukin 6 homologue (viral IL 6) induces endogenous human IL 6 secretion. Journal of medical virology 61 332 335. Mosam, A., Carrara, H., Shaik, F., Uldrick, T. Berkman, A., Aboobaker, J., and Coovadia, H.M. (2009). Increasing incidence of Kaposi's sarcoma in black South Africans in KwaZulu Natal, South Africa (1983 2006). International journal of STD & AIDS 20 553 556. Mosmann, T.R. (1994). Properties and func tions of interleukin 10. Advances in immunology 56 1 26. Mrazek, J., Kreutmayer, S.B., Grasser, F.A., Polacek, N., and Huttenhofer, A. (2007). Subtractive hybridization identifies novel differentially expressed ncRNA species in EBV infected human B cells. Nucleic Acids Res 35 e73. Mukherji, S., Ebert, M.S., Zheng, G.X., Tsang, J.S., Sharp, P.A., and van Oudenaarden, A. (2011). MicroRNAs can generate thresholds in target gene expression. Nat Genet 43 854 859. Muralidhar, S., Pumfery, A.M., Hassani, M., Sa daie, M.R., Kishishita, M., Brady, J.N., Doniger, J., Medveczky, P., and Rosenthal, L.J. (1998). Identification of kaposin (open reading frame K12) as a human herpesvirus 8 (Kaposi's sarcoma associated herpesvirus) transforming gene. Journal of virology 72 4980 4988. Myoung, J., and Ganem, D. (2011). Infection of primary human tonsillar lymphoid cells by KSHV reveals frequent but abortive infection of T cells. Virology 413 1 11.

PAGE 132

132 Nachmani, D., Stern Ginossar, N., Sarid, R., and Mandelboim, O. (2009). Diver se herpesvirus microRNAs target the stress induced immune ligand MICB to escape recognition by natural killer cells. Cell host & microbe 5 376 385. Nador, R.G., Cesarman, E., Chadburn, A., Dawson, D.B., Ansari, M.Q., Sald, J., and Knowles, D.M. (1996). Pr imary effusion lymphoma: a distinct clinicopathologic entity associated with the Kaposi's sarcoma associated herpes virus. Blood 88 645 656. Nakamura, K., Kouro, T., Kincade, P.W., Malykhin, A., Maeda, K., and Coggeshall, K.M. (2004). Src homology 2 conta ining 5 inositol phosphatase (SHIP) suppresses an early stage of lymphoid cell development through elevated interleukin 6 production by myeloid cells in bone marrow. J Exp Med 199 243 254. Neipel, F., Albrecht, J.C., and Fleckenstein, B. (1997). Cell homo logous genes in the Kaposi's sarcoma associated rhadinovirus human herpesvirus 8: determinants of its pathogenicity? Journal of virology 71 4187 4192. O'Connell, R.M., Chaudhuri, A.A., Rao, D.S., and Baltimore, D. (2009). Inositol phosphatase SHIP1 is a p rimary target of miR 155. Proceedings of the National Academy of Sciences of the United States of America 106 7113 7118. O'Connell, R.M., Rao, D.S., Chaudhuri, A.A., Boldin, M.P., Taganov, K.D., Nicoll, J., Paquette, R.L., and Baltimore, D. (2008). Sustai ned expression of microRNA 155 in hematopoietic stem cells causes a myeloproliferative disorder. J Exp Med 205 585 594. O'Connell, R.M., Taganov, K.D., Boldin, M.P., Cheng, G., and Baltimore, D. (2007). MicroRNA 155 is induced during the macrophage inflam matory response. Proceedings of the National Academy of Sciences of the United States of America 104 1604 1609. O'Hara, A.J., Vahrson, W., and Dittmer, D.P. (2008). Gene alteration and precursor and mature microRNA transcription changes contribute to the miRNA signature of primary effusion lymphoma. Blood 111 2347 2353. Oksenhendler, E., Carcelain, G., Aoki, Y., Boulanger, E., Maillard, A., Clauvel, J.P., and Agbalika, F. (2000). High levels of human herpesvirus 8 viral load, human interleukin 6, interleu kin 10, and C reactive protein correlate with exacerbation of multicentric castleman disease in HIV infected patients. Blood 96 2069 2073. Panagopoulos, D., Victoratos, P., Alexiou, M., Kollias, G., and Mosialos, G. (2004). Comparative analysis of signal transduction by CD40 and the Epstein Barr virus oncoprotein LMP1 in vivo. Journal of virology 78 13253 13261. Pasquinelli, A.E., Reinhart, B.J., Slack, F., Martindale, M.Q., Kuroda, M.I., Maller, B., Hayward, D.C., Ball, E.E., Degnan, B., Muller, P. et a l. (2000). Conservation of the sequence and temporal expression of let 7 heterochronic regulatory RNA. Nature 408 86 89.

PAGE 133

133 Pearce, M., Matsumura, S., and Wilson, A.C. (2005). Transcripts encoding K12, v FLIP, v cyclin, and the microRNA cluster of Kaposi's s arcoma associated herpesvirus originate from a common promoter. Journal of virology 79 14457 14464. Pellet, C., Chevret, S., Blum, L., Gauville, C., Hurault, M., Blanchard, G., Agbalika, F., Lascoux, C., Ponscarme, D., Morel, P. et al. (2001). Virologic and immunologic parameters that predict clinical response of AIDS associated Kaposi's sarcoma to highly active antiretroviral therapy. J Invest Dermatol 117 858 863. Peterson, B.A., and Frizzera, G. (1993). Multicentric Castleman's disease. Seminars in on cology 20 636 647. Pfeffer, S. (2007). Identification of virally encoded microRNAs. Methods Enzymol 427 51 63. Pfeffer, S., Sewer, A., Lagos Quintana, M., Sheridan, R., Sander, C., Grasser, F.A., van Dyk, L.F., Ho, C.K., Shuman, S., Chien, M. et al. (20 05). Identification of microRNAs of the herpesvirus family. Nat Methods 2 269 276. Pfeffer, S., Zavolan, M., Grasser, F.A., Chien, M., Russo, J.J., Ju, J., John, B., Enright, A.J., Marks, D., Sander, C., and Tuschl, T. (2004). Identification of virus enco ded microRNAs. Science 304 734 736. Pratt, Z.L., Kuzembayeva, M., Sengupta, S., and Sugden, B. (2009). The microRNAs of Epstein Barr Virus are expressed at dramatically differing levels among cell lines. Virology 386 387 397. Punj, V., Matta, H., Schamus S., Tamewitz, A., Anyang, B., and Chaudhary, P.M. (2010). Kaposi's sarcoma associated herpesvirus encoded viral FLICE inhibitory protein (vFLIP) K13 suppresses CXCR4 expression by upregulating miR 146a. Oncogene 29 1835 1844. Qin, Z., Kearney, P., Plais ance, K., and Parsons, C.H. (2010). Pivotal advance: Kaposi's sarcoma associated herpesvirus (KSHV) encoded microRNA specifically induce IL 6 and IL 10 secretion by macrophages and monocytes. Journal of leukocyte biology 87 25 34. Rai, D., Kim, S.W., McKe ller, M.R., Dahia, P.L., and Aguiar, R.C. (2010). Targeting of SMAD5 links microRNA 155 to the TGF beta pathway and lymphomagenesis. Proceedings of the National Academy of Sciences of the United States of America 107 3111 3116. Ramkissoon, S.H., Mainwarin g, L.A., Ogasawara, Y., Keyvanfar, K., McCoy, J.P., Jr., Sloand, E.M., Kajigaya, S., and Young, N.S. (2006). Hematopoietic specific microRNA expression in human cells. Leuk Res 30 643 647.

PAGE 134

134 Reinhart, B.J., Slack, F.J., Basson, M., Pasquinelli, A.E., Bettin ger, J.C., Rougvie, A.E., Horvitz, H.R., and Ruvkun, G. (2000). The 21 nucleotide let 7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403 901 906. Renne, R., Barry, C., Dittmer, D., Compitello, N., Brown, P.O., and Ganem, D. (2001). Modulation of cellular and viral gene expression by the latency associated nuclear antigen of Kaposi's sarcoma associated herpesvirus. Journal of virology 75 458 468. Renne, R., Blackbourn, D., Whitby, D., Levy, J., and Ganem, D. (1998). Limited transmis sion of Kaposi's sarcoma associated herpesvirus in cultured cells. Journal of virology 72 5182 5188. Renne, R., Zhong, W., Herndier, B., McGrath, M., Abbey, N., Kedes, D., and Ganem, D. (1996). Lytic growth of Kaposi's sarcoma associated herpesvirus (huma n herpesvirus 8) in culture. Nat Med 2 342 346. Rodriguez, A., Vigorito, E., Clare, S., Warren, M.V., Couttet, P., Soond, D.R., van Dongen, S., Grocock, R.J., Das, P.P., Miska, E.A. et al. (2007). Requirement of bic/microRNA 155 for normal immune functio n. Science 316 608 611. Romania, P., Lulli, V., Pelosi, E., Biffoni, M., Peschle, C., and Marziali, G. (2008). MicroRNA 155 modulates megakaryopoiesis at progenitor and precursor level by targeting Ets 1 and Meis1 transcription factors. Br J Haematol 143 570 580. Rousset, F., Garcia, E., Defrance, T., Peronne, C., Vezzio, N., Hsu, D.H., Kastelein, R., Moore, K.W., and Banchereau, J. (1992). Interleukin 10 is a potent growth and differentiation factor for activated human B lymphocytes. Proceedings of the N ational Academy of Sciences of the United States of America 89 1890 1893. Russo, J.J., Bohenzky, R.A., Chien, M.C., Chen, J., Yan, M., Maddalena, D., Parry, J.P., Peruzzi, D., Edelman, I.S., Chang, Y., and Moore, P.S. (1996). Nucleotide sequence of the Ka posi sarcoma associated herpesvirus (HHV8). Proceedings of the National Academy of Sciences of the United States of America 93 14862 14867. Ruvkun, G., Wightman, B., Burglin, T., and Arasu, P. (1991). Dominant gain of function mutations that lead to misre gulation of the C. elegans heterochronic gene lin 14, and the evolutionary implications of dominant mutations in pattern formation genes. Dev Suppl 1 47 54. Sakakibara, S., and Tosato, G. (2009). Viral Interleukin 6: Role in Kaposi's Sarcoma Associated He rpesvirus Associated Malignancies. J Interferon Cytokine Res. Samols, M.A., Hu, J., Skalsky, R.L., and Renne, R. (2005). Cloning and identification of a microRNA cluster within the latency associated region of Kaposi's sarcoma associated herpesvirus. Journ al of virology 79 9301 9305.

PAGE 135

135 Samols, M.A., Hu, J., Skalsky, R.L., Maldonado, A.M., Riva, A., Lopez, M.C., Baker, H.V., and R. Renne (2007). Identification of cellular genes targeted by KSHV encoded microRNAs. PLoS Pathog. Sanders, C.J. (1997). Kaposi's sa rcoma in retrospect. Genitourinary medicine 73 571 574. Sanders, C.J., Canninga van Dijk, M.R., and Borleffs, J.C. (2004). Kaposi's sarcoma. Lancet 364 1549 1552. Sarid, R., Flore, O., Bohenzky, R.A., Chang, Y., and Moore, P.S. (1998). Transcription mapp ing of the Kaposi's sarcoma associated herpesvirus (human herpesvirus 8) genome in a body cavity based lymphoma cell line (BC 1). Journal of virology 72 1005 1012. Sarid, R., Wiezorek, J.S., Moore, P.S., and Chang, Y. (1999). Characterization and cell cyc le regulation of the major Kaposi's sarcoma associated herpesvirus (human herpesvirus 8) latent genes and their promoter. Journal of virology 73 1438 1446. Schafer, A., Cai, X., Bilello, J.P., Desrosiers, R.C., and Cullen, B.R. (2007). Cloning and analysi s of microRNAs encoded by the primate gamma herpesvirus rhesus monkey rhadinovirus. Virology 364 21 27. Schebesta, M., Heavey, B., and Busslinger, M. (2002). Transcriptional control of B cell development. Curr Opin Immunol 14 216 223. Schwarz, D.S., Hutv agner, G., Du, T., Xu, Z., Aronin, N., and Zamore, P.D. (2003). Asymmetry in the assembly of the RNAi enzyme complex. Cell 115 199 208. Schwarz, M., and Murphy, P.M. (2001). Kaposi's sarcoma associated herpesvirus G protein coupled receptor constitutively activates NF kappa B and induces proinflammatory cytokine and chemokine production via a C terminal signaling determinant. J Immunol 167 505 513. Screpanti, I., Musiani, P., Bellavia, D., Cappelletti, M., Aiello, F.B., Maroder, M., Frati, L., Modesti, A. Gulino, A., and Poli, V. (1996). Inactivation of the IL 6 gene prevents development of multicentric Castleman's disease in C/EBP beta deficient mice. J Exp Med 184 1561 1566. Screpanti, I., Romani, L., Musiani, P., Modesti, A., Fattori, E., Lazzaro, D., Sellitto, C., Scarpa, S., Bellavia, D., Lattanzio, G., and et al. (1995). Lymphoproliferative disorder and imbalanced T helper response in C/EBP beta deficient mice. Embo J 14 1932 1941. Selbach, M., Schwanhausser, B., Thierfelder, N., Fang, Z., Khanin, R., and Rajewsky, N. (2008). Widespread changes in protein synthesis induced by microRNAs. Nature 455 58 63.

PAGE 136

136 Shaffer, A.L., Lin, K.I., Kuo, T.C., Yu, X., Hurt, E.M., Rosenwald, A., Giltnane, J.M., Yang, L., Zhao, H., Calame, K., and Staudt, L.M. (2002). B limp 1 orchestrates plasma cell differentiation by extinguishing the mature B cell gene expression program. Immunity 17 51 62. Shuai, K., and Liu, B. (2003). Regulation of JAK STAT signalling in the immune system. Nat Rev Immunol 3 900 911. Shultz, L.D., Lyons, B.L., Burzenski, L.M., Gott, B., Chen, X., Chaleff, S., Kotb, M., Gillies, S.D., King, M., Mangada, J. et al. (2005). Human lymphoid and myeloid cell development in NOD/LtSz scid IL2R gamma null mice engrafted with mobilized human hemopoietic stem cells. J Immunol 174 6477 6489. Sin, S.H., Roy, D., Wang, L., Staudt, M.R., Fakhari, F.D., Patel, D.D., Henry, D., Harrington, W.J., Jr., Damania, B.A., and Dittmer, D.P. (2007). Rapamycin is efficacious against primary effusion lymphoma (PEL) cell lines in vivo by inhibiting autocrine signaling. Blood 109 2165 2173. Skalsky, R.L., Samols, M.A., Plaisance, K.B., Boss, I.W., Riva, A., Lopez, M.C., Baker, H.V., and Renne, R. (2007). Kaposi's sarcoma associated herpesvirus encodes an ortholog of miR 155. Jo urnal of virology 81 12836 12845. Slack, F.J., Basson, M., Liu, Z., Ambros, V., Horvitz, H.R., and Ruvkun, G. (2000). The lin 41 RBCC gene acts in the C. elegans heterochronic pathway between the let 7 regulatory RNA and the LIN 29 transcription factor. M ol Cell 5 659 669. Sood, P., Krek, A., Zavolan, M., Macino, G., and Rajewsky, N. (2006). Cell type specific signatures of microRNAs on target mRNA expression. Proceedings of the National Academy of Sciences of the United States of America 103 2746 2751. Soulier, J., Grollet, L., Oksenhendler, E., Cacoub, P., Cazals Hatem, D., Babinet, P., d'Agay, M.F., Clauvel, J.P., Raphael, M., Degos, L., and et al. (1995). Kaposi's sarcoma associated herpesvirus like DNA sequences in multicentric Castleman's disease. B lood 86 1276 1280. Stark, A., Brennecke, J., Russell, R.B., and Cohen, S.M. (2003). Identification of Drosophila MicroRNA targets. PLoS Biol 1 E60. Staskus, K.A., Zhong, W., Gebhard, K., Herndier, B., Wang, H., Renne, R., Beneke, J., Pudney, J., Anderson D.J., Ganem, D., and Haase, A.T. (1997). Kaposi's sarcoma associated herpesvirus gene expression in endothelial (spindle) tumor cells. Journal of virology 71 715 719. Stern Ginossar, N., Elefant, N., Zimmermann, A., Wolf, D.G., Saleh, N., Biton, M., Hor witz, E., Prokocimer, Z., Prichard, M., Hahn, G. et al. (2007). Host immune system gene targeting by a viral miRNA. Science 317 376 381.

PAGE 137

137 Sun, Q., Matta, H., Lu, G., and Chaudhary, P.M. (2006). Induction of IL 8 expression by human herpesvirus 8 encoded v FLIP K13 via NF kappaB activation. Oncogene 25 2717 2726. Talbot, S.J., Weiss, R.A., Kellam, P., and Boshoff, C. (1999). Transcriptional analysis of human herpesvirus 8 open reading frames 71, 72, 73, K14, and 74 in a primary effusion lymphoma cell line. Virology 257 84 94. Tam, W. (2001). Identification and characterization of human BIC, a gene on chromosome 21 that encodes a noncoding RNA. Gene 274 157 167. Tam, W., Ben Yehuda, D., and Hayward, W.S. (1997). bic, a novel gene activated by proviral inser tions in avian leukosis virus induced lymphomas, is likely to function through its noncoding RNA. Mol Cell Biol 17 1490 1502. Tan, L.P., Wang, M., Robertus, J.L., Schakel, R.N., Gibcus, J.H., Diepstra, A., Harms, G., Peh, S.C., Reijmers, R.M., Pals, S.T. et al. (2009). miRNA profiling of B cell subsets: specific miRNA profile for germinal center B cells with variation between centroblasts and centrocytes. Lab Invest 89 708 716. Tang, S., Bertke, A.S., Patel, A., Wang, K., Cohen, J.I., and Krause, P.R. (2 008). An acutely and latently expressed herpes simplex virus 2 viral microRNA inhibits expression of ICP34.5, a viral neurovirulence factor. Proceedings of the National Academy of Sciences of the United States of America 105 10931 10936. Tang, S., Patel, A., and Krause, P.R. (2009). Novel less abundant viral microRNAs encoded by herpes simplex virus 2 latency associated transcript and their roles in regulating ICP34.5 and ICP0 mRNAs. Journal of virology 83 1433 1442. Teng, G., Hakimpour, P., Landgraf, P., Rice, A., Tuschl, T., Casellas, R., and Papavasiliou, F.N. (2008). MicroRNA 155 is a negative regulator of activation induced cytidine deaminase. Immunity 28 621 629. Thai, T.H., Calado, D.P., Casola, S., Ansel, K.M., Xiao, C., Xue, Y., Murphy, A., Frend ewey, D., Valenzuela, D., Kutok, J.L. et al. (2007). Regulation of the germinal center response by microRNA 155. Science 316 604 608. Thomas, M., Boname, J.M., Field, S., Nejentsev, S., Salio, M., Cerundolo, V., Wills, M., and Lehner, P.J. (2008). Down r egulation of NKG2D and NKp80 ligands by Kaposi's sarcoma associated herpesvirus K5 protects against NK cell cytotoxicity. Proceedings of the National Academy of Sciences of the United States of America 105 1656 1661. Thorley Lawson, D.A. (2001). Epstein B arr virus: exploiting the immune system. Nat Rev Immunol 1 75 82. Tomari, Y., Matranga, C., Haley, B., Martinez, N., and Zamore, P.D. (2004). A protein sensor for siRNA asymmetry. Science 306 1377 1380.

PAGE 138

138 Turner, C.A., Jr., Mack, D.H., and Davis, M.M. (199 4). Blimp 1, a novel zinc finger containing protein that can drive the maturation of B lymphocytes into immunoglobulin secreting cells. Cell 77 297 306. Uldrick, T.S., Wang, V., O'Mahony, D., Aleman, K., Wyvill, K.M., Marshall, V., Steinberg, S.M., Pittal uga, S., Maric, I., Whitby, D. et al. (2010). An interleukin 6 related systemic inflammatory syndrome in patients co infected with Kaposi sarcoma associated herpesvirus and HIV but without Multicentric Castleman disease. Clin Infect Dis 51 350 358. Umbac h, J.L., Kramer, M.F., Jurak, I., Karnowski, H.W., Coen, D.M., and Cullen, B.R. (2008). MicroRNAs expressed by herpes simplex virus 1 during latent infection regulate viral mRNAs. Nature 454 780 783. Umbach, J.L., Nagel, M.A., Cohrs, R.J., Gilden, D.H., a nd Cullen, B.R. (2009). Analysis of human alphaherpesvirus microRNA expression in latently infected human trigeminal ganglia. Journal of virology 83 10677 10683. van den Berg, A., Kroesen, B.J., Kooistra, K., de Jong, D., Briggs, J., Blokzijl, T., Jacobs, S., Kluiver, J., Diepstra, A., Maggio, E., and Poppema, S. (2003). High expression of B cell receptor inducible gene BIC in all subtypes of Hodgkin lymphoma. Genes, chromosomes & cancer 37 20 28. Vigorito, E., Perks, K.L., Abreu Goodger, C., Bunting, S., Xiang, Z., Kohlhaas, S., Das, P.P., Miska, E.A., Rodriguez, A., Bradley, A. et al. (2007). microRNA 155 regulates the generation of immunoglobulin class switched plasma cells. Immunity 27 847 859. Waidner, L.A., Morgan, R.W., Anderson, A.S., Bernberg, E .L., Kamboj, S., Garcia, M., Riblet, S.M., Ouyang, M., Isaacs, G.K., Markis, M. et al. (2009). MicroRNAs of Gallid and Meleagrid herpesviruses show generally conserved genomic locations and are virus specific. Virology 388 128 136. Watanabe, T., Sugaya, M., Atkins, A.M., Aquilino, E.A., Yang, A., Borris, D.L., Brady, J., and Blauvelt, A. (2003). Kaposi's sarcoma associated herpesvirus latency associated nuclear antigen prolongs the life span of primary human umbilical vein endothelial cells. Journal of vi rology 77 6188 6196. Whitby, D., Howard, M.R., Tenant Flowers, M., Brink, N.S., Copas, A., Boshoff, C., Hatzioannou, T., Suggett, F.E., Aldam, D.M., and Denton, A.S. (1995). Detection of Kaposi sarcoma associated herpesvirus in peripheral blood of HIV inf ected individuals and progression to Kaposi's sarcoma. Lancet 346 799 802. Wightman, B., Ha, I., and Ruvkun, G. (1993). Posttranscriptional regulation of the heterochronic gene lin 14 by lin 4 mediates temporal pattern formation in C. elegans. Cell 75 85 5 862. Wilkinson, J., Cope, A., Gill, J., Bourboulia, D., Hayes, P., Imami, N., Kubo, T., Marcelin, A., Calvez, V., Weiss, R. et al. (2002). Identification of Kaposi's sarcoma associated

PAGE 139

139 herpesvirus (KSHV) specific cytotoxic T lymphocyte epitopes and eval uation of reconstitution of KSHV specific responses in human immunodeficiency virus type 1 Infected patients receiving highly active antiretroviral therapy. Journal of virology 76 2634 2640. Xing, L., and Kieff, E. (2007). Epstein Barr virus BHRF1 micro and stable RNAs during latency III and after induction of replication. Journal of virology 81 9967 9975. Yao, Y., Zhao, Y., Xu, H., Smith, L.P., Lawrie, C.H., Sewer, A., Zavolan, M., and Nair, V. (2007). Marek's disease virus type 2 (MDV 2) encoded microR NAs show no sequence conservation with those encoded by MDV 1. Journal of virology 81 7164 7170. Yao, Y., Zhao, Y., Xu, H., Smith, L.P., Lawrie, C.H., Watson, M., and Nair, V. (2008). MicroRNA profile of Marek's disease virus transformed T cell line MSB 1 : predominance of virus encoded microRNAs. Journal of virology 82 4007 4015. Yi, R., Qin, Y., Macara, I.G., and Cullen, B.R. (2003). Exportin 5 mediates the nuclear export of pre microRNAs and short hairpin RNAs. Genes Dev 17 3011 3016. Yin, Q., McBride, J., Fewell, C., Lacey, M., Wang, X., Lin, Z., Cameron, J., and Flemington, E.K. (2008). MicroRNA 155 is an Epstein Barr virus induced gene that modulates Epstein Barr virus regulated gene expression pathways. Journal of virology 82 5295 5306. Yin, Q., Wa ng, X., Fewell, C., Cameron, J., Zhu, H., Baddoo, M., Lin, Z., and Flemington, E.K. (2010). MicroRNA miR 155 inhibits bone morphogenetic protein (BMP) signaling and BMP mediated Epstein Barr virus reactivation. Journal of virology 84 6318 6327. Yoshizaki, K., Matsuda, T., Nishimoto, N., Kuritani, T., Taeho, L., Aozasa, K., Nakahata, T., Kawai, H., Tagoh, H., Komori, T., and et al. (1989). Pathogenic significance of interleukin 6 (IL 6/BSF 2) in Castleman's disease. Blood 74 1360 1367. Yu, F., Harada, J.N. Brown, H.J., Deng, H., Song, M.J., Wu, T.T., Kato Stankiewicz, J., Nelson, C.G., Vieira, J., Tamanoi, F. et al. (2007). Systematic identification of cellular signals reactivating Kaposi sarcoma associated herpesvirus. PLoS Pathog 3 e44. Zahnow, C.A., Y ounes, P., Laucirica, R., and Rosen, J.M. (1997). Overexpression of C/EBPbeta LIP, a naturally occurring, dominant negative transcription factor, in human breast cancer. J Natl Cancer Inst 89 1887 1891. Zhao, Y., Xu, H., Yao, Y., Smith, L.P., Kgosana, L., Green, J., Petherbridge, L., Baigent, S.J., and Nair, V. (2011). Critical role of the virus encoded microRNA 155 ortholog in the induction of Marek's disease lymphomas. PLoS Pathog 7 e1001305. Zhao, Y., Yao, Y., Xu, H., Lambeth, L., Smith, L.P., Kgosana, L., Wang, X., and Nair, V. (2009). A functional MicroRNA 155 ortholog encoded by the oncogenic Marek's disease virus. Journal of virology 83 489 492.

PAGE 140

140 Zhong, W., Wang, H., Herndier, B., and Ganem, D. (1996). Restricted expression of Kaposi sarcoma associa ted herpesvirus (human herpesvirus 8) genes in Kaposi sarcoma. Proceedings of the National Academy of Sciences of the United States of America 93 6641 6646. Zhu, J.Y., Pfuhl, T., Motsch, N., Barth, S., Nicholls, J., Grasser, F., and Meister, G. (2009). Id entification of novel Epstein Barr virus microRNA genes from nasopharyngeal carcinomas. Journal of virology 83 3333 3341. Zhu, S., Wu, H., Wu, F., Nie, D., Sheng, S., and Mo, Y.Y. (2008). MicroRNA 21 targets tumor suppressor genes in invasion and metastas is. Cell research 18 350 359. Ziegelbauer, J.M., Sullivan, C.S., and Ganem, D. (2009). Tandem array based expression screens identify host mRNA targets of virus encoded microRNAs. Nat Genet 41 130 134. Ziegler, J.L., and Katongole Mbidde, E. (1996). Kapo si's sarcoma in childhood: an analysis of 100 cases from Uganda and relationship to HIV infection. International journal of cancer 65 200 203. Zucali, J.R., Ciccarone, T., Kelley, V., Park, J., Johnson, C.M., and Mergia, A. (2002). Transduction of umbilic al cord blood CD34+ NOD/SCID repopulating cells by simian foamy virus type 1 (SFV 1) vector. Virology 302 229 235.

PAGE 141

141 BIOGRAPHICAL SKETCH Isaac Wayne Boss was born in Tacoma, Washington. In Florida, he received his high school diploma from Oviedo High S chool in 1992. He attended Florida Community College Jacksonville where he received his Associate of Arts degree in 2003. He next graduated Summa Cum Laude from the University of Florida in 2006 where he received his B.S. in microbiology and cell s cienc e. He continued at the Universtiy of Florida as a Ph.D student in th e Interdisciplinary Program in biomedical s ciences where he joined associated herpesvirus. He will earn his Ph.D. in me dical sc iences with a concentration in g enetics.