<%BANNER%>

Influence of Vitamin B-6 Nutritional Status on Fatty Acid Profiles in Human Blood and Cultured Cells

Permanent Link: http://ufdc.ufl.edu/UFE0043688/00001

Material Information

Title: Influence of Vitamin B-6 Nutritional Status on Fatty Acid Profiles in Human Blood and Cultured Cells
Physical Description: 1 online resource (109 p.)
Language: english
Creator: Zhao, Mei
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: acids -- b6 -- fatty -- human -- polyunsaturated -- vitamin
Nutritional Sciences -- Dissertations, Academic -- UF
Genre: Nutritional Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Vitamin B-6 deficiency has been linked to the altered n-6 fatty acid (FA) profiles of rat tissue lipids, particularly with a decrease of arachidonic acid (AA) and an increase of linoleic acid over 80 years. Some studies also indicated altered n-3 FA profiles in rat plasma and liver microsomes with vitamin B-6 deficiency. Based on previous findings, it was hypothesized that low vitamin B-6 status decreases n-6/n-3 long chain polyunsaturated fatty acids (LCPUFAs) but increases their precursors, linoleic acid and a-linolenic acid in both blood lipids and cultured human hepatoma (HepG2) cell line by impairing LCPUFA synthesis. The 23 healthy subjects received a 2-day controlled, nutritionally adequate diet followed by a 28-day vitamin B-6 restricted diet to induce a marginal deficiency (plasma PLP between 20-30 nmol/L). Plasma total ?-linolenic acid, AA, eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA) concentrations all significantly decreased (p < 0.05) compared to their baseline values. There were no changes in plasma free FA profiles or FA composition of erythrocyte and peripheral blood mononuclear cell membrane lipids. Total cholesterol, triglycerides, LDL-cholesterol and HDL-cholesterol did not differ. In cultured HepG2 cells, lower vitamin B-6 concentrations in the media led to lower cellular and membrane n-6 LCPUFA composition. In addition, there were accumulated cellular lipids in HepG2 cells cultured with lower vitamin B-6 concentrations compared to the regular medium control. A stable-isotope tracer experiment further demonstrated that unsaturated FA synthesis decreased by 10-20 % in cells with lower vitamin B-6 concentrations. The measurement of mRNA expression of relevant desaturases and elongases in HepG2 cells showed that FADS1 (delta-5 desaturase) and FADS2 (delta-6 desaturase) genes were 40-50% lower. These findings provide several novel perspectives to interpret the link of differences in vitamin B-6 nutritional status to lipid metabolism, which will be helpful to understand the association between vitamin B-6 and related diseases and disorders with perturbed lipid metabolism in large-scale population-based epidemiological studies.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Mei Zhao.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Gregory, Jesse F.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043688:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043688/00001

Material Information

Title: Influence of Vitamin B-6 Nutritional Status on Fatty Acid Profiles in Human Blood and Cultured Cells
Physical Description: 1 online resource (109 p.)
Language: english
Creator: Zhao, Mei
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: acids -- b6 -- fatty -- human -- polyunsaturated -- vitamin
Nutritional Sciences -- Dissertations, Academic -- UF
Genre: Nutritional Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Vitamin B-6 deficiency has been linked to the altered n-6 fatty acid (FA) profiles of rat tissue lipids, particularly with a decrease of arachidonic acid (AA) and an increase of linoleic acid over 80 years. Some studies also indicated altered n-3 FA profiles in rat plasma and liver microsomes with vitamin B-6 deficiency. Based on previous findings, it was hypothesized that low vitamin B-6 status decreases n-6/n-3 long chain polyunsaturated fatty acids (LCPUFAs) but increases their precursors, linoleic acid and a-linolenic acid in both blood lipids and cultured human hepatoma (HepG2) cell line by impairing LCPUFA synthesis. The 23 healthy subjects received a 2-day controlled, nutritionally adequate diet followed by a 28-day vitamin B-6 restricted diet to induce a marginal deficiency (plasma PLP between 20-30 nmol/L). Plasma total ?-linolenic acid, AA, eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA) concentrations all significantly decreased (p < 0.05) compared to their baseline values. There were no changes in plasma free FA profiles or FA composition of erythrocyte and peripheral blood mononuclear cell membrane lipids. Total cholesterol, triglycerides, LDL-cholesterol and HDL-cholesterol did not differ. In cultured HepG2 cells, lower vitamin B-6 concentrations in the media led to lower cellular and membrane n-6 LCPUFA composition. In addition, there were accumulated cellular lipids in HepG2 cells cultured with lower vitamin B-6 concentrations compared to the regular medium control. A stable-isotope tracer experiment further demonstrated that unsaturated FA synthesis decreased by 10-20 % in cells with lower vitamin B-6 concentrations. The measurement of mRNA expression of relevant desaturases and elongases in HepG2 cells showed that FADS1 (delta-5 desaturase) and FADS2 (delta-6 desaturase) genes were 40-50% lower. These findings provide several novel perspectives to interpret the link of differences in vitamin B-6 nutritional status to lipid metabolism, which will be helpful to understand the association between vitamin B-6 and related diseases and disorders with perturbed lipid metabolism in large-scale population-based epidemiological studies.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Mei Zhao.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Gregory, Jesse F.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043688:00001


This item has the following downloads:


Full Text

PAGE 1

1 INFLUENCE OF VITAMIN B 6 NUTRITIONAL STATUS ON FATTY ACID PROFILES IN HUMAN BLOOD AND CULTURED CELLS By MEI ZHAO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF T HE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Mei Zhao

PAGE 3

3 To my parents, Kerong Zhao and Min Wang

PAGE 4

4 ACKNOWLEDGMENTS My special thanks go to my doctoral research advisor, Dr. Jesse F Gregory III. H is expertise in B vitamin area gives me excellent guidance for my doctoral research. He is very knowledgeable, insightful and kind hearted as a research advisor. Without his endless support and encouragement, I could not possibly fulfill my goal of pursui ng the degree of doctor of philosophy in the US I would also like to thank my other committee members, Dr. Mitchell D. Knutson, Dr. Lokenga Badinga, and Dr. Yueh Yun Chi for their professional suggestions and overwhelming support for my research project c ontinuously I also am very grateful to my current and former colleagues, Maria Ralat, Yvonne Lamers, Vanessa da Silva, Joshua Steiner, Valeria Naponelli, and Eoin Quinlivan Their selfless help and companions hip not only helped me learn how to do science but also brought me great joy beyond research. I would also like to thank my fellow gradu ate students and friends in the department The time I spent with them made my life in Gainesville more interesting and colorful. My profound gratitude goes to my f ather Keron g Zhao, and my mother Min Wang, for their tremendous support and countless sacrifices to allow me to have the best education possible throughout my entire life. My final appreciation goes to my boyfriend, Zhichao Lu, for his non stopping support and devotion to my work and life ever since I met him.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 13 CHAPTER 1 LITERATURE REVIEW ................................ ................................ .......................... 15 Introduction and Significance ................................ ................................ .................. 15 History of Vitamin B 6 ................................ ................................ ............................. 16 Chemistry of Vitamin B 6 ................................ ................................ ........................ 16 Food Sources of Vitamin B 6 ................................ ................................ .................. 17 Absorption, Transport and Metabolism ................................ ................................ ... 18 Functions of Vitamin B 6 ................................ ................................ ......................... 20 Amino Acid Metabolism ................................ ................................ .................... 20 Carbohydrate Metabolism ................................ ................................ ................ 21 Lipid Metabolism ................................ ................................ .............................. 22 Lipid profiles ................................ ................................ ............................... 23 Phospholipids and fatty acid profiles ................................ .......................... 24 Enzymes ................................ ................................ ................................ .... 27 Assessment of Vitamin B 6 Status ................................ ................................ .......... 28 Methods ................................ ................................ ................................ ............ 28 Deficiency and Toxicity ................................ ................................ ..................... 30 Requirement of Vitamin B 6 ................................ ................................ .................... 31 Vitamin B 6 in Health and Disease ................................ ................................ ......... 32 Hypotheses and Objectives ................................ ................................ .................... 33 Overall Rationale ................................ ................................ .............................. 33 Hypothesis 1 ................................ ................................ ................................ ..... 34 Hypothesis 2 ................................ ................................ ................................ ..... 34 Hypothesis 3 ................................ ................................ ................................ ..... 34 2 MARGINAL VITAMIN B 6 DEFICIENCY DECREASES PLASMA N 3 AND N 6 POLYUNSATURATED FATTY ACID CONCENTRATIONS IN HEALTHY MEN AND WOMEN ................................ ................................ ................................ ......... 39 Introduction ................................ ................................ ................................ ............. 39 Subjects and Methods ................................ ................................ ............................ 41 Subjects ................................ ................................ ................................ ............ 41

PAGE 6

6 Diet ................................ ................................ ................................ ................... 42 Sample Collection and Screening Measurements ................................ ............ 42 Total Fatty Acid Analysis in Plasma ................................ ................................ 43 Membrane Fatty Acid Analysis in Erythrocytes and PBMCs ............................ 45 Statistical Analysis ................................ ................................ ............................ 46 Results ................................ ................................ ................................ .................... 46 Participant Characteristics ................................ ................................ ................ 46 Effects of Marginal Vitamin B 6 Deficiency on Plasma Lipid Fractions, Total and Free Fatty Acid Concentrations ................................ .............................. 47 Effects of Marginal Vitamin B 6 Deficiency on Membrane Fatty Acid Composition in Erythrocytes and PBMCS ................................ ..................... 48 Discussion ................................ ................................ ................................ .............. 49 3 VITAMIN B 6 DEFICIENCY IMPAIRS FATTY ACID SYNTHESIS IN CULTURED HUMAN HEPATOMA (HEPG2) CELLS ................................ ............. 60 Introduction ................................ ................................ ................................ ............. 60 Materials and Methods ................................ ................................ ............................ 62 Materials ................................ ................................ ................................ ........... 62 Cell Culture ................................ ................................ ................................ ....... 62 Intracellular PLP Analysis ................................ ................................ ................. 63 Total Fatty Acid Profile Analysis in HepG2 Cells Cultured with Different PL Concentrations ................................ ................................ .............................. 64 Membrane Fatty Acid Analysis in HepG2 Cells Cultured with Different PL Concentrations ................................ ................................ .............................. 64 Stable Isotope Tracer Study of Unsaturated Fatty Acid Synthesis in HepG2 Cells Cultured with Different PL Concentrations ................................ ........... 64 Real Time Reverse Transcriptase PCR (qRT PCR) Analysis of mRNA Expression of Desaturases and Elongases in HepG2 Cells Cultured with Different PL Concentrations ................................ ................................ .......... 65 Statistical Analysis ................................ ................................ ............................ 67 Results ................................ ................................ ................................ .................... 67 Intracellular PLP Analysis of HepG2 Cells in Media with Different PL Concentrations over 6 Weeks ................................ ................................ ....... 67 Total Fatty Acid Profiles in HepG2 Cells as Related to PL Concentrations in Culture Media ................................ ................................ ................................ 68 Membrane Fatty Acid Composition in HepG2 Cells as Related to PL Concentrations in Culture Media ................................ ................................ ... 68 Stable Isotope Tracer Study of Unsaturated Fatty Acid Synthesis in HepG2 Cells as Related to PL Concentrations in Culture Media ............................... 69 The mRNA expression of Desaturases and Elongases in HepG2 Cells as Related to PL Concentrations in Culture Media ................................ ............ 71 Discussion ................................ ................................ ................................ .............. 72 4 CONCLUSIONS ................................ ................................ ................................ ..... 91

PAGE 7

7 LIST OF REFERENCES ................................ ................................ ............................... 96 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 109

PAGE 8

8 LIST OF TABLES Table page 1 1 Recommendations for vitamin B 6 intake in humans. ................................ ......... 36 2 1 Baseline characteristics of 23 healthy men and women participating in the study. ................................ ................................ ................................ .................. 55 2 2 The MANOVA analysis of overall effects of 28 d moderate vitamin B 6 restriction on n 3, n 6, n 9 fatty acids, and ratios of product to precursor fatty acids in different blood fractions. ................................ ................................ ........ 55 2 3 Plasma total fatty acid and free fatty acid concentrations in 23 healthy men and women at baseline and after 28 d moderate vitamin B 6 restriction. ........... 56 2 4 Fatty acid composition (in weight percentage, wt %) 1 of erythrocyte and PBMC membrane lipids in 23 hea lthy men and women at baseline and after 28 d moderate vitamin B 6 restriction. ................................ ................................ 57 2 5 R atios of product to precursor fatty acids for plasma total fatty acids, erythrocyte and PBMC membrane fatty acids in 23 healthy men and women at baseline and after 28 d moderate vitamin B 6 restriction. .............................. 57 2 6 The dietary fatty acid and major nutrient composition in the 2 d controlled diet and 28 d vitamin B 6 restricted diet. ................................ ................................ ... 58 3 1 The m/z ratios of FAMEs derived from precursor fatty acids and their major metabolites in synthetic pathways. ................................ ................................ ..... 77 3 2 Primer sequences of genes of interest in unsaturated fatty acid synthesis ( homo sapiens ) retrieved from GenBank. ................................ ........................... 77 3 3 Total fatty acid profiles in HepG2 cells cultured with different PL concentrations. ................................ ................................ ................................ ... 78 3 4 Total fatty acid composition by weight percentage (wt %) in HepG2 cells cultured with different PL concentrations. ................................ ........................... 79 3 5 Membrane fatty acid composition by weight percentage (wt %) in HepG2 cells cultured with different PL concentrations. ................................ ................... 80 3 6 Conversion indices (ratios of product to precursor fatty acids) of cellular and membrane fatty acids in HepG2 cells cultured with different PL concentrations. ................................ ................................ ................................ ... 81

PAGE 9

9 3 7 The areas under the enrichment curves (AUCs) of isotope enriched precursor and newly synthesized fatty acids in HepG2 cells cu ltured with different PL concentrations. ................................ ................................ ................ 82 3 8 The AUC ratios of isotope enriched precursor fatty acids to their major metabolites in synthetic pathways in HepG2 cells cultured with different PL concentrations. ................................ ................................ ................................ ... 83

PAGE 10

10 LIST OF FIGURES Figure page 1 1 Structures of three natural forms of free vitamin B 6. ................................ ......... 36 1 2 Structures of phosphorylated derivatives of three natural forms of vita min B 6. ................................ ................................ ................................ ........................ 36 1 3 Functional properties of vitamin B 6. SHMT: serine hydroxymethyltransferase phosphate; PUFA: polyunsaturated fatty acids. ................................ ................................ ................ 37 1 4 Synthesis of unsaturated fatty acids in mammals. MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid. EPA: eicosapentaenoic acid; DHA: docosahexaenoic acid. ................................ ................................ .............. 38 2 1 Effects of 28 d moderate vitamin B 6 restriction on plasma lipid fractions (A) and plasma PLP and homocysteine concentr ations (B) of 23 participants. ........ 59 3 1 Intracellular PLP concentrations in HepG2 cells cultured with different PL concentrations over 6 weeks. ................................ ................................ ............. 84 3 2 The 16 h enrichment curves of n 9 fatty acids, [D 35] C18:0 (A) and [D 33] C18:1 n 9 (B) in HepG2 cells cultured with different PL concentrations. ............ 85 3 3 The 16 h enrichment curves of n 6 fatty acids, [U 13 C] 18:2 n 6 (A), [U 13 C] 18:3 n 6 (B), [U 13 C] 20:3 n 6 (C), and [U 13 C] 20:4 n 6 (D) in HepG2 cells cultured with different PL concentrations. ................................ ........................... 86 3 4 The 16 h enrichment curves of n 3 fatty acids, [D 5] C18:3 n 3 (A), [D 5] C18:4 n 3 (B), [D 5] C20:5 n 3 (C) and [D 5] C22:6 n 3 (D) in HepG2 cells cultured with different PL concentrations. ................................ ........................... 88 3 5 Relative mRNA expression of related desaturases and elongases in HepG2 cells cultured with different PL concentrations. ................................ ................... 90

PAGE 11

11 LIST OF ABBREVIATIONS ANOVA Analysis of variance AI Adequate intake AUC Area under the curve BHT B utylated hydroxytoluene DHA D ocosahexaenoic acid DPA Docosapentaenoic acid EPA Eicosapentaenoic acid ER Endoplasmic reticulum FA Fatty acid FAD Flavin adenine d inucleotide FAME Fatty acid methyl ester GC/FID Gas chromatography with flame ionization detection GC/MS Gas chromatography with mass spectrometry GOI Gene of Interest HDL High density lipoprotein HepG2 Human hepatoma cell line HPLC High performance liquid chromatography HUFA Highly unsaturated fatty acid LCPUFA Long chain polyunsaturated fatty acid LDL Low density lipoprotein LPC L ysophosphatidylcholine MANOVA Multivariate analysis of variance MEM/EBSS Minimal essential medium with Earle's balanced salts M UFA Monounsaturated fatty acid

PAGE 12

12 NAD + Nicotinamide adenine dinucleotide (oxidized form) NADH Nicotinamide adenine dinucleotide (reduced form) NADPH Nicotinamide adenine dinucleotide phosphate PA P yridoxic acid PBMC Peripheral blood mononuclear cell PBS P hosp hate buffered saline PC Phosphatidylcholine PCR Polymerase chain reaction PE Phosphatidylethano l amine PEMT P hosphatidylethanolamine N methyltransferase PLP phosphate PMP phosphate PNG P yridoxine O D glucoside PNP phosphate PUFA P olyunsaturated fatty acid ROS Reactive oxygen species SAH S adenosyl homocysteine SAM S adenosyl methionine SHMT Serine hydroxymethyltransferase SHR S teroid hormone receptor TCA T ricarboxylic a cid THF Tetrahydrofolate UF CRC University of Florida Clinical Research Center UL U pper intake level V LDL Very low density lipoprotein

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for the Degree of Doctor of Philosophy INFLUENCE OF VITAMIN B 6 NUTRITIONAL STATUS ON FATTY ACID PROFILES IN HUMAN BLOOD AND CULTURED CELLS By Mei Zhao December 2011 Chair: Name Jesse F. Gregory III Major: Nutritional Science s Vitamin B 6 deficiency has been linked to the altered n 6 fatty acid (FA) profiles of rat tissue lipids, particularly with a decrease of arachidonic acid (AA) and an incre ase of linoleic acid over 8 0 years Some studies also indicated altered n 3 FA profiles in rat plasma and liver microsomes with vitamin B 6 deficiency. Based on previous findings, it was hypothesized that low vitamin B 6 status decreases n 6/n 3 long chain polyunsaturated fatty acids (LCPUFAs) but increases their precursors, linole ic acid and linolenic acid in both blood lipids and cultured human hepatoma (HepG2) cell line by impairing LCPUFA synthesis. The 23 h ealthy subjects receiv ed a 2 d ay controlled, nutritionally adequate diet followed by a 28 d ay vitamin B 6 restricted diet to induce a marginal deficiency (plasma PLP between 20 30 nmol /L) Plasma total linolenic acid, AA eicosapentaenoic acid ( EPA) and docosahexaenoic acid ( DHA ) concentrations all significantly decreased (p < 0.05) compared to their baseline values. Ther e were no changes in plasma free FA profiles or FA composition of erythrocyte and peripheral blood mononuclear cell membrane lipids. Total cholesterol, triglycerides, LDL cholesterol and HDL cholesterol did not differ. In cultured HepG2 cells, low er vitami n B 6 concentrations in the media led to lower cellular and membrane n 6 LCPUFA

PAGE 14

14 composition. In addition, there were accumulated cellular lipids in HepG2 cells cultured with low er vitamin B 6 concentrations compared to the regular medi um control A stable isotope tracer experiment further demonstrated that unsaturated FA synthesis decreased by 10 20 % in cells with low er vitamin B 6 concentrations The measurement of mRNA expression of relevant desaturases and elongases in HepG2 ce lls showed that FADS1 (delta 5 desaturase) and FADS2 (delta 6 desaturase) genes were 40 50% lower These findings provide several novel perspectives to interpret the link of differences in vitamin B 6 nutritional sta tus to lipid metabolism, which will be helpful to understand the association between vitamin B 6 and related diseases and disorders with perturbed lipid metabolism in large scale population based epidemiological studies.

PAGE 15

15 CHAPTER 1 LITERATURE REVIEW Introduction and Significance In more than 8 0 years since vitamin B 6 was discovered, much information about its functional and metabolic characteristics has been reported It is well known that vitamin B 6 plays an important role in ami no acid metabolism carbohydrate metabolism, nucleotide synthesis, and heme synthesis. T he exact role that vitamin B 6 plays in lipid metabolism remains unclear, although the interaction between vitamin B 6 and essential fatty acid deficiency was recognize d as early as in the 1930s (1 3) Vitamin B 6 was reported to increase linoleic acid content and decrease arachidonic acid content of different tissue lipids in r ats (4 8) Fatty acid desaturase activities were suppressed by vitamin B 6 deficiency (4, 7, 9) In addition, vitamin B 6 deficiency can impair phosphatidylcholine ( PC ) biosynthesis from phosphatidylethanolamine ( PE ) methyl ation pathway by elevating the inhibitory metabolite of phosphatidylethanola mine N methyltransferase (PEMT), S adenosyl homocysteine (SA H ) (9, 10) T he mechanisms underlying these phenomena are still uncl ear to date Lipids and fatty acids are very important for human body which serv e as the energy source s structu ral components of cell membrane, covalent modifiers o f protein structure gene regulators and precursors for synthesis of bioactive lipid mediators like eicosanoids. Low vitamin B 6 status is associated with inflammation and oxidative stress conditions with abnormal fatty acid patterns independent of homocy steine (11 13) Therefore, to understand the altered lipid metabolism under different nutritional status of vitamin B 6 is very valuable and significant which will further help us to interpret the role of vitamin B 6 in human health and diseases to a greater extent.

PAGE 16

16 History of Vitamin B 6 Vitamin B 6 is a water soluble compound that was identified from nutritional studie s in rats by Gyorgy in the 1930s. In these studies, vitamin B 6 was described to cure acrodynia (a B vitamin deficiency in rats with symptoms of dermatol ogical lesions and edema in paw s and ears) (1) Then, a cryst alline vitamin B 6 form was obtained from plant sources (14) and the structures of 3 different natural forms of free vitamin B 6 py ridoxine, pyridoxal, and pyridoxamine were recognized and synthesized by several other research groups in the next few years (15, 16) In the 1950s, Gunsalus and Snell et al. demonstrated a phosphorylated derivative of pyridoxal, later identified as pyridoxal phosphate (PLP) was the bioactive form of vitamin B 6 (17, 18) To date, the functional and metabolic characteristics of vitamin B 6 have been thoroughly investigated. Chemistry of Vitamin B 6 Structures The three major forms of free v itamin B 6 pyridoxine, pyridoxal, and pyridoxamine vary in the substituent at position 4 of 2 methyl 3 hydroxy 5 hydroxymethyl pyridines. There is a hydroxy methyl group in pyridoxine, a formyl group in pyridoxal, and an aminomethyl group in pyridoxamin e ( Figure 1 1 ). Each of these hydroxymethyl of the pyridine ring (Figure 1 2 ). Another relatively common form of vitamin B 6 exists as a glycosylated form the O D glucopyranosyl) pyridoxine in many plants. This form of pyridoxine has one glycosidic linkage (19) Properties B6 vitamers are water soluble compounds and stable under acidic pH. However, in alkaline media, some forms of vit amin B 6 (e.g. pyridoxal, pyridoxine, and

PAGE 17

17 pyridoxamine) are susceptible to photo oxidation and heat. Especially for the coenzyme PLP, oxidation of the aldehyde to the carboxylate occurs when exposed to light. Both pyridoxal and PLP can react with amino gro ups of substrates and proteins to form a Schiff base and such a carbonyl amine reaction accounts for many of the PLP dependent enzyme mechanisms (20, 21) Food Sources of Vitamin B 6 Free and bound forms of vitamin B 6 are widely distributed in foods. Good sources include meats, dairy products, and whole grain products. Fortified cereal products and dietary supplements are also considered as significant sources of vitamin B 6 (2 2) Generally plant foods contain the glycosylated form of vitamin B 6 pyridoxine O D glucoside (PNG); animal foods have more pyridoxal, pyridoxamine, and their phosphorylated forms. PNG may s erve as the storage form of vitamin B 6 in plants with concentration up to 75% in fruits, vegetables, and grains, however, with little or none in foods of animal origin (19) The overall bioavailability of vitamin B 6 in an average American diet is approximately 71 79% compared to the availability of free pyridoxine as 100% (23) Factors that may cause incomplete bioavailability include food matrix trapping, nondigestible residue and partial utilization of the glycosylated form (22) Some rat studies reported that PNG ha d a lower bioavailability comp ared to free pyridoxine form due to incomplete hydrolysis of the glycosidic bond (24) Several studies in humans indicated that the bioavailability of PNG for adults is ~ 50 60% compared to that of free pyridoxine (25, 26) The loss of vitamin B 6 during cook ing and thermal processing is also significant. In addition, B6 vitamers are light sensitive in solutions, but this sensitivity is influenced

PAGE 18

18 by the pH. Vitamin B 6 is heat labile in alkaline media but relatively heat stable in acid med ia which make it gen erally stable in many forms of storage and handling (20, 27) Among various forms of B6 vitamers, pyr idoxine is the most stable with relatively low chemical activity. Pyridoxine HCl salt is widely used in dietary supplements and food fortification because of its stability, ease of manufacture, and low cost (22) Absorption, Transport and Metabolism Absorption After en tering the small intestine, the phosphorylated forms of vitamin B 6 as well as PLP bound proteins are dephosphorylated by membrane bound alkaline phosphatase. Then, free vitamers are uptaken into mucosal cells via passiv e diffusion, mainly in jejunum (28, 29) In mucosal cells, free vitamers are rephosphorylated as metabolic trapping by ATP dependent py ridoxal kinase (30) Finally, the phosphorylated vitamers cross the basolateral m embrane mainly in unphosphorylated form. However, the glycosylated form of vitamin B 6 specifically PNG can be absorbed intact across small intestine as reflected by urinary excretion (25) Transport After free vitamers exit the basolateral membrane, they immediately enter blood circulation. In circulation B6 vitamers are bound to albumin or associat ed with red cell s to be delivered to the liver and other organs (31) Normally, most B 6 vitamers in blood are presented as PLP which is mainly Schiff base linked to proteins, primarily albumin in plasma and hemoglobin in red cell s. Pyridoxal and pyridoxine can be taken up by red cell s, where pyridoxine is partially con verted to pyridoxal and bound to hemoglobin (32) Most absorbed vitamin B 6 is transported into liver, the primary organ of vitamin B 6 metabolism. Red cell s a lso transport vitamin B 6 mainly in non phosphorylated forms. Once transported to peripheral tissues, the unphosphorylated

PAGE 19

19 forms of vitamin B 6 undergo phosphorylation and then are coupled with binding proteins for the retaining of the vitamin (33) Metabolism As reviewed by Coburn (1990), the turnover of vitamin B 6 consists of five compartments: muscle, liver, plasma, red cell s, and all other pools grouped together into one additional compartment (34) Among the five compartments, liver and muscle retain 80 90% of the total pool size As mentioned above, a large portion of absorbed B 6 vitamers are transported to liver where PLP is synthesized from free vitamers, and a major excretory catabolite 4 pyridoxic acid (4 PA) is produced from excessive B 6 vitamers and their phosphorylated forms (35) The conversion of vitamin B 6 to functional PLP depends on sequential action of pyridoxal kinase and pyridoxine phosphate oxidase. Pyridoxal kinase in mammals is Zn ATP dependent and stimulated by K + catalyzing the ph osphorylation of all three natural forms of vitamin B 6 The oxidase that converts PNP and PMP to PLP is riboflavin dependent and is subject to product inhibition by PLP (30, 36) Interestingly, certain liver tumors are lacking of this oxidase resulting impaired conversion of PMP/PNP to PLP (37, 38) De novo synthesis of vitamin B 6 occurs only in bacteria, fungi, and plants, making it an essential nutrient in human diets. Catabolism of vitamin B 6 is most acti ve in liver. Excess PLP is dephosphorylated to form PL b y alkaline phosphatase, which is then converted to the major excretory product 4 PA by FAD dependent aldehyde oxidase in human liver (33) In fact, the equivalent of about half the daily intake of vitamin B 6 by human body is lost in this way (39) Moreover, other forms of vitamin B 6 are excreted in urine especially with high intakes For instance, 5 pyrid oxic acid is excreted with large amounts of pyridoxine

PAGE 20

20 intake (> 100 mg/d) If large doses of a specific vitamin B 6 form are given, much of it will appear in urine in an intact form (40) E vidence from tracer studies nmol /g is a reasonable average overall vitamin B 6 content of human body The total pool size is approximately 1000 mol in a 70 kg human adult, which was estimated by data from muscle biopsies in 12 human subjects (34, 41) Up to 80% of vitamin B 6 is i n muscle as PLP bound to glycogen phosphorylase. The remaining vitamin B 6 is largely distributed in liver, but also the brain, heart, adrenal glands, kidney, and pancreas (34) Functions of Vitamin B 6 Functions of vitamin B 6 are complex, multifaceted, and interrelated. PLP serves as a coenzyme for more than 100 enzymes involved in t he metabolism of amino acids, carbohydrates and lipids, and heme and nucleotide synthesis (Figure 1 3) Amino Acid Metabolism Vitamin B 6 is best known for its essential role in amino acid metabolism. PLP functions as a coenzyme for transaminases that participate in amino acid catabolism. The mechanism of PLP as a coenzyme is to enable its carbonyl group to form a Schiff base with the amino group of the substrate. Electrons are removed from one of the R group, hydrogen, or carboxyl group attached to the pyridine ring having a high affinity of electrons. Generally, PLP is utilized by keto amino acids, and forming new amino acids by transferring amine groups to keto acids (42) In this way, transaminases link amino acid metabolism to ketogenic and glycogenic reactions. Vitamin B 6 is also involved in decarboxylation reactions with the carboxyl group removed, leading to irreversible formation of amines, including several important

PAGE 21

21 aminobutyrate (43) PLP is a coenzyme for aminolevulinate synthase located in mitochondrial matrix, to catalyze the rate limiting step of heme biosyn thesis from glycine and succinyl CoA (44) The synthase has a short half life probably because of the aminolevulinate product inhibition via reacting with the pyridoxal carbonyl or forming reactive oxygen species ( ROS ) by auto oxidation. Thus vitamin B 6 defi ciency causes heme/cytochrome deficiency and further elevates intracellular ROS formation (4 5) Moreover, PLP functions as a coenzyme involved in side chain cleavage reactions. For instance, PLP is the cofactor of two enzymes involved in cysteine synthase that conde nses homocysteine and se rine to form cystathionine cystat hionase which then catalyzes cysteine formation from cystathionine PLP is also a cofactor for the mitochondrial and cytoplasmic isoenzymes of serine hydroxymethyltransferase (cSHMT and mSHMT) (46) Specifically, serine is converted to glycine and formate initiated by mSHMT. The cS HMT then catalyzes the reversible 3 carbon transfer from serine to tetrahydrofolate (THF) to form 5, 10 methyleneTHF, the precursor of thymidylate. PLP is required for the conversion of tryptophan to NAD + as a coenzyme for kynureninase and kynurenine am inotransferase. The former catalyzes the cleavage of 3 hydroxykynurenine to alanine and 3 hydroxyanthranilate which then form s NAD + The aminotranferase catalyzes the conversion of 3 hydroxykynurenine to xanthurenic acid (47) Carbohydrate Metabolism As described previously up to 80% of PLP is distributed in muscle mainly as the PLP glycogen phosphorylase complex. Glycogen phosph orylase is a homozygous dimer that catalyzes glycogen phosphorolysis to yield glucose 1 phosphate. The

PAGE 22

22 mechanism has been elucidated as protonation of the glucosidic oxygen of the polysaccharide by inorganic phosphate at the initial stage, thus generati ng an oxycarbonium phosphate ion pair. PLP interacts to stabilize this ion pair, thereby permitting covalent addition of phosphate to form glucose 1 phosphate (48) PLP dependent transaminases participate i n the malate aspartate shuttle that enables mitochondria to oxidize NADH formed b y glycolysis. Transaminases also link amino acid metabolism to carbohydrate metabolism through two reactions: the first is the conversion of alanine to pyruvate which then ent ers the glycolytic pathway, and the ketoglutarate which enters the tricarboxylic acid (TCA) cycle directly. PLP ketobutyrate from cystathionine that feeds into the TC A cycle, increasing NADH production for energy metabolism (42, 48) Lipid Metabolism It is a well established fact that vitamin B 6 plays an important role in amino acid metabolism carbohydra te metabolism, nucleotide synthesis, and heme synthesis, however direct evidence of how vitamin B 6 is involved in lipid metabolism remains vague As early as in the 1930s, researchers found that essential fatty acids had a sparing effect on the dermatitis induced by vitamin B 6 deficiency in rats (1 3) After that, the role of vitamin B 6 in lipid metabolism was a subject of interest and studied b y many scientists In these studies, vitamin B 6 deficiency altered fatty acid profiles of different tissue lipids, particularly with a decr ease of arachidonic acid and an increase of linoleic acid (4 8) The mechanisms for such FA metabolic changes can be summarized as follows based on currently published data : 1) a decrease of the desaturation and/or elongation

PAGE 23

23 processes that synthesize arachidonic acid fro m linoleic acid; 2) an alteration in the methylation processes of phospholipids; 3) an increase in arachidonic acid oxidation or a decrease in linoleic acid oxidation; and 4) a lower fatty acid mobilization from triglycerides to phospholipids Lipid p rofiles Some researchers reported an increase in plasma cholesterol with low vitamin B 6 intake in monkeys and rabbits (49, 50) Harripersad and Burger undertook a study to confirm whether a subnormal dietary intake of vitamin B 6 would have an eff ect on plasma total cholesterol, high density lipoproteins (HDL), low density lipoproteins (LDL) and triglycerides (51) After 8 weeks of moderate vitamin B 6 r estriction (20 g pyridoxine HCl /d) a significant decrease in body mass was observed in low vitamin B 6 group compared to the pair fed control The low vitamin B 6 group had higher concentrations of total c holesterol and LDL in plasma There was only a n on significant decrease of plasma HDL in low vitamin B 6 rats A later study also observed an increase of plasma triglycerides and cholesterol with vitamin B 6 deficiency (52) As accumulated data suggest ed an association between low vitamin B 6 status and an increased risk of atherogenesis and coronary heart disease (53, 54) th ese finding s may implicate that low vitamin B 6 status elevates the risk of atherosclerosis and cardiovascular disease by decreas ing HDL /LDL ratio (55 57) In some clinical trials pharmacological doses of pyridoxine were given to lower plasma cholesterol and LDL in the elderly and patients with chronic renal failure (58, 59) One of the studi es showed that mean plasma cholesterol and LDL concentrations were decreased by 10% (p < 0.01) and 17% (p < 0.001), respectively after 8 weeks of pyridoxine supplementation (120 mg/d) (58) However the safety of long term use of vitamin B 6 supplementation at

PAGE 24

24 large doses must be carefully evaluated considering that the tolerable upper intake level (UL) of vitamin B 6 is suggested as 100 mg/d (60) Phospholipids and fatty acid profiles Phospholipids constitute 60% of the lipid mass of a eukaryotic cell membrane. Therefore, even minor changes in phospholipid composition may alter membrane function and even cell viability. Phospholipids are comp osed of a glycerol backbone with fatty acids esterified at the sn 1 and sn 2 positions. The phosphate group is attached to a polar head group at the sn 3 position. Phospholipids can be classified as choline glycerophospholipid (PC), ethanolamine glyceropho spholipid (PE), inositol glycerophospholipid (PI), glycerol glycerophospholipid (PG), and serine glycerophospholipid (PS) according to different polar head groups. The major type of membrane lipids is phosphatidylcholine, comprising 50% of the cellular lip ids (61) Phospholipids form a bilayer membrane which provides the structure components for c ells and organelles, and create s an intracellular enviro nm ent necessary for protein to function and interact. Membrane phospholipids are storage sites of arachidonic acid s which can be released by phospholi pase A 2 and is important as a substrate for eicosanoid synthesis (62, 63) Phospholipids are also precursors to platelet activating factor and inositol triphosphate (64, 65) Many researchers studied effects of vitamin B 6 deficiency on fatty acid profiles of phospholipids Delor me and Lupien studied the influence of vitamin B 6 deficiency on fatty acid composition of phosphatidylcholine (PC), lysophosphatidyl choline (LPC), and phosphatidylethanolamine (PE) in rat liver, plasma and kidneys. The percentage of arachidonic acid decreased but that of linoleic acid increased in different phospholipid fractions of various rat tissues These changes were the greatest in liver and plasma,

PAGE 25

25 and the least changes occurred in kidneys, especially for PE fraction (6) The differences might be due to different site s of fatty acid synthesis, different turnover rates of different phospholipid fractions in different tissues studied. Other scienti sts also confirmed these findings One study reported that linoleic and linolenic acids of liver phospholipids and triglycerides were accumulated in vitamin B 6 deficient rats (5) In another study, male Wistar rats fed with a vitamin B 6 deficient diet with 70% cas ein for 5 weeks were found to have increased amount of linoleic acid and decreased amount of arachidonic acid in plasma total lipid fraction and PE / PC fractions of liver microsomes. I linolenic acid was significantly higher bu t that of DHA was lower in PE/ PC fractions of rat liver microsomes with vitamin B 6 deficiency. The activity of delta 6 desaturase was 64% lower in vitamin B 6 deficient rats than their pair fed controls (7) Another study investigated whether PC biosynthesis was affected by vitamin B 6 deficiency in rat liver microsomes (66) There are t wo major pathways for PC biosynthesis. One involves the transfer of phosphorylcholine from CDP choline to a 1,2 diglyceride catalyzed by choline phosphotransferase (67) The second pathway involves sequential transfer of 3 methyl groups from S adenosyl methionine (SAM) to PE by PE methyltransferase (PEMT) (68) In t h is study, rats fed with a vitamin B 6 deficient diet for 5 weeks had decreased PC content but increased PE content in liver microsomes. The activities of choline phosphokinase and choline p hosphotransferase in liver decreased in vitamin B 6 deficient rats The concentration of PEMT co substrate, SAM decreased by ~ 30 % and its inhibitory metabolite S adenosyl homocysteine (SAH) was elevated under vitamin B 6 defic ient status (66) These data suggest ed an inhibited PC biosynthesis by modified

PAGE 26

26 methionine metabolism and decreased choline utilization in vitamin B 6 deficient rats Since arachi donic acids are primarily incorporated into the phospholipid fraction, the decreased PC synthesis may affect the percentage of arachidonic acid detected in phospholipids. In another study, it showed that severe vitamin B 6 deficiency led to decreased phosp holipid content but accumulated triglyceride content in rat liver (69) However the following 22 d pyridoxine supplementation had little effect on fatty acid composition of major phospholipid classes in rat plasma, liver and kidneys (70) To date, there were very few human studies on the interaction between vitamin B 6 and lipid metabolism. The most recent one was to investigate whether l owering pl asma homocysteine concentration in the elderly with B vitamin supplements would alter n 3 LCPUFA composition in plasma PC (71) This was a double blind ed placebo controlled, randomized clinical trial involving 253 participants ( 65y, plasma homocysteine 13 mol/L). Participants (n=127) in the experimental group were given a daily supplement of 1000 g folate, 500 g vitamin B 12, and 10 mg vitamin B 6 for 2 years. Although plasma homocysteine concentration w as significantly l ower in vitamin supplemented group, the proportion of n 3 LCPUFA s (EPA, DPA, and DHA) in plasm a PC did not differ between B vitamin supplemented and placebo group after 2 years of supplementation (71) However, this study mixed the effects of vitamin B 6, vitamin B 12 and folate As we know, v itamin B 6 a lone is no t a good homocysteine lowering factor compared to folate and vitamin B12 for a dietary deficiency (72, 73) which suggest ed that low vitamin B 6 status changed fatty acid patterns in a way independent of homocysteine. linolenic

PAGE 27

27 linolenic acid and DHA/EP A were observed in 21 subjects with low vitamin B 6 status, suggesting that impaired n 3 LCPUFA synthesis and/or accelerated n 3 LCPUFA turnover may occur in people with low vitamin B 6 status (8) Enzymes As the changes of fatty acid profiles with vitamin B 6 deficiency were confirmed by more and more studies, some scientists began to investigate the enzymes in highly unsaturated fatty acid (HUFA) synthesis. Figure 1 4 elucidates HUFA synthetic pathways in mammals and relevant enzymes involved (74) Mammals are unable to synthesize HUFAs directly from acetyl CoA due to the absence of omega 3 desaturase and delta 12 desaturase. However, HUFA s can be derived from dietary essential fatty acids linolenic acid in mammals (75) Delta 6 desaturase is considered as the most sensitive and strictly regulated enzyme participating in the first and rate limiting step of arachidonic acid biosynthesis from ingest ed linoleic acid. The delta 6 desaturation of C18:2 n 6 to C18:3 n 6 in liver microsomes is catalyzed by multi enzyme components including NADH cytochrome b 5 reductase, cytochrome b 5 and terminal delta 6 desaturase that are all embedded in the lipid bilayer of microsomal membrane. Specifically, NADH and NADPH are electron donors and cytochrome b 5 reductase and cytochrome b 5 transport the electron to the terminal delta 6 desaturase for catalyzation (76) S evere vitamin B 6 deficiency impaired delta 6 desaturation step in rat liver microsomes (9) A striking decrease of terminal delta 6 desaturase activity was found in rat liver microsomes with 5 w ee k s of vitamin B 6 restricted diet when given linoleic acid / linoleoyl CoA as the substrates in vitro The activity of the electron transport enzyme, NADH cytochrome b 5 r eductase was also decreased. The ratio of C20:4 n 6/C18:2 n 6 in liver microsomal total lipids and PC

PAGE 28

28 fraction decreased accordingly. D ecreased PC content was observed, which showed a positive correlation with the microsomal delta 6 desaturase activity (9) Such results suggest ed that the decreased PC content in liver microsomes in a vitam in B 6 deficient status might decrease delta 6 desaturase activity indirectly and thus impair arachidonate biosynthesis. Another study in rats also reported that a subnormal intake of vitamin B 6 (0.4 mg/kg of diet) caused a diminished delta 6 desaturase activity by 37% and 19% re s pectively using linolenic acid as substrates in liver microsomes Consequently, the products derived from lino linolenic acid arachidonic acid and EPA decreased accordingly (4) Other studies observed altered activities of delta 6 desaturase, elongase and acyl CoA oxidase in vitamin B 6 deficient rat s (7, 77) Enhanced activities of liver oleyl and arachidonyl CoA lysophospholipid acyltransferase were observed in vitamin B 6 deficient r ats This did not support the hypothesis that vitamin B 6 deficiency decreased the incorporation of arachidonate and oleate into tissue phospholipids (78) However, based on previous findings vitamin B 6 appears to inhibit rate limiting enzymes in HUFA synthesis via an indirect manner No solid evidence indicated t hat vitamin B 6 or PLP function s as a coenzyme of relevant enzymes in HUFA synthesis Assessment of Vitamin B 6 Status Methods S everal indicators have been developed to assess vitamin B 6 status of an individual including those considered direct (e.g. PLP concentration in cells or fluids) and those that are indirect or functional (e.g. red cell aminotransferase activity coefficients and tryptophan catabolites) (43)

PAGE 29

29 Plasma PLP may be the best single indicator since it appea rs to reflect tissue stores of vitamin B 6 (31) Moreover, there were studies showing a rapid response of plasma PLP concentration to different levels of dietary vitamin B 6 intake (79, 80) The cutoff value of plasma PLP for vitamin B 6 adequacy is between 20 30 nmol /L based on recent findings (81 86) Urinary 4 PA is another direct indicator of vitamin B 6 status in short term. The daily excretion of 4 PA reflects the irreversible o xidation of pyridoxal in tissues and responds promptly to dietary depletion and repletion of vitamin B 6 (31, 87) Generally, a value greater than 3 mmol /d is suggested as an indicator of adequacy (88) Nevertheless, 4 PA excretion can be influenced by many other fact ors including gender, age, alcohol, oral contraceptives, protein intake, and riboflavin status and thus is not considered as a good single indicator (88, 89) In addition some metabolites are used as indirect or functional indicators of vitamin B 6 status. The basis for this takes into account the metabolic pathways and enzymes that are PLP dependent. For i nstance, red cell aminotransferases for aspartate and alanine are commonly measured before and after adding PLP in vitro The ratios of these aminot r a n sferase activities before and after adding PLP (activity coefficient) in human red cell s with PLP incubat ion are higher under vitamin B 6 d eficient status than adequate vitamin B 6 status. Values of 1.5 1.6 for the aspartate aminotransferase activity coefficient and approximately 1.2 for the alanine aminotrasferase activity coefficient were suggested for adeq uacy (88, 90) Considering the lifespan of red cell s, these transaminase activities are thought to be a lo ng term assessment of vitamin B 6 status. Catabolites from tryptophan and methionine are also used for evaluating vitamin B 6 status. Since kynureninase and kynurenine

PAGE 30

30 aminotransferase involved in niacin synthesis from tryptophan are PLP dependent, the int ermediates kynurenine, kynurenic and xanthurenic acid will be accumulated in the urine with vitamin B 6 deficiency Generally, a 24 h urinary excretion of < 65 mmol xanthurenic acid after an oral dose of 2 g tryptophan is suggested as adequate vitamin B 6 status (47, 88) The methionine load test is another indirect measurement of vitamin B 6 status. For this t est, the urinary excretion of cystathionine is examined over 24 h after a 3 g loading dose of L methionine (91) However, the mos t accurate way of assessing vitamin B 6 status is probably to combine two or more of these indicators considering the influence from other factors such as age, exercise, pregnancy, and diseases (92 94) Deficiency and Toxicity Clinical signs of severe vitamin B 6 deficiency are not common in developed countries However, marginal or suboptimal vitamin B 6 status can be found in women of reproductive age, es pecially current and former users of oral contraceptives, male smokers, non Hispanic African American men, and men and women over age 65 (95 98) Whereas no c linical symptoms are displayed with a marginal deficiency, metabolic changes can occur earlier and become more obvious as vitamin B 6 deficiency progresses. Previous studies in our group reported that margin al vitamin B 6 deficiency altered plasma amino ac id profiles with marked elevation of cystathionine and to a lesser extent elevation of glycine. Tracer kinetic studies indicated that vitamin B 6 restriction yield ed increased postprandial rates of whole body cystathionine synthesis and serine production from glycine, while other aspects of one carbon metabolism including fluxes of cysteine and methionine pools and rates of glycine cleavage and

PAGE 31

31 homocysteine remethylation processes were not significantly affected in healthy adults (82 86) When severe vitamin B 6 deficiency occurs, clinical symptoms develop such as small cell type anemia, pellagra like dermatitis, glossiti s and stomatitis, fatigue, depression, cognitive dysfunction and even seizures and death (99) Causes for vitamin B 6 deficiency may include low vitamin B 6 intakes impaired vitamin B 6 absorption, inborn errors affecting enzymes involved in vitamin B 6 isoform interconversion diseases and drug interactions (22) A dverse effects of vitamin B 6 only have been documented from vitamin B 6 supplements but never from food sources. The therapeutic use of pyridoxine for various disorders (e.g. pyridoxine resp onsive anemia, cystathioniuria and homocysteinuria ) and self medication may lead to the potential problem of toxicity. Large doses of vitamin B 6 supplements (> 1000 mg/day) over long periods of time can result in painful neurological symptoms known as sen sory neuropathy (100) In order to prevent this n eurological damage in all individuals, Food and Nutrition Board at the Institute of Medicine (FNB) set the tolerable upper intake level (UL) for pyridoxine at 1 00 mg/day for adults (60) Requirement of Vitamin B 6 Based on physiological and genetic characteristics, vitamin B 6 intakes, and protein intakes of populations with different age and gender, the FNB proposed the recommended dietary allowances (RDA) for vitamin B 6 of 1.3 mg/d for adult men and women. This value reaches the adequacy by 98% of the healthy population within the age group (19 50 yr) (88, 101, 102) Table 1 1 summarizes specific R DAs for vitamin

PAGE 32

32 B 6 in other age groups (101, 103 105) However, due to the limited data on vitamin B 6 requirements for infants, only the adequate intakes (AI) are given instead of the RDAs. Vitamin B 6 in Health and Disease Low circulating folate and vitamin B 6 concentrations are associated with increased risk of strokes and vascular diseases (12, 13, 98, 106) The Study Cohort ( 1980 1994 ) showed that high intakes of folate and vitamin B 6 were inversely associated with the relative risk of coronary heart disease (107) Some researchers proposed the mechanism for this association was due to lower circulating homocysteine concentration after supplementation. However, vitamin B 6 itself is not a strong fa ctor of lowering homocysteine. Other researchers suggest that vitamin B 6 is an independent inflammation predictor not relevant to homocysteine. In some case control studies, plasma PLP was inversely correlated with inflammation marker s C reactive protein (CRP) and fibrinogen in patients with vascular disease (11, 12, 108) These findings generate a hypothesis that inflammation causes a functional vitamin B 6 deficiency that is possibly mediated by increased utilization of vitamin B 6 in the inflammatory processes inc luding cytokine and antibody synthesis and immune cell proliferation As reported by Chiang et al. (109) the low plas ma PLP concentration seen in inflammation was unlikely due to insufficient dietary intake of vitamin B 6 and/or excessive urinary vitamin B 6 excretion since the food intake and 24 h urinary excretion of 4 PA did not differ between rheumatoid arthritis patients and healthy control subjects From another perspective vitamin B 6 deficiency led to abnormal lipid profiles by elevating plasma total cholesterol and LDL concentration s but lowering HDL concentration (49 52) The Framingham Heart Study Cohort observed that low plas ma

PAGE 33

33 PLP concentration w as associated with de crease d ratio of plasma HDL/L DL cholesterol (108) However, a combined supplem entation of vitamin B 6, folate and vitamin B 12 for 6 months did not change HDL and LDL cholesterol concentrations compared to the placebo group (110) The HOPE (Heart Outcomes Prevention Evaluation) study showed that a 5 y ear supplementation of folate, vitamin B 6 and vitamin B 12 slightly but significantly increased plasma HDL cholesterol (111) Since unbalanced LDL and HDL level is considered as a significant predictor for arthrosclerosis and vascular disease, low vitamin B 6 status may further adverse the effects of in flammation status and increase risks of arthrosclerosis and cardiovascular diseases. However, the detailed mechanisms of association between low vitamin B 6 status and inflammation related diseases still need further investigation before any conclusions can be made. Hypotheses and O bjectives Overall Rationale Although the interaction between vitamin B 6 and lipid metabolism was recogn ized as early as in the 1930s, the exact role of vitamin B 6 in lipid metabolism is still not well understood This research project investigated the influence of different vitamin B 6 nutritional status on fatty acid profiles i n human blood and culture d cells and possible mechanisms involved. The abnormal fatty acid profiles with low vitamin B 6 status are probably linked to the role of vitamin B 6 in inflammation related diseases. The following hypothes es were tested in healthy humans a nd cultured human hepatoma (HepG2) cell line with a range of physiologically relevant level s of vitamin B 6 using the experimental strategies outlined in the specific aims:

PAGE 34

34 Hypothesis 1 M arginal vitamin B 6 defici ency results in lower n 6 and n 3 L CPUFAs in plasma and peripheral blood mononuclear cells ( PBMC s) but not in erythrocytes Specific aims are as follows : 1. To determine the influence of marginal vitami n B 6 deficiency on blood lipid fractions including total triglycerides, cholesterol, HDL cholesterol and LDL cholesterol. 2. To determine the influence of marginal vitamin B 6 deficiency on total fatty acid and free fatty acid profiles in plasma 3. To determin e the influence of marginal vitamin B 6 deficiency on erythrocyte and PBMC membrane fatty acid composition. 4. To determine overall effects of moderate vitamin B 6 restriction on n 3, n 6, and n 9 fatty acids in plasma, erythrocytes and PBMCs Hypothesis 2 Vi tamin B 6 deficiency results in lower n 6 and n 3 LCPUFA s in HepG2 cells and th e lowest LCPUFA concentration s are found in most deficient cells S pecific aims are as follows : 1. To measure individual fatt y acid concentrations and fatty acid composition (by weight percentage) in HepG2 cells cultured with a range of physiologically relevant levels of vitamin B 6. 2. To measure membra ne fatty acid composition in HepG2 cells cultured with a range of physiological related levels of vitamin B 6. Hypothesis 3 The n 3 and n 6 LCPUFA synthesis is impaired in HepG2 cells with vitamin B 6 deficiency compared to cells with adequate vitamin B 6 Specific aims are as follows: 1. To determine n 3, n 6, and n 9 fatty acid synthesis in HepG2 cells cultured with a range of physiologically relevant levels of vitamin B 6 using s table isotope tracer techniques.

PAGE 35

35 2. To measure relati ve mRNA expression of desaturases and elongases in n 3, n 6, and n 9 fatty acid synthesis in HepG2 cells cultured with a range of physiologically relevant levels of vitamin B 6.

PAGE 36

36 Table 1 1. Recommendations for vitamin B 6 intake in h umans Life stage A ge Males (mg/d) Females (mg/d) Infants 0 6 months 0.1 (AI) 0.1 (AI) Infants 7 12 months 0.3 (AI) 0.3 (AI) Children 1 3 years 0.5 0.5 Children 4 8 years 0.6 0.6 Children 9 13 years 1.0 1.0 Adolescents 14 18 years 1.3 1.2 Adults 19 50 years 1.3 1.3 Adults > 51 years 1.7 1.5 Pregnancy all ages 1.9 Lactation all ages 2.0 AI: adequate intake. Pyridoxine Pyridoxal Pyridoxamine Figure 1 1. Structures of three natural forms of free vitamin B 6. phosphate phosphate phosphate Figure 1 2. Structures of phosphorylated derivatives of three natural forms of vitamin B 6.

PAGE 37

37 Figure 1 3. Functional properties of vitamin B 6. SHMT: s erine hy droxymethyltransferase phosphate; PUFA: polyunsaturated fatty acids.

PAGE 38

38 Figure 1 4. Synthesis of unsaturated fatty acids in mammals MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid. EPA: eicosapentaenoic acid; DHA: doc osahexaenoic acid.

PAGE 39

39 CHAPTER 2 MARGINAL VITAMIN B 6 DEFICIENCY DECREASES PLASMA N 3 AND N 6 POLYUNSATURATED FATTY ACID CONCENTRATIONS IN HEALTHY MEN AND WOMEN Introduction Vitamin B 6 functions as a coenzyme in the form of PLP in amino acid metabolism, heme biosynthesis, nucleic acid biosynthesis, and gluconeogenesis. Reports of a connection between vitamin B 6 status and lipid metabolism have appeared periodically for over 8 0 years. Essential fatty acids were reported to have an ameliorating effect on the dermatitis induced by vitamin B 6 deficiency in rats (1) Several rat studies showed that vitamin B 6 deficiency altered n 6 fatty acid profiles of tissue lipids, with a decrease of arach idonic acid (C20:4 n 6) and an increase of linoleic acid (C18:2 n 6) (4 6, 9) Other studies reported a signific ant change of n 3 fatty acid profiles of liver and kidney phospholipids in vitamin B 6 deficient rats (7, 112, 113) However, very few studies have investigated effects of changes in vitamin B 6 intake on fatty acid profiles in humans. One reported that plasma PUFA profiles in humans with vitamin B 6 defic iency were not different from those with normal vitamin B 6 status. However, the ratios of C20: 5 n 3 / C18: 3 n 3 and C22:6 n 3 / C18:3 n 3 were significantly lower in the vitamin B 6 deficient group (8) Another study showed that 2 y ear supplementation of folate (1000 g/d), vitamin B 6 (10 mg/d), and vitamin B 12 (500 g/d) di d not change fatty acid profiles of plasma phosphatidylcholine among 123 participants although plasma homocysteine concentrations were significantly lower compared to the placebo group (71)

PAGE 40

40 PUFAs frequently are associated with an immunomodulatory effect in humans. The n 6 PUFA class has a pro inflammation effect that i s mediated by the release of arachidonate derived proinflammatory metabolites In contrast, n 3 PUFAs are associated with anti inflammatory effects. Abnormal plasma fatty acid profiles are associated with many pathological conditions such as autoimmune dis ease, cardiovascular disease, diabetes, and depression etc Patients with such disorders tend to have higher plasma total n 6/n 3 PUFA ratio than healthy people (114 117) Elevated plasma free fatty acid concentrations induce insulin resistance and the release of proinflammatory mediators in vivo (118, 119) The long chain PUFAs can be synthesized from dietary essential fatty acids linoleic linolenic acid in human body. Arachidonic acid, EPA and DHA serve as precursors of bioactive mediators involved in inflammation response and neuroprotection (120 122) while the PUFA composition of membrane lipids affects cell membrane fluidity and function (123) Prostaglandin production is directly modulated by the substrate availability of arachidonic acids and EPA in cellular membrane phospholipids (124) Clinically severe vitamin B 6 deficiency is rare H owever, marginal vitamin B 6 status, as reflected by plasma PLP concentration between 20 30 nmol /L (88) is common in women of reproductive age especially current and former users of oral contraceptives, male smoke rs, and the elderly (95, 97, 98) Whereas no clinical si gns are displayed with a marginal deficiency, metabolic changes can occur earlier and become more obvious as vitamin B 6 deficiency progresses. Previous studies in this lab showed that marginal vitamin B 6

PAGE 41

41 deficiency alters plasma amino acid profiles with marked elevation of cystathionine and to a lesser extent elevation of glycine. Tracer kinetic studies have shown that vitamin B 6 restriction yields increased postprandial rates of whole body cystathionine synthesis and serine production from glycine, w hile other aspects of one carbon metabolism including fluxes of cysteine and methionine pools and rates of glycine cleavage and homocysteine remethylation processes were not significantly affected in healthy adults ( 82 86 ) Controlled vitamin B 6 restric tion studies have allowed investigation of the effects of short term marginal vitamin B 6 status [82 86]. Such studies have provided an opportunity to examine the effect of fatty acid profiles. We report here fatty acid profiles in plasma free fatty acids and total plasma lipids as well as in PBMC and erythrocyte membranes in 23 healthy young adults that participated in two recent vitamin B 6 restrict ion protocols ( 84 86 ) Subjects and Methods Subjects Healthy adult men and nonpregnant women (20 40 y) w ere recruited and screened by standard clinical measures as previously described (86, 125) Medical history, dietary habits, and demographic data were assessed by a questionnaire. Inclusion criteria were: no history of gastrointestinal surgery, chronic disease or chronic drug use; no smoking or alcoholism; n o dietary supplementation; no chronic consumption of a high protein diet; and normal blood tests of hematological, electrolyte, renal and hepatic function. The 23 eligible subjects h ad adequate nutritional status based on serum folate > 7 nmol /L, vitamin B 12 > 200 pmol/L, plasma homocysteine < 12 mol/L, plasma

PAGE 42

42 PLP > 30 nmol /L, and a BMI < 28 kg/m 2 Written informed consent was provided by each subject. The University of Florida Institutional Review Board and the University of Florida Clinical Research Cen ter (UF CRC) Scientific Advisory Committee reviewed and approved this protocol. Diet Participants consumed nutritionally adequate meals with standardized composition for 2 days to minimize dietary variations before the study. Thereafter, a continuous 28 d ay dietary intervention with restricted vitamin B 6 content (< 0.5 mg/d) was administered to induce marginal vitamin B 6 deficiency (plasma PLP between 20 30 nmol /L). During this period, all the participants came to the UF CRC twice a day to consume their breakfast and dinner. Lunch was taken ou t and snacks were given to compensate for daily energy needs. The meals were prepared by the CRC Bionutrition Unit. Custom supplements of multivitamins (no vitamin B 6) and multiminerals were given to the participant s during restriction to assure adequate intake of all other nutrients. All dietary intake data of the 2 d ay (2 d) controlled diet and 28 d ay (28 d) vitamin B 6 restricted diet were collected and analyzed using Nutrition Data System for Research Software ve rsion 2005/2007 (Nutrition Coordinating Center, University of Minnesota, Minneapolis, MN). C ompliance in consuming the vitamin B 6 restricted diet was monitored by measuring plasma PLP weekly (86, 125) Sample Collection a nd Screening Measurements Blood samples were collected after an overnight fast at the e nd of 2 d controlled diet and after the 28 d vitamin B 6 restricted diet. Plasma and erythrocytes were separated by centri fuging the whole blood at 1650 x g, 15 min

PAGE 43

43 at 4 o C within 15min of collection. PBMCs were separat ed using a commercial kit (Lymphocyte H, Cedarlane) from the whole blood within 2 h of collection. All blood fractions were stored at 80 o C for later analysis. Serum folate and vitamin B 12 concentrations at baseline were measured using a commercial chem iluminescence based assay (Elecsys, Roche Diagnostics). Plasma PLP and total homocysteine concentrations were determined by reverse phase HPLC with fluorescence detection (126, 127) Plasma lipid fractions (triglycerides, total cholesterol, HDL cholesterol and LDL cholesterol) were measured according to standard clinical procedures by the Shand s Hospital Clinical Laboratories. Total Fatty Acid Analysis i n Plasma All chemicals and solvents were purchased from Fisher Scientific (Pittsburgh, PA) unless otherwise noted All the solvents used are with HPLC grade or above. The individual fatty acid me thyl ester (FAME) standards the internal standard t ricosanoic acid (C23:0 ) and the Supelco 37 Component FAME Mix were purchased from Sigma Aldrich (St. Louis, MO). Plasma total lipids were extracted according to Folch et al (128) Plasma (200 L) was added into 4 mL chloroform methanol (vol:vol, 2:1) solvent mixture with 0.01% butylated hydroxytoluene (BHT) Tricosanoic acid (C23:0, 1 mg/mL) was used as the internal standard. The mixture was vortexed vigorously for 30 s and kept at room temperature for 1 h. Proteins were removed by filtration (0.45 m filter, Fisher Scientific) Sodium chloride (1 mol/L, 1 mL) was added to the mixture. Phase separation was achieved by centrifugation at low speed (1000 x g, 10 min) and the lower chloroform layer was collected and dried under nitrogen gas. Total fatty acids were then transmethylated to form FAMEs for gas

PAGE 44

44 chromatography (GC) analysis For the transmethylation reaction, 2 mL acetyl chloride methanol (vol:vol, 5:95) solvent mixture was added into the reaction vials. The samples were heated at 100 o C for 1 h. After cooling, the FAMEs were extracted by 1 mL isooctane with 0.01% BHT (129) The FAME containing isooctane was washed with 200 L NaCl (1 mol/L) and dried over anhydrous sodium sulfate ( Na 2 SO 4 ) and concentrated to 50 100 L under nitrogen gas. The quantitative analysis of FAMEs was performed using a capillary column Omeg awax TM 250 (30 m x 0.25 mm x 0.25 m; Supelco Bellefonte, PA ) on a TraceGC Ultra TM gas chromatograph with flame ionization detection (GC/FID, Thermo Scientific). The initial column temperature was 130 o C holding for 5 min followed by an increase rate of 5 o C/min until reaching 250 o C and holding for 12 min. The column was then heated at 27 0 o C for 3 min to remove any residues before the next run. The injector and detector temperatures were set as 250 and 270 o C respectively Injections were performed at a split ratio of 1:50 for plasma samples using helium as the carrier gas with a flow rate of 1 mL/min The injection volume was 2 L/per sample. Data acquisition and analysis were performed u sing Xcalibur software ( Thermo Scientific ) The Supelco 37 Com ponent FAME Mix and individual FAME standards were used for fatty acid identificati on, based on a comparison of peak retention times between samples and standards. The calculation of individual fatty acid concentrations was based on the area ratio of targe t fatty acid to the internal standard (C23:0) (methyl ester form) Plasma free fatty acid

PAGE 45

45 concentrations were analyzed by the Sarah W. Stedman Nutrition and Metabolism Center at Duke University Medical Center (130) Membrane F atty A cid A nalysis in E rythrocytes and PBMCs Frozen red cells from a 1 mL pellet were thawed at room temperature and osmotically lysed with 1 mL cold di stilled water. The cell pellet was centrifuged at 1 000 x g, 10 min at 4 o C to remove unbroken cells, and then ultracentrifuged at 100,000 x g, 30 min at 4 o C using a near vertical rotor NVT65 (Beckman Coulter). After aspirating the supernatants, total membrane pellets w ere washed with 1 mL cold d istilled water 3 times and dispersed and homogenized by sonication in 30 0 L methanol. A modified fatty acid analytical method for biological samples with low lipid abundance was used, combining lipid extraction and fatty acid es terification into one step to minimize sample loss (131) Briefly, 90 L of erythrocyte membrane homogenate in met hanol was mixed with 2 mL of 14% (w: v) boron trifluoride/methanol reagent. The mixture was heated at 100 o C for 1 h and then cooled to room temperature. The FA MEs were extracted by adding 2 mL isooctane and then followed by washing with 2 mL NaCl (1 mol/L) solution After vortexing vigorously for 30 s, phase separation was ach ieved by centrifuging at 1000 x g, 10 min at 4 o C. The upper isooctane layer containing FAMEs was collected, dried over anhydrous Na 2 SO 4 and finally concentrated to 50 100 L under nitrogen gas for GC analysis The PBMC membrane fatty acids were analyzed similarly. Frozen PBMCs were re suspended in 5 mL cold dist illed water and disru pted by sonication for 30 s. The disrupted cell suspension was centrifuged at 1 000 x g, 10 min at 4 o C to remove nucle i and unbroken cells. Total membrane fractions were collected by

PAGE 46

46 o C. T he same method was used for GC sample preparation of PBMC membrane lipid s (131) The FAMEs derivatized from erythrocyte and PBMC membrane fatty acids were analyzed by GC/FID as described earlier. Statistical A nalysis All data were presented a s me an SD A 2 sample t test was performed to determine differences in baseline characteristics between men and women. All the other statistical differences were determined based on the log2 transformation o n 3 stages: 1) Multivariate analysis of variance (M ANOVA) was used to evaluate the overall effects of marginal vitamin B 6 deficiency on fatty acid profiles of different blood fractions; 2) Step down MANOVA analyses were performed to test the overall effects of marginal vitamin B 6 deficiency on n 3, n 6 a nd n 9 fatty acid pools of different blood fractions, respectively; 3) Paired 1 sample t tests w ere used to evaluate the influence of marginal vitamin B 6 deficiency on individual fatty acid metabolites and ratios of product to precursor fatty acids. For t he first two steps, statistical significance was determined at the 0.05 level of the Type I error rate. For the third step, statistical significance was determined after adjusting for multiple comparisons by controlling the positive false discovery rate ( p FDR) at the 0.05 level and computing adjusted p values (132) Data were analyzed using st atistical software SAS 9.2. Results Participant Characteristics Table 2 1 show s the characteristics of 23 participant s at baseline with normal nutritional status for vitamin B 6, folate, and vitamin B 12. There were no

PAGE 47

47 significant differences in baseline characteristics between men and women except that female subjects had lower plasma PLP at baseline (59 13 vs. 45 13 nmol /L) (p = 0.033) ( Table 2 1 ). Effects of Marginal Vitamin B 6 Deficiency on Plasma Lipid Fractions Total and Fr ee Fatty Acid Concentrations Plasma PLP concentration decreased into the range of marginal deficiency from 52 14 nmol /L to 21 5 nmol /L (p 0.001) during the 28 d moderate vitamin B 6 restriction. Plasma total homocysteine concentration did not change (7.0 1.3 vs. 7.1 1.5 mol/L) ( Figure 2 1 ). Plasma HDL cholesterol concentration decreased from 55 10 to 52 11 mg/dL after vitamin B 6 restriction (raw p = 0.009 ) Plasma triglyceride concentration increased from 79 23 to 90 33 mg/dL (raw p = 0. 029 ) However, after adjusting for the pFDR there were no significant changes of total cholesterol, triglycerides, HDL cholesterol and LD L cholesterol ( Figure 2 1 ). The MANOVA analysis of plasma tot al fatty acids showed that the 28 d moderate vitamin B 6 restriction affected the overall fatty acid profiles (p = 0.0031), and those of the n 6 (p = 0.0004), n 3 (p = 0.0182) and n 9 ( p = 0.0013) fatty acid pools in healthy adults (Table 2 2) The concent ration of linolenic acid (C18:3 n 6) and arachidonic acid (C20:4 n 6) significantly decreased from 42 20 to 37 15 mol/L (adjusted p < 0.05) and from 548 96 to 490 94 mol/L ( adjusted p < 0.001) after vitamin B 6 restriction. We also observed a significant decrease in plasma total EPA from 37 13 to 32 13 mol/L ( adjusted p = 0.01 8) and DHA from 121 28 to 109 28 mol/L (adjusted p = 0.018 ) ; however, concentrations of linoleic acid (C18:2 n linolenic acid (C18:3 n 3) t hat

PAGE 48

48 are precursors of LC PUFA synthesis did not change. To tal n 6 PUFA concentration did not change after vitamin B 6 restriction, but total n 3 PUFA concentration decreased (p = 0.01). Consequently, the plasma n 6/n 3 PUFA ratio increased modestly fr om 15.4 2.8 to 16.6 3.1 (p = 0.035) We also measured plasma free fatty acid concentrations which are considered to be indicators o f inflammation. However, there were no significant changes in free fatty acid profiles after 28 d restriction compared to the baseline values ( Table 2 3 ). The ratios of precursor to product fatty acids (conversion indices) were calculated ( Table 2 5 ) to provide a measure of relative fatty acid pool sizes, which would be related to rates of fatty acid interconversion and turnover in vivo The ratio of plasma total C20:4 n 6 / C18:2 n 6 significantly decreased from 0.21 0.04 to 0.19 0.04 (p < 0.01 ) ( Table 2 5 ) The MANOVA analysis showed that marginal vitamin B 6 deficiency had an overall effect on the conversion indices (p = 0.016) with a particular effect on the ratios of long chain n 6 PUFAs to their precursor fatty acid C18:2 n 6 (p = 0.001) and also the ratios in n 9 pathway (p < 0 001) (Table 2 2) Effects o f Marginal Vitamin B 6 Deficiency o n M embrane Fatty Acid Composition in Erythrocytes a nd PBMCS Membrane fatty acid composition is related to cell membrane fluidi ty and influences many cellular functions However, we found no changes of fatty acid composition in red cell membrane lipids after 28 d vitamin B 6 restriction (Table 2 4) The oleic acid (C18:1 n 9) in PBMC membrane lipids increased from 15.9 1.1 % to 16.6 1.2 % (raw p = 0.0 25) However, after adjusting for pFDR, there

PAGE 49

49 was no significant change. The ratio of C18:1 n 9 / C18:0 tended to increase in both erythrocyte and PBMC membrane lipids after restriction, although the changes were not significant ( Table 2 5). Additionally the MANOVA analysis showed an overall effect of vitamin B 6 restriction on the conversion indices of PBMC membrane fatty acids (p < 0.05) but there was no effect on n 3, n 6, and n 9 fatty acid pools in both eryth rocyte and PBMC membrane lipids (Table 2 2) Discussion To our knowledge, this is the first study to investigate whether marginal vitamin B 6 deficiency affects fatty acid profiles in healthy adults. We observed a significant decrease of plasma total lin olenic acid (C18:3 n 6), arachidonic acid (C20:4 n 6) EPA (C20:5 n 3) and DHA (C22:6 n 3) concentrations but no changes in the levels of their precursor fatty acids, linoleic acid (C18:2 n 6) and linolenic acid (C18:3 n 3) after 28 d vitamin B 6 restri ction The ratio of C20:4 n 6 / C18:2 n 6 in plasma total lipids decreased suggesting that the synthesis, turnover or both of C20:4 n 6 was altered These findings largely were consistent with those reported to occur in B 6 deficient rats (4 7, 9, 113) Free fatty acid conce ntrations in plasma were measured in this study, which was not done in previous rat studies. Free fatty acids usually originate from the mobilization of lipid droplets stored in adipose tissue or from the hydrolysis of circu lating phospholipids (115) No significant changes were found in either individual or total free fatty acid concentrations in plasma which suggest ed that marginal vitamin B 6 deficiency did not affect lipid mobilization in these he althy human individuals.

PAGE 50

50 Circulating fatty acids modify membrane fatty acid composition by incorporating into membrane lipid bilayer or exchanging with membrane fatty acids. The exchange of fatty acids from plasma to blood cells is achieved through severa l mechanisms, including: transfer of albumin bound free fatty acids by fatty acid binding proteins, transfer of phosphatidylcholine from plasma lipoproteins to cell membranes directly, and transfer of non esterified fatty acids from the hydrolysis of trigl ycerides in lipoproteins (133, 134) However, our analysis of erythrocyte and PBMC membrane lipids did not show any changes of n 6 and n 3 PUFA compositions as reflected in plasma after 28 d vitamin B 6 restriction. The ratio of C18:1 n 9 / C18:0 in both erythrocyte and PBMC membrane fractions showed a modest, non s ignificant increase after vitamin B 6 restriction Similar findings were observed in erythrocyte membrane lipids of rats fed with vitamin B 6 deficient diet for 20 w ee k s (78) In this study, liver oleyl and arachidonyl CoA lysophospholipid acyltransferase activities were significantly higher in vitamin B 6 deficient rats than pair fed controls which suggest ed that more arachidonate and oleate were incorporated into membrane phospholipids with vitamin B 6 deficiency T hus the percentage of membrane arachidonic acid in blood cells may not differ much before and afte r vitamin B 6 restriction. A potential mechanism underlying the lower n 6 and n 3 LCPUFAs in plasma after vitamin B 6 restriction is impairment of PUFA interconversion. Delta 6 desaturase activity decreased in vitamin B 6 deficient rats (4, 9) but the relation between such in vitro enz yme activit y measurements and in vivo metabolic flux is unknown. Another hypothesis to account for our findings is that

PAGE 51

51 changes of fatty acid profiles are due to the decrease in PC from PE methylation (6) Severe vitamin B 6 deficiency led to decreased phospholipid methylation by elevating homocysteine and further lowering PEMT co substrate, SAM level while elevating PEMT inhibitory metabolite SAH in rat liver microsomes (10, 66) However, no significant change was found in plasma homocysteine concentration (83, 86) or in whole body transmethylation flux (125) in this vitamin B 6 restriction protocol. Another link between vitamin B 6 and lipid metabolism i s the PLP dependent enzyme serine palmitoyltransferase that functions in sphingolipid biosynthesis by catalyzing the condensation of serine and palmitoyl CoA to produce 3 ketodihydrosphingosine. Thus sphingolipid biosynthesis may be impaired with vitamin B 6 deficiency, which may also contribute to the altered fatty acid profiles (135) A recent study in rats using stable isotope tracers lin olenic acid (C18:3 n 3) and 2.6% of linoleic acid (C18:2 n 6) from diets were utilized for fatty acid elongation and desaturation, while almost 80% of the se precursor fatty acids were either catabolized or excreted (136) This suggest s that vitamin B 6 deficiency may alter fatty acid oxidation. Total cholesterol and LDL concentrations increased in rats with subn ormal vitamin B 6 status, but plasma HDL concen tration did not differ from pair fed controls (51) An increase of plasma triglycerides and cholesterol was reported in severe vitamin B 6 deficient rats (52) In our study, we ob served a decrease of plasma HDL cholesterol and an increase of triglycerides after vit amin B 6 re striction (raw p < 0.05) ; however, there were no significant ch anges occurring

PAGE 52

52 in plasma total cholesterol, HDL cholesterol, LDL choleste rol, and triglycerides after adjusting for pFDR Low plasma PLP concentration is associated with an increased risk of cardiovascular disease, possibly by lowering HDL co ncentration while elevating LDL and total cholesterol concentrations (108, 111) Vitamin B 6 status has been shown to be inversely related to inflammation in a large, general population study (13) We observed that t he n 6/n 3 PUFA ratio increased from 15.4 2.8 to 16.6 3.1 (p = 0.035) after vitamin B 6 restriction. An elevated n 6/n 3 PUFA ratio is generally associated with the increased risk of inflammation (114 117) Additionally, the decrease of arachidonate, EPA and DHA in plasma also may suppress eicosanoid synthesis and may further alter the occurrence of inflammation. L ow plasma PLP concentration is associated with an increase in the inflammation marker C reactive protein that is independent of plasma homocysteine concentration (11, 108) ; however, we did not observe an elevation of C reactive protein in a previous study with this vitamin B 6 restriction protocol (82) However one might question that such changes of plasma fatty acid profiles were possibly contributed by changes of dietary fat ty acid patterns during vitamin B 6 restriction. A summary of dietary fatty acids and other major diet constituents of the 2 d controlled diet and 28 d vitamin B 6 restricted diet is shown in Table 2 6. Unfortunately, d ietary fatty acid composition of regular diet before they enrolled in the study was not available Based on the dietary fatty acid data available a linear regression model was b uilt to evaluate effects of low vitamin B 6 diet on changes of plasma fatty acid profiles after

PAGE 53

53 adjusting for gender and dietary fatty acid composition. The low vitamin B 6 diet was correlated to the changes of plasma linoleic acid and DHA concentration s (p < 0.05). However, ther e were no direct effects of dietary fatty acids on any changes of plasma fatty acid profiles during vitamin B 6 restriction. The gender difference also did not contribute to any changes of pl asma fatty acid profiles after adjusting for dietary vitamin B 6 and fatty acid intake Th e linear regression model provided us an alternative perspective to look into the interaction between vitamin B 6, dietary fatty acids and fatty acid profiles in h uman blood and suggested conclusions derived from direct statistical analysis of fatty acid patterns and ratios Plasma fatty acid profiles were considered as significant biomarker s of dietary fatty acid intake based on previous work (137 140) The Atherosclerosis Risk in Communities (ARIC ) Study showed that plasma EPA and DHA of phospholipids and cholesterol esters were the strongest correlated to their dietary intake, linolei c acid and saturated fatty acids (SFA) had a moderate correlation, while MUFAs were only weakly correlated to dietary intake in middle aged adults (139) As presented in Table 2 6, the 28 d restricted diet tend ed to have less PUFA than the 2 d controlled diet. S tudies showed that a low PUFA diet altered plasma fatty acid profiles by elevating LCPUFA ( C20:4 n 6, C20:5 n 3 and C22:6 n 3) composition (138, 140) This was probably due to a compensatory mechanism of stimulating desat urase and elongase activities in LCPUFA synthesis in v ivo when dietary sources were limited. E rythrocytes lack the capacity of LCPUFA biosynthesis and are thus a good reflection of dietary fatty

PAGE 54

54 acid intake in mid term (141) It generally takes 4 6 weeks to equilibrate erythrocyte fatty acid composition with diet (142) However, our 4 weeks of vitamin B 6 restricted study did not show any changes of fatty acid composition in erythrocyte membrane, suggesting that the influence from cha nge s of dietary fatty acid patterns was minimal in this study Although the dietary fatty acid composition of 23 participants befor e the study was not known, the 28 d vitamin B 6 restricted diet was largely based on the nutrient composition of a western d iet that the US population typically consumes except for low vitamin B 6 conten t. The participants were all in a healthy status with no special dietary preferences. Therefore, we would rather conclude that the d ecrease of plasma n 3 and n 6 LCPUFA concentr ations in this study was primarily from the low vitamin B 6 intake but not from any changes of dietary fatty acid composition in our vitamin B 6 restricted diet compared to a typical western diet. As a conclusion short term marginal vitamin B 6 defi ciency decrease d plasma long chain n 6 and n 3 PUFA concentrations. These changes may have important implications regarding the pathobiology of cardiovascular disease and of other disorders in which the metabolism of long chain fatty acids is perturbed.

PAGE 55

55 Ta ble 2 1. Baseline characteristics of 23 healthy men and women participating in the study Characteristics Men Women Total (n = 12) (n = 11) (n = 23) Age (y) 24 5 1 25 6 25 5 BMI (kg/m 2 ) 24.5 2.7 23.6 2.3 24.1 2.5 Plasma PLP ( nmol /L) 59 13 45 13 2 52 14 Serum folate ( nmol /L) 34 8 30 7 32 7 Serum vitamin B 12 (pmol/L) 349 115 388 129 368 124 Plasma homocysteine (mol/L) 7.5 1.0 6.4 1.3 7.0 1.3 1 All values are means SDs. 2 Significant difference between men and women P < 0.05 (2 sample t test). Table 2 2. The MANOVA analysis of overall effects of 28 d moderate vitamin B 6 restriction on n 3, n 6, n 9 fatty acids, and ratios of product to precursor fatty acids in different blood fractions Categories MANOVA p value Overall N 6 fatty acids N 3 fatty acids N 9 fatty acids Plasma total fatty acid concentrations 0.0031 0.0004 0.0182 0.0013 Plasma free fatty acid concentrations NS NS NS NS Erythrocyte membrane fatty acid composition NS NS NS NS PBMC membrane fatty acid composition 0.0305 NS NS NS Product to precursor fatty acid s (plasma total fatty acids) 0.016 0.001 NS 0.0003 Product to precursor fatty acid s (plasma free fatty acids) NS NS NS NS Product to precursor fatty acid s (erythrocyte membrane fatty acids) NS NS NS NS Product to precursor fatty acid s (PBMC membrane fatty acids) 0.0418 NS NS NS Significantly different between baseline and after vitamin B 6 restriction when P < 0.05. NS, not significant.

PAGE 56

56 Table 2 3. Plasma total fatty acid and free fatty acid concentrations in 23 healthy men and women at baseline and after 28 d moderate vitamin B 6 restriction Fatty a cids Total fatty a cids Free fatty a cids Baseline Restricted Baseline Restricted Palmitic a cid (C16:0) (mol/L) 2227 388 1 2187 365 110 59 110 39 Palmitoleic acid (C16:1 n 7) (mol/L) 134 55 112 41 2 15 9 14 4 Stearic acid (C18:0) (mol/L) 947 189 940 213 33 15 38 16 Oleic acid (C18:1 n 9) (mol/L) 1400 346 1436 294 168 92 173 56 Linoleic acid (C18:2 n 6) (mol/L) 2647 409 2653 474 69 45 66 27 Linolenic acid (C18:3 n 6) (mol/L) 42 20 37 15 2 Arachidonic acid (C20:4 n 6) (mol/L) 548 96 490 94 3 3.0 1.7 2.8 1.3 Linolenic acid (C18:3 n 3) (mol/L) 58 18 56 18 6.0 5.5 5.5 4.4 EPA (C20:5 n 3) 4 (mol/L) 37 13 32 13 2 DHA (C22:6 n 3) 4 (mol/L) 121 29 109 28 2 (mol/L) 3170 555 3130 554 143 73 148 54 3 (mol/L) 15 30 391 1550 322 182 99 187 59 6 PUFA 3 (mol/L) 3240 446 3180 498 72 46 69 27 3 PUFA (mol/L) 216 42 197 46 2 6.0 5.5 5.5 4.4 n 6/n 3 ratio 15.4 2.8 16.6 3.1 2 13.1 4.8 15.9 8.3 1 All values are means SDs. S ignificantly different from baseline, 2 P < 0.05 3 P < 0.001. 4 Abbreviations : EPA, eicosapentaenoic acid; DHA, docosahexaenoic acid; MUFA, monounsaturated fatty acids; PUFA, polyunsaturated fatty acids.

PAGE 57

57 Table 2 4. Fatty acid composition ( in weight pe rcentage wt %) 1 of erythrocyte and PBMC membrane lipids in 23 healthy men and women at baseline and after 28 d moderate vitamin B 6 restriction 1 wt %, weight percentage. 2 All value s are means SDs. Table 2 5 R atios of product to precursor fatty acids for plasma total fatty acids, erythrocyte and PBMC membrane fatty acids in 23 healthy men and women at baseline and after 28 d moderate vitamin B 6 restriction Ratios Plasma Red cell m embrane PBMC m embrane Baseline Restricted Basel ine Restricted Baseline Restricted n 9 pathway C16:1n 7/C16:0 0.06 0.02 1 0.05 0.02 0.01 0.01 0.01 0.00 0.01 0.00 0.01 0.00 C18:1n 9/C18:0 1.52 0.47 1.59 0.43 0.67 0.06 0.69 0.07 0.67 0.05 0.70 0.05 n 6 pathway C18:3n 6/C18:2n 6 0.02 0.01 0.01 0.01 C20:4n 6/C18:2n 6 0.21 0.04 0.19 0.04 2 1.47 0.26 1.45 0.26 2.12 0.34 2.20 0.37 n 3 pathway C20:5n 3/C18:3n 3 0.70 0.35 0.62 0.24 C22:6n 3/C18:3n 3 2.28 0.90 2.15 0.80 1 All value s are means SDs 2 Significantly dif ferent from baseline ( P < 0.0 1). Fatty acids Red cell membrane lipids PBMC membrane lipids Baseline Restricted Baseline Restricted Palm itic acid (C16:0) 24.4 1.0 24.6 1.0 20.0 1.8 19.9 1.6 Palmitoleic acid (C16:1 n 7) 0.34 0.16 0.34 0.12 0.27 0.09 0.27 0.09 Stearic acid (C18:0) 19.4 1.4 19.1 1.3 23.9 0.75 23.8 0.8 Oleic acid (C18:1 n 9) 12.9 0.9 13 .2 1.0 15.9 1.1 16.6 1.2 Linoleic acid (C18:2 n 6) 13.6 1.6 13.6 1.7 11.8 1.4 11.4 1.4 Eicosatrienoic acid (C20:3 n 6) 2.19 0.52 2.11 0.47 1.96 0.56 1.99 0.44 Arachidonic acid (C20:4 n 6) 19.6 1.6 19.4 1.5 24.7 2.0 24. 8 1.9 EPA (C20:5 n 3) 0.45 0.12 0.43 0.13 DHA (C22:6 n 3) 7.0 0.9 7.0 1.0 1.50 0.33 1.52 0.34

PAGE 58

58 Table 2 6. The dietary fatty acid and major nutrient composition in the 2 d controlled diet and 28 d vitamin B 6 restricted diet. Major nutrients and dietary fatty acids 2 d controlled diet 28 d restricted diet Total g rams (g) 2750 492 1 2770 598 Total e nergy (kcal) 2610 440 2830 596 Total carbohydrate (g) 415 78 435 103 Total p rotein (g) 60.5 6.9 71.5 12.8 Total f at (g) 83 18 92 19 Cholesterol (mg) 234 162 244 82 To tal saturated fatty a cids (g) 27 8 35 7 Total MUFA (g) 29 7 36 10 Total PUFA (g) 20 5 15 4 SFA 16:0 (palmitic acid) (g) 13 3 16 3 SFA 18:0 (stearic acid) (g) 7.0 1.6 8.8 1.9 MUFA 16:1 n 7 (palmitoleic acid) (g) 0.74 0.23 0.92 0.21 MUFA 18:1 n 9 (oleic acid) (g) 28 7 35 10 PUFA 18:2 n 6 (linoleic acid) (g) 18 5 14 4 PUFA 18:3 n 3 (linolenic acid) (g) 1.8 0.5 1.3 0.5 PUFA 20:4 n 6 (arachidonic acid) (g) 0.073 0.059 0.0 50 0.025 PUFA 20:5 n 3 ( EPA ) (g) 0.0043 0.0050 0.0000 0.0000 PUFA 22:6 n 3 ( DHA ) (g) 0.016 0.015 0.013 0.006 Polyunsaturated to saturated fat r atio 0.78 0.20 0.46 0.14 Total vitamin B 6 (mg) 1.02 0.11 0.37 0.04 1 All value s are means SDs for dietary intakes of all 23 participants. The data of dietary fatty acid and major nutrient composition were collected and analyzed using Nutrition Data System for Research Software Version 2005/2007 developed by the Nut rition Coordinating Center University of Minnesota, Minneapolis, MN

PAGE 59

59 Figure 2 1. Effects of 28 d moderate vitamin B 6 restriction on plasma lipid fractions (A) and plasma PLP and homocysteine concentrations (B) of 23 participants P < 0.001. 0 50 100 150 200 250 Baseline Restricted 0 10 20 30 40 50 60 70 PLP (nmol/L) homocysteine (mol/L) Baseline Restricted Plasma lipid fractions (mg/dL) Plasma PLP and total homocysteine A B

PAGE 60

60 CHAPTER 3 VITAMIN B 6 DEFI CI ENCY IMPAIRS FATTY A CID S YNTHESIS IN CULTURED HUMAN HEPATOMA (HEP G2) CELLS Introduction Vitamin B 6 functions as a coenzyme in the form of PLP in a variety of metabolic reactions including amino acid metabolism, carbohydrate metabolism, heme synthesis, and nucleotid e synthesis The interaction between vitamin B 6 and lipid metabolism was firstly recognized in the 1930s (1) Early rat studies showed that essential fatty acids had an am eliorating effect on the dermatitis induced by vitamin B 6 deficiency. Later stud ies reported that severe vitamin B 6 deficiency alter ed n 3 and n 6 LCPUFA patterns of different tissue lipids in rats which was proposed to be due to impaired LCPUFA synthesis in vivo (4 7, 9) However, there is no direct ev idence of PLP functioning as the cofactor of any desaturases or elongases in LCPUFA synthesis Two recent clinical studies in this lab with moderate vitamin B 6 restriction protocol indicat ed that marginal vitamin B 6 led to a significant decrease of linolenic acid (C18:3 n 6), arachidonic acid (C20:4 n 6) EPA ( C20:5 n 3 ), a nd DHA ( C22:6 n 3 ) concentrations by 10 15% in plasma ( Chapter 2 ) Howe ver, the mechanisms for such metabolic changes of fatty acid profiles with ina dequate vitamin B 6 statu s remain unclear. The HepG2 cell line is an alternative experimental model to study unsaturated fatty acid bio synthesis of human liver cells the primary site for de novo lipogenesis Previous s tudies showed activ e LCPUFA synthesis from prec ursor fatty acids linoleic acid (C18:2 n linolenic acid (C18:3 n 3) in HepG2 cells (143, 144) The current study aimed to determine whether different physiological related concentration s o f vitamin B 6

PAGE 61

61 alter ed fatty acid p rofiles in HepG2 cells and to explore relevant mechanisms underlying such met abolic changes. Stable isotope tracer studies provide an effective way to characterize incorporation of metabolic substrates and their inter conversion to intermediates and end metabolites through either synthe tic or catabolic pathways using substrates label ed with specific stable isotopes (e.g. 13 C or 2 H ). Our lab previously utilized [3 13 C] serine and [U 13 C 5 ] methionine tracers to study homocysteine metabolism in transsulfuration and remethylation pathways in human colon carcinoma (Caco 2) cells und er conditions of folate adequacy and folate deprivation (145) S table isotope tracer studies provide a novel way to measure the rate of metabolite uptake, synthesis and catabolism dynamically to compliment static measures of metabolite concentration (146) I n this study, we utilized stable isotope labeled parent fatty acids (C18:0, C18:2 n 6, and C18:3 n 3) to investigate fatty acid desaturation and elongation processes in HepG2 cells cultured under different physiological related c oncentration s of vitamin B 6. LCPUFA biosynthesis require s a series of desa turase s and elongases ( Chapter 1, Figure 1 4) Delta 6 desaturase is the first rate limiting enzyme of long chain n 3 and n 6 PUFA synthesis. The delta 6 desaturation of C18:2 n 6 to C18:3 n 6 in vivo is catalyzed by multi enzyme components including NADH cytochrome b 5 reductase, cytochrome b 5 and terminal delta 6 desaturase that are all embedded in the lipid bilayer of microsomal membrane (76) Studies showed that delta 6 desaturase activity decreased by 40 60 % in vitamin B 6 deficient ra ts compared to their pair fed controls (4, 9) however, no studies have been done to investigate whether vitamin B 6 deficiency alters delta 6 desaturase and other enzymes in LCPUFA synthesis at the

PAGE 62

62 gene expression level In this study, we also determined the influence of vitamin B 6 concentrations on relative mRNA expression of desaturases and elongases in HepG2 cells. Material s and Methods Materials The HepG2 cell line was obtained from America n Type Culture Collection ( Manassas, VA). Culture media and medium supplements were purchase d from Hyclone (Logan, UT ) or Cellgro (Manassas, VA). The stable isotope labe led fatty acids [U 13C18] linoleic acid ethyl ester, [D 35] stearic acid and [17,17,18,18,18 D 5] linolenic acid sodium salt were purchased from Cambridge Isotope Laboratories ( Andover, MA ). The Trizol reagent for RNA extraction was purc hased from Invitrogen (Carlsbad, CA) The iScript cDNA synthesis kit qRT PCR kit iQTM SYBR Super Mix and Bradford protein assay kit were purchased from Bio Rad (Hercules, CA). All the other chemicals and solvents were purchased from Fisher Scientific ( Pittsburgh, PA) or Sigma Aldrich (St. Louis, MO). All the solvents used are with HPLC grade or above. Cell Culture HepG2 cells were cultured in MEM/EBSS media supplemented with 0.1 mM non essential amino acids, 1 mM sodium pyruvate 2 mM L glutamine and 10% fetal bovine serum HepG2 cells were incubated at 37 o C in a 5% CO 2 atmosphere and cells were passaged every 3 4 days with fresh media and were continuously cultured for 6 weeks until their intracellular PLP reached a steady level. The culture me di a (vitamin B 6 free) was fortified with different physiological related concentratio ns of pyridoxal HCl (PL): 10 nmol /L PL representing severe vitamin B 6 deficiency, 20 nmol /L PL representing marginal vitamin B 6 deficiency, and 50 nmol /L PL representing adequate vitamin B 6

PAGE 63

63 status as reflected in the range of plasma PLP concentration (best single indicator of vitamin B 6 status) in humans (98, 147, 148) Cells were also cultured in the regular media containing the non physiologically high concentration of PL (2000 nmol /L) consisted with the standard composition of MEM/EBSS Intracellular PLP Analysis The assessment of vitamin B 6 status in HepG2 cells was determined by measuring their intracellular PLP weekly. Cells were harvested and washed with PBS three times and resuspended in 1.2 mL PBS. The cell suspension was then sonicated for 45 s and 500 L of disrupted cell suspe nsion was immediately mixed with 500 L 10% (w: v) trichloroacetic acid (TCA) for protein preci pitation The mixture was clarified by centrif ugation at 10,600 x g for 10 min. The 750 L supernatant was mixed with 50 L semicarbizade (0.5 mol/L) to derivatize PLP and PL to their semicarbazone form s for fluorescence detection. The samples were incubated at 37 o C for 12 15 min, and were extr acted by 3 mL diethyl ether twice and 3 mL dichloromethane once to remove TCA and cellular lipids in the sample The semicarbazone derivatives of PLP and PL were measured by HPLC (JASCO, Easton, MD) with a reverse phase Microsorb MV C18 column ( 100 3 m x 4.6 mm x 10 cm, Varian) A post column alkalinization with 4% NaOH (w: v) was used to enhance the fluorescence of PLP and PL semicarbazones for detection. The excitation and emission wavelength s for PL P and PL were 350 nm and 478 nm An isocrati c mobile phase was used for PLP and PL separation (97% of 0. 05 mol/L KH 2 PO 4 with 3% of acetonitrile, pH 2.9) at the flow rate of 1.1 mL/min (126) Total cell protein content was measured by a commercial kit for Bradford protein assay from Bio Rad (149) The intracellular PLP concentration was normalized by total cell protein content in each sample.

PAGE 64

64 Total Fatty Acid Profile Analysis in Hep G2 Cells Cultured with Different PL Concentrations HepG2 cells were harvested and washed with PBS three times before the analysis. Th e cell suspension i n PBS was sonicated 45 s for cell disruption. The sample preparation and quantitative analysis of total cellul ar fatty acid profiles were performed in a way as described previously in Chapter 2 (1 28, 129) Total cell protein was measured to normalize individual fatty acid concentration s in each sample (149) Membrane Fatty Acid Analysis in Hep G 2 Cells Cultured with Different PL Concentrations HepG2 cells were harvested and washed with PBS three times before the analy sis. The cell suspension was sonicated 45 s for cell disruption. The fatty acid composition of HepG2 cell membran e was determined in a way as described in Chapter 2 (131) Stable Isotope Tracer Study of Unsaturated Fatty Acid Synthesis in Hep G 2 Cells Cultured with Different PL Concentrations HepG2 cells were cultu red in media with different PL concentrations f or 3 days to reach a confluency of 70 80%. Cells were then incubated with the unlabeled form of C18:2 n 6 (25 mol/L) or C18:3 n 3 (25 mol/L) for 24 h due to their low abundance in media. The solubility of fa tty acids in aqueous media was achieved by binding fatty acid molecules to bovine serum albumin (fatty acid free) as a molar ratio of 2:1. After 24 h, cell media were replaced with fresh media enriched with [U 13 C 18 ] linoleic acid (25 mol/L), [D 35] stear ic acid (50 mol/L), or [D linolenic acid (25 mol/L). The time course covered 16 h with time points of 0, 4, 8, 12, 16 h Cell and medium samples were collected at each time point.

PAGE 65

65 Total cellular lipids were extracted and derivatized to FAME s as described in Chapter 2 (128, 129) The isotopic enrichment was determined by a TRACE DSQ gas chromatograph mass spectrometry ( Finnigan Thermoquest Voyager, San Jose, CA ) with a capillary column Omegawax TM 250 (30 m x 0.25 mm x 0.25 m; Supelco Bellefonte, PA ) The fatty acid separation was achieved at a helium flow rate of 1.0 mL/ min with similar GC conditions as described in Chapter 2. Negative chemical ionization mass spectrometry was utilized to determine fatty acid metabolites synthesized from their stable isotope labeled precursor s using methane as the reagent gas at a source temperature of 150 o C and electron energy of 70 eV. The abundance of specific ions was determined by selected ion monitoring at the corresponding mass/charge (m/z) ratios of precursor fatty acids and their major metabolites in synth etic pathways as shown in Table 3 1. The enrichment of different precursor and product fatty acids was determined as the ratio of their labeled to unlabeled form s accordingly. Real Time Reverse Transcriptase PCR (qRT PCR) Analysis of mRNA Expression of Desaturases and Elongases in Hep G 2 Cells Cultured with Different PL Concentrations HepG2 cells were cultured in a 6 well plate for 3 days to reach a confluency of ~ 80%. The media were removed and 1 mL Trizol reagent was added to lyse the cells. S ample s were transferred into 1.5 mL microcentrifuge tube s and 200 L of chloroform was added and shake n vigorously for 15 s. S ample s were incubated for 5 min at room temperature followed by centrifugation at 8,000 x g for 15 min at 4 o C. The upper aqueous layer was collected and 500 L of isopropanol was added for RNA precipitation. S amples were then incubated for 10 min at room temperature followed by centrifugation at 16,000 x g for 15 m in at 4 o C. The supernatant was aspired and the

PAGE 66

66 RNA pellet at the bottom was washed with 70% ethanol. The RNA pellets were air dried for 5 10 min, and reconstituted in 100 L of RNase free water. The RNA purity and concentration were determined by Ep pendorf Biophotometer (Eppendorf, Hauppauge, NY) reading absorbance at 260 and 280 nm The cDNA synthesis was performed using an iScript cDNA synthesis kit from Bio 15 L diluted RNA stock (containing ~ 1 g RNA) was mixed with 4 L reaction mix and 1 L RNase H + MMLV reverse transcriptase Samples were running on a S1000 TM Thermal Cycler (Bio Rad, Hercules, CA) with the following conditions: holding for 5 min at 25 o C, 40 min at 42 o C, 5 min at 85 o C a nd finally cool ing to 4 o C. The cDNA sequences of FADS1 (delta 5 desaturase), FADS2 (delta 6 desaturase), SCD (delta 9 desaturase), ELOVL 2 (elongase 2), and ELOVL 5 (elongase 5), and housekeeping gene GAPDH (g lyceraldehyde 3 phosphate dehydrogenase ) in ho mo sapiens were retrieved from GenBank. The real time PCR primers were designed using an online primer design tool NetPrimer (Premium Biosoft, Palo Alto, CA) and synthesized by Integrated DNA Technologies (IDT Inc., Coralville, IA ). The primer sequences used for qRT PCR are listed in Table 3 2. The forward and reverse primers for each gene were selected from two exons separated by a long i n tron (> 1000 bp) which prevent s the amplification of accidentally contaminated genomic DNA in total RNA ext r act in l ater PCR step. The qRT PCR analysis was performed using a commercial kit iQ TM SYBR Super Mix from Bio 1 L cDNA product was mixed with 10 L Super Mix, 1.5 L primer mixer and 7.5 L H 2 O on a 96 well plate. Th e real

PAGE 67

67 time PCR reaction was running on a Time PCR Detection System (Bio Rad, Hercules, CA) with the following conditions: 50 C for 2 min, 95 C for 8.5 min, and 42 cycles with 95 C for 30 s ec and 60 C for 1 min. A melt ing curve analy sis was performed af ter 42 cycles of amplification and single amplicons were detected in all reactions. Ct values were calculated as the differences between Ct values of GOI (gene o f interest) and the house HepG2 cells culture d in regular med ia with 2000 nmol /L PL as the control group. The re lative changes of mRNA expression compared to the control were calculated as 2 Statistical Analysis All the data were presented as mean SD. The significant di fferences were determined by One Way A NOVA with p a irwise comparison (p < 0.05). The area s under the enrichment curve s (AUC s) generated from the 1 6 h time course experiments were calculated using SigmaPlot 10.0. All statistical analysis was performed by SigmaPlot 10.0 software. Results Intracellular PLP Analysis of Hep G 2 Cells in Media with Dif ferent PL Concentrations o ver 6 Weeks I ntracellular PLP concen trations of HepG2 cells cultured with different PL concentrations were measured weekly over 6 w ee k s As shown in Figure 3 1, the differences of intracellula r PLP concentrations among th e four experimenta l groups started to become obvious at the end of week 2 and reached to a steady level after 4 weeks. At the end of week 6, intracell ular PLP concentrations of the four experimental

PAGE 68

68 groups remained stable and were significantly different from each other ( P < 0.001). This suggest ed that different intra cellular vitamin B 6 levels were achieved after 6 weeks Total Fatty Acid Profiles in Hep G 2 Cells as R elated to PL C oncentration s in C ulture M edi a Total fatty acid profiles of HepG2 cells cultured with differe nt PL concentrations were listed in Table 3 3. We observed that most individual fatty acid concen trations were significantly higher in cells cultured with 10 nmol/L PL than those in the other three expe rimental groups As reflected in Table 3 3, t he lower PL concentration was in the media the higher fatty acid concentration was in cells. However, the 20 nmol /L PL group and 50 nmol /L PL group did not di f fer from each other in all individual fatty acid concentration s we measured Total cellular arachidonic acid concentration (C20:4 n 6) did not differ among the four groups. This was possibly due to the accumulation of fatty acids countera ct ing the lower arachidonic acid concentration with low vitamin B 6 level We also measured total fatty acid composition by weight percentage, the relative proportion of arachidonic acid (C20:4 n 6) was significantly lower in 20 nmol /L PL group (3.6 6 0.35 %) and 50 nmol/L PL group (3.62 0.24 % ) compared to 2000 nmol/L PL group (4.25 0.24 %) (p < 0.05) Additionally, the relative proportion of oleic acid (C18:1 n 9) was significantly higher in 20 nmol/L PL group (35.4 1.6 %) than 2000 nmol/L P L group (32.4 0.5 %) (p < 0.05) Membrane Fatty Acid Composition in Hep G 2 Cells as R elated to PL C oncentration s in C ulture M edi a Table 3 5 presented the fatty acid composition of HepG2 cell membrane The concentration of PL in the media had an ove rall effect on the weight percentages of d ihomo linoleic acid (C20:3n 6) (p < 0. 001 ), arachidonic acid (C20:4 n 6) (p < 0.01)

PAGE 69

69 and DHA (C22:6 n 3) (p < 0.05) Specifically, the weight percentage of C20:3 n 6 was 31 % lower in 10 nmol/L PL group than the regular medium control ( 2000 nmol/L PL : 0.8 6 0.06 % vs. 10 nmol/L PL: 0.59 0.05 %) However, there was no differen ce of membrane C20:3 n 6 between the 10 and 20 nmol/L PL group s The weight percentage of membrane C20:4 n 6 was lower in cells with severe vitamin B 6 deficiency than th ose with adequate status (10 nmol/L PL: 4.82 0.18 % vs. 50 nmol/L PL: 5.10 0.14 %). Membrane C22:6 n 3 was significantly higher in 10 nmol/L PL group than the regular medium control (10 nmol/L PL: 2.94 0.31 % vs. 2000 nmol/L PL: 2.48 0. 06 % ) The response of membrane fatty acid composi tion to different PL concentrations in the media seemed to be stronger than that of total cellular fatty acid composition. The conversion indices were calculated as ratios of product fatty acids to their p recursors in Table 3 6. Ratios of total C20:4 n 6/C18:2 n 6 and C20:4 n 6/C20: 3 n 6 were lower in 10 nmol/L group ( 0.98 0.12 ; 2.73 0.27 ) than 2000 nmol/L PL group ( 1 .18 0.05 ; 3.41 0.34 ) (p = 0.008 ). In cell membrane fraction, however, the ratio of C20:4 n 6/C20: 3 n 6 in creased from 5.95 0.33 to 7.73 1.10 unexpected ly There was no difference of conversion indices in both total cellular and membrane fatty acids among three groups with 10, 20, and 50 nmol/L of PL. Stable Isotope Tracer Study of Unsaturated Fatty Acid Synthesis in Hep G 2 Cells as Related to PL Concentrations in Culture Media Plots of isotopic enrichment (presented as ratios of labeled to unlabeled fatty acids) vs. time for n 9 fatty acids (Figure 3 2 ) with a 16 h time course indicated that the appearance of labeled intracellular D35 C18:0 ( precursor) and D3 3 C18:1 n 9 (its product) reached plateau at ~ 12 h post treatment. The enrichment of D35 C18:1 n 9 at plateau was s ignificantly higher in cells cultured in 2000 nmol/L PL media than those in

PAGE 70

70 media with 10 nmol/L 20 nmol/L and 50 nmol/L PL (p < 0.001) however, there was no difference among the three lower PL groups Similarly, plots of iso topic enrichment vs. time for n 6 ( Figure 3 3 ) and n 3 (Figure 3 4 ) fatty acids within 16 h indicat ed that the enrichment of product fatty acids, [U 13 C] C20:4 n 6 (p < 0.001) and D5 C20:5 n 3 (p < 0.05) were significantly higher after 12 h post treatmen t in 2000 nmol/L PL group than the other 3 gro ups N o difference was found among three lower PL groups at 12 h Areas under the enrichment curves (AUC s ) were calculated as a measurement of relative pool size s of labeled precursor and new ly synthesized l abeled fatty acids (Table 3 7). The isotope enriched precursor pools of C18:2 n 6 and C18:3 n 3 did not differ among the 4 groups, however, the isotope enriched C18:0 pool was slight larger in 10 nmol/L PL group than 2000 nmol/L PL group ( 23.0 0.3 vs. 21 .7 0.5 ) (p = 0.017). The AUCs of newly synthesized n 6 fatty acids, [U 13 C] 20:3 n 6 and [U 13 C] 20:4 n 6 were smaller in 10 nmol/L PL group compared to the regular medium control ( 4.14 0.14 vs. 4.38 0.08 ; 1.64 0.01 vs. 1.89 0.01) Th e similar difference was also observed in newly synthesi zed n 3 fatty acid D5 C20:5 n 3 ( 4.93 0.10 vs. 5.36 0.11 ) (p < 0.01). However, there was no difference of any new ly synthesized isotope enriched fatty acid pools among the three lower PL gro ups The AUC ratios of isotope enriched newly synthesized fatty acids to their precursors were calculated (Table 3 8) to estimate relative synthesis rates of unsaturated fatty acids in n 3, n 6 and n 9 pathways, which also reflected the in vivo fluxes of desaturases and elongases in HepG2 cells as related to different PL concentrations in culture media The AUC ratios of C20:4 n 6/C18: 2 n 6, C20:4 n 6/C18:3 n 6, and C20:4 n 6/C20:3 n 6 were slightly lower in cells of 3 lower P L groups

PAGE 71

71 than the regular medium control (p < 0.001). Similar changes were observed in ratios of C18:1 n 9/C18:0 and C20:5 n 3/ C18:4 n 3 (p < 0.001). The lower AUC ratios of n 6 fatty aci ds were consistent with our findings in total and membrane fatty acid profiles of HepG2 cells cultured with different PL concentrations The lower synthesis rates of n 6 LCPUFAs pro bably contributed to the lower n 6 fatty acid compos ition of both total and membrane lipids in HepG2 c ells which also provided a logical explanation for simila r findings in our human study described in Chapter 2 The mRNA expression of Desaturases and Elongases in Hep G 2 Cells as Related to PL Concentrations in Culture Media To further investigate possible mechanisms underlying the lower fatty acid synt hesis in three lower PL groups than the regular medium control we measur ed relative mRNA expression of desaturases and elongases in HepG2 cells cultured with different PL concentrations (Figure 3 5). D ifferent PL concentrations in the media had an overall effect on relative mRNA expression of both FADS1 ( delta 5 desaturase) and FADS2 ( delta 6 desaturase) genes (p < 0.01). There was no significant difference of mRNA expression of the GOIs among three lower PL groups T he relati ve mRNA expression of FADS1 and FADS2 w as 4 0 50 % lower in HepG2 cells with severe vitamin B 6 deficiency than the regular medium control Delta 5 and delta 6 desaturases are considered as rate limiting enzymes of fatty aci d interconversion in HepG2 cells (150) The lower mRNA expression of FADS1 and FADS2 genes could p ossibly account for the lower n 3 and n 6 LCPUF A synthesis of HepG2 cells in three lower PL groups Combined with our data from the stable isotope trace r study, the most obvious response to PL concentrations in the media in n 6 and n 3 LCPUFA synth esis was the

PAGE 72

72 interconversion of C20:3 n 6 to C20:4 n 6 and C18:4 n 3 to C20:5 n 3 in which delta 5 desaturase was involved We postulate that lower FADS1 mRNA expression account s for this response in three lower PL groups R elative m R NA expression of SCD ( delta 9 desat urase) did not differ among four experimental groups although the synthesis of D3 3 C18:1 n 9 from D35 C18:0 was lower (p < 0. 001) in three lower PL groups compared to 2000 nmol/L group. Discussion The HepG2 cell line i s an alternative model to investigate fatty acid synth esis in human liver cells. F atty acid synthesis is very active in HepG2 cells; however, the mobilization of intracellular triglycerides is impaired which further prevents sufficient VLDL a ssembly c onsequently, there is less secretion of triglycerides and more triglycerides are accumulated in HepG2 cells compared to normal rat hepatocytes (143, 144) In this study, we found that vitamin B 6 deficiency (10 & 20 n mol/L PL group s ) led to higher concentrations of most individual fatty acid s in total cellular lipids Similar observation s were reported in vitamin B 6 deficient rat liver with enhanced lipid accumulation (151, 152) One proposed mechanism for this finding is that vitamin B 6 deficien cy impairs carnitine synthesis since c arnitine plays an important role in fatty acid oxidation [153 154] The PLP dependent enzyme SHMT cleaves 3 hydroxy 6 N trimethylysine in carnitine biosynthesis (153) Cho and Leklem provided in vivo evidence that total carnitine concentrations decreased in plasma, skel etal muscl e and liver in rats with vitamin B 6 deficiency than pair fed controls (154) If carnitine availability under vitamin B 6 deficient status became rate limiting, it could lead to lower fatty acid oxidation rate, and thus more fatty acid accumulation in cells cultured with lower PL concentrations Another p lausible mechanism may involve homocysteine induced

PAGE 73

73 endoplasmic reticulum (ER) stress causing increased hepatic biosynthesis and uptake of cholesterol and triglycerides (155) In this study, we observed a higher homocysteine concentration in HepG2 cells with vitamin B 6 deficiency (10 nmol/L PL group) which may also contribute to the accumulated fatty acids in cells with lower B 6 levels. S tatic analysis of fatty acid profiles in total cellular and membrane lipids show ed that the w eight percentage of n 6 fatty acids, C20:3 n 6 and C20:4 n 6 was lower in HepG2 cells of three lower PL groups This finding is consistent with our human study described in C hapter 2 as well as other vitamin B 6 deficient rat studies (4 6, 9) However, the difference was small among groups. The intracel lular P LP concentration was ~ 4 times higher in 2000 nmol/L PL group than 10 nmol/L PL group. A similar findi ng showed that intracellular PLP concentration in MCF 7 cell s cultured with 4900 nmol/L pyridoxine was only ~ 3 times higher t han those with 49 nmol/L pyridoxine (100 fold difference of medium vitamin B 6 concentration) according to Perry et al. (156) This suggests that intracellular PLP is strictly regulated in cells and quite resilient to the large variation of exogenous vitamin B 6 sources. phosphate (PNP/PMP) oxidase is inhibited by excess PLP production and further prevents more PNP and PMP converting into PLP (157) In addition the protein binding of PLP protect s it against enzyme hydrolysis (158) with inadequate B 6 intake Thus, intracellular PLP and most vitamin B 6 related metabolic reactions can maintain a relative ly steady level to variations of vitamin B 6 intake. As re ported consistently in rat studie s that linoleic acid (C18:2 n linolenic acid (C18:3 n 3) were greater but arachidonic acid (C20:4 n 6) EPA (C20:5 n 3) and DHA (C22:6 n 3) w ere lower with vitamin B 6 deficient status in various tissue lipids (4

PAGE 74

74 6, 9) one hypothesis for this particular fatty acid patt ern is due to the impaired n 6/n 3 LCPUFA synthesis by vitamin B 6 deficiency T he first and rate limiti ng enzyme of LCPUFA synthesis, delta 6 desaturase activity was 20 50% lower in vitamin B 6 deficient rats compared to their pair fed contr ols (4, 9) However, the relation of such in vitro enzyme activity and the actual in vivo metabolic flux was not e xamined by previous studies. Using a multiple stable isotope approach, we investigate d L CPUFA synthesis flux from their dietary precursors, [U 13 C ] 18:2 n 6 and D5 C18:3 n 3 in HepG2 cells cultured with differe nt PL concentrations Our findings indicated that the n 6 and n 3 LCPUFA in terconversion was lower in three lower PL groups than the regular medium control. This alteration was the most obvious in the conversion of [ U 13 C] 20:3 n 6 to [U 13 C] C20:4 n 6 and D5 C18:4 n 3 to D5 C20:5 n 3, in both of which delta 5 desaturase was involved. Thus, delta 5 desaturase was probably more influenced by different vitamin B 6 levels than delta 6 desaturase in HepG2 cells, si nce neither the conversion of [U 13 C] 18:2 n 6 to [U 13 C] 18:3 n 6 nor D5 C18:3 n 3 to D5 C18:4 n 3 (catalyzed by delta 6 desaturase) significantly differ amon g four experimental groups. However, the mechanisms by which vitamin B 6 deficiency affects in vi tro desaturase activity and LCPUFA syn thesis remain unclear PLP is not a cofactor of any desaturases and elongas es Both delta 6 and delta 5 desaturases have an N terminal cytochrome b5 like domain and a C termin al multiple membrane spanning desaturase portion Electrons are transferred from NADH to cytochrome b5, and then to the terminal des aturase portion to finalize new double bond formation (74, 159) Cytochrome b5 is a heme containing compound, so it would be possible that insufficient vitamin B 6 intake may lead to he me/cytochrome deficiency and further impair desaturase activities (160, 161)

PAGE 75

75 The synthesis of oleic acid (D33 C18:1 n 9) from stearic acid (D35 C18:0) (catalyzed by delta 9 desaturase) became less in HepG2 cells of three lower PL groups compared to those in 2000 nmol/L PL group T he analysis of c ellular fatty acid profiles indicat ed that relative proportion of C18:1 n 9 was elevated This suggests that lower medium PL concentration may elevate total cellu lar oleic acid s by sup p ressing its oxidation process or secretion of oleic acid containing lipid species out of the cells rather than by affecting its synthesis A s we demonstrated that low er PL concentrations in the media were accompanied by impaired LCPUFA synthesis then another question was raised: H ow did vitamin B 6 influence fatty acid synthesi s ? As described previously, vitamin B 6 deficiency le d to decreased delta 6 desaturase activit y; however, no studies have investigated wh ether vitamin B 6 deficiency affects desaturases and elongases at a gene expression level. Pharmacological doses of PLP w ere reported as a modulator of steroid hormone receptor (SHR) mediated gene express ion. A direct conjugation of PLP with steroid receptors or transcriptional factors inactivates relevant hormone responsive genes (162 164) Vitamin B 6 modulated glucocorticoid receptor mediated transcription and the expression of the albumin gene by inactivating tissue specific DNA binding proteins in cultured cells according to these studies. However, the drawback of th ese studies was using large doses of PLP (100 M 5 mM) incubating the cells, which was totally irrelevant to the actual modulation of PLP on such gene expression at a physiological level and thus had very limited relevance to the present study. In our cell study, we measured relative mRNA expression of desaturases and elongases in HepG2 cells cultured with a range of physiologically relevant levels of

PAGE 76

76 vitamin B 6 The ELOVL2 and EL OVL5 genes encode for e longase 2 and elongase 5 respectively, and t hese two elongase isoforms are found in human liver and are involved in the elongat ion of various LCPUFA s of C18 C22 (165, 166) We found that low er medium PL concen trations downregulated mRNA expression of FADS1 (delta 5 desaturase) and FADS2 (delta 6 desaturase), but had little effect on ELOVL2 a nd ELOVL5 This observation suggests that low er vitamin B 6 level s may influence mainly fatty acid desaturation rather than the elongation process. However, specific mec hanisms of how vitamin B 6 regulates FADS1 and FADS2 expression are still unclear. As a conclusion, this cell study demonstrated that low er medium PL concentration altered n 3/n 6 LCPUFA metabolism in Hep G2 cells by three lines of evidence: lower cellular and membrane n 3/n 6 LCPUFA composition impaired n 3/n 6 LC PUFA biosynthesis, and lower mRNA ex pression of related desaturases. The interpretation of the altered fatty acid profiles with different vitamin B 6 levels will help us understand better about the association between vitamin B 6 and ca rdiovascular disease and of other disorders in which the metabolism of LCPUFA is perturbed.

PAGE 77

77 Table 3 1. The m/z ratios of FAMEs derived from precursor fatty acids and their major metabolites in synthetic pathways Fatty acid methyl esters Mass/ charge (m/z) ratios (P) Stearic acid (C18:0 CH 3 ) 299 (U), 334 (L) Oleic acid (C18:1 CH 3 ) 297 (U), 330 (L) (P) Linoleic acid (C18:2 CH 3 ) 295 (U), 313 (L) linolenic acid (C18:3 CH 3 ) 293 (U), 311 (L) Dihomo linolenic acid (C20:3 CH 3 ) 321 (U), 339 (L) Arachidonic acid (C20:4 CH 3 ) 319 (U), 337 (L) (P) linolenic acid (C18:3 CH 3 ) 293 (U), 298 (L) Stearidonic acid (C18:4 CH 3 ) 291 (U), 296 (L) EPA (C20: 5 CH 3 ) 317 (U), 322 (L) DHA (C22:6 CH 3 ) 343 (U), 348 (L) P: precursor fatty acids, U: unlabeled form, L: stable isotope labeled form. Table 3 2. Primer sequences of gene s of interest in unsaturated fatty acid synthesis ( homo sapiens ) retrieved from Gen Bank. Genes of interest Primer sequences FADS1 (F) FADS1 (R) TGATGTCTGGGTCTTTGCGGA TATGCCGTACAACCACCAGCAC FADS2 (F) FADS2 (R) AACATGATTATGGCCACCTGTCTGT TGGAAGATGTTAGGCTTGGCGT SCD (F) SCD (R) TCTGGAGAAACATCATCCTTATGTCTCT ACAGACGATGAGCTCCTGCTGTTAT ELOVL2 (F) ELOVL2 (R) TCTGCTCTCAATATGGCTGGGTAA TGCGCTGGTAAGATCTTGACACTG ELOVL5 (F) ELOVL5 (R) ATTCTCTTGCCGGGGGATTTTA TGCGTGTGCCCTGACAGAAG GAPDH (F) GAPDH (R) CTGCACCACCAACTGCTTAG AGGGAGGGGAGC CGGCTGTC F: forward primer R: reverse primer

PAGE 78

78 Table 3 3. Total fatty acid profiles i n HepG2 cells cultured with different PL concentrations. Fatty a cids ( nmol /mg protein) 10 nmol/L PL 20 nmol/L PL 50 nmol/L PL 2000 nmol/L PL Palmitic acid (C16:0) 269 12 230 27 241 15 239 24 Palmitoleic acid (C16:1 n 7) 150 10 a 128 16 b 133 6 b 126 8 b Stearic acid (C18:0) 85 7 a 72 5 b 74 6 b 71 4 b Oleic acid (C18:1n 9) 320 13 a 278 12 b 282 21 b 250 19 c Linoleic acid (C18:2n 6) 47 5 a 41 1 b 41 3 b 35 2 c D ihomo linoleic acid (C20:3n 6) 17 1 a 15 1 b 14 1 b 12 1 c Arachidonic acid 45 1 40 4 40 3 41 4 (C20:4n 6) Docosahexaenoic acid (DHA, C22:6n 3) 37 1 a 32 2 b 32 1 b 28 1 c Total fatty acids 970 26 a 836 64 b 857 51 b 803 55 c Data were presented as mean SD (n = 4). Means of each row without a common letter in the superscript differ significantly (p < 0.05).

PAGE 79

79 T able 3 4. Total fatty acid composition by weight percentage (wt %) i n HepG2 cells cultur ed with different PL concentration s. Fatty acids (wt %) 10 nmol/L PL 20 nmol/L PL 50 nmol/L PL 2000 nmol/L PL Palmitic acid (C16:0) 29 0.8 28.9 1.2 29.6 0.7 30.7 0.7 Palmitoleic acid (C16:1 n 7) 15.6 1.1 15.3 0.7 15.6 0.3 16.3 0.5 Ste aric acid (C18:0) 8.10 0.5 7.95 0.1 8.08 0.4 8.22 0.3 Oleic acid (C18:1 n 9) 34.9 1.6 ab 35.4 1.6 a 34.8 0.9 ab 32.4 0.5 b Linoleic acid (C18:2 n 6) 3.80 0.3 3.82 0.3 3.70 0.20 3.40 0.20 D ihomo Linolenic acid (C20:3 n 6) 0.36 0.04 0.33 0.09 0.34 0.12 0.34 0.08 Arachidonic acid (C20:4 n 6) 3.64 0.30 a b 3.66 0.35 a 3.62 0.24 a 4.25 0.24 b DHA (C22:6 n 3) 2.64 0.31 2.66 0.11 2.60 0.20 2.52 0.26 Data were presented as mean SD (n = 4). Means of each row with out a common letter in the superscript differ significantly (p < 0.05).

PAGE 80

80 Table 3 5. Membrane fatty acid composition by weight percentage (wt %) i n HepG2 cells cultured with different PL concentrations. Fatty a cids (wt %) 10 nmol/L PL 20 nmol/L PL 50 nmo l/L PL 2000 nmol/L PL Palmitic acid (C16:0) 37.1 0.9 38.5 0.7 38.0 0.5 37.7 0.5 Palmitoleic acid (C16:1n 7) 20.3 0.4 20.3 0.9 19.4 0.4 20.0 0.2 Stearic acid (C18:0) 9.1 0.6 8.8 0.6 9.0 0.3 9.2 0.5 Oleic acid (C18:1n 9) 20.1 0.9 19.3 0.3 19.5 0.2 20.0 0.2 Linoleic acid (C18:2n 6) 1.42 0.11 1.37 0.12 2.02 0.78 2.00 0.35 D ihomo linoleic acid (C20:3n 6) 0.59 0.05 a 0.63 0.02 ab 0.69 0.05 b 0.86 0.06 c Arachidonic acid (C20:4n 6) 4.50 0.38 a 4.44 0.25 ab 4.82 0.18 ac 5.10 0.14 c Docosahexaenoic acid (DHA, C22:6n 3) 2.94 0.31 a 2.31 0 .38 b 2.51 0.22 b 2.48 0.06 b Data were presented as mean SD (n = 4). Means of each row without a common letter in the superscript differ significantly (p < 0.05).

PAGE 81

81 Table 3 6. Conversion indices (ratios of product to prec ursor fatty acids) of cellular and membrane fatty acids in HepG2 cells cultured with different PL concentrations. Conversion indices Total cellular fatty acids Cell membrane fatty acids 10 nmol/L 20 nmol/L 50 nmol/L 2000 nmol/L 10 nmol/L 20 nmol/L 50 nm ol/L 2000 nmol/L C16:1 n 7/C16:0 0.56 0.02 0.56 0.01 0.55 0.01 0.53 0.05 0.55 0.01 0.53 0.03 0.51 0.02 0.53 0.01 C18:1 n 9/C18:0 3.79 0.19 3.86 0.12 3.79 0.22 3.54 0.12 2.20 0.10 2.19 0.16 2.16 0.09 2.18 0.11 C20:4 n 6/ C18:2 n 6 0.98 0.12 a 0.98 0.08 a 0.98 0.05 a 1.18 0.05 b 3.18 0.25 3.25 0.20 2.70 1.11 2.60 0.41 C20:3 n 6/C18:2 n 6 0.36 0.01 0.36 0.01 0.36 0.03 0.35 0.02 0.42 0.06 0.47 0.03 0.39 0.17 0.44 0.09 C20:4 n 6/C20: 3 n 6 2.73 0.27 a 2.72 0.24 a 2.75 0.16 a 3.41 0.34 b 7.73 1.10 a 7.00 0.45 a 7.00 0.30 a 5.95 0.33 b Data were presented as mean SD (n = 4). Means of each row without a common letter in the superscript differ significantly (p < 0.01).

PAGE 82

82 Table 3 7. The are a s under the enrichment curves (AUC s ) of isotope enriched precursor and newly synthesized fatty acids in HepG2 cells cultured with different PL concentrations. Fatty acids (AUC) 10 nmol/L PL 20 nmol/L PL 50 nmol/L PL 2000 nmol/L PL [U 13 C ] 18:2 n 6 (P) 26.9 0.7 27.7 0.8 28.3 1.0 28.7 0.9 [U 13 C ] 18:3 n 6 14.0 0.6 14.3 0.4 14.5 0.8 14.2 0.3 [U 13 C ] 20 :3 n 6 4.14 0.14 a 4.15 0.11 a 4.10 0.12 a 4.38 0.08 b [U 13 C ] 20:4 n6 1.64 0.01 a 1.62 0.08 a 1.61 0.01 a 1.89 0.01 b [D 35] C18:0 (P) 23.0 0.3 a 22.2 0.3 ab 22.1 0.3 ab 21.7 0.5 b [D 35] C18:1n 9 4.03 0.03 a 4.15 0.05 a 4.07 0.02 a 5.03 0.12 b [D 5] C18:3 n 3 (P ) 23.5 0.8 24.3 0.7 24.2 1.0 24.8 0.6 [D 5] C18:4 n 3 8.80 0.4 8.77 0.3 9.08 0.5 9.12 0.6 [D 5] C20:5 n 3 4.93 0.10 a 5.04 0.12 a 5.01 0.09 a 5.36 0.11 b [D 5] C22:6 n 3 1.15 0.05 1.18 0.02 1.19 0.03 1 .20 0.01 Data were presented as mean SD (n = 3). Means of each row without a common letter in the superscript differ significantly (p < 0.05). P: isotope enriched precursor fatty acids.

PAGE 83

83 Table 3 8. The AUC ratios of isotope enriched precursor fatty acids to their major metabolites in synthetic pathways in HepG2 cells cultured with different PL concentrations AUC ratios 10 nmol/L PL 20 nmol/L PL 50 nmol/L PL 2000 nmol/L PL C18:3n6/C18:2n6 0.65 0. 02 0.65 0.04 0.67 0.03 0.65 0.02 C20:3n6/C18:3n6 0.30 0.02 0.29 0.01 0.29 0.01 0.31 0.01 C20:4n6/C20:3n6 0.40 0.01 a 0.39 0.02 a 0.39 0.01 a 0.43 0.01 b C20:3n6/C18:2n6 0.19 0.01 0.19 0.02 0.19 0.01 0.20 0.01 C20:4n6/C18:2n6 0.076 0.005 a 0.074 0.003 a 0.075 0.002 a 0.086 0.004 b C20:4n6/C18:3n6 0.118 0.006 a 0.114 0.004 a 0.111 0.007 a 0.133 0.004 b C18:4n3/C18:3n3 0.37 0.02 0.37 0.02 0.38 0.03 0.37 0.01 C20:5n3/C18:3n3 0.21 0.01 0.21 0.01 0.21 0.02 0.22 0.01 C22:6n3/C18:3n3 0.049 0.002 0.049 0.003 0.049 0.004 0.0 48 0.001 C20:5n3/C18:4n3 0.5 6 0.01 a 0.5 7 0.0 2 a 0.55 0.02 a 0.5 9 0.01 b C22:6n3/C18:4n3 0.13 0 0.003 0.13 3 0.00 2 0.13 2 0.004 0.14 1 0.002 C22:6n3/C20:5n3 0.23 0.01 0.23 0.02 0.24 0.02 0.22 0.01 C18:1n9/C18:0 0.184 0.003 a 0.181 0.001 a 0.184 0.002 a 0.220 0.003 b Data were presented as mean SD (n = 3). Means of each row wit hout a common letter in the superscript differ significantly (p < 0.001).

PAGE 84

84 Figure 3 1 Intracellular PLP concentrations i n HepG2 cells cultured with different PL concentrations over 6 weeks. nM : nmol /L. V alues of each point were prese nted as mean SD (n = 4). 0 20 40 60 80 100 120 140 160 0 1 2 3 4 5 6 7 PLP concentration (pmol/mg protein) Time (wk) 10 nM PL 20 nM PL 50 nM PL 2000 nM PL

PAGE 85

85 Figure 3 2 The 16 h e nrichm ent curves of n 9 fatty acids, [ D 35 ] C18:0 (A) and [ D 3 3 ] C18:1 n 9 (B) in HepG2 cells cultured with different PL concentrations. Data poin ts were presented as mean SD (n = 3). *p < 0.001. 0.0 0.5 1.0 1.5 2.0 2.5 0 4 8 12 16 20 [D 35] C18:0/C18:0 Time (h) 10 nM PL 20 nM PL 50 nM PL 2000 nM PL A 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0 4 8 12 16 20 [D 33] C18:1 n 9/C18:1 n 9 Time (h) 10 nM PL 20 nM PL 50 nM PL 2000 nM PL B

PAGE 86

86 Figure 3 3. The 16 h enrichm ent curves of n 6 fatty acids, [U 13 C] 18:2 n 6 (A), [U 13 C] 18:3 n 6 (B), [U 13 C] 20:3 n 6 (C), and [U 13 C] 20:4 n 6 (D) in HepG2 cells cultured with different PL concentrations 0.0 0.4 0.8 1.2 1.6 2.0 2.4 2.8 0 4 8 12 16 20 [U 13 C] 18:2 n 6/C18:2 n 6 Time (h) 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 0 4 8 12 16 20 [U 13 C] 18:3 n 6/C18:3 n 6 Time (h) B A

PAGE 87

87 Figure 3 3 Continued Data points were presented as mean SD (n = 3). *p < 0.01 0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35 0.40 0.45 0 4 8 12 16 20 [U 13 C] 20:3 n 6/C20:3 n 6 Time (h) 0.00 0.05 0.10 0.15 0.20 0.25 0 4 8 12 16 20 [U 13 C] 20:4 n 6/C20:4 n 6 Time (h) C D

PAGE 88

88 B Figure 3 4. The 16 h enrichm ent curves of n 3 fatty acids, [ D 5 ] C18:3 n 3 (A), [ D 5 ] C18:4 n 3 (B), [ D 5 ] C20 :5 n 3 (C) and [ D 5 ] C22:6 n 3 (D) in HepG2 cells cultured with different PL concentrations. 0.0 0.5 1.0 1.5 2.0 2.5 0 4 8 12 16 20 [D 5] C18:3 n 3/C18:3 n 3 Time (h) 10 nM PL 20 nM PL 50 nM PL 2000 nM PL 0.0 0.2 0.3 0.5 0.6 0.8 0.9 0 4 8 12 16 20 [D 5] C18:4 n 3/C18:4 n 3 Time (h) 10 nM PL 20 nM PL 50 nM PL 2000 nM PL B A

PAGE 89

89 Figure 3 4 Continued Data points were presented as mean SD (n = 3). *p < 0.0 5 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0 4 8 12 16 20 [D 5] C20:5 n 3/C20:5 n 3 Time (h) 10 nM PL 20 nM PL 50 nM PL 2000 nM 0.00 0.03 0.06 0.09 0.12 0 4 8 12 16 20 [D 5] C22:6 n 3/C22:6 n 3 Time (h) 10 nM PL 20 nM PL 50 nM PL 2000 nM PL C D

PAGE 90

90 Figure 3 5. Relative mRNA expression of rel ated desaturases and elongases in HepG2 cells cultured with different PL concentrations Data were presented as mean SD (n = 5). Means of each column without a common letter in the superscript differ significantly (p < 0.01). 0 0.2 0.4 0.6 0.8 1 1.2 1.4 FADS1 (delta-5 desaturase) FADS2 (delta-6 desaturase) SCD (delta-9 desaturase) ELOVL2 (elongase2) ELOVL5 (elongase5) Relative mRNA expression 10 nM PL 20 nM PL 50 nM PL 2000 nM PL a a a b a a a b

PAGE 91

91 CHAPTER 4 CONCLUSION S This research project primarily investigated the influence of different levels of vitamin B 6 on fatty acid profiles in human s a nd cultured HepG2 cell s We hypothesized that low vitamin B 6 status altered n 3 and n 6 LCPUFA profiles pa rticularly with an increase of linoleic acid (C18:2 n 6) linolenic acid (C18:3 n 3), but a decrease of arachidonic acid (C20:4 n 6), EPA (C20:5 n 3) and DHA (C22:6 n 3) in different human blood fractions cellular and membrane lipids of HepG2 cells These changes were believed to be caused by impair ed n 3 and n 6 LC PUFA synthesis based on previous studies in rat s We tested th ese hypothes es with the following experimental strategies : We analyzed fatty acid profiles of human plasma red cell and PBMC memb rane s and also measured fatty acid composition of cellular and membrane lipids unsaturated fatty acid synthesis and relative mRNA expression of desaturases and elongases in HepG2 cells cultured with different PL concentrations We observed a significant decrease of C18:3 n 6, C20:4 n 6 C20:5 n 3 and C22:6 n 3 in human plasma and also lower C20:3 n 6 and C20:4 n 6 proportion s in cellular and membrane lipids of HepG2 cells cultured wi th low er PL concentrations (10 20, and 50 nmol/L group s ) The stable isotope tracer experiments indicat ed that the synthesis of isotope enriched C20:3 n 6, C20:4 n 6 and C20:5 n 3 from their precursors was also lower in three lower PL groups compared to the regular medium control Of all the steps in unsaturated fatty acid synthesis pathways t he interconversion of C20:3 n 6 to C20:4 n 6 and C18:4 n 3 to C20:5 n 3 w as the most responsive to different PL concentrations in the media A nalysis of relative mRNA expression of desaturases and elongases in HepG2 cells show ed that the lower n 3 and n 6 LCPUFA syn thesis was probably due to the downregulation of FADS1

PAGE 92

92 (delta 5 desaturase) and FADS2 (delta 6 desaturase) gene expression ; however, the mechanisms by which vitamin B 6 regulates these desaturases remain unknown This research project provided several novel insights into the interaction between v itamin B 6 and lipid metabolism, which was recognized as early as in the 1930s. Firstly, most previous studies were conducted in rats severe ly deficient for vitamin B 6 which was probably irrelevant to the moderately low vitamin B 6 status common in humans To our knowledge, we are the first to determine the influence of marginal vitamin B 6 deficiency on lipid metabolism in healthy men and women i n a controlled dietary vitamin B 6 restriction protocol. Secondly, very few previous studies report ed the influence of low vitamin B 6 status on metaboli c flux es of either LCPUFA synthesis or catabolism. One of the se showed that liver synthesis of arachidonic acid from [1 14 C] linoleic acid did not differ between vita min B 6 deficient rats and pair fed controls but the incorporation of [5,6,8,9 11,12,14,15 D 8 ] arachidonic acid was less in liver of vitamin B 6 deficient rats (167) The authors concluded that reduc ed arachidonic acid concentrations may result from increased degradation ra ther than reduced conversion from linoleic acid. However, a similar study reach ed the opposite conclusion by showing more [1 14 C] arachidonic acid was in tissues of vitam i n B 6 deficient rats than in the pair fed controls (168) No previous studies evaluated the influence of d ifferent vitamin B 6 levels on various unsaturated fatty acid synthetic pathways ( Figure 1 4, Chapter 1) With stable isotope tracer techniques couple d w ith GC/MS we are the first to investigate effects of different medium PL concentrations on metabolic fluxes of unsaturated fatty acid synthe sis in n 3, n 6, and n 9 pathways in an in vitro HepG2 cell model. Third the role o f vitamin B 6 in regulating steroid mediated gene expression was

PAGE 93

93 report ed in the 1990s (162 164) In those stu dies, however cultured cells were incubated with PLP concentration s far beyond the physiological range of PLP in vivo which weakened the conclusions from th o se studies and limited their implications for human health. The design of our cell study conversely, was based on the rationale of incubating cells with a range of physiological ly relevant levels of vitamin B 6 (98, 147, 148) and t herefore, this model should more closely simulate the situatio n in human liver cells. We are also the first to determine gene ex pression of multiple desaturases and elongases in HepG2 cells cultured with different PL concentrations However there still exist certain potential limitation s of this research First we had no control over the dietary fatty acid composition that our participants consume d before the study. The 2 d controlled diet prior to the 28 d vitamin B 6 restricted diet may have been too short to el iminate dietary variation of fatty acid status which could p ossibly influence fatty acid profiles at baseline. Second although we observed a significant change of plasma total fatty acid profiles but no change of plasma free fatty acid profiles after 28 d vitamin B 6 restriction we did not determine which lipid fractions the se changes mainly occurred in or which lipid fraction s had the most profound response to marginal vitamin B 6 defic iency Third the cell model we chose was a human hepatom a cell line. A lthough it was demonstrated to be a valid model for fatty acid synthesis (143, 144) these cells do exhibit abnormal aspects of lipid metabolism, including impaired intracellular triglycer ide mobilization and VLDL assembly (144) In addition, t he PEMT pathway is impaired in hepatoma cells. The PEMT has two isoforms PEMT1 and PEMT2. PEMT1 is endoplasmic reticulum (ER) bound and PEMT2 is mitochondria membrane bound ( 169) PEMT2 activity is completely absent in hepatoma cells and

PAGE 94

94 further le a d s to an accum ulation of total cellular PE with decrease d level of total cellular PC (170, 171) This aspect of abnormal phospholipid metabolism in HepG2 cells may limit the i mplications of our findings to normal human liver cells. Previous rat studies together with the results of our research show that low vit amin B 6 status decreas s n 3/n 6 LC PUFAs and unsaturated fatty acid synthesi s by suppressi ng desaturase activ ities and/or downregulating expression of specific desaturases Although o ur studies did not identify precisely how v itamin B 6 is associated with these changes Our results suggest that vitamin B 6 ma y play an indirect role in altering LCPUFA profiles Low circulating PLP concentration s are associated with vascular diseases and other inflammation related disorders (12, 13, 98, 106) Since marginal vitamin B 6 deficiency is only weakly associated with elevated plasma homocysteine ( 82 86 ) researchers have propose d that vitamin B 6 is an independent inflammation predictor not relevant to homocyst eine. I ndeed, i n some case control studies, plasma PLP was inversely correlated with inflammation markers, CRP and fibrinogen in patients with vascular disease s (11, 12, 108) LC PUFAs are known to have an immunomodulatory effect in humans. The pro inflammation effect s of n 6 PUFA s for example, are mediated by the release of arachidonate derived proinflammatory metabolites In contrast, n 3 PUFAs generally have anti inflammatory effects. Abnormal plasma fatty acid profiles are associated with many pat hological conditions such as autoimmune disease, cardiovascular disease, diabetes, and depression etc Patients with such disorders tend to have an elevated plasma total n 6/n 3 PUFA ratio (114 117) Elevated plasma free fatty acid

PAGE 95

95 concentrations induce insulin resistance and the release of proinflammatory mediators in vivo (118, 119) The decreased a rachidonic acid, EPA and DHA associated with vitamin B 6 deficiency may affect eicosanoid synthesis and consequently, inflammation response and neuroprotection (120 122) Prostaglandin production is directly modulated by t he availability of these fatty acid substrates in cellular membrane phospholipids (124) It was reported that kidney p rostaglandin 2 (PGE 2) concentration was higher in vitamin B 6 deficient rats [173 ]. Since inflammation is a putative link between low circulating PLP level and the aforementioned disease states, our work provides potentially valuable insights into the association s between vitamin B 6 nutrition and inflammation related human disease

PAGE 96

96 LIST OF REFERENCES 1. Birch TW, Gyorgy P. A study of the chemical nature of vitamin B(6) and methods for its preparation in a concentrated state. Biochem J 1936;30:304 15. 2. Salmon WD. The effect of certain oi ls in alleviating localized erythematous dermatitis (acrodynia or vitamin B 6 deficiency) in rats. J Biol Chem 1938;123:civ. 3. Quackenbush FW, Platz BR, Steenbock H. Rat Acrodynia and the Essential Fatty Acids. J Nutr 1939;17:115 26. 4. Bordoni A, Hrelia S, Lorenzini A, et al. Dual influence of aging and vitamin B6 deficiency on delta 6 desaturation of essential fatty acids in rat liver microsomes. Prostaglandins Leukot Essent Fatty Acids 1998;58:417 20. 5. Cunnane SC, Manku MS, Horrobin DF. Accumulation o f linoleic and gamma linolenic acids in tissue lipids of pyridoxine deficient rats. J Nutr 1984;114:1754 61. 6. Delorme CB, Lupien PJ. The effect of vitamin B 6 deficiency on the fatty acid composition of the major phospholipids in the rat. J Nutr 1976;106 :169 80. 7. Tsuge H, Hotta N, Hayakawa T. Effects of vitamin B 6 on (n 3) polyunsaturated fatty acid metabolism. J Nutr 2000;130:333S 334S. 8. Krajcovicova Kudlackova M, Klvanova J, Dusinska M. Polyunsaturated Fatty Acid Plasma Content in Groups of General Population with lowvitamin B6 or low iron serum levels. Ann Nutr Metab 2004;48:118 21. 9. She QB, Hayakawa T, Tsuge H. Effect of Vitamin B 6 Deficiency on Linoleic Acid Desaturation in the Arachidonic Acid Biosynthesis of Rat Liver Microsomes. Biosci Biot ech Biochem 1994;58:459 63. 10. Loo G, Smith JT. Effect of pyridoxine deficiency on phospholipid methylation in rat liver microsomes. Lipids 1986;21:409 12. 11. Friso S, Jacques PF, Wilson PW, Rosenberg IH, Selhub J. Low circulating vitamin B(6) is associa ted with elevation of the inflammation marker C reactive protein independently of plasma homocysteine levels. Circulation 2001;103:2788 91. 12. Kelly PJ, Kistler JP, Shih VE, et al. Inflammation, homocysteine, and vitamin B6 status after ischemic stroke. S troke 2004;35:12 5. 13. Morris MS, Sakakeeny L, Jacques PF, Picciano MF, Selhub J. Vitamin B 6 intake is inversely related to, and the requirement is affected by, inflammation status. J Nutr 2010;140:103 10. 14. Lepkovsky S. Crystalline Factor I. Science 1 938;87:169 170.

PAGE 97

97 15. Keresztesy JC, Stevens JR. Vitamin B 6. J Am Chem Soc 1938;60. 16. Gyorgy P. Crystalline vitamin B 6. J Am Chem Soc 1938;60. 17. Braunstein AE. Binding and Reactions of the Vitamin B6 Coenzyme in the Catalytic Center of Aspartate Transa minase. Vitam Horm 1964;22:451 84. 18. Snell EE. Chemical structure in relation to biological activities of vitamin B6. Vitam Horm 1958;16:77 125. 19. Gregory JF, 3rd. Nutritional Properties and significance of vitamin glycosides. Annu Rev Nutr 1998;18:277 96. 20. Ang CY. Stability of three forms of vitamin B6 to laboratory light conditions. J Assoc Off Anal Chem 1979;62:1170 3. 21. Hughes RC, Jenkins WT, Fischer EH. The site of binding of pyridoxal 5' phosphate to heart glutamic aspartic transaminase. Proc Natl Acad Sci U S A 1962;48:1615 8. 22. Gregory JF. Vitamin B 6 Deficiency. In: Homocysteine in Health and Disease. R. Carmel and D.W. Jacobsen, eds., Cambridge University Press, Cambridge, United Kingdom, 2001:307 20. 23. Tarr JB, Tamura T, Stokstad EL. Availability of vitamin B6 and pantothenate in an average American diet in man. Am J Clin Nutr 1981;34:1328 37. 24. McMahon LG, Nakano H, Levy MD, Gregory JF, 3rd. Cytosolic pyridoxine beta D glucoside hydrolase from porcine jejunal mucosa. Purification, p roperties, and comparison with broad specificity beta glucosidase. J Biol Chem 1997;272:32025 33. 25. Gregory JF, 3rd, Trumbo PR, Bailey LB, Toth JP, Baumgartner TG, Cerda JJ. Bioavailability of pyridoxine 5' beta D glucoside determined in humans by stable isotopic methods. J Nutr 1991;121:177 86. 26. Nakano H, McMahon LG, Gregory JF, 3rd. Pyridoxine 5' beta -glucoside exhibits incomplete bioavailability as a source of vitamin B 6 and partially inhibits the utilization of co ingested pyridoxine in humans. J Nutr 1997;127:1508 13. 27. Schaltenbrand WE, Kennedy MS, Coburn SP. Low ultraviolet "white" fluorescent lamps fail to protect pyridoxal phosphate from photolysis. Clin Chem 1987;33:631 2. 28. Middleton HM, 3rd. Uptake of pyridoxine hydrochloride by the ra t jejunal mucosa in vitro. J Nutr 1977;107:126 31.

PAGE 98

98 29. Mehansho H, Hamm MW, Henderson LM. Transport and metabolism of pyridoxal and pyridoxal phosphate in the small intestine of the rat. J Nutr 1979;109:1542 51. 30. Wada H, Snell EE. The enzymatic oxidatio n of pyridoxine and pyridoxamine phosphates. J Biol Chem 1961;236:2089 95. 31. Lui A, Lumeng L, Aronoff GR, Li TK. Relationship between body store of vitamin B6 and plasma pyridoxal P clearance: metabolic balance studies in humans. J Lab Clin Med 1985;106: 491 7. 32. Mehansho H, Henderson LM. Transport and accumulation of pyridoxine and pyridoxal by erythrocytes. J Biol Chem 1980;255:11901 7. 33. Merrill AH, Jr., Henderson JM, Wang E, McDonald BW, Millikan WJ. Metabolism of vitamin B 6 by human liver. J Nutr 1984;114:1664 74. 34. Coburn SP. Location and turnover of vitamin B6 pools and vitamin B6 requirements of humans. Ann N Y Acad Sci 1990;585:76 85. 35. Stanulovic M, Jeremic V, Leskovac V, Chaykin S. New pathway of conversion of pyridoxal to 4 pyridoxic ac id. Enzyme 1976;21:357 69. 36. Kwok F, Churchich JE. Interaction between pyridoxal kinase and pyridoxine 5 P oxidase, two enzymes involved in the metabolism of vitamin B6. J Biol Chem 1980;255:882 7. 37. Thanassi JW, Nutter LM, Meisler NT, Commers P, Chiu JF. Vitamin B6 metabolism in Morris hepatomas. J Biol Chem 1981;256:3370 5. 38. Nutter LM, Meisler NT, Thanassi JW. Absence of pyridoxine (pyridoxamine ) 5' phosphate oxidase in Morris hepatoma 7777. Biochemistry 1983;22:1599 604. 39. Wozenski JR, Leklem JE, Miller LT. The metabolism of small doses of vitamin B 6 in men. J Nutr 1980;110:275 85. 40. Mahuren JD, Pauly TA, Coburn SP. Identification of 5 pyridoxic acid and 5 pyridoxic acid lactone as metabolites of vitamin B6 in humans. J Nutr Biochem 1991;2:4 49 53. 41. Coburn SP, Lewis DL, Fink WJ, Mahuren JD, Schaltenbrand WE, Costill DL. Human vitamin B 6 pools estimated through muscle biopsies. Am J Clin Nutr 1988;48:291 4. 42. Leussing DL. Vitamin B6 Pyridoxal Phosphate: Chemical, Biochemical and Medical A spects. Dolphin, D. Poulson, R. Avramovic, O. Eds. Wiley, New York. 1986.

PAGE 99

99 43. McCormick DB. Vitamin B6 In: Present Knowledge in Nutrition. Bowman, B. A. and Russell, R. M., eds, 9th edition. Washington, D.C., International Life Sciences Institute 2006;2:26 9 78. 44. Scholnick PL, Hammaker LE, Marver HS. Soluble aminolevulinic acid synthetase of rat liver. II. Studies related to the mechanism of enzyme action and hemin inhibition. J Biol Chem 1972;247:4132 7. 45. Woods JS. Studies on the role of heme in the regulation of delta aminolevulinic acid synthetase during fetal hepatic development. Mol Pharmacol 1974;10:389 97. 46. Kikuchi G. The glycine cleavage system: composition, reaction mechanism, and physiological significance. Mol Cell Biochem 1973;1:169 87. 47. Shane B, Contractor SF. Vitamin B 6 status and metabolism in pregnancy. In: Vitamin B 6 Metabolism and Role in Growth. Tryfiates, G. P., eds. Food and Nutrition Press, Westport, CT. 1980:131 71. 48. Palm D, Klein HW, Schinzel R. The role of pyridoxal 5 phosphate in glycogen phosphorylase catalysis. Biochemistry 1990;29:1099 106. 49. Greenberg LD, Rinehart JF. Plasma cholesterol levels of cholesterol fed control and pyridoxine deficient monkeys. Proc Soc Exp Biol Med 1951;76:580 3. 50. Lupien PJ, Hinse CM, Avery M. Cholesterol metabolism and vitamin B6. I. Hepatic cholesterogenesis and pyridoxine deficiency. Can J Biochem 1969;47:631 5. 51. Harripersad R, Burger FJ. The effect of a subnormal dose of vitamin B6 on plasma lipid in the rat. Int J Vitam Nutr Res 1997;67:95 101. 52. Bergami R, Maranesi M, Marchetti M, Sangiorgi Z, Tolomelli B. Influence of dietary n 3 polyunsaturated fatty acids on plasma lipemic effect of vitamin B6 deficiency. Int J Vitam Nutr Res 1999;69:315 21. 53. Cheng CH, Lin PT, Liaw Y P, et al. Plasma pyridoxal 5' phosphate and high sensitivity C reactive protein are independently associated with an increased risk of coronary artery disease. Nutrition 2008;24:239 44. 54. Gori AM, Sofi F, Marcucci R, Giusti B, Franco Gensini G, Abbate R. Association between homocysteine, vitamin B(6) concentrations and inflammation. Clin Chem Lab Med 2007;45:1728 36. 55. Ridker PM, Rifai N, Cook NR, Bradwin G, Buring JE. Non HDL cholesterol, apolipoproteins A I and B100, standard lipid measures, lipid rat ios, and CRP as risk factors for cardiovascular disease in women. JAMA 2005;294:326 33. 56. Gordon DJ, Rifkind BM. High density lipoprotein -the clinical implications of recent studies. N Engl J Med 1989;321:1311 6.

PAGE 100

100 57. Steinbrecher UP, Zhang HF, Lougheed M. Role of oxidatively modified LDL in atherosclerosis. Free Radic Biol Med 1990;9:155 68. 58. Brattstrom L, Stavenow L, Galvard H, et al. Pyridoxine reduces cholesterol and low density lipoprotein and increases antithrombin III activity in 80 year old men with low plasma pyridoxal 5 phosphate. Scand J Clin Lab Invest 1990;50:873 7. 59. de Gomez Dumm NT, Giammona AM, Touceda LA. Variations in the lipid profile of patients with chronic renal failure treated with pyridoxine. Lipids Health Dis 2003;2:7. 60. Fo od and Nutrition Board IOM. Vitamin B6. Dietary Reference Intakes for Thiamin, Riboflavin, Niacin, Vitamin B6, Folate, Vitamin B12, Pantothenic Acid, Biotin, and Choline. Washington, DC: National Academy Press. 1998. 61. Christie WW. Lipid Analysis 2nd ed. Pergamon Press, Oxford, U.K. 1982. 62. Bergstrm S, Danielsson H, Samuelsson B. The enzymatic formation of prostaglandin E2 from arachidonic acid. Biochim. Biophys. Acta. 1964;90:207 10. 63. Vane JR. Inhibition of prostaglandin synthesis as a mechanism of action for aspirin like drugs. Nat New Biol 1971;231:232 5. 64. Bonventre JV. Roles of phospholipases A2 in brain cell and tissue injury associated with ischemia and excitotoxicity. J Lipid Mediat Cell Signal 1997;17:71 9. 65. Uozumi N, Kume K, Nagase T, et al. Role of cytosolic phospholipase A2 in allergic response and parturition. Nature 1997;390:618 22. 66. She QB, Hayakawa T, Tsuge H. Alteration in the phosphatidylcholine biosynthesis of rat liver microsomes caused by vitamin B 6 deficiency. Biosci Bio technol Biochem 1995;59:163 7. 67. Kennedy EP. Biosynthesis of complex lipids. Fed Proc 1961;20:934 40. 68. Bremer J, Greenberg DM. Methyl transfering enzyme system of microsomes in the biosynthesis of lecithin phosphatidylcholine. Biochimica et Biophysica Acta 1961;43:477 88. 69. Pregnolato P, Maranesi M, Marchetti M, Barzanti V, Bergami R, Tolomelli B. Interaction among dietary vitamin B6, proteins and lipids: effects on liver lipids in rats. Int J Vitam Nutr Res 1994;64:263 9. 70. Delorme CB, Lupien PJ. The effect of a long term excess of pyridoxine on the fatty acid composition of the major phospholipids in the rat. J Nutr 1976;106:976 84.

PAGE 101

101 71. Crowe FL, Skeaff CM, McMahon JA, Williams SM, Green TJ. Lowering plasma homocysteine concentrations of older men and women with folate, vitamin B 12, and vitamin B 6 does not affect the proportion of (n 3) long chain polyunsaturated fatty acids in plasma phosphatidylcholine. J Nutr 2008;138:551 5. 72. Mason JB, Miller JW. The effects of vitamins B12, B6, and folate on blood homocysteine levels. Ann N Y Acad Sci 1992;669:197 203; discussion 203 4. 73. Miller JW, Ribaya Mercado JD, Russell RM, et al. Effect of vitamin B 6 deficiency on fasting plasma homocysteine concentrations. Am J Clin Nutr 1992;55:1154 60. 74. Naka mura MT, Nara TY. Structure, function, and dietary regulation of delta6, delta5, and delta9 desaturases. Annu Rev Nutr 2004;24:345 76. 75. Sprecher H. Metabolism of highly unsaturated n 3 and n 6 fatty acids. Biochim Biophys Acta 2000;1486:219 31. 76. Bren ner RR. Regulatory function of delta6 desaturate -key enzyme of polyunsaturated fatty acid synthesis. Adv Exp Med Biol 1977;83:85 101. 77. Wakil SJ, Pugh EL, Sauer F. The Mechanism of Fatty Acid Synthesis. Proc Natl Acad Sci U S A 1964;52:106 14. 78. Zeh aluk CM, Walker BL. Enhancement of liver microsomal acyl CoA lysophospholipid acyltransferase activity in pyridoxine deficient rats. Lipids 1973;8:151 3. 79. Lee CM, Leklem JE. Differences in vitamin B6 status indicator responses between young and middle a ged women fed constant diets with two levels of vitamin B6. Am J Clin Nutr 1985;42:226 34. 80. Lumeng L, Ryan MP, Li TK. Validation of the diagnostic value of plasma pyridoxal 5' phosphate measurements in vitamin B6 nutrition of the rat. J Nutr 1978;108:54 5 53. 81. Bailey AL, Wright AJ, Southon S. High performance liquid chromatography method for the determination of pyridoxal 5 phosphate in human plasma: how appropriate are cut off values for vitamin B6 deficiency? Eur J Clin Nutr 1999;53:448 55. 82. Davis SR, Quinlivan EP, Stacpoole PW, Gregory JF, 3rd. Plasma glutathione and cystathionine concentrations are elevated but cysteine flux is unchanged by dietary vitamin B 6 restriction in young men and women. J Nutr 2006;136:373 8. 83. Davis SR, Scheer JB, Qui nlivan EP, Coats BS, Stacpoole PW, Gregory JF, 3rd. Dietary vitamin B 6 restriction does not alter rates of homocysteine remethylation or synthesis in healthy young women and men. Am J Clin Nutr 2005;81:648 55.

PAGE 102

102 84. Lamers Y, Coats B, Ralat M, Quinlivan EP, Stacpoole PW, Gregory JF, 3rd. Moderate vitamin B 6 restriction does not alter postprandial methionine cycle rates of remethylation, transmethylation, and total transsulfuration but increases the fractional synthesis rate of cystathionine in healthy young men and women. J Nutr 2011;141:835 42. 85. Lamers Y, O'Rourke B, Gilbert LR, et al. Vitamin B 6 restriction tends to reduce the red blood cell glutathione synthesis rate without affecting red blood cell or plasma glutathione concentrations in healthy men and women. Am J Clin Nutr 2009;90:336 43. 86. Lamers Y, Williamson J, Ralat M, et al. Moderate dietary vitamin B 6 restriction raises plasma glycine and cystathionine concentrations while minimally affecting the rates of glycine turnover and glycine cleava ge in healthy men and women. J Nutr 2009;139:452 60. 87. Schuster K, Bailey LB, Cerda JJ, Gregory JF, 3rd. Urinary 4 pyridoxic acid excretion in 24 hour versus random urine samples as a measurement of vitamin B6 status in humans. Am J Clin Nutr 1984;39:466 70. 88. Leklem JE. Vitamin B 6: a status report. J Nutr 1990;120 Suppl 11:1503 7. 89. Bitsch R. Vitamin B6. Int J Vitam Nutr Res 1993;63:278 82. 90. Wilson RG, Davis RE. Clinical chemistry of vitamin B6. Adv Clin Chem 1983;23:1 68. 91. Park YK, Linkswiler H. Effect of vitamin B6 depletion in adult man on the excretion of cystathionine and other methionine metabolites. J Nutr 1970;100:110 6. 92. Rose CS, Gyorgy P, Butler M, et al. Age differences in vitamin B6 status of 617 men. Am J Clin Nutr 1976;29:847 5 3. 93. Leklem JE. Physical activity and vitamin B 6 metabolism in men and women: interrelationship with fuel needs. In: Vitamin B 6: Its role in Health and Disease Reynolds, R. D. & Leklem, J. E., eds. Alan Liss, New York, NY. 1985:221 41. 94. Sloger MS, R eynolds RD. Effects of pregnancy and lactation on pyridoxal 5' phosphate in plasma, blood and liver of rats fed three levels of vitamin B 6. J Nutr 1980;110:1517 24. 95. Lumeng L, Cleary RE, Li TK. Effect of oral contraceptives on the plasma concentration of pyridoxal phosphate. Am J Clin Nutr 1974;27:326 33. 96. Schuster K, Bailey LB, Mahan CS. Vitamin B6 status of low income adolescent and adult pregnant women and the condition of their infants at birth. Am J Clin Nutr 1981;34:1731 5.

PAGE 103

103 97. Huang YC, Yan YY Wong Y, Cheng CH. Vitamin B6 intakes and status assessment of elderly men and women in Taiwan. Int J Vitam Nutr Res 2001;71:313 8. 98. Morris MS, Picciano MF, Jacques PF, Selhub J. Plasma pyridoxal 5' phosphate in the US population: the National Health a nd Nutrition Examination Survey, 2003 2004. Am J Clin Nutr 2008;87:1446 54. 99. Leklem JE. Vitamin B6. In: Handbook of Vitamins. ; 1991:341 378. Machlin L, ed. New York: Marcel Decker Inc 1991:339 80. 100. Schaumburg H, Kaplan J, Windebank A, et al. Sensor y neuropathy from pyridoxine abuse. A new megavitamin syndrome. N Engl J Med 1983;309:445 8. 101. FNB. Dietary Reference Intakes: Vitamins. National Academy Press 1998. 102. Yates AA, Schlicker SA, Suitor CW. Dietary Reference Intakes: the new basis for re commendations for calcium and related nutrients, B vitamins, and choline. J Am Diet Assoc 1998;98:699 706. 103. Hansen CM, Shultz TD, Kwak HK, Memon HS, Leklem JE. Assessment of vitamin B 6 status in young women consuming a controlled diet containing four levels of vitamin B 6 provides an estimated average requirement and recommended dietary allowance. J Nutr 2001;131:1777 86. 104. Kretsch MJ, Sauberlich HE, Skala JH, Johnson HL. Vitamin B 6 requirement and status assessment: young women fed a depletion die t followed by a plant or animal protein diet with graded amounts of vitamin B 6. Am J Clin Nutr 1995;61:1091 101. 105. Driskell JA, Giraud DW, Mitmesser SH. Vitamin B 6 intakes and plasma B 6 vitamer concentrations of men and women, 19 50 years of age. In t J Vitam Nutr Res 2000;70:221 5. 106. Robinson K, Arheart K, Refsum H, et al. Low circulating folate and vitamin B6 concentrations: risk factors for stroke, peripheral vascular disease, and coronary artery disease. European COMAC Group. Circulation 1998;9 7:437 43. 107. Rimm EB, Willett WC, Hu FB, et al. Folate and vitamin B6 from diet and supplements in relation to risk of coronary heart disease among women. JAMA 1998;279:359 64. 108. Friso S, Girelli D, Martinelli N, et al. Low plasma vitamin B 6 concentr ations and modulation of coronary artery disease risk. Am J Clin Nutr 2004;79:992 8. 109. Chiang EP, Smith DE, Selhub J, Dallal G, Wang YC, Roubenoff R. Inflammation causes tissue specific depletion of vitamin B6. Arthritis Res Ther 2005;7:R1254 62.

PAGE 104

104 110. S chnyder G, Roffi M, Flammer Y, Pin R, Hess OM. Effect of homocysteine lowering therapy with folic acid, vitamin B12, and vitamin B6 on clinical outcome after percutaneous coronary intervention: the Swiss Heart study: a randomized controlled trial. JAMA 200 2;288:973 9. 111. Lonn E, Yusuf S, Arnold MJ, et al. Homocysteine lowering with folic acid and B vitamins in vascular disease. N Engl J Med 2006;354:1567 77. 112. Maranesi M, Barzanti V, Coccheri S, Marchetti M, Tolomelli B. Interaction between vitamin B6 deficiency and low EFA dietary intake on kidney phospholipids and PGE2 in the rat. Prostaglandins Leukot Essent Fatty Acids 1993;49:531 6. 113. Cabrini L, Bergami R, Maranesi M, Carloni A, Marchetti M, Tolomelli B. Effects of short term dietary administrat ion of marginal levels of vitamin B(6)and fish oil on lipid composition and antioxidant defences in rat tissues. Prostaglandins Leukot Essent Fatty Acids 2001;64:265 71. 114. Fraser DA, Thoen J, Rustan AC, Forre O, Kjeldsen Kragh J. Changes in plasma free fatty acid concentrations in rheumatoid arthritis patients during fasting and their effects upon T lymphocyte proliferation. Rheumatology (Oxford) 1999;38:948 52. 115. Leaf A. Plasma nonesterified fatty acid concentration as a risk factor for sudden cardia c death: the Paris Prospective Study. Circulation 2001;104:744 5. 116. Tiemeier H, van Tuijl HR, Hofman A, Kiliaan AJ, Breteler MM. Plasma fatty acid composition and depression are associated in the elderly: the Rotterdam Study. Am J Clin Nutr 2003;78:40 6 117. Wang L, Folsom AR, Zheng ZJ, Pankow JS, Eckfeldt JH. Plasma fatty acid composition and incidence of diabetes in middle aged adults: the Atherosclerosis Risk in Communities (ARIC) Study. Am J Clin Nutr 2003;78:91 8. 118. Tripathy D, Mohanty P, Dhinds a S, et al. Elevation of free fatty acids induces inflammation and impairs vascular reactivity in healthy subjects. Diabetes 2003;52:2882 7. 119. Boden G, Lebed B, Schatz M, Homko C, Lemieux S. Effects of acute changes of plasma free fatty acids on intramy ocellular fat content and insulin resistance in healthy subjects. Diabetes 2001;50:1612 7. 120. Kinsella RJ, Fitzpatrick DA, Creevey CJ, McInerney JO. Fatty acid biosynthesis in Mycobacterium tuberculosis: lateral gene transfer, adaptive evolution, and gen e duplication. Proc Natl Acad Sci U S A 2003;100:10320 5.

PAGE 105

105 121. Hong S, Gronert K, Devchand PR, Moussignac RL, Serhan CN. Novel docosatrienes and 17S resolvins generated from docosahexaenoic acid in murine brain, human blood, and glial cells. Autacoids in a nti inflammation. J Biol Chem 2003;278:14677 87. 122. Kuehl FA, Jr., Egan RW. Prostaglandins, arachidonic acid, and inflammation. Science 1980;210:978 84. 123. Stubbs CD, Smith AD. The modification of mammalian membrane polyunsaturated fatty acid compositi on in relation to membrane fluidity and function. Biochim Biophys Acta 1984;779:89 137. 124. Spector AA, Yorek MA. Membrane lipid composition and cellular function. J Lipid Res 1985;26:1015 35. 125. Lamers Y, Coats B, Ralat M, Quinlivan E, Stacpoole P, Gre gory J, 3rd. Moderate vitamin B 6 restriction does not alter postprandial methionine cycle rates of remethylation, transmethylation and total transsulfuration but increases the fractional synthesis rate of cystathionine in healthy young men and women J Nut r 2011 (in press). 126. Ubbink JB, Serfontein WJ, de Villiers LS. Stability of pyridoxal 5 phosphate semicarbazone: applications in plasma vitamin B6 analysis and population surveys of vitamin B6 nutritional status. J Chromatogr 1985;342:277 84. 127. Pfeif fer CM, Huff DL, Gunter EW. Rapid and accurate HPLC assay for plasma total homocysteine and cysteine in a clinical laboratory setting. Clin Chem 1999;45:290 2. 128. Folch J, Lees M, Sloane Stanley GH. A simple method for the isolation and purification of t otal lipides from animal tissues. J Biol Chem 1957;226:497 509. 129. Carvalho AP, Malcata FX. Preparation of fatty acid methyl esters for gas chromatographic analysis of marine lipids: insight studies. J Agric Food Chem 2005;53:5049 59. 130. Patterson BW, Zhao G, Elias N, Hachey DL, Klein S. Validation of a new procedure to determine plasma fatty acid concentration and isotopic enrichment. J Lipid Res 1999;40:2118 24. 131. Kang JX, Wang J. A simplified method for analysis of polyunsaturated fatty acids. BMC Biochem 2005;6:5. 132. Benjamini Y, Hochberg Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J Roy Statist Soc 1995;Ser. B 57:289 300.

PAGE 106

106 133. Brossard N, Croset M, Normand S, et al. Human plasma albumin transp orts [13C]docosahexaenoic acid in two lipid forms to blood cells. J Lipid Res 1997;38:1571 82. 134. Reed CF. Phospholipid exchange between plasma and erythrocytes in man and the dog. J Clin Invest 1968;47:749 60. 135. Hanada K. Serine palmitoyltransferase, a key enzyme of sphingolipid metabolism. Biochim Biophys Acta 2003;1632:16 30. 136. Lin YH, Salem N, Jr. Whole body distribution of deuterated linoleic and alpha linolenic acids and their metabolites in the rat. J Lipid Res 2007;48:2709 24. 137. Dougherty RM, Galli C, Ferro Luzzi A, Iacono JM. Lipid and phospholipid fatty acid composition of plasma, red blood cells, and platelets and how they are affected by dietary lipids: a study of normal subjects from Italy, Finland, and the USA. Am J Clin Nutr 1987;45 :443 55. 138. King IB, Lemaitre RN, Kestin M. Effect of a low fat diet on fatty acid composition in red cells, plasma phospholipids, and cholesterol esters: investigation of a biomarker of total fat intake. Am J Clin Nutr 2006;83:227 36. 139. Ma J, Folsom AR, Shahar E, Eckfeldt JH. Plasma fatty acid composition as an indicator of habitual dietary fat intake in middle aged adults. The Atherosclerosis Risk in Communities (ARIC) Study Investigators. Am J Clin Nutr 1995;62:564 71. 140. Raatz SK, Bibus D, Thomas W, Kris Etherton P. Total fat intake modifies plasma fatty acid composition in humans. J Nutr 2001;131:231 4. 141. Romon M, Nuttens MC, Theret N, et al. Comparison between fat intake assessed by a 3 day food record and phospholipid fatty acid composition of red blood cells: results from the Monitoring of Cardiovascular Disease Lille Study. Metabolism 1995;44:1139 45. 142. Farquhar JW, Ahrens EH, Jr. Effects of dietary fats on human erythrocyte fatty acid patterns. J Clin Invest 1963;42:675 85. 143. Angelet ti C, de Alaniz MJ. Fatty acid uptake and metabolism in Hep G2 human hepatoma cells. Mol Cell Biochem 1995;143:99 105. 144. Gibbons GF, Khurana R, Odwell A, Seelaender MC. Lipid balance in HepG2 cells: active synthesis and impaired mobilization. J Lipid Re s 1994;35:1801 8. 145. Townsend JH, Davis SR, Mackey AD, Gregory JF, 3rd. Folate deprivation reduces homocysteine remethylation in a human intestinal epithelial cell culture model: role of serine in one carbon donation. Am J Physiol Gastrointest Liver Phys iol 2004;286:G588 95.

PAGE 107

107 146. Demmelmair H, Sauerwald T, Koletzko B, Richter T. New insights into lipid and fatty acid metabolism via stable isotopes. Eur J Pediatr 1997;156 Suppl 1:S70 4. 147. Holm PI, Hustad S, Ueland PM, Vollset SE, Grotmol T, Schneede J. Modulation of the homocysteine betaine relationship by methylenetetrahydrofolate reductase 677 C >t genotypes and B vitamin status in a large scale epidemiological study. J Clin Endocrinol Metab 2007;92:1535 41. 148. Kretsch MJ, Sauberlich HE, Newbrun E. E lectroencephalographic changes and periodontal status during short term vitamin B 6 depletion of young, nonpregnant women. Am J Clin Nutr 1991;53:1266 74. 149. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protei n utilizing the principle of protein dye binding. Anal Biochem 1976;72:248 54. 150. Melin T, Nilsson A. Delta 6 desaturase and delta 5 desaturase in human Hep G2 cells are both fatty acid interconversion rate limiting and are upregulated under essential fa tty acid deficient conditions. Prostaglandins Leukot Essent Fatty Acids 1997;56:437 42. 151. Audet A, Lupien PJ. Triglyceride metabolism in pyridoxine deficient rats. J Nutr 1974;104:91 100. 152. Sabo DJ, Francesconi RP, Gershoff SN. Effect of vitamin B6 d eficiency on tissue dehydrogenases and fat synthesis in rats. J Nutr 1971;101:29 34. 153. Hulse JD, Ellis SR, Henderson LM. Carnitine biosynthesis. beta Hydroxylation of trimethyllysine by an alpha ketoglutarate dependent mitochondrial dioxygenase. J Biol Chem 1978;253:1654 9. 154. Cho YO, Leklem JE. In vivo evidence for a vitamin B 6 requirement in carnitine synthesis. J Nutr 1990;120:258 65. 155. Werstuck GH, Lentz SR, Dayal S, et al. Homocysteine induced endoplasmic reticulum stress causes dysregulation of the cholesterol and triglyceride biosynthetic pathways. J Clin Invest 2001;107:1263 73. 156. Perry C, Yu S, Chen J, Matharu KS, Stover PJ. Effect of vitamin B6 availability on serine hydroxymethyltransferase in MCF 7 cells. Arch Biochem Biophys 2007;462 :21 7. 157. Merrill AH, Horiike K, McCormick DB. Evidence for the regulation of pyridoxal 5 phosphate formation in liver by pyridoxamine (pyridoxine) 5 phosphate oxidase. Biochem Biophys Res Commun 1978;83:984 90. 158. Li TK, Lumeng L, Veitch RL. Regulati on of pyridoxal 5' phosphate metabolism in liver. Biochem Biophys Res Commun 1974;61:677 84.

PAGE 108

108 159. Brenner RR, Bernasconi AM, Gonzalez MS, Rimoldi OJ. Dietary cholesterol modulates delta6 and delta9 desaturase mRNAs and enzymatic activity in rats fed a low eFA diet. Lipids 2002;37:375 83. 160. Ames BN, Atamna H, Killilea DW. Mineral and vitamin deficiencies can accelerate the mitochondrial decay of aging. Mol Aspects Med 2005;26:363 78. 161. Depeint F, Bruce WR, Shangari N, Mehta R, O'Brien PJ. Mitochondrial function and toxicity: role of B vitamins on the one carbon transfer pathways. Chem Biol Interact 2006;163:113 32. 162. Huq MD, Tsai NP, Lin YP, Higgins L, Wei LN. Vitamin B6 conjugation to nuclear corepressor RIP140 and its role in gene regulation. Nat C hem Biol 2007;3:161 5. 163. Molina A, Oka T, Munoz SM, Chikamori Aoyama M, Kuwahata M, Natori Y. Vitamin B6 suppresses growth and expression of albumin gene in a human hepatoma cell line HepG2. Nutr Cancer 1997;28:206 11. 164. Tully DB, Allgood VE, Cidlows ki JA. Modulation of steroid receptor mediated gene expression by vitamin B6. FASEB J 1994;8:343 9. 165. Leonard AE, Bobik EG, Dorado J, et al. Cloning of a human cDNA encoding a novel enzyme involved in the elongation of long chain polyunsaturated fatty a cids. Biochem J 2000;350 Pt 3:765 70. 166. Jakobsson A, Westerberg R, Jacobsson A. Fatty acid elongases in mammals: their regulation and roles in metabolism. Prog Lipid Res 2006;45:237 49. 167. Dussault PE, Lepage M. Effects of pyridoxine deficiency on the composition of plasma and liver fatty acids in rats fed low and high fat diets. J Nutr 1975;105:1371 6. 168. Coniglio JG, Culp FB, Goswami A. The metabolism of 1 (14)C arachidonic acid in pyridoxine deficient and pair fed control rats. Lipids 1967;2:484 8 169. Cui Z, Vance JE, Chen MH, Voelker DR, Vance DE. Cloning and expression of a novel phosphatidylethanolamine N methyltransferase. A specific biochemical and cytological marker for a unique membrane fraction in rat liver. J Biol Chem 1993;268:16655 63. 170. Stafford JH, Thorpe PE. Increased exposure of phosphatidylethanolamine on the surface of tumor vascular endothelium. Neoplasia 2011;13:299 308. 171. Tessitore L, Sesca E, Bosco M, Vance DE. Expression of phosphatidylethanolamine N methyltransferase i n Yoshida ascites hepatoma cells and the livers of host rats. Carcinogenesis 1999;20:561 7.

PAGE 109

109 BIOGRAPHICAL SKETCH Mei Zhao is from Tongling City, Anhui Province in China. She attended the First High School in Tongling City and graduated in 1999. Then she en tered in Zhejiang University in China and received a Bachelor of Science degree in B ioinformatics in 2006. After her graduation, she received a graduate assistantship from University of Florida and entered the PhD program in Department of Food Science and Human Nutrition m ajored in the nutritional sciences conc entration in the fall of 2006. She finally completed her PhD studies under the supervision of Dr. Jesse F Gregory III in 2011. After graduation, she is interested in pursuing a career as a nutrition scientist.