Identification of Agriculturally Important Molluscs to the U.S. and Observations on Select Florida Species

MISSING IMAGE

Material Information

Title:
Identification of Agriculturally Important Molluscs to the U.S. and Observations on Select Florida Species
Physical Description:
1 online resource (467 p.)
Language:
english
Creator:
White, Jodi Ann
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Entomology and Nematology
Committee Chair:
Capinera, John L
Committee Members:
Mannion, Catharine M
Paulay, Gustav
Slapcinsky, John
Hodges, Amanda

Subjects

Subjects / Keywords:
bradybaena -- carolinianus -- deroceras -- laeve -- philomycus -- provisoria -- reticulatum -- similaris -- slugs -- snails -- zachrysia
Entomology and Nematology -- Dissertations, Academic -- UF
Genre:
Entomology and Nematology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Many terrestrial molluscs have been documented as important plant pests and contaminants. The Terrestrial Mollusc Tool consists of a non-dichotomous pictorial key, fact sheets and dissection tutorials to help the user to distinguish between closely related species, to aid in the rapid identification of terrestrial gastropods of agricultural, trade and ecological concern. Laboratory evaluation of the consumption potential and life history traits for Deroceras reticulatum and D. laeve were conducted at two constant temperatures and two population densities. There was no significant difference in the mean quantity of lettuce consumed by D. reticulatum and D. laeve; but, D. laeve consumed more at 21 degreeC than at 14 degree C. The mean quantity of lettuce consumed by solitary individuals of both species was significantly greater when compared to respective individuals held in groups of five at both temperatures. Thirty-seven plants commonly grown in Florida were evaluated for susceptibility to herbivory from four mollusc species using choice and no-choice tests. Zachrysia provisoria was the most polyphagous species consuming 84% of test plants, Deroceras reticulatum consumed 11%, Deroceras laeve and Bradybaena similaris consumed 8%. Annuals were generally more susceptible to herbivory than perennials. Laboratory evaluation of the feeding behavior and life history traits of Philomycus carolinianus indicated that weight gain followed a sigmoidal curve. The mean time to first oviposition was used to separate individuals into four statistically significant groups, indicating possible genetic polymorphism. This species is capable of self-fertilization. Paired individuals produced larger clutches of eggs and oviposited less frequently than solitary individuals. Philomycus carolinianus eggs developed at 14, 17, 21 and 25 degrees C ; however, no hatching occurred at 10 and 29 degrees C. Synthetic (gypsy moth, spruce budworm, rabbit pellet) diets and natural (white mushroom, lettuce, carrot) materials were evaluated as potential diets for rearing P. carolinianus. The gypsy moth diet produced the best combination of favorable attributes. Philomycus carolinianus displayed clear feeding preference for select mushroom species but did not consume higher plants, except lettuce. Revision of the genus Philomycus indicated that the genus is monophyletic and consists of at least five species: P. carolinianus, P. togatus, P. venustus, P. flexuolaris and P. sellatus.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Jodi Ann White.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Capinera, John L.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-05-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0043656:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 IDENTIFICATION OF AGRICULTURALLY IMPORTANT MOLLUSCS TO THE U.S. AND OBSERVATIONS ON SELECT FLORIDA SPECIES By JODI WHITE MCLEAN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFIL LMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 201 2

PAGE 2

2 201 2 Jodi White McLean

PAGE 3

3 To my wonderful husband Steve whose love and support helped me to complete this work. I also dedicate this work to my beautif ul daughter Sidni who remains the sunshine in my life.

PAGE 4

4 ACKNOWLEDGMENTS I would like to express my sincere gratitude to my committee chairman, Dr. John Capinera for his endless support and guidance. His invaluable effort to encourage critical thinking is greatly appreciated. I would also like to thank my supervisory committ ee (Dr. Amanda Hodges, Dr. Catharine Mannion, Dr. Gustav Paulay and John Slapcinsky) for their guidance in completing this work. I would like to thank Terrence Walters, Matthew Trice and Amanda Redford form the United States Department of Agriculture Animal and Plant Health Inspection Service Plant Protection and Quarantine (USDA APHISPPQ) for providing me with finan cial and technical assistance. This degree would not have been possible without their help. I also would like to thank John Slapcinsky and the staff as the Florida Museum of Natural History for making their collections and services available and accessible. I also would like to thank Dr. Jennifer Gillett Kaufman for her assistance in the collection of the fungi used in this dissertation. I am truly grateful for the time that both Dr. Gillett Kaufman and Dr. James Kimbrough committed to the identification of the fungal specimens included herein. I also would like to thank Paul Skelley for providing his time and willingly sharing his expertise in scanning electron microscopy. I would like to thank Dr. James Cuda for providing access to his field collecting equipment for use in the collection of the molluscs. Many thanks to Lyle Buss. I do appreciate him taking the time to make the beautiful photography component of this dissertation a success. I also would like to express my sincere gratitude to Kay Weigel for dedicating her time to produce the drawings included in this work

PAGE 5

5 I am forever indebted to Danae Perry and Marissa Gonzalez for their consistently exceptional work. Without their help this degree would not have been completed in a timely manner.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 9 LIST OF FIGURES ........................................................................................................ 10 LIST OF OBJECTS ....................................................................................................... 13 LIST OF ABBREVIATIONS ........................................................................................... 14 ABSTRACT ................................................................................................................... 15 CHAPTER 1 OVERVIEW ............................................................................................................ 17 2 TERRESTRIAL MOLLUSC TOOL .......................................................................... 20 Introduction ............................................................................................................. 20 Materials and Methods ............................................................................................ 21 Supporting Materials ........................................................................................ 22 Key Construction .............................................................................................. 24 Results .................................................................................................................... 25 Discussion .............................................................................................................. 25 3 THE CONSUMPTION PATTERN OF DEROCERAS RETICULATUM AND D. LAEVE (AGRIOLIMACIDAE) AT TWO TEMPERATURES AND TWO DENSITIES ............................................................................................................. 30 Introduction ............................................................................................................. 30 Materials and Methods ............................................................................................ 31 Results .................................................................................................................... 33 Discussion .............................................................................................................. 34 4 HOST PLANT PREFERENCE OF AGRICULTURALLY IMPORTANT MOLLUSC SPECIES .............................................................................................. 43 Introduction ............................................................................................................. 43 Materials and Methods ............................................................................................ 46 Molluscs and Plants ......................................................................................... 46 Palatability Tests .............................................................................................. 47 Statistical Analysis ............................................................................................ 50 Results .................................................................................................................... 50 Dis cussion .............................................................................................................. 52

PAGE 7

7 5 NOTES ON THE LIFE HISTORY TRAITS AND FEEDING BEHAVIOR OF PHILOMYCUS CAROLINIANUS (PULMONATA: STYLOMMATOPHORA: PHILOMYCIDAE) ................................................................................................... 63 Introduction ............................................................................................................. 63 Materials and Methods ............................................................................................ 64 Life History Traits ............................................................................................. 64 Evaluation of Artificial and Natural Diets for Short term Rearing ...................... 68 Food Preference ............................................................................................... 69 Results .................................................................................................................... 72 Life History Traits ............................................................................................. 72 Evaluation of Artificial and Natural Diets for Short term Rearing ...................... 74 Food Preference ............................................................................................... 75 Discussion .............................................................................................................. 76 Life History Traits ............................................................................................. 76 Evaluation of Artificial and Natural Diets for Short term Rearing ...................... 79 Food Preference ............................................................................................... 81 6 PRELIMINARY FINDINGS ON THE EVISION OF THE GENUS PHILOMYCUS (PULMONATA: STYLOMMATOPHORA: PHILOMYCIDAE) .................................. 99 Introduction ............................................................................................................. 99 Materials and Methods .......................................................................................... 100 Species Definition ........................................................................................... 100 Specimen Collection and Preparation ............................................................ 101 Morphological Characters ............................................................................... 102 Adult Reproductive System Characters .......................................................... 102 Morphological Phylogenetic Analysis ............................................................. 106 Isolation of DNA, Amplification by PCR and Sequencing ............................... 106 Molecular Phylogenetic Analysis .................................................................... 108 Resu lts .................................................................................................................. 109 Morphological Phylogenetic Analysis ............................................................. 109 Molecular Phylogenetic Analysis .................................................................... 110 Mitochondrial Clades ...................................................................................... 110 Discussion ............................................................................................................ 111 Taxonomic History of Philomycus ......................................................................... 114 Systematic Accounts ............................................................................................. 118 Family Philomycidae Gray 1847 ..................................................................... 118 Identification key to the New World ge nera of Philomycidae .......................... 118 Genus Philomycus Rafinesque 1820 ............................................................. 118 Philomycus carolinianus (Bosc, 1802) ............................................................ 119 Philomycus flexuolaris Rafinesque, 1820 ....................................................... 122 Philomycus sellatus Hubricht, 1972 ................................................................ 125 Philom ycus togatus Gould, 1841 .................................................................... 127 Philomycus venustus Hubricht, 1953 ............................................................. 132 Philomycus spp. ............................................................................................. 134 Identification key to Philomycus spp. .............................................................. 134

PAGE 8

8 7 SUMMARY AND CONCLUSIONS ........................................................................ 160 APPENDIX A LIST OF SPECIES INCLU DED IN THE TERRESTRIAL MOLLUSC TOOL ......... 165 B TERRESTRIAL MOLLUSC TOOL WEBSITE CONTENT ..................................... 168 LIST OF REFERENCES ............................................................................................. 454 BIOGRAPHICAL SKETCH .......................................................................................... 467

PAGE 9

9 LIST OF TABLES Table page 4 1 List of test plants incl uded in the palatability study ............................................. 56 4 2 Choice test: comsumption (A.I.) of selected ornamental and food plants in Florida, by four pestiferous mollusc species. ...................................................... 58 4 3 No Choice: percent consumption of the foliage of ornamental, fruit and vegetable plants by four pestiferous mollusc species ......................................... 60 4 4 Reassessment (cabbage used as control) of the ac ceptability index values (A.I.) for selected ornamental and food crops that are commonly grown in Florida, and consumed by Zachrysia provisoria. ................................................ 62 5 1 Comparison of reproductive parameters of Philomycus carolinianus reared in pairs and alone. .................................................................................................. 83 5 2 Choice test evaluation of select mushroom species commonly found in Florida by Philomycus carolinianus for acceptability as food sour ce. ................. 84 5 3 Plants used to conduct a nochoice test: none were consumed. ........................ 86

PAGE 10

10 LIST OF FIGURES Figure page 2 1 Lucid key identification process using Zachrysia sp. as an example. ................. 29 3 1 Mean weight gain of Deroceras laeve and D. reticulatum beginning with 14day old juveniles and held at 14C until reproductive maturity ........................... 39 3 2 Mean weight gain of Deroceras laeve and D. reticulatum beginning with 14day old juveniles and held at 21C until reproductive maturity. .......................... 40 3 3 Mean cumulative consumption of lettuce by Deroceras laeve and D. reticulatum per individual beginning with 14day old juveniles and held at 14C until reproductive maturity .......................................................................... 41 3 4 Mean cumulative consumption of lettuce by Deroceras laeve and D. reticulatum per individual beginning with 14day old juveniles and held at 21C until reproductive maturity .......................................................................... 42 5 1 Mean ( SD) weight of 356 Philomycus carolinianus slugs reared on gypsy moth diet (BioServ, Frenchtown, NJ) from hatchlings to reproductive maturity at 21C ................................................................................................. 87 5 2 Mean weight ( SE) slugs in three of four cohorts exhibited by Philomycus carolinianus individuals reared on synthetic gypsy moth diet from egg eclo sion to sexual maturity at 21C .................................................................... 88 5 3 Mean time to reproductive maturity of slugs exhibiting three of four growths patterns displayed by Philomycus carolinianus slugs reared on synthetic gypsy moth diet from eggeclosion to sexual maturity at 21C ........................... 89 5 4 Mean weight of Philomycus carolinianus slugs that in the fourth growth pattern, reared on gypsy moth diet (BioServ, Frenchtown, NJ) from hatchlings until death at 21C ............................................................................. 90 5 5 Temporal trend in survivorship of the 79 Philomycus carolinianus slugs that exhibited the fourth growth pattern when held at 21C and reared on gypsy moth diet (BioServ, Frenchtown, NJ). ................................................................ 91 5 6 Mean percent hatch and mean clutch size for the first six consecutive clutches produced by Philomycus carolinianus slugs held at 21C when reared on gypsy moth diet (Bio Serv, Frenchtown, NJ) ...................................... 92 5 7 Mean ( SE) percent successful embryonic development of Philomycus carolinianus eggs he ld at six constant temperatures .......................................... 93

PAGE 11

11 5 8 Mean ( SE) days to juvenile eclosion of Philomycus carolinianus eggs held at six constant temperatures ............................................................................... 94 5 9 Mean ( SE) percent hatch of Philomycus carolinianus eggs he ld at six constant temperatures ........................................................................................ 95 5 10 Mean ( SE) weight of Philomycus carolinianus slugs reared on seven test diets for eight weeks. Solid bars: initial, hollow bars: final weights. .................... 96 5 11 Mean ( SE) number of clutches produced in eight weeks by Philomycus carolinianus ....................................................................................................... 97 5 12 Mean ( SE) percent mortality of adult slugs of Philomycus carolinianus when reared on s even test diets for eight weeks ................................................ 98 6 1 Phylogram of Bayesian analysis of 64 slug based on the cytochrome oxidase subunit (CO1) gene with branch lengths measured in expected substitutions per site .............................................................................................................. 142 6 2 NJ tree of 38 individual Philomycus based on the cytochrome oxidase subunit (CO1) gene with branch lengths measured in ex pected substitutions per site .............................................................................................................. 143 6 3 Phylogram of MP analysis of 26 slugs based on morphological characters. Bootstrap values printed at respective branches for 50% majority rule consensus tree ................................................................................................. 144 6 4 NJ tree showing unambiguous character state changes for the carolinianus clade form the MP analysis ............................................................................... 145 6 5 NJ tree showing unambiguous character state changes for the flexuolari s clade from the MP analysis ............................................................................... 146 6 6 NJ tree showing unambiguous character state changes for the sellatus clade from the MP analysis. Numbers above branches are character numbers; below branches are character states. Blue dots: homoplasious changes and green dots: nonhomoplasious changes (synapomorphies). ........ 147 6 7 NJ tree showing unambiguous character state changes for the togat us clade from the MP analysis ............................................................................... 148 6 8 NJ tree showing unambiguous character state changes for the venustus clade from the MP analysis ............................................................................... 149 6 9 Mantle pattern of Philomycus flexuolaris (paratype of P. virginicus ) ................. 150 6 10 Genitalia of five Philomycus species ................................................................ 151

PAGE 12

12 6 11 Darts of five Philomycus species ...................................................................... 152 6 12 Central and lateral teeth of four Philomycus species. ....................................... 153 6 13 Jaws of fi ve Philomycus species ..................................................................... 154 6 14 Distribution of Philomycus carolinianus throughout eastern United States. ...... 155 6 15 Distribution of Philomycus flexuolaris throughout eastern United States. ......... 156 6 16 Distribution of Philomycus sellatus throughout eastern United States. ............. 157 6 17 Distribution of Philomycus togatus throughout eastern United States. ............. 158 6 18 Distribution of Philomycus venustus throughout eastern United States. ........... 159

PAGE 13

13 LIST OF OBJECTS Object page 1 1 The Terrestrial Mollusc Tool website ................................................................. 25

PAGE 14

14 LIST OF ABBREVIATION S UF University of Florida: Florida Museum of Natural History FMNH Field Museum of Natural History LMNA Land Mollusca of North America UMMZ University of Michigan Museum of Zoology

PAGE 15

15 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy IDENTIFICATION OF AGRICULTURALLY IMPORTANT MOLLUSCS TO THE U.S. AND OBS ERVATIONS ON SELECT FLORIDA SPECIES By Jodi White McLean May 2012 Chair: John Capinera Major: Entomology and Nematology Many terrestrial molluscs have been documented as important plant pests and contaminants. The Terrestrial Mollusc Tool consists of a nondichotomous pictorial key, fact sheets and dissection tutorial s to help the user to distinguish between closely related species, to aid in the rapid identification of terrestrial gastropods of agricultural trade and ecological concern. Laboratory evaluation of the consumption potential and life history traits for Deroceras reticulatum a nd D. laeve were conducted at two constant temperatures and two population densities. T here was no significant difference in the mean quantity of lettuce consumed by D. reticulatum and D. la e ve ; but, D. laeve consumed more at 21C than at 14C T he mean qu antity of lettuce consumed by solitary individuals of both species was significantly greater when compared to respective individua l s held in groups of five at both temperatures. Thirty seven plants commonly grown in Florida were evaluated for susceptibili ty to herbivory from four mollusc species using choice and nochoice tests Zachrysia provisoria was the most polyphagous species consuming 84% of test plants, Deroceras

PAGE 16

16 reticulatum consumed 11% Deroceras l a e ve and Bradybaena similaris consumed 8%. Annual s were generally more susceptible to herbivory than perennials. Laboratory evaluat ion of the feeding behavior and life history traits of Philomycus carolinianus indicated that weight gain followed a sigmoidal curve The mean time to first oviposition was used to separate individuals into four statistically significant groups indicating possible genetic polymorphism This species is capable of self fertilization P aired individuals produced larger clutches of eggs and oviposit ed less frequently than solitar y individuals Philomycus carolinianus eggs developed at 14, 17, 21 and 25C ; however, no hatching occurred at 10 and 29C Synthetic (gypsy moth, spruce budworm rabbit pellet) diets and natural (white mushroom, lettuce, carrot) materials were evaluated as potential diets for rearing P. carolinianus The gypsy moth diet produced the best combination of favorable attributes Philomycus carolinianus displayed clear feeding preference for select mushroom species but did not consume higher plants, except let tuce. R evision of the genus Philomycus indicated that the genus is monophyletic and consists of at least five species: P. carolinianus, P. togatu s, P. venustus, P. flexuolaris and P. sellatus

PAGE 17

17 CHAPTER 1 OVERVIEW Many terrestrial snails and slugs (Mollusca: Gastropoda) are considered significant agricultural and ecological pests worldwide (Iglesias and Speiser 2001; South 1992). Pestiferous terrestrial gastropods are of concern globally as they are capable of inflicting considerable economic damage to field crops ( e.g., sugar beet, maize, soybean and cereals), vegetables ( e.g., lettuce, cabbage), ornamentals ( e.g., hosta, impatiens, gardenias and marigold), fruits ( e.g., strawberries, banana, and grapes), and forestry plants (Hata et al. 1997). Damage is m ainly caused by direct consumption of plant material (leaves, fruits and flowers); however, the quality of the produce may also be affected by the feces and slime often left behind by the animal or from contamination by the animal itself (Iglesias et al. 2001). The global trade in agricultural produce is guided by several conventional practices formulated to minimize the potential dispersal of pest molluscs and other regulated species (McCullough et al. 2006). As a general rule, many countries that import agricultural produce frequently require phytosanitary certificates from their trade counterparts indicating that shipments are free of molluscs and their eggs (Hata et al. 1997). Contaminated shipments are frequently rejected, destroyed or subjected to co stly treatments (Cowie et al. 2008). These stringent but necessary screening measures are often effective, and are integral to protecting the United States of Americas agricultural trade industry valued at approximate $34 billion (2010) (USDA ERS 2011). U nfortunately, the inherent timedelays often associated with the implementation of these measures may be perceived as an impediment to trade, and

PAGE 18

18 research to investigate novel preclusion and treatment options continues (McCullough et al. 2006). Many snails and slugs are highly adaptable and may rapidly achieve pest status in many cropping systems. Several biological and chemical control measures have been developed for the management of pestiferous molluscs but the efficacy of available control options is o ften highly variable (Iglesias and Speiser 2001). Molluscicides are most often formulated in the form of pellets, and typically, the active ingredient is metaldehyde, carbamate or iron phosphate (Speiser and Kistler 2002; Thompson et al. 2005) Metaldehyde and carbamatebased molluscicides are potentially toxic to nontarget animals (wildlife, pets and beneficial invertebrates) and degrade quickly, (Thompson et al. 2005) whereas iron phosphate is very costly to use because it is required at higher rates per area to achieve similar control as the former chemicals (Speiser and Kistler 2002). The most effective strategies for the management of pestiferous molluscs often employ a combination of measures aimed at preventing introductions or reintroductions into new areas. Preventative measures include early detection of eggs or live specimens in cargo, quarantine and treatments to eradicate the pest species. The Terrestrial Mollusc Tool was developed to facilitate the early detection of terrestrial gastropods of regulatory concern at US ports of entry. This tool provides background information on the biology and ecology of terrestrial snails and slugs and includes a pictorial key for the identification of both native and exotic pest species. Terrestrial snails and slugs have consistently been recorded as agricultural pests worldwide (Nash et al. 2007); however, the information reported in the literature for this

PAGE 19

19 group primarily addresses the monetary loss or the qualitative impact of feeding damage. One of the pr imary goals of this work is to quantify the potential feeding damage of Deroceras reticulatum and D. laeve under laboratory conditions. Historically, terrestrial snails and slugs have been of little agricultural significance in Florida as compared to insec t pests. Hence, the host range of several common snails and slugs (native and nonnative) in Florida is poorly addressed in the literature. This work evaluated the potential host range of the pest species, Bradybaena similaris Zachrysia provisoria, Deroceras reticulatum and D. laeve, under laboratory conditions. Several fruit, vegetable and ornamental species commonly grown in Florida were evaluated in choice and nochoice tests and an acceptability index calculated. The reputation and profile of pestifer ous gastropods often overshadow the ecological importance of less conspicuous nonpest species. It is, however, important to gain an understanding of the biology and provide insight into the ecological role of native snail and slug species in the environment. This work investigated the biology and ecology of the native species Philomycus carolinianus under laboratory conditions. Additionally, the taxonomy of the genus Philomycus was evaluated using morphological and molecular techniques to clarify inconsist encies in the nomenclature of the species classified into this genus.

PAGE 20

20 CHAPTER 2 TERRESTRIAL MOLLUSC TOOL Introduction L ucid tool s a re computer based systems designed to facilitate rapid and accurate visual identification of entities. This tool always inc ludes an interactive key and may also include additional features such as fact sheets and external links to other resources that complement the key and may be useful to the user for making appropriate selections. In recent years, biologists have been incorporating more computer based technologies into species identification tools (Zhang et al 2009; Edwards and Morse 1995). Computer based interactive keys are an especially useful tool for identification work, as they allow users to select multiple character options at any point, as opposed to dichotomous keys that only allow for a single character selection to proceed systematically through the key (Zhang et al. 2008; Shayler and Siver 2006). This feature of interactive key s alleviates the need to select characters that are ambiguous or cannot be seen by the observer hence reducing potential misidentifications (Bell, 2002). Interactive keys also allow the incorporation of images such as photographs and drawings that emphasize characteristics and distinguishi ng features Within these, the user selects appropriate representative images that match features of the specimen in question. P rior decisions in the key, including image selection by the user determines the next suite of characters and/or image options pr esented to the user. Images not appropriately representative of the specimen in question are sequentially eliminated until a final selection is made. The L ucid software package is the most popular interactive key available. It was developed by the Center for Biological Information Technology, University of

PAGE 21

21 Queensland. The lucid software is written in Java code, thus enabling it to function on any modern operating system (e. g., Windows Macintosh Unix Li n u x etc.). The lucid 3.4 system has two maj or components: a builder and a player (Shayler and Siver 2006). The builder component of the system allows the author to construct a lucid key matrix based on character states and features deemed useful by the author. This key matrix is then exported (depl oyed) into the player format, so that it can be viewed and used by an enduser. Any modifications made to the builder must be saved and deployed into the player format. The key can be deployed either in a CD format or it can be accessed via the World Wide Web (Shayler and Siver 2006). The Terrestrial Molluscs Tool was specifically developed to assist in the identification of adult terrestrial slugs and snails of agricultural importance. The tool includes species of quarantine significance as well as invasiv e and contaminant mollusc species commonly intercepted at U.S. ports of entry. This lucidbased identification tool specifically targets federal, state and other agencies or organizations within the U.S. that are concerned with the detection and identification of terrestrial molluscs of agricultural, ecological and trade significance. This tool includes 33 families and 128 species. This resource includes an interactive identification key, comparison chart, fact sheets, biological and ecological notes, a dis section tutorial, a glossary of commonly used terms, and a list of useful links and references. Materials and Methods In order to initiate the construction of the lucid tool, the scope of the tool was first defined. This included determining the potential end users and deciphering what information would be most useful to them.

PAGE 22

22 A list of taxa (snails and slugs) was generated based on pest species reported in Barker 2002, Cowie et al. 2009, and Godan 1983 as well as port of entry interception data provided by the United States Department of Agricultures Animal and Plant Health Inspection Services Plant Protection and Quarantine (USDA APHISPPQ) and the Florida Department of Agriculture and Consumer Services Division of Plant Industry (FDACS DPI). Species w ere selected for inclusion in the tool using the following criteria: (a) all species documented as significant agricultural and ecological pest, (b) all contaminant species documented to materially affect the value and quality of produce, and (c) occasional contaminants or hitchhiker species intercepted at U.S.A. ports of entry a minimum of 7 times per year. Given the recognized time and resource constraints of the project approximately 200 species were considered a reasonable number for inclusion in the tool. Consequently numerous occasional contaminant species that were intercepted fewer than 7 times per year were excluded. General information was then gathered on the targeted taxa from differe nt media and literature sources This included biology, ecology, and parameters needed for the identification of members of this group. Supporting Materials The following pages were created as supporting materials for the lucid key. Each page was generated in an html format to be hosted on the lucid tool website. Home page: This page displays a listing of the components of the lucid tool and provides a link to each component. The format of the home page serves as a template for the general outline of subsequent pages. About the lucid tool: This page gives a general introduction to the lucid tool. It provides the rationale behind the construction of the tool, clearly defines the tools

PAGE 23

23 scope and gives a general outline of the tools components. The source of funding and collaborators are also acknowledged in this section. How to use the lucid key: The how to use the lucid key section of the lucid tool provides an indepth review of the components of the lucid key. This section uses screen shots of various windows of the lucid player to provide a stepby step guide through the navigation process. Important distinguishing features available to the enduser as selection options are highlighted in each screen shot. Also included in this section of the tool is a list of the equipment that may be useful in opt imizing the utility of the key. Additionally, the scope and limitations of the key are addressed in this section of the tool, and the system requirements are briefly mentioned. Terrestrial gastropods: biology and ecology: The biology and ecology section of the lucid tool gives a brief overview of the morphological, behavioral, biological, and ecological characteristics of terrestrial molluscs. How to identify terrestrial gastropods: This section of the tool is geared toward explaining and demonstrating the character istic features of snails and slugs, and how they can be used for identification purposes, because terrestrial gastropods are difficult to identify, particularly without an understanding of the morphology of this group. Fact sheets: This section of the tool is comprised an alphabetical listing of the taxa included in the tool. Each taxon is lin ked to its own fact sheet, which gives a brief description of the taxon its nomenclature, ecological significance, synonyms and any diagnostic feature (s) that may be useful in its identification. Snail and slug dissection tutorial: Many terrestrial gastropods cannot be positively identified without dissection and identification of specific features of the

PAGE 24

24 genitalia. A dissection tutorial is included in the tool and consists of written instructions and stepby step annotated pictorial slide shows for both snails and slugs. Glossary: This section includes an alphabetical list of terms that are unique to malacology or are not commonly used. Each definition was uniquely created with the assistance of multiple malacological references. References: The references include a list of resources used as references for the construction of the tool. Acknowledgments: This includes a list of all the parties involved either direct ly or indirectly in the successful completion of the lucid tool. Information and links: This is a compilation of additional reference material that may be useful to the enduser. Copyright, citation and disclaimers: This section of the tool is a requirem ent of the USDA APHIS PPQ. It explains the legal ramifications of any reuse, misuse or modifications of the content of the lucid tool. Lucid 3.4 system requirements: This portion of the lucid tool informs the enduser of the computer software and hardwar e requirements that are essential for proper functioning of the lucid key. Key Construction The author compiled a list of discriminatory characters and character states for each taxon included in the lucid key. Each taxon was then scored based on the stat e of each characteristic used The computer program (lucid builder) then generated a matrix based on this input The end user interacts with the matrix through an interface in the form of a selection window containing important characteristic features for each taxon. The end user is able to successfully identify a particular snail or slug, through a process

PAGE 25

25 of sequential elimination of characters that are not pertinent to the specimen in question. Results The website hosting the material is as follows: http://idtools.org/id/mollusc/ Object 1 1. The Terrestrial Mollusc Tool website A flow chart of the identification process using a lucid key can be seen in Figure 2 1. A list of species the species included in the Terrestrial Mollusc Tool is included in Appendix A. The factsheets, and supporting materials that were created as a part of the lucid tool are included in Appendix B Discussion The Terrestrial Mollusc Tool was developed primarily to increase the efficiency of identification of terrestrial molluscs of regulatory significance by USDA APHISPPQ. Terrestrial molluscs intercepted during routine cargo inspections would typically be sent offsite for official i dentification by an identifier appointed by the USDA APHISPPQ N ational Identification Service. The turn around time associated with this process often impedes the timely movement of cargo through the ports as consignments of perishable items may be hel d for extended periods pending official identification. The Terrestrial Mollusc Tool was developed to expedite preliminary identification of terrestrial molluscs at the ports of entry and to improve the efficiency of the current decisionmaking process. The construction of the pictorial key component of the Terrestrial Mollusc Tool required the procurement of high quality photographs and diagrams that adequately illustrate diagnostic characters of the taxa included in the key. The author sought and receiv ed permission from the copyright holders to use several of the photographs

PAGE 26

26 included in the key. However, in many cases photographs of species were nonexistent or those that were available were either of poor quality or did not display diagnostic characters of interest. Photographs of unacceptable quality were substituted with appropriate drawings. The limited number of diagnostic morphological characters available in terrestrial molluscs proved to be a significant impediment to the development of the luci d key. The pictorial key is comprised of both quantitative (e.g., length, number of whorls) and qualitative (e.g., color and texture) characters. The author attempted to score a greater number of quantitative characters for each taxon in order to reduce er rors due to enduser perception of qualitative characters. The fact sheet component of the Terrestrial Mollusc Tool was included to inform the enduser of the agricultural significance or potential pest status of each taxon included in the key. There is however, a dearth of information in the literature concerning the ecology and life history traits of several species included in the Terrestrial Mollusc Tool. Additionally, several species are listed in the literature by numerous synonyms due to repeated t axonomic reclassification. The process of resolving the currently accepted classification with older synonyms proved to be very time consuming and was a major impediment in the construction of this tool. For clarity and consistency, the taxonomic nomenclat ure utilized by the USDA APHISPPQ NISs malacology representative was adopted in the construction of the Terrestrial Mollusc Tool. A list of synonyms was recorded for each species in their respective fact sheets to assist the end user.

PAGE 27

27 The Terrestrial Mo llusc Tool was constructed to include the terrestrial mollusc species that are commonly intercepted and of current regulatory concern to the U.S.A. and is not comprehensive for species that may be encountered in the U.S.A The pictorial key component of t he Terrestrial Mollusc Tool requires a suite of diagnostic characters that may only be present in adult s. Additionally, adult albino morphs (white body and shells) and the weathered shells of snails may lack adequate morphological characters for an accurat e diagnosis. The Terrestrial Mollusc Tool will therefore be of limited utility to the end user when juveniles and albino morphs are in question. A few taxa will not be able to be identified below the family level when using the pictorial key in the Terrestrial Mollusc Tool. This is true especially for the families Veronicellidae and Succineidae. The major reason for this is the lack of diagnostic morphological characters and t he variability of members of these groups. M olecular techniques provide useful alternative for the identification of members of these families (Holland and Cowie 2007; Gomes et al. 2010). This inadequacy of the key is, however, mitigated by the fact that most if not all the members of these problematic groups are pestiferous and as such are regulated at the family level. The same is true for several species complexes (e.g., Arion hortensis group, A. ater group) included in the tool. There are a number of malacological terms that were not included in the Terrestrial Mollusc Tool becaus e the targeted endusers are nonexperts. The author attempted to use commonly used language as opposed to technical jargon where possible. Additionally, several diagnostic but subjective and/or inconspicuous characters

PAGE 28

28 traditionally emphasized in publishe d dichotomous keys were excluded from the Terrestrial Mollusc Tool in an attempt to reduce subjectivity. The utility of the Terrestrial Mollusc Tool can be improved over time as it offers the flexibility for continuous modifications and the addition of new taxa of interest.

PAGE 29

29 Figure 21. Lucid key identification process using Zachrysia sp. as an example.

PAGE 30

30 CHAPTER 3 THE CONSUMPTION PATTERN OF DEROCERAS RETICULATUM AND D. LAEVE (AGRIOLIMACIDAE) AT TWO TEMPERATURES AND TWO DENSIT IES Introduction Terrestrial slugs consistently have been reported as agricultural and horticultural pests (Gebauer 2002; Mair and Port 2002; Pickett and Stephenson 1980; Schley and Bees 2003) in temperate regions worldwide (Brooks et al. 2006; Cook et al. 1996; Glen South 1992). Slugs in the genus Deroceras (Family: Agriolimacidae) are plant pests globally (Grimm et al. 2009). Deroceras reticulatum (Mller, 1774), the grey field slug, is thought to have originated in the Palearctic ecozone (Speiser et al. 2001), but has been inadvertently introduced to other continents, aided primarily by trade (Howlett et al. 2008) and the movement of humans across the world (Speiser et al. 2001) Deroceras reticulatum is now considered among the most cosmopolitan slug species recorded to date (Nash et al. 2007; Speiser et al. 2001), occurring in temperate regions (Barker 1991) of Europe, Asia, Australia, New Zealand and North and South America (S outh 1992; Willis et al. 2 006; Yildirim and Kebapi 2004). Over the years, repeated introductions of this species have not lead to established populations in Florida. D. reticulatum flourishes in disturbed habitats such as gardens, grasslands, hedgerows, g reenhouses and agricultural fields (Barker 1991; Godan 1983; Howlett et al. 2008; Lipa and Smits 1999; Willis et al. 2006). D. reticulatum is an important agricultural pest (Barratt et al. 1994; Ester and Nijenstein 1995; Frank 1998; Hammond et al. 1996; K eller et al. 1999; Pilsbry 1948). According to Speiser et al. (2001), this slug is considered the most economically damaging slug pest

PAGE 31

31 species, and as such, the biology and behavior of this species is well documented in the literature (Faberi et al. 2006). Deroceras laeve (Mller, 1774), the marsh slug, is native to North America (Getz 1959), and other areas of the holarctic ecozone, including Europe and Asia. This slug species has colonized a wide range of climatic zones in the Americas, occurring from Al aska to central Florida in the U.S. and throughout Central America (Faberi et al. 2006; Hubricht 1985; Jordaens et al. 2006; Pilsbry 1948; Wiktor 2000). D. laeve has been introduced into South America and successfully coexists with Deroceras reticulatum in temperate zones (Getz 1959). According to Barker (2002), Deroceras laeve is a recognized pest of pastures in North America and Faberi et al. (2006) also reports it to be a crop pest wherever conservation tillage is practiced in southeastern regions of Bue nos Aires Province, Argentina. However, very little has been documented on the comparative pest status of D. laeve (Faberi et al. 2006). This study was undertaken to assess the influence of two constant temperatures and two slug densities on the time to r eproductive maturity and consumption pattern of Deroceras reticulatum and Deroceras laeve. Materials and Methods Field collected s lug s were used to establish laboratory populations of Deroceras reticulatum and Deroceras laeve. D. reticulatum an invasive agricultural pest, was collected from Rockland, Maine. The native D. laeve was collected in Gainesville, Florida. Two week old juveniles of each species were obtained from these colonies for use in this experiment. Twenty five slugs of each species were individually placed into plastic cylindrical containers (9.5 cm diam. X 4.5 cm high) that were partially lined with

PAGE 32

32 moistened, crumpled paper towel, and vented to allow for air circulation while maintaining high humidity levels. The slugs were fed leaf discs of Romaine lettuce ( Lactuca sativa L. var. longifolia), measuring approximately 11.4 cm2. The weight of each leaf disc and the slug were recorded using an analytical balance (Mettler ToledoAL104, Fisher Scientific, Denver, CO) prior to being placed inside the plastic container. The plastic containers were then placed into an incubator (Percival, Boone, IA) at 14 or 21 1C, with a 12h light and dark period (LD: 12/12 h) for the duration of the experiment. Thereafter, at 3day intervals, each slug was wei ghed and the remaining lettuce weighed and replaced with fresh lettuce. In addition, 20 replicate groups of 5 twoweek old juveniles were treated similarly. As the experiment progressed, the numbers of leaf discs were adjusted so that adequate food was alw ays available to the slugs. Twenty leaf discs were maintained in the same manner but without slugs (control) thereby allowing for assessing l ettuce weight change, and accurate estimation of consumption. The experiment was terminated when there was a decline in the amount of lettuce consumed by the slugs, as this likely indicated senescence. Three way analyses of variance (ANOVA) were used to determine if there were any significant differences in development and consumption for Deroceras reticulatum and D. laeve at reproductive maturity. The following variables were evaluated: species, temperature, density and any possible interactions. Any resulting significant differences were further investigated using twosample t tests. All statistical analyses were done using Statistical Analysis System software (SAS Institute, Inc. 2008). Means SE are presented where applicable.

PAGE 33

33 The statistical relationship between the area of lettuce (cm2) and the corresponding weight in milligrams was established using a regression analysis. This should provide a visual estimate of the quantity of leaf tissue consumed. This was assessed by using fifteen cork borers of different sizes (number: 1 (0.13 cm2) to 15 (4.15 cm2)) to randomly excise 20 leaf discs each from fresh lettuce leaf. The 20 leaf discs from each respective cork borer were immediately weighed and mean values calculated. A regression analysis was conducted to determine the relationship between leaf area and weight and to facilitate accurate conversion of data. Results Both Deroceras reticulatum and D. laeve gained weight as they matured; however, D. reticulatum weighed (29.4 2.6 mg) twice ( F = 14.92; df = 86; P = 0.0002) as much as D. laeve (12 .2 2.2 mg) at first oviposition Temperature (14C and 21C) influenced weight gain in each slug species ( F = 4.09; df = 86; P = 0.0462). D. laeve gained approximately five times as much weight when reared at 21oC than at 14oC ( t = 4.47 ; df = 4 3 ; P <0.0001) whereas, D. reticulatum gained weight similarly at both temperatures. For both slug species, there were no difference between the weight of animals reared as solitary individuals and those reared in groups ( F = 0.17; df = 86; P = 0.6789) (Figure 3 1 and Figure 3 2). Despite their larger size, Deroceras reticulatum did not consume significantly ( F = 0.13; df = 85; P = 0.7181) more plant material than D. laeve However, temperature ( F = 16.49; df = 85; P = 0.0001) significantly influenced the amount of lettuce consumed by at least one species. The quantity of lettuce consumed by D. reticulatum at both temperatures [21C (26.3 5.5 mg) and 14C (25.7 3.1 mg)] was not different from

PAGE 34

34 each other ( t = 0 .1 1 ; df = 46; P = 0. 9162), whereas D. laeve consumed more lettuce ( t = 4.47; df = 43; P < 0.0001) at 21C (37.5 8 mg) than a t 14C (7.6 1.1 mg). D ensity ( F = 27.77; df = 85; P < 0.0001) influenced the amount of lettuce consumed by at least one species. D. reticulatum consumed similar quantities ( t = 0 88; df = 46; P = 0. 3827) of lettuce when reared as solitary (27.6 3.5 m g) individuals and as groups of five ( 22.6 4.1 mg). D. laeve consumed more lettuce per slug ( t = 2.46; df = 43; P = 0.0179), when reared as individuals (26.3 5.7 mg) than in groups of five (7.3 1.4 mg) (Figure 3 3 and Figure 3 4). There was a strong correlation (Pearson correlation coefficient = 0.99088) ( F = 702.62, df = 13; P < 0.0001) between lettuce leaf discs weight and area (Y= 46.217 X 6.6718; R2 = 0.9818), allowing for accurate estimation of leaf area consumed b ased on weight loss Discussion The primary goal of this study was to assess the comparative damage potential of Deroceras reticulatum and D. laeve. Secondly, the effects of density and temperature on the consumption pattern and weight gain of D. laeve and D. reticulatum from juve ni les to the adult stage also were investigated. Temperature had minimal effects and density did not directly affect the overall weight of each slug species. The quantity of host material (lettuce) consumed by both species to achieve maturity was also compared to assess the relative damage potential for each species. As expected, groups of slugs consumed more lettuce than solitary individual s. However, the mean quantity of lettuce consumed by solitary specimens of D. reticulatum and D. laeve was significantly greater than that consumed by individuals reared in groups of five, at both temperatures. There was not a simple additive relationship between the

PAGE 35

35 quantity of host material consumed by a solitary individuals and groups, suggesting competitive interferenc e in groups of slugs. This is a common result of group feeding. Evaluation of lettuce consumption between species showed that there was no significant difference between the quantity of host material consumed by Deroceras reticulatum and Deroceras laeve. This is surprising considering the larger size attained by D. reticulatum. This raises the question of why D. reticulatum has consistently been reported to be an agricultural pest (Airey 1987; Brooks et al. 2003; Brooks et al. 2006; Cook et al. 1996; Cook et al. 2000; Frank and Barone 1999; Howlett et al. 2008; Keller et al. 1999; Mair and Port 2002; Pakarinen 1992; Pickett and Stephenson 1980; Schley and Bees 2003; Speiser et al. 2001; Wareing 1993; Wiktor 2000; Willis et al. 2006), whereas D. laeve is onl y reported as an occasional pest, usually where reduced tillage is practiced, or in small gardens or in greenhouses (Dankowska 1996; Faberi et al. 2006; Fox and Landis 1973; Wiktor 2000). One such explanation could be the disparity between the reproductive potential of each species. While conducting this study it was observed that laboratory colonies of D. reticulatum produced larger clutch sizes, and laid eggs more frequent than D. laeve These laboratory populations of D. reticulatum produced clutches ranging in size from 3572 eggs per clutch. Similar observations were noted by Baur (1994) where a clutch size of 100 eggs was reported, whereas Karlin and Bacon (1961) reported 73 eggs per clutch. On the other hand, D. laeve reared under the same laboratory conditions laid five to six eggs per clutch. Faberi et al. (2006) reported that on average, five eggs were produced at 12C and approximately seven eggs at 20C. However, in another study conducted by Karlin and Bacon (1961), it was reported that the clut ch size of D. laeve

PAGE 36

36 ranges from one to 33 eggs per clutch and Dankowska (1996) reported 216 eggs per clutch. The potential tenfold difference in the number of eggs per clutch for D. reticulatum when compared to D. laeve suggests that the population of the former could attain higher levels and c ause greater damage to plants. Hence, it is likely that reproductive output would explain why D. reticulatum is reported more frequently as an economically damaging species. Additionally, the differences in the treatment of both species in the literature could be attributed to cannibalism by Deroceras laeve. The occurrence of cannibalism is not rare among herbivores. Immobile stages are often preyed upon, and unhatched eggs are especially easy prey. Shen (1995) demon strated that cannibalism occurs commonly in D. laeve where the primary means of such an occurrence was through the consumption of unhatched eggs by juveniles. Shen (1995) also observed cannibalism in all life stages, wherein adults and juvenile of D. laev e consumed adults and juveniles of conspecifics. Cannibalism in D. laeve could play a role in restricting the growth of populations and as such could help to explain the lowered incidence of field damaged documented for this species. Fox and Landis (1973) demonstrated experimentally that Deroceras laeve has an omnivorous feeding behavior. The predatory nature of this D. laeve was documented, wherein this species was noted to consume an average of 8.5 green peach aphids [ Myzus persicae (Sulzer)] per slug per day. The authors were able to demonstrate that the aphids were not consumed accidentally, and further demonstrated that D. laeve consumed the eggs of lepidopterans, including: zebra caterpillar [ Ceramica picta (Harris)], alfalfa looper [ Autographa californica (Speyer)] and the celery looper

PAGE 37

37 [ Anagrapha falcifera (Kirby)]. The results of Fox and Landis (1973) experiment suggest that D. laeve may persist at high numbers in the field but not necessarily consume agriculturally important crops as their diet ma y be supplemented by nonplant sources. Several authors have reported Deroceras reticulatum to be a pest in disturbed habitats (Barker 1991; Rathcke 1985), while D. laeve is a pest of areas where conservation tillage is commonly practiced. Disturbed sites are often not able to support slug populations due to the inability of the area to maintain enough humidity to support slug activity. It appears that D. reticulatum has been able to adapt to this type of area by reproducing more frequently and producing l arger numbers of eggs. Also, we observed that D. reticulatum developed significantly faster than D. laeve at cooler temperatures. Assuming that the observation made under experimental conditions hold true in field settings, the combination of characters di splayed by D. reticulatum could account for this species ability to respond more quickly and take advantage of changing conditions in disturbed habitats. Faberi et al. (2006) conducted an experiment in Argentina wherein Deroceras laeve collected locally from Buenos Aires Province was reared at 12 and 20C. The results indicated that s lug s held at the lower temperature (12C) weighed twice as much as slug s held at 20C at the end of the study. Those results are inconsistent with results obtained from this study. In this study it was observed that D. laeve developed at a significantly slower rate at the lower temperature (14C) than at 21C. One possible explanation could be that the geographic locality of each population could influence the biology of this species. The population of D. laeve used in this experiment was collected in Florida, where subtropical conditions exist, whereas the slug population used by

PAGE 38

38 Faberi et al. (2006) was collected in Buenos Aires Province, Argentina, where temperate conditions prevail. Karlin and Bacon (1961) suggest that there may be varietal differences between the native populations of Deroceras laeve in the Americas and populations in Europe. For example, Karlin and Bacon (1961) noted that D. laeve eggs collected from populations in Ohio, U.S.A. had a range of 10 15 days for incubation whereas eggs of European origin had a range of 1720 days when held at 21.6 22.8oC Jordaens et al. (2006) alluded to the fact that there is considerable variation in the lifehistory trai ts of D. laeve. Specifically, there exists a three to eight fold difference between the minimum and maximum mean values for adult size, the length of the reproductive phase, egg weight and incubation period. It is therefore suggested that future studies be conducted to determine if varietal differences exist among populations of D. laeve or if D. laeve represents an unrecognized species complex.

PAGE 39

39 Figure 31. Mean weight gain of Deroceras laeve and D. reticulatum beginning with 14day old juveniles and held at 14C until reproductive maturity. Slugs from both species were assayed singly and in groups of five.

PAGE 40

40 Figure 32. Mean weight gain of Deroceras laeve and D. reticulatum beginning with 14day old juveniles and held at 21C until reproductive maturity. Slugs from both species were assayed singly and in groups of five.

PAGE 41

41 Figure 33. Mean cumulative consumption of lettuce by Deroceras laeve and D. reticulatum per individual beginning with 14day old juveniles and held at 14C until reproductive maturity. Slugs of each species were assayed singly and in groups of five.

PAGE 42

42 Figure 34. Mean cumulative consumption of lettuce by Deroceras laeve and D. reticulatum per individual beginning with 14day old juveniles and held at 21C until reproductive maturity. Slugs of each species were assayed singly and in groups of five.

PAGE 43

43 CHAPTER 4 HOST PLANT PREFERENCE OF AGRICULTURALLY IMPORTANT MOLLUSC SPECIES Introduction Terrestrial snails an d slugs are generalist herbivores that feed on both living and dead plant material (Briner and Frank 1998; Chatfield 1976; Godan 1983; Joe and Daehler 2008; Keller et al. 1999; Pickett and Stephenson 1980; Rueda et al. 1991; Schder et al 2004; South 1992). Analysis of fecal samples from fieldcollected terrestrial molluscs indicates that higher plants are preferentially consumed (Dirzo 1980; Jennings and Barkham 1975; Pallant 1969) with fungi, mosses and liverworts being a minor component of the diet (Dir zo 1980). Pestiferous gastropods will consume many higher plants valued as important agricultural species, including cereals, ornamentals (Briner vegetable crops (Pickett and Stephenson 1980). The palatability of plants to generalist herbivores is highly variable (Buschmann et al. 2005; Williamson and Cameron 1976). This variabi lity is often attributed to physical structures such as hairs, thorns and spines (Dirzo 1980) and secondary defensive compounds produced by plants (Aguiar and Wink 2005; Gelperin 1975; Mlgaard 1986; Rueda et al. 1991). These compounds include terpenes (Ag uiar and Wink 2005; Chevalier et al. 2003; Frank et al. 2002; Gouyon et al. 1983; Linhart and Thompson 1995; Mlgaard 1986), cyanogenic glucosides (Dirzo and Harper 1982; Raffaelli and Mordue 1990), glucosinolates (Chevalier et al. 2003; Dirzo 1980; Mlgaard 1986), tannins, alkaloids (Chevalier et al. 2003; Frank et al. 2002; Dirzo 1980; Mlgaard 1986; Speiser et al. 1992) and carvone (Frank et al. 2002). Notwithstanding the considerable array of natural defenses employed, higher plants continue to be susceptible to varying

PAGE 44

44 degrees of herbivory. In an attempt to mitigate the damage caused by generalist herbivores, the application of pesticides has been incorporated into routine conventional agricultural production (Bengtsson et al. 2005). The application of molluscicides is the primary means of control for pestiferous Molluscicides are largely formulated as edible baits (Bailey 2002; Rae et al. 2007; Speiser 1999), often in t he form of pellets, with either methiocarb or metaldehyde as the active ingredient (Frank et al. 2002; Speiser 1999). The efficacy of molluscicides has in wet conditions, where the pesticide may be rendered ineffective (Cook et al. 1997; Rae et al. 2007; Oberholzer et al. 2003), allowing for the recovery of poisoned slugs (Bourne et al. 1990; Cook et al. 1997). Additionally, pelletized molluscicides that contain metaldehyde are very toxic and pose a threat to nontarget organisms, including invertebrates, mammals and birds (Brooks et al. 2003; Cook et al. 1997; Frank et al. 2002; Hagin and Bobnick 1991; Oberholzer et al. 2003; Purvis and Bannon 1992; Rae et al. 2007; South 1992). Biological control continues to be evaluated as a feasible alternative or accompaniment to chemical control of terrestrial slugs. The use of the nematode Phasmarhabditis hermaphrodita (Schneider) (Speiser et al. 2001; Rae et al. 2 007; Tan and Grewal 2001a), though effective, is very costly (Brooks et al. 2003; Speiser and Kistler 2002). The commercial formulation of this nematode (Nemaslug) has variable pathogenicity between batches (Tan and Grewal 2001b), has a short shelf life, is thermo sensitive (Speiser and Kistler 2002) and is not permitted for use within the

PAGE 45

45 United States of America (Becker Underwood 2011). There are also several species within the beetle family Carabidae that are predominantly mollusc feeders (Hatteland et al. 2010; Oberholzer et al. 2003)) and have been suggested as a management option. Carabid beetles ( Carabus nemoralis Pterostichus niger and P. melanarius) have been documented to prey upon the eggs and juveniles of pestiferous slugs (Hatteland et al. 201 0). Also, cultural control of terrestrial gastropods includes soil cultivation, deep seed placement, and soil compaction (Cook et al. 1997; Davis 1989; Glen et al. 1989, 1990). These strategies have shown some efficacy in agricultural settings, but must be used in conjunction with a molluscicide (Cook et al. 1997; Glen et al. 1989). As the market for crops grown with little or reduced pesticide input continues to expand (Schder et al. 2004), there is increased demand for alternatives (Burrows of crop pl ants that are unattractive to snails and slugs. It is important to gain an understanding of host plant selection by herbivores (Mlgaard 1986) in order to be able to recommend ornamental and food crop plants that are resistant to mollusc attack. Snails and slugs have been reported to cause damage to legumes (Byers 2002), soybean (Hammond 1985; Speiser et al. 2001), corn (Byers and Calvin 1994; Speiser et al. 2001), wheat (Cook et al. 1996), strawberry (Prystupa et al. 1987), barley, oilseed rape, sugar beet potato, Brussels sprouts and other Brassicaceae, green asparagus, Florida, and some o f these are considered to be serious agricultural pests (Klassen et al. 2002; Rawlings et al. 2007).

PAGE 46

46 The goal of this study was to generate an acceptability index to determine which species of plants commonly grown in Florida would most likely be consumed by each of four species of terrestrial molluscs commonly found in Florida, or potentially found here. This was achieved through a series of choice and nochoice tests, which are traditionally conducted to test for host plant selectivity in terrestrial gast ropods In choice tests, Richardson and Whittaker (1982) noted that the degree of separation of plants based on acceptability indices depends heavily on the choice of the reference /control mate rial. Hence, in this experiment, lettuce will be used as the primary reference plant and cabbage used as the reference plant for a subsample of the plants tested to determine whether the plants would be classified similarly for each reference plant. Mater ials and Methods Molluscs and Plants Two invasive, established snails [ Bradybaena similaris (Bradybaenidae) and Zachrysia provisoria (Pleurodontidae)] were used in this study. Both species were collected from Homestead, Florida. Also, two species of slugs were included, Deroceras laeve and Deroceras reticulatum (Agriolimacide). The native species D. laeve was collected in Gainesville, Florida and D. reticulatum, a potentially invasive slug that is not established in Florida, but which has been intercepted on multiple occasions (Stange et al. 1999), was collected in Rockland, Maine. Field collected, adult s of each species were used to determine food acceptability of agronomic and ornamental crop plants, as juveniles usually are more sensitive to toxicants than adults (Speiser et al. 1992). This was done in an effort to minimize variability that may be induced by agedependent sensitivity to plant defense compounds. Between trials, the s lug s were maintained at a

PAGE 47

47 constant temperature of 21C and with a 12h dark and light period (LD: 12/12 h). The mollusc species were fed gypsy month diet (BioServ, Frenchtown, NJ), prior to, and between, studies. A total of 37 plant species in 28 families were evaluated as possible host plants for each of the four mollusc speci es. Ornamental and food crop plants that are of economic importance and commonly grown in Florida, U.S.A. were selected for evaluation in this study. Palatability Tests Choice Test: In the laboratory, a single adult specimen was placed in a cylindrical, transparent plastic container (18.5 cm diam. x 7.5 cm high) that had been lined with a single moistened coffee filter paper to maintain high humidity. Cylindrical containers were employed to minimize potential corner effect caused by a square container. Mollusc s were starved for 24 hours before the experiment to ensure t hey were hungry Mature, fresh nonsenescent leaves were provided at each test. Each test included a control plant [commercially available romaine lettuce (Lactuca sativa L. var. longifolia )] and a test plant. The leaves (lettuce and test) were cut into discs measuring approximately 4.15 cm using a number 15cork borer, weighed, and arranged such that three lettuce and three test discs were arranged equidistant in a circle, along the edges of each test chamber. This ensured that the molluscs had an equal chance of intercepting each individual leaf disc. For each trial, a total of twenty s lug s of each mollusc species were tested.

PAGE 48

48 In addition, a total of twenty control containers were set up s imilarly with three test plant discs and three control plant discs, except that the mollusc was not included. These control containers were included to account for any weight loss or gain by the plant material due to humidity within the containers. The tes t was initiated in the afternoon in an incubator (Percival, Boone, IA) set at 21C. The containers were examined the following morning (approximately 18 hours) to determine if at least 50% of either the test plant or control disc had been consumed, and continued until this level of consumption was attained. The leaf discs were weighed after each feeding event to determine the fresh weight consumed by the molluscs. The following acceptability index was used to evaluate the selective preference of each mollusc species: Acceptability Index: A.I. = Quantity of Both Plants Eaten (g) Quantity of Test Plant Eaten (g) Where, A.I.: 0 Test plant unacceptable A.I.: 0.01 0.07 Test plant slightly acceptable A.I.: 0.08 0.17 Test plant moderately acceptable A.I.: 0.18 0.5 Test plant highly acceptable

PAGE 49

49 The mean change in weight of leaf discs in the control containers was used to correct for fluctuations in the weight of leaf discs presented to the molluscs : A) The weight change in lettuce and test discs in the control containers were calculated by subtracting the initial weight of each disc from the final weight. Positive (>0) indicated weight gain, negative values (<0) indicated weight loss and a value of zero indicated no weight change. The mean weight change fo r the lettuce discs and the test plant in question were then calculated. B) Positive mean values for the leaf discs (lettuce and test plant) in the control containers were then subtracted from corresponding mean weight values in containers being evaluated. Conversely, negative mean control values were added to corresponding values in the test containers. The A.I. values were then calculated using the adjusted values. Nine plants previously presented to Zachrysia provisoria with lettuce as the control in the previous choice tests were reevaluated with cabbage as the control. Three plants were randomly selected from each of the three major A.I. groups (highly, moderately or slightly acceptable) for testing (Table 44). No choice Test: For those plants that were unacceptable to the molluscs (i.e., A.I.=0 ), a n additional no choice test was conducted For this test, 3 leaf discs of the test plant were presented alone (i.e., without lettuce ) under otherwise identical conditions to that of the choice test descri bed above. The goal of the nochoice test was to determine whether these plants would be consumed in the absence of an alternative palatable plant. After 24 hours the experiment was terminated as the molluscs species evaluated

PAGE 50

50 would have been starved for 48 hours (24hrs prior to experiment and 24hrs evaluated) and would have voided their guts. Statistical Analysis All statistical analyses were done using SAS statistical software (SAS Institute, Inc. 2008). The nonparametric Friedmans test (Lockwood III 1998) was used to determine if there were any significant differences between the A.I. of the test plants evaluated in the choice test. Acceptability indices were compared using a Tukeys post hoc multiple comparison test. Results In all four mollusc species evaluated, annuals were more preferred than perennials: Zachrysia provisoria ( F = 34.05; d f= 738; P < 0.00 0 1) ; The majority, 31 (84%) of the food and ornamental plants evaluated, were found to be acceptable to at least one of the four mollusc species when presented with lettuce as an option in the choice test (Table 41). Of the six unacceptable plants five were perennials and one was an ann ual: four were ornamentals, one was a fruit and the other was a vegetable (Table 41). Only t hree ( 8 %) plant speci es ( Petunia sp. Impatiens walleriana and Tagetes patula) of the 3 7 plants that were tested were found acceptable by all four mollusc species in the choice test. Zachrysia provisoria was the most polyphagous mollusc species evaluated in this experiment. T his snail consumed 31 (84%) of the test ed plants, 25 (68%) of these were only acceptable to this species among the four tested in the choice test (Table 42) Of the plants acceptable to Z. provisoria, ten test plants were highly acceptable, 11 were

PAGE 51

51 moderately acceptable, ten were slightly acceptable, and six were significantly ( F =12.78; df = 36, 684; P < 0.001) unacceptable (Table 42). Bradybaena similaris was more selective, consuming six of the plants presented in the choice test, with one plant being hi ghly acceptable ( Phaseolus vulgaris ) and significantly more so ( F = 25.24; df = 36, 684; P < 0.00 0 1) than the other four plants eaten, which were moderately acceptable and one slightly acceptable (Table 42). The Deroceras spp. also were rather selective in t heir feedings. Three of four test plants consumed by Deroceras laeve were highly acceptable and one was moderately acceptable (Table 42). Impatiens walleriana, Petunia sp. and Tagetes patula were highly acceptable; but the ir palatabili t y differed significantly ( F = 55.91; df = 36, 684; P <0.0001) from each other as well as from Cordyline terminalis the fourth plant which was moderately acceptable. Four of the f ive test plants consumed by Deroceras reticulatum were highly acceptable and one moderately acceptable (Table 42). Solenostemon sp. and Impatiens walleriana was found to be significantly more palatable ( F = 59.45; df = 36, 684; P <0.0001) when compared to Petunia sp. and Tagetes patula, and Cordyline terminalis The percent consumption values for noch oice tests are presented in Table 43. Zachrysia provisoria consumed six of the seven test plants presented under these conditions, with percent consumption ranging from <5 61%. Bradybaena similaris consumed 17 of the thirty one plants presented in the no choice tests and consumption ranged from <5 50%. Deroceras laeve consumed 19 of the 33 plants presented, and consumption ranged from <5 24%. Deroceras reticulatum consumed 16 of the 32 plants presented, and consumption ranged from <5 22% (Table 43 ). Stromanthe

PAGE 52

52 sanguinea var. tricolor was the only plant species not consumed by any of the molluscs tested i n either the choice or the nochoice tests (Table 42 and 43). Analysis of the data from the choice test conducted with cabbage as the c ontrol pl ant showed that there were significant ( F =31.78; df = 8, 72; P < 0.0001) differences in the acceptability values obtained for the list of plants tested (Table 4 4). The A.I. values and categories obtained from the choice tests where lettuce was used as the control plant were different when the experiment was repeated using cabbage as the control. Discussion All the test plants evaluated in this study are commonly grown in Florida and many are commercially produced. Thus, these tests provide broad assessmen t of damage potential by these molluscs in Florida. Note that several tropical perennial species are typically grown as annuals in the predominantly subtropical climate of Florida. The most broadly favored plants across the four mollusc species included i n this study ( Zachrysia provisoria, Bradybaena similaris Deroceras laeve and Deroceras reticulatum ) were Impatiens walleriana, Petunia sp. and Tagetes patula, which were e ither moderately or highly acceptable to each mollusc O nly one plant test ed ( Stroma nthe sanguinea var. tricolor ) was shown to be unacceptable to all four mollusc species. Zachrysia provisoria was the most polyphagous herbivore of the four mollusc species. Zachrysia provisoria consumed a large proportion (84%) of the plants provided to i t in the choice test, whereas Deroceras reticulatum consumed only five (1 4 %), Deroceras laeve 4 ( 11 %) and Bradybaena similaris 6 ( 16%) of the 37 plants presented (Table 42).

PAGE 53

53 Under the nochoice testing regime, Zachrysia provisoria consumed all the plants initially rejected in the choice test, with the exception of Stromanthe sanguinea var. tricolor (Marantaceae) (Table 43). Eleven plants were not consumed by the remaining three species ( Bradybaena similaris Deroceras laeve and D. reticulatum ) when each was presented in the nochoice test: Curcurbita moschata, Fragaria ananassa, Lycopersicon esculentum Musa sp., Canna generalis Lantana montevidensis Mirabilis jalapa, Odontonema strictum Pilea cadieri and Philodendron monster In addition, neither Dero ceras species consumed Citrus sp., Canna indica and Hypoestes phyllostachya. Whereas Deroceras reticulatum also did not consume Arachis hypogaea and Rudbeckia fulgida var. sullivantii, but Deroceras laeve did consume small portions of these plants. Bradybaena similaris did not consume three additional plant species in the nochoice test: Cordyline terminalis Hosta sp. var. pilgrim and Torenia asiatica No visible feeding damage was observed on the leaf discs of plants not consumed in the nochoice test. P ickett and Stephenson (1980), suggest that the ocular tentacles of molluscs may be involved in the detection of volatile compounds produced by potential food sources. It is possible that the plants not consumed are unacceptable because they produce volatil e compounds that are perceived as deterrents If so, these mollusc species could determine an acceptable host plant without exploratory grazing. Lactuca sativa ( Lettuce ) is a very attractive plant to slugs and snails as this plant has relative thin, soft leaves and produces only small quantities of secondary compounds (Frank et al. 2002). Pickett and Stephenson (1980) were able to demonstrate that Deroceras reticulatum is attracted to extracts of lettuce. It is likely that this is the case for the other mollusc species included in this study. When the highly

PAGE 54

54 acceptable lettuce was paired with the test plants, the resultant acceptability indices (A.I.) generated were always skewed towards the lettuce and the breadth of the mean A.I. generated for each plant species was very narrow as none of the test plants were consumed in greater quantity than the lettuce (Table 42). Richardson and Whittaker (1982) noted that the degree of separation of plants based on acceptability indices depends heavily on the choice o f the reference /control material. In these tests, the separation was much narrower than observed by Brooks et al. (2003). A second choice test was conducted to determine how the control plant affected host selection by using cabbage ( Brassica oleracea ) as the control plant. Cabbage was selected for use as the control plant because it was found to be highly acceptable in the previous choice test (Table 42). Cabbage proved to be a better plant at separating the prospective hosts into broader levels of acc eptability than lettuce. Mean A.I. ranged from 0.03 0.44 (Table 42), compared with 0.2 0.93 for cabbage (Table 44). The greater separation achieved in the second choice test was as a result of cabbage not being the most preferred plant among those of fered. C abbage produces a variety of glucosinolate compounds. A number of these compounds have been reported as feeding deterrents to slugs (Buschmann et al. 2005). This may provide the basis for greater separation of the test plants computed A.I. Althoug h c abbage has the advantage of providing better separation for use as the check plant in choice tests studies, lettuce has its advantages as well. Lettuce, in comparison to most plants is an attractive host, thus it serves well to identify species

PAGE 55

55 that would be especially at risk A ny plant consumed in the presence of the highly palatable host plant, lettuce would likely be consumed readily under field conditions. Generally, plants grown as annuals are at greater risk of herbivory by all four species, compared to plants grown as perennials. In areas where the snail Bradybaena similaris and the slugs Deroceras laeve and D. reticulatum occur with some regularity, it may be appropriate to incorporate the following plants into landscape or cropping systems ( as i t is highly unlikely for these plants to be as risk of herbivory by these three species ) : Curcurbita moschata, Fragaria ananassa, Lycopersicon esculentum Musa sp., Canna generalis Lantana montevidensis Mirabilis jalapa Odontonema strictum Pilea cadier i and Philodendron monster Stromanthe sanguinea var. tricolor was not acceptable to any of the mollusc species in the choice and nochoice tests and could be considered an appropriate plant for use in landscapes where any of the molluscs tested in the stu dy are of concern. Overall, considering both choice and nochoice studies, it is clear that nearly all the plants tested are at risk of herbivory by Zachrysia provisoria. This study has identified ornamental and food crop plants that can be useful to agr iculturalists and homeowners for use in landscape and cropping systems. If the intended planting area is infested with any of the molluscs species included in this study, the results presented herein should provide a guide as to the degree to which the pla nts would be at risk of herbivory.

PAGE 56

56 Table 41. List of test plants included in the palatability study. In the life cycle column: P perennial, A annual and P/A plant that can be grown as an annual or perennial depending on the climate. Plants Common name Family Life cycle Acceptable Fruits and vegetables Abelmoschus esculentus Okra Malvaceae P/A yes Arachis hypogaea Peanut Fabaceae A yes Brassica oleracea Cabbage Brassicaceae A yes Capsicum sp. Pepper Solanaceae P/A yes Carica papaya Papay a Caricaceae P yes Citrus sp. var pineapple Orange Rutaceae P yes Cucurbita moschata Squash Cucurbitaceae A no Fragaria ananassa Strawberry Rosaceae P/A no Lycopersicon esculentum Tomato Solanaceae P/A yes Musa sp. Banana Musaceae P yes Phaseolu s vulgaris Bean Fabaceae A yes Solanum melongena Eggplant Solanaceae P/A yes Spinacea oleracea Spinach Amaranthaceae A yes Ornamentals Begonia semperflorens Begonia Begoniaceae A yes Canna indica Canna lily Cannaceae P yes Canna generalis Canna lily var. Tropicana Gold Cannaceae P yes Catharanthus roseus Vinca Apocynaceae A yes Colocasia esculenta Variegated taro Araceae P yes Cordyline terminalis Red sister cordyline Agavaceae P yes Hosta sp. var pilgrim Hosta var. pilgrim Liliaceae P yes Hypoestes phyllostachya Pink splash Acanthaceae P yes Impatiens walleriana Double impatiens Balsaminaceae A yes Ipomoea batatas Sweet potato Convolvulaceae P yes Lantana montevidensis Lantana Verbenaceae P no Mirabilis jalapa 4 o'clock Nyctagi naceae P/A yes Odontonema strictum Firespike Acanthaceae P yes Petunia sp. Petunia Solanaceae P/A yes Philodendron monster Philodendron Araceae P yes Pilea cadieri Aluminum plant Urticaceae P yes Rhododendron sp. Azalea Ericaceae P no

PAGE 57

57 Table 41. Continued Plants Common name Family Life cycle Acceptable Rudbeckia fulgida var. sullivantii Black eyed Susan Asteraceae P no Solenostemon sp. Coleus Lamiaceae P/A yes Stromanthe sanguinea var. tricolor Stromanthe Marantaceae P no Tagetes patula Marig old French Asteraceae A yes Torenia asiatica Wishbone flower Scrophulariacea e A yes Tradescantia pallida Purple queen Commelinaceae A yes Zinnia elegans Zinnia Asteraceae A yes Acceptable column indicates plant that was consumed by at least one of t he four mollusc species tested in the choice test where lettuce was used as the control plant.

PAGE 58

58 Table 42. Choice test: comsumption (A.I.) of selected ornamental and food plants in Florida, by four pestiferous mollusc species. Plants Zachr ysia provisoria Bradybaena similaris Deroceras laeve Deroceras reticulatum Fruits and v egetables Abelmoschus esculentus 0.41 a 0.11 b 0 d 0 d Arachis hypogaea 0.14 defghijk 0 c 0 d 0 d Brassica oleracea 0.27 abcd 0 c 0 d 0 d Capsicum sp. 0.15 cdefghijk 0 c 0 d 0 d Carica papaya 0.17 bcdefghij 0 c 0 d 0 d Citrus sp. var pineapple 0.21 bcdefg 0 c 0 d 0 d Cucurbita moschata 0 k 0 c 0 d 0 d Fragaria ananassa 0 k 0 c 0 d 0 d Lycopersicon esculentum 0.3 abc 0 c 0 d 0 d Musa sp. 0.05 ghijk 0 c 0 d 0 d Phaseolus vulgaris 0.05 ghijk 0.21 a 0 d 0 d Solanum melongena 0.11 efghijk 0 c 0 d 0 d Spinacea oleracea 0.14 defghijk 0 c 0 d 0 d Ornamentals Begonia semperflorens 0.19 bcdefghi 0 c 0 d 0 d Canna indica 0.08 fghijk 0.02 c 0 d 0 d Canna generalis 0.11 efghijk 0 c 0 d 0 d Catharanthus roseus 0.19 bcdefghi 0 c 0 d 0 d Colocasia esculenta 0.04 ijk 0 c 0 d 0 d Cordyline terminalis 0.04 hijk 0 c 0.1 c 0.13 c Hosta sp. var pilgrim 0.07 fghijk 0 c 0 d 0 d Hypoestes phyllostachya 0.17 bcdefghij 0 c 0 d 0 d Impatiens walleriana 0.06 ghijk 0.09 b 0.4 a 0.42 a Ipomoea batatas 0.03 jk 0 c 0 d 0 d Lantana montevidensis 0 k 0 c 0 d 0 d Mirabilis jalapa 0.08 fghijk 0 c 0 d 0 d Odontonema strictum 0.19 bcdefghij 0 c 0 d 0 d Petunia s p. 0.25 abcde 0.14 b 0.27 b 0.24 b Philodendron monster 0.13 defhhijk 0 c 0 d 0 d Pilea cadieri 0.19 bcdefgh 0 c 0 d 0 d Rhododendron sp. 0 k 0 c 0 d 0 d Rudbeckia fulgida var. sullivantii 0 k 0 c 0 d 0 d Solenostemon sp. 0.04 hijk 0 c 0 d 0.44 a

PAGE 59

59 Ta ble 42. Continued Plants Zachrysia provisoria Bradybaena similaris Deroceras laeve Deroceras reticulatum Stromanthe sanguinea var. tricolor 0 k 0 c 0 d 0 d Tagetes patula 0.12 defhhijk 0.13 b 0.23 b 0.21 b Torenia asiatica 0.06 ghijk 0 c 0 d 0 d Trad escantia pallida 0.32 ab 0 c 0 d 0 d Zinnia elegans 0.22 bcdef 0 c 0 d 0 d Values shown are acceptability index (AI) of test plant consumed as compared to control (lettuce), where the test plant is: 0unacceptable; 0.010.07: slightly acceptable; 0.080 .17: moderately acceptable and 0.180.5: highly values followed by the same letter are not significantly different.

PAGE 60

60 Table 43. No Choice: percent consumpt ion of the foliage of ornamental, fruit and vegetable plants by four pestiferous mollusc species: Zachrysia provisoria Bradybaena similaris Deroceras laeve and D. reticulatum Plants accepted by molluscs in the choice test were not included in the nocho ice test. Plants Zachrysia provisoria Bradybaena similaris Deroceras laeve Deroceras reticulatum Fruits and vegetables Abelmoschus esculentus 6 5 Arachis hypogaea 20 8 0 Brassica oleracea <5 13 <5 Capsicum sp. <5 <5 <5 Carica papaya 1 2 10 <5 Citrus sp. "pineapple var." <5 0 0 Cucurbita moschata <5 0 0 0 Fragaria ananassa 58 0 0 0 Lycopersicon esculentum 30 0 0 0 Musa sp. 0 0 0 Phaseolus vugaris 38 22 Solanum melongena 33 <5 13 Spinacea oleracea <5 <5 <5 Orna mentals Begonia semperflorens 26 <5 <5 Canna generalis 0 0 0 Canna indica 0 0 Catharanthus roseus 40 21 20 Colocasia esculenta <5 <5 <5 Cordyline terminalis 0 Hosta sp. var pilgrim 0 15 <5 Hypoestes phyllostachya <5 0 0 I mpatiens walleriana Ipomoea batatas 31 24 22 Lantana montevidensis <5 0 0 0 Mirabilis jalapa 0 0 0 Odontonema strictum 0 0 0 Petunia sp. Philodendron monster 5 <5 <5 Pilea cadieri 0 0 0 Rhododendron sp. <5 0 0 0 Rudbecki a fulgida var. sullivantii 61 <5 <5 0

PAGE 61

61 Table 43. Continued Plants Zachrysia provisoria Bradybaena similaris Deroceras laeve Deroceras reticulatum Solenostemon sp. 25 <5 Stromanthe sanguinea var. tricolor 0 0 0 0 Tagetes patula Torenia as iatica 0 16 18 Tradescantia pallida <5 <5 <5 Zinnia elegans 50 14 11

PAGE 62

62 Table 44. Reassessment (cabbage used as control) of the acceptability index values (A.I.) for selected ornamental and food crops that are commonly grown in Fl orida, and consumed by Zachrysia provisoria. Plants A.I. Abelmoschus esculentus 0.86 Canna indica 0.30 Capsicum sp. 0.87 Musa sp. 0.20 Phaseolus vulgaris 0.60 Philodendron monster 0.52 Solanum melongena 0.92 Solenostemon sp 0.63 Tradescantia pallida 0.93 Values shown are derived from test plants consumed relative to cabbage (control), where the test plant is: 0 unacceptable; 0.10. 44: slightly acceptable; 0. 45 0. 55 : moderately acceptable and 0. 561 highly acceptable. Results of Tukey's test at are not significantly different.

PAGE 63

63 CHAPTER 5 NOTES ON THE LIFE HISTORY TRAITS AND FEEDING BEHAVIOR OF PHILOMYCUS CAROLINIANUS (PULMONATA: STYLOMMATOPHORA: PHILOMYCIDAE) Introduction The genus Philomycus Rafinesque (Family: Philomycidae) is comprised of aulacopod slugs that characteristically possess a large empty shell sac and a mantle that extends over the entire back (Burch 1962). Philomycus carolinianus represents one species within this g enus that is widely distributed across eastern North America ranging from Canada to Florida and west to Iowa and eastern Texas (Pilsbry 1948). Philomycus carolinianus typically inhabit the loosened bark of decaying logs in humid undisturbed coniferous and deciduous forests (Pilsbry 1948; South 1992). Decayed beech, birch, basswood and other hardwood trees are typically preferred (Ingram 1949). However, on occasion, slugs may be observed foraging in the open, and P. carolinianus and other species in the genu s Philomycus have been observed crawling down trees from as high as 20 feet (approx. 6 m) (Ingram 1949). Mature s lug s of this species may range from 75100 mm in length, with the sole of the foot undivided. The genital opening is located on the right side of the animals head, as typical of Philomycus, and the pneumosto me (breathing pore) is located anteriorly, on the right margin of the mantle (Pilsbry 1948). This slug has been documented to consume several genera of mushrooms (Ingram 1949) and in the l aboratory lettuce (Pilsbry 1948). This slug produces copious amount of slime even when not disturbed. Ingram (1949) considers Philomycus carolinianus an aggregating species

PAGE 64

64 The biology and life history traits of Philomycus carolinianus are poorly known. The goal of this study was to document the developmental and reproductive character s of P. carolinianus under laboratory conditions. Materials and Methods Life History Traits Growth experiment: Six clutches of eggs were obtained from Philomycus carolinianus field collected in Gainesville, FL In this experiment. O ne replicate constituted a single clutch of eggs, averaging 60 eggs per clutch (Ntotal = 356 eggs ). The clutches were incubated between moistened paper towels in a cylindrical plastic container (18.5 cm diam. x 7.5 cm high). Upon hatching juveniles were promptly removed from the incubation chamber and placed individually into vented cylindrical plastic containers (9.5 cm diam. X 4.5 cm high). The slugs were fed gypsy moth diet (Bi o Serv, Frenchtow n, NJ) from hatching to reproductive maturity (Time at first oviposition) A moistened paper towel was placed in each container to maintain humidity, and each juvenile was weighed every 3 days. The slugs were provided with fresh food and transferred to a c lean container once a week, observed for nine months and maintained at 21C 1C, with a photoperiod of 12:12 (L:D). T here was considerable variation in weight gain and the length of time to reproductive maturity among specimens within each replicate. T he slugs that remained alive for the duration of the experiment could be visually separated into three distinct groups. A hierarchical clustering analysis was used to sort the time to reproductive maturity data into three natural groups using the Statistic al Analysis System (SAS ), JMP V ersion 8 software (SAS Institute, Inc. 2008). The separation was conducted based on the degree of similarity (i.e., the shortest distance between values).

PAGE 65

65 Both sorting methods ( visua l and clustering analysis) were compare d and the results were similar except for a few individuals that occurred in the upper and lower quartiles. These individuals were placed into groups based on the results of the clustering analysis. A one way analysis of variance (ANOVA) was used to determ ine if there were any significant differences among the times to reproductive maturity for each group discerned by the clustering analysis. All statistical analyses were done using SAS software (SAS Institute, Inc. 2008). The growth curves for each group were compared using Tukeys post hoc multiple comparison test Fecundity experiment: O viposition date and clutch size of 124 clutches (Ntotal = 7266 eggs) collected from self fertilizing specimens in the growth experiment were recorded Each clutch was incubated in a separate cylindrical container (18.5 cm diam. x 7.5 cm high), between a folded, moistened paper towel. The eggs were held for 30 days in an incubator at 21C in the dark Eggs were considered to be not viable if no embryonic development was observed at the end of this period, but were included in pertinent calculations (e.g., percent hatch). Hatching date and the number of hatchlings per clutch were recorded. All hatchlings emerged successfully from the eggs within 58 hours. A second experim ent was conducted to evaluate changes in clutch size and hatching success in s uccessive clutches. Thirty adult s from the aforementioned growth experiment were randomly selected, and clutch size and hatching success determined for the first six successive clutches produced by each self fertilizing animal.

PAGE 66

66 A one way analysis of variance (ANOVA) was used to determine if there were any si gnificant differences among clutch sizes and hatch ing success in successive clutch es All statistical analyses were done usi ng SAS (SAS Institute, Inc. 2008). C lutch sizes and hatching success for successive clutch es were compared using Tukeys post hoc multiple comparison test. Influence of pairing on reproductive parameters: The objective of this experiment was to evaluate reproductive parameters of Philomycus carolinianus when reared as solitary or paired specimens, under laboratory conditions. Clutches laid by three field collected s lugs were used. Upon hatching 72 juveniles (F1 progeny) were randomly selected from thr ee clutches to make 36 pairs. It was assumed that all three field collected s l ugs deposited eggs, but it is not clear if the slugs mated prior to captivity. Each pair was placed into vented plastic containers (9.5 cm diam. X 4.5 cm high) lined with moistened paper towel and kept separate from other specimens for the duration of the experiment The slugs were fed gypsy moth diet (BioSe rv, Frenchtown, NJ) ad libitum, and held at 21C with 12:12 (L:D). The eggs from all clutches produced by the paired s lug s o ver ninemonth s were collected and incubated separately. T he following parameters were recorde d: number of eggs per clutch, percent hatching and incubation period (days) In addition, the preoviposition period measured in days and the time between ovipos ition event s of each of the paired slug s were also documented. These parameters were recorded for the pair, not individuals of the pair.

PAGE 67

67 The same reproductive parameters were obtained for 82 randomly selected s lug s selected from the same source but reared in isolation under otherwise identical conditions These parameters were then compared with those of the paired specimens. Two sample t tests were used to compare reproductive parameters between solitary and paired specimens using SAS (SAS Institute, Inc. 2008). Influence of temperature on egg development: The objective of this experiment was to estimate upper and lower temperature thresholds for Philomycus carolinianus e mbryonic development The eggs used in this experiment were collected from a labor atory colony of Philomycus carolinianus maintained at 21C 1C, with a photoperiod of 12:12 (L:D) and fed gypsy moth diet (BioServ, Frenchtown, NJ) ad libitum. Six constant temperatures (10, 14, 17, 21, 25 and 29C 1C) were evaluated using 30 clutches per temperature (1 clutch = 1 replication). The clutches were immediately removed from the adult rearing containers after deposition and incubated in a cylindrical plastic container s (15 cm diam. X 6.5 cm high) between sections of a folded, moistened paper towel and misted with tap water every 57 days to ensure that the eggs did not desiccate. S ix insect rearing chambers (Percival, Boone, IA) were used for incubation, each set at one of the experimental temperatures. P ercent hatching and the time to ha tching were documented. The percent of embryos that developed, as determined by visual inspection, but did not hatch during the course of the experiment were also recorded. The eggs were classified as developed if they met all of the following parameters: the

PAGE 68

68 unhatched embryo responded to tactile stimuli; the embryo was strongly pigmented; and the tentacles were obvious and dark colored. If at least one of these parameters was not met, the egg was considered dead, and was excluded from the pertinent calcul ations. The eggs evaluated in this experiment were incubated until eclosion or for a maximum of 180 days. A one way analysis of variance (ANOVA) was used to test for differences in the percent egg development, percent egg hatch and time to eclosion among t emperature treatments Differences between means were separated using Tukeys post hoc multiple comparison. All statistical analyses were done using SAS Evaluation of Artificial and Natural Diets for Short term R earing The objective of this experiment was to determine an appropriate natural or artificial food s for short term maintenance of laboratory colonies of Philomycus carolinianus The diets selected were those reported in previous studies for short term maintenance of slug colonies or were formulated for insects and mammals. Diets selected were: (1) r omaine lettuce ( Lactuca sativa var. longifolia) (Brooks et al. 2003; Cook et al. 2000; Egonmwan 1992; Pickett and Stephenson 1980; Speiser et al. 1992) (2) c arrot (Daucus carota L.) (Brooks et al. 2 003; Cook et al. 2000; Egonmwan 1992; Grewal et al. 2003; Pickett and Stephenson 1980; Tan and Grewal 2001) (3) rabbit pellets (Faberi et al. 2006; Ireland 1988) (4) w hite mushroom ( Agaricus bisporus ) (Ingram 1949; Keller and Snell 2002; Pilsbry 1948) ( 5) g ypsy moth diet (Bio Serv, Frenchtown, NJ) and (6) s pruce budworm diet (BioServ, Frenchtown, NJ)

PAGE 69

69 A seventh treatment group of unfed slugs were maintained under the same conditions except no food source was provided. This was included to evaluate the effect of a lack of a food source on the slug weight The slugs used in this experiment were selected from a laboratory colony reared on gypsy moth diet. There were 30 adult slugs per treatment. A ll were starved for 5 days prior to the experiment to voi d the gut. Slugs were determined to be adults based its production of at least one clutch of eggs prior to this experiment. Each slug was weighed and placed individually in a clear vented plastic container ( 9 .5 cm diam. X 7 .5 cm high) with moistened paper towel for increased humidity. The containers were arranged in a completely randomized design (7 rows and 30 columns) on a laboratory bench with an ambient temperature of 22C 1C. Slugs were weighed once every 7 days, at which time they were placed in a clean container with fresh food source. A one way analysis of variance (ANOVA) was used to test for significant differences among treatments for the following parameters: final weight of the slugs, number of clutches, and percent mortality. Differences between means were separated using a Tukeys post hoc multiple comparison test. All statistical analyses were done using SAS (SAS Institute, Inc. 2008). Food Preference Mushroom preference: The goal of this experiment was to determine the species or tax onomic groups of mushrooms that would most likely be consumed by Philomycus carolinianus in natural habitats. A total of 51 mushroom species in 18 families, and a single species of lichen, were collected from areas where natural populations of P.

PAGE 70

70 carolinia nus exist and were evaluated as possible host material. An acceptability index was established for each potential food source by comparing consumption of test mushrooms to a control. Adult s of P. carolinianus were used to conduct this experiment at a const ant temperature of 22C. Prior to the initiation of this experiment, the slugs were maintained on gypsy moth diet and had not been exposed to any other food source. S lug s were placed individually in a cylindrical, plastic container (9 cm diam. X 4.5 cm hi gh) with a single moistened paper towel to maintain humidity. Fresh mushrooms were provided for each test, with the commercially available white mushroom (Agaricus bisporus ) as the control. M ushrooms were cut into similar dimensions, weighed and then arranged so one piece each of a test and control mushroom were available. Ten replicates (one slug/container) were used per treatment. No slug was used to evaluate more than one species of test mushroom. F ive control containers were set up similarly with a pair of mushrooms pieces but without a mollusc to calculate weight loss or gain of each mushroom Test s w ere initiated in the afternoon, as slugs are more likely to feed during the evening and examined the following morning (approximately 18 hours) and every hour after until at least 50% of either the test or control had been consumed. The mushroom pieces (control and test) were then weighed. The following acceptability index was used to evaluate feeding preference: Acceptability Index: A.I. = Quantity of both mushrooms eaten (g) Quantity of test mushroom eaten (g) Where,

PAGE 71

71 A.I.: 0 Test mushroom unacceptable A.I.: 0.01 0.44 Test mushroom slightly acceptable A.I.: 0.45 0.55 Test mushroom moderately acceptable A.I.: 0.56 1.0 Test mushroom highly accept able The mean change in weight of each species of mushroom tested (test and control) in the control containers was used to correct for temporal change in the weight of the pieces of mushrooms presented to the molluscs. The procedure used is as follows: A) The weight change in white mushroom and test mushroom in the control containers was calculated by subtracting the initial weight from the final weight. B) Weight gain in the control containers were subtracted from corresponding mean weight values in cont ainers being evaluated. Conversely, weight loss in the control s were added to corresponding values in the test containers. The A.I. values were then calculated using the adjusted values. Suitability of green plants: The objective of this experiment was t o determine whether select plant species would be consumed by Philomycus carolinianus when their preferred host species was not available. No choice tests were conducted for a selected number of understory plant species that co occur with P. carolinianus (Table 53) Each slug was starved for 24 h prior to the initiation of the experiment and placed in a cylindrical, plastic container (9 cm diam. X 4.5 cm high), lined with a single moistened paper towel. A single intact leaf of the test

PAGE 72

72 plant was presented to each slug with no alternative food source for a period of 24 h. If no obvious feeding damage was observed after this period, the test plant was considered to be an unacceptable host. Statistical analysis: All statistical analyses were done using SAS statistical software (SAS Institute, Inc. 2008). The nonparametric Friedmans test (Lockwood III 1998) was used to determine if there were any significant differences among the A.I. of the mushrooms evaluated in the choice test. Acceptability indices wer e compared using Tukeys post hoc multiple comparison test. Results Life History Traits Growth experiment: Philomycus carolinianus gained weight along a sigmoid curve (Figure 51) although with dramatic variation. Time to reproductive maturity also varie d This time to achieve reproductive maturity was used as the basis for the separation of the slugs from each of the six clutches into four statistically significant groups ( F = 2081.93; df = 340; P < 0.0001) (Figure 52 and Figure 5 4). A total of 84 slug s (24%) from the total population adhered to the growth pattern characteristic of group 1. These slugs achieved reproductive maturity in 129 6 ( SD) days. The growth rate of group 1 was significantly faster than groups 2 and 3 ( F = 132.9; df = 262; P < 0.0001). The slugs in group 2 achieved reproductive maturity in 173 25 ( SD) days. The growth rate was slower than slugs in group 1, but faster than those in group 3. There were 79 slugs in group 2, representing 23% of the test population. Group 3 took 217 26 ( SD) days to attain reproductive maturity, and was represented by 102 slugs, or 30% of the test population. The mean weight of individuals in groups 1, 2, and 3 continued to increase after first oviposition was achieved;

PAGE 73

73 however, the rate of wei ght gain progressively declined thereafter (Figure 52). Summary data (minimum, maximum and mean) for groups 1, 2 and 3 are represented in Figure 53. Group four was comprised of specimens that exhibited marginal mean weight gain within the first ten days, then established a trend of progressive mean weight decline until death, never achieving sexual maturity (Figure 54). Seventy nine slugs exhibited this growth pattern, representing 23% of the test population. The mean longevity of individuals in group 4 was 64 days (range 12 64) and the highest percent mortality occurred between 30 and 40 days (Figure 55). There were 12 individuals (of 356) that were not included in the results as they died prematurely and could not be separated into a distinct group w ith any level of confidence. Longevity of P. carolinianus was not specifically addressed in this experiment, as the duration of evaluation was only nine months. However, upon termination of this experiment the slugs were reintroduced to the laboratory colony and were still alive and regularly producing eggs after 18 months of being alive. Fecundity e xperiment and i nfluence of pairing on reproduct ive parameters: T here was no difference in the length of the pre oviposition period (juvenile stage) between solitary and paired individuals (t = 0.98; df = 116; P = 0.3311) ( Table 51 ) T here also was no difference in the length of the incubation period for eggs produced by solitary versus paired slugs (t = 1.22; df = 205; P = 0.2251). Slugs reared in pairs produced significantly fewer eggs (t = 3.12; df = 228; P = 0.002) and had a greater

PAGE 74

74 number of days between each egg laying event, than solitary individuals (t = 4.15; df = 109; P < 0.0001). A higher proportion of eggs hatched for individuals reared as pairs th an as solitary individuals (t = 4.22; df = 228; P < 0.0001) (Table 51). There was a significant increase in the mean number of eggs produced per clutch over successive clutch es ( F = 9.7; df = 5; P <0.0001) (Figure 56) from A mean total of 5 8.8 6.4 eg gs were produced for the first clutch whereas 71 .1 11.1 eggs were produced for the sixth clutch. The first clutch produced the hig hest mean percent hatch at 74% ( F = 2.64; df = 5; P = 0.0249), but generally decreased thereafter with some fluctuation (Fig ure 56). Influence of temperature on egg development: Embryonic development within the egg capsules occurred across the entire temperature range (10 29C) tested Developmental success was higher at 10, 14, 17 and 21C, than at 25 and 29C (F = 10.72; df = 174; P < 0.0001) (Figure 57). H owever, the embryos that developed at 10 and 29C did not hatch ( Figure 5 9). Hatching success of clutches incubated at 14, 17 and 21C were not statistically distinguishable, nor were those incubated at 10, 25 and 29C (F = 25.76; df = 174; P < 0.0001) (Figure 59). Among clutches that hatched, incubation period decreased with increasing temperature, so that eggs incubated at 14C had the longest pre hatching period, whereas those held at 25C the shortest (F = 57.85; df = 174; P < 0.0001) (Figure 58). Evaluation of A rtificial and N atural D iets for S hort term R earing Initial weights of slugs in different treatments did not differ ( F = 0.49; df = 203; P = 0.8146) (Figure 510). The different food sources had both positive and negative effects

PAGE 75

75 on the weight of the slugs ( F = 92.44; df = 153; P < 0.0001) (Figure 510). U nfed slugs had the lowest final weight (1.95 g). Spruce budworm diet resulted in the highest final slug weight (6.19 g), although not surprisingly higher than slugs fed gypsy moth diet, or white mushroom. Individuals fed rabbit pellets lost the most weigh over the eight week period when compared to the other diets, and had a final mean weight of 3.31 g (Figure 5 10). Slugs laid eggs throughout the durat ion of the experiment, regardless of food source. F ood source significantly ( F = 31.47; df = 203; P < 0.0001) affect ed the number of clutches produced. Slugs fed white mushroom and rabbit pellets produced on average less than one clutch and were no different from unfed slugs (Figure 511). There was variation in mortality with diet, with slugs fed mushrooms and rabbit pellets having higher mortality than other groups, whereas those reared on the gypsy moth diet and carrot diet suffered no mortality ( F = 40 .81; df = 203; P < 0.0001) (Figure 5 12). Food Preference There was some degree of separation ( F = 1839.61; df = 49; P < 0.0001) in the acceptability indexes obtained for the mushrooms and the lichen evaluated in this experiment, ranging from highly ac ceptable to unacceptable (Table 52). None of the mushrooms and lichen evaluated was found to be unacceptable to Philomycus carolinianus There were 29 mushrooms and a lichen (60%) that were slightly acceptable, five mushrooms (10%) were moderately acceptable and 15 mushrooms (30%) were highly acceptable. There was no clear preference among the mushroom orders evaluated (Table 52).

PAGE 76

76 Philomycus carolinianus did not feed on any of the forest understory or weedy plant species evaluated (Table 53). Discussion Life History Traits Growth experiment: Philomycus carolinianus specimens held at 21C generally displayed incremental growth for the first 50 days followed by rapid mean weight gain, then gradual decline after approximately 200 days (Figure 51). There were large variation in rate of weight gain among slugs, both within and between clutches, that are not completely evident in the growth curve. According to Zotin (2007), generic growth curves derived from multiple specimens mask individual growth patterns Because of this variation, the time to reproductive maturity was selected as the basis for separating individuals displaying disparate rates of wei ght gain into distinct groups. Four distinct growth patterns were exhibited by P. carolinianus : under labor atory conditions groups 1, 2, and 3 had dissimilar rates of weight gain to reproductive maturity (Figure 52), whereas group 4 had progressive reduction in weight until death (Figure 53). There are several potential biological reasons for such variation i n growth rate including genetically predetermined staggering of growth to reduce sibling competition. T his could be a survival mechanism to increase the probability of survival for a cohort of eggs deposited under dissimilar environmental conditions. Hypot heses of adaptation are difficult to think of for the existence of group 4, as these represent developmental failures. I t is possible that group 4 eggs are the last to be deposited from each clutch and are endowed with fewer biological resources for surviv al. Documenting the order in which the eggs are oviposited for each clutch, then statistically determining whether

PAGE 77

77 there is a correlation between the order in oviposition and growth rate could test this hypothesis. There was a noticeable progressive chang e in the external pigmentation of Philomycus carolinianus as the slug s matured. The mantle and sole of juveniles were predominantly white or cream white and changed to pale orangebrown as the slug s matured. The orangebrown pigmentation appeared darker and intensified with age. Fecundity experiment and influence of pairing on reproductive parameters: This experiment showed that Philomycus carolinianus is capable of selfing or parthenogenesis, and that the reproductive output of selfed/parthenogenetic animal were comparable to paired ones These data further suggest that there could be some reproductive benefit derived from being reared as solitary individuals because potentially greater numbers of juveniles could be produced from solitary slugs, when com pared to paired slugs. Paired specimens did not oviposit as frequently as solitary slugs, nor did they produce clutch sizes as large as solitary specimens, although paired specimens produced clutches with a higher mean percent hatch. P. carolinianus was not previously known to be capable of reproducing by self fertilization or parthenogenesis (Anderson and McCracken 1986; McCracken and Selander 1980). Anderson and McCracken (1986) concluded that there was overwhelming evidence to suggest that P. carolinianus reproduced primarily by out crossing. They also noted that there was some lev el of genetic homogeneity with populations, which they attributed to sampling error and inbreeding. However, selfing or parthenogenesis will also lead to high genetic homogeneit y.

PAGE 78

78 It was not clear in this experiment whether paired specimens reproduced by reciprocal mating or cross fertilization. However, observations of paired specimens revealed elaborate mating rituals where both parties exhibited trail following, followed by t he apparent fusion of both head regions, as also described by Webb (1968). However, this anecdotal evidence for reciprocal mating was not confirmed by dissection. The first clutch of eggs produced by Philomycus carolinianus had the highest hatching succe ss, compared to subsequent clutches. T here was a trend of increasing number of eggs with successive clutches although the clutches were not statistically different after the third oviposition (Figure 56). Influence of temperature on egg development: Te mperature influences biological parameters of all living organisms. The geographic distribution of P. carolinianus ranges from temperate to subtropical regions of North America (Hubricht 1985; Pilsbry 1948). The results of this experiment suggest that embr yonic development (as here defined) of P. carolinianus eggs will occur across the entire temperature range tested, between 10 and 29C. However, percent development declined above 21C, with eggs held at 29C (Figure 57). Evaluation of hatching success i ndicated that the optimal temperature range for P. carolinianus was between 14 and 21C. Low hatching success occurred in eggs held at 25C, and eggs held at 10 and 29C did not hatch. The 29C constant temperature appeared to exceed the upper temperature development threshold for P. carolinianus eggs, as embryos that developed appeared to be viable only for a brief period and did not hatch. Similarly, although 57% of P. carolinianus eggs held at 10C exhibited

PAGE 79

79 embryonic development, none hatched after 100 days of observation. On the 120th day of observation, a total of 5 clutches (267 eggs) that were held at the 10C temperature were randomly selected and removed. These eggs were placed on a laboratory counter overnight (~ 18h) at an ambient temperature of approximately 22C. The next morning, all (100%) the eggs that had previously displayed embryonic development hatched. The mean proportion of juveniles that hatched d was calculated for all five clutches, yielding a mean value of 63%. None of the eggs that remained at the 10C treatment temperature hatched during the prescribed period of evaluation (180 d). After 180 days, the eggs were placed on the laboratory counter at the ambient temperature described previously and held for two weeks. The eggs rapidly deteriorated and there was no eclosion. This indicates that Philomycus carolinianus eggs can survive extended periods of low temperatures, suggesting that eggs could serve as an over wintering stage Supporting this, it is evident that embryonic development proceeds at low temperatures and viable embryos will persist for extended periods and emerge when environmental conditions improve. Although constant temperatures used in laboratory evaluations are not a feature of natural environments, the pre and post eclosion development trends of P. carolinianus observed in this experiment could form a useful basis on which to make inferences about similar phenomena in natural populations. Evaluation of A rtificial and N atural D iets for S hort term R earing Suitability of the diets evaluated varied greatly, with white mushroom, gypsy moth and spruce budworm diets producing the greatest slug weights, demonstrating superior suitability. Slugs reared on these three diets consistently laid eggs throughout t he

PAGE 80

80 duration of the experiment; however, mortality was very high for slugs fed white mushroom. T he quality of the white mushroom inside each container degraded rapidly and may have been responsible for the higher mortality. Post experiment, when the mushroom was replaced and rearing containers changed with greater frequency the mortality rate was substantially reduced. This suggests that low quality of white mushroom as a possible food source may be an artifact of the experiment. The gypsy moth and spruce budworm insect diets remained palatable to the slugs for the longest periods. This is most likely due to the antibiotic and antifungal compounds included in the formulations. Carrot and lettuce could be considered reasonable alternatives to white mushroom and gypsy moth and spruce budworm insect diets. W eight of individuals reared on carrot and lettuce was lower, but these slugs produced large numbers of clutches with low percent mortality. The least suitable diets was the rabbit pellets. There was substantial weight los s of slugs reared on this diet, and these animals produced only a single clutch and experienced high mortality. T his food source also was rapidly colonized by saprophytic fungi and bacteria. Upon the termination of this trial all slugs surviving from the unfed treatment were re integrated into the laboratory colony and maintained on gypsy moth diet. These slugs rapidly gained weight and in approximately three weeks had achieved mean weights comparable to specimens of similar age maintained continuously on gypsy moth diet. Also, these slugs produced clutches with similar frequency and of similar mean clutch size as slugs maintained in the colony. This would suggest that populations in natural

PAGE 81

81 habitats would most likely be able to endure prolonged adverse env ironmental conditions when food resources became limited and quickly recover when conditions improved, and this may be an important feature of P. carolinianus survival strategy. Food Preference The diet of Philomycus carolinianus has been reported to cons ist of a wide variety of mushrooms, with no noticeable species preference under natural conditions (Ingram 1949). The results of this experiment confirm that this species is, indeed, a fungus feeder. Although none of the mushroom species presented to this animal was rejected, it was clear that P. carolinianus displayed some preference. While there was no detectable variation in preference among mushroom orders evaluated, there was among genera and species. This variability may be explained by chemical or st ructural (e.g., texture) difference among mushroom species. Several species of understory plants were offered to P. carolinianus ; however, none were consumed, suggesting this species will not consume much green plant material in natural habitats. In summ ary, Philomycus carolinianus has demonstrated four distinct growth patterns under laboratory conditions. This slug has the ability to reproduce by both self fertilization and cross fertilization. Clutch sizes produced by this slug can be as large as 102 eg gs with percent hatch approaching 100%. E ggs can develop and hatch over a wide temperature range. P. carolinianus will consume any mushroom species and can survive for at least eight weeks without food, with full recovery when favorable conditions return. P. carolinianus is irrefutably a successful species, and the attributes

PAGE 82

82 investigated in this study may contribute to the ability of this species to successfully colonize much of North America.

PAGE 83

83 Table 51. Comparison of reproductive par ameters of Philomycus carolinianus reared in pairs and alone Reproductive parameters Density Degrees of freedom p value Solitary Pair Pre oviposition period (days) 183 2.7 a 189.7 8.4 a 116 0.3311 Time between oviposition events (days) 18.3 1.1 a 33.9 2.8 b 109 < 0.0001 Number of eggs per clutch 58.6 0.7 a 65.5 2.3 b 228 0.002 Percent hatch 64.7 3.8 a 84.6 2.6 b 228 < 0.0001 Incubation period (days) 21.9 0.1 a 21.6 0.2 a 205 0.2251 Data are mean (SE) for parameters listed. M eans in rows followed by the same l etter do not differ based on the twosample t

PAGE 84

84 Table 52. Choice test evaluation of select mushroom species commonly found in Florida by Philomycus carolinianus for acceptability as food source. Order Family Species A.I. Mean A.I. Agaricales Agaricaceae Agaricus bisporus 0.42 a Agaricus blazei 0.3 op Amanitaceae Amanita komarekensis 0.16 uv Amanita phalloides 0.43 kl Amanita rubescens 0.87 c Amanita sp. 0.23 rs Amanita vaginata 0.13 v Amanita verna 0.25 r Amanita virosa 0.43 kl Auriculariaceae Auricularia sp. 0.14 v Lepiotaceae Chlorophyllum molybdites 0.62 e Leucoagaricus sp. 0.19 tu Leucocoprinus luteus 0.2 st Marasmiaceae Lentinula edodes 0.56 gh Pluteac eae Pluteus sp. 0.41 l Strophariaceae Naematoloma sp. 0.22 rst Tricholomataceae Armillaria mellea 0.93 b Armillaria tabescens 0.45 k Lepista sp. 0.94 b Collybia iocephala 0.57 fg Macrocybe titans 0.33 no Clavariaceae 0.35 mn Phallales Phallaceae Clathrus columnatus 0.06 w 0.06 b Lecanorales Cladoniaceae Cladina evansii 0.04 w 0.04 b Boletales Strobilomycetaceae Tylopilus felleus 0.15 v 0.46 a Tylopilus rhoadsiae 0.04 w Xerocomaceae Phylloporus boletinoides 0.99 a Sc lerodermataceae Scleroderma sp. 0.53 hi Suillaceae Suillus cothurnatus 0.6 ef Boletaceae Boletus edulis 0.05 w

PAGE 85

85 Table 52. Continued Order Family Species A.I. Mean A.I. Boletus granulosiceps 0.29 pq Boletus luridiceps 0.99 a Boletus oli veisporus 0.92 b Boletus ornatipes 0.57 fg Boletus rubellus 0.42 kl Boletus underwoodii 0.33 no Leccinum albellum 0.14 v Cantharellales Hydnaceae Hydnum sp. 0.13 v 0.47 a Cantharellaceae Cantharellus cibarius 0.82 d Polyporales Ganode rmataceae Ganoderma applanatum 0.51 ij 0.47 a Ganoderma lucidum 0.55 gh Ganoderma sp. 0.26 qr Polyporaceae Lentinus crinitus 0.37 m Lentinus sp. 0.83 d Panus rudis 0.49 j Trametes sp. 0.44 kl Tyromyces sp. 0.32 nop Pleurotaceae Pleurotus ostreatus 0.42 kl Russulales Russulaceae Lactarius hygrophoroides 0.63 e 0.56 a Lactarius luteolus 0.25 r Russula emetica 0.8 d Values shown are acceptability index (A.I.) of test mushrooms consumed as compared to the control (white m ushroom ). V alues within each column with the same letters are not significant different ( Tukey's

PAGE 86

86 Table 53. Plants used to conduct a nochoice test: none were consumed. Weedy plants Understory plants Monocotyledons Monocotyledons Commelina diffusa Panicum dichotomiflorum Cyperus brevifolius Microstegium vimineum Cyperus globulosus Digitaria ciliaris Cyperus rotundatus Andropogon virginicus Digitaria sanguinalis Eleusine indica Dicotyledons Dicotyledons Alternanthera p ungens Lespedeza striata Bidens alba Callicarpa americana Drymaria cordata Vitis sp. (Muscadine) Ambrosia artemisiifolia Smilax bona nox Eupatorium capillifolium Smilax rotundifolia Wedelia trilobata Smilax glauca Dichondra carolinensis Diospyros sp. Chamaesyce hirta Galium aparine Phyllanthus urinaria Desmodium tortuosum Portulaca amilis Hedyotis corymbosa Portulaca oleracea Rubus cuneifolius Richardia brasiliensis Acalypha sp. Hydrocotyle sp. Nephrolepis sp. Arachis glabrata

PAGE 87

87 0 1 2 3 4 5 6 7 0 50 100 150 200 250 300 Time (days) Mean slug weight (g) Figu re 5 1. Mean ( SD) weight of 356 Philomycus carolinianus slugs reared on gypsy moth diet (BioServ, Frenchtown, NJ) from hatchlings to reproductive maturity at 21 C

PAGE 88

88 0 1 2 3 4 5 6 7 0 50 100 150 200 250 300 350 Time (days) Mean slug weight (g) Group 1 Group 2 Group 3 c b a Figure 52. Mean weight ( SE) slugs in three of four cohorts exhibited by Ph ilomycus carolinianus individuals reared on synthetic gypsy moth diet from egg eclosion to sexual maturity at 21C. Horizontal line denotes mean weight at first oviposition ( reproductive maturity). Curves followed by the same letter are not significantly diff erent from each other ( Tukeys test ).

PAGE 89

89 0 25 50 75 100 125 150 175 200 225 250 275 300 Group 1 Group 2 Group 3 Days after hatching Mean time to reproductive maturity (days) 0 10 20 30 40 50 60 70 95 115 135 155 175 195 215 235 255 275 Frequency of Occurence a b c Figure 53. Mean time to reproductive maturity of slugs exhibiting three of four growths patterns displayed by Philomycus carolinianus slugs reared on synthetic gypsy moth diet from eggeclosion to sexual maturity at 21C. Box plots in dicate the mean, minimum, maximum, upper and lower quartiles of each group. Curves indicate the time to maturity of individuals in each group and the corresponding frequency. Box plots followed by the same letter are not Tukeys test).

PAGE 90

90 0.004 0.005 0.006 0.007 0.008 0.009 0.01 0.011 0 10 20 30 40 50 60 70 Time (days) Mean slug weight (g) Figure 54. Mean weight of Philomycus carolinianus slugs that in the four th growth pattern, reared on gypsy moth diet (BioServ, Frenchtown, NJ) from hatchlings until death at 21C. This growth pattern is characterized by progressive mean weight decline. Specimens following this growth pattern never achieved sexual maturity.

PAGE 91

91 Figure 55. Temporal trend in survivorship of the 79 Philomycus carolinianus slugs that exhibited the fourth growth pattern when held at 21C a nd reared on gypsy moth diet (BioServ, Frenchtown, NJ).

PAGE 92

92 Figure 56. Mean percent hatch and mean clutch size for the first six consecutive clutches produced by Philomycus carolinianus slugs held at 21C when reared on gypsy moth diet (BioServ, Frenchtown, NJ). Graphs followed by the same case letter s are not si gnificantly different ( Tukeys test ).

PAGE 93

93 Figure 57. Mean ( SE) percent successful embryonic development of Philomycus carolinianus eggs held at six constant temperatures. Bars with same letter are

PAGE 94

94 Figure 58. Mean ( SE) days to juvenile eclosion of Philomycus carolinianus eggs held at six constant temperatures. Bars with the same letter label are not

PAGE 95

95 Figure 59. Mean ( SE) percent hatch of Philomycus carolinianus eggs held at six constant temperatures. Bars with the same letter label are not significantly

PAGE 96

96 Figure 510. Mean ( SE) weight of Philomycus carolinianus slugs reared on seven test di ets for eight week s. Solid bars: initial, h ollow bars : final weights. W eights with the same case letters are not si gnificantly different ( Tukeys test 0.05).

PAGE 97

97 Figure 511. Mean ( SE) number of clutches produced in eight weeks by Philomycus carolinianus Bars with the same letters are not si gnificantly different ( Tukeys test ).

PAGE 98

98 Figure 512. Mean ( SE) percent mortality of adult slugs of Philomycus carolinianus when reared on seven test diets for eight weeks. Bars with the same letters are not signific antly different (Tukeys test 0.05).

PAGE 99

99 CHAPTER 6 PRELIMINARY FINDINGS ON THE EVISION OF THE GENUS PHILOMYCUS (PULMONATA: STYLOMMA TOPHORA: PHILOMYCIDA E) Introduction Philomycus type genus of the Philomycidae, are large slugs native to eastern North Am erica. Like other Philomycidae they share the following characteristics: a mantle that extends over the dorsal surface of the animal, a foot with an undivided sole, a large empty shell sac (Burch 1962), and a penis that lacks an epiphallus (Pilsbry 1948). All species of Philomycus have a large calcareous stimulating organ, a synapomorphy which defines the genus. Members of this genus feed on fungi and forage at night or during wet weather (Ingram 1949) and are frequently observed ascending or descending trees (South 1992). During dry weather they aestivate on or under loose tree bark or decaying trees. Species of Philomycus are defined largely by mantle color pattern. The shell, a rich source of taxonomic characters, cannot be used for shell less slugs. Other traditional characters like genital anatomy as well as radula and jaw morphology are described for only two species of Philomycus: P. togatus ( as P. bisdosus and P. batchi ) and P. venustus ( Branson 1968; Fairbanks 1989) making comparisons across species impossible. In fact, most species are known only from their original descriptions and no formal revision or synthesis of the group has been attempted. Therefore, no evaluation of the variation of mantle color pattern within species is possible, and thi s characters efficacy for species diagnosis remains poorly explored.

PAGE 100

100 In order to evaluate mantle pattern variation as a means of species delineation, i ndependent characters are needed to provide support for such categorization. A combination of external (mantle pattern) and internal (genital and jaw) morphological characters has been used to separate the species in other stylommatophora genera. Chichester and Getz (1968) not ed that the use of genitalic characters for specific level diagnosis was reliable in almost all described terrestrial gastropod species. In this portion of the study, phylogeneti c analyses and morphological (external and genitalic) characters of the species of Philomycus are used to conduct a complete revision of the group. As noted above, much of the prior taxonomy of this group was based on mantle color patterns, which can be quite variable within species and even populations. Genitalic, jaw, and radula characters as well as DNA sequence data will be used to evaluate mantle pattern var iation as a justifiable means of separating the species in this genus. Materials and Method s Species Definition Species boundaries are most effectively explored when species are sympatric, as then individuals of different forms have the opportunity to in terbreed. Absence of significant gene flow between two forms in sympatry then provides strong evidence that these forms represent biological species. Absence of gene flow can be demonstrated when two independent morphological and/or genetic characters (suc h as mtDNA sequences and mantle color pattern) covary, so that each form has a unique combination of character states in these two characters. Similarly, demonstrated absence of gene flow between allopatric

PAGE 101

101 forms implies differentiation, but does not test for reproductive isolation as allopatric populations do not have the physical proximity to test for interbreeding. Such populations nevertheless fit the phylogenetic species concept. To test differentiation among forms and populations, mtDNA was sequenced, and color and anatomical characters determined for each slug. Specimen Collection and Preparation Collection. S pecimens were collected from across each species documented range, including their type localities. An albino Philomycus sp. collected from the Fakahatchee Strand Preserve, Copeland, Florida was also included. S pecimens were drowned in water and fixed in 75% ethanol in the field; however, a few were preserved in 95% ethanol. They were then labeled and deposited under unique catalog numbers at the Florida Museum of Natural History, University of Florida, Gainesville ( UF ). Preserved material from the Field Museum of Natural History, Chicago (FMNH) was also evaluated. Preparation. The collected specimens were photographed (alive and preserved) prior to being dissected under a dissecting microscope. It should be noted that mantle patterns are retained in preserved specimens. All adult specimens were scored except those that had deteriorated internally, totaling 24 Philomycus and 2 Megapallifera (P hilomycidae outgroup). The hermaphroditic reproductive systems were dissected from the specimens under a dissecting microscope, and photographed before being examined for distinguishing characters Buccal masses and jaws were dissected and jaws photogr aphed, then tissue removed by soaking in household bleach (sodium hypochlorite solution). The jaws and radulae exposed by this digestion

PAGE 102

102 were then rinsed in a series of distilled water baths to remove bleach crystals. Cleaned jaws and radulae were photographed using a field emission scanning electron microscope. Morphological Characters Thirty four characters were evaluated for each specimen (Table 61). Character states were select ed based on published work or by observations of preserved material. Anatom ical traits from the reproductive system, jaw, radula and external color pattern were included. G eographic distribution was documented based on checked and verified specimens in UF and FMNH collections (Table 62). Adult Reproductive System Characters 1. Ovotestis color 0=cream; 1=gray Pale colored ovotestis were considered cream, regardless of whether they were off white or cream. Ovotestis with other colors (ranging from a pale gray to slate gray) were coded as gray. 2. Ovotestis. 0 =multilobed and c ompact; 1= multilobed and loose. The ovotestis of Philomycus appears multi lobed but forms a single unit. The ovotestis of Megapallifera is multilobed, but each lobe hangs loosely and does not cluster together to form a single unit. 3. Length of hermaphroditic duct. 0 = 5 10mm; 1 = 1015mm; 2 =>15mm. This was measured from the obvious origin of the tube at the junction with the ovotestis, to that of the common duct (albumen gland). 4. Length of free oviduct. 0 = 3 5mm; 1 =>5mm. 5. Maximum diameter of free ovi duct. 0 = 0.1 0.5mm; 1 = 0.5 1.3mm

PAGE 103

103 6. Bursa copulatrix diameter. 0 = 0 3mm; 1 = 3.1 6mm This was measured across its widest part. 7. Bursa copulatrix duct length. 0 = 5 10mm; 1= 1115mm; 2 = 1620mm; 3=>21mm The bursa copulatrix duct length was measured from orig in of the tube at the base of the inflated distal end to the origin of the dart sac. 8. Maximum diameter of bursa copulatrix duct. 0 = 0.5 0.9mm; 1 =>1mm. 9. Dart sac as large as or larger than widest part of penis. 0 = no; 1 = yes 1 0. Dart sac. 0 = absent; 1 = present Philomycus is the only genus of Philomycidae that posses a dart sac. This structure can be found at the junction of the free oviduct and the bursa copulatrix duct. 11. Dart sac maximum diameter. 0 = 0 2.5mm; 1 = 2.6 4.5mm; 2 =>4.6mm 12. Atrium. 0 = short; 1 = long. The atrium was considered short if it was < 10mm. 13. Vas deferens of uniform thickness. 0 = no; 1 = yes 14. Vas deferens length. 0 = 1520mm; 1 = 21 30mm; 2 = 31 39mm; 3 =>40mm 15. Vas deferens maximum diameter. 0 = 1 5mm; 2 =>5mm 16. Vas deferens loops around penis. 0 = no; 1= yes In P. venustus the vas deferens typically encircles the distal portion of the penis as seen in Fairbanks (1989) Figure 6.

PAGE 104

104 17. Penial sheath as long as penis. 0 = no; 1= yes 18. Penial sheath uniform thickness. 0 = no; 1 = yes 19. Penis shape. 0 =curved; 1 =straight. When not everted, t he penis of Philomycus is typically re curved onto the atrium giving the organ a c shaped appearance (curved). The penis of Megapallifera is cylindrical and elongated (straight). 20. Pro ximal region of penis larger (wider) than distal portion. 0 = no; 1= yes 21. Proportional length of penial sheath vs. length of penis. 0 = 1/3 length of penis; 1= 1/2 length of penis; 2= 3/4 full length of penis This ratio gives an estimation of the length of t he penial sheath in relation to the length of the penis. Dart Characters 22. Dart present in dart sac. 0 = no; 1= yes 23. Dart shape. 0 = sigmoid (Figure 6 11A) ; 1 = slightly curved (Figure 6 11C, D) ; 2 = strongly curved (Figure 6 11B, E) ; 3 = absent 24. Dart d istal ly 0 = closed ; 1=open. 25. Dart proximal opening. 0 = slit; 1 = narrow; 2= wide; 3= absent The opening of the dart is variable in shape (Figure 6 11A) The opening of P. carolinianus is always slit like. The openings described as narrow were either obstructed or small and irregularly shaped, never slit like. Openings described as wide are often unobstructed, open and obviously flared.

PAGE 105

105 26. Dart proximal end. 0 = ringed and thick (Figure 6 11A) ; 1 = ringed and thin (Figure 6 11B) ; 2 = not ringed (Figure 6 11D). Jaw Characters 27. Jaw pleated/ribbed. 0 = no; 1= yes The jaws of Philomycus are never ribbed (Figure 612). There may be faint striations on the jaws but not deep grooves or folds (pleats) as in Megapallifera Tentacle Character 28. Tentacle color. 0 = fles h colored; 1= soot colored. The tentacles of the albino color variant of P. carolinianus are fleshcolored (Figure 64). The tentacles of this species are of similar color to the mantle of the animal, unlike other species in the genus that have a soot color ed tentacle (Figure 6 4). Mantle Characters 29. Mantle peach colored. 0 = no; 1= yes The peachcolored mantle may also be described as fleshcolored, but never white (Figure 64). 30. Chevron stripes. 0 = absent; 1= present The oblique stripes on the mantl e of Philomycus have been termed chevrons ( chevron in appearancewhere the arms extend anteriorly from the center ) in the literature, maintained for consistency here. 31. Two rows of black spots. 0 = absent; 1= present The two rows of black spots here refer to the two rows of black spots on the mantle that saddle the dark central band, typical of the traditional P. carolinianus

PAGE 106

106 32. Double row of black spots extends 2/3 length of mantle. 0 =absent ; 1 =present. As figured in P. sellatus described by Hubricht ( 1972) fig. 1de. 33. Dark transverse band across back. 0 = no; 1 = yes As figured in P. sellatus described by Hubricht ( 1972) fig. 1d e. 34. Anterior margin of dark transverse band cream colored. 0 = no; 1 = yes As figured in P. sellatus described by Hubricht ( 1972) fig. 1d e. Morphological Phylogenetic Analysis The character matrix of 34 characters was converted to a nexus file using Mes quite (Maddison and Maddison 2011) M aximum parsimony (MP) analysis was conducted using PAUP version 4.0b10 (Phylogeneti c Analysis U sing Parsimony) (Swofford 2002) with 10000 bootstrap replicates : Heuristic search with 10 random addition sequence ( total of 1364 trees retained), TBR ( tree bisectionreconnection ) with 100 random additions, character optimization criteria set as accelerated transformation (ACCTRAN) topological constraints were not enforced, zerolength branches were not collapsed. All characters were unordered and equally weight ed. For the most parsimonious trees obtained, a strict and a 50% majority rule co nsensus were constructed An unconstrained topology was chosen as Philomycus is monophyletic. Megapallifera mutabilis (Philomycidae) was used as the outgroup. Isolation of DNA, Amplification by PCR and Sequencing Sixtyfour specimens were sequenced (Table 6 3): 36 Philomycus 12 Pallifera (Philomycidae) 12 Megapallifera (Philomycidae) 1 Incilaria

PAGE 107

107 (Philomycidae) 1 Meghimatium (Philomycidae) and 2 Limax (Limacidae) (Figure 6 1). Specimens from several genera in Philomycidae were used to test whether Philom ycus is monophyletic. DNA was extracted from foot tissue using the DNAzol (Molecular Research Center, Inc. Chomczynski et al. 1997) extraction protocol of Meyer (2003) The CO1 mitochondrial gene region of interest was amplified using the Folmer et al (1994) primers LCO 1490 (5 3) (forward) TGTAA AACGACGGCCAGTGGTCAACAAATCATAAAGATATTGG, and HCO 2198 (5 3) (reverse) CAGGAAAGCTATGACTAAACTTCAGGGTGACCAAAAAATCA. The polymerase chain reaction was carried out in 25.5 L volumes inclusive of 1 L templat e Each PCR reaction contained 10.4 L ddH2O, 2.5 L 10X PCR buffer, 3.0 L MgCl2 solution (25 mM stock) 2.5 L dNTPs (10 mM stock) 1.0 L of each primer (HCO and LCO (10 M stock) ), 4.0 L BSA and 0.1 L Taq (5 Units/ L stock) After an i nitial denaturat ion at 95C for 2.5 minutes, t he reaction was run for 41 cycles under the following conditions: 94C for 40 sec (denaturation), then 42C for 40 sec (annealing), and 72C for 60 sec (extension). The final product was then held at 72 C for 3 minutes, then a t 4 10C until retrieval. The PCR prod ucts were electrophoresed o n a 1% agarose gel and visualized with ethidium bromide staining. S uccessfully amplified PCR products were sequenced by Barcode of Life Data systems (BOLD, http://www.barcodinglife.org Ratnasingham and Hebert 2007), using either onehalf or onequarter DyeDeoxyTerminator protocols (Perkins Elmer). The products

PAGE 108

108 were cleaned using either Centri Sep Spin Columns (Princeton Separation) or ethanol prec ipitation following the manufacturers instructions. Cleaned products were run on an ABI Prism 377 sequencer. Specimen data, images trace files and resulting sequences are available in the project folder Barcoding Philomycids in BOLD. S equences were ali gned and edited for phylogenetic analyses using BioEdit (Biological sequence alignment editor, Ibis Biosciences, Carlsbad, CA). Molecular Phylogenetic Analysis Bayesian Analysis. Bayesian phylogenetic analysis was performed using Mr. Bayes (version 3.1.2, Huelsenbeck and Ronquist 2001; Ronquist and Huelsenbeck 2003), with the following parameters: f lat priors, four Markov chains (three heatedset at default ) were run for 3.3 million generations, sampling trees every 100 generations, and allowing the analys is to reach stationarity. Stationarity was determined by plotting the log likelihood scores against the generation time in the using Tracer (v1.41). The first 100,000 generations (1,000 trees) were excluded as the burnin phase. After the removal of the burn in samples, a majority rule consensus tree with posterior probability support values was generated. Values greater than 90% were considered strong support. Limax maximus was set as the outgroup. Maximum likelihood analysis. Maximum likelihood analysis w as performed using PAUP version 4.0 (Swofford 2002), with a bootstrap analysis (Felsenstein 1985) using 1000 replicates with heuristic search, tree bisectionreconnection branchswapping algorithm, MulTrees option in effect and 100 random additions.

PAGE 109

109 Neigh borjoining Analysis A phylogenetic tree was also constructed using the neighbor joining (NJ) method in PAUP version 4.0 (Swafford 2002). The degree of support for internal branches was assessed by bootstrapping (Felsenstein 1985) with 1000 replicates usin g the default settings. Modeltest. The best model fit for the maximum likelihood and Bayesian analyses was evaluated using the Akaike information criterion (AIC) (Akaike 1974), as implemented in ModelTest version 3.7 (ModelTest, Provo, UT)(Posada and Crandall 1998). A Transversional (TVM + I+ G) model was selected, with proportion of invariable site (I) = 0.4510 and gamma distribution of variable sites Results Mo rphological Phylogenetic Analysis Maximum Parsimony Analysis. The MP analysis was unconstrained, equally weighted and the morphological data yielded 1364 equally parsimonious trees of 87 steps. The strict consensus tree with consistency index (CI) of 0.4713 and a homoplasy index (HI) of 0. 5287 for informative characters (31 of 34) and values of CI= 0. 4651 and HI= 0. 5349 for uninformative characters. The retention index (RI) was 0.7107 and the rescaled consistency index (RC) 0.3349. The tree was rooted using Megapallifera mutabilis The tree topology generated from the morphological data was not strongly supported; however, it had similar topology to that of the molecular data, hence the morphological characters were mapped onto the molecular tree for greater resolution (Figure 64 to 68).

PAGE 110

110 Molecular Phylogenetic Analysis The amplified product of 654 bp was readily aligned as it lacked indels The Bayesian analysis conducted for the mitochondrial (CO1) data reached stationarity prior to 100,000 generations but the first 1,000 trees were excluded as the burnin phase (sample points prior to stationarity). The log likelihood score was 8494.3885. The tree generated for the CO1 data were completely resolved with high posterior probability scores for most nodes (Figure 61). The neighbor joining method yielded a tree with similar topology as the ML and Bayesian analyses (Figur e 62). The CO1 support values generated from each analysis were high: posterior probability values > 90% and bootstrap values > 65% (Table 63). Mitochondrial Clades The phylogenetic analyses provided strong support for five reciprocally monophyletic clades. All five clades can also be recognized morphologically, thus they meet the criteria of phylogenetic species. Below is a list of these species and the morphological characters that are unique to each. 1. carolinianus two rows of black spots straddle the central line that runs spans the entire length of the mantle or completely peachcolored. Large dart sac with a dart that is sigmoid shaped. 2. flexuolaris dart sac smaller than distal end of penis. 3. sellatus proximal end of dart ringed and thin, double r ow of black spots extends 2/3 the length of the mantle, dark transverse band across the back with a cream colored anterior margin.

PAGE 111

111 4. togatus free oviduct 15mm long, and dart strongly curved with distal opening obstructed or closed. 5. venustus vas defere ns loops around penis. Discussion Separating species of Philomycus based on mantle pattern variation alone has been challenging. The results of this study indicate that there are five species of Philomycus all of which demonstrate high levels of interspec ific and even more intraspecific variation in mantle pattern. Identification based solely on mantle pattern variation is not diagnostic for all species. Instead, a combination of morphological and reproductive characters must be used. The Bayesian, maximum likelihood (ML), neighbor joining (NJ) and m aximum p arsimony (MP) analyses indicated similar assignment of individuals to the five species here recognized. There was strong support for these groupings in the molecular analyses, but less so in the morphological analysis, although there is some morphological support for each. In an attempt to demonstrate the degree of mantle pattern variation within each species the unique morphological character for each species, and a photograph of the mantle for each specimen was mapped onto the NJ tree produced from the molecular data (Figures 6 4 to 6 8) Although pos terior probabilities often over exaggerate node support there was strong support for the molecular data (Figure 6 1 and 62) as the posterior probability v alue for each clade was greater than 0.9 and the bootstrap values mostly greater than 90%. The genetic clade recognized as P. carolinianus is supported by a single homoplasious morphological character: vas deferens of uniform thickness. This

PAGE 112

112 character state also occurs in the two clades P. flexuolaris and P. venustus P carolinianus can also be separated from these other species by the synapomorphic character: sigmoid shaped dart. P. carolinianus can further be separated into two geographic forms that dif fer in color pattern, but are not different in CO1 sequence. The northern morph has two rows of black spots that straddle the central dark stripe on the mantle with soot colored tentacles, whereas the southern morph has a pale or peachcolored with pale tentacles (Figure 6 4). Each morph can be separated by these synapomorphies, but it is unclear if gene flow is possible between morphs. The genetic clade recognized as the species P. flexuolaris is supported by the synapomorphy: dart sac smaller than widest part of the penis. The mantle pattern of P. flexuolaris is very variable. The chevron stripes may or may not be present and there maybe large blotches or fine flecking depending on the individual. It is clear that the mantle pattern cannot be used to reliably identify this species, therefore dissection and examination of the reproductive system should be done to identify this species (Figure 65). The third genetic clade, P. sellatus is readily differentiated from all other species by several synapomorphi es: proximal end of dart ringed and thin, double row of black spots extends 2/3 the length of the mantle, and the presence of a dark transverse band across the back with a cream colored anterior margin. This species is geographically restricted to the Cumberland Plateau of southeastern Tennessee and northeastern Alabama. This species, though distinct, is very similar to P. carolinianus (Figure 6 6).

PAGE 113

113 The fourth genetic clade corresponds to the morphological species P. togatus that can be identified by a com bination of the following homoplasious characters: free oviduct 15mm long, dart strongly curved, and the distal opening of the dart obstructed or closed. The mantle pattern of this clade is extremely variable. This variation is especially striking in the members collected for this study. T he mantle color/pattern varies from jet black, to brown to completely white, but all animals have soot colored tentacles. There are also individuals that have fine to abundant flecking and flecks can coalesce to form thre e rows of distinct narrow stripes This extreme mantle variation was the primary character and sometimes only character used by previous authors to identify this species. For proper identification, dissection and evaluation of the genitalia should be done (Figure 6 7) The fifth genetic clade corresponds to P. venustus defined by a single synapomorphy: vas deferens loops around penis. This character is unique to this species. However, the mantle pattern is variable, and this species is difficult to separate from P. flexuolaris based on the mantle pattern. The geographic range of these species, therefore dissection and examination of the penis and dart sac is necessary for reliable identification (Figure 68). Thus the genetic and morphological evidence s upports the existence of at least five named species in the genus Philomycus : P. carolinianus P. flexuolaris P. togatus, P. venustus and P. sellatus Each can only be reliably identified based on genitalic and genetic characters. T he albino specimens collected from southern Florida appears very similar to P. carolinianus and may only be color

PAGE 114

114 morphs of that species. However, this conclusion is tentative because the ranges of the two populations do not appear to overlap and there has been no independent t est of their ability to interbreed. Also, the mantle pattern differences might be evolving more rapidly than other characters. It is recommended that additional sampling and characterization be carried out for a more thorough revision of the genus. Designating neotypes for P. carolinianus and P. togatus would further stabilize the taxonomy of this group. There appear to be at least three undescribed species of Philomycus: species 1 ( 437739), species 2 ( 446552) and species 3 ( 447294 and 447223) The se species differ genetically from all other species and though similar in mantle color pattern to P. flexuolaris differ in that they have dart sacs that are as large or larger than the widest part of the penis. Additional samples should be collected to determine the range of variation within these species and as well as their geographic range. Taxonomic History of Philomycus Bosc ( 1802) described Limax carolinianus ; his illustrations indicated a slug that possessed a greatly expanded mantle that was ash colored, m ottled with three obscure bands and had two rows of black spots that straddled the central band, all traversing the dorsal surface of the animal. Rafinesque (1820) proposed Philomycus for four species of fungi feeding slugs ( P. quadrilus P. oxyurus P. fu scus and P. flexuolaris ). Rafinesque (1820) misinterpreted the greatly expanded mantle of the slugs to be the back of the animal, and contrasted the thus presumed absence of a mantle in Philomycus with the reduced mantle characteristic of Limax Frussac ( 1821) suggested that based on the

PAGE 115

115 appearance of the drawing provided by Bosc (1802: plate III, fig. 1), L. carolinianus should be included in Philomycus Gould (1841) described Limax togata, noting that this slug had an extensive mantle that covered the entire back, and suggested that this species may deserve new generic placement due to this morphological peculiarity. Gould also noted that L. togata could be related to L. carolinianus Bosc, 1802. Binney (1842; 1851) recognized that the extensive mantle of Limax carolinianus Bosc, 1802 and L. togata Gould, 1841 was atypical of Limax and proposed a new generic name, Tebennophorus, to encompass those slug species with an extensive mantle that covered the entire dorsal surface. Binney (1842) proposed that Philomycus be retained for species that lacked a mantle as described by Rafinesque (1820). After reviewing the literature, and available morphological and genitalic characters, Pilsbry (1890, 1891) suggested that Limax carolinianus Bosc, 1802, L. togata Gould, 1841, and Tebennophorus caroliniensis Binney, 1842 be placed in Philomycus Pilsbry (1948) also reevaluated the species in Philomycus based on external morphology, geographic distribution and novel genitalic characters and concluded that P. flexuolaris R afinesque, 1820 be relegated to a subspecies of P. carolinianus flexuolaris Based on extensive collections, Hubricht (1951) compared the variation in the mantle pattern and reproductive anatomy of Philomycus carolinianus flexuolaris and P. carolinianus a nd concluded that P. flexuolaris should be reelevated to specific rank. Comparison of the mantle patterns revealed that P.

PAGE 116

116 flexuolaris had a distinct oblique (chevron) color pattern, which is not present in P. carolinianus, and the spots characteristic of P. flexuolaris were much larger and ill defined when compared to those observed in P. carolinianus Hubricht (1951) also evaluated the genitalia and noted that in addition to the smaller size of the dart sac, as noted by Pilsbry (1948), the entire reproductive system of P. flexuolaris was smaller than that of P. carolinianus Hubricht (1951) also described a new subspecies, P. carolinianus collinus, differentiated from the coastal floodplain woods species P. carolinianus by lacking the two rows of black spots and being larger and browner and inha biting upland piedmont habitats This larger sub species also had a broad dorsal band and two narrower lateral bands with small spots scattered irregularly between them. Hubricht (1956) collected P. carolinianus t ogatus slugs from the Shenandoah National Park in Virginia and based on mantle coloration, synonymized his previously described subspecies ( P. carolinianus collinus Hubricht, 1951) with the recently identified P. carolinianus togatus In 1968, Hubricht elevated togatus to the species level without explanation. Subsequent to 1951, Hubricht described three species of Philomycus based solely on differences of the mantle pattern: Philomycus venustus Hubricht, 1953, P. virginicus Hubricht, 1953 and P. sellatus Hubricht, 1972. P. venustus and P. virginicus were said to be similar but were distinguishable by the fine flecking on the mantle of P. virginicus, lacking in P. venustus Philomycus sellatus was also diagnosed by a unique mantle pattern: a broad, dark co lored band that extends laterally across the anterodorsal portion of the mantle. Branson (1968) described

PAGE 117

117 two additional species: P. bisdosus and P. batchi collected in neighboring states and described based on differences in the mantle pattern, genitali c and jaw characters as well as their distribution. These were the first descriptions within this genus to include characters other than the mantle pattern variation. Branson (1968) note d that both species bear similarity in the mantle pattern with previously described species. J uveniles of P. bisdosus were similar to mature specimens of P. virginicus except they were darker brown and more spotted, and adults of P. virginicus were much darker and their color pattern extended to the ventral edge of the mantle. Branson (1968) also suggested that P. batchi was similar to P. flexuolaris ; however, P. batchi was nearly solid black and did not possess longitudinal stripes. As of 1972 there were eight recognized species of Philomycus : P. carolinianus Bosc 1802, P flexuolaris Rafinesque, 1820 and P. togatus ( Gould, 1841) P. venustus Hubricht, 1953, P. virginicus Hubricht, 1953, P. bisdosus Branson, 1968, P. batchi Branson, 1968 and P. sellatus Hubricht, 1972 (Turgeon et al. 1988). All eight were thought to be dis tinguishable on the basis of mantle pattern variations, and two by genitalic characters ( P. bisdosus and P. batchi ) Hubricht (1974) examined the morphological characters of type specimens of Bransons species and compared them to specimens that were collected previously (Hubricht 1953). Hubricht concluded that Philomycus venustus Hubricht, 1953 and P. bisdosus Branson, 1968 should be synonymized under the assumption that P. venustus was a very variable species and P. bisdosus was simply an extreme variant of P. venustus Hubricht (1974) also concluded that P.

PAGE 118

118 batchi was a melanistic variant of P. carolinianus and suggested that these species should also be synonymized. In a later review of the reproductive and morphological anatomy of Philomycus bisdosus a nd P. venustus, Fairbanks (1989) provided evidence that P. bisdosus was not a synonym of P. venustus and he resurrected it from synonymy based on the following characters: (1) the free oviduct of P. venustus was significantly longer than that of P. bisdosus, (2) P. venustus had transverse oblique bands that may manifest as solid lines or spots arranged linearly, whereas P. bisdosus had no transverse bands, (3) P. venustus was larger than P. bisdosus and (4) P. venustus had white foot margins, whereas P. bi sdosus had gray foot margins. Systematic Accounts Family Philomycidae Gray 1847 Identification key to the New World genera of Philomycidae 1. Dart sac with dart present (located at the base of the bursa copulatrix) ..................................................................................Philomycus Dart sac absent .................................2 2. Adult slug less than 40 mm long and 8 mm wide ...... Pallifera Adult slug greater than 40 mm long and 8 mm wide .....Megapallifera Genus Philomycus Rafinesque 1820 Limacella Blainville 1817; Cockerell 1890; not Brard 1815 Philomycus Rafinesque 1820 Tebennophorus Binney 1842

PAGE 119

119 Type species: Philomycus carolinianus Bosc 1802 Description: Mantle is greatly extended so that it covers the entire dorsal surface of the animal. The jaw is faintly striated, never ribbed. Centrals of the radula are unicuspid and laterals bear weak ectocones and no endocones. Initial marginal teeth may be bicuspid, but as you move towards the margin of the radula, they quickly become devoid of teeth, leaving small rectangular bases. The dart sac, located laterally on the vagina, and contains a calcified stimulator (dart) that may or may not be used during copulation. The vagina is often sh ort and may be indistinct in some species. The penis does not bear an epiphallus. There is also a gland that envelops the atrium, which may be pigmented. Distribution: Philomycus species are distributed throughout eastern North America. Philomycus carolin ianus (Bosc, 1802) Philomycus carolinianus (Bosc), Pilsbry, 1948, in part, LMNA, 2: 753, 754 fig. 404 a, b, c, d, e, g, and h. Philomycus caroliniensis F russac 1821, Tab. Syst. Ani m. Moll., Famille des Limaces, p p. 1415. Limacella elfortiana Blainville, 1825, Man. De Malac., p. 464.? Limacella lactiformis Blainville, 1817, Jour. De Phys., 85: 444, pl. 2, fig. v Cockerell, 1890, Ann. Mag. N.H. 6: 380; Nautilus, 5: 5., Pilsbry and Cockerell, 1899, Nautilus, 13: 24.? Limacella lactescens Ferussac, Histoire, pl. 7, fig. 1.? Material examined: United States of America. ARKANSAS. Desha County. 34.12900162, 91.09899902, 12 June 1980, UF 28397 (2 specimens). FLORIDA.

PAGE 120

120 Alachua County. 29.68829918, 82.37190247, February 2010, 50 m, UF 447268 (3 specimens); Collier County. 26.17000008, 81.34999847, 29 July 2004, UF 349468 (one specimen). 26.00799942, 81.41100311, 24 September 2010, 2 m, UF 445015 (8 specimens). 25.87599945, 81.23000336, 25 September 2010, 1 m, UF 445018 (3 specimens). Dade County. 25.56500053, 8 0.44200134, 28 September 2010, 2 m, UF 445045 (one specimen). ILLINOIS. Calhoun County. 39.06600189, 90.61000061, 12 July 1998, UF 284311 (one specimen). KENTUCKY. Clark County. 37.88690186, 84.24359894, 25 May 2011, 175 m, UF 447181 (one specimen). SOUT H CAROLINA. Berkeley County. 33.20750046, 79.46849823, 18 May 2011, 3 m, UF 447034 (one specimen). Description: Foot white. Mantle color off white to cream, and mottled with gray brown. Mottling coalesces to form three dark gray stripes that run anteroposteriorly. These black stripes fuse towards the tail of the animal, and become indistinct at the head region. In addition, there are two rows of black spots that straddle the central dark gray stripe. (Figure 64 ). Tentacles of this species are soot colore d except in the albino variant, in which case they are pale or fleshcolored. Jaw has slight median projection and there are numerous shallow horizontal striae along the entire jaw (Figure 6 1 3 ). There are a few faint vertical striae that are unequally spaced (~0.8 x 1.9 mm). Cent rals of the radula bear a single cusp that is of similar height to the laterals. The mesocone of the central is robust approximate 4/5 the width of the laterals, and the base of mesocone bears a pair of projections. The base of t he

PAGE 121

121 central is narrow proximally and becomes inflated distally. The lateral gradually transition into marginals, without any obvious distinction. Laterals are initially bicuspid, bearing only a large mesocone and a very small ectocone represented by a notch. The ectocone is approximate 2/3 the height of the mesocone, and becomes more prominent proximally The base of the lateral s are angular at the apex (Figure 61 2 ). The marginals are bicuspid but the ectocones gradually become obsolete, leaving unicuspid m arginals. The base of the last set of marginals are devoid of cusps, leaving rectangular bases. Reproductive system of this species was not described originally. Penis free from the atrium, and gradually tapers where it meets the retractor muscle. Vas defe rens long and does not loop around the penis. Dart sac large, and approximately 2/3 the size of the penis (Figure 610). Dart sac encloses a dart that is sigmoid shaped at the distal end and bears a thick, rough translucent band at the base. Ventral opening of the dart slit like (Figures 61 1 ). Distribution: This species has been reported to occur throughout eastern U.S. from the eastern regions of Kansas and southern Iowa, to the southern tips of Florida (Hubricht 1985). Records confirmed in this study fr om the following states: Arkansas, Florida, Illinois, Kentucky and South Carolina (Figure 613). Remarks: Since the description of this species, specific diagnosis has remained fairly consistent. This species is easily distinguishable by the central mantl e stripes, straddled by two rows of black spots and the absence of chevron markings. An albino morph of Philomycus was described by Blainville as Limacella lactiformis This same specimen was also the type of L. lactescens and

PAGE 122

122 L. elfortiana Subsequent to these descriptions, albino specimens have been reported from multiple locations, in mixed populations of individuals with typical pigmentation (Pilsbry 1948). Recently, pure populations of an albino morph was discovered in southern Florida. The albino morph can be separated from all other s by the absence of soot colored tentacles (tentacles retain the flesh color of the mantle). Also, this albino morph is restricted to Southern Florida and does not appear to overlap in geographic range with other color morp hs Analysis of genitalic and molecular characters suggest that the albino species recently discovered in southern Florida, may be a color variant of P. carolinianus (Figure 6 1 and 62) and its geographic range appears to be limited to southern Florida, U .S.A. (Figure 6 1 4 ). However, it is difficult to determine at this time whether this morph is simply a color variant that has become isolated from a larger population or a result of recent divergence. Original description of this species did not include the deposition of a type material by Bosc (1802). It is recommended that a neotype be established for this species to assist in stabilizing the genus. Philomycus flexuolaris Rafinesque, 1820 Philomycus carolinianus flexuolaris Rafinesque, Pilsbry, 1948, in part, LMNA 2: 756, 757 fig. 405 a, b, c, d, and e. Philomycus flexuolaris Rafinesque, Hubricht, 1951, Nautilus 65: 21. Philomycus virginicus Hubricht, 1953, Nautilus 66: 79. (New synonymy) Material examined: United States of America. GEORGIA. Union County. 34.84769821, 83.80010223, 3 June 2010, 870 m, UF 437711 (one specimen);

PAGE 123

123 White County. 34.71659851, 83.86660004, 6 June 2010, 900 m, UF 437659 (2 specimens). KENTUCKY. Letcher County. 37.07040024, 82.82309723, 25 May 2011, 790 m, UF 447163 (5 specimens): 37.06520081, 82.83360291, 25 May 2011, 790 m, UF 447167 (one specimen); 37.06520081, 82.83360291, 25 May 2011, 790 m, UF 447168 (one specimen). MAINE. Oxford County. 44.47399902, 70.8010025, 4 June 2008, 250 m, UF 447270 (one specimen). NEW YORK. Greene County. GPS coordinates unknown, 16 Sep. 2011, elevation unknown, UF 448785 (14 specimens). NORTH CAROLINA. Buncombe County. 35.79600143, 82.3690033, 25 May 2009, 1023 m, UF 434323 (3 specimens); Mitchell County. 36.09799957, 82.09500122, 21 Aug. 2004, 1480 m, UF 348135 (one specimen); Transylvania County. 35.11199951, 82.8239975, 8 May 2007, elevation unknown, UF 416432 (2 specimens). VIRGINIA. Dickenson County. 37.28680038, 82.30090332, 24 May 2011, 485 m, UF 447143 (2 specimens); Madison County. 19 July 1953, FMNH 294085 (paratype) (7 specimens); Washington County. 36.86330032, 81.9253006, 24 May 2011, 700 m, UF 447140 (one specimen). Description: Foot white. Mantle has three distinct stripes that run anteroposteriorly. L arge dark blotches coalesc e to form each stripe and are sometimes connected to each other by oblique lines. The oblique lines often make the (three) stripes appear to be flexuous (chevron in appearancewhere the arms extend anteriorly from the center ). The anteroposterior stripes rarely extend to the tip of the tail as distinct stripes. They often coalesce to form large blotches, or only the central stripe remains distinct. These stripes remain fairly distinct toward

PAGE 124

124 the head of the animals, except immediately in front of the pneum ostome. This slug species never has the two rows of black or brown spots or elongated blotches that saddle the central stripe as seen in P. carolinianus or P. venustus However, there may be small flecks on the mantle resembling those of P. togatus (Figure 6 7 ). Base color of mantle varies from cream to almost pale orange. Tentacles soot colored. Jaw has a slight median projection, with numerous shallow horizontal striae. There are a few faint vertical striae that are almost regularly spaced (Figure 6 13). (~0.8 x 1.6 mm) Centrals of the radula bear a single cusp and are of similar height to laterals. Mesocone robust and approximate 4/5 the width of the laterals. The b ase of the central tooth expands distally. The lateral gradually transition into marginals, without any obvious distinction. Laterals are bicuspid, bearing only a large mesocone and a very small ectocone represented by a notch and the ectocone is approximately 2/3 the height of the mesocone (Figure 61 2 ). Marginals are bicuspid but the ectocones gradually become obsolete, leaving unicuspid marginals. Base of last set of marginals are devoid of cusps, leaving rectangular bases. Penis short and robust, with distal end narrowing abruptly to form a tube as it approaches the penial retractor muscle. V as deferens does not loop around the penis (Figures 6 10). Dart sac very small (less than 1/3 the size of the penis) and possesses a short strongly curved dart (Figures 6 11).

PAGE 125

125 Distribution: This species is common throughout the Appalachian Mountains in Geo rgia, Kentucky, Maine, New York, North Carolina and Virginia (Figure 6 1 5 ). Remarks: Material has been collected from the type locality and dissected but not yet sequenced. Specimens with similar genital anatomy were found from Maine to Georgia with littl e variation in CO1 sequence. In addition to the chevron body markings, the dart sac of this species is characteristically much smaller than the penis. It is recommended that Philomycus virginicus be synonymized with P. flexuolaris. Observations of the chev ron markings on the mantle (Figure 69 ) and the greatly reduced dart sac of the reproductive system (Figure 610) of a paratype of P. virginicus (FMNH 294085) suggest that these two species are the same but confirmation awaits CO1 data The juveniles of this species are almost indistinguishable from that of P. togatus It is recommended that juvenile specimens be allowed to mature before making a diagnosis or molecular techniques be used for juvenile stages. Philomycus sellatus Hubricht, 1972 Philomycus carolinianus (Bosc), Pilsbry, 1948, in part, LMNA, 2: 753, 754 fig. 404 f (non carolinianus Bosc). Philomycus sellatus Hubricht, 1972, Nautilus 86: 17. Material examined: Type material: United States of America. Alabama. Jackson County. GPS coordinates unknown, date unknown, elevation unknown, FMNH 157322 (one specimen).

PAGE 126

126 Non type material: United States of America. ALABAMA. Jackson County. 34.97999954, 86.08499908, 3 June 2006, 512 m, UF 382966 (6 specimens); 34.97679901, 86.08039856, 26 May 2011, 540 m UF 447224 (7 specimens). Description: Foot white. Anterior margin of the mantle irregularly mottled, and just behind this is an area where the pigmentation is sparse. Posterior to this pale region (approximately 1/3 the length of the animal) is a dark colored, transverse band with uneven margins. On the dorsal posterior 2/3 of the mantle, there is a broad dorsal stripe, which is straddled by a series of elongated black spots. Narrow lateral bands traverse each side of the mantle, with mottling above and below. Lateral bands may be obscured if the animal is heavily mottled, and may form a single continuous coloration on the posterior 2/3 of the animal (Figure 6 6). Base color of mantle white to rust colored. Tentacles dark gray in color. Jaw has slight median projection There are numerous shallow horizontal striae along the entire length of the jaw (Figure 61 3 ). There are a few faint vertical striae that are unequally spaced. Penis robust, and tapers only slightly towards the penial retractor muscle. Vas deferens does not loop around the penis as in P. venustus Dart sac large and inflated (Figure 610) and the dart is slightly curved with a flared base (Figure 6 1 1 ). Distribution: This species was collected from the extreme northeastern region of Alabama (Figure 61 6 ), but also was reported from neighboring areas of Tennessee (Hubricht 1972).

PAGE 127

127 Remarks: Philomycus sellatus is a morphologically distinct species. It is easily recognized by the broad band across the upper 1/3 of the mantle. This band is pale on the anterior margins, and the central stripe terminates into it on the posterior margin. This species has a well defined distribution that is restricted to the Cumberland Plateau of southeastern Tennessee and northeastern Alabama (Hubricht, 1985). Phil omycus togatus Gould, 1841 Philomycus carolinianus (Bosc), Pilsbry, 1948, in part, LMNA, 2: 753, 754 fig. 405 f and g. Philomycus carolinianus collinus Hubricht 1951, The Nautilus 65: 2022. Philomycus carolinianus togatus (Gould) Hubricht 1956, The Nautil us, 70: 1516. Philomycus batchi Branson 1968, The Nautilus 81: 127. (New Synonymy) Philomycus bisdosus Branson 1968, The Nautilus 81: 127. (New Synonymy) Philomycus togatus (Gould) Hubricht 1974, Sterkiana 32: 16. Material examined: Type material (parat ype): United States of America. NORTH CAROLINA. Wilkes County. 24 September 1950, FMNH 293805 (A9966) (22 specimens). Non type material: United States of America. KENTUCKY. Clark County. 37.88690186, 84.24359894, 25 May 2011, 175 m, UF 447180 (one specimen); UF 447182 (2 specimens); MadisonClark County line, 16 June 1967, FMNH 155478 (holotype) (one specimen). MAINE. Oxford County. 37.28680038, -

PAGE 128

128 82.30090332, July 2009, 485 m, UF 447269 (2 specimens). VIRGINIA. Buchanan County. 23 July 1967, UMMZ 23065 (on e specimen). Dickenson County. 37.29589844, 82.30190277, 31 May 2010, 550 m, UF 437707 (2 specimens). 37.29589844, 82.30190277, 31 May 2010, 550 m, UF 437708 (one specimen). 37.28680038, 82.30090332, 24 May 2011, 485 m, UF 447144C (one specimen). 37.28680038, 82.30090332, 24 May 2011, 485 m, UF 447155 (3 specimens): 37.28680038, 82.30090332, 24 May 2011, 485 m, UF 447156 (one specimen). Grayson County. 36.7635994, 81.22399902, 23 May 2011, 1160 m, UF 447117 (9 specimens). Smyth County. 36.81669998, 81.4280014, 925 m, 24 May 2011, UF 447128 (3 specimens). Description: Foot white, but the posterior tip (ventral side) usually black or soot colored. Mantle base color off white to cream, and is usually covered in small spots that often coalesce to form t hree distinct stripes. The broad central stripe is often dark gray. Stripes are often overlain with minute black spots In some cases, these central spots may be absent altogether Lateral stripes may resemble the central stripe and occur high on the side of the mantle, but appear narrower and less organized. Stripes appear distinct towards the tail of the animal; however, they become disorganized as they approach the head of the animal, often diffusing to form minute flecks (Figure 67 ). Described above i s the typical color variant. Several color morphs of this species exist and range from unpigmented to completely brown to pitch black, with varying degrees of minute flecks, never large spots or blotches as in P. flexuolaris or P. venustus (Figure 6 7). Te ntacles soot colored in all variants.

PAGE 129

129 This species is e xtremely variable in appearance, even within single populations and may initially be confused with members of other species. The unpigmented morph of this species may be confused with the albino morph of P. carolinianus ; however, both can be separated by the soot colored tentacles of P. togatus The mantle pattern of this species though variable may be quite distinct depending on the morph. This species is the only species that has a brown body form t hat may or may not possess stripes The typical morph of this species has fine flecking, never blotches and does not have chevron stripes typical of P. flexuolaris Jaw strongly arched with a slight anterior projection, and weak striations There are a few faint vertical striae that are unequally spaced (Figure 61 3 ). (~0.7 x 1.9 mm) Centrals unicuspid, and of similar width to laterals and approximate 3/4 their height. Mesocone robust, and the base of central broader at the distal end. Laterals bear a s ingle large mesocone and a very reduced ectocone represented by a notch. Ectocone approximate 2/3 the height of the mesocone. However, the ectocone becomes progressively prominent lateral ly and the mesocone narrows (Figure 6 1 2 ). Base of lateral angular at the distal end. The laterals gradually transition into marginals, without any obvious distinction. Laterals bicuspid. Ectocones gradually become obsolete, in marginals progressively to the margin of the radula. Base of last set of marginals devoid of cusps, leaving only their rectangular bases.

PAGE 130

130 Penis enlarged basally, and retractor muscle is very narrow. Dart sac large, and vas deferens is long and tapers as it approaches the oviduct, but does not loop around penis (Figure 610 ). Dart short and strongly c urved with a thick open base (Figure 61 1 ). Distribution: The species evaluated in this portion of the study were collected or identified from the following states: Kentucky, Maine, North Carolina and Virginia (Figure 69). Remarks: Gould, in 1841, describ ed Philomycus togatus ( Limax togatus ), but did not deposit a type specimen. The lack of type material and Goulds brief description caused a great deal o f confusion for later authors. In 1951, Hubricht described a new subspecies of Philomycus ( P. carolin ianus collinus) from Pittsylvania County, Virginia. In the description of P. carolinianus collinus Hubricht (1951) noted that this subspecies was illustrated in Figure 405f, page 757 of Pilsbry (1948), Land Mollusca of North America, vol. II, under the n ame P. carolinianus The new subspecies occurred in the piedmont of eastern states and differed from coastal plain P. carolinianus in mantle color pattern. After collecting more material between his populations on the central east coast and further north, Hubricht (1956; 1968) ultimately synonymized his species ( P. carolinianus collinus ) with P. togatus. The morphotype of P. togatus described by Hubricht (1951) as P. carolinianus collinus was subsequently redescribed as P. bisdosus by Branson (1968) along with another species from Kentucky, P. batchi Branson (1968) distinguished his two species based on mantle color pattern and genitalic

PAGE 131

131 differences. Branson documented that both species could be separated on the basis that of the small dart sac of P. bisd osus and large dart sac of P. batchi Also, the penis of P. bisdosus was slender, but that of P. batchi was inflated at the point of attachment to the vas deferens and also where it contacted the vagina area. However, his P. batchi specimens appeared to be immature and most differences could be attributed to ontogenetic changes. New material, including adult s, were collected from each species type locality by the author as a part of this study. Genitalia of adult P. batchi did not differ in the characters described by Branson (1968); therefore, I conclude that P. batchi as described by Branson (1968) was a juvenile of P. bisdosus Examination of the paratype of P. carolinianus collinus holotype of P. batchi and specimens of P. bisdosus revealed that alt hough the mantle pattern was variable, some characters were consistent for all three: (1) for those forms that were pigmented, the mantle pattern remained fairly consistent in that they all had characteristic small black spots or flecks distributed over the entire mantle (Figure 6 2, GJ) and (2) the penis of all three species are similar in having a large dart sac that contains a medium size (34 mm) dart that is strongly curved but not sigmoid, and has a narrow, rough translucent base (Figure 610). Also, the penis is attached to the atrium by connective tissue, not free as in other species. The combination of these characters suggest that all three species are the same as the previously described P. togatus Additionally, genetic material isolated from t he collected specimens provide strong support for this conclusion (Figure 61 ). Although the mantle pattern of P.

PAGE 132

132 togatus is highly variable, the molecular characters analyzed in this portion of the study using the CO1 gene suggest that all color morphs ar e sympatric, and d isplay polymorphism within and between populations throughout its geographic range(Figure 67 ). Gould (1841) did not designate a holotype for P hilomycus togatus (formerly L imax t o gata), hence t o stabilize the taxonomy, a neotype should b e chosen preferably from Massachusetts where Goulds material was collected. Philomycus venustus Hubricht, 1953 Philomycus venustus Hubricht, 1953, Nautilus 66: 79. Material examined: United States of America. VIRGINIA. Grayson County. 36.7635994, 81 .22399902, 23 May 2011, 1160, UF 447116 (5 specimens); Smyth County. 36.68719864, 81.54570007, 24 May 2011, 1105 m, UF 447138 (4 specimens). Description: Foot white. Mantle may have three distinct stripes or large dark blotches. For those specimens that have stripes, the central gray black stripe has dark, irregular margins that may consist of distinct black blotches or large spots. Lateral stripes may be connected to the central stripe by faint oblique (chevron where the arms extend anteriorly from the center ) lines. These three stripes extend towards the tip of the tail, and remain distinct. These stripes also remain distinct towards the head of the animal but merge, forming minute flecks just prior to the margin of the mantle (Figure 6 8). Tentacles so ot colored. Jaw has n umerous shallow horizontal striae an obvious median projection. There are also a few faint vertical striae that a re unequally spaced (Figure 613) (~0.9 x 2 mm)

PAGE 133

133 Centrals of radula bear a single cusp and approximately 4/5 the height of the laterals. Mesocone of central robust approximate 4/5 the width of the laterals. Base of central mesocone bears a pair of projections. Basal plate of the central tooth narrow, but widens towards the anterior margins. First laterals appear tricuspid, but ever so slightly, bearing weak endocones and ectocones Ectocone and endocone represented by faint notches, and are approximate 2/3 the height of the mesocone. However, on the other laterals, the endocone disappears, the ectocone becomes more prominent a nd the mesocone narrows and elongates. Base of lateral angular at the apex. Laterals bicuspid but the ectocones become obsolete on last couple of marginals (leaving unicuspid marginals). Base of the last set of marginals are typically devoid of cusps, leav i ng rectangular bases (Figure 6 12). Penis of this species is robust, and tapers as it approaches the penial retractor muscle. Retractor muscle thick, and penial sheath extends to the junction of the penis and vas deferens. A unique character for members o f this species: vas deferens loops around the penis at least twice before lying free. Dart sac large or larger than proximal width of penis (Figure 610 ). Dart slightly curved and opening either may be flared but is often obstructed or narrow (Figure 6 1 1 ) Distribution: Samples of this species were collected in Virginia (Figure 61 8 ). Remarks: There appears to be at least two distinguishing genitalic characters for this species. The penis is tubular, not curved as in the other

PAGE 134

134 species, and the vas deferens always coils around the penis before lying free. This species is often confused with P. flexuolaris as individuals of both species may possess chevron markings, but both species can be distinguished based on their unique genitalic characters Philomycu s spp. Material examined: United States of America. ALABAMA. Jackson County. 34.97679901, 86.08039856, 26 May 2011, 540 m, UF 447223 (1 specimen); 34.97999954, 86.08499908, 03 June 2006, 512 m, UF 447294. NORTH CAROLINA. Swain County 35.70600128 83.2 5469971 24 May 2011, 1105 m, UF 447138 (1 specimen). TENNESSEE. Blount County. 35.61199951, 83.93399811, 02 June 2010, 260 m, UF 437739 (1 specimen). The resultant information (morphological and molecular) for the following specimens suggest that they may be new species: 437739, 446552, 447294 and 447223. They all have dart sacs that are as large or larger than the widest part of the penis, but otherwise bear internal morphological similarities to Philomycus flexuolaris Additional specimens need to be collected and evaluated to determine the nature of these specimens. Identification key to Philomycus spp. 1. Oblique (chevron) lines present on the lateral side of the mantle ...2 Oblique (chevron) lines absent ......3 2. Dart sa c smaller than proximal portion of penis ... flexuolaris Dart sac as large or larger than proximal portion of the penis .. venustus 3. Two rows of distinct black spots/elongated blotches run anteroposteriorly .....4

PAGE 135

135 Two rows of black spots or elongated blotches absent 5 4. Broad dark band across the anterior 1/3 (shoulder) of the mantle .... sellatus Broad band absent .. carolinianus 5. Small irregular spots or flecks cover the entire mantle .... togatus Large irregular spots or blotches cover the entire mantle or spots absent and no obvious body markings. Mantle pale or completely black ...6 6. Large irregular spots or blotches cover the entire mantle venustus No obvious body markings or mantle pale or completely black ...7 7. Length of the bursa copulatrix duct less than 11 cm in length, tentacles soot colored ........... togatus Length of bursa copulatrix duct more than 11 cm in length, tentacles pale/ flesh colored ............................................................................................ carolinianus

PAGE 136

136 Table 61. Morphological character m atrix Species Catalogue number Character score M. mutabilis M. mutabilis P. carolinianus P. carolinianus P. carolinianus P. carolinianus P. carolinianus P. flexuolaris P. flexuolaris P. flexuolaris P. flexuolaris P. flexuolaris P. flexuolaris P. flexuolaris P. flexuolaris P. flexuolaris P. flexuolaris P. sellatus P. sellatus P. togatus P. to gatus P. togatus P. togatus P. togatus P. venustus P. venustus 447272 447183 28397 445015 445018 447034 447268 416432 437659 437711 447143 447163 447168 447270 437739 446552 447223A 447224 382966B 447128 447155 447156 447269 447144C 447116 447138 11111001 00011000111020 ---11010000 1111100100011000111020----11010000 0000100011100100000121000001001000 00110011101 --00001 1000000100000 0 010111101100000121000000100000 1001100111101200000121000001001000 1020101111101100000121000001001000 0 ----2 01001200000121212100010000 1001112101001200000121212101010000 1021113101001100000121212101010000 0021111101100200000121212101010000 1020011001000000000121212101010000 1011101001100000000121212101010000 00110100100---0000121212101010000 0020113111101100100121----01001000 1010111111100300100121212101010000 0010111111210200100121101001011000 1011111111200300000121102201001111 000100111100300000121102201001111 1010101111100100000121212001000000 1021101111100100000121212001000000 1021112111100100000121212001000000 1021111111100100000121212001000000 1020101111100100000121212001000000 0010110111101001100121101001011000 10211101 1 01 -11001 1101001010000

PAGE 137

137 Table 62. Geographic locality of m aterial sequenced and /or dissected. Catalogue no. Location C oordinates UF Latitude Longitude Pallifera costaricensis 1 445027 Cartago, Costa Rica 9.835000038 83.55999756 2 445011 Puntarenas, Costa Rica 8.696000099 83.20400238 3 318787 Dade County, Florida 25.52400017 80.46800232 4 445023 Cartago, Costa Rica 9.83500003 8 83.55999756 Pallifera secreta 5 447133 Smyth County, Virginia 36.68719864 81.54570007 6 447129 Smyth County, Virginia 36.81669998 81.4280014 7 447081 Page County, Virginia 38.61569977 78.3506012 8 447087 Madison County, Virginia 38.60589981 78.36640167 9 447080 Page County, Virginia 38.61569977 78.3506012 Pallifera varia 10 447097 Madison County, Virginia 38.54510117 78.40019989 11 447079 Madison County, Virginia 38.53379822 78.42079926 12 447124 Grayson County, Virginia 36.7635994 81.22399902 Philomycus carolinianus 13 028397 Desha County, Arkansas 14 447181 Clark County, Kentucky 37.88690186 84.24359894 15 447268 Alachua County, Florida 29.68829918 82.37190247 16 447034 Berkeley County, South Carolina 33.20750046 7 9.46849823 17 445018 Collier County, Florida 25.87599945 81.23000336 18 445045 Dade County, Florida 25.56500053 80.44200134 19 445015 Collier County, Florida 26.00799942 81.41100311 20 349468 Collier County, Florida 26.17000008 81.34999847 21 3494 68 Collier County, Florida Philomycus togatus

PAGE 138

138 Table 62. Continued 22 447180 Clark County, Kentucky 37.88690186 84.24359894 23 447182 Clark County, Kentucky 37.88690186 84.24359894 24 447155 Dicke nson County, Virginia 37.28680038 82.3009033 2 25 447144 Dicke nson County, Virginia 37.28680038 82.30090332 26 437708 Dicke nson County, Virginia 37.29589844 82.30190277 27 437707 Dicke nson County, Virginia 37.29589844 82.30190277 28 447156 Dicke nson County, Virginia 37.28680038 82.30090332 2 9 447128 Smyth County, Virginia 36.81669998 81.4280014 30 447269 Oxford County, Maine 44.31000137 70.65000153 Philomycus sellatus 31 382966 Jackson County, Alabama 34.97999954 86.08499908 32 447224 Jackson County, Alabama 34.97679901 86.08039856 Philomycus sp. 33 447223 Jackson County, Alabama 34.97679901 86.08039856 34 447294 Jackson County, Alabama 34.97999954 86.08499908 Philomycus flexuolaris 35 348135 Mitchell County, North Carolina 36.09799957 82.09500122 36 447270 Oxford Cou nty, Maine 44.47399902 70.8010025 37 447167 Letcher County, Kentucky 37.06520081 82.83360291 38 447168 Letcher County, Kentucky 37.06520081 82.83360291 39 447163 Letcher County, Kentucky 37.07040024 82.82309723 40 434323 Buncombe County, North Caro lina 35.79600143 82.3690033 41 447143 Dicke nson County, Virginia 37.28680038 82.30090332 42 437737 Dicke nson County, Virginia 37.29600143 82.30200195 43 437659 White County, Georgia 34.71659851 83.86660004 44 416432 Transylvania County, North Carol ina 35.11199951 82.8239975 45 437711 Union County, Georgia Philomycus sp. 46 446552 Swain County, North Carolina 35.70600128 83.25469971

PAGE 139

139 Table 62. Continued 47 437739 Blount County, Tennessee 35.61199951 83.93399811 Philomycus venustus 48 447138 Smyth County, Virginia 36.68719864 81.54570007 49 447116C Grayson County, Virginia 36.7635994 81.22399902 Megapallifera mutabilis 50 447272 Oxford County, Maine 44.47399902 70.8010025 51 447293 Jackson County, Alabama 34.97679901 86. 08039856 52 447183 Clark County, Kentucky 37.88690186 84.24359894 53 437698 White County, Tennessee 35.92290115 85.39849854 54 447062 Carteret County, North Carolina 34.74779892 77.02189636 Megapallifera wetherbyi 55 437770 Bell County, Kentucky 36.73799896 83.72000122 56 447148 Dicke nson County, Virginia 37.28680038 82.30090332 57 437738 Dicke nson County, Virginia 58 382931 Jackson County, Alabama 34.98899841 86.10099792 59 447225 Jackson County, Alabama 34.97679901 86.08039856 60 4 47245 Marion County, Tennessee 35.14820099 85.78070068 Megapallifera ragsdalei 61 328353 Cleburne County, Arkansas 35.51399994 92.99900055 Incilaria sp. 62 415475 Mascarene Islands, Reunion 21.33600044 55.70600128 Meghimatium sp. 63 3520 04 Okinawa, Japan 26.83699989 128.2720032 Limax maximus 64 447073 Hyde County, North Carolina 65 444829 Flathead County, Montana FMNH Philomycus togatus

PAGE 140

140 Table 62. Continued 66 155478 Madison County, Kentucky 67 293805 Wilkes County, North Carolina Philomycus flexuolaris 68 294085 Madison County, Virginia Unable to determine satisfactory coordinates

PAGE 141

141 Table 63. Species support. Clade CO1: Branch support value/Monophyly Morphological character (synapomorph ic) ML: Bootstrap NJ: Bootstrap BA: Posterior probability carolinianus 99.4/y 100/y 1/y 230 flexuolaris 58.5/y 62.9/y 0.85/y 9 0 togatus 95.2/y 100/y 1/y *4 1; 23 2; 241 sellatus 100/y 100/y 0.98/y 26 2; 32 1; 33 1; 341 venustus 96.9/y 99.3/y 1/y 161 At least one homoplasious character y yes

PAGE 142

142 Figure 61. Phylogram of Bayesian analys is of 64 slug based on the cytochrome oxidase subunit (CO1) gene with branch lengths measured in expected substitutions per site. Posterior probability values printed at respective branches. Limax maximus (Limacidae) was used as an outgroup. Asterisks (*) indicate specimens collected at each species documented type locality.

PAGE 143

143 Figure 62. NJ tree of 38 individual Philomycus based on the cytochrome oxidase subunit (CO1) gene with branch lengths measured in expected substitutions per site. Bootstrap values printed at respective branches. Limax maximus (Limacidae) was used as an outgroup.

PAGE 144

144 Figure 63. Phylogram of MP analysis of 26 slugs based on morphological characters Bootstrap values printed at respective branches for 50% majority rule consensus tree Megapallifera mutabilis ( Philomycidae) was used as an outgroup.

PAGE 145

145 Figure 64 NJ tree showing unambiguous character st ate changes for the carolinianus clade form the MP analysis. Numbers above branches are character numbers; below branches are character states. Blue dots: homoplasious changes and green dots: nonhomoplasious changes (synapomorphies).

PAGE 146

146 Fig ure 65 NJ tree showing unambiguous character state changes for the flexuolaris clade from the MP analysis. Numbers above branches are character numbers; below branches are character states. Blue dots: homoplasious changes and green dots: nonhomoplasious changes (synapomorphies). Mantle pattern ordered phylogenetically, but absent for specimens with a sterisks (*).

PAGE 147

147 Figure 66 NJ tree showing unambiguous character state changes for the sellatus clade from the MP analysis. Numbers above branches are character numbers; below branches are character states. Blue dots: homoplasious changes and green dots: nonhomoplasious changes (synapomorphies).

PAGE 148

148 Figure 67 NJ tree showing unambiguous character state changes for the togatus clade from t he MP analysis. Numbers above branches are character numbers; below branches are character states. Blue dots: homoplasious changes. Mantle pattern ordered phylogenetically.

PAGE 149

149 Figure 68 NJ tree showing unambiguous character state changes for the ve nustus clade from the MP analysis. Numbers above branches are character numbers; below branches are character states. Green dot: nonhomoplasious changes (synapomorphies).

PAGE 150

150 Figure 69 Mantle pattern of Philomycus flexuolaris (paratype of P. virginicus ). A) Lateral view FMNH 294085. B) Dorsal view FMNH 294085.

PAGE 151

151 Figure 610. Genitalia of five Philomycus species. A) P. flexuolaris UF B) P. togatus UF 447128, C) P. carolinianus UF 447034, D) P. sellatus UF 447224, E) P. venustus UF 447116, F) P. flexuolaris FMNH 294085. a = atrium, bc = bursa copulatrix, ds = dart sac, p = penis, vd = vas deferens.

PAGE 152

152 Figure 61 1 Darts of five Philomycus species: upper lateral view and lower image ventral view. A) P. carolinianus UF 447268, B) P. flexuolaris UF 447143, C) P. venustus UF 447116, D) P. sellatus UF 447224, E) P. togatus UF 447144.

PAGE 153

153 Figure 61 2 Central and lateral teeth of four Philomycus species. A) Philomycus carolinianus UF 447034, B) P. venustus UF 447116, C) P. togatus UF 447144C and D) P. flexuolaris UF 447163.

PAGE 154

154 Figure 61 3 Jaws of five Philomycus species: A) P. carolinianus UF 447268, B) P. flexuolaris UF 447163, C) P. togatus 447144 UF D) P. venustus UF 447116, E) P. sellatus UF 447224.

PAGE 155

155 Figure 61 4 Distribution of Philomycus carolinianus throughout eastern United States.

PAGE 156

156 Figure 61 5 Distribution of Philomycus flexuolaris throughout eastern United States.

PAGE 157

157 Figure 61 6 Distribution of Philomycus sellatus throughout eastern Unit ed States.

PAGE 158

158 Figure 61 7 Distribution of Philomycus togatus throughout eastern United States.

PAGE 159

159 Figure 61 8 Distribution of Philomycus venustus throughout eastern United States.

PAGE 160

160 CHAPTER 7 SUMMARY AND CONCLUSIONS The over all goal of this research was to develop a web based user friendly resource for timely and accurate identification of economically and ecologically important terrestrial gastropods, determine the pest potential of four select mollusc species and to clarify the biology, life history and taxonomic ranking of species within the genus Philomycus The Terrestrial Mollusc Tool (TMT) was developed through the compilation and synthesis of data from diverse sources into a single identification tool designed to meet the needs of inspectors at U.S.A. ports of entry and other nonmalacologist endusers. The Terrestrial Mollusc Tool consists of a nondichotomous pictorial key that allows the user to key specimens based on the presence or absence of pertinent morphological charac ters. Final selections are confirmed by consulting the fact sheets that provide specific information on the biology, ecology and distribution of each taxon. The fact sheets also provide highresolution photographs and detailed line drawings of genitalic characters. A dissection tutorial is provided to assist the user to accurately determine the identity of closely related species. The pictorial key and factsheets of the TMT are designed to accommodate regular updates and the incorporation of new information to keep the tool current and maintain utility. The use of pictorial tools is a relatively new phenomenon facilitated by recent technological advances. As such future research should evaluate the utility of the TMT and other pictorial identification tools relative to traditional dichotomous keys. Additional studies were conducted to specifically: (1) determine and compare the relative consumption potential and life history traits of Deroceras reticulatum and D. leave under laboratory conditions, (2) evalua te thirty seven annual and perennial plants

PAGE 161

161 species commonly grown in Florida for susceptibility to herbivory from Zachrysia provisoria, Bradybaena similaris D. reticulatum and D. leave (3) evaluate the effects of temperature and density on the consumpti on potential of D. laeve and D. reticulatum (4) evaluate the biology, life history traits and feeding behavior of the Philomycus carolinianus under laboratory conditions and (5) review the taxonomy of the genus Philomycus using morphological (external and internal) and molecular characters. The cosmopolitan slug D. reticulatum is considered a major agricultural pest worldwide and inhabits disturbed sites, whereas D. laeve is a pest of pastures and flourishes in agricultural systems where conservation till age is employed. Laboratory evaluation of relative consumption potential and life history traits indicate that there was no significant difference in the quantity of host material consumed by both species. However, D. reticulatum has been documented to pro duce larger clutches of eggs and with greater frequency than D. leave under the laboratory and greenhouse conditions, suggesting that the greater reproductive potential of D. reticulatum may be a major contributing factor to the pest status of this species The Florida population of D. laeve used in this study was more successful at higher temperatures in contrast to the Argentinean population used by Faberi et al. (2006) which performed better at lower temperatures. Additional research should be conducted to address populations of D. laeve collected worldwide to determine if there is some degree of speciation caused by geographic isolation or if we may be dealing with a species complex. Results from the experiments evaluating 37 plants commonly grown in Fl orida for herbivory against Zachrysia provisoria, Bradybaena similaris Deroceras reticulatum and D. leave indicate that Z. provisoria was the most polyphagous mollusc species

PAGE 162

162 consuming 84% of all test plants evaluated, whereas D. reticulatum consumed 11% and D. leave and B. similaris consumed 8% respectively. Annuals were generally more susceptible to herbivory when compared to perennials and one ornamental species ( Stromanthe sanguine var tricolor) was unacceptable to all mollusc species. Additional rese arch should evaluate a wider range of plant species cultivated in Florida to determine those plant species least susceptible to herbivory. Laboratory evaluation of the life history traits of Philomycus carolinianus indicated that this species employ self fertilization as a reproductive strategy. The general growth curve for this species was sigmoidal; however, individuals within clutches displayed dramatic variation in weight gain. This may be attributed to genetic variation within the population and should be evaluated further. The experiment comparing the life history parameters of solitary and paired specimens indicated that paired specimens produced smaller clutches of eggs and oviposited less frequently when compared to solitary specimens. The data however, indicate that eggs from paired specimens produced higher mean percent hatch compared to solitary specimens. Additionally, the first clutch of eggs produced the highest mean percent hatch. Data derived from laboratory evaluation of temperature development thresholds for P. carolinianus eggs indicated that no eclosion resulted for eggs held 10 and 29C. However eggs held at 10C exhibited embryonic development and remained viable for up to 120 days hatching within 24h when temperature was increased to approximately 22C. The ability of eggs to persist and remain viable at low temperatures could form an important survival strategy for this species.

PAGE 163

163 Several synthetic (gypsy moth, spruce budworm and rabbit pellet) diets and natural (white mushroom, lettuc e, carrot) materials were evaluated for the suitability as potential diets for short term rearing of Philomycus carolinianus in the laboratory. The synthetic insect diets (spruce budworm and gypsy moth) produced the greatest combination of favorable attributes of the diets evaluated and feasible diets for the maintenance of P. carolinianus laboratory colonies. Additional studies should be conducted to evaluate the suitability of these and other insect diets for short and long term rearing of other mollusc s pecies. The natural diet of Philomycus carolinianus has been documented in the literature to consist of a wide variety of mushrooms; however, no record has been made on the variety and feeding preference of this species. The host range and feeding prefer ence of P. carolinianus was evaluated in the laboratory using choice tests of 50 mushrooms (wild and cultivated) and a lichen species, using white mushroom as the control. The data indicated that P. carolinianus consumed all test mushrooms and lichen speci es evaluated in this study and displayed preferential feeding for select mushroom species. There was however, no evidence to support P. carolinianus feeding preference for higher taxonomic groups (genus, family order) of mushrooms. Several species of higher plants (understory vegetation and weedy plants) commonly found in habitats occupied by P. carolinianus was evaluated for potential herbivory using nochoice tests. No feeding activity was documented for these higher plants. There have been several observ ations of Philomycus consuming lichen; therefore, additional lichen species could be evaluated to determine Philomycus consumption preference.

PAGE 164

164 The taxonomic revision of the genus Philomycus indicated that the genus is monophyletic and consist of at least five species: P. carolinianus P. togatus P. venustus P. flexuolaris and P. sellatus The results are however preliminary as additional specimens are required to further support the findings herein. It is recommended that additional species should be col lected from a broader geographic range, examined and characterized to provide pertinent diagnostic characters in support of the genera P. flexuolaris and especially P. venustus as preliminary results suggests that these two genera may be species complexes or there may be additional species in the genus.

PAGE 165

165 APPENDIX A LIST OF SPECIES INCLUDED IN THE TERRESTRIAL MOLLUSC TOOL Family: Achatinidae Achatina (Lissachatina) fulica Bowdich, 1822 Achatina achatina (Linnaeus, 1758) Archachatina marginata (Swainson, 1821) Elasmias apertum (Pease, 1864) Limicolaria aurora (Jay, 1839) Family : Agriolimacidae Deroceras agreste (Linnaeus, 1758) Deroceras caucasicum (Simroth, 1901) Deroceras laeve (O.F. Mller, 1774) Deroceras panormitanum (= caruanae) (Lessona & Pollonera, 1891) Deroceras reticulatum (O.F. Mller, 1774) Family: Amphibulimidae Amphibulima patula dominicensis Pilsbry, 1899 Family: Ampullariidae Marisa cornuarietis (Linnaeus, 1758) Pila conica (Wood, 1828) Pomacea canaliculata (La marck, 1822) Pomacea glauca (Linnaeus 1758) Pomacea insularum (d'Orbigny, 1835) Pomacea lineata (Spix, 1827) Family: Arionidae Ariolimax columbianus (Gould, 1951) Arion ater (Linnaeus, 1758) Arion circumscriptus Johnston, 1828 Arion distinctus Mabille, 1868 Arion fasciatus (Nielsson, 1919) Arion hortensis Frussac, 1819 Arion intermedius (Normand, 1852) Arion vulgaris (= lusitanicus) MoquinTandon Arion owenii (Davies, 1979) Arion rufus (Linnaeus, 1758) Arion silvaticus Lohmander, 1937 Arion subf uscus (Draparnaud, 1805) Prophysaon andersoni (Cooper, 1872) Family: Helicarionidae Parmarion martensi Simroth, 1893 Parmarion reticulates Hasselt, 1824 Mariaella dussumieri Gray, 1855 Family: Bradybaenidae Acusta touranensis (Souleyet, 1842) Bradybaena similaris (Rang, 1831) Family: Camaenidae Granodomus lima (Frussac, 1821) Family: Chronidae Ovachlamys fulgens (Gude 1900) Family: Cochlicellidae Cochlicella acuta (da Costa, 1778) Prietocella barbara (Linneaus, 1758) Cochlicella conoidea (Draparnaud, 1801 Cochlicella ventricosa (Draparnaud, 1801) Family: Cochliocopidae Cochlicopa lubrica (Mller, 1774) Family: Discidae Discus rotundatus (Mller, 1774) Family: Euconulidae Family: Helicarionidae Guppya gundlachi (Pfeiffer, 1839) Family: Helicidae C epaea hortensis (Mller, 1774) Cepaea nemoralis (Linnaeus, 1758) Cornu aspersum (Mller, 1774) Eobania vermiculata (O.F. Mller, 1774) Helicella italia (Linnaeus, 1758)

PAGE 166

166 Helicogona arbustorum (Linnaeus, 1758) Helix aperta Born, 1778 Helix lucorum Linneaus, 1758 Helix pomatia Linnaeus, 1758 Otala lactea (Mller, 1774) Otala punctata (Mller, 1774) Theba pisana (Mller, 1774) Family: Hygromidae Candidula intersecta (Poiret, 1801) Cernuella neglecta (Draparnaud, 1805) Cernuella virgata (DaCosta, 1778) Hygromi a cinctella (Draparnaud, 1801) Microxeromagna armillata (Lowe, 1852) Monacha cantiana (Montagu, 1803) Monacha cartusiana (Mller, 1774) Monacha syriaca (Ehrenberg, 1831) Trichia striolata (C. Pfeiffer, 1828) Trochoidea pyramidata (Draparnaud, 1805) Trochul us hispidus (Linnaeus, 1758) Xerolenta obvia (Menke, 1828) Xeropicta vestalis (Pfeiffer, 1841) Xerotricha conspurcata Draparnaud, 1801 Family: Limacidae Lehmannia marginata (O.F. Mller, 1774) Lehmannia valentiana (Frussac, 1823) Lehmannia nyctelia (Bo urguignat, 1861) Limacus flavus (Linnaeus, 1758) Limax maximus Linnaeus, 1758 Family: Lymnaeidae Lymnaea stagnalis (Linnaeus, 1758) Radix auricularia (Linnaeus, 1758) Radix peregra (Mller, 1774) Family: Megabulimidae Megalobulimus oblongus (O.F. Ml ler, 1774) Family: Milacidae Milax gagates (Dreparnaud, 1801) Tandonia budapestensis (Hazay, 1881) Tandonia rustica (Millet, 1843) Tandonia sowerbyi (Frussac, 1823) Family: Orthalicidae Bulimulus diaphanus fraterculus (Potiez and Michaud, 1835) Bulimulus guadalupensis (Bruguire, 1789) Family: Parmacellidae Parmacella ibera Eichwald, 1841 Family: Philomycidae Pallifera costaricensis (Morch, 1857) Family: Physidae Physella acuta (Draparnaud, 1805) Family: Pleurodontidae Zachrysia provisoria (Pfeif fer, 1858) Zachrysia trinitaria (Pfeiffer, 1858) Family: Polygyridae Polygyra cereolus (Mhlfeld, 1816) Praticolella griseola (Pfeiffer, 1841) Family: Pupillidae Lauria cylindracea (da Costa, 1778) Pupisoma dioscoricola (Adams, 1845) Family: Subulinidae Allopeas gracile (Hutton, 1834) Leptinaria unilamellata (DOrbigny, 1835) Rumina decollata (Linnaeus, 1758) Subulina octona (Bruguire, 1798) Family: Succineidae Calcisuccinea luteola Gould, 1848 Calcisuccinea dominicensis (Pfeiffer) Oxyloma pfeifferi ( Rossmassler, 1835) Succinea campestris Say, 1818 Succinea costaricana von Martens, 1898 Succinea horticola (Reinhardt, 1877)

PAGE 167

167 Succinea putris (Linnaeus, 1758) Succinea tenella Morelet, 1865 Family: Testacellidae Testacella haliotidea Family: Trochidae Gib bula adriatica (Philippi, 1844) Gibbula albida (Gmelin, 1791) Family: Urocyclidae Elisolimax flavescens (Keferstein, 1866) Family: Veronicellidae Belocaulus angustipes Heynemann, 1885 Diplosolenodes occidentalis (Guilding, 1825) Leidyula moreleti (Cros se and Fischer, 1872) Phyllocaulis gayi (Fischer, 1871) Sarasinula plebeia (P. Fischer, 1868) Sarasinula dubia (Semper, 1885) Sarasinula marginata (Semper, 1885) Vaginulus alte (Frussac, 1822) Veronicella aff. floridana (Leidy, 1868) Veronicella cubensi s (Pfeiffer, 1840) Veronicella laevis Blainville, 1817 Veronicella sloanei (Cuvier, 1817) Family: Viviparidae Viviparus viviparus (Linnaeus, 1758) Family: Zonitidae Oxychilus alliarius (Miller, 1822) Oxychilus cellarius (O.F. Mller, 1774) Zonitoides arboreus (Say, 1819) Zonitoides nitidus (Mller, 1774)

PAGE 168

168 APPENDIX B TERRESTRIAL MOLLUSC TOOL WEBSITE CONTENT Arion ater group: Arion rufus Welcome to the Terrestrial Mollusc Tool. Dissection Tutorial Live specimens should be drowned in an airtight container that is completely filled with water. They should be left overnight or until completely.. Continue reading... How to Use the Key This key was created to assist inspectors at U.S. ports of entry who are inspecting cargo to determine the identity of potentially important, invading... Continue reading... Biology & Ecology The phylum Mollusca includes a wide variety of invertebrates (animals without a spine) including gastropo ds (snails and slugs), cephalopods... Continue reading...

PAGE 169

169 About Introduction to Terrestrial Mollusc Tool The Terrestrial Mollusc Tool was specifically designed to assist in the identification of adult terrestrial slugs and snails of agricultural importance. The tool also includes species of quarantine significance as well as invasive and contaminant mollusc species commonly intercepted at U.S. ports of entry. This Lucidb ased identification tool specifically targets federal, state and other agencies or organizations within the U.S. that are concerned with the detection and identification of molluscs of significance. This tool includes 33 families and 128 species. This resource also includes an interactive identification key, comparison chart, fact sheets, biological and ecological notes, a dissection tutorial, a glossary of commonly used terms, and a list of useful links and references. It should be noted that this dynamic tool is not inclusive of all mollusc pests, as new species of interest arise almost daily. The list of species included in this tool was generated based on pest species reported in scholarly publications by Barker 2002, Cowie et al. 2009, and Godan 1983 as well as commonly intercepted species documented in the port of entry interception data from US Department of Agricultures Animal and Plant Health Inspection Services Plant Protection and Quarantine division (USDA APHISPPQ) and the Florida Department of Agriculture and Consumer Services (FDACS) Division of Plant Industry. The pictorial key included in the Terrestrial Mollusc Tool is unable to identify a few entities below the family level. This is true especially for the families Veronicellidae and Succineidae. The major reason for this is the lack of diagnostic morphological characters and the variability of members of these groups. In many cases, it is recommended that molecular techniques be used in the identification of members of these families (Holland and Cowie 2007; Gomes et al. 2010). This inadequacy of the key is, however, mitigated by the fact that most if not all members of these problematic groups are pestiferous and as such are regulated at the family level. The same is true for the species complexes (e.g., Arion hortensis group, A. ater group) included in the tool. The Terrestrial Mollusc Tool was developed and published by the Center for Plant Health Science and Technology (CPHST) as part of a cooperative agreement with the Department of Entomology and Nematology, University of Florida and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Service (APHIS), Plant Protection and Quarantine (PPQ) and is under the direction of Terrence Walters, CPHST Identific ation Technology Program (ITP) coordinator. The photographs utilized in this tool were generously provided by those credited on each. The photographers and organizations that gave permission to use their images

PAGE 170

170 are also credited in the acknowledgements. Al l drawings were produced by the University of Florida, unless otherwise noted. See Copyright, Citation and Disclaimers for information about the use of content on these pages and all the pag es included in this tool. For information concerning the Terrestrial Mollusc Tool or to offer any feedback or comments, please contact the author or the Entomology and Nematology department at the Univ ersity of Florida, Gainesville, FL. About the Key This key was created to assist inspectors at U.S. ports of entry who are inspecting cargo to determine the identity of potentially important, invading organisms, specifically ter restrial molluscs.It is acknowledged that the scope of this key may be larger and as such may be used as an educational tool for a variety of fields. The taxonomy of terrestrial molluscs is very dynamic, hence a large number of the entities (species, fami lies, groups) included in this key may have been and continue to be revised. For each entity, a list of synonyms has been included in the supporting fact sheets to assist in clarifying the nomenclature. It is recommended that the user read the About this tool and the Biology sections of this tool before attempting to use the pictorial key. The key can reliably identify only adult specimens, as juveniles may not possess the characteristic features of the species. This is true for both snails and slugs. Slugs are generally more difficult to key to the species level and often require dissection. If dissection is necessary, there is a dissection tutorial available in this tool to assist the user to successfully dissect a snail and/or a slug. Equipment required for the optimal use of this key: Hand lens (1020 X) Ruler or Caliper Adult specimens Anatomy drawing (located in Biology section) It is important to remember that this key is not inclusive of all pestiferous mollusc species. This key is intended to serve as an aid in the identification of terrestrial mollusc species documented as major agricultural and ecological pests as well as contaminant and nonpest species that are commonly intercepted at U.S. ports of entry.

PAGE 171

171 Collecting & Handling Specimens It is advised to always exercise caution when handling terrestrial gastropods as s everal species act as intermediate and reservoir hosts for parasites that can cause serious diseases in humans and domestic animals. Gloves should always be worn in order to limit physical contact with living and dead specimens and their associated mucus secretions. In the event of direct external contact with snails, slugs or their secretions, immediately wash affected area carefully with warm soapy water. Collection and Preservation Live specimens should be drowned in an airtight container that is completely filled with water. They should be left until completely drowned (i.e., unresponsive to touch). The specimen should then be transferred to 70 % ethyl alcohol for at least one hour then the alcohol should be replaced with fresh 70% alcohol. Labeling Th e container should then be labeled with at least the following information: collection date, collectors name and location Be sure to retain the label when transferring specimens. The information may be recorded directly on the container or on a label that is placed inside the container. Collection information is very important and should be recorded at the time of collecting the specimen. It is recommended that the label be written in pencil as ink may be destroyed by the alcohol. If specimens are collect ed from different areas, they should be submitted separately. Submission All samples collected should be submitted to the USDA APHISPPQ NIS, along with the appropriate form. It is required by the United States Department of Agriculture (USDA) that all do mestically collected specimens be submitted with an accompanying PPQ 391 (IBP Record) form; specimens associated with imported cargo require a PPQ 309 record. Lucid System Requirements Option 1: Key Server Accessing the key through the Lucid Key Server is the default option. Advantages: It is fully web based and requires no special software or addons.

PAGE 172

172 You do not have to wait for entire key t o load. It can be used on mobile devices such as the iPad, iPhone, etc. Disadvantages: The 4x4 viewing grid is not size adjustable. Because the entire key is not loaded, users may experience latency between character selections. If the key does not load at first, please refresh the page. Begin Key Server Option 2: Java Key Advantages: The key is preloaded, eliminating latency between character selections. The 4x4 viewing grid is size adjustable. Disa dvantages: Entire key must be loaded before it can be used. System requirements are more restrictive (see below). Java applets may be blocked as active content by certain organizations. Java applet will not run on many mobile devices. Operating System: Wi ndows 2000/XP/Vista, Mac OSX 10.4 or greater, Linux (that supports J2RE), Solaris 710. (The key will run on Windows 98/ME/NT4 but these platforms are no longer supported.) System Memory: 256MB RAM (512MB or greater recommended). Web browser: Java enabled web browser such as Internet Explorer, Firefox, Chrome, or Safari. NOTE : Web pages such as fact sheets attached to items in Lucid keys may be considered popups by certain browsers (such as Internet Explorer [IE]). If your browser blocks these popups, in your browser's Internet settings you should allow popups for this tool. Additionally, Internet Explorer may block "active content" on web pages or interactive keys. To allow active content: in Internet Explorer under Tools Internet Options Advanced tab, Security category, the box next to the setting "Allow active content to run in files on My Computer" should be checked. Additionally, certain settings under Tools, Internet Options, Security, Custom level, ActiveX controls and plugins may need to be changed.

PAGE 173

173 The Lucid3 interactive key will run embedded within a web browser as a Java Applet Player. Java Runtime Environment (JRE) version 1.4.2 (1.5 or greater recommended) must be installed on your computer for the Lucid3 Applet Player to run successfully. If in the box above you see text that says your Java status is version 1.4.2 (or greater) from Sun Microsystems Inc., and your computer meets the Lucid3 system requirements, you may open a key: Be gin Java Key Java information If you don't see the necessary text in the box above, if the version number displayed is less than 1.4.2, or you receive an error message stating "Java is an unknown command", you can download and install (make sure to unins tall old versions) the latest Java Runtime Environment version from the Java web site at www.java.com Note: Some Java versions greater than 1.4.2 may have bugs that affect operation of the interactive key. Bugs can usually be resolved by downloading the latest Java Runtime Environment version from the Java web site. Also, be aware that the JRE is continually being updated for compatibility with operating system updates. It's generally a good idea to have the latest JRE version installed. You can verify your Java installation status by doing the following: Windows Type "java version" at a Command Prompt window. You can get to the Command Prompt window by either going to Run from the Start button and typing "c md" or by selecting the Command Prompt menu option from Accessories. Mac OSX, Linux, Unix and other platforms Type "java version" at a terminal window.

PAGE 174

174 Note to Macintosh users OSX comes preinstalled with the JRE and is accessible using Safari. Ensure you have the latest version of JRE by running the software update utility. Internet Explorer version 5.2.3, which is the last version of IE for the Mac, does not support JRE, nor does Opera. Mozilla.org, however, has opted (at least since February 2007) to include the Java Embedding Plugin by default in all of its products (Firefox, Mozilla, or Camino browsers). This will enable them to access JRE and run the key. However, if you require the Java Embedding Plugin, see the links below for information regarding installation, compatibility and updates for the plugin. The Java Embedding Plugin does not work with Explorer or Opera. Information and Installation instructions for the Java Embedding Plugin for Mac OSX can be found at: http://javaplugin.sourceforge.net/ To download the plugin directly, go to the Java Embedding Plugin Summary at: http://sourceforge.net/projects/javaplugin/ If Java version 1.4.2 or greater is now installed on your computer, you may open the key: Begin Java Key Lucid Lucid3 is software for creating and using interactive identification keys. Lucid is developed by QAAFI Biological Information Technology at the University of Queensland in Australia. Visit the Lucidcentral web site for more information on Lucid3. Acknowledgements The T errestrial Mollusc Tool was developed and published by the Center for Plant Health Science and Technology (CPHST) through a cooperative agreement with the University of Florida (UF), Entomology and Nematology department. Funding was provided by USDA APHIS CPHST through the FY200910 Farm Bill. US Department of Agricultures Animal and Plant Health Inspection Services Plant Protection and Quarantine division (USDA APHISPPQ) and the Florida Department of Agriculture and Consumer Services (FDACS) Division of Plant Industry generously

PAGE 175

175 provided access to their port of entry interception data for the compilation of the list of species included in this tool. Technical and logistical support was provided by Amanda Redford (CPHST) and Terrence Walters (CPHST). The author wishes to express sincere gratitude to you all for your time and effort. Without your support and involvement this tool would not have been a success. The author gratefully acknowledges Matthew Trice (CPHST) whose technical expertise is reflecte d in the design, construction, and functionality of the Terrestrial Mollusc Tool website. His efforts were crucial to the completion of this project. IT support: Matthew Trice (CPHST), Amanda Redford (CPHST) and Steve Lasley (U.F.). Editors and Advisors: John Capinera and John Slapcinsky. The author would like to acknowledge and extend profound gratitude to John Capinera and John Slapcnsky for their immense contributions towards the successful completion of this project. Their useful comments, suggestions, guidance and training were vital to the production of this tool. The specimens used in the creation of the Terrestrial Mollusc Tool were made available through the Florida Museum of Natural History, UF, thanks to John Slapcinsky (Collections Manager) and Gustav Paulay (Curator). Expert reviewers: Angela Fields, Aydin rstan, Frederick Zimmerman, James Korecki, Jochen Gerber, John Slapcinsky, Kevin Roe and Rory McDonnell. Non expert reviewers: Amanda Hodges, Catherine Mannion and John Capinera. The author would like to acknowledge the following beta testers for their helpful suggestion and comments to improve the utility of the pictorial key: Amanda Bemis (Florida Museum of Natural History), Lyle Buss (University of Florida) and Stephen McLean (Universit y of Florida). The author would like to thank Suzete Rodrigues Gomes for providing valuable assistance with the nomenclature and systematics of the family Veronicellidae. Dissection tutorials: The snail and slug dissections were executed by Jodi WhiteMcL ean and photographed by Lyle Buss, Entomology and Nematology department, University of Florida. Drawings and Illustrations: All original drawings and illustrations and those adapted from original works were produced by Kay Weigel, University of Florida, unless otherwise noted.

PAGE 176

176 Photographs: The following individuals and organizations generously provided the photographs included in the entire Terrestrial Mollusc Tool: Amy Benson, Andrew Butko, Anneli Salo, Asturnut, Aung, Bernd Haynold, Beth Kinsey, Bill Fran k, Bon Terra Consulting, BotheredByBees, Brian Sullivan, Charles Olsen, Christopher Thomas, David Medcalf, David Robinson, Dfruzzetti, Dilian Georgiev, F. Vincentz, Father Alejandro Snchez Muos, Francisco Welter Schultes, Frank Peairs, Fritz Geller Grimm, Fvlamoen, Gary Rosenberg, Gerry Ellis, Grasso, Guillaume Brocker, Hans Hillewaert, H. Svensson, H. Zell, Harry G. Lee, J. Holmr, J.M. Garg, James K. Lindsey, Jan Meerman, Jeffrey W. Lotz, Jelger Herder, Jeremy Lee, Jessica e McLean, John Slapcinsky, Jose Maria Hernandez Otero, Joseph Berger, Colae, Katrindie Ruberbraut, Kay Weigel, Kjetil Lenes, Kristiina Ovaska, Lars Peters, L. Ruiz Berti, L. Shyamal, L. Tanner, Lansdown Guilding, Linda Schroeder, Lokilech, Lubo Kolouch, Knight, Maaike Pouwels, Magne Flten, Mark Hitchcox, Masaki Hoso, Max0rz, Michael Morris, Parshanthns, Paulo, Phil Poland, R anko, Rasbak, Ray Hamblett, Rex, Richard Fox, Robert Forsyth, Robert Pilla, Robert Reisman, Roberta Zimmerman, Roger Key, Rory McDonnell, Roy Anderson, S. Bauer, Sam Fraser Smith, Sanjay 565658, Sergey Leonov, Susan Prince, Suzete Rodrigues Gomes, T. Beth Kinsey, T. Grasso, J T. Mki, William Leonard, Yuvalif, Zwentibold, www.PetSnails.co.uk, www.wildaboutbritain.co.uk To all, Thank you. Copyrights, Citation & Disclaimers Copyright notice Unless otherwise indicated, content on this Internet site was created and/or authored by USDA/APHIS/PPQ Center for Plant Health Science and Technology (CPHST) through its cooperative agreement with the University of Florida (UF), E ntomology and Nematology department. This content may be freely distributed or copied as content in the public domain (except as noted in the next paragraph). However, it is requested that in any subsequent use of this work CPHST and UF be given appropriat e acknowledgement (see "Suggested citation" below). This site also contains information, text, and images created and/or prepared by individuals or institutions other than CPHST and UF, that may be protected by copyright. Sources of information and text are mentioned in the Acknowledgements and References. In most instances, the origin of images is indicated in image captions and

PAGE 177

177 in the Acknowledgements and References. Users must seek permission from the copyright owner(s) to use this material. Links to th e Internet sites of some individuals and institutions are available on the Information and Links page. Contact Jodi WhiteMcLean ( jodi.wm@gmail.com ) if you need assistance identifying or locating the copyright owner or to check on the copyright status of a particular image. Suggested citation White McLean, J.A. (September, 2011). Terrestrial Mollusc Tool. USDA/APHIS/PPQ Center for Plant Health Science and Technology and the University of Florida. [date you accessed site] < http://idtools.org/id/mollusc > Disclaimers Liability: CPHST and UF do not assume any legal liability or responsibility for the accuracy, completeness, or usefulness of any information contained on this site. The scientific names and classificat ion of molluscs are constantly being revised; hence, it is important to consult the factsheets, current literature or a specialist to confirm the identity of the mollusc. External links: Some web pages on this site provide links to other Internet sites for the convenience of users. CPHST and UF are not responsible for the availability or content of these external sites, nor do CPHST and UF endorse or warrant the products, services, or information described or offered by these other Internet sites. Information and Links Useful Resources: Barker, G.M. (ed.) 2001. The biology of terrestrial molluscs. CABI Publishing, Wallingford, UK. pp558 Barker, G.M. (ed.) 2002. Molluscs as crop pests. CABI Publishing, Wallingford, UK. pp 468 Barker, G.M. (ed.) 2004. Natural enemies of terrestrial molluscs. CABI Publishing, Wallingford, UK. pp 644 Burch, J.B. 1962. How to Know the Eastern Land Snails. Wm. C. Brown Company Publishers, Dubuque, Iowa. pp 214

PAGE 178

178 Cowie, R.H., R.T. Dillion Jr, D.G. Robinson and J.W. Smit h. 2009. Alien nonmarine snails and slugs of priority quarantine importance in the United States: a preliminary risk Assessment. American Malacological Bulletin 27: 113132. Forsyth, R.G. 2004. Royal BC museum handbook: land snails of British Columbia. Vi ctoria, Canada: Royal BC Museum. Godan, D. 1983. Pest slugs and snails. Biology and control. Springer Verlag, Berlin. Grimm, F.W., R.G. Frosyth, F.W. Scheler and A. Karstad. 2009. Indentifying land snails and slugs in Canada. Introduced species and native genera. Canada Food Inspection Agency. Ottawa, ON. Hubricht, L. 1985. The distributions of the native land mollusks of the eastern United States. Fieldiana (Zoology) New Series 24. pp 191 McDonnell, R., T. Paine and M. J. Gormally. 2009. Slugs: A Guide to the Invasive and Native Fauna of California. Oakland: University of California Agriculture and Natural Resources Publ. 8336. Pilsbry, H. A. 1939. Land Mollusca of North America north of Mexico vol. I part 1. Academy of Natural Sciences, Philadelphia. pp 1574 Pilsbry, H. A. 1940. Land Mollusca of North America north of Mexico vol. I part 2. Academy of Natural Sciences, Philadelphia. pp 575994 Pilsbry, H. A. 1946. Land Mollusca of North America north of Mexico vol. II part 1. Academy of Natural Sciences, Philadelphia. pp 1520 Pilsbry, H. A. 1948. Land Mollusca of North America north of Mexico vol. II part 2. Academy of Natural Sciences, Philadelphia. pp 5211113 Robinson, D.G. 1999. Alien invasions: the effects of the global economy on nonmarine gastr opod introductions into the United States. Malacologia 41: 413 438. South, A. 1992. Terrestrial slugs: biology, ecology and control. Chapman and Hall, London. pp 428 pp Online Publications Management Oregon State University. Pacific Northwest nursery IP M. Snails/slugs. http://oregonstate.edu/dept/nurspest/slugs.htm University of California. Agriculture and Natural Resources. UC IPM Online. Snails and slugs: Integrated pest management for home gardeners and landscape professionals. http://www.ipm.ucdavis.edu/PMG/PESTNOTES/pn7427.html

PAGE 179

179 University of Florida. Terrestrial slugs of Florida (Mollusca: Stylommatophora: Veronicellidae, Philomycidae, Agriolimacidae and Limacidae). EENY 493 (IN891). http://edis.ifas.ufl.edu/in891 Keys Discover Life: Mollusc identification guide: http://www.discoverlife.org/20/q?guide=Molluscs Identification guide to the land snails and slugs of western Washington: http://academic.evergreen.edu/projects/ant s/TESCBiota/mollusc/key/webkey.htm Jacksonville Shell Club. http://www.jaxshells.org/ Key to the genera of introduced and native land snails and slugs in Canada Key to the snails of the Bristol Region: http://www.brerc.eclipse.co.uk/files/BRERC_snail_key.pdf Key to the terrestrial gastropods of British Columbia: http://www.livinglandscapes.bc.ca/cbasin/molluscs/pdf/mollusc3.pdf Land snails and slugs of Canada: http://www.mollus.ca/index.htm Land snails of Pennsylvania: http://www.carnegiemnh.org/mollusks/palandsnails/ Mollus.ca: http://www.mollus.ca/index.htm North American Land Snails: northamericanlandsnails.com/ Slugs: A guide to the invasive and native fauna of California: http://ucanr.org/freepubs/docs/8336.pdf Tree snails (of Florida), Drymaeus, Orthalicus, Liguus spp (Gastropoda: Bulimulidae): http://edis.ifas.ufl.edu/in305 Fact Sheets

PAGE 180

180 Achatina achatina Family Achatinidae Species Achatina achatina (Linnaeus, 1758) Common Name Giant African snail, Giant Ghana snail, Giant tiger land snail, Escargot geant, Achatine Description Similar to the other species in the genus, Achatina achatina's shell can attain a length of 200 mm and a maximum diameter of 100 mm. They may possess between 78 whorls and the shell is often broadly ovate. The body of the animal is silver brown in color although albino morphs may exist. Native Range Northern section of West Africa Distribution North America: Currently not present, though it is commonly intercepted at U.S. ports. Africa : Sierra Leone, Liberia, Ivory Coast, Togo, Dahomey, Ghana, Nigeria Ecology Achatinids are gener ally nocturnal forest dwellers but have the potential to adapt to disturbed habitats. Concealed habitats are generally preferred; however, individuals may colonize more open habitats in the event of overcrowding. Achatinids often become more active during periods of high humidity (e.g., after rainfall); however, the occurrence of large numbers of individuals especially during daylight may indicate high population density. Achatinids normally lay their calcareous eggs in the soil, but they may be deposited under leaf litter or rocks. They feed on both living and dead plant material. In addition to being agricultural pests, achatinids can be a threat to public health as they act as a reservoir host of the rat lung parasites ( Angiostrongylus cantonensis and A.

PAGE 181

181 costaricensis), which cause eosinophilic meningoencephalitis in humans. They can also be an unsightly public nuisance duri ng periods of population explosion. Synonyms References Abbott 1989; Barker 2002; Cowie et al. 2008; Cowie et al. 2009 Allopeas gracile Family Subulinidae Species Allopeas gracile (Hutton, 1834) Common Name Graceful awl snail Description The elongated, conical shell of this snail measures approximately 12 mm high, with 79 whorls Vacant shells are tan in color and living specimens are yellow. This species may be confused with Subulina octona; however, Allopeas gracile is smaller and does not have a truncated columella. Native Range Neotropics

PAGE 182

182 Distribution Pacific Islands: Hawaii Central and South America : Mexico Caribbean Asia: Southeastern region Ecology This species has been documented to occur in large numbers wherever it inhabits. These l arge numbers often result in outcompetition of other native species within a particular ecosystem. They often occur in greenhouses. Synonyms Bulimus gracilis Hutton, 1834 Bulimus oparanus Pfeiffer, 1846 Bulimus junceus Gould 1846 Stenogyra upolensis Mou sson, 1865 References Almeida and Bessa 2001; Burch 1962; Cowie 1997; Cowie et al. 2008; Jurickov 2006; Meyer and Cowie 2010; Naggs et al. 2003; Robinson et al. 2009; Rosenberg and Muratov 2006 Amphibulima patula dominicensis Family Amphibulimidae

PAGE 183

1 83 Species Amphibulima patula dominicensis Pilsbry, 1899 Common Name Widemouth bulimulus Description Mature individuals of this species can attain a length of approximately 25 mm, with a total of 3 whorls The shell of this snail appears to be very small in relation to the body. The shell is purple brown in color, with the apex having a more intense purple/pink color. The body of the snail is yellow brown or tan in color. Native Range Dominica Distribution Caribbean: Dominica Ecology This pest is known to feed on the leaves of banana and citrus plants. Synonyms Amphibulima patula (Bruguiere) Amphibulima patula var. dominicensis Pilsbry, 1899 Amphibulima patula dominicanus References Robinson et al. 2009; Stange 2004

PAGE 184

184 Archachatina marginata Family Achatinidae Species Archachatina marginata (Swainson, 1821) Common Name Giant African snail, Banana rasp snail, West African snail Description This species has the potential to get up to 210 mm in length and 130 mm in diameter, with 67 whorls The shell has a brownish yellow background with fairly uniformly arranged bands and zigzag lines or spots that are darkbrown or reddish brown in color. The columella, outer lip and inside the aperture (mouth) are white or pale blue. The apex of the shell is slightly flattened, bulbous and pale or pinkish in color. The body color of the animal is variable (albino or tan to ash grey).

PAGE 185

185 Native Range West Africa Distribution North America : Currently not present, though it commonly is intercepted at U.S. ports. Caribbean : Martinique Africa : Dahomey to Congo, incl uding Sao Thome, Ghana, Annobon Ecology Achatinids are generally nocturnal forest dwellers but have the potential to adapt to disturbed habitats. Concealed habitats are generally preferred; however, individuals may colonize more open habitats in the event of overcrowding. Achatinids often become more active during periods of high humidity (e.g., after rainfall); however, the occurrence of large numbers of individuals especially during daylig ht may indicate high population density. Achatinids normally lay their calcareous eggs in the soil, but they may be deposited under leaf litter or rocks. They feed on both living and dead p lant material. In addition to being agricultural pests, achatinids can be a threat to public health as they act as a reservoir host of the rat lung parasites ( Angiostrongylus cantonensis and A. costaricensis ), which cause eosinophilic meningoencephalitis in humans. They can also be an unsightly public nuisance during periods of population explosion. Archachitina marginata has the ability to live up to 10 years, attaining sexual maturity at 9 10 months under laboratory conditions. Clutch size will vary but may be as large as 40 eggs. The eggs are yellowish in color and may have dark blotches. The eggs have an incubation period of approximately 40 days. They are usually laid below the soil surface; however, they may be found on the soil surface or in vegetati on. Plants consumed by this species include banana, lettuce and papaya. Synonyms Buccinum parvum integrum (Gualtieri, 1742) [Described as synonym by Bequaert and Clench, 1936. Since shown to be Achatina achatina (Linn)] Achatina marginata (Swainson, 1821) Helix (Cochlitoma) amphora (Frussac, 1821) Cochlitoma marginata (G. B. Sowerby, 1825) Helix (Cochlitoma) marginata (Rang, 1831) Achatina (Achatina) marginata (Beck, 1837) Achatina amphora (Catlow and Reeve, 1845) Oncaea marginata (Gistel, 1848) Achatina (Archachatina) marginata (Albers, 1850)

PAGE 186

186 Achatina (Achatinus) marginata (Pfeiffer, 1856) Achatina paivana (Vignon, 1888) Archachatina marginata (Pilsbry, 1904) Archachatina marginata var. amphora (Pilsbry, 1904) Achatina schweinfurthi var. fou reaui (Germain, 1905) Achatina (Archachatina) marginata var. foureaui (Germain, 1908) Achatina intuslalescens "Paiva" (Nobre, 1909) Archachatina (Megachatina) marginata var. foureaui ("Germain" Dautzenberg, 1921) Archachatina (Megachatinops) gaboonensi s var. aequatorialis (Bequaert and Clench, 1936) Archachatina (Megachatina) marginata (Bequaert and Clench, 1936) Archachatina aequatorialis (Dartevelle, 1939) Archachatina (Calachatina) marginata (C. R. Boettger, 1940) References Abbott 1989; Barker 2002; Cowie et al. 2009 Arianta arbustor um Family Helicidae Species Arianta arbustorum (Linnaeus, 1758) Common Name Copse snail

PAGE 187

187 Description The color pattern of this species is highly variable; however, most individuals are light brown with straw colored spots and a large dark brown stripe. The heliciform shell will also vary in size (10 22 mm high and 1428 mm wide with 5 6 whorls ). The umbilicus is completely covered by the columellar edge of the aperture. The lip of the shell is bone white. Sinistral (mouth on left) and dextral (mouth on right) specimens exist. The body of the animal typically is black. Native Range Western and Central Europe Distribution North America: Canada: Newfoundland Europe: Western and Central Ecology This snail survives in damp meadows, marshy habitats as well as mountains and sandhills. Its longevity is approximately 14 years, attaining maturity at 2 4 years. Synonyms Helix arbustorum Helicigonia arbustorum References Anderson 2005; Boycott 1934; Kerney et al. 1979

PAGE 188

188 Ariolimax columbianus Family Arionidae Species Ariolimax columbianus (Gould, 1851) Common Name Pacific banana slug Description This robust slug can attain a length of 185 to 260 mm and may weigh up to 72 g at maturity. This species is normally yellow in color; however, several color morphs exists, that range from white to tan green, red brown, browngreen, olive green, slate green and ochre yellow. The mantle and body of the slug is usually of uniform color; however, the mantle in any of the color morphs may possess darkbrown to black spots, while the body remains a uniform color. In some specimens, this pattern is reversed and the body possess spots that are not present on the mantle In some specimens, the black blotches occur simultaneously on the mantle and body and may even coalesce to give the slug a solid black. The juveniles of this species are finely

PAGE 189

189 speckled. This slug has a caudal mucus pore with the pneumostome (breathing pore) located behind the midpoint of the often finely granulated mantle The keel appears undulating in strongly contracted individuals and does not reach the mantle. The sole of the foot is usually much wider than the body. Slugs in this genus are similar in appearance; however, they can be separated based on the following genitalic characters : A. columbianus : The penis permanently evaginated, and the apical portion is rounded/blunt. The retractor muscle is narrow and strap shaped, and originates on the apex of the penis. A. californicus (Cooper, 1872): The penis forms a hollow tube and can be completely invaginated. The apical portion of the penis is slender and is 1 to 1 2/3 times the length of the basal portion. The retractor muscle is broadly flabellate, and originates close to the a pex of the penis. A. dolichophallus (Mead, 1943): The penis forms a hollow tube and can be completely invaginated. The api cal portion of the penis bears a flagellum that is 2 to 4 times the length of the basal portion. The retractor muscle is narrow and strapshaped, and the point of origin is not at the apex of the penis. This species may also be aphallic (does not have a penis). Native Range North America Distribution North America : U.S.: Alaska, California, Idaho, Oregon, Washington Canad a: British Columbia Ecology The Pacific banana slug can be found inhabiting humid coastal forests. They often are intercepted when they attempt to cross trails. This is not a pest species; however, it is commonly intercepted and may be mistakenly classified as a pest due to its large size. They are infamous for gnawing off their mating partner's penis after copulation. Oval eggs (about 5 x 8 mm) are typical of this species. The eggs are laid in clutches in the soil from autumn to early spring, maturing after three to eight weeks. The slug's diet includes fungi, feces and carrion of other slugs and detritus and necrotic vegetation. It has been noted that A. columbianus displays homing behavior.

PAGE 190

190 Synonyms Limax columbianus Gould 1851, in Binney,Terr. Moll. U.S., 2:43, pl. 66, fig. 1; 1852, U.S. Expl. Exped. Moll., p.3, pl. 1, fig. 1. Ariolimax columbianus Gould, Morch, 1859, Malak, Blatter, 6:110; W. G. Binney, 1865, Amer. Jour. Co nch., 1:48, pl. 6, figs. 11 13. Ariolimax columbianus var. maculatus "Cockerell", Binney, 1890, Third Suppl., Bull. M.C.Z., 19: 211, pl. 6, figs. A, G. A. columbianus forma typicus and forma maculatus Cockerell, 1891, Nautilus, 5:31; forma niger, 5:32 ( All form British Columbia). A. subsp. Californicus forma maculatus Cockerell, 1891, Nautilus, 5:31, foot note; 1897, Nautilus, 11:76. (No locality given). Aphallarion buttoni Pilsbry & Vanatta, 1896, Proc. Acad. Nat. Sci. Phila., p. 348, pl. 12, figs. 3, 4, 5; pl. 13, fig. 4; pl. 14, fig. 11, 12. References Burch 1962, Forsyth 2004; Mead 1943; Pilsbry 1948

PAGE 191

191 A rion ater group: Arion ater Family Arionidae Species Arion ater Linnaeus, 1758 Common Name Black arion, Black slug Red slu g Description This slug belongs to a species complex that can only be differentiated by dissecting the genitalia There are three species in this complex ( Arion ater group): Arion ater, A. rufus and A. vulgaris These slug species range from 75 180 mm in length at maturity. They may be dark brown, black, oran ge or reddish in color. They are large and bulky with long, coarse tubercles on the side and back. The juveniles of these species have an even wider range of colors and can be distinguished from mature adults by the presence of lateral stripes. Juveniles of the Arion ater complex may be confused with adults of other Arion species. The contracted body of this species is bell shaped. The sole of the foot may be black or tripartite (pale with a black vertical line down the center). The foot fringe may possess any of the following colors with vertical

PAGE 192

192 black bands : red, orange, yellow or grey. The mucus of this slug gro up is colorless and they lack a keel Molecular techniques can also be used to identify members of this group. It should be noted that hybrids between Arion ater and Arion vulgaris have been reported by Hagnell et al. 2003. Genitalic characters used to distinguish the three species: Arion ater : genitalia w ith a slender symmetrical atrium. Arion rufus : genitalia with large, thick asymmetrical atrium. Arion vulgaris : genitalia with a short, abbreviated atrium. Native Range Western and Central Europe Distribution North America : U. S.: Maine, Michigan, New York, Oregon, Wisconsin Canada: Newfoundland, Quebec, Ont ario E urope Ecology These plant pests are often found in disturbed sites. This includes gardens, greenhouses and campgrounds. This omnivores diet includes living and dead plant material, fungi, feces and carrion. It is most damaging to ornamental, vegeta ble (e.g., strawberry, sunflower, potato, cabbage, parsley, bean) and fodder crops (e.g., clover) from seedlings to fully mature plants. The mating season lasts from summer through early autumn. If disturbed, an individual from the Arion ater complex will contract its body, often twisting it and rocking side to side. It has been noted that both Arion ater and A. rufus will interbreed. This interbreeding behavior has not been recorded for Arion vulgaris A. vulgaris has the potential to live up to one year a nd can lay up to 400 eggs in a single summer. These eggs often hatch within just 3.55 weeks. Synonyms Limax ater Linnaeus, 1758 Arion empiricorum Frussac, 1819 pars.

PAGE 193

193 References Anderson 2005; Cowie et al. 2009; Forsyth 2004; Grimm et al. 2009; Hagnell et al. 2003; Horsk 2004; Kantor et al. 2009; Kerney et al. 1979; Koztowski 2005; Weidema 2006 Arion ater group: Arion rufus Family Arionidae Species Arion rufus Linnaeus, 1758

PAGE 194

194 Common Name Chocolate arion, European red slug Description This slug belongs to a species complex that can only be differentiated by dissecting the genitalia There are three species in this complex ( Arion ater group): Arion ater, A. rufus and A. vulgaris These slugs species range from 75 180 mm in length at maturity. They may be dark brown, black, orange or reddish in color. They are large and bulky with long, course tubercles on the side and back. The juveniles of these species have an even wider range of colors and can be distinguished from mature adults by the presence of lateral stripes. Juveniles of the Arion ater complex may be confused with adults of other Arion species. The contracted body of this species is bell shaped. The sole of the foot may be black or tripartite (pale with a black vertical line down the center). The foot fringe may possess any of the following colors with vertical black bands : red, orange, yellow or grey. The mucus of this slug group is colorless and they lack a keel Molecular techniques can also be used to identify members of this group. Genitalic characters used to distinguish the three species: Arion ater : genitalia with a slender symmetrical atrium. Arion rufus : genitalia with large, thick asymmetrical atrium. Arion vulgaris : genitalia with a short, abbreviated atrium. Native Range Western and Southern Europe Distribution North America : U. S.: California, Maine, Michigan, New York, Oregon, Wisconsin Canada: Newfoundland, Quebec, Ontario E urope Ecology These plant pests are often found in disturbed sites. This includes gardens, greenhouses and campgrounds. This omnivores diet includes living and dead plant material, fungi, feces and carrion. It is most damaging to ornamental, vegetable (e.g., strawberry, sunflower, potato, cabbage, parsley, bean) and fodder cr ops (e.g., clover) from seedlings to fully mature plants. The

PAGE 195

195 mating season lasts from summer through early autumn. If disturbed, an individual from the Arion ater complex will contract its body, often twisting it and rocking side to side. It has been note d that both Arion ater and A. rufus will interbreed. This interbreeding behavior has not been recorded for Arion vulgaris A. vulgaris has the potential to live up to one year and can lay up to 400 eggs in a single summer. These eggs often hatch within jus t 3.55 weeks. Synonyms Limax rufus Linnaeus, 1758 Arion ater of authors, not Linnaeus, 1758. Arion empiricorum Frussac, 1819 pars. References Anderson 2005; Cowie et al. 2009; Forsyth 2004; Grimm et al. 2009; Horsk 2004; Kantor et al. 2009; Koztowski 2005; Roth and Sadeghian 2006; Weidema 2006

PAGE 196

196 Arion ater gr oup: Arion vulgaris Family Arionidae Species Arion vulgaris MoquinTandon, 1855 Common Name Spanish arion, Iberian slug Lusitanian slug

PAGE 197

197 Description This slug belongs to a species complex that can only be differentiated by dissecting the genital ia There are three species in this complex ( Arion ater group): Arion ater, A. rufus and A. vulgaris These slugs species range from 75 180 mm in length at maturity. They may be dark brown, black, orange or reddish in color. They are large and bulky with long, course tubercles on the side and back. The juveniles of these species have an even wider range of colors and can be distinguished from mature adults by the presence of lateral stripes. Juveniles of the Arion ater complex may be confused with adults of other Arion species. The contracted body of this species is bell shaped. The sole of the foot may be black or tripartite (pale with a black vertical line down the center). The foot fringe may possess any of the following colors with vertical black bands : red, orange, yellow or grey. The mucus of this slug group is colorless and they lack a keel Molecular techniques can also be used to identify members of this group. It should be noted that hybrids between Arion ater and Arion v ulgaris have been reported by Hagnell et al. 2003. Genitalic characters used to distinguish the three species: Arion ater : genitalia with a slender symmetrical atrium. Arion rufus : genitalia with large, thick asymmetrical atrium. Arion vulgari s : genitalia with a short, abbreviated atrium. Native Range Western and Southwestern Europe Distribution North America : U. S.: Maine, Michigan, New York, Oregon, Wisconsin Canada: Newfoun dland, Quebec, Ontario E urope Ecology These plant pests are often found in disturbed sites. This includes gardens, greenhouses and campgrounds. This omnivores diet includes living and dead plant material, fungi, feces and carrion. It is most damaging to ornamental, vegetable (e.g., strawberry, sunflower, potato, cabbage, parsley, bean) and fodder crops (e.g., clover) from seedlings to fully mature plants. The mating season lasts from summer through early autumn. If disturbed, an individual from the Arion ater complex will contract its body, often twisting it and rocking side to side. It has been

PAGE 198

198 noted that both Arion ater and A. rufus will interbreed. This interbreeding behavior has not been recorded for Arion vulgaris A. vulgaris has the potential to liv e up to one year and can lay up to 400 eggs in a single summer. These eggs often hatch within just 3.55 weeks. Synonyms Arion rufus var. vulgaris MoquinTandon, 1855 Arion lusitanicus auctt., non Mabille, 1868 References Anderson 2005; Cowie et al. 2009; Forsyth 2004; Grimm et al. 2009; Hagnell et al. 2003; Horsk 2004; Kantor et al. 2009; Kerney et al. 1979; Koztowski 2005; Weidema 2006 Arion fasciatus group: Arion circumscriptus Family Arionidae

PAGE 199

199 Species Arion circumscriptus Johnston, 1828 Common Name Brown banded arion, White soled slug Description This slug belongs to a species complex that range in length from 30 to 40 mm as fully mature adults. This species complex ( Arion fasciatus group) contains the following species: Arion silvaticus A. circumscriptus and A. fasciatus Species in this group can be separated based on their genitalia The body of the slugs is grayish centrally a nd white laterally with a pair of dark colored stripes that run longitudinally. The stripes are often broken at the posterior edge of the mantle The body often appears to have a granular texture. There may also be a slight reddish color to the dorsal surface of the animal. The slightly granular mantle is rusty gray in color and lacks markings (except in Arion circumscriptus ). The tentacles and head are black in color. The pneumostome (breathing pore) occurs in the anterior one third of the slug's mantle on the right side of the body. In contracted individuals the body is bell shaped. No keel is present in this group; however, an enlarged row of pale colored tubercles may create an impression that one may exist (false keel ). As the common name (White soled slug ) suggests, the sole of this species complex is pale colored, similar to the foot fringe. The mucus secreted by this group is colorless or yellow. Molecular techniques can also be used to identify members of this group. Genitalic characters used to distinguish the three species: Arion fasciatus: genitalia with a short atrium a narrow oviduct and an unpigmented thick epiphallus. Arion circumscriptus: genitalia with a long narrow atrium a relatively narrow oviduct and a pigmented epiphallus. Arion silvaticus: genitalia with a long atrium a broad oviduct and an unpigmented narrow epiphallus. Native Range Europe Distribution North America : U.S.: Northern United States

PAGE 200

200 Canada: Ontario, Quebec, Newfoundland, British Columbia Ecology The slugs in the Arion fasciatus group are typically found in disturbed habitats; however, they commonly invade natural areas. The brown banded arion ( Arion circumscriptus ) is primarily nocturnal All three species have been reported in greenhouses and may become a serious agricultural pest. Reproduction is primarily through self fertilization Synonyms Arion bourguignati Mabille, 1868 References Anderson 2005; Branson 1959; Hutchinson and Heike 2007; Grimm et al. 2009; Kantor et al. 2009; Kerney et al. 1979 Arion fasciatus group: Arion fasciatus Family Arionidae

PAGE 201

201 Species Arion fasciatus (Nilsson, 1919) Common Name White soled slug Orang e banded arion Description This slug belongs to a species complex that range in length from 30 to 40 mm as fully mature adults. This species complex ( Arion fasciatus group) contains the fol lowing species: Arion silvaticus A. circumscriptus and A. fasciatus Species in this group can be separated based on their genitalia The body of the slugs is grayish centrally and white laterally with a pair of dark colored stripes that run longitudinally. The stripes are often broken at the posterior edge of the mantle The body often appears to have a granular texture. There may also be a slight reddish color to the dorsal surface of the animal. The slightly granular mantle is ru sty gray in color and lacks markings except in Arion circumscriptus ). A useful field identification character for this species is the presence of a yellow flush below the dark lateral bands The tentacles and head are black in color. The pneumostome (breathing pore) occurs in the anterior one third of the slug's mantle on the right side of the body. In contracted individuals the body is bell shaped. No keel is present in this group; however, an enlarged row of pale colored tubercles may create an impression that one may exist (false keel ). As the common name (White soled slug ) suggests, the sole of this species complex is pale colored, similar to the foot f ringe. The mucus secreted by this group is colorless or yellow. Molecular techniques can also be used to identify members of this group. Genitalic characters used to distinguish the three species: Arion fasciatus: genitalia with a short atrium a narrow oviduct and an unpigmented thick epiphallus. Arion circumscriptus: genitalia with a long narrow atrium a relatively narrow oviduct and a pigmented epiphallus. Arion silvaticus: genitalia with a long atrium a broad oviduct and an unpigmented n arrow epiphallus. Native Range Northwestern Europe Distribution North America :

PAGE 202

202 U.S.: Kentucky, Northern United States Canada: Ontario, Quebec, Newfoundland Ecology The slugs in the Arion fasciatus group are typically found in disturbed habitats; however, they commonly invade natural areas. The brown banded arion ( Arion circumscriptus ) is primarily nocturnal All three speci es have been reported in greenhouses and may become a serious agricultural pest. Reproduction is primarily through self fertilization Synonyms Limax fasciatus Nilsson, 1823 (non 1822) Ar ion nilssoni Pollonera, 1887 References Anderson 2005; Branson 1959; Hutchinson and Heike 2007; Grimm et al. 2009; Kantor et al. 2009; Kerney et al. 1979; Thomas et al. 2010 Arion fasciatus group: Arion silvaticus Family Arionidae

PAGE 203

203 Species Arion silvaticus Lohmander, 1937 Common Name Forest arion Description This slug belongs to a species complex that range in length from 30 to 40 mm as fully mature adults. This species complex ( Arion fasciatus group) contains the following species: Arion silvaticus A. circumscriptus and A. fasciatus Species in this group can be separated based on their genitalia The body of the slugs is grayish centrally and white laterally with a pair of dark colored stripes that run longitudinally. The stripes are often broken at the posterior edge of the mantle The body often appears to have a granular texture. There may also be a slight reddish color to the dorsal surface of the animal. The slightly granular mantle is rusty gray in color and lacks markings (except in Arion circumscriptus ). The tentacles a nd head are black in color. The pneumostome (breathing pore) occurs in the anterior one third of the slug's mantle on the right side of the body. In contracted individuals the body is bell shaped. No keel is present in this group; however, an enlarged row of pale colored tubercles may create an imp ression that one may exist (false keel ). The sole of this species complex is pale colored, similar to the foot fringe. The mucus secreted by this group is colorless or yellow. Molecular techniques can also be used to identify members of this group. Genitalic characters used to distinguish the three species: A rion fasciatus: genitalia with a short atrium a narrow oviduct and an unpigmented thick epiphallus. Arion circumscriptus: genitalia with a long narrow atrium a relatively narrow oviduct and a pigmented epiphallus. Arion silvaticus: genitalia with a long atrium a broad oviduct and an unpigmented narrow epip hallus. Native Range Europe Distribution North America : U.S.: California, Northern United States

PAGE 204

204 Canada: Ontario, Quebec, Newfoundland, British Columbia Ecology The slugs in the Arion fa sciatus group are typically found in disturbed habitats; however, they commonly invade natural areas. The brown banded arion ( Arion circumscriptus ) is primarily nocturnal All three species have been reported in greenhouses and may become a serious agricultural pest. Reproduction is primarily through self fertilization Synonyms Arion fasciatus of authors, in part, not Nilss on, 1823 Arion circumscriptus var. silvaticus Lohmander, 1937 References Anderson 2005; Branson 1959; Hutchinson and Heike 2007; Grimm et al. 2009; Kantor et al. 2009; Kerney et al. 1979; McDonnell et al. 2009 Arion hortensis group: Arion distinctus Family Arionidae

PAGE 205

205 Species Arion distinctus Mabille, 1868 Common Name Dark face arion Description This slug belongs to a species complex called the Arion hortensis group, which is comprised of Arion hortensis A. owenii and A. distinctus The Arion hortensis group is typically 2535 mm long, and is only distinguished by the morphology of the genitalia These slugs have two color morphs (dark grey or bluish grey ) that are more common than the brownish morph. They possess da rk lateral stripes, where the stripe on the right side of the animal encompasses the pneumostome (breathing pore). Like the body, the tentacles are bluish grey with a contrasting pale yellow or orange sole. The animals have no keel Contracted specimens are rounded in cross section. This group has a characteri stic yellow orange mucus. Molecular techniques can also be used to identify members of this group. Genitalic characters used to distinguish the three species: Arion distinctus : epiphallic structure conical in cross section, and covers the entire opening of the epiphallus. Arion hortensis : epiphallic structure raised with "finger like" projections, and only partially covers the opening of the epiphallus. Arion owenii : epiphallic structure flattened and irregularly shaped, and does not cover the opening of the epiphallus. Native Range Western Europe Distribution North America : U.S.: California, Pennsylvania Canada: Vancouver Southern Vancouver Island, Halifax, near Ottawa and Kingston Australasia: New Zealand

PAGE 206

206 Europe Ecology This slug consumes agriculturally important crops and often inhabit disturbed sites (e .g., gardens, roadsides). Arion hortensis and A. distinctus reproduce by cross fertilization. The means by which A. owenii reproduces has not been documented. In England, A. hortensis mates in the fall and winter while A. distinctus mates during spring and summer months. They can live up to one year. Synonyms Arion hortensis of authors in part, not Frussac, 1819 A. hortensis form 'A' of authors. References Davies 1977; Davies 1979; Grimm et al. 2009; Horsk 2004; Hunter 1966; Iglesias and Speiser 2001; Kantor et al. 2009; Roth and Sadeghian 2006

PAGE 207

207 Arion hortensis group: Arion hortensis Family Arionidae Species Arion hortensis Frussac, 1819 Common Name Garden slug Yellow soled slug Garden arion, Black field slug Southern garden slug Description This slug belongs to a species complex called the Arion hortensis group, which is comprised of Arion hortensis A. owenii and A. distinctus The Arion hortensis group is typically 2535 mm long, and is only distinguished by the morphology of the genitalia These slugs have two color morphs (dark grey or bluish grey ) that are more common than the brownish morph. They possess dark lateral stripes, where the stripe on the right side of the animal encompasses the pneumostome (breathing pore). Like the body, th e tentacles are bluish grey with a contrasting pale yellow or orange sole. The animals have no keel Contracted specimens are rounded in cross section. This group has a characteristic yellow orange mucus. Molecular techniques can also be used to identify members of this group. Genitalic characters used to dis tinguish the three species: Arion distinctus : epiphallic structure conical in cross section, and covers the entire opening of the epiphallus. Arion hortensis : epiphallic structure raised w ith "finger like" projections, and only partially covers the opening of the epiphallus. Arion owenii : epiphallic structure flattened and irregularly shaped, and does not cover the opening of the epiphallus. Native Range Western and Southern Europe

PAGE 208

208 Distribu tion North America : U.S.: California, Delaware, Kentucky, Maryland, Michigan, Minnesota, New Jersey, New York, Ohio, Pennsylvania, Washington, Wisconsin Canada: Newfoundland, Quebec, British Columbia, New England Australasia: New Zealand Europe Ecology This slug consumes agriculturally important crops and often inhabit disturbed sites (e.g., gardens, roadsides). Arion hortensis and A. distinctus reproduce by cross fertilization. The means by which A. owenii reproduces has not been documented. In England, A. hortensis mates in the fall and winter while A. distinctus mates during spring and summer months. They can live up to one year. References Anderson 2005; Davies 1977; Davies 1979; Grim m et al. 2009; Horsk 2004; Hunter 1966; Iglesias and Speiser 2001; Kantor et al. 2009; Kerney et al. 1979; McDonnell et al. 2009; Roth and Sadeghian 2006; Thomas et al. 2010

PAGE 209

209 Arion hortensis group: Arion owenii Family Arionidae Species Arion owenii (Davies, 1979) Common Name Warty arion, Inishowen slug Description This slug belongs to a species complex called the Arion hortensis group which is comprised of Arion hortensis A. owenii and A. distinctus The Arion hortensis group is typically 2535 mm long, and is only distinguished by the morphology of the genitalia These slugs have two color morphs (dark grey or bluish grey ) that are more common than the brownish morph. They possess dar k lateral stripes, where the stripe on the right side of the animal encompasses the pneumostome (breathing pore). Like the body, the tentacles are bluish grey with a contrasting pale yellow or orange sole. The animals have no keel Contracted specimens are rounded in cross section. This group has a characteris tic yellow orange mucus. Molecular techniques can also be used to identify members of this group. Genitalic characters used to distinguish the three species: Arion distinctus : epiphallic s tructure conical in cross section, and covers the entire opening of the epiphallus. Arion hortensis : epiphallic structure raised with "finger like" projections, and only partially covers t he opening of the epiphallus.

PAGE 210

210 Arion owenii : epiphallic structure flattened and irregularly shaped, and does not cover the opening of the epiphallus. Native Range Europe Distribution North America: U.S.: Not reported Europe: Ireland Ecology This slug consumes agriculturally important crops and often inhabit disturbed sites (e.g., gardens, roadsides). Arion hortensis and A. distinctus reproduce by cross fertilization. The means by which A. o wenii reproduces has not been documented. In England, A. hortensis mates in the fall and winter while A. distinctus mates during spring and summer months. They can live up to one year. References Anderson 2005; Davies 1977; Davies 1979; Grimm et al. 2009; Horsk 2004; Hunter 1966; Iglesias and Speiser 2001; Kantor et al. 2009

PAGE 211

211 Arion intermedius Family Arionidae Species Arion intermedius (Normand, 1852) Co mmon Name Hedgehog Arion, Hedgehog slug Description Arion intermedius is one of the smaller Arion species. This slug rang es in length from 1520 mm long with a yellow to grey body and dark grey tentacles and head. The contracted body of this s pecimen is not bell shaped in cross section. Upon close observation the tubercles are noted to form sharp, transparent points, giving the animal a prickly appearance. The tail of the slug has a pale, narrow foot fringe and also lacks a keel Th e sole of the foot is quite distinguishable from other slug species in North America by being yellow grey to pale orange i n color. The mucus produced by this species is pale yellow to bright yellow in color. Though this species is quite distinguishable, it can be mistaken for juveniles of other species (e.g., Arion rufus ). Native Range Western Europe Distribution North Ameri ca : U.S. Canada Pacific Islands: Hawaii Australasia: New Zealand

PAGE 212

212 Asia: Sri Lanka Europe : Western and Central Europe Ecology The diet of Arion intermedius includes living plant tissue and fungi. In areas where it has been introduced, this species can be very destructive. It has been recorded to consume ornamental plants and field crops (e.g. wheat, corn). Self fertilization is the primary means of reproduction although out crossing has been noted to occur. Habitats for this species include fields, grassy roadsides, mature gardens and woods. It is capable of living up to a year. Synonyms References Forsyth 2004; Grimm et al. 2009; Kantor et al. 2009; Kerney et al. 1979; Meyer and Cowie 2010; Naggs et al. 2003

PAGE 213

213 Arion subfuscus group: Arion fuscus Family Arion idae Species Arion fuscus (Mller, 1774) Common Name None reported Description The Arion subfuscus group typical contains slugs that are fairly large, often attaining a maximum length of 70 mm as fully mature adults. A. subfuscus and A. fuscus were treated as the same species (A. subfuscus) until recently. They can be separated by molecular techniques as well as by internal morphological characters explained below. They range in color from grey brown to orange brown and usually have dark brown bands running down the sides, laterally. The pneumostome is encircled by the stripe on the right side of the animal. Unlike others in this genus, individuals in the A. subfuscus group are rounded when contracted. The tubercles are minute and elongated, and the keel is absent. The foot fringe has vertical bands running its length. The sole of this group is dirty white, and the mucus produced may either be yellow, orange and on rare occassions clear. Molecular techniques can also be used to identif y members of this group. The distinguishing morphological features of each species are: Arion subfuscus (Draparnaud, 1805) Genitalia large, light lavender in color and located on the ma rgin of the digestive gland Arion fuscus (Muller, 1774) Genitalia small, dark in color and completely embedded in the digestive gland. Native Range Europe

PAGE 214

214 Distribution Europe Ecology This pestifierous species can be found in a variety of habitats (e.g. forests, fields, gardens). References Anderson 2005; Beyer and Saari 1978; Grimm et al. 2009; Kantor et al. 2009; McDonnell et al. 2011; Pinceel et al. 2005 Arion subfuscus group: Arion subfuscus Family Arionidae

PAGE 215

215 Species Arion subfuscus (Draparnaud, 1805) Common Name Dusky arion Description The Arion s ubfuscus group typically contains slugs that are fairly large, often attaining a maximum length of 70 mm as fully mature adults. A. subfuscus and A. fuscus were treated as the same species (A. subfuscus) until recently. They can be separated by molecular techniques as well as by internal morphological characters explained below. They range in color from grey brown to orange b rown and usually have dark brown bands running down the sides, laterally. The pneumostome is encircled by the stripe on the right side of the animal. Unlike others in this genus, individuals in the A. subfuscus group are rounded when contracted. The tubercles are minute and elongated and the keel is absent. The foot fringe has vertical bands running its length. The sole of this group is dirty white, and the mucus produced may either be yellow, orange and on rare occassions clear. Molecular techniques can also be used to identify members of this group. The distinguishing morphological features of each species are: Arion subfuscus (Draparnaud, 1805) Genitalia large, light lavender in color and located on the margin of the digestive gland Arion fuscus (Muller, 1774) Genitalia small, dark in color and completely embedded in the digestive gland. Native Range Northern and Western Europe Distribution North America : U.S.: California, Connecticut, Delaware, Kentucky, Maine, Maryland, Massachusetts, New Hampshire, New York, North Carolina, Pennsylvania, Rhode Island, Vermont, Virginia, Washington D.C., Wisconsin Canada Europe

PAGE 216

216 Ecology This pestifierous species can be found in a variety of habitats (e.g. forests, fields, gardens). It has been suggested that Arion subfuscus may be a very competitive species as it has been documented that in some areas where the slug has been introduced, it occurs in numbers larger than that of native species. Synonyms Limax subfuscus Draparnaud, 1805 Arion krynickii Kaleniczenko, 1851 Arion brunneus Lehmann, 1862 Arion esthonicus Poska Teiss, 1927 References Anderson 2005; Beyer and Saari 1978; Grimm et al. 2009; Kantor et al. 2009; McDonnell, R.J. et al. 2011; Pinceel et al. 2005; Roth and Sadeghian 2006

PAGE 217

217 Boettgerilla pallens Family Boettgerillidae Species Boettgerilla pallens Simroth, 1912 Common Name Wormslug Desc ription The wormslug is very narrow in appearance. It has the ability to measure up to 60 mm when fully extended, although individuals measuring between 3040 mm are more common. The slug's color varies form a pale yellow to grey to blue grey. In most individuals the back, mantle, head and tentacles are slightly darker than the rest of the body. The sole of the foot is a pale yellow grey and produces a clear mucus. The keel of this slug extends from the tip of the tail to the posterior edge of the mantle The juveniles of this species are much paler than the adults and in some cases may be pale grey white. Native Range Southeastern Europe

PAGE 218

218 Distribution North America : Canada: British Columbia South America : Columbia Europe Ecology The wormslug can be found in greenhouses, gardens, recreational areas, natural areas and nurseries. It is often found in the soil, and is capable of burrowing as deep as 60 cm. It may also occupy burrows made by earthworms. The diet of this slug includes fungi, detritus material, carrion and eggs of other terrest rial molluscs This slug also consume plant roots, and are thus an important nursery and greenhouse pest. Synonyms Boettgerilla vermiformis Wiktor, 1959. Simroth 1912: 55, pl. 3, fig. 50, pl. 8, fig. 32 References Anderson 2005; Grimm et al. 2009; Gunn 1992; Horsak et al. 2004; Kantor et al. 2009; Kerney et al. 1979; Reise et al. 2000

PAGE 219

219 Bradybaenidae Family Bradybaenidae Species Acusta touranensis (Souleyet, 1842) Bradybaena similaris (Ferussac, 1821) Fruticicola fruticum (Muller, 1774) Common Name Acusta touranensis : None reported Bradybaena similaris : Asian tramp snail Fruticicola fruticum : Bush snail Description The Asian tramp snail is approximately 12 mm in length and 12 18 mm wide with 5.5 whorls In this species, both sinistral (mouth on the left) and dextral (mouth on the right) individuals exist. There are four distinct color morphs: 1. yellow tan without a band, 2. yellow tan with a chestnut colored stripe, 3. pale brown without a band, 3. pale brown with a chestnut color band. The bush snail is also variable in color ranging from pale yellow, to white to light red brown, sometimes with a dark chestnut colored stripe. This snail is approximately 10 19 mm high and 1323 mm wide, although specimens measuring up to 25.4 mm have been documented. Adults often possess 6 whorls but a range of 5 6.5 is not uncommon. Native Range Bradybaena similaris : Southeast Asia Fruticicola fruticum : Central and Eastern Europe, and Asia Distribution North America :

PAGE 220

220 U.S.: southeastern U.S. including A labama, Florida, Louisiana, Mississippi, Texas Central and South America Pacific Islands : Hawaiian Islands Caribbean : Puerto Rico, Jamaica Europe ( Fruticicola fruticum ) Auatralasia: Australia Asia Africa Ecology This tropical pest species (Asian tramp sna il) has been known to consume cucurbits, grapes, Hibiscus sp., legumes and various ornamental plants. Self fertilization is possible in this snail. This species achieve full maturity in 100 days on average and longevity is approximately 144 days. The numbe r of eggs produced per clutch ranges form 1 to 202. The bush snail typically matures within a year of hatching and can persist for as many as 5 years or longer. This species is frequently found along roadsides and in lush, damp vegetation. Synonyms Fruti cicola fruticum: Helix fruticum (Muller, 1774) Bradybaena fruticum (Muller, 1774) References Airo et al. 2003; Barker 200; Carvallo et al. 2008; Chang 1990; Cowie et al. 2008; Cowie et al. 2009; Falniowski et al. 2004; Godan 1983; Kerney et al. 1979; Kom ai and Emura 1955; Naggs et al. 2003; Rosenberg and Muratov 2006; Solem 1959; Utsuno and Asami 2010

PAGE 221

221 Bulimulus spp. Family Orthalicidae

PAGE 222

222 Species Bulimulus diaphanus fraterculus (Potiez and Michaud, 1835) Bulimulus guadalupensis (Bruguiere, 1789) Common Name Bulimulus diaphanus fraterculus : Clear bulumulus Bulimulus guadalupensis : The Guadaloupe snail, West Indian bulimilus, Snubnose sculpin Description Bulimulus diaphanus fraterculus : This species will measure up to 18 mm high and 8 mm wide. Bulimulus guadal upensis : The thick, opaque shell of this species does not exceed 24 mm in height The apex of the shell is offwhite to brown in color. There may be one or two faint or three st rong brown stripes following the whorls of the shell There may also be a thin, white, spiral stripes. Native Range Lesser and Greater Antilles Distribution North America : U.S.: Florida Caribbean : Throughout e.g., Saint Martin; Saint Barts; Saint Kitts; Barbuda; Antigua; Guadeloupe; Les Saintes, Dominica, Pue rto Rico, Jamaica Synonyms Bulimulus diaphanus fraterculus : Helix (Cochlogena) fraterculus Ferussac, 1821 Bulimus fraterculus Ferussac, 1835 Bulimulus diaphanus Bulimulus guadalupensis : Bulimulus exilis

PAGE 223

223 Bulumulus guadalupensis Helix exilis Thaumastus exilis References Abbott 1989; Lechmere Guppy 1866; Robinson et al. 2009; Rosenberg and Muratov 2006 Candidula intersecta Family Hygromiidae

PAGE 224

224 Species Candidula intersecta Poir et, 1801 Common Name Wrinkled dune snail Description The wrinkled dune snail's shell can attain a height of 5 8 mm and a width of 7 13 mm, with 5 to 6 1/2 whorls The shell is o ffwhite to pale yellow in color with brown bands or spots. The color pattern of this species is variable. There is often an irregular white stripe on the body whorl Albino or browncolored morphs of this species have been reported in Europe. The body of the animal is pale yellow or blue gray in color. Native Range Western Europe Distribution North America : U.S.: Oregon So uth America : Columbia, Chile Australasia: New Zealand, Australia Europe Ecology This species is often found in open, dry areas (e.g., pastures and coastal plains). It is reported to be a pest of apples, pears, plums and peaches. The snail will damage the f ruit while it is still attached to the tree. Apart from the direct, reduced market value of the fruit, this type of feeding damage allows for secondary infections to the fruit and tree. In some instances, the tree may die from such infections. This species also feeds on both the seeds and the seedlings of cereal crops. The wrinkled dune snail has the propensity to aggregate on vertical structure (e.g., plants, fences); as such, they often pose a contamination risk to cereal grains during harvest, as well as allow for secondary infestation by fungal pathogens, which may make the grain toxic. In field cropping systems, this species is able to survive cultivation, therefore making it difficult to manage.

PAGE 225

225 Synonyms Helix intersecta Poiret, 1801 References Anders on 2005; Godan 1983; Kerney et al. 1979 Cepaea hortensis Family Helicidae Species Cepaea hortens is (Muller, 1774) Common Name White lipped snail, Small banded snail

PAGE 226

226 Description The glossy shell of this snail ranges in height from 10 to 18 mm and a diameter of 14 to 22 mm. The number of whorls on the shell may be either 5 5 1/2 depending on locality. The shell is smooth and may have a uniform color that ranges from primrose yellow, olive yellow, grey yellow or grey yellow brown with the lip being white in color. The shells may have one or five stripes that are chestnut brown i n color. There are also fine growth lines on the external surface of the shell. Cepaea nemoralis and C. hortensis can be separated by the their distinctly colored apertural lip In adult specimens of C. nemoralis the lip is always brown, while that of C. hortensis is white. Also C. nemoralis is larger than C. hortensis. Native Range Western and Central Europe Distribution No rth America : U.S.: Massachusetts, New York, Vermont Canada: Newfoundland, Quebec Atlantic Islands : Iceland Europe : Central and Northern Ecology This snail typically infests greenhouses and its longevity is approximately 5 years. Synonyms Helix subglobosa A. Binney, 1837, Boston Journ. Nat. Hist., 1:485 Helix hortensis Muller, 1774. Verm. Hist., 2: 52; A. Binney, 1851, Terr. Moll., 2:111, l8 Tachea hortensis W. G. Binney, 1878, Terr. Moll., 5: 378, figs. 262, 263 References Anderson 2005; Boycott 1934; Horsak 2004; Kantoret al. 2009; Kerney et al. 1979; Pilsbry 1939

PAGE 227

227 Cepaea nemoralis Family Helicidae Species Cepaea nemoralis (Linnaeus, 1758) Common Name Brown lipped snail, Larger banded snail, Banded wood snail, Grove snail Description The heliciform shell of this snail ranges in width from 18 25 mm (rarely 32 mm), attaining a height of approximately 1222 mm (rarely 28 mm). The height of the shell is usually less than the width of the aperture. The shell is dense and has a slight sheen with few growth lines. The shell may be brown, orange, red, yellow or olive in color and may posses one to five black or dark brown (cinnamon) spiral stripes which may coalesce or be absent. There are 4 1/2 to 5 1/2 whorls with the last descending in front the aperture. The lip is purple brown, thickened and slightly curved. The umbilicus is absent in the adults and narrow in the juveniles. The body of the snail is cream colored; however, the tentacle and head are darker in color.

PAGE 228

228 Cepaea nemoralis and C. hortensis can be separated by the their distinctly colored apertural lip In adult specimens of C. nemoralis the lip is always brown, while that of C. hortensis is white. Also C. nemoralis is larger than C. hortensis. Native Range Western Europe Distribution North America : U.S.: Maine, Maryland, Massachusetts, New Jersey, New York, Ohio, Tennessee, Virginia, West Virginia Canada: Ontario Europe : Central and Western Ecology This snail is commonly found in urban areas where it inhabits gardens or abandoned lots. This snail has frequently been observed aestivating on tree trunks. The diet of this snail includes dead and living plant material, carrion, fungi, moss and insects (thrips, aphids). In some cases it may take approximately three years for this animal to achieve maturity and longevity is approximately 5 years. Polymorphism observed in this snail is genetically determined. Synonyms Tachea nemoralis L. Binney, 1878, Terr. Moll 5:379, fig. 264; 1885, Man. Amer. L. Sh., Bull. U.S. Nat Mus. No. 28, p.468, fig. 512 Helix nemoralis Linnaeus, 1798. Syst. Nat., Ed. X, p. 773 R eferences Anderson 2005; Boycott 1934; Forsyth 2004; Kantor et al. 2009; Kerney et al. 1979; Orstan et al. 2011; Pilsbry 1939

PAGE 229

229 Cernuella spp. Family Hygromiidae Species Cer nuella neglecta (Draparnaud, 1805) C. virgata (DaCosta, 1778) Common Name Cernuella neglecta : Dune snail C. virgata: Maritime garden snail, Vineyard snail, White snail, Striped snail, Zoned snail Description Cernuella neglecta : The shell of the dune snail is 610 mm high and 918 mm wide, with 56 whorls The shell has a white background with several brownpink colored stripes. The aperture of the shell may have a pinkish lip on the inside. The shell of this species is smoother and more depressed than C. virgata.

PAGE 230

230 C. virgata: This shell of this species may attain dimensions as large as 19 mm high and 25 mm wide, with 57 whorls The color of this snail's shell is not uniform. The shell may have dark colored stripes that ma y or may not be continuous (may appear as spots or bands ). Native Range C. neglecta : Mediterranean region C. virgata: Mediterranean region and Western Europe Distribution Cernuella virgata: North America : U.S.: North Carolina, Washington Europe Australia Ecology This group is known to be a pest of small grains and seedling production. This pest species has the potential to produce 60 eggs per clutch and as many as 40 clutches per year. T his species is considered a significant agricultural contaminant of small grains due to sheer numbers of snails that occasionally aggregate on the crop. They cause significant economic losses to farmers as their aggregation on crops clog and damage machine ry during harvest. The presence of large numbers of snails in harvested grain elevates the moisture content and promotes secondary infestation by fungal pathogens that produce toxin in the grain. Toxin contaminated grain is unmarketable, as it is not fit f or animal and human consumption. Multiple countries have rejected shipments of grain from Australia due to contamination by this species. Synonyms Cernuella neglecta : Helix neglecta Draparnaud, 1805 C. virgata: Cochlea virgata Da Costa, 1778 Helix variab ilis Draparnaud, 1801 Xerophila euxina Clessin, 1883

PAGE 231

231 References Anderson 2005; Barker 2002; Hitchcox and Zimmerman 2004; Kerney et al. 1979; Robinson and Slapcinsky 2005 Cochlicella spp. Family Cochlicellidae Species Cochlicella acuta (da Costa, 1778)

PAGE 232

232 C. conoidea (Draparnaud. 1801) C. ventricosa (Draparnaud, 1801) Common Name Cochlicella acuta: Pointed helicelid, Conical snail C. conoidea: None reported C. ventricosa : None reported Description Cochlicella acuta: The pointed helicellid's shell is approximately 1020 mm high and 47 mm wide. It typically has a high spire giving it an elongated appearance, hence its name. The color of this snail is very variable. It may range from being completely off white to having regular browncolored bands and st ripes over the entire shell C. conoidea: This species is approximately 6 9 mm high and 56 mm wide, with 4.56 whorls T he shell is either pale grey or tan with brown spots or bands There is also a browncolored stripe at the base of the body whorl The umbilicus (navel) is narrow. The body of t he animal is apple yellow to tan with a lighter foot The ocular (eye bearing) tentacles are very long and the posterior tip of the foot is pointed. Native Range C. acuta: Mediterranean region and Atlantic Distribution Australasia: Australia E urope : Spain, France, Belgium, Netherlands, British Isles, Turkey ( C. acuta) Mediterranean : Greece, Israel, Egypt Ecology This coastal species prefers sandy and calcareous soils where it is often found in grassy areas. Under unfavorable environmental conditions, this species will aestivate on vertical structures (e.g., posts, walls). This snail can lay on average 36 eggs per clutch. Cochlicella acuta has been reported as a pest of fodder cro ps (i.e. alfalfa, clover, lupine).

PAGE 233

233 Synonyms Cochlicella acuta: Bulimus acustus Zelebor, 1865. Mollusca. In: F. Unger and Th. Kotschy. Die Insel Cypern ihrer physischen und organischen Natur nanch mit Rucksicht auf ihre fruhere Geschichte geschildert: 59 3. Cochlicella acuta Kerny and Cameron, 1979. A field guide to the land snails of Britain and Northwest Europe: on pg. 183, pl.24 fig. 2a, b. Cochlicella conoidea: Cochlicella conoidea, Kerney and Cameron (edition Gittenberger), 1980. Elseviers slakkeng ids: 1 310. Amsterdam & Brusessel. (on pg. 244. fig. 47). References Anderson 2005; Barker 2002; Cowie et al. 2009; Kerney et al. 1979; Gittenberger 1991; Godan 1983

PAGE 234

234 Cochlicopa lubrica Family Cochliocopidae Species Cochlicopa lubrica (Muller, 1774) Common Name Glossy pillar Description This glossy shell ranges in length from 5.27 mm and is about 2.7 mm wide, with 5.56 whorls The shell is off white to brown in color and the body of the animal is dark blueblack. The tip of the lip of the shell may have a purplish tinge. Native Range Holarctic Distribution North America : U.S.: Alaska, California, Colorado, Iowa, Idaho, Illinois, Indiana, Kansas, Massachusetts, Maine, Michigan, Minnesota, Missouri, North Carolina, Nebraska, New Hampshire, New Jersey, New Mexico, New Yor k, Ohio, Pennsylvania, Rhode Island, South Dakota, Tennessee, Utah, Virginia, Vermont, Washington, West Virginia, Wisconsin Canada: Alberta, British Columbia, New Brunswick, Ontario, Quebec, Newfoundland Europe : Czech Republic, Netherlands, Poland, Slovak ia, Great Britain, Ireland Asia: Sri Lanka Australasia: New Zealand

PAGE 235

235 Ecology The glossy snail inhabits forests, riverbanks and grassy areas in close proximity to human dwellings. Synonyms Cionella columna Clessin, 1875 Bulimus nitidissimus Krynicki, 1833 Cionella lubrica Helix lubrica Muller, 1774 References Anderson 2005; Georgiev 2008; Kantor et al. 2009; Kerney et al. 1979; Naggs et al. 2003; Perez and Cordeiro 2008; Quick 1954 Cornu aspersum Family Helicidae Species Cornu aspersum (Muller, 1774) Common Name Brown garden snail, Common snai l, Garden snail

PAGE 236

236 Description Cornu aspersum is a moderately sized snail with a heliciform shell ranging in height from 20 3 5 mm and width from 25 40 mm (rarely 45 mm). The shell is yellow brown and may possess darker brown spiral stripes interrupted by lighter, irregular markings and streaks, creating a banded appearance. There are irregular dimples on the shell There are 4 1/2 to 5 whorls The aperture (mouth) is lar ge and rounded and has a lip that is white, faintly thickened and slightly recurved. In adults of this species, the umbilicus is normally absent or closed, though it may open to form a narrow slit in rare cases. The body of the animal is grey to pale brownochre and the tubercles are yellow. The mantle is somewhat black and speckled with grey yellow. Note: The surface sculpturing of the shell can be used to distinguish between Helix spp. and Cornu aspersum The shell of Cornu aspersum is characteristically wrinkled, while the shell surface of Helix species lack wrinkles. Native Range Mediterranean region and Western Europe Distribution North America : U.S.: East and West Coast of the U.S., Southeastern States except Florida Canada: West Coast South and Central America: Mexico, Chile, Argentina Caribbean : Haiti Pacific Islands: Hawaiian Islands Atlantic Islands Australasia: Australia, New Zealand Asia South Africa Europe Other: western Mediterranean region

PAGE 237

237 Ecology This edible snail l ives in gardens and along roadsides and consumes both living and dead plant material. This species is recorded as a pest of citrus in California. In many parts of the world, C. aspersum attacks vegetables (carrot, cabbage, lettuce, onion, tomato), cereals (oats, wheat, barley), flowers (sweet pea, lilies, carnation, aster, pansy), ornamental (California boxwood, hibiscus, rose) and fruit trees (peach, plum, apple, apricot). The garden snail can lay as many as 80 eggs per clutch. The juveniles of this species will achieve maturity in 12 years. Longevity is approximately 5 years. Synonyms Helix aspersa Muller, 1774 Cantareus aspersus (Muller) Cryptomphalus aspersus (Muller) References Anderson 2005; Boycott 1934; Cowie 2000; Cowie et al. 2008; Cowie et al. 2 009; Forsyth 2004; Kerney et al. 1979

PAGE 238

238 Deroceras agreste Family Agriolimacidae Species Deroceras agreste (Linnaeus, 1758) Common Name Field slug Grey field slug Milky slug Description This slug attains a maximum length of 50 mm when fully extended. It is pale brown to tan in color and does not have any conspicuous body markings. The head and tentacles are dark brown. The tubercles of this species are not prominent. The sole is white and normally produces clear mucus, however the sole will produce milky white mucus when the animal is disturbed. In order to confirm the identity of this species, dissection and observation of the genitalia are required. Deroceras agreste The penis (p) of this species is broad with only a single appendix. Deroceras caucasicum: The penis is broad and has two appendixes at the tip with the vas deferens emerges between them. The posterior edge of the penis is pigmented (dark colored) and there is a hard "clam shaped" shell like plate inside the penis. Deroceras laeve: The penis of this species is long, narrow and mostly twisted, wi th only a single appendix. It should be noted that a penis may be absent in some specimens. Deroceras panormitanum: The penis in the species is broad and markedly bilobed with 4 6 appendixes. Deroceras reticulatum: The penis (p) in the species is broad wi th only a single, irregularly branched appendix. Native Range Western Palaearctic

PAGE 239

239 Distribution Asia Europe : North and Central including Scandinavia and Russia Ecology Habitats of this species include moist, natural and lightly disturbed grassy areas. It has also been noted to tolerate marshy habitats. This species has been reported as a common pest of agricultural crops (e.g., lettuce), seedlings and wild flowers. It also consumes dead vegetation, therefore allowing it to survive periods of fallow. It typi cally lives for a year. Upon maturity it will lay eggs approximately 10 days after mating. The incubation period of this slug is about 3 weeks. Synonyms Limax agrestis Linnaeus, 1758 Agriol imax agrestis (Linnaeus) Agriolimax fedschenkoi Koch et Heynemann, 1874 Agriolimax transcaucasicus coeciger Simroth, 1901 References Anderson 2005; Kantor et al. 2009; Kerney et al. 1979; Niemela 1998; Wiktor 2000 Deroceras caucasicum Family Agriolimacidae

PAGE 240

240 Species Deroceras caucasicum (Simroth, 1901) Common Nam e None reported Description This slug has the potential to attain a length of 40 mm as fully mature adults. The adult color may range from whitish to dark brown. The head region and tentacles are dark brown to black in color. The mantle may be spotted in juveniles of this species. The sole is pale and the solemucus colorless. In order to confirm the identity of this species, dissection and observation of the genitalia are requir ed. Deroceras agreste The penis (p) of this species is broad with only a single appendix. Deroceras caucasicum: The penis is broad and has two appendixes at the tip with the vas deferens emerges between them. The posterior edge of the penis is pigmented (dark colored) and there is a hard "clam shaped" shell like plate inside the penis. Deroceras laeve: The penis of this species is long, narrow and mostly twisted, with only a single appen dix. It should be noted that a penis may be absent in some specimens. Deroceras panormitanum: The penis in the species is broad and markedly bilobed with 4 6 appendixes. Deroceras reticulatum: The penis (p) in the species is broad with only a single, irre gularly branched appendix. Native Range Caucasus Region: Northern Iran, Black Sea, Turkey and Crimea Distribution Asia : Central, Iran Europe : Turkey, Ukraine Ecology This slug species has been reported as a pest of strawberries, cabbage, cucumber, tomatoes, pepper and eggplant. This slug can survive in diverse habitats ranging from

PAGE 241

241 moist meadows to partial deserts. The numbe r of generations per year may vary from one to three depending on the location. Synonyms Agriolimax dymczewiczi sensu Simroth, 1901 non Kaleniczenko, 1851 Agriolimax caspius Simroth, 1901 Lytopelte grusina Simroth, 1901 Lytopelte caucasicus Simroth, 1901 L ytopelte caucasica armenia Akramowski, 1948 Deroceras hamatus Skljar, 1975 References Kantor et al. 2009; Son 2010; Uvalieva 1978; Wiktor 2000; Wiktor 2004 Deroceras laeve Family Agriolimacidae Species Deroceras laeve (O.F. Muller, 1774) Common Name Marsh slug Meadow slug Brown slug Description The meadow slug is a small slug approximately 2535 mm long. It ranges in color from dark brown or yellowish to almost black, while the head and tentacles posses a characteristic smoky, bluish black color. The overall body shape of the slug is

PAGE 242

242 cy lindrical, elongated and ends in a short keel The mantle is oval in shape with fine concentric striations without spots or blotches. The back of the slug is covered with conspicuous elongated tubercles and furrows. The foot is narrow and whitish in color and produces mucus that is thin, watery, non adhesive and colorless. It may be possible to distinguish this sp ecies from D. panormitanum by the slope of the tail. The tail of this species is bluntly rounded, while the tail of D. panormitanum gradually tapers to a point. In order to confirm the identity of this species, dissection and observation of the genitalia are required. Deroceras agreste The penis (p) of this species is broad with only a single appendix. Deroceras caucasicum: The penis is broad and has two appendixes at the tip with the vas deferens emerges between them. The posterior edge of the penis is pigmented (dark colored) and there is a hard "clam shaped" shell like plate inside the penis. Deroceras laeve: The penis of this species is long, narrow and mostly twisted, with only a single appendix. It should be noted that a penis may be absent in some specimens. Deroceras panormitanum: The penis in the species is broad and markedly bilobed with 4 6 appendixes. Deroceras reticulatum: The penis (p) in the species is broad with only a single, irregularly branched appendix. Native Range Holarctic Distribution North America : U. S.: Alabama, Alaska, Arkansas, California, Delaware, Florida, Georgia, Idaho, Illinois, Indiana, Iowa, Kansas, Kentucky, Louisiana, Maine, Maryland, Michigan, Mississippi, Missouri, Nebraska, New Jersey, New Mexico, New York, North Carolina, North Dakota, Ohio, Oklahoma, Pennsylvania, South Dakota, Tennessee, Texas, Utah, Vermont, Virginia, Washington, West Virginia, Wisconsin Canada: Newfoundland, British Columbia, Alberta, Nova Scotia, Ontario, Quebec Caribbean: Jamaica Europe South America

PAGE 243

243 Asia: Sri Lanka Pacific Islands: Hawaii Australasia: New Zealand Ecology This species primarily inhabits moist habitats such as wet marshes, woods and meadows, and sometimes found in greenhouses. This species has the potential to become a garden pest as it consumes living and dead plant material. Deroceras laeve reproduces year round, and generally becomes more ac tive approximately three weeks before other species in the spring. The animal reproduces by self fertilization although outcrossing has been recorded. The round to oval eggs are laid in clutches of approximately 33 (often times much fewer). They measure between 13 mm, and often hatch in 1015 days. The translucent eggs are deposited in crevices in the soil or leaf litter. As the eggs mature, the color changes to a creamish color. Synonyms Limax laevis Muller, 1774, Verm. Terr. Et fluv. Hist., 2: 2 (Denmark) L. gracilis Rafinesque, 1820, Ann. of Nat., 1: 10 (near Hendersonville, Kentucky, in woods). L. campestris A. Binney, 1842, Proc. Bost. Soc. N. H., 1:52 (New England States, New York, Ohio, Missouri): 1842, Bost. Jour. N. H., 4:169; 1851, Terr. Moll., 2:41, pl.64, fig. 3. L. weinlandi Heynemann, 1862, Zeits. F. Malak., 10: 212, pl. 3, fig. 1 (North America) L. campestr is var occidentalis Cooper, 1872, Proc. Acad. Nat. Sci. Phila., p.146, pl. 3, figs. C, 1 5 (California); Cf. W. G. binney, Terr. Moll., 5: 150, pl. 1, fig. L; 3d Suppl., Bull. Mus. Comp. Zool., 19: 206, pl. 8, fig. H (living animal). L. montanus Ingersol l, 1875, Bull. U. S. Geol. And Geogr. Surv. Terr., (2) no. 1: 130 (Hot Sulphur Springs, Colo.); W.G. Binney, 1878, Terr. Moll., 5:152, pl. xii, fig. B (genitalia). Not Limax monotanus Leydig, 1871. L. costaneus Ingersoll, 1875, 1.c., p. 131. (Blue River v ally, Colorado) L. ingersolli W.G. Binney, 1875, Proc. Acad. Nat. Sci. Phila., p. 176; Ann. Lyc. N. H. of N. Y., 10: 169. L. hyperboreus [? Westerleund, 1876, Nachrbl. D. Malak. Ges., 8:97; 1877, K. Svenska Vet. Akad. Handl., 14, no. 12, pl. 21 Agriolim ax montanus Ing., Cockerell, 1888, Jour. of Conch., 5: 358, with forms typicus, intermedius and t ristis p. 359. Limax hemphili W.G. Binney, 1890, 3d Suppl., Bull. Mus. Comp. Zool., 19: 205, pl. viii, fig. E; pl I, fig. 13; pl. ii, fig. 3; 1892, 4th Suppl ., Bull. M.C.Z. 22: 166, pl.3, fig. I. with var. pictus. Agriolimax campestris zonatipes Cockerell, 1892, The Conchologist. 2: 72.

PAGE 244

244 Agriolimax hemphilli ashmuni Pilsbry & Vanatta, in Pilsbry & Ferriss, 1910. Proc. Acad. Nat. Sci. Phil. For 1909, 61: 512, fig. 11 a c (Huachuca Mts., Arizona, in Miller (type loc.), Brown and Tanner canyons and Nogales, Arizona; Pilsbry & Ferris, 1910 same Proc, 62: 130 (Chiricahua Mts., Arizona, at about 8000 ft.). Agriolimax psudodioicus Velitchkovsky, 1910. Deroceras sch ulzi Tzvetkov et Matyokin, 1946. References Anderson 2005; Branson 1959; Branson 1962; Branson 1980; Cowie 1997; Cowie et al. 2008; Forsyth 2004; Horsak 2004; Kantor et al. 2009; Kerney et al. 1979; Meyer and Cowie 2010; Naggs et al. 2003; Perez and Cordei ro 2008; Pilsbry 1939; Rosenberg and Muratov 2006; Wiktor 2000

PAGE 245

245 Deroceras panormitanum Family Agriolimacidae Species Deroceras panormitanum (Lessona & Pollonera, 1891) Common Name Longneck fieldslug, Brown field slug Description De roceras panormitanum is a chocolatebrown, grey brown or almost black slug that ranges in length form 2530 mm. The body of the slug is covered with dark brown speckles or flecks. The skin is very thin and almost completely translucent The mant le is lighter in color over the lung and the sole is light grey. The mucus this slug produces is thin, colorless and not excessively gummy. It may be possible to distinguish this species f rom D. laeve by the slope of the tail. The tail of this species gradually tapers to a point, while the tail of D. laeve is bluntly rounded. In order to confirm the identity of this specimen, dissection and observation of the genitalia are required.

PAGE 246

246 Deroceras agreste The penis (p) of this species is broad with only a single appendix. Deroceras caucasicum: The penis is broad and has two appendixes at the tip with the vas deferens emerges between them. The posterior edge of the penis is pigmented (dark colored) and there is a hard "clam shaped" shell like plate inside the penis. Deroceras laeve: The penis of this species is l ong, narrow and mostly twisted, with only a single appendix. It should be noted that a penis may be absent in some specimens. Deroceras panormitanum: The penis in the species is broad and markedly bilobed with 4 6 appendixes. Deroceras reticulatum: The penis (p) in the species is broad with only a single, irregularly branched appendix. Native Range Southwest Europe Distribution North America : U.S.: Western (Utah, Colorado, California) Canada South America: Columbia Atlantic Islands : Canary Islands, Tri stan da Cunha Australasia: Australia; New Zealand Africa : South including Marion Island Europe Ecology The longneck fieldslug is a fast moving slug which is usually associated with human d wellings. It can be found in greenhouses, gardens, pastures, nurseries and commercial cropping systems. The diet includes living and dead plant material and this species has been reported as a pest of lettuce, asparagus, cereal and root crops. Deroceras panormitanum has been reported to display aggressive behavior involving tail lashing and biting and cannibalism. Eggs range from 1.51.75 mm in diameter and this species reproduce year round.

PAGE 247

247 Synonyms Agriolimax panormitanum Lesson & Pollonera, 1882. Monogr afia dei Limacidi Italiani, Mem. R. Accad. Torino (2)35: 52. Type locality Sicily. Limax panormitanum Lessona & Pollonera, 1882 Limax queenslandicus Hedley, 1888. Proc. R. Soc. Qld. 5(4): 150. Agriolimax pollonerae Simroth, 1889. Nachr. Deutsch. Malak. Ges. 21(11/12): 17982. Agriolimax caruanae Pollonera, 1891. Boll. Mus. Zool. Anat. Comp. R. Univ. Torino 6(99): 3. Agriolimax cecconii Pollonera, 1896. Boll. Mus. Zool. Anat. Comp. R. Univ. Torino 11(264): 6. Agriolimax ceccomii var. ilvatica Pollonera, 19 05. Boll. Mus. Zool. Anat. Comp. R. Univ. Torino 11(517): 3. Agriolimax dubius Hoffmann, 1941. Zool. Anzeiger 136: 2547. Deroceras meridionale Reygrobellet, 1963. Bull. Soc. Zool. Fr. 88: 399. Deroceras caruanae (Pollonera, 1991). References Anderson 2005; Barker 1879; Forsyth 2004; Horsak et al. 2004; Hutchinson and Heike 2007; Kerney et al. 1979 ; Reise et al. 2006; Wiktor 2000

PAGE 248

248 Deroceras reticulatum Family Agriolimacidae Species Deroceras reticulatum (O.F. Muller, 1774) Common Name Grey fieldslug, Field slug Milky slug Description A mature grey fieldslug ranges in length from 35 to 50 mm. The stout body of this slug may be cream colored, greyish or has a slight pink grey color. The mantle has concentric striations and usually covers more than onethird the length of the slug There are dark brown or grey flecks concentrated between the tubercles The tenta cles are dark in color. The thin, clear, sticky mucus of this slug often becomes a milky white when it is harassed. There is a short keel at the tail end. The sole of the foot is tripartite whitish to grey yellow in color with the median field grey. The pneumostome (breathing pore) having a raised, pale border is located in the posterior forth of the mantle This species can easily be confused with Deroceras agreste. In order to confirm the identity of this species, dissection and observation of the genitalia are required. Deroceras agreste The penis (p) of this species is broad with only a single appendix. Deroceras caucasicum: The penis is broad and has two appendixes at the tip with the vas deferens emerges between them. The posterior edge of the penis is pigmented (dark colored) and there is a hard "clam shaped" shell like plate inside the penis Deroceras laeve: The penis of this species is long, narrow and mostly twisted, with only a single appendix. It should be noted that a penis may be absent in some specimens. Deroceras panormitanum: The penis in the species is broad and markedly bilobed with 4 6 appendixes. Deroceras reticulatum: The penis (p) in the species is broad with only a single, irregularly branched appendix.

PAGE 249

249 Native Range Western Europe Distribution North America : U.S.: Alabama, California, Colorado, Hawaii, Illinois, Kentucky, M ichigan, Ohio, Oklahoma, Utah, Washington, Wisconsin, Wyoming Canada: Newfoundland, Quebec, Ontario, British Columbia Asia: Sri Lanka Australasia: New Zealand Europe Ecology This slug pref ers modified habitats, such as garden, greenhouses, roadsides and fields. The diet of D. reticulatum is primarilly constituted of living plant material but this slug is an omnivore and may consume mushrooms, dead slugs earthworms and other animal matter. This species is especially destructive to seedlings and succulent plants. In northern Europe and North America this species damages grains, clover and vegetable crops. This slug has the potential to detect predatory carabid beetles through the use of olfactory cues. When attacked, the slug lashes its tail, secretes copious amounts of mucus and flees its attacker. The slug may also amputate the tip of its tail to evade predation. Reproduction is by cross fertilization and occurs year round under favorable conditions. Mating occurs mainly at night and approximately 6075 eggs (4 mm each) are produced per clutch total ing approximately 700 eggs per year per specimen. The animals lifespan is generally one to two years. Synonyms Limax agrestis Linnaeus, 1758. Syst. Nat. 1: 1082 (part). Limax reticulatus Muller, 1774 Verm. Terr. Et fluv. Hist., 2:10 (gardens of Rosenburg and Fridricksdal) Limax canariensis d'Orbigny, 1839. Hist. NAt. Iles Canaries (Webb and Berthelot) 2(2): 47. Limax tunicata Gould, 1841, Invert. of Mass. p. 3 (Massachusetts). Krynickillus minutus Kalenickzenko, 1851. Bull. Soc. Imp. Nat. Moscou 24: 224. Limax agrestis Leidy, 1851, in Binney, Terr. Moll., 1: 250, pl. 2, figs. 79 (anatomy); Binney, 1851, Terr. Mol. 2: 36, pl. 64, fig. 2.; W.G. Binney, 1878. Terr. Moll. 5:146. Not Limax agrestis Linnaeus, 1758, Syst. Nat. (10) p. 652, as restricted by Luther.

PAGE 250

250 Limax molestus Hutton, 1879. Trans. N.Z. Inst. 11: 331 (new synonymy). Krynickillus niciensis (Boettger) Nevill, 1880. Proc. Zool. Soc. Lond.: 103. Agriolimax agrestis L. of most authors in the last century; Cockerell 1891, Nautilus, 5: 70 (na med color varieties); 11: 15, fig. 1 (monstrosity); 7:21 (in Jamaica) Agriolimax reticulatus Muller, Luther, 1915 Actes fauna et flora Fennica, 40, No. 2.; Ingram, 1943, Nautilus, 55:67. References Anderson 2005; Barker 1879; Branson 1959; Branson 1962; Branson 1980; Carrick 1942; Cowie 1997; Cowie et al. 2009; Forsyth 2004; Horsak 2004; Hutchinson and Heike 2007; Kerney et al. 1979; Naggs et al. 2003; Pilsbry 1939; Thomas et al. 2010; Wiktor 2000

PAGE 251

251 Discus rotundatus Family Discidae Species Discus rotundatus (Muller, 1774) Common Name Rotund disc Description The rotund disc snail is very small. It is approximately 2.5 mm in height and ranges in width from 5.5 7.2 mm, with about 4.56 whorls This flattened shell is almost disc shaped and can either be grey or light yellow brown in color, with prominent uniformly arranged reddish brown blemishes. The body of the animal is bluegrey or blueblack, but pale on the sides of the foot Native Range Western and Central Europe Distribution North America : U.S.: California, New Jersey, New York, Massachusetts, Washington State Canada Atlantic Islands Europe : Southern Scandinavia, Northern Scotland to Algeria, Spain, Ireland to Ukraine, Turkey, Denmark, Norway Ecology This snail inhabits forests, greenhouses, wasteland and gardens. They often lay fewer than 5 eggs per clutch.

PAGE 252

252 Synonyms Helix rotundatus Muller, 1774 References Anderson 2005; Grimm et al. 2009; Forsyth 2004; Horsak 2004; Kerney et al. 1979 Elasmias apertum Family Tornatelli nidae Species Elasmias apertum (Pease, 1864) Common Name None reported Description This snail is very small, approximately 4.5 mm in length and 2.5 mm in diameter, with a total of 3 4.5 whor ls The shell is globoseovate in shape. The snail has a pale brown color and may appear glossy. In some specimens a slight discoloration of the apex of the spire may be observed. The body of the animal is pale with dark tentacles The foot of the animal is almost as long as the shell

PAGE 253

253 Native Range Polynesia Distribution Indian Ocean islands Pacific Islands Aust ralia Ecology This species is generally found on foliage, as they are tree dwellers. Synonyms Tornatellina aperta Pease, Proc. Zool. Soc. Lond., 1864, p.673; 1871, p.473. References Pilsbry and Cooke 1915; Sloem 1964 Eobania vermiculata Family Helicidae

PAGE 254

254 Species Eobania vermiculata (Muller, 1774) Common Name Chocolateband snail Description This snail's shell is whitish (with yellow to grey brown tinge) in color with four or five chestnut brown to chocolate stripes that are more or less spotted or speckled with white. Albino variants do exist (i.e. they do not have stripes). The peristome is also white. The thick walled shell of this species has 56 whorls and may attain a height of 1427 mm and a diamet er of 2230 mm although specimens have been reported to measure 35 mm. The umbilicus (navel) is inconspicuous. Native Range Mediterranean region Distribution North America : U.S. Other: Med iterranean region Ecology This species inhabits fields, gardens and vineyards. During the day, the animal aestivates on vertical structures (e.g., trees, palms, bushes, fences). Synonyms Helix vermiculata Muller, 1774 References Cowie et al. 2009; Pilsbry 1939; Kerney et al. 1979; Yildirim et al. 2004

PAGE 255

255 Euconulidae Family Euconulidae Species Euconulus spp. Common Name Brown hive, Hives E. alderi: Shiny hive

PAGE 256

256 E. chersinus: Wild hive E. dentatus: Toothed hive E. fulvus: Brown hive E. polygyratus: Fat hive E. trochulus: Silk hive Description This small group of snails only attains a maximum width of 3.5 mm. They are generally dome or bee hiveshaped, pale brown and glossy. The aperture is crescent shaped. There are approximately 25 species in the genus Euconulus with six species currently occurring in the eastern U.S.: E. alderi : 2 .1 mm high, 2.32.8 mm wide, 5.2 whorls E. chersinus : 2.35 mm high, 2.5 mm wide, 6.6 whorls E. dentatus : 2.75 mm high, 2. 5 mm wide, 6.9 whorls E. fulvus : 3.2 mm high, 3.4 mm wide, 6.5 whorls E. polygyratus : 2.4 mm high, 2.75 mm wide, 6.8 whorls E. trochulus : 2.4 mm high, 2.45 mm wide, 5.9 whorls Native Range Holarctic Distribution North America : U.S.: Central an d Eastern Canada Europe Australasia: New Zealand

PAGE 257

257 Ecology This snail genus inhabits cool, calcareous wetlands, lowland conifer, coastal dune/beaches or grassy meadows. E. alderi is a protec ted species in Michigan. References Grimm 2009; Forsyth 2004; Kerney et al. 1979; Michigan Natural Features Inventory 2007; Perez and Cordeiro 2008 Granodomus lima Family Camaenidae Species Granodomus lima (Ferussac, 1821) Common Name Rasping nipple snail Description The shell size is 25 35 mm with 4 5 whorls The heliciform shell has regularly spaced, small raised bumps that are more prominent on the body whorl The shell is light brown in color and there are no color markings present. The shell is dull in appearance (not glossy). It has a low spire and the animal is capable of retracting completely into its shell Only dextral individuals exist. The body of the animal is dark brown with a pale brown foot and blueblack tentacles.

PAGE 258

258 Distribution Caribbean : Puerto Rico Ecology This pest species is mainly a contaminant. It has been intercepted many times on crushed automobiles from Puerto Rico. Synonyms Polydontes lima References Wade et al. 2006 Guppya gundlachi Family Helicarionidae

PAGE 259

259 Species Guppya gundlachi (Pfeiffer, 1839) Common Name Glossy granule Description The shell of this snail is approximately 1.75 mm in height and 3 mm in diameter. It has 4 2/3 whorls and is generally glossy in appearance. The growth lines on the shell are inconspicuous; however, after the smooth apical half whorl there are minute, moderately spaced spiral lines. The pale brown shell of the glossy granule snail is minutely perforated. The depressed shell has a low domelike appearance from above. The aperture of the shell is lunate (half moon shaped). Native Range Central America Distribution North America : U. S.: Florida, Texas South and Central America Caribbean : Trinidad, Puerto Rico, Cuba, Jamaica Asia : Thailand Ecology This species is commonly intercepted in shipments of ornamental crops from Thailand to the U.S. Syn onyms Helix pusilla Pfeiffer, 1839, Archiv. F. Naturg., 1: 351. Not of Lowe, 1833. Helix gundlachi Pfeiffer, 1840, Archiv. F. Naturg., 1: 250; substitute for H. pusilla; 1848, Mon. Hel. Viv., 1: 50. Helix simulans C.B. Adams, 1849, Contrib. to Conch., No. 3, p.35 (Jamaica). Helix egena Gould inBinney, 1851, Terr. Moll., 2: 245, pl. 22a, fig. 3. Not of Say.

PAGE 260

260 Guppya gundlachi Pfeiffer, Von Martens, 1892, Biol. Centr. Amer., Moll., p. 122.; H.B. Baker, 1922, Occas. Pap. Mus. Zool. Univ. Mich., 106: 45, pl. 17, figs. 1,3, jaw and teeth. Zonites gundlachi Pfeiffer, W. G. Binney, 1978, Terr. Moll., 5: 127, pl. 22a, fig. 3; pl.2, fig. D, teeth. Guppya orosciana References Baker 1928; Pilsbry 1946; Rosenberg and Muratov 2006 Helicarionidae Family Helicarionidae Species Mariaella dussumieri Gray, 1855 Parmarion martensi Simroth, 1893 Parmarion reticulates Hass elt, 1824

PAGE 261

261 Common Name Mariaella dussumieri : None reported Parmarion martensi : Yellow shelled semi slug Parmarion reticulates : None reported Description Mariaella dussumieri : Mature specimens of this slug will measure up to 200 mm in length. Its body color ranges from yellow brown to olive, with black colored blotches that may coalesce in some individuals giving the animal a c ompletely black appearance. The mantle of this animal extends 2/3 the length of the body. There is a small, internal shell that is flat and beak like in this species. The shell is partially visible through an external pore in the mantle There are two elevated ridges on the very large mantle of this species. The left ridge runs from the anterior portion of the mantle to the posterior edge. The other ridge on the right side of the animal runs from the breathing pore to the opening of the shell There is a prominent keel that extends from the posterior edge of the mantle to the tip of the tail where it ends in the mucus pore. The foot is tripartite and has bands Parmarion martensi : This species is brown in color and is capable of attaining a length of up to 50 mm. The animal i s generally called a semi slug because of a small, soft shell that covers the back. The shell is not large enough to cover the mantle therefore leaving it partially exposed. The animal has the capability to cover its shell with the mantle flaps adjacent to it (the entire structure looks like a 'bag' hanging over the tail of the animal). There is a very prominent, pale colored keel that extends from the base of the pos terior edge of the mantle to the mucus pore. The tentacles bearing the eyes are dark brown to black, while the lower pair is tan/cream colored. Parmarion reticulates : This species is similar to P. martensi The mantle in this species also appears sac like with an opening in the middle through which the shell can be seen. The sole is tripartite and the foot has a mucus pore. Distribution Mariaella dussumieri : Asia : India, Sri Lanka Parmarion martensi : Pacific Islands: Hawaiian Islands, Samoa, American Samoa Asia : Japan, Taiwan, Vietnam, Malay Peninsula, Sumatra, Java, Singapore, Borneo

PAGE 262

262 Ecology Mariaella dussumieri : This species has been documented as a pest of cabbage, young rubber plants and legumes. The incubation period of eggs 446 days. Parmarion martensi : This species has been intercepted on lettuce, fennel, sweet potato, banana, passion fruit, lemon grass and Heliconia sp. It has also been observed feeding on fallen fruits of avocado, guava, citrus, papaya and mango. This species is commonly found around human dwellings and is reported as a reservoir host of the human rat lungworm parasite ( Angiostrongylus cantonensis ). This increases the probability of the slug transmitting this potentially fatal diseasecausing organism to humans. Parmarion reticulates : This species has also been reported to feed on young plants of the rubber tree. References Gupta and Oli 1998; Hollingsworth et al. 2007; Mead 1961; Naggs et al. 2003; Tandon et al. 1975 Helicella itala Family Helicidae

PAGE 263

263 Species Helicella itala (Linnaeus, 1758) Common Name Heath snail Description This species has white, tan or pale yellow shell s that are approximately 512 mm high and 925 mm wide, with 5.56.5 whorls There may also be dark brown stripes on the conical shell of this group. The shell has a wide umbilicus. Native Range Western Europe Distribution Europe : Great Britai n, Ireland, Germany, France, Belgium, Netherlands, Denmark, Austria, Poland Australia Ecology This species occupies open habitats, including grasslands. It can also be found in disturbed habitats (e.g. roadsides, railways and forested dunes). The heath snail aestivates on vertical objects (e.g., blades of grass). This species is generally considered a contaminant; however, in agricultural setting this species may achieve pest status when there is a high population density. Large numbers of heath snails can clog machinery and add moisture to harvested crops. This added moisture often leads to spoilage and in some cases infestation by secondary pathogens. Some secondary pathogens are capable of producing toxins which may be harmful to humans and cattle. They p roduce a maximum of 90 eggs per clutch and can live up to 3 years, reproducing twice per year. Synonyms Helicella ericetorum O.F. Muller References Anderson 2005; Kerney et al. 1979

PAGE 264

264 Helix spp. Family Helicidae Species Helix pomatia Linnaeus, 1758 H. lucorum Linnaeus, 1758 H. aperta Born, 1778 Common Name Roman snail, Edible snail, Vineyard snail Helix aperta : Bur rowing snail, Green snail Description H. pomatia: Helix pomatia has a large shell that can attain a height of 30 50 mm and a width of 3250 mm. There are a total of 56 whorls The thin shell of this snail is globose with a wrinkled surface, giving the appearance of faint spiral lines. The shell has a

PAGE 265

265 brownish color often classified as chamois. This chamois color is often interrupted by wide cinnamonbrown stripes. The stripes may be either distinct or ill defined. The aperture is large with a slightly expanded pecan brown lip that is broadly reflected at the collumela, partially covering the umbilicus. H. lucorum : The thick shell of this species will get as high as 55 mm, with 4.55 rapidly increasing whorls The compress ed, spherical shell has a distinct apex The shell has a white background with dark brown, irregular, vertical bands H. aperta: This species has a diameter of approximate 31 mm, with 4 rapidly increasing whorls This species is not banded or striped. The base color is olive brown to greenish. The shell is thin walled and translucent Note: The surface sculpturing of the shell can be used to distinguish between Helix spp. and Cornu aspersum The shell of Cornu aspersum is characteristically wrinkled, while the shell surface of Helix species lack wrinkles. Native Range Central and Southeastern Europe, and the Mediterranean region Distribution North America : U.S.: Michigan, Wisconsin Europe Other: Mediterranean region Ecology This group of species can be found in greenhouses, grassy areas, forests, gardens and orchards where they may attain pest status. Their longevity is approximately 5 years, although specimens of H. pomatia have been documented to live for over 20 years. Synonyms Helix aperta : Cantareus apertus (Born, 1778) H. lucorum : Helix taurica Krynicki, 1833

PAGE 266

266 Helix radiosa Rossmassler, 1838 Helix taurica mut. martensi O. Boettger, 1883 Helix ancyrensis haussknechti Kobelt, 1906 References Anderson 2005; Boycot t 1934; Horsak 2004; Kantor et al. 2009; Kerney et al. 1979; Pilsbry 1939; Yildirim et al. 2004 Posted on 09 02 11 Hygromia cinctella Family Hygromidae

PAGE 267

267 Species Hygromia cinctella (Draparnaud, 1801) Common Name Girdle d snail Description The shell of the girdled snail is 67 mm high and 1014 mm wide, with 56 whorls The shell is tan to light brown, with pale colored blotches. The outer rim of the body whorl of the shell is very pale when compared to the rest of the whorl The aperture (mouth) is oval and the umbilicus (navel) is small and narrow. Native Range Mediterranean region Distribution Europe Other: Mediterranean region Ecology Found on hedges and in gardens where they aggregate in large numbers. References Anderson 2005; Kerney et al. 1979

PAGE 268

268 Lauria cy lindracea Family Pupillidae Species Lauria cylindracea (da Costa, 1778) Common Name Moss snail Description The shell of this species is 3 4 mm high and 1.8 mm wide with 56 whorls The brown shell of this species is transparent and glossy. It is pupashaped with a low spire The aperture (mouth) may have a papery mucus membrane and may or may not have a tooth. The apertural margin is white, sharp and reflected. The umbilicus (navel) is open and narrow. The body of the animal is dark with pale sides and foot The animal characteristically moves with the shell held in an almost vertical position. Native Range Western Europe and Mediterranean region Distribution Caribbean : Jamaica Europe Ecology This species never lay eggs; instead, it produces living young (ovoviviparous). The juveniles have 22.5 whorls This species occurs in forests, meadows and gardens, but never where the humidity is high. Synonyms Turbo cylindraceus Da Costa, 1778 Pupa umbilicata Draparnaud, 1801 Pupa sempronii Charpentier, 1837 Pupa dilucida Rossmassler, 1837

PAGE 269

269 Lauria cymmetrica Puzanov, 1925 References Anderson 2005; Hausdorf 2007; Kantor et al. 2009; Kerney et al. 1979; Rosenberg and Muratov 2006 Lehmannia marginata Family Limacidae Species Lehmannia marginata (Muller, 1774) Common Name Tree slug Description The tree slug is variable in color, ranging from grey to reddish. There is a short keel at the tip of the tail. The mantle is very large in relation to the size of the animal (1/3 the

PAGE 270

270 length of the body). There are 2 dark colored str ipes on each side of the animal. The lower stripe often branches and may be difficult to see. On the other hand, the mantle has three stripes, with the middle stripe being paler than the ot her two. The pale area between the bands on the mantle forms a lyre shape (horseshoeshaped). The pneumostome (breathing pore) is located on the right, in the posterior third of the mantle The sole is tripartite (grey with a darker center). The mucus is clear and watery. There is a characteristic pale stripe running down the midline of Lehmannia marginata, and this character is very useful to distinguish this species from L. valentiana. However if there is any doubt, the genitalia s hould be used to confirm the identity of the specimen. There is a European species called Lehmannia nyctelia that can be confused with this species. Genitalic characters are provided below for species determination. The following species can be separated by dissection and observation of their genitalia: Lehmannia marginata: The appendix on the penis of this species tapers to a point. It should be noted that the appendix might be inverted in this species. L. valentiana: The appendix on the penis of this species is somewhat tubular or the apex may appear expanded. L. nyctelia: The appendix is lacking in this species. Native Ra nge Europe Distribution North America : U.S.: Oklahoma Australasia: New Zealand Europe Ecology This species inhabits gardens, forests, and open habitat but are rarely encountered in intensively cultivated lowland areas. Lehmannia marginata consusumes alg ae, lichen and mushroom. In the absence of prefered food material this species is reported to consume other mollusc species that are already dead, but are not known to attack other gastropods Clutches of between 830 eggs are deposited in the soil and depending on temperature may incubate for approximately 35130 days. Maturity is achieved in 810 months and longevity is approximately 2.53 years.

PAGE 271

271 Synonyms Limax arborum BouchardChantereaux, 1838 Limax livonicus Schrenk, 1848 Limax marginatus Muller, 1774 References Abbes 2010; Anderson 2005; Branson 1980; Cowie 1997; Forsyth 2004; Horsak 2004; Kantor et al. 2009; Kerney et al. 1979; McDonnell et al. 2009; Thomas et al. 2010 Lehmannia valentiana Family Limacidae Species Lehmannia valentiana (Ferussac, 1 821) Common Name Three band gardenslug, Greenhouse slug

PAGE 272

272 Description Mature adults of this slug can attain a length of abou t 50 75 mm. The threeband gardenslug appears translucent and has a yellow grey or yellow violet color. The slug generally has a two pairs of dark bands on either side of the bodys midline. The lower pair of bands may be faint in some individuals. The sole of the slug is pale grey in color. The keel of this slug is short and does not extend out to the mantle The mantle has multiple ridges with what appears to be a f ingerprint like pattern. The pneumostome (breathing pore) is located on the right, in the posterior third of the mantle. The nonsticky, colorless mucus produced by this slug is very watery. The following species can be separated by dissection and observation of their genitalia: Lehmannia marginata: The appendix on the penis of this species tapers to a point. L. valentiana: The appendix on the penis of this species is somewhat tubular or the apex may appear expanded. Native Range Iberian Peninsula Distribution North America South America Europe Asia : Japan Africa Oceania Ecology The threeband gardenslug is noctur nal in nature and is often dispersed by human activity. This species inhabits moist habitats and generally comsumes decaying wood and living plant material and is often considered a serious pest in greenhouses. This slug produces copious amounts of slime as a defense mechanism. The oval eggs produced by this species are yellow and measures 2.25 mm wide. There may be as many as 60 eggs per clutch.

PAGE 273

273 Synonyms Limax valentianus Ferussac, 1821 Limax valentiana Ferussac, 1822 L. poirieri Mabille, 1883 L. marginatus of authors, not Muller, 1774. References Anderson 2005; Horsak et al. 2004; Kerney et al. 1979; Roth and Sadeghian 2006; Udaka and Numata 2008 Leptinaria unilamellata Family Subulinidae

PAGE 274

274 Species Leptinaria unilamellata (D'Orbigny, 1835) Common Name None reported Description This species measures a maximum of 20.6 mm in height wit h approximately 6 whorls The shell ranges from tan to pale brown in color. The aperture (mouth) has denticles (teeth). Distribution Pacific Islands: Hawaii Central and South America : Mexico Caribbean Ecology Leptinaria unilamellata is capable of self fertilization and has been documented to occur in large numbers wherever it inhabits (e.g., greenhouses). This species is reported to achieve sexual maturity in approximately 104 days and on average will lay as many as 22 eggs per clutch. Synonyms Achatina lamellata Tornatellina (Leptinaria) lamellata Potiez and Michaud References Almeida and Bessa 2001; Cowie 1997; Cowie et al. 2008; Jurickova 2006; Robinson et al. 2009; Rosenber g and Muratov 2006

PAGE 275

275 Limacus flavus Family Lim acidae Species Limacus flavus (Linnaeus, 1758) Common Name Yellow gardenslug, Cellar slug Tawny garden slug Description A s the common name suggests, this slug is yellow in appearance with grayishgreen mottling covering the entire body. In contrast, the tentacles are pale bluish or bluish black in color. Adults of the slug range in length from 75 to 115 mm or more. The oval mantle has ridges that appear to have a fingerprint like pattern. The base color of the mantle is black or dar k gray, and the reticulations are yellow white in color. The pneumostome is located behind the midline of the mantle and i s surrounded by a halo. The keel only appears close to the end of the slug's tail. Interestingly, the body mucus is yellow ish and very adhesive, while the foot mucus is colorless. The sole of the foot is yellow white.

PAGE 276

276 Native Range Southern and Western Europe Distribution North America : U.S.: California, Kansas, Kentucky, Oklahoma, Wisconsin Pacific Islands: Hawaii Australasia: New Zealand Europe Ecology Limacus flavus prefers dark, moist habitats, where it can lay between 12 to 32 eggs per clu tch, totaling 60138 per individual, with each egg measuring 5.06.3 mm. This species can be found in diverse habitats ranging from compost piles, gardens and woodlands to greenhouses. The diet includes lichen, fungi and plant material. This species has been reported as an occasional pest in gardens. It has been recorded that Limacus flavus display food aversions when the food is suspected to be noxious. This sensitization can be displayed for up to 3 weeks without error. Synonyms Limax flavus Linnaeus, 1758. Systema Naturae, Edito decima, reformata 1: 692. Type locality Sweden. Limax variegatus Draparnaud, 1801. Tabl. Moll. 103. Limacella ungicula Brard, 1815. Hist. terr. fluv. Environs Paris: 115. Limax megaldontes Quoy and Gaimard, 1824. Voyage l'Uranie et la Physic. Zool.: 428. Limax umbrosus Philippi, 1844. Enum. Moll. Siciliae: 102. Krynickillus maculatus Kaleniczenko, 1851. Bull. Soc. Imp. Nat. Moscou 24: 226. Limax olivacius Gould, 1852. U.S. Expl. Exped. XII: 4. Limax erenbergii Bourguignat, 1853. Cat. Moll. Saulcy: 3. Krynickia maculata P. Fischer, 1856. J. Conchyliol. 5: 69. Limax deshayesi Bourguignat, 1861. Rev. Mag. Zool. (2)13: 302. Limax companyoi Bourguignat, 1863. Rev. Mag. Zool. (2)15: 179. Limax breckworthianus Lehmann, 1864. Malakozool. Bl. 12: 105. Limax beaticus Mabille, 1868. Rev. Mag. Zool. (2)20: 145.

PAGE 277

277 References Anderson 2005; Barker 1979; Branson 1962; Branson 1980; Cowie 1997; Forsyth 2004; Kantor et al. 2009; Kerney et al. 1979; Landauer and Cardullo 1983; McDonnell et al. 2009; Roth and Sadeghian 2006; Thomas et al. 2010 Limax cinereoniger Family Limacidae Species Limax cinereoniger Wolf, 1803 Common Name Ash grey slug Black keel back slug Description This species can attain a length of 300 mm when fully mature. The color of this species is variable. It may be pale g rey or light brown to jet black, except for the tan to white stripe that runs from the posterior edge of the mantle to the tip of the tail. The

PAGE 278

278 pneumostome (breathing pore) is located in the posterior half of the mantle The keel also occurs near the tip of this species. Note: L. cinereoniger has an obvious tripartite sole (the center of the foot is pale and the margins dark) whereas; L. maximus has a uniformly white sole. Also, a pale tan to white stripe runs down the back of L. ci nereoniger but it is absent in L. maximus Also, juveniles of L. cinereoniger may be confused with adult L. maximus due to their uniformly colored sole. Native Range Northern Europe and the Mediterranean region Distribution Europe Ecology This species ge nerally comsumes algae and mushrooms and should not be considered a pest. This species occurs in woodlands and is not commonly intercepted. Synonyms Limax antiquorum Ferussac, 1819 (part) References Anderson 2005; Kerney et al. 1979; Quick 1960

PAGE 279

279 Limax maximus Family Limacidae Species Limax maximus Linnaeus, 1758 Common Name Giant gardenslug, Great slug Tiger slug Spotted leopard slug

PAGE 280

280 Description This is one of the larger garden slugs with the potential to grow up to 150 mm or more i n length. The body of this slug is yellow grey or brown in color. It usually has black markings that may resemble spots or stripes. These markings may sometimes coalesce into two or three p airs of stripes that run the length of the body, but never forming a continuous line. The tentacles are redbrown in color. The mantle has a yellow or white base color and it is also patterned with a brown color; however, it never has bands or stripes; instead it is irregularly spotted or mottled. Albino variants of this species do exist. The ridges on the mantle appear to have a fingerprint like pattern. The pneumostome (breathing pore) is located in the right, posterior margin of the mantle. The keel only occurs near the tip of the tail, and the sole of the foot is creamy white and produces colorless mucus. Note: L. cinereoniger has an obvious tripartite sole (the center of the foot is pale and the margins dark); whereas, L. maximus has a uniformly white sole. Also, a pale tan to white stripe runs down the back of L. cinereoniger but it is absent in L. maximus Also, juveniles of L. cinereoniger may be confused with adult L. maximus due to their uniformly colored sole. Native Range Europe, North Africa and Asia Minor Distribution North America : U.S.: California, Illinois, Kentucky, Oklahoma, Wisconsin Pacific Islands: Hawaii Australasia: New Zealand Europe Ecology The giant gardenslug prefers habitats modified by humans such as gardens, greenhouses or wooded areas. They prefer damp, shaded places such as beneath rocks or vegetation. They are nocturnal in nature and have a very developed homing behavior. The diet includes fungi, decaying plant material and green plants. They are able to mate while suspended on a thread of mucus and generally produces oval eggs, in clusters (50130) that are approximately 55.5 mm in diameter. The total number of eggs laid by this species throughout its lifetime is roughly 650850. Mating occurs in spring and autumn. They have a lifespan of approximately three to four years.

PAGE 281

281 Synonyms Limax maximus Linnaeus, 1758. Systema Naturae, Edito decima, reformata 1: 652. Type localit y Sweden. Limax cinereus Muller, 1774. Verm. HIst. 2: 5. Limacella parma Brard, 1815. Hist. terr. fluv. Environs. Paris: 110. Limax antiquorum Ferussac, 1819. Hist. nat. Moll. II: 68 (part). Limax maculatus Nunneley, 1837. Trans. Phil. Soc. Leeds I: 46 Limax cellarius (d'Argenville) Lessona & Pollonera, 1882. Monogr. Limacidae Ital. 1: 23. References Anderson 2005; Barker 1979; Branson 1959; Branson 1962; Branson 1980; Cowie 1997; Forsyth 2004; Horsak 2004; Kantor et al. 2009; Kerney et al. 1979; Nie mela et al. 1988; Meyer and Cowie 2010; McDonnell et al. 2009; Roth and Sadeghian 2006; Stephenson 1968, Thomas et al. 2010

PAGE 282

282 Limicolaria aurora Family Ac hatinidae Species Limicolaria aurora (Jay, 1839) Common Name escargot Geant d'Afrique, Nigerian land snail Description This snail generally attains a height of 60 mm and a width of 28 mm, with 9 9.5 whorls at maturity. The shell is smooth, dull oblong ovate and displays a wide range of colors. The umbilicus (navel) is narrow. Native Range East Africa

PAGE 283

283 Distribution North America : Currently not present, though it is commonly inter cepted at U.S. ports Caribbean : Martinique Africa : West: Guinea to Nigeria, Cameroun and Gabon Ecology Achatinids are generally nocturnal forest dwellers but have the potential to adapt to disturbed habitats. Concealed habitats are generally preferred; however, individuals may colonize more open habitats in the event of overcrowding. Achatinids often become more active during periods of high humidity (e.g., after rainfall); however, the occ urrence of large numbers of individuals especially during daylight may indicate high population density. Achatinids are hermaphroditic and there the introduction of a single mature specimen, into a new habitat, can initiate a new population. Achatinids normally lay their calcareous eggs in the soil, but they may be deposited under leaf litter or rocks. They feed on both living and dead plant material. In addition to being agricultural pests, achatinids can be a threat to public health as they act as a reservoir host of the rat lung parasites ( Angiostrongylus cantonensis and A. costaricensis), which causes eosinophilic meningoe ncephalitis in humans. They can also be an unsightly public nuisance during periods of population explosion. This species of Achatinid ( Limicolaria aurora) has the potential to reproduce in much drier conditions than other species. The eggs are often laid in the soil and have an incubation period of approximately 30 days. This species has been reported to consume the following plants: oil palm, yam ( Dioscorea alata), black pepper, Jerusalem artichoke, cucumber, okra, rosemallow, sweet potato and legumes. Synonyms References Abbott 1989; Barker 2002; Ebenso 2006; Cowie et al. 2009; Udoh et al. 1995

PAGE 284

284 Lissachatina fulica Family Achatinidae Species Lissachatina fulica (Bowdich, 1822) Common Name Giant African snail, Achatine, Escargot geant, Caramujo Description The shell of this species is generally narrowly conic with 710 whorls and may attain a length of 200 mm (averaging 50100 mm) and a width of 120 mm when fully mature. The color pattern of the shell will vary widely depending on the diet of the animal but will m ost often consist of alternating bands of brown and tan. The body of the animal is browngray in color and it may be able to extend up to 300 mm in length. Native Range East Africa Distribution North America : Currently not present, though it is commonly intercepted at U.S. ports. South and Central America : Argentina, Brazil (Sao Paulo, Rio de Janeiro, Minas Gerais), Ecuador, Venezuela

PAGE 285

285 Indian Ocean: Madagascar, Mauritius, Seychelles Pacific Islands : Hawaiian Islands, Marianas, Bonin, Caroline Islands, Guam, Wake, Society Islands, Vanuatu, Cook Islands, American Samoa, Western Samoa, Micronesia Caribbean : Guadeloupe, Martinique, St. Lucia, Barbados Australasia: Bougainville, New Guinea, New Ir eland, New Britain, Papua, New Caledonia, Australia (Queensland) Asia : India, Ceylon, Bangladesh, Malaya, Taiwan, Vietnam, Surinam, Java, Bali, Sulawesi, Moluccas, Flores, Timor, Iran, Jaya, Thailand, Japan, Hong Kong, China Africa : Ethiopia, Somalia, Mozambique, Morocco, Ivory Coast, Ghana, Annobon, Equatorial Guinea, Sao Thome, Madagascar Ecology Achatinids are generally nocturnal forest dwellers but have the potential to adapt to disturbed habitats. Concealed habitats are generally preferred; however, individuals may colonize more open habitats in the event of overcrowding. Achatinids often become more active during periods of high humidity (e.g., after rainfall); however, the occurrence of large numbers of individuals especially during daylight may indicate high population density. Achatinids normally lay their calcareous eggs in the soil, but they may be deposited under l eaf litter or rocks. They feed on both living and dead plant material. In addition to being agricultural pests, achatinids can be a threat to public health as they act as a reservoir host of the rat lung parasites ( Angiostrongylus cantonensis and A. costar icensis ), which cause eosinophilic meningoencephalitis in humans. They can also be an unsightly public nuisance during periods of population explosion. References Abbott 1989; Barker 2002; Cowie et al. 2008; Cowie et al. 2009; Meyer and Cowie 2010

PAGE 286

286 Lymnaeidae Family Lymnaeidae Species Radix auricularia (Linnaeus, 1758) R. peregra (Muller, 1774) Lymnaea stagnalis (Linnaeus, 1758) Common Name R adix auricularia: Big ear Radix, Ear pond snail R. peregra: Wandering pond snail Lymnaea stagnalis : The great pond snail, Stagnant pond snail, Swamp lymnaea

PAGE 287

287 Description The shells of this f reshwater dwelling group are not patterned and they do not posses an operculum They will attain a maximum height of 70 mm The tentacles of these species are characteristically triangular in shape with the small eyes located at the base. Radi x auricularia: The big ear Radix may be as large as 1430 mm high and 1225 mm wide, with 4 5 whorls The whorls of this s pecies rapidly increase towards the very large body whorl The shell is slightly glossy and smooth. The thin shell of this species is generally tan to pale yellow. The aperture is ear shaped and the umbilicus (navel) may be slightly open or closed altogether. The body of the animal may have small white spots on the head and tentacles R. peregra: The wandering snail is between 1820 mm high and 1213 mm wide. The shell of this species is tan to brown and may possess a blackish cover The body of the animal is greenish with black and dirty yellow spots covering it. Lymnaea stagnalis : This species is very large when compared to the other 2 species in this group. It can attain a height of 45 70 mm and a width of 20 34 mm. The shell is also tan colored and does not have any obvious markings Distribution Radix auricularia North America : U.S.: Massachusetts, New Jersey, New York, Nevada, Pennsylvania, Vermont Europe : Croatia, Czech Republic, Germany, British Isles, Netherlands, Poland, Slovakia, Ireland (and possibly other countries) Asia R peregra North America : U.S.: Massachusetts, New Jersey, New York, Pennsylvania, Vermont Europe : Croatia, Czech Republic, Germany, British Isles, Netherlands, Poland, Slovakia, Ireland (and possibly other countries) Asia

PAGE 288

288 Lymnaea stagnalis North America : U.S.: Illinois, Massachusetts, Michigan, New Jersey, New York, Pennsylvania, Vermont, Wisconsin, Europe : Croatia, Czech Republic, Germany, British Isles, Netherlands, Poland, Slovakia, Ireland (and possibly other countries) Asia Ecology The species in thi s group prefers stagnant or very slow moving water with dense vegetation. R. auricularia is an intermediate host for a human pharyngeal parasite ( Clinostomum complanatum ). Synonyms Radix auricularia: Helix auricularia Linnaeus, 1758 Limnaea auricularia Lymnaea auricularia (Linnaeus, 1758) Radix auriculatus Montfort, 1810 R. peregra: Buccinum peregrum Muller, 1774 Radix labiata (Rossmassler, 1835) Lymnaea peregra (Muller, 1774) Lymnaea pereger Lymnaea stagnalis : Helix stagnalis Linnaeus, 1758 Limnaea vulgaris Locard, 1840 Limnaea turgida Locard, 1882 Lymnaea stagnalis var. ssorensiana W. Dybowski, 1912 Lymnaea stagnalis var. subulata angarensis B. Dybowski, 1912 References Anderson 2005; Chung et al. 1998; Kantor et al. 2009

PAGE 289

289 Marisa cornuarietis Family Ampullariidae

PAGE 290

290 Species Marisa cornuarietis (Linnaeus, 1758) Common Name Giant ramshorn snail, apple snail Description The shell of this species on average measures 50 mm wide, with 3.5 4 whorls The shell of adults generally appears flattened, as the apex does not extend above the body whorl The juveniles' shell on the other hand, have a more globose shape and the apex is well above the body whorl The shell often appears to be bicolored with different color patterns on the dorsal and ventral surfaces. They almost always have 36 dark colored stripes; however, an unusual morph exists that is completely yellow. The body of this snail is yellow to grey with black blotches coveri ng the entire body. The rigid structure that is used to block the opening of the shell (operculum) is very small and can be retracted entirely into the shell. Native Range Southern and Cent ral America Distribution North America : U.S.: Alabama, Alaska, Arizona, California, Florida, Georgia, Idaho, Texas South America Pacific Islands: Hawaii Caribbean Ecology This omnivorous snail can be found in standing or slow moving water. The adults lay their orangecolored eggs, measuring 23 mm, below the surface of the water. The eggs are often deposited on vegetation in a gelatinous matrix. Clutch size average 210 eggs with an incubation period of approximately 824 days. The snail is not hermaphroditic (both sexes exist). There has been evidence of sexual dimorphism, where the males have a more rounded aperture (mouth) and a thicker shell while the females have an oval shaped aperture (mouth) and thinner shells This snail is of concern because of its

PAGE 291

291 ability to completely decimate the vegetation in its habitat. They also are capable of outcompeting native species through direct competition and predation on their eggs and young. References Barker 2002; Rawlings et al. 2007 Megalobulimus oblongus Famil y Megabulimidae Species Megalobulimus oblongus (Muller, 1774) Common Name Giant South American snail Description The shell of this species will vary in color from brown, to tan, to pinkish. There are no color markings on the shell It may grow as high as 70100 mm, with 5.56 whorls The apertural (mouth) lip in adults of this species is pink. The umbilicus (navel) is covered by the columella (lip of mouth). This species is very similar in appearance to the giant African snails; however, obvious differences include: The whorl just above the body whorl has a characteristic bulge. The body of the animal has a softer, gelatinous texture, when compared to the more leathery feeling of the acahtinids. They produce less slime.

PAGE 292

292 Native Range South America Distribution Caribbean: Barbados, Jamaica South America : Uraguay, Brazil, Argentina Synonyms Strophocheilus oblongus References Abbott 1989; Rosenberg and Muratov 2006

PAGE 293

293 Microxeromagna lowei Family Hygromiidae Species Microxeromagna lowei (Potiez and Michaud, 1852) Common Name Small brown snail, Citrus snail Description The shell of this species is 3 5 mm high and 5.58.5 mm wide, with 4.5 whorls The shell is tan with numerous brown spots of various shades. The lower portion of the shell has narrow stripes that are not continuous. There may be short hairs covering the shel ls (0.05 mm long). In many empty shells the hair may be absent due to abrasion of the surface, leaving hair scars. It has a narrow umbilicus The body of the animal is white with a brown spot at the margin of the mantle

PAGE 294

294 Native Range Western Mediterranean region Distribution Australasia: Australia Africa : C anary Islands to Israel and Lebanon Europe : Italy; Spain; Mediterranean Ecology The small brown snail occupies terrestrial and arboreal habitats. It is generally a contaminant of citrus exports from Australia. Shipments to the U.S. have been rejected due to contamination by this species. Both adults and juveniles of this species may be found in citrus trees on the leaves and fruit as well as in the leaf litter below the trees. This complicat es management strategies for this species. The small brown snail is also a pest of cereals as they generally aggregate on the leaves and seed head. They contaminate cereal grains and increase the moisture content. This allows for the introduction of secondary fungal pathogens which may produce toxins. The toxins produced by these secondary fungal pathogens may cause fatality and reproductive disorders in humans and cattle. The snail density may attain 4000 snails/m2. This self fertile species can mature within 6 weeks and will lay on average 500 eggs per year in the soil. Synonyms Microxeromagna arrouxi Microxeromagna vestita Microxeromagna armillata (Lowe) Helix lowei Potiez & Michaud, 1 838 Helix ( Xerophila) armillata Lowe, 1852 Helix vestita Rambur, 1868 Helix subsecta Tate, 1879 Helicella ( Candidula) mayeri Gude, 1914 References Zhao 2004

PAGE 295

295 Milax gagates Family Milacidae Species Milax gagates (Draparnaud, 1801) Common Name Greenhouse slug Keeled slug Description Fully mature adults of this species may be as long as 70 mm. The body of the animal may be grey brown to black, gradually becoming lighter in color towards the foot There are no obvious markings on the body of neither the adults nor juveniles. The mantle is large and may be slightly granular with a horseshoeshaped groove in the center. There may also be 1617 grooves between the keel and the pneumostome (breat hing pore). The breathing pore is located in the posterior half of the mantle There is a very prominent keel on the back of the animal, extending from the posterior edge of the mantle to the tip of the tail. The sole is tripartite : blackish with a pale median. There are "v" shaped grooves along the median line of the sole. The mucus produced by this sl ug is clear. Native Range Western Mediterranean, Western Europe and the Canary Islands Distribution North America :

PAGE 296

296 U.S.: eastern North America, Pacific Northwest, California South America Australasia: New Zealand, Australia Asia : Japan, Sri Lanka South Africa Europe : Britain, Mediterranean region Ecology Milax gagates has been reported to be very destructive in Hawaii where it is decimating rare, native plants in Haleakala National Park (Hawaiian Islands). The keeled slug is known to cause yield reduction in soybean, sunflower and oilseed rape, by causing damage to seeds and seedlings. This pest species is capable of burrowing and often damages the roots and lower stems of plants (e.g., carrot, potato). The eggs are laid in tunnels made below the soil surface. Clutch size may be as few as 16. The incubation period for the eggs is approximately 25 days, juvenile mature withi n about 45 months. Synonyms Limax gagtes Draparnaud, 1801. Tableau des mollusques terrestres et fluviatiles de la France: 100. Type locality? Montpellier. Limax maurus Quoy and Gaimard, 1824. Voyage L'Uranie et la Physic. Zool.: 427. Limax fulginosus Goul d, 1852. U.S. Expl. Exped. XII: 5. Milax antipodarum Gray. 1855. Cat. Pulmonata Brit. Mus. 1: 177. Limax pectinatus Selenka, 1865. Mal. Blatt.: 105. Milax hewstoni Cooper, 1872. Proc. Acad. Nat. Sci. Philad.: 147. Milax emarginata Hutton, 1879. Trans. N.Z. Inst. 11: 331. Milax tasmanicus Tate, 1881. Pap. Proc. R. Soc. Tas.: 16. Milax nigricolus Tate, 1881. Pap. Proc. R. Soc. Tas.: 17. Amalia antipodarum var. pallida Cockerell, 1891. Ann. Mag. Nat. Hist. VII: 340. Amalia parryi Collinge, 1895. J. Malac. 4(1) : 7. Amalia babori Collinge, 1897. Proc. Malac. Soc. Lond. 2(6): 294. References Anderson 2005; Barker 1979; Barker 1999; Clemente et al. 2010; Cowie et al. 2009; Kerney et al. 1979; Naggs et al. 2003

PAGE 297

297 Monacha spp. Family Hygromiidae Species Monacha cantiana (Montagu, 1803) M. cartusiana (Muller, 1774) M. syriaca (Ehrenberg, 1831) Common Name Monacha cantiana: Kentish snail Kentish garden snail Monacha cartusiana : Carthusian snail, Chartreuse snail Monacha syriaca: None reported

PAGE 298

298 Description Monacha cantiana: The medium sized shell of this snail is 10.5 to 1 4 mm high and 15.5 to 20 mm wide with 5 1/2 6 whorls The shell has a narrow umbilicus (navel like opening at the base of the shell) is globosely depressed, and slightly transparent. The top of the shell is somewhat whitish in color and becomes progressively brownish toward the base This thin shell is glossy in appearance and possess fine, weak, ir regular lines and courser growth wrinkles. The aperture of the shell is broadly lunate while the lip is slightly expanded and shortly dilated at the columellar insertion. A narrow white or brown rib strengthens this insertion. Monacha cartusiana : This species is smaller than C. cantiana It has a shell that is approximately 610 mm high and 917 mm wide with 5.56.5 whorls The shell is pale white or pale yellow in color and may have brown stripes. The aperture of the shell may be darker than the rest of the body. Monacha syriaca: The shell of this species is 7 9 mm high and 813.5 mm wide, with 4.5 5 .5 whorls The brown shell has a white spiral stripe and a white lip The apertural lip (mouth) may be red brown and the umbilicus (navel) is closed. The body of the animal is tan to pale yellow with brown antennae. Native Range M. cantiana: Mediterranean region and Northwestern Europe M. cartusiana: Mediterranean region and Southeastern Europe M. syriaca : Mediterranean region Distribution North America: U.S.: Delaware ( M. cartusiana), North Carolina ( M. syriaca ) Canada: Quebec, Ontario Europe : Netherlands, West Germany, France, England Ecology This group of snails prefers dry, grassy areas (e.g. road sides, pas tures). Monacha cartusiana is an intermediate host for livestock parasites including that of the sheep lungworm disease. Monacha syriaca is a pest of ornamental plants in shade houses in Israel (e.g., Butcher's broom/ horsetongue ( Ruscus hypoglossum ), cas t iron plant ( Apidistra elatior ). Both plant species are used in gardens elsewhere.

PAGE 299

299 Synonyms Monacha cantiana: Helix cantiana Montagu, 1803, Testace Britannica p. 422, Suppl. Pl. 23, fig. 1.; F. R. Latchford, 1885, Amer. Nat. 19: 1111.; A. W. Hanham, 1896, Nautilus, 10: 99. Fruticicola cantiana Montagu, W. G. Binney, 1886. 2nd Suppl. Terr. Moll., Bull. Mus.Comp. Zool., 13: 23, pl. 1, fig. 13. Helix cantiana var. minor Moq., Cockerell, 1889, Nautilus 3: 87. Theba cantiana (Montagu) Taylor, 1917, Monogr L. & Freshw. Moll. Brit. Is., pt. 23, p. 78. Monacha cartusiana : Helix cartusiana Muller, 1774 Monacha syriaca: Helix syriaca (Ehrenberg, 1831) References Anderson 2005; Kantor et al. 2009; Kerney et al. 1979; Pislbry 1939; Robinson 1999; Robinson and S lapcinsky 2005

PAGE 300

300 Otala spp. Family Helicidae Species Otala lactea (Muller, 1774) O. punctata (Muller, 1774) Common Name Otala lactea : Milk snail, Milky snail Otala punctata: Spanish snail Description Otala lactea : The diameter of Otala lactea's shell ranges from 27.5 to 36 mm and the height ranges from 16 to 25 mm. The nonglobular, slightly depressed shell is whitish or brownish and has darker stripes that are speckled. These white specks are very close to each other. The discoloration on the shell may also be either uniformly distributed or it may posses darker fine or gray mottling in the stripes. The surface of the shell is minutely dented or punctuated and has very fine, partly indistinct spiral striations This species has a distinct apertural lip The aperture and peristome are liver brown to black in color. The umbilicus (navel) is inconspicuous. The body of t he animal is tan to grey brown. Otala punctata: This species is morphologically similar to O. lactea ; however, O. punctata shell ranges from 33 to 39 mm wide and 20 to 24 mm high. These species can be separated by: O. lactea: A denticular tooth is present on the columella of the shell The entire apertural l ip of the opening (mouth) is very dark brown. O. punctata: D enticular tooth absent. The upper region of the apertural lip of the opening (mouth) is very pale (tan to white), with the remainder being brown. Native Range O. lactea : Northern Africa and Spain O. punctata : Spain and Southern France

PAGE 301

301 Distribution North America : U.S.: Arizona, California, Florida, Georgia, Louisiana, Mississippi, Texas South America : Argentina Caribbean: Bermuda, Cuba, Jamaica Australia Africa Europe : Spain Other: Mediterranean region Ecology Otala spp. are noctural foliage feeders. Otala lactea has been reported to feed on papaya, lily, anise, broccoli, cabbage, cauliflower, celery, lettuce and yucca plants. This edible snail is often consumed in the Mediterranean region. The milk snail generally exists in rocky heath lands and steppes. The Spanish snail prefers agricultural areas and coastal plains. Synonyms Otala lactea : Helix canariensis Mousson, 1872 Helix ahmarina Mabille, 1883 Helix jacquemetana Mabille, 1883 Otala punctata: Helix punctata (Muller, 1774) References Abbott 1989; Cowie et al. 2009; Pilsbry 1939

PAGE 302

302 Ovachlamys fulgens Family Chronidae

PAGE 303

303 Species Ovachlamys fulgens (Gude, 1900) Common Name Jumping snail Description The jumping snail's shell is 5 7 mm wide, with 45 whorls The foot of the snail is tripartite It also h as a characteristic horn near the tip of its tail that it often uses to catapult itself away from perceived danger. Native Range Japan Distribution North America : U.S.: Florida South and Central America : Costa Rica Pacific Islands: Hawaiian Islands Cari bbean: Trinidad Asia : Japan Ecology This snail has been recorded to be a pest of ornamental plants such as orchids, Heliconia sp. and Dracaena sp. The jumping snail can live for as long as 9 months. It has the potential to self fertilize and begin oviposit ion as soon as 42 days post hatching, with a total clutch size of 165 eggs throughout its life. References Barrientos 1998; Barrientos 2000; Cowie et al. 2008; Cowie et al. 2009; Robinson and Slapcinsky 2005; Stange 2004

PAGE 304

304 Oxychilus spp. Family Zonitidae Species Oxychilus alliarius (Miller, 1822) O. cellarius (Muller, 1774) Common Name O xychilus alliarius : Garlic glass snail O. cellarius : Cellar glass snail Description Oxychilus alliarius : This species is approximate 3.44 mm high and 58 mm wide with 44 1/2 whorls The shell is smooth, glossy and has wide umbilicus (navel). The shell is reddish brown and living animals emit a garlic odor when disturbed. The body color of the animal is blueblack.

PAGE 305

305 Oxychilus cellarius : The narrowly umbilicate shell of this snai l has a height of approximately 4.2 mm and a width of 9 14 mm. The nearly smooth shell is depressed and heliciform. As its common name suggests, the shell has a translucent pale yellow brown color with the umbilicus being even paler and more opaque. The smooth, glossy umbilicus is approximately 1/6th the width of the shell and the shell has a total of 5 1/26 whorls The entire body of the snail, including the tentacles is grey, with the sides and the sole being paler. The pneumostome has small brown freckles around it. Ther e is a groove that runs parallel to the edge of the foot The groove on each side of the animal has a row of small brown specks running alongside it. Characteristically, this snail does not emit a garlic odor and its body is much paler than other species in the genus ( Oxychilus). These species may be confused with a similar species ( Oxychilus draparnaudi ) that is carnivorous. The cellar glass snail ( Oxychilus cellarius ) shell is much larger than that of O. alliarius and smaller than that of O. draparnaudi Also, the convex spire of O. cellarius is flatter than that of O. alliarius Native Range Western Europe Distribution Oxychilus cellarius : North America : U. S.: California, Co lorado, Connecticut, Delaware, District of Columbia, Illinois, Indiana, Maine, Massachusetts, Michigan, Missouri, New Hampshire, New York, New Jersey, Oregon, Pennsylvania, Rhode Island, South Carolina, Utah, Virginia, Wisconsin Australasia: New Zealand Ca nada : Nova Scotia, Quebec, Ontario Asia North Africa Europe Oxychilus alliarius : North America: Canada: Nova Scotia, Quebec, Ontario

PAGE 306

306 Australasia: New Zealand South America : Columbia Asia North Africa Europe Ecology Oxychilus alliarius : This gregarious s pecies can be found in humid habitats (e.g., meadows, cultivated areas, greenhouses). It consumes living and dead plant material as well as small snails and their eggs. Oxychilus cellarius : This species prefer to live in association with human activities and can be found in parks, gardens, under rocks, rubbish, wood, cellars, plant material an around greenhouses. This animal can be found year round with peak breeding activities occurring in autumn and they may be found in abundance. They often produce small white eggs that are roughly 1.5 mm in diameter. In addition to vegetation, this species will feed on the eggs of other snails, slugs and earthworms. Synonyms Oxychilus alliarius : Helix a lliarius Miller, 1822 Oxychilus cellarius : Helix cellaria Muller, 1774, Hist. Verm., 2: 28 (wine cellars of Copenhagen). Helix glaphyra Say, 1816 [Nicholson's] Amer. Edit. British Encycl., art Conchology, No. 5, pl. 1, fig. 3 (garden in Philadelphia). Z onites cellarius Muller, Leidy, 1851, Terr. Moll., 1: 233, pl. 7, fig. 1; W. G. Binney, 1878, Terr. Moll., 5: 112, pl. 2, fig. G (teeth); 1885, Man. Amer. Land Sh., p. 448:, figs. 493, 494. Oxychilus cellarius Muller, Ellis, 1926, British Snails, p. 245, pl. 12, figs. 10 12. Oxychilus pulchrostriatum MacMillan, 1940, Amer. Midland Nat., 23: 731, figs. 24 (Duquesne Bluff, Pittsburg, Pa.) References Anderson 2005; Hutchinson and Heike 2007; Kerney et al. 1979; Meyer and Cowie 2010; Naggs et al. 2003

PAGE 307

307 Pallifera costaricensis Family Philomycidae Species Pallifera costaricensis (Morch, 1857) Common Name Costa Rica mantleslug

PAGE 308

308 Description This species can attain a length of 45 mm. It is pale tan to brown in color, with dark colored markings on the sides. Towards the head of the animal, there is a band (running the width of the body) that is jet black and thick. The sole is undivided, but the edge is dark gray. The tentacles also are dark gray. It should be noted that this species has an extensive mantle that covers the entire back (excluding the head) of the animal. Native Range Cent ral America Distribution South and Central America Ecology This species has been intercepted in cut flowers. References Baker 1930 Parmacella ibera Family Parmacellidae Species Parmacella ibera Eichwald, 1841

PAGE 309

309 Common Name Melon slug Vine slug Description This slug is often mistaken for a snail as the shell is often exposed. This thick walled shell is very narrow with a smooth apex The shell of this species does not coil (possess whorls ). It typically has a brownish yellow color with many tubercles and wrinkles in the aperture (opening). The body of the animal is brown with dark brown bands running the length of the mantle. The animal is generally 32 mm long. The mantle covers most of the body and can measure up to 20 mm. Native Range Mediterranean region (Iberian peninsula) Distribution Europe Asia : Georgia, Armenia, Iran Africa : Egypt, Libya Ecology This slug is a serious pest of citrus in Iran. It may also cause damage to fieldgrown tomatoes, cabbage, melons, pumpkins and cucumber. This species will go into diapause during the warm season and will deposit eggs as deep as 50 mm below the soil surface. Synonyms Parmacella olivieri var. ibera Eichwald, 1841 Parmacella olivieri sensu Simroth, 1883 non Cuvier, 1804 Parmacella simrothi Germain, 1912 Clathropodium vitrinaeformis Westerlund, 1897 References Kantor et al. 2009

PAGE 310

310 Physella acu ta Family Physidae Species Physella acuta (Draparnaud, 1805) Common Name European physa, Left handed pondsnail, Acute baldder snail, Ashy physa, Lateritic physa, Pewter physa, Tadpole snail, Pewter physa Description The European physa has a sinistral (left handed) shell that is 7 12 mm high and 710 mm wide, with 56 whorls This snail has a very large body whorl relative to the rest of the shell The height of the body whorl accounts for approximately 75 % of the total height of th e shell The vacant shell has a tan color, but in living specimens the body whorls appears mottled (black and tan spots and blotches). The aperture (mouth) is oval and may have a white rib. The opaque shell has a pointed spire and does not have a rigid structure blocking the opening of the shell (operculum). The body of the animal is bluegrey in color with innumerable dark spots. Distribution North America : U.S.: Wyoming Australasia: Australia, New Zealand

PAGE 311

311 Asia : Hong Kong Europe : Croatia, Germany, Netherlands, Czech Republic, Britain, Ireland Other: Mediterranean region Ecology This species inhabits shallow, warm, standing fresh water in very high densities. It is able to withstand polluted water and is often introduced inadvertently into new habitats by humans. This species is very adaptable and is recorded as a serious pest of both economic plants in greenhouses and filtering vegetation in sewage treatment plants. Synonyms Haitia acuta Physella heterostropha (Say, 1817) Physa globosa Haldeman, 1841 Physella integra (Haldeman, 1841) References Albrecht et al. 2009; Anderson 2003; Anderson 2005; Cope and Winterbourn 2004; Semenchenko et al. 2008

PAGE 312

312 Polygyra cereolus Family Polygyridae Species Polygyra cereolus (Muhlfeld, 1816) Common Name Southern flatcone snail Description There is considerable variation in the shell size of Polygyra cereolus The height ranges from 3.5 4.6 mm and the diameter ranges from 11.518.2 mm. The number of whorls for this species also varies from 79. The discoidal shell is white with radial streaks or spots of gray or light brown on the base giving the shell a uniform woodbrown or fawncolored appearance. The upper surface of the shell may be completely flat or it may be slightly raised (conical) with obliquely regular rib striations The lower side of the shell is nearly flat or slightly concave with a vortex like umbilicus (navel). The last whorl is swollen at the end (near the aperture). The keel is weak or completely absent. The outer and basal margins of the peristome (margin/edge of the mouth) is reflected and thickened on the inside, giving it a heart shaped appearance. The parietal margin is slightly raised, free and possesses a short, oblique tooth. Native Range Florida Distribution North America : U.S.: Alabama, Florida, Georgia, Kentucky, Louisiana, Mississippi, North Carolina, South Carolina, Texas, Wisconsin South America : Mexico Pacific Islands: Hawaii

PAGE 313

313 Atlantic Islands : Bermuda Caribbean : Cuba Ecology This species is reported to feed on red and white clover ( Trifolium spp.) and alfalfa ( Medicago sativa). Synonyms Helix cereolus J. C. Megerle von Muhlfeld, 1818, Gesellschaft naturforschender Freunde zu Berlin, Magazin etc., 8: 11, pl. 2, fig. 18a, b; Binney, 1959, Terr. Moll., 4: 90, pl. 77, fig. 23 (copy from Muhfeld); Bland, 1860, Ann. Lyc. Nat. Hist. N.Y., 7: 137, fig. 2. Hellix cereolus var. laminifera W. G. Binney, 1858, Proc Acad. Nat. Sci. Phila. P. 200, nude name; cf. Bland, 1860 and Binney, 1869. Helix microdonta Desh., W. G. Binney, 1859, Terr. Moll., 4: 91, in part. Helix carpenteriana Bland, 1860, Ann. Lyc. Nat. His. N.Y., 7: 138. Polygyra carpenteriana Bland, W. G. Binney, 1878, Terr. Moll., 5: 284, fig. 182, pl. vi, fig. m (teeth). Polygyra cereolus Muhlfeld, W. G. Binney, 1878, Terr. Moll., 5: 283, fig. 181; Rhoads, 1899, Nautilus, 13: 44. References Abbott 1989; Cowie 1997; Kalmbacher et al. 1979; Pilsbry 1940; Perez and Cordeiro 2008; Pilsbry 1940

PAGE 314

314 Pomacea spp. Family Ampullariidae Species Pomacea canaliculata (Lamarck, 1822) P. glauca (Linnaeus, 1758) P. insularum (d'Orbigny, 1835) P. lineata (Spix, 1827) P. haustrum (Reeve, 1856) P. diffusa (Blume, 1957) Common Name Apple snails

PAGE 315

315 Pomacea canaliculata: Golden applesnail, South American ampullarid, Channeled applesnail, Miracle snail P. insularum : Island applesnail Description Poma cea spp. Traditionally, apple snails have been diagnosed by characters of the shell operculum and siphon. In recent years, these characters have been proven to be unreliable in differentiating species. As such, molecular techniques have been developed to distinguish between species. The globose sh ell of this group of snails ranges from 4575 mm in height and 4060 mm in width with 4 6 whorls depending on the species. The aperture is oval to round. The color of this species also varies: yellow to green to brown. There may or may not b e brownblack spiral bands on the shell There is a si ngle native species of apple snail in the U.S, Pomacea paludosa. It can be found in wetlands in Florida, Georgia and more recently, Alabama. This should not be confused with the introduced species. A species comparison follows: Pomacea paludosa: Clutch siz e: up to 30; Egg Color: freshly laid eggs are salmon colored in a gelatinous matrix then they become pink white and calcified; Incubation Period: 1528 days; Time to Maturity: undocumented; Longevity: undocumented. P. canaliculata: Clutch size: 251000; Eg g Color: bright pink; Incubation Period: 7 days 6 weeks; Time to Maturity: 55 days to 12 months; Longevity: up to 5 years. P. glauca: Clutch size: 30 90; Egg Color: green; Incubation Period: 1417 days 6 weeks; Time to Maturity: 813.5 months; Longevit y: up to 3 years. P. insularum : Clutch size: undocumented; Egg Color: pink red; Incubation Period: undocumented; Time to Maturity: undocumented; Longevity: undocumented. P. lineata : Clutch size: 100; Egg Color: pink red; Incubation Period: 15 days; Time to Maturity: undocumented; Longevity: undocumented. P. haustrum : Clutch size: 236; Egg Color: bright green and polygonshaped; Incubation Period: 930 days; Time to Maturity: approximately 1 year; Longevity: undocumented. P. diffusa : Clutch size: undocumented; Egg Color: tan to salmon (white when just laid) and honey comb shaped; Incubation Period: undocumented; Time to Maturity: undocumented; Longevity: undocumented.

PAGE 316

316 Native Range South America Distribution North America : U.S.: Alabama, Arizona, California, F lorida, Georgia, Texas South and Central America Pacific Islands: Hawaii, Guam Caribbean : Dominican Republic Australasia: Papua New Guinea S.E. Asia : China, Singapore, Sri Lanka Africa Ecology Apple snails are serious pests of aquatic ecosystems. They are generally found in fresh water habitats, though these species are known to tolerate low levels of salinity. This group is often dispersed by human activity through the pet trade or through their use as a food source. These snails are a threat to wetland ecosystems as they are generalist feeders and as such they have the potential to outcompete and displace other snail species. These snails are omnivorous and will consume vegetation, and all life stages of other snail species. Apple snails are known to be amphibious; however they will spend considerable periods in terrestrial habitats. This behavior facilitates disperal in both terrestrial and aquatic habitats. Pomacea canaliculata species is of concern to the U.S. as they may pose a risk to the rice produci ng area of the U.S. (e.g., Texas and Louisiana).They often are pest of rice and taro in other regions of the world. Generally Pomacea species prefer standing or slow moving water (e.g., marshes, lakes and rivers). It has been reported that Pomacea canaliculata inhabits standing water, but P insularum prefers faster moving water (e.g., rivers). Also, both species may be separated by egg characteristics: the eggs of P. canaliculata are larger and fewer than P. insularum (which lays more than 1000 eggs per cl utch). Apple snails are diecious meaning that both sexes occur separately. Sexual dimorphism has also been documented in some species; in the females the shells are often larger than that of males. Pomacea spp. prefer to lay their eggs above the water line on vegetation or on other substrates like rocks.

PAGE 317

317 Synonyms Pomacea canaliculata: Ampullaria canaliculata Lamarck, 1822. References Barker 2002; Barnes et al. 2008; Cowie 2000; Cowie 2001; Cowie et al. 2009; Pain 1960; Peebles et al. 1972; Rawlings et al. 2007; Thiengo 1987

PAGE 318

318

PAGE 319

319 Praticolella griseola Fami ly Polygyridae Species Praticolella griseola (Pfeiffer, 1841) Common Name Vagrant scrubsnail, Vera cruz shrubsnail Description The tan to browngray, umbilicate (possess a navel like opening), flattened shell of this species varies in height 6 11 mm and diameter 813.7 mm. There are 45 1/2 whorls The shell may be glossy in color with faint oblique striations There are several pale tawny stripes that have a white color on each margin. The spire is short. The umbilicus (navel) is very narrow and the aperture (mouth) lunate. The peristome (edge of the mouth) is simple, white and a little reflected, with the columellar margin slightly extended. Native Range Northern and Central America Distribution North America : U.S.: Florida, Texas Central America: Mexico Caribbean : Cuba, Dominican Republic, Jamaica Ecology This species has been intercepted on shipme nts from the Dominican Republic to the U.S on the leguminous plant, guar gum ( Cyamopsis tetragonolobus )

PAGE 320

320 Synonyms Bradybaena pisum Beck, 1837, Index, p. 18, not described, Pfeiffer, 1. c. in synonymn. Helix griseola Pfeiffer, 1841, Symbolae HIst. Hel., 1: 41, Conchyl. Cab., Helix, p.342, pl. 60, figs. 17, 18; Monogr. Hel. Viv., 1: 337. Helix cicercula Ferussac, in coll., = griseola according to Pfeiffer, Monogr. Hel. Viv., 1: 337. Helix albocincta A. Binney, 1851 Terr. Moll., 1: 109, 128, name only. H albolineata "Binney", Gould 1857, Terr. Moll, 3: 34 (referring to Terr. Moll. 3, pl. 49, fig. 2), as var of berlandieriana. H. albo zonata A. Binney, 1857, Terr. Moll., 3, pl. 49, fig. 2 Dorcasia griseola Pfeiffer, W. G. Binney, 1878, Terr. Moll., 5: 34 8, fig. 231(jaw), pl. vii, fig. v (teeth). H. berlandieriana var. griseola Pfeiffer, Von Martensis, 1892., Biol. Centr. Amer., Moll., p. 140, pl. 7, figs. 1517. References Abbott 1989; Perez and Cordeiro 2008; Pilsbry 1940; Rosenberg and Muratov 2006 Prietocella barbara Family Cochlicellidae Speci es Prietocella barbara (Linnaeus, 1758) Common Name Scrubsnail, Banded conical snail, Small pointed snail, Potbellied helicellid

PAGE 321

321 Description The shell of this species is generally 812 mm high and 58 mm wide, with 78 whorls The shell color i s also variable, ranging from off white to grey to pale yellow. Dark colored spots or stripes may also be present. Native Range Mediterranean region Distribution North America : U.S.: may be in California (verification required) Australasia: New Zealand, Australia Atlantic Islands : Bermuda South Africa Europe : southwest Britain, Belgium, coastal areas of France Other: Mediterranean Basin Ecology This snail will cause severe damage to small grain and seedling production. It is also a pest in legumebased pastures in Australia and is especially damaging to annual medics, alfalfa and clovers. Synonyms Cochlicella barbara (Linneaus, 1758) References Barker 2002; Hitchcox and Zimmerman 2004; Kerney et al. 1979

PAGE 322

322 Prophysaon andersonii Family Anadenidae Species Prophysaon andersonii (Cooper, 1872) Comm on Name Reticulate taildropper Description A mature, adult slug can attain a length of approximately 64 mm. The pale brown, redgrey or yellow body of the slug is usually clouded with darker shades. The tentacles are usually dark brown. This slu g has a characteristic diamondmesh pattern on the dorsal surface of its body, due to the arrangement of the tubercles The pale, finely granulated mantle often has two, dark lateral lines running its length. The pneumostome (breathing pore) is anteriorly or medially located on the mantle The fringe of the foot is pale and does not possess any dark bands ; however, faint lines may be observed. The sole is brilliant white to dirty white with a highly contrasting mucus color (lemon yellow to orange). The tail is acute in shape. When contracted, the body of the slug is tadpoleshaped. The genus Prophysaon has nine recognized species. According to Pilsbry's (1948), there are two species groups (subgenera) in this genus: 1. Prophysaon: I n this group, the epiphallus is extremely long and slender except it enlarges abruptly near the insertion in the penis. P. boreale (Northern taildropper): Body finely reticulate, with pale dorsal line. Penis not much shorter than muscular body of the epiphallus.

PAGE 323

323 P. foliolatum (Yellow bordered taildropper): Body finely reticulate, with pale dorsal line. Penis much shorter th an muscular body of the epiphallus. Large species (~ 90 mm). P. andersonii (Reticulate taildropper): Body finely reticulate, with pale dorsal line. Penis much shorter than muscular body of the epiphallus. Small species (~ 64 mm). P. coeruleum (Blue gray taildropper): Body not finely reticulate, no pale dorsal line. Muscular body of the epiphallus very short. Uniform bluegr ay slug P. dubium (Papillose taildropper): Body not finely reticulate, no pale dorsal line. Muscular body of the epiphal lus long. Purplegray slug 2. Mimetarion: In this group, the epiphallus is of moderate length and slender. Initially, the epiphallus is much wider than the vas deferns, but tapers where both structures meet. P. fasciatum (Banded taildropper): Vagina and spermathecal duct slender and very long. Penis sac broad. P. obscurum (Mottled taildropper): Vagina and spermathecal duct slender and very long. Penis sac narrow. P. vanattae (Scarlet ba cked taildropper): Vagina and spermathecal duct stout and very short. Cavity of epiphallus possess two longitudinal ridges. P. humile (Smoky taildropper): Vagina and spermathecal duct stout and very short. Cavity of epiphallus possess one longitudinal ridge. Native Range North America Distribution North America : U.S.: Alaska to California and east to Idaho Canada: British Columbia Ecology This slug will occur in wooded areas, gardens and disturbed habitats. It has the ability to self amputate and regenerate its tail. The site of potential amputation characteristically has a diagonal constriction and a may appear as a dark line on the sole of the foot Synonyms Arion andersonii Cooper, 1872, Proc. Acad. Nat. Sci. Phila., p148, pl. 3, figs. F15.

PAGE 324

324 Prophysaon hemphilli Bland & Binney, 1873, Ann Lyc. N.H. of N.Y., 10: 295, pl. 13, figs. 2, 4, 6 8; W.G. Binney, 1878, Terr. Mol l., 5: 238, figs. 137 139, pl. v, fig. 1 (teeth), pl. xiii, fig. h (genitalia), "specimens from Mendocino county" excluded. P. pacificum Cockerell, 1890, Nautilus 3: 111., 1891, Nautilus, 5: 31; 1897, 11: 77; W.G. Binney, 1890, Third Suppl., Bull. M.C.Z., 19: 210, pl. 7. Figs. B,F,H. P. flavum Cockerell, 1890 P. andersonii var pallidum Cockerell, 1891, Nautilus, 5:31 P. andersonii var. marmoratum Cockerell, 1892, The Conchologist, 2: 72 P. andersonii var suffusum Cockerell, 1893, The Conchologist, 2: 1 18; 1897, Nautilus, 11: 79 References Forsyth 2004; Ovaska et al. 2004; Pilsbry 1948 Pupisoma dioscoricola Fa mily Valloniidae Species Pupisoma dioscoricola (Adams, 1845)

PAGE 325

325 Common Name Yam babybody Description The small, subglobose shell of this species is approximately 1.95 mm high and 1.8 mm wide w ith 2.5 3.25 whorls The upper whorls are granulated. The cinnamoncolored shell is thin, slightly translucent smooth and glossy. This species can be separated from other species in this genus by the presence of distinct spiral striations on the shell and the first couple of whorls are large. Native Range Asia Distribution North America : U.S.: Florida, Texas South and Central America Pacific Islands: Galapagos Islands Caribbean : Cuba, Jamaica, Haiti, Trinidad Synonyms Helix dio scoricola Adams, 1845. Proc. Boston Soc. N. H., ii. p. 16 Helix punctum Morelet, 1851. Von Martens, Biol. Centr. Amer., Moll., p. 131, pl. 7, f. 3 3b H. caeca Guppy, 1868. Proc. Sci. Asso. Trinidad, p. 241.; Amer. Journal. Conch., vi, p. 307 Microphysa dioscoricola Binney, 1890 Pupisoma americanum Moellendorff, 1899 Pupisoma dioscoricola insigne Pilsbry, 1920 Pupisoma puella Hylton Scott, 1960 Helix dioscoricola Pfriffer, 1848 Helix (Conulus) dioscoricola Tryton, 1886 Thysanophora dioscoricola Pils bry, 1894 Pupisoma dioscoricola Pilsbry, 1920 Pupisoma (Ptychopatula) dioscoriicola Haas 1937 Ptychopatula dioscoricola Paul and Donovan, 2005

PAGE 326

326 Helix punctum Fischer and Crosse, 1872 Helix (Microconus) punctum Tryon, 1887 Thysanophora punctum Pilsbry 1894 Helix caeca Dall 1889 Helix (Acanthinula) caeca Tryon 1887 Patula (Ptychopatula) caeca Pilsbry, 1889 Thysanophora dioscoricola caeca Rhoads, 1899 Pupisoma dioscoricola insigne Baker, 1925 Ptychopatula dioscoricola insigne Tillier, 1980 Pupisoma puella Quintana, 1982 Pupisoma (subgenus?) minus Hass, 1960 Pupisoma minus Oliveira and Almeida, 1999 References Abbott 1989; Anderson 2005; Hausdorf 2007; Kantor et al. 2009; Pilsbry 1920; Rosenberg and Muratov 2006 Rumina decollata Family Subulinidae Spe cies Rumina decollata (Linnaeus, 1758) Common Name Decollate snail

PAGE 327

327 Description The shell of mature specimens can attain a maximum length of 45 mm and a width of 14 mm. It is reasonably easy to detect mature specimens of this species, as they are characteristically "decollateshaped". Upon maturity, adult specimens intentionally break off the tip of the shell leaving it with a blunt end. There are generally 47 whorls in adult specimens. An additional 34 whorls may be observed in juveniles of this species. Native Range Mediterranean region Distribution North America : U.S.: Arizona, California, Florida, Georgia, North Carolina, South Carolina, Texas Central and South America : Me xico Europe Caribbean: Bermuda, Cuba Other: Mediterranean Region Ecology The decollate snail has been employed as biological control for pestiferous snail and slugs for many years. This species will rarely consume plant material. This generalist predator will feed indiscriminately and has been implicated in the decimation of native gastropods (including nonpest species) and beneficial annelids. Sexual maturity occurs at approximately 10 months. Each adult is capable of laying 500 eggs throughout its lifetime. The eggs are deposited singly in the soil and will hatch between 1045 days. Synonyms Bulimus decollatus Draparnaud, 1805 Helix decollata Linnaeus, 1758 Orbitina incomparabilis Germain, 1930 Orbitana truncatella (Germain, 1930) References Abbott 1989; Anderson 2005; Burch 1962

PAGE 328

328 Subulina octona Family Subulinidae Species Subulina octona (Bruguire, 1798) Common Name Thumbnail awlsnail, Miniature awlsnail Description This species measures 1417 mm high, with 89 whorls The shell is long and narrow with a small, ovate aperture (mouth). The shell of this species is thin, translucent and glossy. The color ranges from colorless to pale yellow brown. The body of the animal is pale yellow. This species may be confused with Allopeas gracile; however, Subulina octona is larger and has a truncated columella. Native Range Tropical America Distribution Pacific Islands: Hawaii Central and South America : Mexico Europe

PAGE 329

329 Asia: Sri Lanka Caribbean Ecology This species have been documented to occur in large numbers wherever it inhabits, and often occur in greenhouses. References Almeida and Bessa 2001; Burch 1962; Anderson 2005; Cowie 1997; Cowie et al. 2008; Jurickov 2006; Kerney et al. 1979; Naggs et al. 2003; Robinson et al. 2009; Rosenberg and Muratov 2006 S uccineidae Family Succineidae Species Succinea campestris Say, 1818

PAGE 330

330 S. costaricana von Martens, 1898 S. horticola Reinhardt, 1877 S. putris (Linnaeus, 1758) Indosuccinea tenella (Morelet, 1865) Calcisuccinea luteola Gould, 1848 C. dominicensis (Pfeiffer) Oxyloma elegans (Risso, 1826) Common Name Ambersnails Succinea campestris : Crinkled ambersnail S. costaricana : None reported. S. horticola: None reported. S. putris : Large ambersnail Indosuccinea tenella: None reported Calcisuccinea luteola: Mexico ambersnail C. dominicensis : Dominican ambersnail Oxyloma elegans : Pfeiffer's amber snail Description Ambersnails are very difficult to distinguish. Morphological and molecular techniques are usually required to separate the different species. A common species in this group is Succinea campestris The shell of this snail has a dull appearance due to the faint, irregular microscopic granulation present on the exterior surface. The height of the shell ranges from 9.4 17 mm and the width 6.8 11.5 mm totaling 3 1/33 1/2 whorls The shell is very compact at the top as a result of a very short spire The overall shape of the shell is oval and the base of the shell is wide as a result of th e very large aperture (mouth). The whitish shell has gray streaks. In some cases the shell may be gray in color with light yellow streaks or tint. The wrinkles on the shell are low and wide. The

PAGE 331

331 sutures on the shell are deeply prominent. The interior surface of the shell cream colored or white. Ca lcisuccinea luteola: Shell succiniform averaging a height of 12.5 mm and a width of 6 mm, with 4 whorls The shell of juveniles may be yellow green to tan in color. In adults i t is gray to white, with the inside of the shell sometimes having a yellow color. Aperture (mouth) ovate. C. dominicensis : The succiniform shell of this species can attain a height of 10 mm and a width of 7 mm, with 3.25 whorls The shell is generally tan to pale brown in color, smooth and glossy. This species has a thicker shell than other species. Oxyloma elegans : The shell of this species may be 912 mm high, occ asionally 18 mm, with 3 whorls The color of the shell varies from light brown to black. The pale morphs generally have a dark colored markings on the shell Native Range S. campestris : North America S. putris : Europe and Siberia O. elegans : Holarctic Distribution Succinea spp.: North America : U.S. Canada P acific Islands: Hawaii Europe Calcisuccinea luteola: North America : U.S.: from Louisiana west to Arizona South and Central America Caribbean : Haiti, Dominican Republic

PAGE 332

332 C. dominicensis : Caribbean : Haiti Oxyloma elegans : Europe : Britain, Ireland Ecology In general, Succinea spp. and Indosuccinea spp. consume algae and moss, and occasionally higher plants. Succinea costricana colonize leaf litter and other moist microhabitats. Additionally this species is attracted to lights, which is highly unusual for snails. This species has been noted as a quarantine pest of ornamentals ( Dracaena species) because of its propensity to remain attached to leaves. It can reproduce by self fertilization and lays few eggs; however, it lays year round. Calcisuccinea spp. are considered significant pests of fruit and horticultural crops. They have been detected in greenhouse and nursery production of fruit and ornamental crops, on the other hand Indosuccinea spp are typically found in wetlands (e.g., marshes). These species are prolific and can rapidly achieve pest status. Synonyms Succinea campestris : Succinea campestris Say 1817, Jour. Acad. Nat. Sci. Phila., 1:281 (Sea Islands of Georgia and Cumberland Island; Amelia Island, N.E. Florida; Binney, 1851, Terr. Moll., 2: 67, pl. 67b, fig. 1. Succinea inflata Linnaeus 1844, Trans. Amer. Philos. Soc., 9: 5; Obs. Genus Unio, 4: 5 (South Carolina) S. putris : Helix putris Linnaeus, 1758 Succinea amphibia Draparnaud 1801 Calcisuccinea luteola: Succinea (Calcisuccinea) luteola luteola Gould, 1848 Succinea luteola Gould, 1848 Succinea texasiana Pfeiffer, 1848 Succinea citrina Shuttleworth

PAGE 333

333 References Anderson 2005; Cowie et al. 2008; Cowie et al. 2009; Kantor et al 2009; Villalobos et al. 1995; Perez and Cordeiro 2008; Pilsbry 1948 Tandonia spp. Family Milacidae Species Tandonia budapestensis (Hazay, 1881) T. sowerbyi (Ferussac, 1823)

PAGE 334

334 T. r ustica (Millet, 1843) Common Name Tandonia budapestensis : Keeled slug Budapest slug Tandonia sowerbyi : None reported. Tan donia rustica: Bulb eating slug Root eating slug Description Tandonia budapestensis : Mature, fully extended members of this species will be between 5070 mm long. The body color of this species is variable. Typically the animals appears black at fist glance; however, it has a pale cream or orange background with very dense, dark colored speckling. This species has a distinct olive or pale orangecolored keel that extends from the tip of the tail to the posterior margin of the mantle The pneumostome is located in the posterior half of the mantle and has a grey border. There is also a horseshoeshaped groove in the center of the mantle The sole is tripartite : dark in the middle and pale on either side. The foot mucus is colorless. This slender slug often coils into a 'C' shape when it is not active. Other species in this family will contract their bodies into a domeshape at rest. Tandonia sowerbyi : Fully extended specimens of this species will be approximately 6075 mm. The body of the animal is pale or dark brown. Unlike T. budapestensis this species has dark blotches all over its body. The keel is pale in color, and the grooves between the tubercles are pigmented. The breathing pore has a pale border. The pale sole of this animal produces a contrasting yellow mucus. Tandonia rustica: This slug can measure up to 100 mm long when fully extended. The color of the bulbeating slug is variable ranging from off white to dirty yellow to reddish. All color morphs have multiple black flecks. Similar to the other two species describe in this fact sheet. Typical of the Tandonia genus, thi s species also has a pale colored (yellowish to white) keel The very large mantle occupies approximately 40 % of the anim al's body length. There is a lateral, black streak in the horseshoeshaped groove in the mantle The cream colored sole of this species produces colorless mucus. When disturbed, this species produces thick, milky mucus. Native Range Tandonia budapestensis: Eastern Europe T. sowerbyi: Western Europe and the Mediterranean region T. rustica: Central and Southern Europe

PAGE 335

335 Distribution North America : U.S.: Pennsylvania, Washington D.C. Australasia: New Zealand (except Tandonia budapestensis ) Europe Ecology These species commonly occurs in greenhouses, gardens, ploughed fields and woods. They have the capability to burrow into th e soil at depths of 37 cm. All species are known to eat living plant material. Tandonia budapestensis has been recorded to be a pest of potatoes, other root crops and ornamental plants. Synonyms Tandonia budapestensis : Milax gracilis (Leydig, 1876) Limax gracilis Leydig, 1876. Arch. Naturgesch. 62(1): 276 (not Rafinesque, 1820). Amalia budapestensis Hazay, 1881. Die Molluskenfauna von Budapest, Malakozool. Bl. (n.s.) 3: 37. Type locality Budapest. Amalia cibiniensis Kimakowicz, 1884. Verh. Mitth. siebenb. Ver. Naturwiss. 33: 220. Tandonia sowerbyi : Milax sowerbyi (Ferussac, 1823) Limax sowerbyi Ferussac, 1823. Histoire nayurelle generale et particuliere des mollusques terrestres et fluviatiles (Nouvelle division de pulmones sans opercule) 2: 96. Type l ocality London. Limax carinatus Risso, 1826. Nat. Hist. Moll. Medit.: 56. Limax marginatus Jefferies, 1862. Brit. Conchol. I: 132 (not Muller, 1774; not Draparnaud, 1805). Amalia marginata (not Muller, not Draparnaud) var mongianensis Paulucci, 1879. Es c. Scient. Calabria: 23. Amalia tyrrena Lessona & Pollonera, 1882. Monogr. Limacidae Ital.: 56. Amalia maculata Collinge, 1895. Proc. Malac. Soc. Lond. 1(7): 336. Amalia collingei Hesse, 1926. Abh. Arch. Moll. 2(1): 139. Tandonia rustica:

PAGE 336

336 Limax rustica Millet 1843 Limax marginatus Draparnaud 1805 References Anderson 2005; Barker 1979; Cowie et al. 2009; Horsak 2004; Reise et al, 2006; Wiktor 1996

PAGE 337

337 Testacella haliotidea Family Testacellidae Species Testacella haliotidea Draparnaud, 1801 Common Name Shelled slug Earshell slug Description The length of this semi slug ranges from 80 120 mm. The body of this animal is light grayish brown (somet imes yellowish), with a pale foot fringe and sole. The small (approx. 78 x 5 6 mm) external shell of this animal is locat ed on the dorsoposterior tip of the tail. Members of this group (Testacellidae) characteristically have two distinct, lateral (branched) grooves that originate from the anterior margin of the muchreduced shell Two addition species in this group have been reported from Europe and may be distinguished by the following characters : T. haliotidea: Morphology the dorsal lateral grooves are approximately 2 mm apart at the point of origin. Genitalia the penis has a flagellum and the spermathecal duct is short and thick. T. maugei : Morphology shell larger than both species (1216 mm long by 67 mm wide) and the dorsal lateral grooves are approximately 5 mm apart at the point of origin. Genitalia the penis does not have a flagellum, and the spermathecal duct is long and thin. T. scutulum : Morphology the shell is of similar size to that of T. haliotidea and the dorsal lateral grooves join (just under the shell ) before reachi ng the the point of origin. Genitalia the penis does not have a flagellum and the spermathecal duct is intermediate between those of T. haliotidea and T. maugei Native Range Western Europe and Western Mediterranean region

PAGE 338

338 Distribution North America : U.S. : California Canada Australia: Australia, New Zealand Europe Caribbean : Cuba Ecology This carnivorous semi slug spends most of its time underground, where it hunts and consumes earthworms snails and slugs The shelled slug is commonly found in disturbed habitats like gardens, parks and agricultural fields. This slug is able to burrow to depths of up to one meter during periods of aestivation. This animal has not been reported to feed on plant material and as such should not pose a threat to agricultural produce. The ecological impact that this species may have on other terrestrial mollusc species has not been documented. Synonyms References Anderson 2005; Barker 1979; Barker 1999; Kerney et al. 1979; McDonnell et al. 2009 Theba pisana Family Helicidae

PAGE 339

339 Species Theba pisana (Muller, 1774) Common Name White garden snail, Mediterranean sandsnail, Sandhill snail, White snail Description The tough opaque shell of this species is slightly flattened (low spire ). The height of the shell is 13 mm and width 1 8 mm with 4 1/2 whorls However, some specimens may be smaller. The ivory yellow shell may be uniform or it may possess unequal brown stripes. These stripes or lines may be interrupted forming dots or dashes. The dull surface has fine growth lines. However, the embryonic 1 1/2 whorls are smooth. Native Range Mediterranean region and Western Europe Distribution North America : U.S.: California Atlantic Islands : Bermuda, Canary Islands Australia Europe : Western France, Southwestern England and Wales, Ireland Asia : Iran Africa : South Africa, Somaliland Other: Me diterranean region Ecology Typically this snail is found in coastal, sandy areas Theba pisana has the potential to increase in number rapidly. This species has been deemed a serious pest and and may be a nuisance because of its ability to aggregate in lar ge numbers. It may occur in numbers of up to 3000 in one tree. This snail possesses the ability to defoliate large trees, including citrus and ornamentals. It also consumes garden crops, seedlings and

PAGE 340

340 cereal grains (e.g., wheat, barley, oil seeds, seed car rot and legumes). In grain producing areas this species will cause direct and indirect losses. Direct losses include clogging machinery and directly consuming the crop. Indirect losses include contaminating the grain and allowing for the infestation of the grain by secondary fungal pathogens, due to the added moisture they provide. Theba pisana generally lays its eggs several inches below the soil surface with an average of 70 eggs per clutch. It takes approximately 20 days for the eggs to incubate; however, it may take longer in dry weather. This snail typically does not seek cool, dark places to aestivate. They preferentially attach to plants, fences, under stones or other vertical, physical structures. Longevity: 2 years. Synonyms Helix pisana Muller, 1 774, Verm. Hist., 2: 60; Taylor, 1911, Monogr. L. & Freshw. Moll. Brit. Is., 3:360, pl. 30, 31; Orcutt, 1919, Nautilus, 33:63. References Anderson 2005; Barker 2002; Cowie et al. 2009; Hitchcox and Zimmerman 2004; Pilsbry 1939; Mead 1971; Rumi and Sanchez 2010; Yildirim et al. 2004

PAGE 341

341 Trochoidea pyramidata Family Hygromidae Species Trochoidea pyramidata (Draparnaud, 1805) Common Name Pyramid snail Description The shell of this species ranges from 6 9 mm high and 811 mm wide with 4.57 whorls The slightly glossy, white shell may have brown stripes or spots. The aperture (mouth) of the shell has a white lip inside. The umbilicus (navel) is narrow in this species. The body of the animal is tan to grey. Native Range Western Palearctic region Distribut ion North America: U.S.: North Carolina Europe Synonyms Helix nova Paulucci, 1879 Helix radiata Retowski, 1889 Helix platiensis Sturany, 1902 Helix vernicata Westerlund, 1902 Helicella subplatiensis Germain, 1936 References Abbott 1989; Robinson and Slapc insky 2005

PAGE 342

342 Trochulus hispidus Family Hygromiidae Species Trochulus hispidus (Linnaeus, 1758) Common Name Hairy snail Description The shell of this small snail is 4 6 mm high and 512 mm wide, with 67 whorls The slightly translucent shell is tan to brown. It is also covered with a dense mat of short, curved hairs. The hairs may be absent in vacant shells (due to abrasion); however, hairs will remain attached and visible in the open umbil icus (navel). The body of the animal is tan to grey black. Native Range Europe

PAGE 343

343 Distribution North America : Canada Europe : Czech republic, Netherlands, Poland, Slovakia, Great Britain, Ireland Ecology This species can occur in a wide variety of habitats. Synonyms Trichia hispida References Anderson 2005; Kerney at al. 1979 Trochulus striolatus Family Hygromiidae Species Trochulus striolatus (Pfeiffer, 1828) Common Name Strawberry snail

PAGE 344

344 Description The somewhat flattened (low spire ) shell of the strawberry snail measures 6.59 mm high and 1115 mm wide, with 6 convex whorls The growth ridges of this species are very prominen t. The shell is dark brown or red brown. Light brown spots/flecks may be present. The umbilicus (navel) is obvious. The shells of juveniles of this species are hairy, but the shells of adults lack hair. Native Range Northwestern Europe Distribution Europe : England, Scotland, Wales, Ireland, Netherlands, Slovakia Ecology This species is often associated with human dwellings (e.g., in gardens, on buildings/hedges). As its common name suggests, this species is a pest of strawberries. Synonyms Tri chia striolata References Anderson 2005; Daw and Ivison; Kerney et al. 1979

PAGE 345

345 Urocyclus flavescens Family Urocyclidae Species Urocyclus flavescens (Keferstein, 1866) Common Name African banana slug Description The color of this slug is variable, ranging from pale yellow, lemonyellow, greenyellow, yellow brown to gray. The mantle is typically greenish, and generally covers the anterior third of the dorsum. The dorsal surface is typically uniform in color, except for two faint lateral stripes. In rare cases, there may exist a third stripe medially. A mixture of color varia nts typically exists in a single population. This slender slug will attain a maximum length of 60 mm. The body of the African banana slug quickly tapers from front to back, giving an unusually angular appearance to the posterior section of the animal. A keel is absent. There are also minute longitudinal grooves on the dorsum. These grooves are transected by shorter transverse grooves There is a prominent caudal pore at the posterior end of the animal. The middle of the animal is characteristically vaulted (humped), causing the tail to appear narrower than the body. The sole of the foot is tripartite wi th the middle appearing narrower than the sides. The foot fringe is typically uniform (no vertical bands ). Native Range E ast Africa Distribution Africa : Southern Ecology The African banana slug has been documented as a pest of banana. This slug will damage the fruit by rasping at the peel. This results in necrotic scaring which reduces the marketability (reduced sales and outright rejection of the fruit) of the fruit. Entire bunches can be lost, and losses of greater than 10 % is not atypical. It can be found in banana plantations, forests (inside and at the edge), dune forest and gardens. The

PAGE 346

346 slugs do not seem to have microhabitat preferences, and they can be found out in the open, in grass, under logs and buried between the hands on banana bunches. This species colonize habitats ranging from sea level up to an altitude of 1400 m. This species is nocturnal and lays its eggs during spring. The eggs can be found buried in the soil or under plant material. Hatching commences during spring rains if favorable conditions prevail. The juveniles then procee d up banana plants where they would feed. The juveniles of Urocyclus flavescens are drought resistant. During periods of drought, they have the ability to survive several months in aestivation, both in the soil and under plant material on the ground. Syno nyms Parmarion flavescens Keferstein, 1866. Malak. Bl., 13: 70, pl. 2 figs. 18. Elisolimax rufescens Simroth References Barker 2002; Forcart 1967; Hausdrof 2000; Van Bruggen and Appleton 1977 Veronicellidae: Belocaulus angustipes Family Veronicellidae Species Belocaulus angustipes Heynemann, 1885 Common Name Black velvet leatherleaf, Paraguayan black velvet leatherleaf

PAGE 347

347 Description This slug can measure up to 55 mm when fully extended. It is jet black in color with similar ly colored tentacles There is a pale, inconspicuous tan stripe down the center of the back, which may not be visible. The mantle extends over the entire length of the body. The dorsal surface of the mantle may appear velvety or wrinkled. The pneumostome (breathing pore) and anus is located posteriorly The foot appears tripartite because the mantle of this species has black flecks along the margins. Native Range South America Distribution North America : U.S.: Alabama, Florida, Louisiana, Mississippi South America Ecology This nocturnal pest species consumes a wide variety of plants. It can inhabit greenhouses, grassy fields and nurseries. It is also known to be an i ntermediate host for the nematode Angiostrongylus costaricensis, causative agent of the rat lung disease, oesinophilic meningoencephalitis. It is commonly found in St. Augustine grass. This species can live up to 5 years. Synonyms Veronicella ameghini Gamb etta References Neck 1976; Thome 1989; Walls 2009

PAGE 348

348 Veronicellidae: Diplosolenodes occidentalis Family Veronicellidae

PAGE 349

349 Species Diplosolenodes occidentalis Guilding, 1825 Common Name Spotted leatherleaf slug Description Mature specimens of Diplosolenodes occident alis have the potential to extend up to 60 mm. This species characteristically have black speckling on the dorsal surface of its grey colored body; however, juveniles lack this pigmentation. In rare cases adult specimens may also lack the characteristic sp eckling. The ocular tentacles are dark colored and the sole is pale grey. Native Range Lesser Antilles Distribution North America : U.S.: Introduced to greenhouses in Oklahoma, but apparent ly not established in the U.S. South and Central America Caribbean : Lesser Antilles, Greater Antilles Ecology The spotted leatherleaf slug prefers undisturbed environments; however, it may be observed in agricultural areas where it is generally a minor pest of perennial crops. Crop species eaten include Brassicaceae (e.g., cabbage), pepper, lettuce, tomato and beans. Synonyms Vaginula occidentalis Angas, 1884 Vaginulus occidentalis Vagin ula punctatissima (Semper) Pilsbry 1892 Diplosolenodes occidentalis Thome, 1997. Veronicella occidentalis Guildingm, 1825 Veronicella lavis (Ferussac)

PAGE 350

350 References Branson 1962; Cowie et al. 2009; Robinson et al. 2009; Rosenberg and Muratov 2006; Thome 19 89 Veronicellidae: Phyllocaulis gayi Family Veronicellidae Species Phyllocaulis gayi (Fischer, 1871) Common Name None reported. Description This pale, tancolored slug can get as large as 100 mm long and 20 mm wide. It typically has a cream coloredcolored line running the entire length of the body. There may be gr ey speckling on its dorsum, creating a greyishcolored animal. The tentacles appear blue or silver in color.

PAGE 351

351 Native Range South America Distribution South and Central America : Mexico, Chile Ecology This granivorous (seed eating) species has been observed feeding on the seeds of the peanut plant ( Arachis hypogea), and that of the trees Cryptocarya alba and Aetoxicum punctatum This species may be considered an ecological pest, especially in forest regeneration. Synonyms Vaginula gayi Fischer, 1871 in Fischer, 1871. Revision des especes du genere Vaginula Ferussac. Nouvelles Archives du Museum d'Historie Naturelle. Paris. 7: 147175. Vaginula ( Phyllocaulis ) gayi Fischer, 1871 in Baker, 1925. North American Veronicellidae. Proceedings of the Academy of Natural Sciences of Philadelphia. 77: 157184. Phyllocaulus gayi (Fischer, 1871) in Thome, 1971. Redescricao dos tipos de Veronicellidae (Mollusca, Gastropod) neotropicais: VII especies deposit adas no Museum National d'Histoire Naturelle, Paris, Franca. Iheringia (Zool.) 40: 2752. References NaranjoGarca et al. 2007; Rodrigues Gomes et al. 2009; Simonetti et al. 2003; Thome 1989

PAGE 352

352 Veronicellidae: Sarasinula spp. Family Veronicellidae Species Sarasinula plebeia (Fischer, 1871) S. dubia (Semper, 1 885) S. marginata (Semper, 1885) Common Name Sarasinula plebeia: Caribbean leatherleaf slug, Bean slug S. dubia: None reported. S. marginata: None reported. Description Sarasinula plebeia: This species is grey brown with small black markings. It can attain a maximum length of 70 mm. The Caribbean leatherleaf sl ug can be mistaken for the Florida leatherleaf slug ( Veronicella aff. floridana), but S. plebeia can be distinguished by the location of the female genital pore (away from the foot ) and the absence of the pale median line down the back of the animal. Native Range Sarasinula plebeia: Brazil and the West Indie s Distribution Sarasinula plebeia: North America : U.S.: Florida South and Central America Pacific Islands: New Caledonia

PAGE 353

353 Caribbean : Dominica, Jamaica, Grenadines (Canouan) S. marginata: South America : Brazil, Peru, Columbia Caribbean : Dominica, Guadeloupe Ecology Sarasinula plebeia: This is a serious pest of agriculture in Central America. In South America this slug consumes legume pods and flowers, as well as the foliage of beans, swee t potato, cabbage, Cucurbita sp., tomato, coffee, weedy species in the genus Borreria and the fruit of papaya. In many cases, this pest species has been known to eat young plants to the ground on farms. Plant nurseries that grow tree species like mahogany and red cedar have also been affected by this species. This slug can transmit the nematode Angiostrongylus costaricensis which is pathogenic to humans. Sarasinula ple beia can bury itself in the soil to a depth of up to 100 cm in order to protect itself from desiccation during the dry season. In Texas it has shown the potential to survive subfreezing temperatures. This herm aphroditic slugs can reproduce by self fertilization It can lay up to 80 eggs per clutch. The oval, translucent eggs have an incubation time of 2024 days at 27 degrees Celsius. Adulthood can be attained in 25 months and the adults can live for more than a year. S. marginata: This species has been reported to feed on dasheen ( Colocasia esculenta) in the field. This slug is a minor pest of agriculture in Dominica. The genitalia may be used to distinguish this species from Sarasinula plebeia and S. dubia Synonyms Sarasinula plebeia: Sarasinula dubia (Semper) Vaginulus plebeius Fischer, 1868 in Fischer, 1868. Diagnoses de deux Limaciens de la Nouvelle Caledonie. Journal de Conchyliologie, Paris. 16: 145146. Vaginula plebeja Fischer, 1868 in Aguayo, 1964. Notas sobre la distribucion de la babosa Vaginulus plebejus Mollusca: Veronicellidae. Caribbean Journal of Science. 4: 549551. Sarsinula plebeja Grimpe and Hoffmn, 1925 in Thome, 1971. Redescricao dos tipos de Veronicellidae (Mollusca, Gastropod) neotropicais: VII especies depositadas no Museum National d'Histoire Naturelle, Paris, Franca. Iheringia (Zool.) 40: 2752.

PAGE 354

354 Vaginula behni Semper, 1885 in Thome, 1989. Annotated a nd illustrated preliminary list of the Veronicellidae (Mollusca: Gastropod) of the Antilles, and Central and North America. Journal of Medical and Applied Malacology. 1: 1128. Sarasinula lemei Thome, 1967 inThome, 1989. Annotated and illustrated prelimin ary list of the Veronicellidae (Mollusca: Gastropod) of the Antilles, and Central and North America. Journal of Medical and Applied Malacology. 1: 1128. Sarasinula plebeia Thome, 1993 in Thome, et al. 1997, Annotataed list of Veronicellidae from the coll ections of the Academy of Natural Sciences of Philadelphia and the National Museum of Natural History, Smithsonian Institution, Washington, D.C., U.S.A. (Mollusca: Gatropoda: Soleolifera). Proceedings of the Biological Society of Washington. 110: 520536. Angustipes dubia Angustipes dubius Angustipes plebeius Imerimia plebeja Sarasomia plebeia Vaginula dubia Vaginula moerchi Vaginula plebeius Vaginulus dubius Vaginulus plebejus Vernicella plebeius Viginula dubia Viginula moerchi References Cow ie et al. 2008; NaranjoGarca et al. 2007; Robinson et al. 2009; Rosenberg and Muratov 2006; Rueda et al. 2004; Solem 1964; Thome 1989

PAGE 355

355

PAGE 356

356 Veronicellidae: Vaginulus alte Family Veronicellida e Species Vaginulus alte (Ferussac, 1822) Common Name Black slug Tropical leatherleaf Description The tropical leatherleaf slug measures 7080 mm long. It is dark colored (grayish) with raised pustules/tubercles and a characteristically narrow foot A pale brown line spans the length of its dorsum. The foot is 4 5 mm wide in adults and 1 mm wide in juveniles. The keel is tan colored. The tentacles are 23 mm long, and rarely extend beyond the tip of the mantle Native Range Cental Africa

PAGE 357

357 Distribution Pacific Islands: Hawaii Islands of the Indian a nd Pacific Oceans Australasia: Australia, New Zealand Asia : Southern Africa : South and Central Ecology This pest species consumes vegetable crops, fruits and weeds. This species is an intermediate host for Angiostrongylus cantonensis the rat lung parasite of humans. It occupies dry areas at low altitudes and feed during periods of high humidity (late evening/early morning). The adults of this slug will deposit its eggs in any depression in the soil. The eggs are often observed in a cluster with a threadlike material surrounding it. Fecal matter is also deposited on the eggs to maintain the eggs' high moisture content. The oval, translucent eggs will measure up to 8 mm. Clutch size may be as much as 100 eggs. The eggs often hatch in about a month. The juveniles will measure close to 8 mm upon eclosion (hatching). Although maturity is often attained after 5 months, breeding onl y commences during favorable conditions (warm and rainy weather). Synonyms Laevicaulis alte (Ferussac, 1822) Vaginulus alte Ferussac, 1822 Vaginula leydigi Simroth, 1889 References Cowie 1997; Cowie et al. 2008; Cowie et al. 2009; Naggs et al. 2003; Sol em 1964; Thome 1989

PAGE 358

358 Veronicellidae: Veronicella spp. Family Veronicellidae Species Veronicella fl oridana (Leidy, 1868) V. cubensis (Pfeiffer, 1840) V. sloanei (Cuvier, 1817) V. moreleti (Crosse & Fischer, 1872)

PAGE 359

359 Common Name Veronicella aff floridana : Florida leatherleaf slug V. cubensi s: Cuban slug V. sloanei : Sloan slug Jamaican slug Pa ncake slug V. moreleti : Tan leatherleaf, Morelet slug Description Veronicellid species can only be reliably distinguished from each other through dissections and observation of the genitalia. Veronicella aff. floridana : This species may be distinguished from Veronicella cubensis by the genitalia. V. cubensis : The body color of this slug is variable. There may be multiple shades of brown with two dark stripes running down the length of its back. The lines may be solid or broken up into spots. There may also be an albino form. Another thin, pale white stripe also runs down the midline of the animal. The body texture also varies, where, the body may appear smooth or granular This slu g can usually be distinguished from other species of Veronicellids by the presence its bluegray eye tentacles There is also a pale brown area around the eyespots. Adults will measure bet ween 5070 mm in length, although lengths of up to 120 mm have been recorded. V. sloanei : Similarly to the other species of this genus, this animal has variable body color, ranging from albino, to tan to grey with varying degrees of grey markings. It has the potential to attain a maximum length of 120 mm. The tentacles of this species are typically bluegrey with pale brown tips. V. moreleti : This browncolored species usually does not hav e a dorsomedian stripe. Genitalia: The basal section of the penis is cylindrical. The apex is twisted and the entire region is a hardened mass. Native Range Veronicella floridana: Southern Florida and Greater Antilles V. cubensis: Greater Antilles (Cuba) V. sloanei: Greater Antilles (Jamaica) V. moreleti: South America

PAGE 360

360 Distribution Veronicella aff floridana : North America : U.S.: Alabama, Florida; Louisiana, Texas Central America: Mexico Caribbean : Puerto Rico, Cuba, Dominica, Jamaica V. cubensis : North America : U.S.: California Pacific Islands Caribbean : Cuba, Hispaniola, Puerto Rico, Saint Kitts, Nevis, Dominica, Barbados V. sloanei : Caribbean : Jamaica, Bermuda, Dominican Republic, Grand Cayman, Guadeloupe, Dominica, Barbados, Saint Vincent, Saint Lucia, Cuba V. moreleti : North America : U.S.: This species has been intercepted in Vermont Central and South America Ecology Pest species have been known to consume both ornamental and agricultural crops: melon, pumpkin, pepper, eggplant, cabbage, cassava, taro, sweet potato, yam, papaya, banana, star fruit, mango, noni, citrus and coffee. Veronicella aff floridana : This slug is known as a pest of potatoes in Cuba and that of beans, tomatoes and ornamental plants elsewhere. V. cubensis : This animal is a serious pest of agricultural and ornamental crops (e.g., papaya production in Hawaii) especially in the Pacific Basin. C rops include but are not

PAGE 361

361 limited to the following: banana, cabbage, cassava, citrus, coffee, eggplant, mango, noni, papaya, pepper, pumpkin, satar fruit, sweet potato, taro, yam. It can be found in very moist habitats (e.g., near water bodies). V. sloanei : This opportunistic pest is quite aggressive and consumes a wide variety of ornamental and agricultural crops. Crops consumed by this pest includes but is not limited to the following: leafy vegetables (e.g., spinach, cabbage, lettuce), dasheen, banana, pl antain, tannia, papaya, citrus, bean, peanut, Hibiscus sp. and Bougainvillea sp. This pest can also remove the bark of several plants (e.g., Datura sp. and gardenia), therefore girdling the plant. It will lay clutches of 1012 eggs in a chain. V. moreleti : This slug has been described from multiple habitats from lowland jungles to open savannas. It is viviparous ; therefore, eggs of this species are never intercepted. It has been recorded as a pest of coffee and cacao in Mexico. Synonyms Veronicella aff floridana (Leidy, 1868): Leidyula floridana (Leidy & Binney, 1851), Thome, et al. 1997, Annotataed list of Veronicellidae f rom the collections of the Academy of Natural Sciences of Philadelphia and the National Museum of Natural History, Smithsonian Institution, Washington, D.C., U.S.A. (Mollusca: Gatropoda: Soleolifera). Proceedings of the Biological Society of Washington. 110: 520 536. Vaginulus floridanus Leidy & Binney, Binney 1851, The terrestrial air breathing mollusks of the United States and the adjacent territories of North America. Vol. I. A.A. Gould (ed.) Charles Little and James Brown, Boston, MA. pp. 198, 251, pl. IV. Veronicella floridana (Binney, 1851) in Binney, 1885. A manual of American land shells Bulletin No. 28 of the United States National Museum, p. 528. V. cubensis (Pfeiffer, 1840): O nchidium cubense Pfeiffer, 1840. O. cubensis Veronicella cubensis Thome, 1975. V. sloanei (Cuvier, 1817): Vaginulus sloanei Ferussac V. laevis Blainville, 1817 V. moreleti (Crosse & Fischer, 1872): Leidyula moreleti (Crosse & Fischer, 1872)

PAGE 362

362 Vaginulus m oreleti Fischer, 1871 in Fischer, P. 1871. Revision des especes du genere Vaginula Ferussac. Nouvelles Archives du Museum d'Historie Naturelle. Paris. 7: 147175. Vaginulus kreideli Semper, 1885 in Thome, 1971. Redescricao dos tipos de Veronicellidae (Moll usca, Gastropod) neotropicais: VII especies depositadas no Museum National d'Histoire Naturelle, Paris, Franca. Iheringia (Zool.) 40: 2752. Veronicella (Leidyula) moreleti (Crosse and Fischer, 1872) in Baker, 1925. North American Veronicellidae. Proceedings of the Academy of Natural Sciences of Philadelphia. 77: 157184. Vaginulus mexicanus Strebel and Pfieffer, 1882 in Thome, 1989. Annotated and illustrated preliminary list of the Veronicellidae (Mollusca: Gastropod) of the Antilles, and Central and North America. Journal of Medical and Applied Malacology. 1: 1128. References Cowie 1997; Cowie et al. 2008; Cowie et al. 2009; Fields and Robinson 2004; Lechmere Guppy 1866; McDonnell et al. 2008; NaranjoGarca et al. 2007; Neck 1976; Perez and Cordeiro 2008; Robinson et al. 2009; Rosenberg and Muratov 2006; Stange 2004; Thome 1989; Thome 1993; Whitney et al. 2004

PAGE 363

363

PAGE 364

364 Viviparus viviparus Family Viviparidae Species Viviparus viviparus (Linnaeus, 1758) Common Name River snail, Common river snail

PAGE 365

365 Description This species will attain a maximum height of 40 mm, with 5 6 whorls The shell is yellow green with three distinct brown spiral stripes (that follow the direction of the whorls ). The shell of this operculate snail opaque and slightly glossy. The umbil icus (navel) is inconspicuous, occurirng only as a groove or notch. This species is not hermaphroditic both sexes exist. They are ovoviviparous Distribution North America : Eastern Europe Synonyms Helix vivipara Linnaeus, 1758 Nerita fasciata Muller, 1774 (part.) Nerita vivipara Muller, 1774 (part.) Cycl ostoma achatinum Draparnaud, 1801 Viviparus fluviorum Montfort, 1810 Cyclostoma achatinum Lamarck, 1812 Viviparus vulgaris Gray,1850 Paludina duboisiana Mousson, 1863 Vivipara subfasciata Bourguignat, 1870 Vivipara subfasciata var. sequanica Bourguignat, 1870 Paludina okaensis Clessin, 1875 Vivipara forbesi Bourguignat, 1880 Vivipara nevilli Bourguignat, 1880 Vivipara imperialis Bourguignat, 1884 Vivipara penthica var. albisiana Servain, 1884 Vivipara bourguignati Servain, 1884 Vivipara paeteli ana Servain, 1884 Vivipara penthica Servain, 1884 Vivipara strongyla Servain, 1884 Paludina duboisiana var. concis Westerlund, 1886 Paludina penthica var. porphyrea Westerlund, 1886 References Anderson 2005; Jakubik 2006; Kantor et al. 2009

PAGE 366

366 Xerolenta obvia Family Hygromiidae Species Xerol enta obvia (Menke, 1828) Common Name Heath snail Description This heath snail will attain a maximum height of 16 mm and a diameter of 22 mm, with 5 6 whorls This opaque shell is very flattened for a helicidshaped shell The body whorl of this species turns downwards. The aperture (mouth) is oval in shape and is very thin and brittle, often incomplete in vacant shells as it generally breaks. The background color is white with dark brown spiral stripes. The most obvious and consistent stripe can be found at the periphery. Subsequent stripes may be faint, inconsistent and broken. The umbilicus is open an d obvious. In some species the coiling of the shell when observed through the umbilicus may appear haphazard. Native Range Southeastern Europe

PAGE 367

367 Distribution North America: U.S.: Michigan Europe : England, Ireland, Germany, Bulgaria, Italy, Turkey Ecology This species is known to feed on fodder crops (e.g., alfalfa, clover, lupine, sanfion, seradella) in southern Germany. It i s also a pest in Italy and Bulgaria where it is often intercepted in shipments of fruits and vegetables to other European countries. Xerolenta obvia is a vector of fungal pathogens (e.g., Alternaria sp Fusarium sp ., Phytophthora sp.). It also vectors the sheep and goat parasites, Protostrongylus rufescens Davainea proglottina and Dicrocoelium dendriticum Synonyms Helicella obvia (Menke, 1828) References Kerney et al. 1979; Robinson and Slapcinsky 2005 Xeropicta krynickii Family Hygromidae

PAGE 368

368 Species Xeropicta krynickii (Krynicki, 1833) Common Name Desert snail Description This species has a shell diameter of 1218 mm, with 56 whorls The shell has a white base color with varying shades of brown spots and bands This glossy shell has uneven sculpturing and an open umbilicus (navel). Native Range Mediterranean region Distribution Middle East : Turkey to J ordon, Egypt, Israel Ecology This species prefers open habits, with little vegetation (e.g., gardens, road medians ). Xeropicta krynickii may occur in vineyards and orchards where it will cause damage to the crop. This species is often inadvertently harvested with agricultural produce and is generally considered a contaminant pest. In Israel, this species often invades ornamental cropping systems in search of a place to aestivate. Shipments o f these ornamental plants are often rejected by trading partners due to contamination by this species. Synonyms Xeropicta vestalis (Pfeiffer, 1841) Helix vestalis Pfeiffer, 1841 References Abbott 1989; Cowie et al. 2009; Kostyukovsky and Shaaya 2001; Moran et al. 2004

PAGE 369

369 Xerotricha conspurcata Family Hygromiidae Species Xerotricha conspurcata Draparnaud, 1801 Common Name None reported. Description The shell of this species ranges in height from 3.3 4.5 mm and a width of 4.8 6.8 mm, with 4 5 whorls The shell is light brown with tan or darker brown spots and short stripes randomly distributed over the entire shell There generally are long hairs covering the shell approximately 0.20.3 mm long in the juveniles. The hairs are often absent in the adults. Native Range Western Mediterranean region

PAGE 370

370 Distribution North America : U.S.: California Ecology This species is documented as a pest in vineyards. It can be found in multiple microhabitats, from dense vegetation to wall crevices. Synonyms Xerolenta conspurcata Helix conspurcata Draparnaud, 1801 Helicella conspurcata (Draparnaud, 1801) References Kerney et al. 1979 Zachrysia spp. Family Pleurodontidae Species Zachrysia provisoria (Pfeiffer, 1858) Z. trinitaria (Pfeiffer, 1858)

PAGE 371

371 Common Name Cuban land snails Zachrysia provisoria: Garden zachrysia Z. trinitaria : Trinidad zachrysia Description Zachrysia provisoria: This snail can attain a height of approximately 20 mm and a maximum width of 32 mm, with 45 rapidly expanding whorls This animal's shell is generally globose in shape. The initial whorls have an orange color, while the body whorl is tan with dark blotches and arboreal branchings. Z. trinitaria : This species is larger than Z. provisoria and the shell will measure up to 45 mm. Both species are similar in appearance; however, they can be easily distinguished by their genitalia: Zachrysia provisoria: long flagellum on penis. Z. trinitaria : short flagel lum on penis. Native Range Greater and Lesser Antilles Distribution North America : U.S.: Florida (Not Z. trinitaria ) Central America: Guatemala Caribbean : Cuba, Puerto Rico, Barbados, Saint Croix, Jamaica, Mustique, Nevis, Bahamas, Virgin Islands, Costa Rica, Haiti, Dominican Republic Ecology Zachrysia species generally are pests wherever they become established. Z. provisoria has been noted to be a serious pest of ornamental plants in Florida.

PAGE 372

372 Synonyms Zachrysia provisoria: Helix provisoria Pfeiffer, M alak Bl. V, 1858, p39 (Manzanillo, Cuato and Guisa); Monogr. Hel. Viv. V, 1868, p. 288. Arango, Contrib., p. 72. Helix appendiculata Gundlach, M.S. list, 1858, Pfeiffer, Monogr. V, p. 288, as synonym of H. provisoria ; not otherwise defined. H. auricoma... les individus envoyes de Cabo Cruz, Poey, Memorias II, p. 50, 67, pl. 6, fig. 9 (genitalia). Z. trinitaria : Helix bayamensis Pfr., Malak. Blatter IV, 1857, p. 103 (desription of living animal). Helix trinitaria Gundlach, Pfeiffer, Malak. Blatter V, 1858, p.176, footnote. References Auffenberg and Stange 1993; Cowie et al. 2009; Pilsbry 1928; Robinson and Fields 2004; Rosenberg and Muratov 2006

PAGE 373

373 Zonitoides spp. Family Zonitidae Species Zonitoides (Zonitellus) arboreus (Say, 1819) Zo nitoides nitidus (Muller, 1774) Common Name Zonitoides (Zonitellus) arboreus : Quick gloss Zonitoides nitidus : Black gloss Description Zonitoides (Zonitellus) arboreus : The flattened heliciform shell of this snail is approximately 56 mm in diameter and between 2.4 and 3 mm high. It is often umbilicate (navel like), dark brown and shiny with irregular, faint incremental wrinkles and microscopic spiral striations The whorls are 44 1/2 with the embryonic 1 1/2 whorl being smooth. The body of the snail is bluegrey, including the tentacles However, the

PAGE 374

374 sides and tail are a lighter in color. The sole of the foot is white or gray with paler flecks along the margin. While moving, the foot shows no waves. The aperture is very lunate (moon shaped) and wider than high, with a thin peristome (edge of shell's mouth). Zonitoides arboreus does not possess the orange spot on the mantle found in Z. nitidus Also, quick gloss has a slightly flatter spire than black gloss. Zonitoides nitidus : The flattened heliciform shell of the black gloss snail is approximately 5.9 7 mm wide, 3.64 mm high, dark brown and shiny. The shell has irregular, low wrinkle like axial striae and a total of 4 1/2 to 5 whorls The body of the snail is black with a dull orange spot on the mantle This orange spot can be seen through the shell in contracted individuals. It can be located behind the apertural lip between the suture and the periphery. The snail itself is completely black except for one pale fleck along the edges of the foot The black gloss snail can be distinguished from Zonitoides arboreus by the presence of an orange spot on the mantle Native Range Zonitoides (Zonitellus) arboreus: North America Zonitoides niti dus: Holarctic Distribution Zonitoides (Zonitellus) arboreus : North America : U. S.: all states but Nevada Canada: Alberta, British Columbia, New Brunswick, Newfoundland, Nova Scotia, Ontario, Quebec South and Central America : Mexico, Costa Rico, Guatemala Caribbean : Cuba, Santo Domingo, Jamaica, Guadeloupe Australasia: Australia, New Zealand Asia : Japan South Africa Europe : Prague, Finland, Moscow, Britain, Ireland Zonitoides nitidus : North America :

PAGE 375

375 U.S.: Alaska, Delaware, Iowa, Illinois, Indiana, Kentucky, Louisiana, Maine, Maryland, Massachusetts, Michigan, Minnesota, Nebraska, New Jersey, New York, Ohio, Oklahoma, Oregon, Pennsylvania, South Dakota, Tennessee, Utah, Vermont, Washington, West Virginia, Wisconsin Canada: Alberta, British Columbia, Newfoundland, Nova Scotia, Ontario, Quebec Europe Africa : Algeria Ecology Zonitoides (Zonitellus) arboreus : This species can be found in greenhouses and natural habitats and can withstand some desiccation. It is considered to be a key pest in Hawaiian orchid production. It can be found in rotting wood, leaf litter and vegetation. Its movements are very quick for a snail. The eye tentacles are widely separated with characteristically black, slightly bulbous eyes. Zonitoides nitidus : This species generally lives in marshes, greenhouses and wet areas along the edges of rivers, sloughs, lakes and ponds where it can be found under wood, rocks, and vegetation. Black gloss snails are carnivores and have been noted to be cannibals. This species reproduces mainly by self fertilization Synonyms Zonitoides (Zonitellus) arboreus : Helix arboreus Say, 1816, [Nicholson's] Amer. Edit. British Encycl., vol. 2, art. Conchology, species no. 2, pl. 4, fig. 4. H. breweri Newcomb, 1864, Proc. Cal. Acad. Sci., 3:118 (Lake Tahoe, Cal.) Cf. H. B. Baker, Occas. Pap. Mus. Zool. Univ. Mich., 269: 13. Zonites arboreus Say, W. G. Binney, 1878, Terr. Moll., 5:114, pl. 29, fig. 3; pl. iii, fig. F (teeth). Hyalina arborea var. viridula Cockerell, 1888, ScienceGossip, 24: 257., Custer Co., Colo. Hyalina arborea Say, Von Martens, 1892, Biol. CentraliAmer., Moll., p. 116, pl. 6, figs. 13 13c. Zonitoides arboreus (Say), J. Henderson, 1924, Univ Colo. Studies, 13: 147; 1929, 17: 102; 1936, 23: 109, 258; Sterki, 1893, Proc. Acad. Nat. Sci. Phila.,, p. 394, development of teeth. Helix ottonis Pfeiffer, 1840, Arch. Naturg., 6: 251 (Cuba) ; Gould, 1851, Terr. Moll., 2:238. Hyalina breweri Newcomb, W. G. Binney, 1864, Land and Fr. W. Sh. N.A., 1: 43, fig. 66. Helix whitneyi Newcomb, 1864, Proc. Cal. Acad. Sci., 3: 118 (Lake Tahoe).

PAGE 376

376 Hyalinia wh itneyi Newcomb, W. G. Binney, 1869, L. and Fr. W. Sh. N. A., 1: 32, fig. 37; H. B. Baker, 1931, Nautilus, 44: 98 (identical with Z. arborea). Hyalinia (Polita) roseni Lindholm, 1911, Nachrbl. d. d. mal. Ges., 43: 98 (park near Moscow); cf. Lindholm 1922. Zonitoides nitidus : Helix nitida Muller, 1774, HIst. Verm., 2: 32 (Fridrichsberg, Denmark). Zonites nitidus Muller, W. G. Binney, 1878, Terr. Moll., 5: 113, pl. iii, fig. A (teeth). Zonitoides nitius Muller, Dall, 1905, Harriman Alska Exped., 13: 42; F C. Baker, 1920, Life of the Pleistocene, pp. 307, 339, 389; J. Henderson, Univ. Colo. Studies, 13: 147; 17;102; 23;109; H. B. Baker, 1928, Proc. Acad. Nat. Sci. Phila., 80: 38. Helix hydrophyla Ingalls, Miles, 1861, Ist. Bienn. Rept. Prog. Geol. Surv. M ich., p 235, 238. Helix hydrophila Ingalls in coll., Binney & Bland, 1869, Land and F. W. Sh. N. A., 1: 32 (as synonymn of Hyalina nitida Muller; Greenwich, Washington Co., N.Y.). References Abbott 1989; Anderson 2005; Cowie et al. 2008; Horsk et al. 2004; Kerney et al. 1979; Kuznik Kowalska 2011; Pilsbry 1946; Rosenberg and Muratov 2006

PAGE 377

377 Glossary of Terms a b cd e f g h i kl m n o p r st u v w a Aestivation (to aestivate): Being in a state of arrest (often temporary and can be broken at anytime). Anal pore: Small opening located in the mantle; may be located anteriorly or posteriorly and is responsible for wast e removal by the animal. Annulated: Consisting of rings. Anterior: Directional term: located in front. Nearer the head or front end of a shell. Anterior laterally: This is a directional term meaning towards the front, on the side.

PAGE 378

378 Apertural lip: The margin of the aperture, which may be sharp or thickened depending upon the species (Also see lip). Aperture: The major opening of a shell that the body of the animal may be retracted. Apex: The tip of the spire of a shell. Aphallic: The state of lacking a penis. Apical: Top side of the shell; opposite of base. Apical whorls: The whorls near the apex of the shell. Arboreal: Of or relating to trees OR Treedwelling or frequenting trees. Asymmetrical: Not even on both sides of a usually central axis. Atr ium: Opening or passage of the genitalia. OR Region for the reception of gametes. Axial: Directional term: This refers to a vertical direction often parallel to the columella; opposite of spiral. b Band: In slugs: Any transverse line (runs from side to s ide, or vertically e.g., on the foot fringe). In snails: A section of a shell that is differentiated by color or texture from either side of it. Banding: Color markings in continuous stripes. Base: This is the lower or underside of the shell; opposite of apical. Beehiveshaped: Shell shape: having a shape that resembles a beehive. Body whorl: The large, final coil (most recently formed) of a mollusc shell that contains the body of the snail, i.e. from the aperture to approximately one whorl back. Breat hing pore: This is the breathing hole on the right side of the mantle of molluscs. This allows air to pass through to the mantle for gas exchange. (See also pneumostome). c Calcareous: Consisting of limestone or calcium carbonate. Callus: A area of the s hell that is thickened.

PAGE 379

379 Carinate: Posses or have a keel. Character: 1). A distinctive trait, quality or attribute used for recognizing, describing, or differentiating taxa; 2). The term used to denote such descriptive traits that possess states and are l ocated within the Lucid version 2 (and later) interactive matrix panel. (compare feature) Character state: See also state Columella: The central axis of the shell; originates at the shell apex and ends at the umbilicus. Conical: Shell shape: shells with an elongated spire that tapers to a point and are slightly broader at the base. Conspecific: Of or belonging to the same species or species group. d Decollate: This term is used to describe shells without an apex. Dentate: Possessing teeth or denticles (often refers to the aperture). Denticle: Toothlike structure on or in the opening of a shell (not to be confused with the radulate teeth inside the mouth of the animal). (See also teeth). Denticle (Parietal denticle): Toothlike structure on or in the opening of a shell (not to be confused with the radulate teeth inside the mouth of the animal). (Also see teeth, denticle). Depressed: Shrunken below a certain level. Depressed heliciform: Shell shape: shell that is wider than high. Detritus: Disintegr ated organic material e.g. decaying leaves. Dextral: Having the opening of the shell on the right side when oriented so that the apex is upwards and the aperture is facing you. Diapause: Being in a state of arrest (often predetermined and lasts for a specific period of time). Diecious: Being sexually distinct. Male and female genitalia do not occur in the same specimen.

PAGE 380

380 Discoid or Discoidal: Shell shape: disc shaped, shell that is wider than high and depressed. Distal: The farthest part from an object or the body of the animal. e Entities: See also entity Entity: In Lucid, entities are the items the key aims to identify. Lucid uses the term entity to encompass items of all types. Epiphragm: Temporary mucus secretion deposited in the aperture of the s hell during periods of inactivity (e.g., aestivation). (See also operculum). Euphallic: The state of possessing both fully developed male and female reproductive organs. Evaginate: To turn inside out. Eversion (to evert): The act or condition of being t urned inside out. f Fact sheet: 1). A presentation of data in an HTML format on any subject emphasizing brevity, key points of interest or concern, and a way to convey the most relevant information in the least amount of space; 2). An HTML page itemizing the facts or pertinent information about each of a tool's entities. Feature: 1). A distinctive trait, quality or attribute used for recognizing, describing, or differentiating taxa; 2). The term used to denote such descriptive traits that possess states a nd are located within the Lucid version 3 interactive matrix panel. (compare character) Foot: The muscular organ on the undersurface of the body of a mollusc upon which the animal rests or uses to crawl. Furrow (s): Having pits, grooves or trenches. g G astropod: A singleshelled mollusc. Genital opening (genital pore): Orifice that serves as the entrance to the reproductive system OR the opening that allows for the eversion of the penis.

PAGE 381

381 Genitalia: The reproductive structures of an animal. May refer to either male or female structure. Globose: Shell shape: to be roughly spherical or globular in shape. Granular: Bearing granules on the surface or having a rough appearance. Groove: An elongate and fairly uniform depression or indentation in the shell or soft parts of a mollusc. Growth line (s): Deeply or markedly formed transverse lines on the shell surface due to growth stages and rest periods. h Head: The area of a mollusc's body that has the tentacles, eyes and mouth. Height: The height of the shell is a measure of the distance between the apex and the most basal part of the shell OR the measurement taken from the apex of the shell to the base, when measured parallel to the axis of the shell. Helical: Spirally coiled. Hemiphallic: State of having a reduced (not of typical size and structure) penis. Hermaphrodite: Having both male and female reproductive organs. (See also Hermaphroditic) Hermaphroditic: State of having both male and female reproductive organs. (See also Hermaphrodite) Hirsute: S hells with a hairy surface. Hyponotum: The ventral surface of the mantle. This structure can be found on either sides of the foot. i Impressed: Term used to describe the sutures of the shell when they are recessed OR may describe the sculpturing of the s hell when there are depressions or pits. Invaginate: To fold or turn inward

PAGE 382

382 k Keel: Also known as the carina. This is a longitudinal ridge that runs dorsally along the apex of the tail of the animal. Keel (shell of animal): This is a ridge that runs along the periphery of the body whorl. Keel (tail of animal): Also known as the carina. This is a longitudinal ridge that runs dorsally along the apex of the tail of the animal. l Lip: The margin of the aperture, which may be sharp or thickened depending up on the species (Also see apertural lip). Lirae: Raised, spiral lines on the surface of the shell. m Malacologist: One who studies molluscs. Malacology: The study of molluscs. Mantle: A fleshy, membranous covering of the anterior portion of the body of a mollusc. It secretes the materials that form the shell. Mantle cavity: The gap or space between the mantle and the visceral mass. Median: Along the central line or axis. Microsculpture: Any textural feature of the shell, especially those that can be s een with the aid of a microscope. Mollusc: Common name for animals in the phylum Mollusca. These are invertebrate animals, which have soft unsegmented bodies and may or may not possess a shell. This group includes gastropods (slugs and snails), cephalopods (octopus) and bivalves (clams, oysters). n Necrotic: Dead or dying tissue. Often brown to black in color. Nocturnal: Occurring or becoming active at night.

PAGE 383

383 o Olfactory: Of or relating to the sense of smell. Opaque: Not having the ability to see through an object. (Not transparent or translucent) Operculum: A rigid structure that blocks the opening/aperture of the shell (partially/wholly) when the body of the snail is retracted. This structure is often attached dorsal to the tail of the animal. It can be chitinous, proteinaceous or calcareous. Often observed in aquatic species. (See also epiphragm). Oviposit (Oviposition): The act of egg laying. Oviviparous: Ability to give birth to live young, where the parent produces eggs that hatch internally. (S ee also viviparous) Ovoviviparous: Reproductive strategy: prior to deposition, eggs are retained inside the animal until they are fully developed. p Periostracum: This is a thin membrane that coats the shell, often comprised of chitin or proteinaceous su bstances. This material may be smooth, or covered in hair or 'scalelike' projections. Peristome: Margin of the aperture of a snail's shell. This region may be thickened in mature animals. Pneumostome: This is the breathing hole on the right side of the mantle of molluscs. This allows air to pass through to the lung for gas exchange.(See also breathing pore). Posterior: Directional term: the rear or tail end of an animal. r Radula: A rasplike or ribbonshaped structure that bears rows of teeth used in feeding. Recurved: To curve back at the tip of the shell's lip. (See also reflected) Reticulate: A network pattern of lines or grooves. Ribs: Raised, transverse ridges on the surface of the shell.

PAGE 384

384 s Self fertilization: This is an event where an organis m is produced by the fertilization of an egg by sperm from the same organism. (See also hermaphrodite) Semi slug: A snail that possess a very reduced (no definite coiling) or small shell, that is often located on the posterior edge of the mantle. The anim al is not able to retract into this minute shell. Sexually dimorphic (Sexual dimorphism): This term is used to refer to any species where there is a physical difference between males and females of that same species (e.g., in peacocks, only males have the distinctly colorful feathers on the tail). Shell: A hard, inflexible, calcareous or chitinous structure that vary in size and may either completely encasing the animal, covering some part of it or be internal. Sinistral: Having the opening of the shell on the left side when the observer hold the shell so that the apex is upwards and the aperture faces them. Siphon: In aquatic and semi terrestrial gastropods, this is a narrow breathing tube formed by an extension of the mantle. Slug: A snail that either does not possess a shell or has one that is very reduced (no definite coiling) or internal. Spermatophore: This is a capsule or sac of male gametes and nutrients, which is produced by the male organ of the snail. This capsule is often transferred as a whole, to the female reproductive organ during mating. Spiral: Directional term: direction of the coils of the whorls of a shell; opposite of axial. Spire: All the coils (whorls) of a shell above the body whorl. State: The basic component or distinct phas e of a Lucid feature or character that can be observed, measured, or otherwise assessed. Striae: Any linear indentation on the surface of the shell. They can be either spiral (stripes) or axial (bands) in direction. Striations: Having a series of stripes grooves or lines. Stripe (s): 1). In slugs: Any longitudinal line that runs from the head of the animal to the tail. 2). In snails: Any spiral line that follows the whorls. Succiniform: Shell shape: shell that is higher than wide with a very large aper ture (mouth). The spire is generally brief and the body whorl very expanded.

PAGE 385

385 Suture: The junction/seam between the whorls of a mollusc's shell. t Tentacles: Sensory projections on the head end of a mollusc. There are generally two pairs; upper (posterior ) and smaller, lower (anterior). The upper pair bears the eyes. In many snails the eyes are located at the tips of this structure; however, in Basommatophoran snail species, the eyes are located at the base of the tentacles. Tooth (teeth): Toothlike stru cture in the opening of the shell (not to be confused with the radulate teeth in the mouth of the animal). (See also denticle). Translucent: Allows light to pass through but prevents the ability to see distinct objects. Tripartite: Having three distinct section/regions. Tubercle: An enlarged or raised region on the body of a slug. The shape of this structure is very variable. Tubercles: An enlarged or raised region on the body of a slug. The shape of this structure is very variable. (See also tubercle) u Umbilicus: A navel like indentation or depression in the center of the shell. It may be described as open (inside of columella visible), partially closed (partly covered by base of aperture) or completely closed (not visible). The width of the umbilicus is a measure of its greatest diameter. v Visceral mass: The region of the mollusc's body that contains the organs. Viviparous: Ability to give birth to live young (no eggs produced), where the embryo develops inside the parent. (See also oviviparous) w Whorl: A complete spiral turn/growth of the shell of a mollusc. The whorls are counted from the apex outwards. Whorls: Pleural of whorl. A whorl is a complete spiral turn/growth of the shell of a mollusc. The whorls are counted from the apex outwards. W idth: The width of the shell is the maximum distance across the shell (including the aperture).

PAGE 386

386 How to Identify Terrestrial Gastropods Introduction It may be difficult, even for malacologists, to identify molluscs, simply because they do not usually poss ess many characters that are consistently useful for distinguishing among related species. This section of the tool was designed to assist the user in becoming familiar with the common characters that are used in the identification of terrestrial snails and slugs. Shell Classification How do you know if you truly have a snail or a slug? Gastropods that possess an obvious shell are termed snails whereas gastropods that appear to lack an obvious shell are termed slugs. In the case of semi slugs it may be deb atable whether the animal should be considered a snail or a slug. The entities included in this tool are divided into two major categories (snails and slugs) to reduce ambiguity and to allow users to quickly and more efficiently navigate through the key. Shell Present: Shell obvious with definite coiling and animal may be able to retract into it. Figure 1. Typical snails Shell Absent: Shell very reduced or i nternal and if present, it has no definite coiling. If the shell is partially external, it is usually small and is located on the posterior end of the mantle (see image below, far right).

PAGE 387

387 Figure 2. Typical slugs Slug Characters Several morphological characters can be used to identify slugs. A few of these include: Mantle Characters: Body covered by mantle (partly or wholly) Location of breathing pore on mantle (or on the body of the animal) Mantle groove Body Characters: Length (preserved specimens may shrink to approximately 7080 % the length of living specimens) Body color Body markings (spots, blotches, stripes, bands) Mucus pore Length of the slug (fully extended at maturity) Sole color Tail constriction at the point of amputation (this is a faint groove that can be observed on the dorsal surface of the tail; behind the mantle. A narrow dark colored band on the sole of the animal can also represent the poin t of amputation.) It should be noted that the point of amputation might not always be visible in species that typically possess one. Mucus Color: White, yellow, orange, clear Keel Characters: Presence or absence of the keel Length of the keel

PAGE 388

388 Shell Charac ters Shells generally have a large number of characters that can be used to distinguish between groups of snails. Shell sculpturing is one such character. Common shell sculpturing include: Hairs/Bristles projections on the shell that resemble mammalian hair Pits regularly shaped indentation in the shell Dents irregularly shaped indentations in a shell Striae groovelike indentations that follow the whorls Lirae raised ridges that follow the whorls Ribs raised ridges that run at an angle (usually transversely) to the whorls Pleats/ Wrinkles any type of ridging or creasing that appears to have been formed by folding or crumpling

PAGE 389

389 Figure 3. Shell terminology.

PAGE 390

390 Common Shell Types Figure 4. Common shell types.

PAGE 391

391 How to Measure a Terrestrial Gastropod Measurement can be a useful character in the identification of a terrestrial gastropod. In snails, the length is taken from the apex of the shell to the base of the aperture (mouth). The width should be taken at the widest part of the shell when the shell is oriented so that aperture faces the observer; the width is measured from the side of the body whorl to the outermost side of the aperture (mouth). Terrestrial slugs are measured from the head, excluding the tentacles to the tip of the tail (Figure. 5). It is important that the animal is fully extended to in order to obtain an accurate measurement.

PAGE 392

392 Figure 5. Measuring terrestrial gastropods Umbilicus The umbilicus may be used as a diagnostic character when classifying snails. The umbilicus may be open or closed. The width of the open umbilicus is taken at the widest part of the inner surfaces of the body whorl (Figure. 6).

PAGE 393

393 Figure 6. Types of umbili cus commonly observed in terrestrial snails. Counting Whorls There are several ways to count the number of whorls on the shell of a snail. The most commonly used method described by Pilsbry (1939) will be discussed here. Before counting the whorls, an imaginary line should be drawn across the shell as demonstrated in figure 7 below. The whorls are then counted following the direction of the coils. A complete turn indicates a whorl (i.e., every time the line is intersected when

PAGE 394

394 following the whorls). The body whorl may not be complete, meaning that it may end in quarters or thirds (Figure 7). Figure 7. Counting shell whorls. Genitalia The genitalia (formed by the fusion of both male and female structure) are one of the most diagnostic characters used to distinguish between mollusc species. In many groups (e.g., Veronicellids), a positive identification cannot be obtained without the us e of the genitalia character s. A generalized diagram of the genitalia can be found in Figure 8. There may also be reproductive structures that are present in some species and not others. Additional information on the genitalia (structure and function) can be

PAGE 395

395 found in the biology section of this tool. Figure 8. Generalized diagram of a terrestrial molluscs reprodu ctive system. Biology and Ecology Biology The phylum Mollusca is one of several invertebrate (animals without a spine) groups and comprises a wide array of animals including gastropods (snails and slugs), cephalopods (squids, octopuses) and bivalves (clams, oysters). Of this group, the primary focus of this tool will be the terrestrial gastropods. In general, snails are often described as those species that possess a shell into which they can retract partially or wholly. Slugs m ay or may not have shells and for those species that do have shells, it is much reduced and may be internal. Also, for those slug species that have external shells, the shell cannot host the body of the animal and no obvious coiling can be observed. All t errestrial gastropods have sensory organs referred to as tentacles. There are often two pairs: the larger, upper pair (ocular tentacles) bears the eyes at their tips, and the lower pair (oral tentacles) is used as a sensory organ for detecting odors (Figur e 1). Some snail species have only one pair of tentacles (i.e., they lack the ocular tentacles).

PAGE 396

396 In these species, the eyes are located at the base of the sensory tentacles. Figure 1 General anatomy. The mouth of the animal is located below the tentacles. It contains a specialized structure known as a radula, which is comprised of a mass of chitinous teeth arranged in rows. The radula is used to scrape pi eces of food into the mouth of the animal using a back and forth motion. The reproductive opening (genital pore) of terrestrial gastropods is generally located anterior laterally. In snails, the genital pore is located on the head of the animal, just behi nd the tentacles. Slugs, however, have their genital pore located between the breathing pore and the head, and in some cases this structure may conceal by the mantle. Slugs in the family Veronicellidae are a notable exception to this rule. The genital opening of this group is located ventrally and there are two openings: one that allows access to the female portion of the genitalia and another that allows for the eversion of the male portion of the genitalia. In most terrestrial gastropods, both sex organs occur in the same organism; however, there are a few cases where aphallic (does not have a penis) specimens of normally hermaphroditic species (e.g., Deroceras laeve) do exist. However, there are a few species in which separate sexes occur (e.g., Marisa c ornuarietis ). The mantle is a structure that is located on the dorsal surface of the animal, just behind the head, and it mainly functions to secrete compounds that are used to construction the shell. In snails, the mantle is not readily noticeable as it i s often restricted to the shell. On the other hand, the mantle of slugs is readily visible and generally extends over the back of the animal, covering anywhere from 30100% of the dorsal surface (Figure 2). The mantle may extend over the shell of a few species of semi slugs (e.g., Helicarionidae) when they are active, and can be retracted voluntarily by the animal. The pneumostome or breathing pore is an opening in the mantle of the animal that supports gas exchange, by serving as the entrance to the animals lung. The pneumostome is located on the right side of the animal (i.e., when the animal is positioned with the tail facing the observer, the pneumostome is on the right of the observer).

PAGE 397

397 The ventral portion of the animal bears a muscular structure term ed the foot, which is used in locomotion. The skin of the entire animal secretes mucus that aids in the movement of the animal and also serves to reduce dehydration. Many terrestrial gastropods will produce copious amounts of mucus in an attempt to evade p otential predators or when irritated. Figure 2. A: Mantle covering the dorsal surface of the body: A 30%, B 100%. Figure 3. General Shell Anatomy Ecology Snails and slugs display selective preference for moist, humid habitats (e.g., gardens, forests, wetlands, greenhouses). There are a few terrestrial species that are adapted to environments atypical of terrestrial gastropods (e.g., the snail Cernuella virgata is adapted to living in sand dunes). Snails may aestivate under unfavorable conditions, by retracting into the shell and producing a mucilaginous st ructure (epiphragm) in the aperture (mouth) of the shell. The epiphragm will desiccate and become papery, thus sealing the aperture to reduce moisture loss. Prior to aestivation, some species prefer to

PAGE 398

398 affix themselves to vertical structures such as the si des of buildings, grass blades, and fence posts. Terrestrial slugs generally prefer to inhabit dark, humid places such as beneath rocks and logs on the forest floor, in leaf litter, and under tree bark during daylight. They are normally nocturnal, althoug h they may be found wandering about during the day after it rains. Snails and slugs feed primarily on plant material (living or dead), mushrooms, and lichens. On occasion, terrestrial slugs and snails may feed on conspecifics, other species of molluscs and their eggs, and calcareous material (e.g., rocks, headstones). Snails: Juvenile to Adult It is sometimes difficult to determine if a snail of a given species is a juvenile based solely on its shell. In many cases observation of the genitalia, through di ssection of the specimen, is required. As a general rule, the shell of juveniles tend to have brittle apertural lips, whereas the apertural lips of adult specimens are often thickened, rigid and may be reflected in some species (e.g., Otala spp. and Eobani a vermiculata). Also, the base of the juvenile aperture curves downward, whereas in adult specimens the apertural lips generally curve outward, rather than downward (Figure 4).

PAGE 399

399 Figure 4. Comparison of juvenile and adult shells of Zachrysia provisoria Reproductive System The genitalia (formed by the fusion of both male and female structures) are one of the most diagnostic characters of molluscs. In many groups (e.g., Veronicellids), positive species identification cannot be made without the use of the genitalic characters. A generalized diagram of the genitalia can be found in Figure 5. There also may be genitalic structures present in some species and not others. Some of these structures

PAGE 400

400 are illustrated in Figure 6. Figure 5. Diagram of a terrestrial molluscs generalized reproductive system.

PAGE 401

401 Figure 6. Diagram of a terrestrial molluscs reproductive system with additional specialized structures. Parts of the Reproductive System and their Functi on Ovotestis/Gonad: Site of egg and sperm development in hermaphroditic species (i.e., it functions as an ovary and a testis). Hermaphroditic duct/Ovotestis duct: Allows for the passage of the gametes to the fertilization pocket. Seminal vesicle: Functions in sperm storage (sometimes allow for further sperm maturation), reabsorption and degeneration. Albumen gland: The function of the albumen gland is to produce albumen or perivitelline fluid for the egg. Fertilization pouchspermatheca complex (FPSC)/Fertilization pocket (pouch)/Talon/Carrefour/Spermoviduct: As its name suggests, this is the place where fertilization occurs.

PAGE 402

402 Prostate gland: Functions to produce seminal fluid. Bursa copulatrix/Spermatheca/Gametolytic gland: Functions to receive sperm dur ing copulation. It is also said to have a function in sperm degradation. Oviduct: Functions to separate the groups of oocytes coming from the ovary into a line in order to increase the chances of being fertilized. Vas deferens: Functions to accumulate sperm prior to copulation. Vagina/Upper atrium: Functions to receive sperm during copulation. Atrium: Allows entry to the reproductive system. Flagellum: Used in sperm transfer. Penis: Functions to transfer sperm during copulation. Cross -fertilization Terres trial gastropods have the ability to independently manipulate the movement of the eggs and sperm that originate in the ovotestis. Figure 7. Generaliz ed diagram of the cross fertilization process (Modified from Wiktor 2000). 1. Sperm cells are continuously produced by the ovotestis and released into the hermaphroditic duct. The sperm cells may be temporarily stored in the hermaphroditic duct in seminal vesicles. When the sperm cells are needed for fertilization, the sperm cells actively migrate from the hermaphroditic duct to the fertilization pocket. Inside the fertilization pocket is a structure called the sperm

PAGE 403

403 duct. The sperm duct forms a groove that c an be voluntarily closed by the animal during copulation. This functions to prevent self fertilization when not desired. 2. The sperm then migrates to the prostate gland, which produces fluids that provide nourishment to the passing sperm cells. This fluid i s very thick and immobilizes the sperm cells. The immobilized sperm cells are then transported towards the vas deferens by the peristaltic movement of the walls of the prostate gland. 3. The sperm cells are then transferred from the vas deferens to the penis via the epiphallus. The penis is then everted and the sperm mass deposited into the recipients atrium. 4. The sperm cells may be transferred directly into the mating partners bursa copulatrix. 5. A small percentage of the sperm cells deposited into the bursa copulatrix will migrate into the oviduct. 6. The sperm cells now migrate from the oviduct into the fertilization pouchspermatheca complex. 7. Eggs are voluntarily released from the ovotestis into the fertilization pouchspermatheca complex where it will unit e with sperms that have migrated there. 8. The fertilized eggs (zygotes) are provided with a nutritious albumen coat that is produced by the albumen gland. The eggs are then transported from the fertilization pouchspermatheca complex into the oviduct sectio n of the common duct where they may be arranged in a line (resembling a pearl necklace). Several layers of material of rich in calcium are then deposited around each egg prior to being laid by the recipient. 9. The recipient animal then deposits the fertiliz ed eggs. It should be noted that self fertilization could occur in a similar manner as described above, except no donor is involved. Snail and Slug Dissection How to prepare the animal for dissection Live specimens should be drowned in an airtight container that is completely filled with water. The animal should be left until completely drowned (i.e., unresponsive to touch). This will make it easier to dissect the specimen, as it kills the animal in an extended state (not contracted). Small snails may also be euthanized by emersion in boiling water. Specimens usually expire in a relaxed state and should be removed from boiling water when no longer responsive to touch. The specimen should then be transferred to a dissecting dish containing 70 % ethanol or wa ter. The solution should completely cover the specimen to minimize dehydration of the tissues. The dissecting dish should then be mounted onto the stage of the microscope and the dissection conducted under at least 10 X magnification. Supplies:

PAGE 404

404 Dissectin g microscope Water Dissecting dish Forceps Scalpel Dissecting scissors Pliers 4 inch C clamp or small vice grip (optional) 70 % Ethanol (optional) Curved forceps (optional) # 4 stainless steel insect pins (optional) ** Specimens should never be left in water for extended periods as rapid deterioration of tissues may occur. *For photographing purposes, it is best that all organs be fully submerged. In order to optimize the quality of the photograph, ethanol should be used, as the animal will f loat in water. Snail Dissection Step 1 Orient the specimen Photograph of a freshly preserved animal. Note the head and tail region of the animal, as the specimen will appear different after removal of the shell. For humane purposes, ensure that the animal is completely unresponsive to touch before initiating the dissection. See supplies section on how to relax the specimen.

PAGE 405

405 Figure: 01 Step 2 Remove the animal from the shell In some cases, it may be possible to remove the dead animal from its shell using curved forceps. If this is not p ossible, slowly break the shell from the aperture backwards, following the whorls, until the animal can be removed from the shell intact. (It is important to retain the broken pieces of the shell for identification purposes). A pair of needle nose pliers m ay be used depending on the size of the animals shell. Fi gure:0 2

PAGE 406

406 Figure:03 Figure:04

PAGE 407

407 Figure:05 Step 3 Submerge Shell less animal in 75% Ethanol or Water Diagram showing a Helix species with the shell removed (Figure 06) was provided to assist with the orientation of the specimen. Place the shell less adult specimen in a dish with 75% ethanol or water covering it.

PAGE 408

408 Figure 06 Figure 07 Step 4 Uncoil snail and make an incision above the mantle skirt Slowly uncoil the portion of the animal that was inside the shell to expose its contents. Make an i ncision just above the mantle skirt as indicated by the broken line in Figure 08. Be sure to make shallow incisions and angle the scissors upwards, and away from the internal organs. Cut as far along the skirt as possible.

PAGE 409

409 Figure: 08 Figure: 09 Step 5 Cut along the length of the thin membrane Cut along the broken li nes as indicated in Figure 10. Avoid all internal organs/structures by only cutting the thin (transparent) membrane. Continue with the incision along the edge of the membrane all the way to the first whorl. This will expose portions of the reproductive and digestive system. Also, cut along the lines indicated in Figure 12 to expose the base of both systems.

PAGE 410

410 Figure: 10 Figure: 11

PAGE 411

411 Figure: 12 Step 6 Peel back the membrane to expose the internal organs Peel back the transparent membrane to expose the internal organs. Continue with the incision made in Figure 12 all the way to the end of the coiled regions of the animal (portion that was retained inside the shell).The animal may be inverted to accomplish this as indicated by the broken lines in Figure 15.

PAGE 412

412 Figure: 13 Figure: 14

PAGE 413

413 Figure: 15 Step 7 Remove ovotestis from digestive gland Slowly tease the ovotestis and the albumen gland away from the digestive gland. Both organs can be carefully separated wi th a pair of tweezers. Once dislodged, both systems can be separated as indicated in Figure 19. Figure: 16

PAGE 414

414 Figure: 17 Figure: 18

PAGE 415

415 Fig ure: 19 Step 8 Cut forward into the mantle skirt to expose the base of the reproductive system Rotate the animal unto the side (may have to hold in hands) and cut into the mantle skirt going forward, towards the head. Be sure to make the incision betwee n the ocular tentacles. This cut will expose the basal region of the reproductive system. The pins can be removed from the specimen for photography or closer examination. Figure: 20

PAGE 416

416 Figure: 21 Step 9 Detach the reproductive system Gently separate the reproductive system from the digestive system. Note the genital open ing in Figure 22. Make incisions along the broken lines as indicated in Figure 22. Be careful to avoid cutting through the atrium. This incision will detach the entire reproductive system form the rest of the animal (Figure 23). Use an insect pin to gently unravel the vas deferens, bursa copulatrix, oviduct, flagellum, and penis by following the connection to each. Figure: 22

PAGE 417

417 Figure: 23 Step 10 Treatment for Photography If a photograph of the reproductive system is required, the structures can be arranged and pinned as desired then fixed in place by immersion in 95% ethanol for approximately 15 minutes. DO NOT leave the reproductive structures in 95% ethanol for an extended period as dehydration and distortion will occur. The pins can be removed from the specimen for photography or closer examination.

PAGE 418

418 Figure: 24 Figure: 25 Slug Dissection Step 1 Note general location of internal organs (dorsal view)

PAGE 419

419 These are generalized diagrams of the digestive and reproductive systems. Both systems occupy most of the animal and in many cases are closely associated. Please note that the size, location and relative position of the reproductive organs may vary depending on the species. View from dorsal surface Step 2 Orient the specimen Photograph of a freshly preserved animal. Submerge the relaxed, extended adult specimen in a dish with 75% ethanol or water. Note the head and tail region of the animal, as the specimen will appear dif ferent after removal of the body covering or mantle. For humane purposes, ensure that the animal is completely unresponsive to touch before initiating the dissection. See supplies section on how to relax the specimen.

PAGE 420

420 Figure 02 Step 3 Remove the foot of the animal by cutting along the sole Make a shallow incision near the tip of tail using a pair of sharp dissecting scissors. Angle scissors upwards and proceed with the incision along the foot of the animal. The incision should be made just above the foot fringe, groove, or where the body or mantle of the animal meets the foot. Cut towards the head of the animal (on both sides) to remove the entire foot.

PAGE 421

421 Figure 03 Figure 04

PAGE 422

422 Figure 05 Figure 06

PAGE 423

423 Figure 07 Figure 08

PAGE 424

424 Figure 09 Step 4 Remove the body covering and/or mantle of the ani mal Gently peel the body or mantle back to expose the contents of the animal. Begin at the tip of the tail and work towards the head. Be sure to cut between the body or mantle and the heart to remove the body covering. Also, make incisions along the margin of the foot, to avoid cutting internal organs and eyestalks. Remove the body covering or mantle.

PAGE 425

425 Figure 10 Figure 11 Step 5 Separate the digestive gland from the albumen gland Separate the digestive system from the reproductive system by gently peeling away the digestive gland from the albumen gland.

PAGE 426

426 Figure 12 Figure 13 Step 6 Remove the ovotestis from the digestive gland Gently remove the areas of the digestive gland that cover the ovotestis. The ovotestis is often embedded in the digestive gland but is easily identified, as it is typically a different color (or shade). Make incisions along the sides of the hermaphroditic duct (Figure. 14) to remove all lateral connections to the digestive gland. The animal may need to be inverted for these steps.

PAGE 427

427 Figure 14 Figure 15

PAGE 428

428 Figure 16 Step 7 Remove heart and kidney to reveal bursa copulatrix Gently remove the heart and kidney to reveal the bursa copulatrix and head region (including the optic region)

PAGE 429

429 Figure 17 Figure 18

PAGE 430

430 Figure 19 Step 8 Separate the reproductive system from the digestive system Orient the animal as illustrated in Figure 19 so that the r eproductive system is above the digestive system. Tweezers can then be used to either pull the two systems apart along the dashed lines (Figure. 21) OR the structures can be slowly teased apart beginning at the buccal mass (removing the eye stalks and crop).

PAGE 431

431 Figure 20 Figure 21

PAGE 432

432 Figure 22 Step 9 Unravel the reproductive system Figure 23 displays the entire reproductive system of the animal. The structures are compressed and intertwined at this stage and need to be teased apart. Please Note: the red color of the atrium is not common to all slugs. Use an insect pin to gently unravel the vas deferens, bursa copulatrix, oviduct, and penis by following the connection to each.

PAGE 433

433 Figure 23 Figure 24

PAGE 434

434 Figure 25 Step 10 Treatment for Photography If a photograph of the reproductive system is required, the structures can be arranged and pinned as desired then fixed in place by immersion in 95% ethanol for approximately 15 minutes. DO NOT leave the reproductive structures in 95% ethanol for an extended period as dehydration and distortion will occur. The pins can be removed from the specimen for photography or closer examination.

PAGE 435

435 Figure 26 Figure 27 Veronicellidae Dissection Step 1 Note the external anatomy of the relaxed specimen Submerge the relaxed, extended adult specimen in a dish wi th 75% ethanol or water.

PAGE 436

436 Figure:01 Figure:02 Step 2 Cut along the inner portion of the hyponotum Make a shallow incision near the anus using a pair of sharp dissecting scissors. Angle scissors upwards and proceed with incision along the hyponotum of the animal. The incision should be made on the inner side if the hyponotum. Cut towards the head of the animal (on both sides) to remove the mantle.

PAGE 437

437 Figure:03 Figure:04 Step 3 Remove the mantle of the animal Gently peel back the mantle to expose the contents of the animal. Begin at the tip of the tail and work towa rds the head.

PAGE 438

438 F igure:05 Figure :06 Step 4 Remove the ovotestis from the digestive gland Gently remove the areas of the digestive gland that cover the ovotestis. The ovotestis is often embedded in the digestive gland but is easily identified, as it is typically a different color (or

PAGE 439

4 39 s hade). Make incisions along the sides of the hermaphroditic duct to remove all lateral connections to the digestive gland. The animal may need to be inverted for these steps. Figure:07 Figure: 08

PAGE 440

440 Figure: 09 Step 5 Separate the reproductive system from the digestive system Orient the animal as illustrated in Figure 10 so that the reproductive system is above the digestive system. Make incisions along the dashed lines to separate both systems (Figure 10 11).

PAGE 441

441 Figure: 10 Figure: 11

PAGE 442

442 Figure: 12 Step 6 Unravel the reproductive system Figure 13 displays the entire reproductive system. The structur es are compressed and intertwined at this stage and need to be teased apart. Use an insect pin to gently unravel each portion of the system by following the connection to each.

PAGE 443

443 Figure: 13 Figure: 14 Step 7 Treatment for Photography If a photograph of the reproductive system is requi red, the structures can be arranged and pinned as desired then fixed in place by immersion in 95% ethanol for approximately 15 minutes. DO NOT leave the reproductive structures in 95% ethanol for an extended period, as dehydration

PAGE 444

444 and distortion will occur. The pins can be removed from the specimen for photography or closer examination. The pins can be removed from the specimen for photography or closer examination. Figure: 15 Figure: 16

PAGE 445

445 Figure: 17 How to use the Terrestrial Mollusc Key Introduction This key was created to assist inspectors at U.S. ports of entry to determine the identity of terrestrial mollusc species intercepted in imported cargo and shipments in transit. Some terrestrial molluscs are important agricultural and ecological pests, and others may be contaminant species that may mater ially affect the quality of cargo while others may be non pest hitchhiker species. It is often difficult for non experts to accurately determine identity of terrestrial molluscs in a timely manner. This interactive key is designed to be a user friendly t ool to aid nonmalacalogists to identify some important mollusc species that may affect commerce. It is however acknowledged that the scope of this key may be larger, and as such may also be used as an educational resource in a variety of fields. The taxon omy of terrestrial molluscs is very dynamic; hence, a large number of the entities (species, family, groups) included in this key may have been, and continue to be, revised. For each entity, a list of synonyms has been included in the supporting fact sheet s to assist in clarifying the nomenclature. It is recommended that the user read the Identification and the Biology sections o f this tool in order to use the key more effectively. Only adult specimens have all the characters required by the key to achieve correct identification. Juveniles of many gastropod species often lack adult characters or they may possess additional charact ers that are not maintained through to adulthood. This is true for both snails and slugs. Slugs are generally more difficult to key to the species level and often require dissection. If dissection is necessary, there is a dissection tutorial available in this tool that will be able to assist the user to successfully dissect a snail and/or a slug.

PAGE 446

446 ***** It is important to remember that this key is not inclusive of all pestiferous mollusc species. This key is intended to serve as an aid in the identification of terrestrial mollusc species documented as major agricultural and ecological pests as well as contaminant and nonpest species that are commonly intercepted at U.S. ports of entry. ***** Equipment required for the optimal use of this key: Hand lens (1020X) Ruler or Caliper Adult specimens Anatomy drawings (located in Biology and the Identification section) Key Use Options There are two options (Key Server and Java Applet) available on the Begin Key page to access and utilize the key: (1) The Key Server option is the established default setting for accessing the key, and the key will load automatically using this option once the Begin Key page is accessed. The Key Server option facilitates remote accessibility of the key and is compatible with portable devices such as iPads, iPhones etc. (2) The Java Ap plet option must be selected by the end user from this tab located above the key window. The Key Server and the Java Applet options may both be viewed in Full Screen mode by selecting the Full Screen tab located immediately above the upper right quadrant of the key. Selecting the Full Screen mode will open a new window and will allow the user to view larger images of the entities. There is, however, inherent advantages and disadvantages associated with the Key Server and Java Applet options and the enduser should select the option that provides them with the most utility. More detailed information can be found on the System Requirements page. This key may take several minutes to load due to the nature of the program and the capabilities of the endusers computer. The key contains many photographs that may slow uploading; however, once the key is loaded it should operate at a normal speed How to Use This nondichotomous key is c omprised of 33 families and 129 species. This key provides the user with multiple identification characters that can be selected at any time (in any order), as opposed to having sequentially paired options characteristic of a traditional dichotomous key. TMT Key Window

PAGE 447

447 The browser window is divided into quadrants. Upper left window: Characters Available this is a list of the features and states to select f or the identification of specimens of interest. Upper right window: Taxa Remaining list of families, genera and species that could possibly be the specimen of interest. Lower left window: Characters Chosen list of features or states currently selected. Lower right window: Taxa Discarded list of families, genera and/or species discarded from the characters available section based on the states previously selected. Initiating Key

PAGE 448

448 The first character in the key will be a dependency character, meaning that subsequent selections in the key are based on this character. This dependency character state is used to discriminate between a snail and a slug to allow t he end user to progress through the key more efficiently. Subsequent Selections

PAGE 449

449 Each feature may have two or more character states. The selection options can be made visible by clicking on the arrow at the left corner of each character state. The desired character state can be selected by clicking directly onto the thumbnail photograph or illustration or the checkbox located adjacent to the character state. Also note that multiple selections can be made within each feature/state (e.g., in the above diagram filamentous and tubular can both be selected). There is a feature called find best, that can be useful. It is represented by the magic wand icon at the top of the page. This function will select the best characters that are most useful in separating the remaining taxa.

PAGE 450

450 Each states photograph can be expande d by selecting the icon located at the bottom right of the photograph. This is indicated in the diagram above. Final Selection

PAGE 451

451 The Identification Process The keying process is complete when there is only a single selection remaining. Selecting additional character states at this point will prove to be futile as there will be no other taxa to discard. If the selection is not satisfactory, the organism can be taken through the key again, this time using other character states. Also the final selection may not be identical (color and markings) to the specimen in hand, as many gastropod species are morphologically variable. It is therefore recommended that the user read the fact sheet on the final selection to confirm the identification as additional information, including pictures, are provided in this section of the tool. Selecting Characters One important feature of a Lucid key is the flexibility it provides the user to choose morphological characters pertinent to the specimen in question in any order and in any

PAGE 452

452 combination. The user is however advised to select obvious characters first before progressing to more obscure characters. Additionally multiple characters may be selected simultaneously and unclear characters and those difficult to determine may be skipped. Measurable characters such as height, width, lengt h, number of whorls etc, are very useful to quickly reduce the number of Entities Remaining. It is therefore extremely important to correctly measure the specimen in question. The user should consult the Identification page for the correct procedures to measure terrestrial gastropods. Do not estimate measurable characters or guess any other character selections. When in doubt choose alternative character states. Dissections and Comparing Genitalia Several entities included in this key cannot be reliably identified using external morphological characters additionally some entities may be grouped in a species complex and require examination of genital structures for correct identification. If the specimen in question falls into the aforementioned categories and identification to a lower taxonomic level is desired the user has several options. The user could send the specimen to an expert for official identification OR Based on skill level and appetite for adventure the user may choose to dissect the specimen in question in order to inspect the genitalia. The user should consult the dissection page for the supplies required and the procedures for correctly and humanely preparing the specimen. The slug and snail dissection tutorial provide a stepby step guide to the dissection process. The speci men in question may be quite different from those used in the tutorials but the principles are the same. The fact sheets provide detailed illustrations of characteristic genitalic structures required for identification of entities to the species level. The dissected genitalia of the unidentified specimen should be compared to pertinent illustrations in order to make a determination. Entity not in Key It is probable that on occasions the enduser will be unable to make an appropriate final selection on the first attempt to key a specimen. The end user would be advised to attempt to re key the specimen by selecting a different suite of characters or by selecting the magic wand feature after the dependency character, within the key. If no selection can be made after a reasonable number of attempts the user must consider the possibility that the specimens on hand may be a species not included in the key. Additionally, the specimen may be a juvenile, the shell may be severely weathered (snails) or the specimen may be an albino morph and therefore lack the characters required to make a final selection. Multiple Entities Remain The occasion may arise where the user has exhausted all possible selections from the Features available quadrant of the key window ye t multiple entities remain in the Entities Remaining quadrant. The most likely explanation is that the specimen in question is not an entity included in the key. There may also be occasions where multiple entities remain in the Entities Remaining quadr ant of the key window and multiple characters remain in the Characters Remaining

PAGE 453

453 quadrant but none of the remaining features are pertinent to the specimen in question. In such a case it is possible that the specimen in question could be a juvenile and la ck the characters required for identification or may be an entity not included in the key. All Remaning Entities Disappear There may be occasions when the selection of a particular suite of character states result in all entities disappearing from the Entities Remaining quadrant of the key window. In such a case no entity in the key has been scored for the combination of character states selected. This could be attributed to a number of reasons including; user error in selecting appropriate character stat es or the specimen in question may not be included in the key. The user may attempt to discover a potential error by sequentially de selecting all dubious character states. The Entities Remaining quadrant may repopulate as character states are removed f rom the Features Chosen list. Carefully re examine the specimen in question and only choose features and character states that can be selected with confidence. If all entities continue to disappear from the Entities Remaining quadrant after several att empts using different combinations of features and states then it is most likely that the specimen in question is not included in the key. Please remember that this key is limited to identifying only the species included. If the identification of your spe cimen is critical, it may be sent to the USDA APHIS PPQ National Identification Services representative: Packaging and Handling Information David Robinson USDA APHIS National Malacologist Department of Malacology Academy of Natural Sciences 1900 Benjamin Franklin Parkway Philadelphia, PA 19103 Tel. 2152991175 Fax: 215567 7229 Email: Robinson@ansp.org or David.G.Robinson@usda.gov

PAGE 454

454 LIST OF REFERENCES Aguiar, R. and M. Wink. 2005. How do slugs cope with toxic alkaloids? Chemoecology 15: 167177. Agapow, P. M., O.R.P. Bininda Edmonds, K.A. Crandall, J.L. Gittleman, G.M. Mace, J.C. Marshall and A. Purvis. 2004. The impact of species concepts on biodiversity studies. The Quarterly Review of Biology. 79: 161179. Airey, W. J. 1987. Laboratory studies on damage to potato tubers by slugs. Journal of Molluscan Studies 53 : 97 104. Akaike H. 1974. A new look at the statistical model identifications. IEEE Transactions on Automatic Control. 19: 716723. Alexander, R. D. 1974. The evolution of social behavior. Annual Review of Ecology and Systematics 5 : 325 383. Anderson, J. B. and G. F. McCracken. 1986. Breeding system and population genetic structure in philomycid slugs (Mollusca: Pulmonata). Biological Journal of the Linnaean Society 29: 317 329. Bailey, S. E. R. 2002. Molluscicidal baits or control of terrestrial gastropods. In: G. M. Barker, ed. Molluscs as Crop Pests. CABI Publishing, Wallingford, UK. Pp. 33 54. Bailey, S. E. R. and M. A. Wedgewood. 1991. Complementary video and acoustic recordings of foraging by two pest species of slug on nontoxic and molluscicidal baits. Annals of Applied B iology 119: 147 153. Barker, G. M. 1991. Biology of slugs (Agriolimacidae and Arionidae: Mollusca) in New Zealand hill country pastures. Oecologia 85 : 581595. Barker, G. M. 2002. Gastropods as pests in New Zealand pastoral agriculture, with emphasis on Agriolimacidae, Arionidae and Milacidae. In: G. M. Barker, ed., Molluscs as Crop Pests. CABI Publishing, Wallingford, UK. Pp. 361 421. Barratt, B. I. P., R. A. Byers and D. L. Bierlein. 1994. Conservation tillage crops yields in relation to grey garden s lug ( Deroceras reticulatum (Mller)) (Mollusca: Agriolimacidae) density during establishment. Crop Protection 13 : 49 52. Baur, B. 1994. Parental care in terrestrial gastropods. Experientia 50 : 5 14. Becker Underwood. 2011. Beneficial Nematodes: Nemaslug. Access date (07 09 2011). http://www.beckerunderwood.com/en/distributors/nemaslug_us Begon, M. and G. A. Parker. 1986. Should egg size and clutch size decrease with age? Oikos 47 : 293 302.

PAGE 455

455 Bell, N. L. 2002. A computerized identification key for 30 genera of plant parasitic nematodes. New Zealand Plant Protection 55 : 287 290. Bengtsson, J., J. Ahnstrm and A. Weibull. 2005. The effects of organic agriculture on biodiversity and abundance: a metaanalysis. Journal of Applied Ecology 42: 261269. Binney, A. 1842. Binney on the naked air breathing Mollusca. Boston Journal of Natural History 4 : 171. Binney, A. 1842. Descriptions of some of the species of naked, air breathing Mollusca, i nhabiting the United States. Journal of Natural History. 4 : 164 175. Binney, A. 1851. The terrestrial air breathing mollusks of the United States, and the adjacent territories of North America. Boston, Vol 2. Pp. 13. Bosc, L. A. G. 1802. Histoire naturelle des vers: contenant leur description et leurs moeurs; avec figures dessines daprs nature. Vol. 1. Paris. Pp. 93, pl.8. Bourne, N. B., G. W. Jones and I. D. Bowen. 1990. Feeding behaviour and mortality of the slug Deroceras reticulatum in relation to control with molluscicidal baits containing various combinations of metaldehyde and methiocarb. Annals of Applied Biology 117: 455 468. Branson, B. A. 1968. Two new slugs (Pulmonata: Philomycidae: Philomycus) from Kentucky and Virginia. The Nautilus 81 : 127 133. Briner, T. and T. Frank. 1998. The palatability of 78 wildflower strip plants to the slug Arion lusitanicus Annals of Applied Biology 133: 123133. Brooks, A. S., A. Wilcox, R. T. Cook, K. L. James and M. J. Cook. 2006. The use of an alternative food source (red clover) as a mean of reducing slug pest damage to winter wheat: towards field implementation. Pest Management Science 62 : 252 262. Brooks, A. S., M. J. Crook, A. Wilcox and R. Cook. 2003. A laboratory evaluation of the palatability of legumes to the field slug, Deroceras reticulatum Mller. Pest Management Science 59: 245251. Burrows, T. M. 1983. Pesticide demand and integrated pest management: A limited dependent variable analysis. American Journal of Agricultural Economics 65 : 806810. Bus chmann, H., P. J. Edwards and H. Dietz. Variation in growth pattern and response to slug damage among native and invasive provenances of four perennial Brassicaceae species. Journal of Ecology 93: 322334.

PAGE 456

456 Byers, R. A. 2002. Agriolimacidae and Arionidae as pests in Lucerne and other legumes in forage systems of Northeastern North America. In: G. M. Barker, ed., Molluscs as Crop Pests. CABI Publishing, Wallingford, UK. Pp. 325336. Byers, R. A. and D. D. Calvin. 1994. Economic injury levels to field corn f rom slug (Stylommatophora: Agriolimacidae) feeding. Journal of Economic Entomology 87: 13451350. Carlisle, T. R. 1982. Brood success in variable environments: implications for parental care allocation. Animal Behavior 30: 824 836. Chang, C. 1990. Evaluation of chemical and exclusion methods for control of Bradybaena similaris (Frussac) on grapevine in Taiwan. Agriculture, Ecosystems and Environment 31: 85 88. Chang, C. 2002. Bradybaena similaris (de Frussac) (Bradybaenidae) as a pest of grapevines of Taiwan. In: G. M. Barker, ed., Molluscs as Crop Pests. CABI Publishing, Wallingford, UK. Pp. 241244. Chatfield, J. E. 1976. Studies on food and feeding in some European land molluscs. Journal of Conchology 29: 5 20. Chevalier, L., M. Le Coz Bouhnik and M Charrier. 2003. Influence of inorganic compounds on food selection by the brown garden snail Cornu aspersum (Mller) (Gastropoda: Pulmonata). Malacologia 45: 125 132. Chomczynski, P., K. Mackey, R. Drews and W. Wilfinger. 1997. DNAzol: a reagent for the rapid isolation of genomic DNA. Biotechniques 22: 550 553. Clark, S. J., I. F. Henderson, D. J. Hill and A. P. Martin. 1999. Use of lichen secondary metabolites as antifeedants to protect higher plants from damage caused by slug feeding. Annals of Applied Biology 134: 101108. Cockburn, A. 2006. Prevalence of different modes of parental care in birds. Proceedings of the Royal Society B273: 13751383. Cockerell, D. A. 1890. Notes on slugs, chiefly in the collection at the British Museum. The Annals and Magazine of Natural History, including Zoology, Botany, and Geology 6 : 380 389. Cody, M. L. 1966. A general theory of clutch size. Evolution 20: 174 184. Cook, R. T., S. E. R. Bailey and C. R. McCrohan. 1996. Slug preference for winter wheat cultivars and co mmon agricultural weeds. Journal of applied Ecology 33: 866872.

PAGE 457

457 Cook, R. T., S. E. R. Bailey and C. R. McCrohan. 1997. The potential for common weeds to reduce the slug damage to winter wheat: laboratory and field studies. Journal of Applied Ecology 34: 7987. Cook, R. T., S. E. R. Bailey, C. R. McCrohan, B. Nash and R. M. Woodhouse. 2000. The influence of nutritional status on the feeding behaviour of the field slug, Deroceras reticulatum (Mller). Animal Behaviour 59: 167 176. Cowie, R. H., K. A. Haye s, C. T. Tran and W. M. Meyer III. 2008. The horticultural industry as a vector of alien snails and slugs: widespread invasions in Hawaii. International Journal of Pest Management 54 : 267276. Dankowska, E. 1996. Morphology and life history of Deroceras l aeve (Mll) (Gastropoda: Styllommatophora: Agriolimacidae) in greenhouse conditions. Annals of Agricultural Sciences Series E25: 9195. Davis, A. J. 1989. Effects of soil compaction on damage to wheat seeds by three pest species of slugs. Crop Protection 8 : 118 121. de Queiroz, K. 2005. Ernst Mayr and the modern concept of species. Proceedings of the National Academy of Science. 102: 66006607. Dirzo, R. 1980. Experimental studies on slug plant interactions: I. The acceptability of thirty plant species to the slug Agriolimax caruaneae. Journal of Ecology 68: 981998. Dirzo, R. and J. L. Harper. 1982. Experimental studies on slug plant interactions: III. Differences in the acceptability of individual plants of Trifolium repens to slugs and snails. Journal of Ecology 70: 101117. Donoghue, M.J. 1985. A critique of the biological species concept and recommendations for a phylogenetic alternative. The Bryologist. 88: 172181. Ebenso, I. E. 2003. Molluscicidal effects of neem ( Azadirachta indica ) extracts on edible tropical land snails. Pest Management Science 60 : 178 182. Edwards, M. and D. R. Morse. 1995. The potential for computer aided identification in biodiversity research. Tree 10 : 153 158. Egonmwan, R. I. 1992. Food selection in the land snail Limico laria flammea Mller (Pulmonata: Achatinidae). Journal of Molluscan Studies 58 : 49 55. Ester, A. and J. H. Nijenstein. 1995. Control of the field slug Deroceras reticulatum (Mller) (Pulmonata: Limacidae) by pesticides applied to winter wheat seed. Crop Protection 14 : 409413.

PAGE 458

458 Faberi, A. J., A. N. Lpez, P. L. Manetti, N. L. Clemente and H. A. lvarez Castillo. 2006. Growth and reproduction of the slug Deroceras laeve (Mller) (Pulmonata: Stylommatophora) under controlled conditions. Spanish Journal of A gricultural Research 4 : 345 350. Fairbanks, H. L. 1989. The reproductive anatomy and taxonomic status of Philomycus venustus Hubricht, 1953 and Philomycus bisdosus Branson, 1968 (Pulmonata: Philomycidae). The Nautilus 103 : 20 23. Felsenstein, J. 1985. Conf idence limits on phylogenies: an approach using the bootstrap. Evolution. 39: 783791. Folmer, O., M. Black, W. Hoeh, R. Lutz and R. Vrijenhoek. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3 : 294 299. Fox, L. and Landis, B. J. 1973. Notes on the predaceous habits of the grey field slug, Deroceras laeve. Environmental Entomology 2 : 306 307. Frank, T. 1998. The role of different slug species in damage to oilseed rape bordering on sown wildflower strips. Annals of Applied Biology 133: 483 493. Frank, T. and M. Barone. 1999. Short term field study on weeds reducing slug feeding on oilseed rape. Journal of Plant Diseases and Protection 106 : 53 4 538. Frank, T., K. Bieri and B. Speiser. 2002. Feeding deterrent effect of carnivore, a compound from caraway seeds, on the slug Arion lusitanicus Annals of Applied Biology 141: 1 8. Gebauer, J. 2002. Survival and food choice of the grey field slug ( Der oceras reticulatum ) on three different seed types under laboratory conditions. Journal of Pest Science 75 : 1 5. Geenen, S., K. Jordens and T. Backeljau. 2006. Molecular systematics of the Carinarion complex (Mollusca: Gastropoda: Pulmonata): a taxonomic ri ddle caused by a mixed breeding system. Biological Journal of the Linnean Society. 89: 589604. Gelperin, A. 1975. Rapid foodaversion learning by a terrestrial mollusk. Science 189 : 567570. Getz, L. L. 1959. Notes on the ecology of slugs: Arion circumscriptus Deroceras reticulatum and Deroceras laeve. American Midland Naturalist 61 : 485498. Glen, D. M., A. M. Spaull, D. J. Mowat, D. B. Green, and A. W. Jackson. 1993. Crop monitoring to access the risk of slug damage to winter wheat in the United Kingdom. Annals of Applied Biology 122: 161 172.

PAGE 459

459 Glen, D. M., N. F. Milsom and C. W. Wiltshire. 1989. Effects of seed bed conditions on slug conditions on slug numbers and damage to winter wheat in a clay soil. Annals of Applied Biology 115: 197207. Glen, D. M., N. F. Milsom and C. W. Wiltshire. 1990. Effects of seed depth on slug damage to winter wheat. Annals of Applied Biology 117: 693 701. Godan, D. 1983. Pest slugs and snails. Biology and control. Springer Verlag, Berlin, Heidelberg, New York. Pp. 441. G omes, S. R., F. B. da Silva, I. L. Veitenheimer Mendes, J. W. Thom and S. L. Bonatto. 2010. Molecular phylogeny of the South American land slug Phyllocaulis (Mollusca, Soleolifera, Veronicellidae). Zoologica Scripta 39: 177 186. Gould, A. A. 1841. Report on the Invertebrata of Massachusetts, Comprising the Mollusca, Crustacea, Annelida, and Radiata. Cambridge. Pp. 3. Gouyon, P. H., P. H. Fort and G. Caraux. 1983. Selection of seedlings of Thymus vulgaris by grazing slugs. Journal of Ecology 71: 299306. Grewal, S. K., P. S. Grewal and R. B. Hammond. 2003. Susceptibility of North American native and nonnative slugs (mollusca: Gastropoda) to Phasmarhabditis hermaphrodita (Nematoda: Rhabditidae). Biocontrol Science and Technology 13: 119125. Hagin, R. D. and S. J. Bobnick. 1991. Isolation and identification of a slug specific molluscicide from quackgrass ( Agropyron repens L. Beauv.). Journal of Agricultural and Food Chemistry 39: 192196. Hall, TA. 1999. BioEdit: a user friendly biological sequence alignment editor and analysis program for Windows 95 41 : 9598. Hammond R. B., J. A. Smith and T. Beck. 1996. Timing of molluscicide applications for reliable control in notillage field crops. Journal of Economic Entom ology 898: 10281032. Hammond, R. B. 1985. Slugs as a new pest of soybeans. Journal of the Kansas Entomological Society 58: 364366. Ha ta, T. Y., A. H. Hara and B. K. S. Hu. 1997. Molluscicides and mechanical barriers against slugs, Vaginula plebeia Fisch er and Veronicella cubensis (Pfeiffer) (Stylommatophora: Veronicellidae). Crop Protection 16: 501 506. Hatteland, B. A., K. Grutle, C. E. Mong, J. Skartveit, W. O. C. Symondson and T. Solhy. 2010. Predation by beetles (Carabidae, Staphylinidae) on eggs and juveniles of the Iberian slug Arion lusitanicus in the laboratory. Bulletin of Entomology Research 100: 559 567.

PAGE 460

460 Hausdorf, B. 2011. Progress toward a general species concept. Evolution. 65: 923931. Holland, B. S. and R. H. Cowie. 2007. A geographic m osaic of passive dispersal: population structure in the endemic Hawaiian amber snail Succinea caduca (Mighels, 1845). Molecular Ecology 16: 2422 2435. Howlett, S. A., D. J. Wilson and K. T. Miller. 2008. The efficacy of various bait products against the g rey field slug, Deroceras reticulatum New Zealand Plant Protection 61: 283286. Hubricht, L. 1951. The Limacidae and Philomycidae of Pittsylvania County, Virginia. The Nautilus 65 : 20 22. Hubricht, L. 1953. Three new species of Philomycidae. The Nautilus 66: 78 80. Hubricht, L. 1956. Land snails of Shenandoah National Park. The Nautilus 70: 15 16. Hubricht, L. 1972. Two new North American Pulmonata: Paravitrea seradens and Philomycus sellatus The Nautilus 86 : 16 17. Hubricht, L. 1974. Brief communications Malacological Review. 7 : 33 34. Hubricht, L. 1985. The distribution of the native land mollusks of the eastern United States. Fieldiana: Zoology 24: 1 191. Huelsenbeck, J.P. and F. Ronquist. 2001. MrBayes: Bayesian inference of phylogeny. Bioinformatics 17: 754 755. Iglesias, J. and B. Speiser. 2001. Consumption rate and susceptibility to parasitic nematodes and chemical molluscicides of the pest slugs Arion hortensis s.s. and A. distinctus Journal of Pest Science 74 : 159 166. Iglesias, J., J. Castillej o and R. Castro. 2001. Mini plot field experiments on slug control using biological and chemical control agents. Annals of Applied Biology 139: 285 292. Ireland, P. M. 1988. A comparative study of the uptake and distribution of silver in a slug Arion ater and a snail Achatina fulica. Comparative Biochemistry and Physiology Part C: Comparative Pharmacology 90: 189 194. Jennings, T. J. and J. P. Barkham. 1975. Food of slugs in mixed deciduous woodland. Oikos 26 : 211 221. Joe, S. M. and C. C. Daehler. 2008. Invasive slugs as under appreciated obstacles to rare plant restoration: evidence from the Hawaiian Islands. Biological Invasions 10 : 245255.

PAGE 461

461 Jordaens, K., J. Pinceel and T. Backeljau. 2006. Lifehistory variation in selfing multilocus genotypes of the lan d slug Deroceras laeve (Pulmonata: Agriolimacidae). Journal of Molluscan Studies 72: 229 233. Karlin, E. J. and C. Bacon. 1961. Courtship. Mating and egg laying behaviour in the Limacidae (Mollusca). Transactions of the American Microscopical Society 80: 3 99406. Keller, H. W. and K. L. Snell. 2002. Feeding activities of slugs on Myxomycetes and macrofungi. Mycologia 94: 757 760. Keller, M., J. Kollmann and P. J. Edwards. 1999. Palatability of weeds from different European origins to the slugs Deroceras ret iculatum Mller and Arion lusitanicus Mabille. Acta Oecologica 20 : 109 118. Klassen, W., C. F. Brodel and D. A. Fieselmann. 2002. Exotic pests of plants: Current and future threats to horticultural production and trade in Florida and the Caribbean basin. Micronesica Supp 6 : 5 27. K 2004a. Consumption growth as a measure of comparisons of results from nochoice test and test with multiple choice. Journal of Plant Protection Research 44: 251 258. 2004b. Food preferences of Deroceras reticulatum Arion lusitanicus and Arion rufus for various medicinal herbs and oilseed rape. Journal of Plant Protection Research 44: 240 250. K 2008. Differences in acceptability of herb plants and oilseed rape for slugs ( Arion lusitanicus, Arion. rufus and Deroceras reticulatum ) in food choice tests. Journal of Plant Protection Research 48: 461 474. Linhart, Y. B. and J. D. Thompson. 1995. Terpenebased selective herbivory by Helix aspers a (Mollusca) on Thymus vulgaris (Labiatae). Oecologia 102 : 126132. Lipa, J. J. and P. H. Smits. 1999. Microbial control of pests in greenhouses. In : R. R. Albajes, M. Lodovica Gullino, J. C. Van Lenteren and Y. Elad, eds., Integrated Pest and Disease Management in Greenhouse Crops Kluwer Academic Publishers, Netherlands. Pp. 295309. Lockwood III, J. R. 1998. On the statistical analysis of multiplechoice feeding preference experiments. Oecologia 116 : 475 481. Lucid 3. 20042007. Version 3.4. Center for Biological Information Technology, The University of Queensland, Brisbane. www.lucidcentral.org Maddison, W. P. and D.R. Maddison. 2011. Mesquite: a modular system for evolutionary analysis. Version 2.75. http://mesquiteproject.org

PAGE 462

462 Mair, J. and G. R. Port. 2002. The influence of mucus production by the slug, Deroceras reticulatum on predation by Pterostichus madidus and Nebria brevicollis (Coleoptera: Carabidae). Bi ocontrol Science and Technology 12: 325 335. Mallet, J. 2007. Species, concept of. Encyclopedia of Biodiversity. pp 115. Massachusetts. Mayden, R.L. 1997. A hierarchy of species concepts: the denouement in the saga of the species problem. In: Claridge, M .F., H.A. Dawah and M.R. Wilson (Eds). The Units of Biodiversity. Chapman and Hall, London. pp. 381424. Mayr, E. 1996. What is a species and what is not? Philosophy of Science. 63: 262277. McCracken, G. F. and R. K. Selander. 1980. Self fertilization and monogenic strains in natural populations of terrestrial slugs. Proceedings of the National Academy of Sciences 77: 684 688. McCullough, D. G., T. T. Work, J. F. Cavey, A. M. Liebhold and D. Marshall. 2006. Interceptions of nonindigenous plant pests at US ports of entry and border crossings over a 17year period. Biological Invasions 8 : 611 630. Moens, R. and D. M. Glen. 2002 Agriolimacidae, Arionidae and Milacidae as pests in west European oilseed rape. In: G. M. Barker, ed., Molluscs as Crop Pests. CABI Publishing, Wallingford, UK Pp 425 439. Mlgaard, P. 1986. Food plant preferences by the slugs and snails: A simple method to evaluate the relative palatability of the food plants. Biochemical Systematics and Ecology 14: 113 121. Nash, M. A., L. J. Tho mson and A. A. Hoffmann. 2007. Slug control in Australian canola: monitoring, molluscicidal baits and economic thresholds. Pest Management Science 63: 851859. Oberholzer, F., N. Escher and T. Frank. 2003. The potential of carabid beetles (Coleoptera) to reduce slug damage to oilseed rape in the laboratory. European Journal of Entomology 100: 81 85. Pakarinen, E. 1992. Feeding avoidance of terrestrial gastropods to conspecific and nonspecific material. Journal of Molluscan Studies 58: 109120. Pallant, D 1969. The food of the grey field slug ( Agriolimax reticulatus (Mller)) in woodland. Journal of Animal Ecology 38: 391 397. Pena, J. E. and V. Waddill. 1982. Pests of Cassava in South Florida. The Florida Entomologist 65: 143149.

PAGE 463

463 Peters, H. A., B. Baur F. Bazzaz and C. Krner. 2000. Consumption rates and food preferences of slugs in a calcareous grassland under current and future CO2 conditions. Oecologia 125: 72 81. Pickett, J. A. and J. W. Stephenson. 1980. Plant volatiles and components influencing behavior of the field slug, Deroceras reticulatum (Mller). Journal of Chemical Ecology 6 : 435444. Pilsbry, H. A. 1891. On the genus Tebennophorus Binney, or Philomycus Raf (to be continued). The Nautilus 5 : 4 8. Pilsbry, H. A. 1891. On the genus Tebennophorus Binney, or Philomycus Raf (continued). The Nautilus 5 : 21 23. Pilsbry, H. A. 1948. Land Mollusca of North America north of Mexico vol. II part 2. Academy of Natura l Sciences, Philadelphia. Pp. 5211113. Port, C. M. and G. Port. 1986. The biology and behaviour of slugs in relation to crop damage and control. Agricultural Zoology Reviews 1 : 255299. Posada, D. and K. A. Crandall. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14: 817 818. Prystupa, B. D., J. N. Holliday and G. R. B. Webster. 1987. Molluscicide efficacy against the marsh slug, Deroceras laeve (Stylommatophora: Limacidae) on strawberries in Manitoba. Journal of Economic Entomology 80: 936 943. Purvis, G. and J. W. Bannon. 1992. Nontarget effects of repeated methiocarb slug pellet application on carabid beetle (Coleoptera, Carabidae) activity in winter sown cereals. Annals of Applied Biology 121: 215 223. Rae, R., C. Verdun, P. S. Grewal, J. F. Robertson and M. J. Wilson. 2007. Biological control of terrestrial molluscs using Phasmarhabditis hermaphroditaprogress and prospects. Pest Management Science 63 : 1153 1164. Raffaelli, D. and A. J. Mordue. 1990. The relative importance o f molluscs and insects as selective grazers of cyanogenic white clover ( Trifolium repens ). Journal of Molluscan Studies 56 : 37 45. Rafinesque, C. S. 1820. Annals of nature or Annual synopsis of new genera and species of animals, plants, &c. discovered in North America. Iowa. Pp. 10. Rathcke, B. 1985, Slugs as generalist herbivore: Test of three hypotheses on plant choices. Ecology 66: 828 836. Ratnasingham, S. and P. D. N. Hebert (2007) BOLD: the barcode of life data system (http://www.barcodinglife.org). Molecular Ecology Notes 7 :355 364.

PAGE 464

464 Rawlings, T. A., K. A. Hayes, R. H. Cowie and T. M. Collins. 2007. The identity, distribution, and impacts of nonnative apple snails in the continental United States. BMC Evolutionary Biology 7 : 97 110. Richardson, B. and J. B. Whittaker. 1982. The effect of varying the reference material on ranking of acceptability indices of plant species to a polyphagous herbivore, Agriolimax reticulatus Oikos 39 : 237 240. Ronquist, F. and J. P. Huelsenbeck. 2003. MrBayes version 3. 0: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:15721574. Rueda, A. A., F. Slansky Jr. and G. S. Wheeler. 1991. Compensatory feeding response of the slug Sarasinula plebeia to dietary dilution. Oecologia 88 : 181188. Ryder, O.A. 1986. Species conservation and systematics: the dilemma of subspecies. Trends in Ecology and Evolution. 1: 910. SAS Institute Inc. 2008. Whats New in SAS 9.2. Cary, NC: SAS Institute Inc. Schley, D. and M. A. Bees. 2003. Delay dynamics of the slug Deroc eras reticulatum an agricultural pest. Ecological Modeling 162: 177 198. Schder, I., G. Port and J. Bennison. 2004. The behavioural response of slugs and snails to novel molluscicides, irritants and repellants. Pest Management Science 60: 11711177. Sh ayler, H. A. and P. A. Siver. 2006. Key to freshwater algae: A webbased tool to enhance understanding of microscopic biodiversity. Journal of Science Education and Technology 15: 298 303. Shen, J. 1995. Cannibalism in the terrestrial slug Deroceras laeve. The Nautilus 109 : 4142. Simpson, G.G. 1951. The species concept. Evolution. 5: 285298 South, A. 1992. Terrestrial slugs. Biology, ecology and control. Chapman and Hall, London, UK. Pp. 1 428. Speiser, B. and C. Kistler. 2002. Field tests with a mollusc icide containing iron phosphate. Crop Protection 21 : 389394. Speiser, B., J. G. Zaller and A. Neudecker. 2001. Sizespecific susceptibility of the pest slugs Deroceras reticulatum and Arion lusitanicus to the nematode biocontrol agent Phasmarhabditis herm aphrodita Biocontrol 46 : 311 320. Speiser, B., J. Harmaths and M. Rowell Rhaier. 1992. Effects of pyrrolizidine alkaloids and sesquiterpenes on snail feeding. Oecologia 92: 257 265.

PAGE 465

465 Stange, L. A., J. E. Deisler and T. Fasulo. 1999. Slugs (of Florida) (G astropoda: Pulmonata). University of Florida, Institute of Food and Agricultural Sciences Extension publication EENY 087 (IN244). Pp.110. Starbird, S. A. 1994. The effect of quality assurance policies for the processing tomatoes on the demand for pesticid es. Journal of Agricultural and Resource Economics 19 : 78 88. Swofford, D. L. 2002. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland, Tan, L. and P. S. Grewal. 2001a. Infection behavior of the rha bditid nematode Phasmarhabditis hermaphrodita to the grey garden slug Deroceras reticulatum Journal of Parasitology 87: 13491354. Tan, L. and P. S. Grewal. 2001b. Pathogenicity of Moraxella osloensis a bacterium associated with the nematode Phasmarhabditis hermaphrodita to the slug Deroceras reticulatum Applied and Environmental Microbiology 67: 50105016. Thompson, J. M., J. L. Sibley, W. G. Foshee III, G. J. Keever and A. G. Appel. 2005. Effect of copper hydroxide on slug feeding. Journal of Environmental Horticulture 23: 167170. Turgeon, D. D. J. F. Quinn, A. E. Bogan, E. V. Coan, F. G. Hochberg, W. G. Lyons, P. M. Mikkelsen, R. J. Neves, C. F. E. Roper, G. Rosenberg, B. Roth, A. Scheltema, F. G. Thompson, M. Vecchione, and J. D. Williams. 1998. Common and Scientific Names of Aquatic Invertebrates from the United States and Canada: Mollusks, 2nd Edition. American Fisheries Society Special Publication 26. American Fisheries Society. Bethesda, Maryland. Pp. 1 526. United States Department of Agricul ture Economics Research Service (USDA ERS): The Economics of Food, Farming, Natural Resources, and Rural America. 2011. Access date (09 132011). http://www.ers.usda.gov/Data/FATUS/ Wareing, D. R. 1993. Feeding history -a factor in determining food preference in slugs. Journal of Molluscan Studies 59: 366 368. Webb, G. R. 1968 Observations on the sexology of Philomycus carolinianus Bosc. Gastropodia 1 : 62 Webster, J. and R. W. S. Weber. 2007. Introduc tion to fungi ( 3rd edition). Cambridge University Press, Cambridge, UK. Pp. 1841. Wiktor, A. 2000. Agriolimacidae (Gastropoda: Pulmonata) A systematic monograph. Annales Zoologici 49: 347590. Williamson, P. and R. A. D. Cameron. 1976. Natural diet of t he landsnail Cepaea nemoralis Oikos 27: 493 500.

PAGE 466

466 Willis, J. C., D. A. Bohan, Y. H. Choi, K .F. Conrad and M. A. Semenov. 2006. Use of an individual based model to forecast the effect of climate change on the dynamics, abundance and geographic range of the pest slug Deroceras reticulatum in the U.K. Global Change Biology 12: 16431657. Yildirim, M. Z. and Kebapi. 2004. Slugs (Gastropoda: Pulmonata) of the Lakes Region (Gller Blgesi) in Turkey. Turkish Journal of Zoology 28: 155 160. Zhang, X., X. Ch en and J. Cheng. 2008. SI Key: A tool to generate secondary identification key for targeted diagnosis. Expert Systems with Applications 34: 28122818. Zotin, A. A. 2007. Patterns of individual growth of gray garden slugs Deroceras reticulatum. Biology Bul letin 34 : 457 462.

PAGE 467

467 BIOGRAPHICAL SKETCH Jodi A. White McLean was born on the beautiful island of Jamaica, West Indies in April of 1983. She attended the University of the West Indies, Mona, where she earned her Bachelor of Science degree i n b otany ( m ajor) and z oology ( m inor) in the spring of 2004. She went on to pursue a Doctor of Plant Medicine degree at the University of Florida in the fall of 2005. She successfully completed this degree in the fall of 2008. During the pursuit of the Doct or of Plant Medicine degree, she developed an interest in Malacology and applied to the Entomology and Nematology D epartment at the University of Florida with the hope of engaging in research that relate to this interest. In August of 2009, she got accepted into a Doctor of Philosophy degree program at the Entomology and Nematology Department at the University of Florida, where she worked under the direct supervision of Dr. John Capinera. She received her Ph.D. from the University of Florida in the spring o f 201 2 Upon accomplishing this degree she intends to pursue a career in public service.