<%BANNER%>

Activation of the Largemouth Bass Estrogen Receptors by Model Environmental Estrogenic Compounds

Permanent Link: http://ufdc.ufl.edu/UFE0043634/00001

Material Information

Title: Activation of the Largemouth Bass Estrogen Receptors by Model Environmental Estrogenic Compounds
Physical Description: 1 online resource (162 p.)
Language: english
Creator: Weil, Roxana F
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: endocrine -- estrogen -- receptor
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Endocrine disrupting chemicals are ubiquitous in the aquatic environment and have been found to interact with sex-hormone receptors of aquatic organisms, thus altering their interactions with the endogenous ligand. In largemouth bass, estrogen is involved in a wide array of physiological processes during development as well as adult life, and its action is predominantly mediated via three known estrogen receptors (ERalpha, ERbeta-b and ERbeta-a). The mRNA expression levels of these receptors are tissue dependent and vary throughout the reproductive stages, thus allowing for fine control of downstream gene regulation. Although gene expression of the three ER isoforms has been extensively studied in response to estradiol and xenoestrogens, little is known about the regulation of these receptors at the protein level, due to the lack of specific antibodies. In this study recombinant proteins and polypeptides synthesized based on the hinge region of the ERs were used as antigens in order to obtain isoform-specific antibodies. The antibodies were found to recognize their recombinant hinge-regions, without cross-reactivity between ERs. Steady state mRNA and protein levels of ERalpha were measured in the liver whereas ERbeta-a and ERbeta-b mRNA and protein were measured in the ovaries of LMB females at three distinct stages of reproduction. ERalpha transcript levels in the liver parallel plasma estradiol, but the ER protein was decreased in the final stage of reproduction, even though ERalpha mRNA was still up-regulated, suggesting an increase in protein degradation. In the ovaries, ERalpha mRNA levels showed only a slight increase at later stages of oocyte maturation. In contrast, in the ovaries, both the mRNA and protein levels of the LMB ERbetas were highest during the earliest stage of gonadal development, and significantly decreased afterwards, however, the cell types expressing these are not known, so the transcript changes in a particular cell type is not known. The ERbeta-a antibody recognized only one band in the female ovaries in the cortical alveoli stage, whereas up to three splice variants of ERbeta-b may be present in the ovaries during this stage. Two in vitro assays, specifically binding and transfection assays were used in this study to test the ability of the LMB ERs to bind and be activated by 4,4',4''-(4-propyl-1H-pyrazole-1,3,5-triyl)trisphenol (PPT) a mammalian ER??specific agonist, 2,3-bis(4-hydroxyphenyl)-propionitrile (DPN), a mammalian ER? specific agonist, bisphenol A (BPA), pp'-DDE, dieldrin (organochlorine pesticides that may behave as environmental estrogens), and ICI182,780 (a universal antagonist). The binding assay was done with recombinant ERalpha and ERbeta-b expressed in insect cells, whereas transfection assays were performed using HepG2 cells with all three ERs. Both assays showed that LMB ERs respond similarly to E2 treatment, but differences were observed between them with respect to the other compounds tested. Contrary to their specificities in mammals this study showed that PPT is not specific for the LMB ERalpha, and DPN is not specific for the LMB ERbetas. ERalpha was able to bind and be activated by all the compounds tested, albeit with significantly lower affinity than E2. ERbeta-b also bound all the compounds tested, and was activated by all the compounds tested, however dieldrin was shown to be a weak, partial agonist. Transfection studies were also done using ERbeta-a, and all the compounds, with the exception of dieldrin were full agonists of the LMB ERbeta-a. Differences between the three receptors were also observed in their response to ICI182,780. Although ICI 182,780 was able to fully inhibit the E2 mediated response of the receptors, 10-fold higher concentrations were required to fully abolish the response of ERbeta-a compared to the other receptors. Due to increasing concern over the potential adverse effects of aquatic contaminants on fish species, a liver slice in vitro assay was developed for LMB which allows screening compounds for their estrogenic potential. In this study, liver slices obtained from male LMB were exposed for 48 h to increasing concentrations of E2 (0-1 miroM), pp'-DDE (0-100 microM), BPA (0-100 microM) and dieldrin (0-100 microM). Induction of ERalpha, vitellogenin (Vtg) and zona radiata proteins (Zrp) were used as biomarkers of exposure to estrogenic compounds. A significant induction in the mRNA levels of ERalpha and Zrp was observed with exposure to E2, pp'-DDE and BPA. Vtg protein was also up regulated with E2, pp'-DDE and BPA, but Vtg mRNA was not significantly up regulated with the BPA concentrations used. Dieldrin exposure did not up-regulate ERalpha, Vtg or Zrp. Moreover, two month dietary exposure of male LMB to 2.8 mg dieldrin/kg body weight appeared to inhibit the E2-mediated induction of ERalpha and Zrp mRNA in liver slices obtained from those animals. Overall the data show that EDCs can bind the LMB ERalpha and ERbeta-b in a similar fashion, but their potential to activate the ERs is isoform specific, which can translate to different physiological effects in the fish. Taken together, these in vitro assays can be useful tools to screen the relative potency and efficacy of EDCs for fish receptors, as well as effects on ER regulated genes.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Roxana F Weil.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Denslow, Nancy D.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043634:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043634/00001

Material Information

Title: Activation of the Largemouth Bass Estrogen Receptors by Model Environmental Estrogenic Compounds
Physical Description: 1 online resource (162 p.)
Language: english
Creator: Weil, Roxana F
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: endocrine -- estrogen -- receptor
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Endocrine disrupting chemicals are ubiquitous in the aquatic environment and have been found to interact with sex-hormone receptors of aquatic organisms, thus altering their interactions with the endogenous ligand. In largemouth bass, estrogen is involved in a wide array of physiological processes during development as well as adult life, and its action is predominantly mediated via three known estrogen receptors (ERalpha, ERbeta-b and ERbeta-a). The mRNA expression levels of these receptors are tissue dependent and vary throughout the reproductive stages, thus allowing for fine control of downstream gene regulation. Although gene expression of the three ER isoforms has been extensively studied in response to estradiol and xenoestrogens, little is known about the regulation of these receptors at the protein level, due to the lack of specific antibodies. In this study recombinant proteins and polypeptides synthesized based on the hinge region of the ERs were used as antigens in order to obtain isoform-specific antibodies. The antibodies were found to recognize their recombinant hinge-regions, without cross-reactivity between ERs. Steady state mRNA and protein levels of ERalpha were measured in the liver whereas ERbeta-a and ERbeta-b mRNA and protein were measured in the ovaries of LMB females at three distinct stages of reproduction. ERalpha transcript levels in the liver parallel plasma estradiol, but the ER protein was decreased in the final stage of reproduction, even though ERalpha mRNA was still up-regulated, suggesting an increase in protein degradation. In the ovaries, ERalpha mRNA levels showed only a slight increase at later stages of oocyte maturation. In contrast, in the ovaries, both the mRNA and protein levels of the LMB ERbetas were highest during the earliest stage of gonadal development, and significantly decreased afterwards, however, the cell types expressing these are not known, so the transcript changes in a particular cell type is not known. The ERbeta-a antibody recognized only one band in the female ovaries in the cortical alveoli stage, whereas up to three splice variants of ERbeta-b may be present in the ovaries during this stage. Two in vitro assays, specifically binding and transfection assays were used in this study to test the ability of the LMB ERs to bind and be activated by 4,4',4''-(4-propyl-1H-pyrazole-1,3,5-triyl)trisphenol (PPT) a mammalian ER??specific agonist, 2,3-bis(4-hydroxyphenyl)-propionitrile (DPN), a mammalian ER? specific agonist, bisphenol A (BPA), pp'-DDE, dieldrin (organochlorine pesticides that may behave as environmental estrogens), and ICI182,780 (a universal antagonist). The binding assay was done with recombinant ERalpha and ERbeta-b expressed in insect cells, whereas transfection assays were performed using HepG2 cells with all three ERs. Both assays showed that LMB ERs respond similarly to E2 treatment, but differences were observed between them with respect to the other compounds tested. Contrary to their specificities in mammals this study showed that PPT is not specific for the LMB ERalpha, and DPN is not specific for the LMB ERbetas. ERalpha was able to bind and be activated by all the compounds tested, albeit with significantly lower affinity than E2. ERbeta-b also bound all the compounds tested, and was activated by all the compounds tested, however dieldrin was shown to be a weak, partial agonist. Transfection studies were also done using ERbeta-a, and all the compounds, with the exception of dieldrin were full agonists of the LMB ERbeta-a. Differences between the three receptors were also observed in their response to ICI182,780. Although ICI 182,780 was able to fully inhibit the E2 mediated response of the receptors, 10-fold higher concentrations were required to fully abolish the response of ERbeta-a compared to the other receptors. Due to increasing concern over the potential adverse effects of aquatic contaminants on fish species, a liver slice in vitro assay was developed for LMB which allows screening compounds for their estrogenic potential. In this study, liver slices obtained from male LMB were exposed for 48 h to increasing concentrations of E2 (0-1 miroM), pp'-DDE (0-100 microM), BPA (0-100 microM) and dieldrin (0-100 microM). Induction of ERalpha, vitellogenin (Vtg) and zona radiata proteins (Zrp) were used as biomarkers of exposure to estrogenic compounds. A significant induction in the mRNA levels of ERalpha and Zrp was observed with exposure to E2, pp'-DDE and BPA. Vtg protein was also up regulated with E2, pp'-DDE and BPA, but Vtg mRNA was not significantly up regulated with the BPA concentrations used. Dieldrin exposure did not up-regulate ERalpha, Vtg or Zrp. Moreover, two month dietary exposure of male LMB to 2.8 mg dieldrin/kg body weight appeared to inhibit the E2-mediated induction of ERalpha and Zrp mRNA in liver slices obtained from those animals. Overall the data show that EDCs can bind the LMB ERalpha and ERbeta-b in a similar fashion, but their potential to activate the ERs is isoform specific, which can translate to different physiological effects in the fish. Taken together, these in vitro assays can be useful tools to screen the relative potency and efficacy of EDCs for fish receptors, as well as effects on ER regulated genes.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Roxana F Weil.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Denslow, Nancy D.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043634:00001


This item has the following downloads:


Full Text

PAGE 1

1 ACTIVATION OF THE LARGEMOUTH BASS ESTROGEN RECEPTORS BY MODEL ENVIRONMENTAL ESTROGENIC COMPOUNDS By ROXANA E. WEIL A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Roxana E. Weil

PAGE 3

3 To my wonderful daughter Isabella

PAGE 4

4 ACKNOWLEDGMENTS It is a pleasure to than k all the people who made this doctoral dissertation possible First I am grateful to my mentor, Dr. Nancy Denslow, whose continuous support and guidance throughout these years enabled me to grow as a scientist. Nancy is a dedicated mentor, always encouraging and promoting creativity in science. I would like to ackn owledge my committee members, Dr. Barbe r, Dr. Chegin i, Dr. Shiverick and Dr. Harrison for their time and advice during the course of this project. I would also like to thank my colleagues, Candice Lavelle, Dr. Melinda Prucha, Kevin Kroll, Dr. Daniel Spade Dr. Alvina Mehinto, Dr. Cristina Colli Doula,Ignacio Rodriguez and Erica Anderson who were always available to help and provide ideas, and who made working in this lab a unique experience. I must thank John Munson who has provided invaluable support thro ughout the years. I am especially grateful to Dr. Christopher Matyniuk and Dr. Robert J Griffitt for being valuable collaborators and great friends. I would also like to thank Dr. Andy Kane for his assistance with the liver slice assay, and histopathology I am very appreciative of my parents for being supportive and teaching me that hard work and perseverance will eventually lead to success. They, along with my wonderful brother have been there for me through thick and thin, always helping and encouragin g me throughout these years. A special thank you goes to my daughter Isabella, who spent numerous weekends in the lab with me. I love you! You are the best kid in the world.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 13 CHAPTER 1 INTRODUCTION AND LI TERATURE REVIEW ................................ ..................... 17 Endocrine Disrupting Chemicals ................................ ................................ ............. 17 Estrogen ................................ ................................ ................................ ................. 18 Estrogen Receptors ................................ ................................ ................................ 19 Estrogen Receptor Isoforms ................................ ................................ ............. 20 Tissue Distribution of Estrogen Receptors in Fish ................................ ............ 22 Biomarkers of Estrogen Mimics ................................ ................................ ........ 25 DDE and Bisphenol A as Endocrine Disrupting Chemicals ......... 26 DDE ................................ ................................ ................ 26 Bisphenol A ................................ ................................ ................................ 29 Research Hypotheses ................................ ................................ ............................. 31 2 MATERIALS AND METHODS ................................ ................................ ................ 35 Animals ................................ ................................ ................................ ................... 35 LMB Collection and Sampling ................................ ................................ .......... 35 Laboratory LMB ................................ ................................ ................................ 35 Methods ................................ ................................ ................................ .................. 36 RNA Extraction ................................ ................................ ................................ 36 Real time PCR (qPCR) ................................ ................................ ..................... 36 Antibody Synthesis ................................ ................................ ........................... 37 Amplification of ER hinge regions ................................ .............................. 37 Expression of recombinant ER hinge proteins ................................ ........... 38 Verification of recombinant proteins by MS/MS ................................ ......... 39 Antibod y production ................................ ................................ ................... 41 Column purification of antibodies from serum ................................ ............ 42 Western Blots ................................ ................................ ................................ ... 42 Tissue preparation ................................ ................................ ..................... 42 Western blot detection of ER ER a, ER b, Actin and Histone3 ............. 43 Immunoprecipitation Using LMB ERs ................................ ............................... 44 Culturing of HepG2 Cells ................................ ................................ .................. 46 Transient Transfection Assays in HepG2 Cells ................................ ................ 46 Luciferase Measurements ................................ ................................ ................ 47 Binding Assays ................................ ................................ ................................ 47

PAGE 6

6 Sub cloning of LMB ERs into pVL 1393 vector ................................ .......... 47 Receptor production ................................ ................................ ................... 48 Receptor concentration ................................ ................................ .............. 49 Saturation and competitive binding ................................ ............................ 49 Slice preparation ................................ ................................ ........................ 50 Viability Assay ................................ ................................ ................................ .. 51 Histology ................................ ................................ ................................ ........... 52 Statistical Analysis ................................ ................................ ............................ 52 Wild LMB data ................................ ................................ ............................ 52 Cell culture experiments ................................ ................................ ............ 52 Binding assays ................................ ................................ ........................... 53 Liver slice experiments ................................ ................................ .............. 53 3 VARIATION OF THE TRANSCRIPT AND PROTEIN LEVELS OF THE LARGEMOUTH BASS ESTROGEN RECEPTOR ISOFORMS .............................. 58 Background ................................ ................................ ................................ ............. 58 Results ................................ ................................ ................................ .................... 60 The Antibodies Recognize Their Respective Hinge Regions ........................... 60 Immunoprecipitation Using Anti human ER Antibody ................................ ....... 61 Immunoprecipitation Using ER a and ER b Antibodies ................................ ... 61 Histology of Female Gonads at Different Stages in the Reproductive Cycle .... 62 Plasma E 2 Vtg and Gonados omatic Index During Different Stages of Reproduction ................................ ................................ ................................ 62 Expression of ER in the Liver of Female LMB ................................ ................ 63 Expression of ER s in th e Gonads of Female LMB ................................ ......... 64 Ratios of ER s to ER mRNA in the Gonads of Female LMB ........................ 64 Discussion ................................ ................................ ................................ .............. 65 4 BINDING AND ACTIVATION OF THE LARGEMOUTH BASS ESTROGEN RECEPTORS BY MODEL COMPOUNDS ................................ ............................. 81 Background ................................ ................................ ................................ ............. 81 Results ................................ ................................ ................................ .................... 84 Saturation Binding for the LMB ER and ER b ................................ ................ 84 Competitive Binding for the LMB ER and ER b ................................ ............. 84 ER Transactivation ................................ ................................ ........................... 85 Cell viability assay ................................ ................................ ...................... 85 E 2 mediated interaction of LMB ERs with 2X ERE versus 3X ERE ........... 85 LMB ER activation by DDE ................... 86 ER activation of E 2 and dieldrin mixture ................................ ..................... 87 ICI 182,780 is a full antagonist of the LMB ERs ................................ ......... 88 Discussion ................................ ................................ ................................ .............. 88 5 EFFECTS OF ENVIRONMENTAL ESTROGENS ON ESTROGEN RECEPTOR REGULATED GENES IN LIVER SLICES FROM LARGEMOUTH B ASS ............. 110

PAGE 7

7 Background ................................ ................................ ................................ ........... 110 Results ................................ ................................ ................................ .................. 113 Histology ................................ ................................ ................................ ......... 113 Gene Expression in the Liver Slices is Time dependent ................................ 113 E 2 Mediated Induction of ER Vtg and Zrp mRNA ................................ ........ 114 BPA Mediated Induction of ER Vtg and Zrp mRNA ................................ ..... 114 DDE Mediated Induction of ER Vtg and Zrp mRNA .............................. 115 Dieldrin Effect on ER Vtg and Zrp mRNA Levels ................................ ........ 115 Discussion ................................ ................................ ................................ ............ 116 6 CONCLUSIONS AND FUTURE WORK ................................ ............................... 128 LIST OF REFERENCES ................................ ................................ ............................. 137 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 162

PAGE 8

8 LIST OF TABLES Table page 2 1 List of primer sequences used for qPCR analysis of LMB mRNA expression .... 55 2 2 List of primer sequences used for sub cloning the ER hinge and full length s equences ................................ ................................ ................................ .......... 56 4 1 Relative binding affinities of various chemicals tested to the LMB ER and ER b ................................ ................................ ................................ .................. 96 4 2 EC 50 Concentrations for t he LMB ERs using 2X ERE and 3X ERE Luciferase reporter system. ................................ ................................ ................................ .. 97 4 3 EC 50 for several compounds tested with the LMB ER ER a and ER b using a 3X ERE Luc reporter construct. ................................ ............................. 98

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Functional domains of the LMB ERs.. ................................ ................................ 32 1 2 Estrogen rece ptor mediat ed protein synthesis ................................ .................... 34 2 1 cDNA sequences of LMB Vtg and Zrp used for qPCR standard curves. ............ 57 3 1 Specificity of antibodies fo r the ER isoforms ................................ ...................... 71 3 2 Cross reactivity of anti human ER antibody with LMB ERs. ............................... 72 3 3 Immunoprecipitation using biotinylated anti human ER (hER) antibody. ............ 73 3 4 Immunoprecipitation using ER a and ER b antibodies ................................ ...... 74 3 5 Histological representation of LMB ovaries in three distinct stages of development ................................ ................................ ................................ ....... 75 3 6 Plasma E 2 ,Vtg and gonadosomatic index (GSI) at three different stages in the reproductive cycle of wild LMB ................................ ................................ ..... 76 3 7 Changes in ER mRNA and protein expression in the liver of female largemouth bass at three different stages in the reproductive cycle ................... 77 3 8 Changes in ER a mRNA and protein expression in the gonads of female LMB at three different stages in the reproductive cycle. ................................ ..... 78 3 9 Changes in ER b mRNA and protein expression in the ovaries of female LMB at three different stages in the reproductive cycle ................................ ...... 79 3 10 Changes in ER mRNA expression in the ovary of LMB at three different stages in the reproductive cycle. ................................ ................................ ........ 80 4 1 Representative graphs of E 2 Total, Specific and Non specific binding for the LMB ER and LMB ER b in a cell free assay ................................ .................... 99 4 2 Representative graphs of E 2 saturation binding and scatchard analysis (insert) for the LMB ER and LMB ER b in a cell free binding assay .............. 100 4 3 Competitive binding assays with the LMB ER .. ................................ .............. 101 4 4 Competitive binding assays with the LMB ER b ................................ .............. 102 4 5 HepG2 cell viability. ................................ ................................ .......................... 103 4 6 E 2 mediated transactivation of the LMB ERs ................................ .................... 104

PAGE 10

10 4 7 Dose response of transactivation of the LMB ER ................................ ........... 105 4 8 Dose response of transactivation of the LMB ER a ................................ ......... 106 4 9 Dose response of transactivation of the LMB ER b. ................................ ........ 107 4 10 Dieldrin does not inhibit the E 2 mediated response ................................ .......... 108 4 11 ICI 182,780 inhibits E 2 mediated response. ................................ ...................... 109 5 1 Histology of liver slices. ................................ ................................ .................... 121 5 2 Time dependent induction of ER Vtg and Zrp mRNA levels. .......................... 122 5 3 Dose response of ER Vtg and Zrp mRNA levels in liver slices exposed to increasing concentrations of E 2 ................................ ................................ ....... 123 5 4 Dose response of ER Vtg and Zrp mRNA levels in liver slices exposed to increasing concentrations of BPA ................................ ................................ ..... 124 5 5 Dose response of ER Vtg and Zrp mRNA levels in liver sli ces exposed to DDE ................................ .............................. 125 5 6 Dose response of ER Vtg and Zrp mRNA levels in liver slices exposed to increasing concentrations of dieldrin ................................ ................................ 126 5 7 Dose response of ER Vtg and Zrp mRNA levels exposed to increasing concentrations of E 2 in liver slices obtained from control and dieldrin treated fish ................................ ................................ ................................ .................... 127 6 1 Simplified schematic representation EDC interactions with the LMB ERs in liver tissue, and effects on downstream gene regulation ................................ .. 136

PAGE 11

11 LIST OF ABBREVIATION S 11 KT 11 ketotestosterone Ab Antibody AF 1 Acti vation function 1 BPA Bisphenol A CA Cortical alveoli DBD DNA binding domain DPN 2,3 bis(4 hydroxyphenyl) propionitrile E 2 Estradiol EDC Endocrine disrupting chemicals EM Early maturation ER Estrogen receptor ERE Estrogen response element EV Early vitellog enic FBS Fetal bovine serum FSH Follicle stimulating hormone GnRH Gonadotropin releasing hormone GSI Gonadosomatic index HPG Hippocampus pituitary gonad IP Immunoprecipitation IPTG Isopropyl D 1 thioglactopranoside LB Luria broth LBD Ligand binding domai n LH Luteinizing hormone LM Late maturation

PAGE 12

12 LMB Largemouth bass LV Late vitellogenic mRNA Messenger ribonucleic acid NP Nonylphenol PBS phosphate buffered solution PGF Primary growth follicles PN Perinuclear DDE 1,1 dichloro 2,2 bis(p chlorophenyl)ethy lene PPT 4,4',4'' (4 propyl [1H] pyrazole 1,3,5 triyl)trisphenol Vtg Vitellogenin YGs Yolk globules Zrp Zona radiata protein

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of t he Requirements for the Degree of Doctor of Philosophy ACTIVATION OF THE LARGEMOUTH BASS ESTROGEN RECEPTORS BY MODEL ENVIRONMENTAL ESTROGENIC COMPOUNDS By Roxana E Weil December 2011 Chair: Nancy D. Denslow Major: Medical Sciences Physiology and Pharm acology Endocrine disrupting chemicals are ubiquitous in the aquatic environment and have been found to interact with sex hormone receptors of aquatic organisms, thus altering their interactions with the endogenous ligand. In largemouth bass estrogen is involved in a wide array of physiological processes during development as well as adult life, and its action is predominantly mediated via three known estrogen receptors (ER ER b and ER a). The mRNA expression levels of these receptors are tissue depen dent and vary throughout the reproductive stages, thus allowing for fine control of downstream gene regulation. Although gene expression of the three ER isoforms has been extensively studied in response to 17 estradiol and xenoestrogens, little is known about the regulation of these receptors at the protein level, due to the lack of specific antibodies. In this study recombinant proteins and polypeptides synthesized based on the hinge region of the ERs were used as antigens in order to obtain isoform spe cific antibodies. The antibodies were found to recognize their recombinant hinge regions, without cross reactivity between ERs. Steady state mRNA and protein levels of ER were measured in the liver whereas ER a and ER b mRNA and protein were measured

PAGE 14

14 in the ovaries of LMB females at three distinct stages of reproduction ER transcript levels in the liver parallel plasma estradiol but the ER protein was decreased in the final stage of reproduction, even though ER mRNA was still up regulated suggesting an increase in protein degradation In the ovaries, ER mRNA levels showed only a slight increase at later stages of oocyte maturation In contrast, in the ovaries, bot h the mRNA and protein levels of the LMB ER s were highest during the earliest stage of gonadal development, and significantly decreased afterwards however, the cell types expressing these are not known, so the transcript changes in a particular cell type is not known. The ER a antibody recognized only one band in the female ovaries in the cortical alveoli stage, whereas up to three splice variants of ER b may be present in the ovaries during this stage Two in vitro assays, specifically binding and tran sfection assays were used in this study to test the ability of the LMB ERs to bind and be activated by 4,4',4'' (4 propyl [1H] pyrazole 1,3,5 triyl)trisphenol (PPT) a mammalian ER specific agonist, 2,3 bis(4 hydroxyphenyl) propionitrile (DPN), a mammalian ER specific agonist, bisphenol A DDE, dieldrin ( organochlorine pesticides that may behave as environmental estrogens), and ICI182,780 (a universal antagonist). The binding assay was done with recombinant ER and ER b expressed in insect cells whereas transfection assays were performed using HepG2 cells with all three ERs. Both assays showed that LMB ERs respond similarly to E 2 treatment, but differences were observed between them with respect to the other compounds tested. Contrary to their specificities in mammals t his study showed that PPT is not specific for the LMB ER and DPN is not specific for the LMB ER s. ER was able to bind and be activated by all the compounds tested,

PAGE 15

15 albeit with significantly lower affinity th a n E 2 ER b also bound all the compounds tested, and was activated by all the compounds tested, how ever dieldrin was shown to be a weak, partial agonist. Transfection studies were also done using ER a, and all the compounds, with the exception of dieldrin were full agonists of the LMB ER a. Differences between the three receptors were also observed in their response to ICI182,780. Although ICI 182,780 was able to fully inhibit the E 2 mediated response of the receptors, 10 fold higher concentrations were required to fully abolish the response of ER a compared to the other receptors. Due to increasing co ncern over the potential adverse effects of aquatic contaminants on fish species, a liver slice in vitro assay was developed for LMB which allows screening compounds for their estrogenic potential. In this study, liver slices obtained from male LMB were e xposed for 48 h to increasing concentrations of E 2 (0 1 DDE (0 100 M), BPA (0 100 M) and dieldrin (0 100 M). Induction of ER vitellogenin ( Vtg ) and zona radiata proteins ( Zrp ) were used as biomarkers of exposure to estrogenic compounds. A significant induction in the mRNA levels of ER and Zrp w as observed with exposure to E 2 DDE and BPA. Vtg protein was also up regulated with E 2 DDE and BPA, but Vtg mRNA was not significant ly up regulated with the BPA concentrations used. Dieldrin exposure did not up regulat e ER Vtg or Zrp Moreov er, two month dietary exposure of male LMB to 2.8 mg dieldrin /kg body weight appeared to inhibit the E 2 mediated induction of ER and Zrp mRNA in liver slices obtained from those animals. Overall the data show that EDCs can bind the LMB ER and ER b in a similar fashion, but their potential to activate the ERs is isoform specific which can translate to different physiological effects in the fish. Taken together

PAGE 16

16 these in vitro assays can be useful tools to screen the relative potency and efficacy of EDCs f or fish receptors, as well as effects on ER regulated genes.

PAGE 17

17 CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW Endocrine D isrupting C hemicals Endocrine disrupting chemicals (EDCs), also known as hormonally active compounds can be eithe r natural or anthropog enic and are defined by the U.S. Environmental Protection Agency as any compound that can "interfere with the synthesis, secretion, transport, binding, action, or elimination of natural hormones in the body that are responsible for the maintenance of homeo stasis (normal cell metabolism), reproduction, development, and/or behavior" (Kavlock et al. 1996) There are a large number of man made endocrine disrupting compounds including pharmaceuticals, plasticizers and pe sticides, many of which ultimately enter the aquatic environment. A number of reviews have focused on the prevalence of EDCs in aquatic environments and their effects on wild fish (Sumpter 1998; Guillette 2000; Mill s and Chichester 2005; Parrott et al. 2006; Porte et al. 2006; Bernanke and Kohler 2009; Scholz and Kluver 2009) One of the main targets of EDCs in fish is gonad differentiation and reproduction. Cross talk along the Hippocampus Pituitary Gonad ( HPG ) ax is and homeostasis of sex hormones is especially important during the early stages of fish development. Exposure of fish to EDCs during the sensitive period of gonad differentiation has been shown to have significant physiological repercussions, including sex reversal and intersex gonads in some fish species (Liu et al. 2008; Stelkens and Wedekind 2010) Intersex wild male bass, including largemouth bass, have been found in the United State s in the Colorado River (Hinck et al. 2008) as well as the Rio Grande River (Schmitt et al. 2005) and more recently in the South branch of the Potomac River ( Iwanowicz et al. 2009)

PAGE 18

18 Incidences of intersex male fish have also been documented in many other fish species in the wild including swordfish, Xiphias gladius (De Metrio et al. 2003) flounder, Pleuronectes yokoha mae (Hashimoto et al. 2000) barbel ( Barbus plebejus ) (Vigano et al. 2001) s hovelnose sturgeon ( Scaphirhynchus platyorynchus ) (Harshbarger et al. 2000) and bass (Hinck et al. 2007; Hinck et al. 2009) as well as a result of laboratory exposures. Reversal of male gonads has been observed in p uffer fish ( Takifugu rupribes ) fry exposed to 100 g/g E 2 in their diet from 21 days to 80 day post hatching. There are several excellent studies where xenoestrogens were shown to alter plasma sex steroid levels, inhibit gametogenesis (Hinck et al. 2007; Hinck et a l. 2008) cause alterations to sex specific secondary sexual characteristics (Vajda et al. 2011) and alter steroidogenesis (Garcia Reyero et al. 2006; Hinck et al. 2008) as well as hypothalamic pituitary gonadal ( HPG ) axis signaling (Martyniuk et al. 2010) Estrogen Estrogen is part of the steroid hormone family which includes the stress hormone cortisol as well as the sex steroid testosterone, and its synthesis is under the control of the HPG axis. The physiology and fe edback system of this has been extensively studied, and previously reviewed (Nagahama 1994; Perry and Grober 2003; Clelland and Peng 2009; Zohar et al. 2010) The underlying mechanism involved in the regulation of gonadal steroidogenesis by the pituitary is similar in fish and tetrapods. Briefly, gonadotropin r eleasing h ormone [GnRH] from the hypothalamus stimulates the pituitary to release follicle stimulating hormone [FSH /GTH I ] and luteinizing hormone (LH/GTH II ) (Van der Kraak et al. 1992; Shimizu et al. 2008) Synthesis of these hormones, which are critical to gonadal steroidogenesis can be modulated by EDCs.

PAGE 19

19 For example a decrease in LH release was observed in Atlantic croaker after exposure to arochlor 1254 (Khan et al. 2001) whereas an increase in the gonadotropin mRNA levels was observed in the brain of the hermaphroditic fish, Kryptolebias marmoratus (Rhee et al. 2010) Data collected from f ish that spawn in a synchronous or semi synchronous fashion show that the expression levels of enzymes involved in steroidogenesis vary throughout the reproductive cycle in both females and male gonads (von Hofsten e t al. 2002; Singh and Joy 2009; Mylonas et al. 2010) In female European sea bass ovaries, the steroidogenic acute regulatory protein ( StAR ) has the highest levels of expression during the late maturation ovulation stage of the reproductive cycle, wherea s aromatase mRNA levels are highest during late vitellogenesis. A similar expression pattern of StAR mRNA was also observed in the ovaries of LMB females collected at different times throughout the year (Kocerha et al. 2010) where StAR mRNA correlates with plasma E 2 levels which in the wild female LMB culminated in early spring. Estrogen Receptors In addition to sexual maturation and differentiation, E 2 regulates physiological processes such as growth and develop ment (Shved et al. 2009) osmoregulation (Carrera et al. 2007) and the immune response (Lutton and Callard 2008) Similar to mammalian systems, E 2 effects in fish are mediated by both membrane receptors which are G coupled receptors (Thomas et al. 2006; Pang et al. 2008; Pang and Thomas 2009; Thomas et al. 2010) and nuclear estrogen receptors (ERs), which will be the focus of this review. The nuclear ERs are part of a superfamily of steroid hormone receptors which includes the gluco corticoid, mineralocorticoid and androgen receptors among others

PAGE 20

20 (Thornton 2001) These receptors are transcription factors which bind, and are activated by either endogenous or environmental ligands A list of model ER ligands is shown in Figure 1 2 and a schematic representation of ER mediated gene activ ation is represented in Figure 1 3 and has previously been reviewed by (Eldridge et al. 2008; Rempel and Schlenk 2008; Liu et al. 2010) The nuclear ERs contain five distinct regions (Figure 1 1) which are importa nt for their function (Kumar et al. 1987; Huang et al. 2010) The N terminal domain of the protein is called the activation function 1 (AF 1) domain and is involved in transcriptional regulation independent of liga nd binding to the receptor (El Tanani and Green 1997) The DNA binding domain of the receptor (DBD) is located in the center of the receptor, and it is well conserved across vertebrate species. The DNA binding dom ain is linked to the ligand binding domain (LBD) of the polypeptide by a highly variable region, the hinge region. The function of the C terminal region of the polypeptide (F domain) has not been elucidated, however studies have shown it to function in st abilizing the protein in the absence of ligand (Tateishi et al. 2006) and it can attenuate the dimerization of ERs in the presence of E 2 (Yang et al. 2008) Estrogen R ecept or I soforms Similar to other vertebrates, fish have two subtypes of ERs (ER and ER ) A second isoform of ER w as identified for the first time in fish and it was designated ER (Hawkins et al. 2000) T wo isoforms of ER have been characterized since then in a n umber of fish species, including goldfish ( Carassius auratus ) (Choi and Habibi 2003) largemouth bass ( Micropterus salmoides ) (Sabo Attwood et al. 2004) European sea bass ( Dicentrarchus labrax ) (Halm et al. 2004) Chinese rare mi nnow ( Gabiocypris

PAGE 21

21 rarus ) (W ang et al. 2010) and Nile tilapia ( Oreochromis niloticus ) (Huang et al. 2010) Currently the two ER isoforms are named ER b (ER ) and ER a (ER ). event (Hawkins et al. 2000) The amino acid sequences of the LMB ER s are 76% identical to each other, and they are about 68% identical to the human ER The highest degree of conservation is observed in the DNA binding domai ns of the receptors, with >90% identity across all three receptors (Sabo Attwood et al. 2004; Sabo Attwood et al. 2007) Recently, a second isoform of ER (designated ER 2 ) has also been identified in rainbow trout ( Oncorhynchus mykiss ) (Nagler et al. 2007) and in the cyprinid Spinibarbus denticulates (sdER 2 ) (Zhu et al. 2008) The trout ER 2 groups phylogenetically with the trout 2 is closely related to the sdER 1. These ER isoforms are phylogenetically close to a class containing the ER subunit s of other fish including zebrafish, goldfish, gilthead seabream, Nile tilapia and largemouth bass (Zhu et al. 2008) There is approximately 75% amino acid sequence identity between the two trout ER subtypes compa red to approximately 58% identity between the ER beta subtypes across all ER domains. The multiple copies of ER isoforms in fish may be attributed to a complete genome duplication event approximately 300 million year ago in the ray finned fish (actinopter ygians) lineage (Taylor et al. 2001) and it is hypothesized that the majority of teleost genomes contain four copies of ERs Unlike fish, which express four distinct ER isoforms, mammalian species only carry two isoforms: ER and ER These receptors are different in their res pective tissue distribution, their ability to bind ligands (Kuiper et al. 1997; Nilsson and

PAGE 22

22 Gustafsson 2010) as well as some differences in their functions in the organism (Li u et al. 2002; Gustafsson 2003; Huang et al. 2006) Tissue Distribution of Estrogen Receptors in F ish The ER mRNA distribution and expression levels in fish vary among tissues, the sex of the animal as well as the reproductive stage of the animal. All th e ER isoforms are expressed in the brain of many fish species including the Nile tilapia (Huang et al. 2010) Pejerrey fish (Strobl Mazzulla et al. 2008) Sea bass (Muriach et al. 2008) and LMB (Sabo Attwood et al. 2004; Martyniuk et al. 2009) In Atlantic croaker ( Micropogonias undulatus ) in situ hybridization demonstrated that ERs have differe nt patterns of expression in the hypothalamus for example ER expression being distributed throughout the preoptic nucleus, whereas ER b expression is localized to the wall of the third ventricle (Hawkins et al. 2005) In the LMB brain and pituitary, the ER isoforms are expressed at higher levels than ER (Sabo Attwood et al. 2004; Martyniuk et al. 2009) In LMB, the ER mRNA expression in pituitary was also shown to correlate with the stages of sexual development of the animals. Both male and female LMB showed increasing levels of ER ER b and ER a mRNA s in the pituitary during progression of gonadal maturation (Martyniuk et al. 2009) T he liver plays a crucial role in gonadal development in female fish, as it is the site of synthesis for the egg yolk precursor protein, vitellogenin which is under the control of E 2 Therefore the ERs are prominent in the liver which expresses mostly ER and ER b but significantly lower levels of ER a (Sabo Attwood et al. 2004; Pinto et al. 2005; Fu et al. 2008) The liver is the main organ of ER expression as it is present at the highest levels relative to other organs. ER mRNA expression changes throughout the

PAGE 23

23 reproductive cycle of the female LMB parallel ing plasma E 2 levels (Sabo Attwood et al. 2004) The highest levels of ER have been observed in February March, corresponding to sexual maturation whereas the lowest expression has been observed in November December which corresponds to primary gonadal growth stages (Sabo Attwood et al. 2004) In contrast, ER b and ER a in the liver do not appear to be responsive to increased plasma E 2 levels during the f emale reproductive cycle (Sabo Attwood et al. 2004) In male livers, ER mRNA expression is low relative to female livers (Sabo Attwood et al. 2004) and liver expresses lowe r levels of ER relative to other organs (Xia et al. 2000; Andreassen et al. 2003; Huang et al. 2010) Moreover, in Channel catfish males ER mRNA was present at higher levels th a n ER mRNA (Xia et al. 2000) Similar results were observed in male Sea bream (sb) where the sbER a showed higher level of expression th a n the sbER but sbER b was lower relative to sbER (Pinto et al. 2006) A number of studies have also looked at ER distribution in the gonads, both female and male (Sabo Attwood et al. 2004; Nagler et al. 2007; Fu et al. 2008; Zhu et al. 2008; Huang et al. 2010) In the ovary, the E R isoforms can be found at higher levels relative to ER (Xia et al. 2000; Sabo Attwood et al. 2004; Pinto et al. 2006; Nagler et al. 2007) In LMB, the expression of all three ovarian ERs showed peak expression in November (primary oocyte growth) and steadily decreased in abundance throughout the growth of the ovary (Sabo Attwood et al. 2004) However, the cell types expressing ERs in fish ovaries are not yet know, so it no t clear how the ER transcript levels change in each cell type.

PAGE 24

24 ER expression is also observed in male gonads. In trout testes ER 1 is found in similar levels as ER 2, and greater expression than ER 1 (Nagler et al. 2007) whereas in LMB testes the ER s appear to be more abundant than ER ( Prucha et al. manuscript in preparation). The role of ERs in testis is not yet understood, but it was shown in rainbow trout by immunohistochemist r y that ER protein is found in the interstitial cells at all stages of the annual reproductive cycle of the animal (Bouma and Nagler 2001) ER expression patterns however can change throughout the different stages of testes development. Male Nile tilapia showed higher levels of ER 2 expression in early recrudescing stage of the gonads than in the later stages of testis development (Huang et al. 2010) Interestingly, E 2 and xenoestrogens have inhibitory effects on testicular development, and phenotypic sex reversal can be achieved in embryos of genetically male fish exposed to estrogenic compounds (van Aerle et al. 2002) indicating that the ERs may play a role in differentiating testes in developing f ish. Taken together, this shows that there is significant variation in tissue distribution of these receptors, and regulation of the ERs appears to be dependent upon a multitude of factors including sex, reproductive phase, age, and tissue. Despite increa sing data on ER isoform mRNA distribution and expression in teleostean tissues, studies are lacking that develop and describe distribution and expression patterns for corresponding ER isoform protein s Mortensen and Arukwe (2008) described ER protein re sponses in Atlantic salmon ( Salmo salar ) after exposure to nonylphenol (NP) and PCB126 using a rabbit anti hER antiserum generated against amino acids 154 171 that correspond to the DNA binding (DB) C domain of human ER1, showing an increase in total ER p rotein abundance in the liver

PAGE 25

25 after NP and PCB126 treatment. However, to date there is a lack of teleost specific antibodies to each ER isoform and the spatio temporal relationship between ER isoform message and protein is not well characterized in fish. This is important for increased understanding of both physiological regulation of cell processes by E 2 and endocrine disruption via contaminants. Biomarkers of Estrogen M imics Reproduction is controlled by well orchestrated interactions between differen t components of the HPG axis and consequently, EDCs can have effects at multiple targets (Gray et al. 2002) In addition to those aspects under the control of the HPG axis, egg development in female fish also requi res interaction between the neuroendocrine system and the liver, where the egg yolk precursor protein, vitellogenin ( Vtg ) is synthesized. Vtg is a phospholipoglycoprotein made by the liver under the control of E 2 Vtg is trans ported via the blood to the d eveloping oocyte, where it will be a source of nutrients for the developing embryo (Wallace and Jared 1968; Selman and Wallace 1982; Jalabert 2005) The duration of Vtg synthesis is dependent on the spawning cycle of the fish. LMB spawn once a year, and vitellogenesis takes place for several months, starting in early December and culminating at spawning at the beginning of April. In female LBM, an increase in Vtg mRNA levels in the liver was observed as early as D ecember and it peaked from February to March, which corresponded with a peak in plasma E 2 levels (Sabo Attwood et al. 2004) Vtg synthesis is important in the development of the female oocytes, but in males it is f ound in very low concentrations and therefore its presence in male fish can be used as a sensitive biomarker for exposure to exogenous E 2 mimics (Wahli et al. 1981; Bowman

PAGE 26

26 and Denslow 1999; Marin and Matozzo 2004; L eanos Castaneda and Van Der Kraak 2007) Another group of proteins that have been used as biomarkers of exposure to endocrine disruptors in fish are the zona radiate (Zrp), also termed zona pellucida (ZP) proteins. The Zr proteins make up the egg envelop e which maintains the structural integrity of the egg, and plays an important role during and post fertilization (Oppen Berntsen et al. 1990) Teleost Z r proteins can be divided in four groups: ZP1 (ZPA), ZP2 (ZPB), ZP3 (ZPC) and ZPX (Spargo and Hope 2003) and their synthesis can be either in the liver or the ovary, depending on the fish species (Arukwe and Goksoyr 2003; Conner and Hughes 2003; Sano et al. 2010) In the liver, Z rp synthesis is under the control of estrogen (Berg et al. 2004) and the proteins are transporte d to the ovaries via the blood (Modig et al. 2006) Although not usually expressed in males, Z r protein induction can be seen in male livers after exposure to E 2 (Arukwe and G oksoyr 2003; Genovese et al. 2011) and estrogen mimics such as octylphenol (Genovese et al. 2011) 4 nonylphenol (Arukwe et al. 1997; Lee et al. 2002) alpha zeralenol (Celius et al. 2000) and bisphenol A (BPA) (Lee et al. 2002; Rhee et al. 2009) Dieldrin DDE and Bisphenol A as Endocrine Disrupting Chemicals DDE Aldrin and DDT are organochlorine pesticides that were ext ensively used to control insects on agricultural crops. Dieldrin is the active insecticide metabolized from DDE is a commonly found bioactive product of DDT breakdown (Figure 1 1 ). The use of both Aldrin and DDT for agricultural purposes has been banned in the United States for over 30 years, but due to their highly persistent nature, dieldrin (Jorgenson 2001) DDE (Beard 2006) are still prevalent in the environmen t

PAGE 27

27 These pesticides are not water soluble, but readily bind to sediment and enter the aquatic environment bound to soil due to erosion Although they are not found in the water column, these compounds are taken up by aquatic organisms from the sediment, and they can bioaccumulate as well as bio magnify through the food chain due to their lipophilic nature (Bro Rasmusse n 1996; Houde et al. 2008) Dieldrin and DDE have been found in fish tissues from various freshwater systems across the United States, including fish endogenous to the Cape Fear River system in North Carolina (Mallin et al. 2011) in lake trout from the Great Lakes, Michigan (Carlson et al. 2010) in fish from the Ohio river, the Upper Missouri and Mississippi rivers (Blocksom et al. 2010) among others. Dieldrin and DDE along with o ther organic pollutants have also been found in various marine fish species, including English sole ( Pleuronectes vetulus ), white croaker ( Genyonemus lineatus ), and starry flounder ( Platichthys stellatus ) collected from different sites along the Pacific co ast of the United States (Myers et al. 1994) as well as in marine organisms from different areas of the world (Vorkamp et al. 2004; de Mora et al. 2005; van Leeuwen et al. 200 9) The wide distribution of these compounds in aquatic species poses a concern for the health of the animals as well as for human health t hrough the consumption of fish. The insecticidal properties of both dieldrin and DDE were targeted to the nervous system of insects. It is therefore not surprising that they also affect the nervous systems of other organisms, including fish. The neurotoxic properties of dieldrin were studied in adult LMB by Martyniuk et al. 2010 (Martyniuk et al. 2010) who observed increased levels of the neurotransmitter aminobutyric acid (GABA) in the hypothalamus and cerebellum of female fish injected with 10 mg/ml of dieldrin Other

PAGE 28

28 effects of dieldrin on the LMB brain include changes i n the expression of genes involved in DNA repair mechanism, the inflammation pathway, oxidative stress and genes involved in steroid signaling (Martyniuk et al. 2010a; Martyniuk et al. 2010b) Although designed to be neurotoxins, both dieldrin and DDE also impair other DDE acts as an anti androgen (Kelce et al. 1995) and a weak estrogen (Chen et al. 1997; Frigo et al. 2002) and i t can activate the human ER in MCF 7 cells with approximately 1000 fold lower potency relative to E 2 (Chen et al. 1997) DDE (5.3 mg/g feed over 120 days) resulted in increase in vitellogenin and ER mRNA expression in the liver of the animals, an indicator of ER mediated activity (Garcia Reyero et al. 2006) The plasma steroid levels were also altered in these animals with the E 2 :11 ketotestosterone (11 KT) ratios modulated to the point where the males and females were not distinguishable. E 2 :11 KT ratios are usually high in reproductive females (above 1), and low in male fish (below 1) (Garcia Reyero et al. 2006) as t his ratio is imperative for proper reproduction. DDE, dieldrin also has the ability to bind and activate ERs in MCF 7 cells (Soto et al. 1995) but has very low affinity for the rainbow trout ER (rtE R) (Tollefsen et al. 2002) Estrogenic effects of dieldrin in fish were observed in female LMB fed 0.4 g/g (feed) and 0.8 g/g dieldrin over 120 days. In these animals, vitellogenin an established biomarker for e strogenic compounds, increased in the female livers but interestingly, in the male fish no increase of Vtg mRNA was observed. Moreover, the expression levels of the ERs were significantly reduced in male livers

PAGE 29

29 whereas an increase in these genes was observ ed in female fish (Garcia Reyero et al. 2006) Bisphenol A BPA is primarily used in the manufacture of polycarbonate plastics including reusable bottles, and epoxy resins which often coat the inside of food cans. D ue to its high demand in the manufacturing industry, BPA is produced in excess of 6 billion pounds/yr therefore making it a high production volume chemical (Burridge 2003) Human exposure to this compound is either through environmental exposure or dietary uptake (Mariscal Arcas et al. 2009) Eliminating packaged food from the diet has been shown to significantly red uce the amount of BPA metabolites (by approximately 65%) in the urine of people that changed their died from canned food to fresh, unpackaged foods (Rudel et al. 2011) Although an effort has been made to reduce BPA from packaging materials for foods available to people, such as the production of BPA free water bottles, BPA is ubiquitous in the aquatic environment (Crain et al. 2007) with concentrations varying from ~ 21 g/L in clean rivers to ~ 17.2 mg/L in landfill leachate (Yamamoto et al. 2001) BPA can exert multiple biological effects, including impacting the thyroid system by interacting with the thyroid receptor, (Sun et al. 2009; Freitas et al. 2011) a wide range of toxic effects on development (Stump et al. 2010; Xing et al. 2010) and proper function of the nervous system (Wang et al. 2011; X u et al. 2011) along with effects on the immune (Clayton et al. 2011) and on the endocrine system in mammals (Park et al. 2009; Roy et al. 2009; Talsness et al. 2009) as well as in fish species (Terrien et al. 2011) Since many reviews have focused on the endocrine effects of BPA on

PAGE 30

30 mamm alian model systems (Markey et al. 2002; Richter et al. 2007; Roy et al. 2009) this mini review will focus on the estrogenic effects of this compound in fish species. In wild fish, BPA accumulation has been found in the liver and muscle from a variety of species, including Mullet ( Mugil cephalus ), Salpa ( Sarpa salpa ), White Bream ( Diplodus sargus ), Bass ( Dicentrarchus labrax ), and Ombrine ( Umbrinacirrhosa ) (Mita et al. 2011) among others. Environmental BPA as part of a mixture of other estrogenic compounds is suspected to have contributed to intersex barbell (Barbus sp.) fish found in the tributaries of the river Po, Italy (Vigano et al. 2006) Laboratory studies using rainbow trout ( Onchorhynchus mykiss ) exposed to BPA in water (0.44 M) showed measurable levels of the compound in the plasma, liver and muscle as early as 2 h post exposure. Steady state was reached in the plasma, liver and muscle within 12 h of exposure, and the half life of BPA in the plasma was calculated to be 3.75 h (Lindholst et al 2001) A delayed estrogenic response to BPA was observed in rainbow trout injected with 35 mg/kg BPA with significant increase in plasma Vtg concentrations observed after 3 5 days of the injection in females and 5 7 days for males (Lindholst et al. 2001) Similarly, a dose dependent induction of Vtg mRNA was observed in the liver of male swordfish ( Xiphophorus helleriafter ) following a 3 day exposure to 0.4 10 ppm BPA (Kwak et al. 2001) Other fish species that showed increased Vtg levels after exposure to BPA include the common carp ( Cyprinus carpio ) (Mandich et al. 2007) sea bass (Correia et al. 2007) Japanese medaka ( Oryzias latipes ) (Chen et al. 2007) and fathead minnow (Brian et al. 2007) among others. Other than induction of Vtg BPA exposure has also resulted in altered mRNA expression of ERs Juvenile rare minnows ( Gobiocypris rarus) exposed for 3 days to

PAGE 31

31 different concentratio ns of BPA (0.1 10 M) showed an up regulation of ER mRNA, whereas no effect on ER 1 was observed, and a slight inhibition of ER 2 mRNA (Wang et al. 2011) An induction of Nile tilapia (nt) ER mRNA has also been observed in the tes tes of Nile tilapia males exposed to BPA (10 and 100 g/L) for 4 weeks (Huang et al. 2010) Overall th e data indicates that xenoestrogen s interact with ERs in an isoform specific manner, thus potentially having di fferent physiological effects in LMB. The downstream gene regulation affected by EDCs is likely dependent on the ER isoforms they bind and activate. Research Hypotheses The research hypotheses for this project are 1) that ER protein levels in liver and o vary are positively correlate to the mRNA levels during sexual maturation of the female LMB, 2) that d ifferences in the ligand binding domains of the LMB ERs will affect the binding affinity of ligands to the receptors 3 ) transcriptional activation of th e LMB receptors depends on the binding affinity of different ligands and 4 ) effects of EDCs on ER mediated expression of genes important for reproduction in the liver of LMB will be dependent on the ability of the compound to activate the receptors. In or der to test these hypothesis, t he main research objectives of this dissertation were: 1 ) to examine the natural gene and protein expression of the of the LMB ERs at different stages in the reproductive cycle in liver and gonads of female fish, 2) to charac terize the binding affinity and transactivation potential of model compounds for the LMB ERs, and 3) to study the effects of model environmental estrogens on ER regulated genes in vitro using a liver slice assay.

PAGE 32

32 Figure 1 1 Functional domains of the L MB ERs. The LMB ERs have five functional domains. The numbers above each domain indicates the number of amino acids. The numbers within each of the domains indicates the percent identity to respective domains of the LMB ER

PAGE 33

33 Figure 1 2 Chemical structures of the model compounds that can bind and activate LMB ERs

PAGE 34

34 Figure 1 3 Estrogen receptor mediated protein synthesis. Diagram illustrates the various processes (e.g. receptor binding, transcription, translation) by which endocrine disrupting compounds can influence protein synthesis.

PAGE 35

35 CHAPTER 2 MATERIALS AND METHOD S Animals LMB Collection and S ampling LMB females were collected between October 2005 and September 2006 from the month, with sampling times ranging between 3 5 weeks, as previously described by (Sepulveda et al. 2002) The fish were captured each month by electro shocking and then euthanized using a blow to the head. The bo dy weight, body length, gonad weight and age were recorded, and the gonados o matic index for these individuals was calculated as: (gonad weight/body weight) x 100. Gonad samples and other tissues were collected and snap frozen in liquid n itrogen, then stor ed at 80 o C until processing, four fish for liver, and three for gonads from each stage were rando ml y chosen for protein and RNA analysis. Gonad samples were placed in buffered formalin for histological analysis of ovarian development. Laboratory LMB The LMB used for the liver slice experiments were purchased from American Sport Fish Hatchery (Montgomery, AL). The fish were housed in the Aquatic Facility at the Center for Environmental and Human Toxicology (University of Florida) in accordance with the N ational Institute for Health (NIH) Guide for the Care and Use of Laboratory Animals.

PAGE 36

36 Methods RNA E xtraction LMB ovaries or liver (30 50 mg) were homogenized on ice using a tissue homogenizer (IKA Works, Inc., Wilmington, NC, USA), and total RNA was extract ed using STAT (Teltest, Friendswood, TX, USA) as previously described (Garcia Reyero et al. 2006) RNA was resuspended in 25 L Austin, TX, USA). In order to remove any DNA contamination, the RNA was treated with DNA free instructions. The RNA concentration in each sample was determined on a NanoDrop ND 1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE). RNA was stored at 80 C until further use. Real time PCR (qPCR) First strand cDNA synthesis was perfor med using 1 g RNA which was isolated and treated as described above. The primer sets used to amplify all the genes in this study are listed in Table 2 1 The LMB ER primers are specific for each ER isoform (Sabo A ttwood et al. 2004) Standard curves were generated using a pGEM T Easy vector (Sigma Aldrich, St. Louis, MO, USA) containing the gene of interest as a template. The gene fragments used for 18S rRNA (60 bp) (Blum et al. 2008) ER (71 bp) ER a (84 bp) and ER b (96 bp) mRNA were previously published (Sabo Attwood et al. 2004) The Vtg fragment (233 bp),(Figure 2 1A) used for the qPCR standard curves were cloned from purified LMB cDNA using primers designed using Primer3 based on the LMB Vtg sequence previously published (Bowman and Denslow 1999) The primers used to clone the Zrp gene fragment (246 bp) (Figure 2 1B) were developed from 454 derived cDNA sequences (ICBR UF), using Primer 3. The products were

PAGE 37

37 cloned in the pGEM T Easy vector and transformed into Invitrogen One shot Top10 chemical ly competent E. coli cloned Vtg and Zrp fragments were confirmed by Sanger sequencing at ICBR. The equation used to calculated copy number of plasmid was {6 X 10 23 (copies/mol) X [plasmid concentration ] (g/L)} / molecular weight of the plasmid (g/mol) = copies/L. The standard curves ranged from 1 x 10 2 to 1 x 10 8 copies, and with efficiencies of 95 100%, and R 2 >0.98. R eal time PCR for each gene of interest was performed in duplicate for each sample u sing an iClycler Thermal Cycler (Bio Rad) as previously described by (Martyniuk et al. 2009) using 100 ng of first strand cDNA obtained from DNase treated RNA and 1 L of 10 mM dNTPs and 1X iQ SYBR Green Supermix (Bio Rad, Hercules, CA). A two step the rmal cycling parameter was used with 1Taq polymerase activation at 95 o C for 3 min, followed by 40 cycles of 95 o C for 15 s and 60 o C for 1 min. A dissociation curve was obtained after the 40 cycles, which started at 55 o C (+1 o C/30 s) up and increased to 95 o C. All gene expression values are reported as absolute copy number per g total RNA, using the standard curves described above and the values were normalized to ribosomal 18S. The seasonal female gonad data was calculated as gene expression relative to the cortical alveoli stage because the 18S RNA was variable, and therefore could not be used to standardize the mRNA levels. Antibody S ynthesis Amplification of ER hinge regions PCR amplification for cloning the ER hinge regions was done with 100 ng fu ll length ER template MilliQ L 50 mM

PAGE 38

38 MgCl 2 1 L 10 mM dNTPs, 2 L of 10 mM forward and reverse primers, and 0.2 L of 1U Taq DNA polymerase (Invitrogen, Carlsbad, CA). Init ial denaturation occurred at 95 C for 4 min follo wed by 35 cycles at 95 C for 30 s 56 C for 30 s, a nd 72 C for 1 min. Amplicons were visualized on an ethidium bromide 1% agarose gel and ligated directly into a pET100D TOPO expression vector (Invitrogen CA, USA ) Expression of r ecombinant ER hinge p roteins The LMB ER hinge domain, located between the ligand binding domain and DNA binding domain, has 10 35% identity in the amino acid sequence when compared across isoforms Due to the low sequence similarity between isoforms, the ER hinge domain was used to produce antigens for isoform specific antibodies. The hinge regions for each isoform were previously amplified by PCR using the primers listed in Table 2 1. The PCR products were cloned into the pET100D expression vector (Invitrogen CA, USA ) whi ch adds an N terminal 6X His tag. This was followed by transformation of the plasmid into Rosetta gammi Escherichia coli strain ( Strat a gene CA, USA ), which contain tRNA genes for codons necessary for eukaryotic protein expression. Following sequence con firmation, E.coli was grown in Luria Broth (LB) medium containing 100 g/ mL ampicillin, at 37 o C until the OD 600 was 0.7 0.8. Protein expression was induced using isopropyl B D 1 thiog alactopyranoside (IPTG) for 8 h at room temperature. The cultures (1L t otal ) were centrifuged and the bacter ial pellet was then lysed by sonication in lysis buffer (phosphate buffered saline (PBS) solution containing 1mg/mL lysozyme, 300 mM NaCl, and 20 mM imidazole, pH 8.2) and protein synthesis was assessed by separation on a 4 13% Tris Glycine gel (Invitrogen CA, USA ) followed by Coomassie Brilliant Blue (CBB) staining. The expressed proteins are

PAGE 39

39 referred to as ER Hinge, ER bHinge and ER aHinge. The His tagged proteins were then purified under native conditions from the cell lysate using nickel nitrotriacetic acid (Ni NTA) (Qiagen, CA, USA) affinity chromatography according to the manufa c instructions. In order to bind the proteins to the column, the soluble protein suspension was incubated with the Ni NTA (Qiagen) resin for 60 min with gentle shaking. The protocol. The pu rified protein solutions were concentrated using a Centricon 10 filtering device (Millipore MA, USA ), and the concentrated protein was separated on a 4 13% Tris Glycine gel (Invitrogen) followed by Colloidal Blue staining (BioRad, CA, USA) Verification of recombinant proteins by MS/MS Samples eluted from the Ni NTA purification scheme were run on a 4 12% Bis Tris gel. Proteins were resuspended in 150 L 1% SDS in 0.1 M Tris buffer to concentrate material. Protein was measured using a Bradford protein as say. Proteins were initially denatured with 2 mercaptoethanol at 70 C for 5 min before gel separation on a NuPAGE 4 12% Bis Tris SDS PAGE gel (Invitrogen) at 200 V for 30 min. The gel was stained overnight ( ~ 16 h) with Colloidal Blue ( BioRad, CA, USA ) as per the manufacture Gels were destained in ddH 2 O for an additional 16 h. To verify expressed protein, appropriate sized bands ( ~16 kDa) were excised from the gel and prepared for MS analysis. Gel slices were cut into small pieces of appro ximately 1 mm 2 and washed once with 100 L of 25 mM NH 4 HCO 3 (ABC). One hundred microliters of 25 mM ABC/50% ACN was added to the gel slices after removing the initial ABC wash and slices were vortex for 10 min. The supernatant was removed

PAGE 40

40 and discard ed Gel slices were then treated with a second 100 L of 25 mM ABC/50% ACN, vortexed, and the supernatant removed. Gel pieces were dried using a Speed Vac for 20 min or until gel pieces were completely dried. Reduction and alkylation of proteins were done b y first adding 25 L of 10 mM DTT in 25 mM ABC to the dried gel slices. Gel slices were vortexed and spun briefly. Reduction of prot eins proceeded at 56 C for 1 h After incubation, supernatant was removed and alkylation was achieved by adding 25 L of 55 mM iodoacetamide to the gel pieces. Slices were vortexed, spun briefly, and the reaction allowed to proceed for 45 min at room temperature in the dark. Supernatant was discarded and gel slices washed with 100 L ABC. Slices were vortexed, spun, and supernatant discard. Gel pieces were dehydrated with 100 L of 25 mM ABC/ 50% ACN, vortexed, and briefly spun. This was repeated for a second time before drying the gel pieces to completeness in a Speed Vac for 20 min. Approximately 20 30 L of 12.5 ng/ L proteomics grade trypsin in 25 mM ABC (enough to cover the gel slices) was added to the dried gel slices. Gel slices were put briefly on ice for 10 min. to rehydrate samples. Gel slices were spun briefly and incubated at 37 C overnight. The followin g day, supernatant was collected and transferred to a clean sterile tube. Gel slices were covered with approximately 30 L of 50% ACN/5% formic acid, vortexed for 20 min, spun, sonicated for 10 min, and the supernatant was collected. This was repeated a second time to collect remaining tryptic peptides. The mass spectrometric analysis, samples were cleaned up through a C18 ZipTip column (Millipore MA, USA ) following the pr otocol of the supplier.

PAGE 41

41 MS/MS analysis and protein identification was done by the protein core (ICBR UF). Proteins were identified using the Protein Search Algorithm: Tandem mass spectra were extracted by ABI Analyst version 2.0. All MS/MS samples were analyzed using Mascot (Matrix Science, London, UK; version 2.2.2). Mascot was set up to search NCBI_20100312 with taxonomy Bony Vert e brate database (1086802 entries) assuming the digestion enzyme trypsin. Mascot searched with a fragment ion mass toleranc e of 0.50 Da and a parent ion tolerance of 0.50 Da. Iodoacetamide derivative of Cys, deamidation of Asn and Gln, oxidation of Met, are specified in Mascot as variable modifications. Scaffold (version Scaffold 02 03 01, Proteome Software Inc., Portland, O R) was used to validate MS/MS based peptide and protein identifications. Peptide identifications were accepted if they could be established at greater than 95.0% probability as specified by the Peptide Prophet algorithm (Keller et al. 2002) Protein identifications were accepted if they can be established at gr eater than 99.0% probability and contain ed at least 2 identified unique peptides. Protein probabilities were assigned by the Protein Prophet algorithm (Nesvizhskii et al. 2003) Antibody p roduction The antigens used for ER and ER a antibodies were polypeptides (Figure 3 1) synthesized by the ICBR protein core. The ER b antibody was made using the recombinant ER b hinge region expressed as previously described (Figure 3 1 ). All antigens were sent to Cocalico Biologicals (P A, USA) to immunize and then boost rabbits for antibody production. All the antibodies were column purified from the serum prior to use as described below.

PAGE 42

42 Column purification of antibodies from s erum The antibodies were affinity purified from the plasm a using the recombinant hinge proteins. The recombinant ER and ER a hinge regions were irreversibly bound to recombinant ER b hinge protein was irreversibly immobilized on an AminoLink ructions. Following coupling of the recombinant hinge regions to their respective columns, the antibodies were purified by gravity the column was equilibrated at room temperature and washed with 6 mL of Phosphate Buffered Saline (PBS), followed by the addition of 2 mL of sera pre mixed with 2 mL of PBS and the column was incubated at room temperature for 1.5 h. Following incubation, the column was washed with 12 mL of PBS containing 0.05% Tween. Protein elution was done using 8 mL of glycine buffer (100 mM, pH 2.5). 1 mL fractions were collected in tubes containing 100 L of 1M Tris, pH 7.5 in order to neutralize the proteins. Elution of proteins was monitored by abso rbance at 280 nm. The purified antibodies were stored in one use aliquots at 80 o C until ready to use, to prevent repeated freeze thaw cycles. Western Blots Tissue p reparation Whole tissue h omogenate Ice cold Tris (pH7.5) buffer solution (100 L) cont aining 1X Protease inhibitor cocktail (Sigma) was used to homogenize the tissues. The total protein content in the homogenate was then quantified using the Coomassie standard solut ion (Sigma). Absorbance was read at 562 nm using SOFTmaxPRO

PAGE 43

43 microplate reader (Molecular Devices, CA). The homogenate was diluted to 2.0 g/L total protein concentration using 1X NuPAGE LDS sample buffer (Invitrogen), then samples were heated at 90 o C for 5 min (then stored at 20 o C until ready for use). Preparation of nuclear e xtracts Nuclear extracts were obtained from approximately 30 mg LMB ovarian tissue using the Nuclear Extract kit (Active Motif, Carlsbad, CA, USA) according to the manufactur tissue was pulverized using a cold mortar and pestle with the base submerged in liquid nitrogen, followed by homogenization with a dounce homogenizer until single cell slurry was visible under the microscope. The ce lls were lysed using 1X Stock Hypotonic Buffer and incubated on ice for 15 minutes. The nuclei were pelleted by centrifugation at 14,000 x g for 30 s at 4 o C. The pellets were resuspended in 100 L of the Complete Lysis Buffer and centrifuged at 14,000 x g for 10 min at 4 o C. The supernatants were saved as the soluble nuclear fraction. The protein concentration was measured in the albumin as protein standard solution (Sigma). W es tern blot d etection of ER ER a ER b Actin and Histone3 Whole cell homogenate (40 g total protein) or nuclear extracts ( 20 g total protein) were separated using a gradient 4 12% NuPAGE Bis Tris Gel (Invitrogen) and transferred onto a PVDF membrane (Invitrogen) using a semi dry electrophoretic transfer apparatus (BioRad) using Tris glycine buffer ( 25 mM Tris, 192 mM glycine, 20% methanol). Following transfer, the non specific sites were blocked (1 h) with 5% (w/v) skim milk in TBS T (2 mM Tris, 30 mM NaCl, 0.01% Tween 20 pH. 7.5). The membranes were incubated with primary antibodies in TBS T (pH 7.5) overnight at 4 o C with the respective polyclonal primary antibodies : anti Actin (1:1000 dilution) anti

PAGE 44

44 Histone 3 (1:1000 dilution) (Sigma), biotinyla ted anti human ER (Abcam) (the antibody was biotinylated using a biotin labeling kit, Dojindo Molecular Technologies Inc.) (1:1000 dilution) and the anti L MB ER (0.11 mg/ mL )] (1 :500 dilution) anti LMB ER b (0.14 mg/mL) (1:500 dilution) and ER a (0.08 m g/mL) (1:500 dilution) After washing, the blots were incubated for 1h at room temperature with horseradish peroxidase conjugated secondary antibody (1:3000 dilution) (GE Hea l thcare) or with (1:5000) Avidin HRP (Abcam) for the biotinylated ER primary Im munoreactive bands were detected using Western blot luminol reagent (Santa Cruz Biotechnology, CA, USA) and imaged using the Chemi Doc XRS (BioRad) up to 15 min capture time Band intensity was quantified using the QuantiOne software (BioRad). Immunopreci p itation U sing LMB ERs Nuclear fractions were obtained from ovary samples (cortical alveoli stage) as previously described, and were denatured by heating at 65 o C for 5 min. Protein G magnetic beads Dynabeads (Invitrogen) or Strepavi di n linked beads (Dy nabeads MyOne Strepavidin T1 (Invitrogen)) were used and the proteins were Dynabeads were first blocked in order to minimize non specific binding of proteins. This was done by taking 200 L of the Dynabeads, pulling it down with a magnet and then resuspending it in 400 L of 5% BSA in 25 mM Tris (pH 7.5) to make 50% Dynabead slurry. The slurry was incubated on a rocker at 4 o C for 2 h. The isolated nuclear fraction at a conce ntration of 1 mg/mL in a total volume of 1 mL was then pre cleared using 50 L of the 50% Protein G slurry, and incubated on a rocker for 1h at 4 o C. The pre cleared nuclear fraction was then centrifuged at maximum speed for 20 s to pellet

PAGE 45

45 the Protein G, and the supernatant was transferred to a clean tube. For the immunoprecipitation reactions, 5 g of antibody (anti LMB ER a, anti LMB ER b, biotinylated anti human ER or anti actin (negative control)) was added to different tubes containing the pre clear ed nuclear fraction or tris buffer (negative control). The antibody nuclear fraction mixture was incubated overnight at 4 o C with constant rocking. Following incubation with the respective antibodies, 60 L of bead suspension was added and samples were i ncubated for 1h at 4 o C. Protein G beads were used to bind the anti LMB ER a and anit LMB ER b antibody complex, and the strepavidin beads were used to bind the biotinylated anti human ER. Immunoprecipitated complexes were collected by magnetic pull down of the beads, and washed three times with 1 mL RIPA buffer. Antibody prot ein complexes bound to the the Protein G beads were re suspended in 30 L Laemmli sample buffer (Invitrogen). Antibody protein complexes bound to the Dynabeads MyOne Strepavidin T1 glycine buffer (100 mM, pH 2.5) in order to break the antibody protein bonds, without breaking the biotin strepavidin bond. The eluted proteins were added to 4X Laemmli sample buffer immediately to neutralize the solution. Once in Laemmli loading buffer the samples were heated 5 min at 95 o C. Sam ples were centrifuged at 12,000 x g for 30 s, and supernatants were collected. Equal volume of immunoprecipitated proteins were run on 4 12% NuPAGE Bis Tris Gel and transferred onto PVDF membrane. The proteins that were immunoprecipitated using the anti LMB ER a and anti LMB ER b antibodies were detected using biotinylated anti human ER and the proteins immunoprecipitated using the biotinylated anti LMB ER a and anti LMB ER b were detected using the biotinylated anti human ER as described before.

PAGE 46

46 Culturing of HepG2 Cells HepG2 cells obtained from the American Type Culture Collection (ATCC, USA) were cultured in phenol red supplemented with 1% antibiotic/antimycotic (Sigma), 1 mM sodium pyruvate (Hyclone), 2 mM L glutamine (Sigma) and 10% fetal bovine serum (FBS)(Hyclone) and maintained in a humidified incubator at 37 o C with 5% CO 2 The cells were grown in 100 mm culture plates (Corning) and they were passaged once a week. Transient Transfection Assays in HepG 2 Cells For the transfection assays, the cells were plated at a density of 100,000 cells/well in 500 L culture medium. The cells were allowed to recover for 24 h and then were f 0.3 L Xfect polymer per 1 g of plasmid DNA, in a total volume of 50 L Xfect Reaction The plasmid DNA (previously purified using GenElute HP pla s mid maxiprep kit, Sigma) was added to the Xfect reag ent in the following amounts: 0. 5 g of the ER expression vector plus 1 g of either 2x ERE luciferase (Blum et al. 2008) or 3x ERE luciferase (Addgene) and 0.002 g of pRL TK renilla (Promega, Corp., WI, USA ) which was used as a transfection control. The tran s fection reaction was allowed to proceed for 16 h after which the transfection medium was removed and replaced with 500 L of charcoal stripped FBS medium containing the respective treatments or vehicle (ethano l) not exceeding 0.1% (for single chemical) or 0.2% (for double chemical exposure). The cells were exposed to the treatments for 48 h after which Firefly and Renilla luciferase were measured.

PAGE 47

47 Luciferase Measurements Following the 48 h incubation of the He pG2 cells with vehicle or treatment, the medium was removed and the cells were rinsed with 200 L of PBS buffer (137mM NaCl, 2.68 mM KCl, 8.1mM Na 2 HPO 4 and 1.47 mM KH 2 PO 4 pH 7.4). The cells in each well were lysed using 100 L of 1 X passive lysis buffer (Promega Corp., WI, USA) per well. To facilitate the lysis, the plates were placed at room temperature, on a shaking platform and allowed to shake for 20 30 min at approximately 50 rpm, after which the lysates were transferred to 1.5 mL microcentrifuge tu bes and centrifuged at 10,000 x g for 1 min to pellet cell debris, transferred to new tubes and frozen until ready for analysis. The luciferase activity was measured using the Dual Luciferase Kit (Promega Corp., WI, USA) and the 96 well plates were read on a PerkinElmer 1450LSC & Lumines cence counter MicroBeta JET. To each well of a 96 well plate, 20 L of lysate was added followed by 50 L of the Firefly Luciferase Reagent and t he activity in each well was read The Firefly luciferase signal was quenched by the addition of 50 L of St op & Glo Substrate and the Renilla luciferase activity was read and used as the transfection control. The ratio of Firefly luciferase/ Renilla luciferase was used to generate the relative luciferase units (RLU). The respons e to treatment was calculated as percent change from ethanol control values. Binding A ssays Sub cloning of LMB ERs into pVL 1393 vector LMB genes were sub cloned into the baculovirus trans fer plasmid pVL1393 (Invitrogen, Grand Island, NY, USA ). Full leng th ER and ER b were amplified using primers listed in Table 2 1, and full length ER and ER b template in pcDNA3.1

PAGE 48

4 8 (Invitrogen, CA, USA) and ligated into pCR Blunt II TOPO vector (Invitrogen, CA, USA). The ER sequences were confirmed by Sanger Sequencing pe rformed by the ICBR protein core. ER and ER b were cut from the pCR Blunt II TOPO vector using EcoRI (NEB, MA, USA) restriction digest, and column purified. The pVL 1393 was also digested using the EcoRI restriction enzyme, followed by column purifica tion. The ERs were subsequently ligated into the linear pVL 1393 vector using T4 DNA Ligase (NEB, MA, USA). Full length ER a was subcloned into the pVL1393 vector by GeneScript (NJ, USA). ER a was cut from pcDNA3.1 vector using BamHI and NotI restrictio n sites, and ligated into the pVL 1393 vector linearized using the same restriction enzymes. pVL1393 containing the LMB ER and LMB ER b were transfected into Sf21 cells along with AcV EPA DNA in collaboration with EPA (Durham, NC) (Hartig and Cardon 1992; O'Reilly et al. 1992) Baculovirus clones AcVLMBERa (Large Mouth Bass Alpha), and AcVLMBb b ( Large /mouth Bass Beta B ) were selected based on PIB minus phenotype and isolated. These baculovirus constructs expr ess the estrogen receptor gene under control of the polyhedrin promoter. Receptor p roduction Receptor production and binding assays were done in collaboration with Dr. Phillip Hartig, Mary Cardon and Dr. Vicky Wilson (EPA). General insect cell culture and baculovirus manipulation techniques used to express proteins are described in detail elsewhere (Summers and Smith 1987; O'Reilly et al. 1992) Receptors for assa ys were produced in 50 mL suspension cultures. Sf21 cells were infected at a multiplicity of infection of one, incubated 72 h at a cell density of 1 x10 6 / mL and centrifuged at 700 x

PAGE 49

49 g 10 mi n. The pellet was suspended in 50 mL of high salt TEDG buffer (40 0 mM KCl, 10 mM Tris, 10% glycerol, 1 mM sodium molybdate, 1.5 mM EDTA, 1 mM PMSF, and 1 mM DTT) (Wilson et al. 2002) freeze thawed on ice 3 times, clarified by centrifugation (12,000 x g at 4 C for 30 m in) and frozen at 80 C until used. Receptor concentration For each new batch of receptor produced, we determined the optimum amount of receptor to use in binding assays. The receptor concentration used was based on cell s number per assay well and was cal culated to be 1250 cells for E and 625 cell for ER b. The optimum receptor concentration was judged as one that resulted in an acceptable level of ligand depletion (< 10%) To find the optimum receptor concentration, range finding experiments were condu cted. Total and non specific binding were measured in wells containing serially diluted insect cell lysate corresponding to decreasing receptor concentrations. Insect cell lysate containing receptor was diluted in TEDG buffer with 10mg/ mL BSA. Total bin ding wells contained [ 3 H] E 2 while non specific binding wells contained [ 3 H] E 2 with 100 fold molar excess of unlabeled E 2 Saturation and c ompetitive binding All components were kept on ice or at 4C during binding experiments. Binding assays were per formed in 96 well round bottomed plates. To measure saturation binding, diluted receptor preparations were incubated in triplicate wells with increasing concentrations of [ 3 H] E 2 ( 0.08, 0.1, 0.3, 0.6, 1, 2, 3, 4.5nM ) either alone or with 100 fold molar ex cess unlabeled E 2 The competitive binding experiments used triplicate wells of 1 nM [ 3 H ] E 2 with eight increasing concentrations each of DPN, PPT, Dieldrin, BPA,

PAGE 50

50 DDE and ICI 182,780, and each plate also contained three replicate wells of total bindin g and non specific binding with 1nM of [ 3 H ] E 2 and 100 fold molar excess unlabeled E 2 The first addit ion to the wells consisted of 50 L TEDG buffer with 10 mg/ mL BSA and 0.7% ETOH in the t otal binding wells, 5 L 200 nM (2 fold final volume) E 2 in the n o n specific binding wells, and 50 L of 2 fold concentrated chemical solutions in TEDG buffer with 10 mg/ mL BSA in the competitive binding wells. The n ext addition to all wells was 25 L of 4 nM (4 fold final volume) [ 3 H] E 2 followed by gentle shaking for 5min. The fi nal addition to all wells was 25 L diluted receptor re sulting in a total volume of 100 L per well. Plates were incubated with gentle shaking overnight at 4 o C. The following day, 50 L of 5% dextran coated charcoal in TEDG buffer with 10 m g/ mL BSA was added to each wel l followed by shaking for 10min and centrifugation at 1000 x g for 5min. Finally, 50 L aliquots of supernatant were transferred to scintillation vials and radioactivity was measured on a Beckman LS 5000TD (Irvine, CA) scinti llation counter. Competitive binding assays were repeated a minimum of three times. Slice p reparation The liver slice preparation has been adapted based on the protocol described by (Schmieder et al. 2000) Male LMB were irreversibly anesthetized with tricane methane sulphonate (MS 222), after which the fish abdomen was opened to remove the liver. The liver was excised carefully as to avoid puncturing the gall bladder, and was placed in sterile ice cold balanced salt solution lacking Ca + and Mg + containing 1X antibiotic antimycotic (ABAM) (Sig ma) (pH 7.8) The liver was cannulated via the hepatic veins and perfused with the ice the red blood cells. Due to time constrains, this perfusion was not performed for the fish fed with Dieldrin. Within ap proximately 10min from the time of their removal, the l ivers

PAGE 51

51 were cored using a n 8mm stainless steel hand held corer (Vitron Inc. AZ, USA) and the cores were immediately placed into the chilled (4 o C) Brendel/Vitron (Vitorn Inc. AZ, USA) containing sterile slicing buffer he cores were cut using the Brendel/Vitron slicer into 1 3 19 mg slices which was previously determined to give a thickness of 200 250 m Slices were loaded one per well in 24 well sterile polystyrene plates ( Corning Inc. NY) c ontaining 500 L incubation media (phenol red free L 15 media + 10% charcoal stripped FBS + antibiotic/antimycotic), and pre incubated on an orbital shaker (90 rpm) in an 21 o C incubator for 1h in order to equilibrate the tissues to the media. After the 1h pre incubation, the media was changed either with fresh incubation media or with treatment containing incubation media. The liver slices were incubated on an orbital shaker (90 rpm) at 21 o C for up to 48 h. Full media change was done after 24 h of incuba tion. The time course experiment was done using triplicate slices for each time point, in two independent experiments. The E 2 DDE and dieldrin exposures were done in duplicate slices in three independent experiments. Viability Assay Viability o f the HepG2 cells treated with E 2 DDE was measured using Alamar Blue (Invitrogen, CA, USA). A 100 L aliquot of HepG2 cells were plated in 96 well cell culture plates at a density of 1.0 X 10 5 cells/mL, allowed to ad here overnight and then incubated with increasing concentrations of either E 2 DDE at 37 o C. After 48 h of continuous exposure, 10 L of 10X ready use Alamar Blue was added to the culture media, and incubated at 37 o C for an additional 2 h. The resulting fluorescence was measured after

PAGE 52

52 2 h incubation using an Fmax plate reader (Molecular Devices, CA, USA) with an excitation wavelength of 570 nm and an emission wavelength of 580 nm. Histology Gonad and liver slice ti ssues samples were stored in 10% buffered formalin (Protocol Fisher Scientific, MI, USA) until they were ready for processing. In order to determine the reproductive stage of the animals, gonad samples were placed in buffered formalin (Portocol Fisher Sci e ntific, Waltham, MA, USA), then plastic embedded and cut into 5 10 micron thick sections. For histological analysis, the ovaries were stained using hematoxylin (basophilic dye) and eosin (acidophilic dye) staining protocols. The histological samples w ere analyzed and the individual fish were divided into six distinct stages, based on the development of the ovaries: perinuclear (PN), cortical alveoli (CA), early vitellogenic (EV), late vitellogenic (LV), early maturation (EM) and late maturation (LM) as previously described (Martyniuk et al. 2009) Animals in the CA, LV and LM stages were chosen for analysis Statistical Analysis Wild LMB data Data obtained in the wild LMB seasonal studies were tested using a one way ANOVA followed by Duncan post hoc pairwise multiple comparisons using log transformed expression data (XLSTAT 2011) to determine statistical differences between individual stages. Differences were considered significant with a p value < 0.05. Cell culture e xperiments For all cell culture based experiments, each firefly luciferase activity value was normalized to its corresponding renilla luciferase value by calculating the ratio of unit

PAGE 53

53 firefly luciferase per unit of renilla luciferase. The normalized vehicle means were calculated and ea ch normalized firefly luciferase value was divided by the mean vehicle to give fold change in activity response within a given experiment. Data are represented as means SEM from at least three individual experiments Sigmoidal dose response curves and EC 50 values were generated using GraphPad Prism5 (La Jolla, CA), for individual experiments. The differences in EC 50 values between treatments were analyzed by ANOVA, followed by Newman Keuls (SNK) post hoc pairwise multiple comparison. Differences were considered significant with a p value < 0.05. Binding assays Saturation binding data were analyzed using the Kell Ligand software version 6.0.12 (Biosoft, Cambridge, UK), which provides K d and B max estimates through non linear iterative curve fitting proce dures. Competiti ve binding data were graphed and fit with the one site competition function and the K i was calculated using (GraphPad Prizm version 5, San Diego, CA). To detect significant differences in K d and K i values for the various recept ors, the v alues were calculated for each experiment, and differences were analyzed using one way ANOVA, followed by SNK pairwise mul tiple comparison procedures using SigmaStat (Systat Software Inc, San Jose, CA). Liver slice experiments The qPCR data from the time course experi ment in the liver slice assay were analyzed using mixed model ANOVA, with the test compound and time as the fixed variables, and fish as the random variable. This was followed by post multiple comparisons, and was performed on log transformed gene expression data. All analyses were performed using SAS 4.3 statistical software (NC, USA).

PAGE 54

54 The qPCR data on the effects of E 2 DDE and dieldrin in liver slices w ere analyzed using mixed model ANOVA, with the test compound as the fixed variable, and fish as the random variable. This was followed by post comparisons, and was performed on log transformed gene expression data. All analyses were performed using SAS 4.3 statistical software (NC, USA). The qPC R data on the effects of dieldrin treatment on E 2 induced effects in the liver slices were analyzed using a nested mixed model ANOVA. The E 2 treatments were nested within the control fish or dieldrin fed fish treatment groups. E 2 was assigned as a fixed variable, whereas fish were assigned to be random variables. This was followed by post transformed gene expression data. All analyses were performed using SAS 4.3 statistical software (NC, USA)

PAGE 55

55 Table 2 1. List of primer sequences used for qPCR analysis of LMB mRNA expression Gene Forward Primer Reverse Primer Conc (nM) 18S CGGCTACCACATCCAAGGAA TCCATCACTGCTTTTTATTGTTATGTCC 400 ER CGACGTGCTGGAACCAATGACAGAG ACCTCCTCCTTTTAGTAGT CACTGGCCT 400 ER a GTGACCCGTCTGTCCACA AGAGGACGTGATCGGGGTCT 200 ER b CCGACACCGCCGTGGTGGACTC AACTCCGAGGGGAACGGGGCGA 200 Vtg CAGGTTTTGGCTCAGGATTG TCTGTCTCACTCTACCCGCA 400 Zrp CTGATACAACACGCCAATCC ACCACACGACATCCATTTACGA 400

PAGE 56

56 Table 2 2 List of primer sequences used for sub cloning the ER hinge and full length sequences Gene Forward Primer Reverse Primer ER Hinge CACCGCTGGAACCAATGACAGAGAC TGTGGCTCCAGTGGTATTACACT ER a Hinge CACCCGTGGGAACTGCAGGAAC ACTACAGCGAGTGGTTGGAA ACT ER b Hinge CACCTATCGAGGAGCCCGACAC CCTGTACTTCTTCGGGAAGACT ER Full length CACCATGGGTAAGAGGCAGA CTGACGTGGGTGTAGGATACT ER a Full length CACCATGGCTGGTGCCT CTTTGACGGAATGACCCCACT ER b Full length CACCATGGCCTCCTCCC CACCTCCACTTGGCGTCACT

PAGE 57

57 Figure 2 1 cDNA sequences of LMB Vtg and Zrp used for qPCR standard curves. Vtg (A) and Zrp (B) sequences in pGET Easy vector used for creating standard curves for qPCR. Bold text highlighted by the boxes are the sequences of the forward and rever se primers for real time PCR.

PAGE 58

58 CHAPTER 3 VARIATION OF THE TRANSCRIPT AND PROTEIN LEVELS OF THE LARGEMOUTH BASS ESTROGEN RECEPTOR ISOFORMS Background In vertebrates, the genomic action of the sex steroid 17 estradiol (E 2 ) is mediated through estrogen receptors (ERs) (Auchus and Fuqua 1994) The ERs are transcription factors which dimerize upon binding a ligand and form complexes with co factors to regulate the transcription of E 2 responsive genes (Green and Carroll 2007) The ERs are part of the superfamily of st eroid receptors (Thornton 2001) and, similar to other steroid receptors are comprised of five functional domains (A to F) (Kumar et al. 1987; Huang et al. 2010) The A/B domain (AF 1) is involved in ligand independent transcriptional regulation (El Tanani and Green 1997) The C domain is the DNA binding region, and the E domain is the ligand binding domain The DNA and ligand binding domains of ERs are highly conserved across species as well as ER isoforms, with over 80% ide ntity between their amino acid sequences (Tan et al. 1996; Sabo Attwood et al. 2004) The region between the DNA and ligand binding domains, termed the D domain, also known as the hinge region is one of the least conserved areas Therefore, it can be used to design specific tools such as antibodies, which can distinguish the receptor isoforms In teleost fishes including the largemouth bass (LMB), three ER isoforms have been reported ER ER b and ER a. Phylogenetic analysis of the receptor sequence suggests that the ER a (previously designated ER ) is the result of duplication of the ER gene, and may have occurred through a genome wide duplication event (Hawkins et al., 2000). Recent ly a fourth ER (designated ER 2) has been identified in rainbow

PAGE 59

59 trout ( Oncorhynchus mykiss ) ( Nagler et al. 2007). The ER 2 has been shown to group phylogen e tically with the trout ER 1 and is closely related to the ER isoform from other Salmonidae member s ( Nagler et al. 2007). ER mRNA expression ha s been observed to differ among species, and is dependent on the sex of the animal, tissues and reproductive stage (Sabo Attwood et al. 2004; Martyniuk et al. 2009; Huan g et al. 2010) The LMB reproductive cycle can be characterized based on several sequential stages in oocyte development (Grier et al. 2009; Martyniuk et al. 2009; Uribe and Grier 2011) The initial stage of gona dal development in fish is the primary growth phase which is defined by formation of primary oocytes. This is followed by the secondary growth phase which involves uptake of the hepatic egg yolk precursor protein, vitellogenin (Vtg). Vtg from the liver i s transported via the blood to the ovaries, where it is taken up during secondary growth. Maturation of the eggs takes place once Vtg is incorporated into the oocytes (Patino and Sullivan 2002) In Florida populat ions of LMB primary ovarian growth occurs in the fall and corresponds to low levels of plasma E 2 T he reproductive cycle ends in late spring, at the peak of plasma E 2 levels (Sabo Attwood et al. 2004; Martyniuk et a l. 2009) During this cycle, ER isoform transcript levels have been shown to vary in the liver and gonad of pond reared LMB females. The highest levels of ER mRNA in female LMB are expressed in the liver and increase with the progression of the reproductive cycle. In contrast, the ovaries express higher levels of ER a and ER b during the fall, when plasma E 2 is low (Sa bo Attwood et al. 2004) The objectives of the present study were to characterize ER protein s in the liver and ovary at three well defined reproductive stages: cortical alveoli (primary growth

PAGE 60

60 phase), late vitellogenesis and late maturation (secondary gr owth phases). To do this, I needed to develop ER isoform specific antibodies for the largemouth bass ERs To produce isoform specific antibodies, two strategies were employed. The first strategy was to design a polypeptide based on the least conserved r egion of the ERs, and use it as an isoform specific antigen. The second strategy was to express larger antigens to increase reactivity in host rabbits by expressing recombinant proteins for the hinge region of each of the ER isoforms (Figure 3 1). The hi nge domain is between the DNA and LBD and shows 13% identity between ER and ER a, 20% identity between ER and ER b and 28% identity between the two ER s. In addition, I compare d mRNA levels to protein levels in liver and ovary and hypothesized that changes in mRNA levels during sexual maturation are positively correlated t o ER isoform protein levels in each tissue. Results The Antibodies Recognize Their Respective Hinge R egions In this study, in order to obtain antibodies that would be specific for each of the LMB ER isoforms a ntigens were designed based on the amino aci d sequence of the hinge domain of the receptors (Figure 3 1). The anti LMB ER and anti LMB ER a antibodies used in this study were made in rabbits against specific synthetic polypeptide s as antigen s whereas the anti LMB ER b antibody was made using the recombinant hinge region as an antigen. Cross reactivity of the antibodies a gainst the other ERs was tested using recombinant ER ER b and ER a hinge protein fragments expressed in IPTG induced bacteria and were analysed by Western blots using each of the antibodies (Figure 3 1C E). The ER antibodies detected their respective

PAGE 61

61 re combinant hinge proteins. The antibodies did not show cross react ivity with the recombinant hinge regions of the other ER isoforms. Immunoprecipitation U sing Anti human ER A ntibody The ability of a commercial ly available anti human ER antibody to cross re act with LMB ERs was tested by Western blot analysis of whole cell lysates from ovaries in the three stages of development (Figure 3 2 ). In the cortical alveoli stage three bands were evident which wh ere diminished in the later stages. The commercially available anti human ER antibody was used to immunoprecipitate (IP) the LMB ER a and ER b from ovaries in the cortical alveoli stage. The W estern blots were probed with the anti LMB ER a (Figure 3 3A) and anti LMB ER b antibody (Figure 3 3B) respectively The calculated molecular weights of the ER a protein of approximately 61 kDa and ER b is approximately 67 kDa A band of approximately 60 kDa is visible in the Western blot probed using the anti LMB ER a antibody. A weak, band of approximately 60 kDa is also visible on the Western blot probed using the anti LMB ER b antibody. No bands were visible in any of the negative control lanes. Immunoprecipitation U sing ER a and ER b A ntibodies IP was performed using the anti LMB ER a and anti LMB ER b antibodie s with nuclear fractions from ovaries in the cortical alveoli stage, and were probed using the commercial antibody against total ERs. No band was detected when the anti LMB ER a antibody was used (Figure 3 4A ). The Western blot following ER b IP appeared to have two bands with anti LMB ER b antibody and nuclear fraction (Figure 3 4B ).

PAGE 62

62 The two bands that are strongly immunoreactive across all negative control lanes are due to the protein G eluting off the bead (confirmed by Invitrogen technical support). Histology of F emale G onads at D ifferent S tages in the R eproductive C ycle Ovaries from females at different stages were collected for histological analysis. The female gonads show distinct morphological characteristics indicative of follicular stage s during the reproductive cycle. The staging of the LMB females was done based on the most advanced oocyte as previously described (Grier et al. 2009; Martyniuk et al. 2009) The female fish in this study were grouped int o three stages (Figure 3 3), representative of primary growth, secondary growth and maturation. The cortical alveoli (CA) stage (Figure 3 5 A) involves primary ovarian growth, and it is characterized by primary growth follicles (PGF) which are approximatel y 100 200 m in diameter The late vitellogenesis (LV) (Figure 3 5 B) stage of oocyte growth occurs during secondary growth of the ovary when the oocyte becomes significantly enlarged due to the uptake of vitellogenin. During this stage, yolk globules (YGs), as wel l as larger oil droplets become evident in the oocyte During the late maturation stage (LM) (Figure 3 5 C) of the oocyte the oil and yolk droplets coalesce as the egg is prepared for final maturation and ovulation (Grier et al. 2009) Plasma E 2 Vtg and G onadosomatic Index During Different Stages of R eproduction In LMB females, plasma E 2 levels (Figure 3 6 A) peaked during the late maturation stage of oocyte development, when it reached a concentration of approximately 8000 p g/ml. The lowest levels of plasma E 2 were observed during the primary ovarian growth (approximately 50 pg/ml) Plasma Vtg (Figure 3 6 B) levels were below detection limits during the cortical alveoli stage and it was found to peak during late vitellogenesis and

PAGE 63

63 late maturation stag es. The calculated plasma Vtg protein levels were approximately 1.3 mg/ml during both late vitellogenesis and late maturation stages. The gonadosomatic index (GSI) (Figure 3 6 C) was calculated as percent gonadal weight relative to the weight of the animal The average GSI calculated for the cortical alveoli stage was approximately 0.5%, it increased to approximately 2% during late vitellogenesis In late maturation stage the GSI was almost 4%, significantly (P < 0.05) higher than in both of the previous stages. The plasma E 2 Vtg and % GSI were obtained from (Prucha et al. in preparation) Expression of ER in the L iver of F emale LMB To investigate the expression pattern of ER mRNA in the liver during different stages of the reproductive cycle in females, the mRNA levels were measured by real time PCR and protein expression was measured using Western blot (Figure 3 7 ). The expression of ER was measured in the liver of females in the cortical alveoli, late vitellogenesis and the late maturation stages of reproduction. ER mRNA levels (Figure 3 7 A) were lowest in the early stage of reproduction and w ere sign ificantly increased in the later stages (p< 0.001). The ER mRNA expression increased approximately 100 and 160 fold from the cortical alveoli to the late vitellogenesis and late maturation stages respectively. The Western blot analysis was done using th e anti LMB ER specific antibody. One band was observed at approximately 60 kDa and the protein expression appeared to be highest during late vitellogenesis (Figure 3 7B) The band intensity was quantified using Quantity O ne (BioRad), and the values wer e standardized to actin values (Figure 3 7 C). ER protein expression was significantly lower (p< 0.05) during the

PAGE 64

64 cortical alveoli stage relative to late vitellogenesis, with an approximately 2 fold decrease in band intensity. Expression of ER s in the G onads of F emale LMB The expression profiles of ER a and ER b were studied in the gonad tissues of female LMB at three stages of the reproductive cycle, cortical alveoli, late vitellogenesis and late maturation. Both ER a (Figure 3 8 A) and ER b (Figure 3 9 A) mRNA levels decreased significantly (p < 0.05) in the ovaries from the cortical alv eoli stage to the later stages. The mRNA levels decreased by over 50% during the transition from the CA to LM stages of ovarian maturation Protein expression for ER a (Figure 3 8 B) and ER b (Figure 3 9 B) was determined in nuclear fractions obtained from the bass ovaries, using the anti LMB ER a and anti LMB ER b antibodies respectively In Western blots o ne band at approximately 60 kDa was observed for ER a in ovaries that were in the cortical alveoli stage of development, but the signal became undetectable in the later stages of follicular growth. Three bands were observed in the Western blot probed with the anti LMB ER b antibody. The calculated sizes of the bands w ere 60 kDa, 58 kDa, and 43 kDa. The top two bands were only apparent in the cortical alveoli stage, and diminished in the later stages, whereas the 43 kDa band remained constant throughout the three stages of ovarian development, as can be seen from the W estern blot and densitometry analysis (Figure 3 9 C E ). Ratios of ER s to ER mRNA in the G onads of F emale LMB In order to examine the ratio of ER a and ER b mRNA levels to ER in the ovary, ER mRNA levels was measured during the CA, LV and LM stages of gonadal

PAGE 65

65 development. ER mRNA appeared to be slightly up regulated (Figure 3 10A) during the later stages of development relative to the CA stage, but the up regulation was not statistically significant. The ER a to ER ratio (Figure 3 10B) shows that higher levels (approximately 2x) of ER a are present in the ovaries re lative to ER during the CA stage, but higher levels of ER relative to ER a appear to be present during secondary growth stages. ER b mRNA (Figure 3 10C), was also expressed at significantly higher levels (> 5X) relative to ER but the ratio appears to drop with the progression of ovarian maturation, and the ER b mRNA appears to be expressed at similar levels as ER in the late maturation stage Discussion This study is the first to develop antibodies specific for fish ER isoforms, and to determine protei n expression throughout different stages of the reproductive cycle of the LMB To study the protein expression of the LMB ERs, in this study I developed antibodies to recognise the LMB ER isoforms. The antibodies used were made against a region of the pr oteins that is not well conserved among the three LMB ERs and they did not cross react with the antigens used to obtain antibodies for the other ERs indicating that they are specific for their respective ER isoforms IP experiments were also used in ord er to verify that the antibodies could bind ER a and ER b from ovarian tissues. The first set of experiments was done using the anti LMB ER antibodies for the IP, and the anti human ER antibody was used for detection in the Western blot. Although no band s were detected in the IP experiment using the anti ER a antibody, two bands (approximately 60 kDa and 58 kDa) were detected with the ER b IP, meaning that the ER a antibody can only be used for Western blot experiments. An IP

PAGE 66

66 experiment was also done usi ng the anti human ER antibody as the capture antibody, and the Western blots were probed with anti ER a and anti ER b, respectively. A band was detected by both anti LMB ER antibodies, providing further proof that the antibodies recognize the LMB ERs. LMB have a semi synchronous annual reproductive cycle, and spawning takes place during late spring. In females the stage of the reproductive cycle can be determined based on oocyte development (Grier 2000; Grier et al 2009; Martyniuk et al. 2009) The GSI of the female LMB in this study increase d with the progression of gonad, which is expected for fish undergoing sexual maturation and ovarian development (Martyniuk et al. 2009) Ovarian development involves the incorporation of Vtg into the egg, thus leading to significant oocyte growth (Tyler et al. 1990) Also, plasma E 2 levels as well as plasma Vtg levels were highest during the secondary growth stages, previously observed in LMB females collected in early spring (Sabo Attwood et al. 2004) Under normal physiological conditions during sexual maturation, elevated plasma E 2 levels are responsible for Vtg production in the liver, which is subsequently transported to the ovary via the blood for upta ke into the oocytes (Flouriot et al. 1997; Bowman et al. 2002; Sabo Attwood et al. 2004) In female LMB, ER mRNA expression was shown to be highest in the liver, and was previously shown to be the o nly ER isoform responsive to increased plasma E 2 levels (Sabo Attwood et al. 2004; Greytak and Callard 2007) In this study I used an antibody against the LMB ER to study the correlation between protein expression and mRNA lev els in female LMB. A significant increase in mRNA levels was observed during late vitellogenesis and maturation stages relative to the cortical alveoli stage.

PAGE 67

67 The protein levels of ER also appeared to peak during late vitellogenesis, but during late mat uration, the steady state protein levels decreased to approximately half of what was observed in late vitellogenesis. The decrease in steady state protein levels in the liver could be explained by an increased turnover rate of the receptor. ER protein r egulation and degradation is a complex system and it is not well understood in fish. However, in mammalian studies it has been established that ER protein degradation is ligand dependent, and occurs via the proteosome (El Khissiin and Leclercq 1999; Preisler Mashek et al. 2002; Nakajima et al. 2007) E 2 binds ER to form a ligand receptor complex in order to regulate the transcription of ER responsive genes. Degradation of the ER E 2 complex involves polyubiquiti nation of the receptor (Fan et al. 2003; Berry et al. 2008) and subsequent proteolysis by the proteosome (Berry et al. 2008) In the female LMB, plasma E 2 levels peak during late maturation, thus potentially leading to an increase in the rate of protein degr adation. During this time, mRNA levels are still elevated, suggesting active translation of the protein. The predominant ERs being expressed in the LMB ovaries are ER a and ER b (Sabo Attwood et al. 2004) Similar tissue distribution of ERs has also been observed in Gilthead seabream (Socorro et al. 2000) and fathead minnow (Filby and Tyler 2005) Much attention has been focused on characterizing teleost ERs however, their function in ovarian development and maturation is not yet known. In wild LMB females in this study both ER a and ER b showed the highest level of expression during the cortical alveoli stage of ovarian development, and both were significantly down regulated during the later stages of oocyte development. The inverse relationship between ER a and ER b mRNA expression and plasma E 2 levels was also observed in pond reared LMB

PAGE 68

68 females in a previous study (Sabo Attwood et al. 2004) ER expression in fathead minnows (Filby and Tyler 2005) also appears t o be highly expressed during early ovarian stages, indicating that they may play a role in oocyte development. Mammalian studies have also shown that ovarian ER expression decreases during the estrous cycle where the ER expression was modulated by gonad otropins (Byers et al. 1997) A similar mode of ER regulation may exist in the LMB ovaries, as increased gonadotropin synthesis occurs in the female fish during maturation of the ovaries (Martyniuk et al. 2009) ER mRNA levels in the gonads remained relatively constant throughout the different stages of gonadal development, and only a slightly increase in the later stages of maturation relative to the cortical alveoli was observed. The relative abundance of ERs can also contribute to the stage specific functions of E 2 in the ovaries. Overall, ER expression was much higher relative to ER during the primary growth of the oocytes, indicating that ER may play a more important role during early development of the oocytes, whereas ER may be more important during maturation. In addition it has been shown in transfected HepG2 cells that the LMB ER a and ER b suppress ER activation (Sabo Attwood et al. 2007) which may also play a functional role in gonadal development. Steady state protein levels of ER a and ER b were also studied in the ovaries of LMB females in different stages of the reproductive cycle. During the secondary growth of the oocytes Vtg is incorporated into the eggs, as it is necessary for embryonic development (Zhang et al. 1999) Therefore the predominant protein found in the eggs during late stages of the reproductive cycle is Vtg making the study of protein

PAGE 69

69 expre ssion more challenging. In order to ensure that the Vtg levels in the ovaries do not mask the ER protein expression, nuclear proteins were enriched by obtaining nuclear fractions from the ovaries In this study, it was observed that in the LMB ovaries t h e protein levels for both ER a and ER b correlate with their respective mRNA levels. ER a protein was observed only in the cortical alveoli stage, and the protein appeared to diminish during late vitellogenesis and late maturation. A commercially availab le antibody raised against a well conserved region of the DNA binding domain of the ERs was also used to assess the pattern of ER protein expression in the gonads. A similar protein expression pattern was observed, with the exception of an extra band was also observed around 66 kD a. Although it is not clear what this band is, one possibility is that total phosphorylated ERs (Flint et al. 2002) also become apparent on the Western blot with this antibody. The antib ody against ER b recognized three different sizes of bands in the cortical alveoli stage, at approximately 60, 58 and 43 kDa which may be the products of alternative splice sites (Sabo Attwood et al. 2004; Greytak a nd Callard 2007) Multiple slice variants have previously been proposed for LMB ER s expressed in female gonads (Sabo Attwood et al. 2004) In channel catfish three distinct ER transcripts have been isolated (Patino et al. 2000) whereas in trout two distinct transcript sizes of ER have been identified (Pakdel et al. 2000) transcripts with truncated A/B domain of the protein. More recently, multiple transcript sizes of ER a and ER b have been reported in killifish ( Fundulus heteroclitus ), along with multiple ER transcripts (Greytak and Callard 2007) reported in

PAGE 70

70 the killifish is of approximately 45 kDa calculated molecular weight, which is similar to the 43 kDa ER b variant observed in this study. However, t he 43 kDa band detected using the antibody against the LMB ER b was not obse rved using the commercially available antibody, and it may therefore a splice variant missing part of the DNA binding domain used as an epitope for the anti ER splice variant was shown to miss part of the E /F domain (Greytak and Callard 2007) An ER splice variant missing part of the DNA binding domain has been isolated for the human ER (Price et al. 2001) The lack of a DN A binding domain changes the ability of the protein to only activate AP1 promoter regions, and does not bind EREs in the promoter regions of genes (Price et al. 2001) Another possibility for the presence of this b and is protein degradation. ER protein degradation has been shown in mammalian cell lines to be ligand dependent, and to be mediated by the proteosome pathway. Overall, in the present study I showed that the mRNA and protein expression of the LMB ERs is dependent on the stage of the a ER expression in the liver parallels plasma E 2 levels, whereas the ER a and ER b expression appear to be down regulated during oocyte maturation. ER protein regulation in fish is not yet understood, and further studies should focus on possible splice variants of these receptors, as well as elucidating the effects of E on ER a and ER b expression in female gonads, as well as their cellular localization.

PAGE 71

71 Figure 3 1. Specificity of antibodies for the ER isoforms (A) The hi nge region is located between the DNA binding domain and the ligand binding domain of the receptor. (B) Amino acid comparison of the recombinant hinge regions used to develop the isoform specific antibodies. The amino acid sequences were aligned using th e ClustalW2 program. The anti LMB ER and anti LMB E R a antibodies were obtained by inoculating rabbits with synthetic peptid es corresponding to the boxed amino acids. The anti LMB E R b antibody was obtained by inoculating rabbits with recombinant hinge region protein. Antibody cross reacti vity was evaluated using recombinant hinge proteins. The Western blots were probed with anti LMB ER (C), anti LMB ER b (D) or anti LMB E R a(E) antibodies.

PAGE 72

72 F igure 3 2. Cross reactivity of anti human ER antibody with LMB ERs. Ovarian lysate was obtaine d from animals in CA, LV and LM stages of maturation, and the W estern blot was probed using biotinylated total human ER antibody

PAGE 73

73 F igure 3 3. Immunoprecipitation using biotinylated anti human ER (hER) antibody LMB ERs were immunoprecipitated from nu clear extract obtained from ovaries in the cortical alveoli stage, and t he antibod ies used to probe the western blots were the anti LMB ER a (A) and the anti LMB E R b (B).

PAGE 74

74 Figure 3 4. Immunoprecipitation using ER a and ER b antibodies. The antibody used to probe the western blots was a biotinylated total ER antibody recognizing the DNA binding domain of the protein. Immunoprecipitatio n using the anti LMB E R a ( A ) and anti LMB E R b ( B ) antibodies were tested using nuclear extract from ovaries in the cortical alveoli stage. The Western blot was probed using the biotinylated total ER antibody. The arrows indicate the LMB ER b immunoprec ipitated.

PAGE 75

75 Figure 3 5 Histological representation of LMB ovaries in three distinct stages of development. The ovarian stages are based on the predominant oocyte stage: (A) cortical alveoli (primary growth); (B) late vitellogenic (secondary growth); ( C) oocyte maturation (modified from Martyniuk et al. 2009). Abbreviations are as follows: cortical alveoli ( CA ); nucleolus (N); oil droplet (OD); zona radiata (ZR); yolk globule (YG). The scale bar represents 100 M in each of the pictures.

PAGE 76

76 Fig ure 3 6. Plasma E 2 ,Vtg and gonadosomatic index (GSI) at three different stages in the reproductive cycle of wild LMB The female fish were collected and the plas ma E 2 (A), plasma Vtg (B) and the GSI (C) were measured in the animals Each bar represents the mean SEM from 2 3 fish. Statistical differences in the GSI between the different stages of reproduction are indicated by different letters and were calculat ed by ANOVA followed by Duncan post hoc test. Different letters represent statistical differences among the groups (p < 0.05).

PAGE 77

77 Figure 3 7 Changes in ER mRNA and protein expression in the liver of female largemouth bass at three different stages in the reproductive cycle. ER mRNA (A) copy number was normalized to 18s rRNA and was log transformed. ER protein (B) content in whole cell lysate was measur ed by Western blot using the anti LMB ERa antibody. D ensitometry analysis of each band was standardized to Histone3, ND represents no detection Values represent mean SEM (n= 4 fish). Statistical differences between the different stages of reproducti on were calculated by ANOVA followed by Duncan post hoc test. Different letters represent statistical differences among the groups (p < 0.05).

PAGE 78

78 Figure 3 8 Changes in ER a mRNA and protein expression in the gonads of female LMB at three different stages in the reproductive cycle. Change in ER a mRNA (A) copy number in each stage was calculated relative to the CA stage. ER a protein content (B) was measured in nuclear ex tracts by Western blot, and densitometry analysis of each band was standardized to histone 3 protein expression Values represent mean SEM (n= 3 fish). Statistical differences between the diffe rent stages of reproduction were calculated by ANOVA followe d by Duncan post hoc test. Different letters represent statistical differences among the groups (p < 0.05).

PAGE 79

79 Figure 3 9 Changes in ER b mRNA and protein expression in the ovaries of female LMB at three different stages in the reproductive cycle. ER b mRNA (A) at each stage was calculated relative to the CA stage ER b protein content (B) was measured by Western blot, and de nsitometry analysis for 60 kDa band (C), 58 kDa (D) and 43 kDa (E) were standardized to Histone 3 Values represent mean SEM (n= 3 fish). Statistical differences between the different stages of reproduction were calculated by ANOVA followed by Duncan post hoc tes t Different letters represent statistical differences among the groups (p < 0.05).

PAGE 80

80 Figure 3 10 Changes in ER mRNA expression in the ovary of LMB at three different stages in the reproductive cycle. ER mRNA (A) copy number was calculated relative to expression during the CA stage The ratios of ER a to ER mRNA levels (B) and ER b to ER mRNA (C) were calcula ted for each reproductive stage. Values represent mean SEM (n= 3 fish). Statistical differences between the different stages of reproduction were calculated by ANOVA followed by Duncan post hoc test. Different letters represent statistical differences among the groups (p < 0.05).

PAGE 81

81 CHAPTER 4 BINDING AND ACTIVATION OF THE LARGEMOUTH BASS ESTROGEN RECEPTORS BY MODEL COMPOUNDS Background Environmental pollutants often have the ability to mimic endogenous hormones and interact with their receptors, thus h aving an impact on endocrine homeostasis. Many of these contaminants including pesticides, herbicides and plasticizers are xenoestrogens and can interact with estrogen receptors (ERs) in mammalian (Dang 2010; Sweden borg et al. 2010) as well as in piscine species, including largemouth bass (LMB) (Segner et al. 2003; Sabo Attwood et al. 2007; Blum et al. 2008) Nuclear ERs are part of the steroid hormone receptor family, and i n the absence of a ligand are found associated with molecular chaperones such as Hsp90 (Gougelet et al. 2005) The classical mechanism by which these transcription factors regulate gene expression is mediated by li gand binding to the receptor and subsequent dimerization of the ERs (Nilsson et al. 2001) followed by binding to estrogen responsive elements (EREs) in the promoter regions of responsive genes. ERs can also alter gene transcription by interaction with other transcription factors and regulating genes which contain AP 1 (Ee et al. 2004; Vivar et al. 2010) and Sp1 sites (Glidewell Kenney et al. 2005; Fleming et al. 2006) However, the most common transcrip tional regulatory sequence bound by ERs is the palindromic ERE nnGGTCAnnnTGATCnn, as reviewed by (O'Lone et al. 2004) Variability in the ERE sequences that can be bound by ERs have been identified, but changes in this sequence can affect the ligand mediated transcriptional activity of the receptor in b oth mammal (O'Lone et al. 2004) Carroll et al 200 6; Gao et al. 2008) and fish species (Kitano et al 2006)

PAGE 82

82 In LMB, estrogen induced responses are mediated by the three known soluble receptor isoforms, ER ER a and ER b (Sabo Attwood et al. 2004; Blum et al. 2008) All three receptors are known to be activated by estrogen (E 2 ) which mediates an in vitro response with similar potency in transfected HepG2 cells (Sabo Attwood et al. 2007) The ligand binding domains of the LM B ERs share >60% identity to the human ERs, and the LMB ER LBD is 58% identical to the LMB ER a and 57% identical to ER b (Sabo Attwood et al. 2004) Although there are a number of differences in the LBD of these receptors, the amino acids that are believed to be involve d in E 2 binding to the receptors are fully conserved among the ERs across species and isoforms (Ekena et al. 1996; Sabo Attwood et al. 2004; Sabo Attwood et al. 2007) This is not necessarily the case for the putat ive binding sites of estrogen mimics, and differences in binding these compounds has been observed among the LMB receptors. For example, the estrogen mimic 4 nonylphenol was able to activate ER with an EC 50 of 7.05 M and ER b with an EC 50 of 0.27 M, but no response was observed with ER a, and the authors were not able to determine an EC 50 value (Sabo Attwood et al. 2007) In this study, I used two mode l systems to determine the binding and potential estrogenicity or anti estrogenicity of several compound on the LMB receptors, using the classical ERE. Binding affinities for the ER and ER b receptors were measured using full length recombinant ERs in a cell free system. Similar assays have previously been developed for ER from multiple species including human, fathead minnow ( Pimephales p r omelas ), Japanese quail ( Coturnix japonica ), Japanese giant salamander ( Adrias japonicus ) and the American alligato r ( Alligator mississippiensis ) (Rider et al. 2009) This assay has been shown as a useful tool for high throughput

PAGE 83

83 screening of potential endocrine disruptive chemicals. However, one of the limitations of binding assays is that they do not give an indication of the ability of the bound compounds to activate the receptors. Therefore, I also examined the transcriptional activation of the receptors using HepG2 cells transfected with the LMB ERs, along with a Luciferase reporter system. This assay differentiates between agonists and antagonists for the receptors. This is an important step in understanding steroid hormone receptor p harmacology, since receptor binding does not necessarily show direct correlation with the modulation of gene expression downstream of the receptor (reviewed by Katzenellenbogen et al 1996). In this study, I used model compounds that can be categorized in t hree classes. First, compounds that are classified as specific activators of human ER and ER ( 4,4',4'' (4 propyl [1H] pyrazole 1,3,5 triyl)trisphenol (PPT) and 2,3 bis(4 hydroxyphenyl) propionitrile (DPN) respectively). Then, I used model environmental contaminants with different structures; bis(4 hydroxyphenyl) propane (BPA), diel DDE and ICI 182,780 which was used as a model ER antagonist. The goals of this study were to 1) determine the ability of these compounds to bind the LMB ER and ER b, 2) evaluate differences in the strength of the promoter (two versus three t andem EREs) with the three LMB ERs and 3) study the potential of PPT, DPN, DDE to activate the three LMB ERs and the ability of ICI 182,780 to inhibit the E 2 mediated response.

PAGE 84

84 Results Saturation B inding for the LMB ER and ER b The full length recombinant ER and ER b proteins were expressed in insect cells (Sf21) using a baculovirus expression vector. The binding and saturation assays were performed in a cell free assay for each of the receptors. E 2 saturation binding and Scatchar d analysis were done for ER and ER b and are represented in Figure 4 1and Figure 4 2. Figure 4 1 shows a representative graph of total, specific and non specific binding for ER (4 1A) and ER b (4 1B). The LMB ER b had a dissociation constant (K d ) six t imes smaller than that of ER The K d and maximum binding sites (B max ) were calculated for each receptor by non linear regression analysis using the one site binding equation in the GraphPad Prism software. The calculated K d value for ER was 3.6 0.88 nM and for ER b was 0.6 0.14 nM. The receptor concentrations were similar for ER and ER b, and the binding sites per cell were calculated using the following equation: [B max (mol/L) X assay volume (L) X 6.2 X 10 23 (sites per mol)]/ cell #, where the a ssay volume = 200 l, and the cell # was 1250 cells for E and 625 cell for ER b. The calculated B max for ER was 6.75 X 10 7 binding sites per cell and the B max for ER b was 5.56 X 10 7 binding sites per cell Competitive B inding for the LMB ER and ER b T o determine the relative binding affinit ies DDE and ICI 182,780 for the LMB ER and ER b competitive binding assays were done using a cell free assay. Figure 4 3 and Figure 4 4 show one site competition model for ER and ER b respectively, with the compounds tested. All of the chemicals with the exception of PPT displaced over 80% of the [ 3 H] E 2 from ER PPT however, displaced

PAGE 85

85 over 50% at the highest concentration used however it did not fit a one site binding model and a K i could not be calculated The other compounds tested displayed complete binding curves for ER however they bound with significantly (p < 0.05) lower affinity for the receptor relative to E 2 The K i values were calculated using non linear regression one site fit K i equation in GraphPad Prism are summarized in Table 4 1. From ER b, full displacement of [ 3 H] E 2 was achieved by all the compounds tested with DDE. Both of these chemicals displaced a maximum of ~ 60% o f the bound [ 3 H] E 2 from ER b. ER T ransactivation Cell viability assay Viability of the HepG2 cells treated 48h with the various compounds tested was measured using Alamar Blue Vibility is quantified by the conversion of the reagent to a fluorescent i ndicator, which occurs in metabolically active cells. The Alamar Blue assay (Figure 4 5) show ed that the chemicals used did not decrease the viability of the HepG2 cells over the 48h period of incubation used. E 2 mediated interaction of LMB ERs with 2X E RE versus 3X ERE In order to study the interaction between the LMB receptors with either two tandem EREs versus three tandem EREs, HepG2 cells were co transfected with each of the LMB ERs in conjunction with either a luciferase reporter construct containi ng 2X or 3X ER response elements from the Xenopus Vtg promoter (GGTCA CAG TGACC). The transfected cells were exposed to E 2 (10 1000 nM) or vehicle (0.1% ethanol) for a duration of 48 h. E 2 treatment elicited a dose response curve for all three LMB ERs w ith both the 2X and the 3X ERE. The concentration at which each receptor was activated

PAGE 86

86 50% of the maximum response (EC 50 ) was determined from non linear regression analysis of sigmoid dose response curve s (Figure 4 6). Using the 2X ERE reporter construc t, the EC 50 s obtained were 82.7 nM for ER 98.0 nM for ER a and 49.0 nM for ER b. The EC 50 values obtained using the 3X ERE receptor construct were slightly smaller for ER which was 48.4 nM and ER b which was 58.2 nM but slightly higher for ER a which h ad an EC 50 of 72.0 nM (summarized in Table 4 2). The maximal response achieved with the 3X ERE appears higher for each receptor than the maximal response achieved with the 2X ERE. DDE To determine the a bility of different known estrogenic compounds to activate the LMB ERs, HepG2 cells were co transfected with ER ER a or ER b together with a 3X ERE luciferase reporter vector. All of the compounds tested acted as ER agonists and significantly (P < 0.05) activated the receptor as compared to the ethanol control. Figure 4 7 shows sigmoid dose response curves of the ER activity in response to each chemical tested, relative to the ethanol (0.1%) control. The EC 50 was calculated for each compound using a non linear regression, log (agonist) vs response equation in GraphPad Prism and the values are summarized in Table 4 3. For ER the potency ranking based on EC 50 2 (48.9 nM) > BPA (5.67 M) M) > DDE (135 M) DDE and dieldrin were significantly less potent than E 2 the magnitu de of the maximal response was similar to that of E 2

PAGE 87

87 The effects of E 2 DDE on ER a activity is shown in Figure 4 8. All of the compounds with the exception of dieldrin elicited a response similar to that of E 2 Dieldrin was significantly a weaker activator of the ER a receptor relative to E 2 and the other compounds, with maximal response at approximately 4 fold change from the control. The EC 50 concentrations for each of the compounds with the ER a receptor are summarize d in Table 4 3. The potency ranking as determined by the calculated EC 50 with ER 2 (58.2 nM) > PPT (4.35 M) > BPA (15.2 DDE (35.9 M). Activation of the LMB ER b receptor by the compound s tested is shown in Figu re 4 9 DDE induced a response similar to E 2 whereas the BPA response appeared to be approximately half of the maximal response achieved with E 2 The Luciferase response achieved with PPT and dieldrin were m inimal (approximately 10% of maximal) The EC 50 potency ranking of the compounds tested for the LMB ER b receptor are: E 2 (321.0 nM) > BPA (17.2 dieldrin (63.1 DDE (171.0 M). The EC 50 values obtained for ER b are summarized in Table 4 3 ER activation of E 2 and dieldrin mixture Dieldrin was a very weak activa tor of ER a and ER b. Therefore, to evaluate the ability of dieldrin to act as an antagonist of the LMB ER a and ER b, a the cells were treated with 0.1 M E 2 in conjunction with increasing concentrations of dieldrin For this, the cells were exposed to 0 .1 M E 2 in conjunction with increasing concentrations of dieldrin. Dieldrin alone did not appear to induce a full agonist response in ER a or

PAGE 88

88 ER b, and in combination with E 2 did not decrease the E 2 mediated response for either one of the LMB ER s (Figur e 4 10). ICI 182,780 is a full a nta gonist of the LMB ERs To evaluate the ability of ICI 182,780 to inhibit the E 2 mediated activation of the LMB ERs, HepG2 cells transfected with the LMB receptors in conjunction with the 3X ERE luciferase reporter construc t were exposed for 48h either with 0.1 M E 2 alone or in combination with increasing concentrations of ICI 182,780 (1 10 M). ICI 182,780 inhibition of the LMB ERs is shown in Figure 4 11. Full inhibition of E 2 mediated response was observed for ER and ER b with 10 fold excess of ICI 182,780 relative to E 2 but a 50 fold excess was necessary to have full inhibition for ER a activity. Discussion An increasing number of chemicals in the environment have been recognized to act as endocrine disruptors and to have a negative effect on aquatic life In order to evaluate the effects on contaminants on human health and wild life, classic toxicity studies have used mostly in vivo assays which can be limited by cost and the number of animals that have to be used. In 2007, the National Research Council (NRC) released st emphasizing the need for high throughput assays and focusing toxicity testing on better understanding the mode of action of contaminants (Gibson 2010; Krewski et al. 2010) In order to study the estrogenic potential of model compounds, I used two in vitro assays to address the binding affinity, and transactivation potential of chemicals for the LMB ER isoforms.

PAGE 89

89 The fi rst class of chemicals I tested are known human ER and ER specific agonists, but whose interaction with the LMB receptors was not yet known. For this I used PPT which has been characterized in mammalian studies to be an ER specific agonist, and DPN which has been characterized to be an ER specific a gonist (Escande et al 2006) The second class of chemicals tested was environmental xenoestrogens. For this I chose BPA, a plasticizer which is mass produced and continuously released into the environment, and two representative persistent organochlorine DDE. I also evaluated the ability of ICI182,780 to inhibit the E 2 mediated response in the LMB ERs. ICI182,780 has been characterized as a n universal ER antagonist (Hawkins and Thomas 2004) In this study, the binding aff inities of the compounds were measured using full recombinant full length ER and ER b, in a cell free system. The K d value of E 2 obtained for ER was 3.6 0.98 nM, while the K d value obtained for ER b was 0.6 0.14 nM v alues which are within previous ly reported K d s for other fish ERs The values obtained in this study are very similar with findings for the Channel catfish ER s. In Channel catfish, the K d value for ER was found to be 4.7 0.7 nM (Xia et al. 1999) and the K d for ER was 0.21 0.02 nM (Xia et al. 2000) Using recombinant full length ER s from a number of species in a similar assay, Rider et al. (2009) measured their binding affiniti es for E 2 (Rider et al. 2009) The K d obtained for the fathead minnow ER using the cell free system was 0.58 0.10 nM, which was similar to that of quail ER (K d = 0.58 0.05 nM) and the human ER which ( K d of 0.28 0.04 nM ) (Rider et al. 2009) The similarity in E 2 binding affinity for the ERs across different species is not surprising given that the putative E 2 binding amino acids of the receptors are well

PAGE 90

90 conserved across species, and acro ss the LMB ER isoforms (Sabo Attwood et al. 2004) The activation potential of E 2 for each of the LMB ERs was tested using transfection assays. First I tested the effect of having two versus three tandem EREs in t he promoter region of a responsive gene using a luciferase reporter assay The results show that the EC 50 for E 2 was very similar among ER ER a and ER b regardless of the number of tandem EREs. The calculated EC 50 value obtained in this study for ER was 82.70 nM, for ER a was 49.1 nM and for ER b was 98.2 nM, using the 2X ERE Luc reporter. Similar values were calculated using the 3X ER E receptor construct, where the EC 50 for ER was 48.4 nM, the EC 50 for ER a was 72.0 nM, and ER b was 58.2 nM. The ER isoforms from both LMB (Sabo Attwood et al. 2007) and other vertebrates have previously been sho wn to respond similarly to E 2 exposure (Katsu et al. 2010) It should be noted, however, that although the concentrations needed to elicit a response with the 2X ERE and the 3X ERE were similar, a higher overall re sponse was achieved with the 3X ERE. Upon binding E 2 ERs dimerize and the DNA binding domains of the receptors bind with a twofold axis of symmetry to the ERE motif in the promoter of responsive genes (Klinge 2001) An increase in overall response achieved with increased number of tandem EREs has previously been reported (Tyulmenkov et al. 2000) and may result from differences in the recruitment of coactivators (Klinge et al. 2004) ICI 182,780 was used in this study as a known ER antagonist. The transfection assays showed that ICI 182,780 was able to fully inhibit the E 2 mediated response for all three LMB ERs h owever a higher concentration of ICI 182,780 was required to

PAGE 91

91 inhibit ER a activity. In the binding assay, ICI 182,780 was able to fully displace E 2 from both ER and ER b, and thus is in accord with the transfection data. In a previous study, ICI 182,780 did not completely inhibit the E 2 re sponse with ER a or ER b, but this can be explained by the fact that the study used only 50 fold excess ICI 182,780, where as in the present study, I used up to 100 fold excess ICI 182,780 to E 2 (Sabo Attwood et al. 2 007) Mammalian studies have shown that PPT and DPN are specific agonists for ER and ER respectively (Harrington et al. 2003; Escande et al. 2006) and have been used in fish studies to evaluate the role of ERs in vitellogenin synthesis (Leanos Castaneda and Van Der Kraak 2007) In this study, I showed that unlike the ER specific response observed in mammalian species, PPT and DPN are not specific agonists of the LMB ERs. Both PPT and DPN were shown to bind ER and ER b similarly. Interestingly, the binding curves of DPN and PPT for ER and ER b are very steep, which indicates the possibility of cooperative binding to the receptor. In vitro dimerization and cooperative ligand binding has previously been obser ved with the recombinant human ER ligand binding domain (Brandt and Vickery 1997) full length recombinant human ER and ER (Suzuki et al. 2007) and with purified estrogen receptor from calf uteri (Notides et al. 1981) Cooperative ligand binding can occur due to conformational changes of the receptor, and subsequent receptor dimer formation. The dimer for mation can also occur with E 2 binding; however, if the affinity for the second receptor does not change this phenomenon would not be noticed in the assay. The transfection assays showed that both PPT and DPN acted as agonists of ER in the HepG2 cells, w ith DPN having greater potency than PPT for activating ER PPT

PAGE 92

92 was able to mediate a response through both ER a and ER b, and it was more efficacious than DPN at activating ER b DPN did, however have a significantly lower EC 50 value than PPT for activ ating ER a indicating that it is more potent than PPT. My data parallel results found with Mozambique tilapia ERs (Davis et al. 2010) where PPT and DPN were found to be agonists of all three tilapia ERs in transfec ted Hek293. Taken together, the data indicate that the fish ERs may bind or respond differently than the mammalian ERs and therefore caution should be taken when applying knowledge obtained from mammalian ligand ER interactions to fish species. In this st udy I also examined a number of known aquatic contaminants for their ability to interact with the LMB ERs in vitro BPA is a compound used in the DDE and dieldrin were u sed as model organochlorine pesticides. The binding assays show that all three compounds were able to fully displace [ 3 H] E 2 from ER and their affinity for the receptor as ranked based on the calculated K i values was BPA > dieldrin DDE. The same affinity ranking was observed for ER b, however, dieldrin and DDE produced only partial competitive binding curves, as they were able to displace about 60% of the bound [ 3 H] E 2 from the receptor at the highest concentration used (100 M). As expected based on previous studies all three contaminants had significantly lower affinity for the receptors relative to E 2 (Kuiper et al. 1998; Matthews et al. 2000) However, the data show that at high concentrations these compounds can bind the LMB ERs, and therefore act as agonists or antagonist. The binding assays are limited to detecting the ability of compounds to interact with the ERs. Therefore, in this study a luciferase reporter assay was used in

PAGE 93

93 transfected Hep G2 cells in order to confirm if the model environmental contaminants tested acted as agonists or antagonists of the LMB ERs. In the HepG2 cells expressing the LMB ER significant activity of the reporter gene was observed wi th all the compounds tested, a nd, as expected from the results obtained in the binding assay, all the contaminants showed significantly lower potency than E 2 The potency order of the compounds based on the calculated EC 50 s for ER was BPA (5.67 DDE (135 dieldrin (203 M) E 2 also activated ER a and ER b with significantly greater potency relative to the other compounds testes. The contaminant potency ranking based on EC 50 values for ER a was BPA (15.2 DDE (35.9 M) and for ER b was BPA (17.2 M) > DDE (171.0 M) The potency with which the LMB ER and ER b were activated parallels the binding affinity order obtained in the binding assays, indicating that similar ligand ER interactions occur in the cell free assay as in the cell based transfection assay In this study, BPA has the highest affinity for the LMB ERs relative to the other compounds tested. Also, the binding assays show that BPA has similar affinity for the LMB ERs and the transfection assays show that BPA has similar potency for the LMB ER and ER s. In the transfection assay BPA activated ER and ER a with similar efficacy as E 2 whereas ER b showed less response with BPA relative to E 2 BPA is a known to be a weak estrogenic compound, and has been shown to activate the trout ER in trans fected RTG2 cells (Rutishauser et al. 2004) and both the human ER and ER in transfection assays using HepG2 cells (Gaido et al. 2000) and HeLa cells (Paris et al. 2002) The similar binding affinity of BPA for the different receptor isoforms

PAGE 94

94 indicates that the ERs may bind the ligand in a similar fashion; however binding affinity does is not always correlate with biological response (Strunck et al. 2000) p DDE and dieldrin are both organochlorine pesticides however, their structures are significantly different (Figure 1 1), which can alter their respective interaction with DDE is a planar aromatic chlorinated molecule, whereas dieldrin is a no n planar, non aromatic, bridged polycyclic chlorinated compound. In this study, the DDE and dieldrin were similar for the LMB ER and ER b. However, the transfection assays showed that their ability to activate the receptor s DDE was able to fully activate all three LMB ERs. Moreover, DDE was able to elicit a greater maximal response with the LMB ER a than with E 2 Conformational ch cellular co activators and co repressors (Brzozowski et al. 1997) Although the reason DDE than E 2 is not clear, it may be due to the conformational changes in the receptor structure or co factor recruitment mediated by DDE binding. Other compounds, such as 2,2 bis( p hydroxyphenyl) 1,1,1 trichloroethane ( HPTE), have been shown to activate the human ER with greater efficacy than E 2 in HepG2 cells using a similar, 3X ERE Luc reporter assay (Yoon et al. 2001) This response however, may be cell type dependent as it was not observed in other cells types such as MD A MD 231 and U2 cells in the same study (Yoon et al. 2001) DDE, is a full agonist only of the LMB ER and a very weak agonist of ER b and ER a. Estrogenic activity of dieldrin has previously been

PAGE 95

95 observed with human ER transfected MCF 7 cells (Andersen et al. 2002) Similarly, the human ERs stably expressed in HELN cells showed that dieldrin treatment induced a response in the ER expressing cells, whereas it acted as weak anti estrogen in the ER expressing cells (Lemaire et al. 2006) In this study, I used combination treatments of 0.1 M E 2 and increasing concentrations of dieldrin (up to 100 M) in cells t ransfected with the LMB ER s in order to test the inhibitory potential of dieldrin on the E 2 mediated response. No inhibition of receptor activity was observed at these ratios of E 2 to dieldrin. In the competition binding assay, only approximately 60% of [ 3 H] E 2 was displaced at a ratio of 1nM E 2 to 100 M dieldrin, indicating that the lack of inhibitory response in the transfection assay may be due to the inability of dieldrin to displace E 2 from the ER s. Overall, this data indicate that the LMB ER an d ER b may bind different compounds in a similar manner; however, the transcriptional response of the ERs appears to be isoform dependent. Although the binding data compliment the in vitro activation data, the relative binding affinity of compounds does n ot necessarily correlate with their ability to activate the LMB ER isoforms. This highlights a need for multi level analysis of the effects of estrogenic compounds on ERs. To gain a better understanding of the ligand dependent activation of the LMB ERs, f uture studies should focus on the ligand mediated conformational changes of the receptors, and their interactions the cellular transcriptional machinery.

PAGE 96

96 Ta ble 4 1 Relative binding affinities of various chemicals tested to the LMB ER and ER b ER ER b Chemical K i (log M) K i (log M) E 2 8. 31 0. 114 a 9. 46 0.096 DPN 6.13 0. 177 b 6. 93 0.074 PPT ~ 5.20 7.08 0.055 BPA 5. 81 0.1 49 b 6.14 0.148 dieldrin 4.9 9 0.2 60 c 5.43 0.414 DDE 4. 52 0. 104 c 5.17 0. 205 ICI 182,780 8.01 0. 067 a 8.37 0.062 Different superscript letters (a, b, c, d) represent statistical differences among each of the compounds for the receptor as determined by Kruskal Wallis (one way ANOVA) p< 0.05

PAGE 97

97 Table 4 2 EC 50 Concentrati ons for the LMB ERs using 2X ERE and 3X ERE Luciferase reporter system. 2X ERE Luc 3X ERE Luc Receptor EC 50 (log M) EC 50 (log M) ER 7.08 0.228 7.32 0.225 ER a 7.31 0.179 7.24 0.142 ER b 7.01 0.257 7.14 0.190 EC 50 value is the concentration of E 2 at which 50% of maximum activity was achieved

PAGE 98

98 Table 4 3 EC 50 for several compounds tested with the LMB ER ER a and ER b using a 3X ERE Luc reporter construct ER ER a ER b Chemical EC 50 (log M) EC 50 (log M) EC 50 (log M) E 2 7.18 0.207 a 7.17 0.197 a 7.11 0.219 a DPN 7.16 0.199 a 7.52 0.181 a 6.49 0.292 a PPT 4.55 0.743 b 5.36 0.314 b 6.80 0.160 a BPA 5.25 0.282 b 4.8 0.239 b 4.77 0.304 b dieldrin 4.69 0.249 bc 4.20 0.466 b DDE 4.87 0.225 bc 4.45 0.336 b 3.76 0.691 b EC 50 value is the concentration of E 2 at which 50% of maximum activity was achieved by each receptor. Valu es represent the mean log M concentration standard error from at least three replicate assays. Different superscript letters (a, b, c, d) represent statistical differences among each of the compound for the receptor as determined by Kruskal Wallis (one w ay ANOVA) (p < 0.05)

PAGE 99

99 Figure 4 1 Representative graphs of E 2 Total, Specific and Non specific binding for the LMB ER and LM B ER b in a cell free assay. Total binding for ER (A) and ER b (B) was determined by incubating the receptors with increa sing concentrations of [ 3 H]E 2 alone, and non specific binding was measured by adding 100 fold excess unlabeled E 2 in conjunction with the [ 3 H]E 2 Specific binding was calculated by subtracting the non specific binding from the specific binding. Each expe riment was repeated at least three times and values represent mean SE The receptor concentrations calculated for ER and ER b, per cell using the following equation: [B max (mol/L) X assay volume (L) X 6.2 X 10 23 (sites per mol)]/ cell #, where the assay volume = 200 l, and the cell # was 1250 cells for E and 625 cell for ER b.

PAGE 100

100 Figure 4 2 Representative grap hs of E 2 saturation binding and scatchard analysis (insert) for the LMB ER and LMB E R b in a cell free binding assay. Total binding for ER (A) and ER b (B) was determined by incubating the receptors with increasing concentrations of [ 3 H]E 2 alone, and no n specific binding was measured by adding 100 fold excess unlabeled E 2 in conjunction with the [ 3 H]E 2 Specific binding was calculated by subtracting the non specific binding from the specific binding. The receptor concentrations calculated for ER and E R b, per cell using the following equation: [B max (mol/L) X assay volume (L) X 6.2 X 10 23 (sites per mol)]/ cell #, where the assay volume = 200 l, and the cell # was 1250 cells for E and 625 cell for ER b. Each experiment was repeated at least three t imes.

PAGE 101

101 Figure 4 3. Competitive binding assays with the LMB ER Increasing concentrations of E 2 DPN, PPT and ICI (A) and E 2 DDE (B) were added to the LMB ER in a cell free assay, in the presence of 1 nM of [ 3 H ] E 2 The E 2 b inding was shown on both graphs for comparison. Data w ere fit using a one site competition model using GraphPad Prism Values represent means SE from at least three independent studies.

PAGE 102

102 Figure 4 4. Competitive binding assays with the LMB ER b Increa sing concentrations of E 2 DPN, PPT and ICI (A) and E 2 DDE (B) were added to the LMB ER in a cell free assay, in the presence of 1 nM of [ 3 H ] E 2 The E 2 binding was shown on both graphs for comparison. Data w ere fit using a one sit e competition model using GraphPad Prism Values represent means SE from at least three independent studies.

PAGE 103

103 Figure 4 5 HepG2 cell viability HepG2 cells were plated in 96 well plates and were treated with increasing concentrations of DPN, PPT (A), E 2 BPA, dieldrin DDE (B) different E 2 +ICI combination (C) or different E 2 +dieldrin combination (D) for 48h. Cytotoxicity was measured using alamarBlue and the signal was read on a fluorescent microplate reader.

PAGE 104

104 Figure 4 6 E 2 mediated transact ivation of the LMB ERs. HepG2 cells were transfected with pcDNA3.1 expression vector containing each of the LMB ERs in conjunction with a firefly luciferase reporter plasmid containing either 2X (A) or 3X (B) tandem Xenopus sp. Vtg ERE repeats. At 24 h p ost transfection the cells were treated for 48 h with increasing concentrations of E 2 Values represent means SE of the fold change from ethanol vehicle control of normalized luciferase values from at least three independent experiments.

PAGE 105

105 Figure 4 7 Dose response of transactivation of the LMB ER HepG2 cells were transfected with pcDNA3.1 expression vector containing each of the LMB ERs in conjunction with a firefly luciferase reporter plasmid containing 3X tandem Xenopus sp. Vtg ERE repeats. At 2 4 h post transfection the cells were incubated for 48 h with increasing concentrations of DPN and PPT (A) E 2 or the estrogen mimics: BPA, dieldrin DDE. Values represent means SE of the fold change from ethanol vehicle control of normalized lucif erase values from at least three independent experiments.

PAGE 106

106 Figure 4 8 Dose response of transactivation of the LMB ER a HepG2 cells were transfected with pcDNA3.1 expression vector containing each of the LMB ERs in conjunction with a firefly luciferase reporter plasmid containing 3X tandem Xenopus sp. Vtg ERE repeats. At 24 h post transfection the cells were incubated for 48 h with increasing concentrations of DPN and PPT (A) E 2 or the estrogen mimics: BPA, dieldrin DDE. Values represent means SE of the fold change from ethanol vehicle control of normalized luciferase values from at least three independent e xperiments.

PAGE 107

107 Figure 4 9 Dose response of transactivation of the LMB ER b HepG2 cells were transfected with pcDNA3.1 expression vector containing each of the LMB ERs in conjunction with a firefly luciferase reporter plasmid containing 3X tandem Xenopus sp. Vtg ERE repeats. At 24 h post transfection the cells were incubated for 48 h with increasing concentrations of DPN and PPT (A) E 2 or the estrogen mimics: BPA, dieldrin DDE. Values represent means SE of the fold change from ethanol vehicle control of normalized luciferase values from at least three independent e xperiments.

PAGE 108

108 Figure 4 10 Dieldrin does not inhibit the E 2 mediated response. HepG2 cells were transfected with pcDNA3.1 expression vector containing each of the LMB ERs in conjunction with a firefly luciferase reporter plasmid containing 3X tandem Xe nopus sp. Vtg ERE repeats. At 24 h post transfection the cells were incubated for 48 h with 0.1mM E 2 alone or in combination with increasing concentrations of ICI 182,780 (1 10 mM) (A ) E R a ( B ) ER b. Values represent means SE of the fold change from eth anol vehicle control of normalized luciferase values from at least three independent experiments

PAGE 109

109 Figure 4 11 ICI 182,780 inhibits E 2 mediated response. HepG2 cells were transfected with pcDNA3.1 expression vector containing each of the LMB ERs in con junction with a firefly luciferase reporter plasmid containing 3X tandem Xenopus sp. Vtg ERE repeats. At 24 h post transfection the cells were incubated for 48 h with 0.1 M E 2 alone or in combination with increasing concentrations of ICI 182,780 (1 10 M) (A) ER (B) E R a (C) ER b. Statistical differences between the different stages of reproduction were calculated by ANOVA followed by Duncan post hoc test. Different let ters represent statistical differences among the groups (p < 0.05).

PAGE 110

110 CHAPTER 5 EFFECTS OF ENVIRONMENTAL ESTROGENS ON ESTROGEN RECEPTOR REGULATED GENES IN LIVER SLICES FROM LARGEMOUTH BASS Background Many environmental contaminants are suspected to interfe re with the physiological functions of estradiol (E 2 ) by interacting with its receptors. Therefore, the development of in vitro methods for screening large numbers of estrogenic compounds is essential for understanding their potentially detrimental effect s on piscine species. In vitro assays often used to evaluate the ability of xenoestrogens to interact with estrogen receptors (ERs) of fish have included binding assays (Rider et al. 2009; Rider et al. 2009) transf ected reporter gene assays (Sabo Attwood et al. 2007; Davis et al. 2010) and primary hepatocytes (Navas and Segner 2006; Rani et al. 2010) and have been useful in gaining an understanding into the modes of action of xenoestrogens. However, these assays are limited in their ability to foresee the effects of contaminants on physiological responses in fish livers. Because of these limitations, it is necessary to have other in vitro assays that can better account for the complexity of the fish liver. For this, liver slices are a valuable tool for studying the effects of endocrine disruptors on the intact fish liver. Cultured liver slices maintain the integrity of the tissue ar chitecture and the relevant biochemical and metabolic profile of the liver (Gonzalez et al. 2000; Lemaire et al. 2011) More importantly, recent studies have also shown that toxicity observed in liver slices can be correlated with liver toxicity in vivo much better than other in vitro assays (Elferink et al. 2008) The use of an in vitro system to assess the estrogenic potential of aquatic contaminants also offers a number o f advantages over in vivo exposures. The in vitro liver assay allows an assessment of mechanisms of toxicant action directly in the tissue

PAGE 111

111 of interest, requires a shorter duration of exposure and uses fewer animals to achieve sufficient data. This assay has been widely used to predict toxicity in mammalian species reviewed by (de Kanter et al. 2002; Groneberg et al. 2002; Gomez Lechon et al. 2010) however, few studies have used it to study the effects of environm ental estrogens on ER regulated genes in fish (Schmieder et al. 2000; Schmieder et al. 2004; Navas and Segner 2006) I n the livers of piscine species, estrogen and estrogen mimics stimulate the synthesis of protein s involved in egg synthesis, such as vitellogenin (Vtg) (Selman and Wallace 1983; Wallace and Selman 1990; Heppell et al. 1995; Cheek et al. 2001; Barucca et al. 2006) and zona radiata protein (Zrp) (Arukwe et al. 1997; Shabanipour and Hossayni 2010; Prado et al. 2011) Vtg is an egg yolk precursor protein (Ryffel 1978) whereas Zrps make up the eggshell which protects th e developing embryo (Oppen Berntsen et al. 1999) Vtg and Zrp are synthesized in the liver of female fish during oocyte development and are under the control of ERs. Under normal physi ological conditions, in male fish Vtg and Zrps are expressed in very low levels (Sumpter and Jobling 1995; Tyler et al. 1996) however, their synthesis can be induced by estrogenic compounds (Arukwe and Goksoyr 2003; Maradonna and Carnevali 2007; Genovese et al. 2011) L argemouth bass (LMB) was chosen in this study as a model species because it occupies a wide geographical range within the United States (Hinck et al. 2008) Bass are a predatory species, and contaminants that readily bioaccumulate such as polychlorinated hydrocarbons have been found in tissues of wild caught LMB throughout the US (Hinck et al. 2008) LMB have also been found to be a sensitive

PAGE 112

112 species to environmental estrogens (Sepulveda et al. 2001; Sepulveda et al. 2003; Denslow et al. 2004) In vivo studies have shown Vtg synthesis to be induced in the liver of LMB males with exposure to E 2 (Bowman et al. 2002) estrogen mimics such as methoxyc h lor (Blum et al. 2008) DDE (Garcia Reyero et al. 2006) as well as contaminant mixt ures found in paper mill effluents (van den Heuvel and Ellis 2002) The actions of E 2 in LMB are mediated by three ERs, namely ER ER a and ER b (Sabo Attwood et al. 2004) In LMB liver, ER itself is also induced by E 2 (Sabo Attwood et al. 2004; Garcia Reyero et al. 2006) as well as exposure to xenoestrogen s (Garcia Reyero et al. 2006) whereas the ER s do not appear to be responsive to E 2 exposure (Sabo Attwood et al. 2004) In this study, I used p recision cut liver slices from LMB males to evaluate effects of model aquatic contaminants on ER Vtg and Zrp mRNA expression. The compounds used in this study were BPA, DDE. BPA is a plasticizer commonly used in the manufacturing industry. Therefore, it is a high production chemical with an excess of 6 billion pounds produced per year and it is ubiquitous in the environment (Burridge 2003) DDE are persistent polychlorinated metabolites of the pesticides aldrin and DDT, respectively. Aldrin and DDT were discontinued for use in the United States over 40 years ago; however, their metabolites are still found in the sediments of fresh water systems and they are believed to contribute to impaired reproductive function of LMB in Lake Apopka North Shore areas (Garcia Reyero et al. 2006)

PAGE 113

113 Results Histology Histological analysis was done on the liver slices at T0, 24 h and 48 h in culture, to assess cell viability and integrity (Figure 5 1). The histomicrographs show that membrane integrity is maintained over the culture period. At time zero the hepatocytes appear clear due to high glycogen accumulation, however, a pr ogression of eosin staining can be observed at 24 and 48 h, indicating breakdown of the glycogen. The size of the nuclei also appears to be similar throughout the duration of incubation, and no indication of necrosis is observed. Gene Expression in the Li ver Slices is Time d ependent A time course experiment was done in order to determine the time related effect of E 2 on responsive genes in the LMB liver slices. The liver slices from two animals were exposed to 1 M E 2 for 0, 1, 4, 8, 24 and 48 h in triplicate slices after which they were harvested and mRNA levels for ER Vtg and Zrp were measured using real time qPCR (Figure 5 2 ). ER mRNA (Figure 5 2 A) induction was time dependent, and significant up regulatio n (p< 0.05) occurred as early as 8 h, and peaked at 48 h, with approximately 10 fold induction relative to control. Vtg mRNA (Figure 5 2 B) was significantly induced and reached a plateau after 24 h of exposure to 1 M E 2 About 10 fold induction in Vtg mR NA was observed after 24 h of exposure. Zrp mRNA (Figure 5 2 C) induction showed maximum induction of approximately 3 fold relative to control, after only 1 h of exposure. Zrp induction was statistically significant (p < 0.05) at 1 h and 24 h of exposure.

PAGE 114

114 E 2 Mediated I nduction of ER Vtg and Zrp mRNA The liver slices from three animals were exposed in duplicate to increasing concentrations of E 2 (0 1 M) for 48 h to evaluate the dose dependent induction of responsive genes (Figure 5 3 ). Representative graphs of normalized copy num ber for ER mRNA (Figure 5 3 A), Vtg mRNA (Figure 5 3 B) and Zrp (Figure 5 3 C) show that significant induction in all the gene s measured was achieved at 0.025 M E 2 (p < 0.05) relative to control, and it was maintained for the remainder of the concentrations used Statistical analysis was done using the data obtained from three fish. Variability in response was observed among fish, therefore % maximum response for each fish was calculated and is represented in Figure 5 3 B, D and F, for ER Vtg and Zrp, re spectively. BPA Mediated I nduction of ER Vtg and Zrp mRNA Liver slices from three animals were exposed in triplicate wells to increasing concentrations of BPA (0 100 M) were harvested after 48 h, and ER Vtg and Zrp mRNA levels were measured. ER mR NA (Figure 5 4 A) levels increased in a dose dependent manner, and were significantly (p<0.05) up regulated at all concentrations. ER message reached maximum at 100 mM BPA, with approximately 100 fold induction. Vtg (Figure 5 4 C) and Zrp mRNA (Figure 5 4 E) also appeared to be up regulated by exposure to BPA, but the induction was not statistically significant from control. The variability in response between fish is depicted for ER (Figure 5 5 4 B), Vtg (Figure 5 4 D) and Zrp (Figure 5 4 F) as % maximal res ponse for each fish.

PAGE 115

115 DDE Mediated I nduction of ER Vtg and Zrp mRNA ER Vtg and Zrp mRNA levels (Figure 5 5 ) were measured in liver slices from DDE (0 100 M). ER mRNA levels (Figure 5 5 A) were significantly up regulated by all DDE, and maximum response was reached with 5 M, at approximately 30 fold induction relative to control. The Vtg mRNA (Figure 5 5 C) induction was statistically sig nificant after treatment with 100 DDE, with maximal response 10 fold higher relative to control. The Zrp mRNA response (Figure 5 5 E) was significantly (p<0.05) up regulated at 5 DDE exposure and was maintained for the remaining concentration s. The Zrp mRNA maximal response reached a plateau at 5 fold higher levels than control. The variation in response between animals for each of the three genes is shown: ER (Figure 5 5 B), Vtg (Figure 5 5 D) and Zrp (Figure 5 5 F). Dieldrin E ffect on ER V tg and Zrp mRNA L evels Liver slices from two animals were exposed in triplicate sliced for 48 h to increasing concentrations of dieldrin (0 100 M). There was no significant changes in the ER Vtg or Zrp mRNAs in the dieldrin treated slices (Figure 5 6 ). In order to study possible effects of dieldrin exposure on E 2 mediated responses in fish, liver slices were obtained from control animals or from fish that were fed 3 mg dieldrin/Kg for two month and were exposed for 48 h to increasing concentrations of E 2 (0 1 M). In this study, ER Vtg and Zrp mRNA levels (Figure 5 7 ) were measured in liver slices from control and dieldrin treated fish. The slices obtained from control fish appeared to have a dose dependent induction of all three genes, but it was not stati stically significant. Dieldrin

PAGE 116

116 treatment showed an overall significant down regulation of ER and Zrp mRNA levels and appeared to block the E 2 mediated effects on gene regulation. Discussion This study is the first to use an in vitro liver slice assay to study the estrogenic potential of aquatic contaminants in LMB. The assay showed that liver slices are viable over a period of 48 h, and responsive to E 2 treatment as determined by ER Vtg and Zrp mRNA induction. E 2 mediated induction of ER mRNA in fish livers has been documented in LMB (Sabo Attwood et al. 2007) as well as in other fish species (Nelson et al. 2007; Shi et al. 2011; Wang et al. 2011) In this study, E 2 med iated up regulation of ER Vtg and Zrp mRNA levels at 48 h post exposure was maximal with 0.025 M E 2 the lowest concentration used; therefore a dose dependent increase was not observed. The concentrations of E 2 used in this study were similar to the concentrations used in the H epG2 transfection assays (Chapter 4), where the LMB receptors show a dose dependent response with maximal Luciferase activity observed at 1 M. In the transfection assays, 0.025 M E 2 did not induce a response with any of the LMB ERs, indicating that the l iver slice assay is more sensitive than the transfected HepG2 cells. The increased sensitivity of response could be due either to the presence of cell specific factors (Stoica et al. 1999) or differences in the pr omoter regions of responsive genes. Ligand bound ERs are known to bind estrogen responsive elements (EREs) in the promoter regions of responsive genes (Zilliacus et al. 1995) Transcriptional regulation of genes can also occur through interactions with other transcription factors, such as AP 1 or Sp1 (Paech et al. 1997; Saville et al. 2000) In the transfected HepG2 cells, the Luciferase expression was controlled by the ERs binding the three tandem EREs in the

PAGE 117

117 transcription initiation site of the plasmid. However, promoter regions of E 2 sensitive genes in the liver are more complex (Esterhuyse et al. 2009) For example, the Vtg promoter of the Mozambique tilapia (Esterhuyse et al. 2009) shows a number of putative binding sites for transcription factors, such as the GATA family of proteins known to act synergistically with EREs (Teo et al. 1999) The time course for E 2 (1 M) treatment showed that ER mRNA levels started to increase as early as one hour post exposure, and a statistically signif icant increase was observed after eight hours of exposure. Vtg mRNA expression followed a similar trend as ER whereas the Zrp mRNA appeared to reach a plateau after one hour. The up regulation of Vtg levels are known to be closely correlated with incre ased ER mRNA levels, which has been hypothesized to play an important role in Vtg regulation (Pakdel et al. 1989; Nelson et al. 2007; Meng et al. 2010) Unlike the Vtg mRNA induction which was time dependent, the Zrp mRNA appeared to plateau after an initial up regulation one hour post exposure. Rapid induction of Zrp transcript levels has previously been observed in vivo in the Cichlid Cichlaosma dimerus Octylphenol injection in male C. dimerus increased Zrp mRNA levels significantly after one hour of exposure (Genovese et al. 2011) However, a time dependent induction in Zrp was observed in the C. dimerus males, with maximal response achieved after 72 h. It is not dependent increase in the Zrp mRNA, and Zrp regulation in LMB is not yet understood. The rapid gene induction in this study indicates that E 2 entered the tissue rapidly. Although the rate of E 2 diffusion into the slices was not measured in this experiments, E 2 uptake by liver slices from trout ( Oncorhynchus mykiss ), showed measurable

PAGE 118

118 amounts of E 2 in slices approximately 200 m thick, after 15 minutes of exposure, with a maximal slice concentration after 2 h (Schmieder et al. 2000) In addition the trout slices were incubated at 11 o C, whereas the LMB slices were incubated at 21 o C since bass can thrive in much warmer climates (Jackson 1979) The higher temperature used to incubate the LMB liver slices c ould have produced a more rapid diffusion of E 2 into tissue than was observed in the trout experiment The estrogenic properties of environmental contaminants were also assessed using the liver slice assay. DDE are two structurally different environmental xenoestrogens (Figure 1 1) which can interact and activate the LMB receptors (Chapter 4). In this study BPA exposure induced a dose dependent up regulation of ER mRNA levels relative to control, and an upward trend was observed in the Vtg and Zrp mRNA levels, but they were not statistically significant from control. BPA is known to act as a weak estrogen i n fish (Van d en Belt et al. 2003) and can bind and activate the LMB ERs in vitro with much weaker affinity for the receptors than E 2 (Chapter 4). Other in vitro assays have shown that BPA can induce a weak Vtg response in carp hepatocytes (Smeets et al. 1999) and roach liver explant assay (Gerbron et al. 2010) with the roach being more sensitive than the carp. In this study, treatment of the liver slices with DDE resulted in an up regulation of all three genes analyzed. p DDE is a known xenoestrogen (Garcia Reyero et al. 2006; Hinck et al. 2007) and anti androgen (Bjork e t al. 2011) I have shown previously DDE can bind and induce a response in all three LMB ERs (Chapter 4). The results obtained here are comparable with results obtained in LMB in vivo LMB exposed to dietary DDE for 120 days induced ER and Vtg mRNA levels in the

PAGE 119

119 livers of male bass (Garcia Reyero et al. 2006) The parallel responses obtained in vitro and in vivo indicate that the LMB liver slice assay can be used to screen environmental xenoest rogens. The current study showed that dieldrin exposure did not induce an up regulation of ER Vtg or Zrp mRNA levels. Similar results have also been observed in other fish species in vitro (Smeets et al. 1999) Dieldrin did not induce estrogenic effects as measured by Vtg protein in trout (Smeets et al. 1999) salmon (Tollefsen et al. 2003) or carp (Van den Belt et al. 2003) primary cultu re hepatocytes. In vivo LMB exposure to dieldrin also showed no induction in ER or Vtg mRNA levels in male fish (Garcia Reyero et al. 2006) Dieldrin can bind to both the LMB ER and ER b, however transfected HepG2 cells showed that only ER is activated by dieldrin (Chapter 4). Although it is not understood how these genes are regulated in LMB liver, a current study has shown that both the goldfish ER and the ER s were needed to have an E 2 mediated response for Vtg induction in the liver (Nelson and Habibi 2010) In the goldfish, knock down of the ER s resulted in no E 2 mediated induction of Vtg or ER mRNA levels in the livers of male fish (Nelson and Habibi 2010) This indicates that activation of all the ERs is necessary for induction of ER and Vtg mRNA, as well as possibly Zrp. In this study, I also exposed liver slices from dieldrin treated (subchronic through the diet) and control fish to increasing concentrations of E 2 in order to evaluate the effect of dieldrin on E 2 mediated response. The dieldrin treatment i n vivo did not evoke significant changes in gonadosomatic index, vitellogenin, or plasma E 2 in the male fish (Martyniuk et al. in preparation) however an inhibitory effect of dieldrin treatment was

PAGE 120

120 observe d on ER isoforms expression in the hypothalamus of the male fish (Martyniuk et al. in preparation) The liver slice taken from the control and dieldrin treated fish and subsequently treated with E 2 did not elicit a statistically significant induction of any of the gen es measured, but an upward trend in ER Vtg and Zrp was observed in the livers obtained from the control animals This response however was completely abolished in the dieldrin treated fish suggesting that in vivo dieldrin can work as an anti estrogen The mechanism of action of dieldrin on E 2 responsive genes in the male fish is not well understood, however, d ieldrin has been shown to inhibit the human ER (Lemaire et al. 2006) in a co exposure with E 2 In vitr o transfection assays have shown that dieldrin is a full agonist of the LMB ER but it does not activate ER a or ER b (Chapter 4), and it has been suggested that activation of all the ERs may be necessary for E 2 mediated gene regulation (Nelson and Habibi 2010) in fish liver. In vitro transfection assays did not show dieldrin to abolish E 2 mediated activation of the ER s, however tha t could be low affinity for dieldrin relative to E 2 The exp osure to dieldrin and E 2 in the transfection assay was simultaneous the inhibitory effect observed with the fish fed the dieldrin diet may have occurred because the dieldrin treatment preceded the E 2 treatment. Together, the data indicate that the LMB liv er slice assay is a physiologically relevant method of screening environmental xenoestrogens. Used in conjunction with transfection and binding assays it can also be used to gain a better understanding of the functional roles the three ERs play in E 2 media ted gene expression.

PAGE 121

121 Figure 5 1. Histology of liver slices at time 0 (A), 24 h (B) and 48 h (C) of incubation in vitro Precision cut liver slices were obtained using a Vitron Brendell tissue slicer. The slices were incubated in L15 media at 21 o C up to 48 h. The liver slices were sectioned and stained with H&E.

PAGE 122

122 Figure 5 2. Time dependent induction of ER Vtg and Zrp mRNA levels. ER (A) Vtg (B) and Zrp (C) mRNA levels were measured in response to E 2 treatment in liver slices at different time points. The panels on the left show a representative means SE of the copy numbers for each treatment normalized to the copy number of the 18S rRNA present in liver slices from two fish, for ER (A), Vtg (B) and Z rp (C). The copy numbers were log 10 transformed prior to normalization. Different superscript letters (a, b, c) represent statistical differences between treatments which were calculated using the data obtained from three individual fish, determined by Scheffe post hoc test ( mixed model ANOVA). Time points that have a letter (s) in common are not statistically significant from each other.

PAGE 123

123 Figure 5 3. Dose response of ER Vtg and Zrp mRNA levels in liver slices exposed to increasing concentrations of E 2 Dose response of ER Vtg and Zrp mRNA levels in liver slices exposed to increasing concentrations of E 2 The panels on the left show a representative means SE of the copy numbers for each treatment, one fish (duplicate slices) normalized to the copy number of the 18S rRNA, for ER (A), Vtg (C) and Zrp (E). The copy numbers were log10 transformed prior to normalization. Different superscript letters (a, b, c) represe nt statistical differences between treatments with data from three individual fish, determined by mixed model ANOVA (treatment = fixed variable; fish = random variable); Scheffe post hoc test. The figures on the right show the variability in response betw een animals for ER (B), Vtg (D) and Zrp (F). Percent maximal response was calculated using the log10 copy number normalized to 18S rRNA.

PAGE 124

124 Figure 5 4 Dose response of ER Vtg and Zrp mRNA levels in liver slices exposed to increasing concentrations of BPA. Dose respon se of ER Vtg and Zrp mRNA levels in liver slices exposed to increasing concentrations of BPA. The panels on the left show a representative means SE of the copy numbers for each treatment, one fish (duplicate slices) normalized to the copy number of the 18S rRNA, for ER (A), Vtg (C) and Zrp (E). The copy numbers were log 10 transformed prior to normalization. Different superscript letters (a, b, c) represent statistical differences between treatments with data from three individual fish, determined by mixed model ANOVA (treatment = fixed variable; fish = random variable); Scheffe post hoc test. The figures on the right show the variability in response between animals for ER (B), Vtg (D) and Zrp (F) values were normalized to % maximum response.

PAGE 125

125 Figu re 5 5. Dose response of ER Vtg and Zrp mRNA levels in liver slices exposed to DDE. Dose response of ER Vtg and Zrp DDE. The panels on the left sh ow a representative means SE of the copy numbers for each treatment, one fish (duplicate slices) normalized to the copy number of the 18S rRNA, for ER (A), Vtg (C) and Zrp (E). The copy numbers were log 10 transformed prior to normalization. Different superscript letters (a, b, c) represent statistical differences between treatments with data from three individual fish, determined by mixed model ANOVA (treatment = fixed variable; fish = random variable); Scheffe post hoc test. The figures on the right show the variability in response between animals for ER (B), Vtg (D) and Zrp (F) values were normalized to % maximum response.

PAGE 126

126 Figure 5 6 Dose response of ER Vtg and Zrp mRNA levels in liver slices exposed to increasing concentrations of dieldrin. Dose response of ER Vtg and Zrp mRNA levels in liver sl ices exposed to increasing concentrations of dieldrin. The panels on the left show a representative means SE of the copy numbers for each treatment, one fish (duplicate slices) normalized to the copy number of the 18S rRNA, for ER (A), Vtg (C) and Zrp ( E). The copy numbers were log 10 transformed prior to normalization. Different superscript letters (a, b, c) represent statistical differences between treatments with data from three individual fish, determined by mixed model ANOVA (treatment = fixed vari able; fish = random variable); Scheffe post hoc test. The figures on the right show the variability in response between animals for ER (B), Vtg (D) and Zrp (F ) values were normalized to % maximum response.

PAGE 127

127 Figure 5 7 Dose response of ER Vtg and Zrp mRNA levels exposed to increasing concentrations of E 2 in liver slices obtained from control and dieldrin treated fish. The bars sho w means SE of the copy numbers for each treatment normalized to the copy number of the 18S rRNA present in liver slices from three fish, for ER (A), Vtg (B) and Zrp (C). The copy numbers were log 10 transformed prior to normalization. Different supersc ript letters (a, b, c) represent statistical differences between treatments with data from three individual fish, determined by nested mixed model ANOVA (treatment = fixed variable; fish = random variable, nested within control and dieldrin treatment); Sch effe post hoc test.

PAGE 128

128 CHAPTER 6 CONCLUSIONS AND FUTURE WORK The effects of EDCs on the ER signaling pathway are intricate, and can interfere with E 2 mediated gene regulation with detrimental effects to the overall health and performance of the animal. E 2 is especially important in the fine control of reproduction in female fish and d isruption in homeostasis during this process may have negative consequences on the reproduction potential of the animal (Forget Leray e t al. 2005) The effects of endocrine active compounds on male fish can have equally detrimental effects, as male fish exposed to estrogenic compounds can develop intersex gonads and have decreased reproductive fitness (Schmitt et al. 2005; Hinck et al. 2006) The increased number of aquatic contaminants that can target ER signaling has prompted the U.S. Environmental Protection Agency to encourage the use of cell based and in vitro assays to screen compounds that target ER signaling (U.S.EPA 1 998) In LMB, ER expression has been shown to be tissue dependent, with ER mRNA being predominantly expressed in the liver (Sabo Attwood et al. 2004) ER mRNA expression has previously been shown to be up regulated by plasma E 2 in LMB (Sabo Attwo od et al. 2004) as well as in other fish species (MacKay et al. 1996) This is the first study that used isoform specific antibodies for the LMB ER (Chapter 3) to characterize the protein expression profile in th e liver of female LMB during distinct stages of the reproductive cycle (Grier et al. 2007; Martyniuk et al. 2009; Uribe and Grier 2010) In the liver, the ER pattern of expression was distinct in the early stage ( cortical alveoli) from the later stages (late vitellogenesis and late maturation) of reproduction. ER mRNA increased with elevated levels of plasma E 2 indicating that ER mRNA

PAGE 129

129 expression is regulated in the liver by the circulating E 2 (Figure 3 6 ) ER steady state protein levels in the liver appear ed to follow a similar pattern of expression as the mRNA, with the exception of the late maturation stage, when a decrease in ER protein is observed (Figure 3 7 ) This coincided with peak levels of E 2 which may cause a rapid turn over of the proteins, with an increase d rate of degradation. ER protein regulation in fish in not known; however, in mammalian species it has been established that ligand bound ER protein is targeted for proteolysis by the proteo some (Valley et al. 2008; Powers et al. 2010) In the ovaries of LMB, transcript levels show that the predominant ERs expressed are ER a and ER b (Sabo Attwood et al. 2004) However, the function of nuclear ERs and the localization of ER transcripts in fish ovaries are not known. Moreover, due to the lack of isoforms specific antibodies, no information has previously been available on the protein expression of these isoform s in the female gonads. This study shows that ER a and ER b protein levels parallel the mRNA levels in whole ovarian tissues throughout different stages of the female reproductive cycle (Figures 3 8 and 3 9). The data indicate that the mRNA and protein levels peak ed in the ovaries during the early stag e of reproduction, and significantly decrease d as the oocytes mature ER mRNA was also measured in the ovaries, but the mRNA levels showed a slight increase in the later stages of development (Figure 3 10). Also, the ratios of ER s to ER show ed that mu ch higher transcript levels of ER s relative to ER are expressed during primary ovarian growth, and this is decreased during egg maturation. This indicates that in the ovaries, ER s may play a bigger role in primary oocyte development, whereas ER

PAGE 130

130 may be more important for egg maturation. However, the cell types in fish expressing these ERs are not known, which makes interpretation of these results difficult. Interestingly, ER b protein expression in the gonads showed that two splice variants of the rece ptor may be present during early ovarian growth. ER splice variants have been identified in humans (Daffada and Dowsett 1995) and fish species (Greytak and Callard 2007) some of which appear to be tissue specific A previous study looking at the LMB E Rs also showed that multiple mRNA transcript sizes were observed in LMB gonads (Sabo Attwood et al. 2004) This indicat es the existence of different splice variants of these receptors in LMB ovaries; however their functional significance remains to be elucidated. Furthering the knowledge of the mRNA and protein expression patterns of these receptors throughout the reproductive cycle of the LMB is important in order to understand the function of ERs in fish gonads. This may also allow researchers to predict stages in the reproductive cycle of the animal when it may be more vulnerable to environmental EDCs. Moreover, the stage in the reproductive cycle of a female should always be taken into account when studying the effects of EDCs on the ER signaling pathway as natural physiological fluctuations are significant. A different approach that could have been taken in this study in order to gain a better understanding of ER expression in female gonads at different stage s of reproduction would have been to remove the oocytes from the follicular cells. The follicular envelope can be removed from the oocytes using 0.03% hyaluronidase and manually removing the oocytes (Mishra and Joy 2006) This could be done at each stage of reproduction, therefore eliminating the issues encountered with the large

PAGE 131

131 oocytes that are present in the late vitellogenesis stage and late maturation stage. Another approach would have been to use in situ hyb ridization with isoforms specific probes to determine what cell types in the LMB ovary express the ERs. Future studies should focus on the regulation of the ER isoforms by E 2 Little is known about the feedback mechanisms involved in the regulation of thes e receptors in fish tissues. In vitro studies using either ovarian ex plants or liver slices could help elucidate some of the factors involved in tissue dependent E 2 mediated regulation of the LMB ER isoforms. ER mediated gene transcription is dependent on ligand receptor interactions and subsequent transactivation of the receptors. In this study, the ligand binding pockets of the three ERs were probed with molecules that should bind all three receptors, such as E 2 DDE and d ieldrin, as well as compounds that based on mammalian studies should be isoform specific, such as PPT and DPN. The LMB ERs were shown to bind and respond to E 2 in a similar manner (Chapter 4), and with much greater potency relative to the EDCs tested. Th e binding affinity of E 2 to the LMB ER and ER b were comparable to what has previously been observed in other animal species (Rider et al. 2009) demonstrating that the ability of ERs to interact with the endogenous ligand has been well conserved across species and isoforms. Both the binding and transactivation assays showed that PPT and DPN did not interact with the LMB ERs in an isoforms specific manner (Chapter 4). This was an important finding, because studies looking at the functional role of ER isoforms in regulating responsive genes in fish have used the mammalian specific agonists with the assumption that they will ac t in a similar manner (Leanos Castaneda and Van Der

PAGE 132

132 Kraak 2007) This highlights the importance of testing compounds in a physiologically relevant system, as ERs may interact with xenoestrogens in a species specifi c manner. The ability of the LMB ERs to interact with xenoestrogens was shown in this study to be isoforms specific (Chapter 4). Competitive binding assays (Figures 4 3 and 4 4) showed that all the compounds tested were able to fully displace E 2 from the LMB ER and acted as full agonists of ER ( Figure 4 7). In contrast to ER ER a and ER b were not fully activated by dieldrin (Figures 4 8 and 4 9). Dieldrin was shown to be only a weak, partial agonist of both ER s, and it was only able to partially displa ce E 2 from ER b in the binding assay. These differences in receptor ligand interactions observed may be due to differences in the ligand binding domains of the receptor (Sabo Attwood et al. 2004) Taken together, t his data show that receptor ligand interactions can be isoform specific, and therefore different xenoestrogens can have different responses depending on the ER isoforms activated. Moreover, effects elicited by EDCs in an organism may be tissue specific d epending on the ER isoforms expressed, and specific co factors (Cerillo et al. 1998; Larson et al. 2005) DDE, BPA and dieldrin on the E 2 signaling pathway in the liver of LMB, I d eveloped an in vitro liver slice assay In the time course exposure to 1 M E 2 maximal induction of ER mRNA levels were observed at 48 h post exposure, and the maximal induction of Vtg mRNA levels were seen after 24 h of exposure indicating that their e xpression is mediated by the genomic E 2 signaling pathway (Nagler et al. 2010) Interestingly, the maximal Zrp mRNA levels were observed at 1 h post exposure, indicating that Zrp induction may be mediated by a non genomic pathway. Estrogen signaling can be mediated by the G protein coupled

PAGE 133

133 membrane receptors (Thomas 2000; Boonyaratanakornkit and Edwards 2007; Filardo et al. 2007) The se membrane associated ERs can stimulate the mitogen activated protein kinase (MAPK) cascade (Bhargava et al. 2001; Bulayeva and Watson 2004) which leads to a rapid, non genomic response. In this study, liver slices from male LMB were also exposed for 48 h to increasing concentrations of E 2 (0 1 DDE (0 100 M), BPA (0 100 M) and dieldrin (0 100 M). Induction of ER Vtg and Zrp mRNA levels were used as biomarkers of exposure to estrogenic compounds (Heppell et al. 1995; Westerlund et al. 2001; Kn oebl et al. 2006; Hemmer et al. 2008) A significant induction in the mRNA levels of ER and Zrp was observed with exp o s u re to E 2 DDE and BPA (Chapter 5) Vtg mRNA up regulation was also observed with E 2 DDE and BPA (Chapter 5) It has been e stablished that E 2 regulates the expression of ER Vtg and Zrp however the functional roles of the nuclear ERs in Vtg regulation has not yet been elucidated. In this study, the in vitro liver assay was shown to be a more sensitive assay for ER mediated responses compared to the transfected HepG2 cells. Some of the loss in sensitivity could be due to the use of a heterologous system, because the LMB ERs were expressed in a mammalian cell line. Also, in the cellular context of the liver, the mechanisms o f action of EDCs are complex due to a number of factors (Figure 6 1). ER isoforms can interact with cell specific co factors (Stoica et al. 1999) and can form h omodimers, as well as heterodimers (Monroe et al. 2005; Savatier et al. 2010) Moreover, the promoter regions of responsive genes are complex, and ERs are able to initiate transcription of responsive genes by binding the EREs, as well as interactions

PAGE 134

134 with AP1 and Sp1 promoter sites (Zilliacus et al. 1995; Petit et al. 1999; Barkhem et al. 2002) making the liver slice assay physiologically relevant for xenoestrogen screening. Interestingly, dieldrin exposure did not up regulat e ER Vtg or Zrp mRNA, although it was shown to be a full agonist of ER It has been proposed that both ER and ER are needed for Vtg induction; however dieldrin only activates the LMB ER not ER a or ER b, which supports the hypothesis that ER and the ER s are needed for Vtg synthesis (Nelson and Habibi 2010) Moreover, two month dietary exposure of male LMB to 2.8 mg/kg body weight dieldrin appeared to inhibit the E 2 mediated induction of ER mRNA in liver sli ces obtained from those animals (Figure 5 7), suggesting that in vivo dieldrin may act as an anti estrogen. The differences observed between the transfection assays and liver slice assays with regard to the estrogenic potential of dieldrin highlights the importance of using multiple assays to aid in the classification of EDCs as potential xenoestrogens. It should be noted, that it would be difficult to predict toxic effects of EDCs in vivo based on in vitro studies, especially since the toxic endpoints ma y be tissue specific. However, the in vitro assays are useful for gaining a better understand ing of the modes of action of environmental EDCs. The binding and transactivation assays give information on the relative potency and efficacy of environmental es trogens for the individual fish ER isoforms, whereas the liver slice can give insight on the subsequent effects on the fish livers. Together, these assays can be useful high throughput screening tools for environmental estrogens. Future experiments follo wing this thesis should focus on gaining a better understanding on the functional role of ERs in ER Vtg and Zrp gene regulation. For

PAGE 135

135 this, the promoter regions of the genes can be cloned and putative EREs can be determined. Linking the promoters to a L uciferase assay, can be used to determine the regions in the promoters that are required for an ER mediated response. This can be done using deletion analysis of the respective promoter regions (Huang et al. 2011) and co transfection of the promoter L uciferase construct with the LMB ERs. Future studies are also needed to understand how E 2 binding to the receptors the cell This could be done using nucl ear fractions from liver slices treated with E 2 and chromatin immunoprecipitation can be used to assess the cofactors recruited to the promoter regions of E 2 responsive genes (Liu and Bagchi 2004) such as Vtg. In the aquatic environment, fish are usually exposed to mixtures of chemicals rather than to single compounds. Therefore, it is important to assess the effects of mixtures on the ER mediated gene expression. The liver slice assay has proved to be a sensiti ve assay for this. This assay should also be tested in future studies for potential use to evaluate the effects of contaminants from polluted water systems on ER mediated gene response. For this, liver slices can be directly exposed to water from differe nt polluted sites and gene responses can be assessed by microarrays or qPCR.

PAGE 136

136 Figure 6 1. Simplified schematic representation EDC interactions with the LMB ERs in liver tissue, and effects on downstream gene regulation. ER Vtg and Zrp are sensitive b iomarkers of exposure to various environmental xenoestrogens.

PAGE 137

137 LIST OF REFERENCES Andersen, H. R.,Vinggaard, A. M.,Rasmussen, T. H.,Gjermandsen, I. M.Bonefeld Jorgensen, E. C., 2002. Effects of currently used pesticides in assays for estrogenicity, androgenicity, and aromatase activity in vitro. Toxicol Appl Pharmacol 179, 1 12. Andreassen, T. K.,Skjoedt, K.,Anglade, I.,Kah, O.Korsgaard, B., 2003. Molecular cloning, characterisation, and tissue distribution of oestrogen receptor alpha in eelpout (Zoarces viviparus). Gen Comp Endocrinol 132, 356 368. Arukwe, A.Goksoyr, A., 2003. Eggshell and egg yolk proteins in fish: hepatic proteins for the next generation: oogenetic, population, and evolutionary implications of endocrine disruption. C omp Hepatol 2, 4. Arukwe, A.,Knudsen, F. R.Goksoyr, A., 1997. Fish zona radiata (eggshell) protein: a sensitive biomarker for environmental estrogens. Environ Health Perspect 105, 418 422. Auchus, R. J.Fuqua, S. A., 1994. Hormone nuclear receptor interacti ons in health and disease. The oestrogen receptor. Baillieres Clin Endocrinol Metab 8, 433 449. Barkhem, T.,Haldosen, L. A.,Gustafsson, J. A.Nilsson, S., 2002. Transcriptional synergism on the pS2 gene promoter between a p160 coactivator and estrogen recep tor alpha depends on the coactivator subtype, the type of estrogen response element, and the promoter context. Mol Endocrinol 16, 2571 2581. Barucca, M.,Canapa, A.,Olmo, E.Regoli, F., 2006. Analysis of vitellogenin gene induction as a valuable biomarker of estrogenic exposure in various Mediterranean fish species. Environ Res 101, 68 73. Beard, J., 2006. DDT and human health. Sci Total Environ 355, 78 89. Berg, A. H.,Westerlund, L.Olsson, P. E., 2004. Regulation of Arctic char (Salvelinus alpinus) egg shell proteins and vitellogenin during reproduction and in response to 17beta estradiol and cortisol. Gen Comp Endocrinol 135, 276 285. Bernanke, J.Kohler, H. R., 2009. The impact of environmental chemicals on wildlife vertebrates. Rev Environ Contam Toxicol 19 8, 1 47. Berry, N. B.,Fan, M.Nephew, K. P., 2008. Estrogen receptor alpha hinge region lysines 302 and 303 regulate receptor degradation by the proteasome. Mol Endocrinol 22, 1535 1551. Bhargava, R.,Naeem, R.,Marconi, S.,Luszcz, J.,Garb, J.,Gasparini, R.Ot is, C. N., 2001. Tyrosine kinase activation in breast carcinoma with correlation to HER 2/neu gene amplification and receptor overexpression. Hum Pathol 32, 1344 1350.

PAGE 138

138 Bjork, C.,Nenonen, H.,Giwercman, A.,Bergman, A.,Rylander, L.Giwercman, Y. L., 2011. Pers istent organic pollutants have dose and CAG repeat length dependent effects on androgen receptor activity in vitro. Reprod Toxicol 32, 293 297. Blocksom, K. A.,Walters, D. M.,Jicha, T. M.,Lazorchak, J. M.,Angradi, T. R.Bolgrien, D. W., 2010. Persistent org anic pollutants in fish tissue in the mid continental great rivers of the United States. Sci Total Environ 408, 1180 1189. Blum, J. L.,James, M. O.,Stuchal, L. D.Denslow, N. D., 2008. Stimulation of transactivation of the largemouth bass estrogen receptors alpha, beta a, and beta b by methoxychlor and its mono and bis demethylated metabolites in HepG2 cells. J Steroid Biochem Mol Biol 108, 55 63. Blum, J. L.,Nyagode, B. A.,James, M. O.Denslow, N. D., 2008. Effects of the pesticide methoxychlor on gene expr ession in the liver and testes of the male largemouth bass (Micropterus salmoides). Aquat Toxicol 86, 459 469. Boonyaratanakornkit, V.Edwards, D. P., 2007. Receptor mechanisms mediating non genomic actions of sex steroids. Semin Reprod Med 25, 139 153. Bou ma, J.Nagler, J. J., 2001. Estrogen receptor alpha protein localization in the testis of the rainbow trout (Oncorhynchus mykiss) during different stages of the reproductive cycle. Biol Reprod 65, 60 65. Bowman, C. J.Denslow, N. D., 1999. Development and va lidation of a species and gene specific molecular biomarker: Vitellogenin mRNA in largemouth bass (Micropterus salmoides). Ecotoxicology 8, 399 416. Bowman, C. J.,Kroll, K. J.,Gross, T. G.Denslow, N. D., 2002. Estradiol induced gene expression in largemou th bass (Micropterus salmoides). Mol Cell Endocrinol 196, 67 77. Brandt, M. E.Vickery, L. E., 1997. Cooperativity and dimerization of recombinant human estrogen receptor hormone binding domain. J Biol Chem 272, 4843 4849. Brian, J. V.,Harris, C. A.,Scholze M.,Kortenkamp, A.,Booy, P.,Lamoree, M.,Pojana, G.,Jonkers, N.,Marcomini, A.Sumpter, J. P., 2007. Evidence of estrogenic mixture effects on the reproductive performance of fish. Environ Sci Technol 41, 337 344. Bro Rasmussen, F., 1996. Contamination by pe rsistent chemicals in food chain and human health. Sci Total Environ 188 Suppl 1, S45 60. Brzozowski, A. M.,Pike, A. C.,Dauter, Z.,Hubbard, R. E.,Bonn, T.,Engstrom, O.,Ohman, L.,Greene, G. L.,Gustafsson, J. A.Carlquist, M., 1997. Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389, 753 758.

PAGE 139

139 Bulayeva, N. N.Watson, C. S., 2004. Xenoestrogen induced ERK 1 and ERK 2 activation via multiple membrane initiated signaling pathways. Environ Health Perspect 112, 1481 1487. Burridge, E., 20 03. Bisphenol A: product profile. Eur Chem News 17. Byers, M.,Kuiper, G. G.,Gustafsson, J. A.Park Sarge, O. K., 1997. Estrogen receptor beta mRNA expression in rat ovary: down regulation by gonadotropins. Mol Endocrinol 11, 172 182. Carlson, D. L.,De Vault D. S.Swackhamer, D. L., 2010. On the rate of decline of persistent organic contaminants in lake trout (Salvelinus namaycush) from the Great Lakes, 1970 2003. Environ Sci Technol 44, 2004 2010. Carrera, E. P.,Garcia Lopez, A.,Martin del Rio Mdel, P.,Marti nez Rodriguez, G.,Sole, M.Mancera, J. M., 2007. Effects of 17beta estradiol and 4 nonylphenol on osmoregulation and hepatic enzymes in gilthead sea bream (Sparus auratus). Comp Biochem Physiol C Toxicol Pharmacol 145, 210 217. Celius, T.,Matthews, J. B.,Gi esy, J. P.Zacharewski, T. R., 2000. Quantification of rainbow trout (Oncorhynchus mykiss) zona radiata and vitellogenin mRNA levels using real time PCR after in vivo treatment with estradiol 17 beta or alpha zearalenol. J Steroid Biochem Mol Biol 75, 109 1 19. Cerillo, G.,Rees, A.,Manchanda, N.,Reilly, C.,Brogan, I.,White, A.Needham, M., 1998. The oestrogen receptor regulates NFkappaB and AP 1 activity in a cell specific manner. J Steroid Biochem Mol Biol 67, 79 88. Cheek, A. O.,Brouwer, T. H.,Carroll, S.,Ma nning, S.,McLachlan, J. A.Brouwer, M., 2001. Experimental evaluation of vitellogenin as a predictive biomarker for reproductive disruption. Environ Health Perspect 109, 681 690. Chen, C. W.,Hurd, C.,Vorojeikina, D. P.,Arnold, S. F.Notides, A. C., 1997. Tra nscriptional activation of the human estrogen receptor by DDT isomers and metabolites in yeast and MCF 7 cells. Biochem Pharmacol 53, 1161 1172. Chen, P. J.,Kullman, S. W.,Hinton, D. E.Linden, K. G., 2007. Comparisons of polychromatic and monochromatic UV based treatments of bisphenol A in water via toxicity assessments. Chemosphere 68, 1041 1049. Choi, C. Y.Habibi, H. R., 2003. Molecular cloning of estrogen receptor alpha and expression pattern of estrogen receptor subtypes in male and female goldfish. Mol Cell Endocrinol 204, 169 177. Clayton, E. M.,Todd, M.,Dowd, J. B.Aiello, A. E., 2011. The impact of bisphenol A and triclosan on immune parameters in the U.S. population, NHANES 2003 2006. Environ Health Perspect 119, 390 396.

PAGE 140

140 Clelland, E.Peng, C., 2009. Endocrine/paracrine control of zebrafish ovarian development. Mol Cell Endocrinol 312, 42 52. Conner, S. J.Hughes, D. C., 2003. Analysis of fish ZP1/ZPB homologous genes -evidence for both genome duplication and species specific amplification models of evo lution. Reproduction 126, 347 352. Correia, A. D.,Freitas, S.,Scholze, M.,Goncalves, J. F.,Booij, P.,Lamoree, M. H.,Mananos, E.Reis Henriques, M. A., 2007. Mixtures of estrogenic chemicals enhance vitellogenic response in sea bass. Environ Health Perspect 115 Suppl 1, 115 121. Crain, D. A.,Eriksen, M.,Iguchi, T.,Jobling, S.,Laufer, H.,LeBlanc, G. A.Guillette, L. J., Jr., 2007. An ecological assessment of bisphenol A: evidence from comparative biology. Reprod Toxicol 24, 225 239. Daffada, A. A.Dowsett, M., 1 995. Tissue dependent expression of a novel splice variant of the human oestrogen receptor. J Steroid Biochem Mol Biol 55, 413 421. Dang, Z., 2010. Comparison of relative binding affinities to fish and mammalian estrogen receptors: the regulatory implicati ons. Toxicol Lett 192, 298 315. Davis, L. K.,Katsu, Y.,Iguchi, T.,Lerner, D. T.,Hirano, T.Grau, E. G., 2010. Transcriptional activity and biological effects of mammalian estrogen receptor ligands on three hepatic estrogen receptors in Mozambique tilapia. J Steroid Biochem Mol Biol 122, 272 278. de Kanter, R.,Monshouwer, M.,Meijer, D. K.Groothuis, G. M., 2002. Precision cut organ slices as a tool to study toxicity and metabolism of xenobiotics with special reference to non hepatic tissues. Curr Drug Metab 3, 39 59. De Metrio, G.,Corriero, A.,Desantis, S.,Zubani, D.,Cirillo, F.,Deflorio, M.,Bridges, C. R.,Eicker, J.,de la Serna, J. M.,Megalofonou, P.Kime, D. E., 2003. Evidence of a high percentage of intersex in the Mediterranean swordfish (Xiphias gladius L.) Mar Pollut Bull 46, 358 361. de Mora, S.,Fowler, S. W.,Tolosa, I.,Villeneuve, J. P.Cattini, C., 2005. Chlorinated hydrocarbons in marine biota and coastal sediments from the Gulf and Gulf of Oman. Mar Pollut Bull 50, 835 849. Denslow, N. D.,Kocerha, J.,S epulveda, M. S.,Gross, T.Holm, S. E., 2004. Gene expression fingerprints of largemouth bass (Micropterus salmoides) exposed to pulp and paper mill effluents. Mutat Res 552, 19 34. Ee, P. L.,Kamalakaran, S.,Tonetti, D.,He, X.,Ross, D. D.Beck, W. T., 2004. I dentification of a novel estrogen response element in the breast cancer resistance protein (ABCG2) gene. Cancer Res 64, 1247 1251.

PAGE 141

141 Ekena, K.,Weis, K. E.,Katzenellenbogen, J. A.Katzenellenbogen, B. S., 1996. Identification of amino acids in the hormone bind ing domain of the human estrogen receptor important in estrogen binding. J Biol Chem 271, 20053 20059. El Tanani, M. K.Green, C. D., 1997. Two separate mechanisms for ligand independent activation of the estrogen receptor. Mol Endocrinol 11, 928 937. El Kh issiin, A.Leclercq, G., 1999. Implication of proteasome in estrogen receptor degradation. FEBS Lett 448, 160 166. Eldridge, J. C.,Stevens, J. T.Breckenridge, C. B., 2008. Atrazine interaction with estrogen expression systems. Rev Environ Contam Toxicol 196 147 160. Elferink, M. G.,Olinga, P.,Draaisma, A. L.,Merema, M. T.,Bauerschmidt, S.,Polman, J.,Schoonen, W. G.Groothuis, G. M., 2008. Microarray analysis in rat liver slices correctly predicts in vivo hepatotoxicity. Toxicol Appl Pharmacol 229, 300 309. E scande, A.,Pillon, A.,Servant, N.,Cravedi, J. P.,Larrea, F.,Muhn, P.,Nicolas, J. C.,Cavailles, V.Balaguer, P., 2006. Evaluation of ligand selectivity using reporter cell lines stably expressing estrogen receptor alpha or beta. Biochem Pharmacol 71, 1459 14 69. Esterhuyse, M. M.,Venter, M.,Veldhoen, N.,Helbing, C. C.van Wyk, J. H., 2009. Characterization of vtg 1 mRNA expression during ontogeny in Oreochromis mossambicus (PETERS). J Steroid Biochem Mol Biol 117, 42 49. Fan, M.,Bigsby, R. M.Nephew, K. P., 2003 The NEDD8 pathway is required for proteasome mediated degradation of human estrogen receptor (ER) alpha and essential for the antiproliferative activity of ICI 182,780 in ERalpha positive breast cancer cells. Mol Endocrinol 17, 356 365. Filardo, E.,Quinn J.,Pang, Y.,Graeber, C.,Shaw, S.,Dong, J.Thomas, P., 2007. Activation of the novel estrogen receptor G protein coupled receptor 30 (GPR30) at the plasma membrane. Endocrinology 148, 3236 3245. Filby, A. L.Tyler, C. R., 2005. Molecular characterization of estrogen receptors 1, 2a, and 2b and their tissue and ontogenic expression profiles in fathead minnow (Pimephales promelas). Biol Reprod 73, 648 662. Fleming, J. G.,Spencer, T. E.,Safe, S. H.Bazer, F. W., 2006. Estrogen regulates transcription of the ovin e oxytocin receptor gene through GC rich SP1 promoter elements. Endocrinology 147, 899 911. Flint, A. P.,Sheldrick, E. L.Fisher, P. A., 2002. Ligand independent activation of steroid receptors. Domest Anim Endocrinol 23, 13 24.

PAGE 142

142 Flouriot, G.,Pakdel, F.,Duco uret, B.,Ledrean, Y.Valotaire, Y., 1997. Differential regulation of two genes implicated in fish reproduction: vitellogenin and estrogen receptor genes. Mol Reprod Dev 48, 317 323. Forget Leray, J.,Landriau, I.,Minier, C.Leboulenger, F., 2005. Impact of en docrine toxicants on survival, development, and reproduction of the estuarine copepod Eurytemora affinis (Poppe). Ecotoxicol Environ Saf 60, 288 294. Freitas, J.,Cano, P.,Craig Veit, C.,Goodson, M. L.,Furlow, J. D.Murk, A. J., 2011. Detection of thyroid ho rmone receptor disruptors by a novel stable in vitro reporter gene assay. Toxicol In Vitro 25, 257 266. Frigo, D. E.,Burow, M. E.,Mitchell, K. A.,Chiang, T. C.McLachlan, J. A., 2002. DDT and its metabolites alter gene expression in human uterine cell lines through estrogen receptor independent mechanisms. Environ Health Perspect 110, 1239 1245. Fu, K. Y.,Chen, C. Y.,Lin, C. T.Chang, W. M., 2008. Molecular cloning and tissue distribution of three estrogen receptors from the cyprinid fish Varicorhinus barbatu lus. J Comp Physiol B 178, 189 197. Gaido, K. W.,Maness, S. C.,McDonnell, D. P.,Dehal, S. S.,Kupfer, D.Safe, S., 2000. Interaction of methoxychlor and related compounds with estrogen receptor alpha and beta, and androgen receptor: structure activity studie s. Mol Pharmacol 58, 852 858. Garcia Reyero, N.,Barber, D. S.,Gross, T. S.,Johnson, K. G.,Sepulveda, M. S.,Szabo, N. J.Denslow, N. D., 2006. Dietary exposure of largemouth bass to OCPs changes expression of genes important for reproduction. Aquat Toxicol 7 8, 358 369. Genovese, G.,Da Cuna, R.,Towle, D. W.,Maggese, M. C.Lo Nostro, F., 2011. Early expression of zona pellucida proteins under octylphenol exposure in Cichlasoma dimerus (Perciformes, Cichlidae). Aquat Toxicol 101, 175 185. Gerbron, M.,Geraudie, P. ,Rotchell, J.Minier, C., 2010. A new in vitro screening bioassay for the ecotoxicological evaluation of the estrogenic responses of environmental chemicals using roach (Rutilus rutilus) liver explant culture. Environ Toxicol 25, 510 516. Gibson, J. E., 201 0. An Integrated Summary of Commentary on The National Academy of Sciences Report on "Toxicity Testing in the 21st Century: A Vision and a Strategy". Human & Experimental Toxicology 29, 33 35. Glidewell Kenney, C.,Weiss, J.,Lee, E. J.,Pillai, S.,Ishikawa, T.,Ariazi, E. A.Jameson, J. L., 2005. ERE independent ERalpha target genes differentially expressed in human breast tumors. Mol Cell Endocrinol 245, 53 59.

PAGE 143

143 Gomez Lechon, M. J.,Lahoz, A.,Gombau, L.,Castell, J. V.Donato, M. T., 2010. In vitro evaluation of p otential hepatotoxicity induced by drugs. Curr Pharm Des 16, 1963 1977. Gonzalez, J. F.,Del Valle, P. L.,Thohan, S.Kane, A. S., 2000. Effects of waterborne nitrite on phase I II biotransformation in channel catfish (Ictalurus punctatus). Mar Environ Res 50 29 32. Gougelet, A.,Bouclier, C.,Marsaud, V.,Maillard, S.,Mueller, S. O.,Korach, K. S.Renoir, J. M., 2005. Estrogen receptor alpha and beta subtype expression and transactivation capacity are differentially affected by receptor hsp90 and immunophilin ligands in human breast cancer cells. J Steroid Biochem Mol Biol 94, 71 81. Gray, L. E., Jr.,Ostby, J.,Wilson, V.,Lambright, C.,Bobseine, K.,Hartig, P.,Hotchkiss, A.,Wolf, C.,Furr, J.,Price, M.,Parks, L.,Cooper, R. L.,Stoker, T. E.,Laws, S. C.,Degitz, S. J .,Jensen, K. M.,Kahl, M. D.,Korte, J. J.,Makynen, E. A.,Tietge, J. E.Ankley, G. T., 2002. Xenoendocrine disrupters tiered screening and testing: filling key data gaps. Toxicology 181 182, 371 382. Green, K. A.Carroll, J. S., 2007. Oestrogen receptor mediat ed transcription and the influence of co factors and chromatin state. Nat Rev Cancer 7, 713 722. Greytak, S. R.Callard, G. V., 2007. Cloning of three estrogen receptors (ER) from killifish (Fundulus heteroclitus): differences in populations from polluted a nd reference environments. Gen Comp Endocrinol 150, 174 188. Grier, H., 2000. Ovarian germinal epithelium and folliculogenesis in the common snook, Centropomus undecimalis (Teleostei: centropomidae). J Morphol 243, 265 281. Grier, H. J.,Uribe, M. C.Parenti L. R., 2007. Germinal epithelium, folliculogenesis, and postovulatory follicles in ovaries of rainbow trout, Oncorhynchus mykiss (Walbaum, 1792) (Teleostei, protacanthopterygii, salmoniformes). J Morphol 268, 293 310. Grier, H. J.,Uribe, M. C.,Patino, R. 2009. The ovary, folliculogenesis,and oogenesis in teleosts. In: Jamieson B, editor. Reproductive Biology and Phylogeny of Fish (Agnatha and Osteichthyes). NH, USA; Plymouth, UK:, Science Publishers, Inc. Groneberg, D. A.,Grosse Siestrup, C.Fischer, A., 2002. In vitro models to study hepatotoxicity. Toxicol Pathol 30, 394 399. Guillette, L. J., Jr., 2000. Contaminant induced endocrine disruption in wildlife. Growth Horm IGF Res 10 Suppl B, S45 50. Gustafsson, J. A., 2003. What pharmacologists can learn fr om recent advances in estrogen signalling. Trends Pharmacol Sci 24, 479 485.

PAGE 144

144 Halm, S.,Martinez Rodriguez, G.,Rodriguez, L.,Prat, F.,Mylonas, C. C.,Carrillo, M.Zanuy, S., 2004. Cloning, characterisation, and expression of three oestrogen receptors (ERalpha, ERbeta1 and ERbeta2) in the European sea bass, Dicentrarchus labrax. Mol Cell Endocrinol 223, 63 75. Harrington, W. R.,Sheng, S.,Barnett, D. H.,Petz, L. N.,Katzenellenbogen, J. A.Katzenellenbogen, B. S., 2003. Activities of estrogen receptor alpha and be ta selective ligands at diverse estrogen responsive gene sites mediating transactivation or transrepression. Mol Cell Endocrinol 206, 13 22. Harshbarger, J. C.,Coffey, M. J.Young, M. Y., 2000. Intersexes in Mississippi River shovelnose sturgeon sampled bel ow Saint Louis, Missouri, USA. Mar Environ Res 50, 247 250. Hartig, P. C.Cardon, M. C., 1992. Rapid efficient production of baculovirus expression vectors. J Virol Methods 38, 61 70. Hashimoto, S.,Bessho, H.,Hara, A.,Nakamura, M.,Iguchi, T.Fujita, K., 2000 Elevated serum vitellogenin levels and gonadal abnormalities in wild male flounder (Pleuronectes yokohamae) from Tokyo Bay, Japan. Mar Environ Res 49, 37 53. Hawkins, M. B.,Godwin, J.,Crews, D.Thomas, P., 2005. The distributions of the duplicate oestroge n receptors ER beta a and ER beta b in the forebrain of the Atlantic croaker (Micropogonias undulatus): evidence for subfunctionalization after gene duplication. Proc Biol Sci 272, 633 641. Hawkins, M. B.,Thornton, J. W.,Crews, D.,Skipper, J. K.,Dotte, A.T homas, P., 2000. Identification of a third distinct estrogen receptor and reclassification of estrogen receptors in teleosts. Proc Natl Acad Sci U S A 97, 10751 10756. Hemmer, M. J.,Cripe, G. M.,Hemmer, B. L.,Goodman, L. R.,Salinas, K. A.,Fournie, J. W.Wal ker, C. C., 2008. Comparison of estrogen responsive plasma protein biomarkers and reproductive endpoints in sheepshead minnows exposed to 17beta trenbolone. Aquat Toxicol 88, 128 136. Heppell, S. A.,Denslow, N. D.,Folmar, L. C.Sullivan, C. V., 1995. Univer sal assay of vitellogenin as a biomarker for environmental estrogens. Environ Health Perspect 103 Suppl 7, 9 15. Hinck, J. E.,Blazer, V. S.,Denslow, N. D.,Echols, K. R.,Gale, R. W.,Wieser, C.,May, T. W.,Ellersieck, M.,Coyle, J. J.Tillitt, D. E., 2008. Chem ical contaminants, health indicators, and reproductive biomarker responses in fish from rivers in the Southeastern United States. Sci Total Environ 390, 538 557. Hinck, J. E.,Blazer, V. S.,Denslow, N. D.,Echols, K. R.,Gross, T. S.,May, T. W.,Anderson, P. J .,Coyle, J. J.Tillitt, D. E., 2007. Chemical contaminants, health indicators, and reproductive biomarker responses in fish from the Colorado River and its tributaries. Sci Total Environ 378, 376 402.

PAGE 145

145 Hinck, J. E.,Blazer, V. S.,Schmitt, C. J.,Papoulias, D. M.Tillitt, D. E., 2009. Widespread occurrence of intersex in black basses (Micropterus spp.) from U.S. rivers, 1995 2004. Aquat Toxicol 95, 60 70. Hinck, J. E.,Schmitt, C. J.,Blazer, V. S.,Denslow, N. D.,Bartish, T. M.,Anderson, P. J.,Coyle, J. J.,Dethloff G. M.Tillitt, D. E., 2006. Environmental contaminants and biomarker responses in fish from the Columbia River and its tributaries: spatial and temporal trends. Sci Total Environ 366, 549 578. Hinck, J. E.,Schmitt, C. J.,Ellersieck, M. R.Tillitt, D. E., 2 008. Relations between and among contaminant concentrations and biomarkers in black bass (Micropterus spp.) and common carp (Cyprinus carpio) from large U.S. rivers, 1995 2004. J Environ Monit 10, 1499 1518. Houde, M.,Muir, D. C.,Kidd, K. A.,Guildford, S., Drouillard, K.,Evans, M. S.,Wang, X.,Whittle, D. M.,Haffner, D.Kling, H., 2008. Influence of lake characteristics on the biomagnification of persistent organic pollutants in lake trout food webs. Environ Toxicol Chem 27, 2169 2178. Huang, C.,Zhou, T.,Chen, Y.,Sun, T.,Zhang, S.Chen, G., 2011. Estrogen related receptor ERRalpha mediated downregulation of human hydroxysteroid sulfotransferase (SULT2A1) in Hep G2 cells. Chem Biol Interact 192, 264 271. Huang, E. J.,Wu, C. C.,Lee, S. D.,Chen, J. H.,Liu, J. Y.,Ko J. L.,Lin, J. A.,Lu, M. C.,Chen, L. M.,Huang, C. Y.Kuo, W. W., 2006. Opposing action of estrogen receptors alpha and beta on tumor necrosis factor alpha gene expression and caspase 8 mediated apoptotic effects in HA22T cells. Mol Cell Biochem 287, 137 14 5. Huang, P.,Chandra, V.Rastinejad, F., 2010. Structural overview of the nuclear receptor superfamily: insights into physiology and therapeutics. Annu Rev Physiol 72, 247 272. Huang, W.,Zhang, Y.,Jia, X.,Ma, X.,Li, S.,Liu, Y.,Zhu, P.,Lu, D.,Zhao, H.,Luo, W .,Yi, S.,Liu, X.Lin, H., 2010. Distinct expression of three estrogen receptors in response to bisphenol A and nonylphenol in male Nile tilapias (Oreochromis niloticus). Fish Physiol Biochem 36, 237 249. Iwanowicz, L. R.,Blazer, V. S.,Guy, C. P.,Pinkney, A. E.,Mullican, J. E.Alvarez, D. A., 2009. Reproductive health of bass in the Potomac, U.S.A., drainage: part 1. Exploring the effects of proximity to wastewater treatment plant discharge. Environ Toxicol Chem 28, 1072 1083. Jackson, U. T., 1979. Controlled Spawning of Largemouth Bass. Progressive Fish Culturist 41, 90 95. Jalabert, B., 2005. Particularities of reproduction and oogenesis in teleost fish compared to mammals. Reprod Nutr Dev 45, 261 279.

PAGE 146

146 Jorgenson, J. L., 2001. Aldrin and dieldrin: a review of research on their production, environmental deposition and fate, bioaccumulation, toxicology, and epidemiology in the United States. Environ Health Perspect 109 Suppl 1, 113 139. Katsu, Y.,Kohno, S.,Narita, H.,Urushitani, H.,Yamane, K.,Hara, A.,Clauss, T. M.,Walsh, M. T.,Miyagawa, S.,Guillette, L. J., Jr.Iguchi, T., 2010. Cloning and functional characterization of Chondrichthyes, cloudy catshark, Scyliorhinus torazame and whale shark, Rhincodon typus estrogen receptors. Gen Comp Endocrinol 168, 496 504. Kav lock, R. J.,Daston, G. P.,DeRosa, C.,Fenner Crisp, P.,Gray, L. E.,Kaattari, S.,Lucier, G.,Luster, M.,Mac, M. J.,Maczka, C.,Miller, R.,Moore, J.,Rolland, R.,Scott, G.,Sheehan, D. M.,Sinks, T.Tilson, H. A., 1996. Research needs for the risk assessment of hea lth and environmental effects of endocrine disruptors: a report of the U.S. EPA sponsored workshop. Environ Health Perspect 104 Suppl 4, 715 740. Kelce, W. R.,Stone, C. R.,Laws, S. C.,Gray, L. E.,Kemppainen, J. A.Wilson, E. M., 1995. Persistent DDT metabol ite p,p' DDE is a potent androgen receptor antagonist. Nature 375, 581 585. Keller, A.,Nesvizhskii, A. I.,Kolker, E.Aebersold, R., 2002. Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search. Anal Chem 74, 5383 5392. Khan, I. A.,Mathews, S.,Okuzawa, K.,Kagawa, H.Thomas, P., 2001. Alterations in the GnRH LH system in relation to gonadal stage and Aroclor 1254 exposure in Atlantic croaker. Comp Biochem Physiol B Biochem Mol Biol 129, 251 259. Klinge, C. M., 2001. Estrogen receptor interaction with estrogen response elements. Nucleic Acids Res 29, 2905 2919. Klinge, C. M.,Jernigan, S. C.,Mattingly, K. A.,Risinger, K. E.Zhang, J., 2004. Estrogen response element dependent regulation of transcriptional a ctivation of estrogen receptors alpha and beta by coactivators and corepressors. J Mol Endocrinol 33, 387 410. Knoebl, I.,Blum, J. L.,Hemmer, M. J.Denslow, N. D., 2006. Temporal gene induction patterns in sheepshead minnows exposed to 17beta estradiol. J E xp Zool A Comp Exp Biol 305, 707 719. Kocerha, J.,Prucha, M. S.,Kroll, K. J.,Steinhilber, D.Denslow, N., 2010. Regulation of steroidogenic acute regulatory protein transcription in largemouth bass by orphan nuclear receptor signaling pathways. Endocrinolog y 151, 341 349.

PAGE 147

147 Krewski, D.,Acosta, D.,Andersen, M.,Anderson, H.,Bailar, J. C.,Boekelheide, K.,Brent, R.,Charnley, G.,Cheung, V. G.,Green, S.,Kelsey, K. T.,Kerkvliet, N. I.,Li, A. A.,McCray, L.,Meyer, O.,Patterson, R. D.,Pennie, W.,Scala, R. A.,Solomon, G. M.,Stephens, M.,Yager, J.,Zeise, L.Assess, S. C. T. T., 2010. Toxicity Testing in the 21st Century: A Vision and a Strategy. Journal of Toxicology and Environmental Health Part B Critical Reviews 13, 51 138. Kuiper, G. G.,Carlsson, B.,Grandien, K.,Enmark, E.,Haggblad, J.,Nilsson, S.Gustafsson, J. A., 1997. Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors alpha and beta. Endocrinology 138, 863 870. Kuiper, G. G.,Lemmen, J. G.,Carlsson, B.,Corton, J. C.,Sa fe, S. H.,van der Saag, P. T.,van der Burg, B.Gustafsson, J. A., 1998. Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor beta. Endocrinology 139, 4252 4263. Kumar, V.,Green, S.,Stack, G.,Berry, M.,Jin, J. R.Chambon, P., 1987. Fu nctional domains of the human estrogen receptor. Cell 51, 941 951. Kwak, H. I.,Bae, M. O.,Lee, M. H.,Lee, Y. S.,Lee, B. J.,Kang, K. S.,Chae, C. H.,Sung, H. J.,Shin, J. S.,Kim, J. H.,Mar, W. C.,Sheen, Y. Y.Cho, M. H., 2001. Effects of nonylphenol, bisphenol A, and their mixture on the viviparous swordtail fish (Xiphophorus helleri). Environ Toxicol Chem 20, 787 795. Larson, C. J.,Osburn, D. L.,Schmitz, K.,Giampa, L.,Mong, S. M.,Marschke, K.,Seidel, H. M.,Rosen, J.Negro Vilar, A., 2005. Peptide binding identi fies an ERalpha conformation that generates selective activity in multiple in vitro assays. J Biomol Screen 10, 590 598. Leanos Castaneda, O.Van Der Kraak, G., 2007. Functional characterization of estrogen receptor subtypes, ERalpha and ERbeta, mediating v itellogenin production in the liver of rainbow trout. Toxicol Appl Pharmacol 224, 116 125. Lee, C.,Na, J. G.,Lee, K. C.Park, K., 2002. Choriogenin mRNA induction in male medaka, Oryzias latipes as a biomarker of endocrine disruption. Aquat Toxicol 61, 233 241. Lemaire, B.,Beck, M.,Jaspart, M.,Debier, C.,Calderon, P. B.,Thome, J. P.Rees, J. F., 2011. Precision Cut Liver Slices of Salmo salar as a tool to investigate the oxidative impact of CYP1A mediated PCB 126 and 3 methylcholanthrene metabolism. Toxicol I n Vitro 25, 335 342. Lemaire, G.,Mnif, W.,Mauvais, P.,Balaguer, P.Rahmani, R., 2006. Activation of alpha and beta estrogen receptors by persistent pesticides in reporter cell lines. Life Sci 79, 1160 1169. Lindholst, C.,Pedersen, S. N.Bjerregaard, P., 200 1. Uptake, metabolism and excretion of bisphenol A in the rainbow trout (Oncorhynchus mykiss). Aquat Toxicol 55, 75 84.

PAGE 148

148 Liu, M. M.,Albanese, C.,Anderson, C. M.,Hilty, K.,Webb, P.,Uht, R. M.,Price, R. H., Jr.,Pestell, R. G.Kushner, P. J., 2002. Opposing act ion of estrogen receptors alpha and beta on cyclin D1 gene expression. J Biol Chem 277, 24353 24360. Liu, X. F.Bagchi, M. K., 2004. Recruitment of distinct chromatin modifying complexes by tamoxifen complexed estrogen receptor at natural target gene promot ers in vivo. J Biol Chem 279, 15050 15058. Liu, Z. H.,Zhang, Y. G.Wang, D. S., 2008. Studies on feminization, sex determination, and differentiation of the Southern catfish, Silurus meridionalis a review. Fish Physiol Biochem. Liu, Z. H.,Zhang, Y. G.Wang, D. S., 2010. Studies on feminization, sex determination, and differentiation of the Southern catfish, Silurus meridionalis -a review. Fish Physiol Biochem 36, 223 235. Lutton, B. V.Callard, I. P., 2008. Influence of reproductive activity, sex steroids, and seasonality on epigonal organ cellular proliferation in the skate (Leucoraja erinacea). Gen Comp Endocrinol 155, 116 125. MacKay, M. E.,Raelson, J.Lazier, C. B., 1996. Up regulation of estrogen receptor mRNA and estrogen receptor activity by estradiol in liver of rainbow trout and other teleostean fish. Comp Biochem Physiol C Pharmacol Toxicol Endocrinol 115, 201 209. Mallin, M. A.,McIver, M. R.,Fulton, M.Wirth, E., 2011. Elevated Levels of Metals and Organic Pollutants in Fish and Clams in the Cape Fear R iver Watershed. Arch Environ Contam Toxicol. Mandich, A.,Bottero, S.,Benfenati, E.,Cevasco, A.,Erratico, C.,Maggioni, S.,Massari, A.,Pedemonte, F.Vigano, L., 2007. In vivo exposure of carp to graded concentrations of bisphenol A. Gen Comp Endocrinol 153, 1 5 24. Maradonna, F.Carnevali, O., 2007. Vitellogenin, zona radiata protein, cathepsin D and heat shock protein 70 as biomarkers of exposure to xenobiotics. Biomarkers 12, 240 255. Marin, M. G.Matozzo, V., 2004. Vitellogenin induction as a biomarker of expo sure to estrogenic compounds in aquatic environments. Mar Pollut Bull 48, 835 839. Mariscal Arcas, M.,Rivas, A.,Granada, A.,Monteagudo, C.,Murcia, M. A.Olea Serrano, F., 2009. Dietary exposure assessment of pregnant women to bisphenol A from cans and micro wave containers in Southern Spain. Food Chem Toxicol 47, 506 510. Markey, C. M.,Rubin, B. S.,Soto, A. M.Sonnenschein, C., 2002. Endocrine disruptors: from Wingspread to environmental developmental biology. J Steroid Biochem Mol Biol 83, 235 244.

PAGE 149

149 Martyniuk, C. J.,Doperalski, N.,Kroll, K. J.,Barber, D. S.Denslow, N. D., in preparation. Gene set and sub network enrichment analysis reveals sexually dimorphic responses in the largemouth bass (Micropterus salmoides) hypothalamus to dieldrin. Martyniuk, C. J.,Fesw ick, A.,Spade, D. J.,Kroll, K. J.,Barber, D. S.Denslow, N. D., 2010. Effects of acute dieldrin exposure on neurotransmitters and global gene transcription in largemouth bass (Micropterus salmoides) hypothalamus. Neurotoxicology 31, 356 366. Martyniuk, C. J .,Feswick, A.,Spade, D. J.,Kroll, K. J.,Barber, D. S.Denslow, N. D., 2010b. Effects of acute dieldrin exposure on neurotransmitters and global gene transcription in largemouth bass (Micropterus salmoides) hypothalamus. Neurotoxicology 31, 356 366. Martyniu k, C. J.,Kroll, K. J.,Doperalski, N. J.,Barber, D. S.Denslow, N. D., 2010a. Genomic and proteomic responses to environmentally relevant exposures to dieldrin: indicators of neurodegeneration? Toxicol Sci 117, 190 199. Martyniuk, C. J.,Kroll, K. J.,Porak, W F.,Steward, C.,Grier, H. J.Denslow, N. D., 2009. Seasonal relationship between gonadotropin, growth hormone, and estrogen receptor mRNA expression in the pituitary gland of largemouth bass. Gen Comp Endocrinol 163, 306 317. Matthews, J.,Celius, T.,Halgre n, R.Zacharewski, T., 2000. Differential estrogen receptor binding of estrogenic substances: a species comparison. J Steroid Biochem Mol Biol 74, 223 234. Meng, X.,Bartholomew, C.Craft, J. A., 2010. Differential expression of vitellogenin and oestrogen rec eptor genes in the liver of zebrafish, Danio rerio. Anal Bioanal Chem 396, 625 630. Mills, L. J.Chichester, C., 2005. Review of evidence: are endocrine disrupting chemicals in the aquatic environment impacting fish populations? Sci Total Environ 343, 1 34. Mishra, A.Joy, K. P., 2006. Effects of gonadotrophin in vivo and 2 hydroxyoestradiol 17beta in vitro on follicular steroid hormone profile associated with oocyte maturation in the catfish Heteropneustes fossilis. J Endocrinol 189, 341 353. Mita, L.,Bianco M.,Viggiano, E.,Zollo, F.,Bencivenga, U.,Sica, V.,Monaco, G.,Portaccio, M.,Diano, N.,Colonna, A.,Lepore, M.,Canciglia, P.Mita, D. G., 2011. Bisphenol A content in fish caught in two different sites of the Tyrrhenian Sea (Italy). Chemosphere 82, 405 410. Modig, C.,Modesto, T.,Canario, A.,Cerda, J.,von Hofsten, J.Olsson, P. E., 2006. Molecular characterization and expression pattern of zona pellucida proteins in gilthead seabream (Sparus aurata). Biol Reprod 75, 717 725.

PAGE 150

150 Monroe, D. G.,Secreto, F. J.,Subrama niam, M.,Getz, B. J.,Khosla, S.Spelsberg, T. C., 2005. Estrogen receptor alpha and beta heterodimers exert unique effects on estrogen and tamoxifen dependent gene expression in human U2OS osteosarcoma cells. Mol Endocrinol 19, 1555 1568. Muriach, B.,Carri llo, M.,Zanuy, S.Cerda Reverter, J. M., 2008. Distribution of estrogen receptor 2 mRNAs (Esr2a and Esr2b) in the brain and pituitary of the sea bass (Dicentrarchus labrax). Brain Res 1210, 126 141. Myers, M. S.,Stehr, C. M.,Olson, O. P.,Johnson, L. L.,McCa in, B. B.,Chan, S. L.Varanasi, U., 1994. Relationships between toxicopathic hepatic lesions and exposure to chemical contaminants in English sole (Pleuronectes vetulus), starry flounder (Platichthys stellatus), and white croaker (Genyonemus lineatus) from selected marine sites on the Pacific Coast, USA. Environ Health Perspect 102, 200 215. Mylonas, C. C.,Fostier, A.Zanuy, S., 2010. Broodstock management and hormonal manipulations of fish reproduction. Gen Comp Endocrinol 165, 516 534. Nagahama, Y., 1994. E ndocrine regulation of gametogenesis in fish. Int J Dev Biol 38, 217 229. Nagler, J. J.,Cavileer, T.,Sullivan, J.,Cyr, D. G.Rexroad, C., 3rd, 2007. The complete nuclear estrogen receptor family in the rainbow trout: discovery of the novel ERalpha2 and both ERbeta isoforms. Gene 392, 164 173. Nagler, J. J.,Davis, T. L.,Modi, N.,Vijayan, M. M.Schultz, I., 2010. Intracellular, not membrane, estrogen receptors control vitellogenin synthesis in the rainbow trout. Gen Comp Endocrinol 167, 326 330. Nakajima, A.,Ma ruyama, S.,Bohgaki, M.,Miyajima, N.,Tsukiyama, T.,Sakuragi, N.Hatakeyama, S., 2007. Ligand dependent transcription of estrogen receptor alpha is mediated by the ubiquitin ligase EFP. Biochem Biophys Res Commun 357, 245 251. Navas, J. M.Segner, H., 2006. Vi tellogenin synthesis in primary cultures of fish liver cells as endpoint for in vitro screening of the (anti)estrogenic activity of chemical substances. Aquat Toxicol 80, 1 22. Nelson, E. R.Habibi, H. R., 2010. Functional significance of nuclear estrogen r eceptor subtypes in the liver of goldfish. Endocrinology 151, 1668 1676. Nelson, E. R.,Wiehler, W. B.,Cole, W. C.Habibi, H. R., 2007. Homologous regulation of estrogen receptor subtypes in goldfish (Carassius auratus). Mol Reprod Dev 74, 1105 1112. Nesvizh skii, A. I.,Keller, A.,Kolker, E.Aebersold, R., 2003. A statistical model for identifying proteins by tandem mass spectrometry. Anal Chem 75, 4646 4658.

PAGE 151

151 Nilsson, S.Gustafsson, J. A., 2010. Estrogen Receptors: Therapies Targeted to Receptor Subtypes. Clin P harmacol Ther. Nilsson, S.,Makela, S.,Treuter, E.,Tujague, M.,Thomsen, J.,Andersson, G.,Enmark, E.,Pettersson, K.,Warner, M.Gustafsson, J. A., 2001. Mechanisms of estrogen action. Physiol Rev 81, 1535 1565. Notides, A. C.,Lerner, N.Hamilton, D. E., 1981. P ositive cooperativity of the estrogen receptor. Proc Natl Acad Sci U S A 78, 4926 4930. O'Lone, R.,Frith, M. C.,Karlsson, E. K.Hansen, U., 2004. Genomic targets of nuclear estrogen receptors. Mol Endocrinol 18, 1859 1875. O'Reilly, D. R.,Miller, L. K.Lucko w, V. A., 1992. Baculovirus expression vectors: A laboratory manual. New York NY, W. H. Freeman and Company. O'Reilly, D. R.,Miller, L. K.Luckow, V. A., 1992. Baculovirus expression vectors: A laboratory manual (Eds.) Book Baculovirus expression vectors: A laboratory manual, W.H. Freeman and Company, New York, NY, 347. Oppen Berntsen, D. O.,Arukwe, A.,Yadetie, F.,Lorens, J. B.Male, R., 1999. Salmon Eggshell Protein Expression: A Marker for Environmental Estrogens. Mar Biotechnol (NY) 1, 252 260. Oppen Bernt sen, D. O.,Helvik, J. V.Walther, B. T., 1990. The major structural proteins of cod (Gadus morhua) eggshells and protein crosslinking during teleost egg hardening. Dev Biol 137, 258 265. Paech, K.,Webb, P.,Kuiper, G. G.,Nilsson, S.,Gustafsson, J.,Kushner, P J.Scanlan, T. S., 1997. Differential ligand activation of estrogen receptors ERalpha and ERbeta at AP1 sites. Science 277, 1508 1510. Pakdel, F.,Le Guellec, C.,Vaillant, C.,Le Roux, M. G.Valotaire, Y., 1989. Identification and estrogen induction of two e strogen receptors (ER) messenger ribonucleic acids in the rainbow trout liver: sequence homology with other ERs. Mol Endocrinol 3, 44 51. Pakdel, F.,Metivier, R.,Flouriot, G.Valotaire, Y., 2000. Two estrogen receptor (ER) isoforms with different estrogen d ependencies are generated from the trout ER gene. Endocrinology 141, 571 580. Pang, Y.,Dong, J.Thomas, P., 2008. Estrogen signaling characteristics of Atlantic croaker G protein coupled receptor 30 (GPR30) and evidence it is involved in maintenance of oocy te meiotic arrest. Endocrinology 149, 3410 3426. Pang, Y.Thomas, P., 2009. Involvement of estradiol 17beta and its membrane receptor, G protein coupled receptor 30 (GPR30) in regulation of oocyte maturation in zebrafish, Danio rario. Gen Comp Endocrinol 16 1, 58 61.

PAGE 152

152 Paris, F.,Balaguer, P.,Terouanne, B.,Servant, N.,Lacoste, C.,Cravedi, J. P.,Nicolas, J. C.Sultan, C., 2002. Phenylphenols, biphenols, bisphenol A and 4 tert octylphenol exhibit alpha and beta estrogen activities and antiandrogen activity in repor ter cell lines. Mol Cell Endocrinol 193, 43 49. Park, S. H.,Kim, K. Y.,An, B. S.,Choi, J. H.,Jeung, E. B.,Leung, P. C.Choi, K. C., 2009. Cell growth of ovarian cancer cells is stimulated by xenoestrogens through an estrogen dependent pathway, but their sti mulation of cell growth appears not to be involved in the activation of the mitogen activated protein kinases ERK 1 and p38. J Reprod Dev 55, 23 29. Parrott, J. L.,McMaster, M. E.Hewitt, L. M., 2006. A decade of research on the environmental impacts of pul p and paper mill effluents in Canada: development and application of fish bioassays. J Toxicol Environ Health B Crit Rev 9, 297 317. Patino, R.Sullivan, C. V., 2002. Ovarian follicle growth, maturation, and ovulation in teleost fish. Fish Physiology and Bi ochemistry 26, 57 70. Patino, R.,Xia, Z.,Gale, W. L.,Wu, C.,Maule, A. G.Chang, X., 2000. Novel transcripts of the estrogen receptor alpha gene in channel catfish. Gen Comp Endocrinol 120, 314 325. Perry, A. N.Grober, M. S., 2003. A model for social control of sex change: interactions of behavior, neuropeptides, glucocorticoids, and sex steroids. Horm Behav 43, 31 38. Petit, F. G.,Metivier, R.,Valotaire, Y.Pakdel, F., 1999. Synergism between a half site and an imperfect estrogen responsive element, and coope ration with COUP TFI are required for estrogen receptor (ER) to achieve a maximal estrogen stimulation of rainbow trout ER gene. Eur J Biochem 259, 385 395. Pinto, P.,Passos, A. L.,Power, D. M.Canario, A. V., 2005. Sea bream (Sparus auratus) estrogen recep tors: phylogeny and tissue distribution. Ann N Y Acad Sci 1040, 436 438. Pinto, P. I.,Passos, A. L.,Martins Deborah, M. P. R. S.Canario, A. V., 2006. Characterization of estrogen receptor betab in sea bream (Sparus auratus): phylogeny, ligand binding, and comparative analysis of expression. Gen Comp Endocrinol 145, 197 207. Porte, C.,Janer, G.,Lorusso, L. C.,Ortiz Zarragoitia, M.,Cajaraville, M. P.,Fossi, M. C.Canesi, L., 2006. Endocrine disruptors in marine organisms: approaches and perspectives. Comp Bioc hem Physiol C Toxicol Pharmacol 143, 303 315. Powers, G. L.,Ellison Zelski, S. J.,Casa, A. J.,Lee, A. V.Alarid, E. T., 2010. Proteasome inhibition represses ERalpha gene expression in ER+ cells: a new link between proteasome activity and estrogen signaling in breast cancer. Oncogene 29, 1509 1518.

PAGE 153

153 Prado, P. S.,Souza, C. C.,Bazzoli, N.Rizzo, E., 2011. Reproductive disruption in lambari Astyanax fasciatus from a Southeastern Brazilian reservoir. Ecotoxicol Environ Saf 74, 1879 1887. Preisler Mashek, M. T.,Sol odin, N.,Stark, B. L.,Tyriver, M. K.Alarid, E. T., 2002. Ligand specific regulation of proteasome mediated proteolysis of estrogen receptor alpha. Am J Physiol Endocrinol Metab 282, E891 898. Price, R. H., Jr.,Butler, C. A.,Webb, P.,Uht, R.,Kushner, P.Hand a, R. J., 2001. A splice variant of estrogen receptor beta missing exon 3 displays altered subnuclear localization and capacity for transcriptional activation. Endocrinology 142, 2039 2049. Prucha, M. S.,Doperalski, N.,Rees, J.,Kroll, K. J.,Barber, D. S.De nslow, N. D., in preparation. Regulation of the Largemouth Bass Steroidogenic Acute Regulatory Protein by Xenoestrogens. Manuscript in preparation. Rani, K. V.,Sehgal, N.,Goswami, S. V.Prakash, O., 2010. Relative potencies of natural estrogens on vitelloge nin and choriogenin levels in the Indian freshwater spotted snakehead, Channa punctata: in vivo and in vitro studies. Fish Physiol Biochem 36, 587 595. Rempel, M. A.Schlenk, D., 2008. Effects of environmental estrogens and antiandrogens on endocrine functi on, gene regulation, and health in fish. Int Rev Cell Mol Biol 267, 207 252. Rhee, J. S.,Kang, H. S.,Raisuddin, S.,Hwang, D. S.,Han, J.,Kim, R. O.,Seo, J. S.,Lee, Y. M.,Park, G. S.,Lee, S. J.Lee, J. S., 2009. Endocrine disruptors modulate expression of hep atic choriogenin genes in the hermaphroditic fish, Kryptolebias marmoratus. Comp Biochem Physiol C Toxicol Pharmacol 150, 170 178. Rhee, J. S.,Kim, R. O.,Seo, J. S.,Park, C. B.,Soyano, K.,Lee, J.,Lee, Y. M.Lee, J. S., 2010. Bisphenol A modulates expression of gonadotropin subunit genes in the hermaphroditic fish, Kryptolebias marmoratus. Comp Biochem Physiol C Toxicol Pharmacol. Richter, C. A.,Birnbaum, L. S.,Farabollini, F.,Newbold, R. R.,Rubin, B. S.,Talsness, C. E.,Vandenbergh, J. G.,Walser Kuntz, D. R.v om Saal, F. S., 2007. In vivo effects of bisphenol A in laboratory rodent studies. Reprod Toxicol 24, 199 224. Rider, C. V.,Hartig, P. C.,Cardon, M. C.Wilson, V. S., 2009. Comparison of chemical binding to recombinant fathead minnow and human estrogen rece ptors alpha in whole cell and cell free binding assays. Environ Toxicol Chem 28, 2175 2181. Rider, C. V.,Hartig, P. C.,Cardon, M. C.Wilson, V. S., 2009. Development of a competitive binding assay system with recombinant estrogen receptors from multiple spe cies. Toxicol Lett 184, 85 89.

PAGE 154

154 Roy, J. R.,Chakraborty, S.Chakraborty, T. R., 2009. Estrogen like endocrine disrupting chemicals affecting puberty in humans -a review. Med Sci Monit 15, RA137 145. Rudel, R. A.,Gray, J. M.,Engel, C. L.,Rawsthorne, T. W.,Dods on, R. E.,Ackerman, J. M.,Rizzo, J.,Nudelman, J. L.Brody, J. G., 2011. Food Packaging and Bisphenol A and Bis(2 Ethylhexyl) Phthalate Exposure: Findings from a Dietary Intervention. Environ Health Perspect. Rutishauser, B. V.,Pesonen, M.,Escher, B. I.,Acke rmann, G. E.,Aerni, H. R.,Suter, M. J.Eggen, R. I., 2004. Comparative analysis of estrogenic activity in sewage treatment plant effluents involving three in vitro assays and chemical analysis of steroids. Environ Toxicol Chem 23, 857 864. Ryffel, G. U., 19 78. Synthesis of vitellogenin, an attractive model for investigating hormone induced gene activation. Mol Cell Endocrinol 12, 237 246. Sabo Attwood, T.,Blum, J. L.,Kroll, K. J.,Patel, V.,Birkholz, D.,Szabo, N. J.,Fisher, S. Z.,McKenna, R.,Campbell Thompson M.Denslow, N. D., 2007. Distinct expression and activity profiles of largemouth bass (Micropterus salmoides) estrogen receptors in response to estradiol and nonylphenol. J Mol Endocrinol 39, 223 237. Sabo Attwood, T.,Kroll, K. J.Denslow, N. D., 2004. Dif ferential expression of largemouth bass (Micropterus salmoides) estrogen receptor isotypes alpha, beta, and gamma by estradiol. Mol Cell Endocrinol 218, 107 118. Sano, K.,Kawaguchi, M.,Yoshikawa, M.,Iuchi, I.Yasumasu, S., 2010. Evolution of the teleostean zona pellucida gene inferred from the egg envelope protein genes of the Japanese eel, Anguilla japonica. FEBS J 277, 4674 4684. Savatier, J.,Jalaguier, S.,Ferguson, M. L.,Cavailles, V.Royer, C. A., 2010. Estrogen receptor interactions and dynamics monitore d in live cells by fluorescence cross correlation spectroscopy. Biochemistry 49, 772 781. Saville, B.,Wormke, M.,Wang, F.,Nguyen, T.,Enmark, E.,Kuiper, G.,Gustafsson, J. A.Safe, S., 2000. Ligand cell and estrogen receptor subtype (alpha/beta) dependent activation at GC rich (Sp1) promoter elements. J Biol Chem 275, 5379 5387. Schmieder, P.,Tapper, M.,Linnum, A.,Denny, J.,Kolanczyk, R.Johnson, R., 2000. Optimization of a precision cut trout liver tissue slice assay as a screen for vitellogenin induction: comparison of slice incubation techniques. Aquat Toxicol 49, 251 268. Schmieder, P. K.,Tapper, M. A.,Denny, J. S.,Kolanczyk, R. C.,Sheedy, B. R.,Henry, T. R.Veith, G. D., 2004. Use of trout liver slices to enhance mechanistic interpretation of estrogen re ceptor binding for cost effective prioritization of chemicals within large inventories. Environ Sci Technol 38, 6333 6342.

PAGE 155

155 Schmitt, C. J.,Hinck, J. E.,Blazer, V. S.,Denslow, N. D.,Dethloff, G. M.,Bartish, T. M.,Coyle, J. J.Tillitt, D. E., 2005. Environment al contaminants and biomarker responses in fish from the Rio Grande and its U.S. tributaries: spatial and temporal trends. Sci Total Environ 350, 161 193. Scholz, S.Kluver, N., 2009. Effects of endocrine disrupters on sexual, gonadal development in fish. S ex Dev 3, 136 151. Segner, H.,Navas, J. M.,Schafers, C.Wenzel, A., 2003. Potencies of estrogenic compounds in in vitro screening assays and in life cycle tests with zebrafish in vivo. Ecotoxicol Environ Saf 54, 315 322. Selman, K.Wallace, R. A., 1982. Oocy te growth in the sheepshead minnow: uptake of exogenous proteins by vitellogenic oocytes. Tissue Cell 14, 555 571. Selman, K.Wallace, R. A., 1983. Oogenesis in Fundulus heteroclitus. III. Vitellogenesis. J Exp Zool 226, 441 457. Sepulveda, M. S.,Johnson, W E.,Higman, J. C.,Denslow, N. D.,Schoeb, T. R.Gross, T. S., 2002. An evaluation of biomarkers of reproductive function and potential contaminant effects in Florida largemouth bass ( Micropterus salmoidesfloridanus) sampled from the St. Johns River. Sci To tal Environ 289, 133 144. Sepulveda, M. S.,Quinn, B. P.,Denslow, N. D.,Holm, S. E.Gross, T. S., 2003. Effects of pulp and paper mill effluents on reproductive success of largemouth bass. Environ Toxicol Chem 22, 205 213. Sepulveda, M. S.,Ruessler, D. S.,De nslow, N. D.,Holm, S. E.,Schoeb, T. R.Gross, T. S., 2001. Assessment of reproductive effects in largemouth bass (Micropterus salmoides) exposed to bleached/unbleached kraft mill effluents. Arch Environ Contam Toxicol 41, 475 482. Shabanipour, N.Hossayni, S N., 2010. Histological and ultrastructural study of Zona Radiata in oocyte of common carp Cyprinus carpio (Linnaeus 1758). Micron 41, 877 881. Shi, D.,Wen, H. S.,He, F.,Li, J. F.,Yang, Y. P.,Chen, C. F.,Zhang, J. R.,Chen, X. Y.,Jin, G. X.,Shi, B.,Qi, B. X.Li, N., 2011. The physiology functions of estrogen receptor alpha (ERalpha) in reproduction cycle of ovoviviparous black rockfish, Sebastes schlegeli Hilgendorf. Steroids. Shimizu, A.,Hamaguchi, M.,Ito, H.,Ohkubo, M.,Udagawa, M.,Fujii, K.,Kobayashi, T.Na kamura, M., 2008. Appearances and chronological changes of mummichog Fundulus heteroclitus FSH cells and LH cells during ontogeny, sexual differentiation, and gonadal development. Gen Comp Endocrinol 156, 312 322.

PAGE 156

156 Shved, N.,Berishvili, G.,Hausermann, E.,D' Cotta, H.,Baroiller, J. F.Eppler, E., 2009. Challenge with 17alpha ethinylestradiol (EE2) during early development persistently impairs growth, differentiation, and local expression of IGF I and IGF II in immune organs of tilapia. Fish Shellfish Immunol 26 524 530. Singh, V.Joy, K. P., 2009. Relative in vitro seasonal effects of vasotocin and isotocin on ovarian steroid hormone levels in the catfish Heteropneustes fossilis. Gen Comp Endocrinol 162, 257 264. Smeets, J. M.,van Holsteijn, I.,Giesy, J. P.,Sein en, W.van den Berg, M., 1999. Estrogenic potencies of several environmental pollutants, as determined by vitellogenin induction in a carp hepatocyte assay. Toxicol Sci 50, 206 213. Socorro, S.,Power, D. M.,Olsson, P. E.Canario, A. V., 2000. Two estrogen re ceptors expressed in the teleost fish, Sparus aurata: cDNA cloning, characterization and tissue distribution. J Endocrinol 166, 293 306. Soto, A. M.,Sonnenschein, C.,Chung, K. L.,Fernandez, M. F.,Olea, N.Serrano, F. O., 1995. The E SCREEN assay as a tool t o identify estrogens: an update on estrogenic environmental pollutants. Environ Health Perspect 103 Suppl 7, 113 122. Spargo, S. C.Hope, R. M., 2003. Evolution and nomenclature of the zona pellucida gene family. Biol Reprod 68, 358 362. Stelkens, R. B.Wede kind, C., 2010. Environmental sex reversal, Trojan sex genes, and sex ratio adjustment: conditions and population consequences. Mol Ecol. Stoica, A.,Saceda, M.,Fakhro, A.,Solomon, H. B.,Fenster, B. D.Martin, M. B., 1999. Regulation of estrogen receptor alp ha gene expression by 1, 25 dihydroxyvitamin D in MCF 7 cells. J Cell Biochem 75, 640 651. Strobl Mazzulla, P. H.,Lethimonier, C.,Gueguen, M. M.,Karube, M.,Fernandino, J. I.,Yoshizaki, G.,Patino, R.,Strussmann, C. A.,Kah, O.Somoza, G. M., 2008. Brain aroma tase (Cyp19A2) and estrogen receptors, in larvae and adult pejerrey fish Odontesthes bonariensis: Neuroanatomical and functional relations. Gen Comp Endocrinol 158, 191 201. Strunck, E.,Stemmann, N.,Hopert, A.,Wunsche, W.,Frank, K.Vollmer, G., 2000. Relati ve binding affinity does not predict biological response to xenoestrogens in rat endometrial adenocarcinoma cells. J Steroid Biochem Mol Biol 74, 73 81. Stump, D. G.,Beck, M. J.,Radovsky, A.,Garman, R. H.,Freshwater, L. L.,Sheets, L. P.,Marty, M. S.,Waecht er, J. M., Jr.,Dimond, S. S.,Van Miller, J. P.,Shiotsuka, R. N.,Beyer, D.,Chappelle, A. H.Hentges, S. G., 2010. Developmental neurotoxicity study of dietary bisphenol A in Sprague Dawley rats. Toxicol Sci 115, 167 182.

PAGE 157

157 Summers, M. D.Smith, G. E., 1987. A m anual of methods for baculovirus vectors and insect cell culture procedures. T. A. E. S. B. n. 1555, Texas A&M University, College Station, TX : 1 55. Sumpter, J. P., 1998. Xenoendorine disrupters -environmental impacts. Toxicol Lett 102 103, 337 342. Sumpt er, J. P.Jobling, S., 1995. Vitellogenesis as a Biomarker for Estrogenic Contamination of the Aquatic Environment. Environmental Health Perspectives 103, 173 178. Sun, H.,Shen, O. X.,Wang, X. R.,Zhou, L.,Zhen, S. Q.Chen, X. D., 2009. Anti thyroid hormone a ctivity of bisphenol A, tetrabromobisphenol A and tetrachlorobisphenol A in an improved reporter gene assay. Toxicol In Vitro 23, 950 954. Suzuki, S.,Nishida, S.,Ohno, K.Santa, T., 2007. Modulation of coactivator recruitment by cooperative ligand binding t o human Estrogen receptor alpha and beta. Biol Pharm Bull 30, 1641 1647. Swedenborg, E.,Pongratz, I.Gustafsson, J. A., 2010. Endocrine disruptors targeting ERbeta function. Int J Androl 33, 288 297. Talsness, C. E.,Andrade, A. J.,Kuriyama, S. N.,Taylor, J. A.vom Saal, F. S., 2009. Components of plastic: experimental studies in animals and relevance for human health. Philos Trans R Soc Lond B Biol Sci 364, 2079 2096. Tan, N. S.,Lam, T. J.Ding, J. L., 1996. The first contiguous estrogen receptor gene from a f ish, Oreochromis aureus: evidence for multiple transcripts. Mol Cell Endocrinol 120, 177 192. Tateishi, Y.,Sonoo, R.,Sekiya, Y.,Sunahara, N.,Kawano, M.,Wayama, M.,Hirota, R.,Kawabe, Y.,Murayama, A.,Kato, S.,Kimura, K.Yanagisawa, J., 2006. Turning off estro gen receptor beta mediated transcription requires estrogen dependent receptor proteolysis. Mol Cell Biol 26, 7966 7976. Taylor, J. S.,Van de Peer, Y.,Braasch, I.Meyer, A., 2001. Comparative genomics provides evidence for an ancient genome duplication event in fish. Philos Trans R Soc Lond B Biol Sci 356, 1661 1679. Teo, B. Y.,Tan, N. S.,Lam, T. J.Ding, J. L., 1999. Synergistic effects of nuclear factors -GATA, VBP and ER in potentiating vitellogenin gene transcription. FEBS Lett 459, 57 63. Terrien, X.,Fini J. B.,Demeneix, B. A.,Schramm, K. W.Prunet, P., 2011. Generation of fluorescent zebrafish to study endocrine disruption and potential crosstalk between thyroid hormone and corticosteroids. Aquat Toxicol 105, 13 20.

PAGE 158

158 Thomas, P., 2000. Chemical interference with genomic and nongenomic actions of steroids in fishes: role of receptor binding. Mar Environ Res 50, 127 134. Thomas, P.,Alyea, R.,Pang, Y.,Peyton, C.,Dong, J.Berg, A. H., 2010. Conserved estrogen binding and signaling functions of the G protein coupl ed estrogen receptor 1 (GPER) in mammals and fish. Steroids 75, 595 602. Thomas, P.,Dressing, G.,Pang, Y.,Berg, H.,Tubbs, C.,Benninghoff, A.Doughty, K., 2006. Progestin, estrogen and androgen G protein coupled receptors in fish gonads. Steroids 71, 310 316 Thornton, J. W., 2001. Evolution of vertebrate steroid receptors from an ancestral estrogen receptor by ligand exploitation and serial genome expansions. Proc Natl Acad Sci U S A 98, 5671 5676. Tollefsen, K. E.,Mathisen, R.Stenersen, J., 2002. Estrogen m imics bind with similar affinity and specificity to the hepatic estrogen receptor in Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Gen Comp Endocrinol 126, 14 22. Tollefsen, K. E.,Mathisen, R.Stenersen, J., 2003. Induction of vitel logenin synthesis in an Atlantic salmon (Salmo salar) hepatocyte culture: a sensitive in vitro bioassay for the oestrogenic and anti oestrogenic activity of chemicals. Biomarkers 8, 394 407. Tyler, C. R.,Sumpter, J. P.Witthames, P. R., 1990. The dynamics o f oocyte growth during vitellogenesis in the rainbow trout (Oncorhynchus mykiss). Biol Reprod 43, 202 209. Tyler, C. R.,vanderEerden, B.,Jobling, S.,Panter, G.Sumpter, J. P., 1996. Measurement of vitellogenin, a biomarker for exposure to oestrogenic chemic als, in a wide variety of cyprinid fish. Journal of Comparative Physiology B Biochemical Systemic and Environmental Physiology 166, 418 426. Tyulmenkov, V. V.,Jernigan, S. C.Klinge, C. M., 2000. Comparison of transcriptional synergy of estrogen receptors a lpha and beta from multiple tandem estrogen response elements. Mol Cell Endocrinol 165, 151 161. U.S.EPA, 1998. EDSTAC Final Report Uribe, M. C.Grier, H. J., 2010. Oogenesis of microlecithal oocytes in the viviparous teleost Heterandria formosa. J Morphol. Uribe, M. C.Grier, H. J., 2011. Oogenesis of microlecithal oocytes in the viviparous teleost Heterandria formosa. J Morphol 272, 241 257.

PAGE 159

159 Vajda, A. M.,Barber, L. B.,Gray, J. L.,Lopez, E. M.,Bolden, A. M.,Schoenfuss, H. L.Norris, D. O., 2011. Demasculiniza tion of male fish by wastewater treatment plant effluent. Aquat Toxicol 103, 213 221. Valley, C. C.,Solodin, N. M.,Powers, G. L.,Ellison, S. J.Alarid, E. T., 2008. Temporal variation in estrogen receptor alpha protein turnover in the presence of estrogen. J Mol Endocrinol 40, 23 34. van Aerle, R.,Pounds, N.,Hutchinson, T. H.,Maddix, S.Tyler, C. R., 2002. Window of sensitivity for the estrogenic effects of ethinylestradiol in early life stages of fathead minnow, Pimephales promelas. Ecotoxicology 11, 423 434 Van den Belt, K.,Verheyen, R.Witters, H., 2003. Comparison of vitellogenin responses in zebrafish and rainbow trout following exposure to environmental estrogens. Ecotoxicol Environ Saf 56, 271 281. van den Heuvel, M. R.Ellis, R. J., 2002. Timing of expo sure to a pulp and paper effluent influences the manifestation of reproductive effects in rainbow trout. Environ Toxicol Chem 21, 2338 2347. Van der Kraak, G.,Suzuki, K.,Peter, R. E.,Itoh, H.Kawauchi, H., 1992. Properties of common carp gonadotropin I and gonadotropin II. Gen Comp Endocrinol 85, 217 229. van Leeuwen, S. P.,van Velzen, M. J.,Swart, C. P.,van der Veen, I.,Traag, W. A.de Boer, J., 2009. Halogenated contaminants in farmed salmon, trout, tilapia, pangasius, and shrimp. Environ Sci Technol 43, 4009 4015. Vigano, L.,Arillo, A.,Bottero, S.,Massari, A.Mandich, A., 2001. First observation of intersex cyprinids in the Po River (Italy). Sci Total Environ 269, 189 194. Vigano, L.,Mandich, A.,Benfenati, E.,Bertolotti, R.,Bottero, S.,Porazzi, E.Agradi, E., 2006. Investigating the estrogenic risk along the river Po and its intermediate section. Arch Environ Contam Toxicol 51, 641 651. Vivar, O. I.,Zhao, X.,Saunier, E. F.,Griffin, C.,Mayba, O. S.,Tagliaferri, M.,Cohen, I.,Speed, T. P.Leitman, D. C., 2010. Estrogen receptor beta binds to and regulates three distinct classes of target genes. J Biol Chem 285, 22059 22066. von Hofsten, J.,Karlsson, J. ,Jones, I.Olsson, P. E., 2002. Expression and regulation of fushi tarazu factor 1 and steroidogenic genes during reproduction in Arctic char (Salvelinus alpinus). Biol Reprod 67, 1297 1304. Vorkamp, K.,Riget, F.,Glasius, M.,Pecseli, M.,Lebeuf, M.Muir, D., 2004. Chlorobenzenes, chlorinated pesticides, coplanar chlorobiphenyls and other organochlorine compounds in Greenland biota. Sci Total Environ 331, 157 175.

PAGE 160

160 Wahli, W.,Dawid, I. B.,Ryffel, G. U.Weber, R., 1981. Vitellogenesis and the vitellogenin gene fami ly. Science 212, 298 304. Wallace, R. A.Jared, D. W., 1968. Studies on amphibian yolk. VII. Serum phosphoprotein synthesis by vitellogenic females and estrogen treated males of Xenopus laevis. Can J Biochem 46, 953 959. Wallace, R. A.Selman, K., 1990. Ultr astructural aspects of oogenesis and oocyte growth in fish and amphibians. J Electron Microsc Tech 16, 175 201. Wang, H.,Wang, J.,Wu, T.,Qin, F.,Hu, X.,Wang, L.Wang, Z., 2010. Molecular characterization of estrogen receptor genes in Gobiocypris rarus and t heir expression upon endocrine disrupting chemicals exposure in juveniles. Aquat Toxicol. Wang, H.,Wang, J.,Wu, T.,Qin, F.,Hu, X.,Wang, L.Wang, Z., 2011. Molecular characterization of estrogen receptor genes in Gobiocypris rarus and their expression upon e ndocrine disrupting chemicals exposure in juveniles. Aquat Toxicol 101, 276 287. Wang, Q.,Cao, J.,Zhu, Q.,Luan, C.,Chen, X.,Yi, X.,Ding, H.,Chen, J.,Cheng, J.Xiao, H., 2011. Inhibition of voltage gated sodium channels by bisphenol A in mouse dorsal root ga nglion neurons. Brain Res 1378, 1 8. Westerlund, L.,Hyllner, S. J.,Schopen, A.Olsson, P. E., 2001. Expression of three vitelline envelope protein genes in arctic char. Gen Comp Endocrinol 122, 78 87. Wilson, V. S.,Lambright, C.,Ostby, J.Gray, L. E., 2002. In vitro and in vivo effects of 17 beta trenbolone: A feedlot effluent contaminant. Toxicological Sciences 70, 202 211. Xia, Z.,Gale, W. L.,Chang, X.,Langenau, D.,Patino, R.,Maule, A. G.Densmore, L. D., 2000. Phylogenetic sequence analysis, recombinant exp ression, and tissue distribution of a channel catfish estrogen receptor beta. Gen Comp Endocrinol 118, 139 149. Xia, Z.,Patino, R.,Gale, W. L.,Maule, A. G.Densmore, L. D., 1999. Cloning, in vitro expression, and novel phylogenetic classification of a chann el catfish estrogen receptor. Gen Comp Endocrinol 113, 360 368. Xing, L.,Xu, Y.,Xiao, Y.,Shang, L.,Liu, R.,Wei, X.,Jiang, J.Hao, W., 2010. Embryotoxic and teratogenic effects of the combination of bisphenol A and genistein on in vitro cultured postimplanta tion rat embryos. Toxicol Sci 115, 577 588. Xu, X.,Tian, D.,Hong, X.,Chen, L.Xie, L., 2011. Sex specific influence of exposure to bisphenol A between adolescence and young adulthood on mouse behaviors. Neuropharmacology.

PAGE 161

161 Yamamoto, T.,Yasuhara, A.,Shiraishi H.Nakasugi, O., 2001. Bisphenol A in hazardous waste landfill leachates. Chemosphere 42, 415 418. Yang, J.,Singleton, D. W.,Shaughnessy, E. A.Khan, S. A., 2008. The F domain of estrogen receptor alpha inhibits ligand induced receptor dimerization. Mol Ce ll Endocrinol 295, 94 100. Yoon, K.,Pallaroni, L.,Stoner, M.,Gaido, K.Safe, S., 2001. Differential activation of wild type and variant forms of estrogen receptor alpha by synthetic and natural estrogenic compounds using a promoter containing three estrogen responsive elements. J Steroid Biochem Mol Biol 78, 25 32. Zhang, Q.,Yaniv, K.,Oberman, F.,Wolke, U.,Git, A.,Fromer, M.,Taylor, W. L.,Meyer, D.,Standart, N.,Raz, E.Yisraeli, J. K., 1999. Vg1 RBP intracellular distribution and evolutionarily conserved expr ession at multiple stages during development. Mech Dev 88, 101 106. Zhu, P.,Zhang, Y.,Zhuo, Q.,Lu, D.,Huang, J.,Liu, X.Lin, H., 2008. Discovery of four estrogen receptors and their expression profiles during testis recrudescence in male Spinibarbus denticu latus. Gen Comp Endocrinol 156, 265 276. Zilliacus, J.,Wright, A. P.,Carlstedt Duke, J.Gustafsson, J. A., 1995. Structural determinants of DNA binding specificity by steroid receptors. Mol Endocrinol 9, 389 400. Zohar, Y.,Munoz Cueto, J. A.,Elizur, A.Kah, O., 2010. Neuroendocrinology of reproduction in teleost fish. Gen Comp Endocrinol 165, 438 455.

PAGE 162

162 BIOGRAPHICAL SKETCH Roxana Weil was born in Iasi, Romania. She moved to Kitchener Canada at the age of 12, and following high school graduation Roxana went to University of Waterloo. For her undergraduate degree, she majored in biology and graduated with a Bachelor of Science degree in 2002. In 2002 she joined the lab of Dr. Matt Vijayan at the University of Waterloo for a Master of Science program in b iology t o study the effects of phenanthrenequinone and copper on the cellular stress response in rainbow trout Roxana completed her MSc. degree in 2005, after which she moved to Gainesville Florida. In 2006 Roxana joined the Interdisciplinary Program (IDP) in Bi omedical Sciences in the College of Medicine at UF, and joined the laboratory of Dr. Nancy D. Denslow. pesticides with the largemouth bass estrogen receptors, and the downstream effects on estrogen responsive genes in liver. She received her Ph.D. from the University of Florida in the fall of 2011.