<%BANNER%>

Cardiac MLCK (cMLCK) and Its Role in Cardiac Function

Permanent Link: http://ufdc.ufl.edu/UFE0043629/00001

Material Information

Title: Cardiac MLCK (cMLCK) and Its Role in Cardiac Function
Physical Description: 1 online resource (126 p.)
Language: english
Creator: Warren, Soni A
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: cmlck -- nkx25
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The main focus of our laboratory is to elucidate transcriptional regulation of homeodomain transcription factor Nkx2.5 in the heart. For this study, we have focused on two downstream targets, atrial natriuretic factor (ANF) and cardiac-specific myosin light chain kinase. Transcription factor Nkx2.5 is one of the major transactivators of the ANF gene in the developing heart. ANF is abundantly expressed in atrial cardiomyocytes throughout ontogeny and in ventricular cardiomyocytes in the developing heart. However, during cardiac failure and hypertrophy, ANF expression can reappear in adult ventricular cardiomyocytes. We identified Nkx2.5 binding at three 5' regulatory elements (-34, -31 and -21 kb) and the proximal ANF promoter by ChIP assay using neonatal mouse cardiomyocytes. 3C analysis revealed close proximity between the distal elements and the promoter region. A 5.8-kb fragment consisting of these elements transactivated a reporter gene in vivo recapitulating endogenous ANF expression, which was markedly reduced in Nkx2.5-ablated mice. However, expression of a reporter gene was increased and expanded toward the outer compact-layer in the absence of transcription repressor Hey2 similar to endogenous ANF expression. Functional Nkx2.5 and Hey2 binding sites separated by 59 bp were identified in the -34 kb element in neonatal cardiomyocytes. In adult hearts, this fragment did not respond to pressure-overload, and ANF was induced in the absence of Nkx2.5. Another factor regulated by Nkx2.5 is cardiac MLCK (cMLCK).This kinase has been demonstrated to phosphorylate MLC2v and 2a in vitro and in vivo. Phosphorylation of myosin light chain 2 (MLC2) is one regulatory mechanism to enhance cardiac contraction. To examine the role cMLCK plays in the heart we created two murine models of cMLCK. For our knockout model, we generated a conditional null allele of cMLCK by introducing loxP sites spanning exon 5 through homologous recombination in ES cells. This deletion eliminates the first coding exon of the catalytic domain and results in the frame-shift of the subsequent downstream exons. Northern blotting demonstrated that cMLCK mRNA expression was below the level of detection in cMLCK-/- hearts using the cDNA probe recognizing the upstream from exon 5, indicating that cMLCK-/- mice do not express stable cMLCK mRNA. cMLCK-/- mice were born at the expected Mendelian ratios; however they demonstrated an approximately 20% increase of heart weight/body weight at postnatal day 2. cMLCK-/- mice survive through adulthood despite the mild increase in heart weight/body weight accompanied by reduced cardiac contraction. The phosphorylated-form of MLC2v was below the level of detection in 2D electrophoresis followed by Western blotting with anti-MLC antibody, while the relative amounts of phosphorylated MLC2v to the total MLC2v was approximately 30% in wild-type. Left ventricular dysfunction in knockout mice was also revealed by changes in systolic torsion by magnetic resonance imaging in 12 weeks old mice. Mice null for cMLCK were observed to have torsion of 26.7º/cm vs. 38.3º/cm observed in wild-type. Cardioprotective effects were demonstrated in mice overexpressing cMLCK when subjected to pathological conditions of trans-aortic coarctation (TAC). Fractional shortening was observed to be reduced by 8.5% in cMLCK transgenic mice (n=8) vs. 29.0% in wild type (n=6) four weeks following surgery. The results presented in this dissertation demonstrate that Nkx2.5 and its responsive cis-regulatory DNA elements are essential for ANF expression selectively in the developing heart. Also, loss of cMLCK in gene-targeted mice results in a reduction of phosphorylation of MLC2v accompanied by reduced cardiac contraction while an overexpression of cMLCK appears to have beneficial cardioprotective effects under pathological stress.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Soni A Warren.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Kasahara, Hideko.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043629:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043629/00001

Material Information

Title: Cardiac MLCK (cMLCK) and Its Role in Cardiac Function
Physical Description: 1 online resource (126 p.)
Language: english
Creator: Warren, Soni A
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: cmlck -- nkx25
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The main focus of our laboratory is to elucidate transcriptional regulation of homeodomain transcription factor Nkx2.5 in the heart. For this study, we have focused on two downstream targets, atrial natriuretic factor (ANF) and cardiac-specific myosin light chain kinase. Transcription factor Nkx2.5 is one of the major transactivators of the ANF gene in the developing heart. ANF is abundantly expressed in atrial cardiomyocytes throughout ontogeny and in ventricular cardiomyocytes in the developing heart. However, during cardiac failure and hypertrophy, ANF expression can reappear in adult ventricular cardiomyocytes. We identified Nkx2.5 binding at three 5' regulatory elements (-34, -31 and -21 kb) and the proximal ANF promoter by ChIP assay using neonatal mouse cardiomyocytes. 3C analysis revealed close proximity between the distal elements and the promoter region. A 5.8-kb fragment consisting of these elements transactivated a reporter gene in vivo recapitulating endogenous ANF expression, which was markedly reduced in Nkx2.5-ablated mice. However, expression of a reporter gene was increased and expanded toward the outer compact-layer in the absence of transcription repressor Hey2 similar to endogenous ANF expression. Functional Nkx2.5 and Hey2 binding sites separated by 59 bp were identified in the -34 kb element in neonatal cardiomyocytes. In adult hearts, this fragment did not respond to pressure-overload, and ANF was induced in the absence of Nkx2.5. Another factor regulated by Nkx2.5 is cardiac MLCK (cMLCK).This kinase has been demonstrated to phosphorylate MLC2v and 2a in vitro and in vivo. Phosphorylation of myosin light chain 2 (MLC2) is one regulatory mechanism to enhance cardiac contraction. To examine the role cMLCK plays in the heart we created two murine models of cMLCK. For our knockout model, we generated a conditional null allele of cMLCK by introducing loxP sites spanning exon 5 through homologous recombination in ES cells. This deletion eliminates the first coding exon of the catalytic domain and results in the frame-shift of the subsequent downstream exons. Northern blotting demonstrated that cMLCK mRNA expression was below the level of detection in cMLCK-/- hearts using the cDNA probe recognizing the upstream from exon 5, indicating that cMLCK-/- mice do not express stable cMLCK mRNA. cMLCK-/- mice were born at the expected Mendelian ratios; however they demonstrated an approximately 20% increase of heart weight/body weight at postnatal day 2. cMLCK-/- mice survive through adulthood despite the mild increase in heart weight/body weight accompanied by reduced cardiac contraction. The phosphorylated-form of MLC2v was below the level of detection in 2D electrophoresis followed by Western blotting with anti-MLC antibody, while the relative amounts of phosphorylated MLC2v to the total MLC2v was approximately 30% in wild-type. Left ventricular dysfunction in knockout mice was also revealed by changes in systolic torsion by magnetic resonance imaging in 12 weeks old mice. Mice null for cMLCK were observed to have torsion of 26.7º/cm vs. 38.3º/cm observed in wild-type. Cardioprotective effects were demonstrated in mice overexpressing cMLCK when subjected to pathological conditions of trans-aortic coarctation (TAC). Fractional shortening was observed to be reduced by 8.5% in cMLCK transgenic mice (n=8) vs. 29.0% in wild type (n=6) four weeks following surgery. The results presented in this dissertation demonstrate that Nkx2.5 and its responsive cis-regulatory DNA elements are essential for ANF expression selectively in the developing heart. Also, loss of cMLCK in gene-targeted mice results in a reduction of phosphorylation of MLC2v accompanied by reduced cardiac contraction while an overexpression of cMLCK appears to have beneficial cardioprotective effects under pathological stress.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Soni A Warren.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Kasahara, Hideko.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043629:00001


This item has the following downloads:


Full Text

PAGE 1

1 CARDIAC MLCK ( C MLCK) AND ITS ROLE I N CARDIAC FUNCTION By SONISHA ANDREA WARREN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOC TOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Sonisha Andrea Warren

PAGE 3

3 To my brother Kenroy Warren and my pa rents, Kenneth and Sonia Warren

PAGE 4

4 ACKNOWLEDGMENTS First, I would like to thank God for His unconditional love and favor that He bestowed upon me throughout my matriculation here a t UF. As the source of my strength and my Rock, I am certain I never could have made it through without Him Second, I must thank my family for their undying love, unwavering support and steadfast prayer s. Specifically, I thank my brother Kenroy Warren, for being my inspiration and the single person who has always been most interested and most supportive of my academic pursuits. For as long as I can remember you have always been fascinated by the world o f science and it was your respect and admiration for scientific research that sparked my own intrigue for this field. I am also eternally grateful to my mother Sonia for her kind words of encouragement and my father Kenneth, for being my personal cheerl eader along the way. My work here would not have been accompli shed without being fortunate to be under the men torship of my academic advisor, Dr. Hideko Kasahara. I appreciate her guidance and admire her uncompromising work ethic. The skill set that I ha ve acquired while under he r tutelage is invaluable to me and I look forward to using these skills and applying all I have learned from her in the future. I would also like to thank my committee members Dr. Alfred Lewin, Dr. Mohan Raizada, Dr. Peter Sayesk i and Dr. Naohiro Terada for their valuable advice and expertise they provided towards my research project. I could not have chosen a better supervisory team and am thankful for the time they have devoted and all contributions made to ensure the success of my research. I am grateful to others who have provided technical assistance including, Laura Briggs, Moyi Li Ryota Terada, Colleen Jeffrey, Teresa Collins and Matt Neth.

PAGE 5

5 Finally, I must thank my dea r friends Mark W. Cunningham Giselle S. Hudson and Nek eshia Vaccianna Gray for their moral support throughout my matriculation at UF. I appreciate you celebrating with me my small triumphs and your uplifting words of encouragement when I needed them. Your unwavering support and confidence in my abilities was undeserving of me I could not ask for better best friends. Every thing that I have done and all that I have accomplished is because I have been blessed with an amazing family and support system.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 13 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 16 Dynamics of Cardiac Function ................................ ................................ ................ 16 The Role of Transcription Factors in Cardiac Structure and Function .................... 17 Mouse Models to Study Cardiac Function ................................ .............................. 18 2 Nkx2. 5 IS NECESSARY FOR CARDIAC FORMATION AND FUNCTION ............. 19 Background ................................ ................................ ................................ ............. 19 Loss of Nkx2.5 Results in Compromised Cardiac Conduction ................................ 21 Nkx2.5 and Human Heart Disease ................................ ................................ ......... 21 The ANF proximal promoter contains an Nkx2.5 binding site ................................ 22 3 DIFFERENTIAL ROLE OF Nkx2.5 IN ACTIVATION OF THE ANF GENE IN DEVELOPING VS. FAILING HEART ................................ ................................ ...... 24 Background ................................ ................................ ................................ ............. 24 Materials and Methods ................................ ................................ ............................ 25 Mouse Models ................................ ................................ ................................ .. 25 Chromatin Immunoprecipitation (Chip) Assays Followed by Real Time PCR Mouse Models ................................ ................................ ............................... 26 Chromosome conformation capture (3C) ................................ ......................... 26 Reporter Assays and Cloning of Hey2 ................................ ............................. 26 X Gal Staining, Whole Mount In Situ Hybridization and Measurement of Beta Galactosidase Activity ................................ ................................ ........... 28 Real time RT PCR ................................ ................................ ........................... 28 Western Blotting ................................ ................................ ............................... 28 Transverse Aortic Constriction (TAC) and Pressure Measurement .................. 29 Northern Blotting ................................ ................................ .............................. 29 Statistical Analyses ................................ ................................ .......................... 29 Results ................................ ................................ ................................ .................... 29 Binding o f Nkx2.5 i n t he ANF Gene ( Nppa ) Locus ................................ ........... 29 Identification o f Three Regulatory DNA Elements i n t o f t he ANF Gene ................................ ................................ ................................ ..... 30

PAGE 7

7 Functional Characterization o f t he Nkx2.5 Responsive Site i n t he 34 Kb Region ................................ ................................ ................................ ........... 31 Dynamic changes in the chromatin configuration of the ANF gene locus upon Nkx2.5 binding ................................ ................................ ..................... 31 The Role of Nkx2.5 Elements in the Expression of The ANF Gene in Embryonic and Perinatal Hearts ................................ ................................ ................................ ........... 32 Increased Expression of ANF Mrn a and 34 31 21 ANF Lacz in the Left Ventricle in the Absence of Transcription Repressor Hey2 ........................... 34 Dispensable Function of Nkx2.5 in Re Induction of ANF in Perinatal Failing Hearts ................................ ................................ ................................ ........... 36 Nkx2.5 Independent ANF Transcription in Pressure Overloaded Adult Hearts ................................ ................................ ................................ ........... 37 Discussion ................................ ................................ ................................ .............. 38 4 Nkx2.5 REGULATES THE EXPRESSION OF A CARDIAC SPECIFIC MYOSIN LIGHT CHAIN KINASE (cMLCK) ................................ ................................ ............ 64 Background ................................ ................................ ................................ ............. 64 Ident ification of cMLCK as a Downstream Target of Nkx2.5. ................................ .. 65 cMLCK Kinase Activity ................................ ................................ ............................ 66 Structure of cMLCK ................................ ................................ ................................ 67 Physiological Role of cMLCK ................................ ................................ .................. 67 Reduced cMLCK Protein Expression in Failing Hearts ................................ ........... 69 Conc lusion ................................ ................................ ................................ .............. 70 5 PHYSIOLOGICAL AND PATHOLOGICAL ROLES OF cMLCK IN CARDIAC MUSCLE ................................ ................................ ................................ ................. 71 Background ................................ ................................ ................................ ............. 71 Materials and Methods ................................ ................................ ............................ 72 Generation of C ardiac MLCK / M ice ................................ ................................ 72 Generation of Transgenic M ice overex pressing cMLCK ................................ .. 73 Southern, Northern a nd Western Blotting, Immunostaining a nd Histological Analyses ................................ ................................ ................................ ........ 73 Two Dimensional Gel Elect rophoresis ................................ ............................. 75 Telemetry ECG Recordings and Echocardiogram ................................ ............ 75 Simultaneous Measurements of Cell Shortening and Intracellular Free Calcium ................................ ................................ ................................ ......... 76 Transverse Aortic Constriction (TAC) and Pressure Measurement .................. 77 Swimming training ................................ ................................ ............................ 77 Statistical A nalyses ................................ ................................ .......................... 77 Results ................................ ................................ ................................ .................... 77 Regional and segmental expression of cMLCK protein and phos phorylation of MLC2v in mouse hearts ................................ ................................ ............ 77 Reduction of cMLCK and p MLC2v in pressure overloading and ablation of cMLCK gene in mice leads to moderate cardiac contraction abnormalities .. 79

PAGE 8

8 cMLCK / mice demonstrate heart failure by pressure overloading ................... 81 Overexpression of cMLCK increases phosphorylation of MLC2v in the he art and protect cardiac contraction after pressure overloading .......................... 81 cMLCK / mice reduce tolerance to physiological stress ................................ ... 83 Prol ongation of the ventricular conduction time in cMLCK / mice ..................... 84 Discussion ................................ ................................ ................................ .............. 84 6 CONCLUSIONS, LIMITATIONS AND FUTURE STUDIES ................................ ... 105 Conclusion ................................ ................................ ................................ ............ 105 Summary of Findings ................................ ................................ ............................ 105 Differential Role of Nkx2 .5 in Activation of the ANF in Developing vs. Failing Heart ................................ ................................ ................................ ........... 105 Physiological and Pathological Roles of CMLCK in Cardiac Muscle .............. 106 General Discussion ................................ ................................ ............................... 106 Limitations ................................ ................................ ................................ ............. 112 Future Studies ................................ ................................ ................................ ...... 112 LI ST OF REFERENCES ................................ ................................ ............................. 114 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 126

PAGE 9

9 LIST OF FIGURES Figure page 3 1 Organi zation of the genomic locus including the ANF ( Nppa ) and BNP ( Nppb ) genes. ................................ ................................ ................................ ..... 44 3 2 Diagram of experiment demonstrating tamoxifen injection at E19 ...................... 44 3 3 ChIP analysis of Nkx2.5 in cardiomyocytes expressing Nkx2.5 .......................... 44 3 4 ChIP analysis of H3K4me2 and H3K27me3 in genomic locus ........................... 45 3 5 Schematics of two Nkx2.5 consensus binding sites in the mouse ANF proximal promoter (. ................................ ................................ ........................... 45 3 6 upstream Nkx2.5 binding el ements l ................................ ................................ ................................ ........... 46 3 7 Analysis of deletion and point mutations in the 34 ANF promoter luciferase construct. ................................ ................................ ................................ ............ 47 3 8 Schematic of the A NF locus with Bgl II sites and the positions of PCR primers ................................ ................................ ................................ ............... 48 3 9 Whole mount in situ hybridization demonstrating endogenous ANF mRNA expression ................................ ................................ ................................ .......... 49 3 10 BNP expression in mouse heart ................................ ................................ ......... 49 3 11 Endogenous ANF mRNA expression in comparison to X gal staining of 34 31 21 ANF lacZ transgenic mice ................................ ................................ ........ 50 3 12 Diagram of experimental system indicating tamoxifen injection at E10.5 and X gal staining at E13.5. ................................ ................................ ...................... 51 3 13 R educed X gal intensity in Nkx2.5 ablat ed hearts ................................ .............. 51 3 14 P11 12 flox/flox and flox /flox/Cre hearts after perinatal tamoxifen injection. ....... 52 3 15 Hey2 expression in the heart. ................................ ................................ ........... 52 3 16 Increased X gal intensity in the left ventricle of Hey2 ablated hearts e. .............. 53 3 17 Location of an E box sequence is located at 34835 bp close to the Nkx2.5 binding sequence at 34776 bp site. ................................ ................................ ... 54 3 18 T amoxifen injection at E10.5 into pregnant female ( GATA4 flox/flox ) mated with male ( GATA4 flox/flox/Cre ) mice f ................................ ................................ ............. 55

PAGE 10

10 3 19 E xperimental system indicating tamoxifen injection at E19. Nkx2.5 ablation causes progressive heart failure ................................ ................................ ......... 56 3 20 Model for transcription of the ANF gene in the heart with or without Nkx2.5 under physiological condition s ................................ ................................ ............ 57 3 21 P ressure overload (transverse aortic constriction, TAC) and representative LV pressure volume curve with or without TAC d ................................ ............... 58 3 22 Fold difference of Taqman real time RT PCR of ANF and lacZ mRNA expression ................................ ................................ ................................ .......... 59 3 24 Diagram of experiments utilizing Nkx2.5 ablated mice with or without TAC in adult mice. ................................ ................................ ................................ .......... 60 3 25 Fold difference of Taqman real time RT PCR of Hey2 and ANF mRNA expression without TA C ................................ ................................ ...................... 61 3 26 Relative luciferase reporter activities of BNP ................................ ...................... 61 3 27 R epresentative data with highest DNA protein binding ................................ ...... 62 3 28 Nkx2.5 binding sites locating around 0.5 (ANF promoter), 21, 31 and 34 kb relative to the transcriptional start site. ................................ .......................... 63 5 1 C ardiac MLCK protein and phosphorylated MLC2 expression. .......................... 88 5 2 Specificity of p MLC2 antibody. ................................ ................................ .......... 89 5 3 Cardiac MLCK protein, pho sphorylated MLC2 and connexin 40 expression.. ... 89 5 4 Histological cardiac MLCK protein and phosphorylated MLC2 expression after TAC.. ................................ ................................ ................................ .......... 90 5 5 Cardiac MLCK protein and phosphorylated MLC2 expression after TAC.. ......... 91 5 6 Reduction of cMLCK after pressure overloading... ................................ ............. 91 5 7 Schematics of generation of cMLCK knockout mice.. ................................ ......... 92 5 8 Gene targeting of cMLCK. ................................ ................................ .................. 93 5 9 Moderate heart enlargem ent in cMLCK knockout mice. ................................ ..... 94 5 10 Reduction of contractile function in cMLCK knockout mice. ............................... 95 5 11 Representative images of c ardiomyocytes isolated from cMLCK+/+ and cMLCK / mice at 3 months of age. ................................ ................................ ... 96

PAGE 11

11 5 12 Heart failure in cMLCK knockout mice after 3 months of pressure overloading. ................................ ................................ ................................ ........ 97 5 13 Representative tracing of LV pressure and dP/dt in cMLCK+/+ vs. cMLCK / mice after pressure overloading ................................ ................................ ......... 98 5 14 Overexpression of cMLCK attenuates ca rdiac hypertrophy after 1 week of pressure overloading. ................................ ................................ ......................... 99 5 15 Increased expression of cMLCK preserves cardiomyocyte dimensions under pathological stress. ................................ ................................ ......................... 100 5 16 Overexpression of cMLCK maintains cardiac contraction after 3 months of pressure overloading. ................................ ................................ ....................... 101 5 17 cMLCK is necessary for adaptation to physiological stress. ............................. 102 5 18 Reduced cardiac contraction and MLC2v phosphorylation in cMLCK ablated hearts .. ................................ ................................ ................................ ............. 103 5 19 Prolongation of QRS d uration in cMLCK knockout mice. ................................ 104

PAGE 12

12 LIST OF ABBREVIATION S ANF A trial natriuretic peptide BNP Brain natriuretic peptide ChIP C hromatin immunoprecipitation cMLCK Cardiac myosin light chain kinase EMSAs E lectrophoretic mob ility shift assays LA Left atrium LV Left ventricle MLC2 Myosin (regulatory) light chain 2 RA Right atrium RV Right ventricle TAC Trans aortic coarctation

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Cardiac MLCK (c MLCK ) and Its Role in Cardiac Function By Sonisha Andrea Warren December 2011 Chair: Hideko Kasahara Major: Medical Sciences Physiology and Pharm acology The main focus of our laboratory is to elucidate transcriptional regulation of homeodomain transcription factor Nkx2.5 in the heart. For this study, we have focused on two downstream targets, atrial natriuretic factor (ANF) and cardiac specific myosin light chain kinase. Transcription factor Nkx2.5 is one of the major transactivators of the ANF gene in the developing heart. ANF is abundantly expressed in atrial cardiomyocytes throughout ontogeny and in ventricular cardiomyocytes in the developing heart. However, during cardiac failure and hypertrophy, ANF expression can reappear in adult ventricular cardiomyocytes. We identified Nkx2.5 34, 31 and 21 kb) and the proximal ANF promoter by ChIP assay using n eonatal mouse cardiomyocytes. 3C analysis revealed close proximity between the distal elements and the promoter region. A 5.8 kb fragment consisting of these elements transactivated a reporter gene in vivo recapitulating endogenous ANF expression, which wa s markedly reduced in Nkx2.5 ablated mice. However, expression of a reporter gene was increased and expanded toward the outer compact layer in the absence of transcription repressor Hey2 similar to endogenous ANF expression. Functional Nkx2.5 and Hey2 bind ing sites

PAGE 14

14 separated by 59 bp were identified in the 34 kb element in neonatal cardiomyocytes. In adult hearts, this fragment did not respond to pressure overload, and ANF was induced in the absence of Nkx2.5 Another factor regulated by Nkx2.5 is cardiac MLCK (cMLCK) This kinase has been demonstrated to phosphorylate MLC2v and 2a in vitro and in vivo Phosphorylation of myosin light chain 2 (MLC2) is one regulatory mechanism to enhance cardiac contraction. To examine the role cMLCK plays in the heart we created two murine models of cMLCK. For our knockout model, we generated a conditional null allele of cMLCK by introducing loxP sites spanning exon 5 through homologous recombination in ES cells. This deletion eliminates the first coding exon of the catal ytic domain and results in the frame shift of the subsequent downstream exons. Northern blotting demonstrated that cMLCK mRNA expression was below the level of detection in cMLCK / hearts using the cDNA probe recognizing the upstream from exon 5, indicati ng that cMLCK / mice do not express stable cMLCK mRNA. cMLCK / mice were born at the expected Mendelian ratios; however they demonstrated an approximately 20% increase of heart weight/body weight at postnatal day 2 cMLCK / mice survive through adulthoo d despite the mild increase in heart weight/body weight accompanied by reduced cardiac contraction The phosphorylated form of MLC2v was below the level of detection in 2D electrophoresis followed by Western blotting with anti MLC antibod y, while the relat ive amounts of phosphorylated MLC2v to the total MLC2v was appr oximately 30% in wild type. L ef t ventricular dysfunction in knockout mice was also revealed by changes in systolic

PAGE 15

15 torsion by magnetic resonance imaging in 12 weeks old mice. Mice null for cMLC K were observed to have torsion of 26.7/cm vs. 38.3/cm observed in wild type. C ardioprotective effects were demonstrated in mice overexpressing cMLCK when subjected to pathological conditions of trans aortic coarctation (TAC). Fractional shortening was observed to be reduced by 8.5% in cMLCK transgenic mice (n=8) vs. 29.0% in wild type (n=6) four weeks following surgery. The results presented in this dissertation demonstrate that Nkx2.5 and its responsive cis regulatory DNA elements are essential for AN F expression selectively in the developing heart. Also, loss of cMLCK in gene targeted mice results in a reduction of phosphorylation of MLC2v accompanied by reduced cardiac contraction while an overexpression of cMLCK appears to have beneficial cardiopro tective effects under pathological stress.

PAGE 16

16 CHAPTER 1 INTRODUCTION Despite advances in medicine, heart disease remains the leading cause of death in the United States According to the Center for Disease Control (CDC) roughly 550,000 people are diagnose d with heart failure each year. Heart failure is also the leading cause of hospitalization in people older than 65. Every year about 785,000 Americans have a first heart attack while another 470,000 who have already had one or more heart attacks will have another attack. In 2010, heart disease was estimated to have cost the United States $316.4 billion. Because the most effective treatment for end stage chronic heart failure is currently heart transplant, a practice unsuitable for mild cases of heart diseas e there is an increasing demand for alternative therapeutic modalities to fundamentally improve cardiac function in a failing heart Dynamics of Cardiac Function Coordinated conduction and contraction is critical for cardiac function. Cardiac conduction i s initiated by a spontaneous wave of electricity (action potential) that arises from sinoatrial (SA) nodal cells located in the upper right atrium, followed by sequential spreading of action potential to the atria, atrioventricular (AV) node, His bundles, peripheral Purkinje fiber, and the ventricles. In the SA and AV nodes, inward Ca2+ currents are primarily responsible for slow depolarization of the action potential, whereas Na+ currents are primarily responsible for rapid depolarization of the action pot en tial in other cardiomyocytes. After membrane depolarization, L type Ca2+ channels are activated, followed by Ca2+ release from intracellular Ca2+ stores in sarcoplasmic reticulum (SR) through the cardiac isoform of the ryanodine receptor (RyR2) (Ca2+ ind uced Ca2+ release).

PAGE 17

17 Sufficient intracellular Ca2+ allows actomyosin interactions resulting in cardiac contraction (exci tation contraction coupling). Presumably, ion channels preferentially expressed in heart are transcribed in a cardiac specific manner. Ca lcium release from the SR promotes interaction with actin and myosin in the sarcomere and c ardiac co ntraction depends largely on this motor action of molecular myosin of the thick filament to bind to actin in the thin filament in order to initiate sarcomer e shortening and force development. Abnormalities in sarcomeric proteins, like actin and myosin, expressed in the myocardium are major causes of idiopathic cardiomyopathies and lead to chronic heart failure (Kamisago et al. 2000) The Role of Transcription Factors in Cardiac Structure and Function Homeobox genes comprise a large family of transcription factor regulating genes that are critical for early basic patterning. The structural motif characterizing all memb ers of homeobox genes is a 180 base pair region encoding a 60 amino acid homeodomain (HD). Homeobox genes can be clustered (also known as Hox genes) or dispersed, which are more complex and appear throughout the genome. Expression patterns of dispersed hom eobox genes may be diverse and can be tissue restricted. Several homeobox genes are expressed in the embryonic heart and have been shown to be critical to normal cardiac dev elopment (Komuro and Izumo, 1993a; Lints et al. 1993; Kasahara et al. 1998b) In particular, Nkx2.5 (also known as Csx for cardiac speci fi c homeobox) have been characterized and found to play vital roles in the developme nt of normal cardiac structures as well as regulate the expression of factor s important for t he normal function of the heart.

PAGE 18

18 Mouse Models to Study Cardiac Function The work presented in this dissertation will demonstrate our findings in vivo through characterization of mouse models. Mice are a widely utilized animal model for st udying heart function because of the ability to generate cell type specific, inducible KO or transgenic strategies This advantage makes the mouse an invaluable tool to study the physiological role of cardiac factors, pathogenesis of heart failure and to i dentify novel therapeutic targets. In addition, we are able to determine cardiac relevant physiological assessments in a system similar to human beings. We will also be demon strating data from mice that have undergone pressure overload by trans aortic cons triction (TAC) The mouse model is perhaps the most widely used model for this and it was first described by Rockman et al (Rockman et al. 1991) The greatest advantage of this model is the ability to quantify the pressure caused by t he sudden onset of hypertension achieved with TAC which usually results in early hypertrophy

PAGE 19

19 CHAPTER 2 Nkx2.5 IS NECESSARY FOR CARDIAC FORMATION AND FUNCTION Background Nkx2.5 is a member of the NK2 class of homeodomain (HD) protei ns, which were first described in Drosophila (Kim and Nirenberg, 1989; Azpiazu and Frasch, 1993; Bodmer, 1993) are highly conserved from nematode to human and are characterized by a unique Tyr residue at position 5 4 in the third h elix of the HD (Harvey, 1996) NK2 class homeoproteins are expressed in a tissue specific manner, suggesting a role in tissue specification and maturation. Nkx2.5 (or Csx) is an evolutionarily conserved HD containing transcription factor that is essential for cardi ac development. It is considered to play an important role for regulation of septation during cardiac morphogenesis and for maturation and maintenance of the AV conduction system throughout life. Nkx2.5 is one of the earliest markers for the precardiac mes oderm and its expression continues throughout he art development (Komuro and Izumo, 1993b; Lints et al. 1993; Turbay et al. 1996) In mice, Nkx2.5 expression starts 7.5 days post coitum in the precardiac mesoderm and its expression continues until adulthood Nkx2.5 null mice die before embryonic day 11 prior to the c ompletion of looping (Lyons et al. 1995; Tanaka et al. 1999) making it difficult to examine the function of Nkx2.5 in the later stage of heart development. In contrast, overexpression of Nkx2.5 induces enlarged hearts in Xenopus (Fu and Izumo, 1995; Cleaver et al. 1996) and zebrafish (Chen and Fishman, 1996) embryos with increased number of cardiomyocytes, suggesting potential mitogenic effects of Nkx2.5 on precardiac mesoderm or cardiomyocytes. Nkx2.5 expression continues in adult hearts and human patients with NKX2.5 mutations h ave

PAGE 20

20 progressive conduction defects and left ventricular dysfun ction in adulthood (Schott et al. 1998; Benson et al. 1999) Nkx2.5 led to the stimulation of Nkx2.5 dependent promoters in transient t ransfection assa ys using mice fibrobalsts (Chen and Schwartz, 1995) However, when the carboxyl terminal domain is deleted, its transcriptional activity is markedl y increased (Lee et al. 1998b; Kasahara and Izumo, 1999) without increased DN A bindin g affinity (Kasahara et al. 2000; Kasahara et al. 2001a) suggesting that the carboxyl terminus region of Nkx2.5 contains transcriptional repressor activity independent of DNA binding. Nkx2.5 forms homo and hete ro dimers with other cardiac transcription factors (Durocher et al. 1997; Lee et al. 1998a; Kasahara and Izumo, 1999; Bruneau et al. 2001; Hiroi et al. 2001; Habets et al. 2002) DNA non binding mutants of home oproteins have been utilized as dominant inhibitory molecules to interfere with the X enopus homeoproteins, Mix 1 (Mead et al. 1996) Xvent2 Nkx2.3 (Onichtchouk et al. 1998) and Nkx 2.5 (Grow and Krieg, 1998) Embryos injected with the DNA non binding mutant of Nkx2.5 showed abnormal heart development (Grow and Krieg, 1998) Mice expressing a D NA non binding mutant of Nkx2.5 myosin heavy chain (MHC) promoter were born apparently normal, but the accumulation of Nkx2.5 (I183P) mutant protein in the embryo, neonate and adult myocardium resulted in progressive and profound cardiac conduction defects and heart failure, and most of the mice died before 4 months of age (Kasahara et al. 2001b) In contrast, overexpression of wild MHC promoter showed a more severe phenotype causing emb ryonic or early postnatal lethality likely due to cardiac defects (Kasahara et al. 2001b)

PAGE 21

21 Loss of Nkx2.5 Results in Compromised Cardiac Conduction Similar to the pathogenesis of human congenital AV block and oc casional LV dysfunction associated with NKX2.5 mutations, previous studies (Kasahara and Benson, 2004) reveal that Nkx2.5 is necessary for proper conduction and contraction postnatally, but is more critical in the perinatal heart and is necessary for survi val in mice (Kasahara et al. 2001b) Haploinsufficiency (loss of one allele) of Nkx2.5 is considered to be an underlying cause of human congenital heart disease This phenotype has also been shown in several germli ne heterozygous null Nkx2.5 mice. Although substantially different degrees of defects among studies were reported (Kasahara et al. 2000) PR prolongation accompanied with wide QRS was detected as early as 7 weeks o f age. Deletion of the Nkx2.5 gene after 2 weeks of age, resulted in lack of apparent development heart enlargement heterozygous null mice, PR prolongation or wide QRS by 24 weeks of age, with the exception of one mouse with an intermittent 21 AV block at 24 weeks of age (Briggs et al. 2008) Nkx2.5 a nd Human Heart Disease I n humans, 26 different heterozygous NKX2.5 mutations have been identified in patients with congenital heart disease, and these appear inherit ed in an autosomal dominant fashion (Schott et al. 1998; Benson et al. 1999; Goldmuntz et al. 2001; Gutierrez Roelens et al. 2002; McElhinney et al. 2003) Common cardiac phenotypes in patients include secundum atrial septal defect (ASD) and progressive atrioventricular (AV) conduction failure. Progressive heart failure was also reported (Schott et al., 1998; Benson et al., 1999)

PAGE 22

22 The ANF proximal promoter contains an Nk x2.5 binding site Studies have suggested ANF gene, which encodes the heart major secretory p roduct and is an early marker of cardiomyocyte differentiation is a downstream target of Nkx2.5 (Durocher et al. 1997) In fully developed adult hearts, AN F is normally downregulated in the ventricles, and atrial cardiomyocytes produce the majority of ANF peptide. On the other hand, volume and/or pressure overload to the heart from various etiologies leads to the re expression of genes that are transcribed i n embryonic hearts but silent in adult hearts (Houweling et al. 2005; McGrath et al. 2005; Oka et al. 2007) Whether common or distinct cis elements and transcription factors are responsible for gene regulation during normal cardiac development compared to diseased hearts have been studied extensively, but the process is not completely understood (Rockman et al. 1991; Knowlton et al. 1995; Habets et al. 2002; Mayer et al. 2002; Horsthuis et al. 2008) Nkx2.5 is the most widely used marker for the cardiomyocyte cell lineage (Beltrami et al. 2003; Singh et al. 2007) Mice with germline deletion of Nkx2.5 are developmentally arrested around embryonic (E) day10.5, at which time ANF expression is markedly downregulated both in atria and ventricles (Lyons et al. 1995; Tanaka et al. 1999) To clarify the function of Nkx2.5 beyond E10.5, we recently generated tamoxifen inducible Nkx2.5 gene targeted mice (Briggs et al. 2008; Takeda et al. 2009; Terada et al. 2011) Nkx2.5 ablation beginnin g at mid embryonic (E12.5 and E13.5) and E19 results in premature death; whereas after terminal differentiation of cardiomyocytes beginning at 2 weeks of age, it does not lead to lethality but to moderate cardiac

PAGE 23

23 contractile defects. At all these stages, l evels of ANF transcripts were markedly decreased shortly after Nkx2.5 ablation. ANF transcription is tightly regulated spatially during cardiac development (Durocher et al. 1997) however the precise binding elements for Nkx2.5 in the ANF promoter i s unknown. In the following chapter we will present data detailing the binding sites of Nkx2.5.

PAGE 24

24 CHAPTER 3 DIFFERENTIAL ROLE OF N kx 2.5 IN ACTIVATION OF THE ANF GENE IN DEVELOPING VS. FAILING HEART Background The 28 amino acid atrial natriuretic peptid e (ANF) is released from cardiomyocytes, and regulates fluid and electrolyte balance as well as cardiovascular growth (Houweling et al. 2005; McGrath et al. 2005) During cardiac development, regional myocardial g ene expression is linked to the differentiation of ventricular cardiomyocytes. ANF is abundantly expressed in the atrial and in the inner (trabecular) layer of ventricular cardiomyocytes, where lower proliferative activity was evident compared to the outer (compact) layer between embryonic day (E) 9.5 14.5 (Christoffels et al. 2000; Sedmera et al. 2003) Previous studies demonstrated Nkx2.5 dependent regulation of ANF through its proximal promoter using reporter a ssays and electrophoretic mobility shift assays (EMSAs) (Durocher et al. 1997; Lee et al. 1998a; Bruneau et al. 2001; Kasahara et al. 2001a) yet these findings remain to be clarified in vivo In addition, the p roximal promoter is not responsible for ventricular layer specific expression of ANF gene in vivo The regulatory elements sufficient for ANF transcription in both physiological and pathological ventricles are located within a 140 om the transcription start site using a BAC DNA fragment (Horsthuis et al. 2008) Specific transcription factors and their binding elements in physiological/developmental vs. diseased hearts in this large DNA fragm ent remain to be identified. To identify Nkx2.5 binding elements in the genomic locus including the ANF gene, we employed chromatin immunoprecipitation (ChIP) in mouse cardiomyocytes either expressing or lacking Nkx2.5 shortl y after tamoxifen induced gene disruption We

PAGE 25

25 identified the ANF immunoprecipitated with Nkx2.5 antibodies from cardiomyocytes expressing Nkx2.5 Chromosome conformation capture (3C) revealed close proximity of the dis tal elements and the ANF promoter. Indeed, a 5.8 kb DNA fragment including the proximal promoter and the three upstream elements ( 34, 31, 21 kb regions, 1 2.5 kb each) transactivated a lacZ reporter gene in hearts in vivo in an Nkx2.5 dependent manner, recapitulating expression of endogenous ANF. Materials and Methods Mouse M odels Generation of inducible Nkx2.5 ablated mice was described previously (Briggs et al. 2008) To generate inducible GATA4 gene target ed mice, floxed GATA4 mice (Jackson Laboratory, Stock No 008194, generated by Dr. Stephan Duncan ) (Watt et al. 2004) were bred with Cre ER TM mice driven by a tamoxifen inducible cre mediated recombination system dr iven by the chicken beta actin promoter/enhancer coupled with the cytomegalovirus (CMV) immediate early enhancer (Jackson Laboratory, Stock No 004453, generated by Dr. Andrew McMahon ) (Hayashi and McMahon, 2002) Ma ternal injection of tamoxifen (0.5 1 mg/g body weight, ip) was performed either at E10.5 or E19. Tamoxifen was injected into adult mice (6 9 weeks of age, body weight 20 25 g) for 2 consecutive day s before surgery. Generation of Hey2 germline knockout mice was previously described (Sakata et al. 2002) To generate lacZ reporter mice, luciferase plasmid constructs (pGL2 34 31 21 ANF promoter and 34 31 21 BNP promoter, see below) were subcloned into the pSIB vector (Seki et al. 2006) All animal care protocols fully conformed to the Association for

PAGE 26

26 the Assessment and Accreditation of Laboratory Animal Care, with approvals from the University of Florida Institutional Animal Care and Use Committees. Chromatin Immunoprecip itation (Chip) Assays Followed b y Real Time PCR Mouse Models After genotyping, neonatal hearts isolated from either flox/flox or flox/flox/Cre mice were separated and subjected to serial trypsin digestion followed by Percoll density gradients. Cardiomyocytes (3 x10 6 cells per a single ChIP assay), fixed with 1% formaldehyde, were subjected to ChIP assays (EZ ChIP TM kit, Millipore) using 5 g of affinity purified anti Nkx2.5 (Kasahara et al. 1998a) anti dimethyl histone H 3K4 (07 030, Millipore), anti trimethyl histone H3K27 (07 449, Millipore), or control rabbit IgG antibodies (EZ ChIP TM kit). Taqman real time PCR was performed using 10 fold serially diluted input DNA for generating a standard. Chromosome conformation capt ure (3C) Formaldehyde fixed cardiomyocytes (5x10 6 cells per a single 3C assay) utilized for 3C experiments were subjected to digestion with Bgl II restriction enzyme following the standard protocol provided by Dr. Dekker (University of Massachusetts Medic al School) (Dekker et al. 2002) 20 g BAC DNA containing the entire ANF and BNP loci (Invitrogen, RPC 123.C, Clone ID: 128E8) was used as control. Taqman real time PCR was performed using probes near the restricti on sites Reporter Assays and Cloning o f Hey2 The ANF gene containing BAC clone (Invitrogen, RPC 123.C, Clone ID: 128E8, chromosome 4, 147272452 147481609, length 209,158 bp) was subjected to PCR for amplification of the following genomic DNA fragments u sing specific primers (ANF promoter fragment GTCATTGCCTCCTCTCCCGC

PAGE 27

27 TGTCTCTGCCCACTCTGGTTTC 34 kb fragment 36320 to 34624 from the ANF TGATTACCAGCCCACCTTTGAC ACCCCCAGCCCCGT ATGG 31 kb fragment 31783 to 29218 from the ANF GCACTTGCTACTAAAGGCGGG GGGGTTCAGAAGGGTCTTATCGTC 21 kb fragment 21627 to 20582 from the GGGCTGAGGGGTCACACAAT C TTGGGTTTAGGGTCCACCTTATG Blunt II TOPO or pCR2.1 vector (Invitrogen), sequenced, and inserted into pGL2 basic plasmid (Promega) using appropriate restriction enzyme sites. Neonatal cardiomyocytes is olated as described above were plated in 12 well plates. The next day, cells were cotransfected with 2 g of luciferase reporter constructs and 0.5 g of Rous sarcoma virus galactosidase constructs using the calcium phosphate method for 2 hrs. as describ ed previously (Kasahara et al. 2001a) Mouse Hey2 cDNA was cloned from RNA isolated from neonatal mouse hearts that was subjected to reverse transcription using random priming followed by PCR using two sets of spe GCAGGGAGGGAGGGAGGAAG AGCACTCTCGGAATCCAATGC CCGACAACTACCTCTCAGATTATGG GGCGTTTTCCTTTTCCAAGTCAG l length Hey2 cDNA by PCR. HA tagged full GAAGCTTATG TACCCATACGATGTTCCAGATTACGCT AAGCGCCCTTGTGAGGAAA CGA GGCGTTTTCCTTTTCCAAGTCAG into pcDNA3 vector (Invitrogen) and sequenced.

PAGE 28

28 0.5 g of pcDNA3 or pcDNA3HA Hey2, 2 g of luciferase reporter constructs and 0.5 g of CMV galactosidase constructs were co transfected into neonatal cardiomyocytes using the calcium phosphate method for 2 hrs. X Gal Staining, Whole Mount In Situ Hybridization and Measurement o f Beta Galactosidase Activity Mouse embryos and hearts were stained with beta galactosidase substrate, X gal, and were photographed before and/or after clearing as described (Seki et al. 2003) Whole mount in situ hybridization was performed using the mouse ANF 578 bp PCR products TGGGCAGAGACAGCAAACATC TGACACACCACAAGGGCTTAGG TGGGGAGGCGAGACAAGGG TCTTCCTACAACAACTTCAGTGCG 3') as described (Moorman et al. 2001) Heart homogenates in Reporter Lysis Buffer (Promega) were utilized for measurement of beta galactosidas e activity using o nitrophenyl D galactopyranoside normalized by protein content (BCA Protein Assay Kit, Pierce). Real time RT PCR Real time RT PCR was performed using inventoried Taqman Gene Expression Assays (Applied Mm00600555, lacZ Ac03987581, GATA4 Mm00484689 and Hey2 Mm00469280. Data were normalized to actin expression (No. 4352933E). Triplicate experiments were averaged. Western Blotting The following primary an tibodies were utilized: GAPDH mAb (Research Diagnostics TRK5G4 6C5), and HA mAb (Cell Signaling 2367).

PAGE 29

29 Transverse Aortic Constriction ( TAC ) a nd Pressure Measurement TAC and left ventricular pressure measurement using Millar catheter was performed using a s tandard method as described (Shibata et al. 2004; Pacher et al. 2008) Briefly, a catheter was inserted into the cavity of the left ventricles of anesthetized mice via the carotid artery. Changes in pressure within the LV cavity were detected by the Millar catheter and recorded using PVAN Software Analyses were completed using LabChart5 software. Northern Blotting Northern blotting was performed using probes described previously (Chan et al. 2008a; Takeda et al. 2009) Statistical Analyses hoc test (StatView version 5.01). p < 0.05 wa s considered significant. Results Binding o f Nkx2.5 i n t he ANF Gene ( Nppa ) Locus Nkx2.5 has been shown to regulate transcription of the ANF as well as BNP genes, which are localized in tandem and separated by approximately 14 kb on mouse chromosome 4 (Figure 3 1 ) (Tanaka et al. 1999; Taked a et al. 2009) In order to understand Nkx2.5 dependent transcriptional regulation, we examined Nkx2.5 binding to the ANF/BNP gene locus by ChIP in mouse neonatal cardiomyocytes. Two different cell populations of mouse neonatal cardiomyocytes, either exp ressing or lacking Nkx2.5 were isolated from Nkx2.5 flox/flox or Nkx2.5 flox/flox/Cre mice after maternal i njection of tamoxifen (Figure 3 2 ). Our previous studies demonstrated that Nkx2.5 expression was almost completely ablated after perinatal tamoxifen injection at post natal day 2

PAGE 30

30 (P2) (Briggs et al. 2008) which reduced ANF transcription by 90% at P4 (Takeda et al. 2009) After elimination of interspersed repeats and lo w complexity DNA sequences using RepeatMasker program ( http://www.repeatmasker.org ), the remaining region was utilized for designing Taqman primer and probe sets for every 1 kb in the genomic locus from 44 to +3 kb relative to the ANF tra nscription start site (Figure 3 1 ). Validated primer and probe sets demonstrating linear amplification in serially diluted input DNA were further utilized for ChIP assays (File Builder v3.1, Applied Biosystems ). Nkx2.5 antibodies preferentially immunoprecipitated the genom ic regions 34, 31, 21, 14 (BNP promoter) and 0.3 kb relative to the ANF transcription start site in cardiomyocytes expressing Nkx2.5 but not in cardiomy ocytes lacking Nkx2.5 (Figure 3 3 ). Histone modification patterns examined by H3K4 or H3K27 methyl ation in the ANF/BNP gene locus were not significantly different in the neonatal cardiomyocytes with or witho ut Nkx2.5 (Figure 3 4 ). Howe ver, % recovery from input DNA wa s approximately 10 fold higher in anti H3K4me2 than in anti H3K27me3 antibodies. This could be due to lower efficiencies in immunoprecipitation using H3K27me3 antibodies, or due to reduced occupancy of this marker in this gene locus. Identification o f Three Regulatory DNA Elements i n t o f t he ANF Gene In reporter assays and EMSA we and others previously established that the ANF proximal promoter region includes two potential Nkx2.5 binding sites conserved in mouse and rat (mouse 260 bp and 86 bp sites, and rat 242 and 83 bp sites) (Figure 3 5 ) (Durocher et al. 1997; Lee et al. 1998a; Kasahara et al. 2001a) In neonatal cardiomyocytes (P2) expressing endogenous levels of Nkx2.5 proteins, the proximal ANF promoter ( 451 to +56 bp relative to the transcription start site) mediated 18 fold

PAGE 31

31 activation of a reporter gene relative to the control promoter less construct. The activation was reduced by 85% in cardiomyocytes l acking Nkx2.5 protein (Figure 3 5 ). Addition of the four upstream Nkx2.5 binding elements ( 34, 31, 21 kb and 14 kb BNP promoter elements) identified in ChIP assays, increased luciferase activity by 1.7 to 5.5 fold in Nkx2.5 expr essing cardiomyocytes (Figure 3 6 ). When three elements ( 34, 31, 21 kb elements) were included in tandem ( 34 31 21 ANF luc), we observed a slight further increase in luciferase activity with strong suppression in the absence of Nkx2.5 compared to addition of each element alone. These results indicate that fragments enriched in ChIP assays include Nkx2.5 dependent promoter and enhancer activit ies as tested in neonatal cardiomyocytes. Functional Characterization o f t he Nkx2.5 Responsive Site i n t he 34 Kb Region We next examined Nkx2.5 responsive site(s) in the 34 kb element (1696 bp), which yielded the strongest stimulatory activity among the three elements with exclusion end of the 34 kb element (414 bp) exhibi ted enhancer activity (Figure 3 7 ). This region contains two Nkx2.5 consensus binding sites, which are c onserved in mouse, rat and human ( 3485 1 and 34776 bp sites, Figure 3 7 ). Point mutations of 34851 ( 34M1) and/or 34776 ( 34M2) from AA G to CC G revealed that the 34776 bp site includes predominant Nkx2.5 dependent enhancer activity D ynamic changes in the chromatin configuration of the ANF gene locus upon Nkx2.5 binding The reporter constructs used in transfection studies contained the ANF promoter and enhancer elements adjacent to each other; thus the constructs do not reflect the chromatin structure within the endogenous ANF gene locus. However, proximity could

PAGE 32

32 be established by physical contact between the enhancer and the promoter mediated by protein protein interactions (Li et al. 2006) In fact, protein protein interactions of Nkx2.5 itself and with other cardiac transcription factors have been documented (Chen et al. 1996; Durocher et al. 1997; Lee et al. 1998a; Bruneau et al. 2001; Kasahara et al. 2001a) C hromosome C onformation C apture (3C) method (Dekker et al. 2002) was utilized for determining proximity between the distal elements and the ANF proximal promoter. Briefly, cross linked genomic DNA in the neonatal cardiomyocytes was digested with the restriction enzyme Bgl II and ligated in a large volume. Ligation frequencies were quantified by Taqman real time PCR using speci fic primers and probes and were compared to the ligation frequency of non crosslinked Bgl II digested BAC DNA containing the ANF locus. Globally, there was a higher frequency of interactions between the ANF promoter 34, 31, 21 and BNP promoter) in cardiomyocytes expressing Nkx2.5 than i n those lacking Nkx2.5 (Figure 3 8 ). In particular, interaction frequencies between the ANF promoter and the 31 k b element were higher than between the ANF promoter and the 34 or 21 kb region in Nkx2.5 expressing cardiomyocytes. These results suggest that Nkx2.5 mediates close proximity between the distal regulatory elements and the proximal promoter of the ANF gen e. The Role o f Nkx2.5 Dependent Proximal Pro the Expression o f The ANF Gene i n Embryonic a nd Perinatal Hearts To examine promoter/enhancer activities in vivo we generated transgenic lacZ reporter mice ( 34 31 21 ANF lacZ ) in which lacZ expression is driven by the ANF promoter and the three distal enhancer elements. The BNP promoter region was excluded from the transgenic construct in consideration of potential interference of

PAGE 33

33 transcription initiation from the ANF promoter in vivo In neonatal hearts, in situ hybridization demonstrated ANF expression in atria and in the inne r layer of ventricles (Figure 3 9 ). X gal stained 34 31 21 ANF lacZ expression demonstrated a similar expression pattern overall in a total of five dif ferent transgenic lines (Tg 1 5) (Figure 3 9 ). Some variation in localization and intensity of staining among different transgenic lines is likely due to different genomic integration sites and copy numbers. Notably, when the ANF proximal promoter sequence is substituted for that of BNP ( 34 31 21 BNP lacZ ), lacZ expression in the neonatal heart was not consistently observed in five separate transge nic lines (Figure 3 10 ). This suggests specificity of the 34 31 21 ANF lacZ constructs in cardiac expression. At E10.5 (Figure 3 11 top panels), both ANF mRNA and X gal stained 34 31 21 ANF lacZ expression was nearly restricted to the heart with the exception of weak extra cardiac X gal staining in two transgenic lines (Tg2 and 3). These three transgenic lines (Tg1 3) were further examined in the following experiments because of less extra cardiac expression than two other transgenic lines (Tg4 and 5) (data not shown). In E13.5 hearts, staining intensity of both mRNA and lacZ was higher in the inner trabecular layer vs outer compact layer (Figure 3 11 ). To confirm that 34 31 21 ANF lacZ expression is Nkx2.5 dependent as demonstrated by transient transfection assays in cardiomyocytes, we crossed 34 31 21 ANF lacZ mice with tamoxifen inducible Nkx2.5 knockout mice. In the following experiments, X gal staining was performed side by side using littermates in order to eliminate stage dependent lacZ expression. First, tamoxifen was injected at E10.5 into a pregnant female followed by X gal sta in ing at E13.5 (Figure s 3 12 and 3 13 ). Second,

PAGE 34

34 tamoxifen was injected at E19 into a pregnant female followed by X gal staining at postna tal day 11 12 (P11 12 ) ( Figure 3 14 ). At two different stages in all three transgenic lines, intensity of X gal staining was reduced in Nkx2. 5 flox/flox /Cre mice compared to Nkx2.5 flox/flox littermates. Increased Expression o f ANF Mrna a nd 34 31 21 ANF Lacz in the Left Ventricle in the Absence o f Transcription Repressor Hey2 Multiple previous studies have demonstrated that the ANF promoter al one is sufficient for driving expression of reporter genes in the ventricle but is lacking a trabecular layer specific reporter gene expression pattern (Habets et al. 2002; Horsthuis et al. 2008) suggesting that the ANF promoter combined with upstream elements is necessary to transactivate the lacZ gene in the trabecular layer of the ventricle. Because Nkx2.5 is expressed throughout the ventricular layer (Komuro and Izumo, 1 993a; Lints et al. 1993; Kasahara et al. 1998a) we hypothesized that a repressor interferes with Nkx2.5 specifically in the compact layer. Hey2 (also referred to as CHF1, HRT2, Hesr 2, and HERP1) is a member of the basic helix loop helix transcription factor family that preferentially binds to the E box [ CAC ( G/A ) TG ] and is predominantly expressed in the ventricular compact layer (Fischer et al. 2005; Koibuchi and Chin, 2007; Xin et al. 2007) In Hey2 germline knockout mice (determined by genotyping using PCR, Figure 3 15 ), expression of ANF mRNA was increased in the left ventricle, consistent with previous studies (Figure 3 15 marked with *) (Koibuchi and Chin, 2007; Xi n et al. 2007) Intensity of X gal staining of 34 31 21 ANF lacZ in the left ventricle was also increased in Hey2 / mice in all t hree transgenic lines (Figure 3 16 ). Tissue sections revealed ectopic expression of ANF mRNA and 34 31 21 ANF lacZ in the compact

PAGE 35

35 layer (Figure 3 16 ). These results indicate that the 34 31 21 ANF construct includes Hey2 reponsive elements, which contributes to the elimination of lacZ expression in the compact layer of the left ventricle. A consensus Hey2 binding E box sequen ce conserved in mouse, rat and human was found at 34835 bp site close to the Nkx2.5 responsive site in 34 kb element (59 Nkx2.5 resp onsive 34776 bp site) (Figure 3 17 see Figure 3 7 ). Co transfection of a Hey2 expression plasmid with 34 A NF promoter luciferase reporter plasmid into neonatal cardiomyocytes resulted in substantial reduction of luciferase activities compared to co transf ection of empty plasmid (Figure 3 17 ). At the same dose, we did not observe a reduction of ANF promoter luc iferase expression consistent with a previous report (Xiang et al. 2006) Point mutations in the E box (C A CG T G to C G CG A G) at 34835 bp site attenuated the reduction of luciferase activity following ectopic express ion of Hey2, indicating that the 34835 bp site includes predominant Hey2 dependent repressor activ ity in 34 kb element (Figure 3 1 7 ). A number of in vitro studies, including ours, demonstrated that a GATA transcription factor, GATA4, transactivates the A NF gene by binding to the ANF promoter region (Durocher et al. 1997; Lee et al. 1998a; McBride and Nemer, 2001) Hey2 dependent ANF repression has also been reported to be mediated by a reduction of GATA4 binding to the ANF promoter region (Kathiriya et al. 2004; Fischer et al. 2005; Xiang et al. 2006) Contrary to in vitro studies, ANF expression was not reduced (Molkentin et al. 1997) instead, was slightly increased in GATA4 germline knockout mice (Watt et al. 2004) which die around E7.0 9.5. To clarify these discrepancies at a later stage of heart development when two separated layers in the ventricles are

PAGE 36

36 evident, we employed the same methodology by substitution of floxed Nkx2.5 to floxed GATA4 mice (Watt et al. 2004) Tamoxifen was injected at E10.5 and E11.5, and E13.5 hearts were examined fo r expression of GATA4, ANF and BNP by quantitative RT PCR. Despite the marked reduction of GATA4 after tamoxifen injection, ANF and BNP expression was not reduced, but was instead slightly upregulated consistent with a previous study (Watt et al. 2004) ( Figure 3 18 ). Thus, in embryonic hearts, GATA4 is not required for transactivation of ANF gene. Dispensable Function o f Nkx2.5 i n Re Inductio n o f ANF i n Perinatal Failing Hearts Perinatal ablation of Nkx2.5 causes p rogressive heart failure with increased heart weight/body weight within 4 days leading to premature death at 2 to 4 weeks of age (Figure 3 19 ) (Briggs et al. 2008) Thus, it is intriguing to examine whether ANF is re expressed in the failing heart in the absence of Nkx2.5 which is critical for ANF transcription during cardiac development. Expression of ANF mRNA was examined at P4, P7 and P15 by Northern blotting, which was initially below the level of detection sh ortly after Nkx2.5 ablation at P4, it was slightly detectable at P7, and was markedl y up regulated at P15 (Figure 3 19 ). Re activation of another fetal cardiac gene, myosin heavy chain ( MHC), was also increased from P4 to P15 in Nkx2.5 ablated hearts, l ikely representing cardiac contractile dysfunction in these mice. These data suggest that Nkx2.5 is necessary for ANF expression in physiological development at P4, but may not be necessary for re activation of the ANF gene in the hea rt failure stage (P15) (Figure 3 20 ). Reduction of X gal staining of 31 21 ANF lacZ in P11 12 hearts in the absen ce of Nkx2.5 (shown in Figure 3 14 ), also suggests that the Nkx2.5 binding elements do not play a role in reactivation of the ANF gene.

PAGE 37

37 Nkx2.5 Independent ANF Transc ription i n Pressure Overloaded Adult Hearts To further examine a potential role for Nkx2.5 in gene regulation in pathological hearts, we utilized the pressure overloaded hypertrophy model induced by transverse aortic constrictio n (TAC) in adult mice (Figu re 3 21 ). In normal adult hearts, endogenous ANF mRNA expression was restricted with respect to the surface of the trabecular layers. In contrast, in pressure overload hearts following TAC, ANF expression was expanded toward the outer layer after 2 weeks, and was accompanied by an increase in heart si ze and wall thickness (Figure 3 21 ANF TAC vs. +). In contrast, X gal stained 34 31 21 ANF lacZ expression was not changed with 70 mmHg increases in the maximum left ventricular systolic p ressure following TAC (Figure 3 21 Tg1). Quantitative measurements of ANF mRNA confirmed up regulation by 10 to 25 fold relative to control sham operated mice with increased heart weight/body weight after pressure overloading in multiple mice in all three transgenic lines (Figure 3 7C, ANF, TAC vs. +). In contrast, there was no increase in lacZ mRNA (Figure 3 22 lacZ, TAC vs. +) or lacZ enzymatic activity in the heart lysates (Figure 3 23 TAC vs. +). In contrast to what has been observed in embryonic to perinatal mice (Briggs et al. 2008; Terada et al. 2011) Nkx2.5 ablation at later stages (after 2 weeks of age) does not cause lethality despite the presence of mild contraction defects (T akeda et al. 2009) Tamoxifen injected adult Nkx2.5 flox/flox/Cre mice were subjected to pressure overloading for 1 week and compared to sham opera ted mice (without TAC ) ( Figure 3 24 ). ANF transcription in Nkx2.5 flox/flox/Cre mice was reduced by 0.04 fold compared to control Nkx2.5 flox/flox littermates after tamoxifen injection without TAC, but was upregulated after pressure overloading in the absence of Nkx2.5 (increased from 0.04 to 0.69 fold in comparison to flox/flox control mice). In addition, the car diac hypertrophic

PAGE 38

38 markers, BNP and MHC, were increased in Nkx2.5 abl ated hearts after TAC (Figure 3 24 ). Taken together, these studies demonstrate that 34 31 21 ANF lacZ construct lacks DNA regulatory elements that respond to pressure overload as well as to heart failure. These data also suggest that Nkx2.5 binding may not be necessary for ANF reactivation following left ventricular pressure overloading, despite several studies suggesting that Nkx2.5 is involved in the reactivation of ANF transcription d uring pressure overloading (Thompson et al. 1998; Saadane et al. 1999; Bar et al. 2003) Discussion Transcription factor Nkx2.5 has been widely used as a marker gene for the cardiomyocyte cell lineage (Beltrami et al. 2003; Singh et al. 2007) and has been shown to regulate a critical set of genes to maintain proper cardiac formation and function, including ANF (Tanaka et al. 1999; Takeda et al. 2009; Terada et al. 2011) To our knowledge, this study is the first to systemically examine Nkx2.5 responsive regulatory DNA elements in the ANF gene locus using biologically relevant mouse neonatal cardiomyocytes. These elements, includ 34, 31, 21 and 14 kb) and the ANF proximal promoter, were identified using the ChIP assays. A 5.8 kb genomic fragment including these four elements transactivated a reporter gene ( 34 31 21 ANF lacZ ) and yielded express ion patterns that were comparable to the endogenous ANF gene in embryonic, neonatal and adult hearts at physiological condition in vivo which was markedly downregulated in Nkx2.5 ablated mice. The specific chromosomal configurations mediated by Nkx2.5 cou ld be explained by homodimerization of Nkx2.5 proteins that bind to different sites (Kasahara et al.

PAGE 39

39 2001a) and/or heterodimerization with other transcription factors including TBX5, SRF and Zac1 (Chen et al. 1996; Bruneau et al. 2001; Yuasa et al. 2010) One possibility is that these factors bind to nearby genomic elements, interact with each other, and thereby dynamically modify chromosomal configurations to form an acti ve chromatin hub (Palstra et al. 2003) Nkx2.5 binding at the proximal ANF promoter has previously be en demonstrated in in vitro transfection assays and in EMSAs. The binding of Nkx2.5 to the promoter in in vivo which contains two consensus Nkx2.5 binding sites (TNAAGTG), was confirmed in this study. The newly identified functional Nkx2.5 binding site in the 34 kb enhancer activity has the sequence TGAAGTG ( 34776 bp site). Interestingly, the Nkx2.5 binding sites at 34776 bp and 260 bp are identical. Despite an extensive analysis of mutations in the consensus Nkx2.5 binding sites as well as in the core binding sequence (AAG), we could not map Nkx2.5 binding site(s) in the 31 kb enhancer element. This could be interpreted that Nkx2.5 binding in the 31 kb element occurs via a non consensus sequence or that Nkx2.5 is recruited to this site by other DNA b inding proteins. Expression of endogenous ANF mRNA and 34 31 21 ANF lacZ is restricted to the inner trabecular layer of ventricles, while Nkx2.5 is expressed throughout the layers (Komuro and Izumo, 1993a; Lints et al. 1993; Kasahara et al. 1998a) Therefore, in the outer compact layer, Nkx2.5 may not be able to access the binding sites because of a closed chromatin structure of the binding element(s), or Nkx2.5 might be functionally inactivated by repressor(s). E ctopic lacZ reporter gene expression in the outer compact layer in Hey2 knockout mice indicates that the 34 31 21 ANF lacZ reporter construct

PAGE 40

40 contains Hey2 responsive elements. One Hey2 binding E box sequence was identified in close proximity to the Nkx2. 5 binding site in 34 kb element. The underlying mechanisms of Hey2 binding at 34 kb region leading to reduction of ANF transcription remain to be understood. Hey2 binding at 34 kb element might modify the chromatin structure of the ANF locus, and reduce interactions between 34 kb and ANF promoter regions in the compact layer. We performed 3C assays using neonatal cardiomyocytes isolated from both trabecular and compact layers, this heterogenous source of myocytes may result in relatively low interaction frequencies between 34 kb and the promoter regions examined in this study. Hey2 has been shown to recruit histone deacetylase HDAC1 and the co repressor N Cor to chromatin (Iso et al. 2001) A previous study fail ed to show histone deacetylase dependent inhibition of the ANF proximal promoter (Fischer et al. 2005) ; however, this inhibition remains to be determined in the presence of the distal elements. Another puzzling fin ding is that the 34 31 21 ANF lacZ reporter construct as well as ANF mRNA was upregu lated only in the left ventricle, despite the presence of Hey2 in the compact layers of both ventricles, consistent with previous studies (Koibuchi and Chin, 2007; Xin et al. 2007) Mechanisms governing regional gene regulation between inner trabecular vs. outer compact layers in right vs. left ventricles remain to be elucidated. Of note, expression of lacZ was excluded from the atr ioventricular canal (data not shown), where another inhibitor, Tbx2, has been shown to interact with Nkx2.5 at the ANF promoter (Habets et al. 2002) Hey2 dependent ANF gene repression has been shown to associate w ith reduction of GATA4 binding to the ANF promoter region in in vitro studies (Kathiriya et

PAGE 41

41 al. 2004; Fischer et al. 2005; Xiang et al. 2006) However, in vivo we did not observe a reduction of ANF transcripts s hortly after GATA4 ablation at E13.5 in developing hearts, which is consistent with previous studies in germline GATA4 knockout mice (Molkentin et al. 1997; Watt et al. 2004) The ANF enhancer regions identified i n this study are located within a 140 genomic fragment from the transcription start site using a BAC DNA fragment, a region previously shown to be sufficient for ANF transcription both during development and in pressure overloaded hearts (Horsthuis et al. 2008) Binding of Nkx2.5 to the distal elements ( 34, 31, 21 kb and proximal promoter) is required only for physiological expression of ANF. Combining the results from previous studies (Rockman et al. 1991; Knowlton et al. 1995; Habets et al. 2002; Mayer et al. 2002; Horsthuis et al. 2008) and this study, the 34, 31 and 21 kb elements with the proximal promoter region are not involved in or sufficient for the reactivation of ANF, and the other regulatory region(s) within the 140 kb BAC are responsible for the ANF activation in diseased heart. Cis elements and responsive transcription factors that mediate reactivation of the ANF gene in diseased hearts remain to be discovered. A number of signaling pathways and transcription factors including GATA4/5/6, serum responsive factor, TBX5, MEF2C, Baf60C, glucocorticoid receptor, adrenergic signaling through AP1 and SP1, endothelin 1, and Zac1, have been reported to reg ulate ANF gene expression under physiological or pathological conditions (Houweling et al. 2005; LaPointe, 2005; Temsah and Nemer, 2005; Oka et al. 2007; Kuwahara and Nakao, 2010; Yuasa et al. 2010) To our knowl edge, however, cis elements of all these transcription factors have been examined

PAGE 42

42 within the ANF promoter region, which is insufficient for the reactivation of ANF under pathological conditions. Whether these candidate transcription factors bind to the reg ion outside the promoter or new factors are recruited for reactivation of the ANF gene remains to be elucidated. A previous study demonstrates reduction of Hey2 mRNA 1 week after pressure overloading by TAC (Liu et a l. 2010) We consistently found that Hey2 mRNA was reduced by 50% 2 weeks after TAC ( Figure 3 25 ). Therefore, reduction of repressor Hey2 and subsequent reduction of its occupancy in the ANF gene locus outside of the regions examined in this study may pl ay a role in reactivation of the ANF gene in pressure overloaded hearts. Another candidate transcription repressor, neuron restrictive silencer factor (NRSF), has been shown to regulate ANF expression by coding exon under physiologic al condition (Kuwahara et al. 2001) Nkx2.5 binding at the BNP proximal promoter was demonstrated by ChIP. We detected a nearly 10 fold higher transcription level mediated by the proximal BNP promoter compared to t he ANF promoter i n neonatal cardiomyocytes, this activation was reduced by 27% in the absence of Nkx2.5 (Figures 3 26, 3 27 and 3 28 ). However, the lacZ BNP proximal promoter had only marginal activity in the heart (Figure 3 10 ). Based on the genomic structure of the ANF and BNP genes in tandem, the presence of common regulatory elements is plausible, but they are unlikely to be located within the 34 31 and 21 kb elements. Transient transfection assays in neonatal cardiomyocytes demonstrate that these two promoters include enhancer activities. It would be interesting to examine these effects in hearts in vivo.

PAGE 43

43 In summary, we demonstrated Nkx2.5 bin ding at specific genomic sites in the ANF gene locus. These binding elements were found to be sufficient for transactivating a reporter gene in hearts mirroring endogenous ANF gene expression. We further showed that the repressor Hey2 contributes to spatia l expression pattern of the reporter gene in the developing heart. These results suggest that Nkx2.5 mediates formation of a chromatin hub in the ANF genomic locus in the developing heart. This active chromatin hub involving Nkx2.5 driven regulation of ANF transcription is not sufficient for the reactivation of ANF expression in the pressure overloaded heart or during heart failure.

PAGE 44

44 Figure 3 1. Organization of the genomic locus including the ANF ( Nppa ) and BNP ( Nppb ) genes. Numbers indicate distances i n kilobases (kb) from the ANF transcription start site. Eighteen positions of ChIP PCR primer probe sets are indicated. Figure 3 2. Diagram of experiment demonstrating tamoxifen injection at E19 into pregnant female ( Nkx2.5 flox/flox ) mated with male ( N kx2.5 flox/flox/Cre ) mice followed by isolation of cardiomyocytes at postnatal day 2 (P2). Figure 3 3. ChIP analysis of Nkx2.5 in cardiomyocytes expressing Nkx2.5 isolated from flox/flox hearts (gray bars) or lacking Nkx2.5 isolated from flox/flox/Cre he arts (black bars). Results are shown as % recovery from input DNA (mean S.E.) from two independent experiments with PCR performed in duplicate. ANF, atrial natriuretic factor; BNP, brain natriuretic peptide.

PAGE 45

45 Figure 3 4. ChIP analysis of H3K4me2 (A) and H3K27me3 (B) in a genomic locus including the ANF and BNP genes. Results are shown as %recovery from input DNA (mean S.E.) either in cardiomyocytes expressing Nkx2.5 isolated from flox/flox hearts (gray bars) or lacking Nkx2.5 isolated from flox/fl ox/Cre hearts (black bars). Two independent experiments with PCR performed in duplicate. Figure 3 5. Schematics of two Nkx2.5 consensus binding sites in the mouse ANF proximal promoter (left) located at 260 and 86 bp from the ANF transcription start site. The 260 bp site corresponds to the rat 242 bp site including palindromic consensus binding sites, and the 86 bp site corresponds to the rat 87 bp site. Relative luciferase reporter activities of ANF proximal promoter ( 451 to +56) normalized to galactosidase activity (right) with the value of the promoter less luciferase reporter defined as 1 (means S.E.). ANOVA, *p <0.0001.

PAGE 46

46 Figure 3 6. upstream Nkx2.5 binding elements located around 14 (BNP promoter), 21, 31 and 34 kb relative to the ANF transcriptional start site in the presence of Nkx2.5 ( flox/flox ). Corresponding fold induction of luciferase reporter activities normalized to galactosidase activity with the value in ANF ( 451 to +56) luciferase reporter defined as 1 (means S.E.). ANOVA, *p <0.05 comparison to ANF promoter. # p <0.05 between flox/flox vs. flox/flox/Cre

PAGE 47

4 7 Figure 3 7. Analysis of deletion and point mutations in the 34 ANF promoter luciferase construct demonstrating that the M2 mutation eliminates enhancer activity. Sequence of two consensus Nkx2.5 binding sites located at 34851 and 34776 bp relative to the ANF transcription start site.

PAGE 48

48 Figure 3 8 Schematic of the ANF locus with Bgl II sites and the positions of PCR primers (arrowheads) as indicated. 3C analysis of the ANF gene locus using cardiomyocytes expressing (gray circle) or lacking (black circle) Nkx2.5 Data were normalized to amplification of Bgl II digested and re ligated BAC clones containing the entir e ANF locus (means S.E.) from two independent experiments with PCR performed in duplicate. ANOVA, flox/flox vs. flox/flox/Cre *p <0.0001, **p <0.0018. Whole mount in situ hybridization demonstrating endogenous ANF mRNA expression

PAGE 49

49 Figure 3 9 Whole mo unt in situ hybridization demonstrating endogenous ANF mRNA expression (left) and a total of 5 transgenic lines of X gal staining of 34 31 21 ANF lacZ transgenic mice (right) at postnatal day 2 (P2). Figure 3 10 BNP expression in mouse heart. (A ) Whole mount in situ hybridization demonstrating endogenous BNP mRNA expression both in atria and ventricles, which appears ubiquitous compared to that of ANF mRNA. (B) A total of 5 transgenic lines of X gal staining of 34 31 21 BNP lacZ transgenic mice (Tg1 5)

PAGE 50

50 Figure 3 1 1. Endogenous ANF mRNA expression in comparison to X gal staining of 34 31 21 ANF lacZ transgenic mice (Tg 1, 2 and 3) in developing hearts (E10.5 and E13.5). Enlarged images of left ventricular expression of ANF mRNA and X gal s taining of 34 31 21 ANF lacZ which is positive in the trabecular layer and negative in the compact layer. Bars = 1 mm (B, D) and 100 m (C). LA, left atrium; LV, left ventricle; RA, right atrium; RV, right ventricle.

PAGE 51

51 Figure 3 1 2 Diagram of experime ntal system indicating tamoxifen injection at E10.5 and X gal staining at E13.5. Figure 3 1 3 Representative images of reduced X gal intensity in Nkx2.5 ablated hearts in comparison to the flox/flox litters at E13.5 with tamoxifen injection at E10.5. Arrows for flox/flox and arrowheads for flox/flox/Cre hearts indicating left ventricular X gal staining. Number of mice examined: Tg1, flox/flox =8 and flox/flox/Cre =5; Tg 2, flox/flox =5 and flox/flox/Cre =3; Tg3, flox/flox =6 and flox/flox/Cre =3.

PAGE 52

52 Figure 3 1 4 Representative images of P11 12 flox/flox and flox /flox/Cre hearts after perinatal tamoxifen injection. Arrows for flox/flox and arrowheads for flox/flox/Cre hearts indicating left ventricular X gal staining. Number of mice examined: Tg1, flox/flox =5 and flox/flox/Cre =2; Tg 2, flox/flox =4 and flox/flox/Cre =3; Tg3, flox/flox =3 and flox/flox/Cre =4. Bars = 1 mm. LA, left atrium; LV, left ventricle; RA, right atrium; RV, right ventricle. Figure 3 15 Hey2 expression in the heart. (A) PCR genotypin g of Hey2 +/+ (lane 1) and germline Hey2 / (lane 2). (B) Representative images of in situ hybridization of ANF in Hey2 +/+ vs. Hey2 / litters. ANF expression in the left ventricle of Hey2 / is marked with Right ventricle was rounder and larger in Hey2 knockout mice, in which ANF mRNA was slightly reduced (arrow). LA, left atrium; LV, left ventricle; RA, right atrium; RV, right ventricle.

PAGE 53

53 Figure 3 1 6 Increased X gal intensity in the left ventricle of Hey2 ablated hearts (marked with *) in compari son to the control litters at E13.5 in Tg1 3. Right ventricle of Hey2 / mice is marked with arrows. Representative images were shown from a total of Hey2 +/+ =9 and Hey2 / =8 with heterozygous 34 31 21 ANF lacZ positive embryos. Enlarged images of tissue s ections demonstrate ectopic expression of ANF and lacZ in the compact layer (arrowheads). The compact layer is defined morphologically as the appearance of a compact band of uniform tissue, while the endocardial non compacted trabecular layer consists of t rabecular meshwork with deep endomyocardial spaces LA, left atrium; LV, left ventricle; RA, right atrium; RV, right ventricle.

PAGE 54

54 Figure 3 1 7 Location of an E box sequence is located at 34835 bp close to the Nkx2.5 binding sequence at 34776 bp sit e. Mutated E box sequence used in the 34 ANF luciferase re porter construct is indicated. Western blotting demonstrates HA tagged Hey2 protein expression in the transfected cells (lanes 1, 2) in comparison to control cells tr ansfected with pcDNA3 plasmid. Effects of Hey2 on ANF ( 451 to +56), 34 ANF promoter, and E box mutant of 34 ANF luciferase constructs. Fold induction of luciferase reporter activities normalized to galactosidase activity with the value in ANF ( 451 to +56) luciferase reporter co t ransfected with empty pcDNA3 plasmid defined as 1 (means S.E.). ANOVA, *p <0.05

PAGE 55

55 Figure 3 1 8 Diagram of experimental system indicating tamoxifen injection at E10.5 into pregnant female ( GATA4 flox/flox ) mated with male ( GATA4 flox/flox/Cre ) mice follow ed by is olation of the hearts at E13.5. RNA purified from pooled hearts (n=5 each GATA4 flox/flox and GATA4 flox/flox/Cre ), was subjected to Taqman real time RT PCR. Fold difference of GATA4, ANF and BNP expression in GATA4 flox/flox relative to the control G ATA4 flox/flox/Cre heart defined as 1

PAGE 56

56 Figure 3 1 9 Diagram of experimental system indicating tamoxifen injection at E19. Nkx2.5 ablation causes progressive heart failure within a few weeks Northern blotting shows time dependent changes in ANF, BNP, a comparison to decreased cardiac MLCK and Nkx2.5 mRNA levels at P4 (lanes 1, 2), P7 (lanes 3, 4) and P15 (lanes 5, 6) in control ( flox/flox ) vs. Nkx2.5 knockout hearts ( flox/flox/Cre ). RNA was purified from pooled hearts (n=2 3). Of note, da ta shown in lanes 1 and 2 were reproduced from our previous manuscript. Fold differences in the expression in Nkx2.5 knockout vs. control hearts normalized to 28S RNA are shown. P, postnatal day; MHC, myosin heavy chain; MLCK, myosin light chain kinase.

PAGE 57

57 Figure 3 20 Model for transcription of the ANF gene in the heart with (+) or without ( ) Nkx2.5 under physiological condition at P4, early (P7), and later stages (P15) of failing hearts. Other transcription factors potentially binding at the promoter region (blue, green, pink) may be GATA4/5/6, serum responsive factor, TBX5, MEF2C, Baf60C, glucocorticoid receptor, adrenergic signaling through AP1 and SP1, endothelin 1, and Zac1. Cis elements and responsive transcription factors (yellow, purple) that me diate reactivation of the ANF gene at P7 and P15 remain to be identified.

PAGE 58

58 Figure 3 2 1. Diagram of experiments demonstrating pressure overload (transverse aortic constriction, TAC) and representative LV pressure volume curve with or without TAC demons trating increased LV systolic pressure 2 weeks after TAC. Volume is shown in r elative v olume u nits (RVUs) without additional calibration. Endogenous ANF mRNA expression compared to X gal staining of 34 31 21 ANF lacZ transgenic mice in adult hearts with or without pressure overload (TAC).

PAGE 59

59 Figure 3 22 Fold difference of Taqman real time RT PCR of ANF and lacZ mRNA expression without TAC defined as 1. Increase of ANF but not lacZ mRNA expression in pressure overloaded heart is demonstrated in three tr ansgenic lines. Figure 3 23. Fold difference of lacZ enzymatic activities normalized to amount of proteins with or without TAC in three transgenic lines. LacZ expression without TAC was defined as 1. Heart weight/body weight (HW/BW ) ( means S.E.) an d the number of mice examined are indicated.

PAGE 60

60 Figure 3 24 Diagram of experiments utilizing Nkx2.5 ablated mice with or without TAC in adult mice. Fold MHC mRNA expression in Nkx2.5 knockout heart with or without TAC relative to the control flox/flox heart without TAC defined as 1. Increase in ANF, BNP and MHC mRNA expression in the pressure overloaded heart is demonstrat ed in Nkx2.5 knockout heart. HW/BW (means S.E.) and the number of mice examined are indicated. Bars = 1 mm.

PAGE 61

61 Figure 3 25 Fold difference of Taqman real time RT PCR of Hey2 and ANF mRNA expression without TAC defined as 1. Decrease of Hey2 and incre ase of ANF mRNA expression in pressure overloaded heart are demonstrated. Heart weight/body weight (HW/BW ) ( means S.E.) and the number of mice examined are indicated Figure 3 26 Relative luciferase reporter activities of BNP ( 634 to +11) normali galactosidase activity with the value in promoter less luciferase reporter defined as 1 (means S.E.) from four independent experiments. ANOVA, *p =0.0004, ** p =0.0002.

PAGE 62

62 Figure 3 27 Series of 50bp DNA probes overlapping 10 bp each covering fro m the 634 to +11 region were utilized for EMSA. Three representative data with highest DNA protein binding (Estimated binding affinities Kd = 1.8 5.6 x10 8 M) are shown. The first lane shows free probe (F) without protein, followed by 3 fold serial incre ases in protein concentrations shown in lanes 1 8. MBP (maltose binding protein) fused homeodomain proteins are utilized in these experiments at 8). MBP proteins alone did not demonstrate protein DNA interaction at the

PAGE 63

63 Figure 3 28 Four regions identified as Nkx2.5 binding sites locating arou nd 0.5 (ANF promoter), 21, 31 and 34 kb relative to the transcriptional start site were included either alone or in combination in the BNP( 634 to +11) luciferase reporter construct. Corresponding fold induction of luciferase reporter activities normal ized t galactosidase activity with the value in BNP ( 634 to +11) luciferase reporter defined as 1 (means S.E.). ANOVA, *p <0.05 comparison to BNP promoter. # p <0.05 between flox/flox vs. flox/flox/Cre

PAGE 64

64 C HAPTER 4 N kx 2.5 REGULATES THE EXPRESSION OF A CARDIAC SPECIFIC MYOSIN LIGHT CHAIN KINASE ( c MLCK) Background Cardiomyocytes express several sarcomeric proteins, including actin and myosin, which play important roles in cardiac structure and function. Phosphorylation of myosin light chain 2 (MLC2), located a t the myosin head, contributes to contractile force generation in muscle. Ablation of MLC2v in mice is embryonic lethal at embryonic day (ED) 12.5 13.5 with embryos exhibiting pericardial effusion, systemic edema and engorged liver (Simon J. Conway *, 2002) Similarly, mice null for MLC2a also die in utero around ED 10.5 11.5 due to cardiac insufficiency caused by atrial malfunction (Huang et al. 2003) In addition to MLC2 vital involvement in cardiac development, phosphorylation of MLC2 is a key regulator of heart contraction (Moss and Fitzsimons, 2006) For decades, two gene s were believed to exist that code for MLCK in vertebrates mylk1 and mylk2 which encodes smooth muscle MLCK (smMLCK) and skeletal MLCK (skMLCK) respectively. Smooth muscle MLCK, predominantly expressed in smooth muscles, phosphorylates MLC2 in smooth musc les to initiate contraction. However, in skeletal and cardiac muscles contraction initiation depends on the binding of Ca2+ to troponin C followed by actin myosi n cross bridge formation (Takashima, 2009) With a predominant expression in skeletal muscles, skMLCK potentiates peak tension in skeletal muscle. In a similar manner, phosphorylation b y MLCK is believed to enhance the force and rate of cross bridge recruitment in cardiomyocytes. Despite gain in function mutations of skMLCK discovered in hearts of familial hypertrophy patients (Davis et al. 2001) mice null for skMLCK, as in the case of long

PAGE 65

65 form smMLCK knockouts, appear to have normal cardiac function (Ohlmann et al. 2005; Zhi et al. 2005) Short form smooth muscle MLCK has significantly lower expression levels in the heart compared to those detected in smooth muscle rich organs such as gut, uterus and lung (Blue et al. 2002) Taken together, these findings suggest that an additional MLCK may be preferentially exp ressed in cardiac muscle. Identification of cMLCK as a Downstream Target o f Nkx2.5 C ardiac MLCK (cMLCK ) was previously identified in our lab as a downstream target preferentially expressed in hearts in neonatal cardiomyocytes differentially expressing th e cardiac homeobox transcription factor Nkx2.5 Expression of cMLCK mRNA was markedly downregulated following reduction of Nkx2.5 using adenoviral shRNA in rat and tamoxifen inducible gene targeting in mice. This new kinase is encoded by the mylk3 gene lo cated on chromosome 8 in mouse and on chromosome 16 in human. In mouse, the mylk3 gene encodes 795 amino acids with a predicted molecular weight of 86 kDa excluding post translational modifications. The protein consists of a conserved kinase domain at the carboxyl terminus which bears a 58% and 44% homology to skeletal and smooth muscle MLCK respectively and has a unique amino terminal domain with no homology to known MLCKs. Multi tissue Northern blotting revealed cardiac restricted expression of cMLCK in neonatal and adult stages. When hybridized with skMLCK specific probe, the same membrane detected trace amounts only in the adult ventricle. Cardiac MLCK was found to be expressed at similar levels in the atrium and ventricle (Chan et al. 2008b) In heart lysates, cMLCK expression was estimated to be approximately 0.5g/mg, which is equivalent to the expression of short form smooth muscle MLCK in the lung (Herring et

PAGE 66

66 al. 2000) and 5 10 fold lower than skeletal MLCK in skeletal muscle (Herring et al. 1990) cMLCK Kinase Activity Mouse cMLCK appear to have a high affinity for MLC2v as reflected by a low Km value of 4.3 1.5mM which is equivalent to that of skMLCK to skel etal MLC (3.5mM) and smMLCK to smooth muscle MLC (6 11mM) (Herring et al. 1992) However, low Vmax/Km ratio of 0.06 indicate that cMLCK has a relatively low catalytic efficiency in comparison to skeletal and smooth muscle MLCK towards their MLC substrates (9.3 and 3.5 respectively) (Zhi et al. 1994) This catalytic efficiency was not apparently altered by addition of Ca2+/calmodulin or EGTA in vitro (Chan et al. 2008a) Human cMLCK catalytic kinetics has not yet been determined, however, consistent to mouse MLCK, human MLCK appears to phosphorylate MLC2v without Ca2+/calmodulin, and an addition of Ca2+/calmodulin minimally increased the level of MLC2v phosphorylation (Seguchi et al. 2007a) As had been previously observed with overexpressed skMLCK (Aoki et al. 2000) overexpression of cMLCK promoted sarcomere organization in cultured neonatal cardiomyocytes When cMLCK was knocked down using RNAi, slight changes in peripheral structure up to 96hrs after adenoviral infection was observed (Chan et al. 2008a) In other studies conducted in zebrafish knock down of cMLCK using morpho lino antisense oligonucleotides caused dilation of cardiac ventricles and immature sarcomere structure which led to systemic edema and de ath by circulatory disturbances (Seguchi et al. 2007a)

PAGE 67

67 Additionally, cardiomyo cyte contraction amplitude and kinetics of contraction and relaxation were significantly increased following cMLCK overexpression (Seguchi et al. 2007a) Structure of cMLCK Cardiac MLCK has a similar overall structu re to known skeletal and smooth muscle MLCKs and has a high affinity to MLC2v similar to skeletal MLCK to skeletal muscle MLC2 and smooth muscle MLCK to smooth muscle MLC2. However, its catalytic efficiency is lower, and it was not regulated by Ca 2+ /calmod ulin or EGTA in vitro. Notably, for smooth muscle MLCK, which is also expressed in the heart, the amino acid sequence of substrates appears to be critical for affinity and catalytic activity, particularly an arginine residue in the third position amino ter minus to the phosphorylated serine residue (smooth muscle MLC [ Arg Ala Thr Ser ] The catalytic activity of smooth muscle MLCK toward skeletal MLC2, in which the critical Arg residue is replaced with Gly similar to MLC2v (skeletal MLC [ Gly Gly Ser Ser ], MLC 2v [ Gly Gly Thr Ser ]), was reported as a K m V max / K m ration of 0.03. If similar values are applicable to MLC2v, these data imply that cardiac MLC2v may be as good a substrate for cardiac MLCK ( V max / K m 0.06) as it is for smooth muscl e MLCK but with distinct expression levels in neonatal hearts. Physiological R ole of cMLCK Under physiological conditions, the level of MLC2v phosphorylation is maintained relatively constant by well balanced phosphorylation and phosphatase induced depho sphorylation. Elevation of cytoplasmic [Ca 2+ ] induced by infusion of Ca 2+ has been previously reported to fail to increase MLC2v phosphorylation consistently (Chan et al. 2008a) If Ca 2+ /calmodulin independent cata lytic activity, as well as high affinity and

PAGE 68

68 relatively low catalytic efficiencies of cardiac MLCK toward MLC2v demonstrated in vitro, are applicable to in vivo, these previous studies may reflect functions of cardiac MLCK in the heart. Increased expressi on of cardiac MLCK induced sarcomere organization in neonatal cardiomyocytes (Chan et al. 2008a) as has been observed by overexpression of skeletal MLCK. Ser19 phosphorylation of MLC2 leading to potentiation of th e force and speed of contraction has been well studied in smooth and skeletal muscle. Our findings demonstrate that overexpression of cardiac MLCK enhances cardiomyocyte contraction, likely because of a combination of increased MLC2 phosphorylation and org anized sarcomere structure stably formed within 36 to 48 hours after MLCK adenoviral infection. On the other hand, decreased expression of cardiac MLCK by RNAi resulted, in a 55% reduction of MLC2v phosphorylation and contributed to a reduction in overall cell motion only under increased demand at a 2.5 mmol/L Ca 2+ superfusate concentration. Less dramatic functional effects observed with loss of cardiac MLCK expression may be attributable to remaining MLC2v phosphorylation by other MLC2 kinases, such as smo oth muscle MLCK and protein kinase C, and by counterbalancing MLC2v phosphatase activities. The amino terminus of cardiac MLCK, lacking homologies to known proteins, may have functions specific for cardiac MLCK. For instance, cardiac MLCK previously showe d a striated expression pattern not overlapping with MLC2v in A bands but overlapping with actin in I bands (Chan et al. 2008a) This finding may be interpreted that, locally, the interaction between MLCK and its s ubstrate, MLC2v, may be transient or that cardiac MLCK may have additional functions including phosphorylation of other

PAGE 69

69 proteins. Of note, long form smooth muscle MLCK also colocalizes with actin depending on the actin binding sequence consisting of repeat motifs (DFRXXL) located in the amino terminus, which was not found in cardiac MLCK. Cardiac MLCK appeared to be phosphorylated; however, the phosphorylation sites of other MLCKs important for regulating their activities are not conserved in cardiac MLCK. These include 2 contiguous serine residues in the carboxyl terminus of the Ca 2+ /calmodulin binding sequence of smooth muscle MLCK by protein kinase A, protein kinase C, CaMKII (Ca 2+ /calmodulin dependent protein kinase II) and PAK (789R, 790K); the autopho sphorylation site of skeletal MLCK (amino terminus to the catalytic domain), smooth muscle MLCK (in the calmodulin binding domain and carboxyl terminus to this domain), and dictyostelium MLCK (between the catalytic and calmodulin binding domain). Phenyleph rine stimulation resulted in increased phosphorylation of both cardiac MLCK and MLC2v. Reduced cMLCK Protein Expression in Failing Hearts Cardiac MLCK protein expression appeared to be decreased in aged hearts and in heart failure in mice accompanied by d ecreased MLC2v phosphorylation (Chan et al. 2008a) Because previous studies have demonstrated that MLC2v phosphorylation is decreased in patients with heart failure, and expression of a mutant MLC2v in transgenic mouse hearts that cannot be phosphorylated (Ser14, 15, and 19 to Ala mutations) leads to heart failure, it is possible that decreased cardiac MLCK protein expression may contribute to compromised contractile function in aging and in heart failure. Of note a recent study reported upregulated cardiac MLCK mRNA expression in heart failure. A lack of concordance has been reported between mRNA and protein levels of cardiac MLCK that was likely attributable to altered posttranscriptional

PAGE 70

70 regulation of cardiac M LCK in aging and heart failure in mice (Seguchi et al. 2007a; Chan et al. 2008a) Conclusion Based on these findings, we sought to investigate the role cMLCK plays in vivo by generating mouse models targeting cML CK gene. We hypothesized that cMLCK plays a significant role in cardiac function in vivo The study used to explore this hypothesis is detailed in the following chapter.

PAGE 71

71 CHAPTER 5 PHYSIOLOGICAL AND PATHOLOGICAL ROLES OF c MLCK IN CARDIAC MUSCLE Backgroun d Reduced phosphorylation of the regulatory light chain of myosin (MLC2) has be en implicated in heart disease ( Morano et al. 1992 ) In failing human hearts, MLC2 phosphorylation levels has been reported to be reduced to approximately 18% compared to 30 4 0% phosphorylation levels typical of healthy hearts (Morano et al. 1992; van der Velden et al. 2003a, b; van der Velden et al. 2003c) MLC2 along with the essential light chain (MLC1) is located at the neck regio n of the myosin heavy chain of the myosin molecule and can be modified for regulating contraction by phosphoryl ation P hosphorylation of MLC2 serves to potentiate the rate and force of cardiac contraction but unlike smooth muscle, is not necessary for the initiation of contraction in cardiac muscle (Davis et al. 2001) Cardiac contraction is achieved by shortening of minor and long axis as well as twisting of the apex due to roughly three differential oriented m yocardial layers. In the inner layer (endocardium), myocardium aligns longitudinally; in the midwall, it does circumferentially; in the outer layer (epicardium) it does helically. Dynamic cardiac contraction and relaxation is attributed by a simple actin myosin interaction within the sarcomeres of cardiomyocyte and is regulated by various factors to adapt demands under physiological and pathological stresses. We recently identified cardiac specific MLCK (cMLCK) encoded by Mylk3 as a downstream target of th e homeobox domain transcription factor Nkx2.5 (Chan et al. 2008b) cMLCK was also identified by an independent group as a gene product differentially expressed in failing human hearts (Seguchi et al. 2007b) A knock down

PAGE 72

72 of cMLCK in neonatal cardiomyocytes resulted in altered cytoskeletal structure (Chan et al. 2008b) and zebrafish embryos with cMLCK knocked down using morpholino an ti sense oligonucleotides demonstrated dilation of cardiac ventricles and immature sarcomere structure which led to systemic edema and death due to circulatory disturbance (Seguchi et al. 2007b) cMLCK has also bee n recently identified to be the cardiac specific kinase responsible for basa l phosphorylation of both atrial MLC2 (MLC2a) and ventricular MLC2 (MLC2v) in vivo (Ding et al. 2010a) Based on these observations, we so ught to further investigate the role that cMLCK plays in the heart in vivo by generating mouse models in which cMLCK was either germline deleted which demonstrate d a los s of function, or overexpressed cMLCK demonstrating gain of function. The experimental goal of this present study was to, i n particular, identify and distinguish physiological and patho lo gical contributions of cMLCK to cardiac function. We examine d expression of cardiac MLCK proteins in tissue sections by immunohistochemistry using specific cardiac MLCK antibody in which non specific antibody was eliminated by excess of cardiac MLCK ablated heart homogenate. Here we report that an ablation of cMLCK in the mouse heart results in reduced cardiac contraction and torsion, whereas an overexpressi on of cMLCK is cardioprotective under pathological stress. Materials and Methods Generation of C ardiac MLCK / M ice A genomic fragment for cMLCK from a 129 mouse genomic library was cloned and a targeting vector was constructed by insertion of diphtheria t oxin A chain (DT) gene in intron 3 for negative selection, floxed neomycin resistant gene (NeoR) in the intron 4 for positive selection and an additional loxP site in the intron 5. We targeted exon 5

PAGE 73

73 because this is the first exon of the kinase domain, del etion of which would result in a frame shifting of the subsequent exons. The targeting vector was electroporated into ES cells. ES cells were screened by Southern blotting using the PCR product (425 bp, F, 5' AAGGAGGACATACCTGTGCGAAC 5' CCCAAC ACAGAAGAACATCCTTACC 3'), followed by confirmation of presence of three loxP sites by sequencing of the PCR products. Three ES cell clones were injected to blastocysts and two went germline. By crossing with ACTA1 (alpha skeletal actin) Cre transgenic mice (obtained from Jackson Laboratory), floxed NeoR cassette and exon 5 were deleted. Generation of Transgenic M ice overexpressing cMLCK HA tagged full length cMLCK was cloned into a myosin heavy chain promoter plasmid (kindly provided by J. Robbins) (Gulick et al. 199 1) NotI digested plasmid was purified and injected into fertilized oocytes. Transgenic mice were screened by Southern blotting using the cMLCK cDNA probe. The investigation conforms to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85 23, revised 1996). All animal care protocols fully conformed to the Association for the Assessment and Accreditation of Laboratory Animal Care, with approval from the University of Florida Instituti onal Animal Care and Use Committee Southern Northern a nd Western Blotting, Immunostaining a nd Histological Analyses Northern blotting was performed using the following probes: cardiac MLCK RT TGGCAGCACTCCCCCAACC CCAA ACCGACCCCCTCCTAAG Nkx2.5 probe, PflMI EcoRI fragment of mouse Nkx2.5 cDNA, and GAPDH probe described previously. (Kasahara et al. 1998a)

PAGE 74

74 Genomic Southern blotting was performed for screening of ES cells using t he PCR product (425 bp, F, 5' AAGGAGGACATACCTGTGCGAAC 5' CCCAACACAGAAGAACATCCTTACC 3'). Western blot analyses and immunostaining were performed with the following antibodies: HA (clone C29F4 or 5E2, Cell Signaling), MLC2 (F109.3E1, BioCytex, Marseille, France), phospho MLC2 (gift from Dr. N. Epstein, NIH), cardiac MLCK (Chan et al. 2008a) connexin40 (Cx40 A, Alpha Diagnostic International), troponin T (T6277, SIGMA) p Erk1/2 (9101, Cell Signaling) E rk1/2 (4695, Cell Signaling) and anti GAPDH (Research Diagnostics Inc.). Immunostaining was performed with the following primary an tibodies: anti cardiac MLCK pAb (Kasahara et al. 1998a) and sarcomeric actinin (Si gma A7811). Whole mount immunostaining was performed as follows: after fixation with 4% paraformaldehyde, hearts were dissected into half followed by treatment with a solution containing 80% methanol, 20% DMSO, 3% H 2 O 2 for 3 4 hrs. rehydrated with 75, 50, and 20% methanol in PBS with 0.5% Tween (PBST) for 30 min each. After blocking with PBST including 2% BSA and blocking reagents (Roche) for 1 hr. antibody was added and the hearts were incubated at 4C overnight. After washing with PBST including BSA and blocking reagents, immunoreaction was performed using ABC kit (Vector Laboratory). Fluorescent microscopic images were obtained using ZEISS Axiovert200M with or without Apotome. Histological analyses, including hematoxylin/eosin and ining, acetylcholine esterase staining in frozen tissue sections and whole mount acetylcholine esterase staining were performed as described previously. (Briggs et al. 2008) Digitalized images from AV node, LV free wall in the

PAGE 75

75 longitudinal section at the level of nuclei, and isolated ventricular myocytes were utilized for measurement using Image J software as described previously (Scherrer Crosbie et al. 2001) ; (Janssens et al. 2004) (Minhas et al. 2006) ; (Takeda et al. 2009) Two Dimensional Gel E lectrophoresis Heart tissues were homogenized in acetone containing 10% trichoroacetic acid (TCA) and 10 mM DTT to fix the phosphorylation status of MLC2v, centrifuged after 1 h incubation at 20C, and washed three times with acetone. (Grimm et al. 2005) Two dimensional gel electrophoresis was performed using Protean IEF System (BIO RAD) with IPG strips (pH4 7, 163 2001). After first dimensional separation, gel strips were separated in SDS PAGE gel, transferred to PVDF membrane and immunoblo tted with anti MLC2 antibody. t o confirm that negatively charged MLC2v is phosphorylated, cultured mouse neonatal ventricular cardiomyocytes (2x10 5 cells/3cm) labeled with [ 32 P] orthophosphate 0.1 mCi/ml for 4 hrs. were utilized for two dimensional gel electrophoresis for detection of phosphorylated MLC2v (data not shown). Telemetry ECG Recordings and E chocardiogram Recording of telemetry ECG (Data Sciences International) was performed 3 days after implantation of wireless radiofrequency telemetry devices to avoid effects of anesthesia on ECG. Telemetry data were analyzed using PowerLab software (ADInstruments) as described previously (Wakimoto et al. 2002; Takeda et al. 2009) M mode ultrasound imaging of the left ventricle of anesthetized mice (pentobarbital 60 mg/kg, ip) was obtained at the level of the papillary muscle from a parasternal window using an ultrasound biomicroscope with a single transducer with a frequency 35 or 40 MHz (VisualSonics, Toronto, Canada) as described previously (Takeda et al. 2009) MR imaging of the heart of anesthetized mice with 1.5 to 2% isoflurane was acquired by

PAGE 76

76 a 33 cm clear bore 4.7 T MRI scanner. ECG gating was achieved by attaching leads to the right front paw and lef t leg. Heart rate was maintained at around 400 450 bpm. Tagged images were acquired using the following parameters: flip angle, 50; data matrix, 128 x 128, field of view, 3.0 cm; slice thickness, 1mm; averages, 12. A long axis (four chamber) view of the l eft ventricle was first acquired, then tagged short axis images (at base and apex) parallel to the mitral valve was acquired. Torsion was calculated as the maximum net degree of change between base and apex divided by distance between the two slices. Simul taneous Measurements of Cell Shortening a nd Intracellular Free Calcium Simultaneous measurements of cell shortening and intracellular free calcium were performed as described with modifications (Kagaya et al. 1995) Myocytes were loaded with the acetoxymethyl ester of fura 2 (0.1 mol/L, Molecular Probes/Invitrogen) in 2 PO 4 1.2, CaCl 2 1.2, HEPES 20, MgSO 4 1.2, glucose 15; and 0.0005% Pluronic F 127, pH 7.4) for 10 min utes at room minutes at room temperature to allow for de esterification of the dye, followed by 2 PO 4 1 .2, CaCl 2 1.2, HEPES 4, MgCl 2 0.5, glucose 15, probenesid 1.0, pH 7.4) on a temperature controlled chamber (32C) mounted on an Olympus inverted microscope. When studied at two Ca 2+ concentrations, myocytes were sequentially superfused with 1.2 mM Ca 2+ fol lowed by 2.5 mM Ca 2+ for 30 minutes before measurement. A dual excitation spectrofluorometer was used to record fluorescence emissions (505 nm) elicited from excitation wavelengths at 340 and 380 nm. Myocytes were imaged with a CCD video

PAGE 77

77 camera attached to the microscope and motion was quantified by video motion detection (IonOptix). Transverse Aortic Constriction ( TAC ) a nd Pressure Measurement TAC and left ventricular pressure measurement using Millar catheter was performed using a standard method as des cribed (Shibata et al. 2004; Pacher et al. 2008) Swimming training For chronic swimming training, groups of 14 16 3 month old female cMLCK +/+ and cMLCK / mice were stressed by swimming in water tanks at 32C 7 d ays/ week for 4 weeks as described (McMullen et al. 2003) Statis tical A nalyses hoc test (StatView version 5.01). p < 0.05 is considered significant. Result s Regional and segmental expression of cMLCK protein and phosphorylation of MLC2v in mouse hearts To explore our previous study in identification of cMLCK, this study focused on understanding a potential role of cMLCK and phosphorylation of MLC2 in vivo in hearts. We first examined a transmural expression of cMLCK and phosphorylated MLC2v in normal hearts. As expected, expression of cMLCK and p MLC2v was almost identical using serial tissue sections in normal hearts but was below the level of detect ion in cMLCK gene targeted hearts (cMLCK / ) (Figure 5 1A ). Specificity of p MLC2 antibody predominantly recognizing phosphorylated MLC2 was also shown i n Western blotting ( Figure 5 2 ). Details of cMLCK gene disruption are described below.

PAGE 78

78 Staining of cM LCK in the cytoplasm was more diffuse compared to the striated staining of p MLC2v (Figure 5 1B). Expression of cMLCK protein and p MLC2 appeared higher in the right ventricle compared to the left ventricle (Figures 5 1C, J ). In the left ventricle, intensi ty was higher in the mid to outer epicardial layer than in the inner endocardial layer (Figures 5 1D, K ). However, neighboring cardiomyocytes demonstrate either similar or markedly different staining intensities (Figures 5 1E, F, G, L, M N). A small numbe r of cardiomyocytes in the endocardial layer of ventricles highly expressed cMLCK and p MLC2v (Figures 5 1H, I, O, P). Co localization to th e gap junction protein Connexin 4 0 in the serial tissue section indicates that these cells are Purkinje fibers that form a ventricular conduction system (Figure 5 3) After pressure overloading for 3 months by transverse aortic constriction (TAC), endocardial layers became thickened. Staining of cMLCK and p MLC2v in these layers was weaker compared to mid and epi cardi um (Figure 5 4 ). Tissue lysates from the papillary muscle, or transmural right and left ventricular free wall subjected to Western blotting confirmed that expression of cMLCK was higher in the right ventricle than the left ventricle, and was below the lev el of detection in the papillary muscle (Figure 5 5 A ). Correspondingly, the level of MLC2v phosphorylation determined by two dimensional electrophoresis followed by Western blotting with anti MLC2 antibody (total MLC2) was higher in the right ventricle tha n left ventricl e or papillary muscle (Figure 5 5B ). These results both in tissue staining and Western blotting demonstrate that direct correlation between cMLCK expression and the level of p MLC2v. Both are not uniformly expressed in mouse hearts, and ar e generally high in the mid and epicardial layers of the left ventricle, right ventricle and ventricular conduction systems. Pressure

PAGE 79

79 overloading reduces expression of cMLCK and p MLC2 especially in the endocardial layers. These results are comparable to a p revious study (Davis et al. 2002) with exception that expression of cMLCK and p MLC2 is globally abundant in the ventricular conduction system and the right ventricle, but it is heterogeneous even between neigh boring cardiomyocytes. Reduction of cMLCK and p MLC2v in pressure overloading and ablation of cMLCK gene in mice leads to moderate cardiac contraction abnormalities Reduction of cMLCK and p MLC2v was demonstrated as early as 1 week after pressure overlo ading, by approximately 90% and 58% respectively (Figures 5 6 A, B). On the other hand, phosphorylated Erk1/2 and total Erk1/2 were increased after pressure overloading consistent with previous studies (Figures 5 6 A, B). Based on the data, we hypothesized that reduction of cMLCK and subsequent reduction of p MLC2v would be one potential mechanism involved in reduction of cardiac contraction after pressure overloading. To examine this possibility, we generated cMLCK ablated mice by homologous recombination. Briefly, the mouse cMLCK gene consists of 13 exons spanning 40.3 kb of DNA, encoding the amino terminus and car boxyl terminus kinase domains. The f loxed neoR selection marker and exon 5 were deleted by crossing with ACTB Cre mice in vivo (Figures 5 7 ), wh ich resulted in elimination of the first coding exon of the catalytic domain as well as the frame shifting of the subsequent downstream exons. Deletion of exon 5 was confir m ed by PCR genotyping (Figure 5 8 B ). Northern blotting using a cDNA probe that recog nizes a part of exon 1 to exon 6 (1266 bp), demonstrated that cMLCK mRNA expression was below the level of detection in cMLCK / hearts after

PAGE 80

80 elimination of exon 5 (Figure 5 8 C ). These results suggest that cMLCK / mice do not express stable cMLCK mRNA, mo st likely because of nonsense mediated mRNA decay. In cMLCK / hearts, phosphorylation of MLC2v was below the level of detection using the apical region of the hearts including both right and left ventricle consistent with the immunostai ning in Figure 5 1A (Figures 5 8 D E ). cMLCK / mice were born at the expected Mendelian ratios and survived through adulthood beyond 1.5 years of age. cMLCK / heart was moderately enlarged predominantly in the long axis (Figure 5 9 A). Despite a moderate increase in heart weight at 3 and 6 months of age (Figure 5 9 B), myocardial disarray, or interstitial was not demonstrated (Figure 5 9 C n=3 animals, 2 separated sections each). Cardiac contraction m easured in echocardiography (Figure 5 10 A ) and MRI (Figure 5 10 B ) from a total of n=21 cMLCK +/+ and n=22 cMLCK / mice, demonstrated a reduction of contraction and an increase in volume of the left cavities, both at end systole and diastole. An additional parameter, cardiac torsion, was also reduced in cMLCK / hearts compared to control mice (Figure 5 10 B ). Isolated cardiomyocytes from cMLCK +/+ vs. cMLCK / mice showed an increase of cardiomyocyte cell size in the absence of cMLCK. Ventricular cardiomyocy tes isolated from cMLCK / mice demonstrate reduced contractility, and speed of relaxation without affecting Ca 2+ amplitude (Figure 5 11 ). Overall, cMLCK knockout resulted in moderate reduction in contraction in adult heart. Because cMLCK expression in cu ltured neonatal cardiomyocytes promotes sarcomere formation leading to cardiac, increase of

PAGE 81

81 cardiomyocyte cell size is likely due to compensation to reduced cardiac contraction in whole hearts in vivo cMLCK / mice demonstrate heart failure by pressure o verloading Our hypothesis predicts that cMLCK plays a critical role under pressure overloading. Indeed, cMLCK / heart was markedly enlarged after 3 months of pressure overloading with a reduced survival rate compared to cMLCK +/+ mice (45 vs. 86% ) ( Figur e 5 12 A B ). In mice that survived, heart weight was markedly increased after TAC in the absence of cMLCK (Figure 5 12 C ), which was accompanied by decreased cardiac contractile ability and increased chamber diameters (Figures 5 12 D E ). Left ventricular p ressure measurement revealed that increased end systolic pressure was demonstrated in cMLCK +/+ mice, but unexpectedly not in cMLCK / mice. Instead, cMLCK / mice demonstrated marked increase in end diastolic pressure, and reduction of speed of contraction (+dL/dt) and relaxation ( dL/dt). These hemodynamic measurements indicate that cMLCK / mice progressed into profound heart failure with systolic and diastolic dysfunction after pre ssure overloading (Figure 5 1 3 ). Overexpression of cMLCK increases phosp horylation of MLC2v in the heart and protect cardiac contraction after pressure overloading Based on the phenotype of cMLCK / mice, we speculated that cMLCK overexpression would protect cardiac function after pressure overloading, Transgenic mice over ex pressing cMLCK under the control of myosin heavy chain (a generous gift from J. Robbins) were generated (n=5), and three lines expressing cMLCK relatively homogenously in the left ventricles in the immunostaining were further examined in

PAGE 82

82 Western blotting Expression of cMLCK was increased from 6.5 fold in line TG1 to 20 fold in TG2 and TG3 using heart lysates relative to no n transgenics (NTG) (Figure 5 14 A ). Levels of phosphorylation of MLC2v in three transgenic lines were increased from 42 to 50% compare d to non transgenic mice (34%) (Figure 5 1 4 B). In tissue sections, ectopically expressed cMLCK was mostly localized diffusely in the cytoplasm and small dot like cellular structures detected by anti HA antibody. In the two high expressors, TG2 and TG3, the size and number of the dots positive for HA were increased. The staining suggests that the excess amount of cMLCK might be excluded from the cytoplasm and stored in distinct cellular compartments, suc h as inclusion bodie s (Figure 5 14 C ). These transgenic mice, demonstrate slightly enhanced cardiac contraction compared to NTG u si ng echocardiography (Figure 5 14 D ). To examine whether overexpression of cMLCK protects the heart from pressure overloading, we utilized a lower expressor (TG1) and higher expresso r (TG3) in the following studies. After 1 week of TAC, ectopically expressed cMLCK protein was also reduced accompanied by reduction of p MLC2 particularly in NTG an d lower expressor TG1 (Figure 5 1 5 A ). Despite the similar increase in LV systolic pressure in all three lines after pressure o verloading (Figure 5 15 B LV systolic pressure), the magnitude of inc rea se in heart weight (Figure 5 15 B HW/tibial length) and cellular hypertrophy (Figure 5 1 5 C ) was smaller in both of these transgenic lines compared to control NTG mice. After 3 month of pressure overloading, cardiac contraction was reduced in the NTG and TG1 lines, but it was maintained in TG3 (Figure 5 1 6 ), suggesting that a

PAGE 83

83 higher level of cMLCK is required for cardiac protection after long term pres sure overloading. cMLCK / mice reduce tolerance to physiological stress Cardiac function can be increased by continuous physical training as seen in well trained athletes. This adaptation is achieved by an increase of force production, and by an increa se of the total number of acto myosin motor units as in cardiac h ypertrophy. To understand the role of phosphorylation of MLC2v under physiological stress, we applied a total of 4 weeks of swimming exercise on cMLCK / and cMLCK +/+ mi ce at 3 months of age (Figure 5 1 7 ). Wild type mice tolerated 4 weeks of swimming exercise; however, 25% of cMLCK / mice died during or s h o rtly after swimming (Figure 5 17 B ). After 4 weeks of exercise, both survived cMLCK / and control cMLCK +/+ mice demonstrated an increase d heart weight/body weight (F igure 5 1 7 C ) In the absence of cMLCK, cardiac contraction was significantly reduced compared to control cMLCK +/+ (Figure 5 1 8 ), and sedentary cMLCK / m ice with similar age (Figure 5 9 3 months of age). Swimming slightly incr eased the level of p MLC2 only in wild type mice (39% vs. 33% in sede n tary mice as shown in Figure 5 8 ) ( Figure 5 18 ). Western blotting demonstrated slight increase of cMLCK and p MLC2 only in cMLCK +/+ mice; however p MLC2 was below the level of detection in cMLCK / mice, indicating that cMLCK is the predominant kinase involved in increase of phosphorylation of MLC under physiological stress. Although, an apparent enhancement of cardiac contraction was not detected in cMLCK +/+ mice after 4 weeks of swimmin g under echocardiography, fractional shortening was reduced in cMLCK / mice after exercise

PAGE 84

84 Prolongation of the ventricular conduction time in cMLCK / mice Because cMLCK and phosphorylated MLC2v are highly expressed in the ventricular conduction system (Figure 5 3 ), we examined whether cMLCK / mice demonstrate conduction abnormalities using ambulant teleme try ECG recording (Figures 5 19 A ). An indicator of ventricular conduction time, duration of QRS complex, was significantly prolonged in cMLCK / mice (Figure 5 1 9 B ). Whole mount connexin40 staining demonstrates elongation of ventricular conduction system accompanied by heart enlargement in cMLCK / mice (Figu re 5 19 C ), which might be involved in prolongation of QRS. Functional roles of phosphorylation of MLC2v in the ventricular conduction systems remain to be elucidated. Discussion Cardiac specific MLCK appears largely responsible for basal MLC2v phosphorylation which modulates cardiac muscle contraction. Although previous reports suggested that skele tal MLCK may phosphorylate MLC2v in vivo (Davis et al ., 2001) our data are consistent with reports that despite gain in function mutations of skMLCK discovered in hearts of familial hypertrophy patients, mice null for skMLCK appear to have normal cardiac function (Davis et al. 2001) Additionally, recent studies have demonstrated a direct correlation between loss of MLC phosphorylation and an attenuation of cMLCK in mouse he art (Ding et al. 2010a) Here we report that ablation of cMLCK in mice results in increased heart weight/body weight ratios, elimination of MLC2v phosphorylation and reduced cardiac contraction. The apparent lack o f MLC2v phosphorylation in our cMLCK null mice and

PAGE 85

85 resultant deficit in cardiac function adds support to previous observations in which reduced cardiac function was seen in mice expressing a non phosphorylatable MLC2 (Scruggs et al. 2009) Surprisingly, cMLCK was found to be expressed in the conduction system of the mouse heart as evidenced by its colocalization with connexin 40 (Figure 5 3). This expression also coincided with MLC2 phosphorylation, however, the phy siological role of cMLCK kinase activity in these regions need to examined. Electrocardiographic studies suggest that cMLCK may also play a role in cardiac conduction as revealed by the prolonged QRS interval in cMLCK / mice. However, we cannot rule out the possibility that delay in QRS conduction is not secondary to the ventricular hypertrophy observed in the knockout mice. Immunohistochemical experiments revealed that cMLCK is highest in the mid wall layer and lowest in the endocardium of ventricles Th is graded distribution of cMLCK almost mirrors the phosphorylation of MLC2v in our hands across the left ventricular wall (Figure 5 1). This finding partly corresponds to an MLC2v phosphorylation gradient previously reported of low phosphorylation levels in endocardium compared to epicardium (Davis et al. 2001) and is in contrast to recent studies reporting a homogenous distribution of cMLCK across the ventricular wall (Ding e t al. 2010a) However, it should be noted that the gradient we report here is observed in transverse sections of the heart which may be more difficult to observe in sagittal sections used in a study reported a homogenous distribution of cMLCK across the ventricular wall Left ventricular torsion is a sensitive marker of LV global function and is sensitive to cardiac contractility (Hansen et al. 1991; Buchalter et al. 1994; Moon et al.

PAGE 86

86 1994) Because the mid wa ll layer in which we found cMLCK to be highly concentrated consists primarily of helically oriented myofibers believed responsible for the wringing action of hearts during systole (Rothfeld et al. 1998) we examined whether ablation of cMLCK would affect cardiac torsion Additional evidence of significant loss of cardiac function was seen in the reduction of cardiac torsion in our cMLCK / mice compared to wild type which demo nstrated a degree of torsion comparable to that reported previously (Liu et al. 2006) Several investigations report reduced cardiac torsion in heart disease patients (Garot et al. 2002; Sandstede et al. 2002; Setser et al. 2003; Kanzaki et al. 2006) however further studies are needed to examine whether the spatial gradient of cMLCK found in mouse heart also exists in human cardiac muscle. cMLCK appear s to be necessary f or the maintaining heart function under physiological and pathological cardiac stress. In comparison to wildtype, cMLCK null mice showed increased mortality following swimming exercise which represents a volume overload (75 vs. 100% survival rate). During exercise, a great demand is placed on the heart to supply working skeletal muscles with adequate oxygenated blood to meet increased metabolic needs. Hearts lacking cMLCK underwent hypertrophy along its long axis and resultant decreases in cardiac efficienc y as demonstrated by significant reductions in fractional shortening compared to wild type. Additionally, cMLCK / mice had severe cardiac hypertrophy following TAC (Figure 5 12A) These mice also had an approximate 4 5% survival rate 15 weeks post surgery compared to 86% survival of their wild type counterparts. Catheterization of the left ventricles of cMLCK null mice after TAC revealed lower systolic pressures and increased diastolic pressures compared to wildtype. Additionally, we report reduction in car diac muscle contractility which further

PAGE 87

87 substantiates our findings that cMLCK plays an important role in cardiac function in a failing heart. We further investigated possible effects of cMLCK on the heart via exploring a gain of function approach and repo rt significant protection against loss of cardiac function under pathophysiological conditions in mice overexpressing cMLCK. Overexpression of cMLCK in mice results in increased MLC2 phosphorylation in a dose dependent manner which appears to support maint enance of cardiac function under left ventricular pressure overload. Following TAC, fractional shortening was reduced by 29.0% in wild type vs. 8.5% in cMLCK TG mice. The observations in this study are consistent with previous reports which suggest that an increase in cMLCK expression and MLC2v phosphorylation improves cardiac function in rat myocardial infarction models (Gu et al. 2010) The underlying mechanisms by which cMLCK may protect or improve cardiac functi on remain to be investigated Our findings have demonstrated that cMLCK plays a significant role in cardiac function both under normal conditions and under pathological stress. Considering cMLCK was also identified to be differentially expressed in heart f ailure patients (Seguchi et al. 2007a) and increase in its expression in rat myocardial infarction models significantly improves cardiac functio n (Gu et al. 2010) cMLCK has the potential to be a valid therapeutic target in the treatment of heart disease.

PAGE 88

88 Figure 5 1. Cardiac MLCK protein and phosphorylated MLC2 expression. (A) Immunostaining of cMLCK and p MLC2v in the transverse sections of cMLCK +/+ and cMLCK / adult h earts. Bar = 1 mm. (B) Enlarged images of cMLCK and p MLC2v immunostaining demonstrate intracellular localization of cMLCK and p MLC2v. Bars = 10 m. (C P) Distribution of cMLCK (top panels, C I ) and p MLC2v (bottom panels, J P ) in the serial heart sections including the right and left ventricles was almost identical. Bars = 500 m ( C, D, J, K ), 50 m ( E I and L P ).

PAGE 89

89 Figure 5 2 Specificity of p MLC2 antibody Western blot analyses demonstrate that the antibody used in this study is specific to phosphorylated MLC2. Figure 5 3. Cardiac MLCK protein phosphorylated MLC2 and connexin 40 expression. Fluorescent immunostaining of cMLCK, p MLC2 and connexin40 in serial frozen tissue sections.

PAGE 90

90 Figure 5 4. Histological cardiac MLCK protein and phosphorylated MLC2 expression after TAC. Immunostaining of cMLCK and p MLC2v in the transverse sections of pressure overloaded heart

PAGE 91

91 Figure 5 5. Cardiac MLCK protein and phosphorylated MLC2 expression after TAC. Expression of cMLCK and total MLC2v in the right, left ventricles and papillary muscles dissected from pressur e overloaded heart by TAC. (T) Unphosphorylated (left, with higher pI) and phosphorylated (right, with lower pI) MLC2v in the right, left ventricles and papillary muscles dissected from pressure overloaded heart by TAC examined in two dimensional electroph oresis followed by Western blotting with anti MLC antibody. TAC, transverse aortic constriction. Figure 5 6 Reduction of cMLCK after pressure overloading ( A) Western blotting demonstrates reduction of cMLCK and p MLC2, and induction of p Erk1/2 and Erk1/2 after 1 week of TAC (n=4 mice, lanes 4 7) compared to control mice (n=3 mice, lanes 1 3). (B) Relative of cardiac MLCK Relative expression of cMLCK, p MLC, MLC, p Erk1/2 and Erk1/2 normalized to GAPDH is shown with the value in control hearts witho ut TAC defined as 1 (mean S.E.).

PAGE 92

92 Figure 5 7 Schematics of generation of cMLCK knockout mice. Floxed NeoR cassettes and exon 5 were excised by mating with ACTB Cre deletor mice.

PAGE 93

93 Figure 5 8. Gene targeting of cMLC K. demonstrates 20.2 kb SacI digested genomic DNA in wild type alleles (lanes 1, 2), and 11.6 kb fragments in the targeted alleles (lanes 3, 4). ( B ) The size of genomic PCR fragments spanning exon 5 was red uced from ~1750 bp in cMLCK+/+ to ~800 bp in cMLCK / ( C ) Northern blotting demonstrated that cMLCK mRNA (4.3 kb) was below detection level in cMLCK / mice (lane 1 vs. 2).Cardiac MLCK protein and phosphorylated MLC2 expression. (D) Unphosphorylated (left with higher pI) and phosphorylated (right, with lower pI) MLC2v examined in two dimensional electrophoresis followed by Western blotting with anti MLC antibody (n=4 each). (E) Relative amounts of phosphorylated to total MLC2v are shown (mean S.E., n=4)

PAGE 94

94 Figure 5 9. Moderate heart enlargement in cMLCK knockout mice. (A) Hearts dissected cMLCK +/+ vs. cMLCK / mice at 3 months of age demonstrate moderate heart enlargement predominantly in the long axis in cMLCK / mice. Bars = 2 mm. (B) Heart weight/ body weight (mg/g) of cMLCK +/+ vs. cMLCK / at 3 and 6 months of age (mean S.E.). (C) No apparent fibrosis was observed in cMLCK / mice 3 months of age. Bars = 1 mm (top), 100 m (middle and bottom panels). Cardiac MLCK protein and phosphorylated MLC2 expression.

PAGE 95

95 Figure 5 10. R eduction of contractile function in cMLCK knockout mice. (A ) Echocardiographic indices of cMLCK+/+ vs. cMLCK / at 3 and 6 months of age (mean S.E.). (B ) Cardiac contraction, wall volume, wall thickness and torsion examined in MRI at 3 months of age (mean S.E.). Calculation of cardiac torsion is shown.

PAGE 96

96 Figure 5 11. Representative ima ges of cardiomyocytes isolated from cMLCK+/+ (left) and cMLCK / mice (right) at 3 months of age. Increased cell size was demonstrate d in cMLCK / mice. Bars = 100 m. Cell area ( m2), long axis ( m) and short axis ( m) of cardiomyocytes isolated from cMLC K+/+ and cMLCK / mice (n=300 from 2 mice). (G) Measurements of cardiac contraction and simultaneous Ca2+ transients in isolated cardiomyocytes from cMLCK+/+ (n=63 from 2 mice) and cMLCK / mice (n=76 from 2 mice). Summarized data (mean S.E.) demonstrate that cMLCK / cardiomyocytes show significant reduction in %fractional shortening, systolic sarcomere length and dL/dt (speed of relaxation). ED, end diastolic; ES, end systolic; %FS, % left ventricular fractional shortening.

PAGE 97

97 Figure 5 1 2 Heart fail ure in cMLCK knockout mice after 3 months of pressure overloading. (A) Representative images of the hearts dissected cMLCK+/+ vs. cMLCK / mice after 3 months of pressure overloading demonstrate marked ventricular and atrial enlargement in cMLCK / mice (5 6 months of age). Bars = 2 mm. (B) Survival analysis of cMLCK+/+ vs. cMLCK / mice during 3 months of pressure overloading. Of note, a number of mice died shortly after operation (1 week) were eliminated from these studies in consideration of post operati ve complications. (C) Heart weight/tibial length (mg/mm) of cMLCK+/+ vs. cMLCK / mice (mean S.E.). (D) Representative imaging of M mode ultrasound biomicroscope. (E) Echocardiographic indices of cMLCK+/+ vs. cMLCK / mice (mean S.E.) are shown after p ressure overloading

PAGE 98

98 Figure 5 1 3 Representative tracing of LV pressure and dP/dt in cMLCK+/+ vs. cMLCK / mice after pressure overloading (A). Summarized data from hemodynamic measurements. ED, end diastolic; EDD, end dias tolic dimension; ES, end systolic; ESD, end systolic dimension; %FS, % left ventricular fractional shortening ( B)

PAGE 99

99 Figure 5 14. Overexpression of cMLCK attenuates cardiac hypertrophy after 1 week of pressure overloading ( A) Schematics of transgenic c on struct with insertion of HA myosin heavy chain promoter and enhancer. (B) Two dimensional electrophoresis followed by Western blotting with anti MLC antibody in the heart lysates from NTG and TG1, 2 and 3 mice. Relative amounts of phos phorylated to total MLC2v are shown (mean, n=2 4 each). (C) Heart sections from NTG and TG1, 2 and 3 mice stained with anti HA antibody counterstained with eosin. Bars = 50 m ( D) Echocardiographic indices of NTG and TG1, 2 and 3 mice at 3 months of age ( mean S.E.). Number of mice examined is indicated.

PAGE 100

100 Figure 5 15. Increased expression of cMLCK preserves cardiomyocyte dimensions under pathological stress. (A) Western blotting of the heart lysates from NTG, TG1 and TG3 mi ce with or without 1 week of TAC. Reduction of cMLCK, HA tagged cMLCK in TG1 and TG3 after 1 week of TAC was demonstrated. ( B ) Summarized data of LV systolic pressure and heart weight/tibial length (mg/mm ) ( mean S.E.). Number o f mice examined is indicate d. (C ) Summarized data of cell area ( m2), long axis ( m) and short axis ( m) of cardiomyocytes isolated from NTG, TG1 and TG3 mice with or without 1 week of TAC. Number of cells examined is indicated. MHC, myosin heavy chain; NTG, non transgenic; TG, tran sgenic; %FS, % left ventricular fractional shortening. Number of mice examined is indicated

PAGE 101

101 Figure 5 16 Overexpression of cMLCK maintains cardiac contraction after 3 months of pressure overloading. (A) Summarized data of LV systolic pressure (mean S.E.). (B) Echocardiographic indices of NTG and TG1, 2 and 3 mice at 3 months of age (mean S.E.). Number of mice examined is indicated.

PAGE 102

102 Figure 5 17. cMLCK is necessary for adaptation to physiolo gical stress ( A) Representative images of the hearts dissected cMLCK+/+ vs. cMLCK / mice after 4 weeks of swimming exercise. Bars = 2 mm. (B) Survival analysis of cMLCK+/+ vs. cMLCK / mice during 4 weeks of swimming exercise. Heart weight/body weight (C ) and echocardiographic indices

PAGE 103

103 Figure 5 18. Reduced cardiac contraction and MLC2v phosphorylation in cMLCK ablated hearts. (A ) Echocardiographic indices of cMLCK +/+ vs. cMLCK / mice with or without 4 weeks of swimming exer cise at ~4 months of age (mean S.E.). ( B ) Two dimensional electrophoresis followed by Western blotting with anti MLC antibody in the heart lysates from cMLCK +/+ vs. cMLCK / mice. Relative amounts of phosphorylated to total MLC2v are shown (mean, n=4 eac h).

PAGE 104

104 Figure 5 19. Prolongation of QRS duration in cMLCK knockout mice ( A) Representative telemetry ECG recordings from cMLCK+/+ (top) and cMLCK / (bottom) mice at 5 months of age. (B) Representative averaged ECG recording from stable 10 20 beats with comparable heart rates (between 676 to 796 bpm). (C) PR interval, QRS and QTc duration (mean S.E.) are shown. Duration of QRS was significantly prolonged in cMLCK / vs. cMLCK+/+. (D) Whole mount connexin40 immunostaining dem onstrates ventricular conduction system (brown staining, arrowheads) both in. cMLCK+/+ and cMLCK / Scale bar = 1 mm.

PAGE 105

105 CHAPTER 6 CONCLUSIONS LIMITATIONS AND FUTURE STUDIES Conclusion T his dissertation has two distinct purposes -f irst, to further charac terize the function of Nkx2.5 in the heart specifically by examining its binding elements in the ANF genomic locus and second, to investigate the role of its novel downstream target cMLCK in vivo The studies reported in this dissertation reveal that whil e Nkx2.5 is responsible for the physiological expression of ANF gene, Nkx2.5 does not seem to play a role in the re expression of AN F under pathological conditions The hypothesis of our second goal is that cMLCK regulates cardiac contractility in an Nkx2. 5 dependent fashion As the kinase primarily responsible for MLC2 phosphorylation (Ding et al. 2010a) studies previously described in this dissertation demonstrate that cMLCK plays a significant role in cardiac f unction both under normal heart conditions as well as when the heart is subjected to physiological and pathological stress. Furthermore, data previously presented here strongly suggests that there is a direct correlation between levels of cMLCK protein ex pression and cardiac function. In this section, a summar y of findings directly taken from the studies in this dissertation will be presented followed b y a general discussion of the limitations of this study Summary of Findings D ifferential Role of Nkx2.5 in Activation of the ANF in Developing vs. Failing Heart Nkx2.5 bind s 34, 31 and 21 kb) and the proximal ANF promoter as well as there is close proximity between the distal elements and the promoter region. A 5.8 kb fra gment consisting of these elements transactivated

PAGE 106

106 a reporter gene in vivo recapitulating endogenous ANF expression, which was markedly reduced in Nkx2.5 ablated mice. However, expression of a reporter gene was increased and expanded toward the outer compac t layer in the absence of transcription repressor Hey2 similar to endogenous ANF expression. Functional Nkx2.5 and Hey2 binding sites separated by 59 bp were identified in the 34 kb element in neonatal cardiomyocytes. In adult hearts, this fragment did no t respond to pressure overload, and ANF was induced in the absence of Nkx2.5 Physiological and Pathological Roles of CMLCK in Cardiac Muscle cM LCK a downstream target of Nkx2.5 is responsible for basal MLC2v phosphorylation which modulates cardiac muscl e contraction cMLCK has a graded distribution of cMLCK across the left ventricular wall with highest expression in the midwall region believed to be the location of the helical oriented myofibers in cardiac muscle. This gradient in expression coincides wi th a gradient in MLC2 phosphorylation. An ablation of cMLCK in mice results in increased heart weight/body weight ratios, elimination of MLC2v phosphorylation and reduced cardiac contraction and systolic torsion under basal conditions When subject to incr eases in cardiac stress by volume and pressure overload, cMLCK null hearts function is severely compromised and results in increased mortality. S ignificant protection against loss of cardiac function under pathophysiological conditions i s demonstrated in m ice overexpressing cMLCK. General Discussion The homedomain containing transcription factor, Nkx2.5 is essential for cardiac development. It is considered to play an important role for regulation of septation during cardiac morphogenesis and for maturatio n and maintenance of the AV conduction system throughout life. Nkx2.5 is one of the earliest markers for cardiomyocyte lineage

PAGE 107

107 and its expression continues throughout he art development (Komuro and Izumo, 1993a; Lints et al. 1993; Kasahara et al. 1998b) As a vital factor for cardiac development, it serves that Nkx2.5 will play an essential role in the expression of several factors found in the heart. One such factor is the ANF peptide (Durocher et al. 1997) which regulates fluid and electrolyte balance as well as cardiovascular growth (Houweling et al. 2005; McGrath et al. 2005) Studies presented in thi s dissertation demonstrate a direct regulation of the ANF gene by Nkx2.5. We have illustrated bindin g sites 34, 31, 21 and 14 kb upstream of the promoter region, which are in fact in close proximity of the promoter due to direct interactions with Nkx2.5. It is possible and suggested by our data that an interacti on of Nkx2.5 most likely along with other DNA binding factors such as TBX5, SRF and Zac1 (Chen et al. 1996; Bruneau et al. 2001; Yuasa et al. 2010) w ill result in the formation of a chromatin hub. This yielded conformation facilitate d a close proximity of the ANF promoter and the se distal binding sites in an Nkx2.5 dependent manner as verified by the loss of this interaction frequency in Nkx2.5 ablated mice which may have reflected a disruption of the spatial o rganization necessary for ANF gene transcription W e utilized a reporter gene ( 34 31 21 ANF lacZ ) which yielded expression patterns that were comparable to the endogenous ANF gene in embryonic, neonatal and adult hearts at physiological condition in viv o and which was markedly downregulated in Nkx2.5 ablated mice. The e xpression of endogenous ANF mRNA and 34 31 21 ANF lacZ wa s restricted to the inner trabecular layer of ventricles, while Nkx2.5 is expressed throughout the layers (Komuro and Izumo, 1993a; Lints et al. 1993; Kasahara et al. 1998a) This observation could be explained by a possible

PAGE 108

108 inability of Nkx2.5 to access the binding sites because of a closed chromatin structure of the binding element(s), or Nkx2.5 might be functionally inactivated by repressor(s) in the compact layer. In support of the latter, w e identified E box binding sequence of the repressor Hey2 in close proximity to the Nkx2.5 binding site in 34 kb element Hey2 Ectopic lacZ repo rter gene expression in the outer compact layer in Hey2 knockout mice indicates that the 34 31 21 ANF lacZ reporter construct contains Hey2 responsive elements. The underlying mechanisms of Hey2 binding at 34 kb region leading to reduction of ANF transcr iption remain to be understood. It is possible that Hey2 binding at 34 kb element might modify the chromatin structure of the ANF locus, and reduce interactions between 34 kb and ANF promoter regions in the compact layer. Additionally, we found that the 34 31 21 ANF lacZ reporter construct as well as ANF mRNA was upregulated only in the left ventricle, despite the presence of Hey2 in the compact layers of both ventricles We have found that the reported b inding of Nkx2.5 to the distal elements ( 34, 31 21 kb and proximal promoter) is required only for physiological expression of ANF The re expression of ANF under pathological conditions occurred independent of Nkx2.5 as Nkx2.5 ablated mice were found to demonstrate an upregulation of ANF following T AC. Though t his finding was i nteresting, it should be noted that in the heart under pathological conditions several mechanisms are initiated to adapt to, in our case, pressure overload These mechanisms may be separate from or insufficient to those activ e under physiological conditions As far as we know and up to the time this dissertation was completed this is the first report to systemically examine Nkx2.5 responsive regulatory DNA elements in the

PAGE 109

109 ANF gene locus using biologically relevant mouse neon atal cardiomyocytes. Mechanisms by which ANF is re expressed in the failing heart and remain to be elucidated. Previously, we identified a cardiac specific myosin light chain kinase (cMLCK) as another downstream target of Nkx2.5. Expression of cMLCK is st rikingly comparable to the phosphorylation pattern of its substrate MLC2v (Figures 5 1,2). This data strongly suggests that c MLCK is largely responsible for basal MLC2v phosphorylation which modulates cardiac muscle contraction. This finding is supported b y recent studies have demonstrated a direct correlation between loss of MLC phosphorylation and an attenuation of cMLCK in mouse heart (Ding et al. 2010a) Although there are other ooth muscle and skeletal MLCK (smMCLK and skMLCK respectively) we found no increases in the expression of the se kinases following cMLCK ablation (data not shown) and we were unable to detect any levels of MLC2v phosphorylation in the heart ( Figures 5 8D E ). Furthermore, d espite gain in function mutations of skMLCK discovered in hearts of familial hypertrophy patients (Davis et al. 2001) mice null for skMLCK, as in the case of long form smMLCK knockouts, appear t o have normal cardiac function (Ohlmann et al. 2005; Zhi et al. 2005) Short form smooth muscle MLCK has significantly lower expression levels in the heart compared to those detected in smooth muscle rich organs s uch as gut, uterus and lung (Blue et al. 2002) Taken together, these findings further substantiate our theory that cMLCK is the kinase largely responsible for MLC2 phosphorylation in the heart. We identified cMLCK to be highly expressed with the midwall layer of the heart muscle. This region of cardiac muscle is believed to contain myofibers which run in an

PAGE 110

110 contraction. Lef t ventricular torsion is a sensitive marker of LV global function and is sensitive to cardiac contractility (Hansen et al. 1991; Buchalter et al. 1994; Moon et al. 1994) Because the mid wall layer in which we fou nd cMLCK to be highly concentrated consists primarily of helically oriented myofibers believed responsible for the wringing action of hearts during systole (Rothfeld et al. 19 98) we examined whether ablation of cMLCK would affect cardiac torsion Additional evidence of significant loss of cardiac function was seen in the reduction of cardiac torsion in our cMLCK / mice compared to wild type which demonstrated a degree of tor sion comparable to that reported previously (Liu et al. 2006) Several investigations report reduced cardiac torsion in heart disease patients (Garot et al. 2002; Sandstede et al. 2002; Setser et al. 2003; Kanzaki et al. 2006) however further studies are needed to examine whether the spatial gradient of cMLCK found in mouse heart also exists in human cardiac muscle. Expression of cMLCK was also surprisingly found in the conduction system of the mouse heart as evidenced by its colocalization with Connexin 40 (Figure 5 3). This expression also coincided with MLC2 phosphorylation, however, the physiological role of cMLCK kinase activity in these regions need to examined. Ele ctrocardiographic studies suggest that cMLCK may also play a role in cardiac conduction as revealed by the prolonged QRS interval in cMLCK / mice compared to wildtype. Nkx2.5 is largely expressed in the conduction system of the heart. It is possible that this expre ssion is also driven by Nkx2.5. Mice with Nkx2.5 ablated peri and post natally show the development of conduction defects (Briggs et al. 2008; Takeda et al. 2009) However, b ecause mice null for cMLCK demonstrate distended ventricles along the long axis, we

PAGE 111

111 cannot rule out the possibility that this delay in QRS conduction is not secondary to the ventricular hypertrophy The data presented in this dissertation strongly suggest that cMLCK is necessary for the maintaining heart function under physiological and pathological cardiac stress. cMLCK null mice showed increased mortality compared to wildtype following swimming exercise which represents a volume overload (75 vs. 100% survival rate ). Hearts lacking cMLCK underwent further hypertrophy along its long axis and resultant decreases in cardiac efficiency as demonstrated by significant reductions in fractional shortening compared to wild type. In a dditionally, cMLCK / mice had severe cardiac hypertrophy fo llowing TAC (Figure 5 12A). These mice also had an approximate 45% survival rate 15 weeks post surgery compared to 86% survival of their wild type counterparts. Catheterization of the left ventricles of cMLCK null mice after TAC revealed lower systolic pre ssures and increased diastolic pressures compared to wildtype. Lower systolic pressures indicate that the cMLCK null hearts were unable to generate enough pressure to overcome the pressure needed to pump blood through the reduced diameter of the banded aor ta. High diastolic pressures in the left ventricle are an indication of diastolic dysfunction. These findings indicate cMLCK plays a significant role in both systolic as well as diastolic function of the heart under pressure overload. W h e n we further inv estigated possible effects of cMLCK on the heart by overexpressing cMLCK and subjecting these hearts to pressure overload by TAC, we observed that f ollowing TAC, fractional shortening was reduced by 29.0% in wild type vs. 8.5% in cMLCK TG mice. This data i ndicated to us that cMLCK may provide

PAGE 112

112 protection to the heart under pathological stress by maintaining it efficiency to contract thus preserving cardiac function. We observed no significant differences in sarcomeric organization or fibrosis between cMLCK t argeted mice and wildtype. Therefore, observations reported in Chapter 5 strongly suggest to us that this novel kinase, cMLCK, contributes to cardiac function both under physiological and pathological conditi ons largely via the phosphorylation of MLC2. Li mitations We performed 3C assays using neonatal cardiomyocytes isolated from trabecular and compact layers, this heterogenous source of myocytes may result in relatively low interaction frequencies between 34 kb and the promoter regions examined in this s tudy. It should also be noted that transgenic mice used in the study to determine cardioprotective effects of increased expression were done in mice with germline overexpression of cMLCK. This method may not be directly translatable to clinical application s and thus, require alternative methods of increasing the activity or the expression of cMLCK to improve cardiac function in a failing heart. Future Studies Mechanisms governing regional gene regulation between inner trabecular vs. outer compact layers in right vs. left ventricles need further elucidation In addition, m ore studies are needed to examine by what mechanis m ANF is being re expressed in the failing heart. The re expression of ANF in Nkx2.5 ablated hearts strongly suggests that ANF may be regula ted by alternative pathways exclusive of Nkx2.5

PAGE 113

113 Earlier studies have reported that ZIPK may phosphorylate MLC2 (Ding et al. 2010b) Although we have demonstrated that cMLCK appears to be largely responsible for th e phosphorylation MLC2, a study to examine whether ZIPK has also has the gradient expression observed of cMLCK and MLC2 phosphorylation would validate whether cMLCK is indeed solely responsible for the phosphorylation of MLC2. We have reported that over expression of cMLCK has cardioprotective effects under pathological stress. However, f urther studies should be conducted to deter mine whether cMLCK has the potential to rescue hea r t th at has already begu n the process of heart failure. To test this, cMLCK w ill have to be introduced exogenously perhaps via gene therapy methods after heart failure has been induced. Also, mechanisms regulating the expression and action of cMLCK need to be further examined This is particularly important as it appears that cMLC K expression is closely regulated and is consistently reduced in failing heart.

PAGE 114

114 LIST OF REFERENCES Aoki, H., Sadoshima, J., and Izumo, S. (2000). Myosin light chain kinase mediates sarcomere organization during cardiac hypertrophy in vitro. Nat Med 6 183 188. Azpiazu, N., and Frasch, M. (1993). tinman and bagpipe: two homeo box genes that determine cell fates in the dorsal mesoderm of Drosophila. Genes Dev 7 1325 1340. Bar, H., Kreuzer, J., Cojoc, A., and Jahn, L. (2003). Upregulatio n of embryonic transcription factors in right ventricular hypertrophy. Basic Res Cardiol 98 285 294. Beltrami, A.P., Barlucchi, L., Torella, D., Baker, M., Limana, F., Chimenti, S., Kasahara, H., Rota, M., Musso, E., Urbanek, K., Leri, A., Kajstura, J., N adal Ginard, B., and Anversa, P. (2003). Adult cardiac stem cells are multipotent and support myocardial regeneration. Cell 114 763 776. Benson, D.W., Silberbach, G.M., Kavanaugh McHugh, A., Cottrill, C., Zhang, Y., Riggs, S., Smalls, O., Johnson, M.C., W atson, M.S., Seidman, J.G., Seidman, C.E., Plowden, J., and Kugler, J.D. (1999). Mutations in the cardiac transcription factor NKX2.5 affect diverse cardiac developmental pathways. J Clin Invest 104 1567 1573. Blue, E.K., Goeckeler, Z.M., Jin, Y., Hou, L. Dixon, S.A., Herring, B.P., Wysolmerski, R.B., and Gallagher, P.J. (2002). 220 and 130 kDa MLCKs have distinct tissue distributions and intracellular localization patterns. Am J Physiol Cell Physiol 282 C451 460. Bodmer, R. (1993). The gene tinman is r equired for specification of the heart and visceral muscles in Drosophila. Development 118 719 729. Briggs, L.E., Takeda, M., Cuadra, A.E., Wakimoto, H., Marks, M.H., Walker, A.J., Seki, T., Oh, S.P., Lu, J.T., Sumners, C., Raizada, M.K., Horikoshi, N., W einberg, E.O., Yasui, K., Ikeda, Y., Chien, K.R., and Kasahara, H. (2008). Perinatal loss of Nkx2 5 results in rapid conduction and contraction defects. Circ Res 103 580 590. Bruneau, B.G., Nemer, G., Schmitt, J.P., Charron, F., Robitaille, L., Caron, S., Conner, D.A., Gessler, M., Nemer, M., Seidman, C.E., and Seidman, J.G. (2001). A murine model of Holt Oram syndrome defines roles of the T box transcription factor Tbx5 in cardiogenesis and disease. Cell 106 709 721. Buchalter, M.B., Rademakers, F.E., We iss, J.L., Rogers, W.J., Weisfeldt, M.L., and Shapiro, E.P. (1994). Rotational deformation of the canine left ventricle measured by magnetic resonance tagging: effects of catecholamines, ischaemia, and pacing. Cardiovasc Res 28 629 635.

PAGE 115

115 Chan, J.Y., Takeda M., Briggs, L.E., Graham, M.L., Lu, J.T., Horikoshi, N., Weinberg, E.O., Aoki, H., Sato, N., Chien, K.R., and Kasahara, H. (2008a). Identification of cardiac specific myosin light chain kinase. Circ Res 102 571 580. Chan, J.Y., Takeda, M., Briggs, L.E., Graham, M.L., Lu, J.T., Horikoshi, N., Weinberg, E.O., Aoki, H., Sato, N., Chien, K.R., and Kasahara, H. (2008b). Identification of cardiac specific myosin light chain kinase. Circ Res 102 571 580. Chen, C.Y., Croissant, J., Majesky, M., Topouzis, S., Mc Quinn, T., Frankovsky, M.J., and Schwartz, R.J. (1996). Activation of the cardiac alpha actin promoter depends upon serum response factor, Tinman homologue, Nkx 2.5, and intact serum response elements. Dev Genet 19 119 130. Chen, C.Y., and Schwartz, R.J. (1995). Identification of novel DNA binding targets and regulatory domains of a murine tinman homeodomain factor, nkx 2.5. J Biol Chem 270 15628 15633. Chen, J.N., and Fishman, M.C. (1996). Zebrafish tinman homolog demarcates the heart field and initiates myocardial differentiation. Development 122 3809 3816. Christoffels, V.M., Habets, P.E., Franco, D., Campione, M., de Jong, F., Lamers, W.H., Bao, Z.Z., Palmer, S., Biben, C., Harvey, R.P., and Moorman, A.F. (2000). Chamber formation and morphogenesis in the developing mammalian heart. Dev Biol 223 266 278. Cleaver, O.B., Patterson, K.D., and Krieg, P.A. (1996). Overexpression of the tinman related genes XNkx 2.5 and XNkx 2.3 in Xenopus embryos results in myocardial hyperplasia. Development 122 3549 355 6. Davis, J.S., Hassanzadeh, S., Winitsky, S., Lin, H., Satorius, C., Vemuri, R., Aletras, A.H., Wen, H., and Epstein, N.D. (2001). The overall pattern of cardiac contraction depends on a spatial gradient of myosin regulatory light chain phosphorylation. C ell 107 631 641. Davis, J.S., Hassanzadeh, S., Winitsky, S., Wen, H., Aletras, A., and Epstein, N.D. (2002). A gradient of myosin regulatory light chain phosphorylation across the ventricular wall supports cardiac torsion. Cold Spring Harb Symp Quant Biol 67 345 352. Dekker, J., Rippe, K., Dekker, M., and Kleckner, N. (2002). Capturing chromosome conformation. Science 295 1306 1311. Ding, P., Huang, J., Battiprolu, P.K., Hill, J.A., Kamm, K.E., and Stull, J.T. (2010a). Cardiac myosin light chain kinase i s necessary for myosin regulatory light chain phosphorylation and cardiac performance in vivo. J Biol Chem 285 40819 40829.

PAGE 116

116 Ding, P., Huang, J., Battiprolu, P.K., Hill, J.A., Kamm, K.E., and Stull, J.T. (2010b). Cardiac myosin light chain kinase is necess ary for myosin regulatory light chain phosphorylation and cardiac performance in vivo. J Biol Chem 285 40819 40829. Durocher, D., Charron, F., Warren, R., Schwartz, R.J., and Nemer, M. (1997). The cardiac transcription factors Nkx2 5 and GATA 4 are mutual cofactors. Embo J 16 5687 5696. Fischer, A., Klattig, J., Kneitz, B., Diez, H., Maier, M., Holtmann, B., Englert, C., and Gessler, M. (2005). Hey basic helix loop helix transcription factors are repressors of GATA4 and GATA6 and restrict expression of th e GATA target gene ANF in fetal hearts. Mol Cell Biol 25 8960 8970. Fu, Y., and Izumo, S. (1995). Cardiac myogenesis:overexpression of XCsx2 or XMEF2 in whole Xenopus embryos induces the precocious expression of XMHC gene. Roux Arch Dev Biol 205 198 202. Garot, J., Pascal, O., Dibold, B., Derumeaux, G., Ovize, M., and Guret, P. (2002). [Changes in left ventricular torsion during ischemia reperfusion]. Arch Mal Coeur Vaiss 95 1151 1159. Goldmuntz, E., Geiger, E., and Benson, D.W. (2001). NKX2.5 mutation s in patients with tetralogy of fallot. Circulation 104 2565 2568. Grimm, M., Haas, P., Willipinski Stapelfeldt, B., Zimmermann, W.H., Rau, T., Pantel, K., Weyand, M., and Eschenhagen, T. (2005). Key role of myosin light chain (MLC) kinase mediated MLC2a phosphorylation in the alpha 1 adrenergic positive inotropic effect in human atrium. Cardiovasc Res 65 211 220. Grow, M.W., and Krieg, P.A. (1998). Tinman function is essential for vertebrate heart development: elimination of cardiac differentiation by do minant inhibitory mutants of the tinman related genes, XNkx2 3 and XNkx2 5. Dev Biol 204 187 196. Gu, X., Liu, X., Xu, D., Li, X., Yan, M., Qi, Y., Yan, W., Wang, W., Pan, J., Xu, Y., Xi, B., Cheng, L., Jia, J., Wang, K., Ge, J., and Zhou, M. (2010). Card iac functional improvement in rats with myocardial infarction by up regulating cardiac myosin light chain kinase with neuregulin. Cardiovasc Res 88 334 343. Gulick, J., Subramaniam, A., Neumann, J., and Robbins, J. (1991). Isolation and characterization o f the mouse cardiac myosin heavy chain genes. J Biol Chem 266 9180 9185. Gutierrez Roelens, I., Sluysmans, T., Gewillig, M., Devriendt, K., and Vikkula, M. (2002). Progressive AV block and anomalous venous return among cardiac anomalies associated with tw o novel missense mutations in the CSX/NKX2 5 gene. Hum Mutat 20 75 76.

PAGE 117

117 Habets, P.E., Moorman, A.F., Clout, D.E., van Roon, M.A., Lingbeek, M., van Lohuizen, M., Campione, M., and Christoffels, V.M. (2002). Cooperative action of Tbx2 and Nkx2.5 inhibits AN F expression in the atrioventricular canal: implications for cardiac chamber formation. Genes Dev 16 1234 1246. Hansen, D.E., Daughters, G.T., Alderman, E.L., Ingels, N.B., Stinson, E.B., and Miller, D.C. (1991). Effect of volume loading, pressure loading and inotropic stimulation on left ventricular torsion in humans. Circulation 83 1315 1326. Harvey, R.P. (1996). NK 2 homeobox genes and heart development. Dev Biol 178 203 216. Hayashi, S., and McMahon, A.P. (2002). Efficient recombination in diverse t issues by a tamoxifen inducible form of Cre: a tool for temporally regulated gene activation/inactivation in the mouse. Dev Biol 244 305 318. Herring, B.P., Dixon, S., and Gallagher, P.J. (2000). Smooth muscle myosin light chain kinase expression in cardi ac and skeletal muscle. Am J Physiol Cell Physiol 279 C1656 1664. Herring, B.P., Gallagher, P.J., and Stull, J.T. (1992). Substrate specificity of myosin light chain kinases. J Biol Chem 267 25945 25950. Herring, B.P., Stull, J.T., and Gallagher, P.J. (1 990). Domain characterization of rabbit skeletal muscle myosin light chain kinase. J Biol Chem 265 1724 1730. Hiroi, Y., Kudoh, S., Monzen, K., Ikeda, Y., Yazaki, Y., Nagai, R., and Komuro, I. (2001). Tbx5 associates with Nkx2 5 and synergistically promot es cardiomyocyte differentiation. Nat Genet 28 276 280. Horsthuis, T., Houweling, A.C., Habets, P.E., de Lange, F.J., el Azzouzi, H., Clout, D.E., Moorman, A.F., and Christoffels, V.M. (2008). Distinct regulation of developmental and heart disease induced atrial natriuretic factor expression by two separate distal sequences. Circ Res 102 849 859. Houweling, A.C., van Borren, M.M., Moorman, A.F., and Christoffels, V.M. (2005). Expression and regulation of the atrial natriuretic factor encoding gene Nppa du ring development and disease. Cardiovasc Res 67 583 593. Huang, C., Sheikh, F., Hollander, M., Cai, C., Becker, D., Chu, P.H., Evans, S., and Chen, J. (2003). Embryonic atrial function is essential for mouse embryogenesis, cardiac morphogenesis and angiog enesis. Development 130 6111 6119. Iso, T., Sartorelli, V., Poizat, C., Iezzi, S., Wu, H.Y., Chung, G., Kedes, L., and Hamamori, Y. (2001). HERP, a novel heterodimer partner of HES/E(spl) in Notch signaling. Mol Cell Biol 21 6080 6089.

PAGE 118

118 Janssens, S., Pokr eisz, P., Schoonjans, L., Pellens, M., Vermeersch, P., Tjwa, M., Jans, P., Scherrer Crosbie, M., Picard, M.H., Szelid, Z., Gillijns, H., Van de Werf, F., Collen, D., and Bloch, K.D. (2004). Cardiomyocyte specific overexpression of nitric oxide synthase 3 i mproves left ventricular performance and reduces compensatory hypertrophy after myocardial infarction. Circ Res 94 1256 1262. Kagaya, Y., Weinberg, E.O., Ito, N., Mochizuki, T., Barry, W.H., and Lorell, B.H. (1995). Glycolytic inhibition: effects on diast olic relaxation and intracellular calcium handling in hypertrophied rat ventricular myocytes. J Clin Invest 95 2766 2776. Kamisago, M., Sharma, S.D., DePalma, S.R., Solomon, S., Sharma, P., McDonough, B., Smoot, L., Mullen, M.P., Woolf, P.K., Wigle, E.D., Seidman, J.G., and Seidman, C.E. (2000). Mutations in sarcomere protein genes as a cause of dilated cardiomyopathy. N Engl J Med 343 1688 1696. Kanzaki, H., Nakatani, S., Yamada, N., Urayama, S., Miyatake, K., and Kitakaze, M. (2006). Impaired systolic t orsion in dilated cardiomyopathy: reversal of apical rotation at mid systole characterized with magnetic resonance tagging method. Basic Res Cardiol 101 465 470. Kasahara, H., Bartunkova, S., Schinke, M., Tanaka, M., and Izumo, S. (1998a). Cardiac and ext racardiac expression of Csx/Nkx2.5 homeodomain protein. Circ Res 82 936 946. Kasahara, H., Bartunkova, S., Schinke, M., Tanaka, M., and Izumo, S. (1998b). Cardiac and extracardiac expression of Csx/Nkx2.5 homeodomain protein. Circ Res 82 936 946. Kasahar a, H., and Izumo, S. (1999). Identification of the in vivo casein kinase II phosphorylation site within the homeodomain of the cardiac tissue specifying homeobox gene product Csx/Nkx2.5. Mol Cell Biol 19 526 536. Kasahara, H., Lee, B., Schott, J.J., Benso n, D.W., Seidman, J.G., Seidman, C.E., and Izumo, S. (2000). Loss of function and inhibitory effects of human CSX/NKX2.5 homeoprotein mutations associated with congenital heart disease. J Clin Invest 106 299 308. Kasahara, H., Usheva, A., Ueyama, T., Aoki H., Horikoshi, N., and Izumo, S. (2001a). Characterization of homo and heterodimerization of cardiac Csx/Nkx2.5 homeoprotein. J Biol Chem 276 4570 4580. Kasahara, H., Wakimoto, H., Liu, M., Maguire, C.T., Converso, K.L., Shioi, T., Huang, W.Y., Manning W.J., Paul, D., Lawitts, J., Berul, C.I., and Izumo, S. (2001b). Progressive atrioventricular conduction defects and heart failure in mice expressing a mutant Csx/Nkx2.5 homeoprotein. J Clin Invest 108 189 201.

PAGE 119

119 Kathiriya, I.S., King, I.N., Murakami, M., Nakagawa, M., Astle, J.M., Gardner, K.A., Gerard, R.D., Olson, E.N., Srivastava, D., and Nakagawa, O. (2004). Hairy related transcription factors inhibit GATA dependent cardiac gene expression through a signal responsive mechanism. J Biol Chem 279 54937 54943. Kim, Y., and Nirenberg, M. (1989). Drosophila NK homeobox genes. Proc Natl Acad Sci U S A 86 7716 7720. Knowlton, K.U., Rockman, H.A., Itani, M., Vovan, A., Seidman, C.E., and Chien, K.R. (1995). Divergent pathways mediate the induction of ANF tran sgenes in neonatal and hypertrophic ventricular myocardium. J Clin Invest 96 1311 1318. Koibuchi, N., and Chin, M.T. (2007). CHF1/Hey2 plays a pivotal role in left ventricular maturation through suppression of ectopic atrial gene expression. Circ Res 100 850 855. Komuro, I., and Izumo, S. (1993a). Csx: a murine homeobox containing gene specifically expressed in the developing heart. Proc Natl Acad Sci U S A 90 8145 8149. Komuro, I., and Izumo, S. (1993b). Csx: a murine homeobox containing gene specifical ly expressed in the developing heart. Proc Natl Acad Sci U S A 90 8145 8149. Kuwahara, K., and Nakao, K. (2010). Regulation and significance of atrial and brain natriuretic peptides as cardiac hormones. Endocr J 57 555 565. Kuwahara, K., Saito, Y., Ogawa E., Takahashi, N., Nakagawa, Y., Naruse, Y., Harada, M., Hamanaka, I., Izumi, T., Miyamoto, Y., Kishimoto, I., Kawakami, R., Nakanishi, M., Mori, N., and Nakao, K. (2001). The neuron restrictive silencer element neuron restrictive silencer factor system regulates basal and endothelin 1 inducible atrial natriuretic peptide gene expression in ventricular myocytes. Mol Cell Biol 21 2085 2097. LaPointe, M.C. (2005). Molecular regulation of the brain natriuretic peptide gene. Peptides 26 944 956. Lee, Y., Sh ioi, T., Kasahara, H., Jobe, S.M., Wiese, R.J., Markham, B.E., and Izumo, S. (1998a). The cardiac tissue restricted homeobox protein Csx/Nkx2.5 physically associates with the zinc finger protein GATA4 and cooperatively activates atrial natriuretic factor g ene expression. Mol Cell Biol 18 3120 3129. Lee, Y., Shioi, T., Kasahara, H., Jobe, S.M., Wiese, R.J., Markham, B.E., and Izumo, S. (1998b). The cardiac tissue restricted homeobox protein Csx/Nkx2.5 physically associates with the zinc finger protein GATA4 and cooperatively activates atrial natriuretic factor gene expression. Mol Cell Biol 18 3120 3129.

PAGE 120

120 Li, Q., Barkess, G., and Qian, H. (2006). Chromatin looping and the probability of transcription. Trends Genet 22 197 202. Lints, T.J., Parsons, L.M., Har tley, L., Lyons, I., and Harvey, R.P. (1993). Nkx 2.5: a novel murine homeobox gene expressed in early heart progenitor cells and their myogenic descendants. Development 119 419 431. Liu, W., Ashford, M.W., Chen, J., Watkins, M.P., Williams, T.A., Wicklin e, S.A., and Yu, X. (2006). MR tagging demonstrates quantitative differences in regional ventricular wall motion in mice, rats, and men. Am J Physiol Heart Circ Physiol 291 H2515 2521. Liu, Y., Yu, M., Wu, L., and Chin, M.T. (2010). The bHLH transcription factor CHF1/Hey2 regulates susceptibility to apoptosis and heart failure after pressure overload. Am J Physiol Heart Circ Physiol 298 H2082 2092. Lyons, I., Parsons, L.M., Hartley, L., Li, R., Andrews, J.E., Robb, L., and Harvey, R.P. (1995). Myogenic an d morphogenetic defects in the heart tubes of murine embryos lacking the homeo box gene Nkx2 5. Genes Dev 9 1654 1666. Mayer, B., Kaiser, T., Kempt, P., Cornelius, T., Holmer, S.R., and Schunkert, H. (2002). Molecular cloning and functional characterizati on of the upstream rat atrial natriuretic peptide promoter. J Hypertens 20 219 228. McBride, K., and Nemer, M. (2001). Regulation of the ANF and BNP promoters by GATA factors: lessons learned for cardiac transcription. Can J Physiol Pharmacol 79 673 681. McElhinney, D.B., Geiger, E., Blinder, J., Woodrow Benson, D., and Goldmuntz, E. (2003). NKX2.5 mutations in patients with congenital heart disease. J Am Coll Cardiol 42 1650 1655. McGrath, M.F., de Bold, M.L., and de Bold, A.J. (2005). The endocrine fun ction of the heart. Trends Endocrinol Metab 16 469 477. McMullen, J.R., Shioi, T., Zhang, L., Tarnavski, O., Sherwood, M.C., Kang, P.M., and Izumo, S. (2003). Phosphoinositide 3 kinase(p110alpha) plays a critical role for the induction of physiological, b ut not pathological, cardiac hypertrophy. Proc Natl Acad Sci U S A 100 12355 12360. Mead, P.E., Brivanlou, I.H., Kelley, C.M., and Zon, L.I. (1996). BMP 4 responsive regulation of dorsal ventral patterning by the homeobox protein Mix.1. Nature 382 357 36 0. Minhas, K.M., Saraiva, R.M., Schuleri, K.H., Lehrke, S., Zheng, M., Saliaris, A.P., Berry, C.E., Barouch, L.A., Vandegaer, K.M., Li, D., and Hare, J.M. (2006). Xanthine oxidoreductase inhibition causes reverse remodeling in rats with dilated cardiomyopa thy. Circ Res 98 271 279.

PAGE 121

121 Molkentin, J.D., Lin, Q., Duncan, S.A., and Olson, E.N. (1997). Requirement of the transcription factor GATA4 for heart tube formation and ventral morphogenesis. Genes Dev 11 1061 1072. Moon, M.R., Ingels, N.B., Daughters, G.T., Stinson, E.B., Hansen, D.E., and Miller, D.C. (1994). Alterations in left ventricular twist mechanics with inotropic stimulation and volume loading in human subjects. Circulation 89 142 150. Moorman, A.F., Houweling, A.C., de Boer, P.A., and Christoffels V.M. (2001). Sensitive nonradioactive detection of mRNA in tissue sections: novel application of the whole mount in situ hybridization protocol. J Histochem Cytochem 49 1 8. Morano, I., Adler, K., Agostini, B., and Hasselbach, W. (1992). Expression of m yosin heavy and light chains and phosphorylation of the phosphorylatable myosin light chain in the heart ventricle of the European hamster during hibernation and in summer. J Muscle Res Cell Motil 13 64 70. Moss, R.L., and Fitzsimons, D.P. (2006). Myosin light chain 2 into the mainstream of cardiac development and contractility. Circ Res 99 225 227. Ohlmann, P., Tesse, A., Loichot, C., Ralay Ranaivo, H., Roul, G., Philippe, C., Watterson, D.M., Haiech, J., and Andriantsitohaina, R. (2005). Deletion of MLC K210 induces subtle changes in vascular reactivity but does not affect cardiac function. Am J Physiol Heart Circ Physiol 289 H2342 2349. Oka, T., Xu, J., and Molkentin, J.D. (2007). Re employment of developmental transcription factors in adult heart disea se. Semin Cell Dev Biol 18 117 131. Onichtchouk, D., Glinka, A., and Niehrs, C. (1998). Requirement for Xvent 1 and Xvent 2 gene function in dorsoventral patterning of Xenopus mesoderm. Development 125 1447 1456. Pacher, P., Nagayama, T., Mukhopadhyay, P ., Batkai, S., and Kass, D.A. (2008). Measurement of cardiac function using pressure volume conductance catheter technique in mice and rats. Nat Protoc 3 1422 1434. Palstra, R.J., Tolhuis, B., Splinter, E., Nijmeijer, R., Grosveld, F., and de Laat, W. (20 03). The beta globin nuclear compartment in development and erythroid differentiation. Nat Genet 35 190 194. Rockman, H.A., Ross, R.S., Harris, A.N., Knowlton, K.U., Steinhelper, M.E., Field, L.J., Ross, J., Jr., and Chien, K.R. (1991). Segregation of atr ial specific and inducible expression of an atrial natriuretic factor transgene in an in vivo murine model of cardiac hypertrophy. Proc Natl Acad Sci U S A 88 8277 8281. Rothfeld, J.M., LeWinter, M.M., and Tischler, M.D. (1998). Left ventricular systolic torsion and early diastolic filling by echocardiography in normal humans. Am J Cardiol 81 1465 1469.

PAGE 122

122 Saadane, N., Alpert, L., and Chalifour, L.E. (1999). Expression of immediate early genes, GATA 4, and Nkx 2.5 in adrenergic induced cardiac hypertrophy an d during regression in adult mice. Br J Pharmacol 127 1165 1176. Sakata, Y., Kamei, C.N., Nakagami, H., Bronson, R., Liao, J.K., and Chin, M.T. (2002). Ventricular septal defect and cardiomyopathy in mice lacking the transcription factor CHF1/Hey2. Proc N atl Acad Sci U S A 99 16197 16202. Sandstede, J.J., Johnson, T., Harre, K., Beer, M., Hofmann, S., Pabst, T., Kenn, W., Voelker, W., Neubauer, S., and Hahn, D. (2002). Cardiac systolic rotation and contraction before and after valve replacement for aortic stenosis: a myocardial tagging study using MR imaging. AJR Am J Roentgenol 178 953 958. Scherrer Crosbie, M., Ullrich, R., Bloch, K.D., Nakajima, H., Nasseri, B., Aretz, H.T., Lindsey, M.L., Vancon, A.C., Huang, P.L., Lee, R.T., Zapol, W.M., and Picard, M.H. (2001). Endothelial nitric oxide synthase limits left ventricular remodeling after myocardial infarction in mice. Circulation 104 1286 1291. Schott, J.J., Benson, D.W., Basson, C.T., Pease, W., Silberbach, G.M., Moak, J.P., Maron, B.J., Seidman, C.E. and Seidman, J.G. (1998). Congenital heart disease caused by mutations in the transcription factor NKX2 5. Science 281 108 111. Scruggs, S.B., Hinken, A.C., Thawornkaiwong, A., Robbins, J., Walker, L.A., de Tombe, P.P., Geenen, D.L., Buttrick, P.M., and Solaro, R.J. (2009). Ablation of ventricular myosin regulatory light chain phosphorylation in mice causes cardiac dysfunction in situ and affects neighboring myofilament protein phosphorylation. J Biol Chem 284 5097 5106. Sedmera, D., Reckova, M., DeAlme ida, A., Coppen, S.R., Kubalak, S.W., Gourdie, R.G., and Thompson, R.P. (2003). Spatiotemporal pattern of commitment to slowed proliferation in the embryonic mouse heart indicates progressive differentiation of the cardiac conduction system. Anat Rec A Dis cov Mol Cell Evol Biol 274 773 777. Seguchi, O., Takashima, S., Yamazaki, S., Asakura, M., Asano, Y., Shintani, Y., Wakeno, M., Minamino, T., Kondo, H., Furukawa, H., Nakamaru, K., Naito, A., Takahashi, T., Ohtsuka, T., Kawakami, K., Isomura, T., Kitamura S., Tomoike, H., Mochizuki, N., and Kitakaze, M. (2007a). A cardiac myosin light chain kinase regulates sarcomere assembly in the vertebrate heart. J Clin Invest 117 2812 2824. Seguchi, O., Takashima, S., Yamazaki, S., Asakura, M., Asano, Y., Shintani, Y., Wakeno, M., Minamino, T., Kondo, H., Furukawa, H., Nakamaru, K., Naito, A., Takahashi, T., Ohtsuka, T., Kawakami, K., Isomura, T., Kitamura, S., Tomoike, H., Mochizuki, N., and Kitakaze, M. (2007b). A cardiac myosin light chain kinase regulates sarcome re assembly in the vertebrate heart. J Clin Invest 117 2812 2824.

PAGE 123

123 Seki, T., Hong, K.H., and Oh, S.P. (2006). Nonoverlapping expression patterns of ALK1 and ALK5 reveal distinct roles of each receptor in vascular development. Lab Invest 86 116 129. Seki, T., Yun, J., and Oh, S.P. (2003). Arterial endothelium specific activin receptor like kinase 1 expression suggests its role in arterialization and vascular remodeling. Circ Res 93 682 689. Setser, R.M., Kasp er, J.M., Lieber, M.L., Starling, R.C., McCarthy, P.M., and White, R.D. (2003). Persistent abnormal left ventricular systolic torsion in dilated cardiomyopathy after partial left ventriculectomy. J Thorac Cardiovasc Surg 126 48 55. Shibata, R., Ouchi, N., Ito, M., Kihara, S., Shiojima, I., Pimentel, D.R., Kumada, M., Sato, K., Schiekofer, S., Ohashi, K., Funahashi, T., Colucci, W.S., and Walsh, K. (2004). Adiponectin mediated modulation of hypertrophic signals in the heart. Nat Med 10 1384 1389. Simon J. Conway *, A.K. F., Paige L. Kneer, Michal Machnicki, Srinagesh V. Koushik. (2002). What cardiovascular defect does my prenatal mouse mutant have, and why? genesis 35 1 21. Singh, A.M., Li, F.Q., Hamazaki, T., Kasahara, H., Takemaru, K., and Terada, N. (20 07). Chibby, an antagonist of the Wnt/beta catenin pathway, facilitates cardiomyocyte differentiation of murine embryonic stem cells. Circulation 115 617 626. Takashima, S. (2009). Phosphorylation of myosin regulatory light chain by myosin light chain kin ase, and muscle contraction. Circ J 73 208 213. Takeda, M., Briggs, L.E., Wakimoto, H., Marks, M.H., Warren, S.A., Lu, J.T., Weinberg, E.O., Robertson, K.D., Chien, K.R., and Kasahara, H. (2009). Slow progressive conduction and contraction defects in loss of Nkx2 5 mice after cardiomyocyte terminal differentiation. Lab Invest 89 983 993. Tanaka, M., Chen, Z., Bartunkova, S., Yamasaki, N., and Izumo, S. (1999). The cardiac homeobox gene Csx/Nkx2.5 lies genetically upstream of multiple genes essential for h eart development. Development 126 1269 1280. Temsah, R., and Nemer, M. (2005). GATA factors and transcriptional regulation of cardiac natriuretic peptide genes. Regul Pept 128 177 185. Terada, R., Warren, S., Lu, J.T., Chien, K.R., Wessels, A., and Kasah ara, H. (2011). Ablation of Nkx2 5 at mid embryonic stage results in premature lethality and cardiac malformation. Cardiovasc Res 91 289 299.

PAGE 124

124 Thompson, J.T., Rackley, M.S., and O'Brien, T.X. (1998). Upregulation of the cardiac homeobox gene Nkx2 5 (CSX) i n feline right ventricular pressure overload. Am J Physiol 274 H1569 1573. Turbay, D., Wechsler, S.B., Blanchard, K.M., and Izumo, S. (1996). Molecular cloning, chromosomal mapping, and characterization of the human cardiac specific homeobox gene hCsx. Mo l Med 2 86 96. van der Velden, J., Papp, Z., Boontje, N.M., Zaremba, R., de Jong, J.W., Janssen, P.M., Hasenfuss, G., and Stienen, G.J. (2003a). Myosin light chain composition in non failing donor and end stage failing human ventricular myocardium. Adv Ex p Med Biol 538 3 15. van der Velden, J., Papp, Z., Boontje, N.M., Zaremba, R., de Jong, J.W., Janssen, P.M., Hasenfuss, G., and Stienen, G.J. (2003b). The effect of myosin light chain 2 dephosphorylation on Ca2+ sensitivity of force is enhanced in failin g human hearts. Cardiovasc Res 57 505 514. van der Velden, J., Papp, Z., Zaremba, R., Boontje, N.M., de Jong, J.W., Owen, V.J., Burton, P.B., Goldmann, P., Jaquet, K., and Stienen, G.J. (2003c). Increased Ca2+ sensitivity of the contractile apparatus in e nd stage human heart failure results from altered phosphorylation of contractile proteins. Cardiovasc Res 57 37 47. Wakimoto, H., Kasahara, H., Maguire, C.T., Izumo, S., and Berul, C.I. (2002). Developmentally modulated cardiac conduction failure in trans genic mice with fetal or postnatal overexpression of DNA nonbinding mutant Nkx2.5. J Cardiovasc Electrophysiol 13 682 688. Watt, A.J., Battle, M.A., Li, J., and Duncan, S.A. (2004). GATA4 is essential for formation of the proepicardium and regulates cardi ogenesis. Proc Natl Acad Sci U S A 101 12573 12578. Xiang, F., Sakata, Y., Cui, L., Youngblood, J.M., Nakagami, H., Liao, J.K., Liao, R., and Chin, M.T. (2006). Transcription factor CHF1/Hey2 suppresses cardiac hypertrophy through an inhibitory interactio n with GATA4. Am J Physiol Heart Circ Physiol 290 H1997 2006. Xin, M., Small, E.M., van Rooij, E., Qi, X., Richardson, J.A., Srivastava, D., Nakagawa, O., and Olson, E.N. (2007). Essential roles of the bHLH transcription factor Hrt2 in repression of atria l gene expression and maintenance of postnatal cardiac function. Proc Natl Acad Sci U S A 104 7975 7980. Yuasa, S., Onizuka, T., Shimoji, K., Ohno, Y., Kageyama, T., Yoon, S.H., Egashira, T., Seki, T., Hashimoto, H., Nishiyama, T., Kaneda, R., Murata, M., Hattori, F., Makino, S., Sano, M., Ogawa, S., Prall, O.W., Harvey, R.P., and Fukuda, K. (2010). Zac1 is an essential transcription factor for cardiac morphogenesis. Circ Res 106 1083 1091.

PAGE 125

125 Zhi, G., Herring, B.P., and Stull, J.T. (1994). Structural requir ements for phosphorylation of myosin regulatory light chain from smooth muscle. J Biol Chem 269 24723 24727. Zhi, G., Ryder, J.W., Huang, J., Ding, P., Chen, Y., Zhao, Y., Kamm, K.E., and Stull, J.T. (2005). Myosin light chain kinase and myosin phosphoryl ation effect frequency dependent potentiation of skeletal muscle contraction. Proc Natl Acad Sci U S A 102 17519 17524.

PAGE 126

126 BIOGRAPHICAL SKETCH Sonisha A. Warren is a native of Jamaica who has spent four year s as a student medical scientist at the Univer sity Of Florida College Of Medicine (UF CoM) conducting research in cardiovascular medicine under the mentorship of Hideko Kasahara MD, PhD. Warren is a graduate of Florida Memorial University in Miami, FL where she graduated summa cum laude. Her current work at UF focuses on examining the role cardiac myosin light chain kinase plays in the heart and evaluating its potential as a novel therapeutic target. Upon completion of her studies, Sonisha will be rewarded with a PhD in Medical Sciences, concentrati on in passion for cardiovascular research and her commitment to excellence are reflected in her recently winning the UF an esteemed scientific research competition held annua lly at UF where leading medical science students vie for a prestigious award. Sonisha was awarded the Alumni Graduate Fellowship exclusively offered to the top 10% incoming graduate students each year upon her acceptance into UF nd has since won awards to present at scientific conferences. In 2009, s he presented her work as a symposium speaker at the high profile and internationally supported American Heart Association Annual Scientific Session. Sonisha is a published author wit h more articles currently under construction