<%BANNER%>

Complex Genetic Determinants in Human Immunodeficiency Virus Type 1 (HIV-1) Subtype B Envelope V1-V5 Domains Modulate CX...

Permanent Link: http://ufdc.ufl.edu/UFE0043619/00001

Material Information

Title: Complex Genetic Determinants in Human Immunodeficiency Virus Type 1 (HIV-1) Subtype B Envelope V1-V5 Domains Modulate CXCR4-Dependent Entry into Host Cells
Physical Description: 1 online resource (175 p.)
Language: english
Creator: Williams, Wilton B
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: aids -- bioinformatics -- bnmabs -- ccr5 -- cd4 -- coreceptor -- cxcr4 -- envelope -- evolution -- function -- genotype -- gp120 -- hiv -- lymphocytes -- macrophages -- pathogenesis -- phylogenetics -- pssm -- r5 -- r5x4 -- receptor -- recombination -- sga -- stdg -- tropism -- u87 -- v1v2 -- v3 -- vaccine -- x4
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Evolution of CXCR4-using (X4) Human Immunodeficiency Virus Type 1 (HIV-1) is often associated with disease progression during the natural history of infection. Yet, genotypic determinants for X4 Envelopes (Env), particularly on macrophage tropic viruses, remain unclear. The current study was designed to link the genetic and functional evolution of X4 viruses and to determine a developmental program for emergence of viruses with expanded host cell range. Subtype B HIV-1 envelope (env) genes were amplified and sequenced from cell-associated or plasma viruses for as long as 10 years of infection among 8 therapy-naïve individuals. More than 800 envelopes were analyzed for coreceptor genotype by bioinformatic and phylogenetic algorithms, and a subset validated for function using titered luciferase-gene tagged viruses with a constant gp41 transmembrane region. X4 emergence occurred prior to CD4 T cell decline, and was associated with subsequent rapid CD4 T cell decline and progression to advanced stage disease. CCR5-using (R5) viruses persisted despite X4 emergence during disease progression. Genotype of env variable region 3 (V3) alone was insufficient to confer Env coreceptor use, which was distinct from host cell tropism. Site directed mutagenesis studies of amino acid residue of complex architecture in env variable region 1 (V1) significantly modified CD4-use efficiency, indicating that non-V3 residues modify efficient use of the coreceptor complex. CCR5 and CXCR4-using (R5X4) Envs displayed unique preference for CCR5 use on CD4 T cells, and exclusively used CCR5 on macrophages. CXCR4 use and macrophage tropism by R5X4 Envs was associated with increased access to V3 loop and CD4 binding site, in combination with efficient coreceptor interaction and fusion. Although V3 genotype is a dominant genetic determinant for coreceptor interaction, non-V3 determinants in Env cooperatively regulate X4 development via R5X4 intermediates with different preference for CCR5 and CXCR4 use on host cells. Emergence of X4 viruses follows a developmental program that appears in different infected individuals. Thus, complex discontinuous residues in HIV-1 env provide insights for immunogen design in novel vaccines, and targets for the development of novel CXCR4 entry inhibitors.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Wilton B Williams.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Goodenow, Maureen M.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043619:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043619/00001

Material Information

Title: Complex Genetic Determinants in Human Immunodeficiency Virus Type 1 (HIV-1) Subtype B Envelope V1-V5 Domains Modulate CXCR4-Dependent Entry into Host Cells
Physical Description: 1 online resource (175 p.)
Language: english
Creator: Williams, Wilton B
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: aids -- bioinformatics -- bnmabs -- ccr5 -- cd4 -- coreceptor -- cxcr4 -- envelope -- evolution -- function -- genotype -- gp120 -- hiv -- lymphocytes -- macrophages -- pathogenesis -- phylogenetics -- pssm -- r5 -- r5x4 -- receptor -- recombination -- sga -- stdg -- tropism -- u87 -- v1v2 -- v3 -- vaccine -- x4
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Evolution of CXCR4-using (X4) Human Immunodeficiency Virus Type 1 (HIV-1) is often associated with disease progression during the natural history of infection. Yet, genotypic determinants for X4 Envelopes (Env), particularly on macrophage tropic viruses, remain unclear. The current study was designed to link the genetic and functional evolution of X4 viruses and to determine a developmental program for emergence of viruses with expanded host cell range. Subtype B HIV-1 envelope (env) genes were amplified and sequenced from cell-associated or plasma viruses for as long as 10 years of infection among 8 therapy-naïve individuals. More than 800 envelopes were analyzed for coreceptor genotype by bioinformatic and phylogenetic algorithms, and a subset validated for function using titered luciferase-gene tagged viruses with a constant gp41 transmembrane region. X4 emergence occurred prior to CD4 T cell decline, and was associated with subsequent rapid CD4 T cell decline and progression to advanced stage disease. CCR5-using (R5) viruses persisted despite X4 emergence during disease progression. Genotype of env variable region 3 (V3) alone was insufficient to confer Env coreceptor use, which was distinct from host cell tropism. Site directed mutagenesis studies of amino acid residue of complex architecture in env variable region 1 (V1) significantly modified CD4-use efficiency, indicating that non-V3 residues modify efficient use of the coreceptor complex. CCR5 and CXCR4-using (R5X4) Envs displayed unique preference for CCR5 use on CD4 T cells, and exclusively used CCR5 on macrophages. CXCR4 use and macrophage tropism by R5X4 Envs was associated with increased access to V3 loop and CD4 binding site, in combination with efficient coreceptor interaction and fusion. Although V3 genotype is a dominant genetic determinant for coreceptor interaction, non-V3 determinants in Env cooperatively regulate X4 development via R5X4 intermediates with different preference for CCR5 and CXCR4 use on host cells. Emergence of X4 viruses follows a developmental program that appears in different infected individuals. Thus, complex discontinuous residues in HIV-1 env provide insights for immunogen design in novel vaccines, and targets for the development of novel CXCR4 entry inhibitors.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Wilton B Williams.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Goodenow, Maureen M.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043619:00001


This item has the following downloads:


Full Text

PAGE 1

1 COMPLEX GENETIC DETERMINANTS IN HUMAN IMMUNODEFICIENCY VIRUS TYPE 1 (HIV 1) SUBTYPE B ENV ELOPE V1 V5 DOMAINS MODULATE CXCR4 DEPENDENT ENTRY INTO HOST CELLS By WILTON BRYAN WILLIAMS A DISSERTATION PRESENTED TO THE GRADUAT E SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 W ilton B ryan W illiams

PAGE 3

3 This dissertation is dedicated t o my p arents Ezril and Michelle and Aunts Lena and Phyllis

PAGE 4

4 ACKNOWLEDGMENTS It is with sincere gratitude that I would like to thank s everal people who have played instrumental roles in my life but first I would like to give thanks to Jesus Christ fo r grace and mercy that has prese rved my life I would like to thank my mentor Maureen Goodenow, PhD. for the opportunity to work in her group, fostering my scientific growth and constantly challenging me to do my best My committee members Drs. Rolf Renne, Ayalew Mergia and Jeffrey Har rison provided invalu able insights in the development of my dissertation research and scientific growth and I would like to thank them for that I thank the IDP secretaries for administrative assistance and concentration chairs and faculties for invaluab le mentorship towards my academic growth My parents Ezril and Michelle Williams have been supportive in all my academic endeavors and relocation from Jamaica to the United States to pursue a tertiary level of education so I thank them for their love, sup port and prayers. My A unts Le na Wells and Dorcas Bailey have been supportive and loving mothers while studying i n New York City. Aunt Lena and U ncle Selmon have challenges that started from the dinner table in NYC to phone calls while living in Gainesville, and for that I would like to thank t he m sincerely. I would like to thank my siblings ( Con roy Sr., Nadine, Geoffrey, Magagaret Leroy, Sazeka, Diana and Taneisha ), Aunt Jane, and extended family including my l ate grandmother, Mazenie, for all the support, love and prayers over the years It is a blessing to have them as family. Finally, I w ould like to thank my friends IDP colleagues and Goodenow labmates for invaluable friendships and encouraging words to alw ays strive to achieve the utmost for the highest

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 14 CHAPTER 1 BACKGROUND ................................ ................................ ................................ ...... 16 HIV 1 Pandemic ................................ ................................ ................................ ...... 16 HIV 1 Genome ................................ ................................ ................................ ........ 17 HIV 1 Life Cycle ................................ ................................ ................................ ...... 18 HIV 1 Entry Receptors ................................ ................................ ............................ 19 HIV 1 Target Cells ................................ ................................ ................................ .. 21 Natural History of HIV 1 ................................ ................................ .......................... 22 HIV 1 Envelope ................................ ................................ ................................ ....... 23 V1V2 ................................ ................................ ................................ ................ 23 V3 ................................ ................................ ................................ ..................... 24 C3 V5 ................................ ................................ ................................ ............... 24 Gp41 ................................ ................................ ................................ ................ 25 Envelope Phenotyping ................................ ................................ ............................ 25 Evolution of Envelope Coreceptor Use ................................ ................................ ... 26 Evolution of Envelope Coreceptor Use and Cell Tropism ................................ ....... 27 Env Coreceptor Use Prediction Algorithms ................................ ............................. 27 HIV 1 Quasispecies ................................ ................................ ................................ 28 Mutation rate ................................ ................................ ................................ .... 29 Recombination ................................ ................................ ................................ 29 APOBEC3G and APOBEC3F ................................ ................................ ........... 30 Envelope diversity ................................ ................................ ............................ 31 Current Therapies ................................ ................................ ................................ ... 32 Vaccine Trials ................................ ................................ ................................ ......... 33 Broadly Neutralizing Monoclonal Antibodies ................................ ........................... 36 Hypothesis ................................ ................................ ................................ .............. 36 Specific Aims ................................ ................................ ................................ .......... 37 Specific Aim 1: To Identify Genetic Determinan ts in HIV 1 Envelope that Confer CXCR4 Dependent Entry into CD4 Expressing Host Cells ............... 37 Specific Aim 2: To Determine the Role of Envelope Variable 1 (V1) Domain in Modulating Coreceptor Use a nd/or Target Cell Tropism ........................... 37 Specific Aim 3: To Analyze HIV 1 Envelope Diversity during Viral Evolution ... 38

PAGE 6

6 Significance ................................ ................................ ................................ ............ 38 2 DISCONTINUOUS GENETIC DETERMINANTS IN HIV 1 S UBTYPE B R5X4 ENVELOPES MODULATE CXCR4 DEPENDENT ENTRY AND PREFERENTIAL CCR5 USE ON HOST CELLS ................................ .................... 52 Introduction ................................ ................................ ................................ ............. 52 Materials and Methods ................................ ................................ ............................ 54 Subjects ................................ ................................ ................................ ............ 54 Samples ................................ ................................ ................................ ........... 55 Coreceptor Use Prediction ................................ ................................ ............... 56 Phylogenetic Analysis ................................ ................................ ...................... 56 Cells ................................ ................................ ................................ ................. 57 Envelope Constructs and Virus Production ................................ ...................... 58 Immunoblot Assays ................................ ................................ .......................... 59 Virus Infections ................................ ................................ ................................ 60 Inhibition Studies ................................ ................................ .............................. 61 Statistical analysis ................................ ................................ ............................ 61 Results ................................ ................................ ................................ .................... 62 X4 evolves prior to CD4 T cell decline ................................ .............................. 62 Phylogenetic methods provide an alternative approach for maki ng inferences for the kinetics of X4 evolution ................................ ..................... 62 V3 genotype alone is insufficient to confer X4 phenotype, especially in combination with R5 [R5X4] ................................ ................................ .......... 64 Virus infectivity is associated with Env quantity ................................ ................ 65 Coreceptor phenotype on indicator cells and CD4 T lymphocytes is generally consistent ................................ ................................ ...................... 66 Coreceptor use alone fails to infer macrophage tropism ................................ .. 67 Discontinuous determinants outside of V3 potentially contribute to X4 evolution and macrophage t ropism ................................ ............................... 67 Complex developmental program in Env modulates X4 evolution and macrophage tropism ................................ ................................ ..................... 68 3 PROLINE RESIDUE IN ENVELOPE V1 DOMAIN IMPACTS CD4 USE EFFICIENCY AND SENSITIVITY TO BROADLY NEUTRALIZING MONOCLONAL ANTIBODIES ................................ ................................ ................ 82 Introduction ................................ ................................ ................................ ............. 82 Materials an d Methods ................................ ................................ ............................ 83 Subjects and Samples ................................ ................................ ...................... 83 Site Directed Mutagenesis ................................ ................................ ................ 83 Coreceptor Use Prediction ................................ ................................ ............... 84 Envelope Constructs and Virus Production ................................ ...................... 84 Virus Infections ................................ ................................ ................................ 85 Inhibition studies ................................ ................................ ............................... 85 Results ................................ ................................ ................................ .................... 85 Frequency of Proline in V1 ................................ ................................ ............... 85

PAGE 7

7 Genotypic Analysis of Envs with Proline in V1 ................................ ................. 86 Proline Emerges Overtime in HIV 1 Envelopes ................................ ................ 86 Se quence Analysis of Proline Emergence ................................ ....................... 87 Functional Analysis of Proline Emergence ................................ ....................... 87 Mechanism of Proline Emergence ................................ ................................ .... 88 4 EVIDENCE OF EXTENSIVE RECOMBINATION IN DISTINCT SUBTYPE B AND C HIV 1 ENVELOPE V1 V5 REGIONS ................................ .......................... 97 Introduction ................................ ................................ ................................ ............. 97 Materials and Methods ................................ ................................ ............................ 99 Subjects ................................ ................................ ................................ ............ 99 Samples ................................ ................................ ................................ ........... 99 Standard Genotyping (StdG) ................................ ................................ .......... 100 Single Genome Amplification (SGA) ................................ .............................. 100 Recombination In Vitro ................................ ................................ ................... 101 Recombination Analysis ................................ ................................ ................. 101 Sequence Analysis of Genetic Signatures ................................ ..................... 101 R ecombination Breakpoint Analysis ................................ ............................... 102 Results ................................ ................................ ................................ .................. 102 Frequency of In Vitro Recombination ................................ ............................. 102 Frequency of In Vivo Recombination ................................ .............................. 104 Frequency of Recombinants; StdG vs. SGA ................................ .................. 104 Genetic Signatures i n StdG and SGA Sequences ................................ .......... 106 Analysis of Recombination Breakpoints ................................ ......................... 106 5 DISCUSSION ................................ ................................ ................................ ....... 117 Overall important findings ................................ ................................ ..................... 117 Kinetics of X4 evolution ................................ ................................ ......................... 118 X4 evolution and HIV 1 pathogenesis ................................ ................................ ... 119 Factors that modulate X4 evolution ................................ ................................ ...... 119 Mechanism of X4 evolution ................................ ................................ ................... 121 X4 evolution and host cell tropism ................................ ................................ ........ 121 X4 evolution via R5X4 Envs of distinct coreceptor preference .............................. 122 Role of Proline emergen ce in Env V1 domain ................................ ...................... 123 Proline emergence during Env evolution and pathogenesis ................................ 124 Validation of StdG generated sequences ................................ .............................. 125 Impact of recombination on HIV 1 pathogenesis and X4 evolution ....................... 125 Insights for vaccine development ................................ ................................ .......... 126 Overall conclusions and significance ................................ ................................ .... 127 APPENDIX A GENOTYPIC AND FUNCTIONAL ANALYSIS OF HIV 1 ENVELOPES ............... 128 B OPTIMIZATION OF SINGLE CYCLE VIRUS ASSAYS ................................ ........ 139

PAGE 8

8 U87 Infections ................................ ................................ ................................ ....... 139 Virus Titration on Tzm bl and U87 Cells ................................ ............................... 139 Macrophage Infection ................................ ................................ ........................... 140 LIST OF REFERENCES ................................ ................................ ............................. 146 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 174

PAGE 9

9 LIST OF TABLES Table page 2 1 Kinetics of X4 Evolution.. ................................ ................................ .................... 7 3 2 2 Genotypic a nd functional analysis of HIV 1 Envs.. ................................ ............. 74 2 3 R5 and R5X4 Env sensitivity to entry blockers and V3 monoclonal antibody. .... 80 3 1 E nvelope Sensitivity to Inhibitory Agents.. ................................ .......................... 96 4 1 Frequency of In Vitro Generated Recombinants.. ................................ ............. 110 4 2 Frequency of In Vivo Re combinants.. ................................ ............................... 112 A 1 Characterization of Functional HIV 1 Envelopes.. ................................ ............ 132 B 1 Virus Titration on Independent Cell Lines.. ................................ ....................... 144

PAGE 10

10 LIST OF FIGURES Figure page 1 1 Estimated Number of Individuals Living with HIV in 2009.. ................................ 40 1 2 Estimated Number of New HIV Infections in 2009.. ................................ ............ 40 1 3 Estimated Number of HIV/AIDS Related Deaths in 2009.. ................................ 40 1 4 M ap showing the global distribution of diverse HIV subtypes (represented by single letter codes) and circulating recombinant forms (CRFs). ......................... 41 1 5 Organization of HIV 1 Genome and Position in Vi rion Particle. .......................... 42 1 6 HIV 1 Life Cycle.. ................................ ................................ ................................ 43 1 7 HIV A tail. ............................ 44 1 8 Schematic Representation of HIV 1 Entry into Host Cells.. ................................ 45 1 9 HIV 1 Coreceptors: CCR5 and CXCR4.. ................................ ............................ 45 1 10 Natural History of HIV 1 Infection.. ................................ ................................ ..... 46 1 11 HIV 1 Envelope Genome.. ................................ ................................ .................. 47 1 12 Model of Virion Ass ociated HIV 1 Envelope. ................................ ...................... 47 1 13 Proposed Model for gp120/g41 Trimers.. ................................ ........................... 48 1 14 Classification of Envelope Phenotypes.. ................................ ............................. 49 1 15 HIV dual infection of a cell, heterozygous virion f ormation and recombination. ................................ ................................ ................................ ... 50 1 16 Anti HIV 1 Envelope Broadly Neutralizing Monoclonal Antibodies.. ................... 51 2 1 Natural history and evolutio n of HIV 1 Env coreceptor use. .............................. 71 2 2 Evolutionary relationship of H IV 1 Envs during disease progression. ................. 72 2 3 Env expression and virus infectivity.. ................................ ................................ 75 2 4 CD4 T lymphocyte tropism of HIV 1 En vs.. ................................ ........................ 76 2 5 Macrophage tropism of R5 and R5X4 Envs.. ................................ ..................... 77 2 6 Sequence alignment of env V1 V5 genome for R5 and R5X4 Envs. .................. 78

PAGE 11

11 2 7 Probing mechanism of X4 evolution and macrophage tropism.. ......................... 79 2 8 Model of X4 evolution.. ................................ ................................ ....................... 81 3 1 Genotypic Analysis of Envelopes with Proline in V1 Region.. ............................ 90 3 2 Proline Emergence during Disease Progression.. ................................ .............. 91 3 3 Proline Emergence Overtime in V1 Region. ................................ ....................... 92 3 4 Entry Efficiency of Envelopes with Proline in V1 Domain.. ................................ 93 3 5 Mechanism of P147 in Entry Efficiency.. ................................ ............................ 94 3 6 Mechanism of P147 in Entry Efficiency.. ................................ ............................ 95 4 1 Sequence Alignment of J RFL and LAI.. ................................ ............................ 108 4 2 Frequency of In Vitro Generated Recombinants.. ................................ ............. 109 4 3 SplitsTree Analysis of Recombinants.. ................................ ............................. 111 4 4 Peak Trace Chromatograms of HIV 1 Sequences.. ................................ .......... 113 4 5 Frequency of StdG and SGA Generated Recombinants.. ................................ 114 4 6 Alignment of StdG and SGA Generated Sequences.. ................................ ...... 115 4 7 Recombination Breakpoint Analysis.. ................................ ............................... 116 A 1 Envelope Expression and Virus Infectivity.. ................................ ...................... 133 A 2 Genotypic Analysis of HIV 1 Envelopes from S1.. ................................ ............ 134 A 3 Geno typic Analysis of HIV 1 Envelopes from S2.. ................................ ............ 135 A 4 Genotypic Analysis of HIV 1 Envelopes from S3.. ................................ ............ 136 A 5 Genotypic Analysis o f HIV 1 Envelopes from S4.. ................................ ............ 137 A 6 Genotypic Analysis of HIV 1 Envelopes from S5.. ................................ ............ 138 B 1 Envelope Function for Entry into U87 CD4 CCR5 Cells.. ................................ .. 142 B 2 Envelope Function for Entry into U87CD4 CXCR4 Cells.. ................................ 143 B 3 Optimization of Macrophage Infection.. ................................ ............................ 145 B 4 Donor Variability in Macrophage Infections.. ................................ ................... 145

PAGE 12

12 LIST OF ABBREVIATION S AIDS Acquired immune deficiency syndrome AIC c Akaike Information Criterion AMD31 00 CXCR4 inhibitor developed by AnorMED Inc. Canada APOBEC3 Apolipoprotein B mRNA editing enzyme catal ytic polypeptide like protein 3 CD4 Cluster of differentiation 4 CCR5 CC chemokine receptor 5 CXCR4 CXC chemokine receptor 4 Env Envelope protein env Env elope gene GARD Genetic algorithm for recombination detection gp120 Glycoprotein 120 gp41 Glycoprotein 41 HAART Highly active antiretroviral therapy HIV Human immunodeficiency virus IC 50 50% Inhibitory concentration L Lymphocyte Luc Luciferase M Macrophag e M CSF Macrophage colony stimulating factor MDM Monocyte derived macrophages MRCA Most recent common ancestor MTCT Mother to child transmission NNet Networks PHI Pairwise homoplasy index

PAGE 13

13 Pro (P) Proline residue PBMC Peripheral blood mononuclear cells PMA Phorbol 12 myristate 13 acetate PNGs Potential N linked glycosylation site R5 CCR5 using Env R5X4 CCR5 an d CXCR4 using Env SGA Single genome amplification StdG Standard genotyping T T cell Thr (T) Threonine Tzm bl HeLa cell line derivative (JC.53 bl) ; encodes integrated copies of th galactosidase genes under control of the HIV 1 promoter TAK779 Non peptide CCR5 inhibitor developed at the Takeda and Kagoshima University TCID 50 50% Tissue culture infectivity dose U87 Human gliomablastoma cell line X4 CXCR4 using Env

PAGE 14

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy COMPLEX GENETIC DETERMINANTS IN HUMAN IMMUNODEFICIENCY VIRUS TYPE 1 (H IV 1) SUBTYPE B ENV ELOPE V1 V5 DOMAINS MODULATE CXCR4 DEPENDENT ENTRY INTO HOST CELLS By W ilton B W illiams December 2011 Chair: Maureen Goodenow Major: Medical Sciences Immunology and Microbiology Evolution of CXCR4 using (X4) Human Immunodefici ency Virus Type 1 (HIV 1) is often associated with disease progression during the natural history of infection. Yet, genotypic determinants for X4 Envelopes (Env), particularly on macrophage tropic viruses, remain unclear. The current study was designed to link the genetic and functional evolution of X4 viruses and to determine a developmental program for emergence of viruses with expanded host cell range. Subtype B HIV 1 envelope ( env ) genes were amplified and sequenced from cell associated or plasma vi ruses for as long as 10 years of infection among 8 therapy nave individuals. More than 800 envelopes were analyzed for coreceptor genotype by bioinformatic and phylogenetic algorithms, and a subset validated for function using titered luciferase gene tagg ed viruses with a constant gp41 transmembrane region. X4 emergence occurred prior to CD4 T cell decline, and was associated with subsequent rapid CD4 T cell decline and progression to advanced stage disease. CCR5 using (R5) viruses persisted despite X4 eme rgence during disease progression. Genotype of env variable region 3 ( V3 ) alone was insufficient to confer Env coreceptor

PAGE 15

15 use, which was distinct from host cell tropism. Site directed mutagenesis studies of amino acid residue of complex architecture in env variable region 1 ( V1 ) significantly modified CD4 use efficiency, indicating that non V3 residues modify efficient use of the coreceptor complex. CCR5 and CXCR4 using (R5X4) Envs displayed unique preference for CCR5 use on CD4 T cells, and exclusively use d CCR5 on macrophages. CXCR4 use and macrophage tropism by R5X4 Envs was associated with increased access to V3 loop and CD4 binding site, in combination with efficient coreceptor interaction and fusion. Although V3 genotype is a dominant genetic determina nt for coreceptor interaction, non V3 determinants in Env cooperatively regulate X4 development via R5X4 intermediates with different preference for CCR5 and CXCR4 use on host cells. Emergence of X4 viruses follows a developmental program that appears in d ifferent infected individuals. Thus, complex discontinuous residues in HIV 1 env provide insights for immunogen design in novel vaccines, and targets for the development of novel CXCR4 entry inhibitors.

PAGE 16

16 CHAPTER 1 BACKGROUND HIV 1 Pandemic Human Immun ode ficiency Virus Type 1 (HIV 1) is the causative agent of acquired immune deficiency syndrome (AIDS) I nitial detection of the disease/ AIDS in the early 1980s led to identification of HIV 1, which has impacted the lives of millions of people worldwide. The advent of highly active antiretroviral therapy (HAART) in the mid 1990s improved the life expectancy of many infected individuals To date, HIV 1 remains a global pandemic and a fully protective vaccine and cure remains elusive (109, 249) At the end of 2009, the World Health Organization reported that there were approximately 33.3 million people living w ith HIV 1 worldwide (Figure 1 1 ) (4) In 2009, there were 1. 8 million HIV related deaths (Figure 1 2 ) and 2. 6 mil lion new infections (Figure 1 3 ) (4) thus indicating a net increase of infections. Over 50% of global HIV 1 infections are localized to Sub Saharan Africa with a pproximately 3% of world infections localized to the United Sta tes of America HIV 1 is an enveloped virus that belongs to the viral family Retroviridae which contains viral RNA and reverse t ranscriptase which is needed for convert ing RNA into cDNA (120) HIV 1 is further classified as a L entivirus characteristic of the delayed onset of symptoms after infection The closest relatives of HIV 1 are simian immun odeficiency viruses (SIVs) that infect wild living chimpanzees and gorillas in west central Africa (227) P hylogenetic analyses revealed that chimpanzees were t he original hosts of primate lentiviruses which resulted in independent cross species transmissions to humans via the likeliest route of exposure to infected blood and body fluids during the butchery of bushmeat (93 227) HIV 1 is divided into three groups, major (M), new (N),

PAGE 17

17 and outlier (O), with group M further divided into subtypes; A, B, C, D, F, G, J, an d K. Group M is most common worldwide and the HIV 1 subtypes from g roup M are distributed across different geographical regions as illustrated in Figure 1 4 (209) S ubtype C present in sub Saharan Africa represents the predominant subtype worldwide but subtype B is most prominent in North America, Europe, parts of the Caribbean and South America In addition to the subtypes, recombination between the subtypes lead to the generation of circulating recombinant forms (CRFs) (Figure 1 4) (209) In addition to HIV 1, HIV is divided into another viral clade, HIV 2. HIV 1 a nd HIV 2 are genetically similar, yet distinct based on pathogenicity; HIV 2 is less pathogenic than HIV 1 (44) Furthermore, HIV 2 is localized to West Africa (194) HIV 1 Genome HIV 1 contains 2 positive sense RNA strands of approximately 10 kilo bases packaged in an enveloped virion (Figure 1 5 ). In addition to gag (group antigen or structural proteins) pol (polymerase or enzymatic proteins) and env (envelope or surface proteins) encoded in the genome of all simple retroviruses, HIV 1 encodes additional accessory proteins vif (viral infectivity factor) vpu (viral protein u) vpr (viral protein r) nef (n egative regulatory factor) tat ( trans activator of transcription) and rev (regulator of virion expression) characteristic of complex retroviruses (74, 120) The HIV 1 genome is flan ked by 2 identical long terminal repeats (LTR) that encodes the HIV 1 promoter; Gag encodes structural proteins matrix (p17), capsid (p24), nucleocapsid (p7) and p6; pol encodes enzymatic proteins protease (p10), reverse transcriptase (p66/51), and integra se (p31); and env encodes surface protein gp120

PAGE 18

18 and membrane bound gp41 (74) The 10 kilobase HIV 1 genome encodes the viral products involved in the viral life cycle. HIV 1 Life Cycle The viral life cycle consists of multiple steps that lead to host cell infection and nasce n t virion production (Figure 1 6 ). Receptor mediated entry into host cells initiate s the life cycle that generates progeny HIV 1 that buds from the infected cell (120) Upon entry, the viral core is released into the cytoplasm and HIV 1 then uses the virally encoded reverse transcriptase (RT) present within the virion to convert its RNA geno me to cDNA (217) thus forming a preintegration complex (PIC). The PIC is then shuttled into the nucleus of the cell with the help of viral accessory protein Vpr (145) Viral cDNA is in tegrate d into the host chromosome within the nucleus with the help of virally encoded i ntegrase ( IN ) followed by transcription which is controlled by the long HIV 1 uses alternatively spliced transcripts to produce accessory protei ns Tat and Rev, which creates a positive feedback loop on viral replication via Tat binding to the LTR and promoting increased transcription (55) and Rev mediated export of non spliced transcript variants from the nucleus via Rev binding to Rev responsive element (RRE) in the viral genome (149) HIV 1 accessory proteins, Vif, Vpr, Vpu, Nef, and surface protein Env are translated from alternatively spliced transcripts whereas Gag and Pol are translated fr om unspliced transcripts (Figure 1 7) Gag, Pol, and Env proteins are transcribed into polyproteins that are cleaved into fully functioning mature proteins by either viral protease (PR) for Gag and Pol (121) or host cell protease furin for Env (161) Gag and Pol proteins are found in different reading frames and ribosomal frameshifting during translation produce s the Pol proteins. Gag and Pol processing occurs during or

PAGE 19

19 imme diately afte r budding from an infected cell, thus producing an infectious virus in the process defined as virion maturation Overall, the v iral life cycle is a multiple step process initiated via viral entry, which was the focus of my studies. HIV 1 Entry Receptors HIV 1 mediates a multistep process of viral entry into target cells, which is facilitated by receptor binding and fusion of viral and cellular membranes (240) (Figure 1 8). HIV 1 uses CD4 as the main receptor and CCR5 or CXCR4 as the predominant coreceptors. CD4 (cluster of differentiation 4) is a glycoprotein expressed on the surfaces of immune cells such as T helper cells, monoc ytes, macrophages, and dendritic cells. It was discovered in the late 1970s and was originally known as leu 3 and T4 (after the OKT4 monoclonal antibody that reacted with it) before being named CD4 in 1984 (18, 54) CD4 amplifies the signal generated by T cell receptor (TCR) upon interaction with an antigen presenting cell during the host response to invading pathogens (106) However, i n the early 1980s the T4 receptor that was later termed C D4, was identified as the main receptor for HIV 1 entry into target cells (118) CCR5 and CXCR4 are 7 transmembrane G protein coupled receptors (7TM GPCRs) that mediate several cellular functions including development, leukocyte trafficking, angiogenesis, and immune response by coupling the receptors to complex intracellular signali ng pathways mediated by G proteins (6, 16) CCR5 and CXCR4 are expressed on immune cells and functions as chemokine receptors in the CC and CXC chemokine groups, respectively. Chemokines and their receptors were div ided into four families (CXC, CC, C, and CX3C) on the basis of the pattern of cysteine residues in the ligands (here C represents cysteine and X/X3 represents one or three non cysteine

PAGE 20

20 amino acids), and to date approximately fifty chemokines and receptors have been discovered (7) Chemokines bind to 7TM GPCRs and cause conformational changes that trigger int racellular signaling pathways involved in cell movement and activation (7) Thus CCR5 and CXCR4 mediates chemotaxis of immune cells to sites of inflammation or tissue damage by invading pathogens (162) In 2000, the first crystal structure of a mammalian 7TM GPCR (bovine rhodopsin) was solved (169) Structurally 7TM GPCRs are characterized by an extracellular N terminus, followed by seven transmembrane (7 helices (TM 1 to TM 7) connected by three intracellular (IL 1 to IL 3) and thre e extracellular loops (EL 1 to EL 3), and finally an intracellular C terminus (Figure 1 9) In 1996, Feng and colleagues reported that c o expression of CXCR4 and CD4 on a cell allow ed T cell line tropic HIV isolates to fuse with and infect the cell thereb y supporting the role of CXCR4 as a coreceptor for HIV (73) Soon after CXCR4 was identified as a coreceptor for HIV 1, CCR5 was discovered as another co receptor for HIV 1 infection (64) The discovery that 10% of the Caucasian population in Northern Europe was resistant to HIV 1 was linked to a mutation in the CCR5 gene ( CCR5 (214) and further supported the significant role of C CR5 in facilitating viral infection by CCR5 using viruses that typically establish infection Ligand binding to 7TM GPCRs is essential for signaling that regulates their plethora of functions (106) Thus, c hemokine receptors have n atural ligands and those for CCR5 and CXCR4 were demonstrated to block HIV 1 infection in vitro (22, 167, 256) thus providing further support for CCR5 and CXCR4 as coreceptors for viral entry. The natural chemokine ligands that bind to CCR5 are RANTES (a chemotactic cytokine

PAGE 21

21 (also known as CCL3 and CCL4) The natural chemokine ligand that binds to CXCR4 is stromal derived factor 1 (SDF 1 also called CXCL12) Desp ite having homologous extracellular loop structures CCR5 and CXCR4 have 31% amino acid identity and support infection by distinct HIV 1 strains (61) T he first and second loops of CXCR4 are more negatively char ged compared to the corresponding regions in CCR5, thus supporting a model of charged interactions between HIV 1 V3 loop and extracellular coreceptor loops (61, 62, 146) Overall, host cells expressing CD4, and CCR5 and/or CXCR4 serve as targets for HIV 1. HIV 1 Target Cells A common feature of l entiviruses is tropism for cells from the monocyte/macrophage lineage, predominantly macrophages, which provides a potential hiding place from the host immune system (59) However, p rimate lentiviruses such as HIV and SIV also infect lymphocytes. CD4 expressing T lymphocytes and macrophages are the main cellular targets of different strains of HIV 1 that use distinct coreceptors to mediate viral entry (63, 83, 85, 157) CD4 T lymphocytes are modulators of the adaptive arm, and macrophages constitute the innate arm of the host response in clearing the body of invasive pathogens (63, 106) Most CD4 T lymphocytes express CXCR4, but a subset of memory T cells that circulate in the periphery express CCR5 and are thus highly f avored initial targets of HIV 1 infection (24, 63, 157, 231) CD4 T cells are more permissive for viral infection compared to macrophages (88, 105, 178, 181) L o wer expressio n levels of CD4 and HIV 1 coreceptor s on macrophages relative to CD4 T cells contribute to less efficient infection of macrophages (136, 137, 248) Monocytes circulate in the blood with a half life of about 3 days before migrating into tissues and further differentiating into mature macrophages Monocytes express little to no CCR5

PAGE 22

22 and/ or CXCR4 unlike macrophages, thus favoring macrophages as more efficient targets for HIV 1 infection compared to monocytes (85, 243) Macrophage tropism is an inefficient process in vitro whether by viruses amplified from the brain or blood in acute or chronic stages of infection (105, 141, 180, 181) No netheless macrophages persist from weeks to months and s erve as reservoirs for HIV 1 (21) Overall tropism of lymphocytes and macrophages contribute to viral pathogenesis. Natural History of HIV 1 R 5 viruses use CCR5, R5X4 viruses use CCR5 and CXCR4, and X4 viruses use CXCR4 to mediate e ntry into host cells (15, 61, 83) R5 viruses typically establish infection, whereas X4 viruses emerge overtime (at least among subtype B) and has been associated with advanced stage disease (48, 49, 81, 116, 223) The role of different viral strains in the natural history of HIV 1 infection is illustrated in Figure 1 10 A rapid decline in CD4 T cells and spike in viral load that occurs upon infection is resolved within weeks but CD4 T cell steadily declines overtime due to HIV 1 induced activation of apoptotic pathways by viral binding or infection (24, 26) R5 virus es infect macrophages and CD4 memory T cells directly or via transmis sion of virus attached to dendritic cells (79) M emory CCR5 + T lymphocytes, but not macrophages, are depleted during the acute phase of HIV 1 infection and contributes to a selection for X4 viruses (196) X4 emergence as a cause or consequence of advanc ed stage disease remains unclear, and is one focus of my research. A dvanced stage disease is characterized by CD4 T cell decline (< 15 %) and a rebound in viral load that ultimately leads to the onset of AIDS (114, 11 5) Viral and cellular factors contribute to disease progression, but the focus of my studies was on viral factors such as the genetic determinants in HIV 1 envelope that modulate entry into host cells.

PAGE 23

23 HIV 1 Envelope HIV 1 Env elope (Env) is initially s ynthesized as a 160 KDa polyprotein precursor, Env gp160. Upon synthesis, Env gp160 enters the lumen of the endoplasmic reticulum (ER) where it is oligomerized prior to being transported through the golgi apparatus where glycosylation occurs followed by c leavage into glycoproteins, gp120 and gp41 (161) Cell ular enzymes Dolichol phosphat e and furin are responsible for Env glycosylation and cleavage, respectively (160) Env gp120 is anchored to the surface of the virion via non covalent attachments to the transmembrane protein Env gp41 (203) Env gp120 is compos ed of five hypervariable regions V1 V5 interspersed by five constant regions, C1 C5 (Figure 1 11 ). Functional Env exists as a homotrimer of gp120 and gp41 molecules on the surface of the virion ( Figure 1 12 ); each virion has a range of 7 14 trimeric Env spikes (266) The trimeric nature of Env and extensive glycosylation modulates access to entry determinants an d antibody epitopes (Figure s 1 12 and 1 1 3 ). Overall, t he hy pervariable and constant regions of Env encode determinants that modulate Env function for viral entry and sensitiv ity to neutralizing antibodies, which are further complicated by the structural characteristics of Env. V1V2 Env gp120 V1V2 domain is the mo st variable region in Env based on amino acid changes and length. V1V2 length increase overtime is generally caused by an insertion of potential N linked glycosylation sites (PNGs) which has been characterized as genetic feature s of Env transmission (58, 165) and evasion of antibody neutralization (189, 208, 244) V1V2 shields V3 and discontinuous regions in Env gp120 (38, 158, 205) thus modulating access to epitopes for antibody neutralization (183, 184) and determinants for coreceptor use efficiency and host cell tropism (122, 163, 260) (Figure

PAGE 24

24 1 13) More recently at the AIDS Vaccine 2011 Conference held in Bangkok, Thailand, from September 12 15, 2011 V2 was iden tified as an important target for antibod ies that developed in individuals protected by the RV144 vaccine trial (117) V1V2 also encodes determinants that modulate efficient virion binding prior to viral entry Nawaz and colleagues reported the use of gut ho 4 7 by Envs for binding to CD4 + T cells via t 4 7 bindin g site (LDV) in e nv V2 region (165) Furthermore, p ositively selected mutations in V1V2 serve as compensatory mutations to amino ac id changes of high charge in the V3 loop that are necessary for CXCR4 use (172, 211) V3 Env gp120 V3 domain has a conserved length of approximately 35 amino acids but is genetically diverse, primarily among vira l strains that use different coreceptors (108, 207) Bioinformatic algorithms use the genetic features of the V3 loop to predict Env coreceptor use (25, 78, 235) Bioinformat ic algorithms infer distinct R5 and X4 Env phenotypes, but are insufficient to infer phenotype of Envs that use CCR5 and CXCR4 ( R5X4 ) However, s pecific residues in the V3 loop have been shown to be associated with coreceptor preference by R5X4 Envs on CD4 T cells (89, 144) Given the essential role of V3 loop in dictating coreceptor use, it is not surprising that the V3 loop encodes epitopes for antibody neutralization (47, 98 268) The trim eric nature of Env that facilitates V1V2 shielding of V3 contribute s to the inaccessibility of epitopes on the V3 loop for neutralization susceptibi lity (38, 205) C3 V5 Env gp120 C3 V5 domains enc ode discontinuous determinants that modulate CD4 binding (257) The C3 domain, which encodes most of the CD4 binding site is highly

PAGE 25

25 conserved and encodes e pitopes for broadly neutralizing monoclonal antibodies previ ously isolated from HIV 1 infected subjects (219, 257, 265) Based on the crystal structure of monomeric gp120 and the predicted Env trimers t he C4 domain encodes orm the coreceptor binding s ite domains (130) The C3 V5 region forms the outer domain of Env on which glycosyl groups mask s neutralizing antibody epitopes (158) (Figure 1 13) G p41 In addition to a fusion peptide, Env gp41 consists of a n endo (inside virion) ecto (outside of virion), and a transmembrane domain (202, 251) The heptad repeats (HR 1 and HR2) in the ectodomain form a six helix bundle that contributes to the trimeric nature of gp41 and the fusion peptide facilitates viral and cellular membrane fusion (252, 263) In the Env spike on a virion, t hree gp41 associate with each other via hydrophobic interactions between their respective heptad repeats, thereby bringing together three gp120 to form a trimeric spike (203) Additiona lly, gp41 encodes antibody epitopes in the membrane proximal region (MPER) located in the ectodomain (234, 269) Like the gp120 antibody epitopes, gp41 epitopes are occluded on the trimeric structure of the Env and may be transiently exposed during fusion of viral and cellular membranes (60, 171) Furthermore, gp41 is shielded by gp120 on the surface of the virion (Figure s 1 12 and 1 13), thus hindering access for antibody neu tralization in the unliganded form of the envelope Envelope Phenotyp ing Env phenotype was initially defined as syncytium inducing (SI) or non syncytium inducing (NSI) using a MT 2 co cultivation assay in vitro (125) SI viruses induced

PAGE 26

26 syncytium on MT 2, in contrast to NSI virus es. V iral isolates which con sist of different variants were generally used to define Env phenotype via syncytium forming assays. MT 2 is a T cell line that expresses CD4 and CXCR4, but not CCR5 (157) Thus f ollowing the discovery of CCR5 and CXCR4 as coreceptors for HIV 1 entry in 1996, viral isolates were described as CCR5 ( R5 ) and CXCR4 using ( X4 ) (20) NSI viruses were redefined as R5 and SI viruses as X4. To date viral phenotype is defined as coreceptor use and cell tropism both of which are described in more details below. Evolution of Env elope Coreceptor Use E volution of Env coreceptor use is a biomarker for disease progressio n. R5 viruses predominantly establish primary infection (116) consistent with phylogenetic studies (92, 211) Rare X4 transmission has been reported via mother to child ( MTCT ) and sexual transmission, as well as in cohorts of CCR5 homozygotes (35, 139, 213) X4 viruses are associated with advanced stage disease and rapid progression to AIDS in 50 70% of infected individuals (72, 92, 196, 223) Ye t, the genetic determinants for coreceptor use, especially for CXCR4 using viruses are not fully understood. It is well established that the V3 loop is essential in determining Env coreceptor use (50, 100, 174, 193, 215, 246) Molecular genetics approaches indicate d that h igh charge mutations in V3 loop are necessary for CXCR4 use but compensatory mutations in V1V2 must precede high charge mutations in V3 to facilitate CXCR4 use (172, 211) V1V2 mutations prior to high charge V3 mutations were necessary for viral fitness and viability (172) Despite X4 emergence, R5 viruses persist throughout infecti on suggesting that X4 viruses do not abolish R5 viruses (8, 30) There are three main hypothese s for the R5 t o X4 evolutionary expansion (196) T ransmission mutation hypothesis suggest s that X4 emergence is a result of multiple

PAGE 27

27 genetic changes in the R5 founder population and selection for viral fitness (116, 210) I mmune control hypothesis suggests that X4 emergence is a consequence of the continuous erosion of the immune system over the course of infection given that X 4 viruses are more neutralization sensitive than R5 viruses (238) T arget cell based hypothesis suggests that increased prevalence of nave CD4 T cells (CXCR4 + ) over memory CD4 T cells (CCR5 + and CXCR4 + ) during disease progression due to HIV 1 depletion of memory CD4 T cells, will favor the em ergence of CXCR4 using Envs (245) Evolution of Env elope Coreceptor Use and Cell Tropism CD4 use is biologically relevant for virus infection but Env c oreceptor use and cell tropism def i nes viral phenotype (Figure 1 14 ) ; L R5 (CCR5 use for lymphocyte tropism), M R5 (CCR5 use for lymphocyte and macrophage tropism), D R5X4 (CCR5 and CXCR4 for lymphocyte and macrophage tropism), D X4 (CXCR4 use for lymphocyte and macrophage tropism) and T X4 (CXCR4 use for lymphocyte and T cell tropism) (83) Viruses that mediate entry into CD4 T lymphocytes may fail to mediate entry into macrophages, suggesting that coreceptor use alone is insufficient to confer cell tr opism (34, 83, 105) Host cell factors including cell surface receptor presentation and expression levels may influence cell tropism (136, 248) Thus, coreceptor use and cell tropism are distinct characteristics of Env. To date, there are current genotypic methods available for studying coreceptor use, but analysis of cell tropism is limited to functional methods. Env Coreceptor Use Prediction Algorithms The genetic features o f the V3 loop are widely used to predict Env coreceptor use using bioinformatic algorithms (25, 78, 235) The net charge, 11/25 rule and position specific scoring matrix (PSSM) are three widely used genotypic metho ds for predicting

PAGE 28

28 Env coreceptor use. The net charge of the V3 loop for R5 viruses is typically 4, in contrast to X4 viruses that have a net charge V3 loop 5. Other algorithms make predictions for Env coreceptor use based on specific amino acid compositi ons in the V3 loop. The 11/25 rule predicts that X4 viruses have a positively charged residue (Arginine [R]/ Lysine [K]) at position 11 and/or 25 of the V3 loop, whereas R5 viruses do not ha ve R/K at position 11 and/or 25. PSSM scores an envelope for predi cted coreceptor use based on the likelihood of each residue in the V3 loop to be present at distinct positions, when compared to standard V3 loops of R5 and X4 Envs. PSSM provides a score for each envelope that corresponds with the likelihood for CCR5 or C XCR4 use; R5 < 6.88, X4 > 2.88 (107) The Env coreceptor use prediction methods can distinguish between R5 and X4 Envs, but they fail to distinguish R5X4 from X4 Envs. While the Env coreceptor use prediction methods were developed to predominantly predict R5 and X4 phenotypes, PSSM predicts intermediate phenotypes (IMR5 and IMX4) Intermediate R5 and X4 Envs have genetic features of R5 and X4 Envs respectively, but their PSSM scores lie outside the cutoff for R5 and X4 Envs; PSSM scores for IMR5 and IMX4 lie between 6.88 and 2.88 In addition, IMR5 Envs lack R/K at position 11/25 and IMX4 Envs encode R and/or K at position 11/25 (107) Although, the Env coreceptor use predic tion algorithms were predominantly developed to predict Env coreceptor use and not cell tropism (78, 235) Briggs and colleagues (25) linke d coreceptor use to cell tropism for prediction of Env phenotypes. Overall, genotypic algorithms predicted Env coreceptor use with some degree of accuracy, but none were perfect. HIV 1 Quasispecies Genetic diversity within a population allows a species to evolve in an ever changing environment with shifting selection pressures, and the theoretical advantage

PAGE 29

29 of maintaining a diverse quasispecies is that, when the virus is shifted to a new environmental niche, a variant may already be present in the populatio n which will be more fit in the new environment (222) RNA viruses includ ing HIV 1 typically exist as a quasispecies of related, yet distinct viruses (82, 134, 222) The basis for heterogeneity in HIV 1 is predominantly contributed by the high mutation rate in the viral genome during replication r ecombination and hypermutation of viral genome by host cell factors T he heterogeneity in HIV 1 impacts Env diversity that may provide challenges for entry inhibitors and vaccines, and impact entry efficiency, host cell tropism and susceptibility to neu tralizing monoclonal antibodies. Mutation rate HIV 1 virion contains reverse transcriptase (RT) for converting viral RNA into cDNA. However, RT lacks proof reading capabilities and is e rror prone during viral genome replication; 5 10 mutations are incorpo rated into the HIV 1 genome per round of genome replication ( 5 10 mutations/10000 base pairs) (190, 198) The high error rate of RT is further amplified by the high viral turnover production within an infected indiv idual; an estimated 10.3 x 10 9 virions are produced per day in an infected subject, with a mean life span of 2.2 days (half life t 1/2 = 1.6 days) for productively infected cells and 0.3 days for plasma virions (175) The high error rate by RT and the high virion production per day contributes to HIV 1 quasispecies. Recombination Coinfection and sequential infection of target cells by distinct HIV 1 particles may contribute to a progeny virion with heterozy gous viral genomes that are susceptible to recombination during reverse transcription (Figure 1 15), via the copy choice model of HIV 1 genome replication (166) Sequential infection of target cells by distinct HIV 1

PAGE 30

30 particles is the least favored model for dual infection due to CD4 and CCR5 downregulation after HIV 1 infection (153) HIV 1 co infected macrophages in vitro displayed sign ificantly higher frequency of recombination events than co infected CD4 T cells, suggesting that the cell environment influences the frequency of recombination (138) R ecombination between different viral genomes potentially promotes Env diversity (192) F requent recombination between R5 and X4 env genomes of co infected cells have been implicated in the emergence of a high frequency of CXCR4 using Envs during dise ase progression (155) Recombina tion breakpoints are distributed across the viral genome, but hotspots for frequent crossover sites have been localized to the env C2 region (192, 212) Although recombination in HIV 1 may be an artifact of PCR ampl ification, various methods are available to minimize PCR generated recombinants. T raditional PCR ampl ification of bulk viral quasispecies (standard genotyping) may introduce PCR generated artifacts under certain experimental conditions (111, 148, 152, 225) whereas s ingle genome amplification eliminates the opportunity to generate PCR artifacts (170, 210) While single genome amplification is most ideal for detection of rare v ariants in a viral population, standard genotyping may be effective for studies evaluating the dominant viral population (170) Overall, neither standard genotyping nor single genome amplification is more biased tha n the other in genome amplifi cation, and both methods provide a similar measure of population diversity (110) However, recombination contributes to the viral diversity in the HIV 1 quasispecies. A POBEC3G and APOBEC3F Apolipoprotein B mRNA editing enzyme catalytic polypeptide like protein 3 (APOBEC3 ) is a well characterized family of host restriction factor s, which belongs to a

PAGE 31

31 group of cytidine deaminases that have antiviral protein activity (40) APOBEC3G and APOBEC3F deaminates cytidines (C) to ura cil (U) in newly synthesized single stranded DNA during reverse transcription, thus resulting in G to A mutations in the viral genome (135) Hypermutations by APOBEC3G and APOBEC3F interferes with strand transfer during the reverse transcription proces s to inhibit viral replication as well as generate hypermutated cDNA of newly synthesized HIV 1 transcript in the infected cell. The viral p rotein Vif antagonizes the anti viral APOBEC3G activity by binding to APOBEC3G and target s it fo r ubiquination and subsequent degradation via the proteasome (228) Heger and colleagues recently demonstrated that in a study of 1527 V3 sequences from three independent data sets of X4 and R5 strains where the triplet composition s were analyzed, a higher number of G containing triplets was found in R5 viruses, whereas X4 strains displayed a higher content of A comprising triplets Since APOBEC3G and APOBEC3F are deaminases that induce G to A mutations, Heger and colleagues suggest that G to A mutations in envelope are leading to the co receptor switch from R5 to X4 strains potentially via the action of APOBEC3G and APOBEC3F (96) Therefore, the hypermutations created by APOBEC3G and APOBEC 3F contribute to the viral diversity in the HIV 1 quasispecies, and potentially X4 emergence. Env elope diversity H eterogeneity in HIV 1 quasispecies due to modifications of the viral genome may contribute to envelope diversity There is approximately 30% n ucleotide sequence variation among Envs of different subtypes, with a further 15% difference within each subtype (61, 147) Inter subtype Env diversity potentially contributes to functional differences in predicted Env conformation and genet ic determinants that modulate virus transmission and coreceptor use expansion (45, 58, 173, 174) Furthermore,

PAGE 32

32 r ecombination between subtypes may contribute to the complexity of the HIV 1 q uasispecies and impact Env diversity (2 64) Additionally, selective pressures from the host response (129, 244) and drugs such as antiviral entry inhibitors (8, 182, 195, 253) may contribute to Env modifications to escape the selected pressures, thus further influencing Env diversity Current Therapies HIV 1 antiretroviral drugs target specific steps of the viral life cycle (Figure 1 6): CCR5 inhibitors, fusion inhibitors, nucleoside reverse transcriptase inhibi tors (NRTIs), non nucleoside reverse transcriptase inhibitors (NNRTIs), integrase inhibitors (II) protease inhibitors (PI) and maturation inhibitors (188) While NRTs are incorporated into the newly synthesized viral DNA strand as a faulty nucleotide and causes chain termination during reverse transcription, NNRTIs bind reverse transcriptase and disrupt its function Reverse transcriptase inhibitors were the first class of HIV 1 inhibitors used as drugs; Retrovir (zidovudine, AZT) was clinically available in 1987 (43) Currently, all classes of drugs that target specific steps in the viral life cycle are available in combination therapy as highly active antiret roviral therapy (HAART) regimen, but most HAART regimen consists of 2 NRTIs + 1 PI/NNRTI/II HAART regimen is recommended for individuals with a CD4 count less than 200 cells / mm 3 or those exhibiting AIDS defining illnesses (3) Although HAART regimen may be clinically available, several millions of infected subjects worldwide may not have access to therapy (4) Furthermore, HIV 1 antiretroviral drugs have adverse side effects. Thus, a vaccine and/or cure are in great demand. Since envelope is the first line of viral contact with host cell factors, inhibitory agents against envelope provide a mechanism to block viral entry and prevent infection.

PAGE 33

33 Inhibitory agents against viral e ntry Strategies of viral entry inhibition include the use of entry inhibitors [CD4 and co receptor binding, and fusion]. Drugs that block viral entry are collectively known as entry inhibitors, but display multiple mechanisms of actio n (240) E ntry inhibitors may target CD4 and coreceptor binding, and fusion However the only clinically approved entry inhibitors are Ma raviroc (CCR5 inhibitor) and T20 also known as enfuvirtide (fusion inhibitor). Maraviroc is an allosteric inhibitor that binds to the hydrophobic transmembrane regions of CCR5 thereby altering the conformation of the extracellular loops necessary for HIV b inding (200, 240) X4 viruses may gain a selective advantage during CCR5 a ntagonist treatment. Additionally, Maraviroc resistance may lead to X4 virus outgrowth from preexisting viral reservo irs prior to treatment (241) T20 is a 36 amino acid synthetic peptide with identical sequence to the HR2 region of gp41 and competes for binding to HR1 thus disrupting fusion of viral and cellular membranes (11, 240) Additionally, other entry inhibitors are available for in vitro studies of assessing Env entry efficiency. TAK779 and AMD3100 are competitive inhibitors of gp120 binding to cellular CCR5 and CXCR4, respectively, and soluble CD4 (sCD4) is a recombinant protein that binds to the CD4 binding site on gp120 (9, 65, 77, 97, 255) T he detection of determinants that contribute to entry [CD4 and coreceptor use] may provide the basis for targets of novel entry inhibitors, especially clinically approved CXCR4 inhibitor that remains elusive. Vaccine Trials Despite the advent of HAART, several million people are dying due to HIV 1 related illnesses and millions more are becoming infected (4) An HIV/AIDS vaccine would have several benefits. In particular, adults and children could be given an HIV/AIDS vaccine before being exposed to HIV, and ideally this would protect them

PAGE 34

34 from all routes of HIV transmission. T he protection offered by a vaccin e during sex would not depend on the consent of both partners (unlike condom use) or require behavior change (unlike abstinence). HIV /AIDS vaccine would also be invaluable for couples wishing to conceive a child while minimizing the risk of HIV transmissio n. Furthermore, vaccinating large numbers of people would probably require relatively little equipment and expertise, and would be much simpler and cheaper than providing antiretroviral treatment for those already infected (5) All potential HIV/ AIDS vaccine must pass three phases of clinical tr ials to be clinically confirmed as s afe and effective ; phase I involves a small number of volunteers to test the safety of various doses, phase II involves hundreds of volunteers to further assess safety and, in some cases, positive responses, and phase II I involves thousands of volunteers to test safety and effectiveness. A recent innovation is the Phase IIb trial, a larger form of the Phase II trial that provides some indication of effectiveness To date three HIV 1 vaccine trials have been tested in Pha se IIb or III. The AIDSVAX vaccine trials. The first vaccine candidate to undergo Phase III trials was called AIDSVAX, which consisted of two separate studies. In one study of 5,400 participants, most were gay American men, while the other study involved around 2,500 injecting drug users in Thailand. The vaccine was made from a single HIV protein and was meant to stimulate a protective antibody response. The trials began in 1998 and 1999 respectively, and ended in 2003 as neither study revealed any benefic ial effect in either population group The STEP and Phambili vaccine trials. The phase IIb STEP and Phambili vaccine trials of a vaccine candidate created by the pharmaceutical company Merck

PAGE 35

35 w ere halted in September 2007 ahead of the scheduled end of the study by 2010. The trials were stopped as researchers found that vaccinees and people who receiv ed the placebo were equally likely to becoming infected The STEP trial had started in 2004 in the USA, Canada, Australia, Peru and the Caribbean; the Phambili trial had begun in J anuary 2007 in South Africa (2) There was also some concern that slightly more HIV infections occurred among vaccinees than among those who took a placebo. T he vaccine was delivered using adenovirus type 5, which causes the common cold and i t has been sugg ested that the vaccine provoked a different immune response amo ng people who already had some immunity to the adenovirus strain, thus making them more susceptible to HIV infection (177) Thus, the results of STEP and Phambili vaccine trials raised questions about the use of adenovirus in future vaccines. Furthermore, i t was also noticed that vaccinated or unvaccinated uncircumcised men we re four times more likely to become infected with HIV (199) suggesting a benefit for circumcision in reducing the risk of HIV transmission. The AL VAC / AIDSVAX vaccine trial. In 2006 AIDSVAX was combined with ALVAC in a phase III vaccine trial with the hope that a trial combining AIDSVAX, which promotes the production of antibodies to HIV, and ALVAC, which is designed to stimulate a cellular respon se to the virus, would prove more effective th an the previous AIDSVAX trial (1, 117) The ALVAC/AIDSVAX vaccine trial was also called the RV144 trial and consisted of 16,402 adults in Thailand. The results were publ ished in 2009 and showed that 74 people who received a placebo became infected w ith HIV, compared to 51 who r eceived the vaccine candidate (197) Rerks Ngarm and colleagues reported a

PAGE 36

36 modest protective effect of the vaccine based on the 31.2 percent in the vaccinees analyzed Although a fully protective vaccine remains elusive the detection of broadly neutralizing antibodies against HIV 1 Env in infected individuals is a proof of principle that the immune system is capable of mounting an effective humoral immune response (247, 258) The development of broadly neutralizing monoclonal antibodies occurs within two years of infection and may retard the progression to AIDS (154) However, tailoring an immune response to Env by stimulating potent antibody production over a long period of time when necessary via vaccination remains unsolved. Broadly Neutralizing Monoclonal A ntibodies HIV 1 Env remains the target of neutralizing antibodies elicited by vaccines despit e the challenges of epitope masking by the glycan shield and the complex trimeric structure (109, 119, 129, 130, 154, 249) A subset of broadly neutralizing monoclonal antibodies previously detected in HIV 1 inf ecte d individuals targets discontinuous Env regions as illustrated in Figure 1 16 (249) B roadly neutralizing monoclonal antibodies that target different Env d omains are used in vitro to probe Env conformation during disease progression as a surrogate means of assessing Env structure and function (36, 66, 94, 164, 179, 267) Furthermore, t he detection of determinants that contribute to entry [CD4 and coreceptor use] and antibody neutralization sensitivity may provide the basis for immunogen des ign in vaccines. Hypothesi s A n ordered developmental program in HIV 1 envelope modulates X4 evolution and expanded host cell range Three specifi c aims were proposed to test this hypot hesi s.

PAGE 37

37 Specific Aims Specific Aim 1: To I dentify Genetic Determinants in HIV 1 Envelope that Confer CXCR4 Dependent Entry into CD4 Expressing Host C ells Genotypic determinants for CXCR4 use, particularl y on macrophages, remain unclear (57, 70, 81) Evolution of CXCR4 using (X4) viruses from the founder CCR5 using ( R5 ) virus population occurs via intermediate R5X4 viruses characteristic of CCR5 and CXCR4 use, and a decreased fitness for entry and coreceptor usage efficienc y (29, 46, 226, 236) Thus, R 5X4 Env elopes (Env s ) are important for studying X4 evolution to ultimately prevent X4 emergence but are understudied due to th e low frequency in infected individuals (30, 236) The goal of this study was to track the genetic and functional evolution of X4 Envs during the natural history of HIV 1 infection using a longitudinal study approac h of eight therapy nave HIV 1 subtype B infected pediatric subject s. The results of specific aim 1 are presented in Chapter 2. Specific Aim 2: To Determine the Role of Envelope Variable 1 (V1) Domain in Modulating Coreceptor U se and /or Target C ell T ropis m Env elope V1 V2 domain has been implicated in modulat ing coreceptor use efficiency and cell tropism (122, 132, 163, 260) Although potential N linked glycosylation sites (PNGs) in envelope ( env ) V1V2 are well establ ished for generating a glycan shield that occlude s antibody neutralization epitopes and entry determinants (103, 189, 205, 208, 244) non PNGs residues have been shown to display similar impacts on Env function (163) Proline residues are typically found in protein turns and i nduce complex architecture s in proteins (14) Yet, the role of Proline emergence in V1 region during disease progression remains undefined. The goal of this study was to determine the role of P roline residue in V1 region on Env function for entry and sensitivity to broadly neutralizing monoclonal antibodies S ite directed mutagenesis

PAGE 38

38 approach was used to assess the role of Proline in V1 on Env functio ns. The results of specific aim 2 are presented in Chapter 3. Specific Aim 3: To A nalyze HIV 1 Env elope Diversity d uring Viral E volution Human immunodeficiency virus type 1 (HIV 1) is comprised of closely related but unidentical viruses or quasispecies (82) HIV 1 Env genetic diversity is amplified as a result of the high nucleotide misincorporation rate by the error prone reverse tra nscriptase, and recombination between different HIV 1 genomes in a coinfected cell (166, 192, 198) Among b ulk PCR amplified genomes (Standard G enotyping), a high frequency of recombinants in subtype C plasma sample s was detected (92) Previous reports sug gested that Standard Genotyping (StdG), unlike Single Genome Amplification (SGA ) magnified the frequency of in vivo recombinants (170, 210) contrary to a recent report by Jordan and colleagues (110) The current study was designed to comparatively assess e nv diversity in the context of recombinants using StdG and SGA generated sequences The results of the current study will validate the use of StdG for amplif ication of e nv variants used in studies that evaluated genotypic and functional X4 evolution The results of specific aim 3 are presented in Chapter 4. Significance E volut ion of CXCR4 use and an expanded host cell range may provide challenges for CCR5 based therapies and open avenues for the ability of a fi tness advantage for the virus Thus, u nderstanding the natural history of X4 evo lution is important for studying the de velopmental program in envelope that modulates CXCR4 use. The developmental program in envelope that modulates CXCR4 use may provide the basis for the development of novel therapies to delay the progression to AIDS ; d eterminants of CXCR4 use and function m ay provide targets for immunogen design in novel

PAGE 39

39 vaccines and for the development of novel CXCR4 inhibitors The longitudinal approach using therapy nave samples from multiple subjects facilitated a detailed assessment of X4 evolution and Env diversity du ring the natural history of HIV 1 infection

PAGE 40

40 Figure 1 1. Estimate d Number of Individuals Living w ith HIV in 2009. The total number is estimated to be 33.3 (31.4 35.3) million according to th e World Health Organization (WHO). Figure was tak en from reference (4) Figure 1 2. Estimated Number of New HIV I nfections in 2009. The total number is estimated to be 2.6 (2.3 2.8) million according to the World Health Organization (WHO). Figure was taken from reference (4) Figure 1 3. Estimated Number of HIV/AIDS Related D eaths in 2009. The total number is estimated to be 1.8 (1.6 2.1) million according to the World Health Organization Figure was taken from reference (4)

PAGE 41

41 Figu re 1 4. Map showing the global distribution of diverse HIV subtypes (represented by single letter codes) and circulating recombinant forms (CRFs). Figure obtained from reference (209)

PAGE 42

42 Figure 1 5 Organization of HIV 1 Genome a nd Position in Virion P article. Two identical long terminal repeats (LTR) flank the viral genome T he main genes gag, pol, and env encode structural, enzymatic and coat proteins, respectively. A ccessory genes vif, vpr, vpu, tat, rev and nef encode regu latory proteins Figure source: http://hiv aids health.blogspot.com/2008_08_01_archive.html

PAGE 43

43 Figure 1 6 HIV 1 Life Cycle. CD4 and sequential CCR5/CXCR4 interaction facilitates fusion of viral and cellular membranes and initiates a multistep viral lif e cycle; reverse transcription, integration, translation, budding and maturation The multiple steps involved in viral replication and c urrent therapies that target specific steps are shown ; current therapies inhibit viral binding, fusion, reverse transcri pti on, integration and maturation. Figure was obtained from reference (188)

PAGE 44

44 Figure 1 7. HIV A tail. Transcription and splicing of the RNA genome result in multiple transcripts that produce viral proteins. Fi gure was obtained from reference (33)

PAGE 45

45 Figure 1 8 Schematic Representation of HIV 1 Entry into Host C ells HIV 1 Envelope mediates a complex multistep process of viral e ntry facilitated by conformational changes in Env gp120 and gp41 by sequential CD4 and coreceptor interactions Figure was obtained from reference (240) Figure 1 9 HIV 1 Coreceptors: CCR5 and CXCR4. HIV 1 mainly uses one or both seven transmembrane G protein coupled receptors CCR5 and CXCR4 as coreceptors to mediate entry into CD4 expressing cells Figure source: http://www.thebody.c om/content/art38292.html].

PAGE 46

46 Figure 1 10 Natural History of HIV 1 I nfection X4 evolution from founder R5 virus es is associated with advanced stage disease which is characterized by CD4 T cell d ecline and viral load rebound Opportunistic infections and AIDS subsequently develop. Figure was obtained from reference (204)

PAGE 47

47 Figure 1 11 HIV 1 E nvelope Genome. HIV 1 env encodes determinants that cooperatively regulate viral entry; gp120 mediates CD4 and coreceptor interaction and gp41 mediates fusion of viral and cellular membranes. Figure was generated in PowerPoint. Fig ure 1 12 Model of Virion A ssociated HIV 1 Env elope Functional H IV 1 exists as a homotrimer of gp120 /gp41 heterodimer. Gp120 surface protein is non covalently linked to membrane bound gp41 Figure shown is a modification of figure obtained from reference (249)

PAGE 48

48 Figure 1 13 .Proposed Model for gp120/g41 Trimers. (A) A trimer in the unliganded conformation, viewed from outside the virion towards gp41. The polypeptide ch ain backbones are in ribbon representation; N linked glycans are stick models; deleted V1 V2 and V3 segments are transparent balloons. The three monomers are in red, green and blue, respectively; the sugars, in grey. gp41 is shown as a circle in the rear. (B) The same view of a gp120/gp41 trimer as in panel A but in the CD4 bound conformation, generated by superposing the CD4 bound HIV gp120 structure onto the unliganded SIV gp120 subunits in panel A. The CD4 binding loops were shown as yellow ribbons, and g p41 as a cylinder at the bottom of each panel. Figure shown is a modification of figure obtained from reference (38)

PAGE 49

49 Fig ure 1 14 Classification of Envelope Phenotypes. Coreceptor use and tropism are used to define viral phenotype; L R5, M R5, D R5X4, D X4, and T X4. Figure was obtained from reference (83)

PAGE 50

50 Figure 1 15. HIV dual infection of a cell, heterozygous virion formation and recombination. Figure obtained from reference (209)

PAGE 51

51 Figure 1 16. Anti HIV 1 Envelope Broadly Neutralizing Monoclonal Antibodies. Env domains encode antibody neutralization epitopes, some of which are discontinuous. Figure was obtained from reference (249)

PAGE 52

52 CHAPTER 2 DISCONTINUOUS GENETI C DETERMINANTS IN HI V 1 S UBTYPE B R5X4 ENVELOPES MODULATE CXCR4 DEPENDE NT ENTRY AND PREFERE NTIAL CCR5 USE ON HOST CELLS Introduction Co receptor use and host cell tropism defines Human Immunodeficiency Virus Type 1 (HIV 1) Envelope (Env) phenotype (83) Early founder R5 viruses efficiently infect CD4 T lymphocytes [L R5] in con trast to macrophages [M R5] (25, 105) M R5 viruses emerge during disease progression, which is associated with X4 evolution in more than 50% of infected individuals (72) X4 viruses mediate entry into CD4 T lymphocytes and macrophages using CXCR4 alone [D X4] or in combination with CCR5 [D R5X4]. X4 Envs from late stage disease viruses can mediate entry via CXCR4 into CD4 T lymphocytes and T cell lines [T X4], but appear t o have lost the ability to use CXCR4 on macrophages. While CCR5 use facilitates founder virus infection, evolution of CXCR4 use is a biomarker for disease progression. Although Env V3 loop encodes the principal det erminants for coreceptor use (15) non V3 Env determinants clearly play a crit ical role in coreceptor use (159) Coreceptor use by M R5 and T X4 Envs map to the Env V3 loop (230) In contrast, determinants for CXCR4 use by D R5X4 and D X4 Envs, especially among macrophage tropic viruses are discontinuous and not re stricted to V3 loop (57, 70, 81) Bioinformatics approach provide s tools for inferring Env coreceptor phenotype (25, 235) especially for in depth analys is of Env variants (8, 30) but analyses are limited to the genetic features of the V3 loop. Overall, current bioinformatic tools that infer core ceptor phenotype fail to evaluate complex non V3 Env determinants that regulate coreceptor use and cell tropism during X4 evolution.

PAGE 53

53 X4 evolution occurs during disease progression with a high frequency among subtype B HIV 1 (72) but the kinetics and mechanis ms are controversial (17, 151, 229) While R5 viruses predominantly infect effector memory CD4 T cells, X4 emergence expands host cell range to include infection of centr al memory CD4 T cells (63) Thus, X4 emergence prior to CD4 T cell decline during disease progression may contribute to loss of a larger population of CD4 T cells and ac celerate rapid onset of AIDS (24) Additionally, increased susceptibility to neutralizing antibodies by X4 viruses may contribute to X4 evol ution after immune collapse (196) R5X4 viruses are intermedi ates of X4 evolution (144, 236) R5X4 viruses are present in low frequency and appear to be transient (30) which may be reflective of a fitness valley in the evolutionary landscape as R5X4 viruses are typically less fit for entry and coreceptor use efficiency in compari son to R5 or X4 viruses (46, 226) R5X4 Envs display distinct preferences for CCR5 or CXCR4 use to mediate ent ry into indicator cells (101, 104) CD4 T lymphocytes in peripheral blood express CCR5 or CXCR4, and in s ome cases both, but CXCR4 is expressed on a larger p ercentage of cells than CCR5 (23) Thus, R5X4 Envs can us e CCR5 on CD4 T lymphocytes (143) but prefer ential CXCR4 use on CD4 T lymphocytes is predominant among R5X4 Envs (144, 262) Env structural modeling tools provide insights into a potential role of V 3 and non V3 determinants in modulating viral entry (38, 130, 205) Env conformational changes resulting from V1V2 and V3 rearrangement upon CD4 binding provides access to the bridging sheet that forms the coreceptor binding site (38, 130) While V3 plays a central role in virus coreceptor interaction, V1V2 mediates coreceptor use efficiency and host

PAGE 54

54 cell tropism (122, 132, 168) Additionally, V1V2 and V3 encode epitopes for neutralizing monocl o nal antibodies (47, 128, 184, 247) Thus, immune evasion strategies by Env may induce conformational changes that impact entry effic iency and host cell tropism (39) Lack of a crystal structure of full length trimeric gp120 limits full understanding of the role of dif ferent Env domains in altering coreceptor use and host cell tropism, but molecular genetics approaches are used to map determinants of viral entry a nd cell tropis m (57, 81, 144, 163) The evolutionary process of X4 emergence that occurs in some but not all infected individuals remains unclear, and implicates th e role of host cell factors (159) and complex developmental programs of organized genotypic changes i n Env not limited to V3 (172, 211) The current study wa s designed to track genotypic and functional X4 evolution during the natural history of HIV 1 infection. Bioinformatics and phylogenetics tools were used to predict X4 genotype and the kinetics of X4 evolution. X4 phenotype was verified by function and a m echanism for CXCR4 use was assessed using inhibitory agents that probe Env efficiency for discrete steps in entry. The longitudinal approach using samples from a group of therapy nave subjects facilitated a detailed assessment of X4 evolution via genotypi c and functional analyses of Env coreceptor use and host cell tropism during the natural history of HIV 1 infection. Materials and Methods Subjects The study included 8 HIV 1 infected subjects with longitudinal peripheral blood samples prospectively coll ected over 3 to 8 years prior to treatment with combination antiretroviral therapy. Subjects were recruited into the study at the University of Florida within the early period of the HIV/AIDS epidemic, 1980s to early 1990s, when

PAGE 55

55 combination antiretroviral therapy (ART) was unavailable for pediatrics after obtaining informed parental consent using a protocol approved by the University of Flori da Institutional Review Board. Six subjects were perinatally infected by maternal transmission (S1, S2, S3, S5, S6, S 8) and 2 were infected in 1983 as newborns by an HIV 1 contaminat ed blood transfusion (S4, S7). Samples were obtained within 1 year of infection for 5 subjects, while for 3 subjects the earliest samples were collected after about 3, 5 or 6 years of infecti on. A total of 831 env sequences from all subjects across 45 longitudinal timepoints w as evaluated; for each subject, about 60 to 170 Env sequences in plasma and peripheral blood cells over 4 10 timepoints were analyzed CD4 T cell percent (CD4%) was used as a clinical marker for disease progression with CD4 below 15% indicative of advanced stage disease (114) Seven subjects had CD4 above 15% for the earliest timepoint, while one subject (S2) had ~15% for the earlie st timepoint, which was within 1 year of infection (F igure 2 1). Seven subjects displayed steady CD4 decline to below 15%, while one subject (S8) displayed only transient CD4% decline to ~15% overtime. Samples 1.5 kb V1 V5 region of HIV 1 envs were amplifi ed from peripheral blood mononuclear cell (PBMC) DNA or plasma RNA, cloned into Topo TA vector (Invitrogen, Carlsbad, CA), and sequenced as previously described (80, 242) Nucleotide sequences were translated into a mino acid sequences for each subject and aligned using our motif base alignment method (133) in the Bioedit sequence alignment edito r program according to HIV 1 HXB2 reference en velope (126)

PAGE 56

56 Coreceptor U se P rediction CCR5 or CXCR4 coreceptor use based on the genotypic features of V3 loop (residues 296 to 331 in HIV HXB2 genome) was predicted for each envelope sequence using bioinformatics (25, 78, 107) CCR5 using Envs were designated as R5 and CXCR4 using Envs designated as X4. Position specific scoring matrix (PS SM) further classifies Envs as intermediate R5 (IMR5) or intermediate X4 (IMX4) based on the PSSM score and amino acid residues at position 11 or 25. R5 Env have a PSSM score < 6.88, X4 > 2.88, and IMR5 and IMX4 between 6.88 and 2.88. IMR5 Envs lack R/K at position 11/25, while IMX4 Envs encode R and/or K a t position 11/25 in V3 loop (107) Phylogenetic A nalysis Env evolution was inferred by phylogenetic trees, which were created using env V1 V3 nucleotide sequ enc es, as previously described (92) Putative recombinants among the population of sequences within each individual, ide ntified u sing the PHI NNet algorithm (212) were removed from each intrahost sequence dataset prior to construction of phylogenetic trees. Additionally, a pilot study of PCR based method of genome amplification via standard genotyping and single genome amplification detected a similar frequency of recombinants in HIV 1 viral quasispecies, suggesting that standard genotyping and single genome amplification detect similar population diversity in HIV 1 quasispecies in agr eement with a recent report (110) Phylogenetic trees and the 95% confidence intervals of the most recent common ancestor for the predominant X4 lineage were computed using Bayesian coalescent framework implemented using the BEAST software package 1.5 with relaxed molecu lar clock and a general time reversible model of nucleotide substitution with gamma distributed rate var iation across sites (GTR+G) (92) The maximum clade credibility (MCC) tree was

PAGE 57

57 selected from the posterior tree distribution using the program TreeAnnotator version 1.5 and visualized in FigTree 1.3.1. Programs are described and available for download at http://tree.bio.e d.ac.uk. Cells Leukopaks of whole peripheral blood mononuclear cells [PBMC] screened for blood borne pathogens were obtained from healthy donors from the Civitan Regional Blood Center in Gainesville, Florida, through a protocol approved by the Institutiona l Review Board of the University of Florida. PBMCs were isolated from leukop aks as previously described (176) All medium components for cell culture were obtained from Gibco BRL Invitrogen (Car lsbad, CA) except whe re noted. PBMCs were cultured in supplemented with 10% fetal bovine serum (FBS), Penicillin Streptomycin solution (0.1 mg/ml), and human interleukin 2 (40 U/ml). PBMCs in culture phytohemagglutinin (PHA)/ml for 72 h ours prior to HIV 1 infection. Elutriated monocytes from healthy HIV negative/hCMV negative donors were obtained from Dr. Howard Gendelman (Nebraska Medical Center, Omaha, NE, USA) under protoco ls approved by the Institutional Review Boards at the University of Nebraska (Omaha, NE, USA) and the University of Flo rida (Gainesville, FL, USA) (84) Elutriated monocytes were differentiated into macrophages as previously described (26) Human embryonic kidney (HEK) 293T cells (American Type Culture Collection, Manassas, VA) or Tzm bl cells (JC53 bl cells) obta ined from the NIH AIDS Research an d Reference Reagent Program (185) were cultured in DMEM supplemented with 10% FBS, Penicillin Streptomycin solution (0.1 mg/ml), L Glutamin (2 mM) and sodium bicarbonate (0.05%). U87 cells stably transduced with human CD4 and eith er CCR5 or CXCR4 were obtained from the

PAGE 58

58 NIH AIDS Research a nd Reference Reagent Program (20) and cultured in DMEM supplemented with 15% FBS, Penicillin Streptomycin solution (0.1 mg/ml), puromycin Envelope C onstructs and Virus P roduction Env V1 V5 amplicons were cloned into HIV 1 JRFL(gp160) env encoded in the pcDNA3.1 vect or, as previously described (81) a strategy that maintained a constant gp41 across all Envs and focused results of functional analysis to Env gp120. Luciferase gene tagged pNL4 3.Luc.R + E virus was pseudotyped in trans with envelopes encoded by the env constru cts as previou sly described (80) Virion production in supernatant from transfected 293T cells was confirmed via p24 detection by an in house antigen enzyme linked immunosorbent assay with rabbit polyclonal p24 antibody (NIH AIDS Reagent and Reference Program, DAIDS, NIAID). Viruses were further quantified for infectivity using a modified protocol of an endpoint dilution titration assay on Tzm bl cell lines for Env pseudotyped viruses (140) Serial fourfold dilutions of pseudovirus were made in quadruplicate wells in 96 well culture plates, 10,000 Tzm bl cells were added to each well, and the plates were incubated for 48 hours at 37C and 5% CO 2 Cells were washed once with 1X phosphate buff ered saline (PBS), lysed in 1X cell culture lysing reagent (CCLR) (Promega, Madison, WI), luciferase assay performed using a luciferase assay system (Promega, Wisconsin, MI), and luminescence in each well quantified using a microplate luminometer (BD Pharm ingen Monolight 3096). Numbers of positive and negative wells above mock infected cells were used to calculate the virus titer using the Spearman Karber formula. Wells producing relative luminescence unit (RLU) activity 1.5 times greater than endogenous lu ciferase activity in mocked infected Tzm bl cells were scored as positive. Virus titers were reported as

PAGE 59

59 tissue culture infectivity dose 50 (TCID 50 /ml), and a standard amount of infectious virus was used for infe ction on U87 cell lines (41, 206) Standard R5 (R5 J JRFL ) and X4 (X4 L LAI and X4 M MM) Envs were used as reference CCR5 and CXCR4 tropic Envs. Immunoblot A ssays 48 hours post transfection of 293T cells with env construct, cells were washed twice with co ld phosphate buffered saline (1X PBS), and immediately lysed in ice cold lysis buffer (20 mM Tris HCl, pH 7.5; 150 mM NaCl; 1mM Na 2 EDTA; 1mM EGTA; 1% glycerophosphate; 1 mM Na 3 VO 4 ; 1 ng Technology, Danvers, MA). Whole cell lysates were extracted and centrifuged at 13,000 rpm for 2 minutes at room temperature. Protein concentrations of cell extracts were determined by the BCA protein assay (Bio Rad, Hercules, CA). Aliquots of cell extra cts containing 25 50 g of total proteins were diluted mercaptoethanol, resolved on 4 20% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE) and transferred to PVDF memb ranes (Bio Rad, Hercules, CA). Mem branes were blocked with 5% milk in TBST (20 mM Tris, pH 7.5, 500 mM NaCl, 0.5% Tween 20) for two hours at room temperature and probed with anti sheep polyclonal gp120 antibody (AIDS Reagent and Reference Research Program) or mouse anti actin (Santa Cruz Biotechnology), followed by anti sheep IgG HRP (R & D Systems, Minneapolis, MN) or anti mouse IgG HRP (Cell Signaling Technology). Horseradish peroxidase activity was visualized through enhanced chemiluminescence detection (SuperSignal West Dura Extended Duration Substrate; Thermo Scientific, Rockford, IL) followed by exposure to CL Hyperfilm (Amersham Biosciences, Buckinghamshire, UK). Density (ImageJ) of individual bands was normalized to actin for each lane. Env pseudotyped viruses

PAGE 60

60 quantified for p24 co ncentration and TCID 50 /ml were assessed for Env gp120 incorporation via immunoblot assay. 293T cell supernatant containing 40 ng of Env pseudotyped virus was assessed for Env gp120 detection as described above. Membranes were probed with anti sheep polycl onal gp120 antibody (AIDS Reagent and Reference Research Program) or mouse anti p24 (Santa Cruz Biotechnology), followed by anti sheep IgG HRP (R & D Systems, Minneapolis, MN) or anti mouse IgG HR P (Cell Signaling Technology). Density of individual bands w as normalized to respective p24 for each lane. Virus I nfections U87CD4 CCR5 and U87CD4 CXCR4 indicator cells (20) were seeded in 48 well plates at 1.5 x 10 5 cells per well overnight. Twenty five TCID 50 of virus was added to duplicate or triplicate wells and incubated for 24 hours prior to complete media change. Cell cultures were assessed for infection by measuring luciferase enzyme activity (relative luminescence units RLU) in cell lysates at 48 hours post infecti on. PBMCs were seeded in 96 well plates at 2 x 10 5 cells per well. Fifty TCID 50 of virus was added to duplicate or triplicate wells and incubated for 24 hours prior to complete media change. Cell cultures were assessed for infection by measuring RLU in cel l lysates at 72 hours post infection. MDMs were seeded in 48 well plates at 2.5 x 10 5 cells per well. Two hundred TCID 50 of virus was added to duplicate or triplicate wells and incubated for 24 hours prior to media change (100%). Cell cultures were assesse d for infection by measuring RLU in cell lysates at 96 hours post infection. For all infections, cells were incubated at 37 o and 5% CO 2 Cell cultures were washed once with 1X PBS and lysed with cell culture lysing reagent (1X) prior to RLU measurements. C oreceptor inhibitors used to assess entry into PBMC and MDMs were AMD3100 (a competitive antagonist

PAGE 61

61 of CXCR4) (Sigma Aldrich, St. Louis, MO; AIDS Research and Reference Reagent Program) (97) and TAK779 (a competitive antagonist of CCR5) (AIDS Research an d Reference Reagent program) (9) Primary cell infections were performed on 2 3 independent PBMC and MDM donors. Inhibition S tudies Inhibition of viral infectivity was performed on U87CD4 CCR5 and U87CD4 CXCR4 indicator cells (20) with increasing concentrations of antibodi es and small molecule inhibitors to determine the 50% inhibition constant (IC 50 ). Anti V3 loop monoclonal antibody 447 52D, recombinant protein sCD4, and small molecule inhibitors Maraviroc (CCR5 inhibitor), AMD3100 (CXCR4 inhibitor) and T20 (gp41 inhibito r) were obtained from the AIDS Research and Re ference Program (71, 77, 86, 97) All inhibition reagents wer e prepared in serum free DMEM. sCD4, 447 52D and T20 were incubated with 25 TCID 50 of virus and incubated at 37 o and 5% CO 2 for at least 1 hour prior to addition to cells. Maraviroc and AMD3100 were incubated with U87CD4 CCR5 or U87CD4 CXCR4, respectively, at 37 o and 5% CO 2 for at least 1 hour prior to addition of 25 TCID 50 of virus. Viral infectivity was determ ined by RLU amounts measured in infections performed in the absence and presence of inhibitors. Statistical analysis Comparison of R5 and R5X4 Envs based on sensitivity to different concentrations of inhibitory agents (sCD4, 447 52D, Maraviroc, and T20) was performed using a two way ANOVA. Paired t test was performed to compare the IC 50 s for each inhibitory agent across separate assays; IC 50 s of each R5 Env was compared to each R5X4 Env. onships between p24 concentration and infectious titer of different batches of virus stocks. Analyses were

PAGE 62

62 performed with GraphPad Prism 5.0 software (La Jolla, California, USA), and statistical significance was considered when p value was less than 0.05. Results X4 evolves prior to CD4 T cell decline Coreceptor use during disease progression was inferred based on the genetic features of the V3 loop, while CD4% charts were annotated for points when CD4% initiated decline [inflection point] or were less t han 15%, a level used to define onset of ad vance stage disease (114) (Figure 2 1 ). In two subjects S1 and S8, envelopes predicted to use CXCR4 were undetectable despite CD4 T cell decline below 15% (Figure 2 1G) and to levels fluctuating between 15 20% (Figure 2 1 H ) respectively In contrast, predicted X4 genotypes were detected in six additional subjects (Figure 2 1 A F). Apparent timing of X4 emergence relative to length of infection or CD4 T cell decline to <15% w as variable. In S5 and S3, X4 viruses were detected within the first 1.5 years of infection, whereas X4 viral genotypes in subjects S6, S4, S2 and S7 were observed only after 3 to 12 years of infection. X4 envelopes were detected prior to the CD4% inflecti on point in 4 subjects (S6, S4, S5 and S3). In two subjects S2 and S7, X4 envelopes appeared to emerge only after CD4 T cell decline. Overall, bioinformatic tools revealed that X4 emergence appeared prior to CD4 T cell decline in 4 of 6 subjects. Independe nt of timing of X4 emergence, R5 viruses persisted throughout infection and coexisted with X4 variants for years. Phylogenetic methods provide an alternative approach for making inferences for the kinetics of X4 evolution While bioinformatic algorithms r ely on viral samples collected overtime to predict X4 emergence, phylogenetic tools use longitudinal samples to reconstruct the temporal

PAGE 63

63 history of X4 evolution and is not limited by sample availability (92) Phylogenetic trees calibrated by time reconstructed the genealogy of HIV 1 Envs in each subject using longitudinal env V1 V3 sequences and PSSM inferred Env coreceptor genotype (Figure 2 2). Of the six subjects with X4 viruses, R5 viruses predominated in the population at the earliest timepoint in four subjects (S6, S4, S2 and S7) and represented the most recent common ancest or for X4 genotypes (Figure 2 2 A D). In two subjects S5 and S3, R5 and X4 viruses were present at the earliest timepoints, within 2 months to 1 year post infection (Figure 2 2 E F). In S3, branch depth on the phylogenetic tree for the most recent common ancestor of X4 viruses dated to time before inf ection, suggesting a rare occurrence of X4 transmission and infection (102) In S5 where the initial Env samples were amplified one year post infection (Figure 2 2 E), R5 Envs clustered closest to the root of the tre e and were inferred as the MRCA for X4 Envs using Bayesian methods (92) The phylogenetic trees were annotated for CD4% inflection point, CD4 T cell decline (<15%) and 95% confidence interval (CI) for the timing of the most recent common ancestor (MRCA) for the predominant X4 lineage. In general, X4 emergence via phylogenetics approach was consistent with bioinformatics X 4 emergence occurred prior to the 95% CI of the MRCA for the predominant X4 lineage i n S6, S4, S5 and S3 (Figure 2 1 A, B, E, F). In S2, bioinformatic method indicates that X4 genotypes were detecte d post CD4% decline (Figure 2 1 C) However, the origin of b ranches on the phylogenetic tree that represent s the MRCA for X4 viruses in subject S2, as indicated by the 95% CI for the MRCA of the X4 lineage were located at time points prior to CD4% decline (F igure 2 2C), implicating X4 evolut ion prior to CD4% decli ne. In S7 the

PAGE 64

64 deep lineages during 6 10 years post infection that gave rise to initial X4 viruses at about 12 years of infection, suggest that X4 viruses could have emerged prior to CD4% decline between at 9 years of i nfection ( Figure 2 2D). Using the 95% CI for the MRCA of the predominant X4 viruses and the timepoint of CD4% decline below 15%, p hylogenetics expands the number of subjects with X4 emergence prior to CD4% decline to at least 5 subjects (Table 2 1), in contrast to 4 of 6 detected via bioinfor matics. Independent of the timing of X4 evolution, R5 and X4 Envs coevolved on separate lineages of the phylogenetic trees (F igure 2 2 A F). Additionally, in S1 and S8, exclusive R5 Envs that persisted during disease progression evolved on m ultiple lineages over time (Figure 2 2 G H). Overall, there was a temporal pattern of Env coreceptor genotype evolution and persistent R5 evolution independent of X4 emergence. V3 genotype alone is insufficient to confer X4 phenotype, especially in combination with R5 [R5X 4] Env coreceptor use was further assessed by V3 genotype using the net charge of the V3 loop and 11/25 rule, in addition to PSSM, for a subset of twenty eight Envs from five subjects that were analyzed based on genotype using PSSM alone to evaluate X4 p henotype and kinetics of emergence in Figures 2 1 and 2 2 (Table 2 2). Coreceptor use by the subset of 28 Envs was tested directly by V1 V5 function to mediate entry by single cycle pseudotyped viruses into U87 indicator cells engineered to express CD4 an d CCR5 or CXCR4 (Table 2 2). All envelopes predicted to use R5 were functionally R5, independent of V3 loop net charge. Charge less than 5 is a consistent feature of R5 Envs (25) i n agreement with Env 2.1 from S2. However, exclusive R5 was also associated with net charge equal to 5. X4 prediction of viruses

PAGE 65

65 was less reliable as some predicted X4 viruses used both CCR5 and CXCR4, indicating that V3 loop alone was insufficient to accu rately predict exclusive CXCR4 use. Additionally, i ntermediate R5 or X4 Env predictions by PSSM in some cases indicated use of both CCR5 and CXCR4 for function. Virus infectivity is associated with Env quantity Single cycle pseudotyped viruses titered f or infectivity were used to measure entry into U87CD4 CCR5 and U87CD4 CXCR4 indicator cells and host cells. Non functional viruses that failed to mediate entry into U87 indicator cells incorporated gp120 qualitatively similar or better than func tional vir uses (Figure 2 3A), indicating that Env expression alone is insufficient to infer functionality of Envs. Quantitative gp120 incorporation into functional viruses was assessed on standard amounts of infectious viruses (Figure 2 3B). Incorporation of gp120 i nto virions was associated with virus titer for infectivity (F igure 2 3B). Additionally, virus titer was not significantly impacted by varying the amount of env and pNL4 3Luc + R + E constructs during 293T cotransfection (not shown). The nature of Envs such a s the conformation and glycosylation features may have impacted gp120 d isplacement through the gel (52) and dual protein bands may be reflective of processed gp120 and unprocessed gp160 that are potentiall y incorporated into virions (252) Figure 2 3C illustrated that infectious titer varied across p24 concentration and infectious titer across a ll viruses yielded a R 2 value of 0.006, indicative of an independent correlation between p24 concentration and infectious titer. The amount of gp120 incorporated into functional viruses modulates infectious titer, but Env functionality was not limited to g p120 incorporation into virions.

PAGE 66

66 Coreceptor phenotype on indicator cells and CD4 T lymphocytes is generally consistent Individual Envs were functionally analyzed for CD4 T cell tropism and coreceptor use using peripheral blood mononuclear cells (PBMCs) PBMCs include CD3CD4 T cells that typically express either CCR5 or CXCR4, and to a lesser extent both CCR5 and CXCR4. CXCR4 expressing CD3CD4 T lymphocytes are present at a higher frequency than CCR5 expressing CD3CD4 T lymphocytes in PBMCs (23) Due to the heterogeneity in HIV 1 coreceptor expression on different CD4 T cell subsets in PBMCs, coreceptor antagonist molecules were used to define Env coreceptor use. Entry in the presence of a coreceptor antagonist was set at 20%, because Env pseudotyped viruses that mediated <20% entry in the presence of a coreceptor antagonist failed to mediate entry in the presence of a higher concentration of that antagonist, or at the same concentration of antagonist on PBMCs from an independent donor (not shown). Tropism and coreceptor use on CD4 T lymphocytes was evaluated for representative Envs from four subjects that displayed R5, R5X4 and X4 phenotypes on U87 indicator cells. In one case, Env 5.2 (S5) mediated entry into U87 cells via CCR5 and CXCR4, but used CXCR4 exclusively on CD4 T cells (F igure 2 4D). In contrast, coreceptor use on CD4 T cells by other Envs from all four subjects was similar to coreceptor phenotype determined by U87 cell entry assays (F igure 2 4). Thus, E nv phenotype on indicator cells was sufficient to define Env functionality for entry and coreceptor use on CD4 T cells. Since macrophages serve as the natural hosts for lentiviruses and are potential reservoirs, we next sought to examine macrophage tropism and coreceptor use using representative CCR5 and CXCR4 using Envs.

PAGE 67

67 Coreceptor use alone fails to infer macrophage tropism CD4 T cell tropic Envs that use CCR5 alone (R5) or in combination with CXCR4 (R5X4) from S2 were used to evaluate tropism on monocyte derived macrophages (MDMs). Although most R5 viruses are macrophage tropic, not all are (87) because viral tropism for MDMs requires efficient use of lower levels of CD4 and coreceptor expression (12, 239) Figure 2 5A illustrated that R5 Envs from subject S2 fail ed to mediate entry into MDMs based on our cutoff for entry at three standard deviations above mock infection. MDMs are heterogeneous cell populations consisting of CCR5 + and/or CXCR4 + cells (137) Thus, coreceptor antagonist mol ecules were used to determine Env coreceptor use on MDMs. R5X4 Envs from subject S2 mediated entry into MDM s almost exclusively via CCR5 (Figure 2 5B). The phenotype of exclusive CCR5 use on MDMs despite CCR5 and CXCR4 use on CD4 T cells was a unique pheno type of R5X4 Envs. Discontinuous determinants outside of V3 potentially contribute to X4 evolution and macrophage tropism V1 V5 region of R5 and R5X4 env sequences from S2 that displayed differences in coreceptor use and cell tropism (F igure 2 4 and 2 5 ) were aligned to each other to identify genetic signatures that may confer X4 evolution and macrophage tropism (F igure 2 6). Amino acid sequences were annotated for potential N linked glycosylation site s (PNGs), residues that alter coreceptor use and/or c ell tropism, residues that form the bridging sheet for coreceptor binding, and epitopes for broadly neutral izing monoclonal antibodies (68, 69, 81, 90, 130, 218, 220, 247, 265) Independent of coreceptor use, Envs e ncoded specific amino acid residues dispersed across V1 V5

PAGE 68

68 domains that may alter coreceptor use, cell tropism, PNGs, and sensitivity to broadly 4 7 binding site in the V2 do main (165) 4 7 for efficient viral entry by CCR5 and CXCR4 using Envs. Although C3 V5 encodes entry determinants and antib ody neutralization epitopes (183) minimal env specific genetic differences were detected in C3 V5 In general, genetic differences between R5 and R5X4 Envs were localized to V1V2 and V3 amino acid pos itions 146 195 ( V1V2 ) and 300 342 ( V3 ), suggesting a role for V1V2 in modulating X4 evolution and macrophage tropism. Complex developmental program in Env modulates X4 evolution and macrophage tropism Since discontinu ous determinants in Env impact corece ptor genoty pe and cell tropism (57, 70, 81) R5 and R5X4 Envs from S2 were used to assess mechanisms of X4 genotype and macrophage tropism via dose dependent inhibition experiments with well defined broadly n eutrali zing monoclonal antibody and entry inhibitors. We sought to investigate genetic differences in V1V2 and V3 betw een R5 and R5X4 Envs that may change Env conformation and facilitate X4 evolution and macrophage tropism. Figure 2 7 illustrated the sensitivity of R5 and R5X4 Envs to inhibi tory agents on U87CD4 CCR5 (Figure 2 7A ) and/or U87CD4 CXCR4 cells (Figure 2 7B), and the IC 50 values were reported in Table 2 3. Sensitivity to sCD4 was used as a probe for ef ficient Env CD4 interaction (267) In general, R5X4 Envs displayed increased sensitivity to sCD4 inhibition compared to R5 Envs on U87CD4 CCR5 cells, indicative of increased access to CD4 binding site (F igure 2 7A). R5X4 Envs displayed similar sensitivity to sCD4 on U87CD4 CCR5

PAGE 69

69 (F igure 2 7A) and U87CD4 CXCR4 (F igure 2 7B), suggestive of similar CD4 use on both cell lines and/or an intrinsic nature of R5X4 Envs for CD4 binding site exposure. Sensitivity to 447 52D was used as a probe for the exposure of Env V3 loop (236) In contrast to R5X4 Envs, R5 Envs failed to achieve 50% inhibition on U 87CD4CCR5 52D (F igure 2 7A). R5X4 Envs similarly achieved 50% 52D on U87CD4 CXCR4 (F igure 2 7B), suggesting an intrinsic nature of R5X4 Envs for V3 loop exposure that may contribute to efficien t coreceptor interaction. To assess coreceptor use efficiency of R5X4 relative to R5 Envs, Maraviroc (CCR5 inhibitor) and AMD3100 (CXCR4 inhibitor) were used to investigate efficiency of CCR5 and CXCR4 use, respectively (46, 233) Overall, R5X4 Envs displayed lower sens itivity to Maraviroc relative to the R5 Envs on U87CD4 CCR5 cells (F igure 2 7A), suggesting that R5X4 Envs used CCR5 more efficiently than R5 Envs. R5X4 Envs displayed different sensitivity to AMD310 0 (F igure 2 7B), suggesting that R5X4 Envs may use CX CR4 with different efficiency. Overall, differences in sensitivity to Maraviroc and AMD3100 among R5X4 Envs suggest differences in CCR5 and CXCR4 use efficiency, but the R5X4 Envs studied displayed more efficient CCR5 use relative to R5 Envs. Sensitivity to T20 (fusion inhibitor) was used to investigate viral fusion efficien cy (240) In general, R5X4 Envs displayed lower sensitivity to T20 relative to the R5 Envs on U87CD4 CCR5 cells (F igure 2 7A), suggesting that R5X4 Envs were more efficient for fusion relative to R5 Envs. Furthermore, R5X4 Envs displayed a higher magnitude in sensitivi ty to T20 on U87CD4 CCR5 compared to U87CD4 CXCR4 cells (F igure 2 7B).

PAGE 70

70 Efficient CD4 and/or CCR5 use by R5X4 Envs may result in reduced timing and exposure of gp41 peptide during fusion, thus requiring more T20 for inhibition on U87CD4 CCR5 relative to U87 CD4 CXCR4 cells. Thus, increased fusion efficiency by R5X4 relative to R5 Envs may be a cumulative effect of multiple steps in entry. Table 2 3 summarized the average IC 50 values from multiple assays for inhibitory agents tested against R5 and R5X4 Envs. While statistical significance was only achieved between R5 and R5X4 Envs for IC 50 of Maraviroc ( p value<0.05, paired t test), R5 and R5X4 Envs displayed significant differences for sensitivity to individual concentrations of sCD4, 447 52D, Maraviroc and T 20 (F igure 2 7A) ( p value<0.05, two way ANOVA). Results suggest potential differences between R5 and R5X4 Envs that may contribute to X4 evolution and/or macrophage tropism.

PAGE 71

71 Figure 2 1. Natural history and evolution of HIV 1 Env coreceptor use. Env cor eceptor use evolution was characterized for X4 emergence pre or post CD4% decline during disease progression. X4 emerged with different kinetics in 6 subjects (A F), while R5 persisted in 2 others (G, H). Top panels CD4% chart; arrow #1 denotes CD4% infl ection point and arrow #2 denotes CD4% decline below 15% (red dotted line), indicative of the onset of advanced stage disease. Bottom panels PSSM score chart; R5/ IMR5 Envs (circles) and X4/ IMX4 5 (open symbols).

PAGE 72

72 Figure 2 2. Evolutionary relationship of HIV 1 Envs during disease progression. BEAST phylogenetic trees constructed with env V1 V3 nucleotide sequences were used to make inferences for Env coreceptor use evolution and kinetics of X4 emergence. R5 viruses appeared to establish infection and gave rise to X4 (A E), which emerged prior to CD4% decline (A C, E) with one exception (D). Additionally, R5 and X4 coexisted (F) or R5 persisted (G, H) throughout infection. Branch tips of phyloge netic trees were colored for Env coreceptor use: blue (R5), orange (IMR5), green (IMX4) and red (X4). The branch lengths were estimated with the GTR or GTR+y model of evolution, and an ined in Figure 2 1. Yellow filled and open boxes indicate the 95% confidence interval for the most recent common ancestral node (black filled circle) of the predominant X4 lineage during X4 emergence post and prior to birth, respectively.

PAGE 73

73 Table 2 1. Kin etics of X4 Evolution. The 95% confidence interval for X4 emergence, time post infection for CD4% inflection point and decline below 15% are indicated. BEAST software was used to generate the time frame for the 95% confidence interval of the most recent co mmon ancestral node for the predominant X4 lineage shown on phylogenetic trees (Figure 2 2) Subject ID Years post infection MRCA [X4 lineage] CD4% trend 95% confidence interval Range Inflection point Decline <15% S6 2.7 3.3 0.6 3.8 4.8 S4 8.6 9.4 0. 8 11.6 13.4 S2 0.8 1.8 1.0 0.8 1.0 S7 10.5 11.0 0.4 8.7 9.2 S5 0.5 1.4 1.9 1.9 2.2 S3 1.2 0.0 1.2 0.1 0.3

PAGE 74

74 Table 2 2 Genotypic and functional analysis of HIV 1 Envs. Coreceptor use was inferred based on the genetic features of the env V3 loop a c and entry into U87CD4 (CCR5 or CXCR4) d using titered pNL4 3Luc + R + E viruses pseudotyped with V1 V5. Env c oreceptor use was inferred as R5 (CCR5 using) IM (intermediate CCR5 or CXCR4 using), and X4 (CXCR4 using). Subject ID Env ID Genotype (V3) Function (V1 V5) d Amino acid sequence (V3 loop) Charge a 11/25 b PSSM c S 1 1.1 CT R PNNNT RK SINIGPG R AFYTTGQIIGNI R QAHC 5 R5 R5 R5 1.2 -LS --R ---------------D R --5 R5 R5 R5 1.3 I ----R --------A -D ----R --5 R5 R5 R5 1.4 I ----R --------A D ----R --5 R5 R5 R5 1.5 I ----R --------A -D ----R --5 R5 R5 R5 1.6 I ----R --------A -D ----R --5 R5 R5 R5 1.7 I ----R --------A -D ----R --5 R5 R5 R5 S 2 2.1 CT R PNSNT RR SVQVGPGQAIYTTGQIIG D I R QSHC 3 R5 R5 R5 2.2 --N ---HL --R ---------N A -5 R5 R5 R5 2.3 --N --R IHI --R ---A ----K A -6 X4 IMX4 R5X4 2.4 --N --R IHI --R ---A ----K A -6 X4 IMX4 R5X4 S 4 4.1 CT R PNNNTI K GIQLGPG R AVIAT KR IIG D I R QAHC 5 X4 IMX4 R5X4 4.2 -----R S R ----F -E K T -Y 5 X4 X 4 R5X4 4.3 ----------------K T -Y 5 X4 X4 X4 S 3 3.1 CT R PNNNT RK GITLGPG R VYYTTGQIIG D I RK AHC 5 R5 IMR5 R5X4 3.2 ------------------------5 R5 IMR5 R5X4 3.3 ------------------------5 R5 IMR5 R5X4 3.4 ------------------------5 R5 IMR5 R5X4 3.5 ------R ---------------Y 6 X4 X4 R5X4 3.6 ------R ---------------Y 6 X4 X4 R5X4 S 5 5.1 CT R PNNNT RKR IHIGPG R SWVTT K SITG D I RK AYC 7 X4 X4 R5X4 5.2 ----------------------7 X4 X4 R5X4 5.3 ---Y K -----------G ------7 X4 X4 X4 5.4 ---Y K -----------G ------7 X4 X4 X4 5.5 I ---------------------7 X4 X4 X4 5.6 I ---------------------7 X4 X4 X4 5.7 I ---------------------7 X4 X4 X4 5.8 A ---------------------7 X4 X4 X4

PAGE 75

75 Figure 2 3. Env expression and virus infectivity. Qualitative (A) and quantitative (B) assessment of gp120 incorporation into Env pseudotyped viruses were performed using immunoblot assay an d densitometry. Gp120 incorporation was detected in functional (*) and non functional viruses (A); virus functionality was assessed for entry into U87 cells. p24 (40 pg) normalized viruses yield different mean pixel intensity (MPI) of gp120 detection (Imag eJ) (B), and infectious amount of virus (C). Infectious titers of 3 6 batches of Env pseudotyped viruses are shown via box and whisker plots (C); lower (bottom of box) and upper (top of box) quartile values, median (line in box), and range (whiskers). The range and median values of 2 batches of virus is shown without boxes.

PAGE 76

76 Figure 2 4. CD4 T lymphocyte tropism of HIV 1 Envs. PBMC infections of virus pseudotyped with R5, R5X4 and X4 Envs from four subjects were performed to define Env tropism of CD4 T lym phocytes. Env coreceptor use on heterogeneous CD4 T lymphocyte subsets in PBMCs was confirmed via coreceptor inhibition: no inhibitor (blue bars), TAK779 (black bars), AMD3100 (green bars), and TAK779 and AMD3100 (gray bars). Results from a representative PBMC donor are shown ; absolute relative light units (RLU) (left panels) and percent RLU relative to entry in the absence of inhibitors (right panels) E rror bars represent the standard error of the mean. Env phenotype for entry into U87 cells is shown on e ach panel.

PAGE 77

77 Figure 2 5. Macrophage tropism of R5 and R5X4 Envs. CCR5 using Envs from subject S2 were assessed for tropism (A) and coreceptor use (B) on eight day old monocyte derived macrophages (MDMs). Env coreceptor use on heterogeneous mixtures of MD Ms was confirmed via coreceptor inhibition as described in Figure 2 4. Average values from two representative MDM donors are shown ; absolute RLU values and percent RLU relative to entry in the absence of inhibitors E rror bars represent the standard error of the mean.

PAGE 78

78 Figure 2 6. Sequence alignment of env V1 V5 genome for R5 and R5X4 Envs. Lymphocyte and macrophage tropic R5X4 envs 2.3 and 2.4 were aligned to lymphocyte tropic R5 envs 2.1 and 2.2 to identify potential genotype for X4 use and macrophag e tropism. Envelope sequences were annotated for potential N linked glycosylation sites [PNGs] (yellow), V3 loop (red text box), epitopes for broadly neutralizing monoclonal antibodies (filled circles), residues forming the bridging sheet for coreceptor bi 4 7 binding site (underlined in red), and genoty pic determinants that modulate host cell tropism and/ or coreceptor use (inverted triangle). Epitopes for the following broadly neutralizing monoclonal antibodies are shown:

PAGE 79

79 Figure 2 7. Probing mechanism of X4 evolution and macrophage tropism. U87CD4 CCR5 (A) infection of R5 (2.1, 2.2) and R5X4 (2.3, 2.4) viruses, and U87CD4 CXCR4 (B) infection of R5X4 viruses were performed in increasing concentration of sCD4 (A, B), 447 52D (A, B), Maraviroc (A), AMD3100 (B), and T20 (A, B) in independent assays. Percent viral infectivity relative to infection in the absence of inhibitory agents fr om a representative of 2 3 assays is shown; error bars represent standard error of the mean. Two way ANOVA was used to determine statistically significant differences between primary R5 and R5X4 Envs in sensitivity to varying concentrations of entr y blockers ; p value <0.05 Envs are represe nted by color coded symbols R5 J (gray asterisk), X4 M (gray octagon), 2.1 (light blue filled triangle), 2.2 (dark blue filled diamond), 2.3 (dark green filled square) and 2.4 (light green filled circle).

PAGE 80

80 Table 2 3 R5 and R5X4 Env sensitivity to entry bl ockers and V3 monoclonal antibody. IC 50 of sCD4, 447 52D, Maraviroc/ AMD3100, and T20 were quantified on U87CD4 CCR5 and U87CD4 CXCR4 cells for R5 and R5X4 Envs. IC 50 values represented the average (avg) and standard deviation (SD) from 2 3 assays, and wer e calculated using non linear regression curve equations in 52D, T20, AMD3100], and nM [Maraviroc]. Paired t test was performed to determine statistical differences of IC 50 s across separate assays for entry block ers, between R5 and R5X4 Envs : p value <0.05 ++ (2.4 vs. 2.1/2.2), + (2.3 vs. 2.1). Key ud (undetermined) and dash (assay not performed). Env ID Env phenotype IC 50 U87CD4 CCR5 U87CD4 CXCR4 sCD4 447 52D Maraviroc T20 sCD4 447 52D AMD3100 T20 A vg SD Avg SD Avg SD Avg SD Avg SD Avg SD Avg SD Avg SD R5 J R5 0.2 0.1 0.2 0.1 0.6 0.1 1.6 0.8 2.1 R5 0.4 0.1 >1 ud 0.1 0.0 0.9 0.0 2.1 R5 1.8 0.9 >1 ud 0.4 0.2 >10 ud 2.3 R5X4 0.6 0.4 0.2 0.0 0.6 + 0.1 >10 ud 0.3 0.0 0.2 0.1 47.0 22.0 1.0 0.5 2.4 R5X4 0.3 0.1 0.2 0.1 1.5 ++ 0.4 7.3 3.2 0.2 0.0 0.03 0.0 6.0 1.0 3.0 1.8 X4 M X4 0.2 0.0 0.8 0.3 20.0 10.0 2.8 0.5

PAGE 81

81 Figure 2 8. Model of X4 evolution. Discontinuous determinants in Env modulate X 4 evolution via R5X4 intermediates of distinct preference for coreceptor use on host cells. R5X4 Envs represent a fitness valley in the evolutionary process of Env coreceptor use expansion, which ultimately give rise to X4 emergence that is associated with changes in cell tropism.

PAGE 82

82 CHAPTER 3 PROLINE RESIDUE IN E NV ELOPE V1 DOMAIN IMPACTS CD4 USE EFFICIENCY AND SENSITIVITY TO B ROADLY NEUTRALIZING MONOCLONAL ANTIBODIE S Introduction Human immunodeficiency virus type 1 (HIV 1) Env elope V1V2 domain is a regulato r of viral entry and sensitivity to neutralizing antibodies (122, 132, 183, 184, 260) V1V2 loop impacts access to distal domains in Env gp120 due to a shielding effect of neighboring V1V2 and V3 domains by monomer ic gp120 molecules within the Env trimer (38, 205) It is well established that p otential N linked glycosylation sites (PNGs) in V1V2 create a glycan shield that accounts for the mechanism of V1V2 shielding of antib ody epitopes and entry determinants (36, 123, 201, 244) However, non PNGs in V1 have also been demonstrated to impa ct Env conformation, antibody neutralization sensitivity, and CD4 and coreceptor use (163, 172, 211) Amino acid polymorphisms and length that contribute s to V1V2 variability have also been implicated in viral transmission efficiency during new infections (53, 165, 208) T hus, residues in V1V2 are relevant for immunogen design in the development of a fully protective vaccine that remains elusive. P roline residue is typically found in protein turns and known to significantly modulate the architecture of a protein (14) Yet, the function of Proline residue in V1 domain remains undefined. Previous studies have provided evidence for the impact of single amino acids on vir al entry and antibody neutralization sensitivity (34, 68, 81, 163) thus sug gesting a potential role for Proline in V1 on Env function. Lack of a crystal st ructure of trimeric HIV 1 Env limits a complete understand ing of the residues involved in Env function However, molecular genetics approaches (34, 57, 81, 144) and structural model s (38, 100, 130, 171) have provided insights for th e role of

PAGE 83

83 discontinuous residues in impacting the complex process of viral entry and sensitivity to broadly neutralizing monoclonal antibodies The current study uses molecular genetic s approach to elucidate the impact of Proline residue in V1 (Env positio n 147) on entry efficiency and sensitivity to broadly neutralizing monoclonal antibodies, which were used as surrogate probes for efficiency of discrete steps in entry and Env conformation. Furthermore, t he use of longitudinal Envs provided an opportunity to assess the functional role of Proline emergence in V1 domain on Env evolution during disease progression Materials and Methods Subject s and S amples Six pediatrics infected via maternal transmission (S1, S2, S3, S5, S6, S8) and two via contaminated blo od transfusion (S4, S7) of subtype B HIV 1 were previously described ( Chapter 2 Materials and Methods ) HIV 1 Subtype C maternal subjects from the Zambia Exclusive Breastfeeding Study were previously described (92) 1.5 kb Envs were amplified from PBMC and plasma samples collected over 3 to 8 years post infection of subtype B HIV 1, and from plasma collected within 2 year s of infection of subtype C infected subjects. V1 V5 amplicons were cloned into Topo TA vector (Invitrogen, Carlsbad, CA), sequenced and edited as previously described ( Chapter 2 Materials and Methods ) (92, 133, 24 2) Site Directed M utagenesis Proline residu e in env V1 region (P147) was replaced with Threonine residue, present in envelopes (T147) amplified earlier in infection. T147 and P147 Envs were detected 2 months and 2 years post infection, respectively. E nvelope expression constructs encoding the V1 V5 regions of Envs with Proline in V1 were previously

PAGE 84

84 described ( Chapter 2 Materials and Methods ). Pr imers that encode the P147T based Quick Change Primer D esign Program, and mutagenesis was performed using commercially available Quikchange II Site Directed Mutagenesis Kit (Stratagene, La Jolla, CA). Mutations in envelope genes were confirmed by sequencin g (I nterdisciplinary Center for Biotechnical Research, Gainesville, FL) Coreceptor U se P rediction CCR5 or CXCR4 coreceptor use was predicted for each envelope sequence using position specific scoring matrix (PSSM) bioinformatic tool that analyzed the genotypic features of V3 loop (residues 296 to 331 in HIV 1 HXB2 genome) using an online PSSM web tool, as previously described (Chapter 2 Materials and Methods) (107) Envelope Constructs and Virus P roduction HIV 1 mutant Envs (P147T) were pseudotyped onto pNL4 3Luc + R + E virus as previously described (C hapter 2 Materials and Methods) (81) Virus production in 293T cells was confirmed by the quantification of p24 concentration (pg/ml) and titered for infectivity (TCID 50 /ml) on Tzm bl cells as previously described ( Chapter 2 M ater ials and M ethods) P147 and P147T Envs were a dditionally titered for infectivity (TCID 50 /ml) on U87C D4 CCR5 and U87CD4 CXCR4 cells Virus t itration on Tzm bl often times yielded low titers (<100 TCID 50 /ml) comparable to background and limited the extent of functional analysis of P147 and P147T Envs. In contrast, virus titration on U87 cells yielded up to ten fold higher infectious titers. Studies assessing sensitivity of P147 and P147T env pseudotyped v iruses to inhibitory agents were performed on U87 cells as differences in infection would be limited to the action of the entry blockers

PAGE 85

85 Virus I nfections For entry efficiency experiments, virus infections were performed on U87 indicator ce lls as previ ously described (Chapter 2 M aterials and M ethods) For inhibition studies, virus infections were performed using a modified protocol. Briefly, virus infections were performed in 96 well plate format using 50,000 U87 cells per well and 5 10 TCID 50 per vir us. I nhibition studies Inhibition studies were performed on U87 indicator cells with increasing concentrations of inhibitory agents to determine the inhibitor concentration required to achieve 50% inhibition of infection ( IC 50 ) as described in Chapter 2 (Materials and Methods). Inhibitory ag ents used in this study include soluble CD4 ( r ecombinant protein ) b12 (anti CD4 binding site monoclonal antibody ) Maraviroc ( CCR5 inhibitor) AMD3100 (CXCR4 inhibitor), and 4E10 (anti gp41 monoclonal antibody ), whi ch were obtained from the AIDS Research and Reference Reagent Program (71, 77, 86, 97, 216, 234) Results Frequency of Proline in V1 Data mining of HIV 1 sequences deposited in t he HIV Los Alamos Database from re searchers worldwide indicated a low frequency of Envs with Proline in V1. Less than 5% of 100 subtype B and 100 subtype C Envs encoded Proline in V1. Adopting a similar approach to longitudinal Envs from subtype B infected subjects described in Chapter 2 up to 40% encoded Proline in V1 (Fig ure 3 1A). Up to 70% of subtype C Envs obtained from a previous longitudinal study (Gray, AIDS, 2011) displayed Proline in V1, but the high percentage may be reflected by the limited number of sequences ava ilable for

PAGE 86

86 ana lysis (Fig ure 3 1A ). At least one envelope from all subtype B infected subjects encoded Proline in V1, but at least three subjects (S4, S7, S3) were informative as >25% of sequences encoded Proline in V1 and Proline emergence was maintained in viral popula tions of later timepoints In contrast to Proline detection in Env V1 domains of three subtype C infected subjects, over 200 subtype C sequences from sixteen subjects did not en code Proline in V1 (Fig ure 3 1A). Overall, Proline emergence in V1 occurs at a variable frequency independent of HIV 1 subtypes. Genotypic Analysis of Envs with Proline in V1 Genotypic analysis of the V3 loop of HIV 1 Envs with Proline in V1 inferred CCR5 (R5) or CXCR4 (X4) use (Fig ure 3 1B). Additionally, Envs with Proline in V1 w ere predominantly R5 or X4 depending on the subject Overall, Proline emerges in V1 domains of Env independent of coreceptor use. Proline Emerges O vertime in HIV 1 Env elope s For subtype B infected subjects (S4, S7, S3) where Proline was present in >25% o f over 100 sequences analyzed, the kinetics of Proline emergence during disease p rogression was different. Manual inspection of HIV 1 sequences sampled across 10 years of infection revealed that Proline emerge prior to advanced stage disease (Fig ure 3 2), indicated by a drop below 15% CD4 T cell counts (114, 115) In contrast, Proline emerged post advanced stage disease in subjects S7 and S3 where sequences were analyzed from samples collected across 9 and 2 years of infection respectively Proline emergence was detected early in subject S2, 2 months post infection, but late in subjects S4 and S7, 9 and 12 years post infection respectively. Albeit the limited sample size, Proline emergence occurred with different ki netics relative to advanced stage disease.

PAGE 87

87 Sequence Analysis of Proline Emergence HIV 1 envs sampled from subject S3 during 2 years of infection displayed similar V1 length and Proline emergence overtime. A common V1 length across Envs eliminates the co mplexity of length variation in assessing the functional role of Proline emerge nce. Figure 3 3 illustrates an alignment of HIV 1 envs amplified from subject S3. The sequences were aligned in order of time of sampling from 2 months to 2 years post infection designated with standard HIV 1 HXB2 numbering and annotated for potential N linked glycosylation sites (PNGs), CD4 binding site, domains that enhance viral binding, residues that form the bridging sheet for coreceptor binding, and epitopes for broadly ne utralizing monoclonal antibodies (67, 68, 130, 144, 165, 218, 220, 247, 259, 265) PNGs, entry determinants and antibody epitopes were generally conserved across Envs. However, Envs 3. 2 and 3. 3 encoded Proline resid ue at position 147 in Env V1 domain, and similar genetic features across V1 V5 that were different from other envs [ 3.1, 3.4, 3.5, 3.6 ] amplified at earlier timepoints. Despite multiple genetic differences across V1 V5 region of envs the current study was focused on determining the functional role of Proline in V1 given the essential role of V1V2 on Env function (53, 122, 163, 205) Functional Analysis of Proline E mergence HIV 1 Envs from subject S3 were characte rized for entry into U87CD4 CCR 5 and U87CD4 CXCR4 cells All Envs mediated entry into both U87 indicator cells, but at different levels of efficiency (Fig ure 3 4A). Envs 3.2 and 3. 3 that encode Proline residue in V1 were less efficient for entry into both U87 indicator cells, relative to other Envs. Changes to Proline residue at position 147 failed to impact coreceptor use and entry efficiency on both U87 indicator cells (Fig ure 3 4B). Entry efficiency of P147 (parent)

PAGE 88

88 Envs were compared to the respective P 147T (mutant) Env (Fig ure 3 4B). Efficient CCR5 using (R5 J ) and CXCR4 using (X4 M ) reference Envs were used as controls for infection and standardization of entry efficiency across Envs analyzed. In general, Proline in V1 failed to impact coreceptor use an d net entry efficiency. A limitation of the entry assay is the measurement of the net effect of the multi step process of virus entry and not specific steps. Although the role of Proline in V1 failed to impact the net effect of virus entry, the role on spe cific steps remained undetermined. Mechanism of Proline Emergence To determine the role of Proline residue on specific steps in viral entry P147 and P147T Envs were assessed for sensitivity to sCD4 b12, Maraviroc, AMD3100, and 4E10. Sensitivity to sCD4 and b12 were us ed as surrogate probes to access CD4 binding site ; Maraviroc and AMD3100 probe d efficient CCR5 and CXCR4 use, respectively ; 4E10 probed access to gp41fusion domain; and 447 52D probed access to V3 loop as previously described (Chapter 2 Materials and Methods) (51, 233, 240, 267) P147 and P147T Envs have R5X4 phenotype, thus inhibition studies were performed on U87CD4 CCR5 and U87CD4 CXCR4 cells to elucidate the mechanism of entry via independe nt CCR5 and CXCR4 use. Figure s 3 5 and 3 6 illustrate the inhibition curves for inhibitory act ion of entry blockers on Env 3.2 and 3. 3 respectively. In general, P147 Env s displayed de creased access to CD4 binding site as more sCD4 and b12 was required to achieve 50% inhibition on both U87 indicator cell s in comparison to the respective P147T mutant. Similarly, P147 relative to P147T Envs displayed decreased access to the V3 loop as more 447 52D was required to achieve 50% inhibition on both U87 indicat or cells In contrast, P147 and P147T Envs display ed similar sensitivity to Maraviroc and AMD3100

PAGE 89

89 on U87CD4 CCR5 and U87CD4 CXCR4, respectively and 4E10 on both U87 indicator cells Th e inhibition profiles of Env 3.3 for 4E10 and 447 52D inhibition on U87 CD4 CCR5 (Fig ure 3 6A) and b12 inhibition on U87CD4 CXCR4 (Fig ure 3 6B), were in disagreement wit h inhibition profiles of Env 3.2 on both U87 indicator cells and Env 3. 3 on one of the indi cator cells. The discordant inhibition profiles w ere potentially due to low levels of virus infection, which are characteristic of greater variability among replicate RLU values that quantify viral entry. The IC 50 values for inhibitory agents on Env function as displayed via inhibition curves in Figures 3 5 and 3 6 were re ported in Table 3 1. Overall, Proline in V1 confers decreased access to CD4 binding site and V3 loop, but no impact on efficient coreceptor use and fusion.

PAGE 90

90 Figure 3 1. Genotypic Analysis of Envelopes with Proline in V1 Region Amino acid sequences am plified overtime in each subject was manually examined for presence of Proline residue in V1 region of envs amplified from subjects infected w ith either HIV 1 subtype B or C. White bars represent the total number of sequences and the black bars represent t he number of sequences with Proline in V1 (A). S2 + and S5 + have at least one env with Proline in V1 and S12 A represents envs from 16 subjects. Coreceptor use of envs with Proline residue in V1 from different subjects, inferred via PSSM analysis of the V3 loop are shown (B). Env coreceptor use phenotypes are as follows : R5 (blue bars), IMR5 (red bars), IMX4 (green bars), X4 (purple bars).

PAGE 91

91 Figure 3 2. Proline E mergence duri ng Disease P rogression. Detection of Proline residue in V1 is indicated by the let ter P along the time course of infection studied per subject. The green circle represents timepoint of 15% CD4 T cell frequency (advanced stage disease).

PAGE 92

92 Figure 3 3 Proline Emergence Overtime in V1 Region V1 V5 amino acid s eq uences o f envs sample d overtime from subject S3 were aligned using BioEdit sequence alignment editor and analysis program Sequences were numbered according to standard HIV 1 HXB2 numbering and annotated for P roline emergence (P147), V3 loop (red box), 4 7 binding site (underlined in red) residues ), determinants that modulate host cell tropism and /or coreceptor use (inverted green triangles) and epitopes for broadly neutralizing m onoclonal antibod ies (filled circles) Epitopes for the following broadly neutralizing monoclonal antibodies are shown:

PAGE 93

93 Figure 3 4. Entry E fficiency of Env elope s with Proline in V1 Domain Envs in S3 were analyzed for entry efficiency into U87 indica tor cells (A) in the context of env pseudotyped viruses. Mutant Envs (P147T) were similarly analyzed for entry efficiency relative to parent Env (P147) (B). Top panels: E ntry assessed as luciferase activity (relativ e light unit RLU) ; dash line 3 standa rd deviat ions above background Bottom panels: luciferase activity compared to entry efficient R5 J and X4 L viruses Error bars represent standard deviation across duplicate assay s

PAGE 94

94 Figure 3 5. Mechanism of P147 in Entry Efficiency. I nfections of U87CD4 (A) CCR5 and (B) CXCR4 cells by viruses pseudotyped with P147 (dark blue diamond) and P147 T (light blue triangle) Env 3 .2 were performed in increasing conce ntration s of separate inhibitory agents: sCD4 b12 and 4E10 (A, B), Maraviroc (A), AMD3100 (B) Ref erence Envs: R5 J X4 M Percent viral infectivity relative to infection in the absence of entry blocker s shown Error bars represent standard error of the mean a cross pooled RLU values from 3 5 assays

PAGE 95

95 Figure 3 6. Mechanism of P147 in Entry Efficiency. I nfections of U87CD4 (A) CCR5 and (B) CXCR4 cells by viruses pseudotyped with P147 ( dark green square ) and P147T ( light green circle ) Env 3.3 were performed in increasing concentrations of separate inhibitory agents: sCD4, b12 and 4E10 (A, B), Maraviroc (A ), AMD3100 (B). Reference Envs: R5 J X4 M Percent viral infectivity relative to infection in the absence of entry blockers shown. Error bars represent standard error of the mean across pooled RLU values from 3 5 assays.

PAGE 96

96 Table 3 1. Env elope S ensitivity to I nhibitory A gents IC 50 of entry inhibitors and anti HIV 1 monoclonal antibodies for P147 and respective P147T Envs (3.2 and 3.3) were determined on U87 cells Reference Envs: R5 J (JRFL), X4 M (MM). Average of pooled RLU values from 3 5 assays were used to calculate IC 50 Dash ; IC 50 not applicable. Units ; g/ml [sCD4, b12, 447 52D, AMD3100], nM [Maraviroc] Inhibitory agent U87CD4 CCR5 U87CD4 CXCR4 R5 J Env 3.2 Env 3.3 X4 M Env 3.2 Env 3.3 +P P +P P +P P +P P sCD4 0.3 >10 2 >10 1 1 8 3 5 1 MVC 0.7 0.1 0.1 0.3 0.3 AMD3100 28 2 4 4 2 4E10 2 7 7 3 0.1 >10 1 0.7 5 3 b12 0.1 7 1 10 2 0.4 2 1 1 9 447 52D 0.3 >10 0.2 3 >10 0.2 >10 2 9 3

PAGE 97

97 CHAPTER 4 EVIDENCE OF EXTENSIVE RECOMBINATION IN DISTINCT SUBTYPE B AND C HIV 1 ENV ELOPE V1 V5 REGIONS Introduction Human immunodeficiency virus type 1 ( HIV 1 ) exists as a quasispecies of multiple related, but distinct variants (82) The genetic diversity of HIV 1 quasispe cies conferred by nucleoside misincorporation into the HIV 1 genome due to error prone reverse transcriptase recombination between two heterogeneous RNA genomes in co infected cells, and hypermutation by hos t cells enzymes is magnified by high virus turnover of approximately 10 11 virions per day and 10 8 infected cells per day (112, 135, 150, 190, 198) HIV 1 is a rapidly evolving pathogen and genetic diversity likely i mpact s pathogenesis and disease progression. HIV 1 encodes two single stranded positive sense RNA non covalently linked at into the first strand of viral D NA by the virally encoded reverse transcriptase (192) Coinfection of target cells results in HIV 1 p articles with heterozygous genomes. T he copy choice model of template switching during reverse transcription after heterozygous virion infection, facilitates the formation of recombinants as progeny viruses (13) Although r ecombination breakpoints are dispersed across the HIV 1 genome crossover hotspots have been detected in the cons erved C2 region of e nv (75, 191, 192, 211) Conserved regions of Env serve as hotspots for recombination because similar sequence identity of constant regions in nascent and acceptor RNA during strand transfer gene rates more stable heteroduplexes (10) Furthermore, cross over events in HIV 1 genome replication occur at a higher frequency in macrophages in comparison to CD4 T lymphocytes implicating

PAGE 98

98 the role of the cell ular environment in facilitating recombination (112, 138) Overall, viral properties and cellular factors contribute to HIV 1 recombination Studies assessing genetic diversity of viral populations t ypical ly employ Standard Genotyping (StdG) a polymerase chain reaction (PCR) base d amplification and cloning o f genes representative of variants in a viral sample (92, 152, 211, 261) StdG involves bulk sequencing of viral variants and presents the opportunity for in vitro generat ed recombi nants (artifacts) (152, 261) In contrast, Single Genome Amplification (SGA) reduces the opportunity for in vitro generated artifacts via amplification of a single viral genome obtained from limiting dilution of bulk vir al variants (32, 110, 170, 210) The caveats for SGA include excess sample av ailability that may be limiting and increased cost (32) Furthermore, experimental conditions may be modified to reduce PCR generated recombinants during StdG (111, 225) SGA is ideal for studies evaluating rare viral variants present in less than 30% in viral population (32, 170) but StdG and SGA may yield similar coverage of the population diversity under recommended PCR conditions and nu mber of PCR templates analyzed (110) R ecombinants potentially promote viral evolution, provide challenges for drugs and open avenues for the ability of a fi tness advantage for the virus. Thus identifying recombinants in viral quasispecies remain significant for viral evolutionary studies and development of novel therapies and vaccines. HIV 1 Envs analyzed for corecept or use evolution during disease progression via genotype and function (Chapter 2 and 3) were amplified from viral sa mples via StdG T he current study was designed to investigate if StdG magnify HIV 1 Env diversity in distinct subtype B and C quasispecies. Env diversity was examined in the context of recombinants, and t he frequency and genotype

PAGE 99

99 of recombinants within a viral quasispecies detected via StdG and SGA were used for compar ison M aterials and M ethods Subjects Subtype B e nv sequences were amplifie d via Standard Genotyping (StdG) from 9 pediatric subject s infect ed during the early period of the HIV/AIDS epidemic (1989 to 1999) when combination antiretroviral therapy (ART) was unavailable for pediatrics. Subtype B env sequences were amplified via Sin gle Genome Amplification (SGA) from subject 09 six years post infection amidst a viral load of 737,000 viral RNA copies/ml and frequency of 4% CD4 T cells. The s ubject s w ere recruited into the study at the University of Florida using a protocol approved by the University of Flori da Institutional Review Board. Subtyp e C e nv sequences were isolated via Standard Genotyping (StdG) from 6 maternal subject s in the Zambia Exclusive Breastfeeding Study previously described (92) S ubtype C infected subject s w ere therapy na ve except for a single dose of N evirapine at the time of childbirth Subtype C env sequences were amplified via Single Genome Amplification (SGA) from subject 15 at 1, 12 and 24 months post child birth For subject 15, available p lasma viral loads at 4 and 12 months post child birth were 235,196 and 15 2,500 copies/ml, respectively, and CD4 cell count < 200 cells/l a t time of child birth. A total of 157 StdG derived sequences were evaluated; 35 subtype B and 122 subtype C e nvs A total of 119 SGA sequence s were evaluated; 34 subtype B and 85 subtype C e nvs Samples S ubtype B envs w ere amplified from p eripheral bloo d mononuclear cell s (PBMC) DNA and subtype C cDNA generated from viral RNA of infected subjects as previously

PAGE 100

100 described (80, 92, 232) 1.5 kb V1 V5 region of env was amplified for genotypic analysis. Standard Geno typing (StdG) E nvelope V1 V5 DNA was PCR amplified (nested) using V1 V5 specific primers as previously described (81, 242) followed by ligation into PCR 2.1 vector (Invitrogen, Carlsbad, CA) and transformation o f competent Top10F cel ls (Invitrogen, Carlsbad, CA). Nested PCR primers: 1 st round Polenv (forward GAGCAGAAGACAGTGGCAATGA), 192H (reverse CATAGTGCTTCCTGCTGCT), and 2 nd round D1 (forward CACAGTCTATTATGGGGTACCTGTGTGGAA), 194G (rev erse CTTCTCCAATT GTCCCTCATA). PCR conditions for 1 st and 2 nd round denaturation (1 cycle, 5 minutes, 95 o C), amplification (30 cycles, 94 o C 1 minute, 58 o C 1 minute, 72 o C 2 minutes), and extension (1 cycle, 72 o C, 10 minutes). Single Genome Amplification (SGA) Serially d iluted V1 V5 DNA w as PCR amplified (nested) using e nv V1 V5 specific primers and co nditions as outlined for StdG. Second round products were electrophoresed on 0.7% agarose gels to assess the fraction of PCR positive reactions ibution, the DNA dilution yielding PCR product s in 3 of 1 0 PCR replicates contains a single genome per positive PCR about 80% of the time (110, 170) Thus, i f > 30% of reactions per DNA dilution was PCR positive, DNA samples were further diluted and the PCR and gel electrophoresis process es repeated until a diluted DNA sample yielding 30 % PCR positives was obtained PCR products were directly sequenced by the Interdisciplinary Center for Biotechnical Research (ICBR) at the University of Florida to confirm the presence of a single viral variant Single genomes

PAGE 101

101 were verified by a homologous chromatograph of DNA sequence, and further edit ed and align ed in the BioE dit sequence alignment software program for further analys is. Recombination In V itro Env elope constructs encoding either HIV 1 JRFL or HIV 1 LAI V1 V5 regions in pcDNA3.1 vector were equally mixed at different amounts to achieve a total of 10, 100 and 500 ng of DNA representative of 1000, 10,000 and 60000 viral c opies at 100% PCR efficiency [ 980 Kbp equals to 1 ng ] env V1 V5 genome was PCR amplified from the equally mixed plasmid samples using V1 V 5 specific primers as previously described (81, 92) PCR amplified sequences were sequenced (University of Florida ICBR Core), and edited and aligned using BioEdit sequ ence alignment editor program. Approximately 30 sequences were a nalyzed for each PCR reaction. Sequences were aligned to HIV 1 JRFL and HIV 1 LAI at the nucleotide le vel, and manually analyzed to identify recombinant sequences between HIV 1 JRFL and HIV 1 LAI Recombination A nalysis The presence of recombina nts in a viral sample was confirmed using PHI NNet algorithm adapted to study intra patient evolution as previous ly described (211, 212) Briefly, the PHI NNet algorithm uses an interactive program implemented in SplitsTree package version 4.8 for analyzing and visualizing evolutionary data. The PHI NNet algorithm generates a PHI statistic that indicate s signi ficant presence of recombinants for p value <0.05. Additionally, the PHI test produces the lowest number of false positives (27) Sequence Analysis of Genetic S ignatures Sequences generated via StdG and SGA were aligned using BioEdit sequ ence alignment editor program and manually analyzed for the presence o f similar genetic

PAGE 102

102 signatures across V1 V5 The presence of similar genetic signatures in envs amplified via StdG and SGA were used to infer an evolutionary relatedness consistent with previous studies (156) Recombination Breakpoint A nalysis Genetic algorithm for recombination detection ( GARD ) is a bioinformatic method that search es multipl e sequence alignments for evidence of recombination breakpoints (127) Sequences were uploaded into an online program (http://www.datamonkey.org/GARD/) and the results o f the recombination screen graphically displayed the likelihood for the location of breakp oints R ecombination leads to the creation of mosaic genomes originated from different ancestors Thus querying recombination breakpoints in smaller e nv fragments ( V1 V2, C2 V3 and V1 V3 ) in addition to a larger fragment ( C2 C4 ) via GARD increases the c ha nces for identifying putative recombinants and crossover hotspots in the genome Results Frequency of In V itro R ecombina tion T o assess the magnitude of viral input on the frequency of in vitro generated recombinants during bulk PCR amplification, HIV 1 JRF L and HIV 1 LAI were equally mixed to obtain different total amounts of input DNA ranging from 0.1 to 500 ng. The number of cycles per round of amplification was also investigated. N ucleotide differences between HIV 1 JRFL and HIV 1 LAI are dispersed across e nv V1 V5 regions as shown in Fig ure 4 1, thus facilitating recognition of a recombina t ion between JRFL and LAI genomes via sequence analysis Two rounds of 35 cycles of PCR amplification have been established for effective detection of HIV 1 envelopes in viral samples (81, 92, 242) After 2 rounds of 35 cycles

PAGE 103

103 of PCR amplification, recombinants were generated in each round for all samples of equally mixed HIV 1 JRFL and HIV 1 LAI plasmids at a total input of 0.1, 1, 1 0, 100, and 500 ng (Fig ure 4 2A). Recombinants accounted for ~ 15 20 % of sequences generated after the first round of amplification and up to ~ 30% in the second round, suggesting that the frequency of in vitro generated recombinants increases during the sec ond roun d of amplification at 35 cycles Although no recombinants were detected during the first round of amplifi cation of 500 ng of DNA, up to 25% recombinants were detected after the second round (Fig ure 4 2A). Despite no recombinants in the first round of amplification, the presence of more templates in the PCR reaction mixture for the second round of amplification potentially favored the formation of recombinants. Additionally, r ecombinants generated in the first round of amplification may have been und etected due to the limited number of sequences analyzed After one round of 25 cycles of PCR amplification of equally mixed HIV 1 JRFL and HIV 1 LAI plasmids a total of 500 ng 8 of the 28 sequences analyzed were identified as recombinants (29%) (Fig ure 4 2 B ). No recombinants were detected in 10 and 100 ng mixture s of plasmids in contrast to both rounds of 35 cycles of PCR amplification, consistent with previous studies that less PCR cycles in combination with less DNA template reduces in vitro generated rec ombinants (111, 152) Despite the formation of in vitro generated recombinants, the frequency of recombinants generated per estimated number of amplified plasmid copy at 100% PCR amplification efficiency is very min imal, ranging from 1x10 10 to 1x10 25 (Table 4 1), suggesting that PCR amplification of viral variants will provide more authentic coverage of the sample diversity than PCR artifacts.

PAGE 104

104 Frequency of In Vivo Recombina tion PHI NNet algorithm was used to dete rmine the e xtent of recombination on viral diversity in sets of HIV 1 envs Figure 4 3 briefly illustrated the concept of the SplitsTree algorithm and PHI test in identifying recombinants as previously described (211 212) The SplitsTree algorithm visualized the evolutionary relationship of sequences; related sequences cluster together and recombinants are typically located on the vertices of the splits between sequence clusters ( Fig ure 4 3 A ) If all recombinants ar e removed from the set o f sequences analyzed the p value (PHI statistic) become insignificant (>0.05) (Fig ure 4 3B). In a pilot study the PHI NNet algorithm detected intrapatient recombinant HIV 1 e nvs in 9 subtype B infected subjects and 6 subtype C inf ected subjects ( Table 4 2 ) The sequence set from subject 08 (Table 4 2), which displayed the highest frequency of recombinants was used to demonstrate the application of PHI NNet algorithm in identifying recombinants (Figure 4 3). Overall, t he frequency o f recombinants ranged from 6 61% in the subtype B infected subjects, in which a range of 38 75 sequences were sampled from proviral DNA in PBMC up to 12 years post infection over 3 4 longitudinal timepoints The frequency of recombinants ranged from 8 28% in the subtype C infected subjects, in which 99 278 sequences were sampled from plasma and breast milk up to 2 years post infection over 3 4 longitudinal timepoints Albeit the limiting number of sequences and subjects analyzed, t here is evidence for a hig h frequency of recombination in different subtype B and C envs which may contribute to Env coreceptor use evolution during disease progression. Frequency of Recombinants; StdG vs. SGA SGA entails the generation of multiple copies of a single genome isolat ed from a viral quasispecies via limiting dilution techniques (110, 170) Peak trace chromatograms

PAGE 105

105 of PCR products were analyzed to verify single genome copies in a final PCR reaction prior to bioinformatic studies of recombination analysis. Homologous chromatograms with a single peak representative of one nucleotide at each genome position in the region amplified were characteristic of sample s with a single viral variant ( Fig ure 4 4 A). In contrast, h eterologous chro matograms characteristic of mixed viral variants have overlapping peaks representative of the likelihood of different nucleotides at each genome position in the region amplified ( Fig ure 4 4 B). T o investigate the magnitude of recombinants detected via Std G and SGA, one sub ject of each subtype w as selected to generate single genomes via SGA. Subjects 0 9 [subtype B] and 15 [subtype C] were selected based on sample availability and the high frequency of recombinants de tected via PHI NNet analysis of sequences previously generated via StdG (Table 2). PHI NNet analysis of individual sets of SGA generated sequences independent of subtype, revealed a similar frequency of recombinants among sequences amplifie d via StdG and SGA (Fig ure 4 5). Additionally, there was no statistically significant difference in the number of recombinants detected among sequences generated from each sample via StdG and SGA ( GraphPad; Chi square test) (Fig ure 4 5). Likewise, there was no statistically significant difference between the tot al frequency of recombinants detected in sequences from all samples generated via StdG in comparison to SGA ( GraphPad; U npaired t test) (Fig ure 4 5). Despite a limited number of sequences and subjects studied, StdG and SGA revealed a similar frequency of r ecombinants in viral quasispecies, consistent with a previous report of similar genetic diversity in 17 subtype B infected subjects captured by StdG and SGA (110)

PAGE 106

106 Genetic S ignatures in S tdG and SGA Sequences StdG and SGA generated sequences from corresponding timepoint of amplification and subtype were aligned in BioEdit sequence alignment editor program and manually examined for genetic signatures Similar haplotypes or clusters of amino a cids were identified across the env genome of StdG and SGA generated sequences independent of subt ype R epresentative env sequences (subtype C) with differences in amino acid composition and length in V1V2 that may infer similar genetic signatures were shown in Fig ure 4 6A. Representative env sequences (subtype C) with genetic signatures in conserved r egions are shown in Figure 4 6B. C2 region has conserved length and amino acid compositions whereas V3 has conserved length despite amino acid polymorphisms (53, 95) Similar genetic signatures found in few sequenc es were color coded, but those present in the majority of sequences were uncolored to reflect the high degree of similarity in Std G and SGA generated sequences. Few amino acid polymorphisms were detected in C2 but more were detected in the V3 region of St dG relative to SGA generated sequences Similar genetic signatures were present in StdG and SGA generated sequences, suggesting an evolutionary relatedness and similarity of recombinants Analysis of Recombination B reakpoints Recombination breakpoint analysis was performed on separate sets of StdG and SGA generated e nv V1 V2, C2 V3, V1 V3 and C2 C4 regions using the online program of GARD. GARD analysis of env fragments maximize d th e possibility of identifying putative recombination breakpoints. Fig ure 4 7 indicated that the putative r ecombination breakpoints for StdG and SGA generated seq uences of a sample are generally different. The small number of sequences and subjects decreased the power of data

PAGE 107

107 analysis in finding similar breakpoints in StdG and SGA generated sequences and h otspots for recombination in envs which was previously shown to be l ocalized to the C2 region (75, 191, 211)

PAGE 108

108 Figure 4 1 Sequence A lignment of JRFL and LAI V1 V5 nucleotide sequen ce of JRFL and LAI were numbered according to reference subtype B e nv (HIV 1 HxB2 ). Nucleotide differences between envs are color coded: non synonymous changes (blue), synonymous changes (yellow), and insertions (gray).

PAGE 109

10 9 Figure 4 2. Frequency of I n V it ro G enerated R e combinants Equally mixed amounts of pcDN A3.1 plasmid s encoding separate V1 V5 region of JRFL and LAI yielding a total of 0.1 500 ng was PCR amplified at 35 cycles at 2 rounds (A, B), and 25 cycles at 1 round (B). Two rounds at 35 cycles: 1 s t round orange bar; 2 nd round blue bar. One round at 25 cycles red bar. 980 kbp = 1 ng DNA; HIV 1 plasmid = ~8.35 Kilobase pairs

PAGE 110

110 Table 4 1. Frequency of In Vitro G ene rated R ecombina nts At 100% PCR amplification efficiency, the number of amplified copies equals 2 n x number of initial DNA copies (n = number of PCR amplification cycles). 980 Kilo b ase p airs = 1 ng DNA ; H IV 1 plasmids = ~8.35 kbp. R or Rec s. recombinants ; ud undetermined. Total plasmid input (ng) Input plasmid copies 25 PCR C ycles (1 Round) 35 PCR Cycles (2 Rounds) Amplified plasmid copies No. of Recs. Recs./ amplified plasmid copy Amplified plasmid copies No. of Recs. Recs./ Amplified plasmid copy Recs./ Amplified plasmid copy 1 st R 2 nd R 1 st R 2 nd R 1 st R 2 nd R 0.1 12 4.1E+11 1.4E+22 6 7 1.5E 11 4.9E 22 1 118 4.1E+12 1.4E+23 6 5 1.5E 12 3.6E 23 10 1176 3.9E+10 0 ud 4.0E+13 1.4E+24 2 4 4.9E 14 2.9E 24 100 11765 3.9E+11 0 ud 4.0E+14 1.4E+25 3 7 7.2E 15 5.0E 25 500 58824 2.0E+12 8 4.1E 12 2.0 E+1 5 6.9E+25 0 7 ud 1.0E 25

PAGE 111

111 Figure 4 3. SplitsTree Analysis of R ecombinants. PHI NNet algorithm uses Splits tree package 8 to create a ph ylogenetic tree for HIV 1 e nv V1 V3 sequences from subtype B infected subject 09 (Table 4 2). R ecombinants are shown in an open re d box (A). p value=0 indicative of the presence of recombinants (A). p value=0.05 indicative of no recombinants (B)

PAGE 112

112 Table 4 2. Frequency of In Vivo Recombinants The PHI test detect s extensive recombination in longitudinal e nv V1 V5 sequences amplifie d from 9 subtype B, and 6 subtype C infected subject s Subject ID Viral sample Subtype Timepoints Total N o. of Seqs. Recombinants No. of Seqs. Percent 01 PBMC B 4 45 8 18 02 PBMC B 3 38 3 8 03 PBMC B 5 68 18 26 04 PBMC B 4 58 7 12 05 PBMC B 4 7 1 4 6 06 PBMC B 3 75 46 61 07 PBMC B 4 22 0 0 08 PBMC B 3 49 22 45 09 PBMC B 4 41 10 24 10 PL, BM C 3 99 18 18 11 PL, BM C 3 196 33 17 12 PL, BM C 3 111 9 8 13 PL, BM C 3 115 13 11 14 PL, BM C 3 122 25 20 15 PL, BM C 4 278 79 28

PAGE 113

113 Figure 4 4. Pea k Trace Chromatograms of HIV 1 S equences. Homogeneous samples are represented by homologous peak trace chromatograms (A). Multi variant samples are represented by heterologous peak trace chromatograms (B). Each peak is color coded to repre sent a specifi c nucleotide. T he peak height represents the likelihood of a specific nucleotide at that position. Peak trace chromatograms are provided by the DNA sequencing core (University of Florida ICBR).

PAGE 114

114 Figure 4 5. Frequency o f StdG and SGA G enerated Recombin ants The number of recombinants (gray bars) among the total number of sequences (black bars) generated via StdG and SGA, and the equivalent percent recombinants ( StdG red bars ; SGA green bars) are shown. Samples: B.1 subtype B e nvs C. 1 C.3 subtyp e C e nv from 3 timepoints. Chi square statistics of the total number of recombinants relative to the total number of non recombinants generated via StdG and SGA per sample: p value=0.9 (B.1), p value=1 (C.1), p value=0.06 (C.2), p value=0.8 (C.3). U npaired t test of the frequency of recombinants across samples generated via StdG compared to SGA: p value=0.7. Statistical analyses were performed using statistical packages in Graphpad Prism 4.0.

PAGE 115

115 Figure 4 6. Alignment of StdG and SGA G enerated S equences. Similar genetic signatures found in a subset of St dG and SGA generated subtype C e nv sequences are color coded in the alignment of V1V2 (A) and C2 V3 (B) ETH220 ser ves as the reference subtype C e nv sequence, and the numbering of nucleotide and c orrespond ing amino acid positions are indicated.

PAGE 116

116 Figure 4 7. Recombination B reakpoint A nalysis. HIV 1 env V1V2 (A), C2 V3 (B), V1 V3 (C) and C2 C4 (D) of StdG and SGA generated sequences were separately analyzed for putative recombination breakpoints in the online program for GARD analysis ( http://www.datamonkey.org/GARD/ ). The result s of recombination screens show the model average support (y axis on graphs) for the likely recombination breakpoint at a specified nucleotide position (x axis on graphs) A mode l average support of 1 reflects the highest confidence for a recombination breakpoint at an indicated nucleotide position.

PAGE 117

117 CHAPTER 5 DISCUSSION Overall important findings X4 evolution occurs with varying kinetics relative to CD4 T cell decline and length of infection via an ordered developmental program not explained by V3 genotype alone. A combination of phylogenetics and bioinformatic s approaches indicate that viruses using X4 generally emerge prior to CD4 T cell decline and causes or contribute to rapi d progression to advanced stage disease/AIDS. R5X4 Envs of distinct coreceptor preference on CD4 expressing host cells are intermediates for X4 evolution as il lustrated in Figure 2 8 (page 81 ), which is an expansion of previous models of X4 evolution (83, 101) that incorporates physiological relevance of coreceptor use on primary cells. V3 genotype may be sufficient to confer coreceptor use by L R5, M R5 and T X4 Envs, but requires cooperating V1V2 genotype for corec eptor use by dual tropic (D) R5X4 and X4 Envs. Despite X4 emergence, R5 viruses continue to persist, indicating differences in fitness for X4 and R5. Additionally, X4 emergence does not occur in all subjects as R5 persisted despite CD4 T cell decline in t wo subjects. Although coreceptor use is required for cell tropism, coreceptor use and cell tropism appear to be distinct properties of Envs, which may be conferred by similar mechanisms. For instance, an increased access to CD4 binding site and V3 loop, in combination with efficient CCR5 use and fusion provides a potential mechanism of X4 evolution and macrophage tropism. Overall, complex genetic determinants across envelope, especially in V1V2 and V3, potentially contribute to X4 evolution and expanded hos t cell range.

PAGE 118

118 Kinetics of X4 evolution In the current study CXCR4 using viruses were detected in six of eight subjects at different kinetics for timing relative to advanced stage disease (Figure 2 1, page 71 ) Since the timing and depth of Env sampling p otentially obstructs X4 detection during disease progression (8) phylogenetic methods (92) were used to resolve ambiguity in timing of X4 evolution pre/post CD4 T cell decline and supported X4 evolution prior to advanced stage disease (Figure 2 2, page 72 ) Although R5 viruses generally establish infection (116) the 95% CI for the MRCA of X4 viruses identified within two months of infection in one subject (S3) dated back to time before birth and suggested a rare model of CXCR4 using founder viruses (35, 213) X4 founder infections and emergence complicate the effectiveness of clinically approved CCR5 based inhibitors, thus re emphasizing the need for novel CXCR4 inhibitors to tackle global CXCR4 using viruses (72, 224) Persistent R5 evolution on multiple lineages independent of X4 emergence in phylogenetic trees (Figure 2 2 page 7 2 ) supported a rol e for pathogenic R5 viruses (91) thus ruling out X4 emergenc e as a result of fit ness advantage over R5 viruses. R5 persistence despite X4 emergence suggest s a cooperative role of R5 and X4 viruses during disease progression. Availability of CXCR4 expressing CD4 T cells may favor X4 emergence given an increase in CX CR4 expressing target cell availability overtime in HIV 1 infected subjects (196) However, viral fitness independent of X4 evolution may be driven by immune evasion of broadly neutralizing antibodies and post entry advantages regulated via cell signaling (26, 28) Overall, Env evolution may facilitate X4 emergence, but viral fitness due to Env evolution may also be multifaceted.

PAGE 119

119 X4 evolution and HIV 1 pathogenesis Although X4 emergence is associated with disease progression (48, 49, 81, 223) X4 emergence as a cause or consequence of disease progression remains unclear. Bioinformatics and phylogenetics approaches indicated that X4 emerges prior to CD4 T cell decline in 5/6 subjects where X4 viruses were detect ed ( Figure 2 1, page 71 ; Figure 2 2 page 7 2 ). In one subject (S7) where X4 viruses appear ed to emerge after CD4 T cell decline (Figure 2 1 page 7 1 ), only two viral samples were available between 5 11 years post infection (timepoints just prior to X4 emergenc e) when X4 viruses could have been present based on phylogenetic inferences (Figure 2 2, page 72), but at low frequency However, sample availability and depth of sequencing may have prevented X4 detection in subject S7 To test my hypothesis of X4 emergen ce prior to CD4 T cell decline in subject S7, pyrosequencing of HIV 1 envelopes from one of two samples available 5 11 years post infection would be recommended. Overall, X4 evolution predominantly occurred prior to CD4 T cell decline in subjects where X4 viruses were detected, suggesting that X4 causes or contributes to disease progression and rapid progression to AIDS. Factors that modulate X4 evolution Regoes and colleagues reviewed the three main theories of coreceptor expansion as transmission mutatio n, immune control, and target cell based hypotheses (196) The transmission mutation hypothesis suggests that X4 evolution occurs by chance due to random mutations in envelopes of R5 viruses that are transmitted. T he data from the current study suggest that V3 genotype alone is insufficient to confer CXCR4 use (Table 2 1 page 73 ). Thus random mutations incorporating high charge residues in V3 that are necessary for CXCR4 interaction are insufficient to facilitate CXCR4 use, in agreement

PAGE 120

120 with Pastore and colleagues (172) and rules out transmission mutation hypothesis as a theory for X4 evolution. Target cell based hypothesis suggest that transmitted R5 viruses infect CCR5 expressing CD4 T cells and induce cell death, t hus resulting in a higher frequency of CXCR4 expressing CD4 T cell availabili ty during disease progression. CD4 T cell decline which is well established as a prognostic marker for X4 emergence (124) is indicative of depletion of CXCR4 expressing cells after depletion of CCR5 expressing cells or simultaneously. While the data in the current study do not address the cell populations that were depleted during X4 emergence, the data i ndicates that X4 emergence contributes to overall peripheral blood CD4 T cell decline and rapid disease prog ression (Figure 2 1, page 7 1; Figure 2 2 page 7 2 ). I n contrast to R5 Envs, R5X4 Envs had a more open conformation based on susceptibility to CD4 and V3 loop targeted recombinant protein and monoclonal antibody, respec tively (Figure 2 7 page 79 ). In the p resence of anti CD4 and/or V3 loop targeted antibodies, R5X4 Envs of more open conformation due to access to CD4 binding site and V3 loop have a n increased chance of being neutralized. T hus R5X4 virus emergence was potentially due to a weakened immune syst em consistent with the immune control hypothesis which suggests that X4 viruses are more susceptible to antibody neutralization in contrast to R5, and appear after a depleted immune response in infected individuals However, t he emergence of X4 viruses i n B cell depleted rhesus macaques prior to R5 Simian Human Immunodeficiency Virus (SHIV) infection by Tasca and colleagues suggest that absence or reduction of humoral immune responses alone is insufficient to promote X4 evolution (237) R5 SHIV consists of R5 SIV Env in a HIV 1 genome backbone. Overall,

PAGE 121

121 target cell availability of CXCR4 expressing CD4 T cells during disease progression in combination with immune control of virus potentially modulate X4 emergence Mechanism of X4 evolution The contribution of V1V2 in Env coreceptor use have been previously reported (132, 168) but the current study of coreceptor use and primary cell tropism using longitudinal Envs provides physiological support for V1V2 in modulating Env coreceptor genotype evolution during disease progression. To determine the role of V1V2 in X4 evolution and macrophage tropism, inhibitory agents were used to probe differences in conformation and entry eff iciency of R5 and R5X4 Envs from subject S2 (Figure 2 7 page 79 ) Inhibitory agents are widely used as invaluable tools for probing HIV 1 Env confor mation and efficiency of discre t e steps in entry (31, 233, 236, 267 ) The data in the current study suggest that efficient CD4 and coreceptor use due to the accessibility of such domains on functional R5X4 intermediates potentially facilitates X4 evolution. Although future molecular genetics approaches are needed to conf irm the cooperative role of V1V2 and V3 in influencing X4 evolution and host cell tropism, the current study provides a unique assessment for a mechanism of X4 evolution using surrogate probes of Env conformation and entry efficiency. X4 evolution and host cell tropism Env coreceptor use on CD4 T cells validated Env phenotype for entry into U87 indicator cells (Figure 2 4 page 7 6 ) However, coreceptor use alone failed to infer cell tropism as CD4 T cell tropic CCR5 using Envs failed to mediate entry into m acrophages (Figure 2 5 page 77 ) Independent coreceptor use on CD4 T cells and macrophages by R5X4 Envs implicated that distinct genotypic determinants in envelope modulate coreceptor use on different cell types. Additionally, different CCR5 and CXCR4

PAGE 122

122 con formations and levels of expression on CD4 T cells and macrophages potentially dictate coreceptor use and tropism (136, 239) Macrophage infection required eight times more virus for infection compared to infection of U87 cell lines, and four times more virus for CD4 T cell infection. Low titer viruses were insufficient to study macrophage tropism and may have contributed to a limited number of macrophage tropic viruses detected. Nonetheless, tropism of non diving ma crophages implicates a cellular reservoir for infectious viruses of efficient infectivity in vitro In general, cellular factors appear to play a crucial role in modulating host cell tropism in addition to viral developmental programs that modulate corecep tor use. X4 evolution via R5X4 Envs of distinct coreceptor preference R5X4 Envs were previously reported to primarily use CXCR4 on CD4 T lymphocytes due to inefficient use o f low level CCR5 expression (144) Howe ver, the current study provides evidence for CD4 T lymphocyte tropism by preferential CCR5 using R5X4 Envs (Figure 2 4 page 7 6 ) via efficient CCR5 use (Figure 2 7 p age 79 ) The contribution of CD4 use to net CCR5 use efficiency was undetermined due to th e limitations of our assays. However, R5 and R5X4 viruses achieved 100% inhibition at 100 nM Maraviroc (Figure 2 7 page 79 ) Thus a requirement for more Maraviroc to achieve 50% inhibition of R5X4 relative to R5 viruses, was potentially reflective of effi cient CCR5 use rather than drug resistance. CD4 T lymphocyte tropism of R5X4 Envs of different preference in CCR5 and CXCR4 use in the current study provided physiological support for a model of X4 evolution modulated by preferential CCR5 an d CXCR4 using i ntermediates (101) Preferential CCR5 use on CD4 T cells by R5X4 Envs identified in the current study (Figure 2 4 page 7 6 ) is consistent with a single cross sectional study that previously reported R5X4 Envs of pre ferent ial CCR5 use on

PAGE 123

123 CD4 T cells (89) Previously reported R5X4 Envs mediated entry into MDMs via CCR5 and CXCR4 equally well (89, 262) In contrast, preferential CCR5 using Envs in the current study mediated exclusive CCR5 use into macrophages. Overall, there is an evolution of preference in coreceptor use on CD4T cells and/or macrophages by R5X4 Envs, thus highlighting the complexity of the developmental program of Env core ceptor use evolution. Furthermore, the mechanism facilitating preferential CCR5 dependent entry into CD4 T cells and exclusive CCR5 dependent entry into macrophages by unique R5X4 Envs identified in this study was associated with a combination of increased access to CD4 binding site and V3 loop, and efficient CCR5 use and fusion in agreement with previous studies. Role of P roline emergence in Env V1 domain Inhibition studies with entry inhibitors and monoclonal antibodies facilitated the structure function analysis of HIV 1 Env gp120 due to Proline emergence in V1 (Figure 3 5, page 9 4 ; Figure 3 6, page 9 5 ) Proline residue has a complex architecture that contains a ring structure as the reactive (R) group, thus making Proline residues more conformationally r estricted than other amino acids and favors the presence of Proline residues in protein turns (14) The exact location of V1V2 relative to V3 and ot her domains in the native form of Env remains elusive given the lack of a crystal structure of trimeric Env gp120, but several consistent models of Env trimer have been proposed based on data from structural studies of monomeric gp120 (38, 99, 100, 130, 171) Env V1 domain is predicted to exist as a loop in the secondary structure of gp120 (131, 142, 254) T hus Proline emergence may modulate the V1 loop conformation relative t o other domains in the Env trimer and impact entry and antibody neutralization sensitivity in agreement with previous studies where residues in V1 In general, the presence of

PAGE 124

124 Proline residue in Env V1 (P147) conformation chara cteristic of decreased access to CD4 binding site and V3 loop which may impact entry efficiency and sensitivity to neutralizing antibodies Proline emergence during Env evolution and pathogenesis Proline emergence was observed in Envs independent of pred icted coreceptor use (Figure 3 1 page 9 0 ). Proline emergence was associated with different kinetics in regards to disease progression, as Proline emerged after CD4 T cell decline in two of three subjects analyzed (Figure 3 2 page 9 1 ). HIV 1 Envs that enc oded a Proline residue in V1 (P147) displayed less net entry efficiency compared to longitudinal Envs that lacked a Proline residue in V1 (Figure 3 4A page 9 3 ) P147 Envs displayed a closed conformation based on access to CD4 targeted recombinant protein and V3 loop targeted monoclonal antibody, in contrast to mutant P147T Envs A closed Env conformation contributed by Proline residue in V1 domain potentially facilitates immune evasion of neutralizing antibodies without losing the ability to enter ta rget c ells, albeit a decreased entry efficien cy However, P147 and mutant P147T Envs displayed similar net entry efficiency (Figure 3 4B page 9 3 ), indicating that Proline alone is insufficient to modulate net entry efficiency. Chang and colleagues p revious ly re ported that Env interaction with CD4 and the coreceptor complex was stro nger and lasted longer than Env CD4 binding alone (37) Thus changes in Env CD4 binding alone may not impact net viral entry efficiency if Env coreceptor use and fusion efficiencies are similar as inferred in studies of P14 7 and mutant P147T Envs using inhibit ory agents that disrupt discrete steps in entry (Figure 3 5, page 9 4 ; Figure 3 6 page 9 5 ) A ltering Proline in V1 failed to impact net viral entry thus supporting a role for immune evasion and/or efficiency at discrete steps in entry that may facilitate disease progression.

PAGE 125

125 Validation of StdG generated sequences S tdG and SGA d etected similar frequency of recombinants in HIV 1 samples (Figure 4 5 page 11 4 ) suggesti ng that standard genotyping does not amplify the number of in vivo generated recombinants and provide s SGA comparable genetic coverage of viral diversity, in agreement with a previous study (110) The data also indicate that StdG generated envelopes analyzed in the current studies were authentic in vivo envelopes and not PCR artifacts. The number of sequences analyzed and the e xtent of sample diversity impact the opportunity to identify the same sequenc es generated via StdG and SGA. Thus the similarity of StdG and SGA recombinants was assessed based on gene tic characteristics across the env genome (Figure 4 6 page 115 ) indica tive of the evolutionary r elatedness among the sequences. Overall, S GA provides a reliable means of intra study validation of high throughput PCR based sequencing methods, and evidence of a high frequency of recombinants that potentially contributes to vir al evolution Impact of r ecombination on HIV 1 pathogenesis and X4 evolution R ecombinants may provide misleading evolutionary information for sequenc es analyzed in phylogenetic tree s (221) thus were removed from sequences prior to phylogenetic analysis using the PHI NNet algorithm (Figure 4 3 page 11 7 ). R ecombination involves t he lateral transfer of genes thus r ecombination between envelopes of heterozygous genomes in a virion produced from a coinfected cell may generate a recombinant env genome that encodes an Env with an altered function compared to the parent Envs involved i n the recombination process. Recombinants have been implicated in drug resistance (192) which may open a fitness avenue for viruses during infection and promote disease progression.

PAGE 126

126 Recombinants have also been suggested to increase the frequency for X4 viruses upon the initial emergence of a low fre quency of X4 viruses (155) Incr eased frequency of X4 viruses due to recombination may contribute to CD4 T cell decline and rapid progression to AIDS. Furthermore, recombination in envelope may impact the overall Env conformation that modulates neutralizing antibody sensitivity. Thus rec ombination between env variants may generate a progeny Env with advantages of mediating immune evasion. Overall, r ecombination in envelope may impact Env function for entry (efficient CD4 and coreceptor use and fusion) cell tropism, and antibody neutrali zation sensitivity. Insights for vaccine development To date a prophylactic or therapeutic vaccine remains elusive R5X4 Envs, which are intermediates for X4 evolution provide a target for blocking X4 evolution but R5X4 Envs of different phenotypes may e merge during the evolutionary R5 to X4 process The current study provides evidence that R5X4 Envs with preferential CCR5 use on host cells may exhibit an open conformation and p rovides a ta rget for blocking X4 evolution (Chapter 2) In contrast, t he curre nt study also provides evidence of R5X4 Envs of a closed conformation, which may be facilitated by Proline residue in V1 (P147) (Chapter 3) R5X4 Env conformations may be a cause or consequence of Env coreceptor use evolution, but the determinants of R5X4 Envs that confer an open conformation and Proline induced closed conformation may provide the basis for immunogen design of therapeutic vaccines to block entry of R5X4 Envs and stunt X4 emergence Additionally, prophylactic vaccines should incorporate resi dues that modulate R5X4 conformation, and confer complex Env architecture such as Proline in

PAGE 127

127 V, as R5X4 Envs may be transmitted and establish founder infection albeit at a low frequency. Overall c onclusions and significance Discontinuous residues modulate X4 evolution via an ordered dev elopmental program not explained by V3 genotype alone. V1V2 determinants in combinat ion with V3 potentially determine the ordered developmental program for X4 evolution via R5X4 intermediates of distinct coreceptor preference The kinetics of V1V2 and V3 mutations that may facilitate X4 developmental program was undetermined in the current study. However, previous studies suggest that CXCR4 use is facilitated by compensatory changes in V1V2 prior to high charge mutations in V3 (172, 211) Given the heterogeneity in R5 virus population in HIV 1 quasispecies, it remains undetermined if other lineages of R5 viruses give rise to X4 via non V3 determinants located outside of V1V2 such as C3 V5 An increased access to CD4 binding site and V3 loop implicated the role of efficient CD4 and coreceptor use by R5X4 Envs during X4 evolution. Further studies of longitudinal R5X4 Envs of distinct coreceptor preference on host cells will provide suppor t for the model of X4 evolution presented in the current study. Proline in V1 is a potential residue to consider for immunogen design of prophylactic and therapeutic vaccines to prevent R5X4 Env transmission a nd founder infection, and X4 emergence, respec tively. However, identifying the predominant genotypic determin ants for CXCR4 use by R5X4 Envs will provide insights fo r immunogen design of novel therapeutic vaccines to block R5 to X4 evolution and targets for the development of novel CXCR4 entry inhibi tors to stunt X4 evolution and the rapid progression to AIDS.

PAGE 128

128 APPENDIX A GENOTYPIC AND FUNCTIONAL ANALYSIS OF HIV 1 ENV ELOPE S In order to identify genotypic determinants that potentially regulate viral entry and antibody neutralization sensitivity HIV 1 env V1 V5 domains from six subtype B infected subjects were genotypically and functionally analyzed for entry and cell tropism (Chapters 2 and 3). Fifty eight HIV 1 e nvs were amplified from pr oviral DNA and plasma for over 3 to 8 years post infection acro ss the six subject s V1 V5 region s were cloned into pcDNA3.1 JRFLgp160 co nstructs and subsequently pseudo typed onto pNL4 3Luc + R + E for functional analysis (Chapters 2 and 3). Of the 58 e nv constructs made 28 Envs were scored as functiona l based on entry in to U87CD4 CCR5 and/or U87CD4 CXCR4 cells using 200 l of virus ( qualitative assessment ) (Table A 1). 200 l of virus is not standardized for infectivity and is typically more virus than is required for infection using a normalized amount of infectious viru s described in Chapters 2 and 3 The 28 f unctional viruses were subsequently titered for infectivity and functionally characterized on U87 indicator cells and primary cells using a normalized amount of infectious vir us (Chapters 2 and 3). Qualitative asses sment of Env function for entry into U87 cells was consistent with function using a standardized amount of infectious virus Furthermore, non functional viruses that failed to m ediate infection using 200 l of virus failed to achieve an infectious titer (t iter comparable to background). In general, over 50% of Envs from the constructs made were applicable for use in functional studies. Viral entry is Env dependent Thus, Env expression from constructs and incorporation into pseudotyped virions were assesse d as determining factors for Env functionality. Env gp120 expression from the env constructs was assessed in whole cell lysates of 293T cells transfected with env constructs (Fig ure A 1 A ). Env gp120

PAGE 129

129 incorporation into Env pseudotyped viruses was assessed u sing virus harvested in supernatant of 293T cells during virus production (Fi g ure A 1B ). Figure A 1A illustrate d that gp120 was expressed from constructs linked to functional and non functional viruses and undetectable levels of gp120 expression was obser ved fo r some non functional viruses. Efficiently expressed c odon optimized p96ZM651gp160 opt obtained from the AIDS Research and Reagent Reference Program (76) was used as a reference construct for gp120 expression and pNL4 3Luc + R + E was used as a negative control. Differences in the relative amount of Env gp120 in the 293T cell lysates reflected differences in gp120 band intensities on each immunoblot, but the band intensity across blots may be reflected by differences in film exposure time duri ng blot development. Figure A 1B illustrate d that Env gp120 was incorporated into functional and non functional viruses Differences in gp120 detection reflected different relative amounts of gp120 in each viral supernatant D ifferent Env protein bands pot entially represented processed gp120 and unprocessed gp160 that are incorporated into virions (252) The mobility of gp120 fr om different viruses may reflect differences in patterns and number of glycosylation (19) Overall, Env gp120 expression from constructs or incorporation into virions alone is insufficient to predict virus function for entry. Functional Envs were extensively analyzed for genotypic signatures that may impact coreceptor use and antibody neutralization sen sitivity including length, net charge, and number of PNGs of variable and conserved domains Envs from each subject were aligned based on the timepoint of amplification, which was associated with length of infection (years) and percent CD4 T cells. In subj ect S1 R5 E nvs displayed differences in V1V2 and V4 length due to differences in the number PNGs and

PAGE 130

130 differences in the number of PNGs in V3 domain without changes in length (Fig ure A 2 ) previously demonstrated to impact antibody neutralization sensitiv ity (28, 98, 158, 244, 250) Thus, R5 evolution in subject S1 potentially facilitated evasion of antibody neutralization during disease progression. Additionally, R5 Envs disp layed different net charge in V1 that ma y modulate efficient interaction with CCR5 (62, 146) In subject S2, a unique R5 Env (2.2 ) displayed increased V1 and V4 length that was associated with differences in the number of PNGs, relative to R5 and R5X4 Env s sampled later i n infection (~2 years) (Fig. A 3 ), suggesting a role for V1 and/or V4 in mo dulating CD4 use efficiency and sensitivity to neutralizing antibodies as previously reported (163, 173, 183, 267) R5 Envs had longer V2 domai n than the R5X4 Envs. The V1V2 differences in length, PNGs and amino acid composition may be determinant factors in explaining differences in CCR5 use efficiency and sensitivity to neutralizing antibodies between R5 and R5X4 Envs as sho wn in Fig ure 2 8. In subject S 3, R5X4 Envs generally displayed similar amino acid length, net charge and number of P NGs in e nv regions (Fig ure A 4 ). Envs 3.2 and 3 .3 in subject S3 displayed similar amino acid sequence across V1 V5 which was different from Envs sampled earlier in infection Proline emergence in V1 domain of Envs 3.2 and 3.3 (Fig ure A 4A) were functional ly characterized in Chapter 3. Additionally, Env 3.1 displayed shorte r V4 length that was associated with a decrease in the number of PNGs ( Fig ure A 4B), suggesting a modulation in phenotype of antibody neutralization sensitivity relative to the other longitudinal R5X4 Envs in subject S 3 as previously reported (158, 183) In subject S 4, R5X4 Env 4.2 enc oded one less PNGs relative to an X4 (4.3) and a R5X4 (4.1 ) Env sampled ap proximately 8 and 9 years later, respectively (Fig ure A 5). The emergence of Proline and potential compensatory

PAGE 131

131 residues (non PNGs) to facilitate the conformational flexibility of Pr oline in V1 of Envs 4.1 and 4.3 contributed to an increase in V1 leng th (Fig ure A 5 ). Proline emergence in V1 is associated with an increase V1 length in subject S4 (Fig ure A 5), in contrast to no change in V1 length in subject S3 (Figure A 4). The role of Proline due to an increase or no change in V1 length remains to be defined. In S 5, the most notable difference among R5X4 and X4 sequences was the decrease V4 length of R5X 4 Env (5.1 ) that was associated with a decrease number of PNG s and net charge (Fig u re A 6). R5X4 Env 5.1 potentially has a different phenotype for antibody neutralization sensitivity and entry efficiency relative to other R5X4 and X4 Envs in agreement with previous studies (158, 173, 183) In subj ects S1 and S 3 genotypic differences in Env independent of coreceptor use may modulate CD4 use efficiency and antibody neutralization sensitivity In contrast, genotypic changes in Env s from subjects S 2, S 4, and S5 may contribute to the evolution of diff erent coreceptor use. In general, amino a cid sequence analysis of HIV 1 envs amplified from longitudinal samples within each subject revealed that differences in length, net charge and PNGs across V1 V5 domains may impact Env function for entry [CD4 and co receptor use], host cell tropism, and neutralizing antibody sensitivity.

PAGE 132

132 Table A 1. Characterization of Functional HIV 1 Env elope s. Env V1 V5 domains from longitudinal samples across six HIV 1 subtype B infected subjects were functiona l l y characterized fo r entry into U87CD4 CCR5 and U87CD4 CXCR4 cells. Phenotype of functional Envs are defined as R5 (CCR5 using), R5X4 (CCR5 and CXCR4 using), and X4 (CXCR4 using). Subject ID HIV 1 env sequences env constructs Functional Envs Env phenotype Quasi species Va riants Diversity (%) No. Variants (%) R5 R5X4 X4 S 1 46 19 41 10 53 7 7 0 0 S 2 22 4 18 4 100 4 2 2 0 S 3 124 16 13 12 75 6 0 7 0 s 4 60 17 28 6 35 3 0 2 1 S 5 88 20 23 9 45 8 0 2 6 S 6 33 24 73 17 71 0 0 0 0 Total 373 100 27 58 58 28 9 13 7

PAGE 133

133 Figure A 1. Env elope E xpression and Virus I nfectivity. Env gp120 expression was actin expression in 293T cell lysate (A), and incorporation into env pseudotyped viruses (B). p96ZM651gp160 opt (Env + ) and mock (Env ) transfected 293T cell lysate wer e controls for gp120 expression. Bb (virion backbone) pNL4 3Luc + R + E (B) Env IDs shown in red and black indicate Envs pseudotyped onto functional and non functional viruses respectively. Function was determined based on entry into U87CD4 CCR5 and U87CD4 CXCR4 cells

PAGE 134

134 Figure A 2 Genotypic A naly sis of HIV 1 Envelopes from S 1. V1 V5 regions amplified from l ongitudinal samples in subject S 1 were aligned based on time of sampling (A) Sequences were numbered according to s tandard HI V 1 HXB2 numbering (B) The time of sampling in regards to length of infection (years) and CD4%, and summary o f genotypic characteristics for envs are shown

PAGE 135

135 Figure A 3 Genotypic Analysis of HIV 1 Envelopes from S 2 V1 V5 regions amplified from l ongit udinal samples in subject S 2 were aligned based on time of sampling (A) Sequences were numbered according to s tandard HIV 1 HXB2 numbering (B) The time of sampling in regards to length of infection (years) and CD4%, and summary o f genotypic characteristic s for envs are shown.

PAGE 136

136 Figure A 4 Genotypic Analysis of HIV 1 Envelopes from S 3 V1 V5 regions amplified from l ongitudinal samples in subject S 3 were aligned based on time of sampling (A) Sequences were numbered according to s tandard HIV 1 HXB2 numb ering (B) The time of sampling in regards to length of infection (years) and CD4%, and summary o f genotypic characteristics for envs are shown.

PAGE 137

137 Figure A 5 Genotypic Analysis of HIV 1 Envelopes from S 4 V1 V5 regions amplified from l ongitudinal sample s in subject S 4 were aligned based on time of sampling (A) Sequences were numbered according to s tandard HIV 1 HXB2 numbering (B) The time of sampling in regards to length of infection (years) and CD4%, and summary o f genotypic characteristics for envs ar e shown.

PAGE 138

138 Figure A 6 Genotypic Analysis of HIV 1 Envelopes from S 5 V1 V5 regions amplified from l ongitudinal samples in subject S 5 were aligned based on time of sampling (A) Sequences were numbered according to s tandard HIV 1 HXB2 numbering (B) The t ime of sampling in regards to length of infection (years) and CD4%, and summary o f genotypic characteristics for envs are shown.

PAGE 139

139 APPENDIX B OPTIMIZATION OF SING LE CYCLE VIRUS ASSAY S U87 Infections Human astroglioma cell line U87 cells, which were enginee red to express CD4 and CCR5 or CXCR4 were obtained from the NIH AIDS Reagent and Reference Program and used to assess Env function for entry (20, 56) U87 cells endogenously express orphan receptors, GPR1 and Bonzo/ STRL33, which faci litated entry of SIV and HIV 2 isolates (20) but not HIV 1 isolates (42, 105) In the current study, U87CD4 CCR5 and U87CD4 CXCR4 cells served as appropria te cell models to test Env function for entry via CD4 and CCR5 or CXCR4 use, respectively. R5 (JRFL) env pseudotyped virus mediated entry exclusively into U87CD4 CCR5 (Fig ure B 1) and X4 (LAI, MM) env pseudotyped viruses mediated entry exclusively into U 87CD4 CXCR4 cells (Fig ure B 2). CCR5 inhibitors [ TAK779 (1 M) and Maraviroc (5 M) ] blocked entry of R5 vir uses into U87CD4 CCR5 cells suggesting that entry into U87CD4 CCR5 is CCR5 dependent (F igure B 1). CXCR4 inhibitor [ AMD3100 (10 g/ml)] inhibited e ntry of X4 viruses into U87CD4 CXCR4 to less than 1% of viral entry in the absence of inhibitors (Fig ure B 2), suggesting that viral entry into U87CD4 CXCR4 cells is CXCR4 dependent. Virus T it ration on Tzm bl and U87 C ells HeLa cell line derived Tzm bl (J C53) obtained from the AIDS Research and Reference Reagent Program were engineered to express CD4 and CCR5 in additio n to endogenous CXCR4, and l uciferase under the control of the HIV 1 promoter (185) Tzm bl cell line is widely used in neutralization assay s (187) but baseline luciferase activity provides a challenge for titering low infectious viruses In the current study, viruses that

PAGE 140

140 f ailed to mediate entry above a cutoff of 1.5 times baseline luciferase activity in Tzm b l cells failed to obtain an infectious titer and had to be exc lud ed from functional studies. Some functional viruses qualitatively scored for entry into U87CD4 CCR5 and/or U87CD4 CXCR4 cells failed to achieve an infectious titer on Tzm bl cells indicativ e of Envs of low infectivity. Virus titration on U87 cells was a n alternative approach for titering low infectious viruses. Low infectious v iruses that failed to achieve a titer on Tzm bl cells displayed high titers on U87 indicator cells (Table B 1), sugg esting that cell environment including receptor expression levels impact virus titer in agreement with a previous study (206) R5X4 Envs displayed different titers on U87CD4 CCR5 and U87CD4 CXCR4 cell lines, impl icating that R5X4 infectivity may be impacted by preferential coreceptor use which may be un detected during infection of standard cell lines that express both CCR5 and CXCR4. In general, virus titer is impacted by the environment of the target cells used for nor malization. Macrophage I nfection Macrophages differentiated from peripheral blood monocytes (84) are typically difficult to infect in vitro (105, 181) potentially due to low er levels of CD4 and coreceptor expression relative to CD4 T cells (23, 113, 186, 239) Viral entry into monocyte derived macrophages (MDMs) is assessed as accumulation of luciferase activity regulated via replication of l uciferase tagged viral genome. T he amount of infectious virus num ber of days of monocyte differentiation prior to infection, and number of days post infection to quantify luciferase activity were optimized for macrophage infection (Fig ure s B 3 and B 4). Represent ative macrophage tropic reference (JRFL) and primary R5 (S 1.7) and X4 (S5.3) Envs were selected for macrophage tropic optim ization studies. Six to ten days (6, 8, 10) post monocyte differentiation was suitable for macrophage infection of

PAGE 141

141 reference env pseudotyped virus, but primary env pseudotyped viruses media te d entry into 8 10 days old differentiated monocytes (Fig ure B 3). 200 TCID 50 of virus generally yielded higher luciferase activity for viral infection compared to 100 TCID 50 and luciferase activity was comparable at 4 and 7 days post infection (Fig ure B 3 ) Donor variability further complicated macrophage infectivity and the optimal days post monocyte differentiation that yielded highest luciferase activity (Fig ure B 4). Given the high infectious amounts of virus required for macrophage infection of up to 200 TCID 50 compared to 50 TCID 50 on CD4 T cells and 25 TCID 50 on U87 cells, macrophage tro pic studies were limited to high titer viruses indicative of high infectivity

PAGE 142

142 Figure B 1. Env elope F unction for Entry into U87CD4 CCR5 C ells. U87CD4 CCR5 cells facilitated entry of CCR5 using Env. Env coreceptor use phenotypes R5 (JRFL); X4 (LAI, MM). Coreceptor inhibitors TAK779, Maraviroc ( CCR5 ); AMD310 0 (CXCR4 ) UI uninfected.

PAGE 143

143 Figure B 2. Env elope Function for Entry into U87CD4 CXCR4 C ells. U87CD4 C XCR4 cells faci litated entry of CXCR4 using Env s Env coreceptor use phenotypes R5 (JRFL); X4 (LAI, MM). Coreceptor inhibitors TA K779, Maraviroc (CCR5 ); AMD3100 (C XCR4 ). UI uninfected.

PAGE 144

144 Table B 1 Virus Titration on Independent C ell L ines. Referenc e (JRFL, LAI, MM), and primary env pseudotyped viruses from different subjects were quantified for virion production (p24 pg/ml), and normalized for infectivity on Tzm bl, and U87CD4 CCR5 and/or U87CD4 CXCR4 cell lines. nd not determined. Env ID Env phe notype p24 (pg/ml) Titer (TCID 50 /ml) Tzm bl U87CD4 CCR5 U87CD4 CXCR4 JRFL R5 1788 2564 10240 nd LAI X4 nd 777 nd 10240 MM X4 nd 1285 nd 10240 S 1.5 R5 2438 3841 10240 nd S 1.4 R5 2329 777 5785 nd S 2. 3 R5X4 2771 910 7240 2560 S4.2 R5X4 3673 40 113 4505 S 5.3 X4 1703 196 nd 3840 S 5. 5 X4 3817 40 nd 160

PAGE 145

145 Figure B 3. Optimization of Macrophage I nfection. M onocytes differentiated for 6 (blue bars), 8 (red bars), and 10 (green bars) days were infected with 100 (A, B) or 200 (C,D) TCID 50 of reference (JRFL) and primary env pseudotyped virus es Luciferase activity in MDMs were quantified 4 (A,C) and 7 (B,D) days post infection. Error bars represent range of duplicate infections for MDM donor Figure B 4 Donor Variability in Macrophage I nfections. Monocytes from three independent donors (Donor 1 white bar; Donor 2 black bar; Donor 3 gray bar) were differentiated 6 (A), 8 (B), and 10 (C) days prior to infection with 100 TCID 50 of reference and primary macrophage tropic R5 env pseudotyped viruse s. Luciferase activity was quantified 4 days post infection. Error bars represent range of duplicate infections.

PAGE 146

146 LIST OF REFERENCES 1. 2009. 2009 AVAC Report: Piecing Together the HIV Prevention Puzzle AVAC, Global advocacy for HIV pr evention. 2. 2007. A frica's first large scale HIV vaccine study launches HIV Vaccine Trials Network. 3. 2011. Panel on Antiretroviral Guidelines for Adults and Adolescents. Guidelines for the use of antiretroviral agents in HIV 1 infected adults and ado lescents. Department of Health and Human Services. 4. 2010. UNAIDS report on the global AIDS epidemic 2010. UNAIDS, Geneva. 5. 2009. Estimating the impact of an AIDS vaccine in developing countries. International AIDS Vaccine Initiative. 6. Alkhatib, G. 2009. The biology of CCR5 and CXCR4. Curr Opin HIV AIDS 4: 96 103. 7. Allen, S. J., S. E. Crown, and T. M. Handel. 2007. Chemokine: receptor structure, interactions, and antagonism. Annu Rev Immunol 25: 787 820. 8. Archer, J., A. Rambaut, B. E. Taillon, P R. Harrigan, M. Lewis, and D. L. Robertson. 2010. The evolutionary analysis of emerging low frequency HIV 1 CXCR4 using variants through time -an ultra deep approach. PLoS Comput Biol 6: e1001022. 9. Baba, M., O. Nishimura, N. Kanzaki, M. Okamoto, H. Saw ada, Y. Iizawa, M. Shiraishi, Y. Aramaki, K. Okonogi, Y. Ogawa, K. Meguro, and M. Fujino. 1999. A small molecule, nonpeptide CCR5 antagonist with highly potent and selective anti HIV 1 activity. Proc Natl Acad Sci U S A 96: 5698 5703. 10. Baird, H. A., R. Galetto, Y. Gao, E. Simon Loriere, M. Abreha, J. Archer, J. Fan, D. L. Robertson, E. J. Arts, and M. Negroni. 2006. Sequence determinants of breakpoint location during HIV 1 intersubtype recombination. Nucleic Acids Res 34: 5203 5216. 11. Baldwin, C., and B. Berkhout. 2008. Mechanistic studies of a T20 dependent human immunodeficiency virus type 1 variant. J Virol 82: 7735 7740. 12. Bannert, N., D. Schenten, S. Craig, and J. Sodroski. 2000. The level of CD4 expression limits infection of primary rhesus monk ey macrophages by a T tropic simian immunodeficiency virus and macrophagetropic human immunodeficiency viruses. J Virol 74: 10984 10993.

PAGE 147

147 13. Basu, V. P., M. Song, L. Gao, S. T. Rigby, M. N. Hanson, and R. A. Bambara. 2008. Strand transfer events during HIV 1 reverse transcription. Virus Res 134: 19 38. 14. Berg, J., J. Tymoczko, and L. Stryer. 2002. Biochemistry, Fifth edition ed. W.H. Freeman and Company. 15. Berger, E. A., R. W. Doms, E. M. Feny, B. T. Korber, D. R. Littman, J. P. Moore, Q. J. Sattentau, H. Schuitemaker, J. Sodroski, and R. A. Weiss. 1998. A new classification for HIV 1. Nature 391: 240. 16. Berger, E. A., P. M. Murphy, and J. M. Farber. 1999. Chemokine receptors as HIV 1 coreceptors: roles in viral entry, tropism, and disease. Annu Rev I mmunol 17: 657 700. 17. Berkowitz, R. D., S. Alexander, and J. M. McCune. 2000. Causal relationships between HIV 1 coreceptor utilization, tropism, and pathogenesis in human thymus. AIDS Res Hum Retroviruses 16: 1039 1045. 18. Bernard, A. 1984. Leucocyte t yping : human leucocyte differentiation antigens detected by monoclonal antibodies : specification, classification, nomenclature Berlin, New York : Springer Verlag. 19. Binley, J. M., Y. E. Ban, E. T. Crooks, D. Eggink, K. Osawa, W. R. Schief, and R. W. Sanders. 2010. Role of complex carbohydrates in human immunodeficiency virus type 1 infection and resistance to antibody neutralization. J Virol 84: 5637 5655. 20. Bjrndal, A., H. Deng, M. Jansson, J. R. Fiore, C. Colognesi, A. Karlsson, J. Albert, G. Sca rlatti, D. R. Littman, and E. M. Feny. 1997. Coreceptor usage of primary human immunodeficiency virus type 1 isolates varies according to biological phenotype. J Virol 71: 7478 7487. 21. Blankson, J. N., D. Persaud, and R. F. Siliciano. 2002. The challeng e of viral reservoirs in HIV 1 infection. Annu Rev Med 53: 557 593. 22. Bleul, C. C., M. Farzan, H. Choe, C. Parolin, I. Clark Lewis, J. Sodroski, and T. A. Springer. 1996. The lymphocyte chemoattractant SDF 1 is a ligand for LESTR/fusin and blocks HIV 1 e ntry. Nature 382: 829 833. 23. Bleul, C. C., L. Wu, J. A. Hoxie, T. A. Springer, and C. R. Mackay. 1997. The HIV coreceptors CXCR4 and CCR5 are differentially expressed and regulated on human T lymphocytes. Proc Natl Acad Sci U S A 94: 1925 1930. 24. Brenc hley, J. M., T. W. Schacker, L. E. Ruff, D. A. Price, J. H. Taylor, G. J. Beilman, P. L. Nguyen, A. Khoruts, M. Larson, A. T. Haase, and D. C. Douek.

PAGE 148

148 2004. CD4+ T cell depletion during all stages of HIV disease occurs predominantly in the gastrointestinal tract. J Exp Med 200: 749 759. 25. Briggs, D. R., D. L. Tuttle, J. W. Sleasman, and M. M. Goodenow. 2000. Envelope V3 amino acid sequence predicts HIV 1 phenotype (co receptor usage and tropism for macrophages). AIDS 14: 2937 2939. 26. Brown, J. N., J. J. Kohler, C. R. Coberley, J. W. Sleasman, and M. M. Goodenow. 2008. HIV 1 activates macrophages independent of Toll like receptors. PLoS One 3: e3664. 27. Bruen, T. C., H. Philippe, and D. Bryant. 2006. A simple and robust statistical test for detecting the presence of recombination. Genetics 172: 2665 2681. 28. Bunnik, E. M., Z. Euler, M. R. Welkers, B. D. Boeser Nunnink, M. L. Grijsen, J. M. Prins, and H. Schuitemaker. 2010. Adaptation of HIV 1 envelope gp120 to humoral immunity at a population level. Nat M ed 16: 995 997. 29. Bunnik, E. M., E. D. Quakkelaar, A. C. van Nuenen, B. Boeser Nunnink, and H. Schuitemaker. 2007. Increased neutralization sensitivity of recently emerged CXCR4 using human immunodeficiency virus type 1 strains compared to coexisting CCR 5 using variants from the same patient. J Virol 81: 525 531. 30. Bunnik, E. M., L. C. Swenson, D. Edo Matas, W. Huang, W. Dong, A. Frantzell, C. J. Petropoulos, E. Coakley, H. Schuitemaker, P. R. Harrigan, and A. B. van 't Wout. 2011. Detection of inferred CCR5 and CXCR4 using HIV 1 variants and evolutionary intermediates using ultra deep pyrosequencing. PLoS Pathog 7: e1002106. 31. Bunnik, E. M., M. J. van Gils, M. S. Lobbrecht, L. Pisas, A. C. van Nuenen, and H. Schuitemaker. 2009. Changing sensitivity t o broadly neutralizing antibodies b12, 2G12, 2F5, and 4E10 of primary subtype B human immunodeficiency virus type 1 variants in the natural course of infection. Virology 390: 348 355. 32. Butler, D. M., M. E. Pacold, P. S. Jordan, D. D. Richman, and D. M. Smith. 2009. The efficiency of single genome amplification and sequencing is improved by quantitation and use of a bioinformatics tool. J Virol Methods 162: 280 283. 33. Caputi, M., and A. M. Zahler. 2002. SR proteins and hnRNP H regulate the splicing of t he HIV 1 tev specific exon 6D. EMBO J 21: 845 855. 34. Cashin, K., M. Roche, J. Sterjovski, A. Ellett, L. R. Gray, A. L. Cunningham, P. A. Ramsland, M. J. Churchill, and P. R. Gorry. 2011. Alternative coreceptor requirements for efficient CCR5 and CXCR4 m ediated HIV 1 entry into macrophages. J Virol.

PAGE 149

149 35. Cavarelli, M., and G. Scarlatti. 2011. HIV 1 co receptor usage: influence on mother to child transmission and pediatric infection. J Transl Med 9 Suppl 1: S10. 36. Chaillon, A., M. Braibant, T. Moreau, S. Thenin, A. Moreau, B. Autran, and F. Barin. 2011. The V1V2 domain and an N linked glycosylation site in the V3 loop of the HIV 1 envelope glycoprotein modulate neutralization sensitivity to the human broadly neutralizing antibody 2G12. J Virol 85: 3642 3648 37. Chang, M. I., P. Panorchan, T. M. Dobrowsky, Y. Tseng, and D. Wirtz. 2005. Single molecule analysis of human immunodeficiency virus type 1 gp120 receptor interactions in living cells. J Virol 79: 14748 14755. 38. Chen, B., E. M. Vogan, H. Gong, J. J Skehel, D. C. Wiley, and S. C. Harrison. 2005. Structure of an unliganded simian immunodeficiency virus gp120 core. Nature 433: 834 841. 39. Chen, L., Y. D. Kwon, T. Zhou, X. Wu, S. O'Dell, L. Cavacini, A. J. Hessell, M. Pancera, M. Tang, L. Xu, Z. Y. Ya ng, M. Y. Zhang, J. Arthos, D. R. Burton, D. S. Dimitrov, G. J. Nabel, M. R. Posner, J. Sodroski, R. Wyatt, J. R. Mascola, and P. D. Kwong. 2009. Structural basis of immune evasion at the site of CD4 attachment on HIV 1 gp120. Science 326: 1123 1127. 40. C hiu, Y. L., V. B. Soros, J. F. Kreisberg, K. Stopak, W. Yonemoto, and W. C. Greene. 2005. Cellular APOBEC3G restricts HIV 1 infection in resting CD4+ T cells. Nature 435: 108 114. 41. Chong, H., K. Hong, C. Zhang, J. Nie, A. Song, W. Kong, and Y. Wang. 200 8. Genetic and neutralization properties of HIV 1 env clones from subtype B/BC/AE infections in China. J Acquir Immune Defic Syndr 47: 535 543. 42. Cilliers, T., S. Willey, W. M. Sullivan, T. Patience, P. Pugach, M. Coetzer, M. Papathanasopoulos, J. P. Moo re, A. Trkola, P. Clapham, and L. Morris. 2005. Use of alternate coreceptors on primary cells by two HIV 1 isolates. Virology 339: 136 144. 43. Cimons, M. 1987. U.S. Approves Sale of AZT to AIDS Patients, Los Angeles Times. Los Angeles Times, Los Angeles, CA. 44. Clavel, F., D. Gutard, F. Brun Vzinet, S. Chamaret, M. A. Rey, M. O. Santos Ferreira, A. G. Laurent, C. Dauguet, C. Katlama, and C. Rouzioux. 1986. Isolation of a new human retrovirus from West African patients with AIDS. Science 233: 343 346.

PAGE 150

150 4 5. Coetzer, M., R. Nedellec, T. Cilliers, T. Meyers, L. Morris, and D. E. Mosier. 2011. Extreme genetic divergence is required for coreceptor switching in HIV 1 subtype C. J Acquir Immune Defic Syndr 56: 9 15. 46. Coetzer, M., R. Nedellec, J. Salkowitz, S. McLaughlin, Y. Liu, L. Heath, J. I. Mullins, and D. E. Mosier. 2008. Evolution of CCR5 use before and during coreceptor switching. J Virol 82: 11758 11766. 47. Conley, A. J., M. K. Gorny, J. A. Kessler, L. J. Boots, M. Ossorio Castro, S. Koenig, D. W. Lin eberger, E. A. Emini, C. Williams, and S. Zolla Pazner. 1994. Neutralization of primary human immunodeficiency virus type 1 isolates by the broadly reactive anti V3 monoclonal antibody, 447 52D. J Virol 68: 6994 7000. 48. Connor, R. I., and D. D. Ho. 1994. Human immunodeficiency virus type 1 variants with increased replicative capacity develop during the asymptomatic stage before disease progression. J Virol 68: 4400 4408. 49. Connor, R. I., K. E. Sheridan, D. Ceradini, S. Choe, and N. R. Landau. 1997. Chan ge in coreceptor use correlates with disease progression in HIV 1 -infected individuals. J Exp Med 185: 621 628. 50. Cormier, E. G., and T. Dragic. 2002. The crown and stem of the V3 loop play distinct roles in human immunodeficiency virus type 1 envelope glycoprotein interactions with the CCR5 coreceptor. J Virol 76: 8953 8957. 51. Crooks, E. T., P. L. Moore, D. Richman, J. Robinson, J. A. Crooks, M. Franti, N. Schlke, and J. M. Binley. 2005. Characterizing anti HIV monoclonal antibodies and immune sera b y defining the mechanism of neutralization. Hum Antibodies 14: 101 113. 52. Crooks, E. T., T. Tong, K. Osawa, and J. M. Binley. 2011. Enzyme digests eliminate nonfunctional Env from HIV 1 particle surfaces, leaving native Env trimers intact and viral infec tivity unaffected. J Virol 85: 5825 5839. 53. Curlin, M. E., R. Zioni, S. E. Hawes, Y. Liu, W. Deng, G. S. Gottlieb, T. Zhu, and J. I. Mullins. 2010. HIV 1 envelope subregion length variation during disease progression. PLoS Pathog 6: e1001228. 54. Dalglei sh, A. G., P. C. Beverley, P. R. Clapham, D. H. Crawford, M. F. Greaves, and R. A. Weiss. 1984. The CD4 (T4) antigen is an essential component of the receptor for the AIDS retrovirus. Nature 312: 763 767. 55. Dayton, A. I., J. G. Sodroski, C. A. Rosen, W. C. Goh, and W. A. Haseltine. 1986. The trans activator gene of the human T cell lymphotropic virus type III is required for replication. Cell 44: 941 947.

PAGE 151

151 56. de Roda Husman, A. M., R. P. van Rij, H. Blaak, S. Broersen, and H. Schuitemaker. 1999. Adaptation to promiscuous usage of chemokine receptors is not a prerequisite for human immunodeficiency virus type 1 disease progression. J Infect Dis 180: 1106 1115. 57. Del Prete, G. Q., G. J. Leslie, B. Haggarty, A. P. Jordan, J. Romano, and J. A. Hoxie. 2010. Di stinct molecular pathways to X4 tropism for a V3 truncated human immunodeficiency virus type 1 lead to differential coreceptor interactions and sensitivity to a CXCR4 antagonist. J Virol 84: 8777 8789. 58. Derdeyn, C. A., J. M. Decker, F. Bibollet Ruche, J L. Mokili, M. Muldoon, S. A. Denham, M. L. Heil, F. Kasolo, R. Musonda, B. H. Hahn, G. M. Shaw, B. T. Korber, S. Allen, and E. Hunter. 2004. Envelope constrained neutralization sensitive HIV 1 after heterosexual transmission. Science 303: 2019 2022. 59. Desport, M. 2010. Lentiviruses and Macrophages: Molecular and Cellular Interactions. Caister Academic Press. 60. Dimitrov, A. S., A. Jacobs, C. M. Finnegan, G. Stiegler, H. Katinger, and R. Blumenthal. 2007. Exposure of the membrane proximal external regi on of HIV 1 gp41 in the course of HIV 1 envelope glycoprotein mediated fusion. Biochemistry 46: 1398 1401. 61. Doms, R. W., and S. C. Peiper. 1997. Unwelcomed guests with master keys: how HIV uses chemokine receptors for cellular entry. Virology 235: 179 19 0. 62. Doranz, B. J., Z. H. Lu, J. Rucker, T. Y. Zhang, M. Sharron, Y. H. Cen, Z. X. Wang, H. H. Guo, J. G. Du, M. A. Accavitti, R. W. Doms, and S. C. Peiper. 1997. Two distinct CCR5 domains can mediate coreceptor usage by human immunodeficiency virus typ e 1. J Virol 71: 6305 6314. 63. Douek, D. C., L. J. Picker, and R. A. Koup. 2003. T cell dynamics in HIV 1 infection. Annu Rev Immunol 21: 265 304. 64. Dragic, T., V. Litwin, G. P. Allaway, S. R. Martin, Y. Huang, K. A. Nagashima, C. Cayanan, P. J. Maddon, R. A. Koup, J. P. Moore, and W. A. Paxton. 1996. HIV 1 entry into CD4+ cells is mediated by the chemokine receptor CC CKR 5. Nature 381: 667 673. 65. Dragic, T., A. Trkola, D. A. Thompson, E. G. Cormier, F. A. Kajumo, E. Maxwell, S. W. Lin, W. Ying, S. O. Smith, T. P. Sakmar, and J. P. Moore. 2000. A binding pocket for a small molecule inhibitor of HIV 1 entry within the transmembrane helices of CCR5. Proc Natl Acad Sci U S A 97: 5639 5644.

PAGE 152

152 66. Duenas Decamp, M. J., and P. R. Clapham. 2010. HIV 1 gp120 det erminants proximal to the CD4 binding site shift protective glycans that are targeted by monoclonal antibody 2G12. J Virol 84: 9608 9612. 67. Duenas Decamp, M. J., P. Peters, D. Burton, and P. R. Clapham. 2008. Natural resistance of human immunodeficiency virus type 1 to the CD4bs antibody b12 conferred by a glycan and an arginine residue close to the CD4 binding loop. J Virol 82: 5807 5814. 68. Dunfee, R. L., E. R. Thomas, P. R. Gorry, J. Wang, J. Taylor, K. Kunstman, S. M. Wolinsky, and D. Gabuzda. 2006. The HIV Env variant N283 enhances macrophage tropism and is associated with brain infection and dementia. Proc Natl Acad Sci U S A 103: 15160 15165. 69. Dunfee, R. L., E. R. Thomas, J. Wang, K. Kunstman, S. M. Wolinsky, and D. Gabuzda. 2007. Loss of the N linked glycosylation site at position 386 in the HIV envelope V4 region enhances macrophage tropism and is associated with dementia. Virology 367: 222 234. 70. Edo Matas, D., K. A. van Dort, L. C. Setiawan, H. Schuitemaker, and N. A. Kootstra. 2011. Compar ison of in vivo and in vitro evolution of CCR5 to CXCR4 coreceptor use of primary human immunodeficiency virus type 1 variants. Virology 412: 269 277. 71. Emmelkamp, J. M., and J. K. Rockstroh. 2007. CCR5 antagonists: comparison of efficacy, side effects, pharmacokinetics and interactions -review of the literature. Eur J Med Res 12: 409 417. 72. Esbjrnsson, J., F. Mnsson, W. Martnez Arias, E. Vincic, A. J. Biague, Z. J. da Silva, E. M. Feny, H. Norrgren, and P. Medstrand. 2010. Frequent CXCR4 tropism of HIV 1 subtype A and CRF02_AG during late stage disease -indication of an evolving epidemic in West Africa. Retrovirology 7: 23. 73. Feng, Y., C. C. Broder, P. E. Kennedy, and E. A. Berger. 1996. HIV 1 entry cofactor: functional cDNA cloning of a seven tra nsmembrane, G protein coupled receptor. Science 272: 872 877. 74. Frankel, A. D., and J. A. Young. 1998. HIV 1: fifteen proteins and an RNA. Annu Rev Biochem 67: 1 25. 75. Galetto, R., A. Moumen, V. Giacomoni, M. Vron, P. Charneau, and M. Negroni. 2004. T he structure of HIV 1 genomic RNA in the gp120 gene determines a recombination hot spot in vivo. J Biol Chem 279: 36625 36632. 76. Gao, F., Y. Li, J. M. Decker, F. W. Peyerl, F. Bibollet Ruche, C. M. Rodenburg, Y. Chen, D. R. Shaw, S. Allen, R. Musonda, G. M. Shaw, A. J.

PAGE 153

153 Zajac, N. Letvin, and B. H. Hahn. 2003. Codon usage optimization of HIV type 1 subtype C gag, pol, env, and nef genes: in vitro expression and immune responses in DNA vaccinated mice. AIDS Res Hum Retroviruses 19: 817 823. 77. Garlick, R. L ., R. J. Kirschner, F. M. Eckenrode, W. G. Tarpley, and C. S. Tomich. 1990. Escherichia coli expression, purification, and biological activity of a truncated soluble CD4. AIDS Res Hum Retroviruses 6: 465 479. 78. Garrido, C., V. Roulet, N. Chueca, E. Poved a, A. Aguilera, K. Skrabal, N. Zahonero, S. Carlos, F. Garca, J. L. Faudon, V. Soriano, and C. de Mendoza. 2008. Evaluation of eight different bioinformatics tools to predict viral tropism in different human immunodeficiency virus type 1 subtypes. J Clin Microbiol 46: 887 891. 79. Geijtenbeek, T. B., D. S. Kwon, R. Torensma, S. J. van Vliet, G. C. van Duijnhoven, J. Middel, I. L. Cornelissen, H. S. Nottet, V. N. KewalRamani, D. R. Littman, C. G. Figdor, and Y. van Kooyk. 2000. DC SIGN, a dendritic cell spe cific HIV 1 binding protein that enhances trans infection of T cells. Cell 100: 587 597. 80. Ghaffari, G., D. J. Passalacqua, J. L. Caicedo, M. M. Goodenow, and J. W. Sleasman. 2004. Two year clinical and immune outcomes in human immunodeficiency virus inf ected children who reconstitute CD4 T cells without control of viral replication after combination antiretroviral therapy. Pediatrics 114: e604 611. 81. Ghaffari, G., D. L. Tuttle, D. Briggs, B. R. Burkhardt, D. Bhatt, W. A. Andiman, J. W. Sleasman, and M. M. Goodenow. 2005. Complex determinants in human immunodeficiency virus type 1 envelope gp120 mediate CXCR4 dependent infection of macrophages. J Virol 79: 13250 13261. 82. Goodenow, M., T. Huet, W. Saurin, S. Kwok, J. Sninsky, and S. Wain Hobson. 1989. H IV 1 isolates are rapidly evolving quasispecies: evidence for viral mixtures and preferred nucleotide substitutions. J Acquir Immune Defic Syndr 2: 344 352. 83. Goodenow, M. M., and R. G. Collman. 2006. HIV 1 coreceptor preference is distinct from target c ell tropism: a dual parameter nomenclature to define viral phenotypes. J Leukoc Biol 80: 965 972. 84. Gorantla, S., M. Che, and H. E. Gendelman. 2005. Isolation, propagation, and HIV 1 infection of monocyte derived macrophages and recovery of virus from br ain and cerebrospinal fluid. Methods Mol Biol 304: 35 48. 85. Gordon, S., and P. R. Taylor. 2005. Monocyte and macrophage heterogeneity. Nat Rev Immunol 5: 953 964.

PAGE 154

154 86. Gorny, M. K., A. J. Conley, S. Karwowska, A. Buchbinder, J. Y. Xu, E. A. Emini, S. Koeni g, and S. Zolla Pazner. 1992. Neutralization of diverse human immunodeficiency virus type 1 variants by an anti V3 human monoclonal antibody. J Virol 66: 7538 7542. 87. Gorry, P. R., and P. Ancuta. 2011. Coreceptors and HIV 1 pathogenesis. Curr HIV/AIDS Re p 8: 45 53. 88. Gorry, P. R., G. Bristol, J. A. Zack, K. Ritola, R. Swanstrom, C. J. Birch, J. E. Bell, N. Bannert, K. Crawford, H. Wang, D. Schols, E. De Clercq, K. Kunstman, S. M. Wolinsky, and D. Gabuzda. 2001. Macrophage tropism of human immunodeficien cy virus type 1 isolates from brain and lymphoid tissues predicts neurotropism independent of coreceptor specificity. J Virol 75: 10073 10089. 89. Gray, L., M. J. Churchill, N. Keane, J. Sterjovski, A. M. Ellett, D. F. Purcell, P. Poumbourios, C. Kol, B. W ang, N. K. Saksena, S. L. Wesselingh, P. Price, M. French, D. Gabuzda, and P. R. Gorry. 2006. Genetic and functional analysis of R5X4 human immunodeficiency virus type 1 envelope glycoproteins derived from two individuals homozygous for the CCR5delta32 all ele. J Virol 80: 3684 3691. 90. Gray, L., M. Roche, M. J. Churchill, J. Sterjovski, A. Ellett, P. Poumbourios, S. Sherieff, S. Sheffief, B. Wang, N. Saksena, D. F. Purcell, S. Wesselingh, A. L. Cunningham, B. J. Brew, D. Gabuzda, and P. R. Gorry. 2009. Tis sue specific sequence alterations in the human immunodeficiency virus type 1 envelope favoring CCR5 usage contribute to persistence of dual tropic virus in the brain. J Virol 83: 5430 5441. 91. Gray, L., J. Sterjovski, M. Churchill, P. Ellery, N. Nasr, S. R. Lewin, S. M. Crowe, S. L. Wesselingh, A. L. Cunningham, and P. R. Gorry. 2005. Uncoupling coreceptor usage of human immunodeficiency virus type 1 (HIV 1) from macrophage tropism reveals biological properties of CCR5 restricted HIV 1 isolates from patien ts with acquired immunodeficiency syndrome. Virology 337: 384 398. 92. Gray, R. R., M. Salemi, A. Lowe, K. J. Nakamura, W. D. Decker, M. Sinkala, C. Kankasa, C. J. Mulligan, D. M. Thea, L. Kuhn, G. Aldrovandi, and M. M. Goodenow. 2011. Multiple independent lineages of HIV 1 persist in breast milk and plasma. AIDS 25: 143 152. 93. Hahn, B. H., G. M. Shaw, K. M. De Cock, and P. M. Sharp. 2000. AIDS as a zoonosis: scientific and public health implications. Science 287: 607 614. 94. Haldar, B., S. Burda, C. Wil liams, L. Heyndrickx, G. Vanham, M. K. Gorny, and P. Nyambi. 2011. Longitudinal study of primary HIV 1 isolates in drug nave

PAGE 155

155 individuals reveals the emergence of variants sensitive to anti HIV 1 monoclonal antibodies. PLoS One 6: e17253. 95. Hartley, O., P. J. Klasse, Q. J. Sattentau, and J. P. Moore. 2005. V3: HIV's switch hitter. AIDS Res Hum Retroviruses 21: 171 189. 96. Heger, E., A. Thielen, R. Gilles, M. Obermeier, T. Lengauer, R. Kaiser, and S. Trapp. 2011. APOBEC3G/F as one possible driving force f or co receptor switch of the human immunodeficiency virus 1. Med Microbiol Immunol. 97. Hendrix, C. W., C. Flexner, R. T. MacFarland, C. Giandomenico, E. J. Fuchs, E. Redpath, G. Bridger, and G. W. Henson. 2000. Pharmacokinetics and safety of AMD 3100, a novel antagonist of the CXCR 4 chemokine receptor, in human volunteers. Antimicrob Agents Chemother 44: 1667 1673. 98. Hioe, C. E., T. Wrin, M. S. Seaman, X. Yu, B. Wood, S. Self, C. Williams, M. K. Gorny, and S. Zolla Pazner. 2010. Anti V3 monoclonal anti bodies display broad neutralizing activities against multiple HIV 1 subtypes. PLoS One 5: e10254. 99. Huang, C. C., S. N. Lam, P. Acharya, M. Tang, S. H. Xiang, S. S. Hussan, R. L. Stanfield, J. Robinson, J. Sodroski, I. A. Wilson, R. Wyatt, C. A. Bewley, and P. D. Kwong. 2007. Structures of the CCR5 N terminus and of a tyrosine sulfated antibody with HIV 1 gp120 and CD4. Science 317: 1930 1934. 100. Huang, C. C., M. Tang, M. Y. Zhang, S. Majeed, E. Montabana, R. L. Stanfield, D. S. Dimitrov, B. Korber, J. Sodroski, I. A. Wilson, R. Wyatt, and P. D. Kwong. 2005. Structure of a V3 containing HIV 1 gp120 core. Science 310: 1025 1028. 101. Huang, W., S. H. Eshleman, J. Toma, S. Fransen, E. Stawiski, E. E. Paxinos, J. M. Whitcomb, A. M. Young, D. Donnell, F. Mmi ro, P. Musoke, L. A. Guay, J. B. Jackson, N. T. Parkin, and C. J. Petropoulos. 2007. Coreceptor tropism in human immunodeficiency virus type 1 subtype D: high prevalence of CXCR4 tropism and heterogeneous composition of viral populations. J Virol 81: 7885 7 893. 102. Huang, W., S. H. Eshleman, J. Toma, E. Stawiski, J. M. Whitcomb, J. B. Jackson, L. Guay, P. Musoke, N. Parkin, and C. J. Petropoulos. 2009. Vertical transmission of X4 tropic and dual tropic HIV 1 in five Ugandan mother infant pairs. AIDS 23: 190 3 1908. 103. Humbert, M., and U. Dietrich. 2006. The role of neutralizing antibodies in HIV infection. AIDS Rev 8: 51 59.

PAGE 156

156 104. Irlbeck, D. M., H. Amrine Madsen, K. M. Kitrinos, C. C. Labranche, and J. F. Demarest. 2008. Chemokine (C C motif) receptor 5 us ing envelopes predominate in dual/mixed tropic HIV from the plasma of drug naive individuals. AIDS 22: 1425 1431. 105. Isaacman Beck, J., E. A. Hermann, Y. Yi, S. J. Ratcliffe, J. Mulenga, S. Allen, E. Hunter, C. A. Derdeyn, and R. G. Collman. 2009. Hetero sexual transmission of human immunodeficiency virus type 1 subtype C: Macrophage tropism, alternative coreceptor use, and the molecular anatomy of CCR5 utilization. J Virol 83: 8208 8220. 106. Janeway Jr., C., P. Travers, M. Walport, and M. Shlomchik. 2005 IMMUNOBIOLOGY the immune system in health and disease, 6th Edition ed. Garland Science Publishing, New Yorl, NY, USA. 107. Jensen, M. A., F. S. Li, A. B. van 't Wout, D. C. Nickle, D. Shriner, H. X. He, S. McLaughlin, R. Shankarappa, J. B. Margolick, an d J. I. Mullins. 2003. Improved coreceptor usage prediction and genotypic monitoring of R5 to X4 transition by motif analysis of human immunodeficiency virus type 1 env V3 loop sequences. J Virol 77: 13376 13388. 108. Jiang, X., V. Burke, M. Totrov, C. Wil liams, T. Cardozo, M. K. Gorny, S. Zolla Pazner, and X. P. Kong. 2010. Conserved structural elements in the V3 crown of HIV 1 gp120. Nat Struct Mol Biol 17: 955 961. 109. Johnston, M. I., and A. S. Fauci. 2008. An HIV vaccine -challenges and prospects. N E ngl J Med 359: 888 890. 110. Jordan, M. R., M. Kearney, S. Palmer, W. Shao, F. Maldarelli, E. P. Coakley, C. Chappey, C. Wanke, and J. M. Coffin. 2010. Comparison of standard PCR/cloning to single genome sequencing for analysis of HIV 1 populations. J Viro l Methods 168: 114 120. 111. Judo, M. S., A. B. Wedel, and C. Wilson. 1998. Stimulation and suppression of PCR mediated recombination. Nucleic Acids Res 26: 1819 1825. 112. Jung, A., R. Maier, J. P. Vartanian, G. Bocharov, V. Jung, U. Fischer, E. Meese, S. Wain Hobson, and A. Meyerhans. 2002. Recombination: Multiply infected spleen cells in HIV patients. Nature 418: 144. 113. Kabat, D., S. L. Kozak, K. Wehrly, and B. Chesebro. 1994. Differences in CD4 dependence for infectivity of laboratory adapted and pri mary patient isolates of human immunodeficiency virus type 1. J Virol 68: 2570 2577. 114. Kaplan, J. E., C. Benson, K. H. Holmes, J. T. Brooks, A. Pau, H. Masur, C. f. D. C. a. P. (CDC), N. I. o. Health, and H. M. A. o. t. I. D. S. o. America. 2009.

PAGE 157

157 Guidel ines for prevention and treatment of opportunistic infections in HIV infected adults and adolescents: recommendations from CDC, the National Institutes of Health, and the HIV Medicine Association of the Infectious Diseases Society of America. MMWR Recomm R ep 58: 1 207; quiz CE201 204. 115. Kaplan, J. E., H. Masur, K. K. Holmes, USPHS, and I. D. S. o. America. 2002. Guidelines for preventing opportunistic infections among HIV infected persons -2002. Recommendations of the U.S. Public Health Service and the I nfectious Diseases Society of America. MMWR Recomm Rep 51: 1 52. 116. Keele, B. F., E. E. Giorgi, J. F. Salazar Gonzalez, J. M. Decker, K. T. Pham, M. G. Salazar, C. Sun, T. Grayson, S. Wang, H. Li, X. Wei, C. Jiang, J. L. Kirchherr, F. Gao, J. A. Anderson L. H. Ping, R. Swanstrom, G. D. Tomaras, W. A. Blattner, P. A. Goepfert, J. M. Kilby, M. S. Saag, E. L. Delwart, M. P. Busch, M. S. Cohen, D. C. Montefiori, B. F. Haynes, B. Gaschen, G. S. Athreya, H. Y. Lee, N. Wood, C. Seoighe, A. S. Perelson, T. Bhatt acharya, B. T. Korber, B. H. Hahn, and G. M. Shaw. 2008. Identification and characterization of transmitted and early founder virus envelopes in primary HIV 1 infection. Proc Natl Acad Sci U S A 105: 7552 7557. 117. Kim, J. H., S. Rerks Ngarm, J. L. Excler and N. L. Michael. 2010. HIV vaccines: lessons learned and the way forward. Curr Opin HIV AIDS 5: 428 434. 118. Klatzmann, D., E. Champagne, S. Chamaret, J. Gruest, D. Guetard, T. Hercend, J. C. Gluckman, and L. Montagnier. 1984. T lymphocyte T4 molecule behaves as the receptor for human retrovirus LAV. Nature 312: 767 768. 119. Klein, J. S., and P. J. Bjorkman. 2010. Few and far between: how HIV may be evading antibody avidity. PLoS Pathog 6: e1000908. 120. Knipe, D., and P. Howley. 2001. Fundamental Vir ology, Fourth Edition ed. Lippincott Williams & Wilkins, Philadelphia, PA, USA. 121. Kohl, N. E., E. A. Emini, W. A. Schleif, L. J. Davis, J. C. Heimbach, R. A. Dixon, E. M. Scolnick, and I. S. Sigal. 1988. Active human immunodeficiency virus protease is required for viral infectivity. Proc Natl Acad Sci U S A 85: 4686 4690. 122. Koito, A., G. Harrowe, J. A. Levy, and C. Cheng Mayer. 1994. Functional role of the V1/V2 region of human immunodeficiency virus type 1 envelope glycoprotein gp120 in infection of primary macrophages and soluble CD4 neutralization. J Virol 68: 2253 2259. 123. Kolchinsky, P., E. Kiprilov, P. Bartley, R. Rubinstein, and J. Sodroski. 2001. Loss of a single N linked glycan allows CD4 independent human

PAGE 158

158 immunodeficiency virus type 1 infe ction by altering the position of the gp120 V1/V2 variable loops. J Virol 75: 3435 3443. 124. Koot, M., I. P. Keet, A. H. Vos, R. E. de Goede, M. T. Roos, R. A. Coutinho, F. Miedema, P. T. Schellekens, and M. Tersmette. 1993. Prognostic value of HIV 1 sync ytium inducing phenotype for rate of CD4+ cell depletion and progression to AIDS. Ann Intern Med 118: 681 688. 125. Koot, M., A. H. Vos, R. P. Keet, R. E. de Goede, M. W. Dercksen, F. G. Terpstra, R. A. Coutinho, F. Miedema, and M. Tersmette. 1992. HIV 1 b iological phenotype in long term infected individuals evaluated with an MT 2 cocultivation assay. AIDS 6: 49 54. 126. Korber B, Foley BT, Kuiken C, Pillai SK, and S. JG. 1998. Numbering Positions in HIV Relative to HXB2CG. Theoretical Biology and Biophy sics Group, Los Alamos National Laboratory, Los Alamos, NM, Human Retroviruses and AIDS. 127. Kosakovsky Pond, S. L., D. Posada, M. B. Gravenor, C. H. Woelk, and S. D. Frost. 2006. GARD: a genetic algorithm for recombination detection. Bioinformatic s 22: 3096 3098. 128. Kunert, R., F. Rker, and H. Katinger. 1998. Molecular characterization of five neutralizing anti HIV type 1 antibodies: identification of nonconventional D segments in the human monoclonal antibodies 2G12 and 2F5. AIDS Res Hum Retrov iruses 14: 1115 1128. 129. Kwong, P. D., M. L. Doyle, D. J. Casper, C. Cicala, S. A. Leavitt, S. Majeed, T. D. Steenbeke, M. Venturi, I. Chaiken, M. Fung, H. Katinger, P. W. Parren, J. Robinson, D. Van Ryk, L. Wang, D. R. Burton, E. Freire, R. Wyatt, J. So droski, W. A. Hendrickson, and J. Arthos. 2002. HIV 1 evades antibody mediated neutralization through conformational masking of receptor binding sites. Nature 420: 678 682. 130. Kwong, P. D., R. Wyatt, J. Robinson, R. W. Sweet, J. Sodroski, and W. A. Hendr ickson. 1998. Structure of an HIV gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody. Nature 393: 648 659. 131. Kwong, P. D., R. Wyatt, Q. J. Sattentau, J. Sodroski, and W. A. Hendrickson. 2000. Oligomeric modeli ng and electrostatic analysis of the gp120 envelope glycoprotein of human immunodeficiency virus. J Virol 74: 1961 1972. 132. Labrosse, B., C. Treboute, A. Brelot, and M. Alizon. 2001. Cooperation of the V1/V2 and V3 domains of human immunodeficiency virus type 1 gp120 for interaction with the CXCR4 receptor. J Virol 75: 5457 5464.

PAGE 159

159 133. Lamers, S. L., J. W. Sleasman, and M. M. Goodenow. 1996. A model for alignment of Env V1 and V2 hypervariable domains from human and simian immunodeficiency viruses. AIDS Res Hum Retroviruses 12: 1169 1178. 134. Lauring, A. S., and R. Andino. 2010. Quasispecies theory and the behavior of RNA viruses. PLoS Pathog 6: e1001005. 135. Lecossier, D., F. Bouchonnet, F. Clavel, and A. J. Hance. 2003. Hypermutation of HIV 1 DNA in the absence of the Vif protein. Science 300: 1112. 136. Lee, B., M. Sharron, C. Blanpain, B. J. Doranz, J. Vakili, P. Setoh, E. Berg, G. Liu, H. R. Guy, S. R. Durell, M. Parmentier, C. N. Chang, K. Price, M. Tsang, and R. W. Doms. 1999. Epitope mapping of CCR5 reveals multiple conformational states and distinct but overlapping structures involved in chemokine and coreceptor function. J Biol Chem 274: 9617 9626. 137. Lee, B., M. Sharron, L. J. Montaner, D. Weissman, and R. W. Doms. 1999. Quantification of CD4, C CR5, and CXCR4 levels on lymphocyte subsets, dendritic cells, and differentially conditioned monocyte derived macrophages. Proc Natl Acad Sci U S A 96: 5215 5220. 138. Levy, D. N., G. M. Aldrovandi, O. Kutsch, and G. M. Shaw. 2004. Dynamics of HIV 1 recomb ination in its natural target cells. Proc Natl Acad Sci U S A 101: 4204 4209. 139. Levy, J. A. 1998. HIV and the Pathogenesis of AIDS, Second ed. ASM Press, Washington, DC. 140. Li, M., F. Gao, J. R. Mascola, L. Stamatatos, V. R. Polonis, M. Koutsoukos, G Voss, P. Goepfert, P. Gilbert, K. M. Greene, M. Bilska, D. L. Kothe, J. F. Salazar Gonzalez, X. Wei, J. M. Decker, B. H. Hahn, and D. C. Montefiori. 2005. Human immunodeficiency virus type 1 env clones from acute and early subtype B infections for standa rdized assessments of vaccine elicited neutralizing antibodies. J Virol 79: 10108 10125. 141. Li, S., J. Juarez, M. Alali, D. Dwyer, R. Collman, A. Cunningham, and H. M. Naif. 1999. Persistent CCR5 utilization and enhanced macrophage tropism by primary blo od human immunodeficiency virus type 1 isolates from advanced stages of disease and comparison to tissue derived isolates. J Virol 73: 9741 9755. 142. Liu, J., A. Bartesaghi, M. J. Borgnia, G. Sapiro, and S. Subramaniam. 2008. Molecular architecture of nat ive HIV 1 gp120 trimers. Nature 455: 109 113.

PAGE 160

160 143. Loftin, L. M., M. Kienzle, Y. Yi, and R. G. Collman. 2011. R5X4 HIV 1 coreceptor use in primary target cells: implications for coreceptor entry blocking strategies. J Transl Med 9 Suppl 1: S3. 144. Loftin, L. M., M. F. Kienzle, Y. Yi, B. Lee, F. H. Lee, L. Gray, P. R. Gorry, and R. G. Collman. 2010. Constrained use of CCR5 on CD4+ lymphocytes by R5X4 HIV 1: efficiency of Env CCR5 interactions and low CCR5 expression determine a range of restricted CCR5 medi ated entry. Virology 402: 135 148. 145. Lu, Y. L., P. Spearman, and L. Ratner. 1993. Human immunodeficiency virus type 1 viral protein R localization in infected cells and virions. J Virol 67: 6542 6550. 146. Lu, Z., J. F. Berson, Y. Chen, J. D. Turner, T. Zhang, M. Sharron, M. H. Jenks, Z. Wang, J. Kim, J. Rucker, J. A. Hoxie, S. C. Peiper, and R. W. Doms. 1997. Evolution of HIV 1 coreceptor usage through interactions with distinct CCR5 and CXCR4 domains. Proc Natl Acad Sci U S A 94: 6426 6431. 147. Lynch, R. M., T. Shen, S. Gnanakaran, and C. A. Derdeyn. 2009. Appreciating HIV type 1 diversity: subtype differences in Env. AIDS Res Hum Retroviruses 25: 237 248. 148. Malet, I., M. Belnard, H. Agut, and A. Cahour. 2003. From RNA to quasispecies: a DNA polymer ase with proofreading activity is highly recommended for accurate assessment of viral diversity. J Virol Methods 109: 161 170. 149. Malim, M. H., S. Bhnlein, R. Fenrick, S. Y. Le, J. V. Maizel, and B. R. Cullen. 1989. Functional comparison of the Rev tran s activators encoded by different primate immunodeficiency virus species. Proc Natl Acad Sci U S A 86: 8222 8226. 150. Mansky, L. M., and H. M. Temin. 1995. Lower in vivo mutation rate of human immunodeficiency virus type 1 than that predicted from the fid elity of purified reverse transcriptase. J Virol 69: 5087 5094. 151. Margolick, J. B., A. Muoz, A. D. Donnenberg, L. P. Park, N. Galai, J. V. Giorgi, M. R. O'Gorman, and J. Ferbas. 1995. Failure of T cell homeostasis preceding AIDS in HIV 1 infection. The Multicenter AIDS Cohort Study. Nat Med 1: 674 680. 152. Meyerhans, A., J. P. Vartanian, and S. Wain Hobson. 1990. DNA recombination during PCR. Nucleic Acids Res 18: 1687 1691. 153. Michel, N., I. Allespach, S. Venzke, O. T. Fackler, and O. T. Keppler. 20 05. The Nef protein of human immunodeficiency virus establishes superinfection

PAGE 161

161 immunity by a dual strategy to downregulate cell surface CCR5 and CD4. Curr Biol 15: 714 723. 154. Mikell, I., D. N. Sather, S. A. Kalams, M. Altfeld, G. Alter, and L. Stamatato s. 2011. Characteristics of the earliest cross neutralizing antibody response to HIV 1. PLoS Pathog 7: e1001251. 155. Mild, M., J. Esbjrnsson, E. M. Feny, and P. Medstrand. 2007. Frequent intrapatient recombination between human immunodeficiency virus ty pe 1 R5 and X4 envelopes: implications for coreceptor switch. J Virol 81: 3369 3376. 156. Mitra, R. D., V. L. Butty, J. Shendure, B. R. Williams, D. E. Housman, and G. M. Church. 2003. Digital genotyping and haplotyping with polymerase colonies. Proc Natl Acad Sci U S A 100: 5926 5931. 157. Moore, J. P., S. G. Kitchen, P. Pugach, and J. A. Zack. 2004. The CCR5 and CXCR4 coreceptors -central to understanding the transmission and pathogenesis of human immunodeficiency virus type 1 infection. AIDS Res Hum Retr oviruses 20: 111 126. 158. Moore, P. L., E. S. Gray, I. A. Choge, N. Ranchobe, K. Mlisana, S. S. Abdool Karim, C. Williamson, L. Morris, and C. S. Team. 2008. The c3 v4 region is a major target of autologous neutralizing antibodies in human immunodeficienc y virus type 1 subtype C infection. J Virol 82: 1860 1869. 159. Mosier, D. E. 2009. How HIV changes its tropism: evolution and adaptation? Curr Opin HIV AIDS 4: 125 130. 160. Moulard, M., and E. Decroly. 2000. Maturation of HIV envelope glycoprotein precur sors by cellular endoproteases. Biochim Biophys Acta 1469: 121 132. 161. Moulard, M., S. Hallenberger, W. Garten, and H. D. Klenk. 1999. Processing and routage of HIV glycoproteins by furin to the cell surface. Virus Res 60: 55 65. 162. Murdoch, C., and A. Finn. 2000. Chemokine receptors and their role in inflammation and infectious diseases. Blood 95: 3032 3043. 163. Musich, T., P. J. Peters, M. J. Duenas Decamp, M. P. Gonzalez Perez, J. Robinson, S. Zolla Pazner, J. K. Ball, K. Luzuriaga, and P. R. Clapha m. 2011. A conserved determinant in the V1 loop of HIV 1 modulates the V3 loop to prime low CD4 use and macrophage infection. J Virol 85: 2397 2405. 164. Nabatov, A. A., G. Pollakis, T. Linnemann, A. Kliphius, M. I. Chalaby, and W. A. Paxton. 2004. Intrapa tient alterations in the human immunodeficiency virus type 1 gp120 V1V2 and V3 regions differentially modulate coreceptor usage,

PAGE 162

162 virus inhibition by CC/CXC chemokines, soluble CD4, and the b12 and 2G12 monoclonal antibodies. J Virol 78: 524 530. 165. Nawaz F., C. Cicala, D. Van Ryk, K. E. Block, K. Jelicic, J. P. McNally, O. Ogundare, M. Pascuccio, N. Patel, D. Wei, A. S. Fauci, and J. Arthos. 2011. The genotype of early reactivity, Pathog 7: e1001301. 166. Negroni, M., and H. Buc. 2001. Mechanisms of retroviral recombina tion. Annu Rev Genet 35: 275 302. 167. Oberlin, E., A. Amara, F. Bachelerie, C. Bessia, J. L. Virelizier, F. Arenzana Seisdedos, O. Schwartz, J. M. Heard, I. Clark Lewis, D. F. Legler, M. Loetscher, M. Baggiolini, and B. Moser. 1996. The CXC chemokine SDF 1 is the ligand for LESTR/fusin and prevents infection by T cell line adapted HIV 1. Nature 382: 833 835. 168. Ogert, R. A., M. K. Lee, W. Ross, A. Buckler White, M. A. Martin, and M. W. Cho. 2001. N linked glycosylation sites adjacent to and within the V1 /V2 and the V3 loops of dualtropic human immunodeficiency virus type 1 isolate DH12 gp120 affect coreceptor usage and cellular tropism. J Virol 75: 5998 6006. 169. Palczewski, K., T. Kumasaka, T. Hori, C. A. Behnke, H. Motoshima, B. A. Fox, I. Le Trong, D. C. Teller, T. Okada, R. E. Stenkamp, M. Yamamoto, and M. Miyano. 2000. Crystal structure of rhodopsin: A G protein coupled receptor. Science 289: 739 745. 170. Palmer, S., M. Kearney, F. Maldarelli, E. K. Halvas, C. J. Bixby, H. Bazmi, D. Rock, J. Falloon R. T. Davey, R. L. Dewar, J. A. Metcalf, S. Hammer, J. W. Mellors, and J. M. Coffin. 2005. Multiple, linked human immunodeficiency virus type 1 drug resistance mutations in treatment experienced patients are missed by standard genotype analysis. J Clin M icrobiol 43: 406 413. 171. Pancera, M., S. Majeed, Y. E. Ban, L. Chen, C. C. Huang, L. Kong, Y. D. Kwon, J. Stuckey, T. Zhou, J. E. Robinson, W. R. Schief, J. Sodroski, R. Wyatt, and P. D. Kwong. 2010. Structure of HIV 1 gp120 with gp41 interactive region reveals layered envelope architecture and basis of conformational mobility. Proc Natl Acad Sci U S A 107: 1166 1171. 172. Pastore, C., R. Nedellec, A. Ramos, S. Pontow, L. Ratner, and D. E. Mosier. 2006. Human immunodeficiency virus type 1 coreceptor switc hing: V1/V2 gain of fitness mutations compensate for V3 loss of fitness mutations. J Virol 80: 750 758.

PAGE 163

163 173. Pastore, C., A. Ramos, and D. E. Mosier. 2004. Intrinsic obstacles to human immunodeficiency virus type 1 coreceptor switching. J Virol 78: 7565 757 4. 174. Patel, M. B., N. G. Hoffman, and R. Swanstrom. 2008. Subtype specific conformational differences within the V3 region of subtype B and subtype C human immunodeficiency virus type 1 Env proteins. J Virol 82: 903 916. 175. Perelson, A. S., A. U. Neu mann, M. Markowitz, J. M. Leonard, and D. D. Ho. 1996. HIV 1 dynamics in vivo: virion clearance rate, infected cell life span, and viral generation time. Science 271: 1582 1586. 176. Perez, E. E., S. L. Rose, B. Peyser, S. L. Lamers, B. Burkhardt, B. M. Du nn, A. D. Hutson, J. W. Sleasman, and M. M. Goodenow. 2001. Human immunodeficiency virus type 1 protease genotype predicts immune and viral responses to combination therapy with protease inhibitors (PIs) in PI naive patients. J Infect Dis 183: 579 588. 177 Perreau, M., G. Pantaleo, and E. J. Kremer. 2008. Activation of a dendritic cell T cell axis by Ad5 immune complexes creates an improved environment for replication of HIV in T cells. J Exp Med 205: 2717 2725. 178. Peters, P. J., J. Bhattacharya, S. Hibb itts, M. T. Dittmar, G. Simmons, J. Bell, P. Simmonds, and P. R. Clapham. 2004. Biological analysis of human immunodeficiency virus type 1 R5 envelopes amplified from brain and lymph node tissues of AIDS patients with neuropathology reveals two distinct tr opism phenotypes and identifies envelopes in the brain that confer an enhanced tropism and fusigenicity for macrophages. J Virol 78: 6915 6926. 179. Peters, P. J., M. J. Duenas Decamp, W. M. Sullivan, R. Brown, C. Ankghuambom, K. Luzuriaga, J. Robinson, D. R. Burton, J. Bell, P. Simmonds, J. Ball, and P. R. Clapham. 2008. Variation in HIV 1 R5 macrophage tropism correlates with sensitivity to reagents that block envelope: CD4 interactions but not with sensitivity to other entry inhibitors. Retrovirology 5: 5 180. Peters, P. J., M. J. Dueas Decamp, W. M. Sullivan, and P. R. Clapham. 2007. Variation of macrophage tropism among HIV 1 R5 envelopes in brain and other tissues. J Neuroimmune Pharmacol 2: 32 41. 181. Peters, P. J., W. M. Sullivan, M. J. Duenas Dec amp, J. Bhattacharya, C. Ankghuambom, R. Brown, K. Luzuriaga, J. Bell, P. Simmonds, J. Ball, and P. R. Clapham. 2006. Non macrophage tropic human immunodeficiency virus type 1 R5 envelopes predominate in blood, lymph nodes, and semen: implications for tran smission and pathogenesis. J Virol 80: 6324 6332.

PAGE 164

164 182. Pfaff, J. M., C. B. Wilen, J. E. Harrison, J. F. Demarest, B. Lee, R. W. Doms, and J. C. Tilton. 2010. HIV 1 resistance to CCR5 antagonists associated with highly efficient use of CCR5 and altered trop ism on primary CD4+ T cells. J Virol 84: 6505 6514. 183. Pinter, A. 2007. Roles of HIV 1 Env variable regions in viral neutralization and vaccine development. Curr HIV Res 5: 542 553. 184. Pinter, A., W. J. Honnen, Y. He, M. K. Gorny, S. Zolla Pazner, and S. C. Kayman. 2004. The V1/V2 domain of gp120 is a global regulator of the sensitivity of primary human immunodeficiency virus type 1 isolates to neutralization by antibodies commonly induced upon infection. J Virol 78: 5205 5215. 185. Platt, E. J., M. Bil ska, S. L. Kozak, D. Kabat, and D. C. Montefiori. 2009. Evidence that ecotropic murine leukemia virus contamination in TZM bl cells does not affect the outcome of neutralizing antibody assays with human immunodeficiency virus type 1. J Virol 83: 8289 8292. 186. Platt, E. J., K. Wehrly, S. E. Kuhmann, B. Chesebro, and D. Kabat. 1998. Effects of CCR5 and CD4 cell surface concentrations on infections by macrophagetropic isolates of human immunodeficiency virus type 1. J Virol 72: 2855 2864. 187. Polonis, V. R. B. K. Brown, A. Rosa Borges, S. Zolla Pazner, D. S. Dimitrov, M. Y. Zhang, S. W. Barnett, R. M. Ruprecht, G. Scarlatti, E. M. Feny, D. C. Montefiori, F. E. McCutchan, and N. L. Michael. 2008. Recent advances in the characterization of HIV 1 neutralizati on assays for standardized evaluation of the antibody response to infection and vaccination. Virology 375: 315 320. 188. Pomerantz, R. J., and D. L. Horn. 2003. Twenty years of therapy for HIV 1 infection. Nat Med 9: 867 873. 189. Poon, A. F., F. I. Lewis, S. L. Pond, and S. D. Frost. 2007. Evolutionary interactions between N linked glycosylation sites in the HIV 1 envelope. PLoS Comput Biol 3: e11. 190. Preston, B. D., B. J. Poiesz, and L. A. Loeb. 1988. Fidelity of HIV 1 reverse transcriptase. Science 242 : 1168 1171. 191. Quiones Mateu, M. E., Y. Gao, S. C. Ball, A. J. Marozsan, A. Abraha, and E. J. Arts. 2002. In vitro intersubtype recombinants of human immunodeficiency virus type 1: comparison to recent and circulating in vivo recombinant forms. J Virol 76: 9600 9613.

PAGE 165

165 192. Ramirez, B. C., E. Simon Loriere, R. Galetto, and M. Negroni. 2008. Implications of recombination for HIV diversity. Virus Res 134: 64 73. 193. Raymond, S., P. Delobel, M. Mavigner, M. Cazabat, C. Souyris, K. Sandres Saun, L. Cuzin, B Marchou, P. Massip, and J. Izopet. 2008. Correlation between genotypic predictions based on V3 sequences and phenotypic determination of HIV 1 tropism. AIDS 22: F11 16. 194. Reeves, J. D., and R. W. Doms. 2002. Human immunodeficiency virus type 2. J Gen Virol 83: 1253 1265. 195. Reeves, J. D., F. H. Lee, J. L. Miamidian, C. B. Jabara, M. M. Juntilla, and R. W. Doms. 2005. Enfuvirtide resistance mutations: impact on human immunodeficiency virus envelope function, entry inhibitor sensitivity, and virus neut ralization. J Virol 79: 4991 4999. 196. Regoes, R. R., and S. Bonhoeffer. 2005. The HIV coreceptor switch: a population dynamical perspective. Trends Microbiol 13: 269 277. 197. Rerks Ngarm, S., P. Pitisuttithum, S. Nitayaphan, J. Kaewkungwal, J. Chiu, R. Paris, N. Premsri, C. Namwat, M. de Souza, E. Adams, M. Benenson, S. Gurunathan, J. Tartaglia, J. G. McNeil, D. P. Francis, D. Stablein, D. L. Birx, S. Chunsuttiwat, C. Khamboonruang, P. Thongcharoen, M. L. Robb, N. L. Michael, P. Kunasol, J. H. Kim, and M T. Investigators. 2009. Vaccination with ALVAC and AIDSVAX to prevent HIV 1 infection in Thailand. N Engl J Med 361: 2209 2220. 198. Roberts, J. D., K. Bebenek, and T. A. Kunkel. 1988. The accuracy of reverse transcriptase from HIV 1. Science 242: 1171 11 73. 199. Robertson, M., D. Mehrotra, D. Fitzgerald, A. Duerr, D. Casimiro, J. McElrath, D. Lawrence, and S. Buchbinder. 2008. Efficacy Results from the STEP Study (Merck V520 Protocol 023/HVTN 502): A Phase II Test of Concept Trial of the MRKAd5 HIV 1 Gag /Pol/Nef Trivalent Vaccine. 200. Roche, M., M. R. Jakobsen, J. Sterjovski, A. Ellett, F. Posta, B. Lee, B. Jubb, M. Westby, S. R. Lewin, P. A. Ramsland, M. J. Churchill, and P. R. Gorry. 2011. HIV 1 escape from the CCR5 antagonist maraviroc associated wit h an altered and less efficient mechanism of gp120 CCR5 engagement that attenuates macrophage tropism. J Virol 85: 4330 4342. 201. Rong, R., F. Bibollet Ruche, J. Mulenga, S. Allen, J. L. Blackwell, and C. A. Derdeyn. 2007. Role of V1V2 and other human imm unodeficiency virus type 1 envelope domains in resistance to autologous neutralization during clade C infection. J Virol 81: 1350 1359.

PAGE 166

166 202. Root, M. J., and H. K. Steger. 2004. HIV 1 gp41 as a target for viral entry inhibition. Curr Pharm Des 10: 1805 1825. 203. Roux, K. H., and K. A. Taylor. 2007. AIDS virus envelope spike structure. Curr Opin Struct Biol 17: 244 252. 204. Rowland Jones, S. L. 2003. Timeline: AIDS pathogenesis: what have two decades of HIV research taught us? Nat Rev Immunol 3: 343 348. 20 5. Rusert, P., A. Krarup, C. Magnus, O. F. Brandenberg, J. Weber, A. K. Ehlert, R. R. Regoes, H. F. Gnthard, and A. Trkola. 2011. Interaction of the gp120 V1V2 loop with a neighboring gp120 unit shields the HIV envelope trimer against cross neutralizing a ntibodies. J Exp Med 208: 1419 1433. 206. Rusert, P., A. Mann, M. Huber, V. von Wyl, H. F. Gunthard, and A. Trkola. 2009. Divergent effects of cell environment on HIV entry inhibitor activity. AIDS 23: 1319 1327. 207. Sagar, M., O. Laeyendecker, S. Lee, J. Gamiel, M. J. Wawer, R. H. Gray, D. Serwadda, N. K. Sewankambo, J. C. Shepherd, J. Toma, W. Huang, and T. C. Quinn. 2009. Selection of HIV variants with signature genotypic characteristics during heterosexual transmission. J Infect Dis 199: 580 589. 208. Sagar, M., X. Wu, S. Lee, and J. Overbaugh. 2006. Human immunodeficiency virus type 1 V1 V2 envelope loop sequences expand and add glycosylation sites over the course of infection, and these modifications affect antibody neutralization sensitivity. J Virol 80: 9586 9598. 209. Saksena, N., D. Dwyer, and B. Wang. 2011. HIV and AIDS Updates on Biology, Immunology, Epidemiology and Treatment Strategies. InTech, Croatia. 210. Salazar Gonzalez, J. F., E. Bailes, K. T. Pham, M. G. Salazar, M. B. Guffey, B. F. K eele, C. A. Derdeyn, P. Farmer, E. Hunter, S. Allen, O. Manigart, J. Mulenga, J. A. Anderson, R. Swanstrom, B. F. Haynes, G. S. Athreya, B. T. Korber, P. M. Sharp, G. M. Shaw, and B. H. Hahn. 2008. Deciphering human immunodeficiency virus type 1 transmissi on and early envelope diversification by single genome amplification and sequencing. J Virol 82: 3952 3970. 211. Salemi, M., B. R. Burkhardt, R. R. Gray, G. Ghaffari, J. W. Sleasman, and M. M. Goodenow. 2007. Phylodynamics of HIV 1 in lymphoid and non lymp hoid tissues reveals a central role for the thymus in emergence of CXCR4 using quasispecies. PLoS One 2: e950. 212. Salemi, M., R. R. Gray, and M. M. Goodenow. 2008. An exploratory algorithm to identify intra host recombinant viral sequences. Mol Phylogene t Evol 49: 618 628.

PAGE 167

167 213. Salvatori, F., and G. Scarlatti. 2001. HIV type 1 chemokine receptor usage in mother to child transmission. AIDS Res Hum Retroviruses 17: 925 935. 214. Samson, M., F. Libert, B. J. Doranz, J. Rucker, C. Liesnard, C. M. Farber, S. Sa ragosti, C. Lapoumeroulie, J. Cognaux, C. Forceille, G. Muyldermans, C. Verhofstede, G. Burtonboy, M. Georges, T. Imai, S. Rana, Y. Yi, R. J. Smyth, R. G. Collman, R. W. Doms, G. Vassart, and M. Parmentier. 1996. Resistance to HIV 1 infection in caucasian individuals bearing mutant alleles of the CCR 5 chemokine receptor gene. Nature 382: 722 725. 215. Sander, O., T. Sing, I. Sommer, A. J. Low, P. K. Cheung, P. R. Harrigan, T. Lengauer, and F. S. Domingues. 2007. Structural descriptors of gp120 V3 loop for the prediction of HIV 1 coreceptor usage. PLoS Comput Biol 3: e58. 216. Saphire, E. O., P. W. Parren, R. Pantophlet, M. B. Zwick, G. M. Morris, P. M. Rudd, R. A. Dwek, R. L. Stanfield, D. R. Burton, and I. A. Wilson. 2001. Crystal structure of a neutralizi ng human IGG against HIV 1: a template for vaccine design. Science 293: 1155 1159. 217. Sarafianos, S. G., K. Das, C. Tantillo, A. D. Clark, J. Ding, J. M. Whitcomb, P. L. Boyer, S. H. Hughes, and E. Arnold. 2001. Crystal structure of HIV 1 reverse transcr iptase in complex with a polypurine tract RNA:DNA. EMBO J 20: 1449 1461. 218. Scanlan, C. N., R. Pantophlet, M. R. Wormald, E. Ollmann Saphire, R. Stanfield, I. A. Wilson, H. Katinger, R. A. Dwek, P. M. Rudd, and D. R. Burton. 2002. The broadly neutralizin g anti human immunodeficiency virus type 1 antibody 2G12 recognizes a cluster of alpha1 ->2 mannose residues on the outer face of gp120. J Virol 76: 7306 7321. 219. Scheid, J. F., H. Mouquet, B. Ueberheide, R. Diskin, F. Klein, T. Y. Oliveira, J. Pietzsch, D. Fenyo, A. Abadir, K. Velinzon, A. Hurley, S. Myung, F. Boulad, P. Poignard, D. R. Burton, F. Pereyra, D. D. Ho, B. D. Walker, M. S. Seaman, P. J. Bjorkman, B. T. Chait, and M. C. Nussenzweig. 2011. Sequence and structural convergence of broad and poten t HIV antibodies that mimic CD4 binding. Science 333: 1633 1637. 220. Schief, W. R., Y. E. Ban, and L. Stamatatos. 2009. Challenges for structure based HIV vaccine design. Curr Opin HIV AIDS 4: 431 440. 221. Schierup, M. H., and J. Hein. 2000. Consequences of recombination on traditional phylogenetic analysis. Genetics 156: 879 891. 222. Schneider, W. L., and M. J. Roossinck. 2001. Genetic diversity in RNA virus quasispecies is controlled by host virus interactions. J Virol 75: 6566 6571.

PAGE 168

168 223. Schuitemaker, H., M. Koot, N. A. Kootstra, M. W. Dercksen, R. E. de Goede, R. P. van Steenwijk, J. M. Lange, J. K. Schattenkerk, F. Miedema, and M. Tersmette. 1992. Biological phenotype of human immunodeficiency virus type 1 clones at different stages of infection: prog ression of disease is associated with a shift from monocytotropic to T cell tropic virus population. J Virol 66: 1354 1360. 224. Schuitemaker, H., A. B. van 't Wout, and P. Lusso. 2011. Clinical significance of HIV 1 coreceptor usage. J Transl Med 9 Suppl 1: S5. 225. Shafikhani, S. 2002. Factors affecting PCR mediated recombination. Environ Microbiol 4: 482 486. 226. Shakirzyanova, M., W. Ren, K. Zhuang, S. Tasca, and C. Cheng Mayer. 2010. Fitness disadvantage of transitional intermediates contributes to dy namic change in the infecting virus population during coreceptor switch in R5 simian/human immunodeficiency virus infected macaques. J Virol 84: 12862 12871. 227. Sharp, P. M., and B. H. Hahn. 2010. The evolution of HIV 1 and the origin of AIDS. Philos Tra ns R Soc Lond B Biol Sci 365: 2487 2494. 228. Sheehy, A. M., N. C. Gaddis, and M. H. Malim. 2003. The antiretroviral enzyme APOBEC3G is degraded by the proteasome in response to HIV 1 Vif. Nat Med 9: 1404 1407. 229. Shepherd, J. C., L. P. Jacobson, W. Qiao B. D. Jamieson, J. P. Phair, P. Piazza, T. C. Quinn, and J. B. Margolick. 2008. Emergence and persistence of CXCR4 tropic HIV 1 in a population of men from the multicenter AIDS cohort study. J Infect Dis 198: 1104 1112. 230. Shioda, T., J. A. Levy, and C Cheng Mayer. 1991. Macrophage and T cell line tropisms of HIV 1 are determined by specific regions of the envelope gp120 gene. Nature 349: 167 169. 231. Sleasman, J. W., L. F. Aleixo, A. Morton, S. Skoda Smith, and M. M. Goodenow. 1996. CD4+ memory T cel ls are the predominant population of HIV 1 infected lymphocytes in neonates and children. AIDS 10: 1477 1484. 232. Sleasman, J. W., B. H. Leon, L. F. Aleixo, M. Rojas, and M. M. Goodenow. 1997. Immunomagnetic selection of purified monocyte and lymphocyte p opulations from peripheral blood mononuclear cells following cryopreservation. Clin Diagn Lab Immunol 4: 653 658. 233. Sterjovski, J., M. Roche, M. J. Churchill, A. Ellett, W. Farrugia, L. R. Gray, D. Cowley, P. Poumbourios, B. Lee, S. L. Wesselingh, A. L. Cunningham, P. A. Ramsland, and P. R. Gorry. 2010. An altered and more efficient mechanism of

PAGE 169

169 CCR5 engagement contributes to macrophage tropism of CCR5 using HIV 1 envelopes. Virology 404: 269 278. 234. Stiegler, G., R. Kunert, M. Purtscher, S. Wolbank, R Voglauer, F. Steindl, and H. Katinger. 2001. A potent cross clade neutralizing human monoclonal antibody against a novel epitope on gp41 of human immunodeficiency virus type 1. AIDS Res Hum Retroviruses 17: 1757 1765. 235. Snchez, V., M. Masi, C. Roble dano, S. Padilla, J. M. Ramos, and F. Gutirrez. 2010. Performance of genotypic algorithms for predicting HIV 1 tropism measured against the enhanced sensitivity Trofile coreceptor tropism assay. J Clin Microbiol 48: 4135 4139. 236. Tasca, S., S. H. Ho, an d C. Cheng Mayer. 2008. R5X4 viruses are evolutionary, functional, and antigenic intermediates in the pathway of a simian human immunodeficiency virus coreceptor switch. J Virol 82: 7089 7099. 237. Tasca, S., K. Zhuang, A. Gettie, H. Knight, J. Blanchard, S. Westmoreland, and C. Cheng Mayer. 2011. Effect of B cell depletion on coreceptor switching in R5 simian human immunodeficiency virus infection of rhesus macaques. J Virol 85: 3086 3094. 238. Tersmette, M., and F. Miedema. 1990. Interactions between HIV and the host immune system in the pathogenesis of AIDS. AIDS 4 Suppl 1: S57 66. 239. Thomas, E. R., R. L. Dunfee, J. Stanton, D. Bogdan, J. Taylor, K. Kunstman, J. E. Bell, S. M. Wolinsky, and D. Gabuzda. 2007. Macrophage entry mediated by HIV Envs from br ain and lymphoid tissues is determined by the capacity to use low CD4 levels and overall efficiency of fusion. Virology 360: 105 119. 240. Tilton, J. C., and R. W. Doms. 2010. Entry inhibitors in the treatment of HIV 1 infection. Antiviral Res 85: 91 100. 241. Tilton, J. C., C. B. Wilen, C. A. Didigu, R. Sinha, J. E. Harrison, C. Agrawal Gamse, E. A. Henning, F. D. Bushman, J. N. Martin, S. G. Deeks, and R. W. Doms. 2010. A maraviroc resistant HIV 1 with narrow cross resistance to other CCR5 antagonists dep ends on both N terminal and extracellular loop domains of drug bound CCR5. J Virol 84: 10863 10876. 242. Tuttle, D. L., C. B. Anders, M. J. Aquino De Jesus, P. P. Poole, S. L. Lamers, D. R. Briggs, S. M. Pomeroy, L. Alexander, K. W. Peden, W. A. Andiman, J W. Sleasman, and M. M. Goodenow. 2002. Increased replication of non syncytium inducing HIV type 1 isolates in monocyte derived macrophages is linked to advanced disease in infected children. AIDS Res Hum Retroviruses 18: 353 362.

PAGE 170

170 243. Tuttle, D. L., J. K. Harrison, C. Anders, J. W. Sleasman, and M. M. Goodenow. 1998. Expression of CCR5 increases during monocyte differentiation and directly mediates macrophage susceptibility to infection by human immunodeficiency virus type 1. J Virol 72: 4962 4969. 244. va n Gils, M. J., E. M. Bunnik, B. D. Boeser Nunnink, J. A. Burger, M. Terlouw Klein, N. Verwer, and H. Schuitemaker. 2011. Longer V1V2 region with increased number of potential N linked glycosylation sites in the HIV 1 envelope glycoprotein protects against HIV specific neutralizing antibodies. J Virol 85: 6986 6995. 245. van Rij, R. P., H. Blaak, J. A. Visser, M. Brouwer, R. Rientsma, S. Broersen, A. M. de Roda Husman, and H. Schuitemaker. 2000. Differential coreceptor expression allows for independent evolu tion of non syncytium inducing and syncytium inducing HIV 1. J Clin Invest 106: 1039 1052. 246. Verrier, F., A. M. Borman, D. Brand, and M. Girard. 1999. Role of the HIV type 1 glycoprotein 120 V3 loop in determining coreceptor usage. AIDS Res Hum Retrovir uses 15: 731 743. 247. Walker, L. M., S. K. Phogat, P. Y. Chan Hui, D. Wagner, P. Phung, J. L. Goss, T. Wrin, M. D. Simek, S. Fling, J. L. Mitcham, J. K. Lehrman, F. H. Priddy, O. A. Olsen, S. M. Frey, P. W. Hammond, S. Kaminsky, T. Zamb, M. Moyle, W. C. K off, P. Poignard, D. R. Burton, and P. G. P. Investigators. 2009. Broad and potent neutralizing antibodies from an African donor reveal a new HIV 1 vaccine target. Science 326: 285 289. 248. Wang, J., K. Crawford, M. Yuan, H. Wang, P. R. Gorry, and D. Gabu zda. 2002. Regulation of CC chemokine receptor 5 and CD4 expression and human immunodeficiency virus type 1 replication in human macrophages and microglia by T helper type 2 cytokines. J Infect Dis 185: 885 897. 249. Wayne, C. K., and S. F. Berkley. 2010. The renaissance in HIV vaccine development -future directions. N Engl J Med 363: e7. 250. Wei, X., J. M. Decker, S. Wang, H. Hui, J. C. Kappes, X. Wu, J. F. Salazar Gonzalez, M. G. Salazar, J. M. Kilby, M. S. Saag, N. L. Komarova, M. A. Nowak, B. H. Hahn, P. D. Kwong, and G. M. Shaw. 2003. Antibody neutralization and escape by HIV 1. Nature 422: 307 312. 251. Weissenhorn, W., A. Dessen, S. C. Harrison, J. J. Skehel, and D. C. Wiley. 1997. Atomic structure of the ectodomain from HIV 1 gp41. Nature 387: 426 43 0. 252. Welman, M., G. Lemay, and E. A. Cohen. 2007. Role of envelope processing and gp41 membrane spanning domain in the formation of human

PAGE 171

171 immunodeficiency virus type 1 (HIV 1) fusion competent envelope glycoprotein complex. Virus Res 124: 103 112. 253. Westby, M., M. Lewis, J. Whitcomb, M. Youle, A. L. Pozniak, I. T. James, T. M. Jenkins, M. Perros, and E. van der Ryst. 2006. Emergence of CXCR4 using human immunodeficiency virus type 1 (HIV 1) variants in a minority of HIV 1 infected patients following treatment with the CCR5 antagonist maraviroc is from a pretreatment CXCR4 using virus reservoir. J Virol 80: 4909 4920. 254. White, T. A., A. Bartesaghi, M. J. Borgnia, J. R. Meyerson, M. J. de la Cruz, J. W. Bess, R. Nandwani, J. A. Hoxie, J. D. Lifso n, J. L. Milne, and S. Subramaniam. 2010. Molecular architectures of trimeric SIV and HIV 1 envelope glycoproteins on intact viruses: strain dependent variation in quaternary structure. PLoS Pathog 6: e1001249. 255. Wu, B., E. Y. Chien, C. D. Mol, G. Fenal ti, W. Liu, V. Katritch, R. Abagyan, A. Brooun, P. Wells, F. C. Bi, D. J. Hamel, P. Kuhn, T. M. Handel, V. Cherezov, and R. C. Stevens. 2010. Structures of the CXCR4 chemokine GPCR with small molecule and cyclic peptide antagonists. Science 330: 1066 1071. 256. Wu, L., G. LaRosa, N. Kassam, C. J. Gordon, H. Heath, N. Ruffing, H. Chen, J. Humblias, M. Samson, M. Parmentier, J. P. Moore, and C. R. Mackay. 1997. Interaction of chemokine receptor CCR5 with its ligands: multiple domains for HIV 1 gp120 binding a nd a single domain for chemokine binding. J Exp Med 186: 1373 1381. 257. Wu, L., T. Zhou, Z. Y. Yang, K. Svehla, S. O'Dell, M. K. Louder, L. Xu, J. R. Mascola, D. R. Burton, J. A. Hoxie, R. W. Doms, P. D. Kwong, and G. J. Nabel. 2009. Enhanced exposure of the CD4 binding site to neutralizing antibodies by structural design of a membrane anchored human immunodeficiency virus type 1 gp120 domain. J Virol 83: 5077 5086. 258. Wu, X., Z. Y. Yang, Y. Li, C. M. Hogerkorp, W. R. Schief, M. S. Seaman, T. Zhou, S. D. Schmidt, L. Wu, L. Xu, N. S. Longo, K. McKee, S. O'Dell, M. K. Louder, D. L. Wycuff, Y. Feng, M. Nason, N. Doria Rose, M. Connors, P. D. Kwong, M. Roederer, R. T. Wyatt, G. J. Nabel, and J. R. Mascola. 2010. Rational design of envelope identifies broadly neutralizing human monoclonal antibodies to HIV 1. Science 329: 856 861. 259. Wu, X., T. Zhou, S. O'Dell, R. T. Wyatt, P. D. Kwong, and J. R. Mascola. 2009. Mechanism of human immunodeficiency virus type 1 resistance to monoclonal antibody B12 that effecti vely targets the site of CD4 attachment. J Virol 83: 10892 10907. 260. Wyatt, R., J. Moore, M. Accola, E. Desjardin, J. Robinson, and J. Sodroski. 1995. Involvement of the V1/V2 variable loop structure in the exposure of human

PAGE 172

172 immunodeficiency virus type 1 gp120 epitopes induced by receptor binding. J Virol 69: 5723 5733. 261. Yang, Y. L., G. Wang, K. Dorman, and A. H. Kaplan. 1996. Long polymerase chain reaction amplification of heterogeneous HIV type 1 templates produces recombination at a relatively high frequency. AIDS Res Hum Retroviruses 12: 303 306. 262. Yi, Y., F. Shaheen, and R. G. Collman. 2005. Preferential use of CXCR4 by R5X4 human immunodeficiency virus type 1 isolates for infection of primary lymphocytes. J Virol 79: 1480 1486. 263. Yue, L., L Shang, and E. Hunter. 2009. Truncation of the membrane spanning domain of human immunodeficiency virus type 1 envelope glycoprotein defines elements required for fusion, incorporation, and infectivity. J Virol 83: 11588 11598. 264. Zhang, M., B. Foley, A K. Schultz, J. P. Macke, I. Bulla, M. Stanke, B. Morgenstern, B. Korber, and T. Leitner. 2010. The role of recombination in the emergence of a complex and dynamic HIV epidemic. Retrovirology 7: 25. 265. Zhou, T., I. Georgiev, X. Wu, Z. Y. Yang, K. Dai, A Finzi, Y. D. Kwon, J. F. Scheid, W. Shi, L. Xu, Y. Yang, J. Zhu, M. C. Nussenzweig, J. Sodroski, L. Shapiro, G. J. Nabel, J. R. Mascola, and P. D. Kwong. 2010. Structural basis for broad and potent neutralization of HIV 1 by antibody VRC01. Science 329: 8 11 817. 266. Zhu, P., J. Liu, J. Bess, E. Chertova, J. D. Lifson, H. Gris, G. A. Ofek, K. A. Taylor, and K. H. Roux. 2006. Distribution and three dimensional structure of AIDS virus envelope spikes. Nature 441: 847 852. 267. Zhuang, K., A. Finzi, S. Tasc a, M. Shakirzyanova, H. Knight, S. Westmoreland, J. Sodroski, and C. Cheng Mayer. 2011. Adoption of an "open" envelope conformation facilitating CD4 binding and structural remodeling precedes coreceptor switch in R5 SHIV infected macaques. PLoS One 6: e2135 0. 268. Zolla Pazner, S., X. P. Kong, X. Jiang, T. Cardozo, A. Ndas, S. Cohen, M. Totrov, M. S. Seaman, S. Wang, and S. Lu. 2011. Cross Clade HIV 1 Neutralizing Antibodies Induced with V3 Scaffold Protein Immunogens following Priming with gp120 DNA. J Vi rol 85: 9887 9898. 269. Zwick, M. B., A. F. Labrijn, M. Wang, C. Spenlehauer, E. O. Saphire, J. M. Binley, J. P. Moore, G. Stiegler, H. Katinger, D. R. Burton, and P. W. Parren. 2001. Broadly neutralizing antibodies targeted to the membrane proximal

PAGE 173

173 extern al region of human immunodeficiency virus type 1 glycoprotein gp41. J Virol 75: 10892 10905.

PAGE 174

174 BIOGRAPHICAL SKETCH Wilton Bryan Williams was born in 1982 to Ezril and Michelle Williams in Kingston, Jamaica, W.I. Determined to give the ir children the education they did not receive, Ezril and Michelle Williams worked tirelessly to support my educational journey through St. Judes Primary and Calabar High School. Upon completion of five years at Calabar High School, my success in the Carib bean Examination Council external exams awarded me a place in Sixth Form at Calabar High where he spent two years undergoing pre university courses in life sciences and also served as the president of the student body during my senior year. At 18 years old he moved to New York City in January 2001 to begin his University of New York. While in New York City he lived with Aunt Lena and Uncle Selmon Wells. In August 2005, he enrolled in the Interdisciplinary Program (IDP) in Biomedical Sciences in the College of Medicine at the University of Florida to pursue a Doctor of Philosophy in medical sciences immunology and microbiology. Wilton was awarded the Graduate Alumni Research Fellow ship from the IDP, which funded 75% of his stipend for the first four years of his graduate school career. Wilton was a recipient of the Bill and Melinda Gates Global Travel Award in 2010, which provided an all expense paid trip to attend the HIV 1 Evoluti on, Genomics and Pathogenesis Keystone Meeting held in Whistler, British Columbia in March 2011, where he presented data from his dissertation research in a poster. Wilton also received the Bill and Melinda Gates Global Travel Award in 2011 to attend the H IV Vaccines Keystone Meeting to be held in Keystone, Colorado, in March 2012. In 2009, Wilton served as the president for the IDP Graduate Student Organization. Upon completion of his doctoral studies, he ete experiments and write an

PAGE 175

175 additional manuscript, and transition the responsibilities of the Env project to other lab 1 vaccine development while mentoring young student scientists in academia. With th is goal in mind, he wishes to pursue post doctoral studies evaluating immunogen design and delivery, and immune mecha nisms of host response to HIV 1 In search of postdoctoral opportunities, Wilton had four interviews during the month of November 2011 at t he following institutions: Research Center (Dr. Hans Peter Kiem lab), Institute of Human Virology at the man Vaccine Institute at Duke University School of Medicine After reviewing his job offers, Wilton plans to begin postdoctoral studies on approximately March 1 st