<%BANNER%>

Tomato Flavor Molecules

Permanent Link: http://ufdc.ufl.edu/UFE0043615/00001

Material Information

Title: Tomato Flavor Molecules A Story of Guaiacol and Glycosylation
Physical Description: 1 online resource (94 p.)
Language: english
Creator: Mageroy, Melissa Hamner
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: flavor -- glycosyltransferase -- guaiacol -- methyltransferase -- tomato
Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Plant Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: O-Methyltransferases (OMT) are important enzymes responsible for synthesis of many small molecules, including lignin monomers, flavonoids, alkaloids, and aroma compounds. One such compound is guaiacol, a volatile molecule with a smoky aroma that contributes to tomato flavor. Little is known about the pathway and regulation of guaiacol synthesis. One possible synthetic route is via catechol methylation. We identified a tomato O-methyltransferase (CTOMT1) with homology to a Nicotiana tabacum catechol OMT. CTOMT1 was cloned from Solanum lycopersicum cv. M82 and expressed in E. coli. Recombinant CTOMT1 enzyme preferentially methylated catechol, producing guaiacol. To validate the in vivo function of CTOMT1, gene expression was decreased or increased in transgenic S. lycopersicum plants. Suppression of CTOMT1 resulted in significantly reduced fruit guaiacol emissions. CTOMT1 overexpression resulted in slightly increased fruit guaiacol production, suggesting that catechol availability might limit guaiacol production. To test this hypothesis, wild type (WT) and CTOMT1 overexpressing tomato pericarp discs were supplied with exogenously applied catechol. Guaiacol production increased in both WT and transgenic fruit discs, although to a much greater extent in CTOMT1 overexpressing discs. Finally, we identified two introgression lines, 10-1 and 10-1-1, with increased guaiacol and higher CTOMT1 expression. Taken together, these data led us to conclude that CTOMT1 is a catechol-O-methyltransferase that produces guaiacol in tomato fruit. Many of the small volatile molecules, including guaiacol, that contribute to tomato flavor are glycosylated. A large family of glycosyltransferases (UGTs) is known to glycosylate a broad group of secondary metabolites, including flavor compounds. Little is known about UGTs or the function of these glycosides in tomato. One of the largest pools of glycosylated flavor volatiles is 2-phenylethanol glycoside. In order to identify tomato UGTs that glycosylate 2-phenylethanol, we first characterized 2-phenylethanol glycoside. We found that the 2-phenylethanol aglycone was attached to a polysaccharide and perhaps a malonyl glucose moiety. To screen potential candidate UGTs, we co-expressed the 2-phenylethanol biosynthetic pathway with candidate UGTs through transient expression in Nicotiana benthamiana. One potential 2-phenylethanol UGT was identified, SGN-U578227. UGT candidates were also overexpressed and suppressed down in tomato fruit. However, no changes to volatiles in the 2-phenylethanol synthesis pathway were found.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Melissa Hamner Mageroy.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Klee, Harry J.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043615:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043615/00001

Material Information

Title: Tomato Flavor Molecules A Story of Guaiacol and Glycosylation
Physical Description: 1 online resource (94 p.)
Language: english
Creator: Mageroy, Melissa Hamner
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: flavor -- glycosyltransferase -- guaiacol -- methyltransferase -- tomato
Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Plant Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: O-Methyltransferases (OMT) are important enzymes responsible for synthesis of many small molecules, including lignin monomers, flavonoids, alkaloids, and aroma compounds. One such compound is guaiacol, a volatile molecule with a smoky aroma that contributes to tomato flavor. Little is known about the pathway and regulation of guaiacol synthesis. One possible synthetic route is via catechol methylation. We identified a tomato O-methyltransferase (CTOMT1) with homology to a Nicotiana tabacum catechol OMT. CTOMT1 was cloned from Solanum lycopersicum cv. M82 and expressed in E. coli. Recombinant CTOMT1 enzyme preferentially methylated catechol, producing guaiacol. To validate the in vivo function of CTOMT1, gene expression was decreased or increased in transgenic S. lycopersicum plants. Suppression of CTOMT1 resulted in significantly reduced fruit guaiacol emissions. CTOMT1 overexpression resulted in slightly increased fruit guaiacol production, suggesting that catechol availability might limit guaiacol production. To test this hypothesis, wild type (WT) and CTOMT1 overexpressing tomato pericarp discs were supplied with exogenously applied catechol. Guaiacol production increased in both WT and transgenic fruit discs, although to a much greater extent in CTOMT1 overexpressing discs. Finally, we identified two introgression lines, 10-1 and 10-1-1, with increased guaiacol and higher CTOMT1 expression. Taken together, these data led us to conclude that CTOMT1 is a catechol-O-methyltransferase that produces guaiacol in tomato fruit. Many of the small volatile molecules, including guaiacol, that contribute to tomato flavor are glycosylated. A large family of glycosyltransferases (UGTs) is known to glycosylate a broad group of secondary metabolites, including flavor compounds. Little is known about UGTs or the function of these glycosides in tomato. One of the largest pools of glycosylated flavor volatiles is 2-phenylethanol glycoside. In order to identify tomato UGTs that glycosylate 2-phenylethanol, we first characterized 2-phenylethanol glycoside. We found that the 2-phenylethanol aglycone was attached to a polysaccharide and perhaps a malonyl glucose moiety. To screen potential candidate UGTs, we co-expressed the 2-phenylethanol biosynthetic pathway with candidate UGTs through transient expression in Nicotiana benthamiana. One potential 2-phenylethanol UGT was identified, SGN-U578227. UGT candidates were also overexpressed and suppressed down in tomato fruit. However, no changes to volatiles in the 2-phenylethanol synthesis pathway were found.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Melissa Hamner Mageroy.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Klee, Harry J.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043615:00001


This item has the following downloads:


Full Text

PAGE 1

1 TOMATO FLAVOR MOLECULES: A STORY OF GUAIACOL AND GLYCOSYLATION By MELISSA HAMNER MAGEROY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEG REE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Melissa Hamner Mageroy

PAGE 3

3 Then you will understand what is right and just and fair every good path. For wisdom will enter your heart, and knowledge will be pleasant to your soul. Discr etion will protect you, and understanding will guard you. ~Proverbs 2:9 11

PAGE 4

4 ACKNOWLEDGMENTS I thank my parents and sisters for their love, support, and encouragement throughout life. I also t hank my grand parents for instilling in me a love for learning a nd constant support and love. I thank my husband, Jon Mageroy, for opening my eyes to so many things, and his loving support. I also want to acknowledge Eric Schmelz at the United States Department of Agriculture ( USDA ) for his help on the purification of pe tunia gly cosides and Alisdair Fernie and Takayuki Tohge for their assistance in analyzing tomato glycosides. I want to thank my undergraduate advisor, Dr. James Shinkle, for first giving me the opportunity to do plant research and directing me to graduat e school. I want to thank my lab members: Dawn Bies, Peter Bliss, Abbye Floystad, Charles Goulet, Yusuke Kamiyoshihara, Mark Taylor, and Denise Tieman for all of their help, support, and friendship. I especially want to thank Charles Goulet and Denise Tiem an for all their guidance, assistance with experiments, and helpful conversations. I also want to thank my advisor Harry Klee for sharing his knowledge and scientific wisdom with me. I also thank the members of my committee: Kevin Folta and Andrew Hanson, who both allowed me to do rotations in their lab which contributed to publications, and Jon Stewart.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 10 ABSTRACT ................................ ................................ ................................ ................... 11 CHAPTER 1 TOMATO FLAVOR ................................ ................................ ................................ 13 Uncovering Lost Flavor ................................ ................................ ........................... 13 Peeling Apart Flav or Volatiles ................................ ................................ ................. 14 Volatile Biosynthesis ................................ ................................ ............................... 15 Fatty Acid Derived Volatiles ................................ ................................ .............. 15 Amino Acid Derived Volatiles ................................ ................................ ........... 16 Carotenoid Derived Volatiles ................................ ................................ ............ 17 Continuing the Search ................................ ................................ ............................ 17 2 GUAIACOL SYNTHIESIS: METHYLATION OF CATECHOL BY an O METHYLTRANSFERASE ................................ ................................ ....................... 20 Overview ................................ ................................ ................................ ................. 20 The Fl avor Molecule Guaiacol ................................ ................................ .......... 20 Small Molecule Methyltransferases ................................ ................................ .. 20 Catechol: Discovery and Synthesis ................................ ................................ .. 21 Synthesis of Guaiacol ................................ ................................ ....................... 22 Investigation of Guaiacol Synthesis in Tomato ................................ ................. 22 Results ................................ ................................ ................................ .................... 22 Identification of a Catechol O Methyltransferase (CTOMT1) from S. lycopersicum ................................ ................................ ................................ 22 Specificity and Specific Activity ................................ ................................ ........ 23 Overexpression of CTOMT1 in planta ................................ .............................. 23 Suppression of CTOMT1 in planta ................................ ................................ ... 24 Catecho l Feeding of Fruit Pericarp Disc ................................ ........................... 24 Use of nahG Transgenic Plants for in vivo Analysis of Increase Catechol ....... 25 Discussion ................................ ................................ ................................ .............. 25 Materials and Methods ................................ ................................ ............................ 27 Phylogenetic Tree of Small Molecule Methyltransferases ................................ 27 CTOMT1 in vitro Expression and Purification ................................ ................... 27 Enzymatic Assay ................................ ................................ .............................. 28

PAGE 6

6 Production of Transgenic Plants ................................ ................................ ....... 29 Volatile Collection ................................ ................................ ............................. 29 Gene Expression Analysis ................................ ................................ ................ 30 CTOMT1 Expression and Gu aiacol Quantification through Flora Dade Ripening ................................ ................................ ................................ ........ 30 Catechol Feeding of Fruit Pericarp Disc ................................ ........................... 30 3 QUANTITATIVE TRAIT LOCUS ASSO CIATED WITH INCREASED GUAIACOL ................................ ................................ ................................ ............. 39 Overview ................................ ................................ ................................ ................. 39 Looking for Genetic Variation ................................ ................................ ........... 39 Enhancing Diversity ................................ ................................ .......................... 40 Identifying Quantitative Trait Loci (QTL) ................................ ........................... 40 Results ................................ ................................ ................................ .................... 41 Finding a Guaiacol QTL ................................ ................................ ................... 41 Comparing Activity of CTOMT1 Orthologs from S. lycopersicum and S. pennellii ................................ ................................ ................................ ......... 41 Gene Expression Analysis ................................ ................................ ................ 42 Catechol and Salicylic Acid Quantification ................................ ........................ 42 Discussion ................................ ................................ ................................ .............. 42 Materials and Methods ................................ ................................ ............................ 45 Mapping and Volatile Analysis of CTOMT1 ................................ ...................... 45 Catechol and Salicylic Acid Quantification ................................ ........................ 45 4 GLYCOSYLATION OF FLAVOR MOLECULES ................................ ..................... 54 Overview ................................ ................................ ................................ ................. 54 Small Molecule Glycosides ................................ ................................ ............... 54 Family 1 Glycosyltransferases (UGTs) ................................ ............................. 54 Aromatic Small Molecule Glycosides ................................ ............................... 55 2 Phenylethanol Glycosylation ................................ ................................ ......... 56 Results ................................ ................................ ................................ .................... 56 Isolation and Characterization of 2 Phenylethanol Glycoside ........................... 56 Selection of Tomato UGT Candidates and Cloning ................................ .......... 57 Transgenic Expression of UGT Candidates in Tomato ................................ .... 58 Discussion ................................ ................................ ................................ .............. 59 Materials and Methods ................................ ................................ ............................ 61 Glycoside Extraction fr om Petunia hybrida Flowers ................................ ......... 61 Glycoside Extraction from Tomato Fruits ................................ .......................... 62 Phylogenetic Tree of UGTs ................................ ................................ .............. 62 Cloning and Protein Expression in E. coli ................................ ......................... 63 Transient Expression in N.benthamiana ................................ ........................... 63 Tran sgenic Expression in Tomato ................................ ................................ .... 64 RNA Extraction and Volatiles Collection ................................ ........................... 64 5 CONCLUSIONS ................................ ................................ ................................ ..... 72

PAGE 7

7 APPEND IX: PROMOTER AND GENOMIC SEQUENCE COMPARISON .................... 73 LIST OF REFERENCES ................................ ................................ ............................... 83 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 94

PAGE 8

8 LIST OF TABLES Table page 1 1 Volatiles that contribute to tomato aroma. ................................ .......................... 18 2 1 Relati ve activity of CTOMT1 on substrates with similar structure to catechol. .... 31 2 2 Catechol feeding of tomato discs. ................................ ................................ ....... 31 3 1 Compar ison of enzyme activity between CTOMT1 orthologs from S. lycopersicum and S. pennellii ................................ ................................ ............ 47 4 1 Comparison of free and bound volatiles from ripe cv. Moneymaker tomatoes ... 65 4 2 Expressed Sequence Tag ( EST ) counts for UGT candidate unigenes ............... 65

PAGE 9

9 LIST OF FIGURES Figure page 2 1 Identification of potential S. lycopersicum CTOMTs ................................ ........... 32 2 2 Enzyme activity of CTOMT1. ................................ ................................ .............. 34 2 3 Vectors for transgen e expression. ................................ ................................ ...... 35 2 4 Gene expression and guaiacol levels in transgenic plants ................................ 36 2 5 CTOMT1 expression and guaiacol produ ction through fruit development .......... 37 2 6 Guaiacol spectrum of catechol fed disc ................................ .............................. 38 3 1 Chromosome 10 map with positions of ILs 10 1 and 10 1 1 .............................. 48 3 2 CTOMT1 expression and guaiacol emission from ILs. ................................ ....... 49 3 3 Methyl salicylate levels in M82 and ILs 10 1 and 10 1 1 ................................ .... 50 3 4 Amino acid alignment of S. lycopersicum and S. pennellii CTOMT1 .................. 51 3 5 Catechol and salicylic acid quantification ................................ ........................... 52 3 6 Spectra of silylated catechol ................................ ................................ ............... 53 4 1 Amino acid alignment of PSPG region ................................ ............................... 66 4 2 Isolated glycosides from Petunia ................................ ................................ ........ 67 4 3 Comparison of M82 and IL8 2 1 glycosides. ................................ ...................... 68 4 4 Homology of tomato UGT can didates with known UGTs from Arabidopsis ....... 69 4 5 Relative levels of 2 phenylethanol from transient expression in N. benthamiana ................................ ................................ ................................ ....... 71

PAGE 10

10 LIST OF ABBREVIATION S AADC Aromatic L amino acid decarboxylases ADH Alcohol dehydrogenase AdoMet S adenosyl L methionine CAPS C leaved amplified polymorphic sequence CCD C arotenoid cleavage dioxygenase CCRC Complex Carbohydrate Research Center EST Expressed sequence tag FISH Fluores cence in situ Hybridization GC MS Gas chromatography mass spectroscopy HPL H ydroperoxide lyase IL Introgression line LC MS Liquid chromatography mass spectroscopy LOX L ipoxygenase MES 2 (N morpholino)ethanesulfonic acid MW Molecular weight OMT O methyltans ferase RFLP Restriction fragment length polymorphism PCR Polymerase chain reaction PG Polygalacturonase PSPG Plant Secondary Product Glycosyltransferase Motif QTL Q uantitative trait loc us UGT UDP dependent glycosyltransferases

PAGE 11

11 Abstract of Dissertation Pr esented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy TOMATO FLAVOR MOLECULES: A STORY OF GUAIACOL AND GLYCOSYLATION By MELISSA HAMNER MAGEROY Decem ber 2011 Chair: Harry J. Klee Major: Plant Molecular and Cellular Biology O M ethyltransferases (OMT) are important enzymes responsible for synthesis of many small molecules, including lignin monomers, flavonoids, alkaloids, and aroma compounds. One such compound is guaiacol, a volatile molecule with a smoky aroma that contributes to tomato flavor. Little is known about the pathway and regulation of guaiacol synthesis One possible synthetic rout e is via catechol methylation. We identified a tomato O methy ltransferase (CTOMT1) with homology to a Nicotiana tabacum catechol OMT. CTOMT1 was cloned from Solanum lycopersicum cv. M82 and expressed in E. coli Recombinant CTOMT1 enzyme preferentially methylated catechol, producing guaiacol. To validate the in vivo function of CTOMT1, gene expression was decreased or increased in transgenic S. lycopersicum plants. Suppression of CTOMT1 resulted in significantly reduced fruit guaiacol emissions. CTOMT1 overexpression resulted in slightly increased fruit guaiacol prod uction suggesting that catechol availability might limit guaiacol production. To test this hypothesis, wild type (WT) and CTOMT1 overexpressing tomato pericarp discs were supplied with exogenously applied catechol. Guaiacol production increased in both WT and transgenic fruit discs, although to a much greater extent in CTOMT1 overexpressing discs. Finally, we identified two

PAGE 12

12 introgression lines 10 1 and 10 1 1, with increased guaiacol and higher CTOMT1 expression Taken together, these data led us to concl ude that CTOMT1 is a catechol O methyltransferase that produces guaiacol in tomato fruit. Many of the small volatile molecules, including guaiacol, that contribute to tomato flavor are glycosylated. A large family of g lycosyltransferase s (UGTs) is known to glycosylate a broad group of secondary metabolites, including flavor compounds. Little is known about UGTs or the function of these glycosides in tomato One of the largest pools of glycosylated flavor volatiles is 2 phenylethanol glycoside. In order to i dentify tomato UGTs that glycosylate 2 phenylethanol, we first characterized 2 phenylethanol glycoside. We found that the 2 phenylethanol aglycon e was attached to a polysaccharide and perhaps a malonyl glucose moiety To screen potential candidate UGTs we co expressed the 2 phenylethanol biosynthetic pathway with candidate UGTs through transient expression in N icotiana benthamiana One potential 2 phenylethanol UGT was identified, S GN U578227. UGT candidates were also overexpress ed and suppress ed down in t omato fruit. However, no change s to volatiles in the 2 phenylethanol synthesis pathway were found.

PAGE 13

13 CHAPTER 1 TOMATO FLAVOR Un cover ing Lost Flavor Domestication of t omato ( Solanum lycopersicum ) by Native Americans most likely began in Central America befo re the arrival of Europeans (Tank sley 2004 ) By the end of the 19 th century, a wide range of cultivars that are today generally referred to as varieties were available. These varieties were diverse in color, size, and flavor (Bai and Lindhou t, 2007). Today most fresh market tomatoes are bland and et al ., 2008). This loss in flavor profile diversity is in part due to the economic pressure on breeders to select fo r characteristic s that reduce production cost s such as increase d yield larger fruit size, and longer shelf life. These traits tend to be negatively correlated with good flavor (Bai and Lindhout, 2007 ; Klee, 2010 ). Improving or even maintaining tomato fla vor through breeding has proven to be a daunting task as flavor is a complex trait that is comprised of a mixture of sugars, acids, and volatiles (Baldwin et al ., 2008; Tieman et al ., 2006 a ). From a sensory perspective, the interaction and balance of these three components are important for creating good tomato flavor as flavor perception is a summation of both taste and smell. Sweetness has been show n to enhance the perception of volatiles with floral/fruit y notes while sourness heightens the perception greens notes (Baldwin et al., 1998). Although attempts to improve taste by increasing sugars and acids have shown some success (Jones and Scott 1983), it has been difficult to overcome the correlation between small fruit size and increased sugar content ( Klee, 2010).

PAGE 14

14 Breeding for increased volatile production is an even greater challenge as volatiles are synthesized from multiple precursors, including amino acids, fatty acids, and carotenoids (Goff and Klee, 2006) Also, a large number of quantitative tr ait loci (QTLs) affecting their synthesis have been identified (Tieman et al ., 2006 a ; Mathieu et al ., 2008). To further complicate matters, flavor is also affected by environment al conditions, harvest maturity, and postharvest handling (Baldwin, 2002 ; Petr o Turza, 1986 ). In order to o ver come these challenges, we must employ new tools in molecular breeding and methods for gene discovery (Klee, 2010). A s we strive to re cover lost flavor, we also have a great opportunity to explore gene regulation, enzyme func tion, and secondary metabolism Peeling Ap art Flavor Volatiles The first description of tomato fruit alcohols an d acetaldehydes was made in 1934 (Gustafson). For the next twenty yea rs, there was a continued interest in describing and identifying components that contribute to tomato aroma, but n ot until 1968 was there any real quantitative analysis of tomato volatiles ( Johnson et al ., 1968). Quantitative methods to analyze fresh tomato flavor volatiles were further developed by R.G. Buttery (Buttery et al ., 1987; Buttery et al ., 1988 ; Buttery et al 1989 ) Over 400 different volatiles have been identified from tomato fruit (Buttery et al 1989; Petro Turza, 1986). However, only about 30 of these volatiles are present at perceivable levels to humans (Table 1 1) ( Tieman et al ., 2006a ) Approximately, 100 QTLs that impact volatiles and their precursors have been identified. Generally, genes associated with these QTL s encode regulatory factors control ling volatile biosynthetic pathways or enzyme s in these pathway s (Klee, 2010)

PAGE 15

15 Volatile Biosynthesis T omato flavor v olatiles are synthes ized from diverse classes of molecules including: fatty acids, amino acids, and carotenoids (Tieman et al 2006a). Many aroma volatiles increase during fruit ripening (Baldwin et al 1991). The increase is thought to be due to changes in substrate availability and enzyme accumulation (Baldwin et al ., 2000). For example, the synthesis of some volatile precursors, such as carotenoids, is known to be ripening regulated and occur s upon c hromoplast differentiation (Bramley, 2002). R egulation of synthesis of enzyme s involved in volatile synthesis is not well understood. H owever compari sons between ripening mutants and their controls indicates that the ripening process induces changes in bo th mRNA and protein accumulation (Biggs et al ., 1985). Although isolating volatile synthetic enzymes has been challenging due to the genetic redunda ncy and broad substrate specificity the role for several important enzymes have been discovered (Klee, 2010 ). Fatty Acid Derived Volatiles (Goff and Klee, 2006) Examples of fatty a cid derived volatiles are hexenal and cis 3 hexenol S ynthesis of these volatiles beg ins with the oxidation of C 18 compounds such as linoleic acid and linolenic acid to form fatty acid hydroperoxides. This reaction is catalyzed by non heme iron containing dioxygenases named lipoxygenases (LOX) Although there are at least five LOX genes expressed in ripe fruit, so far only LOXC has been shown to have a significant impact on the production of C 6 volatiles in tomato fruit (Chen et al 2004). Hydroperoxides formed by LOX can be further modified by hydroperoxide lyase (HPL) HPL cleaves at the hydroperoxide containing carbon to form an aldehyde and an

PAGE 16

16 oxoacid (Riley et al 1996) Resulting aldehyde s can be further reduced to form their corresponding alcohols ( Matsui, 2006) In tomato, an a lcohol dehydrogenase ( ADH ) has been shown to catalyz e the synthesis of these C 6 alcohol s (Speir s et al 1998) Amino Acid Derived Volatiles Amino acid precursors of aroma molecules include alanine, valine, leucine, isoleucine, and phenylalanine (Baldwin et al ., 2000). Although the pathways are not well esta blish ed it is thought that branched chain amino acids contribute to the formation of volatiles such as 3 methylbuta nal/ol and 2 methylbutanal/ol. Both the amino acids and keto acids could serve as building block s for volatile synthesis. It has bee n keto acids to fruit pericarp disc stimulates synthesis of volatiles although application of the keto acids leads to significantly higher rates of volatiles synthesis (Klee, 2010 ; Kochevenko et al ., manusc ript under review ). A similar result has also been observed in Cucumis melo L. fruit (Gonda et al ., 2010). Much more is known about phenylalanine derived volatiles, which include phenylacetaldehyde, 2 phenylethanol, and 1 nitro 2 phenethane. These volatile s are described as fruity/floral (Tieman et al ., 2006b) The first and major flux controlling step of the pathway to synthesis of these volatiles is catalyzed by a family of genes called aromatic L amino acid decarboxylases (AADC) These enzymes convert phe nylalanine to phenethylamine (Tieman et al ., 2006b). In the 2 phenylethanol biosynthetic pathway, the final step from phenylacetaldehyde to 2 phenylethanol is catalyzed by a small family of aldehyde reductase s (Tieman et al ., 2007)

PAGE 17

17 Carotenoid Derived Vola tiles Volatiles derived from carotenoids includ damascenone, gera nlyacetone, and pseudoionone. These volatiles are also characterized as fruity/floral (Klee, 2010). Although these volatile s tend to be present at low levels in tomato fruit, they can have a great impact on flavor due to the ir low odor thresholds (Baldwin et al ., 2000). Carotenoid cleavage dioxygenases (CCD) have been shown to be important in the formation of geran yl acetone ionone (Simkin et al ., 2004) These enzyme s are capable of cleaving carotenoids at the 5 6 7, 8 or 9 10 positions to produce aldehydes and ketones ( Vogel et al ., 2008). Continuing the Search Although many volatile pathways have been identified, many are still unknown Additionally, the understanding of how these pathways are regulated is still el emental (Klee, 2010). The scope of this work is to identify the biosynthetic pathway and enzymes that synthesize guaiacol Also explore d is a molecule modification process that may serve to regulate the pool of free volatiles.

PAGE 18

18 Table 1 1 Volatiles that c ontribute to tomato aroma. Structure Conc. (ppb) Odor threshold (ppb) Precursor Description cis 3 Hexenal 12 000 0.25 Fatty acid green, grassy Hexan al 3 000 5 Fatty acid g reen, grassy 1 Penten 3 one 520 1 Fatty acid g reen, citrus cis 3 Hexenol 150 70 Fatty acid g reen, leafy trans 2 Hexenal 60 17 Fatty acid green, grassy trans 2 Heptenal 60 13 Fatty acid green, grassy 2 Phenylethanol 1 900 750 Phe f loral, r ose 1 Nitro 2 phenylethane 17 2 Phe f loral, s weet Phenylacetaldehyde 15 4 Phe f loral, honey 2+3 Methylbutanal 27 1 0.2 Ile Leu f ruity, cocoa

PAGE 19

19 Table 1 1. (Continued) Structure Conc. (p pb) Odor threshold (ppb) Precursor Description 3 Methylbutanol 380 120 Phe f ruity, wine ionone 4 0.007 Carotenoid f loral, fruity damascenone 1 0.002 Carotenoid f ruity, sweet Gera n yl acetone 57 60 Carotenoid s we et, citrus 6 Methyl 5 hepten 2 one 130 2000 Carotenoid f ruity, citrus Methyl salicylate 48 40 Phe and/or chorismate W inter green 2 Isobutylthiazole 36 3.5 Unknown musty Adapted fro m Baldwin et al ., 2000 and Goff and Klee et al ., 2007

PAGE 20

20 CHAPTER 2 GUAIACOL SYNTHIESIS: METHYLATION OF CATEC HOL BY AN O METHYLTRANSFERASE Overview The Flavor Molecule Guaiacol Guaiacol (2 methoxyphenol) is found in many processed food products such as wine, roasted coffee, tea, cocoa, and food additives like liquid smoke (Serra Bonveh and Ventura Coll, 1998; Dorfner et al ., 2003; Guillen et al ., 1995; Hayasaka et al ., 2010; Kumazawa and Masuda, 2002). Guaiacol is not commonly found in fresh fruits and vege tables, but is an important contributor to tomato flavor. Common flavor descriptors of guaiacol are medicinal or smoky ( lvarez Rodrguez et al 2003). G uaiacol has been described as an undesirable compound in many fruits, based on its medicinal like arom a (Zierler et al ., 2004; Zanor et al ., 2009). However, guaiacol has not been well correlated with either liking or disliking in tomato fruit. Therefore, we were interested in identifying genes responsible for its synthesis to permit guaiacol content altera tions Little is known about how guaiacol is synthesized in plants. Based upon its structure, we deduced that it could be synthesi zed by a methylation of catechol Small Molecule Methyltransferases Methylation of small molecules is catalyzed by methyltra nsferases that transfer a methyl group from S adenosyl L methionine (AdoMet) to an acceptor molecule Usually methyltransferases that methyla te hydroxyl or carboxyl groups are known as O methyltransferases (OMTs) but some methylate nitrogen and sulfur gro ups on small molecules (Noel et al ., 2003). Many plant OMTs with important functions in phenylpropanoid biosynthesis have been identified. These enzymes synthesize secondary metabolites such as lignin, flavonoids and aroma molecules ( Gang et al

PAGE 21

21 2002 ). Th ese aroma molecules include several volatiles that are important contributors to R osa chinensis (China Rose) Ocimum basilicum (Basil) and Clarkia breweri (Fairy Fans) fragrance (Gang et al ., 2002; Gang et al ., 2005; Wang et al ., 1997). S ynthesi s of the t omato flavor volatile methyl salicylate has also been shown to require enzymatic activity of an OMT. In this biosynthetic pathway, the carboxyl group of salicylic acid is methylated to produce methyl salicylate (Tieman et al ., 2010). Catechol: Discovery an d Synthesis We deduce that c atechol is the direct precursor of guaiacol based upon structurally similarities Catechol ( 1,2 dihydroxybenzene) was first isolated by H. Reinsch in 1893 from Mimosa catechu fo und in fruits and vegetables. The browning observed in cut apples is in part due to the oxidation of catechol to benzoquinone (Matheis, 1983; Zheng et al ., 2010). In microorganisms, catechol is known to be synthesized from phenol, benzoic acid, salicylic acid, or 2,3 dihydroxybenzoic acid (Evans et al ., 1951; Katagiri et al ., 1962; Subba Rao et al ., 1967) One well characterized bacterial gene that converts salicylic acid to catechol is nah G a salicylic acid hydroxylase ( Gaffney et al ., 1993; Yamamoto et al ., 1965 ). Many studies in transgenic plants have demonstrated a great reduction in the salicylic acid content of plants expressing nah G (van Wees and Glazebrook 2003; Boss et al 2010) There has been little exploration of catechol synthesis in plants. One study, in Tecoma stuns, suggests that catechol is synthesized from anthranilic acid, while another, in Gaultheria adenothrix suggests that it is synthesized from salicylic acid (Ellis and Towers 1969).

PAGE 22

22 Synthesis of Guaiacol Guaiacol can be synthesiz ed from catechol by the addition of a methyl group. Methylation of catechol is catalyzed by orthodiphenol O methyltransferases (Pellegrini et al ., 1993). OMTs with activity on various orthodiphenolic substrates, including catechol, have previously been cha racterized in Fragaria x ananassa, N tabacum and O basilicum (Collendavelloo et al ., 1981; Maury et al ., 1999; Gang et al ., 2002 ; Wein et al ., 2002 ), although a direct in vivo role for any enzyme involved in guaiacol synthesis has not been demonstrated. Investigation of Guaiacol Synthesis in Tomato Here we describe both in vitro and in vivo approaches to identify a tomato catechol OMT. The catalytic activity of candidate OMTs on catechol was fir st determined using recombinant protein expressed in E. coli This activity was then confirmed in vivo by transgene expression in tomato fruit. Results Identification of a Catechol O M ethyltransferase (CTOMT1) from S. lycopersicum Potential S. lycopersicum catechol OMT candidates were selected by identification of c oding sequences with similarity to previously characteriz ed small molecule OMTs (Figure 2 1 ). Five candidate genes were selected, SGN U582403, SGN U565623, SGN U319245, SGN U575022, and SGN U321686. Full length cDNAs were synthesized from S. lycopersicum c v. M82 ripe fruit RNA. Candidate genes were cloned into an expression vector in E. coli Initial screens were performed by adding catechol directly to bacterial cultures expressing recombinant protein and measuring guaiacol production. Only SGN U582403 con verted cate chol to guaiacol

PAGE 23

23 Specificity and Specific Activity To further test the specificity of SGN U582403 for catechol, the activity of SGN U582403 on substrates with similar structure to catechol was measured. Recombinant enzyme purified from E. coli was incubated with [ 14 C] AdoMet and the following potential substrates: catechol, guaiacol, salicylic acid, benzoic acid orcinol, caffeic acid, protocatechuic aldehyde, 2,5 dimethyl 4 methyoxy 3(2H) furanone, and pyrogallol SGN U582403 had relatively high activity with catechol as a substrate, much lower activity on protocatechuic aldehyde and slight activity on orcinol, caffeic acid, and pyrogallol (Table 2 1) The specific activity of SGN U582403 with catechol as a substrate was also measured. Purified e nzyme was incubated with excess [ 14 C] AdoMet and various concentrations of catechol. The enzyme was determined to have a K m of 8.36 1.78 M and K cat value of 9. 67 2.42 s 1 (Figure 2 2 ). Guaiacol was confirmed as the product by GC MS. Based on these resu lts, the gene encoding the SGN U582403 protein was renamed CTO MT1. Overexpression of CTOMT1 in planta To further test the function of CTOMT1 in planta, a full length CTOMT1 cDNA was cloned into pHK1001 (Figure 2 3) for constitutive overexpression. The cons truct was transformed into S. lycopersicum cv. Flora Dade. Seventeen independent lines were initially screened for transgene expression. Based on this screen, the four best overexpressing lines were further analyzed for CTOMT1 mRNA levels (Figure 2 4A ) and guaiacol synthesis in ripe fruits (Figure 2 4B ). Guaiacol production was significantly increased in two of the four lines overexpressing CTOMT1 However, the increased guaiacol was not proportional to the increased RNA levels; up to a 26 fold increase in

PAGE 24

24 transcript resulted in only a two fold increase in guaiacol. A similar lack of correlation between CTOMT1 transcript abundance and guaiacol productio n was observed throughout development of non transgenic Flora Dade fruit Although CTOMT1 expression was th e highest in immature green fruit, guaiacol production was much higher in ripe fruit (Figure 2 5 ). Suppression of CTOMT1 in planta CTOMT1 was also cloned into pK2WG7 (Figure 2 3) (Karimi et al ., 2002) for antisense knock down and transformed into cv. Flor a Dade Twenty five lines were initially screened for supression of CTOMT1 RNA using leaf tissue. The four lines with greatest RNA reduction were further screened for CTOMT1 mRNA levels in ripe fruit (Figure 2 4C ). Volatile emissions were also determined ( Figure 2 4D ). The guaiacol levels were significantly reduced in all four antisense lines, confirming the role of CTOMT1 in guaiacol synthesis. Catechol Feeding of Fruit Pericarp Disc While antisense lines in which CTOMT1 levels were greatly reduced produce d significantly less guaiacol than controls, over expression of CTOMT1 had much less effect on guaiacol levels. These results suggested that while CTOMT1 is essential for guaiacol synthesis, it may not be rate limiting under normal circumstances. Rather, s ynthesis of catechol might limit the production of guaiacol in CTOMT1 overexpressing plants. We tested this hypothesis by feeding catechol to fruit pericarp discs of Flora Dade (WT) and CTOMT1 overexpressing lines. Volatiles were collected after incubation for 4 h. Both WT and CTOMT1 discs produced more guaiacol when supplied with exogenous catechol. However, while WT catechol fed discs exhibited a 36 fold increase in guaiacol synthesis, CTOMT1 discs exhib ited a 52 fold increase (Table 2 2 ; Figure 2

PAGE 25

25 6 ). The se results indicate that while CTOMT1 catalyzes the conversion of catechol to guaiacol, the availability of catechol likely limits guaiacol synthesis in fruit tissue. Use of n ahG Transgenic Plants for in vivo Analysis of Increase Catechol We also observed that transgenic fruit overexpressing the salicyl ate hydrolase gene, n ahG produce 38 fold more guaiacol than the non transgenic cv. Ailsa Craig control (data not shown). Historically, n ahG plants have been used in pathogen response studies because much of the salicylic acid pool is converted to catechol, which accumulates (Gaffney et al ., 1993; Van Wees and Glazebrook, 2003). n ahG plants provide an in vivo confirmation that, when catechol levels are increased guaiacol production is also increased. Discussi on We identified potential candidates by screening for catechol methylation with tomato homologs of previously characterized orthodiphenol OMTs. Of the five candidate S. lycopersicum proteins that were screened for catechol methylation activity, only CTOMT 1 was capable of converting catechol to guaiacol, suggesting that this enzyme is solely responsible for guaiacol synthesis in vivo The closest homolog of this protein in sequence databases (81% identity) is an enzyme with in vitro catechol OMT activity fr om N. tabacum (Collendavelloo et al ., 1981; Maury et al ., 1999; Pellegrini et al ., 1993). The N. tabacum CTOMT gene is highly inducible by pathogen infection (Pellegrini et al ., 1993). In vivo effects on catechol and guaiacol pools have not been reported. The activity of CTOMT1 on catechol was confirmed by recombinant enzyme assays. The K m and K cat values were similar to those of other characterized diphenol O methyltransferase s ( www.brenda enzymes.org ). While CTOMT1 preferentially methylates catechol, it does have some activity on protocatechuic aldehyde, oricinol

PAGE 26

26 caffeic acid, and pyrogallol All of these molecules have a similar basic structure of a benzene ring with at least two hydroxyl groups. CTOMT1 wa s unable to methylate molecules lacking two hydroxyl groups, indicating that the diphenol structure is important for substrate recognition. While plant OMTs usually have a high degree of selectivity, a few are promiscuous and catalyze methylation of struct urally related compounds (Lam et al ., 2007 Wein et al., 2002 ). However, CTOMT1 exhibited a strong preference for catechol over other tested diphenol compounds. In order to test if that CTOMT1 is a catechol OMT in vivo its expression was increased or redu ced in transgenic tomato plants Suppression of the endogenous gene significantly reduced guaiacol emission indicating that CTOMT1 is the major, if not only, enzyme responsible for guaiacol synthesis. Although there were high levels of CTOMT1 expression i n overexpressing plants, there were not correspondingly large increases in guaiacol production. It is probable that catechol levels limit guaiacol production, as normal endogenous levels of catechol must be low and high levels have been shown to be toxic t o plants (Morse et al ., 2007; Van Wees and Glazebrook, 2003). This hypothesis is further supported by the fact that in Flora Dade, CTOMT1 expression decreases with ripening, while guaiacol production increases. When we tested the hypothesis that catechol i s limiting guaiacol production by supplying fruit pericarp discs with exogenous catechol, we were able to significan tly increase guaiacol emission. Both WT and CTOMT1 overexpressing discs produced more guaiacol when supplied with non limiting catechol. How ever, the increase in guaiacol synthesis was much greater in CTOMT1 overexpressing discs than in non transgenic controls These results indicate that under certain circumstances, CTOMT1

PAGE 27

27 expression influences the rate of guaiacol synthesis but there must be a level of control that precedes catechol. This conclusion is further supported by the elevated guaiacol levels in n ahG overexpressing plants, which have high catechol levels. Materials and Methods Phylogenetic Tree of Small Molecule Methyltransferases S. lycopersicum OMT candidates were identified by a TBLASTN search of the sol genomic network Lycopersicon combined (tomato) unigene database using O. basilicum chavicol OMT and eugenol OMT amino acid sequences (Q93WU3; Q93WU2 ). Other similar proteins were i dentified by conducting a BLASTP search of the NCBI non redundant prot ein sequences using candidate CTOMTs. Twenty three OMT amino acid sequences were used to generate a protein alignment. The evolutionary history was inferred using the Neighbor Joining me thod (Saitou and Nei, 1987). The bootstrap test (1000 replicates) was used to calculate the percentage of replicate trees in which the associated taxa clustered together (Felsenstein, 1985). The evolutionary distances were computed using the Poisson correc tion method (Zuckerkandl and Pauling, 1965). The analysis involved 25 amino acid sequences. All positions containing gaps and missing data were eliminated. There were a total of 306 positions in the final dataset. Evolutionary analyses were conducted in ME GA5 (Tamura et al., 2011). CTOMT1 in v itro Expression a nd Purification SGN U582403 ( CTOMT1 ) was PCR amplified from S. lycopersicum and S. pennellii fruit cDNA. The products were cloned into pENTR/D/TOPO vectors and sequenced ( CHUL Research Center, http://www.sequences.crchul.ulaval.ca ) The coding regions were then cloned into vector pET160 by recombination and transformed into E. coli BL21 DE3 (Invitrogen, ht tp://www.invitrogen.com ) for inducible protein

PAGE 28

28 expression. Bacteria were precultured for 16 h at 37C in Luria Bertani broth containing 50 g/mL carbenicillin and the culture was used to inoculate 100 mL of the same medium. Cells were grown at 24C to an OD 600 of 0.5. Protein expression was induced by adding isopropyl 1 D thiogalactoside to the medium at a final concentration of 0.1 mM. Induced cultures continued growing at 25C for 16 h. Cells were harvested by centrifugation (10 min, 4 420 g) and resus pended in 6 mL of lysis buffer (1x Phosphate buffered saline (PBS)), lysozyme, 10% v/v glycerol, and Bacterial Protease Inhibitor Cocktail [Sigma, http://www.sigmaaldrich.com/ ]) and lysed with sonication. Prote in was purified using Ni Talon (Clonetech, http://www.clontech.com/ ) affinity chromatography. The column was washed with 1X PBS containing 5 mM imidazole. Imidazole concentration was increased to 150 mM in the elut ion buffer. Protein levels were quantified using Bradford Reagent and Bovine Serum Albumin as a standard (BioRad, http://www.bio rad.com/ ). Protein was stored in 16% glycerol at 80C. Enzymatic A ssay For relative ac tivity assays, 2. 7 g purified enzyme was assayed at 25C in a 100 L reaction containing 50 mM Tris mercaptoethanol, 15 M substrate, 10 mM AdoMet, 0.4 mM [methyl 14 C] AdoMet (specific activity 50.4 mCi mmol 1 ; Amersham). Substrates were d iluted in 50% ethanol. Assays were done in triplicate, including boiled enzyme controls. After 30 min at 25C the reactions were stopped by adding equal volumes of hexanes. The methylated substrate was extracted on a vortex mixer for 15 sec and centrifugin g (5 min, 13 200 g). 50 L of the organic layer was counted for 10 min in 3 ml Ready Gel Scintillation Fluid (Beckman Coulter, http://www.beckmancoulter.com ). Counts for the boiled enzyme

PAGE 29

29 controls were subtrac ted from the sample counts, and activity for catechol was normalized to 100%. For specific activity on catechol, procedures were the same as above, except for substrate concentrations. Concentrations used were: 0, 1, 5, 15, 25, and 50 M. The conversion of catechol to guaiacol was validated by repeatin g the experiment using only unlabeled AdoMet and analyzing organic layer by GC MS. Production of Transgenic P lants The full length open reading frame of CTOMT1 was cloned into a vector, pHK1001, containing the constitutive FMV 35S promoter (Richins et al ., 1987) followed by the nos 3 terminator, for overexpression. S. lycopersicum cv. Flora Dade cotyledons were transformed by Agrobacterium mediated transformation (McCormick et al ., 1986) with the kanamycin sel ectable marker, NPTII. Antisense constructions were made by cloning a full length CTOMT1 into pK2WG7 (Karimi et al ., 2002). Antisense constructs were made by the Plant Transformation Core Research Facility at the University of Nebraska ( http://unlcms.unl.edu/biotech/plant transformation ). Volatile C ollection Volatiles were collected from tomato fruits according to Tieman et al (2006 a ). One hundred grams of fruit was chopped and placed in a glass tube. Each tube was fitted with a rubber stopper. One end of the tube was attached to the volatile collection apparatus which allows for the regulation of air flow over the column. The other end was attached to a column containing SuperQ resin. A ir was passed over the samples and volatiles were collected on a SuperQ Resin for 1 h. Five L of nonyl acetate were added to each column as an internal control of column recovery. Volatiles were eluted off the column with methylene chloride and run on a GC/ MS and GC for analysis as described in Tieman et al (2006 a ).

PAGE 30

30 Gene Expression Analysis Tomato fruit was chopped and quickly frozen in liquid nitrogen. Samples were stored at 80 until further use. RNA was extracted using Plant RNeasy kit (Qiagen, http://www.qiagen.com ). Possible genomic DNA contamination was removed by on column DNaseI treatment for 15 min at room temperature. Quantitative PCR was Time PCR System using total amount of 325 ng total RNA, Taqman 1 step kit (Applied Biosystems, http://www.appliedbiosystems.com ), 500 nm forward and reverse primer. A total reaction volume of 25 l was used. A standard curve was generated usin g pENTR OMT1 ranging from 10 5 to 10 10 copies per 5 L. CTOMT1 Expression and Guaiacol Quantification through Flora Dade Ripening RNA was extracted and volatiles were collected from Flora Dade fruit at the following stages: immature green, mature, turning, and red ripe. RNA extraction and volatile collection were performed as above described. Catechol Feeding of Fruit Pericarp Disc Tomato discs were cut from pericarp tissue of ripe Flora Dade and CTOMT1 overexpressing fruit using a size 10 borer. One hundre d discs were used for each sample treatment. Discs were placed in P etri dishes and an X was cut in the top of each with a razor blade. 10 l of either water or 1 M catechol dissolved in water were pipetted into each disc. Covers were placed on petri dish es and discs were left to incubate for 4 h. Discs were then placed in glass tubes and volatiles were extracted as previously described. Guaiacol was quantified by GC/MS using a guaiacol standard curve.

PAGE 31

31 Table 2 1 Relative activity of CTOMT1 on substrates with similar structure to catechol. Substrate Structure SlCTOMT1 activity Catechol 100% Guaiacol 0% Salicylic acid 0% Benzoic acid 0% Oricinol 9% Caffeic acid 2% Protocatechuic aldehyde 17% Pyrogallol 4% 2,5 dimethyl 4 methox y 3(2H) furanone 0% Table 2 2 Catechol feeding of tomato discs. Guaiacol emitted (n mol disc 1 h 1 ) Control Catechol Flora Dade 0.04 0.01 0.36 0.04 OE1683 0.54 0.30 4.53 0.83 Data are means SE.

PAGE 32

32 Figure 2 1. Identification of potentia l S. lycopersicum CTOMTs. Potential tomato CTOMT candidates were identified by finding coding sequences with similar to known OMTs. Protein alignment and a Neighb or Joining tree were done using MEGA5 (Tamura et al ., 2011) The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches ANMT= a nthranilate N methyltransferase CAOMT= caffeic acid O methyltransferase; CTOMT= catechol O methyltransferase; CVOMT= c havicol O methyltransferase; EOMT= eugenol O methyltransferase ; IAOMT= i ndole 3 acetate O methyltransferase; JAMT= jasmonic acid carboxyl methyltransferase; MOMT= myricetin O methyltransferase; OROMT= orcinol O methyltransferase; ROMT= reserveratrol O methyltransfe rase; SAMT= salicylic acid carboxyl methyltransferase. Ab.SAMT is Atropa belladonna (BAB39396). At.IAOMT and At.JAMT are Arabidopsis thaliana (Q9FLN8; AAG23343). Ca.JAMT is Capsicum annuum (ABB02661). Fa.OMT is Fragaria x ananassa (AAF28353) Nt.CAOMT and Nt .CTOMT are Nicotiana tabacum (AAL91506; CAA50561). Ob.CAOMT, Ob.CVOMT and Ob.EOMT are Ocimum basilicum (Q9XGV9; Q93WU3; Q93WU2). Ph.SAMT is Petunia hybrida (AAO45013). Pt.CAOMT is Pinus taeda (AAC49708). Rh.OROMT is Rosa hybrida (AAM23004). Sf.SAMT is Ste phanotis floribunda (CAC33768). Sh.MOMT is Solanum habrochaites (ADZ76434). Rg.ANMT is Ruta graveolens (A9X7L0). SL.U575022, SL.U570080, SL.U321686, SL.U582403, and SL.U565623 are S. lycopersicum unigenes. Tt.CTOMT is Thalictrum tuberosum (AAD29844). Vv.RO MT is Vitis vinifera (CAQ76879). ZM.CTOMT is Zea mays (NP_001106047).

PAGE 33

33

PAGE 34

34 A B CTOMT1 K m (M) K cat (s 1 ) S. lycopersicum 8.36 1.78 9.67 2.42 Figure 2 2. Enzyme activity of CTOMT1. ( A ) The pre dicted pathway for the synthesis of guaiacol from catechol. This is the reaction that CTOMT1 is thought to catalyze. ( B ) The specific activity and turnover rate of CTOMT1. Values were determined using non linear regression. These values were similar to val ues found for previously characterized diphenol OMTs as listed on BRENDA (www.brenda enzymes.org/).

PAGE 35

35 Figure 2 3 Vectors for transgen e expression. The pHK DEST OE plasmid map was created using Seria lClo ner 2 1 and the pK2GW7 plasmid is based on sequence data from Karimi et al ., 2002. ccbD attR2 RB LB attR1 FMV promoter pHK DEST OE 9712 bp

PAGE 36

36 A B C D Figure 2 4 Gene expression and gu aiacol levels in transgenic plants. (A ) CTOMT1 mRNA levels for four lines overexpressing (OE) CTOMT1 (B ) Guaiacol emission for four OE CTOMT1 lines as a percentage of control (FD) (C ) Suppression of endogenous mRNA levels f or four antisense (AS) lines. (D ) Guaiacol emission for four AS CTOMT1 lines as a percentage of control (FD) Total mRNA and volatiles were extracted from ripe fruit. Error bars represent standard error of the mean differences ( P <0.05). Sta tistical groups are indicated by use of different letters adjacent to bars.

PAGE 37

37 A B Figure 2 5 CTOMT1 expression and guaiacol production through fruit development. (A) CTOMT1 RNA was measured in immat ure green (IM), mature green (MG), turning (TU), an d ripe (F) Flora D ade fruit. (B) Fruit guaiacol levels. Error bars represent standard error of the mean significant differences (P <0.05). Statistical groups are indicate d by letters

PAGE 38

38 Figure 2 6 Guaiacol spectrum of catechol fed disc. This spectrum shows the guaiacol peak as measured by GC MS. As shown, the CTOMT1 overexpressing disc ) when just fed water. However, whe n supplied with non limiting catechol, CTOMT1 overexpressing disc ( ) produce much more guaiacol than catechol fed WT disc ( ). OMT + Catechol WT + Catechol OMT WT

PAGE 39

39 CHAPTER 3 QUANTITATIVE TRAIT L OCUS ASSOCIATED WITH INCR EASED G UAIACOL Overview Looking for Genetic V ariation There are now 13 recognized species of cultivated tomato S. lycopersicum and its wild relative s Formerly, these species were under the segregated genus Lycopersic on but now have been group ed into the genus Solanum along with potato and eggplant (Peralta et al ., 2006) Much diversity exists between and within species. Although there is much phenotypic variation within S. lycopersicum accessions it i s low in genetic diversity as compared to its wild relatives as measured by allozymes and restriction fragment length po lymorphism s (RFLPs) (Miller and Tanksley, 1990 ; Rick and Yoder, 1988 ) One explanation for this lower diversity is the breeding system that S. lycopersicum utilizes Tomato and its wild relatives can be separated into two types of breeding systems, those that are self incompatible and those that are self compatible. Self incompatible species show more variation that all self compatible species (Miller and Tanksle y, 1990; Rick and Yoder, 1988). The primary cause of the lack of genetic variation among S. lyc opersicum accession s is domestication. The modern tomato has gone through three major genetic bottlenecks: early domestication by the native peoples of Central America, transport of a limited germplasm to Europe, and intensive breeding during the developme nt of tomato as a commercial crop after World War II (Bai and Lindhout, 2007; Klee, 2010)

PAGE 40

40 Enhancing D iversity Good QTL mapping requires high variation and marker coverage (Rick and Yoder, 1988). O utcrossing tomato wit h its wild relatives integrates novel quantitative variation which can enhance the discovery of QTLs (Eshed and Zamir, 1994). The green fruited S pennellii is a good choice as the wild parent in such a cross because it produces fruit after controlled self pollination, the offspring of S. lyc ope rsicum S. pennellii are fertile, and there is a wealth of allozymic differences between the two species (Rick, 1960; Rick and Yoder, 1988). An previously described introgression population of 75 S. lycopersicum lines, each containing a single homozyg ous S. pennellii chromosomal segment in an otherwise S. lycopersicum genome was crea ted by initially crossing S. lycopersicum cv. M82 as t he female parent with S. pennellii as the male parent The F1 hybrid of this cross was then backcrossed to the M82 pa rent and repeatedly selfed Altogether the lines provide complete representation of the wild species genome and are nearly isogenic to M82 (Eshed and Zamir, 1994; Eshed and Zamir, 1995) Identifying Quantitative Trait Loci An initial analysis of the introg ression population revealed 23 QTLs for total soluble solids and 18 QTLs for fruit size (Eshed and Zamir, 1995) This same population was later used to identify QTL s affecting fruit flavor volatile emission. After collecting data from i ntrogression lines (ILs) grown in multiple locations over five different seasons 25 different loci were identified affecting at least one of 23 different volatiles. Additionally, the ILs have been used in numerous other ways, such as metabolic profiling and identification o f loci affecting salinity stress, demonstrating their value as a tool in the discovery of gene trait associations (Frary et al ., 2011; Schauer et al ., 2006).

PAGE 41

41 Results Finding a G uaiacol QTL In analysis of ILs by Tieman et al. (2006a) increased guaiacol lev els were reported in IL10 1 Further analysis of the complete data set indicated the presence of a guaiacol QTL on the overlapping IL 10 1 1 (fdr = 0.000220175) near the top of chromosome 10. Using the S. lycopersicum genome sequence database ( http://solgenomics.net/ ), a cleaved amplified polymorphic sequence (CAPS) ma rker was devel oped (details in Materials and M ethods) to map the position of CTOMT1 (Figure 3 1 ). The gene was located within the S. pennellii segment o f IL 10 1 but not 10 1 1. IL 10 1 contains approximately 60 million base pairs of S. pennellii DNA. IL 10 1 1 is a much smaller segment contained within IL10 1 and adjacent to the position of CTOMT1 To further elaborate the nature of the QTL, guaiacol was collected from ripe IL10 1, IL1 0 1 1, and M82 fruits (Figure 3 2A ). Both IL 10 1 and IL 10 1 1 had elevated guaiacol production relative to M82. However, IL 10 1 1 produced significantly more guaiacol than IL 10 1. Both ILs also produced significantly mor e methylsalicylate as well (Figure 3 3 ). Comparing Activity of CTOMT1 Orthologs from S. lycopersicum and S. pennellii In order to determine the underlying cause for the increased guaiacol production in these ILs, the orthologous S. pennellii CTOMT1 was clo ned and sequenced. Differences in the promoter and the coding sequences were found ( Appendix A). Some changes in the coding sequence resulted in amino acid differences ( Figure 3 3 ). However, when the specific activity of recombinant S. pennellii CTOMT1 was tested there was no significant difference the specific activity between the S. pennellii and the M82 enzymes ( Table 3 1 ).

PAGE 42

42 Gene Expression Analysis CTOMT1 mRNA levels were also measured from ripe IL10 1, IL10 1 1, and M82 fruits (Figure 3 2B ). RNA expres sion analysis indicated that CTOMT1 RNA levels were significantly increased in both ILs. Analysis of these lines seems to indicate that increased guaiacol is associated with increase d CTOMT1 expression. Catechol and Salicylic Acid Quantification In order better understand how the catechol synthesis pathway is affected in ILs 10 1 and 10 1 1, catechol and salicylic acid were quantified from ripe fruit. Catechol and salicylic acid were extracted from ground tissue and then derivatized and quantified using GC MS (Figure 3 5 ) A trend of lower catechol was found in the ILs. This same trend was also seen for salicylic acid concentrations. Discussion Through screening of an introgression population we were able to identify a QTL associated with higher guaiacol p roduction near the top of chromosome 10. CTOMT1 was mapped to the region covered by IL 10 1, with high er guaiacol and high er CTOMT1 expression than M82 However, another IL, 10 1 1, adjacent to but not including the CTOMT1 gene, also synthesized significan tly more guaiacol and had higher CTOMT1 expression. Although in these lines increased guaiacol production seems associated with increased expression of CTOMT1, we know that this is not always the case, as exemplified in CTOMT1 overexpressing transgenics. S omething other than just increased gene expression is contributing to increased guaiacol levels. T here must be a genetic element within the S. pennellii derived 10 1 1 segment that directs higher guaiacol production. Recently, it has been shown that many t omato QTLs are in trans to structural genes encoding enzymes that contribute to the phenotype Steinhause r et al

PAGE 43

43 (2011) found that 17 out of 27 robust QTLs that they mapped were located trans to the structural gene that encodes the corresponding enzyme ac tivity The most probabl e explanation for the increase of guaiacol in IL10 1 and IL 10 1 1 is the existence of a trans acting regulatory element contained in IL 10 1 1 T he over expression of a single transcription factor can increase the production of a w hole pathway of enzymes and metabolites (Dal C in et al ., 201 1 ) Perhaps a transcription factor that upregulates the guaiacol synthesis pathway is located on IL 10 1 1 Preliminary results indicate that both methylsalicylate and eugenol are also increased i n these ILs while catechol and salicylic acid levels decrease The precursor for methylsalicylate is salicylic acid (Tieman et al ., 2010). Salicylic acid has also been proposed as the precursor for catechol in G. adenothrix ( Ellis and Towers, 1969). Salic ylic acid and eugenol have cinnamic acid as a common precursor (Koeduka et al ., 2006; Mtraux 2002). If this entire pathway is upregulated we would expect to see increased gene expression of other genes in the pathway and increased metabolite levels. This hypothesis could be tested using global expression analysis of the ILs compared to M82 and more in depth metabolite analysis Another possible cause for the observed phenotype s of IL10 1 and IL10 1 1 is that an enzyme that converts salicyli c acid to catech ol is located in 10 1 1. As previously discussed catechol availability limits guaiacol production. If there is an enzyme on IL10 1 1 that increases the production of catechol, then CTOMT1 expression may also be stimulated. As catechol is toxic to plants, it is expected that its concentration would be tightly regulated; catechol may act as regulator of CTOMT1 expression in order to keep its levels low BLAST analysis of the 10 1 1 segment against known enzymes that

PAGE 44

44 produce catechol did not reveal any potent ial candidates; however, this analysis was not exhaustive A third possibility is that a chromosomal rearrangement has occurred. Chromosomal rearrangements can cause suppression of recombination (Verlaan et al ., 2011). This in combination with low marker c overage can result in discrepancies between genetic and physical maps ( Liharska et al ., 1996). Fluorescence in situ Hybridization (FISH) is a useful technique for discovering chromosomal rearrangements and correctly mapping introgressed genes from wild spe cies (Verlaan et al ., 2011). Also, chromosome architecture and loci interactions are not well understood. It is know that transcription enhancers can be locate d some distance away from the core promoter. DNA looping facilitates the interaction of the enhan cer with the promoter (Kagey et al ., 2010). Perhaps there is such an element located in 10 1 1 that is interacting with the promoter of CTOMT1 It is also possible that there are two guaiacol QTLs represented by these ILs. However, this is not very likely as CTOMT1 does not seem to be a QTL This conclusion is supported by the result that overexpression of the gene alone is not sufficient to increase guaiacol production. To fully rule out CTOMT1 as a QTL by itself, we would need a recombinant that only incl uded the region above 10 1 1. This is very difficult to achieve as CTOMT1 is near the end of the chromosome. It is possible that there could be a CTOMT1 allele that acts as a QTL for decreased guaiacol. Further analysis of heirloom varieties and wild speci es could help identify allozymes with decreased catechol methylation activity.

PAGE 45

45 Our understanding of chromosome structure and gene regulation only scratches the surface of the depth of complexity that exist s This lack of knowledge makes sorting out complex traits difficult. Hopefully, as technologies and techniques develop we will be able to unravel more of these regulatory networks. Materials and Methods Mapping and Volatile Analysis of CTOMT1 A guaiacol QTL on the overlapping ILs 10 1 and 10 1 1 was iden tified as previously described (Tieman et al ., 2006 a ). Guaiacol contents for each of five seasons as well as summary values for the combined seasons are available at http://ted.bti.cornell.edu/cgi bin/TFGD/metabolite/metabolite_info.cgi?ID=M0000025. To det ermine the map position of CTOMT1, a marker that distinguishes between the S. lycopersicum and S. pennellii alleles was developed. The following primers were u sed: F ATTAATGCTTTCCTGTCGAACC and R ACCTCCAACATCAACCAAAGTT. The product size was 3.7 kb. Amplif ication products were digested with DdeI (New England Biolabs, www.neb.com ). Genomic sequence alignments of S. lycopersicum and S. pennellii were done with ClustalW using genomic sequence data provided by A.R. Fernie (per sonal communication). Protein purification and enzyme activity assays were performed as described in Chapter 2. Volatiles were collected and RNA was quantified from ripe M82, IL10 1, and IL10 1 1 fruit as described in C hapter 2 Catechol and Salicylic Aci d Quantification Catechol was extracted from ripe M82, IL10 1 and IL10 1 1 fruits (n 3) After grinding tissue in liquid nitrogen, 3 g were measured and catechol was extracted with 3 ml of acetonitrile. As an internal control, 500 ng of 4 nitrophenol w ere added to each sample. Samples were vortexed and centrifuge d for 1 0 min at 25 000 g. The

PAGE 46

46 s upernatant was placed in a glass vial and dried under nitrogen gas. A standard curve was also made using catechol, salicylic acid, and 4 nitrophenol using each sta ndard at the following quantities: 0, 10 ng, 50 ng, 100 ng, 500 ng, 1000 ng, 5000 ng, 10000 ng. Samples were resuspended in 200 l of an hydrous acetonitrile. For deriva tization, 100 l of the resuspended sample was place d in a new vial with 100 l of N met hyl N trimethylsilyltrifluoroacetamide (MSTFA) with 1% trimethylchlorosilane (TMCS) (Thermo Scientific www.thermoscientific.com ). Reaction vials were place d c for 1 h. Samples were then analyzed using GC MS on a Agilent 5975 GC/MSD ( www.chem.agilent.com ) (He carrier gas; 0.7 ml min 1 c injection volume 2 l) with a Agilent DB 5ms column ((5% Phe nyl) methylpolysiloxane; 30 m long, 250 m i.d., 1 m film thickness) T he temperature c (4 c min 1 c Source and c and c respectively. Ions selected for detection were as f ollows: catechol 136,166,239 (Figure 3 6) ; salicylic acid 135, 193, 267; 4 nitrophenol 150, 196, 211. Compounds were identified by retention times with standards and specific ions.

PAGE 47

47 Table 3 1 Comparison of e nzyme activity between CTOMT1 orthologs from S. lycopersicum and S. pennellii CTOMT1 K m (M) K cat (s 1 ) S. lycopersicum 8.36 1.78 9.67 2.42 S. pennellii 13.14 3.93 10.87 4.39 Data are means SE.

PAGE 48

48 A B Figure 3 1. Chromosome 10 map wit h positions of ILs 10 1 and 10 1 1. (A) Genetic markers are shown above the black line. Positions of S. pennellii segments in ILs 10 1 and 10 1 1 were originally determined by Eshed and Zamir (1995). Fine mapping of CTOMT1 was done by developing a new mark er for the gene. The S pennellii allele of CTOMT1 was present on 10 1, but not 10 1 1. Phys ical distances were determined using chromosomal sequence data from sol genomic network ( www.solgenomics.net ). (B) An ex pansion of the region encompassing 10 1 1 is shown. Marker sequences are available on the sol genomic network. See Materials and Methods for the sequence of CTOMT1 marker primers

PAGE 49

49 A B Figure 3 2. CTOMT1 expression and guaiacol emission from ILs. ( A ) Increased guaiacol in fr uit from ILs 10 1 and 10 1 1. (B ) Increased mRNA levels of CTOMT1 in ILs 10 1 and 10 1 1. Error bars represent standard error of the mean HSD was used to determine si gnificant differences ( P <0.05). Statistical groups are indicated by letters. a b c b b a

PAGE 50

5 0 Figure 3 3 Methyl salicylate levels in M82 and ILs 10 1 and 10 1 1 Increased methyl salicylate levels in fruit from ILs 10 1 and 10 1 1. Error bars represent standard error of the mean P <0.05). Statistical groups are indicated by letters.

PAGE 51

51 Figure 3 4 Amino acid alignment of S. lycopersicum and S. pennellii CTOMT1. Amino acid sequences wer e determined by translating the coding region of CTOMT1 An asterisk (*) indicates a fully conserved residue. A colon (:) indicates conservation between groups of strongly similar properties. A period (.) indicates conservation between groups of weakly sim ilar properties. Protein alignment was performed with ClustalW.

PAGE 52

52 Figure 3 5 Catechol and salicylic acid quantification. Catechol ( ) and salicylic acid ( ) were quantified from fruit ILs 10 1 and 10 1 1 and M82. Error bars represent standard error of the mean

PAGE 53

53 A B Figure 3 6. Spectra of silylated catechol. ( A) Peak of silylated catechol 500 ng standard. (B) Mass spectrum o f derivatized catechol. Ions 239, 166, and 136 were used to identify catechol in tomato fruit samples.

PAGE 54

54 CHAPTER 4 GLYCOSYLATION OF FLA VOR MOLECULES Overview Small Molecule Glycosides Many classes of plant secondary metabolites are glycosylated. These class es include hormones, betalains, phenylpropanoids, terpenoids, steroids, flavonoids, coumarins, glucosinates, cyanogenic glucosides, and cyclic hydroxamic acids ( Bowles et al ., 2006 ). Glycosylation increases solubility and stability and decreases chemical r eactivity. For some molecules, such as p aminobenzoate, glycosylation promotes membrane transport and storage in the vacuole (Brazier Hicks et al ., 2007; Eudes et al ., 2008; Lim et al ., 2002; Lim et al ., 2004 ; Paquette et al ., 2003). For other molecules, l ike saponins and quercetin, glycosylation is necessary for bioactivity (Cartwright et al ., 2008; Osbourn et al ., 2003). Family 1 G lycosyltransferases Glycosyltransferases are ubiquitous across all kingdoms of life (Campbell et al ., 1997). Small lipophilic molecules are glycosylated by the Family 1 glycosyltransferases. Most glycosyltransferases in this family require UDP activated sugars and are, therefore, called UDP dependent glycosyltransferases (UGTs) (Osmani et al ., 2009). Four plant UGTs have been c rystallized. Although the primary sequence may be quite variable, the secondary structure is quite conserved (Shao et al 2005). The secondary structure consists of two Rossmann fold domains connected by an interdomain linker. The two domains form a deep, narrow pocket for substrate binding that is made accessible via movement of the flexible linker ( Bowles et al ., 2005; Osmani et al ., 2009).

PAGE 55

55 The C terminal domain contains a highly conserved region called the Plant Seconda ry Product Glycosyltransferase m ot if (PSPG) (Figure 4 1 ) (Jones and Vogt, 2001; Lim and Bowles, 2004; Paquette et al ., 2003; Vogt and Jones, 2000 ). This motif is important for recognition and binding of the UDP sugar. UDP glucose is the most commonly utilized sugar; however UDP galactose, UDP xylose, UDP mannose and UDP glucuronic acid are preferred by some UGTs (Kohara et al ., 2007; Masada et al ., 2007; Weis et al ., 2008) The UGT N terminal domains are much more variable than the C terminal domains. The N terminal domain is believed to b e important for interaction with the acceptor molecule (Shao et al ., 2005). N terminal amino acid sequence homology is not an indicator of substrate preference. A pair of UGTs with 20% homology in this domain may have activity on the same substrate while a nother pair with 80% homology may recognize different substrates (Osmani et al ., 2009). Studies of the phylogeny and activit ies of Arabidopsis UGTs have provided important information about UGT structure and function. 120 UGTs have been identified in the Arabidopsis genome (Paquette et al ., 2003). These enzymes have been placed into 14 phylogenetic groups (Li et al ., 2001; Ross et al ., 2001; Osmani et al ., 2009). Enzymes within a group tend to show activity on the same types of substrates (Lim et al ., 2003 ). Aromatic Small Molecule Glycosides Many of the small molecules important to tomato flavor are glycosylated (Tab le 4 1 ) (Birti et al ., 2009; Buttery et al ., 1990; Marlatt et al ., 1992; Ortiz Serrano and Gil, 2007). Glycosylation of these molecules prev ents their volatilization and, therefore, contribution to tomato flavor. One of the largest pools of glycosidically bound tomato

PAGE 56

56 volatiles has been observed for the flavor molecule 2 phenylethanol (Birti et al ., 2009; Buttery et al ., 1990; Marlatt et al ., 1992 ). IL8 2 1 from the Solanum lycopersicum X Solan um pennellii introgression population has been characterized as a very high 2 phenylethanol producing line ( T admor et al ., 2002; Tieman et al ., 2006 b ). This line also produces elevated levels of a 2 phen ylethanol glycoside (Tieman, unpublished). It can be estimated that roughly two thirds of the total 2 phenylethanol pool is contained in the glycosylated form. 2 P henylethanol G lycosylation Much of what is know n about the structure and accumulation of 2 p henylethanol glycoside comes from studies on roses. These studies indicate d that 2 phenylethanol is bound to either a mono or disaccharide composed of hexose, hexose hexose, or hexose pentose sugars ( Watanabe et al ., 2001). The concentration of 2 phenylet hanol glycoside increased and decreased in a diurnal pattern antithetical to the concentration of free 2 phenylethanol, suggesting that the glycoside serves as a storage molecule for timed release of the aglycon e (Hayashi et al ., 2004; Picone et al ., 2004) This pattern is not what has been observed in fruits. Concentrations of glycosides were observed to increase with fruit ripening (Birti et al ., 2009; Groyne et al ., 1999). Enzymatic r elease of aromatic aglycon e s from the s e glycosides has been demonstrat ed to be important in increasing the flavor of wine (Cabrita et al ., 2006; Ugliano and Molo, 2008). Results Isolation and Characterization of 2 Phenylethanol Glycoside I n order to develop a protocol for the isolation and characterization of 2 phenylethanol glycosides Petunia hybrida flowers were chosen for glycoside analysis Petunia was selected because it is also a member of the

PAGE 57

57 Solanacea e family and a prolific producer of 2 phenylethanol. A crude extract was made from 400 flowers and fractionated using flash chromatography. Further purification was done using LC MS. Fractions with m ass spectra that indicate d the presence of both di and tri saccharides bound to 2 phenylethanol were collected The fraction with the highest purity was pr edicted to contain a 2 p henylethanol tri saccharide This fraction was dried and sent to the Complex Carbohydrate Research Center (CCRC) at the University of Georgia ( www.ccrc. uga.edu ) for further analysis. Reports from CCRC indicated the purified glycoside contains primarily terminal and 1 2 linked glucose (Figure 4 2 ). To determine the 2 phenylethanol glycoside structure from tomato, a crude extraction was made from ripe fr uit of IL8 2 1 and it s M82 parent These extract s were sent f or analysis to Dr. Alisdair Fernie at the Max Planck Institute for Molecular Plant Physiology. LC MS data showed a peak with MW 387 that was highly abundant in IL8 2 1, but absent in M82 (Figure 4 3 ) One possible structure assignment for this product is 2 phenylethyl O malonyl D glucopyranoside. This compound has been sent to the RIKEN Institute for NMR structural confi rmation. Selection of Tomato UGT Candidates and Cloning Known Arabidopsis family 1 UGT s were used to search the sol genomic network Lycopersicon combined (tomato) unigene database for UGT sequences (Figure 4 4) Over 100 probable family 1 UGTs were found. In order to narrow the list of candidates, only unigenes with a high numb er of fruit ESTs were chosen. Six candidates were selected: SGN U578221, SGN U578227, SGN U565076, SGN U584032, SGN U576693, and SGN U 571691 (Table 4 2) Full length cDNAs were synthesized from S. lycopersicum cv. M82 ripe fruit RNA. Candidate genes were c loned vectors for

PAGE 58

58 expression in E. coli Although bacteria were grown in minimal media at low temperatures the protein was completely insoluble. Attempts to increase expression levels and solubility were made by adding plasmids coding for rare codon tRNAs and protein chaperone s to expression bacteria However, results were not improved. The next strategy for characterizing candidate UGTs was to use transient expression in Nicotiana benthamiana For transient expression, candidate genes were cloned in to the binary vecto r pHK1001 and transformed into Agrobacterium tumefaciens The Agrobacterium containing various pHK1001 constructs were infiltrated into N.benthamiana leaves along with p19, a silencing suppressor, and PAAS, a phenylacetaldehyde synthase from Petunia hybrid a ( Ka mi n aga et al ., 2006; Voinnet et al ., 2003) After 5 days, the leaves were chopped an d volatiles were collected. Expression of p19 with PAAS produce leaves with high levels of 2 phe nylethanol. Only one of the UGT candidates, SGN U578227 was observed to lower 2 phenylethanol when expressed toge ther with p19 and PAAS (Figure 4 5). Transgenic Expression of UGT Candidates in Tomato Candidate gene pHK1001 overexpression (pHK OE ) construct s were also transformed into tomato. SGN U578227 was al so cloned in anitsense orientation (pHK AS ) for RNA suppression As we were interested in identifying a UGT that glycosylated 2 phenylethanol, Agrobacterium was used to transform IL8 2 1 cotyledons for transgene expression. The numbers of independent transg enic lines for each construct were as follows: 6 pHK OE 578221, 60 pHK OE 565076, 7 pHK OE 584032, 14 pHK OE 576693, 2 pHK OE 571691, 68 pHK OE 578227, and 6 pHK AS 578227 Due to time and resource s constraints only 26 of the pHK OE 578227 and 28 of the pHK OE 56 5076 were tested for transgene expression using leaf tissue. Volatiles were measured for ripe

PAGE 59

59 fruit of 24 of the pHK OE 578227 plants and all the plants of the other constructs except pHK OE 565076. None of the candidate genes impacted volatiles in the 2 phe nylethanol pathway, including phenylacetaldehyde and 1 nitro phenylethane, or other observed volatiles During the production of these transgenic plants, SGN U565076 was found to be upregulated by the overexpression of the transcription factor ORDORANT1 (O DO1) (Dal Cin et al ., 2011) ODORANT1 is a MYB transcription factor from Petunia hybrid important for the regulation of volatile benz en oid synthesis (Verdonk et al ., 2005). ODORANT1 was also overexpressed in tomato plants to gain understanding of the pheny lalanine metabolic pathway. Although no changes in volatile emissions were detected in the tomato plants, there were significant increases in phenylpropanoid glucosides. Because SGN U565076 (formerly SGN U217248 ) was the only glucosyltransferase found to b e upregulated, it was proposed as the likely candidate for phenylpropanoid glucosylation (Dal cin et al ., 2011). For this reason, ripe fruit s from 11 of the best SNG U565076 over e xpressing plants w ere collected, lyophy lized, and sent to for analysis to Dr. Alisdair Fernie at the Max Planck Institute for Molecular Plant Physiology for metabolite analysis. Discussion Analysis of glycosides from both petu nia and tomato showed that the 2 phenylethanol glycosides are decorated with multiple sugars. This is simil ar to what has been observed in other studies on flower and tomato glycosides, although the precise structure of tomato glycosides remains unknown (Tikunov et al ., 2010; Watanabe et al ., 2001). Based upon the product of MW 387 found in the IL8 2 1 enriched peaks, one possible glycoside present is 2 phenylethyl O malonyl D glucopyranoside O

PAGE 60

60 malonyl D glucopyranosides have been shown to be conjugated with flavor molecules in raspberry, strawberry, guava, and papaya (Withopf et al ., 1997 ). The high number of UGT unigenes found in the tomato database is not surprising as 120 UGTs have been identified in the Arabidopsis genome (Paquette et al ., 2003). This is part of the challenge of working with UGTs; they are numerous and redundant. Each enzyme is b elieved to recognize multiple substrates and multiple enzymes recognize a single substrate. Another challenge of working with UGTs is that when recombinant proteins are produced, they are often in the insoluble fraction s and sometimes only slightly presen t in the soluble fraction (Personal communication, Eng of these proteins in yeast versus E. coli often does not improve yield (Personal communication, Wilfred Schwab). Development of an in planta expression system for screening an d characterization of UGTs may be a way to overcome this challenge. Attempts to solubilize protein using urea could also be made, but this can be problematic as it usually result in improper protein refolding. One attempt to develop an in planta screen for a 2 phenylethanol UGT was done by expressing candidate UGTs with PAAS from Petunia hybrid a This bifunctional enzyme catalyzes the decarboxylation and oxidation of phenylalanine to form phenylacetaldehyde (Kaminaga et al ., 2006). Enzymes that reduce ph enylacetaldehyde to 2 phenylethanol appear to be present in other members of the Solancea e family, petunia and tomato (Tieman et al ., 200 7 ). Fortunately, there was also an endogenous enzyme in N. benthamiana that performed this last step, allowing us to re construct the 2 phenylethanol pathway in a plant that is easily transformable by only adding PAAS

PAGE 61

61 Using this approach, a candidate UGT SGN U578227 that decreased 2 phenylethanol pools was identified. However, when SGN U578227 was overexpressed or suppres sed down in tomato fruit, no changes in volatiles that are part of the 2 phenylethanol synthetic pathway were observed. The overexpression of the other candidate UGTs was also not effective in changing emitted volatile levels. Altering the endogenous expre ssion of a single UGT may no t be able to affect 2 pheny l ethanol emission from fruit if the activity of another UGT compensates for the gain or loss of activity. This scenario is highly probable as UGTs are known to be nonspecific and redundant. It is also possible that none of these UGTs gly cosylate 2 phe nylethanol in tomato. However, d ue to the high level of expression of these genes in tomato fruit it is likely that they have an important role there. Many other metabolites in the phenylpropanoid pathway are kn own to be glycosylated, such as flavonoids, anthocyanins, and lignin. Further analysis of these metabolites is needed in order to assess if there are any effects of increasing the expression of these UGTs. Materials and Methods Gly coside E xtraction f rom Petunia hybrida F lowers Petunia g lycosides were extracted from 400 flowers with ethyl acetate according to the methods of Oka et al. (1999). Extracts were dried under N 2 gas and resuspended in methanol. Soluble material was transferred to a new vial an d dried under N 2 gas. Resulting residue was resuspended in 30% m ethanol and soluble material was dried. Residue was resuspended in 30% m ethanol and separated by flash chromatography on a C18 column. Resulting fractions with detectable UV absorption at 280 nm were analyzed for the presence of 2 phenylethanol glycoside by hydrolysis of the glycoside

PAGE 62

62 and measurement of free 2 phenylethanol by GC MS (see below). Fractions containing 2 phenylethanol were further purified by LC MS. Mass spectra seemed to indicate the presence of both di and trisaccharides bound to 2 phenylethanol. Peaks with the highest purity of the hypothesized 2 p henylethanol trisaccharide were collected and dried. The r esulting powder (approximately 500 ng) was sent to the Complex Carbohydrat e Research Center (CCRC) at the University of Georgia for further analysis. Glycoside Extraction from Tomato Fruits Tomato glycosides were extracted from 1 kg of ripe M82 and IL8 2 1 fruits by pureeing fruit in a blender and then centrifuging the puree at 9000 g for 10 min. The supernant was run over a S ep Pak C18 column (Waters, www.waters.com ) and eluted with methanol. The elutant was dried, lyophilized, and shipped to the Max Planck Institute in Golm Germany. Crude extracts were further purified by LC MS. Phylogenetic Tree of U GT s S. lycopersicum UGT candidates were identified by a TBLASTN search of the sol genomic network Lycopersicon combined (tomato) unigene database using previously characterized Arabidopsis UGT sequences ( www.p450.kvl.dk ) The evolutionary history was inferred using the Neighbor Joining method (Saitou and Nei, 1987). The bootstrap test (1000 replicates) was used to calculate the percentage of replicate tree s in which the associated taxa clustered together (Felsenstein, 1985). The evolutionary distances were computed using the Poisson correction method (Zuckerkandl and Pauling, 1965). The analysis involved 42 amino acid sequences. All positions containing gap s and missing data were eliminated. There were a total of 285 positions in the final dataset. Evolutionary analyses were conducted in MEGA5 (Tamura et al ., 2011).

PAGE 63

63 Cloning and Protein Expression in E. coli UGT candidate genes, SGN U578221, SGN U578227, SG N U565076, SGN U584032, SGN U576693, and SGN U571691, w ere PCR amplified from S. lycopersicum fruit cDNA. The products were cloned into pENTR/D/TOPO vectors and sequenced ( CHUL Research Center, http://w ww.sequences.crchul.ulaval.ca ) The coding regions were then cloned into vector s p DEST15 and pDEST17 by recombination and transformed into E. coli BL21 DE3 (Invitrogen, http://www.invitrogen.com ) or pLysS Competent Cells (EMD, http://www.emdchemicals.com ) for inducible protein expression. Bacteria were precultured for 16 h at 37C in Luria Bertani broth containing 50 g/mL carbenicillin and the culture was used to inoculate 1L of M9 minimal medi um. Cells were grown at 24C to an OD 600 of 0.5. Protein expression was induced by adding isopropyl 1 D thiogalactoside to the medium at a final concentration of 0.1 mM. Induced cultures continued g rowing at 20 C fo r 16 h. See chapter 3 for protein 6Xhis tag protein purification steps. For GST tag protein purification, c ells were centrifugation (10 min, 4 420 g) and resuspended in PBS and Bacteri al Protease Inhibitor Cocktail ( Sigm a, http:// www.sigmaaldrich.com ) Cells were lysed with sonication Proteins were purified from cell lysates using gravity flow with Glutathione Superflow Resin (Clontech http:// www.clontech.com ) according to the manufacturer's instructions. Transient Expression in N.benthamiana Bacteria carrying pHK1001 constructs ( see C hapter 2 ), p19 (Voinnet et al ., 2003), and PAAS (Kaminaga et al ., 2006) were precultured for 2 days at 28 C in Luria Bertani broth contai ning 50 g/mL spectinomycin and the culture s w ere used to inoculate 100 mL of the same medium. Cells were grown at overnight at 28 C Cultures were pelleted

PAGE 64

64 by centrifugation (10 min, 6 000 g) The pellet was resuspended in 200 mL MES buffer [10 mM MgCl 2 ; 10 mM MES pH 5.8] Three mL syringes were used to infiltrate the leaves. Three different treatments were used: p19 alone, p19 with PAAS, and p19 with PAAS and pHK1001 constructs. Five leaves of five plants were used per treatment. After 5 days, leaves w ere finely chopped. Six grams of sample was placed in a glass tube Volatile collection procedure was as described in chapter 3, except that volatiles were collected from 2 h. Transgenic Expression in Tomato The full length open reading frame of the UGT ca ndidate genes were cloned into a vector, pHK1001, containing the constitutive FMV 35S promoter (Richins et al ., 1987) followed by the nos 3 terminator, in both the sense and antisense directions S. lycopersicum IL8 2 1 cotyledons were transformed by Agro bacterium mediated transformation (McCormick et al ., 1986) with the kanamycin selectable marker, NPTII. RNA Extraction and Volatiles Collection RNA was extracted from leaf tissue as described in Chapter 2. RNA was quantified using Power SYBR Green RNA to 1 Step Kit (Invitrogen, www.invitrogen.com ) A total reaction volume of 20 L and 100 ng of RNA was used per reaction. Time PCR System Volatiles were colle cted as described in Chapter 2.

PAGE 65

65 Table 4 1. Comparison of free and bound volatiles from ripe cv. Moneymaker tomatoes Volatile Free compound ( g/L) Glycoside ( g/L) Hexanal 1827.0 402.9 3 Methylbutanol 623.6 7240.0 trans 2 Hexenal 122.4 192.8 cis 3 Hexe nol 3121.0 23.4 2 Isobutylthiazole 12.0 Tr Methyl salicylate 1.3 2.5 Guaiacol 3240.0 18.6 2 Phenylethanol 67.0 539.8 Ionone 2.0 Tr Adapted from Ortiz Serrano and Gil, 2007 Table 4 2 EST counts for UGT candidate unigenes Unigene Total ESTs ESTs f rom fruit Nonspecified SGN U578221 135 55 22 SGN U578227 93 83 2 SGN U565076 21 12 7 SGN U584032 77 64 9 SGN U576693 30 24 2 SGN U571691 7 1 4 EST numbers from http://solgenomics.net/

PAGE 66

66 AmUGT73E2 K D R G LLI NG WAP Q VLIL SH P S V GG FV THCG W NS ML E G V TSG LPMI T WPVF 389 AtUGT73C3 R D R G LIV HG WAP Q VLIL SH P T I GG FL THCG W NST I E S I T A G VPMI T WPFF 395 SrUGT73E1 K E R G LLI K G WAP Q VLIL SH P S V GG FL THCG W NST L E G I TSG IPLI T WPLF 396 AtUGT73C6 Q D R G LLI K G W S P Q MLIL SH P S V GG FL THCG W NST L E G I T A G LPML T WPLF 39 5 LbUGT K G R G FLI K G W S P Q ILVL SH P S V G AFL THCG W NST L E GCCSG LPVI TC PLF 390 NtSAUGT K E K G LII R G WAP Q VLIL D H E S V G AFV THCG W NST L E G V SGG VPMV T WPVF 382 SlTwi1 K E K G LII R G WAP QS VIL D H E AI G AFV THCG W NST L E G I S A G VPMV T WPVF 376 : :*:::.**:** ::*.* ::*.*:******* :*. .*:*::* *.* AmUGT73E2 A E Q F CN E K FIV H VI K TG I R V G V E VPIIF G DEE K V G VLV K N DE I K MVI D K L 439 AtUGT73C3 A D Q FL N E AFIV E VL K I G V R I G V E R A C LF G EED K V G VLV KK ED V KK AV E C L 445 SrUGT73E1 G D Q F CNQ K LVV Q VL K A G V S A G V EE VM K W G EED K I G VLV D K E G V KK AV EE L 446 AtUGT73C6 A D Q F CN E K LVV Q IL K V G V S A E V K E VM K W G EEE K I G VLV D K E G V KK AV EE L 445 LbUGT A E Q FI N E K LI TQ VL GTG V S V G V K AAV T W G M EE K SG IVM KR ED V K N AI E K I 440 NtSAUGT A E Q FF N E K LV T E VL K TG A G V GS I Q W KR S A S E G ----V KR E AIA K AI KR V 427 SlTwi1 A E Q FF N E K LV T E VM R SG A G V GS K Q W KR T A S E G ----V KR E AIA K AI KR V 421 .:** *: ::..:: :..: : .:. : Figure 4 1. Amino acid alignment of PSPG region. Amino acid sequences from UGTs were aligned using ClustalW. The highlighted region shows the 44 amino acids of the PSPG region. An asterisk (*) ind icates a fully conserved residue. A colon (:) indicates conservation between groups of strongly similar properties. A period (.) indicates conservation between groups of weakly similar properties. AmUGT73E1 is Antirrhinum majus ( BAG16513 ). AtUGT73C3 is Ar abidopsis thaliana ( NP_181216 ). SrUGT73E1 is Stevia rebaudiana ( AAR06917 ). AtUGT73C6 is Arabidopsis thaliana ( NP_181217 ). LbUGT is Lycium barbarum ( BAG80555 ).NtSAUGT is Nico tiana tabacum ( AAB36652 ). SlTwi1 is Solanum lycopersicum ( CAA59450 ).

PAGE 67

67 Figure 4 2. Isolated glycosides from Petunia. LC MS analysis of purified putative 2 phenylethanol glycoside was p er formed at the CCRC by hydrolysis of the glycoside bond.

PAGE 68

68 Figure 4 3. Comparison of M82 and IL8 2 1 glycosides. Glycosides were extracted from ripe (A) M82 and (B) IL8 2 1 fruits. Crude extracts were analyzed in the lab of A. R. Fernie at the Max Planck Institute by T. Tohge using LC MS. Two highly abundant peaks were observed in the IL8 2 1 by the M82 spectrum. Fractionation of these peaks (shown in inset) revealed a unique product of MW 387 in IL 8 2 1

PAGE 69

69 Figure 4 4. Homology of tomato UGT candidates with known UGTs from Arabidopsis Amino acid sequences of the 8 tomato UGT candidates (SGN U) and representatives of different Arabidopsis UGT familie s ( www.p450.kvl.dk ) were aligned using ClustalW. A Neighb or Joining tree was constructed using MEGA5 (Tamura et al ., 2011) The percentage of replicate trees in which the associated taxa clustered together in the boot strap test (1000 replicates) are shown next to the branches Colored boxes represent Arabidopsis groups as defined by Li et al ., 2001 and are as follows: group A, group C, group D, group E, group F, group G, group H, group I, group J, gr oup K, group L.

PAGE 70

70

PAGE 71

71 Figure 4 5. Relative levels of 2 phenylethanol from transient expression in N. benthamiana Volatiles were collected from N. benthamiana leaves 5 days after inoculation with p19 and PAAS (control) or p1 9, PAAS, and pHK SGN U578227. 2 phe nylethanol levels were normalized to the control. Error bars represent standard error of the mean The asterisk ( ) indicates a significant test.

PAGE 72

72 CHAPTER 5 CONCLUSIONS In the course o f this work, a catechol OMT, CTOMT1, capable of synthesizing guaiacol from catechol in tomato fruits has been identified In vitr o biochemical analysis showed an affinity for catechol similar to other previously characterized catechol OMTs. Altering e xpres sion of the CTOMT1 gene can significantly affect the levels of guaiacol synthesis in tomato fruit However, under some circumstances, steps leading up to catechol synthesis can limit the ability of the fruit to synthesize guaiacol. The ability of CTOMT1 to increase guaiacol production when catechol is not limiting was demonstrated by feeding CTOMT1 overexpressing fruit pericarp disc s with excess amounts of catechol. Since reduced expression of CTOMT1 results in reduced guaiacol synthesis, it should be possi ble to obtain fruits with significantly reduced guaiacol synthesis by a variety of transgenic and non transgenic techniques. This might be done by looking for natural variation in heirloom varieties or, as we show here, suppress ing down CTOMT1 expression. Understanding glycosyltransferase activity and regulation is of great importance in our ability to redirect volatiles from glycosylation and to create a more flavorful tomato or, as in the case of guaiacol, remove undesirable volatiles by glycosylating the m However, this endeavor presents many challenges as glycosyltransferases lack single substrate specificity and putative glycosyltransferases are numerous in the tomato genome. Proper characterization of glycosides will help to determine what types of rea ction and enzymes are required for flavor molecule glycosylation. Additionally, development of new technique s for screening UGT candidates will help to overcome the challenge expressing enzymes in non plant systems.

PAGE 73

73 APPENDIX PROMOTER AND GENOMIC SEQUENCE COMPARISON Below is show n the p romoter and genomic sequence comparison of CTOMT1 between S. lycopersicum cv M82, S. lycopersicum cv. Heinz1706 and S. pennellii Sequence alignment was performed with ClustalW. Bases in red are coding sequence. M82 TATATATCAATTTTCAACATGATA ------TAAAGATAGGCATTTGGAGAGAAATTTTG Heinz1706 TATATATCAATTTTCAACATGATA ------TAAAGATAGGCATTTGGAGAGAAATTTTG S.pennellii TATATATCAATTTTCAACATAAGAATTCAGATAAAGATAGGCATTTGGAGAGAAATTTTG ******************** ***************************** M82 ATAAAACCCGATGTTGTACAAATTTTAAGGGGTTTAGTTGTAGAATATGAAATACTAGTA Heinz1706 ATAAAACCCGATGTTGTACAAATTTTAAGGGGTTTAGTTGTAGAATATGAAATACTAGTA S.pennellii ATAAAACCCGATTTTGTACAAATTTTAAGGG TTCAGTTATAGCATATGA AATACTAGTA ************ ****************** ** **** *** **************** M82 ATCTGTAGCATGAAATAAGAAGGCATATAGGTATCGGGTGGCATTATTTTATGAGCCCAC Heinz1706 ATCTGTAGCATGAAATAAGAAGGCATATAGGTATCGGGTGGCATTATTTTATGAGCCCAC S.pennellii A TCTGTAGCATGAAATAAGAAGGCATATAGGTATCGGGTGCCATTATTTTATGAGCCCAC **************************************** ******************* M82 TTAGCCATTAACTTTCAAAATAAAATGGAACATACTTGGGCCAGAACTCAGCGAATATGG Heinz1706 TTAGCCATTAACTTTCAAAATAAAATGG AACATACTTGGGCCAGAACTCAGCGAATATGG S.pennellii TTAGCCATTAA ----------AAATGGAACATAATTGGGCCAGACCTCAGCGAATATGG *********** ************ ********** ************** M82 GCTTAGCAATTGCATATGGACCTCACTGT ----------TAGGTTCCCTATATA ACTAG Heinz1706 GCTTAGCAATTGCATATGGACCTCACTGT ----------TAGGTTCCCTATATAACTAG S.pennellii GCTTAATAATTGCATATGGACCTTACTGTGCAACTTATGCTAGGTTCCCTATATAACTAG ***** **************** ***** ******************** M82 TTCACA TAATACTTATTGTTACAAGGAGCTGAATTTGTAACAAGGTCATATATATATATA Heinz1706 TTCACATAATACTTATTGTTACAAGGAGCTGAATTTGTAACAAGGTCATATATATATATA S.pennellii TTCACATAATACTTTTTGTTACAAGGAGCTGAATTTGTAACAAGGTCATATATATATA -************** ******************* ************************ M82 TATACTGTACTAACATTATAAAGATAAGCGTGCAAAAACCAATAAACGAATAATGGTTAC Heinz1706 TATACTGTACTAACATTATAAAGATAAGCGTGCAAAAACCAATAAACGAATAATGGTTAC S.pennellii -CACTGTACTAACATTATAAAGATAAGTGTGCAAAAACCAACAAACGGATAATGGTTAC ************************* ************* ***** *********** M82 TTCGGATTAAGTCAAGGAAATACTGAAATCAAGGAGTTTGATTTTAAGAAAGAACTTTAC Heinz1706 TTCGGATTAAGTCAAGGAAATACTGAAATCAAGGAGTTTGATTTTAAGAAAGAACTTTAC S.pennellii TTCGGATTAAGTCCA GGAAATACTAAAATCAAGGAGTTTGATTTTAAGAAAGAACTTTAC ************* ********** *********************************** M82 TTGATGTAGAATTTTAAATCAAGAGAGTTTTGAGT ------------------------Heinz1706 TTGATGTAGAATTTTAAATCAAGAGAGTTTTGAGT -----------------------S.pennellii TTTATGTAGAATTTTAAATCAAGAGAGTTTTGAGTTGAGGTGGAGTTTGAAGTGAAAGAA ** ******************************** M82 AACACTCTGAAGAGTTGTGCTTGAGAGTCACTCAGAACAAGGTGTGCACTCACAGAGCA Heinz170 6 AACACTCTGAAGAGTTGTGCTTGAGAGTCACTCAGAACAAGGTGTGCACTCACAGAGCA S.pennellii TAACTCTCTAAAGAGTTGTGCTTGAGAGTCACTCAGAACAAGGTGTGCACTCACAGAGCA *** **** ************************************************** M82 AAAACCAATTGGCTTCGCCAA TGTTGTTTGACTATTGAAGGAACACATTGAAGAATCAGG

PAGE 74

74 Heinz1706 AAAACCAATTGGCTTCGCCAATGTTGTTTGACTATTGAAGGAACACATTGAAGAATCAGG S.pennellii AAAACCAATTGGCTTCGCCAATGTTGTTTGACTATTGAAGGAACACATTGAAGAATCAGG ************************************************* *********** M82 TCCTAATGCAACTACAAGTTTTAGCCTTCATGTGTTCATTTGAGTTGTAATATTAATGCA Heinz1706 TCCTAATGCAACTACAAGTTTTAGCCTTCATGTGTTCATTTGAGTTGTAATATTAATGCA S.pennellii TCCTAATGCAACTACAAGTTTTAGCGTTCATGTGTTCATG GAGTTGTAATATTAATGCA ************************* ************* ******************* M82 AATCTTAATTTTAGTGTGTTATTGGATTATAATCTTCAAGTTGGGATAACTTAAAGATTT Heinz1706 AATCTTAATTTTAGTGTGTTATTGGATTATAATCTTCAAGTTGGGATAACTTAAAGATTT S.pennellii A TCTTAATTCTTGTGTGTTATTGGAT TATAATCTTCAAGTTGGGATAACTTAAAGATTT ******** *********************************************** M82 GAGGACATATATCTTGAGAGGTTTGTGAGTTGTTAAGAATTAGAGTTCATAATTTTGTGG Heinz1706 GAGGACATATATCTTGAGAGGTTTGTGAGTTGTTAAGAATTAGAGTTCATAATT TTGTGG S.pennellii GAGGACATATATCTTGAGAGGTTTGTGAGTTGTTAAGAATTAGAGTTCATAATTTTGTAT ********************************************************** M82 TTTAGAATTGTTAAGAATTAGAGTTCATAATGTCTTGTTGAAAGGCTCATTGTGCTTTAG Heinz1706 TTTAG AATTGTTAAGAATTAGAGTTCATAATGTCTTGTTGAAAGGCTCATTGTGCTTTAG S.pennellii ATTACA -----------TAGA TTCATAATGTCTTGTTGAAAGGCTCATTGTGGATTAG *** **** ******************************* **** M82 AAAAGTTGTGGTTAAATGTTGTAGATGTACATG TGATTTTT --------GTGAACTGGA Heinz1706 AAAAGTTGTGGTTAAATGTTGTAGATGTACATGTGATTTTT --------GTGAACTGGA S.pennellii AAAAGTTGTGGTTAAATGTTGTAGATGTACATGTGATTTTTATGACTTTTGTGAGCTGGA ***************************************** **** ***** M82 TATTTTTACATAAAAATAATGTAGTGTTGATACCATTTTGTTAAAGCACATTAGCCAAGA Heinz1706 TATTTTTACATAAAAATAATGTAGTGTTGATACCATTTTGTTAAAGCACATTAGCCAAGA S.pennellii TATTTTTACATAAAAATAATGTAGTGTTTATACTATCTTGTTAAAGCACATTAGCCAAGA ************ **************** **** ** *********************** M82 TACTAGTTAATGGGACTATAAGTAGCGTCACGAAATTCTTTTGGTGGAATTCGGTTTAGA Heinz1706 TACTAGTTAATGGGACTATAAGTAGCGTCACGAAATTCTTTTGGTGGAATTCGGTTTAGA S.pennellii TACTAGTTAATGGGACTATAAGTAGCGTCACGAAATTCT TTTGGTGGAATTCGGTTTAGA ************************************************************ M82 ATTAATAGAAGTTTAGCATTAATAGGATTATTTCAAGTGACAAGAGAATCATTCAAAATG Heinz1706 ATTAATAGAAGTTTAGCATTAATAGGATTATTTCAAGTGACAAGAGAATCATTCAAAATG S.pen nellii ATTAATAGAAGTTTAGCATTAATAGGATTATTTAGAGTAACAAGAGAATCATTCAAAATG ********************************* *** ********************* M82 GTAAACATCACTTACTTAGGAAGCTAAAAGAAAACCTTAAAGTAGGTTATCTTTCCATCT Heinz1706 GTAAACATCACTTACTT AGGAAGCTAAAAGAAAACCTTAAAGTAGGTTATCTTTCCATCT S.pennellii GTAAACATCACTTACTTAGGAAGCTAAAAAAACAA TTAAAGTAGGT ATCTTTCCATCT ***************************** ** *********** ************ M82 AGAAAGTGATTGAAAAAATAAATCTAGTAATGTTAGGTGCAACA ACTTTAAATCATCACA Heinz1706 AGAAAGTGATTGAAAAAATAAATCTAGTAATGTTAGGTGCAACAACTTTAAATCATCACA S.pennellii AGAAAGTGATTGAAAAA CAAATCTAGTAATGTTAGGTGCAACAACTTTGAATCATCACA ***************** ****************************** ********** M82 GAGAAAAAGTGGACTGAAAAAGAATAATCATAAAGGAGATTTCATGATTTGATATATACA Heinz1706 GAGAAAAAGTGGACTGAAAAAGAATAATCATAAAGGAGATTTCATGATTTGATATATACA S.pennellii AAGAAAAAGTGGACTGAAAAAGAATAATCATAAAGGAGATTTCATGATTTGATATATACA *********************** ************************************ M82 TACATAT -------------------TTATTTTTTGTTATACCAAACAAAGATTTTATT Heinz1706 TACATAT -------------------TTATTTTTTGTTATACCAAACAAAGATTTTATT S.pennellii TATATATACATACATATTTATTTTATTTTATTTTTTGTTATACCAAACAAA GATTTTATT ** **** *********************************

PAGE 75

75 M82 TATTTATTGTTTTTAAAAAAAAGAAAAATCTCTAGTTGAAGACTCTTTCTTGCAAATTTC Heinz1706 TATTTATTGTTTTTAAAAAAAAGAAAAATCTCTAGTTGAAGACTCTTTCTTGCAAATTTC S.pennellii TA TTTATTGTTTTTAAAATGAAGAAAAATCTCTAGTTGAAGACTCTTTCTTGCAAATTTC ****************** **************************************** M82 AACAAGCAACGTATCAAGGTAAAAAAAAAAAAATAACACATGTAATGTATCTTCATATGT Heinz1706 AACAAGCAACGTATCAAGGTAAAAAAAAA AAAATAACACATGTAATGTATCTTCATATGT S.pennellii AACAAGTAACTTATCAAGGTAAAAAAAA ----TAACACATGTAATGTATCTTCATATGT ****** *** ***************** *************************** M82 CATCATTAAATAGAAGGGGTTAGTTAGAATTTAGTAATACATTCAAAAAAAACTAA CAGC Heinz1706 CATCATTAAATAGAAGGGGTTAGTTAGAATTTAGTAATACATTCAAAAAAAACTAACAGC S.pennellii CATCATTAAATAGAAGGGGTTAGTTAGAATTTAGTAATACATTCAAAAAAAAAACTCACC **************************************************** ** M82 AATTCAA TGTATCTTCATATATTAATGTGGTCATATCAACCTTGAACATATTAAACAATA Heinz1706 AATTCAATGTATCTTCATATATTAATGTGGTCATATCAACCTTGAACATATTAAACAATA S.pennellii CATTCAATGTATCTTCATATATTAATGTGGTCATATTATCTTTGAACATATTAAACAATA *********************************** ******************* M82 TAATAGAGAAATAAAATTTGTAAATATCGATATTCTACTTCAACTAGACAATTACATTGT Heinz1706 TAATAGAGAAATAAAATTTGTAAATATCGATATTCTACTTCAACTAGACAATTACATTGT S.pennellii TAATAGAAAAATAAAATTTGTAAATGTCGATATTCTACTTCAAGTAGACAATTACATTGT ******* ***************** ***************** **************** M82 TTGTATTCACAATTTTGATAAAGTAATGAGAAGTAAATTAATAGAATACAATAGGAATTT Heinz1706 TTGTATTCACAATTTTGATAAAGTAATGAGAAGTAAATTAATAGAATACAATAGGAATTT S.pennellii TTGTATTCACAATT TTGATAAAGTAATGAGAAGTAAATTAATAGAATACAATAGGAATTT ************************************************************ M82 GTATATCCATCGTTAAAAGTCAAGAGATAAAACAAACTTT ATGTATTTAATTATCTAAG Heinz1706 GTATATCCATCGTTAAAAGTCAAGAGATAAAACAAACTTT ATGTATTTAATTATCTAAG S.pennellii GTATATCCATCGTTAAAAGTCAAGAGATAAAACAAACTTTTATGTATTTAATTATCTTAG **************************************** **************** ** M82 AGTCAATTAACTAATTGTATGTTAATATGATGGTTAGGTGAAGAAAACATGTTATAGTAA Heinz17 06 AGTCAATTAACTAATTGTATGTTAATATGATGGTTAGGTGAAGAAAACATGTTATAGTAA S.pennellii AGTCAATTAACTAATTGTATGTTAATATGATGGTTAGGTGAAGAAAACATGTTATAGTAA ************************************************************ M82 TATTGTATGAGGAAAATAT GAAGAAAATGACTGAATTCTCTTGTTCAGTAAAGCAGACAG Heinz1706 TATTGTATGAGGAAAATATGAAGAAAATGACTGAATTCTCTTGTTCAGTAAAGCAGACAG S.pennellii TATTATATGAGGAAAATATGAAGAAAATGACTGAATTCTCTTGTTCAGTAAAGCAGACAG **** ****************************************** ************* M82 CCAATCACATGTTAAGTGGCCTACTCTCCACTTTTTT AGTGGACCTTATGCTTCACTAA Heinz1706 CCAATCACATGTTAAGTGGCCTACTCTCCACTTTTTT AGTGGACCTTATGCTTCACTAA S.pennellii CAAATCACATGTTAAGTGGCCTACTCTCCATTTTTTTTAGTGGACCTTGTGCTTCACTAA **************************** ****** ********** *********** M82 CTTTT TTTTTTTTACCAAAAGCAATAATTTTTAATCCAAACAGTAAACAAAAAAAAAAA Heinz1706 CTTTT TTTTTTTTACCAAAAGCAATAATTTTTAATCCAAACAGTAAACAAAAAAAAAAA S.pennellii CTTATATTTTTTTTACCAAAAGCAA TAATTTTTAATCCAAACAGTAAACACAAAAAGAAA *** ******************************************** ***** *** M82 A CATACCACCAACTCACATATACAGGAAGTAACTGTGCACAATGGAAGAAGGAAATGGA Heinz1706 -CATACCACCAACTCACATATACAGGAAGTAACTGTGCACAATGGAAGAAG GAAATGGA S.pennellii CACATACCACCAACTCACATATACAGGAAGTAACTGTGCACAATGGAAGAAGGAAAAGGA ****************************************************** *** M82 GCGATCCACTGCTGCTTCGAGATGTTATTATTACAATTTTCAGATTGAACTGAATATACT Heinz1706 GCGAT CCACTGCTGCTTCGAGATGTTATTATTACAATTTTCAGATTGAACTGAATATACT

PAGE 76

76 S.pennellii GCGATCCACTGCTACTTCGCGATGTTATTATTAGAATTTTCAGATTGAACTGAATATACT ************* ***** ************* ************************** M82 GCTTTCAAGTCATGAACGTGAGATAAAATAAT AATATTAGGCAGATAGAGGGAGTGATAT Heinz1706 GCTTTCAAGTCATGAACGTGAGATAAAATAATAATATTAGGCAGATAGAGGGAGTGATAT S.pennellii GCTTTCAAGTCATGAACGTGAGATAAAAAAATAATATTAGGCAGATAGAGAGAGTGATAT **************************** ********************* ********* M82 ATACTTCATTAGTCTCCATTTATATAATTATTTTTCTTTTTCATCAGTAAACAAAAAAAA Heinz1706 ATACTTCATTAGTCTCCATTTATATAATTATTTTTCTTTTTCATCAGTAAACAAAAAAAA S.pennellii ATACTTCATTGATCTC ---------------------TTTAATCAGTAA CAAAAAAGA ********** **** *** ******** ******* M82 AGAAAATATTTTTATATTTAATAACAAATTAATTTTTAAATAAATCAGAACAGATAGAAT Heinz1706 AGAAAATATTTTTATATTTAATAACAAATTAATTTTTAAATAAATCAGAACAGATAGAAT S.pennellii ATAAAACATTTCTATATTTAATAACAAATTAATTTTTA AATATATCAGAACAGATAGAAT **** **** ****************************** ***************** M82 GCCACTATGCAATTGAAAAAGAACAAAAAACGAATGAAAAGCAGACGCATTACTAATATT Heinz1706 GCCACTATGCAATTGAAAAAGAACAAAAAACGAATGAAAAGCAGACGCATTACTAATATT S.pe nnellii GCCACTATGCAATTGAAAAAGAACAAAAAACGAATGAAAAGCAGACGCATTACTAATATT ************************************************************ M82 CCCACCAAGAAATCAATTATGACCAATCTTTGACAAAACAACAATTCTTGGTTTGATATT Heinz1706 CCCACCAAGAAATCAA TTATGACCAATCTTTGACAAAACAACAATTCTTGGTTTGATATT S.pennellii CCCACCAAGAAATCAATTATGACCAATCTTTGACAAAACAACAATTCTTGGTTTGATGTT ********************************************************* ** M82 TATAAAAGGGTAGTCTAACCCCATTATACATCATCTTGAGGCC TAACAAAACACTCCAAG Heinz1706 TATAAAAGGGTAGTCTAACCCCATTATACATCATCTTGAGGCCTAACAAAACACTCCAAG S.pennellii TATAAAAGGGTACTCTAACCCCATTATACATCATCTTGAGGCCTAACAAAACACTCCAAG ************ *********************************************** M82 CAGCAAAAATAACATTTTCTTGTTCATCTCTAAGTTCTTTTTAGCT ATGGGATCGACAGC Heinz1706 CAGCAAAAATAACATTTTCTTGTTCATCTCTAAGTTCTTTTTAGCT ATGGGATCGACAGC S.pennellii CAGCAAAAATAACATTTTCTTGTTCATCTCTAAGTTCTTTTTAGCT ATGGGATCGACAGC ********************** ************************************** M82 AAATATCCAGTTAGCAACACAATCGGAAGACGAAGAGCGTAATTGCACGTACGCCATGCA Heinz1706 AAATATCCAGTTAGCAACACAATCGGAAGACGAAGAGCGTAATTGCACGTACGCCATGCA S.pennellii AAATATCCAGTTACCAACACAATCGGAAAACGAAGAGCGTAATTGCACG TACGCCATGCA ************* ************** ******************************* M82 ACTACTCTCATCGTCAGTGCTTCCCTTCGTTTTGCACTCAACTATCCAATTGGATGTTTT Heinz1706 ACTACTCTCATCGTCAGTGCTTCCCTTCGTTTTGCACTCAACTATCCAATTGGATGTTTT S.pennellii ACTACTCTCATCGTCAGTGCTTCCCTTCGTTTTGCACTCAACTATCCAATTGGATGTTTT ************************************************************ M82 TGACATACTCGCAAAAGATAAAGCCGCCACTAAACTATCTGCTTTAGAAATTGTGTCTCA Heinz1706 TGACATACTCGCAAAAGATAAAGCCGC CACTAAACTATCTGCTTTAGAAATTGTGTCTCA S.pennellii TGAGATACTCGCAAAAGATAAAGCCGCCACTAAACTATCTGCTTTAGAAATTGTGTCTCA *** ******************************************************** M82 CATGCCTAACTGTAAGAACCCTGATGCCGCTACCATGCTAGACCGGATGCTTTA TGTCCT Heinz1706 CATGCCTAACTGTAAGAACCCTGATGCCGCTACCATGCTAGACCGGATGCTTTATGTCCT S.pennellii CATGCCTAACTGTAAGAACCCTGATGCCGCTACCATGCTAGACCGGATGCTTTATGTCCT ************************************************************ M82 AGCTA GTTATTCTTTACTCGATTGCTCGGTTGTTGAAGAGGGAAATGGGGTGACCGAAAG Heinz1706 AGCTAGTTATTCTTTACTCGATTGCTCGGTTGTTGAAGAGGGAAATGGGGTGACCGAAAG S.pennellii AGCTAGTTATTCTTTACTCGATTGTACTGTTGTTGAAGAGGGAAATGGGGTGACCGAAAG ************************ ***** ***************************

PAGE 77

77 M82 GCGCTATGGTCTGTCACGAGTGGGGAAATTTTTTGTACGTGATGAAGATGGTGCATCCAT Heinz1706 GCGCTATGGTCTGTCACGAGTGGGGAAATTTTTTGTACGTGATGAAGATGGTGCATCCAT S.pennellii GCGCTATGGTCTGTCACGAGTGGGGAAATTTTTTGTACGTGATGAAGATGGTGCATCCAT ************************************************************ M82 GGGACCATTGTTGGCTTTGCTTCAAGATAAAGTATTCATTAACAGCTG GTCAGTTTTCTC Heinz1706 GGGACCATTGTTGGCTTTGCTTCAAGATAAAGTATTCATTAACAGCTG GTCAGTTTTCTC S.pennellii GGGACCATTGT TGGCTTTGCTTCAAGATAAAGCATTCATTAACAGCTG GTCAGTTTTCTC ******************************** *************************** M82 TTTTTACTGCAGCAATCTTTCTTTTTAACCAAACTTTTATCATGTCAATTGTATGTGGTC Heinz1706 TTTTTACTGCAGCAATCTTTCTTTTTAACCAAACTTTT ATCATGTCAATTGTATGTGGTC S.pennellii TTTTTACTGCAGCAATCTTTCTTTTTAACCAAACTTTTATCATGTCAATTGTATGTGGTC ************************************************************ M82 ATCCTAGTATAACCTAACAAATTGAGTATATATTAGAGATTTTCTCACAATATAAGTGAG Hein z1706 ATCCTAGTATAACCTAACAAATTGAGTATATATTAGAGATTTTCTCACAATATAAGTGAG S.pennellii ATCCTAGTATAACCTAACAAATTGAGTATATATTAGAGATTTTCTCACAATATATGTGAG ****************************************************** ***** M82 TCAGAGTCAGGTGGAT ATATCATGCAAAGTTGAAGACCCTTTTTTGATCCCTTCATTATA Heinz1706 TCAGAGTCAGGTGGATATATCATGCAAAGTTGAAGACCCTTTTTTGATCCCTTCATTATA S.pennellii TCAGAGTCAGGTGGATATATCATGCAAAGTTGAAGACCCTTTTTTGATCCCTTCATTATA ******************************************** **************** M82 TTCTTAATATACAAAACATGTATCTTTGCTGGCTATTATATTAGGGCGGCC AAATAGAT Heinz1706 TTCTTAATATACAAAACATGTATCTTTGCTGGCTATTATATTAGGGCGGCC AAATAGAT S.pennellii TTCTTAATATACAAAACATGTATCTTTGCTGGCTATTATATTAGGGCGGCCCAAATAGAT *************************************************** ******** M82 AATTATTCCTATATATTACTTCATGAAGGAATCTCAGAATATTAATGCTTTCCTGTCGAA Heinz1706 AATTATTCCTATATATTACTTCATGAAGGAATCTCAGAATATTAATGCTTTCCTGTCGAA S.pennellii AATTATTCCTATATATTACTTC ATGAAGGAATCTCAGAATATTAATGCTTTCCTGTCGAA ************************************************************ M82 CCATCTGGTATCCAAAACTCACTAGGCCGACCAATTAAAATCCATGATGCATAGGACCTA Heinz1706 CCATCTGGTATCCAAAACTCACTAGGCCGACCAATTAAAATCCATGATG CATAGGACCTA S.pennellii CCATCCGGTATCCAAAACTCACTAGGCCGACCAATTCAAATCCATGATGCATAGGACCTA ***** ****************************** *********************** M82 TGACAGAGTGAATGAGTCTATTTCCTAGCTCGAATCAAAGATTTCTGATCAAGTGTAAAG Heinz1706 TGACAGAGTGAATGAGTCTATTTCCTAGCTCGAATCAAAGATTTCTGATCAAGTGTAAAG S.pennellii TTACAGAGTGAATGAGTCTATTTCCTAGCTCGAATCAAAGATTTCTGATCAAGTGTGAAG ****************************************************** *** M82 TGATGTGATCATGAGACTAATGGAATT TGTAAGTTAATTACAGTTATCATGTTAACAAAT Heinz1706 TGATGTGATCATGAGACTAATGGAATTTGTAAGTTAATTACAGTTATCATGTTAACAAAT S.pennellii TGATGTGATCATGAGACTAATGGAATTTGTAAGTTAATTACAATTATCATGTTAACAAAT ****************************************** ************ ***** M82 ACATCAACTGGTTCAAGTTAGCATATAAATTGCTAACAGAATG ---------------T Heinz1706 ACATCAACTGGTTCAAGTTAGCATATAAATTGCTAACAGAATG ---------------T S.pennellii ACATCAACTGGTTCAAGTTAGCATATAAATTGCTAAGAGAATACTTTTGCATGAGCCTAT ****** ****************************** ***** M82 GTCCACTCAATTGCCAAAGATCAAGGGTACACTATAATTTCAAGAAATTGTTGGATAGTT Heinz1706 GTCCACTCAATTGCCAAAGATCAAGGGTACACTATAATTTCAAGAAATTGTTGGATAGTT S.pennellii GTCCACTCAACTGCCAAAGATCAAGGGTACACT GTAATTTCGAGAAATTATTGGATAGTT ********** ********************** ******* ******* ********** M82 AGAGTACGTATGTTATCAGACTCATACTCGTGAAATTACACTGAATATATTGTC ----T Heinz1706 AGAGTACGTATGTTATCAGACTCATACTCGTGAAATTACACTGAATATATTGTC ----T S.pennellii AGGGTACGTATGTTATCAGACTCATACTCGTGAAATTACACTGAATATATTGTTATTAAT

PAGE 78

78 ** ************************************************** M82 GCTGGATACTTGGGAATTAATTGCTTCCAGATGAGACTGAGGCGTAATTATAGTAGTTGT Heinz1706 GCTGGATACTT GGGAATTAATTGCTTCCAGATGAGACTGAGGCGTAATTATAGTAGTTGT S.pennellii GCTGGATACTTGGGAATTAATTGCTTCCAGATGAGACTGAGGCGTAATTATAGTAGTTGT ************************************************************ M82 ATTTCTGACTCTCTCTATCTAATTTAAATTACAG GTTT GAACTAAAAGATGCAGTACTTG Heinz1706 ATTTCTGACTCTCTCTATCTAATTTAAATTACAG GTTTGAACTAAAAGATGCAGTACTTG S.pennellii ATTTCTGACTCTCTCTATCTAATTTAAATTACAG GTTTGAACTAAAAGATGCAGTACTTG ************************************************************ M82 AAGGTGGAGTTCCATTTGACAGGGTGCATGGTGTACATGCATTTGAATATCCAAAATTGG Heinz1706 AAGGTGGAGTTCCATTTGACAGGGTGCATGGTGTACATGCATTTGAATATCCAAAATTGG S.pennellii AAGGTGGAGTTCCATTTGACAGGGTGCATGGTGTACATGCATTTGAATATCCAAAATTGG ***************** ******************************************* M82 ACCCAAAGTTCAATGATGTTTTCAACCAGGCAATGATAAACCACACAACTGTTGTCATGA Heinz1706 ACCCAAAGTTCAATGATGTTTTCAACCAGGCAATGATAAACCACACAACTGTTGTCATGA S.pennellii ACCCAAAGTTCAATGATGTTTTCAACCAGGCAATGATCAACCAC ACAACTGTTGTCATGA ************************************* ********************** M82 AAAGAATACTTGAAAATTACAAAGGTTTTGAGAATCTCAAAACTTTGGTTGATGTTGGAG Heinz1706 AAAGAATACTTGAAAATTACAAAGGTTTTGAGAATCTCAAAACTTTGGTTGATGTTGGAG S.pennelli i AAAGAATACTTGAAAATTACAAAGGTTTTGAGAATCTCAAAACTTTGGTTGATGTTGGAG ************************************************************ M82 GTGGTCTTGGTGTTAATCTCAAGATGATTACATCTAAATACCCCACAATTAAGGGCACTA Heinz1706 GTGGTCTTGGTGTTAATCTCAA GATGATTACATCTAAATACCCCACAATTAAGGGCACTA S.pennellii GTGGTCTTGGAGTTAATCTCAAGATGATTACATCTAAATACCCCACAATTAAGGGCACTA ********** ************************************************* M82 ATTTTGATTTGCCTCATGTTGTTCAACATGCACCTTCCTATCCTG GTAC CTTAATTCTTG Heinz1706 ATTTTGATTTGCCTCATGTTGTTCAACATGCACCTTCCTATCCTG GTACCTTAATTCTTG S.pennellii ATTTTGATTTGCCTCATGTTGTTCAACATGCAACTTCCTATCCTG GTACCTTAATTCTTG ******************************** *************************** M82 TTTTATTGTTCACTTTGATACTTTGTTTCAATGTTAGAGATTTATACTTTGTTTCAATGT Heinz1706 TTTTATTGTTCACTTTGATACTTTGTTTCAATGTTAGAGATTTATACTTTGTTTCAATGT S.pennellii TTTTATTGTTCAATTTGATACTTTGTTTCA -------------------------ATGT ************ *************** ** **** M82 TAGAGATTTAAATTACAATTCATTGGATTGTTTTGTTTGCAAACAAGTTATACAGAGATT Heinz1706 TAGAGATTTAAATTACAATTCATTGGATTGTTTTGTTTGCAAACAAGTTATACAGAGATT S.pennellii TAGAGATTTAAATTACAATTCATTGGATTGTTTTGTTTGCAAACAAGTTATGCAG AGATT *************************************************** ******** M82 ATAATACGAGGTTTAAAATAATAACGAGATTCTTTAATCGATAGATTTCTAAAATGGTAG Heinz1706 ATAATACGAGGTTTAAAATAATAACGAGATTCTTTAATCGATAGATTTCTAAAATGGTAG S.pennellii ATAATA CGAGGTTTAAAATAATAACGAGATTCTTTGATCG -------------------*********************************** **** M82 CTCTCAATTTCCTAACATGAACTGAATTTGTCTTAATAAATATTGCAG GGGTGGATCATG Heinz1706 CTCTCAATTTCCTAACATGAACTGAATTTGTCT TAATAAATATTGCAG GGGTGGATCATG S.pennellii --------------------------------------------CAG GGGTGGATCATG *************** M82 TTGGGGGAGATATGTTTGAAAGTGTTCCACAAGGAGATGCTATTTTTATGAAG GTAATGT Heinz1706 TTGGGGGAGATATGTTTGAAAGTGTTCCACAAGGAGATGCTATTTTTATGAAG GTAATGT S.pennellii TTGGGGGAGATATGTTTGAAAGTGTTCCACAAGGAGATGCTATTTTTATGAAG GTAATGT ************************************************************ M82 CCAAATCTTTA GCAGAGGCTGTATGTATGTACTGTGCATATATTTGGCTTACATGTCGAA

PAGE 79

79 Heinz1706 CCAAATCTTTAGCAGAGGCTGTATGTATGTACTGTGCATATATTTGGCTTACATGTCGAA S.pennellii CCAAATCTTTAGCAGAGGCAATATGTATGTACTGTGCATATATTTGGCTTACATGTCGAA ******************* ****************** ********************* M82 AGTCTTCTTTAATTTCTTAGATTTTGTGTTCAGTCAAACAAACTTTATTTTGTTCCTCAC Heinz1706 AGTCTTCTTTAATTTCTTAGATTTTGTGTTCAGTCAAACAAACTTTATTTTGTTCCTCAC S.pennellii AGTCTTCTTTAATTT TTAGATTTTGTGTTCAGTCAAACAAACTTTATTTTGTTCCTCAC *************** ******************************************** M82 ATAACCGATGCGAGTTATGTAACGCTTCTTTTTGTTTCACAAATTAGCGGACCTAAATTC Heinz1706 ATAACCGATGCGAGTTATGTAACGCTTCTTTTTGTTTCACAAATTAGCGGACCTAAATTC S.pennellii ATAACCGATGCGAGTTA TGTAACGCTTCTTTTTGTTTCACAAATTAGCGGACCTAAATTC ************************************************************ M82 AATACTTTTGGGTTCACAAACTTTGGGTTGACCGATTTATGAAATAAAAAAGAAGTCGCT Heinz1706 AATACTTTTGGGTTCACAAACTTTGGGTTGACCGATTTATGAAA TAAAAAAGAAGTCGCT S.pennellii AATACTTCTGGGTTCACAAACTTTGGGTTGACCAATTTATGAAATAAAAAAGAAGTCGCG ******* ************************* ************************* M82 CACAACTTGTGTCAGCTGGAACTTAACTACTTGCATAGTCTTGCATTCCTGTTCTTCACC Heinz1706 CACAACTTGTGTCAGCTGGAACTTAACTACTTGCATAGTCTTGCATTCCTGTTCTTCACC S.pennellii CACAACTTGTGTCAGCTGGAACTTAACTACTTGCATAGTCTTGCATTCCTGTTCTTCACC ************************************************************ M82 AATAGTATCTATAACCTATGAT TAATAAGGGCATTCTGTGTTTATTGATGAAAAG TGGAT Heinz1706 AATAGTATCTATAACCTATGATTAATAAGGGCATTCTGTGTTTATTGATGAAAAG TGGAT S.pennellii AATAGTATCTATAACCTATGATTAATAAGGACATTCTGTGTTTATTGATGAAAAG TGGAT ****************************** ******************* ********** M82 CCTTCATGACTGGAGTGATGGTCACTGCCTCAAATTGCTGAAGAACTGTCATAAGGCTCT Heinz1706 CCTTCATGACTGGAGTGATGGTCACTGCCTCAAATTGCTGAAGAACTGTCATAAGGCTCT S.pennellii CCTTCATGACTGGAGTGATGGTCACTGCCTCAAATTGCTGAAGAACTGCCATAAGGCTCT *********************************************** *********** M82 ACCGGACAACGGAAAGGTGATTGTTGTGGAGGCCAATCTACCAGTGAAACCTGATACTGA Heinz1706 ACCGGACAACGGAAAGGTGATTGTTGTGGAGGCCAATCTACCAGTGAAACCTGATACTGA S.pennellii ACCGGACAACGGAAAGGTGATTGTTGTG GAGGCCAATCTACCAGTGAAACCTGATACTGA ************************************************************ M82 TACCACAGTGGTTGGAGTTTCACAATGTGATTTGATCATGATGGCTCAGAATCCCGGAGG Heinz1706 TACCACAGTGGTTGGAGTTTCACAATGTGATTTGATCATGATGGCTCAGAATCCC GGAGG S.pennellii TACCACAGTGGTTGGAGTTTCACAATGTGATTTGATCATGATGGCTCAGAATCCGGGAGG ****************************************************** ***** M82 TAAAGAGCGTTCTGAACAGGAGTTTCGGGCATTGGCAAGTGAAGCTGGATTCAAAGGTGT Heinz1706 TAAAGA GCGTTCTGAACAGGAGTTTCGGGCATTGGCAAGTGAAGCTGGATTCAAAGGTGT S.pennellii CAAAGAGCGTTCTGAACAGGAGTTTCGGGCATTGGCAAGTGAAGCTGGATTCAAAGGTGT *********************************************************** M82 TAACCTAATATGTTGTGTCTGTAATTTTTGGGTC ATG GAATTTTACAAG TAGATTTCCAC Heinz1706 TAACCTAATATGTTGTGTCTGTAATTTTTGGGTCATG GAATTTTACAAG TAGATTTCCAC S.pennellii TAACCTAATATGTTGTGTCTGTAATTTTTGGGTCATG GAATTTTACAAG TAGATTTCCAC ************************************************************ M82 AACCTACTTCGCTCTTATGATTATGTATTTTCGTGGCACTCTGGGACTGGAATTTATAAA Heinz1706 AACCTACTTCGCTCTTATGATTATGTATTTTCGTGGCACTCTGGGACTGGAATTTATAAA S.pennellii AACCTACTTCGCTCTTATGATTATGTACTTTCGTGGCACTCTGGGACTGGAATTTATAAA ************* ************** ******************************** M82 CTAGCCCAGCTTGAATGTTTGACGTTGATTCCTAATAATATTTATATTACTACTTGTTTG Heinz1706 CTAGCCCAGCTTGAATGTTTGACGTTGATTCCTA ATAATATTTATATTACTACTTGTTTG S.pennellii TTAGCCCAGCTTGAATGTTTGACGTTGATTCCTA ATAATA TTTATATTACTACTTGTTTG ***********************************************************

PAGE 80

80 M82 TTTCTCTAGTTTGAGAGGATGTCATTAACTCATTGTAACTTCTGTCTTAATAATATTTAT Heinz1706 TTTCTCTAGTTTGAGAGGATGTCATTAACTCATTGTAACTTCTGTCTTAATAATATTTAT S.penne llii TTTCTCTAGTTTGAGAGGATGTCAT -------TGTAACTTCTGTCTTAATAATATTTAT ************************* *************************** M82 ATATTCCTCTGTTCCATTTGATATGATGCCTTCCTTTTTAGTTTTCAGAAAAAAGAATGA Heinz1706 ATATTCCTCTGTTCCATTT GATATGATGCCTTCCTTTTTAGTTTTCAGAAAAAAGAATGA S.pennellii ATATTCCTCTGTTCCATTTGATATGATGCCTTCCTTTTTAGTTTTCAGCAAAA GAATGA ************************************************ **** ****** M82 ACCCAAACATACGTAACCCGTCCAATCCGCCCAGAATTTTAAGGGT TGGGCTCAAGATAA Heinz1706 ACCCAAACATACGTAACCCGTCCAATCCGCCCAGAATTTTAAGGGTTGGGCTCAAGATAA S.pennellii ACCCAAACATACGTAACCCGTCCAATCCGCCCAGAATTTTAAGGGTTGGGCTCAAAATAA ******************************************************* **** M82 TTTGAAATGGGTTCAATCTCAACCCATTCAAGCAAAGAGAATTCTCAATTGAGCCCAATT Heinz1706 TTTGAAATGGGTTCAATCTCAACCCATTCAAGCAAAGAGAATTCTCAATTGAGCCCAATT S.pennellii TTTGAATTGGGTTCAATCTCAACCCATTCAAGCAA GAAAATTCTCAATTGAGCCCAATT ****** ****************** ********** ** ********************* M82 CAATCTCCAATTTCAACCCGTTTTAAAAAAATTTATTAAGATATGTTCCTATATTGAAAG Heinz1706 CAATCTCCAATTTCAACCCGTTTTAAAAAAATTTATTAAGATATGTTCCTATATTGAAAG S.pennellii CAATCTCCAATTTCAACCCGTTTTAAATTTTTTTATTAAGATATGTTCCTAT ATTGAAAG *************************** ***************************** M82 TATGAATTATTATCTATTTAACATCTTTTAGAATTTATCTATCAATTTGTTACTTTTTTA Heinz1706 TATGAATTATTATCTATTTAACATCTTTTAGAATTTATCTATCAATTTGTTACTTTTTTA S.pennellii TAT GAGTTATTATATATTTAACATCTCTCGGGATTTATCTATCAATTTGTTATTTTTTTA ***** ******* ************ ******************** ******* M82 ACAAAAAATTCTTGAGCCGAAATTCAAATTGTGATTATAAAAGTTATATATCAATATGTT Heinz1706 ACAAAAAATTCTTGAGCCGAAATTCAAATT GTGATTATAAAAGTTATATATCAATATGTT S.pennellii ACAAAAAATTCTTGAGTCGAAATTCAAATTGTGATTATAAAAGTTATATATCAATATGTT **************** ******************************************* M82 AAATTATTGAGATTAATCGGATCAAATTGGGTAGGTCAA GACCAACCCCGTTTTTT AGC Heinz1706 AAATTATTGAGATTAATCGGATCAAATTGGGTAGGTCAA GACCAACCCCGTTTTTTAGC S.pennellii AAATTATTGTGATTAATCGGGTCAAATTGGGCAGGTCAAAGACCAAACCCGTTTTTTAGC ********* ********** ********** ******* ****** ************* M82 CCATTTGA --------------ACCCAAAGTAAACTTGGGCGGGTCGAGACCCAACCCA Heinz1706 CCATTTGA --------------ACCCAAAGTAAACTTGGGCGGGTCGAGACCCAACCCA S.pennellii CCATTTGAGCCCAACCCATTTGAACCCAAAGTAAACTTGGGCGGGTCGAGACCCAACCCA ******** ************* ************************ M82 ATTTCTATTCAACCCATTGTAATATTTTAAATTTCAACC -ACCCGCCCATTTGACACCC Heinz1706 ATTTCTATTCAACCCATTGTAATATTTTAAATTTCAACC -ACCCGCCCATTTGACACCC S.pennellii ATTTCTATTCAACCCATTGTAATATTTTAAATTTCAACCCAACCCGCCCATTTGACACCC *************************************** ******************* M82 CTAATTATTATTTTTATTTTCATATTTCCTTTTTCAAACTGCTTTGGGGTGCTTTAGGAA Heinz1706 CTAATTATTATTTTTATTTTCATATTTCCTTTTTCAAACTGCTTTGGGGTGCTTTAGGAA S.pennellii CTAATTATTATTTT TATTTTCATATTTCCTTTTTCAAACTGCTTTGGGATGCTTTAGGAA ************************************************ *********** M82 ACCACACTTTGTCTCTACGAGGTAGGAATAAGGTCTATGTACACTCTACCCTACCCAGAC Heinz1706 ACCACACTTTGTCTCTACGAGGTAGGAATAAGGTCTATGTA CACTCTACCCTACCCAGAC S.pennellii ACCACACTTTGTCTCTACGAAGTAGGAATAAGGTTTATGTACAATCTACCCTACCCAGAC ******************** ************* ******** **************** M82 TATACTTGTGAGATTACACTGGATATGCATCCAGTTGTTGTTGTTGGGTTCTAGACTCTA Heinz17 06 TATACTTGTGAGATTACACTGGATATGCATCCAGTTGTTGTTGTTGGGTTCTAGACTCTA

PAGE 81

81 S.pennellii TACACTTGTGAAATTAC ------------------GTTATTGTTGGGTTCTAGACTCTA ** ******** ***** *** ******************** M82 ATCTTTTCAAGTTACTAGG AGTAACTTGTACAAATTCAAATCAACTTTTGTAACAAACAT Heinz1706 ATCTTTTCAAGTTACTAGGAGTAACTTGTACAAATTCAAATCAACTTTTGTAACAAACAT S.pennellii ATCTTTTCAAGTTACTAGGAGTAACTTGTACAAATTCAA TCAACTTTTGTAACAATCAT *************************************** ******* ********* *** M82 GGAGTTTGAGCCAAAGATACTGGCTTTAGCCGAGCCCATACCTCCCTAGTCCCTCCACCC Heinz1706 GGAGTTTGAGCCAAAGATACTGGCTTTAGCCGAGCCCATACCTCCCTAGTCCCTCCACCC S.pennellii GGAATTTGAGCCAAAGATACTGGCTTTAGCCGAGCCCATACCTCCCTAGTCCCTCCACCC *** ******************************************************** M82 CTACTAGGATGAGGCATTGCCTCTTCACGATTTGGATGTATAGCTATTGGACTATATAAC Heinz1706 CTACTAGGATGAGGCATTGCCTCTTCACGATTTGGATGTATAGCTATTGGACTATATAAC S.pennellii CTACTAGGATGAGGCATTGCCTCTT CACGATTTGGATGTATAGCTATTGGACTATATAAC ************************************************************ M82 CATAGT ------AACATGTTTTATTGCACAAGTTCTTTTAAGCCATTGAATTAGCAAAG Heinz1706 CATAGT ------AACATGTTTTATTGCACAAGTTCTTTTAAGCCATTGAAT TAGCAAAG S.pennellii CATAGTCCATAGTAACATGTTTTATTGCACAAGTTCTTTTAAGCCATTGAATTAGCAAAG ****** *********************************************** M82 ATATGGATTTACTTGAAAGCATTTGATATACATTAACTTCCAACTGCTAATGAGAACATA Heinz1706 ATA TGGATTTACTTGAAAGCATTTGATATACATTAACTTCCAACTGCTAATGAGAACATA S.pennellii ATATGGATTTACTTGAAAGCATTTGATATACATTAACTTCCAACTGCTAACGAGAACATA ************************************************** ********* M82 TTGAAGGTGAGGAAATGAAAAGACAATATA CAGATAAGCACATATATAGACATAGTTCAG Heinz1706 TTGAAGGTGAGGAAATGAAAAGACAATATACAGATAAGCACATATATAGACATAGTTCAG S.pennellii TTGAAGGTGAGGAAATGAAAAGACAATATACAGATAAGCACATATATAGACATAGTTCAG ********************************************************** ** M82 TTGGGTTTTATTCTGTTAGAATAAAAAGACAAAAGATCGAAGCAGAGTTTACATTTTGAA Heinz1706 TTGGGTTTTATTCTGTTAGAATAAAAAGACAAAAGATCGAAGCAGAGTTTACATTTTGAA S.pennellii TTGG TTTTATTCTGTTAGAATAAAAAGACAAAAGATCGAAGCAGAGTTTACATTTTGAA **** **** *************************************************** M82 GAGCAAAGCTGCAAGATTGCTCAACTGAAATCTATTTTGACCATGTCTCTGCAGCAGCAT Heinz1706 GAGCAAAGCTGCAAGATTGCTCAACTGAAATCTATTTTGACCATGTCTCTGCAGCAGCAT S.pennellii GAGCAAAGCTGCAAGATTGCTCAACTGAAATCTATT TTGACCATGTCTCTGCAGCAGCAT ************************************************************ M82 CGGACTATGTTTCCATTTAGCTGCTCCCAAGAATATCCTTGTACAATTCCTTGATTTTTG Heinz1706 CGGACTATGTTTCCATTTAGCTGCTCCCAAGAATATCCTTGTACAATTCCTTGATTTTTG S. pennellii CGGACTATGTTTCCATTTAGCTGCTCCCAAGAATATCCTTGTATAATTCCTTGATTTTTG ******************************************* **************** M82 CTATCAAAGCTTCTCTGTTAGCAGCAAAAGGTAATAAGAAGAGAGGTAAGCTAGGATGAA Heinz1706 CTATCAAAGCTTCT CTGTTAGCAGCAAAAGGTAATAAGAAGAGAGGTAAGCTAGGATGAA S.pennellii CTATCAAAGCTTCTCTGTTAGCAGCAAAAGGTAATAAGAAGAGAGGTAAGCTAGGATGAA ************************************************************ M82 CACACAAAGGTATGAATAATAAACTTAACTTCCACTAGTTC ATATACAAAGGAACGGAAA Heinz1706 CACACAAAGGTATGAATAATAAACTTAACTTCCACTAGTTCATATACAAAGGAACGGAAA S.pennellii CACACAAAGGTATGAATAATAAACTTAACTTCCACTAGTTCATATACAAAGGAACGGAAA ************************************************************ M82 TAACCTGTCAGGTTTGAAGATCAAGTTCTTGTAGGCAAACCACTGCAGAGGAAGGGAAGA Heinz1706 TAACCTGTCAGGTTTGAAGATCAAGTTCTTGTAGGCAAACCACTGCAGAGGAAGGGAAGA S.pennellii TAACCTGTCAGGTTTGAAGATCAAGTTCTTGTAGGCAAACCACTGCAGAGGAAGGGAAGA ******************** ****************************************

PAGE 82

82 M82 TCCCCCAAAAACGTGTAAATGAAGTCAAGATAACATGGTAATCGATTATATAGTTCAAAG Heinz1706 TCCCCCAAAAACGTGTAAATGAAGTCAAGATAACATGGTAATCGATTATATAGTTCAAAG S.pennellii TCCCCCAAAAACGTGTAAATGAAGTCAAGATAACATGGTAATCGATT ATATAGTTCAAAG ************************************************************ M82 TTTAACCAAACAAGCATTGATGAAGCCTGATGCTAATGCCTATGCAATATGGTTCAAAGA Heinz1706 TTTAACCAAACAAGCATTGATGAAGCCTGATGCTAATGCCTATGCAATATGGTTCAAAGA S.pennellii TTTAACCAAACAAGCATTGATGAAGCCTGATGCTAATGCCTATGCAATATGGTTCAAAGA ************************************************************ M82 AAGGATTTAACTTAAGTATAACGTTTATTTTTTACCCTATCAGTGTAATTATTGGTTATA Heinz1706 AAGGATTTAACTTAAGTATAACGTT TATTTTTTACCCTATCAGTGTAATTATTGGTTATA S.pennellii AAGGATTTAACTTAAGTATAACGTTTATTTTTTACCCTATCAGTGTAATTATTGGTTATA ************************************************************ M82 GCATTCAGGTTACAACATACAGAGTAGTGGCTAAGAGTGAAAATATTTCAAC TTACACCG Heinz1706 GCATTCAGGTTACAACATACAGAGTAGTGGCTAAGAGTGAAAATATTTCAACTTACACCG S.pennellii GCATTCAGGTTACAACATACAGAGTAGTGGTTAAGAGTGAAAATATTTCAACTTACACCG ****************************** ***************************** M82 GTG TAACCAATTCCTACAAGCTCAAGAACACCAGGAATCAAAGGAAGCCTGTCAATTGCC Heinz1706 GTGTAACCAATTCCTACAAGCTCAAGAACACCAGGAATCAAAGGAAGCCTGTCAATTGCC S.pennellii GTGTAACCAATTCCTACAAGCTCAAGAACACCAGGAATCAAAGGAAGCCTGTCAATTGCC ******************************* ***************************** M82 TGCCACAATTAAGCAAGTCCCTTTGTCAAAGTTTGTTATAGTTTGCAACACCTGAACTAA Heinz1706 TGCCACAATTAAGCAAGTCCCTTTGTCAAAGTTTGTTATAGTTTGCAACACCTGAACTAA S.pennellii TGCCACAATTAAGCAAGTCCCTTTGTCAA GTTTGTTATAGTTTGCAACACCTGAACA AA ***************************** *************************** ** M82 AATGGAACTAAAAAA GTCTTAAGGTAGCAATTAGTAGCAGTA Heinz1706 AATGGAACTAAAAAA GTCTTAAGGTAGCAATTAGTAGCAGTA S.pennellii AATGGAACTAAAAAAAGTCTTAAGGTAGCAATTAGTAGCAGTA *********** **** **************************

PAGE 83

83 LIST OF REFERENCES lvarez Rodrguez, M.L., Belloch, C., Villa, M., Uruburu, F., Larriba, G. and Coque, J. R. (2003) Degradation of vanillic acid and production of guaiacol by microorganisms isol ated from cork samples. FEMS Microbiol. Lett., 220 (1), 49 55. Bai, Y. and Lindhout, P. (2007) Domestication and breeding of tomatoes: What have we gained and what can we gain in the future? Ann Bot. 100 (5), 1085 1094. Baldwin, E.A. (2002) Fruit flavor, v olatile metabolism, and consum er perceptions. In (M. Knee, ed) Boca Raton, FL: CRC Press. Baldwin, E.A., Nisperos Carriedo, M. O. and Moshonas, M. G. (1991) Quantitative analysis of flavor and other volatiles and for certain constituents of two tomato cult ivars during ripening. J Am Soc Hort. Sci 116 (2), 265 269. Baldwin E A Scott J W Einstein M A Malundo T M M Carr B T Shewfelt R L and Tandon K S. ( 1998 ) Relationship between sensory and instrumental analysis for tomato flavor. J Am Soc Hort Sci 123 906 15. Baldwin, E.A., Scott, J. W., Shewmaker, C. K. and Schuch, W. (2000) Flavor trivia and tomato aroma: Biochemistry and possible mechanisms for control of important aroma components. HortScience, 35 (6), 1013 1022. Baldwin, E.A., G oodner, K. and Plotto, A. (2008) Interaction of volatiles, sugars, and acids on perception of tomato aroma and flavor descriptors. J. Food Sci., 73 (6), S294 S307. Biggs M S Harriman R W and Handa A K (1986) Changes in gene expression during tomato fruit ripening. Plant Physiol ., 81 395 403 B (2009) Changes in volatiles and glycosides during fruit maturation of two contrasted tomato ( S olanum lycopersicum ) lines. J. Agric. Food Chem., 57 (2), 591 598. Boss, W.F., Sederoff, H. W., Im, Y. J., Moran, N., Grunden, A. M. and Perera, I. Y. (2010) Basal signaling regulates plant growth and development. Plan t Physiol 154 (2), 439 443. Bowles, D., Lim, E., Poppenberger, B. and Vaistij, F. E. (2006) Glyosyltransferase of lipophilic small m olecules. A nnu. Rev. Plant Biol. 57 (1), 567 597. Bowles, D., Isayenkova, J., Lim, E. and Poppenberger, B. (2005) Glycosyltransferases: Managers of small molecules. Curr Opin Plant Biol 8 (3), 254 263.

PAGE 84

84 Bramley, P M. (2002) Regulation of carotenoid forma tion during tomato fruit ripening and development J. Exp. Bot 53 (377), 2107 2113 Brazier Hicks, M., Offen, W. A., Gershater, M. C., Revett, T. J., Lim, E., Bowles, D. J., Davies, G. J. and Edwards, R. (2007) Characterization and engineering of the bifu nctional N and O glucosyltransferase involved in xenobiotic metabolism in plants. PNAS 104 (51), 20238 20243. Buttery, R.G., Teranishi, R. and Ling, L. C. (1987) Fresh tomato aroma volatiles: A quantitative study. J. Agric. Food Chem., 35 (4), 540 544. But tery, R.G., Takeoka, G., Teranishi, R. and Ling, L. C. (1990) Tomato aroma components: Identification of glycoside hydrolysis volatiles. J. Agric. Food Chem., 38 (11), 2050 2053. Buttery, R.G., Teranishi, R., Ling, L. C., Flath, R. A. and Stern, D. J. (1988 ) Quantitative studies on origins of fresh tomato aroma volatiles. J. Agric. Food Chem., 36 (6), 1247 1250. B uttery R., T eranishi R., F lath R. and L ing L. (1989) Fresh tomato volatiles composition and sensory studies. ACS Symp. Ser., 388 213 222. Cab rita, M.J., Freitas, A. M. C., Laureano, O. and Stefano, R. D. (2006) Glyc osidic aroma compounds of some P ortuguese grape cultivars. J. Sci. Food Agric., 86 (6) 922 931 Campbell, J., Davies, G., Bulone, V. and Henrissat, B. (1997) A classification of nucl eotide diphospho sugar glycosyltransferases based on amino acid sequence similarities. Biochem. J., 326 ( 3), 929 942 Cartwright, A.M., Lim, E., Kleanthous, C. and Bowles, D. J. (2008) A kinetic analysis of regiospecific glucosylation by two glycosyltransfe rases of A rabidopsis thaliana : Domain swapping to introduce new activities J. Biol. Chem., 283 (23), 15724 15731. Chen, G., Hackett, R., Walker, D., Taylor, A., Lin, Z. and Grierson, D. (2004) Identification of a specific isoform of tomato lipoxygenase (Tom loxC) involved in the generation of fatty acid derived flavor compounds. Plan t Physiol. 136 (1), 2641 2651. Collendavelloo, J., Legrand, M., Geoffroy, P., Barthelemy, J. and Fritig, B. (1981) Purificati on and properties of the three O diphenol O methyltran sferases of tobacco leaves. Phytochemistry, 20 (4), 611 616.

PAGE 85

85 Dal Cin, V., Tieman, D. M., Tohge, T., McQuinn, R., de Vos, R. C. H., Osorio, S., Schmelz, E. A., Taylor, M. G., Smits Kroon, M. T., Schuurink, R. C., Haring, M. A., Giovannoni, J., Fernie, A. R. and Klee, H. J. (2011) Identification of genes in the phenylalanine metabolic pathway by ectopic expression of a MYB transcription factor in tomato fruit. Plant Cell, 23 (7), 2738 2753. Dorfner, R., Ferge, T., Kettrup, A., Zimmermann, R. and Yeretzian, C. ( 2003) Real time monitoring of 4 vinylguaiacol, guaiacol, and phenol during coffee roasting by resonant laser ionization time of flight mass spectrometry. J. Agric. Food Chem., 51 (19), 5768 5773. Ellis, B.E. and Towers, G. H. N. (1969) The biogenesis of cat echol in G aultheria Phytochemistry, 8 (8), 1415 1417. Eshed, Y. and Zamir, D. (1995) An introgression line population of L ycopersicon pennellii in the cultivated tomato enables the identification and fine mapping of yield associated QTL. Genetics, 141 (3), 1147 1162. E shed Y. and Z amir D. (1994) A genomic library of L ycopersicon pennellii in L ycopersicon esculentum a tool for fine mapping of genes. Euphytica, 79 (3), 175 179. Eudes, A., Bozzo, G. G., Waller, J. C., Naponelli, V., Lim, E., Bowles, D. J., G regory, J. F.,III and Hanson, A. D. (2008) Metabolism of the folate precursor p aminobenzoate in plants: Glucose ester formation and vacuolar storage J. Biol. Chem., 283 (22), 15451 15459. Evans, W.C., Smith, B. S. W., Linstead, R. P. and Elvidge, J. A. (19 51) Chemistry of the oxidative metabolism of certain aromatic compounds by micro organisms. Nature, 168 (4279), 772 775. Felsenstein J. (1985) Confidence limits on phylogenies: An approach us ing the bootstrap. Evolution 39 783 791. Frary, A., Keles, D., P inar, H., Gol, D. and Doganlar, S. (2011) NaCl tolerance in L ycopersicon pennellii introgression lines: QTL related to physiological responses. Biol. Plant., 55 (3), 461 468. Gaffney, T., Friedrich, L., Vernooij, B., Negrotto, D., Nye, G., Uknes, S., Ward, E., Kessmann, H. and Ryals, J. (1993) Requirement of salicylic acid for the induction of systemic acquired resistance. Science, 261 (5122), 754 756. Gang, D.R. (2005) E volution of Flavors and Scents Annu. Rev. Plant Biol., 56 (1), 301 325.

PAGE 86

86 Gang, D.R., Lavid N., Zubieta, C., Chen, F., Beuerle, T., Lewinsohn, E., Noel, J. P. and Pichersky, E. (2002) Characterization of phenylpropene O methyltransferases from sweet basil: Facile change of substrate specificity and convergent evolution within a plant O methyltr ansferase family. Plant Cell 14 (2), 505 519. Goff, S.A. and Klee, H. J. (2006) Plant volatile compounds: Sensory cues for health and nutritional value? Science, 311 (5762), 815 819. Gonda, I., Bar, E., Portnoy, V., Lev, S., Burger, J., Schaffer, A. A., Tad mor, Y., Gepstein, S., Giovannoni, J. J., Katzir, N. and Lewinsohn, E. (2010) Branched chain and aromatic amino acid catabolism into a roma volatiles in C ucumis melo L. fruit. J Exp Biol 61 (4), 1111 1123. Groyne, J., Lognay, G. and Marlier, M. (1999) Ac cumulation of glycosidically bound compounds in F ragaria x ananassa cv. elsanta fruits at various developmental stages. Biotechnol Agron Soc 3 5 9. Guillen, M.D., Manzanos, M. J. and Zabala, L. (1995) Study of a commercial liquid smoke flavoring by me ans of gas Chromatography/Mass spectrometry and fourier transform infrared spectroscopy. J. Agric. Food Chem., 43 (2), 463 468. Gustafson, F.G. (1934) Production of alcohol and acetaldehyde by tomatoes. Plant Physiol., 9 (2), 359 367. Hayasaka, Y., Baldock, G. A., Pardon, K. H., Jeffery, D. W. and Herderich, M. J. (2010) Investigation into the formation of guaiacol conjugates in b erries and leaves of grapevine V itis vinifera L. cv. cabernet sauvignon using stable isotope tracers combined with HPLC MS and MS/M S analysis. J. Agric. Food Chem., 58 (4), 2076 2081. Hayashi, S., Yagi, K., Ishikawa, T., Kawasaki, M., Asai, T., Picone, J., Turnbull, C., Hiratake, J., Sakata, K., Takada, M., Ogawa, K. and Watanabe, N. (2004) Emission of 2 phe glucopyranoside and the biogenesis of these compounds from [ 2 H 8 ] phenylalanine in rose flowers. Tetrahedron, 60 (33), 7005 7013. Jean Pierre, M. (2002) Recent breakthroughs in the study of salicylic acid biosynthesis. Trends Plant Sci ., 7 (8), 332 334. Johnson, J.H., Gould, W. A., Badenhop, A. and Johnson, R. M. (1968) Quantitative comparison of isoamylol, pentanol, and 3 hexen 1 ol in tomato juice : varietal and harvest differences and processing effects. J. Agric. Food Chem., 16 (2), 25 5 258. Jones, P. and Vogt, T. (2001) Glycosyltransferases in secondary plant metabolism: Tranquilizers and stimulant controllers. Planta, 213 (2), 164 174.

PAGE 87

87 Jones, R.J. and Scott, S. J. (1983) Improvement of tomato flavor by genetically increasing sugar and acid content. Euphytica, 32 845 855. Kagey, M.H., Newman, J. J., Bilodeau, S., Zhan, Y., Orlando, D. A., van Berkum, N. L., Ebmeier, C. C., Goossens, J., Rahl, P. B., Levine, S. S., Taatjes, D. J., Dekker, J. and Young, R. A. (2010) Mediator and cohesin connect gene expression and chromatin architecture. Nature, 467 (7314), 430 435. Kaminaga, Y., Schnepp, J., Peel, G., Kish, C. M., Ben Nissan, G., Weiss, D., Orlova, I., Lavie, O., Rhodes, D., Wood, K., Porterfield, D. M., Cooper, A. J. L., Schloss, J. V., Pichersky, E., Vainstein, A. and Dudareva, N. (2006) Plant phenylacetaldehyde synthase is a bifunctional homotetrameric enzyme that catalyzes phenylalanine decarboxylation and oxidation. J. Biol Chem 281 (33), 23357 23366. Karimi, M., Inz, D. and Depicke r, A. vectors for agrobacterium mediated plant transformation. Trends Plant Sci., 7 (5), 193 195. Katagiri, M., Yamamoto, S. and Hayaishi, O. (1962) Flavin adenine dinucleotide requirement for the enzymic hydroxvlation and decarboxyla tion o f salicylic acid. J Biol Chem 237 (7 ), 2413 2414. Klee, H.J. (2010) Improving the flavor of fresh fruits: Genomics, biochemistry, and biotechnology. New Phytol., 187 (1), 44 56. Kochevenko, A., Arajo, W.L., Maloney, G.S., Tieman, D.M., Do, P.T., Taylor, M.G., Klee, H.J. and Fernie, A.R. ( Under review ) Catabolism of branched chain amino acids supports respiration but not volatile synthesis in tomato fruits Mol. Plant Koeduka, T., Fridman, E., Gang, D. R., Vasso, D. G., Jackson, B. L., Kish, C. M., Orlo va, I., Spassova, S. M., Lewis, N. G., Noel, J. P., Baiga, T. J., Dudareva, N. and Pichersky, E. (2006) Eugenol and isoeugenol, characteristic aromatic constituents of spices, are biosynthesized via reduction of a coniferyl alcohol ester. PNAS 103 (26), 10 128 10133. Kohara, A., Nakajima, C., Yoshida, S. and Muranaka, T. (2007) Characterization and engineering of glycosyltransferases responsible for steroid saponin biosynthesis in solanaceous plants. Phytochemistry, 68 (4), 478 486. Kumazawa, K. and Masuda, H (2002) Identification of potent odorants in different green tea varieties using flavor dilution technique. J. Agric. Food Chem., 50 (20), 5660 5663. Lam, K., Ibrahim, R., Behdad, B. and Dayanandana, S. (2007) Structure, function, and evolution of plant O methyltransferases. Genome, 50 (11), 1001 1013.

PAGE 88

88 Li, Y., Baldauf, S., Lim, E. K. and Bowles, D. J. (2001) Phylogenetic analysis of the UDP glycosylt ransferase multigene family of A rabidopsis thaliana J. Biol. Chem., 276 (6), 4338 4343. Liharska, T., Wordrag en, M. v., Kammen, A. v., Zabel, P. and Koornneef, M. (1996) Tomato chromosome 6: Effect of alien chromosomal segments on recombinant frequencies. Genome, 39 (3), 485 491. Lim, E.K. and Bowles, D. J. (2004) A class of plant glycosyltransferases involved in cellular homeostasis. EMBO J., 23 2915 2922. Lim, E., Doucet, C. J., Li, Y., Elias, L., Worrall, D., Spencer, S. P., Ross, J. and Bowles, D. J. (2002) The activity of A rabidopsis glycosyltransferases toward salicylic acid, 4 hydroxybenzoic acid, and other benzoates. J. Biol. Chem., 277 (1), 586 592. Lim, E., Baldauf, S., Li, Y., Elias, L., Worrall, D., Spencer, S. P., Jackson, R. G., Taguchi, G., Ross, J. and Bowles, D. J. (2003) Evolution of substrate recognition across a multigene fam ily of glycosyltransf erases in A rabidopsis Glycobiology, 13 (3), 139 145. Marlatt, C., Ho, C. T. and Chien, M. (1992) Studies of aroma constituents bound as glycosides in tomato. J. Agric. Food Chem., 40 (2), 249 252. Masada, S., Terasaka, K. and Mizukami, H. (2007) A single am ino acid in the PSPG box plays an important role in the catalytic function of CaUGT2 (curcumin glucosyltransferase), a group D fam ily 1 glucosyltransferase from C atharanthus roseus FEBS Lett., 581 (14), 2605 2610. M atheis G. (1983) Enzymatic browning of f oods quantitative relationships between browning and food constituents. Z. Lebensm. Unters. Forsch., 176 (6), 454 462. Mathieu, S., Dal Cin, V., Fei, Z., Li, H., Bliss, P., Taylor, M. G., Klee, H. J. and Tieman, D. M. (2009) Flavour compounds in tomato fr uits: Identification of loci and potential pathways affecting volatile composition. J. Exp. Bot., 60 (1), 325 337. Matsui, K. (2006) Green leaf volatiles: Hydroperoxide lyase pathway of oxylipin metabolism. Curr. Opin. Plant Biol., 9 (3), 274 280. Maury, S., Geoffroy, P. and Legrand, M. (1999) Tobacco O methyltransferases involved in phenylpropanoid metabolism. the different caffeoyl coenzyme A/5 hydroxyferuloyl coenzyme A 3/5 O methyltransferase and caffeic Acid/5 hydroxyferulic acid 3/5 O methyltransferase classes have distinct substrate specificities and expression patterns. Plant Physiol 121 (1), 215 224.

PAGE 89

89 McCormick, S., Niedermeyer, J., Fry, J., Barnason, A., Horsch, R. and Fraley, R. (1986) Leaf disc transformation of cultivated tomato ( L. esculentum ) us ing A grobacterium tumefaciens Plant Cell Reports, 5 (2), 81 84. Miller, J.C. and Tanksley, S. D. (1990) RFLP analysis of phylogenetic relationships and genetic variation in the genus L ycopersicon TAG, 80 (4), 437 448. Morse, A.M., Tschaplinski, T. J., Derv inis, C., Pijut, P. M., Schmelz, E. A., Day, W. and Davis, J. M. (2007) Salicylate and catechol levels are maintained in n ahG transgenic poplar. Phytochemistry, 68 (15), 2043 2052. Noel, J.P., Dixon, R. A., Pichersky, E., Zubieta, C. and Ferrer, J. (2003) C hapter two structural, functional, and evolutionary basis for methylat ion of plant small molecules. Recent Adv Phytochem 37 37 58. Oka, N., Ohishi, H., Hatano, T., Hornberger, M., Sakata, K. and Watanabe, N. (1999) Aroma evol ution during flower opening in R osa damascena mill. Z Naturforsch C 54 (12), 889 895. Ortiz Serrano, P. and Gil, J. V. (2007) Quantitation of free and glycosidically bound volatiles in and effect of glycosidase addit ion on three tomato varieties ( S olanum lycopersicum L.). J. Agric Food Chem., 55 (22), 9170 9176. Osbourn, A.E. (2003) Saponins in cereals. Phytochemistry, 62 (1), 1 4. Osmani, S.A., Bak, S. and Mller, B. L. (2009) Substrate specificity of plant UDP dependent glycosyltransferases predicted from crystal structures and ho mology modeling. Phytochemistry, 70 (3), 325 347. Paquette, S., Mller, B. L. and Bak, S. (2003) On the origin of family 1 plant glycosyltransferases. Phytochemistry, 62 (3), 399 413. Pellegrini, L., Geoffroy, P., Fritig, B. and Legrand, M. (1993) Molecular cloning and expression of a new class of ortho diphenol O methyltr ansferases induced in tobacco ( N icotiana tabacum L.) leaves by infection or elicitor treatment. Plant Physiology, 103 (2), 509 517. Peralta, I.E., Knapp, S. and Spooner, D. M. (2006) Nomencla ture for wild and cultivated tomatoes. Report of the Tomato Genetics Cooperative, 56 6 12. Petro Turza, M. (1986) Flavor of tomato and tomato products. Food Reviews International, 2 (3), 309 351. Picone, J.M., Clery, R. A., Watanabe, N., MacTavish, H. S. a nd Turnbull, C. G. N. (2004) Rhythmic emi ssion of floral volatiles from R osa damascena semperflorens Planta, 219 (3), 468 478.

PAGE 90

90 Richins, R.D., Scholthof, H. B. and Shepherd, R. J. (1987) Sequence of figwort mosaic virus DNA (caulimovirus group). Nucleic Acids Res 15 (20), 8451 8466. Rick, C.M. (1960) Hybridization between Lycopersicon esculentum and Solanum pennellii phylogenetic and cytogenetic significance. PNAS 46 (1), 78 82. R ick C. and Y oder J. (1988) Classical and molecular gen etics of tomato highlights and perspectives. Annu. Rev. Genet., 22 281 300. Riley, J.C.M., Willemot, C. and Thompson, J. E. (1996) Lipoxygenase and hydroperoxide lyase activities in ripening tomato fruit. Postharvest Biol. Technol., 7 (1 2), 97 107. Ross J., Li, Y., Lim, E. and Bowles, D. J. (2001) Higher plant glycosyltransferases. Genome Biol., 2 (2), reviews3004.1 3004.6 Saitou N. and Nei M. (1987) The neighbor joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. and Evol ., 4 406 425. Schauer, N., Semel, Y., Roessner, U., Gur, A., Balbo, I., Carrari, F., Pleban, T., Perez Melis, A., Bruedigam, C., Kopka, J., Willmitzer, L., Zamir, D. and Fernie, A. R. (2006) Comprehensive metabolic profiling and phenotyping of interspecific introgression lines for tomato improvement. Nat. Biotechnol., 24 (4), 447 454. Serra Bonveh J. and Ventura Coll, F. (1998) Evaluation of smoky taste in cocoa powder. J. Agric. Food Chem., 46 (2), 620 624. Shao, H., He, X., Achnine, L., Blount, J. W., Dixo n, R. A. and Wang, X. (2005) Crystal structures of a multifunctional Triterpene/Flav onoid glycosyltransferase from M edicago truncatula Plant Cell, 17 (11), 3141 3154. Simkin, A.J., Schwartz, S. H., Auldridge, M., Taylor, M. G. and Klee, H. J. (2004) The to mato ca r otenoid cleavage dioxygenase 1 genes contribute to the formation of the flavor volatiles ionone, pseudoionone, and geranylacetone. Plant J 40 (6), 882 892. Speirs, J., Lee, E., Holt, K., Yong Duk, K., Scott, N. S., Loveys, B. and Schuch, W. (199 8) Genetic manipulation of alcohol dehydrogenase levels in ripening tomato fruit affects the balance of some flavor aldehydes and alcohols. Plan t Physiol., 117 (3), 1047 1058. Steinhauser, M., Steinhauser, D., Gibon, Y., Bolger, M., Arrivault, S., Usadel, B ., Zamir, D., Fernie, A. R. and Stitt, M. (2011) Identification of enzyme activit y quantitative trait loci in a S olanum lycopersicum x S olanum pennellii introgression line population. Plan t Physiol [Epub ahead of print]

PAGE 91

91 Subba Rao, P.V., Moore, K. and To wers, G. H. N. (1967) The conversion of tryptophan to 2,3 dihydro xybenzoic acid and catechol by A spergillus niger Biochem. Biophys. Res. Commun., 28 (6), 1008 1012. Tadmor, Y., Fridman, E., Gur, A., Larkov, O., Lastochkin, E., Ravid, U., Zamir, D. and Lewi nsohn, E. (2002) Identification of malodorous, a wild species allele affecting tomato aroma that was selected against during domestication. J. Agric. Food Chem., 50 (7), 2005 2009. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and Kumar, S. ( 2011) MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol and Evol 28 (10), 2731 2739 Tanksley, S.D. (2004) The genetic, developmental, and molecular bases of fruit s ize and shape variation in tomato. Plant Cell, 16 S181 S189. Tieman, D.M., Loucas, H. M., Kim, J. Y., Clark, D. G. and Klee, H. J. (2007) Tomato phenylacetaldehyde reductases catalyze the last step in the synthesis of the aroma volatile 2 phenylethanol. P hytochemistry, 68 (21), 2660 2669. Tieman, D.M., Taylor, M., Schauer, N., Fernie, A. R., Hanson, A. D. and Klee, H. J. (2006b) Tomato aromatic amino acid decarboxylases participate in synthesis of the flavor volatiles 2 phenylethanol and 2 phenylacetaldehyd e. PNAS 103 (21), 8287 8292. Tieman, D.M., Zeigler, M., Schmelz, E. A., Taylor, M. G., Bliss, P., Kirst, M. and Klee, H. J. (2006a) Identification of loci affecting flavour volatile emissions in tomato fruits. J. Exp. Bot., 57 (4), 887 896. Tieman, D., Zeig ler, M., Schmelz, E., Taylor, M. G., Rushing, S., Jones, J. B. and Klee, H. J. (2010) Functional analysis of a tomato salicylic acid methyl transferase and its role in synthesis of the flavor volatile methyl salicylate. Plant J 62 (1), 113 123. Tikunov, Y .M., de Vos, R. C. H., Gonzlez Params, A. M., Hall, R. D. and Bovy, A. G. ( 2010) A role for differential glycoconjugation in the emission of phenylpropanoid volatiles from tomato fruit discovered using a metabolic data fusion approach. Plant Physiol 15 2 (1), 55 70. Ugliano, M. and Moio, L. (2008) Free and hydrolytically released volatile compounds of vitis vinifera L. cv. fiano grapes as odour active constituents of fiano wine. Anal Chim Acta, 621 (1), 79 85.

PAGE 92

92 Van Wees, S.C.M. and Glazebrook, J. (2003) L oss of non host res istance of Arabidopsis n ahG to P seudomonas syringae pv. phaseolicola is due to degradation products of salicylic acid. Plant J 33 (4), 733 742. Verdonk, J., Haring, M., van Tunen, A. and Schuurink, R. (2005) ODORANT1 regulates fragranc e biosynthesis in petunia flowers. Plant Cell, 17 (5), 1612 1624. Verlaan, M.G., Szinay, D., Hutton, S. F., de Jong, H., Kormelink, R., Visser, R. G., Scott, J. W. and Bai, Y. (2011) Chromosomal rear rangements between tomato and Solanum chilense hamper mapp ing and breeding of the TYLCV resistance gene ty 1. Plant J [ Epub ahead of print ] Vogel, J.T., Tan, B. C., McCarty, D. R. and Klee, H. J. (2008) The carotenoid cleavage dioxygenase 1 enzyme has broad substrate specificity, cleaving multiple carotenoids a t two different bond positions. J. Biol. Chem., 283 11364 11373. Vogt, T. and Jones, P. (2000) Glycosyltransferases in plant natural product synthesis: Characterization of a supergene family. Trends Plant Sci., 5 (9), 380 386. Voinnet, O., Rivas, S., Mestr e, P. and Baulcombe, D. (2003) An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J 33 (5), 949 956. Wang, J., Dudareva, N., Bhakta, S., Raguso, R. A. and Pichersk y, E. (19 97) Floral scent production in C larkia breweri (onagraceae) II. localization and developmental modulation of the enzyme S adenosyl L methionine:(iso)eugenol O methyltransfera se and phenylpropanoid emission Plant Physiol 114 (1), 213 221. Watanab e, S., Hashimoto, I., Hayashi, K., Yagi, K., Asai, T., Knapp, H., Straubinger, M., Winterhalter, P. and Watanabe, N. (2001) Isolation and identification of 2 phenylethyl disaccharide glycosides and mono glycosides from rose flowers, and their potential rol e in scent formation. Biosci. Biotechnol. Biochem., 65 (2), 442 445. Wein, M. Lavid, N., Lunkenbein, S., Lewinsohn, E., Schwab, W. and Kaldenhoff, R. (2002) Isolation, cloning and expression of a multifunctional O methyltransferase capable of forming 2,5 d imethyl 4 methoxy 3(2H) furanone, one of the key aroma compounds in strawberry fruits. Plant J., 31 (6), 755 765. Weis, M., Lim, E., Bruce, N. C. and Bowles, D. J. (2008) Engineering and kinetic characterisation of two glucosyltransferases from A rabidopsis thaliana Biochimie, 90 (5), 830 834. Withopf, B., Richling, E., Roscher, R., Schwab, W. and Schreier, P. (1997) Sensitive and selective screening for 6' O malonylated glucoconjugates in plants. J. Agric. Food Chem., 45 (3), 907 911.

PAGE 93

93 Yamamoto, S., Katagiri, M., Maeno, H. and Hayaishi, O. (1965) Salicylate hydroxylase, a monooxygenase requiring flavin adenine dinucleotide. J .Bi ol Chem 240 (8), 3408 3413. Zanor, M.I., Rambla, J., Chab, J., Steppa, A., Medina, A., Granell, A., Fernie, A. R. and Causse, M. (20 09) Metabolic characterization of loci affecting sensory attributes in tomato allows an assessment of the influence of the levels of primary metabolites and volatile organic contents. J Exp Bot 60 (7), 2139 2154. Zheng, L.T., Ryu, G., Kwon, B., Lee, W. and Suk, K. (2008) Anti inflammatory effects of catechols in lipopolysaccharide stimulated microglia cells: Inhibition of microglial neurotoxicity. Eur. J. Pharmacol., 588 (1), 106 113. Zierler, B., Siegmund, B. and Pfannhauser, W. (2004) Determination of o ff flavour compounds in apple juice caused by microorganisms using headspace solid phase microextraction gas chromatography mass spectrometry. Anal. Chim. Acta, 520 (1 2), 3 11. Zuckerkandl, E. and Pauling, L. (1965) Evolutionary divergence and convergence in proteins. Edited in Evolving Genes and Proteins by V. Bryson and H.J. Vogel, pp. 97 166. Academic Press, New York.

PAGE 94

94 BIOGRAPHICAL SKETCH Melissa Hamner Ma geroy grew up in San Antonio, Texas She attended Trinity University in San Antonio, where she majo red in biology. During her time at Trinity she took part in undergraduate research and was award a Summer Undergraduate Research Fellowship from the American Society of Plant Biology. This experience sparked her interest in plant biology and her desire to pursue a PhD in the field. After graduating from Trinity in 2007, she enter ed the Plant Molecular and Cellular Biology Graduate program at the University of Florida. Sinc e that time, she has been studying enzyme s that are important in the synthesis and reg ulation of tomato flavor molecules in the lab of Dr. Harry J. Klee. After graduating, she will be moving to Vancouver, B ritish Columbia to begin a post doctoral position in the lab of Joerg Bohlmann.