<%BANNER%>

Molecular Mechanisms for the Constitutive Activation of Jak2 Mutations

Permanent Link: http://ufdc.ufl.edu/UFE0043569/00001

Material Information

Title: Molecular Mechanisms for the Constitutive Activation of Jak2 Mutations
Physical Description: 1 online resource (209 p.)
Language: english
Creator: Gnanasambandan, Kavitha
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: allosteric -- exon12 -- inhibitors -- jak2 -- mpn -- mutations -- v617f
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Jak2 tyrosine kinase plays a critical role in hematopoiesis and is essential for life. Constitutive activation of Jak-STAT signaling through Jak2 mutations have been linked to leukemia and myeloproliferative neoplasms (MPNs). In the case of a predominant Jak2 mutation, V617F, we identified that mutant F617 interacts with the adjacent F595 through a pi stacking mechanism. Mutation of F594 and F595 to A reduced the activation levels of Jak2-V617F to that of Jak2-WT. Thus, a pi stacking interaction between F617 and F595 was found to be critical for the constitutive activation of Jak2-V617F. We then examined the mechanism for the constitutive activation of the Jak2 exon 12 mutation, H538Q/K539L. Data obtained from Jak2 MD simulations indicated that the mutation of K539 to L shifted the salt bridge interaction of D620 and E621 with K539 to the adjacent R541. Mutation of R541 to A in vitro, reduced the activation of Jak2-H538Q/K539L by 50% and the mutation of R541 to D or E completely reduced the activation of Jak2-H538Q/K539L back to Jak2-WT levels. Thus, the shift in salt bridge interaction of D620 and E621 from K539 to R541 was found to be important for the constitutive activation of Jak2-H538Q/K539L. Activation of Jak2 can also be regulated by phosphorylation on the multiple tyrosine residues that are present throughout the kinase. Using ESI mass spectrometry, we identified that Jak2 was phosphorylated on Y372 and Y373. Among the two, only Y372 was found to be important for Jak2 activation. Y372F mutation abrogated receptor bound ligand dependent, but not hydrogen peroxide dependent Jak2 activation. Y372F did not affect Jak2-receptor co-association. However, it disrupted dimerization dependent Jak2 activation in the presence of SH2B-?. Thus, phosphorylation of Jak2 at Y372 was found to be important for Jak2 dimerization and activation in the case of receptor bound ligands. Overall, data from these studies indicate that exon 14 and exon 12 Jak2 mutations cause constitutive activation by disrupting JH2-mediated autoinhibition on JH1. Phosphorylation of Jak2 at Y372 was found to be important for receptor-bound ligand dependent Jak2 dimerization and activation. Thus, Jak2 regulation is important for maintaining physiological levels of Jak-STAT signaling.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Kavitha Gnanasambandan.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Sayeski, Peter P.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043569:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043569/00001

Material Information

Title: Molecular Mechanisms for the Constitutive Activation of Jak2 Mutations
Physical Description: 1 online resource (209 p.)
Language: english
Creator: Gnanasambandan, Kavitha
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: allosteric -- exon12 -- inhibitors -- jak2 -- mpn -- mutations -- v617f
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Jak2 tyrosine kinase plays a critical role in hematopoiesis and is essential for life. Constitutive activation of Jak-STAT signaling through Jak2 mutations have been linked to leukemia and myeloproliferative neoplasms (MPNs). In the case of a predominant Jak2 mutation, V617F, we identified that mutant F617 interacts with the adjacent F595 through a pi stacking mechanism. Mutation of F594 and F595 to A reduced the activation levels of Jak2-V617F to that of Jak2-WT. Thus, a pi stacking interaction between F617 and F595 was found to be critical for the constitutive activation of Jak2-V617F. We then examined the mechanism for the constitutive activation of the Jak2 exon 12 mutation, H538Q/K539L. Data obtained from Jak2 MD simulations indicated that the mutation of K539 to L shifted the salt bridge interaction of D620 and E621 with K539 to the adjacent R541. Mutation of R541 to A in vitro, reduced the activation of Jak2-H538Q/K539L by 50% and the mutation of R541 to D or E completely reduced the activation of Jak2-H538Q/K539L back to Jak2-WT levels. Thus, the shift in salt bridge interaction of D620 and E621 from K539 to R541 was found to be important for the constitutive activation of Jak2-H538Q/K539L. Activation of Jak2 can also be regulated by phosphorylation on the multiple tyrosine residues that are present throughout the kinase. Using ESI mass spectrometry, we identified that Jak2 was phosphorylated on Y372 and Y373. Among the two, only Y372 was found to be important for Jak2 activation. Y372F mutation abrogated receptor bound ligand dependent, but not hydrogen peroxide dependent Jak2 activation. Y372F did not affect Jak2-receptor co-association. However, it disrupted dimerization dependent Jak2 activation in the presence of SH2B-?. Thus, phosphorylation of Jak2 at Y372 was found to be important for Jak2 dimerization and activation in the case of receptor bound ligands. Overall, data from these studies indicate that exon 14 and exon 12 Jak2 mutations cause constitutive activation by disrupting JH2-mediated autoinhibition on JH1. Phosphorylation of Jak2 at Y372 was found to be important for receptor-bound ligand dependent Jak2 dimerization and activation. Thus, Jak2 regulation is important for maintaining physiological levels of Jak-STAT signaling.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Kavitha Gnanasambandan.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Sayeski, Peter P.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043569:00001

Full Text

PAGE 1

MOLECUL AR MECHANISMS FOR THE CONSTITUTIVE ACTIVATION OF JAK2 MUTATIONS By KAVITHA GNANASAMBANDAN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORID A IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011 1

PAGE 2

2011 Kavitha Gnanasambandan 2

PAGE 3

To Amma and Appa, for their uncondi tional love, encouragement, and suppor t 3

PAGE 4

ACKNOWLEDGMENTS I would like to thank all the people who have supported my journey during the past four years. I am indebted to my advisor, Dr. Peter Sayeski, who was instrumental in my growth as a gr aduate student. He has provided tremendous support, encouragement and constructive criticism as and when required. The amount of freedom he provided allow ed for a comfortable and energetic environment in the lab. Peter has always been very open to talk to and has given great advice in important situations. I am thankful to Peter for being a true mentor. I would like to thank my committee me mbers Dr. Brian Cain, Dr. Robert McKenna, Dr. Joanna Long, and Dr. Brian Law for spending their valuable time in supervising my progress and providing appropriate guidance. Their comments, suggestions, and criticism were useful in designing my experiments. Additionally, I would like to acknowle dge Andrew Magis. He introduced me to molecular dynamics simulations, which became an important tool for my research. Apart from providing his experti se, he also patiently trained me to be able to run the simulations independently. I would like to thank the past member s of the Sayeski lab Jacqueline Sayyah, Robert Blair, Nick Figureoa, and Shigeharu Tsuda for their help and friendship. I would also like to thank Anurima Majumder, R ebekah Baskin, Annet Kirabo, and Dr. Sung Park for being wonder ful lab mates and friends, sharing all my good and bad times. Our lab bonding event s at lunch, coffee, and potlucks have always been filled with fun and fro lic and will remain unforgettable! 4

PAGE 5

Outside the lab, I have received wonder ful support from my friends both in the U.S.A and India. I would like to specially acknowled ge my long time buddies Sakthi, Ram, Padma, and T hulasi for being there for me always, helping me survive through the tough times, and grow as a person. Most of all, I owe immense gratitude to my family, es pecially my mom and dad. I would like to thank them for their numerous blessings and prayers. I derived my curious nature from my father who takes pride in learning about my research and asks all the toughest questions. My mother inspired me to be independent and take bold decisions when required. My parents have always had confidence in me and supported my decisions. I would also like to thank my brothers, sister-in-laws, grand parents, a ll my family members, and friends for their love and support. Ultimately, I owe a ll the success until date to the almighty! 5

PAGE 6

TABL E OF CONTENTS page ACKNOWLEDG MENTS..................................................................................................4 LIST OF FI GURES ........................................................................................................11 LIST OF OB JECTS........................................................................................................14 LIST OF ABBR EVIATIONS...........................................................................................15 ABSTRACT ....................................................................................................................16 CHAPTER 1 INTRODUC TION.....................................................................................................18 The Protein Ki nase Fam ily......................................................................................18 Conservation of Kinas e Architec ture.................................................................19 Bonding and Non-bonding Inte ractions in Protei ns...........................................20 The Role of Jak-STAT Signali ng in Cellular Function..............................................21 Structure-Function Rela tionship of Jak2..................................................................23 Regulation of Ja k2 Func tion....................................................................................25 Jak2 Regulation in cis .......................................................................................25 The Role of Tyrosine Phosphoryl ation in Jak2 Regulation................................26 Jak2 Regulation in trans ....................................................................................26 Deregulation of Jak2 Ac tivity in Disease..................................................................27 Jak2 Exon 14 Mutati ons....................................................................................28 Jak2 Exon 12 Mutati ons....................................................................................32 Jak2 Fusion Mutati ons......................................................................................33 Missing Links...........................................................................................................36 Rationa le.................................................................................................................37 2 THE CONSTITUTIVE ACTIVATION OF JAK2-V617F IS MEDIATED BY A PI STACKING INTERACTION INVOLVING PHENYLALANINES 595 AND 617 ..................................................................................................................45 Summary .................................................................................................................45 Prefac e....................................................................................................................46 Materials and Methods............................................................................................49 Homology M odeling..........................................................................................49 Molecular Dynamics Simulati ons......................................................................49 Plasmids and Reagents ....................................................................................50 Site Directed Mutagenes is................................................................................50 Cell Cult ure.......................................................................................................50 Transient Cell Transfect ions .............................................................................51 Immunoprecipit ation..........................................................................................51 6

PAGE 7

Western Blotting ................................................................................................51 Luciferase Assay...............................................................................................52 Kinase As say....................................................................................................52 Statistical Analys is............................................................................................52 Result s....................................................................................................................53 F617 Interacts with F594 and F595 in the JH2 Domain of Jak2V617F ............................................................................................................53 Potential Stacking Interaction between the Residues 617 and 595 is Stronger in Jak2-V 617F than Ja k2-WT......................................................53 Potential Stacking Interaction between 595 and 617 is Critical to the Constitutive Acti vation of Ja k2-V617F .....................................................56 F594, F595, and V617 are Conserved across Diverse Species and amongst Jak1, Jak2 and T yk2, but not Jak3..................................................57 Mutation of F594, F595 to Ala Reduced Jak2-V617F Autophosphorylation and Kinase Ac tivity.......................................................58 Interaction between F594, F595 and F617 is Important for Jak2 Dependent STAT1/3 Mediat ed Gene Transcr iption.......................................60 Interaction between F594, F595 and F617 is a Unique Property of Jak2-V617F...................................................................................................61 The Side Chain Structure and Hydr ophobicity of Amino Acids at 594 and 595 are Important for the Autophosphorylation of Jak2-V617F...............62 Validation of the Stacking Interaction between 594/595 an d 617...................64 Discussio n...............................................................................................................65 3 A SHIFT IN THE SALT BRIDGE INTERACTION OF RESIDUES D620 AND E621 FROM K539 TO R541 IS IMPORTANT FOR THE CONSTITUTIVE ACTIVATION OF JAK2 EXON 12 MUTATION, H538Q/K539L.......................................................................................................... 81 Summary .................................................................................................................81 Prefac e....................................................................................................................82 Materials and Methods............................................................................................84 Molecular Dynamics Simulati ons......................................................................84 Plasmids and Reagents....................................................................................85 Site Directed Mutagenes is................................................................................85 Cell Cult ure.......................................................................................................86 Transient Cell Transfect ions .............................................................................86 Western Blotting ................................................................................................86 Luciferase Assay...............................................................................................86 Statistical Analys is............................................................................................87 Result s....................................................................................................................87 Activation of Jak2-H538Q/K539L is not significantly different from that of Ja k2-V617F ........................................................................................87 F595A Mutation Partially Reduces the Activation of Jak2H538Q/K539L................................................................................................88 Polarity of Amino Acid 539 is Import ant for the Autoin hibition of Jak2WT.................................................................................................................89 7

PAGE 8

Jak2-H538Q/K539L and Jak2-V617F Mutati ons Affect the Active Site Conformation in both the Kinas e and Pseudokinas e Domains ......................90 Jak2 Mutations, V617F and H538Q/K539L, Disrupt Autoinhibition by Altering Specific Interactions within and between the JH1 and JH2 Domain s.........................................................................................................92 Jak2 Mutations, V617F and H538Q/K539L, Alter interactions within the N-lobe of the Ps eudokinase Do main........................................................94 Jak2 Mutations, V617F and H538Q/K539L, Disturb the Stability of the Autoinhibitory Interface............................................................................95 Salt Bridge Interactions between D620, E621, and K539 is Important for Jak2 Auto inhibiti on....................................................................................96 Salt bridge Interaction between D620, E621, and R541 is Important for the Constitutive Acti vation of Jak2 -H538Q/K 539L....................................97 Discussio n...............................................................................................................99 4 PHOSPHORYLATION OF JAK2 AT Y372 IS IMPORTANT FOR JAK2 DIMERIZATION AND ACTIVATIO N .....................................................................115 Summary ...............................................................................................................115 Preface ..................................................................................................................116 Materials and Methods..........................................................................................119 Cell Cult ure.....................................................................................................119 Mass Spectrom etry.........................................................................................119 Site-Directed Mutagenesis ..............................................................................120 Transient Cell Tr ansfecti ons...........................................................................120 Cell Lysis and Immuno precipitat ion................................................................121 Western Blo tting..............................................................................................121 Luciferase A ssay.............................................................................................122 Immunofluore scence.......................................................................................122 Statistical A nalysis ..........................................................................................123 Results ..................................................................................................................123 Y372 is a Conserved Site of Jak2 Phosphor ylation........................................123 Loss of Y372 and Y373 Phosphorylation Reduces Jak2 Phosphorylat ion...........................................................................................124 The Jak2-Y372F Mutation Abrogates Jak2-mediated Gene Expressi on...................................................................................................125 Loss of Y372 Phosphorylation Prevents Interferon-Gammaand Epidermal Growth Factor-, but not Hydrogen PeroxideMediated Jak2 Activa tion.............................................................................................126 Loss of Y372 Phosphorylation does not Affect Jak2/Receptor Coassociatio n...................................................................................................128 Co-expression of SH2Bis Capable of Partially Restoring Jak2Y372F Activa tion..........................................................................................129 Discussio n.............................................................................................................130 5 PURIFICATION OF RECOMBINANT HUMAN JAK2 PROTEIN USING BACTERIAL AND INSE CT SYSTEMS..................................................................140 8

PAGE 9

Summary ............................................................................................................... 140 Preface ..................................................................................................................140 Materials and Methods..........................................................................................143 Construction of Jak2 Cons truct for Expression in E.coli ...................................143 Construction of Jak2 Construct an d Production of Baculoviruses for Expression in In sect Ce lls............................................................................144 Insect Cell Culture...........................................................................................144 Plaque Assa y..................................................................................................145 Protocol for Purification of Reco mbinant JH1-3 Jak2 from Inclusion Bodies in E.coli .............................................................................................145 Activity A ssay..................................................................................................147 Protocol for Protein Purifica tion from Insect Cells ...........................................147 Results ..................................................................................................................148 Expression of Jak2 in E.coli using pTrcHis2TOPO..........................................148 Jak2 Expression in E. coli using pQET7vector 2.............................................149 Purification of Jak2 fr om Inclusion Bodies .......................................................150 Jak2 Expression in Insect Ce lls...................................................................... 152 Purification of Jak2 from Insect Cells ..............................................................153 Troubleshooting Jak2 Degradatio n.................................................................154 Discussio n.............................................................................................................155 6 DISCUSSION AND CONCLUSIO N.......................................................................165 Overview ...............................................................................................................165 Lessons Learnt from Jak2 Exon 14 and Exon 12 Mu tations..................................165 Implications for Jak2 Allosteric I nhibitors: The Path Not Taken.............................167 Current Allosteric Inhibitors for Kinases in Cancer..........................................170 BCR-ABL1 ................................................................................................171 Akt............................................................................................................173 B-RAF ....................................................................................................... 173 MEK..........................................................................................................174 Allosteric Inhibito rs for Jak2............................................................................175 LS104 .......................................................................................................176 ON044580................................................................................................ 176 Possible Targets on the Jak2 Surfac e for Allosteric Inhibiti on...............................177 Jak2 Kinase Domain .......................................................................................178 Autoinhibitory Interface bet ween the Kinase and Pseudokinase Domains .......................................................................................................179 SH2-linker JH2 Interface...............................................................................180 FERM Doma in................................................................................................180 Identification of Druggable Allosteric Pockets using Virtual Screening..................181 Role of Tyrosine Phosphorylat ion on Jak2 R egulation ..........................................183 Crystal Structure for Jak2: Need of t he Hour .........................................................184 LIST OF REFE RENCES..............................................................................................189 BIOGRAPHICAL SKETCH ..........................................................................................209 9

PAGE 10

LIST OF TABLES Table page 1-1 Jak2 mutations that occur in various hematalogica l disor ders............................38 1-2 Jak2 chromosoma l transloca tions.......................................................................40 2-1 Comparison of the side chain structure and hydropathy index of the respective amino acids that were used for side directed mutagenesis at 594, 595 and 617 ............................................................................................71 3-1 Changes in salt bridge and vdW interactions caused by Jak2 mutations ...........................................................................................................105 6-1 Current allosteric inhibitors for BCR-ABL and Jak2 that target sites other than the AT P-binding site........................................................................187 10

PAGE 11

LIST OF FIGURES Figure page 1-1 Conserved kinas e architec ture.........................................................................41 1-2 Jak2 struct ure-func tion.....................................................................................42 1-3 The Jak2 protein structure and hotspots for Jak2 mutations............................43 1-4 Jak2 chromosoma l transloca tions....................................................................44 2-1 The V617F mutation induces a possible stacking interaction between F594, F595 and F617 in Jak2............................................................72 2-2 A potential stacking interaction between F595 and F617 in Jak2V617F weakens the interacti on between F617 and V100 0..............................73 2-3 A potential stacking interaction between F595 and F617 alters the JH1-JH2 interaction and active site conformation in Jak2-V617F....................74 2-4 Jak2 sequence conservation at F594, F 595 and V 617.....................................75 2-5 Mutation of F594 and F595 to Ala impairs the autophosphorylation and kinase activity of Jak2-V 617F....................................................................76 2-6 Mutation of F594 and F595 to Ala impairs STAT mediated gene transcription downstream of Jak2 -V617F. ........................................................77 2-7 Mutation of F594 and F595 to Ala does not affect Jak2-WT autophosphoryl ation. ........................................................................................78 2-8 Side chain structure and hydrophobicity of amino acids at 594, 595 and 617 are important for the constitu tive activation of Jak2-V617F................79 2-9 Characterization of the stacking interaction between F595 and F617 by geometri cal analysis...........................................................................80 3-1 Activation of Jak2 exon 12 muta tion, H538Q/K539L, is not different from that of Jak2-V617 F.................................................................................106 3-2 Mutation of F595 to alanine partially reduces the activation of Jak2H538Q/K539L.................................................................................................107 3-3 Mutation of K539 to non-polar amino acid, Leu, causes constitutive activation of Jak2............................................................................................108 3-4 Jak2 mutations, H538Q/K539L and V617F induce conformational changes in both the pseudokinase dom ain and the kinas e domain...............109 11

PAGE 12

3-5 Jak2 mutations, H538Q/K539L and V617F induce changes in interactions that affect the autoinhibitory in terface..........................................110 3-6 Salt bridge interactions betw een D620, E621, and K539 in Jak2-WT is replaced by those between D620, E621, and R541 in Jak2H538Q/K539L.................................................................................................111 3-7 Jak2 mutations, H538Q/K539L and V617F induce changes in interactions between the JH1 and JH2 domains ............................................112 3-8 Salt bridge interaction between D 620, E621, and K539 is critical to the autoinhibition of Jak2-W T.........................................................................113 3-9 Salt bridge interaction between D 620, E621, and R541 is critical to the constitutive activati on of Jak2-H538 Q/K539L...........................................114 4-1 Y372 and Y373 are Jak2 phosphoryl ation sites that are conserved across varying species and among Jak family me mbers................................134 4-2 Loss of phosphorylation at Y372 and Y373 decreased the ability of Jak2 to autophosph orylate.............................................................................135 4-3 Loss of Y372 phosphoryl ation reduced Jak2-dependent gene transcripti on....................................................................................................136 4-4 Phosphorylation of Y372 is essential for interferon-gamma and epidermal growth factor dependen t, but not hydrogen peroxide dependent Jak2 ac tivation. .............................................................................137 4-5 Phosphorylation of Y372 is not required for Jak2-IFNGR coassociation ...................................................................................138 4-6 Activation of Jak2-Y372F is only partially recovered in the presence of SH2B.......................................................................................................139 5-1 Screening for pTrcHis2TOPO Jak2 JH1-JH3 expression in TOP10 E. coli cells.....................................................................................................158 5-2 Cloning and expression screening of pQET7-Vector 2-JH1-JH3 Jak2 in E. coli cells..................................................................................................159 5-3 Purification of JH1-JH3 Ja k2 from inclusion bodies in E. coli after refolding using the iFOLD syst em...................................................................160 5-4 Jak2 expression in insect cells using the Bac to Bac system from Invitrogen. .......................................................................................................161 12

PAGE 13

5-5 Cloning and expression screening of pFastBac HT-Jak2 in insect cells ................................................................................................................162 5-6 Purification of full length and JH1-JH4 Jak2 from 250 mL of Sf9 insect cells using Ni-NTA co lumn chromato graphy.. ......................................163 5-7 Troubleshooting Jak2 protein degr adation inside inse ct cells.........................164 6-1 Possible targets for Jak2 allosteric i nhibition. .................................................188 13

PAGE 14

LIST OF OBJECTS Object page 2-1 Interactions at the JH1JH2 interface in Jak2-WT..............................................70 2-2 Interactions at the JH1JH2 interface in Jak2-V 617F.........................................70 2-3 Interactions at the JH1-JH2 interface in Jak2 -V617F/F594A/F595A..................70 2-4 stacking interacti on in Jak2 -WT......................................................................70 2-5 stacking interacti on in Jak2 -V617F.................................................................70 3-1 Interactions at the JH1JH2 interface in Jak2-WT............................................104 3-2 Interactions at the JH1-JH 2 interface in Ja k2-H538Q/K 539L...........................104 3-3 Interactions at the JH1JH2 interface in Jak2-V 617F.......................................104 3-4 Interactions at the JH1-JH2 interface in Jak2 -H538Q/K539L/V617F...............104 14

PAGE 15

LIST OF ABBREVIATIONS ALL Acute Lymphoid Leukemia BCR B-cell Receptor cHL Classical Hodgkin Lymphoma CML Chronic Myelogenous Leukemia DS Down Syndrome ET Essential thrombocythemia FERM 4.1 protein/ez rin/radixin/moesin HCMV Human cytomegalovirus HPV Human Papilloma Virus IFN Interferon Jak Janus Kinase MD Molecular Dynamics MPN Myeloproliferative Neoplasms PMF Primary Myelofibrosis PV Polycythemia vera SCID Severe Combined Immunodeficiency SDS-PAGE Sodium Dodecyl SulfatePolyacrylamide Gel Electrophoresis SH2 Src Homology 2 SOCS Suppressor of Cytokine Signaling STAT Signal Transducers and Activators of Transcription 15

PAGE 16

Abstract of Dissertation Pr esented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for t he Degree of Doctor of Philosophy MOLECULAR MECHANISMS FOR THE CONSTITUTIVE ACTIVATION OF JAK2 MUTATIONS By Kavitha Gnanasambandan December 2011 Chair: Peter P. Sayeski Major: Medical Sciences Biochemistry and Molecular Biology Jak2 tyrosine kinase plays a critical role in hematopoiesis and is essential for life. Constitutive activation of Ja k-STAT signaling through Jak2 mutations have been linked to leukemia and myelopro liferative neoplasms (MPNs). In the case of a predominant Jak2 mutation, V617F, we identified that mutant F617 interacts with the adjacent F595 through a pi stacking mechanism. Mutation of F594 and F595 to A reduced the activation leve ls of Jak2-V617F to that of Jak2WT. Thus, a pi stacking interaction between F617 and F595 was found to be critical for the constitutive activati on of Jak2-V617F. We then examined the mechanism for the constitutive activa tion of the Jak2 exon 12 mutation, H538Q/K539L. Data obtained from Jak2 MD simulations indicated that the mutation of K539 to L shifted the salt bridge interaction of D620 and E621 with K539 to the adjacent R541. Mutation of R541 to A in vitro, reduced the activation of Jak2-H538Q/K539L by 50% and the mutation of R541 to D or E completely reduced the activation of Jak2-H538Q/K539L back to Jak2-WT levels. Thus, the shift in salt bridge interaction of D 620 and E621 from K539 to R541 was found to be important for the constitutive activation of Jak2-H538Q/K539L. 16

PAGE 17

17 Activation of Jak2 can also be regul ated by phosphorylation on the multiple tyrosine residues that are present throughout the kinase. Using ESI mass spectrometry, we identified that Ja k2 was phosphorylated on Y372 and Y373. Among the two, only Y372 was found to be im portant for Jak2 activation. Y372F mutation abrogated receptor bound ligand dependent, but not hydrogen peroxide dependent Jak2 activation. Y372F did not affect Jak2-receptor co-association. However, it disrupted dimerization dependent Jak2 activation in the presence of SH2B. Thus, phosphorylation of Jak2 at Y372 was found to be important for Jak2 dimerization and activation in the case of receptor bound ligands. Overall, data from these studies indi cate that exon 14 and exon 12 Jak2 mutations cause constitutive activation by disrupting JH2-mediated autoinhibition on JH1. Phosphorylation of Jak2 at Y372 was found to be important for receptorbound ligand dependent Jak2 dimerization and activation. Thus, Jak2 regulation is important for maintainin g physiological levels of Jak-STAT signaling.

PAGE 18

CHA PTER 1 INTRODUCTION1 The Protein Kinase Family Protein kinases are enzymes that cata lytically transfer a phosphat e from a donor, such as the ATP, to that of the protein substrates on Se r, Thr or Tyr residues. This process can be reversed by the action of a phosphatase. The history of kinases dates back to the 1950s, when the phosphorylat ion of glycogen phosphorylase by phosphorylase kinase on a serine residue wa s identified by Edmond Fischer and Edward Krebs. Later, in 1979 Tony Hunter ident ified that a viral pr otein, v-Src, was a kinase that phosphorylated its substrates on tyrosines. The fi rst sequence of a protein kinase was solved for Protein Kinase A (PKA) in 1981 and the first kinase structure was also solved for PKA in 1991. There are about 518 human protein kinases known to date that constitute roughly 1.7% of the genome. Protein kinases can be classified into 8 major families, without including the uncla ssified kinases and atypical kinases. The tyrosine kinase family consists of 90 kinases that include 58 receptor tyrosine kinases and 32 non-receptor tyrosine kinases. Intere stingly, all the me mbers of the kinase family, with the exception of atypical kinases, share a highly conserved kinase domain in terms of both sequence and struct ure (Cohen 2002). The Jak-STAT signaling pathway that was characterized in the 1990s provided evidence for the role of kinases in the transmission of signals from the plasma membrane to the nucleus. 1 Reproduced in part with permission from A Structure-Function Perspective of Jak2 Mutations and Implications for Alternate Drug Design Strategies: The Road not Taken Curr. Med. Chem. 2011 18, 4659-4673. Bentham Science Publishers. 18

PAGE 19

Conservation of Kinase Architecture The highly conserved catalytic domain has been the basis for the classification of proteins under the kinase fam ily. The crystal structure of PKA that was solved in 1991 has since served as a template for the entir e kinase family (Knighton et al. 1991). The catalytic domain of protein kinases has a bi -lobal fold (Fig. 1-1). It has a small Nterminus lobe that comprises five sheets ( and 1 -helix ( C The glycine rich G-loop, which connects the 1 and 2 strands in the N-lobe anchors the and phosphates of ATP. The G-loop is therefor e important for bindi ng and orienting ATP. There is a conserved VAIK motif in the N-term inus, the lysine in which is important for phosphotransfer. The N-lobe is usually very dy namic and flexible in order to allow the conformational changes that are required for the kinase activation. The C-terminus lobe is large and relatively more stable when co mpared to the N-lobe. It consists of seven helices ( D I and four very short -strands (. A deep cleft is formed between the two lobes, which constitutes the active site. ATP, which serves as the phosphate donor, binds to the active site. The kinase substrates dock adjacent to ATP in the Clobe. Stable binding of ATP is facilitated th rough co-ordination with magnesium or other divalent cations. Kinases are mainly activated by trans phosphorylation of a primary phosphorylation site that is present in t he activation loop, located in the C-lobe. Preceding the activation loop is a highly c onserved DFG loop, which plays an important role in magnesium binding and is critical for catalysis. The conserved APE motif, present as a part of the activa tion loop, plays a major role in the recognition of peptide substrates (Kornev and Taylor 2010). 19

PAGE 20

Though the structure of kinases is highly cons erved in their active conformation, it can be extremely diver se in their inactive conformation. Further each kinase bears distinctive features with respect to the dom ains that flank the kinase domain and also they have different activation mechanisms. For example, a unique feature of the Jak and GCN2 kinases is the presence of a pseudokinase domain adjacent to the kinase domain. Additionally, the Jaks have a unique insertion loop in the C-lobe that connects G and I. This unique Jak2 insertion loop is not conserved in other kinases (Lucet et al. 2006). Bonding and Non-bonding inte ractions in Proteins Conformational stabilit y of a protein's nativ e structure is marginal. A single amino acid substitution can affect the protein's st ability by inducing changes in one or more of the following properties hydrogen bond, salt bridge, hydrophobic intera ction, disulphide bond, volume of a residue, and relative positioning of the aromatic rings. Thus, mutations could alter the protein's stability by a few kcal/mol based on these changes in interactions. Some of these mutants can be more stable than t he wild type confirming the theory that the native stat e of a protein is not always the most energetically stable state. Such kinase mutants get selected natur ally and lead to disease conditions like cancer. The protein structure has a hydrophobic core and a hydrophilic exterior such that it can be soluble in the aqueous environment insi de the cell. The hydrophobic core is kept stable through van der Waals (vdW) interacti ons between the hydrophobic amino acids like leucine that form the core. vdW interactions predo minantly occur between amino acid residues that are in clos e proximity, within the vdW radius. Electrostatic interactions 20

PAGE 21

occur frequently on the surface of the prot ein, where there is a high dielectric environment and these interactions only occur between ordered regions. Electrostatic interactions that are pH dependent are term ed as salt bridges and they are unique to protein structures. Salt bridges can either stabilize or dest abilize the protein structure. Hydrogen bonding interactions pl ay an important role in the formation of secondary structures. Hydrogen bonding is an electrostatic dipole-dipole interaction between hydrogen and an electronegative at om like nitrogen or oxygen, with some features of a covalent interaction. Based on the dist ance and the positioning of the hydrogen and the electronegative atom, the secondar y structure can be either an -helix, 310 helix or sheet. Energy from a hydrogen bond is hig her than vdW, but lower than that of covalent or salt bridge interactions (Boss hard et al. 2004; Nakamura 1996). The tertiary structure of proteins is mainly stabilized via disulphide bonds between the side chain thiol groups of cysteine residues that link various segments of the protein. These sulphur-sulphur covalent bonds are highly energetic and are very useful in linking multiple domains in order to form the quater nary structure. Additionally, the side chain rings of aromatic amino acids like Tyr, Phe and Trp are often in volved in aromaticaromatic interactions, whose energy is dependent on the distance and relative positioning of the rings. These interactions al so known as "pi stacking" interactions can be both hydrophobic and electrostatic in nat ure and they often contribute to the stabilization of the protein structure. The Role of Jak-STAT Signaling in Cellular Function Janus kinases (Jaks) are non-receptor ty rosi ne kinases, which play an important role in cytokine receptor signaling. The Jak fa mily consists of four members; Jak1, Jak2, 21

PAGE 22

Jak3 and Tyk2. Jak1, Jak2 and Tyk2 are expre ssed ubiquitous ly, but Jak3 expression is restricted to myeloid and lymphoid tissues. Diffe rent cytokines activa te different subsets of Jaks. One of the downstream substrates of the Jaks is the Signal Transducers and Activators of Transcription (STATs). The Jak-STAT signaling pathw ay has been implied in the regulation of cellular growth and proliferation. Jaks mostly remain associated with the re ceptor even before ligand binding. Once the ligand binds to the receptor, it causes receptor oligomerizat ion. Next, the Jaks associated with the oligomer ized receptors activate each other mutually through trans phosphorylation on the tyrosine residues in t he activation loop. Once the Jaks get activated they phosphorylate the receptor and create docking sites for the binding of downstream effectors like STATs. The STAT s bind to these phosphorylated receptors through their SH2 domain, bringing them in close proximity to t he Jaks. Jaks then act upon the STATs to phosphorylate them. Phosphorylated STATs dimerize and translocate into the nucleus, where they activa te the transcription of effector genes that result in cell proliferation and differentiation. While this paradigm of Jak activation is widely accepted, one key limitati on of this model is the pauc ity of structural data in support of it. The Yin and Yang of Jak-STAT signaling. The Jak-STAT signaling pathway is highly regulated and any change in this controlled process can affect normal physiology. The Jak1 knockout mice die perinatally due to defects in signaling through a subset of cytokine receptors (Rodig et al. 1998). Jak2 has a non-redundant role in erythropoiesis, as the Jak2 knockout mice die embryonically at day 12.5 due to lack of definitive erythropoiesis (Neubauer et al. 1998; Parganas et al. 1998). Jak3 knockout mice are 22

PAGE 23

viable, but have defects in lymphoid development and also present with Severe Combined Immunodeficiency (SCID) (Nosaka et al. 1995; Park et al. 1995; Thomis et al. 1995). Mutations in Jak3 have also bee n seen in patients with autosomal SCID (Macchi et al. 1995; Russell et al. 1995). The T yk2 knockout mice ar e viable, but exhibit defects in interferon and IL-12 signaling (Kar aghiosoff et al. 2000; Shimoda e t al. 2000). Inhibition of Jak mediated signal tr ansduction has been observed in diseases associated with the Human Papilloma Viru s (HPV), Human cytomegalovirus (HCMV), Leishmania donovani and Ehrlichia chaffeensis Jak inhibition has also been associated with tumor-related immunosuppression caused by the reduction of Tcell proliferation (Duh et al. 2001). On the contrary, there has been mounting evidence for the occurrence of Jak mutations that cause constitutive activation in cancer. Specifically, Jak2 mutations have been identified in Acute Lymphoid Leukemia (ALL), Chronic Myelogenous Leukemia (CML), Myeloproliferative N eoplasia (MPN), lymphomas and myelomas. Constitutively active Jak2 has also been implicated in solid cancers of the brea st, prostrate, head and neck. Over expression of Jak2 has also been associated with sma ll cell lung cancer (Voortman et al. 2010). Therefor e, it is important to have a balance in the level of activation of the Jaks in order to ma intain normal physiological functions. Structure-Function Relationship of Jak2 The Jak2 gene was identified to be a memb er of the Jak family in 1992. Among the different Jak family members, Jak2 is solely respons ible for erythropoietin (EPO) receptor signaling. The significant role of Jak2 in erythropoiesis has been established by knock out mouse studies and also by the recent discovery of somati c Jak2 mutations in human myeloproliferative neoplasms (MPNs). 23

PAGE 24

The protein structures of all four Jak family members share seven conserved Jak Homology ( JH) domains based on their sequenc e conservation (Fig. 1-2). The seven JH domains can be further classified into four functional motifs based on the homology of their tertiary structure. The C-terminal JH 1 domain is a highly conserved kinase domain, which contains the activation loop residues (Y1007, Y1008) and the ATP binding site (K882). The JH1 domain is required for Jak2 activation following ligand binding. The adjacent JH2 has similar structural properti es to the kinase domain, but lacks certain conserved motifs such as HRD motifs that are required for cata lytic activity and was therefore predicted to be a pseudokinase domain. The JH2 domain has been shown to negatively regulate the kinase domain in the absence of ligands to maintain it in the inactive state. The presence of such a pseudokinase domain adjacent to the kinase domain is a unique structural property of t he Jak family members. Recently, it was shown that the JH2 domain is actually a dua l-specificity kinase that negatively regulates the adjacent kinase domain (JH1) by phos phorylating residues Ser 523 and Tyr 570 in Jak2 (Ungureanu et al. 2011). However, the authors have not demonstrated any catalytic activity of the JH2 domain on other substrat es such as STATs. Additionally, the catalytic activity of JH2 domain was only 10% of that of the JH1 domain. The JH3 domain and part of the JH4 domain form an uncharacterized SH2 (Src Homology 2) like domain. Part of the JH4, JH5, JH6, and JH7 domains pr esent at the N-terminus of the protein form the FERM domain (F for 4.1 protein, E for ezrin, R for radixin and M for moesin), which helps in the association of Ja k2 with the various cell surface receptors. Unfortunately, a three-dimensional crystal structure of full length Jak2 is not yet available; only a portion of the kinase domai n has been solved (PDB 2b7a) (Lucet et al. 24

PAGE 25

2006). However, in 2002, Kroemer and colleagues computationally created a homology model of the full length Jak2 (Giordanetto and Kroemer 2002). This model served to bring forth several ideas regarding the mechanism of Jak2 activation, JH2 mediated autoinhibition and the struct ure-function relationship of individual domains. Regulation of Jak2 Function Strict regulatory control of Jak2 signaling is important under two circumstances. First, in the absence of ligand, Jak2 kinase acti vity must be maintained at a basal level, which is characterized by an absence of activation loop phosphorylation and low phospho-transferase activity. Second, followi ng activation, the Jak2-mediated signaling processes must be stopped via appropriate spatial and temporal negative feedback mechanism s. Collectively, these two leve ls of control are achieved through both cis and trans mechanisms. At the cis level, the regulation is achieved by the allosteric interaction between various Jak domains and by the phosphorylation/dephosphorylation of 49 different tyrosine residues that are di stributed throughout the Jak2 protein. Post Jak2 activation, trans regulation occurs via negative feedback loops. Jak2 Regulation in cis An intrinsic level of Jak2 regulation is achieved by the aut oinhibition of the pseudokinase domain (JH2) over the kinase domain (JH1) in the absence of cytokine stimulation. JH2 inhibits the kinase acti vity non-competitively, by decreasing the maximum velocity (Vmax) of the enzyme catalysis withou t any changes in its substrate affinity (Km) (Saharinen et al. 2003). This prev ents the phosphorylation of the two tyrosines Y1007 and Y1008 in the activation loop, thus suppressing the basal kinase activity in the absence of cytokine stimulat ion. Ligand binding to the receptor causes conformational changes in the receptor/Jak2 complex, which possibly relieves the JH225

PAGE 26

mediated inhibition and allows for Jak2 activation. This provides rationale for the presence of several oncogenic mutations in the JH2 domain that cause ligandindependent, constitutive Jak2 activation. The Role of Tyrosine Phosphorylation in Jak2 Regulation Jak2 has 49 tyrosine residues in its protein sequence a nd some of these are known to play an important role in its acti vation and regulation. Two of the key tyrosine residues, Y1007 and Y1008, are present in the activation loop of the kinase domain. The phosphorylation of these two residues serves as the initiating and also an essential event for Jak2 activation. The other 47 ty rosines are spread throughout the seven JH domains. Three of them that were characte rized from our lab include Y201 and Y372 in the FERM domain and Y972 in the kinase do main (Godeny et al. 2007; McDoom et al. 2008; Sayyah et al. 2011). Phosphorylation of Y119 has been shown to cause receptor specific down regulation through Jak2 dissoci ation from the re ceptor (Funakoshi-Tago et al. 2006). Y221 and Y813 are autophosphorylation site s, which enhance Jak2 activation. Phosphorylation at Y570 terminates Jak2 activation in response to ligand binding and down regulates its kinase activity (Argetsinger et al. 2004; Kurzer et al. 2004). Apart from tyrosines, a few serine phosphorylat ion sites have also been identified like phospho Ser 523, which down regulates Jak2 kinase activity in the negative feedback loop (Mazurkiewicz-Munoz et al. 2006). Of these, Ser 523 and Tyr 570 have been shown to be autophosphorylated by the pseudok inase domain (Ungureanu et al. 2011). Jak2 Regulation in tr ans Another level of regulation occurs post Jak2 activation through the SOCS (Suppressor of Cytokine Signaling) proteins which are the major regulators in the 26

PAGE 27

negative feedback loop. The binding of STATs to their promoter contro ls the express ion of the SOCS gene. SOCS proteins bind to active Jak2 through their SH2 domains and facilitate UE3 ligase mediated proteasomal degradation of the kinase. Concurrent with the role of SOCS in Jak2 negative regulation, mutations in the SOCS1 gene have been identified in the classical Hodgkin Lymphoma (cHL). Other such negative regulators include phosphatases like SH-PTP1 and PT P1B, which inactivate Jak2 through dephosphorylation of Tyr 1007 and 1008 (Duh et al. 2001). Additionally, Lnk, an SH2 (B3) adaptor protein, was i dentified as an important negat ive regulator of Jak2 in hematopoietic cells (Gery et al. 2009). Ad ipocyte fatty acid binding protein (AFABP/aP2), which serves as a fatty acid s ensor for Jak2, was also recently identified as another negative regulator of Jak2 (Thomps on et al. 2009). According to this report, when fatty acid levels are high in the cell as in the case of obesity, the AFABP/aP2 binds to and attenuates Jak2 kinase activity. Deregulation of Jak2 Activity in Disease Deregulation of Jak2 activity is a co mmon event in various types of cancer, especially in hematological malignancies such as BCR-ABL negative myeloproliferative neoplasms (MPNs). These are a class of st em cell derived hematol ogical disor ders, which include Polycythemia Vera (PV), Esse ntial Thrombocythemia (ET) and Primary Myelofibrosis (PMF). They are clinically c haracterized by the presence of increased red blood cell, platelet and granulocyte counts along with bone marrow fibrosis, respectively. MPN patients also bear a risk of leukemic transformation in the long term. William Dameshek first identified MPNs in 1951, but the molecular mechanism for the dysfunctional hematopoiesis in these pati ents was unknown and no effective treatments were available to them until the recent past. In 2005, several research groups 27

PAGE 28

independently reported a V to F substitution at position 617 in Jak2 that was identified in the granulocytes of several MPN patients (Baxter et al. 2005; James et al. 2005; Kralovics et al. 2005a; Levine et al. 2005; Zhao et al. 2005). Jak2-V617F occ urs somatically in hematopoietic stem cells and leads to cytokine independent constitutive Jak-STAT signaling. The Jak2 V617F mutation on exon 14 is present in at least 90% of PV, 50% of ET and 50% of PMF patients (Levine et al 2007). But, the exon 12 mutations and a thrombopoietin receptor mutation (W515K/L) account for the other fraction of V617F negative ET and PMF patients (Pikman et al. 2006; Scott et al. 2007). Following the identification of Jak2-V617F in MPN, there have been several reports of its occurrence in other hematological diso rders including leukemia, lymphoma and myeloma (Table 1-1). Apart from the V617F mutation that occurs in exon 14, Jak2 mutations have also been found in exons 12 15 in patients presenting with various types of hematological disorders. These mutations deregulate the Jak-STAT signaling pathway and skew the prolif eration and differentiation of hematopoietic stem cells during hematopoiesis. However, the mechan ism(s) by which these different Jak2 mutations confer constitutive activation have not been examined. Jak2 Exon 14 Mutations The identification of the Jak2-V617F mu tation in 2005 stimulated research in various dir ections leading to approximately 700-800 publications so lely regarding Jak2V617F over the past 6 years. Investigations from a clinical point of view have focused on studying the occurrence of the Jak2-V 617F mutation in other hematological disorders apart from MPNs, t he development of diagnostic tools that can be used to screen for the V617F mutation in patients, a nd in the identification of novel Jak2 mutations in MPN patients. Microarray studi es have also been conducted using patient 28

PAGE 29

samples in order to identify changes in t he gene expres sion pattern induced by Jak2V617F (Kralovics et al. 2005b). Furthermore the gene expression pattern of Jak2V617F-positive ET patients has been found to be different from that of Jak2-V617Fnegative patients (Puigdecanet et al. 2008). One challenging question that arose as a consequence of the discovery of V617F was, how can one mutation, that is Jak2-V 617F, lead to three different disorders; namely, PV, ET, and PMF? To address this issue, several cases have been presented (Levine 2009). Since Jak2-V617F allele was found to be homozy gous in PV patients and heterozygous in ET patients, it is argued that gene dosage may be a determining factor. Mouse models developed for MPN also support this case (Xing et al. 2008). Another possibility is the presence of additi onal mutations in genes apart from Jak2, which in combination with V617F may det ermine the specific pathology. Further, germline genetic variations may also be re sponsible for the sim ilar, yet distinct phenotypes observed clinically among the Jak2 -V617F positive patients. For example, in 2009, three independent groups reported a predisposition allele called the /1 haplotype which explained the higher occurr ence of the Jak2-V617F mutation among first-degree relatives of MPN patients (Jones et al. 2009; Kilpivaara et al. 2009; Olcaydu et al. 2009a). Another line of current research in cludes the understanding of the molecular mechanism for the constitutive activation of Jak2-V617F. The point mutation at Val 617 occurs in the autoinhibitory pseudokinase doma in (JH2) of Jak2 an d therefore allows the kinase to evade negative cis regulation (Fig. 1-2). Kinetic studies of Jak2-V617F have shown that although its Vmax is similar to that of Jak2-WT, it has a lower Km and 29

PAGE 30

hence an increased affinity towards substrates leading to hyperactivation (Zhao et al. 2010). Interestingly, an earlier report had s hown there was no difference in the enzyme kinetics of Jak2-V617F when compared to Jak2-WT (Erdmann et al. 2008). Nevertheless, in vitro assays reported by several group s have demonstrated that Jak2V617F is hyperkinetic (Dusa et al. 2010; Gnanasambandan et al. 2010; Zhao et al. 2005) and that the FERM and SH2 domains are r equired for its functi on (Gorantla et al. 2010; Wernig et al. 2008). These reports have shown that the FE RM domain is important for the association of Jak2-V617F with the erythropoietin receptor (EpoR), while the SH2-like domain is required for cross-phosphorylation and aggregation in the receptor complexes at the membrane. This in turn implies that the constitutive activation of Jak2-V617F is mainly at the level of re lieving the autoinhibitio n of the pseudokinase domain over the kinase domain. The V617 F mutation by itself does not confer independence from the function of other Jak2 domains. But, in order to obtain a molecular mechanism as to how a point muta tion causes constitutive activation, more information at the level of pr otein structure is needed. Sinc e a full length Jak2 crystal structure does not exist, homology model s and molecular dynamic simulations have been useful in predicting the mechanism of these mutations (Gnanasambandan et al. 2010; Lee et al. 2009a; Lee et al. 2009b). In par ticular, the creat ion of full-length homology models and the initial descriptions of novel stru cture-function relationships of the different domains by Kroemer and colle agues has been the starting point in this area of research (Giordanetto and Kroemer 2002; Lindauer et al. 2001). The homology model of Jak2 JH1 and JH2 domains indicated that the activation loop in the kinase domain and V617 in the pseudokinase domain could be involved in 30

PAGE 31

an autoinhibitory interaction (Lindauer et al. 2001) (Fig 12 and 1-3). Therefore, the mutation V617F may be disrupting this autoinhibition, resulting in Jak2 constitutive activation. However, a t the trans level of regulation, several negative feedback regulators such as the SOCS and Lnk ar e still activated. Thus, one wonders how does the Jak2-V617F mutant protein escape the inhibitory effect of these trans regulators? Jak2-V617F seems to evade this negative regul ation by hyper methylating the SOCS3 promoter thereby making it insensitive to STAT binding or hyper phosphorylating the SOCS3 protein thus making it more sensitive to degradation (Fourouclas et al. 2008; Hookham et al. 2007). Additionally, an HDAC inhibitor, in combination with a Jak2 inhibitor, has been shown to reduce Jak2-V617F signaling in vitro (Wang et al. 2009). Thus, gene suppression through epigenetic modifications could also be a possible explanation for the resistance of Jak2 V617F against the cellular regul ators of signaling. Apart from V617F, additional mutations in the exon 14 region cause constitutive activation of Jak2 in various diseases. These include C618R and D620E in PV, E627E and C616Y in unclassified MPN, L611S in ALL, IREED in Down syndrome, K607N in AML, and R683G in Down Syndrome-ALL (Table 1-1). Identification of Jak2-V617F and availability of the crystal structure for Jak2 kinase domain has also opened the doors to the development of small molecule inhibitors for Jak2. Several mouse models for MPNs that have been created as either transgenic or knock-in model s using the V617F allele have been very useful in testing the broad range of Jak2 inhibitors that are being developed for use in the MPN patients (Lacout et al. 2006; Li et al. 2010; Xing et al. 2008). 31

PAGE 32

Jak2 Exon 12 Mutations Jak2-V617F, the predominantly found exon 14 mutation in MPN was identified in 2005. In 2007, Scott et al reported the occurrence of exon 12 mutations in Jak2-V617F negative MPN patients (Scott et al. 2007). There are at least 20 different exon 12 mutations that have been reported to date, which include single or multiple substitution, insertion, deletion and duplication mutations (Table 1-1). These mutations are found almost exclusively in PV. The exon 12 mutations are located structura lly in the linker region located between the SH2 domain and pseudokinase domain (Fig. 1-2). Functionally, this linker has been implicated in relaying the engagement of cyto kines to the extracellular portion of the receptor with the relief of JH2 mediated autoinhi bition. Therefore, it is thought that exon 12 mutations lead to constitutive activation of Jak2 by altering the interaction between JH1 and JH2 domains similar to that of Jak2-V617F. Molecular dynamics simulation studies conducted using various Jak2 exon 12-15 mutations show that in most of the clinically occurring mutations, the JH1-JH2 in terface is open indicating disruption of JH2-mediated autoinhibition and subsequent c onstitutive activation (Lee et al. 2009b). The 46/1 Jak2 haplotype has been found to predispose patients to both Jak2V617F and exon 12 mutation positive MPNs (Olcaydu et al. 2009a; Olcaydu et al. 2009b). On the other hand, Jak2-V617F positiv e PV patients have a distinct clinical phenotype from that of PV patients carrying the exon 12 mutations. While patients with exon 12 mutations have isolated erythrocytos is, Jak2-V617F positive patients present a trilineage pattern of erythrocytosis, leukocytosis, and thrombocytosis. PV patients with Jak2 exon 12 mutations have higher hemogl obin levels, lower erythropoietin levels, lower platelet counts, and lower leukocyte counts than Jak2-V617F positive PV patients 32

PAGE 33

(Pietra et al. 2008). Additionally mitotic recombination leading to homozygosity is more likely to occur in Jak2-V617F-positive PV pa tients than those that carry the exon 12 mutations. This indicates that even though both Jak2-V617F and exon 12 mutations are constitutively active, th eir downstream signaling pathways are different, which eventually leads to variation in thei r pathophysiology and clinical phenotypes. Accordingly, Zou et al. reported that the catalytic acti vity, downstream signaling, ability to bind erythropoietin receptor and the transforming properties of Jak2-V617F are significantly higher when compared to t he exon 12 mutant, Jak2-K539L (Zou et al. 2011). Contrary to this report however, Scott et al. reported that exon 12 mutants including Jak2-K539L have increased Jak2 signaling when compared to Jak2-V617F (Scott et al. 2007). Interestingly, there are no apparent differences in the assay conditions used by these two groups. While Jak2-V617F and exon 12 mutations are predominant in MPN patients, Ma et al. reported that Jak2 mutations also occur in exons 13 and 15 (Ma et al. 2009) (Table 1-1). This indicates that the pseudokinase domain serves as a hot spot for mutations that lead to constitutive Jak2 activation. Based on the anti-symmetrical interface between the kinase and pseudokinase domains, most of the Jak2 mutations identified to date occur in the N-lobe of the pseudoki nase domain, which participates in the autoinhibition of the C-lobe of the kinase domain. Jak2 Fusion Mutations The first evidence for Jak2 constitutive activation in human cancers came in 1997 when the TEL-Jak2 fusion gene was identifi ed among leukemia patients (Lacronique et al. 1997; Peeters et al. 1997). The chro mosomal translocation occurred between ETV6/TEL located on 12p13 chromosome and Jak2 on 9p24, resulting in a fusion gene 33

PAGE 34

that contains the N-terminal dimerizati on domain of TEL and the C-terminal kinase domain of Jak2. The chimeric protein exhibits constituti ve kinase activation mediated by increased homodimerization. Since then, at least 14 different chromosomal translocations involving the Jak2 gene have been identified in different hematological malignancies, including both myeloid an d lymphoid disorders (Table 1-2). Chromosomal translocations between the Bcell Receptor (BCR) and Jak2 genes have been reported in atypical Chronic Myeloid Leukemia (aCML) and Acute Myeloid Leukemia (AML) (Cirmena et al. 2008; Gr iesinger et al. 2005). The human autoantigen pericentriolar material 1 (PCM 1) gene has also been implicated as a fusion partner of Jak2 in atypical CML, AML, Chronic Eosinophilic Leukemia (CEL), PMF, unclassifiable Myelodysplastic/myeloproliferative neopl asm (MDS/MPN), precursor BAcute Lymphoblastic Leukemia (B-ALL) and T-cell ly mphoma (Adlade et al. 2006; Bousquet et al. 2005; Murati et al. 2005; Reiter et al. 2005). Nebral et al. reported the fusion of Jak2 with the N-terminus of t he Paired box protein 5 (PAX5), a master regulator of Bcell development, in ALL (Coyaud et al. 2010; Nebral et al. 2009). The DNA binding domains along with the nuclear localization signal of PAX5 are fused with the Jak2 kinase domain. Therefore, the chimeric PAX5-Jak2 is located in the nucleus and is capable of binding to the wild type PAX5 target s. Interestingly, the DNA binding domain of PAX5 has not been shown to mediate dimerization and the kinase activity of the PAX5-Jak2 has not been examined. Therefore, t he effect of the fusi on partner on Jak2 activity cannot be predicted. Based on the re cent findings of histone phosphorylation by Jak2 in the nucleus (Dawson et al. 2009), it is possible that the PAX5-Jak2 affects gene expression in ALL by altering the status of histone phosphorylation. This would be 34

PAGE 35

interesting to determine as other PAX5 fu sio ns such as PAX5-TEL and PAX5-ELN have been shown to act as transcriptional represso rs via a dominant negative mechanism on wild type PAX5 (Bousquet et al. 2007). Fusion of the Single strand DNA binding protein 2 (SSBP2) with Jak2 has been reported in pr ecursor B-ALL (Poitras et al. 2008). Recently, a novel SEC31A-Jak2 fusion was identified in classical Hodgkin Lymphoma (cHL) and shown to constitutively activate the Jak-STAT pathway (Van Roosbroeck et al. 2011). Interestingly, in this case the constitutive activation of Jak2 did not depend on the WD40 repeats or the proline rich domain in SEC31A fusion partner, which facilitates protein-protein interactions. The role of the required domain of the SEC31A partner has not yet been identified. Apar t from the Jak2 fusion part ners described above, NF-E2, RUNX1 (AML1) and RPN1 have also been ident ified as putative partners involved in chromosomal translocation with Jak2 (Mark et al. 2006; Najfeld et al. 2007). Six additional chromosomal translocations invo lving Jak2 have been reported, but the fusion partners have not been id entified (Patnaik et al. 2010; Tirado et al. 2010). The functional and molecular characterization of these chimeric proteins may reveal their role in the tumorigenesis of the respective cancers. The occurrence of Jak2 fusion genes in hem atological malignancies is relatively rare when compared to that of the point mutations. While point mutations disrupt auto regulation and lead to ligand hypersensitivity in MPNs, they are not sufficient to cause a more advanced phenotype such as leukemia. However, the clinical phenotypes of Jak2 fusion genes are more aggressive than t hat of point mutations and have rapid progression to blast phase (Smith and Fan 2008) Further, in most cases of Jak2 fusion, there is a common pattern of an N-terminal dimerization domain being fused with the C35

PAGE 36

terminal Jak2 kinase domain. Yet, the differ ent fusion genes confer different clinical phenotypes. This may be ascribed to the variabilit y in the site of Jak2 fusion (Fig. 1-4). Given the role of the different JH domains on Jak2 kinase activity the variation in the clinical phenotypes observed might correlate with the Jak2 domains included in the chromosomal translocation. For example, in the case of ETV6/TEL-Jak2 fusion found in ALL and T-cell lymphoblastic leukemia, a parti al JH2 domain is present along with the entire JH1 domain. However, in the case of ETV6/TEL-Jak2 fusion present in AML, complete JH1 and JH2 domains are present. Further, the N-terminus domains from the different partner genes may influence Jak2 kinase activity by variant mechanisms of regulation. Also, the fusion mutations may o ccur in different types of somatic cells. Hence, the phenotype observed may vary based on the level of kinase activity of the chimeric protein and also the nature of the cells in which they occur. Missing Links The Jak2 tyrosine kinase was discovered in 1992 as a member of the Jak family. Howev er, several important questions regardi ng Jak2 function and its role in disease remain unanswered. To date, there is no crys tal structure available for full length Jak2. Hence, organization of the seven Jak homol ogy domains and inter-domain interactions has not been characterized. Theref ore, the allosteric regulation of Jak2 catalytic activity through the various domains is not complete ly understood. Specifically, the mechanism by which the pseudokinase mediates the autoinhibition of the kinase domain is not known. Similarly, the mechanism by which inactive Jak2 is activated by phosphorylation following ligand binding to th e receptor still remains elusive. In terms of the role of the Jak2 mutati on, V617F, it is not yet known whether the mutation is the cause or consequence of the disease pathogenesis. Further, the 36

PAGE 37

37 mystery of how one V617F mutation leads to th ree disorders is not solved. What makes the mutation capable of evading the natural negative feedback mechanism that exists in the cell? With regard to the therapeutics for MPN patients, t here are no curative treatment options yet. Jak2 tar geting using small molecule inhibitors is a new effort in the recent years. However, gi ven the role of Jak2 in seve ral important functions in the body, specific targeting of Jak2-V617F vs. WT may be important. How can such specificity be achieved and what areas should be targeted to achieve this specificity? Rationale The discov ery of Jak2-V617F has opened the doors for studies in the relatively unexplored fields of drug design, treatment strategies and clinical diagnostics for the MPNs. However, understanding the molecular me chanism of Jak2 mutations that are associated with MPNs will be important for effe ctive drug design. The mutations occur in the autoinhibitory interface between t he kinase and pseudokinase domains. Knowledge of the mechanism for constitu tive activation would also help us appreciate the unique autoinhibition property in Jak2 and its role in the regulation of Jak-STAT signaling. Further, it will help us develop specific inhibitors that w ould target the mutant Jak2 better when compared to wild type. Apart from V617F, mutations in the exon 12 region of Jak2 have also been identified in MPN patients. An interesting question at this juncture is whether there could be any differences in the structure or signaling of Jak2 exon 12 mutations when compared to that of the V617F mutation. Any difference in mechanism identified between the mutant s may help us reason the differences observed in the clinical phenotype of t he MPN patients presenting with exon 14 and exon 12 patients.

PAGE 38

Table 1-1. Jak2 mutations that oc cur in various hematalogical disor ders LOCATION (Amino acids encoded) MUTATION DISEASE REFERENCE Kinase domain (849-1123) R867Q Ch-B-ALL (Mullighan et al. 2009) D873N Ch-B-ALL (Mullighan et al. 2009) Exon 20 (858-920) T875N AMKL cell line (Mercher et al. 2006) Exon 21 (921 962) P933R Ch-B-ALL (Mullighan et al. 2009) Pseudokinase domain (545-806) I682F Ch-B-ALL (Mullighan et al. 2009) R683G DS-B-ALL (Bercovich et al. 2008; Gaikwad et al. 2009; Kearney et al. 2009; Mullighan et al. 2009) R683S DS-B-ALL (Bercovich et al. 2008; Gaikwad et al. 2009; Kearney et al. 2009; Mullighan et al. 2009) RQIns683 DS-B-ALL (Mullighan et al. 2009) Exon 16 (665 to 710) I682-D686 (IREED) del DS-B-ALL (Malinge et al. 2007) L624P MPNs (Ma et al. 2009) E627E MPNs (Schnittger et al. 2006) Exon 15 (623 to 664) I645V MPNs (Ma et al. 2009) H606Q MPNs (Ma et al. 2009) K607N AML (Lee et al. 2006) H608Y MPNs (Ma et al. 2009) L611S Ch-B-ALL (Kratz et al. 2006) V617F MPNs, CMML, JMML, RARS, AML, MDS (Lee et al. 2006; Pich et al. 2009; Remacha et al. 2006; Renneville et al. 2006; Szpurka et al. 2006; Tono et al. 2005) V617I MPNs (Ma et al. 2009) D620E+V617F MPNs (Grunebach et al. 2006; Schnittger et al. 2006) C616Y+V617F MPNs (Zhang et al. 2007) C618R+V617F MPNs (Ma et al. 2009; Yoo et al. 2009) Exon 14 (593-622) Exon 14 del MPNs (Ma et al. 2010) F557L MPNs (Ma et al. 2009) V567A MPNs (Ma et al. 2009) L579F MPNs (Ma et al. 2009) H587N MPNs (Ma et al. 2009) S591L MPNs (Ma et al. 2009) R564L, R564Q MPNs (Ma et al. 2009) Exon 13 (548-592) G571S, G571R MPNs (Ma et al. 2009) 38

PAGE 39

Table 1-1. Continued. LOCATION MUTATION DISEASE REFERENCE SH2-JH2 Linker (501-544) T514M MPNs (Ma et al. 2009) N533Y MPNs (Ma et al. 2009) F537I MPNs (Sayyah et al. 2008) K539L MPNs (Scott et al. 2007) L545V MPNs (Ma et al. 2009) F547V MPNs (Passamonti et al. 2011) F547L MPNs (Ma et al. 2009) H538QK539L MPNs (Passamonti et al. 2011; Schnittger et al. 2009; Scott et al. 2007) H538-K539del MPNs (Ma et al. 2009; Schnittger et al. 2009) E543del MPNs (Passamonti et al. 2011) N542-E543del MPNs (Passamonti et al. 2011; Schnittger et al. 2009; Scott et al. 2007) E543-D544del MPNs (Passamonti et al. 2011; Percy et al. 2007; Schnittger et al. 2009; Scott et al. 2007) D544-L545del MPNs (Schnittger et al. 2009) F537-K539delinsL MPNs (Passamonti et al. 2011; Schnittger et al. 2009; Scott et al. 2007) H538-K539delinsL MPNs (Passamonti et al. 2011; Williams et al. 2007) R541-E543delinsK MPNs (Butcher et al. 2008; Williams et al. 2007) F537I546dup10+F547L MPNs (Passamonti et al. 2011; Pietra et al. 2008) 547insLI540-F547 MPNs (Passamonti et al. 2011) I540-E543delinsMK MPNs (Butcher et al. 2008; Passamonti et al. 2011) H538DK539LI540S MPNs (Passamonti et al. 2011; Schnittger et al. 2009) I540-N542delinsS MPNs (P assamonti et al. 2011) F537-F547dup MPNs (Passamonti et al. 2011) V536-F547dup MPNs (Passamonti et al. 2011; Schnittger et al. 2009) V536-I546dup11 MPNs (Passamonti et al. 2011; Pietra et al. 2008) I540D544delinsMK MPNs (Ma et al. 2009) Exon 12 (501-547) N542-D544delinsN MPNs (Ma et al. 2009) FERM domain (37-380) Exon 8 (313-352) R340Q MPNs (Aranaz et al. 2010) aAbbreviations used: Ch-B-ALL childhood B-cell precursor acute lymphoblastic leukemia, DSdown syndrome, AMLacute myeloid leukemia, AMKL acute megakaryoblastic leukemia, CMMLchronic myelomonocytic leukemia, JMMLjuvenile myelomonocytic leukemia, MPNs myeloproliferative neoplasms, MDS myelodysplastic syndrome, RARS refractory anemia with ringed sideroblasts. 39

PAGE 40

Table 1-2. Jak2 chromosomal translocations Translocation Fusion partner Disease Reference t(9;12)(p24;p13) TEL-Jak2 T-ALL precursor B-ALL, atypical CML, MDS (Lacronique et al. 1997; Najfeld et al. 2007; Peeters et al. 1997) t(9;22)(p24;q11.2), t(9;22)(p24;q11) BCR-Jak2 atypical CML, AML (Cirmena et al. 2008; Griesinger et al. 2005) t(8;9)(p22;p24) PCM1-Jak2 atypical CML, precursor B-ALL, CEL, AML, T-cell lymphoma, PMF, MDS/MPN (Adlade et al. 2006; Bousquet et al. 2005; Murati et al. 2005; Reiter et al. 2005) del(9)(p13:p24) PAX5b ALL (Coyaud et al. 2010; Nebral et al. 2009) t(5;9)(p14.1;p24.1) SSBP2 precursor B-ALL (Poitras et al. 2008) t(4;9)(q21;p24) SEC31A-Jak2 classical Hodgkin Lymphoma (cHL) (Van Roosbroeck et al. 2011) t(9;12)(p24;q13) NFE2c MDS (Najfeld et al. 2007) add (9) (p24) and del (21)(q11.2) AML1 (RUNX1) c MDS (Najfeld et al. 2007) t(3;9)(q21;p24) RPN1 c CIMF (Mark et al. 2006) t(9;22)(p24;q11.2) Unknown B-ALL (Tirado et al. 2010) t(2;9)(p21;p24) Unknown PMF (Patnaik et al. 2010) t(8;9)(q22;p24) Unknown PMF (Patnaik et al. 2010) t(9;17)(p24;q23) Unknown PV (Patnaik et al. 2010) t(4;9)(q25;p24) Unknown PMF (Patnaik et al. 2010) t(8;9)(q13;p24) Unknown DL BCL (Patnaik et al. 2010) a Abbreviations: AML1 acute myeloid leukemia 1, BCR B-cell receptor CMLchronic myeloid leukemia, CEL chronic eosinophilic leukemia, cHL classi c hodgkin's lymphoma, CIMF chronic idiopathic myelofibrosis, DLBCL diffuse large B-cell lymphoma, ETV6 Ets variant gene 6, NFE2 nuclear factor erythroid-derived 2, PAX5 paired box gene 5, PCM1 Human autoantigen pericentriol ar material 1, PMF primary myelofibrosis, PV polycythemia vera, RPN1 ribophorin 1, SSBP2 single stranded DNA binding protein 2, T-ALL T cell ALL. b PAX5-Jak2 is not constitutively active. c Not fully characterized 40

PAGE 41

Figure 1-1. Conserved kinase architecture. Jak2 kinase do main (PDB: 2b7a). The hinge region is shown in blue, VAIK motif in gr een, glycine loop in purple, DFG loop in orange, activation loop in yellow, HRD motif in red and unique Jak2 insertion loop in ochre. 41

PAGE 42

FERM SH2like Pseudo kinase Kinase N-Terminal C-Terminal FERM SH2like Pseudo kinase Kinase N-Terminal C-Terminal JH7 JH6 JH5 JH4 JH3 JH2 JH1Exon12 H538Q/K539L Exon14 V617F pY1007 C NExon12 JH7 JH6 JH5 JH4 JH3 JH2 JH1 C NpY1007 H538Q/K539L Exon14 V617F Figure 1-2. Jak2 structure-function. Jak2 has seven homology domains: JH1 JH7. The seven Jak homology domains can be classi fied into four functional domains as indicated above. Shown is a 2D cart oon representation of the domains, not to scale. The boundaries depicted for each domain may not be accurate, since they have not been defined yet. The two major class of Jak2 mutations are the exon 14 and exon 12 mutations. These mutations are present in the pseudokinase domain and in the linker between the pseudokinase and the SH2-like domains, respectively. 42

PAGE 43

FERM Domain SH2-like Domain Pseudokinase Domain Kinase Domain Figure 1-3. The Jak2 protein structur e and hotspots for Jak2 mutations. Cartoon representation of the full length Jak2 homology model prepared using VMD 1.8.6. showing the kinase domain (tan), pseudokinas e domain (blue), SH2like domain (red) and the FERM domain (g reen). Also shown are the regions where most of the known Jak2 mutati ons occur; exon 14 (purple spheres) and exon 12 (yellow spheres) 43

PAGE 44

44 HLH TK TEL/Jak2 Coiled coil TK BCR/Jak2 HLH PK TK HLH PK TK Coiled coil TK PK SH2 PCM1/Jak2 Coiled coil TK PK SH2 SEC31A/Jak2 SSBP2/Jak2 WD40 PK TK Coiled coil TK Coiled coil TK PK SH2 LisH TK PK SH2 PAX5/Jak2 Paired TK OP HLH TK TEL/Jak2 Coiled coil TK BCR/Jak2 HLH PK TK HLH PK TK HLH PK TK HLH PK TK Coiled coil TK PK SH2 PCM1/Jak2 Coiled coil TK PK SH2 SEC31A/Jak2 SSBP2/Jak2 WD40 PK TK Coiled coil TK Coiled coil TK PK SH2 LisH TK PK SH2 PAX5/Jak2 Paired TK OP Figure 1-4. Jak2 chromosomal translocations. N-terminus domains from the different fusion partners are fused with the C-terminu s of Jak2, which includes at least the kinase domain (colored in tan). OP-Octapeptide, WD40 transducin repeat motifs terminating in W-D dipeptide, LisH LIS1 homology domain, TK Tyrosine kinase, PK pseudo kinase, SH 2 Src Homology 2, HLH Helix Loop Helix.

PAGE 45

CHA PTER 2 THE CONSTITUTIVE ACTIVATION OF JAK2-V617F IS MEDIATED BY A PI STACKING INTERACTION INVOLVING PHENYL ALANINES 595 AND 6171 Summary Somatic mutations in the Jak2 allele that lead to constitutive kinase activation of the protein have been identif ied in human disease conditions such as the myeloproliferative neoplasms (MPNs). The most common mutation in these patients is a V617F substitution mutation, which is belie ved to play a causative role in the MPN pathogenesis. As such, identifying the molecular basis for the constitutive activation of Jak2-V617F is important fo r understanding its clinical implications and potential treatment. Here, we hypothesized that c onversion of residue 617 from Val to Phe resulted in the formation of novel stacking interactions with neighboring Phe residues. To test this, we first exam ined the Jak2 structure via molecular modeling and identified a potential stacking interaction between F594, F595 and F617. Disruption of this interaction through site directed mutagenesis impaired Jak2 autophosphorylation, Jak2 dependent gene transcription and in vitro kinase activity of the Jak2-V617F protein. Further, substitution of F594 and F595 with Trp did not affect Jak2 function significantly, but replacement with charged residues did, s howing the conservation of aromaticity and hydropathy index at these pos itions. Using molecular dy namics (MD) simulations, we found that the stacking interaction between residues 595 and 617 in the Jak2-V617F 1 Reproduced with permission from The Constitutive Activation of Jak2-V617F is Mediated by a Stacking Mechanism Involving Phenylalanines 595 and 617. Biochemistry 2010 49 (46), 9972-9984. American Chemical Society. 45

PAGE 46

protein was of much greater energy and conformed to the properties of stacking, relative to the Jak2-WT or Jak2-V617F/F594A/F595A. In summary, we have identified a stacking interaction between F595 and F617 that is specific to and is critical for the constitutive activation of Jak2-V617F. Preface Jak2 is a non-receptor tyrosine kinase belonging to the Janus (Jak) family of tyrosine kinases. Jak2 is essential for life as mice that are devoid of a functional Jak2 allele die during embryonic development due to a lack of definitive erythropoiesis (Neubauer et al. 1998; Parganas et al. 1998). As such, i t plays a critical role in a number of cytokine-de pendent signaling processes including those actions that are mediated by the erythropoietin receptor (Sandberg et al. 2004; Witthuhn et al. 1993). Deregulation of Jak2 kinase activity is a common event in various types of cancer especially in hematological neoplasias su ch as the classical myeloproliferative neoplasms (MPNs). MPNs were first described by William Dameshek in 1951 as a class of stem cell derived hematological disorders that include polycythemia vera (PV), essential thrombocythemia (ET) and primary myelofibrosis (P MF). They are clinically characterized by the presence of increased peripheral red blood cells, platelets, or neutrophils along with bone marrow fibrosis, re spectively (Levine and Gilliland 2008). Unfortunately, current treatments are merely palliative in nature (Levine et al. 2007). In 2005, several research groups independently r eported a G to T transversion within exon 14 of Jak2 to be responsible for the MPN phenotype in a large percentage of afflicted individuals (Baxter et al. 2005; James et al 2005; Kralovics et al. 2005a; Levine et al. 2005; Zhao et al. 2005). This mutation manifest s as a Val to Phe substitution at position 46

PAGE 47

617 in the Jak2 protein. The Jak2-V617F mutant occurs somatically in hematopoietic stem cells and it is responsible for the consti tutive activation of Jak2, subsequent cytokine independent signaling, and pathogenesis. However, the precise molecular and biochemical events of the V617F mutation th at allow for its gain-of-function phenotype and subsequent evasion of negative feedback regulation are poorly understood. Based on structural homology, Jak2 is predicted to have a multi-domain architecture consisting of seven conserved Jak Homology (JH) domains. The C-terminal JH1 domain is a highly conserved kinase domain and is responsible for ATP binding, Jak2 activation, and substrate phosphorylation. The JH2 domain is the pseudo kinase domain. Though the structure of JH2 is simila r to the kinase domain, it was predicted to be inactive due to mutations in conserved mo tifs that were known to be required for kinase activity. Interestingly, in the absenc e of ligand, the JH2 domain inhibits the phospho-transferase activity of the kinase do main. JH2 mediated inhibition is intrinsic and does not require other regulatory protei ns. It inhibits the kinase activity noncompetitively by decreasing the maximum velocity (Vmax) of the enzyme catalysis, but does not change its substrate affinity (Km) (Saharinen et al. 2003). The V617F substitution mutation in the autoinhibitory JH2 pseudokinase domain, allows the kinase to evade this cis negative regulation by lowering its Km value for substrates (Zhao et al. 2010). Exactly how the JH1 and JH2 domains inte ract is not known. To date, the only region of Jak2 that has been crystallized is the Jak2 kinase domai n (Lucet et al. 2006). Accordingly, computational models hav e been generated and they suggest a possible JH1-JH2 interface consisting of residues D994 E1024 in the JH1 kinase domain and 47

PAGE 48

Val 617 E621 in JH2 autoinhi bitory domain (Giordanetto and Kroemer 2002; Lindauer et al. 2001). pi stacking is a non-bonded interaction wh ich can occur between aromatic molecules or those with a -orbital. In proteins, it is usually present between the side chain aromatic rings of amino acids like Phe, Tyr or Trp. stacking interactions exist in two configurations; an off-c entered parallel ring-ring inte raction (1p) and a perpendicular T-shaped ring-ring interaction (1t) (McGaughey et al. 1998). The significance of stacking interaction has been realized in base stacking amongst the nucleotide bases in DNA. It also plays an important role in cert ain DNA/protein interactions, transmembrane domain assembly, and amyloid fibril formati on in neurodegenerative disorders (Churchill et al. 2009; Fiedor et al. 2009; Gazit 2002). Colle ctively, these studies demonstrate that such energetically favorable aromatic stacki ng interactions stabilize protein structures. The observation of a Val to Phe substitution at position 617 in MPN patients suggests that its aromatic side chain could be introducing new structural conformations in Jak2 via novel stacking interactions. We therefore hypothesized that Phe 617 participates in a stacking interaction in the mutant Jak2-V617F. Using a combination of in silico methods such as protein homology modeling and molecular dynamic simulations, along with site-directed mutagenesis and in vitro cell culture studies, we conclude that the presen ce of Phe at position 617 induces strong stacking interactions with Phe 595. Furthermore, elimination of this interacti on significantly reduced the kinas e activity of the Jak2-V617F mutant protein. This stacking interaction could contribute the energy required for the stabilization of the constitutively active conformation of Jak2-V617F that is achieved by 48

PAGE 49

preventing the JH2 mediated aut oinhibition over the JH1 kinase domain. As such, by providing an improved biochemic al underst anding of how the Jak2-V617F protein maintains its constitutive kinase activity, this work may facilitate in the development of drugs that can specifically target the Jak2-V617F protein and provide effective therapy for those individuals suffering fr om Jak2-mediated disorders. Materials and Methods Homology Modeling Homology models of the Jak2 JH2 domain were generated through the SWISS MODEL server using Haematop oietic Cell Kinase as an init ial template (PDB code: 1ad5a). In addition, a full-length homology model of Jak2 that was kindly provided by Dr. Romano Kroemer (Gio rdanetto and Kroemer 2002) was used for subsequent Molecular Dynamic simulations. Molecular Dynamics Simulations The simulations were performed using t he NAMD analy sis package developed by the Theoretical and Computational Biophysics Group at the Universi ty of Illinois at Urbana-Champaign (Phillips et al. 2005). To maximize the simulation time, the fulllength homology model of Jak2 was truncated to residues 545-1123; the resulting model consisted of the JH2 pseudo kinase domain and the JH1 kinase domain. High hydrophilicity cavities inside the protein we re filled with water molecules using the program DOWSER (Zhang and Hermans 1996) and the protein was enclosed in a water box with 10 padding. Sodium and chlori de ions were added to neutralize the system. All simulations were performed using the CHA RMM force field (Brooks et al. 1983) with Particle mesh Ewald electrostatics and periodic boundary conditions. The pressure and temperature of all systems were held consta nt at 310 K and 1 atm, respectively. The 49

PAGE 50

time step for the simulations was 1 femtosecond. Initially the protein motion was restricted using harmonic constraints as the system was minimized for 0.25 nanoseconds, then the constraints were re laxed and the system wa s equilibrated for 1 nanosecond. No analysis was performed on the minimization and equilibration data. Finally, each system was simulated for 20 ns as the final production run. Plasmids and Reagents The pcDNA3 vector encoding the full-lengt h human Jak2 cDNA was a kind gift from Dr. Joe Zhao (Zhao et al. 2005). The pGEX-GST-STAT1 plasmid was graciously provided by Dr. Showkat Ali (Ali et al. 1997) The luciferase gene reporter construct, pLuc-GAS, contained four tandem copies of the Jak2 responsive interferon gamma activation sequence (GAS) response element upstream of a minimal thymidine kinase promoter and the firefly luciferase cDNA. Western blotting antibodies used for detection of Jak2 were purchased from Millipore and BioSource. The anti-Jak2 antibody used for immunoprecipitation was from Santa Cruz Biotechnology. Antibody to detect phosphoJak2 was purchased from BioSource. Anti-S TAT1 antibody was from Santa Cruz and anti phospho-STAT1 antibody was from Millipore. Site Directed Mutagenesis All mutations were created using the Quik-Change site-directed mutagenesis kit purchased from Stratagene/Agile nt Technologies. The primer s were from OriGene and Invitrogen. All mutations were conf irmed by DNA sequence analysis. Cell Culture COS-7 cells were cultured in high gluc ose DMEM (4.5g/L) with 10% fetal bovine serum at 37C and in the presence of 5% C O2. 50

PAGE 51

Transient Cell Transfections COS-7 cells were transiently transfected with 10 g of the respective plasmids using Lipofectin (Invitrogen). The transfecti on complexes were incubated with the cells for 4 hours at 37C, followed by 1 hour incubation with the T7 RNA polymerase expressing vaccinia virus, vTF-7. After 16-20 hours of recovery in serum containing media, soluble protein lysates were obtained and used for subsequent immunoprecipitation and western blotting. Immunoprecipitation Transfected cells wer e collected using 900 L of RIPA buffer per 100 mm dish of cells, in the presence of protease inhibitors. The cells were lysed further by sonication and incubated on ice for 30 min. Insoluble debris was pelleted via high speed centrifugation and the cleared supernatant was used for i mmunoprecipitation. Each supernatant was incubated with 2 g of anti-Jak2 antibody and 20 L of Protein A/G beads (Santa Cruz) at 4C with rocking for 2 hours. The beads were washed three times in Wash Buffer (25 mM Tris, pH 7.5, 150 mM NaCl and 0.1% Triton X-100) and then resuspended in SDS containing sample buffer. Western Blotting Protein samples were separated by SDS-PAGE and then transferred electrophor etically onto nitrocellulose membranes. Membranes were blocked for 45 minutes followed by 1 hour incubation with t he respective primary antibodies at room temperature. Membranes were washed thr ee times with TBST before incubation with secondary antibody and subsequent washing. Protein bands were detected using the Enhanced ChemiLuminescence method (Perki n Elmer) and X-ray film (MidSci). 51

PAGE 52

Luciferase Assay COS-7 cells cultured in 100 mm dishes were co-transfected with 5 g of the indicated Jak2 expression plasmids along with 5 g of luciferase plasmid in 60 L SuperFect (Qiagen) for 3 hours at 37C. The ce lls were then trypsinized and plated onto 6-well plates at a density of 6 105 cells per well. After 48 hours of recovery, the cells were lysed using 0.5 mL of 1X Reporter Lysis Buffer (Promega) per well. Luciferase activity in the cell lysates wa s measured as Relative Luminescence Units (RLU) in the presence of Luciferin subs trate (Promega) and ATP using a Monolight Model 3010 Luminometer (BD Biosciences). Kinase Assay COS-7 cells were transiently transfected with the indicated plasmids and Jak2 was immunoprecipitat ed as described. The Jak2 immunoprecipitates were washed twice in IP Wash Buffer and twice in Kinas e Buffer (10 mM Tris, pH 7.4, 150 mM NaCl, 10 mM MgCl2, 0.5 mM DTT and 0.5 mM ATP). GST-STAT1 was expressed in and purified from E. coli as previously described (Ali et al. 1997). Jak2 immunoprecipitates were incubated with 1 g of GST-STAT1 for 25 min at 28oC in 50 L Kinase buffer. Reactions were stopped by the addition of 4X SDS sample buffer and subsequently western blotted for phospho Jak2, phospho STAT1, total Jak2 and total STAT1 as described. Statistical Analysis All the experiments were repeated at least three times. Statistical significance of the results from luciferase assay and densitom etry of western blo tting were calculated 52

PAGE 53

using Students t -test. Distributions with p values < 0.05 and < 0.005 were considered to be signific ant with 95% and 99.5% confidence levels, respectively. Results F617 Interacts with F594 and F595 in the JH2 Do main of Jak2-V617F In order to identify the mo lecular mechanism of constitu tive activation in Jak2V617F, we examined the changes that occur in the immediat e molecular environment of amino acid 617. In the absence of a crystal structure of the JH2 domain, we analyzed the homology model of this region using t he UCSF molecular visualization software, Chimera (Pettersen E. F. 2004). The V617F mutation was introduced in the Jak2-WT model and the rotamers of the mutated am ino acid were optimized based on torsion angles and steric hindrances (Fig. 2-1A and 2-1B). Distance between the nearest carbon atoms of the residues 617, 594, and 595 in both Ja k2-WT and Jak2-V617F were determined (Fig. 2-1C and 2-1D). It was found that the dist ance between F594/F595 and the amino acid at position 617 in Jak2-V 617F (F617) was less than that in Jak2-WT (V617). Based on the homology models and rotamer optimization of both the native and V617F JH2 domains, we hypothesized that the V617F mutation resulted in the formation of an aromatic-aromatic stacking ( stacking) interaction between the residues F594, F595 and F617, which was abs ent in Jak2-WT. In summary, using homology modeling we identified possible stacking interactions between the mutated F617 and residues F594 and/or F595. Potential Stacking Interaction betw een the Residues 617 and 595 is Stronger in Jak2-V617F than Jak2-WT As a next step, we wanted to vali date the homology model results using Molecular Dynamics (MD) simulations. MD simulation explicitly calculates the forces 53

PAGE 54

between all atoms of a system integrated over a period of time, mimicking the natural motion of atoms in a physiological environm ent and hence, allowing for an examination of the effect of a specific mutation in the context of an entire molecule. For Jak2-WT, we found that V617 predom inantly interacts with V1000 in the activation loop of the JH1 domain and has a very weak interaction with F595 (Fig. 2-2A and Obj. 2-1). Due to the autoinhibition of the JH 2 domain over JH1, the activation loop that includes residues Y1007 and Y1008 remains buried within the ki nase domain in an inactive state. In contrast, the simulation of Jak2-V617F showed that the interaction between F595 and F617 significantly strengthened over time while the interaction between F617 and V1000 weakened (Fig. 2-2B and Obj. 2-2). Howe ver, the interaction between F594 and F617 did not change. Because of the stronger interaction between F595 and F617, the interaction of 617 in the JH2 domain with 10 00 in the JH1 domain was broken, resulting in the movement of the kinas e domain activation loop away from the inhibitory JH2 domain. This motion of the activation loop, which was specifically observed in V617F, could have potentially shifted Y1007 and Y1008 to a more favorable conformation that was suited for Jak2 activation. Thus, the MD simulations of Jak2-WT and Jak2-V617F represent the inactive and active states of the enzyme, respectively. Presumably, conversion of the F594/F595 ar omatic rings to A594/A595 would disrupt any potential stacking interaction with the aromatic F 617 in the V617F mutant. Therefore, we introduced the F594A and F595A mutations into the Jak2-V617F model and observed that the F617 shifted its interaction from 595 back to V1000 in the JH1 domain (Fig. 22C and Obj. 2-3). This was followed by an a ccompanying shift in the conformation of the activation loop back to a native-like, inactive state. 54

PAGE 55

In order to understand the significance of these changes induced by the V617F mutation at the JH1-JH2 interface, we co mpared the average energy of the non-bonded interactions that occur between resi dues 617-595 and 617-1000 in Jak2-WT, V617F and V617F/F594A/F595A using the NAMD energy plug-in. In the case of energy between 595 and 617, the values of the mean interaction ener gy were found to be -1.87 kcal/mol for Jak2-WT, -3.4 kcal/mol for Jak2-V617F and -0.77 kcal/mol for Jak2V617F/F594A/F595A (Fig. 2-2D). These result s indicate that the interaction between 595 and 617 in Jak2-V617F was stronger than in Jak2-WT or Jak2V617F/F594A/F595A. Further, an increase in the interacti on between F595 and F617 should cause changes in the interaction at the JH1-JH2 interface. Specifical ly, we compared the change in distance and interaction ener gy between residues 617 and 1000 amongst Jak2-WT, V617F and V617F/F594A/F595A. The mean values of the non-bonded interaction energy between 617 and 1000 were f ound to be -0.69 kcal/mol for Jak2-WT, -0.14 kcal/mol for Jak2-V617F and -1.55 kcal /mol for V617F/F594A/F595A (Fig. 2-2E). Accordingly, we observed that as the in teraction between 595 and 617 strengthened in Jak2-V617F, simultaneously, the distance between residues F617 (JH2) and V1000 (JH1) increased (Fig. 2-2F). The increase in this distance was also accompanied by a reduction in the interaction energy relative to Jak2-WT. However, when F594 and F595 were mutated to alanine in Jak2-V617F, the distance between residues 617 and 1000 decreased while the interaction energy increased. Interestingly, the distance and energy of interaction between 617 and 1000 in V617F/F594A/F595A were comparable to that of Jak2-WT. 55

PAGE 56

Collectively the data in Fig. 2-2 indicate that the interaction between F595 and F617 in Jak2-V617F replaces the one betw een V617 and V1000 in Jak2-WT, thereby reducing the interaction between JH1 and JH2 domains. Furthermore, mutation of the aromatic Phe at positions 594 and 595 to Ala weakens the interaction with F617 and thereby restores the interaction between F6 17 in the JH2 domain and V1000 in the JH1 domain. Finally, the simulations indicate that there is no direct interaction between F594 and F617, though the F594A mutation affe cts the interaction between the JH1and JH2 domains. Potential Stacking Interaction betw een 595 and 617 is Critical to the Constitutive Activation of Jak2-V617F We next wanted to observe the effects of the V617F and F594A/F595A mutations in the context of the overall JH1-JH2 in teraction and hence the conformation of the kinase domain. To do this, we generated surfac e representations of the Jak2 proteins using the Visual Molecular Dynamics (VMD) viewer (Humphrey et al. 1996). As shown in Figure 2-3A, the V617-V1000 interaction is involved in forming the interface between the JH1 and JH2 domains. Upon mutation of V 617 to F617, this interaction is lost causing the JH1 and JH2 domains to move apart. However, the F594A/F595A mutation restores the interaction of F617 in the JH2 domain with V1000 in the activation loop thus bringing the JH1 and JH2 domains closer together. This change in distance between the JH1-JH2 domains caused by the muta tions also affects the change in the conformation of the active site (Fig. 2-3B ). Specifically, there was a change in the interaction between N859 in t he nucleotide-binding loop (G856-G861) that binds the phosphate of ATP and M1064 in the unique Jak2 insertion loop (S1056-I1078). We measured the distance of interaction between the two residues amongst Jak2-WT, 56

PAGE 57

Jak2-V617F and Jak2-V617F/594A/F595A ( Fig 2-3C). We observed that N859 and M1064 interact closely in Jak2-WT. This inte raction appears to close the active site and prevent the binding of substr ate and ATP, thereby creating an inactive kinase state. In Jak2-V617F, there was an increase in the distance between N859 and M1064. This indicated that the interacti on between the nucleotide binding loop and the insertion loop was lost, thereby opening the active site to resemble an active kinase state. However, when F594 and F595 were mutated to Ala in t he context of Jak2-V617F, the interaction between the nucleotide binding loop and the insertion loop was partially restored resulting in a constrained entrance to the ac tive site and theref ore reduced accessibility to ATP and substrates. Collectively, Figure 2-3 illustrates the disruptive effect of the V617F mutation on the JH1-JH2 interaction, which in turn induc es changes in the active site conformation of the kinase domain, thus resulting in a consti tutively active kinase state. However, this effect is reversed upon introducing the mu tations F594A/F595A, again emphasizing the role of F594 and F595 in the mechanism fo r Jak2-V617F constitu tive activation. F594, F595, and V617 are Conserved across Diverse Species and amongst Jak1, Jak2 and T yk2, but not Jak3 To further understand the role of F594 and F595 in Jak2-V617F function, we examined the amino acid sequence conservati on at these positions. Multiple sequence alignment of the Jak2 protei n sequence from a diverse variety of species confirmed that all three residues, F594, F595 and V617 were completely conserved (Fig. 2-4A). This appears to convey the evolutionary significanc e of these three amino acids at their respective positions. Next, we examin ed the conservation of F594, F595 and V617 amongst the other members of the human Jak kinase family Interestingly, we found 57

PAGE 58

that only F594 was conserved amongst all family members (Fig. 2-4B). At position 595, aromatic amino acids were present in Ja k1, Jak2 and Tyk2, but not Jak3, which had Leu, an aliphatic amino acid. Nevertheless, the hydropathy index at the position 595 was highly conserved amongst all the Jak fa mily members. Hence, hydrophobicity and aromaticity of the am ino acid side chain present at 595 may contribute towards the regulation of Jak2 activation. Mutation of F594, F595 to Ala Reduc ed Jak2-V617F Autophosphorylation and Kinase Activity Phosphorylation at Y1007 is required for maximal Jak2 ca talytic activity (Feng et al. 1997) and the Jak2-V617F mutant is know n to be hyper-phosphorylated at this position (Kundrapu et al. 2008). T herefore, based on our in silico studies (Fig. 2-1 to 24), we hypothesized that the interaction between F594, F595 and F617 is important for Jak2-V617F hyper-phosphorylation at Y1007. To test this, we used site directed mutagenesis to determine whether mutation of F594 and F595 to Ala, either individually or in combination, would affect Jak2-V617F autophosphorylation. For this, COS-7 cells were transfected with either 10 g each of empty vector, Jak2-WT, Jak2-V617F, Jak2V617F/F594A, Jak2-V617F/F595A or Jak2 -V617F/F594A/F595A plasmids. The following day, phosphorylation at pY1007 was determined via immuno-precipitation with anti-Jak2 antibody and western blot analys is with anti-phospho Jak2 (pY1007/pY1008) antibody. We found that the Jak2-V617F displa yed higher levels of autophosphorylation relative to Jak2-WT (Fig. 25A, Top). However, mutation of either F594 or F595 alone, or both in combination, reduced Jak2 -V617F autophosphorylation. The same membrane was re-probed with anti-Jak2 antibody in order to determine the levels of total Jak2 protein (Fig. 2-5A, Bo ttom). The levels of pY1007/pY1008 58

PAGE 59

autophosphorylation, normalized to tota l Jak2 protein from five independent experiments, were then graphed (Fig. 2-5B). The cumulative results indicate that mutation of either F594 or F595 alone, or bot h in combin ation, significantly reduced Jak2-V617F autophosphorylation. Having examined the effects of F594A /F595A on Jak2 autophosphorylation, we next wanted to determine the effects of F594A/F595A on Jak2-V617F mediated substrate phosphorylation. GST-STAT1, expre ssed and purified from E. coli, was used as a Jak2 kinase substrate. Jak2 prot ein was immunoprecipit ated from transfected COS-7 cells as described above and the imm unoprecipitates were incubated with the GST-STAT1 substrate. Afte r terminating the kinase reactions, the samples were separated by SDS-PAGE and western blotte d for phospho-STAT1, phospho-Jak2, total STAT1 and total Jak2. A representative blot is shown as Fig. 2-5C and the ratios of phospho-STAT1 to total STAT1 from three in dependent experiments are shown as Fig. 2-5D. Consistent with the autophosphorylation results, Jak2-V617F was hyper-kinetic relative to Jak2-WT in phosphorylating STAT1. However, mutations at either F594 or F595, or both in combination, significant ly reduced the ability of Jak2-V617F to phosphorylate the GST-STAT1 substrate. In summary, a Jak2-V617F protein that ca rries mutations of either F594A or F595A, or both in combination, had sign ificantly reduced autophosphorylation and phospho-transferase activity when compared to Jak2-V617F. As such, the data indicate that both F594 and F595 play im portant roles in the activation and subsequent catalytic activity of Jak2-V617F. 59

PAGE 60

Interaction between F594, F595 and F617 is Important for Jak2 Dependent STAT1/3 Mediated Gene Transcription Once phosphorylated by Jak2, STAT proteins dimerize and translocate into the nucleus to modulate gene transcription (Darne ll et al. 1994). Therefore, we next wanted to determine how the F594A/F595A mutati ons would affect STAT signaling and gene transcription downstream of Jak2-V617F. For th is, we used a luciferase construct in which four copies of the STAT responsiv e Gamma Interferon Ac tivation Sequence (GAS) were placed upstream of a minimal thymidine kinase promoter and the firefly luciferase cDNA. COS7 cells were co-transfected with the luciferase construct and the respective Jak2 plasmids. Luciferase activi ty was then plotted as a function of Jak2 mutation status. We found that expression of Jak2-V617F resulted in >2000 times more luciferase activity when compared to Jak2-W T (Fig. 2-6). However, mutation of either F594 or F595 alone, or both in combination, si gnificantly reduced the luciferase activity of Jak2-V617F to levels that were similar to Jak2-WT. Interestingly, ~2-fold increase in the Jak2-V617F kinase activity (Fig. 2-5) co rrelated with a ~2,000-fold change in gene transcription (Fig. 2-6). This indicates the amplification power of kinase activity via downstream signaling proteins which may be due in part to either in trinsic structural changes in the kinase caused by the muta tion and/or reduced activity of negative regulatory proteins such as the SOCS. Collectively, the data demonstrate t hat the reduced auto phosphorylation and phospho-transferase activity of the F594A and F595A mutants correlates with impaired Jak2-mediated gene transcription. 60

PAGE 61

Interaction betw een F594, F595 and F 617 is a Unique Property of Jak2-V617F While we observed that mutation of F594 or F595 affects the activation, catalytic activity and downstream gene transcription in Ja k2-V617F (Figs. 2-4 to 2-6), we next wanted to determine whether these residues were specific for Jak2-V617F, as opposed to Jak2-WT. The homology modeling and MD simulations of Jak2-WT show a lack of interaction between F594/F595 and V617, as there is no aromatic ami no acid at position 617 in Jak2-WT protein. Therefore, we hypothesized that if F594 and F595 were mutated to Ala in the context of Jak2-W T, there would not be any effect on Jak2 autophosphorylation as ther e is no strong interacti on between 594/595 and 617. To test this, we introduced the F594A /F595A mutations into Jak2-WT and then measured the ability of the mutant protei n to autophosphorylate. COS-7 cells were transfected with 10 g each of empty vector, Jak2-WT, Jak2-WT/F594A/F595A, Jak2V617F, or Jak2-V617F/F594A/F595A. The follo wing day, Jak2 was immunoprecipitated and probed for phosphorylation at Y1007 and Y1008 via Western blot analysis. A representative blot is shown as Fig. 2-7A and the aggregate data from five independent experiments is shown as Fig. 2-7B. When no rmalized to total protein, we found that the autophosphorylation levels did not significantly change between Jak2-WT and Jak2WT/F594A/F595A. Conversely, for the Jak2-V617F construct, there was a statistically significant reduction in autophosphorylati on when the F594A/F595A mutations were introduced. Overall, the data in Fig. 2-7 confirmed that the interacti on between F594/F595 and F617 is specific to Jak2-V617F due to its aromatic nature and for that reason mutation of F594 and F595 does not affect the autophosphorylat ion capacity of Jak2-W T. 61

PAGE 62

The Side Chain Structure and Hydrophobi city of Amino Acids at 594 and 595 are Important for the Autophosphorylation of Jak2-V617F Our hypothesis is that an aromatic stacking interaction between F594/F595 and F617 in the Jak2-V617F protein is critical for its constitutive activation. The data in Figs. 2-4 to 2-6 show that conversion of either F594 or F595 to Ala impairs the ability of the Jak2-V617F protein to autophos phorylate, phosphorylate a GS T-STAT1 substrate, and mediate gene transcription, respectively. It is also known that substitution of V617 with Trp causes Jak2 constitutive activation similar to V617F (D usa et al. 2008). We therefore reasoned that mutation of F594 and/ or F595 to another aromatic amino acid such as Trp (W) would reconstitute the stacking interaction with 617 and mimic the activity of the Jak2-V617F protein. Furthe rmore, we wanted to determine if a charge based interaction between 594/595 and 617 was sufficient to confer constitutive activation of the Jak2 protein. To determine this, COS-7 cells were trans fected with the indicated plasmids and Jak2 autophosphorylation levels at Y1007/Y1008 were determi ned via IP/western blot analysis. Fig. 2-8A shows a representative blot and Fig. 2-8B shows the cumulative results from three independent experim ents. We again found that V617F had significantly higher autophosphorylation when compared to Jak2-WT. Conversion of F594/F595 to Trp, in the context of V 617F mutant protein seems to reduce its autophosphorylation levels relative to Jak2-V617F. The V617W mutant had autophosphorylation levels that were sim ilar to V617F and above Jak2-WT. Placement of Trp at all three positions (V 617W/F594W/F595W) slightly reduced its autophosphorylation capacity relative to Jak2-V617W. However, there was no statistically significant difference in the autophosphorylation of Jak2-V617F, Jak262

PAGE 63

V617F/F594W/F595W, Jak2-V617W and Jak2-V617W/F594W/F595W. Finally, when the aromati c interaction was substituted with a charge based interaction using Lys (K) and Glu (E), we found that the V617K/F594 E/F595E and V617E/F594K/F595K mutants had significantly reduced aut ophosphorylation relative to Jak2-V617F. To test the effect of these same mu tations on Jak2-mediated gene transcription, we conducted the Jak2-mediated luciferase a ssay with these constructs. As seen in Fig. 2-8C, the gene transcription levels of Jak2 -V617F were at least 2000 fold higher than the WT, in accordance with our previous result s (Fig. 2-6). Interesti ngly, the luciferase activity of the V617F sample did not change when F594 and F595 were mutated to Trp. The V617W mutant generated luciferase activi ty that was ~2-fold higher than V617F while that of the V617F/F594W/F595W and V617W/F594W/F595W mutants were similar to V617F. However, there was a marked reduction in the luminescence when 617, 594 and 595 were converted to charged residues, relative to Jak2-V617F. In summary, substituting Phe with another aromatic and hydrophobic residue, Trp at position 617, 594 and 595 affected Jak2 -V617F phosphorylation moderately. However, this small change in phosphorylati on did not significantly affect downstream STAT mediated gene transcription as viewed from the luciferase assay. This variation in results could be due to the difference in sens itivity of the two assays or because the change in autophosphorylation did not significantly affect downstream STAT activation. Finally, changing the nature of the 594/595/617 interaction to a charge based interaction using Lys and Glu, which are basic/acidic and hydrophilic, resulted in significantly reduced Jak2 autophosphorylatio n and Jak2 mediated gene transcription. Collectively, 63

PAGE 64

these results underscore the im portance of both the hydropathy index an d aromaticity of amino acids at 594, 595 and 617 for constituti ve activation of Jak2-V617F (Table 2-1). Validation of the Stacking Interaction betw een 594/595 and 617 In order to formally demonstrate the stacking nature of interaction between 594/595 and 617, we measured three standard parameters t hat are used to define stacking interactions: centroid distance, theta (azimuthal) and gamma (yaw) angles (McGaughey et al. 1998). Gamma is the angle between the two normal vectors, keeping F595 as the reference (Fig. 2-9A). Theta is the solid body azimut hal angle of rotation between the centroid and the normal vector s (Fig. 2-9B). We compared these parameters between Jak2-WT (Obj. 2-4), Jak2-V617F (Obj. 2-5) and Jak2V617F/F594A/F595A in order to confirm that the stacking interaction between 594/595 and 617 is specific to Jak2-V617F. The distribution for centroid distance in Jak2-WT was unimodal and had a peak around 5.5 Fig. 2-9C). In Jak2-V617F however, it was of bimodal nature with peaks at 5.5 and 6.5 These bimodal peaks are consistent with previous reports demonstrating that the distribution of centro id distances between residues participating in -stacking interactions is bimodal (Mc Gaughey et al. 1998). When F594 and F595 were mutated to alanine in the context of V617F, the bimodal distribution was lost and the distance between 595 and 617 increased. After correcting for spherical polar and Euler probability bias (McGaughey et al. 1998), the gamma and theta angles calculated for each of the Jak2 simulations were plotted as probability densities. With respec t to the gamma angle, for Jak2-WT, the probability density was at it s minimum near 0 and generally increased while 64

PAGE 65

approaching 90. In contrast, for Jak2-V617F the probability was at its maximum near 0 and generally decreased while approaching 90. Again, the Jak2V617F/F594A/F595A behaved very similar to Jak2-WT in that the probability density was at its minimum near 0 and increased as it approached 90. In the case of the theta angle, the probability density for Ja k2-WT generally decreased from 0o to 90o with no specific peak distribution. In contrast, t he probability density for the Jak2-V617F mutant had a clear peak around 25. Finally, for th e Jak2-V617F/F594A/F595A mutant, the distribution increased from 0o to 90o, but without a clear peak dist ribution. Overall, both the theta and gamma angle distributions for Jak2-V617F were consistent with distribution patterns for a stacking interaction orientat ed in an off-centered parallel configuration (McGaughey et al. 1998). Thus, the data in Fig. 2-9 support the existence of a stacking interaction between F595 and F617 in Jak2-V617F in an off-centered parallel orientation. This stacking interaction is specific to Jak2-V617F due to the aromatic nature of the participating Phe at both positions. Discussion Due to its causative role in a number of hematopoietic disorders, the Jak2-V61 7F mutation has become an area of intense inve stigation. For example, studies have attempted to quantify its mutant allele frequency in the MPN patients, identify its downstream signaling targets, and develop inhibitors that specifically block it (Kiss et al. 2010; Tefferi 2010; Vannucchi et al. 2008). In this study, we used a combination of in silico and in vitro studies to identify the mechanism of constitutive activation of the Jak2V617F protein. Here, we report that a specific stacking interaction between F617 and 65

PAGE 66

F595 reliev es the autoinhibition of the JH2 domai n over the JH1 domain, resulting in the constitutive activation of the protein. We found that the nature of inte raction between F595 and F617 was stacking by comparing the centroid distance, thet a and yaw angles between Jak2-WT and Jak2V617F/F594A/F595A. The centroid distance of the measured stacking interaction is within the expected range of 4.5-7.0 (Burley and Petsko 1985). Based on the theta and gamma angles, we found that F617 intera cts with F595 in an o ff-centered parallel interaction. Henceforth, the V617F mutati on disrupts the intera ction between the JH2 and JH1 domains at the previously described I-1 and I-2 interfaces (Lee et al. 2009a; Lindauer et al. 2001), by forming a stacking interaction with F595 in the -helix. Calculation of the energy bet ween 595 and 617 indicate that this interaction in Jak2V617F was twice as stable as that in Jak2-WT. However, when both F594 and F595 were mutated to alanine in the context of Jak2-V617F, we found that the interaction between 595 and 617 was only half as stable as Jak2-WT and one-fifth of Jak2-V617F, thus reiterating the contribution of this in teraction towards Jak2-V617F activation (Fig. 22D). The stacking nature of the F 595-F617 interaction serves as the energy source to cause the shift in conformation of Jak2-V617F to an active form even in the absence of ligand. Thus, the interaction between the JH 1 and JH2 domains at the I-2 interface is critical for Jak2 autoinh ibition and a competitive stacking interaction between F595 and F617 in the JH2 domain can disrupt this interface. Using MD simulations, a previous report by Lee et al also identified a critical role for F595 in Jak2 constitutive activation (Lee et al. 2009a). Our results here agree with the Lee et al results regarding the three interfac es between the JH1 and JH2 domains. 66

PAGE 67

Howev er, differences between their data and our data do exist. For example, in the inactive state, Lee et al. found that V617 interacts with L1001 and K1030 while we found that V617 interact s principally with V1000 and to a lesser extent with L1001. Our data is supported by the observations that V617F mutation weakens the bonding energy between residues 617 and 1000 and increases t he distance between these two amino acids. Using in vitro based cell assays, Dusa et al similarly found a critical role for F595 in constitutive Jak2-V617F activation (Dus a et al. 2010). Our results here again confirm the critical role of F595 in Jak2-V617F activation and also extend that work by identifying the mechanism of Jak2-V617F activation; namely, an energetically favorable off-centered parallel stacking interaction between F595 and F617. Additionally, we report for t he first time the critical role of F594 in Jak2-V617F constitutive activation. Though we found no direct interaction between F594 and F617, we believe F594 facilitates Jak2-V617F constitutive activation via one of two mechanisms. First, F594 may provide the appr opriate structural environment for the F595/F617 stacking interaction to exist. In ot her words, F594 may keep F595 in a position that is favorable to interacting with F617. Secondly, it is possible that a stacking interaction exists between F594 and F595. However, if it does exist, our data indicates that it would be quite weak. Irrespective of the mechanism, our data demonstrate the vital role of F594 as the F594A mutation alone significantly reduced the autophosphorylation, phospho-transferase activity, and STAT mediated gene transcription of Jak2-V617F (Figs. 2-5 and 2-6). Residues F594, F595 and V617 are highly conserved in Jak2 amongst a diverse number of species implicating their critical role in enzyme function. The hydropathy 67

PAGE 68

index and s ide chain structure of the amino acids is conserv ed at all the three positions amongst the JAK family members, except Ja k3. Interestingly, mutations that are homologous to Jak2-V617F in Jak1 (V658F) and Tyk2 (V678F) also confer constitutive kinase activity (Staerk et al. 2005). Based on our results here, we believe that the homologs to F594/F595 in Jak1 and Tyk2 may also play a critical role in the constitutive activation of these mutations In support of this, Dusa et al. have demonstrated that the F595A homologous mutation in Jak1 (F636A), blocks constitutive activation of the V658F mutant (Dusa et al. 2010). Interestingl y, in the case of Jak3, the homolog to V617 is M592, which is a conserved substitu tion. However, when it is mutated to Phe (M592F), the mutation does not confer constitu tive activity. An explanation for this may be that F595 is not conserved in Jak3 so no stacking interaction is formed between the Jak3 homologs of 595 and 617. Therefore, the mechanism of Jak3 constitutive activation may be different from other JAK family members such as Jak2. Given the causative role that Jak2 soma tic mutations play in pathogenesis of a number of hematological diso rders, numerous groups, incl uding our own, have sought to identify inhibitors that block Jak2 kinase activity (Kiss et al. 2010). In these reports, the ATP binding pocket within the JH1 domain of Jak2 was targeted for inhibition. Consequently, it was not surprising to see th at these inhibitors also have significant inhibitory potential on wild type Jak2 protein. The significance of our work here is that with the identification of an important off-centered parallel stacking interaction between F595 and F617 along with the critical role of F594 in Jak2-V617F constitutive activation, we have provided new mechanisms and target sites that could potentially 68

PAGE 69

allow for the development of ant i-Jak2-V617F inhibitors, which will have little to no effect on wild type kinase ac tivity. In summary, using an inter-disciplinary combination of in silico and in vitro based methodologies, we have characterized the biochemical mechanism by which the Jak2V617F protein confers constitutive activation Furthermore, we are the first to identify the importance of F594 in Jak2-V617F constituti ve activation. Collectively, these results advance our understanding of how the Jak2-V 617F protein contributes to human disease. 69

PAGE 70

Object 2 -1. Interactions at the JH1-JH 2 interface in Jak2-WT (.mov file 5MB) Object 2-2. Interactions at the JH1-JH2 interface in Jak2-V617F (.mov file 5MB) Object 2-3. Interactions at the JH1-JH2 interface in Ja k2-V617F/F594A/F595A (.mov file 4MB) Object 2-4. stacking interaction in Ja k2-WT (.mov file 13MB) Object 2-5. stacking interaction in Jak2-V617F (.mov file 17MB) 70

PAGE 71

Table 2-1. Comparison of the side c hain structure and hydr opathy index of the respective amino acids that were used for side directed mutagenesis at 594, 595 and 617 RESIDUE SIDE CHAIN STRUCTURE HYDROPATHY INDEX* Phe (F) 2.8 Trp (W) -0.9 Lys (K) -3.9 Glu (E) -3.5 Ala (A) 1.8 71

PAGE 72

72 A. C. B. D.F595 V617 F594 Jak2-V617F Jak2-WT4.78 8.97 F595 F617 F5943.77 3.40 A. C. B. D.F595 V617 F594 Jak2-V617F Jak2-WT4.78 8.97 F595 F617 F5943.77 3.40 Figure 2-1. The V617F mutation induces a possible stacking interaction between F594, F595 and F617 in Jak2. (A, B) Cartoon representations of the Jak2-WT and Jak2-V617F JH2 domain homology models, respectively, generated using SWISS MODEL and visualized with Chimera. (C, D) The distances between F594 (white), F595 (yellow) and 617 (magenta) were lesser in Jak2V617F when compared to Jak2-WT. All the distances were calculated using the Structural Analysis tools in Chimera.

PAGE 73

C. Jak2-V617F-F594A-F595A F594F595 F617 Y1007, Y1008 F617 Y1007, Y1008 V1000 A595 A594 JH2 JH1A. Jak2-WT V617 Y1007, Y1008 V1000 F595 F594 JH2 JH1B. Jak2-V617F F617 Y1007, Y1008 V1000 F595 F594 JH2 JH1E. D. F. C. Jak2-V617F-F594A-F595A F594F595 F617 Y1007, Y1008 F617 Y1007, Y1008 V1000 A595 A594 JH2 JH1A. Jak2-WT V617 Y1007, Y1008 V1000 F595 F594 JH2 JH1B. Jak2-V617F F617 Y1007, Y1008 V1000 F595 F594 JH2 JH1E. D. D. F. Figure 2-2. A potential stacking interaction between F595 and F617 in Jak2-V617F weakens the interaction between F 617 and V1000. Snapshot s of the MD simulations for Jak2-WT (A), Jak2-V617F (B), and Jak2-V617F/F594A/F595A (C) at 20 ns focusing on the JH1 (orange) JH2 (cyan) interface. Amino acid 594 is highlighted in light green, 595 in dark green, 617 in mauve and 1000 in white. The activation loop is shown in yellow and the residues Y1007 and Y1008 are shown in blue. (D) Com parison of the non-bonded energy calculated between the residues 595 and 617 amongst Jak2-WT (black), Jak2-V617F (red) and Jak2-V617F/F594A /F595A (blue) using NAMD energy. (E) Comparison of the non-bonded ener gy calculated amongst Jak2-WT (black), Jak2-V617F (red) and Jak2-V617F/F594A/F595A (blue) using NAMD energy. (F) Comparison of the distance calculated between the specific carbon atoms of 617 and 1000 amongst Jak2-WT (black, V617 CB and V1000 CB), Jak2-V617F (red, F617 CZ and V1000 CB) and Jak2V617F/F594A/F595A (blue, F617 CZ and V1000 CB) using the VMD graphics tools. 73

PAGE 74

JH1 JH2JH1 JH2JH1 JH2A. B. JH1 JH1 JH1 N859 M106 4 N859 M106 4 N859 M106 4 JH1 JH2JH1 JH2JH1 JH2B. JH1 JH1 JH1 N859 M1064 N859 M1064 N859 M1064 0 5 10 15 20 25 30 35 40 0100200300400500600 Time (250ps steps)Distance ()C.Jak2-WT Jak2-V617F Jak2-V617F/F594A/F595A859 -1064 JH1 JH2JH1 JH2JH1 JH2A. B. JH1 JH1 JH1 N859 M106 4 N859 M106 4 N859 M106 4 JH1 JH2JH1 JH2JH1 JH2B. JH1 JH1 JH1 N859 M1064 N859 M1064 N859 M1064 0 5 10 15 20 25 30 35 40 0100200300400500600 Time (250ps steps)Distance ()C.Jak2-WT Jak2-V617F Jak2-V617F/F594A/F595A859 -1064 Figure 2-3. A potential stacking interaction between F595 and F617 alters the JH1JH2 interaction and active site conforma tion in Jak2-V617F. (A) Snap shots of the surface representati ons of the JH1 (orange) and JH2 (cyan) domains generated in VMD viewer from the MD simulations of Jak2-WT, Jak2-V617F, and Jak2-V617F/F594A/F595A at 20 ns. The activation loop is shown in yellow, with the residues Y1007/Y1008 in blue, V1000 in white, V/F617 in mauve, and F595 in green. Distance between the JH1 and JH2 domains is represented by the white double-headed arro w. (B) Cartoon representation of the JH1 kinase domain for Jak2-WT, Jak2-V617F and Jak2V617F/F594A/F595A, displaying the active site conformation. N859 is shown in magenta, catalytic loop is shown in cyan (K970-N981), activation loop (D994-E1024) in yellow and the unique Ja k2 insertion loop (S1056-I1078) is shown in ice blue (top). The change in distance between the two is indicated by a white double-headed arrow in a magnified view of the active site (bottom). (C) Comparison of the dist ance calculated between the specific carbon atoms of 859 and 1064 amongst Jak2-WT (black, N859 CG and M1064 CE), Jak2-V617F (red, N859 CG and M1064 CE) and Jak2V617F/F594A/F595A (blue, N859 CG and M1064 CE) using the VMD graphics tools. 74

PAGE 75

590 619 590 619 590 619 590 619 Figure 2-4. Jak2 sequence conservation at F594, F595 and V617. Multiple sequence alignment of the human Jak2 primary amino acid sequence with different species (A) and with other human JAK family members (B). Sequence conservation at F594 and F595 are highli ghted in blue and that at position V617 is shown in orange. The non-conserved amino acid at 595 is highlighted in pink and that at 617 is shown in green. The reference sequence positions are indicated for human Jak2 protein. 75

PAGE 76

D. B. * ** 0 50 100 150 200 250 300 350 400 EmptyWTV617FV617F F594A V617F F595A V617F F594A F595AJak2 Phosphorylation %WT 0 50 100 150 200 250 EmptyWTV617FV617F F594A V617F F595A V617F F594A F595ASTAT1 Phosphorylation %WTC. V617F / F595A V617F / F594A / F595A V617F / F594AIB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAb IB = anti-STAT1 pAb IB = anti-pY701STAT1 pAbEmpty WT V617F Jak2(pY1007/ pY1008) Jak2 STAT1 (pY701) GSTSTAT1 111 111 111 111Jak2(pY1007/ pY1008) A.IP = anti-Jak2 pAb IB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAb 111 V617F / F594A / F595A Empty WT V617F / F595A V617F / F594A V617F 111 Jak2 D. B. * ** 0 50 100 150 200 250 300 350 400 EmptyWTV617FV617F F594A V617F F595A V617F F594A F595AJak2 Phosphorylation %WT 0 50 100 150 200 250 EmptyWTV617FV617F F594A V617F F595A V617F F594A F595ASTAT1 Phosphorylation %WTC. V617F / F595A V617F / F594A / F595A V617F / F594AIB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAb IB = anti-STAT1 pAb IB = anti-pY701STAT1 pAbEmpty WT V617F Jak2(pY1007/ pY1008) Jak2 STAT1 (pY701) GSTSTAT1 111 111 111 111Jak2(pY1007/ pY1008) A.IP = anti-Jak2 pAb IB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAb 111 V617F / F594A / F595A Empty WT V617F / F595A V617F / F594A V617F 111 Jak2 Figure 2-5. Mutation of F594 and F595 to Ala impairs the autophosphorylation and kinase activity of Jak2-V617F. A) CO S-7 cells were transfected with 10 g of the indicated plasmids and the following day, Jak2 protein was immunoprecipitated from the transfe cted cells and western blotted for phospho-Jak2 to detect autophosphorylat ion at Y1007 and Y1008 (Top). The membrane was stripped and re-probed for total Jak2 (bottom). (B) Jak2 autophosphorylation was quant ified using densitometry for at least five independent experiments and plotted as a function of Jak2 mutation status. (C) Immunoprecipitated Jak2 from COS7 cells transfected with the indicated plasmids was allowed to phosphorylate 1 g of GST-STAT1 in vitro PhosphoSTAT1 and phospho-Jak2 levels were det ected by Western blot analysis. The membranes were stripped and re-probed fo r total STAT1 and total Jak2. (D) Phosphorylation of GST-STAT1 was quant ified using densit ometry from at least three independent ex periments and the levels for each mutant were plotted as a function of Jak2 mutation status. Values are expressed as mean S.D, p < 0.05, **p < 0.005 (Student's t -test) 76

PAGE 77

** 0 500 2000 2500 3000** ** ** Luciferase Activity: %WT EmptyWTV617FV617F F594A V617F F595A V617F F594A F595A Figure 2-6. Mutation of F594 and F595 to Al a impairs STAT mediated gene transcription downstream of Jak2-V617F. COS-7 ce lls were co-transfected with 5 g of the indic ated plasmids along with 5 g of luciferase plasmid. Luciferase activity was measured from the cell lysates using the Reporter Lysis Buffer. Relative Luminescence Units (RLU) were av eraged from at least three independent experiments and plotted as a function Ja k2 mutation status, ** p < 0.005. 77

PAGE 78

B. A.IB = anti-Jak2 pAb IP = anti-Jak2 pAb 111V617F / F594A / F595A Empty WT V617F WT/ F594A/F595A Total Jak2 111 IB = anti-Jak2 pY1007/ pY1008 pAb Jak2 (pY1007/ pY1008) 0 50 100 150 200 250 300 350 400 450 500 550 EMPTYWT WT F594A F595A V617FV617F F594A F595AJak2 Phosphorylation %WT *B. A.IB = anti-Jak2 pAb IP = anti-Jak2 pAb 111 111V617F / F594A / F595A Empty WT V617F WT/ F594A/F595A Total Jak2 111 IB = anti-Jak2 pY1007/ pY1008 pAb Jak2 (pY1007/ pY1008) 0 50 100 150 200 250 300 350 400 450 500 550 EMPTYWT WT F594A F595A V617FV617F F594A F595AJak2 Phosphorylation %WT 0 50 100 150 200 250 300 350 400 450 500 550 EMPTYWT WT F594A F595A V617FV617F F594A F595AJak2 Phosphorylation %WT Figure 2-7. Mutation of F594 and F595 to Ala does not affect Jak2-WT autophosphorylation. (A) COS-7 cells were transfected with 10 g of the indicated Jak2 expression plasmids and Jak2 protein was subsequently immunoprecipitated from the transfe cted cells and autophosphorylation was assessed by western blot analysis (t op). The same membrane was stripped and re-probed for total Jak2 (botto m) (B) Jak2 autophosphorylation was quantified using densitometry and the average values from at least five independent experiments were plotted as a function of Jak2 mutation status, p < 0.05. 78

PAGE 79

Figure 2-8. Side chain structure and hydr ophobicity of amino acids at 594, 595 and 617 are important for the constituti ve activation o f Jak2-V617F. (A) Autophosphorylation of the indicated Jak2 plasmids was assessed by western blot analysis (top). The same memb rane was stripped and re-probed for total Jak2 (bottom). (B) Jak2 autophosphorylation was quantified using densitometry and the aver age values from at l east three independent experiments were plotted, p < 0.05. (C) Luciferase assays were conducted using COS-7 cells transfected with the indicated Jak2 expression plasmids. The average luciferase activity (RLU) for each construct from at least three independent experiments was plotted, p < 0.05. A. IP = anti-Jak2 0 50 100 150 200 250 300E MPT Y WT V617F V 6 1 7F/ F 59 4 W/ F 5 95W V6 1 7W V 617W/ F594 W / F5 9 5W V617E/ F594K/ F595K V 6 17K/ F 5 94E/ F 5 95EJak2 Phosphorylation %WTC. 0 1000 2000 3000 4000 5000 6000Luciferase Activity %WT EMPTY WT V617F V617F/ F594 W/ F595W V 6 17W V61 7 W/ F5 94 W/ F5 9 5W V 617E / F594K / F59 5 K V6 1 7K/ F5 9 4E/ F595EJak2(pY1007/ IB = anti-Jak2 IB = anti-Jak2 Empty WT V617W V617W/F594W/F595W V617K/F594E/F595E V617F V617F/F594W/F595W p Y1008 ) Jak2 B. V617E/F594K/F595K 111 111 79

PAGE 80

80 Jak2-V617F/F594A/F595A A. B. Jak2-WT Jak2-V617F C. Native Jak2Jak2-V617F Centroid V61 F61 F59 F59 F5 F5 distance Theta/ Azimuthal Gamma/ Yaw angle Figure 2-9. Characteriz ation of the stacking interaction between F595 and F617 by geometrical analysis. (A, B) Definiti on of the vectors required for the geometrical characterization of the stacking interaction in Jak2-WT and Jak2-V617F. The centroid vector bet ween the planes of amino acid side chains being compared (F595 and V/F 617) is shown in orange and the normal vector that is perpendicular to the plane of side chain is shown in red for F595 and green for V/F617. Theta ( ) is defined as the angle between the normal for the reference amino acid, wh ich is F595, and the centroid vector. Gamma ( is defined as the angle between the two normal vectors for the amino acids being compared; F595 and V/F617. (C) Comparison of the centroid distance, theta and gamma angles between 595 and 617 amongst Jak2-WT, Jak2-V617F and Jak2-V617F/F594A/F595A. The indicated parameters were calculated over the peri od of the individual MD simulations using VMD viewer and the probability density at each measured value was plotted using MATLAB with a bin width of 5

PAGE 81

CHA PTER 3 A SHIFT IN THE SALT BRIDGE INTERACTION OF RESIDUES D620 AND E621 FROM K539 TO R541 IS IMPORTANT FO R THE CONSTITUTIVE ACTIVATI ON OF JAK2 EXON 12 MUTATION, H538Q/K539L Summary Mutations in the exon 14 and exon 12 region s of Jak2 tyrosine kinase that cause constitutive activation have been associated with Myeloproliferativ e Neoplasms (MPNs). Understanding the molecular mechanism for the constitutive activati on of such Jak2 mutations is important for the development of potent Jak2 inhibitors. Previously, we showed that a pi stacking interaction bet ween mutant F617 and adjacent F595 is important for the constitutive activati on of Jak2-V617F (Gnanasambandan et al., 2010). Here, using a combination of mole cular dynamics (MD) simulations, in vitro mutagenesis, and biochemical assays, we st udied the molecular mechanism for the constitutive activation of the Jak2 exon 12 mutation, H538Q/K539L. We began by comparing the activation of Jak2-H538Q/K539L, Jak2-V617F and Jak2H538Q/K539L/V617F and did not find any significant differences among them. However, mutation of F594 and F595 to A reduced the activation of Jak2-H538Q/K539L by 50%. Results from in vitro mutagenesis suggested that polar ity of K539 is important for maintaining basal Jak2 activation. This was in turn supported by data from MD simulations that indicated the presence of salt bridge interactions between K539, D620, and E621 in Jak2-WT. Accordi ngly, mutation of K539 to alanine resulted in the constitutive activation of Jak2-WT, while K539D or K539E mutations diminished the Jak2-WT activation by 50%. MD simulations al so revealed that in the case of Jak2H538Q/K539L, D620 and E621 formed salt br idge interactions with R541 instead of K539 in WT. Mutation of R 541 to alanine reduced Jak2-H538Q/K539L activation only by 81

PAGE 82

50%. However, R541D and R541E mutations r educed the activation levels of Jak2H538Q/K539L to that of Jak2-WT. Collectively, we have identifie d that a shift in the salt bridge inter action of residues D620 and E621 with K539 in Jak2-WT to R541 is important for the constitutive activation of Jak2-H538Q/K539L. Preface Jak2 is a non-receptor tyrosine kinase, whic h transmits signals from cytokine and growth factor receptors at the plasma membrane to the nuc leus. Specifically, Jak2 is known to play a critical role in erythr opoietin signaling and hem atopoiesis as Jak2 knockout mice die embryonically due to the lack of definitive erythropoiesis (Neubauer et al. 1998; Parganas et al. 1998). On t he other hand, mutations in Jak2, both chromosomal translocation and point mutations t hat cause constitutive activation, have been identified in cancer. A chromosomal translocation between the Jak2 kinase domain and the dimerization domain of the ET V/TEL gene was identified in leukemia patients in 1997 (Lacronique et al. 1997; Peet ers et al. 1997). Howeve r, point mutations in the exon 14 and exon 12 regions of Jak2 were later identified in myeloproliferative neoplasms (MPN) patients in 2005 and 2007, respec tively (Baxter et al. 2005; James et al. 2005; Kralovics et al. 2005a; Levine et al 2005; Zhao et al. 2005; Scott et al. 2007). Thus, regulation of Jak2 activity is important for normal cellular grow th and proliferation. Members of the Janus family of tyrosine kinases (J aks) share seven Jak homology domains (JH1-7) based on their sequence homology. The seven JH domains can be further classified into four functional domains kinase, pseudokinase, SH2-like and FERM domains, based on their secondary and tertiary structure homology. While the primary catalytic activity of Jak2 is carri ed out at the kinase dom ain, the presence of three other domains indicate s the importance Jak2 kinase activity regulation in cis 82

PAGE 83

Adjacent to the kinase domain is the pseudo kinase dom ain (JH2), which was predicted to lack catalytic activity (Saharinen et al. 2000). However, Silvennoinen and colleagues recently showed that the pseudokinase domai n has low-level dual specific kinase activity that can negatively regulate Jak2 ki nase activity by phosphorylating residues S523 and Y570 (Ungureanu et al. 2011). Thus, the pseudokinase domain is important for Jak2 autoinhibition and negative regulation. The Jak2 exon 14 mutation, V617F, occurs in the pseudokinase domain and it leads to constitutive activation by disrupting the autoinhibition. Ou r group along with others recently identified that a pi stacking interaction between F595 and mutant F617 is crit ical to the constitutive activation of Jak2-V617F (Dusa et al. 2010; Gnanasam bandan et al. 2010; Lee et al. 2009a). Next to the pseudokinase is the SH2-like domain, whose function is not known. However, the linker region connecting the SH2-like and the pseudokinase domain has been implicated in relaying conformational changes that induce Jak2 kinase domain activation upon ligand binding to the rec eptor (Zhao et al. 2009). Jak2 exon 12 mutations that were identified among MPN pati ents occur in this linker region and some of them, including Jak2-H538Q/K539L, have been shown to cause constitutive kinase activation (Scott et al. 2007). While Jak2-V61 7F is the most co mmon exon 14 mutation, at least 25 different exon 12 mutations, ranging from single or multiple substitution, insertion and deletion mutations have been reported to date (H aan et al. 2010; Gnanasambandan and Sayeski et al. 2011). Ja k2-V617F mutation occurs among PV, ET and PMF patients. However, the exon 12 mutations are prim arily identified among PV patients. 83

PAGE 84

Previous ly, we identified the importance of the F595-F617 interaction to the constitutive activation of Jak2-V617F. Here we attempted to understand the molecular mechanism of a representative Jak2 exon 12 mutation, H538 Q/K539L. In this mutation, charged amino acids H538 and K539 are mutat ed to non-polar amino acids, glutamine and leucine, respectively. Based on the full length Jak2 homology model, a loop carrying the amino acids 538 and 539 is lo cated adjacent to the autoinihibitory interface. Based on data from MD simulati ons, we hypothesized that a shift in the interaction of D620 and E621 with K539 in Jak2-WT to R541 is important for the constitutive activation of Jak2-H538Q/K539L. This shift in the salt bridge interaction in turn destabilizes the interactions at the autoinhibitory interface thus resulting in constitutive activation. Data from in vitro mutagenesis also suppor t the importance of the polarity of amino acids K539 and R541 in the activation of Jak2-WT and Jak2H538Q/K539L, respectively. Overall, it is our hope that the information on the molecular mechanism of Jak2 exon 12 mutations will as sist in the continued effort to develop effective Jak2 inhibitors for the treatment of MPN patients. Materials and Methods Molecular Dynamics Simulations NAMD analysis package developed by the Theoretical and Computational Biop hysics Group at the Univer sity of Illinois at Urbana-C hampaign was used to conduct the MD simulations (Phillips et al. 2005). To maximize the simulation time, a full-length homology model of Jak2 was truncated to residues 393-1123. The resulting model consisted of the SH2-like domain, JH2 pseudo kinase domain, and the JH1 kinase domain. The DOWSER program was used to fill high hydrophilicity cavities inside the protein with water molecules (Zhang and He rmans 1996) and the protein was enclosed 84

PAGE 85

in a water box with 10 padding. The syst em was neutralized by adding sodium and chloride ions. The CHARMM force field (Brooks et al. 1983) with Particle mesh Ewald electrostatics and periodic boundary conditions were used to perform the simulations. Constant pressure and temperature of 1 at mosphere and 310 Kelvin was applied to all systems, respectively. Time step for the si mulations was 1 femtosecond. Initially the protein motion was restricted using harmonic constraints as the system was minimized for 0.25 nanoseconds, then the constrai nts were relaxed and the system was equilibrated for 1 nanosecond. The minimizati on and equilibration data were not used for analysis. Finally, each system was simulat ed for 20 ns as the final production run. The visual molecular dynamics (VMD) view er was used to conduct the trajectory analysis of the MD simulations (Humphrey et al. 1996). Plasmids and Reagents pcDNA3 vector encoding the full-length hum an Jak2 cDNA was a kind gift from Dr. Joe Zhao (Zhao et al. 2005). The lucife r ase gene reporter construct used (pLucGAS) contained four tandem copi es of the Jak2 responsive interferon gamma activation sequence (GAS) response element upstream of a minimal thymidine kinase promoter and the firefly luciferase cDNA. Western bl otting antibodies used for detection of Jak2 were purchased from Millipore and BioSource. Antibody to detect Jak2 phosphorylation at Y1007 and Y1008 was purch ased from Invitrogen. Site Directed Mutagenesis The Quik-Change site-directed mutagenesis ki t from Stratagene/ Agilent Technologies was used to create all the Jak2 mutations indicated. Primers used for mutagenesis were obtained from OriGene and Invitrogen. All the mutations created were confirmed using DNA sequence analysis. 85

PAGE 86

Cell Culture COS-7 cells were cultured in high gluc ose DMEM (4.5g/L) containing 10% fetal bovine serum at 37C and in the presence of 5% CO2. Transient Cell Transfections COS-7 cells were transiently transfected with 10 g of the respective plasmids using Lipofectin (Invitrogen). The transfecti on complexes were incubated with the cells for 4 hours at 37C, followed by 1 hour incubation with the T7 RNA polymerase express ing vaccinia virus, vTF7-3. After 1620 hours of recovery in serum containing media, soluble protein lysa tes were obtained and used for subsequent western blotting. Western Blotting Protein samples were separated by denaturing SDS-PAGE and transferred electrophor etically onto nitrocellulose me mbranes. Membranes were blocked with 5% milk/TBST for 40 minutes at room temper ature. This was followed by overnight incubation of the membrane with the respective primary antibodi es at 4C. The following day, membranes were washed three times with TBST before incubation with secondary antibody and subsequent washi ng at room temperature. Protein bands were detected using enhanced chemiluminescence method (W estern Lighting Plus or Ultra, PerkinElmer) and X-ray film (MidSci). Luciferase Assay COS-7 cells were co-transfected with 5 g of the indicated Jak2 expression plasmids along with 5 g of luciferase plasmid using 30 l SuperFect (Qiagen) in 100 mm dishes for 3 hours at 37C. The cells were then trypsinized and plated onto 6-well plates at a density of 6 105 cells per well. After 48 hours of recovery, the cells were lysed using 0.5 mL of 1X Reporter Lysis Buffer (Promega) per well. Luciferase activity in 86

PAGE 87

the cell lys ates was measured as Relative Luminescence Units (RLU) in the presence of Luciferin substrate (Pro mega) and ATP using a Monolig ht Model 3010 Luminometer (BD Biosciences). Statistical Analysis All the experiments were repeated at least three times. Statistical signific ance of the results from luciferase assay and densitom etry of western blo tting were calculated using Students t -test. Distributions with p values < 0.05 and < 0.005 were considered to be significant with 95% and 99.5% confidence levels, respectively. Results Activation of Jak2-H538Q/K539L is not significantly different from that of Jak2V617F Among the various exon 12 mutations, H538Q/K539L is one of the more commonly observed mutations in MPN patient s (Scott et al. 2011; Passamonti et al. 2011). In order to understand the molecular me chanism for constitutive activation of exon 12 mutations, the activati on of Jak2-H538Q/K539L was compared to that of Jak2V617F. Jak2 activation was assessed by detecting Jak2 autophosp horylation via over expression in COS-7 cells. In order to observe the effect of a comb ination of the exon 14 and exon 12 mutations, a Jak2 construct that carries both H538Q/K539L and V617F was created. COS-7 cells were transfected wit h empty vector, native Jak2 (Jak2-WT), Jak2-H538Q/K539L, Jak2-V617F, and Jak2-H538 Q/K539L-V617F, using lipofectin and vaccinia virus. Transfected cells were lys ed and the lysates were probed for Jak2 autophosphorylation at Y1007 and Y1008, using western blotting (Fig. 3-1A, top). The membrane was stripped and reprobed for tota l Jak2 (Fig. 3-1A, bottom). When compared to Jak2-WT, Jak2 autophosphoryl ation was found to be higher among the 87

PAGE 88

mutants; Jak2-H538Q /K539L, Jak2-V617F and Jak2-H538Q/K539L-V617F. Jak2 activation levels were also verified by measuring downstream STATdependent gene transcription using luciferase assay (Fig. 31B). Again, it was observed that Jak2 mutants H538Q/K539L, V617F, and H538Q/K539L-V617F had 200-fold higher transcription than Jak2-WT, corresponding to the observed autophosphorylation (Fig. 31A). However, there was no sign ificant difference in the luciferase activity of the three mutants. Overall, the dat a in Figure 3-1 indicate that t here is no significant difference in the activation and downstream STAT-dependent gene transcr iption levels of Jak2V617F, Jak2-H538Q/K539L, and Jak2H538Q/K539L-V617F. F595A Mutation Partially Reduces th e Activation of Jak2-H538Q/K539L Previous studies from our lab hav e indi cated the importance of residues F594 and F595 in the constitutive activation of Jak2 -V617F; specifically, F595 was found to form a pi stacking interaction with F617 (Gnanasambandan et al. 2010). Data in Fig. 3-1 shows that the function of Jak2-V617F and Ja k2-H538Q/K539L are similar. Though the possibility of a pi stacking interaction is absent in Jak2-H538Q/K539L, we wanted to understand the role of F594 and F595 in the context of the Jak2 exon 12 mutation. Therefore, mutations F594A, F595A, and F 594A/F595A were created in the background of Jak2-H538Q/K539L and their function was tested using the autophosphorylation and luciferase assays. As observed previously, Jak2-H538Q/K539L had increased autophosphorylation levels when compared to WT (Fig. 3-2A). Howe ver, the mutations F594A, F595A and F594A/F595A reduced the ac tivation of Jak2 -H538Q/K539L. Next, the STAT dependent gene transcription levels induced by the various Jak2 constructs were measured using the luciferase a ssay. Jak2-H538Q/K539L induced the expected 150-fold increase in luciferase activity when compared to Jak2-WT (Fig. 3-2B). 88

PAGE 89

Interestingly, though Jak2-H538Q /K539L/F5 94A had reduced autophos phorylation, its luciferase activity did not vary significant ly from that of Jak2-H538Q/K539L. However, the luciferase activity of both Jak2-H538Q/K539L/F595A and Jak2H538Q/K539L/F594A/F595A were lesser than that of Jak2H538Q/K539L, at least by 50%, and still remained greater than Jak2-WT by 5-fold. Collectively, the data in Fig. 3-2 indicate that amino acid F595 plays an important role in the activation of Jak2H538Q/K539L. Polarity of Amino Acid 539 is Importa nt for the Autoinhibition of Jak2-WT Data in Fig. 3-2 showed that mutati on F595A disrupted the function of Jak2H538Q/K539L by only 50%. This indicated that there are other interactions, which are unique to Jak2-H538Q/K539L, that contribute to the stability of the active conformation. In order to address the basis for constitu tive activation of Jak2-H538Q/K539L, we sought to understand the importance of polar ity at positions 538 and 539, and the contribution of the individual mutations H5 38Q and K539L. Therefore, COS-7 cells were transfected with empty vector, Jak2 -WT, Jak2-H538Q, Jak2-K539L, Jak2H538Q/K539L, Jak2-H538K/K539R, and Ja k2-H538D/K539E. Lysates from the transfected cells were blotted with antipY1007/pY1008 Jak2 in order to measure autophosphorylation (Fig. 3-3A, top). The same membrane was stripped and re-probed to detect total Jak2 (Fig. 3-3A, bottom). In co mparison to Jak2-WT, Jak2-H538Q had similar autophosphorylation, while that of Jak2-K539L and Jak2-H538Q/K539L were significantly higher. However, upon mutati ng 538 and 539 to other charged amino acids, as in the case of Jak2-H538K/K539R, and Jak2-H538D/K539E, the autophosphorylation remained at basal levels. Function of the va rious Jak2 mutations was also tested using the luciferase assay. Here, it was obser ved that Jak2-H538Q had an approximately 289

PAGE 90

fold increas e in luciferase activity when compared to Jak2-WT (F ig. 3-3B), while the activity of Jak2-K539L and Jak2-H538Q/K539L we re at least 200-fold higher than Jak2WT. However, the luciferase activity of Jak2-H538K/K539R, and Jak2-H538D/K539E were similar to that of Jak2-WT. In summary, data in Fig. 3-3 demonstrate that the primary contribution to the constitutive activation of Jak2-H538Q/K539L co mes from that of K539L. Additionally, it also shows that maintaini ng the polarity of amino acid s at positions 538 and 539 prevents Jak2 constitutive activation. Jak2-H538Q/K539L and Jak2-V617F Mutations A ffect the Active Site Conformation in both the Kinase and Pseudokinase Domains Data from Fig. 3-3 suggested that the mechanism for the c onstitutive activation of Jak2-H538Q/K539L could be based on the loss of polarity at position 539. This indicates the importance of the associat ed salt bridge interactions for Jak2 autoinhibition. Next, we wanted to i dentify those interactions using an in silico approach, that is, molecular dynamics simulations. Pr eviously, MD simulations identified a pi stacking interaction that was important fo r Jak2-V617F. Here, we used MD simulations to identify the interactions that contribute to the activation of Jak2-H538Q/K539L. 20 ns MD simulations were run for truncated hom ology models of Jak2-WT, Jak2-V617F, Jak2-H538Q/K539L, and Jak2H538Q/K539L-V 617F. RMSD values for each Jak2 structure were calculated over the period of the simulation with respec t to the first frame and plotted (Fig. 3-4A). The RMSD values of t he different Jak2 constructs increase at a specific rate up to 10 ns (200 frames), a fter which the changes become minimal and the proteins reach steady state by 20 ns (400 fr ames). Changes in the conformation of the individual kinase and pseudokinase domains were compared across the four Jak2 90

PAGE 91

models. In the case of the Jak2-WT kinas e domain, the glycine loop interacts with the activation loop and constrains the accessibi lity of the active site (Fig. 3-4B). Interestingly, in Jak2-H538Q/K539L the kinas e domain seems to assumes a more open conformation. Clearly, the glycine loop does not interact with the activation loop here, resulting in a more accessible active site. Similarly, in the case of Jak2-V617F, the interaction between the glycine loop and the ac tivation loop is lost and the activation loop assum es a more extended "active kina se-like" conformation (Huse and Kuriyan 2002). When V617F was combined with H538Q/K 539L, again the interaction between the glycine loop and the activation loop was absent. A rotation induced conformational change of the C helix to an "active-kinase like" conformation (Huse and Kuriyan 2002) was observed in all three Jak2 mutant s. Next, based on the JH1-JH2 sequence alignment used for the homology modelling of Jak2 (Lindauer et al. 2001), the corresponding conserved motifs in the pseudokinase domain was observed. Major changes were observed in the N-lobe of the pseudokinase domain, corresponding to the glycine loop and the C helix across the four Jak2 models. When compared to Jak2-WT, the pseudokinase domain of Jak2-H538Q/K539L attained a more open conformation due to a shift in the angle bet ween the Nand C-lobe s (Fig. 3-4C). The H538Q/K539L mutation is present in a l oop outside the N-lobe of the pseudokinase domain. Similarly, in the case of Jak2-V617F, this shift becomes more pronounced resulting in a 90 tilt of the C helix with respect to the Clobe. This change was caused due to the presence of the V617F mutati on in the glycine loop that connects the 5 sheet to 6. In the case of Jak2-H538Q/K539L-V617F, the C helix was tilted with respect to the C-lobe and the pseudoki nase domain has an open conformation. 91

PAGE 92

Overall, data from the MD simulations indicat e that mutations V617F and H538Q/K539L affect the conformation of both the Jak2 kinase and pseudokinase domains. These conformational changes can in tu rn disrupt the autoinhibitory interface between the two domains and hence in fluence the kinase activity. Jak2 Mutations, V617F and H538Q/K539L, Disrupt Autoinhibi tion by Altering Specific Interactions within and between the JH1 and JH2 Domains Data in Figure 3-4 indicated the differences in the conformation of the individual kinase and pseudokinase domains across the four Jak2 models. Next, we wanted to understand the change in interactions at the autoinhibitory interface between the kinase and the pseudokinase domains. Therefore, we observed the changes that happen at this interface using the MD simulation traj ectories. There exists an anti-symmetrical interface between the JH1 and JH2 domains, with the C-lobe of JH1 interacting with the N-lobe of JH2 and vice versa. Our interest li es in the N-lobe of JH2 domain, due to the location of the V617F and H538Q/K539L in this region. In the case of Jak2-WT, there appears to be an intimate interaction between the JH1 and JH2 domains, which is stabilized by some key interactions between residues V1000 and V617 along with that of K1030 and E543 (Fig. 3-5A, Obj. 3-1). Additionally, the residue of interest, K539 was involved in a salt bridge interaction with two residues D620 and E621, within the JH2 domain (Fig. 3-5B). However, in the case of Jak2-H538Q/K539L, positioning of the JH1 and JH2 domains were not symmetrical when compared to that of Jak2-WT and the autoinhibitory interface was disrupted (Obj. 3-2). Disrupti on of the JH1-JH2 symmetry could have stemmed from the lo ss of stability in the N-lobe of the JH2 domain, since the K539L mutation disrupted its interaction with D620 and E621. Consequently, the V617V1000 and K1030-E543 interactions were lost and the activation loop shifted away from 92

PAGE 93

the autoinhibitory interface. Next, in the case of Jak2-V617F, the mutated F617 now interacts with the adjacent F595 through pi s tacking as demonstrated previously (Gnanasambandan et al. 2010) (Obj. 3-3). Subsequently, interaction with the activation loop is disrupted and the N-lobe of JH2 domai n moves away from the C-lobe of the kinase domain thus marring the autoinhibi tory regulation on the kinase domain. Interestingly, a combination of the V617F mutation with H538Q/K539L resulted in a greater distance between the JH1 and JH2 do mains when compared to individual mutations (Obj. 3-4). This greater distance in turn di minished any autoinhibitory interactions between the two domains. Salt bridge interactions in each Jak2 model were analyzed using the VMD plug-in and compared across the mutations in order to delineate the specific interactions that were responsible for the changes observed at the autoinhibitory interface (Table 3-1). Tabulating the results clearly indicated that the D620, E 621 K539 interactions that were lost due to the K539L mutation were be ing replaced by that of D620, E621R541 in the case of Jak2-H538Q/K539L and Jak2 -H538Q/K539L-V617F (Fig. 3-5B). In the case of Jak2-V617F, the salt bridges betwe en D620, E621, and K539 were preserved. However, D620 was now interacting with R541 and K1030 residues indicating a shift in the conformation of JH2 that is facilitating it. In all three mutants, the salt bridges between residues E543, E566, and K1030 that bridge JH1-JH2 domains are lost. In addition to this, the vdW in teraction between V617 and V1000 was also absent among all three mutants. In the case of Jak2-V617F and Jak2-H538Q/K539L-V617F, the mutant F617 interacts with F595 vi a a pi stacking interaction. 93

PAGE 94

Overall, data in Fig. 3-5 suggest that the disruption of the JH1-JH2 interface forms the basis for the consti tutive activation of exon 14 and exon 12 Jak2 mutations. This disruption may stem from the loss of important salt bridge interactions as in Jak2H538Q/K539L or formation of a pi st acking interaction as in Jak2-V617F. Jak2 Mutations, V617F and H538Q/K539L, Alter interactions w ithin the N-lobe of the Pseudokinase Domain Analysis of the MD simulation trajectories revealed salt bridge interactions that varied across the four Jak2 models (Fig 3-5 and Table 3-1) Next, energy and interaction distance of each salt bridge i dentified within the pseudokinase domain were measured during the simulations and plotted. Clearly, interaction between 539 and 620 was at a closer range and much stronger in Jak2-WT than the other three models (Fig. 3-6A, B). Interestingly, the energy betw een 539 and 620 in Jak2-V617F was found to be lower than that in Jak2-WT. However, it was still significantly higher than Jak2H538Q/K539L and Jak2-H538Q/K539L-V617F. When K539 was mutated to L, the adjacent residue R541 reconstituted the in teraction with D620. Correspondingly, the energy between 541 and 620 was higher and the distance between them was smaller in Jak2-H538Q/K539L and Jak2-H538Q/K539L-V617F than Jak2-WT (Fig. 3-6C, D). Even though K539 was not mutated, interacti on between R541 and D620 in Jak2-V617F was relatively stronger than that in Jak2-WT. E621 is another residue that interacts strongly with K539 in Jak2-WT. The energy and distance between 539 and 621 was very similar between Jak2-WT and Jak2-V617F throughout t he simulation period (Fig. 3-6E, F). Conversely, the distance and energy between 621 and 539 were relatively lower in Jak2-H538Q/K539L and Jak2-H538Q/K539L/V617F than Jak2-WT. When K539 was mutated to L, R541 replaced K539 to intera ct with E621, as in the case of 620-539. 94

PAGE 95

Accordingly, the distance and energy dat a support strong R541-E621 interac tion in Jak2-H538Q/K539L and Jak2-H538Q/K539L/V617F (Fig. 3-6G, H). However, in the case of Jak2-WT, R541 and E621 residues we re far apart and there was no interaction energy between them. The distance betwe en R541 and E621 in Jak2-V617F was intermediate, but still not sufficient to increase the energy of interaction. Overall, the data in Fig. 3-6 confirms that the mutation, H538Q/K539L causes a shift in the interaction of D620 and E621 from K539 to that of R541 in the Jak2 pseudokinase domain. Jak2 Mutations, V617F and H538Q/K539L, Disturb the Stability of the Autoinhibitor y Interface Direct changes in salt bridge interacti ons caused by the K539L mutation were analysed in Fig. 3-6. Next, indirect changes in interactions between the JH1 and JH2 domains that arose as a consequence of the K539L or V617F mutation were also analyzed by measuring their interaction ener gy and distance. For example, residues V617 and V1000 were found to interact in cl ose range and at higher energy in Jak2-WT (Fig. 3-7A, B). However, in the cases of Jak2-V617F, Jak2-H538Q/K539L, and Jak2H538Q/K539L/V617F, 617 and 1000 were far apart and hence their energies were significantly lower than Jak2-WT. Upon the mu tation of V617 to F, the vdW interaction between 617 and 1000 was replaced by a str onger pi stacking interaction between 595 and 617, as reported previously (Gnanasam bandan et al. 2010). Thus, the interaction energy between 595 and 617 was significantly higher in Jak2-V617F and Jak2H538Q/K539L/V617F than Jak2-WT and Jak2-H 538Q/K539L (Fig. 3-7C). Despite the low interaction energy, distance between the residues 595 and 617 in Jak2-WT is comparable to that in Jak2-V617F, and Jak2-H538Q/K539L/V617F (Fig. 3-7D). This 95

PAGE 96

incongruence may arise from the difference in the nature of interactions, that i s, vdW in Jak2-WT when compared to pi stacking in Jak2-V617F and Jak2-H538Q/K539L/V617F. However, the residues 595 and 617 are far apart in Jak2-H538Q/K539L. While 6171000 was a vdW interaction, a strong salt bridge interaction between JH1 and JH2 domains was also observed via resi dues K1030 and E543. K1030 and E543 were closer in distance and had greater interaction energy in Jak2-WT than that in Jak2V617F, Jak2-H538Q/K539L, and Jak2-H 538Q/K539L/V617F (Fig. 3-7E, F). In summary, data in Fig. 3-7 indicates t hat mutations in the pseudokinase domain such as V617F and H538Q/K539L disrupt th e interactions at the Jak2 JH1-JH2 autoinhibitory interface. Salt Bridge Interactions between D 620, E621, and K539 is Important for Jak2 Autoinhibition Data obtained from the Jak2 MD simulations ( Figs. 3-4, 3-5, 3-6, and 3-7) suggest that the shift in the salt bridge interaction of D620 and E6 21 from K539 in Jak2-WT to R541 in Jak2-H538Q/K539L could be key to the constitutive activation. Hence, we examined whether the disrupt ion of the D620, E621 K 539 interaction in Jak2-WT through alanine mutations can affect Jak2 ac tivation. COS-7 cells were co-transfected with luciferase plasmid along with either empty vector, Jak2-WT, Jak2-D620A, Jak2E621A, Jak2-D620A/E621A, Jak2-K539A, Ja k2-D620A/K539A, or Jak2-E621A/K539A. Luciferase activity of the transfected cells were measured and graphed (Fig. 3-8A). Interestingly, individual mu tations of D620 and E621 to alanines reduced the activation of Jak2-WT by approximately 50%. Howeve r, a combination of D620A and E621A caused an approximate 70% reduction in Jak2-WT activity. In cont rast, mutation of K539A either individually or in combi nation with D620A or E621A increased Jak2 96

PAGE 97

activation tremendously. These results indicate that K539 is the dominant partner in the salt bridge interactions with D620 and E621 that is required to maintain Jak2 autoinhibition. Next, we tested if we could reconstitute the salt bridge interaction between D620, E621 and K539 by int erchanging their charges. COS-7 cells were co -transfected with luciferase plasmid along with either empt y vector, Jak2-WT, Jak2-D620K, Jak2-E621K, Jak2-K539D, Jak2-K539E, Jak2-D620K/K539D, or Jak2-E621K/K539E and their respective luciferase activities were measur ed. It was observed that mutation of either D620 or E621 to K reduced Jak2 activation by approximately 30% (Fig. 3-8B). However, mutation of K539 to negative charged residues su ch as D or E reduced Jak2 activity by approximately 50% relative to Jak2-WT. A co mbination of D620K al ong with K539D or E621K with K539E also reduced Jak2 activity similar to the indivi dual K539D or K539E mutations. Thus, reversal of charges bet ween amino acids 620, 621, and 539 is not capable of reconstituting the salt br idge and hence does not restore function. Overall, mutations of D620 and E621 to either alanines or charged residues affect Jak2 stability and decrease its activity. Howe ver, mutations of K539 to non-polar alanine residues result in Jak2 constitutive activa tion and to that of negatively charged residues compromise Jak2 function. Thus, data in Fig. 3-8 reiterates the im portance of the salt bridge interaction between D620, E621, and K539 to Jak2 autoinhibition and is in agreement with the in silico data (Figs. 3-5 and 3-6). Salt bridge Interaction between D620, E621, and R541 is Important for the Constitutive Activation of Jak2-H538Q/K539L Data from Fig. 3-6 and 3-8 indic ated t hat residues D620 and E621 interact with K539 in Jak2-WT. However, Jak2 MD simula tions also revealed that upon mutation of 97

PAGE 98

K539 to L, D620 and E621 shift the interaction to R541 (Fig. 3-6). T herefore, we next wanted to understand the significance of the salt bridges between D620, E621, and R541 in the context of the constitutive ac tivation of Jak2-H538Q/K539L. To address this question, mutations that would disrupt or reconstitute the sa lt bridge interaction between D620, E621 and R541 were created in Ja k2-H538Q/K539L. Func tion of these Jak2 mutants were compared using the luciferase assay. First, alanine mutations that would disrupt the interaction were created. COS-7 cells were co -transfected with luciferase plasmid along with either empty vector, Jak2-WT, Jak2-H538Q/K539L, Jak2H538Q/K539L/D620A, Jak2-H538Q/K539L/ E621A, Jak2-H538Q/K539L/D620A/E621A, Jak2-H538Q/K539L/R541A, Jak2-H538 Q/K539L/D620A/R541A, or Jak2H538Q/K539L/E621A/R541A and their luci ferase activities were measured. Interestingly, mutation of either D620 or E621 to A either individually or in combination did not affect the luciferase activity of Jak2-H538Q/K539L (Fig. 3-9A). However, mutation of R541 to A reduced the luciferase activity of Jak2-H538Q/K539L by 50%. Combination of R541A with eit her D620A or E621A also reduc ed the luciferase activity of Jak2-H538Q/K539L by 50%. These results agai n indicate that similar to K539 (Fig. 38), R541 plays the dominant role in the sa lt bridge interactions with D620 and E621. Next, we reversed the charges on t he participating residues and used these mutations to test if the salt bridge interact ion can be reconstituted. COS-7 cells were cotransfected with luciferase plasmid along wi th either empty vector, Jak2-H538Q/K539L, Jak2-H538Q/K539L/D620R, Jak2-H538Q/K539L/ E621R, Jak2-H538Q/K539L/R541D, Jak2-H538Q/K539L/R541E, Jak2-H538 Q/K539L/D620R/R541D or Jak2H538Q/K539L/E621R/R541E and their luciferase activity were meas ured. Mutation of 98

PAGE 99

either D620 or E621 to R did not affect t he function of Jak2-H538Q /K539L (Fig. 3-9B). However, mutation of R541 to either D or E reduced the luciferase activity of Jak2H538Q/K539L to the levels of Jak2-WT. Th e above observation was also true in the cases of Jak2-H538Q/K539L/D620R/R541 D and Jak2-H538Q/K539L/E621R/R541E. These results suggest that the positive char ge at 541 is critical for the constitutive activation of Jak2-H538Q/K539L. Overall, data in Fig. 3-9 illustrate the importance of the salt bridge interaction between D620, E621, and R541 for the consti tutive activation of Jak2-H538Q/K539L. Together with data in Fig. 3-8, it can be concluded that a sh ift the in the salt bridge interaction of D620 and E621 from K539 in Ja k2-WT to R541 in Jak2-H538Q/K539L is responsible for the constitutive activation of Jak2-H538Q/K539L. Discussion Identification of Jak2 mutations in MPN patients had opened up a series of questions, regarding appropriate diagnosis and treatment stra tegies for these patients. One such question Is regarding the mechanis ms for the constitutive activation of Jak2 mutations. Both Jak2-V617F and exon 12 mu tations occur in the N-lobe of the pseudokinase domain, mainly at the interf ace between the JH1 and JH2 domains. Thus, these mutations may cause constitutive activation by disrupting the autoinhibitory effect of JH2 over JH1. Therefore, in an effort to address this timely question, our group previously reported the pi stacking intera ction between mutant F617 and adjacent F595 as the molecular mechanism responsible for the constitutive activation of Jak2-V617F (Gnanasambandan et al. 2010). Here, using a combination of in silico and in vitro data we have identified that a shift in the intera ction of residues D620 and E621 from K539 in 99

PAGE 100

Jak2-WT to R541 is the basis for the constitu tive activation of Ja k2 exo n 12 mutation, H538Q/K539L. Residue K539, present in t he loop at the end of the N-lobe interacts with D620 and E621 in the glycine loop of the JH2 domain in Jak2-WT. This interaction may stabilise the JH2 domain in a conformation suitable for interaction with the JH1 domain in an anti-symmetrical mode (Fig. 3-5A) Additionally it was also found that in the case of Jak2-H538Q/K539L, D620 and E621 now inte ract with R541 and this shift in interactions induced a significant change in the conformation the pseudokinase domain when compared to Jak2-WT (Fig. 3-4C, 3-5B). Thus, mutation of K539 to L prevents its interaction with D620 and E621 and shifts the salt bridge to the adjacent, R541. Subsequently, the anti-symmetr ical positioning of the JH1 and JH2 domains is affected and the autoinhibition is disrupted. In t he case of Jak2-V617F, though D620, E621 still interact with K539, the autoinhibition could have been mainly disrupted due to the increase in distance between JH1 and JH2, as a result of the pi stacking interaction within the JH2 domain. A combination of the tw o effects, that is, disruption of the antisymmetry between JH1 and JH2 along with in creased distance between them can be observed in Jak2-H538Q/K539L/V617F (Fig. 35A). Our results on the simulation of Jak2-H538Q/K539L are in agreem ent with that reported by Lee et al. on the role of K539 in positioning V617 to favorably interact with the activation loop (Lee et al. 2009b). However, we have shown here for the first time it is the shi ft in the interaction of D620 and E621 from K539 to R541 that is important for the constitutive activation of Jak2H58Q/K539L. 100

PAGE 101

Apart from the observations made using the molecular dynamics simulations, mutational studies als o indicated the impor tance of a positive charge at position 539. Conversion of K539 to non-polar amino acids such as A or L increased the activation of Jak2 dramatically (Fig. 3-3, 3-8). However, conversion of K539 to negatively charged D or E decreased Jak2 activity. Interestingly, mutation of R541 to non-polar A in Jak2H538Q/K539L reduced its activity by 50% (Fig. 3-9A). Howeve r, R541D or R541E mutations completely restored the activity of Jak2-H538Q/K539L back to the levels of Jak2-WT (Fig. 3-9B). This again reiterated the importance of a positive charge at R541 in order to form a salt bridge interact ion with D620 and E621. On the other hand, mutations at positions D620 and E621 did not a ffect the activation of both Jak2-WT and Jak2-H538Q/K539L. This indicates that K 539 and R541 are the dominant partners in their salt bridge interactions with D620 and E621. Mutations of the D620 and E621 may disrupt the interactions with both K 539 and R541 and hence may not result in constitutive activation. Thus, the constitutive activation of Jak2-H538Q/K539L is caused by the shift in the interaction of D 620 and E621 from K539 in Jak2-WT to R541. Jak2 mutations identified in the exon 12 region are quite heterogeneous and many of them result in Jak2 constitutive activation (Gnanasambandan and Sayeski 2011; Haan et al. 2010). Here, we have studied the molecular mechanism for a specific exon 12 mutation, Jak2-H538Q/K539L. However, our findings can also be extended to other exon 12 mutations. The exon 12 region consis ts of residues 501 to 547, which comprise the SH2-JH2 linker region. Resu lts from the current study indicate that the SH2-JH2 linker could be involved in interactions at the JH1-JH2 interface and it can control the conformation of the N-lobe of the pseudokinas e domain. Accordingly, Zhao et al. have 101

PAGE 102

reported that this SH2-JH2 linker acts as a s witch that controls Jak2 kinase ac tivation by flexing the hinge of the pseudokinase domain in response to ligand binding to the receptor (Zhao et al. 2009). Therefore, mutati ons in the hotspot exon 12 region can disturb the local polarity of the linker region and convert it s conformation to the 'ON' mode, mimicking the ligand boun d state. Subsequently, this could affect the conformation of the pseudokinase domain hinge and disrupt the interactions at the JH1JH2 interface leading to constitutive Jak2 activation. Recently, the pseudokinase domain has be en shown to possess dual specific kinase activity that is important for Jak2 negative regulation (Ung ureanu et al. 2011). Based on our results, the exon 12 mutations can disrupt t he conformation of the N-lobe of the pseudokinase domain and its hinge r egion. Consequently, these changes can reduce the kinase activity of the JH2 domain in addition to disrupting allosteric interactions at the JH1-JH2 interface. However, several questions regarding the mechanism for autoinhibition by the ps eudokinase domain and how it is disrupted during kinase domain activati on upon ligand binding remain. Results from the current study reveal that the exon 14 Jak2-V617F mutation affects the distance between the JH1 and JH2 domains, while the exon 12 mutations affect their mode of interaction. T hough the molecular mechanisms for the two mutations are different, both of them act by disrupting the autoinhibit ion at the interface and result in similar levels of Jak2 hyper activation and function. Therefore, development of allosteric drugs that can target the JH1-JH2 interface and lock the conformation to autoinhibitory mode will be us eful in treating Jak2 mutations positive MPNs. ATP-competitive inhibitors for Jak2 that are currently in clinical trials do not show 102

PAGE 103

any promising results (Maj umder and Sayes ki 2010; Wadlei gh and Tefferi 2010). Thus, such allosteric drugs may possess higher sele ctivity for Jak2 and its mutations leading to improved treatment efficacy. Overall, using a combination of molecular dynamics simulations and in vitro mutagenesis, we have shown that the disrupti on of a salt bridge interaction between D620, E621, and K539 and replacing it with that of R541 is the basis for the constitutive activation of Jak2-H538Q/K539L. While comparing the molecular mechanism of exon 12 mutations and exon 14, Jak2-V617F, we found that both of them disrupt the autoinhibitory interactions between JH1 and JH2 and result in Jak2 hyperactivation. Collectively, these results contribute to our understanding of the Jak2 mutations in disease and also suggest novel strategies for Jak2 drug design. 103

PAGE 104

Object 3 -1. Interactions at the JH1-JH 2 interface in Jak2-WT (.mov file 9MB) Object 3-2. Interactions at the JH1-JH2 interface in Ja k2-H538Q/K539L (.mov file 9MB) Object 3-3. Interactions at the JH1-JH2 interface in Jak2-V617F (.mov file 10MB) Object 3-4. Interactions at the JH1-JH 2 interface in Jak2-H538Q/K539L/V617F (.mov file 10MB) 104

PAGE 105

Table 3-1. Changes in salt bridge and vdW interactions caused by Jak2 mutations No. Jak2-WT Jak2-V617F Jak2-H538Q/K539L Jak2-H538Q/K539L/V617F JH2 Domain 1 D620-K539 D620-K539 Absent Absent 2 Absent D620-R541 D620-R541 D620-R541 3 E621-K539 E621-K539 Absent Absent 4 Absent Absent E 621-R541 E621-R541 5 Absent F595-F617 Absent F595-F617 JH1-JH2 Interface 6 E543-K1030 Absent Absent Absent 7 V617-V1000 Absent Absent Absent 105

PAGE 106

A. B. WCLIB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAb 111Empty WT HQKL/V617F H538Q/K539L V617F 111 WCLIB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAb 111Empty WT HQKL/V617F H538Q/K539L V617F 111 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5E m pty W T V 61 7F H538Q/K539L H 538 Q / K539 L/V 617FLuciferase Activity (RLU) x 10 6 ** A. B. WCLIB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAb 111Empty WT HQKL/V617F H538Q/K539L V617F 111 WCLIB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAb 111Empty WT HQKL/V617F H538Q/K539L V617F 111 WCLIB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAb 111Empty WT HQKL/V617F H538Q/K539L V617F 111 WCLIB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAb 111Empty WT HQKL/V617F H538Q/K539L V617F 111 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5E m pty W T V 61 7F H538Q/K539L H 538 Q / K539 L/V 617FLuciferase Activity (RLU) x 10 6 ** Figure 3-1. Activation of Jak2 exon 12 mutation, H538Q/K539L, is not different from that of Jak2-V617F. A) COS-7 cells were transfected with 10 g of the indicated plasmids using Lipofectin, followed by infection with of vaccinia virus vTF-7 at 1 MOI. ~10% of the input from the cell lysates was separated by SDS-PAGE and western blotted with anti-pY1007/ pY1008 Jak2 (top). The membrane was stripped and re-probed with anti-Jak2 to confirm equal loading (bottom). Shown is a representative blot from three independent exper iments B) COS-7 cells were co-transfected with 5 g of the indicated plasmids and 5 g of luciferase plasmid using SuperFect. Transfected cells were lysed using the reporter lysis buffer and the lysates were used to measure luciferase activity. Relative Luminescence Units (RLU) measured for each indicated sample was averaged from at least three independent experiments and the values were plotted with respect to the activity of Jak2-WT. Val ues are expressed as mean S.D, p < 0.05, **p < 0.005 (Student's t-test). 106

PAGE 107

B. A.IB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAbWCLEmpty WT HQKL/K539L/F595A H538Q/K539L H538Q/K539L/F594A HQKL/K539L/FA/FA 111 111IB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAbWCLEmpty WT HQKL/K539L/F595A H538Q/K539L H538Q/K539L/F594A HQKL/K539L/FA/FA 111 111 111 111 0 1 2 3 4 5 6 EmptyWTH538Q, K539L H538Q, K539L, F594A H538Q, K539L, F595A H538Q, K539L, F594A, F595ALuciferase Activity (RLU) x 10 6 ** **B. A.IB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAbWCLEmpty WT HQKL/K539L/F595A H538Q/K539L H538Q/K539L/F594A HQKL/K539L/FA/FA 111 111IB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAbWCLEmpty WT HQKL/K539L/F595A H538Q/K539L H538Q/K539L/F594A HQKL/K539L/FA/FA 111 111 111 111A.IB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAbWCLEmpty WT HQKL/K539L/F595A H538Q/K539L H538Q/K539L/F594A HQKL/K539L/FA/FA 111 111 111 111IB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAbWCLEmpty WT HQKL/K539L/F595A H538Q/K539L H538Q/K539L/F594A HQKL/K539L/FA/FA 111 111 111 111 0 1 2 3 4 5 6 EmptyWTH538Q, K539L H538Q, K539L, F594A H538Q, K539L, F595A H538Q, K539L, F594A, F595ALuciferase Activity (RLU) x 10 6 ** ** Figure 3-2. Mutation of F595 to alanine parti ally reduces the activation of Jak2H538Q/K539L. A) COS-7 cells were transfected with 10 g of the indic ated plasmids as described previously. ~ 10% of the input fr om the whole cell lysates was separated by SDS-PAGE and western blotted with anti-pY1007/ pY1008 Jak2 (top). The membrane was stripped and re-probed with total Jak2 to confirm equal loading (bottom). Shown is a represent ative blot from four independent experiments B) COS-7 cells were co-transfected with 5 g of the indicated plasmids and 5 g of luciferase plasmid. Cell lysates were used to measure their respec tive luciferase activities. RLU measured for each sample was plotted. The values ob tained from at least three independent experiments were averaged and plotted as a function of Jak2-mutation status, p < 0.05, **p < 0.005. 107

PAGE 108

WCLEmpty WT K539L H538Q H538Q/K539L H538D/K539E H538K/K539RIB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAb 111 111A. B. 0 5 10 15 20 25Empty WT H5 3 8Q K5 39 L H538Q/K539L H 5 3 8D /K539E H 5 3 8K / K 5 3 9RLuciferase activity (RLU) x 10 6 ** WCLEmpty WT K539L H538Q H538Q/K539L H538D/K539E H538K/K539RIB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAb 111 111 WCLEmpty WT K539L H538Q H538Q/K539L H538D/K539E H538K/K539RIB = anti-Jak2 pY1007/pY1008 pAb IB = anti-Jak2 pAb 111 111A. B. 0 5 10 15 20 25Empty WT H5 3 8Q K5 39 L H538Q/K539L H 5 3 8D /K539E H 5 3 8K / K 5 3 9RLuciferase activity (RLU) x 10 6 ** Figure 3-3. Mutation of K539 to non-polar amino acid, Leu, causes constitutive activation of Jak2. A) COS-7 ce lls were transfected with 10 g of the indicated plasmids and their autophosphorylation was assessed using western blot analysis. Shown is a representative blot from three independent experiments B) COS-7 cells were co-transfected with 5 g of the indicated plasmids and 5 g of luciferase plasmid. Luciferase activity measured for each sample was plotted as a function of mutation status. The values obtained from at least four independent experiments were averaged a nd plotted as a function of Jak2mutation status, p < 0.05, **p < 0.005. 108

PAGE 109

0 1 2 3 4 5 6 7 0 100 200 300 400Time (500 ps steps)RMSD ()A. Jak2-WT Jak2-H538Q/K539L Jak2-V617F Jak2-H538Q/K539L-V617F B. C.Kinase domain Pseudokinase domainN-lobe C-lobe Chelix 0 1 2 3 4 5 6 7 0 100 200 300 400Time (500 ps steps)RMSD ()A. Jak2-WT Jak2-H538Q/K539L Jak2-V617F Jak2-H538Q/K539L-V617F B. C.Kinase domain Pseudokinase domain 0 1 2 3 4 5 6 7 0 100 200 300 400Time (500 ps steps)RMSD ()A. Jak2-WT Jak2-H538Q/K539L Jak2-V617F Jak2-H538Q/K539L-V617F Jak2-WT Jak2-H538Q/K539L Jak2-V617F Jak2-H538Q/K539L-V617F B. C.Kinase domain Pseudokinase domainN-lobe C-lobe Chelix Figure 3-4. Jak2 mutations, H538Q/K539L and V617F induce conformational changes in both the pseudokinase domain and t he kinase domain. A) Molecular dynamics simulations were conducted up to 20 ns for the indicated Jak2 homology models using NAMD. RMSD va lues for each Jak2 model were calculated for the backbone atoms during the course of the simulation with respect to the zero time frame (0 ns) and plotted. A trend line was added by averaging the data every 2 points. The respective trend lines for Jak2-WT is colored in black, Jak2-V617F in pink, Jak2-H538Q/K539L in orange and Jak2-H538Q/K539L/V617F in blue. Snap s hots of the Jak2 domains across the indicated models at 20 ns were gener ated using VMD B) Kinase domain and C) Pseudokinase domain. Homologous conserved motifs in both the domains are highlighted using the follo wing colors: VAIK motif in ice blue, Glycine loop in red, catalytic loop in wh ite, activation loop in yellow, DFG loop in light green. Based on the alignm ent used for the generation of this homology model, the homologous DFG motif in the pseudokinase domain corresponds to "NPP". However, another DPG motif present downstream is also considered to be the homologous "DFG" motif (Ungureanu et al. 2011). Hence, both the "NPP" and "DPG" motifs have been highlighted in light green. The activation loop residues Y1007 and Y1008 in the kinase domain and the corresponding residues, S703 and I704 in the pseudokinase domain are shown in ice blue color using licorice representation. 109

PAGE 110

Jak2-WT Jak2-H538Q/K539L Jak2-V617F Jak2-H538Q/K539L-V617F A. B. Jak2-WT Jak2-H538Q/K539L Jak2-V617F Jak2-H538Q/K539L-V617F A. B. Figure 3-5. Jak2 mutations, H538Q/K539L and V617F induce changes in interactions that affect the autoinhib itory interface. A) Snaps hots of the Jak2 JH1-JH2 interface were taken at 20 ns using VMD. The kinase (JH1) domain is shown in orange and the pseudokinase (JH2) dom ain is shown in cyan. Specific residues that are involved in intera ctions are represented in licorice. Activation loop residues Y1007 and Y100 8 are shown in ice blue, K1030 is in silver, V1000 is in white, E621 in mauve, D620 in lime, V617 in pink, F595 in green, E543 in orange, R541 in red, K539 in purple, H538 in violet. Loops connecting the JH1 and JH2 domains are s hown in silver. B) N-lobe of the pseudokinase domain showing a close up view on the interactions between D620 (lime), E621 (mauve), H538 (violet) K539 (purple), and R541 (red). Salt bridge interactions are indicated by c onnecting lines (white) and the distance between the residues are shown in above the connecting lines. 110

PAGE 111

541 -621 539 -621 541 -620 539 -620 -120 -100 -80 -60 -40 -20 0 20 050100150200250300350400 Time (500ps steps)Non-bonding energy (kcal/mol)A. C. E. G. -120 -100 -80 -60 -40 -20 0 20 050100150200250300350400 Time (500 ps steps)Non-bonding energy ( kcal/mol) 0 2 4 6 8 10 12 14 16 18 050100150200250300350400 Time (500 ps steps)Distance () 0 5 10 15 20 25 050100150200250300350400 Time (500 ps steps)Distance ()B. D. -120 -100 -80 -60 -40 -20 0 20 050100150200250300350400 Time (500 ps steps)Non-bonding energy (kcal/mol) -120 -100 -80 -60 -40 -20 0 20 050100150200250300350400 Time (500 ps steps)Non-bonding energy (kcal/mol) 0 2 4 6 8 10 12 14 16 18 20 050100150200250300350400 Time (500 ps steps)Distance ()H. 0 5 10 15 20 25 050100150200250300350400 Time (500 ps steps)Distance ()F. 541 -621 539 -621 541 -620 539 -620 -120 -100 -80 -60 -40 -20 0 20 050100150200250300350400 Time (500ps steps)Non-bonding energy (kcal/mol)A. C. E. G. -120 -100 -80 -60 -40 -20 0 20 050100150200250300350400 Time (500 ps steps)Non-bonding energy ( kcal/mol) 0 2 4 6 8 10 12 14 16 18 050100150200250300350400 Time (500 ps steps)Distance () 0 5 10 15 20 25 050100150200250300350400 Time (500 ps steps)Distance ()B. D. -120 -100 -80 -60 -40 -20 0 20 050100150200250300350400 Time (500 ps steps)Non-bonding energy (kcal/mol) -120 -100 -80 -60 -40 -20 0 20 050100150200250300350400 Time (500 ps steps)Non-bonding energy (kcal/mol) 0 2 4 6 8 10 12 14 16 18 20 050100150200250300350400 Time (500 ps steps)Distance ()H. 0 5 10 15 20 25 050100150200250300350400 Time (500 ps steps)Distance ()F. Figure 3-6. Salt bridge interactions between D620, E621, and K539 in Jak2-WT is replaced by those between D620, E621, and R541 in Jak2-H538Q/K539L. Non-bonding energy and distances co rresponding to specific bonding interactions were calculated usi ng the NAMD energy plug-in and VMD graphics tools respectively. The energy and distance values calculated for each interaction (A, B) 539 and 620 (C, D) 541 and 620 (E, F) 539 and 621 (G, H) 541 and 621, across the 4 homology models were plotted as a function of time. A trend line was added for each model by averaging out the data for every 10 points. The respective trend lines for Jak2-WT is colored in black, Jak2-V617F in pink, Jak2-H538Q/K539L in orange and Jak2H538Q/K539L/V617F in blue. 111

PAGE 112

617 -1000 595 -617 543 -1030 0 5 10 15 20 25 30 35 050100150200250300350400 Time (500 ps steps)Distance ()B. -3 -2 -1 0 1 2 3 050100150200250300350400 Time (500 ps steps)Non-bonding energy (kcal/mol)A. -8 -7 -6 -5 -4 -3 -2 -1 0 1 050100150200250300350400 Time (500 ps steps)Non-bonding energy (kcal/mol) 2 4 6 8 10 12 14 16 050100150200250300350400 Time (500 ps steps)Distance ()D. C. E. 0 5 10 15 20 25 30 050100150200250300350400 Time (500 ps steps)Distance ()F. -90 -80 -70 -60 -50 -40 -30 -20 -10 0 10 050100150200250300350400 Time (500 ps steps)Non-bonding energy (kcal/mol)617 -1000 595 -617 543 -1030 0 5 10 15 20 25 30 35 050100150200250300350400 Time (500 ps steps)Distance ()B. -3 -2 -1 0 1 2 3 050100150200250300350400 Time (500 ps steps)Non-bonding energy (kcal/mol)A. -8 -7 -6 -5 -4 -3 -2 -1 0 1 050100150200250300350400 Time (500 ps steps)Non-bonding energy (kcal/mol) 2 4 6 8 10 12 14 16 050100150200250300350400 Time (500 ps steps)Distance ()D. C. E. 0 5 10 15 20 25 30 050100150200250300350400 Time (500 ps steps)Distance ()F. -90 -80 -70 -60 -50 -40 -30 -20 -10 0 10 050100150200250300350400 Time (500 ps steps)Non-bonding energy (kcal/mol) Figure 3-7. Jak2 mutations, H538Q/K539L and V617F induce changes in interactions between the JH1 and JH2 domains. N on-bonding energy and distances corresponding to specific bonding intera ctions were calculated using the NAMD energy plug-in and VMD graphics t ools respectively. The calculated values for each interaction (A, B) 617 and 1000 (C, D) 595 and 617 (E, F) 543 and 1030, were plotted as a function of time. The respective trend lines for Jak2-WT is colored in black, Jak2 -V617F in pink, Jak2-H538Q/K539L in orange and Jak2-H538Q/K539L/V617F in blue. 112

PAGE 113

B. 0 0.5 1 1.5 2 2.5 3Empt y WT D620K E6 2 1K K539D K5 3 9E D620K/K539 D E621 K/ K539 ELuciferase Activity (RLU) x 10 6 *A. 0 0.5 1 1.5 2 2.5 3E mp ty WT D 6 2 0 A E 6 2 1 A D62 0 A/E621A K539A D620A/K539A E 6 2 1 A/K 5 3 9 ALuciferase Activity (RLU) x 10 6 **B. 0 0.5 1 1.5 2 2.5 3Empt y WT D620K E6 2 1K K539D K5 3 9E D620K/K539 D E621 K/ K539 ELuciferase Activity (RLU) x 10 6 *A. 0 0.5 1 1.5 2 2.5 3E mp ty WT D 6 2 0 A E 6 2 1 A D62 0 A/E621A K539A D620A/K539A E 6 2 1 A/K 5 3 9 ALuciferase Activity (RLU) x 10 6 ** 0 0.5 1 1.5 2 2.5 3E mp ty WT D 6 2 0 A E 6 2 1 A D62 0 A/E621A K539A D620A/K539A E 6 2 1 A/K 5 3 9 ALuciferase Activity (RLU) x 10 6 ** Figure 3-8. Salt bridge inte raction between D620, E621, and K539 is critical to the autoinhibition of Jak2-WT. (A, B) COS-7 cells were co-transfected with 5 g of the indicated Jak2 plas mids and luci ferase plasmid. Lysates from the transfected cells were used to measur e luciferase activity. RLU measured was plotted as a function of the mutation status. Shown is a representative plot from at least three independent ex periments, p < 0.05, **p < 0.005. 113

PAGE 114

114 B. 0 2 4 6 8 10 12 14 EmptyWTH538Q, K539L H538Q, K539L, D620R H538Q, K539L, E621R H538Q, K539L, R541D H538Q, K539L, R541E H538Q, K539L, D620R, R541D H538Q, K539L, E621R, R541ELuciferase Activity (RLU) X10 6 ** ** 0 5 10 15 20 25 30 EmptyWTH538Q, K539L H538Q, K539L, D620A H538Q, K539L, E621A H538Q, K539L, D620A, E621A H538Q, K539L, R541A H538Q, K539L, D620A, R541A H538Q, K539L, E621A, R541ALuciferase Activity (RLU) X10 6 ** ** *A. B. 0 2 4 6 8 10 12 14 EmptyWTH538Q, K539L H538Q, K539L, D620R H538Q, K539L, E621R H538Q, K539L, R541D H538Q, K539L, R541E H538Q, K539L, D620R, R541D H538Q, K539L, E621R, R541ELuciferase Activity (RLU) X10 6 ** ** 0 5 10 15 20 25 30 EmptyWTH538Q, K539L H538Q, K539L, D620A H538Q, K539L, E621A H538Q, K539L, D620A, E621A H538Q, K539L, R541A H538Q, K539L, D620A, R541A H538Q, K539L, E621A, R541ALuciferase Activity (RLU) X10 6 ** ** *A. Figure 3-9. Salt bridge inte raction between D620, E621, and R541 is critical to the constitutive activation of Jak2-H538 Q/K539L. (A, B) COS-7 cells were cotransfected with 5 g of the indicated Jak2 and lucifer ase plasmids. Luciferase assay was performed on t he cell lysates. RLU measured was plotted as a function of the mutation st atus. Shown is a representative plot from at least three independent ex periments, p < 0.05, **p < 0.005.

PAGE 115

CHA PTER 4 PHOSPHORYLATION OF JAK2 AT Y372 IS IMPORTANT FOR JAK2 DIMERIZATION AND ACTIVATION 1 Summary Jak2 tyrosine kinase plays an important role i n cytokine mediated signal transduction. There are 49 tyrosine residues in Jak2 and phosphorylation of some of these are known to play important roles in the regulation of Jak2 kinase activity. Here, using mass spectrometry, we identified tyro sine residues Y372 and Y373 as novel sites of Jak2 phosphorylation. Mutation of Y372 to F (Y372F) significantly inhibited Jak2 phosphorylation, including that of Y1007, whereas the Jak2-Y373F mutant displayed only modest reduction in protein phosphorylation. Relative to Jak2-WT, the ability of Jak2-Y372F to bind to and phosphorylate STAT1 was decreased, resulting in reduced Jak2-mediated downstream gene transcription. Wh ile the Y372F mutation had no effect on receptor-independent, hydrogen peroxide-m ediated Jak2 activation, it impaired interferon-gamma (IFN and epidermal growth factor (E GF)-dependent Jak2 activation. Interestingly however, the Y372F mutant exhi bited normal receptor binding properties. Finally, co-expression of SH2-B only partially restored the acti vation of the Jak2-Y372F mutant suggesting that the mechanism wher eby phosphorylation of Y372 is important for Jak2 activation is via dimerization. As such, our results indicate that Y372 plays a critical yet differential role in Jak2 ac tivation and function via a mechanism involving Jak2 dimerization and stabilization of the active conformation. 1 Reprinted in part from Phosphorylation of Y372 is critical for Ja k2 tyrosine kinase activation. Cellular Signaling 2011 23 (11), 1806-1815. 011, with permission from Elsevier. 115

PAGE 116

Preface Jak2 is a non-receptor tyrosine kinase belonging to the Janus family of tyrosine kinases that also includes Jak1, Jak3 and T yk2. A key cellular role of Jak2 is to phosphorylate and hence activate the STAT fam ily of latent cytoplasmic transcription factors. Once activated, the dimerized ST AT proteins translocate to the nucleus, bind DNA promoter elements and modul ate gene expression. Jak2 is activated extrinsically by a variety of cytokine and grow th factor receptor ligands as well as by reactive oxygen species resulting in signaling cascades that regulate cell growth, proliferation and death. Jak2 activity is also intrinsically regul ated through the specific phosphorylation or dephosphorylation of some of its tyrosine residues. The Jak kinases are structurally composed of seven Jak homology (JH) domains. The JH1 domain, located at the C terminal end of the protein, corresponds to the catalytically active tyrosine kinase domain (Duh and Farrar 1995) The JH2 domain that was predicted to lack catalytic activi ty, but has sequence similarity with the JH1 domain, is termed as the pseudokinase dom ain. The pseudokinase domain has been shown to negatively regulate Jak kinase acti vity (Chen et al. 2000; Lindauer et al. 2001; Saharinen et al. 2003b). The JH3 and JH4 r egions represent the SH2-like domain whose function is not fully def ined. At the amino terminus, the JH4-JH7 regions of Jaks comprise the FERM domain. The FERM domain has been shown to be involved in Jak association with receptors (Girault et al. 1998; Hilkens et al. 2001; Zhou et al. 2001). The significance of the FERM domain was understood when mutations in the Jak3 FERM domain that resulted in the loss of its kinase activity were identified in severe combined immunodeficiency (SCID) patients (Cac alano et al. 1999; Zhou et al. 2001). Specifically it was reported that these mutati ons reduced the interaction of Jak3 with the 116

PAGE 117

common -chain of the IL-2 receptors and in paralle l, inhibited its activation in response to ligand binding (Cac alano et al. 1999; Zhou et al. 2001). Therefore, it appears that structural changes in the FERM domain brought about by point mutations can alter the activity of Jak kinases. Of the 49 Jak2 tyrosine residues encoded in murine Jak2, phosphorylation of some of them have been shown to play import ant roles in overall Jak2 tyrosine kinase regulation. Interestingly, m any of these characterized tyro sine residues are situated at the C terminus of Jak2, where the pseudok inase and kinase domains reside. For example, phosphorylation of Y1007 in the activation loop of the kinase domain is required for maximal Jak2 activation (Feng et al. 1997). Additionally, phosphorylation of Y868, Y966 and Y972 has been shown to enhance Jak2 activation (Argetsinger et al. 2010; McDoom et al. 2008). However, aut ophosphorylation at Y913 in the kinase domain negatively regulates Jak2 by suppre ssing erythropoietin-induced Jak2 activation (Funakoshi-Tago et al. 2008b). Finally, phosphorylation of Y570 situated in the pseudokinase domain of Jak2 has been shown to suppress Jak2 tyrosine kinase activity, while that of Y637 enhances Jak2 ac tivation (Argetsinger et al. 2004; Feener et al. 2004; Robertson et al. 2009). Collectively, these data suggest that the activation or inhibition of Jak2 tyrosine kinase can be infl uenced by the phosphorylation status of its numerous tyrosine residues. Fewer phosphorylated tyrosine residues ha ve been characterized in the N terminal region of Jak2, which includes the FERM domain. The charac terized phosphorylated tyrosine residues in the FERM domain have different consequences for Jak2 tyrosine kinase regulation, based on the presence or abs ence of ligand activation and the type of 117

PAGE 118

ligand-receptor syste m involved. For in stance, phosphorylation of Y119 has been shown to dissociate Jak2 from the erythropoi etin receptor and down-regulate its kinase activity in response to erythropoietin (Funakoshi-Tago et al. 2006). Conversely, phosphorylation of Y119 has no effect on Ja k2 regulation in the presence of the interferon-gamma receptor. Our laboratory has shown that phosphorylation of Y201 facilitated Jak2/SHP-2 interaction, which al lowed for the recruitm ent of Jak2 to the angiotensin II type-1 recept or signaling complex (Godeny et al. 2007). In addition, phosphorylation of Y221 increas es ligand-independent Jak2 tyrosine kinase activity (Argetsinger et al. 2004). However, it has no effect on Jak2-dependent signaling in the presence of an erythropoietin-leptin recept or chimera (Feener et al. 2004). Further, phosphorylation of Y317 has been shown to play an important role in the feedback inhibition of Jak2 kinase activity following ligand-mediated activation (Robertson et al. 2009). Given the limited knowledge of how t he FERM domain regulates Jak2 function, identification of novel Jak2 tyrosine phosphorylation sites in this region is important. In this study, we identified Y372 as a novel Jak2 phosphorylation site in the FERM domain of Jak2. Though we found Y373 to be phosphorylated, Y373F mutation did not significantly affect Jak2 phosphorylation. However, we found that phosphorylation of Y372 is critical for maximal Jak2 phosphorylation, STAT1 activation and Jak2dependent gene transcription. In addition, Y 372 phosphorylation has an important and differential role on Jak2-dependent signal transduction in response to ligand. In particular, loss of Y372 phosphorylation reduces interferonand epidermal growth factor-mediated Jak2 activation, but has no effect on hydrogen peroxide-mediated Jak2 activation. Interestingly, Y372 does not contri bute to Jak2 receptor association, despite 118

PAGE 119

its impaired catalytic activity. Lastly, co-expression of SH2Bpartially restored the activation of the Jak2-Y372F mutant. As such this work demonstrates a critical yet differential role of Y372 phosphor ylation in the regulation of the Jak2 kinase activity and subsequent downstream signaling. Materials and Methods Cell Culture BSC-40, COS-7, and Jak2 def icient mouse embryonic fi broblasts (Jak2-/MEF) were cultured at 37oC in a 5% CO2 humidified atmosphere. BSC-40 cells were maintained in high glucose (4.5 g/L) DMEM supplemented wit h 10% newborn calf serum. COS-7 and MEF cells were grown in high glucose DMEM supplemented with 10% fetal bovine serum. The Jak2 null MEFs were kindly provided by Dr. James Ihle (Parganas et al. 1998). BSC-40 cells were used for vaccinia virus mediated transfection-infection experim ents. COS-7 cells were used for experiments involving cotransfection of luciferase or SH2Bplasmids. MEFs were used to examine Jak2 activation in response to ligand stimulat ion. MEFs treated with interferon-gamma, epidermal growth factor or hydrogen peroxide were gr owth-arrested with serum-free DMEM containing 0.5% BSA for 18 hours prior to stimulation. Mass Spectrometry Recombinant Jak2 protein was over-expressed in BSC-40 cells using a vaccinia virus expression system similar to how we have done previously (Ma and Sayeski 2004). The expressed protein was resolved via SDS-PAGE, coomassie stained, excised from the gel and subj ected to nano-HPLC/ ESI ionization on an LTQ mass spectrometer as previously de scribed (Godeny et al. 2007). 119

PAGE 120

Site-Directed Mutagenesis The Y372F and Y373F Jak2 mutations were created in the murine Jak2 cDNA using the QuikChange Mutagenesis protocol (Stratagene, La Jolla, CA). The sense primer sequence used to create the Jak2-Y372F mutation was 5TTAATTGACGGGTTTTACAGACTAACT and the antisense primer sequence was 5AGTTAGTCTGTAAAACCCGTCAATTAA. The sense primer sequence for the Jak2Y373F mutation was 5-ATTGACGGGTATTTTAGACTAACTGCG and the antisense primer sequence was 5-CGCAGTTAGTCT AAA ATACCCGTCAAT. All the mutations were verified by DNA sequencing. Transient Cell Transfections For vaccinia virus mediated transient Jak2 express ion, BSC-40 cells were transfected with 10 g of pRC-CMV plasmids encoding the murine Jak2-WT, Jak2Y372F or Jak2-Y373F cDNA using Lipofectin (Invitrogen, Carlsbad, CA). After 4 hours of transfection, the cells were infected with the recombinant vaccinia virus, vTF7-3, at a multiplicity of infection (MOI) of 1. 0 for 1 hour. The media containing Lipofectin/DNA/vTF7-3 was then removed fr om the cells, replaced with fresh serumcontaining media and the cells were allowed to recover for 16 hours, after which protein lysates were prepared. For Targefect-medi ated transfections of Jak2-/MEF cells, plasmid DNA, Targefect and virofect enhancer (Targeting Systems, El Cajon, CA) were combined in a total volume of 1 mL of serum-free DMEM and incubated at 37oC for 20 minutes. 1 mL of serum-containing DMEM wa s mixed with the tran sfection complex and added onto the cells in 100 mm dishes. The cells were incubated with the transfection complex for 3 hours at 37oC and then allowed to recover for 48 hours in serumcontaining media. For, SuperFect-mediated co-transfections the respective plasmid 120

PAGE 121

DNA and SuperFect (Qiagen, Valencia, CA) were incubated in 300 L of serum freeDMEM for 10 minutes at room temperature. Later, 3 mL of serum containing DMEM was mixed with the transfecti on complexes and added to the MEFs in 100 mm dishes. The cells were then allowed to recover for 48 hours. Cell Lysis and Immunoprecipitation Cells were washed with two volumes of ice-cold PBS containing 1 mM Na3VO4 and lysed with 0.8 mL of ice cold RIPA buffe r (20 mM Tris pH 7.5, 10% glycerol, 1% Triton X-100, 1% deoxycholic acid, 0.1% SDS, 2.5 mM EDTA, 50 mM NaF, 10 mM Na4P2O7, 4 mM benzamidine, and 10 g/mL aprotinin). Cleared protein lysates were incubated with 2 g of antibody and 20 L of protein A/G plus agarose beads (Santa Cruz Biotechnology, Santa Cruz, CA) for 2 hours at 4o C. Protein complexes were washed three times with wash buffer (25 mM Tris, pH 7.5, 150 mM NaCl, and 0.1% Triton X-100) and resuspended in SDS sample buffer. Immunoprecipitated proteins were boiled, separated by SDS-PAGE, and transferred onto nitrocellulose membranes. Anti-Jak2 and anti-STAT1 antibodies for imm unoprecipitation were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Western Blotting Nitrocellulo se membranes were blocked in either 5% BSA/TBST or 5% milk/TBST at room temperature. The membranes were then in cubated with the primary antibody, followed by the respective secondary anti body (1:4000, GE Healthcare), with TBST washes in-between. A mixture of PY99, PY20 and 4G10 monoclonal antibodies from Santa Cruz Biotechnology, BD Transducti on Labs, and Millipore, respectively, were used to detect phosphotyrosine. Anti -Jak2 pY1007/pY1008 and anti-STAT1 pY701 121

PAGE 122

antibodies were from BioSour ce and Santa Cruz Biotechnology, respectively A cocktail of antibodies from Millipore and BioSource we re used to detect Jak2. The anti-STAT1 antibody was from Santa Cruz Biotechnology and the anti-myc antibody was from Cell Signaling. The blots were vis ualized using Western LightningPlus or Ultra enhanced chemiluminescence system (Perkin Elmer, Waltham, MA). Densitometry was performed using the automated digitizing so ftware, Un-Scan-It, Version 5.1 (Silk Scientific, Orem, Utah). All phosphorylation levels were normalized to total protein levels. Luciferase Assay COS-7 cells were transiently transfected with the appropriate Jak2 expression plasmid and 2 g of a luciferase reporter plasmid c onsisting of four tandem copies of the interferonactivating sequence (pLuc-GAS) using Lipofectin. Following 5 hours of transfection, approximately 7 x 105 cells were seeded onto six well culture dishes. The cells were allowed to recover in serum cont aining DMEM for 48 hours and then lysed in 1X Reporter Lysis buffer (Promega) for 5 hours. During lysis, the lysates were exposed to one freeze-thaw cycle between 23oC and -80oC. 20 L sample of lysate was combined with 100 L of luciferase substrate and relative light units were assessed by a Monolight 3010 luminometer. Immunofluorescence Jak2-/MEFs were cultured in 2-well cham ber slides where they were transfected with 2 g of either pRK5-FLAG-Jak2-WT or Y372F using Targefect and allowed to recover for 48 hours. The cells were then se rum starved for 18 hours and then treated with 500 IU/mL (final concentration) of interf eron-gamma for either 0 or 15 minutes. 122

PAGE 123

Following interferontreatment, the cells were fixed at -20C in a mixture of 50% methanol a nd 50% acetone for 10 minutes. T he fixed cells were blocked with 10% BSA for 30 minutes at room temper ature. They were then inc ubated overnight with a primary antibody mixture of rabbit antiFLAG and mouse anti-IFNGR at 4C. Next day, the cells were washed with PBS for four times at room temperature. Following this, they were incubated with a secondary antib ody mixture of anti-rabbit conjugated to TR (Red) and anti-mouse conjugated to FITC (Green) for one hour at room temp erature. The cells were again washed with PBS, mounted with Ultra Cruz DAPI containing mounting media (Santa Cruz) and sealed with a cover slip. These cells were imaged using a 60x objective on an inverted fluorescence microscope (Olympus). The anti-FLAG antibody was from Sigma and the anti-IFNGR anti body was from Abcam. The secondary antibodies were from Santa Cruz. Statistical Analysis Statistical signific ance between groups was analyzed using Students t-test. Significance was set at = p < 0.05 and ** = p < 0.005. Results Y372 is a Conserved Site of Jak2 Phosphorylation Jak2-WT was over expressed in BSC-40 cells using a vaccinia virus system and then purified to homogeneity as previously described (Ma and Sayeski 2004) The purified Jak2 protein was then subjec ted to a combination of nano-HPLC/ ESI ionization on a LTQ mass spectrometer. P eptide fragment analysis corresponding to Y372 and Y373 indicated that they were both phosphorylated (Fig. 4-1A). To further characterize the significanc e of Y372 and Y373 phosphorylation, we determined whether these amino acid residues were conserved evolutionarily. 123

PAGE 124

Comparison of the amino acid sequence of Jak2 from diverse species revealed that tyrosines 372 and 373 are conserved (Fig. 4-1B). However, evaluation of the amino acid sequence of the different Jak family member s in mouse revealed that Y372 is highly conserved, while tyrosine at position 373 is replaced wit h phenylalanine in murine Jak1, Tyk2, and Jak3 (Fig. 4-1C). This indicated t hat the aromaticity of 373 is conserved, but not its phosphorylation. Thus, the data in Fig. 4-1 indicate that Y372 and Y373 in murine Jak2 are sites of phosphorylation. The Y372 residue is highly conserved across various species and also in other Jak family members while Y373 is conserved only across species. The highly conserved nature of Y372 relative to Y373 suggests that phosphorylation of Y372 could play an important role in Jak2 function. Loss of Y372 and Y373 Phosphorylation Reduces Jak2 Phosphorylation Our next step was to determine if these ty rosines were important for total Jak2 tyrosine phosphorylation as well as for phosphorylation of Y1007, a residue whose phosphorylation is essential for maximal Jak 2 activation (Feng et al. 1997). For this, Y372 and Y373 were mutated to phenylalanine in order to disrupt phosphorylation at these sites, while preserving the protein st ructure. BSC-40 cells were transfected with empty vector, Jak2-WT, Jak2-Y372F, or Ja k2-Y373F. Overexpressed Jak2 protein was immunoprecipitated with a Jak2 antibody and the precipitates were serially probed with antibodies to detect overall tyrosine phosphorylation (Fig. 4-2A), tyrosine 1007 phosphorylation (Fig. 4-2B), and total Jak2 prot ein (Fig. 4-2C). Thre e independent blots were then quantified and the average levels of total Jak2 tyrosine phosphorylation (Fig. 4-2D) and Y1007 phosphorylation (Fig. 4-2E) were plotted as a function of Jak2 status. The cumulative results show that total Jak2 phosphorylation was significantly reduced 124

PAGE 125

for both Jak2-Y372F and Jak2-Y373F, alth ough the reduction with Jak2-Y372 was much greater (Fig. 4-2D). With respect to Jak2 Y1007 phosphorylation levels, we found that the loss of phosphor ylation at Y372 completely eliminated Jak2 Y1007 phosphorylation, when compared to wild-type Jak2 protein. The Y373 mutant also exhibited significantly r educed Y1007 phosphorylation when compared to Jak2-WT, but to a lesser extent than t hat of the Y372F mutant. Collectively, the data in Fig. 4-2 demonstrat e the significant yet differential roles of Y372 and Y373 in regulating Jak2 autophosphoryl ation. Specifically, Y372 appears to be more important for the catalytic activi ty of Jak2 when compared to Y373, since Y372F mutation more effectively reduced Y1 007 and total Jak2 phosphorylation relative to Y373F. Furthermore, this observation is in accordance with the sequence conservation of tyrosine at 372 when compared to the mere conserva tion of aromaticity at position 373 (Fig. 4-1C). The Jak2-Y372F Mutation Abrogates Jak2-mediated Gene Expression It is known that Jak2 is capable of drivi ng a basal level of gene expr ession even in the absence of ligand stimulation (Chatti et al. 2004; Wallace et al. 2004). This ligandindependent gene expression corresponds to the intrinsic functi onal activity of Jak2. Here, we sought to determine whether loss of Y372 phosphorylation affects the intrinsic functional capacity of Jak2 to drive gene expression. For this, COS-7 cells were transiently transfected with a plasmid encoding the firefly luciferase cDNA under the control of four tandem Jak/STAT-binding prom oter elements (Wallace et al. 2004). In addition, the cells were co-transfected wit h empty vector, Jak2-WT, or Jak2-Y372F plasmids. Two days later, luciferase ac tivity was determined and graphed as a function of Jak2 status (Fig. 4-3A). We found that the Jak2 -Y372F mutation significantly 125

PAGE 126

reduced the ability of Jak2 to drive lucife rase gene expr ession when compared to Jak2WT. To confirm equal expressi on levels of both Jak2-WT and Jak2-Y372F, a portion of the transfected protein lysates were immunoblo tted with a Jak2 antibody (Fig. 4-3B). Thus, the results from the luciferase assay reveal the importance of Y372 phosphorylation in Jak2 dependent activation of downstream gene transcription. This is in agreement with observed reduction in ST AT1 phosphorylation and co-association by the Jak2-Y372F mutant (data not shown). Loss of Y372 Phosphorylation Prevents Interferon-Gammaand Epidermal Grow th Factor-, but not Hydrogen Peroxide-Mediated Jak2 Activation Next, we wanted to examine the functional significance of Y372 phosphorylation in the context of ligand-dependent Jak2 signa ling. Interferon-gamma is a known and potent activator of Jak2 tyrosine kinase (Parg anas et al. 1998; Pestka et al. 1997). We therefore sought to determine the effect of Y372 phosphorylati on on interferon-gammamediated Jak2 activation. Here, Jak2-/MEFs that endogenously express the interferon-gamma receptor were transiently transfected with empty-vector, Jak2-WT or Jak2-Y372F expressing plasmids. The cells were treated with interferon-gamma as indicated and then lysed. Jak2 protein was immunoprecipitated from the lysate and Jak2 Y1007 phosphorylation levels were m easured by immunoblotting with an anti-Jak2 pY1007/ pY1008 antibody. In agreement with published repor ts (Funakoshi-Tago et al. 2006; Parganas et al. 1998), we found that Jak2-WT was activated in a liganddependent manner (Fig. 4-4A, t op). However, loss of Y372 phosphorylation blocked the interferon-gamma-mediated increase in Jak2 tyrosine 1007 phosphorylation. The membrane was subsequently st ripped and equal Jak2 protein expression was verified via Western blot with an anti-Jak2 antibody (Fig. 4-4A, bottom). 126

PAGE 127

Jak2 can also be activated in response to mitogenic gr owth factors such as epidermal growth factor (Andl et al. 2004; Shuai et al. 1996). Thus, we sought to determine the effect of Jak2 Y372 phosphorylation on the ability of Jak2 to respond to growth factor stimulation as opposed to cytokine stimulation. Cells were again transfected with empty vector Jak2-WT or Jak2-Y372F plas mids. We found that in agreement with previously publis hed reports (Andl et al. 2004; Shuai et al. 1996), Jak2WT was activated in response to epidermal gr owth factor stimulation (Fig. 4-4B, top). On the other hand, loss of Y372 phosphorylat ion completely inhibited the epidermal growth factor-mediated increase in Jak2 kina se activity as determined by the complete lack of Y1007 phosphorylation on the Y372F mutant. The membrane was stripped and re-probed with an anti-Jak2 antibody to verify equal protein loading (F ig. 4-4B, bottom). Lastly, Jak2 can be activated by hydrogen peroxide induced oxidative stress (Madamanchi et al. 2001; Sandberg and Sayeski 2004; Simon et al. 1998). This mechanism of activation is uniquely differ ent from that of interferon-gamma and epidermal growth factor, in that it involves oxidation of inhibitory phosphatases rather than oligomerization of recept or bound Jak2 molecules as in the former case (Kurdi and Booz 2009; Madamanchi et al. 2001; Simon et al. 1998). Therefore, we wanted to determine the impact of Y372 phosphorylation on receptor independent Jak2 activation in response to hydrogen peroxide. For this, Jak2-/MEFs were transiently transfected with empty vector, Jak2-WT or Jak2-Y372F expressing plasmi ds. After serum starvation, the cells were treated as shown. Consistent with previous reports (Madamanchi et al. 2001; Sandberg and Saye ski 2004; Simon et al. 1998), hydrogen peroxide potently activated Jak2-WT (Fig. 4-4C, top). Unlike interferon-gamma and 127

PAGE 128

epidermal growth factor, the loss of Y372 phosphorylation did not have any effect on hydrogen peroxide-mediated Jak2 tyrosi ne 1007 phosphorylation. To demonstrate equal Jak2 express ion amongst all samples, the membrane was stripped and re-blotted with anti-Jak2 antibody (Fig. 4-4C, bottom). Collectively, the data in Fig. 4-4 dem onstrate that phosphoryl ation of Y372 is critical for interferon-gammaand epidermal gr owth factor-mediated Jak2 activation, but not for hydrogen peroxide-dependent Jak2 activation. Loss of Y372 Phosphorylation does not Affect Jak2/Receptor Co-associ ation The data in Fig. 4-4 demonstrate that phosphorylation of Y372 is important for receptor-mediated Jak2 activation thr ough interferon gamma and epidermal growth factor, but not for recept or-independent activation through hydrogen peroxide. Y372 is present in the FERM domain, which is known to play an important role in Jak2/receptor co-association (He et al. 2003; Huang et al 2001). Therefore, one possible explanation for the observed inability of interferon gamma and epidermal growth fa ctor to activate Jak2 is that the Y372F mutation may disrupt Jak2/receptor co-association. To assess this, Jak2-/MEFs were transfected with FLAG tagged Jak2 expression plasmids and cellular localization of both Jak2 and the interferon-gamma receptor (IFNGR) was determined using immunofluorescence. We observed that for both Jak2-WT and Jak2Y372F, Jak2 localized near the membr ane and was distributed diffusely in the cytoplasm and this pattern did not change with interferon-gamma treatment (Fig. 4-5). The IFNGR was located primarily at the plasma membrane. There was considerable overlap in the co-localization pattern of Jak2 and IFNGR in the case of Jak2-WT and this did not change with the introduction of th e Y372F mutation. Furthermore, the ability 128

PAGE 129

of the Jak2-Y372F mutant to fully co-asso ciate with the IFNGR was also observed in IP/western co-immunoprecipitatio n assays (data not shown). In summary, the data in Fig. 4-5 indicate that the inability of interferon gamma to activate the Y372F mutant is not due to an impaired ability of the protein to bind to the IFNGR. Co-expression of SH2Bis Capable of Partially Re storing Jak2-Y372F Activation Following ligand binding, receptor bound Jak2 molecules are brought within close proximity to one another allowing for Jak2 dimerization and subsequent activation (Livnah et al. 1999; Ortmann et al. 2000). SH2Bis an adaptor protei n that promotes dimerization and stabilization of Jak2 in its ac tive conformation (Kurze r et al. 2004; Nishi et al. 2005; Rui and Carter-Su 1999). As the next step in understanding the mechanism of Jak2 regulation through phosphorylation of Y372, we hypothesized that the Y372F mutation may impair Jak2 dimerization and/or stabilization of the activation loop. To test this, cells were transfected with SH2Bas well as Jak2-WT or Jak2-Y372F plasmids. Two days later, the cells were lysed and biochemical analysis was performed. Shown are represent ative blots for the levels of Y1007 phosphorylation (Fig. 4-6A), Jak2 protein expression (Fig. 4-6B), and SH2Bexpression (Fig. 4-6C). Quantification of the phosphoY1007 levels normalized to to tal Jak2 protein revealed that co-expression of a strong dimerizing agent, SH2Bincreased Jak2-WT phosphorylation by 5-fold (Fig. 4-6D). Howeve r, in the case of Jak2-Y372F, Jak2 kinase activity was only partially restored. Taken together, the data in Fig. 4-6 demonstrate that co-expression of SH2Bis capable of partially restoring Jak2-Y372F acti vation. As such, this suggests that the 129

PAGE 130

mechanism by which the Y372F mutation affects Jak2 kinase function is via mechanisms that involve Jak2 dimerization and/or stabilization of the activation loop. Discussion Using mas s spectrometry analysis, we repor t in this study the identification of tyrosines 372 and 373 as novel sites of Ja k2 phosphorylation. T he data suggest that Y372 has an important role to play in Jak2 activation. Under basal conditions, the Jak2Y372F mutant had an impaired ability to autophosphorylate, and drive Jak2-dependent STAT1 mediated gene expression. Interest ingly, the Jak2-Y372F mutant was not activated in response to interferon-gamma an d epidermal growth factor, but it was fully activated in response to hydrogen peroxide. However, the inability of the Jak2-Y372F mutant to activate in response to interfer on-gamma stimulation was not due to a defect in receptor co-association. Las tly, co-expression of SH2Bpartially restored Jak2Y372F activation suggesting t hat phosphorylation of Y372 affe cts Jak2 kinase activity via mechanisms that involve Jak2 dimeri zation and/or stabiliza tion of the active conformation of the protein. Of the 49 Jak2 tyrosine residues, some ar e known to be phosphorylated and play important roles in Jak2 tyrosine kinase f unction. Interestingly, many of these characterized Jak2 tyrosine phosphorylatio n sites are situated either in the pseudokinase or kinase domains of the pr otein. Less is known regarding the consequences of phosphorylation of tyrosines in the N-terminus of Jak2, where the FERM domain resides. Early work demonstrated that the FERM domain is important for cytokine receptor interaction (Chen et al. 2000; Frank et al. 1995; Kohlhuber et al. 1997; Zhou et al. 2001). More recent work however has shown the importance of the FERM 130

PAGE 131

domain in J ak2 activation and kinase regulat ion (Funakoshi-Tago et al. 2006; Zhao et al. 2010a). Additional evidence comes from the identification of phosphorylation sites in the FERM domain that regulate Jak2 kinase activity. Our results clearly demonstrate that Jak2 -Y372F is defective in activation and kinase activity. Since Y372 is situated in t he FERM domain of Jak2, the loss of Jak2Y372F activity could be explained by one of three possible mechanisms: i) phosphorylation of Y372 is critical for rec eptor co-association ii) phosphorylation of Y372 initiates conformational changes in t he FERM domain that results in changes in kinase activity at the C terminal end of the protein or iii) phosphorylation of Y372 facilitates Jak2 dimerization and subsequent activation. Our results here demonstrate that the Y372F mutant binds the IFNGR norma lly (Fig. 4-5) and treatment of cells with hydrogen peroxide results in full activati on of the Jak2-Y372F mutant protein characterized by a completely stabilized active conformation (Fig. 4-4C). As such, these results suggest that the inability of the Jak2-Y372F mutant to activate is neither due to impaired receptor co-association nor an inability to stabilize the active conformation of the protein. Thus, our data suggests that the mechanism by which Jak2-Y372F has weakened kinase activity is due to impaired dime rization of the Jak2 molecules. This is supported by the observation that expression of SH2Bwhich strongly promotes dimerization and stabilizes the active confo rmation of the protein (Kurzer et al. 2004; Nishi et al. 2005; Rui and Cart er-Su 1999), partially restored Jak2-Y372F activity (Fig. 4-6). Further, the role of dimerization in Jak2 activation is supported by the observed constitutive activation of Jak2 fusion protei ns in cancer, where the Jak2 kinase domain is fused with the oligomerization domains from other partner genes (Griesinger et al. 131

PAGE 132

2005; Lacronique et al. 1997). Our results also demons trate that while Y372 is important for Jak2 activation in response to receptor-bound ligand, it has no effect on hydrogen peroxide-dependent Jak2 activation. Reacti ve oxygen species such as hydrogen peroxide activate Jak2 by inactivating phosphatases through oxidation (Simon et al. 1998). Accordingly, Y1007 phosphorylation and Jak2 activation happen autonomously simply due to the blockade of phosphatase acti vity. In the case of ligand binding to cytokine or growth factor receptors, Jak2 dimerizes and activates via auto and transphosphorylation mechanisms. Accordingly, an impaired dimerizi ng ability of the Jak2-Y372F mutant would be consistent with the inability of the protein to activate in response to receptor activation. A previous work investigated the effect of several conserved Jak2 tyrosine residues, including Y372, on Jak2 functi on (Funakoshi-Tago et al. 2008). Although no evidence was provided that Y372 is phosphory lated, it was shown that a Jak2-Y372F mutant had no effect on Jak2-mediated erythroid progenitor colony fo rmation. We show here that Y372 is phosphorylated using mass spectrometry. Further, Y372 phosphorylation is critical for Jak2 r egulation as loss of Y372 phosphorylation suppressed Jak2 autophosphorylation as well as interferon-gamma and epidermal growth factor-mediated Jak2 activation. The discrepancy between these two findings could be due to several factors. Firs t, our analysis was done at the protein level whereas Funakoshi-Tago et al. used cell based assays. Thus, there may be other kinases in the cell that can act in place of the Y372F mutant. Second, while FunakoshiTago et al. examined the effect of the Jak2 -Y372F mutation in the context of erythropoietin signaling, we studied Jak2-Y3 72F activation in response to interferon132

PAGE 133

gamma and epidermal growth factor signaling. As such, Y372 may play a differential role in response to different stimuli. This concept is supported by the observation that a Jak2-Y119F mutant protein exhibited impair ed erythropoietin recept or binding, but had no consequence on interferon-gamma recept or binding (Funakoshi-Tago et al. 2006). Collectively these results suggest that there are underlying differences in how individual FERM domain tyrosines interact wi th cytokine receptors. We have identified Y372 as a novel site of Jak2 phosphorylation and have shown that phosphorylation of this si te is critical for Jak2 kinase function. Furthermore, our results advance the overall understanding of Jak2 tyrosine kinase regulation via mechanisms that involve the FERM domain. 133

PAGE 134

134 Mouse Rat Chimpanzee Human Zebra fish Chicken Cow Dog 350 399 B Jak2 Jak1 Jak3 Tyk2 C 336 385 A 300 400 500 600 700 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 m/z 0 100 E A L S F V S L I D G pYpYR130 201 314 401 548 647 734 847 960 1075 1132 1375 1618 1792 1792 1663 1592 1479 1392 1245 1146 1059 946 833 718 661 418175 b yb3 b4 y2 b5 b6 y4 y6 y7 y8 y9 y10y11 b12 b10 y5-h2o Mouse Rat Chimpanzee Human Zebra fish Chicken Cow Dog 350 399 B Jak2 Jak1 Jak3 Tyk2 C 336 385 A 300 400 500 600 700 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 m/z 0 100 E A L S F V S L I D G pYpYR130 201 314 401 548 647 734 847 960 1075 1132 1375 1618 1792 1792 1663 1592 1479 1392 1245 1146 1059 946 833 718 661 418175 b yb3 b4 y2 b5 b6 y4 y6 y7 y8 y9 y10y11 b12 b10 y5-h2o 300 400 500 600 700 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 m/z 0 100 E A L S F V S L I D G pYpYR130 201 314 401 548 647 734 847 960 1075 1132 1375 1618 1792 1792 1663 1592 1479 1392 1245 1146 1059 946 833 718 661 418175 b yb3 b4 y2 b5 b6 y4 y6 y7 y8 y9 y10y11 b12 b10 y5-h2o Figure 4-1 Y372 and Y373 are Jak2 phosphorylation s ites that are conserved across varying species and among Jak family mem bers. A) Jak2 was over expressed in BSC-40 cells using vaccinia viru s system and purified as previously described. Purified Jak2 protein was then subjected to nano-HPLC micro ESI analysis on an LTQ mass spectrometer. The tryptic peptide containing Y372 and Y373 was found to be doubly phosphorylated based upon mass of the peptide. Phosphorylation sites were lo cated to the tyrosine residues by MS/MS sequencing, specifica lly the b10 ion, which is labeled in the spectra. Jak2 sequences from different species (B) and Jak family members (C) were aligned using ClustalW. Conservation of residues 372 and 373 is highlighted in both the alignments.

PAGE 135

E m p t y V e c t o r J a k 2 W T J a k 2 Y 3 7 2 F J a k 2 Y 3 7 3 F IP: anti-Jak2-pAb IB: anti-Jak2 pY1007/Y1008-pAb IB: anti-Jak2-pAb Jak2(P) Jak2 IB: anti-Tyr(p)-mAb Jak2(P) 111 111 111 A B C DTotal Jak2 Phosphorylation % Control -20 30 80 130Empty Vector WTY372FY373F 0 ** *Jak2 Y1007 Phosphorylation % ControlE WTY372FY373F -20 30 80 130 1 2 3 4 Empty Vector 0 ** *E m p t y V e c t o r J a k 2 W T J a k 2 Y 3 7 2 F J a k 2 Y 3 7 3 F IP: anti-Jak2-pAb IB: anti-Jak2 pY1007/Y1008-pAb IB: anti-Jak2-pAb Jak2(P) Jak2 IB: anti-Tyr(p)-mAb Jak2(P) 111 111 111 A B C DTotal Jak2 Phosphorylation % Control -20 30 80 130Empty Vector WTY372FY373F 0 ** *Jak2 Y1007 Phosphorylation % ControlE WTY372FY373F -20 30 80 130 1 2 3 4 Empty Vector 0 ** IP: anti-Jak2-pAb IB: anti-Jak2 pY1007/Y1008-pAb IB: anti-Jak2-pAb Jak2(P) Jak2 IB: anti-Tyr(p)-mAb Jak2(P) 111 111 111 A B C DTotal Jak2 Phosphorylation % Control -20 30 80 130Empty Vector WTY372FY373F 0 ** *Jak2 Y1007 Phosphorylation % ControlE WTY372FY373F -20 30 80 130 1 2 3 4 Empty Vector 0 ** *Jak2 Y1007 Phosphorylation % ControlE WTY372FY373F -20 30 80 130 1 2 3 4 Empty Vector 0 ** Figure 4-2. Loss of phosphorylation at Y372 and Y373 decreased the ability of Jak2 to autophosphorylate. A) BSC-40 cells were transfected with 10 g of empty vector, Jak2-WT or Jak2-Y372F plasmi d. Jak2 was immunoprecipitated, resolved by SDS-PAGE and immunoblott ed for phosphotyrosine. B) The membrane was stripped and re-probed fo r phosphorylation at Y1007/Y1008. C) Equal Jak2 expression across all samp les was verified. D) Quantification of total Jak2 phosphorylation (n=3) and E) Jak2 Y1007/1008 phosphorylation (n=3) were done using densitometry. Stat istical significance was determined via Students t -test, = p < 0.05, ** = p < 0.005. 135

PAGE 136

0 20 40 60 80 100 120Luciferase Activity: %WTJak2-WT Empty Vector ** Jak2-Y372F A B N o J a k 2IB: anti-Jak2-pAbJ a k 2 W T J a k 2 Y 3 7 2 F111 0 20 40 60 80 100 120Luciferase Activity: %WTJak2-WT Empty Vector ** Jak2-Y372F A B N o J a k 2IB: anti-Jak2-pAbJ a k 2 W T J a k 2 Y 3 7 2 F111 N o J a k 2IB: anti-Jak2-pAbJ a k 2 W T J a k 2 Y 3 7 2 F111 Figure 4-3. Loss of Y372 phosphorylation reduced Jak2-dependent gene transcription. A) COS-7 cells were transiently transfected with 2 g of luciferase plasmid and 5 g of empty vector, Jak2-WT or Ja k2-Y372F plasmids. Transfected cells were lysed and the relative lumi nescence units (RLU) were read as a measure of luciferase gene expression us ing a luminometer. B) Equal Jak2 expression was ascertained via Western blot analysis. ** = p < 0.005. Shown is one of three independent results. 136

PAGE 137

Empty Jak2-WTJak2-Y372FIP: anti-Jak2 Empty Jak2-WTJak2-Y372FIP: anti-Jak2 A CEmpty Jak2-WTJak2-Y372FIP: anti-Jak2 B 0 10 0 10 0 10 IFN (mins) IB: anti-Jak2 IB: anti-Jak2 pY1007/1008-pAb 111 111 0 10 0 10 0 10 H2O2(mins) 111 IB: anti-Jak2 111 IB: anti-Jak2 pY1007/1008-pAb 111 0 10 0 10 0 10 EGF (mins) IB: anti-Jak2 pY1007/1008-pAb IB: anti-Jak2 111 Jak2 (P) Jak2 Empty Jak2-WTJak2-Y372FIP: anti-Jak2 Empty Jak2-WTJak2-Y372FIP: anti-Jak2 A CEmpty Jak2-WTJak2-Y372FIP: anti-Jak2 B 0 10 0 10 0 10 IFN (mins) IB: anti-Jak2 IB: anti-Jak2 pY1007/1008-pAb 111 111 0 10 0 10 0 10 H2O2(mins) 111 IB: anti-Jak2 111 IB: anti-Jak2 pY1007/1008-pAb 111 0 10 0 10 0 10 EGF (mins) IB: anti-Jak2 pY1007/1008-pAb IB: anti-Jak2 111 Jak2 (P) Jak2 Figure 4-4. Phosphorylation of Y372 is essential for interferon-gamma and epidermal growth factor dependent, but not hydrogen peroxide dependent Jak2 activation. MEF cells were transiently transfected with 10 g empty vector plasmid, Jak2-WT plasmid or Jak2-Y372F plasmid. Following transfection, the cells were treated with A) 500 IU/mL in terferon-gamma (n=3 ), B) 200 ng/mL epidermal growth factor (n =2), and, C) 0.5 mM hydr ogen peroxide (n=2), for 0 or 10 minutes. The cells were subsequently lysed and Jak2 was immunoprecipitated. Jak2 Y1007 phosphorylation was determined via Western blot analysis with an anti-Jak2 pY10 07/pY1008 antibody (top). The membrane was stripped and re-blotted with ant i-Jak2 antibody to verify equal Jak2 expression among samples (bottom). 137

PAGE 138

01 5 Jak2-WT 01 5 Jak2-Y372F IFN (mins) FLAG-Jak2 IFNGR Co-localization DAPI 20 m Merge 015 Jak2-WT 015 Jak2-Y372F IFN (mins) FLAG-Jak2 IFNGR Co-localization DAPI 20 m 20 m Merge Figure 4-5. Phosphorylation of Y372 is not required for Jak2-IFNGR co-associ ation. After transfection with the indicate d Jak2 plasmid and subsequent serum starvation, the cells were treated with interferon-ga mma as indicated. The cells were then co-immunostained with anti-Jak2 and anti-IFNGR ( chain) antibodies and imaged using a fluore scence microscope. FLAG-Jak2 was stained using Texas Red (red) and IFNGR with FITC (green). The nuclei were counter stained with DAPI (blue). ImageJ software was used to confirm the co-localization pattern of Jak2 with IFNGR. Shown is o ne of two independent results. 138

PAGE 139

139 D SH2B ( g ) IB = anti-Jak2-pAb IB = anti-myc-mAb IB = anti-Jak2 pY1007/pY1008-pAb 0 2 0 2 J ak 2 W T J ak 2 Y 3 7 2 F111 111 81 A B C IP: anti-Jak2 Jak2 Jak2 (P) Myc-SH2B 0 200 400 600 800 0202SH2B ( g) ** WT Y372F Jak2 Phosphorylation %WT (0 g, SH2B )D SH2B ( g ) IB = anti-Jak2-pAb IB = anti-myc-mAb IB = anti-Jak2 pY1007/pY1008-pAb 0 2 0 2 J ak 2 W T J ak 2 Y 3 7 2 F111 111 81 A B C IP: anti-Jak2 Jak2 Jak2 (P) Myc-SH2B SH2B ( g ) IB = anti-Jak2-pAb IB = anti-myc-mAb IB = anti-Jak2 pY1007/pY1008-pAb 0 2 0 2 J ak 2 W T J ak 2 Y 3 7 2 F111 111 81 A B C IP: anti-Jak2 Jak2 Jak2 (P) Myc-SH2B 0 200 400 600 800 0202SH2B ( g) ** WT Y372F Jak2 Phosphorylation %WT (0 g, SH2B )c Figure 4-6. Activation of Jak2-Y372F is parti ally recovered in the presence of SH2B. COS-7 cells were transi ently transfected with 2 g of either em pty vector or myc-SH2Balong with 5 g of either Jak2-WT or Ja k2-Y372F plasmids. A) Transfected cells were lysed and the Jak2 activation was measured by western blot using anti-pY1007/pY1008 Jak2 Expression levels of Jak2 (B) and SH2B(C) were ascertained using antiJak2 and anti-myc antibodies. D) Densitometry analysis was perform ed on the western blots to quantify Jak2 phosphorylation and plotted with respect to Jak2-WT without SH2Bn = p < 0.05, ** = p < 0.005.

PAGE 140

CHA PTER 5 PURIFICATION OF RECOMBINANT HUMAN JAK2 PROTEIN USING BACTERIAL AND INSECT SYST EMS Summary Jak2 is a tyrosine kinase that plays a signific ant role in cellular signaling and disease. It is important to understand the st ructure and function of Jak2, in order to decipher its role in disease and develop e fficient therapeutics. To date, structurefunction knowledge of Jak2 has been acquir ed from biochemical studies, homology modeling and molecular dynamics simulations. However, the crystal structure of Jak2 will provide more precise information on the domain organization and molecular networks that connect them. Here, we atte mpted to purify the Jak2 protein using recombinant methods, in order to be able to obtain a crystal structure. Both bacterial and insect systems were used to express either full length or partial Jak2 proteins. However, problems such as protein insolubility and degradation prevented successful purification of the Jak2 protein at sufficient purity and concentration that is required for crystallisation. The protocol s employed and the results obtained are summarized here in order to guide future attempts at troubleshooting such problems and purifying the Jak2 protein. Preface Jak2 is a cytoplasmic tyrosine kinase that was identified as t he third member of the Jak family in 1992 (Harpur et al. 1992) Jak2 is expressed ubiquitously and its crucial role in hematopoies is was identified through knoc kout studies. Jak2 has two catalytic domains located adjacent to each other, unlike other tyrosine kinases. Later one of the domains was found to lack certai n conserved residues and was predicted to be a pseudokinase domain. There were also five other homology domains shared by 140

PAGE 141

the Jak family members. The seven Jak hom ology domains were identified based on their primary sequence homology. However, based on their secondary structure homology, they can be further classified int o four functional domains as kinase, pseudokinase, SH2-like and FERM domain. The pseudokinase domain has been shown to negatively regulate the kinase domain through autoinhibition (Saharinen et al. 2000). There have been numerous biochemical studi es conducted to study the structurefunction of the Jak family members. However, there is no evidence regarding the physical arrangement of the seven Jak hom ology domains. Kroemer and colleagues prepared a homology model of the full length Jak2 protein using a combination of domain modeling, loop modeling, and comparative sequence analysis methods (Giordanetto and Kroemer 2002). Th is model has served as an alternate in place of a crystal structure, to prov ide ideas regarding the plausib le domain arrangements. The Jak2 homology model has shown that ther e could be an anti-symmetrical interface between the kinase domain and pseudokinase dom ain that mediates the autoinhibition. However, knowledge about the allosteric regulat ion of the Jak kinase is still incomplete. Specifically, the mechanism by which the pseudokinase domain autoinhibits the kinase domain and also the mechanism for kinase activation following ligand binding to the receptor is not known yet. Curiosity about th e crystal structure of Jak2 has been fueled by the recent discovery of a Jak2 mutation, V617F, to be associated with a large population of patients present ing with the myelopr oliferative neoplasms (MPN) disease (Wadleigh and Gilliland 2006). The V617F mutati on occurs in the pseudokinase domain and it is predicted to disrupt the autoinhibition ov er kinase domain, thus resulting in constitutive activation of Jak2. This important discovery motivated t he identification of 141

PAGE 142

small molecule inhibit ors that can inhibi t Jak2 activity and hence can be used in the treatment of MPN disease. Thus, the crys tal structure of the Jak2 kinase domain was solved in 2006 and it has since assisted in devel oping several Jak2 inhibitors that target the kinase domain (Lucet et al. 2006). A major obstacle in obtaining the cryst al structure or conducting biophysical studies is obtaining a pure Jak2 protein. In order to obtain crystals of a particular protein, high concentrations of the protein that is near 100% purity is required. Further, presence of disordered regions that increas e motions in the protein can prohibit the formation of crystals. Jak2 protein has 1132 amino acids and its mole cular weight is 130 KDa. Based on secondary structure predictions and homology modeling, Jak2 has four major domains that are connected through link er regions. The linker regions are large disordered regions that are sensitive to pr otease action and often lead to degradation of the pure protein. Ma and Sayeski have previous ly shown the feasibility of purifying Jak2 protein by expressing it via vaccinia viru s in mammalian cells (Ma and Sayeski 2004). However, the yields were not sufficient for crystallisation. Moroever, it requires the use of HA-antibody affinity, which may not be economical for large-scale purifications. Collectively, until date there has been no feasible purification of the full length Jak2 protein at levels that are sufficient to conduct biophysical studies or crystallisation. Therefore, in the interest of deciphering the mechanism for Jak2-V617F constitutive activation we attempted to purify full length and partial Jak2 proteins that included both the kinase and the pseudokinase domains. E. coli is the best known system for recomb inant expression and purification of proteins in order to obtain high yields. However, E. coli is a prokaryotic system that 142

PAGE 143

lacks appropriate post-translational modification enzymes and chaperones to assist in the proper folding of eukaryotic proteins. Therefore, there is a high probability that multi domain eukaryotic proteins that are expres sed in E. coli may become insoluble and end up in inclusion bodies. However, it is possibl e to recover such proteins from inclusion bodies using appropriate refolding protocols. Insect cells have been found to be more favorable for expressing recombinant eukaryo tic proteins since their posttranslational modifications and folding machinery are very similar to that of the mammalian cells. However, the yield of protein obtained from insect cells can be lesser and a comparatively larger scale up would be required than that of E. coli. We ran into some obstacles in the form of misfolded proteins that go into inclusion bodies in E. coli and Jak2 protein degradation inside insect cells, while purifying Jak2. Here, I have attempted to summarize my effort s in the purification of Jak2 using both bacterial and insect systems and suggested possible modifications that could be employed in the purification protocol in future. Materials and Methods Construction of Jak2 Construct for Expression in E.coli Human Jak2 cDNA encoding amino acids 483 to 1132 was amplified from pC MV6human Jak2 ORF (Origene) using high fidelity Platinum Taq polymerase (Invitrogen). The PCR product was TOPO cloned into pTrcHis 2TOPO vector (Invitrogen) that carries a C-terminus His tag. Human Jak2 cDNA encoding amino acids 483 to 1132 was amplified from pCMV6human Jak2 ORF (O rigene) using PfuTurbo and the restriction sites Not I and Xho I were introduced on their 5'and 3'ends by engineering the primers. The amplified PCR product was cloned into pQ ET7-vector2 (Qiagen) using 143

PAGE 144

restriction digestion with Not I and Xho I, followed by lig a tion using T4 DNA ligase at room temperature. Construction of Jak2 Construct and Pr oduction of Baculoviruses for Expression in Insect C ells Full length human Jak2 cDNA was cloned fr om pcDNA3-Jak2 to pFastBac HT C using Sal I and Not I restriction digestion, fo llowed by ligation using T4 DNA ligase at 16C overnight. Similarly, Jak2 cDNA enc oding amino acids 295 to 1132 was cloned from pcDNA3-Jak2 to pFastBac HT B using EcoR I restriction digestion, followed by ligation using T4 DNA ligase at 16 C overnight. In all cases, clones were verified by restriction digestion, PCR screening and DNA sequencing. Jak2 cDNA cloned into the pFastBac HT vectors were used to transform DH10Bac E. coli cells. Here, they undergo homologous transposition via the flanking Tn7 transposon elements into the bacmid present in DH10Bac E. coli cells. Cells containing the recombinant bacmid were selected usi ng blue white selection based on the lacZ reporter expression. The recombinant bacmid contains the Jak2 cDNA incorporated into the baculovirus genome. This recombinant bacm id was purified from positive colonies and used to transfect the Sf9 insect cells. Tr ansfected insect cells express the proteins encoded by the recombinant bacmid and pa ckage the baculovirus. The recombinant baculovirus is then secreted into the media from the insect cells. Thus, the supernatant containing the recombinant baculovirus was used to further amplify the virus and also employed for recombinant protein ex pression in the insect cells. Insect Cell Culture Sf9 insect cells were used for both reco mbinant baculovirus amplification and protein expression. These cells were grow n in Sf-900 II serum free medium medium 144

PAGE 145

(Invitrogen) in the presence of 1X antibiotic-antimycotic (Invitrogen). The Sf9 cells were cultured at 28 C in an Exc ella E24R shaker, with shaking at a speed of 110 rpm. Plaque Assay The recombinant bac ulovirus was tite red using an agarose based plaque assay. The Sf9 cells were grown in suspension up to a density of 2x106 cells/mL and then diluted to 1x106 cells/mL using fresh serum free medi um. 1 mL of the diluted cells was added to each well of a 6-well plate and allowed to attach for about 30 minutes at 28 C. 1mL serial dilutions of the virus were prepar ed using serum free medium in the dilution range of 10-2 to 10-7. 200 L of the diluted virus was added to each well of the attached cells in the 6-well plate and incubated for 1 hour at 28 C, with shaking every 15 minutes. Each virus dilution was titered in duplicate wells. A nutrient solution was prepared by mixing 1.3X Sf900 media, 100X antibiotic-antimycotic, and 10X FBS. 4% agarose was also prepared and added to the nut rient solution that was warmed at 37 C. After the 1 hour incubation, the virus wa s removed and the agarose-nutrient solution was added to the cells. Once t he agarose solidified, it was layered with 2 mL of serum free medium and the plates were incubated at 28 C for 72 hours. The plaques were visualized at the end of 72 hours using neutral red staining. Protocol for Purification of Recombinan t JH1-3 Jak2 from Inclusion Bod ies in E.coli The protocol used for cell ly sis and purification from in clusion bodies was guided in part by the iFOLD refolding system manual and the Qiaexpressionist. E. coli expressing pQET7v2 JH1-JH3 Jak2 was allowed to grow to an OD600 of 0.8 and induced with 0.5 mM IPTG. Following IPTG induction, the cult ure was grown for 3 hours and the cells were collected by centrifugation at 4000g for 20 minutes at 4 C. The collected cells 145

PAGE 146

were resuspended in a lysis buffer contai ning 50 mM Tris, 50 mM NaCl, 1mM TCEP, 0.5 mM EDTA, and 5% glycerol at pH 8. The cells wer e lysed using lysozyme and mechanical lysis via french press. The l ysate obtained was centrifuged at 8000g for 15 minutes at 4C. The inclusion bodies present in the pellet were further purified by resuspension in a wash buffer (50 mM Tr is, 50 mM NaCl, 1mM TCEP, 0.5 mM EDTA, and 5% glycerol at pH 8) that contained 1% triton-X 100 and t hen wash buffer without triton-X 100, followed by centri fugation. Protein present in the purified inclusion bodies was denatured by resuspending them in t he denaturing buffer (50 mM Tris, 50 mM NaCl, 5 mM TCEP, 0.5 mM EDTA, and 5% glycero l at pH 8), followed by the addition of 30% N-laurylsarcosine per 0.5 g of the pellet. The resuspended solution was centrifuged at 25000g for 15 minutes at 4 C. The supernatant containing the denatured protein was collected and dialysed agains t a buffer containing 10 mM Tris, 0.05 mM EDTA, 0.1 mM TCEP, and 0.06% N-laurylsarcosine, at pH 8. The denatured protein was then refolded in the E4 buffer that was identified by screening using the iFOLD system. The E4 refolding buffer contained 50 mM Tris, 100 mM NaCl, 12.5 mM Methyl-cyclodextrin, and 1 mM TCEP at pH 8. After refo lding, the protein sample was spun at 20000g for 45 minutes to remove any precipitat es. The soluble fraction of the refolded protein was dialysed against the His column binding buffer (10 mM NaH2PO4, 500 mM NaCl, and 30 mM Imidazole at pH 8) and th en bound to a Ni-NTA column. The column was washed using the same His column bind ing buffer and the protein was eluted using the elution buffer (10 mM NaH2PO4, 500 mM NaCl, and 250 mM Imidazole at pH 8). 146

PAGE 147

Activity Assay ELISA was used to assess the activity of refolded proteins and it was conducted using the Invitrogen kit for detecting Jak2 phosphorylation at Y1007 and Y1008. The assay was performed according to manufacturers instructions. 32P kinase assay was also conducted to assess the Jak2 activity after refolding. It was performed by incubating 500 ng of Jak2 protein with 100 ng of STAT1 peptide in 60 l of kinase buffer (100 mM HEPES pH 7.6, 10 mM MgCl2, 200 mM NaCl, 6 M Cold ATP, 1 Ci -ATP, freshly added 2 mM Na3VO4, and 1 mM DTT) for 25 minutes at 28 C. The reaction was stopped by adding 6 l of 0.5 M EDTA. The entire reaction was transferred onto a 21 mm Glass microfibre W hatman filter, which was washed in 5% TCA and dissolved in scintillati on liquid. Radioactivity of each sample was measured using a scintillation counter. T he counts observed were normaliz ed to the total protein used and extrapolated as a measure of the kinase activity. Protocol for Protein Puri fication from Insect Cells Sf9 cells were grown to a density of 2 106 cells/mL and infected with the baculovirus at an MOI of 5. After infecti on, the cells were cultured for 72 hours and pelleted at 3000g for 10 minutes. T he cell pellet was lysed in 50 mL lysis buffer (50 mM Tris, 500 mM NaCl, 20 mM imidazol e, 5% glycerol at pH 8) per 2 109 cells. Additionally, 1mg/mL lysozyme, 1% IG EPAL, benzonase, 1 mM PMSF, and EDTA free protease inhibitor tablets (Roche) were also added in order to assist in lysis. Following lysis, the sample was sonicated and the l ysate was centrifuged at 14000g for 1 hour at 4 C. Supernatant obtained was incubated wit h pre-equilibrated Ni-NTA agarose beads for 2 hours at 4 C with gentle rocking. The protein purification proc edure from now on 147

PAGE 148

was conducted at 4 C. The protein bound Ni-NTA beads were allowed to settle in an empty column and the flow through was coll ected. The settled beads were washed with 2 column volumes eac h of 20 mM and 60 mM imidazole. The bound protein was eluted using 2 column volumes of 250 mM imidazol e. The eluted protein was dialyzed to remove the imidazole and then run through a Superdex 200 gel filtration column. Buffer used for the gel filtration contained 50 mM Tris, 150 mM NaCl, 5 mM DTT, 5% glycerol at pH 8. Samples collected during the purif ication were analysed using denaturing SDSPAGE, native PAGE, coomassie st aining and western blotting. Results Expression of Jak2 in E.coli using pTrcHis2TOPO E. coli is the best-known system for recombi nant expression in order to obtain high yields. Therefore, it became the first choice for expressing the recombinant human Jak2 protein. The pTrcHis2TOPO system from Invi trogen offered the convenience of cloning the Jak2 cDNA directly into the vector al ong with a C-terminal his tag. Thus, it can be used for expression under the control of the trc promoter after IPTG induction. The cloned Jak2 cDNA was transformed into TOP10 cells. One of the colonies was picked and inoculated in SOB medium containing 0. 5% glucose to grow overnight. Glucose helps in preventing leaky basal transcription, in the absence of IPTG induction. The over night culture was then diluted and allowed to grow in SOB medium until it reached an OD600 of 1. It was then induced with 1 mM IPTG and cultured for another 12 hours. Sample cultures were collected at 0, 1, 2, 3, 4 and 12 hours after IPTG induction for monitoring protein expression and the cell pe llet was dissolved in 1X SDS buffer. These samples were then run on SDS-PAGE and either stained with coomassie (Fig. 5-1A) or blotted with anti-Jak2 antibody (Fig. 5-1B). 148

PAGE 149

Coomassie staining of the samples reveal ed that Jak2 was express ed in an IPTG dependent manner and its expression increased over time (Fig. 5-1A). This indicated that 3 hours could be the optimal time point to attain maximum ex pression. This was further confirmed through western blotting. However, there were no marked changes in the Jak2 expression when compared to the other bands observed on the gel. Accordingly, the western blotting reveal ed that Jak2 was undergo ing degradation as indicated by the other low molecular weight bands observed on the blot (Fig. 5-1B). Overall, the pTrcHis2TOPO-Jak2 did not ex press at high enough levels as expected. It is important to start with high expression leve ls in order to obtain appreciable amounts of protein after purification. Hence, we dec ided to try other prokaryotic systems that might provide higher expression levels. Jak2 Expression in E. coli using pQET7vector 2 The reason that pTrcH is2TOPO-Jak2 did not express at high levels could be due to the lack of a strong promot er. Next, we decided to use a vector background that has has a robust promoter such as T7, which provides high transcription and translation efficiency. Therefore, Jak2 cDNA enc oding 483-1132 amino acids was cloned into pQET7-vector2. The clones were verified us ing both restriction di gestion with NdeI and PCR screening using Jak2 primers for the region cloned (Fig. 5-2A). Clones 6 and 7 were found to be positive. pQET7-vector2 -Jak2 cDNA can be expressed only in E. coli strains such as BL21(DE3) that carry the T7 RNA polymerase gene. Expressions of the clones were verified in two E. coli strains that were derived from BL21 (DE3) BL21 Star (DE3) and BL21 Star (DE3) pLysS. While BL21 Star (DE3) is genetically modified to offer increased mRNA stability, BL21 Star (DE3) pLysS is more suitable for expression of 149

PAGE 150

heterologous proteins that are toxic to E. coli Pilot expression was conducted in both the strains. Jak2 gene expression was induced in E. coli cultures at OD600 of 1 using 0.5 mM IPTG. 1 mL culture samples were collected at 0, 1, 2, 3, 4 and 12 hours after IPTG induction. At the end of 12 hours, the cells were pelleted and lysed using SDS buffer. Aliquots of the lysates were run on SDS-PAGE and stained with coomassie (Fig. 5-2B). The coomassie staining revealed that BL21 Star (DE3) had an IPTG dependent increase in Jak2 expression, which peak ed around 4 hours after induction. However, BL21 Star (DE3) pLysS had lower expression than BL21 Star (DE3) due to its lower basal expression levels in order to protect E. coli from growth inhibitory proteins. Recombinant Jak2 expression in BL21 Star (DE3) was also confirmed by blotting with anti-His tag (Fig. 5-2C). Thus, data in Fig. 5-2 confirmed the successful cloning and subsequent expression of recombinant Jak2 pr otein at sufficient levels in BL21 Star (DE3) E. coli Purification of Jak2 from Inclusion Bodies Having confirmed high expressi on of pQET7-vector2-Jak2 in E. coli the next step was to purify the protei n using affinity chromatography methods. The BL21 Star (DE3) expressing Jak2 was scaled up to 250 mL cu lture when compared to pilot expression. The cell pellet obtained after expression was lysed and the supernatant was bound to the Ni-NTA column for his affinity based pur ification. The column was washed and the bound protein was eluted using high concentrations of imidazole. Samples collected during purification were separated by SDS-PAGE and analysed using coomassie staining. Detailed protocols for expression and purification can be found under the methods section. 150

PAGE 151

As shown in Fig. 5-3A, a major fraction of th e Jak2 protein was pre sent in the pellet after lysis and therefore did not bind to the column. The small amount of Jak2 protein that was present in t he supernatant was collected during elution from the affinity column. In order to make sure that this was not due to inco mplete lysis, the time for sonication was increased and additional freezethaw cycles were used to improve lysis. However, this did not change the protein leve ls in the lysate supernatant, confirming that the issue was not incomplete lysis. Th is suggested that the expressed protein might be present in inclusion bodies. Since Jak2 is a heterologous protein that is being expressed in E. coli it is possible that due to the lack of appropriate post-translational modifications, Jak2 did not undergo proper folding and therefore became insoluble. Sometimes lowering the temperature from 37 C, at which E. coli is usually cultured, can improve the chances of proper folding and increase t he protein solubility Therefore, we conducted pilot expression of Jak2 at 3 temperatures: 26 C, 30 C, and 37 C. Samples were collected at 0, 1, 2, 3.5, 5, and 6 hours after IPTG induction. The collected samples were pelleted and lysed with appropr iate lysis buffer. The supernatant and pellet were analysed by coomassie staining. The expression of Jak2 was maximal at 37C, but remained in the pellet at both 30 C (data not shown) and 37 C (Figs. 5-3B and 5-3C). However, Jak2 expression was very minimal at 26 C (data not shown). Thus, the next step was to purify the Jak2 pr otein from inclusion bodies. In order to refold the protein from its denat ured form, it was important to find a buffer that contained the appropriate stabilizing agents that would assi st in refolding. The refolding conditions can vary based on the physicochemical properti es of each protein. The iFold refolding system (EMD biosciences) offered the opti on of screening 92 different buffer conditions 151

PAGE 152

for re folding. Therefore, this system was c hosen in order to identify the buffer in which the Jak2 protein refolds best without precipitat ion. The variables in the 92 buffers were pH, different concentrations of salt, cyclodex trin, redox reagents, and refolding additive reagents. Activity of refolded Jak2 in each buffer was assessed using an ELISA to detect phosphotyrosines and the appropriate buffer was chosen as the buffer E4 that contained 50 mM Tris, 100mM NaCl, 12.5 mM cyclodextrin, and 1 mM TCEP at pH 8 (Fig. 5-3D). Jak2 protein from the inclusion body was resuspended in a denaturing buffer and then slowly refolded by dialysis against buffer E4. Refolded protein was then loaded onto a Ni-NTA column and purifie d based on affinity. The eluted protein was subjected to a radioactivity based activity assay. Su rprisingly, the protein did not show any detectable auto or transphosphorylat ion activity (Fig. 5-3E). Thus, human Jak2 protein containing t he JH1 and JH2 domains can be expressed at high levels in E. coli Unfortunately, the protein becomes insoluble and several attempts at refolding Jak2 from inclus ion bodies did not come to fruition. Jak2 Expression in Insect Cells The next step was to shift to a eukaryotic system such as insect cells that might be more suitable for expressing the mammalian prot eins. Full length Jak2 and partial Jak2 protein containing the kinase, pseudokin ase and SH2-like domains were chosen for expression in insect cells (Fig. 5-4A). T he full-length Jak2 construct will help us to understand the individual role of each domain in the overall regulation of Jak2 activity. The partial Jak2 construct was mainly dev ised by keeping in mind that the V617F mutation occurs in the pseudokinase domai n and the exon 12 mutations occur in the linker region connecting the pseudokinase wi th the SH2-like domain. The Bac-to-Bac 152

PAGE 153

system (Invitrogen) was used in order to gen er ate the baculovirus for recombinant Jak2 expression in insect cells (Fig. 5-4B). The Jak2 cDNA corresponding to the two constructs was cloned into pFastBac HT donor vectors that contain N-terminal 6X His tag. The positive cl ones obtained were verified by the size of uncut DNA via mini prep, followed by PCR screening (Fig. 5-5A, B). The cloned plasmid was transformed into DH10Bac E. coli cells in order to generate a recombinant bacmid via site-specific transposition. The recombinant Jak2 bacmid was purified and verified using PCR (Fig. 5-5C, D) The recombinant bacmid containing Jak2 was used to transfect the Sf9 insect cells, which resulted in the generation of recombinant baculovirus. The baculovirus obta ined was used to infect the Sf9 cells for a pilot protein expression, in or der to optimise the MOI of viru s (Fig. 5-5E, F) and culture time after infection (Fig. 5-5G, H) for maxi mal Jak2 expression. However, there was no significant difference observed in the over all Jak2 expression between the various MOI or time points tested. Theref ore, we decided to use t he median MOI of 5 and maximal time point of 72 hours for infection. Severa l low molecular weight bands were observed beneath both full length and JH1-4 Jak2 during the pilot expression, indicating possible protein degradation. Purification of Jak2 from Insect Cells 250 mL culture of the Sf 9 cells was infected with recombinant bac ulovirus expressing either full length or partial Jak2, during its lo g phase, using the optimised parameters. The cells were pelleted and lysed in his lysis buffer. The lysate supernatant was bound to pre-equilibrated Ni-NTA beads and Jak2 was eluted using high concentrations of imidazole. Details of the pr otocol used for purification can be found in the methods section. Samples collected du ring the purification were separated on an 153

PAGE 154

SDS-PAGE and analysed using both cooma ssie staining and wes tern blotting. However, since the expressed Jak2 levels were low, Jak2 could not be identified via coomassie staining. Therefore, the Jak2 le vels in various fractions were mainly analysed by western blotting, that has higher sensitivity than coomassie staining. As seen in Fig. 5-6A, very low levels of the full length Jak2 protein was present in the lysate and the supernatant after lysis. In the case of JH1-JH4 Jak2, the expressed protein levels were relatively higher than full-length protein. Nevertheless, it was still below the sensitivity of coomassie staining (Fig. 5-6B). While some of the protein was lost in flow through or washes, majority of the protein was recovered in the elutions. Still, the concentration of eluted protein was not sufficient to proceed with further downstream applications. The low molecular weight bands beneath Jak2 still persisted in the elutions indicative of degradation. Following this first attempt at purification, the Sf9 cultures were further scaled up from 250 mL to 1 litre cultures. At this scale, Jak2 expressi on levels were higher and the eluted Jak2 protein could be detected in the coomassie staining (data not shown). Additional protease inhibitors were used and the protein purificat ion was conducted at 4 C in order to minimize protein degr adation. However, several other bands corresponding to contaminating proteins and Jak2 degradation st ill persisted in the eluted fractions. The next goal was to use ad ditional chromatographic methods in order to improve the protein purity and possibly remove the degradation products. Troubleshooting Jak2 Degradation Gel filtration chromatography was chos en to separate Jak2 from both the contaminating proteins and t he degradation products. The Jak2 JH1-JH4 protein eluted 154

PAGE 155

from the His affinity column was concentra ted using amicon. The concentrated protein was separated by both denaturing SDS-PAG E and native PAGE electrophoresis (Fig. 57A, B). In comparison to the multiple bands observed in the concentrated fraction on denaturing PAGE, only one band at higher intensity was observed in the native PAGE. This was also verified by western blotti ng with Jak2 antibody (Fig. 5-7C, D). The concentrated protein was then run through a gel filtration column (Fig. 5-7E). Surprisingly, the Jak2 protei n was detected in the void fraction corresponding to aggregation (Fig. 5-7F). Thus, it indicated that Jak2 wa s possibly aggregating with the degradation products, even while it is inside the cells during expression. Since the protein is in an aggregated form, it is not suitable for crystallisation. Therefore, preventing cellular degr adation and aggregation of Jak2 is important in order to use it for further studies. Discussion Here, we have attempted to purify Jak2 ei ther full length or at least JH1 and JH2 domains together using recombinant expres sion and his based affinity chromatography. Purified Jak2 protein could have been useful for obtaining the crystal structure, understanding the domain or ganization and alloster ic regulation of Jak2. However, we faced some bottlenecks during Jak2 expr es sion and purification in both the E. coli and insect systems. In the case of E. coli the expression level of Jak2 was very high. However, at least 90% of it was insoluble and was present in the inclusion bodies (Fig. 5-3A). Here, a eukaryotic protein such as Jak2 is expresse d in a prokaryote. It is possible that the appropriate glycosylation and pho sphorylation patterns requir ed for correct folding of Jak2 is not available in E. coli and therefore it becomes insoluble. Also, since Jak2 155

PAGE 156

consists of several domains, the probability of refolding the protein in vitro is greatly reduced. Refolding protocols mainly focus on im proving the stability of the proteins by adding stabilizing agents such as L-glutami ne or L-arginine. Ther efore, it may not be addressing the issue of lack of appropria te post translational modifications. Other options, such as co-expresssion of another pr otein that might improve the chances for correct Jak2 folding in E. coli should also be considered. Fo r example, in the case of cSrc and c-Abl kinas e domains, co-expression with YopH tyrosine phosphatase enabled soluble expression and purification in the scale of milligrams (Seeliger et al. 2005). In some cases, co-expression of chaperones that assist in folding can also improve the soluble expression of heterologous proteins in E. coli (Baneyx and Palumbo 2003). Similarly, in the case of Jak2, co-exp ression of a phosphatase or chaperone may improve its solubility in E. coli In the case of insect syst ems, the main issue faced was regarding Jak2 protein degradation and aggregation inside the cells. Such degradation has been previously observed in the case of other proteins. It can be attributed to the expression of a late viral gene, V-CATH, which leads to the production of the cysteine protease, VCathepsin (Slack et al. 1995). Since the time poi nt of the expression of Jak2 coincides with the expression of such proteases, Jak becomes subject to degradation. It has been suggested that such degradation issues can be avoided by culturing the cells for less than 48 hours after infection (Pavsic et al. 2008). However, in the case of Jak2, changing the culture time after infection did not reduce the degradation observed (data not shown). Additionally, some other r eports have provided evidence for blocking degradation by adding protease inhibitors dire ctly to the insect cell culture, after 156

PAGE 157

baculov irus infection (Pyle et al. 1995). The future experiments should focus on preventing the protease activity inside t he cells and hence reduce Jak2 degradation. Overall, addressing the current issues in Jak2 protein purification may help us to answer the bigger questions with regard to the role of Jak2 mutations in disease. Therefore, sufficient focus and effort s hould be geared towards obtaining the crystal structure of full length Jak2 or at least the JH1-JH2 domains together. 157

PAGE 158

172 --111--79--61--49--M 0 1 2 3 4 12 Time after IPTG induction (h) 172 --111--79--61--49---0 1 2 3 4 12 Time after IPTG induction (h)A. B. 172 --111--79--61--49--M 0 1 2 3 4 12 Time after IPTG induction (h) 172 --111--79--61--49---0 1 2 3 4 12 Time after IPTG induction (h)A. B. Figure 5-1. Screening for pTrcHis2TOPO Jak2 JH1-JH3 expression in TOP10 E. coli cells. E. coli expressing Jak2 JH1-JH3 were grown until it reaches an OD600=1 and induced with 1 mM IPTG. Follo wing IPTG induction, the cells were allowed to grow for an additional 12 hours, with 1mL samples collected at the indicated time points after IP TG induction. Collected samples were pelleted, lysed in SDS buffer, and the whole cell lysates were run on SDSPAGE. The gels were then analyzed for Jak2 expression using A) coomassie staining and B) western blotting with anti-Jak2. 158

PAGE 159

Figure 5-2. Cloning and expression screening of pQET7-Vector 2-JH1-JH3 Jak2 in E. coli cells. A) JH1-JH3 Jak2 was cloned in to p QET7-Vector2 using restriction digestion. The clones obtained were screened using restriction digestion by Nde I, which linearizes the empty vector while generating 1.5 Kb and 5.2 Kb products in the positive clone. Clones 5, 6 and 7 were found to follow the expected pattern for positive clones. The clones were also screened using PCR to amplify the Jak2 insert using primers that flank the two ends cloned (483 and 1132 amino acids). The expect ed 2 Kb product was present in Clones 6 and 7, confirming that they have the Jak2 insert. The expression of pQET7-Vector 2-JH1-3 Jak2 was tested by a time course conducted after IPTG induction in 2 E. coli strains: B BL21 Star (DE3) and L BL21 Star DE3 pLysS. The lysates of samples collected were analyzed using B) coomassie staining and C) western blotting with anti His antibody. 159

PAGE 160

Refolding Buffers E4 F6 C7 H7 B10 H10 F11 A12 E12 0 50 100 150 200 250 300 350 400Phosphorylation Activity %ControlD.Refolding Buffers E4 F6 C7 H7 B10 H10 F11 A12 E12 0 50 100 150 200 250 300 350 400Phosphorylation Activity %ControlRefolding Buffers E4 F6 C7 H7 B10 H10 F11 A12 E12 0 50 100 150 200 250 300 350 400Phosphorylation Activity %ControlD. 79 60 P S SAB W1 W2 E1 E2 79 60 M 0 1 2 3.5 5 6 Supernatant M 0 1 2 3.5 5 6 79 60 Pellet B. E. 79 60 M 0 1 2 3.5 5 6 Supernatant 79 60 79 60 M 0 1 2 3.5 5 6 Supernatant M 0 1 2 3.5 5 6 79 60 Pellet M 0 1 2 3.5 5 6 79 60 M 0 1 2 3.5 5 6 79 60 79 60 Pellet C. A. 0 500 1000 1500 2000 2500 3000 3500 4000Null E1 E2 Control STAT1 E1 + S T A T 1 E2 + STAT1 Co ntr o l + S T A T 1Samples32PCount (CPM)E.Refolding Buffers E4 F6 C7 H7 B10 H10 F11 A12 E12 0 50 100 150 200 250 300 350 400Phosphorylation Activity %ControlD.Refolding Buffers E4 F6 C7 H7 B10 H10 F11 A12 E12 0 50 100 150 200 250 300 350 400Phosphorylation Activity %ControlRefolding Buffers E4 F6 C7 H7 B10 H10 F11 A12 E12 0 50 100 150 200 250 300 350 400Phosphorylation Activity %ControlD. 79 60 79 60 P S SAB W1 W2 E1 E2 79 60 M 0 1 2 3.5 5 6 Supernatant 79 60 79 60 M 0 1 2 3.5 5 6 Supernatant M 0 1 2 3.5 5 6 79 60 Pellet M 0 1 2 3.5 5 6 79 60 M 0 1 2 3.5 5 6 79 60 79 60 Pellet B. E. 79 60 79 60 M 0 1 2 3.5 5 6 Supernatant 79 60 79 60 M 0 1 2 3.5 5 6 Supernatant M 0 1 2 3.5 5 6 79 60 M 0 1 2 3.5 5 6 79 60 79 60 Pellet M 0 1 2 3.5 5 6 79 60 79 60 M 0 1 2 3.5 5 6 79 60 79 60 Pellet C. A. 0 500 1000 1500 2000 2500 3000 3500 4000Null E1 E2 Control STAT1 E1 + S T A T 1 E2 + STAT1 Co ntr o l + S T A T 1Samples32PCount (CPM) 0 500 1000 1500 2000 2500 3000 3500 4000Null E1 E2 Control STAT1 E1 + S T A T 1 E2 + STAT1 Co ntr o l + S T A T 1Samples32PCount (CPM)E. Figure 5-3. Purification of JH1-JH 3 Jak2 from inclusion bodies in E. coli after refolding using the iFOLD system. A) Jak2 expr essed in 250 mL of BL21 Star (DE3) culture was purified usi ng Ni NTA column chromatography. Samples collected during the purification were r un on an SDS-PAGE and stained using coomassie staining. P Pellet after l ysis, SSupernatant after lysis, SAB Supernatant after binding to Ni-NTA beads, W1Wash 1, W2Wash 2, E1Elution 1, E2Elution 2. Samples co llected during Jak2 expression at 37C was separated by SDS-PAGE and stai ned with coomassie staining B) Supernatant and C) Pellet after lysis. Inso luble Jak2 present in the inclusion bodies was denatured and its refolding was tested in 92 buffers obtained via the iFOLD refolding system. D) After refolding, the Jak2 activity was tested using ELISA for phospho Jak2 and the phosphorylation activity observed was plotted against the various refolding buffers used. E) Activity of Jak2 refolded in buffer E4 was tested using the radioactivity based kinase assay and the radioactivity measured in each samp le was potted in counts per minute (CPM). 160

PAGE 161

JH7 JH6 JH5 JH4 JH3 JH2 JH1 FERM SH2like Pseudo kinaseKinase N-Terminal C-TerminalFull length Jak2 Jak2 JH1-JH4 (295 AA 1132 AA) A.JH7 JH6 JH5 JH4 JH3 JH2 JH1 FERM SH2like Pseudo kinaseKinase N-Terminal C-TerminalFull length Jak2 Jak2 JH1-JH4 (295 AA 1132 AA) JH7 JH6 JH5 JH4 JH3 JH2 JH1 FERM SH2like Pseudo kinaseKinase N-Terminal C-TerminalJH7 JH6 JH5 JH4 JH3 JH2 JH1 FERM SH2like Pseudo kinaseKinase N-Terminal C-TerminalJH7 JH6 JH5 JH4 JH3 JH2 JH1 FERM SH2like Pseudo kinaseKinase N-Terminal C-TerminalFull length Jak2 Jak2 JH1-JH4 (295 AA 1132 AA) A. Courtesy: Bac-toBacExpression Kit Handbook (Invitrogen)B. Courtesy: Bac-toBacExpression Kit Handbook (Invitrogen) Courtesy: Bac-toBacExpression Kit Handbook (Invitrogen)B. Figure 5-4. Jak2 expression in insect cells using the Bac to Bac system from Invitrogen. A) Shown are the different regions of Jak2 that were cloned into pFastBac HT vectors. B) Graphical repr esentation of the protocol used to generate the recombinant baculovirus through the Bac to Bac system. 161

PAGE 162

M 14 2 3 5 6 Full Length Jak2 M 1 4 1 4A. M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Jak2 Full length Jak2 JH1-4 Control Mini PrepC. M 1 2 3 4 5 6 7 8 9 10 13 14 15 16 11 12 Jak2 Full length Jak2 JH1-4 Control Screening by PCRD.M 1 2 3 Jak2 JH1-4 M 1 2 B.3 M 2 3 5 6 Full Length Jak2 14 M 1 4 1 4A. M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Jak2 Full length Jak2 JH1-4 Control Mini PrepC. M 1 2 3 4 5 6 7 8 9 10 13 14 15 16 11 12 Jak2 Full length Jak2 JH1-4 Control Screening by PCRD.M 1 2 3 Jak2 JH1-4 M 1 2 B.3 0 1 2 5 10 20 MOI (PFU/ml) 1721118117211181600 1 2 5 10 20 MOI (PFU/ml) 172111816024 48 72 0 Time (hrs) C M C M C M C M 172111810 24 48 72 Time (hrs) M C M C M C M C Full length Jak2 JH1-4 Jak2 E. G. F. H. 0 1 2 5 10 20 MOI (PFU/ml) 1721118117211181600 1 2 5 10 20 MOI (PFU/ml) 172111816024 48 72 0 Time (hrs) C M C M C M C M 172111810 24 48 72 Time (hrs) M C M C M C M C Full length Jak2 JH1-4 Jak2 E. G. F. H. Figure 5-5. Cloning and expression screening of pFastBac HT-Jak2 in insect cells (A, B) Plasmid prep and PCR screening of full length Jak2 and JH1-JH4 Jak2 cloned into pFastBac HT C and pFastBac HT B respectively, were tested on agarose gel. C) Plasmid preps of reco mbinant bacmid containing full length and JH1-JH4 Jak2 were tested on agaros e gel. D) The recombinant bacmids obtained were screened through PCR, usin g primers flanking the Jak2 gene, either full length or JH1-JH 4. Screening of Jak2 expr ession at different MOI, after 72 hours of infection. E) Fu ll length Jak2 and F) JH1-JH4 Jak2. Screening of Jak2 expression at differ ent time points (hours), after infecting the insect cells at a constant MOI of 5 PFU/mL G) Full length Jak2 and H) JH1-JH4 Jak2. 162

PAGE 163

Lysate LysateSup Flow thruWash Eluate 17211181601 2 1 2 3 4 Full length Jak2 (130KDa) 172111-Lysate LysateSup Flow thruWashEluate 1 2 1 2 3 4 JH1-4 Jak2 (97 KDa)A. B. Lysate LysateSup Flow thruWash Eluate 17211181601 2 1 2 3 4 Full length Jak2 (130KDa) 172111-Lysate LysateSup Flow thruWashEluate 1 2 1 2 3 4 JH1-4 Jak2 (97 KDa)A. B. Figure 5-6. Purification of A) full length and B) JH1-JH4 Jak2 from 250 mL of Sf9 insect cells using Ni-NTA column chroma tography. Samples collected during purification were run on SDS-PAGE and blotted using anti-Jak2. 163

PAGE 164

164 172 111 80 60B e f o r e D i a l y s i s A f t e r D i a l y s i s F i l t r a t eC o n c e n t r a t e d Elution 1B e f o r e D i a l y s i s A f t e r D i a l y s i s F i l t r a t eCo n c e n t r a t e d Elution 2 A. 172 60 E l u t i o n 1E l u t i o n 2 Concentrated D. 172 111 80 60B e f o r e D i a l y s i s A f t e r D i a l y s i s F i l t r a t eC o n c e n t r a t e d Elution 1B e f o r e D i a l y s i s A f t e r D i a l y s i s F i l t r a t eC o n c e n t r a t e d Elution 2 C. E l u t i o n 1E l u t i o n 2 Concentrated 172 60 B. -0.0050 0.0000 0.0050 0.0100 0.0150 0.0200 0.0250 0.0300 0.0350 AU 0.00 5.00 10.00 15.00 20.00 25.00 MillilitersE. 172 111 80 60 3 12 14 16 40 60 80 Void fraction F. 172 111 80 60B e f o r e D i a l y s i s A f t e r D i a l y s i s F i l t r a t eC o n c e n t r a t e d Elution 1B e f o r e D i a l y s i s A f t e r D i a l y s i s F i l t r a t eCo n c e n t r a t e d Elution 2 A. 172 60 E l u t i o n 1E l u t i o n 2 Concentrated D. 172 111 80 60B e f o r e D i a l y s i s A f t e r D i a l y s i s F i l t r a t eC o n c e n t r a t e d Elution 1B e f o r e D i a l y s i s A f t e r D i a l y s i s F i l t r a t eC o n c e n t r a t e d Elution 2 C. E l u t i o n 1E l u t i o n 2 Concentrated 172 60 B. 172 111 80 60B e f o r e D i a l y s i s A f t e r D i a l y s i s F i l t r a t eC o n c e n t r a t e d Elution 1B e f o r e D i a l y s i s A f t e r D i a l y s i s F i l t r a t eCo n c e n t r a t e d Elution 2 A. 172 60 E l u t i o n 1E l u t i o n 2 Concentrated 172 60 E l u t i o n 1E l u t i o n 2 Concentrated D. 172 111 80 60B e f o r e D i a l y s i s A f t e r D i a l y s i s F i l t r a t eC o n c e n t r a t e d Elution 1B e f o r e D i a l y s i s A f t e r D i a l y s i s F i l t r a t eC o n c e n t r a t e d Elution 2 C. E l u t i o n 1E l u t i o n 2 Concentrated 172 60 E l u t i o n 1E l u t i o n 2 Concentrated 172 60 B. -0.0050 0.0000 0.0050 0.0100 0.0150 0.0200 0.0250 0.0300 0.0350 AU 0.00 5.00 10.00 15.00 20.00 25.00 Milliliters -0.0050 0.0000 0.0050 0.0100 0.0150 0.0200 0.0250 0.0300 0.0350 AU 0.00 5.00 10.00 15.00 20.00 25.00 MillilitersE. 172 111 80 60 3 12 14 16 40 60 80 Void fraction F. Figure 5-7. Troubleshooting Jak2 protein degradation inside insect cells. Eluted fractions of JH1-JH4 Jak2 protein we re dialyzed and concentrated. Samples collected during the process were analyzed through coomassie staining and western blotting with anti-Jak2, respec tively on both (A, B) denaturing SDSPAGE and (C, D) native PAGE. E) The concentrated protein was separated on a Superdex 200 gel filtration column F) The various fractions collected during the gel filtration chromato graphy were run on a SDS-PAGE and western blotted using anti-Jak2. T he number above each column indicates the fraction number as colle cted during the chromatography.

PAGE 165

CHA PTER 6 DISCUSSION AND CONCLUSION1 Overview The main focus of this dissertation wa s to understand the regulation of Jak2 in both normal physiology and disease. The dat a presented here carry significance in terms of their contribution towards the under standing of Jak2 mutations in dis ease and Jak2 inhibitor development. First, we have s hown that a pi stacking interaction between F595 and F617 forms the basis for the constitutive activation of a predominant Jak2 mutation, V617F. Next, we identified the im portance of a shift in the salt bridge interaction of residues D620 and E621 with K539 in Jak2-WT to that of R541 in the constitutively active exon 12 mutant, Ja k2-H538Q/K539L. We have also demonstrated that phosphorylation at Y372 is important for ligand dependent activation of Jak2. Specifically, Y372F mutation disrupts Jak2 di merization during activation. Overall, these findings emphasize the importance of various domains in the regulation of Jak2 activity and suggest the development of allosteric inhibitors fo r efficient Jak2 targeting in disease. These implications are discussed in detail below. Lessons Learnt from Jak2 Exon 14 and Exon 12 Mutations Based on the Jak2 homology model, the exon 14 and exon 12 mutations are predicted to be present at the interface between the ki nase and the pseudokinase domains. This in turn implies that the mutati ons cause constitutive activation of Jak2 by disrupting the autoinhibitory interactions between these two domains. In Chapters 2 and 1 Reproduced in part with permission from A Structure-Function Perspective of Jak2 Mutations and Implications for Alternate Drug Design Strategi es: The Road not Taken. Curr. Med. Chem. 2011 18, 4659-4673. Bentham Science Publishers. 165

PAGE 166

3, we investigated such changes in the local interactions induced by these mutations using the tools of molecular dynamic simu lations, mutagenesis and biochemical assays. Jak2 mutation, V617F, disrupted the intera ction between the JH1 and JH2 domains by shifting the interaction of 617 from V1000 in JH1 domain to F595 in JH2 domain (Fig. 22). Due to the energetic adv antage of the induced pi stacking interaction, the JH2 domain became more stable and also, the di stance between the two domains increased (Fig. 2-3). On the other hand, Jak2 exon 12 mutations occur in the SH2-JH2 linker, which consists of several polar residues. In Ja k2-WT, several salt bridge interactions in this region seem to stabilize the interacti on of the C-terminus of the linker region with that of the glycine loop in the pseudokinas e domain. Specifically, our MD simulations reveal that a salt bridge interaction is present between K539 in the linker and D620, E621 in the glycine loop (Fig. 3-5). Upon mutation of K539 to L, this salt bridge shifts to adjacent R541. Consequently, the glycine loop is pushed downward and the interaction between the two C helices in the JH1 and JH2 domains is affected. Based on these results, we suggest that in Jak2-WT, the glycine loop in the pseudokinase domain that carries V617 interacts with the activation loop in the kinase domain and maintains it in an inactive conformation. This is supported by additional interactions between the two C helices and also those between the SH2-JH2 linker and C-lobe of the kinase dom ain. These three interfaces have proven to be very sensitive and any mutation that affects the hydrophobicity or charge of the amino acids in these regions can affect Jak2 autoinhibiti on and lead to constitutive activation. Our findings also correlate with the results repor ted in literature (Chen et al. 2000; Lee et al. 2009b; Lindauer et al. 2001; Zhao et al. 2009) Thus, these results appear to explain 166

PAGE 167

why the pseudokinase domain remains a hots pot for gain-of-function Jak2 mutations. Most of the in vitro results obtained so far support t he full length homology model of Jak2 prepared by Kroemer and colleagues (G iordanetto and Kroemer 2002). However, in order to completely understand the autoinhibition and confirm these findings, a crystal structure for the Jak2 JH1 and JH2 domains would be necessary. A direct application of our mechanistic discoveries is in drug devel opment for the treatment of MPN patients. We have shown that mutations that disrupt t he pi stacking interaction in Jak2-V617F or the salt bridge of R541 in Jak2-H538Q/K539L c an prevent the constitutive activation of these mutant proteins and restore activity to the levels of Jak2-WT (Figs. 2-5, 3-9). Therefore, this presents the Jak2 JH1-JH2 interface as an attractive target for developing allosteric inhibitors. Implications for Jak2 Allosteric Inhibitors: The Path Not Taken The identification of the Jak2-V617F mutation among a large percentage of MPN patients provided new hope for the development of small molecule inhibitors against Jak2. As a result, some Jak2 inhibitors from both class I and class II are currently in clinical trials. Class I drugs were developed specifically for Jak2 based on available protein structural information. Class II dr ugs were those that were developed against other kinases, but were found to have beneficial off-target effects on Jak2. Based on the currently available results from these clin ical trials, benefits of these drugs include improvement of splenomegaly, pr uritus, erythrocytosis, leuko cytosis and thrombocytosis (Majumder and Sayeski 2010; Wadleigh an d Tefferi 2010). Though these drugs have positive effects in terms of reducing symptomologies asso ciated with the MPN phenotype, they are unable to hinder the deleterious bone marrow fibrosis or significantly reduce the mutant-allelic burden in the bone marrow. Also, toxicity, in the 167

PAGE 168

forms of anemia, nausea, vomiting and dia rrhea, has been observ ed in these patients (Sayeski and Majumder 2010; Wadleigh and Tefferi 2010). The current design of Jak2 selective inhi bitors is based on structural information available from homology models or crystal structures for the wild type Jak2 kinase domain. Most of these inhibitors target the ATP-binding pocket in the kinase domain and hence are ATP-competit ive. ATP-competitive inhibito rs bind tightly to the kinase domain in its active conformation and prev ent ATP binding or hydrolysis, thereby reducing the kinase activity. The kinase domai ns of proteins from different kinase families have distinct conformations in thei r inactive state. However, upon activation, they assume a very similar active state conf ormation (Taylor et al. 1992). Targeting the active kinase conformation may provide increased sensitivity towards constitutively active mutant Jak2. On the ot her hand, this strategy may also result in non-specific effects through action on Jak2-WT and other impor tant kinases that are active in the cell. Accordingly, results from the clinical trials reveal that treatment with current generation ATP-competitive Jak2 inhibitors results in myelosuppression and anemia (Sayeski and Majumder 2010; Wadleigh an d Tefferi 2010). This could be a possible effect of these drugs on wild type Jak2, wh ich plays an important role in normal hematopoiesis. Although it w ould be premature to judge t he general success or failure of existing ATP-competitive drugs, the results clearly indicate the need for specific targeting of mutant forms of Ja k2. Such specific ablation of Jak2 mutant activity would, in theory, reduce the mutant allelic burden and hence improve th e therapeutic window. Apart from the issue of sele ctivity, development of drug re sistance is also higher with the use of ATP competit ive inhibitors. Using in vitro assays, it was shown that mutation 168

PAGE 169

of residues Y931, Y958 and P960 in the hinge region of the Jak2 kinase domain was shown to confer constitutive activation al ong with resistance to ATP-competitive Jak2 inhibitors, including INCB018424 (Hornakov a et al. 2011). This finding indicates the possibility of such secondary mutations occurring in patients during prolonged treatment with ATP-competitive inhibitors. In the case of kinases such as B-Ra f, RET, FLT3, KIT and EGFR, the kinase domain serves to be a hotspot for somatic mutati ons that cause constitutive activation in cancers. Such mutations generally occur in the ATP binding region, catalytic region, activation loop and P-loop of t he kinase domain. These mutations cause constitutive activation by destabilizing the inactive conformation of the kinase. However, in Jak2 only a single substitution mutation, T875N, in the kinase domain has been shown to cause MPN in murine models (Mercher et al. 2006). The Jak2-T875N mutation occurs in the N-terminal lobe of the kinase domai n and is predicted to cause constitutive activation by altering the surface properties of the domain and by disrupting the autoinhibition of the JH2 dom ain over the JH1 domain. Further, a few other kinase domain mutations have been identified in ch -B-ALL (Table 1-1). This overall rare incidence of kinase domain mutations indicate s a rather tight control of Jak2 kinase activity by other cis acting JAK homology domains, which are difficult to disrupt by mutations in the kinase domain itself. Keeping these factors in mind, it is important to understand that current Jak2 small molecular inhibitors target the Jak2 kinase domain, which does not carry these gain-offunction mutations. Therefore, inhibiting Jak2 kinase activity via the selective targeting 169

PAGE 170

of JAK regulatory domains may serve to improve the therapeutic inde x and s pecificity of the drugs. Current Allosteric Inhibito rs for Kinases in Cancer Since the role of kinas es in cancer has become more obvious in the recent years, kinases have become attractive targets for i nhibition. An important part of drug design against kinases includes the selection of th e drug binding site that would achieve high target specificity. Additiona lly, the nature of interactions between the inhibitor and the target atoms at the binding site would determine its binding affinity and potency. Therefore, the active site, where the phosphate from ATP is catalytically transferred to the substrate, would be an ideal targeting site for kinases. However, the catalytic activity of kinases can also be moderated allosterically from sites th at are remote to the active site. Binding of a drug to the allosteric site can therefore moderate the catalytic activity indirectly through a network of residues that connects to the active site, without directly competing with the ATP. There are four general types of kinase in hibitors based on their binding site and mode of inhibition: ATP-competitive inhibitors (t ype I), inhibitors that bind to the inactive kinase conformation (type II), allosteric inhibitors, and covalent inhibitors (Zhang et al. 2009). Of these, type II and allosteric inhibitors provide high kinase selectivity. Selective targeting of Jak2 is important because of its critical role in hematopoiesis, for which the allosteric inhibitors may be suitable. The term "allostery" means "different shape". Allosteric inhibitors are nonATP competitive and inhibit kinase activity by binding to a site that is remote to the active site. This approach can help achieve target specificity and increased drug efficacy. There are several examples in the literature for such nonATP competitive inhibitors that are being cu rrently tested for treatment in various 170

PAGE 171

cancers. A review of these drugs may prov ide perspective for a si milar design against Jak2 in hematological malignancies. BCR-ABL1 Despite having good efficacy, the first generation inhibitors for BCR-ABL, such as imatinib, induce secondary mutati ons in the ki nase that result in drug resistance. These mutations mostly occur in the P-loop and al ter the inactive conformation of the BCRABL kinase domain, to which the imatinib binds preferentially. Consequently, more potent second-generation inhibitors, such as dasatinib, nilotinib and bosutinib, were developed (An et al. 2010). Both the first and second gener ation BCR-ABL inhibitors bind to the active site of the kinase domain. While imatinib has been shown to be nonATP competitive, it still binds to the inac tive kinase near the ac tive site. A BCR-ABL T315I mutation, which disrupts the gatekeeper residue of the kinase domain, is resistant to both first and second-generation inhibito rs. Henceforth, several alternative approaches, such as the development of no n-ATP competitive inhibitors, are being pursued to combat the resistance mutation. Cu rrent allosteric inhibitors for BCR-ABL target three regions that are remote to the active site: 1) Myristoyl binding cleft: Since myristoylation has been known to stabilize ABL in its inactive conformation, the bindi ng of inhibitors to this po cket in the ABL kinase domain are predicted to have the same effect. GNF-2 is a lead compound that binds to this cleft and allosterically inhibits BCR-ABL kinas e activity (Table 6-1). GNF-2 has a 4,6disubstituted pyrimidine core st ructure, which is essential for its activity and it binds to the cylindrical myristate-binding cavi ty of the Abl kinase domain in a trans conformation. The 4-trifluoromethoxyaniline gr oup interacts at the base of the pocket and is essential for activity. However, substi tutions at the pyrimidine 6-positions can be tolerated since 171

PAGE 172

they are exposed to the solvent (Deng et al 2010). The selectivity of these compounds for BCR-ABL is exc eptional a nd they also have significant in vivo efficacy when used in combination with imatinib or nilotinib (Z hang et al. 2010). Therefore, GNF-2 may have good clinical efficacy, reduced drug resistanc e, and decreased toxicity due to its high selectivity. 2) Switch pocket inhibitors: DCC-2036 is an inhibitor that binds to a switch control pocket in the BCR-ABL kinase domain and locks it in the inactive conformation (Chan et al. 2011). During the active state, R386 in the Abl1 kinase domain stabilizes the phosphorylated Y393 in the activation loop. Howe ver, in the inactive state R386 forms a salt bridge with E282 under the C-helix. Therefore, D CC-2036 was designed with a tetrahydro-isoquinoline ring that hydrogen bonds to both E282 and R386 in order to target the inactive Abl1. Further, DCC-20 36 also has a carboxamide-substituted pyridine ring, which hydrogen bonds with t he backbone of the ATP hinge residue M318 as a second docking site in order to have increased binding energy and potency. In preclinical studies, this drug has shown goo d oral bioavailability, limited off-target effects, and excellent safety. It is currently being evaluated in phase I/II clinical trials for the treatment of imatinib-refractory CML. 3) Substrate-competitive inhibitors: ON012380 is an inhibitor that binds to the substratebinding site of the ABL kinase domain and inhibits it at least ten-fold more potently than imatinib (Gumireddy et al 2005). ON012380 was designed to have a structure that is unrelated to ATP or any other purine or pyrm idine nucleosides such that it blocks the substrate binding site rather than the ATP bi nding site. This inhibitor has good efficacy 172

PAGE 173

and reduced toxicity in murine models (Gumireddy et al. 2005). However, the activity of ON012380 in clinical trials has not been tested. Akt Akt is an important enzyme downstream of PI3K, whos e function is important for the progression of several cancers. The pl eckstrin homology (PH) domain of Akt is important for maintaining its inactive confo rmation by binding to the kinase domain. The allosteric inhibitors for Akt bind to t he PH domain and lock the kinase in its closed inactive conformation. Therefore, such inhibitors prevent activation and membrane association of Akt. These allosteric inhibi tors are highly selective for Akt, even at the level of its specific isoforms and do not have any activity against other AGC family kinases (Barnett et al. 2005). On the other hand, data from crystal stru ctures predict that the ATP-competitive Akt inhibitors bind to the kinase domain in its open conformation and cannot induce the closed inactive conformation (Lindsley et al. 2008). Clinical differences between the use of ATP-competitive and allosteric inhibitors have not been investigated. However, an oral allosteric Akt inhibitor, MK-2206 has shown positive results in phase I clinical trials for the treatm ent of solid tumors (Hirai et al. 2010; Pal et al. 2010). B-RAF B-RAF is an important kinase in the MAPK signaling pathway and is the frequent target of oncogenic mutations. Specifically, B-RAF-V600E is a commonly observed mutant in malignant melanom as. ATP-competitive inhibitors for B-RAF like PLX4032 have been shown to have beneficial effects in pat ients. However, such inhibitors have led to the development of resistant mutations in other signaling proteins. In the case of a B-RAF heterodimer, it was found that a PLX4032 drug-bound B-RAF transactivates the 173

PAGE 174

drug-free partner allosterically (Poulik akos et al. 2010). Thus, the binding of an inhibitor activates the downstream MEK and ERK signal ing pathways. Interestingly, a unique feature of this drug is that it inhibits the mutant B-RAF and activates the wild type form. Cells that carry BRAF-V600E have a lesser propensity to form heterodimers and hence are more sensitive to inhibito rs. Therefore, mutations arise in other proteins such as Ras and MEKs as a resistance mechanism in these cells. Recently, Murphy et al. identified a novel dual target inhibitor, C6 that allosterically inhibits both PDGFR and B-RAF by binding to a DFG-out conformation of the kinase, similar to imatinib (Murphy et al. 2010). This compound has very good specificity for the two kinases and hence has reduced toxicity that arises due to offtarget effects. C6 is an allo steric inhibitor with a amino-tria zole scaffold that binds to the inactive kinase conformation. This com pound has good pharmacokinetic properties and potent angiogenic effects. Since C6 binds to the inactive conformation of B-RAF, it disrupts dimerization and hence allosteric activation of downstream signaling. Therefore, probability of inducing drug resistance could be lower. MEK MAPK/ERK Kinase (MEK) is an important signaling protei n downstream of Raf in the MAPK pathway that controls cellular proliferation. Si nce this pathway has been constitutively active in cancers, it became a natural target for inhibi tion in order to treat cancers. While B-RAF mutations are more common, as menti oned before, B-RAF inhibitors cause activation of wild type kinas e while inhibiting the mutant. In order to target wild type B-RAF, targeting the dow nstream MEK could be a logical option. 174

PAGE 175

Most of the MEK inhibitors developed to date are non-ATP competitive. An allosteric binding pocket of t hese inhibitors was located adjacent to the MgATP binding site in the kinase (Lee 2010). These allosteric inhibitors are highly selective for MEK and also share a common diaryl amine scaffold which is responsible for their stable binding. While some of the MEK inhibitors that had good preclinical results failed in clinical trials, several MEK selective allost eric inhibitors are still being developed and tested in patients. Some of these inhibitors that are in clinical trials include AZD6244, GSK112012, RDEA119 and TAK-733. Similar to BCR-ABL, allosteric inhibito rs are also being developed for other kinases. Another leading exampl e of a drug that does not ta rget the kinase domain is the rapamycin derivative, temsirolimus. It is an FDA approved anti-cancer drug that binds to the FKBP12/Rapamycin Binding (FRB) domain of the mTOR kinase and inhibits its function (Johnson 2009). Thus, allosteric inhibitors have proven useful for improved selectivity and decreased toxicity resulting in improved clin ical efficacy. These drugs also serve as good alternatives to ATP-competitive inhibi tors that can someti mes lead to drug resistance. Therefore, lessons learnt from these examples may guide the development of Jak2 allosteric inhibitors which can act as suitable alternatives to the existing class of ATP mimetic inhibitors. Allosteric Inhibitors for Jak2 While there are a number of ATP-competitive inhibitors fo r Jak2, to date, there are only two known non-ATP competitive inhibitors for this target. 175

PAGE 176

LS104 LS104 is a hydroxystyryl-acrylonitrile co mpound, which is an analog of a nonspecific Jak2 inhibitor, AG490. It has incr eased affinity and specificity for Jak2 when compared to AG490. LS104 has an elongat ed linker between the nitrile and 3,4dihydroxyphenyl groups. It inhibi ts the growth of leukemic cell lines and primary cultures obtained from leukemia patients (Lipka et al 2008) (Table 6-1). It has been shown to inhibit BCR-ABL, Jak2, and FLT3, but does not have any effect on Src family kinases. LS104 inhibits the Jak2 kinase activity, signaling distal to Jak2, and selectively induces apoptosis in Jak2-V617F transformed cells, in vitro (Kasper et al. 2008) The combination of LS104 with ATP-competitive inhibitors induced apoptosis in Jak2-V617F transformed cells, synergistically. It prev ents cytokine-independent colony growth of bone marrow cells derived from MPN patients, ex vivo LS104 is predicted to be a substrate competitive inhibitor. However, t he crystal structure of LS104 with Jak2 is not available to confirm its bind ing mode. Additionally, its cl inical efficacy is yet to be determined. ON044580 ON044580 is an -benzoyl styryl benzyl sulfide, which is shown to inhibit the growth of leukemic cell lines and Jak2-V617 F transformed cells (Jatiani et al. 2010). Similar to ON012380, ON044580 was also des igned to have a st ructure that is unrelated to ATP or any other purine or pyrimi dine nucleosides such that it would not be ATP-competitive and still possess kinase inhibitory activity. ON044580 inhibits both Jak2 and BCR-ABL in a non-ATP competitive manner. It is pr edicted to be substratecompetitive inhibitor. Both BCR-ABL and Jak2 share a common substrate, STAT5, which in turn supports the substrate inhibi tor hypothesis. ON044580 also inhibits the 176

PAGE 177

imatinib-re sistant BCR-ABL-T31 5I mutant with higher sens itivity. Moreover, it was observed that ON044580 leads to the degradation of BCR-ABL, Jak2 and STAT5 possibly by destabilizing their multi-protein complex (Samanta et al. 2010). Interestingly, the Jak2 pseudokinase domain was found to be required for complete kinase inhibition by ON044580 (Jatiani et al. 2010). This further suggests that ON044580 could be binding to Jak2 in its inactive confo rmation and that the pseudokinase domain is required to maintain the inactive form. No crystal structure information is available regarding the interaction of ON044580 with Jak2 or BCR-ABL so its exact binding mode is not known. This drug also effectively inhibits the growth and induces apoptosis in ex vivo cultures of bone marrow cells from pati ents in different stages of leukemia and monosomy 7 myelodysplastic syndrome (Jat iani et al. 2010). Jak2 signaling is constitutively active in both these condi tions and therefore, it is proposed that ON044580 could be used to treat both MDS and MPN. Collectively, LS104 and ON044580 are two know n allosteric inhibitors for Jak2, which effectively down regulate Jak2dependent, transformed cell growth. Further studies are required to determine their binding interactions with Jak2, selectivity for Jak2 mutant over wild type, relative toxicity and drug resistance. This information will be useful to perform a comparative analysis with their ATP-competitive counter parts and identify the benefits of allosteric inhibitor development for Jak2. Possible Targets on the Jak2 Surf ace for Allosteric Inhibition Jak2 is a multi-domain tyrosine kinase, whic h is made up of 1132 amino acids, weighs approximately 130 KDa and o ccupies a volume of about 158000 cubic angstroms. Regulation of Jak2 activity c an be achieved using different levels of coordination among its domains. This aspect will be useful in identifying allosteric 177

PAGE 178

pockets that could be targeted for Jak2 i nhibit ion. During the development of ATPcompetitive Jak2 inhibitors, t he target pocket is usually defined as that surrounding the ATP-binding pocket. However, in order to devel op allosteric inhibitors for Jak2, it would be necessary to identify druggable pockets on t he Jak2 surface that are remote to the active site. Exploring the vast surface area of Jak2 to identify such pockets may seem like a daunting task. However, this task is feasible when the recent advancements in molecular docking are combined with the info rmation available the regarding structurefunction relationships of Jak2. The contributi on of structural biol ogy to the development of inhibitors, specifically for kinases, is notable (Johnson 2009). Based on the available structural information, possible areas for a llosteric targeting in Jak2 are discussed below. Jak2 Kinase Domain The ATP-binding site in the kinase domain is currently being targeted for ATPcompetitive inhibitors that bind to the ac tive conformation of the kinase. However, targeting the pockets in the inactive ki nase conformation may provide more Jak2 selectivity. In the inactive conformation, when the catalytic loop is in the DFG-out conformation, it blocks ATP binding and this in turn may result in distinct pockets adjacent to the ATP binding site (Figure 6-1) Specifically, the ty pe II inhibitor pocket formed between the C-helix and the activation segment could be a possible target. A classic example for this is Gleevec, whic h preferentially binds to and stabilizes the inactive conformation of BCRABL (Schindler et al. 2000). T he crystal structure of the inactive form of Jak2 is not available and th is information may be useful in identifying such pockets. Also, the Jak2 kinase domain has a unique insertion loop, which is not conserved in other kinases. This feature s hould be considered during the design of Jak2 178

PAGE 179

allosteric inhibitors. Additionally, considering the case of LS104, targeting the substratebinding site of Jak2 may also serve as an effe ctive strategy for inhibition. There is also precedent for a peptide inhibitor, Tkip, which i nhibits Jak2 by binding to the activation loop in its autophosphorylated st ate similar to that of SOCS binding (Flowers et al. 2004). Thus, targeting regions apart from the ATP binding site may also result in effective Jak2 inhibition through an allosteric mechanism Autoinhibitory Interface between the Kinase and Pseudokinase Domains Among the non-receptor tyrosine kinases, Jak2 has a unique architecture of having a ps eudokinase domain located adjacent to the kinase domain. The JH2 domain is classified to be a pseudokinase due to t he lack of tyrosine kinase activity and the absence of a conserved HRD motif, which is replaced by HGN (Wilks et al. 1991). Saharinen and Silvennoinen firs t reported the role of the JH2 domain being an autoinhibitory domain over the JH1 kinas e domain (Saharinen and Silvennoinen 2002; Saharinen et al. 2000). They also showed t hat residues 758-807 in the JH2 domain are important for the autoinhibition, while residues 619-757 enhance this inhibition. Therefore, Jak2 activation in response to lig and binding involves the relief of the kinase domain from the autoinhibition of JH2, possibl y via the phosphorylation of its activation loop. The molecular mechanism for the consti tutive activation of Jak2-V617F involves the disruption of inhibitory interactions at this interface (Dusa et al. 2010; Gnanasambandan et al. 2010; Lee et al. 2009a). The autoinhibitory regulation of Jak2 makes it an attractive drug target since it involves conformational changes as a part of its functional cycle (Peterson and Golemis 2004) Therapeutically successful inhibitors that stabilize the autoinhibited fold of pr oteins have been identified for other targets 179

PAGE 180

inclu ding BCR-ABL (imatinib) and N-WASP (wisko statin). Therefore, targeting Jak2 at its JH1-JH2 interface may stabilize t he autoinhibited form of the protein. SH2-linker JH2 Interface Function of the SH2-like domain located adjacent to the pseudokinase domain has not been well characterized. However, the linker connecting the SH2 domain to the pseudokinase domain has been implicated in Jak2 activation (Figure 6-1). Specifically, Zhao et al. reported that upon ligand binding, the SH2-pseudokinase domain linker flexes the hinge between the JH1 and JH2, thus leading to Jak2 activation (Zhao et al. 2009). Accordingly, several Jak2 exon 12 mutations that lead to constitutive Jak2 activation occur in the SH2-JH2 linker region It is possible that these mutations are stabilizing the linker region in the 'ON' m ode that is normally associated with Jak2 activation. However, this needs to be demonstr ated experimentally. It is interesting to note that in another tyrosine kinase, Z AP-70, the linker betw een the SH2 and kinase domains autoinhibits kinase activity by reduc ing the flexibility of the hinge region (Deindl et al. 2007). Targeting the pockets that mi ght control conformational changes induced by the SH2-JH2 linker will be useful in regulat ing Jak2 kinase activity. Further, targeting different allosteric sites based on the location of the mutations may also provide mutant specific inhibition, as in t he case of exon 14 vs. exon 12. FERM Domain The Jak2 FERM domain has been known to be important for Jak-receptor association. Zhou et al. has shown that the Jak3 FERM domain physically interacts with the kinase domain and regulates both Jak3 receptor associ ation and kinase activity (Zhou et al. 2001). Interestingly, in the case of Jak2, it was found that the FERM domain negative ly regulates Jak2 wild type, but positively regulates Jak2-V617F kinase activity 180

PAGE 181

(Wernig et al. 2008). Further, phosphorylation of tyrosines in the Jak2 FERM domain has been reported to have both positive and negative regulator y effects on Jak2 kinase activity. Specifically, mutation of tyrosines 114, 119 and 317 in the FERM domain or deletion of the FERM domain itself has been shown to increase the kinase ac tivity of Jak2-WT (Funakoshi-Tago et al. 2006; Robertson et al. 2009; Wernig et al. 2008). Recently, a potential activation mutation in the FERM domain, R340Q, was identified in Jak2-V617F negative MPN patients (Aranaz et al. 2010). There is precedent for negative regulation through FERM domain in Focal Adhesion Kinase (FAK). The FAK kinase domain is autoinhibited by the FERM domai n via sterical blocking of the catalytic cleft, which is very similar to the predi cted interaction between the JH1and JH2 domains in the JAKs (Lietha et al. 2007). Overall, Jak2 FERM domain seems to be regulating both Jak2 receptor association and kinase activi ty. Thus, targeting pockets in FERM domain may help modulate Jak2 kinase activity. In this case, available information on the actual mode of FERM domain interactions with the receptor should be considered while assessing the pockets for targeting. Identification of Druggable Alloster ic Pockets using Virtual Screening While the above-mentioned surfaces can be used as targets, identifying a druggable pocket within those surf aces that can bind a high affinity compound involves a different approach. I dentification of lead compounds for targets using structure based virtual screening has become popular in the past decade and it has proved very useful in drug discovery. Its high throughput nature allows for the screening of a large number of compounds in a fast and inexpensive manner, which is not feasible experimentally. Virtual screening involves the molecular docking of various inhibitors to a defined pocket 181

PAGE 182

on the target and ranking the ligands based on parameters such as binding energy, geometrical complementarity, and bonding interactions. T he scoring function used to rank the compounds varies based on the docki ng program used, such as a force fieldbased function in DOCK, an empirical function in Glide and a shape based function in LigandFit (Muegge and Enyedy 2004). Ranking of compounds using current docking programs is very crude and therefore a large number of compound s have to be tested biologically using high throughput screening methods in order to identify a possible lead compound. This limitation arises due to unr eliable scoring methods, which sometimes fail to account for the conforma tional flexibility of the protei n and hence do not reflect the nature of ligand-protein interactions accurately. Due to a high degree of conservation am ong kinase structures, even in the absence of crystal structures for certain kinases, homology models are being used for virtual screening of inhibitors. For example, homology modeling was employed for the development of ATP-competitive Jak2 inhibitors, before the crystal structure of the Jak2 kinase domain was solved in 2006 (Sandberg et al. 2005). In addition, given the vast amount of Jak2 surface available for ta rgeting, the homology model can also be adopted for Jak2 allosteric inhibitor design. Id entification of alloster ic binding sites can be tricky and use of molecular dynamics may be required. Since allosteric sites are linked to remote functional sites indirect ly, they can be identified using cooperative coupling methods. This may require a comb ination of approaches that are based on both sequence, as in the Statistical Coupling Analysis (SCA) and protei n structure, as in the COREX algorithm (Wade et al. 2010). This virtual screening process can in turn be guided by the available biochemical data on Jak2 structure-function relationships. 182

PAGE 183

Further, Haan et al., has suggested a chemical genetic s based approach to achieve more specificity while targeting Jak kinases (Haan et al. 2010). We have made an attempt to point out the possible surfaces for Jak2 allosteric inhibition here. However, a systematic dissection of the Jak2 surface using computational approaches wil l be required to identify druggable allosteric sites. Identification of the Jak2 a llosteric sites would require the use of cooperative coupling methods and analysis of the geometrical and ph ysiochemical properties of multiple pockets on the Jak2 surface in various conformations as identified using molecular dynamics simulations. Further, t he predicted allosteric sites can be cross-referenced to available biological data from the Jak2 structure-function studi es for validation. It is our hope that future research in the area of Jak2 drug development would focus on identifying and targeting the allosteric sites on Jak2 surface, in order to improve the specificity during inhibition. While no judgments can be made on the current ATPcompetitive inhibitors for Jak2, allosteric inhibitor design may simply provide an alternative approach that could lead to select ive and more effective inhibitors for MPN treatment. Moreover, a combination of allosteric and ATP-competitive inhibitors could prove more effective than an individual inhibitor. Role of Tyrosine Phosphorylation on Jak2 Regulation Jak2 is a tyrosine kinase whose activity is also regulation by cis or trans phosphorylation of the various tyrosine resid ues present throughout the protein. In Chapter 4, we have shown the importance of phosphory lation at Y372 for Jak2 activation. Y372 is present in the FERM domai n, which helps in the association of Jak2 with cytokine and growth hormone receptors. In terestingly, the mutation of Y372 to F that disrupts phosphorylation, does not affect Jak2-receptor co-association. However, it 183

PAGE 184

does affect Jak2 dimerization and in turn reduces Jak2 activation. The importance of dimerization adds a clue to solving the puzzl e of how Jak2 gets activated. It has been known that ligands bind to receptors and induce receptor dimerization, which in turn brings the receptor-associated Jaks in close proxim ity (Sandberg et al. 2004). However, the sequence of events that lead to Jak acti vation following ligand binding is still elusive. It is possible that once the Jaks are in close proximity, they dimerize and activate each other through transphosphorylation of Y1007 and Y1008 in the activation loops. Additionally, the fact that Y372 is in the FERM domain re iterates the importance of the domain in Jak2 activation. A recent repor t indicated that the SH2-JH2 linker acts as a switch that flexes the hinge of JH2 fo llowing ligand binding l eading to kinase domain activation. This suggests that the FERM and the downstream SH2-like domains may act as messengers that transmit the conformati onal changes from ligand-bound receptor to the kinase domain. Thus, the FERM and SH2-like domains together with the pseudokinase domains could control the ac tivation of Jaks allosterically. This hypothesis can also be supported by the fact that Jak2 mutations have been identified in the FERM domain and the SH2-JH2 linker region among MPN patients (Aranaz et al. 2010; Zhao et al. 2009; Zhou et al. 2001). Crystal Structure for Jak2: Need of the Hour Over the period of the past 20 years, J anus Kinases have become more and more interesting to scientists in terms of their importance in cellular signaling and function. Howev er, several important questions regardi ng their structure-function correlataion and activation still remain. In terms of the protein structure, Jaks have the unique organization of two kinase domains adjacent to each other apart from that of GCN2 kinase. Jaks also have a peculiar SH2-like domain, which does not have any known 184

PAGE 185

function in the recognit ion of phosphotyrosin es similar to canonical SH2 domains. The presence of these multiple domains to r egulate one kinase domain arouses the question of domain organization. A full length Jak2 homology model proposed by Kroemer and colleagues has served as a guiding light fo r the various structure-function studies conducted so far and seems to be in frequency with the in vitro results obtained. However, in reality, it is tempting to visualize whether the anti-symmetry between the kinase and pseudokinase domains propos ed by the model holds true. Recently, Dr. Silvennoinen and colleagues showed that the Jak2 pseudokinase domain displays dual specific kinase activity and it negatively regulates Jak2 activity through phosphorylation at S523 and Y570 residues (Ungureanu et al. 2011). This adds a new dimension to model of Jak2 activation. Apart from the allosteric interactions via the JH1-JH2 interface, the pseudokinase do mains can also autoinhibit the kinase domain through S523 and Y570 phosphorylation. Additionally, it has been shown that mutants such as Jak2-V617F display reduced phosphorylation at S523 and Y570 residues. Does this mean that the pseudokinase domain should be inactivated for the kinase domain to be activated? Results from our MD simulations indicate that Jak2V617F and Jak2-H538Q/K539L mutations seve rely modify the conformation of important catalytic motifs of t he pseudokinase domain, such as the C helix, hinge region and the glycine loop (Figs. 2-2 and 3-4). This could mean that these mutations may actually disrupt the catalytic activity of the pseudokinase domain. Thus, the basis for Jak2 activation could be two forked di sruption of interactions at the JH1-JH2 interface and also inactivation of the pseudoki nase domain. This result again reiterates 185

PAGE 186

186 the importance of the Jak2 crystal structure in order to understand the JH1-JH2 organization and how it influences Jak2 activation. Additionally, the crystal structure woul d also indicate whether there is any interaction of the FERM domai n with domains other than that of SH2-like domain. Some in vitro studies have suggested that the FERM domain could be possibly interacting with the kinase domain in the inactive form, indicating a dual autoinhibition from both the FERM and the pseudokinase domains (Funakoshi-Tago et al. 2008a). Further, the crystal struct ure would help us to underst and the structure-function correlation of various Jak2 mutations that are identified under disease conditions. Additionally, it would facilitate the identification of alloster ic pockets on the Jak2 surface that could be targeted for inhibitor development. In Chapter 5, we have summarized our effort s to purify Jak2 either in part or full length for the purposes of crystallization. However, due to various issues such as protein insolubility and degradation, Jak2 purification was not successful and hence it could not be crystallized. Future efforts to troubleshoot Jak2 purification and obtaining the crystal structure would be worthwhile, considering the numerous benefits that could be obtained afterward. Thus, data presented in this dissertati on demonstrate the molecular mechanisms for the constitutive activation of different Ja k2 mutations and highlight the significance of multi-level regulation of Jak2 kinase activity.

PAGE 187

Table 6-1. Current allosteric inhibitors for B CR-ABL and Jak2 that target si tes other than the ATP-binding site Name Structure Target Kinases IC50 (nM) Predicted Mechanism of Inhibition Ref. GNF-2 BCR-ABL 138 Targets the myristoyl binding cleft (Zhang et al. 2010) DCC-2036 BCR-ABL 5.8 Targets the switch control pocket (Chan et al. 2011) ON012380 BCR-ABL 10 Substratecompetitive (Gumireddy et al. 2005) LS104 Jak2, FLT3 1500 (Jak2), 4000 (FLT3) Substratecompetitive (Kasper et al. 2008; Lipka et al. 2008) ON044580 BCR-ABL, Jak2 3000 (BCRABL), 4000 (Jak2) Substratecompetitive (Jatiani et al. 2010) 187

PAGE 188

Figure 6-1. Possible targets for Jak2 allosteric inhibition. Surface re presentation of a full length Jak2 homology model prepared us ing VMD 1.8.6. The kinase domain is shown in orange, pseudokinase domain in cyan, SH2-JH2 linker in yellow, SH2-like domain in red and the FERM domain in green. Other linker regions between the domains are shown in white. 188

PAGE 189

LIST OF REFERENCES Adlade J, Prot C, Gelsi-Boyer V, Pautas C, Murati A, Copie-Bergman C, Imbert M, Chaffanet M, Birnbaum D, and Mozziconacci MJ. A t(8;9) translocation with PCM1-JAK2 fusion in a patient with T-cell lymphoma. Leukemia 20: 536-537, 2006. Ali MS, Sayeski PP, and Bernstein KE. Jak2 acts as both a STAT1 kinase and as a molecular bridge linking STAT1 to the angiotensin II AT1 receptor. J Biol Chem 275: 15586-15593, 2000. Ali MS, Sayeski PP, Dirksen LB, Hayze r DJ, Marrero MB, and Bernstein KE. Dependence on the motif YIPP for the physical association of Jak2 kinase with the intracellular carboxyl tail of the angiotensin II AT1 receptor. J Biol Chem 272: 23382-23388, 1997. An X, Tiwari AK, Sun Y, Ding PR, Ashby CR, and Chen ZS. BCR-ABL tyrosine kinase inhibitors in the treatment of Philadelphia chromosome positive chronic myeloid leukemia: a review. Leuk Res 34: 1255-1268, 2010. Andl CD, Mizushima T, Oyama K, Bowser M, Nakagawa H, and Rustgi AK. EGFRinduced cell migration is mediated predom inantly by the JAK-STAT pathway in primary esophageal keratinocytes. Am J Physiol Gastrointest Liver Physiol 287: G1227-1237, 2004. Aranaz P, Ormazbal C, Hurtado C, Erquiaga I, Calasanz MJ, Garca-Delgado M, Novo FJ, and Vizmanos JL. A new potential oncog enic mutation in the FERM domain of JAK2 in BCR/ABL1-negative and V617F-n egative chronic myeloproliferative neoplasms revealed by a comprehensive scr eening of 17 tyrosine kinase coding genes. Cancer Genet Cytogenet 199: 1-8, 2010. Argetsinger LS, Kouadio JL, Steen H, Stens balle A, Jensen ON, and Carter-Su C. Autophosphorylation of JAK2 on tyrosi nes 221 and 570 regulates its activity. Mol Cell Biol 24: 4955-4967, 2004. Argetsinger LS, Stuckey JA, Robertson SA, Ko leva RI, Cline JM, Marto JA, Myers MG, and Carter-Su C. Tyrosines 868, 966, and 972 in the kinase domain of JAK2 are phosphorylated and required for maxi mal JAK2 kinase activity. Mol Endocrinol 24: 1062-1076, 2010. Baneyx F, and Palumbo JL. Improving heter ologous protein folding via molecular chaperone and foldase co-expression. Methods Mol Biol 205: 171-197, 2003. Barnett SF, Defeo-Jones D, Fu S, Hancock PJ, Haskell KM, Jones RE, Kahana JA, Kral AM, Leander K, Lee LL, Malinowski J, McAvoy EM, Nahas DD, Robinson RG, and Huber HE. Identification and characteri zation of pleckstrin-homology-domaindependent and isoenzyme-specific Akt inhibitors. Biochem J 385: 399-408, 2005. 189

PAGE 190

Baxter EJ, Scott LM, Campbell PJ, East C, Fourouclas N, Swanton S, Vassiliou GS, Bench AJ, Boyd EM, Curtin N, Sco tt MA Erber WN, and Green AR. Acquired mutation of the tyrosine kinase JAK2 in human myeloprolifer ative disorders. Lancet 365: 1054-1061, 2005. Bercovich D, Ganmore I, Scott LM, Wainreb G, Birger Y, Elimelech A, Shochat C, Cazzaniga G, Biondi A, Basso G, Cario G, Schrappe M, Stanulla M, Strehl S, Haas OA, Mann G, Binder V, Borkhardt A, Ke mpski H, Trka J, Bielorei B, Avigad S, Stark B, Smith O, Da stugue N, Bourquin JP, Tal NB Green AR, and Izraeli S. Mutations of JAK2 in acute lymphoblas tic leukaemias associated with Down's syndrome. Lancet 372: 1484-1492, 2008. Bosshard HR, Marti DN, and Jelesarov I. Protei n stabilization by salt bridges: concepts, experimental approaches and clarific ation of some misunderstandings. J Mol Recognit 17: 1-16, 2004. Bousquet M, Broccardo C, Quelen C, Megge tto F, Kuhlein E, Delsol G, Dastugue N, and Brousset P. A novel PAX5-ELN fusion protein identified in B-cell acute lymphoblastic leukemia acts as a dominant negative on wild-type PAX5. Blood 109: 3417-3423, 2007. Bousquet M, Quelen C, De Mas V, Duchayne E, Roquefeu il B, Delsol G, Laurent G, Dastugue N, and Brousset P. Th e t(8;9)(p22;p24) translocat ion in atypical chronic myeloid leukaemia yields a new PCM1-JAK2 fusion gene. Oncogene 24: 72487252, 2005. Brooks BR, Bruccoleri RE, Olafson BD, St ates DJ, Swaminathan S, and Karplus M. Charmm a Program for Macromolecular Energy, Minimization, and Dynamics Calculations. J Comput Chem 4: 187-217, 1983. Burley SK, and Petsko GA. Aromatic-aromati c interaction: a mechanism of protein structure stabilization. Science 229: 23-28, 1985. Burley SK, and Petsko GA. Amino-arom atic interactions in proteins. FEBS Lett 203: 139-143, 1986. Butcher CM, Hahn U, To LB, Gecz J, Wilkins EJ, Scott HS, Bardy PG, and D'Andrea RJ. Two novel JAK2 exon 12 mutations in JAK2V617F-negative polycythaemia vera patients. Leukemia 22: 870-873, 2008. Cacalano NA, Migone TS, Bazan F, Hanson EP, Chen M, Candotti F, O'Shea JJ, and Johnston JA. Autosomal SCID caused by a point mutation in the N-terminus of Jak3: mapping of the Jak3-receptor interaction domain. EMBO J 18: 1549-1558, 1999. Campbell GS, Argetsinger LS, Ihle JN, Ke lly PA, Rillema JA, and Carter-Su C. Activation of JAK2 tyrosine kinase by pr olactin receptors in Nb2 cells and mouse mammary gland explants. Proc Natl Acad Sci U S A 91: 5232-5236, 1994. 190

PAGE 191

Carter-Su C, Argetsinger LS, Campbell GS Wang X, Ihle J, and Witthuhn B. The identification of JAK2 tyrosine kinase as a signaling molecule for growth hormone. Proc Soc Exp Biol Me d 206: 210-215, 1994. Carter-Su C, King AP, Argetsinger LS, Sm it LS, Vanderkuur J, and Campbell GS. Signalling pathway of GH. Endocr J 43 Suppl: S65-70, 1996. Chan WW, Wise SC, Kaufman MD, Ahn YM, Ensinger CL, Haack T, Hood MM, Jones J, Lord JW, Lu WP, Miller D, Patt WC, Smith BD, Petillo PA, Rutkoski TJ, Telikepalli H, Vogeti L, Y ao T, Chun L, Clark R, Ev angelista P, Gavrilescu LC, Lazarides K, Zaleskas VM, Stewar t LJ, Van Etten RA, and Flynn DL. Conformational Control Inhibi tion of the BCR-ABL1 Tyrosi ne Kinase, Including the Gatekeeper T315I Mutant, by the Switch-Control Inhibitor DCC-2036. Cancer Cell 19: 556-568, 2011. Chang YJ, Holtzman MJ, and Chen CC. Differentia l role of Janus family kinases (JAKs) in interferon-gamma-induced lung epithelial ICAM-1 expression: involving protein interactions between JAKs, phosphol ipase Cgamma, c-Src, and STAT1. Mol Pharmacol 65: 589-598, 2004. Chatti K, Farrar WL, and Duh RJ. Tyrosine phosphorylation of the Janus kinase 2 activation loop is essential for a high-activi ty catalytic state but dispensable for a basal catalytic state. Biochemistry 43: 4272-4283, 2004. Chen M, Cheng A, Candotti F, Zhou YJ, Hy mel A, Fasth A, Notarangelo LD, and O'Shea JJ. Complex effects of naturally occurring mutations in the JAK3 pseudokinase domain: evidence for interactions between the kinase and pseudokinase domains. Mol Cell Biol 20: 947-956, 2000. Churchill CD, Navarro-Whyte L, Rutledge LR and Wetmore SD. Effects of the biological backbone on DNA-protein stacking interactions. Phys Chem Chem Phys 11: 10657-10670, 2009. Cirmena G, Aliano S, Fugazza G, Bruzzone R, Garuti A, Bocciardi R, Bacigalupo A, Ravazzolo R, Ballestrero A, and Sessar ego M. A BCR-JAK2 fusion gene as the result of a t(9;22)(p24;q11) in a pat ient with acute myeloid leukemia. Cancer Genet Cytogenet 183: 105-108, 2008. Cohen P. Protein kinases--the major drug targets of the twent y-first century? Nat Rev Drug Discov 1: 309-315, 2002. Coyaud E, Struski S, Prade N, Familiades J, Eichner R, Quelen C, Bousquet M, Mugneret F, Talmant P, Pages MP, Lefebvre C, Penther D, Lippert E, Nadal N, Taviaux S, Poppe B, Luquet I, Baranger L, Eclache V, Radford I, Barin C, Mozziconacci MJ, Lafage-Pochitaloff M, Anto ine-Poirel H, Charrin C, Perot C, Terre C, Brousset P, Dastugue N, and Br occardo C. Wide diversity of PAX5 alterations in B-ALL: a Groupe Fr ancophone de Cytogenetique Hematologique study. Blood 115: 3089-3097, 2010. 191

PAGE 192

Darnell JE, Jr., Kerr IM, and Stark GR Jak-STAT pathways and transcription al activation in response to IFNs and other extracellular signaling proteins. Science 264: 1415-1421, 1994. Dawson MA, Bannister AJ Gttgens B, Foster SD Bartke T, Green AR, and Kouzarides T. JAK2 phosphorylates hist one H3Y41 and excludes HP1alpha from chromatin. Nature 461: 819-822, 2009. Deindl S, Kadlecek TA, Brdicka T, Cao X, Weiss A, and Kuriyan J. Structural basis for the inhibition of tyrosine kinase activity of ZAP-70. Cell 129: 735-746, 2007. Deng X, Okram B, Ding Q, Zhang J, Choi Y, Adrian FJ, Wojciechowski A, Zhang G, Che J, Bursulaya B, Cowan-Jacob SW, Ru mmel G, Sim T, and Gray NS. Expanding the diversity of allosteric bcr-abl inhibitors. J Med Chem 53: 6934-6946, 2010. Duh RJ, and Farrar WL. Characterization of active and inactive forms of the JAK2 protein-tyrosine kinase produced via the baculovirus expression vector system. J Biol Chem 270: 23084-23089, 1995. Duh RJ, Wang LH, and Farrar WL. Negative regulation of Janus kinases. Cell Biochem Biophys 34: 17-59, 2001. Dusa A, Mouton C, Pecquet C, Herman M, and Constantinescu SN. JAK2 V617F constitutive activation requires JH2 re sidue F595: a pseudokinase domain target for specific inhibitors. PLoS One 5: e11157, 2010. Dusa A, Staerk J, Elliott J, Pecquet C, Poir el HA, Johnston JA, and Constantinescu SN. Substitution of pseudokinase domain resi due Val-617 by lar ge non-polar amino acids causes activation of JAK2. J Biol Chem 283: 12941-12948, 2008. Erdmann DA, B.; Bohn, J.; De Pover, A.;Flo ersheimer, A.; Fontan a,, P.; Gerspacher MH, J.C.; Hofmann, F.; Radi merski, T.; Wille, R.;, and Zimmermann CC, P. Kinetic study of human full-length wild-type JAK2 and V617F mutant proteins. Open Enzym Inhib J 1: 5, 2008. Feener EP, Rosario F, Dunn SL, St ancheva Z, and Myers MG. Tyrosine phosphorylation of Jak2 in the JH2 domain inhibits cytokine signaling. Mol Cell Biol 24: 4968-4978, 2004. Feng J, Witthuhn BA, Matsuda T, Kohlhuber F, Kerr IM, and Ihle JN. Activation of Jak2 catalytic activity requires phosphorylation of Y1007 in the kinase activation loop. Mol Cell Biol 17: 2497-2501, 1997. Ferrin TE, Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, and Meng EC. UCSF chimera A visualization system for exploratory research and analysis. J Comput Chem 25: 1605-1612, 2004. 192

PAGE 193

Fiedor J, Pilch M, and Fiedor L. Tuning the thermodynamics of association of transmembrane helices. J Phys C hem B 113: 12831-12838, 2009. Flowers LO, Johnson HM, Mujtaba MG, Ellis MR, Haider SM, and Subramaniam PS. Characterization of a peptide inhibitor of Janus kinase 2 that mimics suppressor of cytokine signaling 1 function. J Immunol 172: 7510-7518, 2004. Fourouclas N, Li J, Gilby DC, Campbell PJ Beer PA, Boyd EM, Goodeve AC, Bareford D, Harrison CN, Reilly JT, Green AR, and Bench AJ. Methylation of the suppressor of cytokine signaling 3 gene (SOCS3) in myeloproliferative disorders. Haematologica 93: 1635-1644, 2008. Frank SJ, Yi W, Zhao Y, Goldsmith JF, Gilliland G, Jiang J, Saka i I, and Kraft AS. Regions of the JAK2 tyrosine kinase r equired for coupling to the growth hormone receptor. J Biol Chem 270: 14776-14785, 1995. Funakoshi-Tago M, Pelletier S, Matsuda T, Pa rganas E, and Ihle JN. Receptor specific downregulation of cytokine signaling by autophosphorylation in the FERM domain of Jak2. EMBO J 25: 4763-4772, 2006. Funakoshi-Tago M, Pelletier S, Moritake H, Parganas E, and Ihle JN. Jak2 FERM domain interaction with the erythropoietin re ceptor regulates Jak2 kinase activity. Mol Cell Biol 28: 1792-1801, 2008a. Funakoshi-Tago M, Tago K, Kasahara T, Par ganas E, and Ihle JN. Negative regulation of Jak2 by its auto-phosphorylation at ty rosine 913 via the Epo signaling pathway. Cell Signal 20: 1995-2001, 2008b. Gaikwad A, Rye CL, Devidas M, Heerema NA Carroll AJ, Izraeli S, Plon SE, Basso G, Pession A, and Rabin KR. Prevalence and clinic al correlates of JAK2 mutations in Down syndrome acute lymphoblastic leukaemia. Br J Haematol 144: 930-932, 2009. Gazit E. A possible role fo r pi-stacking in the self-asse mbly of amyloid fibrils. FASEB J 16: 77-83, 2002. Gery S, Cao Q, Gueller S, Xing H, Te fferi A, and Koeffler HP. Lnk inhibits myeloproliferative disorder-associ ated JAK2 mutant, JAK2V617F. J Leukoc Biol 85: 957-965, 2009. Ghoreschi K, Laurence A, and O'Shea JJ. Se lectivity and therapeut ic inhibition of kinases: to be or not to be? Nat Immunol 10: 356-360, 2009. Giordanetto F, and Kroemer RT. Prediction of the structure of human Janus kinase 2 (JAK2) comprising JAK homology domains 1 through 7. Protein Eng 15: 727-737, 2002. 193

PAGE 194

Girault JA, Labesse G, Mornon JP, and Callebaut I. Janus kinases and focal adhesion kinases play in the 4.1 band: a superfam ily of band 4.1 domains im portant for cell structure and signal transduction. Mol Med 4: 751-769, 1998. Gnanasambandan K, Magis A, and Sayeski PP. T he constitutive activation of Jak2V617F is mediated by a stacking mechanism involving phenylalanines 595 and 617. Biochemistry 49: 9972-9984, 2010. Gnanasambandan K, and Sayeski PP. A Struct ure-Function Perspective of Jak2 Mutations and Implications for Alternat e Drug Design Strategies: The Road not Taken. Curr Med Chem 2011. Godeny MD, Sayyah J, VonDerLinden D, Johns M, Ostrov DA, Caldwell-Busby J, and Sayeski PP. The N-terminal SH2 domain of the tyrosine phosphatase, SHP-2, is essential for Jak2-dependent signaling via the angiotensin II type AT1 receptor. Cell Signal 19: 600-609, 2007. Gorantla SP, Dechow TN, Grundler R, Ille rt AL, Zum Bschenfelde CM, Kremer M, Peschel C, and Duyster J. Oncogenic J AK2V617F requires an intact SH2-like domain for constitutive activation and induc tion of a myeloprolif erative disease in mice. Blood 116: 4600-4611, 2010. Griesinger F, Hennig H, Hillmer F, Podleschny M, Steffens R, Pies A, Wrmann B, Haase D, and Bohlander SK. A BCR-JAK2 fusion gene as the result of a t(9;22)(p24;q11.2) translocation in a patient with a clinically typical chronic myeloid leukemia. Genes Chromosomes Cancer 44: 329-333, 2005. Grunebach F, Bross-Bach U, Kanz L, and Bro ssart P. Detection of a new JAK2 D620E mutation in addition to V617F in a patient with polycythemia vera. Leukemia 20: 2210-2211, 2006. Gumireddy K, Baker SJ, Cosenza SC, John P, Kang AD, Robell KA, Reddy MV, and Reddy EP. A non-ATP-competitive inhibi tor of BCR-ABL overrides imatinib resistance. Proc Natl Acad Sci U S A 102: 1992-1997, 2005. Haan C, Behrmann I, and Haan S. Perspectives fo r the use of structural information and chemical genetics to develop inhibitors of Janus kinases. J Cell Mol Med 14: 504527, 2010. Harpur AG, Andres AC, Ziemiecki A, Aston RR, and Wilks AF. JAK2, a third member of the JAK family of protein tyrosine kinases. Oncogene 7: 1347-1353, 1992. He K, Wang X, Jiang J, Guan R, Bernst ein KE, Sayeski PP, and Frank SJ. Janus kinase 2 determinants for growth hormone rec eptor association, surface assembly, and signaling. Mol Endocrinol 17: 2211-2227, 2003. 194

PAGE 195

Hilk ens CM, Is'harc H, Lillem eier BF, Strobl B, Bates PA, Behrmann I, and Kerr IM. A region encompassing the FERM domain of Ja k1 is necessary for binding to the cytokine receptor gp130. FEBS Lett 505: 87-91, 2001. Hirai H, Sootome H, Nakatsuru Y, Miyama K, Taguchi S, Tsujioka K, Ueno Y, Hatch H, Majumder PK, Pan BS, and Kotani H. MK -2206, an allosteric Akt inhibitor, enhances antitumor efficacy by standard chemotherapeutic agents or molecular targeted drugs in vitro and in vivo. Mol Cancer Ther 9: 1956-1967, 2010. Hookham MB, Elliott J, Suessmuth Y, Staerk J, Ward AC, Vainchenker W, Percy MJ, McMullin MF, Constantinescu SN, and Johnston JA. The myeloproliferative disorder-associated JAK2 V617F mutant escapes negative regulation by suppressor of cytokine signaling 3. Blood 109: 4924-4929, 2007. Hornakova T, Springuel L, Devreux J, Dusa A, Constantinescu S, Knoops L, and Renauld JC. Oncogenic JAK1 and JAK2-act ivating mutations resistant to ATPcompetitive inhibitors. Haematologica 2011. Huang LJ, Constantinescu SN, and Lodish HF The N-terminal domain of Janus kinase 2 is required for Golgi processing and cell surface expression of erythropoietin receptor. Mol Cell 8: 1327-1338, 2001. Humphrey W, Dalke A, and Schulten K. VMD: visual molecular dynamics. J Mol Graph 14: 33-38, 27-38, 1996. Huse M, and Kuriyan J. The conformati onal plasticity of protein kinases. Cell 109: 275282, 2002. James C, Ugo V, Le Couedic JP, Staerk J, Delhommeau F, Lacout C, Garcon L, Raslova H, Berger R, Bennaceur-Griscelli A, Villeval JL, Constantinescu SN, Casadevall N, and Vainchenker W. A unique clonal JAK2 mutation leading to constitutive signalling causes polycythaemia vera. Nature 434: 1144-1148, 2005. Jatiani SS, Cosenza SC, Reddy MV, Ha JH, Baker SJ, Samanta AK, Olnes MJ, Pfannes L, Sloand EM, Arlinghaus RB, and Reddy EP. A Non-ATP-Competitive Dual Inhibitor of JAK2 and BCR-ABL Kinas es: Elucidation of a Novel Therapeutic Spectrum Based on Substrat e Competitive Inhibition. Genes Cancer 1: 331-345, 2010. Johnson LN. Protein kinase inhibitors: cont ributions from structure to clinical compounds. Q Rev Biophys 42: 1-40, 2009. Jones AV, Chase A, Silver RT, Oscier D, Zo i K, Wang YL, Cario H, Pahl HL, Collins A, Reiter A, Grand F, and Cross NC. JAK2 hapl otype is a major risk factor for the development of myelopr oliferative neoplasms. Nat Genet 41: 446-449, 2009. 195

PAGE 196

Joseph EW Pratilas CA, Poulikakos PI, Tadi M, Wang W, Taylor BS, Halilovic E, Persaud Y, Xing F, Viale A, Tsai J, Chapman PB, Bollag G, Solit DB, and Rosen N. The RAF inhibitor PLX4032 inhibits ER K signaling and tumor ce ll proliferation in a V600E BRAF-selective manner. Proc Natl Acad Sci U S A 107: 14903-14908, 2010. Karaghiosoff M, Neubauer H, La ssnig C, Kovarik P, Schindle r H, Pircher H, McCoy B, Bogdan C, Decker T, Brem G, Pfeffer K, and Mller M. Partial impairment of cytokine responses in Tyk2-deficient mice. Immunity 13: 549-560, 2000. Kasper S, Breitenbuecher F, Hoehn Y, Heidel F, Lipka DB, Markova B, Huber C, Kindler T, and Fischer T. The kinase inhibi tor LS104 induces apoptosis, enhances cytotoxic effects of chemotherapeutic drugs and is targeting the receptor tyrosine kinase FLT3 in acute myeloid leukemia. Leuk Res 32: 1698-1708, 2008. Kearney L, Gonzalez De Castro D, Yeung J, Procter J, Horsley SW, Eguchi-Ishimae M, Bateman CM, Anderson K, Chaplin T, Young BD, Harrison CJ, Kempski H, So CW, Ford AM, and Greaves M. Specific JAK2 mutation (JAK2R683) and multiple gene deletions in Down syndrome acute lymphoblastic leukemia. Blood 113: 646648, 2009. Kilpivaara O, Mukherjee S, Sc hram AM, Wadleigh M, Mulla lly A, Ebert BL, Bass A, Marubayashi S, Heguy A, Garcia-Manero G, Kantarjian H, Offit K, Stone RM, Gilliland DG, Klein RJ, and Levine RL. A ge rmline JAK2 SNP is associated with predisposition to the development of JAK2(V617F)-positive myeloproliferative neoplasms. Nat Genet 41: 455-459, 2009. Kiss R, Sayeski PP, and Keseru GM. Recent developments on JAK2 inhibitors: a patent review. Expert Opin Ther Pat 20: 471-495, 2010. Knighton DR, Zheng JH, Ten Eyck LF, Ashford VA, Xuong NH, Taylor SS, and Sowadski JM. Crystal structure of the catalytic subunit of cyclic adenosine monophosphate-dependent pr otein kinase. Science 253: 407-414, 1991. Kohlhuber F, Rogers NC, Wat ling D, Feng J, Guschin D, Briscoe J, Witthuhn BA, Kotenko SV, Pestka S, Stark GR, Ihle JN, and Kerr IM. A JAK1/JAK2 chimera can sustain alpha and gamma interferon responses. Mol Cell Biol 17: 695-706, 1997. Kornev AP, and Taylor SS. Defining the conser ved internal architecture of a protein kinase. Biochim Biophys Acta 1804: 440-444, 2010. Kralovics R, Passamonti F, Buser AS, T eo SS, Tiedt R, Passweg JR, Tichelli A, Cazzola M, and Skoda RC. A gain-of -function mutation of JAK2 in myeloproliferative disorders. N Engl J Med 352: 1779-1790, 2005a. 196

PAGE 197

Kralovics R, Teo SS, Buser AS, Brutsche M, Tiedt R, Tichelli A, Passamonti F, Pietra D, Cazzola M, and Skoda RC. Altered gene expression in myeloprolif erative disorders correlates with activation of signaling by the V617F mutation of Jak2. Blood 106: 3374-3376, 2005b. Kratz CP, Boll S, Kontny U, Schrappe M, Niemeyer CM, and Stanul la M. Mutational screen reveals a novel JAK2 mutation, L611 S, in a child with acute lymphoblastic leukemia. Leukemia 20: 381-383, 2006. Kundrapu K, Colenberg L, and Duhe RJ. Ac tivation loop tyrosines allow the JAK2(V617F) mutant to attain hyperactivation. Cell Biochem Biophys 52: 103-112, 2008. Kurdi M, and Booz GW. JAK redux: a second look at the regulation and role of JAKs in the heart. Am J Physiol Heart Circ Physiol 297: H1545-1556, 2009. Kurzer JH, Argetsinger LS, Zhou YJ, Kouadio JL O'Shea JJ, and Carter-Su C. Tyrosine 813 is a site of JAK2 autophosphorylation critical for activation of JAK2 by SH2-B beta. Mol Cell Biol 24: 4557-4570, 2004. Lacout C, Pisani DF, Tulliez M, Gachelin FM, Vainchenker W, and Villeval JL. JAK2V617F expression in murine hematopoi etic cells leads to MPD mimicking human PV with secondary myelofibrosis. Blood 108: 1652-1660, 2006. Lacronique V, Boureux A, Valle VD, Poirel H, Quang CT, Mauchauff M, Berthou C, Lessard M, Berger R, Ghysdael J, and Bernard OA. A TEL-JAK2 fusion protein with constitutive kinase activity in human leukemia. Science 278: 1309-1312, 1997. Lee CSD, N. S. Highly sele ctive MEK inhibitiors. Curr Enz Inhib 6: 11, 2010. Lee JW, Kim YG, Soung YH, Han KJ, Kim SY, Rhim HS, Min WS, Nam SW, Park WS, Lee JY, Yoo NJ, and Lee SH. The JAK2 V617F mutation in de novo acute myelogenous leukemias. Oncogene 25: 1434-1436, 2006. Lee TS, Ma W, Zhang X, Giles F, Kantar jian H, and Albitar M. Mechanisms of constitutive activation of Janus kinase 2-V617F revealed at the atomic level through molecular dynamics simulations. Cancer 115: 1692-1700, 2009a. Lee TS, Ma W, Zhang X, Kantarjian H, and Albita r M. Structural effe cts of clinically observed mutations in JAK2 exons 1315: comparison with V617F and exon 12 mutations. BMC Struct Biol 9: 58, 2009b. Levine RL. Mechanisms of mutations in myeloproliferative neoplasms. Best Pract Res Clin Haematol 22: 489-494, 2009. Levine RL, and Gilliland DG. Myeloproliferative disorders. Blood 112: 2190-2198, 2008. 197

PAGE 198

Levine RL, Pardanan i A, Tefferi A, and Gilliland DG. Role of JAK2 in the pathogenesis and therapy of myelopro liferative disorders. Nat Rev Cancer 7: 673-683, 2007. Levine RL, Wadleigh M, Cools J, Ebert BL, Wernig G, Huntly BJ, Boggon TJ, Wlodarska I, Clark JJ, Moore S, Adelsperger J, K oo S, Lee JC, Gabriel S, Mercher T, D'Andrea A, Frohling S, Dohner K, Ma rynen P, Vandenberghe P, Mesa RA, Tefferi A, Griffin JD, Eck MJ, Sellers WR, Me yerson M, Golub TR, Lee SJ, and Gilliland DG. Activating mutation in the tyrosine kinase JAK2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis. Cancer Cell 7: 387-397, 2005. Li J, Spensberger D, Ahn JS, Anand S, Beer PA, Ghevaert C, Chen E, Forrai A, Scott LM, Ferreira R, Campbell PJ, Watson SP, Li u P, Erber WN, Huntly BJ, Ottersbach K, and Green AR. JAK2 V617F impairs hematopoietic stem cell function in a conditional knock-in mouse model of JAK2 V617F-positive essential thrombocythemia. Blood 116: 1528-1538, 2010. Lietha D, Cai X, Ceccarelli DF, Li Y, Schalle r MD, and Eck MJ. Structural basis for the autoinhibition of fo cal adhesion kinase. Cell 129: 1177-1187, 2007. Lindauer K, Loerting T, Liedl KR, and Kroemer RT. Prediction of the structure of human Janus kinase 2 (JAK2) comprising the tw o carboxy-terminal domains reveals a mechanism for autoregulation. Protein Eng 14: 27-37, 2001. Lindsley CW, Barnett SF, Layton ME, and Bi lodeau MT. The PI3K/Akt pathway: recent progress in the development of ATP-co mpetitive and allosteric Akt kinase inhibitors. Curr Cancer Drug Targets 8: 7-18, 2008. Lipka DB, Hoffmann LS, Heidel F, Markova B, Blum MC, Breitenbuec her F, Kasper S, Kindler T, Levine RL, Huber C, and Fischer T. LS104, a non-ATP-competitive small-molecule inhibitor of JAK2, is potently inducing apoptosis in JAK2V617Fpositive cells. Mol Cancer Ther 7: 1176-1184, 2008. Livnah O, Stura EA, Middleton SA, Johnson DL, Jolliffe LK, and Wilson IA. Crystallographic evidence for preformed dime rs of erythropoietin receptor before ligand activation. Science 283: 987-990, 1999. Lucet IS, Fantino E, Styles M, Bamert R, Patel O, Broughton SE, Walter M, Burns CJ, Treutlein H, Wilks AF, and Rossjohn J. The structural basis of Janus kinase 2 inhibition by a potent and specif ic pan-Janus kinase inhibitor. Blood 107: 176-183, 2006. Ma W, Kantarjian H, Zhang X, Wang X, Zhang Z, Yeh CH, O'Brien S, Giles F, Bruey JM, and Albitar M. JAK2 exon 14 deletion in patients with chronic myeloproliferative neoplasms. PLoS One 5: e12165, 2010. 198

PAGE 199

Ma W, Kantarjian H, Zhang X, Yeh CH, Zhang ZJ, Verstovsek S, and Albitar M. Mutation profile of JAK2 transcripts in patients with chronic myelopr oliferative neoplasias. J Mol Diagn 11: 49-53, 2009. Ma X, and Sayeski PP. Vaccinia virus-medi ated high level expression and single step purification of recomb inant Jak2 protein. Protein Expr Purif 35: 181-189, 2004. Macchi P, Villa A, Giliani S, Sacco MG, Frattini A, Porta F, Ugazio AG, Johnston JA, Candotti F, and O'Shea JJ. Mutations of Jak-3 gene in patients with autosomal severe combined immune deficiency (SCID). Nature 377: 65-68, 1995. Madamanchi NR, Li S, Patterson C, and Run ge MS. Reactive oxygen species regulate heat-shock protein 70 via the JAK/STAT pathway. Arterioscler Thromb Vasc Biol 21: 321-326, 2001. Majumder A and Sayeski PP. Tyro sine-Protein Kinase Jak2 Inhibitors for the Treatment of Myeloproliferat ive Neoplasms. Drug Future 35: 651-660, 2010. Malinge S, Ben-Abdelali R, Settegrana C, R adford-Weiss I, Debre M, Beldjord K, Macintyre EA, Villeval JL, Vainchenker W, Berger R, Bernard OA, Delabesse E, and Penard-Lacronique V. Novel activating JAK2 mutation in a patient with Down syndrome and B-cell precursor ac ute lymphoblastic leukemia. Blood 109: 22022204, 2007. Mark HF, Sotomayor EA, Nelson M, Chav es F, Sanger WG, Kaleem Z, and Caughron SK. Chronic idiopathic myelofibrosis (CIMF) resulting from a unique 3;9 translocation disrupting the janus kinase 2 (JAK2) gene. Exp Mol Pathol 81: 217223, 2006. Mazurkiewicz-Munoz AM, Argetsinger LS, K ouadio JL, Stensballe A, Jensen ON, Cline JM, and Carter-Su C. Phosph orylation of JAK2 at se rine 523: a negative regulator of JAK2 that is stimulated by grow th hormone and epidermal growth factor. Mol Cell Biol 26: 4052-4062, 2006. McDoom I, Ma X, Kirabo A, Lee KY, Ostr ov DA, and Sayeski PP. Identification of tyrosine 972 as a novel site of Jak2 tyro sine kinase phosphorylation and its role in Jak2 activation. Biochemistry 47: 8326-8334, 2008. McGaughey GB, Gagne M, and Rappe AK. pi-Stacki ng interactions. Alive and well in proteins. J Biol Chem 273: 15458-15463, 1998. Mercher T, Wernig G, Moore SA, Levine RL, Gu TL, Frhling S, Cullen D, Polakiewicz RD, Bernard OA, Boggon TJ, Lee BH, and Gilliland DG. JAK2T875N is a novel activating mutation that results in myel oproliferative diseas e with features of megakaryoblastic leukemia in a murine bone marrow transplantation model. Blood 108: 2770-2779, 2006. 199

PAGE 200

Muegge I, and Enyedy IJ. Virtual screening for kinase targets. Current Medicinal Che mistry 11: 693-707, 2004. Mullighan CG, Zhang J, Harvey RC, CollinsUnderwood JR, Schulman BA, Phillips LA, Tasian SK, Loh ML, Su X, Liu W, Devidas M, Atlas SR, Chen IM, Clifford RJ, Gerhard DS, Carroll WL, Reaman GH, Smith M, Downing JR, Hunger SP, and Willman CL. JAK mutations in high-risk childhood acute lymphoblastic leukemia. Proc Natl Acad Sci U S A 106: 9414-9418, 2009. Murati A, Gelsi-Boyer V, Adlade J, Perot C, Talmant P, Giraudier S, Lod L, Letessier A, Delaval B, Brunel V, Imbert M, Gar and R, Xerri L, Bir nbaum D, Mozziconacci MJ, and Chaffanet M. PCM1-JAK2 fusion in myeloproliferative disorders and acute erythroid leukemia with t(8;9) translocation. Leukemia 19: 1692-1696, 2005. Murphy EA, Shields DJ, Stoletov K, Dneprovskaia E, McElroy M, Greenberg JI, Lindquist J, Acevedo LM, Anand S, Majeti BK, Tsigelny I, Saldanha A, Walsh B, Hoffman RM, Bouvet M, Klemke RL, Vogt PK, Arnold L, Wrasidlo W, and Cheresh DA. Disruption of angiogenesis and tumor grow th with an orally active drug that stabilizes the inactive st ate of PDGFRbeta/B-RAF. Proc Natl Acad Sci U S A 107: 4299-4304, 2010. Najfeld V, Cozza A, Berkofsy-Fessler W, Prchal J, and Scalise A. Numerical gain and structural rearrangements of JAK2, i dentified by FISH, characterize both JAK2617V>F-positive and -negative patients with Ph-negative MPD, myelodysplasia, and B-lymphoid neoplasms. Exp Hematol 35: 1668-1676, 2007. Nakamura H. Roles of electros tatic interaction in proteins. Q Rev Biophys 29: 1-90, 1996. Nebral K, Denk D, Attarbaschi A, Knig M, Mann G, Haas OA, and Strehl S. Incidence and diversity of PAX5 fusion genes in childhood acute lymphoblastic leukemia. Leukemia 23: 134-143, 2009. Neubauer H, Cumano A, Muller M, Wu H, Huffstadt U, and Pfeffer K. Jak2 deficiency defines an essential developmental checkpoint in definitive hematopoiesis. Cell 93: 397-409, 1998. Nishi M, Werner ED, Oh BC, Frantz JD, Dhe-Paganon S, Hansen L, Lee J, and Shoelson SE. Kinase activation through dimerization by human SH2-B. Mol Cell Biol 25: 2607-2621, 2005. Nosaka T, van Deursen JM, Tripp RA, Thierfelder WE, Witthuhn BA, McMickle AP, Doherty PC, Grosveld GC, and Ihle JN. De fective lymphoid development in mice lacking Jak3. Science 270: 800-802, 1995. Olcaydu D, Harutyunyan A, Jger R, Berg T, Gisslinger B, Pabinger I, Gisslinger H, and Kralovics R. A common JAK2 haplotype confers susceptibility to myeloproliferative neoplasms. Nat Genet 41: 450-454, 2009a. 200

PAGE 201

Olcaydu D, Skoda RC, Looser R, Li S, Cazzola M, Pietra D, Passamonti F, Lippert E, Carillo S, Girodon F, Vannucchi A, Reading NS, Prchal JT, Ay C, Pabinger I, Gisslinger H, and Kralovics R. The 'GGCC' haplotype of JAK2 confers susceptibility to JAK2 exon 12 mutation-positive polycythemia vera. Leukemia 23: 1924-1926, 2009b. Ortmann RA, Cheng T, Visconti R, Frucht DM, and O'Shea JJ. Janus kinases and signal transducers and activators of transcription: their ro les in cytokine signaling, development and immunoregulation. Arthritis Res 2: 16-32, 2000. Pal SK, Reckamp K, Yu H, and Figlin RA. Akt inhibitors in clinical development for the treatment of cancer. Expert Opin Investig Drugs 19: 1355-1366, 2010. Parganas E, Wang D, Strav opodis D, Topham DJ, Marine JC, Teglund S, Vanin EF, Bodner S, Colamonici OR, van Deursen JM, Grosveld G, and Ihle JN. Jak2 is essential for signaling through a va riety of cytokine receptors. Cell 93: 385-395, 1998. Park SY, Saijo K, Takahashi T, Osawa M, Ar ase H, Hirayama N, Miya ke K, Nakauchi H, Shirasawa T, and Saito T. Developmental de fects of lymphoid cells in Jak3 kinasedeficient mice. Immunity 3: 771-782, 1995. Passamonti F, Elena C, Schnittger S, Skoda RC, Green AR, Girodon F, Kiladjian JJ, McMullin MF, Ruggeri M, Besses C, Vannucch i AM, Lippert E, Gisslinger H, Rumi E, Lehmann T, Ortmann CA, Pietra D, Pascu tto C, Haferlach T, and Cazzola M. Molecular and clinical featur es of the myeloproliferative neoplasm associated with JAK2 exon 12 mutations. Blood 117: 2813-2816, 2011. Patnaik MM, Knudson RA, Gangat N, Hanson CA, Pardanani A, Tefferi A, and Ketterling RP. Chromosome 9p24 abnormaliti es: prevalence, description of novel JAK2 translocations, JAK2V617F muta tion analysis and clinicopathologic correlates. Eur J Haematol 84: 518-524, 2010. Pavsic M, Vito T, and Lenarcic B. Purificati on and characterization of a recombinant human testican-2 expressed in baculo virus-infected Sf9 insect cells. Protein Expr Purif 58: 132-139, 2008. Peeters P, Raynaud SD, Cools J, Wlodarska I, Grosgeorge J, Philip P, Monpoux F, Van Rompaey L, Baens M, Van den Berghe H, and Marynen P. Fusion of TEL, the ETS-variant gene 6 (ETV6), to the receptor -associated kinase JAK2 as a result of t(9;12) in a lymphoid and t(9; 15;12) in a myeloid leukemia. Blood 90: 2535-2540, 1997. Pelletier S, Gingras S, Funakoshi-Tago M, Ho well S, and Ihle JN. Two domains of the erythropoietin receptor are sufficient fo r Jak2 binding/acti vation and function. Mol Cell Biol 26: 8527-8538, 2006. 201

PAGE 202

Percy MJ, Scott LM, Erber WN, Harrison CN, Reilly JT, Jones FG, Green AR, and McMullin MF. The frequency of JAK2 e xon 12 mutations in idiopathic erythrocytosis patients with lo w serum erythropoietin levels. Haematologica 92: 1607-1614, 2007. Pestka S, Kotenko SV, Muthukumaran G, Izotova LS, Cook JR, and Garotta G. The interferon gamma (IFN-gamma) receptor: a paradigm for the multichain cytokine receptor. Cytokine Growth Factor Rev 8: 189-206, 1997. Peterson JR, and Golemis EA. Autoinhibited proteins as promising drug targets. J Cell Biochem 93: 68-73, 2004. Pettersen E. F. GTD, Huang C. C., Couch G. S. Greenblatt D. M., Me ng E. C., Ferrin T. E. UCSF Chimera--a visualization system for exploratory research and analysis. J Comput Chem 25: 8, 2004. Phillips JC, Braun R, Wang W, Gumbart J, Tajkhorshid E, V illa E, Chipot C, Skeel RD, Kale L, and Schulten K. Scalabl e molecular dynamics with NAMD. J Comput Chem 26: 1781-1802, 2005. Pich A, Riera L, Sismondi F, Godio L, Davi co Bonino L, Marmont F, and Francia di Celle P. JAK2V617F activating mutation is associated with the myelopro liferative type of chronic myelomonocytic leukaemia. J Clin Pathol 62: 798-801, 2009. Pietra D, Li S, Brisci A, Passamonti F, Rumi E, Theocharides A, Fe rrari M, Gisslinger H, Kralovics R, Cremonesi L, Skoda R, and Ca zzola M. Somatic mutations of JAK2 exon 12 in patients with JAK2 (V617F)negative myeloproliferative disorders. Blood 111: 1686-1689, 2008. Pikman Y, Lee BH, Mercher T, McDowell E, Ebert BL, Gozo M, Cuker A, Wernig G, Moore S, Galinsky I, DeAngelo DJ, Clark JJ, Lee SJ, Golub TR, Wadleigh M, Gilliland DG, and Levine RL. MPLW515L is a novel somatic activating mutation in myelofibrosis with myeloid metaplasia. PLoS Med 3: e270, 2006. Poitras JL, Dal Cin P, Aster JC, Deangelo DJ, and Morton CC. Novel SSBP2-JAK2 fusion gene resulting from a t(5;9)(q14. 1;p24.1) in pre-B acute lymphocytic leukemia. Genes Chromosomes Cancer 47: 884-889, 2008. Poulikakos PI, Zhang C, Bollag G, Shok at KM, and Rosen N. RAF inhibitors transactivate RAF dimers and ERK signalling in cells with wild-type BRAF. Nature 464: 427-430, 2010. Puigdecanet E, Espinet B, Loz ano JJ, Sumoy L, Bellosillo B, Arenillas L, Alvarez-Larrn A, Sol F, Serrano S, Besses C, and Fl orensa L. Gene expression profiling distinguishes JAK2V617F-negative from JAK2 V617F-positive patients in essential thrombocythemia. Leukemia 22: 1368-1376, 2008. 202

PAGE 203

Pyle LE, Barton P, Fujiwara Y, Mitchell A, a nd Fidge N. Secretion of biologically active human proapolipoprot ein A-I in a baculovir us-insect cell system: protection from degradation by protease inhibitors. J Lipid Res 36: 2355-2361, 1995. Quintas-Cardama A, Vaddi K, Liu P, Manshouri T, Li J, Sc herle PA, Caulder E, Wen X, Li Y, Waeltz P, Rupar M, Burn T, Lo Y, Kelley J, Covington M, Shepard S, Rodgers JD, Haley P, Kantarjian H, Frid man JS, and Verstovsek S. Preclinical characterization of the selective J AK1/2 inhibitor INCB018424: therapeutic implications for the treatment of myeloproliferative neoplasms. Blood 115: 31093117, 2010. Rajakulendran T, Sahmi M, Lefrancois M, Sicheri F, and Therrien M. A dimerizationdependent mechanism drives RAF catalytic activation. Nature 461: 542-545, 2009. Reiter A, Walz C, Watmore A, Schoch C, Blau I, Schlegelberge r B, Berger U, Telford N, Aruliah S, Yin JA, Vanstraelen D, Barker HF, Taylor PC, O'Driscoll A, Benedetti F, Rudolph C, Kolb HJ, Hochhaus A, H ehlmann R, Chase A, and Cross NC. The t(8;9)(p22;p24) is a recurrent abnormality in chronic and acute leukemia that fuses PCM1 to JAK2. Cancer Res 65: 2662-2667, 2005. Remacha AF, Nomdedeu JF, Puget G, Estivill C, Sarda MP, Canals C, and Aventin A. Occurrence of the JAK2 V617F mutati on in the WHO provisional entity: myelodysplastic/myeloproliferative diseas e, unclassifiable-refractory anemia with ringed sideroblasts associated with marked thrombocytosis. Haematologica 91: 719-720, 2006. Renneville A, Quesnel B, Charpentier A, Terr iou L, Crinquette A, Lai JL, Cossement C, Lionne-Huyghe P, Rose C, Bauters F, and Preudhomme C. High occurrence of JAK2 V617 mutation in refractory anemia with ringed sideroblasts associated with marked thrombocytosis. Leukemia 20: 2067-2070, 2006. Robertson SA, Koleva RI, Argetsinger LS, Carter-Su C, Marto JA, Feener EP, and Myers MG. Regulation of Jak2 functi on by phosphorylation of Tyr317 and Tyr637 during cytokine signaling. Mol Cell Biol 29: 3367-3378, 2009. Rodig SJ, Meraz MA, White JM, Lampe PA, Riley JK, Arthur CD, King KL, Sheehan KC, Yin L, Pennica D, Johnson EM, and Schrei ber RD. Disruption of the Jak1 gene demonstrates obligatory and nonredundant roles of the Jaks in cytokine-induced biologic responses. Cell 93: 373-383, 1998. Rui L, and Carter-Su C. Identif ication of SH2-bbeta as a potent cytoplasmic activator of the tyrosine kinase Janus kinase 2. Proc Natl Acad Sci U S A 96: 7172-7177, 1999. Russell SM, Tayebi N, Nakajima H, Riedy MC, Roberts JL, Aman MJ, Migone TS, Noguchi M, Markert ML, Buckley RH, O'Shea JJ, and Leonard WJ. Mutation of Jak3 in a patient with SCID: essential role of Jak3 in lymphoid development. Science 270: 797-800, 1995. 203

PAGE 204

Saharinen P, and Silv ennoinen O. The pseudokinase domain is required for suppression of basal activity of Jak2 and Jak3 tyrosine kinases and for cytokineinducible activation of signal transduction. J Biol Chem 277: 47954-47963, 2002. Saharinen P, Takaluoma K, and Silvennoinen O. Regulation of the Jak2 tyrosine kinase by its pseudokinase domain. Mol Cell Biol 20: 3387-3395, 2000. Saharinen P, Vihinen M, and S ilvennoinen O. Autoinhibition of Jak2 tyrosine kinase is dependent on specific regions in its pseudokinase domain. Mol Biol Cell 14: 14481459, 2003. Samanta AK, Chakraborty SN, Wang Y, Sc hlette E, Reddy EP, and Arlinghaus RB. Destabilization of Bcr-Abl/Jak2 Network by a Jak2/Abl Kinase Inhibitor ON044580 Overcomes Drug Resistance in Blast Crisis Chronic Myelogenous Leukemia (CML). Genes Cancer 1: 346-359, 2010. Sandberg EM, and Sayeski PP. Jak2 tyrosine kinase mediates oxidative stress-induced apoptosis in vascular smooth muscle cells. J Biol Chem 279: 34547-34552, 2004. Sandberg EM, Wallace TA, Godeny MD, V onDerLinden D, and Sayeski PP. Jak2 tyrosine kinase: a true jak of all trades? Cell Biochem Biophys 41: 207-232, 2004. Sandberg EM, Ma X, He K, Frank SJ, Ostrov DA, and Sayeski PP. Identification of 1,2,3,4,5,6-hexabromocyclohexane as a small molecule inhi bitor of Jak2 tyrosine kinase autophosphorylation J Med Chem. 48: 2526-33, 2005. Sanz A, Ungureanu D, Pekkala T, Ruijtenbeek R, Touw IP, Hilhorst R, and Silvennoinen O. Analysis of Jak2 catalytic function by peptide microarrays: the role of the JH2 domain and V617F mutation. PLoS One 6: e18522, 2011. Sayyah J, Gnanasambandan K, Kamarajugadda S, Tsuda S, Caldwell-Busby J, and Sayeski PP. Phosphorylation of Y372 is crit ical for Jak2 tyrosine kinase activation. Cell Signal 23: 1806-1815, 2011. Sayyah J, Magis A, Ostrov DA, Allan RW Braylan RC, and Sayeski PP. Z3, a novel Jak2 tyrosine kinase small-molecule in hibitor that suppresses Jak2-mediated pathologic cell growth. Mol Cancer Ther 7: 2308-2318, 2008. Schindler T, Bornmann W, Pellicena P, Miller WT, Clarkson B, and Kuriyan J. Structural mechanism for STI-571 inhibiti on of abelson tyrosine kinase. Science 289: 19381942, 2000. Schnittger S, Bacher U, Haferlach C, Geer T, Muller P, Mittermuller J, Petrides P, Schlag R, Sandner R, Selbac h J, Slawik HR, Tessen HW, Wehmeyer J, Kern W, and Haferlach T. Detection of JAK2 exon 12 mutations in 15 patients with JAK2V617F negative polycythemia vera. Haematologica 94: 414-418, 2009. 204

PAGE 205

Schnittger S, Bacher U, Kern W, Schroder M, Haferlach T, and Schoch C. Report on two novel nucleotide exchanges in t he JAK2 pseudokinase domain: D620E and E627E. Leukem ia 20: 2195-2197, 2006. Scott LM, Tong W, Levine RL, Scott MA, Beer PA, Stratton MR, Futreal PA, Erber WN, McMullin MF, Harrison CN, Warren AJ, Gilliland DG, Lodish HF, and Green AR. JAK2 exon 12 mutations in polycythemia vera and idiopathic erythrocytosis. N Engl J Med 356: 459-468, 2007. Seeliger MA, Young M, Henderson MN, Pellic ena P, King DS, Falick AM, and Kuriyan J. High yield bacterial expression of ac tive c-Abl and c-Src tyrosine kinases. Protein Sci 14: 3135-3139, 2005. Shimoda K, Kato K, Aoki K, Matsuda T, Miyamoto A, Shibamori M, Yamashita M, Numata A, Takase K, Kobayashi S, Sh ibata S, Asano Y, G ondo H, Sekiguchi K, Nakayama K, Nakayama T, Okamura T, Okamura S, and Niho Y. Tyk2 plays a restricted role in IFN alpha signaling, alt hough it is required fo r IL-12-mediated T cell function. Immunity 13: 561-571, 2000. Shuai K, Halpern J, ten Hoeve J, Rao X, and Sawyers CL. Constitutive activation of STAT5 by the BCR-ABL oncogene in chronic myelogenous leukemia. Oncogene 13: 247-254, 1996. Simon AR, Rai U, Fanburg BL, and Cochran BH. Activation of the JAK-STAT pathway by reactive oxygen species. Am J Physiol 275: C1640-1652, 1998. Slack JM, Kuzio J, and Faulkner P. Charac terization of v-cath, a cathepsin L-like proteinase expressed by the baculovirus Autographa calif ornica multiple nuclear polyhedrosis virus. J Gen Virol 76 ( Pt 5): 1091-1098, 1995. Smith CA, and Fan G. The saga of JAK2 mutations and translocations in hematologic disorders: pathogenesis, di agnostic and therapeutic prospects, and revised World Health Organization diagnostic criteria for myeloproliferative neoplasms. Hum Pathol 39: 795-810, 2008. Staerk J, Kallin A, Demoulin JB, Vainch enker W, and Constantinescu SN. JAK1 and Tyk2 activation by the homologous pol ycythemia vera JAK2 V617F mutation: cross-talk with IGF1 receptor. J Biol Chem 280: 41893-41899, 2005. Szpurka H, Tiu R, Murugesan G, Aboudola S, Hsi ED, Theil KS, Sekeres MA, and Maciejewski JP. Refractory anemia with ringed sideroblasts associated with marked thrombocytosis (RARS-T), another myeloproliferative condition characterized by JAK2 V617F mutation. Blood 108: 2173-2181, 2006. Taylor SS, Knighton DR, Zheng J, Ten Eyck LF, and Sowadski JM. Structural framework for the protein kinase family. Annu Rev Cell Biol 8: 429-462, 1992. 205

PAGE 206

Taylor SS, and Kornev AP. Protein kinases: evolution of dynamic regulatory proteins. Trends Biochem Sci 36: 65-77, 2011. Tefferi A. Novel mutations and their functional and clinical relevance in myeloproliferative neoplasms: JAK2, MP L, TET2, ASXL1, CBL, IDH and IKZF1. Leukemia 24: 1128-1138, 2010. Thomis DC, Gurniak CB, Tivol E, Sharpe AH, and Berg LJ. Defects in B lymphocyte maturation and T lymphocyte acti vation in mice lacking Jak3. Science 270: 794797, 1995. Thompson BR, Mazurkiewicz-Muoz AM, Suttl es J, Carter-Su C, and Bernlohr DA. Interaction of adipocyte fa tty acid-binding protein (AFABP) and JAK2: AFABP/aP2 as a regulator of JAK2 signaling. J Biol Chem 284: 13473-13480, 2009. Tirado CA, Chen W, Huang LJ, Laborde C, Hiem enz MC, Valdez F, Ho K, Winick N, Lou Z, and Koduru P. Novel JAK2 rearrangement resulting from a t(9;22)(p24;q11.2) in B-ac ute lymphoblastic leukemia. Leuk Res 34: 1674-1676, 2010. Tono C, Xu G, Toki T, Takahashi Y, Sasa ki S, Terui K, and Ito E. JAK2 Val617Phe activating tyrosine kinase mutation in juvenile myelomonocytic leukemia. Leukemia 19: 1843-1844, 2005. Ungureanu D, Saharinen P, Junttila I, Hilton DJ, and Silvennoinen O. Regulation of Jak2 through the ubiquitin-proteasome pathway involves phosphorylation of Jak2 on Y1007 and interaction with SOCS-1. Mol Cell Biol 22: 3316-3326, 2002. Ungureanu D, Wu J, Pekkala T, Niranjan Y, Young C, Jensen ON, Xu CF, Neubert TA, Skoda RC, Hubbard SR, and Silvennoinen O. The pseudokinase domain of JAK2 is a dual-specificity protein kinase that negatively regulates cytokine signaling. Nat Struct Mol Biol 18: 971-976, 2011. Van Roosbroeck K, Cox L, Tousseyn T, Lahor tiga I, Gielen O, Cauw elier B, De Paepe P, Verhoef G, Marynen P, Vandenberghe P, De Wolf-Peeters C, Cools J, and Wlodarska I. JAK2 rearrangements, including the novel SEC31A-JAK2 fusion, are recurrent in classical Hodgkin lymphoma. Blood 117: 4056-4064, 2011. Vannucchi AM, Antonioli E, Guglielmelli P, Pardanani A, and Tefferi A. Clinical correlates of JAK2V617F presence or allele burden in myeloproliferative neoplasms: a critical reappraisal. Leukemia 22: 1299-1307, 2008. Verstovsek S, Manshouri T, Quintas-Cardam a A, Harris D, Cortes J, Giles FJ, Kantarjian H, Priebe W, and Estrov Z. WP1066, a novel JAK2 inhibitor, suppresses proliferation and induces apoptosis in eryt hroid human cells carrying the JAK2 V617F mutation. Clin Cancer Res 14: 788-796, 2008. 206

PAGE 207

Voortman J, Lee JH, K illian JK, Suuriniemi M, Wang Y, Lucchi M, Sm ith WI, Jr., Meltzer P, and Giaccone G. Array comparative genomic hybridization-based characterization of genetic alterati ons in pulmonary neuroendocrine tumors. Proc Natl Acad Sci U S A 107: 13040-13045, 2010. Wade RC, Henrich S, Salo -Ahen OMH, Huang B, Rippm ann F, and Cruciani G. Computational approaches to identifying and characteri zing protein binding sites for ligand design. Journal of Molecular Recognition 23: 209-219, 2010. Wadleigh M, and Gilliland DG. The JAK2(V617F) tyrosine kinase mutation in myeloproliferative disorder s: Summary of published lit erature and a perspective. Curr Hematol Malig Rep 1: 75-80, 2006. Wadleigh M, and Tefferi A. Preclinical and clinical activity of ATP mimetic JAK2 inhibitors. Clin Adv Hematol Oncol 8: 557-563, 2010. Wallace TA, VonDerLinden D, He K, Frank SJ, and Sayeski PP. Microarray analyses identify JAK2 tyrosine kinase as a key mediator of ligand-independent gene expression. Am J Physiol Cell Physiol 287: C981-991, 2004. Wang Y, Fiskus W, Chong DG, Buckley KM, Nata rajan K, Rao R, Joshi A, Balusu R, Koul S, Chen J, Savoie A, Ustun C, J illella AP, Atadja P, Levine RL, and Bhalla KN. Cotreatment with panobinostat and JAK2 inhibitor TG101209 attenuates JAK2V617F levels and signal ing and exerts synergistic cytotoxic effects against human myeloproliferative neoplastic cells. Blood 114: 5024-5033, 2009. Wernig G, Gonneville JR, Crowley BJ, Rodr igues MS, Reddy MM, Hudon HE, Walz C, Reiter A, Podar K, Royer Y, Const antinescu SN, Tomasson MH, Griffin JD, Gilliland DG, and Sattler M. The Jak2V617F oncogene associated with myeloproliferative diseases requires a functional FERM domai n for transformation and for expression of the Myc and Pim proto-oncogenes. Blood 111: 3751-3759, 2008. Wilks AF, Harpur AG, Kurban RR, Ralph SJ Zrcher G, and Ziemiecki A. Two novel protein-tyrosine kinases, each with a sec ond phosphotransferase-related catalytic domain, define a new class of protein kinase. Mol Cell Biol 11: 2057-2065, 1991. Williams DM, Kim AH, Rogers O, Spivak JL, and Moliterno AR. Phenotypic variations and new mutations in JAK2 V617F-negative polycythemia vera, erythrocytosis, and idiopathic myelofibrosis. Exp Hematol 35: 1641-1646, 2007. Witthuhn BA, Quelle FW, Silvennoinen O, Yi T, Tang B, Miura O, and Ihle JN. JAK2 associates with the eryt hropoietin receptor and is tyrosine phosphorylated and activated following stimulat ion with erythropoietin. Cell 74: 227-236, 1993. Xing S, Wanting TH, Zhao W, Ma J, Wang S, Xu X, Li Q, Fu X, Xu M, and Zhao ZJ. Transgenic expression of JAK2V617F causes myeloproliferative disorders in mice. Blood 111: 5109-5117, 2008. 207

PAGE 208

208 Yoo JH, Park TS, Maeng HY, Sun YK, Kim YA, Kie JH, Cho EH, Song J, Lee KA, Suh B, and Choi JR. JAK2 V617F/C618R mutati on in a patient with polycythemia vera: a case study and review of the literature. Cancer Genet Cytogenet 189: 43-47, 2009. Zhang J, Adrin FJ, Jahnke W, Cowan-Jacob SW Li AG, Iacob RE, Sim T, Powers J, Dierks C, Sun F, Guo GR, Ding Q, Okram B, Choi Y, Wojciechowski A, Deng X, Liu G, Fendrich G, Strauss A, Vajpai N, Gr zesiek S, Tuntland T, Liu Y, Bursulaya B, Azam M, Manley PW, Engen JR, Daley GQ, Warmuth M, and Gray NS. Targeting Bcr-Abl by combining alloster ic with ATP-binding-site inhibitors. Nature 463: 501-506, 2010. Zhang J, Yang PL, and Gray NS. Targeting cancer with small molecule kinase inhibitors. Nat Rev Cancer 9: 28-39, 2009. Zhang L, and Hermans J. Hydrophilici ty of cavities in proteins. Proteins 24: 433-438, 1996. Zhang SJ, Li JY, Li WD, Song JH, Xu W, and Qiu HX. The investigation of JAK2 mutation in Chinese myeloproliferative di seases-identification of a novel C616Y point mutation in a PV patient. Int J Lab Hematol 29: 71-72, 2007. Zhao L, Dong H, Zhang CC, Kinch L, Osawa M, Iacovino M, Grishin NV, Kyba M, and Huang LJ. A JAK2 interdomain linker re lays Epo receptor engagement signals to kinase activation. J Biol Chem 284: 26988-26998, 2009. Zhao L, Ma Y, Seemann J, and Huang LJ. A r egulating role of the JAK2 FERM domain in hyperactivation of JAK2(V617F). Biochem J 426: 91-98, 2010. Zhao R, Xing S, Li Z, Fu X, Li Q, Krantz SB, and Zhao ZJ. Identification of an acquired JAK2 mutation in polycythemia vera. J Biol Chem 280: 22788-22792, 2005. Zhou YJ, Chen M, Cusack NA, Kimmel LH, M agnuson KS, Boyd JG, Lin W, Roberts JL, Lengi A, Buckley RH, Geahlen RL, Cando tti F, Gadina M, Changelian PS, and O'Shea JJ. Unexpected effects of FERM dom ain mutations on catalytic activity of Jak3: structural implication for Janus kinases. Mol Cell 8: 959-969, 2001. Zou H, Yan D, and Mohi G. Differential biologic al activity of disease-associated JAK2 mutants. FEBS Lett 585: 1007-1013, 2011.

PAGE 209

BIOGRAPHICAL SKETCH Kavitha Gnanasambandan was born and brought up in the metropolitan city of Chennai, which is located in southern India. She was very studious and curious as a child, who was interested in mathematics and physical sciences during her school days. When it was time to choose a career path fo r real, she decided to explore the field of biotechnology. She pursued her undergraduate studies in bi otechnology at the PSG College of Technology in Coimbatore, India. It was here that she found a cure for her curiosity when she was solving problems in Mendelian inheritanc e and enzyme kinetics under the guidance of some excellent teacher s. Having learnt the fundamentals of biotechnology, she came to t he University of Florida in 2007 to pursue her doctoral studies in biomedical sciences. She joined the laboratory of Dr. Peter Sayeski in the summer of 2008 to study the molecular mechani sm of Jak2 constitutive activation in hematological malignancies. Here, she interpre ted the structure-function correlation of the mutations that cause Jak2 constitutive activation and paved way for the use of this information in drug development. She received her Ph.D. in December 2011. 209