<%BANNER%>

The Evolution of Endocrine Extraembryonic Membranes; A Comparative Study of Steroidogenesis and Steroid Signaling in the...

Permanent Link: http://ufdc.ufl.edu/UFE0043562/00001

Material Information

Title: The Evolution of Endocrine Extraembryonic Membranes; A Comparative Study of Steroidogenesis and Steroid Signaling in the Chorioallantoic Membrane of Oviparous Amniotes
Physical Description: 1 online resource (181 p.)
Language: english
Creator: Albergotti, Lori C
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: amniote -- endocrine -- evolution -- extraembryonic -- membrane -- oviparous
Biology -- Dissertations, Academic -- UF
Genre: Zoology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: During development, all amniotes (mammals, reptiles, and birds) form extraembryonic membranes, which regulate gas and water exchange, remove metabolic wastes, provide shock absorption, and transfer maternally derived nutrients. In viviparous (live-bearing) amniotes, both extraembryonic membranes and maternal uterine tissues contribute to the placenta, an endocrine organ that synthesizes, transports, and metabolizes hormones essential for development. Historically, endocrine properties of the placenta have been viewed as an innovation of placental amniotes. However, an endocrine role of extraembryonic membranes has not been investigated in oviparous (egg-laying) amniotes despite similarities in their basic structure, function, and shared evolutionary ancestry. To begin addressing this question, I examined steroidogenesis and steroid hormone signaling capability in the chorioallantoic membrane (CAM) of the domestic chicken (Gallus gallus), the American alligator (Alligator mississippiensis) and the Florida red-belly slider turtle (Pseudemys nelsoni), representing three lineages of the amniote phylogeny that reproduce strictly by oviparity. To investigate steroidogenesis, I examined mRNA expression of key steroidogenic enzymes involved in the biosynthesis of steroid hormones by real-time quantitative PCR. Further, I examined the CAMs capability to synthesize progesterone in vitro in the presence of a steroid precursor by explant culture and radioimmunoassay. To investigate steroid hormone signaling, I quantified mRNA expression of steroid receptors and confirmed protein expression of two steroid receptors; the progesterone and estrogen receptor by immunohistochemistry. Collectively, the data presented here indicates that the oviparous CAM is steroidogenic and has steroid hormone signaling capability. These findings represent a paradigm shift in evolutionary reproductive biology by suggesting that endocrine activity of extraembryonic membranes is not a novel characteristic of placental amniotes. Rather, we hypothesize that endocrine activity of extraembryonic membranes is an evolutionarily conserved characteristic of amniotes. If steroidogenesis and steroid signaling in extraembryonic membranes is conserved, this would then suggest that the endocrine role of the amniote placenta likely evolved initially in an oviparous ancestor and offers a new hypothesis for the evolution of the placenta as an endocrine organ. Despite numerous studies demonstrating the presence of endocrine disrupting contaminants in the reptilian and avian CAM, extraembryonic membranes have not been established as targets of endocrine disruption. In an attempt to better understand the regulation of steroid activity in and the impact of environmental contaminants on these tissues; mRNA expression of steroid receptors and steroidogenic enzymes in the alligator CAM was examined following estrogenic exposure. I observed a change in steroid receptor mRNA expression following exposure to the naturally occurring estrogen, 17ß-estradiol. This suggests that xenoestrogens could interfere with embryonic development through the steroidogenic pathway of the CAM itself; however, more work is needed to better understand the biological impact of environmental contaminants on these tissues.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Lori C Albergotti.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Guillette, Louis J.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043562:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043562/00001

Material Information

Title: The Evolution of Endocrine Extraembryonic Membranes; A Comparative Study of Steroidogenesis and Steroid Signaling in the Chorioallantoic Membrane of Oviparous Amniotes
Physical Description: 1 online resource (181 p.)
Language: english
Creator: Albergotti, Lori C
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: amniote -- endocrine -- evolution -- extraembryonic -- membrane -- oviparous
Biology -- Dissertations, Academic -- UF
Genre: Zoology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: During development, all amniotes (mammals, reptiles, and birds) form extraembryonic membranes, which regulate gas and water exchange, remove metabolic wastes, provide shock absorption, and transfer maternally derived nutrients. In viviparous (live-bearing) amniotes, both extraembryonic membranes and maternal uterine tissues contribute to the placenta, an endocrine organ that synthesizes, transports, and metabolizes hormones essential for development. Historically, endocrine properties of the placenta have been viewed as an innovation of placental amniotes. However, an endocrine role of extraembryonic membranes has not been investigated in oviparous (egg-laying) amniotes despite similarities in their basic structure, function, and shared evolutionary ancestry. To begin addressing this question, I examined steroidogenesis and steroid hormone signaling capability in the chorioallantoic membrane (CAM) of the domestic chicken (Gallus gallus), the American alligator (Alligator mississippiensis) and the Florida red-belly slider turtle (Pseudemys nelsoni), representing three lineages of the amniote phylogeny that reproduce strictly by oviparity. To investigate steroidogenesis, I examined mRNA expression of key steroidogenic enzymes involved in the biosynthesis of steroid hormones by real-time quantitative PCR. Further, I examined the CAMs capability to synthesize progesterone in vitro in the presence of a steroid precursor by explant culture and radioimmunoassay. To investigate steroid hormone signaling, I quantified mRNA expression of steroid receptors and confirmed protein expression of two steroid receptors; the progesterone and estrogen receptor by immunohistochemistry. Collectively, the data presented here indicates that the oviparous CAM is steroidogenic and has steroid hormone signaling capability. These findings represent a paradigm shift in evolutionary reproductive biology by suggesting that endocrine activity of extraembryonic membranes is not a novel characteristic of placental amniotes. Rather, we hypothesize that endocrine activity of extraembryonic membranes is an evolutionarily conserved characteristic of amniotes. If steroidogenesis and steroid signaling in extraembryonic membranes is conserved, this would then suggest that the endocrine role of the amniote placenta likely evolved initially in an oviparous ancestor and offers a new hypothesis for the evolution of the placenta as an endocrine organ. Despite numerous studies demonstrating the presence of endocrine disrupting contaminants in the reptilian and avian CAM, extraembryonic membranes have not been established as targets of endocrine disruption. In an attempt to better understand the regulation of steroid activity in and the impact of environmental contaminants on these tissues; mRNA expression of steroid receptors and steroidogenic enzymes in the alligator CAM was examined following estrogenic exposure. I observed a change in steroid receptor mRNA expression following exposure to the naturally occurring estrogen, 17ß-estradiol. This suggests that xenoestrogens could interfere with embryonic development through the steroidogenic pathway of the CAM itself; however, more work is needed to better understand the biological impact of environmental contaminants on these tissues.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Lori C Albergotti.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Guillette, Louis J.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043562:00001


This item has the following downloads:


Full Text

PAGE 1

1 THE EVOLUTION OF ENDOCRINE EXTRAEMBRYONIC MEMBRANES; A COMPARATIVE STUDY OF STEROIDOGENESIS AND STEROID SIGNALING IN THE CHORIOALLANTOIC MEMBRANE OF OVIPAROUS AMNIOTES By LORI CRUZE ALBERGOTTI A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Lori Cruze Albergotti

PAGE 3

3 Ken I will be forever grateful for your love and support

PAGE 4

4 ACKNOWLEDGMENTS First, I would like to thank Lou Guillette for his generous financial, technical and emotional support. Lou has taught me that being a scientist is the opportunity to be a detective in pursuit of answers to an intriguing question, and this pursuit requires not only an analytical mind, but also a creative one. I thank Lou for giving me this opportunity and for his endless guidance and encouragement, and last but not least for his friendship. I could not have asked for a better graduate experience and I am convinced that this has everything to do with having Lou as an advisor and Bernie, Colette, Marty and Malcolm as committee members. I would like to thank Bernie for pushing me outside of my comfort zone, for encouraging me to think broadly about my research, and for his willingness to provide lab assistance. Thank you to Colette for lending statistical and experimental design expertise, for pushing me to think about the big picture of my research, and for alwa ys believing in me. I would like to thank Marty for expanding my understanding of evolution and development, for allowing me the amazing opportunity to teach with him, and for making his lab available to me. Thank you to Malcolm for his expertise in develo pmental signaling, for his constant enthusiasm, and for his willingness to the take time to hear how things are going and offer words of encouragement. I would also like to thank the Department of Biology for providing a wonderful academic home for the las t five years. I would like to thank the Biology faculty in general for being excellent academic role models and in particular I would like to thank Rebecca Kimball, Ed Braun, Charlie Baer, Marta Wayne and Dave Evans for taking an interest in me, offering g uidance and assistance, and for helping me become a better scientist. I would also like to thank Keith Choe for the generous use of his microscope and camera

PAGE 5

5 Thank you to my lab mates, colleagues and friends from whom I have learned so much. Thanks to Sat omi Kohno and Brandon Moore for teaching me molecular biology, for providing technical advice, and for helping me hit the ground running. Thank you to Thea Edwards and Alison Roark for sharing my interest in the placenta and extraembryonic membranes and fo r the countless hours of conversation that helped to define my ideas about the evolution of these structures. Thank you to Heather Hamlin for her assistance with tissue culture and hormone techniques, for her boundless energy and amazing spirit. Thank you to Krista McCoy, Leslie Babonis, Kelly Hyndman, and Marda Jorgensen for providing histology, immunohistochemistry and microscopy training and advice. Thank you to Mike McCoy for providing statistical expertise and support and for pushing me to think outsid e the box about data analysis. Thank you to Ashley Boggs and Nicole Botteri for sharing this experience with me and for their continuous support and friendship. Thanks to the wonderful undergraduate students that I have had the pleasure to mentor and witho ut whose toiling hours in the lab this work would have been incredibly difficult; Chris Olmo, Yao Fu, Sasha Strul, Jacob Fyda, Shellah Palmer, Jenna Harty, Momna Younas, Gabrielle Rolland, and Patpilai Kasinpila. I would also like to thank the Florida Fish and Wildlife Conservation Commission for their assistance in the collection of alligator and turtle eggs. Finally, I would like to thank my mom and dad for their love and encouragement. A special thanks to all of my friends, but especially Chip, Michelle Jon, Christine, Stephanie and the EC, for keeping me sane these last few years I thank my wonderful husband for making me laugh every day, for reminding me that life is a balance and for his willingness to join in this adventure with me.

PAGE 6

6 TABLE OF CONTE NTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 16 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 19 The Evolution of Viviparity ................................ ................................ ...................... 20 Egg Retention and the Lengthening of Gestation ................................ ............. 21 The Reduction of the Eggshell ................................ ................................ ......... 24 Th e Emergence of the Placenta ................................ ................................ ....... 27 An Endocrine Placenta ................................ ................................ ........................... 30 A New Hypothesis for the Evolution of Endocrine Extraembryonic Membranes and the Placenta: Implications for the Evolution of Viviparity ............................... 32 Specific Hypotheses ................................ ................................ ............................... 33 Significance of Work ................................ ................................ ............................... 34 2 STEROIDOGENESIS AND STEROID SIGNALING IN THE CHORIOALLANTOIC MEMBRANE OF THE CHICKEN ( GALLUS GALLUS ) ........ 37 Materials and Methods ................................ ................................ ............................ 39 CAM Collection ................................ ................................ ................................ 39 RNA Isolation and Reverse Transcription ................................ ......................... 39 Real time Quantitative Polymerase Chain Reaction (RT qPCR) ...................... 39 Cloning and Sequencing of Plasmids ................................ ............................... 41 RT qPCR Primers ................................ ................................ ............................ 41 Sexing of Embryos ................................ ................................ ........................... 41 In Vitro Explant Culture ................................ ................................ .................... 42 Immunohistochemistry and Microscopy ................................ ............................ 42 Statistical Analysis ................................ ................................ ............................ 43 Results ................................ ................................ ................................ .................... 45 The Chicken CAM has the Required Molecular Mechanisms to Perform Steroidogenesis and Synthesis of Progesterone ................................ ........... 45 The Chicken CAM is Capable of In Vitro Progesterone Synthesis ................... 46 The Chicken CAM is Capable of Responding to P4 Signaling Through the Progesterone Receptor ................................ ................................ ................. 47

PAGE 7

7 Discussi on ................................ ................................ ................................ .............. 49 3 THE CHORIOALLANTOIC MEMBRANE OF THE AMERICAN ALLIGATOR ( ALLIGATOR MISSISSIPPIENSIS ) HAS THE CAPABILITY TO PERFORM STEROID BIOSYNTHESIS AND RESPOND TO STEROID HORMONE SIGNALING ................................ ................................ ................................ ............ 56 Materials and Methods ................................ ................................ ............................ 60 Egg Collection and Sample Preparation ................................ ........................... 60 RNA Isolation and Reverse Transcription ................................ ......................... 61 Real time Quantitative Polymerase Chain Reaction (RT qPCR) ...................... 61 RT qPCR Normalization ................................ ................................ ................... 62 Cloning and Sequencing of Plasmids ................................ ............................... 63 Immunohistochemistry and Microscopy ................................ ............................ 63 Statistical Analysis ................................ ................................ ............................ 64 Results ................................ ................................ ................................ .................... 66 Internal Control Expression among Embryonic Stages and between Incubation Temperatures ................................ ................................ .............. 66 Steroidogenic Factor, Enzyme and Steroid Receptor Expression among Embryonic Stages ................................ ................................ ......................... 67 Steroidogenic Factor, Enzyme and Steroid Receptor Expression between Incubation Temperatures ................................ ................................ .............. 68 PR and ESR1 Immunolocalization ................................ ................................ ... 69 Discussion ................................ ................................ ................................ .............. 69 4 T HE OVIPAROUS CHORIOALLANTOIC MEMBRANE OF THE RED BELLY SLIDER TURTLE ( PSEUDEMYS NELSONI ) HAS THE CAPABILITY TO SYNTHESIZE PROGESTERONE AND RESPOND TO STEROID HORMONE SIGNALING ................................ ................................ ................................ ............ 94 Materials and Methods ................................ ................................ ............................ 97 Egg Collection ................................ ................................ ................................ .. 97 RNA Isolation and Reverse Transcription ................................ ......................... 98 Real time Quantitative Polymerase Chain Reaction (RT qPCR) ...................... 98 Cloning and Sequencing of Plasmids ................................ ............................... 99 RT qPCR Primers ................................ ................................ .......................... 100 In Vitro Explant Culture ................................ ................................ .................. 100 Histol ogy, Immunohistochemistry and Microscopy ................................ ......... 101 Statistical Analysis ................................ ................................ .......................... 102 Results ................................ ................................ ................................ .................. 103 The Turtle CAM is Capable of In Vitro Progesterone Synthesis ..................... 103 The Turtle CAM is Capable of Responding to Steroid Hormone Signaling .... 103 Discussion ................................ ................................ ................................ ............ 104 5 E STROGENIC EXPOSURE AFFECTS CHORIOALLANTOIC MEMBRANE GENE EXPRESSION AND TIMING OF HATCH IN THE AMERICAN ALLIGATOR ( ALLIGATOR MISSISSIPPIENSIS ) ................................ ................. 120

PAGE 8

8 Materials and Methods ................................ ................................ .......................... 125 Egg Collection ................................ ................................ ................................ 125 In Ovo Exposure ................................ ................................ ............................. 125 CAM Collection, RNA Isolation, Reverse Transcription and Real time Quantitative Polymerase Chain Reaction (RT qPCR) ................................ 126 Hatch Data ................................ ................................ ................................ ..... 127 Statistical Analysis ................................ ................................ .......................... 127 Results ................................ ................................ ................................ .................. 128 Steroid Receptor and Ste roidogenic Enzyme Expression in the CAM Following Estrogenic Exposure ................................ ................................ ... 128 The Effect of Estrogenic Exposure on Timing of Hatch ................................ .. 128 Hatchling Body Morphometrics Following Estrogenic Exposure ..................... 129 Discussion ................................ ................................ ................................ ............ 129 6 SUMMARY, CONCLUSIO NS AND FUTURE DIRECTIONS ................................ 146 Summary and Conclusions ................................ ................................ ................... 146 Future Directions ................................ ................................ ................................ .. 150 LIST OF REFERENCES ................................ ................................ ............................. 154 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 179

PAGE 9

9 LIST OF TABLES Table page 2 1 Chicken PCR primers used for RT Quantitative real time PCR .......................... 51 3 1 Alligator PCR primers used for RT Quantitative real time PCR .......................... 80 3 2 Statistic summary of RT Quantitative real time PCR on the alligator CAM at three embryonic stages ................................ ................................ ...................... 81 3 3 Statistic summary of RT Quantitative real time PCR on the alligator CAM at two incubation temperatures ................................ ................................ ............... 82 4 1 Turtle PCR primers used for RT Quantitative real time PCR ........................... 113 5 1 Alligator PCR primers used for RT Quantitative real time PCR ........................ 137 5 2 Statistic summary of RT Quantitative real time PCR on the alligator CAM at four time periods post exposure ................................ ................................ ....... 138

PAGE 10

10 LIST OF FIGURES Figure page 1 1 The extraembryonic membranes of ovi parous and viviparous squamates ......... 35 1 2 General overview of t he steroid hormone biosynthetic pathway ......................... 36 2 1 A simplified version of steroid biosynthesis highlighting the specific ste roidogenic enzymes investigated ................................ ................................ ... 52 2 2 Relative mRNA expression of steroidogenic enzymes in the chick CAM. .......... 53 2 3 Progeste rone synthesis in the chick CAM ................................ .......................... 54 2 4 PR and ESR1 mRNA expression and PR immunolocalization in the chick CAM ................................ ................................ ................................ ................... 55 3 1 mRNA expression of internal control genes in alligator CAM ............................. 83 3 2 Relative mRNA expression of steroidogenic factor and enzymes in the all igator CAM incubated at the FPT ................................ ................................ .... 84 3 3 Relative mRNA expression of steroidogenic factor and enzymes in the al ligator CAM incubated at the MPT ................................ ................................ ... 85 3 4 Relative mRNA expression of steroid receptors in the all igator CAM incubated at the FPT ................................ ................................ .......................... 87 3 5 Relative mRNA expression of steroid receptors in the all igator CAM incubated at the MPT ................................ ................................ ......................... 89 3 6 Relative mRNA expression of NR5A1, HSD3B1, PR, and ESR2 in the alligator CAM between incubation temperatures at embryonic stage 19 ............ 90 3 7 Relative mRNA expression of GR and ESR1 in the alligator CAM between incubation temperatures at embryonic stage 23 ................................ ................. 91 3 8 PR immunolo calization in the alligator CAM ................................ ....................... 92 3 9 ESR1 immunolocalization in the alligator CAM ................................ ................... 93 4 1 Progesterone synthesis in the turtle CAM ................................ ........................ 114 4 2 Relative mRNA expression of steroid receptors in the turtle CAM .................... 115 4 3 Histology and immunolocalization of PR in turtle CAM ................................ ..... 116

PAGE 11

11 4 4 Amniote reproductive modes and evidence of steroid hormone synthesis and/or steroid signaling in extraembryonic membranes and placentae ............ 117 4 5 A simplified version of progesterone biosynthesis ................................ ............ 118 4 6 Model for the evolution of endocrine function in the amniote yolk sac (YSM) and chorioallantoic membrane (CAM) ................................ .............................. 119 5 1 Relative mRNA expression of ESR1 in the CAM following estrogenic exposure ................................ ................................ ................................ ........... 139 5 2 Relative mRNA expression of ESR2 in the CAM following estrogenic exposure ................................ ................................ ................................ ........... 140 5 3 Relative mRNA expression of PR in the CA M following estrogenic exposure .. 141 5 4 Relative mRNA expression of CYP19A1 in the CAM following estrogenic exposure ................................ ................................ ................................ ........... 142 5 5 Relative mRNA expression of HSD3B1 in the CAM following estrogenic exposure ................................ ................................ ................................ ........... 143 5 6 The effect of estroge nic exposure on timing of hatch ................................ ....... 144 5 7 The effect of estr ogenic exposure on hatchling body morphometrics ............... 145 6 1 Evidence of endocrine extraembryonic membranes in amniotes ...................... 153

PAGE 12

12 LIST OF ABBREVIATION S A Androstenedione. An androgenic steroid that can act as a precursor in the synthesis of both estrogens and androgens. ACTB Actin, b eta. A highly conserved cytoskeletal protein that is commonly used as an internal control gene in mRNA expression studies. AR Androgen receptor. A nuclear steroid receptor that is activated by binding of androgens. CAM Chorioallantoic membrane. An extraemb ryonic membrane composed of chorion and allantois. cDNA Complimentary DNA. DNA that is complementary to a certain sequence of messenger RNA template. CL Corpus luteum. A transitory endocrine organ formed from the post ovulatory follicle. CORT Corticostero ne. One of the glucocorticoid hormones. CYP11A1 Cytochrome P450 11A 1, also called cytochrome side chain cleaving enzyme Steroidogenic enzyme that converts cholesterol to pregnenolone. CYP17A1 Cytochrome P450, family 17, subfamily A, polypeptide 1 also hydroxylase Steroidogenic enzyme that is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. CYP19 A1 C ytochrome P450, family 19, subfamily A, polypeptide 1, also cal led aromatase. Steroidogenic enzyme that convert s a ndrostenedione or testosterone respectively DNA Deoxyribonucleic acid. The genetic code required by all life to develop and function. dNTPs Deoxyribonucleotide triphosphate. G eneric term referring to the four deoxyribonucleotides: dATP, dCTP, dGTP and dTTP. EDC Endocrine disrupting contaminant. A natural or man made substance that has the ability to alter the synthesis, transport, regulation, or clearance of hormones. E2 Estrad iol

PAGE 13

13 ERS1 Estrogen receptor 1 also named Estrogen receptor alpha. A nuclear receptor which is activated by the binding of estrogens. ESR2 Estrogen receptor 2 also named Estrogen receptor beta. A nuclear receptor which is ac tivated by the binding of estrogens. FPT Female producing temperature. The incubation temperature that results in the development of female gonads in species with environmental sex determination. GAPDH Glyceraldehyde 3 phosphate dehydrogenase. An enzyme in volved in glycolysis that is commonly used as an internal control gene in mRNA expression studies. geNORM Geometric mean normalization. A lgorithm used to determine the most stable internal control (housekeeping) genes from a set of tested candidate reference genes in a given sample panel. GR Glucocorticoid receptor. A nuclear receptor which is activated by the binding of glucocorticoids. HSD3B1 Hydroxy delta 5 steroid dehydrogenase, 3 beta and steroid delta isomerase 1 hydroxysteroid dehydrogenase A steroidogenic enzyme which converts pregnenolone to progesterone. HSD17B1 Hydroxysteroid (17 beta) dehydrogenase 1. A steroidogenic enzyme involved in the interconversion of weaker and stronger estrogens and androgens. LMMs Linear mixed e ffects models. A statistical approach that contains experimental factors of both fixed and random effects types. M P T Male producing temperature. The incubation temperature that results in the development of male gonads in species with environmental sex det ermination. mRNA Messenger ribonucleic acid. A type of RNA that is transcribed from DNA in the synthesis of protein. NF Normalization factor. A value calculated by geNORM and assigned to each RT qPCR sample to correct for potential differences in RNA quali ty or quantity. NR5A1 Nuclear receptor 5A1, also named steroidogenic factor 1. A transcription factor that regulates genes involved in steroid biosynthesis.

PAGE 14

14 P4 Progesterone. A steroid hormone synthesized from pregnenolone, which plays a critical role in pr egnancy. P5 Pregnenolone. A steroid hormone involved in the steroidogenesis of progesterone, mineralocorticoids, glucocorticoids, androgens, and estrogens. POLR2E RNA polymerase II polypeptide E. A n enzyme that catalyzes the transcription of DNA in order t o synthesize precursors of RNAs. PR Progesterone receptor. A nuclear receptor which is activated by the binding of progestins. PCR Polymerase chain reaction. A molecular technique used to amplify a section of DNA or cDNA. RPS13 Ribosomal protein S13. O ne of the many proteins belonging to the small subunit of the ribosome that is commonly used as an internal control gene in mRNA expression studies RNA Ribonucleic acid. A nucleic acid that is present in all living cells. RN18S1 18S ribosomal. The small ribo somal unit of RNA that is commonly used as an internal control gene in mRNA expression studies. RPL8 Ribosomal protein L8. A r ibosomal protein that is a component of the 60S subunit of RNA that is commonly used as an internal control gene in mRNA expressio n studies. RT qPCR Real time quantitative polymerase chain reaction. A molecular technique for the quantification of an amplified PCR product based on incorporation of a fluorescent reporter dye T he fluorescent signal increases in p roportion to the amount of PCR product produced and is monitored at each cycle, such that the time point at which the first significant increase in the amount of PCR product correlates with the initial amount of target template. StAR Steroidogenic acute regulatory protein. A tra nsport protein that regulates cholesterol transfer from the outer to inner mitochondria membrane. T Testosterone. An androgen steroid hormone. TSP Thermo sensitive period. The period of embryonic development when the developing gonad is sensitive to the ef fects of incubation temperature.

PAGE 15

15 TSD Temperature sex determination. A type of environmental sex determination where incubation temperature during development determines the sex of the embryo. HSD 11 hydroxysteroid dehydrogenase. Two enzymes (type 1 an d 2) associated with the interconversion of cortisol and cortisone.

PAGE 16

16 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy T HE EVOLUTION OF ENDOCRINE EXTRAEMBRYONIC MEMBRANES; A COMPARATIVE STUDY OF STEROIDOGENESIS AND STEROID SIGNALING IN THE CHORIOALLANTOIC MEMBRANE OF OVIPAROUS AMNIOTES By Lori Cruze Albergotti December 2011 Chair: Louis J. Guillette, Jr. Major: Zoology During development, all amniotes (mammals, reptiles, and birds) form extraembryonic membranes, which regulate gas and water exchange, remove metabolic wastes, provide shock absorption, and transfer maternally derived nutrients. In viviparous (live bearing ) amniotes, both extraembryonic membranes and maternal uterine tissues contribute to the placenta, an endocrine organ that synthesizes, transports, and metabolizes hormones essential for development. Historically, endocrine properties of the placenta have been viewed as an innovation of placental amniotes. However, an endocrine role of extraembryonic membranes has not been investigated in oviparous (egg laying) amniotes despite similarities in their basic structure, function, and shared evolutionary ancestr y To begin addressing this question, I examined steroidogenesis and steroid hormone signaling capability in the chorioallantoic membrane (CAM) of the domestic chicken ( Gallus gallus ), the American alligator ( Alligator mississippiensis ) and the Florida r ed belly slider turtle ( Pseudemys nelsoni ) representing three lineages of the amniote phylogeny that reproduce strictly by oviparity To investigate steroidogenesis, I

PAGE 17

17 examined mRNA expression of key steroidogenic enzymes involved in the biosynthesis of steroid hormones by real time quantitative PCR. Further, I examined the CAMs capability to synthesize progesterone in vitro in the presence of a steroid precursor by expl ant culture and radioimmunoassay. To investigate steroid hormone signaling, I quantified mRNA expression of steroid receptors and confirmed protein expression of two steroid receptors; the progesterone and estrogen receptor by immunohistochemistry. Colle ctively, the data presented here indicate s that the oviparous CAM is steroidogenic and has steroid hormone signaling capability. These findings represent a paradigm shift in evolutionary reproductive biology by suggesting that endocrine activity of extraem bryonic membranes is not a novel characteristic of placental amniotes. Rather we hypothesize that endocrine activity of extraembryonic membranes is an evolutionarily conserved characteristic of amniotes If steroidogenesis and steroid signaling in extraem bryonic membranes is conserved, this would then suggest that the endocrine role of the amniote placenta likely evolved initially in an oviparous ancestor and offers a new hypothesis for the evolution of the placenta as an endocrine organ. Despite numerous studies demonstrating the presence of endocrine disrupting contaminants in the reptilian and avian CAM, extraembryonic membranes have not been established as targets of endocrine disruption. In an attempt t o better understand the regulation of steroid act ivity in and the impact of environmental contaminants o n these tissues ; mRNA expression of steroid receptors and steroidogenic enzymes in the alligator CAM was examined following estrogenic exposure. I observed a change in steroid receptor mRNA expression following e xposure to the naturally occurring

PAGE 18

18 estradiol. This suggest s that xenoestrogens could interfer e with embryonic development through the steroidogenic pathway of the CAM itself; however, more work is needed to better understand the bi ological impact of environmental contaminants on these tissues.

PAGE 19

19 CHAPTER 1 INTRODUCTION 1 Since ancient Greece, philosopher biologists have described similarities and differences in the structures, which support the developing embryo, between oviparous (egg laying) and viviparous (live bearing) animals [ 1 2 ] Aristotle, in his treatise, De generatione animalium ( On the generation of animals), proposed that fetal nutrition in viviparous mammals was accomplished by a connection between the fetal and maternal circulatory systems via the circulatory system of the embryo w as also connected via umbilical cords to two membranes; one that surrounded the yolk, and one that lined the inner surface of the eggshell. He suggested that th e first membrane delivered nutrients from the yolk for embryonic development, and in comparing viviparous and oviparous animals suggested plant, for it receives it s first growth and nourishment by being attached to something membrane, the sanguineous one, i [ 2 ] Subsequently, generations of researchers have dedicated th eir careers to the study of extraembryonic membranes and the placenta. While studies focused primarily on the extraembryonic membranes of mammals and the chick until the 19 th century, we now have an increasing number of descriptions of piscine (reviewed in [ 3 ] ) and 1 A significant part of this chapter is published, see Albergotti L, C., Guillette LJ, Jr. Viviparity in reptiles: evolution and endocrine physiology. In: Norris DO, Lopez KH (eds.), Hormones and reproduction in vertebrates, vol. 3: Elsevier; 2011: 247 275.

PAGE 20

20 squamate (lizard and snakes) placentae and extraembryonic membranes (reviewed in [ 4 ] A web of science search reveals that nearly 1 8,000 scientific papers have been published on the placenta or extraembryonic membranes from 1900 to present and that does not take into account the e arly works of the pioneers in this field. Yet, even with the staggering amount of research conducted to date there still remain many unanswered questions about the physiology and evolution of extraembryonic membranes and the placenta [ 1 ] My primary interest concerns the physiology and more specifically the endocrinology of extraembryonic membranes and the evolution of endocrine signals in these tissues. Prior to the early 1900s, the placenta was considered to function as an organ of protection, nutrient transfer, gas exchange and waste removal. An endocrine role for the placenta was first proposed by Joseph Halban in 1905 [ 5 ] and when Egon Diczfalusy (1955) went on to suggest that the metabolism (and p ossibly production) of placental [ 6 ] The amazing foresight shown by these early researchers has led not only to a greater understanding of the endocrinology of mammalian pregnancy, but also has led researchers to ask comparative questions about the endocrinology of gestation in nonmammalian viviparous vertebrates. The Evolution of Viviparity It is currently estimated that viviparity has evolved independently over 100 times within squamate reptile s [ 7 ] This transition in reproductive mode from oviparity to viviparity has occurred more frequently in squamates [ 8 ] than in any other vertebrate lineage including fishes [ 9 10 ] amphibians [ 11 12 ] and mammals [ 13 ] This high frequency of occurrence in squamates coupled with a complete absence of viviparity in

PAGE 21

21 other reptiles [ 7 ] has made the study of squamate viviparity intriguing for more than a century. In order for reptilian viviparity to evolve, viviparous species must overcome three major morphological and/or physiological modifications. First, egg retention time must be increased so that the embryo completes development in utero Second, eggshell thic kness must be decreased to reduce the physical barrier between embryonic and maternal environments so that, at the least, gas and water can effectively be exchanged Third, a placenta must develop to facilitate maternal and embryonic exchange [ 14 ] Due to the diversity of viviparous squamates and the number of proposed independent origins, these processes could have been achieved through different mechanisms, but then again limited by physiological and morphological constraints. H ere, I provide a brief overview of some of the work that has shaped our understanding of these modifica tions associated with the evolution of viviparity with a focus on the evolution of the placenta. In addition, I will present a new hypothesis for the evolution of endocrine extraembryonic membranes, including the placenta, of amniotes (mammals, reptiles in cluding birds). Egg Retention and the Lengthening of Gestation By definition, viviparity requires that the time of egg retention is increased so that the embryo completes development in utero. In order to understand the lengthening of gestation in squamat es, we must understand the physiology of pregnancy and thus, first turn our attention to the corpus luteum and its possible role in egg retention. In all vertebrates, the corpus luteum (CL) is a transitory endocrine organ formed from the post ovulatory fo granulosa and thecal cell layers undergo luteinization, which involves changes in

PAGE 22

22 vascularization, hypertrophy, and the accumulation of lipids [ 15 ] The CL functions in the secretion of hormones for some predetermined time period before degenerating (luteolysis). The natural lifespan of the CL varies in vertebrates, but is short l ived in most mammalian species unless implantation occurs. If implantation is successful, the maternal recognition of pregnancy [ 15 16 ] In placental mammals, the maternal recognition of pregnancy is defined as the prevention of luteolysis by biochemical signals of embryonic origin [ 17 ] which vary in mammals. Depending on the species, maternal recognition of pregnancy can be provided by a number of embryonic factors, such as chorionic gonadotropins, interferons, steroids, and peptide hormones [ 17 ] The endocrine properties of the CL are most often associated with the secretion of progesterone (P4) in non mammalian vertebrates [ 18 21 ] but the CL has also been shown to secrete other steroid and peptide hormones in eutherian mammals and viviparous squamate s [ 22 24 ] In eutherians, P4 is associated with uterine quiescence and as such P4 secretion by the CL plays an important role in the maintenance of pregnancy until synthesis of this steroid hormone is assumed by the placenta in many species [ 16 25 27 ] The CL is a major source of P4 in reptiles ; therefore, it has been suggested that the CL in squamates could provide some hormonal control of gravidity via the secretion of P4 [ 14 20 28 ] In the reptiles that reproduce strictly by oviparity, the tuatara, crocodilians, and turtles, the life of the CL is approximately the length of time it takes to shell the eggs (a few days to a few weeks) and it deteriorates shortly before or after oviposition [ 29 30 ] whereas the CL of squamates is maintained for varying periods of gravidity that can last

PAGE 23

23 for weeks or months [ 31 34 ] In oviparous squamates, the presence of an active CL is strongly correlated with egg retention and the timing of oviposition coincides with the loss of luteal activity [ 14 35 ] However, viviparous squamates show a great deal of variation in the life of corpora lutea with luteolysis occurring well before parturition in some species, which precludes any gross generalizations concerning the role of the CL alone in the lengthening of egg retention in viviparous species (as reviewed in [ 36 ] ). Maintenance of the CL as well as its correlation with circulating P4 concentrations is also variable in viviparous squamates. Many studies have determined the CL to be the primary source of P4 in viviparous squamates and have reported a strong positive correlation between the persistence of the CL during gestation and circulating P4 concentrations in viviparous lizards [ 33 37 38 ] and snakes [ 39 40 ] However, in Sceloporus jarrovi [ 41 ] and Chalcides chalcides [ 32 ] plasma P4 concentrations remain elevated late in gestation following luteolysis. In S. jarrovi Guillette et al. (1981) found luteolysis to occur in conjunction with the development of the chorioallantoic placenta. This observation led to the hypothesis that another source of P4 the placenta -could be important in the maintenance of gestation [ 41 ] Such a hypothesis mirrors the pattern found in many eutherian mammals in which P4 synthesis by the placenta replaces that of the CL during gestation [ 16 ] The mec hanisms controlling the lengthening of egg retention in squamates are still poorly understood. In some species, correlational evidence presents a strong case for the role of the CL in the maintenance of gestation; however, in other species we can find no s uch correlation. Likewise, circulating concentrations of P4 during gestation are quite variable across viviparous species In addition essentially nothing is known about

PAGE 24

24 the maternal recognition of pregnancy in viviparous reptiles, but a few studies sugge st that this phenomenon could occur in viviparous lizards [ 42 43 ] If maternal recognition of pregnancy occurs in reptiles, chemical signals of embryonic origin could function to prevent CL det erioration, modify the uterine environment, and increase the length of gestation. These embryonic chemical signals could be compounds similar to those found in mammals suggesting that the early embryonic expression of cytokines, prostaglandins, estrogens a nd other steroids as well as peptide hormones should be investigated in oviparous and viviparous squamates [ 43 ] The Reduction of the Eggshell The reduction of the thickness and structure of the eggshell is another requisite change for the evolution of viviparity in squamates [ 14 44 ] Oviparous squamates generally lay flexible eggs composed of two layers; a thick inner shell membrane composed of proteinaceous fibers and an extremely thin external crust of calcium carbonate [ 45 46 ] Some viviparous species also have a shell membrane present for the duration of embryonic development, but an external calcif ied layer is either absent or greatly reduced [ 44 47 48 ] All viviparous species examined demonstrate either a significant reduction in eggshell thickness or loss of the eggshell altogether [ 49 ] However, the debate continues over the timing of eggshell reduction in terms of the evolutionary transition to vivipari ty. One hypothesis proposes that eggshell reduction was a refinement of viviparity occurring after complete egg retention had evolved whereas the other and more generally accepted hypothesis proposes that a reduction in the eggshell evolved concurrently wi th increasing periods of egg retention and thus is a requirement of viviparity [ 14 47 50 ] The later hypothesis has been supported by

PAGE 25

25 experiments utilizing the liza rd, Lacerta vivipara which demonstrates both parity modes in reproductively isolated populations. Heulin a nd colleagues successfully crossed individuals in the laboratory from oviparous and viviparous populations of L. vivpara, generating hybrid F1 femal es that intermediate between the completely calcified eggshells of oviparous parental populatio n [ 51 52 ] Further hybridization experimen ts of L. vivipara performed by Arrayago et al. (1996) resulted in oviposition by hybrid F1 females at an embryonic stage of development also intermediate between the oviparous and viviparous populations. This artificial experiment directly connects increas ed time of egg retention with decreased thickness of the eggshell, although it does not show a causal relationship. Two nonexclusive hypotheses have been put forth to explain the adaptive significance of evolving reduced eggshell thickness concurrently w ith prolonged periods of in utero egg retention. The first proposes that decreasing the thickness of the eggshell would facilitate gas exchange between maternal and embryonic environments. This would be particularly important in later stages of development as oxygen requirements of the embryos increase drastically in the exponential growth phase of development [ 50 ] However, this hypothesis was not supported when tested in oviparous species from the genu s Sceloporus [ 53 ] Oviparous Sceloporus species exhibit differences in the amount of embryonic development that can be supported in utero Sceloporus scalaris,

PAGE 26

26 support advanced embryonic de velopment during extended egg retention experiments, while other oviparous Sceloporus species do not. However, in contrast to the above proposed hypothesis, these differences in the possible amount of extended in utero development were not related to thick ness of the eggshell [ 53 ] A second hypothesis suggests that reducing eggshell thickness would reduce diffusion distance between embryonic and maternal tissues; thereby facilitating the movement of chemical signals from the embryo to the mother that could play an important role in the maternal recognition of pregnancy [ 14 49 ] In addition, reducing the eggshell thickness would also reduce the diffusion dis tance for nutrient transfer from mother to the developing offspring. A common finding when oviparous and viviparous squamate species are compared is that the uterine shell glands are reduced in some capacity and that reduction is correlated with a reduct ion in eggshell thickness. The mechanism by which this occurs is still poorly understood but likely involves altered estrogen signaling. Uterine shell glands are prominent in all oviparous squamates studied to date, but are absent or greatly reduced in the majority of viviparous species. In the viviparous species with obvious uterine shell glands, a general reduction in size of the shell gland has been reported as in L. vivipara [ 44 ] as well as a reduction in the thickness of the endometrial stroma as in Pseudemoia. spenceri [ 54 ] Shell glands undergo seasonal changes with reproductive c yclicity that match changes in the prominent sex steroid hormones, E2 and P4; therefore future studies are needed to understand the mechanisms associated with shell gland formation and recruitment. Estrogens appear to be central to shell gland recruitment, proliferation, and synthesis of secretory material and ERs serve as key

PAGE 27

27 modulators in this process. Further, the regulation of the expression of other important factors, such as membrane calcium pumps, needs to be examined. While the mechanisms by which u terine shell glands and the eggshell are reduced remains unresolved, there is evidence that reducing the eggshell evolved concurrently with the evolution of extended egg retention and as such should be considered a requirement for the evolution of vivipari ty in squamates. The Emergence of the Placenta Placentation is another key characteristic of viviparity in squamates. In all viviparous squamates examined, placentae are present and thus appear to be required for embryonic survival in utero [ 14 ] Here, we define a placenta as a composite structure of maternal and embryonic origin. The embryonic contribution to the placenta consists of one or more of the four extraembryonic membranes (yolk sac, chorion, allantois, and amnion). These membranes function in the transfer of maternally derived nutrients, regulation of gas and water excha nge, removal of metabolic wastes, and protection of the developing embryo [ 55 56 ] These basic requirements are crucial for embryonic survival and development regardless of whether the embryo is encased within a calcified egg in an external nest (oviparous) or maintained within the maternal uterus (viviparous) (Figure 1 1). Gas and water exchange with the environment is achieved by two vascularized extraembryonic membranes, the chorioallantois and the yolk sac membrane. The chorioallantoic membrane (CAM) is formed by the apposition of the non vascularized chorion and highly v ascularized allantois and serves as the major respiratory organ of the developing embryo. The yolk sac membrane transfers nutrients from the yolk, functions in water exchange and has been proposed to act as a secondary gas

PAGE 28

28 exchange site supplementing the c horioallantois [ 1 14 57 ] To facilitate exchange with the environment, these membranes line the inner surface of the eggshell with the surface area of the CAM increasing dramatically during development to meet the gas demands of the embryo. In viviparous species, the loss of the calcified crust and reduction in the protein layer of the eggshell results in apposition of the eggshell or extraembryonic membranes to the vascularized uterus allowing exchange between the embryo and the maternal environment. Viviparous squamates have two primary types of placentation present during gestation, a chorioallantoic placenta and some form of yolk sac placenta [ 58 ] Both types of placentas are epitheliochorial in squamates reptiles meaning that the extraembryonic membranes are in contact with the uterus through apposition, but the embryonic tissue does not erode and invade the uterine lining [ 59 ] The yolk sac placenta is typically formed at the abembryonic pole during early stages of embr yonic development and broadly describes the apposition of omphalopleure (yolk sac) to the uterine epithelium. The chorioallantoic placenta (allantoplacenta) is present later in development at the embryonic pole and is formed by apposition of the CAM to the uterus. Both yolk sac and chorioallantoic placentas demonstrate a wide range of morphological diversity and exhibit varying degrees of complexity across squamates [ reviewed in 4 ] Four major types of chorioallantoic placentas have been described in squamates and are differentiated by levels of morphological complexity. Weekes [ 60 ] described the first three of these types and a fourth has been proposed by Blackburn and Vitt [ 4 ] The simplest and most common type of chorioallantoic placenta, Weekes type I, involves

PAGE 29

29 indirect apposition of the CAM to the uterus without any anatomical specializations in either structure. A reduced shell membrane encasing the embryo is present and it is this structure that lies in contact with the uterine epithelium. In types II and III, we see the emergence of the placentome, a specialized region that forms at the embryonic pole and brings the chorionic epithelium and uterine epithelium in direct apposition. Here, the chorioallant oic epithelium interdigitates with the uterine mucosa, and this region has been proposed as a site of histotrophic transfer due to the appearance of absorptive chorionic cells and a secretory uterine epithelium [ 61 ] The type IV chorioallantoic placenta is the most complex and has been described in the South American lizard genus Mabuya [ 62 ] This type of chorioallantoic placenta undergoes extensive transformation and demonstrates invagination of the CAM by uterine endometrium forming interlocking projections. The placentome and specialized chorionic cells called areolae hav e been suggested to function in nutrient transfer [ 62 ] Oviparous species and viviparous species with a simple placenta (type I) are predominately lecithotrophic, meaning that nourishment for embryonic development is primarily supplied by the yolk [ 63 ] Therefore, in the transition to viviparity as the period of egg retention was increased and eggshell thickness decreased, the major requirement of a placental structure was to aid in gas exchange, wh ich appears to be the primary role of the type I placenta. Species forming a more complex chorioallantoic placenta exhibit differentiation into specialized regions, the placentome and paraplacentome. The paraplacentome has been described as possibly functi oning as a specialized gas exchange organ in Pseudemoia entrecasteauxii [ 64 ] and as another site of histotrophic transfer in Mabuya mabouya [ 65 ] While the vast majority of viviparous

PAGE 30

30 squamates are lecithotrophic, it is common for these species to exhibit some degree of placental transport of organic and inorganic nutrients as well [ 66 69 ] In contrast, the condition of matrotrophy is quite rare in squamates. Yet, a fe w species exhibit a high degree of matrotrophy in which the majority of the nutrients required for embryonic development are provided by the mother via a placenta. These species have microlecithal eggs with little or no yolk present in the oocyte. The New World species of the genus Mabuya demonstrate the most extreme form of matrotrophy, which surpasses that found in any other squamate reptile and is similar to that of eutherian mammals [ 65 ] The specialized type IV chorioallantoic placenta of Mabuya heathi provides approximately 99% of nutrients for embryonic development [ 70 ] An Endocrine Placenta In eutherian mammals, the placenta is an endocrine organ that synthesizes, metabolizes, and transports a suite of steroid and peptide hormones crucial for embryonic survival and development [ 71 ] P4 is a key placental hormone that plays a role in the maintenance of pregnancy [ 72 ] timing of birth [ 73 ] and promotes growth of the embryo [ 74 ] and of the placenta itself [ 74 76 ] The first indirect evidence of placental P4 synthesis in squamates came from observations in S. jarrovi In this lizard species, maternal plasma P4 concentrations remain elevated after luteolysis and because luteolysis occurs in conjunction with the development of the chorioallantoic placenta, this led to the hypothesis that another source of P4 the place nta could be important in the maintenance of gestation [ 41 ] The three toed skink, Chalcides chalcides also demonstrates elevated plasma P4 following deterioration of the CL and forma tion of the placenta. The chorioallantoic

PAGE 31

31 placenta of this species has been shown to be capable of steroidogenesis [ 32 ] Guarino et al. (1998) investigated the expression of the steroidogenic enzyme hydroxy delta 5 steroid dehydrogenase, 3 beta and steroid delta isomerase 1 (HSD3B1), which conver ts pregnenolone (P5) to P4 in the CL and chorioallantoic placenta. They found high HSD3B1 activity in the CL during early gestation, but not at late pregnancy, whereas the placenta exhibited intense HSD3B1 only at late pregnancy. In vitro synthesis of P4 by the CL was high during early, but not late pregnancy, but P4 synthesis was highest at late pregnancy in the placenta. This work supports the hypothesis of an endocrine chorioallantoic placenta in C. chalcides and models a similar pattern found in many e utherian mammals where the placenta assumes the primary role of P4 synthesis following deterioration of the CL [ 32 ] In vitro production of P4 by the chorioallantoic placenta also has been demonstrated in the southern snow skink ( Niveoscincus microlepidotus ). Girling and Jones (2003) reported that the chorioallantoic placenta of this species was capable of synthesizing P4 when P5 precursor was added to the culture media; however, unlike C. chalcides this study did not find significant levels of P4 produced b y the placenta in the absence of added P5 [ 21 ] The relatively simple, type I chorioallantoic placenta of S. jarrovi can perform in vitro metabolism of steroid hormones and synthesis of P4 in the presence of P5 [ 77 ] In vitro experiments revealed that placental tissue rapidly clears P4 and corticosterone (CORT) from culture media, indicating the ability of the placenta to convert P4 and even corticosteroids to other metabolites [ 77 ] Painter and Moore (2005) suggested that steroid hormone metabolism by the squamate chorioallantoic placenta could play an

PAGE 32

32 important role in the regulation of maternal and embryonic hormone concentrations by preventing steroid hormones from freely diffusing between the developing embryo and mother. The extraembryonic membranes of oviparous species and placentae of viviparous species p erform similar functions to meet the gas, water, and nutrient demands of the embryo (Figure 1 1). This indicates that very little specialization of extraembryonic membranes is required in a transition to viviparity and explains why the majority of viviparo us species exhibit a relatively simple chorioallantoic placenta that appears to predominately function in gas exchange. Yet, evidence indicates that the chorioallantoic placenta has additional roles in endocrine processes in squamates. Are these specializa tions unique to the chorioallantoic placentae of viviparous mammals and squamates or could the CAM of oviparous species also perform similar functions? A New Hypothesis for the Evolution of Endocrine Extraembryonic Membranes and the Placenta: Implications for the Evolution of Viviparity We have suggest ed previously [ 36 ] that endocrine properties of chorioallantoic placenta are not novel features of viviparous mammals and squamates. Rather, a hypothesi s was presented stating that the oviparous CAM has endocrine properties, which gave rise to an endocrine placenta. The basis for our hypothesis comes from s tudies investigating mamm alian [ 71 78 79 ] and lizard [ 21 ] placentae, which rev ealed that both extraembryonic membranes and maternal tissues contribute to hormone synthesis and metabolism. Given that extraembryonic membranes share numerous similarities in their basic structure and function that are conserved across amniotes [ 55 ] I hypothesize that the oviparous CAM is an endocrine organ that has the capability to synthesize and respond to steroid hormone signaling.

PAGE 33

33 If the CAM of oviparous amniotes is capable of producing and responding to embryonic signaling factors, such as steroid hormones, these signaling factors would have functions other than the maternal recognition of pre gnancy in oviparous species and could likely be involved in tissue proliferation, vascularization, and embryonic growth. However, these factors would be useful embryonic signals of pregnancy as viviparity evolves and endocrine properties of oviparous speci es could become co opted in a novel environment such as the uterus; thus, facilitating the use of embryonic signaling factors in the maternal recognition of pregnancy in viviparous squamates. That is, as squamates retained the egg in utero for longer time periods and eggshell thickness was reduced, signaling factors synthesized by the extraembryonic membranes would be free to communicate with the maternal uterus and could play a role in maintaining the life of the corpus luteum and further lengthen gestatio n until in utero Specific Hypotheses My aim is to determine if steroidogenic activity of extraembryonic membranes is a unique characteristic of placental amniotes, or if these membranes also have an endocrine role in oviparous non mam malian species. To investigate this question, I will examine steroidogenesis in the CAM of taxa representing the major phylogenetic groups of non mammalian amniotes, which reproduce strictly by oviparity. I specifically test the following hypotheses: (1) t he molecular mechanisms required to perform steroid hormone synthesis are evident in the oviparous CAM (Figure 1 2) ; (2) the CAM has the capability to synthesize steroid hormones; (3) the molecular mechanisms required to respond to steroid hormone signals are present in the CAM; (4) the CAM has the capability to modulate steroid hormone signals; (5) mRNA expression in the CAM is

PAGE 34

34 regulated and levels of steroidogenic enzymes and/or steroid receptors can be altered by exposure to endocrine disrupting contamin ants (EDCs) during embryonic development. Significance of Work The presence of steroidogenic activity in the extraembryonic membranes of oviparous amniotes would imply a more ancient origin of endocrine activity for these membranes than is currently belie ved. This serves as the first major work to investigate steroidogenesis and steroid signaling in the CAM of oviparous amniotes. By focusing on th r e e of the major phylogenetic groups of non mammalian amniotes that reproduce strictly by oviparity (birds, cro codilians, and turtles), I attempt to uncover a potentially conserved trait within amniotes. In addition, I attempt to determine whether steroidogenic activity in the CAM is regulated. It is vital to the understanding of this system to reveal this distinct ion because if gene expression in the CAM is regulated, it is possible for gene expression to be altered. EDCs have been identified in the CAMs of crocodilians, turtles, and birds [ 80 82 ] Aside from identifying their presence in the CAM, it is not currently known whether EDCs could disrupt normal CAM function. Howev er, if endocrine activity of the CAM is a conserved trait of amniotes and if steroidogenesis is regulated in this tissue, EDCs could potentially interfere with steroidogenesis and steroid signaling in the CAM during development.

PAGE 35

35 Figure 1 1. The extr aembryonic membranes of oviparous and viviparous squamates. Oviparous and viviparous amniotes share the same extraembryonic membranes, the amnion, chorion, allantois, and yolk sac. These structures perform similar functions regardless of reproductive mode indicating that very little specialization of extraembryonic membranes is required in an initial transition to viviparity. Figure r edrawn from Guillette LJ, Jr. The evolution of viviparity in lizards. Bioscience 1993; 43:742 751. Artwork by Patpilai Kasinp ila

PAGE 36

36 Figure 1 2 General overview of t he steroid hormone biosynthetic pathway. Cholesterol is the substrate for de novo steroid hormone synthesis and steroidogenesis proceeds by the conversion of one hormone to another by the action of specific e nzymes (italiciz ed general class abbreviations shown above arrows, see legend for full gene names). The grey shaded region reflects the stress hormone pathway; whereas un shaded regions depict synthesis of sex steroid hormones.

PAGE 37

37 CHAPTER 2 STEROIDOGENESIS AND STEROID SIGNALIN G IN THE CHORIOALLAN TOIC MEMBRANE OF THE CHIC KEN ( GALLUS GALLUS ) 2 A key defining characteristic of amniotes (mammals, reptiles, and birds) is the formation of four extraembryonic membranes during embryonic development; the amnion, cho rion, allantois, and yolk sac [ 55 ] Fusion of the chorion and allantois forms either the chorioallantoic placenta in viviparous (live bearing) species, or the chorioallantoic membrane (CAM) in oviparous (egg laying) species [ 83 ] Both the chorioallantoic placenta and CAM perform functions crucial for embryonic survival and development [ 55 83 ] Yet, only the placenta, which is a composite structure composed of extraembryonic membranes and maternal decidua, is classified as an endocrine organ [ 71 83 ] The mammalian chorioall antoic placenta synthesizes, transports, and metabolizes a suite of steroid and peptide hormones [ 71 83 84 ] Of these, placental progesterone (P4), plays a key role in the maintenance of pregnancy [ 72 ] timing of birth [ 73 ] and promotes growth of the embryo [ 74 ] and placenta [ 75 76 ] Historically, endocrine properties of the placenta have been viewed as an innovation of eutherian mammals [ 83 ] However, evidence of an endocrine placenta in three species of viviparous lizards [ 21 32 77 ] has recently called this traditional eutherian centric view into question. Examination of mammalian [ 71 78 79 ] and lizard [ 21 ] placentas has reveal ed that both extraembryonic membranes and maternal tissues contribute to hormone synthesis and metabolism. Therefore, I asked whether the extraembryonic membranes 2 Published previously, see Albergotti LC, H.J. Hamlin, M.W. McCoy, L.J. Guillette, Jr. Endocrine Activity of Extraembryonic Membranes Extends beyond Placental Amniotes. PLoS ONE 2009; 4(5):e5452.

PAGE 38

38 of oviparous amniotes could also play a role in the production of hormones during embryonic d evelopment. Although some differences do exist in the formation of the chorionic ectoderm between placental and oviparous amniotes [ 85 ] such an investigation is warranted given that the extraembryonic membranes share numerous similarities in their basic structure and function that are conserved across amniota. The presence of steroidogenic activity in the extraembryonic membranes of an oviparous amniote would imply a more ancient origin of endocrine function for these membranes than is currently believed. Both the chorioallantoic placenta and CAM are derived from chorion and allantois [ 83 85 ] Therefor e, if the CAM has similar steroidogenic properties as the chorioallantoic placenta, then it should synthesize key placental hormones, such as P4. Here I examined the potential activity of P4 in the CAM of chicken ( Gallus gallus ). To confirm P4 activity I m ust demonstrate that: (1) the oviparous CAM has the molecular mechanisms in place to perform steroidogenesis and synthesis of P4. Indeed, I show mRNA expression patterns of key steroidogenic enzymes involved in P4 biosynthesis. (2) The CAM is able to synth esize P4. I demonstrate that in vitro P4 synthesis takes place in the CAM and is not a product of steroids in the yolk or embryo, by isolating the CAM from other tissues and testing for synthesis directly in the presence of a steroid hormone precursor. (3) The CAM is capable of responding to the P4 signal through an appropriate receptor. Again, I demonstrate, via mRNA expression and protein immunolocalization of the progesterone receptor, that the CAM is capable of modulating P4 activity.

PAGE 39

39 Materials and Meth ods CAM Collection Fertilized chicken ( Gallus gallus ) eggs were obtained from Charles River Laboratories (North Franklin, CT) and staged according to Hamburger and Hamilton [ 86 ] CAMs were collected by removing the eggshell directly over the embryo and excising CAM away from embryo and yolk sac membrane. CAMs were washed in 1X phosphate buffered saline (PBS). RNA Isolation and Reverse Transcription Dissected CAM was stored in the RNA preservative, RNA later solution (Ambion) at 4C. Total RNA was isolated from CAM with TRIzol reagent ( Invitrogen Life Technologies), purified with the SV Total RNA Isolation System (Promega), and Rad). Concentrations and quality of RNA samples were evaluated by measuring optical density with a N 1000 (Thermo Scientific) and by formaldehyde gel electrophoresis. Total RNA was treated with ribonuclease free deoxyribonuclease I (DNase I; Qiagen) to and compl ementary DNA (cDNA) was diluted 10 fold and stored at 20C until RT qPCR analysis. Real time Quantitative Polymerase Chain Reaction (RT qPCR) RT qPCR analysis was performed on CAM samples from embryonic days 8 (n=10), 10 (n=17), 12 (n=14), 14 (n=10), 16 (n=14), and 18 (n=12). cDNA was analyzed in triplicate by RT qPCR amplification using an iCycler MyIQ Single Color Real Time PCR Detection System (Bio Rad). Each 15 10 fold dilution of 10X Gold Buffer (Applied Bios ystems), 3 mM MgCl 2

PAGE 40

40 0.04% Tween 20, 0.4% glycerol, 1% DMSO, 500 fold dilution of SYBR Green Fluorescein Calibration Dye (Bio L AmpliTag Gold DNA polymera se (Applied Biosystems). RT qPCR amplification conditions included an enzyme activation step of 95 C (10 min) followed by 40 cycles (reference genes) or 50 cycles (target genes) of 95 C (15 sec) and a primer specific combined annealing/extension temperatur e (1 min). The specificity of amplification was confirmed by melt curve analysis. Triplicate data for each gene were averaged and amplification was determined by the absolute quantification method [ 87 ] In brief, copy numbers were calculated from the cycle threshold value by the linear regression of a standard curve. Standard curves for each target gene were generated from a plasmid containing the amplicon of interest. Controls l acking cDNA template were included on every RT qPCR plate to determine the specificity of target cDNA. Additionally, to confirm that target cDNA was not contaminated by genomic DNA, RT qPCR was performed with ACTB and PR primers on the RNA isolated from ev ery sample. To normalize mRNA expression levels, RT qPCR was performed on all samples with five reference genes: actin, beta (ACTB), glyceraldehyde 3 phosphate dehydrogenase ( GAPDH), ribosomal protein L8 (RPL8), RNA polymerase II polypeptide E (POLR2E), an d ribosomal protein S13 (RPS13). The geometric mean was calculated according to geNORM [ 88 ] generating a normalization factor (NF) for each sample to correct for potential differences in RNA quality or quantity. For each target gene, absolute copy number was divided by the NF. Data are reported as relative mRNA expression and represent mean normalized mRNA transcript

PAGE 41

41 Cloning and Sequencing of Plasmids RT qPCR of pooled cDNA was used to generate a PCR product for each primer set. Amplified PCR products were separated on a 2% agarose gel and visualized by ethidi um bromide on a Gel Doc EQ with Quantity One 4.6 software (Bio Rad). RT qPCR products were purified by Wizard SV Gel and PCR Clean Up System (Promega) and purified samples were confirmed by electrophoresis on a 2% agarose gel. PCR products were cloned int o a pGEM T Vector System (Promega). Plasmid DNA was purified using the Wizard Plus SV Minipreps DNA Purification System (Promega) and sequenced on an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems) using a BigDye Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems). The specificity of cloned DNA was confirmed using BLAST against sequences available in Genbank. 1000, converted to copies/ and serially d iluted in a solution containing 50 mM Tris HCl (pH 8.3), 75 mM mL of tRNA. RT qPCR Primers All Primers were designed to amplify mRNA specific fragments from chicken coding sequences ( National Center for Biotechnology Information ) using Primer3 software [ 89 ] and were synthesized by Eurofins MWG Operon. Primer pairs were combined and diluted to a fina combined annealing/extension temperature used in RT qPCR are listed in Table 2 1. Sexing of Embryos To sex individuals used in RT qPCR analysis, CAM genomic DNA was extracted from TRIzol reagent (Zhu, Shirley, DNA extraction from TRIZOL organic phase, http://med.stanford.edu/labs/vander ijn/Protocols.html ). DNA concentration was

PAGE 42

42 described in [ 90 ] For in vitro tissue culture, day 18 individuals were sexed by visual inspection of embryonic gonads. In Vitro Explant Culture CAMs f rom 7 eggs were collected on embryonic day 18. CAMs were cut into 12 sections of approximately 0.1g wet weight (mean=0.104g 0.0009 SEM) allowing for duplicate sections to undergo identical treatment regimes. CAM sections were incubated at 37C on an orbi tal shaker in L 15 culture media (Invitrogen) either with or without cholesterol and cAMP as precursor. Precursor solutions and concentrations are based on King et al. 2004 [ 91 ] For cholesterol, 22(R) Hydroxycholesterol (Sigma) was mL and combined with 1 mM Dibutyryl cAMP (Sigma). After 2, 4, or 8 hours of in cubation, concentration of progesterone in the culture media was quantified by solid phase radioimmunoassay [ 92 ] To determine background and cross reactivity of the P4 assay, controls consisting of only cholesterol and cAMP were incubated for 8 hours with an average P4 concentration of 0.337pg/ mL /g 0.423 SEM. Immunohistochemistry and Microscopy Diss ected CAM was fixed in 4% paraformaldehyde at 4C overnight. Tissues were washed 3X in 1X PBS and stored in 75% ethanol at 4C. CAMs were dehydrated, paraffin embedded, and sectioned at 8 microns. Tissue sections were deparaffinized in citrosolv and rehydr ated through graded concentrations of ethanol to 0.1 M Tris buffered saline (TBS, pH 7.6). Immunohistochemistry was performed using the Vectastain Universal Quick Kit, R.T.U. (Vector Laboratories) with the following modifications: for antigen retrieval, s lides were autoclaved for 30 min in 10 mM sodium citrate buffer (pH

PAGE 43

43 6.0). Sections were treated with 3% hydrogen peroxide for 20 min, blocked in normal horse serum (NHS) for 1h our and treated with the Avidin Biotin blocking kit (Vector Laboratories). Betw een all incubation steps, slides were washed in TBS (5 min), 0.1 M TBS containing 0.2% Tween 20 (5 min), and again in TBS (5 min). CAM sections from day 16 (n=5) and day 18 (n=5) were incubated with a 1:50 dilution of mouse monoclonal anti progesterone re ceptor antibody (Ab 8), Thermo Scientific. PR Ab 8 recognizes both PR isoforms in chicken oviduct [ 93 ] and ovary [ 94 ] Sections were treated with 3, 39 diaminobenzidine for 5 min (Vector Laboratories) and washed in running tap water for 5 min. A control section receiving normal horse serum in place of primary antibody was included on every slide. Slides were dehydrated, cleared and mounted with Permount mounting media (Fish er Scientific). Sections were imaged using a Leica DMRE microscope under DIC and Leica DFC 300 FX camera with Leica Firecam software. Statistical Analysis All statistical analyses were performed in the R statistical programming environment version 2.8.0 [ 95 ] For gene expression analyses, the total numbers of mRNA transcripts for 5 control and 5 target genes from the CAM were determined by RT qPCR. To quantify relative expression of target genes, we divided each sample by a normalization factor to were estimated as the geometric mean expression of 5 control genes using geNORM [ 88 ] Samples displaying a non specific melt curve were excluded from the analysis and account for differences in number of samples between genes. To analyze each target gene, we used linear mixe d effects models (LMMs) to estimate the parameters for relative mRNA expression over the 6 day experiment. For each analysis, embryonic day

PAGE 44

44 was treated as a fixed effect, and embryonic day, RT qPCR plate, and sex of individuals were treated as random effec ts. Model assumptions were evaluated visually via examination of residuals and QQ plots and square root transformations were performed when necessary to normalize errors (all genes were square root transformed except CYP17A1 which did not require transformation). Outliers were identified from residuals and QQ plots and removed from the study (note that inclusion of outliers did not change patterns of significance, but were excluded from the final analysis because they have a d isproportionate influence on mean estimates and caused violations of normality). The assumption of homogeneity of variances was met for all genes except HSD3B1, which is likely due to the substantial changes in mean expression of HSD3B1 as the embryo devel oped. Thus for HSD3B1 variance was assumed to be a power of the estimated mean for each day and the exponent was estimated from the data as part of the estimation procedure [ 96 ] For in vitro tissue culture, I used the same analytical approach described above using a LMM to estimate P4 concentration in culture media. In this analysis treatment (precursor versus control) and time (hour) are fixed effects o n P4 concentrations (pg/ mL /g of CAM tissue) and day of dissection, egg, replicate and sex of individual were treated as random effects. P4 concentration was square root transformed and two outliers, the largest value for control at 4 hours (206) and the la rgest value for precursor at 8 hours (213) were excluded from the analysis as outliers.

PAGE 45

45 Results The Chicken CAM has the Required Molecular Mechanisms to Perform Steroidogenesis and Synthesis of Progesterone Cholesterol is required for the de novo synthes is of steroid hormones with steroidogenesis proceeding by the conversion of one steroid hormone to another by the action of specific enzymes [ 84 ] To determine whether the oviparous CAM has the molecular mechanisms required for P4 synthesis, I examined mRNA expression of key steroidogenic enzymes in the steroid biosynthesis pathway [ 84 97 ] (Figure 2 1). The relative levels and timing of mRNA exp ression were determined by harvesting CAM tissue, which forms on embryonic day 5, on embryonic days 8, 10, 12, 14, 16, and 18 and performing quantitative real time RT PCR (RT qPCR) of mRNA coding for steroidogenic acute regulatory protein (StAR), cytochrom e P450 11A1 (CYP11A1), cytochrome P450, family 17, subfamily A, polypeptide 1 (CYP17A1), hydroxy delta 5 steroid dehydrogenase, 3 beta and steroid delta isomerase 1 (HSD3B1), and hydroxysteroid (17 beta) dehydrogenase 1 (HSD17B1). I show the presence of steroidogenic enzyme mRNA in the CAM of an oviparous amniote (Figure 2 2). Overall, there was significant mRNA expression of StAR (F 1, 67 =65.222, p< 0.0001), CYP11A1 (F 1, 68 =58.489, p<0.0001), and CYP17A1 (F 1, 66 =80.004, p<0.0001); however, the level of e xpression did not change significantly between embryonic day 8 and 18 for several components of the steroidogenic pathway (StAR F 5, 67 =1.144, p=0.346), (CYP11A1 F 5, 66 =1.618, p=0.167), (CYP17A1F 5, 66 =1.787, p=0.128). In contrast, I observed a 464 fold increase in HSD3B1, which converts pregnenolone (P5) to P4, from day 8 to day 18 of development (F 5, 68 =89.282, p<0.0001). Detection of the steroidogenic enzymes required for the transport and

PAGE 46

46 conversion of cholesterol to P4 identifies a molecular mechanis m for achieving P4 synthesis in the CAM. Additionally, the significant increase in HSD3B1 indicates that P4 synthesis in the CAM potentially increases through development similar to that of the chorioallantoic placenta through pregnancy [ 84 98 ] In contrast, HSD17B1 showed a significant decrease in expression, with mRNA expression decreasing to nearly zero by day 18 (F 5, 68 =16.027, p<0.0001), which could be associated with decreasing yolk androgens during development. Early in chick development, Elf and Fivizzani [ 99 ] reported high levels of androstenedione (A), testosterone (T), and dihydrotestosterone in the yolk, which decreased as development proceeds. They showed that yolk estradiol until increasing on embryonic day 20, wh ich is beyond the duration of our study. Because HSD17B1 is a key enzyme in the conversion between A and T [ 100 ] (Figure 2 1), high levels of yolk A and T earlier in embryonic development could explain why HSD17B1 mRNA expression in the CAM was initially high a nd then decreased through time. This scenario suggests that the CAM utilizes a maternal source of androgens during development. Taken together, our results indicate that the chick CAM has the molecular mechanisms in place to perform steroidogenesis in gene ral and P4 synthesis in particular. The Chicken CAM is Capable of In Vitro Progesterone Synthesis Placental P4 synthesis in mammals is generally elevated from mid to late pregnancy [ 98 ] ; therefore, to investigate P4 synthesis in the CAM, I harvested CAM tissue on embryonic day 18 and performed in vitro explant culture. Sections of CAM were incubated in culture media fo r 2, 4, or 8 hours either with or without cholesterol (plus cAMP) as a precursor. The concentration of P4 in the culture media was then

PAGE 47

47 quantified by radioimmunoassay. If the CAM is steroidogenic, addition of the steroid hormone precursor (cholesterol) to the culture media should stimulate increased P4 production. Indeed, our results showed a significant increase in concentration of P4 in the culture media following the addition of cholesterol precursor (F 1, 58 =46.917, p<0.0001) (Figure 2 3). Additionally, I observed a significant interaction between time of incubation and addition of precursor to the culture media (F 2, 58 =3.709, p= 0.0305). This result confirms that P4 synthesis can be induced in the chick CAM in the presence of a steroid hormone precursor. Further, I found that in the absence of precursor, the CAM produced a detectable level of P4 that did not change significantly during the assay (mean=34 pg/ mL /g 8.2 SEM, F 2, 21 =1.626, p=0.2205) (Figure 2 3) suggesting that the CAM can exhibit endogenous P4 synthesis, but under the in vitro conditions used here this synthesis is likely limited by the lack of precursor. In contrast, a decrease in P4 concentration during the assay would have indicated that P4 detected at the first time point was perhaps the product of hormones leaching from this highly vascularized tissue. In sum, our results demonstrate that the chick CAM is capable of in vitro P4 synthesis. At present, I am unable to comment on the bioavailability of cholesterol in the CAM under in vivo con ditions as these data do not currently exist. The Chicken CAM is Capable of Responding to P4 Signaling Through the Progesterone Receptor Finally, I examined the capability of the chick CAM to respond to P4 signaling through an appropriate hormone recepto r. As in human [ 101 ] chick P4 receptor (PR) is predominately expressed in two isoforms, PR A and PR B [ 102 ] In chicken, the mRNA sequences of these isoforms are identic al with the exception that PR B has an additional 128 amino acids located at the N terminus [ 102 ] To identify both PR isoforms

PAGE 48

48 in the CAM, I designed primers that recognized the shared mRNA sequence (PR) and performed RT qPCR to examine relative expression during development. I show that PR increased significantly through embryonic development (F 5, 68 =15.897, p<0.0001), demonstrating a 758% increase be tween embryonic day 8 and 18 (Figure 2 4A). I hypothesized that the observed increase in PR expression in the CAM could be due to autoregulation by P4 and/or upregulation by an estrogen. If CAM PR is under autoregulation, i.e. P4 regulates its own synthe sis, one might expect that as HSD3B1 and presumably P4 increases, a corresponding decrease in PR expression would result [ 103 ] However in placental tissues, P4 has been shown to maintain and possibly upregulate PR in rats [ 76 ] and to significantly increase the expression of PR in humans [ 104 ] Therefore, it is possible that an increase in HSD3B 1 and P4 could result in an increase in PR expression in the CAM. If CAM PR is upregulated by an estrogen, I might expect to see an upregulation of both chick PR [ 105 ] and estrogen receptor alpha (ESR1) [ 106 ] Therefore, I examined ESR1 mRNA expression in the CAM and found that ESR1 increased by 307% between embryonic day 8 and 18 (F 5, 66 =14.432, p<0.0001) (Figure 2 4A) suggesting that an estrogen might play a role in PR regulation. To determine if PR mRNA is translated at the level of the protein I performed immunolocalization of the nuclear PR with an antibody designed to recognize both chicken A and B isoforms [ 93 ] I found PR to be localized to the nucleus predominately in the chorionic epithelium and in the epithelial cells of mesenchymal blood ves sels (Figure 2 4B). Positive nuclear staining was also found in the allantoic epithelia and

PAGE 49

49 mesenchyme. In total, mRNA expression and protein localization of PR in the CAM indicates that this tissue can modulate the activity of P4 during embryonic developm ent. Discussion Collectively, our study indicates that the chick CAM is steroidogenic and has the capability to both synthesize progesterone and receive progesterone signaling. By demonstrating mRNA expression of steroidogenic enzymes, I show that the chi ck CAM has the molecular mechanisms in place to perform steroidogenesis and biosynthesis of P4. I demonstrate that the CAM is capable of in vitro synthesis of P4 in the presence of a steroid precursor. Additionally, I show that the CAM is capable of modula ting P4 activity through the progesterone receptor. In eutherian mammals, placental P4 plays a key role in the maintenance of pregnancy [ 72 ] timing of birth [ 73 ] and promotes growth of the embryo [ 74 ] and of the placenta itself [ 74 76 ] Further, P4 has been observed to stimulate blood vessel proliferation [ 107 ] and maturation [ 108 ] in the mouse endometrium. Additionally, P4 has been suggested to play a role in human fetoplacental vascularization by regulating the proliferation of placental vascular smooth musc le cells [ 109 ] and through relaxation of placental blood vessels [ 110 ] At present, I can only speculate on the role of P4 in the physiology of the CAM. I hypothesize that P4 in the oviparous CAM might be expected to serve similar roles as in eutherians cont ributing to the maintenance of embryonic development, timing of hatch, and growth of the embryo and of the CAM. Like the placenta, the CAM is a highly vascularized organ; therefore, I suggest that P4 might be involved in CAM blood vessel proliferation and maintenance. Our findings represent a paradigm shift in evolutionary reproductive biology by indicating that steroidogenic activity of extraembryonic membranes is not a novel

PAGE 50

50 characteristic of placental amniotes. Further, I hypothesize that endocrine acti vity of extraembryonic membranes might be an evolutionarily conserved characteristic of amniotes. If steroidogenic activity of extraembryonic membranes is evolutionarily conserved, then the endocrine role of the amniote placenta is likely to have evolved i nitially in an oviparous ancestor. Our hypothesis that the extraembryonic membranes of amniotes are steroidogenic suggests an additional unifying characteristic of amniotes and has implications for evolutionary reproductive biology, particularly for the evolution of viviparity. It is curren tly estimated that within squamates (lizards and snakes) viviparity has independently evolved approximately 105 times [ 8 ] In the transition from oviparity to viviparity in squamates, the period of time that eggs are retained within the uterus is increased and the thickness of the eggshell is decreased [ 14 ] Eggshell reduction facilitates maternal fetal gas exchange, but has also been proposed to function in the diffusion of chemical signals from the embryo to the mother in order to prolong gestation [ 14 ] Thus, secretion of s teroid hormones by the oviparous CAM could be important in establishing maternal recognition of pregnancy during the evolution of viviparity in this group. I suggest that evolutionary tinkering in the timing and spatial expression of steroidogenic genes in the CAM could lead to novel endocrine functions in communication with the maternal uterus; thus, facilitating the endocrine role of the chorioallantoic placenta.

PAGE 51

51 Table 2 1. Chicken PCR primers used for RT Quantitative real time PCR Gene Direction Sequenc Annealing (C) RPL8 Sense CAACCCCGAAACAAAGAAAA 62.4 Antisense ATACGACCTCCACCAGCAAC ACTB Sense TGCGTGACATCAAGGAGAAG 60.9 Antisense AGAGCTAGAGGCAGCTGTGG POLR2E Sense ATCAACATCACGGAACACGA 60 Antisense GCAGCTCCGTCACTTCTTCT GAPDH Sense TATCTTCCAGGAGCGTGACC 60 Antisense TCTCCATGGTGGTGAAGACA RPS13 Sense AAAGGCTTGACTCCCTCACA 60 Antisense ATGTTTGCGAACAGCAACAG StAR Sense GCCAAAGACCATCATCAACC 61.6 Antisense GACCAAAGCACTCAACAGCA CYP11A1 Sense GGTGTCTACGAGAGCGTGAA 64.4 Antisense GTTGCGGTAGTCACGGTATG CYP17A1 Sense GACATCTTCCCCTGGCTACA 64.4 Antisense CACAGTGTCCCCACAGAATG HSD3B1 Sense TCTCCAGGAAGGAGGCTTTA 62.4 Antisense GTAGAACTGCCCCCTGATGT HSD17B1 Sense GAGAGGGACCACGGTGCTGAT 64.4 Antisense AGTGGCGAACACTTTGAACC PR Sense CCCAGTCTCTAACGCAAAGG 65 Antisense GCTCAATGCCTCGTAAAACA ESR1 Sense GATAATAGGCGCCACAGCAT 62.9 Antisense TAGTCGTTGCACACAGCACA

PAGE 52

52 Figure 2 1. A simplified version of steroid biosynthesis highlighting the specific steroidogenic enzymes investigated. Filled boxes highlight the steroidogenic enzymes examined by RT qPCR. Progesterone (P4) is highlighted as the focus of our study. First, the transport protein, StAR is needed to facilitate the movement of cholesterol from the outer to inner mitochondrial membrane. Cholesterol is then converted to pregnenolone by the action of CYP11A1. hydroxy pregnenolone by CYP17A1 or to P4 by HSD3B1. P4 can either be a final product in this pathway or serve as a precursor in the synthesis of glucocorticoids, androgens, or estrogens. HSD17B1 functions in the inter conversion of weaker and stronger androgens an d estrogens and was included as a marker of upstream steroid enzyme activity [ 84 97 ]

PAGE 53

53 Figure 2 2. Relative mRNA expression of steroidogenic enzymes in the chick CAM. RT qPCR analysis of mRNA coding for StAR, CYP11A1, CYP17A1, HSD3B1 and HSD17B1 on chick embryonic days 8, 10, 12, 14, 16, and 18 Data are reported as relative mRNA expression and represent mean normalized

PAGE 54

54 Figure 2 3. Progesterone synth esis in the chick CAM. CAM sections were incubated in culture media for 2, 4, or 8 hours either with (circles) or without (squares) cholesterol (plus cAMP) as a precursor. Concentration of P4 in the culture media is represented as pg/ mL of P4 per g of CAM tissue (pg/ mL /g). To determine background and cross reactivity of the P4 assay, controls consisting of only cholesterol and cAMP were incubated for 8 hours with an average P4 concentration of 0.337pg/ mL /g 0.423 SEM (not shown).

PAGE 55

55 Figure 2 4. PR and ESR 1 mRNA expression and PR immunolocalization in the chick CAM (A) RT qPCR analysis of mRNA coding for PR and ESR1 on chick embryonic. Data are reported as relative mRNA expression and represent C ) PR IHC of embryonic day 18 CAM. (B) PR positive section. Nuclear staining of PR is localized predominately to the chorionic epithelium (c), and epithelial cells of blood vessels (bv). Positive nuclear staining is also present in allantoic epithelium ( a), and mesenchyme (m). (C) Negative control of corresponding CAM section incubated without primary PR antibody does not show specific nuclear staining. Scale bar represents 10 microns.

PAGE 56

56 CHAPTER 3 THE CHORIOALLANTOIC MEMBRANE OF THE AMER ICAN ALLIGATOR ( ALLIGATOR MISSISSIPP IENSIS ) HAS THE CAPABILITY T O PERFORM STEROID BIOSYNTHESIS AND RES POND TO STEROID HORM ONE SIGNALING The mammalian placenta is an endocrine organ that functions in the synthesis, transport and metabolism of numerous hormones, including steroid hormones during pregnancy [ 111 ] Likewise, it is well established that the ability of the mammalian placenta to perfo rm these steroidogenic functions is crucial for the survival, development and health of the developing embryo [ 112 113 ] More recently, it has been suggested that disruption of normal placental steroidogenesis not only affects the embryo during pregnancy, but can also have long lasting effects into adulthoo d, a condition referred to as the fetal or embryonic origins of adult disease [ 114 115 ] W hile it is now understood that steroidogenesis is a cr itical function of the placenta, the evolution of steroidogenesis in this organ is poorly understood. We have hypothesized previously, that the ability of the placenta to perform steroidogenesis likely evolved in the extraembryonic membranes of an oviparou s ancestor [ 36 116 ] Mammals, reptiles and birds compose the group of vertebrates known as amniotes. The formation of common extraembryonic membranes during development is a defining characteristic of this group and amniote extraembryonic membranes; amnion, allantois, chorion and yolk sac, share many structural and functional similarities across taxa due to their shared evolutionary ancestry [ 55 ] W ithin amniotes, the chorioallantoic placenta evolved with the transition to viviparity (live birth) from oviparity (egg laying) and is a composite organ composed of a maternal and an embryonic contribution [ 4 36 ] The maternal contribution to the placenta consists of uterine tissues whereas the embryonic contribution consists of extraembryonic membranes [ 56 ] The embryonic

PAGE 57

57 components to the placenta are present in all amniotes, regardless of parity mode [ 36 ] For instance, the apposition of chorion and allantois forms the chorioallantois, and this structure either lines the inner surface of the eggshell and is referred to as the chorioallantoic membrane (CAM) in oviparous amniotes or apposes to the maternal uterus and forms the chorioallantoic placenta in viviparous amniotes [ 14 43 ] Li kewise, the yolk sac is present in all amniotes, but will appose to the maternal uterus and form the yolk sac placenta in some, but not all viviparous amniotes [ 14 43 ] Prior to the early 1900s, the mammalian placenta was considered to primarily function as an organ of protection, nutrient transfer, gas exchange and waste removal. An endocrine role for the mammalian placenta was first suggested by Joseph Halban in 1905 (as cited in [ 6 ] ) and for more than half a century an endocrine placenta was viewed as an exclusive trait of eutherian mammals. However, eutherian mammals are not the only amniotes that reproduce by viviparity and form a placenta. In fact, viviparity and placentation has evolved independently over 100 times within the squamate reptiles (lizards and snakes) [ 7 8 ] Although first described in the 1930s, the reptilian placenta, like its mammalian counterpart, was thought to act primarily in protection, nutrient transfer, ga s exchange and waste removal but starting in the early 1980s, evidence of an endocrine role for the squamate placenta was obtained (for reviews, see [ 14 36 49 ] Consequently, a steroidogenic placenta has now been documented in three species of viviparous lizards [ 21 32 77 ] indicating that a steroidogenic plac enta is not an innovation of eutherian mammals [ 36 ] Steroid biosynthesis is a common characteristic of the mammalian placenta ; however, the steroidogenic enzymes expressed and thus, the hormones synthesized by

PAGE 58

58 the placenta varies among species [ 111 ] That is, in many species the chorioallantoic placenta does not express all of the enzymes of the sex or stress steroid synthesis pathways. Steroid biosynthesis begins with cholesterol and proceeds by the conversion of one steroid hormone to another by th e action of specific enzymes [ 84 ] Progesterone (P4) biosynthesis is dependent on the steroido genic enzyme, hydroxy delta 5 steroid dehydrogenase, 3 beta and steroid delta isomerase 1 (HSD3B1), which converts pregnenolone (P5) to P4 [ 97 ] Androgen biosynthesis requires cy tochrome P450, family 17, subfamily A, polypeptide 1 (CYP17A1) to convert P5 or P4 to dehydroepiandrosterone or androstenedione (A), respectively [ 97 ] The biosynthesis of estrogens is dependent on the enzyme, cytochrome P450, family 19, subfamily A, (E2), respectively [ 97 ] D espite species differences in the levels and timing of expression, most eutherian placentae also appear to be targets of the major classes of sex and stress hormones and typically exhibit expression of the nuclear steroid rece ptors, such as the progesterone receptor (PR) [ 117 ] androgen receptor (AR) [ 118 ] glucocorticoid receptor (GR) [ 119 ] [ 120 ] and estrogen [ 121 ] Currently, the extraembryonic membranes of oviparous amniotes are believed to function in the same primary roles that the placenta was assumed to perform before an endocrine role was discovered; i.e. protection, nutrient transfer, gas exchange and waste removal. Yet, it has now been established that both the maternal tissues and the extraembryonic membranes contribute to steroidogenesis in mammalian [ 71 78 79 ] and lizard [ 21 ] placentas. Therefore, one could hypothesize that the extraembryonic

PAGE 59

59 membranes of oviparous amniotes, sharing a conserved evolutionary history, could also perform steroidogenesis. Recently, our laboratory reported that the extraembryonic membranes of one oviparous amniote, the CAM of the chicken ( Gallus gallus ), has the capability to synthesize and respond to the signaling of P4 ( [ 116 ] Chapter 2) We demonstrated that the chicken CAM exhibited mRNA expression of steroidogenic enzymes involved in P4 biosynthesis, was capable of in vitro P4 synthesis, and exhibited mRNA and protein expression of the PR. This indicated that steroidogenic extraembryonic membranes are n ot an exclusive characteristic of viviparous amniotes and we hypothesized that steroidogenic extraembryonic membranes might be an evolutionarily conserved characteristic of all amniotes ( [ 116 ] Chapter 2) Here I i nvestigate d our hypothesis by examining steroidogenesis in the CAM of another oviparous archosaurian amniote, the American Alligator ( Alligator mississippiensis ). If the alligator CAM is capable of steroidogenesis, then it should express the enzymes required for steroid h ormone biosynthesis and the receptors required to respond to steroid hormone signaling. First, I investigate d whether the alligator CAM demonstrate s expression of mRNA coding for the nuclear receptor 5A1 (NR5A1, also named steroidogenic factor 1), a key re gulator of steroidogenesis [ 122 ] and HSD3B1, CYP17A1 and CYP19A1, the key steroidogenic enzymes involved in the synthesis of progestins, androgens and estrogens ; respectively [ 97 ] Second I investigate d if the alligator CAM demonstrates expression of mRNA coding for PR, AR, GR, ESR1 and ESR2, the key receptors responding to the signaling of pr o gestins, androgens, glucocorticoids and estrogens, respectively [ 123 ] In addition, I examine d protein i mmunolocalization to determine if steroid receptor mRNA is translated to a

PAGE 60

60 functional protein in the case of PR and ESR1. Further I examine d whether steroidogenic factor, enzyme and steroid r eceptor mRNA are expressed at the same levels in the alligator CAM or if there are differences in the relative levels of gene expression. In crocodilians, sex is determined by incubation temperature during a critical window of embryonic development, refer red to as the thermo sensitive period (TSP). In the American alligator, the TSP occurs during the embryonic stages 21 to 24 [ 124 ] and eggs incubat ed at 33.0 to 33.5 C result in the development of a male gonad; whereas, eggs incubated at 30 C result in the development of female gonad [ 124 125 ] In the placenta, gene expression has been observed to change du ring the course of pregnancy [ 126 127 ] and to be differentially expressed between male and female fetuses [ 128 ] Therefore I examine d whethe r steroidogenic factor, enzyme and steroid receptor mRNA expression in the CAM changes between the: 1) three embryonic stages corresponding to the stages before, during and after the TSP of sex determination, or 2) incubation temperatures which give rise t o male or female embryos. Materials and Methods Egg Collection and Sample Preparation Fieldwork was conducted under permits from the Florida Fish and Wildlife Conservation Commission ( #WX01310h ). During the summer of 2007, 4 clutches of American alligato r eggs were collected from nests located within Lake Woodruff National Wildlife Refuge (Deland, Florida) and were transported to the University of Florida for incubation. Within 48 h ours of arrival, eggs were candled to assess viability and embryos from 2 to 3 eggs per clutch were used to determine the average embryonic stage of the clutch based on criteria described by Ferguson [ 129 ] Eggs from

PAGE 61

61 each clutch were then evenly distributed for incubation either at a female producing temperature ( FPT ) of 30 C or a male producing temperature (M P T) of 33 C. At embryonic stages 19, 23 and 25, CAMs were dissected away from the embryo and eggshe ll, washed in 1X phosphate buffered saline ( PBS ) and preserved for subsequent analysis. RNA Isolation and Reverse Transcription Dissected CAM was stored in the RNA preservative, RNAlater solution (Ambion) at 4 C overnight and stored at 20 C until RNA i solation Total RNA was isolated from CAM with TRIzol reagent (Invitrogen Life Technologies), purified with the SV Total RNA Isolation System (Promega), and reverse transcribed with the iScript cDNA Synthesis Kit (Bio Rad). Total RNA was treated with ribon uclease free deoxyribonuclease I (DNase I; Qiagen) to remove any genomic DNA contamination. Concentrations and quality of RNA samples were evaluated by measuring optical density with a NanoDrop ND 1000 (Thermo Scientific) and by formaldehyde gel electropho resis. One RNA was reverse transcribed in 20 L reaction and complementary DNA (cDNA) was stored at 20 C until RT qPCR analysis. Real time Q uantitative P olymerase C hain R eaction (RT qPCR) RT qPCR analysis was performed on CAM samples from egg s incubated at either the FPT or MPT at embryonic stages 19 ( FPT n=8, MPT n=8 ), 23 ( FPT n=8, MPT=10 ) and 25 ( FPT n=12, MPT n= 9 ). Complementary DNA was analyzed in triplicate by RT qPCR amplification using an iCycler MyIQ Single Color Real Time PCR Detectio n System (Bio Rad). Each 15 Tris HCl (pH 7.84), 50 mM KCl, 3 mM MgCl 2 20, 0.8% glycerol, 2% DMSO, 200 Fluorescein

PAGE 62

62 Calibration Dye (Bio / L AmpliTag Gold DNA polymerase (Applied Biosystems) and 25 fold dilution of cDNA. RT qPCR amplification conditions included an enzyme activation step of 95C (8 min) followed by 40 cycles ( internal control genes) or 50 cycles (target genes) of 95 C (15 sec) and a primer specific combined annealing/extension temperature (1 min). T he specificity of amplification was confirmed by melt curve analysis. RT qPCR has been used in previous studies to measure mRNA expression levels of each of our target genes in the American alligator [ 130 134 ] Primer pairs were combined and diluted to a final P rimer sequence s, annealing /extension temperatures and GenBank accession number or reference are reported in Table 3 1. Triplicate data for each gene were averaged and mRNA expression levels of the steroidogenic factor (NR5A1) steroidogenic enzymes (CYP17A1, HSD3B1 CYP19A1) and steroid receptors (PR, AR, GR, ESR1, ESR2) were determined by the absolute quantification method [ 87 ] In brief, copy numbers were calculated from the cycle threshold ( Ct ) value by the linear regression of an absolute standard curve. Absolute standard curves for each target gene were generated from a plasmid containing the amplicon of interest at known concentrations as previous ly reported in ( [ 116 ] Chapter 2) (see cloning section below). Controls lacking cDNA template were included on every RT qPCR plate to determine the specificity of target cDNA. Additionally, to confirm that target cDNA was not contaminated by g enomic DNA, RT qPCR was performed with RPL8 primers on the RNA isolated from every sample. RT qPCR Normalization To normalize mRNA expression levels RT qPCR was performed on all samples with three internal control genes: actin, beta (ACTB), 18S ribosoma l RNA ( RN18S1),

PAGE 63

63 and ribosomal protein L8 ( RPL8). For comparisons of embryonic stage effects within an incubation temperature, all samples were normalized using RN18S1 expression. D ata are reported as relative expression and represent mean normalized mRNA transcript percentage in (% of RN18S1 ). For comparisons of incubation temperature effects within each embryonic stage, all samples were normalized using ACTB expression. Data are re ported as relative expression and represent mean normalized mRNA transcript percentage in (% of ACTB). Cloning and S equencing of P lasmids RT qPCR of pooled cDNA was used to generate a PCR product for each primer set and a mplified PCR products were separa ted on a 2% agarose gel and visualized by ethidium bromide on a Gel Doc EQ with Quantity One 4.6 software (Bio Rad). RT qPCR products were purified by Wizard SV Gel and PCR Clean Up System (Promega) and purified samples were confirmed by electrophoresis o n a 2% agarose gel. PCR products were cloned into a pGEM T Vector System (Promega). Plasmid DNA was purified using the Wizard Plus SV Minipreps DNA Purification System (Promega) and sequenced on an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems) us ing a BigDye Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems). The specificity of cloned DNA was confirmed using BLAST against sequences available in Genbank. 1000, converted to copies/ L a nd serially diluted in a solution containing 50 mM Tris HCl (pH 8.3), 75 mM mL of tRNA. Immunohistochemistry and M icroscopy Dissected CAM was fixed in 4% paraformaldehyde at 4C overnight. Tissues were washed in 1X PBS and stored in 75% ethanol at 4C. CAMs were dehydrated,

PAGE 64

64 paraffin embedded and sectioned at 8 microns. Tissue sections were deparaffinized in citrosolv and rehydrated through graded concentrations of ethanol to dionized water Immunohistochemistry was performed using the Vectastain Universal Quick Kit, R.T.U. (Vector Laboratories) with the following modifications: for antigen retrieval, slides were autoclaved for 30 min in 10 mM sodium citrate buffer (pH 6.0). Sections were treated with 3% hydrogen peroxide for 20 mi n at room temperature blocked in normal horse serum (NHS) for 1h and treated with the Avidin Biotin blocking kit (Vector Laboratories). Between all incubation steps, slides were washed in 0.1 M Tris buffered saline (TBS, pH 7.6) (5 min), 0.1 M TBS contai ning 0.2% Tween 20 (5 min), and again in TBS (5 min). CAM sections from stage 19 (n= 3 ) stage 23 (n= 2 ) and stage 25 (n=3) were incubated at a 1:50 dilution of mouse monoclonal anti progesterone receptor antibody (Ab 8 ) or a 1:1000 dilution of mouse monocl onal anti estrogen receptor (Ab 10) Thermo Scientific. Sections were treated with 3, 39 diaminobenzidine (Vector Laboratories) for 1.5 min for PR or 30 sec for ESR1 and washed in running tap water for 5 min A control section receiving normal horse serum in place of primary antibody was included on every slide. Slides were dehydrated, cleared and mounted with Permount mounting media (Fisher Scientific). Sections were imaged using a n Olympus BX60 microscope under differential inference contrast (DIC) and Z eiss AxioCAM MR3 camera with Zeiss AxioVision LE 4.8.2 software. Statistical A nalysis All statistical analyses were performed in the R statistical programming environment version 2.13.1 [ 95 ] For gene expression analyses, the total numbers of mRNA transcripts for 3 internal control and 9 target genes from the CAM were determined by RT qPCR. For internal control gene analysis, I used linear mixed effects

PAGE 65

65 models (LMMs) to estimate mRNA expression In th ese analys e s embryonic stage and incubation temp erature were fixed effects on mRNA expression and RT qPCR plate was treated as a random effect Model assumptions were evaluated visually via examination of residuals and QQ plots and log or square root transformations were performed when necessary to norm alize errors To quantify relative expression of target genes, I normalized each sample to RN18S1 expression f or comparisons of embryonic stage effects within an incubation temperature and to ACTB expression for comparisons of incubation temperature effects within each embryonic stage I used two different normalization genes for these analyses because I was unable to isolate a single control gene that was unaffected by both incubation tempera ture and embryonic stage, see results section for further explanation I used LMMs to compare relative mRNA expression for the three embryonic stage s In these analys es embryonic stage was treated as a fixed effect, and RT qPCR plate and maternal clutch w ere treated as random effects. Inclusion of m aternal clutch ; however, did not significantly reduce model deviance and was excluded from the model for all genes except NR5A1 and CYP17A1 at the FPT Model assumptions were evaluated visually via examination o f residuals and QQ plots and log or square root transformations were performed when necessary to normalize errors. Outliers were identified from residuals and QQ plots and removed from the study (note that inclusion of outliers did not change patterns of i nference but were excluded from the final analysis because they have a disproportionate influence on mean estimates and caused violations of normality). The assumption of homogeneity of variances was met for all genes. Two samples were lost in preparation for the RT qPCR run of NR5A1

PAGE 66

66 and account for the difference in the number of starting samples f or NR5A1 as compared to the other genes. T o analyze each target gene for incubation temperature effects within an embryonic stage I used unpaired, two sided S test to compare means from CAMs incubated at the FPT to means from CAMs incubated at the MPT within each embryonic stage. Assumptions of normality were evaluated with a two sided F test and log transformations were performed when necessary to no rmalize errors. In the event that error structure could not be normalized by transformation as was the case in ESR1 at embryonic stage 23, the Welch (Satterthwaite) approximation for the effective degrees of freedom was used. R esults Internal Control Exp ression among Embryonic Stages and between Incubation Temperatures A significant change was observed in each of our internal control genes associated with developmental conditions, either among embryonic stages or between incubation temperatures. I found t hat both ACTB and RPL8 expression was different among embryonic stages, but neither ACTB nor RPL8 were differentially expressed between incubation temperatures ( Figure 3 1 ). In contrast, RN18S1 expression was not different among embryonic stages but was differentially expressed between th e two incubation temperatures (Figure 3 1) In an attempt to correct for this problem, the geometric mean was calculated according to geNORM [ 88 ] which generate d a normalizatio n factor (NF) for each sample. Unfortunately, the NF was also different among embryonic stages as well as between incubation t emperatures (Figure 3 1). Due to these limitations, I was unable to perform multiple comparisons between embryonic

PAGE 67

67 stages and incubation temperatures and was confined to making comparisons of incubation temperature effects within each embryonic stage and e mbryonic stage effects within each incubation temperature. Steroidogenic Factor, Enzyme and Steroid Receptor Expression among Embryonic Stages I identified for the first time the pr esence of steroidogenic factor and enzyme mRNA s in the CAM of an oviparou s reptile. At both the female and male producing temperatures, mRNA expression levels of steroidogenic factor and enzymes exhibited NR5A1 was the highest expressed factor and CYP19A1 was the lowest expressed enzyme, whereas HSD3B1 and CYP17A1 were expressed at similar relative levels (Fig ure 3 2 Fig ure 3 3 ). T he effect of embryonic stage on the level of steroidogenic factor and enzyme mRNA in the alligator CAM was examined a t the two incubation temperatures. At both incubation temperatures, there was significant mRNA expression of the s teroidogenic factor and enzymes (Table 3 2). At the female producing temperature (FPT), the level of expression did not change significantly a mong embryonic st ages for CYP19A1 (Figure 3 2). However, mRNA expression of NR5A1 decreased 2.6 fold, HSD3B1 decreased 7.5 fold and CYP17A1 decreased 6.5 fold between embryonic stages 19 and 25 (Fig ure 3 2 ). A t the male producing temperature ( MPT ), mRNA ex pression of NR5A1 decreased 2.4 fold, HSD3B1 decreased 9 fold and CYP17A1 decreased 4.5 fold between embryonic stage 19 and 25 (Figure 3 3). In contrast, CYP19A1 expression increased 1.5 fold between embryonic stage 19 and 25 ( Figure 3 3 ).

PAGE 68

68 Additionally, I show for the first time the pr esence of steroid receptor mRNA s in the CAM of an oviparous reptile. At both incubation temperatures and all three embryonic stages, the mRNA expression levels of steroid receptors exhibited the pattern GR > ESR1 > PR > AR > ESR2 (Figure 3 4, Figure 3 5). GR was the most highly expressed steroid receptor and ESR2 was the lowest expressed receptor, ESR1 exhibited the second highest level of relative expression and was expressed at approximately an order of magnitude higher tha n PR and AR, which had similar relative levels of expression, but with PR > AR (Figure 3 4, Figure 3 5). At both incubation temperatures there was significant expression of steroid receptor mRNA (Table 3 2). At the FPT, t he level of expression did not ch ange significantly among embryon ic stages for PR (Figure 3 4) ; however, mRNA expression of AR decreased 3.8 fold and GR and ESR1 both decreased 2 fold between embryonic stage 19 and 25; w hereas, ESR2 expression increased 12.3 fold between embryonic stage 1 9 and 25 (Fig ure 3 4 ). A t the MPT, the expression of ESR1 d id not change significantly among embryon ic stages (Figure 3 5). However, t he expression of PR decreased 1.8 fold, AR decreased 4 fold and GR decreased 2.8 fold between embryonic stage 19 and 25 ; wh ereas ESR2 increased 2 fold between embryonic stages 19 and 23 (Fig ure 3 5 ). Steroidogenic Factor, Enzyme and Steroid Receptor Expression between Incubation Temperatures Next, I examined the effect of incubation temperature on the level of mRNA expres sion at three embryonic stages. At embryonic stage 19, the expression of CYP17A1 and CYP19A1 was not different between CAMs incubated at the FPT or MPT (Table 3 3). H owever, NR5A1 expression was 1.5 fold greater and HSD3B1 expression

PAGE 69

69 was 2.8 fold greater i n CAMs incubated at the MPT than at the FPT ( Table, 3 3, Fig ure 3 6 ). Additionally at stage 19, the expression of AR GR and ESR1 was not different between CAMs incubated at the FPT or MPT (Table 3 3), whereas PR expression was 1.3 fold greater and ESR2 ex pression was 4 fold greater in CAMs incubated at the MPT than at the FPT ( Table, 3 3, Fig ure 3 6 ). At embryonic stage 23, the expression of steroidogenic factor and enzyme mRNA was not different between CAMs incubated at the FPT or the MPT (Table 3 3 ). L ikewise, the expression of PR, AR and ESR2 was not different between the incubation temperatures (Table 3 3) However, GR expression was 1.4 fold greater and ESR1 expression was 1.9 fold greater in CAMs incubated at the FPT than the MPT ( Table 3 3, Fig ure 3 7 ). Finally, at embryonic stage 25, expression of steroidogenic factor and enzyme s as well as the expression of steroid receptor mRNA s was not different between CAMs incubated at the FPT or the MPT (Table 3 3). PR and ESR1 Immunolocalization For two of the steroid receptors, I sought t o determine if PR and ESR1 mRNA was translated to protein I performed immunolocalization of the nuclear PR and ESR1 and observed that both PR (Figure 3 8) and ESR1 (Figure 3 9) were predominately localized to the nucle us in the chorionic and allantoic epithelium and in the epithelial cells of mesenchymal blood vessels Positive nuclear staining of both PR and ESR1 was also present to a lesser degree in the mesenchyme. Discussion A ll amniote embryos form common extraem bryonic membranes during development, thus studies of steroidogenesis in the chorioallantoic membrane from

PAGE 70

70 oviparous vertebrates can increase our understanding of how the chorioallantoic placenta evolved as an endocrine organ. Albergotti et al. ( [ 116 ] Chapter 2) were the first to evaluate the presence of steroidogenic enzymes in the CAM of an oviparous amniote and found that the chicken CAM exhibited mRNA expression of steroidogenic acute regulatory protein (StAR) ,cytochrome P450 11A1 (CYP11A 1), HSD3B1, CYP17A1 and hydroxysteroid (17 beta) dehydrogenase. Like the chicken, the alligator CAM exhibit ed mRNA expression of HSD3B1 and CYP17A1. In addition, I have shown the expression of mRNA coding for CYP19A1 and the steroidogenic factor, NR5A1, fo r the first time in the CAM of an oviparous amniote The presence of steroidogenic factor and enzyme mRNAs supports our hypothesis that the alligator CAM has the potential at the molecular level to regulate and synthesize steroid hormones. NR5A1, belongs to the steroid receptor family of transcription factors and is considered a master regulator of steroidogenesis [ 122 ] In the alligator CAM, NR5A1 was more highly expressed than any of the steroidogenic enzymes examined, suggesting a role for NR5A1 in the regulation of steroidogenesis in this tissue. HSD3B1 and CYP17A1 were expressed at greater relative levels than CYP19A1, possibly suggest ing that the CAM syn thesizes proges tins and androgens at a higher level than estrogens. In eutherian placentae, it is typical to see differences in the steroidogenic factors and enzymes expressed and species related differences are evident in the expression of HSD3B1, CYP17A1 and CYP19A1 as well as the corresponding hormones synthesized [ 111 ] HSD3B expression and the ability to synthesize P4 appear to be a fundamental ch aracteristic of steroidogenic placentae (except canine) [ 127 135 137 ] although the timing and level of expression varies and species differences are evident in

PAGE 71

71 the isoforms of HSD3B expressed in the placenta [ 97 ] CYP 17A1 expression and androgen b iosynthesis is present in the placenta of some species, such as rat, pig, sheep and cow [ 126 135 136 138 139 ] ; but is lacking in the horse, baboon and human placenta, requiring these species to utilize a non placental source of androgens for placental synthesis of estrogens [ 72 111 140 ] Expression of CYP19A1 and the abilit y to synthesize estrogens is found in the placenta of human, horse, cow, pig and sheep; however, CYP19A1 and estrogen biosynthesis is lacking in the mouse and rat placenta [ 135 139 141 142 ] Given that eutherian placentae vary in how steroidogenesis is accomplished and what steroid hormones are synthesized, it is not surprising that the alligator CAM would also reflect differences in the relative levels of steroidogenic enzymes expressed and the potential steroid hormones synthesized. Albergotti et al. ( [ 116 ] Chapter 2) reported the presence of steroid receptors in the CAM of an oviparous amniote ; that is, they found that the chicken CAM exhibited both mRNA and protein expressio n of the PR and mRNA expression of ESR1. Like the chicken, PR and ESR1 mRNAs were present in the alligator CAM and I have also shown mRNA expression of AR, GR and ESR2 for the first time in an oviparous CAM, which supports our hypothesis that the oviparous CAM has the molecular capability to respond to steroid hormone signaling. In addition, I have demonstrated that mRNA is translated to the protein level for at least two of the steroid receptors examined, PR and ESR1. I observed that GR was the most high ly expressed steroid receptor with average expression an order of magnitude higher than ESR1. ESR1, which demonstrated the second highest level of expression was an order of magnitude higher than PR and AR,

PAGE 72

72 which had similar levels of relative expression, but with PR > AR. ESR2 was also present in the alligator CAM, but was expressed at relatively low levels. The levels of steroid receptor expression found here could reflect the relative importance of the alligator CAM to be able to respond to glucocorticoi ds, estrogens, progestins and androgens, respectively. However, it is well established that transcription do es not always reflect translation to functional protein. As with the steroidogenic factor and enzymes reported above, future work has to examine the translation of mRNAs into active proteins before we can establish function or signal reception in the CAM tissues of the American alligator. Unfortunately, there is very little known about how the relative levels of steroidogenic factor, enzyme and steroi d receptor mRNA compare to one another in the placenta. Many studies have identified the presence of or quantified the expression of one or two of these factors in a single study, but to the best of my knowledge, a comparison of the relative levels of mRNA as undertaken here in the CAM has not been conducted in placental tissues. In the placenta, GR in conjunction with the placental enzyme, 11 hydroxysteroid dehydrogenase (11 HSD), which catalyzes the interconversion of biologically active and inactive glucocorticoids, are important regulators of glucocorticoid action [ 119 ] Glucocorticoids have been shown to be influence placental gene expression [ 143 145 ] placental and fetal growth [ 145 ] placental vascularity [ 146 ] and timing of birth [ 147 ] During pregnancy, the human placenta synthesizes increasing concentrations of E2 and P4 [ 117 ] E2 acting through ESR1 has been suggested to promote normal placental development [ 120 ] and both ESR1 and ESR2 appear to play a role in human trophoblast differentiation [ 121 ] E2 also plays a role in the regulation of placental P4

PAGE 73

73 synthesis, which occurs in conjunction with autoregulation by P4 itself, acting through PR [ 117 148 ] P4 is not o nly instrumental in the maintenance of pregnancy [ 72 ] and timing of parturition [ 73 ] but has also been shown to promote placental [ 74 75 ] and fetal [ 74 ] growth and is suggested to play a role in human fetoplacental vascularization [ 109 110 ] AR mediated actions of androgens on the placenta remain specul ative at this point in time; however, recent work has demonstrated the presence of AR mRNA and protein in human placenta and also noted that AR mRNA expression is increased in placentae from preeclamptic pregnancies [ 118 ] Currently, I can only speculate on the role of steroid hormones in the physiology of the alligator CAM. I hypothesize that steroid hormones might have similar roles as in eutherians and act to regulate gene expression, infl uence differentiation, development, growth and vascularization of the CAM as well as play a potential role in the maintenance of embryonic development, timing of hatch and growth of the embryo. Placental gene expression has been observed to change with de velopment [ 126 127 ] and fetal sex [ 128 ] ; therefore, I investigated whether steroidogenic factor, enzyme and steroid receptor mRNA expression in the CAM changes among the embryonic stages corresponding to before, during and after the TSP or the incubation temperatures which give rise to either a male or femal e embryo. Overall, I found that all of the genes examined changed among the embryonic stages of our study either at one or both of the incubation temperatures (Figure 3 2 through Figure 3 4 ) and several genes were expressed differently between incubation t emperatures (Figure 3 6, Figure 3 7 ) suggesting that steroidogenic factor, enzyme and steroid receptor mRNA expression is affected by conditions, such as developmental stage and temperature.

PAGE 74

74 With the exception of CYP19A, which increased in expression betwe en stage 19 and 25 in CAMs incubated at the MPT and ESR2, which increased in expression between stage 19 and 25 in CAMs at both incubation temperatures, all of the genes exhibiting significant changes among embryonic stages showed decreased expression at s tage 25 relative to stage 19 or 23. This general pattern of decreased gene expression at stage 25 suggests that the CAM could shut down steroidogenesis at this point in embryonic development. The staging system used for the alligator (and many other specie s) is based on the accumulation of morphological traits and the stage numbers used are somewhat deceiving as they imply a linear time scale. However, alligator developmental stages are not linear in terms of the embryonic days between each stage [ 149 ] Stage 25 is late in the developmental process and since this tis sue will be discarded at hatch, the CAM could shut down steroidogenesis or even processes in general ,as evident from decreased expression of ACTB and RPL8 at stage 25 (Figure 3 1). I note that our results showing either no change in expression among emb ryonic stages or decreased mRNA expression at stage 25 relative to stage 19 or 23 are different than our previous report on the chicken CAM, in which expression of HSD3B1, PR and ESR1were found to increase between day 8 and 18 of development [ 116 ] One possible explanation for this discrepancy is that our study did not survey gene expression across embryonic development in the same manner as in the chicken CAM, which examined expression on a linear time scale of days rather than by stages and s panned the days immediately following the formation of the CAM to right before hatch, making it difficult to directly compare the patterns of expression between these two studies. Despite these distinctions; however, it does appear that the chicken and

PAGE 75

75 all igator CAM could differ in the developmental expression of these genes. We have limited developmental data on embryonic plasma concentrations of steroid hormones in the American alligator. However, it has been shown that plasma concentrations of P4 are hig hest around the TSP period (stages 21.5 to 22.5 for males; 20 to 23.5 for females), declining thereafter and remaining low for the second half of incubation [ 150 ] This pattern is in stark contrast to embryonic plasma P4 in the chicken, which steadily increases from day 9 to day 20 [ 151 ] and could possibly account for the differences I observed between alligator and chicken CAM expression of HSD3B1 and PR. The placenta has hi storically been viewed as an asexual organ; however, a growing number of studies are reporting sexually dimorphic patterns of placental gene expression between male and female fetuses (as reviewed in [ 152 ] ). For example, M ao et al. (2010) [ 153 ] reported that murine placental expressions of several isoforms of H SD3B as well as ESR1 are influenced by fetal sex and maternal diet. Within the same dietary groups, ESR1 was upregulated in female placentae relative to male placentae and Hsd3b5 was upregulated in male placentae relative to adjacent female placentae [ 153 ] At the embryonic stage immediately prior to the TSP, I observed that the alligator CAM e xhibit ed a temperature dependent pattern of expression of NR5A1, HSD3B1, PR and ESR2 with CAMs incubated at the MPT showing higher levels of expression than those incubated at the FPT (Figure 3 6) Additionally, I found that during the TSP, the alligator C AM showed a temperature dependent pattern of expression of GR and ESR1 with CAMs incubated at the FPT showing higher levels of expression than those incubated at the MPT (Figure 3 7 ).

PAGE 76

76 While the underlying molecular mechanisms of temperature sex determina tion ( TSD ) remain unresolved, it has been suggested that temperature can either directly or indirectly stimulate or suppress the expression of steroidogenic factors, enzymes and steroid receptors [ 154 157 ] that could play a role in TSD. Because sex has yet to be determined at embryonic stage 19 in the alligator, the temperature dependent express ion that I observed at this stage could simply be a direct or indirect result of incubation temperature, i.e., the higher temperature of the MPT enhanced CAM expression of NR5A1, HSD3B1, PR and ESR2 or it could suggest that embryo physiology is different b etween embryos fated to develop as male or female prior to the stage of actual gonadal differentiation. Likewise, the temperature dependent expression of ESR1 and GR observed in the CAM during the period of sex determination could again simply be a result of incubation temperature or it could reflect a sexually dimorphic pattern of gene expression in this tissue, but at this time I am unable to distinguish between these possibilities. Our study demonstrates that t he oviparous alligator CAM has the molecular mechanisms in place to perform biosynthesis of progestins, androgens and estrogens. I have not demonstrated; however, that the alligator CAM has the molecular mechanisms to perform de novo steroid synthesis, whi ch would require demonstration of STAR [ 158 ] and CYP11A1 [ 97 ] Albergotti and Guillette [ 36 ] suggested a model for the evolution of endocrine function in the reptilian yolk sac and CAM in which the CAM evolved the ability to biotransform yolk steroids as well as synthesize steroid hormones de novo It is well established that the yolk of oviparous amniotes is a rich source of maternally derived steroid hormones [ 159 ] While the majority of studies have focused on the

PAGE 77

77 abundance and distribution of A, T and E2 in the yolk, recent work has indicated that P4 is present in considerably greater concentrations than both E2 and T in American alligator yolk [ 160 ] Typically, yolk steroid concentrations are initially high and then begin to decline at some point during embryonic development [ 99 161 162 ] Yolk P4 concentrations are highest at oviposition and then decline through embryonic development in the re d eared slider turtle ( Trachemys scripta ) [ 161 ] Yolk A, T and E2 concentrations are relatively stable between embryonic stage 16 to 21 in the American alligator, but then dec line dramatically in subsequent stages [ 163 ] If the CAM is indeed capable of converting maternal yolk hormones, then decreasing yolk steroids through development could result in decreased substrate available for these processes. In addition to maternal yolk steroids, another possibility is that t he CAM is utilizing hormones synthesized by the embryo. In contrast to yolk steroids, which are steroid hormones until after gonadogenesis [ 164 165 ] Here, I have discuss ed yolk and were independent entities; however, the yolk sac, embryo and CAM are all connected t hrough circulation and the more realistic picture is that there is significant interplay and transfer of chemical messengers [ 36 ] The fact that the oviparous CAM expresses steroidogenic enzymes, which could play a role in converting yolk steroids, raises some interesting possibilities. Currently, it is still not fully understood how steroids are mobilized from the yolk to the embryo, and how and where yolk steroids are metabolized and exert their actions [ 159 ] Despite numerous studies documenting a decrease in yolk steroids during embryonic development, the explanation for this

PAGE 78

78 phenomenon remains to be elucidated [ 159 166 ] Recently, Paitz et al showed that whole egg hormone concentrations in European starlings ( Sturnus vulgaris ) decline during embryonic development and that exogenous T in the yolk was metabolized by yolk albumen extraembryonic membrane homogenates, supporting a hypothesis that a decrease in yolk steroid concentrations is due to metabolism rather than dilution by or leaching to the albumen [ 167 ] I hypothesize that the CAM plays a role in the biotransformation of steroid hormones deposited in the yolk and synthesized by the embryo. Steroid metabolism in the eutherian placentae facilitates the regulation of maternal and fetal hormone environm active hormones to inactive metabolites to prevent the diffusion of potentially harmful hormones between the mother and fetus. However, metabolism of biologically inactive steroid metabolites to their active forms is also an important feature of the placenta. For example, estrogen sulfotransferase in the placenta catalyzes the sulfoconjugation of active estrogens and renders them hormonally inactive [ 112 168 ] ; whereas, steroid sulfatase catalyzes the hydrolysis of inactive, conjugated steroids and converts them into biologically active hormones [ 112 169 ] It was recently reported that estrogen sulphotransferase activity is increased in the yolk and extraembryonic membranes of the red eared slider turtle [ 162 ] during the period of incubation when yolk E2 concentrations have been observed to declin e naturally [ 162 ] and r adioactive labeled E2 was shown to be converted to a water soluble metabolite [ 170 ] From these embryonic memb ranes of oviparous

PAGE 79

79 amniotes may serve an important role in metabolizing maternal steroids, just as they do in placental mammals [ 167 ] T he chicken ( [ 116 ] Chapter 2) and alligator studies suggest that at the molecular level, the oviparous CAM of archosaurs shares the abi lity to synthesize steroid hormones. In addition, these two studies suggest that at the molecular and protein level the archosaurin CAM shares the ability to respond to steroid hormone signaling. Collectively, our findings support the hypothesis that ster oidogenesis and steroid hormone signaling of extraembryonic membranes could be an evolutionary conserved characteristic of amniotes. However, more work is needed and future studies should attempt to investigate protein and functional levels of s teroid bios ynthesis and steroid hormone signaling in oviparous extraembryonic membranes.

PAGE 80

80 Table 3 1 Alligator PCR primers used for RT Quantitative real time PCR Gene Direction Annealing (C) GenBank accession number or refere nce ACTB Sense ATGAGGCCCAAAGCAAAAGA 60 DQ421415 Antisense CCCAGTTGGTGACAATGCC RN18S1 Sense GTCCGAAGCGTTTACTTTGA 59.2 AF173605.1 Antisense TCTGATCGTCTTCGAACCTC RPL8 Sense GGTGTGGCTATGAATCCTGT 62.9 Katsu et al. (2004) Antisense ACGACGAGCAGCAATAAGAC NR5A1 Sense CAGTCTCGAATGTGAAATACCTGGA 66.4 AF180296 Antisense CGCGTTGGCCTTCTCCT CYP17A1 Sense CCAGAAAAAGTTCACCGAGCAC 62.9 DQ007997 Antisense CGGCTGTTGTTGTTCTCCATG HSD3B1 Sense GTGATCCCATCTGCAATGGTG 60 Milnes et al. (2008) Antisense CCATCTGCCTTCAGGACATGTT CYP19A1 Sense CAGCCAGTTGTGGACTTGATCA 62 AY029233 Antisense TTGTCCCCTTTTTCACAGGATAG PR Sense AAATCCGTAGGAAGAACTGTCCAG 67.5 AB115911 Antisense GACCTCCAAGGACCATTCCA AR Sense TGTGTTCAGGCCATGACAACA 66.5 AB186356 Antisense GCCCATTTCACCACATGCA GR Sense AAAAAACTGTCCCGCATGCC 66.5 AF525750 Antisense CGTTGGACTGCTGAATTCCTTT ESR1 Sense AAGCTGCCCCTTCAACTTTTTA 66.5 AB115909 Antisense TGGACATCCTCTCCCTGCC ESR2 Sense AAGACCAGGCGCAAAAGCT 65 AB115910 Antisense GCCACATTTCATCATTCCCAC

PAGE 81

81 Table 3 2. Statistic summary of RT Quantitative real time PCR on the alligator CAM at three embryonic stages. Gene Incubation temperature a Expression of mRNA b Expression among embryonic stages b Expression between stages NR5A1 FPT F 1, 13 = 4349.9 7, *** F 2 13 = 6.18, ** 19>25 HSD3B1 FPT F 1, 22 = 100.4, *** F 2 22 = 8.72, ** 19>25 CYP17A1 FPT F 1, 14 = 6687.67 *** F 2 14 = 37.87, *** 19>25 CYP19A1 FPT F 1, 23 = 9679.71 *** F 2 23 = 0.3, ns ns NR5A1 MPT F 1, 21 = 13533.94 *** F 2 21 = 7.21, ** 19>25 HSD3B1 MPT F 1, 21 = 176.09 *** F 2 21 = 23.98, *** 19>25 CYP17A1 MPT F 1, 21 = 2637.19 *** F 2 21 = 18.24, *** 19>25 CYP19A1 MPT F 1, 22 =34.34, *** F 2 22 =3.81, 19<25 PR FPT F 1, 23 = 11665.37 *** F 2 23 = 2.0, ns ns AR FPT F 1, 23 = 6082.12 *** F 2 23 = 10.76, *** 19>25 GR FPT F 1, 23 = 7670.70 *** F 2 23 = 7.66, ** 19>25 ESR1 FPT F 1, 22 = 269.03, *** F 2 22 = 5.55, 19>25 ESR2 FPT F 1, 22 =94.51 *** F 2 22 = 8.01, ** 19<25 PR MPT F 1, 22 = 18703.15 *** F 2 22 = 7.21, ** 19>25 AR MPT F 1, 22 = 2390.45 *** F 2 22 = 10.75, *** 19>25 GR MPT F 1, 22 = 41.94 *** F 2 22 = 17.66, *** 19>25 ESR1 MPT F 1, 22 = 192.21 *** F 2 22 = 3.56, ns ns ESR2 MPT F 1, 22 =7.54 ** F 2 22 = 3.82, ** 19<23 a FPT = female producing temperature; MPT = male producing temperature b Data presented as F(df)=, p value= *** p < 0.000 1 ** p<0.01 p<0.05 ns=not significant

PAGE 82

82 Table 3 3. Statistic summary of RT Quantitative real time PCR on the alligator CAM at two incubation temperatures. Gene Stage 19 a FPT vs. MPT b Stage 23 a FPT vs. MPT b Stage 25 a NR5A1 t(13)=2.30, FPTMPT t(19)=1.52, ns ESR1 t(14)=1.14, ns ns t(12.15)=2.85, ** FPT>MPT t(19)=0.50, ns ESR2 t(14)=2.60, FPT
PAGE 83

83 Figure 3 1. mRNA expression of internal control genes in alligator CAM. RT qPCR analysis of mRNA coding for ACTB, RPL8, and RN18S1 at embryonic stages 19 23 and 25 in CAMs incubated at the FPT (filled circles) or MPT (open squares) The normalization factor (NF) generated according to geNORM is also shown. ACTB, RN18S1 and RPL8 d ata are reported as mRNA SEM. NF data are reported as normalized expression and represent the geometric mean of the three internal control genes SEM

PAGE 84

84 Figure 3 2. Relative mRNA expression of steroidogenic factor and enzymes in the alligator CAM incubated at the FPT RT qPCR analysis of mRNA coding for NR5A1, HSD3B1, CYP17A1, and CYP19A1at embryonic stages 1 9, 23, and 25. Data are reported as relative mRNA expression and represent mean normalized mRNA transcript percentage in (% of RN18S1) SEM.

PAGE 85

85 Figure 3 3. Relative mRNA expression of steroidogenic factor and enzymes in the alligator CAM incubated at the MPT RT qPCR analysis of mRNA coding for NR5A1, HSD3B1, CYP17A1, and CYP19A1at embryonic stages 19, 23, and 25. Data are reported as relative mRNA expression and represent mean normalized mRNA transcript percentage in (% of RN18S1) SEM.

PAGE 86

86

PAGE 87

87 Figure 3 4 Relative mRNA expression of steroid receptors in the alligator CAM incubated at the FPT RT qPCR analysis of mRNA coding for PR, AR, GR, ESR1, and ESR2 at embryonic stages 19 23 and 25 Data are reported as relative mRNA expression and represent mean nor malized mRNA transcript percentage in (% of RN18S1 ) SEM.

PAGE 88

88

PAGE 89

89 Figure 3 5. Relative mRNA expression of steroid receptors in the alligator CAM incubated at the MPT RT qPCR analysis of mRNA coding for PR, AR, GR, ESR1, and ESR2 at embryonic stages 19, 23, a nd 25. Data are reported as relative mRNA expression and represent mean normalized mRNA transcript percentage in (% of RN18S1) SEM.

PAGE 90

90 Figure 3 6. Relative mRNA expression of NR5A1, HSD3B1, PR, and ESR2 in the alligator CAM between incubation temperatures at embryonic stage 19. FPT data are represented as filled circles and MPT data are represented as open squares. Data are reported as relative mRNA expression and represent mean normalized mRNA transcript percentage in (% of ACTB ) SEM.

PAGE 91

91 Fig ure 3 7 Relative mRNA expression of GR and ESR1 in the alligator CAM between incubation temperatures at embryonic stage 23. FPT data are represented as filled circles and MPT data are represented as open squares. Data are reported as relative mRNA express ion and represent mean normalized mRNA transcript percentage in (% of ACTB ) SEM.

PAGE 92

92 Figure 3 8. PR immunolocalization in the alligator CAM (A) Positive nuclear staining of PR was localized to the chorionic epithelium (c) and epithelial cells of blood v essels (bv ). (B) Nuclear staining was also observed in the allantoic epithelium and mesenchyme (m). (C) Positive CAM section corresponding to the (D) n egative control incubated without primary PR antibody Negative control CAM section d id not show specific nuclear staining. Scale bar represents 50 microns

PAGE 93

93 Figure 3 9. ESR1 immunolocalization in the alligator CAM (A) Positive nuclear staining of ESR1 was localized to the chorionic epithelium (c) and mesenchyme (m) (B) Nuclear staining was also observed in the allantoic epithelium and (C) in the epithelial cells of blood vessels (bv ). (D) Negative control of corresponding CAM section shown in (C) incubated without primary ESR1 antibody d id not show specific nuclear staining. Scale bar represents 50 microns

PAGE 94

94 CHAPTER 4 THE OVIPAROUS CHORIO ALLANTOIC MEMBRANE O F THE RED BELLY SLIDER TURTLE ( PSEUDEMYS NELSONI ) HAS THE CAPABILITY T O SYNTHESIZE PROGESTERONE AND RES POND TO STEROID HORM ONE SIGNALING The formation of a sing le extraembryonic membrane during development, the yolk sac, characterizes the ancestral condition of vertebrates [ 1 56 ] In addition to the yolk sa c, the amniote (reptile, bird and mammal) ancestral condition is characterized by the formation of three additional extraembryonic membranes, the amnion, chorion and allantois [ 1 ] These four extraembryonic membranes of the amniote egg ga ve rise to the placenta, which Mossman (1987) described as an apposition of extraembryonic [ 56 ] Thus, it is not surprising that the amniote extraem bryonic membranes of oviparous (egg laying) species and placentae of viviparous (live bearing) species perform similar functions to meet the gas, water, and nutrient demands of the embryo [ 56 ] Of the four extraembryonic membranes, the chorion and allantois fuse early in embryonic development to form either the chorioallantoic membrane (CAM) in oviparous species or the chorioallantoic placenta in viviparous species [ 83 ] Both the CAM and the chorioallantoic placenta are highly vascularized structures and perform respiratory functions by providing gas exchange between the developing embryo and its external environment [ 171 172 ] i.e., the nest environment in oviparous species or the ute r ine environment in viviparous species. We have previously stated ( [ 36 ] Chapter 1), that this conservation of basic function s of amniote extraembryonic membranes indicates that little specialization of these membranes is required in the transition from oviparity to viviparity. This explains why the majority of viviparous squamates (lizards and snakes) exhibit a relatively simpl e

PAGE 95

95 chorioallantoic placenta that appears to predominately function in gas exchange. The CAM and chorioallantoic placenta are organs of transport, not only of gases, but also of water and other inorganic ions essential for embryonic development, such as calc ium, potassium and phosphorus ( [ 173 ] as reviewed in [ 174 ] ). In some viviparous species, the ch orioallantoic placenta takes on additional roles in the transfer of nutrients, and in the most complex placental types, will transport all or the majority of nutrients the embryo requires for development (as reviewed in [ 174 175 ] ). Still another transport function of the chorioallantoic placenta involves the transfer of steroid hormones between maternal and fetal environments [ 176 ] Yet, the chorioallantoic placenta not only transports steroid hormones, but also synthesizes, metabolizes and responds to an array of hormones critical for embryonic development and surviva l [ 111 153 177 178 ] I n euther ian mammals progesterone (P4) synthesized by the placenta promotes uterine quiescence and the maintenance of pregnancy [ 179 ] timing of parturition [ 73 ] and fetal [ 74 ] and placental growth [ 75 76 ] Placental P4 synthesis is not an ex clusive characteristic of eutherian mammals as the ability to synthesize P4 has been demonstrated in even the simplest chorioallantoic placenta of viviparous squamates [ 77 ] which is simply an apposition of the CAM to the uterine epithelium without any anatomical specializations in either structure [ 41 ] Further, placental P4 synthesis is not an exclusive characteristic of the maternal contribution to the placenta and it is now evident that maternal and extraembryonic tissues alike contribute to steroidogenesis in mamma lian [ 71 78 79 ] and lizard [ 21 ] placentae. Therefore we hypothesized that CAM s of oviparous amniotes, sharing

PAGE 96

96 conserved basic functions and evolutionary history, could also perform steroidogenesis and respond to steroid signaling [ 36 116 ] Albergotti et al. demonstrated that the CAM of one oviparous amniote, the chicken, shares the capability of chorioallantoic placenta e to synthesize and respond to the signaling of P4 ( [ 116 ] Chapter 2). The chicken CAM exhibited mRNA expression of steroidogenic enzymes involved in P4 biosynthesis, was capable of in vitro P4 synthesis, and exhibited mRNA and protein expression of the progesterone receptor (PR) which indicat ed that steroidogenic and steroid responsive extraembryonic membranes are not exclusive characteristics of viviparous amniotes ( [ 116 ] Chapter 2). In addition, I have demonstrated that the CAM of another oviparous amniote, the American Alligator ( Alli gator mississippiensis ), exhibits mRNA expression of steroidogenic enzymes and mRNA and protein expression of the PR and estrogen Chapter 3). Our previous studies in the chicken and alligator suggest that the oviparous CAM of archosaurs shares the capability to synthesize steroid hormones at the molecular level and respond to steroid hormone signaling at the molecular and protein level. Collectivel y, this work support s our hypothesis that steroidogenesis and steroid hormone signaling of extraembryonic membranes could be an evolutionary conserved characteristic of amniotes. Here, I move d beyond oviparous archosaurs and investigate d the potential ster oid activity in the CAM of the Red belly Slider Turtle ( Pseudemys nelsoni ) The placement of turtles in the amniote phylogeny remains unresolved [ 180 ] However, birds, crocodilians, turtles and the tuatara represent the main lineages of extant amniotes that reproduce strictly by oviparity [ 7 180 181 ] The aim of our study was to investigate a

PAGE 97

97 third branch of the oviparous amniote phylogeny in an attempt to uncover a potentially conserved trait of amniote extraembryonic membranes. I examine d the capability of the turtle CAM to perform steroid synthesis and respond to steroid hormone signaling. If the turtle CAM has similar steroidogenic properties as the chorioallantoic placenta, then it should synthesize key placental hormones, such as P4. T o investigate steroid hormone synthesis, I examine d the ability of the turtle CAM to perform in vitro P4 synthesis Likewise, if the turtle CAM has similar steroid signaling properties as the chorioallantoic placenta, then it should have the capability to respond to signaling through steroid receptors. To investigate steroid hormone signaling, I examine d turtle CAM expression of mRNA coding for PR, receptors responding to the signaling of progestins, androgens, and estrogens, respectively. In addition, to determine if steroid r eceptor mRNA is translated to protein, immunolocalization of the PR was examined Materials and Methods Egg Collection A nnual reproduction and nesting of the Florida red belly turtle roughly coincides with that of the American Alligator. It has been repo rted by others [ 182 ] and observed by myself that P. nelsoni routinely lay their eggs in the nest mounds of the American alligator. During the summers of 2007 2008 and 2009, Florida red belly turtle eggs were collected from alligator nests located within Lake Woodruff National Wildlife Refuge (Deland, Florida) and transported to the University of Florida for incubation. Within 48 h ours of arrival, embryos from 1 to 2 eggs per clutch w ere used to determine the average embryonic stage of the clutch based on criteria described by Yntema [ 183 ]

PAGE 98

98 Eggs from each clutch were incubated at a female producing temperature ( FPT ) of 30 C [ 184 ] RNA Isolatio n and Reverse Transcription In 2007 and 2009, CAMs were collected at embryonic stages 16, 19 and 22, and were dissected away from the embryo, yolk and eggshell, washed in 1X phosphate buffered saline (PBS) and stored in the RNA preservative, RNA later sol ution (Ambion) at 4 C overnight and stored at 20 C until RNA isolation Total RNA was isolated from CAM with the SV Total RNA Isolation System (Promega), and reverse transcribed with the iScript cDNA Synthesis Kit (Bio Rad). Concentrations and quality of RNA samples were evaluated by measuring optical density with a NanoDrop ND 1000 (Thermo Scientific) and by formaldehyde gel electrophoresis. Total RNA was treated with ribonuclease free deoxyribonuclease I (DNase I; Qiagen) to remove any genomic DNA contam ination. One in 20 L reaction and complementary DNA (cDNA) was stored at 20 C until RT qPCR analysis. Real time Q uantitative P olymerase C hain R eaction (RT qPCR) RT qPCR analysis was performed on CAM samples from different clutches at embryonic stages 16 (n=18), 19 (n=12) and 22 (n=19). Complementary DNA was analyzed in triplicate by RT qPCR amplification using an iCycler MyIQ Single Color Real Time PCR Detection System (Bio Rad). Each 15 ion contained 10 mM Tris HCl (pH 7.84), 50 mM KCl, 3 mM MgCl 2 Tween 20, 0.8% glycerol, 2% DMSO, 200 fold dilution of SYBR Green (Invitrogen), 0.01 Fluorescein Calibration Dye (Bio / L AmpliTag Gold DNA polymerase (Applied Biosystems) and 25 fold dilution of cDNA. RT qPCR amplification conditions included an enzyme activation step of 95 C (8 min) followed by

PAGE 99

99 40 cycles ( internal control genes) or 50 cycles (target genes) of 95 C (15 sec) and a primer s pecific combined annealing/extension temperature (1 min). T he specificity of amplification was confirmed by melt curve analysis. Triplicate data for each gene were averaged and mRNA expression levels of the steroid receptors ( PR, AR, ESR1, ESR2 ) were de termined by the absolute quantification method [ 87 ] In brief, copy numbers were calculated from the cycle threshold ( Ct ) value by the linear regression of an absolute standard curve. Absolute standard curves for each target gene were generated from a plasmid containing the amplicon of interest at known concentrations. Controls lacking cDNA template were included on every RT qPCR plate to determine the specificity of target cDNA. Additionally, to confirm that target cDNA was not contaminated by genomic DNA, RT qPCR was performed with protein phosphatase 1 gamma ( PP1) primers on the RNA isolated from every sample. All sample means were normalized using PP1 expression. Data are repo rted as relative expression and represent mean normalized mRNA transcript percentage in (% of PP1 ). Cloning and S equencing of P lasmids RT qPCR of pooled cDNA was used to generate a PCR product for each primer set. Amplified PCR products were separated on a 2% agarose gel and visualized by ethidium bromide on a Gel Doc EQ with Quantity One 4.6 software (Bio Rad). RT qPCR products were purified by Wizard SV Gel and PCR Clean Up System (Promega) and purified samples were confirmed by electrophoresis on a 2% agarose gel. PCR products were cloned into a pGEM T Vector System (Promega). Plasmid DNA was purified using the Wizard Plus SV Minipreps DNA Purification System (Promega) and sequenced on an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems) using a

PAGE 100

100 B igDye Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems). The specificity of cloned DNA was confirmed using BLAST against sequences available in Genbank. 1000, converted to copies/ L and seri ally diluted in a solution containing 50 mM Tris HCl (pH 8.3), 75 mM mL of tRNA. RT qPCR P rimers All primers were designed using Primer3 software [36] and were synthesized by Eurofins MWG Operon. With the exception of PP1, all pr imers were designed to amplify mRNA specific fragments from P. nelsoni coding sequences (NCBI). For PP1, primers were designed from a partial mRNA sequence for Trachemys scripta (DQ848991.1), cloned and sequenced as described above. Blast results indicated a (109/111) 9 8 % identity in PP1 sequences between T. scripta and P. nelsoni The two single nucleotide differences between the species were not found in either the forward or reverse primer region, allowing the use of this primer set for P. nelsoni All p rimer pairs were combined annealing /extension temperature s and GenBank accession numbers are reported in Table 4 1. I n V itro Explant C ulture In 2008, CAMs were collected at embryonic stage s 23 to 24. Sections of CAM were cut to approximately 0.1g wet weight (mean= 0.108g 0.001 SEM). CAM sections were incubated at 30 C on an orbital shaker in L 15 culture media (Invitrogen) either with (n=18) or without (n=21) cholesterol and cAMP as precurs or. Precursor solutions and concentrations are based on King et al. 2004 [ 91 ] For cholesterol, 22(R) Hydroxycholesterol (Sigma) was dissolved in 95% ethanol (Fisher) to a final mL and combined with 1 mM Dibutyryl cAMP (Sigma). After 8

PAGE 101

101 hours of incubation, concentration of progesterone in the culture media was quantified by solid phase radioimmunoassay [ 92 ] To determine background and cross reactivity of the P4 assay, controls consisting of only cholesterol and cAMP (absence of CAM) were incubated for 8 hours In the absence of CAM, all samples w ere below the limit of detection of the assay Histology, Immunohistochemistry and M icroscopy In 2009, dissected CAM was fixed in neutral buffered formalin, washed in 1X PBS and stored in 75% ethanol. CAMs from stage 16 (n=3), stage 19 (n=3) and stage 22 (n=3) were dehydrated, paraffin embedded, and sectioned at 5 microns. Standard h ematoxylin and eosin staining was performed with stains from Surgipath Immunohistochemistry was performed using the Elite ABC Mouse IgG Kit (Vector Laboratories). Tissue sections were deparaffinized in xylene, transferred to 100% eth anol, treated with 3% hydrogen peroxide in methanol (10 min) and rehydrated through graded concentrations of ethanol to dionized water (dH 2 0). Antigen retrieval was performed by heating slides to 95 to 97 C(25 min) in Trilogy solution (Cell Marque), rinsed in dH 2 0, and placed in 0.1 M Tris buffered saline containing 0.2% Tween 20 (TBS T) for 5 minutes. Sections were treated with the Avidin Biotin blocking kit (Vector Laboratories) and then blocked in normal serum (20 min). Sections were incubated with a 1:1 00 dilution of mouse monoclonal anti progesterone receptor antibody (Ab 8) (30 min) and ABC reagent (5 min). Slides were washed in TBS T between all incubation steps. Se ctions were treated with 3, 39 diaminobenzidine (5 min) (Vector Laboratories) and washed in water (5 min). A negative control section receiving concentration matched IgG controls were included on every slide. Slides were dehydrated, cleared

PAGE 102

102 and mounted wit Allan Scientific). Sections were imaged using an Olympus BX60 microscope under differential inference contrast (DIC) and Zeiss AxioCAM MR3 camera with Zeiss AxioVision LE 4.8.2 software. Statistical Analysis All s tatistical analyses were performed in the R statistical programming environment version 2.13.1 [ 95 ] For gene expression analyses, the total numbers of mRNA transcripts for 1 internal control and 4 target genes from the CAM were determined by RT qPCR. To quantify relative expression of target genes, each sample was normalized by PP1 expression. T o analy ze each target gene I used linear mixed effects models (LMMs) to compare relative mRNA expression over the three stage experiment. For each analysis, embryonic stage was treated as a fixed effect, and RT qPCR plate, maternal clutch and collection year wer e treated as random effects. Collection year did not significantly reduce the deviance in the data explained by the model and was excluded from the model for all genes. Likewise, maternal clutch did not significantly reduce the deviance in the data explain ed by the model and was excluded from the model for all genes except AR. Model assumptions were evaluated visually via examination of residuals and QQ plots and log transformations were performed on all target genes. The assumption of homogeneity of varian ces was violated for two genes ( PR and ESR1 ) and so I weighted the variance for each stage according to a power law function that was estimated from the data as part of the model fitting procedure [ 96 ] For in vitro tissue culture, an unpaired, two test was used to compare the mean concentration of P4 in the culture media from CAMs incubated with L15 media only (absence of precursor) to CAMs incubated with L 15 media plus

PAGE 103

103 cholesterol and cAMP (precursor). The assumption of normality was evaluated with a two sided F test. test assuming unequal variances was als o used to compare the concentration of P4 in the culture media from CAMs with L15 media only (absence of precursor) to a hypothetical mean of zero. Results The T urtle CAM is C apable of I n V itro P rogesterone S ynthesis T he effect of steroid precursor addition on the concentration of P4 in culture media was analyzed There was a significant increase in the concentration of P4 in the culture media following the addition of cholesterol precursor plus cAMP (t(37)=2.77, p=0.008, mean=1362.18 pg/ mL /g 126.3 2 SEM) (Figure 4 1). Further, a significant concentration of P4 in the culture media in the absence of precursor, but in the presence of CAM was found (t(20)= 11.57, p<0.0001, mean=955.2 pg/ mL /g 82.57 SEM) (Figure 4 1). The T urtle CAM is C apable of R esp onding to S teroid H ormone S ignaling The relative levels of steroid receptor mRNA in the CAM exhibited the pattern ESR1 > ESR2 > AR > PR (Figure 4 2). At all three embryonic stages, ESR1 was the most highly expressed steroid receptor and PR was the lowest. The relative levels of steroid receptor mRNAs were separated by an order of magnitude or greater. T he effect of embryonic stage on the level of mRNA expression was analyzed in the turtle CA M. Overall, there was significant mRNA expression of PR (F 1,45 = 3932.05, p <0.0001), AR (F 1,33 = 1235.5, p <0.0001), ESR1 (F 1,45 = 742.9, p <0.0001) and ESR2 (F 1,45 = 669.5, p <0.0001). However, the level of express ion did not change significantly among embryonic stages for ESR1 ( 2,45 = 2.52, p =0.0916) and ESR2 (F 2,45 = 2.72, p =0.0764) (Figure 4 2). In contrast, PR expression increased 2.3 fold (F 2,45 =3.67,

PAGE 104

104 p=0.0335) and AR expression increased 7.0 fold (F 2,33 =29.3 6, p<0.0001) between embryonic stage s 16 and 22 (Figure 4 2). To determine if PR mRNA was translated to protein, immunolocalization of the nuclear PR was performed Nuclear PR staining was evident throughout the chorionic and allantoic epithelia mesenchyme and epithelial cells of mesenchymal blood vessels (Figure 4 3). Discussion Oviparity is the ancestral reproductive mode of amniotes [ 56 172 185 ] Within this group of vertebrates; b irds, crocodilians, turtles and the tuatara represent the major lineages of extant amniotes that reproduce strictly by oviparity [ 7 180 181 ] In contrast, both squamate and mammalian lineages are represented by two reproductive modes, with some species reproducing by oviparity and others reproducing by viviparity [ 181 ] (Figure 4 4). We previously hypothesized that endocrine extraembryonic membranes are not an exclusive trait of viviparous amniotes, but rather are a conserved characteristic of amniotes independen t of reproductive mode [ 36 116 ] To that end steroid synthesis and /or steroid signaling potential has now been demonstrated in the CAMs of two oviparous species, the chicken an d alligator ( [ 116 ] Chapter 2, Chapter 3) Our current study examine d steroid hormone synthesis and signaling in a third branch of the oviparous amniote phylogeny. Here, I d emonstrat e that the turtle CAM can perfo rm steroid synthesis and has steroid hormone signaling capabilities (Figure 4 4), lend ing further support for our hypothesis that endocrine activity of extraembryonic membranes is a conserved trait of amniota. Albergottti et al. were the first to demonstr ate that the oviparous CAM of chicken has the capability to perform in vitro P4 synthesis ( [ 116 ] Chapter 2) Our current study shows that in vitro P4 synthesis can also be induced in the CAM of another oviparous

PAGE 105

105 amniote, the Florida red belly slider turtle. To be confident that the P4 quantified in the culture media was synthesized by the turtle CAM, I removed CAM tissue from the egg and tested for synthesis directly in the presence of a steroid hormone precursor. I hypothesized that if the CA M was steroidogenic, then addition of the steroid hormone precursor to the culture media would stimulate increased P4 production. Our results showed a significant increase in the concentration of P4 in the culture media following the addition of precursor (Figure 4 1) confirm ing that P4 synthesis can be induced in the turtle CAM. In addition, I found a significant concentration of P4 in the culture media in the absence of precursor suggesting that the turtle CAM exhibits endogenous P4 synthesis. However, t he CAM is a highly vascularized tissue and it is possible that the P4 detected in the culture media in the absence of precursor could be the result of P4 synthesized by or mobilized from a source other than the CAM which simply leached from the CAM to the culture media at the time of dissection. While, the data were not able to tease apart the question of endogenous P4 synthesis at this time, the power of this experimental approach is its ability to definitively show that the turtle CAM has the ability to synthesize P4 in the presence of a steroid hormone precursor. The concentrations of P4 in the culture media reported in the turtle CAM assay are substantially higher than those previously reported in the chicken ( [ 116 ] Chapter 2). In the presence of precursor, the average concentration of P4 in the culture media after 8 hours of incubation was 101.12 pg/ mL /g 10.22 in the chicken as compared to 1362.18 pg/ mL /g 126.32 in the turtle and in the absence of precursor was 43.65 pg / mL /g 7.14 in the chicken and 955.2 pg/ mL /g 82.57 in the turtle. It seems highly unlikely that the extreme differences in concentration of P4 between these two studies

PAGE 106

106 could be explained by laboratory procedures. While a different shipment of the P4 an tibody used in the radioimmunoassay between these studies could introduce some variation in the results, the Guillette laboratory has a long history with this technique and different shipments of antibodies produce consistent results with values between sh ipments being less than two times different. Our results indicate that the concentration of P4 in the culture media was 13 times higher in the presence of precursor and 22 times higher in the absence of precursor in the turtle as compared to the chicken. T his suggests that there are considerable differences in the CAMs ability to synthesize P4 and perhaps in the level of endogenous P4 production between these two species, at least late in embryonic development when these experiments were performed. Species differences in CAM P4 synthesis might be influenced by differences in circulating levels of maternally deposited yolk hormones or those synthesized by the embryo, as well as the levels the steroidogenic enzymes and steroid receptors expressed in the CAM. Steroid hormone biosynthesis begins with cholesterol and requires the action of specific steroidogenic enzymes to convert one hormone to another. In the biosynthesis of P4, cholesterol is converted to pregnenolone (P5) by the action of cytochrome P450 11A1 (CYP11A1). P5 can then be converted to P4 by the action of hydroxy delta 5 steroid dehydrogenase, 3 beta and steroid delta isomerase 1 (HSD3B1) [ 97 ] ( Figure 4 5) Th us, the turtle CAM s demonstrated ability to synthesize P4 from cholesterol indicates that the steroidogenic enzymes, C YP11A1 and HSD3B1, are present and functional in this tissue CYP11A1 and HSD3B1 mRNAs have previously been demonstrated in the chick CAM and HSD3B1 in the alligator CAM ( [ 116 ] Chapter 2,

PAGE 107

107 Chapter 3). Further, the chick CAM also demonstrate d in vitro synthesis of P4 from cholesterol ( [ 116 ] Chapter 2). Therefore, the CAM s of three oviparous amniotes ha ve now been shown to express steroidogenic enzymes either at the molecular level alone (alligator), the molecular and functional le vel (chicken) or the functional level alone (turtle); thus, supporting our hypothesis that a conserved characteristic of the oviparous CAM includes the capability to perform steroidogenesis (Figure 4 4) The importance of placental P4 in the maintenance o f pregnancy is well established in eutherian mammals [ 179 ] However, oviparous amniotes, such as birds, crocodilians and turtles lay their eggs at early embryonic stages prior to the development of extraembryonic membrane s [ 53 86 129 183 ] indicating that this would not be a logical function of CAM P4 in these species. Yet, if we consider additional roles of placental P4, we find potential functions of P4 in the oviparous CAM. First, P4 prom otes protein synthesis and general growth [ 186 ] both of the placenta [ 74 76 ] and of the fetus [ 74 ] In addit i on, P4 stimulates the proliferation of blood vessels [ 107 ] and plays a role in fetoplacental vascularizatio n [ 109 110 ] The CAM, like the chorioallantoic placenta undergoes dramatic growth during development and functions as a support structure for the growing embryo. Thus, one could hypothesize that P4 synthesized by the CAM could play a role in promoting CAM and embryonic growth. Moreover both the CAM and chorioallantoic placenta are highly vascularized organs; therefore, it seems reasonable to suggest that P4 could have a role in CAM blood vessel proliferation and vascularization. For example, vascular endothelial growth factor (VEGF) and fibroblast growth factor (FGF) are importa nt regulators of placental [ 187 ] and CAM angiogenesis [ 188 189 ] P4 has been shown to induce the expression of VEGFs [ 190 ] and FGFs

PAGE 108

108 [ 191 ] ; therefore, it would be interesting to know how P4 affects VEGF and FGF expression and vascularization in the CAM. I suggest that future work should investigate these proce sses as first steps in determining potential functions of P4 in the oviparous CAM. Progestins, estrogens and androgens exert their actions on target cells primarily through binding and activation of the PR, estrogen receptors (ERs) and AR, respectively. As members of the steroid hormone superfamily, these receptors act as ligand dependent transcription factors to regulate gene expression [ 84 192 ] Steroid hormone receptor mRNA and protein expression was demonstrated in the oviparous CAMs of chicken and alligator ( [ 116 ] Chapter 2, Chapter 3). Here, for the first time, I show the presence of PR, AR, ESR1 and ESR2 mRNA and protein expression of PR in the CAM of a turtle (Figure 4 2, Figure 4 3). The presence of steroid receptor mRNA and protein in the turtle CAM lends additional s upport for our hypothesis that the capability to respond to steroid hormone signaling is a conserved characteristic of the oviparous CAM. In the turtle CAM, the relative levels of mRNA were separated by an order of magnitude or more and exhibited the pattern ESR1 > ESR2 > AR > PR. The levels of steroid receptor expression found here could reflect the relative importance of the turtle CAM to be able to respond to estrogens, androgens and progestins, re spectively. Yet, it is well recognized that mRNA expression does not always result in protein expression. Further transcript levels do not necessarily reflect translation levels. Therefore, f uture studies are needed to examine the translation of the stero id receptor mRNAs into active proteins before we can establish function of

PAGE 109

109 Placental [ 126 127 193 ] and CAM ( [ 116 ] Chapter 2, Chapter 3) steroidogenic enzyme and steroid receptor mRN As have been observed to change during development. Therefore, I investigated steroid receptor mRNA expression in the turtle CAM at three embryonic stages corresponding to before (stage 16), during (stage 19) and after (stage 22) the thermo sensitive perio d (TSP) of sex determination. Embryonic stages surrounding the TSP were chosen with the hypothesis that this developmental period w ould correspond to increased steroid signaling activity in the embryo and CAM, thereby increasing the chances of detecting an d quantifying differences in CAM steroid receptor mRNAs. Overall, I found that PR and AR exhibited changes among the embryonic stages suggesting that steroid receptor mRNA expression is affected by developmental stage in these two genes. In the turtle CA M, both PR and AR showed increased expression at stage 22 relative to stage 16. This pattern is similar to the one observed in the chick CAM, where PR exhibited very low expression early in development, but increased substantially between day 8 and 18 of d evelopment ( [ 116 ] Chapter 2). However, the pattern of expression in the turtle CAM contrasts with that of the alligator, which showed a incubated at the male producing temperature and in AR at the female producing temperature ( Chapter 3). Currently, there is very little developmental data on placental steroid receptor expression through gestation. However, in the junctional zone of the rat chorioallantoic placenta PR bi nding sites increase d between days 14 and 20 of pregnancy [ 178 ] Thus, it appears that the chick and turtle CAM, by demonstrating increa sed PR mRNA expression during the developmental period examined, could

PAGE 110

110 resemble the pattern of PR in the rat placenta, but without protein analyses in the CAMs these studies are not directly comparable. Unfortunately, developmental expression patterns of A R in the placenta are not available for comparison. It is well recognized that vertebrate yolk contains maternally derived steroid hormones deposited into the egg at oviposition [ 99 160 163 ] However, how yolk steroid hormones are mobilized to and what functions they provide for the develo ping embryo is less clear. It is becoming increasingly evident; however, that yolk hormones are mobilized to and metabolized by the embryo [ 167 ] and extraembryonic membranes [ 162 170 ] Thus, we have hypothesized that the CAM can respond to and biotransform circulating yolk steroid hormones in addition to those synthesized by the embryo and CAM [ 36 ] Concentrations of yolk steroids, such as e (E2), testosterone (T) and P4, are typically highest at oviposition and subsequently decline during embryonic development [ 155 161 163 ] Thus, yolk steroids might be important early sources of hormones prior to steroidogenic capability coming on line in the embryo or CAM, an idea that is supported by the presence of steroid receptor mRNAs in the embryo prior to erform steroid synthesis [ 194 ] Yolk steroids could be biotransformed by the CAM to synthesize different hormone products and/or for the degradation of biologically active hormones to less active forms, thus acting to buffer embryonic exposure to potentially harmful levels o f steroid signals at inopportune times in development [ 36 ] Moreover, we previously hypothesize d th at the oviparous yolk sac membrane (YSM), in addition to the CAM, would have the ability to respond to and biotransform materna lly deposited yolk st eroids [ 36 ] T he bird YSM functions in the transport and

PAGE 111

111 conversion of maternally deposited lipid s in the yolk to the embryo [ 195 196 ] Therefore, I build on our previous hypothesis, which suggested that in mobilizing yolk lipids and steroids, the YSM could deliver these substances to the CAM, thereby providing substrates for steroidogenesis in this tissue [ 36 ] and further hypothesize that the YSM also has the capability itself to metabolize yolk st eroid s and perform steroidogenesis (Figure 4 6). In support of this hypothesis, I have recently observed that the chick YSM exhibits mRNA expression of steroidogenic enzymes and steroid receptors and protein expression of PR and ESR1 (Albergotti, unpublish ed data) (Figure 4 4). Collectively, our hypothesis suggests that the oviparous amniote has an integrated system of steroid synthesis and metabolism in which the embryo and extraembryonic membranes function together to regulate the steroid milieu of the d eveloping embryo (Figure 4 6 ) Moreover, we have suggested that this system has been co opted and modified to serve a viviparous mode of reproduction, but likely did not evolve in response to viviparity [ 36 ] Rather, steroidogenesis and steroid signaling in extraembryonic membranes is likely older than even amniotes, as t he ancestral condition of vertebrates is characterized by the formation of a single extraembryonic membrane, the YSM [ 1 56 ] and the yolk of fishes and amphibians contains signaling molecules, such as steroid, thyroid and retinoid hormones that are mobilized to the developing embryo ( [ 197 203 ] Fujik u ra and Suzuki, 1991 as cited by [ 204 ] ). Collectively, our study indicate s that the turtle CAM has the capability to perform in vitro P4 synthesis, respond to an drogens and estrogens at the molecular level, and respond to progestins at the molecular and protein level Future studies are needed to

PAGE 112

112 better understand steroidogenesis and steroid signaling in the oviparous CAM as well as the YSM I suggest that protein and functional assays are of the upmost importance in future investigations While immunolocalization of the PR has been demonstrated in three oviparous CAMs to date, demonstration of protein expression of key steroidogenic enzymes are lacking. Likewise, I suspect that the CAM has the capability to synthesize not only P4, but also estrogens, androgens and glucocorticoids and future work should investigate extraembryonic membrane synthesis of these and other peptide hormones associated with the chorioallant oic placenta

PAGE 113

113 Table 4 1. Turtle PCR primers used for RT Quantitative real time PCR Gene Direction Annealing (C) GenBank accession number PP1 Sense TCCTGCTGGCCTACAAGATT 63.7 DQ848991.1 Antisense CGCCTCTTGCACTCATCATA PR Sense CCAGCATGTCGATTGAGAAA 60 AB301062.1 Antisense GCTGCTGGAGTGCAACAATA AR Sense ATGTCCTGGAAGCCATTGAG 68 AB301061.1 Antisense CTCTCCCCAAGCTCATTCAG ESR1 Sense ATCATTTGGGTCCAGCAGTC 60.5 AB301060.1 Antisense TAAGAATACCACGGGGCTTG ESR2 Sense ACGCTTCGAGGTCAAAGAAA 60 AB548299.1 Antisense GCCATATTCCGCGTATCATC

PAGE 114

114 Figure 4 1. Progesterone synthesis in the turtle CAM. CAM sections were incubated in culture media for 8 hours either without (open squares) or with (filled circles) cholesterol (plus cAMP) as a precursor. Concentration of P4 in the culture media is represented as pg/ mL of P4 per g of CAM tissue (pg/ mL /g). To determine background and cross reactivity of the P4 assay, controls consisting of only cholesterol and cAMP (absence of CAM) were incubated for 8 hours. In the absence of CAM, all samples were below the limit of detection of the assay.

PAGE 115

115 Figure 4 2. Rela tive mRNA expression of steroid receptors in the turtle CAM RT qPCR analysis of mRNA coding for PR, AR ESR1, and ESR2 at embryonic stages 1 6, 19, and 2 2. Data are reported as relative mRNA expression and represent mean normalized mRNA transcript percent age in (% of PP1 ) SEM.

PAGE 116

116 Figure 4 3. Histology and immunolocalization of PR in t urtle CAM (A) H& E staining in the turtle CAM showing the allantoic epithelium (a), mesenchyme (m) and chorionic epithelium (c). (B) Positive nuclear staining of PR was localized to both epithelial layers, the mesenchyme and to the epithelial cells of blood vessels (bv ). ( C) Positive CAM section corresponding to the (D) n egative control receiving co ncentration matched IgG Scale bar represents 50 microns.

PAGE 117

117 Figure 4 4. Amniote reproductive modes and evidence of steroid hormone synthesis and/or steroid signaling in extraem bryonic membranes and placentae. Birds crocodilians, turtles and the tuatara represent the major lineages of extant amniotes reproduc ing only by oviparit y (filled circles); whereas lizards, snakes and mammalian lineages are represented by two reproductive modes, with some reproducing by oviparity and others reproducing by viviparity (open circles). Previous studies have demonstrated that the chorioallantoic placenta (open squares) and the yolk sac placenta (open diamonds) have the ability to pe rform steroid synthesis and/or respond to steroid hormone signaling in the viviparous lineages noted. There have been no investigations of such in snakes. We have previously demonstrated that the oviparous CAM (filled squares) of chicken and alligator has the capability to perform steroidogenesis and /or respond to steroid hormone signaling. This study demonstrates that this capability extends to a turtle. Further, we have observed that this capability is also evident in the chick YSM (filled diamonds) (Albe rgotti, unpublished data). Taken together, these findings suggest that endocrine extraembryonic membranes could be conserved characteristics of amniota. Phylogeny adapted from Ezaz T, Stiglec R, Veyrunes F, Marshall Graves JA. Relationships between vertebr ate ZW and XY sex chromosome systems. Curr Biol 2006; 16:R736 R743 [ 205 ]

PAGE 118

118 Figure 4 5 A simplified version of progesterone biosynthesis. F illed boxes highlight steroidogenic enzyme s required for the conversion of cholesterol to progesterone (P4) Cholesterol is converted to pregnenolone (P5) by the action of CYP11A1 P5 can then be converted to P4 by the action of HSD3B1.

PAGE 119

119 Figure 4 6 Model for the evolution of endocrine function in the amniote yolk sac (YSM) and chorioallantoic membrane (CAM). This model proposes that initially the YSM mobilized yolk lipids and steroids to embryonic circulation (pathway 1). With the evolution of amni otes, the YSM also mobilized yolk lipids and CAM (pathway 3) acquired the ability to convert yolk steroids to 'protect' the developing embryo and/ or provide 'developmental signaling' a s well as the ability to synthesize steroid hormones de novo prior to the evolution of viviparity. Figure adapted from Albergotti LC, Guillette LJ, Jr. Viviparity in reptiles: evolution and endocrine physiology. In: Norris DO, Lopez KH (eds.), Hormones and reproduction in vertebrates, vol. 3: Elsevier; 2011: 247 275. [ 36 ]

PAGE 120

120 CHAPTER 5 ESTROGENIC EXPOSURE AFFECTS CHORIOALLANT OIC MEM BRANE GENE EXPRESSION AND TIMIN G OF HATCH IN THE AM ERICAN ALLIGATOR ( ALLIGATOR MISSISSIPP IENSIS ) T he highly vascularized chorioallantoic membrane (CAM) is formed by the fusion of two extraembryonic membranes, the chorion and allantois [ 55 ] In viviparous, i.e. live bearing amniotes (mammals, reptiles and birds), the CAM apposes the maternal uterus and together these tissues form the chorioallantoic placenta T he chorioallantoic placenta is a transient organ that serves as in the maternal fetal exchange of gases, metabolic wastes nutrients and chemical messengers [ 56 ] In the absence of contact with maternal circulation, the CAM of the self contained oviparous egg serves as the major site of respiration, as a repository for metabolic wastes [ 55 ] and in the transfer of essential electrolytes [ 173 ] Following parturition, the placenta is no longer needed and is discarded at birth. Similarly, the CAM is discarded at hatching and much of the CAM tissue is left in the eggshell as the hatchling emerges [ 82 ] In the 1970s, David Peakall and coll e agues began develop ing techniques that allowed CAM tissue collected after hatching to be used as a nonlethal and noninvasive indicator of embryonic exposure to persistent environmental contaminants [ 206 207 ] This line of research was initially undertaken in an attempt to understand the onset and accumulation of the pesticide, 1,1,1 trichloro 2,2 bis(4 chlorophenyl)ethane (DDT) in peregrine falcon ( Falco peregrinus ) eggs in regards to population declines Using museum preserved eggshells, Peakall demonstrated the absence of 2,2 bis ( p chloro phenyl) 1,1 dichloroethylene (DDE) a major metabolite of DDT, in eggshell membranes collected before the production of DDT and a subsequent increase of DDE in eggshell membranes thereafter [ 207 ] This seminal study not only revealed t hat contaminants

PAGE 121

1 21 could accumulate in eggshell membranes, but also that it was possible to use a nonlethal source to gather this information. It was suggested that CAM exposure to environmental contaminants could arise internally, i.e. contaminants maternal ly deposited in to the yolk enter circulation and are transported to the CAM o r sequestered to the allantois [ 82 ] or externally, i.e. contaminants in the nest environment are transported across the eggshell and are transported to the CAM, which lines the inner surface [ 208 209 ] The use of eggshell membranes to estimate contaminant burdens in the egg was validated by Peakall et al. (1983) in a comparison of CAM and whole egg concentrations of DDE and polychlorobiphenyls (PCBs) in peregrine falcons [ 210 ] Subsequent studies in great blue herons ( Ardea herodiasfannini ) [ 2 11 ] loggerhead sea turtles ( Caretta caretta ) [ 82 ] and the American Alligator ( Alligator mississippiensis ) [ 212 ] have all revealed a strong positive relationship between the concentrations of organochlorine contaminants in the CAM and those in the egg. Further, a laboratory study conducted in the ch icken ( Gallus domesticus ) demonstrated that organochlorine contaminant concentrations in the CAM could be used to e stimate contaminant load not only in the egg, but also in the laying hen In addition, a significant relationship between CAM contaminant loa d and hepatic enzyme activity in chicks and hens was demonstrated indicating that CAM contaminant concentration could be used as an indicator of a biological response [ 80 ] The chemicals mentioned above have now been demonstrated to behave as endocrin e disrupting contaminants (EDCs). The EDC hypothesis, originally articulated in 1991, suggested that many man made and naturally occurring chemicals had the ability

PAGE 122

122 to disrupt the normal functioning of the endocrine system at concentrations currently found in our environment [ 213 ] The vast majority of EDC studies have described steroid receptor mediated interactions where an environmental contaminant interferes with function by either binding the receptor and thus, behaving as a hormone agonist or by blo cking receptor binding and thereby behaving as a hormone antagonist [ 214 215 ] However, there is increasing evidence that EDCs can also alter steroid action through disruption of steroid hormone synthesis via modification of steroidogenic enzyme pathways and through disruption o f steroid hormone metabolism via inhibition of enzymes involved in steroid elimination (as reviewed in [ 215 ] ). All EDCs are not estrogenic in their actions; however, estrogenic mediated actions continue to dominate the field of EDC research [ 214 ] One such xenoestrogen, Bisphenol A ( BPA, 2,2 bis (4 hydroxyp henyl) propane ) has been the subject of great interest and controversy in recent years [ 216 ] Originally synthesized in 1891, BPA was shown to have the estrogenic properties as early as the 1930s [ 217 ] Howev er, BPA was passed over as a pharmaceutical estrogen [ 218 ] and instead is used today in the manufacture of polycarbonate plastics and epoxy resins. As one of the highest volume chemicals produced worldwide, BPA is ubiquitous and widespread in our environment [ 219 220 ] and is present in many common consumer products, such as in the lining of food and beverage cans, plastic bottles, and dental sealants [ 221 ] Aside from identifying the presence and accumulation of environmental contaminants in the CAM, there is currently very little known concerning if and how these chemicals impact this tissue Y et, an investigat ion of cytochrome P4501A catalyzed deethylation of 7 ethoxyresorufin (EROD) activity in the CAMs of chicken

PAGE 123

123 [ 208 222 ] and Eider duck ( Somateria mollis sima ) [ 222 ] revealed that EROD activity was not only present in the chicken and duck CAM, but was also induced 10 50 fold in the chick CAM following exposure to PCB 126 [ 208 ] and 5 fold in the duck CAM following e naphthoflavone (BNF) [ 222 ] Granberg et al. (2003) further investigated the binding of labeled polycyclic aromatic hydrocarbons (PAHs) in the chicken CAM and demonstrated that PCB 126 and BNF exposure increased PAH binding i n the endothelial cells of CAM blood vessels [ 209 ] Overall, the findings from these studies suggested that the CAM 1) expresses CYP genes important in the biotransformation of xenobiotics, 2) has the capability to biotransform environmental contaminants, and 3) could be a target of EDC action [ 208 209 222 ] It has recently been demonstrated that the CAMs of chicken, American alligator and Red belly slider turtle ( Pseudemys nelsoni ) exhibit steroid hormone synthetic activity and are targets o f steroid signaling as they exhibit steroid hormone receptors ( [ 116 ] Chapter s 2, 3, 4). Therefore, I hypothesized that the presence of EDCs in the CAM could potentially interfere with steroid signaling and or steroidogenesis in this tissue. To investigate this hypothesis, mRNA expression was examined in the American alligator CAM following exposure to a naturally occurring estrogen e stradiol (E2) and an environmental estrogen, BPA. It has now been demonstrated that BPA behaves as an estrogen agonist by binding the estrogen receptor (ER) not only in mammalian species, but also in nonmammalian vertebrates, including chicken, the green a nole lizard ( Anolis carolinensis ), the African clawed frog ( Xenopus laevis ) and the rainbow trout ( Oncorhynchus mykiss ) (reviewed in [ 223 ] ) and that BPA, like E2, can stimulate the transcription of ER mRNA [ 224 ] In addition, both E2 and BPA also have the ability

PAGE 124

124 to bind the progest erone receptor (PR) [ 225 ] and induce PR mRNA transcripti on [ 226 227 ] Furthermore, E2 and BP A have been shown to affect the expression and activity of steroidogenic enzymes, but the direction of change reported is inconsistent. For example, E2 and BPA ha ve been reported to both stimulate [ 228 229 ] and inhibit [ 230 232 ] CYP19 (also called aromatase) gene expression or activity. In addition, E2 was reported to increase 3 hydr oxysteroid dehydrogenase activity [ 233 234 ] while E2 and BPA were reported to decrease the expression or activity of this same enzyme [ 235 237 ] The reported differences cited here likely reflect species, tiss ue/cell, and mechanism specific responses as even within human placental studies, opposite effects of E2 and BPA on CYP19 expression have been reported [ 228 232 ] Here, I investigate d whether estrogenic exposure affects steroid hormone processes in the CAM through receptor mediated actions by examining mRNAs coding for examine d whether CAM steroidogenic enzyme actions were affected by estrogenic exposure by examining mRNAs coding for cytochrome P450, family 19, sub fam ily A, polypeptide 1 (CYP19A1), and hydroxy delta 5 steroid dehydrogenase, 3 beta and steroid delta isomerase 1 (HSD3B1) the key steroidogenic enzymes involved in the synthesis of estrogens and progestins ; respectively [ 97 ] Our study attempt s to determine whether CAM steroid signaling and / or steroidogen esis are regulated in response to estrogenic exposure The question of regulation is vital to the understanding of this system beca use if gene expression in the CAM is regulated as such it is possible for gene expression to be altered by exposure to xenoestrogens In addition, developmental estrogenic exposure has been demonstrated to affect the

PAGE 125

125 timing of birth as well as fetal and neonatal growth patterns in a number of organisms, such as rodents, ewes, and Japanese medaka fish ( Oryzias latipes ) [ 238 241 ] Therefore, the effect of in ovo estrogenic exposure on the timing of hatch and hatchling body morphometrics of alligators was also investigated. Materials and Methods Egg Collection Fieldwork was conducted under permits from the Florida Fish and Wildlife Conservation Commission and the U.S. Fish and Wildlife Service During the summer of 2009, American alligator ( Alligator mississippiensis ) eggs were collected from nests located within Lake Woodruff National Wildlife Refuge (Deland, Flor ida) and were transported to the University of Florida for incubation. Within 48 h of arrival, eggs were candled to assess viability and embryos from 2 to 3 eggs per clutch were used to determine the average embryonic stage of the clutch based on criteria described by Ferguson [ 129 ] Eggs from six clutches for gene expression analyses or five clutches for hatching analyses were evenly distributed into treatment groups and incubated at a female producing temperature of 30 C. In Ovo Exposure At embryonic stage 20 (immediately prior to the thermal sensitive period of sex determination) eggs were weighed to the nearest 0.05 grams and received one of the following treatments applied topically to the eggshell; 95% ethanol vehicle control (0.5 of egg weight). Following treatment, eggs were allowed to air dry at room temperature for 10 minutes and returned to the incubator. The timing of exposure, treatment

PAGE 126

126 application, and doses of BPA and E2 are based on studies in another crocodilian, C aiman latirostris [ 242 243 ] CAM Collection, RNA Isolation, Reverse Transcription and Real time Q uantitative P olymerase C hain R eaction (RT qPCR) CAM sample s were dissected away from the embryo and eggshell at 12, 24, 48 and 72 hours post exposure, washed in 1X phosphate buffered saline ( PBS ) stored in the RNA preservative, RNAlater solution (Ambion) at 4 C overnight and stored at 20C until RNA isolation Total RNA was isolated, reverse transcribed and complementary DNA was analyzed in triplicate as described in Chapter 3 RT qPCR was performed on CAM samples collected at 12 hours (vehicle control n=11, BPA n=11, E2 n=12), 24 hours (vehicle control n=12, BPA n=11, E2 n=12), 48 hours (vehicle control n=12, BPA n=13, E2 n=11), and 72 hours (vehicle control n=12, BPA n=12, E2 n=12). Primer pairs Table 5 1 Triplicate data for each gene were averaged and mRNA expression levels of the steroid receptors ( ESR1, ESR2, and PR ) and steroidogenic enzymes ( HSD3B1 and CYP19A1 ) were determined by the absolute quantification method [ 87 ] as previously described in Chapter 3 Controls lacking cDNA template were included on every RT qPCR plate to determine the specificity of target cDNA. Additionally, to confirm that target cDNA was not contaminated by genomic DNA, RT q PCR was performed with RPL8 primers on the RNA isolated from every sample. To normalize mRNA expression levels, RT qPCR was performed on all samples with ribosomal protein L8 ( RPL8 ). D ata are reported as relative expression and represent mean normalized mR NA transcript percentage in (% of RPL8 ).

PAGE 127

127 Hatch D ata Hatch dates were recorded for every animal and timing of hatch was calculated as the difference between embryonic stage 20 and the day of hatching. At hatching, body mass (BM), tail girth (TG), snout vent length (SVL), and total length (TL) were measured. Statistical A nalysis All statistical analyses were performed in the R statistical programming environment version 2.13.1 [ 95 ] For gene expression analyses, the total numbers of mRNA t ranscripts for 1 internal control and 5 target genes from the CAM were determined by RT qPCR. To quantify relative expression of target genes, I normalized mRNA expression of each sample to RPL8. I used linear mixed effects models (LMMs) to compare relativ e mRNA expression between the treatment groups at each discrete time period. In these analys e s, in ovo exposure was treated as a fixed effect, and RT qPCR plate and maternal clutch were treated as random effects ; however, maternal clutch did not significan tly reduce model deviance and was excluded from the mode l for all genes. Model assumptions were evaluated visually via examination of residuals and QQ plots and log or square root transformations were performed when necessary to normalize errors. Outliers were identified from residuals and QQ plots and the largest value of ESR1 and ESR2 in the E2 treatment at 72 hours and the largest value of HSD3B1 in the BPA treatment at 48 hours, were removed from the study (note that inclusion of these values did not ch ange patterns of inference but were excluded from the final analysis because they had a disproportionate influence on mean estimates and caused violation of normality). The assumption of homogeneity of variances was met for all genes. T he RT qPCR plate se t up account s for the difference in the number of

PAGE 128

128 degrees of freedom between genes. T he same analytical approach described above was used to estimate the effect of in ovo exposure on the timing of hatch and hatch ling body morphometrics. In these analyses in ovo exposure was treated as a fixed effect and maternal clutch was treated as a random effect. Results Steroid Receptor and Steroidogenic Enzyme Expression in the CAM F ollowing Estrogenic Exposure T he effect of estrogenic exposure on the level of mRNA expression in the CAM at four discrete time periods was analyzed The level of mRNA expression was not different among the treatment groups at any of the time periods examined for ESR2 (Figure 5 2), PR (Figure 5 3), CYP19A1 (Figure 5 4), or HSD3B1 (Figure 5 5) a summary of statistical analyses are presented in Table 5 2 Likewise, ESR1 expression was not different among the treatment groups at 12 hours, 24 hours, or 48 hours post exposure. However, ESR1 mRNA in the E2 treatment group was upregulated 1.4 f old relative to the vehicle control and 1.6 fold relative to the BPA treatment group at the 72 hour time period (F 2,25 =5.21, p=0.01) (Table 5 2 Figure 5 1). The Effect of Estrogenic Exposure on Timing of Hatch The effect of estrogenic exposure on the timi ng of hatch was analyzed and it was observed that alligators exposed to BPA and E2 in ovo hatched earlier than those exposed to the vehicle control (F 2,70 =7.4, p=0.0012) (Figure 5 6). The average time to hatch for BPA and E2 exposed animals was 45.1 0.4 and 45.0 0.4 days, respectively, whereas the average time to hatch in vehicle exposed animals was 46.5 0.7 days (Figure 5 6).

PAGE 129

129 Hatchling Body Morphometrics Following Estrogenic Exposure Next, the effect of estrogenic exposure on body morphometrics at h atch was analyzed. B ody mass (F 2,70 =1.22, p=0.30), tail girth (F 2,70 =0.20, p=0.82), total length (F 2,70 =0.007, p=0.94), and snout vent length (F 2,70 =0.72, p=0.49) were not different among the treatment groups (Figure 5 7). Discussion It is well established that persistent environmental contaminants accumulate in the CAM [ 206 ] and it appears that this tissue has the capability to biotransform these compounds [ 208 209 222 ] Indeed, it has even been suggested that the CAM could represent a first line of metabolic defense against certain toxic compounds penetrating the shell [ 209 ] The majority of pollutants identified in CAM studies are classified as EDCs, i.e. chemicals that can interfere with the normal functioning of the endocrine system by modifying steroid hormone receptor and steroidogenic enzyme mediated actions (reviewed in [ 215 ] Our previous studies in the chicken, alligator and turtle indicates that the CAM has the capabili ty to respond to steroid hormone signaling and perform steroidogenesis ( [ 116 ] Chapter s 2, 3, 4). Therefore, I examined whether exposure to either a naturally occurring estrogen (E2) or a synthetic estrogen (BPA) could potentially interfere wi th steroid signaling and or steroidogenesis in the alligator CAM. Here, I demonstrate that estrogenic exposure affected steroid receptor mRNA expression by showing that topical application of E2 resulted in upregulation of CAM ESR1 In general, E2 upregu late s ESR1, ESR2 and PR (as reviewed in [ 244 ] ), and in addition has been shown to upregulate or downregulate CYP19A1 [ 228 231 ] and HSD3B1 [ 233 235 ] dependent on species and tis sue /cell types. T herefore, I expected

PAGE 130

130 that if the CAM was responsive to estrogenic treatment, I could potentially observe a change in mRNA expression of any of these genes following estrogenic exposure. Yet, based on previous studies and as will be explain ed in subsequent paragraphs, I predicted that the effect of E2 exposure on CAM ESR1 should be greater than that on ESR2 and/or PR. As there is less consistency in steroidogenic enzyme responses to E2, I predicted that transcription of these genes could be affected by exposure but that either an upregulation or downregulation was possible and that t he magnitude of change would li kely be less than that of ESR1 Our finding that E2 result ed in an upregulation of ESR1 only after 72 hours suggests that topically applied E2 did not penetrate the eggshell in sufficient concentration to elicit a response in CAM ESR1 until between the 4 8h and 72h collection time points. This result c oupled with a complete absence of an observed effect in ESR2 and PR or the steroidogenic enzymes could suggest that ; 1) the dose of E2 was only sufficient to effect ESR1 expression 2) CAM steroid receptors e xhibit a differential response to E2 .or 3) the time series used was insufficient to capture a response in mRNA expression beyond that of ESR1. It has been reported that E2 is a more potent activator of ESR1 than ESR2 [ 245 246 ] and has higher binding affinity for ER than PR [ 225 ] ESR1 and ESR2 have distinct expression patterns in tissue distribution studies [ 247 ] and while both were identified in t he CAM, ESR1 relative expression was on average 10 orders of magnitude higher than that of ESR2, suggesting that ESR1 is the predominant subtype of ER expressed in this tissue. In addition, PR relative expression in the CAM was on average an order of magni tude lower than that of ESR1. Thus, the low dose of E2 used in our study may not

PAGE 131

131 have been sufficient to induce ESR2 and PR mRNA expression. Likewise, ESR1 mRNA expression is approximately 10 and 1 order(s) of magnitude higher than that of CYP19A1 and HSD3 B1, respectively, which again could explain why E2 did not induce a change in mRNA expression of the steroidogenic enzymes examined. A d ifferential response of ESR1 and ESR2 to E2 has been noted in other gene expression studies. In the chicken, in ovo E2 exposure on the first day of incubation resulted in increased ESR1 mRNA expression in male gonads on day 10 of incubation, whereas gonadal ESR2 expression was unaffected by E2 exposure in either sex [ 248 ] Likewise, Sabo Attwood et al. (2004) showed that large mouth bass ( Micropterus salmoides ), hepatic expression of ERs differed in response to E2, with E2 inducing a response in ESR1, but not in ESR2 [ 249 ] Therefore, it is possible that t he ERs are not regulated in the same fashion by E2 in the CAM. It is also possible that since ESR1 was unaffected by E2 exposure until 72 hours post application that our time series was insufficient to detect a response to E2 in ESR2, PR and steroidogenic enzyme mRNAs. This might seem unlikely based on a topical application study in the slider turtle ( Trachemys scripta ) which showed that labeled E2 applied to the eggshell peaked withi n embryos at 25 hours after application, but could be detected as early as 2 hours after application [ 250 ] However, the turtle and alligator eggshell are vastly different in their porous nature [ 45 ] and at this point I can only sp eculate on the timing and concentration of topically applied E2 that penetrated the interior of the egg (see further discussion concerning internal dose below); but my findings suggest that the temporal transfer of E2 across the eggshell was less efficient than that reported in the turtle.

PAGE 132

132 While BPA has been demonstrated to exhibit estrogenic actions in numerous studies, it has been shown in competitive binding assays that BPA was 1000 to 10,000 and 1000 to 2,300 times less potent than E2 in the mammalian and non mammalian species examined, respectively (as reviewed in [ 223 ] ). This could explain why an upregulation of ESR1 in response to E2, but not BPA was observed in our study. It is important to note that the estrogenic exposures of this study were the result of a one time topical application to the eggshell and the concentrations applied to the eggshell, were considered low doses of E2 and BPA. The doses, method of delivery, and timing of exposure were based on studies in another crocodilian, C aiman latirostris which demonstrated effects of estrogenic exposure in post hatching animals [ 242 243 ] While internal dose, i.e., the concentration of E2 or BPA penetrating the interior of the egg, was not determined in this study, previous work examining the applied versus internal dose in the marine turtle ( Chelonia myd as ) revealed that only 34% and 8% of DDE applied topically at embryonic stage 21 was found in the egg and embryo, respectively at stage 28 [ 251 ] Thus, it is fairly safe to assume that the internal doses of E2 and BPA of our study were considerably lower than those applied externally and might account for the lack of response in ESR2, PR, CYP19A1 and HSD3B1 mRNA expression to E2 and BPA exposure and ERS1 in BPA exposure. Prematurity, either being born too soon or too small, is a leading cause of human infant mortality and morbidity [ 252 253 ] In the United States, the occurrence of human pret erm birth has increased more than 20% and low birth weight has increased 10% from 1990 to 2006 [ 254 ] In analyzing the distribution of spontaneous singleton births, Davidoff et al. (2006) showed that the average gestation time decreased by a week

PAGE 133

133 between 1992 and 2002 [ 255 ] There has been much speculation on whether increased exposure to environmental contaminants, such as BPA, could play a role in the increased occurrence of preterm birth and low birth weight [ 253 ] Diethylstilbestrol (DES), a synthetic, non steroidal estrogen that was ironically prescribed as a treatment for preterm birth and problematic pregnanc ies in the 1950s and 1960s has been associated with premature birth in humans [ 256 ] [ 257 ] DES exposure in rats was shown to affect the length of gestation and either increased or decreased gestation length dependent on the timing of exposure [ 241 ] A number of EDCs with estrogenic potential have been correlated with preterm birth including cadmium [ 258 ] organochlorine pesticides [ 259 260 ] PCBs [ 261 ] and BPA [ 262 ] BPA exposure has also been observed to cause premature hatching in medaka [ 239 ] Here, I show ed that in alligators both E2 and BPA exposure accelerated timing of hatch compared to vehicle controls. While the average difference between estrogenic exposed and vehicle treated animals was small, the effect of premature hatching could have significant i mplications and warrants further investigation. It has also been suggested that increased estrogenic exposure during embryonic development can negatively affect fetal growth [ 263 ] BPA exposure has been shown to decrease fetal body weight in rats [ 238 ] birth weight in ewes [ 240 ] and hatch size in medaka [ 239 ] However, our study did not detect an effect of estrogenic exposure on alligator hatchling body morphometrics. In addition to decreasing fetal and birth body weight, in utero BPA exposure has been shown to increase body weight as animals age [ 220 ] ; thus, it will be important to examine whether in ovo estrogenic exposure influenced post hatching growth rate in the alligators from our study.

PAGE 134

134 The CAM has been utilized as a nonlethal indicator of embryonic exposure to environmental contaminants i n numerous oviparous bird and reptile species [ 206 ] It is likely that CAM contaminant exposure could arise from sources both internal and external to the shelled egg. Internal exposure could arise from maternal transmission, i.e. off loading of co ntaminants to the yolk [ 264 ] Contaminants present in the yolk could then be transported to the CAM via circulation. Previous studies in the loggerhead sea turtle and American alligator have dem onstrated that PCBs are present in the egg prior to CAM formation. However, these compounds are readily transported to the CAM upon its development [ 82 212 ] In addition, external exposure could arise in the nest vascularized nature facilitate the CAMs primary role of gas exchange with the external environment. In addition, the CAM mobilizes calcium from the eggshell to the embryo [ 265 ] In light of this, i t seems likely that contaminants, which come in contact with the eggshell, perhaps through contact with contaminated feathers or feet of brooding parents in avian nests or contaminated nesting material in reptilian nests, could be transported to the CAM. It is evident from previous studies in the American alligator and other species with temperature sex determination that E2 and other chemicals applied topically have the ability to penetrate the eggshell and cause embryonic sex reversal [ 250 266 267 ] Very little is known concerning the extent of contaminant transmission across the eggshell in natural environments Yet a recent laboratory study attempted to invest igate the transmission of contaminants across the eggshell of a reptilian species as they would be exposed in the natural environment, i.e., through contaminated nesting material. Solla et al. i ncubated snapping turtle ( Chelydra serpentina ) eggs in soil

PAGE 135

135 co ntaminated with various pesticides and found that internal transmission of pesticides increased with duration of contaminant exposure [ 268 ] suggesting that r eptilian eggs incubated in natural environments likely absorb contaminants from nesting substrate throughout incubation. To my knowledge no studies have quantified BPA in the CAM, yet BPA has been measured in placental tissues of rats [ 269 ] and humans [ 270 ] While acute BPA exposu re studies indicate that BPA is rapidly metabolized and excreted in adult animals, it has been suggested that lower metabolism during fetal development could result in decreased clearance [ 271 ] As the CAM and chorioallantoic placenta are derived from the same extraembryonic membranes and perform similar functions during development, it thus stands to reason that the CAM could be exposed to BPA and play a role in its metabolism and excretion. This idea is supported by the finding that labeled BPA injected into the yolk of Japanese quail ( Coturnix japonica ) on day 3 of embryonic develop ment was observed in the allantoic fluid on days 10 and 15 of incubation with more pronounced radioactive labeling on day 15 compared to day 10 [ 272 ] The obse rvation that ESR1 mRNA was upregulated in the CAM following in ovo E2 exposure in conjunction with our previous findings that CAM steroidogenic enzymes and steroid receptor mRNAs are affected by developmental timing ( [ 116 ] Chapter s 2, 3, 4) and incubation temperature ( Chapter 2) indicate that gene expression in the oviparous CAM is regulated. While more work is needed to understand the regulation of steroid pathways in the CAM, establishing that gene expression in the oviparous CAM is regulat ed suggests that it is possible for gene expression to be altered in this tissue Our study indicates that estrogenic exposure affects mRNA expression in the CAM and

PAGE 136

136 thus, suggests that environmental contaminants acting through estrogenic pathways could im pact CAM gene expression. Dose response studies examining steroid signaling, steroid synthesis and steroid metabolism mediated actions in response to EDCs known to bioaccumulate in this tissues are needed. Further, our previous studies have demonstrated th e presence of the androgen receptor and glucocorticoid receptor in the CAM ( Chapter 3 Chapter 4) and future studies should investigate whether these receptors are affected by exposure to naturally occurring or synthetic androgens and glucocorticoids. As B PA has been demonstrated to strongly bind the human estrogen related receptor ( ERR ) [ 273 ] which is highly expressed in the placenta [ 274 ] I suggest that future work should also investigate if the CAM expresses EER and how ERR expression might be affected by estrogenic exposure.

PAGE 137

137 Table 5 1 Alligator PCR primers used for RT Quantitative real time PCR Gene Direction Annealing (C) GenBank accession number or reference RPL8 Sense GGTGTGGCTATGAATCCTGT 62.9 Katsu et al. (2004) Antisense ACGACGAGCAGCAATAAGAC PR Sense AAATCCGTAGGAAGAACTGTCCAG 67.5 AB115911 Antisense GACCTCCAAGGACCATTCCA ESR1 Sense AAGCTGCCCCTTCAACTTTTTA 66.5 AB115909 Antisense TGGACATCCTCTCCCTGCC ESR2 Sense AAGACCAGGCGCAAAAGCT 65 AB115910 Antisense GCCACATTTCATCATTCCCAC CYP19A1 Sense CAGCCAGTTGTGGACTTGATCA 62 AY029233 Antisense TTGTCCCCTTTTTCACAGGATAG HSD3B1 Sense GTGATCCCATCTGCAATGGTG 60 Milnes et al. (2008) Antisense CCATCTGCCTTCAGGACATGTT

PAGE 138

138 Table 5 2 Statistic summary of RT Quantitative real time PCR on the alligator CAM at four time periods post exposure. Gene 12 hour a 24 hour a 48 hour a 72 hour a ESR1 2,22=2.60, ns 2,23=0.82, ns 2,24=0.77, ns 2,24=5.21, ESR2 2,22=1.02, ns 2,23=0.22, ns 2,24=2.20, ns 2,24=0.21, ns PR 2,27=2.57, ns 2,27=1.46, ns 2,28=0.16, ns 2,26=0.29, ns CYP19A1 2,27=1.22, ns 2,27=0.16, ns 2,28=0.86, ns 2,26=0.07, ns HSD3B1 2,27=0.38, ns 2,27=0.12, ns 2,27=0.63, ns 2,26=0.69, ns a Data presented as F(df)=, p value= ** p<0.01 p<0.05 ns=not significant

PAGE 139

139 Figure 5 1. Relative mRNA expression of ESR 1 in the CAM following estrogenic exposure. RT qP CR analysis of mRNA coding for ESR1 at 12, 24, 48, and 72 hours following topical ap plication of 95 % ethanol vehicle control (open squares), BPA (grey diamonds), or E2 (solid circles). Data are reported as relative mRNA expression and represent mean normalized mRNA transcript percentage in (% of RPL8 ) SEM.

PAGE 140

140 Figure 5 2. Relative mRNA expression of ESR 2 in the CAM following estrogenic exposure. RT qP CR analysis of mRNA coding for ESR 2 at 12, 24, 48, and 72 hours following topical application of 95 % ethanol vehicle control (open squares), BPA (grey diamonds), or E2 (solid circles). Dat a are reported as relative mRNA expression and represent mean normalized mRNA transcript percentage in (% of RPL8 ) SEM.

PAGE 141

141 Figure 5 3. Relative mRNA expression of PR in the CAM following estrogenic exposure. RT qP CR analysis of mRNA coding for PR at 12, 24, 48, and 72 hours following topical application of 95 % ethanol vehicle control (open squares), BPA (grey diamonds), or E2 (solid circles). Data are reported as relative mRNA expression and represent mean normalized mRNA transcript percentage in (% of RPL8 ) SEM.

PAGE 142

142 Figure 5 4. Relative mRNA expression of CYP19A1 in the CAM following estrogenic exposure. RT qP CR analysis of mRNA coding for CYP19A1 at 12, 24, 48, and 72 hours following topical application of 95 % ethanol vehicle control (open squares), BPA (grey diamonds), or E2 (solid circles). Data are reported as relative mRNA expression and represent mean normalized mRNA transcript percentage in (% of RPL8 ) SEM.

PAGE 143

143 Figure 5 5. Relative mRNA expression of HSD3B1 in the CAM following estrogenic exp osure. RT qP CR analysis of mRNA coding for HSD3B1 at 12, 24, 48, and 72 hours following topical application of 95 % ethanol vehicle control (open squares), BPA (grey diamonds), or E2 (solid circles). Data are reported as relative mRNA expression and represe nt mean normalized mRNA transcript percentage in (% of RPL8 ) SEM.

PAGE 144

144 Figure 5 6. The effect of estrogenic exposure on timing of hatch T iming of hatch was recorded for animals exposed in ovo at stage 20 to either 95% ethanol vehicle control (open squares), BPA (grey diamonds), or E2 (solid circles). Timing of hatch was calculated as the difference be tween embryonic stage 20 and day of hatching Data represent mean hatch day SEM.

PAGE 145

145 Figure 5 7. The effect of estr ogenic exposure on hatchling body morphometrics. Body mass, tail girth, snout vent length and total length was recorded upon hatching for animals exposed in ovo at stage 20 to either 95 % ethanol vehicle control (open squares), BPA (grey diamonds), or E2 ( solid circles). Data represent mean values SEM.

PAGE 146

146 CHAPTER 5 SUMMARY CONCLUSIONS AND FUTURE DIRECTION S Summary and Conclusions While the placenta was first proposed to function as an endocrine organ in the early 1900s [ 5 ] t he role of steroid hormone synthesis, metabolism and signaling continues to be defined in the placenta today [ 275 277 ] and the evolution of the se functions in the placenta remains as a fundamental research question [ 278 ] Prior to my work, it was known that the embryonic contribution to the mammalian placenta performs steroid hormone synthesis and responds to steroid hormone signaling via steroid re ceptors [ 113 279 283 ] (Figure 6 1) In addition, the ability to perform steroid hormone synthesis had been demonstrated in the embryonic contribution to the squamate placenta in one species of viviparous lizard [ 21 ] (Figure 6 1) As the embryonic contribution s to mammalian and squamate placentae i.e. the extraembryonic membranes, are also present in birds and oviparous reptiles, I looked to the pre cursor of the amniote placenta in an attempt to understand its evolution of endocrine function. Results from Chapter 2 showed that the chicken chorioallantoic membrane (CAM) expressed mRNA coding for steroidogenic enzymes required for steroid biosynthesis, ha d the ability to perform progesterone (P4) synthesis and show ed mRNA expression of estrogen receptor (ESR1) and mRNA and protein level expression of the progesterone receptor (PR) This represented the first examination of steroid activity in the CAM of an oviparous amniote and demonstrat ed that s teroidogenesis and steroid signaling in extraembryonic membranes a re not exclusive characteristic s of placental mammals and squamates Al though, the oviparous CAM of birds might have proven unique in this regard, we hypothesized that CAM steroid activity would extend to other

PAGE 147

147 oviparous species, thus representing an addit ional unify ing characteristic of amniotes and a possible explanation for how the placenta evolved as an endocrine organ. In Chapter 3 and Chapter 4, I investigated this hypothesis in the CAM s of other oviparous amniotes, the American alligator and Florida red belly slider turtle, respectively. Chapter 3 showed that the alligator CAM expressed mRNA coding for some of the steroidogenic enzymes identified in the chicken as well as mRNA and protein level expression of PR In addition, Chapter 3 identified a re gulator of steroidogenesis (NR5A1 also called SF 1), the steroidogenic enzyme (CYP19A1 also called aromatase) and glucocorticoid receptor mRNAs and ESR1 protein for the first time in an oviparous repti le CAM Chapter 4 revealed that the turtle CAM also expressed mRNA coding for ESR1, ESR2 and AR and mRNA and protein level expression of the PR. In addition, Chapter 4 showed that the turtle CAM, like the chicken, had the ability to perform P4 synthesis Collectively, results from Chapters 2 through Chapter 4 showed that the CAMs of species representing three branches of the extant oviparous amniote phylogeny had the capability to perform steroidogenesis and respond to steroid hormone signaling (Figure 6 1) and supports our hypothesis that these features could be a conserved trait of amniote extraembryonic membranes regardless of reproductive mode If steroidogenesis and steroid signaling in extraembryonic membranes is conserved, this would then suggest that the endocrine role of the amniote placenta likely evolved initially in an oviparous ancestor and offers a new hypothesis for the evolution of an endocrine placenta.

PAGE 148

148 In Chapter 2 through Chapter 4, the mRNA expression of some genes was observed to change during development. In addition, Chapter 3 showed that mRNA expression of some genes was affected by incubation temperature. Th ese results suggested that the expression of genes involved in steroid synthesis and signaling could be regulated in this tissue. Chapter 5 attempted to determine if CAM steroid receptors and/or steroidogenic enzymes were regulated in response to estrogenic exposure. Chapter 5 showed that a one time, low dose of th e naturally occurring estradiol applied topically to the alligator eggshell resulted in an upregulation of CAM ESR1. While an effect on CAM gene expression was not observed in response to the synthetic estrogen, Bisphenol A, results from Chapter 5 nonetheless suggested that steroid activity in the CAM, which is known to accumulate environmental contaminants [ 206 ] could be affected by exposure to xenoestrogen s In squamates, the transition from oviparity to viviparity involves cha nges in the timing of egg retention, thickness of the eggshell, and the development of a placenta [ 14 ] With the over 100 independent evolutionary origins of viviparity in squamate reptiles [ 7 8 ] it seems equally likely that the transition in reproductive mode ; 1) may not be an exceedingly difficult one to make and 2) may occur in response to various selective forces but likely involves similar molecular, cellular and morphogenic pathways Therefore, we should not be surprised t o find that many of the required molecular, cellular and organ level characteristics of viviparity, including endocrine signaling, were already present in the oviparous ancestors allowing them to be modified for a viviparous mode of reproduction. However, d ifferences in the use of various

PAGE 149

149 pathways and mechanisms and timing associated with these processes would likely occur. From the previous work described in Chapter 1 and my work presented here I suggest the following to have evolved concurrently with l ive birth and consider them requirements of viviparity; intrauterine retention of the egg for the duration of embryonic development, reduction of the eggshell, and formation of a fully functioning placenta that includes not only the exchange of gases, wast e and nutrients but also endocrine signals as well. In light of my findings, it is likely that embryonic endocrine signals from the extraembryonic membranes play a key role in the maternal recognition, establishment, and maintenance of gestation in viviparous squamates. Given that the CAM is present in all birds, reptile s, and mammals, why has viviparity not evolved in birds or in the other reptiles (tuatara, crocodilians and turtles)? Simply put, the presence of a steroidogenic CAM is not enough in itself to facilitate a transition from oviparity to viviparity in the abs ence of extended egg retention in conjunction with continued embryonic development and decreased eggshell thickness. Egg retention is brief in birds and crocodilians, whereas egg retention is extended in some species of turtles and in the tuatara [ 53 ] However, embryonic development is arrested in turtles and presumed to be so in the tuatara as little embryon ic development occurs in utero and embryos are at the gastrula stage at the time of oviposition [ 53 ] Thu s, oviposition occurs at early stages of development prior to development of the CAM in birds, crocodilians, turtles, and the tuatara [ 53 284 ] In contrast, oviparous squamates typically retain eggs in utero past the time of CAM development on average for one third to one half of embryonic development [ 284 285 ] Moreover, if the thickness of the

PAGE 150

150 eggshell is not reduced in utero then embryonic or extraembryonic signals that might play a role in further extending egg retention will not be in communication with the maternal uterus. Future Directions We currently understand much about the morphological and physiologica l attributes of viviparity, but despite a century of inquiry, many major questions remain. The molecular mechanisms involved in the suite of physiological (especially endocrine), anatomical, and developmental modifications associated with the evolution of viviparity have only begun to be explored. Determining the extent of ste roid hormone synthesis, metabolism and signaling in the oviparous extraem bryonic membranes, specifically the CAM and yolk sac membrane (YSM) could shed light on the physiological mechanisms associated with the evolution of viviparity. In this regard, a full investigation of the CAMs ability to synthesize steroid hormones beyond P4 is needed. In addition to P4, the synthesis and metabolism of estrogens, androgens and glucocorticoids hormones play pivotal roles in the placenta during pregnancy [ 111 ] Therefore establishing the ability to synthesize and metabolize these hormones not only in the CAM, but also in the YSM would greatly incre ase our understanding of the role of steroid hormones in oviparous extraembryonic membranes. The ability of the chicken and turtle CAM to synthesize P4 from cholesterol indicates that CYP11A1 and HSD3B1 are functional in this tissue; h owever, demonstrating protein expression of steroidogenic enzymes is needed. Further more determining the correlation between ; 1) mRNA and protein levels of expression of steroidogenic enzymes and steroid receptors and 2) steroidogenic enzyme and steroid receptor levels

PAGE 151

151 of protein expression is needed to understand steroid hormone mechanisms of action in these tissues. We have speculated that steroid hormones in the CAM might regulate gene expression, influence differentiation, development, growth and vascularization of the CAM as well as play a potential role in the maintenance of embryonic development, timing of hatch and growth of the embryo. While results from Chapter 5 showed an effect of estrogenic exposure on CAM ESR1 expression and timing of hatch, demonstrating more than a correlation between these two observations will likely prove difficult. However, examining gene expression and morphological effects of in ovo exposure to multiple doses of naturally occurring and synthetic hormones across multiple developmental ti me points would help define the function of steroid hormone synthesis and signaling in the CAM. In addition to steroid hormones, the embryonic contribution to the placenta synthesizes a suite of peptide hormones, neurohormones, growth factors and cytokine s that modulate placental hormone production and release through endocrine, paracrine and autocrine mechanisms [ 71 ] Many of the se factors, such as activin [ 286 ] prolactin, grow th hormone, placental lactogen [ 287 ] transforming growth factor platelet derived growth factor fibroblast growth factor, epidermal growth factor (as reviewed in [ 189 ] ) interleukin 6 [ 288 ] and prostaglandin E [ 289 ] have all been shown to affect angiogenesis in the chicken CAM This suggests that the oviparous CAM has the mechanisms in place to respond to many important modulators of placental chemical signaling pathway s. Therefore, determining how these factors might also modulate

PAGE 152

152 hormone production and release in the oviparous extraembryonic membranes will be important in future studies Finally and most importantly, future studies must continue to examine steroidogen ic and steroid signaling capabilities in the extraembryonic membranes of other oviparous amniotes to either support or refute our hypothesis that this is a conser ved characteristic of amniotes (Figure 6 1) High priority should be given to examining the CA M and YSM of oviparous lizards, snakes and mammals, and to comparative studies of steroidogenic and steroid signaling capabilities of these tissues between closely related oviparous and viviparous squamate species. Further, should our hypothesis be support ed through future research efforts it will be important to investigate steroid activity in the YSM of fishes and amphibians as this is the ancestral extraem bryonic membrane of vertebrates and the only extraembryonic membrane of anamniotes.

PAGE 153

153 Figure 6 1. Evidence of endocrine extraembryonic membranes in amniotes. Previous studies ( black diamonds ) demonstrated that the embryonic contributio ns t o the chorioallantoic and yolk sac placenta have the ability to perform steroid synthesis and resp ond t o steroid hormone signaling in the viviparous taxa noted The work presented here ( black squares) provided evidence that the oviparous CAM of the taxa noted shares that capability. In addition, I have recently observed steroidogenesis and steroid signaling capabilities in the YSM of chicken (grey squares, data not shown here ). Open circles denote current holes in our understanding of this system and where future research efforts are needed

PAGE 154

154 LIST OF REFERENCES 1. Mess A, Blackburn DG, Zeller U. Evolutionary transformations of fetal membranes and reproductive strategies. J Exp Zool A 2003; 299A:3 12. 2. Aristotle, Platt A. De Generatione Animalium In: Smith JA, Ross WD (eds.), The works of Aristotle translated into English, vol. 5. Oxf ord: Clarendon Press 1912. 3. Wourms JP, Lombardi J. Reflections on the evolution of piscine viviparity. Am Zool 1992; 32:276 293. 4. Stewart JR, Thompson MB. Evolution of placentation among squamate reptiles: recent research and future directions. Comp Biochem Physiol, A 2000; 127:411 431. 5. Del Mar Yllera M, Alexandre Pires GM, Cifuentes JM. Placenta: regularization of neovascularization. Microvascularization pattern of the rabbit term placenta. Microsc Res Tech 2003; 60:38 45. 6. Diczfalusy E. My li fe with the fetal placental unit. Am J Obstet Gynecol 2005; 193:2025 2029. 7. Shine R. The evolution of viviparity in reptiles: an ecological analysis. In: Gans C, Billett F (eds.), Biology of the reptilia, vol. 15. New York: John Wiley & Sons; 1985: 605 694. 8. Blackburn DG. Are viviparity and egg guarding evolutionarily labile in squamates? Herpetologica 1999; 55:556 573. 9. Dulvy NK, Reynolds JD. Evolutionary transitions among egg laying, live bearing and maternal inputs in sharks and rays. Proc R Soc Lond [Biol] 1997; 264:1309 1315. 10. Goodwin NB, Dulvy NK, Reynolds JD. Life history correlates of the evolution of live bearing in fishes. Philos Trans R Soc Lond, B 2002; 357:259 267. 11. Gower DJ, Giri V, Dharne MS, Shouche YS. Frequency of independe nt origins of viviparity among caecilians (Gymnophiona): evidence from the first 'live bearing' Asian amphibian. J Exp Biol 2008; 21:1220 1226. 12. Reynolds JD, Goodwin NB, Freckleton RP. Evolutionary transitions in parental care and live bearing in verte brates. Philos Trans R Soc Lond, B 2002; 357:269 281.

PAGE 155

155 13. Zeller U. Mammalian reproduction: Origin and evolutionary transformations. Zool Anz 1999; 238:117 130. 14. Guillette LJ, Jr. The evolution of viviparity in lizards. Bioscience 1993; 43:742 751. 15. Saidapur SK. Structure and function of postovulatory follicles (corpora lutea): the ovaries of nonmammalian vertebrate. Int Rev Cytol 1982; 75:243 285. 16. Rothchild I. The yolkless egg and the evolution of eutherian viviparity. Biol Reprod 2003; 68:3 37 357. 17. Senger P. Pathways to pregnancy and parturition. Pullman, WA: Current Conceptions, Inc; 2005. 18. Koob TJ, Callard IP. Reproductive endocrinology of female elasmobranchs: lessons from the little skate ( Raja erinacea ) and spiny dogfish ( Squalu s acanthias ). J Exp Zool 1999; 284:557 574. 19. Powell ML, Kavanaugh S, Sower SA. Identification of a functional corpus luteum in the Atlantic hagfish, Myxine glutinosa Gen Comp Endocrinol 2006; 148:95 101. 20. Callard IP, Fileti LA, Perez LE, Sorbera L A, Giannoukos G, Klosterman LL, Tsang P, McCracken JA. Role of the corpus luteum and progesterone in the evolution of vertebrate viviparity. Am Zool 1992; 32:264 275. 21. Girling JE, Jones SM. In vitro progesterone production by maternal and embryonic tis sues during gestation in the southern snow skink ( Niveoscincus microlepidotus ). Gen Comp Endocrinol 2003; 133:100 108. 22. Arslan M, Zaidi P, Lobo J, Zaidi AA, Qazi MH. Steroid levels in preovulatory and gravid lizards ( Uromastix hardwicki ). Gen Comp Endo crinol 1978; 34:300 303. 23. estradiol Podarcis sicula sicula In vitro studies. Prostaglandins 1993; 45:159 166. 24. N iswender GD, Juengel JL, McGuire WJ, Belfiore CJ, Wiltbank MC. Luteal function: the estrous cycle and early pregnancy. Biol Reprod 1994; 50:239 247. 25. Simpson ER, MacDonald PC. Endocrine physiology of the placenta. Annu Rev Physiol 1981; 43:163 188.

PAGE 156

156 26 Spencer TE, Johnson GA, Burghardt RC, Bazer FW. Progesterone and placental hormone actions on the uterus: Insights from domestic animals. Biol Reprod 2004; 71:2 10. 27. Spencer T, Bazer F. Conceptus signals for establishment and maintenance of pregnancy. Reprod Biol Endocrinol 2004; 2:49. 28. Custodia Lora N, Callard IP. Progesterone and progesterone receptors in reptiles. Gen Comp Endocrinol 2002; 127:1 7. 29. Guillette LJ, Jr., Cree A. Morphological changes in the corpus luteum of tuatara ( Sphenodon punctatus ) during gravidity. J Morphol 1997; 232:79 91. 30. Guillette LJ, Jr., Woodward AR, You Xiang Q, Cox MC, Matter JM, Gross TS. Formation and regression of the corpus luteum of the American alligator ( Alligator mississippiensis ). J Morphol 1995; 224:97 110. 31. Cruz MVS, Mendez de la Cruz FR. Corpus luteum through the gestation of Sceloporus palaciosi (Sauria : Phrynosomatidae). Copeia 1999:214 218. 32. Guarino FM, Paulesu L, Cardone A, Bellini L, Ghiara G, Angelini F. Endocrine activity of the corpus luteum and placenta during pregnancy in Chalcides chalcides (Reptilia, Squamata). Gen Comp Endocrinol 1998; 111:261 270. 33. Martinez Torres M, Hernandez Caballero ME, Alvarez Rodriguez C, Luis Diaz JA, Ortiz Lopez G. Luteal development and progesterone levels during pregnancy of the viviparous temperate lizard Barisia imbricata imbricata (Reptilia : Anguidae). Gen Comp Endocrinol 2003; 132:55 65. 34. Uribe MDA, Omana MEM, Quintero JEG, Guillette LJ, Jr. Seasonal variation in ovarian histolo gy of the viviparous lizard Sceloporus torquatus torquatus J Morphol 1995; 226:103 119. 35. Jones RE, Guillette LJ, Jr. Hormonal control of oviposition and parturition in lizards. Herpetologica 1982; 38:80 93. 36. Albergotti LC, Guillette LJ, Jr. Vivipa rity in reptiles: evolution and endocrine physiology. In: Norris DO, Lopez KH (eds.), Hormones and reproduction in vertebrates, vol. 3: Elsevier; 2011: 247 275. 37. Jones SM, Swain R. Annual reproductive cycle and annual cycles of reproductive hormones in plasma of female Niveoscincus metallicus (Scincidae) from Tasmania. J Herpetol 1996; 30:140 146.

PAGE 157

157 38. Fergusson B, Bradshaw SD. Plasma arginine vasotocin, progesterone, and luteal development during pregnancy in the viviparous lizard Tiliqua rugosa Gen C omp Endocrinol 1991; 82:140 151. 39. Highfill DR, Mead RA. Sources and levels of progesterone during pregnancy in the garter snake, Thamnophis elegans Gen Comp Endocrinol 1975; 27:389 400. 40. Chan SWC, Ziegel S, Callard IP. Plasma progesterone in snake s. Comp Biochem Physiol, A 1973; 44:631 637. 41. Guillette LJ, Jr., Spielvogel S, Moore FL. Luteal development, placentation, and plasma progesterone concentration in the viviparous lizard Sceloporus jarrovi Gen Comp Endocrinol 1981; 43:20 29. 42. Guillette LJ, Jr. The evolution of vertebrate viviparity: morphological modifications and endocrine control. In: Wake DB, Roth G (eds.), Complex organismal functions: integration and evolution in vertebrates, Dahlem workshop report #45. Chichester: J. Wile y and Sons Ltd; 1989: 219 233. 43. Guillette LJ, Jr. The evolution of viviparity in amniote vertebrates new insights, new questions. J Zool 1991; 223:521 526. 44. Heulin B, Stewart JR, Surget Groba Y, Bellaud P, Jouan F, Lancien G, Deunff J. Developmen t of the uterine shell glands during the preovulatory and early gestation periods in oviparous and viviparous Lacerta vivipara J Morphol 2005; 266:80 93. 45. Packard MJ, Packard GC, Boardman TJ. Structure of eggshells and water relations of reptilian egg s. Herpetologica 1982; 38:136 155. 46. Palmer BD, Guillette LJ, Jr. Oviductal proteins and their influence on embryonic development in birds and reptiles. In: Deeming DC, Ferguson MWJ (eds.), Egg incubation: its effects on embryonic development in birds a nd reptiles. Cambridge: Cambridge Univ. Press; 1991: 29 46. 47. Qualls CP. Influence of the evolution of viviparity on eggshell morphology in the lizard, Lerista bougainvillii J Morphol 1996; 228:119 125. 48. Guillette LJ, Jr., Jones RE. Ovarian, oviductal, and placental morphology of the reproductively bimodal lizard, Sceloporus aeneus J Morphol 1985; 184:85 98. 49. Guillette LJ, Jr. The evolution of viviparity in fishes, amphibians, and reptiles: An endocr ine perspective. In: Norris DO, Jones RE (eds.), Hormones and reproduction in fishes, amphibians, and reptiles. Plenum Press: NY; 1987: 523 562.

PAGE 158

158 50. Guillette LJ, Jr. The evolution of viviparity and placentation in the high elevation, Mexican lizard Scelop orus aeneus Herpetologica 1982; 38:94 103. 51. Arrayago MJ, Bea A, Heulin B. Hybridization experiment between oviparous and viviparous strains of Lacerta vivipara : A new insight into the evolution of viviparity in reptiles. Herpetologica 1996; 52:333 342 52. Heulin B, Arrayago MJ, Bea A, Brana F. Characteristcs of egshells of the (oviparous X viviparous) hybrid strain of the lizard Lacerta vivipara Can J Zool Rev Can Zool 1992; 70:2242 2246. 53. Andrews RM, Mathies T. Natural history of reptilian deve lopment: constraints on the evolution of viviparity. Bioscience 2000; 50:227 238. 54. Herbert JF, Lindsay LA, Murphy CR, Thompson MB. Calcium transport across the uterine epithelium of pregnant lizards. In: Herptol. Monogr.; 2006: 205 211. 55. Kluge AG. Chordate structure and function. New York: Macmillan Publishing Co., Inc.; 1977. 56. Mossman HW. Vertebrate fetal membranes: comparative ontogeny and morphology, evolution, phylogenetic significance, basic functions, research opportunities. New Brunswick, N.J.: Rutgers University Press; 1987. 57. Stewart JR, Thompson MB. Evolutionary transformations of the fetal membranes of viviparous reptiles: a case study of two lineages. J Exp Zoo A 2003; 299A 13 32. 58. Stewart JR, Blackburn DG. Reptilian placentati on: structural diversity and terminology. Copeia 1988:839 852. 59. Thompson MB, Adams SM, Herbert JF, Biazik JM, Murphy CR. Placental function in lizards. International Congress Series 2004; 1275:218 225. 60. Weekes HC. A review of placentation among rep tiles with particular regard to the function and evolution of the placenta. Proc Zool Soc London 1935; 1935:625 645. 61. Blackburn DG, Callard IP. Morphogenesis of placental membranes in the viviparous, placentotrophic lizard Chalcides chalcides (Squamata : Scincidae). J Morphol 1997; 232:35 55. 62. Blackburn DG. Chorioallantoic placentation in squamate reptiles structure, function, development, and evolution. J Exp Zool 1993; 266:414 430.

PAGE 159

159 63. Thompson MB, Speake BK. Energy and nutrient utilisation by e mbryonic reptiles. Comp Biochem Physiol, A 2002; 133:529 538. 64. Adams SM, Biazik JM, Thompson MB, Murphy CR. Cyto epitheliochorial placenta of the viviparous lizard Pseudemoia entrecasteauxii : a new placental morphotype. J Morphol 2005; 264:264 276. 65 Jerez A, Ramirez Pinilla MP. The allantoplacenta of Mabuya mabouya (Sauria, Scincidae). J Morphol 2001; 249:132 146. 66. Thompson MB, Speake BK, Russell KJ, McCartney RJ. Nutrient uptake by embryos of the Australian viviparous lizard Eulamprus tympanum Physiol Biochem Zool 2001; 74:560 567. 67. Swain R, Jones SM. Maternal fetal transfer of H 3 labelled leucine in the viviparous lizard Niveoscincus metallicus (Scincidae: Lygosominae). J Exp Zool 1997; 277:139 145. 68. Speake BK, Herbert JF, Thompson MB Evidence for placental transfer of lipids during gestation in the viviparous lizard, Pseudemoia entrecasteauxii Comp Biochem Physiol, A 2004; 139:213 220. 69. Thompson MB, Stewart JR, Speake BK. Comparison of nutrient transport across the placenta of lizards differing in placental complexity. Comp Biochem Physiol, A 2000; 127:469 479. 70. Blackburn DG, Vitt LJ, Beuchat CA. Eutherian like reproductive specializations in a viviparous reptile. Proc Natl Acad Sci USA 1984; 81:4860 4863. 71. Petraglia F, Florio P, Nappi C, Genazzani AR. Peptide signaling in human placenta and membranes: autocrine, paracrine, and endocrine mechanisms. Endocr Rev 1996; 17:156 186. 72. Henson MC. Pregnancy maintenance and the regulation of placental progesterone biosynthesis in the baboon. Hum Reprod Update 1998; 4:389 405. 73. Mesiano S, Chen EC, Fitter JT, Kwek K, Yeo G, Smith R. Progesterone withdrawal and estrogen activation in human parturition are coordinated by progesterone receptor A expression in the myometrium. J C lin Endocrinol Metab 2002; 87:2924 2930. 74. Mark PJ, Smith JT, Waddell BJ. Placental and fetal growth retardation following partial progesterone withdrawal in rat pregnancy. Placenta 2006; 27:208 214.

PAGE 160

160 75. Jojovic M, Wolf F, Mangold U. Epidermal growth f actor, vascular endothelial growth factor and progesterone promote placental development in rat whole embryo culture. Anat Embryol (Berl) 1998; 198:133 139. 76. Ogle TF, Mills TM, Costoff A. Progesterone maintenance of the placental progesterone receptor and placental growth in ovariectomized rats. Biol Reprod 1990; 43:276 284. 77. Painter DL, Moore MC. Steroid hormone metabolism by the chorioallantoic placenta of the mountain spiny lizard Sceloporus jarrovi as a possible mechanism for buffering maternal fetal hormone exchange. Physiol Biochem Zool 2005; 78:364 372. 78. Giannoulias D, Haluska GJ, Gravett MG, Sadowsky DW, Challis JRG, Novy MJ. Localization of prostaglandin H synthase, prostaglandin dehydrogenase, corticotropin releasing hormone and glucoco rticoid receptor in rhesus monkey fetal membranes with labor and in the presence of infection. Placenta 2005; 26:289 297. 79. Pasqualini JR. Enzymes involved in the formation and transformation of steroid hormones in the fetal and placental compartments. J Steroid Biochem Mol Biol 2005; 97:401 415. 80. Bargar TA, Scott GI, Cobb GP. Chorioallantoic membranes indicate avian exposure and biomarker responses to environmental contaminants: a laboratory study with white leghorn chickens ( Gallus domesticus ). Env iron Sci Technol 2003; 37:256 260. 81. Bargar TA, Sills McMurry C, Dickerson RL, Rhodes WE, Cobb GP. Relative distribution of polychlorinated biphenyls among tissues of neonatal American alligators ( Alligator mississippiensis ). Arch Environ Contam Toxicol 1999; 37:364 368. 82. Cobb GP, Wood PD. PCB Concentrations in eggs and chorioallantoic membranes of loggerhead sea turtles ( Caretta caretta ) from the Cape Romain National Wildlife Refuge. Chemosphere 1997; 34:539 549. 83. Cross JC, Baczyk D, Dobric N, Hemberger M, Hughes M, Simmons DG, Yamamoto H, Kingdom JCP. Genes, development and evolution of the placenta. Placenta 2003:123 130. 84. Norris DO. Vertebrate endocrinology. San Diego: Academic Press; 2007. 85. McEwen RS. Vertebrate embryology. New York: Henry Holt and Company, Inc.; 1957.

PAGE 161

161 86. Hamburger V, Hamilton HL. A series of normal stages in the development of the chick embryo. J Morphol 1951; 88:49 92. 87. Bustin SA. Absolute quantification of mRNA using real time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 2000; 25:169 193. 88. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. Accurate normalization of real time quantitative RT PCR data by geometric averaging of multiple internal contr ol genes. Genome Biol 2002; 3:1 11. 89. Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. Totowa, NJ: Humana Press; 2000. 90. Fridolfsson AK, Ellegren H. A simple and universal method for molecular sexing of non r atite birds. J Avian Biol 1999; 30:116 121. 91. King SR, Matassa AA, White EK, Walsh LP, Rao RM, Stocco DM, Reyland ME. Oxysterols regulate expression of the steroidogenic acute regulatory protein. J Mol Endocrinol 2004; 32:507 517. 92. McCoy KA, Bortnic k LJ, Campbell CM, Hamlin HJ, Guillette L.J. J, St. Mary CM. Agriculture alters gonadal form and function in the toad Bufo marinus Environ Health Perspect 2008; 116:7. 93. Gonzalez Moran G, Camacho Arroyo I. Changes in the presence of progesterone recept or isoforms in the oviduct magnum of newly hatched chicks after gonadotropins treatment. Life Sci 2003; 73:871 882. 94. Gonzlez Morn G, Garca Izquierdo J, Camacho Arroyo I. Progesterone receptor isoforms in ovary of newly hatched chick after gonadotrop in treatment during embryonic development. Comp Biochem Physiol, A 2002; 132:519 526. 95. Team RDC. R: A language and environment for statistical computing. R Foundation for Statistical Computing. In. Vienna, Austria; 2008. 96. Pinheiro JC, and Bates, D.M. Mixed effects models in S and S Plus. Springer; 2000. 97. Payne AH, Hales DB. Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocr Rev 2004; 25:947 970. 98. Challis JRG, Matthews SG, Gibb W, Lye SJ. Endocrine and paracrine regulation of birth at term and preterm. Endocr Rev 2000; 21:514 550.

PAGE 162

162 99. Elf PK, Fivizzani AJ. Changes in sex steroid levels in yolks of the leghorn chicken, Gallus domesticus during embryonic development. J Exp Zool 2002; 293:594 600. 100. Penning TM. Molecular endocrinology of hydroxysteroid dehydrogenases. Endocr Rev 1997; 18:281 305. 101. Kastner P, Krust A, Turcotte B, Stropp U, Tora L, Gronemeyer H, Chambon P. Two distinct estrogen regulated promoters generate transcripts e ncoding the two functionally different human progesterone receptor forms A and B. EMBO J 1990; 9:1603 1614. 102. Tora L, Gronemeyer H, Turcotte B, Gaub MP, Chambon P. The N terminal region of the chicken progesterone receptor specifies target gene activat ion. Nature 1988; 333:185 188. 103. Graham JD, Clarke CL. Physiological action of progesterone in target tissues. Endocr Rev 1997; 18:502 519. 104. Goldman S, Weiss A, Almalah I, Shalev E. Progesterone receptor expression in human decidua and fetal membr anes before and after contractions: possible mechanism for functional progesterone withdrawal. Mol Hum Reprod 2005; 11:269 277. 105. Pasanen S, Ylikomi T, Syvl H, Tuohimaa P. Distribution of progesterone receptor in chicken: novel target organs for prog esterone and estrogen action. Mol Cell Endocrinol 1997; 135:79 91. 106. Griffin C, Flouriot G, Sonntag Buck V, Gannon F. Two functionally different protein isoforms are produced from the chicken estrogen receptor alpha gene. Mol Endocrinol 1999; 13:1571 1 587. 107. Walter LM, Rogers PAW, Girling JE. The role of progesterone in endometrial angiogenesis in pregnant and ovariectomised mice. Reproduction 2005; 129:765 777. 108. Girling JE, Lederman FL, Walter LM, Rogers PAW. Progesterone, but not estrogen, st imulates vessel maturation in the mouse endometrium. Endocrinology 2007; 148:5433 5441. 109. Cudeville C, Mondon F, Robert B, Rebourcet R, Mignot T M, Benassayag C, Ferre F. Evidence for progesterone receptors in the human fetoplacental vascular tree. Bio l Reprod 2000; 62:759 765.

PAGE 163

163 110. Omar HA, Ramirez R, Gibson M. Properties of a progesterone induced relaxation in human placental arteries and veins. J Clin Endocrinol Metab 1995; 80:370 373. 111. Strauss JF, Martinez F, Kiriakidou M. Placental steroid ho rmone synthesis: unique features and unanswered questions. Biol Reprod 1996; 54:303 311. 112. Conley AJ, Mason JI. Placental steroid hormones. Baillieres Clin Endocrinol Metab 1990; 4:249 272. 113. Evain Brion D, Malassine A. Human placenta as an endocrine organ. Growth Horm IGF Res 2003; 13:S34 S37. 114. Jonathan R S. Glucocorticoid programming of the fetus; adult phenotypes and molecular mechanisms. Mol Cell Endocrinol 2001; 185:61 71. 115. Jansson T, Powell TL. Role of the placenta in fetal pr ogramming: underlying mechanisms and potential interventional approaches. Clin Sci 2007; 113:1 13. 116. Albergotti LC, Hamlin HJ, McCoy MW, Guillette LJ, Jr. Endocrine activity of extraembryonic membranes extends beyond placental amniotes. PLoS ONE 2009; 4:e5452. 117. Shanker YG, Jagannadha Rao A. Progesterone receptor expression in the human placenta. Mol Hum Reprod 1999; 5:481 486. 118. Hsu TY, Lan KC, Tsai CC, Ou CY, Cheng BH, Tsai MY, Kang HY, Tung YH, Wong YH, Huang KE. Expression of androgen recept or in human placentas from normal and preeclamptic pregnancies. Taiwan J Obstet Gyne 2009; 48:262 267. 119. Klemcke HG, Sampath Kumar R, Yang K, Vallet JL, Christenson RK. 11 beta hydroxysteroid dehydrogenase and glucocorticoid receptor messenger RNA expr ession in porcine placentae: effects of stage of gestation, breed, and uterine environment. Biol Reprod 2003; 69:1945 1950. 120. Bukovsky A, Cekanova M, Caudle MR, Wimalasena J, Foster JS, Henley DC, Elder RF. Expression and localization of estrogen recep tor alpha protein in normal and abnormal term placentae and stimulation of trophoblast differentiation by estradiol. Reprod Biol Endocrinol 2003; 1:1 18. 121. Bukovsky A, Caudle MR, Cekanova M, Fernando RI, Wimalasena J, Foster JS, Henley DC, Elder RF. Placental expression of estrogen receptor beta and its hormone binding variant comparison with estrogen receptor alpha and a role for estrogen receptors in asymmetric division and differentiation of estrogen dependent cells. Reprod Biol Endocrinol 2003; 1:1 21.

PAGE 164

164 122. Schimmer BP, White PC. Minireview: steroidogenic factor 1: its roles in differentiation, development, and disease. Mol Endocrinol 2010; 24:1322 1337. 123. Beato M, Klug J. Steroid hormone receptors: an update. Hum Reprod Update 2000; 6:225 23 6. 124. Lang JW, Andrews HV. Temperature dependent sex determination in crocodilians. J Exp Zool 1994; 270:28 44. 125. Milnes MR, Jr, Roberts RN, Guillette LJ, Jr. Effects of incubation temperature and estrogen exposure on aromatase activity in the brain and gonads of embryonic alligators. Environ Health Perspect 2002; 110:393 396. 126. Durkee TJ, McLean MP, Hales DB, Payne AH, Waterman MR, Khan I, Gibori G. P450(17 alpha) and P450SCC gene expression and regulation in the rat placenta. Endocrinology 1992 ; 130:1309 1317. 127. Arensburg J, Payne AH, Orly J. Expression of steroidogenic genes in maternal and extraembryonic cells during early pregnancy in mice. Endocrinology 1999; 140:5220 5232. 128. Sood R, Zehnder JL, Druzin ML, Brown PO. Gene expression patterns in human placenta. Proc Natl Acad Sci USA 2006; 103:5478 5483. 129. Ferguson M. Reproductive biology and embryology of the crocodilians. In: Gans C, Maderson P, Billet F (eds.), Biology of the reptilia, vol. 14. New York: J. Wiley and Sons; 1985: 329 491. 130. Gunderson MP, Kohno S, Blumberg B, Iguchi T, Guillette LJ, Jr. Up regulation of the alligator CYP3A77 gene by toxaphene and dexamethasone and its short term effect on plasma testosterone concentrations. Aquat Toxicol 2006; 78:272 283. 131. Kohno S, Bermudez DS, Katsu Y, Iguchi T, Guillette LJ, Jr. Gene expression patterns in juvenile American alligators ( Alligator mississippiensis ) exposed to environmental contaminants. Aquat Toxicol 2008; 88:95 101. 132. Milnes MR, Bryan TA, Katsu Y, Kohn o S, Moore BC, Iguchi T, Guillette LJ, Jr. Increased posthatching mortality and loss of sexually dimorphic gene expression in alligators ( Alligator mississippiensis ) from a contaminated environment. Biol Reprod 2008; 78:932 938. 133. Moore BC, Milnes MR, Kohno S, Katsu Y, Iguchi T, Guillette LJ, Jr. Influences of sex, incubation temperature, and environmental quality on gonadal estrogen and androgen receptor messenger RNA expression in juvenile American alligators ( Alligator mississippiensis ). Biol Reprod 2010; 82:194 201.

PAGE 165

165 134. Katsu Y, Bermudez DS, Braun EL, Helbing C, Miyagawa S, Gunderson MP, Kohno S, Bryan TA, Guillette LJ, Jr., Iguchi T. Molecular cloning of the estrogen and progesterone receptors of the American alligator. Gen Comp Endocrinol 2004; 1 36:122 133. 135. Conley AJ, Head JR, Stirling DT, Mason JI. Expression of steroidogenic enzymes in the bovine placenta and fetal adrenal glands throughout gestation. Endocrinology 1992; 130:2641 2650. 136. Lea RG, Wooding P, Stewart I, Hannah LT, Morton S, Wallace K, Aitken RP, Milne JS, Regnault TR, Anthony RV, Wallace JM. The expression of ovine placental lactogen, StAR and progesterone associated steroidogenic enzymes in placentae of overnourished growing adolescent ewes. Reproduction 2007; 133:785 796 137. Tuckey RC. Progesterone synthesis by the human placenta. Placenta 2005; 26:273 281. 138. Johnson DC. Cellular localization and factors controlling rat placental cytochrome P45017 alpha (CYP17): 17 alpha hydroxylase/C17,20 lyase activity. Biol Repr od 1992; 46:30 38. 139. Mason JI, France JT, Magness RR, Murry BA, Rosenfeld CR. Ovine placental steroid 17{alpha} hydroxylase/C 17,20 lyase, aromatase and sulphatase in dexamethasone induced and natural parturition. J Endocrinol 1989; 122:351 359. 140. Albrecht ED, Pepe GJ. Placental steroid hormone biosynthesis in primate pregnancy. Endocr Rev 1990; 11:124 150. 141. Kamat A, Graves KH, Smith ME, Richardson JA, Mendelson CR. A 500 bp region, 40 kb upstream of the human CYP19 (aromatase) gene, mediates placenta specific expression in transgenic mice. Proc Natl Acad Sci USA 1999; 96:4575 4580. 142. Kamat A, Hinshelwood MM, Murry BA, Mendelson CR. Mechanisms in tissue specific regulation of estrogen biosynthesis in humans. Trends Endocrin Met 2002; 13:122 128. 143. Hahn T, Barth S, Graf R, Engelmann M, Beslagic D, Reul JMHM, Holsboer F, Dohr G, Desoye G. Placental glucose transporter expression is regulated by glucocorticoids. J Clin Endocrinol Metab 1999; 84:1445 1452. 144. Robinson BG, Emanuel RL, Frim DM, Majzoub JA. Glucocorticoid stimulates expression of corticotropin releasing hormone gene in human placenta. P Nat Acad Sci 1988; 85:5244 5248.

PAGE 166

166 145. Baisden B, Sonne S, Joshi RM, Ganapathy V, Shekhawat PS. Antenatal dexamethasone treatment leads to cha nges in gene expression in a murine late placenta. Placenta 2007; 28:1082 1090. 146. Hewitt DP, Mark PJ, Waddell BJ. Glucocorticoids prevent the normal increase in placental vascular endothelial growth factor expression and placental vascularity during la te pregnancy in the rat. Endocrinology 2006; 147:5568 5574. 147. Whittle WL, Patel FA, Alfaidy N, Holloway AC, Fraser M, Gyomorey S, Lye SJ, Gibb W, Challis JRG. Glucocorticoid regulation of human and ovine parturition: the relationship between fetal hypothalamic pituitary adrenal axis activation and intrauterine prostaglandin production. Biol Reprod 2001; 64:1019 1032. 148. Shanker YG, Rao AJ. Regulation of progresterone biosynthesis in the human 1997; 43:591 599. 149. Ferguson MWJ. Post laying stages of embryonic development for crocodilians. In: Webb G, Manolis JW, Charlie S, Whitehead PJ (eds.), Wildlife management: crocodiles and alligators. Chipping Norton, Australia: Surrey Beatty & Sons Pt y Limited; 1987. 150. Medler KF, Lance VA. Sex differences in plasma corticosterone levels in alligator ( Alligator mississippiensis ) embryos. J Exp Zool 1998; 280:238 244. 151. Kalliecharan R, Hall BK. A developmental study of the levels of progesterone, corticosterone, cortisol, and cortisone circulating in plasma of chick embryos. Gen Comp Endocrinol 1974; 24:364 372. 152. Clifton VL. Review: sex and the human placenta: mediating differential strategies of fetal growth and survival. Placenta; 31:S33 S3 9. 153. Mao J, Zhang X, Sieli PT, Falduto MT, Torres KE, Rosenfeld CS. Contrasting effects of different maternal diets on sexually dimorphic gene expression in the murine placenta. P Nat Acad Sci 2010; 107:5557 5562. 154. Bergeron JM, Gahr M, Horan K, Wi bbels T, Crews D. Cloning and in situ hybridization analysis of estrogen receptor in the developing gonad of the red eared slider turtle, a species with temperature dependent sex determination. Dev Growth & Differ 1998; 40:243 254. 155. Elf PK. Yolk steroid hormones and sex determination in reptiles with TSD. Gen Comp Endocrinol 2003; 132:349 355. 156. Pieau C, Dorizzi M. Oestrogens and temperature dependent sex determination in reptiles: all is in the gonads. J Endocrinol 2004; 181:367 377.

PAGE 167

167 157. Ram sey M, Crews D. Steroid signaling and temperature dependent sex determination reviewing the evidence for early action of estrogen during ovarian determination in turtles. Semin Cell Dev Biol 2009; 20:283 292. 158. Clark BJ, Stocco DM. StAR A tissue spec ific acute mediator of steroidogenesis. Trends Endocrin Met 1996; 7:227 233. 159. Groothuis TGG, Schwabl H. Hormone mediated maternal effects in birds: mechanisms matter but what do we know of them? Philos T R Soc B 2008; 363:1647 1661. 160. Hamlin HJ, L owers RH, Albergotti LC, McCoy MW, Mutz J, Guillette LJ, Jr. Environmental influence on yolk steroids in American alligators ( Alligator mississippiensis ). Biol Reprod 2010; 83:736 741. 161. Bowden RM, Ewert MA, Nelson CE. Hormone levels in yolk decline throughout development in the red eared slider turtle ( Trachemys scripta elegans ). Gen Comp Endocrinol 2002; 129:171 177. 162. Paitz RT, Bowden RM. Rapid decline in the concentrations of three yolk steroids during development: Is it embryonic regulation? Gen Comp Endocrinol 2009; 161:246 251. 163. Conley AJ, Elf P, Corbin CJ, Dubowsky S, Fivizzani A, Lang JW. Yolk steroids decline during sexual differentiation in the alligator. Gen Comp Endocrinol 1997; 107:191 200. 164. Woods JE, Podczaski ES. Androgen synthesis in the gonads of the chick embryo. Gen Comp Endocrinol 1974; 24:413 423. 165. Woods JE, Simpson RM, Moore PL. Plasma testosterone levels in the chick embryo. Gen Comp Endocrinol 1975; 27:543 547. 166. Gilbert L, Bulmer E, Arnold KE, Graves JA. Yolk androgens and embryo sex: maternal effects or confounding factors? Horm Behav 2007; 51:231 238. 167. Paitz RT, Bowden RM, Casto JM. Embryonic modulation of maternal steroids in European starlings ( Sturnus vulgaris ). P R Soc B 2010; 278:99 106. 168. Tong MH, Jiang H, Liu P, Lawson JA, Brass LF, Song W C. Spontaneous fetal loss caused by placental thrombosis in estrogen sulfotransferase deficient mice. Nat Med 2005; 11:153 159. 169. Reed MJ, Purohit A, Woo LWL, Newman SP, Potter BVL. Steroid sulfatase : molecular biology, regulation, and inhibition. Endocr Rev 2005; 26:171 202.

PAGE 168

168 170. Paitz RT, Bowden RM. A proposed role of the sulfotransferase/sulfatase pathway in modulating yolk steroid effects. Integr Comp Biol 2008; 48:419 427. 171. Romanoff AL. The avian embryo. New York Macmillan; 1960. 172. Mess A, Carter AM. Evolution of the placenta during the early radiation of placental mammals. Comp Biochem Phys A 2007; 148:769 779. 173. Stewart ME, Terepka AR. Transport functions of the chick chorio allanto ic membrane: normal histology and evidence for active electrolyte transport from the allantoic fluid, in vivo. Exp Cell Res 1969; 58:93 106. 174. Munro HN, Pilistine SJ, Fant ME. The Placenta in nutrition. Annu Rev Nutr 1983; 3:97 124. 175. Blackburn DG. Convergent evolution of viviparity, matrotrophy, and specializations for fetal nutrition in reptiles and other vertebrates. Am Zool 1992; 32:313 321. 176. Levitz M. Conjugation and transfer of fetal placental steroid hormones. J Clin Endocrinol Metab 196 6; 26:773 777. 177. Lee MJ, Wang Z, Yee H, Ma Y, Swenson N, Yang L, Kadner SS, Baergen RN, Logan SK, Garabedian MJ, Guller S. Expression and regulation of glucocorticoid receptor in human placental villous fibroblasts. Endocrinology 2005; 146:4619 4626. 178. Ogle TF, Mills TM, Soares MJ. Changes in cytosolic and nuclear progesterone receptors during pregnancy in rat placenta. Biol Reprod 1989; 40:1012 1019. 179. Pieber D, Allport VC, Hills F, Johnson M, Bennett PR. Interactions between progesterone recep tor isoforms in myometrial cells in human labour. Mol Hum Reprod 2001; 7:875 879. 180. Zardoya R, Meyer A. The evolutionary position of turtles revised. Naturwissenschaften 2001; 88:193 200. 181. Blackburn DG. Viviparity and oviparity: evolution and repr oductive strategies. In: Knobil TE, Neill JD (eds.), Encyclopedia of reproduction, vol. 4. London, UK: Academic Press; 1999: 994 1003. 182. Enge KM, Percival HF, Rice KG, Jennings ML, Masson GR, Woodward AR. Summer nesting of turtles in alligator nests in Florida. J Herpetol 2000; 34:497 503.

PAGE 169

169 183. Yntema CL. A series of stages in the embryonic development of Chelydra serpentina J Morphol 1968; 125:219 251. 184. Ewert MA, Etchberger CR, Nelson CE. Turtle sex determining modes and TSD patterns, and some TSD patterns correlates. In: Valenzuela N, Bull JJ (eds.), Temperature dependent sex determination: Smithsonian Books; 2004. 185. Neill WT. Viviparity in snakes: Some ecological and zoogeographical considerations. Am Nat 1964; 98:35 55. 186. Ogle TF. Cha racteristics of high affinity progesterone binding to rat placental cytosol. Endocrinology 1980; 106:1861 1868. 187. Reynolds LP, Redmer DA. Angiogenesis in the placenta. Biol Reprod 2001; 64:1033 1040. 188. Wilting J, Christ B, Bokeloh M, Weich HA. In v ivo effects of vascular endothelial growth factor on the chicken chorioallantoic membrane. Cell Tissue Res 1993; 274:163 172. 189. Ribatti D, Nico B, Vacca A, Roncali L, Burri PH, Djonov V. Chorioallantoic membrane capillary bed: A useful target for study ing angiogenesis and anti angiogenesis in vivo. Anat Rec 2001; 264:317 324. 190. Ancelin M, Buteau Lozano H, Meduri G, Osborne Pellegrin M, Sordello S, Plout J, Perrot Applanat M. A dynamic shift of VEGF isoforms with a transient and selective progestero ne induced expression of VEGF189 regulates angiogenesis and vascular permeability in human uterus. Proc Natl Acad Sci USA 2002; 99:6023 6028. 191. Rider V, Carlone DL, Foster RT. Oestrogen and progesterone control basic fibroblast growth factor mRNA in th e rat uterus. J Endocrinol 1997; 154:75 84. 192. Tsai MJ, BW OM. Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 1994:451 486. 193. Fujimoto J, Nakagawa Y, Toyoki H, Sakaguchi H, Sato E, Tamaya T. Estrogen related receptor expression in placenta throughout gestation. J Steroid Biochem Mol Biol 2005; 94:67 69. 194. Pikulkaew S, De Nadai A, Belvedere P, Colombo L, Dalla Valle L. Expression analysis of steroid hormone receptor mRNAs during zebrafish embryogene sis. Gen Comp Endocrinol 2010; 165:215 220. 195. Speake BK, Murray AMB, Noble RC. Transport and transformations of yolk lipids during development of the avian embryo. Prog Lipid Res 1998; 37:1 32.

PAGE 170

170 196. Noble RC, Connor K, Smith WK. The synthesis and accum ulation of cholesterol esters by the developing embryo of domestic fowl. Poult Sci 1984; 63:558 564. 197. Azuma M, Seki T, Fujishita S. Changes of egg retinoids during the development of Xenopus laevis Vision Res 1990; 30:1395 1400. 198. Greenblatt M, B rown CL, Lee M, Dauder S, Bern HA. Changes in thyroid hormone levels in eggs and larvae and in iodide uptake by eggs of coho and chinook salmon, Oncorhynchus kisutsch and O. tschawytscha Fish Phys Biochem 2005; 6:261 278. 199. Hwang P P, Wu S M, Lin J H, Wu L S. Cortisol content of eggs and larvae of teleosts. Gen Comp Endocrinol 1992; 86:189 196. 200. Irie T, Seki T. Retinoid composition and retinal localization in the eggs of teleost fishes. Comp Biochem Physiol B 2002; 131:209 219. 201. Kobuke L, Spe cker JL, Bern HA. Thyroxine content of eggs and larvae of coho salmon, Oncorhynchus kisutch J Exp Zool 1987; 242:89 94. 202. Lam TJ. Hormones and egg/larval quality in fish. J World Aquac Soc 1994; 25:2 12. 203. Weber GM, Farrar ES, Tom CKF, Grau EG. Ch anges in whole body thyroxine and triiodothyronine concentrations and total content during early development and metamorphosis of the toad Bufo marinus Gen Comp Endocrinol 1994; 94:62 71. 204. Hanken J, Jennings DH, Olsson L. Mechanistic basis of life hi story evolution in anuran amphibians: direct development. Amer Zool 1997; 37:160 171. 205. Ezaz T, Stiglec R, Veyrunes F, Marshall Graves JA. Relationships between vertebrate ZW and XY sex chromosome systems. Curr Biol 2006; 16:R736 R743. 206. Cobb GP, B argar TA, Pepper CB, Norman DM, Houlis PD, Anderson TA. Using chorioallantoic membranes for non lethal assessment of persistent organic pollutant exposure and effect in oviparous wildlife. Ecotoxicology 2003; 12:31 45. 207. Peakall DB. DDE: its presence i n peregrine eggs in 1948. Science 1974; 183:673 674. 208. Annas A, Granberg L, Strandberg W, Brandt I, Brittebo EB, Brunstrm B. Basal and induced EROD activity in the chorioallantoic membrane during chicken embryo development. Environ Toxicol Phar 1999; 8:49 52.

PAGE 171

171 209. Granberg L, Brunstrm B, Brandt I. Formation of benzo[a]pyrene and 7,12 dimethylbenz[a]anthracene adducts in vascular endothelia of cytochrome P4501A induced chicken embryos. Environ Toxicol Chem 2003; 22:2393 2399. 210. Peakal DB, Lew TS, S pringer AM, Walker Ip W, Risebrough RW, Monk JG, Jarman WM, Walton BJ, Reynolds LM, Fyfe RW, Kiff LF. Determination of the DDE and PCB contents of peregrine falcon eggs: A comparison of whole egg measurements and estimates derived from eggshell membranes. Arch Environ Contam Toxicol 1983; 12:523 528. 211. Cobb GP, Norman DM, Kendall RJ. Organochlorine contaminant assessment in great blue herons using traditional and nonlethal monitoring techniques. Environ Pollut 1994; 83:299 309. 212. Cobb GP, Wood PD, O 'Quinn M. Polychlorinated biphenyls in eggs and chorioallantoic membranes of American alligators ( Alligator mississippiensis ) from coastal South Carolina. Environ Toxicol Chem 1997; 16:1456 1462. 213. Colborn T, Clement C (eds.). Chemically induced altera tions in sexual and functional development: The wildlife/human connection. Princeton: Princeton University Press; 1992. 214. Guillette LJ, Jr. Endocrine disrupting contaminants beyond the dogma. Environ Health Perspect 2005; 114. 215. Fisher JS. Are all EDC effects mediated via steroid hormone receptors? Toxicology 2004; 205:33 41. 216. Crain DA, Eriksen M, Iguchi T, Jobling S, Laufer H, LeBlanc GA, Guillette LJ, Jr. An ecological assessment of bisphenol A: evidence from comparative biology. Reprod Toxic ol 2007; 24:225 239. 217. Dodds EC, Lawson W. Synthetic oestrogenic agents without the phenanthrene nucleus. Nature (Lond) 1936; 137. 218. Vandenberg LN, Maffini MV, Sonnenschein C, Rubin BS, Soto AM. Bisphenol A and the great divide: a review of controv ersies in the field of endocrine disruption. Endocr Rev 2009; 30:75 95. 219. Vom Saal FS, Hughes C. An extensive new literature concerning low dose effects of bisphenol A shows the need for a new risk assessment. Environ Health Perspect 2005; 113:926 933. 220. Rubin BS, Murray MK, Damassa DA, King JC, Soto AM. Perinatal exposure to low doses of bisphenol A affects body weight, patterns of estrous cyclicity, and plasma LH levels. Environ Health Perspect 2001; 109.

PAGE 172

172 221. Council AC. http://www.bisphenol a.org/index.html In. Washington, DC; 2011. 222. Annas A, Brunstrm B, Brittebo EB. CYP1A dependent activation of xenobiotics in endothelial linings of the chorioallantoic membrane (CAM) in birds. Arch Toxicol 2000; 74:335 342. 223. Agency USEP. A cross species mode of action information assessment: a case study of bisphenol A. In: Assessment NCfE (ed.). Washington, DC; 2005. 224. Levy G, Lutz I, Krger A, Kloas W. Bisphenol A induces feminization in X enopus laevis tadpoles. Environ Res 2004; 94:102 111. 225. Laws SC, Carey SA, Ferrell JM, Bodman GJ, Cooper RL. Estrogenic activity of octylphenol, nonylphenol, bisphenol A and methoxychlor in rats. Toxicol Sci 2000; 54:154 167. 226. Ing NH, Tornesi MB. Estradiol up regulates estrogen receptor and progesterone receptor gene expression in specific ovine uterine cells. Biol Reprod 1997; 56:1205 1215. 227. Bergeron RM, Thompson TB, Leonard LS, Pluta L, Gaido KW. Estrogenicity of bisphenol A in a human endom etrial carcinoma cell line. Mol Cell Endocrinol 1999; 150:179 187. 228. stimulatory effects of estrogen on aromatase (CYP19) gene expression in human placenta. Mol Endocrinol 2009; 23:784 793. 229. Kinoshita Y, Chen S. Induction of aromatase (CYP19) expression in breast 2003; 63:3546 3555. 230. Tsai CL, Wang LH, Fang LS. Estradiol and para chlorophenylalani ne during the critical period of feminization in tilapia ( Oreochromis mossambicus ). Neuroendocrinology 2001; 74:325 334. 231. Zhou W, Liu J, Liao L, Han S, Liu J. Effect of bisphe nol A on steroid hormone production in rat ovarian theca interstitial and granulosa cells. Mol Cell Endocrinol 2008; 283:12 18. 232. Huang H, Leung LK. Bisphenol A downregulates CYP19 transcription in JEG 3 cells. Toxicol Lett 2009; 189:248 252. 233. Mic evych P, Soma KK, Sinchak K. Neuroprogesterone: key to estrogen positive feedback? Brain Res Rev 2008; 57:470 480.

PAGE 173

173 234. Beaudoin C, Blomquist C, Bonenfant M, Tremblay Y. Expression of the genes for 3 beta hydroxysteroid dehydrogenase type 1 and cytochrome P450scc during syncytium formation by human placental cytotrophoblast cells in culture and the regulation by progesterone and estradiol. J Endocrinol 1997; 154:379 387. 235. estradiol treatment decreases steroidogenic enzyme messenger ribonucleic acid levels in the rainbow trout testis. Endocrinology 2001; 142:1841 1848. 236. hydroxysteroid ultured leydig tumor cells. Endocrinology 1985; 117:2127 2133. 237. Ye L, Zhao B, Hu G, Chu Y, Ge R S. Inhibition of human and rat testicular steroidogenic enzyme activities by bisphenol A. Toxicol Lett 2011; 207:137 142. 238. Hardin B, Bond G, Sikov M, Andrew F, Beliles R, Niemeier R. Testing of selected workplace chemicals for teratogenic potential. Scand J Work Environ Health 1981; 7:66 75. 239. Ramakrishnan S, Wayne NL. Impact of bisphenol A on early embryonic development and reproductive maturation. Reprod Toxicol 2008; 25:177 183. 240. Savabieasfahani M, Kannan K, Astapova O, Evans NP, Padmanabhan V. Developmental programming: differential effects of prenatal exposure to bisphenol A or methoxychlor on reproductive function. Endocrinology 2006; 147: 5956 5966. 241. Zimmerman SA, Clevenger WR, Brimhall BB, Bradshaw WS. Diethylstilbestrol induced perinatal lethality in the rat. II. Perturbation of parturition. Biol Reprod 1991; 44:583 589. 242. Stoker C, Beldomenico PM, Bosquiazzo VL, Zayas MA, Rey F, Rodriguez H, Munoz de Toro M, Luque EH. Developmental exposure to endocrine disruptor chemicals alters follicular dynamics and steroid levels in Caiman latirostris Gen Comp Endocrinol 2008; 156:603 612. 243. Stoker C, Rey F, Rodriguez H, Ramos JG, Sirosky P, Larriera A, Luque EH, Munoz de Toro M. Sex reversal effects on Caiman latirostris exposed to environmentally relevant doses of the xenoestrogen bisphenol A. Gen Comp Endocrinol 2003; 133:287 296. 244. Hall JM, Couse JF, Korach KS. The multifaceted mechanisms of estradiol and estrogen receptor signaling. J Biol Chem 2001; 276:36869 36872.

PAGE 174

174 245. Barkhem T, Carlsson B, Nilsson Y, Enmark E, Gustafsson J Nilsson S. Differential response of estrogen recepto estrogen agonists/antagonists. Mol Pharmacol 1998; 54:105 112. 246. lator of the cellular response to estrogens and antiestrogens. Endocrinology 1999; 140:5566 5578. 247. Kuiper GGJM, Carlsson B, Grandien K, Enmark E, Hggblad J, Nilsson S, Gustafsson J Comparison of the ligand binding specificity and transcript tissue 870. 248. Sakimura M, Tsukada A, Usami M, Hanzawa S, Saito N, Ohno Y, Shimada K. P450 aromatase in the gonad of chicken embryos. J Poult Sci 2002; 39:302 309. 249. Sabo Attwood T, Blum JL, Kroll KJ, Patel V, Birkholz D, Szabo NJ, Fisher SZ, McKenna R, Campbell Thompson M, Denslow ND. Distinct expression and activity profiles of largem outh bass ( Micropterus salmoides ) estrogen receptors in response to estradiol and nonylphenol. J Mol Endocrinol 2007; 39:223 237. 250. Crews D, Bull JJ, Wibbels T. Estrogen and sex reversal in turtles: a dose dependent phenomenon. Gen Comp Endocrinol 1991 ; 81:357 364. 251. Podreka S, Georges A, Maher B, Limpus CJ. The environmental contaminant DDE fails to influence the outcome of sexual differentiation in the marine turtle Chelonia mydas Environ Health Perspect 1998; 106. 252. Behrman RE, Butler AS (ed s.). Preterm birth: causes, consequences, and prevention. The National Academies Press; 2007. 253. Stillerman KP, Mattison DR, Giudice LC, Woodruff TJ. Environmental exposures and adverse pregnancy outcomes: a review of the science. Reprod Sci 2008; 15:63 1 650. 254. Martin JA, Hamilton BE, Sutton PD, Ventura SJ, Menacker F, Kirmeyer S, Mathews TJ. Births: Final data for 2006. National vital statistics reports. In, vol. 57. Hyattsville, MD: National Center for Health Statistics; 2009. 255. Davidoff MJ, Di as T, Damus K, Russell R, Bettegowda VR, Dolan S, Schwarz RH, Green NS, Petrini J. Changes in the gestational age distribution among U.S. singleton births: impact on rates of late preterm birth, 1992 to 2002. Semin Perinatol 2006; 30:8 15.

PAGE 175

175 256. Brackbill Y Berendes HW. Dangers of diethylstilboestrol: review of a 1953 paper. Lancet 1978; 2:520. 257. Hatch EE, Troisi R, Wise LA, Titus Ernstoff L, Hyer M, Palmer JR, Strohsnitter WC, Robboy SJ, Anderson D, Kaufman R, Adam E, Hoover RN. Preterm birth, fetal gr owth, and age at menarche among women exposed prenatally to diethylstilbestrol (DES). Reprod Toxicol 2011; 31:151 157. 258. Henson MC, Chedrese PJ. Endocrine disruption by cadmium, a common environmental toxicant with paradoxical effects on reproduction. Exp Biol Med 2004; 229:383 392. 259. Longnecker MP, Klebanoff MA, Zhou H, Brock JW. Association between maternal serum concentration of the DDT metabolite DDE and preterm and small for gestational age babies at birth. The Lancet 2001; 358:110 114. 260. P athak R, Ahmed RS, Tripathi AK, Guleria K, Sharma CS, Makhijani SD, Banerjee BD. Maternal and cord blood levels of organochlorine pesticides: association with preterm labor. Clin Biochem 2009; 42:746 749. 261. DeLong RL, Gilmartin WG, Simpson JG. Prematur e births in California Sea Lions: association with high organochlorine pollutant residue levels. Science 1973; 181:1168 1170. 262. Cantonwine D, Meeker J, Hu H, Sanchez B, Lamadrid Figueroa H, Mercado Garcia A, Fortenberry G, Calafat A, Tellez Rojo M. Bis phenol A exposure in Mexico City and risk of prematurity: a pilot nested case control study. Environ Health 2010; 9:62. 263. Ranjit N, Siefert K, Padmanabhan V. Bisphenol A and disparities in birth outcomes: a review and directions for future research. J Perinatol 2010; 30:2 9. 264. (DDT) in egg forming tissues and eggs of laying hens following a single oral administration. J Vet Med A 2002; 49:334 336. 265. Terepka AR, Stewart ME, Merkel N. Tran sport functions of the chick chorio allantoic membrane: II. Active calcium transport, in vitro. Exp Cell Res 1969; 58:107 117. 266. Crain DA, Guillette LJ, Jr, Rooney AA, Pickford DB. Alterations in steroidogenesis in alligators ( Alligator mississippiensi s ) exposed naturally and experimentally to environmental contaminants. Environ Health Perspect 1997; 105:528 533.

PAGE 176

176 267. Bergeron JM, Crews D, McLachlan JA. PCBs as environmental estrogens: turtle sex determination as a biomarker of environmental contaminati on. Environ Health Perspect 1994; 102:780 781. 268. Solla SRd, Martin PA. Absorption of current use pesticides by snapping turtle ( Chelydra serpentina ) eggs in treated soil. Chemosphere 2011. 269. Domoradzki JY, Pottenger LH, Thornton CM, Hansen SC, Card TL, Markham DA, Dryzga MD, Shiotsuka RN, Waechter JM. Metabolism and pharmacokinetics of bisphenol A (BPA) and the embryo fetal distribution of BPA and BPA monoglucuronide in CD Sprague Dawley rats at three gestational stages. Toxicol Sci 2003; 76:21 34. 270. Schnfelder G, Wittfoht W, Hopp H, Talsness CE, Paul M, Chahoud I. Parent bisphenol A accumulation in the human maternal fetal placental unit. Environ Health Perspect 2002; 110:doi:10.1289/ehp.021100703. 271. Vandenberg LN, Hauser R, Marcus M, Olea N, Welshons WV. Human exposure to bisphenol A (BPA). Reprod Toxicol 2007; 24:139 177. 272. Halldin K, Berg C, Bergman Brandt I, Brunstrm B. Distribution of bisphenol A and tetrabromobisphenol A in quail eggs, embryos and laying birds and studies on reproduction variables in adults following in ovo exposure. Arch Toxicol 2001; 75:597 603. 273. Takayanagi S, Tokunaga T, Liu X, Okada H, Matsushima A, Shimohigashi Y. Endocrine disruptor bisphenol A strongly binds to human estrogen related 105. 274. Takeda Y, Liu X, Sumiyoshi M, Matsushima A, Shimohigashi M, Shimohigashi Y. the human reproductive tissue s: predominant expression of type isoform. J Biochem (Tokyo) 2009; 146:113 122. 275. Escobar JC, Patel SS, Beshay VE, Suzuki T, Carr BR. The human placenta expresses CYP17 and generates androgens de novo. J Clin Endocrinol Metab 2011; 96:1385 1392. 276. Mukherjee S, James JL, Thilaganathan B, Whitley GSJ, Michael AE, Cartwright JE. Elevated glucocorticoid metabolism in placental tissue from first trimester pregnancies at increased risk of pre eclampsia. Placenta 2011; 32:687 693. 277. Sathishkumar K, Balakrishnan M, Chinnathambi V, Chauhan M, Hankins GDV, Yallampalli C. Fetal sex related dysregulation in testosterone production and their receptor expression in the human placenta with preeclampsia. J Perinatol 2011.

PAGE 177

177 278. Wake MH. Evolutionary scenar ios, homology and convergence of structural specializations for vertebrate viviparity. Am Zool 1992; 32:256 263. 279. Schwarz BE, Milewich L, Gant NF, Johnston JM, MacDonald PC, Porter JC. Progesterone binding and metabolism in human fetal membranes. Ann N Y Acad Sci 1977; 286:304 312. 280. Stewart PM, Rogerson FM, Mason JI. Type 2 11 beta hydroxysteroid dehydrogenase messenger ribonucleic acid and activity in human placenta and fetal membranes: its relationship to birth weight and putative role in fetal adrenal steroidogenesis. J Clin Endocrinol Metab 1995; 80:885 890. 281. Hobkirk R. Steroid sulfotransferases and steroid sulfate sulfatases: characteristics and biological roles. Can J Biochem Cell Biol 1985; 63:1127 1144. 282. Taylor AH, McParland PC, T aylor DJ, Bell SC. The progesterone receptor in human term amniochorion and placenta is isoform C. Endocrinology 2006; 147:687 693. 283. Sun M, Ramirez M, Challis JRG, Gibb W. Immunohistochemical localization of the glucocorticoid receptor in human fetal membranes and decidua at term and preterm delivery. J Endocrinol 1996; 149:243 248. 284. Andrews RM. Patterns of embryonic development. In: Deeming DC (ed.) Reptilian incubation: environment, evolution and behaviour. Nottingham: Nottingham University Pres s; 2004: 75 102. 285. Andrews RM. Evolution of viviparity in squamate reptiles ( Sceloporus spp.): a variant of the cold climate model. J Zool 2000; 250:243 253. 286. Breit S, Ashman K, Wilting J, Rssler J, Hatzi E, Fotsis T, Schweigerer L. The N myc onc ogene in human neuroblastoma cells: down regulation of an angiogenesis inhibitor identified as activin A. Cancer Res 2000; 60:4596 4601. 287. Martial JA. Opposing actions of intact and N terminal fragments of the human prolactin/growth hormone family members on angiogenesis: an efficient mechanism for the regulation of angiogenesis. Proc Nat Acad Sci USA 1999; 96:1246 1251. 288. Wei L H, Kuo M L, Chen C A, Chou C H, Lai K B, Lee C N, Hsieh C Y. Interleukin 6 promotes cervical tumor growth by VEGF dependent angiogenesis via a STAT3 pathway. Oncogene 2003; 22:1517 1527.

PAGE 178

178 289. Form DM, Auerbach R. PGE2 and angiogenesis. Proc Soc Exp Biol Med 1983; 172:214 218.

PAGE 179

179 BIOGRAPHICAL S KETCH Lori Cruze Albergotti was born in Knoxville, Tennessee. She graduated from Farragut High School in 1990 and attended Pellissippi State Technical Community College before transferring to the University of Tennessee where she graduated Cum Laude tenure, Lori worked as a research assistant in the laboratory of Neil Greenberg where she assisted with behavioral assays investigating the physiology of aggressive and reproductive behavior in the green anole ( Anolis carolinensis ). After graduation, Lori went on to work as a veterinary technician for a number of years in South Carolina, Alaska and Oregon before returning to science. In 2004, Lori joined the laboratory of Patrick P hillips as a research technician in the Center for Ecology and Evolutionary Biology at the University of Oregon. In the Phillips lab, Lori investigated variation in thermal preference among natural isolates of the soil nematode, Caenorhabditis elegans Thi s study provided the first empirical test of the classical adaptive hypothesis, which predicts that organisms should prefer temperatures that maximize fit ness As a result of this work, Lori co authored two publications and received a student presentation award at the 2006 Meeting of Evolutionary Biologists of the Pacific Northwest. After two years at the University of Oregon, Lori moved to the University of Florida and began her PhD in the Department of Zoology with Dr. Louis Guillette, Jr. Lori has assis ted in teaching one semester of Evolutionary Developmental Biology and one semester of Communicating Complexity in Science. During her graduate degree, Lori has been heavily involved with mentoring students in research activities and has

PAGE 180

180 mentored nine unde rgraduate and one high school student, five of whom are from underrepresented groups. Lori served as a Howard Hughes Medical Institute G.A.T.O.R (Group Advantaged Training of Research) mentor from 2007 2008 and as assistant director from 2009 2010. Lori me ntored two students who have presented their work at international conferences and five that have presented their work at University of Florida symposiums. In terms of Departmental service, Lori served as a coordinator for the Undergraduate Research Assi stantship Program from 2006 2008 and was the student representative on the Physiology job search committee in 2009. Lori served as president of the Biology Graduate Student Association and was the student representative on the advisory committee from 2009 2 010 She also served as a representative on the Graduate Student Fundraising Committee from 2010 2011. Outside of the Biology Department, Lori has served as an Alachua County Science and Engineering Fair judge in 2008 and 2010. She also traveled to Tulane University in New Lori was awarded an Alumni fellowship at the University of Florida in 2006 and a N ational Science Foundation Graduate Research Fellowship in 2008. She received a Trainee poster award at the International Gordon Research Conference on Environmental Endocrine Disruptors in 2008 and as a result gave an impromptu oral presentation at that m Xi Grants in aid of Research awards, one of which was awarded to her undergraduate student. In 2010, Lori was an invited speaker at the International Environmental

PAGE 181

181 Hormone Conference in New Orleans. She has co authored one book c hapter and three peer reviewed publications during her time at the University of Florida o ne of which received the Best Graduate Student Paper award for the Department of Biology in 2009.