<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.

DARK ITEM
Permanent Link: http://ufdc.ufl.edu/UFE0043524/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.
Physical Description: Book
Language: english
Creator: El Mohtar, Choaa A
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Choaa A El Mohtar.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Dawson, William O.
Electronic Access: INACCESSIBLE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043524:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043524/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2014-12-31.
Physical Description: Book
Language: english
Creator: El Mohtar, Choaa A
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Choaa A El Mohtar.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Dawson, William O.
Electronic Access: INACCESSIBLE UNTIL 2014-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043524:00001


This item has the following downloads:


Full Text

PAGE 1

1 EXPLORING C ITRUS T RISTEZA V IRUS BASED VECTOR LIMITS FOR HETEROLOGOUS GENE/S EXPRESSION By CHOAA AMINE EL MOHTAR A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 C hoaa Amine El Mohtar

PAGE 3

3 To my family

PAGE 4

4 ACKNOWLEDGMENTS Success is team work in which the contribution of each member varies. I would like to thank the chai r of my committee Professor William O. Dawson who was influential in the success of this work through his continuous guidance, supervision and help enabling its presentation in this final format. I highly appreciate the time, commitment and effort of my co mmittee members Professor Ernest Hiebert, Dr. Jeffrey Rollins and Dr. Nian Wang. I am grateful for Dr. Satyanarayana Tatinei who guided my first steps into the C itrus tristeza virus world. Also I would like to acknowledge a lovely and nice person, Dr. Sidd arame Gowda for the fruitful discussions and help throughout my research. I am appreciative of support. I would like to thank the present and past CTV working team at Dr. William O. Dawson laboratory for the molecular biology kn owledge generated through the years and excellent technical support which enabled me to develop the present vectors. I should mention by name Cecile Robertson who helped me greatly by doing the ELISA, taking the plant photos and infecting most of the citru s seedlings. Furthermore, I would like to thank the present members for the great companion ship and friendly laboratory atmosphere they provide. You will always have a special niche in my heart. I should not forget my fellow students and friends in the U n iversity of F lorida plant path ology department and citrus research and education center especially Abby, Frank, Bo, Juan, Fahiem, Shamel, Ayako, Luis, Osama, Ahmad and Sriddahar. I would like to thank Dr Valerian Dolja who provided the TEV 7HAT, GLRaV 2 p 24 and TuMV P1/HC Pro clones and Dr Tom Kerpolla who provided the b i molecular fluorescence complementation clones. On a personal note, I would like to acknowledge my family. I am eternally indebted for my parents Amine and Ghania, for providing unconditio nal and exceptional support

PAGE 5

5 and standing by my side through all the years. I am blessed by having two great and lovely sisters Maya and Maysa, who have always been there for me Last but not least, is my gratitude for my wife Diana and my son Amine wh o are shaping my life and sacrificed a lot during the past two years. You provided the background platform for my success and I dedicate this work to you.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 ABSTRACT ................................ ................................ ................................ ................... 11 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 13 Virus Vectors ................................ ................................ ................................ .......... 13 Applications of Virus vectors ................................ ................................ ................... 13 History of Virus Vectors ................................ ................................ .......................... 14 Virus Vector Design ................................ ................................ ................................ 15 CTV Vectors ................................ ................................ ................................ ........... 16 2 MATERIALS AND METHODS ................................ ................................ ................ 19 Plasmid Construction ................................ ................................ .............................. 19 Polymerase Chain Reaction (PCR) ................................ ................................ ........ 33 Agrobacterium Injection/Infiltration ................................ ................................ ......... 34 Plant Growth Conditions ................................ ................................ ......................... 35 Infection of Citrus Plants ................................ ................................ ......................... 35 Protoplast Preparation, Transfection, RNA Isolation and Northern Blot Analysis ... 36 Western Blots ................................ ................................ ................................ ......... 37 Plant and Protoplast Photos ................................ ................................ ................... 38 Enzyme Linked Immunosorbent Assay (ELISA) ................................ ..................... 38 GUS Assay ................................ ................................ ................................ ............. 39 3 RESULTS ................................ ................................ ................................ ............... 40 Systems Used to Examine CTV Based Expression Vectors ................................ ... 40 Addition of an Extra Gene at Different Locations within the CTV Genome ............. 41 Insertions at the p13 Gene Site ................................ ................................ ........ 41 Gene insertion between p20 and p23 ................................ ............................... 47 ................................ ................................ .... 50 Production of an Extra Protein without Pro ducing an Extra Subgenomic mRNA .... 54 Internal Ribosome Entry Site Strategy (IRES) ................................ .................. 54 The Tobacco etch virus (TEV) IRES ................................ .......................... 54 Active ribosome complementary sequence (ARC) IRES ........................... 56 Poly Peptide Fusion ................................ ................................ ......................... 56 Production of Heterologous Proteins from a Single CTV Vector ............................. 59

PAGE 7

7 Use of Single Controller Elements to Express Multiple Proteins ...................... 59 Replacement of the p13 gene ................................ ................................ .... 60 ................................ .............................. 62 Use of Multiple Promoters to Express Foreign Genes Simul taneously ............ 63 Expression of multiple heterologous genes simultaneously from the same genomic location ................................ ................................ ........... 65 Expression of multiple f oreign genes simultaneously from different locations ................................ ................................ ................................ 69 Level of Foreign Gene Expression of the Different Constructs in Citrus ................. 72 4 DISCUSSION ................................ ................................ ................................ ......... 74 LIST OF REFERENCES ................................ ................................ ............................... 84 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 94

PAGE 8

8 LIST OF TABLES Table page 1 1 List of primers used in building expression vector ................................ .............. 22

PAGE 9

9 LIST OF FIGURES Figure page 3 1 GFP replacement of p13 to produ ce CTV based expression vectors ................. 4 4 3 2 GUS replacement of p13 to produce CTV based expression vectors. ................ 46 3 3 GFP i nsertion between p13 and p20 to produce CTV based expression vectors. ................................ ................................ ................................ ............... 48 3 4 GFP insertion between p20 and p23 to produce CTV based expression vectors. ................................ ................................ ................................ ............... 49 3 5 vectors. ................................ ................................ ................................ ............... 51 3 6 produc e CTV based expression vectors. ................................ ............................ 52 3 7 GFP inserted behind IRES sequences to create CTV based expression vectors. ................................ ................................ ................................ ............... 55 3 8 GFP and a protease fused to p23 to create CTV based expression vectors. ..... 56 3 9 Comparison of Florescence in N. benthamiana. ................................ ................. 57 3 10 Wes tern blot analysis of different expression vectors infiltrated into N. benthamiana leaves using GFP antibody. ................................ .......................... 59 3 11 Hybrid gene (GFP/Protease/GUS fusion) replacement of p13 to create express ion vectors. ................................ ................................ ............................. 61 3 12 Stability of Constructs in N. benthamiana ................................ .......................... 62 3 13 NTR to create expression vectors. ................................ ................................ ............................. 63 3 14 Activity of reporter genes generated by insertion of the Hybrid gene (GFP/Protease/GUS fusion) behind p23 ................................ .......................... 64 3 15 Bimolecular Flouresence compleme ntation (BiFC) prove of concept ................. 66 3 16 BiFC gene replacement of p13 to produ ce CTV based expression vectors ....... 67 3 17 CTV based expression vector built to simultaneously express two genes from two c ontroller elements ................................ ................................ ....................... 69

PAGE 10

10 3 18 CTV based expression vector built to simultaneously express two genes from two controller elements. ................................ ................................ ...................... 71 3 19 Western blot analysis of the different constructs in citrus to evaluate the expression of GFP and GUS. ................................ ................................ ............. 73

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy EXPLORING C ITRUS T RISTEZA V IRUS BASED VECTOR LI MITS FOR HETEROLOGOUS GENE/S EXPRESSION By C hoaa Amine El Mohtar December 2011 Chair: William O Dawson Major: Plant Pathology Virus vectors are key tools in basic molecular biology research and have great potential for commercial applications in express ing foreign genes Stability of foreign inserts is a major drawback for long term potential applications of virus vectors for protein expression. Citrus tristeza virus (CTV) has been unique among plant virus vectors in having the ability to accommodate a f oreign insert for many years. CTV has ten genes that are expressed by subgenomic (sg) RNAs. The controller elements for the sgRNA are located upstream of the open reading frames. Previously, a foreign gene was inserted between the major and minor coat protein genes. In this study I tested the vector limits of using CTV to express foreign genes ranging from 806 to 3480 n ucleotides in size. The gene cassettes were introduced into the CTV genome as replacement s of the p13 gene, as add ed extra gene s at three different locatio ns (p13 p20, p20 p23 and p23 translated region (NTR) ) a s fusion s to p23 and protease processing, and behind IRES sequences to create bi cistronic messages. Twenty seven expression vectors were created and tested in Nicotinia benthamiana protoplasts and plants. The most successful strategies were examined in citrus. Remarkably, most of the vector constructs replicated, spread

PAGE 12

12 systemically in plants, and expressed the foreign gene. The highest expressing vec tors replacing the p13 gene effectively expressed different reporter genes. However, optim al expression of the reporter gene depended both on the size and location of the insertion. Efficient expression of two genes simultaneously from the same vector was accomplished in both N. benthamiana a nd citrus. This research demonstrates the elasticity (size of inserts) and flexibility (different locations) of the CTV genome to accommodate and express foreign gene/s by different strategies.

PAGE 13

13 CHAPTER 1 INTRODUCTION Virus Vectors There are two common methods in which heterologous nucleotide sequences are expressed in plants. The first is by integrating foreign DNA into the plant genome, which is expressed in the next generation of plants. Alternatively, heterologous sequences can be expressed in the present generation of pl ants using virus based vecto rs. Virus vectors are developed via manipulation of the viral genome to express a sequence of interest. Virus vectors have been used to express or over express a protein of interest or to prevent expression of an endogenous gene by induction of RNA silenci ng Applications of Virus vectors Virus vectors have been developed from plant and animal viruses -RNA as well as DNA viruses. Viral vectors have become an integral tool of basic molecular biology research and have been intensively studied for developm ent of potential practical applications. In animal systems, viral vectors are being designed to treat genetic diseases caused by genetic disorders The application of this technology is referred to as gene therapy. More than 200 genes have been tested for human gene therapy (Edelstein et al., 2007). In plant systems, vectors have been used to induce gene silencing (virus induced gene silencing = VIGS) as a tool in the discovery of plant gene functions. Tagged viral vectors expressing reporter genes are rou tinely used to elucidate aspects of virus biology including understanding of replication, gene function, differential susceptibility of different genotypes, cell to cell as well as long distance movement, cross protection, temporal expression of genes, spa tial separation, localization within the host cell and insect transmission (Andrade et al., 2007;

PAGE 14

14 Baulcombe et al., 1995; Canto et al., 1997; Dawson et al., 1988, 1989; Deleris et al., 2006; Dietrich and Maiss, 2003; Dolja et al., 1992; Folimonova et al., 2008, 2010; Gowda et al., 2000; Hagiwara et al., 1999; Ion Nagy et al., 2006, Kawakami et al., 2004; Liu et al., 2009; Lucy et al., 2000; Padgett et al., 1997; Ratcliff et al., 1999; Roberts et al., 1997; Sato et al., 2003; Takahashi et al., 2007; Tatineni et al., 2008; 2011; Verver et al., 1998). For potential commercial applications, several biotechnology companies are using virus based expression vectors to produce specialty products such as vaccines, antibodies, and pharmaceuticals in plants (Canizares et al., 2005; Gleba et al., 2007; Lico et al., 2008). Recently, a virus based vector expressing an engineered zinc finger nuclease has been used to non transgenically stably modify plant genomes (Marton et al., 2010). History of Virus Vectors The early de velopment of viral vectors was aimed at the inexpensive production of high levels of specialty proteins that could be scaled up in the field. The first attempt s at a plant viral vector utilized Cauliflower mosaic virus a dsDNA virus (Brisson et al., 1984; Gronenborn et al., 1981). However, this vector was too unstable to be useful ( Ftterer et al., 1990). The development of reverse genetics systems amenable for manipulation of RNA viruses made many more viruses candidates for vector development (Ahlquist e t al., 1984). In the early development of these systems, t here was considerable controversy concerning the value of RNA viruses fo r vectors (Siegel, 1983, 1985; Van Vluten Dotting, 1983 Van Vluten Dotting et al., 1985). It was argued that the lack of proof reading of the RNA virus replicases would result in rapid sequence drift that could not maintain the fidelity of foreign sequences during replication. However, subsequent

PAGE 15

15 development and use of RNA virus based vectors demonstrated that this concern was ov erstated. Virus Vector Design In the earliest stages of vector design were gene substitutions in which a heterologous open reading frame (ORF) was substituted for a viral ORF (Brisson et al., 1984; Dawson et al., 1988; French et al., 1986; Siegel, 1983; Ta kamatsu et al., 1987). The substituti on strategy expressed low level s of the foreign protein s and did not spread throughout the plant ( Dawson et al., 1988; French et al ., 1986; Takamatsu et al., 1987 ). et al., 1989) that added an extra subgenomic RNA promoter to produce an extra sub genomic RNA for expression of the inserted ORF. Insertion of proteins designed to be cleaved from the poly protein has been used to express extra proteins from viruses that e xpress their genome via a poly protein strategy (for example the potyviri dae family) (Dolja et al., 1992, 1997). Another strategy employs internal ribosome entry sites which can initiate translation of an internal ORF as a bi cistronic messenger RNA (Toth et al., 2001). Engineering an effective vector requires a balance between different factors. The vector needs to be designed such that replication and systemic movement in the plant are reduced minimally while the level of expression of the foreign protein is maximal (Shivprasad et al., 1999). The final factor i s the stability of the vector. In general, the reduced recombination and increased competitiveness of the vect or with the resulting recombinants that have lost part or all of the inserted sequences.

PAGE 16

16 CTV Vectors been working to create virus based vectors for citrus trees based on Citrus tristeza virus (CTV) (Folimonov et al., 2007) CTV with a g en ome size of approximately 20kb, has the largest reported genome of a plant RNA virus (Karasev et al., 1995; Pappu et al., 1994). It has two conserved gene modules associated with replication and virion formation (Karasev, 2000). The replication gene modu le occupies protein strategy with a +1 ribosomal frame shift for a limited express ion of the RNA dependent RNA polymerase (Karasev et al., 1995). The filamentous virions of CTV are encapsidated by two coat proteins, with the major coat protein (CP) encapsidating about 97% of the virus RNA (CPm) (Satyanarayana et al., 2004). Vir i on formation is a complex process re quiring two proteins (Hsp70h and p61) in addition to the coat proteins (Satyanarayana et al., 2000, 2004; Tatineni et al., 2010). These four genes as well as the 6 remaining genes are terminal sub genomic (sg) RNAs (Hilf et al., 1995). Upstream of each ORF there is a c ontroller element (CE) that determine s the transcription level (Gowda et al., 2001) Levels of transcription are also associated with the +1 transcription start site ( Aylln et al., 2003 ) the presence of a non translated region upstream of the ORF (Gowda et al., 2001), and the closeness o f the ORF to the terminus (Satyanarayana et al., 1999) The first engineered CTV vector s examined three different strategies for expression of heterologou s proteins. These were (i) fusion to the CP gene, (ii) insertion of an extra gene and (iii) replacement of the p13 ORF (Folimonov et al., 2007) Replacement of the p13 ORF and fusion to the coat protein ORF did not result in

PAGE 17

17 effective vectors, but the ad dition of an extra gene resulted in viable vectors that produce relative large amounts of foreign gene and were stable in citrus trees for years However, the se efforts in designing CTV vectors examined only a few of the many possibilities for expressing foreign genes in this large virus. In the present research I attempted to test the manipulation limits of CTV to engineer expression v ector s I examined the elasticity and flexibility of CTV to engineer virus based vectors by testing insertions of differe nt sizes at different positions within the genome respectively. Furthermore, I examined the correlation between insert size and position with optimal expression and movement I also examined whether different fusion strategies with different viral genes a re viable and whether multiple foreign genes can be expressed. The result is that CTV is elastic and flexible for manipulation giving a multitude of different viable vector strategies. Once citrus is infected with a CTV vector containing a foreign gene, it is easy to move the vector to o ther citrus trees by grafting. However, a limitation of the CTV vector system is the difficulty of initially getting citrus infec ted with new vector constructs. To date it has been not successful to directly inoculate citrus from cDNA clones, either by A gro bacterium mediated inoculation, particle bombardment, or mechanical inoculation with RNA transcripts ( Gowda et al., 2005; Satyanarayana et al., 2001 ). The alternative has been to inoculate with virions purified from Nicotia na benthami a na protoplasts ( Folimonov et al., 2007; Robertson et al., 2005; Satyanarayana et al., 2001 ; Tatineni et al., 2008 ). However, the infection rate has been only approximately 0.01 0.1% of protoplasts with in vitro transcribed RNA (Satyanarayana e t al., 2001). Yet, since virions are much more infectious to the protoplasts than RNA (Navas Castillo et al., 1997)

PAGE 18

18 amplification of infection is done by sequential passage in protoplasts (Folimonov et al., 2007; Robertson et al., 2005; Satyanarayana et a l., 2001; Tatineni et al., 2008) Although workable, this is an extremely difficult system Recently, A gro bacterium mediated inoculation (A gro inoculation) of N. benthaminana plants has result ed in systemic infection. This procedure allows for the analysis of vector constructs more quickly in these plants and provides copious amounts of recombinant virus for inoculation of citrus. In this report the activity of the different vector constructs in N. benthamina (27 vectors) and citrus (12 vectors) is describ ed

PAGE 19

19 CHAPTER 2 MATERIALS AND METHODS Plasmid Construction Satyanarayana et al., 1999, 2000, 2003; Tatineni et al., 2008) were the basic plasmids for developing all in vitro RNA transcripts of expression vectors used to transfect N. benthamiana protoplast sets The numbering of the nucleotides (nts) is based on the full length T36 clone (GenB ank a ccession # AY170468) (Satyanarayana et al., 19 99, 2003). CTVp333R 23 ITEV GFP and CTVp333R 23 I3XARC GFP ( Figure 3 7A) were created by fusing the non translated region ( NTR ) of Tobacco etch virus ( TEV ) ( nts 2 144 GenB ank accession # DQ986288) (Carrasco et al., 2007) and 3xARC 1 (A ctive Ribosome Complementary S equence) (Akergenov et al., 2004) behind the p23 stop codon ( between nts 19 020 19 021 in full length T36 clone) usi ng overlap extension polymerase chain reaction ( PCR ) (Horton et al., 1989). For creating expression vectors by gene addition and/or substitution at differ ent locations, CTV ortho logous coat protein (CP) controller elements (CE s ) were selected from three cl osely related closteroviruses: B eet yellows virus (BYV) (94 nts from 13 547 13 640 GenB ank accession # AF190581) (Peremyslov et al., 1999) B eet yellow stunt virus (BY SV) (101 nts from 8 516 8 616 GenB ank accession # U51 931) (Karasev et al., 1996 ) and G rap e vine leaf roll associated virus 2 (GLRaV 2) (198 nts from 9 454 9 651 GenB ank accession # DQ286725) to drive the ORFs for cycle 3 green florescent protein (GFP) ( Chalfie et al., 1994; Crameri et al., 1996) Glucuronidase ( GUS ) ORF of Eisherchia coli bF osYC 155 238 (bFos C), and bJunYN 1 15 4 (bJunN). CTVp333R 23 BYbJun N GbFosC, CTVp333R 23 BYbJunN, CTVp333R 23 GbFosC ( Figure 3 15A) were

PAGE 20

20 created by overlap extension PCR ( Horton et al., 1989 ) from plasmids pBiFC bFosYC155 and pBiFC bJunYN155 (Hu et al., 2002) and CTV9R (Satyanarayana et al., 1999 ; 2003 ). Since two Not I sites exist within the b i molecular fluorescence genes ( BiFC ), the overlap extension PCR products were digested partially by Not I restriction endonuclease. The PCR product s w ere introduced into a Stu I and Not I digested ( Figures 3 7A and 3 15A) genome by digesting the plasmid with Pst I (nts # 17 208 17 213) and Not I or Stu I (introduced behind 19 ,293 the final C TV nucleotide). Overlap extension PCR (Horton et al., 1989) was used to introduce the appropriate ge nes at the different locations. Replacement of the p13 gene was done by deleting nts 17 293 17 581 in the p13 ORF and controller element (CE) by overlap ext ension PCR (Fig 3 1A, 3 2A, 3 11A, 3 16A, 3 17A and 3 18A ). Similarly, insertion between p13 and p20 ( nts # 17 685 17 686) ( Figure 3 3A) p20 p23 ( nts # 18 312 18 313) ( Figure 3 4A) and p23 TR ( nts # 19 020 19 021) ( Figure 3 5A, 3 6A, 3 13A, 3 16A, 3 17A and 3 18A) were done by overlap extension PCR. A hybrid ge ne created by fusing the GFP ORF (Chal f i e et al., 1994; Crameri et al., 1996) and GUS ORF separated by the helper component protease ( HC Pro ) protease motif (nts 1 966 2 411 GenB ank accession # M11 458) (Allison et al., 1985 ; Carrington et al., 1989 ) and its recognition sequence fused to the N terminus of GUS ( ATGAAAACTTA CAATGTTGGAGGGATG nts 2 412 2 438 GenB ank accession # M11458) (Allison et al., 1985 ; Carrington et al., 1989 ) (Amino acid seq uence (A.A.) MKTYNVG GM ) (arrow indicat ing processing site) and C terminus of GFP ( ATGAAGACCTATAACGTAGGTGGCATG ) was created and inserted behind

PAGE 21

21 p23 ( Figure 3 13A ) or as replacement of p13 (Fig 3 11A ) under different controller elements. A similar hyb rid gene was created using the nuclear inclusion a ( NIa ) protease motif of TEV (nts 6 270 6 980 Gen B ank accession # M11458) (Allison et al., 1985 ) and its recognition sequence ( GAGAATCTTTATTTTCAGAGT (nts 8 499 8 519 GenB ank accession # M11458) ( A.A. ENLYFQ S) (arrow indicating processing site) (Carrington and Dougherty, 1988) at C terminus of GFP and GAAAACCTATACTT CCAATCG at N terminus of GUS). The redundancy of the amino acid genetic code was used to eliminate complete duplication of the nucleotide sequen ce s of the recognition motifs. A similar strategy was used to create a hybrid gene between the p23 ORF and the GFP ORF in construct CTV33 23 HC GFP 72 and CTV33 23 NIa GFP 73 ( Figure 3 8) Switching the recognition motif of the proteases generated control vectors CTV33 23 HC GFP 74 and CTV33 23 NIa GFP 75 (Fig 3 8) The binary plasmid pCAMBIACTV9R (Gowda et al., 2005) was modified to eliminate the p33 gene by deleting nts 10 858 11 660 (Satyanarayana et al., 2000; Tatineni et al., 2008) and introducing a Swa I site behind the ribozyme engineered based on subt erranean clover mottle virusoid (Turpen et al., 1993). PCR products amplified from the expression bone were introduced into the modified binary plasmid pCAMBIACTV9R p33 di gested with Pst I (Forward primer C 749) and Swa I (Reverse primer C 1894). When introducing the bimolecular fluorescence complementation ( BiFC ) genes into constructs CTV33 23 BYbJunN GbFosC 59 ( Figure 3 17 ) CTV33 BYbJunN 23 GbFosC 67 ( Figure 3 17 ) C TV33 BYbJunN GbFosC 76 ( Figure 3 16) CTV33 23 GbFosC 98 ( Figure 3 16) and CTV33 23 BYbJunN 97 ( Figure 3 16) a primer was used to switch the Pst I site to

PAGE 22

22 the compatible Nsi I site ( primer C 2085) for ease of cloning (the bFos C gene sequence contains on e Pst I site while the bJun N gene sequence contains two Pst I sites). Preliminary screening for the right inserts in the different expression vectors was done by restriction digestion using the appropriate enzymes. The junctions where the foreign genes were introduced into the expression vectors were confirmed by sequencing at the Interdisciplinary Center for Biotechnology Research (ICBR; University of Florida, Gainesville, Fl). All primers are listed in T able 1 1 Table 1 1. List of primers used in building expression vector Primer name Descritpion C 749 AGT CCT CGA GAA CCA CTT AGT TGT TTA GCT ATC clones nts # 17,121 17,145) with an added Xho I site before nt #17,121) (downstream of this primer there exists within CTV genome a Pst I site (nts 17,208 17,213 of CTV T36) used for cloning) (F.P.) C 1358 TTA TGC GGC CGC AGG CCT TGG ACC TAT GTT GGC CCC CCA TAG 19,293 of CTV T36 clone) contain ( Stu I and Not I sites) (R.P.) C 1568 TAA TCG TAC TTG AGT TCT AAT ATG GCT AGC AAA GGA GAA GAA 21) BYV CP IR (nts # 13,620 13,640 GenBank Accession # AF190581) (F.P.) C 1894 GCC GCA CTA GTA TTT AAA TCC CGT TTC GTC CTT TAG GGA CTC GTC AGT GTA CTG ATATAA GTA CAG ACT GGA CCT ATG TTG GCC CCC CAT AGG GAC AGT G 19,293 of CTV T36 clone) with extensions that include a ribozyme of s ubterranean clover virusoid (underlined) (Turpen et al., 1993) and Swa I and Spe I sites (R.P.) C 1973 ATG GAT GAG CTC TAC AAA TGA TTG AAGTGG ACG GAATAA GTT CC 19,043 of CTV T36 clone) with extension into GFP 720) ( F.P.)

PAGE 23

23 Table 1 1. Continued Primer name Descritpion* C 1974 GGA ACT TAT TCC GTC CACTTC AAT CAT TTG TAG AGCTCA TCC AT 720) 19,043 of CTV T36 clone) (R.P.) C 1975 GCA CGT TGT GCT ATA GTA CGT GCC ATA ATA GTG AGT GCT AGC AAA GTATAA ACG CTG GTGTTT AGC GCA TAT TAA ATA CTA ACG GLRaV 2 intergenic region of CP (nts 9,568 9,651 GenBank accession # DQ286725) (F.P.) C 1976 CAG CTT GCT TCT ACCTGA CAC AGT TAA GAA GCG GCATAA ATC GA A GCC AAA CCCTAA ATT TTG CAA CTC GAT CAATTG TAA CCT AGA GCG AAGTGC AAT CA BYSV CP intergenic region of (nts 8,516 8,616 GenBank accesion # U51931) (F.P). C 1977 TTT AGC GCA TAT TAA ATA CTA ACG ATG GCT AGC AAA GGA GAA GAA 21) with exte nsion into the 2 CP intergenic region (nts 9,628 9,651 GenBank accession # DQ286725) (F.P.) C 1979 ACT GTG TCA GGT AGA AGC AAG CTG TCA GAT GAA GTG GTGTTC ACG 19,020 of CTV T36 clone) BYS V CP IR (nts 8,516 8,539 GenBank accesion # U51931) (R.P.) C 1982 TTG G AT TTA GGT GAC ACT ATA G TG GAC CTATGTTGG CCC CCC ATA Sp6 promoter (underlined 19,293 of CTV T36 clone) used to develop dig labeled probe (R.P.) C 1983 GTA ACCTAG AGC GAA GTG CAA TCA ATG GCT AGC AAA GGA GAA GAA 23) BYSV IR of CP ( nts 8,593 8,616 GenBank accession # U51931) (F.P.)

PAGE 24

24 Table 1 1. Continued Primer name Descritpi o n C 1984 GCC TAA GCT TAC AAA TAC TCC CCC ACA ACA GCT TAC AAT ACT CCC CCA CAC AGC TTA CAA ATA CTC CCC CAC AAC AGCTTG TCG AC 3X active ribosome complementary sequence (3XARC 1 nts 1 86 ) (Akbergenov et al., 2004) (F.P.) C 1985 CTC CGT GAA CAC CACTTC ATC TG A AAA TAA CAA ATC TCA ACA CAA 21 GenBank accession # M11458) with extension 18,997 19,020 of CTV T36 clone) (F.P.) C 1986 TTG TGT TGA GAT TTG TTA TTT TCA GAT GAA GTG GTG TTC ACG GAG 997 19,020 of CTV T36 clone) 21 GenBank accession # M11458) (R.P.) C 1989 GGA GTATTT GTA AGCTTA GGC TCA GAT GAA GTG GTGTTC ACG GAG 19,020 of CTV T36 clone) f 3XARC 1 (nts 1 21) (R.P.) C 1990 CCC CAC AAC AGCTTG TCG ACA TGG CTA GCA AAG GAG AAG AAC TTT 25) 3XARC 1 (nts 66 86) (F.P.) C 2007 CGT GAA CAC CACTTC ATC TGA TTC GAC CTC GGT CGT CTT AGT TAA Pm and the intergenic region of CP (nts 13,547 13,570 GenBank accession # AF190581) with extension into p23 19,020 of CTV T36 clone) (F.P.) C 2008 TTA ACT AAG ACG ACC GAG GTC GAA TCA GAT GAA GTG GTG TTC ACG 19,0 20 of CTV T36 clone) with extension into the intergenic region of BYV (nts 13,547 13,570 GenBank accession # AF190581) (R.P.)

PAGE 25

25 Table 1 1. Continued Primer name Descritpion C 2009 GGC GAT CAC GAC AGA GCC GTGTCA ATT GTC GCG GCT AAG AAT GCT GTG GAT CGC AGC GCT TTC ACT GGA GGG GAG AGA AAA ATA GTT AGT TTG TAT GCCTTA GGA AGG AACTAA GCA CGT TGT GCT ATA GTA CGT GC GLRaV region (nts 9,454 9,590 GenBank accession # DQ286725) (F.P.) C 2 010 TGA CAC GGC TCT GTC GTG ATC GCC TCA GAT GAA GTG GTGTTC ACG 19,020 of CTV T36 clone) of GLRaV 2 CPm coding sequence (nts 9,454 9,477 GenBank accession # DQ286725) (R.P.) C 2011 GCC ACC TAC GTT ATA GG T CTT CAT TTT GTA GAG CTC ATC CAT GCC 717) with extension into the TEV HC Pro protease recognition sequence (nts 2,412 2,435(genetic code redundancy used to eliminate duplication GenBank accession # M11458) (R.P.) C 2012 AAG ACC TAT AAC GTA GGT GGC ATG AAG GCT CAATAT TCG GAT CTA Pro protease motif (nts 1,959 1,979 GenBank accession # M11458) with extension into the HC Pro recognition sequence (nts 2,415 2,438 genetic code redundancy used to eliminate duplication Gen Bank accession # M11458) (F.P.) C 2013 ATG AAA ACT TAC AAT GTT GGA GGG ATG TTA CGT CCT GTA GAA ACC 21) with extension into the TEV HC Pro recognition TEV HC Pro protease motif (nts 2,412 2,438 GenBank accessio n # M11458) (F.P.)

PAGE 26

26 Table 1 1. Continued Primer name Descritpion C 2014 GGT TTC TAC AGG ACG TAA CAT CCC TCC AAC ATT GTA AGT TTT CAT TEV HC Pro recognition sequence (nts 2,412 2,438 GenBank accession # M11458) with extension into d of GUS ORF sequence (nts 4 21) (R.P.) C 2015 CCG CAG CAG GGA GGC AAA CAA TGA TTG AAGTGG ACG GAA TAA GTT 19,041 of CTV T36 clone) of GUS ORF (nts 1,789 1,812) (F.P.) C 2016 AAC TTA TTC CGT CCA C TT CAA TCA TTG TTT GCCTCC CTG CTG CGG 1,812) with extension into 19,021 19,041 of CTV T36 clone) (R.P.) C 2017 CTT ACT CTG AAA ATA AAG ATT CTC TTT GTA GAG CTC ATC CAT GCC 717) with e of TEV NIa protease recognition sequence (nts 8,499 8,519 GenBank end of TEV NIa protease motif (nts 6,270 6,272 GenBank accession # M11458) (R.P.) C 2018 AAA GAG AAT CTT TAT TTT CAG AGT AAG GGA CCA CGT G AT TAC AAC motif (nts 6,270 6,290 GenBank accession # M11458) with extension into its recognition sequence (nts 8,499 8,519 GenBank end of GFP (nts 715 717) (F.P.) C 2019 CGA TTG GAA GTA TAG GTT TTC T TG CGA GTA CAC CAA TTC ACT CAT 6,961 6,980 GenBank accession # M11458) with extension into NIa recognition sequence (nts 8,499 8,519 GenBank accession # M11458 genetic code redundancy used to eliminate duplication) (R.P.)

PAGE 27

27 Tab le 1 1. Continued Primer name Descritpion C 2020 CAA GAA AAC CTA TAC TTC CAA TCG ATG TTA CGT CCT GTA GAA ACC extension into the TEV NIa recognition sequence (nts 8,499 8,519 GenBank accession # M11458 genetic code redunda ncy used to eliminate TEV NIa protease motif (nts 6,978 6,980 GenBank accession # M11458) (F.P.) C 2021 GTC ACT TTG TTT AGC GTG ACT TAG CAG CTT GCT TCT ACC TGA CAC 8,516 8,536 GenBank accession # U51931) with (nts 17,269 17,292 of CTV T36 clone) (F.P.) C 2022 GTG TCA GGT AGA AGC AAG CTG CTA AGT CAC GCT AAA CAA AGT GAC 17,292 of CTV T36 clone) BYSV CP IR (nts 8,516 8,536 GenB ank accession # U51931) (R.P.) C 2023 TTA GTC TCT CCA TCT TGC GTG TAG CAG CTT GCT TCT ACC TGA CAC 8,516 8,536 GenBank accession # U51931)with p20 (nts 18,286 18,309 of CTV T36 clone) (F.P.) C 2024 GTG T CA GGT AGA AGC AAG CTG CTA CAC GCA AGATGG AGA GAC TAA 18,309 of CTV T36 clone) end of BYSV CP IR (nts 8,516 8,536 GenBank accession # U51931) (R.P.) C 2025 ATG GAT GAG CTC TAC AAA TGA GTT TCA GAA ATT GTC GAATCG CAT 17,581 17,604 of CTV T36 clone) with extension into 700 720) (F.P.)

PAGE 28

28 Table 1 1. Continued Primer name Descritpion C 2026 ATG CGA TTC GAC AAT TTC TGA AAC TCA TTT GTA GAG CTC ATC CAT 700 720) with extension (nts 17,581 17,604 of CTV T36 clone) (R.P.) C 2027 ATG GAT GAG CTC TAC AAA TGA GTT AAT ACG CTT CTC AGA ACG TGT 18,330 of CTV T36 clone) with extension GFP (nts 700 720) (F.P.) C 2028 ACA CGT TCT GAG AAG CGT ATT AAC TCA TTT GTA GAG CTC ATC CAT 720) with extension into p23 IR (nts 18,310 18,330 of CTV T36 clone) (R.P.) C 2029 TTT AGC GCATAT TAA ATA CTA ACG ATG TAC CC ATAC GAT GTT CCA pHA CMV carrying bFos (AA 118 210) YC ( AA 155 238) (Hu et al., 2002) with extension into the GLRaV 2 9,651 GenBank accession # DQ286725) (F.P.) C 2030 TGG AAC ATC GTATGG GTA CAT CGT TA GTAT TTA ATATGC GCT AAA 2 (nts 9,628 9,651 GenBank accession # DQ286725) HA tag (21nts) in pHA CMV carrying bFos (AA 118 210) YC ( AA 155 238) (Hu et al., 2002) (R.P.) C 2031 ACT GTGTCA GGT AGA AGC AAG CTG TTA CTT GTA CAG CTC GTC CAT YC (AA 232 238) (Hu et al., 2002) with extension into the BYSV 8,539 GenBank accession # U51931) (R.P.) C 2032 GTA ACCTAG AGC GAA GTG CAATCA ATG GACTAC AAA GAC GAT GAC f rom pFLAG CMV2 carrying bJunN (Hu et al., 2002) with BYSV CP IR (nts 8,593 8,616 GenBank accession # U51931) (F.P.)

PAGE 29

29 Table 1 1. Continued Primer name Descritpion C 2051 GTC ACT TTG TTT AGC GTG ACT TAG GGC GAT CAC GAC AGA GCC GTG 2 CPm (nts 9,454 9,474 GenBank accession # DQ286725) p18 (nts 17,269 17,292 of CTV T36 clone) (F.P.) C 2052 CAC GGC TCT GTC GTG ATC GCC CTA AGT CAC GCT AAA CAA AGT GAC 00 19,020) with extension into 2 CPm coding sequence (nts 9,454 9,474 GenBank accession # DQ286725) (R.P.) C 2053 GTC ACT TTG TTT AGC GTG ACT TAG TTC GAC CTC GGT CGT CTT AGT intergenic region of CP (nts 13,547 13,567 GenBank accession # AF190581) p18 (nts 17,269 17,292 of CTV T36 clone) (F.P.) C 2054 ACT AAG ACG ACC GAG GTC GAA CTA AGT CAC GCT AAA CAA AGT GAC 17,292 of T36 CTV clone) with extension into BY V intergenic region of CP (nts 13,547 13,567 GenBank accession # AF190581) (R.P.) C 2055 CAC AAC GTC TAT ATC ATG GCC TAG GTT TCA GAA ATT GTC GAA TCG 17,581 17,601 of CTV T36 clone) with extension into f EYFP YN(AA 147 154) from pFlag CMV2 carrying bJun YN (Hu et al., 2002) C 2056 CGA TTC GAC AAT TTC TGA AAC CTA GGC CAT GAT ATA GAC GTT GTG YN(AA 147 154) from pFlag CMV2 carrying bJun YN (Hu et al., 2002) with extension into p13 (nts 17,581 17,601 of CTV T36 clone)

PAGE 30

30 Table 1 1. Continued Primer name Descritpion C 2057 GGC ATG GAC GAG CTG TAC AAGTAA TTG AAGTGG ACG GAATAA GTT YC (AA 231 238) (Hu et al., 2002) with 19,021 19,041 of CTV T36 clone) C 2058 AAC TTA TTC CGT CCA CTT CAA TTA CTT GTA CAG CTC GTC CAT GCC 19,041 of CTV T36 clone) EYFP YC (AA 231 238) (Hu et al., 2002) C 2059 TCG CTC TTA CCT TGC GAT AAC TA G CAG CTT GCT TCT ACCTGA CAC 8,536 GenBank accession # U51931) with extension 17,662 17,685 of CTV T36 clone) (F.P.) C 2063 GTA ACCTAG AGC GAA GTG CAA TCA ATG TTA CGT CCT GTA GAA ACC 1 21) with extension into the BYSV CP IR (nts 8,593 8,616 GenBank accession # U51931) (F.P.) C 2064 GGT TTC TAC AGG ACG TAA CAT TGA TTG CACTTC GCT CTA GGTTAC AA 8,591 8,616 G enBank accession # U51931) with GUS ORF (nts 1 21)(R.P) C 2067 CCG CAG CAG GGA GGC AAA CAA TGA GTT TCA GAA ATT GTC GAATCG 17,601 of CTV T36 clone) with extension into the 1,812) (F.P.) C 2068 CGA TTC GAC AAT TTC TGA AAC TCA TTG TTT GCCTCC CTG CTG CGG 1,812) with extension into 17,601 of CTV T36 clone) C 2069 GTG TCA GGT AGA AGC AAG CTG CTA GTT ATC GCA AGG TAA GAG CGA of p13 (nts 17,662 17,685 of CTV T36 clone) 8,516 8,536 GenBank accession # U51931) (R.P.)

PAGE 31

31 Table 1 1. Continued Primer name Descritpion C 2070 ATG GAT GAG CTC TAC AAATGA AGT CTA CTC AGT A GT ACG TCT ATT 17,709 of CTV T36 clone) of GFP (nts 700 720) (F.P.) C 2071 AAT AGA CGT ACT ACT GAGTAG ACT TCA TTT GTA GAG CTC ATC CAT 720) of p20 (nts 17,686 17,709 of CTV T36 clone) (R.P.) C 2085 GCG G ATGCAT TATTT GGTTTT ACA ACA ACG GTA CGT TTC AAA ATG 17,245 of CTV T36 clone) with two point mutations (C A(17,205) and G T(17,210)) creating Nsi I site to replace the Pst I site ( F.P.) C 2087 AAG ACC TAT AAC GTA GGT GGC ATG AAG GCT CAA TAT TCG GAT CTA Pro protease motif (nts 1,959 1,979 GenBank accession # M11458) with extension into the HC Pro recognition sequence (nts 2,415 2,438 genetic code sequence redundanc y was used to eliminate duplication GenBank accession # M11458 (F.P.) C 2088 ATG AAA ACT TAC AAT GTT GGA GGG ATG GCT AGC AAA GGA GAA GAA 21) with extension into the TEV HC Pro recognition sequence (nts 2,412 2,438 GenBank accession # M11458) (F.P.) C 2089 TTC TTC TCC TTT GCT AGC CAT CCC TCC AAC ATT GTA AGT TTT CAT TEV HC Pro recognition sequence (nts 2,412 2,438 GenBank accession # M11458) with extension into sequence (nts 4 21) (R.P.) C 2091 GAG AAT CTT TAT TTT CAG AGT AAG GGA CCA CGT GAT TAC AAC C motif (nts 6,270 6,291 GenBank accession # M11458) with extension into its recognition sequence (nts 8,499 8,519 GenBank accession # M11458) (F.P.)

PAGE 32

32 Table 1 1. Continued Primer name S Descritpion C 2092 GAA AAC CTA TACTTC CAATCG ATG GCT AGC AAA GGA GAA GAA CT 23) with extension into the TEV NIa protease recognition sequence (nts 8,499 8,519 genetic code seqence redundancy used to eliminate duplic ation GenBank accession # M11458) (F.P.) C 2093 AGT TCT TCT CCT TTG CTA GC CAT CGA TTG GAA GTATAG GTT TTC TEV NIa protease recognition sequence (nts 8,499 8,519 genetic code sequence redundancy used to eliminate duplication GenBank accession # M11458) wi th extension into the GFP ORF sequence (nts 1 23) (R.P.) C 2094 AAG ACCTAT AAC GTA GGT GGC ATG AAG GGA CCA CGT GAT TAC AAC NIa protease motif sequence nts 6,270 6,291 GenBank accession # M11458) with extension into the HC Pro recognition seq uence (nts 2,415 2,438 genetic code sequence redundancy was used to eliminate duplication GenBank accession # M11458) (F.P.) C 2095 CCC TCC AAC ATT GTA AGT TTT CAT TTG CGA GTA CAC CAATTC ACT motif(nts 6,959 6,981 GenBank accessio n # DQ986288) with extension into the TEV HC Pro protease motif (nts 2,415 2,438 GenBank accession # M11458) (R.P.) C 2096 GAG AAT CTT TAT TTT CAG AGT AAG GCT CAATAT TCG GAT CTA AAG Pro protease motif (nts 1,959 1,979 GenBank accession # M11458) with extension into the TEV NIa protease recognition sequence (nts 8,499 8,519 GenBank accession # M11458) (F.P.)

PAGE 33

33 Table 1 1. Continued Primer name Descritpion C 2097 CGA TTG GAA GTATAG GTT TTC TTC GGATTC CAA ACCTGA ATG AAC of HC Pro protease motif (nts 2,388 2,411 GenBank accession # M11458) with extension into the TEV NIa protease recognition sequence (nts 8,499 8,519 GenBank accession # M11458)(R.P.) C 2098 GCC ACCTAC GTT ATA GGT CTT CAT GAT GAA GTG GTGTTC ACG GAG of p23(nts 18,997 19,017 of CTV T36 clone) with extension into the Pro protease recognition sequence (nts 2,412 2,435(genetic code seqence redundancy used to eliminate duplication) GenBank accession # M11458) (R.P.) C 2099 ACT CTG AAA ATA AAG ATT CTC GAT GAA GTG GTGTTC ACG GAG AAC 19,017 of CTV T36 clone) with extension into the recognition sequence (nts 8,499 8,519 GenBank accession # M11458) (R.P.) M 804 CAT TTA CGA ACG ATA GCC ATG GCT A GC AAA GGA GAA GAA 20) (nts 126 143 GenBank accession # M11458) (F.P.) Polymerase C hain R eaction (PCR) PCR was perfo rmed using diluted plasmids (1: 50) as templates using Vent DNA polymerase (New England Biola bs, Ipswich, Ma. ) according to the manufacturer recommendations. PCR and overlap extension PCR was performed in a PTC100 TM thermocycler ( MJ research, Watertown, MA ). Initially a denaturing step at 94 o C for 2 min was carried out followed by 35 cycles of de naturing at 94 o C for 20 seconds (sec ), 56 o C

PAGE 34

34 for 45 sec and 72 o C at 1minute (m in ) per 1000 base pair) and a final extension step at 72 o C for 10 m in Agro bacterium Injection/I nfiltration Agro bacterium mediated inoculation (Agro inoculation) of Nicotiana be nthamiana was performed according to the procedure developed by Gowda et al., ( 2005 ) with minor modifications. Agrobacterium tumefaciens strain EHA 105 was transformed with the binary plasmid containing CTV, variants (expression vectors) and silencing supp ressors (p19 of Tomato bushy stunt virus (Gowda et al., 2005); p24 of GLRaV 2 (Chiba et al., 2007), P1/HC Pro of Turnip mosaic virus (Kas schau et al., 2003) and p22 of T omato chlorosis virus (Caizares et al., 2008) by the heat shock method (37 o C for 5 m ) (Walkerpreach and Velten, 1994) and subsequently were grown at 28 o C for 48 hours ( h s ) on Luria B urtani (LB) (Sigma Aldrich, St Louis, MO) agar medium supplemented with antibiotics ( kanamycin (50 g / mL ) and Rifampicilin (50 g / mL ) ) The colonies (two in dividual colonies per construct) were grown overnight as seed cultures in LB mediu m supplemented with the same antibiotics 0.5 mL of the seed culture was used to inoculat e 35 mL of LB medium supplemented with the same antibiotics for overnight growth The bacterial culture was centrifuged at 6 000 revolutions per minute ( rpm ) and re suspended in 10 mM MgCl 2 and 10 mM 2( N morpholino ) ethane sulfonic acid ( MES ) The pellet was washed with 10 mM MgCl 2 and 10 mM MES an d suspended in induction medium ( 10 mM MgCl 2 and 10 mM MES containing acetosyringone at a final concentration of 150 M ) The suspension was incubated in the in duction medium for at least 5 h s before injection using a 1ml syringe equipped with a needle into the stem or infiltration using the same s yringe without a needle into the abaxial (lower) surface of N. benthamiana leaves.

PAGE 35

35 Plant Growth C onditions N. benthmaiana plants main tained in a growth room (21 o C with a 16 h of light and 8h dark cycle ) were used for Agrobacterium tumefaciens injection/ in filtration four weeks after t r ansplanting Infection of Citrus P lants Recombinant virions of CTV for infection of citrus plants were obtained f rom infiltrated or systemi c leaves of N. benthamiana The virions were partially purified and enriched by concent ration over a sucrose cushion in an SW41 rotor according to the protocol previously described in Robertson et al., ( 2005) Briefly, i nfected plant material extracted in a 40mM potassium phosphate buffer in 5% sucrose containing 1 mM d ithiothreitol (3 g tis sue/ 10 mL buffer) was centrifuged at 10,000 rpm for 10 min at 4 o C Eleven milliliters of the extract was than layered over 1ml of 70% sucrose (cushion gradient) in an SW41 ultra centrifuge tube and centrifuged at 38,000 rpm for 75 min at 4 o C. The 70% sucr ose in the tube was bleeded into two 400 L portions. The first 400 L portion (at the bottom of the tube was discarded) whereas the second 400 L portion contained the concentrated virions and used for inoculation. Virion s of constructs expressing two het erologous proteins were concentrated twice over a step gradient followed by a cushion gradient in SW28 and SW41 rotors, respectively (Ga rnsey and Henderson, 1982). The step gradient consisted of 5 mL of 25% sucrose and 5 mL of 50% sucrose beneath 27 mL of buffer extracted virions from infected plant material. The lowest 2 mL of the sucrose step gradient was discarded and the next 1.5 mL of the gradient was pooled from different tubes to concentrate in SW41 rotor. Inoculation of citrus plants was carried out by bark flap inoculation into 1 1.5 year old Citrus

PAGE 36

36 macrophylla seedlings (Robertson et al., 2005) which were grown in a greenhouse with temperatu re s ranging between approximately 25 32 o C. Protoplast Preparation, Transfection, RNA Isolation and Northern B lot A nalysis N. benthamiana leaf mesopyhll protoplasts were prepared according to the procedure previously developed by Nava Castillo et al., ( 1997). Surface sterilized leaves from three week old N. benthamiana plants were gently slashed on the lower side with a sterile blade and incubated overnight in the dark (16 20 hs) in 0.7 M MMC (0.7 M mannitol, 5 mM MES, 10 mM CaCl 2 ) supplemented with the 1% cellula se (Yakult Honsh, Tokyo, Japan) and 0.5% macerase pectinase enzymes (Calbiochem, La Jolla, Ca.). Capped in vitro RNA transcripts from Not I or Stu I linearized p lasmid DNA were generated by a protocol previously described by Satyanarayana et al., ( 1999) using Sp6 RNA polymerase (Epicentre Technologies, WI). The in vitro generated RNA transcripts were transfec ted into the protoplasts using poly ethylene glycol (PEG) mediated protocol as described by Satyanarayana et al., (1999) Four days after transfection protoplasts were used for preparation of total RNA for N orthern blot hybridization analysis and isolatio n of virions. Protoplasts were pellet ed in equal amounts in two 1.5mL eppendorf tubes. The first tube was flash frozen in liquid nitrogen and stored at 80 o C This sample was later used for isolation of virions and subsequent ino culation of a new batch of protoplasts to amplify virion s (Satyanarayana et al., 2000). The second tube was used for RNA isolation by the b uffard buffer disruption of protoplast s followed by phenol : chloroform : isoamyl alcohol (25 : 24 : 1) extraction and ethanol precipitation as previously described by Navas Castillo et al., (1997) and Robertson et al., ( 2005 ) Total RNA was resuspended in 20 l DNAse/RNAase free water and used in Northern

PAGE 37

37 blot hybridization an alysis as previously described by Lewan d owski and Dawson ( 1998). In bri ef isolated RNA was heat denatured in denaturing buffer (8.6% formal dehyde, 67% formamide in 1X MOPS (5 mM sodium acetate, 1 mM EDTA, 0.02 M MOPS ( 3(N Morpholino)propanesulfonic acid ) pH = 7.0) separated in a 0.9% agarose gel in 1X MOPS containing 1.9% fo rma ldehyde and transferred onto a nylon membrane ( Boehringer Mannheim Germany) by electr oblotting. Pre hybridization (at least 1hr) and hybridization (overnight) were carried out in a hybridization oven (Sigma Aldrich, St. Louis, MO) at 68 o C. A 900 nts d igoxigenin labeled RNA end of the CTV genome (plus strand specific CTV RNA probe) ( Satyanarayana et al., 1999) was used for hybridization except when the insertion of the heterologous sequence was behind p23 in which case a d igoxigenin labeled RNA probe was produced from PCR amplified DNA TR of CTV and SP6 phage promoter (C 1982 ) according to the manufacturer recommendation ( Boehringer Mannheim Germany) that is complimentary to the sequence inserted b ehind p23 in TR sequence of CTV. Western B lots After powdering the plant tissue in liquid nitrogen with a mortar and pestle, L aemmli buffer (50 mM Tris Cl, pH 6.8, 2.5% 2 mercaptoethanol, 2% SDS, 0.1% bromophenol blue, 10% glycerol) wa s added (100 l per 100 mg tissue ). The sa mple was transferred to a 1.5 mL centrifuge tube and boiled in a water bath for 3 min followed by centrifugation in a 5415D Eppendorf microfuge (Eppendorf, Hamburg, Germany) at maximum speed for 2 min. The supernat ant was transferred to a new tube and stored at 20 o C until further use. E lectrophoresi s was carried out in a 12% SDS p olyacrylamide gel with a 4% stacking gel (Bio Rad, Hercules, Ca.) at 20 mA / 2 gels followed by two

PAGE 38

38 hours of blotting using a semi dry bl otter (WEP, Seattle, WA) at 60 mA / gel to transfer the protein onto a nitrocellulose membrane (Bio Rad, Hercules, Ca.). The membrane was blocked for 1 h at room temperature followed by incubation with the primary antibody for CP (1:5000), GFP (1:100) (Clo ntech Laboratories, Palo Alto, Ca.) or GUS (1:100 0) (Molecular probes, Eugene, OR ) for an hour followed by incubation for one h our in horseradish peroxidase conjugated donkey anti rabbit secondary antibody (1:10,000) (Amersham, Buckinghams hire,United Kingd om). Finally, the chemiluminescent system for western blot (Amersham, Buckinghamshire, United Kingdom) development on an X ray film (Kodak, Rochester, NY) was used according to the manufacturer s recommendations. Plant and Protoplast Photos P lant pi ctures u nder UV or white light were taken with a digital c amera (Canon EOS Digital Rebel XTi 400D, Lake Success, New York). Close up fluorescent pictures of plant part s or protoplast were taken using a fluorescent dissecting microscope with FITC 480nm excitation f ilter and FITC 515 emission filter (Zeiss Stemi SV 11 UV fluorescence dissecting microscope, Carl Zeiss Jena, GmbH., Jena, Germany). High resolution protoplast pictures were taken u sing a confocal scanning microscope (Leica TCS SL, Leica Microsystems, Inc. Exton, PA). Enzyme Linked Immunosorbent A ssay (ELISA) Double antibody sandwiched ELISA was used according to the procedure developed by Garnsey and Cambra (1991). A rabbit polyclonal antibody (1 g / mL ) was used for coating the ELISA plate. The plant ti ssue sample was diluted at a 1: 20 in PBS T (phosphate buffer saline 1% Tween 20) extraction buffer. The detection antibody used was Mab ECTV 172 (1:100K dilution).

PAGE 39

39 GUS Assay Citrus bark pieces or systemic leaves from Agro inocu lated N. benthamiana plants were surface sterilized in alcohol (70% ethanol) follo wed by s odium hypo chloride (10% solution) for 3 min followed by three 3 min washes in sterile distilled water These plant tissues were stained for GUS activity according to the procedure described by Orbovic and Grosser ( 2006 ) for GUS. The samples were incubated overnight in an EDTA phosphate buffer (0.1 M Na 2 HPO 4, 1 mM Na 2 EDTA) containing 1 mg / mL X gluc (cyclohexyl ammouniu m salt; Gold B iotechnology, St Louis, MO ). Stained tissues were f ix ed in 95% ethanol: glac ial acetic acid solution ( 3: 1).

PAGE 40

40 CHAPTER 3 RESULTS Systems Used to Examine CTV Based Expression Vectors I examined CTV based expression vectors in three systems, N. benthamiana mesophyll protoplasts N. benthamiana and Citrus macropylla Th e full length cDNA clone of CTV (pCTV9R) and a mutant with most of the p33 gene deleted Pst I restriction site removed ( Satyanarayana et al., 2000; Tatineni et al., 2008) was used for building con structs to infect whole plants. Preliminar y assays were done in N. benthamiana protoplasts, which require constructs to be built in SP6 transcription plasmid s (Satyanarayana e t al., 1999). A mini replicon pCTV Cla 333R (Gowda et al., 2001) for this purpose The ultimate goal to obtain citrus trees infected with the different CTV expression vectors requires optimization of constructs and techniques So far, no successful direct agro inoculation of citrus trees has been achieved. Thus, the working pro cedure is to amplify and concentrate virions for inoculation of citrus trees by stem slashing or bark flap inoculation (Robertson et al., 2005; Satyanarayana et al., 2001) Transcripts of r ecombinant CTV constructs could be inoculated into N. benthamiana protoplasts and the virus amplified by successive passaging of the virions in crude sap through a series of protoplast sets (Folimonov et al., 2007; Satyanarayana et al., 2001; Tatineni et al., 2008). Also, recombinant CTV can be amplified in N. benthamian a plants after agro inoculation (Gowda et al., 2005). Recently, Spanish collaborators have demonstrated that CTV can replicate and move systemically in N. benthamiana plants (Ambros et al., 2011 ). The virus can infect mesophyll cells of agro inoculated are as of leaves, but as the virus moves systemically into upper non inoculated leaves, it is

PAGE 41

41 limited to vascular tissues and usually induces vein clearing and later vein necrosis. All of the vector constructs were examined during systemic infection of N. ben thamiana plants. Since CTV virions do not resuspend after centrifugation to a pellet, virions have to be concentrated by centrifugation through a sucrose step gradient (Garnsey et al., 1977; Robertson et al., 2005). After inoculation, the tops of citrus pl ants were removed, and viral systemic infections were monitored in new growth after 2 3 months. Once trees were infected, inoculum (buds, leaf pieces, or shoots) from the first infected plant was used to propagate new plants for experimentation. The whole process takes approximately one year. For this reason, I chose to examine only the most promising vect or constructs in citrus trees. Some of the lat er developed constructs are not yet in c itrus Addition of an Extra Gene at Different Locations within the CTV Genome Insertions at the p13 G ene S ite The effective CTV vector developed previously (Folimonov et al., 2007) has an additional gene inserted between the two coat protein genes, positioning the foreign gene as the sixth gene from Yet, the most highly expressed genes of CTV tend to (Hilf et al., 1995; Navas Castillo et al., 1997) Thus, positioning a heterologous n higher levels of expression. P13, the third gene f expressed gene that is not necessary for the infection of most of the CTV host range (Tatineni et al., 2008 2011 ). Yet, replacement of the p13 ORF with the GFP ORF was not successful in previous attempts (Folimo nov et al., 2007). P ossible reasons for th e failure include that t he previous construct was designed with the assumption that translation initiated at the first start codon, but the p13 ORF has a second in frame

PAGE 42

42 AUG T ranslation m ight normally start at the second AUG. However, fusion of the GFP ORF behind the second in frame AUG also did not result in express ion of the reporter gene (Gowda et al., unpublished result ). The second possibility is that the p13 controller element (CE) might extend into the p13 O RF or that ribosome recruitment is directed from within the ORF. Here, I deleted the p13 intergenic region and ORF and inserted a new ORF behind a heterologous CE in the p13 position. The GFP ORF controlled by the CP CE from BYSV ( 101 nts from 8 516 8 616 GenBank accession # U51931 ) GLRaV 2 (198 nts from 9 454 9 651 GenBank accession # DQ286725) or BYV were engineered into p CTV9R as a replacement for nts 17 293 17581 (CTV33 13 BY GFP 57 CTV33 13 G GFP 65, CTV33 13 B GFP 66 respectively ) ( Figure 3 1 A). RNA transcripts were used to inoculate a series of protoplasts to determine whether the constructs could replicate and whether virions formed sufficiently for passage in crude sap to a new batch of protoplasts The fluorescence of infected protoplast s (data not presented) and northern blot hybridization analysis demonstrate d the successive passage of the expression vectors through the proto plast transfers ( Figure 3 1 B). Furthermore, the level of the GFP mRNA was similar to that of CP. Vector sequences CTV33 13 BY GFP 57 CTV33 13 G GFP 65 and CTV33 13 B GFP 66 were transferred into the Agrobacterium binary plasmid for agro inoculation of N. benthamiana plants. All three vectors infected and moved systemically in vascular tissue of the N. benthamiana plants as indicated by fluorescence in leaves, buds, flowers and corolla ( Figure 3 1C). The vein clearing phenotype was observed in early stages of infection and confirmed by ELISA (Data not presented).

PAGE 43

43 Fig ure 3 1 GFP replacement of p13 to produce CTV based expression vectors. (A) Schemat t open reading frames with blue outline d boxes represent ing the replica tion gene block whereas the red outline d boxes represent ing the closterovirus conserved gene block (Karasev, 2000). T he black circle and bl ack boxes outline d boxes represent RNA silencing suppressors (Lu et al., 2004). Gold outline d boxes represent genes dispensa ble for the infection of some citrus genotypes (Tatineni et al., 2008 2011 ). Filled black rectangle represents the deletion of the p33 controller elements and ORF (nts 10858 11660 GeneBank a ccession # AY170468) (Satyanarayana et al., 1999; 2000; 2003)). Arrows indicate the processing of the tandem leader proteases (LP) 1 and LP2 MT (methyl transferase), Hel (Helicase), RdRp (RNA depen dent RNA polymerase ) (deletion of the 33k D a protein sequence), p6 (6k D a protein), Hsp70h (heat shock protein 70 homologue), p61 (61k D a protein), CPm (minor coat protein), CP (major coat protein, inter cellular silencing suppressor), p18 (18 k D a prote in), p13 (13 k D a protein), p20 (20 k D a protein, inter/intra cellular silencing suppressor), p23 (23 k D a protein, intracellular silencing suppressor) M odification to produce expression vectors CTV33 BY GFP 57 (C57), CTV33 G GFP 65 (C65), CTV33 B GFP 66 (C66) include the CP CE of BYSV, GLRaV 2 and BYV driving GFP, respectively. (B) Northern blot analysis of wild type CTV (WT) and CTV based expression vector transfected to N. benthamiana protoplast (T) and passaged to a new set of protoplasts (P) detected with a plus sense RNA specific 900 nts (Satyanarayana et al., 1999) (C) Representative sample s of GFP fluorescence in N. benthamiana infected with CTV33 BY GFP 57 magnified under a fluorescent stereoscope. Similar GFP fluorescence was reported for CTV33 G GFP 65 and CTV33 B GFP 66. (D) Representative sample of fluorescence in the phloem of citrus bark pieces infected with constructs CTV33 G GFP 65 and CTV33 B GFP 66 with high (left) and low (right) magnification under a fluorescent stereoscope.

PAGE 44

44

PAGE 45

45 CTV33 13 G GFP 65 and CTV33 13 B GFP 66 were amplified and used to inoculate Citrus macrophylla plants. The initially infect ed plants exhibited bright fluorescence in vascular tissue ( Figure 3 1D). Fluorescence continued in the vascular tissue of infected plants 2 years after inoculation. The GFP ORF (720 nts) was replaced with the GUS ORF (1812 nts) in the same position to exa mine the expression of a larger foreign gene The BYSV CP CE was selected to drive the GUS ORF in expression vector CTV33 13 BY GUS 61 ( Figure 3 2A). RNA transcripts derived from this construct w ere transfected into protoplast where t he virus replicated and pass ag ed efficiently from one protoplast batch to another as indicated by no rthern blot hybridization analysis ( Figure 3 2 B). In addition, it revealed that the level of accumulation of GUS mRNA was comparable to the CP mRNA, and the CP and CPm mRNAs accumulation levels originating from the vector w as similar to that of the wild type virus. Agro inoculation of N. benthamian a plants revealed that the construct infected and spread throughout the vascular tissue of the plants based on GUS staining and was confirmed by ELISA (d ata not presented) and the vein clearing phenotype (data not shown) Virions isolated from infiltrated leaves of N. benthamiana plants of CTV33 13 BY GUS 61 infected four out of four inoculated Citrus macrophylla plants as confirmed by ELISA (d ata not presented) and the enzyme activity of the GUS prote in ( Figure 3 2C). The GUS gene was still biologically active in citrus 1.5 year after inoculation (data not shown) Technically, the above constructs replaced a gene (p13) rather than added an extra gene. To examine a vector with an extra gene between p13 and p20 t he CP CE

PAGE 46

46 of BYSV upstream of the GFP ORF wa s inserted between nts 17685 17686 to yield CTV33 13 BY GFP 69 ( Figure 3 3A ). This vector should produce an extra subgenomic Fig ure 3 2 GUS replacement of p13 to produce CTV based expression vectors (A) and its modification creating expression vector CTV33 BY GUS 61 in which the p13 ORF and its controller element is replaced by GUS ORF under the control of CP CE of BYSV. (B) Northern blot hybridization analys is of wild type CTV (WT) and CTV based expression vector CTV33 BY GUS 61 (C61) transfected to N. benthamiana protoplast (T) and passaged to a new set of protoplasts (P) detected with a plus sense RNA specific 900 nts (Satyanarayana et al., 1999) (C) Representative sample of GUS activity in the bark pieces of citrus trees infected with construct CTV33 BY GUS 61(right) and the GUS solution before fixing of the bark pieces (left) (A = Healthy control, B = infect ed ) RNA between the s g RNAs of p13 and p20. Vector CTV33 13 BY GFP 69 was examined in N. benthamiana protoplasts and plants. In the protoplast system, CTV33

PAGE 47

47 13 BY GFP 69 replicated efficiently and was successfully pass ag ed from one protoplast b atch to another demonstrating ef ficient replication and virion formation as indicated by fl uorescence (Data not presented ) and northern blot hybridization analysis ( Figure 3 3 B). The foreign mRNA accumulated at a relatively high level but the CP mRNA was reduced. Similar to the p13 repla cement constructs, agro inoculation of the expression vector CTV33 13 BY GFP 69 into N. benthamiana plants enabled the new vector to infect and spread throughout the vascular tissue ( Figure 3 3C). Construct CTV33 13 BY GFP 69 infected 3 of 4 C. macrophylla plants as indicated by strong fluorescence throughout the vascular tissue ( Figure 3 3C) and confirmed by ELISA (Data not presented). The plants remained GFP positive 2 years after inoculation (data not presented). Gene i nsertion between p20 and p23 To exa an extra gene was inserted between the p20 and p23 genes (nts 18312 18313 ) T he BYV or BYSV CP CE was used to drive transcription of the GFP mRNA in two vectors based on T36 CTV9R p33 (CTV33 20 B GFP 49 and CTV33 20 BY GFP 58) (Fig 3 4 A). The new vectors produce d an extra sg RNA between the p20 and p23 sg RNAs ( Figure 3 4B) However, the accumulation of the p20 sg mRNA was substantially reduced. Both vectors replicated and were passaged in protop lasts, but the protoplast passage was reduced as demonstrated by reduced numbers of cells with GFP fluorescence and Northern blot hybridization ( Figure 3 4B and C ). When both CTV33 20 B GFP 49 or CTV33 20 BY GFP 58 vectors were infiltrated into N. benthami ana leaves for transient expression the vector s replicated and produced abundant amounts of GFP as indicated by fluorescence (d ata not presented) and western b lot analysis (Figure 3 4 D). However,

PAGE 48

48 Fig ure 3 3 GFP insertion between p13 and p20 to pro duce CTV based expression vectors and its modification by inserting between p13 and p20 the GFP ORF under the control of BYSV CP CE creating expression vector CTV33 13 BY GFP 69 (B) Northern blot hybridization analysis of t ransfected protoplast w ith the w ild type virus (WT) and expression vector CTV33 13 BY GFP 69 (C69) from transcripts (T) and their passages (P) detected with a plus sense RNA specific 900 nts Representative sample of fluorescence in N. benthamiana (C) and peeled bark phloem pieces of C. macrophylla (D) infected with CTV33 13 BY GFP 69 magnified under a fluorescent stereoscope. w hen agro inoculated into N. benthamiana plants the constructs replicated but movement into upper non ino culated leaves was random and often unsuc cessful. Since

PAGE 49

49 Figure 3 4. GFP insertion between p20 and p23 to produce CTV based expression vectors and its modification producing expression vector CTV33 20 B GFP 49 and CTV33 20 BY GFP 58. (B) Northern blot hybridization analysis of t ransfected protoplast with the w ild type virus (WT) and expression vectors CTV33 20 B GFP 49 (C49) and CTV33 20 BY GFP 58 (C58) from transcripts (T) and their passages (P) detected with a (Satyanarayana et al., 1999) (C) Flourescenc e under UV light of protoplast (right) and the leaf (left) showing lack of efficient movement of the vector. (D) Western blot analysis of the same gene inserted at different locations in the CTV genome. BCN5 (Folimonov et al., 2007) original CTV vector (contains GFP under BYV promoter between CPm and CP), const ructs CTV33 23 BY GFP 37 (C37, i nsertion of BYSV driving GFP behind p23), CTV33 20 BY GFP 58 (C58, i nse rtion of BYSV driving GFP between p20 and p23), CTV33 13 BY GFP 69 (C69, i nsertion of BYSV driving GFP between p13 and p20),CTV33 13 BY GFP 57(C57, r eplacement of p13 gene with BYSV CP CE driving GFP ) and CTV33 27 BY GFP 63 (C63, Insertion of BYSV CP CE driving GFP ORF between CPm and CP).

PAGE 50

50 systemic infection of N. benthamiana plants was marginal, no attem pt was made to inoculate citrus. TR A new set of expression vectors was engineered by inserting a foreign gene position could be expected to result in the highest level of expression for a foreign gene (Hilf et al., 1995 ; Navas Castillo et al., 1997 ). known what effect an extra gene in this area would have on the efficiency of replication. Tobacco mosaic virus ( TMV ) and A lfalfa mosaic virus (A MV ) failed to produce viable vectors (Dawson et al., 1989; Snchez Navarro et al., 2001 ). T he CP CE of BYSV, GLRaV 2 or BYV upstream of the GFP ORF w as inserted between nucleotides 19 0 20 and 19 021 creating vectors CTV33 23 BY GFP 37, CTV33 23 G GFP 40 and CTV33 23 B GFP 42, respectively ( Figure 3 5 A). All of the constructs when tra nsfected into protoplast s replicated and were pass ag ed efficiently as indicated b y northern blot hybridization analysis ( Figure 3 5 B) and GFP fluoresce nce ( d ata not presented ). The GFP mRNA was the highest accumulating mRNA, with only slight decreases to t he other mRNAs compared to that of the wild type virus ( Figure 3 5B). Furthermore, the constructs with a GFP accumulation of the foreign gene mRNA among the constructs examined. CTV33 23 BY GFP 37, CTV33 23 G GFP 40 and CTV33 23 B GFP 42 constructs were agro inoculated into N. benthamiana plants The infections spread systemically throughout the vascular tissue as demonstr ated by GFP fluorescence ( Figure 3 5C ) phenotype (vein clearing followed by necrosis), and

PAGE 51

51 E LISA (d ata not presented) The fluorescence in the vascular tissue of N. benthamiana plants was extremely bright and continued for the life of the infected plants ( Figure 3 5C) Figure 3 5. GFP TR to produce CTV based express ion vectors and its modification by insertion of GFP behind p23 under control of CP CE of BYSV, GLRaV 2 and BYV creating expression vectors CTV33 23 BY GFP 37 (C37), CTV33 23 G GFP 40 (C40) and CTV33 23 B GFP 42 ( C42), respectively. (B) Northern blot hybridization analysi s of t ransfected protoplast with the w ild type virus (WT) and expression vectors CTV33 23 BY GFP 37, CTV33 23 G GFP 40 and CTV33 23 B GFP 42 from transcripts (T) and their passages (P) detected wit (C) Representative sample of fluorescence in N. benthamiana infected with either of the three constructs CTV33 23 BY GFP 37, CTV33 23 G GFP 40 and CTV 33 23 B GFP 42 magnified under a fluorescent stere oscope. (D) Representative sample of fluorescence in the phloem tissue of Citrus macropylla infected with constructs CTV33 23 BY GFP 37 and CTV33 23 G GFP 40.

PAGE 52

52 Fig ure 3 6 G to produce CTV based expression vectors (A) Schematic representation of CTV and modification by insertion of GUS ORF under control of BYSV CP TR creating express ion vector CTV33 23 BY GUS 60 ( 60). (B) Northern blot hybridization analysis of t ransfected protoplast with the w ild type virus (WT) and expre ssion vectors CTV33 23 BY GUS 60 from transcripts (T) detected (C) Enzymatic activity of the GUS protein in N. benthamiana tissue and c itrus phloem bark pieces (tube 1 (assay solution) and 2 (tissu e) from healthy plants and tube 3 (assay solution) and tube 4 (tissue) from infected N. benthamiana and citrus (b lue color indicate enzymatic activity). Construct CTV33 23 BY GFP 37 was amplified by passage through 12 sets of protoplast s before citrus inoc ulation. Three of four C macrophylla plants that were bark flap inocu lated with the concentrated virion s became infected. The infection of citrus was confirmed by fluorescence of GFP (Fig 3 5D) and ELISA (d ata not presented)

PAGE 53

53 Inoculation of citrus with co nstructs CTV33 23 G GFP 40 was done via amplification in agro inoculated N. benthamiana plants. The infection rate was in 1 of 4 C. macrophylla plants as indicated by fluorescence ( Figure 3 5D) and confirmed by ELISA (Data not presented) Similar to N. ben thamiana citrus plants expressed bright fluorescence in the vascular tissue 12 weeks after inoculation ( Figure 3 5D) and were still fluorescing 2.5 years later. T o examine the a l arger gene GUS ORF downstre am of the BYSV CP CE was inserted, resulting in construct CTV33 23 BY GUS 60 ( Figure 3 6 A). The construct replicated in transfected protoplast s. H owever, the accumulation levels of all the CTV s g RNAs were decreased profoundly compared to the wild type vir us as demonstrated b y N orthern blot hybridization analysis ( Figure 3 6 B). Also the CTV33 23 BY GUS 60 construct pass aged poorly in protoplast s (d ata not presented). Yet, after agro inoculation of N. benthamiana plants, the vector replicated and moved syst emically as demonstrated by symptoms production (vein clearing followed by necrosis), ELISA (Data not presented) and GUS assays. T he activity of GUS in the N. benthamiana plants was continuously produced in old and new leaves un til the death of the plant ( Figure 3 6 C) Similar to CTV33 13 BY GUS 61, the TR wa s able to accommodate moderate (800 nts) to long genes (2000 nts) albeit with a differential effect on sg RNA levels of upstream genes ( Figures 3 5B and 3 6B) Concentrated v irions from c onstruct CTV33 23 GUS 60 were used to inoculate 10 C. macropyhlla plants. One C. macrophylla plant became i nfected as confirmed by ELISA (d ata not presented) and activity of the GUS gene ( Figure 3 6C) Furthermore,

PAGE 54

54 GUS activity and western blo t analysis revealed the presence of the GUS gene in citrus 1.3 years after inoculation ( Figure 3 6C, Figure 3 19). Production of an Extra Protein without Producing an Extra Subgenomic mRNA Internal Ribosome Entry Site Strategy (IRES) The Tobacco etch virus (TEV) IRES The N TR of TEV mediates cap independent translation of viral mRNA. Studies N TR of TEV demonstrate its ability to initiate translation at an internal ORF in a bi cistronic m RNA (Gallie, 2001; Niepel and Gallie, 1999 N TR of T EV ( nt s 2 144 GenB ank accession # DQ986288) was inserted into a CTV mini replicon behind the p23 ORF ( between nts 19020 19 0 21 ) foll owed by the GFP ORF (CTVp333R 23 ITEV GFP) ( Figure 3 7 A) to examine whether a bi cistronic s g m RNA would work with this virus Although N orthern blot hybridization analysis demonstrated that the mini replicon replicated and produced abundant amounts of the bi cistronic mRNA in t ransfected N. benthamiana protoplast s ( Figure 3 7C), GFP fluorescence was not observed suggesting a la ck of translation of the second ORF in the bicistronic mRNA I also examined the N TR TEV IRES construct in full length CTV in N. benthamiana protoplast s and plants. Construct CTV33 23 ITEV GFP 41 was pass ag ed efficiently through protoplast sets ( Figure 3 7 B) indicating the good replication and formation of virions but n o fl uo rescing protoplasts were observed demonstrating that this IRES did not work well in CTV ( d ata not presented). This construct infected and moved systemically in N. benthamiana plants based on ELISA assay (data not presented) and systemic symptoms of vein clearing followed by necrosis but no GFP fluorescence was observed under UV light (Data not presented ).

PAGE 55

55 Fi gure 3 7 GFP inserted behind IRES sequences to create CTV based expressi on vectors (A) Schematic representation of and CTV Cla 333R and their modification behind p23 creating expression vectors CTV33 23 ITEV GFP 41;CTV33 23 I3X ARC GFP TR IRES and 3xAR C 1 IRES, respectively and CTVp333R 23 IT E V GFP; CTVp333R 23 I3XARC GFP represent ing TR IRES and 3xARC 1 IRES, respectively (B) 1 Northern blot hybridization analysis from tranfected N. benthamiana protoplast with wild type virus (WT), CTV33 23 ITEV GFP 41 (C41) andCTV33 23 I3XARC GF P 43 (C43); T = RNA isolated from transcript transfected protoplast and P = RNA isolated from virion transfected protoplast isolated from RNA transfected protoplast. 2 Northern blot hybridization analysis from protoplast transfected with CTVp333R 23 ITEV GFP (Lane A); CTVp333R 23 I3XARC GFP (lane B), CTVp333R (lane C) and CTVp333R 23 B GFP (BYV CP CE driving the expression of GFP behind p23) (Lane D). Gels were hybridized probe

PAGE 56

56 Activ e ribosome complement ary s equence (ARC) IRES Insertion of an IRES consensus sequence obtained from analysis of rice ribosomal RNA ( the engineered 3xARC 1 (86 nts) IRES (Akbergenov et al., 2004)) was next examined for activity in CTV. This IRES was fused behind the p23 ORF (nt s 19020 19021) in both the CTV mini replicon (CTVp333R 23 I3XARC GFP) and (CTV33 23 I3XARC GFP 43) as described above ( Figure 3 7 A ). However, after infection of protoplasts and plants, no GFP fluorescence was observed even though the viru s repli cated well in both ( Figures 3 7 B and C ). Poly P eptide Fusion Figure 3 8 GFP and a protease fused to p23 to create CTV based expression vectors. two TEV proteases (NIa and HC Pr o) and their recognition sequences to create expression vectors CTV33 23 HC GFP 72, CTV33 23 NIa GFP 73, CTV33 23 HC GFP 74 and CTV33 23 NIa GFP 75.

PAGE 57

57 Figure 3 9 Comparison of Florescence in N. benthamiana (A) Comparison of flouresnce in infiltrated l eaves of representative samples of constructs CTV33 23 HC GFP 72, CTV33 23 NIa GFP 73, CTV33 23 HC GFP 74 and CTV33 23 NIa GFP 75 ( GFP fused) and CTV33 23 BY GFP 37, CTV33 23 G GFP 40 and CTV33 23 B GFP 42 (free GFP ) under hand held UV light (Right) and the same leaves under white light (left). (B) Comparison on whole plant level between representative samples of constructs CTV33 23 HC GFP 72 and CTV33 23 NIa GFP 73 (fused GFP ) and CTV33 23 BY GFP 37, CTV33 23 G GFP 40 and CTV33 23 B GFP 42 ( GFP under its own controller element behind p23 (Free GFP )) under hand held UV light (Right) and same plants under white light (Left). (C) Comparison between the abaxial ( Lower) and adaxial (upper) leaf surfaces of the same representative leaf sample of constructs CTV3 3 23 HC GFP 72 and CTV33 23 NIa GFP 73 under hand held UV light (Right) and white light (Left). P23 the most highly expressed gene of CTV, is a multifunctional protein that is essential for citrus infection. P23 is a silencing suppressor and controls plus to minus RNA ratio in infected cells via an RNA binding domain constitut ing positive charged

PAGE 58

58 amino acid residues and a Zn finger domain present between amino acid 50 86 (Lopez et al., 2000; Lu et al., 2004; Satyanarayana et al., 2002 b ). In order to create a gene fusion the HC Pro or NIa protease motifs of TEV were selected to be fused at the C terminus of p23 ( between nts 19017 and 19018 ) ( Figure 3 8 ). The protease recognition sequence of the HC Pro and NIa was duplicated between p23 and the protease and between the protease and GFP creating vectors CTV33 23 HC GFP 72 and CTV33 23 NIa GFP 73, respectively ( Figure 3 8 ). The processing of the protease motif from p 23 should release the p23 with 7 extra amino acids at its C term inus in the case of HC Pro and 6 amino acids in the case of NIa. T he GFP protein should have two extra and one extra amino acid following cleavage from HC Pro and NIa, respectively. The recognition sequences were switched between HC Pro and NIa creating vectors CTV33 23 HC GFP 74 and CT V33 23 NIa GFP 75 as controls that are unable to be cleaved ( Figure 3 8 ). All the polypeptide fusion vectors were created in CTV binary vectors for infection of plants because in protoplast it was shown that p23 fusion did not affect the ability to replic ate and pass between protoplast sets (Tatineni and Dawson, unpublished result ). In N. benthamiana infiltrated leaves, all constructs fluoresced similar ly to each other and to the free GFP constructs behind p23 ( Figure 3 9A) Furthermore, western immuno blo t analysis fro m infiltrated leaves indicated processing of the reporter gene from the polypeptide fusion ( Figure 3 10 ). The GFP protein did not localize to the nucleus unlike the fusion to p23 without a protease processing releasing the reporter gene (Tati neni et al., unpublished result ; data not presented) U pon agro inoculation of plants only constructs with the protease and its homologous processing sites were able to move systemically into upper non inoculated leaves. The fluorescence in upper non

PAGE 59

59 inoc ulated leaves was weaker than those for the expression vectors CTV33 23 BY GFP 37, CTV33 23 G GFP 40 and CTV33 23 B GFP 42 carrying GFP under its own controller element ( Figure 3 9B ). Furthermore, it was easier to visualize fluorescence on the abaxial rath er than the adaxial leaf surface ( Figure 3 9C ). Upon inoculation of citrus with construct CTV33 23 HC GFP 72 one plant became positive with relatively low ELISA value compared to others (d ata not presented) The reporter gene activity was not detected. Figure 3 10. Western blot analysis of different expression vectors infiltrated into N. benthamiana leave s using GFP antibody GFP ( GFP inserted under the BYV CP CE controller element between CPm and CP (produces free GFP )(Tatineni et al., 2008)), B= CTV33 23 BY GFP HC GUS 51, C= CTV33 23 G GFP NIa GUS 54, D= Empty well; E= CTV33 BY GFP NIa GUS 78, F= CTV33 23 HC GFP 72, G= CTV33 23 NIa GFP 73 Production of Heterologous Protein s from a Single CTV V ector Use of Single Controller Elements to Express Multiple Proteins T o exploit the polypeptide strategy to express multiple genes driven by the same controller element in a CTV based vector, a fusion poly peptide was created consisting of GFP/Protease (Pro) /GUS. Two different protease motifs were used in the different constructs, HC Pro and NIa, with their proteolytic motifs and recognition sequences separating GFP ORF from the GUS ORF ( Figures 3 14A and 3 16) ( Carrington and Dougherty, 1988; Carrington et al., 1989). Theoretically, in case the NIa was the protease motif in the fusion, six extra amino acids are coupled with the N terminal protein (GFP) at its C terminus whereas only one extra amino acid is added to the N

PAGE 60

60 terminus of GUS. Similarly, where HC Pro was the protease within the fusion poly peptide, 7 extra amino acids are added to the C terminus of GFP and two extra amino acids added to the N terminus of GUS. The fusion genes ranged in size from 3127 to 3480 nts. Replacement of the p13 gene T he two fusions of GFP /Pro/GUS described above were engineered into the p13 site of CTV in the agro inoculation binary vector under the control of the BYSV CP CE (CTV33 13 BYGFP HC GUS 77 with HC Pro protease motif and CTV33 13 BYGFP NIa GUS 78 with NIa protease motif) ( Figure 3 11A) The constructs were agro inoculated to N. benthamiana to monitor the ability to systemically infect the plant and produce GUS and GFP Both g enes and active proteins were produced based on their assays ( Figure 3 11 B ). Western immune blot analysis indicated the efficient processing of the GFP prot ein from the polypeptide fusion ( Figure 3 10 ). The virus multiplied and spread to high titers in N. benthamiana plants as indicated by symptom development in the upper leaves ( Figure 3 11B) and ELISA (data not presented) However, the level of GFP fluorescence was less than that of vectors CTV33 13 BY GFP 57 CTV33 13 G GFP 65 and CTV33 13 B GFP 66 expressing the GFP alone and spread more slowly into the upper non inoculated leaves than those vectors (d ata not presented). In N. benthamiana plants, overlapping fluorescence and enzymatic activity of GUS were demonstrated 7 months after the injection of the construct revealing their stability ( Figure 3 12 ).

PAGE 61

61 Figure 3 11 Hybrid gene ( GFP /Protease/GUS fusion) replacement of p13 to create expression vectors. (A) Schematic representation of CTV9R modification to create expression vectors CTV33 BY GFP HC GUS 77 and CTV33 BY GFP NIa GUS 78 with the two fusion genes under the control of BYSV CP CE with TEV HC Pro and NIa spanned by their proteolysis recognition sequence seperatin g GFP and GUS, respectively. (B) Activity of the reporter genes in N. benthamiana and Citrus macrophylla (a.) Representative sample of N. benthamiana plant infected with either CTV33 BY GFP HC GUS 77 or CTV33 BY GFP NIa GUS 78 under white light an d (b.) the same plant under UV light (c.) Two pictures of peeled phloem bark pieces of C. macrophylla infected with construct CTV33 BY GFP NIa GUS 78 under a flourescent stereoscope (d.) Representative sample of GUS activity in systemic N. benthamiana leaves contro l leaf (Left) and infected leaf (right) (e.) Peeled bark phloem pieces and GUS solution of healthy C. macrophylla plant (f.) Peeled bark phloem pieces of C. macrophylla plant infected with construct CTV33 BY GFP NIa GUS 78. Blue color ind icate GUS activity.

PAGE 62

62 Figure 3 12. Stability of CTV based expression vectors in N. benthamiana (A ) Upper leaf from Agro in oculated N. benthamiana plants carrying the binary vector CTV33 BYGFP HC GUS 77 (GFP/HC Pro/GUS) pictured under epi fluorescen ce microscope. (B) The same leaf was tested for GUS activity indicating near complete overlap between the two reporter genes. In an attempt to improve the expression level of GFP and GUS, the fusion polypeptide was moved cl The fusion gene with either BYSV, GLRaV 2 or BYV CP CE with the protease of HC Pro TR referred to as CTV33 23 BY GFP HC GUS 51, CTV33 23 G GFP HC GUS 53 and CTV33 23 BY GFP HC GUS 55 whereas with the NIa p rotease constructs were named CTV33 23 BY GFP NIa GUS 52, CTV33 23 G GFP NIa GUS 54 and CTV33 23 BY GFP NIa GUS 56, respectively ( Figure 3 13 ). After N. benthamiana plants were agro inoculated, a ll the constructs multiplied and spread into the upper non i noculated leaves as indicated by GFP fluorescence ( Figure 3 14A ) and GUS activity ( Figure 3 14A ). Similar to constructs CTV33 13 BYGFP HC GUS 77 and CTV33 13 BYGFP NIa GUS 78, fluorescence overlapping with GUS enzymatic activity was demonstr ated 7 months after injection (d ata not presented) indicating the stability of the fusion.

PAGE 63

63 However, C. macrophylla plants infected with con struct CTV33 23 BY GFP HC GUS 51 revealed only faint fluorescence and almost no GUS activity ( Figure 3 14B) and high ELISA values (d ata not presented). Figure 3 1 3 Hybrid gene ( GFP /Protease TR to create expression vectors (A) Schematic its modification to produce expression vectors CTV33 23 BY GFP HC GUS 51 and CTV33 23 BY GFP NIa GUS 52 has the BYSV CP CE driving the hybrid genes that contain HC Pro and NIa proteases respectively whereas CTV33 23 G GFP HC GUS 53 (C53) and CTV33 23 G GFP NIa GUS 54 (C54) are GLRaV 2 driven and CTV33 23 BY GFP HC GUS 55 (C55) and CTV33 23 BY GFP NIa GUS 56 (C56) are BYV driven fusion genes. (B) Northern blot hybridization analysis of transfected protopl ast with transcript s of wild type virus (WT), C53, C54, C55 and C56 and their virion passages (p). Use of Multiple Promoters to Express Foreign Genes Simultaneously Bimolecular fluorescence complementation (BiFC) in CTV. To assess the expression of two CP CE controlling different ORFs the BiFC system which produces

PAGE 64

64 visible fluorescence only when the two proteins accumulate in the same cell, was used. This system was developed using the bJun fused to the N terminus of EYFP (A.A. 1 154 : referred to as bJunN ; Hu et al., 20 02 ) and bFos ORF fused to C terminus of EYFP (A.A. 155 238 : referred to as bFosC; Hu et al., 2002 ) Both proteins localize to the Fig ure 3 14 Activity of reporter genes generated by insertion of the Hybrid gene ( GFP /Protease /GUS fusion) behind p23 ( A) Activity of the reporter genes in N. benthamiana plants (a.) Representative sample of N. benthamiana plant infected with CTV33 23 BY GFP HC GUS 51, CTV33 23 G GFP HC GUS 53 CTV33 23 BY GFP NIa GUS 52 or CTV33 23 G GFP NIa GUS 54 under white light and ( b.) the same plant under hand held UV light (c.) Representative sample of GUS activity in infected systemic N. benthamiana leaves and control leaves (tubes 1 and 2 represent the solution before fixing and tissues in fixing solution respectively from healt hy leaves whereas 3 and 4 represent the solution and tissues from infected leaves, respectively, G tube is the GUS assay buffer (B.) Activity of reporter genes in C. macrophylla (a.) Picture of peeled phloem bark pieces of C. macrophylla infected with cons truct CTV33 23 BY GFP HC GUS 51 under a flourescent stereoscope (b.) Peeled bark phloem pieces GUS activity in infected and healthy C. macrophylla plants (tubes 1 and 2 represent the solution and tissues in fixing solution from healthy leaves whereas 3 and 4 represent the solution and tissues from infected leaves, respectively.

PAGE 65

65 nucleus where they directly interact ena bling the EYFP protein to regain its wild type folding pattern and results in emission of fluorescence upon activation by a blue light source (e xcitation wave length is 525nm and emission wavelength is 575nm) (Hu et al., 2002 ). One or both components of BiFC were introduced into the CTV mini replicon of the p23 ORF (between nts # 19020 and 19021 GenB ank a ccession # AY170468 ) referred to as CT Vp333R 23 BYbJunN, CTVp333R 23 GbFosC and CTVp333R 23 BYbJunN GbFosC ( Figure 3 15 A) Northern blot hybridization analysis demonstrates the successful transfection of all three constructs into N. benthamiana protoplast ( Figure 3 15B). The two transcription factors interacted in the p lant cell as demonstrated by n uclear fluorescence observed only in protoplast s infected with CTVp333R 23 BYbJunN GBFosC ( Figure 3 15C) It is worth noting that the size of the two inserted genes is approximately identical to tha t of the GUS ORF. As a control for the Bi FC experiments, I also introduced the genes individually into CTV33 23 BYbJunN 97 and CTV33 23 GbFosC 98 so that only one component would be produced ( Figure 3 16B). Neither con struct CTV33 23 BYbJunN 97 nor CTV33 23 GbFosC 98 exhibited nuclear fluorescence. E xpress ion of multiple heterologous genes simultaneously from the same genomic location Replacement of the p1 3 gene The two BiFC genes were introduced into a anarayana et al., 1999, 2000, 2003 ; Tatineni et al., 2008 ) as a replacement of the p13 gene ( replacement of the nucleotides deleted between 17292 and 17581 ) resulting in CTV33 BYbJunN GbFosC 76 ( Figure 3 16A) T ransfection of protoplasts with the RNA transcripts of CTV3 3 BYbJunN GbFosC 76 resulted in

PAGE 66

66 the nuclear fluorescence of infected protoplast s (d ata not presented) Similarly, infiltrated leaves of N. benthamiana plants with full length CTV33 BYbJunN GbFosC 76 emitted nuclear fluorescence ( Figure 3 16B ). In contrast infiltrated Fig ure 3 1 5 Bimolecular Flouresence complementation (BiFC) prove of concept. (A) Satyanarayana et al., 2003) replicon and its modification to create expression r eplicons: (a.) Insertion of bot TR giving rise to CTVp333R 23 BYbJun N GbFosC and the controls with one gene behind p23, CTVp333R 23 BYb JunN(b.) or CTVp333R 23 GbFosC(c .). (B) Northern blot hybridization analysis of transfected protoplast with CTVp333R 23 BYbJun N GbFosC (Lane a.), CTVp333R 23 BYbJun N (Lane c .) and CTVp333R 23 GbFosC (Lane b.). (C) Flourescence of a transfected protoplast when pictured under a stereoscope (Upper) or a laser scanning confocal microsc ope (lower) indicating the flourescence from the nucleus.

PAGE 67

67 leaves with constructs CTV33 23 BYbJunN 97 and CTV33 23 GbFosC 98 did not exhibit nuclear fluorescence (d ata not presented). Monitoring stem phloem and leaf veins of N. benthamiana plants infiltrat ed with CTV33 BYbJunN GbFosC 76 seven weeks after infiltration revealed fluorescence of the vascular tissue indicating the ability of this construct to systemically infect upper leaves of N. benthamiana ( Figure 3 16B). Figure 3 16. BiFC gene replac ement of p13 to produce CTV based expression vectors. vector CTV33 BYbJunN GbFosC 76 and the control vectors CTV33 23 G bFosC 98 and CTV33 23 BY bJunN 97 (inserti on behind p23 nts 19 020 19021). (B) Representative sample of N. benthamiana fluorescence in systemically infected plants. TR In the next s eries of experiments, the expression of the two genes was examined The two

PAGE 68

68 gene components of the BiFC system were introduced into CTV behind p23 (between nts # 19020 and 19021) CTV33 23 BYbJunN GbFosC 59 (Fig 3 17A) Upon RNA transfection of construct CTV33 23 BYbJunN GbFosC 59 nuclear flourescence of infected protoplast was observed under the fluorescent microscope ( d ata not pres ented ) However, it was difficult to pass the new construct from one protoplast b atch to another similar to GUS and the GFP /Pro /GUS fusion genes inserted at the same location Upon agro infiltration of N. benthamiana plants with CTV33 23 BYbJun GbFosC 59 in full length CTV, fluorescence was observed in infiltrated areas ( d ata not presented ). Systemic symptoms similar to that expected for infection of N. benthamiana by CTV was extremely delayed However, monitoring upper non inoculated leaves and phloem ti ssue of the stem at seven weeks after agro infiltration of leaves revealed fluorescence of nuclei of the vascular tissue, demonstrating systemic infection by the vector ( Figure 3 17C). These results confirmed by ELISA (data not presented) indicate that th affecting the ability of CTV to systemically invade the plants. Similar to both genes replacin g p13 in construct CTV33 BYbJunN GbFosC 76 there was a delay in the time frame of colonizing the upper vascular tissues by constru ct CTV33 23 BYbJunN GbFosC 59. Nuclear fluorescence of systemic stem phloem tissue indicates that CTV33 BYbJunN GbFosC 76 infected more cells than construct CTV33 23 BYbJunN GbFosC 59 ( Figure 3 16B and Figure 3 17C). This difference in the number of cells infected indicates the better ability of CTV33 BYbJunN GbFosC 76 to move in N. benthamiana as compared to CTV33 23 BYbJunN GbFosC 59.

PAGE 69

69 E xpress ion of multiple foreign genes simultaneously from different locations To express multiple foreign genes from two unique genomic positions, I elected to replace the p13 gene and insert a second gene behind p23. CTV33 BYbJunN 23 GbFosC 67 ( Figure 3 17A) was created via replacement of the p13 gene with the BYSV Fig ure 3 17 CTV based expression vector built to simultaneously express two genes from two controller elements. (A) Sc hematic representation of CTV9R and its mod ification to produce expression vectors CTV33 23 BYbJunN GbFosC 59 and CTV33 BYbJunN 23 GbFosC 67. (B) Northern blot hybridization analysis of the RNA transfected protoplast with the wild type virus (WT,T), two clones of CTV33 BYbJunN 23 GbFosC 67( C67,T1 and T2) and two clones of CTV33 23 BY bJu nN Gb FosC 59 (C59, T3 and T4) (C) Flourescence of N. benthamiana plant parts under a flourescent stereo microscope (CTV33 23 BY bJunN Gb FosC 59 = a.,b., c and d; CTV33 BYbJunN 23 GbFosC 67= e.) (a.) bud (b. ) Corolla (c.) systemic leaves, (d.) peeled bark phloem pieces and (e.) infiltrated leaf

PAGE 70

70 CP CE driving the bJunN ORF and the GLRaV 2 CP CE controlling the bFosC ORF inserted between the p23 ORF an CTV33 BYbJunN 23 GbFosC 67 was transfected into protoplasts and Northern blot analysis revealed the replication of the virus ( Figure 3 17B). However, accumulation of the p23 mRNA was greatly reduced. CTV33 BYbJunN 23 GbFosC 67 was agro inoculated into N. benthamiana Leaves infiltration indicated nuclear fluorescence of infected cells ( Figure 3 17C) which were much fewer in number compared to constructs CTV33 BYbJunN GbFosC 76 and CTV33 23 BYbJunN GbFosC 59 I solation of virions fro m leaves and transfection of protoplast was carried out resulting in nuclear fluorescence of infected protoplast indicating the successful formation o f biologically active virions (d ata not presented). However, systemic infection was not achieved as indica ted by the lack of nuclear fluorescence in the stem and upper non inoculated leaves of N. benthamiana plants and confirmed by ELISA. In order to further study simultaneous multiple gene expression from the different locations as above CTV33 BYGUS 23 GGFP 71 was engineered such that the GUS ORF under the control of the BYSV CP CE replaced the p13 gene ( nts 17292 17582 ) and the GFP ORF under the control of the GLRaV 2 CP CE was inserted ) ( Figure 3 18A). RNA transcripts of CTV33 BYGUS 23 GGFP 71 were transfected into N. benthamiana protoplasts and northern blot analysis indicated efficient replication of the construct in protoplasts ( Figure 3 18B). Leaf infiltration of N. benthamiana plants with construct CTV33 BYGUS 23 GGFP 71 resulted in replication of the virus as indicated by visible fl uorescence under a UV light and by GUS activity (d ata not presented) The agro

PAGE 71

71 inoculated plants began to exhibit GUS activity and fluorescenc e in the upper non inoculated leaves 6 weeks after infiltration (Fig 3 18C) The systemic infection of upper leaves was slightly slower than constructs with only GFP alone. Also the phenotype of vein clearing followed by necrosis associated with CTV infec tion of N. benthamiana Fig ure 3 18 CTV based expression vector built to simultaneously express two genes from two controller elements. (A) Sc hematic representation of CTV9R and its modification to produce expression vect ors CTV33 BYGUS 23 GGFP 71 (B) Northern blot hybridization analysis of the RNA transfected protopl ast with the wild type virus (WT ) and the CTV33 BYGUS 23 GGFP 71 (C71) expressio n vector probed w TR +p23 (Satyanarayana et al., 1999) (C) Biological activity of reporter genes in N. benthamiana and Citrus. N. benthamiana plant under white light (a.) and hand held UV light (b.). (c.) GUS activity from healthy (tube 1 (assay solution) and 2 (tis sue) and infected N. benthamiana (tube 3 (assay solution) and tube 4 (tissue). (d.) Peeled bark phloem pieces under flourescent microscope and (e.) GUS assay activity in citrus similar to (c.)

PAGE 72

72 vascular tissue occurred late r than that of single gene vectors The level of fluorescence when observed under UV light appeared to be slightly less than that of the single gene constructs However, the GFP fluorescence was more in plants infected with construct CTV33 23GGFP 71 which was controlled by its o wn CE, compared to that of the fusion in constructs (CTV33 23 BY GFP HC GUS 51, CTV33 23 BY GFP NIa GUS 52, CTV33 23 G GFP HC GUS 53, CTV33 23 G GFP NIa GUS 54, CTV33 13 BYGFP HC GUS 77 and CTV33 13 BYGFP NIa GUS 78). The activity of both genes continued until the death of the N. benthamiana plants. Similarly, in citrus the expression of both genes were better than the same genes in constructs CTV33 13 BYGFP NIa GUS 78 and CTV33 23 BY GFP HC GUS 51. Level of Foreign Gene Expression of the Different Cons tructs in Citrus It is difficult to direct ly compare foreign gene expression from the different vectors in citrus due to the difference s in the time s of infection, the age s of the tissue and the effect s of the inserted foreign gene cassette on the replicat ion of the virus. Yet, protein presence in citrus is the best measure of expression level. Thus, w estern blot analysis was used to compare the relative level of expression of the different GFP and GUS constructs in citrus to that of CP protein, a house kee ping gene to determine the replication level s Western blots using the GFP antibodies and the CP antibody revealed a trend which confirms the relative the genome and a lower expression level when the inserted gene is moved further away ion between p13 and p20 ( Figure 3 19A ). In contrary, the GUS expression in citrus revealed a higher relative expression level as replacement of p13 rather than insertion behind p23 ( Fig ure 3 19B)

PAGE 73

73 Figure 3 19. Western blot analysis of the different constructs in citrus to evaluate the expression of GFP and GUS. (A) GFP and CP antibody used to determine the level of expression of GFP relative to CP in citrus 708 plant infected with 3CTV9R (Tatineni et al., 2008), 1808 plant infected with BCN5 (Folimonov et al., 2007), 1916 plant infected with CTV33 23 G GFP 40, 1874 plant infected with CTV33 23 BY GFP 37, 1934, 1935, 1937 infected with CTV33 13 BY GFP 69, 1931 and 1939 infected with construct CTV33 G GFP 65 and CTV33 B GFP 66, respectively. (B) GUS and CP antibody used to determine the level of expression of GUS relative to CP in citrus 2084,2085, 2086, 2087 plant s infected with construct CTV33 BYGUS 61, 2132 plant infec ted with construct CTV33 23 BYGUS 60, 2096 plant infected with expression vector CTV33 BYGFP NIa GUS 78, E= empty well and buffer = iveC

PAGE 74

74 C HAPTER 4 DISCUSSION In this work, I found that Citrus tristeza virus ( CTV ) was extraordinarily permissive in al lowing insertion of foreign sequences at different places genome. I created and examined 27 different potential vector constructs to express foreign genes via additional s ubgenomic (sg) m RNAs, di cistronic mRNAs, or protease proces sing of fusion proteins. Remarkably, most of these con structs functioned as vectors. Additionally, I found that CTV is capable of simultaneously producing large amounts of multiple foreign proteins or peptides. The ability of N icotiana benthami an a to becom e systemically infected with CTV constructs greatly aided analysis of th e different potential vectors. First was in the production of inoculum for getting the vectors in to citrus. The original procedure was to successively passage t he recombinant virus or vectors in protoplasts. One major limitation of that procedure was the first inoculation of protoplasts with RNA transcripts, which resulted in approximately 0.01 to 0.1% of the protoplasts becoming infected (Satyanarayana et al., 2001). This limitation wa s size dependent. RNA transcripts of smaller constructs, for example infected 10 to 100 times more protoplasts than the wild type RNA (Satyanarayana et al., 1999; 2001). In contrast, RNA of constructs wi t h large insertions infected even fewer proto plasts than the wild type RNA. Virions are approximately 10,000 times more infectious than RNA (Navas Castillo et al., 1997), so in the subsequent passages virions were used as inoculum. However, the critical st ep was the first passage that must result in an increased infection rate for further ampli fi cation. The largest constructs examined here could not have been am plified by protoplast passage. Another complication with

PAGE 75

75 the protoplast passage procedure was the difficulty in avoiding contamination during the series of passages over several weeks. The systemically infected N. benthamiana plants supplied adequate virus for inoculation of citrus plants much more easily Additionally, the systemically infected N. be nthamiana plants provided a quicker assay of foreig n gene expression than citrus. It was possible to assess the effectiveness of potential vectors in N. benthamiana in weeks instead of months and years in citrus. Agro bacterium tumefaciens mediated inoculat ion of CTV based vectors to N. benthamiana plants was conducted for 27 constructs. All of the constructs replicated in the infiltrated areas of mesophyll cells (transient expression) which does not require the ability of the virus to move within the plant However, all but three of the constructs were able to move from the infiltrated cells in this host and spread systemically into the vascular tissue of the upper leaves. Two of the constructs that were unable to move were fusions to p23 that lacked the co rrect protease processing sites (CTV33 23 HC GFP 74 and CTV33 23 NIa GFP 75). A functional p23 protein, which is a suppressor of RNA silencing, is required for infection of citrus (Lu et al., 2004; Tatineni et al., 2008). The lack of free p23 production probably prevented infection here since direct fusion of GFP to the p23 protein previously was shown to prevent systemic infection of plants ( Tatineni et al., unpublished result s ). The third construct that did not move systemically in N. benthamiana was t he insertion of the two BiFC genes at different location s in construct CTV33 BYbJunN 23 GbFosC 67. The ultimate goal was to develop high expressing and stable vectors for the natural CTV host, citrus. Thus, virions were concentrated from N. benthamiana plants infected with 12 different constructs that spread systemically and expressed moderate

PAGE 76

76 to high levels of the foreign protein(s) and used to inoculate citrus. C macrophylla plants became positive for virus infection between 6 60 weeks after inoculation depending on the insert length in the virus and the amount of virions co ncentrated from the N. benthamiana leaves that were used for inoculation. Eleven of the 12 constructs that infected citrus produced moderate levels of the reporter gene/s. Several approaches were examined for expression of foreign genes from CTV. The fi a duplication of a controller element and an additional ORF, which resulted in an a TMV via duplicating th e CP subgenomic promoter controlling a foreign gene (Dawson et al., 1989; Donson et al., 1991; Shivprasad et al., 1999). An advantage of this strategy is that it expresses the exact protein with no additional amino acids added to the N or /and C terminus wh ich could affect its biological activity at relatively high levels However, there are limitations of this strategy that should be considered. Duplication of the controller element can lead to homologous recombination resulting in the loss of the gene of interest (Chapman et al., 1992; Dawson et al., 1989). Although this made the TMV insert unstable, it appeared to have little effect on the stability in CTV (Folimonov et al., 2007). The use of a heterologous controller element from related viruses stabil ized the TMV insertions. However, heterologous controller elements usually are differentially recognized by the replicase complex of the virus (Folimonov et al., 2007; Shivprasad et al., 1999). This observation can be utilized to regulate the levels of des ired gene expression (Shivprasad et al., 1999). An important consideration is that there can be competition between the differe nt subgenomic RNAs of a virus. With TMV,

PAGE 77

77 the extra gene competed with the coat protein gene and the movement gene. There appear ed to be a maximal capacity for production of subgenomic RNAs that was divided among the three RNAs. Manipulations that resulted in increases in one resulted in decreases in the others. The ideal compromise was to reduce coat protein production to allow op timal foreign gene and movement gene expression ( Girdishivelli et al., 2000; Shivprasad et al., 1999;). Yet, CTV subgenomic mRNAs appeared to be much less competitive ( Aylln et al., 2003 ; Folimonov et al., 2007 ). In previous work, a CTV vector that exp ressed an extra gene between the CP and CPm genes was an effective and stable vector in citrus trees. The foreign gene was in p The position of the extra gene was chosen arbitrarily. Here I continued vector design in an attempt to define the limits of manipulation of the CTV genome in producing extra proteins or peptides. The virus expresses mRNAs (Hilf et al., 1995). One rule of CTV gene expression discovered from previous res earch transcrib ed higher than internal genes (Hilf et al., 1995; Navas Castillo et al., 1997) For very low in its native posi tion, but transcription became very high when the p33 gene (Satyanarayana et al., 1999). Thus, expression of higher levels than from the posit ion 6 arbitrarily chosen in the first vector (Folimonov et al., 2007) Yet based on results from other viruses, only certain positions within the viral genome are likely to tolerate extra gene insertions. For example, with TMV or Alfalfa mosaic virus the

PAGE 78

78 (Dawson et al., 1989; Lehto and Dawson, 1990; Sanchez Navarro et al., 2001). Remarkably, almost all of the constructs with insertions in CTV within the p13 deletion, between p13 and p20, and betw een p In contrast, the only position the virus did not tolerate insertions was between the p 20 and p23 genes. It is possible that these insertions interfered with the transcription of one or both of the adjacent genes. CTV v ectors expressing GFP from different genomic positions produced variable amounts of fluorescence with altered distribution and timing in N. benthamiana Visual assessment of symptom development and fluorescence indicated that the vectors with GFP inserted stab le for the life of the plants. However, Western immunoblots from citrus plants revealed a trend of higher expression when the foreign gene was positioned closer to e CTV genome. The similar vectors expressing BY bJunN 97 or bFosC 98 which had almost identical sized foreign inserts, required more time to establish systemic infections in N. benthamiana than those with the GFP ORF. The length of the inserted gene also affected the vectors. The vectors with the GUS ORF inserted at the N. benthamiana plants compared to the insertion of the GFP ORF at the same location s The insertion of the GUS ORF behind the p23 gene substantially reduced all of the CTV s g RNAs, yet the vector was still able to systemically infect N. benthamiana plants. This larger gene disrupted viral subgenomic RNA transcription much less wh en positioned at the p13 position Western immunoblots revealed higher expression of GUS when inserted as a replacement of p13 rather than as an insertion behind p23.

PAGE 79

79 I attempted to create a vector with an extra gene but without an extra subgenomic RNA by creating a bi cistronic messenger with an internal ribosome entry site (IRES) inserted in front of a foreign ORF. IRESs direct cap independent translation of the second ORF in the bi cistronic message. The positive attributes of this strategy are that it is not necessary to duplicate contr oller elements and the protein is produced with no extra amino acids. However, both IRES constructs replicated and systemically invaded the N. benthamiana plants, but both failed to express visual levels of GFP. There are several possible reasons to expla in the expression failure. The first is that IRESs from different viral families have different requirements for the eukaryotic cell proteins (Balvay et al., 2009; Fernandez Miragall et al., 2009; Fitzgerald and Semler, 2009). The different requirement amo ng IRESs enables differential translation efficiency in different cell types (Dorokhov et al., 2002; Masoumi et al., 2003; Roberts and Groppelli, 2009; Woolaway et al., 2001). A second reason could be the competition between the second ORF and the first OR F in a bi cistronic mRNA (Ivanov et al., 1997; Koh et al., 2003). A third reason is the interaction between the cap independent translat poly A tail (K neller et al., 2006). For Tobacco etch virus TEV it was demonstrated that synergism exis TR and poly A tail (Gallie et al., 1995). The IRES and TR synergistic interaction was reported for another plant carmovirus (Koh et al., 2003). Thus, the elements necessary for the efficient translation c ould be missing from not in a bicistronic messenger (Dorokhov et al., 2002; Roberts and Groppelli, 2009). Another strategy to express foreign genes in a viral vector consists of in frame fusion of an ORF of interest to a viral ORF at either the N or C terminus. The two

PAGE 80

80 proteins can be released by engineering a protease and processing sites between the two proteins (Dolja et al., 1997; Gopinath et al.,2000). It was first adapted in the potyviridae, TEV (Dolja et al., 1992). The major advantage of polyprotein fusion strategy is that the foreign protein is expressed in 1 :1 ratio with the viral protein A major limitation is that this process adds extra amino acids at the N and/or C termini of both proteins, whi ch may affect their biological activities. I created a series of constructs utilizing the HC Pro or NIa proteases from potyviruses to enable post translational processing of the engineered polyprotein to release free GFP, protease, and the p23 protein. Th ese vectors were able to systemically infect N. benthamiana The systemic movement of these constructs was slower than the expression vector constructs containing only the GFP ORF as an extra gene. The slower systemic movement and the lower levels of GFP e xpression in the systemic leaves partially could be attributed to the extra C terminal amino acids added to the p23 protein reducing its activity in RNA silencing suppression or amplification of viral RNAs or the protease processing delayed its activity. Although these constructs did not produce the maximal levels of foreign protein, they were viable vectors expressing substantial amounts of GFP. Upon identifying the locations within the CTV genome that could accommodate foreign gene inserts, I designed st rategies to construct viral vectors that express multiple genes. The first strategy depended on the use of a single controller element driving the transcription of a GFP/Pro/GUS hybrid gene. The hybrid gen e ranged in size from 3127 nts to 3480 nts. Other strategies utilized two extra controller elements ( CEs ) to produce two extra s g RNAs simultaneously. This strategy gave the flexibility to insert

PAGE 81

81 the two genes in tandem in the same location or in two different locations. Both strategies worked. This is no t the first time that two foreign genes have been expressed from a virus. In viral vectors that transcribe some of their genes via subgenomic RNA, the use of two d ifferent vectors was examined. Two TMV vectors were simultaneously inoculated into the same plant to express antibodies (Verch et al., 1998). The strategy proved the concept of producing full size antibodies from transient expression viral based vectors. However, the yield was low. The second attempt was to inoculate the same plant with two non c ompeting virus vectors. The two virus vectors selected were PVX and TMV (Giritch et al., 2006). There was improvement in the expression compared to vectors based on the same virus. The third attempt was a virus vector and its engineered defective RNA. TMV dRNA was engineered not to affect the replication of the helper virus by deleting internal sequences (Lewandowski and Dawson, 1998). The virus as well as the dRNA was successfully loaded with the genes of interest for the production of antibodies as well as pharmaceuticals (Roy et al., 2010). In potyviruses, several species could accommodate the expression of two foreign proteins (Beauchemin et al., 2005; Kelloniemi et al., 2008; Masuta et al., 2000). CTV was able to express two proteins as two extra gene s or as an extra gene followed by protease process ing from different locations within the genome. The genes chosen were relative ly large, increasing the genome size by as much as 18% Heterologous protein expression in whole plant s is usually accomplish ed by development of transgenic plants by insertion of foreign DNA into the plastid or nuclear genome. Plastid transformation has been successful for only a few annual crops. Time

PAGE 82

82 and success of nuclear transformation varies among the different crops. Cert ain plants are more recalcitrant to transformation and subseq uent regeneration than others. There are other disadvantages, pa rticularly in perennial crops. For example, citrus has a long juvenile stage after regeneration that prolongs the time necessary to evaluate the horticultural characteristics and dela ys the time to commercial use. Another major disadvantage is that traits engineered are available only to the next generation of plants. I now have developed a series of different CTV vectors, each with d ifferent characteristics that are more effect ive under specific conditions. For example, with the a I would advocate the expression of a small gene (300 400 nts) at the in CTV for maximal expression. A medium gene (75 0 1000 nts) could be more efficiently expre ssed from within the p13 area. A large gene (> 1500 nts) probably would be better accommodated as an insertion between CP and CPm where it would disrupt the viral subgenomic RNAs less and result in better systemic invasion of the plant. For expression of smaller proteins, peptides, or RNAs to target RNA silencing, it is possible that the virus could accommodate 3 or 4 different genes. Different combinations of extra s g RNAs and prot ease processing can be chosen. Al though two foreign proteins have been produced from other viruses, CTV is unique in usefulness because of its stability. The original vector has been continuously producing GFP for 8 year s (W.O. Dawson, unpublished result ). The uses of the CTV based expres sion vector have evolved since its inception. It was initially developed as a laboratory tool for citrus improvement. The vector was designed to express potential genes for transformation of citrus. Results of the effect of the heterologous gene in citru s, particularly if the effect was expected in mature tissue

PAGE 83

83 or fruit, could be obtained by the virus years before results would come from direct transformation. However, conditions and needs of the citrus industry have changed due to the invasion of a new bacterial disease Huanglongbing (HLB). This disease has spread so rapidly and is so damaging that the survival of the citrus industry is threatened. Initially, the CTV vector was used to identify antimicrobial peptides with activity against the HLB bacter ium f or transformation into citrus. However, the disease is spreading so rapidly that transgenic plants may not be available in time to save the indu stry. Due to the remarkable stability, the CTV vector now is being considered for use in the field to prote ct citrus trees and to treat infected trees until resistant transgenic plants become available. The CTV vector as a tool in the field to fight an invading disease of citrus is only one example of what viral vectors can do for agriculture. The possibilitie s are many for very stable vectors like those of CTV and perennial crops, particularly trees. Many trees are productive for 100 years or more. During the lifespan of the trees technologies changes and disease and pest pressures change. To improve trees by traditional transformation methods requires removing all of the present trees from the field and replanting. The use of a viral vector could add new genes to the existing trees.

PAGE 84

84 LIST OF REFERENCE S Ahlquist, P., French, R., Janda, M., Loesch Fries, L. S., 1984. Multi component RNA plant virus infection derived from cloned viral cDN A. Proc. Natl. Acad. Sci. USA 8, 7066 7070. Akbergenov, R., Zhanybekova, S., Kryldakov, R.V., Zhigailov, A., Polimbetova, N.S., Hohn, T., Iskakov, B.K., 2004. ARC 1, a sequenc e element complementary to an internal 18S rRNA segment, enhances translation efficiency in plants when present in the leader or intercistronic region of mRNAs. Nucleic Acids Res. 32, 239 247. Allison,R.F., Dougherty,W.G., Parks,T.D., Willis,L., Johnston,R .E., Kelly,M., Armstrong,F.B. 1985. Biochemical analysis of the capsid protein gene and capsid protein of tobacco etch virus: N terminal amino acids are located on the virion's surface. J Virol. 147 309 316 Ambrs, S., El Mohtar, C. Ruiz Ruiz, S., Pea L., Guerri, J., Dawson, W.O., Moreno, P., 2011. Agroinoculation of Citrus tristeza virus causes systemic infection and symptoms in the presumed n onhost Nicotiana benthamiana MPMI 24 1119 1131 Andrade, M., Sato, M., Uyeda, I., 2007. Two resistance modes to Clover yellow vein virus in pea characterized by a green fluorescent protein tagged virus. Phytopathology 97, 544 550. Aylln, M.A., Gowda, S., Satyanarayana, T., Karasev, A.V., Adkins, S., Mawassi, M., Guerri, J., Moreno, P., Dawson, W.O., 2003. Effec ts of modification of the transcription initiation site context on c itrus tristeza virus subgenomic RNA synthesis. J. Virol. 77, 9232 9243. Balvay, L., Soto Rifo, R., Ricci, E. P., Decimo, D., Ohlmann, T. 2009. Structural and functional diversity of viral IRESes. Biochim. Biophys. Acta 1789, 542 557. Baulcombe, D.C., Chapman, S., Santa Cruz, S., 1995. Jellyfish green fluorescent protein as a reporter for virus infections. Plant J. 7, 1045 1053. Beauchemin, C., Bougie, V., Lalibert, J. F., 2005. Simultaneo us production of two foreign proteins from a potyvirus based vector. Virus Res. 112 1 8. Brisson N Paszkowski J Penswick J R Gronenborn B Potrykus I Hohn T. 1984. Expression of a bacterial gene in plants by using a viral vector. Nature 31 0, 511 5 14 Caizares, C.M., Navas Castillo, J., Moriones, E., 2008. Multiple suppressors of RNA silencing encoded by both genomic RNAs of the crinivirus, Tomato chlorosis virus Virology 379, 168 174.

PAGE 85

85 Canizares, M.C., Nicholson, L., Lomonossoff, G.P., 200 5 Use of viral vectors for vaccine production in plants. Immunol. Cell Biol 83 263 270. Canto, T., Prior, D. A. M., Hellwald, K. H., Oparka, K. J., Palukaitis, P., 1997. Characterization of cucumber mosaic virus IV. Movement protein and coat protein ar e both essential for cell to cell movement of cucumber mosaic virus. Virology 237, 237 248. Carrasco,P., Daros,J.A., Agudelo Romero,P.,Elena,S.F.,2007. A real time RT PCR assay for quantifying the fitness of tobacco etch virus in competition experiments. J Virol. Methods 139, 181 188. Carrington, J.C., Cary, S.M., Parks, T.D. and Dougherty, W.G., 1989. A second proteinase encoded by a plant potyviral genome. EMBO J. 8 365 370. Carrington, J.C., Dougherty, W.G., 1988. A viral cleavage site cassette: Identi fication of amino acid sequences required for tobacco etch virus polyprotein processing Proc. Natl. Acad. Sci. USA 85, 3391 3395. Chalfie, M., Tu, Y., Euskirchen, G., Ward, W.W., Prasher, D.C., 1994. Green fluorescent protein as a marker for gene expressi on. Science 263, 802 805. Chapman, S., Kavanagh, T., Baulcombe, D., 1992. Potato virus X as a vector for gene expression in plants. Plant J 2 549 557. Chiba, M., Reed, J.C., Prokhnevsky, A.I., Chapman, E.J., Mawassi, M., Koonin, E.V., Carrington, J.C., D olja, V.V., 2006. Diverse suppressors of RNA silencing enhance agroinfection by a viral replicon. Virology 346, 7 14. Crameri, A., Whitehorn, E.A., Tate, E., Stemmer, W.P., 1996. Improved green fluorescent protein by molecular evolution using DNA shuffling Nat. BioTechniques 14, 315 319. Dawson, W. O., Bubrick, P., Grantham, G. L. 1988. Modifications of the tobacco mosaic virus coat protein gene affect replication, movement, and symptomatology. Phytopathology 78, 783 789. Dawson, W.O., Lewandowski, D.J., H ilf, M.E., Bubrick, P., Raffo,A.J., Shaw, J.J., Grantham, G.L. Desjardins, P.R., 1989. A tobacco mosaic virus hybrid expresses and loses an added gene. Virology 172, 285 292. Deleris, A., Gallego Bartolome, J., Bao, J., Kasschau, K.D., Carrington, J.C., Vo innet, O., 2006. Hierarchical action and inhibition of plant Dicer like proteins in antiviral defense. Science 313 68 71. Dietrich, C., Maiss, E., 2003. Fluorescent labeling reveals spatial separation of potyvirus populations in mixed infected Nicotiana b enthamiana plants. J. Gen. Virol. 84, 2871 2876.

PAGE 86

86 Dolja, V.V., Hong, J., Keller, K.E., Martin, R.R., Peremyslov, V.V., 1997. Suppression of potyvirus infection by co expressed closterovirus protein. Virology 234, 243 252. Dolja, V.V., McBride, H.J., Carring ton, J.C., 1992. Tagging of plant potyvirus replication and movement by insertion of beta glucuronidase into the viral polyprotein. Proc. Natl Acad. Sci. USA 89, 10208 10212. Donson, J., Kearney, C.M., Hilf, M.E., Dawson, W.O. 1991. Systemic expression of a bacterial gene by a tobacco mosaic virus based vector. Proc Natl Acad Sci USA. 88, 7204 7208. Dorokhov,Y.L., Skulachev,M.V., Ivanov,P.A., Zvereva,S.D., Tjulkina,L.G., Merits,A., Gleba,Y.Y., Hohn,T., Atabekov,J.G., 2002. Polypurine (A) rich sequences promote cross kingdom conservation of internal ribosome entry. Proc. Natl. Acad. Sci. USA. 99, 5301 5306. Edelstein, M. L., Abedi, M. R. Wixon, J., 2007. Gene therapy clinical trials worldwide to 2007 an update. J. Gene Med. 9, 833 842. Fernandez Miragall O Lopez de Quinto S Martinez Salas E. 2009. Relevance of RNA structure for the activity of picornavirus IRES elements. Virus Res 139, 172 182. Fitzgerald, K.D., Semler, B.L., 2009. Bridging IRES elements in mRNAs to the eukaryotic translation appa ratus. Biochim. Biophys. Acta 1789, 518 528. Folimonov, A.S., Folimonova, S.Y., Bar Joseph, M., Dawson, W.O., 2007. A stable RNA virus based vector for citrus trees. Virology 368, 205 216. Folimonova, S.Y., Folimonov, A.S., Tatineni, S., Dawson, W.O., 2008 Citrus tristeza virus : survival at the edge of the movement continuum. J. Virol. 82, 6546 6556. Folimonova, S.Y., Robertson, C.J., Shilts, T., Folimonov, A.S., Hilf, M.E., Garnsey, S.M. Dawson, W.O. 2010. Infection with strains of Citrus tristeza virus does not exclude super infection by other strains of the virus. J. Virol. 84 1314 1325. French, R., Janda, M., Ahlquist, P., 1986. Bacterial gene inserted in an engineered RNA virus: efficient expression in monocotyledonous plant cells. Science 231, 1294 97 Ftterer, J., Bonneville, J.M., Hohn, T., 1990. Cauliflower mosaic virus as a gene expression vector for plants. Physiol. Plant. 79, 154 157. Gallie, D.R., 2001. Cap independent leader of tobacco etch virus is eukaryotic initiation factor 4G dependent. J. Virol. 75, 12141 12152. poly(A) tail are functionally synergistic regulators of translation. Gene 165, 233 238.

PAGE 87

87 Garnsey, S.M., Cambra, M., 1991. Enzyme linked immunosorbent assay (ELISA) for citrus pathogens. In: Roistacher, C.N. (Ed.), Graft Transmissible Diseases of Citrus, Handbook for Detection and Di agnosis. FAO, Rome, pp. 193 216 Garnsey, S. M., Gonsalves, D., Purcifull, D. E., 1977 Mechanical transmission of citrus tristeza virus. Phytopathology 67, 965 968. Garnsey, S.M., Henderson C.T., 1982. Extraction, centrifugation, and assay techniques for purification of intact citrus tristeza virus. Workshop on Plant Virus Detection, Agric Exp. Stn., University of Puerto Rico, Rio Piedras, March 29 April2, 1982, 106 112. Giritch A Marillonnet S Engler C van Eldik G Botterman J Klimyuk V Gleba Y ., 2006 Rapid high yield expression of full size IgG antibodies in plants coi nfected with noncompeting viral vectors. Proc Natl Acad Sci USA 103, 14701 14706 Gleba, Y., Klimyuk, V., Marillonnet, S., 2007. Viral vectors for the expression of proteins in plants. Curr. Opin. Biotechnol. 18, 134 141. Gopinath, K., Wellink, J., Po rta, C., Taylor, K.M., Lomonossoff, G.P., van Kammen, A., 2000. Engineering cowpea mosaic virus RNA 2 into a vector to express heterologous proteins in plants Virology 267 159 173. Gowda, S., Satyanarayana, T., Ayllon, M.A., Albiach Marti, M.R., Mawassi, M., Rabindran, S., Garnsey, S.M., Dawson, W.O., 2001. Characterization of the cis acting elements controlling subgenomic mRNAs of citrus tristeza virus: production of positive and negative terminal and positive terminal RNAs. Viro logy 286 1, 134 151. Gowda, S., Satyanarayana, T., Davis, C. L., Navas Castillo, J., Albiach Marti, M. R., Mawassi, M., Valkov, N., Bar Joseph, M., Moreno, P., Dawson, W. O., 2000. The p20 gene product of C itrus tristeza virus accumulates in the amorphous inclusion bodies. Virology 274, 246 254. Gowda, S., Satyanarayana, T., Robertson, C.J., Garnsey, S.M., Dawson, W.O., 2005. Infection of citrus plants with virions generated in Nicotiana benthamiana plants agroinfiltrated with a binary vector based Citrus t risteza virus p. 23 33. In M. E. Hilf, N. Duran Vila, and M. A. Rocha Pea (eds.), Proceedings of the 16th Conference of the International Organization of Citrus Virologists. IOCV, Riverside, CA, 728 USA. Grdzelishvili, V.Z., Chapman, S.N., Dawson, W.O., Lewandowski, D.J., 2000. Mapping of the Tobacco mosaic virus movement protein and coat protein subgenomic RNA promoters in vivo. Virology 275, 177 192.

PAGE 88

88 Gronenborn, B., Gardner, R.C., Schaefer, S., Shepherd, R.J., 1981. Propagation of foreign DNA in plants using cauliflower mosaic virus as vector. Nature 294, 773 76. Hagiwara, Y., Peremyslov, V.V., Dolja, V.V., 1999. Regulation of closterovirus gene expression examined by insertion of a self processing reporter and by northern hybridization. J. Virol. 73, 79 88 7993. Hilf, M. E., Karasev, A. V., Pappu, H. R., Gumpf, D. J., Niblett, C. L., Garnsey, S. M., 1995. Characterization of citrus tristeza virus subgenomic RNAs in infected tissue. Virology 208, 576 582. Horton, R.M., Hunt, H.D., Ho, S.N., Pullen, J.R., P ease, L.B., 1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77, 61 68. Hu, C.D., Chinenov, Y., Kerppola, T.K., 2002. Visualization of interactions among bZIP and Rel family proteins in living cells using bimolecular fluorescence complementation. Molecular Cell 9, 789 798. Ion Nagy, L., Lansac, M., Eyquard, J.P., Salvador, B., Garcia, J.A., Le Gall, O., Hernould, M., Schurdi Levraud, V., Decroocq, V., 2006. PPV long distance movement is occasion ally permitted in resistant apricot hosts. Virus Res. 120, 70 78. Ivanov, P.A., Karpova, O.V., Skulachev, M.V., Tomashevskaya, O.L., Rodionova, N.P., Dorokhov, Y. L., Atabekov, J.G., 1997. A tobamovirus genome that contains an internal ribosome entry site functional in vitro. Virology 232, 32 43. Karasev, A.V., 2000. Genetic diversity and evolution of closteroviruses Annu. Rev. Phytopathol. 38 293 324. Karasev, A.V., Boyko, V.P., Gowda, S., Nikolaeva, O.V., Hilf, M.E., Koonin, E.V., Niblett, C.L., Cline, K., Gumpf, D.J., Lee, R.F., Garnsey, S.M., Lewandowski, D.J., Dawson, W.O., 1995. Complete sequence of the citrus tristeza virus RNA genome. Virology 208, 511 520. Karasev,A.V., Nikolaeva,O.V., Mushegian,A.R., Lee,R.F. Dawson,W.O., 1996. Organization of the 3' terminal half of beet yellow stunt virus genome and implications for the evo lution of closteroviruses. J. Virol. 221, 199 207. Kasschau, K.D., Xie, Z., Allen, E., Llave, C., Chapman, E.J., Krizan, K.A., and Carrington, J.C., 2003. P1/HC Pro, a vira l suppressor of RNA silencing, interferes with Arabidopsis development and miRNA function. Dev. Cell 4, 205 217. Kawakami, S., Watanabe, Y., Beachy, R. N., 2004. Tobacco mosaic virus infection spreads cell to cell as intact replication complexes. Proc. Nat l. Acad. Sci. USA 101, 6291 6296.

PAGE 89

89 Kelloniemi J Mkinen K Valkonen J P T. 2008 Three heterologous proteins simultaneously expressed from a chimeric potyvirus: infectivity, stability and the correlation of genome and virion lengths Virus Res. 135, 282 2 91. Kneller, E.L., Rakotondrafara, A.M., Miller, W.A. 2006. Cap independent translation of p lant viral RNAs. Virus Res. 119, 63 75. untranslated region and an internal ribosome entry site di fferentially enhances the translation of a plant virus coat protein. J. Biol. Chem. 278, 20565 20573. Lehto, K., and Dawson, W.O., 1990. Replication, stability, and gene expression of tobacco mosaic virus mutants with a second 30K ORF. Virology 175, 30 40. Lewandowski, D. J. and Dawson, W. O., 1998. Deletion of internal sequences results in Tobacco mosaic virus defective RNAs that accumulate to high levels without interfering with replication of the helper virus. Virology 251, 427 437. Lico, C., Chen, Q., S anti, L., 2008. Viral vectors for production of recombinant protein s in plants. J Cell Physiol 216, 366 377. Liu, Y.P., Peremyslov, V.V., Medina, V., Dolja, V.V. 2009. Tandem leader proteases of Grapevine leafroll associated virus 2: host specific functi ons in the infection cycle. Virology 383, 291 299. L pez, C., Navas Castillo, J., Gowda, S., Moreno, P., Flores R., 2000. The 23 kDa terminal gene of citrus tristeza virus is an RNA binding protein. Virology 269, 462 470. Lu, R., Fo limonov, A., Shintaku, M., Li, W. X., Falk, B. W., Dawson, W. O., Ding, S. W., 2004. Three distinct suppressors of RNA silencing encoded by a 20 kb viral RNA genome. Proc. Natl. Acad. Sci. USA 101, 15742 15747. Lucy, A. P., Guo, H. S., Li, W. X., Ding, S. W., 2000. Suppression of post transcriptional gene silencing by a plant viral protein localized in the nucleus. EMBO J. 19, 1672 1680. Marton, I., Zuker, A., Shklarman, E., Zeevi, V., Tovkach, A., Roffe, S., Ovadis, M., Tzfira, T., Vainstein, A., 2010. Non transgenic genome modification in plant cells. Plant Physiol. 154, 1079 1087. Masoumi, A., Hanzlik, T. N., Christian, P. D. 2003. Functionality of the 59 and intergenic IRES elements of cricket paralysis virus in a range of insect cell lines, and its rel ationship with viral activities. Virus Res 94, 113 120. Masuta, C., Yamana, T., Tacahashi, Y., Uyeda, I., Sato, M., Ueda, S., Matsumura, T., 2000. Development of clover yellow vein virus as an efficient, stable gene expression system for legume species. P lant J 23,539 546.

PAGE 90

90 Navas Castillo, J., Albiach Mart, M. R., Gowda, S., Hilf, M. E., Garnsey, S. M., Dawson, W. O., 1997. Kinetics of accumulation of citrus tristeza virus RNAs. Virology 228, 92 97. Niepel, M., Gallie, D.R., 1999. Identification and char acterization of the functional independent translation. J. Virol. 73, 9080 9088. O rbovic, V., Grosser, J.W., 2006. Citrus: Sweet orange (Citrus sinensis L. Osbeck trange [Citrus sinensis (L.) Osbeck x Poncirus trifoliata (L.) Raf.], in: K. Wang (ed.), Agrobacterium protocol Methods in Molecular Biology, Humana Press Inc, USA pp177 189. Padgett, H.S., Epel, B.L., Heinlein, M.H., Watanabe, Y., Beachy, R.N. 1996. Dist ribution of tobamovirus movement protein in infected cells and implications for cell to cell spread of infection. Plant J. 10, 1079 1099. Pappu, H.R., Karasev, A.V., Anderson, E.J., Pappu, S.S., Hilf, M.E., Febres, V.J., Eckloff, R.M.G., McCaffery, M., Boy ko, V., Gowda, S., Dolia, V.V., Koonin, E.V., Gumpf, D.J., Cline, K.C., Garnsey, S.M., Dawson, W.O., Lee, R.F., Niblett, C.L., the Citrus tristeza closterovirus genome. Virology 199, 35 46. Peremyslov,V.V., Hagiwara,Y., Dolja,V.V. 1999. HSP70 homolog functions in cell to cell movement of a plant virus P roc. Natl. Acad. Sci. U.S.A. 96, 14771 147 76. Ratcliff, F., MacFarlane, S., Baulcombe, D.C., 1999. Gene silencing without DNA: RNA mediated cross protection between viruses. Plant Cell, 11, 1207 1215. Roberts, A.G., Santa Cruz, S., Roberts, I.M., P rior, D.A.M., Turgeon, R., Oparka, K.J., 1997. Phloem unloading in sink leaves of Nicotiana benthamiana : comparison of a fluorescent solute with a fluorescent virus. Plant Cell 9, 1381 1396. Roberts, L.O., Groppelli, E., 2009. An atypical IRES within the 5 0 UTR of a dicistrovirus genome. Virus Res. 139, 157 165. Robertson, C.J., Garnsey, S.M., Satyanarayana, T., Folimonova, S., Dawson, W.O., 2005. Efficient infection of citrus plants with different cloned constructs of Citrus tristeza virus amplified in Nic otiana benthamiana protoplasts. Proc. 16th Conf. IOCV. IOCV, Riverside, CA, pp. 187 195. Roy, G., Weisburg, S., Rabindran, S., Yusibov, V., 2010. A novel two component Tobacco mosaic virus based vector system for high level expression of multiple therapeut ic proteins including a human monoclonal antibody in plants. Virology 405, 93 99 Snchez Navarro, J. A., Miglino, R., Ragozzino, A., and Bol, J. F. 2001. Engineering of Alfalfa mosaic virus RNA 3 into an expression vector. Arch. Virol. 146, 923 939.

PAGE 91

91 Sato M., Masuta, C., Uyeda, I., 2003. Natural resistance to Clover yellow vein virus in beans controlled by a single recessive locus. Mol. Plant Microbe Interact. 16, 994 1002. Satyanarayana, T., Bar Joseph, M., Mawassi, M., Albiach Mart, M.R., Aylln, M.A., Gowda, S., Hilf, M.E., Moreno, P., Garnsey, S.M., Dawson, W.O., 2001. Amplification of Citrus tristeza virus from a cDNA clone and infection of citrus trees. Virology 280, 87 96. Satyanarayana, T., Gowda, S., Aylln, M.A., Albiach Mart, M.R., Dawson,W.O. 2002a. Mutational analysis of the replication signals in non translated region of Citrus tristeza virus. Virology 300 140 152. Satyanarayana, T., Gowda, S., Aylln, M.A., Albiach Mart, M.R., Rabindram, R., Dawson, W.O. 2002b. The p23 protein of Citrus tristeza virus controls asymmetrical RNA accumulatio n. J. Virol. 76 473 483. Satyanarayana, T., Gowda, S., Aylln, M.A., Dawson, W.O., 2003. Frame shift mutations in infectious cDNA clones of Citrus tristeza virus : a strategy to minimize the toxicity of viral sequences to Escherichia coli. Virology 313, 48 1 491. Satyanarayana, T., Gowda, S., Aylln, M.A., Dawson, W.O., 2004. Closterovirus bipolar virion: evidence for initiation of assembly by minor coat protein and its restriction to 804. Satyan arayana, T., Gowda, S., Boyko, V. P., Albiach Marti, M. R., Mawassi, M., Navas Castillo, J., Karasev, A. V., Dolja, V., Hilf, M. E., Lewandowski, D. J., Moreno, P., Bar Joseph, M., Garnsey, S. M., Dawson, W. O., 1999. An engineered closterovirus RNA replic on and analysis of heterologous terminal sequences for replication. Proc. Natl. Acad. Sci. USA 96, 7433 7438. Satyanarayana, T., Gowda, S., Mawassi, M., Albiach Marti, M. R., Aylln, M. A., Robertson, C., Garnsey, S. M., Dawson, W. O., 2000. Closterovirus encoded HSP70 homolog and p61 in addition to both coat proteins function in efficient virion assembly. Virology 278, 253 265. Shivprasad, S., Pogue, G.P., Lewandowski, D.J., Hidalgo, J., Donson, J., Grill, L.K., Dawson, W.O., 1999. Heterologous sequences g reatly affect foreign gene expression in tobacco mosaic virus based vectors. Virology 255, 312 323. Siegel, A., 1983. RNA viruses as cloning vehicles. Phytopathology 73,775. Siegel, A., 1985. Plant virus based vectors for gene transfer may be of considerab le use despite a presumed high error frequency during RNA synthesis. Plant Mol. Biol. 4, 327 29.

PAGE 92

92 Takahashi, T., Sugawara, T., Yamatsuta, T., Isogai, M., Nat suaki, T., Yoshikawa, N., 2007. Analysis of the spatial distribution of identical and two distinct v irus populations differently labeled with cyan and yellow fluorescent proteins in coinfected plants. Phytopathology 97, 1200 1206 Takamatsu, N., Ishikawa, M., Meshi, T., Okada, Y., 1987. Expression of bacterial chloramphenicol acetyl transferase gene in to bacco plants mediated by TMV RNA EMBO J. 6, 307 311. Tatineni, S., Gowda, S., Dawson W.O., 2010. Heterologous minor coat proteins of Citrus tristeza virus strains affect encapsidation, but the coexpression of HSP70h and p61 restores encapsidation to wild type levels. Virology 402, 262 270. Tatineni, S., McMechan A.J., Hein G.L., French R., 2011. Efficient and stable expression of GFP through Wheat streak mosaic virus based vectors in cereal hosts using a range of cleavage sites: Formation of dense fluores cent aggregates for sensitive virus tracking. Virology 410, 268 281. Tatineni, S., Robertson, C. J., Garnsey, S. M., Bar Joseph, M., Gowda, S., Dawson, W. O., 2008. Three genes of Citrus tristeza virus are dispensable for infection and movement throughout some varieties of citrus trees. Virology 376, 297 307. Tatineni, S., Robertson, C. J., Garnsey, S. M.,Dawson, W. O., 2011. A plant virus evolved by acquiring multiple nonconserved genes to extend its host range PNAS 108, 17366 17371. Toth R L Chapman S Carr F Santa Cruz S ., 2001 A novel strategy for the expression of foreign genes from pla nt virus vectors. FEBS Lett. 489, 215 219 Turpen, T.H., Turpen, A.M., Weinzettl, N., Kumagai, M.H., Dawson, W.O., 1993 Transfection of whole plants from woun ds inoculated with Agrobacterium tumefaciens containing cDNA of tobacco mosaic virus. J. Virol. Meth. 42, 227 239. Van Vloten Doting, L., 1983. Advantages of multiple partite genomes of single stranded RNA plant viruses in nature, for research and genetic engineering. Plant Mol. Biol. 1, 55 60. Van Vloten Doting, L., Bol, J.F., Cornelissen, B., 1985. Plant virus based vectors for gene transfer will be of limited use because of the high error frequency during viral RNA synthesis. Plant Mol. Biol. 4, 323 326. Verch, T., Yusibov, V., Koprowski, H., 1998. Expression and assembly of a full length monoclonal antibody in plants using a plant virus vector. J. Immunol. Methods 220, 69 75. Verver, J., Wellink, J., Van Lent, J., Gopinath, K., and Van Kammen, A. 1998 Studies on the movement of cowpea mosaic virus using the jellyfish green fluorescent protein. Virology 242, 22 27.

PAGE 93

93 Walkerpeach C.R. and Velten J. 1994. Agrobacterium mediated gene transfer to plant cells: cointegrate and binary vector systems. In: Gelvin S. B. and Schilperoort R.A. (eds.), Plant Molecular Biology Manual, 2nd ed. Kluwer Academic Publishers, Dordrecht, Netherlands, pp. B1/1 B1/19. Woolaway, K.E., Lazaridis, K., Belsham, G.J., Carter, M.J., Robert, L.O., 2001. The 5 untranslated region of rhopa losiphum padi virus contains an internal ribosome entry site which functions efficiently in mammalian, plant, and insect translation system. J. Virol. 75, 10244 10249.

PAGE 94

94 BIOGRAPHICAL SKETCH Choaa A. El Mohtar was born and raised in Aramon ALey, Mount Leban on, Lebanon. He had his preliminary education at the International School of Chouiefat, Lebanon. His undergraduate and graduate studies were at the American University of Beirut where he gained a BS degree in Chemistry in 1997, BS in Agr iculture in 2001 and an MS degree in plant protection in 2003. The MS thesis work of Choaa was associated with the development of detection methods for the almond witches broom phytoplasma. After graduation Mr El Mohtar worked for two years as a research assistant in the plant protection department at the American University of Beirut. He was responsible for breeding and screening tomato and cucu mber cultivars for resistance again st T omato yellow leaf curl virus and C ucu rbit yellow stunt disorder virus C hoaa El Mohtar joined the University of Florida PhD program in June 2005 where he researched the deve lopment of a second generation C itrus tristeza virus based expression vectors.