<%BANNER%>

Identification of Alternatively Spliced Menkes Copper ATPase (Atp7a) Transcript Variants

Permanent Link: http://ufdc.ufl.edu/UFE0043521/00001

Material Information

Title: Identification of Alternatively Spliced Menkes Copper ATPase (Atp7a) Transcript Variants
Physical Description: 1 online resource (66 p.)
Language: english
Creator: Kim, Changae
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: alternatively -- atp7a -- atpase -- copper -- deficient -- iron -- menkes -- spliced -- trascript -- variants
Food Science and Human Nutrition -- Dissertations, Academic -- UF
Genre: Food Science and Human Nutrition thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The Menkes copper Atpase (Atp7a) protein is responsible for copper export from intestinal epithelial cells. The Atp7a gene is strongly induced in the small intestine of iron-deficient rats, suggesting an important physiological role during perturbations of iron homeostasis. Recent studies revealed novel 5? splice variants of the rat Atp7a transcript (1). Novel 5? splicing events have been documented but how those relate to potentially alternative transcripts is not clear. Methods: Forward and reverse primers were designed in the rat Atp7a gene, and RT-PCR was used to amplify different regions of the Atp7a cDNA, including the full-length transcript. Northern blotting was performed to quantify Atp7a mRNA expression in control and iron-deficient rats, and to identify the number of transcript variants that exist. Results: Full-length Atp7a transcripts containing the 5? splice variants were identified by PCR and Northern blotting. Northern blotting also clearly identified multiple Atp7a transcripts. Confirming previous qRT-PCR analyses, Northern blots showed increased Atp7a mRNA expression in iron deficiency. Conclusion: These results suggest the existence of multiple Atp7a transcripts in rat intestine, including full-length transcripts containing three 5? splice variants. Moreover, the induction of Atp7a gene expression was confirmed by a complementary method. Further research is important to confirm the existence of alternative Atp7a proteins encoded by these splice variants, and to determine their intracellular location and to characterize their functional properties.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Changae Kim.
Thesis: Thesis (M.S.)--University of Florida, 2011.
Local: Adviser: Collins, James Forrest.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043521:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043521/00001

Material Information

Title: Identification of Alternatively Spliced Menkes Copper ATPase (Atp7a) Transcript Variants
Physical Description: 1 online resource (66 p.)
Language: english
Creator: Kim, Changae
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: alternatively -- atp7a -- atpase -- copper -- deficient -- iron -- menkes -- spliced -- trascript -- variants
Food Science and Human Nutrition -- Dissertations, Academic -- UF
Genre: Food Science and Human Nutrition thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The Menkes copper Atpase (Atp7a) protein is responsible for copper export from intestinal epithelial cells. The Atp7a gene is strongly induced in the small intestine of iron-deficient rats, suggesting an important physiological role during perturbations of iron homeostasis. Recent studies revealed novel 5? splice variants of the rat Atp7a transcript (1). Novel 5? splicing events have been documented but how those relate to potentially alternative transcripts is not clear. Methods: Forward and reverse primers were designed in the rat Atp7a gene, and RT-PCR was used to amplify different regions of the Atp7a cDNA, including the full-length transcript. Northern blotting was performed to quantify Atp7a mRNA expression in control and iron-deficient rats, and to identify the number of transcript variants that exist. Results: Full-length Atp7a transcripts containing the 5? splice variants were identified by PCR and Northern blotting. Northern blotting also clearly identified multiple Atp7a transcripts. Confirming previous qRT-PCR analyses, Northern blots showed increased Atp7a mRNA expression in iron deficiency. Conclusion: These results suggest the existence of multiple Atp7a transcripts in rat intestine, including full-length transcripts containing three 5? splice variants. Moreover, the induction of Atp7a gene expression was confirmed by a complementary method. Further research is important to confirm the existence of alternative Atp7a proteins encoded by these splice variants, and to determine their intracellular location and to characterize their functional properties.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Changae Kim.
Thesis: Thesis (M.S.)--University of Florida, 2011.
Local: Adviser: Collins, James Forrest.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043521:00001


This item has the following downloads:


Full Text

PAGE 1

1 IDENTIFICATION OF ALTERNATIVELY SPLICED MENKES COPPER ATPASE ( ATP7A ) TRANSCRIPT VARIANTS By CHANGAE KIM A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Changae Kim

PAGE 3

3 To my wonderful husband w ithout his endless love, prayer, encouragement and support, none of this would be possible

PAGE 4

4 ACKNOWLEDGMENTS There are many people who were there for me to complete this task. Without them I would not have been able to finish this work. I would like to first thank my advisor Dr. James F. Collins. Dr. Collins gave me this wonderful opportunity to explore in the scientific world. He ha s taught me how to do bench work, and how to write and speak in a scientific manner. I will always be thankful that he was my mentor. I would like to thank Dr. Ranganathan for helping me around the lab. I would like to thank the members of my committee, Dr Mitchell Knutson, who would always challenge me and help me to think in depth and figure out the problem together. I also would like to thank Dr. Michelle Gumz, who was always there for me with warm heart, supporting me and encouraging me to finish stron g. I thank my lab members (Lingli Jiang, Sukru Gulec, Yan Lu, and Liwei Xie) for their assistance, encouragement, and friendship. Lastly, I would like to thank my friends and family for all their support and love.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 ABSTRACT ................................ ................................ ................................ ..................... 9 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 11 2 LITERATURE REVIEW ................................ ................................ .......................... 16 Introduction to Copper ................................ ................................ ............................ 16 Copper Homeostasis ................................ ................................ .............................. 17 Copper Intake and Requirement ................................ ................................ ...... 17 Copper Absorption ................................ ................................ ........................... 18 Copper Handling by Enterocytes ................................ ................................ ...... 19 Delivering to Liver ................................ ................................ ............................. 19 Copper Excretion ................................ ................................ .............................. 20 Iron Homeostasis ................................ ................................ ................................ .... 21 Iron Absorption ................................ ................................ ................................ 21 Iron in Liver ................................ ................................ ................................ ....... 23 Copper and Iron Interactions ................................ ................................ .................. 23 Menkes Copper ATPase ( Atp7a ) ................................ ................................ ............ 26 Specific Aims ................................ ................................ ................................ .......... 28 3 MATERIALS AND METHODS ................................ ................................ ................ 33 Overview of Study Design for Specific Aim s I and II ................................ ............... 33 Chemicals, Reagents, and qPCR Primers ................................ .............................. 33 RNA Isolation from Rat Intestinal Epithelial Cells (IEC 6 cells) and Spra gue Dawley (SD) Rats Intestine ................................ ................................ .................. 34 RT PCR Analysis Using the Rat Intestine and IEC 6 Cells Total RNA ................... 34 PCR Studies of Atp7a Spli ce Variants in Rat Intestine and IEC 6 Cells ................. 34 Column Purification and Cloning ................................ ................................ ............. 35 IEC 6 Cells Transfection with CFP Vector ................................ .............................. 37 qPCR to Confirm the Over Expression of Atp7a Full Length and Novel Splice Variants ................................ ................................ ................................ ............... 37 Northern Blot for Gene Expression of Differ ent Splice Variants and Identification of More Novel Splice Variants. ................................ ................................ ............ 38 End Labeling of Exon 1/1a, 1/2, and 1/3 Oligonucleotides ................................ .. 39

PAGE 6

6 4 RESULTS ................................ ................................ ................................ ............... 41 Identification of Different Splice Variants by Using PCR ................................ ......... 41 Verification of Known Splice Variants ................................ ................................ ..... 42 Gene Expression of Different Splicing Variants ................................ ...................... 43 5 DISCUSSION ................................ ................................ ................................ ......... 53 Spec ific Aim I ................................ ................................ ................................ .......... 53 Specific Aim II ................................ ................................ ................................ ......... 54 APPENDIX: SEQUENCE DATA FOR NOVEL SPLICE VARIANTS ............................. 57 REFERENCES ................................ ................................ ................................ .............. 61 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 66

PAGE 7

7 LIST OF TABLES Table page 2 1 Rat Atp7a primer sequence chosen for the PCR ................................ ................ 30

PAGE 8

8 LIST OF FIGURES Figure page 2 1 Process involved in a copper absorption ................................ ........................... 32 4 1 Assessment of RNA Quality. ................................ ................................ .............. 44 4 2 Amplification of Atp7a full length transcript. ................................ ....................... 45 4 3 PCR analysis of different sets of exons.. ................................ ............................ 46 4 4 RT PCR amplification using exon 1 forward primer in combination with various reverse primers. ................................ ................................ ..................... 47 4 5 Gene structure of novel Atp7a splice variants.. ................................ .................. 48 4 6 Amplification of full length Atp7a ....... 49 4 7 Determination of the number of different Atp7a transcripts.. .............................. 50 4 8 e nd l abeling of exon 1/1a, 1/2, and 1/3 ................................ .. 51 4 9 Gene expression under iron deficiency.. ................................ ............................ 52

PAGE 9

9 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment o f the Requirements for the Degree of Master of Science IDENTIFICATION OF ALTERNATIVELY SPLICED MENKES COPPER ATPASE (ATP7A) TRANSCRIPT VARIANTS By Changae Kim December 2011 Chair: James F. Collins Major: Food Science and Human Nutrition The Menkes copp er Atpase ( Atp7a ) protein is responsible for copper export from intestinal epithelial cells. The Atp7a gene is strongly induced in the small intestine of iron deficient rats, suggesting an important physiological role during perturbations of iron homeosta Atp7a transcript ( 1 ) potentia lly alternative transcripts is not clear. Methods: Forward and reverse primers were designed in the rat Atp7a gene, and RT PCR was used to amplify different regions of the Atp7a cDNA, including the full length transcript. Northern blotting was performed to quantify Atp7a mRNA expression in control and iron deficient rats, and to identify the number of transcript vari ants that exist. Results: Full length Atp7a transcripts containing rn blotting also clearly identified multiple Atp7a transcripts. Confirming previous qRT PCR analyses, Northern blots showed increased Atp7a mRNA expression in iron deficiency. Conclusion: These results suggest the existence of multiple Atp7a transcripts i n rat intestine, including full the induction of Atp7a gene expression was confirmed by a complementary method.

PAGE 10

10 Further research is important to confirm the existence of alternative Atp7a p roteins encoded by these splice variants, and to determine their intracellular location and to characterize their functional properties.

PAGE 11

11 CHAPTER 1 INTRODUCTION The metabolic link between iron and copper has been studied for decades. In fact, copper and ir on are known to interact with each other in many ways, including absorption and intracellular transport. In 1928, Hart et al uncovered the relationship between iron and copper, specifically discovering the role of copper in forming hemoglobin and in overco ming anemia. ( 2 3 ) Also, in 1980 there were studies on the effect of iron deficiency on copper metabolism during preg nancy and the interaction of these metals in pregnant animals ( 4 ) The results showed that iron deficiency caused an maternal diet de creased, the iron and copper liver levels also decreased ( 5 ) Furthermore, a rat study during the suckling period through adulthood showed that iron deprivation led to an increase of copper in enterocytes and liver ( 6 ) Further studies involving the metabolism of copper and iron may provide additional insight into the connection between these pathways and their physiological roles. There is a biological importance for humans and other mammals of iron contai ning proteins. Iron dependent proteins that contain neither iron sulfur clusters nor heme, transiently bind iron and facilitate its movement across the plasma membrane and intracellular membranes. In animals, iron sulfur cluster containing proteins are lin ked by a series of enzymatic steps, and they are important for cellular energy production. The primary function of heme iron is to be the oxygen carrying constituent of hemoglobin in erythrocytes and myoglobin in muscle tissue These two proteins exemplify the importance of iron in mammalian physiology.

PAGE 12

12 Iron physiology is important for normal homeostasis. On average, 3 to 4 g of iron is contained in an adult human. Approximately 2 g is found in the blood as hemoglobin iron. Iron is stored in liver, spleen and macrophages. Under normal circumstances, girls have 300 mg and women have 1000 mg of total body iron. Boys and men have higher amounts of stored iron with boys having 500 mg and men 1500 mg. However, under pathological conditions, iron stores can reach 40,000 to 50,000 mg ( 7 ) Iron is absorbed from the intestine or released into the circulation from macrophages during red blood cell (RBC) breakdown. After 120 days of circulation, senescent RBC, are scavenged and inge sted by cells of immune system, known as reticuloendothelial macrophages. These macrophages are mainly found in the spleen, liver and bone marrow. Macrophages of the reticuloendothelial system (RES) in these tissues recognize senescent RBCs, ingest them, breakdown hemoglobin, and recycle iron back into serum. Most of the iron used for hemoglobin synthesis is supplied to the plasma transferrin pool by the RES. The ferric form of iron in plasma is carried by transferrin. Transferrin is an 80 kDa glycoprotein consisting of a singly polypeptide chain and two N linked complex type glycan chains ( 8 ) The total amount of iron bound to transferrin in the plasma is about 3 mg. Approximately 70 90% of the iron on transferrin is delivered to the bone marrow for hemoglobin synthesis in RBC precursors. However, about 20 25 mg of iron must cycle through the transferrin iron compartment daily t o meet the ongoing needs of erythropoiesis. There are many known physiological roles of copper. Copper has an essential role in cross linking of collagen and elastin, which is required for the formation of strong, flexible connective tissue. The cros s linking of collagen is done by the copper

PAGE 13

13 dependent enzyme lysyl oxidase. Rat studies have shown that lysyl oxidase activity decreases during severe copper deficiency ( 9 ) Copper also plays multiple roles in the central nervous system. The r ole of cuproenzymes in catecholamine metabolism implies a function in normal neurotransmission ( 10 ) The role of copper in cardiac function has been s tudied in the past. Weanling rats deprived of copper showed cardiac symptoms but no symptoms were apparent in older rats. In one study, humans with copper deficiency were shown to have irregularities in heart function ( 11 ) Furthermore, there are several studies showing a role for copper in immune function. An animal study has shown that both low and high copper intakes influence immune function. Animals with severe co pper deficiency showed changes in T lymphocytes and T helper cells, B cells and monocytes, and interleukin 2 ( 12 ) There are other physiologic functional roles of c opper, and the effect of dietary copper needs to be further investigated in the future. On average approximately 1.3 mg/d of copper enters the body from the diet. Approximately 0.8 mg/d of copper is extracted from the diet and delivered to the liver. E xcretion occurs mostly through the copper exporter ATP7B into the bile. In liver, copper is incorporated into ceruloplasmin ( CP ) and other cuproenz ymes. CP is secreted into the circulation for copper delivery to cells of the body. Approximately 100 mg of t otal body copper content is distributed in various tissues, with most found in bone and muscle. Homeostatic control of body copper levels includes modulation of copper absorption in the intestine and copper excretion from the liver. The Menkes copper ATPa se ( Atp7a ) is a P type Atpase, which is expressed in intestinal epithelial cells (IEC 6), where it is important for copper efflux after dietary absorption. The Atp7a gene is strongly induced by iron deficiency in the rat intestine ( 6 )

PAGE 14

14 Iron homeostasis related genes (e.g. Dmt1 and Dcytb iron deficiency in the mammalian intestine. The Atp7a gene is also upregulated by a intestinal iron homeostasis ( 13 ) variants of Atp7a in rat intestine and intestinal e pithelial (IEC 6) cells ( 1 ) Utilizing an array of Atp7a antibodies, which were extensively validated, different Atp7a proteins were detected among proteins isolated from the membrane and cytosolic fractions. The specificity of the immunoreactions was confirmed by shRNA knockdown of Atp7a transcripts, with resulting attenuation of the bands detected in membrane preps (unpublished observation). Thus, alternative splici ng of the Atp7a transcript may lead to the production of novel protein variants in potentially different subcellular locations with distinct functions. Menkes disease is an X linked recessive disorder of copper deficiency. A primary defect in Menkes diseas e is the reduced transport of dietary copper across the basolateral membrane of enterocytes to hepatic portal circulation. The gene affected in patients with Menkes disease was identified in 1993 94 by several research scientists (16) The gene that underl ies this disease is called Atp7a. Atp7a is important for regulating copper levels in the body. In the small intestine, Atp7a protein helps control the absorption of copper from our diet. To verify novel splice variants and to determine the number of Atp7a transcripts, we used intestinal epithelial cells in culture and rats fed an iron deficient diet. We hypothesized that multiple Atp7a transcript variants exist and that some of them trategy to

PAGE 15

15 identify splice variants. Also, Northern blot analysis was utilized to detrmine the number of Atp7a transcripts and to quantify gene expression levels during iron deficiency.

PAGE 16

16 CHAPTER 2 LITERATURE REVIEW Introduction to Copper Copper is one of t he required trace elements in humans and is an essential nutrient for all organisms. Copper is found in the body in two transition states, the oxidized cupric ion (Cu 2+ ) and the reduced cuprous ion (Cu 1+ ). There are several inhibitors that affect copper ab sorption, including phylate, zinc in excess, iron, calcium/phosphorus and vitamin C. In the gut, copper is absorbed by enterocytes before distribution to the body ( 14 ) Dietary copper absorption is dependent on the exporter Atp7a. An error can occur where Atp7a is mutated or dysfunctional, which leads to Menkes disease. The genetic defect in this disease was identified in 1962 ( 15 ) but more detail of the physiological role was discovered by several research scientists more recently. Menkes disease is an X linked recessive disorder of copper deficiency, with a reported incidence of 1:10,000 live births ( 16 ) Patients with Menkes disease show dramatic developmental and neurological impairment due to disrupted delivery of copper to the brain. The majority of Menkes disease patients do not live past early childhood. Other symptoms t hat are caused by a decreased function of copper dependent enzymes are connective tissue abnormalities and lack of pigmentation. The dietary recommendation for copper was first introduced in 1980 ( 17 ) An Upper Tolerable Intake Level (UL) has also been established as an excessive amount of copper can potentially be toxic. Obervations from in vitro cell culture studies have shown that excessive copper can lead to the presence of free cuprous ions that readily react with hydrogen peroxide, forming the deleterious hydroxyl radical, which can

PAGE 17

17 damage DNA and other cellular biomolecules ( 18 ) Moreover, there are many other nutrients that can interact with copper and alter its cellular homeostasis. Copper Homeostasis Copper Intake and Requirement Dietar y reference intakes for copper were established almost a decade ago. The richest food sources of copper include shellfish, nuts, seeds, organ meats, wheat bran cereals, whole grain products, and chocolate foods. Other fruits and vegetables, chicken, many f ish, and dairy products contain relatively low concentrations of copper ( 19 ) Depending on individual food choices, copper intake can vary daily. The Third National Health and Nutrition Examination Survey showed that the median intake in the United States is approximately 1.0 to 1.1 mg/day for women and 1.2 to 1.6 mg/day for men ( 20 ) This survey shows th at healthy individuals are consuming higher amounts than the current RDA which indicates that in the United States, dietary copper requirements are met. The Dietary Reference Intakes (DRI) for copper were established in 2001 ( 21 ) The RDA for adult males and females is 0.9 mg/day. The RDA for pregnant women is 1 mg/day an d for lactating women is 1.3 mg/day. The DRI recommendations for children vary with age. Adequate intake (AI) for infants from 0 to 6 months of age is 0.2 mg/day and for infants from 7 to 12 months age is 0.22 mg/day. The Tolerable Upper Intake Limit (UL) for copper is 10 mg/day. This upper limit was created due to potential liver damage caused by excess copper. Haschke et al. have shown that infants consuming a diet high in iron may interfere with copper absorption ( 22 ) Infants fed a formula containing low concentrations of iron absorbed more copper than inf ants consuming the same formula with a higher iron concentration.

PAGE 18

18 Copper Absorption Our daily food intake is the main source of the copper for our bodies. The exact mechanism is not fully defined, but studies with animal models have begun to provide some basic information on the mechanism of copper absorption ( 23 ) 25 50% of copper found in the daily foods humans consume i s readily absorbed by the small intestine. When a deficiency in copper occurs, there is an increase in copper absorption and the opposite occurs when copper is in excess, causing a decrease in absorption. Dietary copper must be reduced from the Cu 2+ to the Cu 1+ state for transport across the apical membrane into enterocytes. Once reduced, the metal is likely transported into enterocytes via facilitated diffusion by copper transporter 1 (Ctr1). Ctr1 is a homotrimeric plasma membrane protein that was first di scovered in Saccharomyces cerevisiae and later characterized in mammals ( 24 25 ) The human form of Ctr1 (hCtrl) was identified by complementation of a yeast mutant (Ctrl1) that is defective in high affinity copper uptake. The toxicity of copper overload was more pronounced with overexpression of the Ctr1 gene in yeast ( 25 ) In the homozygous Ctr1 knockout mouse, a higher amount of copper was found in the intestine of the KO compared to the wild type mouse ( 26 ) which suggests that copper import can occur without Ctr1. Another possible transporter involved in copper absorption is divalent metal transporter (Dmt1). Dmt1 is known to transport iron across the apical membrane of enterocytes; Dmt1 can also transport Mn 2+ Cu 2+ Co 2+ Ni 2+ and Pb 2+ ( 27 28 ) Intestinal Caco 2 cell studies have shown the ability of Dmt1 to transport copper. Caco 2 cells were transfected with DMT1 antisense nucleotide, resulting in an inhibition of iron uptake by 80% and an inhibition of copper uptake by 47%. T his result suggested that DMT1 is the main iron transporter but that it also participates in copper transport

PAGE 19

19 ( 29 ) In a study of dietary iron deprivation, Dmt1 mRNA and protein levels were strongly induced ( 30 ) However, others have studied intestinal Cu import in Belgrade rats, a mutant rat with nonfunctional Dmt1, and des cribed a novel ATP dependent absorption process for copper ( 31 ) Copper Handling by Enterocytes Once copper is absorbed into the enterocyte, it is bound by chapero nes that deliver it to several cuproenzymes, copper binding proteins, or the copper export protein Atp7a. Atox1is a chaperone for the Menkes copper ATPase (ATP7a), which delivers copper to the trans Golgi network. Copper is transported out of enterocytes b y Atp7a or other unknown proteins. Once copper exits enterocytes, the oxidizing environment converts cuprous copper (Cu + ), which specifically interacts with Ctr1 and Atp7a, to cupric copper (Cu 2+ ), which binds to albumin or 2 macroglobulin for delivery in the portal blood to the liver (Figure 2) Delivering to Liver 2 macroglobulin is taken up by the liver, either for storage, mobilization into the peri pheral circulation, or excretion into bile. Some of the copper is incorporated into metallothionein (MT) in the liver of animals when copper intake is high, suggesting a role for MT in cellular detoxification ( 32 ) A large proportion o f hepatic copper is incorporated into ceruloplasmin (CP) within hours, which is excreted into the blood. Ceruloplasmin accounts for over 80% of the copper found in the circulation, and contains 6 atoms of copper in its structure. CP with its bound Cu is re leased from the liver into the blood and is delivered to cells with specific CP receptors on their surface. Ceruloplasmin binds to these receptors; the copper is reduced, dissociates from CP,

PAGE 20

20 and is released into the cell ( 33 ) Cp plays an important physiological role in iron release from sites of iron storage and in the central nervous system. Copper Excretion The primary route of copper excretion is through bile into the gastrointestinal tract. During copper loading, the Atp7b copper ATPase translocates to the biliary canalicular membrane for copper export and excreted copper combines with a small amount of c opper from intestinal cells, pancreatic and intestinal fluids, and unabsorbed dietary copper. This copper is then eliminated in the feces ( 34 ) Fecal copper is the major excretory route, and about 97% is lost, with only a small amount being reabsorbed. Healthy humans excrete only 10 to 30 g of copper per day in the urine, but urinary losses can increase markedly in some conditions, such as renal tubular defects ( 35 ) Other routes of excretion include saliva, hair, nails, and sloughed epithelial cells; however, they contribute little to total co pper loss. Atp7b also pumps copper into the trans Golgi network in hepatocytes for incorporation into apo ceruloplasmin prior to secretion into the peripheral blood system. The genetic defect of the Atp7b gene will utosomal recessive disease that causes abnormal copper storage in body tissues. Copper chelation therapy using D penicillamine is available for treatment of Wilson disease; this therapy is not always successful, especially if diagnosis is delayed and it m ay have severe side effects. When there is copper accumulation in the liver, brain and kidney, multi organ damage occurs, including liver dysfunction, movement disorders, cirrhosis, and neuropsychological abnormalities ( 36 )

PAGE 21

21 Iron Homeostasis Iron Absorption In our body, two thirds of the iron is found in hemoglobin within red blood cells (RBCs). RBCs circulate for 120 day s, and are ingested by immune system macrophages. These macrophages are found in the reticuloendothelial system (RES) which recognizes old RBCs, ingests them, and breaks down the hemoglobin. Furthermore, the RES liberates the iron and recycles it back into the bloodstream. Our dietary iron is absorbed in the upper small intestine, predominately in the epithelial cell layer of the duodenum and proximal jejunum. Iron is a dietarily essential transition element. Ferrous iron, Fe +2 is the biological form of i ron found in humans and other mammals. However, most of the food we consume contains the ferric form (Fe 3+ ), which is highly insoluble. Before it can be efficiently absorbed, the ferric iron needs to be reduced to the ferrous form (Fe 2+ ). Iron enters the p lasma bound to transferrin, which is involved in transporting iron between tissues and around the body. Transferrin will move to the duodenum, which is a major player in iron metabolism because this tissue is where iron is absorbed and delivered into the p ortal circulation. Circulating transferrin bound iron is taken up into cells by a cell surface transferrin receptor by endocytosis. The slightly acidic environment in the endosome releases Fe 3+ from transferrin, which is then reduced to Fe 2+ The Fe 2+ is t hen transported out of the endosome by divalent metal transporter 1 (DMT1). In the duodenal enterocyte, divalent metal transporter 1 (DMT1) is also the main transporter for intestinal iron uptake ( 37 ) A mutation of Dmt1 may cause iron deficiency anemia. In studies where Dmt1 was knoc ked out in the small intestine ( 27 ) and in rodents carrying

PAGE 22

22 spontaneous mutations in Dmt1 ( 38 ) animals were severely anemic. These findings suggest that Dmt1is likely the major route for iron transport into the enterocyte. One of the brush border reductases that can act on ferric iron is duodenal cytochrome b (D cytb) ( 39 ) Dcytb expression is highest in the proximal small intestine, and during iron deficiency or in hypoxia, its expression is enhanced by stimuli that increa se iron absorption ( 40 ) However, in a recent study, Dcytb knockout mice had no clear phenotype which shows that Dcytb is not essential for iron absorption ( 41 ) Other reductases may thus be involved ( 42 ) Absorbed iron then enters the labile iron pool along with any absorbed heme iron and is available for use by the cell or export out of the cell by ferroportin. Ferroportin (Fpn1) is the only know n exporter of iron and is required in order for iron to cross the basolateral membrane into the portal circulation. Ferroportin is induced by iron deficiency when iron absorption increases. The importance of Fpn1 has been shown by deletion of the gene in z ebrafish, mice, and by mutation of the gene in humans ( 43 45 ) Intestine specific knockout of Fpn 1 led to severe iron deficiency, and zebrafish lacking Fpn1 also showed severe iron deficiency. These findings suggest that Fpn1 is required for normal iron absorption. Iron efflux from the enterocytes also requires Hephaestin (Heph). In the small intestine, Heph plays a role as a major iron oxidase. Heph was identified by positional cloning as the gene mutated in the sex linked anemic ( sla ) mouse ( 46 ) Hephasestin has high homology to the plasma protein ceruloplasmin (CP). Heph shares with CP an ability t o bind copper and an ability to oxidize ferrous iron to ferric iron.

PAGE 23

23 Iron in Liver In iron metabolism, the liver plays an important role. Hepatocytes and Kupffer cells are the long term depository for iron. Most importantly, the liver synthesizes hepcidi n (Hepc) and secretes it into the circulation to regulate systemic iron metabolism. Hepc is a negative regulator of iron absorption in the gut and iron release from storage sites. When body iron increases, the liver produce s hepcidin, causing ferroportin t o be internalized and degraded by interaction with Hepc, which in turn inhibits iron transport across the intestinal epithelium into the portal blood ( 47 ) In one study using mice that lacked Hepc, the animals developed significant iron overload ( 48 ) This result demonstrates that hepcidin is inversely related to body iron i ntake. Furthermore, a study where mice were engineered to overexpress hepcidin showed that these mice developed a severe iron deficiency anemia ( 49 ) This result s howed that hepcidin was a repressor of iron absorption, so iron absorption is increased when hepcidin levels are reduced as in iron deficiency Copper and Iron I nteractions Dietary iron and copper are absorbed in the duodenum, where interaction occurs. On ce copper is in the cell, it is delivered to Atp7a. During iron deficiency there is increased metallothionein (MT) mRNA expression and Atp7a mRNA and protein expression, which suggests that copper absorption, may be increased during states of iron deficien cy. Absorbed copper is transported by albumin or 2 macroglobulin in the portal blood to the liver. In liver, copper is incorporated into the ferroxidase, ceruloplasmin (CP), or excreted into the bile. In order for iron to be released efficiently from hepatocytes and other tissues, CP is required. Result s in CP KO mice have shown that iron accumulates in hepatocytes ( 50 ) Copper is released from the liver bound to

PAGE 24

24 CP. Ceruloplasmin functions to deliver copper to other organs and tissues, and as stated it is also important for iron r elease from certain tissues. Iron bound to TF delivers iron to the bone marrow for red cell hemoglobin production; iron utilization by these cells is copper dependent. Even though copper deficient mice have sufficient amounts of plasma iron, the mice still become anemic because copper deficiency affects iron utilization by erythroid cells. This defective iron utilization may affect hemoglobin synthesis. Iron is also taken up by other tissues, but in brain, iron release is dependent upon glycosylphosphatidyl inositol linked CP (PI CP). In rats given a copper deficient diet, the iron concentration is lower in brain ( 51 ) Iron contained within erythrocytes is recycled to reticuloendothelial (RE) macrophages. The release of iron from RE macrophages is a coppe r dependent process, again involving CP and GPI CP ( 42 ) Moreover, dietary copper deprivation causes CP deficiency, which causes iron to accumulate in the RE cells ( 50 ) This CP deficiency in RE macrophages highlights the recent discoveries of the connection between copper and iron. The discovery of genes and gene mutations involved in the metabolism of copper and iron will provide an impo rtant key to a deeper understanding of the connections between the pathways, and their physiological and pathological consequences. The connection of copper and iron was reported in 1928 by Hart, Elvehjem et al. ( 2 ) They first showed that copper can facilitate he moglobin formation and overcome anemia. In 1932, the retention of iron and its partition between the hemoglobin and the tissues was studied in rats. The rats were fed milk alone or 0.5 mg of iron per day or 0.1 mg/day of Cu was added to the milk. The resul ts showed, when extra iron was given, it was divided between hemoglobin and the tissues. When extra copper was given, a large

PAGE 25

25 amount of the retained iron went to the bone marrow for hemoglobin formation and the tissue iron was reduced ( 52 ) suggesting that copper has no effect on iron retention. A recent review highlights current advances in iron copper interactions for regulating iron and copper homeostasis ( 42 ) During iron deficiency increases of copper in enterocytes has been noted. An in vivo study has shown increased mRNA expression of metallothionein (MT) and Atp7a mRNA in rats that were fed an iron deficient diet ( 1 6 ) again suggesting increased copper content in intestinal enterocytes. A monolayer of polarized Caco2 ce lls, which models intestinal mucosa, was used to compare the effects of Fe 2+ and Cu 2+ on cellular uptake and overall transport. The depletion of cellular iron or copper have increased uptake of both metal ions, and also enhanced overall transport of iron f rom the apical to the basal chamber. This study suggested that perhaps copper availability in some way influences the expression of transporters associated with basolateral iron transport ( 23 ) In iron deficient rat intestine, the Atp7a gene is strongly induced, suggesting increased copper absorption by enterocytes ( 6 ) The relationship between iron and copper absorption and storage has been studied for decades. In one study, rats were fed a milk diet deficient in both Fe and Cu, and replenished with either copper or physiological s aline solution. This study showed that rats that were administered copper had a significantly higher concentration of iron in the plasma than the group given saline. This result supports the theory that copper is necessary for the release of iron from stor age sites ( 53 ) Moreover, a current study utilizing gene chip analyses revealed genetic changes in the duodenum during iron deficiency. The results showed that several different genes were induced, and one of the most interesting genes was the

PAGE 26

26 Menkes copper ATPase ( Atp7a ) ( 54 ) A tp7a may be involved in the hepatic copper loading observed during iron deficiency and might play important roles in overall body iron homeostasis ( 30 ) In a rat stu dy from the suckling period through adulthood, novel genes involved in iron absorption during iron deficiency were identified. In this study, Menkes copper ATPase ( Atp7a ) showed strong induction in iron deprived rats of all ages examined, which provided ev idence that may explain copper loading in the iron deficient state ( 6 ) The induction of Atp7a in iron deficiency was also replicated in an in vitro model, IEC 6 ce lls. Three splicing variants were shown to be strongly induced during iron deprivation in these cells ( 1 ) These ongoing discoveries provide an important key to a de eper understanding of connection between iron and copper. Menkes Copper ATPase ( Atp7a ) The Menkes Copper ATPase gene is P type Atpase that delivers copper to cuproenzymes in the secretory pathway and is used for cellular copper export. Dierick et al. repo rted a detailed molecular analysis of the genomic structure of the Menkes disease gene. There are 23 exons in Atp7a covering a genomic region of approximately 140 kb ( 55 ) This Menkes P type ATPase is predominantly localized t o the trans Golgi apparatus of cells. Atp7a continuously recycles between the Golgi and the plasma membrane when copper efflux occurs. Based on the dynamic role of the trans Golgi network in cellular protein trafficking, we can further understand the role of Atp7a in copper efflux from the cell ( 56 ) However, there are many splice variants that are found during genetic m utations and splicing of normal physiological relevance. Gene splicing occur in eukaryotes, prior to mRNA translation, by the differential inclusion or exclusion of region of pre mRNA. Gene splicing is an important source of protein diversity. The pre mRNA transcribed

PAGE 27

27 from one gene can lead to different mature mRNA molecules that generate multiple functional proteins. Splice variants can be trafficked to different places and can function differently under different circumstances. Gene splicing enables a sin gle gene to increase its coding capacity, allowing the synthesis of protein isoforms that are structurally and functionally distinct. Studies have verified that three splice variants of Atp7a are found in rat intestinal epithelial cells ( 1 ) Alternative splicing is now thought to affect more than half of all human genes ( 57 ) Protein function can be regulated by the removal of interaction or localization domains by alternative splicing. Also, this process can regulate gene expression by splicing transcripts into unproductive mRNAs targeted for degradation. Splicing variants can thus be thought of as on/off switches that can regulate gene expression ( 58 ) By affecting regions involved in interaction or localization, alter native splicing may generate alternative protein isoforms that could play key regulatory roles ( 57 ) Alternative splicing machinery is thus an efficient tool for pr otein and gene expression regulation. During genetic mutations in humans and rats, Menkes disease often presents splicing mutations associated with partial skipping of the exons ( 59 ) After amplifying cDNAs from different human cell lines, sequence analysis revealed that multiple transcripts of Atp7a w ere present. One of the splice variants was 5 kb and it was missing exons 3 15 ( 60 ) This splice variant was considerably smaller than the 8.5 kb full length Atp7a mRNA ( 55 ) Also, there is splicing variant study using a mouse model. Mice hemizygous for the blotchy allele of the X linked mottled locus have similar connective tissue defects

PAGE 28

28 known as occipital horn syndrome (OHS) and may represent a mouse model of this disease. This disease also has abnormal of copper transport and is known to be allel ic to Menkes disease. This study with blotchy mice showed that northern blot analysis revealed the presence of three transcripts, one of normal size and two > 8.4 kb mRNA ( 59 ) In addition, by screening patient samples for mutations by RT PCR and by the chemical cleavage mismatch technique, Das et al. re cently identified 10 different mutations associated with classic Menkes disease. Splicing of normal physiological relevance in the Atp7a transcript was detected in were discovered ( 1 ) These observations lead to the conclusion that Atp7a protein variants may exist, with potentially different intracellular locations and distinc t physiological functions. Many scientists are finding different splicing variants, yet characterization of these variants has not been completed in many cases. Uncovering what factors control splicing could be critical to provide additional insights into the mechanism of copper and iron homeostasis. Importantly, our preliminary studies have indeed identified different sized Atp7a immunoreactive proteins, using an array of Atp7a antibodies and shRNA knockdown in IEC 6 cells with concomitant reduction of t he immunoreactive proteins shown with western blotting (Lu, Y. & Collins, J. unpublished data). These current studies were thus designed to identify the transcript variants that encode these proteins, and to determine the total number of transcript variant s that exist in intestinal epithelial cells. Specific Aims Specific Aim 1: Identifying different transcripts is an important step to verify the existence of novel splice variants. A complimentary PCR based approach using Exon 1

PAGE 29

29 forward and exon 23 reverse primers was completed to produce the full length Apt7a transcript. Also, a PCR based approach using different primer sets (Table 2) was completed to identify more novel splice variants. An alternative PCR based approach using Ex1 1A/23, Ex1 2/23, and Ex1 potential splice variants. Specific Aim 2: In order to determine the number of transcripts that exist in intestinal epithelial cells and whether Atp7a mRNA is regulated by iron status in vivo the Northern blot technique was used. Total RNA was purified from rat duodenual mucosa and IEC 6 cells, and separated by gel electrophoresis. Probing was done using a non radioactive technique using a full length Atp7a cDNA clone to produce random prime labeled probes ddUTP probe was done. As some transcripts may be similar in size, different percentage gels were used and some gels were run for longer periods of time to separate large mRNA molecules of similar mol ecular weight.

PAGE 30

30 Table 2 1. Rat Atp7a primer sequence s chosen for the PCR Exons Forward Exon 1 AGGCTGCGTGCTGGTTGATC Exon 2 GGAATGTAAAGACATCAAAATGGAACC TTAATGTGATGGACACCATTCACTTTC Exon 3 ACTTCAGACTCCAAAGACCCTCCA AA TGCGTTGTACACCTTGCAGCT Exon 4 CAGCATCAAATCCCATGTCTTCAA Exon 5 AGCCACTGGTCGTGATAG CTCAG Exon 6 AATGCCATTGCCTTCTCCAGC Exon 7 TGACGTGTGCCTCCTGTGTCC Exon 8 TTATGATCTAAGTGGTTGGCTGATCG Exon 9 GGACTGATGATCTATATGATGGTTATGGA Exon 10 CTTCGCTATGTGTTCCAGCCATC Exon 11 AAGCTAATTTCCTTACAAGCAACAGAAG Exon 12 GAAGAACAAGTGGATGTGGAACT TGTA GGACTCGTCTACCATAGAATGCCC Exon 13 CCTGTGGCTAAGAAACCTGGCA TGATGTCTGTGCCTCCTCTACAAGTT Exon 14 GGAAAGTAGGCTTCCACAATTTCAA Exon 15 GCTACAACAGAAGCATCTCCCGA Exon 16 TCCTAAAGGATGTTCACTGTTACTTTCTG Exon 17 GTACCTGCACAGATTTCCAGGTTGTA Exon 18 TTCTGCT CTTCCTGTATTAGATGAACTGT CTGAGAAGCAATAGACCGAGCTGTT Exon 19 Exon 20 AGCTGCTTCGATGGCTACATCTG Exon 21 TGACCTTCTGGATGTTGTGGCA Exon 22 AGTACCACAGAGACAGATGAAGCGG Exon 23 ACATAATGCCAGGTTCAGAGCTCC 3'end revII CAGTGTGGTGTCGTCATCTTCCC Exon 1/1A TG GAATCCTAGACAGAATCTCACTAT Exon CCTGGAATCCTAGGAATGTAAAGACA

PAGE 31

31 Table 2 1 Continued Exons Forward Full length for Primer walking ACCTCAAATTGGGAGCCATTGA ACAAGACCATTTCTAATCATCCATTCC Full length2 for primer walking ATCAGCACCACTAGATCATAAACGAA TTAGGAGTTACATAGTGCTCTGTGCT

PAGE 32

32 Figure 2 1 Process involved in a c opper absorption Shown in this diagram is a single enterocyte, with the processes that are involved in copper absorption from the diet. Dietary copper is first reduced and then transported across the apical surface by copper transporter 1 (ctr1). Once copp er enters the cytoplasmic pool, it is rapidly bound to chaperones for distribution to various cellular compartments. Copper chaperone atox1 delivers copper to the menkes copper transporting atpase (atp7a) in the trans golgi network (tgn). In the tgn, coppe r is incorporated into copper containing proteins bound for the secretory pathway, including hephaestin (hp), a multi copper ferroxidase that is important to oxidize transported iron on the basolateral surface for binding to transferrin. Under the conditio ns of copper excess, atp7a trafficks to the basolateral membrane and functions in copper export. Once cuprous copper exits cells, it spontaneou macroglobulin for transport through the portal blood to the liver. The copper export process may also be increased during iron deficiency, as atp7a expression is strongly induced.

PAGE 33

33 CHAPTER 3 MATERIALS AND ME THODS Overview of Study Design for Specific Aims I and II For specific aim 1, once intestinal epithelial cells (IEC 6 cells) reached 70 80% confluency, RNA isolation was completed. Using total RNA, RT PCR analysis was performed in a BIORAD Thermal Cycler. The forward primers and reverse primers were designed using PREMIER Biosoft NetPrimer, and by using different combination sets of primers, PCR was completed. The amplicons were visualized by agarose gel electrophoresis and PCR products were column purified Purified PCR products were subcloned into T/A vectors and sequenced. Sequences were compared with databases to align the sequences with known cDNAs. For specific aim II, the same IEC 6 cells from specific aim I were used. Sprague Dawley rats were used as our animal model. The rats were fed control or iron deficient diets and mucosal scrapes were obtained after euthanization. RNA isolation was completed and total RNA was electrophoresed in different percentage agarose gels. The Northern blot procedure was completed next using ROCHE DIG high prime DNA labeling and detection starter kit II protocol. Also, ddUTP was done. Chemicals, Reagents, and qPCR P rimers Chemicals were obtained from Invitrogen, Fisher Scien tific, Fermentas, and Sigma Aldrich, and were of analytical grade or high purity. T/A cloning products were from Promega, Madison, WI. qPCR primers were from IDT, Coralville, IA. Other sources are mentioned as appropriate.

PAGE 34

34 RNA Isolation from Rat Intestina l Epithelial C ells (IEC 6 cells) and Sprague Dawley (SD) Rats I ntestine All animal studies were reviewed and approved by the University of Florida IACUC. Male SD rats were obtained at 3 wks of age and were placed in wire mesh bottom cages, 1 2 animals per cage. Rats were fed AIN 93G diets (Dyets, Bethlehem, PA) that were either control (198 ppm Fe), or low iron (~3 ppm Fe). When rats were ~8 wk of age, they were euthanized and mucosal scrapes were taken from ~20 cm of the proximal small intestine. RNA was p urified from mucosal scrapings and IEC 6 cells with Trizol reagent (Invitrogen, Carlsbad, CA), and quality was confirmed by agarose gel electrophoresis. RNA was quantified by a BIORAD NanoPhotometer. RNA samples were either fresh or stored in ethanol at 8 0 o C until use. RT PCR Analysis Using the Rat Intestine and IEC 6 Cells T otal RNA To synthesize first strand cDNA from total RNA, five micrograms of total RNA was reverse transcribed with SuperScript III First Strand Synthesis System for RT PCR (Invitrogen Carlsbad, CA). Olidgo(dT) primer was used, and we followed the protocol provided by Invitrogen. Synthesized cDNA were either fresh or stored at 20 o C until use. PCR S tudies of Atp7a Splice Variants in Rat Intestine and IEC 6 C ells To verify the presenc e of the detected splice variants and to determine novel as follows: Forward primers were designed in rat Atp7a exons 1, 2,3,5,7,9,11,12,13,15,17,18,and 21. Reverse prime rs were designed in rat Atp7a exons 2,3,4,6,8,10,12,13,14,16,18,20, 22, 23. (Table 2). Forward primers were also designed in rat Atp7a that bound to the exon 1/exon 1a junction; exon 1/ exon 2 junction; exon 1/

PAGE 35

35 3 junction. These 3 primers were used with a n exon 23 reverse primer, to verify the presence of the de tected splice variants in full length transcripts. All other primers were used in combination with a single forward primer and a single reverse primer, and all primers were designed to have similar melting temperatures. Two microliters of the cDNA reaction was used with Takara Ex Taq polymerase (Japan). Reactions were run in 200 microliter PCR tubes with the following cycling parameters: 9 4 o C for 2 min, 45 cycles with 9 4 o C for 30 s, 58 o C for 30 s 72 o C for 4.5 min and then 72 o C for 10 min. The final PCR products were visualized by agarose gel electrophoresis. Exon 1 forward and exon 23 reverse primer se t was used to amplify th e full length sequence for a template to generate probes for Norther n blotting. Using the PCR products, cloning was done using the TOPO Cloning Kit (Invitrogen). Following ligation, transformation was completed using One Shot Top10 chemically competent cells (Invitrogen). 200 l of transformation products were spread on am picillin plates containing IPTG/ Xgal and incubated overnight at 37 o C White colonies were chosen and removed from plate; these were grown in 5 ml LB medium overnight at 37 o C. The colonies were purified using the PureYield Plasmid Miniprep System (Prome ga). From these plasmid preps, 2 g was sent out for sequencing to the University of Florida DNA Sequencing Core. A series of forward and reverse primers was used to sequence the full length Atp7a cDNA fragment in its entirety by a primer walking strategy (Table 2). Column Purification and C loning To clone the PCR product, A tailing reaction was done as follows. 0.5 l dNTP and 2.0 l Taq polymerase was added and the mix was incubated at 37 o C for 15 min. Following the A tailing reaction, column purificat ion was performed by using GeneJet

PAGE 36

36 PCR Purification Kit (Fermentas). The purification protocol provided by Fermentas was used. During the step of adding elution buffer, 30 l of elution buffer was used. Following the purification, PCR amplicons were subclo ned using a pGEM T cloning vector (Promega). The cloning was done according to the procedure of pGEM T Vector were prepared before making competent cells. The composition o f the TFBI buffer was as follows: 30 mM KAc, 100 mM KCL, 10 mM CaCl 2 50 mM MnCl 2 and 15% glycerol. To sterilize, TFB I was filtered through a 0.22 m filter unit (MILLIPORE) and stored at 4 o C. The composition of the TFB II buffer was as follows: 10 mM Na Mops (pH 7.0), 75 mM CaCl 2 10 mM KCl, and 15% glycerol. The buffer was autoclaved and store at 4 o C. First, the bacterial cells were streaked on a new LB plate and incubated overnight at 37 o C. Isolated colonies were selected and cells were precultured in 5 ml LB broth overnight at 37 o C. Next, 1 ml of cultured cells were inoculated into 100 ml LB broth and incubated for 2.5 3.0 hours at 37 o C, using a shaking incubator. The cells were asceptically transfered to sterile, ice cold 40 ml centrifuge tubes, and the cultures were cooled to 0 o C by storing the tubes on ice for 5 min. Next, the cells were centrifuged at 4500 x g for 10 min. at 4 o C. The media was decanted from the cell pellets. The pellets were then resuspended in 10 ml of ice cold TFB I and st ored on ice for 10 min. Once again, the suspension was centrifuged at 4500 x g for 10 min at 4 o C, and the buffer was decanted from the cell pellets. The pellets were resupsended in 4 ml of ice cold TFB II and stored for 15 min. on ice. 100 l of this susp ension was aliquot into prechilled tubes and frozen in on dry ice. Finally, the samples were stored at 80 o C for future use. Cloned PCR

PAGE 37

37 products were sequenced utilizing vector specific primers. Sequences were compared with databases to align the sequence s with known cDNAs (BLAST). IEC 6 Cells Transfection with CFP V ector We next sought to overexpress full length Atp7a transcripts by transfecting IEC 6 cells, because these cells have been described to be a suitable in vitro model. IEC 6 cells were cultur ed under standard conditions in a humidified incubator in the presence of 5% CO 2 at 37 o C. Cells were grown in six well plates and transfection was performed when they had reached ~70% confluency. For cell transfection, TurboFect in vitro Transfection reag ent (Fermentas) was used. In each well, 4 g of DNA was diluted in 400 l of serum free 1X DMEM, 6 l of Turbofect was added and cells were incubated with this mixture at 37 o C for 36 to 48 hours in a CO 2 incubator. qPCR to Confirm the Over E xpression of Atp 7a Full Length and Novel Splice V ariants The same primer sets were used as described above. Primers that amplified 18S rRNA were utilized as constitutive controls. RNA was purified from IEC 6 cells. RNA was converted to cDNA with the BioRad iScript kit in a 20 l reaction with one g of RNA. 2 l of the cDNA reaction was used with 10 l of SYBR Green master mix (BioRad) and 0.75 l of each primer (3.33 pM each) in a 20 l reaction. PCR cycling parameters were 50 o C for 2 min, 95 o C for 8.5min, and 42 cyc les with 95 o C for 30 s and 60 o C for 1 min. Each RT reaction was analyzed in duplicate for 18S rRNA and Atp7a of IEC 6 cells.

PAGE 38

38 Northern Blot for Gene Expression of Different Splice Variants and I dentification of More Novel Splice V ariants. Northern blot a nalysis was performed according to the procedure of DIG High Prime DNA labeling and Detection Starter Kit II from ROCHE. Five micrograms of total RNA was electrophoresed in different percentages of agarose in 1X MOPS buffer containing 2% formaldehyde. Aft er separation, the gel was soaked in 20X SSC twice for 15 minutes. Capillary transfer was allowed to proceed overnight in 20X SSC. The following day, the RNA was crosslinked onto a nylon membrane in a XL1000 UV Generation of DIG labeled probes was performed using the DIG High Prime DNA Labeling and Detection Starter Kit II (ROCHE) with 1 microgram of template DNA. The template DNA was the full length Atp7a cDNA cut out of t he plasmid vector and gel purified. The production of the full length Atp7a cDNA is described above. The template DNA was diluted into double distilled water to a final volume of 16 l in a reaction vial, and heated in boiling water for 10 min. The DNA wa s snap cooled on ice for 1 min and then added to the reaction tube. Four microliters of DIG High Prime (ROCHE) labeling mixture was added and mixed into the tube by pipetting. The reaction was incubated at 37 o C for 5 hours and then stopped by addition of 2 l 0.2 M EDTA. A nylon membrane containing the RNA samples to be probed was prehybridized in DIG Easy Hybridization (ROCHE) solution at 42 o C for at least 30 min. The labeled probe DNA was denatured in boiling water for 5 minutes and then added to the hy bridization tube. Hybridization continued overnight at 42 o C The following day, blots were washed at 42 o C two times for 15 minutes in a wash solution (2X SSC, 0.1% SDS) in a shaking water bath, and subsequent washes were at 68 o C two times for 15 minutes (0.5X SSC, 0.1% SDS) also

PAGE 39

39 in a shaking water bath. Following the washes, blots were exposed to Blue Basic Autorad film for the appropriate length of time. To determine the band size on films, the RNA ladder bands in the gel were measured from the top of t he gel and a standard curve was made. Next, the distance that the band traveled on the film was measured and compared against the standard curve to estimate the size. End L abeling of Exon 1/1a, 1/2, and 1/3 Oligonucleotides process of labeling oligonucleotides with digoxigenin ddUTP TCGAACCCCAGCCCTGGAATCCTAGACAGAATCTCACTATGTCACCTATG TCGAACCCCAGCCCTGGAATCCTAGGAATGTAAAGACATAA AAATGGAAC CCCAGCCCTGGAATCCTAGGTTTCCCTAGAAGAAAAAAGTGCAACTGTTA End Labeling Kit, 100 pmol of oligonucleotide was added to sterile double distilled wate r to make a final volume of 10 l. The tube was placed on ice and the following reagents were added: 4 l of reaction buffer, 4 l of CoCl 2 solution, 1 l of DIG ddUTP solution and 1 l of terminal transferase. Samples were mixed, centrifuged briefly and i ncubated at 37 o C for 15 min. After the incubation, samples were kept on ice. 2 l of 0.2 M EDTA was added next to stop the reaction, followed by hybridization to the membrane. 20 ml of DIG Easy hybridization solution was preheated. The blot was incubated in heated hybridization solution for 30 min. 5 pmol of the end labeled probe was added in 3.5 ml of fresh DIG Easy hybridization solution. The prehybridization solution was poured off and the probe/DIG Easy Hybridization mixture was immediately added to th e

PAGE 40

40 membrane. The mixture was incubated with gentle agitation for 13 hours at 43 o C There were two step post hybridization washes. First, the membrane was washed 2 times for 5 min in 2 X SSC + 0.1% SDS at 42 o C Next, the membrane was washed 2 times for 15 min in 0.5 X SSC + 0.1% SDS at 68 o C There was constant agitation while the membrane was being washed. After the washes, blots were processed identically as described in the previous section.

PAGE 41

41 CHAPTER 4 RESULTS Identification of Different Splice Vari ants by Using PCR In order to identify different splice variants, we designed different forward and reverse primer sets and used them for RT PCR (Table 2). First, the quality of the RNA was assessed by loading 2 g of total RNA into a 1% agarose gel. The g el confirmed that the R NA was of high quality (Figure 4 1A). Moreover, 18S rRNA was analyzed to provide further e vidence of RNA quality (Figure 4 1B). Furthermore, exon 1 forward and exon 3 reverse primers were us ed to examplify successful prod u c tion of th e cDNA; this end of the Atp7a transcript was successfully amplified demonstrating the quality of the cDNA produced (Figure 4 1C). To amplify the Atp7a full length transcript, IEC 6 cell cDNA was used for RT PCR with exon 1 forward an d exon 23 reverse primers. The size of the full length Atp7a transcript is approximately 4.6 kb, which was confirmed by agarose gel electrophoresis (Figure 4 2). Moreover, by using different forward and reverse primer sets, PCR demonstrated that exon 1 6 amplification produced multiple bands (Figure 4 3 A). Also, exon 7 10, 13 16, 17 20, 18 22, and 21 23 amplification showed multiple bands (Figure 4 3 B). The common forward and reverse primers were used here as a positive control. This procedure was done usi ng RNA purified from IEC 6 cells. By using RNA from rat reverse primers. Exon 1 6, 1 8, 1 10, 1 12 and 1 14 amplification showed m ultiple bands (Figure 4 4 A). Furthermore, a gain by using RNA from IEC 6 cells, additional PCR 20, 1 22, and 1 23 amplification showed multiple bands. After cutting out each band from the

PAGE 42

42 gels, amplicons from exon 1 23 wer e cloned into a T/A vector and sent out for sequencing (Figure 4 5 ). These PCR experiments showed that there are potentially several different splice variants of the Atp7a transcript. Verification of Known S plic e V ariants A previous study in rat intestine and intestinal epithelial cells in culture revealed splice variants of Atp7a ( 1 ) The current studies were thus d esigned to verify the existence of these alternative splice variants. The previously identified gene structure and the relative location of PCR primers used are shown in (Figure 4 6 ). The exon 1/1a, 1/2, and 1/3 primers were xons (Table 2 1 ). Using these prime rs with exon 23 reverse primer, PCR indicated three solid bands (Figure 4 6 B). These were sub cloned and sent out to be sequenced to confirm that these are the correct gene. A different technique was also used to ident ify more novel splice variants. Total RNA was isolated from SD rat mucosal scrape. The rats were either on a control diet or iron deficient diet. To measure the size of the different bands, a standard curve was made by using an RNA ladder (Figure 4 7 A). Th e total RNA was loaded in the gel and transferred to a nylon membrane. The blot was probed with Atp7a full length, and the blot showed different sized bands (Figure 4 7 B). Exon 1/1a, 1/2, and 1/3 oxigenin ddUTP. In control experiments to validate probe labeling, the film revealed the intensity of the spots to determine the amounts of DIG labeled oligonu cleotide in our sample s (Figure 4 8 A). T otal RNA was loaded o n the gel and transferred to a nylon membrane. The blot s were probed with either full length Atp7a probes or oligonucleotide s ( ex1/1a,

PAGE 43

43 1/2, and 1/3 ) ; although there is a lot of background, an identical p attern was observed using full length probe vs. the different oligonuceloti des (Figure 4 8 B). Gene Expression of Different Splicing Variants A previous study using qRT PCR has shown that the Atp7a gene is strongly induced by iron deficiency in the rat intestine ( 6 ) By performing Northern blots, we were able to confirm the induction of the Atp7a gene in iron deficient rats (Figure 4 9 A). Sprague Dawley rats were fed control or low iron diets and RNA was purified from mucosal scrapes Eq ual loading of the RNA was assessed by using UN SCAN IT gel Gel Analysis Software of the image of the RNA gel (Figure 4 9 A). Moreover, rats on control or iron deficient diets and IEC 6 cells were used to quantify Atp7a mRNA expression. The film clearly ind icates induction of Atp7a mRNA expression in iron deficient rat. Also, the IEC 6 cells and iron deficient lanes show different size bands (Figure 4 8 B). This experiment clearly indicates the induction of the Atp7a gene when comparing the control and iron deficient rats (Figu re 4 8 )

PAGE 44

44 A B C Figure 4 1. Assessment of RNA Quality. Total RNA was isolated from IEC 6 cells: Panel A, 2 g of total RNA in agarose gel. Panel B, duplicate of 18s and exon 1 forward and 3 reverse amplication curve from qRT PCR showing the RNA integrity. Extensive studies in our lab had shown that intact RNA Ct value is between 18 and 20. Panel C, qRT PCR using exon 1 forward and exon 3 reverse primer set, indication of successful cDNA synthesis as this is from the e Atp7a transcript.

PAGE 45

45 Figure 4 2. Amplification of Atp7a full length t r anscript. PCR analysis of full length Atp7a from IEC 6 cells. Primer sets were exon 1 forward and exon 23 reverse. The PCR products were loaded in 1 % agarose gel with 1 Kb ladde r. The expected siz e of the full length is 4,682 bp.

PAGE 46

46 A B Figure 4 3 PCR analysis of d iffere nt sets of e xons. PCR: Panel A, the exon 1 6 lane shows multiple bands which represents splice variants. Panel B, exon 7 10, 13 16, 17 20, 18 22, and 21 23 lanes also show multiple bands which represent splice variants. Both Panel A and B are Atp7a from IEC 6 cells. Common F & R are loaded as the positive control. indicate s expected size bands

PAGE 47

47 A B Figure 4 4 RT PCR amplification using ex on 1 forward primer in combination with various reverse p rimers. PCR: Panel A, total RNA isolated from rat intestine mucosal scrape. Exon 1 6, 1 8, 1 10,1 12 and 1 14 lanes show multiple bands which represent splice variants. Panel B, total RNA isolated from IEC 6 cells. Exon 1 20, 1 22, and 1 23 lanes indicate different bands. Specifically the exon 1 23 lane shows multiple transcripts. Both Panel A and B used different reverse primers and common forward and reverse primers for the positive control. ind icate s expected size bands

PAGE 48

48 Figure 4 5 Gene structure of novel Atp7a splice v ariants. Indication of where splicing occurs in different exons is shown. These were amplified from IEC 6 cell RNA. Exons contained within the different transcript variants a re shown. A dashed line indicates that splicing occurred within the indicated exon. The lines between the exons in dicate the regions of the full length transcript that were spliced out. Novel splice variants shown in this figure were derived from cloning of the PCR products using Ex 1 23 primers in IEC 6 cells and these bands came from series of experi ments. An example of one of these experiment s is shown in figure 4 4 panel B (Exon 1 23A)

PAGE 49

49 A B C Figure 4 6 Amplification of full l ength Atp7a ariants. Panel A, gene structure and relative location of PCR primers. Whether these findings from the previous study from our lab ( 1 ) Panel B, PCR analysis using IEC 6 cells. 25 l of Exon 1/1a, 1/2, and 1/3 PCR product were loaded ce variants exists as full length transcript. Panel C, schematic figure of Atp7a protein s showing functional domains of Ex1/1a,1/2, and 1/3. Ex1/1a and 1/2 is full length, and Ex 1/3 is shorter missing metal binding domain (MBD) 1. TMD transmembrane domains

PAGE 50

50 A B Figure 4 7 Determination of the number of d ifferent Atp7a t ranscripts. Panel A, this is regression analysis by measuring the distance of each of the bands that the ladder traveled from the top to the gel. Total RNA was isolated from SD r at mucosal scrapes. Panel B, Northern blot of control and iron deficient mucosal scrapes. 5 g of total RNA was loaded in 1X MOPS buffer containing 2% formaldehyde agarose gel, then transferred to a nylon membrane. The blot was probed with a Atp7a full le ngth transcript. The arrows indicate the different sized transcripts that were detected under high stringency conditions. Shown below the northern blot is the stained RNA gel exemplifying equal loading.

PAGE 51

51 A B Figure 4 8 e nd labe ling of e xon 1/1a, 1/2, and 1/3. Panel A, Different dilution series of the oligonucleotide was completed to see the labeling efficiency. Panel B, Total RNA was isolated from SD rat mucosal scrapes. 5 g of total RNA were loaded in 1X MOPS buffer containing 2% formaldehyde agarose gel, then transferred to a nylon membrane. The blot s were probed with either full length or Ex1/1a, 1/2, and 1/3 that are labeled with digoxigenen ddUTP. Short (top, panel B) and long (bottom, panel B) exposures are shown.

PAGE 52

52 A B Figure 4 9 Gene expression under iron d eficiency. Northern blot: Panel A, 5 g of control and iron deficient rat duodenum mucosal scrape RNA were loaded in 1X MOPS buffer containing 2% formaldehyde agarose gel. Panel B, the same amount of the product as panel A was loaded in addition to also loading RNA from IEC 6 cells. Both panel A and B were probed with full length Atp7a PCR product. Shown next to the Northern blot is the stained RNA gel exemplifying equal loading.

PAGE 53

53 CHAPTER 5 DISCUSSION Specific Aim I The aim of this study was to determine the composition of Atp7a transcript variants using a PCR based approach. The cloning and sequencing of the genes for Menkes disease has shown its importance for copper transport and homeostasis in mammalian cell s ( 61 ) PCR was used to determine the structure of Atp7a transcript variants and to amplify full length Atp7a for Northern blot experiments. In this study, intestinal epithelial cells (IEC 6) were used because we know that Atp7a is strongly induced by iron chelation in IEC 6 cells, which are an appropriate cell model for intestinal iron absorption. Using RT PCR with different primer sets, several parts of the Atp7a transcript were amplified to see if we detecte d multiple bands, indicating they are alternative splices in that region of the gene. Since Atp7a is such a large gene, we amplified the gene in pieces, looking for regions that contain more than one band. The exon 1 6 amplification showed multiple bands a (Figure 4 3 A). This result could indicate the presence of transcript variants. Another example of a gel showed multiple bands in exon 13 16, 18 22, and 21 23 amplificat ions (Figure 4 3 B). These observations again suggested that there may be al ternative splicing in that region. Studies done in different cell lines were thus able to show the existence of multiple forms of the ATPase. Through another recent study the authors were able to indicate how different isoforms befit potential role s in th e normal physiology of copper ( 61 62 ) However, the physiological relevance of these variants was not clear.

PAGE 54

54 In addition to these potentially novel splice variants, we were also able to identify full number of experiments, we eventually decided to focus on exon 1 23. We hypothesized that most transcripts would have exon 1 and exon 23 (which contained the stop codon). PCR amplification of full length Atp7a analysis was completed to study the promoter re gion and to map the transcription start site, which is the PCR products were sequenced and it was determine d that there were three splice ( 1 ) U sing these three splice variants, forward primers primers were used for this PCR amplification. The purpose of splicing is to modify t he full length Atp7a mRNA and to produce uniquely structured transcript variants that code for alternative proteins that play roles in copper transport or regulatory roles. The PCR data showed amplicons that were close to the predicted size of full length transcrip t, which was ~4.6 kb (Figure 4 6 splice variants exist as full length transcript s Specific Aim II Additionally, the Northern blot technique was use to determine the number of Atp7a transcript s that exist in intestinal epithelial cells and to examine Atp7a mRNA expression during iron deficiency. Previously, a study was done using human cell lines that expressed the Menkes Cu transporting Atp7a. By using N orthern blot analysis, they were able to find t he evidence for a smaller transcript by using a probe with exon 23 sequences ( 60 ) In this study Sprague Dawley (SD) rats were used, because this rat is

PAGE 55

55 an appropriate model for basic multi purpose research, and SD rats have been used extensively by our lab in the past. The fu ll length Atp7a was PCR was successfully amplified using exon 1 forward and exon 23 reverse primers. The size of the band showed the predicted size, which is 4.6 kb (Figure 4 2). The full length cDNA was used as a template for generating random primed pro bes for Northern blot. Using the full length probe, the Northern blot from control and iron deficient rats showed multiple transcript s (Figure 4 7 ). Also, this experiment confirmed by an independent method, that Atp7a mRNA is increased in the iron deficie nt state confirming previous results using qRT PCR to detect a specific target, mainly the Atp7a transcript. In this experiment, a significant amount of background was obse rved on the images. However, an identical pattern using full length probe vs. different oligonucleotides was noted (Figure 4 8 ). This finding again suggests that full length transcripts exist containing the novel A previous study on di valent metal transporter 1 (DMT1) splice variant s was done. The experiment showed that alternative promoters and alternative RNA processing creates a combination of four DMT1 mRNA variants. One of the isoforms of DMT1 is most actively expressed in duodenal and ki dney cells. Another isoform correlate s with the role of DMT1 in the release of iron from endosome s following iron uptake by the transferrin cycle ( 63 ) Hav ing identified these different transcript and protein variants it is now possible to address specific function s and biological roles. In summary, by using the PCR technique and Northern blot techniques we have identified multiple Atp7a transcripts. Pres umably, the resulting different mRNAs may be

PAGE 56

56 translated into different protein isoforms. The alternative full length transcripts shown to Furthermore, b y an independent me thod, induction of Atp7a mRNA expression in the duodenum of iron deficient rats was confirmed. Overall, these finding are novel and they pave the way for future studies. These PCR amplicons can be cloned into a CFP vector to produce fusion proteins that can be expressed in intestinal epithelial cells. The intracellular locations of the proteins can then be determined by confocal microscopy. It will be important to determine if these transcripts encode new protein variants and to determine the physiologic roles of these proteins

PAGE 57

57 APPENDIX SEQUENCE DATA FOR NOVEL SPLICE VARIANTS These are the raw sequence data for novel splice variants that are shown in Figure 4 5 Exon 1 forward and exon 23 reverse primers are used. Fi gure 4 5 Schematic A CTCACTATAG GGCGAATTGG GCCCTCTAGA TGCATGCTCG AGCGGCCGCC AGTGTGATGG ATATCTGCAG AATTCGCCCT TAGGCTGCGT GCTGGTTGAT CGCTGCCGCC CTACGGAGCT CCGAGCTCGA ACCCCAGCCC TGGAATCCTA GGAATGTAAG GACATCAAAA TGGAACCAAA TATGGATGCA AATTCAATTA CTATCACTGC TGAGGGAATG ACCTTCTGGA TGTTGTGGCA AGTATTGACT TGTCAAGGAA AACAGTCAAG AGGATTCGAA TCAATTTTGT CTTTGCCCTG ATTTATAATC TGATTGGAAT TCCCATCGCT GCTGGAGTTT TTCTGCCCAT CGGCTTGGTT TTACAACCCT GGATGGGATC CGCAGCCGTG GCCGCTTCAT CTGTCTCTGT GGTACTTTCT TCCCTTTTCC TCAAGCTTT A CAGGAAGCCA ACATATGACA ATTATGAGTT GCGTCCCCGG AGCCACACAG GACAGAGGAG TCCTTCAGAA ATCAGCGTTC ACGTTGGAAT AGATGATACC TCCAGAAATT CTCCAAGACT GGGTTTACTG GACCGGATTG TCAATTACAG CAGAGCCTCC ATAAATTCAC TGCTGTCTGA CAAACGCTCC CTCAACAGCG TCGTCACTAG TGAGCCTGAT AAGCACT CAC TTCTGGTGGG AGACTTCCGG GAAGATGACG ACACCACACT GAAGGGCGAA TTCCAGCACA CTGGCGGCCG TTACTAGTGG ATCCGAGCTC GGTACCAAGC TTGGCGTAAT CATGGTCATA GCTGTTTCCT GTGTGAAATT GTTATCCGCT CACAATTCCA CACAACATAC GAGCCGGAAG CATAAAGTGT AAAGCCTGGG GTGCCTAATG AGTGAGCTAA CTCACA TTAA TTGCGTTGCG CTCACTGCCC GCTTTCCAGT CGGGAAACCT GTCGTGCCAG CTGCATTAAT GAATCGGCCA ACGCGCGGGG AGAGGCGGTT TGCGTATTGG GCGCTCTTCC GCTTCCTCGC Figure 4 5 S chematic B GACTCACTAT AGGGCGAATT GGGCCCTCTA GATGCATGCT CGAGCGGCCG CCAGTGTGAT GGATATCTGC AGAATTCGCC CTTAGGCTGC GTGCTGGTTG ATCGCTGCCG CCCTACGGAG CTCCGAGCTC GAACCCCAGC CCTGGATTCC TAGGAATGTA AAGACATCAA AATGGAACCA AATATGGATG CAAATTCAAT TACTATCACT GTTGAGGGAA TGACATGTAT TTCCTGTGTC CGGACCATTG AGCAGCAGAT TGGGAAAGTG AATGGTGTCC ATCACATTAA AGTTTCCCTA GAAGAAAAA A GTGAACATCC TTTAGGAGCA GCTGTAACCA AATATTCCAA GCAGGAGCTG GACACTGAAA CCTTGGGTAC CTGCACAGAT TTCCAGGTTG TACCCGGCTG TGGAATTAGC TGTAAAGTCA CCAATATTGA AGGTTTGCTA CATAAGAGTA ACTTGAAGAT AGAAGAAAAT AACATTAAAA ATGCATCCCT GGTTCAAATT GATGCAATTA ATGAACAGTC ATCACCTT CA TCGTCTATGA

PAGE 58

58 TTATTGATGC TCATCTCTCG AATGCTGTTA ATACTCAGCA GTACAAAGTC CTCATTGGTA ACCGGGAATG GATGATAAGA AATGGTCCTG TCATAAGTAA TGATGTGGAC GAGTCTATGA TTGAACATGA AAGAAGAGGC CGGACTGCTG TGTTGGTGAC AATCGATGGT GAACTGTGTG GCTTGATCGC TATTGCTGAT ACTGTGAAAC CTGAGG CAGA GCTGGCTGTG CACATTCTGA AATCTAAGGG TTTGGAAGTA GTTCTGATGA CTGGAGACAA CAGTAAAACA GCTCGGTCTA TTGCTTCTCA GGTTGGCATT ACTAAGGTGT TTGCCGAAGT TCTGCCTTCC ACAAAGTTGC TAAGGTGAAG CAGCTTCAGG AGGAGGGAAA GCGCGCAGCC ATGGTAGGAG ATGGAATCAA TGACTCTCCA GCTCTGGCAA TGGCA AGCGT CGGAATTGCC ATCGG Figure 4 5 S chematic C GACTCACTAT AGGGCGAATT GGGCCCTCTA GATGCATGCT CGAGCGGCCG CCAGTGTGAT GGATATCTGC AGAATTCGCC CTTAGGCTGC GTGCTGGTTG ATCGCTGCCG CCCTACGGAG CTCCGAGCTC GAACCCCAGC CCTGGAATCC TAGGAATGTA AAGACATCAA AATGGAACCA AATAT GGATG CAAATTCAAT TACTATCACT GTTGAGGGAA TGACATGTAT TTCCTGTGTC CGGACCATTG AGCAGCAGAT TGGGAAAGTG AATGGTGTCC ATCACATTAA AGTTTCCCTA GAAGAAAAAA GTGCAACTGT TATTTATAAC CCTAAACTTC AGACTCCAAA GACCCTCCAA GAAGCTATCG ATGACATGGG CTTTGATGCT CTTCTTCACA ATGCTAACCC TCT TCCTGTC TTAACCAATA CTGTGTTTCT GACTGTTACT GCTCCACTGG CTCTGCCATG GGACCATATC CAAAGTACAT TGCTCAAGAC CAAGGGTGTG ACTGGGGTTA AGATTTCCCC TCAGCAAAGA AGTGCAGTGG TTACCATAAT CCCATCTGTG GTGAGTGCTA ATCAGATCGT GGAGCTGGTC CCAGACCTCA GTTTAGACAT GGGAACTCAG GAGAAAAAGT CA GGAACTTC TGAGGAGCAT AGCACACCTC AGGCAGGGGA AGTCCCGCTG AAGATGAGAG TGGAAGGGAT GACCTGCCTT TCATGCACTA GCACCATTGA AGGAAAAGTT GGAAAGCTGC AAGGTGTACA ACGCATTAAA GTGTCCCTAG ACAACCAAGA AGCTACTATT GTGTATCAAC TTCATCTGTC TCTGTGGTAC TTTCTTCCCT TTTCCTCAAG CTTTACAGGA AGCCAACATA TGACAATTAT GAGTTGCGTC CCCGGAGCCA CACAGGACAG AGGAGTCCTT CAGAAATCAG CGTTCACGTT GGAATAGATG ATACCTCCAG AAATTCTCCA TGACTGGGTT TACTGGACCG GATTGTCAAT TACAGCAGAG CCTCCA Figure 4 5 S chematic D GACTCACTAT AGGGCGAATT GGGCCCTCTA GATGCATGCT CGAGCGGCCG CCAGTGTGAT GGATATCTGC AGAATTCGCC CTTAGGCTGC GTGCTGGTTG ATCGCCGCCG CCCTACGGAG CTCCGAGCTC GAACCCCAGC CCTGGAATCC TAGGAATGTA AAGACATCAA AATGGAACCA AATATGGATG CAAATTCAAT TACTATCACT GTTGAGGGAA TGACATGTAT TTCCTGTGTC CGGACCATTG AGCAGCAGAT TGGGAAAGTG AATGGTGTC C ATCACATTAA AGTTTCCCTA GAAGAAAAAA GTGCAACTGT TATTTATAAC CCTAAACTTC AGACTCCAAA

PAGE 59

59 GACCCTCCAA GAAGCTATCG ATGACATGGG CTTTGATGCT CTTCTTCACA ATGCTAACCC TCTTCCTGTC TTAACCAGTA CTGTGTTTCT GACTGTTACT GCTCCACTGG CTCTGCCATG GGACCATATC CAAAGTACAT TGCTCAAGAC CAAGGGT GTG ACTGGGGTTA AGATTTCCCC TCAGCAAAGA AGTGCAGTGG TTACCATAAT CCCATCTGTG GTGAGTGCTA ATCAGATCGT GGAGCTGGTC CCAGACCTCA GTTTAGACAT GGGAACTCAG GAGAAAAAGT CAGGAACTTC TGAAGAGCAT AGCACACCTC AGGCAGGGGA AGTCCTGCTG AAGATGAGAG TGGAAGGGAT GACCTGCCAT TCATGCACTA GCACCA TTGA AGGAAAAGTT GGAAAGCTGC AAGGTGTACA ACGCATTAAA GTGTCCCTAG ACAACCAAGA AGCTACTATT GTGTATCAAC CTCATCTGAT CACAGCAGAG GAAATAAAGA AGCAGATTGA AGCTGTGGGT TTTCCAGCCT TCATAAAAAA ACAGCCAAAG TACCTCAAAT TGGGAGCCAT TGACGTTGAG CGCCTGAAGA GTACACCAGT CAAATCTTCA GAAG GATCTC AGCAAAAGAG CCCAGCGTAT CCCAGTGACT CAGCAATCAC ATTTACCATA GACGGCATGC ATT Figure 4 5 S chematic E GACTCACTAT AGGGCGAATT GGGCCCTCTA GATGCATGCT CGAGCGGCCG CCAGTGTGAT GGATATCTGC AGAATTCGCC CTTAGGCTGC GTGCTGGTTG ATCGCTGCCG CCCTACGGAG CTCCGAGCTC GAACCCC AGC CCTGGAATCC TAGGAATGTA AAGACATCAA AATGGAACCA AATATGGATG CAAATTCAAT TACTATCACT GTTGAGGGAA TGACATGTAT TTCCTGTGTC CGGACCATTG AGCAGCAGAT TGGGAAAGTG AATGGTGTCC ATCACATTAA AGTTTCCCTA GAAGAAAAAA GTGCAACTGT TATTTATAAC CCTAAACTTC AGACTCCAAA GGCTCCTATC CAGCA GTTTG CAGACAAACT CAGTGGCTAC TTTGTTCCTT TTATCGTCTT GGTTTCCATT GTTACCCTCT TGGTGTGGAT TATAATTGGA TTTCAAAATT TTGGAATTGT GGAAGCCTAC TTTCCCGGCT ACAACAGAAG CATCTCCCGA ACAGAAACCA TAATCCGCTT TGCTTTCCAA GTGTCTATCA CAGTTCTGTG TATCGCATGT CCCTGTTCAC TGGGGCTAGC CACC CCAACT GCTGTGATGG TGGGCACAGG AGTAGGTGCT CAGAATGGCA TACTTATCAA AGGTGGGGAG CCACTGGAGA TGGCTCATAA GGTAAAGGTA GTGGTGGTTG ACAAGACTGG AACCATTACC CATGGAACCC CAGTAGTGAA CCAAGTAAAG GTTCAGGTGG AAAGTAACAA GATATCACGC AATAAGATCC TGGCCATTGT GGGAACTGCA GAAAGTAACA GT GAACATCC TTTAGGAGCA GCTGTAACCA AATATTGCAA GCAGGAGCTG GACACTGAAA CCTTGGGTAC CTGCACAGAT TTCCAGGTTG TACCCGGCTG TGGAATTAGC TGTAAAGTCA CCAATATTGA AGGTTTGCTA CATAAGAGTA ACTTGAAGAT AGAAGAAAAT AACATTAAAA ATGCATCCCT GGTTCAAA Figure 4 5 S chematic F GACTCACTAT AGGGCGAATT GGGCCCTCTA GATGCATGCT CGAGCGGCCG CCAGTGTGAT GGATATCTGC AGAATTCGCC CTTAGGCTGC GTGCTGGTTG ATCGCTGCCG CCCTACGGAG CTCCGAGCTC GAACCCCAGC CCTGGAATCC

PAGE 60

60 TAGGAATGTA AAGACATCAA AATGGAACCA AATATGGATG CAAATTCAAT TACTATCACT GTTGAGGGAA TGACATGTAT TTCCTGTGT C CGGACCATTG AGCAGCAGAT TGGGAAAGTA ACAAGATATC ACGCAATAAG ATCCTGGCCA TTGTGGGAAC TGCAGAAAGT AACAGTGAAC ATCCTTTAGG AGCAGCTGTA ACCAAATATT GCAAGCAGGA GCTGGACACT GAAACCTTGG GTACCTGCAC AGATTTCCAG GTTGTACCCG GCTGAGGAAT TAGCTGTAAA GTCAGCAATA TTGAAGGTTT GCTACAT AAG AGTAACTTGA AGATAGAAGA AAATAACATT AAAAATGCAT CCCTGGTTCA AATTGATGCA ATTAATGAAC AGTCATCACC TTCATCGTCT ATGATTATTG ATGCTCATCT CTCAAATGCT GTTAATACTC AGCAGTACAA AGTCCTCATT GGTAACCGGG AATGGATGAT TAGAAATGGT CTTGTCATAA GTAATGATGT GGACGAGTCT ATGATTGAAC ATGAAA GAAG AGGCCGGACT GCTGTGTTGG TGACAATCGA TGATGAACTG TGTGGCTTGA TCGCTATCGC TGATACTGTG AAACCTGAGG CAGAGCTGGC TGTGCACATT CTGAAATCTA TGGGTTTGGA AGTAGTTCTG ATGACTGGAG ACAACAGTAA AACAGCTCGG TCTATTGCTT CTCAGGTTGG CATTACTAAG GTGTTTGCCC GAAGTTCTGC CTTCCCACAA GTTG CTAAGG TGAAGCAGCT TCAGGAGGAG GGAAAGCGCG TAGCCATGGT AGGAGATGGA ATCAATGACT CTCCAGCTCT GGCAATGG

PAGE 61

61 REFERENCES 1. Collins JF, Hua P, Lu Y, Ranganathan PN. Alternative splicing of the Menkes copper Atpase (Atp7a) transcript in the rat intestinal epithelium. Am J Physiol Gastr L 2009;297(4):G695 G707. 2. Fox PL. The copper iron chronicles: The story of an intimate relationship. Biometals 2003;16(1):9 40. 3. Hart EB SH, Elvehjem CA. Iron in nutrition. I. Nutritional anemia on whole milk diets and the utilizatio n of inorganic iron in hemoglobin building. J Biol Chem 1925;65:67 80. 4. Sherman AR, Moran PE. Copper Metabolism in Iron Deficient Maternal and Neonatal Rats. J Nutr 1984;114(2):298 306. 5. Gambling L, Dunford S, McArdle HJ. Iron deficiency in the pregn ant rat has differential effects on maternal and fetal copper levels. J Nutr Biochem 2004;15(6):366 72. 6. Collins JF, Franck CA, Kowdley KV, Ghishan FK. Identification of differentially expressed genes in response to dietary iron deprivation in rat duod enum. Am J Physiol Gastr L 2005;288(5):G964 G71. 7. Sheth S, Brittenham GM. Genetic disorders affecting proteins of iron metabolism: Clinical implications. Annu Rev Med 2000;51:443 64. 8. Testa U, ed. Proteins of Iron Metabolism Boca Raton, Fl: CRC Pres s, 2002. 9. Werman MJ, Barat E, Bhathena SJ. Gender, Dietary Copper and Carbohydrate Source Influence Cardiac Collagen and Lysyl Oxidase in Weanling Rats. J Nutr 1995;125(4):857 63. 10. Prohaska JR. Biochemical Changes in Copper Deficiency. J Nutr Bioche m 1990;1(9):452 61. 11. Milne DB. Assessment of Copper Nutritional Status. Clin Chem 1994;40(8):1479 84. 12. Bonham M, O'Connor JM, Hannigan BM, Strain JJ. The immune system as a physiological indicator ofmarginal copper status? Brit J Nutr 2002;87(5):39 3 403. 13. Xie L, Collins JF. Transcriptional regulation of the Menkes copper ATPase (Atp7a) gene by hypoxia inducible factor (HIF2{alpha}) in intestinal epithelial cells. Am J Physiol Cell Physiol 2011;300(6):C1298 305.

PAGE 62

62 14. van den Berghe PVE, Klomp L WJ. New developments in the regulation of intestinal copper absorption. Nutr Rev 2009;67(11):658 72. 15. Menkes JH, Weakley DR, Alter M, Steigleder GK, Sung JH. Sex Linked Recessive Disorder with Retardation of Growth, Peculiar Hair, and Focal Cerebral a nd Cerebellar Degeneration. Pediatrics 1962;29(5):764 &. 16. Lutsenko S, Petris NJ. Function and regulation of the mammalian copper transporting ATPases: Insights from biochemical and cell biological approaches. J Membrane Biol 2003;191(1):1 12. 17. Rec ommended dietary allowances -1980. Nutr Rev 1980;38(8):290 4. 18. Gaetke LM, Chow CK. Copper toxicity, oxidative stress, and antioxidant nutrients. Toxicology 2003;189(1 2):147 63. 19. Lurie DG HJ, Schubert A. Journal of Food Composition and Analysis 1989;2:298 316. 20. Institute of Medicine. Copper. In: Food and Nutrition Board e. Dietary Reference Intakes: Vitamin A, Vitamin K, Arsenic, Boron, Chromium, Copper, Iodine, Iron, Manganese, Molybdenum, Nickel, Silicon, Vanadium, and Zinc. Washington, D C: National Academy Press, 2002:224 57. 21. Trumbo P, Yates AA, Schlicker S, Poos M. Dietary reference intakes: Vitamin A, vitamin K, arsenic, boron, chromium, copper, iodine, iron, manganese, molybdenum, nickel, silicon, vanadium, and zinc. J Am Diet Ass oc 2001;101(3):294 301. 22. Haschke F, Ziegler EE, Edwards BB, Fomon SJ. Effect of Iron Fortification of Infant Formula on Trace Mineral Absorption. J Pediatr Gastr Nutr 1986;5(5):768 73. 23. Linder MC, Zerounian NR, Moriya M, Malpe R. Iron and copper ho meostasis and intestinal absorption using the Caco2 cell model. Biometals 2003;16(1):145 60. 24. Dancis A, Yuan DS, Haile D, et al. Molecular Characterization of a Copper Transport Protein in Saccharomyces Cerevisiae an Unexpected Role for Copper in Iro n Transport. Cell 1994;76(2):393 402. 25. Zhou B, Gitschier J. hCTR1: A human gene for copper uptake identified by complementation in yeast. P Natl Acad Sci USA 1997;94(14):7481 6. 26. Nose Y, Kim BE, Thiele DJ. Ctr1 drives intestinal copper absorption an d is essential for growth, iron metabolism, and neonatal cardiac function. Cell Metab 2006;4(3):235 44.

PAGE 63

63 27. Gunshin H, Fujiwara Y, Custodio AO, DiRenzo C, Robine S, Andrews NC. Slc11a2 is required for intestinal iron absorption and erythropoiesis but dis pensable in placenta and liver. J Clin Invest 2005;115(5):1258 66. 28. Gunshin H, Mackenzie B, Berger UV, et al. Cloning and characterization of a mammalian proton coupled metal ion transporter. Nature 1997;388(6641):482 8. 29. Arredondo M, Munoz P, Mura CV, Nunez MT. DMT1, a physiologically relevant apical Cu1+ transporter of intestinal cells. Am J Physiol Cell Ph 2003;284(6):C1525 C30. 30. Ravia JJ, Stephen RM, Ghishan FK, Collins JF. Menkes copper ATPase (Atp7a) is a novel metal responsive gene in rat duodenum, and immunoreactive protein is present on brush border and basolateral membrane domains. J Biol Chem 2005;280(43):36221 7. 31. Knopfel M, Smith C, Solioz M. ATP driven copper transport across the intestinal brush border membrane. Biochem Bioph Res Co 2005;330(3):645 52. 32. Bremner I. Involvement of Metallothionein in the Hepatic Metabolism of Copper. J Nutr 1987;117(1):19 29. 33. Percival SS, Harris ED. Copper Transport from Ceruloplasmin Characterization of the Cellular Uptake Mechanism. Am J Physiol 1990;258(1):C140 C6. 34. Linder MC, HazeghAzam M. Copper biochemistry and molecular biology. Am J Clin Nutr 1996;63(5):S797 S811. 35. Danks DM. Copper Deficiency in Humans. Annual Review of Nutrition 1988;8:235 57. 36. Puig S, Thiele DJ. Mo lecular mechanisms of copper uptake and distribution. Curr Opin Chem Biol 2002;6(2):171 80. 37. Andrews NC, Schmidt PJ. Iron homeostasis. Annu Rev Physiol 2007;69:69 85. 38. Fleming MD, Trenor CC, Su MA, et al. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 1997;16(4):383 6. 39. McKie AT, Barrow D, Latunde Dada GO, et al. An iron regulated ferric reductase associated with the absorption of dietary iron. Science 2001;291(5509):1755 9. 40. Latunde Dada GO, Van der Westhuizen J, Vulpe CD, Anderson GJ, Simpson RJ, McKie AT. Molecular and functional roles of duodenal cytochrome B (Dcytb) in iron metabolism. Blood Cells Mol Dis 2002;29(3):356 60.

PAGE 64

64 41. Gunshin H, Starr CN, DiRenzo C, et al. Cybrd1 (duodenal cytoc hrome b) is not necessary for dietary iron absorption in mice. Blood 2005;106(8):2879 83. 42. Collins JF, Prohaska JR, Knutson MD. Metabolic crossroads of iron and copper. Nutr Rev 2010;68(3):133 47. 43. Donovan A, Brownlie A, Zhou Y, et al. Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature 2000;403(6771):776 81. 44. Pietrangelo A. Non HFE hemochromatosis. Hepatology 2004;39(1):21 9. 45. Donovan A, Lima CA, Pinkus JL, et al. The iron exporter ferropo rtin/Slc40a1 is essential for iron homeostasis. Cell Metab 2005;1(3):191 200. 46. Vulpe CD, Kuo YM, Murphy TL, et al. Hephaestin, a ceruloplasmin homologue implicated in intestinal iron transport, is defective in the sla mouse. Nat Genet 1999;21(2):195 9 47. Knutson MD, Oukka M, Koss LM, Aydemir F, Wessling Resnick M. Iron release from macrophages after erythrophagocytosis is up regulated by ferroportin 1 overexpression and down regulated by hepcidin. P Natl Acad Sci USA 2005;102(5):1324 8. 48. Nicola s G, Bennoun M, Devaux I, et al. Lack of hepcidin gene expression and severe tissue iron overload in upstream stimulatory factor 2 (USF2) knockout mice. P Natl Acad Sci USA 2001;98(15):8780 5. 49. Nicolas G, Bennoun M, Porteu A, et al. Severe iron deficie ncy anemia in transgenic mice expressing liver hepcidin. P Natl Acad Sci USA 2002;99(7):4596 601. 50. Harris ZL, Durley AP, Man TK, Gitlin JD. Targeted gene disruption reveals an essential role for ceruloplasmin in cellular iron efflux. P Natl Acad Sci USA 1999;96(19):10812 7. 51. Prohaska JR, Gybina AA. Rat brain iron concentration is lower following perinatal copper deficiency. J Neurochem 2005;93(3):698 705. 52. Josephs HW. Studies on iron metabolism and the influence of copper. J Biol Chem 1932;96(2):559 71. 53. Marston HR, Allen SH. Function of Copper in Metabolism of Iron. Nature 1967;215(5101 ):645 &. 54. Collins JF. Gene chip analyses reveal differential genetic responses to iron deficiency in rat duodenum and jejunum. Biol Res 2006;39(1):25 37.

PAGE 65

65 55. Dierick HA, Ambrosini L, Spencer J, Glover TW, Mercer JFB. Molecular Structure of the Menkes Disease Gene (Atp7a). Genomics 1995;28(3):462 9. 56. Dierick HA, Adam AN, EscaraWilke JF, Glover TW. Immunocytochemical localization of the Menkes copper transport protein (ATP7A) to the trans Golgi network. Hum Mol Genet 1997;6(3):409 16. 57. Lareau LF, Green RE, Bhatnagar RS, Brenner SE. The evolving roles of alternative splicing. Curr Opin Struc Biol 2004;14(3):273 82. 58. Bingham PM, Chou TB, Mims I, Zachar Z. On Off Regulation of Gene Expression at the Level of Splicing. Trends Genet 1988;4(5):134 8. 59. Das S, Levinson B, Vulpe C, Whitney S, Gitschier J, Packman S. Similar Splicing Mutations of the Menkes Mottled Copper Transporting Atpase Gene in Occipital Horn Syndrome and the Blotchy Mouse. Am J Hum Genet 1995;56(3):570 6. 60. Reddy MCM, Harri s ED. Multiple transcripts coding for the Menkes gene: Evidence for alternative splicing of Menkes mRNA. Biochem J 1998;334:71 7. 61. Harris ED, Qian YC, Reddy MCM. Genes regulating copper metabolism. Mol Cell Biochem 1998;188(1 2):57 62. 62. Harris ED, Reddy MCM, Majumdar S, Cantera M. Pretranslational control of Menkes disease gene expression. Biometals 2003;16(1):55 61. 63. Hentze MW, Hubert N. Previously uncharacterized isoforms of divalent metal transporter (DMT) 1: Implications for regulation and c ellular function. P Natl Acad Sci USA 2002;99(19):12345 50.

PAGE 66

66 BIOGRAPHICAL SKETCH Changae Kim was born in Anyang, South Korea and moved to the United States when she was 9 years old. Changae completed her B.S. in b iology at the Northeastern Illinois Univers ity in 2007. She was married in the year of 2008 and she moved to Florida. Changae has always had a profound interest in nutrition education and research. In 2009, Changae was accepted into the M.S. program in food science and human nutrition with a concen tration in nutritional sciences at the University of Florida. Currently, Changae is working under the guidance of Dr. James F. Collins. After graduation Changae intends on pursuing a doctor of philosophy in nutritional science.