Generation of a delta mir-K12-7 Kshv Microrna Mutant and a Virus Producer Cell Line

MISSING IMAGE

Material Information

Title:
Generation of a delta mir-K12-7 Kshv Microrna Mutant and a Virus Producer Cell Line
Physical Description:
1 online resource (57 p.)
Language:
english
Creator:
Sangani,Rajnikumar R
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Medicine
Committee Chair:
Renne, Rolf
Committee Members:
Laipis, Philip J
Denslow, Nancy D

Subjects

Subjects / Keywords:
herpesvirus -- kshv -- mirna
Medicine -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
The current approach to identify gene targets of Kaposi?s sarcoma-associated herpesvirus (KSHV) miRNAs utilizes bioinformatics algorithms to predict sequence complimentary to 3? UTRs followed by experimental verification of targets. Thus far, this approach has led to the identification of a very few miRNA targets. Additionally, only a few of the miRNA targets have been experimentally proven to date. This strategy imposes limitations as miRNA dependent phenotypes may not readily be seen in the context of infection. Hence, generating miRNA deletion-mutants of KSHV are imperative to study their function in the context of infection. The latency-associated region is a genomic region which is abundantly expressed during latency. As all KSHV miRNAs reside in the latency-associated region, simply removing a miRNA might lead to loss of hairpin structure in the adjacent miRNAs. Loss of hairpin structure would affect miRNA expression. Here, a KSHV miR K12-7 deletion mutant was generated in a bacterial artificial chromosome (BAC) backbone containing the JSC-1 KSHV virus using two-step red recombination. A recombinant virus was also reconstructed in mammalian 293T cells. Further, this recombinant virus will be used to infect iSLK cells to generate a producer cell line that can be stored, re-grown and induced to produce a high titer of recombinant virus
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Rajnikumar R Sangani.
Thesis:
Thesis (M.S.)--University of Florida, 2011.
Local:
Adviser: Renne, Rolf.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-02-29

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043496:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 GENER K12 7 KSHV MICRO RNA MUTANT AND A VIRUS PRODUCER CELL LINE B y RAJNIKUMAR R. SANGANI A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Rajnikumar R. Sangani

PAGE 3

3 To my parents, family and friends

PAGE 4

4 ACKNOWLEDGMENTS I would like to acknowledge all of the people who contributed to this work and helped guide me in the laboratory. First, I would like to thank the members of my committee, Dr. Nancy Denslow and Dr. Philip Laipis, for their patience and guidance over the past two years. I would like to thank the members of Renne Core Laboratory: Dr. Brian Krueger, Curt is Lanier, and Vaibhav J ain for all of their help in making laboratory an enjoyable place of work. I would particularly like to thank Dr. Brian Krueger who taught me bacmid recombineering protocol, provided critical insight required for problem solving and helped me edit parts of this thesis. I would also like to thank all the members of Renne Laboratory: Dr. Jian Hong, Dr. Irina Haecker, Dr. Soo Jin Han, Karlie Plaisance Bonstaff, Issac Boss, Hong Seek Choi and Nonhlanhla Dlamini. I would particularly lik e to thank Karlie Plaisance Bonstaff for teaching me cell culture techniques required for the project. Finally, I would like to thank my advisor, Dr. Rolf Renne, for giving me a chance to succeed as from my time as a laboratory technician to a graduate st udent, for his mentoring, encouragement, and patience over duration of this project.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 LIST OF ABBREVIATIONS ................................ ................................ ............................. 9 ABSTRACT ................................ ................................ ................................ ................... 11 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 13 MicroRNA ................................ ................................ ................................ ............... 13 MicroRNA Biogenesis ................................ ................................ ...................... 13 MicroRNA Mechanism ................................ ................................ ...................... 14 MicroRNA Regulates Fundamental Processes in All metazoan ....................... 14 s Sarcoma Assocoated Herpesvirus and Its Associated Diseases ............. 14 KSHV Life Cycle ................................ ................................ ................................ ..... 15 KSHV MicroRNAs ................................ ................................ ................................ ... 16 KSHV MicroRNAs and Latency ................................ ................................ ........ 16 KSHV MicroRNAs Regulate Cellular and Viral Targets ................................ .... 17 Current Approaches for MicroRNA Target Identification ................................ ......... 18 2 K12 7 KSHV BAC MIRNA ................................ .............. 21 Background ................................ ................................ ................................ ............. 21 Mutation Background ................................ ................................ .............................. 22 Mutation Strategy ................................ ................................ ................................ .... 22 Materials and Methods ................................ ................................ ............................ 23 Two step Red mediated Recombination ................................ .......................... 23 Deletion Primers for miR K12 7 Deletion ................................ .......................... 24 Primers for Colony PCR and Verification PCR ................................ ................. 24 Generation of Targeting Fragment for first Red Recombination ....................... 25 Generation of Electrocompetent GS1783 E.coli ................................ ............... 25 First Red Recombination ................................ ................................ .................. 26 Screening of First Red recombinants ................................ ............................... 26 Second Red Recombination ................................ ................................ ............. 26 Qualities of terminal repeats ................................ ................................ ...... 27 Verification of mir K12 7 dele tion ................................ ............................... 27 K12 7 KSHV ................................ ... 28 Results ................................ ................................ ................................ .................... 28

PAGE 6

6 3 K12 K12 7 KSHV BAC ...... 40 Background ................................ ................................ ................................ ............. 40 Materials and Methods ................................ ................................ ............................ 40 Cell Culture ................................ ................................ ................................ ....... 40 K12 7 KSHV BAC for Transfection ................................ ....... 41 Transient Transfection of 293T Cells ................................ ................................ 41 Propagation of Transfected 293T Cel ls ................................ ............................ 42 Reactivation of Recombinant Virus ................................ ................................ .. 42 Isolation & Quantification of Recombinant Virus ................................ ............... 42 Results ................................ ................................ ................................ .................... 43 4 ESTABLISHING A PRODUCER CELL LINE ................................ .......................... 47 Background ................................ ................................ ................................ ............. 47 Materials and methods ................................ ................................ ............................ 48 Cell Line ................................ ................................ ................................ ........... 48 De novo Infection of iSLK cells ................................ ................................ ......... 48 Induction of virus ................................ ................................ .............................. 48 Results ................................ ................................ ................................ .................... 49 5 DISCUSSION AND FUTURE DIRECTIONS ................................ .......................... 51 LIST OF REFERENCES ................................ ................................ ............................... 54 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 57

PAGE 7

7 LIST OF TABLES Table page 2 1 Li st of primers ................................ ................................ ................................ ..... 30 2 2 List of published targets of KSHV miRNAs ................................ ......................... 31 3 1 List of viral copy number ................................ ................................ .................... 46

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Two step ds Red mediated recombination. ................................ ........................ 20 2 1 Mutagenesis strategy. ................................ ................................ ........................ 32 2 2 Generation of targeting fragment. ................................ ................................ ....... 33 2 3 Generation of Targeting fragment. ................................ ................................ ...... 34 2 4 Insertion of kanamycin cassette: ................................ ................................ ........ 35 2 5 Pulse field gel electrophoresis o f First Recombinants. ................................ ....... 36 2 6 miR K12 7 replica plates. ................................ ................................ ................... 37 2 7 Deletion of miR K12 7. ................................ ................................ ....................... 38 2 8 Pulse field gel electrophoresis of Second Recombinants. ................................ 39 3 1 Transient Transfection of 293T cell. ................................ ................................ ... 44 3 2 Quantification of virus. ................................ ................................ ........................ 45 4 1 K12 7 KSHV producer cell line. ................................ ........... 50

PAGE 9

9 LIST OF ABBREVIATION S AIDS a cquired immune deficiency syndrom ATP a denosine tri phosphate BAC b acterial artificial chromosome b p base pair cDNA cloned DNA DMEM d DNA deoxy ribonucleic acid HAART h ighly active antiretroviral t heray HHV 8 h uman herpesvirus 8 IL interleukin iSLK inducible SLK Kb kilo base KLAR KSHV latency associated region KS k KSHV k associated herpesvirus LANA l atency associated nuclear antigen MCD m MiRNA m icroRNA ORF s open reading frame s PCR p olymerase chain reaction PEL p rimary effus ion lymphoma qPCR quantitative PCR RISC RNA induced silencing complex rKSHV recombinant KSHV

PAGE 10

10 RNA r ibonucleic acid RTA r eplication and transcriptional activator TPA tetradecanoyl phorbol acetate TRs terminal repeats UTR u ntranslated region VA valproic acid WT w ild type

PAGE 11

11 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master o f Science GENER K12 7 KSHV M ICRO RNA MUTANT AND A VIRUS PRODUCER CELL LINE By RAJNIKUMAR R. SANGANI August 2011 Chair: Renne Ro lf Major: M edical Science s The current approach to identify gene targets of coma associated herpesvirus ( KSHV ) miRNAs utilizes bioinformatics algorithms to predict sequence approach has led to the identification of a very few miRNA targets. Additionally only a few of the miRNA targets have been experimentally proven to date. This strategy imposes limitations as miRNA dependent phenotypes may not readily be seen in the context of infection. Hence, generating miRNA deletion mutants of KSHV are imperative to study their function in the context of infection The latency associated region is a genomic region which is abundantly expressed during latency As all KSHV miRNAs reside in the latency associated region simply removing a miRNA might lead to loss of hairpin structure in the adjacent miRNA s Loss of hairpin structure would affect miRNA expression Here, a KSHV miR K12 7 deletion mutant was generated i n a bacterial artificial chromosome (BAC) backbone containing the JSC 1 KSHV virus using two step red recombination. A recombinant virus was also reconstructed in mammalian 293T cells Further, this recombinant virus will be used to infect iSLK cells to ge nerate a

PAGE 12

12 producer cell line that can be stored, re grown and induced to produce a high titer of recombinant virus.

PAGE 13

13 CHAPTER 1 INTRODUCTION M i cro RNA In 1993, Victor Ambros group discovered that a gene lin 4 produces small RNAs with antisense complementar ity to another gene, lin 14 ( 15 ) Further study demonstrated that lin 4 small RNA targets the untranslated region ( UTR ) of lin 14 mRNA to post transcriptionally silence it. This ground breaking study unearthed an entirely novel mechanism for gene expression regulations by a class of small RNAs, mainly micro RNAs ( miRNAs ) Small interfering RNAs ( siRNAs ) and miRNA s, essentially serve simila r functions but differ in their stringency of complimentarity to the target mRNA, the former having 100% complimentary while the later, stringency of complimentarity is somewhat relaxed. Since the discovery of the lin 4, more than 900 miRNAs have been iden tified in human s t o date (MIRNA SANGER). M i cro R NA B iogenesis miRNA genes are mostly encoded from intronic region s of protein coding genes but a few miRNAs have also been found to transcribe from exons as well. Genes for human miRNAs are generally transcrib ed by RNA polymerase II into primary miRNA (Pri miRNA) stem loop structure. The p ri miRNA structure is subsequently recognized g. This cleaved structure, also called the pre miRNA hairpin, is quickly exported from nucleus to the cytoplasm by the exportin 5/Ran GTPase pathway. The pre miRNA is recognized and processed by cytoplasmic Dicer, an RNase III type endonuclease. Dicer clea ves off the bulgy head of the pre miRNA hairpin to generate a short

PAGE 14

14 strand of ds RNA is destined to be incorporated into the RNA induced silencing complex (RISC). Once the mature miRNA is incorporated into RISC the transcript containing the complementary sequence is targeted ( 3 ) Micro RNA M echanism miRNAs can direct RISC to target a transcript by two mechanisms; transcript degradation or tran slational repression. The f ate of the transcript being targeted relies on the level of complementarity with the miRNA. Low complementarily exerts translational silencing while high complementarily leads to degradation of the message Thus, the major fu n ction of miRNA s seems to be the regulation of gene expression through either of the described mechanisms. In both cases, position s 2 8 from the end of the miRNA are the most important basess t hat exert post translational in hibition of the message. This sequence of the miRNA is referred as the seed miRNA sequence ( 4 ) Micro RNA Regulates Fundamental Processes in All metazoan When the first miRNA was discovered in C. elegans, it was thought to be s pecific to worm biology However, i n 2000, when Pasquinelli et al. demonstrated that C. elegans miRNA, let 7, was 100% conserved in mice and humans, it triggered research to identify novel miRNAs across species. More than 15,000 different miRNAs have been identified in all metazoan and plant species investigated so far (miRBase V.17) and these have been implicated in central biological processes including, but not limited to, development, organogenesis, cell cycle control, and apoptosis ( 1 3 ) K Assocoated Herpesvirus and Its Associated D iseases associated herpesvirus ( KSHV ) a lso known as human herpesvirus 8 (HHV 8), is an AIDS

PAGE 15

15 defining malignancy The g enomic DNA fragments of KSHV w ere identified in KS lesions but not in unaffected skin, by Chang et al. in 1994 using a PCR based representational difference analysis ( 10 ) This pioneer ing work subsequently lead to the cloning and sequencing of the KSHV ( 20 ) KSHV is found in AIDS patients as a result of secondary infection or affecting immune suppressed individuals. In addition to KS, which is of endothelial origin, KSHV is also associated with two lymphoproliferative disease (MCD). Although the use of highly active antiretroviral therapy ( HAART ) has reduced the number of AIDS KS and PEL cases significantly, KSHV is stil l rampant in the developing world and caus es severe mortality ( 32 ) KSHV Life Cycle KSHV contains a double stranded DNA genome encodi ng 90 Open reading frames (ORFs ) ( 19 ) KS HV ORFs are classified as l ytic genes or l atent genes. Lytic gene s are required for productive viral infectio n and include tho se encoding viral protei ns required for DNA replication viral gene expression, and viral structural proteins. KSHV has the ability to establish and maintain latent infection, characteristic of most gamma herpesviruses. It has been demonstrated that the ma jority of cells in KS tumors and PELs are latently infected with KSHV Upon infection, the KSHV genome circularizes and persists as an episome in the nucleus of infected cells. Only a few genes are expressed during latency from the same genomic region, called latency associated region (LAR), and this region expresses latency associated nuclear antigen (LANA), vcyclin, vFLIP and 12 miRNAs Restricted gene expression during latency along with nonimmunogenic miRNAs targeting the components of cell mediated immunity is very elegant mechanism to evade immune detect ion. This state of infection

PAGE 16

16 exhibits a evade the host immune system ( 6 19 ) KSHV MicroRNAs E arly research had shown that miRNAs can serve as major modulators of gene expression V irologists soon demonstrated that DNA viruses also en code miRNAs ( 9 22 25 ) Researchers have found that DNA vi ruses are able to exploit miRNA dependent gene regulations to further their life cycle. This finding makes sense from an evolutionary perspective as a virus exert s itself to co evolve with a host that it depend s on cDNA cloning from PEL cell line s latent ly infected with KSHV revealed a 12 hairpin cluster in the region of the genome that corresponds to latency. This KSHV latency associated region (KLAR) encodes 12 pre miRNAs, giving rise to a total of 17 mature miRNAs ( 25 ) Ten of the 12 hairpins are expressed from a single transcript, while the rest were found in the Kaposin/K12 open reading f rame ( 6 ) Although miRNAs are shown to target the a few exceptions of targeted sites residing within coding regions or the ( 12 18 ) miRNA target specificity, as described earlier, depends on the mRNA seed sequence. Therefore a single miRNA can target many mRNAs and it is believed that about half of all mammalian transcripts are regulated by miRNAs ( 4 13 ) KSHV M i cro RNAs and Latency Analysis of KSHV miRNAs expression in PEL cell line s has revealed that all of the miRNAs are expressed abundantly during latency. As latency is the default life cycle of KSHV upon infection, it is logical to hypothesize that KSHV modulates host gene expression to establish and maintain latency using viral miRNAs Cell mediated

PAGE 17

17 immunity is an important component of the host response against intracellular pathogens. KSHV miRNAs inhibit effector cell recogni tion by T cell and NK cell or by miRNA induced expression of IL 6 and IL 10 cytokines ( 7 ) KSHV miRNA s also target pro apoptotic factor BCLAF1 thus extend the life of infected cells. The u se of viral miRNAs instead of viral proteins to establish and/or maintain latency provides the virus with an additi onal advantage as only few, if any antigens would be presented to the host immune system Understanding functions of the KSHV miRNAs will require mutant KSHV lacking one or more miRNAs. These viral mutants have to be examined by transcriptome an d proteomic profiling of infected cells to reveal corresponding targets. Currently virologists can only study phenotypic effects in cell culture given the limitations imposed by the absence of model systems to study KSHV pathogenesis Current estimate from genome wide microarrays and proteomics profiling suggests that any given miRNA can regulate more than 100 targets ( 2 16 27 ) KSHV M i cro RNAs R egulate Cellular and V i ral T argets In 2005, several laboratories identified 12 pre miRNAs within KSHV, which are expressed during latency in tumors of endothelial and l ymphoid origin ( 9 21 25 ) This finding presented a reason to hypothesize that KSHV miRNAs would regulate both cellular and viral target genes. Samols et al. further expressed the KSHV miRNA cluster in 293 cells to profile a list of potential target genes that were down regulated in cells expressing the KS HV miRNA cluster ( 26 ) Recent reports have confirmed that viral RTA, a switch required to initiate lytic replication, is targeted by miR K12 9* ( 5 ) ) and miR K12 7 5p ( 17 ) During latency, KSHV must also protect the infected cells from destruction and arbitrary proliferation for maintaining latency and spreading infection fur ther. Samols et. al described that KSHV miRNAs can repress thrombospondin, an

PAGE 18

18 inhibitor of angiogenesis ( 26 ) Taken together, KSHV miRNAs can potentially regulate key cellular processes such as apoptosis, angiogenesis, innate and adaptive immunity, and cell cycle control ( Table: 2 2; for review see ( 6 29 ) ). This suggests that they play important roles in viral biology and potentially pathogenesis. Thus, the central objective to study ing KSHV miRNAs is to identify their targets, both, cellular and viral. Target identificati on will help to better explain vir al biology and pathogenesis. Current Approaches for M i croRNA Target I dentification Identification of miRNA targets can be complicated by the fact that a single miRNA can bind to multiple targets with a different degree of complementarity The major factor that contributes to the target specificity of a miRNA is the seed sequence, usually located between positions 2 to 8 end of a n miRNA The l UTR, number of target sites with in the mRNA, and additional base pairing and AU content of the RNA flanking a seed sequence all contribute to the target efficiency ( 6 ) Current approaches to determine miRNA targets utilize bioinformatics based tools using the above mentioned criteria to predict target s The predicted targets are then experimentally verified using either miRNA over expression in non physiological cells or antagomir based miRNA inhibition to knock down the expression of the gene. Bioinformatics tools such as PicTar, TargetScan, DIANA microT, and miRanda are currently used to predict miRNA targets. Because these tools use different criteria for target se lection, targets predicted for any given miRNA are never consistent. Bioinformatics tools may predict targets that are biologically irrelevant as numerous factors including expression levels of miRNA and that of targets dictate miRNA targeting. Defining a miRNA target is also contextual because only those genes that can be expressed in a given cell type can be considered as legitimate targets.

PAGE 19

19 Predicted targets also have to be validated experimentally. Genome wide transcriptome analyses are performed after ectopic expression of a given miRNA or sequence specific inhibition of the same by antagomirs. Targets can also be confirmed of a reporter gene and assessing the ability of the miRNA to bring down the reporter expression level. Additionally if antibodies against the predicted targets are available, it can provide strong support for target validation by western blot analysis. Notwithstanding the approaches taken so far to validate miRNA targets, function of t he given viral miRNA s can only be understood in the context of infection. Therefore, an experimental system that will allow the systemic removal of individual miRNAs will prove to be a great tool to study the functions of viral miRNA We adopted the two st ep Red mediated recombination to specifically delete miR K12 7 and create a markerless recombinant KSHV BAC ( Figure 1 1)

PAGE 20

20 Fig ure 1 1. Two step ds Red mediated recombination. During the first recombination, the targeting fragment rep laces miR K12 7 with the kanamycin marker. Second recombination induces I SceI mediated ds DNA breaks followed by excision of kanamycin marker. This experimental approach produces markerless recombinant KSHV BAC with the desired deletion. This r KSHV BAC will be transfected in 293T cells to produce infectious virus.

PAGE 21

21 CHAPTER 2 K12 7 KSHV BAC MIRNA Background MicroRNAs (miRNAs) are approximately 22 nucleotide long non coding RNA regions of the target mRNAs leading to tran slational silencing of the targets. To date, only a few genes have been experimentally proven to be miRNA targets. More than 200 miRNAs have been discovered in double stranded DNA viruses, mainly herpesviruses asso ciated herpes virus (KSHV), also known as human herpes virus 8 (HHV8), is a gammaherpesvirus that encodes 12 pre miRNAs, all located in the latency associated region. Upon infection, KSHV predominantly maintains latency wherein a few vial genes are transcr ibed while the rest are transcriptionally silent. Contrarily, a high level of expression of viral miRNAs is found during latency ( 8 ) In the past few years, several viral and cellular targets of viral miRNAs were discovered implicating their role in many fundamental cellular processes like promoting angiogenesis, inhibition of apoptosis, and regulation of transcription factors ( 6 35 ) Table 2 2 lists some of the experimentally ver ified KSHV miRNA targets. Notably among those are cellular targets including THBS 1 ( angiogenesis inhibitor ) BACH1 (transcriptional suppressor), BCLAF1 (pro apoptotic factor), Rbl2 (repressor of DNA methyl transferase) ( transcription factor), and viral target RTA (major switch for lytic replication) Recently, role s for many miRNAs in maintaining latency and regulating the switch to lytic replication have also been established. Thus, identification of more targets of viral miRNAs will provide more information on viral pathogenesis and possible therapies.

PAGE 22

22 M utation Background Until very recently, mutants of KSHV have been made in the BAC36 background. A recent publication, however, revea led that BAC36 has a large du plication of the KSHV genome in its long terminal repeats (LTR) ( 34 ) T his finding prompted researchers to generate another BAC mid system without duplications or deletions in the KSHV genome because KSHV mutants generated in the BAC36 backgr ound would not be ideal the 219BAC which was derived from JSC 1, a PEL cell line with high virus titer. The 219BAC was created by inserting the pBelo45 backbone in between vIRF 1 and ORF5 7. This backbone has a GFP marker and provides hygromycinB resistance to mammalian cells. It also contains chloramphenicol resistance and an origin of replication for bacmid selection in bacteria. Two step DS double recombination was used to delete miR K1 2 7 in the 219BAC background. Mutation Strategy Mature miRNAs are derived from Pre microRNA hairpin s as described earlier. A p re microRNA hairpin is the substrate for Dicer, an RNaseIII, which recognizes the overall shape of the RNA duplex to produce matu re miRNA s To create a miR K12 7 miRNA mutant, the 20 base pair region encoding one arm of the miRNA hairpin was deleted from the viral genome (Fig ure. 2 1) This deletion destroy s the formation of the Pre microRNA hairpin ; resulting in the loss of substrate specificity for Dicer, and leading to the deletion of the microRNA from the virus Ideally, this strategy should also not affect the expression of the other microRNAs found within the cluster

PAGE 23

23 Materials and Methods Two step Red mediated Rec ombination The protocol of two step Red mediated recombination was developed by Tischer et al ( 31 ) We modified the protocol to create a miR K12 7 deletion mutation in the 219BAC background ( Figure 1 1) E.coli GS1783 was used to fa cilitate two rounds of homologous recombination as it contains the temperature inducible Red recombination system and arabinose inducible I SceI In the first round of recombination, the targeting fragment containing the kanamycin selectable marke r was generated and inserted in to the KSHV genome in the place of miR K12 7. Deletion primers to amplify the kanamycin selectable marker were designed to carry flanking sequences of miR K12 7. The resultant targeting fragment wou ld replace miR K12 7 via inter molecular homologous recombination when Red expression is induced at 42 C. Clones were screened for the kanamycin cassette insertion and the quality of BAC terminal repeats ( TRs ) were determined. For the second round of reco mbination, clone s containing both the kanamycin cassette and intact TRs, were selected. Clone s were grown in LB chloramphenicol and arabinose was added to induce the expression of I SceI restriction enzyme which would linearize the viral bacmid at the inse rtion site of the kanamycin cassette This linearized bacmid could then use itself as the substrate for an intra molecular homologous recombination resulting in the excision of the marker. Clones were further selected for chloramphenicol resistance but kan amycin sensitiv y as the marker cassette should be removed. Clones were further verified for deletion of the 20 bases of the miRNA arm and qualit y of BAC TRs was checked again.

PAGE 24

24 D eletion P rimers for miR K12 7 Deletion Deletion primers are listed in table 2 1. D eletion primers were designed with sequences flanking the miR K12 7 region which was targeted for deletion. Figure 2 2 describes the strategy to design deletion primers. T he f orward primer miR K12 7 delF contai ned sequences 40 bp of upstream and 20 bp downstream of the miR K12 7 deletion target. 20 bp corresponding to the kanamycin cassette was added to make 80 bp primer. The r everse primer was similar except it contained 20 bp of genomic sequence upstream of the miR K12 7 deletion followed by 4 0 bp of sequence corresponding to the region downstream of the mi R K12 7 deletion. Targeting fragment generated using deletion primers would contain d uplication of 20 bp upstream and downstream sequences of miR K12 7 at both end s of the fragment Upon lin earization of KSHV BAC with arabinose inducible I SceI substrate s for second Red mediated intra molecular homologous recombination would be generated for the excision of kanamycin marker Primers for Colony PCR an d V erification PCR K11test and KanR primers were used for colony PCRs (Table 2 1) K11test primer corresponds to a region upstream of miR K12 7 in the KSHV genome while KanR targets the end of the kanamycin marker. Successful insertion of the kanamycin cas sette would result in 1.3 Kb amplification products. The f irst step to v erify the miR K12 7 deletion from the chloramphenicol resistant and kanamycin sensitive second recombinants was done using colony PCR primers. The lack of amplification reflects th e excision of the kanamycin cassette. The s econd step to verify miR K12 7 was done using verification primers, K7 verifyF and K7 verifyR

PAGE 25

25 These primers target flanking sequences of miR K12 7. Successful deletion of miR K12 7 result s in the amplification o f a 60 bp product while amplification of the wildtype virus results in the production of an 80 bp product. Generation of T argeting F ragment for first Red Recombination PCR was carried out using the Phusion High Fideli ty PCR kit (Finnzymes) according for the following changes in condition s : No DMSO was used, only 1 ng of pEP Kan L of PCR reaction, and PCR was run for only 20 cycles. The primers used in this reaction were obtained from IDT and designed according to the procedure explained in the previous L PCR react L DpnI was added to digest the template for 2 hours at 37 C. The PCR reaction was run on a 1% agarose TBE gel and gel purified using a Qiagen Gel purification kit. Generation of E lectrocompetent GS1783 E.coli A 2 mL over night culture of E. coli strain GS1783 containing the KSHV 219 BAC was inoculated in to 40 mL of LB L ) in a sterile 250 mL flask. Bacteria were grown at 220 rpm at 30 C until 0.5 O.D. Induction of Red expression was carried out by shaking the flask vigorously in a 42 C water bath for 10 minutes. Immediately after, the culture flask was placed on ice slurry for 10 minutes. The culture was transferred with ice cold pipettes in to 15 mL ice cold culture tubes and centrifuged at 3 000x g at 0 C for 8 minutes. Cells were spun and washed three times with sterile ice cold ddH 2 O At the end of the last wash, cells were resuspended in the water remaining in the tubes. These electro competent cells were then used for electroporation of the targeting fragment to achieve the first red recombination.

PAGE 26

26 First Red Recombination 100 ng of gel purified targeting fragment L of GS1783 electro competent E.Coli in a pre chilled 1mm cuvette. Electroporation was performed using a Bio Rad gene pulser XCell set at 1.5 The t ime constant of the pulse was observed in the range of 3.5 to 4.5 to achieve successful cells were recovered from pulse shock in an eppendorf tube at 30 C at 220 rpm for 1 h ou r. of the recovered cells were plated on LB kanamycin plate s and incubated at 30 C for 24 hrs. Screening of First Red recombinants Positive integrates after the first Red recombination were ide ntified using colony PCR and lengths of the terminal repeats were confirmed using pulse field gel electrophoresis (PFGE). C olonies from the first Red recombination were grow n overnight in 5 m L LB kanamycin to verify the insertion of kanamycin marker. Overnight mini cultures were also streaked on kanamycin plates to prepare the master plate. BAC DNAs were isolated using Qiagen mini Colony PCRs to determine insertion of kanamycin cassette were performed b y Taq primers. PCR products were run on a 1% agarose TBE gel to visualize the length of amplification product to confirm the insertion of targeting fragment Second Red R ecombination A clone from the first recombination plate that contain ed the kanamycin insertion cassette and intact TRs was grown overnight in kanamycin containing LB media. 2 m L of the culture was inoculated in 40 m L of LB chloramphenicol and grown at 30 C at 220

PAGE 27

27 rpm. When the culture reached O.D. 0.5, arabinose was added to a final concentration of 2% and cells were further grown for 45 minutes to induce I SceI expression I SceI was used to linearize the virus at the site of the kan amycin c assette insertion Cells were then shaken vigorously on a 42 C water bath for 10 minutes to induce R ed recombinase expression. Cells were further grown for 2 hours to facilitate intra molecular homologous recombination leading to the excision of the kan am ycin cassette. A 10 fold serial dilution series of the culture was L chloramphenicol and 1% arabinose. Plates were incubated at 30 C for 24 48 hours. Qualities of terminal repeats Recombinant BAC DNAs were NheI diges ted for 2 hours at 37 C and subsequently run on PFGE. 1% Megabase agarose gel ladder was prepared in 0.5X TBE buffer and run in 0.5X TBE at 47 F (8 C) for 16 hours. Quality of the TRs was determined by comparing digestion patterns of BAC clones with t hat of WT 219BAC. Clones that possessed kanamycin cassette insertion intact terminal repeats and a similar banding pattern to that of the wildtype BAC were chosen for second R ed recombination. Verification of mir K12 7 d eletion Clones from the second Red recombination were replica plated on LB agar plates supplemented with 1% arabinose along with chloramphenicol or kanamycin. BAC DNAs of chloramphenicol resistant but kanamycin sensitive clones were isolated and PCRs were performed using verifi cation primers. PCR reactions were run on a 6% TBE acrylamide gel and the 20 bp deletion of miR K12 7 was verified. BAC DNAs were also subjected to NheI digestion and run on PFGE to confirm that the terminal repeats were intact.

PAGE 28

28 Stocking E. coli GS1783 H a rboring miR K12 7 KSHV V erified clones with intact terminal repeats were grown overni ght in LB chloramphenicol. An e qual volume of 80% glycerol was added to make glycerol stocks. These glycerol stocks were stored at 80 C. R esults The k anamycin targeting fragment was successfully generated and size verified on a TBE agarose gel (Fig ure 2 3 ). The g el purified targeting fragment was delivered into freshly made electrocompetent WT KSHV BAC harboring E.coli GS1783 cells at 4.3 mS More th an 100 clones were observed on the LB kanamycin plate 48 hours post electroporation Kanamycin resistance is conferred due to the inter molecular homologous recombination between the targeting fragment and WT KSHV BAC. While all of the clones unde r screening have the kanamycin cassette insertion in their respective BACs as a result of inter molecular recombination (Fig ure 2 4 ), only clones 1 5 have intact terminal repeats when compared to WT219BAC (Fig ure 2 5) Terminal repeats of clones 6 10 a re either degraded or lost. C lone # 4 was selected for a second round of Red recom bination, however this time; Sce I was induced to linearize the virus and promote the removal of the Kanamycin cassette by homologous recombination. Half of the clones screened after the s econd Red recombination by replica plat ing show kanamycin sensitivity (Fig ure 2 6 ). Clones sensitive to kanamycin confirm the excision of the targeting fragment When verified for the 20 bp deletion of miR K12 7 from the KSHV BAC, all clones except clone # 1 show the deletion (Fig ure 2 7 ). Further, a ll of the clones except #4 have intact terminal repeats (Fig ure 2 8 ). Because the two step recombination strategy excises the marker after the deletion

PAGE 29

29 m utation, a markerless and quality verified miR K12 7 KSHV BAC is created Two clones were chosen and glycerol stocks were frozen at 80 C. All first Red recombinants had kanamycin cassette insertion because clones were selected for kanamycin resistan ce. Half of the second Red recombinant clones screened by replica plating were kanamycin sensitive and chloramphenicol resistant. Thus, i t is evident that the two step Red mediated recombination strategy is highly efficient for molecular manipulation o f the KSHV virus cloned in to 219 BAC. Not only has it provided a DNA sequence s behind but it also enables us to manipulate the vir al genome in a quality controlled manner at each st ep.

PAGE 30

30 Table 2 1. List of primers Primers Sequences miR K12 7 delF GCGGCTGGCACACGGGCCGT TGGTAGTAAGATACAGCATA AGGATGACGAC miR K12 7 delR AGCGC CACCGGACGGGGATT TATGCTGTATCTTACTACCA ACGGCCCGTGTGCCAGCCGC AACCAATTAAC K11test KanR miR K12 7verifyF miR K12 7verify R This table lists the primers used in this study. miR K12 7 delF and miR K 12 7 delR were used to amplify targeting fragment. Insertion of targeting fragment in WT KSHV BAC219 was confirmed by K11test and KanR primers. miR K12 7 verifyF and miR K12 7 verifyR confirmed the deletion of 20 bp region from BAC219

PAGE 31

31 Table 2 2. List o f published targets of KSHV miRNAs KSHV miRNAs Target Function miRNA Cluster THBS1 Angiogenesis In hibitor K12 11 BACH1 Transcriptional Suppressor K12 5 BCLAF1 Pro apoptotic Factor K12 3 & K12 7 C/EBP Transcription Factor K12 4 5p Rbl2 Repressor of DNA Methyl Transferase Cluster (K12 6 & K12 11) MAF Transcription Factor K12 1 I B NF B Inhibitor K12 9* RTA (Viral Gene) Major Transctivator of Lytic Replication K12 5 RTA (Viral Gene) Major Transctivator of Lytic Replication KSHV miRNA Target Funct ion miRNA Cluster THBS1 Angiogenesis Inhibitor K12 11 BACH1 Transcriptional Suppressor K12 5 BCLAF1 Pro apoptotic Factor K12 3 & K12 7 C/EBP Transcription Factor K12 4 5p Rbl2 Repressor of DNA Methyl Transferase Cluster (K12 6 & K12 11) MAF Transcri ption Factor This table lists the published target of KSHV miRNAs. Notably, KSHV viral miRNAs also target viral genes apart from cellular genes (Adapted from Boss, Plaisance and Renne, 2009, Trends in Microbiology ).

PAGE 32

32 Figure 2 1 Mutagenesis strategy. Hairpin structure is highly important for recognition by Drosha and its ability to further process the hairpin in to pre miRNA. Deletion of 20 bases from one arm of the mature miRNA hairpin structure would disrupt hairpin structure formation.

PAGE 33

33 Figure 2 2 Generation of targeting fragment A markerless mutation strategy was employed by using E. coli GS1783 harboring the KSHV 219BAC bacmid and the Red recombination system. Color coding of sequences is as follows: yellow 20 bp upstream of deletion, gree n 40 bp upstream of deletion, blue 20 bp downstream of deletion, orange 40 bp downstream of deletion, black with red star kanamycin selection marker sequence with I SceI restriction site, black kanamycin selection marker reverse sequence.

PAGE 34

34 Figure 2 3. Generation of t argeting fragment The kanamycin targeting fragment is visualized at 1.1 Kb as expected.

PAGE 35

35 Figure 2 4 Insertion of kanamycin cassette: After first Red recombination, clones were screened for the kanamycin cassette insertion b y colony PCR. WT 219BAC is the negative control. All of the clones screened were successful first recombinants.

PAGE 36

36 F igure 2 5 P ulse field gel electrophoresis of First Recombinants. BAC clones from the first recombination plates were NheI digested along w ith WT 219BAC as control and run on PFGE. Intact terminal repeats of the clones are determined by comparing their digestion pattern to that of WT 219BAC control. Clones 1 5 show intact terminal repeats as WT 219BAC control.

PAGE 37

37 Fig ure 2 6 miR K12 7 repli ca plates. Clones from the second red recombination were streaked on Kanamycin or chloramphenicol replica plates.

PAGE 38

38 Fig ure 2 7 Deletion of miR K12 7. Second Red clones were subjected to verification PCR and run on a 0.6 % TBE acrylamide gel. Deletion o f miR K12 7 in BAC clones was confirmed by the visualization of the 20 bp shorter amplification product as compared to that of WT 219BAC control.

PAGE 39

39 Fig ure 2 8 P ulse field gel electrophoresis of Second Recombinants. Cam resistant but Kan sensitive BAC c lones were NheI digested along with WT 219BAC as control and run on PFGE. Intact terminal repeats of the clones were determined by comparing their digestion pattern to that of WT 219BAC control.

PAGE 40

40 CHAPTER 3 K12 K12 7 KSHV BAC Background Following the creation of the miR K12 7 mutant bacmid, live and infective virus was generated to further study how this mutation affects viral pathogenesis. The m ammalian ce ll line 293T is an ideal system for transfecting large vir al BACmid s Previous work in the Renne lab has demonstrated that vir al particles can be produced using these cells. 12 O tetrad ecanoylphorbol 13 acetate (TPA) a phorbol ester which activates protein kinase C (PKC), and Valproic acid a HDAC inhibitor which makes chromatin transcriptionally accessible were used to reactivate the virus from latency TPA activates an extensive signal transduction pathway and VA makes an entire chromatin transcriptional ly accessible Even though these chemical induc ers of viral lytic replication have broad effects the aim here was to produce virus particle s to help generate a stable virus producer cell line rather than to study any miRNA deletion based phen otypic changes at this time 293T cells will provide a short term latency state for transfected BAC mutants and provide us with enough virus particles to create a stable cell line Recombinant virus produced after induction of lytic replication by TPA and VA will be used to infect iSLK cells to create a virus producing cell line. M aterials and M ethods Cell Culture 293T cells were freshly thawed from a liquid nitrogen frozen stock. Cells were suspended in serum free Dulbecco's Modified Eagle's Medium ( DMEM ) and centrifuged for 5 minutes at 1100 rpm at 4 C. Cells were resuspended and maintained in complete DMEM (DMEM media supplemented with 10% FBS and 1% penicillin/streptomycin).

PAGE 41

41 Cells were grown at 37 C in a CO 2 incubator. Cells were split and maintained e very two days by first trypsinizing them with 1 mL trypsin and 1:10 diluting them with fresh complete DMEM. K12 7 KSHV BAC transfected 293T cells were grown under 100 g/ mL hygromycin B selection s Isolation K12 7 KSHV BAC for Transfectio n K12 7 KSHV BAC was thawed and inoculated in 500 mL LB chloramphenicol overnight. BAC DNA was prepared using the Qiagen Large construct Maxi Transient Transfection of 293T Cells 293T cells were plated in 6 well plates at the cell density of 300,000 in a total of 2 mL DMEM complete media Plates were incubated in the CO 2 incubator at 37 C for 24 hours prior to transfection. Transfection was performed using 293 Mir us Trans IT according to manufacture IT was mixed well with K12 7 KSHV BAC DNA was added to the mixture and mixed well by pipetting up and down. After 30 minute the transfection reaction mixture was added drop wise to each well. The p late was rocked back and forth and from side to side to distribute the transfecting complex evenly on cells. The plate was incubated for 24 48 hours in a CO 2 incubator at 37 C. At 24 48 hours post transfection, cells were checked for GFP expression to determine transfection efficiency. Once BAC DNA was transfected in to 293T cells, as confirmed by GFP mL hygromycin B was added to select BAC transfected cells.

PAGE 42

42 Propagation of Transfected 293T Cells Transfected 293T cells were harvested from 6 well plates by disrupting cells with trypsin. Cells were then transferred to 10cm dish containing fresh DMEM complete in the pres en mL hygromycin B to provide selection of BAC infected cells over non infected cells. Infected 293T cells were allowed to recover for a few days under antibiotic selection. Once the 10cm plate was 40 60% confluent with green cells, cells were transferred and propagated in 15cm plates. Virus was ready to induce from latency when plates were 40 60% confluent. Reactivation of Recombinant Virus Recombinant virus was induced to reactivate from latency by addition of 20 ng/ mL TPA and 1mM valproic acid. Virus was harvested 4 days post induction from cell culture media and cleaned using a 0.45 micron filter. Isolation & Quantification of Recombinant Virus Filtrate media containing recombinant virus was pipetted drop wise on top of a 25% sucrose cush ion and subjected to ultracentrifugation at 25,000rpm for 1 hour. Pellets containing virus were resuspended in 1% of the original filtrate volume using serum free DMEM to make the virus stock and it was stored at the recombinant virus w as used to isolate DNA for further quantification using DNAzole according to the Invitrogen r of ddH 2 0 and reaction. Real Time qPCR was performed using five 10 fold serial dilutions of pcDNA3.1 Orf73 plasmid as standard s along with primers specific for the N terminus of LANA (Orf73). Real Time qPCR was performed using Fast SyBr Green according to the recommendations (Applied

PAGE 43

43 Biosystems) Viral gen ome copy number was determined by comparing the threshold cycle (C t ) of sample DNA to the plasmid standard curve. R esults The 293T cell line is a highly transfectable mammalian cell line. 293T cells were successfully transf e K12 7 rKSHV BAC as a considerable number of cells expresse d GFP 24 hours post transfection. Transfected 293Tcells were maintained and transferred to 10cm plates and scale d up to harvest virus ( Figure 3 1 ). When induced with TPA and VA, transfected 293T cells yield ed an average 2.8 x 10 5 copies of WT KSHV and 1.73 x 10 6 copies of K12 7 rKSH V when quantified with Real time qPCR ( Figure 3 2 ). Table 3 1 lists viral copies per mL for 3 preparat ions of each, WT and recombinant KSHV. Although WT219 BAC transfected cells displayed K12 7 rKSHV BAC transfected cells, virus yields were six fold high er in K12 7 rKSHV BAC transfected cells Even though titers for recombinant and WT viruses were not normalized to measure viral production per cell, it was K12 7 rKSHV was induced to lytic replication at a higher level. K12 7 rKSHV will be used to infect iSLK cells to create a doxycycline inducible producer cell line in the next chapter

PAGE 44

44 Fig ure 3 1 Transient Transfection of 293T cell s 293T cells were transfected with 3 g K12 7 rKSHV BAC and GFP expression was observed 24 hours post K12 7 KSHV BAC transfected 293T cells A) 3 days post transfection and B) expanded and grown to confluence in a 10 cm plate

PAGE 45

45 F igure 3 2. Quantification of v irus. Viruses from infected 293T cells were purified and resuspended in 1% original volume. V iral copy numbers were quantified by qPCR using LANA as standard. Virus quantification from 3 different sets of A) K12 7 KSHV BAC transfected cells

PAGE 46

46 Table 3 1. List of viral copy number S ample Viral cop y per mL 219 BAC a 3 36 x 10 5 219 BAC b 4 14 x 10 5 219 BAC c 8 96 x 10 4 K12 7 KSHV a 2 6 x 10 6 K12 7 KSHV b 1 8 x 10 6 K12 7 KSHV c 7 97 x 10 5 Viruses were induced to reactivate from laten cy with TPA and VA. Viral copy numbers were determined by qPCR

PAGE 47

47 CHAPTER 4 ESTABLISHING A PRODUCER CELL LINE Background Currently available KSHV infected cell lines have many experimental limitations. Spontaneous lytic reactivation of virus occurs at a v ery significant level in most of the existing PEL cell lines ( 24 ) Earlier, the Renne L ab oratory observe d that recombinant virus cannot be produced from transfected 293T cells after thawing from frozen stocks Also, the amount of virus production decreases over longer passages of the transfected 293T cells. Thus, the absence of recombinant virus producer ce ll lines has led to mandatory repetition of the entire procedure i.e. from creating recombinant KSHV BAC to transiently transfecting 293T cells followed by virus induction, if more recombinant virus is needed. Constant repetition of the entire procedure l ead s to additional problems like mutations within the virus and inconsistent amounts of virus production. i SLK cells uninfected endothelial cell s of gingival KS lesion of an HIV negative renal transplant recipient SLK cells which contai n a doxycycline inducible RTA expression cassette, was created and provided by Don Ganem. RTA (Replication and Transcriptional Activator), the major immediate early lytic gene needed for reactivation, is the latent lytic switch encoded by ORF50. Ectopic ex pression of RTA leads to induction of latently KSHV infected cells ( 33 ) The inducible RTA cells were produced by transducing SLK endothelial cells ( 28 ) w ith a RTA expression construct which is tightly regulated by a promoter bearing a tet operator sequence. Cells were also transduced with Tet On transactivator which c an be activated by doxycycline. iSLK cells have been also demonstrated as a good model for maintaining KSHV latency. When

PAGE 48

48 virus is required in sizeable quantity, infected iSLK cell s or frozen thawed stock can be induced by addition of doxycycline and sodi um butyrate. Materials and methods Cell L ine iSLK cells were maintained in complete DMEM media (supplemented with 10% FBS and 1% penicillin/streptomycin) with 100 g / mL G418 and puromycin. Infected iSLK cells were under additional selection of 100 g /mL hygromycin B. De novo Infection of iSLK cells iSLK cells were seeded 14 16 hours prior to infection in 24 well plates at 100,000 polybrene Poly brene is a small, positively charged polymer that increases efficiency of viral infection by neutraliz ing surface charge s on the cell Cells were incubated for 12 hours, then virus was removed and fresh media was added. Cells were observed for GFP expressi on 24 hours post infection. Infected iSLK cells were then incubated and monitored for several days post infection. Cells were washed with PBS and trypsinized to dislodge and transferred to 6 well plates in the presence of of hygromycin B for selection of infected cells. Hygromycin B inhibits protein synthesis of only uninfected iSLK cells while rKSHV confers hygromycin B resi stance in infected cells Cells were allowed to recover from selection, and then expanded and frozen cell stocks were made. Induction of virus Once infected iSLK cells reached 40 60% confluency in 15 cm plates, cells were e, to induce RTA expression, and 1mM of sodium

PAGE 49

49 butyrate, another HDAC inhibitor. Virus was harvested 4 days post induction from cell culture media using a filter and quantified by Real Time qPCR. Results iSLK cells were infected with recombinant v irus and I observed few GFP expressing cells 4 days post infection. Infected cells were put under hygromycin B selection upon visualizing GFP expressing cells Earlier attempts to expand infected iSLK cells had failed so we repeated the infection. Cur rently infected cells are under hygromycin B selection and expansion. Once we expand infected iSLK cells successfully, we will freeze them. This frozen stock will be tested for its ability to serve as a producer cell line which can be frozen, thawed and in duced to produce recombinant virus. A n important step in the quality control of generating this viral mutant will be whole genome sequencing. The mutant virus will be sequence verified by Illumina solexa sequencing to further confirm the miR K12 7 deletio n and to determine if there are any other mutations in the viral genome. Further, real time PCR will be performed to show that only miR K12 7 has been deleted and that the miR K12 7 deletion does not affect the expression of the other KSHV miRNAs. In su mmary, I have successfully created and validated a markerless recombinant KSHV BAC containing miR K12 7 deletion. Upon transfection into 293T cells infectious virus was reconstituted

PAGE 50

50 Fig ure 4 1 K12 7 KSHV producer cell line. iSLK cells were infected K12 7 KSHV. Image was taken 3 days post infection. Only few GFP expressing iSLK cells were observed post infection. Left, phase contrast image; Center, fluorescent image; Right, merged image.

PAGE 51

51 CHAPTER 5 DISCUSSION AND FUTUR E DIRECTIONS The mutation strategy employed in this study has proven to be an ideal system to systematically delete an individual KSHV miRNA. Each step during the mutagenesis procedure ensures that the quality of BAC TRs is not compromised Skalsky et.al identified that TRs contain two LANA binding sites and a GC rich replication element ( 30 ) Not only LANA b inds to LANA binding sites in order to tether the episome to the chromosome, it also recruits cellular replication components at the origin of replication for latent DNA replication. Thus, functions of LANA and TRs are crucial for episome maintenance. The m utagenesis strategy used here will ensure that TRs of recombinant BACs are neither degraded nor lost. Most importantly, we can produce KSHV miRNA approach will grea tly benefit virology researchers to create and produce good molecular biology reagents. In the context of the viral mutant generated here Lin et. al experimentally confirmed that miR K12 7 5p, a miRNA derived from miR K12 7, targets replication and tra nscription activator ( RTA ) ( 17 ) As RTA is the main protein switch that induces lytic replication, miR K12 7 targeting of RTA may promote the maintenance of latency. Additionally, bioin formatic analysis by Qin et. al lead to the identification of binding sites for miR K12 7 within the 3'UTR of the basic region/leucine zipper motif transcription factor C/EBPbeta which is a known regulator of IL 6 and IL 10 transcriptional activation ( 23 ) IL 6 and IL 10 have been implicated in KSHV associated cancer pathogenesis. To identify other potential targets of miR K12 7, comparative array based transcript ion profiling of recombinant KSHV and WT KSHV can be very useful. Those

PAGE 52

52 genes that upregulate upon infection of mutant virus in comparisons to WT KSHV infected cells, and also contain seed sequence homology, can be further tested by reporter assays to vali date them as genuine targets of miR K12 7. Target identification using recombinant virus generated through the two step Red mediated recombination offers advantage s as described below over ectopic over expression of a miRNA and antagomir based inhibit ion approach. Because physiological expression levels of a miRNA and target genes are important for targeting, ectopically over expressing a miRNA might result into targeting of a transcript which otherwise would not be targeted at physiological concentrat ion. Transfecting miRNA mimics may also increase off target effects. As there can be more than 100 targets of a given miRNA, it will be difficult to determine targets that are relevant in the context of infection. Hence, recombinant virus generated here wi ll be crucial for miR K12 7 target identification. Once potential miR K12 7 targets have been identified by microarray profiling, gene s showing changed potential target g enes will be cloned downstream of a luciferase reporter gene to check miRNA dependent inhibition of the reporter gene. Subsequently the seed sequence can be mutated to abrogate miRNA dependent inhibition of the reporter gene to validate a given gene as a genuine target. Recently developed techniques like HITS CLIP (high throughput sequencing of RNAs isolated by crosslinking immunoprecipitation) ( 11 ) and PAR CliP (Photoactivatable Ribonucleoside Enhanced Crossli nking and Immunoprecipitation) ( 14 ) have proved to be great tools to determine miRNA targets. These techniques are developed based on the enrichment of Ago/miRN A/mRNA complexes from cells. HITS

PAGE 53

53 CLIP uses UV irradiation to crosslink RNA protein complexes having the direct contact in cells, followed by stringent immunoprecipitation of these complexes and partial RNA digestion. Resulting small RNAs in the RNA protei n complexes are sequenced through high throughput PAR CLIP relies on incorporation of photoreactive ribonucleoside analogs in RNAs by living cells. These methods exploit RNA protein interactions to identify miRNA targets in physiological conditions. These methods can also be employed to compare miRNA targets in wt and recombinant KSHV as additional means to identify and validate miR K 12 7 targets. It is evident from the literature that KSHV miRNAs target host and viral transcripts to contribute to the establishment and maintainance of latency ( 6 17 ) It is imperative to identify and experimentally prove the targets for miR K12 7 and those of the other KSHV miRNAs. Finding and experimentally proving KSHV miRNA targets will require quality controlled KSHV miRNA deletion mutants. By using this two step BAC recombin ation protocol, one can generate miRNA deletion KSHV mutants. Identification of crucial targets will lead to the emergence of a unifying theme pertaining to KSHV pathogenes is and potential therapies.

PAGE 54

54 LIST OF REFERENCES 1. Ambros, V. 2004. The functions of animal microRNAs. Nature 431: 350 355. 2. Baek, D., J. Villen, C. Shin, F. D. Camargo, S. P. Gygi, and D. P. Bartel. 2008. The impact of microRNAs on protein output. Nature 455: 64 71. 3. Bartel, D. P. 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116: 281 297. 4. Bartel, D. P. 2009. MicroRNAs: target recognition and regulatory functions. Cell 136: 215 233. 5. Bellare, P., and D. Gan em. 2009. Regulation of KSHV lytic switch protein expression by a virus encoded microRNA: an evolutionary adaptation that fine tunes lytic reactivation. Cell host & microbe 6: 570 575. 6. Boss, I. W., K. B. Plaisance, and R. Renne. 2009. Role of virus encod ed microRNAs in herpesvirus biology. Trends Microbiol 17: 544 553. 7. Boss, I. W., and R. Renne. 2010. Viral miRNAs: tools for immune evasion. Current opinion in microbiology 13: 540 545. 8. Cai, X., C. H. Hagedorn, and B. R. Cullen. 2004. Human microRNAs ar e processed from capped, polyadenylated transcripts that can also function as mRNAs. Rna 10: 1957 1966. 9. Cai, X., S. Lu, Z. Zhang, C. M. Gonzalez, B. Damania, and B. R. Cullen. 2005. Kaposi's sarcoma associated herpesvirus expresses an array of viral micr oRNAs in latently infected cells. Proceedings of the National Academy of Sciences of the United States of America 102: 5570 5575. 10. Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles, and P. S. Moore. 1994. Identification of herpesv irus like DNA sequences in AIDS associated Kaposi's sarcoma [see comments]. Science 266: 1865 1869. 11. Chi, S. W., J. B. Zang, A. Mele, and R. B. Darnell. 2009. Argonaute HITS CLIP decodes microRNA mRNA interaction maps. Nature 460: 479 486. 12. Duursma AM, K. M., Schrier M, le Sage C, Agami R. 2008. miR 148 targets human DNMT3b protein coding region. RNA (New York, N.Y 14: 872 877. 13. Friedman, R. C., K. K. Farh, C. B. Burge, and D. P. Bartel. 2009. Most mammalian mRNAs are conserved targets of microRNAs. G enome research 19: 92 105. 14. Hafner, M., M. Landthaler, L. Burger, M. Khorshid, J. Hausser, P. Berninger, A. Rothballer, M. Ascano, Jr., A. C. Jungkamp, M. Munschauer, A. Ulrich, G.

PAGE 55

55 S. Wardle, S. Dewell, M. Zavolan, and T. Tuschl. 2010. Transcriptome wide identification of RNA binding protein and microRNA target sites by PAR CLIP. Cell 141: 129 141. 15. Lee, R. C., R. L. Feinbaum, and V. Ambros. 1993. The C. elegans heterochronic gene lin 4 encodes small RNAs with antisense complementarity to lin 14. Cell 7 5: 843 854. 16. Lim, L. P., N. C. Lau, P. Garrett Engele, A. Grimson, J. M. Schelter, J. Castle, D. P. Bartel, P. S. Linsley, and J. M. Johnson. 2005. Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature 433: 769 7 73. 17. Lin, X., D. Liang, Z. He, Q. Deng, E. S. Robertson, and K. Lan. 2011 miR K12 7 5p encoded by Kaposi's sarcoma associated herpesvirus stabilizes the latent state by targeting viral ORF50/RTA. PloS one 6: e16224. 18. Lytle JR, Y. T., Steitz JA. 2007. Target mRNAs are repressed as efficiently by microRNA binding sites in the 5' UTR as in the 3' UTR. PNAS 104: 9667 9672. 19. Mesri, E. A., E. Cesarman, and C. Boshoff. 2010. Kaposi's sarcoma and its associated herpesvirus. Nat Rev Cancer 10: 707 719. 20. Moo re, P. S., S. J. Gao, G. Dominguez, E. Cesarman, O. Lungu, D. M. Knowles, R. Garber, P. E. Pellett, D. J. McGeoch, and Y. Chang. 1996. Primary characterization of a herpesvirus agent associated with Kaposi's sarcomae. Journal of virology 70: 549 558. 21. Pf effer, S., A. Sewer, M. Lagos Quintana, R. Sheridan, C. Sander, F. A. Grasser, L. F. van Dyk, C. K. Ho, S. Shuman, M. Chien, J. J. Russo, J. Ju, G. Randall, B. D. Lindenbach, C. M. Rice, V. Simon, D. D. Ho, M. Zavolan, and T. Tuschl. 2005. Identification o f microRNAs of the herpesvirus family. Nat Methods 2: 269 276. 22. Pfeffer, S., M. Zavolan, F. A. Grasser, M. Chien, J. J. Russo, J. Ju, B. John, A. J. Enright, D. Marks, C. Sander, and T. Tuschl. 2004. Identification of virus encoded microRNAs. Science 304 : 734 736. 23. Qin, Z., P. Kearney, K. Plaisance, and C. H. Parsons. 2010. Pivotal advance: Kaposi's sarcoma associated herpesvirus (KSHV) encoded microRNA specifically induce IL 6 and IL 10 secretion by macrophages and monocytes. Journal of leukocyte biolo gy 87: 25 34. 24. Renne, R., W. Zhong, B. Herndier, M. McGrath, N. Abbey, D. Kedes, and D. Ganem. 1996. Lytic growth of Kaposi's sarcoma associated herpesvirus (human herpesvirus 8) in culture. Nat Med 2: 342 346.

PAGE 56

56 25. Samols, M. A., J. Hu, R. L. Skalsky, and R. Renne. 2005. Cloning and identification of a microRNA cluster within the latency associated region of Kaposi's sarcoma associated herpesvirus. Journal of virology 79: 9301 9305. 26. Samols, M. A., R. L. Skalsky, A. M. Maldonado, A. Riva, M. C. Lopez, H. V. Baker, and R. Renne. 2007. Identification of cellular genes targeted by KSHV encoded microRNAs. PLoS pathogens 3: e65. 27. Selbach, M., B. Schwanhausser, N. Thierfelder, Z. Fang, R. Khanin, and N. Rajewsky. 2008. Widespread changes in protein synthesis induced by microRNAs. Nature 455: 58 63. 28. Siegal B, L. K. S., Schiffer A, Sayar J, Engelberg I, Vonsover A, Ramon Y, Rubinstein E. 1990. Kaposi's sarcoma in immunosuppression. Possibly the result of a dual viral infection. Cancer 65: 492 498. 29. Skalsky, R. L., and B. R. Cullen. 2010. Viruses, microRNAs, and host interactions. Annual review of microbiology 64: 123 141. 30. Skalsky, R. L., J. Hu, and R. Renne. 2007. Analysis of viral cis elements conferring Kaposi's sarcoma associated herpesvirus episome pa rtitioning and maintenance. Journal of virology 81: 9825 9837. 31. Tischer, B. K., J. von Einem, B. Kaufer, and N. Osterrieder. 2006. Two step red mediated recombination for versatile high efficiency markerless DNA manipulation in Escherichia coli. Biotechn iques 40: 191 197. 32. Vanni T, S. E., Machado MW, Schwartmann G. 2006. Systemic treatment of AIDS related Kaposi sarcoma: current status and perspectives. Cancer treatment reviews 32: 445 455. 33. Xu, Y. C., W. B. Liang, H. Gou, W. J. Chen, Y. H. Zhu, J. Ji a, and L. Zhang. 2005. [Expression and purification of GST Rta fusion protein from EB virus and preparation of the polyclonal antibody against GST Rta]. Sichuan da xue xue bao. Yi xue ban = Journal of Sichuan University 36: 665 667, 699. 34. Yakushko, Y., C Hackmann, T. Gunther, J. Ruckert, M. Henke, L. Koste, K. Alkharsah, J. Bohne, A. Grundhoff, T. F. Schulz, and C. Henke Gendo. 2010. Kaposi's Sarcoma Associated Herpesvirus Bacterial Artificial Chromosome Contains a Duplication of a Long Unique Region Fra gment within the Terminal Repeat Region. Journal of virology 85: 4612 4617. 35. Ziegelbauer, J. M. 2011. Functions of Kaposi's sarcoma associated herpesvirus microRNAs. Biochimica et biophysica acta.

PAGE 57

57 BIOGRAPHICAL SKETCH Rajni Sangani was born in Jamnag ar, India. The youngest of three siblings in a farming family, he grew up in a rural village Majoth, India. He moved to boarding school at the age of 12 to finish higher secondary ed ucation. He earned his B.S. in b iotechnology in 2002 from Virani Science College, Saurashtra University India. He further earned his p ost g raduate diploma in applied biochemistry from Maharaja Sayajirao University of Baroda in 2004. Further, h e earned MS in biochemistr y from M aharaja Sayajirao University Baroda in 2005. He entered the interdisciplinary program in biomedical sciences at UF in 2007. He changed his mentor and concentration in 2010 and joined Renne Core laboratory as a to overexpress and purify the human m itochondrial ribosme small subunit protein 22. In Spring of 2011, Dr. Rolf Renne agreed to carry over his project of miRNA deletion mutant of KSHV in bacmid and extend it into a master s thesis project.