Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2013-08-31.

MISSING IMAGE

Material Information

Title:
Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2013-08-31.
Physical Description:
Book
Language:
english
Creator:
Holman,Mary E
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Microbiology and Cell Science
Committee Chair:
Maupin, Julie A
Committee Members:
Gonzalez, Claudio F.
Rice, Kelly Christine

Subjects

Subjects / Keywords:
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre:
Microbiology and Cell Science thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility:
by Mary E Holman.
Thesis:
Thesis (M.S.)--University of Florida, 2011.
Local:
Adviser: Maupin, Julie A.
Electronic Access:
INACCESSIBLE UNTIL 2013-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043487:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 SULFUR MOBILIZATION IN ARCHAEA By MARY ELIZABETH HOLMAN A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Mary Elizabeth Holman

PAGE 3

3 To my family

PAGE 4

4 ACKNOWLEDGMENTS I thank my professor, Dr. Maupin, for giving me this project and guiding me through it, and our collaborator Dr. S ll. Thank y ou to Markus Englert from Dr. S laboratory for performing the Northern blots for tRNA thiolation analysis, and to Nathaniel Hepowit protein structure modeling. I thank my undergrad helpers, Mark Guterman and Cori Philips, for working on this project with me.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 LIST OF ABBREVIATIONS ................................ ................................ ............................. 9 ABSTRACT ................................ ................................ ................................ ................... 10 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 12 Sulfur and its Importance in Biomolecules ................................ .............................. 12 Cysteine Desulfurases ................................ ................................ ............................ 13 Rhodaneses ................................ ................................ ................................ ............ 14 Haloferax volcanii A Model Archaeon ................................ ................................ .. 17 Sampylation Sys tem of Haloferax volcanii ................................ .............................. 18 SAMPs are Proposed to Carry Activated Sulfur During Syntheses of Thiamin and Molybdenum Cofactor ................................ ................................ ................... 19 Molybdenum Cofactor Biosynthesis ................................ ................................ ........ 19 Thiamin Biosynthesis ................................ ................................ .............................. 21 Involvement of Ubiquitin Like SAMPs in tRNA Modification ................................ .... 22 Thionucleoside Modifications of tRNA ................................ ................................ .... 22 4 Thiouridine Biosynthesis ................................ ................................ ............... 23 2 Thiouridine Biosynthesis ................................ ................................ ............... 24 Thermus thermophilus Grasp Fold Proteins Involved in Sulfur Relay .................. 26 Uncharacterized Sulfur Transfer Proteins of H. volcanii ................................ .......... 27 Hypothesis ................................ ................................ ................................ ........ 28 Specific Aims ................................ ................................ ................................ .... 28 2 METHODS ................................ ................................ ................................ .............. 33 Materials ................................ ................................ ................................ ................. 33 Strains and Growth Conditions ................................ ................................ ............... 34 D NA ................................ ................................ ................................ ........................ 34 Multiple Sequence Alignments of Putative Sulfur Transfer Enzymes ..................... 34 Generating Knockouts of Proposed Sulfur Transfer Genes ................................ .... 35 Generation of Pre Knockout Plasmids ................................ ............................. 3 6 Generation of Knockout Plasmids ................................ ................................ .... 37 Generation of Markerless Deletions in H. volcanii Using Knockout Plasmids .. 38 Anaerobic Growth Assay with DMSO as the Final Electron Acceptor ..................... 39 Growth Assay in the Absence of Thiamin ................................ ............................... 40

PAGE 6

6 tRNA Thiolation Analysis Using Total RNA ................................ ............................. 40 Extracting Total RNA ................................ ................................ ........................ 40 Assay for Thiolation ................................ ................................ .......................... 41 Determination of Thiosulfate Sulf urtransferase (TST) Activity ................................ 42 Preparation of Cell Lysate ................................ ................................ ................ 42 Determination of Protein Concentration ................................ ........................... 42 Sulfurtransferase Activity Assays ................................ ................................ ..... 43 3 RESULTS ................................ ................................ ................................ ............... 49 Multiple Sequence Alignments of Putative Sulfur Transfer Enzymes ..................... 49 Hvo_0580 A Putative tRNA 2 Thiolation Pro tein ................................ ........... 49 Hvo_0109 A Putative SufS Type Cysteine Desulfurase ................................ 50 Hvo_A0635 A Putative Cyst(e)ine Lyase ................................ ....................... 51 Hvo_0024 and Hvo_0025 Putative Thiosulfate Sulfurtransferases ............... 52 Hvo_1651 A Putative Thiamin Biosynthesis/tRNA Modification Protein ........ 53 Identification of Knockouts by PCR and Southern Blot ................................ ........... 54 Knockout Genes are Not Required for Molybdenum Cofactor Biosynthesis ........... 55 Knockout Genes are Not Required for Thiamin Biosynthesis ................................ 56 Knockout Genes are Not Required for 2 Thiolation of tRN A ................................ ... 57 4 Thiolation of tRNA Requires Further Analysis ................................ ..................... 57 Hvo_0024 is Required for Thiosulfate Sulfurtransferase Activity ............................ 58 4 DISCUSSION ................................ ................................ ................................ ......... 72 LIST OF REFERENCES ................................ ................................ ............................... 77 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 85

PAGE 7

7 LIST OF TABLES Table page 2 1 Plasmids ................................ ................................ ................................ ............. 44 2 2 Strains ................................ ................................ ................................ ................ 45 2 3 Primers ................................ ................................ ................................ ............... 46 2 4 Probes ................................ ................................ ................................ ................ 47 3 1 Thiosulfate Sulfurtransferase (TST) Activity ................................ ....................... 71

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Proposed mechanism of the NifS desulfuration reaction ................................ ... 30 1 2 Model of hypothesized funct ions of uncharacterized sulfur transfer proteins in Haloferax volcanii ................................ ................................ .............................. 31 1 3 ThiI catalyzes the hydrolysis of ATP to AMP and pyrophosphate ...................... 31 1 4 The Cys 344 and Cys 456 residues of E. coli ThiI form a disulfide bond during biosynthesis of 4 thiouridine ................................ ................................ .... 32 2 1 Gene knockout system based on the pyrE2 gene ................................ ............. 48 3 1 Identification of knockouts by PCR ................................ ................................ ..... 60 3 2 Con firmation of the Hvo_0024 knockout by Southern blot. ................................ 60 3 3 Multiple amino acid sequence alignment of the Hvo _0580 protein with proteins of the n type ATP pyrophosphatase superfamily ................................ .. 61 3 4 Multiple amino acid sequence alignment of Hvo_0109 with homologous cysteine desulfurases of the SufS type ................................ .............................. 62 3 5 Multiple amino acid sequence alignment of Hvo_A0635 with homologous cyst(e)ine lyases ................................ ................................ ................................ 63 3 6 Multiple amino acid sequence alignment of the Hvo_0024 and Hvo_0025 proteins with homologous tandem domain rhodaneses ................................ ..... 65 3 7 Hvo_0024 and Hvo_0025 gene region s ................................ ............................. 66 3 8 3D structure analysis of putative sulfurtransfera ses of H. volcanii and the T. thermophilus TST 1UAR ................................ ................................ ..................... 66 3 9 Multiple amino acid sequence alignment of the Hvo_1651 protein with homologous ThiI proteins ................................ ................................ ................... 68 3 10 Anaerobic growth with DMSO as the terminal electron acceptor ........................ 69 3 11 Growth in the absence of thiamin ................................ ................................ ....... 70 3 12 tRNA 2 thiolation analysis by APM gel electrophoresis and Northern blot with tRNA Lys UUU probe ................................ ................................ ............................... 70 3 13 tRNA 4 thiolation analysis by APM gel electrophoresis and Northern blot with tRNA Ala GGC probe ................................ ................................ ................................ 71

PAGE 9

9 LIST OF ABBREVIATIONS MoCo Molybdenum cofactor MST Mercaptopyruvate sulfurtransferase S 2 U 2 thiouridine S 4 U 4 thiouridine TST Thiosulfate su l furtransferase

PAGE 10

10 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science SULFUR MOBILIZATION IN ARCHAEA By Mary Elizabeth Holman August 2011 Chair: Julie A. Maupin Furlow Major: Microbiology and Cell Science Sulfur is essential to life, with an persulfide required for the generation of a number of biomolecules Re duced sulfur from cysteine serves as the substrate for per sulfide formation by cystei ne desulfurase enzymes. R hodaneses can generate persulfide in vitro while i n vivo roles of these enzymes remain largely unknown. P ersulfide transfer has been extensively studied in bacteria and eukaryotes, while lit tle is known regarding these pathways in the domain archaea. Small Archaeal Modifier Proteins (SAMPs) and their activating enzyme UbaA have been demonstrated to act in molybdenum cofactor biosynthesis and tRNA 2 thiolation in the archaeon Haloferax volcanii However, t he source of pers ulfide sulfur is unknown, as well as any additional sulfur relay proteins in teracting in the se pathways M echanistic and enzymatic similarities between MoCo, 2 and 4 thiour idine, and thiamin biosyntheses suggest that SAMPs also act in sulfur mobilization during synthes e s of thiamin and 4 thiouridin e In an attempt to further characterize these p athways in archaea, Hvo_A0635, Hvo_0109, Hvo_1651, H vo_0024, Hvo_0025 and Hvo_0580 were investigated for possible sulfur mobilization roles in H. volcanii Comparative genomics revealed that Hvo_0109 and Hvo_A0635 share homology with SufS type cysteine

PAGE 11

11 desulfurases and cyst(e)ine lyases, respectively. Hvo_0580 is homologous to n type ATP pyro phosphatases involved in 2 thiomodifica tion. Hvo_1651 is homologous to thiamin biosynthesis/tRNA modif ication protein s of the ThiI family The presence of s ignature motifs and conserved 3D structure indicate Hvo_0024 and Hvo_0025 as TST type rhodaneses Knockouts in Hvo_A0635, Hvo_1651, Hvo_0024 and Hvo_0025 were assayed for growth in the absence of thiamin, anaerobic growth with DMSO as the terminal electron acc eptor and tRNA thiolation by APM gel electrophores i s and Northern blot. Hvo_0109 and Hvo_0580 strains are pending confirmation and were not used for phenotype analysis. Assays indicated that Hvo_A0635, Hvo_1651, Hvo_0024 and Hvo_00 25 are not require d for the s ynthesis of thiamin, MoCo, or 2 thiouridine. Thiosulfate sulfurtransferase (TST) assays of Hvo_0024 and Hvo_0025 knockouts revealed a requirement of Hvo_0024 for TST activity in H. volcanii Future work in characterizing these proteins, including the possi bly critical persulfide donor Hvo_0109 and probable tRNA 2 thiolation protein Hvo_0580 will further our understanding of archaeal sulfur mobilization and its relation to bacterial and eukaryotic systems.

PAGE 12

12 CHAPTER 1 INTRODUCTION Sulfur and its Importance in Biomolecules Sulfur is one of twelve non metallic elements essential to life (Beinert, 2000a), as it is needed to synthesize many biomolecules, including amino acids, vitamins, and cofactors. Sulfur certainly ha s some unique properties the chemical bonds can be broken easily, and it can serve as both a nucleophile and an electrophile (Beinert, 2000b). Sulfur has a strong tendency to self associate and cannot be found as a single atom in nature (Beinert, 2000a). This tendency goes so far that, when the chain of sulfur atoms is long enough that the ends can touch, rings of elemental sulfur are formed. For this reason, elemental sulfur is no t soluble and is not readily accessible to microorganisms (Beinert, 2000a). For the incorporation of sulfur into biomolecules, sulfur must be in a reduced form (sulfide) or an activated form termed sulfane sulfur (Kessler, 2006). Reduced sulfur in the form of sulfide can be incorporated into the amino acid cysteine, which serves as the substrate for many sulfur transfer proteins. Although sulfide is toxic, it is tolerated by cells at levels that allow for the synthesis of cysteine (Kessler, 2006). Interestingly, cysteine as a free am ino acid is also toxic to cells. In vitro analys is shows rapid reduction of ferric iron by free cysteine, result ing in high levels of hydroxyl radicals in the presence of hydrogen peroxide (Park & Imlay, 2003). Cysteine pools maintained at low levels ( 100 200 M ) allow minimal DNA damage to occur due to this process (Park and Imlay, 2003). The transfer of sulfur in the sulfane form between sulfur carriers has been recognized as a cellular mechanism to avert the toxicity of free sulfide (Cartini et al ., 2011). Sulfane sulfur is also referred to as persulf idic sulfur, since enzymes that generate this active form take a sulfur atom

PAGE 13

13 from a cysteine substrate onto a persulfide group on their active site. Low molecular weight persulfides in the free form degrade to thiol and elemental sulfur under most conditio ns (Kessler, 2006). However, while free persulfides may be very labile, when in the sheltered environment of an enzyme active site they can be protected and transported to sites of biosynthesis (Beinert, 2000a). Cysteine Desulfurases Enzymes that generate and transfer sulfane sulfur include the cysteine desulfurases. The sulfur transfer role of the cysteine desulfurases has proven essen tial in the biosyntheses of Fe S clusters, thiamine, thionucleosides in tRNA, biotin, and molybdopt erin, among others (Begl ey et al ., 1999; Marquet 2001). Cysteine desulfurases catalyze the formation of sulfane sulfur by removing sulfur from the amino acid cysteine in a pyridoxal phosphate dependent reaction, which can be generally outlined using the prototype Azotobacter vin elandii cysteine desulfurase NifS (F igure 1 1) (Zheng et al ., 1994). The reaction is initiated by the binding of a pyridoxal phosphate cofactor to the NifS enzyme. Cofactor bound NifS then binds the cysteine substrate to cause a rearrangement of the substrate structure, which eventually results in the formation of a quinonoid intermediate (Zheng et al ., 1994). At this stage, the cysteine sulfur is attacked by the NifS cysteinyl residue to form a persulfide intermediate. Cleavage of the bond between the cysteine substrate and its sulfur results in a sulfane sulfur boun d NifS and a pyridoxal phosphate bound alanine (Zheng et al ., 1994). The sulfane sulfur present on the cysteine desulfurase can then be transferred to sulfur carrier enzymes of various biosynthetic pathways (Cartini et al ., 2011). An additional cysteine d esulfurase identified in A. vinelandii is the IscS protein, na med for its role is Fe S cluster biosynthesis (Zheng et al ., 1998). A homolog of A.

PAGE 14

14 vinelandii IscS has also been identified in Escherichia coli and is given the name IscS (Mihara and Esaki, 2 002). IscS is biochemically very similar to NifS and follows the same general reaction mechanism (Kessler 2006). Solved crystal structures of E. coli IscS and the NifS cysteine desulfurase from Thermotoga maritima show that these enzymes are homodimers (K aiser et al ., 2000; Cupp Vickery et al ., 2003). Each monomer has a large domain containing the pyridoxal phosphate cofactor and a small domain containing the active site loop with the critical cys teinyl residue (Kaiser et al 2000; Cupp Vickery et al ., 20 03). The IscS protein of E. coli serves as the central sulfur providing enzyme known to directly provide sulfur for the biosynthesis of Fe S proteins, thiamin, and all thionucleosides (Lauhon & Kambampati, 2000; Lauhon, 2002). Additionally, IscS may provide sulfur to other biomolecules through more indirect pathways (Kessler 2006). The central importance of the IscS cysteine desulfurase in E. coli has prompted the search for homologs in other organisms. Indeed, IscS hom ologs often contain signature motifs and are proximal to other Isc type components on the genome (Kessler 2006). Several different cysteine desulfurases have been identified in many different organisms, but only one has been characterized from the domain archaea. A cysteine desulfurase homolog from Haloferax volcanii termed SufS has shown a likely role in Fe S cluster assembly due to its ability to reassemble Fe S clusters in vitro when incubated with Fe 2+ and L cysteine (Zafrilla et al ., 2010). Rhodane ses In addition to the cysteine desulfurases, rhodanese enzymes are also able to catalyze the transfer of sulfane sulfur. Proteins containing rhodanese domains are found in many different organisms from all three domains of life and have been suggested to be involved in a range of biological processes (Bordo and Bork, 2002). Rhodaneses

PAGE 15

15 catalyze the transfer of sulfane sulfur from a donor molecule to a thiophilic acceptor. In vitro these enzymes catalyze the transfer of sulfur from a thiosulfate donor to a cyanide acceptor (Bordo and Bork, 2002). For this reason, rhodaneses are referred to as thiosulfate:cyanide sulfurtransferases by official nomenclature rules (Cipollone et al ., 2007). Since the in vivo substrates of many of these enzymes have not yet been identified, the physiological role of most rhodaneses remains unclear (Cipollone et al ., 2007). Rhodanese enzymes are not only widespread among organisms, but often are numerous w ithin individual genomes The Pseudomonas aeruginosa genome encodes ten rhoda nese proteins, with varying structural features (Cipollone et al ., 2007). The presence of several rhodanese proteins in a single organism suggests varied physiological roles within the rhodanese superfamily. Proposed roles include cyanide detoxification ( Sorbo 1957) and synthesis of several sulfur containing biomolecules such as Fe S cluster proteins (Pagani et al ., 1984), thiamin (Palenchar et al ., 2000), thiouridine (Palenchar et al ., 2000) and molybdopterin (Leimkuhler and Rajagopalan, 2001). The rhodanese superfamily proteins vary immensely in sequence, with the exception of conserved amino acid stretches at the N and C terminal regions, known as rhodanese signatures (Cipollone et al ., 2007). These rhodanese signatures are used to identify rhodanese proteins from many organisms of different phyla (Cipollone et al ., 2007). While the sequences of rhodanese proteins may vary significantly, structurally the rhodanese proteins are highly simi lar and can be categorized based on their quaternary structure. Rhodanese domain proteins are classified as single domain, tandem domain, or multidomain proteins depending on the number of rhodanese and

PAGE 16

16 other protein domains that are present on the protein (Cipollone et al ., 2007). Single domain rhodanese proteins containing only the C terminal catalytic domain are found in both prokaryotic and eukaryotic genomes (Cipollone et al ., 2007). The only case reported thus far of a single domain rhodanese that doe s not possess in vitro thiosulfate:sulfurtransferase activity is the Wolinella succinogenes Sud protein, which catalyzes the transfer of sulfur from polysulfide to cyanide (Kreis Kleinschmidt et al ., 1995). The second category of rhodanese proteins, the ta ndem domain rhodaneses, are very common, and contain a catalytic C terminal domain as well as an inactive N terminal domain. These proteins often display sulfurtransferase activity in vitro either as thiosulfate sulfurtransferases (TSTs) or 3 mercaptopyru vate sulfurtansferases (MSTs) with cyanide as the sulfur acceptor (Cipollone et al ., 2007). The high structural similarity between the TSTs and MSTs can be demonstrated by the conversion of enzymes with TST activity to those with MST activity and vice vers a by site direc ted mutagenesis (Nagahara et al ., 1995). T he amino acid sequences in the active site of these enzymes appear to serve as the main determinant of sulfur donor specificity. A third category of rhodaneses, the multidomain rhodaneses, contain a catalytic rhodanese domain in combination with one or more domains of different function. The role of the rhodanese domain in multidomain proteins seems to be related to the role of the attached domains. For example, ThiI is a multidomain protein in bacter ia that contains a C terminal rhodanese domain and an N terminal THUMP domain. The ThiI protein is involved in the biosynthetic pathways of both the vitamin thiamin and 4 thiouridine, a modified base found in some bacterial tRNAs (Palenchar et al ., 2000). The N terminal THUMP domain of ThiI is known to function in bringing RNA modification enzymes to their targets

PAGE 17

17 (Cipollone et al ., 2007). A proposed mechanism of ThiI involves a cysteine desulfurase to transfer sulfur to the ThiI rhodanese domain, which can then provide active sulfur for the biosynthesis of thiamin and 4 thiouridine (Mueller et al ., 2001). Haloferax volcanii A Model Archaeon The group of organisms classified as archaea have only recently been recognized as one of three fundamental domains of life (W oese et al ., 1990). Archaea inhabit some of the most extreme environments on the planet, including conditions with pH values as low as 0.2 (Schleper et al ., 1995), temperatures as high as 122 o C (Takei et al ., 2008), or pressures as high as 40 MPa ( Marteinsson et al ., 1999 ). Haloferax volcanii is a halophilic archaeon naturally found in hypersaline environments such as the Dead Sea (Mullakhanbhai and Larsen, 1975). Cells of H. volcanii are disc shaped and appear cupped when grown under optimal conditions (Mullakhanbhai and Larsen, 1975). The mechanism utilized by this organism for maintaining homeostasis while tolerating such high salt conditions is an accumulation of intracellular cations or countercations (Mevarech et al ., 2000). Because of thi s, most H. volcanii proteins require salt for their activity, with an optimal concentration of 1.7 2.5 molar (Mullakhanbhai and Larsen, 1975). In addition to high salt requirements, H. volcanii cells grow optimally in the presence of oxygen and at a temper ature of 42 o C (Mullakhanbhai and Larsen, 1975). However, anaerobic growth can be achieved with nitrate ( Bickel Sankotter and Ufer 1995 ) dimethyl sulfoxide (DMSO), trimethylamine oxide (TMAO) or fumarate as alternative electron acceptors (Oren and Truper, 1990; Oren 1991). H. volcanii grows on a wide variety of sugars, sugar alcohols and low molecular weight acids as sole carbon and energy sources under aerobic conditions (Javor 1984).

PAGE 18

18 Haloferax volcanii is a model archaeon for the study of archaeal cell physiology due to its ease of culture in the laboratory, rapid methods of gene knockout and transformation, stable genome, and ability to express and purify affinity tagged proteins from cells, to name a few (Soppa 2006; Allers and Mevarech 2005). The genome of H. volcanii strain DS2 has been sequenced in its entirety and consists of a main chromosome of 2.8 Mbp and four smaller replicons named pHV1 (86 Kb), pHV2 (6.4 Kb), pHV3 (442 Kb) and pHV4 (690 Kb) (Hartman et al ., 2010). Genome sequencing of archaeal organisms has revealed that while the archaea are similar to prokaryotes in general morphology, they share many characteristics with the eukaryotes (Brown and Doolittle 1997). This includes similariti es in archaeal and eukaryotic enzymes involved in transcription (Bell and Jackson 2001), translation (Dennis 1997), and DNA replication (MacNeill 2001). Sampylation System of Haloferax volcanii Ubiquitin like S mall A rchaeal M odifier P roteins SAMP1 and SAMP2 from the archaeon H. volcanii have been shown to covalently attach to proteins by a ubiquitin like isopeptide bond (Humbard et al ., 2010). It is hypothesized that this archaeal SAMPylation system served as an evolutionary precursor to the ubiquitinat ion system that is u niversal in eukaryotes (Humbard et al ., 2010). In the eukaryotic system, conjugation of ubiquitin and ubiquitin like proteins to their targets serves a role in prote a some mediated proteolysis, heterochromatin remodeling, and protein tra fficking ( Hochstrasser 2009). Ubiquitin and ubiquitin like proteins belong to a superfamily of small proteins characterized by a grasp fold ( Hochstrasser 2000 ). The grasp fold

PAGE 19

19 proteins happen are widespread among the archaea and include SAMPs 1 and 2 (Humbard et al ., 2010). Miranda et al. (2011) proposed a model in which SAMP1 and SAMP2, as well as the E1 like activating enzyme UbaA, are involved in both protein conjugation and sulfur transfer. T he first step in the putative sulfur transfer pathway is the adenylation of SAMPs by UbaA which is thought to activate these proteins for both protein conjugation and acceptance of sulfur Generation of the C terminal thiocarboxylated SAMPs by the additio n of active sulfur is thou ght to occur next likely with a cysteine desulfurase serving as the sulfur donor (Miranda et al ., 2011 ). Rhodanese proteins may relay the sulfur from the cyst eine desulfurases to the SAMPs (Miranda et al ., 2011). SAMPs are Propos ed to Carry Activated Sulfur During Syntheses of Thiamin and Molybdenum Cofactor Interestingly, the enzymology and mechanism of the activation of the ubiquitin and ubiquitin like proteins is strikingly similar to the activation of sulfur in the biosyntheti c pathways of thiamin and molybdenum cofactors (Kessler 2006). For this reason, it is presumed that the archaeal SAMPs act to carry activated sulfur for synthesis of thiamin and molybdenum cofactors. Bacterial grasp fold proteins and their respective E1 like activating enzymes function in thiamin and molybdenum cofactor biosynthesis, so it is likely that this is the case in archaea as well (Makarova and Koonin 2010). Miranda et al. (2011) linked the UbaA and SAMP1 proteins to sulfur transfer in molybd enum cofactor biosynthesis by demonstrating the requirement for cells to grow under anaerobic conditions with DMSO as the terminal electon acceptor. Molybdenum Cofactor Biosynthesis The activation of ubiquitin like proteins such as the archaeal SAMPs by E 1 like

PAGE 20

20 activating enzymes is very similar to the activation of sulfur during molybdenum cofactor biosynthesis in enzymology and mechanism. The pterin based molybdenum cofactor (MoCo) is required for the activity of a number of molybdoenzymes including nitr ate reductase and xanthine d ehydrogenase (Kessler 2006). MoCo biosynthesis is an evolutionarily conserved pathway present in all three kingdoms of life (Kessler 2006). During MoCo biosynthesis, two sulfur atoms are incorporated into a cyclic pyranopterin monophosphate precursor, known as precursor Z, using a protein thiocarboxylate as a sulfur donor. Synthesis begins with adenylation of the C terminal glycine of the MoaD protein by the ATPase MoeB (Shigi et al ., 2008). This step is homologous to the adeny lation of the ubiquitin like SAMPs by the activating enzyme UbaA (Schindelin 2005). Cysteine desulfurase or rhodanese proteins then transfer activated sulfur to MoaD to create the thiocarboxylated form of MoaD (Kessler 2006). This thiocarboxylated MoaD f orms a heterotetrameric complex with another protein, MoaE, forming molybdopterin synthase (Schwarz et al ., 2009). The molydopterin synthase complex catalyzes the transfer of two sulfur atoms from two bound MoaD thiocarboxylates to precursor Z to create mo lybdopterin (Shigi et al ., 2008). This incorporation of sulfur from the MoaD thio carboxylates into precursor Z occurs in two successive steps (Kessler 2006). Evidence for a reaction intermediate that contains a single sulfur atom incorporated into precurs or Z has been obtained, although it is unknown which position of precursor Z first incorporates one of the sulfur atoms of the MoaD thiocarboxylates (Kessler 2006). The sulfurtransferase involved in transferring activated sulfur to MoaD to create the thi ocarboxylated form appears to be IscS in E. coli ( Zhang et al ., 2010 ). In humans,

PAGE 21

21 a cytosolic protein termed MOCS3, which contains a C terminal rhodanese like domain, seems to be involved in both adenylation and sulfur transfer to the MoaD homolog, MOCS2A, during molybdenum cofactor biosynthesis ( Matthies et al ., 2005; Schmitz et al ., 2008). The sulfur donor to MoaD to create the MoaD thiocarboxylate in archaea has not yet been identified. Thiamin Biosynthesis S ulfur activation during the biosynthesis of t hiamin is very similar in enzymology and mechanism to that of MoCo and the activat ion of ubiquitin like proteins. Although SAMPs have been demonstrated to act in MoCo biosynthesis currently no proteins involved in archaeal thiamin biosynthesis have been i dentified Thiamin pyrophosphate is essential for all living organisms and performs a key role as the cofactor of enzymes involved in metabolism of carbohydrates and the biosynthes i s of branched chain amino acids (Kessler 2006). In thiamin biosynthesis, t he crucial sulfur containing intermediate is the thiocarboxylated ThiS protein (Kessler 2006). The ThiS thiocarboxylate is generated in a two step process similar to ubiquitin like protein activation by the ubiquitin activating enzyme and also to the firs t step in MoCo biosythesis (Kessler 2006). It is not surprising, then, that the ThiS protein shares the C terminal Gly Gly sequence with ubiquitin, whereas ThiF shares high sequence similarity with ubiquitin activating enzyme (Kessler 2006). To generate t he ThiS thiocarboxylate, ThiS is first adenylated by ThiF in an ATP dependent reaction, at which point activat ed sulfur is introduced by the cysteine desulfurase IscS (Kessler 2006). In E. coli an additiona l protein is involved named ThiI for its role i n thiamin biosynthesis (Mueller, 2006) Since ThiI contains a rhodanese like module, it is likely that this protein serves as a persulfide carrier (Kessler 2006). The role of ThiI in thiamin biosynthesis, however, is unclear.

PAGE 22

22 While E. coli cannot synthesi ze thiamin when the thiI gene is knocked out, the in vitro thiolation of E. coli ThiS does not require ThiI (Mueller 2006). It is possible that a more efficient in vitro system would involve unidentified sulfur carrier proteins acting together with ThiI (Mueller 2006). Involvement of Ubiquitin Like SAMPs in tRNA Modification A direct physical association has been demonstrated between the archaeal homolog (Hvo_0580) of the eukaryotic Urm1 associated tRNA thiolation protein Ncs6p and the ubiquitin like SAM P2 protein (Humbard et al ., 2010). The eukaryotic Urm1 protein and its associated protein Ncs6p have been shown to be involved in specific tRNA modification by a process in which Uba4 adenylates and di rectly transfers sulfur to Urm1 (Leidel et al ., 2009) Ncs6p binds and activates tRNA by adenylation for acceptance of activated sulfur from the Urm1 thiocarboxylate (Leidel et al ., 2009). With the finding that the archaeal ubiquitin like protein SAMP2 and its activating enzyme UbaA are required for tRNA 2 thi olation (Miranda et al ., 2011), it seems likely that the archaeal Ncs6p homolog, Hvo_0580, serves a role in this process as well. Given the ubiquity of a variety of tRNA modifications across cellular life, this is likely to be the ancestral function of the ubiquitin like proteins that subsequently were recruited for other chemically similar reactions, such as MoCo and thiamine biosynthesis, as well as protein modification (Makarova and Koonin 2010). Thionucleoside Modifications of tRNA Over 100 post transcriptional RNA modifications have been identified in RNA molecules across all three domains of life (Rozenski et al ., 1999). In general, tRNA modifications found in regions outside of the anticodon loop contribute to a more stable tertiary structure, while those located in the anticodon loop are thought to influence the

PAGE 23

23 accuracy and efficiency of translation by affecting how the tRNA interacts with the ribosome and messenger RNA (Rogers et al ., 1995). An example of a post transcriptional modification occurring both inside and outside the anticodon loop of tRNA is the thiolation modification. E. coli is known to contain four different types of thiolated nucleosides including 2 thiouridine and 4 thiouridine (Kessler 2006). The 2 and 4 thiouridine modifications have also been identified in archaeal species (Mc C loskey et al ., 2001, Aravind et al ., 2001). Interestingly, althoug h the eukaryotes have been shown to possess the 2 thiouridine base (Laten et al .,1983) the presence of 4 thio uridine has never been detected. 4 Thiouridine Biosynthesis The 4 thiomodification of uridine has been shown to occur in both bacterial and archae al organisms. Some bacteria use the modified nucleoside 4 thiouridine at position 8 in tRNA as a photosensor of ultraviolet (UV) light (Mueller 2006). When exposed to UV light, the nucleosides 4 thiouridine and cytidine 13 undergo a cross linking reaction (Bergstrom and Leonard 1972), stopping protein synthesis and arresting growth (Ramabhadran and Jagger 1976; Kramer et al ., 1988). This process allows for the repair of UV induced DNA damage, and growth resumes upon synthesis of new tRNAs (Mueller 2006). In E. coli all of the tRNAs contain s 4 U to some extent, although the levels of s 4 U in particular tRNAs are found to vary wit h growth rate ( Emilsson et al ., 1992 ) Very little is known regarding the synthesis of 4 thiouridine in archaea. In bacteria, the thiamin and 4 thiouridine synthesis pathways are very similar in the respect that both utilize the IscS and ThiI enzymes for t he delivery of activated sulfur (Mueller 2006). Activated sulfur generated by IscS is transferred to the rhodanese domain of the

PAGE 24

24 ThiI protein (Kessler 2006), which then binds tRNA to transfer sulfur for 4 thiouridine generation (Mueller 2006). It has be en demonstrated that mutants in thiI continue to grow when exposed to near UV light, as these mutants do not generate the s 4 U modification in tRNA that serves as the photosensor (Mueller et al ., 1998). Mechanistic details of ThiI binding and transfer of a ctivated sulfur to tRNA are becoming more clear as direct evidence is gathered from the E. coli ThiI protein. Fairly recent evidence for Thi I as an ATP pyrophosphatase which activates the uridine substrate by adenylation before transfer of sulfur has provi ded another striking similarity in the pathways of 2 and 4 thiouridine syntheses (Figure 1 3) (You et al 2008). It is now known that cysteines 344 and 456 of ThiI are critical for the formation of s 4 U modified tRNA in E. coli (Palenchar et al 2000; Mueller et al 2001). These critical cys 344 and cys 456 residues have been demonstrated to form a disulfide bond on the same ThiI protein during the generation of s 4 U (Figure 1 4) (Chapman et al 2006). In addition, direct evidence exists for a role of cys 4 56 as the persulfide active site of E. coli ThiI (Chapman et al 2006). The presence of a persulfide group on ThiI when incubated with only IscS and cysteine indicates that no intermediate sulfur carrier is required for the formation of s 4 U (Chapman et al 2006), considering also that the rate of s 4 U synthesis by ThiI and IscS matches the rate of 2 thiouridine formation by the complete system including the sulfur carrier proteins (Ikeuchi et al ., 2006). 2 Thiouridine Biosynthesis The 2 thiouridine modification is found in the wobble position of tRNAs specific for lysine, glutamine, and glutamate (Mueller 2006). Post transcriptional RNA modifications at the first (wobble) position of the tRNA anticodon participate in the precise decoding of the gen etic code mediated by codon anticodon interactions (Agris

PAGE 25

25 et al ., 2007). The wobble modifications control codon recognition by restricting, expanding, or altering the decoding properties of tRNA (Agris et a l., 2007). In bacteria, the process of generating 2 thiouridine is similar to that of 4 thiouridine excep t for a few important differences. Activated sulfur generated by IscS is incorporated into 2 thiouridine via the protein MnmA (Mueller 2006). MnmA contains the signature motif of the ATP pyrophospha tase superfamily, suggesting that it activates its substrates by forming adenylated intermediates (Kambampati and Lauhon, 2003; Umeda et al ., 2005). However, whether MnmA contains a rhodanese like module for the transfer of activated sulfur is less clear, as a persulfidic intermediate could not be observed with this protein but has been suggested (Kessler 2006). Also, five addit ional proteins characterized as persulfide carriers are involved in the 2 thiouridine pathway that constitute a complex sulfur rel a y system (Ikeuchi et al 2006). An enzyme persulfide is therefore the most probable sulfur donor to the activated uridine for both 4 thiouridine and 2 thiouridine formation in bacteria such as E. coli (Kessler 2006). In archaea, it has been shown that the ubiquitin activating enzyme homolog UbaA and ubiquitin like protein SAMP2 are required for 2 thiouridine synthesis, although not all steps in this pathway have been identified (Miranda et al ., 2011). Similarly, eukaryotic 2 thiouridine formation occur s through a chemical reaction related to ubiquitination. Yeast s 2 U synthesis requires the cysteine desulfurase Nfs1, ubiquitin like Urm1, and its activating enzyme Uba4 (Noma et al ., 2009). During synthesis, Uba4 activates the C terminus of Urm1 by adenyla tion, then transfers active sulfur from Nfs1 to Urm1 to form the Urm1 thiocarboxylate. Tandem domain rhodanese TUM1, although not essential for s 2 U synthesis, is likely involved in persulfide transfer from Nfs1 to the

PAGE 26

26 rhodanese module on Uba4 (Noma et al ., 2009). The Urm1 thiocaboxylate transfers sulfur to tRNA with assistance from the Ncs6p/Ncs2p complex. Ncs6p like mnmA, contains the ATP pyrophosphatase signature motif, which suggests that this protein adenylates uridine upon tRNA binding (Leidel et al ., 2009) By forming a complex with Ncs6p, Ncs2p may influence the tRNA binding activity of Ncs6p or it might play an enzymatic role in the thiolation process (Leidel et al ., 2009) Thermus thermophilus Grasp Fold Proteins Involved in Sulfur Relay g rasp f old proteins and E1 like enzymes of the thermophilic bacterium Thermus thermophilus act in a sulfur transfer pathway tha t resembles what is currently known of the archaeal sulfur transfer system involving the SAMPs The Thermus E1 like protein TtuC, gra sp fold proteins TtuB and TtuA, as well two cysteine desulfurases (IscS a nd SufS type) comprise a system essential for the 2 thiolation of ribothymidine (Shigi et al ., 2006a,b; Shigi et al ., 2008). This modified nucleoside of uridine, abbreviated s 2 T, is found at position 54 in transfer tRNAs from several thermophiles and acts to stabilize tRNA at high temperatures (Watanabe et al ., 1974; Kowalak et al ., 1994). The T. thermophilus TtuC (tRNA two thiouridine C) protein is an E1 like enzyme that adenyl ates the C termin al glycine of the grasp fold TtuB protein, much like the E1/UbaA/MoeB proteins that activate the ubiquitin/ubiquitin like/MoaD proteins (Shigi et al ., 2008). Th e activated TtuB protein is thiocarboxylated by cys teine desulfurases, and th e sulfur on TtuB is taken by TtuA for transfer to tRNA (Shigi et al ., 2008; Shigi et al ., 2006 a ). In addition to the thiomodification of tRNA, the TtuC protein has also shown to be involved in thiamin and molybdenum cofactor biosyntheses (Shigi et al ., 200 8). Interestingly, TtuB and TtuC form thiol based conjugates in vitro (Shigi et al ., 2008) much like the eukaryotic ubiquitin and E1 proteins and their homologs in H. volcanii

PAGE 27

27 (Hepowit et al ., unpublished results). Functions of the sulfur transfer proteins of T. thermophilus could therefore provide insight into functions of the homologous proteins in H. volcanii Uncharacterized Sulfur Transfer Proteins of H. volcanii The H. volcanii genome encodes several proteins with suspected roles in sulfur mobilization. Hvo_0024, Hvo_0025, Hvo_1651, Hvo_A0635, Hvo_0109, and Hvo_0580 are among these putative sulfur transfer proteins and are hypothesized to be involved in molybdenum cofactor, thia min, 2 thiouridine, or 4 thiou ridine biosyntheses Hvo_A0635 and Hvo_0109 are homologs of cyst(e)ine lyases and SufS type cysteine desulfurases, respectively Our working model is that these proteins serve as the source of activated sulfur for the pathways mentioned above. The cysteine desulfurases either directly transfer persulfide sulfur t o the ubiquitin like SAMPs or relay the persulfide to rhodanese like proteins Hvo_0024 and Hvo_0025 These tandem domain rhodanese like proteins (Hvo_0024 and Hvo_0025) may act to transfer sulfur to SAMP1 and SAMP2. SAMP1 and its activating enzyme UbaA have been linked to MoCo biosynthesis (Miranda et al ., 2011) but the process of sulfur transfer to SAMP1 remains unclear, as well as any additional sulfur relay proteins n ecessary to synthesize of the molybdenum cofactor in H. volcanii SAMP2 and the activating enzyme UbaA, on the other hand, are necessary for 2 thiolation of uridine nucleosides in tRNA (Miranda et al ., 2011). This is thought to be assisted by the n type AT P pyrophosphatase superfamily protein Hvo_0580, which is proposed to activate tRNA by adenylation before transfer of sulfur from the SAMP2 thiocarboxylate to the uridine nucleoside. Activation of sulfur during biosynthesis of thiamin closely resembles that of molybdenum cofactor synthesis as well as the activation of SAMPs by UbaA. Given that

PAGE 28

28 archaeal MoCo synthesis has been indirectly shown to require SAMP1 and UbaA, it is likely that SAMPs act in the synthesis of thiamin as well. The E. coli ThiI protein is known to be involved in both thiamin and 4 thiourid ine biosynthesis (Mueller 2006). Since SAMP2 is required f or tRNA 2 thiolation, it is lik ely that SAMPs interact with the ThiI homolog Hvo_1651, which has putative roles in both thiamin and 4 thiouridi ne syntheses based on known roles of bacterial ThiI. Hypothesis Our hypothesis for this study is that Hvo_0109 and Hvo_A0635 serve to generate persulfide for transfer to rhodanese proteins Hvo_0024 and Hvo_0025 or directly to SAMP 1 and SAMP2 during synthe sis of molybdenum cofactor, thiamin, and thionucleosides 2 and 4 thiouridine (Figure 1 2). We propose that the Hvo_0580 protein adenylate s tRNA for acceptance of sulfur by SAMP2 in the biosynthesis of 2 thiouridine. We also propose that Hvo_1651 activates tRNA by adenylation in additio n to transferring sulfur for the formation of the modified nucleoside 4 thiouridine. An additional role as a persulfide carrier in thiamin biosynthesis is expected for this protein. Specific Aims To test the above hypothesis, markerless deletion strains will be generated for each putative sulfur mobilization gene and analyzed for the phenotype of the mutant compared to the parent strain in several assays. A growth assay in the absence of thiamin will determine a possible requi rement for each knockout gene in thiamin biosynthesis, while anaerobic growth assay with DMSO as the terminal electron acceptor will determine possible requirement of knockout genes in MoCo biosynthes is. Analysis of total RNA by APM gel electrophoresis and Northern blot will determine any genes essential for 2 and 4 thiolation of tRNA by probing for specific tRNA species

PAGE 29

29 thought to contain these modifications. Finally, thiosulfate sulfurtransferase activity assays will be performed on Hvo_0024 and Hvo_0025 and compared to the parent strain to determine if these genes are required for TST activity.

PAGE 30

30 Figure 1 1. Proposed mechanism of the NifS desulfuration reaction (Zheng et al ., 1994).

PAGE 31

31 Figure 1 2. Model of hypothesized functions of uncharacterized sulfur transfer proteins in Haloferax volcanii Figure 1 3. ThiI catalyzes the hydrolysis of ATP to AMP and pyrophosphate. Direct evidence suggests formation of an adenylation intermediate in tRNA m odification by suspected ATP pyrophosphatase ThiI (You et al ., 2008).

PAGE 32

32 Figure 1 4. The C ys 344 and C ys 456 residues of E. coli ThiI form a disulfide bond during biosynthesis of 4 thiouridine (Chapman et al 2006).

PAGE 33

33 CHAPTER 2 METHODS Materials ATCC 974 liquid medium consisted two separately mixed solutions. Solution one consisted of 125 g NaCl, 50 g MgCl 2 2 O, 5 g K 2 S0 4 and 0.134 g CaCl 2 2 O brought to a final volume of 750 ml in deionized water. Solution two consisted of 5 g tryptone and 5 g yeast e xtract brought to a final volume of 250 ml in deionized water. The two solutions were combined after autoclaving to make a final volume of 1 liter. ATCC 974 solid agar plates followed the same recipe with the exception that all ingredients were mixed at on ce and 20 g agar was added to the mixture. Luria Bertani (LB) medium consisted of 10 g NaCl, 10 g tryptone, and 5 g yeast extract, brought to a final volume of 1 liter in deionized water. Solid LB medium followed the same recipe with the addition of 15 g a gar. YPC medium consisted of 100 ml deionized H 2 O, 200 ml 30% salt water [240 g NaCl, 30 g MgCl 2 2 O, 35 g MgSO 4 2 O, 7 g KCl, and 20 ml 1 M Tris HCl pH 7.5 in 1 liter final volume] and 33 ml 10X YPC [1.65 g yeast extract, 0.33 g peptone, 0.33 g casamino acids, and 582 l 1 M KOH in a final volume of 33 ml in deionized H 2 O], with the addition of 3 mM CaCl 2 to the sterilized mixture upon cooling. Casamino acids (CA) solid medium consisted of 100 ml deionized H 2 O, 200 ml 30% salt water (see above), 5 g agar and 33 ml 10X CA [1.65 g casamino acids and 776 l 1 M KOH to a final volume of 33 ml in deionized H 2 O] with the addition of 3 mM CaCl 2 0.8 1 thiamin and 0.01 1 biotin to the sterilized mixture upon cooling. Glycerol minimal medium (GMM) con sisted of 200 ml 30% salt water (see above), 110 ml deionized H 2 0, and 10 ml 1 M Tris HCl pH 7.5. After sterilization and cooling, 5 mM NH 4 Cl, 20 mM glycerol, 3 mM CaCl 2 trace minerals (1.8 mM MnCl 2 4H 2 O, 1.5 mM ZnSO 4 7H 2 O, 8.3 mM

PAGE 34

34 FeSO 4 7H 2 O, 0.2 mM CuSO 4 5H 2 O), 0.01 1 biotin,1 mM KPO 4 pH 7.5, and 50 1 uracil were added to the medium. Strains and Growth Conditions The plasmids and strains used in this study are listed in Tables 2 1 and 2 2. Haloferax volcanii was grown under aerobic conditions unless otherwise noted, at a temperature of 42 o C shaking at 200 rpm for liquid cultures. Liquid media used for growth of H. volcanii strains was either ATCC 974, glycerol minimal medium without thiamin, or YPC medium sup plemented with 50 1 5 flouroorotic acid (5 FOA) when indicated. Solid agar media used for growth of H. volcanii strains was either ATCC solid medium or casamino acids (CA) solid medium supplemented with uracil (10 1 ) and 5 FOA (50 1 ) when indicated. E. coli was grown under aerobic conditions in Luria Bertani (LB) broth with 50 1 ampicillin. Glycerol stock cultures of all strains and plasmids were maintained at 80C and were prepared by mixing equal volume of stationary phase culture with sterile 40% (vol/vol) glycerol in cryogenic tubes. DNA Desalted oligonucleotide primers (Table 2 3) were ordered from Integrated DNA Technologies (Coralville, Iowa). Plasmid DNA was extracted from cells using the Qiagen QIAprep Spin Miniprep Kit. Ge nomic DNA was extracted from cells by DNA spooling (Dyall Smith, 2009). DNA was sequenced by Eton Bioscience, Inc. (Research Triangle Park, NC). Multiple Sequence Alignments of Putative Sulfur Transfer Enzymes C omparative genomics was used to identify homologs of sulfur transfer proteins in H. volcanii Rhodanese domain proteins (Hvo_0024 and Hvo_0025), cysteine

PAGE 35

35 desulfurase (Hvo_0109), cystine lyase (Hvo_A0635) and n type ATP pyrophosphatases with and without THUMP domains (Hvo_058 0 and Hvo_1651, respectively) were identified in the H. volcanii genome. Proteins with known roles in sulfur transfer as well as proteins with more putative roles based on annotation were identified in Uniprot. Multiple sequence alignment s were performed i n Clustal and visualized in Jalview sequence editor Sequence motifs, binding sites, etc. of known and proposed function are based on literature and are referenced in the text and figures where appropriate. Generating Knockouts of Proposed Sulfur Transfer Genes When attempting to assign gene functions, the most straightforward method is to create a gene knockout and analyze the phenotype of the mutant compared to the parent strain. The suspected sulfur transfer genes Hvo_0024, Hvo_0025, Hvo_1651, Hvo_A0635, Hvo_0109, and Hvo_0580 were targeted for deletion from the H. volcanii genome using a markerless pyrE2 based deletion method (Bitan Banin et al ., 2003; Allers et al ., 2004). This method was first utilized in Saccharomyces cerevisiae where genes involved in uracil biosynthesis serve as counterselectable markers (Boeke et al ., 1984). The selection is due to the fact that uracil synthesizing strains are sensitive to the toxic uracil analog 5 fluoroorotic acid (5 FOA), whereas strains that lack the gene encodi ng orotate phoshoribosyl transferase, which is essential for uracil biosynthesis, are resistant to 5 FOA. The H. volcanii pyrE2 gene encodes the enzyme orotate phosphoribosyl transferase and is useful as a counterselectable genetic marker for creating gene knockouts (Bitan Banin et al ., 2003; Allers et al ., 2004). This pyrE2 deletion method begins with the construction of a non replicative plasmid containing both the pyrE2 gene and a chromosomal DNA fragment with a deletion in the gene targeted for knockout After incorporation of the plasmid onto the genome of a pyrE2

PAGE 36

36 strain of H. volcanii (pop in), the next step is the excision of the plasmid (pop out) by a chromosomal crossover event (Figure 2 1) and selection for the pop out with 5 FOA. Generation of Pr e Knockout Plasmids For markerless pyrE2 based deletion of the putative sulfur mobilization genes of H. volcanii two sets of plasmids were generated: i) pre knockout and ii) knockout plasmids. For construction of the pre knockout plasmids, primers were us ed to amplify the gene targeted for knockout plus 500 to 700 base pairs of DNA flanking the gene on either side by polymerase chain reaction (PCR). Forward primers for used to amplify the Hvo_0025, Hvo_0109, Hvo_1651, and Hvo_A0635 gene regions contained a BamHI site and reverse primers contained a HindIII site. All primers used to generate plasmids are shown in Table 2 3. Purified PCR products for the Hvo_0025, Hvo_0109, Hvo_1651, and Hvo_A0635 were digested with BamHI and HindIII, followed by ligation wit h T4 DNA ligase into a pTA131 vector digested with the same restriction enzymes to create the pre knockout plasmids. Plasmid vector pTA131 was supplied by Dr. Thorsten Allers (University of Nottingham; Allers et al ., 2004) and contains a wild type pyrE2 gene, an ampicillin resistance marker, and a ColE1 origin of replication for high copy number plasmid generation in E. coli The primers used to generate the insert for the Hvo_0024 pre knockout plasmid did not contain restriction sites, and thus the puri fied PCR product was phosphorylated with T4 polynucleotide kinase before insertion into a dephosphorylated pTA131 vector that had been digested with blunt end cutter EcoRV to create the Hvo_0024 pre knockout plasmid. Pre knockout plasmids were transformed into E. coli TOP10 competent cells and grown on LB media containing 50 g/ml ampicillin. Transformants were screened by PCR with the primers used to generate the

PAGE 37

37 insert fragment, and those generating a band corresponding to the insert gene and flanking reg ions were grown in LB ampicillin for subsequent plasmid extraction and confirmation by DNA sequencing. Generation of Knockout Plasmids For the construction of knockout plasmids, pre knockout plasmids served as template DNA for PCR reactions with inverse p rimers that amplified only the gene flanking regions and the pTA131 vector. PCR products were purified, phosphorylated with T4 polynucleotide kinase and ligated with T4 DNA ligase to create the knockout plasmids. These plasmids were transformed into E. col i TOP10 competent cells and grown on LB media containing 50 g/ml ampicillin. Transformants were subject to PCR screening with the primers used to create the pre knockout insert fragment to ensure that a 1 1.4 kb band corresponding only to the gene flankin g regions was present. Sequencing of plasmid DNA served to confirm the fidelity of the DNA sequence of the flanking regions and the absence of the target gene. The Hvo_0580 knockout plasmid was not generated from a pre knockout plasmid, but instead was cre ated by the insertion of two separate DNA fragments corresponding to 500 bp gene flanking regions into vector pTA131. The two DNA fragments were amplified by PCR and purified. The DNA fragment number one was digested with restriction enzymes KpnI High Fide lity and XhoI, then ligated with T4 DNA ligase to a digested and dephosphorylated pTA131 vector. The resulting plasmid was transformed into E. coli TOP10 competent cells and grown on LB ampicillin medium. PCR screening of transformants was performed to con firm the presence of DNA fragment number one. Plasmid DNA was extracted from transformants containing the

PAGE 38

38 insert, and was digested with restriction enzymes XhoI and XbaI and dephosphorylated. The second DNA fragment to be inserted was digested with XhoI an d XbaI, then ligated to the vector with T4 DNA ligase. The resulting Hvo_0580 knockout plasmid was transformed into E. coli TOP10 cells, and transformants were screened by PCR for the presence of insert number two using the primers that generated the inser t. Plasmid DNA sequencing served to confirm the presence and fidelity of both 500 bp flanking regions in the Hvo_0580 knockout plasmid. Generation of Markerless Deletions in H. volcanii Using Knockout Plasmids Markerless deletions of the putative sulfur m obilization genes were generated in H. volcanii by use of knockout plasmids in a pop in/pop out method (Bitan Banin et al ., 2003; Allers et al ., 2004). All knockout plasmids isolated from E. coli TOP10 cells were transformed into E. coli GM2163 cells to de methylate the plasmid DNA in preparation for transformation into H. volcanii E. coli GM2163 transformants were grown on LB ampicillin media before plasmid DNA extraction. Demethylated knockout plasmids were transformed into H. volcanii strain H26, a pyr E2 strain obtained from Dr. Thorsten Allers. Transformants were screened for successful integration of the plasmid into the genome (pop in) by PCR using primers that anneal 700 bp to 900 bp outside of the target gene, which is further outside of the flanki ng regions present on the knockout plasmids. Transformants that were shown to have integrated plasmids by the presence of a 1.4 1.8 kb PCR product were pooled and grown in YPC medium supplemented with 5 FOA to select for cells with excised plasmids (pop ou ts) that occurred due to chromosomal crossover events. Cells were plated onto casamino acids media supplemented with uracil (10 1 ) and 5 FOA (50 1 ) and screened with the

PAGE 39

39 same primers used to screen the pop ins to identify clones that resulted i n a recombination event that incorporated the knockout and not a reversion to the wild type genotype (Figure 2 1). Knockout strains and primers used to confirm these strains are shown in Table s 2 2 and 2 3, respectively. Genomic DNA was extracted from each knockout strain as well as the parent strain for Southern blot analysis to fully confirm each strain as a knockout strain as previously described (Sherwood et al 2009). Anaerobic Growth Assay with DMSO as the Final Electron Acceptor To determine a possible role of any of the suspected sulfur transfer genes in molybdenum cofactor biosynthesis, a growth assay was performed under anaerobic conditions with dimethyl sulfoxide (DMSO) as the final electron acceptor. The H26 parent strain and HM1052, a ubaA strain known to be growth deficient in these conditions (Miranda et al ., 2011), were used as controls in this experiment. Knockout strains and controls were inoculated from an ATCC plate into 4 ml YPC medium in 13 x 100 mm test tubes to se rve as starter cultures. Starter cultures were grown aerobically while shaking at 200 rpm at 42 o C to late log phase, at which point 100 l from each starter culture was inoculated into 10 ml screw cap tubes filled to capacity with YPC medium supplemented w ith 100 mM DMSO and 2% (w/v) glucose. Tubes were incubated anaerobically and stationary at 42 o C. Optical density (OD) measurements at 600 nm against an uninoculated blank were determined at several different time points to obtain a standard growth curve fo r each strain. Growth of each strain was determined in biological triplicate.

PAGE 40

40 Growth Assay in the Absence of Thiamin To determine if any of the suspected sulfur transfer proteins are essential to thiamin biosynthesis, a growth assay was performed in the ab sence of the vitamin thiamin for each of the knockout strains as well as the H26 parent strain as a control. Strains were inoculated into 4 ml of glycerol minimal medium minus thiamin in 13 x 100 mm tubes from isolated colonies on an ATCC plate to serve as starter cultures. These starter cultures were grown to late log phase at 42 o C (200 rpm) and used as an inoculum for the growth assay. Starter culture cells from each strain were inoculated in biological triplicate into 250 ml flasks containing 20 ml of gl ycerol minimal medium minus thiamin to an initial OD at 600 nm of 0.03. Flasks were incubated at 42 o C while shaking at 200 rpm. The OD at 600 nm was measured at several different time points against an uninoculated blank to obtain a standard growth curve f or each strain. tRNA Thiolation Analysis Using Total RNA To investigate possible role s of suspected sulfur transfer proteins in tRNA thiolation total RNA was isolat ed from mutant strains, parent strain H26 and strain HM1052 ( ubaA ) known to be defective in the thiolation of tRNA Lys UUU Extracted RNA was hybridized to probes specific for tRNA Lys UUU and tRNA Ala GGC and separated by APM gel electrop horesis to determine whether tRNAs were thiolated (see below for details). Extracting Total RNA For tRNA thiolation assays, cells were grown to log phase in starter cultures containing 3 ml ATCC 974 medium, then inoculated into 3 ml of fresh medium and again grown to log phase. Cells from starter cultures were inoculated into 250 ml flasks containing 50 ml of ATCC 974 medium, then incubated at 42 C shaking at 200 rpm. Total RNA was extracted from 37.5 ml of log phase cells by centrifugation at 3,000 x g

PAGE 41

41 for 15 min and resupended in 1 ml ATCC medium. Cells were transferred to 2 ml Eppendorf tubes and pelleted at 4,200 x g for 15 min. Cells were resuspended in lysis buffer [10 mM Tris Hcl pH 8.0, 10 mM NaCl, 1 mM trisodium citrate, 1.5% (w/v) sodium dodecyl sulfate] plus 17.5 l diethyl pyrocarbonate (DEPC), followed by incubation at 37 o C for 10 min and incubation on ice for 10 min. After incubation, 312.5 l NaCl saturated water [40 g NaCl per 100 ml DEPC treated water] was added to each tube of cell lysate and mixed by inversion. Tubes were incubated on ice for 15 min and pelleted by centrifugation at 12,000 x g for 20 min. Supernatant (0.5 ml) from each tube was transferred to a fresh 2 ml Eppendorf tube along with 2.5 volumes of 95% ethanol. Tubes were incubated at 80 o C overnight before recovery of total RNA by centrifugation at 17,000 x g for 10 min followed by a 70% ethanol wash. Pelleted total RNA was resuspended in 100 l DEPC treated water. RNA was further purified by extraction with equal volume of acidic phenol (pH 5.0): chloroform: isoamyl alcohol (25:24:1) followed by chloroform: isoamyl alco hol (24:1). RNA was precipitated in 0.25 M sodium acetate (pH 5.0) with two volumes of 95% ethanol ( 80 C, 15 min) and washed with 70% ethanol. The air dried RNA pellet was resuspended in 30 l DEPC treated water with a typical yield of 100 to 150 g RNA. RNA quality was assessed by agarose gel electrophoresis, and RNA concentration was determined by absorbance at 260 nm. Assay for Thiolation Total RNA was separated by [(N acryloylamino)phenyl] mercuric chloride (APM) gel electrophoresis (Igloi, 1988) and hybridized as previously described (Miranda et al. 2011) to one of two different probes (Table 2 4). One probe is specific for lysine tRNAs with anticodon UUU (tRNA Lys UUU ). This probe was selected based on the widespread

PAGE 42

42 distribution of 2 thiouridine anticodon of lysine tRNAs (in addition to glutamine and glutamate tRNAs). The second probe is specific for tRNA Ala GGC tRNAs and was selected for the detection of 4 thiouridine derivatives at positio ns 8 in tRNA, since this tRNA is not thiolated at the wobble position in the anticodon and thus can be distinguished from 2 thiouridine derivatives. These thiolated tRNAs can be recognized by their retarded migration in APM gels compared with the nonthiola ted form, which migrates faster (Igloi 1988). Determination of Thiosulfate Sulfurtransferase (TST) Activity Knockout strains of the putative thiosulfate sulfurtransferases Hvo_0024 and Hvo_0025 as well as the H26 parent strain were assayed for sulfurtrans ferase activity with thiosulfate by methods adapted from those previously described by Hanzelmann et al. (2009). Preparation of Cell Lysate To obtain cell lysate for activity assays, cells were grown to log phase in starter cultures containing 3 ml ATCC 974 medium, then were inoculated into 250 ml flasks containing 50 ml of ATCC 974 medium to a starting OD of 0.03. Flasks were incubated at 42 C shaking at 200 rpm until an OD of 0.8 1.2 was reached. Cultures were centrifuged at 5,000 x g for 10 at 4 o C min and resupended in 1 ml 100 mM Tris acetate buffer (pH 8.6) containing 2 M NaCl. Resuspended cells were lysed by sonication and filtered through a 0.2 m filter. The protein concentration of the resulting cell lysate was determined using a BCA protein assa y (see below). Determination of Protein Concentration The BCA protein assay kit (Thermo Scientific Pierce, Rockford IL) was utilized to determine the protein concentration of cell lysate. A bovine serum albumin protein

PAGE 43

43 standard was used to first generate a standard curve. This was done by adding 1 ml of a 1:50 ratio of reagent A to reagent B into 50 l of BSA protein samples of varying concentrations. After incubation of samples at 37 o C for 30 mins, the absorbance of each sample was read at 562 nm and used to generate a linear best fit equation of protein concentration versus absorbance at 562 nm. The above assay was repeated with cell lysate, and resulting absorbance readings were plugged into the equation obtained from the standard curve to determine the p 1 Sulfurtransferase Activity Assays Reaction mixtures consisted of 100 mM Tris acetate buffer (pH 8.6), 2 M NaCl, 50 mM sodium thiosulfate, 50 mM potassium cyanide, and 400 g cell lysate in a total reaction volume of 0.5 ml. Potassium cy anide was added to the mixture last to initiate the reaction After incubation for 5 30 min at 42 o C, 250 l formaldehyde was added to quench the reaction, and color was developed upon addition of 750 l ferric nitrate reagent [6.67 g Fe(NO 3 ) 3 9 H 2 O and 13.3 ml 65% HNO 3 (v/v) to a final volume of 100 ml]. Samples were centrifuged at 3,000 x g for 3 min and transferred to 1 ml cuvettes. The absorbance at 460 nm was measured for each sample against a blank with buffer in place of cell lysate incub ated for the same period of time. The total rhodanese activity for strains Hvo_0024, Hvo_0025, and H26 was determined using the A 460nm and the extinction coefficient for thiocyanate, 460nm = 4,200M 1 cm 1 One unit of enzyme activity was defined as the amount of enzyme that catalyzes the formation of 1 nmol of thiocyanate/min; specific activities are given as units per milligram of total protein.

PAGE 44

44 Table 2 1 Plasmids Plasmid Description Vector Reference pTA131 pyrE2 gene under control of the Halobacterium salinarum constitutive ferredoxin promoter pBluescript II Allers et al ., 2004 pJAM1900 Hvo_0024 plus 700 bp flanking (pre knockout plasmid) pTA131 This work pJAM1901 Hvo_0025 plus 500 bp flanking (pre knockout plasmid) pTA131 This work pJAM1902 Hvo_0109 plus 500 bp flanking (pre knockout plasmid) pTA131 This work pJAM1903 Hvo_1651 plus 500 bp flanking (pre knockout plasmid) pTA131 This work pJAM1904 Hvo_A0635 plus 500 bp flanking (pre knockout plasmid) pTA131 This work pJAM1905 Hvo_0024 700 bp flanking (knockout plasmid) pTA131 This work pJAM1906 Hvo_0025 500 bp flanking (knockout plasmid) pTA131 This work pJAM1907 Hvo_0109 500 bp flanking (knockout plasmid) pTA131 This work pJAM1908 Hvo_1651 500 bp flanking (knockout plas mid) pTA131 This work pJAM1909 Hvo_A0635 500 bp flanking (knockout plasmid) pTA131 This work pJAM1910 Hvo_0580 500 bp flanking (knockout plasmid) pTA131 This work

PAGE 45

45 Table 2 2. Strains Strain Description Reference E. coli Strains TOP10 chemically competent transformation strain Invitrogen GM2163 demethylation strain Marinus et al., 1983 H. volcanii Strains DS70 plasmid pHV2 deficient strain of DS2 Wendoloski et al., 2001 H26 pyrE2 knockout in strain DS70 Allers et al., 2004 HM1052 Hvo_0558 ( ubaA) knockout in strain H26 Miranda et al., 2011 MH100 Hvo_0024 knockout in strain H26 This work MH101 Hvo_0025 knockout in strain H26 This work MH102 Hvo_0109 knockout in strain H26 This work MH103 Hvo_1651 knockout in strain H26 This work MH104 Hvo_A0635 knockout in strain H26 This work MH105 Hvo_0580 knockout in strain H26 This work

PAGE 46

46 Table 2 3. Primers Primer Purpose Primer Name Primer Sequence (5' 3') generate gene and Hvo_0024 confirm up 700bp CCTCCCGGTGGGTCGCCAG flanking insert Hvo_0024 confirm dw 700bp GGTACGCGCGGATGTCCTCG generate gene and Hvo_0025 500bp FW atg GGATCC CGTAGAGGAGCGCGGTCAC flanking insert Hvo_0025 500bp RV atg AAGCTT TCCAGTTCCCCTTCTACGCG generate gene and Hvo_0109 500bp FW atg GGATCC CGTCGGTGAATCGAGTCGCC flanking insert Hvo_0109 500bp RV atg AAGCTT GCTGACCGTCCCCGTCACCG generate gene and Hvo_1651 500bp FW atg GGATCC GCCTCCTCCCACTGCTTGAG flanking insert Hvo_1651 500bp RV atg AAGCTT GCGCCGACGATACAGACCTG generate gene and Hvo_A0635 500bp FW atg GGATCC CGACCGGGTGAACGTCGTCC flanking insert Hvo_A0635 500bp RV atg AAGCTT TCTGCGTTCGCCTCACTCGA generate knockout Hvo_0024 inverse up TACCATGCCCCCACGTTTC plasmid Hvo_0024 inverse down TGACGAGCGAGGTTACGGCTG generate knockout Hvo_0025 inverse up CGCGTTTCACCGTACAACAG plasmid Hvo_0025 inverse down AAGGGTAACTGAGCCGCCTCG generate knockout Hvo_0109 Knockout UP CTGCACTCTCATTGGGTGTG plasmid Hvo_0109 Knockout DW TGAGTACCCGGTTTTTCGCG generate knockout Hvo_1651 knockout UP CGTCTGATTCACGGTCGG plasmid Hvo_1651 knockout DW GGCGAGTGAGCGCGGGAG generate knockout Hvo_A0635 Knockout UP AGTGCGTTATCGGGTGTCAT plasmid Hvo_A0635 Knockout DW TGGTGAGTGCAGCGCAGTAT Hvo_0580 KnpI FW1 ttGGTACCAGGAGGCGTTGCACACTTCGAGGTGGACCG generate knockout Hvo_0580 XhoI RV1 tCTCGAGCACTCCATTGCCGGTCGGTTGC plasmid Hvo_0580 XhoI FW2 tCTCGAGGATAGAAGCGGTCTGAGCGGCTACGGAA Hvo_0580 XbaI RV2 tTCTAGAGGAATCGCGAGCAACATCACCGAACGGCTGGA confirm Hvo_0024 900bp FW CGGAGTTCGTCGGCAGACTTG knockout Hvo_0024 900bp RV TCGAGGGTTGTCACGGGAGA confirm Hvo_0025 confirm up 700bp GCGGGTGTCCACGATGACGG knockout Hvo_0025 confirm dw 700bp TCGGCATCGGCGTGGCAATC

PAGE 47

47 Table 2 3. Continued. Primer Purpose Primer Name Primer Sequence (5' 3') confirm Hvo_0109 700bp FW CGCGTTCGAGTCGGTCGGAG knockout Hvo_0109 700bp RV CGTAAAAGGATTCCGGGGCC confirm Hvo_1651 700bp FW CGACAGGGGCGTCAGCGTCG knockout Hvo_1651 700bp RV CGGAGGGCTCGCGGACCAAC confirm Hvo_A0635 700bp FW AACGCGATTCACCGGCTCTACC knockout Hvo_A0635 700bp RV GCGCGAAGGCCACATTCAGT confirm Hvo_0580 confirm up 700bp CCGTCTCGGCATCGTCGTCC knockout Hvo_0580 confirm dw 700bp CATCACGCAGCCGTCCCTCA Table 2 4. Probes Probe Name Probe description Probe sequence Citation tRNA lys UUU specific for lysine tRNAs with anticodon UUU CGGGCTGGGAGGGACTTGAACCCCC Miranda et al ., 2011 tRNA ala GGC specific for alanine tRNAs with anticodon GGC GGACTCGCCGGGATTCGAACCCGGGGC Gupta, 1984

PAGE 48

48 Figure 2 1. Gene knockout system based on the pyrE2 gene ( Allers et al. 2004)

PAGE 49

49 CHAPTER 3 RESULTS Multiple Sequence Alignments of Putative Sulfur Transfer Enzymes While sulfur mobilization is essential for many functions in the cell, this process is poorly understood in archaea. To examine sulfur mobilization in archaea, the haloarchaeon Haloferax volcanii was used as a model system. H. volcanii ORFs encoding homologs of proteins mediating sulfur transfer were identified by comparative genomics. Rhodanese domain proteins (Hvo_0024 and Hvo_0025), cysteine desulfurase (Hvo_0109), cystine lyase (Hvo_A0635) and n type ATP pyrophosphatases with and without THUMP domains (Hvo_0580 and Hvo_1651, respectively) were identified in the H. volcanii genome. Hvo_0580 A Putative tRNA 2 Thiolation Protein Hvo_0580 of H. volcanii is a putative protein involved in the thiolation of tRNA that shares ho mology with n type ATP pyrophosphatases including those of the eukaryotic Urm1 pathway of 2 thiolation of tRNA (Nakai et al ., 2008 ). Figure 3 1 depicts the multiple sequence alignment of the Hvo_0580 protein and homologous n type ATP pyrophosphatase superf amily proteins of Saccharomyces cerevisiae, Thermus aquaticus, and Salmonella typhimurium Residues of the ATP pyrophosphatase signature motif (SGGXDS) involved in ATP binding (Bork and Koonin, 1994) as well as CXXC and GHXXDD motifs (where X represents an y amino acid residue) are often conserved in the TtcA p rotein family (Jager et al ., 2004) The formation of 2 thiocytidine by bacterial TtcA proteins is similar to the syntheses of 2 and 4 thiouridine, in that the cysteine desulfurase IscS is required for transfer of sulfur to TtcA. Tt cA likely forms an adenylated tRNA intermediate before transfer of sulfur from IscS to the tRNA. In enteric

PAGE 50

50 bacteria ( e.g., Salmonella typhimurium ), the two cysteines of the CXXC motif at positions 122 and 125 of TtcA are req uired for the thiolation of cytidine (s 2 C) at tRNA position 32 (Jager et al ., 2004). The TtcA cysteine residues 122 and 125 required for s 2 C formation as well as the GHXXDD motif are highly conserved amo ng the TtcA protein family (Figure 3 1). In contrast, cysteines of the CXXC motif in the 210 213 positions of ente ric TtcA proteins are not conserved in H. volcanii Hvo_0580, eukaryotic Ncs6p and the YS1MC23 protein of the hyperthermophilic bacterium Thermu s aquaticus (Figure 3 1). Thus, with exception of TtcA of S. typhimurium the other proteins included in the multiple sequence alignment presented in Figure 3 1 do not have all conserved residues of the TtcA signature motifs identified by Jager et al. (2004). Hvo_0109 A Pu tative SufS Type Cysteine Desulfurase The protein encoded by gene locus tag Hvo_0109 is closely related to SufS type cysteine desulfurases (Figure 3 2 ). Although the Hvo_0109 protein did not align with significant similarity to IscS or NifS type cysteine desulphurases, the Hvo_0109 protein was related in primary sequence to SufS type cysteine desulfurases. Cysteine desulfurases of the SufS type are suspected to proceed by a catalytic mechanism s imilar to that of the NifS/IscS type enzymes. SufS type enzym es appear to have important roles in sulfur metabolism during oxidative stress (Zheng et al ., 2001) and iron starvation (Outten et al ., 2004). SufS type proteins from E. coli Erwinia chrysanthemi and Synechocystis show remarkably high sequence simi larity to the Hvo_0109 protein including conserved catalytic cysteine residues and pyridoxal phosphate binding lysines (Figure 3 2).

PAGE 51

51 Hvo_A0635 A Putative Cyst( e)i ne Lyase H. volcanii Hvo_A0635 encodes a homolog of the cysteine/cystine lyase family. Cyst(e)ine lyases often prefer cystine as their substrate to catalyze the formation of free cysteine persulfide, pyruvate and ammonia (Lang and Kessler, 1 999). Although the protein encoded by Hvo_A0635 was not related in primary sequence to IscS NifS and SufS ty pe cysteine desul f urases, it was related in primary sequence to cyst(e)ine lyases. Cyst(e)ine lyases of Synechocystis Synecococcus elongatus Trichodesmium erythraeum Nostoc Thermosynecococcus elongatus and Symbiobacterium thermophilum were aligned with Hvo_A0635 (Figure 3 5). Consistent with other cyst(e)ine lyase family members a conserved pyridoxal phosphate binding lysine residue w as identified in Hvo_A0635 (Figure 3 5). Likewise, arginine residues proposed to serve as binding site s for the two carboxylates of the substrate cystine are conserved in Hvo_A0635 (Figure 3 5). In contrast, while the cysteine residues at positions 92 and 112 of the Synechocystis cysteine lyase are conserve d in some cyst(e)ine lyases, these are not conserv ed in t he Hvo_A0635 protein The Cys 112 of the Synechocyst is cyst ( e ) ine lyase is proposed to serve as an active site residue in the formation of a cysteine persulfide (Campanini et al. 2006). However, not all enzymes with cysteine l yase activity have ret ained these conserved active site cysteine residue s (Mihara et al 1997). The cysteine residues were proposed to be conserved among cyst(e)ine lyases based on alignment with only the family members from cyanobacteria. As the formation of persulfid e at the active site cysteine appears to be critical for the function of cyst( e)ine lyase/desulfurases there must be a cysteine residue that can serve this function Cys 153 is the lone cys teine residue in the Hvo_A0635 protein sequence, suggesting that this is t he active site residue despite its non conserved nature.

PAGE 52

52 Hvo_0024 and Hvo_0025 Putative Thiosulfate Sulfurtransferases The H. volcanii Hvo_0024 and Hvo_0025 proteins are tandem rhodanese domain proteins with putative thiosulfate sulfurtransferase activity based on sequence homology. The two H. volcanii proteins were aligned with the thiosulfate sulfurtransferases RhoBov from Bos taurus RhdA from A. vinelandii 1UAR from T. thermophilus and the mercaptopyruvate sulfurtransferase SseA from E. coli (Figure 3 4). Figure 3 4A shows the alignment of the N terminal inactive rhodanese domain and Figure 3 4B shows alignment of the C terminal cata lytic rhodanese domain of these proteins. Rhodanese signature motifs with the conserved amino acid sequence [F/Y] X 3 H [L/I/V] P G A X 2 [L/I/V/F] at the N terminal and [A/V] X 2 [F/Y] [D/E/A/P] G [G/S/A] [W/F] X E [F/Y/W] at the C terminal regions are used to identify rhodaneses based on the high conservation of these residues among members of this family (Cipollone et al 2007). Although the Hvo_0024 and Hvo_0025 proteins clearly have high similarity to the rhodanese protein family, these proteins do not e ntirely conform to the signature sequence. Hvo_0024 does not conform to the motif at the first amino acid of the N terminal signature sequence (D instead of Y), and Hvo_0025 contains an A instead of the L/I/V in the N terminal signature region. The C termi nal region for Hvo_0024 also varies from the rhodanese signature motif where it contains an L instead of W /F in the eighth residue of that signature region. Residues of the active site loop beginning with the active site cyst eine can be seen in Figure 3 4 B Active site motifs CRXGX[R/T] and CG[S/T]GVT can be used to categorize TSTs and MSTs, respectively (Cipollone et al 2007). While the E. coli SseA, which catalyzes MST activity, matches the expected active site MST motif, other known MST/TSTs do not fo llow the active site pattern expected based on in vitro function. The A. vinelandii RhdA TST, for example, fits only

PAGE 53

53 two out of four expected amino acid identities for TSTs. Hvo_0024 and Hvo_0025 appear more like TSTs than MSTs at the active site as they p ossess the R in the last residue of the active site signature motif and do not possess the G in the second residue that is characteristic of the MSTs (65 CNTARR 70 and 79 CRIGER 84 for Hvo_0024 and HVO_0025, respectively). Structural protein modeling is u seful for the identification and characterization of tandem domain rhodanese proteins, which vary immensely in primary sequence identity but have a highly conserved three dimensional structure (Cipollone et al 2007). Figure 3 8A depicts the three dimensi onal structure of the T. thermophilus TST 1UAR (RCSB protein databank) along with predicted structures of the putative TSTs Hvo_0024 and Hvo_0025 modeled using Pymol (N. Hepowit, unpublished data). When the 3D structures of these three proteins were align e d (Figure 3 8 B), clear similarities were detected that would be expected among double domain TSTs. Therefore, based on similarities to other tandem domain rhodaneses in primary amino acid signature sequence motifs as well as in three dimensional structure, the Hvo_0024 and Hvo_0025 proteins are most likely sulfurtransferases of the thiosulfate sulfurtransferase subtype. Hvo_1651 A Putative Thiamin Biosynthesis /tRNA Modification Protein The H. volcanii Hvo_1651 protein is related to ThiI proteins involved in thiamin biosynthesis and the thiolation of tRNA. Figure 3 7 shows the multiple sequence alignment of the Hvo_1651 protein with ThiI proteins from the bacteria E. coli Salmonella typhimurium A. vinelandii and Bacillus anthracis Amino acids experimentally determined to be involved in ATP binding in the B. anthracis ThiI protein (Waterman et al ., 2006) are somewhat conserved in Hvo_1651 and indicated in Figure 3 7 (black boxes). The SGGXDS ATP binding motif seen in the alignment of the

PAGE 54

54 Hvo_0580 homologs of the ATP pyrophosphatase family is also present in the ThiI family of proteins including Hvo_1651 (dashed box). The E. coli ThiI is an ATP pyrophosphatase based on experimental evidence ( You et al 2008 ) As the generation of 2 and 4 thiouridine is quite similar, at least in bacteria, primary sequence relationships between the ATP pyrophosphatases and the ThiI proteins would be expected. Regarding the active site cysteine, which binds persulfide sulfur for transfer in the biosyn theses of thiamin or tRNA, E. coli ThiI cysteine residue at position 456 has been demonstrated as the catalytic site, which forms a disulfide bond with cysteine residue 344. While these cysteine residues (Cys456 and 344) are critical for the formation of s 4 U in E. coli the Cys456 residue is not conserved in the B. anthracis and H. volcanii (Hvo_1651) ThiI like proteins which are 403 and 391 amino acids in length, respectively. Although Hvo_1651 Cys347 is not conserved among the bacterial ThiI proteins, it does align with residues in the active site region of these proteins which includes the critical cysteine 344 residue of E. coli ThiI. However, it does not appear as though the B. anthracis or the Hvo_1651 proteins possess the ability to form a disulfide b ond with residues similar to E. coli ThiI, since the E. coli ThiI Cys456 residue is not conserved among these proteins. Identification of Knockouts by PCR and Southern Blot To further understand the function of the pu tative sulfur mobilization enzymes of H. volcanii described above knockouts in these gene s were generated in the H. volcanii genome by homologous recombination with the pyrE2 pop in/pop out system f or homologous recombination (details in Methods ). Knockout strains were identified by target gene and outside of the knockout plasmid used for homologous recombination.

PAGE 55

55 Using these primers, the PCR products generated fro m Hvo_A0635, Hvo_1651, Hvo_0024, and Hvo_0025 knockout strains were 1.4 to 1.8 kb consistent with the amplification of only the flanking regions and absence of the target gene (Figure 3 1). In contrast, the PCR products generated from H26 parent strain co ntrol were consistent in size with amplification of each of the target genes with their respective flanking regions. Knockout strains for Hvo_0109 and Hvo_0580 were not identified using this method. To confirm the absence of each target gene (Hvo_A0635, Hv o_1651, Hvo_0024, and Hvo_0025) from the H. volcanii genome, Southern blot was performed. T he Hvo_0024 knockout strain was analyzed by Southern blot to the target gene (Figure 3 2). The presence of a band at 1.94 kb for Hvo_002 4 and a 2.72 kb band for the H26 parent strain served to confirm this strain as a knockout based on the e xpected results for this probe. Southern blot of the other knockout strains will require further optimization of hybridization conditions. Knockout Gen es are Not Required for Molybdenum Cofactor Biosynthesis When grown anaerobically, cells can no longer use oxygen as the term inal electron acceptor, and often use alternative acceptors such as nitrate, dimethyl sulfoxide (DMSO), trimethylamine oxide (TMAO) or fumarate in the case of H. volcanii (Oren and Truper, 1990; Oren 1991). DMSO reductase is a molybdenum containing enzyme that requires the pterin based molybdenum cofactor for its synthesis. Thus, for DMSO to accept electrons from DMSO reductase, synt hesis of the molybdenum cofactor must occur. Strain HM1052 ( ubaA ) has previously been shown to be growth deficient under anaerobic conditions with DMSO as the final electron acceptor, suggesting that the UbaA enzyme is critical for molybdenum cofactor bio synthesis

PAGE 56

56 (Miranda et al ., 2011). Here we performed a growth assay under anaerobic conditions with DMSO as the terminal electron acceptor for knockouts in Hvo_A0635, Hvo_1651, Hvo_0025, and Hvo_0024 along with controls H26 (parent strain) and HM1052 ( ubaA ) to determine if the genes encoded by these proteins are required for MoCo biosynthesis. However, none of the knockouts tested showed inhibited growth relative to the parent strain when grown under these conditions (Figure 3 8). Although there are some di fferences in the growth rates between strain s including the potentially enhanced growth of Hvo_A0635, none of th e knockout strains exhibited a le vel of growth deficiency comparable to the ubaA strain. Therefore, it appears that the Hvo_A0635, Hvo_1651, H vo_0025, and Hvo_0024 proteins are not essential for the synthesis of the pterin based molybdenum cofactor. Knockout Genes are Not Required for Thiamin Biosynthesis Thiamin pyrophosphate is essential in all living organisms as a cofactor of carbohydrate metabolism enzymes such as the pyruvate:ferredoxin oxioreductase of archaea (Ma et al ., 1997 ) and for the biosynthesi s of branched chain ami no acids (Kessler 2006). To determine if any of the suspected sulfur transfer proteins are essential to thiamin b iosynthesis, a growth assay was performed in the absence of thiamin for Hvo_A0635, Hvo_1651, Hvo_0025, and Hvo_0024 knockout strains as well as the H26 parent strain as a control. Growth deficiency in the absence of thiamin indicates the inability of cells to synthesize this essential cofactor. However, none of the knockouts tested showed inhibited growth relative to the parent strain when grown in glycerol minimal media in the absence of the thiamin (Figure 3 9), indicating that

PAGE 57

57 Hvo_A0635, Hvo_1651, Hvo_00 25, and Hvo_0024 do not have roles in thiamin biosynthesis. Knockout Genes are Not Required for 2 Thiolation of tRNA Thiolation of tRNA can be detected by migration differences on an APM gel between thiolated and non thiolated tRNAs (Igloi, 1988). This ser ved as the basis for detection of thiolated tRNA from Hvo_A0635, Hvo_1651, Hvo_0025, and Hvo_0024 knockout strains in addition to the H26 parent strain and HM1052, the ubaA strain control previously demonstrated to lack the 2 thiouridine modification (Mir anda et al ., 2011). Figure 3 10 shows the N orthern blot analysis of total RNA probed specifically for lysine tRNAs with anticodon UUU. Lysine tRNAs typically contain the 2 thiouridine modification in the anticodon, thus making this assay specific for detec ting the 2 thiouridine modification in tRNA As expected based results from Miranda et al (2011) the HM1052 ( ubaA ) strain showed no retardation in migration on the APM gel compared to the parent strain, indicating a lack of thiolated lysine tRNA. However, retarded migration similar to the parent stain was seen in all four knockouts tested, indicating no difference in tRNA thiolation in the anticodon of lysine tRNA UUU between these strains. Based on these results, the Hvo_A0635, Hvo_0024, Hvo_0025 a nd Hvo_1651 proteins serve roles that do not inc lude 2 thiouridine modification of lysine tRNA UUU 4 Thiolation of tRNA Requires Further Analysis The presence of 4 thiouridine modified tRNA was analyzed in the same manner as for the 2 thiouridine modificat ion, except a probe specific for alanine tRNAs with anticodon GGC was used. Although the alanine tRNAs with GGC anticodon are not

PAGE 58

58 specific for the 4 thiouridine modification at position 8 in tRNA, this particular tRNA does not contain the 2 thiouridine mod ification. Thus, any retardation in migration in this analysis can be attributed to thiolation modifications other than 2 thiouridine. Figure 3 11 depicts the N orthern blot analysis of knockout strains Hvo_A0635, Hvo_1651, Hvo_0025, Hvo_0024 in addition to the H26 parent strain and HM1052 ( ubaA ). All tested strains show ed equal migration of tRNA on the APM gel indicating that none of the knockout genes are required for the thiolation of alanine tRNAs with anticodon GGC. Although all E. coli tRNAs contain the s 4 U modification to some extent ( Emilsson et al ., 1992 ), i t is possible that this particular tRNA does not contain the 4 thiou ridine modification in archaea. Future experiments will be performed using a method for detection of 4 thiouridine in total tRNA The absorbance at 334 nm (the max of s 4 U) indicates the presence of 4 thiouridine in tRNA, as tRNA lacking the 4 thiouridine modification will not show a peak at this wavelength (Mueller et al ., 1998). Hvo_0024 is Required for Thiosulfate Sulfurtran sferase Activity Thiosulfate sulfurtransferase (TST) activities of cell lysate of the Hvo_0024 and Hvo_0025 knockout strains were compared to that of the H26 parent strain to determine any differences in TST activity. One unit is defined as the amount of e nzyme activity that catalyzes the for mation of 1 nmol of thiocyanate per min under standard conditions (see methods for details). S pecific activities are given as units per milligram of total protein. While the Hvo_0025 showed a slightly elevated level of TST activity relative to the parent strain, the Hvo_0024 knockout strain showed no detectable TST activity with thiosulfate as the sulfur source (Table 3 1). This strongly suggests that the Hvo_0024 protein is a thiosulfate sulfurtansferase. An alternative possibility for the diminis hed TST

PAGE 59

59 activity of this strain could be that this strain is in fact a double knockout resulting from loss of transcription of Hvo _0025 as a result of the markerless in frame deletion of the Hvo_0024 gene. As Hvo_0024 and Hvo_00 25 genes could act together and perhaps compensate for the loss of the other gene a double knockout would be expect ed to show diminished TST activity compared to a single knockout However, the Hvo_0024 and Hvo_0025 genes are not transcribe d from the same operon and are instead divergently transcribed with a common upstream intergenic region (Figure 3 7). Future experiments will be performed to determine whether the Hvo_0024 mutant strain can be complemented by the Hvo_0024 gene to further understand this finding.

PAGE 60

60 Figure 3 1. Identification of knockouts by PCR. Knockouts generated a 1.4 1.8 kb product corresponding to gene flanking regions H26 (parent strain) control generated a larger PCR product corresponding to the gene plus gene flanking regions. KO = knockout strain; WT = wild type control strain. Figure 3 2. Confirmation of the Hvo_0024 knockout b y Southern blot. A probe was used to generate a 1.94 kb fragment from the Hvo_0024 knockout corresponding to a fla nking region of Hvo_0024. The 2.72 kb band generated from the H26 parent strain corresponds to the Hvo_0024 gene and flanking region.

PAGE 61

61 Figure 3 3. Multiple amino acid sequence alignment of the Hvo_0580 protein with proteins of the n type ATP pyrophosphatase superfamily from Saccharomyces cerevisiae (GI:50593215) Thermus aquaticus (GI:218295238) and Salmonella typhimurium (GI:16764998). Conserved residu es are highlighted in gray Residues of the ATP pyrophosphatase signature motif (SGGXDS) involved in ATP binding (Bork and Koonin, 1994) as well as motifs CXXC and GHXX DD present in the TtcA protein family (Jager et al ., 2004) are boxed in black outline and indicated below the amino acid sequence.

PAGE 62

62 Figure 3 4. Multiple amino acid sequence alignment of Hvo_0109 with homologous cy steine desulfurases of the SufS type from Escherichia coli (GI:89108520), Erwinia chrysanthemi (GI:307131457), and Synechocystis (GI:16331747) Conserved residue s are highlighted in gray with p yridoxal phosp hate binding lysin e residues indicated by a star and catalytic cysteine residues indicated by an arrowhead.

PAGE 63

63 Figure 3 5. Multiple amino acid sequence alignment of Hvo_A0635 w ith homologous cyst (e) ine lyases from Synechocystis (GI:3820 527), Synecococcus elongatus (GI:56750305), Trichodesmium erythraeum (GI:71675187), Nostoc sp. (GI:17230702), Thermosynecococcus elongatus (GI:22299870), and Symbiobacterium thermophilum (GI:51891270) with conserved residues highlighted in gray, pyridoxal phosphate binding lysine residue s indicated by a star, arginine binding residues of the two carboxylates of the substr ate cystine indicated with diamonds, c ysteine residues proposed to be conserved among cyst(e)ine lyases (Campanini et al 2006) indicated with arrowheads, and t he lone c ysteine residue of Hvo_A0635 indicated by a n arrow

PAGE 64

64 Figure 3 5. Continued.

PAGE 65

65 A B Figure 3 6. Multiple amino acid sequence alignment of the Hvo_0024 and Hvo_0025 proteins with homologous tandem domain rhodaneses SseA from E. coli (GI:89109327), RhoBov from Bos taurus (GI:29135275), RhdA from A. vinelandii (GI:226717820), and 1UAR from T. thermophilus (GI:55980997). A) The N terminal inactive rhodanese domain B) The C terminal cat alytic rhodanese domain Conserved residues are highlighted in gray. Rhod anese signature motifs are noted by dashed boxes (Cipollone et al ., 2007). Conserved amino acid active site loop residues, starting with the catalytic cysteine, are boxed with a solid line

PAGE 66

66 Figure 3 7. Hvo_0024 and Hvo_0025 gene regions. These Hvo_0024 and Hvo_0025 ge nes are divergently transcribed A Figure 3 8. 3D structure analysis of putative sulfurtransferases of H. volcanii and the T. thermophilus TST 1UAR. A) Predicted 3D structures of Hvo_00 2 4, Hvo_0025 (modeled in Pymol) and T. thermophilus 1UAR (PDB). B) Alignment of predicted 3D struc tures for comparison. Hvo_0024 is indicated in Blue, Hvo_0025 is indicated in green, and T. thermophilus 1UAR is indicated in red.

PAGE 67

67 B Figure 3 8. Continued.

PAGE 68

68 Figure 3 9. Multiple amino acid sequence alignment of the Hvo_1651 protein with homologous proteins ThiI from Escherichia coli and ThiI homologs from Salmonella typhimurium, Azotobacter vinelandii and Bacillus anthracis. Identical residu es are highlighted in gray, ATP binding sites (Waterman et al 20 06) are boxed in black outline, t he SGGXDS ATP binding motif that is also seen in ATPases of the PP loop superfamily (Bork and Boonin, 1994 ) is indicated by the dashed box, and c ritical residues C ys 344 and C ys 456 of E. coli ThiI are indicated by arrowheads.

PAGE 69

69 Figure 3 9. Continued. Figure 3 10. Anaerob ic growth with DMSO as the terminal electron acceptor. The optical density was measured at several time points to determine growth rates of knockout strains relat ive to the H26 parent strain. S train HM1052 ( ubaA ) was included as a negative control. Strains that do not gro w under these conditions may be deficient in molybdenum cofactor biosynthesis. Error bars represent standard deviation

PAGE 70

70 Figure 3 11. Growth in the absence of thiamin. The optical density was measured at several time points to determine growth rates of knockout strains relative to the H26 parent strain to determine a possib le role in thiamin biosynthesis Error bars represe nt standard deviation. Figure 3 12. tRNA 2 thiolation analysis by APM gel electrophoresis and Northern blot with tRNA Lys UUU probe. Hvo_A0635, Hvo_0024, Hvo_0025 and Hvo_1651 knockouts as well as the H26 parent str ain have thiolated tRNAs as indicated by the r etarded migration of the tRNA Lys UUU specific RNA on the APM gel The negative control strain HM1052 ( ubaA ) shows no thiolati on of tRNA, as UbaA is crucial for this modification.

PAGE 71

71 Figure 3 13. tRNA 4 thiolation analysis by APM gel electrophoresis and Northern blot with tRNA Ala GGC probe. All strains used showed equal migration on the APM gel with no differences in thiolation between t he knockouts and the parent. This indicates that either all tRNA is thiolated or there is complete absence of thiolation for all strains with this probe Table 3 1. Thiosulfate Sulfurtransferase (TST) Activity Strain Total Protein (mg) Activity (U) Specific Activity (U/mg) H26 0.4 1 6 40 Hvo_0025 ) 0.4 2 2 55 Hvo_0024 ) 0.4 n.d. n.d. Note: Activity with thiosulfate was measured using cell lysate of Hvo_0024 and Hvo_0025 knockout strains as well as the H26 parent strain. No TST activity was detected in the Hvo_0024 knockout strain, sugg esting the Hvo_0024 protein is required for thiosulfate sulfurtransferase activity in H. volcanii n.d. = none detected

PAGE 72

72 CHAPTER 4 DISCUSSION While many biosynthetic pathways requiring the transfer of sulfur in the persulfide and thiocarboxylate form s have been investigated in bacteria, little work has been done regarding these sulfur mobilization pathways and their respective sulfur carriers in archaea. To further our understanding of sulfur mobilization in archaea, s ix proteins were identified in the archaeon Haloferax volcanii as homologs of bacterial and/or eukaryotic sulfur carrier e nzymes. Proteins encoded by Hvo_0580, Hvo_0109, Hvo_A0635, Hvo_1 651, Hvo_0024 and Hvo_0025 were subjected to analysis by multiple amino acid se quence alignment to deter mine more specific possible functions than could be inferred based on annotation. The Hvo_0580 protein, annotated as an n type ATP pyrophosphatase, was shown to share homology with tRNA 2 thiolation proteins such as the Salmonella tyrphimurium 2 thiocytid ine protein TtcA. In addition, presence of the ATP pyrophosphatase signature motif (SGGXDS) involved in ATP binding and adenylation of tRNA strongly suggest a role of the Hvo_0580 protein in 2 thiolation of tRNA. With previous work showing the role of the archaeal ubiquitin like protein SAMP2 and its activating enzyme UbaA in 2 thiouridine biosynthesis, it is possible that the Hvo_0580 is involved as the sulfur transfer protein between SAMP2 and tRNA. While the isolation of a Hvo_0580 knockout strain is sti ll ongoing, the knockout plasmid is completed by this work and will enable future construction of this mutant. Proteins Hvo_0109 and Hvo_A0635, annotated as cysteine desulfurases, did not align with IscS/NifS type c ysteine desulfurases as annotated Instea d, Hvo_0109 exhibited high sequence similarity to the SufS type cysteine desulfurases, a subtype in

PAGE 73

73 the cysteine desulfurase family suspected to act in sulfur metabolism during periods of cellular stress. H vo_A0635, alternatively, aligned well with the cys teine desulfurase like proteins of the cysteine/cystine lyase family that usually utilize cystine as a sulfur substrate rather than cysteine. Hvo_0109 and Hvo_A0635 are expected to provide a source of persulfide to sulfur carriers of various sulfur utilizi ng pathways in H. volcanii Hvo_0024 and Hvo_0025 are putative thiosulfate sulfurtransferases, and therefore were analyzed by multiple sequence alignment for the presence of rhodanese signature motifs and similarit y to other TSTs in three dimensional struc ture. As the rhodanese signature sequences are not absolutely conserved among rhodanese proteins (see A. vinelandii RhdA) the few deviations in these sequences seen in the Hvo_0024 and Hvo_0025 proteins should not be used to exclude these proteins from the rhodanese family. Active site loop residues of both Hvo_0024 and Hvo_0025 resemble that of the TST subtype, and additional 3D structure comparison of these proteins with the Thermus thermophilus TST 1UAR suggest that these proteins belong to the TST subfa mily of rhodaneses. The Hvo_1651 protein is a homolog of the E. coli tRNA modification/thiamin biosynthesis protein ThiI. Upon alignment with E. coli ThiI and other ThiI like proteins of various bacteria, it wa s found that Hvo_1651 contains the SGGXDS moti f of the ATP pyrophosphatase superfamily. This is consistent with the likelihood that the pathways of 2 and 4 thiouridine syntheses are similar as n type ATP pyrophosphatase enzymes may activate tRNA by adenyation before transfer of sulfur for both the 2 and 4 thiouridine biosynthetic pathways The search for active s ites revealed that the Hvo_1651 protein does not contain residues conserved with the two critical cysteine

PAGE 74

74 residues of E.coli ThiI. However, Bacillus anthracis ThiI was also shown to be miss ing a residue analogous to the E. coli ThiI cys 456 residue, as the B. anthracis and Hvo_1651 proteins are both short sequences with approximately 400 amino acids. While residues related to the E. coli ThiI cys 344 persulfide site were conserved in all aligned proteins except Hvo _1651, a cysteine residue was identified in Hvo_1651 at position 344 within the conserved active site region and could very well serve as the persulfide site for this haloarchaeal enzyme Thus, it appears as though the B. anthracis ThiI and Hvo_1651 proteins do not form a disulfide bond between two cysteines during biosynthesis of 4 thiouridine as the E. coli ThiI protein has been demonstrated to do, and must undergo a slightly different m echanism. Based on the relationshi ps identified by sequence al ignments, the ThiI like Hvo_1651 protein is expected to have roles in 4 thiouridine and thiamin biosyntheses. Molybdenum cofactor biosynthesis in H. volcanii is known to require the ubiquitin like SAMP1 protein as well as its ac tivating enzyme UbaA. However, the source of sulfur as well as any intermediate sulfur carriers are yet undetermined. Thus, possible roles for the putative persulfide generating cysteine desulfurase Hvo_0109 and the cy(e)ine lyase Hvo_A0635 are especially of interest in this pathway. Unfortunately, the knockout strain of Hvo_0109 has yet to be confirmed as thus was not used in phenotype analyses Therefore, possible roles for Hvo_A0635 as the source of persulfide as well as Hvo_0024, Hvo_0025 or Hvo_165 1 in transfer of sulfur for MoCo biosynthesis were investigated. Anaerobic growth with DMSO as the terminal electron acceptor, however, suggested that none of these proteins are involved in molydenum cofactor biosynthesis.

PAGE 75

75 Thiamin biosynthesis in E. coli is known to require the IscS and ThiI proteins. To determine possible roles of the Hvo_A0635, Hvo_1651, Hvo_0024 and Hvo_0025 proteins in thiamin biosynthesis, mutant and wild type stains were analyzed for growth in the absence of thiamin Putative cystei ne persulfide generating Hvo_A0635 and possible ThiI protein Hvo_1651 were of special interest for roles in thiamin synthesis, however none of the four mutants examined were impaired for growth in the absence of thiamin and, thus, are not essential for the biosynthesis of this sulfur containing vitamin. Assays for 2 thiolation as well as 4 thiolation of tRNA were based on the thiolation of tRNA lys UUU (2 thiolation) and tRNA ala GGC (4 thiolation). Although H vo_0580 is expected to mediate tRNA 2 thiolation, th e knockout strain is yet to be con firmed and thus only Hvo_A0635, Hvo_1651, Hvo_0024, and Hvo_0025 were analyzed for both 2 and 4 thiolation. With Hvo_1651 as an expected tRNA 4 thiolation protein, and other proteins tested as possible sulfur sources (Hvo _A0635) or sulfur relay proteins (Hvo_0024/Hvo_0025), none of the strains showed any pattern of tRNA thiolation that differed from that of the parent strain. Further testing for 4 thiolation by other methods is underway, as the tRNA ala GGC used to determine 4 thiolation levels in this study may not contain the 4 thiouridine modification. Lastly, sulfurtransferase activity assays served to determine the in vitro TST activity of Hvo_0024 and Hvo_0025. These proteins are highly similar in sequence and structure to the TST proteins of the rhodanese superfamily. The parent strain as well as the Hvo_0025 knockout strain displayed rhodanese activity with thiosulfate, w hile knockout strain of Hvo_0024 showed no detectable activity. This evidence suggests that Hvo_0024 is a thiosulfate sulfurtransferase, and may serve an in vivo function in

PAGE 76

76 persulfide sulfur tr ansfer. It is possible that Hvo_0025 serves an in vivo functio n similar to Hvo_0024, but is a mercaptopyruvate sulfurtransferase (MST) in vitro Although active site residues of Hvo_0025 appear more like those of the TSTs, rhodaneses with proven in vitro sulfur transfer activities, such as A. vinelandii RhdA, do not necessarily conform to motifs used to categorize these proteins. Further testing will determine whether Hvo_0025 has rhodanese activity with mercaptopyruvate We have demonstrat ed in this study that the cyst(e)ine lyase Hvo_A0635 is not the critical persul fide generating enzyme for the synthesis of MoCo, thiamin, or 2 thiouridine in H. volcanii This leaves the only other annotated cysteine desulfurase of H. volcanii Hvo_0109, as a possible provider of persulfide for these biosynthetic pathways. A knockout strain of Hvo_0109 has yet to be identified after several screenings of possible mutants. Perhaps this cysteine desulfurase serves such critical roles in persulfide dependent biosynthesis that a knockout would simply be lethal resulting in only wild type cells after induced recombination Future work may include creation of a conditional Hvo_0109 mutant to test this hypothesis. In addition, Hvo_0024 has proven essential for thiosulfate sulfurtransferase activity in H. volcanii Continued investigation of the in vivo role of this protein, as well as the other sulfur mobilization proteins of still unknown function investigated in this work will further our understanding of archaeal systems and their relations to bacteria and eukaryota.

PAGE 77

77 LIST OF REFERENCES Agris, P.F., Vendeix, F.A., and Graham, W.D. (2007). tRNA's wobble decoding of the genome: 40 years of modification. J Mol Biol 366 1 13. Allers, T., and Mevarech, M. (2005). Archaeal genetics the third way. Nat Rev Genet 6 58 73. Allers, T., Ngo, H.P., Mevarech, M., and Lloyd, R.G. (2004). Development of additional selectable markers for the halophilic archaeon Haloferax volcanii based on the leuB and trpA genes. Appl Environ Microbiol 70 943 953. Aravind, L., and Koonin, E.V. (2001). THUMP -a pre dicted RNA binding domain shared by 4 thiouridine, pseudouridine synthases and RNA methylases. Trends Biochem Sci 26 215 217. Begley, T.P., Xi, J., Kinsland, C., Taylor, S., and McLafferty, F. (1999). The enzymology of sulfur activation during thiamin and biotin biosynthesis. Curr Opin Chem Biol 3 623 629. Beinert, H. (2000a). A tribute to sulfur. Eur J Biochem 267 5657 5664. Beinert, H. (2000b). Iron sulfur proteins: ancient structures, still full of surprises. J Biol Inorg Chem 5 2 15. Bell, S.D., and Jackson, S.P. (2001). Mechanism and regulation of transcription in archaea. Curr Opin Microbiol 4 208 213. Bergstrom, D.E., and Leonard, N.J. (1972). Photoreaction of 4 thiouracil with cytosine. Relation to photoreactions in Escherichia coli transfer rib onucleic acids. Biochemistry 11 1 9. Bickel Sanktter, S., and Ufer, M. (1995). Properties of a dissimilatory nitrate reductase from the halophilic archaeon Haloferax volcanii Z Naturforsch 50 ,365 372. Bitan Banin, G., Ortenberg, R., and Mevarech, M. (20 03). Development of a gene knockout system for the halophilic archaeon Haloferax volcanii by use of the pyrE gene. J Bacteriol 185 772 778. Boeke, J.D., LaCroute, F., and Fink, G.R. (1984). A positive selection for mutants lacking orotidine 5' phosphate d ecarboxylase activity in yeast: 5 fluoro orotic acid resistance. Mol Gen Genet 197 345 346. Bordo, D., and Bork, P. (2002). The rhodanese/Cdc25 phosphatase superfamily. Sequence structure function relations. EMBO Rep 3 741 746.

PAGE 78

78 Bork, P., and Koonin, E.V. (1994). A P loop like motif in a widespread ATP pyrophosphatase domain: implications for the evolution of sequence motifs and enzyme activity. Proteins 20 347 355. Brown, J.R., and Doolittle, W.F. (1997). Archaea and the prokaryote to eukaryote transitio n. Microbiol Mol Biol Rev 61 456 502. Campanini, B., Schiaretti, F., Abbruzzetti, S., Kessler, D., and Mozzarelli, A. (2006). Sulfur mobilization in cyanobacteria: the catalytic mechanism of L cystine C S lyase (C DES) from synechocystis. J Biol Chem 281 38769 38780. Cartini, F., Remelli, W., Dos Santos, P.C., Papenbrock, J., Pagani, S., and Forlani, F. (2011). Mobilization of sulfane sulfur from cysteine desulfurases to the Azotobacter vinelandii sulfurtransferase RhdA. Amino Acids 41 141 150. Cipollone R., Ascenzi, P., and Visca, P. (2007). Common themes and variations in the rhodanese superfamily. IUBMB Life 59 51 59. Cupp Vickery, J.R., Urbina, H., and Vickery, L.E. (2003). Crystal structure of IscS, a cysteine desulfurase from Escherichia coli. J M ol Biol 330 1049 1059. Dennis, P.P. (1997). Ancient ciphers: translation in Archaea. Cell 89 1007 1010. Dyall Smith, M. (2009). The halohandbook: protocols for haloarchaeal genetics. 144 pp. http://www.haloarchaea.com/resources/halohandbook Edmonds, C.G., Crain, P.F., Gupta, R., Hashizume, T., Hocart, C.H., Kowalak, J.A., Pomerantz, S.C., Stetter, K.O., and McCloskey, J.A. (1991). Posttranscriptional modification of tRNA in thermophilic archaea (Archaebacteria). J Bacteriol 173 3138 3148. Emilsson, V., Nslund, A.K., and Kurland, C.G. (1992). Thiolation of transfer RNA in Escherichia coli varies with growth rate. Nucleic Acids Res 20 4499 4505. Gupta, R. (1984). Halobacterium volcanii tRNAs. Identification of 41 tRNAs covering all amino acids, and the sequences of 33 class I tRNAs. J Biol Chem 259 9461 9471. Hnzelmann, P., Dahl, J.U., Kuper, J., Urban, A., Mller Theissen, U., L eimkhler, S., and Schindelin, H. (2009). Crystal structure of YnjE from Escherichia coli, a sulfurtransferase with three rhodanese domains. Protein Sci 18 2480 2491. Hartman, A.L., Norais, C., Badger, J.H., Delmas, S., Haldenby, S., Madupu, R., Robinson, J., Khouri, H., Ren, Q., Lowe, T.M. et al. (2010). The complete genome sequence of Haloferax volcanii DS2, a model archaeon. PLoS One 5 e9605. Hochstrasser, M. (2000). Evolution and function of ubiquitin like protein conjugation systems. Nat Cell Biol 2 E153 157.

PAGE 79

79 Hochstrasser, M. (2009). Origin and function of ubiquitin like proteins. Nature 458 422 429. Humbard, M.A., Miranda, H.V., Lim, J.M., Krause, D.J., Pritz, J.R., Zhou, G., Chen, S., Wells, L., and Maupin Furlow, J.A. (2010). Ubiquitin like smal l archaeal modifier proteins (SAMPs) in Haloferax volcanii. Nature 463 54 60. Igloi, G.L. (1988). Interaction of tRNAs and of phosphorothioate substituted nucleic acids with an organomercurial. Probing the chemical environment of thiolated residues by aff inity electrophoresis. Biochemistry 27 3842 3849. Ikeuchi, Y., Shigi, N., Kato, J., Nishimura, A., and Suzuki, T. (2006). Mechanistic insights into sulfur relay by multiple sulfur mediators involved in thiouridine biosynthesis at tRNA wobble positions. Mo l Cell 21 97 108. Jger, G., Leipuviene, R., Pollard, M.G., Qian, Q., and Bjrk, G.R. (2004). The conserved Cys X1 X2 Cys motif present in the TtcA protein is required for the thiolation of cytidine in position 32 of tRNA from Salmonella enterica serovar Typhimurium. J Bacteriol 186 750 757. Javor, B.J. (1984). Growth potential of halophilic bacteria isolated from solar salt environments: carbon sources and salt requirements. Appl Environ Microbiol 48 352 360. Kaiser, J.T., Clausen, T., Bourenkow, G.P., Bartunik, H.D., Steinbacher, S., and Huber, R. (2000). Crystal structure of a NifS like protein from Thermotoga maritima: implications for iron sulphur cluster assembly. J Mol Biol 297 451 464. Kambampati, R., and Lauhon, C.T. (2003). MnmA and IscS are re quired for in vitro 2 thiouridine biosynthesis in Escherichia coli. Biochemistry 42 1109 1117. Kessler, D. (2006). Enzymatic activation of sulfur for incorporation into biomolecules in prokaryotes. FEMS Microbiol Rev 30 825 840. Kowalak, J.A., Dalluge, J .J., McCloskey, J.A., and Stetter, K.O. (1994). The role of posttranscriptional modification in stabilization of transfer RNA from hyperthermophiles. Biochemistry 33 7869 7876. Kramer, G.F., Baker, J.C., and Ames, B.N. (1988). Near UV stress in Salmonella typhimurium: 4 thiouridine in tRNA, ppGpp, and ApppGpp as components of an adaptive response. J Bacteriol 170 2344 2351. Kreis Kleinschmidt, V., Fahrenholz, F., Kojro, E., and Krger, A. (1995). Periplasmic sulphide dehydrogenase (Sud) from Wolinella suc cinogenes: isolation, nucleotide sequence of the sud gene and its expression in Escherichia coli. Eur J Biochem 227 137 142.

PAGE 80

80 Lang, T., and Kessler, D. (1999). Evidence for cysteine persulfide as reaction product of L Cyst(e)ine C S lyase (C DES) from Syne chocystis. Analyses using cystine analogues and recombinant C DES. J Biol Chem 274 189 195. Laten, H.M., Cramer, J.H., and Rownd, R.H. (1983). Thiolated nucleotides in yeast transfer RNA. Biochim Biophys Acta 741 1 6. Lauhon, C.T. (2002). Requirement for IscS in biosynthesis of all thionucleosides in Escherichia coli. J Bacteriol 184 6820 6829. Lauhon, C.T., and Kambampati, R. (2000). The iscS gene in Escherichia coli is required for the biosynthesis of 4 thiouridine, thiamin, and NAD. J Biol Chem 275 2 0096 20103. Leidel, S., Pedrioli, P.G., Bucher, T., Brost, R., Costanzo, M., Schmidt, A., Aebersold, R., Boone, C., Hofmann, K., and Peter, M. (2009). Ubiquitin related modifier Urm1 acts as a sulphur carrier in thiolation of eukaryotic transfer RNA. Natur e 458 228 232. Leimkhler, S., and Rajagopalan, K.V. (2001). A sulfurtransferase is required in the transfer of cysteine sulfur in the in vitro synthesis of molybdopterin from precursor Z in Escherichia coli. J Biol Chem 276 22024 22031. Ma, K., Hutchins A., Sung, S.J., and Adams, M.W. (1997). Pyruvate ferredoxin oxidoreductase from the hyperthermophilic archaeon, Pyrococcus furiosus, functions as a CoA dependent pyruvate decarboxylase. Proc Natl Acad Sci U S A 94 9608 9613. MacNeill, S.A. (2001). Under standing the enzymology of archaeal DNA replication: progress in form and function. Mol Microbiol 40 520 529. Makarova, K.S., and Koonin, E.V. (2010). Archaeal ubiquitin like proteins: functional versatility and putative ancestral involvement in tRNA modification revealed by comparative genomic analysis. Archaea 2010 Marinus, M.G., Carraway, M., Frey, A.Z., Brown, L., and Arraj, J.A. (1983). Insertion mutations in the dam gene of Escherichia coli K 12. Mol Gen Genet 192 288 289. Marquet, A. (2001). E nzymology of carbon sulfur bond formation. Curr Opin Chem Biol 5 541 549. Marteinsson, V.T., Birrien, J.L., Reysenbach, A.L., Vernet, M., Marie, D., Gambacorta, A., Messner, P., Sleytr, U.B., and Prieur, D. (1999). Thermococcus barophilus sp. nov., a new barophilic and hyperthermophilic archaeon isolated under high hydrostatic pressure from a deep sea hydrothermal vent. Int J Syst Bacteriol 49 Pt 2 351 359.

PAGE 81

81 Matthies, A., Nimtz, M., and Leimkhler, S. (2005). Molybdenum cofactor biosynthesis in humans: ide ntification of a persulfide group in the rhodanese like domain of MOCS3 by mass spectrometry. Biochemistry 44 7912 7920. McCloskey, J.A., Graham, D.E., Zhou, S., Crain, P.F., Ibba, M., Konisky, J., Sll, D., and Olsen, G.J. (2001). Post transcriptional mo dification in archaeal tRNAs: identities and phylogenetic relations of nucleotides from mesophilic and hyperthermophilic Methanococcales. Nucleic Acids Res 29 4699 4706. Mevarech, M., Frolow, F., and Gloss, L.M. (2000). Halophilic enzymes: proteins with a grain of salt. Biophys Chem 86 155 164. Mihara, H., and Esaki, N. (2002). Bacterial cysteine desulfurases: their function and mechanisms. Appl Microbiol Biotechnol 60 12 23. Mihara, H., Kurihara, T., Yoshimura, T., Soda, K., and Esaki, N. (1997). Cystei ne sulfinate desulfinase, a NIFS like protein of Escherichia coli with selenocysteine lyase and cysteine desulfurase activities. Gene cloning, purification, and characterization of a novel pyridoxal enzyme. J Biol Chem 272 22417 22424. Miranda, H.V., Nemb hard, N., Su, D., Hepowit, N., Krause, D.J., Pritz, J.R., Phillips, C., Sll, D., and Maupin Furlow, J.A. (2011). E1 and ubiquitin like proteins provide a direct link between protein conjugation and sulfur transfer in archaea. Proc Natl Acad Sci U S A 108 4417 4422. Mueller, E.G. (2006). Trafficking in persulfides: delivering sulfur in biosynthetic pathways. Nat Chem Biol 2 185 194. Mueller, E.G., Buck, C.J., Palenchar, P.M., Barnhart, L.E., and Paulson, J.L. (1998). Identification of a gene involved in the generation of 4 thiouridine in tRNA. Nucleic Acids Res 26 2606 2610. Mueller, E.G., Palenchar, P.M., and Buck, C.J. (2001). The role of the cysteine residues of ThiI in the generation of 4 thiouridine in tRNA. J Biol Chem 276 33588 33595. Mullakhanbh ai, M.F., and Larsen, H. (1975). Halobacterium volcanii spec. nov., a Dead Sea halobacterium with a moderate salt requirement. Arch Microbiol 104 207 214. Nagahara, N., Okazaki, T., and Nishino, T. (1995). Cytosolic mercaptopyruvate sulfurtransferase is e volutionarily related to mitochondrial rhodanese. Striking similarity in active site amino acid sequence and the increase in the mercaptopyruvate sulfurtransferase activity of rhodanese by site directed mutagenesis. J Biol Chem 270 16230 16235. Nakai, Y., Nakai, M., and Hayashi, H. (2008). Thio modification of yeast cytosolic tRNA requires a ubiquitin related system that resembles bacterial sulfur transfer systems. J Biol Chem 283 27469 27476.

PAGE 82

82 Noma, A., Sakaguchi, Y., and Suzuki, T. (2009). Mechanistic ch aracterization of the sulfur relay system for eukaryotic 2 thiouridine biogenesis at tRNA wobble positions. Nucleic Acids Res 37 1335 1352. Oren, A., and Truper, H.G. (1990). Anaerobic growth of halophilic archaeobacteria by reduction of dimethylsulfoxide and trimethylamine N oxide. FEBS Microbiol Lett 70 : 33 36. Oren, A. (1991). Anaerobic growth of halophilic archaeobacteria by reduction of fumarate. J Gen Microbiol 137 :1387 1390. Outten, F.W., Djaman, O., and Storz, G. (2004). A suf operon requirement for Fe S cluster assembly during iron starvation in Escherichia coli. Mol Microbiol 52 861 872. Pagani, S., Bonomi, F., and Cerletti, P. (1984). Enzymic synthesis of the iron sulfur cluster of spinach ferredoxin. Eur J Biochem 142 361 366. Palenchar, P.M ., Buck, C.J., Cheng, H., Larson, T.J., and Mueller, E.G. (2000). Evidence that ThiI, an enzyme shared between thiamin and 4 thiouridine biosynthesis, may be a sulfurtransferase that proceeds through a persulfide intermediate. J Biol Chem 275 8283 8286. P ark, S., and Imlay, J.A. (2003). High levels of intracellular cysteine promote oxidative DNA damage by driving the fenton reaction. J Bacteriol 185 1942 1950. Ramabhadran, T.V., and Jagger, J. (1976). Mechanism of growth delay induced in Escherichia coli by near ultraviolet radiation. Proc Natl Acad Sci U S A 73 59 63. Rogers, K.C., Crescenzo, A.T., and Sll, D. (1995). Aminoacylation of transfer RNAs with 2 thiouridine derivatives in the wobble position of the anticodon. Biochimie 77 66 74. Rozenski, J. Crain, P.F., and McCloskey, J.A. (1999). The RNA Modification Database: 1999 update. Nucleic Acids Res 27 196 197. Schindelin, H. (2005). Evolutionary Origin of the Activation Step During Ubiquitin dependent Protein Degradation. Protein Degradation 1. U biquitin and the Chemistry of Life (Mayer, J. R., Ciechanover, A., and Rechsteiner, M., Eds.) 1: 21 43. Wiley VCH Verlag, Weinheim, Germany. Schleper, C., Puehler, G., Holz, I., Gambacorta, A., Janekovic, D., Santarius, U., Klenk, H.P., and Zillig, W. (199 5). Picrophilus gen. nov., fam. nov.: a novel aerobic, heterotrophic, thermoacidophilic genus and family comprising archaea capable of growth around pH 0. J Bacteriol 177 7050 7059.

PAGE 83

83 Schmitz, J., Chowdhury, M.M., Hnzelmann, P., Nimtz, M., Lee, E.Y., Schindelin, H., and Leimkhler, S. (2008). The sulfurtransferase activity of Uba4 presents a link between ubiquitin like protein conjugation and activation of sulfur carrier proteins. Biochemistry 47 6479 6489. Schwarz, G., Mendel, R.R., and Ribbe, M.W. ( 2009). Molybdenum cofactors, enzymes and pathways. Nature 460 :839 847. Sherwood, K.E., Cano, D.J., and Maupin Furlow, J.A. (2009). Glycerol mediated repression of glucose metabolism and glycerol kinase as the sole route of glycerol catabolism in the haloar chaeon Haloferax volcanii. J Bacteriol 191 4307 4315. Shigi, N., Sakaguchi, Y., Asai, S., Suzuki, T., and Watanabe, K. (2008). Common thiolation mechanism in the biosynthesis of tRNA thiouridine and sulphur containing cofactors. EMBO J 27 3267 3278. Shig i, N., Sakaguchi, Y., Suzuki, T., and Watanabe, K. (2006a). Identification of two tRNA thiolation genes required for cell growth at extremely high temperatures. J Biol Chem 281 14296 14306. Shigi, N., Suzuki, T., Terada, T., Shirouzu, M., Yokoyama, S., an d Watanabe, K. (2006b). Temperature dependent biosynthesis of 2 thioribothymidine of Thermus thermophilus tRNA. J Biol Chem 281 2104 2113. Soppa, J. (2006). From genomes to function: haloarchaea as model organisms. Microbiology 152 585 590. Sorbo, B.H. ( 1957). Sulfite and complex bound cyanide as sulfur acceptors for rhodanese. Acta Chem. Scand. 11: 629 633. Takei, K., Nakamura, K., Toki, T., Tsunogai, U., Miyazaki, M., Miyazaki, J., Hirayama, H., Nakagawa, S., Nunoura, T., and Horikoshi, K. (2008). Cell proliferation at 122 C and isotopically heavy CH4 production by a hyperthermophilic methanogen under high pressure cultivation. Proc Natl Acad Sci U S A 105:10949 10954. Umeda, N., Suzuki, T., Yukawa, M., Ohya, Y., Shindo, H., and Watanabe, K. (2005). Mito chondria specific RNA modifying enzymes responsible for the biosynthesis of the wobble base in mitochondrial tRNAs. Implications for the molecular pathogenesis of human mitochondrial diseases. J Biol Chem 280 1613 1624. Watanabe, K., Oshima, T., Saneyoshi M., and Nishimura, S. (1974). Replacement of ribothymidine by 5 methyl 2 thiouridine in sequence GT psi C in tRNA of an extreme thermophile. FEBS Lett 43 59 63. Waterman, D.G., Ortiz Lombarda, M., Fogg, M.J., Koonin, E.V., and Antson, A.A. (2006). Crys tal structure of Bacillus anthracis ThiI, a tRNA modifying enzyme containing the predicted RNA binding THUMP domain. J Mol Biol 356 97 110.

PAGE 84

84 Wendoloski, D., Ferrer, C., and Dyall Smith, M.L. (2001). A new simvastatin (mevinolin) resistance marker from Halo arcula hispanica and a new Haloferax volcanii strain cured of plasmid pHV2. Microbiology 147 959 964. Woese, C.R., Kandler, O., and Wheelis, M.L. (1990). Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc Natl Acad Sci U S A 87 4576 4579. Zafrilla, B., Martnez Espinosa, R.M., Esclapez, J., Prez Pomares, F., and Bonete, M.J. (2010). SufS protein from Haloferax volcanii involved in Fe S cluster assembly in haloarchaea. Biochim Biophys Acta 1804 1476 1482. Zhang, W., Urban, A., Mihara, H., Leimkhler, S., Kurihara, T., and Esaki, N. (2010). IscS functions as a primary sulfur donating enzyme by interacting specifically with MoeB and MoaD in the biosynthesis of molybdopterin in Escherichia coli. J Biol Chem 2 85 2302 2308. Zheng, L., Cash, V.L., Flint, D.H., and Dean, D.R. (1998). Assembly of iron sulfur clusters. Identification of an iscSUA hscBA fdx gene cluster from Azotobacter vinelandii. J Biol Chem 273 13264 13272. Zheng, L., White, R.H., Cash, V.L., an d Dean, D.R. (1994). Mechanism for the desulfurization of L cysteine catalyzed by the nifS gene product. Biochemistry 33 4714 4720. Zheng, M., Wang, X., Templeton, L.J., Smulski, D.R., LaRossa, R.A., and Storz, G. (2001). DNA microarray mediated transcrip tional profiling of the Escherichia coli response to hydrogen peroxide. J Bacteriol 183 4562 4570.

PAGE 85

85 BIOGRAPHICAL SKETCH Mary H olman grew up in Bloomington, Minnesota and graduated from South Dakota from 2005 to 2009 as a student athlete, competing on the university swim team while earning her b achel or s degree in b iology. Upon completion of her undergraduate degree, Mary went on to graduate school at the University of Florida, and in August 2011, graduated with her Master of Science in m icrobiology and cell science She plans on using her graduate de gree as a scientist In the United States Air Force.