Effect of the Nitrate Reductase Operon on Staphylococcus aureus Biofilm Formation

MISSING IMAGE

Material Information

Title:
Effect of the Nitrate Reductase Operon on Staphylococcus aureus Biofilm Formation
Physical Description:
1 online resource (77 p.)
Language:
english
Creator:
Holman,Sara E
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Microbiology and Cell Science
Committee Chair:
Rice, Kelly Christine
Committee Members:
Romeo, Tony
Maupin, Julie A

Subjects

Subjects / Keywords:
biofilm -- nitrate -- reductase -- staphylococcus
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre:
Microbiology and Cell Science thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Staphylococcus aureus is thought to produce endogenous nitric oxide (NO) primarily through the action of NO synthase (NOS). It is known that nitrate reductases of plants and Salmonella typhimurium can convert nitrite to NO, but whether this pathway exists in S. aureus is unknown. NO, a possible signaling molecule, has been shown to inhibit attachment during S. aureus biofilm formation. This purpose of this study was to determine if S. aureus nitrate reductase has an effect on biofilm phenotype, and if so, whether this phenotype is attributable to altered levels of NO production. S. aureus Newman and its corresponding nar mutant were grown as biofilms in the presence or absence of sodium nitrate (NaNitrate) or sodium nitrite (NaNitrite). Biofilm differences were observed using Live/Dead staining and confocal microscopy. Untreated Newman biofilms were weakly attached and patchy, but treatment with NaNitrate or NaNitrite significantly increased the biomass and average thickness. The nar mutant biofilm did not respond to NaNitrate treatment, but showed significantly more biomass and average thickness when treated with NaNitrite. A nar mutant was also created in strain UAMS-1, which contains an NO-reductase gene not present in Newman, possibly altering its response to NO production. Although UAMS-1 produced a more robust biofilm compared to Newman, treatment with NaNitrate caused a similar effect on its biofilm phenotype (increased biomass and average thickness), and its nar mutant showed no change in average thickness when treated with NaNitrate. Relative levels of NO production in wild-type and mutant biofilms were measured using DAF-FM diacetate assays. NaNitrate treatment in both wild-type strains resulted in increased NO production compared to untreated biofilms, whereas NaNitrite treatment had a less pronounced effect. NO levels in the nar mutant in both strains did not increase in response to treatment with NaNitrate. Collectively, these results demonstrate that S. aureus nitrate reductase affects biofilm development when grown in the presence of NaNitrate or NaNitrite, but further study is required to determine if altered NO levels are responsible for these phenotypes. This study has also uncovered a previously-unrecognized role for nitrate reductase in contributing to endogenous NO production in S. aureus.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Sara E Holman.
Thesis:
Thesis (M.S.)--University of Florida, 2011.
Local:
Adviser: Rice, Kelly Christine.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043456:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 EFFECT OF THE NITRATE REDUCTASE OPERON ON STAPHYLOCOCCUS AUREUS BIOFILM FORMATION By SARA ELIZABETH HOLMAN A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Sara Elizabeth Holman

PAGE 3

3 To my family

PAGE 4

4 ACKNOWLEDGMENTS I thank my parents for always supporting me, and the Gator Masters Swim Team for being my family in Gainesville. I thank my professor, Dr. Rice, for helping me on this project, and my collaborator Dr. Richardson. I thank my undergrad helper, Jenna, for b eing a pleasure to work with.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 ABSTRACT ................................ ................................ ................................ ..................... 9 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 11 Staphy lococcus aureus ................................ ................................ ........................... 11 MRSA ................................ ................................ ................................ ............... 12 S. aureus Virulence Factors ................................ ................................ ............. 13 Regulation of S. aureus Virulence Factors ................................ ....................... 14 Metabolism ................................ ................................ ................................ ....... 15 Biofilms ................................ ................................ ................................ ................... 16 S. aureus Biofilms ................................ ................................ ................................ ... 18 Attachment Phase ................................ ................................ ............................ 18 Accumulation Phase ................................ ................................ ......................... 19 Maturation and Dispersal Phases ................................ ................................ ..... 20 Nitric Oxide ................................ ................................ ................................ ............. 20 Role of Nitric Oxide in Biofilms ................................ ................................ ......... 21 Role of NO Metabolism in S. aureus Virulence ................................ ................ 22 Potential Routes of Endogenous NO Formation in S. aureus ........................... 23 Nitrate Reductases ................................ ................................ ................................ 24 Regulators of nar ................................ ................................ .............................. 25 NO Production by nar in Other Organisms ................................ ....................... 26 Hypothesis ................................ ................................ ................................ .............. 27 2 METHODS AND MATERIALS ................................ ................................ ................ 29 Bacterial Strains and Growth Conditions ................................ ................................ 29 Creation of Mutants ................................ ................................ ................................ 29 Creation of the Trans Complement Plasmid pCN nar ................................ ............. 31 Biofilm Assays for Confocal Microscopy ................................ ................................ 33 Measurement of Relative NO Production in Static Biofilms ................................ .... 34 Treatment Conditions ................................ ................................ .............................. 35 3 RESULTS ................................ ................................ ................................ ............... 43 Effect of Nitrate Metabolism on S. aureus Biofilms ................................ ................. 43 NO Production Varies Between Wild type and Mutants ................................ .......... 45

PAGE 6

6 Nitrate Levels Affect NO Production ................................ ................................ ....... 46 Analysis of the nar Mutation in UAMS 1 ................................ ................................ 46 Analysis of nar Complementation in UAMS 1 ................................ ......................... 48 4 DISCUSSION ................................ ................................ ................................ ......... 59 LIST OF REFERENCES ................................ ................................ ............................... 63 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 77

PAGE 7

7 LIST OF TABLES Table page 2 1 Strains and plasmids used in this study ................................ .............................. 37 2 2 S. aureus genes investigated in this study ................................ ......................... 38 2 3 Primers used in this study ................................ ................................ .................. 39

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Po stulated routes for NO formation and consumption in S. aureus .................... 28 2 1 Diagram representing primer locations ................................ ............................... 39 2 2 Confirmation of nar mutants in S. aureus UAMS 1 ................................ ........... 40 2 3 Confirmation that the nar complement plasmid is present and carries the narGHJI genes in E.coli DH5 ................................ ................................ .......... 41 2 4 Confirmation that the nar complement plasmid is present and carries the narGHJI genes in S. aureus strain UAMS 1 ................................ ....................... 42 3 1 Effect of the nar mutation on biofilm formation. ................................ .................. 50 3 2 Effect of the nirBD mutation on biofilm formation. ................................ ............... 51 3 3 Effect of the nreC mutation on biofilm formation. ................................ ................ 52 3 4 COMSTAT analysis of wild type (Newman) and nar nir and nre mutant biofilms ................................ ................................ ................................ ............... 53 3 5 Relative NO production by wild type (Newman) and nar nir nos hmp and nre mutants, as measured by DAF FM diacetate staining. ................................ 54 3 6 Relative NO production in nitrate treated cultures by wild type (Newman) as measured by DAF FM diaceta te staining ................................ ........................... 55 3 7 Effect of the nar mutation on biofilm formation in UAMS 1. ................................ 56 3 8 COMSTAT analysis reveals statistically significant differences between wild type (UAMS 1) and the nar mutant ................................ ................................ ..... 57 3 9 Relative NO production by wild type (UAMS 1) and nar mutant as measured by DAF FM diacetate staining. ................................ ................................ .......... 58

PAGE 9

9 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science EFFECT OF THE NITRATE REDUCTASE OPERON ON STAPHYLOCOCCUS AUREUS BIOFILM FORMATION By Sara Elizabeth Holman August 2011 Chair: Kelly C. Rice Major: Microbiology and Cell Science Staphylococcus aureus is thought to produce endogenous nitric oxide (NO) primarily through the action of NO synthase (NOS). It is known that nitrate reductases of plants and Salmonella typhimurium can convert nitri te to NO, but whether this pathway exists in S. aureus is unknown. NO a possible signaling molecule, has been shown to inhibit attachment during S. aureus biofilm formation. This purpose of this study was to determine if S. aureus nitrate reductase has an effect on biofilm phenotype, and if so, whether this phenotype is attributable to altered levels of NO production. S. aureus Newman and its corresponding nar mutant were grown as biofilms in the presence or absence of sodium nitrate (NaNitrate) or sodi um nitrite (NaNitrite). Biofilm differences were observed using Live/Dead staining and confocal microscopy. Untreated Newman biofilms were weakly attached and patchy, but treatment with NaNitrate or NaNitrite significantly increased the biomass and average thickness. The nar mutant biofilm did not respond to NaNitrate treatment, but showed significantly more biomass and average thickness when treat ed with NaNitrite. A nar mutant was also created in strain UAMS 1, which contains an NO reductase gene not present in Newman, possibly altering its response to NO production. Although UAMS 1

PAGE 10

10 produced a more robust biofilm compared to Newman, treatment wit h NaNitrate caused a similar effect on its biofilm phenotype (increased biomass and average thickness), and its nar mutant showed no change in average thickness when treated with NaNitrate. Relative levels of NO production in wild type and mutant biofilms w ere measured using DAF FM diacetate assays. NaNitrate treatment in both wild type strains resulted in increased NO production compared to untreated biofilms, whereas NaNitrite treatment had a less pronounced effect. NO levels in the nar mutant in both strains did not increase in response to treatment with NaNitrate. Collectively, these results demonstrate that S. aureus nitrate reductase affects biofilm development when grown in the presence of NaNitrate or NaNitrite, but further study is required to d etermine if altered NO levels are responsible for these phenotypes. This study has also uncovered a previously unrecognized role for nitrate reductase in contributing to endogenous NO production in S. aureus

PAGE 11

11 CHAPTER 1 I NTRODUCTION Staphylococcus aureus S taphylococcus aureus is a bacterium that belongs to Micrococcaceae family, and appears as gram positive cocci in clusters when observed under a microscope (Lowy 1998). S. aureus can be distinguished from other members of the Staphylococcus genus because of its gold pigmentation of colonies, positive coagulase test mannitol fermentation, and deoxyribonuclease tests ( Wilkinson, 1997 ). The S. aureus genome consists of a circular chromosome around 2800 base pairs in length, con taining prophages, plasmids, a nd transposons (Lowy 1998). Staphylococcus aureus is one of the most successful human pathogens, causing invasive infections in both immunocompromised and immunocompetent hosts ( Gaujoux Viala et al 2011; Shankar et al 2009; Minhas et al., 2011 ; Imat aki et al., 2006 ). Infections by S. aureus are notoriously difficult to prevent and treat, as this defense against S. aureu s (Richardson et al., 2006). S. aureus can cause skin and soft tissue infections (Decker et al., 1986) bacteremia (Mylotte et al., 1987) abscesses (Cheng et al., 2011) endocarditis (Espersen and Fridmodt Moller 1986) toxic shock syndrome (Bohach et a l., 1990) sepsis (Bone, 1994) and nosocomial infections (Stamm et al., 1981) However, S. aureus is also considered a part of the normal flora, as it asymptomatically colonizes healthy people (Chambers and DeLeo, 2009). Approximately 30% of humans are n asal carriers and are an important source of the spread of S. aureus strains among individuals ( Gorwitz et al., 200 8 ; Kluytmans et al.,

PAGE 12

12 1997 ). Transmission is primarily through direct skin to skin contact with a colonized individual ( Miller and Diep, 200 8 ). Persons colonized with S. aureus are at increased risk for subsequent infection ( Wenzel and Perl, 1995 ). Rates of colonization are high among intravenous drug users, patients with Type I diabetes ( Tuazon et al. 1975 ) surgical patients ( Kluytmans et al. 1995 ) patients with acquired immunodeficiency syndrome (Weinke et al 1992 ) and patients with defects in leukocyte function ( Waldvogel, 1995 ). MRSA Staphylococcus aureus is notorious for its ability to become resistant to antibiotics, which is often acquired by horizontal gene transfer, or in some cases by chromosomal mutation and antibiotic selection (Chambers and DeLeo, 2009). Methicilin resistant S. aureus (MRSA) stra ins are resistant to practically all lactam antibiotics, a class represented by penicillins and cephalosporins ( Chambers and Neu, 1995 ). MRSA was once confined to hospitals and other health care environments (termed health care associated MRSA or HA MRS A) along with the patients frequenting these facilities, however since the 1990s there has been an explosion of the number of cases in people lacking the risk factors and exposure to these facilities ( Gorak et al., 1999; Herold et al., 1998 ; Wu et al., 200 2 ). New MRSA strains, referred to as community associated MRSA (CA MRSA) strains are largely responsible for these cases and appear to have rapidly disseminated among the general population in most areas of the United States (David and Daum, 2010). Whil e HA MRSA strains mostly infect older individuals with previous health conditions who have been exposed to the health care setting, CA MRSA strains tend to infect younger and otherwise healthy individuals ( Naimi et al., 2003 ; Fridkin et

PAGE 13

13 al., 2005 ). CA MRS A infections have become commonplace and have created a public health crisis in the U.S. emergency departments and other clinical settings (David and Daum, 2010). There are few antibiotics available to treat MRSA infections (Daum and Seal, 2001) and the development of new classes of antibiotics has slowed (Talbot et al., 2006) Furthermore, there have been reports of isolates resistant to each of the few antibacterial drug classes effective against MRSA, raising the possibility that an untreatable multi d rug resistant strain of S. aureus may develop in the future ( Dowzicky et al., 2000; Luh et al., 2000; Marty et al., 2006; Meka et al., 2004 ; Rose and Rybak, 2006 ). S. aureus V irulence F actors S. aureus possesses a broad array of virulence factors that contribute to its pathogenesis, including colonization/adherence factors, toxins, phagocytosis inhibitors, and immune evasion molecules (Bartlett and Hulten, 2010). The first step in infection is the atta chment to host cells or the extracellular matrix by Microbial Surface Components Recognizing Adhesive Matrix Molecules (MSCRAMMS), which are cell wall anchored proteins secreted by the sec system (Bartlett and Hulten, 2010). These molecules have an expose d binding domain for interaction with the host, a cell wall spanning domain, and a domain for covalent or non covalent attachment to bacterial surfaces (Patti et al., 1994). As soon as S. aureus gains access to tissues in the body, several chemoattractant s are released that produce a concentration gradient that stimulate the migration of neutrophils to the site of infection ( Gasque 200 4 ). However, S. aureus is able to synthesize chemotaxis inhibitory proteins (CHIPS) that block receptors for the chemoatt ractants, which inhibits leuokocyte activation and migration ( de Haas et al., 200 4 ). In addition, S. aureus can produce a number of secreted toxins and exo

PAGE 14

14 enzymes that can destroy specific host cell and tissue types (Lowy 1998). S. aureus can also explo it the inflammatory response of the host by surviving inside the phagosome if it becomes engulfed by neutrophils ( Gresham et al., 200 0 ). Becoming intracellular allows S. aureus to escape host immunity until the neutrophils lyse and release DNA, forming extracellular traps that bind and finally kill the bacteria ( Brinkman n and Zychlinsky, 200 7 ). Regulation of S. aureus V irulence F actors The first well characterized regulator of virulence factor expression in S. aureus was the accessory gene regulator (A gr) (Recsei et al., 1986). The agr system consists of two divergently transcribed loci controlled by two promoters, P2 and P3, that regulate the transcription of a cell density sensing two component regulator system and a regulatory RNA known as RNAIII (N ovick et al., 1995). The P2 promoter controls four genes: argA agrB agrC and agrD (Som erville and Proctor, 2009). When AgrD, an autoinducer peptide, reaches a threshold level outside of the cell due to its accumulation during bacterial grow th, it compl exes with AgrC (mem brane sensor kinase) and activates its kinase domain (Lina et al., 1998). Subsequent transfer of a phosphoryl group from AgrC to AgrA (response regulator) activates this transcription factor, which in turn increases transcription from b oth the P2 and P3 promoters (Koenig et al., 2004). Transcription from P3 produces the riboregulator RNAIII, which enhances the synthesis of secreted virulence determinants (such as alpha toxin, serine protease) and represses the synthesis of surface assoc iated proteins (such as protein A) (Recsei et al., 1986). The s econd major virulence regulator identified in S. aureus was the staphylococcal accessory regulator (SarA) (Cheung et al., 1992). SarA encodes a DNA binding protein which functions in part to regulate the transcription of agrABCD and

PAGE 15

15 RNAIII (Morfeldt et al., 1996). More recently, a whole family of SarA proteins has been iden tif i ed in S. aureus which comprise a complex network of regulators (Cheung et al., 2004; Cheung et al., 2008). In addition, the S. aureus sigma factor B is activated under stress conditions (environmental or nutritional), growth transitions, or during morphological changes (Senn et al., 2005). In the absence of environmental stimuli, B is bound to an ant i sigma factor, RsbW (So merville and Proctor, 2009). Stress inducing stimuli are hypothesized to activate a signal cascade that results in the activation of the anti anti sigma factor, RsbV, which bind s RsbW in a competitive manner to increase the concent ration of free B (Palma and Cheung, 2001). This allows for the association of B with the core RNA polymerase, which can then bind to promoters to allow for virulence gene transcription (Biscoff et al., 2004). Metabolism Central to the metabolism of S. aureus is the TCA cycle, which supplies biosynthetic intermediates, reducing potential, and ATP (Somerville and Proctor, 2009). Under nutrient rich conditions and during exponential growth phase, TCA cycle activity is very low since the bacterial demand for intermediates is supplied by via carbohydrate fermentation (Somerville et al., 2003). However, when environmental conditions change and carbohydrates and nutrients are limited during stationary phase, TCA cycle activity is increased and the bacteria b egin to catabolize non preferred carbon sources such as the secreted end products of carbohydrate fermentation (Somerville et al., 2002). Repression of the TCA cycle is mediated primarily by CcpA, CodY, and SrrA, which respond to changes in the availabili ty of carbon, nitrogen, and oxygen, respectively (Seidl et al., 2008; Soneneshein 2005; Throup et al., 2001). Thus, as the

PAGE 16

16 metabolic status changes, the DNA binding ability of the regulators also changes, and the TCA cycle is acti vated (So merville and Pr octor, 2009). Numerous studies have implicated the TCA cycle in the regulation of vir ulence (Bae et al., 2004; Coulter et al., 1998; Mei et al., 1997; Somerville et al., 2003). TCA cycle mutants result in a small colony phenotype and a slow growin g subp opulation that causes chro nic and relapsing infections (Kriegeskorte et al., 2011). A recent study showed that when S. aureus TCA cycle mutants were cultured in vitro with the soft tissue of mice, the tissue cells produced significantly lower amounts of nitric oxide and an inducible nitric oxide synthase compared to cells exposed to wild type bacteria (Massilam any et al., 2011). It was proposed that this altered metabolism allows the bacteria to evade host immune responses which enhances their ability to survive within the host (Massilamany et al., 2011). S. aureus is a facultative anaerobic organism, meaning it can grow in e ither aerobic conditions or anaerobic/low oxygen conditions, however the growth rate is drastically reduced after a shift from aerobic to anaerobic growth (Fuchs et al., 2007). Growth under anaerobic or low oxygen conditions is supported by carbohydrate f ermentation or nitrate respiration ( Strasters and Winkler, 1963 ; Burke and Lascelles, 1975 ). Oxygen plays a role in virulence gene regulation and the ability of the bacteria to persist in the host environment ( Chan and Foster, 1998; Pragman et al., 2004 ; R oss and Onderdonk, 2000 ; Ohlsen et al., 1997 ). Biofilms A biofilm can be defined as a community of microorganisms attached to a surface by extracellular polymeric substances which are produce d by the bacteria themselves ( Donlan, 2002 ). Bacteria in biofi lms are physiologically distinct from their corresponding

PAGE 17

17 planktonic bacteria, and they function in a coordinated way that resembles multi cellular organisms ( ). Biofilms can consist of a single species of microbe or can be multi sp ecies or even mu l ti kingdom groupings (Jefferson 2004). An important aspect of the biofilm is that it forms a sticky matrix that typically contains mostly exopolysaccharides, but can also be compromised of protein s nucleic acids, lipids, or other polyme rs ( Flemming and Wingender 20 10 ). This matrix aids in the ability of the biofilm to resist antimic robials and harmful chemicals ( Otto 200 6 ). In bacteria, biofilm formation is the most common microbial lifestyle in both man made and natural environments, and occurs on all surface types (Lindsay and Von Holy 2006). While planktonic (free swimming) cultures have been used in many microbial studies of the past and present, planktonic cell studies do not always reflect the growth of bacteria in nature, and have provided a biased view of microbes living in the environment (Parsek and Fuqua, 2004). Established biofilms are extremely hard to combat in living hosts because they are up to 1000 fold more resistant to antimicrobials than are planktonic cells ( Brooun et al., 2000 ). This increased resistance can be partially attributed to the reduced growth rate of bacteria within biofilms or the wide variety of metabolic states within the biofilm (Kwon et al., 2008). As a result, many times in clinical settings a bacterial biofilm infection will relapse and it becomes necessary to frequently remove or replace the infected tissue or medical device ( Go erke and Wol z 2010; Reslinksi et al., 2009 ). In addition to being less susceptible to antibiotics, biofi lms can withstand nutrient deprivation, pH changes, oxygen radicals, and disinfectants better than planktonic bacteria (Jefferson 2004). Some proposed reasons that bacteria form biofilms include : 1) protection from the

PAGE 18

18 harmful conditions in the host envi ronment (Gilbert et al., 2002), 2) division of labor where the bacteria within the biofilm perform different metabolic functions (Shapiro, 1998) 3 ) biofilms promote the exchange of genetic material ( Nguyen et al. 2010 ), and 4) to remain fixed in a favora ble niche, such as a nutrient rich area (Jefferson, 2004). S. aureus B iofilms S. aureus biofilm formation plays an important role in many diseases such as native valve endocarditis (Chambers et al., 1983), osteomyelitis (Priest and Peacock, 2005), chronic wound infections (Siddiqui and Berstein, 2010), and chronic lung infections in cystic fibrosis patients (Rajan and Saiman, 2002). In clinical settings, biofilms of S. aureus can also form on the surfaces of medical devices and cause persist ent infections (Zimmerli 2006). In general, biofilm formation can be divided into four distinct phases: attachment, accumulation, maturation, and dispersal (Ch r istensen et al., 1994). Attachment P hase The attachment phase is induced by environmental si gnals and may take only seconds to activate (Aparna and Yadav, 2008). These environmental signals vary by organism and include nutrient changes, pH, temperature, oxygen concentration, hydrodynamics, osmolarity, the presence of specific ions, and factors d erived from the biotic environment ( Goller and Romeo 2008). Attachment is reversible, as some cells may detach from the substrata which is crucial for the dissemination of bacteria to other colonization sites (Otto 2008). The primary determinants of a ttachment in S. aureus are a group of surface associated proteins called MSCRAMMs (microbial surface components recognizing adhesive matrix mol ecules) that bind to human matrix proteins such as fibrinogen or fibronectin (Patti et al., 1994). Studies have shown that the

PAGE 19

19 autolysin class of MSCRAMMs play a direct role in mediating the attachment of bacteria to plastic surfaces and human matrix proteins, which serves as a pre requisite for biofilm formation (Heilmann et al., 1997, Heilman et al., 2003). Cell lysis and subsequent release of genomic DNA (eDNA) has also been shown to be an important mediator of attachment in S. aureus (Rice et al ., 2007, Mann et al. 2009). Accumulation P hase In the accumulation phase, cells irreversibly bind and begin to multi ply, causing cell aggregates become thicker and more layered (Aparna and Yadav, 2008). The mechanisms responsible for exopolysaccharide (EPS) production are also activated during this phase, allowing the growing biofilm to trap nutrients and encapsulate p lanktonic bacteria (Aparna and Yadav, 2008). In general, the biofilm matrix not only consists of exopolysaccharides, but a vast array of proteins, adhesins, and extracellular DNA (eDNA), which all contribute to the structural integrity of the biofilm (Bra nda et al., 2005). The nature of the biofilm matrix greatly depends on the growth conditions, medium, and substrates, as well as the species present within the biofilm (Lopez et al., 2010). The accumulation phase of S. aureus biofilm development also relies upon polysaccharide adhesins that promote the adhesive interactions between cells (Gotz 2002). The polysaccharide intracellular adhesin (PIA), encoded by the icaABCD operon, is thought to be the main determinant of accumu lation in S. aureus (Heilman et al., 1996). However, PIA production does not seem to be of universal importance for S. aureus biofilm formation, as PIA independent biofilms have been demonstrated in certain strains of S. aureus (Rohde et al., 2007) and in Staphylococcus epidermi di s (Arciola et al., 2006; Rohde et al., 2005). An example of PIA independent accumulation

PAGE 20

20 in S. aureus comes from hip and knee joint infection isolates of S. aureus where it was found that the adhesive protein Aap substitutes for PIA (Rohde et al., 2007). Maturation and D ispersal P hases As cells continue to grow and divide, eventually a mature biofilm is developed that has a complex architecture consisting of bacterial microcolonies interspersed with less dense regions of the ma trix that include water channels that carry nutrients and waste products (Stoodley et al., 1994; Costerton et al., 1994). At the end of the maturation phase, the biofilm reaches its maximal thickness (Aparna and Yadav, 2008). In the final phase, cell det achment or dispersal is observed, in which some of the bacteria develop the planktonic phenotype and leave the biofilm (Aparna and Yadav, 2008). Detachment can be caused by many factors, including external perturbations such as increased fluid shear, inte rnal biofilm processes such as endogenous enzymatic degradations, or by the release of EPS or surface binding proteins (Hall Stoodley et al., 2004). Controlled detachment maintains a certain biofilm thickness and governs a specific rate of biofilm dissemi nation, which in S. aureus is regulated by the quorum sensing system agr ( Boles and Horswill 2008). The A gr syst em is, to date, the most well characterized regulator of S. aureus biofilm detachment. Nitric Oxide Nitric oxide (NO) is a small, hydrophobic molecule that can easily pass through membranes, and regulates a wide range of biological functions via the post translational modification of proteins (Blaise et al., 2005). NO is an important bioregulatory molecule in the nervous, immu ne and cardiovascular systems of eukaryotes, and participates in the regulation of daily activit i es as well as cytotoxic events (Blaise et al., 2005). NO is formed by the oxidation of the amino acid L arginine to give NO and citruline, in a

PAGE 21

21 process catalyzed by nitric oxide synthase (NOS) (Marletta et al., 1998). NO undergoes reactions with oxygen, superoxide ions, and reducing agents to produce products that themselves are reactive toward particular targets, sometimes resulting in toxic events such as nitrosati ve stress (Hughes 2008). Nitrosative stress occurs when the production of NO or other reactive nitrogen intermediates overwhelms the ability of the cell to remove them, resulting in damage to DNA, lipids and proteins ( Hughes 2008 ). Role of Nitric Oxide in Biofilms In a recent study, bacterial derived NO has been shown to promote cell death and dispersal of Pseudomonas aeruginosa biofilms at low, sublethal concentrations (Barraud et al., 2006). In this study, two mutants were analyzed : a nitrite reductas e mutant, nir S which lacks the only known enzyme capable of NO production through anaerobic respiration, and an NO reductase mutant, nor CB which is incapable NO reduction to N 2 O (Barraud et al., 2006). The wild type and mutant strains all exhibited nor mal biofilm development at 2 days growth. After 6 days of maturation however, significant differences between the mutants and wild type were observed. The nir S mutants showed much thicker biofilms that were confluent over the entire surface and showed n o dispersal or cell death compared to the wild type strain. Conversely, the nor CB mutant biofilms showed enhanced dispersal of cells, displayed hollow voids within the biofilm, and exhibited enhanced cell death compared to the wild type (Barraud et al., 2006). This study showed that NO plays a role in biofilm development and dispersal in P. aeruginosa More recent studies have shown that this holds true for other species as well, such as Neisseria gonorrhoeae (Falsetta et al., 2010). In S aureus it has been shown that acidified nitrite inhibit s of biofilm formation and that the

PAGE 22

22 addition of NO scavengers abrogates this effect, suggesting that NO is either directly or indirectly involved (Schlag et al., 2007). Role of NO M etabolism in S. aureus V iru lence Generation of NO by the host inducible NO synthase (iNOS) is an important mechanism of host resistance to pathogens ( Fang 2004 ). The presence of S. aureus stimulates the production of NO by human phagocytes (Shay et al., 2003), which has been obser ved in people with staphylococcal infections (Choi et al., 1998). However, S. aureus is able to resist the antimicrobial action of NO via its nitrosative stress response, which involves the transition into hypoxic/anaerobic metabolism (Richardson et al. 2006; Richardson et al., 2008 ). This ability of S. aureus to replicate when NO is present distinguishes it from many other pathogenic species (Richardson et al., 2008). Aerobic respiration in S. aureus is inhibited by NO as it competitively binds the c ytochrome hemes of the terminal oxidases (Richardson et al., 2008). As S. aureus transitions to anaerobic metabolism under nitrosative stress conditions, an increase in lactate dehydrogenase activity can be seen (Richardson et al., 2008). This increase i n lactate dehydrogenase activity due to NO is relatively specific for S. aureus and was not seen in similar pathogenic species such as S. epidermidis and S. saprophyticus (Richardson et al., 2008). After NO exposure, aerobic and fermenting S. aureus bact eria produced almost exclusively L lactate (Richardson et al., 2008). This increase in L lactate suggests that the major glucose metabolic pathways are being restricted by nitrosative stress, and this reflects the increase in lactate dehydrogenase product ion (Richardson et al., 2008). L lactate dehydrogenase, encoded ldh 1, is divergently transcribed from the NO scavenging flavohemoglobin encoded by hmp (Richardson et al., 2008). The hmp ldh1 locus thus encodes not only L lactate dehydrogenase, but a

PAGE 23

23 also a detoxifi cation system for host derived NO that prevents the det rimental consequences of NO on bacterial metabolism (Richardson et al., 2008). Production of the flavohaemoprotein, Hmp, by S. aureus is an effective adaptive response to nitrosative stress and neutralizes host derived NO (Richardson et al., 2006). Hmp is responsible for about 90% of measurable NO consumption in S. aureus and is therefore critical for NO detoxification (Richardson et al., 2006). In addition to the increase in Ldh1 and Hmp, many other proteins have been shown to be upregulated in response to nitrosative stress. These include the DNA response regulator SrrA, which upregulates anaerobic gene expression, pyruvate formate lya se (PflB), and several other fermentation pathway enzymes (Hochgrafe et al., 2008). This indicates that the ability to switch to anaerobic metabolism during NO stress is critical for the resistance of S. aureus to this condition (Hochgrafe et al., 2008). Potential R outes of E ndogenous NO F ormation in S. aureus Nitrate (NO 3 ) and nitrite (NO 2 ) can be used as terminal electron acceptors under anaerobic conditions (Schlag et al., 2007). All bacterial nitrate reductases catalyze the reduction of nitrate to nitrite (Moreno vivian et al., 1999). Nitrite produced by the S. aureus NarGHJI nitrate reductase can be further reduced to ammonia by a cytoplasmic NADH dependent nitrite reduc tase encoded by the S. aureus nir BD genes, which are also referred to in the literature as nasDE (Schlag et al., 2008). Nitrite dissimilation mediated by NirBD does not generate a proton motive force and is not a respiratory pathway (Schlag et al., 2007). Rather, it serves to detoxify accumulating nitrite in nitrate respiring cells and acts as an electron sink to regenerate NAD + (Schlag et al., 2007). All S. aureus strains sequenced to date contain genes encoding a bacterial NOS (saNOS) enzyme and Hmp, w hich play a role in the formation and consumption of NO

PAGE 24

24 in S. aureus respectively, as depicted in Figure 1 1. Like their eukaryotic counterparts, bacterial NOS produces NO and citruline through the enzymatic oxidation of L arginine (Marletta et al., 1998 ). As discussed above, Hmp is the major system used by S. aureus to detoxify NO, and requires microaerobic (or low oxygen) conditions in order to properly function (Nobre et al., 2008). NO can also be reduced to nitrous oxide (N 2 O) by NO reductase ( N or) (Hendricks et al., 2000). The nor gene is so far only known to exist in the sequenced strain MRSA252 and the related methicillin susceptible clinical strain UAMS 1 (Holden et al., 2004, unpublished data). The nor gene is not present in the sequenced genome of S. aureus strain Newman ( Baba et al., 2008 ). The postulated pathways of NO production via acidified nitrite and nitrite reduction via NarGHJI depicted in Figure 1 1 will be further discussed below. Nitrate R educta ses Both eukaryotic and bacterial nitrate reductases contain a pterin based molybdenum cofactor at their active sites, and all bacterial nitrate reductases contain an iron sulfur cluster (Moreno V ivian et al., 1999). There are three types of bacterial nit rate reductases: 1) cytoplasmic assimilatory (Nas) 2) membrane bound respiratory (Nar), and 3) periplasmic dissimilatory (Nap) nitrate reductases (Moreno V ivian et al., 1999). The narGHJI genes of S. aureus encode a membrane bound respiratory nitrate redu ctase (Moreno V ivian et al., 1999). Nar type nitrate reductases are dissimilatory, and generate a transmembrane proton motive force by using nitrate as electron acceptor in anaerobic conditions, allowing the synthesis of ATP (Moreno V ivian et al., 1999). The Nar system is induced by nitrate and repressed by oxygen (Moreno V ivian et al., 1999). NarG is a catalytic alpha subunit with an MGD cofactor ( Blasco et al., 2001 ), NarH is a beta subunit with four iron sulfur centers (Guigliarelli et al., 1996) and

PAGE 25

25 NarI is a q uinol oxidizing gamma subunit ( Sodergren et al., 1988 ). NarJ is not part of the final enzyme, but participates in the assembly of the alpha beta complex (Dubourdieu and DeMoss, 1992) Regulators of nar There are currently two known regulat ors of the S. aureus n arGHJI operon NreABC is a very specific two component regulatory system that in response to oxygen depletion activates the genes involved in dissimilatory nitrate reduction and transport of nitrate and nitrite (Schlag et al., 2008). Deletion of NreABC results in severe impairment of dissimilatory nitrate and nitrite reduction (Schlag et al., 2008). The promoters upstream of nir R, nar G, and nar K have been shown to be under the positive control of NreABC (Schlag et al., 2008). YhcSR is a two component signal transduction system that is essential for survival of S aureus (Yan et al., 2011). YhcSR regulates expression of both n arG HJI and n reABC operons to positively modulate the nitrate respiratory pathway in anaerobic conditions (Ya n et al., 2011). Yhc R directly binds to the promoter regions of narG and nreABC to positively regulate their expression (Yan et al., 2011) In addition, under anaerobic conditions, addition of nitrate to the media dramatically increased expression of yhc S R, whereas the addition of nitrite had no effect (Yan et al., 2011). Biofilm growth conditions also regulate the expression of the nar operon. In a S. aureus biofilm mode of growth the nar G nar H and nar I genes of the nitrate reductase operon were found to be upregulated at least two fold compared to planktonic cultures (Beenken et al., 2004). Anaerobic conditions also upregulate transcription of the nar operon as well as the nir operon (Fuchs et al., 200 7). Given that many areas of mature S. aureus biofilm are low oxygen or anerobic microenvironments, it is possible that nar

PAGE 26

26 expression is also upregulated in these areas of the biofilm. Although the studies mentioned above verify the importance of nitra te reductase during anaerobic and biofilm growth, little attention has been paid to studying the full effect of nitrate reductase on S. aureus biofilm development nor has its role in endogenous NO production been investigated. In this respect, it has bee n shown that during S. aureus static biofilm growth, NO appeared to be produced in the presence of aci dified nitrite, which was direc t l y or indirectly involved in the inhibition of biofilm formation (Schlag et al., 2007). In this study by Schlag et al. p reformed static biofilms were eradicated by the addition of either nitrate or nitrite, and furthermore the inhibition of biofilm formation by nitrite was abrogated by the addition of NO scavengers, suggesting that NO is involved (Schlag et al., 2007). Int erestingly, Schlag et al. ( 2007 ) also demonstrated that a S. aureus narG mutant strain did not exhibit nitrate responsive biofilm inhibition, but did display inhibition of biofilm formation in re sponse to nitrite NO P roduction by nar in O ther O rganisms S tudies on NarGHJI nitrate reductases in organisms other than S. aureus provide valuable insight into the possible mechanisms of action of endogenous NO production by the S. aureus nitrate reductase. In Salmonella typhimurium NarGHI mutants are unable to produce NO, which indicates that the enzyme is somehow responsible for NO production (Gilberthorpe and Pool 2008). In addition, production of NO in the wild type Salmonella strain only occurred in the absence of nitrate (Gilberthorpe and Pool 2008). Ni trate reductases in plants have been known to generate NO from nitrite since the early 1980s (Harper 1981; Dean and Harper 1988). This occurs when the plant accumulates NO 3 or NO 2 under stress conditions such as anaerobic conditions, fungus infestatio n, or when photosynthetic activity is inhibited (del Rio et al., 2004). In

PAGE 27

27 plants, the mechanism of NO generation from nitrite by nitrate reductase involves NADH as an electron donor and the molybendum cofactor likely serves as t he cataly s is site (Yamasak i et al., 1999; Rockel et al., 2002). The plant nitrate reductase also produces peroxynitrite simultaneously with NO (Yamasaki and Sakihama 2000). The nitrate reductase of P aeruginosa is also known to produce NO (Wharton and Weintraub, 1980). Therefo re, it is possible that S. aureus nitrate reductase may contribute to endogenous NO production in one of two ways (Figure 1 1): 1) Direct enzyma tic conversion of nitrite to NO or 2) indirectly by reducing nitrate to nitrite, a portion of which in turn is c hemical l y converted to NO under low pH conditions. Hypothesis Based on the studies discussed above, we hypothesize that the S aureus nitrate reductase is important for biofilm formation, possibly by contributing to endogenous NO production. To this en d, this study will pursue two specific aims: 1) to determine if mutation of the nar GHJI gene cluster in S. aureus strains Newman and UAMS 1 has an effect on biofilm phenotype and 2) to determine if nitrate reductase contributes to endogenous NO production Studying both of these S. aureus strains will allow a comparison of the role of nitrate reductase in biofilm formation and NO production between a strain possessing two known NO detoxifying genes ( nor and hmp in strain UAMS 1) versus a strain that only has one known NO detoxifying system ( hmp only, in strain Newman) Since we hypothesize that nar dependent differences in biofilm formation could be due to altered NO levels, these two strains could have two very different responses to the nar mutation du e to the presence or absence of the nor gene.

PAGE 28

28 Figure 1 1. Postulated routes for NO formation and consumption in S. aureus The potential routes for NO metabolism depicted above are based on the presence of these genes in the S. aureus MRSA252 sequenced genome (a closely related strain to UAMS 1) (Holden et al., 2004), in combination with published data from S. aureus and/or other NO producing bacteria. The potential routes of endogenous NO production are depicted in blue. The nor gene ( depicted in red ) is not conserved throughout all published S. aureus genomes, however it is present in strain UAMS 1 and in the published genome of MRSA252.

PAGE 29

29 CHAPTER 2 M ETHODS AND MATERIALS Bacterial Strains and Growth Conditions Staphylococcus aureu s strains and plasmids us ed in this study are listed in T able 2 1. Planktonic cultures of S. aureus were grown in tryptic soy broth (TSB) or biofilm media (TSB NaGlc: TSB supplemented with 3% (wt/vol) NaCl and 0.5% (wt/vol) glucose). Where indicated, the following antibiotics where added: e rythromycin (Erm), 2 g/ml or 10 g/ml, c hloramphenicol (Cm), 10 g/ml, and s pectinomycin (Spec), 1000 g/ml. Escherichia coli was grown in L uria Bertani (LB) broth with 50 g/ml a mpicillin (Amp) or 50 g/ml k anamycin (Km). Glycerol stocks were prepared by mixing an equal volume of overnight culture with 50% glycerol (vol/vol) in cryogenic tubes. Stocks were maintained at 80 O C. For each experiment, fresh S. aureus culture was obtained from the frozen glycerol stocks and streaked onto tryptic soy agar (TSA) containing the appropriate sel ective antibiotic as listed in T able 2 1. Creation of Mutants Plasmid pBT2 nar and the nos hmp nre nir and nar mutants in S. aureus strain Newman were created by Dr. Anthony Richardson (University of North Carolina at Chapel Hill), while plasmid pCN51 nar and allele replacement mutagenesis of the nar operon (using pBT2 nar ) in S. aureus strain UAMS 1 was performed in this study. Mutations used in this study and gene functions are lis ted in Table 2 2 The pBT2 nar plasmid was generated by Dr. Richardson as follows: PCR amplification of the narGHJI genes from S. aureus strain COL was carried out using the nar specific primers lis ted in Table 2 3 This fragment was cloned into vector pCR BluntII, followed by transformed into E. coli

PAGE 30

30 (Inoue et al., 1990) so that internal Cla I sites would not be methylated, which would inactivate the cut site s. The plasmid was cut with Cla I liberating an internal 3.5 kilo base long nar fragment, and the remaining vector was then blunted by Klenow DNA polymerase and ligated with a blunted 1.4 kilo base Eco RI fragment from plasmid pLZ Sp12 containing a s pectino mycin resistance (SpR) cassette. A 4.8 kilo base fragment containing this nar ::SpR allele with Pvu II cut sites at each end was then cloned into the Eco RV of plasmid pBT2, creating the final plasmid pBT2 nar Plasmid pBT2 nar was subsequently used for the creation of a nar mutation in S. aureus strains Newman and UAMS 1, using the following allele replacement mutagenesis procedure: the pBT2 nar plasmid was first transformed into S. aureus strain RN4220 (a chemically mutated S. aureus strain that more readily accepts foreign DNA) by electroporation using standard methods (Schenk and Laddaga, 1992). The RN4220 strain containing the pBT2 nar plasmid (grown at 30 O C to allow plasmid replication) was then used to produce a phage lys ate for the purpose of transferring the plasmid to strain UAMS 1. This was done using standard methods with a 11 phage added to achieve a multiplicity of infection (MOI) of 0.1 (Novick 1991). The plasmid was then phage transduced into UAMS 1 using stan dard methods and an MOI of 0.1 with growth at 30 O C (Shafer and Iandolo, 1979). The integration of pBT2 nar into the nar gene on the UAMS 1 chromosome was achieved as follows: UAMS 1 was grown at 43 O C (non permissive temperature for plasmid replication) in the presence of s pectinomycin to promote integration of the plasmid into the chromosome via homologous recombination at the nar gene locus. To promote a second recombination event, a sin gle colony was used to i noculate TSB (no antibiotic) and grown at fo r five

PAGE 31

31 days at 30 O C. An ali quot of the culture was diluted 1000 fold into fresh TSB (no antibiotic) every 24 hours. On days 3 5, the culture was serially diluted and spread on TSA containing s pectinomycin. Isolated colonies were screened for s pectinomyc in resistant and c hloramphenicol sensitive phenotypes by picking and patching colonies onto TSA Spec 1000 and TSA Cm 5 plates. Verification that the potential knockout strains were correct was carried out using PCR amplification with nar complement primers ( Figure 2 2). Creation of the T rans C omplement P lasmid pCN nar Complementation of the nar mutation in S. aureus strains Newman and UAMS 1 was carried out as follows: PCR amplification of the narGHJI operon from S. aureus strain Newman was performed using the nar specific complement primers listed in Table 2 3 with Sph I and Bam HI restriction sites engineered into the forward and reverse primer sites, respectively. The resulting 7.5 kilobase fragment was purified using a DNA Clean and Concentrator kit (Zymo Research). The nar PCR fragment and pCN51 plasmid vector (Charpentier et al., 2004) were both digested with Sph I and Bam HI restriction enzymes. The pCN51 vector was then gel purified using a Zymoclean Gel DNA Recovery Kit (Zymo Research) to liberate the native promoter. This was necessary so that the native nar promoter would be the sole promoter for controlling gene expression of the narGHJI operon to be inserted into the vector. The remaining pCN51 vector fragment was then ligated to the nar PCR product. The ligation was transformed into E. coli DH5 via heat shock using standard methods (Inoue et al., 1990) and plated on Luria Bertani (LB) broth with 50 g/ml a mpicillin

PAGE 32

32 (Amp). PCR was used to check transformants for the nar insert using nar internal primers (Figure 2 3). To account for any effects the vector may have, a vector only control plasmid plasmid was constructed by di gestion of the pCN51 vector with Bam H1 and Sph 1 restriction enzymes in order to separate the Pcad promoter from the rest of the vector. The purified vector minus the promoter was treated with Klenow enzyme to create blunt ends, followed by a self ligation to regenerate a circular plasmid, which was then transformed into E. coli DH5 creating plasmid pCN klenow. The loss of the Sph 1 restriction site was confirmed by enzymatic digestion with Sph 1. Plasmids pCN nar and pCN klenow were subsequently electropo rated into S. aureus strain RN4220 using standard methods (Schenk and Laddaga, 1992). Electroporations were plated onto TSB with 2 g/ml e rythromycin (Erm) to select for the vector. Restriction digests of the plasmids using Sph I enzyme were performed in order to assure that the insert was still present in pCN nar (data not shown). A positive clone was selected for preparation of a phage lysate using the 11 phage added to an MOI of 0.1 using standard methods (Novick 1991). This lysate was then used for a phage transduction of pCN nar and pCN Klenow each into S. aureus Newman and UAMS 1 using standard methods with an MOI of 0.1 and growth at 37 O C (Shafer and Iandolo, 1979). Resultant strains were named Newman nar pCN51 nar Newman nar pCNKlenow, UAMS 1 nar pCN51 nar and UAMS 1 nar pCNKlenow. When plasm ids purified from these strains were checked by PCR with the nar internal primers, all appeared to contain the nar operon (Figure 2 4A). Subsequent restriction digestion of

PAGE 33

33 these plasmids with SphI (whic h should linearize into a 12 kb fragment) revealed the predicted sized fragment in the UAMS 1 nar mutants ( F igure 2 4B), however digestion of pCN nar from the Newman nar mutant revealed the presence of multiple bands, possibly indicating the rearrangement of the plasmid in this strain (data not shown). Therefore, subsequent analysis of these complement strains solely focused on the UAMS 1 nar mutant. Biofilm Assays for Confocal Microscopy To determine phenotypic differences between the S. aureus Newman w ild type strain and the nreC nir and nar mutant strains, static biofilm assays were performed in conju n ction with confocal microscopy. We lls of an optically clear bottom 96 well tissue culture plate (Costar 3614) were pre coated for 24 hours with 200 l of 20% (vol/vol) human plasma (Sigma) in bicarbonate buffer (Sigma Carbonate Bicarbonate capsule s, 1 capsule dissolved per 100 ml of water). After coating, the plasma was removed from the wells and 200 l of overnight culture of S. aureus in TSB NaGlc di luted to an OD 600 of 0.05 was added to each well. Cultures were grown for 24 hours at 37 O C. Culture supernatants were then removed and LIVE/DEAD stain (Invitrogen) was added (1.5 l /ml propidium iodide and 0.5 l /ml Syto9 in 0.85% vol/vol NaCl). The stain was allowed to absorb at room temperature for 20 30 minutes under aluminum foil to preserve light sensitivity. Stain was then removed and 200 l of 0.85% (vol/vol) NaCl was added to each well. Static biofilm a nalysis of UAMS 1, its isogenic nar mutant and complement strain was performed using the assay protocol described above. Biofilm wells were subjected to imaging using a Zeiss Pascal LSM5 Confocal Laser Scanning Axiovert 200 Microscope using an Argon laser and a 40x water

PAGE 34

34 immersion lens. Two wells were inoculated for each biological replicate, and two representative images were taken of each well. At least three biological replicates were imaged per strain and condition, for a total of at least 10 acquire d z stacks. The z stacks were taken at 1.0 m z slice intervals and a scanning speed of 8, on frame mode. The images were processed using the LSM Browser software (Zeiss) and biofilm characteristics were quantified using COMSTAT software for MatLab (Heydo rn 2000). Sigma Plot was used to organize data and perform statistical analyses. A one way Analysis of Variance (ANOVA) as well as a normality test and an equal variance test were performed on all data. Holm Sidak test was performed on sets of data that passed the normality and equal variance tests. For comparisons of data that did not pass these p value of p <0.05 indicates statistical significance. Measurement of R elative NO P roduction in Static Biofilms To determine the different levels of NO produced by the S. aureus wild type, mutant, and complement strains, biofilm assays were performed followed by DAF FM diacetate staining for the quantification of NO. DAF FM diacetate is a non fluorescent molecule that can permeate the cell membrane, where it is then cleaved by intracellular esterases to release DAF FM, which can then react with NO to produce a highly fluorescent Benzoltriazole derivative (Kojima et al., 1 998). Biofilm assays were performed as previously described, except that 24 well plates were pre coated with 350 l of 20% (v/v) human plasma. After coating f or 24 hours, the plasma was removed from the wells and 1 ml of overnight culture of S. aureus in TSB NaGlc was added after being diluted to an OD 600 of 0.05. Cultures were grown for 8 hours at 37 O C. The total well

PAGE 35

35 biomass (adherent biofilm + supernatant) was resuspended by scraping off the surface of the well and p ipetting to mix before being aliquo t ed into 1.5 ml microcentrifuge tubes. Suspensions were centrifuged at 13 RPM for 5 minutes, and supernatants were carefully removed by pipetting. Cell pellets were resuspended in 1 ml FM diacetate in 0.85% NaCl. This was done in minima l lighting to pre serve light of each suspension were added in duplicate to a 96 well plate for fluorescence readings from a Biotek Synergy HT plate reader. The plate reader was set to read fluorescence from the bottom of the plate, an d readings were taken using the Gen5 version 1.09 which took a RFU reading with filter settings of 495/20 excitation and 515/20 emission and sensitivity of 75. Although the density of cells in each well were similar, a corresponding OD 600 reading was also taken for each and used to calculate the RFU/OD 600 to account for slight variations in OD. Levels of DAF FM fluorescence (proportional to the amount of intracellular NO) were recorded after 1 hour at 37 O C. Data was collected for at least three biologica l replicates, where one biological replicate equals two wells, for each strain and condition. Sigma Plot was used to organize data and perform statistical analyses. A one way Analysis of Variance (ANOVA) as well as a normality test and an equal variance test were performed on all data. Student Newman Keuls Tests were performed on sets of data that passed the normality and equal variance tests. For comparisons of uneven sample sizes that did not pass one or med to determine statistical significance. In all cases, a p value of p<0.05 indicates statistical significance. Treatment Conditions Stocks of sodium nitrate (NaNitrate) and sodium nitrite (NaNitrite) were prepared by dissolving 5.10 grams of NaNitrate and 4.14 grams of NaNitrite each in 200ml of

PAGE 36

36 deionized H 2 O to achieve a final concentration of 0.3M, followed by filter sterilization. All additions of nitrate or nitrite to biofilms were taken from these stocks. Biofilms were either left untreated or supplemented with 2, 4, 6, 8, or 10 mM NaNitrate or 10 mM NaNitrite at the time of inoculation. Where indicated, cultures were also supp lemented with 1 mM of the NO scavenger carboxy PTIO (cPTIO; Sigma) at the time of inoculation.

PAGE 37

37 Table 2 1. Strains and p lasmids used in this study Strain or plasmid Description Reference Escherichia coli DH5 Host strain for construction of Hanahan 1983 recombinant plasmids Staphylococcus aureus RN4220 Easily transformable restriction Kreiswirth et al., 1983 deficient strain Newman Lab strain Duthie and Lorenz, 1952 AR0495 Newman narGH JI : Spec R Obtained from A. Richardson, UNC Chapel Hill AR0100 Newman nos ::Erm Obtained from A. Richardson, UNC Chapel Hill AR0094 Newman hmp ::Erm Richardson 2006 AR0570 Newman nirBD ::Km Obtained from A. Richardson, UNC Chapel Hill AR0328 Newman nreC ::Spec Obtained from A. Richardson, UNC Chapel Hill Newman nar pCN51 nar Newman narGH JI + This work narGHJI gene complement Newman nar pCNKlenow Newman narGH JI + This work vector control UAMS 1 Osteomyelitis clinical isolate Gillaspy et al., 1995 UAMS 1 nar UAMS 1 narGHJI : Spec R This work UAMS 1 nar pCN51 nar UAMS 1 narGHJI + This work narGHJI gene complement UAMS 1 nar pCNKlenow UAMS 1 narGHJI + This work vector control Plasmids pCN51 E. coli S. aureus shuttle vector Charpentier et al., 2004 with origin of replication for S. aureus ; Amp R Erm R pBT2 E. coli S. aureus shuttle vector Bruckner 1997 with thermosensitive origin of r ep for S. aureus ; Amp R Cm R pBT2 nar GHJI homologous recom Obtained from A. bination vector ; Spec R Cm R Richardson, UNC Chapel Hill pCN51 nar narGHJI gene complement in This work the pCN51 vector pCN Klenow pCN51 vector without original Obtained from the lab of K.C. Pcad promoter Rice, University of Florida

PAGE 38

38 Table 2 2 S. aureus genes investigated in this study Gene/operon Function Reference narGHJI membrane bound respiratory Moreno Vivian et al., nitrate reductase 1999 nreABC Transcriptional activator of genes Schlag et al., 2008 involved in reduction and transport of nitrate and nitrite nirBD reduces nitrite to ammonia Neubauer et al., 1999 hmp detoxifies NO to nitrate Poole 2005 nos synthesizes NO from L arginine Hughes 2008

PAGE 39

39 Table 2 3 Primers used in this study Primer role Forward/Reverse Oligonucleotide sequence (5' 3') nar complement Forward CCCGCATGCTGAAATTGTACCTGGTGTGA Reverse CCCGGATCCATTGCTTCTGGTGTCAAATC nar locus for the Forward AATTTAATGGGAATTGGTCGATCC creation of pBT nar Reverse TCCTTTCACCTCTTATGCTTACAC nar internal primers Forward CGCCATTCTGCCACTTGTAA Reverse GAGCAAAGTGAATGGAAACC Figur e 2 1. Diagram representing primer locations for the nar complementation primers (orange), nar internal primers (pink), and nar locus primers used in the creation of pBT nar (green).

PAGE 40

40 Figure 2 2. Confirmation of nar mutants in S. aureus UAMS 1. PCR reactions of nar mutants were performed with nar complement primers.

PAGE 41

41 Figure 2 3. Confirmation that the nar complement plasmid is present and carries the narGHJI genes in E.coli DH5 The presence of the narGHJI genes in the plasmid was confirmed by PCR reactions of nar complementation plasmid and S. aureus UAMS 1 DNA with nar internal primers.

PAGE 42

42 Figure 2 4. Confirmation that the nar complement plasmid is present and carries the narGHJI genes in S. aureus strain UAMS 1. A) PCR reactions of nar complementation plasmids and UAMS 1 DNA were performed with nar internal primers. B) Restriction digestion of n ar complement plasmids with SphI enzyme, producing a linear 12 kb fragment.

PAGE 43

43 CHAPTER 3 R ESULTS Effect of N itrate M etabolism on S. aureus B iofilms To determine if the nar nir, or nreC mutation s in S. aureus strain Newman ha ve an effect on its biofilm phenotype, wild type and nar mutant biofilms were gro wn as untreated static biofilms or in media supplemented with either 10 mM NaNitrate or 10 mM NaNitrite. The LIVE/DEAD stain u sed in this study utilizes a green (Syto 9) and re d (propidium iodide) dye to differentiate between live (green) and dead (red) cells. The Syto 9 labels both live and dead bacteria, however the propidium iodide penetrates only dead or damaged bacteria, with the red stain fluorescence dominating the green fluorescence. Using this method of biofilm visualization, confocal microscopy after 24 hours of biofilm growth revealed qualitative differences in the overall structure and thickness of the nar nir and nre mutant biofilm s compared to wild type (Figures 3 1 3 2, and 3 3 ). To analyze the data in quantit ative terms, COMSTAT and Holm Sidak statistical analyses were performed on all the confocal biofilm data to measure differences in the average thickness and biomass of the biofilms (Figure 3 4A and B). Specifically, biofilms of wild type Newman treated with nitrate and nitrite had significantly more total biomass and average thickness than its respective untreated biofilm. Interestingly, the nar mutant biofilm had significantly increased biomass under untreated growth conditions compared to the wild type strain. Furthermore, treatment of the nar mutant biofilm with nitrate did not alter its biomass or average thickness, but treatment with nitrite did increase these parameters. These resu lts suggest that nitrate reduction has a significant effect on biofilm morphology under these in vitro growth conditions.

PAGE 44

44 A nitrite reductse ( nir ) mutant was also analyzed by confocal microscopy to test if the effect of nitrate on the biofilm s is due to increased production of ammonia (produced by Nir from nitrite). Additionally, an nre (positive regulator of nar and nir expression ) mutant was also analyzed to see if perturbing the regulation of nar and nir expression has a similar phenotypic effect as t he nar and/or nir mutants. The nir mutant biofilm displayed increased biomass and average thickness in the untreated condition compared to wild type, however t he nre mutant biofilm was similar to the wild type strain under untreated conditions (Figure 3 4 A and B) In addition, nitrate treatment had no real effect on nre whereas nitrate treatment caused an increase in biomass and average thickness in nir compared to the untreated condition Furthermore, nitrite treatment had no effect on nir but resulted in increased biomass and average thickness in nre compared to the untreated condition which was also seen in the nar mutant biofilm Confocal images of 24 hour biofilms are in agreement with these COMSTAT analyses (Figure s 3 2 and 3 3). T his suggests that Nre may not be playing a large role in regulating nir transcription under these conditions, however is likely very involved in nar regulation. Overall, these results demonstrate that perturbations in the nitrate metabolism pathway in the form of nar nir and nre mutations results in an altered phenotype when nitrate or nitrite is added to the biofilm. Furthermore, since the nir mutant biofilm responded to nitrate treatment in a manner similar to the wild type strain (Figure 3 4A and B) this suggest s that the observed effects of nitrate on biofilm morphology are due to accumulation of nitrite and not due to increased production of ammonia.

PAGE 45

45 NO P roduction V aries B etween W ild t ype and M utants Even though the results above have suggested t hat nitrate metabolism has an effect on biofilm development, the reason for this is still unclear One possibility that was discussed in Chapter 1 is that Nar may produce NO, which in turn could impact biofilm development. NO production by Nar is known to occur in a variety of different organisms, such as Salmonella (Gilberthorpe and Pool 2008), Pseudomonas (Wharton and Weintraub, 198 0), and in plants (Harper 1981), but w hether or not this occurs in S. aureus is currently un known. Therefore, to ascertain the relative levels of NO production by wild type Newman and nar nir nos hmp and nre mutant strains, DAF FM diacetate assays of 8 h our biofilm s either untreated or grown in the presence of 10mM NaNitrate or NaNitrite were performed (Figu re 3 5) Untreated biofilms of all the strains were sim ilar with regards to DAF FM flu o r escence (about 2000 2500 RFU/OD), indicating that relative NO levels did not differ between Newman and its isogenic mutant strains, or that differences were too subtle to be detected by this method. However, a drastic difference in the relative levels of NO produced in the nar mutant and wild type biofilms was observed when grown in the presence of nitrate or nitrite The nar mutant displayed significantly less DAF FM fluorescence than the wild type in both treatment conditions, indicating that much less NO is being produced under these growth conditions. Interestingly, the addition of nitrate to the wild type biofilm resulted in higher levels of NO produced than the addition of nitrite to the biofilm. The nre mutant resulted in similarly low NO levels as the nar mutant under both treatment conditions. The hmp (detoxifies NO to nitrate) mutant served as a control in this experiment, as the mutant should accumulate hi gher levels of NO than the wild type strain. As expected, the hmp mutant did indeed result in the highest levels of NO when treated with either nitrate or

PAGE 46

46 nitrite. The nir (reduces nitrite to ammonia) mutant resulted in slightly more NO produced in the nitrate condition than the wild type, however the wild type and nir mutant showed no difference in the nitrite condition. The nos mutant resulted in no significant differenc e compared to wild type in either treatment condition. These results demonstrate that perturbations in the nitrate metabolism pathway in the form of nar nir hmp and nre mutations results in an different levels of relative NO production when nitrate or nitrite is added to the biofilm. Given these results and the previous COMSTAT results, it can be gathered that these mutations result in both a phenotypic change in the biofilm and an altered level of NO production in the biofilm in comparison to the wild type. Nitrate L evels A ffect NO P roduction To determine if the amount of nitrate added to the biofilms is proportionally related to increased production of NO, DAF FM diacetate assays were performed on 8 hour wild type biofilms that were grown in the pres ence of increasing levels (2, 4, 6, and 8mM concentrations) of NaNitrate at the time of inoculation (Figure 3 6) The levels of NO (as indicated by DAF FM staining) increased in comparison to the untreated condition starting at 4 mM nitrate, with increasi ng levels observed as the amount of nitrate increased As a control, parallel cultures were incubated in the presence of carboxy PTIO, an NO scavenger, which was added at the time of inoculation (Figure 3 6) Surprisingly, cPTIO was only able to partiall y abrogate the levels of NO (as indicated by DAF FM fluorescence) at nitrate concentrations above 4mM. Analysis of the nar M utation in UAMS 1 To assess the effects of the nar mutation in an S. aureus strain with the ability to detoxify NO using two path ways: an H mp pathway (also present in Newman) and a Nor

PAGE 47

47 pathway (not present in Newman), a knockout of the nar gene locus was created in the S. aureus strain UAMS 1. Wild type and nar mutant biofilms were grown in the presence and absence of 10mM NaNitrat e for 24 hours before being treated w ith LIVE/DEAD staining. Qualita tive differences were observed between the wild type and the nar mutant in the presence of NaNitrate (Figure 3 7D and E) however the untreated biofilms were very similar in appearance (Figure 3 7 A and B ). When NaNitrate was added to the biofilm, cell density and thickness increased in the wild type biofilm, while the nar mutant did not show this effect. To further analyze the data in quantit ative terms, COM STAT and statistical analysis using a Student Newman Keuls test were performed on the biofilm data for the wild type and nar mutant (Figure 3 8) These results confirmed that there was no significant difference in the average thickness or biomass between the wild type and nar mutant in the untreated condition. However, when 10mM of NaNitrate was added to the biofilms, the wild type biofilm had significantly more biomass and average thickness compa red to its untreated control. N itrate treatment had no eff ect on the nar mutant biofil m in terms of average thickness, and surprisingly, biomass was s lightly less than the untreated nar mutant biofilm. Additionally, DAF FM diacetate assays were performed on 8 hour biofilms of the UAMS 1 wild type and nar mutan t to determine the relative levels of NO produced (Figure 3 9) This experiment showed that the trend of NO production in UAMS 1 and the nar mutant was very similar to that seen in the Newman wild type and nar mutant, where mutant NO levels were significa ntly lower than wild grown in th e presence of nitrate Levels of NO (indicated by fluorescence) in the untreated conditions of both wild type and nar are extremely low compared to the large

PAGE 48

48 RFU/OD value of the wild type strain treated with nitrate. Interestingly, nitrite treatment resulted in only a slight increase in DAF FM fluorescence in UAMS 1 compared to its untreated control, which was much more subtle compared to the results observed when Newman was treated w ith nitrite (Figure 3 5 ). As was observed with the Newman nar mutant, the addition of nitrate or nitrite to the UAMS 1 nar mutant biofilm did not result in increased NO production. Nitrite addition actually resulted in statistically lower levels of relat ive NO production in the nar mutant. We can concl ude from these results that the nar mutation has different effects on biofilm phenotype and NO production in S. aureus strains Newman and UAMS 1. Key similarities do exist, however, such as the failure of t he mutants in both strains to produce the large amounts of NO that are seen in eac h wild type when nitrate is added. Also, while both wild type strains showed an increase in biomass and average thickness in nitrate treated biofilm s, mutation of the nar in both strains abolished this response to nitrate treatment. Analysis of nar C omplementation in UAMS 1 The S. aureus UAMS 1 nar mutant was transformed wi t h a plasmid containing the nar operon with its native promoter cloned upstream, and assessed for complementation of its biofilm phenotype and relative NO production. Surprisingly, this strain did not show complementation of the nar mutant biofilm phenotype or relative NO production wh en subjected to confocal microscopy and DAF FM diacetate experiments (data not shown). One possibility accounting for this was that since these experiments were carried out in the absence of antibiotic selection (both overnight culture growth and subseque nt biofilm growth), the plasmid may have been lost. Further investigation pertaining to the stability of the plasmid was carried out, whereby the complementation strain was streaked for isolation on a TSA/Erm 2 agar plate and incubated at 37 O C

PAGE 49

49 overnight. The next day, one colony was used to inoculate a culture tube containing 3mL TSB without antibiotic and incubated at 37 O C shaking at 250 RPM overnight. The next day this step was repeated with subculturing into a new tube. On the final day, the culture w as serially diluted and plated onto both TSA plain and TSA/Erm 2 agar plates. The total colonies on each plate were counted and used to calculate the CFU/ml of each plate. The results showed a significant decrease in the amount of colonies on the TSA/Erm 2 plate (1.04 x 10 8 CFU/ml) compared to the TSA plate (6.1 x 10 9 CFU/ml). This indicated that the plasmid was lost in 98.3% of the bacterial cells when antibiotic selection was not used in the growth medium. To remedy this, a preliminary biofilm confocal microscopy experiment was performed whereby antibiotic selection was used in all steps of the protocol. Confocal microscopy results of this preliminary experiment suggested that the nar complementation strain restored the biofilm phenotype back to the wil d type phenotype, since NaNitrate addition resulted in a biofilm with more cell density and thickness than the untreated condition in the complement strain, thus resembling the wild type treated with NaNitrate (Figure 3 7 C and F ). Future work will entail repeating the confocal microscopy and DAF FM studies on the complement strain in the presence of antibiotic selection.

PAGE 50

50 Figure 3 1. Effect of the nar mutation on biofilm formation. Depicted are representative orthogonal views of 24 hour static biofi lms. The large square in each image represents the top down view whereas the side panels are orthogonal (side) views. The cells are stained with LIVE/DEAD stai n where by red cells are dead or damaged and the green cells are live. A) Newman, B) Newman + NaN itrate, C) Newman + NaNitrite, D) Newman nar E) Newman nar + NaNitrate, F) Newman nar + NaNitrite. Images were acquire d at 400x magnification by confocal microscopy, and are each representative of 18 random fields of view acquired in 3 independent experim ents

PAGE 51

51 Figure 3 2. Effect of the nirBD mutation on biofilm formation. Depicted are representative orthogonal views of 24 hour static biofilms. The large square in each image represents the top down view whereas the side panels are orthogonal (side) views. The cells are stained with LIVE/DEAD stain where by the red cells are dead or damaged and the green cells are live. A) Newman, B) Newman + NaNitrate, C) Newman + NaNitrite D) Newman n i r E) Newman ni r + NaNitrate, F) Newman ni r + NaNitrite. Images were acquire d at 400x magnification by confocal microscopy, and are each representative of 10 18 random fields of view acquired in 3 independent experiments.

PAGE 52

52 Figure 3 3. Effect of the nreC mutation on biofilm formation. Depicted are representative orthogonal views of 24 hour static biofilms. The large square in each image represents the top down view whereas the side panels are orthogonal (side) views. The cells are stained with LIVE/DEAD stain where by the red cells are dead or damaged and the green cells are live. A) Newman, B) Newman + NaNitrate, C) Newman + NaNitrite D) Newman n r e E) Newman nre + NaNitrate, F) Newman nre + NaNitrite. Images were acquire d at 400x magnification by confo cal microscopy, and are each representative of 10 18 random fields of view acquired in 3 independent experiments.

PAGE 53

53 Figure 3 4. COMSTAT analysis of wild type (Newman) and nar nir and nre mutant biofilms. A) Biomass, B) Average thickness. Data represents average standard error (SEM) of at least 10 z stack measurements acquired in at least 3 independent experiments. One asterisk (*) represents statistical significance of the nar nir and nre mutant biofilms compared to Newman wild type und er the untreated condition. T wo asterisks (**) represent statistical significance of nitrate and nitrite treatment compared to the untreated control of each respective strain. A Holm Sidak test was used with a P value of p<0.05 indicating statistical significance.

PAGE 54

54 Figure 3 5. Relative NO production by wild type (Newman) and nar nir nos hmp and nre mutants as measured by DAF FM diacetate staining DAF FM fluorescence was measured as relative fluorescence units per OD 600 of each sample (RFU/O D). 10 mM of Na nitrate or Na nitrite were added as indicated on the graph. Results represent the average SEM of 3 independent experiments. Asterisks (*) represent statistically significant measurements when compared to the corresponding Newman measure ments under the same condition. A Student Newman Keuls test was used with a P value of p<0.05 indicating statistical significance.

PAGE 55

55 Figure 3 6 Relative NO production in nitrate treated cultures by wild type (Newman) as measured by DAF FM diacetate staining. Fluorescent data is re ported as the average RFU/OD SEM Varying amounts of NaNitrate with and without 1 mM cPTIO (an NO scavenger) were added as indicated on the graph. Results represent the average of 3 biological replicates. A Student Newman Keuls test was used with a P v alue of p <0.05 indicating stati stical significance. Asterisks (*) represent statistically significant measurements when compared to the corresponding nitrate + cPTIO treatment mea surements.

PAGE 56

56 Figure 3 7 Effect of the nar mutation on biofilm formation in UAMS 1. Depicted are representative orthogonal views of 24 hour static biofilms. The large square in each image represents the top down view whereas the side panels are orthogonal (side) views. The cells are stained with LIVE/DEAD stain where by the red cells are dead or damaged and the green cells are live. A) UAMS 1, B) nar mutant, C) nar com plement D) UAMS 1 + NaNitrate, E) nar + NaNitrate, F) nar complement + NaNitrate. Images were acquire d at 400x magnification by confocal microscopy, and are each representative of 12 random fields in 3 biological replicates, with the exception of the complement (panels C and F), which re present 4 random fields of view and 1 biological replicate.

PAGE 57

57 Figure 3 8 COMSTAT analysis reveals statistically significant differences between wild type (UAMS 1) and the nar mutant. A) Biomass, B) Average thickness. Data represents average SEM of 12 z stack measurements acquire d f r om 3 biological replicates. Asterisks (*) repr esent statistically significant measurements when compared to the corresponding untreated condition. A Student Newman Keuls test was used with a P value of p<0.05 in dicating statistical significance.

PAGE 58

58 Figure 3 9. Relative NO production by wild type (UAMS 1) and nar mutant as measured by DAF FM diacetate staining DAF FM fluorescence was measured as relative fluorescence units per OD 600 of each sample (RFU/OD). 1 0 mM of Na nitrate or Na nitrite were added as indicated on the graph. Results represent the average SEM of 3 independent experiments was used with a P value of p <0.05 indicating statistical significance. Asterisks (*) represent statist ically significant measurements when compared to the corresponding untreated measurements.

PAGE 59

59 CHAPTER 4 D ISCUSSION The wild type S. aureus Newman strain, when treated with NaNitrate or NaNitrite, produced biofilms with significantly more biomass and average thickness, as did the S. aureus UAMS 1 strain when treated with NaNitrate. This suggests that nitrate and nitrite metabolism have a pos itive effect on biofilm formation. The nar mutation in S. aureus strain s Newma n and UAMS 1 resulted in an altered phenotype compar ed to the wild type in NaNitrate treated biofilms, indicating that nitrate reductase does have an effect on biofilm formation in S. aureus Although preliminary, the complementation of the narGHJI genes in the UAMS 1 nar mutant shows that the replacemen t of these genes back into the nar k nockout strain restores wild type phenotype, suggesting that it is the nar genes that are p roducing the effect, and not some other factor. Analysis of NO production in the Newman and UAMS 1 wild type strains and their respective nar mutant s showed that the nar mutant s produce much less NO than wild type when treated with eit her NaNitrate or NaNitrite. This suggests that the nitrate reductase plays a role in endogenous NO production in S. aureus under conditions where high levels of nitrate and nitrite are present, and represents a previously unrecognized function of this enzyme in S. aureus Furthermore, the nre mutant (regulator of nar ) in the Newman strain also s howed drastically decreased NO levels compared to wild type, which is what would be expected since nar expression in the presence of nitrate is dependent on nreABC ( Schlag et al., 2008 ). It was expected that the hmp mutant would have a very high level of NO accumulation, since Hmp is a detoxifier of NO, which is exactly what was observed in this study. The nir mutant cannot reduce nitrite to ammonia, so it would be expected that h igher levels of NO

PAGE 60

60 would be seen in this strain since nitrite would accumulate. Surprisingly, increased relative NO levels were observed in the nir mutant strains in the presence of added nitrate compared to added nitrite. This suggests that exogenous nitrite may not be efficiently taken up by cell s under these growth conditions, or alternatively, exogenous nitrite may not be stimulating high level expression of narGHJI Both of these possibilities would exp lain why levels of NO were higher when these biofilms were grown with nitrate as opposed to nitrite. To verify these possibilities, future work will focus on examining nar and nir transcription as well as measuring intracellular nitrite levels under the gr owth conditions used in this study. The nos mutant has lost the ability to produce NO through via NO synthase, however the NO levels in the nos mutant were similar com p a red to wild type. This could be because other pathways (i e. nitrate reductase) are greater contributors to NO production compared to NOS under the growth conditions used in this study. Alternatively, NO production by NOS may be at too low or transient levels to be detected by reaction with DAF FM or may be occurring at a phase of biofi lm development (i e. earlier or later than 8 hours growth) that was not investigated in these studies In addition, NO production in the wild type shows that addition of NaNitrate results in significantly more NO produced than NaNitrite. As mentioned abo ve, t his could be due to the fact that nar expression is induced at a higher level in the presence of nitrate compared to nitrite thus resulting in increased NO production in the presence of nitrate Indeed we see that when varying levels of NaNitrate w ere added to the biofilms, each incr ease in NaNitrate resulted in a corresponding increase in NO production. Also, the addition of an NO scavenger (carboxy PTIO) reduced the levels of

PAGE 61

61 NO detected, suggesting that it is specifically NO that is being detect ed in the experiment. That said, not all of the DAF FM fluorescence detected was diminished by the scavenger, which could be due to other reactive nitrogen species such as N 2 O 3 possibly reacting with DAF FM, as this has been shown to be the case with the related fluorescent probe DAF F2 (McQuade and Lippard 2010). While the Nar GHI nitrate reductase of Salmonella t yphimurium produces NO only in the absence of nitrate, our study suggests that the nitrate reductase of S. aureus functions on the opposite manner, with NO produced in the presence of nitrate. This is likely due to the regulators of the S. aureus narGHJI NreABC and YhcSR which both are induced in anaerobic conditions in the presence of nitrate (Schlag et al., 2008 ; Yan et al., 2011). It is possible that efficient NO production via S. aureus nitrate reductase occurs in a sequential fashion, whereby nitrate is first reduced to nitrite, and once nitrate is depleted, the accumulated intracellular nitrite is then reduc ed to NO via Nar. To investigate this, future experiments will include a time course study to carefully monitor NO production, nitrate, and nitrite levels, during S. aureus biofilm growth. In addition, all current knowledge thus far ha s lead to the belie f that NO promotes cell death and dispersal of biofilms, such as in P. aeruginosa (Barraud et al. 2006) and previous studies on S. aureus (Schlag et al., 2007). Our current study found that in the wil d type strains Newman and UAMS 1, nitrate addition to the biofilm results in an increase in NO production, and surprisingly, also an increase in biomass and average thickness. This suggests that under the biofilm growth conditions tested here NO is having the opposite effect than what the previous literatur e would predict. In the case of S. aureus these differences in results may be due to the fact that Schlag et al. (2007) performed their

PAGE 62

62 studies with a S. aureus strain that is dependent on PIA for biofilm formation, whereas the strains used in this thesi s study do not require PIA for biofilm formation in vitro ( Fluckiger et al., 2005; Beenken et al., 2004 ). Future work to directly implicate NO as the effector of the nitrate and/or nitrite dependent biofilm phenotypes observed in the studies presented in this thesis should include an experiment that would introduce NO exogenously to the biofilms If the results of this study can be reproduced by artificially in troducing NO to the cell, then this would pro vide direct evidence that NO is responsible for the biofilm phenotype observed between the wild type and the nar mutation.

PAGE 63

63 L IST OF REFERENCES Aparna, M.S., and Yadav, S. (2008). Biofilms: microbes and disease Braz J Infect Dis 12 526 530. Arciola, C.R., Campoccia, D., Baldassarri, L., Donati, M.E., Pirini, V., Gamberini, S., and Montanaro, L. (2006). Detection of biofilm formation in Staphylococcus epidermidis from implant infections. Comparison of a PCR met hod that recognizes the presence of ica genes with two classic phenotypic methods. J Biomed Mater Res A 76 425 430. Baba, T., Bae, T., Schneewind, O., Takeuchi, F., and Hiramatsu, K. (2008). Genome sequence of Staphylococcus aureus strain Newman and compa rative analysis of staphylococcal genomes: polymorphism and evolution of two major pathogenicity islands. J Bacteriol 190 300 310. Bae, T., Banger, A.K., Wallace, A., Glass, E.M., Aslund, F., Schneewind, O., and Missiakas, D.M. (2004). Staphylococcus aure us virulence genes identified by bursa aurealis mutagenesis and nematode killing. Proc Natl Acad Sci U S A 101 12312 12317. Barraud, N., Hassett, D.J., Hwang, S.H., Rice, S.A., Kjelleberg, S., and Webb, J.S. (2006). Involvement of nitric oxide in biofilm dispersal of Pseudomonas aeruginosa. J Bacteriol 188 7344 7353. Bartlett, A.H., and Hulten, K.G. (2010). Staphylococcus aureus pathogenesis: secretion systems, adhesins, and invasins. Pediatr Infect Dis J 29 860 861. Bayles, K.W. (2007). The biological r ole of death and lysis in biofilm development. Nat Rev Microbiol 5 721 726. Beenken, K.E., Dunman, P.M., McAleese, F., Macapagal, D., Murphy, E., Projan, S.J., Blevins, J.S., and Smeltzer, M.S. (2004). Global gene expression in Staphylococcus aureus biofi lms. J Bacteriol 186 4665 4684. Bischoff, M., Dunman, P., Kormanec, J., Macapagal, D., Murphy, E., Mounts, W., Berger Bchi, B., and Projan, S. (2004). Microarray based analysis of the Staphylococcus aureus sigmaB regulon. J Bacteriol 186 4085 4099. Blai se, G.A., Gauvin, D., Gangal, M., and Authier, S. (2005). Nitric oxide, cell signaling and cell death. Toxicology 208 177 192. Blasco, F., Guigliarelli, B., Magalon, A., Asso, M., Giordano, G., and Rothery, R.A. (2001). The coordination and function of th e redox centres of the membrane bound nitrate reductases. Cell Mol Life Sci 58 179 193.

PAGE 64

64 Bohach, G.A., Fast, D.J., Nelson, R.D., and Schlievert, P.M. (1990). Staphylococcal and streptococcal pyrogenic toxins involved in toxic shock syndrome and related ill nesses. Crit Rev Microbiol 17 251 272. Boles, B.R., and Horswill, A.R. (2008). Agr mediated dispersal of Staphylococcus aureus biofilms. PLoS Pathog 4 e1000052. Bone, R.C. (1994). Gram positive organisms and sepsis. Arch Intern Med 154 26 34. Branda, S. S., Vik, S., Friedman, L., and Kolter, R. (2005). Biofilms: the matrix revisited. Trends Microbiol 13 20 26. Brinkmann, V., and Zychlinsky, A. (2007). Beneficial suicide: why neutrophils die to make NETs. Nat Rev Microbiol 5 577 582. Brooun, A., Liu, S., and Lewis, K. (2000). A dose response study of antibiotic resistance in Pseudomonas aeruginosa biofilms. Antimicrob Agents Chemother 44 640 646. Brckner, R. (1997). Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus. FEMS Microbiol L ett 151 1 8. Burke, K.A., and Lascelles, J. (1975). Nitrate reductase system in Staphylococcus aureus wild type and mutants. J Bacteriol 123 308 316. Chambers, H.F., and Deleo, F.R. (2009). Waves of resistance: Staphylococcus aureus in the antibiotic era. Nat Rev Microbiol 7 629 641. Chambers, H.F., Korzeniowski, O.M., and Sande, M.A. (1983). Staphylococcus aureus endocarditis: clinical manifestations in addicts and nonaddicts. Medicine (Baltimore) 62 170 177. Chambers, H.F., and Neu, H.C. (1995). Pe nicillins. In Principles and practice of infectious diseases, G. Mandell, J.E. Bennett, and R. Dolin, eds. (New York: Churchill Livingstone), pp. 233 246. Chan, P.F., and Foster, S.J. (1998). The role of environmental factors in the regulation of virulence determinant expression in Staphylococcus aureus 8325 4. Microbiology 144 ( Pt 9) 2469 2479. Charpentier, E., Anton, A.I., Barry, P., Alfonso, B., Fang, Y., and Novick, R.P. (2004). Novel cassette based shuttle vector system for gram positive bacteria. Ap pl Environ Microbiol 70 6076 6085. Cheng, A.G., DeDent, A.C., Schneewind, O., and Missiakas, D. (2011). A play in four acts: Staphylococcus aureus abscess formation. Trends Microbiol 19 225 232.

PAGE 65

65 Cheung, A.L., Bayer, A.S., Zhang, G., Gresham, H., and Xiong, Y.Q. (2004). Regulation of virulence determinants in vitro and in vivo in Staphylococcus aureus. FEMS Immunol Med Microbiol 40 1 9. Cheung, A.L., Koomey, J.M., Butler, C.A., Projan, S.J., and F ischetti, V.A. (1992). Regulation of exoprotein expression in Staphylococcus aureus by a locus (sar) distinct from agr. Proc Natl Acad Sci U S A 89 6462 6466. Cheung, A.L., Nishina, K.A., Trotonda, M.P., and Tamber, S. (2008). The SarA protein family of S taphylococcus aureus. Int J Biochem Cell Biol 40 355 361. Choi, K.C., Jeong, T.K., Lee, S.C., Kim, S.W., Kim, N.H., and Lee, K.Y. (1998). Nitric oxide is a marker of peritonitis in patients on continuous ambulatory peritoneal dialysis. Adv Perit Dial 14 173 179. Christensen, G., Baldassarri, L., and Simpson, W. (1994) Colonization of medical devices by coagulase negative staphylococci. In Infections associated with indwelling medical devices, 2nd ed., A. L. Bisno and F. A. Waldvogel, eds. (Washington, DC : ASM Press), pp. 45 78. Costerton, J.W., Lewandowski, Z., DeBeer, D., Caldwell, D., Korber, D., and James, G. (1994). Biofilms, the customized microniche. J Bacteriol 176 2137 2142. Coulter, S.N., Schwan, W.R., Ng, E.Y., Langhorne, M.H., Ritchie, H.D., W estbrock Wadman, S., Hufnagle, W.O., Folger, K.R., Bayer, A.S., and Stover, C.K. (1998). Staphylococcus aureus genetic loci impacting growth and survival in multiple infection environments. Mol Microbiol 30 393 404. Daum, R.S., and Seal, J.B. (2001). Evol ving antimicrobial chemotherapy for Staphylococcus aureus infections: Our backs to the wall. Crit Care Med 29 N92 96. Davey, M.E., and O'toole, G.A. (2000). Microbial biofilms: from ecology to molecular genetics. Microbiol Mol Biol Rev 64 847 867. David, M.Z., and Daum, R.S. (2010). Community associated methicillin resistant Staphylococcus aureus: epidemiology and clinical consequences of an emerging epidemic. Clin Microbiol Rev 23 616 687. de Haas, C.J., Veldkamp, K.E., Peschel, A., Weerkamp, F., Van Wa mel, W.J., Heezius, E.C., Poppelier, M.J., Van Kessel, K.P., and van Strijp, J.A. (2004). Chemotaxis inhibitory protein of Staphylococcus aureus, a bacterial antiinflammatory agent. J Exp Med 199 687 695. Dean, J.V., and Harper, J.E. (1988). The Conversio n of Nitrite to Nitrogen Oxide(s) by the Constitutive NAD(P)H Nitrate Reductase Enzyme from Soybean. Plant Physiol 88 389 395.

PAGE 66

66 Decker, M.D., Lybarger, J.A., Vaughn, W.K., Hutcheson, R.H., and Schaffner, W. (1986). An outbreak of staphylococcal skin infect ions among river rafting guides. Am J Epidemiol 124 969 976. del Ro, L.A., Corpas, F.J., and Barroso, J.B. (2004). Nitric oxide and nitric oxide synthase activity in plants. Phytochemistry 65 783 792. Donlan, R.M. (2002). Biofilms: microbial life on sur faces. Emerg Infect Dis 8 881 890. Dowzicky, M., Talbot, G.H., Feger, C., Prokocimer, P., Etienne, J., and Leclercq, R. (2000). Characterization of isolates associated with emerging resistance to quinupristin/dalfopristin (Synercid) during a worldwide cli nical program. Diagn Microbiol Infect Dis 37 57 62. Dubourdieu, M., and DeMoss, J.A. (1992). The narJ gene product is required for biogenesis of respiratory nitrate reductase in Escherichia coli. J Bacteriol 174 867 872. D uthie E.S., and L orenz L.L. (1 952). Staphylococcal coagulase; mode of action and antigenicity. J Gen Microbiol 6 95 107. Espersen, F., and Frimodt Mller, N. (1986). Staphylococcus aureus endocarditis. A review of 119 cases. Arch Intern Med 146 1118 1121. Falsetta, M.L., McEwan, A.G. Jennings, M.P., and Apicella, M.A. (2010). Anaerobic metabolism occurs in the substratum of gonococcal biofilms and may be sustained in part by nitric oxide. Infect Immun 78 2320 2328. Fang, F.C. (2004). Antimicrobial reactive oxygen and nitrogen specie s: concepts and controversies. Nat Rev Microbiol 2 820 832. Flemming, H.C., and Wingender, J. (2010). The biofilm matrix. Nat Rev Microbiol 8 623 633. Fluckiger, U., Ulrich, M., Steinhuber, A., Dring, G., Mack, D., Landmann, R., Goerke, C., and Wolz, C. (2005). Biofilm formation, icaADBC transcription, and polysaccharide intercellular adhesin synthesis by staphylococci in a device related infection model. Infect Immun 73 1811 1819. Fridkin, S.K., Hageman, J.C., Morrison, M., Sanza, L.T., Como Sabetti, K ., Jernigan, J.A., Harriman, K., Harrison, L.H., Lynfield, R., Farley, M.M. et al. (2005). Methicillin resistant Staphylococcus aureus disease in three communities. N Engl J Med 352 1436 1444. Fuchs, S., Pan Farr, J., Kohler, C., Hecker, M., and Engelm ann, S. (2007). Anaerobic gene expression in Staphylococcus aureus. J Bacteriol 189 4275 4289.

PAGE 67

67 Gasque, P. (2004). Complement: a unique innate immune sensor for danger signals. Mol Immunol 41 1089 1098. Gaujoux Viala, C., Zeller, V., Leclerc, P., Chichepo rtiche, V., Mamoudy, P., Desplaces, N., and Ziza, J.M. (2011). Osteomyelitis in adults: an underrecognized clinical entity in immunocompetent hosts. A report of six cases. Joint Bone Spine 78 75 79. Gilbert, P., Allison, D.G., and McBain, A.J. (2002). Biofilms in vitro and in vivo: do singular mechanisms imply cross resistance? J Appl Microbiol 92 Suppl 98S 110S. Gilberthorpe, N.J., and Poole, R.K. (2008). Nitric oxide homeostasis in Salmonella typhimurium: roles of respiratory nitrate reductase and flavohemoglobin. J Biol Chem 283 11146 11154. Gillaspy, A.F., Hickmon, S.G., Skinner, R.A., Thomas, J.R., Nelson, C.L., and Smeltzer, M.S. (1995). Role of the accessory gene regulator (agr) in pathogenesis of staphylococcal osteomyelitis. Infect Immun 63 3373 3380. Goerke, C., and Wolz, C. (2010). Adaptation of Staphylococcus aureus to the cystic fibrosis lung. Int J Med Microbiol 300 520 525. Goller, C.C., an d Romeo, T. (2008). Environmental influences on biofilm development. Curr Top Microbiol Immunol 322 37 66. Gorak, E.J., Yamada, S.M., and Brown, J.D. (1999). Community acquired methicillin resistant Staphylococcus aureus in hospitalized adults and childre n without known risk factors. Clin Infect Dis 29 797 800. Gorwitz, R.J., Kruszon Moran, D., McAllister, S.K., McQuillan, G., McDougal, L.K., Fosheim, G.E., Jensen, B.J., Killgore, G., Tenover, F.C., and Kuehnert, M.J. (2008). Changes in the prevalence of nasal colonization with Staphylococcus aureus in the United States, 2001 2004. J Infect Dis 197 1226 1234. Gresham, H.D., Lowrance, J.H., Caver, T.E., Wilson, B.S., Cheung, A.L., and Lindberg, F.P. (2000). Survival of Staphylococcus aureus inside neutroph ils contributes to infection. J Immunol 164 3713 3722. Guigliarelli, B., Magalon, A., Asso, M., Bertrand, P., Frixon, C., Giordano, G., and Blasco, F. (1996). Complete coordination of the four Fe S centers of the beta subunit from Escherichia coli nitrate reductase. Physiological, biochemical, and EPR characterization of site directed mutants lacking the highest or lowest potential [4Fe 4S] clusters. Biochemistry 35 4828 4836. Gtz, F. (2002). Staphylococcus and biofilms. Mol Microbiol 43 1367 1378.

PAGE 68

68 Hall Stoodley, L., Costerton, J.W., and Stoodley, P. (2004). Bacterial biofilms: from the natural environment to infectious diseases. Nat Rev Microbiol 2 95 108. Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166 557 580. Harper, J.E. (1981). Evolution of Nitrogen Oxide(s) during In Vivo Nitrate Reductase Assay of Soybean Leaves. Plant Physiol 68 1488 1493. Heilmann, C., Hussain, M., Peters, G., and Gtz, F. (1997). Evidence for autolysin mediated primary attachme nt of Staphylococcus epidermidis to a polystyrene surface. Mol Microbiol 24 1013 1024. Heilmann, C., Schweitzer, O., Gerke, C., Vanittanakom, N., Mack, D., and Gtz, F. (1996). Molecular basis of intercellular adhesion in the biofilm forming Staphylococcu s epidermidis. Mol Microbiol 20 1083 1091. Heilmann, C., Thumm, G., Chhatwal, G.S., Hartleib, J., Uektter, A., and Peters, G. (2003). Identification and characterization of a novel autolysin (Aae) with adhesive properties from Staphylococcus epidermidis. Microbiology 149 2769 2778. Hendriks, J., Oubrie, A., Castresana, J., Urbani, A., Gemeinhardt, S., and Saraste, M. (2000). Nitric oxide reductases in bacteria. Biochim Biophys Acta 1459 266 273. Herold, B.C., Immergluck, L.C., Maranan, M.C., Lauderdale, D.S., Gaskin, R.E., Boyle Vavra, S., Leitch, C.D., and Daum, R.S. (1998). Community acquired methicillin resistant Staphylococcus aureus in children with no identified predisposing risk. JAMA 279 593 598. Heydorn, A., Nielsen, A.T., Hentzer, M., Sternber g, C., Givskov, M., Ersbll, B.K., and Molin, S. (2000). Quantification of biofilm structures by the novel computer program COMSTAT. Microbiology 146 ( Pt 10) 2395 2407. Hochgrfe, F., Wolf, C., Fuchs, S., Liebeke, M., Lalk, M., Engelmann, S., and Hecker, M. (2008). Nitric oxide stress induces different responses but mediates comparable protein thiol protection in Bacillus subtilis and Staphylococcus aureus. J Bacteriol 190 4997 5008. Holden, M.T., Feil, E.J., Lindsay, J.A., Peacock, S.J., Day, N.P., Enri ght, M.C., Foster, T.J., Moore, C.E., Hurst, L., Atkin, R. et al. (2004). Complete genomes of two clinical Staphylococcus aureus strains: evidence for the rapid evolution of virulence and drug resistance. Proc Natl Acad Sci U S A 101 9786 9791. Hughes, M .N. (2008). Chemistry of nitric oxide and related species. Methods Enzymol 436 3 19.

PAGE 69

69 Hussain, M., Herrmann, M., von Eiff, C., Perdreau Remington, F., and Peters, G. (1997). A 140 kilodalton extracellular protein is essential for the accumulation of Staphy lococcus epidermidis strains on surfaces. Infect Immun 65 519 524. Imataki, O., Makimoto, A., Kato, S., Bannai, T., Numa, N., Nukui, Y., Morisawa, Y., Ishida, T., Kami, M., Fukuda, T. et al. (2006). Coincidental outbreak of methicillin resistant Staphylo coccus aureus in a hematopoietic stem cell transplantation unit. Am J Hematol 81 664 669. Inoue, H., Nojima, H., and Okayama, H. (1990). High efficiency transformation of Escherichia coli with plasmids. Gene 96 23 28. Jefferson, K.K. (2004). What drives bacteria to produce a biofilm? FEMS Microbiol Lett 236 163 173. Kluytmans, J., van Belkum, A., and Verbrugh, H. (1997). Nasal carriage of Staphylococcus aureus: epidemiology, underlying mechanisms, and associated risks. Clin Microbiol Rev 10 505 520. Klu ytmans, J.A., Mouton, J.W., Ijzerman, E.P., Vandenbroucke Grauls, C.M., Maat, A.W., Wagenvoort, J.H., and Verbrugh, H.A. (1995). Nasal carriage of Staphylococcus aureus as a major risk factor for wound infections after cardiac surgery. J Infect Dis 171 21 6 219. Koenig, R.L., Ray, J.L., Maleki, S.J., Smeltzer, M.S., and Hurlburt, B.K. (2004). Staphylococcus aureus AgrA binding to the RNAIII agr regulatory region. J Bacteriol 186 7549 7555. Kojima, H., Nakatsubo, N., Kikuchi, K., Kawahara, S., Kirino, Y., N agoshi, H., Hirata, Y., and Nagano, T. (1998). Detection and imaging of nitric oxide with novel fluorescent indicators: diaminofluoresceins. Anal Chem 70 2446 2453. Kreiswirth, B.N., Lfdahl, S., Betley, M.J., O'Reilly, M., Schlievert, P.M., Bergdoll, M.S., and Novick, R.P. (1983). The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305 709 712. Kriegeskorte, A., Kni g, S., Sander, G., Pirkl, A., Mahabir, E., Proctor, R.A., von Eiff, C., Peters, G., and Becker, K. (2011). Small colony variants of Staphylococcus aureus reveal distinct protein profiles. Proteomics 11 2476 2490. Kwon, A.S., Park, G.C., Ryu, S.Y., Lim, D. H., Lim, D.Y., Choi, C.H., Park, Y., and Lim, Y. (2008). Higher biofilm formation in multidrug resistant clinical isolates of Staphylococcus aureus. Int J Antimicrob Agents 32 68 72. Lina, G., Jarraud, S., Ji, G., Greenland, T., Pedraza, A., Etienne, J., Novick, R.P., and Vandenesch, F. (1998). Transmembrane topology and histidine protein kinase activity of AgrC, the agr signal receptor in Staphylococcus aureus. Mol Microbiol 28 655 662.

PAGE 70

70 Lindsay, D., and von Holy, A. (2006). Bacterial biofilms within the clinical setting: what healthcare professionals should know. J Hosp Infect 64 313 325. Lowy, F.D. (1998). Staphylococcus aureus infections. N Engl J Med 339 520 532. Luh, K.T., Hsueh, P.R., Teng, L.J., Pan, H.J., Chen, Y.C., Lu, J.J., Wu, J.J., and Ho, S .W. (2000). Quinupristin dalfopristin resistance among gram positive bacteria in Taiwan. Antimicrob Agents Chemother 44 3374 3380. Lpez, D., Vlamakis, H., and Kolter, R. (2010). Biofilms. Cold Spring Harb Perspect Biol 2 a000398. Mann, E.E., Rice, K.C., Boles, B.R., Endres, J.L., Ranjit, D., Chandramohan, L., Tsang, L.H., Smeltzer, M.S., Horswill, A.R., and Bayles, K.W. (2009). Modulation of eDNA release and degradation affects Staphylococcus aureus biofilm maturation. PLoS One 4 e5822. Marletta, M.A., Hurshman, A.R., and Rusche, K.M. (1998). Catalysis by nitric oxide synthase. Curr Opin Chem Biol 2 656 663. Marty, F.M., Yeh, W.W., Wennersten, C.B., Venkataraman, L., Albano, E., Alyea, E.P., Gold, H.S., Baden, L.R., and Pillai, S.K. (2006). Emergence of a clinical daptomycin resistant Staphylococcus aureus isolate during treatment of methicillin resistant Staphylococcus aureus bacteremia and osteomyelitis. J Clin Microbiol 44 595 597. Massilamany, C., Gangaplara, A., Gardner, D.J., Musser, J.M., Steffen D., Somerville, G.A., and Reddy, J. (2011). TCA cycle inactivation in Staphylococcus aureus alters nitric oxide production in RAW 264.7 cells. Mol Cell Biochem. McQuade, L.E., and Lippard, S.J. (2010). Fluorescent probes to investigate nitric oxide and o ther reactive nitrogen species in biology (truncated form: fluorescent probes of reactive nitrogen species). Curr Opin Chem Biol 14 43 49. Mei, J.M., Nourbakhsh, F., Ford, C.W., and Holden, D.W. (1997). Identification of Staphylococcus aureus virulence ge nes in a murine model of bacteraemia using signature tagged mutagenesis. Mol Microbiol 26 399 407. Meka, V.G., Pillai, S.K., Sakoulas, G., Wennersten, C., Venkataraman, L., DeGirolami, P.C., Eliopoulos, G.M., Moellering, R.C., and Gold, H.S. (2004). Linez olid resistance in sequential Staphylococcus aureus isolates associated with a T2500A mutation in the 23S rRNA gene and loss of a single copy of rRNA. J Infect Dis 190 311 317. Miller, L.G., and Diep, B.A. (2008). Clinical practice: colonization, fomites, and virulence: rethinking the pathogenesis of community associated methicillin resistant Staphylococcus aureus infection. Clin Infect Dis 46 752 760.

PAGE 71

71 Minhas, P., Perl, T.M., Carroll, K.C., Shepard, J.W., Shangraw, K.A., Fellerman, D., and Ziai, W.C. (201 1). Risk factors for positive admission surveillance cultures for methicillin resistant Staphylococcus aureus and vancomycin resistant enterococci in a neurocritical care unit. Crit Care Med. Moreno Vivin, C., Cabello, P., Martnez Luque, M., Blasco, R., and Castillo, F. (1999). Prokaryotic nitrate reduction: molecular properties and functional distinction among bacterial nitrate reductases. J Bacteriol 181 6573 6584. Morfeldt, E., Tegmark, K., and Arvidson, S. (1996). Transcriptional control of the agr d ependent virulence gene regulator, RNAIII, in Staphylococcus aureus. Mol Microbiol 21 1227 1237. Morozkina, E.V., and Zvyagilskaya, R.A. (2007). Nitrate reductases: structure, functions, and effect of stress factors. Biochemistry (Mosc) 72 1151 1160. Mylotte, J.M., McDermott, C., and Spooner, J.A. (1987). Prospective study of 114 consecutive episodes of Staphylococcus aureus bacteremia. Rev Infect Dis 9 891 907. Naimi, T.S., LeDell, K.H., Como Sabetti, K., Borchardt, S.M., Boxrud, D.J., Etienne, J., J ohnson, S.K., Vandenesch, F., Fridkin, S., O'Boyle, C. et al. (2003). Comparison of community and health care associated methicillin resistant Staphylococcus aureus infection. JAMA 290 2976 2984. Neubauer, H., Pantel, I., and Gtz, F. (1999). Molecular characterization of the nitrite reducing system of Staphylococcus carnosus. J Bacteriol 181 1481 1488. Nguyen, K.T., Piastro, K., Gray, T.A., and Derbyshire, K.M. (2010). Mycobacterial biofilms facilitate horizontal DNA transfer between strains of Mycobac terium smegmatis. J Bacteriol 192 5134 5142. Nobre, L.S., Gonalves, V.L., and Saraiva, L.M. (2008). Flavohemoglobin of Staphylococcus aureus. Methods Enzymol 436 203 216. Novick, R.P. (1991). Genetic systems in staphylococci. Methods Enzymol 204 587 63 6. Novick, R.P., Projan, S.J., Kornblum, J., Ross, H.F., Ji, G., Kreiswirth, B., Vandenesch, F., and Moghazeh, S. (1995). The agr P2 operon: an autocatalytic sensory transduction system in Staphylococcus aureus. Mol Gen Genet 248 446 458. Ohlsen, K., Koll er, K.P., and Hacker, J. (1997). Analysis of expression of the alpha toxin gene (hla) of Staphylococcus aureus by using a chromosomally encoded hla::lacZ gene fusion. Infect Immun 65 3606 3614. Otto, M. (2006). Bacterial evasion of antimicrobial peptides by biofilm formation. Curr Top Microbiol Immunol 306 251 258.

PAGE 72

72 Otto, M. (2008). Staphylococcal biofilms. Curr Top Microbiol Immunol 322 207 228. Palma, M., and Cheung, A.L. (2001). sigma(B) activity in Staphylococcus aureus is controlled by RsbU and an additional factor(s) during bacterial growth. Infect Immun 69 7858 7865. Parsek, M.R., and Fuqua, C. (2004). Biofilms 2003: emerging themes and challenges in studies of surface associated microbial life. J Bacteriol 186 4427 4440. Patel, A.H., Nowlan, P. Weavers, E.D., and Foster, T. (1987). Virulence of protein A deficient and alpha toxin deficient mutants of Staphylococcus aureus isolated by allele replacement. Infect Immun 55 3103 3110. Patti, J.M., Allen, B.L., McGavin, M.J., and Hk, M. (1994). MS CRAMM mediated adherence of microorganisms to host tissues. Annu Rev Microbiol 48 585 617. Poole, R.K. (2005). Nitric oxide and nitrosative stress tolerance in bacteria. Biochem Soc Trans 33 176 180. Pragman, A.A., Yarwood, J.M., Tripp, T.J., and Schliev ert, P.M. (2004). Characterization of virulence factor regulation by SrrAB, a two component system in Staphylococcus aureus. J Bacteriol 186 2430 2438. Priest, D.H., and Peacock, J.E. (2005). Hematogenous vertebral osteomyelitis due to Staphylococcus aure us in the adult: clinical features and therapeutic outcomes. South Med J 98 854 862. Rajan, S., and Saiman, L. (2002). Pulmonary infections in patients with cystic fibrosis. Semin Respir Infect 17 47 56. Recsei, P., Kreiswirth, B., O'Reilly, M., Schlieve rt, P., Gruss, A., and Novick, R.P. (1986). Regulation of exoprotein gene expression in Staphylococcus aureus by agar. Mol Gen Genet 202 58 61. (2009). In vivo biofilm on the surface of a surgical mesh implant. Pol J Microbiol 58 367 369. Rice, K.C., Mann, E.E., Endres, J.L., Weiss, E.C., Cassat, J.E., Smeltzer, M.S., and Bayles, K.W. (2007). The cidA murein hydrolase regulator contributes to DNA release and biofilm developme nt in Staphylococcus aureus. Proc Natl Acad Sci U S A 104 8113 8118. Richardson, A.R., Dunman, P.M., and Fang, F.C. (2006). The nitrosative stress response of Staphylococcus aureus is required for resistance to innate immunity. Mol Microbiol 61 927 939.

PAGE 73

73 Richardson, A.R., Libby, S.J., and Fang, F.C. (2008). A nitric oxide inducible lactate dehydrogenase enables Staphylococcus aureus to resist innate immunity. Science 319 1672 1676. Rockel, P., Strube, F., Rockel, A., Wildt, J., and Kaiser, W.M. (2002). Re gulation of nitric oxide (NO) production by plant nitrate reductase in vivo and in vitro. J Exp Bot 53 103 110. Rohde, H., Burandt, E.C., Siemssen, N., Frommelt, L., Burdelski, C., Wurster, S., Scherpe, S., Davies, A.P., Harris, L.G., Horstkotte, M.A. et al. (2007). Polysaccharide intercellular adhesin or protein factors in biofilm accumulation of Staphylococcus epidermidis and Staphylococcus aureus isolated from prosthetic hip and knee joint infections. Biomaterials 28 1711 1720. Rohde, H., Burdelski, C ., Bartscht, K., Hussain, M., Buck, F., Horstkotte, M.A., Knobloch, J.K., Heilmann, C., Herrmann, M., and Mack, D. (2005). Induction of Staphylococcus epidermidis biofilm formation via proteolytic processing of the accumulation associated protein by staphy lococcal and host proteases. Mol Microbiol 55 1883 1895. Rooijakkers, S.H., van Kessel, K.P., and van Strijp, J.A. (2005). Staphylococcal innate immune evasion. Trends Microbiol 13 596 601. Rose, W.E., and Rybak, M.J. (2006). Tigecycline: first of a new class of antimicrobial agents. Pharmacotherapy 26 1099 1110. Ross, R.A., and Onderdonk, A.B. (2000). Production of toxic shock syndrome toxin 1 by Staphylococcus aureus requires both oxygen and carbon dioxide. Infect Immun 68 5205 5209. Schenk, S., and L addaga, R.A. (1992). Improved method for electroporation of Staphylococcus aureus. FEMS Microbiol Lett 73 133 138. Schlag, S., Fuchs, S., Nerz, C., Gaupp, R., Engelmann, S., Liebeke, M., Lalk, M., Hecker, M., and Gtz, F. (2008). Characterization of the o xygen responsive NreABC regulon of Staphylococcus aureus. J Bacteriol 190 7847 7858. Schlag, S., Nerz, C., Birkenstock, T.A., Altenberend, F., and Gtz, F. (2007). Inhibition of staphylococcal biofilm formation by nitrite. J Bacteriol 189 7911 7919. Seid l, K., Bischoff, M., and Berger Bchi, B. (2008). CcpA mediates the catabolite repression of tst in Staphylococcus aureus. Infect Immun 76 5093 5099. Senn, M.M., Giachino, P., Homerova, D., Steinhuber, A., Strassner, J., Kormanec, J., Flckiger, U., Berge r Bchi, B., and Bischoff, M. (2005). Molecular analysis and organization of the sigmaB operon in Staphylococcus aureus. J Bacteriol 187 8006 8019.

PAGE 74

74 Shafer, W.M., and Iandolo, J.J. (1979). Genetics of staphylococcal enterotoxin B in methicillin resistant i solates of Staphylococcus aureus. Infect Immun 25 902 911. Shankar, K., Gyanendra, L., Hari, S., and Narayan, S.D. (2009). Culture proven endogenous bacterial endophthalmitis in apparently healthy individuals. Ocul Immunol Inflamm 17 396 399. Shapiro, J. A. (1998). Thinking about bacterial populations as multicellular organisms. Annu Rev Microbiol 52 81 104. Shay, A.H., Choi, R., Whittaker, K., Salehi, K., Kitchen, C.M., Tashkin, D.P., Roth, M.D., and Baldwin, G.C. (2003). Impairment of antimicrobial acti vity and nitric oxide production in alveolar macrophages from smokers of marijuana and cocaine. J Infect Dis 187 700 704. Siddiqui, A.R., and Bernstein, J.M. (2010). Chronic wound infection: facts and controversies. Clin Dermatol 28 519 526. Sodergren, E.J., Hsu, P.Y., and DeMoss, J.A. (1988). Roles of the narJ and narI gene products in the expression of nitrate reductase in Escherichia coli. J Biol Chem 263 16156 16162. Somerville, G.A., Chaussee, M.S., Morgan, C.I., Fitzgerald, J.R., Dorwar d, D.W., Reitzer, L.J., and Musser, J.M. (2002). Staphylococcus aureus aconitase inactivation unexpectedly inhibits post exponential phase growth and enhances stationary phase survival. Infect Immun 70 6373 6382. Somerville, G.A., Cockayne, A., Drr, M., Peschel, A., Otto, M., and Musser, J.M. (2003). Synthesis and deformylation of Staphylococcus aureus delta toxin are linked to tricarboxylic acid cycle activity. J Bacteriol 185 6686 6694. Somerville, G.A., and Proctor, R.A. (2009). At the crossroads of b acterial metabolism and virulence factor synthesis in Staphylococci. Microbiol Mol Biol Rev 73 233 248. Sonenshein, A.L. (2005). CodY, a global regulator of stationary phase and virulence in Gram positive bacteria. Curr Opin Microbiol 8 203 207. Stamm, W .E., Weinstein, R.A., and Dixon, R.E. (1981). Comparison of endemic and epidemic nosocomial infections. Am J Med 70 393 397. Stoodley, P., Debeer, D., and Lewandowski, Z. (1994). Liquid flow in biofilm systems. Appl Environ Microbiol 60 2711 2716. S trasters K.C., and Winkler K.C. (1963). C arbohydrate metabolism of S taphylococcus aureus J Gen Microbiol 33 213 229.

PAGE 75

75 Talbot, G.H., Bradley, J., Edwards, J.E., Gilbert, D., Scheld, M., Bartlett, J.G., and America, A.A.T.F.o.t.I.D.S.o. (2006). Bad bugs n eed drugs: an update on the development pipeline from the Antimicrobial Availability Task Force of the Infectious Diseases Society of America. Clin Infect Dis 42 657 668. Throup, J.P., Zappacosta, F., Lunsford, R.D., Annan, R.S., Carr, S.A., Lonsdale, J.T ., Bryant, A.P., McDevitt, D., Rosenberg, M., and Burnham, M.K. (2001). The srhSR gene pair from Staphylococcus aureus: genomic and proteomic approaches to the identification and characterization of gene function. Biochemistry 40 10392 10401. Tuazon, C.U. Perez, A., Kishaba, T., and Sheagren, J.N. (1975). Staphylococcus aureus among insulin injecting diabetic patients. An increased carrier rate. JAMA 231 1272. Uhln, M., Guss, B., Nilsson, B., Gatenbeck, S., Philipson, L., and Lindberg, M. (1984). Comple te sequence of the staphylococcal gene encoding protein A. A gene evolved through multiple duplications. J Biol Chem 259 1695 1702. Waldvogel, F.A. (1995). Staphylococcus aureus (including toxic shock syndrome). In s and practice of infectious diseases. 4th ed. Vol. 2, G. Mandell, J.E. Bennett, and R. Dolin, eds. (New York: Churchill Livingstone), pp. 1754 1777. Weinke, T., Schiller, R., Fehrenbach, F.J., and Pohle, H.D. (1992). Association between Staphylococcus aur eus nasopharyngeal colonization and septicemia in patients infected with the human immunodeficiency virus. Eur J Clin Microbiol Infect Dis 11 985 989. Wenzel, R.P., and Perl, T.M. (1995). The significance of nasal carriage of Staphylococcus aureus and the incidence of postoperative wound infection. J Hosp Infect 31 13 24. Wharton, D.C., and Weintraub, S.T. (1980). Identification of nitric oxide and nitrous oxide as products of nitrite reduction by Pseudomonas cytochrome oxidase (nitrate reductase). Bioche m Biophys Res Commun 97 236 242. Wilkinson, B.J. (1997). Biology. In The staphylococci in human disease, K.B. Crossley and G.L. Archer, eds. (New York: Churchill Livingstone), pp. 1 38. Wu, K.C., Chiu, H.H., Wang, J.H., Lee, N.S., Lin, H.C., Hsieh, C.C., Tsai, F.J., Peng, C.T., and Tseng, Y.C. (2002). Characteristics of community acquired methicillin resistant Staphylococcus aureus in infants and children without known risk factors. J Microbiol Immunol Infect 35 53 56. Yamasaki, H., and Sakihama, Y. (2000 ). Simultaneous production of nitric oxide and peroxynitrite by plant nitrate reductase: in vitro evidence for the NR dependent formation of active nitrogen species. FEBS Lett 468 89 92.

PAGE 76

76 Yamasaki, H., Sakihama, Y., and Takahashi, S. (1999). An alternative pathway for nitric oxide production in plants: new features of an old enzyme. Trends Plant Sci 4 128 129. Yan, M., Yu, C., Yang, J., and Ji, Y. (2011). The essential two component system YhcSR is involved in regulation of the nitrate respiratory pathway of Staphylococcus aureus. J Bacteriol 193 1799 1805. Zimmerli, W. (2006). Infection and musculoskeletal conditions: Prosthetic joint associated infections. Best Pract Res Clin Rheumatol 20 1045 1063.

PAGE 77

77 B IOGRAPHICAL SKETCH Sara Elizabeth Holman grew up in Bloomington, MN, and graduated from John F. Kennedy Senior High School in 2005. Upon graduation she attended the University of South Dakota, where she competed for the swim team while pursuing a Bachelor of Science in b iology which she com pleted in 2009 S he went on to attend graduate school at the University of Florida and achieved a Master of Science in m icrobiology and cell science in August of 2011 Sara plans on becoming an Officer in the Unites States Air Force with a specialty in scientific research.