Purification and Characterization of a Pre-Therapy HIV-1 Protease Variant and Variants Containing Drug-Pressure Selected...

MISSING IMAGE

Material Information

Title:
Purification and Characterization of a Pre-Therapy HIV-1 Protease Variant and Variants Containing Drug-Pressure Selected Mutations for Electron Paramagnetic Resonance (EPR) Studies
Physical Description:
1 online resource (203 p.)
Language:
english
Creator:
Gonzales,Estrella G
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Chemistry
Committee Chair:
Fanucci, Gail E
Committee Members:
Smith, Benjamin W
Dunn, Ben M

Subjects

Subjects / Keywords:
aids -- deer -- epr -- hiv -- mutations -- protease
Chemistry -- Dissertations, Academic -- UF
Genre:
Chemistry thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Human Immunodeficiency Virus (HIV) is the infectious agent that causes AIDS (Acquired Immune Deficiency Syndrome). HIV Type 1 protease (HIV-1 PR) is the enzyme essential in the maturation of the virus. Many anti-retroviral drugs target HIV 1 PR to prevent formation of the mature, infectious particle. Recently, protease inhibitors (PI) have been ineffective in the treatment of AIDS because of the emergence of drug-resistant variants of HIV-1 PR. Thus, the structure of HIV-1 protease and its interaction with substrates and inhibitors have been continually studied. Of particular interest is the flap region of HIV-1 PR, in which its flexibility allows it to adopt a variety of conformations and therefore control access of substrate or inhibitor. Moreover, naturally-occurring polymorphisms and drug-pressure selected mutations may have some impact on the flap conformation and flexibility. Several techniques have been used to sample the conformations of HIV-1 PR including pulsed electron paramagnetic resonance (EPR) methods. In this work, double electron-electron resonance (DEER) spectroscopy is used to characterize the flap conformation and flexibility of a pre therapy variant of HIV-1 protease and several variants containing drug-pressure selected mutations. The primary HIV-1 PR variants in this work are referred to as pre-therapy (PREi) and post-therapy (POSTi). These constructs were cloned into a vector suitable for bacterial expression of the protease. Mutagenesis was carried out on the POSTi variant to obtain several constructs containing drug-pressure selected mutations. The HIV-1 PR constructs were purified, spin-labeled, and subsequently characterized by sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE), circular dichroism (CD) spectroscopy, mass spectrometry (MS), and continuous wave-electron paramagnetic resonance (CW-EPR) spectroscopy. DEER analysis was performed on inactive PREi, POSTi, POSTi-A82V, Bsi (stabilized, inactive form of subtype B LAI), and Bsi-I63P apo constructs. Analysis of DEER data reveals the conformational states of HIV-1 PR corresponding to the tucked/curled, closed, semi-open, and wide-open conformations. Results have shown variations in the most probable distance and predominant conformations of the different HIV-1 PR variants. These results have demonstrated that drug-pressure selected mutations can alter the flap conformation and flexibility of HIV-1 PR. DEER analysis was also done on the PREi and POSTi constructs after addition of a protease inhibitor, ritonavir (RTV). Overall, DEER is a powerful technique for monitoring the effect of drug pressure selected mutations and addition of inhibitor on the flap conformation and flexibility of HIV-1 protease.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Estrella G Gonzales.
Thesis:
Thesis (M.S.)--University of Florida, 2011.
Local:
Adviser: Fanucci, Gail E.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043384:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 PURIFICATION AND CHARACTERIZATION OF A PRE THERAPY HIV 1 PROTEASE VARIANT AND VARIANTS CONTAINING DRUG PRESSURE SELECTED MUTATIONS FOR ELECTRON PARAMAGNETIC RESONANCE (EPR) STUDIES By ESTRELLA GARLIT GONZALES A THESIS PRE SENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Estrella Garlit Gonzales

PAGE 3

3 To my Mom Evie, whose love I will always remem ber, to my ever supportive and loving Dad John, and to my siblings, especially Ate Emmy

PAGE 4

4 ACKNOWLEDG E MENTS I am forever grateful to God for his guidance and for whom I gather my strength and will to liv e. It is because of Him that we humans are born into this world having the gift of wisdom and knowledge to ceaselessly understand the processes that drive the world which He created with His greatness I dedicate this to my parents, John a nd Evie Gonzales for their unending love, guidance, and support My Mom may not be in this world anymore but I will forever cherish the love and memories we shared. I thank Mom and Dad for having molded me into a disciplined and hard working person not on ly for me to attain self fulfillment but most importantly to striv e for the benefit of the other I thank my sisters, Emmy and Grace, and brothers, Elmer and Ellsworth, for their unwavering love and support. I particularly thank Ate Emmy for her help in e verything and just for being a sister and a friend at the same time I am very grateful for Alex Aloy for his unconditional love and for just always being there for me. I thank all my other friends for their care and support. I si ncerely thank my adviser, Dr. Gail Fanucci, for the opportunity to work in her research group I thank her for providing knowledge and insights not just about technical aspects of research but also about dealing with shortcomings in work and life, in gener al. I am grateful for her encouragement and support. I would like to thank my committee members, Dr. Ben Dunn of the Department of Biochemistry and Molecular Biology in the UF College of Medicine and Dr. Ben Smith. I thank Dr. Dunn for his collaboration wi th the HIV 1 protease project and for valuable insights about my research. I especially thank Dr. Smith for his patience and encouragement and for believing in my potential.

PAGE 5

5 I would like to express my gratitude to Dr. Alex Angerhofer for help in the use o f the EPR instrument. I likewise thank Dr. Steve Hagen of the Department of Physics for the use of his CD spectrometer. I also thank Dr. Cristina Dancel of the Department of Chemistry Mass Spectrometry Facility for helping me run and analyze my samples. I am also indebted to her because she has unconditionally helped me survive in graduate school. I would like to thank my fellow Fanucci group members for their friendship and support. I especially thank Dr. Jamie Kear, Dr. Mandy Blackburn, Mike Veloro, Ian de Vera, and Rochelle Huang for helpful discussions on the HIV 1 protease project and because of them I learned so much about biochemistry and biophysical techniques. I also thank Dr. Luis Galiano for conceptualizing the HIV 1 PR project. I acknowledge t he National High Magnetic Field Lab (NHMFL) in hous e research proposal (IHRP), National Institute of Health ( NIH ), National Science Foundation (NSF), and University of Florida (UF) Startup for funding.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDG E MENTS ................................ ................................ ............................... 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 11 LIS T OF ABBREVIATIONS ................................ ................................ ........................... 16 ABSTRACT ................................ ................................ ................................ ................... 21 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 23 Introduction t o HIV ................................ ................................ ................................ .. 23 HIV 1 Structure and Genome ................................ ................................ ........... 24 HIV 1 Life Cycle ................................ ................................ ............................... 25 Intro duction to HIV 1 Protease ................................ ................................ ................ 26 Structure and Function ................................ ................................ ..................... 26 Conformational Sampling of HIV 1 Protease ................................ .................... 28 HIV 1 Protease Cleavage Sites and Substrate Recognition ............................. 30 HIV 1 Protease Inhibitors ................................ ................................ ................. 32 HIV 1 Protease Variants and Subtype Polymorphisms ................................ .... 34 HIV 1 Protease Drug Resistant Variants ................................ .......................... 35 Mechanisms of drug resistance ................................ ................................ 38 Influence of protease cleavage site mutations on drug resistance ............. 39 Scope of Work ................................ ................................ ................................ ........ 40 Details of HIV 1 PR Constructs ................................ ................................ ........ 4 0 Previous Work on HIV 1 PR Constructs ................................ ........................... 41 Objectives of Work ................................ ................................ ........................... 43 Summary ................................ ................................ ................................ ................ 44 2 BACKGROUND ON TECHNIQUES ................................ ................................ ....... 56 Cloning and Protein Expression Systems ................................ ............................... 56 Site Directed Mutagenesis ................................ ................................ ...................... 59 Purification and Characterization of Proteins ................................ .......................... 61 Isolation of Proteins from Inclusion Bodies and Refolding ................................ 61 Chromatography ................................ ................................ ............................... 62 SDS PAGE ................................ ................................ ................................ ....... 64 Circular Dichroism (CD) Spectroscopy ................................ ............................. 65 Mass Spectrometry (MS) ................................ ................................ .................. 67 Electron Paramagnet ic Resonance (EPR) Spectroscopy ................................ ....... 67

PAGE 7

7 Site Directed Spin Labeling ................................ ................................ .............. 68 Continuous Wave EPR (CW EPR) ................................ ................................ ... 69 Double Electron Electron Resonance (DEER) Spectroscopy ................................ 71 DEER Data Analysis ................................ ................................ ........................ 73 Tikhonov Regul arization ................................ ................................ ................... 74 Background Subtraction and Self Consistent Analysis ................................ ..... 76 Gaussian Reconstruction ................................ ................................ ................. 78 3 CLONING AND MUTAGENESIS ................................ ................................ ............ 89 Materials and Methods ................................ ................................ ............................ 89 Cloning of HIV 1 PR PRE and POST Constructs ................................ ............. 89 Site Directed Mutagenesis of HIV 1 PR Constructs ................................ ......... 90 Results and Discussion ................................ ................................ ........................... 92 Cloning ................................ ................................ ................................ ............. 92 Mutagenesis ................................ ................................ ................................ ..... 94 4 PURIFICATION AND CHARACTERIZATION OF HIV 1 PROTEASE CONSTRUCTS ................................ ................................ ................................ ..... 104 Materials and Methods ................................ ................................ .......................... 104 Expression of HIV 1 PR ................................ ................................ .................. 104 Purification of HIV 1 PR ................................ ................................ .................. 105 Spin Labeling of HIV 1 PR ................................ ................................ .............. 107 SDS PAGE ................................ ................................ ................................ ..... 107 Circular Dichroism (CD ) Spectroscopy ................................ ........................... 108 Mass Spectrometry (MS) ................................ ................................ ................ 108 CW EPR ................................ ................................ ................................ ......... 109 Results and Discussion ................................ ................................ ......................... 109 SDS PAGE ................................ ................................ ................................ ..... 110 CD Spectroscopy ................................ ................................ ........................... 111 MS ................................ ................................ ................................ .................. 112 CW EPR ................................ ................................ ................................ ......... 113 5 DISTANCE MEASUREMENTS OF HIV 1 PROTEASE CONSTRUCTS .............. 132 Pr evious DEER Studies on HIV 1 PR ................................ ................................ ... 133 Materials and Methods ................................ ................................ .......................... 136 Sample Preparation for DEER Data Collection ................................ .............. 136 DEER Experiments ................................ ................................ ........................ 137 DEER Data Analysis ................................ ................................ ...................... 138 Results and Discussion ................................ ................................ ......................... 138 Comparison of HIV 1 PR Apo Constructs ................................ ....................... 139 Comparison of HIV 1 PR Constructs With and Without RTV .......................... 147 Experimental Limitations ................................ ................................ ................ 151 6 CONCLUSIONS AND FUTURE WORK ................................ ............................... 172

PAGE 8

8 Conclusions ................................ ................................ ................................ .......... 172 Future Work ................................ ................................ ................................ .......... 174 APPENDIX A PRIMER CHARACTERISTICS AND PCR PARAMETERS FOR MUTAGENESIS EXPERIMENTS ................................ ................................ ......... 175 B ADDITIONAL INFORMATION ON THE PURIFICATION AND CHARACTERIZATION OF HIV 1 PR CONSTRUCTS ................................ .......... 178 C POPULATION VALIDATION OF SELECTED HIV 1 PR CONSTRUCTS ............. 184 LIST OF REFERENCES ................................ ................................ ............................. 189 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 203

PAGE 9

9 LIST OF TABLES Table page 1 1 Various proteins expressed by the HIV 1 genes. ................................ ................ 46 1 2 Cleavage sites in HIV 1 polyproteins. ................................ ................................ 50 1 3 Protease inhibitor (PI) resistance associated mutations. ................................ .... 54 1 4 Sequence alignment of subtype B LA I, B si PRE i POST i V6 i and MDR769 i .... 54 1 5 Amino acid substitutions made on post therapy (POST) sequence. ................... 55 3 1 E. coli codo n optimized DNA and amino acid sequence of PRE. ....................... 97 3 2 E. coli codon optimized DNA and amino acid sequence of POST. ..................... 97 3 3 Namin g convention for HIV 1 PR constructs. ................................ ..................... 98 3 4 E. coli codon optimized DNA and amino acid sequence of PMUT1. ................. 98 3 5 E. coli codon optimized DNA and amino acid sequence of PMUT3. .................. 98 3 6 E. coli codon optimized DNA and amino acid sequence of PMUT2. .................. 99 3 7 E. coli codon optimized DNA and amino acid sequence of PMUT5. .................. 99 3 8 E. coli codon optimized DNA and amino acid sequence of B si .......................... 99 3 9 E. coli codon optimized DNA and amino acid sequence of B si I63P. ................ 100 4 1 Theoretical isoelectric points (pI) of HIV 1 PR constructs. ................................ 116 4 2 Standard parameters used for circular dichroism (CD) spectroscopy data collection. ................................ ................................ ................................ ......... 116 4 3 Standard parameters used for CW EPR data collection. ................................ .. 116 4 4 Theoretical MW of HIV 1 PR constructs with and without MTSL and MW determined from ESI MS analysis. ................................ ................................ ... 117 5 1 Standard parameters for DEER data colle ction. ................................ ............... 157 5 2 Parameters used for the pulse sequence. ................................ ........................ 157 5 3 Individual population profiles for PRE apo. ................................ ....................... 158 5 4 Individual population profiles for POST apo. ................................ .................... 159

PAGE 10

10 5 5 Individual population profiles for PMUT1 apo. ................................ .................. 160 5 6 Individual population profiles for B si apo. ................................ .......................... 161 5 7 Individual population profiles for B si I63P apo. ................................ .................. 162 5 8 Summary of most probable distance of HIV 1 PR apo constructs. ................... 163 5 9 Comparison of relative percentages of the individual populations for HIV 1 PR PRE apo at different values. ................................ .......................... 165 5 10 Comparison of the relative percentages of the individual populations for HIV 1 PR apo constructs. ................................ ................................ ................. 166 5 11 Individual pop ulation profiles for PRE RTV. ................................ ...................... 168 5 12 Individual population profiles for POST RTV. ................................ ................... 169 5 13 Comparison of relative percentages of the individual populations for PRE and POST HIV 1 PR constructs in the absence and presence of RTV. .................. 170 A 1 Primers to produce the pET23_ PMUT1 construct. ................................ .......... 175 A 2 Primers to produce the pET23_ PMUT3 construct. ................................ .......... 175 A 3 Primers to produce the pET23_ PMUT2 construct. ................................ .......... 175 A 4 Primers to produce the pET23_ PMUT5 construct. ................................ .......... 176 A 5 Primers to produce the pET23_ B si I63P construct. ................................ .......... 176 A 6 Components of the PCR mixture ................................ ................................ ...... 176 A 7 Thermal cycling parameters for HIV 1 protease site directed mutagenesis reactions. ................................ ................................ ................................ .......... 177 B 1 Buffers used in the purification of HIV 1 PR. ................................ .................... 178 B 2 Optical density at 280 nm and estimated protein concentration of HIV 1 PR samples used for CD data collection. ................................ ............................... 1 78 B 3 Optical density at 280 nm and estimated concentration of HIV 1 PR samples used for EPR data collection ................................ ................................ ............ 179

PAGE 11

11 LIST OF FIGURES Figure page 1 1 The ass embly of viral proteins and other constituents in HIV 1. ......................... 45 1 2 Schematic diagram of the HIV 1 genome ................................ ........................... 45 1 3 Viral life cycle of HIV 1.. ................................ ................................ ..................... 47 1 4 Structural assembly of HIV 1 from an immature to a mature virus. .................... 47 1 5 Ribbon diagrams of HIV 1 PR highlighting the main regions. ............................. 48 1 6 ................................ ................................ ...... 48 1 7 Crystal structures of HIV 1 PR in the closed conformatio n. ................................ 49 1 8 Molecular dynamics (MD) simulation structures of HIV 1 PR.. ........................... 49 1 9 Schematic representation of HIV 1 gag and gag pol p olyproteins. ..................... 50 1 10 Chemical structure of HIV 1 PR substrate ................................ .......................... 50 1 11 Substrate binding pocket of HIV 1 protease. ................................ ...................... 51 1 12 Various types of HIV 1 inhibitors ................................ ................................ ......... 51 1 13 Chemical structures of the FDA approved HIV 1 protease inhibitors. ................ 52 1 14 General classification of HIV. ................................ ................................ .............. 53 1 15 Sequence variation of protease inhibitor (PI) nave and treated isolates of subtype B HIV 1 PR. ................................ ................................ .......................... 53 1 16 Ribbon diagrams of HIV 1 PR PRE, POST, V6, and MDR769 ........................... 55 2 1 Example of vector map ................................ ................................ ....................... 80 2 2 Host and vector elements essential in protein overexpression. .......................... 80 2 3 pET23a vector map. ................................ ................................ ........................... 81 2 4 Structure of isopropyl D 1 thiogalactopyranoside ( IPTG). ............................... 81 2 5 Various steps in site directed mutagenesis ................................ ........................ 81 2 6 Typical circular dichrois m (CD) spectra. ................................ ............................. 82

PAGE 12

12 2 7 Energy diagram representing the Zeeman Effect. ................................ .............. 82 2 8 Chemical modification of t he protein side chain ................................ .................. 83 2 9 Typical EPR spectrum of a system with electron spin state of m s = ............. 83 2 10 Energy diagram and EPR spectrum of a system wi th an electron spin state of m I = 0, 1. ................................ ................................ ................................ ........... 83 2 11 EPR line shapes representing various modes of spin motion. ............................ 84 2 12 Pulse sequen ce of the four pulse DEER experiment.. ................................ ........ 84 2 13 Illustration of the intramolecular and intermolecular interactions in doubly labeled HIV 1 protease ................................ ................................ ...................... 85 2 14 Plot of the experimental dipolar evolution function ................................ ............. 85 2 15 Pake pattern obtained by Fourier transformation. ................................ ............... 86 2 16 Example of an L curve ................................ ................................ ........................ 86 2 17 Flow chart of the Self Consistent Analysis (SCA) method ................................ .. 87 2 18 Example of popula tion validation process. ................................ ......................... 88 3 1 Map of or iginal vector containing the Pre i K55C and Post i K55C HIV 1 PR DNA inserts. ................................ ................................ ................................ ....... 97 3 2 DNA gel of pET23a plasmid containing PRE and POST HIV 1 PR DNA. ........ 100 3 3 Sample DNA gel after Dpn I digestion. ................................ .............................. 101 3 4 DNA gel of pET2 3_PMUT1. ................................ ................................ ............. 101 3 5 DNA gel of pET23_PMUT3. ................................ ................................ ............. 102 3 6 DNA gel of pET23_PMUT2. ................................ ................................ ............. 102 3 7 DNA gel of pET23_PMUT5. ................................ ................................ ............. 103 4 1 SDS PAGE gel of PRE. ................................ ................................ .................... 117 4 2 SDS PAGE gel of POST. ................................ ................................ ................. 118 4 3 SDS PAGE gel of PMUT1. ................................ ................................ ............... 118 4 4 SDS PAGE gel of PMUT3. ................................ ................................ ............... 119

PAGE 13

13 4 5 SDS PAGE gel of PMUT2 ................................ ................................ ............... 119 4 6 SDS PAGE gel of PMUT5. ................................ ................................ ............... 120 4 7 SDS PAGE gel of B si ................................ ................................ ....................... 120 4 8 SDS PAGE gel of B si I63P.. ................................ ................................ .............. 121 4 9 SDS PAGE gel of spin labeled HIV 1 PR constructs. ................................ ....... 121 4 10 Circular dichroism spectra f or spin labeled HIV 1 PR constructs ...................... 122 4 11 Mass spectra of spin labeled PRE. ................................ ................................ ... 123 4 12 Mass spectra of spin labeled POST. ................................ ................................ 124 4 13 Mass spectra of spin labeled PMUT1. ................................ .............................. 125 4 14 Mass spectra of spin labeled PMUT3. ................................ .............................. 126 4 15 Mass spectra of spin labeled PMUT2. ................................ .............................. 127 4 16 Mass spectra of spin labeled PMUT5. ................................ .............................. 128 4 17 Mass spe ctra of spin labeled B si ................................ ................................ ...... 129 4 18 Mass spectra of spin labeled B si I63P. ................................ ............................. 130 4 19 CW EPR spectra for spin labeled HIV 1 PR cons tructs ................................ .... 131 5 1 HIV 1 PR crystal structures w ith spin labels at the K55C / ............. 154 5 2 Dipolar evolution curves and distan ce distribution profiles for apo and RTV bound subtype B HIV 1 PR ................................ ................................ ..... 154 5 3 Distance distribution profiles of subtype B HIV 1 PR apo and with inhibitors ... 155 5 4 Dipolar evolution curves and distance distributio n profiles for subtype B apo, V6, and MDR769 ................................ ................................ .............................. 155 5 5 Distance distribution profiles of apo forms of HIV 1 PR su btype B, C, F, CRF01_A/E and multi drug resistant constructs, V6 and MDR769 .................. 156 5 6 Absorption spect ra for a nitroxide spin label. ................................ .................... 156 5 7 DEER data analysis for PRE apo. ................................ ................................ .... 158 5 8 DEER data analysis for POST apo.. ................................ ................................ 159

PAGE 14

14 5 9 DEER data analysis for PMUT1 apo.. ................................ .............................. 160 5 10 DEER data analysis for B si apo.. ................................ ................................ ...... 161 5 11 DEER data analysis for B si I63P apo.. ................................ .............................. 162 5 12 Dipolar evolution curves and distance distribution profiles of HIV 1 PR PRE, POST, PMUT1, B si and B si I63P apo constructs. ................................ ............. 163 5 13 Overlay of distance distr ibution profiles of HIV 1 PR apo constructs with B si ... 164 5 14 Overlay of di stance distribution profiles between HIV 1 PR apo constructs ..... 164 5 15 Dipolar evolution curves individual Gaussian populations, and L curves at different values ................................ ................................ .............................. 165 5 16 R elative percentage of individual populations for HIV 1 PR PRE, POST, P MUT1, B si and B si I63P apo constructs.. ................................ ....................... 166 5 17 Population analysis of HIV 1 PR PRE, POST, PMUT1, Bsi, and Bsi I63P apo constructs. ................................ ................................ ................................ ....... 167 5 18 Ribbon diagrams of HIV 1 PR PRE and POST ................................ ................ 167 5 19 DEER data analysis for PRE RTV.. ................................ ................................ .. 168 5 20 DEER data analysis f or POST RTV.. ................................ ................................ 169 5 21 Overlay of dipolar evolution curves and distance distribution profiles of PRE apo and PRE RTV and POST apo and POST RTV ................................ .......... 170 5 22 Relative percentage of individual populations for PRE and POST HIV 1 PR constructs in the absence and presence of RTV ................................ ............. 171 5 23 Change in relative percent of individual populations for PRE and POST HIV 1 PR constructs in the absence and presence of RTV. ................................ ....... 171 B 1 Calibration curve of 4 oxo TEMPO standard ................................ .................... 179 B 2 CW EPR spectra for spin labeled HIV 1 PR PRE, POST, and PMUT1 ............ 180 B 3 Mass spectra of spin labeled PRE. ................................ ................................ ... 181 B 4 Mass spectra of spin labeled POST.. ................................ ............................... 182 B 5 Mass spectra of spin labeled PMUT1. ................................ .............................. 183 C 1 Population validation of PRE apo. ................................ ................................ .... 184

PAGE 15

15 C 2 Population validation of PRE RTV. ................................ ................................ ... 185 C 3 Population validation of POST RTV. ................................ ................................ 186 C 4 Population validation of PMUT1 apo. ................................ ............................... 187 C 5 Population validation of B si I63P apo. ................................ ............................... 188

PAGE 16

16 LIST OF ABBREVIATION S AIDS Acquired immune deficiency syndrome A Adenine Ala (A) Alanine A mp Ampicillin APV Amprenavir Rev Anti repression transactivator p rotein APT Approximate Pake transf ormation Arg (R) Arginine Asn (N) Asparagine Asp (D) Aspartic acid ATV Atazanavir AZT D (+) azido deoxythymidine B la lactamase BME mercaptoethanol B Bohr magneton (9.27400949 10 24 JT 1 ) CA Capsid CD Circular dichroism CRF Circular recombinant form CD4 Cluster of differentiation 4 CW EPR Continuous wave electron paramagnetic resonance Cys (C) Cysteine C Cytosine Da Dalton DRV Darunavir

PAGE 17

17 dNTP Deoxynucleotide triphosphate DNA Deoxyribonucleic acid DSC Differential scanning calorimetry DMSO D imethylsulfoxide DTT Dithiothreitol DEER Double electron electron resonance dsDNA Double stranded DNA EI Electron impact EPR Electron paramagnetic resonance ESE Electron spin echo ESI Electrospray ionization Env Envelope EDTA Ethylenediaminetetraacetic acid FPV Fosamprenavir FWHM Full width at half maximum Glu (E) Glutamic acid Gln (Q) Glutamine Gly (G) Glycine gp Glycoprotein diGly (Gly Gly) G lycylglycine (2 [(2 ami noacetyl)amino]acetic acid) Gag Group specific antigen G Guanine g G yromagnetic ratio or spectroscopic factor HAART Highly active antiretroviral therapy His (H) Histidine

PAGE 18

18 HIV Human immunodeficiency virus IB Inclusion body IDV Indinavir IN I ntegrase pI Isolectric point Ile (I) Isoleucine IPTG Isopropyl D thiogalactoside ITC Isothermal titration calorimetry kDa K ilo d alton LSB Laemmli sample buffer Leu (L) Leucine LBF Local backbone fluctuations LPV Lopinavir LB Luria Bertani Lys (K) Lysine B Magnetic field MHC Major histocompatibility complex m e M ass of electron (9.109 x 10 31 kg) MS M ass spectrometry MA Matrix T m Melting temperature mRNA M essenger RNA MTSL ( 1 oxy 2,2,5,5 tetramethylpyrrolinyl 3 methyl ) methanethiosulfonate Met (M) Methionine MD Molecular dynamics

PAGE 19

19 MW Molecular weight MC Monte Carlo MCS Multiple cloning site Nef Negative factor protein NFV Nel finavir NNRTI Non nucleoside reverse transcriptase inhibitor NMR Nuclear magnetic resonance NOE Nuclear Overhauser effect NC Nucleocapsid NRTI Nucleos(t)ide reverse transcriptase inhibitor ORF Open reading frame OD Optical density O ri Origin of replication Phe (F) Phenylalanine h 34 m 2 kg/s) PAGE Polyacrylamide gel electrophoresis PES Polyethersulfone Pol Polymerase PCR Polymerase chain reaction POST Post therapy PRE Pre therapy Pro (P) Proline PR Protease PI Protease inhibitor PDB Protein Data Bank

PAGE 20

20 e Proton electric charge (1.60217653 10 C) RT Reverse transcriptase RNA Ribonucleic acid RTV Ritonavir SQV Saquinavir SCA Self consistent analysis Ser (S) Serine SNR Signal to noise ratio SDSL Site directed spin labeling SEC Size exclusion chromatography SDS Sodium dodecyl sulfate SU Surface Thr (T) Threonine T Thymine TKR Tikhonov regularization TPV Tipranavir Tat Transactivating regulatory protein TM Transmembrane Trp (W) Tryptophan Tyr (Y) Tyrosine UV Vis Ultraviolet Visible Val ( V) Valine Vpr Viral protein R Vpu Viral protein U Vif Virion infectivity factor

PAGE 21

21 A bstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science PURIFICATION AND CHA RACTERIZATION OF A P RE THERAPY HIV 1 PROTEASE VARIANT AND VARIANTS CONTAINING DRUG PRESSURE SELECTED MUTATIONS FOR ELECTR ON PARAMAGNETIC RESO NANCE (EPR) STUDIES By Estrella Garlit G onzales August 2011 Chair: Gail E. Fanucci Major: Chemistry Human Immunodeficiency Virus (HIV) is the i nfectious agent that causes AIDS (Acquired Immune Deficiency Syndrome). HIV Type 1 protease (HIV 1 PR) is the enzyme essential in the maturation of th e virus. Many anti retroviral drugs target HIV 1 PR to prevent formation of the mature, infectious particle Recently, protease inhibitors (PI) have been ineffective in the treatment of AIDS because of the emergence of drug resistant variants of HIV 1 PR. Thus, the structure of HIV 1 protease and its interaction with substrates and inhibitors have been continually studied. Of particular interest is the flap region of HIV 1 PR, in which its flexibility allows it to adopt a variety of conformations and therefore control access of substrate or inhibitor. Moreover, naturally occurring polymorphisms and drug pressure selected mutations may have some impact on the flap conformation and flexibility. Several techniques have been used to sample the conform ations of HIV 1 PR including pulsed electron paramagnetic resonance (EPR) methods. In this work, double electron electron resonance (DEER) spectroscopy i s used to characterize the flap conformation and flexibility of a

PAGE 22

22 pre therapy variant of HIV 1 protease and several variants containing drug pressure selected mutations. The primary HIV 1 PR variants in this work are referred to as pre therapy (PRE i ) and post therapy (POST i ). These constructs were cloned into a vector suitable for bacterial expression of t he protease. Mutagenesis was carried out on the POST i variant to obtain several constructs containing drug pressure selected mutations. The HIV 1 PR constructs were purified spin labeled and subsequently characterized by sodium dodecylsulfate polyac rylamide gel electrophoresis ( SDS PAGE ) circular dichroism ( CD ) spectroscopy, mass spectrometry (MS) and continuous wave electron paramagnetic resonance ( CW EPR ) spectroscopy. DEER analysis was performed on inactive PRE i POST i POST i A82V B si (stabilized, inactive form of subtype B LAI), and B si I63P apo constructs Analysis of DEER data reveal s the conform ational states of HIV 1 PR corresponding to the tucked/curled, closed, semi open, and wide open conformations. Results have shown variations in the most probable distance and predominant conformations of the different HIV 1 PR variants. The se results have demonstrated that drug pressure selected mutations can alter the flap conformation and flexibility of HIV 1 PR DEER analysis was also done on the PRE i and POST i constructs after a ddition of a proteas e inhibitor, ritonavir ( RTV ) Overall, DEER is a powerful technique for monitoring the effect of drug pressure selected mutations and addition of inhibitor on the flap conformation and flexibility of HIV 1 protease.

PAGE 23

23 CHAPTER 1 INTRODUCTION Introduction to HIV H uman immunodeficiency virus (HIV) is the infectious particle that causes AIDS (Acquired Immune Deficiency Syndrome), a clinical cond ition that involves the suppression of the human immune system and progressively leads to opportunistic infections and rare cancers. Since its discovery, the number of people infected with HIV has increased in tremendous rates and AIDS has evolved into a g lobal epid emic In the last decade, the annual number of new HIV infections has decreased and because of the development of antiretroviral therapy the number of AIDS related deaths has been reduced. Although the figures have been steadily declining since the late 1990s a considerable percentage of the world population is presently living with HIV. In 2009, about 33.3 million people are HIV infected, 68% of which come from the Sub Saharan Africa ( 1 ) HIV belongs to the Lentivirus family, a subfamily of the retroviruses, wh ich possess a positive single stranded messenger RNA ( 2 ) Retroviruses rely on a host cell for reproduction of their genomic RNA. Upon infection of a host cell, viral RNA is reverse transcribed into DNA integrated into the host cell genome and replicated by the host cell machinery Lentiviruses are associated with a disease having a long incubation period and lead ing to immune suppression HIV exists as HIV 1 and HIV 2. Although these two types of HIV share only 40% sequence homology, they have identical morphological and genomic organizations ( 3 ) The replication cycle is similar and both viruses lead to immunological failure and similar clinical manifestations upon infection. However, based on epid emiologic, clinical, and

PAGE 24

24 virologic data, HIV 2 is shown to be less virulent than HIV 1. HIV 2 infection is characterized by a long asymptomatic period and lower transmission rate ( 4 ) HIV 1 Structure an d Genome The HIV t ype 1 (HIV 1) virus shown in Figure 1 1, has a cone shaped core containing the viral capsid (CA) protein. The capsid contains two identical RNA strands that are closely associated with the viral RNA dependent DNA polymerase (Pol), also called reverse transcriptase (RT), and the nucleocapsid (NC) proteins ( 2 ) A gp120 external surface (SU) protein connected noncovalently to a gp41 transmembrane (TM) prote in and embedded in the lipid bilayer constitute the e nvelope glycoproteins, which surround the viral surface. The inner membrane of the virus consists of the matrix (MA) protein that provides integrity to the virus. The HIV 1 genome, which is shown in F igure 1 2, is about 9.8 kb and consists of open reading frames (ORF) that code for several viral proteins ( 2 ) It is a full length viral mRNA, which is translated into the gag and gag pol proteins ( 2, 5 ) Table 1 1 summarizes the various viral proteins and their function and localization ( 6 ) The three major structural proteins MA (p 17) CA (p24) and NC (p7) are encoded by the gag gene while the pol gene encodes the viral enzymes. The gag precursor p55 produces the smaller proteins p17, p24, p7, and p6 by proteolytic cleavage The gag pol precursor protein is cleaved into products consisting of the reverse transcriptase (RT), protease (PR), and integrase (IN) proteins. PR processes the gag and gag pol polyproteins and IN is involved in virus integration. The env gene produces the envelope proteins, which are vital for the recogniti on and binding of virus to the host cell. The envelope gp120 and gp41 are made from precursor gp160, which is a mono spliced RNA from the full length viral mRNA. Tat and rev code for viral regulatory

PAGE 25

25 proteins that are involved in upregulating HIV replicat ion and enhancing expression of viral proteins respectively. Nef encodes a negative factor protein, which serves multiple functions including viral suppression and downregulation of CD4 and MHC Class I molecules The genes, vif vpr and vpu produce acces sory proteins, which promote viral replication assembly, and budding; viral infectivity; degradation of CD4 cells ; and the overall suppression of the cell immune response ( 2 ) HIV 1 Life Cycle Figure 1 3 illustrates the steps involved in viral replication and maturation of HIV 1 ( 7 ) The cycle begins w ith the attachment of the mature virion to the host cell by binding of gp120 to the CD4 receptor (Step 1). After fusion (Step 2), the capsid is uncoated and the virus releases the RNA, reverse transcriptase, integrase, and other viral proteins into the hos t cell cytoplasm. The genomic RNA is then reverse transcribed by RT into a double stranded DNA (Step 3). The viral DNA is transported across the nucleus and integrated into the host cell genome by IN (Step 4). The HIV DNA formed is referred to as the provi rus, which can be inactive for several years. Upon activation of proviral DNA, RNA polymerase in the host cell produces copies of the HIV genetic material and shorter messenger RNA serve as the template for translation into the viral proteins (Step 5). The viral proteins and RNA then assemble into an immature virus. In step 6, a budding event occurs, wherein the virus exits and uses the cell surface as an envelope to form its outer membrane. Eventually, the polyproteins within the non infectious virus are c leaved by HIV protease and reorganized to form the mature virus (Step 7). Figure 1 4 shows the structural assembly of the immature and mature HIV 1.

PAGE 26

26 Introduction to HIV 1 Protease The role of HIV 1 protease (PR) in the viral life cycle is to form a matur e, infectious virus by post translational processing of the gag and gag pol polyproteins. Anti retroviral drugs have been used against HIV 1 to prevent formation of the mature, infectious particle In particular, HIV 1 protease inhibitors (PI) have been sh own to inhibit post translational processing, block HIV 1 replication, and reduce viral load ( 8 ) Despite th eir potency, anti retroviral drugs have become ineffective against emerging drug resistant variants of HIV 1 PR ( 9 ) Thus, there is the continuing need to examine the structure of HIV 1 PR and its interactions with various substrates and inhibitors in order to design more effec tive drugs. Structure and Function Human immunodeficiency virus type 1 (HIV 1) protease (EC 3.4.23.16) is a member of the aspartic protease family ( 10 ) It is composed of two noncovalently associated, structurally identical monomers, where each monomer consists of 99 amino acids ( 11 ) In retroviral proteases, each monomer is generally composed of four structural elements: A1 and A2 loop, B1 and B2 loop, C1 and C2 helix, and the D1 and D2 loop, as indicated in Figure 1 5A ( 12 15 ) In HIV 1 protease, all of these elements are present except that a loop replaces the helix C1. The B1 loop contains the catalytic aspart hairpins, which are functionally important because of their flexibility and involvement the helix C 1 and the flap and the region between the flap and A2. The dimerization domain consists of a four stranded sheet interface that is formed by the amino and

PAGE 27

27 carboxyl termini of both monomers. A typical X ray crystal structure of HIV 1 protease is shown in Figure 1 5B, in which the key regions are labeled To date, there are over 400 structures deposited in the Protein Data Bank (PDB) ( http://www.pdb.org ) including structures of the apo enzyme and substrate or inhibitor bou nd HIV 1 PR The active site region of the protease is primarily formed by residues 25 32, 47 53, and 80 84, in which are the major catalytic residues indicated in Figure 1 5B ( 16 ) The conserved active site residues include the catalytic triad Asp25 Thr26 Gly27 which form a loop and stabilized by a network of hydrogen bonds ( 18 ) The O 1 atoms in t he Asp25 / carbo xylate groups interact closely and form a nearly co planar arrangement. The hydrogen bonding network forming the interaction between Asp25, Thr26, and Gly27 is referred to as the grip as illustrated in Figure 1 6. The O 1 atom of each Thr26 is protonated by the amide group of the opposite Thr26 residue and deprotonated by the carboxyl group of residue 24 in the opposite loop ( 14 ) Structures of HIV 1 protease were determined crystallographically in various conformations. The first X ray cry stal structures of the apoenzymes were reported at 2.7 to 3.0 resolution ( 19 22 ) In most of the crystal structures without ligand, HIV 1 protease is usually found in an open conformation, in which the flaps are s lightly oriented away from the active site ( 15 ) The binding of substrate or inhibitor requires a substantial movement of the flaps to form into a closed conformation ( 23, 24 ) The flaps shift by as much as 7 and the subunits rotat e by about 2 around the axis along the subunit sheet interface ( 14, 25 27 ) I n th e closed conformation, the flap residues are interacting strongly with substrate or inhibitor and therefore access to the active site is

PAGE 28

28 blocked. T he closed conformation of HIV 1 PR shown in Figure 1 7, illustrates t he inaccessibility of the active si te to substrate or inhibitor Conformational Sampling of HIV 1 Protease HIV 1 protease undergoes conformational changes due to the intrinsic flexibility of its flaps ( 23, 24 ) The flaps of unliganded HIV 1 PR are described as having an ensemble of various conformational states in dynamic equilibrium which include predominantly semi open states and small populations of closed and w ide open conformations ( 28 ) Studies on the crystal stru ctures of HIV 1 PR and other retroviral proteases have revealed that the semi open conformation is the most thermodynamically stable ( 14 ) Various other techniques have been used to describe the different HIV 1 PR flap conformations including nuclear magn etic resonance (NMR) spectroscopy, isothermal titration calorimetry (ITC), and molecular dynamics (MD) simulations ( 28 43 ) NMR studies have been performed on free and bound HIV 1 protease to study flap dynamics ( 28 32 ) NMR relaxation experiments have shown that transverse relaxation rates of backbone amides of HIV 1 protease are relatively higher in the flap region of the free protease ( 28 ) This indicates that without substrate/inhibitor, the HIV 1 PR flaps are relatively flexible in the millisecond microsecond times cale corresponding to conformational exchange. In the inhibitor bound protease, the flaps, with the exception of residues 50 and 51, are rigid in solution ( 43 ) A more recent study by Freedberg et al. has shown relaxation and nuclear Overhauser effect (NOE) data indicating that flaps are flexible in the sub nanosecond (ns) timescale, which is faster than overall tumbling of protein ( 29 ) The sub ns fluctuations of the flap tips (residues 49 53) reflect a

PAGE 29

29 dynamic equilibrium between the ensemble of semi open conforma tion al states and possibly including minor populations of the closed and wide open conformations. Differential scanning calorimetry (DSC) and isothermal titration calorimetry (ITC) have been used to study the stability of HIV 1 protease and monitor struct ural changes upon binding of ligand. The combination of DSC and ITC provides an accurate means of determining thermodynamic binding constants of protease inhibitor complexes. DSC and ITC studies have revealed that the dimeric structure of HIV 1 PR is stabi lized by inhibitor binding in an entropically driven process ( 33 36 ) Structure based analysis of binding energetics have shown that residues in the active site and the flap region have the greatest van der Waals contacts with the inhibitor and therefore contribute more to the energetics of binding ( 34 ) Todd et al. examined the extent of stabilization upon inhibitor binding by determining the residue stability constant, which is a statistical measure of the probability of a residue to be either in a folded or unfolded state ( 33, 34 ) It has been established that the central part of the protease, which includes the dimer interface and adjacent areas, defines the most stable region of the protease Meanwhile, the flap region corresponds to the most unstable part of the protein and upon inhibitor binding, the flaps are forced into a conformation which allows direct interaction with the inhibitor. Unlike X ray, which reveals only a single protein conformation, and NMR, which detects the average conformation, molecular dynamics (MD) simulation experiments sample the flap closing and opening events in HIV 1 PR ( 37 ) MD simulation studies were the first to provide a structure for the wide open conformation ( 38, 39 ) Hornak et al. performed simulations on ligand free HIV 1 PR using a low viscosity imp licit solvent

PAGE 30

30 to characterize the transition from a closed to semi open conformation ( 37 ) The simulations reveal that the unligan ded HIV 1 PR adopts a semi open flap conformation and transiently forms into the closed conformation with reversal of flap handedness, as seen in Figure 1 8. Several flap opening events were observed, including the wide open conformation, in which the dis 30 . Such open state exists transiently and reverts back to the predominant semi open form. Hornak et al. also studied the effect of manual docking of inhibitor into the open state of HIV 1 PR and they observed s pontaneous conversion of the protease into the closed form ( 40 ) X ray crystal structures and o ther MD simulation studies have shown that flaps can adopt a curled or tucked conformation, which constitute only a small fraction of the conformational ensemble of HIV 1 PR ( 41, 42, 44 ) Recently Double Electron Electron Resonance (DEER) spectroscopy has been utilized by our group to examine flap conformations of different HIV 1 PR var iants ( 45 51 ) DEER results obtained by our group will be described in further detail in Chapter 5. HIV 1 Protease Cleavage Sites and Substrate Recognition HIV 1 proteas e binds to at least ten natural substrates, whose amino acid sequences are given in Table 1 2 The substrates do not have sequence homology and are asymmetric around the cleavage sites in both size and charge distribution ( 52 ) According to the nomenclature of Schechter and Berger ( 53 ) the subsites within the substrate/inhibitor are represented as P4 P3 P2 represents the scissile bond or cleavage site The residues on the N terminal side of the scissile bond are unprimed while the C terminal residues are primed ( 14 ) The

PAGE 31

31 Figure 1 9 shows an illustration of gag and gag pol polyprotei ns and the corresponding cleavage sites. The order in which HIV 1 protease recognizes and cleaves gag and gag pol polyprotei ns is not well established ( 14 ) However, it is known th at the initial cleavage occurs between p6 gag po l and PR (site VIII), which is essential for the release of PR ( 54 ) There is some evidence that the first target of HIV 1 PR is located on the p2/ NC (site III) ( 55, 56 ) The last and slowest step is the cleavage of the CA/ p2 (site II) ( 57, 58 ) Sequence v ariability within the recognition sites may affect rates of cleavage and impact protease activity ( 59 ) The mechanism of enzyme action of HIV 1 PR, commonly called the mechanism is described by a classic acid base catalysis ( 60 ) It involves a water molecule that protonates the carboxy l groups of Asp25 in both monomers. A proton from the carboxyl dyad is then t ransferred to the P1 carbonyl oxygen of the substrate, where the peptide bond is eventually cleaved As shown in Figure 1 10, the mechanism involves a tetrahedral intermediate which is mimicked in most of the currently used licensed protease inhibitors. I n HIV 1 protease, r esidues 8, 23, 25, 27 30, 32, 47 50, 53, 76, 80 82 and 84 form the substrate binding pocket as depicted in Figure 1 11 ( 61 ) Figure 1 11B shows the specific residues in the protease that interact with the substrate subsites. Substrate binds to the protease in an extended strand conformation, wherein several hydrogen bonds form between the backbones of substrate and protease to facilitate binding ( 52 ) The sites between the P 2 positions on the substrate directly bridge the enzyme which comprises residues 28 30, 32, 47, 49 50, 76, and 84, is smaller compared to the other binding sites and is known to be specific

PAGE 32

32 ( 14 ) This limits the that can bind the pocket ( 62, 63 ) Like substrates, p rotease inhibitors were designed so that the P 2 residues form strong interactions with the enzyme binding site ( 14 ) The emergence of a mutation in the active site can disrupt inhibitor binding at independent sites between the P 2 region ( 52 ) This led Schiffer et al. to structurally examine substrate recognition by HIV 1 protease T he ir structural studies have shown that most of the substrates within the active site pocket adopt a toroid shape on the unprimed side (P1 to P3 region) and ( 52 ) From this finding they have suggested that the enzyme recognizes substrates based on shape and accessibility rather than the amino acid sequence. They to fit well within the active site region. HIV 1 Prot ease Inhibitors There is no definitive cure or vaccine against AIDS; however, HIV infection can be treated using clinically licensed drugs ( 16, 61 ) C urrentl y, there are 25 anti retroviral drugs in the market that target different steps in the HIV 1 life cycle (Figure 1 12). These are 1) coreceptor antagonists and fusion inhibitors, which target viral entry, 2) nucleos(t)ide and non nucleoside reverse transcri ptase (RT) inhibitors (NRTI and NNRTI), which block reverse transcription, 3) integrase inhibitors, which prevent integration of viral DNA into the host cell genome, and 4) protease inhibitors (PI), which hinder viral maturation ( 61 ) Zidovudine or AZT ( (+) azido deoxythymidine), an RT inhibitor release d in 1989, was the first drug to be approved for the treatment of AIDS and HIV infection. The current regimen for HIV infection uses highly active

PAGE 33

33 anti retroviral therapy (HAART), which consists of a combination of licensed NRTI/NNRTI and/or PI. HIV 1 PR inhibitors were originally designed based on classical substrates or transition state analogs and are modeled from the peptidomimetic inhibitors for the related aspartic protease, renin. However, m echanism base d screening of renin inhibitors and peptide mixtures has resulted in l imited success in identifying HI V 1 PR inhibitors. 1 protease was the first therapeutic target ( 64 ) The protease inhibitors are generally designed such tha t the P2 ( 60 ) To date, there are ten protease inhibitors approved by the United States Food and Drug Administration (FDA), namely saquinavir (SQV), ritonavir (RTV), indinavir (IDV), nelfinavir (NFV), amprenavir (APV), fosamprenavir (FPV), lopina vir (LPV), atazanavir (ATV), tipranavir (TPV), and darunavir (DRV) ( 60, 65, 66 ) The chemical structures are shown in Figure 1 13. All are competitive active site inhibitors that bind with affinities to the purified enzyme ranging from low nanomolar to picomolar ( 60 ) With the exception of tipranivir and darunavir, protease inhibitors are pept idomimetics, which were designed based on the transition state formed as a result of protease substrate interaction (Figure 1 10). They are composed of non cleavable, dipeptide isosteres as core scaffolds and commonly contain a secondary hydroxyl group, wh ich substitutes the P1 carbonyl moiety of substrates ( 16 ) The hydroxyl at the P1 site of the inhibitor is essential for tight binding with the protease by forming interactions with the catalytic inhibitor complex is a

PAGE 34

34 conserved water molecule that mediates co ( 27 ) HIV 1 Protease Variants and Subtype Polymorphisms Given the relatively small size of HIV 1 protease, the sequence variability in HIV 1 protease is presumably limited (67) However, recent data from the Los Alamos HIV database reveals an abundance of gene s equences derived from clinical isolates (68) The variability in the genetic sequence of HIV 1 protease is primarily due to the high mutation rate resulting from the lack of proofreading ability of viral reverse transcriptase. In reverse transcription, at least one nucleotide substitution occurs for every three rounds of replication (~10 4 to 10 5 mutations per nucleotide per cycle of replication), on average (69) Other factors of g enetic variation include the high in vivo rate of HIV replication, high frequency of recombination, and the accumulation of variants during the course of infection (11) The HIV 1 virus may be subjected to additional selective pressures, such as anti retroviral therapy, that contribute to genetic differences between isolates within an individual and between individuals (15) There is no prototype or consensus wild type HIV 1 protease but rather a complex mixture of related sequences (55) HIV 1 protease sequences that arise from naturally occurring polymorphisms are classified into groups, subtypes (or clades), and circulating recombinant forms (CRFs), as shown in Figure 1 14 ( 70 ) Groups refer to the viral lineage. The most common is Group M (major), which comprises at least nine distinct subtypes : A D, F H, J, and K, and several CRFs. The subtypes refer to the taxonomic groups within a particular lineage whereas CRFs refer to various recombinant forms of the virus that arise from

PAGE 35

35 the genetic combination of two viral subtypes ( 68 ) Group O viral strains can be found in west central Africa and groups N and P, which were discovered in Cameroon, are extremely rare ( 11 ) Historically, the most common HIV 1 subtype is B, which is prevalent in North Ame rica, Western Europe, and Australia (11) The subtype B isolates have been widely studied for drug screening and susceptibility testing. However, they account for only a small portion of HIV 1 isolates worldwide. The majority of HIV 1 infection relat ed cases, which occur in the sub Saharan Africa, is primarily caused by subtype C HIV 1 (1, 11) Recently, other subtypes have become more frequent and account for about 25% of HIV infected patients, particularly in Europe (71) The Los Alamos HIV database contains several sequences of the subtype B viral genome (68) The most widely studied sequence is HXB2 (Accession Number K03455), a specific clone from the French isolate LAI, which does not have any identical match to sequences of other patient derived isolates (72) The use of HXB2 (or LAI) as a consensus reference sequence is based on historical precedence (73) HIV 1 Protease Drug Resistant Variants HIV 1 protease drug resistant variants evolve from the selective pressure of protease inhibitor (PI) therapy ( 15 ) The emergence of these variants has led to the failure of most anti retroviral drugs ( 9 ) Almost half of the amino acid residues of these drug resistant variants arise from the accumulation and pers istence of multiple mutations, which lead to drug resistance ( 16, 74 76 ) Drug resistant variants have reduced sensitivity and affinity to protease inhibitors (PI), but still maintain their ability to bind and process natural substrates ( 16 )

PAGE 36

36 The Stanford HIV database maintains a collection of the sequences of various HIV 1 protease isolates ( 74 ) A comparison of the HIV 1 PR subtype B sequences from PI treated and untreated (PI nave) patients reveals variations in several conserved regions of the protease (Figure 1 15). This suggests that exposure to inhibitor contributes to the prevalence of mutations in HIV 1 PR in sites that are functionally important in substrate binding and catalysis, such as the active site and flap regions. There is also a noticeable increase in th e mutation prevalence in sites outside of the functional regions, particularly at positions 10, 36, 62, 63, 71, and 90. The International AIDS Society USA group has reported data that have been published or presented at scientific meetings on mutations in HIV 1 PR associated with PI resistance ( 65 ) The m utations are classified as either primary or secondary mutations. A recent review lists 1 5 primary mutations (30, 32, 46 47, 48, 50, 54, 58, 74, 76, 82 83, 84, 88, and 90) shown in Table 1 3, that are associated with PI resistance ( 77 ) Based on the list, the most common mutations that arise from t he majority of inhibitors can be found at positions 10, 46, 54, 82, and 90. Primary or active site mutations, which are the main contact residues for drug binding, cause resistance by reducing susceptibility of protease to an inhibitor ( 16, 61, 65, 77 ) These mutations lead to inefficient processing of the enzyme and subsequent decrease in the replicative capacity of the virus ( 61 ) The primary mutations, which appear frequently in HIV 1 PR drug resistant variants, include D30N, G48V, I50V/L, V82A, I84V, and L90M ( 16, 78 ) They usually emerge in combination with each other and other sites within and outside the enzyme active site. Studies have revealed that the D30N/L90M mutation is associated with nelfinavir resistance while the G48V/L90M

PAGE 37

37 mutation arises as a result o f saquinavir therapy ( 61, 79, 80 ) Mutations at I50L/V and I84V are usually common in atazanavir, fosamprenavir, and darunavir ( 77 ) I84V is also found as a major mutation in indinavir, ritonavir, saquinavir, and amprenavir therapy and may develop with the mutation L90M ( 58, 77 ) The most common V82A mutation is observed predominantly in HIV 1 isolates from patients receiving treatment with ritonavir as well as in combination with indinavir a nd lopinavir ( 58, 81 ) In cases where ritonavir is used as a pharmacological booster for other PIs, the mutations that are selected are the same as with the unboosted protease inhibitor (Table 1 3) ( 77 ) Secondary or compensatory mutations, which can be present before therapy or appear in response to inhibitors, are typically found outside the active site. They do not have a substantial effect on the resistance phenotype but they help restore the replicative capacity of the virus ( 61, 65, 77 ) For instance, the N88D mutation arises as a result of the nelfinavir resistance associated D30N/L90M mutation to compensate for the impaired viral replication ( 79 ) They also compensate for impaired protease function by increasing the catalytic efficiency and thermodynamic stability of the enzyme ( 82 86 ) The study by Clemente et al. has show n that the combination of non active site mutations M36I and A71V increase d the enzymatic efficiency of a mutant containing the D30N primary mutation ( 84 ) Mahalingam et al. has demonstrated that mutants having the K45I and N88D secondary mutations increase d the stability of protease, which may compensate for the lower activity and result in enhanced viral replication ( 85, 86 ) Several secondary mutations exist as common polymorphisms in drug nave patients. A number of studies have revealed that the sequences of isolates obtained from untreated patients possess amino acid substitutions associated with inhibitor

PAGE 38

38 resis tance ( 87 ) Some of these natural polymorphisms are found at positions 10, 36, 46, 63, 71, 77 and 82 ( 67 ) Based on the Stanford HIV data base, the mutation at position 63 is a common amino acid polymorphism, which is found in over 50% of the HIV 1 PR subtype B isolates (Figure 1 14) ( 74 ) The L63P mutation occurs in multiple combinations with other resistance mutations to compensate for reduced viral fitness ( 16, 61, 67, 87 ) It has been demonstrated to improve viral replication in the presence of double mutations at positions 82 and 84 and therefore compensate for the deleterious effects of these mutations. The L63P mutation may stabilize the protease and influence flap motion ( 87, 88 ) Mechanisms of d rug r esistance M utat ions in HIV 1 protease can decrease the incorporation and binding affinity of an inhibitor ( 16, 61 ) The altered binding is primarily due to the inherent plasticity of HIV 1 PR, which means that the protease can adjust by rearranging interactions not only within the region of the mutated residue but t hroughout the enzyme ( 16, 65, 89 92 ) A ctive site mutations alter the shape of the binding pocket and therefore directly impact the protease inhibitor interacti on ( 23 ) Schiffer et al. su ggested that an inhibitor, which protrudes beyond the substrate envelope, causes mutations in specific HIV 1 protease residues that it direct ly contact s ( 93 ) The primary mutations that have been sh own to interact with inhibitor atoms and therefore confer drug resistance a re D 30, I 47, G 48, I 50, V 82, and I 84 The mechanism by which non active site mutations alter inhibitor binding remains elusive although it has been suggested that these mutations con fer drug resistance through an indirect mechanism ( 16, 93 ) Rose et al. proposed that non active site mutations affect p rotein flexibility by either preventing the flaps from adopting the wide

PAGE 39

39 open conformation or decrea sing the rate of flap closure so that the protease preferentially binds the substrate over the inhibitor ( 23 ) The study by Schiffer et al. concurred that the change in conformational flexi bility as a result of the mutations can be explained by the hydrophobic sliding mechanism ( 92 ) Each monomer of HIV 1 protease consists of 19 hydrophobic residues outside the active site, which comprise the hydrophobic core. Mol ecular dynamics simulation of unliganded HIV 1 protease demonstrated that the hydrophobic residues alter their side chain conformations and exchange van der Waal contacts with other residues The exchange of hydropho bic interactions result ing from the sliding of hydrophobic residues past one another is referred to as the hydrophobic sliding mechanism This process, which requires only minimal energy expenditure, can be correlate d with changes in the dynamics of the p rotease. Thus, the conformational changes associated with non active site s econdary mutations can be explained by the extensive rearrangement of the hydrophobic core which detrimentally impacts inhibitor binding ( 92 ) Influence of p rotease c leavage s ite m utations on d rug r esistance The sequence of substrate cleavage sites can coevolve with the protease to attain drug resistance without compromising enzyme function ( 93 ) A number of studies have reported the association between specific mutations in the protease and cleavage sites, such as in NC/p1 and p1/p6, which alter s the susceptibility of HIV 1 protease to various protease inhibitors ( 16, 94 98 ) One study reported that p1/p6 cleavage site mutations are associated with the NFV resistant D30N/N88D protease mutations ( 16, 99 ) The cleavage site amino acid changes have been demonstrated to compensate for the negative effects of the D30N/N88D by improving the replicative capacity and processing of substrate. In another study, i t has been determined that substitutions in the gag

PAGE 40

40 NC/p1 cleavage site (A431V, K436E and/or I437V/T), without any alterations in the protease sequence, were selected during PI exposure ( 65, 99 ) Additionally, Goodeno w et al. ( 59 ) studied the association of gag pol mutations with protease activity and Ho et al. ( 100 ) established a correlation between drug associated changes in the gag pol amino acid residues and viral replication and drug response. The findings f rom these studies suggest that the sequence of the cleavage site can undergo changes to compensate for the decreased interactions between mutant protease and substrate and therefore improve substrate binding and enzyme catalytic activity ( 65 ) In addition to the emergen ce of protease resistance to protease inhibitors, prolonged exposure to PI may lead to evolution of protease cleavage sites to maintain viral fitness ( 16 ) Scope of Work Details of HIV 1 PR Construct s N aming and abbreviations of constructs (e.g. B si ) used in this work are described following the subtype or variant of HIV 1 protease stands for stabil ization against autoproteolysis. In s ubtype B HIV 1 PR autoproteolytic cleavage ha s been found to occur between positions 6 and 7, 33 and 34, and 63 and 64 The Q7K mutation carried out by Rose et al. reduced the rate of autoproteolysis by more than a 100 fold ( 101 ) Meanwhile, the mutant protease constructed by Mildner et al., which consists of L33I and L63I substitutions, increased the stability of the HIV 1 protease with specificity and kinetic propert ies similar to the wild type enzyme ( 102 ) In this work, the Q7K, L33I and L 63I mutations were engineered into the subtype B HIV 1 PR construct to increase the stability of the enzyme and slow down autoproteolysis of active protease in which a D25N mutation was incorporated into the sequence. The naturally occurring cysteine residues (C67A

PAGE 41

41 and C95 A) were substituted with alanine for the purpose of site directed spin labeling and to prevent non specific disulfide bonding. All constructs for electron paramagnetic resonance (EPR) spectro scopy studies were engineered with a K55C mutation, which will be described in further detail in Chapter 5. In this work, t he B si construct which is the in active form of subtype B LAI and contains the stabilizing mutations (Q7K, L33I, and L63I), is used a s the reference construct. The primary construct s used in this work are variants of subtype B HIV 1 PR The sequence s were derived from gag pol alleles obtained from a pediatric subject (D1) infected with HIV by maternal transmission ( 59 ) The gag pol alleles were isolated from serial blood samples obtained over 7 years before therapy initiation (pre therapy) and after the developmen t of multiple drug resistance following 77 weeks of initial combination protease inhibitor (PI) therapy including ritonavir (RTV) and an additional 16 weeks of treatment with indinavir (IDV) (post therapy) ( 100 ) The pre therapy and post therapy protease sequences will be referred to as PRE and POST, respectively. Table 1 4 shows the sequence alignment of the PRE i and POST i protease constru cts with the reference construct B si and multi drug resistant constructs, V6 i ( 90 ) and MDR769 i ( 103 ) which were also obtained f rom patient isolates. The crystal s tructures in F igure 1 16 show that PRE i con tains four amin o acid substitutions relative to subtype B LAI excluding the D25N, C67A and C95A mutations. POST i consists of mutations in the active site (V82A ), near active site (L10I and I15V), flap ( I54A and Q58E), and hinge ( E 34 Q M 36 I and T 37 N) regions some of w hich are also found in V6 and MDR769. Previous Work on HIV 1 PR Constructs In the presence of combination protease inhibitor (PI) anti retroviral therapy, mutations in gag and gag pol develop in viruses in vivo during replication. Ho et al.

PAGE 42

42 investigated the pre therapy and post therapy gag pol polyprotein and protease constructs to assess the influence of amino acid changes in gag and PR on viral fitness and drug resistance ( 100 ) To reveal which particular amino acid substitutions contributes to a change in viral replicative capacity and PI sensitivity, specific sites on the post therapy gag and protease sequence were back mutated into the pre the rapy (PRE) sequence. Each mutant consists of mutations at specific sites in the PR sequence and gag mutations at p2 (V376I) and p7 (V398E). The specific mutations are summarized in Table 1 5. The amino acids at position 487 (p6 gag ), 494 (p6 gag ) and 437 (p6 gag pol ) remain the same as in th e post therapy (POST) sequence. The first mutation was carried out in the active site of the PR sequence wherein post therapy alanine was converted to pre therapy valine (A82V) ( 100 ) This resulted to a recovery of about 50% replicative capacity and an increase in sensitivity to either PI inhibitors, RTV or IDV, about half relative to pre therapy virus. Mutation of the flap region, particularly at residues 54 and 58 (A54I, E58Q), impr oved viral replication and increased sensitivity to RTV. However, this virus was more resistant to IDV compared with the post therapy virus. The third set of mutations involves a combination of active site (A82V) and near active site (I10L, V15I) mutations The final mutant consists of a combination of mutations in the flap (A54I, E58Q) and hinge (Q34E, I36M, N37T) region. The viruses containing the latter sets of mutations failed to restore replicative capacity to the post therapy virus. However, these vir uses showed reduced resistance to PI with levels similar to the pre therapy virus These results indicate that replication fitness does not necessarily correlate with susceptibility to PI ( 100 ) The findings of the study also reveal that gag can be a dominant modulator of protease resistance

PAGE 43

43 phenotype by varying susceptibili ty of PR to inhibitors. Mutations in the gag p2/p7 cleavage site and p7 failed to fully recover viral replicative capacity but changes in these posi tions modulated response to PI. Objectives of Work The functionally important region of the HIV 1 protease that has drawn much attention is the flap region. The flexibility of the flaps allows control of substrate or inhibitor access to the active site ( 23, 24 ) It is believed that either naturally occurring polymorphisms or drug pressure selected mutations in the protease can alter flap conformation and flexibility and therefore influence t he accessibility of a substrate or inhibitor ( 83 85, 90, 104, 105 ) Thus, further study on the effect of mutations on flap conformation and flexibility is necessary. To characterize the flap conformations, spin labe ls were incorporated on specific sites on each flap using the site directed spin labeling (SDSL) technique and the distance between the spin labels w as measured using a pulsed electron paramagnetic resonance (EPR) method, called Double Electron Electron Re sonance (DEER) spectroscopy. The overall goal of this work is to purify and characterize inactive subtype B HIV 1 PR variants for analysis by DEER spectroscopy. The previously des cribed constructs, PRE i POST i and POST i mutants containing the amino acid s ubstitutions listed in Table 1 5, were s tudied. These constructs w ere characterized using the following techniques: SDS PAGE, circular dichroism (CD) spectroscopy, mass spectrometry (MS), and continuous wave electron paramagnetic resonance (CW EPR) spe ctro scopy. DEER analysis w as carried out on PRE i POST i P OST i A82V B si and B si I63P apo constructs to compare the flap conformation s and determine whether the conformational changes are associated with drug pressure selected mutations The B si I63P mutant w as

PAGE 44

44 constructed to detect a conformational change result ing from a single amino acid substitution. The effect of the inhibitor, ritonavir (RTV), on the flap co nformations of PRE i and POST i w as a lso investigated. Summary This chapter has provided an introduc tion to HIV and HIV 1 protease. The structure and function of HIV 1 PR was described in detail, particularly focusing on the various conformations of the protease and its correlation with enzyme function. The occurrence of different variants of HIV 1 PR a nd the basis for the existence of naturally occurring polymorphisms and drug pressure selected mutations was presented. The HIV 1 PR constructs studied i n this work has been described. The succeeding chapters will present the techniques and methods used an d the results obtained in this work. Chapter 2 will provide a background on the various techniques used. In Chapter 3, the methodology and results for cloning and mutagenesis of all HIV 1 PR constructs will be presented. Chapter 4 will present the methods and results for the purification and characterization of all HIV 1 PR constructs. Chapter 5 will provide a description of the experimental design and methodology used for analyzing HIV 1 PR by DEER spectroscopy. In addition, previous DEER work on HIV 1 PR done by our group will be described. Results of DEER analysis on particular HIV 1 PR constructs will also be presente d.

PAGE 45

45 Figure 1 1. The assembly of viral proteins and other constituents in HIV 1. Figure a dapted from Levy ( 2 ) Figure 1 2. Schematic diagram of the HIV 1 genome containing the genes that code for several polyproteins including gag and gag pol Figure adapted from Levy ( 5 )

PAGE 46

46 Table 1 1. Various proteins expressed by the HIV 1 gene s NAME SIZE FUNCTION LOCALIZATION Gag MA p17 Membrane anchoring; Env interaction; nuclear transport of viral core (myristylated protein) Virion CA p24 Core capsid Virion NC p7 Nucleocapsid, binds RNA Virion Pol Protease (PR) p15 Gag and gag pol cleavage and maturation Virion Reverse Transcriptase (RT) p66 Reverse transcription Virion RNase H p51 RNase H activity Virion Integrase (IN) p31 DNA provirus integration Virion Env gp120/gp 41 External viral glycoproteins bind to CD4 and secondary receptors Plasma membrane, virion envelope Tat p16/p14 Viral transcriptional transactivator Primarily in nucleolus/nucleus Rev p19 Regulates viral mRNA expression; RNA transport, stability and uti lization factor (phosphoprotein) Primarily in nucleolus/nucleus shuttling between nucleolus and cytoplasm Vif p23 Promotes virion maturation and infectivity Cytoplasm (cytosol, membranes), virion Vpr p10 15 Virus replication; Promotes nuclear localizatio n of pre integration complex, inhibits cell division, arrests infected cells at G2/M stages in cell cycle Virion/nucleus (possibly nuclear membrane) Vpu p16 Promotes extracellular release of viral particles; degrades CD4 in the ER Integral membrane protei n Nef p25 p27 Virus suppression; CD4 and MHC class I down regulation (myristylated protein) Plasma membrane, cytoplasm (possibly virion) Table adapted from HIV Sequence Compendium 2010 ( 6 )

PAGE 47

47 Figure 1 3. Viral life cycle of HIV 1. Numbered steps are described in the text in detail. Figure adapted from National Institute of Allergy and Infectious Diseases ( http://www.niaid.nih.gov ). Figure 1 4. Structural assembly of HIV 1 from an immature to a mature virus. Image courtesy of National Institute of Allergy and Infectious Diseases http://www.niaid.nih .gov ).

PAGE 48

48 Figure 1 5 Ribbon diagrams of HIV 1 PR (PDB ID 2 BPX ) highlighting the A) four structural elements, A1 and A2 loop (yellow), B1 and B2 loop (blue), C1 loop and C2 helix (red), and D1 and D2 loop (green) and B) main regions. Structures rendered by PyMOL ( 17 ) Figure 1 6 hydrogen bonds between the active site residues are shown. Atoms are color coded as follows: carbon (gray), oxygen (red), and nitrogen (blue). Carbon atoms of Leu24 are shaded green to distinguish it from the Asp25 Thr26 Gly27 catalytic triad. Structures rendered by PyMOL ( 17 )

PAGE 49

49 Figure 1 7 Crystal structures of HIV 1 PR (PDB ID 2BPX) A) top view and B) space filling model in the closed conformation. Structures rendered by PyMOL ( 17 ) Figure 1 8. Molecular dynamics (MD) simulation structures of HIV 1 PR. Top view (top) and side view (bottom) of the A) closed, B) se mi open, and C) wide open flap conformations. Figure modified from Simmerling et al. ( 37 )

PAGE 50

50 Table 1 2. Cleavage sites in HIV 1 polyproteins. Site Location HXB2 a Consensus Sequence gag poly protein I MA/CA VSQNY / PIVQN II CA/p2 KARVL / AEAMS III p2/NC SATIM / MQRGN IV NC/p1 ERQAN / FLGKI V p1/p6 gag RPGNF / LQSRP pol polyprotein VI NC/TFP ERQAN / FLREN VII TFP/p6 gag pol EDLAF / LQGKA VIII p6 gag pol /PR TSFSF / PQITC I X PR/RT CTLNF / PISPI X RT/RN GAETF / YVDGA XI RN/IN IRKVL / FLDGI Nef polyprotein Nef AACAW / LEAQE a PDB accession ID of HIV 1 PR subtype B LAI consensus reference sequence Figure 1 9. Schematic representation of HIV 1 gag and gag pol poly proteins. Arrows and numbers designate cleavage sites (refer to Table 1 2 for the location of sites) The representations of the labels are as follows: MA (matrix), CA (capsid), NC (nucleocapsid), PR (protease), RT (reverse transcriptase), RN (RNase H), IN (integrase), p2 (red shaded box), p1 (blue shaded box), TFP (transmembrane protein, gray shaded box). Figure 1 1 0 Chemical structure of HIV 1 PR substrate showing the scissile bond (right) formed during substrate cleavage.

PAGE 51

51 Figure 1 11 Substrate binding pocket of HIV 1 protease. A) Ribbon diagram (PDB ID 2BPX ) showing the primary residues involved in substrate binding. Residues from the two subunits of the dimer are distinguished by a prime. B) Enlarged view of the substrate binding pocket ( PDB 1F7A). Structures rendered by PyMOL ( 17 ) Figure 1 12 Various types of inhibitors targeting different stages in the HIV 1 viral life cycle. Figure adapted from National Institute of Allergy and Infectious Diseases ( http://www.niaid.nih.gov ).

PAGE 52

52 Figure 1 13. Chemical structures of the FDA approved HIV 1 protease inhibitors (PI).

PAGE 53

53 Figure 1 14. General classification of HIV. Figure 1 15 Sequence variation of protease inhibi tor (PI) nave and treated isolates of s ubtype B HIV 1 PR. The mutation prevalence is relative to the LAI consensus sequence. (DR = dimerization region, AS = active site)

PAGE 54

54 Table 1 3. Protease i nhibitor (PI) resistance associated mutations. Inhibitor Primar y Mutations Secondary Mutations Atazanavir/ +/ Ritonavir I50L, I84V, N88S L10I/F/V/C, G16E, K20R/M/I/T/V, L24I, V32I, L33I/F/V, E34Q, M36I/L/V, M46I/L, G48V, F53L/Y, I54L/V/M/T/A, D60E, I62V, I64L/M/V, A71V/I/T/L, G73C/S/T/A, V82A/T/F/I, I85V, L90M, I93L /M Darunavir/ Ritonavir I47V, I50V, I54L/M, L76V, I84V V11I, V32I, L33F, T74P, L89V Fosamprenavir/ Ritonavir I50V, I84V L10F/I/R/V, V32I, M46I/L, I47V, I54L/V/M, G73S, L76V, V82A/F/S/T, L90M Indinavir/ Ritonavir M46I/L, V82A/F/T, I84V L10I/R/V, K20M/R, L24I, V32I, M36I, I54V, A71V/T, G73S/A, L76V, V77I, L90M Lopinavir/ Ritonavir V32I, I47V/A, L76V, V82A/F/T/S L10F/I/R/V, K20M/R, L24I, L33F, M46I/L, I50V, F53L, I54V/L/A/M/T/S, L63P, A71V/T, G73S, I84V, L90M Nelfinavir D30N, L90M L10F/I, M36I, M46I/L, A7 1V/T, V77I, V82A/F/T/S, I84V, N88D/S Saquinavir/ Ritonavir G48V, L90M L10I/R/V, L24I, I54V/L, I62V, A71V/T, G73S, V77I, V82A/F/T/S, I84V Tipranavir/ Ritonavir I47V, Q58E, T74P, V82L/T, N83D, I84V L10V, L33F, M36I/L/V, K43T, M46L, I54A/M/V, H69K/R, L89I/M /V Table adapted from Johnson et al. ( 77 ) Table 1 4 Sequence alignment of subtype B L AI, B si PRE i POST i V6 i and MDR769 i Amino acid residues in blue represent differences relative to LAI. D25N and K55C mutation s are labeled red and green respectively Q7K, L33I, and L63I s tabilizing mut ations are highlighted in yello w. C67A and C95A m utations are highlighted in cyan. Construct Sequence 10 20 30 40 50 B (LAI) PQITLW Q RPL VTIKIGGQLK EALL D TGADD TV L EEMSLPG RWKPKMIGGI B si ----K -------------N -----I ------------PRE i ---------------N -----T T --------POST i -----I -V -----N -----Q IN T ---------V6 i -------------R ---N ----IF -I ------------MDR769 i ----I ------------N ------VN -----L ---6 0 70 80 90 B (LAI) GGFI K VRQYD QI L IEI C GHK AIGTVLVGPT PVNIIGRNLL TQIG C TLNF B si ---C -----I --A -------------------A ---PRE i ---C --VP --A -----------------------A ---POST i --A C -E -VP --A ---------A -----A ---V6 i ---C -----P --A --V --------A ------M ---A ---MDR769 i --V C ----VP --A --V --------A V ----M ---A ---

PAGE 55

55 Figure 1 16. Ribb on diagrams of HIV 1 PR PRE, POST V6, and MDR769 in which the amino acid d ifferences relative to subtype B LAI are highlighted and labeled Table 1 5. Amino acid substitutions made on post therapy (POST) sequence. MUTANT gag PR PMUT1 V376I, V398E A82V PMUT2 V376I, V398E A54I, E58Q PMUT3 V376I, V398E I10L, V15I, A82V PMUT5 V376I, V398E Q34E, I36M, N37T, A54I, E58Q

PAGE 56

56 C HAPTER 2 BACKGROUND ON TECHNI QUES Cloning and Protein Expression Systems M olecular cloning also referred to as recombinant DNA technology, is a modern approach for o btaining sufficient quantities of a protein of interest Cloning involves the insertion of a DNA segment of interest into an autonomously replicating DNA m olecule or vector which is used for the propagation of the target gene in a host bacterial cell ( 106, 107 ) T he widely used bacterial system is Escherichia coli ( E. coli ) The vector which contains suitable transcription and translation control elements, is also used for high level production or overexpression of the target protein in the host cell ( 108 ) Protein expression using recombinant DNA technology requires careful selection of t he DNA for insert ion vector, and type of E. coli cell s. Synthetic DNA can be purchased from DNA 2.0 ( https://www.dna20.com ) or other companies with DNA synthesizers The advantages of using synthetic genes include the optimiz ation for codon us age bias and enhancement of protein expression ( 109 ) Codon optimization i s important particularly if the target protein is not naturally expressed in E. coli T he difference in the codon usage of prokaryotic and eukaryotic systems results in a poor level of protein expression ( 107 ) In addition, the DNA insert can be constructed to prevent the formation of secondary structures in mRNA, such as pause or stop loops which may block translation ( 107, 109 ) A typical ex pression vector, also known as plasmid, is shown in Figure 2 1 It is a circular, double stranded DNA (dsDNA) which can replicate independently from the chromosome. The gene of interest can be inserted into the vector if restriction sites found in the pla smid are incorporated at the ends of the DNA insert T he chosen

PAGE 57

57 restriction sites should not be naturally present within the gene to avoid excision of the gene by restriction enzymes Restriction enzymes are endonucleases that recognize and cut a particula r site producing a stranded ends, referred to as sticky ends ( 108 ) The restric tion sites are usually palindromic, that is, the sequence is read the same on both strands. The DNA of interest is then inserted into the plasmid by ligation, the process of aligning the ends of two double stranded DNA molecules to form a covalent linkage or a phosphodiester bond ( 106 ) Vectors consist of several features that are essential for its propagation in a host cell ( 108 ) The plasmid generally possesses an origin of replication ( ori ) so that DNA can replicate. It also contains a selectable marke r or a resistance gene to distinguish cells that have taken up the vector from those that have not. A commonly used resistance gene is bla or amp R which encodes lactamase to inactivate ampicillin, an antibiotic that hinders growth of bacteria by prevent ing the polysaccharide chains in the bacterial cell walls to cross link. In effect, cells with the amp gene survive in a medium containing ampicillin wh ereas those without the resistance gene die. Expression vectors possess a multiple cloning site (MCS) or polylinker region, which contains several restriction sites for insertion of the gene of interest. Plasmids also consist of a promoter region, where RNA transcription begins. Promoters such as the T7 promoter are often inducible and not constitutive. The pET vector system which is based on the T7 promoter driven system, has been used to express thousands of different proteins ( 110 112 ) These vectors are often transf ormed into a host bearing the DE3 lysogen which is the T7 RNA polymerase

PAGE 58

58 gene for expression of target proteins ( 113 ) Figure 2 2 illustrates the host and vector elements available for control of T7 RNA polymerase levels using the pET system ( 114 ) A number of pET vectors are commercially available including the pET23a vector (Figure 2 3), which is chosen for this work. The E. coli expression system has many advantages including its ease of growth and manipulation and the availability of a variety of vectors and host strains that ha ve been developed for maximizing protein expression ( 107 ) However, the challenge is in choosing the appropriate host strain f or a particular expression vector. The pET vector system requires a host strain containing the bacteriophage DE3 gene, which encodes for T7 RNA polymerase ( 1 14 ) The benefit of having DE3 lysogen with a lacUV5 promoter is that target genes are expressed only upon induction therefore basal expression levels and target gene expression can be controlled ( 112, 113 ) As illustrated in Figure 2 2, transcription of T7 RNA polymerase and expression of target gene proceed s by induction using lactose or its analog. Isopropyl D 1 thiogalactopyranoside (IPTG) is the common ly used lactose analog (Figure 2 4). The use of the T7 expression system results in the production of large amounts of the desired protein after induction. The most widely used hosts are BL21 and its derivatives which lack both lon and ompT proteases ( 115, 116 ) In this work, BL21(DE3) cells with genotype E. coli B F dcm ompT hsdS (r B m B ) gal i s used as the expression strain because it contains the T7 syste m which allows for high level protein expression and easy induction ( 117 ) The BL21(DE3)pLysS c ells of the genotype E. coli B F dcm ompT hsdS (r B m B ) gal [ pLysS C a m r ] are similar to the BL21(DE3) strain, but contains the pLysS

PAGE 59

59 plasmid which provides tighter control of protein expression ( 117 ) This strain carries the gene encoding for T7 lysozyme, which binds to T7 RNA polymerase to reduce basal transcri ption of target genes in the u ninduced state T7 lysozyme lowers the background expression level of target genes but does not interfere with levels of expression after induction with IPTG. The presence of target protein before induction can be potentially toxic to the host cell and res ults in low level of protein expression upon induction. Thus, BL21(DE3)pLysS cells are primarily used to minimize the production of toxic proteins. Site Directed Mutagenesis Site directed mutagenesis is an important technique in molecular biology for modify ing DNA sequences, particularly in studying protein structure function relationships. Most of the mut agenesis methods have been developed bas ed upon the polymerase chain reaction (PCR) ( 108 ) The most common and simplest met hod is t he QuickChange Site Directed Mutagenesis System developed by Stratagene ( 118 ) In this method, a dsDNA vector is used as a template and primers containing the site of mutation are allowed to anneal to the DNA followed by extension using PCR ( 119 ) For each round of PCR, the mutation of interest is introduced using a pair of complementary primer s Site directed mutagenesis imposes certain requirements on the primers to favor primer template annealing rather than primer dim er formation ( 118, 119 ) P rimer s ha ve a t ypical length of about 25 45 bases. Longer oligonucleotides are more specific and stable. The site of mutation is normally situated in the middle of the oligonucleotide such that about 10 15 base pairs are present on each side. The requirement for primer m elting temperature (T m ) is at least 78 C which should be higher than the annealing

PAGE 60

60 temperature Oligonucleotides with higher GC content have a greater T m and are therefore more stable ; however GC base pairs at the ends should be minimized to avoid the pri mer from annealing to itself. The typical strategy for site directed mutagenesis is shown in Figure 2 5 ( 119 ) The first step involves annealing of the primers to the template plasmid DNA. Then, DNA is linearly amplified using PCR in t he presence of deoxynucleotide triphosphates (dNTPs) and DNA polymerase. A high fidelity polymerase is used to minimize the chances of introducing unwanted mutations when extending an entire plasmid. Pfu DNA polymerase is especially used for this purpose b ecause it is thermostable, non strand ( 118 ) Also, addition of dimethylsulfoxide ( DMSO ) into the reaction mixture prevents primers and template DNA to anneal to itself ( 119 ) DMSO disrupts base pairing, facilitating strand separation in GC rich regions of DNA, and reducing the propensity of the DNA to form secondary structure. After the PCR reaction, the product is digested with Dpn I. This endonuclease preferentially nicks d am methylated and hemimethylated DNA (5 Gm 6 ATC 3, where represents the cleavage site) and thus digests the parental plasmid but not the PCR product. DNA isolated from almost all E. coli strains is dam methylated and therefore susceptible to Dpn I diges tion. Also, t he template plasmid must not come from a methylation deficient ( dam ) E. coli strain such as JM10 1 Following Dpn I digestion, the PCR product is transformed into a suitable strain of E. coli cells, e.g. XL1 blue cells, which is capable of sea l ing nicks in the PCR product. W ithout the Dpn I digest, a large number of colonies will contain the parental DNA and not the plasmid DNA having the

PAGE 61

61 mutation of interest because the transformation efficiency of the template plasmid is several orders of magn itude better than the linear PCR product. Purification and Characterization of Proteins The initial step in the is olation of a target protein involves cell lysis ( 106 ) Methods for breaking open cells involve mechanical disruption using a ho mogenizer, which uses a closely fitting piston and sleeve to crush tissue; a French press, which is a device that shears open cells by pushing through a small orifice at high pressure; or a sonicator, which uses ultrasonic vibrations. After lysis, cells ar e filtered or centrifuged to remove particulate cell debris. The protein of interest is usually present in the supernatant solution. However, the water soluble protein may also settle into inclusion bodies in the form of a cell pellet. Isolation of Protei ns from Inclusion Bodies and Refolding Recombinant proteins are most often expressed in the intracellular space of the bacteria, but expression can be controlled so that the target protein is secreted into the periplasmic space or into the culture medium ( 107 ) Some water soluble proteins are also produced in the bacterial cell in insoluble form which lack biological activity as a result of protein misfolding and aggregation. Such proteins are sequestered into inclusion bodies. After cell lysis, inclusion bodies can be separated by centrifugation from soluble proteins and other cellular components. It is then solubilized using d enaturants such as urea or guanidine hydrochloride a nd reducing agents to break the disulfide bonds. Removal of the denaturant and the process of refolding the protein are carried out either by dilution or dialysis ( 107 ) The conditions of refolding and reformation of disulfide

PAGE 62

62 bonds, which varies from protein to protein, must be optimized by determining the suitable pH and i onic strength of buffer, detergent, dilute acid or base to be used. Chromatography Protein purification requires chromatography to separate the target protein from all other proteins The basic principle of chromatography is to bind a protein of interest to a solid support followed by elution using a suitable solvent ( 120 ) Separation can be based on ionic interactions, size exclusion, or affinity. In i on exchange chromatography ions bound electrostatically to an insoluble and chemically inert matrix, called cation or anion exchangers, are reversibly replaced by ions in solution ( 106 ) Proteins, in particular, are polyelectrolytes that possess both positive and negative charges and as such bind to either cation or anion exchangers. The strength of binding depends on the n umber of charges in the protein. The electrical charge of proteins depends on the amino acid composition and the pH of the medium. If the pH is lower than the isoelectric point (pI), the protein will have a positive net charge and a pH above the pI will le ad to a net negative charge. In purifying protein, the pH and salt concentration of the buffer are chosen so that the desired protein is strongly bound to the selected ion exchanger ( 120 ) Weakly bound protein can be eluted with salt solutions of low concentrations wh ereas strongly bound proteins require high salt concentrations of about 10 mM to 1 M. Cellulosic ion exchangers, such as DEAE (diethyla minoethyl), are typically employed in the initial stage of purification to separate the target protein from the rest of the components in the cell lysate, which bind to the column. Gel filtration, also called gel chromatography or size exclusion chromat ography (SEC), is based on the different sizes and shapes of protein molecules ( 106 ) The

PAGE 63

63 matrix is composed of beads made of hydrated, sponge like material containing pores of different sizes. If a solution containing molecules of varying size is passed through a gel column, smaller molecules diffuse into the beads and prolong column passage. The largest proteins, however, canno t penetrate the pores and therefore traverse the column more rapidly. Gel filtration is a gentle method because proteins are not bound to the gel; however, the drawback is that it requires small volumes of concentrated samples ( 120 ) The method is typically carried out as the last step in the purification process. Affinity chromatography is based on the ability of p roteins to interact with specific molecules tightly but noncovalently, e.g. enzymes with substrates, receptors with ligands, antibodies to antigens, or glycoproteins with lectins ( 120 ) In this technique, protein in solution is separated from other substances by interacting with a ligand that is covalently attached to an inert and porous matrix. The desired protein is then recovered in highly purified form by optimized elution cond itions, i.e. changing the pH or ionic strength to reduce protein ligand interactions. Fusion tags can be incorporated into vectors to allow expression of proteins with a short peptide sequence attached to the N or C terminus and thereby facilitate detect ion and purification of the target protein ( 107, 114 ) The prese nce of tags in the protein improves purification because the tagged protein can bind specifically to a particular resin. Commercially available tags include His 6 (six tandem histidine residues, which bind to Ni NTA), GST (glutathione S transferase, which b inds to glutathione Sepharose), thioredoxin (binds to ThioBond resin) and maltose binding protein (binds to amylose resin) among others ( 107 ) The His Tag sequence is particularly useful for purifying proteins that are initially expressed in inclusion bodies because affinity

PAGE 64

64 purification can be accomplished in denaturing conditions that solubilize the protein ( 114 ) SDS PAGE Electrophoresis is the process of moving charged molecules by applying an electric field ( 121 ) Electrophoresis of macromolecules such as proteins and nucleic acids, is carried out in a porous matrix of either polyacrylamide or agarose gel When an electric field is applied to a protein solution, it migrates at a rate that depends on its net charge size and shape ( 120, 122 ) Sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS PAGE) uses a highly cross linked gel of polyacrylamide as the inert mat rix through which the proteins migrate ( 122 ) The matrix serves as a size selective sieve in the separation. The gel is prepared by polymerization of acrylamide and cross linked by methylene bis acrylamide. The pore size of the gel can be adjusted so that it is small enough to retard the migration of the protei n molecules of interest. SDS PAGE is often employed under denaturing conditions so that proteins are separated only according to size ( 120 ) Befor e electrophoresis, p rotein samples are dissolved in a sample buffer which contains a reducing agent such as dithiothreitol mercaptoethanol (BME) to break any disulfide linkages in the proteins. The samples are then boiled to d isrupt the tertiar y structure of the protein such that all of the constituent polypeptides of a multi subunit can be analyzed separately. The sample buffer also includes a negatively charged detergent, sodium dodecylsulfate (SDS) which binds to the hydrophobic regions of t he protein molecules, causing them to unfold into extended polypeptide chains and release from their associations with other proteins or lipid molecules ( 122 ) SDS binds to the protein at a fairly constant ratio of about 1

PAGE 65

65 molecule of SDS per 3 amino acids resulting in an almost constant charge to weight ratio and a net negative charge ( 120 ) The proteins then migrate to the anode or positive end of the electrophoresis reservoir with a constant acceler ation, independent of their composition. The size of a protein can be estimated by comparing the distance of migration with standard proteins of known molecular weight Circular Dichroism (CD) Spectroscopy Circular dichroism (CD) spectroscopy is a techni que often used for monitoring protein folding. Similar to ultraviolet visible (UV Vis) spectroscopy, it is based on the principle of light absorption of a certain material as a function of wavelength ( 106 ) A solution containing a solute absorbs light according to the Beer Lambert law (Equation 2 1), (2 1) where A nce or optical density, I 0 is the incident intensity of light at a given wavelength I is the transmitted intensity at i s the molar extinction coefficient of the solute at c refers to the molar concentration, and l is the length of the light path in cm. Because the value of varies with A or can be plotted against to yield the absorbance spectrum. The wavelength of absorption depends on the functional groups (chromophores) or arrangement of atoms in the sample ( 123 ) Polypeptides absorb strongly in the ultraviolet (UV) region of the spectrum ( = 100 to 400 nm) because of the aromatic side chains of Phe, Trp, and Tyr ( 124 ) In general, the wavelength at 280 nm is used to monitor the optical density of proteins.

PAGE 66

66 Chromophores in chiral envir onments generate circular dichroism as a consequence of light absorption ( 124 ) A CD spectrometer measures the intensity of absorption of left circularly polarized light relative to that of right circularly polarized light over a continuous range of wavelengths. Proteins are chiral molecules with different values for left and right circularly polarized light, L and R The difference in these quantities, = L R as a function of constitutes the CD spectrum. Different structural elements exhibit certain characteristic spectra shown in Figure 2 6. Spectra of helical proteins produce very intense CD signals, whic h correspond to negative bands at 222 nm and 208 nm and a positive band at 193 nm, whereas spectra for p roteins with sheet structure are variable, with a negative band appearing at 218 nm and positive band at 195 nm ( 126, 127 ) D isordered proteins, which have a random conformation, have very low ellipticity above 210 nm and negative bands near 195 nm ( 126 ) The CD spectrum can be analyzed to determine the percentage of secondary structure present in a single polypeptide or protein molecule ( 12 7 ) Vari ous software for analyzing CD data are available at the following websites: CDPro ( http://lamar.colostate.edu/~sreeram/CDPro/main.html ), Circular Dichroism at UMDNJ ( http://rwjms.umdnj.edu/research/cdf/about_cd/applications.html ), CONTIN ( http://s provencher.com/pages/contin cd.shtml ), CCA + the CD Spe ctrum Analyser System ( http://www.chem.elte.hu/departments/protnmr/cca/ ), DICROPOT ( http://dicroprot pbil.ibcp.fr/ ), DICHROWEB ( http://dichroweb.cryst.bbk.ac.uk/html/home.shtml ), K2D ( http://www.embl.de/~andrade/k2d.html ), and SOMCD ( http://geneura.ugr.es/cgi bin/somcd/index.cgi ) ( 126 )

PAGE 67

67 Mass Spectrometry (MS) Mass spectrometry (MS) is widely used for the identification and characterization of biological macromolecules particularly proteins It is a technique that measures the molecular mass by analysis of the ions produced upon ionization of a sample ( 128 ) Samples are traditionally ionized by electron impact (EI) where molecules are bombarded with high energy particles produc ing numerous fragments Recent MS to produce molecular ions and to overcome the problems associated with the thermal instability and involatility of macromolecular analytes ( 129 ) The e lectrospray ionization (ESI) technique is a soft ionization method, which is capable of generating non fragmented molecular ions from biological macromolecules in aqueous solution ( 128 ) In this method, the sample is passed through a low voltage needle, in which the electric field at the needle tip dispe rses the solution into a fine spray of charged droplets. These droplets, which form smaller droplets as they traverse through a tube, are eventually ionized and propelled into the mass analyzer. The output, referred to as the mass spectrum, consists of io ns with different intensities and mass/charge (m/z) ratio. M ass spectra of proteins are usually complicated because of the presence of multiply charged ions Electron Paramagnetic Resonance (EPR) Spectroscopy E lectron paramagnetic resonance ( E PR ) spectroscopy is a magnetic resonance technique that studies paramagnetic species or systems of unpaired electrons and their interactions in the presence of an external magnetic field. In the simplest case, a free electron possesses a magnetic moment t hat aligns parallel or antiparallel in a magnetic field. This induces the Zeeman E ffect, a process whereby the electron spin states (m s =

PAGE 68

68 ) break their spin d egeneracy and split into levels, as illustrated in the energy diagram in Figure 2 7. In th e case of EPR, the difference in energy levels ( E ) is proportional to the applied magnetic field, mathematically expressed as the Zeeman equation (Equation 2 2) ( 130, 131 ) The change constant ( h = 6.626068 10 34 m 2 kg/s) and frequency, which is proportional to the strength of the applied magnetic field ( B ), g or the spectroscopic g factor (approximately equal to 2 for most samples), and the Bohr magneton, B (9.2740154 x 10 24 J/T). B is a proportionality constant defined in Equation 2 3, where e is the electric charge, is (1.054 x 10 34 J s), and m e is the mass of the electron (9.109 x 10 31 kg). The resonant condition occurs when the applied energy is equal to the splitting between the levels E and E ( 2 2) (2 3) Site Directed Spin Labeling S ite directed spi n labeling (SDSL), in conjunction with EPR, is a common tool for analyzing protein structure and dynamics, particularly in measuring the mobility of proteins ( 132 135 ) This technique involves the introduction of a spin labeled side chain into protein sequences, usually through the use of site directed mutagenesis by cysteine substitution followed by reaction with a sulfhydryl specific nitroxide reagent. The general re action scheme is shown in Figure 2 8. The commonly used spin label is (1 oxy 2,2,5,5 tetramethylpyrrolinyl 3 methyl) methanethiosulfonate (MTSL) due to its

PAGE 69

69 high sulfhydryl selectivity and reactivity, relatively smaller volume of the modified amino aci d side chain, and sharp sensitivity of EPR spectra to structural changes ( 132 ) SDSL EPR is a useful technique for monitoring conformational changes in biomacromolecules because the motional dynamics of the side ch ain, as reflected in the EPR spectral line shape, correlates with the general feature of the protein fold. Changes in the rate of rotation of bonds results in changes in spectral shape. The EPR spectra are very sensitive to changes in secondary structure a nd local dynamics, thus can be used in the detection of protein conformational changes ( 132 140 ) Continuous Wave EPR (CW EPR) As previously described, EPR is a phenomenon that arises from the Zeeman Effect, where in resonant condition is achieved when the energy applied is equal to the splitting of the energy levels in a magnetic field. In continuous wave EPR (CW EPR), the resonant condition is attained by varying the magnetic field at a constant frequency. The res ultant spectrum, shown in Figure 2 9, is a derivative of an absorption peak or a dispersive peak which results when the field is modulated ( 130, 131 ) When analyzing proteins by SDSL EPR, the resultant spectrum consists of three dispersive peaks, which correspond to the splitting of the energy levels as a result of the inter action of the nitroxide spin label with the nitrogen nucleus. The interaction of the electron in the nitroxide spin label and the nuclear spin of nitrogen is referred to as the hyperfine interaction. This coupling splits each of the Zeeman interaction leve ls into three different energy levels, based on the 2I+1 splitting rule, corresponding to m I = 0, 1. The energy diagram and derivative absorption spectrum are given in Figure 2 10 ( 130, 131 )

PAGE 70

70 The line shape of an EPR spectrum of a spin labeled side chain contains information about the dynamics or motion of the nitroxide ring on the nanosecond timescale ( 132 ) T he motion of the nitroxide ring originates from rotation around bonds within the nitroxide side chain as well as local backbone fluctuations (LBFs), which are rigid body motions of secondary structure elements or oscillations about backbone dihedral angles ( 135, 137, 139 ) T hese motions are reflected in the EPR spectra of the nitroxide side chain and provide information regarding three different correlation times of motion : R or the rotational correlation time which represents the overall tumbling of the protein in solution, B or effective correlation time due to rotational isomerizations about the bonds that link the nitroxide to the backbone (spin label mobili ty), and S or the effective correlation time for segmental motion of the backbone relative to the average protein structure (flexibility of backbone) ( 138 ) Figu re 2 1 1 shows EPR spectral line shapes of nitroxides with varying correlation times An EPR line shape characterized by very distinct, sharp peaks corresponds to a spin with fast isotropic motion (Figure 2 11A) When motion is restricted to some extent, th e peak is broadened slightly ( Figure 2 11B ). As motion becomes more restricted and correlation time increases, significant line broadening is observed, as seen in the slow and rigid spectra (Figure 2 11C and D, respectively) Some spectra possess multiple dynamic states, which represent a rich variety of complex dynamic modes that are fingerprints of the local structure ( 141 ) For example, spins located in buried sites possess a dominant immobile component as a consequence of tertiary interactions while in most solvent exposed sites, a dominant mobile component is observed because of partial flexibility of the spin label ( 141 )

PAGE 71

71 Double Electron Electron Resonance (DEER) Spectroscopy The conformatio nal changes that a protein molecule undergoes reveal information about its biological function. The relative movement in protein domains can be measured by determining the distance between two sites in the molecule. Site directed spin labeling with CW EPR can access distances of up to 25 while pulsed EPR techniques can be used to measure distances between 20 80 ( 14 2 ) The four pulse double electron electron resonance (DEER) experiment has been the most widely applied method for distance measurements on spin labeled biomacromolecules ( 143 ) Two unp aired electrons separated by a distance r are coupled to each other through electron electron dipolar and other short range interactions such as J coupling ( 144 ) In general, the coupling between two spins S A and S B is described by the Hamiltonian: ( 2 4) where D is the dipole dipole tensor and J is the exchange coupling ( 142 ) For distances longer than 10 , the following are assumed: exchange cou pling is isotropic, g ( 142 ) The dipole dipole tensor can then be described by the point dipole approximation: (2 5) where is the angle between the spin to spin vector and the magnetic field axis and dd is the dipole dipole coupling between spins described by the equation: (2 6)

PAGE 72

72 Thus, distance measurements rely on dd which is inversely proportional to the cube of the distance r 0 is the magnetic permeability of vacuum ( 1.256637 10 T m/A) B is the Bohr magneton and the g values can be approximated by the isotropic value, g A = g B 2.006. At distances larger than 15 , J couplings are an order of magnitude smaller than the dipole dipole coupling and can thus be neglected in Equa tion 2 5. An echo experiment is typically employed to obtain data, which provides information about the interactions between an observer spin A and a second electron spin B. The pulse pattern for the four pulse DEER echo experiment is illustrated in Fig ure 2 12 ( 143 ) At the observer frequency, a refocused Hahn echo sequence is applied. Based on the vector model, a first pulse is applied to turn the magnetization of the A spins into the xy plane. After evolving for time 1 a pulse is applied to produce the electron spin echo (ESE), which corresponds to the inverted dotted line on Figure 2 12. After ESE, the final pulse on the observer sequence is applied after an other evolution time 2 which eventually refocuses the spin echo. The pulse at the pump frequency, in between the two pulses on the observer frequency, is applied for detection of the dipolar interactions. The pulse on the second irradiation frequen cy only affects the B spins, but the flipping of magnetization changes the local magnetic field around the A spins. By varying the delay time t the intensity of the refocused echo varies as a result of the dipolar evolution. In effect, the refocused ESE c orresponds to a coherence transfer echo, the intensity of which is modulated as a function of the strength of the coupling between spins A and B.

PAGE 73

73 The echo signal V(t) as a function of the dipolar evolution time t is a product of the contributions of F(t) a nd B(t) described by Equation 2 7. 2 7) As illustrated in Figure 2 13, F(t) refers to the interactions of spins within the same molecule whereas B(t) is background signal due to interactions with spins from neighboring molecules ( 142, 145 ) Fi gure 2 1 4 shows the plot of V(t) as a function of delay time t The experimentally determined dipolar evolution function V(t) has to be separated into F(t) and B(t) before further data analysis. Separation of the form factor and background factor is carried out by background subt raction, which will be further discussed later in a separate section. T he plot of the form factor, which corresponds to the background subtracted echo, is shown in Figure 2 1 4 DEER Data Analysis The dipolar evolution curve, which manifests the dipolar dipolar coupling between two spins, can be converted into a distance distribution to determine the spin to spin distance r The simplest method of conversion is by Fourier transformation into a frequency domain spectrum represented by the Pake pattern shown in Figure 2 1 5 where the splitting is proportional to T he distance distribution P(r) can be computed exactly from the form factor F(t) (Equation 2 8), where t he kernel function K(t,r) is expressed by Equation 2 9 (145) However, the solution is an inverse problem, whi ch entails finding the distance profile that satisfies the experimental data. (2 8) (2 9)

PAGE 74

74 A few methods have been developed to solve the distance distribution P(r) One approach to finding the best solution for the distance distribution P(r) uses curve fitting methods. The meth od involves simulating distance distribution profiles to generate a theoretical dipolar evolution curve that adequately fits the experimental data. The Monte Carlo (MC) method is one variation to the curve fitting approach, which uses computational algorit hms to generate a distance profile with an assumed Gaussian or Lorentzian form. Another method called Tikhonov regularization (TKR) is discussed in further detail in the next section Tikhonov Regularization The c onv ersion of the form factor F(t) into a distance distribution P(r) is a moderately ill posed problem ( 142, 145 ) This means that t here is no unique solution to finding the distance profile that best fits the experimental data because different distance profiles can produce sim ilar dipolar evolution curves. In addition, small amounts of noise in the experimental data and slight errors in background substraction can result in large changes in the distance distribution Special mathematical algorithms have to be applied to solve such an ill posed problem, which requires a certain smoothness of the distribution P(r) ( 145 ) Smoothness can be achieved by minimizing the target function: (2 10 ) This method of minimizing G is referred to as Tikhonov regularization. Equation 2 10 can also be expressed as: (2 1 1 )

PAGE 75

75 w her e is the criterion for minimum root mean square (RMS) deviation and r epresents the second derivative of the distance distribution corresponding to the smoothness criterion The regularization param eter (also referred to as in some literature) largely determines the solution to P(r) The value of must be chosen to compromise the smoothness of P(r) and the deviation between experimental and simulated form factors. This can be achieved using the L curve criterion as a guide. It is based on a plot of log ( ) vs. log ( ) with being varied on a logarithmic scale as shown in Figure 2 1 6 A. As seen in Figure 2 1 6 B, s mall values correspond to undersmoothing, in which the distance distribution pr ofile contains several sharp, narrow peaks. The corresponding dipolar evolution curve in Figure 2 1 6 C is over fit such that some of the noise is included in the TKR fit. Increasing leads to a large decrease in and smoothing does not affect the deviati on. With large values of the deviation increases significantly with exceedingly small values, thereby resulting to oversmoothing and exceptionally broad peaks appear in the distance distribution profile as shown in Figure 2 1 6 H The corresponding dip olar evolution curve in Figure 2 1 6 I is under fit, that is, the TKR fit neglects some of the oscillations that contribute to the signal and clearly does not adequately fit the data The optimum regularization parameter refers to the transition between und ersmoothing and oversmoothing, which often corresponds to the corner of the L shaped curve, as indicated on Figure 2 1 6 A. An optimum value that results in a distance distribution profile and dipolar evolution curve shown in Figures 2 1 6 D and

PAGE 76

76 Figure 2 1 6 E, respectively, is a compromise between smoothness of P(r) and the quality of the fit of F(t) Background Subtraction and Self Consistent Analysis As previously mentioned, i t is imperative to separate the form factor F(t) from the background B(t) in order to obtain an echo signal that accurately represents the intra molecular spin spin coupling and excludes signal contributed by intermolecular interactions. The intra molecul ar spin spin interactions have shorter distances, which correspond to the high frequency oscillations that last until decay time T dd ( Figure 2 1 4 ). Good fits are typically obtained if the maximum dipolar evolution time fulfills the condition t max = 2 T dd ( 142 ) The background can then be determined from the portion of the curve at The DeerAnalysis2008 software (available online at http://www.epr.ethz.ch/ software/index ) used for DEER data analysis provides modules for subtracting background ( 145 ) One module fits the background to a simple polynomial of various degrees while t he other fits the background to an exponential function corresponding to a homogeneous background with variable dimensions. The approximate P ake transformation ( APT ) module provided by the software, gives a small range but good estimate of the correct bac kground subtraction level. Small variations in background subtraction can lead to small differences in the distance distribution profile ( 142 ) If background is fit before the dipolar modulation or evolution curve decays (overcorrection) long er distance distributions may be suppressed If the background is assumed to decay slowly thus fitting it at a longer time (undercorrection), some spurious contributions at longer distances are introduced. Incorrect background subtraction can also lead t o suppression of small peaks in the

PAGE 77

77 distance profile that correspond to lowly populated states in the protein sample. Hence, it is necessary to identify the best level of background subtraction so that the most accurate distance distribution profile can be obtained. The self consistent analysis (SCA) method for obtaining the correct level of background subtraction was developed by our group. The steps involved in the analysis are presented in Figure 2 1 7 The first step is to generate the dipolar modula tion or evolution curve and the distance distribution profile by Tikhonov regularization (TKR) using the recommended level of background subtraction provided by the DeerAnalysis2008 software. The distance distribution profile corresponds to the sum of the sub populations or protein conformational states The Gaussian reconstruction process determines the peak center, full width at half maximum (FWHM), and relative percentages of each sub population The values obtained are entered into the DeerSim software which uses the Monte Carlo (MC) method to generate a theoretical dipolar modulation The theoretical curve is then overlaid with the background subtracted echo curve or TKR fit. If the two curves do not match exactly, another background subtraction level has to be selected. The process is repeated until the DeerSim and TKR generated dipolar evolution curves match within a certain error The method for statistical analysis is currently being developed by another group member. The process can als o be applied to validate fine features present in the distance distribution profile. Minor populations in the distance profile can be suppressed using the DeerAnalysis software. The theoretical dipolar evolution curve generated is then overlaid with the ex perimental dipolar evolution curve. If the theoretical curve overlays with the experimental curve within the noise of the signal, the suppressed peak can be

PAGE 78

78 regarded as unnecessary. If, however, the curves do not exactly match, then the suppressed peak con tributes to the overall output and is considered as a sub population. This population validation process is illustrated in Figure 2 18. Figures 2 18A and B show a sample distance distribution profile and the corresponding fit to Gaussian functions, respect ively. Figure 2 18C corresponds to the overlaid experimental and theoretical modulations. Suppressing the peak at 30.5 results in a change in the theoretical dipolar evolution curve, which does not overlay exactly with the experimental curve (Figure 2 18 D). The theoretical dipolar modulation that arises from suppressing the wide open peak also does not overlay well with the experimental dipolar evolution curve (Figure 2 18E). In certain cases, suppressing two peaks results in cancellation of the dipolar m odulations, that is, the theoretical and experimental curves match as a result of suppressing both peaks. The example in Figure 2 18F shows that suppressing the tucked/curled peak at 30.5 and the wide open peak leads to a significant alteration in the di polar evolution curves. This implies that both tucked/curled and wide open conformations contribute to the overall distance distribution profile. Gaussian Reconstruction The process of Gaussian reconstruction involves generating the sub populations from the distance distribution profile. In this method, the TKR generated distance profile is fit to a series of Gaussian functions that sum up to regenerate the original profile. Originally, brute force manual fitting was used to obtain the individual sub popu lations. This was done by estimating values of distance, FWHM, and relative percentages to input into DeerSim and thus obtaining a distance profile that fits the original profile. Another method uses the Origin 8.0 software and its later versions to genera te

PAGE 79

79 Gaussian functions that fit into the original profile through the peak finding capabilities of the software. The advantage of this method is that hidden or overlapping peaks can be identified by taking the second derivative of the distance profile. The peak local minima correspond to the individual Gaussian populations.

PAGE 80

80 Figure 2 1. Example of vector map containing the necessary components of a plasmid including the origin of replication or ori (black ) ; amp R an antibiotic resistance gene ( red ) ; multip le cloning site or MCS (dark gray ) ; and promoter (light gray). Figure 2 2. Host and vector elements essential in the overexpression of target protein. Figure adapted from Novagen ( 114 )

PAGE 81

81 Figure 2 3. pET23 a vector map. The heavily shaded b lack arrow refers to the T7 promoter region, which also contains the site for insertion of gene of interest. Figure courtesy of Novagen ( http://www.emdchemicals.com/life science research/ ). Figure 2 4. Structure of i sopropyl D 1 thiogalactopyranoside ( IPTG ). Figure 2 5. Various steps in site directed mutagenesis, where x represents the mutation. Figure adapted from Zheng et al. ( 119 )

PAGE 82

82 Figure 2 6 Typical circular dichroism (CD) spectra of helix (filled ci rcles), sheet (open circles), and random coil (open diamonds) structures of protein. Reprinted by permission from Macmillan Publishers Ltd: The EMBO Journal Fndrich ( 125 ) C opyright 2002 Figure 2 7 Energy diagram representing the Zeeman Eff ect.

PAGE 83

83 Figure 2 8. Chemical modification of the protein side chain ( cysteine ) using MTSL as spin label Figure 2 9. Typical EPR spectrum of a system with an electron spin state of m s = Figure 2 10. A) Energy diagram and B) example of EPR spectru m of a system with an electron spin state of m I = 0, 1.

PAGE 84

84 Figure 2 11. EPR line shapes representing various modes of spin motion. Figure 2 12. Pulse sequence of the four pulse DEER experiment. 1 and 2 represents the fixed delay times and the time t between the inverted electron spin echo (dotted line) and the pump pulse is varied. The intensity of the refocused echo is integrated as shown. Figure adapted from Jeschke ( 142 )

PAGE 85

85 Figure 2 13. Illustration of doubly labeled HIV 1 protease showing the intramole cular F(t) (solid lines) and intermolecular B(t) (dotted line) interactions. Figure adapted from Jeschke ( 142 ) Figure 2 14. Plot of the experimental dipolar evolution function V(t) (black), background factor B(t) (black dotted line), a nd form factor F(t) (gray). T dd represents the echo decay time, t max refers to the maximum time for collection of echo data, and represents the modulation depth.

PAGE 86

86 Figure 2 15. Pake pattern obtained by Fourier transformation of the dipolar evolution curve. Figure 2 16. Example of an A) L curve and corresponding distance distribution profiles and background subtracted echo (black) overlaid with the TKR generated dipolar modulation curves (red) of B) and C) undersmoothed ( =0.0 01), D) and E) optimal ( =10), F) and G) =100, and H) and I) oversmoothed ( =10000) values.

PAGE 87

87 Figure 2 1 7 Flow chart of the Self Consistent Analysis (SCA) method for optimizing background subtraction of the dipolar modulation curve that generates the distance distribution profile.

PAGE 88

88 Figure 2 1 8 Example of population validation process for verifying minor populations A) Distance distribution profi le from TKR analysis (red) overlaid with the sum of the populations obtained by Gaussian reconstruction (blue dashed), B) individual Gaussian populations (suppressed populations are indicated by an asterisk), and background subtracted dipolar echo curve (b lack) overlaid with the TKR generated dipolar modulation (red) and Gaussian reconstructed dipolar modulation (blue) generated C) without subtracting any population and D F) with suppression of populations.

PAGE 89

89 CHAPTER 3 CLONING AND MUTAGENE SIS Materials and Methods Chemicals, reagents, and supplies were obtained from Fisher Scientific (Pittsburgh, Pennsylvania) unless otherwise indicated. pET23 a DNA was purchased from Novagen (Gibbstown, New Jersey). E. coli codon optimized HIV 1 protease DNA was purchas ed from DNA 2.0 (Menlo Park, California). Restriction enzymes ( Nde I and Bam HI ) T4 DNA ligase and 1 kb standard DNA ladder were purchased from New England Biolabs ( Ipswich, Massachusetts). The QuikChange site directed mutagenesis kit was purchased from Stratagene ( Santa Clara California). XL1 Blue E. coli cells were purchased from Invitrogen (Carlsbad, California). The QIAquick gel extraction kit and QIAprep spin mini prep kit were purchased from Qiagen (Valencia, California ) Cloning o f HIV 1 PR PRE and POST Constructs The Escherichia coli ( E. coli ) codon and expression optimized genes for HIV 1 protease Pre i K55C and Post i K55C constructs were received as pJ201:29193 (Figure 3 1A) and pJ201:29194 (Figure 3 1B) vectors, respectively. T he corresponding DNA and amino acid sequences of the HIV 1 PR constructs are given in Tables 3 1 and 3 2. Plasmids containing the Pre i K55C and Post i K55C and pET23 a vector were digested by incubating the vectors with Nde I and Bam HI in the appropriate buff er at 37 C for approximately 2 hours. The digests were run through a 1% agarose gel and visualized using a UV transilluminator. The desired bands were excised from the gel and DNA was extracted using a QIAquick gel extraction k it using the provide d protocol. The Pre i K55C and Post i K55C gene inserts were ligated into the pET23 a vector by

PAGE 90

90 incubating DNA in appropriate proportions with T4 DNA ligase at room temperature for approximately 1 h. The ligation reaction mixture was transformed into XL1 blue E. c oli cells via standard heat shock method. The ligated vector was isolated and purified using the QIAprep spin mini prep kit The plasmid D NA obtained was submitted for DNA sequencing for confirmation. In this work, pET23_Pre i K55C (pET23_PRE) and pET23_ Post i K55C (pET23_POST) refers to the DNA while Pre i K55C (PRE) and Post i K55C (POST) refers to the protease. This naming convention also ap plies to the other constructs (Table 3 3) Site D irected M utagenesis of HIV 1 PR C onstructs To obtain each of the constructs containing drug pressure selected mutations (Table 1 5 and Table 3 3), several rounds of site directed mutagenesis were perform ed on pET23_ P OST. The DNA and amino acid sequences of the mutant constructs are given in Tables 3 4 to 3 7, where the sites of mutation are highlighted. The pET23_ Post i A82V K55C construct (pET23_PMUT1) was obtained by mutation of alanine at position 82 to valine using pET23_ Post i K55C as the template pET23_ Post i A82V I10L V15I K55C (pET23_PMUT3) was obtained by performing successive mutations on the pET23_PMUT1 First, isoleucine at position 10 was converted to leucine and then the product pET23_ Post i A82 V I10L K55C intermediate mutant was used as a template to form the pET23_PMUT3 construct. The same mutagenesis strategy was performed for the pET23_ Post i A54I E58Q K55C (pET23_PMUT2) and pET23_ Post i A54I E58Q Q34E I36M N37T K55C (pET23_PMUT5) construct s. T he sequences, melting temperatures (T m ), and molecular weights of the primers used for each mutant are provided in Appendix A (Tables A 1 to A 4).

PAGE 91

91 An additional mutant construct, B si I63P, was obtained by substituting isoleucine at position 63 of B si with proline. This corresponds to the DNA mutation, AT T CC T, where the mutation is highlighted (Table 3 9). As explained in Chapter 1, the amino acid residue at position 63 of B si the stabilized, inactive form of HIV 1 PR subtype B LAI, was converted from leuc ine to isoleucine as it is a putative cleavage site for HIV 1 PR autoproteolysis. The DNA and amino acid sequences of B si and B si I63P are given in Tables 3 8 and 3 9, respectively. The primer sequence and parameters used for mutagenesis of pET23_B si I63P are provided in Table A 5 of Appendix A. Site directed mutagenesis was carried out using the QuikChange site directed mutagenesis kit The primers were designed using the PrimerX software (available online at http://www.bioinformatics.org/primerx/ ). The template DNA was mixed with the primers, deoxynucleotide triphosphate (dNTP) mixture, P fu Ultra polymerase, polymerase buffer and sterile, nuclease free water in the specific order and proportions optimized for HIV 1 PR as listed in Table A 6 of Appendix A. A separate mixture containing 5% (v/v) dimethylsulfoxide (DMSO) was also prepared. The mixtures were subjected to polymerase chain reaction (PCR) in an Eppendorf ( Hauppauge, N ew Y ork ) thermocycler for 3 h ours. The thermal cycling parameters used are shown in Table A 7 of Appendix A. After PCR, Dpn I was added to the mixture and incubated for another 1 to 2 h at 37 C. The PCR product was transformed into XL1 blue E. coli cells via standard heat shock method The mutant DNA was isolated and purified using the QIAprep spin miniprep kit and submitted for DNA sequencing for confirma tion.

PAGE 92

92 Results and Discussion Cloning The cloning process involves the insertion of target DNA into a plasmid that is suitable for a chosen bacterial expression strain. The major requirement is for the DNA insert and plasmid to have restriction enzyme sites that are complementary for the ligation process to work. After ligation, DNA is transformed into E. coli cells and selectively gro wn in ampicillin containing media. Cells that survive should have plasmid containing the target DNA. The success of ligation can also be verified by cleavage using an appropriate restriction enzyme followed by agarose gel electrophoresis, which provides an estimate of the size of DNA by comparison with a DNA standard ladder. The ligated DNA can also be compared with a reference plasmid DNA containing an insert of the same size. The theoretical size of the pET23 vector is 3666 base pairs (bp) or 3.6 kilob ase (kb) while the DNA inserts, which include the restriction enzyme sites, have 315 bp each. Thus, the DNA gel for the successfully ligated plasmid should contain a band that corresponds to about 4 kb. Figure 3 2 shows the DNA gels of the pET23 PRE and pE T23_P OST. Samples labeled 1A, 1B, and 1C correspond to DNA isolated from different colonies in one LB agar plate whereas samples 2A, 2B, and 2C represent DNA from different colonies in another plate. The gel for both plasmids possesses 2 bands, an upper ba nd that corresponds to roughly 5.5 kb and a lower band, which is estimated to be about 2.5 kb. This is expected as the reference pET23 a plasmid containing a HIV 1 PR DNA insert (Figure 3 2, lane 1) also has 2 bands at the same position. This result is not surprising because gel electrophoresis does not separate molecules only according to size but also based on shape. DNA molecules that are exactly alike can

PAGE 93

93 travel through the gel at different rates depending on the topological parameters of the molecule, e .g. degree of supercoiling. Since the plasmid is a closed circular DNA, there is a large possibility for the DNA to twist into a supercoiled conformation. The rate of migration across the gel of circular, linear, and supercoiled DNA increases, respectively Supercoiled DNA, which is a more compact molecule, can penetrate through the mesh of the gel unlike circular DNA. Overall, gel electrophoresis is useful to verify the presence of DNA and comparison with a reference HIV 1 PR DNA provides evidence of the success of ligation. DNA sequencing was necessary to confirm whether the DNA insert having the correct sequence was incorporated into the pET23 a vector. Results for DNA sequencing revealed that for pET23_ P RE, only bands on lanes 4, 6 and 7 (Figure 3 2A) h ad the correct sequence. The DNA sequence of bands on lanes 2 and 3 correspond to the sequence of the original plasmid. This indicates that the initial step involving the excision of the pET23 plasmid containing the original DNA insert was unsuccessful. Th e original plasmids were most likely not removed in solution after the succeeding steps in the cloning process and were then transformed into the E. coli cells. These formed as separate colonies in the LB agar medium. DNA sequencing analysis of the DNA cor responding to lane 5 did not produce a signal, indicating that the plasmid was not successfully ligated. For pET23_ P OST, the DNA sequence of bands that correspond to lanes 3, 4, and 6 (Figure 3 2B) were correct. Bands corresponding to lanes 2 and 5 were f ound to have the DNA sequence of the original plasmid whereas DNA from lane 7 did not generate a signal. Cloning of P RE and P OST DNA into the pET23 a vector was partially successful in that not all of the DNA were cloned and ligated. Nevertheless, the

PAGE 94

94 succe ssfully cloned pET23_ P RE and pET23_ P OST were used for expression of HIV 1 PR in the bacterial strain, BL21(DE3) pLysS E. coli cells. Mutagenesis In this work, site directed mutagenesis was utilized to modify codons in HIV 1 PR DNA and study the effect of s pecific mutations on protein structure and function. The QuikChange site directed mutagenesis kit was used because it is a simple, fast, and efficient method. However, it is imperative to select the correct primers and proportions of components in the PCR mixture to avoid failure in obtaining a PCR product. To verify if DNA amplification is successful, gel electrophoresis of the PCR product was performed. Figure 3 3 shows a gel of the PCR products of two separate runs (A and B) of the same HIV 1 PR DNA sam ple. The bands that appear at about 4 kb in lanes 2 and 3 represent plasmid DNA containing nicks, which is the expected position for a linear pET23 a plasmid with the HIV 1 PR DNA insert. It is noticeable that th e se bands are not present in lanes 4 and 5 in dicat ing that PCR failed to amplify DNA As expected, the control PCR mixture on lane 6 does not contain the ~4 kb band. The bands at the bottom of the gel correspond to the primers. After PCR, the ligation mixture is transformed into XL 1 Blue E. coli c ells, which is chosen because it is capable of sealing nicks in the plasmid DNA and also enhances the stability of the DNA insert ( 146 ) Subsequent growth on ampicillin containing media allows the selection of cells that have taken up plasmid possessing the HIV 1 PR DNA insert. However, cells that survive do not necessarily contain the plasmid DNA with the correct sequence. Thu s, it is imperative to run DNA sequencing on the isolated DNA. In this work, the following mutants were constructed: 1) pET23_ PMUT1 2) pET23_ PMUT3 3) pET23_ PMUT2 and 4) pET23_ PMUT5 DNA using pET23_ POST as

PAGE 95

95 the template DNA. A single point DNA mutation w as performed for each round of mutagenesis with the exception of the pET23_Post i A54I K55C intermediate mutant. DNA gels were obtained for each mutant, wherein samples 1A and 1B represent DNA isolated from different colonies in one LB agar plate and sample s 2A and 2B correspond to DNA from different colonies in another plate. For pET23_ PMUT1, the codon for alanine (A82) in pET23_ POST was replaced with one that codes for valine (G C A G T A, where the mutation is highlighted, Table 3 4). The DNA gel of pET23_ PMU T1 is shown in Figure 3 4. The bands corresponding to lanes 3 and 4, which were subjected to DNA sequencing, have the correct sequence. Two rounds of mutagenesis were performed on pET23_ PMUT1 to construct pET23_ PMUT3. The intermediate mutant, pET23_Post i A82V I10L K55C was obtained by converting isoleucine to leucine ( A TT C TT, where the mutation is highlighted, Table 3 5) at position 10 in the protein sequence. This mutant was then used as the template for converting valine (V15) to isoleucine ( G TT A TT, where the mutation is highlighted, Table 3 5). The DNA gel of pET23_ PMUT3 is shown in Figure 3 5. DNA corresponding to bands on lane 2 and 5 were sequenced. Results revealed that the band at lane 5 did not have the correct sequence. pET23_ PMUT2 was ob tained by performing two rounds of mutagenesis. Instead of the usual single point DNA mutation, pET23_Post i A54I K55C was initially constructed by replacing two DNA base pairs in the codon for alanine (A54) to convert into isoleucine ( GC C AT C, where the mu tation is highlighted, Table 3 6). Once produced, the resultant DNA was used as the template to c onstruct pET23_ PMUT2. This was carried out by changing glutamic acid at position 58 to glutamine ( G AG C AG,

PAGE 96

96 where the mutation is highlighted, Table 3 6). The D NA gel of pET23_ PMUT2 is shown in Figure 3 6. DNA corresponding to bands on lanes 2 4 were sequenced and shown to have the correct sequence. pET23_ PMUT2 was used as the template for constructing pET23_ PMUT5. Three rounds of mutagenesis were carried out. T he first round involves switching the glutamine residue at position 34 with glutamic acid ( C AG G AG, where the mutation is highlighted, Table 3 7) to form the pET23_Post i A54I E58Q Q34E K55C intermediate mutant. This was followed by the conversion of isoleu cine (I36) to methionine (AT C AT G where the mutation is highlighted, Table 3 7) to produce pET23_Post i A54I E58Q Q34E I36M K55C Finally, pET23_ PMUT5 was obtained by substituting asparagine (N37) with threonine (A A C A C C, where the mutation is highlighted, Table 3 7). The DNA gel of pET23_ PMUT5 is shown in Figure 3 7. The bands on lanes 2 and 4 have the correct DNA sequence.

PAGE 97

97 Figure 3 1. Map of original vector containing the A) Pre i K55C and B) Post i K55C HIV 1 PR DNA inserts (red). Table 3 1. E. coli codon optimized DNA and amino acid sequence of P RE 10 20 ccg cag att acc ttg tgg caa cgt ccg ctg gtt acg att aag att ggt ggt cag ctg aaa P Q I T L W Q R P L V T I K I G G Q L K 30 40 gaa gct ctg ctg aac acc ggt gcc gac gac acg gtg ctg gaa gag atg acc ctg acc ggc E A L L N T G A D D T V L E E M T L T G 50 60 cgt tgg aag ccg aaa atg atc ggc ggc att ggt ggc ttt atc tgc gtt cgt caa tac gat R W K P K M I G G I G G F I C V R Q Y D 70 80 caa gtc ccg atc gag att gca ggt cac aaa gcg att ggc act gtt ctg gtg ggt cca acg Q V P I E I A G H K A I G T V L V G P T 90 ccg gtc aat atc atc ggt cgc aat ctg ctg acc cag atc ggt gcg acc ttg aac ttc P V N I I G R N L L T Q I G A T L N F Table 3 2. E. coli codon optimized DNA and amino acid sequence of P OST 10 20 ccg caa atc acg ctg tgg caa cgt ccg att gtc acc atc aaa gtt ggc ggt cag ctg aaa P Q I T L W Q R P I V T I K V G G Q L K 30 40 gag gca ctg ctg aat acg ggt gcg gac gat acc gtt ctg cag gaa atc aac ttg acg ggt E A L L N T G A D D T V L Q E I N L T G 50 60 cgc tgg aaa ccg aag atg att ggc ggc atc ggc ggt ttt gcc tgc gtc cgt gag tac gac R W K P K M I G G I G G F A C V R E Y D 70 80 cag gtg ccg att gaa att gct ggt cac aag gcg att ggt acc gtt ttg gtg ggt cca act Q V P I E I A G H K A I G T V L V G P T 90 ccg gca aac att atc ggc cgt aat ctg ctg acc caa atc ggt gcg acc ctg aac ttc P A N I I G R N L L T Q I G A T L N F

PAGE 98

98 Table 3 3. Naming convention for HIV 1 PR constructs. Construct # Name of Construct (DNA) Name of Construct (Prote in ) 1 pET23_PRE pET23_Pre i K55C PRE Pre i K55C 2 pET23_POST pET23_Post i K55C POST Post i K55C 3 pET23_PMUT1 pET23_Post i A82V K55C PMUT1 Post i A82V K55C 4 pET23_PMUT2 pET23_Post i A54I E58Q K55C PMUT2 Post i A54I E58Q K55C 5 pET23_PMUT3 pET23_Post i A82V I10L V15I K55C PMUT3 Post i A82V I10L V15I K55C 6 pET23_PMUT5 pET23_Post i A54I E58Q Q34E I36M N37T K55C PMUT5 Post i A54I E58Q Q34E I 36M N37T K55C 7 pET23_ B si pET23_B si K55C B si B si K55C 8 pET23_ B si I63P pET23_B si I63P K55C B si I63P B si I63P K55C Table 3 4 E. coli codon optimized DNA and amino acid sequence of PMUT1 Site of mutation is in bold 10 20 ccg caa atc acg ctg tgg caa cgt ccg att gtc acc atc aaa gtt ggc ggt cag ctg aaa P Q I T L W Q R P I V T I K V G G Q L K 30 40 gag gca ctg ctg aat acg ggt gcg gac gat acc gtt ctg cag gaa atc aac ttg acg ggt E A L L N T G A D D T V L Q E I N L T G 50 60 cgc tgg a aa ccg aag atg att ggc ggc atc ggc ggt ttt gcc tgc gtc cgt gag tac gac R W K P K M I G G I G G F A C V R E Y D 70 80 cag gtg ccg att gaa att gct ggt cac aag gcg att ggt acc gtt ttg gtg ggt cca act Q V P I E I A G H K A I G T V L V G P T 90 ccg g t a aac att atc ggc cgt aat ctg ctg acc caa atc ggt gcg acc ctg aac ttc P V N I I G R N L L T Q I G A T L N F Table 3 5 E. coli codon optimized DNA and amino acid sequence of PMUT3 Sites of mutation are in bold 10 20 ccg c aa atc acg ctg tgg caa cgt ccg c tt gtc acc atc aaa a tt ggc ggt cag ctg aaa P Q I T L W Q R P L V T I K I G G Q L K 30 40 gag gca ctg ctg aat acg g gt gcg gac gat acc gtt ctg cag gaa atc aac ttg acg ggt E A L L N T G A D D T V L Q E I N L T G 50 60 cgc tgg aaa ccg aag atg att ggc ggc atc ggc ggt ttt gcc tgc gt c cgt gag tac gac R W K P K M I G G I G G F A C V R E Y D 70 80 cag gtg ccg att gaa att gct ggt cac aag gcg att ggt acc gtt ttg gtg ggt cca act Q V P I E I A G H K A I G T V L V G P T 90 ccg g t a aac att atc ggc cgt aat ctg ctg acc caa atc ggt gcg acc ctg aac ttc P V N I I G R N L L T Q I G A T L N F

PAGE 99

99 Table 3 6 E. coli codon optimized DNA and amino acid sequence of PMUT2 Sites of mutation are in bold 10 20 ccg caa atc acg ctg tgg caa cgt ccg att gtc acc atc aaa gtt ggc g gt cag ctg aaa P Q I T L W Q R P I V T I K V G G Q L K 30 40 gag gca ctg ctg aat acg ggt gcg gac gat acc gtt ctg cag gaa atc aac ttg acg ggt E A L L N T G A D D T V L Q E I N L T G 50 60 cgc tgg aaa ccg aag atg att ggc ggc atc ggc ggt ttt at c tgc gtc cgt c ag tac gac R W K P K M I G G I G G F I C V R Q Y D 70 80 cag gtg ccg att gaa att gct ggt cac aag gcg att ggt acc gtt ttg gtg ggt cca act Q V P I E I A G H K A I G T V L V G P T 90 ccg gca aac att atc ggc cgt aat ctg ctg acc caa atc ggt gcg acc ctg aac ttc P V N I I G R N L L T Q I G A T L N F Table 3 7 E. coli codon optimized DNA and amino acid sequence of PMUT5 Sites of mutation are in bold 10 20 ccg caa atc acg ctg tgg caa cgt ccg att gtc acc atc aaa gtt ggc ggt cag ctg aaa P Q I T L W Q R P I V T I K V G G Q L K 30 40 gag gca ctg ctg aat acg ggt gcg gac gat acc gtt ctg g ag gaa at g a c c ttg acg ggt E A L L N T G A D D T V L E E M T L T G 50 60 cgc tgg aaa ccg aag atg att ggc ggc atc ggc ggt ttt at c tgc gtc cgt c ag tac gac R W K P K M I G G I G G F I C V R Q Y D 70 80 cag gtg ccg att gaa att gct ggt cac aag gcg att ggt acc gtt ttg gtg ggt cca act Q V P I E I A G H K A I G T V L V G P T 90 ccg gca aac att atc ggc cg t aat ctg ctg acc caa atc ggt gcg acc ctg aac ttc P V N I I G R N L L T Q I G A T L N F Table 3 8 E. coli codon optimized DNA and amino acid sequence of B si 10 20 cca caa atc act ctg tgg aaa cgt ccg ctg gtc acc att aaa att ggc ggt caa ctg aaa P Q I T L W K R P L V T I K I G G Q L K 30 40 gaa gcg ctg ctg aac acc ggt gca gat gat acc gtt atc gag gaa atg agc ctg ccg ggt E A L L N T G A D D T V I E E M S L P G 50 60 cgt tgg aaa cct aaa atg att ggc ggt att ggt ggt ttc att tgt gtg cgc cag tac gac R W K P K M I G G I G G F I C V R Q Y D 70 80 cag atc att atc gaa atc gcc ggc cac aag gca att ggt acc gtg ctg gtt ggc ccg acc Q I I I E I A G H K A I G T V L V G P T 90 ccg gtt aac atc atc ggc cgc aac ctg ctg act cag att ggc gcc acg ctg aac ttc P V N I I G R N L L T Q I G A T L N F

PAGE 100

100 Table 3 9 E. coli codon optimized DNA and amino acid sequence of B si I63P Site of mutation is in bold 10 20 cca caa atc act ctg tgg aaa cgt ccg ctg gtc acc att aaa att ggc ggt caa ctg aaa P Q I T L W K R P L V T I K I G G Q L K 30 40 gaa gcg ctg ctg aac acc ggt gca gat gat acc gtt atc gag gaa atg agc ctg ccg ggt E A L L N T G A D D T V I E E M S L P G 50 60 cgt tgg aaa cct aaa atg att ggc ggt att ggt ggt ttc att tgt gtg cgc cag tac gac R W K P K M I G G I G G F I C V R Q Y D 70 80 cag atc cc t atc gaa atc gcc ggc cac aag gca att ggt acc gtg ctg gtt ggc ccg acc Q I I I E I A G H K A I G T V L V G P T 90 ccg gtt aac atc atc ggc cgc aac ctg ct g act cag att ggc gcc acg ctg aac ttc P V N I I G R N L L T Q I G A T L N F Figure 3 2 DNA gel of pET23 a plasmid containing A) P RE and B) P OST HIV 1 PR DNA The STD lane corresponds to NEB 1 kb standard DNA ladder.

PAGE 101

101 Figure 3 3 Sample DNA g el after Dpn I digestion The STD lane corresponds to NEB 1 kb standard DNA ladder. Figure 3 4 DNA ge l of pET23_ PMUT1 The STD lane corresponds to NEB 1 kb standard DNA ladder.

PAGE 102

102 Figure 3 5 DNA gel of pET23_ PMUT3 The STD lane corresponds to NEB 1 kb standard DNA ladder. Figure 3 6 DNA gel of pET23_ PMUT2 The STD lane corresponds to NEB 1 kb standard DNA ladder.

PAGE 103

103 Figure 3 7. DNA gel of pET23_PMUT5. The STD lane corresponds to NEB 1 kb standard DNA ladder.

PAGE 104

104 CHAPTER 4 PURIFICATION AND CHA RACTERIZATION OF HIV 1 PROTEASE CONSTRUCT S Materials and Methods Chemicals, reagents, and supplies were obtained from Fisher Scientific (Pittsburgh, Pennsylvania) unless otherwise indicated. BL21(DE3) pLysS E. coli cells were purchased from Invitrogen (Carlsbad, Californi a). AG 501 X8 (D) resin, 20 50 mesh, Laemmli sample buffer (LSB), Biorad Criterion pre cast 16.5% Tris Tricine peptide SDS PAGE gel and other SDS PAGE buffers and supplies were purchased from BioRad (Hercules, California). Molecular weight (MW) protein mar kers were purchased from Promega (Madison, Wisconsin). HiTrap Q HP Anion Exchange column and HiPrep 26/10 desalting column were purchased from GE Healthcare (formerly Amersham Biosciences, Pittsburgh, Pennsylvania). 0.60 I.D. x 0.84 O.D. capillary tubes we re purchased from Fiber Optic Center (New Bedford, Massachusetts). Expression of HIV 1 PR The following plasmid DNA constructs were transformed separately into BL21(DE3)pLysS E. coli cells via standard heat shock method : 1) pET23_ PRE, 2) pET23_ POST, 3) pET23_ P MUT1, 4) pET23_ P MUT2, 5) pET23_ P MUT3, 6) pET23_ P MUT5, 7) pET23_ B s i K55C and 8) pET23_ B s i I63P K55C ( Refer to Table 3 3 for the naming convention). The transformed cells were inoculated in 5 mL sterile Luria Bertani (LB) media and grown at 37 C with shaking at 250 rpm until the optical density at 600 nm (OD 600 ) reached approximately 0.60. This was transferred to 1 L sterile LB media and grown at 37 C with shaking at 300 rpm to approximately OD 600 of 1.0. The cells were induced by addition of 0.1 % (v/v) isopropyl D thiogalactopyranoside (IPTG) and further incubated for 4 to 5 h at 37C. Cells were

PAGE 105

105 harvested by centrifugation for 15 min at 8500 g and 4 C using a Sorvall RC6 floor model centrifuge with SLA 3000 rotor. Purification of HIV 1 PR A ll buffers used for protein purification are listed in Table B 1 of Appen dix B. Resuspension and wash buffers were prepared prior to protein purification. The resuspension buffers containing 1 M and 9 M urea were prepared fresh. All buffers were filtered through 0.22 m membrane. Approximately 1 to 2 g of AG 501 X8 (D) resin ( 20 50 mesh) was added to the urea buffers, allowed to stir for 1 to 2 h and the resin was removed by filtration. The pH of the inclusion body (IB) resuspension buffer containing 9 M urea was typically set to pH 8.85 or adjusted according to the spec ific isoelectric point (pI) of the protein being purified The theoretical pIs of the HIV 1 PR constructs, which were generated by the ExPASy ProtParam tool ( http://expasy.org/ ) are shown in Table 4 1. The cell pellet obtained from expression was resuspended in 30 mL resuspension buffer. The cells were lysed by tip sonication for 2 min (5 sec on, 5 sec off) at appr oximately 25 W output power using a Fisher Scientific sonic dismembrator (Pittsburgh, Pennsylvania) followed by 3 passes through a 35 mL French pressure cell (Thermo Scientific, Waltham, Massachusetts) operating at approximately 1200 lb/ psi The lysed cells were centrifuged for 30 min at 18500 g and 4 C using the Eppendorf 5810R centrifuge with F34 6 38 rotor. The same rotor was used for all the succeeding washing steps and all other steps in the purification. After centri fugation, the supernatant was discarded and the pellet, which contains the cell debris and inclusion bodies, was collected and resuspended with 40 mL wash buffer 1. The suspension was

PAGE 106

106 homogenized using a 50 mL Dounce Tissue Homogenizer, tip sonicated for 2 min then centrifuged for 30 min at 18500 g and 4 C. The inclusion bodies were washed again using the same process with 40 mL each of wash buffers 2 and 3. The washing steps served to separate the inclusion bodies from non target proteins and oth er cellular components. The inclusion bodies were solubilized in 30 mL inclusion body (IB) resuspension buffer and homogenized followed by tip sonication and centrifugation at 18500 g and 4 C for 30 min The supernatant was collected and subjected to anion exchange chromatography. A 5 mL HiTrap Q HP anion exchange column (GE Healthcare, Pittsburgh, Pennsylvania) was equilibrated with approximately 60 to 80 mL of IB resuspension buffer on an Akta Prime liquid chromatography system (GE Healthcare, Pitt sburgh, Pennsylvania). The supernatant (approximately 30 mL) was applied to the column at a rate of 5 mL/min and the flow through, which contains the HIV 1 PR, was collected in 4 mL fractions. The fractions (approximately 32 mL) were pooled and acidified to pH 5 by addition of formic acid to a final concentration of 25 mM. This was allowed to stand overnight at 4 C allowing precipitation of contaminants. Any precipitate formed was removed by centrifugation at 8500 g for 30 min at 6 C. The solution co ntaining soluble HIV 1 PR was refolded by 10 fold stepwise dilution with 300 mL of 10 mM formic acid solution on ice using a peristaltic pump for approximately 2 h The pH of the solution was adjusted to 3.8 by adding approximately 1 mL of 2.5 M sodiu m acetate. The solution was allowed to equilibrate for 1 h at 30 C followed by adjustment of pH to 5 with 2.5 M sodium acetate. The solution was centrifuged for 20 min at 18500 g and 23 C to remove contaminants that precipitated during refolding. HIV 1 PR was

PAGE 107

107 concentrated to OD 280 = 0.5 using an Amicon 100 mL concentrator equipped with a Millipore 10,000 Da MW cut off polyethersulfone (PES) membrane and buffer exchanged with 10 mM Tris HCl buffer pH 6.9 using a 53 mL HiPrep 26/10 desalting column for spin labeling Prior to buffer exchange, the HiPrep 26/10 desalting column was equilibrated with 3 to 4 column volumes (~60 to 80 mL) of the Tris HCl buffer. Spin Labeling of HIV 1 PR The concentration of the HIV 1 PR in 10 mM Tris HCl buffer was adjusted to approximately OD 280 = 0.2. A very small amount of spin label [(1 oxy 2,2,5,5 tetramethylpyrrolinyl 3 methyl) methanethiosulfonate (MTSL)], approximately 20 fold molar excess relative to HIV 1 PR, was dissolved in 100 L of pure ethanol a nd added to about 40 mL sample. The spin labeling reaction was carried out in the dark at 4 C for 12 to 16 h The spin labeled protein was buffer exchanged into the storage buffer, 2 mM NaOAc of pH 5.0, using a desalting column. Column equilibration was done as previously using 2 mM NaOAc buffer. The concentration of the HIV 1 PR spin labeled samples was adjusted according to the method of characterization: OD 280 = 0.5 for SDS PAGE; OD 280 = 0.2 to 0.3 for CD spectroscopy; OD 280 = 0.1 for mass spect rometry; OD 280 = 1.0 for CW EPR. Samples were stored at 20 C until analysis. SDS PAGE Approximately 15 L of samples collected from the purification process and purified spin labeled HIV 1 PR were mixed in a 1:1 ratio with Laemmli sample buffer (LSB) containing mercaptoethanol (BME) and subsequently boiled for 5 min The samples were then loaded into a pre cast 16.5 % Tris Tricine peptide SDS PAGE gel. The gel was run at 150 V until the visible dye reached the bottom edge of the gel.

PAGE 108

108 Circular Di chroism (CD) Spectroscopy Samples with a concentration of approximately 0.2 to 0.3 mg/mL were prepared in 2 mM NaOAc buffer at pH 5.0. The protein concentration of each construct (Appendix B; Table B 1) from the collected absorption at 280 nm and extinction coefficient ( ) of 12490 M 1 cm 1 provided by the ExPASy website ( http://expasy.org/ ). All measurements were collected on an Aviv 400 CD spectrometer using Hellma cuvettes with a path length of 1 cm. The parameters used for the CD experiments are listed in Table 4 2. The m easured values refer to A and results were calculated by averaging data obtained from 4 scans and subtracting the background signal from the buffer. The mean residue ellipticity, [ ], was calculated based on the following equation: [deg cm 2 dmol 1 ] (4 1) where c is the concentration in mol/L (M), l is the path length in cm, and n R is the number of residues. d is the observed ellipticity in degrees calculated from the average corrected A : (4 2) The CD spectrum is then obtained by plotting [ ] vs. wavelength in nm. Mass Spectrometry (MS) Spin labeled HIV 1 PR samples with concentration of approximately 0.1 mg/mL in 2 mM NaOAc buffer at pH 5.0 were submitted for analysis at the UF Chemistry Department Mass Spectrometry Facility. Approximately 0.5 % (v/v) acetic acid in 50/50 (v/v) methanol/water was added to 100 L sample and injected directly through

PAGE 109

109 an autosampler, ionized by electrospray ionization (ESI) in positive mode followed by analysis using an Agilent 6210 Time of Flight Mass Spectrometer (TOF MS). All data were processed using the MassHunter software. CW EPR Samples were placed in 0.60 I.D. x 0.84 O.D. capillary tubes. The tube was inserted into the loop gap resonator and data were collected at room temperature (approximately 20 to 25 C). The CW EPR instrument used was a modified Brker ER200 spectrometer with an ER023 M signal channel and an ER032 M field control unit (Molecular Specialties, Milwaukee, Wisconsin). CW EPR spectra were collected with 1 G modulation amplitude and 100 G sweep width at X band frequency of 9.6 to 9.7 G Hz. Table 4 3 provides a complete list of the ty pical parameters used for CW EPR data collection. Results and Discussion The expression and purification protocol used in this work was based on Freire et al. ( 83, 105, 147 ) and optimized by a fellow group member, Angelo Veloro. In the purification process, buffers containing urea were prepared fresh because urea degrades spontaneously forming pr oducts that can carbamylate free cysteines and thereby affect the spin labeling efficiency of HIV 1 PR ( 148 ) Any urea decomposition products were reacted by ionization with glycylglycine (diGly), which is present in the wash buffers, followed by removal by ion exc hange with the AG501 X8 (D) mixed ion bed resin. The purified and spin labeled HIV 1 PR samples were characterized by SDS PAGE, CD, MS, and CW EPR.

PAGE 110

110 SDS PAGE The purity of HIV 1 PR was monitored by running SDS PAGE on samples obtained from specified step s in the purification process. The technique can be also be used to estimate the molecular weight (MW) of protein by comparison with known standards. SDS PAGE gels of HIV 1 PR constructs purified in this work are shown in Figures 4 1 to 4 8. Bands that app eared near the 10 kDa MW marker correspond to the HIV 1 PR monomer, which is expected as its estimated MW is 11 kDa. All constructs possess this band but with varying amounts of protein. The size of the band is roughly proportional to the amount of protein present in the sample. The POST, P MUT3, and P MUT5 constructs have the most abundant HIV 1 protease. Degradation of HIV 1 PR can be monitored by examining the presence of any bands lower than the 10 kDa marker, which corresponds to possible cleavage produ cts. Though hardly noticeable because of the very large band size for POST, PMUT3, and PMUT5 HIV 1 PR, some faint bands can be seen below the HIV 1 PR band. The SDS PAGE gel profiles of all constructs were similar with some minor differences. For all co nstructs, the supernatant after French press produced bands of various MW, which correspond to cellular debris and other components that dissolved in the resuspension buffer and were separated from the inclusion bodies. As seen in Figures 4 1 to 4 8A, comp arison of lanes 2 4 and lanes 6 9 reveals that several bands appeared in the wash pellets while only a few faint bands appeared for the wash supernatant solutions. This implies that the wash steps were not substantially effective in removing non target pro teins. It is worth noting that lanes 6 8 of the SDS PAGE gel of B si (Figure 4 7) showed only a faint band for HIV 1 PR. However, lanes 5 and 9, which correspond to wash 4 supernatant and pellet, respectively, contain the band for HIV 1

PAGE 111

111 PR. This anomaly ma y be attributed to the SDS PAGE sample preparation. After dissolving the sample in LSB followed by boiling, the sample was centrifuged. Most of the HIV 1 PR may be insoluble and deposited at the bottom of the microcentrifuge tube C onsequently, only little amount of the protein was loaded into the gel. For all constructs, distinct bands appeared at approximately 35 kDa during the purification process (Figures 4 1 to 4 8A). This unidentified protein contaminant was not removed after passing through the Q co lumn since bands of the same MW were still present as seen in Figures 4 1 to 4 8B. For the P OST construct (Figure 4 2), a light but distinct band was present between 15 and 25 kDa in both gels, which could correspond to the HIV 1 PR dimer of approximately 21 kDa. This also appeared as very faint bands in the gels of the PMUT3 and B si constructs. Based on the gel profiles of the column fractions, fractions 4 9 contained the largest amount of protein and were pooled for the subsequent acidification and refold ing steps. Acidification of the HIV 1 PR facilitated the precipitation of protein contaminants that appeared as several bands in Figure 4 1 to 4 8B. After the acidification and refolding process, a huge amount of solid was typically removed by centri fugation. At this point, the HIV 1 PR obtained is estimated to have >95 % purity and suitable for spin labeling. S pin labeled HIV 1 PR samples of OD ~0.5 were run through SDS PAGE to verify the purity. The SDS PAGE gel in Figure 4 9 shows that the spin l abeled HIV 1 PR samples have >99% purity. CD Spectroscopy Isolation of protein from inclusion bodies entails refolding the protein using an appropriate buffer with the correct pH. After the refolding process, the purifie d protein may or may not be properly folded. In this work, CD experiments were performed to

PAGE 112

112 v erify if the purified and spin l abeled HIV 1 PR constructs have the proper secondary structure. Figure 4 10 shows the CD spectra of the HIV 1 PR constructs. All co nstructs have a similar profile, which is typical of a protein with primarily sheet conformation. This is in agreement with the structure of HIV 1 PR, which consists of predominantly strands. The experimentally determined CD spectra also match publishe d CD results for HIV 1 PR, thus confirming the proper folding of the protein samples. However, slight differences can be seen in the minima, particularly with PMUT5 which may be attributed to the mutations present in the construct Further CD analysis nee ds to be performed to calculate the % sheet s tructure of each of the spin labeled samples MS The purified and spin labeled HIV 1 PR samples were analyzed by ESI MS to confirm the molecular weight (MW) of HIV 1 PR. In addition, this method was used to ch eck the spin labeling efficiency, that is, whether MTSL was attached successfully to the protein. Table 4 4 shows the list of MW of the HIV 1 PR constructs with and without spin label and the observed MW obtained from the MS spectra. The theoretical MW wit h MTSL corresponds to MW (HIV 1 PR) + MW (MTSL) MW (Hydrogen), wher e the MW (MTSL) is 185.38 Da. Figures 4 11 to 4 18 show mass spectra of the HIV 1 PR constructs. A typical ESI MS mass spectrum contains a series of peaks that represent multiple charge v ariants. The m/z peaks may be protonated or adducts of Na + NH 4 + or any ion present in solution. The mass spectra of HIV 1 PR constructs possess m/z peaks that correspond to [M/n] n+ ions, where n represents the charge state. Because the MW of the protein i s known, identifying the characteristic m/z peaks is relatively straightforward. The simplest

PAGE 113

113 strategy for peak identification is to pick the +10 charge state, divide the MW by 10, and search for the m/z peak. For example, the theoretical MW of the PRE con struct is 10874.98 Da, thus the m/z peak having a +10 charge state corresponds to an approximate m/z of 1087.498. This peak corresponds to m/z 1087.494 in Figure 4 11. All the other peaks can easily be identified because they are adjacent to each other, di ffering by a consecutively decreasing number of charges as m/z increases. The ESI MS results pro vide confirmation that all spin labeled HIV 1 PR con structs have the correct MW. The spin labeling efficiency was determined by verifying the presence of any un labeled protein. The MS spectra of PMUT3 (Figure 4 14), PMUT5 (Figure 4 16), and B si (Figure 4 17) show the presence of unlabeled HIV 1 PR monomer and dimer. By comparison of intensities of the m/z peaks, the spin labeling efficiency can be roughly estimat ed. PMUT3 contains approximately 40% unlabeled protein whereas PMUT5 and B si have about 20 to 30% unlabeled protein. All the other HIV 1 PR constructs contain little to no unlabeled protein and are thus efficiently labeled. CW EPR Site directed spin label ing in conjunction with EPR has been used as a tool to probe the structure and conformational dynamics of proteins ( 132 134, 140, 141 ) The motional dynamics of the nitroxide side chain, as reflected in the EPR line shape, can be correlated to motion arising from the secondary structure through local backbone fluctuations (LBF) and the overall protein structure due to conformational changes in the protein fold. In this work, SDSL EPR was used to observe any changes i n the nitroxide line shape of different variants of HIV 1 PR. Figure 4 19 shows an overlay of the CW EPR spectra of HIV 1 PR constructs. By visual inspection, only a minor difference

PAGE 114

114 in the EPR line shape, particularly on the high field portion (Figure 4 1 9 inset), can be observed. This is in agreement with previous studies in our group, which revealed only slight changes in the EPR spectra of different HIV 1 PR subtypes ( 51 ) In fact, it has also been shown that addition of inhibitor to HIV 1 PR has a minor effect on the spect ral line shape. NMR and ITC studies have suggested that inhibitor binding induces a conformational change and that the major source of protein motion arises from minor backbone fluctuations ( 28, 29, 33 37 ) These ty pes of motion, however, were not detected using CW EPR at X band frequency. The spectral line shape rather reflects only the internal motion of the nitroxide spin label. Because CW EPR did not reveal any information on protein conformational changes, the t echnique was used instead to confirm whether the HIV 1 PR constructs are efficiently spin labeled for DEER studies. Pulsed EPR, described in further detail in Chapter 5, was employed to monitor the conf ormational changes in HIV 1 PR. Qualitative inspection of the signal to noise ratio (SNR) of the CW EPR spectra (Figure 4 19) reveals that all HIV 1 PR samples are s ubstantially spin labeled. Spin labeled HIV 1 PR samples for DEER analysis were typically concentrated to OD 280 of 2.5 to 2.7. However, it should not be assumed tha t spin labeled proteins with the same optical density have the same concentration of spin label. A standard curve using 4 oxo TEMPO was obtained (Appendix B; Figure B 1) to verify the concentration of spin labeled protein that produces C W EPR spectra with good SNR. Table B 3 of Appendix B provides a list of values for optical density, protein concentration, and spin label concentration of the HIV 1 PR constructs. It has been determined that samples with OD 280 of ~1.0 and spin label concen tration of greater than 15 M for the HIV 1 PR

PAGE 115

115 monomer are efficiently labeled and suitable for analysis by DEER. Based on Table B 3, it is noticeable that PMUT3, PMUT5, and B si have high OD 280 values but correspond to relatively low spin label concentrati ons. This suggests that these constructs m ay not be efficiently labeled.

PAGE 116

116 Table 4 1. Theoretical isoelectric points (pI) of HIV 1 PR constructs. Construct # Name of Construct a pI 1 PRE 9.06 2 POST 9.06 3 PMUT1 9.06 4 PMUT2 9.06 5 PMUT3 9.45 6 PMUT5 9.06 7 B si 9.39 8 B si I63P 9.39 a See Table 3 3 for the naming convention of HIV 1 PR constructs. Table 4 2 Standard parameters used for c ircular d ichroism (CD) spectroscopy data collection Parameter Value Experiment Type Wavelength Temperature 25 C Bandwidth 1.0 nm Wavelength Start 250 nm Wavelength End 200 nm Wavelength Step 1.0 nm Averaging Time 1.000 s Settling Time 0.333 s Multi Scan Wait 1.000 s Number of Scans 4 Table 4 3 Standard parameters used for CW EPR data collection Param eter Value Frequency ~9.6 GHz Center Field ~3230 3270 G Sweep Width 100 G Time Constant 0.16384 s Acquisition Time 40.6323 s Modulation Amplitude ~1 G Power 20 dB Receiver Gain 1 x 10 5 Receiver Phase 100 Number of Scans 1 Number of Points 1024

PAGE 117

117 Table 4 4. Theoretical MW of HIV 1 PR constructs with and without MTSL and MW determined from ESI MS analysis HIV 1 PR Construct Theoretical MW (Da) (without MTSL) Theoretical MW (Da) (with MTSL) Observed MW a (Da) (with MTSL) Standard Deviation PRE 1 0690.6 10874.98 10874.94 0.20 POST 10601.4 10785.78 10785.60 0.15 PMUT1 10629.4 10813.78 10813.62 0.18 PMUT3 10643.4 10827.78 10827.68 0.11 PMUT2 10642.5 10826.88 10826.74 0.11 PMUT5 10648.5 10832.88 10832.73 0.11 B si 10702.7 10887.08 10 886.93 0.07 B si I63P 10686.6 10870.98 10 870.86 0.08 a Value corresponds to the average MW calculated from the m/z peaks of varying charge states. Figure 4 1. SDS PAGE gel of P RE. A) Samples obtained from steps in the purification as indicated. B) Lanes correspond to fractions 1 10 collected from Q column chromatography. MW lane corresponds to Promega broad range protein markers.

PAGE 118

118 F igure 4 2 SDS PAGE gel of POST. A) Samples obtained from steps in the purification as indicated. B) Lanes correspond to fractions 1 10 collected from Q column chromatography. MW lane corresponds to Promega broad range protein markers. Figure 4 3 SDS PAGE gel of PMUT1. A) Samples obtained from steps in the purification as indicated. B) Lanes correspond to fractions 1 10 collected from Q column chromatography. MW lane corresponds to Promega broad range protein markers.

PAGE 119

119 Figure 4 4 SDS PAGE gel of PMUT3. A) Samples obtained from steps in the purification as indicated. B) Lanes correspond to fractions 1 10 collected from Q column chrom atography. MW lane corresponds to Promega broad range protein markers. Figure 4 5 SDS PAGE gel of PMUT2. A) Samples obtained from steps in the purification as indicated. B) Lanes correspond to fractions 1 10 collected from Q column chromatography. MW lane corresponds to Promega broad range protein markers.

PAGE 120

120 Figure 4 6 SDS PAGE gel of PMUT5. A) Samples obtained from steps in the purification as indicated. B) Lanes correspond to fractions 1 10 collected from Q column chromatography. MW lane correspond s to Promega broad range protein markers. Figure 4 7 SDS PAGE gel of B si A) Samples obtained from steps in the purification as indicated. B) Lanes correspond to fractions 1 10 collected from Q column chromatography. MW lane corresponds to Promega br oad range protein markers.

PAGE 121

121 Figure 4 8 SDS PAGE gel of B si I63P. A) Samples obtained from steps in the purification as indicated. B) Lanes correspond to fractions 1 10 collected from Q column chromatography. MW lane corresponds to Promega broad range pr otein markers. Figure 4 9. SDS PAGE gel of spin labeled HIV 1 PR constructs. MW lane corresponds to Promega broad range protein markers.

PAGE 122

122 Figure 4 10. Circular dichroism spectra for spin labeled HIV 1 PR PRE (blue), POST (red), PMUT1 ( green ), PMUT2 (purple), PMUT3 ( magenta ), PMUT5 (cyan), B si (black), and B si I63P (orange).

PAGE 123

123 Figure 4 11. Mass spectra of spin labeled P RE The upper spectrum shows the major peaks wi th the charge states indicated. The lower spectrum is an enlarged view of the m/z peak with +10 charge state.

PAGE 124

124 Figure 4 1 2. Mass spectra of spin labeled P OST The upper spectrum shows the major peaks with the charge states indicated The lo wer spectrum is an enlarged view of the m/z peak with +10 charge state.

PAGE 125

125 Figure 4 13 Mass spectra of spin labeled PMUT1 The upper spectrum shows the major peaks with the charge states indicated The lower spectrum is an enlarged view of the m/z pe ak with +10 charge state.

PAGE 126

126 Figure 4 14. Mass spectra of spin labeled PMUT3. The upper spectrum shows the major peaks with the charge states indicated The lower spectrum is an enlarged view of the m/z peak with +10 charge state.

PAGE 127

1 27 Figure 4 15. M ass spectra of spin labeled PMUT2. The upper spectrum shows the major peaks with the charge states indicated The lower spectrum is an enlarged view of the m/z peak with +10 charge state.

PAGE 128

128 Figure 4 16. Mass spectra of spin labeled PMUT5. The upper spectrum shows the major peaks with the charge states indicated The lower spectrum is an enlarged view of the m/z peak with +10 charge state.

PAGE 129

129 Figure 4 1 7 Mass spectra of spin labeled B si The upper spectrum shows the major peaks with the charge s tates indicated The lower spectrum is an enlarged view of the m/z peak with +10 charge state.

PAGE 130

130 Figure 4 1 8 Mass spectra of spin labeled B si I63P The upper spectrum shows the major peaks with the charge states indicated The lower spectrum is an e nlarged view of the m/z peak with +10 charge state.

PAGE 131

131 Figure 4 19. CW EPR spectra for spin labeled HIV 1 PR P RE (blue), P OST (red), P MUT1 (green), P MUT2 (purple), P MUT3 (magenta), P MUT5 (cyan), B si (black), and B si I63P (orange). Inset shows an enlarged view of the high field peak.

PAGE 132

132 CHAPTER 5 DISTANCE MEASUREMENT S OF HIV 1 PROTEASE CONSTRUCT S As described in Chapter 2, Double Electron Electron Resonance (DEER) spectroscopy is a technique for determining the distance between specific sites in a protein mol ecule In HIV 1 protease, the distance between spin labeled sites on the flaps of each monomer can be measured. From the distance profiles obtained, the conformational ensemble which corresponds to the sum of the protein conformational states, of various HIV 1 PR variants and subtypes can be compared. This chapter describes previous DEER studies on HIV 1 PR and results of DEER experiments on HIV 1 PR pre therapy (PRE), post therapy (POST) PMUT1 ( POST A82V ), B si and B si I63P apo constructs (See Table 3 3 for the naming convention). DEER analysis was also performed on the PRE and POST constructs with the protease inhibitor, ritonavir (RTV). The K55C mutation was introduced into the protease constructs to serve as a site for attaching the methanethiosulfona te spin label (MTSL). Previous studies have shown that spin labeling the protein at this position, which is a solvent exposed site, does not significantly alter the structure and activity of the HIV 1 protease ( 149 ) Based on X ray crystal structures and MD simulation studies of HIV 1 PR, the distance between the DEER measurement ( 39, 45 ) Figure 5 1 shows X ray crystal structures of HIV 1 PR with the flaps in the closed and semi open conformations The distance between the spin labels is predicted to decrease by approximately 3 , from about 36 to 33 , as the flaps shift f rom semi open to a closed conformation.

PAGE 133

133 Previous DEER Studies on HIV 1 PR As previously mentioned, our group has utilized DEER spectroscopy to characterize the flap conformations of HIV 1 PR. Luis Galiano a former member of our group, demonstrated that the DEER technique can be used to measure the distance between flaps of HIV 1 PR and thereby determine the flap conformations ( 45, 47 ) Results of the study revealed significant variation in the distance d istribution profile of B si in the absence and presence of a protease inhibitor, ritonavir (RTV) Figur e 5 2 shows the dipolar evolution curve and distance profile of apo and inhibitor bound HIV 1 PR. A noticeable difference is seen in the dipolar evolution curves such that the inhibitor bound protease consists of more oscillations compared to an almost dampened oscillati on for the apo protease. This reflects the motion and flexibility of the flaps and the possible changes in conformation the protease undergoes upon binding of inhibitor. From the distance profile, it has been determined that the most probable distance of t he apo HIV 1 PR is 35.4 , which corresponds to a semi open conformation. In addition, the distance distribution is broad, which is indicative of flaps sampling a wide range of conformations. Upon addition of RTV, the most probable distance decreased by ab out 3 (from ~36 to ~33 ) and the breadth of the distribution narrowed. This clearly indicates that the flaps closed in to interact with the inhibitor and as such restricted the motion of the flaps, which is characteristic of a closed conformation. Mandy E. Blackburn also a previous member of our group, optimized the process of obtaining DEER data ( 49 ) By impr oving the signal to noise ratio (SNR), the sub populations of HIV 1 PR can be determined from the distance profiles. Using the improvised technique, the distance distribution profiles of B si in the absence and presence of nine FDA approved protease inhibit ors and a substrate mimic, CA/p2, were

PAGE 134

134 compared (Figure 5 3) ( 48 ) These results mainly showed the effect of inhibitor binding on the distance profiles. The inhibitors and CA/p2 substrate were classified based on how the inhibitor/substrate affected the closing of the flaps. CA/p2, RTV, LPV, TPV, conformational ensemble is in the closed conformation. The lower percentage of closed conformation fo HIV 1 PR bound with t hese inhibitors possess a predominant semi open conformation except for ATV, which has approximately 40% closed conformation. Galiano et al. ( 46 ) studied the effect of mutations in drug resistant HIV 1 PR variants, V6 ( 90 ) and MDR769 ( 103 ) V6 is a clinical isolate from a pediatric patient treated with RTV while MDR769 was isolated from a patient previously treated with IDV, NFV, SQV, and APV. Figure 5 4 shows DEER resul ts for V6 and MDR769. Compared to B si the distance profile reveals that MDR769 has a longer interflap distance, corresponding to a more open conformation In contrast, the most probable distance for V6 is shorter than B si which corresponds to a more clo sed conformation. This is in agreement with the MD simulation studies done by Simmerling et al ( 39, 46 ) These findings provide evidence that drug pressure selected mutations, particularly those that are relatively far from the active site, can influence HIV 1 PR function by altering flap motion and flexibility. Thus, distance distribution profiles, which provide information on flap conformations, can be used to compare the different HIV 1 PR var iants containing drug pressure selected mutations. resistant construct by studying the effect of addition of inhibitors on the distance distribution profile ( 47, 49 ) The apo

PAGE 135

135 most probable distance is shorter than B si apo. However the breadth of the profile for V6 i s broader whereas Galiano reported a broader profile for B si which may be attributed to the low signal to noise ratio (SNR) as seen in Figure 5 4 The effects of inhibitors on the distance profile of V6 were relativel y similar to B si with some notable exceptions. Similar to B si IDV, NFV, and ATV only slightly changed the most probable distance and the breadth of distribution. However, RTV, which had a strong effect on flap closing of B si has a minimal effect on the d istance profile of V6 and almost no change in the breadth of the distance profile. All the other inhibitors had moderate to strong effect on the V6 distance profile, which was also observed in B si Overall, the effects of inhibitors on V6 compared to B si w ere almost the same; however, the breadth of the distance profiles of V6 were relatively broader. Jami e L. Kear a previous member of our group, determined the distance distribution profiles of non B subtype HIV 1 PR variants as well a s previously studied drug resistant constructs, V6 and MDR769 ( 50, 51 ) Distance measurements on the non B subtypes and drug resistant constructs were carried out to examine the effects of naturally occurring polymorphisms and drug pressure selected mutations on the flap conformation and flexibility of HIV 1 PR. R esults showed that polymorphisms and drug pressure selected mutations alte r the average flap conformation and flexibili ty of HIV 1 PR Figure 5 5 sho ws the distance distribution profiles of the apo forms of HIV 1 PR subtypes B, C, F, and CRF01_A/E and drug resistant constructs V6 and MDR769. The most probable distance for almost all subtypes and the drug resistant constru cts are centered between 35 to 36 , with the exception of subtype C which has a slightly

PAGE 136

136 longer inter flap distance of a bout 37 . The differences in the overall shape and breadth of the profiles reveal a variation in flap conformation and flexibility as a consequence of the polymorphisms and mutations Kear also studied the effects of the various FDA approved inhibitors on subtypes CRF01_A/E and F ( 51 ) The results for both non B subtypes were similar to that of subtype B si in that IDV, NFV, and ATV had a whereas all the other inhibitors displayed a As previously cited, Galiano and Blackburn reported a more open conformation for MDR769 and a more closed conformation for V6 ( 47, 49 ) Kear determined that the most probable distance of V6 and MDR769 is almost the same as B si and the predominant flap conforma tion for both constructs is the semi open conformation ( 51 ) Compared to B si MDR769 has a larger relative percentage of wide open conformation whereas V6 shows a greater relative percentage of tucked/curled conformation. Materials and Methods Chemicals, reagents, and supplies were obtained from Fisher Scientific (Pittsburgh, Pennsylvania) unless otherwise indicated Deu terated solvents were purchased from Cambridge Isotope Laboratories, Inc. (Andover, Massachusetts). Ritonavir (RTV) was generously received from the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID NIH (Bethesda, Maryland) Sample Pre paration for DEER Data Collection Inactive HIV 1 PR pre therapy (PRE), post therapy (POST), PMUT1 (POST A82V), B si and B si I63P constructs were purified and spin labeled as described in Chapter 4. The purified and spin labeled samples were concentrated t o OD 280 ~ 2.5 to 2.7 using an Amicon Ultra 4 Centrifugal Filter Unit with Ultracel 3 membrane. The

PAGE 137

137 sample was buffer exchanged as follows: 1 mL of concentrated HIV 1 PR was diluted with 3 mL deuterated 20 mM NaOAc (C 2 D 3 O 2 ) in D 2 O (pH 5.0) and centrifuged u ntil the volume of sample was approximately 1 mL. This process was repeated 3 times such that by the end of the fourth concentrating step, the sample buffer is approximately 100% deuterated solvent. Also, the OD 280 was obtained to verify if it is roug hly the same as the initial OD 280 To avoid multiple freeze/thaw cycles, 70 L of the spin labeled protein in deuterated buffer was aliquoted into 0.2 mL PCR tubes and stored at 20 C. For apo samples, 30 L of deuterated glycerol was directly added to 70 L of sample so that the final concentration of glycerol is approximately 30 %. For RTV bound samples, a 4:1 molar excess of inhibitor (typically 3 to 6 L) was added to 65 L of sample. The sample was left standing for 15 to 30 min to allow suffi cient time for binding, after which deuterated glycerol was added to the sample. Samples were mixed thoroughly and transferred to a 4 mm quartz EPR tube using a syringe fitted with plastic tubing. DEER Experiments DEER data were collected on a Brker EleX sys E580 EPR spectrometer (Billerica, M assachusetts ) equipped with the ER 4118X MD 5 dielectric ring resonator at a liquid nitrogen and inserted into the resonator. A series o f preliminary experiments was performed to determine the following parameters: center field, T m d 0 (time in ns at which the echo begins) pulse gate (the breadth of the echo in ns), and appropriate positions for the observer and pump frequenc ies the central resonance located at approximately 3460 G in the spectrum (Figure 5 6).

PAGE 138

138 field resonance approximately 26 G ted in Table 5 1. The four pulse DEER sequence (Figure 2 11) described in Chapter 2, is then applied to collect DEER data. The pulse parameters used with the Xepr software p ackage from Bruker Biospin are given in Table 5 2. DEER Data Analysis Data analysis was carried out as described in Chapter 2. The raw experi mental data was processed via Tikhonov Regularization (TKR) using DeerAnalysis2008 software to generate d istance distribution profiles and background subtracted dipolar evolution curves. The level of background subtraction was optimized via the self consi stent analysis (SCA). Finally, distance profiles were fit with a series of Gaussian functions. Population validation, described in Chapter 2, was done as necessary. Results and Discussion As described earlier in this chapter, the flap conformations of di fferent HIV 1 PR subtypes (B, C, F, and CRF01_A/E) and drug resistant constructs (V6 and MDR769) were previously determined by our group using DEER spectroscopy ( 45 51 ) The distance distribution profile represents the conformational ensemble, which corresponds to the sum of the sub populations that exist in HIV 1 PR ( 49 ) The four major conformational states or sub populations determined from NMR and ITC studi es and modeled by molecular dynamics (MD) simulations, are referred to as semi open, closed, wide open, and tucked/curled conformations ( 28, 29, 33 37 ) In this work, HIV 1 PR variants pre therapy (PRE), post therapy (POST) and PMUT1 (POST A82V) a construct containing drug pressure selected mutations, were analyzed by DEER

PAGE 139

139 spectroscopy. DEER results obtained were compared with B si and B si I63P apo construc ts. Also, the PRE and POST constructs were analyzed after addition of the protease inhibitor, ritonavir (RTV). The spin labeling efficiency of the HIV 1 PR samples were verified by mass spectrometry (MS) and CW EPR as described in Chapter 4. MS and CW EPR results for the B si and B si I63P constructs were presented in Chapter 4. However, for the PRE, POST and PMUT1 constructs, DEER analysis was performed on older samples, for which MS and CW EPR results are given in Appen dix B Comparison of HIV 1 PR Apo Con structs The comprehensive results of DEER data analysis for the apo constructs are shown in Figures 5 7 to 5 11. Figures 5 7 to 5 11 A show the overlay of the theoretical dipolar evolution curve from Gaussian reconstruction and the dipolar modulation fit to the experimental background subtracted echo. As described in Chapter 2, the TKR generated di polar modulation and theoretical curves are overlaid to ensure the curves matched. This procedure ascertains that the most accurate background subtraction i s chos en. Figures 5 7 to 5 11 B show the overlay of the TKR generated distance distribution and the distance profile obtained by Gaussian reconstruction. The process of Gaussian reconstruction is necessary for generating the individual populations that sum up to form the distance profile. This method determines the center, full width at half maximum (FWHM), and relative percentage of each peak, which are important parameters that characterize each in dividual population. Figures 5 7 to 5 11 C show the Gaussian popul ations and Table 5 3 to 5 7 lists the distance, FWHM, and relative percentage of the individual p opulations. Figures 5 7 to 5 11 D show the L curve used for choosing the appropriate regularization parameter ( ). As stated in Chapter 2,

PAGE 140

140 the optimum value of usually corresponds to the corner of the L curve. However, this was not applicable here, for reasons that will be explained later in the Experimental Limitations section. Figures 5 7 to 5 11 E show the Pake dipolar pattern resulting from Fourier transform ation of th e background subtracted echo and TKR genera ted fit Figure 5 12A and B shows the dipolar modulation and distance distribution profile, respectively, for the apo constructs generated by TK R analysis. Long pass filter, a digital filter ing system t hat selectively attenuates shorter waveleng ths, was applied to generate a dipolar evolution curve with an enhanced signal to noise ratio (SNR) and consequently improve DEER data analysis. Comparison of the dipolar evolution curves reveals some variations i n the oscillations. The oscillations for B si POST, and PMUT1 constructs are relatively broad and not well defined whereas oscillations for the PRE and B si I63P are more pronounced. Dipolar evolution curves that have well defined oscillations correspond to narrower distance distributions and shorter most probable distance, which is the most intense point of the distance distribution profile ( 50 ) The shift in t he first minimum of the echo curve (marked by a dashed vertical line on Figure 5 12A) indicates a difference in the frequency of the oscillations and variation in the most probable distance of the distance distribution profile (Figure 5 12B) ( 49 ) Comp arison of the most probable distance for HIV 1 PR apo constructs, given in Table 5 8, reveals that PRE and B si I63P have the same center at 33.2 whereas B si and POST have nearly similar values at 36.8 and 37.0 . The PMUT1 construct has a relatively fa rther most probable distance of 38.5 , where there is a noticeable splitting of the distance distribution into populations. This can be seen in the echo curve of PMUT1, where the first minimum is slightly shifted to the right, indicating a relatively

PAGE 141

141 long er distance compared to the other constructs. Figure 5 13 shows the distance profiles of PRE, POST, PMUT1, and B si I63P overlaid with the distance profile of B si The shift in most probable distance relative to B si is clearly evident for the PRE and B si I6 3P constructs. Figure 5 14 also shows a comparison of most probable distance between constructs. The Gaussian reconstruction process reveals the sub populations that comprise the distance distribution profile. The individual populations correspond to the four major flap conformations: tucked/curled (25 30 ), closed (~33 ), semi open (36 38 ), and wide open (40 46 ). The tucked/curled conformation refers to the state of HIV 1 PR when its flaps tuck or curl into the active site pocket ( 41, 44 ) This has been observed in MD simulations and the distances measured were consistent with findings from DEER studies. However, the exact distance assignment of these conformations has not been established. The Gaussian populations reported for each of the construct are based on results of the population validation process. Population validation was done to verify if some of the minor populations nee d to be suppressed. A comprehensive summary of the population validation process is given in Appendix C. Each of the peaks assigned in the Gaussian profile should represent real protein conformational states rather than artifacts or peaks arising from bac kground or noise. For example, as seen in the background subtracted dipolar evolution curve of the PRE construct on Figure 5 7A, the echo signal between = 2 to 3 s appears to have a large amount of noise compared to experimental data previously collect ed by our group. To verify this, distance profiles were obtained at different truncated values of at 2.0 s, 2.5 s, and 3.0 s. Figure 5 15 shows the dipolar evolution curves, the corresponding

PAGE 142

142 Gaussian population profiles, and the L curves. Table 5 9 s hows the relative percentages of the individual populations at the indicated values. When is truncated, it is noticeable that the populations at longer distances corresponding to the wide open conformation are shifted to a shorter distance. At = 2.0 s, the peak corresponding to the semi open conformation, disappeared. In effect, truncation of the value to 2.0 s, altered the relative percentage of the populations for the closed and w ide open conformations. Other than the large shift in the distanc e of the wide open conformation, there is only a slight difference in the relative percentage of the populations at = 2.5 s and = 3.0 s. In addition, only very minor changes were observed in the breadth of the populations for all values. Overall, t he effect of truncating is the reduction of the span of the distance profile because essentially removing some of the data at longer changes the level of background subtraction and manifests as a shift in the population at longer distances. However, it is still uncertain whether this results in the removal of noise and whether the population assigned to a wide open conformation is real or not. Table 5 10 and Figure 5 16 show the relative percentage of sub populations for each of the HIV 1 PR apo constr ucts. The population analysis is also presented as a 3D bar graph in Figure 5 17. The most predominant conformation for PRE and B si I63P is the closed conformation whereas B si POST, and PMUT1 have the largest percentage for the semi open conformation. R esults for B si are consistent with previous findings although with a small variation in the center and relative percentages for each sub population. This may be attributed to the inefficient labeling of the B si construct, which will be discussed in further detail in the Experimental Limitations section.

PAGE 143

143 The population breadth, which is measured by the FWHM, reflects the motion of the spin label in each conformation and the range of conformational sampling in the protein. A broad distribution indicates that the spin label is more flexible and that the flaps sample a wide range of conformations ( 45 ) Distributions corresponding to semi open and wide open conformations are usually broad whereas the closed conformation typically has a narrower popu lation breadth Upon addition of inhibitor, HIV 1 protease adopts the closed conformation whe re the flexibility and range of HIV 1 PR flap motion is limited ( 39, 45 ) DEER analysis of HIV 1 PR in the presence of ritonavir ( RT V ) showed that the breadth of the distance profile is 3. 0 which is narrower than that of the apoenzyme ( 45 ) In the inhibited state, it is known that large amplitude backbone motions are restricted and that the flaps undergo only very small and rapid oscillations ( 28, 150 ) Thus, the narrow breadth of distance profile for HIV 1 PR with inhibitor is attributed to the motion of the spin label about the flexible linker ( 49 ) The FWHM values of the semi open population for the B si and POST are 5.6 and 5.1 , respectively, which correspond to a relatively wide population breadt h compared to the narrower breadth for the closed conformation at about 4 for both constructs. This is consistent with results of previous DEER studies o n apo B si HIV 1 PR ( 49, 51 ) For the PRE and B si I63P constructs, t he population breadth s of the closed conformation are 3.8 and 3.5 respectively. How ever the difference between the FWHM of the closed and semi open populations for the PRE construct is 0.4 , which is evidently small, and for B si I63P the FWHM values are the same. Because PRE and B si I 63P have a large percent closed population of 56% an d 57%, respectively, >50% of the population adopt a conformation in which the motion of the flaps is restricted. As the

PAGE 144

144 protease transitions from closed to the open conformations, there is little to no change in the range of motion, as reflected in the val ues for FWHM. Interestingly, results for PMUT1 are different in that the FWHM values are smaller than expected for a construct having a predominant semi open conformation. The population breadth for both closed (3.4 ) and semi open conformation (3.6 ) is almost the same and the breadth is smaller for the wide open conformation at 2.7 DEER results for the PRE construct are unexpected because an apo construct with a large percentage of closed conformation has not been previously reported. X ray crysta l structures of l igand free HIV 1 PR primarily exhibit the semi open conformation ( 28, 29, 33 37, 40 ) This has been confirmed by DEER studies for subtypes B, C, CRF_01 A/E, F and multi drug resistant constructs V6 and MDR769 ( 48 51 ) It has been shown that V6 has a shorter most probable distance and is more closed compared to B si but its predominant conformation is semi open. C rystal structures of all inhibitor bound HIV 1 P R are found in the closed conformation because the flaps, close in and interact with the inhibitor via a conserved water molecule ( 27 ) This is consistent with DEER results and MD simulations that inhibitor bound HIV 1 PR adopt s the closed conformation ( 39, 45 ) However, MD simulation s tudies of unbound closed HIV 1 PR which is achieved by remov ing the inhibitor from the bound state of HIV 1 PR showed that the average distance and profile breadth are similar to the bound closed simulations ( 39 ) In addition, intraflap hydrogen bonding which may have stabilized the closed flap conformation was observed in the simulations These results indicate that despite the loss of flap inhibitor interactions, ligand free protease may adopt a cl osed conformation

PAGE 145

145 The predominant closed conformation for the PRE construct may be due to some interactions within the protease that stabilize the closed conformation. It is possible that t he closed conformation is stabilized by specific amino acid resid ues which are located in critical sites of HIV 1 PR This led to careful examination of the amino acid differences of PRE relative to B si PRE and B si differ in amino acids at sites 37, 39, 62, and 63, which are located in the hinge area (Figure 5 18). In drug resistant HIV 1 PR variants, the L63P mutation is identified as a secondary mutation that compensates for the decrease in function and activity as a consequence of primary mutations. Interestingly, a number of studies have revealed that the L63P muta tion, although associated with progression to drug resistance, is also commonly present in drug nave patient isolates. The presence of proline at site 63 in the PRE construct may have some functional advantage and its location in the protein possibly lea ds to a more rigid protease and less flexible flaps. It is also possible that the L63P mutation is preserved in HIV 1 PR pre therapy variants to maintain its activity in the presence of inhibitors. Thus, it is of interest to investigate the effect of the L 63P mutation on the flap conformations of HIV 1 PR. DEER analysis on the B si I63P mutant was performed to compare its flap conformation with the B si and PRE constructs. Recall that the mutation is I63P rather than L63P because the B si construct contained t he L63I stabilizing mutation. This further supports that position 63 is a critical site that can affect the stability of the protease. DEER results clearly showed a shift in the most probable distance of the B si I63P construct relative to B si and that it h as a large percentage of closed conformation of 57%, similar to the PRE construct. This provides evidence that a single secondary mutation can drastically shift the conformational ensemble of HIV 1 PR. Additionally, the

PAGE 146

146 proline at site 63 in the PRE constr uct may have contributed largely to its conformational ensemble. The combined percentage of semi open and wide open conformations for the POST construct (74%) is greater than PRE (18%) and the percent population for the wide open conformation (26%) is grea ter relative to B si (12%). Because the POST construct is composed of seve ral mutations, which are selected for by RTV IDV combination inhibitor therapy, these may have a profound effect on the flap conformation and flexibility. Relative to PRE, it contain s mutations in the active site ( V 82 A ), near active site ( L 10 I and I 15 V ), flap ( I 54 A and Q 58 E ), and hinge ( E34Q, M36I, and T37N ) regions (Figure 5 18). The flap and hinge mutations are located in sites that can influence the motion and flexibility of the fl aps. Therefore, t he combined effect of the mutations is to shift the conformational ensemble, in which the majority of the population is in an open conformation. Additionally, the broader than average breadth for the distance distribution profile compared to previously reported results on other constructs, indicates either an increase in flexibility of the flaps or the flaps are relatively unstable in the closed conformation. The PMUT1 construct consists of the same mutations as the POST except that the mu tation at position 82 was back mutated to Val which is present in the PRE construct. The V82A mutation is a primary mutation common in most drug resistant constructs such as in V6 and MDR769. Because it is an active site mutation, it directly affects inhi bitor binding. It is associated with the initial decrease in effectiveness of RTV and also observed in patient isolates receiving IDV and LPV ( 58, 81 ) As discussed in Chapter 1, the substitution of Ala with Val was studied by Ho et al. to determine the

PAGE 147

147 effect of reverting a particular site in the POST sequence to a pre therapy amino acid residue, on viral replicative capacity and PI sensitivity ( 100 ) Th e amino acid substitution resulted in 50% recovery of replicative capacity and about 50% increase in sensitivity to either RTV or IDV relative to PRE. In this work, the effect of the A82V mutation on the flap conformation and flexibility was investigated. DEER results revealed that the predominant conformation of PMUT1 is semi open. However, the percent closed population of 33% is almos t 2 times larger than that for POST (18%) and the percentage of wide open conformation decreased markedly from 29% for POST to 4% for PMUT1. In addition, the percentage of closed conformation increased to almost 50% of PRE, indicating that there may be som e rearrangement in the active site pocket occurring in a certain fraction of the population such that the flaps adopt a more closed conformation. Overall, the changes observed in the populations of PMUT1 relative to PRE and POST provides evidence that a si ngle active site mutation can dramatically alter the protein conformational ensemble. Comparison of HIV 1 PR Constructs With and Without RTV As previously stated the effect of addition of inhibitor to HIV 1 PR is a shift from semi open to a cl osed confor mation Upon inhibitor binding, the flaps are expected to close in on the active site and interact with the inhibitor, allowing HIV 1 PR to adopt a rigid conformation known as the closed conformation. NMR studies on flap dynamics and structure based analys is on binding energetics have provided evidence that inhibitor bound HIV 1 PR adopts a closed conformation ( 28, 29, 33, 34 ) DEER results of different HIV 1 PR subtypes have shown that the inter flap distance shifts from about 36 to 33 upon inhibitor binding ( 48 51 )

PAGE 148

148 Multi drug resistant constructs contain both primary and secondary mutations that influence flap conformation and flexi bility. It is expected that a drug res istant HIV 1 PR which is previously exposed to an inhibitor that select ed for mutations in the protease will not bind to a protease inhibitor as effectively. The active site mutations directly affect protease inhibitor interaction whereas non active site mutations alter the motion of the flaps by either preventing HIV 1 PR to reach the wide open conformation and thus disallowing access to inhibitor or preventing the flaps from closing so that the inhibitor cannot interact with active site amino acid residu es effectively ( 23 ) A multi drug resistant construct, V6, was analyzed by DEER to determine the effect of addition of inhibitor on the flap conformation ( 49 ) Results were mostly similar to B si with one notable exception. The protease inhibitor RTV, which had a st rong ef fect on flap closing of B si has only a minimal effect on the distance distribution profile of V6. These results are expected since the mutations present in V6 were selected under RTV therapy. In this work, the effect of addition of RTV to the PRE and POST HIV 1 PR variants was investigated. D EER data analysis of the PRE and POST constructs in the presence of ritonavir (RTV) are given in Figures 5 19 and 5 20 and a summary of the Gaussian population profiles is listed on Tables 5 11 and 5 12. A comp arison between the dipolar evolution curves and distance distribution profiles of HIV 1 PR in the absence and presence of RTV is shown in Figure 5 21. The dipolar modulation of PRE in the presence of RTV (Figure 5 21A) clearly reveals a shift in the first minimum and an increase in the frequency of oscillations compared to PRE apo. This indicates a shift in the distance distribution to shorter distances and a narrower breadth of population. There is a considerable decrease in the

PAGE 149

149 breadth of each population; however, Figure 5 21C shows that the most probable distance of both apo and bound PRE is exactly the same at 33.2 . The observed changes in oscillations in the dipolar evolution curve manifest as a variation in the percentages of the sub populations. Tab le 5 13 presents a summary of the relative percentage for each sub population and Figure 5 22 shows separate bar graphs for each population. The differences in the relative percent for each population between the constructs with and without RTV are clearly illustrated in Figure 5 23. Compared to PRE apo, values for PRE in the presence of RTV reveal a slight increase in the percent closed population (from 56% to 65%) and small decrease in the semi open conformation (from 17% to 7%). This indicates that some fraction of the population may be accounted for by RTV bound PRE. The total percent tucked/curled conformation and the percentage population of wide open however, are almost the same. In contrast to PRE, the dipolar evolution curves of POST in the absenc e and presence of RTV (Figure 5 21B) do not reveal any changes in the frequency of oscillations. Although the oscillation for the POST with RTV is slightly more well defined than POST apo, both echo curves are relatively broad indicating wider distribution profiles. The noticeable downward shift in the first minimum of dipolar evolution curve of POST in the presence of RTV may be attributed to the shift in the most probable distance from 37.0 to 36.0 as seen in the distance distribution profile (Figure 5 21D), but it may also be due to the large change in percentage of populations at longer distances. Figure 5 23 clearly shows a relatively large decrease in the percentage of wide open conformation of 17%. However, there is almost no change in the percent semi open population relative to POST apo. A slight increase in the percentages of

PAGE 150

150 closed (from 18% to 24%) and tucked/curled (from 8% to 17%) conformations is also observed. The increase in % tucked/curled and % closed and corresponding decrease in % wid e open possibly indicate s the presence of RTV bound HIV 1 PR. To some extent, the DEER results for the PRE construct in the presence of RTV are inconsistent with the expected results that there should be a significant change in the percentage of closed po pulation. This is not surprising, however, because the PRE apo construct is predominantly closed, indicating that its flaps are less flexible. Having a restricted motion in the flaps decreases the likelihood of flap opening and allowing access of an inhibi tor to the active site cavity. Th us, only a small fraction of the closed population may be accounted for by RTV bound HIV 1 PR. As mentioned previously PRE contains some amino acid residues that are different from B si and this may have some effect on the flexibility of the flaps. Although the variant is a pre therapy isolate, it contains the L63P mutation, which is associated with progression to high level drug resistance. It is possible that the proline at that particular site has some impact on the flap motion and conformation of HIV 1 PR and a subsequen t effect on inhibitor binding. DEER results for POST in the presence of RTV are consistent with expectations for a drug resistant construct in that addition of inhibitor has a minimal effect on the conform ational ensemble In addition, these findings, which are similar to V6, are expected because the mutations present in the POST construct were selected under RTV therapy. The combination of mutations may have stabilized the wide open conformation which pre vents the flaps from closing and binding with the inhibitor. Thus, drug pressure selected mutations clearly influence the motion and flexibility of HIV 1 PR, which ultimately determ ines the binding of inhibitor.

PAGE 151

151 Experimental Limitations A number of experim ental factors affect the quality of DEER data obtained. These include quality of sample, signal to noise ratio (SNR), and maximum dipolar evolution time ( t max ). The sample is considered of good quality on the basis of spin labeling efficiency and absence o f any protein aggregation. Obtaining a sample of good quality was addressed in Chapter 4. This is essential because it determines the signal to noise ratio (SNR), which ultimately affects the quality of DEER data ( 49 ) Most of the signal collected from DEER is attributed to background, which means only a small fraction is due to the spin spin interaction of interest. If a sample is poorly spin labeled, it will contain mostly unlabeled or singly labeled proteins, resulting in a decrease in the DEER echo signal. Aggregation of protein is not particularly desirable for DEER analysis because it increases the signal due to background and dampens oscillations in the dipolar evolution curve. In addition, in the presence of aggregation, the intermolecular distan ce can be smaller and thus overlap with the population of spins at longer distances, which c omplicates DEER data analysis. Signal to noise ratio (SNR) largely affects the quality and accuracy of the distance distribution profile ( 49 ) As mentioned, goo d SNR can be obtained in a short amount of time if samples are efficiently spin labeled. Samples with low SNR usually contain a large amount of noise that masks oscillations in the data. As demonstrated earlier, the effect of truncating is to shift the f arthest populations to shorter distances. However, this method did not determine whether some noise was effectively removed and that assignment of the population at longer distances is still uncertain. Low SNR is also manifested as a distortion in the shap e of the L curve. This complicates DEER data

PAGE 152

152 analysis because the corner of the L curve, which often represents the optimum value, is obscured. The distortion is primarily observed in the small value region, where the curve is dominated by the smoothing function (log ). An indication of poor SNR is the large increase in deviation (log ) at small values ( 49 ) This can be observed in almost all of the DEER results presented with a few exceptions, particularly B si I63P, which clearly has good SNR bas ed on its experimental dipolar evolution curve (Figure 5 10A). Samples with a large amount of noise seen in the experimental dipolar modulation usually have distorted L curves, which i s particulary observed for POST RTV. Other c onstructs, such as PRE apo, PRE RTV and POST apo, h ave higher SNR relative to POST RTV but do not have perfectly shaped L curves, which led to difficulty in selecting the optimum value. In contrast, PMUT1 and B si which have relatively lower SNR compared to B si I63P, adopt a normal shaped L curve. However, selection of the optimal value for PMUT1 is complicated. Another consequence of poor SNR is the dampening of oscillations leading to broader than average distance profiles. This was particularly observed in the POST and B si sam ples. The discrepancies in the results of the B si construct compared to previous results reported by our group may be attributed to the spin labeling efficiency, which was reported in Chapter 4 to be only about 70 80%, and may have resulted in a lower SNR. The MS data for the PRE construct (Figure B 3) also shows underlabeling of the sample, which may have an effect on the L curve. The POST and PMUT1 constructs have acceptable spin labeling efficiency based on the MS data shown in Figures B 4 and B 5, respe ctively. However, DEER analysis of the samples is complicated because of poor SNR of data for both constructs. B si I63P, which was reported in Chapter 4 to be efficiently labeled, is the only construct

PAGE 153

153 that produced an acceptable SNR and therefore did not complicate DEER analysis. The possible inaccuracies and uncertainty of the DEER results, particularly in assigning conformations corresponding to the minor populations, are certainly attributed to low SNR. Spin labeling efficiency and SNR are important fa ctors that determine the time for data collection. In addition, the time for collecting data also depends on the maximum dipolar evolution time, t max It has been determined that increasing the t max results in a decrease in the breadth of the distance prof ile, which correspond to dipolar evolution curves having more frequent oscillations ( 49 ) Therefore, to obtain a distance profile with an accurate breadth of population, the dipolar evolution curves must be collected at sufficiently long t max to captur e at least two oscillations.

PAGE 154

154 Figure 5 1. HIV 1 PR crystal structures showing the (red) closed (PDB ID 2BPX) and (blue) semi open (PDB ID 1HHP) flap conformations with spin labels at the urn et al. ( 48 ) Copyright 2009 American Chemical Society. Figure 5 2. A) Dipolar evolution curves for apo (black) and RTV bound (gray) subtype B HIV 1 PR and B) corresponding distance distribution profiles. Figure adapted from Galian o ( 47 )

PAGE 155

155 Figure 5 3. Distance dist ribution profiles of subtype B HIV 1 PR apo and with inhibitors closing. Figure adapted from Blackburn ( 49 ) Figure 5 4. A) Dipolar evolution curves for subtype B apo (black), V6 (gray), and MDR769 (light gray) and B) corresponding distance distribution profiles. Figure adapted from Galiano ( 47 )

PAGE 156

156 Figure 5 5. A) Distance distribution profiles of apo forms of HIV 1 PR subtype B, C, F, CRF01_A/E and multi drug resistant constructs, V6 and MDR769, and B) population a nalysis summarizing the relative percentage of each conformation. Figure adapted from Kear ( 51 ) Figure 5 6. Absorption spectra for a nitroxide spin label. The peak maximum at the 1 ) and the low f ield transition 2 ).

PAGE 157

157 Tabl e 5 1. Standard parameters for DEER data collection. Parameter Value Sweep width 160 G Shot repetition time 4000 Shots/point 100 Center Field ~3460 G Low Field ~3432 G Frequency ~9. 6 GHz Pulsed Attenuation 0.1 Video Bandwidth 25 MHz Modulation Amplitude ~1 G Time Constant 0.082 0.164 s Receiver Phase 100 Number of Scans Variable Ta ble 5 2. Parameters used for the pulse sequence. Parameter d0 d1 d2 d3 PG dx Value 100 200 30 00 100 220 12

PAGE 158

158 Figure 5 7 DEER data analysis for PRE apo. A) Background subtracted dipolar echo curve (black) overlaid with the TKR generated dipolar modulation (red) and Gaussian reconstructed dipolar modulation (blue), B) distance distribution profil e from TKR analysis (red) overlaid with the sum of the populations obtained by Gaussian reconstruction (blue dashed), C) individual Gaussian populations, D) L curve ( = 10), and E) Pake dipolar pattern. Tab l e 5 3. Individual population profiles for PRE a po. Center () ( 0.3 ) FWHM () ( 0.5 ) Relative Population ( %) ( 5 %) Tucked/Curled 1 22.0 2.8 4 Tucked/Curled 2 25.1 3.4 18 Closed 33.2 3.3 56 Semi Open 38.3 3.7 17 Wide Open 45.1 3.2 5

PAGE 159

159 Figure 5 8 DEER data analysis for POST apo. A) Backg round subtracted dipolar echo curve (black) overlaid with the TKR generated dipolar modulation (red) and Gaussian reconstructed dipolar modulation (blue), B) distance distribution profile from TKR analysis (red) overlaid with the sum of the populations obt ained by Gaussian reconstruction (blue dashed), C) individual Gaussian populations, D) L curve ( = 100), and E) Pake dipolar pattern. Table 5 4. Individual population profiles for POST apo. Center () ( 0.3 ) FWHM () ( 0.5 ) Relative Population ( %) ( 5 %) Tucked/Curled 28.9 4.2 8 Closed 33.4 4.2 18 Semi Open 36.9 5.1 45 Wide Open 40.6 5.5 29

PAGE 160

160 Figure 5 9 DEER data analysis for PMUT1 apo. A) Background subtracted dipolar echo curve (black) overlaid with the TKR generated dipolar modulation ( red) and Gaussian reconstructed dipolar modulation (blue), B) distance distribution profile from TKR analysis (red) overlaid with the sum of the populations obtained by Gaussian reconstruction (blue dashed), C) individual Gaussian populations, D) L curve ( = 10 ), and E) Pake dipolar pattern. Table 5 5. I ndividual population profiles for PMUT1 apo. Center () ( 0.3 ) FWHM () ( 0.5 ) Relative Population ( %) ( 5 %) Tucked/Curled 1 24.4 2.0 4 Tucked/Curled 2 28.0 1.8 4 Closed 32.9 3.4 33 Semi Open 38.7 3.6 55 Wide Open 46.4 2.7 4

PAGE 161

161 Figure 5 10 DEER data analysis for B si apo. A) Background subtracted dipolar echo curve (black) overlaid with the TKR generated dipolar modulation (red) and Gaussian reconstructed dipolar modulation (blue), B) distance distribution profile from TKR analysis (red) overlaid with the sum of the populations obtained by Gaussian reconstruction (blue dashed), C) individual Gaussian populations, D) L curve ( = 100), and E) Pake dipolar pattern. Table 5 6 I ndividual populati on profiles for B si apo. Center () ( 0.3 ) FWHM () ( 0.5 ) Relative Population ( %) ( 5 %) Closed 32.8 4.3 17 Semi Open 36.9 5.6 71 Wide Open 41.6 3.7 12

PAGE 162

162 Figure 5 11 DEER data analysis for B si I63P apo. A) Background subtracted dipolar echo curve (black) overlaid with the TKR generated dipolar modulation (red) and Gaussian reconstructed dipolar modulation (blue), B) distance distribution profile from TKR analysis (red) overlaid with the sum of the populations obtained by Gaussian reconstruct ion (blue dashed), C) individual Gaussian populations, D) L curve ( = 10), and E) Pake dipolar pattern. Table 5 7. I ndividual population profiles for B si I63P apo. Center () ( 0.3 ) FWHM () ( 0.5 ) Relative Population ( %) ( 5 %) Tucked/Curled 3 0.5 3.7 10 Closed 33.2 3.5 57 Semi Open 36.6 3.5 27 Wide Open 42.8 3.8 6

PAGE 163

163 Figure 5 12 (A) Dipolar evolution curve s where background subtracted echo (black) is overl aid with the TKR generated fit and (B) distance dis tribution profile s of HIV 1 PR PRE (blue), POST (red), PMUT1 (magenta), B si (green), and B si I63P (orange) apo constructs Table 5 8. Summary of most probable distance of HIV 1 PR apo constructs. Most Probable Distance () ( 0.2 ) PRE 33.2 POST 37.0 P MUT1 38.5 B si 36.8 B si I63P 33.2

PAGE 164

164 Figure 5 13 Overlay of distance distribution profiles of HIV 1 PR A) PRE (blue), B) POST (red), C) B si I63P (orange) and D) PMUT1 (magenta) with B si (black dashed) apo constructs Figure 5 1 4 Overlay of dist ance distribution profiles of HIV 1 PR A) PRE (blue) and POST (red), B) PRE (blue) and B si I63P (orange), C) PRE (blue) and PMUT1 (magenta), and D) POST (red) and PMUT1 (magenta).

PAGE 165

165 Figure 5 1 5 Background subtracted dipolar echo curve (black) overlaid with the TKR generated dipolar modulation (red) and Gaussian reconstructed dipolar modulation (blue) individual Gaussian populations and L curves respectiv e ly, for HIV 1 PR PRE apo at A), B) and C) = 2.0 s; D), E ) and F) = 2.5 s; and G ) H) and I ) = 3.0 s. Table 5 9 Comparison of relative percentage s of the individual population s for HIV 1 PR PRE apo at different values Relative Population ( %) ( 5 %) Distance Assignment ( ) = 2.0 s = 2 .5 s = 3.0 s Tucked/ Curled 1 25 30 5 5 4 Tucked/ Curled 2 25 30 16 17 18 Closed 33 64 58 56 Semi open 36 38 0 15 17 Wide open 40 46 15 5 5

PAGE 166

166 Table 5 10 Comparison of the relative percentage s of the individual population s for HIV 1 PR apo constructs. Relative Popula tion ( %) ( 5 %) Distance Assignment ( ) PRE POST PMUT1 B si B si I63P Tucked/ Curled 25 30 22 8 8 0 10 Closed 33 56 18 33 17 57 Semi open 36 38 17 45 55 71 27 Wide open 40 46 5 29 4 12 6 Figure 5 1 6 Individual plots showing relative percentage of A) tucked/curled, B) closed, C) semi open a nd D) wide open conformations for HIV 1 PR PRE, POST, PMUT1, B si and B si I63P apo constructs. Error is 5 %.

PAGE 167

167 Figure 5 1 7 Population analysis of HIV 1 PR PRE (blue), POST (red), PMUT1 ( magenta), B si (green), and B si I63P (orange) apo constructs Error is 5 %. Figure 5 18 Ribb on diagrams of HIV 1 PR PRE and POST in which the amino acid differences relative to subtype B LAI are highlighted and labeled

PAGE 168

168 Figure 5 19 DEER data ana lysis for PRE RTV. A) Background subtracted dipolar echo curve (black) overlaid with the TKR generated dipolar modulation (red) and Gaussian reconstructed dipolar modulation (blue), B) distance distribution profile from TKR analysis (red) overlaid with th e sum of the populations obtained by Gaussian reconstruction (blue dashed), C) individual Gaussian populations, D) L curve ( = 10), and E) Pake dipolar pattern. Tab l e 5 11 I ndividual population profiles for PRE RTV. Center () ( 0.3 ) FWHM () ( 0. 5 ) Relative Population ( %) ( 5 %) Tucked/Curled 1 24.3 4.0 11 Tucked/Curled 2 30.9 2.3 13 Closed 33.4 3.0 65 Semi Open 38.3 2.3 7 Wide Open 46.4 2.7 4

PAGE 169

169 Figure 5 20 D EER data analysis for POST RTV. A) Background subtracted dipolar echo curve (bl ack) overlaid with the TKR generated dipolar modulation (red) and Gaussian reconstructed dipolar modulation (blue), B) distance distribution profile from TKR analysis (red) overlaid with the sum of the populations obtained by Gaussian reconstruction (blue dashed), C) individual Gaussian populations, D) L curve ( = 10 0 ), and E) Pake dipolar pattern. Tab l e 5 12 Individua l population profiles for P OST RTV. Center () ( 0.3 ) FWHM () ( 0.5 ) Relative Population ( %) ( 5 %) Tucked/Curled 1 26.5 3.1 4 Tucked/Curled 2 29.7 3.3 13 Closed 33.1 3.7 24 Semi Open 36.6 4.4 47 Wide Open 40.8 4.0 12

PAGE 170

170 Figure 5 21 Overlay of background subtracted dipolar echo curve (gray) with TKR generated dipolar evolution c urves of A) PRE apo (blue) and PRE RTV (black dashed) and B) POST apo (red) and POST RTV (black dashed) and overlay of distance distribution profiles of C) PRE apo (blue) and PRE RTV (black dashed) and D) POST apo (red) and POST RTV (black dashed). Table 5 13 Comparison of relative percentages of the individual populations for PRE and POST HIV 1 PR constructs in the absence and presence of RTV Relative Population ( %) ( 5 %) Distance Assignment ( ) PRE APO PRE RTV POST APO POST RT V Tucked/ Curled 25 30 22 24 8 17 Closed 33 56 65 18 24 Semi open 36 38 17 7 45 47 Wide open 40 46 5 4 29 12

PAGE 171

171 Figure 5 22 Individual plots showing relative percentage of A) tucked/curled, B) closed, C) semi open and D) wide open conformations of PRE and POST HIV 1 PR constructs in the absence and presence of RTV Error is 5 %. Figure 5 2 3 Change in relative percent of tucked/curled, closed, semi open and wide open conformations of PRE RTV relative t o PRE apo (blue) and POST RTV relative to POST apo (red) Error is 5 %.

PAGE 172

172 CHAPTER 6 CONCLUSIONS AND FUTU RE WORK Conclusions This work investigated different s ubtype B HIV 1 PR variants by Double Electron Electron Resonance (DEER) spectroscopy. In particular DEER results for the pre therapy (PRE i ) and post therapy (POST i ) construct s wer e compared to determine the effect of drug pressure selected mutations on flap conformation and flexibility Other mutants were also constructed by reverting sites in POST i to PR E i amino acid residues. The PRE i POST i and P O ST i A82V construct s were also compared to B si which is th e inactive and stabilized form of subtype B LAI, and B si I63P constructs In Chapter 3, the cloning and mutagenesis of all HIV 1 PR construc ts w ere presented. Because the codon optimized genes, Pre i K55C and Post i K55C DNA, were purchased in a vector that is not suitable for expression, cloning had to be performed to insert the target genes into the pET23a vector. The results have shown that PRE an d P OST DNA were successfully cloned into pET23 a Mutagenesis experiments were performed to obtain the following constructs containing drug pressure selected mutations: 1) pET23_ PMUT1, 2) pET23_ PMUT3, 3) pET23_ PMUT2, and 4) pET23_ PMUT5. Based on t he DNA sequencing results, all of the mutants were successfully constructed. The success of cloning and mutagenesis experiments was important as the DNA obtained was used for expression of HIV 1 PR in BL21(DE3) pLysS E. coli cells. Results for the purificat ion and characterization of HIV 1 PR were presented in Chapter 4. The following purified and spin labeled inactive HIV 1 PR constructs: 1) P RE 2) P OST, 3) P MUT1 4) PMUT2 5) P MUT3 6) P MUT5, 7) B si and 8) B si I63P

PAGE 173

173 (See Table 3 3 for the naming convention) were characterized by SDS PAGE, CD spec troscopy, MS, and CW EPR for subsequent analysis by DEER spectroscopy. SDS PAGE analysis was done on samples to determine the purity of HIV 1 PR. The HIV 1 PR constructs were determined to be >95% pure after the refolding and buffer exchange process. CD sp ectroscopy was performed to verify the secondary structure of the HIV 1 PR constructs. Results showed that the purified and spin labeled proteins were correctly folded. MS analysis was carried out to confirm the MW of the spin labeled HIV 1 PR and to check for presence of any unlabeled protein. Results showed that some of the HIV 1 PR constructs, particularly P MUT3 P MUT5, and B si were less than 80% labeled and may not be suitable for DEER analysis. Based on the CW EPR spectra, all HIV 1 PR constructs have good SNR. However, determination of the spin label concentrations for the proteins revealed that PMUT3, PMUT5, and B si may not be efficiently labeled, which is consistent with MS results. Results for the DEER analysis of the PRE, POST, PMUT1, B si and B si I63P apo constructs were presented in Chapter 5. By detecting shifts in the inter flap distances, DEER spectroscopy is useful in determining changes in the conformational ensemble of HIV 1 PR. DEER results have shown variations in the population of confo rmational states of different subtypes and variants of HIV 1 PR. However, the accuracy of the assignment of populations is limited by the quality of the data. The signal to noise ratio (SNR) has to be sufficiently high to accurately determine lowly populat ed conformational states. Nevertheless, the technique is useful in comparing the predominant conformations of different apo HIV 1 PR constructs PRE and B si I63P have predominantly closed conformations, indicating a limited flexibility in the range of

PAGE 174

174 HIV 1 PR flap motion, whereas POST, POST A82V, and B si have the expected predominant semi open conformation. DEER results also showed that addition of ritonavir (RTV) to the PRE and POST constructs did not significantly shift the conformational ensemble of HI V 1 PR. The results demonstrate that certain amino acids in the PRE construct, particularly at site 63, and the combination of mutations in the POST construct, have a major impact on the flap conformation and flexibility. Future Work DEER analysis needs t o be performed on the purified and spin labeled PRE, POST, and PMUT1 samples, which were reported to have good spin labeling efficiency in Chapter 4, to obtain DEER data with high SNR. Data needs to be recollected for these constructs in order to verify DE ER results presented in this work and to determine the reproducibility of analyzing efficiently spin labeled samples and DEER data with good SNR. DEER analysis on the PRE and POST constructs in the presence of RTV also needs to be repeated because of low S NR. The other POST mutants constructed in Chapters 3 and 4 will also be analyzed. Proper folding of constructs needs to be verified by further CD analysis to compare the % sheet structure of the constructs containing mutations with PRE, POST, and B si Ad ditional DEER studies will be performed by determining the effects of substrates (CA/p2 and p2/p7) and FDA approved inhibitors on the flap conformations of all HIV 1 PR constructs in this work. For constructs in the presence of inhibitor, inhibitor binding needs to be verified using other techniques such as ITC and NMR titration experiments.

PAGE 175

175 APPENDIX A PRIMER CHARACTERISTI CS AND PCR PARAMETER S FOR MUTAGENESIS EXPERIMENTS Table A 1. Primers used in incorporating mutations into pET23_ POST to produce the pET23_ PMUT1 construct. Mutation T m ( C) MW GC content (%) A82V Forward GTGGGTCCAACTCCGGTAAACATTATCGGCCG 66.1 9,825.4 56.2 Reverse CGGCCGATAATGTTTACCGGAGTTGGACCCAC 66.1 9,825.4 56.2 Table A 2. Primers used in incorporating mutations into pET23_ POST to produce the pET23_ PMUT3 construct. Mutation T m ( C) MW GC content (%) A82V Forward GTGGGTCCAACTCCGGTAAACATTATCGGCCG 66.1 9,825.4 56.2 Reverse CGGCCGATAATGTTTACCGGAGTTGGACCCAC 66.1 9,825.4 56.2 I10L Forward GCTGTGGCAACGTCCGCTTGTCACCATCAAAG 67.0 9,785.4 56.2 Reverse CTTTGATGGTGACAAGCGGACGTTGCCACAGC 67.0 9,865.4 56.2 V15I Forward CGCTTGTCACCATCAAAATTGGCGGTCAGCTGAAAG 66.1 11,069.2 50.0 Reverse CTTTCAGCTGACCGCCAATTTTGATGGTGACAAGCG 66.1 11,051.2 50 .0 Table A 3. Primers used in incorporating mutations into pET23_ POST to produce the pET23_ PMUT2 construct Mutation T m ( C) MW GC content (%) A54I Forward GGCATCGGCGGTTTTATCTGCGTCCGTGAGTAC 67.2 10,167.6 57.5 Reverse GTACTCACGGACGCA GATAAAACCGCCGATGCC 67.2 10,101.6 57.5 E58Q Forward GGTTTTATCTGCGTCCGTCAGTACGACCAGGTGCCG 68.4 11,059.2 58.3 Reverse CGGCACCTGGTCGTACTGACGGACGCAGATAAAACC 68.4 11,064.2 58.3

PAGE 176

176 Table A 4. Primers used in incorporating mutations into pET23_ POST to produce the pET23_ PMUT5 construct. Mutation T m ( C) MW GC content (%) A54I Forward GGCATCGGCGGTTTTATCTGCGTCCGTGAGTAC 67.2 10,167.6 57.5 Reverse GTACTCACGGACGCAGATAAAACCGCCGATGCC 67.2 10,101.6 57.5 E58Q Forward GGTTTTATCTGCGTCCGTC AGTACGACCAGGTGCCG 68.4 11,059.2 58.3 Reverse CGGCACCTGGTCGTACTGACGGACGCAGATAAAACC 68.4 11,064.2 58.3 Q34E Forward CGGACGATACCGTTCTGGAGGAAATCAACTTGAC 63.8 10,475.8 50.0 Reverse GTCAAGTTGATTTCCTCCAGAACGGTATCGTCCG 63.8 10,408.8 50.0 I36M Forward GTTCTGGAGGAAATGAACTTGACGGGTCGC 63.9 9,327.1 53.3 Reverse GCGACCCGTCAAGTTCATTTCCTCCAGAAC 63.9 9,086.9 53.3 N37T Forward GTTCTGGAGGAAATGACCTTGACGGGTCGCTG 66.0 9,936.5 56.2 Reverse CAGCGACCCGTCAAGGTCATTTCCTCCAGAAC 66.0 9,714.3 56.2 Table A 5. Prime rs used in incorporating mutations into pET23_ B si to produce the pET23_ B si I63P construct. Mutation T m ( C) MW GC content (%) I63P Forward CAGTACGACCAGATCCCTATCGAAATCGCCGGC 66.5 10,052.6 57.5 Reverse GCCGGCGATTTCGATAGGGATCTGGTCGTACTG 66.5 10,216.6 57.5 Table A 6. Components of the PCR mixture and their corresponding volume for site directed mutagenesis. Order of Addition Component Volume PCR Mixture 1 ( L) Volume PCR Mixture 2 ( L) Volume Control ( L) 1 Water 34.5 38 38 2 DMSO 2.5 0 0 3 dNTP Mix (10mM) 1 1 1 4 Primers Forward 2 1.5 2 Reverse 2 1.5 2 5 Template DNA 2 2 2 6 Pfu buffer 5 5 5 7 Pfu polymerase 1 1 0 Total Volume 50 50 50

PAGE 177

177 Table A 7. Thermal cycling parameters for HIV 1 protease site directed mutagenesis re actions. Segment Cycles Temperature ( C) Time 1 1 95 30 sec 2 18 95 30 sec 55 1 min 68 6 min

PAGE 178

178 APPENDIX B ADDITIONAL INFORMATI ON ON THE PURIFICATION AND CHARACTERIZATION OF HIV 1 PR CONSTRUCTS Table B 1. Buffers used in the purifi cation of HIV 1 PR. Buffer pH Component Resuspension Buffer 7.5 20 mM Tris HCl (Stored at 25 C) 1 mM EDTA a 10 M BME b Wash Buffer 1 7.0 25 mM Tris HCl (Stored at 4 C) 2.5 mM EDTA 0.5 M NaCl 1mM Gly Gly 50 M BME Wash Buffer 2 7.0 25 mM Tris HCl (Prepared fresh) 2.5 mM EDTA 0.5 M NaCl 1mM Gly Gly 50 M BME 1M Urea Wash Buffer 3 7.0 25 mM Tris HCl (Stored at 4 C) 1.0 mM EDTA 0.5 M NaCl 1mM Gly Gly 50 M BME Inclusion Body (IB) Adjust depending on the pI 25 mM Tris HCl Resuspension Buffer of protein (not >0.5 lower than pI) 2.5 mM EDTA (Prepared fresh) 0.5 M NaCl 1mM Gly Gly 50 M BME 9M Urea a EDTA: Ethylenediaminetetraacetic acid; b BME: mercapthoethanol Table B 2. Optical density at 280 nm a nd estimated protein concentration of HIV 1 PR samples used for CD data collection. HIV 1 PR Construct OD 280 Estimated Protein Concentration ( M) PRE 0.251 20.1 P OST 0.332 26.6 PMUT1 0.262 21.0 PMUT3 0.325 26.0 PMUT2 0.266 21.3 PMUT5 0.308 24.7 B si 0.256 20.5 B si I63P 0.253 20.3

PAGE 179

179 Table B 3. Optical density at 280 nm and estimated concentration of HIV 1 PR samples used for EPR data collection and concentration of spin label for the HIV 1 PR monomer determined from CW EPR. HIV 1 PR Construct OD 280 Es timated Protein Concentration ( M) Estimated Concentration of MTSL ( M) PRE 1.136 91.0 18.1 P OST 1.364 109.2 23.2 PMUT1 1.305 104.5 24.2 PMUT3 1.423 113.9 13.9 PMUT2 1.207 96.6 19.7 PMUT5 1.701 136.2 19.6 B si 1.717 137.5 19.6 B si I63P 1.025 8 2.1 16.9 Figure B 1. Calibration curve of 4 oxo TEMPO standard determined by CW EPR. EPR intensities of three calibration points (10 M, 20 M and 50 M) were measured. The linear fit equation as indicated was used to estimate the spin label concentration of HIV 1 PR samples.

PAGE 180

180 The DEER results presented in Chapter 5 correspond to older samples of the PRE POST and PMUT1 HIV 1 PR constructs. The spin labeling efficiency of the se samples was verified by MS and CW EPR and results are presented here (Figures B 2 to B 5) To verify the certainty of the DEER results obtained, the three constructs were repurified and spin labeled and results for the characterization are presented in Chapter 4. However, DEER analysis was not per formed on the repurified PRE POST and PMUT1 samples because of technical problems associated with the DEER instrument. Figure B 2. CW EPR spectra for spin labeled HIV 1 PR PRE (blue), POST (red), and PMUT1 (magenta).

PAGE 181

181 Fi gure B 3. Mass spectra of spin labeled PRE. The upper spectrum shows the major peaks with the charge states indicated. The lower spectrum is an enlarged view of the m/z peak with +10 charge state.

PAGE 182

182 Figure B 4. Mass spectra of spin labeled POST. The u pper spectrum shows the major peaks with the charge states indicated. The lower spectrum is an enlarged view of the m/z peak with +10 charge state.

PAGE 183

183 Figure B 5. Mass spectra of spin labeled PMUT1. The upper spectrum shows the major peaks with the char ge states indicated. The lower spectrum is an enlarged view of the m/z peak with +10 charge state.

PAGE 184

184 APPENDIX C POPULATION VALIDATIO N OF SELECTED HIV 1 PR CONSTRUCTS Figure C 1. Population validation of PRE apo. A) Distance distribution profile from TK R analysis (red) overlaid with the sum of the populations obtained by Gaussian reconstruction (blue dashed), B) individual Gaussian populations (suppressed populations are indicated by an asterisk) and C E) background subtracted dipolar echo curve (black) overlaid with the TKR generated dipolar modulation (red) and Gaussian reconstructed dipolar modulation generated by subtracting the suppressed populations (blue).

PAGE 185

185 Figure C 2. Population validation of PRE RTV. A) Distance distribution profile from TKR analysis (red) overlaid with the sum of the populations obtained by Gaussian reconstruction (blue dashed), B) individual Gaussian populations (suppressed populations are indicated by an asterisk), and C E) background subtracted dipolar echo curve (black) overlaid with the TKR generated dipolar modulation (red) and Gaussian reconstructed dipolar modulation generated by subtracting the suppressed populations (blue).

PAGE 186

186 Figure C 3. Population validation of POST RTV. A) Distance distribution profile from T KR analysis (red) overlaid with the sum of the populations obtained by Gaussian reconstruction (blue dashed), B) individual Gaussian populations (suppressed populations are indicated by an asterisk), and C E) background subtracted dipolar echo curve (black ) overlaid with the TKR generated dipolar modulation (red) and Gaussian reconstructed dipolar modulation generated by subtracting the suppressed populations (blue).

PAGE 187

187 Figure C 4. Population validation of PMUT1 apo. A) Distance distribution profile fro m TKR analysis (red) overlaid with the sum of the populations obtained by Gaussian reconstruction (blue dashed), B) individual Gaussian populations (suppressed populations are indicated by an asterisk), and C H) background subtracted dipolar echo curve (bl ack) overlaid with the TKR generated dipolar modulation (red) and Gaussian reconstructed dipolar modulation generated by subtracting the suppressed populations (blue).

PAGE 188

188 Figure C 5. Population validation of B s i I63P apo. A) Distance distribution profile from TKR analysis (red) overlaid with the sum of the populations obtained by Gaussian reconstruction (blue dashed), B) individual Gaussian populations (suppressed populations are indicated by an asterisk), and C E) background subtracted dipolar echo curve (black) overlaid with the TKR generated dipolar modulation (red) and Gaussian reconstructed dipolar modulation generated by subtracting the suppressed populations (blue).

PAGE 189

189 LIST OF REFERENCES 1. UNAIDS. (2010) 2010 Report on the Globa l AIDS Epidemic, UNAIDS. 2. Levy, J. A. (1993) Pathogenesis of human immunodeficiency virus infection, Microbiol. Rev. 57 183 289. 3. Andersson, S. (2001) HIV 2 and the immune response, AIDS Rev. 3 11 23. 4. Azevedo Pereira, J. M., Santos Costa, Q., a nd Moniz Pereira, J. (2005) HIV 2 infection and chemokine receptors usage clues to reduced virulence of HIV 2, Curr. HIV Res. 3 3 16. 5. Levy, J. A. (2007) HIV and the Pathogenesis of AIDS 3rd ed., ASM Press, Washington, D.C. 6. HIV Sequence Compendi um 2010 Kuiken, C., Leitner, T., Hahn, B., Mullins, J., Wolinsky, S., Foley, B., Apetrei, C., Mizrachi, I., Ra mbaut, A., and Korber, B., Eds. Published by Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, NM, LA UR 10 03684. 7 HIV Replication Cycle (2010) National Institute of Allergy and Infectious Diseases, National Institutes of Health (NIH), Bethesda, Maryland. Accessed from http://www.niaid.nih.gov on January 2011. 8. Ashorn, P., McQuade, T. J., Thaisrivongs, S., Tomasse lli, A. G., Tarpley, W. G., and Moss, B. (1990) An inhibitor of the protease blocks maturation of human and simian immunodeficiency viruses and spread of infection, Proc. Natl. Acad. Sci. U.S.A. 87 7472 7476. 9. Condra, J. H., Schleif, W. A., Blahy, O. M ., Gabryelski, L. J., Graham, D. J., Quintero, J. C., Rhodes, A., Robbins, H. L., Roth, E., Shivaprakash, M., Titus, D., Yang, T., Teppler, H., Squires, K. E., Deutsch, P. J., and Emini, E. A. (1995) In vivo emergence of HIV 1 variants resistant to multipl e protease inhibitors, Nature 374 569 571. 10. Barrett, A. J., Rawlings, N. D., and Woessner, J. F. (2003) The Handbook of Proteolytic Enzymes Academic Press, London. 11. Shafer, R. W., Stevenson, D., and Chan, B. (1999) Human immunodeficiency virus re verse transcriptase and protease sequence database, Nucleic Acids Res. 27 348 352. 12. Andreeva, N., and Gustchina, A. (1979) On the supersecondary structure of acid proteases, Biochem. Biophys. Res. Commun. 87 32 42.

PAGE 190

190 13. Andreeva, N. (1991) A consensu s template of the aspartic proteinase fold, in Structure and Function of the Aspartic Proteinases (Dunn, B., Ed.), pp 559 572, Plenum Press, New York. 14. Wlodawer, A., and Gustchina, A. (2000) Structural and biochemical studies of retroviral proteases, B iochim. Biophys. Acta 1477 16 34. 15. Dunn, B. M., Goodenow, M. M., Gustchina, A., and Wlodawer, A. (2002) Retroviral proteases, Genome Biology 3 reviews3006.3001 3006.3007. 16. Ali, A., Bandaranayake, R. M., Cai, Y., King, N. M., Kolli, M., Mittal, S. Murzycki, J. F., Nalam, M. N. L., Nalivaika, E. A., zen, A., Prabu Jeyabalan, M. M., Thayer, K., and Schiffer, C. A. (2010) Molecular basis for drug resistance in HIV 1 protease, Viruses 2 2509 2535. 17. The PyMOL Molecular Graphics System, Version 1 .1r1, Schrdinger, LLC. 18. Davies, D. R. (1990) The structure and function of the aspartic proteinases, Annu. Rev. Biophys. Biophys. Chem. 19 189 215. 19. Navia, M. A., Fitzgerald, P. M., McKeever, B. M., Leu, C. T., Heimbach, J. C., Herber, W. K., Sig al, I. S., Darke, P. L., and Springer, J. P. (1989) Three dimensional structure of aspartyl protease from human immunodeficiency virus HIV 1, Nature 337 615 620. 20. Lapatto, R., Blundell, T., Hemmings, A., Overington, J., Wilderspin, A. F., Wood, S., Me rson, J. R., Whittle, P. J., Danley, D. E., Geoghegan, K. F., Hawrylik, S. J., Lee, S. E., Scheld, K. G., and Hobart, P. M. (1989) X ray analysis of HIV 1 proteinase at 2.7 resolution confirms structural homology among retroviral enzymes, Nature 342 299 302. 21. Wlodawer, A., Miller, M., Jaskolski, M., Sathyanarayana, B. K., Baldwin, E., Weber, I. T., Selk, L. M., Clawson, L., Schneider, J., and Kent, S. B. H. (1989) Conserved folding in retroviral proteases: Crystal structure of a synthetic HIV 1 prote ase Science 245 616 621. 22. Spinelli, S., Liu, Q. Z., Alzari, P. M., Hirel, P. H., and Poljak, R. J. (1991) The three dimensional structure of the aspartyl protease from the HIV 1 isolate BRU, Biochimie 73 1391 1396. 23. Rose, R. B., Craik, C. S., and Stroud, R. M. (1998) Domain flexibility in retroviral proteases: Structural implications for drug resistant mutations, Biochemistry 37 2607 2621.

PAGE 191

191 24. Gustchina, A., and Weber, I. T. (1990) Comparison of inhibitor binding in HIV 1 protease and in non vir al aspartic proteases: The role of the flap, FEBS Lett. 269 269 272. 25. Tomasselli, A. G., Howe, W. J., Sawyer, T. K., Wlodawer, A., and Heinrikson, R. L. (1991) The complexities of AIDS: An assessment of the HIV protease as a therapeutic target, Chim. Oggi 9 6 27. 26. Rick, S. W., Erickson, J. W., and Burt, S. K. (1998) Reaction path and free energy calculations of the transition between alternate conformations of HIV 1 protease, Proteins 32 7 16. 27. Miller, M., Schneider, J., Sathyanarayana, B. K. Toth, M. V., Marshall, G. R., Clawson, L., Selk, L., Kent, S. B. H., and Wlodawer, A. (1989) Structure of complex of synthetic HIV 1 protease with a substrate based inhibitor at 2.3 resolution, Science 246 1149 1152. 28. Ishima, R., Freedberg, D. I., Wang, Y. X., Louis, J. M., and Torchia, D. A. (1999) Flap opening and dimer interface flexibility in the free and inhibitor bound HIV protease, and their implications for function, Structure 7 1047 1055. 29. Freedberg, D. I., Ishima, R., Jacob, J., Wang Y. X., Kustanovich, I., Louis, J. M., and Torchia, D. A. (2002) Rapid structural fluctuations of the free HIV protease flaps in solution: Relationship to crystal structures and comparison with predictions of dynamics calculations, Protein Sci. 11 221 23 2. 30. Ishima, R., Ghirlando, R., Tzsr, J., Gronenborn, A. M., Torchia, D. A., and Louis, J. M. (2001) Folded monomer of HIV 1 protease, J. Biol. Chem. 276 49110 49116. 31. Ishima, R., Torchia, D. A., Lynch, S. M., Gronenborn, A. M., and Louis, J. M. (2003) Solution structure of the mature HIV 1 protease monomer: Insight into the tertiary fold and stability of a precursor, J. Biol. Chem. 278 43311 43319. 32. Louis, J. M., Ishima, R., Nesheiwat, I., Pannell, L. K., Lynch, S. M., Torchia, D. A., and Gr onenborn, A. M. (2003) Revisiting monomeric HIV 1 protease. Characterization and redesign for improved properties, J. Biol. Chem. 278 6085 6092. 33. Todd, M. J., Semo, N., and Freire, E. (1998) The structural stability of the HIV 1 protease, J. Mol. Biol 283 34. Todd, M. J., and Freire, E. (1999) The effect of inhibitor binding on the structural stability and cooperativity of the HIV 1 protease, Proteins 36 147 156.

PAGE 192

192 35. Todd, M. J., Luque, I., Velzquez Campoy, A., and Freire, E. (2000) Thermodynamic basis of resistance to HIV 1 protease inhibition: Calorimetric analysis of the V82F/I84V active site resistant mutant, Biochemistry 39 11876 11883. 36. Velzquez Campoy, A., Todd, M. J., and Freire, E. (2000) HIV 1 protease inhibitors: Enthalpic versus entropic optimization of the binding affinity, Biochemistry 39 2201 2007. 37. Hornak, V., Okur, A., Rizzo, R. C., and Simmerling, C. (2006) HIV 1 protease flaps spontaneously open and reclose in molecular dynamics simulations, Proc. Natl. Acad. Sci. U.S .A. 103 915 920. 38. Collins, J. R., Burt, S. K., and Erickson, J. W. (1995) Flap opening in HIV 1 protease simulated by 'activated' molecular dynamics, Nat. Struct. Biol. 2 334 338. 39. Ding, F., Layten, M., and Simmerling, C. (2008) Solution structur e of HIV 1 protease flaps probed by comparison of molecular dynamics simulation ensembles and EPR experiments, J. Am. Chem. Soc. 130 7184 7185. 40. Hornak, V., Okur, A., Rizzo, R. C., and Simmerling, C. (2006) HIV 1 protease flaps spontaneously close to the correct structure in simulations following manual placement of an inhibitor into the open state, J. Am. Chem. Soc. 128 2812 2813. 41. Scott, W. R. P., and Schiffer, C. A. (2000) Curling of flap tips in HIV 1 protease as a mechanism for substrate entr y and tolerance of drug resistance, Structure 8 1259 1265. 42. Tth, G., and Borics, A. (2006) Flap opening mechanism of HIV 1 protease, J. Mol. Graph. Model. 24 465 474. 43. Nicholson, L. K., Yamazaki, T., Torchia, D. A., Grzesiek, S., Bax, A., Stahl, S. J., Kaufman, J. D., Wingfield, P. T., Lam, P. Y., and Jadhav, P. K. (1995 ) Flexibility and function in HIV 1 protease, Nat. Struct. Biol. 2 274 280. 44. Heaslet, H., Rosenfeld, R., Giffin, M., Lin, Y. C., Tam, K., Torbett, B. E., Elder, J. H., McRee D. E., and Stout, C. D. (2007) Conformational flexibility in the flap domains of ligand free HIV protease, Acta Crystallogr. D Biol. Crystallogr. 63(Pt 8) 866 875. 45. Galiano, L. M., Bonora, M., and Fanucci, G. E. (2007) Inter flap distances in HIV 1 protease determined by pulsed EPR measurements, J. Am. Chem. Soc. 129 11004 11005.

PAGE 193

193 46. Galiano, L. M., Ding, F., Veloro, A. M., Blackburn, M. E., Simmerling, C., and Fanucci, G. E. (2009) Drug pressure selected mutations in HIV 1 protease alter flap conf ormations, J. Am. Chem. Soc. 131 430 431. 47. Galiano, L. M. 2008 Site directed spin labeling EPR studies of conformational dynamics in the flap region of HIV 1 protease Ph.D. dissertation. University of Florida, Gainesville Florida 48. Blackburn, M E., Veloro, A. M., and Fanucci, G. E. (2009) Monitoring inhibitor induced conformational population shifts in HIV 1 protease by pulsed EPR spectroscopy, Biochemistry 48 8765 8767. 49. Blackburn, M. E. 2010 Monitoring polymorphism and inhibitor induced conformational ensemble shifts in HIV 1 protease via pulsed electron paramagnetic resonance Ph.D. dissertation. University of Florida, Gainesville, Florida. 50. Kear, J. L., Blackburn, M. E., Veloro, A. M., Dunn, B. M., and Fanucci, G. E. (2009) Subtype polymorphisms among HIV 1 protease variants confer altered flap conformations and flexibility, J. Am. Chem. Soc. 131 14650 14651. 51. Kear, J. L. 2010 An electron paramagnetic resonance study of HIV 1 protease and the development of a soluble expressio n system for prorenin Ph.D. dissertation. University of Florida, Gainesville, Florida. 52. Prabu Jeyabalan, M., Nalivaika, E. A., and Schiffer, C. A. (2002) Substrate shape determines specificity of recognition for HIV 1 protease: Analysis of crystal str uctures of six substrate complexes, Structure 10 369 381. 53. Schechter, I., and Berger, A. (1967) On the size of the active site in proteases, Biochem. Biophys. Res. Commun. 27 157 162. 54. Xiang, Y., Ridky, T. W., Krishna, N. K., and Leis, J. (1997) Altered Rous sarcoma virus gag polyprotein processing and its effects on particle formation, J. Virol. 71 2083 2091. 55. Barrie, K. A., Perez, E. E., Lamers, S. L., Farmerie, W. G., Dunn, B. M., Sleasman, J. W., and Goodenow, M. M. (1996) Natural variati on in HIV 1 protease, gag p7 and p6, and protease cleavage sites within gag/pol polyproteins: Amino acid substitutions in the absence of protease inhibitors in mother and children infected by human immunodeficiency virus type 1, Virology 219 407 416.

PAGE 194

194 5 6. Pettit, S. C., Sheng, N., Tritch, R., Erickson Viitanen, S., and Swanstrom, R. (1998) The regulation of sequential processing of HIV 1 gag by the viral protease, in Aspartic Proteinases, Retroviral and Cellular Enzymes (James, M. N. G., Ed.), pp 15 25, Plenum Press, New York. 57. Pettit, S. C., Moody, M. D., Wehbie, R. S., Kaplan, A. H., Nantermet, P. V., Klein, C. A., and Swanstrom, R. (1994) The p2 domain of human immunodeficiency virus type 1 gag regulates sequential proteolytic processing and is req uired to produce fully infectious virions, J. Virol. 68 8017 8027. 58. Tie, Y., Boross, P. I., Wang, Y. F., Gaddis, L., Liu, F., Chen, X., Tozser, J., Harrison, R. W., and Weber, I. T. (2005) Molecular basis for substrate recognition and drug resistance from 1.1 to 1.6 resolution crystal structures of HIV 1 protease mutants with substrate analogs, FEBS Journal 272 5265 5277. 59. Goodenow, M. M., Bloom, G., Rose, S. L., Pomeroy, S. M., O'Brien, P. O., Perez, E. E., Sleasman, J. W., and Dunn, B. M. (200 2) Naturally occurring amino acid polymorphisms in human immunodeficiency virus type 1 (HIV 1) gag p7 NC and the C cleavage site impact gag pol processing by HIV 1 protease, Virology 292 137 149. 60. Anderson, J., Schiffer, C., Lee, S. K., and Swanstrom, R. (2009) Viral Protease Inhibitors, in Handbook of Experimental Pharmacology (Krusslich, H. G., and Bartenschlager, R., Eds.), Springer Verlag Berlin, Heidelberg. 61. Menndez Arias, L. (2010) Molecular basis of human immunodeficiency virus drug resista nce: An update, Antiviral Res. 85 210 231. 62. Tzsr, J., Weber, I. T., Gustchina, A., Blaha, I., Copeland, T. D., Louis, J. M., and Oroszlan, S. (1992) Kinetic and modeling studies of S3 S3' subsites of HIV proteinases, Biochemistry 31 4793 4800. 63. Dunn, B. M., Gustchina, A., Wlodawer, A., and Kay, J. (1994) Subsite preferences of retroviral proteinases, Methods Enzymol. 241 254 278. 64. Wlodawer, A., and Vondrasek, J. (1998) Inhibitors of HIV 1 protease: A major success of structure assisted drug design, Annu. Rev. Biophys. Biomol. Struct. 27 249 284. 65. Wensing, A. M. J., van Maarseveen, N. M., and Nijhuis, M. (2010) Fifteen years of HIV protease inhibitors: Raising the barrier to resistance, Antiviral Res. 85 59 74. 66. Tomasselli, A. G., a nd Heinrikson, R. L. (2000) Targeting the HIV protease in AIDS therapy: A current clinical perspective, Biochim. Biophys. Acta 1477 189 214.

PAGE 195

195 67. Kozal, M. J., Shah, N., Shen, N., Yang, R., Fucini, R., Merigan, T. C., Richman, D. D., Morris, D., Hubbell, E ., Chee, M., and Gingeras, T. R. (1996) Extensive polymorphisms observed in HIV 1 clade B protease gene using high density oligonucleotide arrays, Nature 2 753 759. 68. Los Alamos HIV Database (2011) Los Alamos National Laboratory, Los Alamos, New Mexico Accessed from http://hiv.lanl.gov on January 2011. 69. Mansky, L. M., and Temin, H. M. (1995) Lower in vivo mutation rate of human immunodeficiency virus type 1 than that predicted from the fidelity of purified reverse transcriptase, J. Virol. 69 5087 5094. 70. Kantor, R., Shafer, R. W., and Katzenstein, D. (2005) The HIV 1 non subtype workgroup: An international collaboration for the collection and analysis of HIV 1 non subtype B data, J. Int. AIDS Soc. 7 71. 71. Le Vu, S., Le Strat, Y., Barin, F., Pillonel, J., Cazein, F., Bousquet, V., Brunet, S., Thierry, D., Semaille, C., Meyer, L., and Desenclos, J. C. (2010) Population based HIV 1 incidence in France, 2003 08: A modelling analysis, The Lancet Infectious Diseases 10 682 687. 72. Wong Staal, F. (1985) Name for AIDS virus, Nature 314 574. 73. Shafer, R. W., Rhee, S. Y., Pillay, D., Miller, V., Sandstrom, P., Schapiro, J. M., Kuritzkes, D. R., and Bennett, D. (2007) HIV 1 protease and reverse transcriptase mutations for drug resistance surveilla nce, AIDS 21 215 223. 74. HIV Drug Resistance Database (2011) Stanford University, Palo Alto, California. Accessed from http://hiv db stanford.edu on January 2011. 75. Wu, T. D., Schiffer, C. A., Gonzales, M. J., Taylor, J., Kantor, R., Chou, S., Israels ki, D., Zolopa, A. R., Fessel, W. J., and Shafer, R. W. (2003) Mutation patterns and structural correlates in human immunodeficiency virus type 1 protease following different protease inhibitor treatments, J. Virol. 77 4836 4847. 76. Rhee, S. Y., Taylor, J., Fessel, W. J., Kaufman, D., Towner, W., Troia, P., Ruane, P., Hellinger, J., Shirvani, V., Zolopa, A., and Shafer, R. W. (2010) HIV 1 protease mutations and protease inhibitor cross resistance, Antimicrob. Agents Chemother. 54 4253 4261. 77. Johnson V. A., Brun Vzinet, F., Clotet, B., Gnthard, H. F., Kuritzkes, D. R., Pillay, D., Schapiro, J. M., and Richman, D. D. (2010) Update of the drug resistance mutations in HIV 1: December 2010, Top HIV Med. 18 156 163.

PAGE 196

196 78. Gulnik, S. V., Suvorov, L. I., Liu, B., Yu, B., Anderson, B., Mitsuya, H., and Erickson, J. W. (1995) Kinetic characterization and cross resistance patterns of HIV 1 protease mutants selected under drug pressure, Biochemistry 34 9282 9287. 79. Sugiura, W., Matsuda, Z., Yokomaku, Y., Hertogs, K., Larder, B., Oishi, T., Okano, A., Shiino, T., Tatsumi, M., Matsuda, M., Abumi, H., Takata, N., Shirahata, S., Yamada, K., Yoshikura, H., and Nagai, Y. (2002) Interference between D30N and L90M in selection and development of protease inhibitor resistant human immunodeficiency virus type 1, Antimicrob. Agents Chemother. 46 708 715. 80. Jacobsen, H., Yasargil, K., Winslow, D. L., Craig, J. C., Krhn, A., Duncan, I. B., and Mous, J. (1995) Crystal structure of human immunodeficiency virus type 1 mutants with decreased sensitivity to proteinase inhibitor Ro 31 8959, Virology 206 527 534. 81. Molla, A., Korneyeva, M., Gao1, Q., Vasavanonda, S., Schipper, P. J., Mo, H. M., Markowitz, M., Chernyavskiy, T., Niu, P., Lyons, N., Hsu, A., Granneman, G. R., Ho, D. D., Boucher, C. A. B., Leonard, J. M., Norbeck, D. W., and Kempf, D. J. (1996) Ordered accumulation of mutations in HIV protease confers resistance to ritonavir, Nature Med. 2 760 766. 82. Menndez Arias, L., Martnez, M. A., Quiones Mateu, M. E., and Martinez Picado, J. (2003) Fitness variations and their impact on the evolution of antiretroviral drug resistance, Curr. Drug Targets Infect. Disord. 3 355 371. 83. Muzammil, S., Ross, P., and Freire, E. (2003) A major role for a set of non ac tive site mutations in the development of HIV 1 protease drug resistance, Biochemistry 42 631 638. 84. Clemente, J. C., Hemrajani, R., Blum, L. E., Goodenow, M. M., and Dunn, B. M. (2003) Secondary mutations M36I and A71V in the human immunodeficiency vi rus type 1 protease can provide an advantage for the emergence of the primary mutation D30N, Biochemistry 42 15029 15035. 85. Mahalingam, B., Boross, P. I., Wang, Y. F., Louis, J. M., Fischer, C. C., Tozser, J., Harrison, R. W., and Weber, I. T. (2002) C ombining mutations in HIV 1 protease to understand mechanisms of resistance, Proteins 48 107 116. 86. Mahalingam, B., Louis, J. M., Reed, C. C., Adomat, J. M., Krouse, J., Wang, Y. F., Harrison, R. W., and Weber, I. T. (1999) Structural and kinetic analy sis of drug resistant mutants of HIV 1 protease, Eur. J. Biochem. 263 238 245.

PAGE 197

197 87. Lech, W. J., Wang, G., Yang, Y. L., Chee, Y., Dorman, K., McCrae, D., Lazzeroni, L. C., Erickson, J. W., Sinsheimer, J. S., and Kaplan, A. H. (1996) In vivo sequence dive rsity of the protease of human immunodeficiency virus type 1: Presence of protease inhibitor resistant variants in untreated subjects, J. Virol. 70 2038 2043. 88. Markowitz, M., Mo, H., Kempf, D. J., Norbeck, D. W., Bhat, T. N., Erickson, J. W., and Ho, D. D. (1995) Selection and analysis of human immunodeficiency virus type 1 variants with increased resistance to ABT 538, a novel protease inhibitor, J. Virol. 69 701 706. 89. Prabu Jeyabalan, M., Nalivaika, E. A., King, N. M., and Schiffer, C. A. (2003) Viability of a drug resistant human immunodeficiency virus type 1 protease variant: Structural insights for better antiviral therapy, J. Virol. 77 1306 1315. 90. Clemente, J. C., Moose, R. E., Hemrajani, R., Whitford, L. R. S., Govindasamy, L., Reutzel, R., McKenna, R., Agbandje McKenna, M., Goodenow, M. M., and Dunn, B. M. (2004) Comparing the accumulation of active and nonactive site mutations in the HIV 1 protease, Biochemistry 43 12141 12151. 91. Piana, S., Carloni, P., and Rothlisberger, U. (2002 ) Drug resistance in HIV 1 protease: Flexibility assisted mechanism of compensatory mutations Protein Sci. 11 2393 2402. 92. Foulkes Murzycki, J. E., Scott, W. R. P., and Schiffer, C. A. (2007) Hydrophobic sliding: A possible mechanism for drug resistanc e in human immunodeficiency virus type 1 protease, Structure 15 225 233. 93. King, N. M., Prabu Jeyabalan, M., Nalivaika, E. A., and Schiffer, C. A. (2004) Combating susceptibility to drug resistance: Lessons from HIV 1 protease, Chem. Biol. 11 1333 133 8. 94. Zhang, Y. M., Imamichi, H., Imamichi, T., Lane, H. C., Falloon, J., Vasudevachari, M. B., and Salzman, N. P. (1997) Drug resistance during indinavir therapy is caused by mutations in the protease gene and its gag substrate cleavage sites, J. Virol. 71 6662 6670. 95. Bally, F., Martinez, R., Peters, S., Sudre, P., and Telenti, A. (2000) Polymorphism of HIV type 1 gag p7/p1 and p1/p6 cleavage sites: Clinical significance and implications for resistance to protease, AIDS Res. Hum. Retroviruses 16 12 09 1213. 96. Mammano, F., Petit, C., and Clavel, F. (1998) Resistance associated loss of viral fitness in human immunodeficiency virus type 1: Phenotypic analysis of protease and gag coevolution in protease inhibitor treated patients, J. Virol. 72 7632 7 637.

PAGE 198

198 97. Doyon, L., Payant, C., Brakier Gingras, L., and Lamarre, D. (1998) Novel gag pol frameshift site in human immunodeficiency virus type 1 variants resistant to protease inhibitors, J. Virol. 72 6146 6150. 98. Maguire, M. F., Guinea, R., Griffin, P ., Macmanus, S., Elston, R. C., Wolfram, J., Richards, N., Hanlon, M. H., Porter, D. J., Wrin, T., Parkin, N., Tisdale, M., Furfine, E., Petropoulos, C., Snowden, B. W., and Kleim, J. P. (2002) Changes in human immunodeficiency virus type 1 gag at position s L449 and P453 are linked to I50V protease mutants in vivo and cause reduction of sensitivity to amprenavir and improved viral fitness in vitro J. Virol. 76 7398 7406. 99. Nijhuis, M., van Maarseveen, N. M., Lastere, S., Schipper, P., Coakley, E., Glas s, B., Rovenska, M., de Jong, D., Chappey, C., Goedegebuure, I. W., Heilek Snyder, G., Dulude, D., Cammack, N., Brakier Gingras, L., Konvalinka, J., Parkin, N., Krausslich, H. G., Brun Vezinet, F., and Boucher, C. A. B. (2007) A novel substrate based HIV 1 protease inhibitor drug resistance mechanism, PloS Med. 4 e36. 100. Ho, S. K., Coman, R. M., Bunger, J. C., Rose, S. L., O'Brien, P., Munoz, I., Dunn, B. M., Sleasman, J. W., and Goodenow, M. M. (2008) Drug associated changes in amino acid residues in g ag p2, p7 NC and p6 Gag /p6 Pol in human immunodeficiency virus type 1 (HIV 1) display a dominant effect on replicative fitness and drug response, Virology 378 272 281. 101. Rose, J. R., Salto, R., and Craik, C. S. (1993) Regulation of autoproteolysis of th e HIV 1 and HIV 2 proteases with engineered amino acid substitution, J. Biol. Chem. 268 11939 11945. 102. Mildner, A. M., Rothrock, D. J., Leone, J. W., Bannow, C. A., Lull, J. M., Reardon, I. M., Sarcich, J. L., Howe, W. J., Tomich, C. S. C., Smith, C. W., Heinrikson, R. L., and Tomasselli, A. G. (1994) The HIV 1 protease as enzyme and substrate: Mutagenesis of autolysis sites and generation of a stable mutant with retained kinetic properties, Biochemistry 33 9405 9413. 103. Logsdon, B. C., Vickrey, J. F., Martin, P., Proteasa, G., Koepke, J. I., Terlecky, S. R., Wawrzak, Z., Winters, M. A., Merigan, T. C., and Kovari, L. C. (2004) Crystal structures of a multidrug resistant human immunodeficiency virus type 1 protease reveal an expanded active site cav ity, J. Virol. 78 3123 3132. 104. Coman, R. M., Robbins, A. H., Fernandez, M. A., Gilliland, C. T., Sochet, A. A., Goodenow, M. M., McKenna, R. M., and Dunn, B. M. (2008) The contribution of naturally occurring polymorphisms in altering the biochemical a nd structural characteristics of HIV 1 subtype C protease, Biochemistry 47 731 743.

PAGE 199

199 105. Ohtaka, H., Schon, A., and Freire, E. (2003) Multi drug resistance to HIV 1 protease inhibition requires cooperative coupling between distal mutations, Biochemistry 42 13659 13666. 106. Voet, D., and Voet, J. G. (2004) Biochemistry Vol. 1, 3rd ed., John Wiley & Sons, Inc., Hoboken, New Jersey. 107. Higgins, S. J., and Hames, B. D., (Eds.) (1999) Protein Expression: A Practical Approach Oxford University Press, In c., New York. 108. Howe, C. (2007) Gene Cloning and Manipulation 2nd ed., Cambridge University Press, Cambridge. 109. Welch, M., Govindarajan, S., Ness, J. E., Villalobos, A., Gurney, A., Minshull, J., and Gustafsson, C. (2009) Design parameters to cont rol synthetic gene expression in Escherichia coli PLoS ONE 4 e7002. 110. Studier, F. W., and Moffatt, B. A. (1986) Use of bacteriophage T7 RNA polymerase to direct selective high level expression of cloned genes, J. Mol. Biol. 189 113 130 111. Rosen berg, A. H., Lade, B. N., Chui, D. S., Lin, S. W., Dunn, J. J., and Studier, F. W. (1987) Vectors for selective expression of cloned DNAs by T7 RNA polymerase, Gene 56 125 135. 112. Studier, F. W., Rosenberg, A. H., Dunn, J. J., and Dubendorff, J. W. (19 90) Use of T7 RNA polymerase to direct expression of cloned genes, Methods Enzymol. 185 60 89. 113. Studier, F. W. (1991) Use of bacteriophage T7 lysozyme to improve an inducible T7 expression system, J. Mol. Biol. 219 37 44. 114. pET System Manual (20 03) Novagen, Gibbstown, New Jersey. Accessed from http://www.emdchemicals.com/life science research on January 2011. 115. Phillips, T. A., VanBogelen, R. A., and Neidhardt, F. C. (1984) lon gene product of Escherichia coli is a heat shock protein, J. Bact eriol. 159 283 287. 116. Grodberg, J., and Dunn, J. J. (1988) ompT encodes the Escherichia coli outer membrane protease that cleaves T7 RNA polymerase during purification, J. Bacteriol. 170 1245 1253. 117. Weiner, M. P., Anderson, C., Jerpseth, B., Wel ls, S., and Johnson Browne, B. (1994) Strategies 7 41 43.

PAGE 200

200 118. QuikChange Site Directed Mutagenesis Kit Instruction Manual (2005) Agilent Technologies Stratagene Products Division, Santa Clara, California. Accessed from http://genomics.agilent.com on Jan uary 2011. 119. Zheng, L., Baumann, U., and Reymond, J. L. (2004) An efficient one step site directed and site saturation mutagenesis protocol, Nucleic Acids Res. 32 e115:111 115. 120. Buxbaum, E. (2007) Fundamentals of Protein Structure and Function S pringer Science, New York. 121. Berg, J. M., Tymoczko, J. L., and Stryer, L. (2002) Biochemistry W.H. Freeman and Co., New York. 122. Protein Electrophoresis: Technical Manual (1999) GE Healthcare Life Sciences, Pittsburgh, Pennsylvania. Accessed from h ttp://www.gelifesciences.com on January 2011. 123. Boyer, R. (2000) Modern Experimental Biochemistry Addison Wesley Longman, Inc., San Francisco, California. 124. Barrett, G. C., and Elmore, D. T. (2004) Amino Acids and Peptides Cambridge University Pr ess, Cambridge. 125. Fndrich, M., and Dobson, C. M. (2002) The behaviour of polyamino acids reveals an inverse side chain effect in amyloid structure formation, The EMBO Journal 21 5682 5690. 126. a to estimate protein secondary structure, Nature Protocols 1 2876 2890. 127. Whitmore, L., and Wallace, B. A. (2007) Protein secondary structure analyses from circular dichroism spectroscopy: Methods and reference databases, Biopolymers 89 392 400. 128. Mikkelsen, S. R., and Corton, E. (2004) Bioanalytical Chemistry John Wiley & Sons, Inc., Hoboken, New Jersey. 129. Matsuo, T., and Seyama, Y. (2000) Introduction to modern biological mass spectrometry, J. Mass Spectrom. 35 114 130. 130. Weil, J. A ., and Bolton, J. R. (1972) Electron Spin Resonance: Elementary Theory and Practical Applications John Wiley and Sons, Inc., Hoboken, New Jersey.

PAGE 201

201 131. Poole Jr., C. P. (1983) Electron Spin Resonance. A Comprehensive Treatise on Experimental Techniques 2 nd ed., John Wiley and Sons, New York. 132. Mchaourab, H. S., Lietzow, M. A., Hideg, K., and Hubbell, W. L. (1996) Motion of spin labeled side chains in T4 lysozyme. Correlation with protein structure and dynamics, Biochemistry 35 7692 7704. 133. Columb us, L., Klai, T., Jek, J., Hideg, K., and Hubbell, W. L. (2001) Molecular motion of s helices: Analysis by variation of side chain structure, Biochemistry 40 3828 3846. 134. Langen, R., Oh, K. J., Cascio, D., and Hubbell, W. L. (2000) Crystal structures of spin labeled T4 lysozyme mutants: Implications for the interpretation of EPR spectra in terms of structure, Biochemistry 39 8396 8405. 135. Fanucci, G. E., and Cafiso, D. S. (2006) Recent advances and applications of site directed spin labeling, Curr. Opin. Struct. Biol. 16 644 653. 136. Hubbell, W. L., a nd Altenbach, C. (1994) Investigation of structure and dynamics in membrane proteins using site directed spin labeling, Curr. Opin. Struct. Biol. 4 566 573. 137. Hubbell, W. L., Cafiso, D. S., and Altenbach, C. (2000) Identifying conformational changes w ith site directed spin labeling, Nat. Struct. Biol. 7 735 739. 138. Columbus, L., and Hubbell, W. L. (2002) A new spin on protein dynamics, Trends Biochem. Sci. 27 288 295. 139. Hubbell, W. L., Gross, A., Langen, R., and Lietzow, M. A. (1998) Recent ad vances in site directed spin labeling of proteins, Curr. Opin. Struct. Biol. 8 649 656. 140. Mchaourab, H. S., Klai, T., Hideg, K., and Hubbell, W. L. (1999) Motion of spin labeled side chains in T4 lysozyme: Effect of side chain structure, Biochemistr y 38 2947 2955. 141. Crane, J. M., Mao, C., Lilly, A. A., Smith, V. F., Suo, Y., Hubbell, W. L., and Randall, L. L. (2005) Mapping of the docking of secA onto the chaperone secB by site directed spin labeling: Insight into the mechanism of ligand transfe r during protein export, J. Mol. Biol. 353 295 307. 142. Jeschke, G., and Polyhach, Y. (2007) Distance measurements on spin labelled biomacromolecules by pulsed electron paramagnetic resonance, Phys. Chem. Chem. Phys. 9 1895 1910.

PAGE 202

202 143. Pannier, M., Veit S., Godt, A., Jeschke, G., and Spiess, H. W. (2000) Dead time free measurement of dipole dipole interactions between electron spins, J. Magn. Reson. 142 331 340. 144. Rabenstein, M. D., and Shin, Y. K. (1995) Determination of the distance between two s pin labels attached to a macromolecule, Proc. Natl. Acad. Sci. U.S.A. 92 8239 8243. 145. Jeschke, G., Chechik, V., Ionita, P., Godt, A., and Zimmerman, H. (2006) DeerAnalysis2006 A comprehensive software package for analyzing pulsed ELDOR data, Appl. M agn. Reson. 30 473 498. 146. XL1 Blue Competent Cells (2004) Agilent Technologies Stratagene Products Division, Santa Clara, California. Accessed from http://www.genomics.agilent.com on January 2011. 147. Velazquez Campoy, A., Vega, S., and Freire, E. ( 2002) Amplification of the effects of drug resistance mutations by background polymorphisms in HIV 1 protease from African subtypes, Biochemistry 41 8613 8619. 148. Lippincott, J., and Apostol, I. (1999) Carbamylation of cysteine: A potential artifact in peptide mapping of hemoglobins in the presence of urea, Anal. Biochem. 267 57 64. 149. Shao, W., Everitt, L., Manchester, M., Loeb, D. D., Hutchison, C. A., and Swanstrom, R. (1997) Sequence requirements of the HIV 1 protease flap region determined by s aturation mutagenesis and kinetic analysis of flap mutants, Proc. Natl. Acad. Sci. U.S.A. 94 2243 2248. 150. Yamazaki, T., Hinck, A. P., Wang, Y. X., Nicholson, L. K., Torchia1, D. A., Wingfield, P., Stahl, S. J., Kaufman, J. D., Chang, C. H., Domaille, P. J., and Lam, P. Y. S. (1996) Three dimensional solution structure of the HIV 1 protease complexed with DMP323, a novel cyclic urea type inhibitor, determined by nuclear magnetic resonance spectroscopy, Protein Sci. 5 495 506.

PAGE 203

203 BIOGRAPHICAL SKETCH Estrella Garlit Gonzales also known as Star, was born in 1981 in Southeastern Mindanao in the Philippines. She studied high school at the Philippine Science High School Southern Mindanao Campus in Davao Cit y. She moved to Manila and attended undergraduate school at the Ateneo de Manila University, where she obtained her B.S. Chemistry degree in March 2001. She worked in the same institution as an instructor and research assistant from 2002 2008. In August 20 08, she moved to the United States and attended the Department of Chemistry graduate program at the University of Florida. She eventually joined the research group of Dr. Gail E. Fanucci. She obtained her M.S. Chemistry degree in August 2011.