Controlling Nuclear Jaks and Stats for Specific Gene Activation by IFN Gamma

MISSING IMAGE

Material Information

Title:
Controlling Nuclear Jaks and Stats for Specific Gene Activation by IFN Gamma
Physical Description:
1 online resource (69 p.)
Language:
english
Creator:
Noon Song,Ezra
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Microbiology and Cell Science
Committee Chair:
Johnson, Howard M
Committee Members:
Larkin III, Joseph
Mergia, Ayalew
Yamamoto, Janet K
Peck, Ammon B

Subjects

Subjects / Keywords:
epigenetic -- epigenetics -- histone -- ifn -- ifnar -- ifnar1 -- ifnar2 -- ifngr -- ifngr1 -- jak -- jak1 -- jak2 -- pjak1 -- pjak2 -- receptor -- signaling -- stat -- stat1 -- stat2 -- tyk2
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre:
Microbiology and Cell Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
IFN gamma is a pleotropic cytokine that ligates to specific cell surface receptors to mediate specific gene induction. Moreover, the formation of the ligated receptor complex activates the Janus kinase (JAK) and the signal transducer and activator of transcription (STAT) pathway. It has been previously demonstrated that IFN gamma, its receptor subunit IFNGR1 and STAT1 form a macromolecular complex that translocates to the nucleus to accomplish gene activation. In this study, we report on the epigenetics associated with IFN gamma signaling. Furthermore we characterize the receptor complex by assessing the association, sub-cellular localization and function of activated JAK1 and JAK2 with the IFN?-IFNGR1-STAT1 complex. We found that activated JAK1 and JAK2 associate with IFNGR1 throughout signaling and specifically within the nucleus. Furthermore, this JAK-receptor association correlated with an increase in the tyrosine phosphorylation of histone H3 on residue 41 (H3pY41) globally and specifically at the IRF1 promoter. Cumulatively, we propose that the activated IFN gamma receptor complex includes JAK1 and JAK2, and that these kinases are directed specifically to relative promoters via their specific interaction with the activated receptor. Finally, we demonstrate that TYK2 is constitutively present in the nucleus of WISH cells and that treatment with either type I IFN IFN alpha 2 or IFN tau causes the appearance of activated TYK2 and IFNAR1 within the nuclear compartment. Our results suggest that ligands which engage the JAK/STAT pathway in general also use activated JAKs within the nuclear compartment to induce specific epigenetic events.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Ezra Noon Song.
Thesis:
Thesis (Ph.D.)--University of Florida, 2011.
Local:
Adviser: Johnson, Howard M.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043362:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 CONTROLLING NUCLEAR JAKS AND STATS FOR SPECIFIC GENE ACTIVA T I ON BY IFN GAMMA By EZRA NEPTUNE NOON SONG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENT S FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Ezra Neptune Noon Song

PAGE 3

3 To all those who believed in me

PAGE 4

4 ACKNOWLEDGMENTS I thank Dr. Johnson for his attention, wisdom, and generalship in training me to become a scientist. I thank all my committee members and especially Dr. Larkin for their valuable time and advice. I thank Erin, Tenisha, Rea, Jonathan Massimo, Fawnafish, Jeyko, and my mama for their moral and technical support; you all are awesome.

PAGE 5

5 TABLE OF CO NTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 LIST OF ABBREVIATIONS ................................ ................................ ............................. 9 ABSTRACT ................................ ................................ ................................ ................... 11 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 13 Extracellular Polypeptide Messages ................................ ................................ ....... 13 The STATs ................................ ................................ ................................ ....... 14 The JAKs ................................ ................................ ................................ .......... 16 The JAK/STAT Pathway ................................ ................................ ......................... 18 Interferons ................................ ................................ ................................ ............... 19 The JAK/STAT Dilemma ................................ ................................ ......................... 21 STATs Use the Ran/importin Pathway, but Lack an NLS ................................ 21 STATs Redundantly Target the GAS Element ................................ ................. 21 JAK2/STAT5 Si gnaling is Redundantly Used by Several Ligands .................... 25 JAK2V617F Disorders Use Specific Receptors for Signaling ........................... 26 Nuclear JAKs ................................ ................................ ................................ .... 27 Concerted Receptor STAT Gene Activation ................................ ........................... 29 2 MATERIALS AND METHODS ................................ ................................ ................ 38 C ell Culture and Antibodies ................................ ................................ .................... 38 Chromatin Immunoprecipitation (ChIP) Assay ................................ ........................ 38 Nuclear Fractionation and Nuclear JAK2 Activation ................................ ............... 39 Indirect Immunofluorescence Assay and Confocal Microscopy .............................. 40 Analysis of Proteins Bound to Biotinylated GAS Promoter DNA ............................. 40 Western Blot Analysis and Immunoprecipitation ................................ ..................... 41 3 RESULTS ................................ ................................ ................................ ............... 42 pJAK2 and pJ AK1 Are Recruited to the GAS Element in the IRF1 Promoter ......... 42 ............ 43 ............... 43 pJAK2, IFNGR1, and STAT1 Directly Associate with GAS Promoter Element of ................................ ................................ ....................... 45 ............. 45

PAGE 6

6 TYK2 is constitutively present in nuclei, while pTYK2 appears in nuclei following type I IFN treatment ................................ ................................ ............................. 46 ........... 46 4 DISCUSSION ................................ ................................ ................................ ......... 53 LIST OF REFERENCES ................................ ................................ ............................... 61 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 69

PAGE 7

7 LIST OF TABLES Table page 1 1 Ligands that signal using Janus kinases (JAKs) and signal transducers and activators of transcription (STATs). ................................ ................................ .... 33 1 2 Phenotypes of STAT knockout mic e. ................................ ................................ .. 35 1 3 Phenotypes of JAK knockout mice. ................................ ................................ .... 35

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Schemati c model of the JAK/STAT signaling pathway ................................ ....... 34 1 2 Domain architecture of STAT proteins. ................................ ............................... 35 1 3 Domain architecture of JAK proteins. ................................ ................................ 36 1 4 Canonical IFNy signaling. ................................ ................................ ................... 37 3 1 and H3pY41 with the IRF1 promoter ................................ ................................ .. 48 3 2 treatment. ................................ ................................ ................................ ........... 49 3 3 JAK2 is consti tutively present in nuclei, while pJAK2 appears in nuclei ................................ ................................ .................... 50 3 4 TYK 2 is constitutively present in nuclei, while p TYK 2 appears in nuclei following type I IFN t reatment ................................ ................................ ............ 52 3 5 pJAK2, IFNGR1, and pSTAT1, are induced to associate with histone H3 in STAT1 is constitutively associated. ................................ ................................ .... 52 4 1 Model for the mechanism of signaling. ................................ ....................... 60

PAGE 9

9 LIST OF ABBREVIATION S AcH3 Acetylated histone H3 APC Antigen presenting cell CD Cluster of differentiation ChIP Chromatin immunoprecipitation EGF Epidermal growth factor EGFR Epidermal growth factor receptor EPO Erythropoietin EPOR Erythropoietin receptor FERM Four point, Ezrin, Radixin, moesin domain; N terminus of JAK used for receptor association GAS Gamma activa ted sequence G CSF Granulocyte colony stimulating factor G CSFR Granulocyte col ony stimulating factor receptor GH Growth Hormone GHR Growth hormone receptor GM CSF Granulocyte/macrophage colony stimulating factor H3pY41 Histone H3 tyrosine phosphorylated on residue 41 HP1 heterochromatin protein 1 HSC Hematopoietic stem cell IFN Interferon IFNAR Type I IFN receptor IFNGR IFN gamma receptor IL Interleukin IP Immunoprecipitate IRF IFN regulatory factor

PAGE 10

10 JAK Janus kinase JH JAK homology LD STAT linker domain LIF Leukocyte inhibitory factor ND STAT N domain NLS Nuclear Localization Sequence OPN Osteopontin PBS Phosphate buffered saline PDGF Platelet derived growth factor pJAK Activated JAK PRL Prolactin pSTAT Tyrosine phosphorylated STAT PV Polycythemia Vera SC ID Severe combined immunodeficiency SH2 Src homology 2 STAT Signal transducer and activator of transcription TAD Transcriptional activation domain T H 1 T helper 1 T H 2 T helper 2 TPO Thrombopoietin TPOR Thrombopoietin receptor WL Whole cell lysate WSXWS Try p tophan, serine, any amino acid, tryptophan, serine Y Tyrosine

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CONTROL LING NUCLEAR JAKS AND STATS FOR SPECIFIC GENE ACTIVA T I ON BY IFN GAMMA By Ezra Neptune Noon Song August 2011 Chair: Howard Marcellus Johnson Major: Microbiology and Cell Science IFN i s a pleotropic cytokine that ligates to specific cell surface r ecept ors to mediate specific gene induction Moreover, the formation of the ligated receptor complex activates the Janus kinase (JAK) and the signal transducer and activator of transcription (STAT) pathway It has been previously demonstrated that IFN rec eptor subunit IFNGR1 and STAT1 form a macromolecular complex that translocates to the nucleus to accomplish gene activation. In this study, we report on the epigenetics associated with IFN signaling. Furthermore we characterize the receptor complex by ass essing the association, sub cellular localization and function of activated JAK1 and JAK2 with the IFN IFNGR1 STAT1 complex. We found that activated JAK1 and JAK2 associate with IFNGR1 throughout signaling and specifically within the nucleus. Furthermore, this JAK receptor association correlated with an increase in the tyrosine phosphorylation of histone H3 on residue 41 (H3pY41) globally and specifically at the IRF1 promoter. Cumulatively, we propose that the activated IFN receptor complex includes JAK1 and JAK2, and that these kinases are directed specifically to relative promoters via their specific interaction with the activated receptor. Finally, we demonstrate that TYK2 is constitutively present in the nucleus of WISH cells and that

PAGE 12

12 treatment with ei ther type I IFN IFN or IFN causes the appearance of activated TYK2 and IFNAR1 within the nuclear compartment. Our results suggest that ligands which engage the JAK/STAT pathway in general also use activated JAKs within the nuclear compartment to induce specific epigenetic events.

PAGE 13

13 CHAPTER 1 INTRODUCTION Ex tracellular Polypeptide M essages We are multi cellular organisms consisting of a vast array of highly differentiated cells. To ensure the success and homeostasis of our overall being, these various cells must be able to r espond to their microenvironment and communicate with each other. Moreover, in order to properly orchestrate the simultaneous growth, division, death, mobilization, activation, tissue differentiation, and other innumerable measures, our cells must be able to interpret outside signals and coordinate their actions. A major way that communication is achieved is via secretion of extracellular polypeptides. These protein messages are made and released from the cell in response to particular stimuli. These messag es are often classified as cytokines, growth factors or hormones. Environmental factors and the nature of the protein limit the half life, distance and direction the message can travel. Nevertheless, these protein messages can then bind to specific cell su rface receptors on any cell which has them. The binding of these extracellular protein messages to their cognate receptors is a ligation event which induces a conformational change in the ligand/receptor complex leading to concomitant receptor internalizat ion and activation. Ultimately this activation event is a stimulus which results in immediate physiological changes in the cell and/or chromatin remodeling allowing for specific gene regulation. Thus, the binding of these extracellular protein messages (li gands) to their cognate receptors induces activation, internalization and a signaling event that allows for the cell to respond to particular stimuli. The predominant way that most of these ligands signal once they activate their receptors is via the JAK/S TAT pathway Figure 1 1, Table 1 1

PAGE 14

14 The STATs The STATs are known to be transcription factors which exist in the cytoplasm and can undergo JAK assisted tyrosine phosphorylation. This phosphorylation is an activation event which allows STATs to dimerize via reciprocal SH2 domain interactions and subsequently enter the nucleus where they bind to palindromic like elements located within the promoters of specific genes ( Horvath, 2000 ) In mammals there are seven STATs: STAT1, STAT2, STAT3, STAT4, STAT5a, STAT5b, and STAT6. The domain architecture of thes e proteins is shown in Figure 1 2. Conserved among the STATs are five distinct regions: a four barrel DNA binding domain, a helical linker domain, an SH2 domain, and an effector domain. The C terminal transa ctivation domain is involved in communication with transcription complexes. The effector domain is believed to regulate function specifically through contribution to its nuclear export. The N terminus of the STATs is the most conserved element and plays a role in stabilizing STAT binding to DNA. Finally, the helical linker domain is simply believed to connect the DNA binding and SH2 domains. Once a receptor is ligated with commensurate JAK activation and receptor phosphorylation, it is believed that specifi c STATs are recruited to phosphorylated receptor with docking achieved via SH2 binding contribution from the STAT. Next, the STAT is phosphorylated on a single tyrosine located around position 700. This phosphorylation can be performed by the JAKs or by th e receptor itself if it has intrinsic tyrosine kinase activity. Nevertheless, phosphorylation allows the STATs to form homodimers and enter the nucleus. While most ligands predominantly induce STAT homodimers, a few exceptions have been noted; STAT1 is als o known to form

PAGE 15

15 heterodimers with STAT2 and STAT3. Regardless, dimerization is believed to be a requirement for DNA binding as STAT monomers cannot bind DNA. The physiological roles of the STATs have best been characterized using STAT knockout mice ( Khwaja, 2006 ) See Table 1 2 for a list of their phenotypes. Deficiency in STAT2 and STAT3 are embryonically lethal. STAT1 knockout mice quickly succumb to viral and bac terial pathogens due to lack of an innate immune response, however, if the mice are kept in pathogen free conditions they are phenotypically normal and reproductive. Knockout of STAT4 results in mice lacking a T helper 1 ( T H 1 ) cell response. Similarly, STA T6 knockout mice have T helper 2 ( T H 2 ) deficient cellular responses. These STATs have been associated with specific cytokine signaling systems that promote these adaptive immune responses. In mice STAT5 knockout exhibits a sexual dimorphism believed to be caused through growth hormone signaling ( Udy et al., 1997 ) Moreover, male mice deficient in STAT5a are normal phenotypically, while their female counterparts do not develop normal breast tissue and cannot lactate. Males deficient in STAT5b grow more slowly than normal and have liver produced serum proteins which are more characteristic of female mice. Besides growth hormone signaling regulation, STAT5 also plays a rol e in the generation of CD4+CD25+Foxp3+ T cells in the thymus and periphery ( Burchill et al., 2007 ) These cells play a role in immune regulation in humans and mut ations in either STAT5 gene display immune pathologies associated with decreased CD25 and Foxp3 expression ( Cohen et al., 2006 ) The DNA element that activated hom odimeric STATs bind to was discovered via studying JAK/STAT signaling induced by a cytokine known as IFN gamma ( ). In

PAGE 16

16 this case, dimerized STAT1 was found to enter the nucleus and bind to a palindromic like element, TTC(N) 2 4 GAA, where N is any nucleot ide, and was so named the gamma activated sequence (GAS). Since then, the STAT dimers induced by other ligands have also been shown to bind to this same or similar sequence ( Horvath, 2000 ) The JAKs In mammals, the JAKs are a family of 4 tyrosine kinases known as TYK2, JAK1, JAK2, and JAK3 ( Haan et al., 2006 ) They are tyrosine kinases ranging from 120 140 kDa and are ubiquitously expressed with the exception of JAK3, which is restrict ed to hematopoietic cells. The conserved JAK homology (JH) domains are depicted in Figure 1 3. The N terminus consisting of JH3 JH7 is involved in receptor subunit binding. An SH2 domain overlaps the JH3 JH4 domains and further contributes to receptor bind ing. The JH2 domain is a pseudokinase domain thought to play a role in autoregulation of JAK activity when associated with non ligated receptor. The JH1 domain is a classical tyrosine kinase domain which becomes activated via auto tyrosine phosphorylation of the residue located around position 1000 of the JAKs. This phosphorylation is critical to the activity of the kinase and the transmission of signal by the ligated receptor. The same JAKs are used by different receptor subunits to which they pre associa te Besides receptor activation and subsequent signal transduction, the JAKs known physiological roles include regulation of cell surface expression via association of receptor subunits, and have also been shown to play roles in the degradation and surface recycling of their associated receptors ( Haan et al., 2006 ) Furthermore, the JAK ambiguous term deduced through correlation of degradation rates of receptor subunits and JAKs ( Haan et al., 2006 ) and the lack of gp130 JAK1 disassociation before and after IL 6 treatment

PAGE 17

17 ( Behrmann et al., 2004 ) However, association constants for JAKs and receptors have yet to be determined. The cyto kines of the hematopoietic system provide a common link connecting the JAK kinases to signaling. They include: interleukins (ILs), colony stimulating factors, interfe rons (IFNs), erythropoietin (EPO ), and thrombopo i e tin (TPO ) These cytokines all use J AK k inases for their signaling ( Khwaja, 2006 ) Moreover, t hese cytokines predominantly bind to a family of transmembrane receptors, either monomeric or heterodimeric, that share structural features. The heterodimeric receptors share a common signaling subunit and a unique ligand binding chain ( Rane and Reddy, 2002 ) These can furt chain (granulocyte macrophage colony stimulating factor, IL 3, IL 5), the gp130 subunit (IL 6, leukemia inhibitory factor (LIF) oncostatin M, IL chain (IL 2, IL 4, IL 7, IL 9, IL 13, IL 15). The single chain and heterodimeric group together make up the type I cytokine receptors, which are characterized by the presence of a WSXWS motif, fibronectin type III domains in the extracellular part of the receptor, and by conserved Box1/Box 2 regions in the membrane proximal cytoplasmic domain ( Khwaja, 2006 ) The type II cytokine receptors include the IFN and IL 10 receptors, and they lack the WSXWS m otif but do have the Box1/Box2 region ( Khwaja, 2006 ) Signaling via these cytokine receptors is initiated by ligand binding, which induces the dimerization or a co nformational change of receptor subunits. The JAKs are constitutively associated with the receptor subunits via their FERM domain and the receptor Box1 domain, thereby conferring the functional equivalent of a receptor tyrosine kinase, as these receptors

PAGE 18

18 l ack this quality ( Behrmann et al., 2004 ) Receptor oligomerization brings the associated JAKs to close proximity, allowing their auto or trans phosphorylation an d activation. The JAKs have a multitude of physiological roles, including regulating the cell surface expression of their associated receptors ( Ragimbeau et al., 2003 ) and the recycling and degradation of their associated receptors ( Gauzzi et al., 1997 ) Gene targeting studies of the JAK kinases in mice show distinct phe notypes and are summarized in Table 1 3 ( Igaz et al., 2001 ) JAK1 knockout mice die perinatally due to profound d efects in lymphoid development ( Rodig et al., 1998 ) while JAK2 knockout mice die in the embryonic period due to a lack of erythropoiesis ( Parganas et al., 1998 ) This correlates with the rol e of JAK2 in erythropoietin (EPO) signaling, a cytok ine which plays a vital role in erythropoiesis Mice deficient in JAK3 are viable, owing to the limited expression of JAK3. They exhibit the murine severe combined immunodeficiency (SCID) phenotype that affects B and T cell populations. TYK2 knockout mice are phenotypically normal but have been shown to have exercise intolerance compared to their littermates, suggesting a mitochondrial respiration dis regulation ( Potl a et al., 2006 ) The JAK/STAT P athway Figure 1 1 presents a schematic representation of this commonly used pathway engaged by over 60 ligands in mammals (see Table 1 1 ). Ligand binds to an extracellular transmembrane receptor inducing receptor oligomeriz ation. Receptors are most often dimeric consisting of either two identical or different receptor subunits. Receptor activation is induced via tyrosine phosphorylation of the JAK protein, which are pre associated with specific membrane proximal binding site s on the receptor. The JAKs subsequently tyrosine phosphorylate the receptor subunit creating docking sites

PAGE 19

19 for the Src homology 2 (SH2) domains of STATs to bind. Once recruited, the STATs are then also tyrosine phosphorylated by the JAKs. This allows them to form STAT dimers which translocate to the nucleus and modulate specific gene expression ( Horvath, 2000 ) This is basically the classical model of JAK/STAT signaling. Interferons Interferons (IFNs) were discovered in the late 1950s as agents which interfered with viral infection. It was later det ermined that IFNs are secreted polypeptides that exert a wide range of biological activities including: anti viral, anti tumoricidal properties, apoptotic potentiation, growth inhibition, and lymphocyte activation to name a few. IFNs are categorized into three branches according to the specific receptor system engaged ( Borden et al., 2007 ) T ype I IFN consists of at least twenty mem bers including: further subdivided into 13 members. Besides their strong antiviral properties, they are also structurally type I IFN is achieved via engagement of the type I receptor subunit s known as IFNAR1 and IFNAR2. Type III IFN includes the members IL 28A, IL 28B, and IL 29. These ligands all contain intro ns and signal through the IL 10 receptor and IL 28 receptor While type III IFN engage unique receptors, they are believed to induce a similar intracellular signaling event as the type I IFN signaling system ( Borden et al., 2007 ) Type II IFN has ty pe I IFN members, but it also has potent immunomodulatory function and signals through its own distinct receptor subunits IFNGR1 and IFNGR2. IFNs are currently portrayed as cytokines which stimulate both intracellular and extracellular networks to regulate and enhance innate and adaptive immune responses,

PAGE 20

20 as well as provide tumor surveillance. Because of these properties, much interest and research has been invested into the mechanism of their signaling and it was the studying of IFN signaling which led to the discovery and characterization of the JAK/STAT pathway, its components, and the GAS element. S ignaling I is a pleiotropic cytokine produced by activated immune cells including: NKT, NK, T cells, B cells and professional APCs ( Gough et al., 2008 ; Schroder et al., 2004 ) The signaling mechanism has been well studied and has become a paradigm for JA K/STA T signaling in general, and is shown in Figure 1 4 complex is quickly internalized via receptor mediated endocytosis. Concurrently, JAK1 and JAK2, w hich are pre associated with the intracellular domains of IFNGR1 and IFNGR2 respectively, bec ome activated and phosphorylate tyrosine residue 440 of IFNGR1. STAT1 can then bind to this phosphotyrosine via its SH2 domain and is subsequently tyrosine phospho rylated on position 701 by either JAK. Tyrosine phosphorylated STAT1 dimerizes and is imported into the nucleus via the Ran/importin pathway ( Sekimoto et al., 1997 ) Subsequently dimerized STAT1 bind s to GAS elements located within the promoters of specific genes thereby activating them. Thus, the key role sole ascribed to the receptors and JAKs in signaling is simply to create activated STAT1 dimers. Additi onally signaling can also activate the commonly used auxiliary pathways: Ras/MAPK, PI3K/Akt, and CamKII potentially aiding in signal amplification and general growth/survival signals. ( Gough et al., 2008 ; Schroder et al., 2004 )

PAGE 21

21 The JAK/STAT D ilemma The current model for JAK/STAT signaling is oversimplified in many regards. First, STATs do not contain a prove n nuclear localization sequence (NLS) which permits association with the Ran/importin pathway for nuclear entry. Second, how over 60 ligands redundantly use homodimeric STATs to accomplish specific gene induction profiles remains unexplained. Finally, the translocation and gene regulation by nuclear JAKs has not been addressed with respect to JAK/STAT signaling, nor has its gene targeting mechanism. STATs Use the Ran/importin P athway but Lack an NLS The nuclear translocation of proteins greater than 40 kDa generally requires the engagement of the energy dependent Ran/importin pathway. This pathway uses the Ran and importin proteins to chaperone cargo containing a NLS through the nuclear pore complex and into the nucleus ( Johnson et al., 2004 ; Lyman et al., 2002 ; Sekimoto et al., 1997 ) While it is known that dimeri zed STATs use this pathway to gain nuclear entry, no such sequence has been empirically proven to exist in the STATs ( Johnson et al., 2004 ) Rather, the associati on of STATs with other specifically activated signaling components containing the NLS has been shown to chaperone their nuclear entry ( Ahmed and Johnson, 2006 ; Johnson et al., 2004 ; Kawashima et al., 2006 ; Lee et al., 2009 ; Williams et al., 2004 ) It has been reported that STAT1 acquires an NLS once it is activated and dimerizes with another activated STAT1 molecule ( Na rdozzi et al., 2010 ) Further, it was show n that two juxtaposed STAT1 molecules form a spatially contiguous cluster of polycationic amino acids where each molecule contributes a few cationic residues to form a conf ormational targeting sequence As such, the se authors contended that this

PAGE 22

22 di molecular NLS could only be formed by STAT1 dimerization. Additionally, they delineate the half NLS region of each STAT1 molecule to be located within the DNA binding domain formed by homodimeric STAT1 ( McBride et al., 2002 ) Another group went on to similarly show that the STAT1 and STAT2 heterodimer induced by type I IFN also forms an analogous conformational NLS ( Melen et al., 2001 ) These results fail to consider the association of this STAT heterodimer with IRF9, a known nucleo cytoplasmic shuttling protein ( Tang et al., 2007 ) Nevertheless, these dimers containing STAT1 are the only known examples of a di molecular/conformational NLS nuclear import known to bind to and u se importin for nuclear entry ( Lange et al., 2007 ) The group pioneering the conformational STAT1 NLS also showed that STAT1 binds terminus, specifically Armadillo repeats 8 10 with a K d of 10 6 M or more ( Johnson et al., 2004 ; McBride et al., 2002 ) As all known K d s of conventional NLSs bind with a K d of 10 8 M o r lower ( Johnson et al., 2004 ) these findings beg the question of physiological relevance. Finally, the demonstratio n that the STAT1 binding site on importin alph a 5 exists in Armadillo repeat s 8 10 ( Nardozzi et al., 2010 ; McBride et al., 2002 ) is bewildering as binding to Armadillo repeats 2 4 is required for importin alpha activation leading to nuclear pore associati on and translocation ( Lange et al., 2007 ; Johnson et al., 2004 ) Further investigation was performed to analyze potential NES and NLS sequences on STAT 3 ( Liu et al., 2005 ) 5 ( Iyer and Reich, 2008 ) and 6 ( Chen and Reich, 2010 ) which have also been shown to use the Ran/importin system for nuclear entry once activated by a ligand ( Meyer and Vinkemeier, 2004 ) While clear and definitively proven nuclear export sequences ( NES ) for all these STATs were o bserved,

PAGE 23

23 no NLS sequences were uncovered. Rather, specific sequences required for nuclear entry were pointed out, but not shown to be NLSs. The authors describe new sequences were fo und in the coiled coil region ( Meyer and Vinkemeier, 2004 ) rather than the DNA binding domain as proposed for STAT1. Further, these sequences allowed for constitutive nucleo cytoplasmic shuttling of these STATs regardless of their activation status. Altogether, it appears that STAT3, 5 and 6 do not use the same mechanism of nuclear entry as STAT1. The inability of these groups to specifically point out and prove NLSs on these STATs makes it highly unlikely that the STATs have NLSs. STATs R edundantly T arget the GAS E lement Signaling specificity also cannot be explained by the targeted DNA sequence bound by all homodimeri c STATs. Moreover, all STATs capable of homodimerization: 1, 3, 4, 5, and 6, bind to a GAS or GAS like element ( Ehret et al., 2001 ; Horvath, 2000 ) As such, many genes containing GAS elements are redundantly targeted by different STATs. For example, the induction of interferon regulatory factor 1 (IRF1) is achieved by ( Ahmed and Johnson, 2006 ; Goenka et al., 1999 ) IL 6 ( Harroch et al., 1994 ) IL 12 ( Galon et al., 1999 ) and IL 2 ( Schwarz et al., 1992 ) which use homodimeric STAT1, STAT3 STAT4, and STAT5, respectively. Thus, different ligands can redundantly use different STATs to induce the same gene by acting on this same GAS sequence. Interestingly, Prolactin (PRL) and IL 4 have been shown to inhibit IRF1 induction through STAT5 ( Luo and Yu Lee, 1997 ) and STAT6 ( Goenka et al., 1999 ) respectively. Besides highlighting the lack of targeting specificity provided between the

PAGE 24

24 STATs, this promiscuous binding begs the question of how the STATs uniquely target and regulate GAS co ntaining genes. There is evidence that homodimeric STATs not only target the same GAS elements, but that they directly compete for them. As mentioned above, the reciprocal regulation of IRF1 by IL 4 and is mediated by their activation of STAT6 and S TAT1 respectively. Still, the regulation of IRF1 induction depends on the relative amounts of STAT1 and STAT6 which bind to it and simultaneous treatment with both cytokines on HepG2 cells causes both STATs to bind to the IRF1 promoter ( Goenka et al., 1999 ) It has been further show n that treating cells with constant concentrations of IL 4 and while increasing the intracellular levels of STAT6 suppresses IRF1 induction by causing increased recruitment of STAT6 to the IRF1 GAS element. Similarly, it has been demonstrated that STAT5 activated by IL 2 and STAT3 activated by IL 6 compete for the same binding sites in the IL 17 locus of nave CD4+T cells ( Yang et al., 2011 ) Moreover, increasing the concentrations of IL 6 while holding IL 2 levels constan t caused the increase in T H 1 7 phenotype. The inverse relationship also held true; increasing the concentration of IL 2 respective to IL 6 suppressed this phenotype and expression of IL 17. Again, this was attributed to direct competition for gene occupancy by the STATs activated by their respective ILs. While this group presented only data focusing on the IL 17 locus, they also looked at global chromatin occupancy of STAT4 and STAT6 by polarizing CD4+ nave T cells towards a T H 1 or T H 2 phenotype ( Wei et al., 2010 ) In this case they found that STAT4 under T H 1 conditions and STAT6 under T H 2 conditions bound to many of the same genes. Moreover, the GAS motif was found to be redundantly targeted. Thus, STAT4 and STAT6, STAT1 and

PAGE 25

25 STAT6, and STAT3 and STAT5 have all been shown to directly target and compete for regulation of target genes containing the GAS element. Finally, i t should also be noted that the study comparing STA T4 and STAT6 demonstrated that these STATs also bound to a unique subset of genes. Thus, while STATs can and do compete for occupancy of the same GAS elements, they also bind to specific genes distinctly (reviewed Ehret et al., 2001 ) All the above studies failed to take into account the activation status of these STATSs and used diagnostic tools that could not discriminate between phosphorylated and non phosphorylat ed STAT. This is an impor tant issue to address as STAT1 3 5 ( Meyer and Vinkemeier, 2004 ) and 6 ( Chen and Reich, 2010 ) have all been shown to exist and function in the nucleus whe n not tyrosine phosphorylated JAK2/STAT5 S ignaling is Redundantly U sed by S ev eral L igands The activation of STATs by different ligands in the same cell has raised important questions on the specificity of biological actions. This has been especially noted for the cytokines: IL 3, Erythropoietin (EPO), Thrombopo i e tin (TPO), Prolacti n (PRL), Growth hormone (GH) and Granulocyte Macrophage colony stimulating factor (GM CSF) all of which specifically require JAK2 and STAT5 activation to mediate unique gene responses. The mechanism for how these six different ligands specifically activate signaling systems using activated STAT5 has not been established. A study comparing PRL GH, GM CSF, and EPO signaling has shown that these ligands all induce STAT5 homodimerization ( Gouilleux et al., 1995 ) This study used COS cells transfected with STAT5 and the appropriate receptor followed by ligand treatment. They found that in all instances the activated STAT5 bound to the same GAS elements found in severa l casein promoter. However, only PRL and not EPO nor GH, were

PAGE 26

26 casein promoter in vivo This suggests that additional specifications are required to direct activated STATs to target genomic elements. Another study using BaF3 cells transfected with receptors for E PO and then stimulated with either IL 3 or E PO demonstrated exclusive STAT 5 signaling and GAS binding ( Pallard et al., 1995 ) Moreover, they showed that treatment with either cytokine permitted cell growth in agreement with the fact that these cells depend on activated STAT5 for their survival. However, EPO but not IL 3 treatment led to the induction of beta globin ( DeMartino et al., 1994 ) attributing to the specific gene differentiation profile induced by EPO. Thus, the specificity of JAK/STAT signaling could not be sol ely attributed to activation of redundantly used JAK2 and STAT5. JAK2V617F Disorders Use Specific Receptors for S ignaling Recently, major attention has been paid toward an oncogenic and constitutively active form of JAK2 in which valine at position 617 i s changed to phenylalanine (JAK2V617F). This mutation is believed to abolish the function of the auto inhibitory region of JAK2 and has been observed in myeloproliferative diseases in which JAK2 and STAT5 are constitutively activated ( Funakoshi Tago et al., 2010 ; Lu et al., 2005 ; Reuther, 2008 ) This mutated fo rm of JAK2 is predominantly found in patients diagnosed with polycythemia vera (PV), thrombocythemia, and primary myelofibrosis which are clinically observed as excessive red blood cells, overproduction of platelet cells and fibrosis of the bone marrow, re spectively. Furthermore, transgenic mice containing this JAK2 mutation showed granulocytosis, leukocytosis, and thrombocytosis ( Shide et al., 2008 ) Finally, when b one marrow cells expressing the JAK2 mutant were injected into normal mice, they developed erythrocytosis and subsequent PV like symptoms ( James et al., 2005 ) Thus JAK2V617F contributes to oncogenesis via

PAGE 27

27 promoting the aberrant differentiation of hematopoie tic stem cells (HSC) and its derivatives into granulocytes, thrombocytes, leukocytes, and erythrocytes. This differentiation suggests aberrant signaling by GM CS F, TPO, and EPO receptors Interestingly, JAK2 and STAT5 are redundantly used by these signaling systems to induce HSC differentiation. How JAK2 and STAT5 are uniquely activated by these particular ligands to induce differentiation has not been addressed, nor has it been discerned how only myeloid clonal disorders develop with respect to the JAK2V617F background. In vitro experiments using BaF3 cells have detailed much of the mechanism of JAK2V617F mediated transformation. BaF3 is a murine bone marrow deri ved pro B cell line that depends on IL 3 signaling and subsequent JAK2 and STAT5 activation for their survival ( Funakoshi Tago et al., 2010 ) It was found that when these cells were transfected with JAK2V617F they could transform and become growth factor independent in line with the oncogenic properties of JAK2V617F and its activation of STAT5 ( Funakoshi Tago et al., 2010 ) Importantly, this transformation was dependent on the co expression of EPOR, TPOR, and G CSFR. Moreover, when coexpressed with the mutant JAK2, the respective receptor signaling systems wer e found to be constitutively active ( Funakoshi Tago et al., 2010 ; Lu et al., 2005 ) Thus the JAK2V617F mutat ion is only oncogenic when coupled to a particular receptor signaling platform. This JAK2V617F receptor interaction is important in developing the specific phenotypes associated with the respective neoplasias. Nuclear JAKs Further investigation into the m echanism of JAK2V617F signaling has revealed very interesting and unconventional findings, particularly in discerning a nuclear role for

PAGE 28

28 JAK2 ( Dawson et al., 2009 ; Liu et al., 2011 ) Moreover, JAK2 activated either by the mutation above or by cytokines, cause JAK2 to target and phosphorylate histone H3 located within the promoter of target genes thereby activating them As such, treatment of cells with the cytokines LIF, IL 3, and PDGF2 all increase global H3Y41 phosphorylation ( Dawson et al., 2009 ) However, the specific gene t argeting mechanism of JAK2 has not been elucidated, though unique engagement with specific receptor signaling systems is an attractive notion. It has also been shown that JAK2 and JAK2V617F also play an indirect role in epigenetics by binding to and phosp horylating the histone methyltransferase PRMT5, both outside and within the nucleus ( Liu et al., 2011 ) This phosphorylation inactivates PRMT5 causes global chromati n removal of symmetrically dimethylated histones H2A and H4 at position R3 and results in specific gene regulation. Thus, JAK2 plays both a direct and indirect role in epigenetics and specific gene expression. Interestingly, histone H3 ( Griffiths et al., 2011 ) and PRMT5 ( Liu et al., 2011 ) have also been shown to be a substr ate for JAK1, implying redundancy in JAK usage. It must also be noted that the nuclear localization of JAKs are not a novel discovery. JAK1 ( Griffiths et al., 20 11 ; Hao et al., 2005 ; Lobie et al., 1996 ) JAK2 ( Lobie et al., 199 6 ; Mertani et al., 2003 ; Nilsson et al., 2006 ) and TYK2 ( Ragimbeau et al., 2001 ) have all been shown to be constitutively present or play an active role within the nucleus of the cells studied. Importantly, growth hormone treatment was shown to induce the translocation of activated JAK2 to the nucleus in GHR transfected CHO cells ( Lobie et al., 1996 ) and in CWSV 1 cells ( Ram and Wax man, 1997 ) while IF

PAGE 29

29 treatment of TYK2 GFP transfected U1A cells was shown not to alter the nuclear cytoplasmic distribution of total activated TYK2 ( Ragimbeau et al., 2001 ) Con certed R eceptor STAT G ene A ctivation It has been suggested that the association of homodimeric STATs with other proteins is responsible for their specificity of gene induction ( Ahmed and Johnson, 2006 ; Johnson et al., 2004 ) For example, the acetyltransferase p300 has been shown to associate with STAT1 ( Horvath, 2000 ) 3 ( Giraud et al., 2002 ; Horvath, 2000 ; Lee et al., 2009 ) and 5 ( Pfitzner et al., 1998 ) to accomplish promoter activation via histone acetylation. However, the redundant use of p300 and others cofactors which contribute to STAT signaling responses via general gene activating mechanisms still does not explain signa ling specificity. It is interesting to note that the association of cotranscription factors such as p300 have been found to interact with many receptor systems where they may interface with activated STATs and JAKs ( Chia et al., 2010 ; Lee et al., 2009 ; Tang et al., 2007 ) Thus, the recruitment of STATs to unique receptor s ubunits may allow them to engage other unique and redundantly used cofactors to mediate their specific gene response. A multitude of evidence from many different labs has strongly suggested that the ligand, receptor and JAKs play a much grander role in s ignaling than mere JAK/STAT activation. Where investigated, ligands, receptors, and JAKs have all been observed in the nucleus in addition to STATs following ligand stimulation (reviewed in Subramanium et al., 2001) In many instances it has been shown th at the ligated receptor associates with STATs in the nucleus where they function as a complex to activate specific promoters.

PAGE 30

30 The mechanism of EGF signaling has been extensively detailed and highlights this association. It has been shown that upon ligatio n by EGF, the receptor EGFR is rapidly internalized via receptor mediated endocytosis, undergoing retrograde transport leading to importin mediated nuclear entry. Nuclear EGFR complexes with STAT3 and STAT5 to activate the promoters of cyclin D1, iNOS, cfos ( Lo et al., 2005 ) and aurora B ( Hung et al., 2008 ) respectively. Similar to the EGF, osteopontin (OPN) mediated ligation of CD44 induces cyclin D1 activation via a nuclear complex consisting of CD44, STAT3, an d p300 ( Lee et al., 2009 ) In this case it should be noted that STAT3 nuclear accumulation and cyclin D1 expression was inhibited by transfecting cells with CD44 muta nts either lacking an intracellular domain or bearing a mutation in its nuclear localization sequence. Thus, a full length receptor capable of nuclear translocation and STAT association was required for gene activation and STAT nuclear import Finally, GH induction and nuclear translocation of STAT5 ( Chia et al., 2010 ; Ram and Waxman, 1997 ) JAK2 ( Mertani et al., 2003 ; Ram and Waxman, 1997 ) GH, and GHR ( Mertani et al., 2003 ) has also been shown, however the association of these components within the nucleus or at specific promoters has not been determined. S ignaling M echanism Our lab has focused on the mechanism of I signaling. We and others ( Bader and Weitzerbin, 1994 ) have shown that I and its alpha r eceptor subunit (IFNGR1) are rapidly internalized and translocated to the nucleus ( Ahmed and Johnson, 2006 ; Larkin e t al., 2000 ) I binds first to the extracellular domains of IFNGR subunits activating the receptor and inducing receptor mediated endocytosis. Upon internalization, I binds via its C terminus to residues 253 287 of IFNGR1 ( Szente and Johnson, 1994 ) JAK1 associates with human IFNGR1

PAGE 31

31 on residues 266 269 throughout activation ( Gough et al., 2008 ; Schroder et al., 2004 ) however, the binding of I to the intracellular domain of IFNGR1 potentiates the movement of JAK2 from IFNGR2 to 283 309 and 404 432 on murine IFNGR1 ( Szente et al., 1995 ) Interestingly, there is overlap for the binding of these proteins on IFNGR1. STAT1 is recruited to residue 440 of IFNGR1 and is tyrosine phosphorylated by the JAKs. The polycationic sequence of I is then recognized by importin and the entire activated receptor complex consisting of I IFNGR1, and STAT1, are imported into the nucleus. There the receptor complex binds to target genes such as IRF1 and IDO1 to promote their activation ( Ahmed and Johnson, 2006 ) An important question remains as to whether JAK1 and JAK2 are part of this activated nuclear receptor complex. The finding that JAK1 and JAK2 function in the nucleus to specifically activate target genes by phosphorylating histone H3 within target promoters begs the question of how the JAKs are directed to specific histones and how this role fits into conventional JAK/STAT signaling. The epigenetic gene activation mediated by JAK2 is performed through several cytokines utilizing receptor systems that activate JAK2 ( Dawson et al., 2009 ; Griffi ths et al., 2011 ) This has led us to ask whether I is one of these cytokines as it s signaling depends on both JAK1 and JAK2 ( Briscoe et al., 1996 ) Further, the fact that JAK2 requires a receptor association to accomplish specific gene induction ( Gouilleux et al., 1995 ; Pallard et al., 1995 ) and that JAK receptor ass ociation ( Behrmann et al., 2004 ; Haan et al., 2006 ) strongly suggest that the JAKs complex with the receptor throughout signaling and particularly within the nucleus. Thus, we thought it was logical to assess the associations of JAK1 and JAK2 with the I IFNGR1 STAT1 receptor complex as part of I signaling. Particularly, we

PAGE 32

32 sought to assess histone H3pY41 levels globally and at specific promoters following I stimulation.

PAGE 33

33 Table 1 1 Ligands that signal using Janus kinases (JAKs) and signal transducers and activators of transcription (STATs). Ligand JAK(s) STAT(s) EPO TPO P RL GM CSF G CSF IL 11 Serotonin IFN IL 4 Insulin Thrombin IL 6 GH IL 2 IL 3 IL 7 LIF IL 10 IL 5 IL 9 Angiotensin Leptin IL 12 IL 23 Type I IFNs JAK2 JAK2 JAK2 JAK2 JAK1, JAK2, TYK2 JAK1, JAK2, TYK2 JAK2 JAK1, JAK2 JAK1, JAK3 JAK1 JAK2 JAK1, JAK2, TYK2 JAK2 JAK1, J AK3 JAK2 JAK1, JAK3 JAK1, JAK2, TYK2 JAK1, TYK2 JAK2 JAK1, JAK3 JAK2, TYK2 JAK2 JAK2, TYK2 JAK2, TYK2 JAK1, TYK2 STAT5 STAT5 STAT5 STAT5 STAT3 STAT3 STAT3 STAT1 STAT6 STAT1, STAT5 STAT1, STAT3 STAT1, STAT3 STAT3, STAT5 STAT3, STAT5 STAT3, STAT5 STAT3, STAT 5 STAT1, STAT3, STAT5 STAT1, STAT3, STAT5 STAT1, STAT3, STAT5 STAT1, STAT3, STAT5 STAT1, STAT2, STAT3 STAT3, STAT5, STAT6 STAT1, STAT3, STAT4, STAT6 STAT1, STAT3, STAT4, STAT6 STAT1, STAT2, STAT3 6 Adapted with modifications from Schindler, 2002 ( Schindler, 2002 )

PAGE 34

34 Figure 1 1 Schematic model of the JAK/STAT signaling pathway. A ligand binds to its receptor(s), activating the JAKs that are pre associated with their receptor subunits. The JAKs then phos phorylate the cytoplasmic domain of their receptors, creating docking sites for the SH2 domain of STATs. Once the STATs are recruited to the receptor, they are phosphorylated on key tyrosine and by JAKs. This activation of STATs allows them to form homodim ers that subsequently translocate to the nucleus to bind specific sequences (GAS) on genomic DNA to activate gene expression.

PAGE 35

35 Figure 1 2. Domain architecture of STAT proteins. Defined abbreviations for the structural and functional regions of the STAT proteins: ND, N domain responsible for STAT STAT interactions (yellow box); COILED COIL, coiled coil domain contributes to protein interactions (green box); DNA, DNA binding domain (red box); LD, linker domain contributes to tr anscription (orange box); SH2 S rc homology 2 domain responsible for receptor binding and STAT dimerization (blue box). All STATs are activated by tyrosine (Y) phosphorylation around pos i tion 700. The transcriptional activation domains (TAD, purple box), aids in recruiting transcripti onal cofactors. Table 1 2. Phenotypes of STAT knockout mice. Targeted Gene Phenotype STAT1 No innate response to viral or bacterial infection STAT2 Viable and fertile, defective type I IFN functions STAT3 Early embryonic lethal STAT4 Lack of TH1 func tion STAT5A No breast development or lactation STAT5B No breast development or lactation STAT6 Lack of TH2 function Adapted with modification from Darnell, 1997. ( Darnell, 1997 ) Table 1 3. Phenotypes of JAK knockout mice. Targeted Gene Phenotype TYK2 Normal, but lack of physical endurance JAK1 Perinatal lethal, low birth weight, no nursing JAK2 Embryonic lethal, lack of erythropoie sis JAK3 SCID Adapted with modifications from Igaz et al., 2001.

PAGE 36

36 Figure 1 3 Domain architecture of JAK proteins. FERM domain encompasses JH7 JH5 and is required for receptor association. An SH2 domain exists in JH4 JH3 and may contribute to receptor binding. JH2 is the pseudokinase domain and is believed to play an autoinhibitory role of the JH1 domain which is a classical tyrosine kinase domain. Around position 1000 within the JH1 domain lies tyrosine residues which become phosphorylated with the ac tive JAK.

PAGE 37

37 Figure 1 4 Canonical IFN signaling. Ligand binding to IFNGR induces a conformational change in IFNGR1 and IFNGR2. This binding is believed to occur with a dimer of IFN binding to two IFNGRs, such that the stoichiometry is 2:2. Subsequent t o ligation, JAK2 and JAK1 become activated and phosphorylate tyrosine (pY) 440 of IFNGR1. STAT1 is recruited to this pY and is phosphorylated on residue 701. Phosphorylated STAT1 forms a homodimer and is imported into the nucleus via the Ran/importin pathw ay where it binds to the GAS element thereby inducing target genes. The PI3K/Akt, Ras/MAPK, and CamKII pathways can also be activated.

PAGE 38

38 CHAPTER 2 MATERIALS AND METHOD S Cell C ulture a nd A nti b odie s WISH cells were purchased from American Type Culture Collec tion (ATCC) and were grown in MEME (Sigma Aldrich) with 10% FBS and antibiotics. For all experiments, cells were serum starved for at least 4 hours, washed twice with PBS and 500 ng/m l 2 The f ollowing polyclonal antisera were purchased from Santa Cruz: IFNGR1 (sc 700), STAT1 (sc 346), pSTAT1 (sc 7988 R), pSTAT2 ( sc 21689 R ), TYK2 ( sc 169 ), pTYK2 ( sc 11763 ), pJAK1 (sc 16773 R), pJAK2 (sc 16566 R), normal rabbit Ig G (sc Tubulin (sc Lamin (sc 20682), and Histone H3 (sc 10809). A ntibody to acetylhistone wa s from Active Motif (06 599). Antibody to IFNAR1 was from Epitomics (EP899Y ). Antibody to JAK2 was from Millipore (06 1310) Additional antibodies to pJAK2 were also purchased from Cell Signaling: 3771 (polyc lonal) and 3776 (monoclonal). Antibody to tyrosine phosphorylated Histone H3 was from Abcam (ab26310). Chromatin I mmunoprecipitation (ChIP) A ssay WISH cells were treated or not with I for 1 h our Cells were then washed twice with cold PBS and treated with 1% formaldehyde for 10 min at 37C. The rest of the procedure was conducted using the ChIP kit from Millipore (#17 295) as per the D NA fragments of ~ 500 bp. Control IgG or different antibodies were used for each immunoprecipitation as indicated DNA fragments eluted were used for PCR with the following primers that spanned the GAS element in their promoters. Human IFN regulatory fact or 1 ( IRF 1)

PAGE 39

39 promoter region was amplified with the primers CGCCCTGTACTTCCCCTT ( 403 to 3 86 ) and CACCGAGCAATCCAAACACTTA ( 222 to 3 44 ) As a control, PCR was conducted with the primers from the human ac tin promoter CTCGCTCTCGCTCTTTTTTTTTTT C ( 967 to 9 41 ) and CTCGAGCCATAAAAGGCAACT ( 844 to 864 ) The PCR conditions were: 94C for 5 min, followed by 35 cycles at 94C for 15 s, 60C for 30 s, and 68 C for 20 s. This was followed by annealing at 68C for 5 min. Following ChIP with dif ferent antibodies indicated, the DNA protein complex was used to elute the associated proteins by boiling with the electrophoresis buffer and was analyzed by Western blotting, as mentioned below. Nuclear Fractionation and N uclear JAK2 A ctivation Following treatment, WISH cells were washed twice in cold PBS, removed by scraping in lysis buffer, and pelleted via low speed centrifugation. The supernatant was removed and saved as cytoplasmic extract while the pellet, containing intact nuclei, was gently resuspe nded in lysis buffer. The centrifugation, re suspension, and decanting was then repeated twice more. Isolated nuclei were confirmed by trypan blue staining. Nuclear extracts were prepared by sonicating the final nuclear pellet in lysis buffer, followed by centrifugation to remove insoluble material. Whole cell lysate was independently generated by simply sonicating cells following their scraping in lysis buffer. To determine activation of JAK2 within the nucleus, WISH cells were treated with I for 10 min and nuclei were collected as described above. Pooled nuclei were resuspended in kinase buffe r consisting of 10 mM PBS, 100 M Na 3 VO 4 5 mM MgCl 2 and 300 M ATP, and equal volumes were aliquoted in separate tubes followed by

PAGE 40

40 incubation at 37 o C for the in dicated times. Nuclei were then recollected by centrifugation and nuclear lysates obtained as described above. Indirect I mmunofluorescence A ssay and C onfocal M icroscopy WISH cells on coverslips were fixed with 2% paraformaldehyde and processed as described elsewhere ( Kima et al., 2010 ) In brief, i ncubation with primary antibodies was done at 1:50 dilution and was performed in binding buffer supplemented with 0.05% s aponin. Coverslips were incubated with goat anti rabbit secondary antibodies conjugated to FITC (Molecular probes) at a 1:200 dilution. Finally, the nucleic acid dye propidium iodide was added to all coverslips and the excess removed by washings with PBS Coverslips were then mounted on glass slides with ProLong antifade (Molecular P robes), and t he images observed were obtained using a Zeiss Axiovert 200 M confocal microscope under 40x water immersion objective and an auxiliary 2x magnification. 3D reconstr uction of images from 2D images was done using 17 image sections from the stack, 4 m above and below the focal plane through the nucleus of the c ells ( a 0.5 m displacement each along the Z axis) and sections were merged to render a 3D reconstruction of t he cells. All images were further clarified using LSM 5 Pascal v3.2 SP2 ( Zeiss, Heidelberg, Germany). Analysis of P roteins B ound to B iotinylated GAS P romoter DNA To identify the proteins associated with the GAS promoter, a nucleotide sequence from human IR F 1 promote r containing the GAS motif 5 TGATTTCCCCGAAATG 3 was chosen. An oligonucleotide containing a BamHI site followed by 5 copies of this sequence and another oligonucleotide with complementary sequence were annealed and then inserted into the pG L3 Basic vector using standard cloning techniques Sequence analysis showed two insertion events, gen erating a

PAGE 41

41 vector with 10 GAS elements; the first five tandem copies were separated from the second five by six basepairs: GATCCG Th e GAS copies were amplified out of this vector GGTGCCAGAACATTTCT and biotin TACTGTTGGTAAAGCCACC resulting biotinylated x10 GAS PCR product was precipitated out using standard ethanol/sodium acetate protocol, and the final DNA pellet was redissolved in a minimal amount of water and analyzed via a 1.4% agarose gel. Equal amounts of this DNA were incubated with 1 mg of whole cell lysates and left to rock at 4 o C overnight followed by incubation with Neu travidin agarose (Thermo Scientific) for 2 hours. Precipitated material was sedimented and washed with PBS. The bound proteins were eluted with SDS sample buffer, boiled electroph oresed, and analyzed by Western blotting. Western Blot A nalysis and I mmunopr ecipitation Cells were washed with PBS and harvested in lysis buffer (10 mM HEPES (pH 7.9), 100 mM KCl, 1% Triton X 100, 1 mM NaF, 1 mM Na 3 VO 4 2 mM MgCl 2 1 mM DTT, and 1 mM PMSF Whole cell lysate was generated via sonication on ice and insoluble materia l removed via centrifugation at 14k rpm for 10 min at 4 o C. Protein concentration was measured using 660 nm protein assay reagent (Pierce) Protein (10 g each) was electrophoresed on an acrylamide gel, transferred to PVDF and probed with the antibodies i ndicated. HRP conjugated secondary anti bodies were used, and detection was conducted by chemiluminescence (Pierce). Immunoprecipitation was conducted by incubating specific antibodies with equal amounts of lysate followed by incubation with Protein A Ag ar ose ( Santa Cruz ), for at least 2 hours. Precipitated material was sedimented and washed thrice with PBS.

PAGE 42

42 CHAPTER 3 RESULTS pJAK2 and pJAK1 A re R ecruited to the GAS E lement in the IRF1 P romoter We previously showed by ChIP analysis that treatment of cells promo ter region of the IRF 1 gene ( Ahmed and Johnson, 2006 ) A simila r ChIP analysis was performed for activated JAK2 (pJAK2) and JAK1 (pJAK1) using WISH cells treated bp fragments were immunoprecipitated with antibodies to STAT1, IFNGR1, pJAK1, pJAK2, a cetylated histone H3 (AcH3), and histone H3 phosphorylated on tyrosine 41 (H3pY41), followed by PCR with primers fl anking the GAS element from IRF 1. The PCR product selected for amplification extended from n ucleotides 403 to 222 in the promoter of the IR F 1 actin gene, 967 to 8 44, was chosen. As shown in Figure 3 1A STAT1, IFNGR1, pJAK1, pJAK2, AcH3, and H3pY41 were associated with the GAS element of the IRF1 we prev iously showed the presence of IFNGR1 and STAT1 at the GAS promoter ( Ahmed and Johnson, 2006 ) their presence here can also be considered as an internal positive cont rol. Phosphorylation of AcH3 on Y41, H3pY41, results in disassociation of in transcription of genes such as IRF1, ( Dawson et al., 2009 ) Untreated cells showed IRF 1 promoter only in input and anti AcH3 precipitated actin promoter was precipitated only by anti Th showed the presence of pJAK1 and pJ AK2 in the promoter of the IRF 1 gene.

PAGE 43

43 Association of pJAK1 and pJAK2 with IFNGR1 in Cells T ( Ahmed and Johnson, 2006 ) This complex is actively transported into the nucleus where the nuclear if pJAK1 and pJAK2 were associated with IFNGR1 in the complex as this would provide a mechanism for the specific presence of the JAKs at the IRF 1 promoter. Accordingly, cell lysates were immunoprecipitated (IP) with antibodies to IFNGR1 and analyzed by Western blots. As shown in Figure 3 1B both pJAK1 and pJAK2 bound to IFNGR1 stably over 15 to 60 minutes with similar levels of pJAK2 over the time period and maximal pJAK1 binding at 60 minutes. pJAK2 has been shown to bind to ( Szente et al., 1995 ) These observations provide the mechanism for activation of the JAKs and for their specific Cell lysates were also Western blotted for tyrosine phosphorylation of histone H3 (H3pY41) after 3 1C increased H3pY41 was observed at 30 and 60 minutes, with a peak at 30 minutes. These results are consistent with nuclear pJAK2, and perhaps pJAK1, phosphorylation of histone H3 at Y41, which is associ ated with specific gene activation. pJAK2 is P resent in the N ucleus of C ells only after T In order to further determine if pJAK2 was present in the nucleus of WISH cells clear lysates for both pJAK2 and JAK2. pJAK2 was present in the nucleus only after treatment of cells with was pre sent constitutively (Figure 3 2A ). JAK2 contains a classical

PAGE 44

44 cationic NLS, which may allow movement in an inactive state betw een the cytoplasm and nucleus ( Lobie et al., 1996 ) lamin were used as markers of nuclear and cyto plasmic fractions, respectively. pJAK2 appeared in the nucleus in association with IFNGR1, which we activated genes ( Ahmed and Johnson, 2006 ) This does not preclude activation of JAK2 in the nucleus via nuclear IFNGR1. In order to determine possible activation of JAK2 in the nucleus in addition to the known activation in the cytoplasm isolated the nuclei, and determined if there was an increase in nuclear pJAK2 over time. As shown in Figure 3 2B pJAK2 was present in the nucleus at 0 minutes of nuclear Western blot. The level of nuclear pJAK2 increased at 5 and 15 minutes and decreased at 30 minutes. Thus, there was further activation of cells was capable of phosphorylat ion of nuclear JAK2. These activation events are only in the presence of pSTAT1 in th e nucleus. It is noteworthy that pSTAT1 levels were maximal at 0 minutes of isolated nuclei and decreased thereafter over time. By comparison, pY41H3 levels increased in nuclei over time. Immunoprecipitation of ells showed IFNGR1 and pJAK2 association, which would be expected in nuclear IFNGR1 involvement with nuclear activation of JAK2 (Figure 3 2C ). Thus, the increase in pJAK2 appears to be related to

PAGE 45

45 nuclear events other than furth er nuclear activation of pSTA T1 pJAK2, IFNGR1, and STAT1 D irectly A ssociate with GAS P romoter E lement of C ells T We have previously shown that IFNGR1 and STAT1 directly associate with the GAS promoter e ( Ahmed and Johnson, 2006 ) In order to verify the association of pJAK2, a biotinylated GAS promoter was generated and incubation with lysates, the mixture was then incubated with Neutravidin conjugated to ag arose. Following washing, the bound proteins were eluted, electrophoresed, and probed with antibodies to pJAK2, IFN GR1, and STAT1. As shown in Figure 3 2D all these proteins were associated 60 minutes. Thus, pJAK2, IFNGR1, and STAT1 are associated with the GAS promoter element only after Immu nofluorescence of pJAK2 in the N ucleus of C ells T To complement the ChIP analysis and Western blots, we performed immu were stained for JAK2 an d pJAK2. As shown in Figure 3 3A JAK2 was present throughout the cell, but pJAK2 was absent from untreated cells. By contrast, pJAK2 was observed in th ng presence in the nucleus (Figure 3 3B ). The predominant presence of pJAK2 in the nucleus was also observed at 60 m 3 3C ). Thus, similar to ChIP and Western blo ts, JAK2 was present in both the cytoplasm and nucleus of untreated and

PAGE 46

46 pTYK2 is P resent in the N ucleus of C ells only after T reatment with Type I I FN while total TYK2 is constitutively present In or der to determine if other JAK/STAT utilizing ligands besides also induce the nuclear localization of activated JAKs besides JAK2 and JAK1 we characterized the nuclear and cytoplasmic distribution of T YK2 and pTYK2 by sub cellular fractionation of WISH cells treated with IFN 2 or IFN For both of these ligands we were able to show the constitutive presence of TYK2 in nuclear extracts. However, pTYK 2 was present in nuclear lysates only after treatment w ith either type I IFN (Figure 3 4). Like JAK2 TYK2 also contains a putative classical cationic NLS, which may allow movement in an inactive state between the cytoplasm and nucleus To ascertain the purity of nuclear lamin we re again used as markers of nuclear and cytoplasm ic fractions, respectively. To further verify the authenticity of type I IFN signaling, the nucelocytoplasmic profile of pSTAT1, and pSTAT2 were also examined. Figure 3 4 shows that these activated STATs ar e present in both compartments only after type I IFN treatment in accord with the known signaling mechanism of type I IFN. Because TYK2 is known to associate with the IFNAR1 subunit to activate STAT1 and 2 we also examined its nucleocytoplasmic profile (Fi gure 3 4). We found that in response to either IFN 2 or IFN IFNAR1 accumulates in the nuclear fraction over a period of one hour, while its cytoplasmic presence decreases. pJAK2 and IFNGR1 A re A ssociated with ells We showed i n Figure 3 1C phosphorylation of histone H3 at tyrosine 41. We test here for the association of pJAK2,

PAGE 47

47 60 minutes and whole cell lysates were immunoprecipitated against histone H3 followed by Western blotting for the indi cated proteins. As shown in Figure 3 5 pJAK2, IFNGR1, and pSTAT1 were associated with histone H3 at 30 and 60 but not to any significant extent in untreated cells. Interestingly, STAT1 protein was associated with histone H3 in untreated cells, increased pSTAT1. This would suggest that unphosphorylated STAT1 protein is pSTAT1. This is consistent with studies in Drosophila that show that unphosphorylated STAT is present in the nucleus of cells and fu nctions as a heterochromatin stabilizer. Exit from the nucleus or disassociation from histone H3/heterochromatin was associated with heterochromatin destabilization and gene activation ( Yan et al., 2011 ) The association of pJAK2 and IFNGR1 with histone H3 is consistent with pJAK2 phosphorylation of tyrosine 41 on the protein.

PAGE 48

48 Figure 3 1. pJAK2, and H 3pY41 with the IRF1 promoter. A ) WISH cells were treated formaldehyde for 10 minutes. Chromatin from cross linke d cells was sheared by sonication and immunoprecipitated with the specific antibodies indicated, followed by incubation with protein A Sepharose saturated with salmon sperm DNA. The detection of immunoprecipitated IRF 1 or actin promoter was conducted by PCR with promoter specific primers. PCR products w ere run on a 1.4% agarose gel. B of pJAK1 and pJAK2 with IFNGR1 correlates with the tyrosine phosphorylation of histone H3. WISH cells were incubated with or without ng/ml) for the indicated times, then whole cell lysates were obtained. Equal amounts of protein were immunoprecipitated using IFNGR1 antibody. Immunoprecipitated material was then washed, subject to PAGE, and then Western blotted using the indicated antib od ies. C ) H3pY41, then stripped and re probed for AcH3. Numbers at the bottom of pYH3 blot represent relative intensity of b ands as measured by using Image J program downloaded from the National Institute of Health. The results are representative of three experiments.

PAGE 49

49 Figure 3 2 tr eatment. A the indicated times, then whole cell (WL) and nuclear lysates were independently obtained (see Materials and Methods), and analyzed by Western blot with the indicated antibodies. B ) WISH cell s were treated with Methods). Isolated nuclei were then incubated at 37 o C in kinase buffer for the indicated times. Lysates were obtained and subjected to Western blotting for t he indicated proteins. Numbers at the bottom represent relative intensity of bands as meas ured by using Image J program. C ) Cells were treated with indicated times and nuclear extracts were immunoprecipitated with antibody to IFNGR1. Eluted proteins were Western blotted with antibodie s to pJAK1, pJAK2, and IFNGR1. D) pJAK2, IFNGR1, and STAT1 are associated with the GAS promoter. A biotinylated double stranded oligomer containing five copies of the GAS element taken from the IRF1 promo ter was incubated with equal amounts of whole cell lysates (WL) from WISH cells that were untreated or treated with for 30 min or 60 min. This complex was then added to Neutravidin conjugated to agarose (GAS probe). The bound proteins were washed, eluted, electrophoresed, and probed sequentially with antibodies to pJAK2, IFNGR1, and STAT1. The results are represent ative of at least two experiments.

PAGE 50

50 Figure 3 3 JAK2 is constitutively present in nuclei, while pJAK2 appears in nuclei pJAK2 in WIS H cells either left A) untreated n g/ml) for B) 30 or C) 60 minutes. Following immunofluorescence, images of cells were obtained via confocal microscopy. 3D reconstruction of images from 2D above and below the focal plane t displacement each along the Z axis). Sections were merged to render a 3D reconstruction of the cells. The resulting images were projected by rotation at 0 along the X axis, 90 along the Y axis, and presented belo w each un rotated image. All image processing was done using Pascal (Microsoft) software attached to a LSM 5 Pascal workstation.

PAGE 51

51 Figure 3 4 TYK 2 is constitutively present in the nucleus and is activated upon type I IFN tr eatment. WISH cells were in cubated with A) 10 kU/ml of IFN or B) 500 ng/ml IFN for the indicated times, then cytoplasmic an d nuclear lysates were obtained and analyzed by Western blot with the indicated antibodies. Results are representative of at least three experiments.

PAGE 52

52 Figure 3 5 pJAK2, IFNGR1, and pSTAT 1, are induced to associate with histone H3 in response to STAT1 is constitutively associated. Equal amounts of whole cell lysates and 60 minutes were subjected to immunoprecipitation against histone H3 antibody. The bound proteins were washed, eluted, electrophoresed, and probed sequentially with antibodies to pJAK2, IFNGR1, pSTAT1, STAT1, and histone H3. The results are representati ve of at least two experiments.

PAGE 53

53 CHAPTER 4 DISCUSSION Our previous studies of IFN signaling have focused on events that were critical for the specificity of gene activation. One of the reasons for such studies is the lack of obviousness for specific gene activation in the classical model of the mechanism of JAK/STAT signaling. The STA T family of transcription factors has seven members, which are thought to be the mediators of the unique functions associated with greater than 60 different ligands/receptor systems ( Ahmed and Johnson, 2006 ; Johnson et al., 2004 ) Activated STAT in the phosphorylated state, pSTAT, uniquely forms homodimers that bind to the response elements in the promoter region of activated genes. Heterodimers are the exception of which pSTAT1/pSTAT2, pSTAT1/pSTAT3, and 6, and growth hormone activity, respectively. The sole function of the ligand in this view, is to interact wi th the extracellular domain of the receptor complex. This in turn results in activation of receptor associated JAK kinases, whose sole function is activation of the STATs on the cytoplasmic domain of the receptor complex. The receptor complex is ascribed n o other relevance to the signaling beyond a platform for STAT activation and activated JAKs are ascribed no other function beyond that in the cytoplasm. Disassociation of the pSTATs from the receptor and subsequent nuclear translocation results in the spec ific transcriptional events that are associated with the ligand ( Borden et al., 2007 ; Horvath, 2000 ) It has rec ently been acknowledged that the classical model of JAK/STAT signaling was over simplified in its original form ( Gough et al., 2008 ) In the case of IFN complexity beyond simple JAK/STAT activation in signal transduction is indicated

PAGE 54

54 in the relatively recent demonstration that other pathways, including MAP kinase, PI3 kinase, Cam kinase II, and others cooperate with or act in parallel to JAK/STAT signal ing to regulate IFN effects at the level of gene activation and cell phenotypes ( Gough et al., 2008 ) All of these pathways are generic in the sense that a plethor a of cytokines with functions different from those of IFN also activate them. Thus, for IFN and other cytokines, uniqueness of function would seem to depend on cytokine control of complex and unique qualitative, quantitative, and kinetic aspects of the a ctivation of these pathways. We are not aware that this has been demonstrated for any cytokine. There is evidence of a functional interaction between STATs in gene activation/suppression, which provide more insight into STAT mediation of cytokine signaling The induction of IL 17 by activated STAT3, for example, was countered by IL 2 activation of STAT5 ( Yang et al., 2011 ) It was demonstrated by ChIP sequencing that STAT3 and STAT5 bound to multiple common sites across the IL 17 gene locus, including non coding sequences. Activation of STAT5 by IL 2 resulted in more binding of STAT5 and less binding of STAT3 at these sites, whereas activation of STAT3 by IL 6 induced the opposite; the combination of the two STATs resulted in dynamic regulation of the IL 17 gene locus by the opposing effects of IL 2 (STAT5) and IL 6 (STAT3) ( Yang e t al., 2011 ) A similar complementarity was observed with STAT4 and STAT6 with respect to Th1 and Th2 cell development, but with much less competition for binding sites at coding and non coding regions of the gene ( Wei et al., 2010 ) These Yin Yang interactions of STAT transcription factors are referred to as specification with respect to lymphocyte phenotypes. Important questions, however, are not addressed with res pect to claims of specification and signaling specificity. For example, IL 6, IL 23,

PAGE 55

55 and IL 27 all activate STAT3 and are all involved in Th17 induction/differentiation and function ( Batten et al., 2006 ; Colgan and Rothman, 2006 ; Stumhofer et al., 2006 ) Additionally, it has been shown that IL 23 receptor is re quired for terminal differentiation of IL 17 producing effector T helper cells ( McGeachy et al., 2009 ) Thus, STAT3 does not seem to be the only factor required for activation and generation of Th 17 cells. Rather, the requirements of IL 6 and IL 23 for Th17 induction/differentiation and IL 27 for suppression all involve activated STAT3 mediated through multiple unique ligand/receptor interactions. Interesting an d contrary to the above report, it has been demonstrated that IL 2 participates in expansion of Th 17 cells in uveitis and scleritis ( Amadi Obi et al., 2007 ) We have previously shown that IFN are transported to the nucleus as a complex where IFN provides a classical polycationic NLS for such transport ( Ahmed and Johnson, 2006 ) The C terminus of IFN represented by the mouse IFN peptide, IFN (95 132), was capable of also provided the NLS signal for nuclear transport. Importantly, mo use IFN (95 132) and human IFN (95 134) mimetics both induced an antiviral state and upregulation of MHC class II molecules in cells similar to that of full length IFN Both IFN and its peptide mimetics bind to an intracellular site, IFNGR1 (253 287), on the cytoplasmic domain of receptor subunit IFNGR1. This binding plays a key role in movement of JAK2 from IFNGR2 to IFNGR1 as it enhances the binding affinity of JAK2 and IFNGR1 ( Szente et al., 1995 ) The activation of JAK2 and JAK1 as a result of this is important for the and

PAGE 56

56 IFN the GAS element of IFN activated genes and ( Ahmed and Johnson, 2006 ) It has been suggested that JAK tyrosine kinases play an important role in the epigen e tics of gene acti vation in addition to STAT activation in the cytoplasm ( Dawson et al., 2009 ; Griffiths et al., 2011 ; Nilsson et al., 2006 ) Leukemic cells with a JAK2V617F gain of function mutation have constitutively active JAK2V617F in the nucleus. This leads to tyrosine phosphorylation on Y41 on histone H3, which results in was associated with exposure of euchromatin for gene activation. Although present in the nucleus, wild type JAK2 was only activated when K562 cells were treated with PDGF or LIF, or when BaF3 cells were treated with IL 3. The question of how a ligand/receptor interaction resulted in the presence of pJAK2 in the nucleus was not addressed, nor its targeting mechanism to discrete genomic sites and promoters. We felt that our dis covery of the IFN IFNGR1 pSTAT1 complex and its movement to the nucleus provided a logical mechanism for transport of pJAK1 and pJAK2 not only to the nucleus, but also to histone H3 regions of genes activated by IFN Thus, ChIP followed by PCR in IFN treated cells showe d the association of pJAK1, pJAK2, IFNGR1, and STAT1 on t he same DNA sequence of the IRF 1 gene promoter. Similar to the pJAK2 findings above, pJAK1 has recently been shown to phosphorylate Y41 on histone H3 in in vitro experiments ( Griffiths et al., 2011 ) actin gene, which is not activated by IFN did not show the above associations. These findings were confirmed by biotinylated GAS promoter binding and confocal microscopy.

PAGE 57

57 Consistent with leukemic cell studies, the presence of activated JAKs in th e nucleus was associated with phosphorylated Y41 on histone H3 in the region of the GAS promoter. Cumulatively we present a model in which the IFN IFNGR1 pSTAT1 pJAK1 pJAK2 complex translocates to the nucleus and targets the histone H3 surrounding the GAS element (see Figure 4 1) Recent studies in Drosophila have shown that unphosphorylated STAT is ( Ya n et al., 2011 ) Further, activation/phosphorylation of STAT to pSTAT causes it to disassociate from heterochromatin and bind to cognitive sites in euchromatin. Moreover, these events correlate with unphosphorylated STAT association with stable heterochr omatin and gene silencing, while pSTAT was associated with heterochromatin destabilization and gene expression. It has been reported that unphosphorylated STATs 1 and 3 function as transcription factors by mechanisms distinct from those of phosphorylated S TATs ( Cheon et al., 2011 ) The unphosphorylated STATs have been proposed to be involved in prolonged transcriptional events of several days. The relationship of th ese unphosphorylated STAT transcriptional activities, unlike the results reported here and in Drosophila, were not studied in the context of epigenetic events. Similar to the Drosophila histone H3 in untreated WISH cells. Treatment of the cells with IFN resulted in the disassoci ation of unphosphorylated STAT1 from histone H3 and its return, possibly at a different site in the activated pSTAT1 form. These observations are consistent with regulated epigenetic events in the region of genes that are activated by IFN Thus, we propose that the complex of IFN IFNGR1 pSTAT1 pJAK1 pJAK2 contains the

PAGE 58

58 transcription/co transcript ion signals for specific gene activation as well as the activated JAK activity for the associated epigen e tics of histone H3 phosphorylation. We estimate that the aggregate molecular weight of the complex to be approximately 530 kDa, a feasible cargo size f or active transport through the nuclear pore complex ( Lyman et al., 2002 ) The results of our study provide insight into the mechanism of IFN signaling including the role of the JAK/STAT pathway in the specificity of such signaling. We were further interested to see if other ligands and JAKs beside JAK1, and JAK2 were involved in the nuclear translocation of activated JAKs. Towards this end we used the type I IFNs specifically IFN 2 and IFN and explored the sub cellular activation of TYK2. We found that TYK2 was constitutively present in the nuclear and cytoplasmic fractions. However, stimulation with either type I IFN induced activati on of TYK2 to pTYK2 in the nucleus and cytoplasm in agreement with previously published results ( Ragimbeau et al., 2001 ) Because TYK2 is known to associate wi th IFNAR1 before and after type I IFN stimulation ( Ragimbeau et al., 2003 ) we also examined its nucleo cytoplasmic distribution. We found that upon ligand activa tion, IFNAR1 translocated to the nucleus while its cytoplasmic presence decreased This is in agreement with our previous finding that IFNAR1 pos sess a functional NLS and undergo es nuclear translocation upon IFN treatment ( Subramaniam and Johnson, 2004 ) The association of IFNAR1 and TYK2 within the nuclear compartment was not addressed in this study though we speculate its existence together with activated STAT1 and STAT2. Alt ogether our findings suggest that type I IFN activation of TYK2 to pTYK2 within the nuclear compartment are analogous to type II IFN nuclear activation of JAK2 to pJAK2.

PAGE 59

59 Cumulatively, these results support the notion that ligands that a ctivate JAK/STAT signaling in general cause their respectively activated JAKs to localize in the nuclear compartment where they may play roles in specific epigenetic translational responses.

PAGE 60

60 Figure 4 1 Model for the mechanism of I signaling. I binds as a dimer to two IFNGRs. Activated JAK1, activated JAK2, activated (P) STAT1 and I then bind to the intracellular domain of IFNGR1. IFNGR1 is internalized with these cofactors as a single macromolecular complex, and is imported into the nucleus via the Ran/importin pathway using the NLS found on I Within the nucleus the receptor complex targets the GAS element using the DNA binding domain of the STATs. Finally, JAK1 and JAK2 phosphorylate adjacent histone H3 on residue 41 allowing for gene ac tivation.

PAGE 61

61 LIST OF REFERENCES Ahmed, C.M., and H.M. Johnson. 2006. IFN gamma and its receptor subunit IFNGR1 are recruited to the IFN gamma activated sequence element at the promoter site of IFN gamma activated genes: evidence of tran sactivational activity in IFNGR1. J Immunol 177:315 321. Amadi Obi, A., C.R. Yu, X. Liu, R.M. Mahdi, G.L. Clarke, R.B. Nussenblatt, I. Gery, Y.S. Lee, and C.E. Egwuagu. 2007. TH17 cells contribute to uveitis and scleritis and are expanded by IL 2 and inh ibited by IL 27/STAT1. Nat Med 13:711 718. Bader, T., and J. Weitzerbin. 1994. Nuclear accumulation of interferon gamma. Proc Natl Acad Sci U S A 91:11831 11835. Batten, M., J. Li, S. Yi, N.M. Kljavin, D.M. Danilenko, S. Lucas, J. Lee, F.J. de Sauvage, and N. Ghilardi. 2006. Interleukin 27 limits autoimmune encephalomyelitis by suppressing the development of interleukin 17 producing T cells. Nat Immunol 7:929 936. Behrmann, I., T. Smyczek, P.C. Heinrich, H. Schmitz Van de Leur, W. Komyod, B. Giese, G. Muller Newen, S. Haan, and C. Haan. 2004. Janus kinase (Jak) subcellular localization revisited: the exclusive membrane localization of endogenous Janus kinase 1 by cytokine receptor interaction uncovers the Jak.receptor complex to be equivalent to a rece ptor tyrosine kinase. J Biol Chem 279:35486 35493. Borden, E.C., G.C. Sen, G. Uze, R.H. Silverman, R.M. Ransohoff, G.R. Foster, and G.R. Stark. 2007. Interferons at age 50: past, current and future impact on biomedicine. Nat Rev Drug Discov 6:975 990. Briscoe, J., N.C. Rogers, B.A. Witthuhn, D. Watling, A.G. Harpur, A.F. Wilks, G.R. Stark, J.N. Ihle, and I.M. Kerr. 1996. Kinase negative mutants of JAK1 can sustain interferon gamma inducible gene expression but not an antiviral state. Embo J 15:799 809. Burchill, M.A., J. Yang, C. Vogtenhuber, B.R. Blazar, and M.A. Farrar. 2007. IL 2 receptor beta dependent STAT5 activation is required for the development of Foxp3+ regulatory T cells. J Immunol 178:280 290. Chen, H.C., and N.C. Reich. 2010. Live cell imaging reveals continuous STAT6 nuclear trafficking. J Immunol 185:64 70. Cheon, H., J. Yang, and G.R. Stark. 2011. The functions of signal transducers and activators of transcriptions 1 and 3 as cytokine inducible proteins. J Interferon Cytokine Res 3 1:33 40.

PAGE 62

62 Chia, D.J., B. Varco Merth, and P. Rotwein. 2010. Dispersed Chromosomal Stat5b binding elements mediate growth hormone activated insulin like growth factor I gene transcription. J Biol Chem 285:17636 17647. Cohen, A.C., K.C. Nadeau, W. Tu, V. Hw a, K. Dionis, L. Bezrodnik, A. Teper, M. Gaillard, J. Heinrich, A.M. Krensky, R.G. Rosenfeld, and D.B. Lewis. 2006. Cutting edge: Decreased accumulation and regulatory function of CD4+ CD25(high) T cells in human STAT5b deficiency. J Immunol 177:2770 2774 Colgan, J., and P. Rothman. 2006. All in the family: IL 27 suppression of T(H) 17 cells. Nat Immunol 7:899 901. Darnell, J.E., Jr. 1997. STATs and gene regulation. Science 277:1630 1635. Dawson, M.A., A.J. Bannister, B. Gottgens, S.D. Foster, T. Bar tke, A.R. Green, and T. Kouzarides. 2009. JAK2 phosphorylates histone H3Y41 and excludes HP1alpha from chromatin. Nature 461:819 822. DeMartino, J., M. Carroll, B. Mathey Prevot, and A.D. D'Andrea. 1994. Erythropoietin receptor contains both growth promo ting activity and differentiation promoting activity. Ann N Y Acad Sci 718:213 221; discussion 221 212. Ehret, G.B., P. Reichenbach, U. Schindler, C.M. Horvath, S. Fritz, M. Nabholz, and P. Bucher. 2001. DNA binding specificity of different STAT proteins Comparison of in vitro specificity with natural target sites. J Biol Chem 276:6675 6688. Funakoshi Tago, M., K. Tago, M. Abe, Y. Sonoda, and T. Kasahara. 2010. STAT5 activation is critical for the transformation mediated by myeloproliferative disorder associated JAK2 V617F mutant. J Biol Chem 285:5296 5307. Galon, J., C. Sudarshan, S. Ito, D. Finbloom, and J.J. O'Shea. 1999. IL 12 induces IFN regulating factor 1 (IRF 1) gene expression in human NK and T cells. J Immunol 162:7256 7262. Gauzzi, M.C., G. Barbieri, M.F. Richter, G. Uze, L. Ling, M. Fellous, and S. Pellegrini. 1997. The amino terminal region of Tyk2 sustains the level of interferon alpha receptor 1, a component of the interferon alpha/beta receptor. Proc Natl Acad Sci U S A 94:11839 1184 4. Giraud, S., F. Bienvenu, S. Avril, H. Gascan, D.M. Heery, and O. Coqueret. 2002. Functional interaction of STAT3 transcription factor with the coactivator NcoA/SRC1a. J Biol Chem 277:8004 8011. Goenka, S., J. Youn, L.M. Dzurek, U. Schindler, L.Y. Yu Lee, and M. Boothby. 1999. Paired Stat6 C terminal transcription activation domains required both for

PAGE 63

63 inhibition of an IFN responsive promoter and trans activation. J Immunol 163:4663 4672. Gough, D.J., D.E. Levy, R.W. Johnstone, and C.J. Clarke. 2008. I FNgamma signaling does it mean JAK STAT? Cytokine & growth factor reviews 19:383 394. Gouilleux, F., C. Pallard, I. Dusanter Fourt, H. Wakao, L.A. Haldosen, G. Norstedt, D. Levy, and B. Groner. 1995. Prolactin, growth hormone, erythropoietin and granuloc yte macrophage colony stimulating factor induce MGF Stat5 DNA binding activity. Embo J 14:2005 2013. Griffiths, D.S., J. Li, M.A. Dawson, M.W. Trotter, Y.H. Cheng, A.M. Smith, W. Mansfield, P. Liu, T. Kouzarides, J. Nichols, A.J. Bannister, A.R. Green, a nd B. Gottgens. 2011. LIF independent JAK signalling to chromatin in embryonic stem cells uncovered from an adult stem cell disease. Nature cell biology 13:13 21. Haan, C., S. Kreis, C. Margue, and I. Behrmann. 2006. Jaks and cytokine receptors -an intim ate relationship. Biochemical pharmacology 72:1538 1546. Hao, A., V. Novotny Diermayr, W. Bian, B. Lin, C.P. Lim, N. Jing, and X. Cao. 2005. The LIM/homeodomain protein Islet1 recruits Janus tyrosine kinases and signal transducer and activator of transcr iption 3 and stimulates their activities. Molecular biology of the cell 16:1569 1583. Harroch, S., M. Revel, and J. Chebath. 1994. Induction by interleukin 6 of interferon regulatory factor 1 (IRF 1) gene expression through the palindromic interferon res ponse element pIRE and cell type dependent control of IRF 1 binding to DNA. Embo J 13:1942 1949. Horvath, C.M. 2000. STAT proteins and transcriptional responses to extracellular signals. Trends in biochemical sciences 25:496 502. Hung, L.Y., J.T. Tseng Y.C. Lee, W. Xia, Y.N. Wang, M.L. Wu, Y.H. Chuang, C.H. Lai, and W.C. Chang. 2008. Nuclear epidermal growth factor receptor (EGFR) interacts with signal transducer and activator of transcription 5 (STAT5) in activating Aurora A gene expression. Nucleic a cids research 36:4337 4351. Igaz, P., S. Toth, and A. Falus. 2001. Biological and clinical significance of the JAK STAT pathway; lessons from knockout mice. Inflamm Res 50:435 441. Iyer, J., and N.C. Reich. 2008. Constitutive nuclear import of latent a nd activated STAT5a by its coiled coil domain. Faseb J 22:391 400. James, C., V. Ugo, J.P. Le Couedic, J. Staerk, F. Delhommeau, C. Lacout, L. Garcon, H. Raslova, R. Berger, A. Bennaceur Griscelli, J.L. Villeval, S.N. Constantinescu, N. Casadevall, and W Vainchenker. 2005. A unique clonal JAK2 mutation

PAGE 64

64 leading to constitutive signalling causes polycythaemia vera. Nature 434:1144 1148. Johnson, H.M., P.S. Subramaniam, S. Olsnes, and D.A. Jans. 2004. Trafficking and signaling pathways of nuclear localizi ng protein ligands and their receptors. BioEssays : news and reviews in molecular, cellular and developmental biology 26:993 1004. Kawashima, T., Y.C. Bao, Y. Nomura, Y. Moon, Y. Tonozuka, Y. Minoshima, T. Hatori, A. Tsuchiya, M. Kiyono, T. Nosaka, H. Na kajima, D.A. Williams, and T. Kitamura. 2006. Rac1 and a GTPase activating protein, MgcRacGAP, are required for nuclear translocation of STAT transcription factors. J Cell Biol 175:937 946. Khwaja, A. 2006. The role of Janus kinases in haemopoiesis and h aematological malignancy. Br J Haematol 134:366 384. Kima, P.E., J.A. Bonilla, E. Cho, B. Ndjamen, J. Canton, N. Leal, and M. Handfield. 2010. Identification of Leishmania proteins preferentially released in infected cells using change mediated antigen t echnology (CMAT). PLoS Negl Trop Dis 4. Lange, A., R.E. Mills, C.J. Lange, M. Stewart, S.E. Devine, and A.H. Corbett. 2007. Classical nuclear localization signals: definition, function, and interaction with importin alpha. J Biol Chem 282:5101 5105. La rkin, J., 3rd, H.M. Johnson, and P.S. Subramaniam. 2000. Differential nuclear localization of the IFNGR 1 and IFNGR 2 subunits of the IFN gamma receptor complex following activation by IFN gamma. J Interferon Cytokine Res 20:565 576. Lee, J.L., M.J. Wang and J.Y. Chen. 2009. Acetylation and activation of STAT3 mediated by nuclear translocation of CD44. J Cell Biol 185:949 957. Liu, F., X. Zhao, F. Perna, L. Wang, P. Koppikar, O. Abdel Wahab, M.W. Harr, R.L. Levine, H. Xu, A. Tefferi, A. Deblasio, M. Ha tlen, S. Menendez, and S.D. Nimer. 2011. JAK2V617F mediated phosphorylation of PRMT5 downregulates its methyltransferase activity and promotes myeloproliferation. Cancer cell 19:283 294. Liu, L., K.M. McBride, and N.C. Reich. 2005. STAT3 nuclear import i s independent of tyrosine phosphorylation and mediated by importin alpha3. Proc Natl Acad Sci U S A 102:8150 8155. Lo, H.W., S.C. Hsu, M. Ali Seyed, M. Gunduz, W. Xia, Y. Wei, G. Bartholomeusz, J.Y. Shih, and M.C. Hung. 2005. Nuclear interaction of EGFR and STAT3 in the activation of the iNOS/NO pathway. Cancer cell 7:575 589.

PAGE 65

65 Lobie, P.E., B. Ronsin, O. Silvennoinen, L.A. Haldosen, G. Norstedt, and G. Morel. 1996. Constitutive nuclear localization of Janus kinases 1 and 2. Endocrinology 137:4037 4045. Lu, X., R. Levine, W. Tong, G. Wernig, Y. Pikman, S. Zarnegar, D.G. Gilliland, and H. Lodish. 2005. Expression of a homodimeric type I cytokine receptor is required for JAK2V617F mediated transformation. Proc Natl Acad Sci U S A 102:18962 18967. Luo, G., and L. Yu Lee. 1997. Transcriptional inhibition by Stat5. Differential activities at growth related versus differentiation specific promoters. J Biol Chem 272:26841 26849. Lyman, S.K., T. Guan, J. Bednenko, H. Wodrich, and L. Gerace. 2002. Influence of cargo size on Ran and energy requirements for nuclear protein import. J Cell Biol 159:55 67. McBride, K.M., G. Banninger, C. McDonald, and N.C. Reich. 2002. Regulated nuclear import of the STAT1 transcription factor by direct binding of importin alpha. E mbo J 21:1754 1763. McGeachy, M.J., Y. Chen, C.M. Tato, A. Laurence, B. Joyce Shaikh, W.M. Blumenschein, T.K. McClanahan, J.J. O'Shea, and D.J. Cua. 2009. The interleukin 23 receptor is essential for the terminal differentiation of interleukin 17 produci ng effector T helper cells in vivo. Nat Immunol 10:314 324. Melen, K., L. Kinnunen, and I. Julkunen. 2001. Arginine/lysine rich structural element is involved in interferon induced nuclear import of STATs. J Biol Chem 276:16447 16455. Mertani, H.C., M. Raccurt, A. Abbate, J. Kindblom, J. Tornell, N. Billestrup, Y. Usson, G. Morel, and P.E. Lobie. 2003. Nuclear translocation and retention of growth hormone. Endocrinology 144:3182 3195. Meyer, T., and U. Vinkemeier. 2004. Nucleocytoplasmic shuttling of STAT transcription factors. Eur J Biochem 271:4606 4612. Nardozzi, J., N. Wenta, N. Yasuhara, U. Vinkemeier, and G. Cingolani. 2010. Molecular basis for the recognition of phosphorylated STAT1 by importin alpha5. J Mol Biol 402:83 100. Nilsson, J., G. Bjursell, and M. Kannius Janson. 2006. Nuclear Jak2 and transcription factor NF1 C2: a novel mechanism of prolactin signaling in mammary epithelial cells. Mol Cell Biol 26:5663 5674.

PAGE 66

66 Pallard, C., F. Gouilleux, M. Charon, B. Groner, S. Gisselbrecht, and I Dusanter Fourt. 1995. Interleukin 3, erythropoietin, and prolactin activate a STAT5 like factor in lymphoid cells. J Biol Chem 270:15942 15945. Parganas, E., D. Wang, D. Stravopodis, D.J. Topham, J.C. Marine, S. Teglund, E.F. Vanin, S. Bodner, O.R. Col amonici, J.M. van Deursen, G. Grosveld, and J.N. Ihle. 1998. Jak2 is essential for signaling through a variety of cytokine receptors. Cell 93:385 395. Pfitzner, E., R. Jahne, M. Wissler, E. Stoecklin, and B. Groner. 1998. p300/CREB binding protein enhanc es the prolactin mediated transcriptional induction through direct interaction with the transactivation domain of Stat5, but does not participate in the Stat5 mediated suppression of the glucocorticoid response. Molecular endocrinology 12:1582 1593. Potl a, R., T. Koeck, J. Wegrzyn, S. Cherukuri, K. Shimoda, D.P. Baker, J. Wolfman, S.M. Planchon, C. Esposito, B. Hoit, J. Dulak, A. Wolfman, D. Stuehr, and A.C. Larner. 2006. Tyk2 tyrosine kinase expression is required for the maintenance of mitochondrial res piration in primary pro B lymphocytes. Mol Cell Biol 26:8562 8571. Ragimbeau, J., E. Dondi, A. Alcover, P. Eid, G. Uze, and S. Pellegrini. 2003. The tyrosine kinase Tyk2 controls IFNAR1 cell surface expression. Embo J 22:537 547. Ragimbeau, J., E. Dond i, A. Vasserot, P. Romero, G. Uze, and S. Pellegrini. 2001. The receptor interaction region of Tyk2 contains a motif required for its nuclear localization. J Biol Chem 276:30812 30818. Ram, P.A., and D.J. Waxman. 1997. Interaction of growth hormone activ ated STATs with SH2 containing phosphotyrosine phosphatase SHP 1 and nuclear JAK2 tyrosine kinase. J Biol Chem 272:17694 17702. Rane, S.G., and E.P. Reddy. 2002. JAKs, STATs and Src kinases in hematopoiesis. Oncogene 21:3334 3358. Reuther, G.W. 2008. J AK2 activation in myeloproliferative neoplasms: a potential role for heterodimeric receptors. Cell cycle 7:714 719. Rodig, S.J., M.A. Meraz, J.M. White, P.A. Lampe, J.K. Riley, C.D. Arthur, K.L. King, K.C. Sheehan, L. Yin, D. Pennica, E.M. Johnson, Jr., and R.D. Schreiber. 1998. Disruption of the Jak1 gene demonstrates obligatory and nonredundant roles of the Jaks in cy tokine induced biologic responses. Cell 93:373 383. Schindler, C.W. 2002. Series introduction. JAK STAT signaling in human disease. J Clin Invest 109:1133 1137.

PAGE 67

67 Schroder, K., P.J. Hertzog, T. Ravasi, and D.A. Hume. 2004. Interferon gamma: an overview of signals, mechanisms and functions. J Leukoc Biol 75:163 189. Schwarz, L.A., A.M. Stevens, J.A. Hrachovy, and L.Y. Yu Lee. 1992. Interferon regulatory factor 1 is inducible by prolactin, interleukin 2 and concanavalin A in T cells. Mol Cell Endocrinol 8 6:103 110. Sekimoto, T., N. Imamoto, K. Nakajima, T. Hirano, and Y. Yoneda. 1997. Extracellular signal dependent nuclear import of Stat1 is mediated by nuclear pore targeting complex formation with NPI 1, but not Rch1. Embo J 16:7067 7077. Shide, K., H. K. Shimoda, T. Kumano, K. Karube, T. Kameda, K. Takenaka, S. Oku, H. Abe, K.S. Katayose, Y. Kubuki, K. Kusumoto, S. Hasuike, Y. Tahara, K. Nagata, T. Matsuda, K. Ohshima, M. Harada, and K. Shimoda. 2008. Development of ET, primary myelofibrosis and PV in m ice expressing JAK2 V617F. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K 22:87 95. Stumhofer, J.S., A. Laurence, E.H. Wilson, E. Huang, C.M. Tato, L.M. Johnson, A.V. Villarino, Q. Huang, A. Yoshimura, D. Sehy C.J. Saris, J.J. O'Shea, L. Hennighausen, M. Ernst, and C.A. Hunter. 2006. Interleukin 27 negatively regulates the development of interleukin 17 producing T helper cells during chronic inflammation of the central nervous system. Nat Immunol 7:937 945. Subramaniam, P.S ., Torres, B.A ., and Johnson, H.M 2001. So many ligands, so few transcription factors: a new paradigm for signaling through the STAT transcription factors. Cytokine 15 :175 87. Subramaniam, P.S., and H.M. Johnson. 2004. The IFNAR1 subunit of the type I IFN receptor complex contains a functional nuclear localization sequence. FEBS Lett 578:207 210. Szente, B.E., a nd H.M. Johnson. 1994. Binding of IFN gamma and its C terminal peptide to a cytoplasmic domain of its receptor that is essential for function. Biochemical and biophysical research communications 201:215 221. Szente, B.E., P.S. Subramaniam, and H.M. Johns on. 1995. Identification of IFN gamma receptor binding sites for JAK2 and enhancement of binding by IFN gamma and its C terminal peptide IFN gamma(95 133). J Immunol 155:5617 5622. Tang, X., J.S. Gao, Y.J. Guan, K.E. McLane, Z.L. Yuan, B. Ramratnam, and Y.E. Chin. 2007. Acetylation dependent signal transduction for type I interferon receptor. Cell 131:93 105.

PAGE 68

68 Udy, G.B., R.P. Towers, R.G. Snell, R.J. Wilkins, S.H. Park, P.A. Ram, D.J. Waxman, and H.W. Davey. 1997. Requirement of STAT5b for sexual dimorph ism of body growth rates and liver gene expression. Proc Natl Acad Sci U S A 94:7239 7244. Wei, L., G. Vahedi, H.W. Sun, W.T. Watford, H. Takatori, H.L. Ramos, H. Takahashi, J. Liang, G. Gutierrez Cruz, C. Zang, W. Peng, J.J. O'Shea, and Y. Kanno. 2010. Discrete roles of STAT4 and STAT6 transcription factors in tuning epigenetic modifications and transcription during T helper cell differentiation. Immunity 32:840 851. Williams, C.C., J.G. Allison, G.A. Vidal, M.E. Burow, B.S. Beckman, L. Marrero, and F. E. Jones. 2004. The ERBB4/HER4 receptor tyrosine kinase regulates gene expression by functioning as a STAT5A nuclear chaperone. J Cell Biol 167:469 478. Yan, S.J., S.J. Lim, S. Shi, P. Dutta, and W.X. Li. 2011. Unphosphorylated STAT and heterochromatin p rotect genome stability. Faseb J 25:232 241. Yang, X.P., K. Ghoreschi, S.M. Steward Tharp, J. Rodriguez Canales, J. Zhu, J.R. Grainger, K. Hirahara, H.W. Sun, L. Wei, G. Vahedi, Y. Kanno, J.J. O'Shea, and A. Laurence. 2011. Opposing regulation of the loc us encoding IL 17 through direct, reciprocal actions of STAT3 and STAT5. Nat Immunol 12:247 254.

PAGE 69

69 BIOGRAPHICAL SKETCH Ezra Neptune Noon Song was born in Chicago, Illinois on February 28, 1984, three hours before the 29 th He lived the first four yea rs of his life there before moving to Miami for the next fourteen years. After waiting tables for several years he earned his High School diploma and went to Vas sar Colleg e where he earned a Bachelors of S cience in c hemistry. Feeling a pull towards the bi ological sciences, he decided to go to gradate school under Dr. Howard Johnson. After several painful years he learned that suffering is part of the process that makes us stronger, smarter, and better people. Now that his Ph D is acquired he can venture forth into the p ostdoc toral wilderness to satisfy his scientific wanderlust.