Flavonoid Directed Regulation in Lactobacilli

MISSING IMAGE

Material Information

Title:
Flavonoid Directed Regulation in Lactobacilli
Physical Description:
1 online resource (140 p.)
Language:
english
Creator:
Pande,Santosh
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Microbiology and Cell Science
Committee Chair:
Lorca, Graciela Liliana
Committee Members:
Gonzalez, Claudio F.
Romeo, Tony
Shanmugam, Keelnatham T
Bloom, Linda B

Subjects

Subjects / Keywords:
brevis -- flavonoids -- kaempferol -- lab -- lactobacilli -- lbrevis -- lttrs -- lysr -- probiotics -- tf -- transcription
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre:
Microbiology and Cell Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
The ability of transcription factors to respond to flavonoids as signal molecules was investigated in Lactobacillus brevis. Through in vitro screening of a small library of flavonoids, LVIS1989 (KaeR), a LysR type transcriptional regulator (LTTR), was identified as responsive to kaempferol. The modulation of KaeR activity by flavonoids was characterized in vivo and in vitro. DNase I footprint analysis identified the binding of KaeR at two distinctive sites, one in the intergenic region between LVIS1988 and LVIS1989 (-39 to +2) and another within LVIS1988 (-314 to -353, from kaeR translation start point). Electrophoretic mobility shift assays (EMSAs) revealed that both binding sites are required for KaeR binding in vitro. Furthermore, KaeR-DNA interactions were stabilized by the addition of kaempferol (20 uM). In vivo qRT-PCR experiments performed in L. brevis confirmed that the divergently transcribed genes LVIS1986, LVIS1987, and LVIS1988 and kaeR are up-regulated in the presence of kaempferol, indicating the role of KaeR as a transcriptional activator. Transcriptional lacZ fusions using Bacillus subtilis as a surrogate host showed that expression of kaeR was induced by the presence of the flavonoid. These results indicate that KaeR belongs to a small and poorly understood family of LTTRs that are positively autoregulated by a ligand.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Santosh Pande.
Thesis:
Thesis (Ph.D.)--University of Florida, 2011.
Local:
Adviser: Lorca, Graciela Liliana.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043351:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 FLAVONOID DIRECTED REGULATION IN LACTOBACILLI By SANTOSH GURUNATHRAO PANDE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Santosh Gurunathrao Pande

PAGE 3

3 To my wife, parents and brothers for believing in me and providing unconditional love and support

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank Dr. Graciela L. Lorca, chair of my PhD supervisory committee, for her support, encouragement and advice throughout my research program. I will always remain indebted to her for providing me an opportunity to work with her and for guiding me in writing the article and this dissertatio n I would also like to thank Dr. Claudio Gonzalez for his constructive criticism and encouragement to develop strong critical thinking skills I would also like to acknowledge Dr. K. T. Shanmugam, Dr. Tony Romeo and Dr Linda Bloom for serving on my PhD s upervisory committee and for their valuable feedback on my research. I am thank ful for both Fernando Pagliai and Chris L. Gardner for providing help w henever I needed their assistance A ll the members of Drs Lorca and Gonzalez were also i nstrumental in this work, especially Anastasia Potts, Clara V u and Kin Lai for their invaluable assistance during my research. I also would like to acknowledge Mariam Besharat, Nayant ara Orekondy and Beverly Driver for their technical assistance. My speci al thanks to Dr. Boris Belitsky and Dr. Abraham Sonenshein for making the pLG103 plasmid available. I also thank University of Florida Alumni Foundation and the National Institute s of Health (NIH) for providing the financial support for my dissertation pro ject. Finally, the words are not enough to thank my wife, parents and brothers W ithout their assistance none of this would have been possible.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 TABLE OF CONTENTS ................................ ................................ ................................ .. 5 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 15 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 16 Flavonoids ................................ ................................ ................................ .............. 16 Dietary Flavonoids and Health ................................ ................................ ................ 16 Flavonoids Classification ................................ ................................ ........................ 17 Flavones ................................ ................................ ................................ ........... 17 Flavonols ................................ ................................ ................................ .......... 18 Flavanone ................................ ................................ ................................ ......... 18 Flavan 3 ols ................................ ................................ ................................ ...... 18 Anthocyanins ................................ ................................ ................................ .... 18 Isoflavones ................................ ................................ ................................ ....... 18 Microbial Modification of Flavonoids ................................ ................................ ....... 19 Modification of Flavonoids by Lactic Acid Bacteria (LAB) ................................ ....... 20 Modulation of Gene Expression ................................ ................................ .............. 21 Classification of Transcription Factors ................................ ................................ .... 25 Transcription Factors Responding to Flavonoids ................................ .................... 27 Members of TetR Family Responsive to Flavonoids ................................ ........ 27 Members of MarR Family Responsive to Flavonoids ................................ ....... 28 Me mbers of LuxR Family Responsive to Flavonoids ................................ ........ 28 Members of LysR Family Responsive to Flavonoids ................................ ........ 29 The LysR Family of Transcrip tion Regulators (LTTRs) ................................ ........... 30 Introduction ................................ ................................ ................................ ....... 30 Domain Arrangement of LTTRs ................................ ................................ ........ 30 LTTRs DNA Binding Sites ................................ ................................ ................ 31 Mode of Regulation ................................ ................................ ................................ 32 Mode of Gene Regulation by LTTRs ................................ ................................ 32 Negative Gene Regulation by LTTRs ................................ ............................... 34 LrhA regulation of the flhDC operon ................................ ........................... 34 HexA regulation of vi rulence genes in Erwinia carotovora ......................... 34

PAGE 6

6 Positive Gene Regulation by LTTRs ................................ ................................ 35 AtzR regulation of atzDEF ................................ ................................ .......... 35 SpvR regulation of spvABCD ................................ ................................ ..... 36 LTTR Autoregulation ................................ ................................ ............................... 36 Negative Autoregulation ................................ ................................ ................... 37 AtzR ................................ ................................ ................................ ........... 37 CysB ................................ ................................ ................................ .......... 37 Positive Autoregulation ................................ ................................ ..................... 38 SpvR ................................ ................................ ................................ .......... 39 LrhA ................................ ................................ ................................ ........... 39 Project Design and Rationale ................................ ................................ ................. 40 2 MATERIALS AND METHODS ................................ ................................ ................ 53 Materials ................................ ................................ ................................ ................. 53 Bacterial Strains and Plasmids ................................ ................................ ............... 54 Competent Cells Preparation ................................ ................................ .................. 54 DNA Manipulations ................................ ................................ ................................ 55 DNA Amplification ................................ ................................ ............................ 55 Cloning Techniques ................................ ................................ .......................... 56 Transformation ................................ ................................ ................................ 56 DNA Electrophoresis ................................ ................................ ........................ 57 Site Directed Mutagenesis ................................ ................................ ................ 57 Construction of lacZ Fusions ................................ ................................ ............ 58 RNA Extraction ................................ ................................ ................................ 59 cDNA Synthesis ................................ ................................ ............................... 59 Protein Techniques ................................ ................................ ................................ 60 Protein Overexpression in E. coli ................................ ................................ ..... 60 Protein Purification ................................ ................................ ........................... 60 Protein Quantification ................................ ................................ ....................... 61 Protein Sepa ration by SDS PAGE ................................ ................................ ... 61 Size Exclusion Chromatography ................................ ................................ ............. 62 Small Molecule Screening by Differential Scanning Fluorometry ............................ 62 Electrophoretic Mobility Shift Assays (EMSAs) ................................ ....................... 63 DNase I Footprinting ................................ ................................ ............................... 64 galactosidase Assays ................................ ................................ .......................... 65 The Tools Used for Bioinformatics Studies ................................ ............................. 65 3 LVIS1989 (KAER), A LYSR TYPE TRANSCRIPTIONAL ACTIVATOR, UP REGULATES LVIS1986 LVIS1987 LVIS1988 and LVIS1989 IN RESPONSE TO KAEMPFEROL ................................ ................................ ................................ 74 Introduction ................................ ................................ ................................ ............. 74 Results ................................ ................................ ................................ .................... 76 The LysR Member, KaeR (LVIS1989) Interacts With Flavonoids In Vitro ........ 76 Flavonoids are Involved in the Upregulation of LVIS1986 LVIS1987 LVIS19 88 and LVIS1989 mRNAs ................................ ................................ ... 77

PAGE 7

7 Identification of KaeR Binding Region ................................ .............................. 79 KaeR Interacts With Two Binding Sites Separated by 280 bp .......................... 79 The Two Protected Regions are Required for the Formation of Higher Order Complexes In Vitro ................................ ................................ ........................... 80 KaeR Activity is Modulated by Kae mpferol In Vitro ................................ .......... 81 In Vivo LVIS1988 Expression ........... 82 KaeR is Positively Autoregulated ................................ ................................ ..... 84 Discussion and Conclusion ................................ ................................ ..................... 84 4 IDENTIFICATION OF KAER AMINO ACIDS INVOLVED IN LIGAND INTERACTION ................................ ................................ ................................ ....... 99 Introduction ................................ ................................ ................................ ............. 99 Results ................................ ................................ ................................ .................. 101 KaeR Structure Modeling ................................ ................................ .............. 101 Identification of Residues that Modulate KaeR Activity ................................ .. 103 Effects of Mutations on the DNA Binding Properties of KaeR ....................... 104 Effect of Mutations on the Oligomeric State of KaeR ................................ ..... 104 Conclusions ................................ ................................ ................................ .......... 105 5 SUMMARY AND CONCLUSIONS ................................ ................................ ........ 123 Summary of Findings ................................ ................................ ............................ 123 Future Direction ................................ ................................ ................................ .... 125 APPENDIX OPTIMIZATION O F KAER BINDING CONDITIONS ................................ ................... 126 LIST OF REFERENCES ................................ ................................ ............................. 1 27 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 140

PAGE 8

8 LIST OF TABLES Ta ble page 1 1 Flavonoids classification ................................ ................................ ..................... 42 1 2 Major transcription factors families in prokaryotes ................................ ............. 44 2 1 Strains used in this study. ................................ ................................ ................... 66 2 2 Plasmids used in this study. ................................ ................................ ............... 67 2 3 Primer s used for electrophoretic mobility shift assays (EMSA s ) and DNase I footprint assays. ................................ ................................ ................................ 68 2 4 Primers used to clone the genes for protein expression. ................................ .... 69 2 5 Primers used to clone the genes for lacZ reporter assays and sequencing reactions. ................................ ................................ ................................ ............ 70 2 6 Primers used for quantitative real time PCR (qRT PCR). ................................ ... 71 2 7 Primers used for site directed mutagenesis. ................................ ....................... 72 2 8 List of bioinformatics tools used. ................................ ................................ ......... 73 3 1 Stabilizati on effect of ligand binding ................................ ................................ .. 89 4 1 Summary of the KaeR homology modeling results. ................................ .......... 107 4 2 Summary of KaeR mutation studies ................................ ................................ 108

PAGE 9

9 LIST OF FIGURES Figure page 1 1 One component and two component response regulators. ................................ 46 1 2 Mechanism of transcriptional repression ................................ ........................... 47 1 3 Mechanism of transcriptional activation. ................................ ............................. 48 1 4 Dua l role of transcription factors ................................ ................................ ........ 49 1 5 LTTR domains arrang ement ................................ ................................ ............... 51 1 6 Classical mode of gene regulation by LTTRs ................................ .................... 52 3 1 Fluorescence based ligand screening assay. ................................ ..................... 90 3 2 Genomic environment of the L. brevis genes encoding LysR type transcripti onal regulators. ................................ ................................ ................... 91 3 3 Identification of the genes regulated by LVIS1989 (KaeR). ................................ 92 3 4 Identification of the KaeR binding regi on ................................ ............................ 93 3 5 Identification of KaeR binding sites. ................................ ................................ .... 94 3 6 Effect of kaempferol on KaeR binding to the different binding sites.. .................. 96 3 7 Gel filtration analysis of KaeR oligomerization in presence of kaempferol. ........ 97 3 8 In vivo ................................ ....................... 98 4 1 CbnR and ArgP dimers. ................................ ................................ .................... 109 4 2 CbnR tetramer (PDB # 1IZ1). ................................ ................................ ........... 110 4 3 ArgP tetramer (PDB # 3ISP) ................................ ................................ ............. 111 4 4 KaeR domains arrangement. ................................ ................................ ............ 112 4 5 The effector binding domain of CynR (PDB # 3HFU) alignment to the structural model of KaeR. ................................ ................................ ................. 113 4 6 Analysis of the azide ligand binding pocket in CynR. ................................ ....... 114 4 7 Residues involv ed in ethanediol binding in CynR ................................ ............ 115 4 8 Summary of the putative KaeR residues involved in the ligand binding.. ......... 116

PAGE 10

10 4 9 Electro phoretic mobility shift assays (EMSAs) to assess kaempferol effect on KaeR mutants. ................................ ................................ ................................ .. 117 4 10 Size exclusion chromotography to assess kaempferol effect on KaeR mutants ................................ ................................ ................................ ............ 120 4 11 CynR dimerization domain within the CynR tetramer. ................................ ...... 122 A 1 Optimization of the KaeR binding conditions. ................................ ................... 126

PAGE 11

11 L IST OF ABBREVIATIONS ABS Activator binding site Amp Ampere Ap r Ampicillin resistance BGSC Bacillus genetic stock center B. subtilis Bacillus subtilis C Degree celcius C4 HSL C4 homoserine lactone CAP Catabolite activator protein CBS CysB binding site cDNA Complementary DNA Chrom Chromobacterium Cm r Chloramphenicol resistance Comb Combretum CPRG Chlorophenol Red D galactopyranoside CRP /Crp Cyclic AMP receptor protein CTD Carboxy terminal domain C terminal Carboxy terminal DBD DNA binding domain DMSO Dimethyl sulphoxide dNTP Deoxyribonucleotide triphosphate DNA Deoxyribonucleic acid DTT Dithiothreitol EBD Effecto r binding domain E. coli Escherichia coli

PAGE 12

12 EDTA Ethylenediamine tetra acetic acid EGTA Ethylene glycol tetra acetic acid EMSA Electrophoretic mobility shift assay Erw. Erwinia Eub Eubacterium FPLC Fast protein liquid chromatography GIT Gastro intestinal tra ct GRAS Generally regared as safe HTH Helix turn helix IPTG D 1 thiogalactopyranoside ITC Isothermal titration calorimetry L. Lactobacillus L Lit er LAB Lactic acid bacteria LB Luria Bertani Medium L. brevis Lactobacillus brevis LTTR LysR type transcriptional regulator M Molar M Micromolar min Minutes ml Milliliters mM Milimolar MW Molecular weight N terminal Amino terminal NA Not Applicable

PAGE 13

13 ND Not determined ng Nanogram nm Nanometer nM nanoMolar NO Nitric oxide OD600 Optical density at 600 nm OFS Organically farmed soybeans ORF Open reading frame P. ae ruginosa Pseudomonas aeruginosa PAGE Polyacrylamide Gel Electrophoresis PCR Polymerase chain reaction PDB Protein data bank Pg Picogram Poly (dI dC) Poly(deoxyinosinic deoxycytidylic) P. putida Pseudomonas putida qRT PCR Quantitaive r eal time polymerase ch ain reaction R. Rhizobium RBS Repressor binding site RCSB Resource for studying b iological macromolecules RD Regulatory domain RNA Ribonucleic acid RNAP RNA polymerase RPM Revolutions per minute SD Shine Dalgarno sequence SDS Sodium ( Dodecyl ) S ulfate

PAGE 14

14 sec Second TCEP Tris (2 carboxyethyl) phosphine TF Transcription factor U Units UV Ultra V io let V Volt wHTH Winged helix turn helix

PAGE 15

15 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment o f the Requirements for the Degree of Doctor of Philosophy FLAVONOID DIRECTED REGULATION IN LACTOBACILLI By S antosh G urunathrao Pande August 2011 Chair: Graciela L. Lorca Major: Microbiology and Cell Science The ability of transcription factors to respo nd to flavonoids as signal molecules was investigated in Lactobacillus brevis Through in vitro screening of a small library of flavonoids, LVIS1989 (KaeR), a LysR type transcriptional regulator (LTTR), was identified as responsive to kaempferol. The modul ation of KaeR activity by flavonoids was characterized in vivo and in vitro DNase I footprint analysis identified the binding of KaeR at two distinctive sites, one in the intergenic region between LVIS1988 and LVIS1989 ( 39 to +2) and another within LVIS1 988 ( 314 to 353, from kaeR translation start point). E lectrophoretic mobility shift assays (EMSAs) revealed that both binding sites are required for KaeR binding in vitro Furthermore, KaeR DNA interactions were stabilized by the addition of kaempferol ( In vivo qRT PCR experiments performed in L. brevis confirmed that the divergently transcribed genes LVIS1986, LVIS1987, and LVIS1988 and kaeR are up regulated in the presence of kaempferol, indicating the role of KaeR as a transcriptional activator Transcriptional lacZ fusions using Bacillus subtilis as a surrogate host showed that expression of kaeR was induced by the presence of the flavonoid. These results indicate that KaeR belongs to a small and poorly understood family of LTTRs that are posit ively autoregulated by a ligand.

PAGE 16

16 CHAPTER 1 INTRODUCTION Flavonoids Flavonoids are plant derived polyphenolic compounds which act as a first line of defence against environmental stress conditions In plants flavo noids are responsible for fruit and flower coloration. F lavonoids role in plant protection against environmental stres s conditi ons has been extensively studied In general plant flavonoids are i nduced under excess light, cold, and drought conditions ( Tatinni et. al 2004 ; Li et a l. ,1993 ) F lavonoids quench the reactive oxygen species generated as a result of the se stress conditions. Flavonoids also offer a competitive advantage to the plants. The a llelopathic role of flavonoids has been shown in Centaurea maculosa Bais et al (2 003) reported that Centaurea maculosa weed roots secr ete ( ) c atechin which inhibits the growth of the native plants F lavonoids also possess antimicrobial properties against pathogenic fungi and bacteria which affect the plant health through foliage loss and reduced growth rate (Close and McArthur, 2002) The flavonoids are also responsible for the signaling of symbiotic relationship between leguminous plant s and Rhizobia. Leguminous plants exud e flavonoids which are sensed by Rhizobia activating the transcription of the genes involved in nodulation (Brencic and Winans, 2005) Dietary Flavonoids and H ealth Flavonoids possess antioxidant and radical scavenging properties (Rice Evans et al. 1997) Flavonoid s are suggested to mediate anti depressant or anti p activity and possess anti inflammatory properties (Jger and Saaby, 2011) The r ole of the g reen tea epicatechin and its derivaties in cancer prevention has been suggested using mouse model studies (Mantena et al. 2005;

PAGE 17

17 Wang et al. 1992; Baliga and Katiyar, 2006) In s tudies b y Fraga et.al (2011 ) it was suggested that flavonol s lower blood pressure by maintaing optimal NO levels and decreasing the concentration of superoxide anions in blood vessels A 24 year study carried out in Finland using 9 959 human subjects ranging in age from 1 5 t o 99 suggested that flavonoids could have the potential to reduce lung cancer incidence (Knekt et al. 1997) Another study car ried out over five years with 805 human subjects aged 64 to 8 4 s howe d that the consumption of flavo noids, in particular quercetin, k aempferol, myriceti n a pigenin, and luteolin was inversely proportional to mortality from coronary heart disease ( Hertog et al .,1993) Flavonoids are also suggested to protect the tissues from lipid per oxidation which is thought to be involved in atherosclerosis, chronic inflammation and cancer ( Le Marchand, 2002; Middleton et al. 2000; Hollman and Katan, 1999) However, the studies carried out to prove anticarcinogenic and cardioprotective effects of flavonoids are not conclusive. Flavonoids C lassification The basic structure of flavonoids consists of two benzene rings (A and B) connected through central pyrone ring (C) Flav onoids are classified into the following classes based upon the structural differences (Table 1 1) Flavon es The f lavones structure is planar. It consists of a double bond between positions 2 and 3 of the C ring. The C ring is connected to the B ring at po sition 2. The B ring has a s apple skin s and celeries (Griffiths and Smith, 1972b; Aura 2005 ) The examples of flavones are l uteolin and apigenin.

PAGE 18

18 Fla vonols The f lavonols have a planar ring structure. The B ring is connected to the pyrone ring at position 2. The C ring fission occurs at positions between bonds 1 and 2, 3 and 4 as well as between 4 and 10. E xamples of flavonols are quercetin, kaempferol and myricetin. These are found in oni ons, apples, red wine, broccoli and tea. Flavanone The Flavanone structure is not planar and lacks a double bond between positions 2 and 3 of the central pyrone ring. Flavanones are degraded through C ring fission at p ositions between 1 and 2 as well as 4 and 10. Citrus fruits grape fruits are abundant in flavanone Examples of flavanone are h esperitin and n aringenin Flavan 3 ols The flavan 3 ols ring structure is not planar. The C ring of flavan 3 ols does not harbor a carbonyl group. Flavan 3 ols are found in fruits, tea, and wine. Some of th e examples of flavan 3 ols are c atechin, epicatechin and epigallocatechin. Anthocyanins The a nthocyanin structure is planar. The central C ring lacks the carbonyl group found in flavones. There are double bonds between positions 1 and 2 as well as 3 and 4 of the C ring. These are present in fruits and flowers and are responsible for fru it and flower coloration. Cherries grape s plu m s, raspberries, strawberries peach es and apple s are ab un dant in anthocyanins. Isoflavones The i soflavone structure is planar. It differs from the rest of the flavonoids since A ring is connected to the central C ring at position 3. Soybean s are rich in flavonoids. Examples of isoflavones are daidzein a nd genistein.

PAGE 19

19 Microbial Modification of F lavonoids C omplex flavonoids cannot be absorbed directly in the gastrointestinal tracts of humans Instead, they are further broken down by the gut microbiota into smaller compounds with high er biological activity ( Selma et al ., 2009). Flavonoids are usually conjugated to sugars and organic acids in their natural state. Hence most studies on flavonoid degradation are carried out with flavonoid glycosides. These studies suggested that the firs t step of degradation in volves deconjugation i.e. cleavage of s ugar moiety from the flavonoid producing aglycones (Aura, 2005) Flavonoiddegradation takes place through the central C ring fission. The degradation product s formed depend upon the position of the C ring cleavage an d number of hydroxyl groups p resent (Selma et al. 2 009) Some microorganisms isolated from human fecal sampl e are able to degrade flavonoid For example, W inter et al (1989) showed that Clostridium strains could cleave quercetin, kaempferol, n aringenin to 3,4 dihydroxyphenyl acetic acid, 4 hydr oxyphenyl acetic acid and p henylacetic acid respectively. Eub acterium ramulus could cleave genistein to 6 hydroxy O desmethylangolensin and 2 (4 hydroxyphenyl) propionic acid ( Schoefer et al., 2002) Similarly, Braune et al (2001) sugg ested that this bacterium degrade s l uteolin to 3 4 dihydroxyphenyl propionic acid ( from the B and C ring s) and phloroglucinol ( from A ring ) Griffiths and Smith, ( 1972 a ) showed that the rat intestinal microbiota could cleave apigenin to p hydroxyphenylpropionic acid, p hydroxycinnamic acid and p hydroxybenzoic acid whereas m yricetin was degraded to 3 hydroxyphenyl acetic acid, 3,5 dihydroxyphenyl acetic acid and 3, 4, 5 trihydroxyphenyl acetic acid (Griffiths and Smith, 1972b) Naring inin a n aringenin glycoside, is reported to be de graded to phloroglucinol and 3 phenyl propionic acid by colonic micro flora

PAGE 20

20 (Rechner et al ., 2004) Catechin and epicatechin were cleaved to 3 hydroxyphenyl propion dihydroxyphenyl valerolactone, 3 hydroxyphenyl valerolactone, 3 hydroxyhippuric acid by human fecal microflora (Tzounis et al. 2008) Anthocyanin is degraded to 3, 4 dihydroxybenzoic acid (Vitaglione et al. 2007) T aken together, these studies s howed that the gut microbiota is involved in flavonoids degradation and suggest that degradation happens through the C ring fission. However, the de tailed mechanism is unknown Modification of F lavonoids by Lactic Acid Bacteria ( LAB ) L actic Acid Bacteria (LAB) is a group of ba cteria that ferment hexoses primarily to lactic acid. These Gram positive bacteria are non pathogenic, microaerophilic or anaer obic and do no t sporulat e LAB group includes the genera Lactobacillus (Lb.) Entero coccus (E.) Lactococcus (Lc.), Aero coccus (A ) Pediococcus (P.), Leuconostoc (Ln.), Vagococcus (V.), Carnobacterium (C.), Tetragenococcus (T.), Weissela (W.) and Oenococ cus (O.) LAB are usually found in diverse niches such as the gastrointestinal, vaginal and urogenital tracts, fermented fruits and vegetables, meat and dairy products LAB are considered GRAS ( generally regarded as safe ) microorgani s ms and many species a re used as probiotics Most of the LAB are used as the starters for the dairy, meat and food fermentations ( Leal Sanchez et.al 2003) Many ge nera are involved in the fermentation of olives, cabbage, cucu mbers, eggplants, caper berries and grape must. L. brevis and L. p lantarum are some of the Lactobacillus species isolated from these environments. Interestingly the flavonoid content in the berries help in inhibiting the growth of the G ram negative and pathogenic bacteria without affecting the growth of l actobacilli ( Puupponen Pimi et al. 2001) There is scarce information on the LAB interaction with

PAGE 21

21 the flavonoids Most of the studies performed are limited to the deconjugation step. The formation of biologically active aglycone is due the high gluco sidic activity of many LAB species (Di Cagno et al ., 2010 ; Chun et al. 2007; Pham and Shah, 2009; Lpez de Felipe et al. 2010 ). No studies are reported on the degradation of the aglycone form of the flavonoids. Modulation of Gene E xpression Bacteria are exposed to the changing environmental conditions such as nutrient and oxygen limitation s temperature change s and various other stress conditions. In order to quickly adapt to the new environment the genes involved in maintaining cell homeostasis competi tion or survival should be expressed in temporal fashion. In prokaryotes protein levels can be controlled at the level of mRNA synthesis (transcriptional initiation, elongation or termination), synthesis of protein (translation) or post tran s lationally b y protein modifications (such as phosphorylation). In bacteria, most genes are regulated at the level of transcription initiation by the use of alternative sigma factors one component and two component systems. For example, S upregulates around 50 0 genes involved in survival during starvation conditions and stationary phase in E scherichia coli ( Weber et al ., 2005 ). Two component systems are named after the two proteins involved in the pathway: a sensor kinase located in sert ed in the membrane and a response regulator in the cytoplasm. When an environmental signal (i.e., changes in pH, osmolarity) is recognized by the membrane bound sensor kinase the protein is autophosphorylated As a result, the sensor kinase transfers the phospho ryl group to the response regulatory protein, which then binds the DNA and in most cases activates transcription (Figure 1 1)

PAGE 22

22 One component response regulatory systems are traditionally known as regulatory s ystem s are the most abundant in prokaryotes (Ulrich et al. 2005) In a one component regulatory system, the effector binding domain (EBD) and DNA binding domain (DBD) are present in the same protein Once a signal molecule is present in the cellular environment, it interacts with the effector binding doma in of the protein This interaction is thought to cause a structural rearrangement that lead s to transcriptional activation or repression, depending on the particular gene and the en vironmental stimulus (Figure 1 1 ). The number of t ranscription factor s var ies in different micro organisms It was found that the percentage of transcription factors was correlated with the changing environmental conditions to which the microorganism is exposed to r ather than the genome size (Ulrich et al. 2005) T ranscription factors are divided into more than 50 families based upon the ir similarity in the DBD (Minezaki et al. 2006) Transcription factors interact at the specific binding sites within the promoter region. Transcription factors can be found in different oligomeric forms such as dimer s tetramer s or heterodimers These proteins recognize on average 16 30 nt long palindromic or pseudopalindromic sequences on DNA (Schell, 1993; Rodionov, 2007) B inding of the t ranscription factor ( TF ) to the DNA may result in repression or activation of the gene expressi on. Repressors may interact at the RNA polymerase ( RNAP ) binding site inhibiting the RNAP access to the promoter region by steric hindrance ( Figure 1 2 ) For example, the binding of L acI overlaps the lac ZYA promoter inhibiting the RNAP access to the promot er (Mller Hill, 1996)

PAGE 23

23 The r epressor binding site also can be found further downstream of the promoter region that hinders the RNAP movement and blocks the tran scription elongation (Figure 1 2 B) For example PurR in E. coli interacts at a site 242 bp downstream from transcription s tart site of purB (He and Zalkin, 1992) R epression can also be a chieved by l ooping mechanism which inhibits RNAP access to the promoter In the E. coli gal operon, two operator sites are found. T he two sites are located around 60 and +53 positions relative to the galE transcription start site (Mller Hill, 1998) R epression is achieved by a loop ing mechanism due to the GalR repressor binding at the two operator sites Another mechanism of repression by steric hindrance can be exemplified by CytR. The transcription factor CytR modulates the interaction capability of the catabolite activator protei n ( CAP ) (also known as cyclic AMP recep tor protein CRP ) with the RNAP. CytR interacts at a site located between the two CAP binding sites which prevent subunit of the RNAP. Thus transcription initiation is prevented (Figure 1 2 C) (Shin et al. 2001) In absence of active repressor (in the presence of c ytidine), CAP interaction with RNAP stabilizes RNAP binding to the promoter thus enhancing the transcription from the promoter (Figure 1 2 F). Small molecules modulate the affinity of the TF to the bindin g sequence. decrease the affinity (Figure 1 2) For example, allolactose acts as an inducer lowers LacI binding to the operator Tryptophan acts as a corepressor by interacting with the inactive TrpR protein The ligand interaction changes TrpR conformation which increases TrpR affinity to the P trp

PAGE 24

24 Transcriptional a ctivators usually interact upstream or adjacent to 35 elements depending upon the type of promoter. For example, C RP binds at position 41 i n class II promoters (Zheng et al. 2004) (Figure 1 3A) I n class I promoters CRP binds upstream of the 35 element at positions 62, 72 and 92 (Figure 1 3B) T he mechanism of activation depends on the type of pro moter as well In class I promoter s activation is achieved by the interaction of the carboxy CTD). This allows the RNAP to strongly interac t with the promoter (Figure 1 3B ). In class II promoters gene activation is achieved by the interaction between the activator and NTD as well as subunit of the RNAP (Figure 1 3A ) (Browning and Busby, 2004) Some transcription factors can behave as both repressor s and activator s under different conditions (Figure 1 4). For example, AtzR under standard growth conditions (explaine d below in detail) represses tr anscrip tion from the promoter by inhibit ing RNAP access In the presence of cyanuric acid and under nitrogen limi ti ng conditions the AtzR interaction site is shifted further upstream to the 35 site. Th e shift in the binding site allows the RNAP access to the promoter and the genes atzDEF are tran scribed (Porra et al. 2010) Similarly the OxyR transcription factor in reduced state binds at 35 s ite (extended form ) (Figure 1 4A ). Under oxidizing conditions an allosteric change in the TF causes shift in the OxyR binding site (compact form) which allows RNAP interactio n at the promoter ( Toledano et al. 1994 ) (Figure 1 4B). Some repressors interact at several sites in the promoter and stimulate DNA looping The DNA looping prevents RNAP access to promoter and thus inhibit s transcription (Figure 1 4C ). In the araBAD ope ron, AraC interacts at two sites and

PAGE 25

25 bend s the DNA. This looping inhibits RNAP acc ess to the promoter (Figure 1 4C ). In the presence of the inducer arabinose, the repressor changes conformation and allow s activation of transcription from the promoter (Figu re 1 4D ) The araBAD operon is also under catabolite repression control (Schleif, 2003) Another mechanism of transcription activation is found in the MerR family of transcription regulators which act by inducing change s in the DNA conformation (Figure 1 4). I nteraction of MerR with the promoter leads to a conformational change in the DNA. In the abs ence of Hg ( II ), the RNAP can weakly bind the promoter and the open complex forma tion is inhibited (Figure 1 4E) In presence of Hg ( II), a stable complex is formed between RNAP: DNA: MerR and Hg (II). Within the complex the active MerR:Hg(II) reorients the promoter region to initiate transcription by allowing the formation of the open complex (Figure 1 4F) (Brown et al. 2003; Heldwein and Brennan, 2001) Some transcriptional activators do not require binding of the protein to the DNA. Under specific conditions the T F interacts directly with the RNAP to initiate transcription without binding to the DNA. For example, t he bacteriophage N4 single stranded DNA binding protein (N4SSB) upregulates transcription from the N4 late promoters in E coli The gene expression is a chieved by a direct interaction of the N4SSB protein with the carboxy terminus of the RNAP subunit (Figure 1 3 C) (Miller et al ., 1997) Classification of Transcription Factors Bacterial transcription factors are classified based upon sequence identity and the presence of st ructural motifs involved in DNA recognition. In prokaryotes, the most common folds are the helix turn helix (HTH) and the winged helix turn helix (wHTH). The location of the DNA binding region s varies and they can be found in the N terminus

PAGE 26

26 (i.e., Fur and LacI families), C terminus (i.e., LuxR and OmpR families) or in the center (i.e., ArsR and MarR families) of the protein. The HTH DNA binding domain is the most common motif found in bacterial transcription factors. It consists of two helices helix 2 an d 3 connected through a short turn. Glycine is the most conserved residue in the turn that connect s the two helices. h elix 1 is necessary for stabiliz ing HTH structure. The h elix 2 and h elix 3 are positioned 120 from each other. The h elix 3 interacts with the DNA at the major groove ; hence it is called a recognition helix. The TetR, LacI and Fis families are some examples that contain this fold. The winged helix turn helix motif is a variation of the HTH motif. It consists of a n ( and ), three beta strands ( and ), and two wings/turns ( W1 and W2 ) W1 W2. The s up the helix turn helix motif where the i nteraction at the major groove (recognition helix). The structure of the wHTH domain structure resembles that of a butterfly with W1 and W2 representing the as the thorax H ence the motif is named winged helix turn helix. This fold can be fou nd in the MarR, OmpR and IclR families. Rodionov (2007) identified the number of transcription factors from 230 sequenced genomes of prokaryotic organisms. The predictions were based upon profile Hidden Markov Models (HMMs) (Kummerfeld and Teichmann, 2006) using the PFAM (Finn et al. ,2006) and SUPERFAMILY (Wilson et al. 2007) databases. The major transcription factor families from this study are summarized in Table 1 2. The study suggested that the LysR type transcription regulators are most abundant in prokaryotes followed by the

PAGE 27

27 AraC and TetR families However, the number of transcripti onal regulators in different microorganism s do not necessarily follow a similar trend For example, MarR and IclR are the largest families in B. subtilis (Moreno Campuzano et al. 2006) and Bordetella species (Molina Henares et al. 2006) respectively. However, in L. brevis the largest family is MarR (Lorca, unpublished). Transcription Factors Resp onding to F lavonoids There are very few transcription factor families known to respond to flavonoids. Most of the transcription factors that have been identified are believed to regulate genes required to survive the antimicrobial properties of flavonoids. These TFs have been discovered in several different families including TetR (LmrA, YxaF, and TtgR), MarR (YetL), LuxR (RhlR), and LysR (NodD). However, NodD is the only characterized protein that senses flavonoids in a specific mode. NodD mediates the upr egulation of Rhizobium genes involved in nodulation. The m ode of regulation of the tra nscri ption factors responsive to flavonoids are described below Members of TetR Family Responsive to Flavonoids TtgR from the non pathogenic water and soil bacterium P se udomonas putida negatively regulates ttgABC transcription. The ttgR gene is negatively auto regulated (Teran et al. 2003) The TetR family members contain a N terminal DNA binding domain and a C terminal effector binding domain. The genes in the ttgABC operon encode for a multidrug efflux pump TtgABC which i s involved in detoxification of structurally unrelated antimicrobial compounds like antibiotics, dyes biocides thus conferring multidrug resistance to P. putida (Teran et al ., 2003) Using gene reporter assays it was observed that the expression of the ttgABC operon was also activa ted in

PAGE 28

28 presence of the flavonoids. Dir ect binding experiments with Ttg R using isothermal t itrat ion c alorimetry (ITC) confirmed the results (Teran et al. 2006) It was suggested that the response of TtgR from P. put ida to the flavonoids is non specific and is functioning as a resistance mechanism to the antimicrobial properties of the flavonoids. The yxaF gene found in B. subtilis is oriented in the same direction as that of its target genes yxaGH (Hirooka et al. 2007) Microarray analysis and genome wide computational an alysis w ere used to find the YxaF regulated genes The gene yxaG encodes for a quercetin 2,3 dioxygenase (Bowater et al. 2004) and yxaH encodes for a n un characterized membrane protein. Using yxaGH promoter : lacZ fusion reporter assays it was suggested that quercetin acts as an inducer. Electrophoretic mobility shift assay s (E MSA ) using different flavonoids showed that fisetin, tamarixatin and galangin also inhibited the interaction of YxaF with the yxaGH promoter (Hirooka et al ., 2007) Members of MarR Family Responsive to Flavonoids The MarR member yetL is divergently transcribed to yetM which encodes a putative FAD dependent m onooxygenase (Hirooka et al. 2009) DNA microarray analysis showed that transcription of yetM is enhanced in yetL mutant s EMSA studies suggested tha t YetL interact s with yetL and yetM promoters but the addition of flavonoids prevent s this interaction. These results were further supported by yetL and yetM : lacZ reporter assays. It was proposed that the regulation of yetM by YetL in response to flavono ids is a survival strategy used by B. subtilis in flavonoid rich environment s (Hirooka et al ., 2009) Members of LuxR Family Responsive to Flavonoids Vandeputte et al (2010) dem onstrated that bark extract from Combretum albiflorum could inhibit a signal transduction pathway that is mediated by quorum

PAGE 29

29 sensing factors HPLC analysis suggested that catechin was one of the active compounds in this bark extract. Using Pseudomonas aeru ginosa and E. coli as biosensor strains it was shown that catechin inhibited sensing of C4 HSL through the RhlR transcriptional regulator (Vandeputte et al. 2010) In agreement with these observations, it has been demonstrated that the plant genes involved in flavonoid biosynthetic pathway s were up regulated in response to homoserine lactones suggesting an antimicrobial role for flavonoids (Mathesius et al. 2003) Members of LysR Family Respo nsive to Flavonoids NodD from Rhizhobium leguminosarum responds to flavonoids by inducing the expression of multiple genes involved in promoting nodulation in leguminous plants. There is a symbiotic association between Rhizhobium and plants. The plants get benefited due to the bacterial fixation of atmospheric nitrogen to ammonia (N 2 to NH 3 ) and the bacteria receive a carbon source from the plant. Multiple copies of the nodD gene are present in different strains of Rhizobia One or two copies are present i n R. leguminosarum bv. viciae and Rhizobium sp strain NGR234 respectively (Downie et al. 1985) T hree copies are present in R. leguminosarum bv. Phasoeli (Davis and Johnston, 1990) While most of the NodD proteins respond to flavonoids in R. mel il oti it was found that NodD3 does not require an effector molecule to activate gene expression (Swanson et al. 1993) Based on EMSA and DNase I footprint assays it was suggested that the interaction of NodD3 with DNA binding sites (nod boxes) leads to DNA bending and this activat es transcription from the promoter (Fisher and Long, 1993) However the effect of the flavonoid s was not evident in this case possibly because the overexpression of NodD3 was sufficient for the up regulation of nodABC genes

PAGE 30

30 (Mulligan and Long, 1989) The ability of NodD to react to different flavonoids is related to the plant host range of the bacteria (Broughton and Perret, 1999) It was also found that nod genes are also under negative regulation I n R. meliloti NolR, a NodD homologue, negatively regulates the genes involved in nodulation. In addition, NodD interacts with a 47 bp sequence ( containing the palindromic sequence ATC N9 GAT) in R. leguminasarum (Wang and Stacey 1991; Fisher and Long, 1993) Variation from this motif in different strains also has been reported. Understanding of NodD interaction with flavonoids is mostly based upon genetic analysis and mutational studies Thus, there are no direct binding experi ments support ing that flavonoids bind to NodD (van Rhijn and Vanderleyden, 1995) The LysR Family of Transcription R egulators (LTTRs) Introduction LTT Rs are one component transcription factors with a DNA binding domain and effector binding domain in the same regulatory protein. LTT Rs are the most abundant transcription factors in prokaryotes (Pareja et al. 2006; Rodinov, 2007) They are involved in regulating genes required for diverse activities. Some ex amples of genes regulated by LTT Rs include virulenc e, sporulation, antibiotic resistance, and DNA replication genes (Maddocks and Oyston, 1993) Domain A rrangement of LTTRs The domain arrangement is shown in Figure 1 5. The 90 amino acids in the N terminal in LTTRs form the DNA binding dom ain. Within this domain, residues 23 to 43 form the wHTH (Schell, 1993; Maddocks and Oyston, 2008) The wHTH motif is connected to linker helix through hinge 1. H inge 1 allows flexibility to wHTH during interaction with DNA. Most LTTRs are 300 amino acids long with r esidues 90 to 300

PAGE 31

31 being involved in the formation of the regulatory domain. The wHTH is connected to the regulatory domain by a linker helix through hinge 2. The r egulatory domain is divided into two sub domains : regulatory domain I (RDI) and regulatory domain II (RDII) (Muraoka et al. 2003; Tyrrell et al. 1997). Usually the last 30 40 amino acids (C terminal) are also part of RDI. Al though the exact mechanism of this interaction is not known i t has bee n suggested that the C terminal 40 60 amino acids are involved with DNA interaction (Schell et al. 1990; Lochowska et al. 2001) RDI and RDII are connected by two crossover regions ( in Figure1 5 these are labeled 3a and 3b) which form a hinge or cleft region (hinge 3) (Muraoka et al. 2003) It is suggested that residues from 95 to 210 are involved in ligand interaction in this cleft (Jorgensen and Dandanell, 1999) Hinge 3 is also suggested to play a role in structural rearrangements after the ligand interaction (Muraoka et al., 2003; Zhou et al. 2010) LTT R s DNA Binding S ites LTTRs usually interact at two sites on the DNA which are called the a ctivator b ind ing s ite (ABS) and the r epressor b inding s ite (RBS). When the LTTR mediate s gene activation the ABS is generally found near the 35 position and the RBS is located near the 65 position with respect to the transcription start site. Because i n most cases the TF is divergently transcribed from the regulated genes the RBS overlaps the promoter for the LTTR (Figure 1 6). However, binding sites have sometimes been found as far downstream as the +350 position of the regulated gene (Porra et al. 2007; Viswanathan et al. 2007b) The sequence at RBS is a palindromic T N11 A (ATC N9 GAT) ; although variation in this sequence has been reported (Toledano et al. 1994; Hryniewicz and Kredich, 1995; Grob and Guiney, 1996; Lehnen et al. 2002) In contrast, t he ABS sequence is highly variable. The ABS is a secondary site for LTT R

PAGE 32

32 interactions and studies show that it is involved in activation On the other hand, the RBS is generally a strong binding site and is required for gene repression (Porra et al. 2009) LTTRs usually recognize the dyad symmetry in the binding sequences. However i t has been suggested that the direct repeats within the promoter region of NodD are involved in the binding of NodD to the promoter (Wang and Stacey, 1991; Fisher and Long, 1993) Mode of R egulation M ode of Gene R egulation by LTT R s According to the classical mode l of gene regulation by LTT Rs, the gene encoding the LTTR is constitutively transcribed. Once the LTTR is present in the cellular 6). Next the two dimers interact with each other, promoting DNA bending. As a result, gene expression is inhibited. This model has been inf e rred from multiple studies including those performed with CysB (Hryniewicz and Kredich, 1994) AtzR (Porra et al ., 2010) and OxyR (Toledano et al. 1994) Once a n inducer molecule is present in the cellular environment, it interacts in the hinge 3 region of the TF between regulatory domain I and regulatory domain II (Muraoka et al ., 2003; Parsek et al. 1992; Craven et al. 2009; Tyrrell et al. 1997) leading the LTT R structural rearrangement. The structural rearrangement causes the dimer overlapping the target gene promoter to shif t further upstream. This movement results in a relaxation of the DNA bend as a result the RNA polymerase is able to access the promoter which allows transcription initiation from the promoter This mechanism explains the rol e of L TT R s as transcriptional ac tivators. Recently the structure of ArgP ( Zhou et al ., 2010) was elucidated which explained at the molecular level the results proposed in the classical model of regulation

PAGE 33

33 discussed above (Figure 1 6 ). ArgP is a tetramer in solution In the crystal stru cture of ArgP two forms of dimers were observed : o ne dimeriz ed through DNA binding domains and the other through regulatory domains. The authors proposed that ArgP interacts with its promoter as a dimer at a high affinity site (RBS). This favors the inter action with a second dimer through the C terminal regulatory domains of ArgP and thus it favo rs tetramerization. The second dimer in the tetramer interacts with the low affinity site (ABS) in the target gene promoter region (extended form of the protein). It was also observed that the DNA binding domains in ArgP (as discussed in C hapter 4) were along one face of the tetramer and the regulatory domains were present on the other. Within the regulatory domain, a cleft that can accommodate the ligand was obse rved. However, the effector was not co crystallized with ArgP. It was suggested that once the ligand binds to the ArgP effector binding doman, it would shift the ArgP binding sites in the ABS and allow the RNAP to access the promoter. These observations ar e supported by results seen in n itrogen a ssimilation c ontrol protein ( NAC ) from Klebsiella pneumoniae In NAC it was suggested that the two forms of the tetramers, compact and extended, were present in the absence of physiologically relevant coinducers. I t was proposed that NAC could adopt two forms to recognize different promoter binding sites under different physiological conditions (Rosario et al. 2010) In a few cases the small molecules that modify the activity of LTTRs transcription factors have been elucidated. In some cases like that of NodD3 (Mulligan and Long, 1989) LrhA (Lehnen et al ., 2002) SpvR (Grob and Guiney, 1996) it has been suggested that an abundance of the transcription factor was sufficient for transcriptional activation. These conclusions were based on the target promoter: lacZ fusion stud ies.

PAGE 34

34 Many genes regulated by LTTRs have been identified (For a review see Schell, 1993; Maddocks and Oyston, 2008) Some representative examples were chosen to illustrate the different mode s of regulation discover ed. Ne gative Gene R egulation by LTT Rs LrhA r egulation of the flhD C o peron LrhA is a member of a small group within LTT Rs which negatively regulate s the ir target genes (Lehnen et al ., 2002) The flhD C operon is involved in flagella biosynthesis. LrhA negatively regulates the expression of the se genes by binding to the promoter region. DNase I footprint assay s showed that LrhA interacts at 89 to 129 positions re lative to transcription start site by binding to the sequence ATGACTTATACAT (AT N9 AT). The e ffector molecule that modulate s the binding of LrhA to this promoter have not been identified. A t ranslation al fusion of flhDC to lacZ showed that flhDC expression was up regulated in a lrhA mutant. Similar upregulation was observed in genes involved in motility, chemotaxis and flagella biosynthesis. However, EMSA analysis showed that LrhA only interacts with P lrhA and P flhD promoters and the upregulation o f the o ther genes was indirect. H exA r egulation of virulence g enes in Erw inia carotovora HexA is responsible for regulating the expression of several genes involved in the virulence of the plant pathogen Erw carotovora HexA has high sequence identity (64%) to L rhA from E. coli Unlike classical LTTRs hexA is not associated with the target genes. In hexA mutant s, an increase in production of pectate lyase, protease, and cellula se enzymes as well as higher motility was observed. EMSA experiment s showed that repre ssion is achieved by binding of HexA in the pelC promoter the promoter for pectate lyase (Harris et al. 1998)

PAGE 35

35 Positive Gene Regulation by LTTR s AtzR r egulation of a tzDEF This is an example of classica l mod e of gene regulation by LTT Rs. AtzR from Pseudomonas sp. ADP acts as an activator for the genes atzDEF in response to cyanuric acid and under nitrogen limiting conditions (Porra et al ., 2007) DNase I footprint assays showed that AtzR interacted with a binding region in the P atzDEF at one binding site This binding site was named as activation binding s ite (ABS) since it is located around 35 region of t he P atzDEF Three s equences wit h in the ABS were found and named as ABS1, ABS2 and ABS3 In addition AtzR also bound to a sequence within the divergently oriented P atzR The site overlapping P atzR wa s na med as repression binding site (RBS) since it is involved in atzR auto repression (Porra et al ., 2007) F urther hydroxyl radical footprint suggested that ABS and RBS are located on the same face of the helix (Porra et al ., 2010) Based upon atzD lacZ fusion studies, the investigators found that ABS3 situated immediate downstream from the 35 element of P atzDEF was mainly responsible for the transcription rep ression of this promoter. The sequences at the three sites were GTCG N6 GGCG N7 AGTG ( the ABS1, ABS2 and ABS3 are underlined ) The sequence at the RBS was GTGC N7 GCAC (Porra et al ., 2010) As per the proposed mechanism of regulation, u nder regular conditions AtzR binds to ABS2 and ABS3 sequence s ( the e xtended form of the protein). Once the effector molecule cyanuric acid is added, AtzR binds preferentially to ABS1 and ABS2 ( the compact form of the protein). This structural change allows the RNA polymerase access to the promoter thus enhancing gene tran scription (Porra et al ., 2010)

PAGE 36

36 SpvR r egulation of spvABCD The spv regulon from Salmonella dublin consists of spvR encoding LTT R homologue and four structural genes, spvABCD, which are up regulated in the stationary phase (Coynault et al ., 1992). The biological role of the spvABCD genes is not known. The spvR is located upstream of spvABCD and it is oriented in the same direction as spvABCD (Coynault et al. 1992; Fang et al. 1991) The lacZ studies suggested that SpvR is required for spvA expression (Caldwell an d Gulig, 1991; Fang et al. 1991; Krause et al. 1992) DNase I footprint assay showed that SpvR interact s at a 54 bp region spanning from position 54 to 79 at the P spvA The binding sequence at P spvA is TG T GC N7 GC A CA which is consistent with the LTT R binding consensus sequence at RBS (T N11 A) (Grob and Guiney, 1996) Based upon presence of two complexes in EMSA studies it was suggested that SpvR interacts at the two sites. The disa ppearance of the faster migrating complex at higher protein concentration s suggested that cooperativity might be involved in this interaction (Grob and Guiney, 1996) Northern blot assay studies suggested that spvABCD form s an operon with two transcriptional start sites at 70 and 98 bp upstream of spvA translation start site (Krause et al ., 1992) The spvR gene is monocistronic while spvABCD form s a second transcription al unit (Abe and Kawahara, 1995) LTT R Autoregu l a tion Much of the attention in the research field ha s been directed to wards the target genes regulated by LTT R members rather than to the LTT R autoregulation. It is alrea dy accepted that most of the LTT Rs are nega tively auto regulated whereas LTT Rs act as activators for the target genes ( Mad docks and Oyston, 2008; Schell, 1993) (Figure 1 6).

PAGE 37

37 Negative A utoregulation Most of the LTT Rs are negatively auto regu lated. Some of the examples are described below AtzR As described above AtzR from Pseudomonas sp. strain ADP activates transcription of the atzDEF operon (Porra et al ., 2007) AtzR also acts as the repressor at its own promoter. AtzR is divergently transcribed from the target genes (Porra et al ., 2009) DNase I footprint assay s suggested that AtzR His 6 protected the promoter from positions 41 to 14 (RBS) relative to atzR trans cription start site In addition, protection was also seen from positions 71 to 42 (ABS as described previously). Based upon the presence of an N ) recognition sequence (CGGCAC N5 TTGCT) the authors suggested that the P atzR was recognized by RNA polymerase with an N ). DNase I footprint studies s howed that AtzR competed with the RNA polymerase f or binding at the P atzR In vitro transcription assays suggested that AtzR repressed transcription from P atzR in a concentration dependent manner and prevented open complex formation. As a consequence transcription from P atzR is repressed (Porra et al ., 2009) The sequence at RBS was found to be GGTGCCG N5 CGGCACC. Deletion of the ABS relieved AtzR autorepression and this suggest s that ABS has a role in AtzR au torepression. AtzR represents the classical mode o f negative autoregulation by LTT Rs CysB CysB from Salmonella typhimurium positively regulates the cystein biosynthesis genes in respo nse to N acetyl L serine, and is negatively auto regulated ( Ostrowsky

PAGE 38

38 and Kredich, 1990; Kredich, 1992) DNase I footprint suggested that C ysB protected the c ysB promoter from positions 10 to +36 ( Ostrowsky and Kredich, 1991 ) overlapping the transcription start site. Hydroxy rad ical footprint showed that CysB binds the DNA at two divergently oriented half sites, one situated from 8 to 26 positions with the s equence TCAGATATAATGATATAG and another from position +15 to +33 with sequence TTATTATTAAATCGTATTA. These two sequences a re separated by around 21 bp corresponding to two helical turns. After adding the ligand N acetyl L serine no dif ference in the hyperse nsitive sites were found indicating the DNA bending was not involved. It wa s suggested that the addition of the effector simply weakens CysB interaction with the cysB promoter T hese conclusions were supported by earlier in vivo studies using cys B lac Z fus ions (Bielinska and Hulanicka, 1986) and in vitro transcription assays showed that CysB inhibited the transcription from the cysB promoter wh ile the addition of the effector resulted in increased transcription from the promoter (Ostrowsky and Kr edich, 1991 ) While m ost of the negatively autoregulated LTT Rs are believed to be divergently transcribed from the target genes cysB is one of the exceptions to this rule The CysB regulated genes are not present in the vicinity of cy sB gene. Positive Autoregulation There is a very small group of positively autoregulated LTT Rs. In contrast to the negatively autoregulated LTTRs, positively autoregulated LTT Rs are not divergently transcribed from the modulated gene. These are usually not located in close proximity of the genes under its regulation.

PAGE 39

39 SpvR As described earlier, the SpvR gene has the same orientation as spvABCD and spvR However, the levels of induction of spvR are low (3 to 10 fold) when compared to the spvABCD genes (100 fo ld). SpvR lacZ translation al fusion studies suggested that spvR is positively autoregulated as a muta tion results in no expression from spv promoter (Abe et al. 1994) The expression of spvR gene, alike spvABCD operon, is s ) (Kowarz et al. 1994; Chen et al. 1995) s ) is responsible for recognition of the promoters for the genes expressed in stationary phase and during starvation in E. coli DNase I footprint studies showed that SpvR protected the spvR promoter from 23 to 72 containing two spvR binding sites. The region had TGTGC N7 GGTCA (T N11 T instead of the conserved T N11 A) SpvR binding motif (Grob and Guiney, 1996) In addition to these sequences, random PCR mutagenesis experiments and lacZ reporter assays suggested that the two palindromic sequences (TNTGCANA) present within t his protection region were necessary for optimal recognition of SpvR binding sites. One of the palindromic sequences was present in the spvR recognition motif whereas another was 21bp downstream from the first motif (Grob et al. 1997) LrhA LrhA negati vely regulates flhD C operon involved in flagella biosynthesis in E. coli The genes regulated by LrhA were identified by using DNA microarray studies. LrhA is not encoded in the vicinity of target genes and is present at a different location in genome (Lehnen et al ., 2002; Bongaerts et al. 1995) lrhA lacZ translational fusion studies showed that lrhA is downregulated in lrhA mutant strain. LrhA binds to lrhA promoter as evidenced by EMSA. DNase I protection assay showed a protected region

PAGE 40

40 from positions 194 to 226 relative to transcription start site (Lehnen et al ., 2002) The LrhA binding site has AT N9 AT sequence wh ich is different from the known T N11 A site. The signal molecule is not identified for LrhA. The positive autoregulation mechanism by LrhA is not understood completely (Lehnen et al ., 2002) Project Design and R ationale For the present study L actobacillus brevis ATCC 367 was considered as the test microorganism L. brevis has be en isolated from several flavonoid rich environments such as decaying plants fruits and grain fermentation s ( Kandler and Weiss, 1986 ) These facts indicate the L. brevis has the potential to sense and respond to flavonoids. I t is proposed L. brevis ATCC 367 has the ability to sense and r espond the flavonoids mainly through L TTR The first objective of this study was to identify the transcription factors classified within the LTT R family that are able to respond to flavonoids. This was achieved thro ugh a fluorescence based ligand screen ing assay (Vedadi et al ., 2006; Niesen et al ., 2007) This in vitro study was carried out using the purified LTTRs from L. brevis and variety of flavonoids with different chemical scaffolds. In order to identify and c haracterize the promoter region : transc ription factor interaction electrophoretic mobility shift assays (EMSAs) were carried out using different fragments around the transcription factor genomic context S equence based DNase I footprint study was use d to determ i ne L TTR binding sites. The secon d objective of this project was to assess the effect s of the identified flavonoids on gene expre s sion. The in vitro effects were confirmed in vivo with qRT PCR and lacZ reporter assays. The in vitro characterization was performed using EMSA s and size exclu sion chromatography.

PAGE 41

41 The third objective of this study was to identify the LTTR critical amino acids involved in ligands recognition. For this objective, bioinformatics analyses were carried out. A structural model of the LTTR was constructed and putative amino acids involved in ligands interaction were identified. The involvement of these residues in binding to flavonoids was determined by site directed mutagenesis and t he effect s of these mutations on ligand interaction s were determined by EMSA s

PAGE 42

42 Tab le 1 1. Flavonoids classification: Flavonoids are classified in six classes. Flavonoids structure consists of two benzene rings (A and B) connected through central pyrone (C) ring. The flavonoids members differ based upon the R1, R2, and R3 groups substit ution. Flavonoid class Structure Examples R1 R2 R3 Flavonol Isorhamnetin OMe H Kaempferol H H Myricetin OH OH Quercetin OH H Flavone Apigenin H Luteolin OH Flavanone Eri odictyol OH OH Hesperetin OMe OH Naringenin OH H

PAGE 43

43 Table 1 1. Continued Flavonoid class Structure Examples R1 R2 R3 Flavan 3 ol (+) Catechin H H OH (+) Catechin 3 gallate H H Gallate ( ) Epicatechin H OH H ( ) Ep icatechin 3 gallate H Gallate H ( ) Epigallocatechin 3 gallate OH OH H ( ) Epigallocatechin OH Gallate H Anthocyanidin Cyanidin OH OH Delphinidin OH OH Malvidin OMe OMe Pelargonidin H H Peonidin H OMe Petunidin OH OMe Isoflavones Daidzein H Genistein OH

PAGE 44

44 Table 1 2. Major transcription factors families in prokaryotes Modified from Rodi o nov ( 2007 ) Family Examples DBD a pos b mod c Function TF #s d AraC MelR, RhaS, XylR, MarA, SoxS, R hrA H C A Carbon metabolism, cell wall synthesis, stress responses 6954 ArsR CadC, CzrA, NmtR, SmtB, ZiaR w CR R Homeostasis of transition metals (Cd, Co, Zn, Ni, Zn, As, Pb) 982 AsnC Lrp, BkdR, PutR w N D Amino acid metabolism 1527 Cro Cro, CI, CopR, X re H N R B acterial plasmid copy number control 5258 Cold shock cspB, cspC, cspD, cspE cspF CSD V A Low temperature adaptation 607 Crp Fnr, Dnr, NtcA, PrfA, CooA, HcpR, w C A(R) Global regulator protein. Catabolite response 891 DeoR GlpR, AgaR, IolR w N R C arbohydrates utilization 915 Fis NtrC, NifA, NorR, FhlA, TyrR, PrpR H C A N itrogen, amino acid, and secondary metabolism, flagella ( dependent) 2843 Fur Zur, Mur, Nur, Irr, PerR w N R(A) M etal ion homeostasis (Fe, Zn, Mn, Ni), peroxide stress 888 GntR AraR, ExuR, DgoR, TreR, FadR, HutC, CitR, PdhR, BioR w N R C arbohydrates, fatty acid and amino acid utilization, biotin metabolism 4293 W winged helix turn helix, H Helix turn helix, m miscellaneous, CSD cold shock domain, C C terminal, N N terminal, CR center, A Activator, R repressor, D dual role. A(R) mostly activator, R(A) mostly repressor. a DNA Binding Domain, b DNA binding do main position, c mode of gene regulation, d Transcription factors numbers.

PAGE 45

45 Table 1 2. Continued Family Examples DBD a pos b mod c Function TF #s d IclR KdgR, PcaR, AllR, MhpR w N R (A) S ugar acids and aromatic compounds utilization, secondary metab olism 1122 LacI GalR, CcpA, CytR, NagR, ScrR, PurR ,ScrR, PurR H N R C arbohydrates utilization, catabolite repression, purine metabolism 2000 LuxR RhlR, TraR, ComA, NarP, NarL, FixJ m C A(R) Quorum sensing, competence, nitrogen oxides metabolism, anaerob ic switch 3706 LysR IlvY, CysB, MetR, CynR, NodD, AmpR, SpvR, CatR w N D Amino acid biosynthesis, nodulation, antibiotic resistance, virulence, Aromatic compounds utilization 9421 MarR SlyA, PecS, AdcR, BadR, HucR w CR R Multiple antibiotic resistance re sponse, Zn uptake 3280 MerR GlnR, TnrA, SoxR, BmrR,CueR, CadR, PbrR, ZntR H N R N itrogen metabolism, response to stress, multidrug efflux, heavy metal resistance (Hg, Cu, Cd, Pb, Zn) 2337 OmpR ArcA, PhoB, CiaR, ToxR, VirG w C A Biosynthesis of membrane c omponents, phosphate metabolism, competence, virulence 5010 ROK NagC, XylR, Mlc H N R C arbohydrates utilization 1198 RpiR HexR H N R C arbohydrates utilization 636 Rrf2 IscR, NsrR, RirA H N R FeS cluster, iron, nitrogen metabolism 818 TetR AcrR, QacR, F abR, RutR, BioQ H N R A ntibiotic resistance, fatty acids, pyrimidine, and biotin metabolism 6190 W winged helix turn helix, H Helix turn helix, m miscellaneous, CSD cold shock domain, C C terminal, N N terminal, CR center, A Activator, R repressor, D dua l role. A(R) mostly activator, R(A) mostly repressor. a DNA Binding Domain, b DNA binding domain position, c mode of gene regulation, d t ranscription factor numbers.

PAGE 46

46 Figure 1 1. One component and two component response regulators: A ) In one component r esponse regulators the i nput (sensor or EBD) and output (DBD) domains are present in one protein. B) Once a ligand or signal molecule is present in the cellular environment it interacts with the input domain. This interaction activates the output (DBD) d omain thus activating or repre ssing transcription from the promoter. C) In two component response regulators Input (sensor kinase) domain is usually present in the cell membrane. D) Once the ligand or effector molecule is present in the cellular environmen t the sensor kinase is autophosphorylated which eventually phosphorylates the cytoplasmic output domain (DBD) protein. Phosphorylation of DBD protein activates the DBD which leads to DBD interaction with the promoter r egion to activate or repress transcri ption.

PAGE 47

47 Figure 1 2. Mechanism of transcription al repression : A) Repressor (sometimes in presence of corepressor) bind s at the RNA polymerase binding site in the promoter and hinders RNA polymerase interaction. B) Repressor interaction at a site in the gene/operon blocks transcription elongation, C) The repressor interaction with an activator modulates the activator activity which affects promoter recognition by RNAP D) The i nducer (shown as red triangle) and transcription factor interaction causes a co nformational change inhibit ing the repressor binding at the promoter region or E) R epressor binding sites (RBS) F) In the absence of active repressor, the interaction of the activator with RNAP stabilizes the interaction of RNAP with the promoter. R repres sor, A CTD), RBS repressor binding site.

PAGE 48

48 Figure 1 3. M echanism of t ranscription al activation: A) TFs that act as transcriptional activators and bind at sequence s adjacent to the 35 region of the promoter ( class II promoter) or B) upstream of the 35 region (class I promoter). T ranscriptional activation is achieved through the interaction of the TF with RNAP. C) Some transcriptional activators do not bind DNA but rather facilitate recognition of promoter by RNAP.

PAGE 49

49 Figure 1 4. Dual role of transcription factor s A) In the absence of an inducer, the repressor overlaps the 35 region (extended form of TF), which blocks RNAP access to the promoter. B) The inducer molecule changes the repressor conformation ( compact form of TF) which facilitates the interaction of RNAP with the promoter through a shift in the binding site to a site further upstream of the 35 region. C ) Repressor interaction at two sites results in DNA looping which block s RNA polymerase acces s to the promoter. D ) I n the presence of the inducer the repressor conformation is changed which facilitates R NAP interaction with the promo ter E) T he interaction of the transcription factor at the promoter leads to a conformational change in DNA which in hibits open complex formation with RNAP. F) In presence of the inducer transcription factor facilitates the open complex formation by reorienting the DNA structure.

PAGE 50

50 Figure 1 4 continued

PAGE 51

51 Figure 1 5 LTTR domains arrangement: A) The DBD is fo rmed from the first 90 amino acids (green b ox). Within this region 23 to 43 residues form a wHTH DNA binding motif (Black Box). HTH is the most conserved motif among LTTR members. The effector binding domain/ regulatory domain (EBD/RD) is formed from the last 90 300 residues. The RD is divided into two domains : the regulatory domain I (RDI) and the regulatory domain II (RD II). C terminal amino acids are also part of RD I. C terminal 40 60 amino acids are also thought to be involved in the DNA interaction (green). Residues 95 to 210 are involved in substrate/ligand interaction. B) The cartoon diagram shows LTTRs domains arrangement. DBD is formed from the first 90 amino acids. wHTH is connected to the regulatory domains through a linker helix. Hinge 1 conne cts the wHTH to the linker helix whereas hinge 2 connects the linker helix to regulatory domain I (RDI). Hinge 3 is formed from crossover region between RDI (3a) and RDII (3b) forms the ligand binding cleft.

PAGE 52

52 Figure 1 6. Classical mode of gene regula tion by L TTR s : A) Classical LTT R members are divergently transcrib ed from the target genes. A) LTT R dimer first interacts with RBS through an N terminal DNA binding doma in (denoted as N in red). B) LTT R binding at RBS favors tetramerization through the reg ulatory domain (denoted as C in red).The second dimer in the tetramer interacts with the ABS through the DNA binding domains. This in teraction bends the DNA. The LTT R binding at RBS and ABS turns off transcription from the respective promoters. C) When a l igand/ effector molecule is present in the cellular enviro nment, it interacts with the LTTR causing LTT R structural rearrangements These rearrangements bring the two dimers together (compact form) by relaxing the DNA bend. The structural rearrangement s al so shift the LTT R binding site at ABS ( allows RNAP access to the target gene promoter ), and thus transcription from the promoter is enhanced

PAGE 53

53 CHAPTER 2 MATERIALS AND METHOD S Materials The oligonucleotides used in this study were from Sigma Aldrich (St. L ouis, MO ) Biodyne B precut modified nylon membranes and Lightshift chemiluminescent detection kit for Electrophoretic Mobili ty Shift Assay studies were from Pierce Biotechnology (Rockford, IL ) R estriction endonucleases, T4 DNA ligas e, DNA size standards Taq DNA polymerase, Longamp Taq DNA polymerase were from New England Biolabs (Ipswich, MA) Flavonoids, p oly (dI dC), oligonucleotides, c hlorophen ol red D g alactopyranoside reagent, organic and inorganic analytical grade chemicals were from Sigma Aldric h (St. Louis, MO). 40 % acrylamide/bis acrylamide solutions, Bradford protein assay reagents, the empty criterion cassettes were from Bio R ad (Hercules, CA). The primers used for DNase I footprint were from Applied biosystems (Foster City, CA) The RNA e xt raction kit was from Ambion ( Austin TX) whereas qRT PCR reaction reagents and SYPRO orange dye were from Invitrogen (San Diego, CA) Plasmid purification kit (QIAquick), plasmid extraction kit (QIAprep Spin Miniprep ), and DNeasy blood and tissue kit were purchased fr om QIAGEN (Valencia, CA). P fu turbo polymerase used for site directed mutagenesis was from Stratagene (La Jolla, CA) Ni NTA superflow resin was purchased from QIAGEN (Valencia, CA). The super ose 12 10/300 GL column used for FPLC was from GE h e althcare (Uppsala, Sweden) whereas the standards were purchased from Sigma aldrich (St. Louis, MO) The SDS PAGE molecular weight standards Kodak X ray films were from Fisher (Waltham, MA)

PAGE 54

54 Bacterial S trains and P lasmids Lactobacillus brevis ATCC367 was o btained from the American Type Culture Collection (ATCC, Manassas VA ). Bacillus subtilis M168 was obtained from the Bacillu s Genetic Stock C enter ( BGSC Columbus OH ) Lactobacillus strains were grown at 30 C in MRS broth (Difco Laboratories, Detr oit, MI). Escherichia coli DH5 cells, used to carry and propagate all vectors, were grown in Luria Bertani medium (Difco) at 37 C under aerobic conditions. B.subtilis M168, used for lacZ reporter assays, were also grown in Luria Bertani medium (Difco) a t 37 C under aerobic conditi ons. When appropriate, media were B. subtilis M168 E. coli ). All antibiotics and chemicals were purchased from Sigma Aldrich (St. Louis, MO). All strains and plasmids used for this stu dy are show n in Table s 2 1 and 2 2 Competent Cells P reparation The E. coli competent cells were prepared with CaCl 2 and MgCl 2 (Sambrook et al. 1989) Briefly, the respective E. coli strain was streaked on a n LB plate supplemented wit h 10 mM MgCl 2 The plate was incubated at 37 C overnight. One colony was chosen from the plate for inoculation in 5 ml TYM broth (2 % t rypteine, 0.5 % y east extract, 0.58 % NaC l, and 0.2 % MgCl 2 ). The c ulture was grown for 2 hr at 37 C at 250 rpm The gr own culture was transferred to 500 ml of TYM which was incubated at 37 0 C until the OD 600~0.5. The cells were harvested by centrifugation at 300 0 rpm for 12 min at 4 C The pellet was resuspended in 40 ml (for 100 ml of original culture) of TfbI (30 mM K Acetate; 50 mM MnCl 2 100 mM KCl, 10 mM CaCl 2 15 % g lycerol). The resuspended cells were incubated on ice for 5 15 min for Rec + strains or 60 90 min for Rec strain.

PAGE 55

5 5 T he cells were harvested by centrifugation at 3000 rpm for 8 min at 4 C The pellet was r esuspended in 4 ml (for 100 ml of original culture) of TfbII (10 mM MOPS pH 7; 75 mM CaCl 2 ; 10 mM KCl; 15 % glycerol). The competent cells were aliquoted in 0.2 ml aliquots and stored at 80 C until use. For B. subtilis M 168 competent cells preparation, B subtilis M 168 was streaked on LB plate. The plate was incubated at 30 C overnight. One colony was inoculated in 2 ml SpC (1X T base : 1mM MgSO 4 0.5 % glucose, 0.2 % yeast extract, and 0.0 3 % casamino acids) The culture was incubated at 37 0 C with aerati on (250 rpm) After 5 hrs of incubation the culture was transferred to 18 ml of prewarmed SpII (1X T base, 3.5 mM MgSO 4 0.5 % glucose, 0.1 % yeast extract, and 0.01 % casaminoacids) in 250 ml flask. The culture was incubated at 37 0 C for 90 min. The cultu re was harvested by centrifugation at 8000 rpm for 3 min at room temperature. The pellet was resuspended in prewarmed 1.6 ml of SpII and 0.4 ml 50 % glycerol. The competent cells were separated in 0.5 ml aliquots and stored at 80 0 C until use. DNA M anipul ations DNA Amplification Polymerase chain reaction was used to amplify the gene under study. Quickload Taq 2X M aster mix (N ew E ngland B iolabs Ipswich, MA) was used for PCR reactions. For amplification of genes larger than 2 kb, l ongamp Taq 2X mastermix (N ew E ngland B iolabs, Ipswich, MA) was used. The PCR reaction was carried out as per The PCR products were cleaned by QIAquick PCR purification kit (Qiagen Valencia, CA )

PAGE 56

56 Cloning T echniques T he primers were designed to amplify the gene of interest. Extra nucleotides were primers which also included restriction endonuclease sites (Table 2 5 ). The PCR amplified products were digested with restriction enzymes if requ ired using N ew E ngland B iolabs ( Ipswich, MA) recommended buffers. Similarly, the vector was digested using the same restriction enzymes used for insert digestion. The digested PCR product and vector were purified using QIAquick PCR purif ication kit (Qiagen ). T4 DNA li g a se N ew E ngland B iolabs ( Ipswich, MA) was used for liagation. The ligation reaction was carried out as per manu facturer recommended protocol. For cloning in p15TV L, the LVIS0344 LVIS0398 LVIS0806, LVIS0910 LVIS1989 LVIS2088 and LVIS2204 genes were amplified from L. brevis ATCC 367 chromosomal DNA using PCR. Th e primers are listed in Table 2 4 Ligation independent cloning (LIC) infusion reaction was used. Briefly, BD infusion pellet was dissolved with 8.5 l of predigested p15TV L plasmid then 2l infusion/vector mix was mixed with 0.5 l of insert (PCR target). The infusion: vector: insert mix was incubated at 28 0 C for 30 min and used for transformation. Transformation T ransformation of bacterial cells with DNA was carried out using the heat shock method (Sambrook et al ., 1989) The E.coli or E. coli XL blue competent cells were used for cloning experiment s whereas E. coli BL21 competent cells were used for protein expression An aliquot of the competent cells ( 80 l ) were mixed with 20 ng to 50 ng reaction sample or target recombinant plasmid and incubated on ice for 10 minutes The cells were transferred to 37 0 C for 5 min. After incubation the cells were im mediately transferred to ice for 2 min. The cells were resuspended in 1ml LB and

PAGE 57

57 incubated at 37 0 C. After 45 min the cells were plated on LB medium supplemented with suitable antibiotic selection marker. For transformation of B. subtilis M 168, the B. subtilis M 168 competent cells were thawed at 37 0 C. An e qual volume of SpII EGTA (0.5 % glucose, 0.09 % MgSO 4 0.1 % yeast extract, 0 .01 % casamino acids, 0.002 % EGTA) was added to the competent cells and 20 ng to 50 ng of plasmid DNA The mix was incubated at 37 0 C for 30 min under aerobic conditions (250 RPM ) After 30 min the culture was plated on LB plates using the required select ive antibiotic. DNA Electrophoresis Chromosomal DNA or DNA fragments were analysed on 1 % agarose (for fragments larger than 1Kb) or 1.5 % agarose ( for fragments smaller than 1Kb ) Electrophoresis was performed at 400 mA, 90 V in 1X TAE (40 mM Tris Acetat e; 2 mM EDTA pH 8.5) for 30 40 min Before loading on the gel, 5 l DNA sample was mixed with 1l of 6X loading dye ( New England Biolabs Ipswich MA) The 1 kb or 100 bp molecular weight standards (NEB) were used to determine the size of the separated f ragments After electrophoresis, the gel was incubated in ethidium bromide for 10 min. The gel was visualized under UV light by imageQuant 400 (GE Healthcare, Piscataway, NJ ) analyzer. Site Directed M utagenesis Site direc ted mutagenesis was performed using Pfu Turbo DNA polymerase (Strat a gene La Jolla, CA ) as per manufactu the reaction mixture used for site directed mutagenesis comprised of 1X reaction buffer (Strat a gene, La Jolla, CA) 0.5 M of each of the primers (sense an d antisense), 50 to 100 ng of the template DNA, 2 mM of dNTP mix 1.5 U of P fu turbo DNA polymerase, 3 % DMSO.

PAGE 58

58 The PCR conditions were 1 Cycle at 95 0 C for 30 sec, 18 cycles at 95 0 C for 30 sec, 55 C for 1 min, 68 0 C for 7 min, 1 cycle at 68 0 C for 10 min The primers used for site directed mu tagenesis are shown in Table 2 7 The amplified DNA was subjected to DpnI treatment (20 U for 150 min) for cleavage of hemimethylated template DNA After DpnI treatment the DNA was transformed in to E. coli by h eat sho ck transformation method as described previously. Construction of l acZ F usions The p lasmid pDG1663 (Gurou t Fleury et al. 1996) was used for transcriptional analyses of LVIS1988 and LVIS1989 expression Plasmid pSP01 was constructed by cloning a fragment (amplified with primers P3 Fw and P4 Rv Table 2 5 ) containing the complete LVIS1989 ( kaeR ) sequence, the intergenic region between LVIS1988 LVIS1989, and the first 270 nucleotides of LVIS1988 Similarly, plasmid pSP02 was constructed using primers P5 Fw and P4 Rv except that onl y site I was included (Table 2 5 ). The PCR fragments were cut with Hin dIII and Ba m HI restriction enzymes, and ligated to plasmid pDG1663 digested with the same enzyme. After ligation, samples were transformed in to E. coli Recombinant clones were identified by colony PCR using P9 _Fw and 1989_RT_Rv primers The clones were confirmed by sequencing using the primer LVIS1989_RT_Rv (Table 2 6 ). Ectopic integration of pSP01 and pSP02 in the thrC locus of B. subtilis M168 was perfo rmed by natural transformation (Petit Glatron and Chambert, 1992) The resulting strains were la beled S P01 and SP02 ( Table 2 1 ). The ectopic integration of pSP01 and pSP02 was confirmed by PCR using primers P15 _Rv and P16 _Fw Plasmid pLG103 ( Belitsky and Sonenshein, 2002) was used for analyses of LVIS1988 and kaeR expression. Tran scriptional fusions to LVIS1988 (to obtain plasmid

PAGE 59

59 pSP05 ) were constructed by cloning a PCR fragment (using primers P11 Fw and P12 _Rv ) in the Bgl II and Eco RI sites. The clones were confirmed by seque ncing using primer P9 _Fw (Table 2 5 ). In the plasmids pSP 04 and pSP03 the lacZ gene was transcriptionally fused to kaeR by cloning fragments that contained either binding site I (using primers P6 _Rv and P7_Fw) or both sites (P6_Rv and P8_Fw ), respectively. The clones were confirmed by sequen cing using primer s P 9 _Fw and P10 _Rv (Table 2 5 ). Strains SP03, SP04, SP05, SP06, and SP07 were constructed by transforming B. subtilis with the indicated plasmids followed by ectopic integration in the amy E locus. For heterologous gene expression of L. brevis genes in B. subt ilis the LVIS1989 ( kaeR ) gene was amplified (using primers P13 _Rv and P14 _Fw Table 2 5 ) and cloned in the pAX01 plasmid (Hrtl et al. 2001) under a xylose inducible promoter. The resulting pSP06 recombinant plasmid was introduced in B. subtilis and integrated in the l acA locus. RNA E xtraction Bacterial cells were cultured in MRS broth, in the presence or absence of myricetin, kaempf erol or hesperitin (10 centrifugation at 4 C when OD 600 =0.3 or OD 600 =1 .5 was observed. Total RNA was subsequently isolated using a RiboPure TM Bacteria kit (Ambion Austin, TX ) in accordance with th e manufacturer's protocol. The RNA was quantified by Nanodrop ND 1000 spectrophotometer at 260 nm. cDNA S ynthesis cDNAs were synthesized with the superscript III first strand synthesis supermix for qRT PCR (Invitrogen San Diego, CA ) in accordance with the manufacturer's instructions an d stored at 80 C prior to use. Real time quantitative PCR (qRT PCR)

PAGE 60

60 was carried out in a Bio Rad iCycler IQ apparatus, using SYBR Green ER qPCR SuperMix for iCycler (Invitrogen SanDiego, CA ) in accordance with the manufacturer's recommended protocol. Th e qRT PCR cycles conditions were 1 cycle at 50 0 C for 2 min, 1 cy cle at 95 0 C for 10 min, 45 cycles at 95 0 C for 15 sec and 1 min at 60 0 C. The data analysis was carried out by using Bio R ad iQ5 software. The primers used in q RT PCR for LVIS1986, LVIS1987 LVIS1988 LVIS1989 and for amplification of intergenic regions are listed in Table 2 6 The L. brevis ATCC 367 rpoD gene was used as an internal control. Protein Techniques Protein O verexpression in E. coli Protein overexpression was carried out as descr ibed previously. ( Pagliai et al. 20 10 ) Briefly, 2 L of LB supplemented with ampicillin (100 g /ml) was inoculated with 10 ml overnight grown E. coli BL21 Star(DE3) cells (Stratagene, USA) containing the recombinant plasmid The cells were grown at 37 0 C under aerobic condition (250 RPM ) until OD 600 ~0.6 to 0. 8. IPTG ( 1 mM) was added to the culture which was further incubated at 16 0 C overnight. The cells were harvested by centrifugation at 7500 RPM for 20 min at 4 0 C. The cell pellets were stored at 80 0 C until further use. Protein P urification Protein purifi cation was carried out as described previously ( Pagliai et al. 2010 ) The cell p ellet was resuspended in b inding buffer (500 mM NaCl, 5% g lyce rol, 50 mM HEPES, pH 7.5, 5 mM i midazole, 0.5 mM TCEP ) with 0 .5 % NP 40 and 1 mM of PMSF A French Press was used to lyse the suspension The lysate was clarified by c entrifugation (4 C, 30 min at 17,000 RPM ) and the cell free extract was applied to a metal chelate affinity column charged with Ni 2+ The column was then washed with 250

PAGE 61

61 ml wash buffer (500 mM NaCl, 5 % glycerol, 50 mM HEPES, pH 7.5, 30 mM imidazole 0.5 mM TCEP ) T he protein was eluted in elution buffer (binding buffer with 250 mM i midazole). The purified proteins were dialyzed against 10 mM HEPES, pH 7.5, 500 mM NaCl, 2.5% glycerol and 0.5 mM TC EP overnight at 4 0 C. The dialyzed protein was separated in 80 0 C until use. Protein Quantification Protein c oncentrations were determined using Bio R ad protein assay kit as per This protein quantification is based upon Bradford method (Bradford, 1976) The protein samples were added to 1 ml acidic Bradford reagent (Bio R ad Hercules, CA ) After 5 min incubation at roo m temperature, OD at 595 nm was measured by spectrophotometer (UV 1700 pharmaspec, Shimadzu) Bovine gamma globu lin was used as a standard The relative protein concentration was determined by comparison with a standard curve. Protein S eparation by SDS PA GE The cell lysates and Ni affinity chromatography fractions were assessed for purity by SDS PAGE. EZ run SDS PAGE protein marker w as used to determine the polypeptide molecular weights (Fisher, Waltham, MA) 15 l of protein samples were mixed with 3 l o f 5X loading dye (10 % w/v SDS; 10 merc aptoethanol; 20 % v/v glycerol; 0.2 M Tris HCl pH 6.8; 0.05 % w/v bromophenol blue). The protein samples were denatured by heating at 90 0 C for 5 min. After 5 min the samples and th e molecular weight marker were separated on 12 % SDS polyacrylami de gel by electrophoresis ( 150 V, 40 to 60 min) in 1X running buffer (25 m M Tris HC l, 200 mM glycine, 0.1 % w/v SDS). Gel s were stained with coomassie blue and analyzed by imageQuant 400 (GE) analyzer.

PAGE 62

62 Size Exclusion C hromatography P rotein samples were pre pared using 10 mM HEPES, pH 7.5, 500 mM NaCl, 25 were added After 20 minutes of incubation on ice, samples were injected onto a prepacked Superose 12 10/300 GL gel filtration column (GE Healthcare, Sweden) connected to an LCC 501 plus (Pharmacia Biotech Inc. Piscataway,NJ ) equilibrated with 10 mM HEPES, pH 7.5, 500 mM NaCl. Filtration was carried out at 4 C using a flow rate of 0.5 ml/min. E luted proteins were monitored continuously for absorbance at 280 nm using a UV M II monitor (Pharmacia Bi otech Inc. Piscataway NJ ). Blue dextran 2000 was used to determine the void volume of the column. A mixture of protein molecular weight standa rds, containing IgG (150 kDa), bovine serum albumin (66 kDa), albumin (45 kDa), trypsinogen (24 kDa), c ytochrome C (12.4 kDa) and v itamin B12 (1.36 kDa) was also applied to the column under similar conditions. The elution volume and molecular mass of each protein standard was then used to generate a standard curve from which the molecular weight of eluted proteins was determined. Small Molecule S creening by Differential Scanning F luorometry Purified proteins were subjected to screening against apigenin, naringenin, naringin, quercetin, epicatechin, acacetin, luteolin, chrysin, hesperitin, kaempferol and myricetin at a final concentration of as previously described (Vedadi et al. 2006; Niesen et al. 2007) Proteins were diluted to a final concentration of mM Hepes, pH 7 and f a protein solution were then prepared with each chemical compound, and placed into duplicate 96 well plates (Bio Rad, Hercules, CA). Samples were then heated from 25 C to 80 C at a rate of 1 C per minute. A real time PCR device (iCycler IQ, Biorad) wa s used to monitor protein

PAGE 63

63 unfolding, by measuring the increase in fluorescence of the fluorophor e SYPRO Orange (Invitrogen, San Diego CA). Fluorescence intensities were plotted against temperature for each sample well. Transition curves were fit using the Boltzmann equation using the Origin 8 software (Northhampton, MA). The midpoint of each transition was calculated and compared to the midpoint of the reference sample. If the difference between them was greater than 2.0 C, the corresponding compound was the experiment was repeated to confirm the effect in a dose dependent manner. Electrophoretic Mobility Shift Assays (EMSA s ) EMSA analysis of KaeR or mutant KaeR was performed using proteins purified and concentrated according to the procedures described above. Different fragments containing the putative binding sites for KaeR (summarized in chapter 3 Fig ure 3 4 A) end) primers (Table 2 3 ), and subsequently purified using QIAquick sp in columns (Qiagen Valencia, CA ). D ifferent probes contained sequences in the surroundings of the intergenic region between LVIS1988 and LVIS1989 ( Primers E8 Fw to E9 Rv ) as well as a putative promoter downstream LVIS1989 (P LVIS1990 gen erated with primer s E10 _Fw and E11 _Rv ; P LVIS199 1 gen erated with primers E12 _Fw and E13 _Rv Table 2 3 ). The binding buffer for EMSA assays was optimized by the addition of 2.5 mM MgCl 2 and 0.5 mM CaCl 2 These were found to improve KaeR binding to F kae2 suggesting Ca 2+ and Mg 2+ ions play a role during the formation of a strong complex (see Appendix A ). The interaction was also found to be very sensitive to pH in both the binding and running buffer. To maintain the stability of the complex, binding buffer was prepared at pH 6.7 while the running buffer was kept at pH 7.5 (see Appendix A ). The optimized reaction mix for EMSA (20 l)

PAGE 64

64 labelled DNA fragment, 10 mM Tris HCl, pH 6.8, 150 mM KCl, 0.5 mM EDTA, 0.2 mM DTT, 0.5 mM CaCl 2 2.5 mM MgCl 2 0.1% Triton X100, 25 ng/ l Poly(dI dC) nonspecific competitor DNA, purified KaeR protein (0 500 nM) and ligand (0 C, samples were separated on 5 % acrylamide/bis acrylamide non denaturing gels, in 0.5X Tris borat e EDTA buffer, pH 7.5 (TBE pH 7.5 ). Electrophoresis was performed at 4 C in 0.5x TBE as a running buffer. The DNA was then transferred from the polyacrylamide gel to a Biodyne B Nylon Membrane (Pierce Biotechnology Rockford, IL ) by electroblotting at 38 0 mAmps in 0.5x TBE. Transferred DNA was cross linked by UV and biotin labeled DNA was detected using a horseradish peroxidase/Super Signal Detection System (Pierce Biotechnology Rockford, IL ) Membranes were exposed to Kodak X ray film (Fisher, Waltham, MA) DNase I Footprinting DNase I footprint assay was carried out at the Plant and Microbe Genomics facility, Ohio State University, Columbus, as described previously by Zianni et al. ( 2006) FAM labeled probes were generated by PCR, using primers E3 _Rv and D1 _Fw (Table 2 3 ). The reaction containing 2.5 ng/ul labeled probe, 8 g of KaeR, 10 mM Tris HCl, pH 6.8 150 mM KCl, 0.5 mM EDTA, 0.2 mM DTT, 0.5 mM CaCl 2 2.5 mM MgCl 2 0.1 % Triton X100, 25 ng/ l Poly ( dI dC) nonspecific competitor DNA, and 0.006 U of DNase I (New England Biolabs Ipswich, MA ) was incubated for 2 0 min at 37 C. A digestion reaction without KaeR was included as a control. The reaction was terminated by the addition of 10 mM EDTA, pH 8.0. The digested DNA and sequencing reaction products were analyzed with a 3730 DNA analyzer, and the

PAGE 65

65 protected regi ons were identified with GeneMarker (Soft genetics) as described earlier (Zianni et al ., 2006) galactosidase A ssa ys Cells were grown at 37 C under aerobic condition s (250 RPM ) in LB broth in the various time points during growth phase Cells were washed twice with 0.9 % NaCl and permea bilized with 1 % toluene in Z buffer (60 mM Na 2 HPO 4 40 mM NaH 2 PO 4 10 mM KCl, 1 mM MgSO 4 mercapthoethanol) (Miller, 1972) galactosidase activity was assayed by following the catalytic hydrolysis of the chlorophenol red D galactopyranoside (CRPG) substrate (Sigma Aldrich, USA). Absorbance at 570 nm was read continuously using a Synergy HT 96 well plate reader (Bio Tek In struments Inc., galactosidase activity is expressed in Miller units. Assays were performed in duplicates at least three times. The Tools Used for Bioinformatics S tudies The tools used for bioinformati cs studies are listed in Table 2 8

PAGE 66

66 Table 2 1 Strains used in this study Name Relevant genotype/phenotype a Source E. coli lacZ lacZYA argF )U169 recA1 endA1 hsdR17 (rk mk + ) supE44 thi 1 gyrA relA1 Laboratory stock E. coli BL21 (DE3) E. coli B F dcm ompT hsdS(rB mB ) gal Stratagene B. subtilis M 168 trpC2 B GSC 1 L. brevis ATCC 367 Wild Type ATCC 2 B. subtilis SP01 M168 : [ LVIS1988 ( 387 to +973 ) lacZ ] Em r This work B. subtilis SP02 M168 : [ LVIS1988 ( 135 to +973 ) l acZ ] Em r This work B. subtilis SP03 M168 : [ LVIS1989 ( 400 to +14) lacZ ] Cm r : empty pAX01 Em r This work B. subtilis SP04 M168 : [ LVIS1989 ( 400 to +14) lacZ ] Cm r lacA : [ XylR P XylA LVIS1989 ( +1 to +973 )] Em r This work B. subtilis SP05 M168 : [ LVIS1989 ( 182 to +14) lacZ ] Cm r lacA : [ XylR P XylA LVIS1989 (+1 to +973)] Em r This work B. subtilis SP06 M168 : [ LVIS1988 ( 399 to +16) lacZ ] Cm r lacA : [ XylR P XylA LVIS1989 (+1 to +973)] Em r This work B. subtilis SP07 M168 : [ LVIS1988 ( 399 to +16) lacZ ] Cm r lacA : empty pAX01. Em r This work B. subtilis SP 15 M168 empty pDG1663 Em r This work B. subtilis SP 16 M168 : empty pLG103 Cm r : empty pAX01 Em r This work a The pos i tions indicated are relative to LVIS1989 translation start codon. 1 Bac illus Genetic Stock Center, 2 American Type Culture Collection

PAGE 67

67 Table 2 2 Plasmids used in this study. Name Relevant genotype/Phenotype a Source p15TV L Expression vector for purification of proteins by nick el affinity cromatography. Ap r Addgene plasmid 26093 pAX01 B. subtilis vector for ectopic integration into lacA site containing XylR P XylA cassette. Ap r ,Em r Hrtl et al ., 2001 pLG103 B. subtilis vector for integration into amyE site containi n g two prom oterless reporters, gusA and lacZ in opposite orientaion s Ap r Cm r Belitsky and sonenshein 2002 pDG1663 B. subtilis vector for ectopic integration into thrC site containing E. coli spoVG lacZ Ap r Em r Gurout Fleury et al ., 1996 pSP01 LVIS1988 lac Z transcriptional fusion in pDG1663 carrying the L. brevis sequence from 387 to +973 Ap r Em r This work pSP02 LVIS1988 lacZ transcriptional fusion in pDG1663 carrying the L. brevis sequence from 135 to +973 Ap r Em r This work pSP03 LVIS1989 lacZ t ranscriptional fusion in pLG103 carrying the L. brevis sequence from 400 to +14 Ap r ; Cm r This work pSP04 LVIS1989 lacZ transcriptional fusion in pLG103 carrying the L. brevis sequence from 182 to +14. Ap r Cm r This work pSP05 LVIS1988 lacZ transcrip tional fusion in pLG103 carrying the L. brevis sequence from 399 to +16. Ap r Cm r This work pSP06 L. brevis LVIS1989 from +1 to +973 cloned in pAX01. Ap r Em r This work p LB 0 1 p15TV L His6 LVIS0344. Ap r This work p LB 0 2 p15TV L His6 LVIS0398. Ap r Th is work p LB 0 3 p15TV L His6 LVIS0806. Ap r This work p LB05 p15TV L His6 LVIS0910. Ap r This work p LB06 p15TV L His6 LVIS1989. Ap r This work p LB07 p15TV L His6 LVIS2088. Ap r This work p LB08 p15TV L His6 LVIS2204. Ap r This work a The positions indicat ed are relative to LVIS1989 translation start codon.

PAGE 68

68 Table 2 3 Primers used for electrophoretic mobility shift assay s (EMSA s ) and DNase I footprint assays Oligonucleotide Name Oligonucleotide Sequence (5' 3') Pos b Purpose Mod c (5') E1 _Rv TGTTGC ATGTTCCGTAATCG +122* EMSA E2 _Fw TTGGCATGGGTTTTTAGCTC 176 EMSA Biotin E3 _Rv TGTGATGAAACTGTAGAAATCGTC +33* DNase I footprint VIC E7 _Rv TGTGATGAAACTGTAGAAATCGTC +33* EMSA E4 _Fw TTCCCAGGGTTTGGTAATCA 400 EMSA Biotin E6 Rv CCCATGCCAACCAGTACCATG AGACGAA 167 EMSA D1 _Fw GGGTAGGTGCGTCAGTAACC 463 DNase I footprint FAM E8 _Fw GCCTTCAACGTTATTAAACATCATTG 312 EMSA Biotin E9 Rv TTAGTCGAAAGTTGAGTTGTTTGCA 40 EMSA E10 _Fw TCAGTTGCCCCCTTTATGAC +745* EMSA Biotin E11 _Rv CCATTCCCACACAATTTTCC +110 6 EMSA E12_Fw GCGTGCTACATCTGAGCGTA +1398* EMSA Biotin E13_ Rv CCAGAGCCTTTTGAAACCAA +1694* EMSA b Position c Modifica tion. The pos i tions indicated are relative to LVIS1989 translation start co don

PAGE 69

69 Table 2 4 Primers used to clone the genes for protein expression. # The pos i tions indicated are relative to respective genes translation start codons. The extra b ases added for cloning in p15TV L are shown in itali cs Oligonucleotide Name Oligonucleotide Sequence (5' 3') Pos ition LVIS0344_Fw ttgtatttccagggcat GTGAATTTTCGACAGTTAGAATATTTC +1 # LVIS0344_Rv caagcttcgtcatcatc AGTAACTGTCAATGAAGCGCTG +856 # LVIS0398_Fw ttgtatttccagggc ATGCTAGATAAACGATACGAAAC +1 # LVIS0398_Rv caagcttcgtcatcatc AGTTACCAGGTTGTCGTAAAG +886 # LVIS0806_Fw ttgtatttccagggc ATGAAAACGAAACAGGAAAGTATC +1 # LVIS0806_Rv caagcttcgtcatcatc AATTTAATTGGTTCCGAAGTTGTTTG +964 # LVIS0910_Fw ttgtatttccagggc ATGTCGCAGCGTGCAGTG +1 # LVIS0910_Rv caagcttcgtcatcatc AAAATTGATGAGTGTCAAAATACC +817 # LVIS1989_Fw ttgtatttccagggc ATGACTATCGACGATTTCTAC +1 LVIS1989_Rv caagcttcgtcatca TCAGTCCGTTAGATAATGAATGAAC +882* LVIS2088_Fw ttgtatttccagggc ATGCTACCCTTTGCTTATCG +1 # LVIS2088_Rv caagcttcgtcatcatc AGTTATTGCGGGGATGTTCC +907 # LVIS2204_Fw ttgtatttccagggc ATGAATACA AAAGATTTGGATTATTTC +1 # LVIS2204_Rv caagcttcgtcatcatc ATCCTAGCCGCAAACTCTCTC +886 #

PAGE 70

70 Table 2 5 Primers used to clone the genes for lacZ reporter assays and sequencing reactions Oligonucleotide Name Oligonucleotide Sequence (5' 3') Pos b Purpose Restriction Enzyme P3 Fw aaaaa ggatcc GTAATCATGATGGAACA 387 LVIS1988: LVIS198 9 cloning in pDG1663 ( Site I and II ) BamHI P4 Rv aaaaa aagctt GGGAATCCTCCAATAAAT +973 LVIS1988 : LVIS198 9 cloning in pDG1663 HindIII P5 Fw ttttt ggatcc ATAAGGATCATTTACCAT 135 LVIS1988 : LVIS198 9 cloning in p DG1663 (Site I) BamHI P6 _Rv ggccat agatcT CGTCGATAGTCATT GAAGAACCT +14 LVIS1988 : LVIS198 9 cloning in pLG103 BglII P7 _Fw ggccat gaattc TACTGGTTGGCATGGGTTTT 182 LVIS1988 : LVIS198 9 cloning in pLG103 (Site I) EcoRI P8 _Fw ggccat gaattc TTCCCAGGGTTTGGTAATCA 400 LVIS1988: LVIS198 9 cloning in pLG103 ( Site I an d II ) EcoRI P11 Fw ctctag agatct TCCCAGGGTTTGGTAATCATGATGG 399 LVIS1988 : LVIS198 9 cloning in pLG103 ( Site I and II ) BglII P12 Rv ggtccg gaattc AATCGTCGATAGTCATTGAAGAACC +16 LVIS1988 : LVIS198 9 cloning in pLG103 EcoRI P13 _Rv aaaaaa ccgcgg GGGAATCCTCC AATAAATG +973 LVIS1989 cloning in pAX01 SacII P14 _Fw gaaatg ggatcc ATGACTATCGACGATTTCTACAG +1 LVIS1989 cloning in pAX01 BamHI P15_ Rv CAGGTTATCTGTACCCGCCGGA +189 pDG1663 ectopic integration confirmation P16_ Fw TAACACTCAGTCCCGGTTCC + 5 90 pDG1663 ectopic integration confirmation P9 Fw AGCGCCATTCGCCATTCAGGCT +769 $ Sequencing P10 Rv CATAAGGGACTCCTCATTAAG +3 Sequenci n g b Position. The positions indicated are relative to LVIS1989 thrB translation start codon s $ lacZ and gusA start codons in pLG103. Extra nucleotides used are shown in small letters and restriction sites used for cloning are underlined.

PAGE 71

71 Table 2 6 Primers used for quantitative real time PCR (qRT PCR). b The positions indicated are relative to LVIS1989 # respective genes translation start codons. Name Sequence (5' 3') Pos ition b LVIS1986_RT_Fw GACACCCCCATTCAAA CAAT +133 # LVIS1986_RT_Rv AATCTGGGCCTTGGTGATCT +294 # LVIS1987_RT_Fw TTAAAGCGATGGCCGACTAC +164 # LVIS1987_RT_Rv AGCCCGCGCAATTAGATTAT +323 # LVIS1988_RT_Fw CGATGTAATGTGGACCGTGA +1227 # LVIS1988_RT_Rv CACCAACTTCGATGACATGC +1377 # LVIS1989_RT_Fw GGCGTGGT ACGATTCAGATT +269 # LVIS1989_RT_Rv TGACTTTGAACGTCGCGTAG. +458 # L1986.1987_ Rv AAGGTACTGGGTGCATTTGG 2104 L1986.1987_ Fw GTTACTGCCACCCGTGACC 2263* L1987.1988_ Rv TGAACGCGCGAAGTTTAAG 1533* L1987.1988_ Fw GTTTCAACGCCTGGCTTATC 1693* L1988.1989_ Rv TGTGAT GAAACTGTAGAAATCGTC +33* L1988.1989_ Fw GCTCGGCCAATACTTTTCGT 160* rpo D_Fw ATTCCCGTTCATATGGTGGA +640 # rpo D_Rv GAACCTTTTCCGTTG G CATA +769 #

PAGE 72

72 Table 2 7 Primers used for site directed mutagenesis. Oligonucleotide Name Oligonucleotide Primers (5' 3') Pos ition b 1989_P100A_Fw ATTCAGATTGGCAGTGTGGCCGTCATGGCTCAGTACGGT +280 1989_P100A_Rv ACCGTACTGAGCCATGACGGCCACACTGCCAATCTGAAT +318 1989_Q153A_Fw CTACGCGACGTTCAAAGTGCACAACTGAACCACTCACAG +439 1989_Q153A_Rv CTGTGAGTGGTTCAGTTGTGCACTTTGAACGTCGCGTAG +477 1989_V205A_Fw CTCAGTCCCGGTTCCGGTGCTTATGAACGAATCAGCGAG +595 1989_V205A_Rv CTCGCTGATTCGTTCATAAGCACCGGAACCGGGACTGAG +633 1989_ R148A_Fw TTTGATCTCGGTATTCTAGCCGACGTTCAAAGTCAACAA +424 1989_R148A_Rv TTGTTGACTTTGAACGTCGGCTAGAATACCGAGATCAAA +462 1989_E127A_Fw ATTAACTTTTCTTTGGCAGCATTAGAGGGGGCTGATCTC +361 1989_E127A_Rv GAGATCAGCCCCCTCTAATGCTGCCAAAGAAAAGTTAAT +399 1989_I229A_Fw CGTTTTTCCACACCGCATGCTGAAACACTGCTGGCAATG +667 1989_I229A_Rv CATTGCCAGCAGTGTTTCAGCATGCGGTGTGGAAAAACG +705 b The pos i tions indicated are relative to LVIS1989 translation start co don.

PAGE 73

73 Table 2 8 List of bioinformatics tools used. Bioinformatics tool Purpose Website References PHYRE KaeR structure modeling http://www.sbg.bio.ic.ac.uk/~phyre/ Kelley LA and Sternberg MJE, 2009 SWISS MODEL KaeR structure modeling http://swissmodel.expasy.org/workspace/ Benkert et al., 2011 PDB RCSB Identification of ligand bound homologous structure http://www.pdb.org/pdb/home/home.do Berman et al., 2000 PyMOL Structural alignment http://www.pymol.org/ Warren L. Delano, DeLano Scientific LLC, San Carlos, CA, USA ClustalW Sequence alignment http://www.ebi.ac.uk/To ols/msa/clustalw2/ Larkin et al., 2007 Ortholog neighborhood Comparative genomics http://img.jgi.doe.gov/ Mavromatis et al., 2009

PAGE 74

74 CHAPTER 3 LVIS1989 (KAER), A L YSR TYPE TRANSCRIPTI ONAL ACTIVATOR, UP REGULATES LVIS1986 LVIS1987 LVIS1988 A ND LVIS19 89 IN RESPONSE TO KAEMPFEROL Introduction Flavonoids are plant derived compounds that constitute a significant component of the human diet. They are believed to possess both anti carcinogenic and cardio protective prope rties (Selma et al ., 2009) Stu dies have revealed, however, that complex flavonoids are not absorbed by the gastrointestinal tract. They are instead broken down by gut microbiota into smaller compounds wi th higher biological activity (Spencer, 2003; Hein et al. 2008; Verzelloni et al. 2011) Some of the microorganisms capable of cleaving flavonoids to produce aliphatic organic acids include Eub oxidoreducens com monly found in the bovine rumen, and the human fecal microbes Eub. ramulus and Clostridium orbisc indens (Winter et al ., 1989; Krumholz and Bryant, 1986; Braune et al ., 2001) The degradation and transformation of th ese compounds by other beneficial members of the microbiota such as Lactobacillus however, have be en scarcely explored (Rodrguez et al. 2009) Lactobacillus species are widely used throughout the food industry, for both their fermentation and probiotic properties (Lebeer et al. 2008; Gobbetti et al. 2010) Many species of Lactobacillus have been isolated from flavonoid rich environments. L. brevis is frequently found in decaying plants and fruit fermentations ( Kandler and weiss, 1986 ) where exposure to complex flavonoids and their organic acid constituents is inevitab le. Consequently, I hypothesized that L. brevis may have developed the ability to sense and respond to these types of molecules, as a result of their continued exposure to them. More specifically, we are interested in the flavonoids present in the food int ake,

PAGE 75

75 and their role as modifiers of signal pathways in beneficial microbes that may in turn affect their interaction with the host. Recently, several microbial transcription factors with the ability to mediate transcriptional activation in response to flav onoid exposure have been identified. These transcription factors have been discovered in different families, including TetR (LmrA, YxaF and TtgR; Hirooka et al. 2007 ; Teran et.al., 2006) MarR (YetL; Hirooka et al. 2009), LysR (NodD; (Rossen et al. 1985) and most recently, LuxR (RhlR; Vandeputte et al ., 2010) In most cases, they are involved in the regulat ion of genes due to the antimicrobial activity of flavonoids The mechanisms through which LTTRs modulate gene expression are diverse. In Rhizobium leguminosarum NodD, a LysR type transcriptional regulator (LTTR) activates the expression of nodulation gene s in response to the flavonoid narin genin (Rossen et al ., 1985) One of the most intriguing aspects of LTTR members, however, is their ability to mediate transcriptional activation through DNA bending and differential interactions with the RNA polymerase. This type of me chanism has been documented in several LTTR members including CrgA, NodD, ArgP, BenM and CatM; however, they are all unique in the outcomes (Zhou et al 2010; Craven et al ., 2009; Chen et al. 2005; Sainsbury et al. 2009) For example in R. leguminosarum (Ch en et al. 2005), in the absence of naringenin, NodD, binds to the nodA promoter region as a tetramer, promoting the DNA to bend. The addition of naringenin acted to sharpen this bend, inducing the expression of nodA and related genes; (Chen et al ., 2005) The present study was undertaken to identify and characterize a new LTTR regulator KaeR (LVIS1989) in L. brevis, capable of mediating a positive response to the

PAGE 76

76 flavonoi d kaempferol. It was determined that k aeR ( LVIS1989 ) is also positively autoregulated by the presence of the ligand. Result s The LysR Member, KaeR (LVIS1989) Interacts With Flavonoids In V itro A fluorescence based small molecule screening assay was used to identify tran scription factors that bind flavonoids in L brevis This technique is based upon a principle that when a ligand binds to a protein there will be a shift in its melting temperature. The SYPRO orange dye (Invitrogen San Diego, CA) was used for these studies which changes its emission properties with the extent of protein unfolding. The more stable the protein the more will be the shift in its melting temperature after ligand addition (Figure 3 1). The flavonoids exhibiting at least 2 0 C diff erence in the melting temperature w ere considered as a positive hit. The genome of L. brevis was searched for LysR type transcription regulators that are classified within the COG0583 ( C luster of O rthologous G enes). It was determined that L. brevis encodes for seven proteins classified within COG0583: LVIS0344, LVIS0398, LVIS0806, LVIS0910, LVIS1989, LVIS2088 and LVIS2204 Figure 3 2 shows the genomic environment of L. brevis all LTTRs All genes were cloned and the recombinant proteins were purified with the exception of LVIS0344 and LVIS0910, due to their poor solubility under the conditions tested. To establish the midtransition temperature (Tm), purified proteins for LVIS0398, LVIS0806, LVIS1989, LVIS2088 and LVIS2204 were subjected to thermal denaturat ion. The effect of flavonoids on the thermal stability of eac Apigenin, n aringenin q uercetin a cacetin l uteolin and c hrysin had no effect on any of the proteins tested while, myricetin, kaempfe rol and h esperi tin increased th e thermal

PAGE 77

77 stability of LVIS1989 (Table 3 1). Although m yricetin, kaempferol and quercetin are flavon 3 ols that share a similar chemical scaffold confirmation assays revealed that only myricetin and kaempferol bind to LVIS1989 in a dose dependent manner ( 1 mM) Quer cetin was not found to have stabilization effect s on LVIS 1989 (Table 3 1) Flavonoids are Involved i n the U p r egulation o f LVIS1986 LVIS1987 LVIS1988 a nd LVIS1989 mRNAs To determine the in vivo effect of these chemicals on L. brevis t he genomic environment of LVIS1989 was analyzed to uncover putative ge nes regulated by this protein. In general, LTTR members are encoded divergently from the genes under their control. LVIS1989 is encoded on the plus strand, and shares high sequence ident ity with Oenococcus oeni PSU 1 (47% identity; GI : 116491191 ), L. plantarum WCFSI (41% identity, GI : 2837 9389 ) and L. rhamnosus (37% identity, GI : 258509654 ). None of the genes have been previously characterized. Upstream of LVIS1989 on the minus strand t hree genes are encoded in an LVIS1988 and LVIS1987 have high sequence identity with 3 polyprenyl 4 hydroxybenzoate decarboxylases ( ubiD and ubiX respectively). The third gene in the predicted operon, LVIS1986 encodes a conserved hypothetical protein compo sed of 136 amino acids. Interestingly, this operon structure is only conserved in O. oeni PSU 1 ( NC_008528 ) (Fig. 3 3 A) where in Pediococcus pentosaceous ATCC 25745 (NC_008525), L. gasseri JV V03 (NZ_ACG01000006) and L. sakei 23K (NC_007576), the genes homologous to LVIS1986, LVIS1987, LVIS1988 and LVIS 1989 may compose a single transcriptional unit. In contrast, partial associations are found in L. plantarum WCFSI (NC_004567) and L. rhamnosus GG ( NC_013198 ) Downstream of LVIS1989 in the plus strain, LVIS1990 encodes for an N

PAGE 78

78 formylmethionyl tRNA deformylase ( def 2 ). Comparative genomics performed using the Ortholog Neighborhood Viewer at the JGI I ntegrated M icrobial G enomes website ( http://img.jgi.doe.gov/ ) revealed that def2 is not phylogenetically link ed to LVIS1986_1987_1988_1989 It was then tested if LVIS1986 _1987_198 8 comprise d a single transcriptional unit. qRT P CR experiments were performed u sing primers designed around the intergenic regions of genes LVIS1988 LVIS1987 and LVIS1986 (Table 2 6 in dicated as L1 986. 1987 Fw and Rv L1987. 1988 Fw and Rv L1988. L1989 Fw and Rv ). The results suggested that if LVIS1986 _1987_198 8 indeed form ed a single transcriptional unit. Based on these results the expression levels of LVIS1986, LVIS1987, LVIS1988 and L VIS 1989 were determined in the presence or absence of myricetin, hesperitin and kaempferol. L. brevis cells were grown in MRS broth with 10 M of each flavonoid, then collected in both the early exponential phase (OD 600 = 0.3) and late stationary phase (OD 6 00 = 1.5). The mRNA levels were determined by qRT PCR (Figure 3 3 B and C). In exponential phase, kaempferol increased the expression of all four genes by 2.5 5 fold (Figure 3 3 B) while myricetin was only found to induce the expression of LVIS1989 (by 4 fol d). Hesperi tin was found to be a weak inducer of LVIS1986 (2 fold change), but had no effect on the other genes measured (data not shown). Interestingly, LVIS1986, LVIS1987, and LVIS1988 were induced in stationary phase cells grown in the presence of kaemp ferol (~2.5 fold ) or myricetin (~2 fold) (Fig. 3 3 C). These results indicate that both flavonoids have the potential to induce gene expression, though the uptake or binding capabilities of kaempferol may occur with higher affinity. Based on these results, LVIS1989 was given the na me KaeR, for kaempferol responsive protein.

PAGE 79

79 Identification o f KaeR Binding R egion Since most of the LTTRs are divergently transcribed from the promoter regulated by them (Schell, 1993, Madd ocks and Oyston, 2008) the putative promoter region of KaeR F k ae1 was tested using EMSA assays P utative promoter region s found downstream of kaeR were also tested ( P LVIS1990 and P LVIS199 1 ) Under standard conditions, KaeR interacted weakly with F k ae 1 (Fi gure 3 4 A and 3 6C ) but not with P LVIS1990 P LVIS1991 (data not shown ). A variety of primer combinations was utilized to obtain DNA fragments of various lengths to determine the region of binding that would result in stable DNA : KaeR complexes. The best re sults were obtained using fragment F kae2 which comprised the intergenic region between LVIS1988 and LVIS1989 as well as the first 280 nucleotides of LVIS1988 EMSA analysis of F kae2 and KaeR, revealed their binding to be concentration dependent; this was made evident by a correlated increase of high molecular weight oligomers, with increas ing concentrations of KaeR (Figure 3 4 B). Using KaeR at 100 nM F kae 2 was observed to form only a small complex with the protein. With 400 nM KaeR however, a larger, slo wer migrating complex was obtained, suggesting that KaeR oligomerizes cooperatively with DNA. The multiple intermediate complexes observed when using 250 nM KaeR (evidenced as a smear), suggest that in vitro the complexes are unstable. KaeR Interacts With Two Binding Sites Separated b y 280 bp DN a se I footprint assay s revealed the presence of two binding sites separated by 280 bp. Binding site I protected the 41 nucleotide sequence from +2 to 3 9 (from the kaeR translation start codon Figure 3 5 A ) while b inding site II protected a 4 0 n ucleotide sequence, from 314 to 353 (Figure 3 5 B ) KaeR binding site II is located

PAGE 80

80 upstream from binding site I, and lies within the encoding sequence for LVIS1988 O ne imperfect inverted repeat c GATT t N5 t AATC c was ident ified from 337 to 353 (Figure 3 5 C). Previous studies have reported LTTR binding at two distinct binding sites namely the A ctivator B inding S ite (ABS) and the R epressor B inding S ite (RBS). Within the RBS, it has been proposed that a palindromic sequence (T N11 A) is involved with gene activation or repression (Wilson et al ., 1995) Binding site I contains an imperfect inverted repeat (TTATgCCtaaatGGaATAA), and overlaps a putative 10 sequence in the promoter regio n of kaeR (Figure 3 5 C). Of note is the presence of the conserved cytosine and guanine (CC N5 GG) which may mediate contact with KaeR, as shown for CatR (Parsek et al. 1992) and TrpI (Chang and Crawford, 1991 ; Gao and Gussin, 1991) The Two Protected Regions are Required f or the Formation o f Higher Order Complexes In V itro T o determine if the two protected sequences ident ified by DNase footprint are require d for KaeR binding, multiple primer combinations were used to generate ~200 bp long probes containing binding site I ( 1 76 to + 33, F kae1 ) or binding site II ( 400 to 1 67 F kae 3 ) (Figure 3 6 ) Their binding was then comp ared to a probe containing both protected regions ( 400 to + 33, F kae 2 ) (Figure 3 6 A) A very weak modification in the electrophoretic mobility was found when using site I ( F kae1 Figure 3 6 C), while n o significant increase in complex formation was observed when site II was considered ( F kae3 ) ( Figure 3 6 D) Th e use of a longer fragment ( 176 to +122, F kae5 ) containing the complete intergenic region (but only binding site I) showed an increase in the stability of the K aeR DNA complex (Figure 3 6 B). To determi ne if additional binding sequences were present in that region, a fragment within the intergenic region, ending just outside

PAGE 81

81 site I and site II, was amplified ( 312 to 40 F kae 4 ). KaeR binding was not observed in the presence or absence of the ligand (dat a not shown). These results indicate that binding site I may be the primary binding site, while binding site II may only be required to stabilize the KaeR oligomer on DNA. KaeR Activity is Modulated b y Kaempferol In V itro The effect of kaempferol on the a bility of KaeR to bind DNA was assessed by EMSA. For this experiment, 20 M kaempferol was added to increasing concentrations of KaeR. Modifications in the mobility of the KaeR: F kae 2 complex were observed. When kaempferol was present in excess of 500 fold, the KaeR: F kae 2 complex was able to form a s table intermediate complex (Figure 3 6 A). At lower ratios however (400 fold excess), kaempferol did not affect the migration of the complex. Unfortunately, higher concentrations of the kaempferol could not be te sted due to its poor solubility in buffer. The differences observed in the complex migration, may result from variations in the oligomeric state of KaeR, induced by interactions with the ligand. To explore this possibility, the oligomeric state of KaeR was assessed by gel filtration experiments. The majority of KaeR eluted as a monomer, (apparent MW = 40 kD) however the observed sizes were slightly larger than the expected monomeric size of 34 kDa. Additionally, a small percentage of tetramer like species ( apparent MW=160 kDa) was detected, and a small peak with an estimated MW of 5 kDa was also observed (Fig. 3 7 A). No extra bands, however, were obtained on SDS PAGE gels (Figure 3 7 B). An increase in tetramer like species was observed following the addition of kaempferol or myricetin (10 The presence of higher oligomeric forms (>300 kDa) was also detected, evidenced by the increased concentrations observed in the void vol ume. Marginal increment of high

PAGE 82

82 order oligomers in the presence of ligands has previously been reported for AtzR, although the main p roduct was the tetramer ic form in all cases (Porra et al ., 2007) Here, the binding of kaempfero l induced a major shift from the monomer to the tetramer like species of KaeR (Figure 3 7) Taken together, the increased stability of tetramers in the presence of kaempferol, correlate s with the variations observed in the F kae2 :KaeR complex migration The compact state of the tetramer may have mechanistic implications, such as the DNA bending mechanism previously shown for other LTTR proteins (Muraoka et al ., 2003; Zhou et al ., 2010; Porra et al ., 2007; Chen et al ., 2005; Sainsbury et al ., 2009) Based on these results, additional EMSA analysis was carried out to determine if the binding of KaeR to site I ( F kae1 and F kae5 ) or site II ( F kae3 ), could be improved by the addition of the ligand. As shown in Fig ure 3 6 C, at low protein concentration (250 nM) the complex F kae1 :KaeR migrat ion is very weak and kaempferol marginally modified the migration. The addition of kaempferol to the F kae3 :KaeR or to the F kae5 :KaeR complex had no effect on th e stability of the complex (F igure 3 6 B and D ). These results indicate that kaempferol induced variations of the F kae2 :KaeR complex, depend on the presence of both binding sites. In Vivo n LVIS1988 E xpression To gain functional insight on the Kae R binding sites, transcriptional fusions to the lacZ reporter gene were constructed and the regulation studies were conducted using B. subtilis as a surrogate host. Of note, B. subtilis M168 does not contain genes with high similarity to the genes under st udy. To determine if each binding site was necessary for expression of the LVIS1988 gene, the promoter region of LVIS1988 was fused to the lacZ gene, using the

PAGE 83

83 integrative plasmid pDG1663 (Gurout Fleury et al ., 1996) The complete kaeR gene sequence was cloned in cis to maintain the same genomic context found in L. brevis (Figure 3 8 ). Strain SP01 contains both KaeR binding sites, whil e strain SP02 contains only binding site I. A higher basal expression level was observed in SP01 ( 54 0.9 Miller Units) when compared to SP02 (17 2.7 Miller units). Interestingly, induction was observed in both transcriptional fusions when kaempferol, o r the structurally related m yricetin, was added to the medium In the presence of kaempferol, induction was increased by 2.5 fold in strain SP02, while a 3.4 fold increase was observed in strain SP01. These results indicate that although binding site II is not essential for induction of LVIS1988 expression levels are enhanced when it is present. T o determine if KaeR is required for expression of LVIS1988 galactosidase activities of two strains carrying the LVIS1988 kaeR intergenic region (containing binding sites I and II ) in absence (strain SP07) or presence of kaeR (strain SP06), w ere compared The kaeR gene was cloned in trans as a chromosomal insert ion at the lacA locus and expressed from a xylose inducible promoter ( strain SP06). Similar low expression levels were obtained in SP07 (17 5.0 Miller units) and SP06 (13 0.9 Miller units). The addition of kaempferol resulted in a 2 galactosidase activity in SP0 6 (26 0.1 Miller units) while no changes were observed in SP0 7 Although expression of LVIS1988 was induced in SP0 6 with kaeR positioned in trans the activity values were lower than th ose obtained when kaeR was expressed in cis (SP01, 183 1.6 Miller units). These results indicate that both the location and expression levels of KaeR are important for optimal induction of the LVIS1988 gene.

PAGE 84

84 KaeR i s Positively A utoregulated To determine if KaeR mediates its own regulation, the same fragment used in SP07 (containing KaeR binding site II and the intergenic region between LVIS1988 and LVIS1989 ) was cloned in the opposite orientation in pLG103 (Belitsky and Sonenshein, 2002) and integrated into the amyE locus (strain SP03). The resulting basal expression level was higher (48 2.2 Miller units) than that observed for LVIS1988 (SP07, 17 5.0 Miller units) (Figure 3 8 ). The expression of the kaeR promoter was then assessed when kaeR was cloned in trans (as a ch romosomal insertion at the lacA locus, strain SP04). In the SP04 strain, basal level expression of kaeR did not modify expression from the P kaeR promoter (44 3 Miller units). Furthermore, expression levels were not significantly affected by t he addition of 0.5 % xylose galactosidase activity was observed when only binding site I was present (strain SP05, Figure 3 8 ). Expression levels of the kaeR promoter were assessed in both the presence and absence of kaempferol or myricetin using strains SP04 and SP0 5. In both strains, the expression of the reporter gene was increased from 1.9 to 2.9 fold, following the addition of kaempferol, although the higher levels were seen only in SP05, where only binding site I was present. A similar ratio was obtained usin g myr i cetin as the inducer (Figure 3 8 ). These results indicate that activation of kaeR transcription is dependent on the presence of KaeR and the in ducer molecule. Discussion and C onclusion In terrestrial environments, plant derived flavonoids serve as importa nt signaling molecules for microbial gene expression. Upon interaction of these compounds with specific microorganisms such as Rhizobium, plant nodulation is induced (Brencic and Winans, 2005) How ever, their effect s on the regulatory networks of other

PAGE 85

85 microorganisms commonly isolated from environments that are rich in these plant d erived compounds, like Lactobacillus are largely unknown. Though flavonoids represent a significant component of the human diet, the specific effect of flavonoids and their derivat iv es within the host signal transduction pathways, are just emerging. We hy pothesized that flavonoids may serve as signal molecules that are indirectly involved with the modulation of probiotic traits. I n vitro screening was conducted against a small library of flavonoids, using purified transcription factors from the L TT R family KaeR was successfully identified as a transcriptional regulator that binds kaempferol as an effector molecule. Since this is the first study at the molecular level to identify a Lactobacillus specie s responsive to flavonoids, this work was directed towar ds understanding the mechanisms of transcription al regulation by this new member of the LysR family. The LTTR family is one of the largest in prokaryotes (Pareja et al ., 2006) yet the mechanisms behind their regulatory actions are largely unknown. Members of the LTTR family regulate transcription of a diverse population of genes, including those involved with antibiotic resistance, spor ulation, virulence, DNA replication and nodulation (Maddocks and Oyston, 2008) While LTTR members are abundant in most bacterial genomes only seven members are kn own to be encoded in L. brevis (5 % of the transcription factors). These proteins share low sequence identity and most genes under their regulation have unknown functions. KaeR shows the typical genomic organization found in transcription factors that belon g to the LTTR family. It is encoded divergently of three genes : LVIS1988, LVIS1987 and LVIS1986 The first two genes ( LVIS1988 and LVIS1987 ) have high sequence identity to 3 polyprenyl 4

PAGE 86

86 hydroxybenzoate decarboxylase while LVIS1986 has no homologs with kn own function. These genes, including kaeR were upregulated by the addition of kaempferol to the growth media. Although the biochemistry of these genes is unknown, they may be involved in kaempferol modification or degradation. Several mechanisms of LTTR mediated gene regulation have previously been described (Schell, 1993; Maddocks and Oyston, 2008) Of these, the large majority involve transcriptional activation of the regulated genes, while the LTTR is negatively autoregulated. Furthermore, the mode of regulation is most frequently determined by the location and affinity of the DNA binding sequences. Based on the results obtained in vivo with LacZ fusions, KaeR is positively autoregulated. Very few examples have p reviously been reported with this mode of regulation. YtxR from Yersinia enterocolitica (Axler DiPerte et al ., 2006) controls the expression of the ytxAB g enes potentially involved in the producti on of an enterotoxin. Although y txR is also positively autoregulated, it has been proposed that a small molecule might not be required since increased expression of YtxR i s sufficient to activate transcription (Axl er DiPerte et al ., 2006). These results indicate that the mechanism of KaeR is different from that of YtxR in the sense that KaeR is positively autoregulated upon interaction with the inducer molecule. The operon structure of KaeR is commonly found in othe r LTTR members that are negatively autoregulated. Such is the case with NodD, the only other LysR member previously studied for regulation by flavonoids (Peters et al. 1986; Redmond et al. 1986; Firmin et al. 1986 ; Rossen et al ., 1985) Interestingly, similarities between KaeR and NodD also include the presence of overlapping promoters, both proteins are

PAGE 87

87 divergently encoded by the genes they regulate, and each is capable of responding to flavonoids. KaeR, however, does not share sequence identity to NodD, and the mechanism of regulation seems to differ significantly between the two proteins. Previous studies have shown NodD is expressed constitutively in Rhizobium leguminosarum, and it is negatively autoregulated b y flavonoids (Rossen et al 1985) According to the classical model of transcriptional activation, LTTRs usually bind DNA as oligomers (tetramers in general) in absence RBS while two subunits bind the ABS, provoking a sharp bend in the DNA (Porrua et al ., 2007). Subsequent binding of cyanuric acid would relax the DNA bend, facilitating the interaction with RNAP, and thus leading the enhanced expression from the promoter. Here I showed that KaeR binds two sequences. Site I is located 39 to +2 bp upstream of kaeR ( LVIS1989 ) while site II is located within LVIS1988 314 bp to 353 bp upstream of site I. In vivo I observed that while both sites are required for optimal expression, induction by kaempferol can be attained by the presence of site I alone. There are few previously documented studies where LTTR b inding sites were located within the up regulated genes. LadA from Myxococcus xanthus binds in the dev operon bet ween +319 and +376 (Viswanathan et al. 2007b ) Similarly, MetR from Salmonella typhimurium binds in metF from +62 to +85 (Cowan et al. 1993) MetR binding to the downstream sequenc es also requires binding to the 95 to 50 sequences. In both LadA and MetR, binding results in gene activation. It has been proposed that MetR could act as an anti repressor to destabilize MetJ binding though steric hindrance by either directly contacting the RNA polymerase or through DNA bending (Cowan et al ., 1993).

PAGE 88

88 A similar hypothesis was formulated for LadA based on t he fact that negative regulatory elements were found between +219 and +280 in the dev operon (Viswanathan et al. 2007a ). Although I hav e not determined the direct binding of another transcription factor to the F kae2 fragment, it is possible that KaeR act through a similar mechanism of DNA bending followed by activation of gene expression.

PAGE 89

89 Table 3 1. Stabilization effect of ligand bind ing. The thermal stabilization of 10 M KaeR using 60 M ligand was evaluated by fluorometry. Chemical Structure 1 (C) Myricetin 23.2 Hesperitin 2.6 Kaempferol 2.5 Quercetin 0.2 Apigenin 0.2 Naringenine 0 Acacetin 0.2 Luteolin 0 Chrysin 0 1 Delta temperature was calculated as the difference in the transition temperature between the protein in the absence and presence of given ligand.

PAGE 90

90 Figure 3 1. Fluorescence based ligand screening assay. The melting curve for KaeR native protein is shown by the red line whereas the melting curve of the KaeR with the ligand (myricetin) is indicated by the green line. The vertical line represents the respective midtransition temperatures. Tm t ransition temperature of unfolding in the absence of ligand, T 0 m t ransition temperature of unfolding in the presence of ligand. Hits were determined by formula T 0 m Tm = > 2 0 C.

PAGE 91

91 Figure 3 2. Genomic environment of the L. brevis genes encoding LysR type transcriptional regulators. The genes encoding LTTRs are shown in black. The numbers represent the number of bp in the predicted intergenic regio ns.

PAGE 92

92 Figure 3 3. Identification of the genes regulated by LVIS1989 (KaeR). (A) The genomic environment of LVIS1989 was extracted and compared to the closest ortholog neighborhood regions. (B and C) Effect of addition of flavonoids on mRNA levels of gen es encoded divergently to LVIS1989 L. brevis cells were grown in MRS broth in absence (control, white bars) and presence of 1 myricetin (grey bars) or kaempferol (black bars) and cells were collected during exponential phase (B) or stationary phase (C ). RNA extractions and qRT Materials and methods amplification values obtained were corrected with those obtained using rpoD as internal control. The values shown are relative to those observed for the same gene in cells grown in absence of flavonoids.

PAGE 93

93 Figure 3 4. Identification of the KaeR binding region. (A) To determine the DNA region for KaeR binding various DNA fragments were obtained by combining different primers in the LVIS1988 LVIS1989 intergenic re gion. EMSA results are summarized in the inset Table. (+) Positive binding of KaeR using 250 nM of pure protein; ( ) Negative binding using up to 500 nM of purified KaeR protein. (B) EMSA assays performed using increasing concentrations of KaeR (100 500 nM as indicated) with fragment F kae2

PAGE 94

94 Figure 3 5. Identification of KaeR binding sites. DNase I footprinting assays identified (A) a protected site I located upstream KaeR (residues +2 to 39, from the translation start point of KaeR); and (B) protecte d site II located within LVIS1988 (residues 314 to 353, from the translation start point of k aeR ). The electropherogram shows a fragment of the digested probe in absence (black) or presence (white) of KaeR highlighting the protected region. The reaction a probe generated by using the primers D1 _Fw and E3 _Rv shown in Table 2 4 The nucleotide sequence protected by KaeR is shown in the bottom of the panels. (C) Analysis of the intergenic re gion between the divergently transcribed genes LVIS1988 and LVIS1989 The protected sites I and II are boxed. Predicted Shine Dalgarno sequence (SD) and 10 and 35 of the P KaeR is indicated.

PAGE 95

95 Figure 3 5. Continued

PAGE 96

96 Figure 3 6. Effect of k aem pferol on KaeR binding to the different binding sites. EMSA assays were performed using (A) F kae2 (containing binding site I and II), (B) F kae5 (containing site I), (C) F kae1 (containing site I) and (D) F kae3 (containing site II) fragments. The concentrati The presence or absence of each key component in the reaction mix is indicated on top of each panel. The full binding conditions are described Materials and methods

PAGE 97

97 Figure 3 7. (A) Gel filtration analysis of KaeR oligomerization in presence of kaempferol. KaeR preincubated in absence (continuous line) or presence of Materials and methods PAGE showing the homogeneity of KaeR after purification by nickel affinity chromatography.

PAGE 98

98 Figure 3 8 In vivo using B.subtilis as a surrogate strain. For each strain used, a graphical representation i s made that indicate the presence of site I or II, the location of kaeR (in cis or integrated at the lac A locus) and the orientation of the fusion. galactosidase assays were Materials and methods NA not applicable, ND n ot determined.

PAGE 99

99 CHAPTER 4 IDENTIFICATION OF KA ER AMINO ACIDS IN VOLVED IN LIGAND INT ERACTION Introduction The o bjective of this study was to identify the KaeR amino acids involved in the kaempferol interacti on and oligomerization. CbnR from Ralstonia eutropha N H9 was the first full length LTT R structure crystallized in 2003 (Muraoka et al ., 2003) Though LTTRs are the most abundant family in prokaryotes, only four LTTR structures have been determined namely, CbnR (Muraoka et al ., 2003) C rgA (Sainsbury et al. 2009), ArgP (Zhou et al ., 2010) and TsaR (Monferrer et al. 2010) It is thought that the low solubility of these proteins and the high flexibility of the helix turn helix DBDs under crystallization conditions are the reasons for the low success obtained with this family of proteins. No effector has been co crystallized with proteins either. More protein structures are available for effector binding dom ains (EBDs ) of LTTRs S ome examples include OxyR (Choi et al. 2001) CysB (Tyrrell et al. 1 997) BenM (Craven et al ., 2009) and CbI (Stec et al. 2006) Based upon ligand bound EBD crystal structures it became evident that the C terminal residues are involved in ligand interaction. This was also confirmed by genetic studies a s assessed in CbI (Stec et al., 2006) BenM (Craven et al ., 20 09) OxyR (Choi et al ., 2001) CysB (Lochowska et al 2001) and ArgP (Zhou et al ., 2010) M utation in the C terminal domain residues caused altered transcriptional activity from the res pective promoters Also, the genetic analysis and bioinformatics studies suggest ed that the N terminal 60 70 residues are involved in DNA binding (Schell, 1993; Lochowska et al ., 2001) As described previously t he DNA binding helix turn helix spans from the 23 to 43 amino acid residues. The C terminal domain is divided into two

PAGE 100

100 sub domains regulatory domain I (RD I) and regulatory domain II (RD II) (Schell, 1993; Tyrrell et al ., 1997) The co inducer binding cleft is present between these two domains. It has also been shown that the last 60 amino acids in the C terminal of NahR are necessary for optimal DNA interaction (Schell et al ., 1990) Similarly in the ArgP crystal structure, the DBD inte raction with the extreme C terminal residues of the effector binding domains was observed supporting the possible role of the C terminal residues in DNA interaction (Zhou et al ., 2010) In CbnR two forms of the pro tein were observed, a compact form and another extend ed form. The CbnR dimers a re comprised of the two subunits, a compact form sub unit and extended form subunit that interact through the linker helices (Figure 4 1). In the crystal structure, CbnR was dime r of dimers in which the DBDs were aligned along one face of the tetramer whereas the regulatory domains were located on the opposite side. The regulatory domains in the dimers were arranged in an anti parallel fashion. The re gulatory domains face had a 50 cleft to accommodate a ligand. S imilar tetrameric arrangement wa s observed in the case of ArgP (Figure 4 2). In addition to the two forms of the monomers with in a dimer, two forms of dimers were observed in ArgP. The two dimers differed in the dimerizat ion domains, one dimerized through DNA binding domains whereas another through the regulatory domains ( Zhou et al ., 2010 ) (Figure 4 3). The TsaR structure confirmed that the two types of the monomers might be a comm on theme in the LTTR family. The dimers were formed from a compact and an extended s ubunits of the protein which dimeriz e d through the antiparallel linker helices. H owever, the tetrameric TsaR structure was different from that of CbnR and ArgP. I n the TsaR tetramer the regulatory domains were arranged in antiparellel

PAGE 101

101 fashion but the DBDs were arranged diagonally. The TsaR tetramer had a flat square shape rather than a diamond shape which was evident in CbnR and ArgP tetramers Based upon the flexible regul atory domain and the lack of extensive interface contacts among C terminal domains it was suggested that the structure represented the active in contrast to the found in CbnR (Monferrer et al. 2010) Thus, most of the crystallized LTTR structures suggest ed that the dimers can be composed of open and closed subunit s whereas the DBD s and RDs a re arranged to favor the classical mo del of gene regulation by LTT Rs However, another protein CrgA is the only exception to this rule It is ring shaped where only monomers is found (Sainsbury et al ., 2009) Since the structure for KaeR has not been solved a bioinformatics approach was used to c onstruct a structural model The EBD of the modeled KaeR structure was aligned to other protein s crystallized with a lig an d and putative residues involved in flavonoid interaction were identified. The amino acid residues were modified to alanine by site di rected mutagenesis. The mutant proteins were expressed in E. coli and purified by using Ni affinity chromatography as described in materials and methods The purified proteins were used for size exclusion chromatography and EMSA studies to assess the effec t of t he mutations on oligomerization, DNA interaction and in the response to flavonoids Results KaeR Structure M odeling The protein structure prediction was performed by using the web interface programs SWISS MODEL work space (Benkert et al ., 2011) and P HYRE

PAGE 102

102 (www.sbg.bio.ic.ac.uk/ phyre, Protein Homology Analogy Recognition Engine, Imperial College, London) (Kelley, 2009) (Table 4 1 ). The search in PHYRE program was able to identify a template protein, PDB 1IXC. This prot ein c orresponds to full length s tructure of CbnR from Ralstonia eutropha NH9 (Muraoka et al ., 2003) KaeR had a 15 % sequence identity to CbnR. The predicted structure was confirmed by using another program, SWISS MODEL workspace (automated mode query) which has a different al go rithm to predict the structure. In PHYRE the C termi n al domains were also modeled. The program identified CynR (PDB # 3HFU) as a EBD structure with the highest probability an d sequence identity ( 100 % and 23 % respectively). Table 4 1 summariz es the modeling results obtained. In the KaeR modeled structure the DBD is compr ised of 3 88 residues whereas 89 293 residues are part of C terminal regulatory domains. A predicted wHTH domain is connected t o the regulatory domain through linker helix formed from 60 to 88 amino acids. The regulatory domain I (RD I) is formed by amino acids 89 to 167 and 268 to 293 whereas regulatory domain II (RD II) is formed by residues 168 to 267. The regulatory domain I i s comprised of 5 beta strands and 4 alpha helices and regulatory domain II is comprised of 3 bet a strands and 5 alpha helices (F igure 4 4). To compare the two models, the respective PDB files were downloaded and aligned using PyMOL. The two models were hig hly similar (Figur e 4 5 A ). Although KaeR was modeled to the CbnR full length protein, the structure of CynR had a small molecule in the predicted binding pocket. B ased o n these results f urther analysis was carried out using the CynR (PDB # 3HFU ) structure as the template.

PAGE 103

103 Identificat ion of Residues that Modulate KaeR A ctivity CynR from E. coli is involved in cellular response to azide (Singer et al., unpublished ). Although the molecular structure of CynR is publically available in the RCSB server the anal ysis of the structure of CynR has not been published yet. I performed the analysis on the CynR ligand binding pocket. As expected the azide molecule is located in a cleft formed between regulatory domain I and II (Figure 4 5 C ). Within the same cleft anoth er small molecule, ethanediol was found. This compound is commonly used as a protein stabilizer during the crystallization conditions. Although, it is n ot expected that ethanediol has a biological role in CynR, it may be required to stabilize the protein.A structural alignment between KaeR and CynR was performed (Figure 4 5A). The ligand binding site overlapped well. In contrast to CynR, where two binding sites were observed, a large continuo us binding site was present in KaeR (Figure 4 5B) These differenc es may be due to a bigger ligand ( i.e. kaempferol ) can be accommodated in the KaeR cavity. To identify the residues in KaeR that mediate binding with kaempferol, the residues involved in ligand binding in CynR were analyzed The ligand explorer tool at the RCSB was used. Figure 4 6 shows the residues involved in azide binding. T hreonine 100 and 200 are responsible for hydrogen bonds with the ligand. T200 is the major residue responsible for the hydrogen contacts with the N1, N2 and N3 in a zide. T100 forms o ne hydrogen bond through a water molecule (bridged hydrogen bond). In the structural alignment of CynR and KaeR the CynR T 100 and T 200 correspond to the P100 and V 205 in KaeR. The additional residue s R148 and Q153 were identified within 4 radius of azide in KaeR. Ethanediol interacted with the P99, E 126 and I224 residues in CynR In KaeR these residues co rrespond to P100, E127 and I229 (Figure 4 7).

PAGE 104

104 Next I used site directed mutagenesis to determine if the residues identified in the puta tive ligand binding pocket of KaeR are involved in the modulation of KaeR activity. To this end, residues P100, E127, R148, Q153, V205 and I229 (Figure 4 8) were changed to alanine. The effects of mutations were assessed on the DNA binding capabilities as well as on the oligomeric form of the protein. Effe cts of Mutations on the DNA Binding P roperties of KaeR As described earlier (chapter 3), KaeR binds two sequences within the pr omoter region of LVIS1988 / KaeR In vitro using EMSA assays, it was observe d that KaeR binding to F kae2 results in an intermediate complex at low protein concentration ( 250 nM ) (complex 1 ) and a large complex (complex 2) at concentrations higher than 400 nM. The effect s of mutations on KaeR w ere first assessed on the ability of t he proteins to bind to the DNA (Figure 4 9 ). At protein concentrations of 100 nM the P100A, V205A, Q153A E127A and I229A mutants showed a weak DNA binding while no binding was observed for the wild type KaeR at this concentration. All m utants te sted were able to form complex 1 at concentration similar to the wild type protein. It was observed that mutations on P100A and Q153A dramatically affected the formation of complex 2. Mutations on V205A, E127A and I 229A resulted in a formation of weak complex 2. The mutation on R148A had no effect on the formation of higher order complex The effect of kaempferol was then tested on each mutant. The V205A KaeR mutant formed a very weak complex 2 that it was disrupted in presence of kaempfe rol. All other mutations fai led to modify their binding to DNA in presence of the ligand. Effect of Mutations on the Oligomeric S tate of KaeR Based on the def ects on complex 2 formation displayed by the mutants in EMSA assays, the purified pr oteins were subjected to size ex c lusion ch romatography studies.

PAGE 105

105 As previously described (chapter 3), KaeR eluted as a monomer (40 kDa observed molecular weight ). The addition of kaempferol resulted in the formation of tetramers (160 kD observed molecular weight ) All mutations performed in the hin ge 3 displayed chang es in the oligomeric state of KaeR. Mutations on P100A, V205A resulted in elution as tetramers that were not changed by the addition of kaempferol. KaeR mutated in Q1 53A, I229A and R148A eluted as dimer s (71 kDa) Addition of kaempferol favored the oligo merization of the proteins into larger complexes (216 kDa) (Figure 4 10 ). The major s pecies of KaeR E127A were tetra meric (160 kDa) whereas a small er peak (34 kDa) that may correspond to the monomeric form was also observed. The addition of 10 Conclusions The signal transduction mechanisms underl ying transcriptional activation are poorly understood. It involves inter domain communication upon binding of a ligand. Some research groups have proposed that the linker helix (between DBD and EBD) is involved in signal transduction (Lu et al ., 2010) Our results indicate that in KaeR the flexibility of the EBD may mediate this process. In the modeled KaeR it was observed that the hinge 3 region in EBD (between RDI and RDII) is also involved in dimerization. To determine if the same residues that mediate dimerization are involved in ligand binding I conducted site directed mutagenesis. Interestingly, the mutants displayed changes in the oligomeric state of the proteins and impaired DNA binding. In CynR E126 (equivalent to KaeR E127) is loca ted in the dimerization interfac e (Fi gure 4 11 ) and in the close proximity of the ethanediol molecule. The presence of a negatively charge d residue in this inter fac e may contribute to the flexibility in the hinge region. In KaeR the removal of this residue

PAGE 106

106 (E127 mutant) resulted in stable tetramers in solution that were able to oligomerize cooperatively on DNA. The addition of kaempferol did not modify the migrat ion of the F kae2 :E127A complex or the oligomeric status of the protein in solution. Based on these results I propose that the hinge 3 region is the location of ligand interaction. The presence of the ligand would promote protein oligomerization by sequen tially combining different forms of KaeR monomers (in open and close d conformations). This proposal is based on the observation that all residues muta ted in the dimerization interfac e resulted in stable dimers or tetramers with DNA binding defects. Further experiments with additional mutants will be required to test this hypothesis.

PAGE 107

107 Table 4 1. Summary of the KaeR homology modeling results. Template PDB # E value % Seq a Iden t ity a Ligand % Prob b CbnR 1IXC 0 15 100 CatM Variant (R156H) 3GLB 0 20 (2Z,4 Z) HEXA 2,4 Dienedioic acid, Glycerol, Sulphate 100 BenM Variant (R156H, T157S) 2H99 0 18 Acetate, Chloride, Glycerol, Sulphate 100 CysB 1AL3 1.40E 45 17 Sulphate 100 Dnt R (Y110S, F111V) 2UYE 4.00E 38 15 Glycerol, thiocyanate 100 PA0477 2ESN 3.00E 37 19 100 CynR 2HXR 3.80E 32 23 100 CynR 3HFU ND c 23 Azide, ethanediol ND a Sequence, b probability, c not determined.

PAGE 108

108 Table 4 2 Summary of KaeR mutation studies DNA binding assays Oligomeric state Protein Complex 1 C omplex 2 Modification b y Kaempferol ( ) ligand) (+) ligand KaeR (WT) + +++ + Monomer Tetramer P100A + + Tetramer Tetramer V205A + ++ + Tetramer Tetramer R148A + +++ + Dimer Octomer Q153A + + + Dimer Octomer E127A + + Monomer and Tetramer Monomer and Tetramer I229A + + + + Dimer Octomer

PAGE 109

109 Figure 4 1. CbnR and ArgP dimers: A) CbnR dimer (PDB 1IXC). B) ArgP dimer (PDB 3ISP).The extended subunit is shown in orange color whereas the compact subunit is indicated in cyan color. The putative ligand binding pockets are indicated by a red circle. The ligand binding region is present in a c left formed around hinge 3. RDI: regulatory domain I, RDII: regulatory domain II, wHT H: winged Helix Turn Helix, H1: Hinge1, H2: Hinge 2, H3: Hinge 3 LHs: Linker helices.

PAGE 110

110 Figure 4 2. CbnR tetramer ( PDB # 1IZ1) : The DNA binding domains are present along one face of the tetramer. Corresponding DNA recognition motifs are indicated as wHTH (Winged Helix Turn Helix). Two DBDs are involved in ABS recognition whereas the remaining two rec ognize the RBS. The regulatory domains in each dimer are arranged in an antiparallel fashion. The ArgP tetramer regulatory domains arrangement is shown in inset. RBS: Recognition or Repressi on Binding Site, ABS: Activator Binding Site wHTH: winged Helix T urn Helix,CS: Closed sub unit protein (compact form subunit), OS: Open Subunit protein (Extended form subunit) 1 1 Inset figure r eprinted with permission from Elsevier Zhou, X., Lou, Z., Fu, S., Yang, A ., Shen, H., Li, Z., Feng, Y., Bartlam, M., Wang, H., and Rao, Z. (2010) Crystal structure of ArgP from Mycobacterium tuberculosis confirms two distinct conformations of full length LysR transcriptional regulators and reveals its function in DNA binding and transcriptional regulation. J Mol Biol 396 : 1012 1024.

PAGE 111

111 Figure 4 3. ArgP tetramer (PDB # 3ISP) : A) DNA binding domain dimer and B) Regulatory domain dimer C) ArgP tetramer. The DNA binding doma ins are indicated by circles. CS Closed subunit protein (Compact form), OS Open Subunit protein (Extended form), DBD1 DNA Binding Domain 1, DBD2 DNA Binding Domain 2, DBD3 DNA Binding Domain 3, DBD4 DNA Binding Domain 4 2 2 Reprinted with permission from Elsevier. Zh ou, X., Lou, Z., Fu, S., Yang, A., Shen, H., Li, Z., Feng, Y., Bartlam, M., Wang, H., and Rao, Z. (2010) Crystal structure of ArgP from Mycobacterium tuberculosis confirms two distinct conformations of full length LysR transcriptional regulators and reveal s its function in DNA binding and transcriptional regulation. J Mol Biol 396 : 1012 1024.

PAGE 112

112 Figure 4 4 KaeR do mains arrangement : DNA Binding Domain (DBD) is indicated by a green box, RDI is shown in orange and light yellow. RDII is shown in yellow. B) The KaeR DNA Binding Domain (DBD). Helices involved in DNA recognition are indicated as H2 and H3. C) KaeR regulat ory domains arrangement. The putative ligand binding pocket is shown by a black circle. D) the full length KaeR modeled structure. H2 Helix 2, H3 Helix 3, wHTH winged Helix Turn Helix, Regulatory domain I, RD regulatory domain, RDII regulatory domain II, DBD DNA Binding Domain.

PAGE 113

113 Figure 4 5. The effector binding domain of CynR (PDB # 3HFU) was aligned to the structural model of KaeR. A) S tructural alignment of KaeR (RDI orange and RDII wheat color) and CynR (RDI green, RDII yellow orange). Surface re presentations of B) KaeR and C) CynR shows the accessibility of the ligand binding pockets. Azide is sh o wn in red and ethanediol is indicated in pink. The ligand binding pocket is indicated by blue circles.

PAGE 114

114 Figure 4 6 Analysis of the azide ligand b inding pocket in CynR. The zoomed square depicts the residues in CynR (green) involved in azide (red) binding. The aligned residues in KaeR within a 4 distance from azide are circled.

PAGE 115

115 Figure 4 7 R esidues involved in ethanediol binding. Structural alignment of CynR (green) and KaeR (cyan) EBDs. The corresponding residues in KaeR are circled. EDO: ethanediol, AZ: a zide.

PAGE 116

116 Figure 4 8 Summary of the putative KaeR residues involved in the ligand binding. A) Cartoon diagram of the RD s in KaeR showing the putative amino acid s that contact the ligand (indicated as sticks) B) SDS PAGE gel of the wild type and mutant forms of KaeR. MW Molecular weight marker. EDO: ethanediol, AZ: a zide.

PAGE 117

117 Figure 4 9. Electrophoretic mobility shift a ssays (EMSAs) to assess kaempferol effect on KaeR mutants. A) KaeR, B) P100A,C) Q153A D) E127A, E) R148A, F) V205A, and G) I229A .Kaempferol was dissolved in DMSO. F kae2 probe was used. kae kaempferol

PAGE 118

118 Figure 4 9. Continued

PAGE 119

119 Figure 4 9. Continued

PAGE 120

120 Figure 4 10 Size exclusion chr o motography to assess kaempferol effect on KaeR mutants Elution profiles for A) KaeR B) P100A,C) Q153A D) E127A, E) R148A, F) V205A, and G) I229A with ( red ) and without Kaempferol ( blue ) .ka e kaempferol .Ka empferol was dissolved in DMSO.

PAGE 121

121 Figure 4 10 Continued

PAGE 122

122 Figure 4 11 CynR dimerization domain with in the CynR tetramer. The KaeR effector binding domain (Cyan) was aligned with the CynR effector binding domain (Blue). The CynR residue E126 (blue) is aligned with KaeR E127 (cyan) The aligned residues are ind icated to the right in inset. In CynR, the E126 residues from two monomers (green and blue) might interact with ethanediol bring ing the two monomers together. EDO Ethanediol, RDI Regulatory domain I, RDII Regulatory domain II.

PAGE 123

123 CHAPTER 5 SUMMARY AND CONCLUSI ONS Summary of Findings Flavonoids are synthesized in plant s and are shown to protect plants from adverse environmental conditions. Since L. brevis is found in a flavonoi d rich environment, it was hypothesized that L. brevis may have the potential to respond to the flavonoids. The overall objective of th is study was to characterize a transcription factor that responds to the flavonoids in L. brevis To identify transcripti on factors that may interact with flavonoids, an in vitro fluorescence based ligand screening assay was used Only the protein LVIS1989 (Ka eR) a LTTR, could interact with the flavonoids myricetin h espere tin and kaempferol Bioinformatics studies suggest ed that the divergently encoded genes LVIS1986 LVIS1987 LVIS1988 may be under the control of k aeR transcription regulation The expression of LVIS1986 LVIS1987 LVIS1988 genes in the presence of kaempferol was tested and it was found that the genes are upregulated as a single transcriptional unit. The binding region of KaeR was located in the intergenic region between the LVIS1988 and LVIS198 9 (kaeR) genes. EMSA experiments using different concentrations of KaeR suggested that Kae R tetra meriz ed cooperat ively on DNA. Further, DNase I footprint studies identified two distinctive KaeR interaction sites, one in the intergenic region between LVIS1988 and LVIS1989 ( 39 to +2) and another within LVIS1988 ( 314 to 353, from kaeR translational start point). Furt her experiments using EMSA showed that both binding sites are required for KaeR binding. The effect of flavonoids was tested on the KaeR: P kaeR complex. It was found that kaempferol stabilized the KaeR: P kaeR complex.

PAGE 124

124 The effect of kaempferol on the oligom eric state of KaeR was tested by siz e exclusion chromatography. KaeR eluted as a monomer (observed MW = 40 kDa) while the addition of kaempferol promoted oligomerization and the formation of a tetramer. The regulatory implications of the KaeR binding sit e s were assessed in vivo using B. subtilis as a surrogate system. The intergenic region of LVIS1988 and kaeR were transcriptionally fused to lacZ The in vivo studies suggested that KaeR acts as an activator for LVIS1988 while kaeR is positively autoregulat ed. These results indicate that KaeR belongs to a small and poorly understoo d family of LTTRs that are positively autoregulated in the presence of a ligand. Bioinformatic analysis was carried out to identify putative amino acids involved in ligand interact ion. A structural model of KaeR was constructed and c ompared to another LTTR structure crystallized with small signal molecules. The analysis suggested that P100A E127A, R148A, Q153A, V205A I229A residues located in the hinge 3 region may be involved in kaempferol binding. Site directed mutagenesis followed by size exclusion chromatography experiments showed that all mutations modified the oligomeric state of the protein. EMSA experiments showed that mutations P100A, E127A, Q153A and I229A modified the ab ility to form complex 2 and to interact with kaempferol. Interestingly, although KaeR V205A was not able to form a stable complex 2, it was still able to interact with kaempferol in EMSA assays. These results indicate that the hinge 3 region in the protein is important in the formation dimers and tetramers as well as in the binding of the ligand. In summary, I id entified a new member of the LTT R family that is positively modulated by flavonoids. The results described are significant since those represent an

PAGE 125

125 important step in the identification of food components that may modulate probiotic properties in Lactobacillus species. Future Direction Current efforts are directed to determine the molecular mechanism of KaeR positive autoregulation by flavonoids in L. brevis To this end, the important nucleotides involved in KaeR: DNA binding are being analyzed by performing site directed mutagenesis in the promoter region of LVIS1988 and kaeR The result will allow in the identification of specific nucleotides involv ed in binding and those important for activation by kaempferol. The effect of KaeR protein mutations ( P100A, E127A, R148A, Q153A, V205A, and I229A ) on the regulation of both kaeR and LVIS1988 will be analyzed by lacZ transcriptional fusion studies It is ex pe cted that the results will uncover the mechanism of signal transduction upon binding of a ligand in LTTR family.

PAGE 126

126 APPENDIX OPTIMIZATION OF KAER BINDING CONDITIONS Figure A 1 Optimization of the KaeR binding conditions Binding of KaeR to F kae2 wa s optimized by (A) adding 0.5 mM CaCl 2 and 2.5 mM MgCl 2 or (B) modifying the pH of the reaction mix as indicated on top of each panel.

PAGE 127

127 LIST OF REFERENCES Abe, A., and Kawahara, K (1995) Transcriptional regulation and promoter sequenc e of the spvR gene of virulence plasmid pKDSC50 in Salmonella choleraesuis serovar Choleraesuis. FEMS Microbiol Lett 129 : 225 230. Abe, A., Matsui, H., Danbara, H., Tanaka, K., Takahashi H. and Kawahara, K. (1994) Regulation of spvR gene expression of Sal monella virulence plasmid pKDSC50 in Salmonella choleraesuis serovar Choleraesuis. Mol Microbiol 12 : 779 787. Aura, A. M.( 2005) In vitro digestion models for dietary phenolic compounds Thesis, VTT Espoo, Finland Axler DiPerte, G. L., Miller, V. L., and Darwin, A. J. (2006) YtxR, a conserved LysR like regulator that induces expression of genes encoding a putative ADP ribosyltransferase toxin homologue in Yersinia enterocolitica J Bacteriol 188 : 8033 8043. Bais, H. P., Vepachedu, R., Gilroy, S., Callaway R. M., and Vivanco, J. M. (2003) Allelopathy and exotic plant invasion: from molecules and genes to species interactions. Science 301 : 1377 1380. Baliga, M. S. and Katiyar, S. K., (2006) Chemoprevention of photocarcinogenesis by selected dietary botanica ls. Photochem Photobiol Sci 5 : 243 253. Belitsky, B. R. and Sonenshein, A. L. (2002) GabR, a member of a novel protein family, aminobutyrate in Bacillus subtilis Mol Microbiol 45 : 569 583. Benkert P, Biasini M, Schwede T. (2011). Toward the estimation of the absolute quality of indiv idual protein str ucture models. Bioinformatics 27 :343 50. Berman, H. M., Westbrook, J., Feng, Z., Gilliland, G., Bhat, T. N., Weissig, H., Shindyalov I. N., and Bourne, P. E. (2000) The Protein Data Bank. Nucleic Acids Res 28 : 235 242. Bielinska, A., and Hulanicka, D. (1 986) Regulation of the cysB gene expression in Escherichia coli. Acta Biochim Pol 33 : 133 137. Bongaerts, J., Zoske, S., Weidner U., and Unden, G. (1995) Transcriptional regulation of the proton translocating NADH dehydrogenase genes (nuoA N) of Escherich ia coli by electron acceptors, electron donors and gene regulators. Mol Microbiol 16 : 521 534. Bowater, L., Fairhurst, S. A., Just V. J., and Bornemann, S. (2004) Bacillus subtilis YxaG is a novel Fe containing quercetin 2,3 dioxygenase. FEBS Lett 557 : 45 48.

PAGE 128

128 Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem 72 : 248 254. Braune, A., Gutschow, M., Engst W., and Blaut, M. (2001) Degradation of quercetin and luteolin by Eubacterium ramulus Appl Environ Microbiol 67 : 5558 5567. Brencic, A., and Winans, S. C. (2005) Detection of and response to signals involved in host microbe interactions by plant associated bacteria. Microbiol Mol Biol Rev 6 9 : 155 194. Broughton, W. J. and Perret, X. (1999) Genealogy of legume Rhizobium symbioses. Curr Opin Plant Biol 2 : 305 311. Brown, N. L., Stoyanov, J. V., Kidd S. P., and Hobman, J. L. (2003) The MerR family of transcriptional regulators. FEMS Microbiol Rev 27 : 145 163. Browning, D. F., and Busby, S. J. W. (2004) The regulation of bacterial transcription initiation. Nat Rev Micro 2 : 57 65. Caldwell, A. L., and Gulig, P. A. (1991) The Salmonella typhimurium virulence plasmid encodes a positive regulator o f a plasmid encoded virulence gene. J. Bacteriol. 173 : 7176 7185. Chang, M. and Crawford, I. P. (1991) In vitro determination of the effect of indoleglycerol phosphate on the interaction of purified TrpI protein with its DNA binding sites. J Bacteriol 173 : 1590 1597. Chen, C., Buchmeier, N., Libby, S., Fang, F., Krause M. and Guiney, D. (1995) Central regulatory role for the RpoS sigma factor in expression of Salmonella dublin plasmid virulence genes. J. Bacteriol. 177 : 5303 5309. Chen, X. C., Feng, J., H ou, B. H., Li, F. Q., Li Q., and Hong, G. F. (2005) Modulating DNA bending affects NodD mediated transcriptional control in Rhizobium leguminosarum Nucleic Acids Res 33 : 2540 2548. Choi, H. J., Kim, S. J., Mukhopadhyay, P., Cho, S., Woo, J. R., Storz G. and Ryu, S. E. (2001) Structural Basis of the Redox Switch in the OxyR Transcription Factor. Cell 105 : 103 113. Chugani, S.A. Parsek, M.R. Hershberger, C.D. Murakami, K. Ishihama, A. Chakrabarty, A.M. ( 1997 ) Activation of the catBCA promoter: probin g the interaction of CatR and RNA polymerase through in vitro transcription J. Bacteriol 179 : 2221 2227 Chun, J., Kim, G. M., Lee, K. W., Choi, I. D., Kwon, G. H., Park, J. Y., Jeong, S. J., Kim J. S. and Kim, J. H. (2007) Conversion of isoflavone gluc osides to aglycones in soymilk by fermentation with Lactic Acid Bacteria. J Food Sci 72 : M39 M44.

PAGE 129

129 Close, D. C., and McArthur, C. (2002) Rethinking the role of many plant phenolics: protection from photodamage Not herbivores? Oikos 99 : 166 172. Cowan, J. M. Urbanowski, M. L., Talmi M., and G. V. Stauffer, (1993) Regulation of the Salmonella typhimurium metF gene by the MetR protein. J Bacteriol 175 : 5862 5866. Coynault, C., Robbe Saule, V., Popoff M. Y., and Norel, F. (1992) Growth phase and SpvR regulatio n of transcription of Salmonella typhimurium spvABC virulence genes. Microb Pathog 13 : 133 143. Craven, S. H., Ezezika, O. C., Haddad, S., Hall, R. A., Momany C., and Neidle, E. L. (2009) Inducer responses of BenM, a LysR type transcriptional regulator fr om Acinetobacter baylyi ADP1. Mol Microbiol 72 : 881 894. Davis, E. O. and Johnston, A. W. B. (1990) Analysis of three nodD genes in Rhizobium leguminosarum biovar phaseoli; nodD 1 is preceded by nolE a gene whose product is secreted from the cytoplasm. M ol Microbiol 4 : 921 932. Di Cagno, R., Mazzacane, F., Rizzello, C. G., Vincentini, O., Silano, M., Giuliani G. De Angelis M., and Gobbetti, M. (2010) Synthesis of isoflavone aglycones and equol in soy milks fermented by food related lactic acid bacteria and their effect on human intestinal Caco 2 Cells. J Agricult Food Chem 58 : 10338 10346. Downie, J. A., Knight, C. D., Johnston A. W. B., and Rossen, L. (1985) Identification of genes and gene products involved in the nodulation of peas by Rhizobium legu minosarum MGG 198 : 255 262. Fang, F. C., Krause, M., Roudier, C., Fierer J., and Guiney, D. G. (1991) Growth regulation of a Salmonella plasmid gene essential for virulence. J Bacteriol 173 : 6783 6789. Finn, R. D., Mistry, J., Schuster Bckler, B., Griff iths Jones, S., Hollich, V., Lassmann, T., Moxon, S., Marshall, M., Khanna, A., Durbin, R., Eddy, S. R., Sonnhammer E. L. L., and Bateman, A. (2006) Pfam: clans, web tools and services. Nucleic Acids Res 34 : D247 D251. Firmin, J. L., Wilson, K. E., Rossen L., and Johnston, A. W. B. (1986) Flavonoid activation of nodulation genes in Rhizobium reversed by other compounds present in plants. Nature 324 : 90 92. Fisher, R. F., and Long, S. R. (1993) Interactions of NodD at the nod Box: NodD binds to two distinc t sites on the same face of the helix and induces a bend in the DNA. J Mol Biol 233 : 336 348. Fraga, C. G. Litterio, M. C., Prince, P. D., Calabr V ., Piotrkowski B ., Galleano M (2011 ) Cocoa flavanols: effects on vascular nitric oxide and blo od pressure. J Clin Biochem Nutr 48 : 63 67.

PAGE 130

130 Fritsch, P.S. Urbanowski, M.L. Stauffer, G.V. ( 2000 ) subunits in MetR dependent activation of metE and metH : Important residues in the C terminal domain and orientation requirements within RNA polymerase J. Bacteriol. 182 : 5539 5550 Gao, J. and Gussin, G. N. (1991) Mutations i n TrpI binding site II that differentially affect activation of the trpBA promoter of Pseudomonas aeruginosa EMBO J 10 : 4137 4144. Gobbetti, M., Cagno R. D., and De Angelis, M. (2010) Functional Microorganisms for Functional Food Quality. Crit Rev Food S ci Nutr 50 : 716 727. Griffiths, L. A. and Smith, G. E. (1972a) Metabolism of apigenin and related compounds in the rat. Metabolite formation in vivo and by the intestinal microflora in vitro. Biochem J 128 : 901 911. Griffiths, L. A. and Smith, G. E. (1 972b) Metabolism of myricetin and related compounds in the rat. Metabolite formation in vivo and by the intestinal microflora in vitro. Biochem J 130 : 141 151. Grob, P., and Guiney, D. G. (1996) In vitro binding of the Salmonella dublin virulence plasmid r egulatory protein SpvR to the promoter regions of spvA and spvR J Bacteriol 178 : 1813 1820. Grob, P., Kahn, D., and Guiney, D. G. (1997) Mutational characterization of promoter regions recognized by the Salmonella dublin virulence plasmid regulatory prote in SpvR. J Bacteriol 179 : 5398 5406. Gurout Fleury, A. M., Frandsen N., and Stragier, P. (1996) Plasmids for ectopic integration in Bacillus subtilis Gene 180 : 57 61. Harris, S. J., Shih, Y. L., Bentley S. D., and Salmond, G. P. C. (1998) The hexA gene of Erwinia carotovora encodes a LysR homologue and regulates motility and the expression of multiple virulence determinants. Mol Microbiol 28 : 705 717. He, B., and Zalkin, H. (1992) Repression of Escherichia coli purB is by a transcriptional roadblock mec hanism. J Bacteriol 174 : 7121 7127. Heldwein, E. E. Z. and Brennan, R. G. (2001) Crystal structure of the transcription activator BmrR bound to DNA and a drug. Nature 409 : 378 382. Hein, E. M., Rose, K., G., Friedrich A. W.,and Humpf, H. U. ( 2008) Deconjugation and degradation of flavonol glycosides by pig cecal microbiota characterized by fluorescence in situ hybridization (FISH). J Agricult Food Chem 56 : 2281 2290.

PAGE 131

131 Hertog, M. G. L., Feskens, E. J. M., Kromhout, D., Hollman P. C. H., and Kat an, M. B. (1993) Dietary antioxidant flavonoids and risk of coronary heart disease: the Zutphen elderly study. Lancet 342 : 1007 1011. Hirooka, K., Danjo, Y., Hanano, Y., Kunikane, S., Matsuoka, H., Tojo S., and Fujita, Y. (2009) Regulation of the Bacillus subtilis d ivergent yetL and yetM genes by a transcriptional repressor, YetL, in response to flavonoids. J Bacteriol 191 : 3685 3697. Hirooka, K., Kunikane, S., Matsuoka, H., Yoshida, K. I., Kumamoto, K., Tojo S., and Fujita, Y. (2007) Dual regulation of t he Bacillus subtilis regulon comprising the lmrAB and yxaGH operons and yxaF gene by two transcriptional repressors, LmrA and YxaF, in response to flavonoids. J Bacteriol 189 : 5170 5182. Hollman, P. C. H. and Katan, M. B. (1999) Dietary flavonoids: intake health effects and bioavailability. Food ChemToxicol 37 : 937 942. Hryniewicz, M. M. and Kredich, N. M. (1994) Stoichiometry of binding of CysB to the cysJIH cysK and cysP promoter regions of Salmonella typhimurium. J Bacteriol 176 : 3673 3682. Hryniewi cz, M. M. and Kredich, N. M. (1995) Hydroxyl radical footprints and half site arrangements of binding sites for the CysB transcriptional activator of Salmonella typhimurium J Bacteriol 177 : 2343 2353. Hrtl, B., Wehrl, W., Wiegert, T., Homuth G., and Sc humann, W. (2001) Development of a new integration s ite within the Bacillus subtilis chromosome and construction of compatible expression c assettes. J Bacteriol 183 : 2696 2699. Jorgensen, C. and Dandanell, G. (1999) Isolation and characterization of m utat ions in the Escherichia coli regulatory p rotein XapR. J. Bacteriol. 181 : 4397 4403. Jger, A. and Saaby, L. (2011) Flavonoids and the CNS. Molecules 16 : 1471 1485. Kandler, O., and Weiss, N. (1986) Regular, non sporing Gram positive rods, p. 1208 1234. In : Sneath, P.H.A., Mair, N., Sharpe, M.E., and Holt, J.G. (ed.), Bergey's manual of systematic bacteriology, vol. 2. William and Wilkins, Baltimore. Kelley L A. Sternberg M J (2009) Protein structure prediction on the Web: a case study using the Phyre serv er. Nature protocols 4 : 363 -371. Knekt, P., Jrvinen, R., Seppnen, R., Helivaara, M., Teppo, L., Pukkala E., and Aromaa, A. (1997) Dietary flavonoids and the risk of lung cancer and other malignant neoplasms. Am J Epidemiol 146 : 223 230. Kowarz, L., Co ynault, C., Robbe Saule V., and Norel, F. (1994) The Salmonella typhimurium katF ( rpoS ) gene: cloning, nucleotide sequence, and regulation of spvR and spvABCD virulence plasmid genes. J Bacteriol 176 : 6852 6860.

PAGE 132

132 Krause, M., Fang F. C., and Guiney, D. G. (1992) Regulation of plasmid virulence gene expression in Salmonella dublin involves an unusual operon structure. J Bacteriol 174 : 4482 4489. Kredich, N. M., (1992) The molecular basis for positive regulation of cys promoters in Salmonella typhimurium and Escherichia coli Mol Microbiol 6 : 2747 2753. Krumholz, L. R. and Bryant, M. P. (1986) Eubacterium oxidoreducens sp. nov. requiring H 2 or formate to degrade gallate, pyrogallol, phloroglucinol and quercetin. Arch Microbiol 144 : 8 14. Kummerfeld, S. K. an d Teichmann, S. A. (2006) DBD: a transcription factor prediction database. Nucleic Acids Research 34 : D74 D81. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgi ns DG. (2007). Clustal W and Clustal X version 2.0. Bioinformatics 23 : 2947 2948. Leal Snchez, M. V., Ruiz Barba, J. L., Snchez, A. H., Rejano, L., Jimnez Daz R., and Garrido, A. (2003) Ferm entation profile and optimization of green olive fermentation using Lactobacillus plantarum LPCO10 as a starter culture. Food Microbiol 20 : 421 430. Lebeer, S., Vanderleyden J., and De Keersmaecker, S. C. (2008) Genes and Molecules of Lactobacilli Support ing Probiotic Action. Microbiol Mol Biol Rev 72 : 728 764. Lehnen, D., Blumer, C., Polen, T., Wackwitz, B., Wendisch V. F. and Unden, G. (2002) LrhA as a new transcriptional key regulator of flagella, motility and chemotaxis genes in Escherichia coli Mol Microbiol 45 : 521 532. Le Marchand, L., (2002) Cancer preventive effects of flavonoids a review. Biomed Pharmacother 56 : 296 301. Li, J., Ou Lee, T. M., Raba, R., Amundson R. G., and Last, R. L. (1993) Arabidopsis flavonoid mutants are hypersensitive to U V B irradiation. Plant Cell 5 : 171 179. Lochowska, A., Iwanicka Nowicka, R., Plochocka D., and Hryniewicz, M. M. (2001) Functional dissection of the LysR type CysB Transcriptional Regulator. J Biol Chem 276 : 2098 2107. Lorca, G. L., Ezersky, A., Lunin, V. V., Walker, J. R., Altamentova, S., Evdokimova, E., Vedadi, M., Bochkarev A., and Savchenko, A. (2007) Glyoxylate and pyruvate are antagonistic effectors of the Escherichia coli IclR transcriptional regulator. J Biol Chem 282 : 16476 16491.

PAGE 133

133 Lpez de Felip e, F., Curiel J. A., and Muoz, R. (2010) Improvement of the fermentation performance of Lactobacillus plantarum by the flavanol catechin is uncoupled from its degradation. J Appl Microbiol 109 : 687 697. Lu,D., Fillet,S., Meng,C., Alguel, Y., Kloppsteck,P. Bergeron,J., Krell,T., Gallegos,M.T., Ramos ,J. and Zhang,X. (2010) Crystal structure of TtgV in complex with its DNA operator reveals a general model for cooperative DNA binding of tetrameric gene regulators. Genes Dev 24 : 2556 2565. Maddocks, S. E. and Oyston, P. C. (2008) Structure and function of the LysR type transcriptional regulator (LTTR) family proteins. Microbiology 154 : 3609 3623. Mantena, S. K., Meeran, S. M., Elmets C. A., and Katiyar, S. K. (2005) Orally administered green tea polyphenols p revent ultraviolet radiation induced skin c ancer i n mice through activation of cytotoxic T cells and inhibition of angiogenesis in t umors. J Nutr 135 : 2871 2877. Mathesius, U., Mulders, S., Gao, M., Teplitski, M., Caetano Anolls, G., Rolfe B. G., and Bau er, W. D. (2003) Extensive and specific responses of a eukaryote to bacterial quorum sensing signals. PNAS 100 : 1444 1449. Mavromatis K, Chu K, Ivanova N, Hooper SD, Markowitz VM, et al. (2009) Gene Context Analysis in the Integrated Microbial Genomes (IMG ) Data Management System. PLoS ONE 4(11): e7979. doi:10.1371/journal.pone.0007979 Middleton, E., Kandaswami C., and Theoharides, T. C. (2000) The effects of plant flavonoids on mammalian cells:implications for inflammation, heart disease, and cancer. Phar macol Rev 52 : 673 751. Miller, A.D.W., Ebright, R., and Rothman Denes, L. (1997) RNA polymerase subunit: a target for DNA binding independent activation. Science 275 : 1655 1657. Miller, J.H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 466 pp. Minezaki, Y., Homma K., and Nishikawa, K. (2006) Genome wide survey of transcription factors in prokaryotes reveals many bacteria specific families not found in archaea. DNA Res 12 : 269 280. Molina Henares, A. J., Krell, T., Eugenia Guazzaroni, M., Segura A., and Ramos, J. L. (2006) Members of t he IclR family of bacterial transcriptional regulators function as activators and/or repressors. FEMS Microbiol Rev 30 : 157 186. Monferrer, D., Tralau, T., Kertesz, M. A., Dix, I., Sola M., and Uson, I. (2010) Structural studies on the full length LysR ty pe regulator TsaR from Comamonas testosteroni T 2 reveal a novel open conformation of the tetrameric LTTR fold. Mol Microbiol 75 : 1199 1214.

PAGE 134

134 Moreno Campuzano, S., Janga S. C., and Perez Rueda, E. (2006) Identification and analysis of DNA binding transcrip tion factors in Bacillus subtilis and other F irmicutes a genomic approach. BMC Genomics 7 : 147. Mulligan, J. T., and Long, S. R. (1989) A family of activator genes regulates e xpression of Rhizobium meliloti nodulation g enes. Genetics 122 : 7 18. Muraoka, S. Okumura, R., Ogawa, N., Nonaka, T., Miyashita K., and Senda, T. (2003) Crystal structure of a full length LysR type transcriptional regulator, CbnR: unusual combination of two subunit forms and molecular bases for causing and changing DNA bend. J Mol Bi ol 328 : 555 566. Mller Hill, B. The Lac Operon: A Short History of a Genetic Paradigm. (Walter de Gruyter, New York, 1996). Mller Hill, B., (1998) Some repressors of bacterial transcription. Curr Opin Microbiol 1 : 145 151. Niesen, F. H., Berglund H., an d Vedadi, M. (2007) The use of differential scanning fluorimetry to detect ligand interactions that promote protein stability. Nat Protocols 2 : 2212 2221. Ostrowski, J., and Kredich, N. M. (1990) In vitro interactions of CysB protein with the cysJIH promot er of Salmonella typhimurium : inhibitory effects of sulfide. J Bacteriol 172 : 779 785. Ostrowski, J., and Kredich, N.M. (1991) Negative autoregulation of cysB in Salmonella typhimurium : in vitro interactions of CysB protein with the cysB promoter. J. Bacte riol 173 2212 2218. Pareja, E., Pareja Tobes, P., Manrique, M., Pareja Tobes, E., Bonal J., and Tobes, R. (2 006) ExtraTrain: a database of extragenic regions and t ranscriptional information in prokaryotic organisms. BMC Microbiology 6 : 29. Parsek, M. R., Shinabarger, D. L., Rothmel R. K., and Chakrabarty, A. M. (1992) Roles of CatR and cis,cis muconate in activation of the catBC operon, which is involved in benzoate degradation in Pseudomonas putida J Bacteriol 174 : 7798 7806. Peters, N., Frost J.,and Long, S. (1986) A plant flavone, luteolin, induces expression of Rhizobium meliloti nodulation genes. Science 233 : 977 980. Petit Glatron, M. F. and Chambert, R. (1992) Peptide carrier potentiality of Bacillus subtilis levansucrase. J Gen Microbiol 138 : 1 089 1095. Pham, T. T. and Shah, N. P. (2009) Performance of Starter in Yogurt Supplemented with Soy Protein Isolate and Biotransformation of Isoflavones during Storage Period. J Food Sci 74 : M190 M195.

PAGE 135

135 Porra, O., Garca Gonzlez, V., Santero, E., Shingle r V., and Govantes, F. (2009) N dependent promoter naturally lacking upstream activation sequences. Mol Microbiol 73 : 419 433. Porra, O., Garca Jaramillo, M., Santero E., and Govantes, F. (2007) The LysR type regulator A tzR binding site: DNA sequences involved in activation, repression and cyanuric acid dependent repositioning. Mol Microbiol 66 : 410 427. Porra, O., Platero, A. I., Santero, E., Del Solar G., and Govantes, F. (2010) Complex interplay between the LysR type regulator AtzR and its binding site mediates atzDEF activation in response to two distinct signals. Mol Microbiol 76 : 331 347. Puupponen Pimi, R., Nohynek, L., Meier, C., Khknen, M., Heinonen, M., Hopia A. and Oksman Caldentey, K. M. (2001) Antimicrob ial properties of phenolic compounds from berries. J Appl Microbiol 90 : 494 507. Prez Rueda, E. and Collado Vides, J. (2000) The repertoire of DNA binding transcriptional regulators in Escherichia coli K 12. Nucleic Acids Res 28 : 1838 1847. Rechner, A. R ., Smith, M. A., Kuhnle, G., Gibson, G. R., Debnam, E. S., Srai, S. K., Moore K. P., and Rice Evans, C. A. (2004) Colonic metabolism of dietary polyphenols: influence of structure on microbial fermentation products. Free Radic Biol Med 36 : 212 225. Redmon d, J. W., Batley, M., Djordjevic, M. A., Innes, R. W., Kuempel P. L., and Rolfe, B. G. (1986) Flavones induce expression of nodulation genes in Rhizobium Nature 323 : 632 635. Rice Evans, C., Miller N., and Paganga, G. (1997) Antioxidant properties of ph enolic compounds. Trends Plant Sci 2 : 152 159. Rodionov, D. A. (2007) Comparative genomic reconstruction of transcriptional regulatory networks in bacteria. Chem Rev 107 : 3467 3497. Rodrguez, H., Curiel, J. A., Landete, J. M., de las Rivas, B., de Felipe, F. L., Gmez Cordovs, C., Mancheo J. M, and Muoz, R. (2009) Food phenolics and lactic acid bacteria. Int J Food Microbiol 132 : 79 90. Rosario, C. J., Frisch R. L., and Bender, R. A. (2010) The LysR type nitrogen assimilation control protein forms co mplexes with both long and short DNA binding sites in the absence of coeffectors. J Bacteriol 192 : 4827 4833. Rossen, L., Shearman, C. A., Johnston A. W. B., and Downie, J. A. (1985) The nodD gene of Rhizobium leguminosarum is autoregulatory and in the pr esence of plant exudate induces the nodA,B,C genes. EMBO J 4 : 3369 3373.

PAGE 136

136 Sainsbury, S., Lane, L. A., Ren, J., Gilbert, R. J., Saunders, N. J., Robinson, C. V., Stuart D. I., and Owens, R. J. (2009) The structure of CrgA from Neisseria meningitidis reveals a new octameric assembly state for LysR transcriptional regulators. Nucleic Acids Res 37 : 4545 4558. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular cloning: a laboratory manual. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Pres s. Schell, M. A. (1993) Molecular biology of the LysR family of transcriptional regulators. Annu Rev Microbiol 47 : 597 626. Schell, M. A., Brown P. H., and Raju, S. (1990) Use of saturation mutagenesis to localize probable functional domains in the NahR p rotein, a LysR type transcription activator. J Biol Chem 265 : 3844 3850. Schleif, R. (2003) AraC protein: A love hate relationship. BioEssays 25 : 274 282. Schneider, H., Schwiertz, A., Collins M. D. and Blaut, M. (1999) Anaerobic transformation of quercet in 3 glucoside by bacteria from the human intestinal tract. Arch Microbiol 171 : 81 91 91. Schoefer, L., Mohan, R., Braune, A., Birringer M., and Blaut, M. (2002) Anaerobic C ring cleavage of genistein and daidzein by Eubacterium ramulus FEMS Microbiol Le tt 208 : 197 202. Selma, M. J. C., and F. A. (2009) Interaction between p henoli cs and gut microbiota: role in human h ealth. J Agricult Food Chem 57 : 6485 6501. Shin, M., Kang, S., Hyun, S. J., Fujita, N., Ishihama, A., Valentin Hansen P., and Choy, H. E. (2001) Repression of deoP2 in Escherichia coli by CytR: conversion of a transcription activator into a repressor. EMBO J 20 : 5392 5399. Singer, A. U., Evdokimova, E. Kagan, O., Cuff, M.E., Edwards, A.M., Joachimiak, A., Savchenko, A. Crystal structure of the ligand binding domain of E. coli CynR with its specific effector azide. Spencer, J. P. (2003) Metabolism of Tea Flavonoids in the Gastrointestinal Tract. J Nutr 133 : 3255S 3261S. Stec, E., Witkowska Zimny, M., Hryniewicz, M. M., Neumann, P., Wilkins on, A. J., Brzozowski, A. M., Verma, C. S., Zaim, J., Wysocki S., and Bujacz, G. D. (2006) Structural basis of the sulphate starvation r esponse in E. coli crystal structure and mutational analysis of the cofactor binding domain of the Cbl t ranscriptiona l r egulator. J Mol Biol 364 : 309 322. Swanson, J. A., Mulligan J. T., and Long, S. R. (1993) Regulation of syrM and nodD3 in Rhizobium meliloti Genetics 134 : 435 444.

PAGE 137

137 Tattini, M., Galardi, C., Pinelli, P., Massai, R., Remorini D., and Agati, G. (2004) Dif ferential accumulation of flavonoids and hydroxycinnamates in leaves of Ligustrum vulgare under excess light and drought stress. New Phytol 163 : 547 561. Teran, W., Felipe, A., Segura, A., Rojas, A., Ramos J. L., and Gallegos, M. T (2003) Antibiotic depe ndent induction of Pseudomonas putida DOT T1E TtgABC efflux pump is mediated by the drug binding repressor TtgR. Antimicrob Agents Chemother 47 : 3067 3072. Teran, W., Krell, T. Ramos J. L., and Gallegos, M. T. (2006) Effector repressor interactions, bin ding of a single effector molecule to the operator bound TtgR homodimer mediates derepression. J Biol Chem 281 : 7102 7109. Toledano, M. B., Kullik, I., Trinh, F., Baird, P. T., Schneider T. D., and Storz, G. (1994) Redox dependent shift of OxyR DNA contac ts along an extended DNA binding site: a mechanism for differential promoter selection. Cell 78 : 897 909. Tyrrell, R., Verschueren, K. H. G. Dodson, E. J., Murshudov, G. N., Addy C., and Wilkinson, A. J. (1997) The structure of the cofactor binding frag ment of the LysR family member, CysB: a familiar fold with a surprising subunit arrangement. Structure 5 : 1017 1032. Tzounis, X., Vulevic, J., Kuhnle, G. G., George, T., Leonczak, J., Gibson, G. R., Kwik Uribe C., and Spencer, J. P. (2008) Flavanol monome r induced changes to the human faecal microflora. Br J Nutr 99 : 782 792. Ulrich, L. E., Koonin E. V., and Zhulin, I. B. (2005) One component systems dominate signal transduction in prokaryotes. Trends Microbiol 13 : 52 56. van Rhijn, P. and Vanderleyden, J. (1995) The Rhizobium plant symbiosis. Microbiol Rev 59 : 124 142. Vandeputte, O. M., Kiendrebeogo, M., Rajaonson, S., Diallo, B., Mol, A., El Jaziri M., and Baucher, M. (2010) Identification of catechin as one of the flavonoids from Combretum albiflorum bark extract that reduces the production of quorum sensing controlled virulence factors in Pseudomonas aeruginosa PAO1. Appl Environ Microbiol 76 : 243 253. Vedadi, M., Niesen, F. H., Allali Hassani, A., Fedorov, O. Y., Finerty, P. J., Wasney, G. A., Yeung R., Arrowsmith, C., Ball, L. J., Berglund, H., Hui, R., Marsden, B. D., Nordlund, P., Sundstrom, M., Weigelt J., and Edwards, A. M. (2006) Chemical screening methods to identify ligands that promote protein stability, protein crystallization, and struct ure determination. PNAS 103 : 15835 15840.

PAGE 138

138 Verzelloni, E., Pellacani, C., Tagliazucchi, D., Tagliaferri, S., Calani, L., Costa, L. G., Brighenti, F., Borges, G., Crozier, A., Conte A., and Del Rio, D. (2011) Antiglycative and neuroprotective activity of co lon derived polyphenol catabolites. Mol Nutr Food Res 55 : S35 S43. Viswanathan, P., Murphy, K., Julien, B., Garza A. G., and Kroos, L. (2007a) Regulation of dev an operon that includes genes essential for Myxococcus xanthus development and CRISPR associa ted genes and repeats. J Bacteriol 189 : 3738 3750. Viswanathan, P., Ueki, T., Inouye S., and Kroos, L. (2007b) Combinatorial regulation of genes essential for Myxococcus xanthus development involves a response regulator and a LysR type regulator. PNAS 104 : 7969 7974. Vitaglione, P., Donnarumma, G., Napolitano, A., Galvano, F., Gallo, A., Scalfi L., and Fogliano, V. (2007) Protocatechuic acid is the major human metabolite of cyanidin glucosides. J Nutr 137 : 2043 2048. Wang, S. P., and Stacey, G. (1991) Stu dies of the Bradyrhizobium japonicum nodD1 promoter: a repeated structure for the nod box. J Bacteriol 173 : 3356 3365. Wang, Z. Y., Huang, M. T., Ferraro, T., Wong, C. Q., Lou, Y. R., Reuhl, K., Iatropoulos, M., Yang C. S., and Conney, A. H. (1992) Inhibi tory Effect of Green Tea in the Drinking Water on Tumorigenesis by Ultraviolet Light and 12 O Tetradecanoylphorbol 13 acetate in the Skin of SKH 1 Mice. Cancer Res 52 : 1162 1170. Warren L. DeLano "The PyMOL Molecular Graphics System."DeLano Scientific LLC, San Carlos, CA, USA. http://www.pymol.org Weber, H., Polen, T., Heu veling, J., Wendisch, V.F., and Hengge, R. (2005) Geno me wide analysis of the general stress response network in Escherichia coli : sigmaS dependent genes, promoters and sigma factor selec tivity. J Bacteriol 187: 1591 1603. Wilson, D., Madera, M., Vogel, C., Chothia C., and Gough, J. (2007) The SUPERFAMILY database in 2007: families and functions. Nucleic Acids Res 35 : D308 D313. Wilson, R. L., Urbanowski M. L., and Stauffer, G. V. (1995) DNA binding sites of the LysR type regulator GcvA in the gcv and gcvA control regions of Escherichia coli J Bacteriol 177 : 4940 4946. Winter, J., Moore, L. H., Dowell V. R., and Bokkenheuser, V. D. (1989) C ring cleavage of flavonoids by human intestinal bacteria. Appl Environ Microbiol 55 : 1203 1208.

PAGE 139

139 Zheng, D., Constantinidou, C., Hobman J. L., and Minchin, S. D. (2004) Identification of the CRP regulon using in vitro and in vivo transcriptional profiling. Nucleic Acids Res 32 : 5874 5893. Zhou, X., Lou, Z., Fu, S., Yang, A., Shen, H., Li, Z., Feng, Y., Bartlam, M., Wang H., and Rao, Z. (2010) Crystal structure of ArgP from Mycobacterium tuberculosis confirms two distinct conformations of full length LysR transcriptional regulators and reveals its functi on in DNA binding and transcriptional regulation. J Mol Biol 396 : 1012 1024. Zianni, M., Tessanne, K., Merighi, M., Laguna R., and Tabita, F. (2006) Identification of the DNA Bases of a DNase I footprint by the use of dye primer s equencing on an automated capillary DNA analysis i nstrument. J Biomol Tech 17 : 103 113.

PAGE 140

140 BIOGRAPHICAL SKETCH Santosh Gurunath rao Pande received his Bachelor of Engineering (B.E.) in c hemical e ngineering from North Maharashtra University, Jalgaon, In dia in May 2002 and Master of T echnology (M. Tech.) in b iotechnology from Anna University, Guindy, Chennai, India in June 2006. He was a recipient of a two year fellowship from the Department of Biotechnology (DBT), Government of India to pursue M. Tech. program (July 2004 to June 2006) Subsequently, he was selected through campus placement to Hyderabad, India as a trainee (July 2006 to June 2007). In August 2007 he was admitted to the graduate program at the University of Florida, Gainesville wh ere he was a recipient of the graduate alumni fellowship (August 2007 to August 2011). In January of 2008 oratory where he was exposed to many fascinating aspects of bacterial transcriptional gene regulation In particula r, he worked on the characterization of the LysR family transcriptional factor from L. brevis During his PhD program Santosh attended different conferences and meetings including the American Society for Microbiology (ASM) 3 rd conference on beneficial mi crobes (October 25 29, 2010, Miami, Florida). In December 2008 he married Rupali Morkhande. Upon completion of his PhD in August 2011 Santosh plans to pursue research training in academi a (Postdoctoral training) after which he wants to return to India to pursue research career in industry/ academia.