Genetic Dissection of Murine Lupus Susceptibility Locus Sle1c Identifies Estrogen-Related Receptor Gamma As a Novel Regu...

MISSING IMAGE

Material Information

Title:
Genetic Dissection of Murine Lupus Susceptibility Locus Sle1c Identifies Estrogen-Related Receptor Gamma As a Novel Regulator of Autoimmunity
Physical Description:
1 online resource (95 p.)
Language:
english
Creator:
Perry,Daniel J
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Immunology and Microbiology (IDP)
Committee Chair:
Morel, Laurence
Committee Members:
Riva, Alberto
Sobel, Eric S
Mathews, Clayton Elwood
Wallace, Margaret R

Subjects

Subjects / Keywords:
autoimmunity -- cd4 -- cell -- cgvhd -- dissection -- err -- errgamma -- esrrg -- estrogen -- f1 -- gamma -- genetic -- genetics -- lupus -- nzb -- nzbw -- nzw -- receptor -- related -- sle -- sle1 -- sle1c -- sle1c2 -- t -- th1
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Systemic lupus erythematosus (SLE) is a chronic autoinflammatory disease that manifests in many forms ranging from mild to acute and affecting multiple organ systems. It is characterized by the presence of pathogenic antinuclear antibodies (ANA) that result in the deposition of immune complexes in basement membranes throughout the body. These immune complexes can then induce inflammatory responses that over time lead to tissue destruction. This capability of tissue destruction anywhere in the body is the reason for the multifaceted nature of the disease. Patients with the highest mortality are those in which the kidneys are involved. In such cases, immune complex deposits result in glomerulonephritis (GN), eventually leading to kidney failure and death. Because the genetic and environmental factors that cause SLE are poorly understood, treatment is generally limited to regimens of immunosuppressive therapies, which tend to have detrimental side effects. Thus there is an imminent need for the discovery of improved treatments. The focus of the work in our lab is on identifying genetic factors responsible for SLE etiology using the NZM2410 recombinant inbred mouse strain. Derived from NZB and NZW, its parental strains are the basis of the classic NZB/W F1 lupus mouse model. Linkage analysis of a cohort of NZM x B6 F1 backcrossed to NZM identified three major lupus susceptibility loci. Among these, Sle1, located on Chromosome 1, has been shown to be required for initiation of the disease by mediating a loss of tolerance to nuclear antigens. Subsequently, Sle1 was determined to be composed of three subloci, Sle1a, Sle1b, and Sle1c. Further characterization of the Sle1c sublocus found it to be a complex locus as well, with decreased germinal center and T dependent immune responses mapping to the telomeric portion, and CD4+ T cell hyperactivation and increased chronic graft-versus-host disease (cGVHD) mapping to the centromeric portion of the locus. In this project phenotypic mapping was used to refine the centromeric Sle1c2 sublocus to a 675Kb interval. Recombinant congenic strains with the NZW-derived Sle1c2 interval introgressed exhibited CD4+ T cell activation and cGVHD susceptibility, similar to mice with the parental Sle1c. In addition, B6.Sle1c2 mice were found to have a robust expansion of INF? expressing TH1 cells. Also, when the Sle1c2 locus in NZB x B6 F1 mice was NZB/NZW as compared to NZB/B6, B cell activation, autoantibody production, and GN were exacerbated, verifying the locus as a bona fide lupus susceptibility locus. Of the two genes in the Sle1c2 interval, only one, Estrogen-related receptor gamma (Esrrg), had detectable expression in CD4+ T cells. Furthermore, congenic B6.Sle1c2 mice expressed less Esrrg than B6 controls in CD4+ T cells, and Esrrg expression had a very strong negative correlation to CD4+ T cell activation. Taken together, I propose Esrrg to be a novel target for the therapeutic intervention of SLE.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Daniel J Perry.
Thesis:
Thesis (Ph.D.)--University of Florida, 2011.
Local:
Adviser: Morel, Laurence.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043350:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 GENETIC DISSECTION OF MURINE LUPUS SUSCEPTIBILITY LOCUS SLE1C IDENTIFIES ESTROGEN RELATED RECEPTOR GAMMA AS A NOVEL REGULATOR OF AUTOIMMUNITY By DANIEL JAMES PERRY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNI VERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Daniel James Perry

PAGE 3

3 To my loving wife who supports me through thick and thin Also to my mother who put hers elf through school while raising two children on her own. Th e i r dedication is my inspiration.

PAGE 4

4 ACKNOWLEDGMENTS Much of th e work in this project could not be done with out the generous gift of FoxP3 eGFP knock in mice for Dr. Vijay Kuchroo at Harvard Medical School and the analysis of microarray data by Dr. Igor Dozmorov at Oklahoma Medical Research Center. I would also like to tha nk Neal Benson for his assistance with FACS sorting and Leilani Zeumer Xuekun Su, and Jessica Lohmann for their excellent animal husbandry work. Also, several senior colleagues, including Kim Blenman, Biyan Duan, Zhiwei Xu, Carla Cuda, and Surya Potula were instrumental for technical assistance in almost every aspect of this project. I thank my committee for their critical advice and suggestions. Last but not least, I thank my mentor for the opportunity and continued guidance.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 ABSTRACT ................................ ................................ ................................ ..................... 9 CHAPTER 1 BACKGROUND AND RELEVENCE ................................ ................................ ....... 11 Systemic Lupus Erythematosus ................................ ................................ .............. 11 Genetics of SLE in Humans ................................ ................................ .................... 12 Genetics of Lupus in Mice ................................ ................................ ....................... 14 Congenic Dissection ................................ ................................ ......................... 15 The NZM2410 Model of Murine Lupus ................................ ............................. 16 Role of CD4 + T cells in SLE ................................ ................................ .................... 19 T H 1 in SLE ................................ ................................ ................................ ........ 21 T H 17 in SLE ................................ ................................ ................................ ...... 23 IL 17 in murine lupus ................................ ................................ ................. 23 IL 17 in SLE patients ................................ ................................ .................. 25 2 MURINE LUPUS SUSCEPTIBILITY LOC US SLE1C2 MEDIATES CD4 + T CELL HYPERACTIVATION AND MAPS TO ESTROGEN RELATED RECEPTOR GAMMA ESRRG ................................ ................................ ................................ .... 34 Materials and Methods ................................ ................................ ............................ 36 Mice ................................ ................................ ................................ .................. 36 Cell Isolation and Culture ................................ ................................ ................. 37 Flow Cytometry ................................ ................................ ................................ 38 Gene Expression Analyses ................................ ................................ .............. 39 ELISA ................................ ................................ ................................ ............... 39 Western Blot ................................ ................................ ................................ ..... 40 Mixed Bone Marrow Chimera ................................ ................................ ........... 40 Chronic Graft Versus Host D isease (cGVHD) ................................ .................. 41 EAE ................................ ................................ ................................ .................. 41 Statistical Analysis ................................ ................................ ............................ 42 Results ................................ ................................ ................................ .................... 42 CD4 + T Cell Hyperactivation Maps to the Centr omeric End of Sle1c ............... 42 Sle1c2 Exhibits a Unique Cytokine Profile Denoted by Marked T H 1 Skewing .. 43 Esrrg is Defectively Regulated in B6. Sle1c2 CD4 + T Cells ............................... 45 Sle1c2 Exacerbates Lupus in the Induced cGVHD Model ............................... 48 S le1c2 Mediates Severity of Spontaneous Lupus via Epistatic Interactions ..... 49

PAGE 6

6 Discussion ................................ ................................ ................................ .............. 50 3 DISCUSSION ................................ ................................ ................................ ......... 64 APPENDIX A IN SILICO IDENTIFICATION OF POTENTIAL CAUSITIVE SLE1C2 ALLELES RESPONSIBLE FOR ESRRG DOWNREGULATION ................................ ............. 68 B GENERATION OF A VECTOR FOR ECTOPIC EXPRESSION OF ESRRG IN PRIMARY CD4 + T CELLS ................................ ................................ ...................... 76 LIST OF REFERENCES ................................ ................................ ............................... 79 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 95

PAGE 7

7 LIST OF TABLES Table page 1 1 1997 Update of the 1982 American College of Rheumatology Revised Criteria for Classification of Systemic Lupus Erythematosus .............................. 29 1 2 IL 17 in murine models of lupus ................................ ................................ .......... 32 2 1 ................................ ................................ ........................... 54 A 1 SNPs in constrained elements ................................ ................................ ............ 71 A 2 SNP effects on transcription factor binding ................................ ......................... 72

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Integration of human and murine studies for new SLE drug discovery. .............. 30 1 2 Map of the Sle1c locus at the beginning of the project. ................................ ...... 31 1 3 IL 17 in SLE pathogenesis. ................................ ................................ ................ 33 2 1 Physical map of the Sle1c l ocus. ................................ ................................ ........ 55 2 2 Mapping phenotypes used to define Sle1c2 ................................ ...................... 56 2 3 Additional Sle1c2 phenotypes. ................................ ................................ ........... 57 2 4 Global gene expression of CD4 + T cells. ................................ ............................ 58 2 5 Sle1c2 generates augmented T H 1 lineage. ................................ ........................ 59 2 6 Sle1c2 results in decreased expression of Esrrg by CD4 + T cells. ..................... 60 2 7 Additional Esrrg expression data. ................................ ................................ ....... 61 2 8 Sle1c2 exacerb ates induced lupus in a T cell intrinsic manner. ......................... 62 2 9 Sle1c2 exacerbates spontaneous lupus. ................................ ............................ 63 A 1 Comparative SNP analysis of Sle1c2 ................................ ................................ 70 A 2 Alignment of rs32038280 with transcription factor binding sites. ........................ 75 B 1 Gene expression in 293 cells transfected with Esrrg ................................ ......... 77 B 2 Protein expression in 293 cells transfected with Esrrg ................................ ...... 78

PAGE 9

9 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy GENETIC DISSECTION OF MURINE LUPUS SUSCEPTIBILITY LOCUS SLE1C IDENTIFIES ESTROGEN RELATED RECEPTOR GAMMA AS A NOVEL REGULATOR OF AUTOIMMUNITY By Dan iel James Perry August 2011 Chair: Laurence Marguerite Morel Major: Medical Sciences Immunology and Microbiology Systemic lupus erythematosus ( SLE) is a chronic auto inflammatory disease that manifests in many forms ranging from mild to acute and affec ting multiple organ systems. It is characterized by the presence of pathogenic antinuclear antibodies (ANA) that result in the deposition of immune complexes in basement membranes throughout the body. These immune complexes can then induce inflammatory r esponses that over time lead to tissue destruction. This capability of tissue destruction anywhere in the body is the reason for the multifaceted nature of the disease. Patients with the highest mortality are those in which the kidneys are involved. In such cases, immune complex deposits result in glomerulonephritis (GN), eventually leading to kidney failure and death. Because the genetic and environmental factors that cause SLE are poorly understood, treatment is generally limited to regimens of immuno suppressive therapies which tend to have detrimental side effects. Thus there is a n immi nent need for the discovery of improved treatments The focus of the work in our lab is on identifying genetic factors responsible for SLE etiology using the NZM241 0 recombinant inbred mouse strain. Derived from NZB

PAGE 10

10 and NZW, its parental strains are the basis of the classic NZB/W F1 lupus mouse model. Linkage analysis of a cohort of NZM x B6 F1 backcrossed to NZM identified three major lupus susceptibility loci A mong these, Sle1 located on C hromosome 1, has been shown to be required for initiation of the disease by mediating a loss of tolerance to nuclear antigens. Subsequently, Sle 1 was determined to be composed of three subloci Sle1a Sle1b and Sle1c Furth er characterization of the Sle1c sublocus found it to be a complex locus as well, with decreased germinal center and T dependent immune responses mapping to the telomeric portion, and CD4 + T cell hyperactivation and increased chronic graft versus host dise ase (cGVHD) mapping to the centromeric portion of the locus. In this project phenotypic mapping was used to refine the centromeric Sle1c2 sublocus to a 675 Kb interval. Recombinant congenic s trains with the NZW derived Sle1c2 interval introgressed exhibit ed CD4 + T cell activation and cGVHD susceptibility similar to mice with the parental Sle1c In addition, B6. Sle1c2 mice H 1 cells. Also, when the Sle1c2 locus in NZB x B6 F1 mice was NZB/NZW as co mpared to NZB/B6, B cell activation, autoantibody production, and GN were exacerbated, verifying the locus as a bona fide lupus susceptibility locus. Of the two genes in th e Sle1c2 interval, only one, Estrogen related receptor gamma ( Esrrg ), had detectable expression in CD4 + T cells. Furthermore, congenic B6. Sle1c2 mice expressed less Esrrg than B6 controls in CD4 + T cells, and Esrrg expression had a very strong negative correlation to CD4 + T cell activation. Taken together, I propose Esrrg to be a novel target for the therapeutic intervention of SLE.

PAGE 11

11 CHAPTER 1 BACKGROUND AND RELEV ENCE Systemic Lupus Erythematosus According to the CDC, the incidence of Systemic Lupus Erythematosus (SLE) is estimated to be between 300,000 and 4 million cases in the U.S. (1) SLE is an autoimmune disorder mediated by pathogenic immune attack on nuclear antigens, resulting in the production of anti nuclear autoantibodies (ANA) whose specificities include double stranded DNA (dsDNA), histones, chromatin/subnucleosome complexes, and ribonucleoproteins. High levels of these autoantibodies result in imm une complex formation that is subsequently deposited in the basement membranes of various tissues. There, they induce inflammation and t issue destruction. Therefore, SLE has the ability to a ffect almost any organ system resulting in neurological, musculoskeletal, gastrointestinal, renal, cardiac, and pulmonary manifestations as well as fever, fatigue, and malaise (2) Because of this heterogeneity of clinical symptoms, which tend to fluctuate with disease flares up and remissions, dia gnosis is never straightforward. Usually, SLE can be diagnosed if a patient exhibits at least four of the criteria on the American College of Rheumatology Revised Criteria for Classification of Systemic Lupus Erythematosus (Table 1 1) either serially or s imultaneously (3, 4) This list of criteria does have s everal limitations, especially with diagnosing the onset of SLE, and revision efforts are in progress (5) There is no cure for SLE, and currently, treatment is directed toward decreasing the frequency and severity of flares. This is largely achieved via a regimen of antimalarial, immu nosuppressive and anti inflammatory treatments that tend to have serious side effects (6) Type I interferon is a major accelerator of disease flare ups (7)

PAGE 12

12 H ydroxychloroquine is an anti malarial that inhibits phagosome function, thereby attenuating toll like receptor mediated type I interferon production. Glucocorticoids decrease B and T cell activation and usually require significant dose increases during flare ups, which produce detrim ental side effects. Cyclophosphamide is a chemotherapeutic that when metabolized by lymphocytes, cross links DNA resulting in apoptosis. Azathioprine and m ycophenolate mofetil both interfere with purine synthesis in lymphocytes, thereby inhibiting prolif eration. T here is also strong evidence for a number of biological therapies h owever, the majority have failed clinical trials, with several mo re likely due to trial design than actual ineffectiveness (6) Still one, Belimumab, was reported to be effective and well tolerated in phase II and III clinical trials and it became the first biological therapy approved by the FDA for treatment of active SLE in March of 201 1 (8, 9) Belimumab is a human monoclonal antibody that binds and inhibits B lymphocyte stimulator (BLyS; also known as BAFF ), an important survival factor for B cells. The use of more effective biological therapi es is expected to decrease the reliance on glucocorticoid and chemotherapeutic agents, thus reducing side effects, decreasing the frequency and severity of flare ups, and improving quality of life for SLE patients. Genetics of SLE in Humans SLE is a com plex genetic disorder, resulting from a combination of genetic and environmental factors that individually do not cause disease. The most compelling evidence of a genetic contribution in human SLE lies in the fact that incidence between monozygotic twins is roughly tenfold higher than in dizygotic twins and other full siblings (10, 11) In addition, there are strong familial association and race effects that dictate prevalence, age of onset, and severity (12 14)

PAGE 13

13 Although it can affect males and females of any age, SLE onset most commonly occurs in women of child bearing age. Thus, SLE exhibits a sexual dimorphism, common to many autoimmune diseases, such that nine females are affected for every one male. As this skewing suggests, there are clear effects of sex hormones and SLE onset and severity (15, 16) Additionally murine models have shown a direct effect of estrogen both thro ugh castration/replenishment studies and through receptor knockout studies (17, 18) Also as expected, this gender difference is likely due to a dose effect of the X Chromosome as men with Klinefelter Syndrome (47 ,XXY) have a similar prevalence of SLE as 46,XX women and about 14 fold higher prevalence as in 46,XY men (19) The sex chromosome controlled hormones are not the whole story of the X Chromosomethat encodes a pl ethora of genes with immune function. Toll like receptor 7 ( TLR7 ) has been proven to be associated with disease pathogenesis. The second copy of Tlr7 in a duplication translocation of part of the X Chromosome onto the Y Chromosome was discovered as the m ain functional contributor to the Y linked autoimmune acceleration ( Yaa ) phenotype observed in mice (20 24) Subsequently, a study in humans found an allele of TLR7 with associated risk for SLE development in males Undoubtedly, such studies will find more of SLE associations of X linked genes. Regardless, the fact that males are also susceptible is shows that autosomal genes also contribute to pathogenesis. One way to identify genes responsible for SLE is through genetic association studies. These studies attempt to establish a relationship between the alleles at a given locus with disease by establishing that the frequency of a given allele within an affected

PAGE 14

14 population is significantly higher than the overall po pulation. The recent annotation of millions of single nucleotide polymorphisms (SNPs) in the human genome and the inception of high throughput genotyping technologies has enabled the use of genome wide association studies (GWAS) to simultaneously search e ntire genomes of large cohorts for causative alleles To date, SLE susceptibility has been associated to dozens of genes by GWAS (25, 26) While these associations offer important new insights into SLE etiology, t here are logistical limitations to GWAS. Extremely large sample sets are required to achieve significant associations and extrinsic factors such as ethnicity, clinical history, and lifestyle must be considered in choosing these sets. Further, GWAS are ca pable of identifying genomic associations but do not characterize the function that an allelic variation confers. For this, other methods are required. Genetics of Lupus in Mice In inbred strains of mice, it is possible to test whether a disease phenotype is linked to specific regions of the genome. To identify susceptibility loci known as quantitative trait loci (QTL) susceptible strains are bred to resistant strains. A large cohort of N 2 (F1 backcrossed to one of the parental strains) mice is then ge nerated for phenotypic and genetic analysis. A genome wide scan is conducted on all N 2 mice using microsatellite markers that are polymorphic between the two parental strains. All mice are then assayed for selected phenotypes that are representative for the disease being studied and statistics are used to identify linkage between genetic regions and the selected phenotypes Linkage analyses have already led to the discovery of roughly 3,000 mouse QTL for various diseases (27)

PAGE 15

15 Congenic Dissection C ongenic dissection is an effective method to study the genetic factors that convey lupus susceptibility in the mouse because it offers the potential to study each locus, or identified susceptibility allele o f a gene, individually and within a controlled genetic background It involves the generation of recombinant congenic strains in which individual QTLs from susceptible strains are substituted onto the genome of a resistant strain (a lternatively, resistanc e loci can be substit uted onto the susceptible backgr ound). This relies on a marker assisted selection breeding protocol to reduce the number of generations it takes to remove contaminating donor genome from the unlinked regions (28) T his approach has proven successful in identifying genes responsible for other complex phenotypes such as: d ifferential isoform expression of Ly108 has been shown to contribute to the NZM2410 derived lupus susceptibility locus, Sle1b (29, 30) ; a complex rearrangement in the prom o ter region of Vnn3 ha s been shown to contribute to the A/J derived malaria susceptibility locus, Char9 (31) ; and a muta tion of Slc11a1 has been shown to result in the type 1 diabetes resistance of the B10 derived Idd5.2 locus (32) A common feature of linkage analyses is that they tend to identify QTLs that contain multiple physically linked genetic effects (27) To better define the location of the susceptibility allele (s) within the locus, genetic mapping is performed using subcongenic strains that are screened for the phenotypes associated with the locus. At this point, if the locus associated phenotype has broken down and maps to multiple loci, subsequent rounds of genetic mapping may be necessary If, however, the susceptibility locus maps to one sufficiently small genetic interval in which there are few (ideally one) genes, a complete functional characterization of the locus and genetic

PAGE 16

16 analyses of potential candidate genes can be performed. Optimal identification of the susceptibility allele would involve the discovery of genetic polymorphisms that result in variances in expression or function of the gene product. Definitive proof woul d require that the associated phenotype be reconstituted when the susceptibility allele is expressed on the resistant parental genome. Ultimately, animal models are employed to assist in studying human disorders. In this way, a collaborative approach shou ld be used where linkage analysis and congenic dissection methods in murine models leads to the identification of candidate genes that Murine models are also useful for candidate gene functional studies and drug testing before novel therapies can be tes ted in clinical trials (Figure 1 1). The NZM2410 Model of Murine Lupus The NZM2410 (NZM) mouse strain was derived from a ( NZB x NZ W ) F1 x NZW backcross followed by inbreed ing to homozygosit y (33) It was found to replicate the spontaneous lupus like disease with increased severity and without the sexual dimorphism observed in the parental NZB/W F1 strain. An a nalysis of a cohort of NZM x B6 F1 backcrossed to NZM identified an association between GN and three loci on Chromosomes 1, 3, and 7, which were then termed Sle1 Sle 2 and Sle3 respectively (34) Recombinant congenic strains revealed t hat though these loci were implicated in the autoimmune phenotypes, each individual locus was not sufficient to initiate the fulminate disease seen in the parent NZM strain (35) This is characteristic of complex genetic disorders such that the genetic factors contributing to SLE susceptibility do not individually cause disease but instead require epistatic interaction s for pathog enesis

PAGE 17

17 Proof of this model came in the form of the B6. Sle1/2/3 tripl e congenic strain, which r econstitut ed disease to a similar extent as that observed in the parental NZM strain (36) Phenotypic characterization revealed that Sle2 was associated with B cell hyperactivity and expansion of the B1a cell compar tment (37) Recently, cyclin dependent kinase inhibitor 2C ( Cdkn2c ) was identified as the cand idate gene for Sle2c1 a sublocus of Sle2 (38) A promoter polymorphism the in Cdkn2c was shown to result in decreased expression and consequent defective G1 arrest in B6. Sle2c1 splenic B cells and peritoneal cavity B1a cells. This results in expansion o f B 1a cells and aberrant differentiation of splenic B cells into plasma cells. Sle3 was initially associated with increased polyclonal and anti nuclear antibody production as well as GN susceptibility (35) This locus was later found to consist of two loci Sle3 and Sle5 that were each capable of causing disease when combined with Sle1 (39, 40) The increased GN severity caused by Sle3 was found to be attributable to a cluster of kallikrein genes that can regulate the development of anti glomerular basement membrane autoantibodies and have been associated with both SLE and spontaneous lupus nephritis in humans (41, 42) Sle1 had the strongest linkage and was characterized by loss of tolerance to nuclear antigen and B and T cell hyperactivation (35, 43) Import antly, Sle1 was found to be syntenic to the human SLE QTL 1q22 24 and 1q41 44 (44, 45) Also, it overlaps with SLE susceptibility loci from other mouse strains. These include Cgnz1 from NZM2328 Nba2 from NZB and Bxs3 from Bxsb. Yaa (46 49) Genetic mapping of Sle1

PAGE 18

18 subsequently revealed the presence of multiple susceptibility loci, which were termed Sle1a Sle1b and Sle1c (50) Sle1c is an ~7.5Mb NZW derived locus, beginning somewhere in the centromeric recombination interval between D1MIT459 and D1 MIT274 and extend ing to the telomere of Chromosome 1 (Figure 1 2 ) Importantly, Sle1c has been shown to accelerate autoimmunity in NZB x B6. Sle1c F1 mice validating it as a lupus susceptibility locus (51) Two loci appear to be contributing to the overall Sle1c phenotype This had been determined through B6. Sle1c subcongenic lines of mice that have since been discontinued. The first locus, Sle1c 1 is telomeric to D1MIT2 74 Its phenotypes include decreased humoral response to T depend e nt antigen and impaired germinal center (GC) formation and function (52) Evidence suggests a role for complement receptor 2 ( Cr2 ) and not compleme nt receptor related protein ( Crry Cr1l ) that is only 5.2Kb from Cr2 (53, 54) The NZW allele of Cr2 exhibits reduced binding of its C3d ligand and reduces signaling that is predicted to be due to a non synonymous coding SNP predicted to introduce a novel glycosylation site and inhibit receptor dimerization The second locus, Sle1c2 i s centromeric to D1MIT17 and is associated with T cell hyperactiv a t ion and proliferation, enhanced chronic graft versus host disea se and decreased T reg numbers (52) The next chapter details my further refinement of the Sle1c2 locus. The positional candidate genes centromeric to D1MIT17 have not been described as having roles in the immune system. Since Sle1c is syntenic to human C hromosome 1q31 32, which has been linked to SLE (55) elucidation of the genetic factors responsible for Sle1c2 is like ly to reveal novel pathways that may be utilized for improved therapies for human autoimmunity.

PAGE 19

19 Role of CD4 + T cells in SLE It has been 25 years since the initial classification of the T H 1 and T H 2 subsets CD4+ T cell subsets (56) Since then, several other subsets have been defined, most notably, T reg and T H 1 7 cells. As will be discussed in the next chapter, Sle1c2 confers T H 1 skewing and a T H 17 gene expression profile in congenic mice. In this section these f our subsets will be briefly described, followed by a detailed discussion of the roles of T H 1 and T H 17 cells in SLE pathogenesis. CD4 + T cells are classified into functional lineages based on the cytokines they produce. This is largely dictated by the circumstances in which they were activated as nave cells. T cells require 3 signals from antigen pres enting cells (APCs) for activation. For CD4 + T cells, signal 1 is comprised of cognate peptide/major histocompatibility complex II (pMHCII) engagement of T cell receptors (TCRs). Signal 2 is sent through costimulatory surface molecules, most notably, B7 molecules on APCs interacting with CD28 on T cells. Finally, signal 3 is received from soluble cytokine molecules both from the milieu in which activation is occurring and directly from the activating APC at the immune synapse. It is this last signal tha t determines the fate of the nave T cell. The m ain induction cytokine s for T H 1 cells are IL 12 and IL 18 (57) Receptor signaling is mediated by signal transducer and activator of transcription 4 (STAT 4 ) and IL 1 receptor associated kinase pathway respectively. The net result of this signaling in combination wi th TCR and coreceptor signaling is activation of the T H 1 master transcription factor T box expressed in T cell (T bet) and production of the major T H 1 cells promote response to intracellular pathogens, activation of phagocytes, class switching of B cells to IgG2a and IgG3, and delayed type hypersensitivity responses (58)

PAGE 20

20 Nave CD4 + T cells activated in the presence of IL 4 differentiate into T H 2 cells. The IL 4 receptor signals through STAT6 and induces transcription of the T H 2 master transcription factor, GATA3 (57) T H 2 cells are distinguished by their production of IL 4, IL 5, and IL 13, and they function to induce extracellular pathogen responses B cell class switching to IgG1 and IgE and eosinophil activation (58) Re gulatory T cells (T reg ), as their name implies, function to downregulate effector T cell responses. They come in two flavors, natural T reg and induced T reg (nT reg and iT reg respectively) (59) nT reg differentiate during thymic selection when there is sufficient a v i d ity between self pMHCII and TCR. iT reg differentiate in the periphery in the p 2. In addition, retinoic acid potently synergizes iT reg polarization. Forkhead box P3 (F ox P3) is the master regulator and IL 10 is the main cytokine of both nT reg and iT reg though several other soluble and surface mediators are in volved (60) There are also two additional inducible CD4 + T cell subsets with regulatory function. T R 1 cells are FoxP3 require IL 10 to differentiate, and p roduce IL (61) while iT R 35 cells are also FoxP3 require IL 10 and IL 35 to differenti ate, and produce IL 35 (62) The critical finding that IL 23 was essential for development of experimental au toimmune encephalomyelitis ultimately led to the discovery of T H 17 cells (63) IL 23, it turns out, is required for the maintenance of T H 17 cells. This lineage of T helper cells occurs when nave T cells are activated in the presence of proinflammatory IL 6 or IL 21 and anti RAR related orphan receptor gamma H 17 cells secrete autocrine IL 21 and IL 23 17 and IL 22 as effector

PAGE 21

21 cytokines. Their main function is to mediate immunity toward extracellular pathogens by recruiting neutrophils and inducing local antimicrobial responses by stromal tissues (64) It is also worth mentioning that, in addition to these four subsets, additional CD4 + T helper cell lineages have been discovered in recent years CD4 + T cells that are activated in the presence of IL 4 and TGF 9 producing T H 9 cells (65, 66) Like T H 17 cells, T H 22 cells produce IL 22 but appear to be a distinct subset in that they do not secrete IL 17 (67, 68 ) Located in germinal centers (GC), T FH cells are required for GC formation and maintenance and are noted for expression of their master transcription factor B cell CLL/lymphoma 6 (Bcl6) and of the GC homing cytokine chemokine (C X C motif) receptor 5 (CXCR5) (69) While they do produce IL 21, which aids B cell class switching in GCs, they also are capable of IFN IL 4, and IL 17 production. Thus, they are not characterized by a canonical cytokine per se, and it is no t clear if they are actually T H 1, T H 2, and T H 17 cells whose receptor affinity has allowed them to further differentiate into T FH T H 1 in SLE Upon the initial identification and functional description of the T H 1 and T H 2 subsets, the dogma soon developed t hat cell mediated autoimmune disorders, such as type 1 diabetes were T H 1 mediated while humoral autoimmune disorders, such as SLE were T H 2 mediated. Since then, evidence has mounted demonstrating a major role for T H 1 cells in SLE pathogenesis (58) It was, in fact, several years before the description of T H found to positively correlate with disease severity indicators anti DNA antibodies and low C3 (70) More recently, similar findings r eported greater numbers of peripheral cells (71) In addition more of

PAGE 22

22 the T H 1 inducing cytokine s IL 12 and IL 18 are found in the serum, glomeruli and urine from SLE patients and IL12, and IL 1 8 all correlate with the severity of GN (71 73) The T H 1 association with SLE is reflected in several animal models as well. Increased production in NZB/W F1 mice correlates with increa sed autoantibody levels and GN in these mice prevents these phenotypes (74, 75) Also, CD4 + T cells from mice congenic for the NZW derived Sle1 locus produce more in respon se to histone derived pMHCII stimulation than cells from non congenic mice showing that increased can specifically be a property of autoreactive T cells (43) In M RL/ lpr mice the findings were analogous to those in NZB/W F1 mice : more CD4 + resulting in increased spontaneous and T dependent production of T H 1 induced IgG2a and IgG3 antibodies (76) Finally, th e pristane induce d model of SLE is also characterized by requirement for T H 1 since / mice do not develop disease (77) While it is not certain why increased I severity, the class switching to IgG2a and IgG3 that is induced by T H 1 cells is likely to play a role. These isotypes are considered to be more pathogenic because as opposed to T H 2 induced IgG1, T H 1 induced IgG2 a and IgG3 are capable of fixing complement and can therefore cause more inflammation and tissue destruction (78) Taken together, T H 1 are vital to the pathology of SLE and thus targeting their dysregulation may prove to be therapeutically beneficial

PAGE 23

23 T H 17 in SLE 1 As previously mentioned, the role of T H 17 in the development of autoimmunity was initially scrutinized in murine models of induced EAE (79) This disease model was originally believed to be dependent on IL 12, and thus, T H 1 mediated. However, the revelation that IL 12 shared a subunit, p40, with a newly discovered cytokine, IL 23, and that this novel cytokine, not IL 12, was required for induction of disease set the stage for investigation of T H 17 in these models (63, 80) More recently, several lines of research have reported increased IL 17 production and T H 17 functions in murine models of lupus as summarized Table 1 2 IL 17 in mur ine lupus BXD2 is one of 20 BXD recombinant inbred strains derived from a cross between C57BL/6J (B6) and DBA/2J (81, 82) These mice develop a spontaneous and age dependent lupus like syndrome denoted by production of the canonical anti DNA, anti histone, and rheumatoid factor autoantibodies, as well as splenomegaly, glomerulonephritis (GN), and erosive arthritis (83, 84) CD4 + T cells from BXD2 mice have enhanced T H 17 development and consequent i ncreased serum levels of IL 17 (85) Moreover, IL 17 secreting CD4 + cells were shown to localize to germinal centers (GCs) in BXD2 spleens. This augmented IL 17 response was associated with increase GC development and stability in BXD2 spleens as compared to B6 controls. Additionally, BXD2 have increased amounts of IL 17R + B cells (85) These B cells have both an increased basal and an IL 17R induced acti pathway, resulting in an increased expression of regulator of G signaling (RGS) proteins 1 Reprinted with permission from Arth ritis Hindawi Publishing Company, 2011 Daniel Perry et al.

PAGE 24

24 (86) subunits resulting in decreased chemotaxis (87, 88) Indeed, BXD2 B cells were shown to have a diminished chemotactic response to CXCL12 and CXCL13, especially in the presence of IL 17 (85, 86) This increased potential for B cell accumulation at the sites of CXCL12 and CXCL13 production, such as follicular dendritic cell rich areas (89, 90) is the likely cause of the enhanced GC formation in the BDX2 strain. Moreover, the concurrent production of IL 17 by T H 17 cells in GCs further promotes B cell accumulation and GC stability. IL 17 also results in increased activation induced cytidine deaminase ( Aicda ) expression and somatic hypermutation in BXD2 I L 17R + B cells, which have an intrinsically enhanced ability to produce autoantibodies as compared to IL 17R deficient BDX2 B cells (85) Thus IL 17 has a central role in pathogenesis of the lupus like syndrome observed in this model. The MRL/ lpr strain is a classical model of spontaneous lupus. It exhibits a lymphoproliferative disorder which manifests with au toantibody production, GN and accumulation of CD4 CD8 double negative T (DNT) cells in the periphery (91) A mutation in Fas is responsible for the lpr phenotype and is the major functional contributor of pathogenesis in this strain (92, 93) It was recently shown that Fas deficient DNT cells are capable of producing significant amounts of IL 17 (94) Further, the T H 17 stablizing cy tokine, IL 23, potently induced IL 17 production in these DNT cells that were then capable of renal infiltration and GN induction. Finally, deletion of IL 23R prevented splenomegaly, lymphadenopathy, autoantibody production, and GN in the context of Fas d eficiency and was associated with a major reduction of the DNT cell compartment along with its concomitant IL 17 production (95) Thus, a pathogenic

PAGE 25

25 TH17 like function of DNT cells has been exposed, highlighting th is subset as a target for disease intervention. The SNF1 mouse model, derived from the F1 outcross of the New Zealand Black and SWR recombinant inbred strains, develops a spontaneous lupus like syndrome that can be accelerated by immunization of nucleosom al peptides (96) Upon disease induction, autoantibodies are produced and GN with TH17 infiltration is initiated (97) Interestingly, low dose therapy of a tolerogenic hist one derived peptide caused increased TGF 6 expression in dendritic cells and resulted in enhancement of Treg function with a reduction in TH17 renal infiltrates (97) Treatment with either oral o r nasal anti CD3 also ameliorate d autoantibody production and nephritis in this model by inducing a regulatory T cell subset and reducing IL 17 production by T follicular helper cells (98, 99) These results indic ate that therapies regulating T reg /T H 17 homeostasis in favor of T reg might be effective at moderating SLE pathogenesis. Finally, disruption of TNF prone NZM2328 mice results in exacerbated disease that associated with a greatly enhanced T effector/memory compartment. These cells were found to have a T H 17 gene signature and produced more IL 17 than TNF ptor sufficient T effector/memory cells (100) This work highlights a TNF regulatory function and raises a note of caution for TNF IL 17 in SLE patients As with murine lupus models, evidence f or a T H 17 role in human SLE is also mounting. Several recent reports show that plasma IL 17 and IL 17 producing T cells are increased in SLE patients (101 106) Moreover, disease activity and severity is

PAGE 26

26 associated with increased IL 17 production (101 104) SLE patients have increased phosphorylation of STAT3 (107) which is required for T H 17 differentiation, as STAT3 deficiency in hyper IgE syndrome patients results in the ablation of T H 17 cells (108, 109) The T H 17 polarizing cytokines, IL 6, IL 21, and IL 23, all signal in a ST AT3 dependent manner to induce production (110) Indeed, SLE patients also have inc reased plasma levels of IL 6, and higher R ORC expression (102, 111 ) Taken together, T H 17 expansion is an important feature of SLE that needs to be further investigated. Since IL 17 productio n correlates with disease severity, the question is raised as to whether the female bias of SLE is due to differences in T H 17 biology. While this has not been studied extensively, production of IL 17 in vitro was shown to decrease with age in m en but not in women (112) Although these results do demonst rate a gender difference, the relevance to SLE induction is not clear since the young cohorts, who were between 21 and 40 years old ( the highly susceptible age of onset for SLE ) did not produce different amounts of IL 17 in males versus females. Neverthel ess, the ability to maintain higher levels of IL 17 production with age may contribute to the maintenance of the disease state in females. More recently, it was reported that in vivo treatment of mice with estrogen enhances T H 17 polarization in vitro sup porting the hypothesis that T H 17 cells contribute to the female bias of SLE (113) There is, however, no direct evidence for this theory and further study is needed to clarify the role that gender may play in T H 17 f unction and disease induction. Similar to Fas deficient mouse models of lupus, a significant amount of IL 17 is also produced by an expanded subset of DNT cells in SLE patients (105) These DNT

PAGE 27

27 cells are derived fr om CD8 + cells that have downregulated CD8 in response to receptor stimulation (114) While they are normally present in very small amounts, their expansion in SLE patients may be due to increased T cell activation. Because of their downregulated co receptor, they have decreased survival and proliferation and display uni que gene expression patterns and proinflammatory cytokine profiles (114) Notably, as in lupus prone mice, DNT cells can be found in kidney biopsies of SLE patients (105) Therefore, DNT cells appear to represent a distinct effector population of T cells whose dysregulation may b e central to SLE pathogenesis. The fundamental role of type I IFN dysregulation is well established in SLE pathogenesis (7) Unregulated IFN proinflammatory cytokine production, including for IL 6 and IL 23 that lead to T H 17 mediated inflammation in mice (115) Also plasmacytoid dendritic cells (pDCs), which are known to potently secrete IFN 6, and IL 23 in response to Toll like receptor (TLR) 7 stimulation in human studies (116, 117) These pDCs are capable of inducing T H 17 differentiation when co cultured with CD4 + cells. Endogenous nucleic acids are autoantibody targets in SLE and are capable of TLR activation follo wing their uptake as immune complexes (1, 118) Therefore, pDCs can be chronically activated, potentiating T H 17 development and disease pathogenesis. IL 17 also promotes B cell survival both alone and synergisti cally with B cell activating factor (BAFF) (104) Hence, a feedback loop is established where IL 17 promotes autoreactive B cells to persist longer and make autoantibodies which activate pDCs to induce more T H 17 ce lls. In parallel, the expansion of DNT cells results in more IL 17 production, exacerbating this progression (Figure 1 3 ). As IL 17 is a central

PAGE 28

28 mediator to this process, therapeutic intervention that targets T H 17 development and IL 17 production will be valuable treatments for SLE.

PAGE 29

29 Table 1 1. 1997 Update of the 1982 American College of Rheumatology Revised Criteria for Classification of Systemic Lupus Erythematosus (3, 4) Criterion Description 1. Malar Rash F ixed erythema, flat or raised, over the malar eminences, tending to spare the nasolabial folds 2. Discoid rash Erythematous raised patches with adherent keratotic scaling and follicular plugging; atrophic scarring may occur in older lesions 3. Photosen sitivity Skin rash as a result of unusual reaction to sunlight, by patient history or physician observation 4. Oral ulcers Oral or nasopharyngeal ulceration, usually painless, observed by physician 5. Nonerosive Arthritis Involving 2 or more peripher al joints, characterized by tenderness, swelling, or effusion 6. Pleuritis or Pericarditis 1. Pleuritis -convincing history of pleuritic pain or rubbing heard by a physician or evidence of pleural effusion OR 2. Pericarditis -documented by electr ocardigram or rub or evidence of pericardial effusion 7. Renal Disorder 1. Persistent proteinuria > 0.5 grams per day or > than 3+ if quantitation not performed OR 2. Cellular casts -may be red cell, hemoglobin, granular, tubular, or mixed 8. Neuro logic Disorder 1. Seizures -in the absence of offending drugs or known metabolic derangements; e.g., uremia, ketoacidosis, or electrolyte imbalance OR 2. Psychosis -in the absence of offending drugs or known metabolic derangements, e.g., uremia, ke toacidosis, or electrolyte imbalance 9. Hematologic Disorder 1. Hemolytic anemia -with reticulocytosis OR 2. Leukopenia -OR 3. Lyphopenia -OR 4. Thrombocytopenia -<100,000/ mm3 in the absence of offending drugs 10. Immunologic Disorder 1. Anti DNA: antibody to native DNA in abnormal titer OR 2. Anti Sm: presence of antibody to Sm nuclear antigen OR 3. Positive finding of antiphospholipid antibodies on: a. an abnormal serum level of IgG or IgM anticardiolipin antibodies, b. a positive test result for lupus anticoagulant using a standard method, or c. a false positive test result for at least 6 months confirmed by Treponema pallidum immobili zation or fluorescent treponemal antibody absorption test 11. Positive Antinuclear Antibody An abnormal titer of antinuclear antibody by immunofluorescence or an equivalent assay at any point in time and in the absence of drugs

PAGE 30

30 Figure 1 1 Inte gration of human and murine studies for new SLE drug discovery. Study of human SLE patients and mouse models of lupus has led to the identification of potential therapeutic targets. In depth studies in murine models are undertaken to validate the associati on of the potential targets with disease symptoms. The efficacy of targeted treatments is first tested on murine models of lupus prior to the initiation of human clinical trials. 2 2 Reprinted with permission from Journal of Biomedicine and Biotechnology Hindawi Publishing Comp Murine Models of Systemic Lupus Erythematosus

PAGE 31

31 Figure 1 2. Map of the Sle1c locus at the beginning of the project. All MIT microsatellite markers are shown, where black denotes a polymorphic and gray a non informative marker for B6 and NZW. Positions of known protein coding genes are shown. The recombination interval is between D1MIT459 and D1MIT274

PAGE 32

32 Table 1 2 IL 17 in murine models of lupus 3 Model Description References BXD2 IL 17 promotes spontaneous GC development as well as autoantibody production by IL 17R + B cells (85, 86) MRL. lpr Expansion o f IL 17 producing DNT cells with kidney infiltration and GN induction (94, 95) SNF1 Enhanced IL 17 production by CD4 + T cells with kidney infiltration (97) NZM2328 Disrupt (100) 3 Reprinted with permission from Arthritis Hindawi Publishing Company, 2011 Daniel Perry et al.

PAGE 33

33 Figure 1 3 IL 17 in SLE pathogenesis. IL 17, IL 21, and BAFF promote survival, class switching, and production of antinuclear autoantibodies by autoreactive B cel ls. Consequently, nucleic acid containing immune complexes stimulate pDCs to produce type I interferon, IL 6, and IL 23, which enhance DC activation, and T H 17 induction, thus completing a feedback loop for autoimmune activation. Concurrently, hyperactiva tion in the context of autoimmunity may actuate the accumulation of DNT cells that produce more IL 17 and exacerbates the disease state. Ultimately, T H 17 and DNT cells infiltrate systemic tissues and incite end organ disease 4 4 Reprinted with permission from Arthritis Hindawi Publishing Company, 2011 Daniel Perry et al.

PAGE 34

34 CHAPTER 2 MURINE LUPUS SUS CEPTIBILITY LOCUS SLE1C2 MEDIATES CD4 + T CELL HYPERACTIVATION AND MAPS TO ESTROGEN REL ATED RECEPTOR GAMMA ESRRG To review from chapter 1, p atients afflicted with SLE suffer an assortment of symptoms that can affect any organ system and that va ry in nature and severity throughout disease progression. The most common indicator of SLE is the presence of antinuclear autoantibodies (ANA) that aberrantly target nuclear antigens, such as double stranded DNA (dsDNA), histone and chromatin complexes, a nd ribonucleoproteins. The resultant immune complexes then aggregate in basement membranes, triggering inflammation and tissue damage. A common complication of SLE occurs when this process takes place in the kidney, a condition known as glomerulonephriti s (GN), leading to kidney failure and death. The murine NZM2410 recombinant inbred strain spontaneously develops a lupus like disease that closely mimics SLE in humans. Derived from the classic NZB/W F1 murine lupus model, it has an advantage over its pa rental strains in that it is homozygous, making it an ideal model to identify novel genetic determinants of lupus (reviewed (47, 119) Linkage analysis of NZM2410 to GN identified the major lupus susceptibility loc us, Sle1 as an NZW derived interval on C hromosome 1 beginning at D1MIT30 and extending to the telomere (34) This region overlaps syntenic human SLE QTLs, 1q22 23 and 1q41 42, suggesting that similar genetic facto rs mediate pathogenesis in both species (44) }. Subsequent studies using congenic mice demonstrated distinct functional requirements th a t Sle1 imparted in the induction of mur ine lupus. Specifically, B6. Sle1 mice display B and T cell intrinsic loss of tolerance to nuclear antigens (35, 43, 120, 121) Still, the underlying genetic

PAGE 35

35 determinants of SLE pathogenesis remained obscure in thi s 62Mb region which contains an estimated 350 genes. The challenging process of candidate gene identification employed extensive phenotypic mapping and has so far revealed that at least five genes are responsible for the Sle1 phenotype. Initially, three subloci, Sle1a Sle1b and Sle1c were found to contribute to the production ANA, revealing the complex genetics of this locus (50) Then Sle1a and Sle1c were themselves determined to correspond to at least two subloci, yielding Sle1a1 Sle1a2 Sle1b Sle1c1 and Sle1c2 as the five current subloci of Sle1 (52, 122) Complement receptor 2 ( Cr2 ) was the first candidate gene for Sle1c and subsequently found to co segregate with the telomeric Sle1c1 (52, 53) Ensuing human association studies confirmed thes e findings by identifying a haplotype that alters CR2 splicing (123, 124) Additionally, the effect of Sle1b has been attributed to polymorphisms in the signaling lymphocytic activation molecule (SLAM)/CD2 gene clu ster, with direct evidence for one SLAM family member Ly108 (29, 30) Finally, though not yet validated, pre B cell leukemia transcription factor 1 Pbx1 is the only positional candidate for Sle1a1 (122) Thus, three novel lupus susceptibility candidate genes have been identified within the Sle1 interval T cell hyperactivation and dysregulation of their effector cytokines are central to SLE pathogenesis, thus they are ide al targets for novel therapies (125, 126) We have previously reported that a sublocus at the centromeric end of Sle1c termed Sle1c2 is associated with increased activation and proliferation of CD4 + T cells (52) In th is chapter I describe the map ping of Sle1c2 to Estrogen related receptor gamma ( Esrrg ) gene

PAGE 36

36 regulation of transcriptional programs mak e it a therapeutic candidate. Additionally, I H 1 cells in congenic B6. Sle1c2 mice. Finally, I demonstrate the pathogenicity of these traits in two lupus accelerating dis ease models. Materials and Methods Mice B6. Sle1c mice that contain a NZW derived congenic interval at the telomere of C hromosome 1 have been described previously (50) The loci previously referred to as Sle1c.Cr2 w 1 and Sle1c.Cr2 b 1 in that a previous study (52) have been renamed Sle1c1 and Sle 1c2 respectively to be more consistent with the terminology of other loci. To generate subcongenic strains, B6 x B6. Sle1c F1 mice were backcrossed to B6 and the progeny were tested for recombinations in the Sle1c interval by genotyping microsatellites tha t are polymorphic between NZW and B6. Individuals that were positive for recombinations were bred to B6 and the progeny of this expansion backcross were screened for the subcongenic interval as above and then bred to homozygosity. To fine map the ends of congenic intervals, positional SNPs that are polymorphic for B6 and NZW were selected from Mouse Phenome Database ( http://phenome.jax.org/SNP ) and flanking primers were used in BigDye Terminator (ABI) sequencing reactions to determine alleles. B6.Cg Tg(TcraTcrb)425Cbn/J (B6.OTII) (127) and B6(C) H2 Ab1 bm12 /KhEgJ (B6.bm12) were purchased from The Jackson Laborator y B6 .FoxP3 eGFP knock in mice (128) were a kind gift from Vijay Kuchroo. Bicong enic B6. Sle1c2 mice containing the OTII transgene or the FoxP3 eGFP knock in locus were generated as above. B6.129P2 Tcrb tm1Mom Tcrd tm1Mom /J (B6. Tcrbd / ), B6.129S2 Ighm tm1Cgn /J (B6. Mu MT) and B6.Cg Igh a Thy1 a Gpi1 a /J

PAGE 37

37 (B6. Thy1 a ) mice were purchased from The J ackson L aborator y and used for mixed bone marrow experiments. NZB mice were purchased from The Jackson Laborator y and used to generate B6 x NZB F1 and B6. Sle1c2 x NZB F1. All mice were bred and maintained at the University of Florida in specific pathogen free conditions. All experiments were conducted according to protocols approved by the University of Florida Institutional Animal Care and Use Committee. Cell Isolation and Culture Single cell suspensions were prepared by mechanically disrupting spleen a nd lysing red blood cells in 155mM NH 4 Cl for 3 minutes at room temperature. Cells were then washed in ice cold 5% FCS in PBS and passed through 30m nylon mesh to remove debris. Splenocyte suspensions were enriched for CD4 + T cells by labeling with magne tic beads and negatively selecting on magnetic columns using CD4 + T cell + cells into Nave and T em populations, splenocytes from 3 mice were first enriched for CD4 + T cells as above and po oled, then labeled with fluorescently conjugated anti bodies against CD4, CD62L, and CD44 and sorted (Nave: CD4 + CD44 lo CD62L + and T em : CD4 + CD44 hi CD62L ) by a FACSAria cell sorter (BD Biosciences). RPMI supplemented with 10% FCS, HEPES, 2 Mercaptoethanol, a nd penicillin streptomycin was used as culture medium. Cells were stimulated either with plate bound antibody, by pre coating with 5l/ml anti CD3e (145 2C11) and 2.5l/ml anti CD28 (37.51) in PBS, or with 0.5g/ml phorbol 12 myristate 13 acetate and 1M ionomycin. For antigen specific proliferation assays, total splenocytes from B6 mice were irradiated with 2000Rad and pulsed for 2 hours at 37C with either OVA 323 339 or H 476 90 at the indicated concentrations. These were then co cultured 1:1 with bead enriched CD4 + T cells from OTII mice in triplicate. 3 H Thymidine was added

PAGE 38

38 at 1Ci/200l for the last 18 hours of 72 hour cultures to measure proliferation. Cells were then harvested onto glass filter paper and counts per minute were measured using a liq uid scintillation counter. For T H 17 polarization, CD4 + T cells were cultured with plate bound anti CD3e and anti CD28, 2.5ng/ml TGF 6 for 48 hours. For Treg culture, FACS sorted CD4 + GFP T cells from FoxP3 eGFP mice were cultured with p late bound anti CD3e and anti CD28, and 2.5ng/ml TGF all trans retinoic acid (atRA). Flow Cytometry Cell suspensions were blocked with 10% normal rabbit serum and anti CD16/32 (2.4G2) in staining buffer (5% FCS, 0.05% sodium azide in PBS) and incubated on ice for 30 minutes. Biotinylated or fluorophore conjugated antibodies specific for CD3 Molecular Complex (17A2), CD4 (RM4 5), CD8a (53 6.7), CD44 (IM7), CD62L (MEL 14), CD25 (7D4), CD69 (H1.2F3), CD90.1 (OX 7), CD90.2 (53 2.1), B220 (RA3 6B2), CD19 (1D3), IgM (II/41), CD80 (16 10A1), CD86 (GL1), I Ab (AF6 120.1), and isotype controls were used in predetermined amounts and combinations for surface staining by incubating on ice for 1 hour. When needed, streptavidin peridinin chlorophy ll a protein Cy5.5 (SA PerCP Cy5.5, BD Biosciences) was used to detect biotinylated antibodies by (XMG1.2), IL 4 (11B11), IL 17A (TC11 18H10), and FoxP3 (FJK 16s) were detecte d antibodies were from BD Biosciences except for anti FoxP3, which was from eBiosciences. After staining, cell suspensions were washed and stored in staining buffer with 1% formalin at 4C until analysis on a FACSCalibur cytometer (BD Biosciences). At least 50,000 events per sample were collected and lymphocyte

PAGE 39

39 populations were gated based on forward and side scatter characteristics. When cytokine profiles were analyzed cells were treated with leukocyte activation cocktail (BD Gene Expression Analyses Total cellular RNA from prepared cell suspensions, cerebrum, liver, heart, and kidney was isolated using RNeasy mini kits, Qiashredders, and RNase free DNase sets (Qiagen). cDNA was then synthesized using the ImProm II Reverse Transcription Primer3 software (129) and tested for specific generation of desired amplicons using standard PCR. Suitable primers ( Table 2 1 ) were used in Sybr Green (Applied Biosystems) based Real Time PCR. Taqman Gene Expression Assays (Applied Biosys tems) were used to measure Esrrg (Mm00516269_mH) and Gapdh endogenous control. Relative q uantities were calculated using the comparative C T method (RQ=2 T of the B6 biogroup. Global gene expression of CD4 + T cells from 6 month old B6 and B6. Sle1c2 mice (n=5 per strain) began with RNA isolation from bead sorted splenocytes as above. Next, cDNA was synthesized, fragmented, and biotin labeled using the Ovation Biotin RNA Amplification and Labeling System (NuGEN Technologies ). Finally, prepared cDNA was hybridized to Affymetrix (130) as presented elsewhere (131) ELISA Anti dsDNA and anti chromatin were measured by ELISAs as previously described (43) Sera were tested in duplicate in a 1:100 dilution. Relative units were

PAGE 40

40 standardized using a positive serum from an NZM2410 mouse, arbitrarily setting the reactivity of a 1:100 dilution of this control serum to 100 units. W estern Blot To detec in ice cold RIPA lysis buffer (50mM NaF, 2mM activated sodium orthovanadate, 2mM PMSF, 2g/ml aprotinin, 10g/ml leupeptin, and 1g/ml pepsatin A, 1% Nonidet P 40, 0.5% sodium deoxychola te, 1% SDS in PBS; all reagents from Sigma), and aggregates were removed by centrifugation. The p rotein concentrations of homogenates were quantified using a Bradford Assay (Bio Rad). Total proteins (50g) were boiled for 5 minutes in Laemmli buffer, and then separated by SDS P AGE in 10% gels, followed by transfer to polyvinylidene fluoride membranes. After blocking in 5% milk in TBS T, membranes were probed with anti Clean Blot Detection Reagent HRP (Thermo Scientific), and developed with Amersham ECL Plus Western Blotting Detection Reagent (GE Healthcare). Mixed Bone Marrow Chimera Chimeras were prepared as previously described (121) Briefly, 4 5 month old B6. Tcr / recipients were lethally irradiated with two doses of 525Rad 4 6 hours apart the day before reconstitution. Donor bone marrow cell suspensions f rom B6. Thy1 a and B6. Sle1c2 were mixed 1:1 after depleting T cells using anti CD5 magnetic microbeads (Miltenyi). Recipients received 10 7 cells intravenously from sex matched donors and grafts were allowed to reconstitute for 8 weeks. In a parallel experi ment, hosts were 2 month old B6 and donors were B6. Mu MT and B6.Tcrbd / or B6. Sle1c2 Mu MT and B6.Tcrbd / These chimeras were engineered to have B or T cells of B6. Sle1c2 origin. After reconstitution, these chimeras were used as cGVHD recipients.

PAGE 41

41 Chroni c Graft Versus Host Disease ( cGVHD ) cGVHD was induced as previously described (132) Br ie fly, B6 and B6. Sle1c2 hosts received 8 x 10 7 B6.bm12 splenocytes via i.p. injection. In another experiment, cGVHD was induced in B6. Mu MT/B6. Tcrbd / B6. Mu MT/B6. Sle1c2 Tcrbd / and B6. Sle1c2 Mu MT/B6. Tcrb d / mixed bone marrow chimeras. Sera were collected weekly for 3 weeks after induction and stored for ELISA. Hosts were sacrificed 3 weeks after transfer, kidneys were prepared for histology, and splenocytes were analyzed by FACS. The presence of immun e complexes in the kidneys was evaluated on frozen tissue sections stained with FITC conjugated anti C3 (Cappel) and anti IgG H+L chains (Jackson Immunoresearch). Staining intensity was evaluated in a blind manner on a semi quantitative 0 3 scale and aver aged on at least 10 glomeruli per section. EAE Induction of experimental autoimmune encephalomyelitis (EAE), a well characterized animal model of m ultiple s clerosis, has been previously described (128, 133) On da y 0, four month old male B6 or B6. Sle1c2 mice were anesthetized and sequence 35 55 (MOG 35 55 ) and 50 ubcutaneous injection to the left of the base of the tail. Additionally, 200ng pertussis toxin was administered i ntraperitoneally on days 0 and 2. Daily clinical scores were assessed by the following criteria: 0, no disease, 1, flaccid tail, 2, hind limb paraparesis, 3, hind limb paralysis, 4, quadriplegia, 5, moribund. Mice were euthanized at a score of 4 and not allowed to progress to a moribund state.

PAGE 42

42 Statistical A nalysis Statistical analyses were performed using the GraphPad Prism 4 software. Unless indicated, graphs sho w median values for each group Mann Whitney t tests were used for direct comparisons and Bonferroni correction s w ere used for multiple comparisons as indicated Each in vitro experiment was performed at least twice with reproduc ible results. Results CD4 + T Cell Hyperactivation Maps to the Centromeric E nd of Sle1c In order to narrow the set of potential candidate genes responsible for the CD4 + T cell hyperactivation displayed by Sle1c congenic mice, several subcongenic strains wer e generated in which recombinations at the centromeric end were targeted using microsatellite markers that are polymorphic between B6 and the parental NZW. Additional fine mapping was performed using polymorphic SNPs. This revealed a 675Kb NZW derived ce ntromeric extension between rs31626695 and rs49456336 in two of the subcongenic strains, REC2b and REC5, and the original B6. Sle1c strain (Figure 2 1 A ). In addition, it redefined the centromeric terminus of Sle1c from D1MIT459 to rs30920616, shortening th e locus length to 7.39Mb. Phenotypic mapping showed that only the strains with this centromeric extension displayed increased spleen weight and CD4:CD8 T cell ratio in aged mice as compared to B6 (Figure 2 2A). Additionally, these strains displayed hype ractivation of the CD4 + T cell compartment as they had a significantly higher percentage of CD69 + activated T cells and of CD44 hi CD62L T effector/memory cells (T em ). Since the strain with the shortest interval necessary for CD4 + T cell hyperactivation is the REC5 subcongenic, and REC1, 2, 3, and 8 are negative, Sle1c2 is then defined as the region between

PAGE 43

43 SNPs rs30920616 and rs32528185 (Figure s 2 1A, 2 1 B). E xcept where noted, REC5 is used as B6. Sle1c2 for the remainder of this study. As opposed to the s plenomegaly phenotype, which is age dependent, the CD4 + hyperactivation phenotype is detectable in very young mice (Figure s 2 2B 2 3 A ), indicating a more direct effect of the Sle1c2 interval for this phenotype. Importantly, as previously shown for the en tire Sle1c interval (52) mixed bone marrow chimera experiments show that CD4 + hyperactivation is intrinsic to Sle1c2 T cells (Figure 2 3 B). As expected, the previously observed increased proliferation of B6. Sle1c CD4 + T cells also co segregated with the Sle1c2 interval (Figure 2 2 C ). This inherent hyperactivation and resultant proliferation results in an overall expansion of the CD4 + T cell compartment, specifically T em not nave CD4 + T cells (Figure 2 2B) Mod est age dependent expansions of B cell and CD8 + T cell compartments were also observed in B6. Sle1c2 mice (Figure 2 2B ), however, surface phenotype analysis found no evidence of hyperactivation in these cells (not shown). Taken together, the CD4 + T cell hy peractivation phenotype observed in mice congenic with the 7. 39 Mb NZW derived Sle1c interval has been shown to co segregate with the much shorter 675Kb Sle1c2 interval. This drastically reduces the set of potential candidate genes from 48 to 2 (Figure 2 1 B ). Sle1c2 E xhibits a U nique C ytokine P rofile D enoted by M arked T H 1 S kewing A gene expression and pathway analysis of B6 and B6. Sle1c2 CD4 + splenocytes H 1 skewing in B6. Sle1c2 mice (Figure s 2 4 A, 2 4 B ). Intracellular staining of splenocytes confirmed this finding, as a much larger percentage of CD4 + splenocytes from B6. Sle1c2 + as compared to B6 (Figure 2 5 A ). No differences were observed

PAGE 44

44 in percentages of IL 4 T H 17/T reg homeostasis were upregulated in B6. Sle1c2 CD4 + T cells (Figure 2 5 B ). These included genes encoding the master transcription factor, Forkhead Box P3 ( FoxP3 ) a major surface marker, in ( Il2ra ) and a major effector cytokine, ( IL10 ) for T reg cells (134) as well as the required transcripti on factors, interferon regulatory factor 4 ( Irf4 ) and RAR related orphan receptor alpha ( Rora ) and effector cytokines, Il17a IL21 and Il22 for T H 17 cells (64) Additionally, the aryl hydrocarbon receptor ( Ahr ) which has been implicated in T H 17/T reg homeostasis (135) was also upregulated. In spite of this marked T H 17/T reg si gnature, in vitro and in vivo analyses did not reveal a propensity to favor either of these subsets. Incorporation of a FoxP3 eGFP reporter allele (128) in B6 and B6. Sle1c2 mice showed that, contrary to our previous reports that measured T reg as CD4 + CD62L + CD25 + (52, 136) there is a slight age dependent accumulation of T reg (Figure 2 3 C ). However, B6. Sle1c2 CD4 + GFP T cells trans retinoic acid (atRA) had an unaltered percentage of FoxP3 expressing cells (Figure 2 3 D ). To measure T H 17 po larization, CD4 + 6. This also did not reveal differences in IL 17 production between the two strains (Figure 2 5 C ). Finally, EAE was used as model to test for differences in T H 17/T reg homeostasis in vivo (137) and once again, no differences were observed in day of onset or severity (Figure 2 5 E ). Notably, Sle1c2 CD4 + T cells was increased in vitro especially under T reg and T H 17 polarizing conditions (Figure 2 5 C), highlighting the T H 1 skewing induced by Sle1c2 Hence, while the global gene expression analysis predicted i ncreased

PAGE 45

45 commitment to T H 1, T reg and T H 17 lineages, the only observed difference was with T H 1 cells. Esrrg is D efectively R egulated in B6. Sle1c2 CD4 + T C ells The 675Kb Sle1c2 interval contains just 2 known genes, Esrrg and Usher syndrome 2A homolog ( Ush 2a ) (Figure 2 1B ), with the latter having no detectable expression in CD4 + cells (data not shown). Contrary to Ush2a Esrrg was detectable in CD4 + splenocytes (Figure 2 6 A ). Furthermore, there was significantly less expression of Esrrg in CD4 + (40.611.4 % less, p<0.001) but not in CD4 splenocytes from B6. Sle1c2 compared to B6. Like the CD4 + T cell activation phenotype, there were no gender differences in Esrrg expression in age matched mice of both strains Regardless of age or strain, Esrrg expressio n showed a strong negative correlation with both CD69 + and T em percentages (Figure 2 6 B ), indicating a direct effect on CD4 + T cells activation. These findings qualify Esrrg as the candidate gene for Sle1c2 Since Esrrg coding sequence or UTR sequence d ifferences were not found at the DNA level between the two strains, the causative allelic differences were predicted to lie in promoter or enhancer elements. As is the case for many nuclear receptors, Esrrg utilizes alternative promoters to encode transcr (Figure 2 1B) (138) While the promoters for this gene have not been thoroughly described, two of the transcripts have the same first exon (though they have slightly different transcript starts), and were thought to share a proximal promoter. The SNP that defines one end of the centromeric recombination interval of Sle1c2 rs31626695, lies at 156 and 197 relative to these two transcript start sites However, an in silico analysis (139) did not define this region as a relevant transcription factor binding site, regardless of allele. Furthermore, it is outside of the highly conserved constrained element that

PAGE 46

46 encompasses roughly 100bp of promoter and the entire first exon of these transcripts. Therefore, rs31626695 is likely not the causative allele. Sequencing from 450 to +1 revealed only 1 other allelic dif ference between the two strains A missing adenosine in a series of 10 adenosines was found in NZW derived Sle1c2 at 260 relative to the beginning of transcript 1. Again, this area was not conserved and the missing adenosine is not predicted to affect t ranscription factor binding. A third transcript begins outside of the Sle1c2 interval so there would not be genetic differences in that promoter (Figure 2 1B ). Therefore, unless there are other unknown alternative promoters, as was the case for the murin e paralog of Esrrg Estrogen receptor 1 (alpha) ( Esr1 ) (140) I theorized that the decreased Esrrg expression by Sle1c2 is li kely attributable to a polymorphism affecting an enhancer element. Deep sequencing of the Sle1c2 locus is currently underway to reveal potential causative genetic differences. Because Esrrg is known to be active in highly metabolic and in central nervou s system tissues (141 144) cDNA from brain, heart, kidney, and liver from adult mice w as examined to determine if Sle1c2 resulted in differential regulation of Esrrg in these tissues as well. A trend for decreased expression was observed in kidney and liver, and in brain, Esrrg expression was significantly decreased (Figure 2 7C ). Interestingly, an increased expression trend was observed in heart. Esrrg deficient mice die postnatally due to a defective switch fro m glycolytic to oxidative metabolism (145) Consistent with Esrrg / mice, B6. Sle1c2 mice also struggle to thrive and roughly three quarters of neonates die by day 2 (data not shown). It is possible that in respon se to failed Esrrg expression, a compensatory mechanism may allow for Esrrg to be upregulated in the myocardium of a small percentage of neonates, resulting in survival.

PAGE 47

47 To determine if decreased expression of Esrrg in CD4 + T cells had transcriptional co nsequences in its putative target genes, a set of genes that were differentially expressed by B6. Sle1c CD4 + T cells in the gene expression analysis and were also on chip analysis (145, 146) were analyzed by quantitative RT PCR. Five of the twelve genes analyzed had significantly decreased expression (Figure 2 7D ). These included transcriptional regulators, c myc binding protein ( Mycbp ) and retinoic acid receptor a lpha ( Rara ) a subunit of electron transport complex I, NADH dehydrogenase (ubiquinone) Fe S protein 1 ( Ndusf1 ) a mitochondrial protein modifier, peptidylprolyl isomerase F ( Ppif ) and a mitochondrial oxidoreductase, reticulon 4 interacting protein 1 ( Rtn 4ip1 ) These data suggest that the decreased Esrrg expression induced by Sle1c2 can a ffect Esrrg target gene expression. in CD4 + cells, this data remains circumstantial The overall expression of Esrrg in CD4 + T cells is low compared to other tissues. Liver had roughly 4 times, while kidney and brain had about 50 times the amount of Esrrg transcripts as CD4 + T cells after normalizing to Gapdh (Figure 2 6C ). Low mess age expression correlated with low protein expression detectable by flow cytometry (data not shown). It was detectable by immunoblotting (Figure 2 6D ), but the differences observed in mRNA expression could not be confirmed in the protein levels using this method. More sensitive techniques, such as ELISA, will need to be employed in order to assess Sle1c2 + T cells.

PAGE 48

48 It is unclear as to whether all CD4 + T cells have a continuously ubiquitous low expression or if a small subpopulation expresses higher amou nts of Esrrg under specific conditions. We attempted to clarify this question by checking the expression in FACS sorted nave and T em CD4 + T cells. This sorting strategy was chosen because of the strong skewing effect that the Sle1c2 locus has on these C D4 + subpopulations. Our results showed that B6 T cells exhibit a strong upregulation in T em cells as compared to nave cells, while, in B6. Sle1c2 mice, Esrrg expression remained constant in both populations (Figure 2 7B ). However, this data is somewhat p erplexing in that the nave population in B6. Sle1c2 had expression levels equal to the B6 T em population. This would indicate an overall greater Esrrg expression in B6. Sle1c2 CD4 + T cells which is contrary to our previous findings (Figure 2 6 A ). Sle1c2 E xacerbates L upus in the I nduced cGVHD M odel For complex genetic diseases such as SLE to develop, epistatic interactions of multiple susceptibility alleles are required. When individual loci are isolated, as I have done with B6. Sle1c2 overt disease does not occur. In order to prove that the CD4 + T cell phenotypes that segregated with Sle1c2 are relevant to lupus pathogenesis, the cGVHD induced lupus model was used (47, 147) This model was previously used to val idate the larger Sle1c interval and preliminary mapping using subcongenic strains showed that increased cGVHD susceptibility mapped to the centromeric portion of the locus and so should be a phenotype of Sle1c2 (52) This was in fact the case as B6. Sle1c2 recipients of B6.bm12 adoptive transfers had significantly increase d splenomegaly compared to B6 recipien ts (Figure 2 8 A). In addition, their B cells were more activated and produced more autoantibodies (Figure s 2 8 B, 2 8 C). Finally, the kidneys of B6. Sle1c2 mice that had received B6.bm12 splenocytes showed an

PAGE 49

49 increased deposition of pathogenic IgG2a immune complexes as compared to B6 recipients (Figure 2 8 D). The use of mixed bone marrow recipients showed that th e Sle1c2 induced ability of host B cells to be more responsive to cGVHD was actually intrinsic to T cells (Figure 2 8 E). While this is consistent with our previous finding that Sle1c2 i s CD4 + T cell intrinsic, the mechanisms governing Sle1c2 induced cGVHD sensitivity are not clear. The pathogenesis in this model has been reported to be mediated by alloreactive donor CD4 + T and host B cell interactions (147) It has recently been reported, however, that host B cells require CD4 + T cells during their ontogeny in order to be responsive to cGVHD (148) While there was clear evidence that H 1 by Sle1c2 can enhance B cell responsiveness to cGVHD or that it can directly enhance the cGVHD reaction. Alternatively, Sle1c2 CD4 + T cell hy peractivity may prime B cells for cGVHD through more generalized interactions, such as CD40 & CD40L (148) Sle1c2 M ediates S everity of S pontaneous L upus via E pistatic I nteractions To reconstitute the effect of epistasis, NZB x B6 F1 and NZB x B6. Sle1c2 F1 hybrids were generated and aged to 12 months. In this model, which was previously used to validate the l arger Sle1c interval (51) NZB susceptibility loci interact with either the NZW or the B6 alleles within the Sle1c2 interval. Because this is an F1 model of spontaneous lu pus, all loci are heterozygous, meaning there is only one copy of any given susceptibility allele, which would most likely be the case in human SLE. Our findings showed that splenomegaly, CD4:CD8 ratios, and T em percentages were significantly increased wh en just 1 allele of the NZW derived Sle1c2 was present (Figure 2 9 A). Additionally, increased B7 2 expression in NZB x B6. Sle1c2 mice

PAGE 50

50 indicated that B cells were more activated as well (Figure 2 9 A). Moreover, the addition of NZB loci allowed for B cells to generate pathogenic autoantibodies that increased with age (Figure 2 9 B). This age dependent increase was more pronounced when Sle1c2 was present, and reflects the accumulation of activated CD4 + T cells by Sle1c2 in aged mice (Figure s 2 2 B, 2 3A 2 9A 2 9 B ). Finally, GN was greatly exacerbated with the presence of Sle1c2 (Figure s 2 9 C, 2 9 D) Taken together, this data confirms Sle1c2 as a pathogenic lupus susceptibility locus in spontaneous SLE. Discussion The major lupus susceptibility allele Sle1 was originally described to consist of roughly 30% of telomeric C hromosome 1 (34) It was then reduced to the telomeric 20% of C hromosome 1 and determined to be NZW derived when it was congenically transferred ont o the lupus resistant B6 genome (149) Subsequent congenic dissection mapped Sle1 associated CD4 + T cell hyperactivation to Sle1a and Sle1c subloci (43, 50) The current study advances the work on Sle1c Originally defined to be 7.72Mb, extending from D1MIT459 to the telomeric end of C hromosome 1, it contain ed 48 known protein coding genes and 4 known microRNAs. Pr evious analyses have shown that the phenotypic effect of this locus is due to at least two subloci, with C r 2 established as the candidate gene for the telomeric Sle1c1 sublocus (53) and an undefined gene regulating the centromeric Sle1c2 sublocus (52) In this study, we have isolated Sle1c2 as a single lupus susceptibility allele that enhances both induced and spontaneous models of murine lupus and associates with the previously observed CD4 + T cell hyperactivation Additionally, a strong T H 1 skewing, marked by a significant + T cells, was found. Further, physical mapping and

PAGE 51

51 gene expression analysis identified Esrrg as the candidate gene regulating this phenotype. Dysregulated T cell activation is a major con tributor to autoimmune diseases such as SLE and is therefore an important focus for therapeutic intervention (126, 150) One of the challenges of identifying newer more effective treatments has been in targeting sp ecific T cell subsets. In this way, complications associated with the immunosuppression that occurs with more global targeting can be avoided. Even then, there is still the possibility that targeting some subsets may leave patients vulnerable to opportun functional role in CD4 + T cell biology is speculative at this point, this study suggests that pharmacological augmentation of its activity may alleviate pathogenic activation, effector memory accumulation, and T H 1 skewing. Nuclear receptors are a family of transcription factors whose activities are mediated by binding of endogenous ligands and other coregulatory proteins. Several members of the nuclear receptor family have already been implicated in T cell bi ology, vitamin D receptor, estrogen receptors, glucocorticoid receptor, and peroxisome proliferator activated receptor (64, 151 153) cell biology. It is structurally related to the estrogen receptors, but does not bind natural estrogens (154, 155) In fact, endogenous ligands for ERRs have not been identified and they are thus referred to as orphan nuclear receptors. It has been shown, however, that ERRs are constitutively active due to properties of their ligand binding do mains

PAGE 52

52 T herefore, their coregulatory proteins are considered to be the main mediators of their action (155) Regardless, several synthetic compounds have been shown to augment medi ated transactivation of its target genes, demonstrating its potential as a therapeutic target (154) Interestingly, bisphenol A (BPA), an industrial component of some plastics and resins and known to be an endocrine disruptor, has been shown to (156) mediate environmental triggers of autoimmunity. ERRs are important regulators of metabolism and energy homeostasis and Esrrg expression is highly restricted to metabolically active tissues (144, 154, 155) There, it transactivates genes involved in mitochondrial biogenesis, lipid transport and metabolism, tricarboxylic acid cycle, electron transport chain, and oxidative phosphorylation, allowing for energy production by effic ient fatty acid oxidation. This vital function is demonstrated in Esrrg null mice, where the lack of a critical switch from glycolytic to lipid based metabolism in the myocardium results in perinatal lethality (145) Activation and proliferation by T cells is also metabolically demanding (157) However, contrary to other metabolically demanding tissues, activated T cells employ aerobic glycolysis to meet energy requirements. Known as the Warberg effect, this form of metabolism generates glucose meta bolites at the expense of ATP production. This is advantageous to proliferating cells where substrate for biosynthesis, not ATP, is the limiting component (158) Remarkably, enhancement of the Warburg effect may result in T cell hyperactivation, as evidenced by mice with enhanced ability to sequester glucose. A report using mice that are transgenic for the T cell glucose transporter, glucose transporter type 1 (GLUT1), or that have enhanced ability to traffic GLUT1 to

PAGE 53

53 the cell surface, found T c ell hyperactivation phenotypes very similar to B6. Sle1c2 mice, namely, age dependent accumulation of CD69 + and T em cells, increased proliferation, (159) Consequently, aged mice suffer ed from hypergammaglobulinemia and GN, exhibiting a direct connection between energy metabolism and autoimmunity. A more recent report demonstrated how T H 1, T H 2, and T H 17 lineage commitment requires glycolytic metabolism and is suppressed by fatty acid ox idation, while T reg differentiation requires lipid metabolism (160 ) Sle1c2 may similarly contribute to the Warberg effect in CD4 + T cells as decreased Esrrg expression would limit transcription of target genes tha t regulate oxidative lipid based metabolism, novel therapies.

PAGE 54

54 Table 2 Gene ID Gene Name Forward primer Reverse primer Reference As3mt arsenic (+3 ox idation state) methyltransferase CCAGGGCCGTTCTGAGTT TGTCCTTTAGCCACCCTCTTG (146) Cd59a CD59a antigen CTCATCTTACTCCTGCTGCTTCT CCAACACCTTTGATACACTTGC (146) Crtam cytotoxic and regulatory T cell molecule CATCATCGTTCAGCTCTTCATC TGGGCACTCTTCTTTGTTTTG (146) Esrra estrogen related receptor, alpha CTGAAAGCTCTGGCCCTTG CTGTCTGGCGGAGGAGTG (161) Fabp4 fat ty acid binding protein 4, adipocyte GAAATCACCGCAGACGACA TTCATAACACATTCCACCACCA (145) Mycbp c myc binding protein GCTGGACACGCTGACGAA TCTGGGTTTTCCGGGGTAG (146) Ndufs1 NADH d ehydrogenase (ubiquinone) Fe S protein 1 TGACCCACTCGTTCCACCT CGGCTCCTCTACTGCCTGA (146) Ppargc1a peroxisome proliferative activated receptor, gamma, coactivator 1 alpha TACGCAGGTCGAACGAAAC GTGGAAGCAGGGTCAAAATC (162) Ppif peptidylprolyl isomerase F (cyclophilin F) CGTGGTGCTGGAGTTAAAGG CTGTGCCATTGTGGTTGGT (146) Rara retinoic acid receptor, alpha TCCCCAAGATGCTGATGAA CCCGACTGTCCGCTTAGA (146) Rtn4ip1 reticulon 4 interacting protein 1 AGAACTGGTGGATGCAGGAA GGGAGAATGTGTGGTGAAGG (146) Steap3 STEAP family member 3 CCCGTCCATTGCTAATTCC GTCCAGCCGTAGGTGAGTGT (146)

PAGE 55

55 Figure 2 1. Physical map of the Sle1c locus. The intervals for Sle1c and its subcongenics are shown in (A), while Sle1c2 along with the exon intron structures for its two known protein coding genes are shown in (B). NZW derived regions are white and B6 derived regions are black. All known polymorphic MIT microsatellite markers, as well as SNPs that define recombination intervals are depicted. Scale is in Mb and all positions are current with Ensemble releas e 67 ( www.ensembl.org/Mus_musculus/ ) which is based on NCBI m37.

PAGE 56

56 Figure 2 2 M apping phenotypes used to define Sle1c2 Strain comparison of spleen weights and CD4 + T cell activation determined by f low cytometry of splenocytes from 10 14 month old mice (A). Total cell numbers of B and T cell compartments were obtained from FACS analyses of splenocytes from 5 8 month old and 10 14 month old mice grouped by locus (B). Nave T cells are defined as CD4 + CD44 lo CD62L + and T em cells are defined as CD4 + CD44 hi CD62L Antigen specific and polyclonal proliferation of CD4 + T cells was measured by 3 H thymidine incorporation (C). REC2B and REC5 subcongenic strains and REC2B.OTII and REC5.OTII bicongenic strains were used as Sle1c2 and Sle1c2 .OTII respectively. Significance in (A) indicates multiple comparison analysis to B6. Significance in (B) indicates Mann Whitney comparison to B6 of the same age group. Two way ANOVA was used to measure strain effect on antigen specific proliferation with t test was used to compare polyclonal and mitogen induced proliferation to B6 (C). P 0.05, ** P 0.01, *** P 0.001 P 0 .001

PAGE 57

57 Figure 2 3 Additional Sle1c2 phenotypes. Co mparison of B6 and Sle1c subcongenic REC5 spleen weights and CD4 + T cell activation over time as determined by flow cytometry (A). FACS analysis of B6.Thy1a and B6. Sle1c2 (Thy1b) mixed bone marrow chi meras (B). GFP + percentages of CD4 + T cells from B6.FoxP3 eGFP and B6. Sle1c2 .FoxP3 eGFP was measured over the lifetime (C). GFP + percentages from B6.FoxP3 eGFP and B6. Sle1c2 .FoxP3 eGFP were measured by flow cytometry both ex vivo and after in vitro induc tion of FACS sorted CD4 + FoxP3 T cells under T H 0 (anti CD3 and CD28 only), and T reg t P 0.05, ** P 0 .01, *** P 0.001

PAGE 58

58 Figure 2 4 Global gene expression of CD4 + T cells. H eat map (A) and pathway analysis (B) of genes related to Ifng expression.

PAGE 59

59 Figure 2 5 Sle1c 2 generates augmented T H 1 lineage. Representative histograms and quantification + T cells were from 2 3 month old mice (A). A heat map illustrates upregulated expression of genes involved in T H 17 and T reg homeostasis by B6. Slec2 CD4 + T cells (B). Representative plots of intracellular stainin g (C) and quantification (D) shows Slec2 CD4 + T cells cultured under T H 0 (anti CD3 and CD28 only), T reg H 6) polarizing conditions. EAE clinical scores did not significantly differ bet ween B6 and B6. Sle1c2 (n=6) (E). t test: P 0.05, ** P 0.01, *** P 0.001.

PAGE 60

60 Figure 2 6 Sle1c2 results in decreased expression of Esrrg by CD4 + T cells. qPCR comparing Esrrg expression from thymocytes, splenocytes, CD4 + T cells, and n on CD4 + T cell fraction (CD4 ) between B6 and B6. Sle1c2 (A). Correlation between Esrrg expression by CD4 + T cells and CD69 + and T em percentages of CD4 (B). Esrrg expression in various tissues by B6 mice, normalized to Gapgh and relative to B6 CD4 + T cell and Actin (D). t test s were used to compare Esrrg expression to B6 for each cell population in (A) Significance that slope does not equal zero (P) and c orrelation coefficient for linear regression s (R 2 ) ar e shown in (B). *** P 0.001

PAGE 61

61 Figure 2 7 Additional Esrrg expression data. Representative FACS plots of CD69 + and T em (CD44 hi CD62L ) used to analyze correlation to Esrrg expression in Figure 2 6B (A). Esrrg expression of FACS sorted Nave (CD4 + CD44 lo CD62L + ) and T em (CD4 + CD44 hi CD62L ) cells from B6 and B6. Sle1c2 splenocytes (B). Esrrg expression in various tissues by B6. Sle1c2 mice, normalized to Gapgh and relative to the B6 expression in that same tissue (C). E xpression of various genes reported t o be r Gapdh and relative to the B6 expression of that same gene ( D ) t test: P 0.05, ** P 0.01, *** P 0.001.

PAGE 62

62 Figure 2 8 Sle1c2 exacerbates induced lupus in a T cell intrinsic manner. cGVHD was induced in B6 and B6.Sle1c2 mice and spleens were weighed (A) and B cell activation was measured by FACS (B) after 3 weeks. Sera were collected once a week, beginning a day 0, and anti dsDNA and anti chromatin IgG were measured by ELISA (C). IgG2a and C3 deposition was detected in frozen kidney sections (D). Sections were separately scored in a blind manner and additive values are shown. cGVHD was also induced in mixed bone marrow chimeras such that B and T cells were either of B6 (b) or B6.Sle1c2 (s) origin and autoantibodies were measured at 5 weeks (E). t test was used to compare to B6 in (A), (B), (D), and (E). P 0.05, ** P 0.01, *** P 0.001

PAGE 63

63 Figure 2 9. Sle1c2 exacerbates spontaneous lup us. Spleen weight and flow cytometry data were quantified from 12 month old NZB x B6 F1 and NZB x B6. Sle1c2 F1 mice (A). Anti dsDNA IgG was measured at 5 and 12 months (B). IgG and C3 deposition was detected in frozen kidney sections (C, D). Sections scored in a blind manner and additive values are shown. t test was used to compare to NZB x B6. P 0.05, ** P 0.01, *** P 0.001

PAGE 64

64 CHAPTER 3 DISCUSSION Sle1c2 has been pared down to 675Kb from the 7.5Mb Sle1c interval. We have shown that this region is sufficient to confer the CD4 + T cell hyperactivation that was originally observed in B6. Sle1c mi ce. Mixed bone marrow chimeras showed that this was CD4 + T cell intrinsic. Further, a prominent T H 1 skewing was found as B6. Sle1c2 + cells that B6 mice. Additionally, the ability to exacerbate both spontaneo us and induced lupus segregated with Sle1c 2 The use of FoxP3 eGFP knock in mice indicated that, contrary to previous reports (52) T reg were not decreased in Sle1c2 mice. This last finding is likely due to the fa ct that the previous reports defined T regs by surface phenotype CD4 + CD25 + CD62L + not by expression of the master regulator FoxP3, which is a more accurate way to measure T regs (59, 134) The major accumulation of T EM cells, which are CD62L was likely the reason that T regs appeared less frequent when measuring by surface phenotype. The fine mapping of Sle1c2 has allowed for a considerable reduction of positional candidate genes from 48 to 2. Of these, only Esrrg was expressed in CD4 + T cells. Expression in the CD4 + cell compartment is essential to qualify as a candidate because the Sle1c2 phenotype is CD4 + T cell intrinsic. No coding sequence or isoform differences were found between the NZW and B6 derived allel es if Esrrg There was, however, a decreased expression in Sle1c2 splenocytes that segregated with CD4 + T cells. Most compellingly, Esrrg expression had a very strong negative correlation with CD4 + T cell activation phenotypes. along with an d belong to a family of orphan nuclear receptors that are closely related to estrogen receptors, but do not bind natural estrogens (163)

PAGE 65

65 They mediate transcription of their target genes by bind ing to estrogen response elements ( AGGTCAnnnTGACCT ) either as homodimers or heterodimers and to modified half sites, known as ERR response element s ( TnAAGGTCA ) as monomer s (163) Their endogenous ligands are not known but it has been shown that they have a fairly high level of const itutive activation (164) The action on target genes is therefore mediated by the concentration of co activators such as peroxisome proliferator activated and corepressors, such as r eceptor i nteracting p rotein 140 (RIP140) (165, 166) Synthetic ligands wit h differing activities on ERRs have been identified, allowing for pharmacological stimulation or inhibition. GSK4716 shows selective agonist activity, while 4 Hydroxytamoxifen (4 OHT) works as an inverse agonist (167, 168) A preliminary in vitro culture of CD4 + T cells with GSK4716 or 4 OHT did not find differences in CD44, CD69, or IFN suggestive data for an opposing dose response effect of these agents on CD62L such that 4 OHT increased, and GSK4716 decreased expression. This may be a promising result, but would need to be repeated with estrogen to contro l for the effect 4 OHT has on estrogen receptors. As was covered in the discussion regulation of oxidative metabolism (154) Evidence that energy metabolism can regulate T cell homeostasis is growing and would be a subject to explore in Sle1c2 C D4 + T cells (157) The work done by the Rathmell group is especially intriguing in that it provides a direct explanation a glycolytic program that allows for an expansion of T H 1 subsets (159, 160) To

PAGE 66

66 evaluate this hypothesis, glycolysis and lipid oxidation rates of B6. Sle1c2 CD4 + T cells should be measured as they were by Rathmell et al (160) An important aspect of this project that requires clarificatio n is whether the protein levels of ERR Since the coding sequence in the NZW allele is identical to the B6 allele and splice isoforms have not been found (data not shown), post transcriptional and post translational modifications and regulatio n are predicted to also be unaltered. However, s everal attempts at semi difference. It is likely that this method is not sensitive enough. As discussed in the last chapter, expression and protein levels of are very low, requiring a large amount (at least 50g) of total protein to be loaded for SDS PAGE, which may obscure any subtle differences. A more sensitive ELISA should be attempted. One of the initial goals of this p roject was to replicate the effect of Sle1c2 either by decreasing expression of Esrrg in B6 CD4 + T cells or by increasing it in B6. Sle1c2 CD4 + T cells. An expression vector was constructed that expressed Esrrg with a GFP reporter (Appendix B). The const ruct works as expected in 293 cells. However, we are so far unable to transfect primary CD4 + transfection process. The future plan is to subclone this construct into a lentiviral vector This should lead to higher viabi lity and more stable expression so that the effect of ERR in vivo Additionally, pre manufactured lentivirus expressing Esrrg specific shRNA (Openbiosystems) will be used to recapitulate Sle1c2 decreased Esrrg expression in vivo Ultimately, endogenous Esrrg can be conditionally deleted or kn ocked down in the CD4 + T cells of B6 mice. This can be done by crossing mice

PAGE 67

67 expressing a CD4 Cre transgene to mice with either a floxed Esrrg locus or to mice with a n Esrrg specific shRNA inserted downstream of a Rosa26 Stop fl/fl locus B6 mice containi ng the CD4 Cre transgene and the Rosa26 Stop fl/fl locus are available from the Jackson Laboratories. The floxed Esrrg locus and Esrrg specific shRNA knocked into the Rosa26 Stop fl/fl locus would have to be generated. Finally ChIP Seq will reveal novel insights into transcriptional programs that are + T cells. will be found to bind to regulatory elements of genes involved in oxidative metabolism, as has previously been found in other tissues (141 144) Coupled with differential metabolic functional findings + T cell function will be established. There may also be other gene programs that are regula ted by + T cells which may result in the Sle1c2 induced hyperactivation and T H 1 skewing of CD4 + T cells insights gained from these experiments will elucidate novel pathways whose dys regulation can mediate autoimmunity.

PAGE 68

68 APPENDIX A IN SILICO IDENTIFICATION OF PO TENTIAL CAUSITIVE SLE1C2 ALLELES RESPONSIBLE FOR ESRRG DOWNREGULATION An in silico analysis was performed in an effort to narrow the set of total polymorphic SNPs to a smaller set that are more likely to affect transcription or Esrrg. A set SNPs that are polymorphic between B6 and NZB was selected based on their position within constrained elements for 35 eutherian mammals ( www.ensembl.org ). W here the NZW allele was not available the DBA allele was assumed based on the high sequence homology between the two strains in the Sle1c2 region (Figure A 1) This produced a set of 21 SNPs that were used to perform an in silico analysis for differentia l transcription factor binding (139) (Table A 1). The analysis yielded a few intriguing data (Table A 2) First, the NZW allele of rs32271729 removes a Pbx1 binding site. As this is the candidate gene for Sle1a1 a potential explanation for epistatic interaction between Sle1a1 and Sle1c2 is revealed. Second, the NZW allele of rs31811886 peroxisome proliferator activated receptors (PPARs) and the retinoid X receptors (RXRs) are known to play a role in energy homeostasis (169) Therefore, this SNP could represent a disconnect from a metabolic transcriptional program. Finally, the NZW allele of rs32038280 removes an highly conserved (Figure A 2) inter feron regulatory factor 1 (IRF 1) site and adds a HNF1 homeobox A (HNF1a) site. This may tie into the T H signaling may activate Esrrg through IRF1, which would activate lipid oxidation programs that would negate the oxidative glycolysis that is essential for efficient T H 1 differentiation. The NZW allele would lack this negative feedb ack loop. This analysis is based on some assumptions that a the c ausative allele may not be a SNP It may be an indel or some other structural variant,

PAGE 69

69 or it may be a novel SNP that would not be annotated. Second, the cau sative allele may not be in a constrained region. Third, the decreased expression of Esrrg may be due to more than one polymorphism. Regardless of these assumptions, this analysis sets a logical starting point for uncovering the genetic cause for decre ased Esrrg by Sle1c2

PAGE 70

70 Figure A 1. Comparative SNP analysis of Sle1c2 B6 vs NZW (Top); DBA vs NZW (Middle); B6 vs DBA (Bottom)

PAGE 71

71 Table A 1. SNPs in constrained elements SNP Position (Chr:Mb) B D W Constrained Element Length (bp) Score p value rs 32278316 1:189819821 G A nd 1:189819730 189820148 419 688.60 1.94e 23 rs32524022 1:189837554 C T T 1:189837499 189837723 225 434.40 6.29e 21 rs31690177 1:189854244 C T nd 1:189853716 189854496 781 1766.40 3.36e 144 rs32271729 1:189857580 T C nd 1:189857 321 189857741 421 559.70 2.94e 31 rs32099068 1:189857612 A G nd 1:189857321 189857741 421 559.70 2.94e 31 rs31811886 1:189858530 T C C 1:189858361 189858686 326 867.30 7.20e 84 rs32239074 1:189860163 G C C 1:189859871 189860209 339 1209.00 6.12e 184 r s32038280 1:189865403 G A A 1:189865266 189865590 325 1035.70 1.96e 125 rs3667534 1:189866887 T C C 1:189866872 189867047 176 441.80 4.54e 45 rs31081923 1:189881827 A G G 1:189881778 189881982 205 417.40 1.93e 35 rs31690423 1:189884459 C A nd 1:189884 317 189884608 292 911.50 2.34e 115 rs30473053 1:189885064 G C C 1:189884976 189885373 398 569.80 1.39e 32 rs3673367 1:189886643 G A A 1:189886617 189886768 152 201.10 1.06e 12 rs3683961 1:189903263 G A A 1:189903149 189903299 151 152.80 5.03e 08 rs3208 5863 1:189903441 T G nd 1:189903362 189903484 123 141.70 9.11e 09 rs2228901 1:189905663 T C C 1:189905588 189905760 173 499.70 7.37e 58 rs30572892 1:189906487 C A A 1:189906364 189906546 183 500.80 4.55e 57 rs31400926 1:189906947 T A A 1:189906836 1899 07224 398 1402.60 2.36e 212 rs32757999 1:189907183 T C C 1:189906836 189907224 398 1402.60 2.36e 212 rs30993521 1:190011782 G A A 1:190011495 190012021 527 921.90 9.19e 65 rs3694567 1:190013851 G C C 1:190013798 190013848 51 78.70 1.40e 06

PAGE 72

72 Table A 2 SNP effects on transcription factor binding Sequence Position Model Factor Strand B6 Score NZW Score Change rs32278316 1:189819821 T01471 Ik 3 + 2.6 2.60 rs32278316 1:189819821 M00059 YY1 2.5 2.50 rs32278316 1:189819821 M00706 TFII I + 2 2.00 rs32524022 1:189837554 M00162 1 Oct + 2.7 2.70 rs32524022 1:189837554 M00238 Barbie Box 3.4 4.5 1.10 rs31690177 1:189854244 M00480 LUN 1 + 2.8 2.80 rs31690177 1:189854244 MA0028 ELK1 2 2.00 rs31690177 1:189854244 T04446 Nkx5 1 6.1 4.4 1.7 0 rs31690177 1:189854244 MA0026 Eip74EF 1.6 1.60 rs32271729 1:189857580 M00124 Pbx 1b 5.2 5.20 rs32271729 1:189857580 T05671 NIL 5 5.00 rs32271729 1:189857580 MA0070 PBX1 3.4 0.8 2.60 rs32271729 1:189857580 MA0041 Foxd3 2 2.00 rs322 71729 1:189857580 MA0017 NR2F1 1.7 1.70 rs32099068 1:189857612 M00026 RSRFC4 4.3 4.30 rs32099068 1:189857612 T00422 IRF 1 4 4.00 rs32099068 1:189857612 M00408 MADS A + 2.7 2.70 rs32099068 1:189857612 MA0038 Gfi 0.7 1.9 1.20 rs31811886 1:189858530 M00242 PPARalpha:RXRalpha + 4.4 4.40 rs31811886 1:189858530 M00415 AREB6 2.8 2.80 rs31811886 1:189858530 T00772 STE12 2.2 2.20 rs31811886 1:189858530 MA0072 RORA_2 + 2.1 2.10 rs31811886 1:189858530 M00664 STE12 + 2 2.00 rs31811886 1:189858530 MA0071 RORA_1 + 1.4 1.40 rs31811886 1:189858530 MA0011 br_Z2 1.1 1.10 rs31811886 1:189858530 MA0045 HMG I/Y + 1 1.00 rs32239074 1:189860163 M00681 WRKY 2.9 2.90 rs32239074 1:189860163 MA0046 HNF1A + 1.7 1.70

PAGE 73

73 rs3 2239074 1:189860163 M00016 E74A 3 4.6 1.60 rs32038280 1:189865403 T00368 HNF 1alpha A 4.5 4.50 rs32038280 1:189865403 MA0046 HNF1A 4.1 4.10 rs32038280 1:189865403 M00747 IRF 1 3.4 3.40 rs32038280 1:189865403 M00790 HNF1 2.8 5.6 2.80 rs32038280 1:189865403 M00451 Nkx3 1 + 3.1 5.2 2.10 rs32038280 1:189865403 MA0063 Nkx2 5 + 2.1 2.10 rs3667534 1:189866887 M00454 MRF 2 3.7 3.70 rs3667534 1:189866887 MA0111 Spz1 + 1.3 1.30 rs31081923 1:189881827 M00670 NIL 1 1.00 rs3 1690423 1:189884459 M00753 RCS1 + 3.3 3.30 rs31690423 1:189884459 M00640 HOXA4 1.3 1.30 rs30473053 1:189885064 T00715 RAP1 4.2 4.20 rs30473053 1:189885064 T00725 REB1 + 3.6 3.60 rs30473053 1:189885064 M00480 LUN 1 + 2.5 2.50 rs30473053 1 :189885064 MA0028 ELK1 + 2 2.00 rs3673367 1:189886643 rs3683961 1:189903263 M00274 STE11 + 1.9 3.5 1.60 rs3683961 1:189903263 MA0073 RREB1 1.2 1.20 rs32085863 1:189903441 T02338 Sp3 + 3.9 3.90 rs32085863 1:189903441 T01841 NIL 1.1 2.6 1.50 rs32085863 1:189903441 T01842 NIL 1.1 2.6 1.50 rs2228901 1:189905663 MA0073 RREB1 1.9 1.90 rs2228901 1:189905663 T00806 TEF 1 + 1.5 1.50 rs2228901 1:189905663 MA0020 Dof2 1.5 1.50 rs2228901 1:189905663 MA0021 Dof3 1.5 1.50 rs3057 2892 1:189906487 T03458 Crx + 5.1 7 1.90 rs30572892 1:189906487 MA0022 dl_1 + 2.9 1.7 1.20 rs31400926 1:189906947 M00697 HBP 1b + 3.5 3.50 rs31400926 1:189906947 T00114 c Ets 1 54 3 3.00

PAGE 74

74 rs31400926 1:189906947 T00244 Egr 1 + 4.7 2.3 2.40 rs314 00926 1:189906947 T00899 WT1 4.5 2.4 2.10 rs31400926 1:189906947 M00706 TFII I 1.3 1.30 rs31400926 1:189906947 M00733 SMAD4 3.3 2.2 1.10 rs32757999 1:189907183 MA0078 Sox17 3.8 3.80 rs32757999 1:189907183 M00063 IRF 2 + 3.3 3.30 rs327579 99 1:189907183 M00729 Cdx 2 3.1 3.10 rs32757999 1:189907183 M00699 ICSBP + 3 3.00 rs32757999 1:189907183 M00664 STE12 + 2 2.00 rs32757999 1:189907183 MA0045 HMG I/Y + 1.8 1.80 rs32757999 1:189907183 MA0084 SRY + 1.8 1.80 rs30993521 1:19001 1782 T01422 ste11 4.4 4.40 rs30993521 1:190011782 M00274 STE11 2.6 6.5 3.90 rs3694567 1:190013851 T01973 NIL + 7 2.1 4.90 rs3694567 1:190013851 M00721 CACCC binding factor + 3.4 3.40 rs3694567 1:190013851 T01526 Brachyury 4.8 2.1 2.70 rs3694 567 1:190013851 M00150 Brachyury 5 2.4 2.60

PAGE 75

75 Figure A 2. Alignment of rs32038280 with transcription factor binding sites.

PAGE 76

76 APPENDIX B GENERATION OF A VECT OR FOR ECTOPIC EXPRE SSION OF ESRRG IN PRIMARY CD4 + T CELLS B6 CD4 + T cells were used to cl one Esrrg without a stop codon in front of a 2A peptide followed by gfp This construct was subcloned into a pCDNA3 mammalian expression vector and tested in 293 cells along with si Esrrg (ABI). RT PCR and qPCR (Figure B 1) showed high levels of Esrrg exp ression that was specifically knocked down by si Esrrg Protein expression and knock down were also detected by microscopy, western blot, and FACS (Figure B 2)

PAGE 77

77 Figure B 1. Gene expression in 293 cells transfected with Esrrg E2G = Esrrg 2A gfp (A) RT PCR, (B) qPCR.

PAGE 78

78 Figure B 2 Protein expression in 293 cells transfected with Esrrg E2G = Esrrg 2A gfp. (A) FACS, (B) Microscopy, (C) Wester n blot

PAGE 79

79 LIST OF REFERENCES 1. Barrat, F., T. Meeker, J. Gregorio, J. Chan, S. Uematsu, S. Akira, B. Chang, O. Duramad, and R. Coffman. 2005. Nucleic acids of mammalian origin can act as endogenous ligands for Toll like receptors and may promote systemic lupus erythematosus. J Exp Me d 202: 1131 1139. 2. Lam, G. K., and M. Petri. 2005. Assessment of systemic lupus erythematosus. Clin Exp Rheumatol 23: S120 132. 3. Hochberg, M. C. 1997. Updating the American College of Rheumatology revised criteria for the classification of systemic lup us erythematosus. Arthritis Rheum 40: 1725. 4. Tan, E. M., A. S. Cohen, J. F. Fries, A. T. Masi, D. J. McShane, N. F. Rothfield, J. G. Schaller, N. Talal, and R. J. Winchester. 1982. The 1982 revised criteria for the classification of systemic lupus erythe matosus. Arthritis Rheum 25: 1271 1277. 5. Petri, M., and L. Magder. 2004. Classification criteria for systemic lupus erythematosus: a review. Lupus 13: 829 837. 6. Yildirim Toruner, C., and B. Diamond. 2011. Current and novel therapeutics in the treatment of systemic lupus erythematosus. J Allergy Clin Immunol 127: 303 312; quiz 313 304. 7. Pascual, V., L. Farkas, and J. Banchereau. 2006. Systemic lupus erythematosus: all roads lead to type I interferons. Curr Opin Immunol 18: 676 682. 8. Jacobi, A. M., W. Huang, T. Wang, W. Freimuth, I. Sanz, R. Furie, M. Mackay, C. Aranow, B. Diamond, and A. Davidson. 2010. Effect of long term belimumab treatment on B cells in systemic lupus erythematosus: extension of a phase II, double blind, placebo controlled, dose ra nging study. Arthritis Rheum 62: 201 210. 9. Wallace, D. J., W. Stohl, R. A. Furie, J. R. Lisse, J. D. McKay, J. T. Merrill, M. A. Petri, E. M. Ginzler, W. W. Chatham, W. J. McCune, V. Fernandez, M. R. Chevrier, Z. J. Zhong, and W. W. Freimuth. 2009. A pha se II, randomized, double blind, placebo controlled, dose ranging study of belimumab in patients with active systemic lupus erythematosus. Arthritis Rheum 61: 1168 1178. 10. Kelly, J. A., K. L. Moser, and J. B. Harley. 2002. The genetics of systemic lupus erythematosus: putting the pieces together. Genes Immun 3 Suppl 1: S71 85. 11. Deapen, D., A. Escalante, L. Weinrib, D. Horwitz, B. Bachman, P. Roy Burman, A. Walker, and T. M. Mack. 1992. A revised estimate of twin concordance in systemic lupus erythemato sus. Arthritis Rheum 35: 311 318.

PAGE 80

80 12. Sestak, A. L., T. S. Shaver, K. L. Moser, B. R. Neas, and J. B. Harley. 1999. Familial aggregation of lupus and autoimmunity in an unusual multiplex pedigree. J Rheumatol 26: 1495 1499. 13. Fessel, W. J. 1974. Systemic lupus erythematosus in the community. Incidence, prevalence, outcome, and first symptoms; the high prevalence in black women. Arch Intern Med 134: 1027 1035. 14. Kaslow, R. A., and A. T. Masi. 1978. Age, sex, and race effects on mortality from systemic lu pus erythematosus in the United States. Arthritis Rheum 21: 473 479. 15. Walker, S. E. 2011. Estrogen and autoimmune disease. Clin Rev Allergy Immunol 40: 60 65. 16. Petri, M. 2008. Sex hormones and systemic lupus erythematosus. Lupus 17: 412 415. 17. Roub inian, J., N. Talal, J. Greenspan, J. Goodman, and P. Siiteri. 1978. Effect of castration and sex hormone treatment on survival, anti nucleic acid antibodies, and glomerulonephritis in NZB/NZW F1 mice. J Exp Med 147: 1568 1583. 18. Bynot, K. K., J. M. Hac kenberg, K. S. Korach, D. B. Lubahn, P. H. Lane, and K. A. Gould. 2008. Estrogen receptor alpha deficiency attenuates autoimmune disease in (NZB x NZW)F1 mice. Genes Immun 9: 137 152. 19. Scofield, R. H., G. R. Bruner, B. Namjou, R. P. Kimberly, R. Ramsey Goldman, M. Petri, J. D. Reveille, G. S. Alarcn, L. M. Vil, J. Reid, B. Harris, S. Li, J. A. Kelly, and J. B. Harley. 2008. Klinefelter's syndrome (47,XXY) in male systemic lupus erythematosus patients: support for the notion of a gene dose effect from t he X chromosome. Arthritis Rheum 58: 2511 2517. 20. Pisitkun, P., J. A. Deane, M. J. Difilippantonio, T. Tarasenko, A. B. Satterthwaite, and S. Bolland. 2006. Autoreactive B Cell Responses to RNA Related Antigens Due to TLR7 Gene Duplication. Science 312: 1669 1672. 21. Subramanian, S., K. Tus, Q. Z. Li, A. Wang, X. H. Tian, J. Zhou, C. Liang, G. Bartov, L. D. McDaniel, X. J. Zhou, R. A. Schultz, and E. K. Wakeland. 2006. A Tlr7 translocation accelerates systemic autoimmunity in murine lupus. Proc Natl Acad Sci U S A 103: 9970 9975. 22. Deane, J. A., P. Pisitkun, R. S. Barrett, L. Feigenbaum, T. Town, Jerrold M. Ward, R. A. Flavell, and S. Bolland. 2007. Control of Toll like Receptor 7 Expression Is Essential to Restrict Autoimmunity and Dendritic Cell Proli feration. Immunity 27: 801 810. 23. Fairhurst, A. M., S. h. Hwang, A. Wang, X. H. Tian, C. Boudreaux, X. Zhou, J. Casco, Q. Z. Li, J. Connolly, and E. Wakeland. 2008. Yaa autoimmune

PAGE 81

81 phenotypes are conferred by overexpression of TLR7. Eur J Immunol 38: 1971 1978. 24. Santiago Raber, M. L., S. Kikuchi, P. Borel, S. Uematsu, S. Akira, B. L. Kotzin, and S. Izui. 2008. Evidence for Genes in Addition to Tlr7 in the Yaa Translocation Linked with Acceleration of Systemic Lupus Erythematosus. J Immunol 181: 1556 156 2. 25. Moser, K., J. Kelly, C. Lessard, and J. Harley. 2009. Recent insights into the genetic basis of systemic lupus erythematosus. Genes Immun 10: 373 379. 26. Sestak, A. L., B. G. Frnrohr, J. B. Harley, J. T. Merrill, and B. Namjou. 2011. The genetics of systemic lupus erythematosus and implications for targeted therapy. Ann Rheum Dis 70 Suppl 1: i37 43. 27. Flint, J., W. Valdar, S. Shifman, and R. Mott. 2005. Strategies for mapping and cloning quantitative trait genes in rodents. Nat Rev Genet 6: 271 2 86. 28. Wakeland, E., L. Morel, K. Achey, M. Yui, and J. Longmate. 1997. Speed congenics: a classic technique in the fast lane (relatively speaking). Immunol Today 18: 472 477. 29. Wandstrat, A. E., C. Nguyen, N. Limaye, A. Y. Chan, S. Subramanian, X. H. Tian, Y. S. Yim, A. Pertsemlidis, H. R. Garner, L. Morel, and E. K. Wakeland. 2004. Association of Extensive Polymorphisms in the SLAM/CD2 Gene Cluster with Murine Lupus. Immunity 21: 769 780. 30. Kumar, K. R., L. Li, M. Yan, M. Bhask arabhatla, A. B. Mobley, C. Nguyen, J. M. Mooney, J. D. Schatzle, E. K. Wakeland, and C. Mohan. 2006. Regulation of B Cell Tolerance by the Lupus Susceptibility Gene Ly108. Science 312: 1665 1669. 31. Min Oo, G., A. Fortin, G. Pitari, M. Tam, M. M. Stevens on, and P. Gros. 2007. Complex genetic control of susceptibility to malaria: positional cloning of the Char9 locus. J Exp Med 204: 511 524. 32. Kissler, S., P. Stern, K. Takahashi, K. Hunter, L. B. Peterson, and L. S. Wicker. 2006. In vivo RNA interference demonstrates a role for Nramp1 in modifying susceptibility to type 1 diabetes. Nat Genet 38: 479 483. 33. Rudofsky, U. H., B. D. Evans, S. L. Balaban, V. D. Mottironi, and A. E. Gabrielsen. 1993. Differences in expression of lupus nephritis in New Zealand mixed H 2z homozygous inbred strains of mice derived from New Zealand black and New Zealand white mice. Origins and initial characterization. Lab Invest 68: 419 426. 34. Morel, L., U. H. Rudofsky, J. A. Longmate, J. Schiffenbauer, and E. K. Wakeland. 1994 Polygenic control of susceptibility to murine systemic lupus erythematosus. Immunity 1: 219 229.

PAGE 82

82 35. Morel, L., C. Mohan, Y. Yu, B. P. Croker, N. Tian, A. Deng, and E. K. Wakeland. 1997. Functional dissection of systemic lupus erythematosus using congeni c mouse strains. J Immunol 158: 6019 6028. 36. Morel, L., B. P. Croker, K. R. Blenman, C. Mohan, G. Huang, G. Gilkeson, and E. K. Wakeland. 2000. Genetic reconstitution of systemic lupus erythematosus immunopathology with polycongenic murine strains. Proc Natl Acad Sci U S A 97: 6670 6675. 37. Mohan, C., L. Morel, P. Yang, and E. Wakeland. 1997. Genetic dissection of systemic lupus erythematosus pathogenesis: Sle2 on murine chromosome 4 leads to B cell hyperactivity. J Immunol 159: 454 465. 38. Xu, Z., H. H Potula, A. Vallurupalli, D. Perry, H. Baker, B. P. Croker, I. Dozmorov, and L. Morel. 2011. Cyclin Dependent Kinase Inhibitor Cdkn2c Regulates B Cell Homeostasis and Function in the NZM2410 Derived Murine Lupus Susceptibility Locus Sle2c1. J Immunol 186: 6673 6682. 39. Sobel, E., L. Morel, R. Baert, C. Mohan, J. Schiffenbauer, and E. Wakeland. 2002. Genetic dissection of systemic lupus erythematosus pathogenesis: evidence for functional expression of Sle3/5 by non T cells. J Immunol 169: 4025 4032. 40. Li u, K., Q. Z. Li, Y. Yu, C. Liang, S. Subramanian, Z. Zeng, H. W. Wang, C. Xie, X. J. Zhou, C. Mohan, and E. K. Wakeland. 2007. Sle3 and Sle5 can independently couple with Sle1 to mediate severe lupus nephritis. Genes Immun 8: 634 645. 41. Li, Q. Z., J. Zho u, R. Yang, M. Yan, Q. Ye, K. Liu, S. Liu, X. Shao, L. Li, X. J. Zhou, E. K. Wakeland, and C. Mohan. 2009. The lupus susceptibility gene kallikrein downmodulates antibody mediated glomerulonephritis. Genes Immun 10: 503 508. 42. Liu, K., Q. Li, A. Delgado Vega, A. Abelson, E. Snchez, J. Kelly, L. Li, Y. Liu, J. Zhou, M. Yan, Q. Ye, S. Liu, C. Xie, X. Zhou, S. Chung, B. Pons Estel, T. Witte, E. de Ramn, S. Bae, N. Barizzone, G. Sebastiani, J. Merrill, P. Gregersen, G. Gilkeson, R. Kimberly, T. Vyse, I. Kim S. D'Alfonso, J. Martin, J. Harley, L. Criswell, E. Wakeland, M. Alarcn Riquelme, C. Mohan, P. S. Group, I. C. Group, G. C. Group, S. C. Group, A. C. Group, and S. Consortium. 2009. Kallikrein genes are associated with lupus and glomerular basement memb rane specific antibody induced nephritis in mice and humans. J Clin Invest 119: 911 923. 43. Mohan, C., E. Alas, L. Morel, P. Yang, and E. K. Wakeland. 1998. Genetic Dissection of SLE Pathogenesis Sle1 on Murine Chromosome 1 Leads to a Selective Loss of Tolerance to H2A/H2B/DNA Subnucleosomes. J Clin Invest 101: 1362 1372.

PAGE 83

83 44. Wakeland, E. K., K. Liu, R. R. Graham, and T. W. Behrens. 2001. Delineating the Genetic Basis of Systemic Lupus Erythematosus. Immunity 15: 397 408. 45. Wakeland, E. K., A. E. Wands trat, K. Liu, and L. Morel. 1999. Genetic dissection of systemic lupus erythematosus. Curr Opin Immunol 11: 701 707. 46. Hogarth, M. B., J. H. Slingsby, P. J. Allen, E. M. Thompson, P. Chandler, K. A. Davies, E. Simpson, B. J. Morley, and M. J. Walport. 19 98. Multiple Lupus Susceptibility Loci Map to Chromosome 1 in BXSB Mice. J Immunol 161: 2753 2761. 47. Perry, D., A. Sang, Y. Yin, Y. Y. Zheng, and L. Morel. 2011. Murine models of systemic lupus erythematosus. J Biomed Biotechnol 2011: 271694. 48. Waters, S. T., S. M. Fu, F. Gaskin, U. S. Deshmukh, S. S. Sung, C. C. Kannapell, K. S. K. Tung, S. B. McEwen, and M. McDuffie. 2001. NZM2328: A New Mouse Model of Systemic Lupus Erythematosus with Unique Genetic Susceptibility Loci. Clinical Immunol 100: 372 383. 49. Vyse, T. J., S. J. Rozzo, C. G. Drake, S. Izui, and B. L. Kotzin. 1997. Control of multiple autoantibodies linked with a lupus nephritis susceptibility locus in New Zealand black mice. J Immunol 158: 5566 5574. 50. Morel, L., K. R. Blenman, B. P. Crok er, and E. K. Wakeland. 2001. The major murine systemic lupus erythematosus susceptibility locus, Sle1, is a cluster of functionally related genes. Proc Natl Acad Sci U S A 98: 1787 1792. 51. Giles, B. M., S. N. Tchepeleva, J. J. Kachinski, K. Ruff, B. P. Croker, L. Morel, and S. A. Boackle. 2007. Augmentation of NZB Autoimmune Phenotypes by the Sle1c Murine Lupus Susceptibility Interval. J Immunol 178: 4667 4675. 52. Chen, Y., D. Perry, S. A. Boackle, E. S. Sobel, H. Molina, B. P. Croker, and L. Morel. 200 5. Several Genes Contribute to the Production of Autoreactive B and T Cells in the Murine Lupus Susceptibility Locus Sle1c. J Immunol 175: 1080 1089. 53. Boackle, S. A., V. M. Holers, X. J. Chen, G. Szakonyi, D. R. Karp, E. K. Wakeland, and L. Morel. 2001. Cr2, a candidate gene in the murine Sle1c lupus susceptibility locus, encodes a dysfunctional protein. Immunity 15: 775 785. 54. Tchepeleva, S. N., J. M. Thurman, K. Ruff, S. J. Perkins, L. Morel, and S. A. Boackle. 2010. An allelic variant of Crry in the murine Sle1c lupus susceptibility interval is not impaired in its ability to regulate complement activation. J Immunol 185: 2331 2339. 55. Sestak, A., S. Nath, A. Sawalha, and J. Harley. 2007. Current status of lupus genetics. Arthritis Res Ther 9: 210.

PAGE 84

84 5 6. Mosmann, T. R., H. Cherwinski, M. W. Bond, M. A. Giedlin, and R. L. Coffman. 1986. Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J Immunol 136: 2348 2357. 57. Zhu, J., H. Yam ane, and W. E. Paul. 2010. Differentiation of effector CD4 T cell populations (*). Annu Rev Immunol 28: 445 489. 58. Theofilopoulos, A. N., S. Koundouris, D. H. Kono, and B. R. Lawson. 2001. The role of IFN gamma in systemic lupu s erythematosus: a challenge to the Th1/Th2 paradigm in autoimmunity. Arthritis Res 3: 136 141. 59. Curotto de Lafaille, M. A., and J. J. Lafaille. 2009. Natural and adaptive foxp3+ regulatory T cells: more of the same or a division of labor? Immunity 30: 626 635. 60. Belkaid, Y., and W. Chen. 2010. Regulatory ripples. Nat Immunol 11: 1077 1078. 61. Roncarolo, M. G., S. Gregori, M. Battaglia, R. Bacchetta, K. Fleischhauer, and M. K. Levings. 2006. Interleukin 10 secreting type 1 regulatory T cells in rodent s and humans. Immunol Rev 212: 28 50. 62. Collison, L. W., V. Chaturvedi, A. L. Henderson, P. R. Giacomin, C. Guy, J. Bankoti, D. Finkelstein, K. Forbes, C. J. Workman, S. A. Brown, J. E. Rehg, M. L. Jones, H. T. Ni, D. Artis, M. J. Turk, and D. A. Vignali 2010. IL 35 mediated induction of a potent regulatory T cell population. Nat Immunol 11: 1093 1101. 63. Cua, D., J. Sherlock, Y. Chen, C. Murphy, B. Joyce, B. Seymour, L. Lucian, W. To, S. Kwan, T. Churakova, S. Zurawski, M. Wiekowski, S. Lira, D. Gorman R. Kastelein, and J. Sedgwick. 2003. Interleukin 23 rather than interleukin 12 is the critical cytokine for autoimmune inflammation of the brain. Nature 421: 744 748. 64. Perry, D., A. Peck, W. Carcamo, L. Morel, and C. Nguyen. 2011. The Current Concept of TH17 Cells and Their Expanding Role in Systemic Lupus Erythematosus. Arthritis 2011: 10. 65. Dardalhon, V., A. Awasthi, H. Kwon, G. Galileos, W. Gao, R. A. Sobel, M. Mitsdoerffer, T. B. Strom, W. Elyaman, I. C. Ho, S. Khoury, M. Oukka, and V. K. Kuchro o. 2008. IL 4 inhibits TGF beta induced Foxp3+ T cells and, together with TGF beta, generates IL 9+ IL 10+ Foxp3( ) effector T cells. Nat Immunol 9: 1347 1355. 66. Veldhoen, M., C. Uyttenhove, J. van Snick, H. Helmby, A. Westendorf, J. Buer, B. Martin, C. Wilhelm, and B. Stockinger. 2008. Transforming growth factor beta 'reprograms' the differentiation of T helper 2 cells and promotes an interleukin 9 producing subset. Nat Immunol 9: 1341 1346. 67. Duhen, T., R. Geiger, D. Jarrossay, A. Lanzavecchia, and F. Sallusto. 2009. Production of interleukin 22 but not interleukin 17 by a subset of human skin homing memory T cells. Nat Immunol 10: 857 863.

PAGE 85

85 68. Trifari, S., C. D. Kaplan, E. H. Tran, N. K. Crellin, and H. Spits. 2009. Identification of a human helper T cell population that has abundant production of interleukin 22 and is distinct from T(H) 17, T(H)1 and T(H)2 cells. Nat Immunol 10: 864 871. 69. Crotty, S. 2011. Follicular helper CD4 T cells (TFH). Annu Rev Immunol 29: 621 663. 70. Hooks, J. J., H. M. Mou tsopoulos, S. A. Geis, N. I. Stahl, J. L. Decker, and A. L. Notkins. 1979. Immune interferon in the circulation of patients with autoimmune disease. N Engl J Med 301: 5 8. 71. Tucci, M., L. Lombardi, H. B. Richards, F. Dammacco, and F. Silvestris. 2008. Ov erexpression of interleukin 12 and T helper 1 predominance in lupus nephritis. Clin Exp Immunol 154: 247 254. 72. Calvani, N., H. B. Richards, M. Tucci, G. Pannarale, and F. Silvestris. 2004. Up regulation of IL 18 and predominance of a Th1 immune response is a hallmark of lupus nephritis. Clin Exp Immunol 138: 171 178. 73. Tokano, Y., S. Morimoto, H. Kaneko, H. Amano, K. Nozawa, Y. Takasaki, and H. Hashimoto. 1999. Levels of IL 12 in the sera of patients with systemic lupus erythematosus (SLE) -relation to Th1 and Th2 derived cytokines. Clin Exp Immunol 116: 169 173. 74. Enghard, P., D. Langnickel, and G. Riemekasten. 2006. T cell cytokine imbalance towards production of IFN gamma and IL 10 in NZB/W F1 lupus prone mice is associated with autoantibody level s and nephritis. Scand J Rheumatol 35: 209 216. 75. Haas, C., B. Ryffel, and M. Le Hir. 1998. IFN gamma receptor deletion prevents autoantibody production and glomerulonephritis in lupus prone (NZB x NZW)F1 mice. J Immunol 160: 3713 3718. 76. Takahashi, S. L. Fossati, M. Iwamoto, R. Merino, R. Motta, T. Kobayakawa, and S. Izui. 1996. Imbalance towards Th1 predominance is associated with acceleration of lupus like autoimmune syndrome in MRL mice. J Clin Invest 97: 1597 1604. 77. Richards, H. B., M. Satoh, J C. Jennette, B. P. Croker, H. Yoshida, and W. H. Reeves. 2001. Interferon gamma is required for lupus nephritis in mice treated with the hydrocarbon oil pristane. Kidney Int 60: 2173 2180. 78. Baudino, L., S. Azeredo da Silveira, M. Nakata, and S. Izui. 2006. Molecular and cellular basis for pathogenicity of autoantibodies: lessons from murine monoclonal autoantibodies. Springer Semin Immunopathol 28: 175 184.

PAGE 86

86 79. Korn, T., E. Bettelli, M. Oukka, and V. Kuchroo. 2009. IL 17 and Th17 Cells. Annu Rev Immuno l 27: 485 517. 80. Murphy, C. A., C. L. Langrish, Y. Chen, W. Blumenschein, T. McClanahan, R. A. Kastelein, J. D. Sedgwick, and D. J. Cua. 2003. Divergent pro and antiinflammatory roles for IL 23 and IL 12 in joint autoimmune inflammation. J Exp Med 198: 1951 1957. 81. Morse, H. C., T. M. Chused, J. W. Hartley, B. J. Mathieson, S. O. Sharrow, and B. A. Taylor. 1979. Expression of xenotropic murine leukemia viruses as cell surface gp70 in genetic crosses between strains DBA/2 and C57BL/6. J Exp Med 149: 118 3 1196. 82. Taylor, B. A., C. Wnek, B. S. Kotlus, N. Roemer, T. MacTaggart, and S. J. Phillips. 1999. Genotyping new BXD recombinant inbred mouse strains and comparison of BXD and consensus maps. Mamm Genome 10: 335 348. 83. Mountz, J. D., P. Yang, Q. Wu, J. Zhou, A. Tousson, A. Fitzgerald, J. Allen, X. Wang, S. Cartner, W. E. Grizzle, N. Yi, L. Lu, R. W. Williams, and H. C. Hsu. 2005. Genetic Segregation of Spontaneous Erosive Arthritis and Generalized Autoimmune Disease in the BXD2 Recombinant Inbred Stra in of Mice. Scand J Immunol 61: 128 138. 84. Hsu, H. C., T. Zhou, H. Kim, S. Barnes, P. Yang, Q. Wu, J. Zhou, B. A. Freeman, M. Luo, and J. D. Mountz. 2006. Production of a novel class of polyreactive pathogenic autoantibodies in BXD2 mice causes glomerulo nephritis and arthritis. Arthritis Rheum 54: 343 355. 85. Hsu, H. C., P. Yang, J. Wang, Q. Wu, R. Myers, J. Chen, J. Yi, T. Guentert, A. Tousson, A. L. Stanus, T. v. L. Le, R. G. Lorenz, H. Xu, J. K. Kolls, R. H. Carter, D. D. Chaplin, R. W. Williams, and J. D. Mountz. 2008. Interleukin 17 producing T helper cells and interleukin 17 orchestrate autoreactive germinal center development in autoimmune BXD2 mice. Nat Immunol 9: 166 175. 86. Xie, S., J. Li, J. Wang, Q. Wu, P. Yang, H. Hsu, L. Smythies, and J. Mo untz. 2010. IL 17 activates the canonical NF kappaB signaling pathway in autoimmune B cells of BXD2 mice to upregulate the expression of regulators of G protein signaling 16. J Immunol 184: 2289 2296. 87. Koelle, M. 1997. A new fa mily of G protein regulators the RGS proteins. Curr Opin Cell Biol 9: 143 147. 88. Shi, G., K. Harrison, G. Wilson, C. Moratz, and J. Kehrl. 2002. RGS13 regulates germinal center B lymphocytes responsiveness to CXC chemokine ligand (CXCL)12 and CXCL13. J Immunol 169: 2507 2515.

PAGE 87

87 89. Allen, C., K. Ansel, C. Low, R. Lesley, H. Tamamura, N. Fujii, and J. Cyster. 2004. Germinal center dark and light zone organization is mediated by CXCR4 and CXCR5. Nat Immunol 5: 943 952. 90. Allen, C., T. Okada, and J. Cyster 2007. Germinal center organization and cellular dynamics. Immunity 27: 190 202. 91. Cohen, P., and R. Eisenberg. 1991. Lpr and gld: single gene models of systemic autoimmunity and lymphoproliferative disease. Annu Rev Immunol 9: 243 269. 92. Adachi, M., R. Watanabe Fukunaga, and S. Nagata. 1993. Aberrant transcription caused by the insertion of an early transposable element in an intron of the Fas antigen gene of lpr mice. Proc Natl Acad Sci U S A 90: 1756 1760. 93. Kono, D., and A. Theofilopoulos. 2006. Genetics of SLE in mice. Springer Semin Immunopathol 28: 83 96. 94. Zhang, Z., V. Kyttaris, and G. Tsokos. 2009. The role of IL 23/IL 17 axis in lupus nephritis. J Immunol 183: 3160 3169. 95. Kyttaris, V., Z. Zhang, V. Kuchroo, M. Oukka, and G. Tsokos. 201 0. Cutting edge: IL 23 receptor deficiency prevents the development of lupus nephritis in C57BL/6 lpr/lpr mice. J Immunol 184: 4605 4609. 96. Kaliyaperumal, A., C. Mohan, W. Wu, and S. Datta. 1996. Nucleosomal peptide epitopes for nephritis inducing T help er cells of murine lupus. J Exp Med 183: 2459 2469. 97. Kang, H., M. Liu, and S. Datta. 2007. Low dose peptide tolerance therapy of lupus generates plasmacytoid dendritic cells that cause expansion of autoantigen specific regulatory T cells and contraction of inflammatory Th17 cells. J Immunol 178: 7849 7858. 98. Wu, H., F. Quintana, and H. Weiner. 2008. Nasal anti CD3 antibody ameliorates lupus by inducing an IL 10 secreting CD4+ CD25 LAP+ regulatory T cell and is associated with down regulation of IL 17+ CD4+ ICOS+ CXCR5+ follicular helper T cells. J Immunol 181: 6038 6050. 99. Wu, H., E. Center, G. Tsokos, and H. Weiner. 2009. Suppression of murine SLE by oral anti CD3: inducible CD4+CD25 LAP+ regulatory T cells control the expansion of IL 17+ follicular helper T cells. Lupus 18: 586 596. 100. Jacob, N., H. Yang, L. Pricop, Y. Liu, X. Gao, S. Zheng, J. Wang, H. Gao, C. Putterman, M. Koss, W. Stohl, and C. Jacob. 2009. Accelerated pathological and clinical nephritis in systemic lupus erythematosus prone Ne w Zealand Mixed 2328 mice doubly deficient in TNF receptor 1 and TNF receptor 2 via a Th17 associated pathway. J Immunol 182: 2532 2541.

PAGE 88

88 101. Wong, C., L. Lit, L. Tam, E. Li, P. Wong, and C. Lam. 2008. Hyperproduction of IL 23 and IL 17 in patients with sy stemic lupus erythematosus: implications for Th17 mediated inflammation in auto immunity. Clin Immunol 127: 385 393. 102. Chen, X., Y. Yu, H. Deng, J. Sun, Z. Dai, Y. Wu, and M. Yang. 2010. Plasma IL 17A is increased in new onset SLE patients and associate d with disease activity. J Clin Immunol 30: 221 225. 103. Shah, K., W. Lee, S. Lee, S. Kim, S. Kang, J. Craft, and I. Kang. 2010. Dysregulated balance of Th17 and Th1 cells in systemic lupus erythematosus. Arthritis Res Ther 12: R53. 104. Doreau, A., A. Be lot, J. Bastid, B. Riche, M. Trescol Biemont, B. Ranchin, N. Fabien, P. Cochat, C. Pouteil Noble, P. Trolliet, I. Durieu, J. Tebib, B. Kassai, S. Ansieau, A. Puisieux, J. Eliaou, and N. Bonnefoy Brard. 2009. Interleukin 17 acts in synergy with B cell acti vating factor to influence B cell biology and the pathophysiology of systemic lupus erythematosus. Nat Immunol 10: 778 785. 105. Crispn, J., M. Oukka, G. Bayliss, R. Cohen, C. Van Beek, I. Stillman, V. Kyttaris, Y. Juang, and G. Tsokos. 2008. Expanded dou ble negative T cells in patients with systemic lupus erythematosus produce IL 17 and infiltrate the kidneys. J Immunol 181: 8761 8766. 106. Mok, M., H. Wu, Y. Lo, and C. Lau. 2010. The Relation of Interleukin 17 (IL 17) and IL 23 to Th1/Th2 Cytokines and D isease Activity in Systemic Lupus Erythematosus. J Rheumatol 107. Harada, T., V. Kyttaris, Y. Li, Y. Juang, Y. Wang, and G. Tsokos. 2007. Increased expression of STAT3 in SLE T cells contributes to enhanced chemokine mediated cell migration. Autoimmunity 40: 1 8. 108. Ma, C., G. Chew, N. Simpson, A. Priyadarshi, M. Wong, B. Grimbacher, D. Fulcher, S. Tangye, and M. Cook. 2008. Deficiency of Th17 cells in hyper IgE syndrome due to mutations in STAT3. J Exp Med 205: 1551 1557. 109. de Beaucoudrey, L., A. Pue l, O. Filipe Santos, A. Cobat, P. Ghandil, M. Chrabieh, J. Feinberg, H. von Bernuth, A. Samarina, L. Jannire, C. Fieschi, J. Stphan, C. Boileau, S. Lyonnet, G. Jondeau, V. Cormier Daire, M. Le Merrer, C. Hoarau, Y. Lebranchu, O. Lortholary, M. Chandesris F. Tron, E. Gambineri, L. Bianchi, C. Rodriguez Gallego, S. Zitnik, J. Vasconcelos, M. Guedes, A. Vitor, L. Marodi, H. Chapel, B. Reid, C. Roifman, D. Nadal, J. Reichenbach, I. Caragol, B. Garty, F. Dogu, Y. Camcioglu, S. Glle, O. Sanal, A. Fischer, L. Abel, B. Stockinger, C. Picard, and J. Casanova. 2008. Mutations in STAT3 and IL12RB1 impair the development of human IL 17 producing T cells. J Exp Med 205: 1543 1550.

PAGE 89

89 110. Chen, Z., A. Laurence, and J. O'Shea. 2007. Signal transduction pathways and trans criptional regulation in the control of Th17 differentiation. Semin Immunol 19: 400 408. 111. Chun, H., J. Chung, H. Kim, J. Yun, J. Jeon, Y. Ye, S. Kim, H. Park, and C. Suh. 2007. Cytokine IL 6 and IL 10 as biomarkers in systemic lupus erythematosus. J Cl in Immunol 27: 461 466. 112. Goetzl, E. J., M. C. Huang, J. Kon, K. Patel, J. B. Schwartz, K. Fast, L. Ferrucci, K. Madara, D. D. Taub, and D. L. Longo. 2010. Gender specificity of altered human immune cytokine profiles in aging. FASEB J 24: 3580 3589. 113 Khan, D., R. Dai, E. Karpuzoglu, and S. A. Ahmed. 2010. Estrogen increases, whereas IL 27 and IFN gamma decrease, splenocyte IL 17 production in WT mice. Eur J Immunol 40: 2549 2556. 114. Crispn, J., and G. Tsokos. 2009. Human TCR alpha beta+ CD4 CD8 T cells can derive from CD8+ T cells and display an inflammatory effector phenotype. J Immunol 183: 4675 4681. 115. Espinosa, A., V. Dardalhon, S. Brauner, A. Ambrosi, R. Higgs, F. Quintana, M. Sjstrand, M. Eloranta, J. N Gabhann, O. Winqvist, B. Sundeli n, C. Jefferies, B. Rozell, V. Kuchroo, and M. Wahren Herlenius. 2009. Loss of the lupus autoantigen Ro52/Trim21 induces tissue inflammation and systemic autoimmunity by disregulating the IL 23 Th17 pathway. J Exp Med 206: 1661 1671. 116. Lombardi, V., L. Van Overtvelt, S. Horiot, and P. Moingeon. 2009. Human dendritic cells stimulated via TLR7 and/or TLR8 induce the sequential production of Il 10, IFN gamma, and IL 17A by naive CD4+ T cells. J Immunol 182: 3372 3379. 117. Yu, C., W. P eng, J. Oldenburg, J. Hoch, T. Bieber, A. Limmer, G. Hartmann, W. Barchet, A. Eis Hbinger, and N. Novak. 2010. Human plasmacytoid dendritic cells support Th17 cell effector function in response to TLR7 ligation. J Immunol 184: 1159 1167. 118. Vollmer, J., S. Tluk, C. Schmitz, S. Hamm, M. Jurk, A. Forsbach, S. Akira, K. Kelly, W. Reeves, S. Bauer, and A. Krieg. 2005. Immune stimulation mediated by autoantigen binding sites within small nuclear RNAs involves Toll like receptors 7 and 8. J Exp Med 202: 1575 1 585. 119. Morel, L. 2010. Genetics of SLE: evidence from mouse models. Nat Rev Rheumatol 6: 348 357. 120. Sobel, E., C. Mohan, L. Morel, J. Schiffenbauer, and E. Wakeland. 1999. Genetic dissection of SLE pathogenesis: adoptive transfer of Sle1 mediates the loss of tolerance by bone marrow derived B cells. J Immunol 162: 2415 2421.

PAGE 90

90 121. Sobel, E., M. Satoh, Y. Chen, E. Wakeland, and L. Morel. 2002. The major murine systemic lupus erythematosus susceptibility locus Sle1 results in abnormal functions of both B and T cells. J Immunol 169: 2694 2700. 122. Cuda, C. M., L. Zeumer, E. S. Sobel, B. P. Croker, and L. Morel. 2010. Murine lupus susceptibility locus Sle1a requires the expression of two sub loci to induce inflammatory T cells. Genes Immun 11: 542 553. 123 Wu, H., S. A. Boackle, P. Hanvivadhanakul, D. Ulgiati, J. M. Grossman, Y. Lee, N. Shen, L. J. Abraham, T. R. Mercer, E. Park, L. A. Hebert, B. H. Rovin, D. J. Birmingham, D. M. Chang, C. J. Chen, D. McCurdy, H. M. Badsha, B. Y. H. Thong, H. H. Chng, F. C Arnett, D. J. Wallace, C. Y. Yu, B. H. Hahn, R. M. Cantor, and B. P. Tsao. 2007. Association of a common complement receptor 2 haplotype with increased risk of systemic lupus erythematosus. Proc Natl Acad Sci U S A 104: 3961 3966. 124. Douglas, K., D. Wi ndels, J. Zhao, A. Gadeliya, H. Wu, K. Kaufman, J. Harley, J. Merrill, R. Kimberly, G. Alarcn, E. Brown, J. Edberg, R. Ramsey Goldman, M. Petri, J. Reveille, L. Vil, P. Gaffney, J. James, K. Moser, M. Alarcn Riquelme, T. Vyse, G. Gilkeson, C. Jacob, J. Ziegler, C. Langefeld, D. Ulgiati, B. Tsao, and S. Boackle. 2009. Complement receptor 2 polymorphisms associated with systemic lupus erythematosus modulate alternative splicing. Genes Immun 10: 457 469. 125. La Cava, A. 2009. Lupus and T cells. Lupus 18: 1 96 201. 126. Crispn, J. C., V. C. Kyttaris, C. Terhorst, and G. C. Tsokos. 2010. T cells as therapeutic targets in SLE. Nat Rev Rheumatol 6: 317 325. 127. Barnden, M. J., J. Allison, W. R. Heath, and F. R. Carbone. 1998. Defective TCR expression in transg enic mice constructed using cDNA based alpha and beta chain genes under the control of heterologous regulatory elements. Immunol Cell Biol 76: 34 40. 128. Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, and V. K. Kuchroo. 2 006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441: 235 238. 129. Rozen, S., and H. Skaletsky. 2000. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132: 365 386. 130. Rocke, D. M., and B. Durbin. 2001. A model for measurement error for gene expression arrays. J Comput Biol 8: 557 569. 131. Dozmorov, I., and M. Centola. 2003. An associative analysis of gene expression array data. Bioinformatics 19: 204 211.

PAGE 91

91 132. Morris, S. C., P. L. Cohen, and R. A. Eisenberg. 1990. Experimental induction of systemic lupus erythematosus by recognition of foreign Ia. Clin Immunol Immunopathol 57(2): 263 273. 133. Slavin, A., C. Ewing, J. Liu, M. Ichikawa, J. Slavin, and C. C. Bernard. 1998. Induction of a multiple sclerosis like disease in mice with an immunodominant epitope of myelin oligodendrocyte glycoprotein. Autoimmunity 28: 109 120. 134. Josefowicz, S. Z., and A. Rudensky. 2009. Control of regulatory T cell lineage commitment and maintenance. Immunity 30: 616 625. 135. Stockinger, B., K. Hirota, J. Duarte, and M. Veldhoen. 2011. External influences on the immune system via activation of the aryl hydrocarbon receptor. Semin Immunol 23: 99 105. 136. Chen, Y., C. Cuda, and L. Morel. 2005. Genetic Determination of T Cell Help in Loss of Tolerance to Nuclear Antigens. J Immunol 174: 7692 7702. 137. Korn, T., M. Mitsdoerffer, and V. K. Kuchroo. 2010. Immunological basis for the development of tissue inflammation and organ specific autoimmunity in animal models of multiple sclerosis. Results Probl Cell Differ 51: 43 74. 138. Gigure, V. 1999. Orphan nuclear receptors: from gene to function. Endocr Rev 20: 689 725. 139. Marinescu, V. D., I. S. Kohane, and A. Riva. 2005. MAPPE R: a search engine for the computational identification of putative transcription factor binding sites in multiple genomes. BMC Bioinformatics 6: 79. 140. Ishii, H., and Y. Sakuma. 2011. Complex organization of the 5' untranslated region of the mouse estro transcripts with distinct 5' ends. J Steroid Biochem Mol Biol 125: 211 218. 141. Alaynick, W. A., J. M. Way, S. A. Wilson, W. G. Benson, L. Pei, M. Downes, R. Yu, J. W. Jonker, J. A. Holt, D. K. Rajpal, H. Li, J. Stuart, R. McPherson, K. S. Remlinger, C. Y. Chang, D. P. McDonnell, R. M. Evans, and A. N. Billin. 2010. ERRgamma regulates cardiac, gastric, and renal potassium homeostasis. Mol Endocrinol 24: 299 309. 142. Friese, A., J. A. Kaltschmidt, D. R. Ladle, M. Sigrist, T. M. Jessell, and S. Arber. 2009. Gamma and alpha motor neurons distinguished by expression of transcription factor Err3. Proc Natl Acad Sci U S A 106: 13588 13593. 143. Lorke, D. E., U. Ssens, U. Borgmeyer, and I. Hermans Borgmeyer. 2 000. Differential expression of the estrogen receptor related receptor gamma in the mouse brain. Brain Res Mol Brain Res 77: 277 280.

PAGE 92

92 144. Bookout, A. L., Y. Jeong, M. Downes, R. T. Yu, R. M. Evans, and D. J. Mangelsdorf. 2006. Anatomical profiling of nucl ear receptor expression reveals a hierarchical transcriptional network. Cell 126: 789 799. 145. Alaynick, W. A., R. P. Kondo, W. Xie, W. He, C. R. Dufour, M. Downes, J. W. Jonker, W. Giles, R. K. Naviaux, V. Gigure, and R. M. Evans. 2007. ERRgamma directs and maintains the transition to oxidative metabolism in the postnatal heart. Cell Metab 6: 13 24. 146. Dufour, C. R., B. J. Wilson, J. M. Huss, D. P. Kelly, W. A. Alaynick, M. Downes, R. M. Evans, M. Blanchette, and V. Gigure 2007. Genome wide orchestration of cardiac functions by the orphan nuclear receptors ERRalpha and gamma. Cell Metab 5: 345 356. 147. Via, C. S. 2010. Advances in lupus stemming from the parent into F1 model. Trends Immunol 31: 236 245. 148. Choudhury, A. P. L. Cohen, and R. A. Eisenberg. 2010. B cells require "nurturing" by CD4 T cells during development in order to respond in chronic graft versus host model of systemic lupus erythematosus. Clin Immunol 136: 105 115. 149. Morel, L., Y. Yu, K. R. Blenman, R. A. Caldwell, and E. K. Wakeland. 1996. Production of congenic mouse strains carrying genomic intervals containing SLE susceptibility genes derived from the SLE prone NZM2410 strain. Mamm Genome 7: 335 339. 150. Steward Tharp, S. M., Y. J. Song, R. M. S iegel, and J. J. O'Shea. 2010. New insights into T cell biology and T cell directed therapy for autoimmunity, inflammation, and immunosuppression. Ann N Y Acad Sci 1183: 123 148. 151. Glass, C. K., and K. Saijo. 2010. Nuclear receptor transrepression pathw ays that regulate inflammation in macrophages and T cells. Nat Rev Immunol 10: 365 376. 152. Pernis, A. B. 2007. Estrogen and CD4+ T cells. Curr Opin Rheumatol 19: 414 420. 153. Mora, J. R., M. Iwata, and U. H. von Andrian. 2008. Vitamin effects on the imm une system: vitamins A and D take centre stage. Nat Rev Immunol 8: 685 698. 154. Gigure, V. 2008. Transcriptional control of energy homeostasis by the estrogen related receptors. Endocr Rev 29: 677 696. 155. Eichner, L. J., and V. Gigure. 2011. Estrogen related receptors (ERRs): A new dawn in transcriptional control of mitochondrial gene networks. Mitochondrion 11: 544 552.

PAGE 93

93 156. Takayanagi, S., T. Tokunaga, X. Liu, H. Okada, A. Matsushima, and Y. Shimohigashi. 2006. Endocrine disruptor bisphenol A strongl y binds to human estrogen related receptor gamma (ERRgamma) with high constitutive activity. Toxicol Lett 167: 95 105. 157. Michalek, R. D., and J. C. Rathmell. 2010. The metabolic life and times of a T cell. Immunol Rev 236: 190 202. 158. Vander Heiden, M G., L. C. Cantley, and C. B. Thompson. 2009. Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science 324: 1029 1033. 159. Jacobs, S. R., C. E. Herman, N. J. Maciver, J. A. Wofford, H. L. Wieman, J. J. Hammen, and J. C. Rathmell. 2008. Glucose uptake is limiting in T cell activation and requires CD28 mediated Akt dependent and independent pathways. J Immunol 180: 4476 4486. 160. Michalek, R. D., V. A. Gerriets, S. R. Jacobs, A. N. Macintyre, N. J. MacIver, E. F. Mason, S A. Sullivan, A. G. Nichols, and J. C. Rathmell. 2011. Cutting edge: distinct glycolytic and lipid oxidative metabolic programs are essential for effector and regulatory CD4+ T cell subsets. J Immunol 186: 3299 3303. 161. Liu, D., Z. Zhang, and C. T. Teng 2005. Estrogen related receptor gamma and peroxisome proliferator activated receptor gamma coactivator 1alpha regulate estrogen related receptor alpha gene expression via a conserved multi hormone response element. J Mol Endocrinol 34: 473 487. 162. Wang L., J. Liu, P. Saha, J. Huang, L. Chan, B. Spiegelman, and D. D. Moore. 2005. The orphan nuclear receptor SHP regulates PGC 1alpha expression and energy production in brown adipocytes. Cell Metab 2: 227 238. 163. Gigure, V. 2002. To ERR in the estrogen pathway. Trends Endocrinol Metab 13: 220 225. 164. Hong, H., L. Yang, and M. R. Stallcup. 1999. Hormone independent transcriptional activation and coactivator binding by novel orphan nuclear receptor ERR3. J Biol Chem 274: 22618 22626. 165. Huppunen, J., G Wohlfahrt, and P. Aarnisalo. 2004. Requirements for transcriptional regulation by the orphan nuclear receptor ERRgamma. Mol Cell Endocrinol 219: 151 160. 166. Castet, A., A. Herledan, S. Bonnet, S. Jalaguier, J. M. Vanacker, and V. Cavaills. 2006. Recep tor interacting protein 140 differentially regulates estrogen receptor related receptor transactivation depending on target genes. Mol Endocrinol 20: 1035 1047.

PAGE 94

94 167. Chao, E. Y., J. L. Collins, S. Gaillard, A. B. Miller, L. Wang, L. A. Orband Miller, R. T. Nolte, D. P. McDonnell, T. M. Willson, and W. J. Zuercher. 2006. Structure guided synthesis of tamoxifen analogs with improved selectivity for the orphan ERRgamma. Bioorg Med Chem Lett 16: 821 824. 168. Coward, P., D. Lee, M. V. Hull, and J. M. Lehmann. 2 001. 4 Hydroxytamoxifen binds to and deactivates the estrogen related receptor gamma. Proc Natl Acad Sci U S A 98: 8880 8884. 169. Plutzky, J. 2011. The PPAR RXR transcriptional complex in the vasculature: energy in the balance. Circ Res 108: 1002 1016.

PAGE 95

95 BIOGRAPHICAL SKETCH Daniel was born and raised in Rhode Island where he graduated from Toll Gate High School with honors in 1994. His affinity to nature, biology, and physiolog y led him to pursue pre veterinary medicine at the University of Vermont where he earned his B.S. in Animal Sciences in 1998. While there, he also gained valuable laboratory experience in a work study program under the guidance of Dr. Karen Plaut and Dr. Woody Panky, and was even given his own project in a dairy milk research lab. After graduation, he spent time back in Rhode Island as a veterinary technician, but it was his undergraduate research experience that led him to pursue a laboratory manager pos ition for Dr. Laurence Morel when he moved to Gainesville. The challenges and excitement of scientific discovery eventually swayed him to forgo veterinary medicine in the spring of 2006 where he was offered a position as a graduate research assistant studying a congenic model of murine lupus.