Genetic Variation in Caenorhabditid Nematode Worms

MISSING IMAGE

Material Information

Title:
Genetic Variation in Caenorhabditid Nematode Worms
Physical Description:
1 online resource (97 p.)
Language:
english
Creator:
Salomon,Matthew P
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Zoology, Biology
Committee Chair:
Baer, Charles F
Committee Members:
Gillooly, James
Braun, Edward L
Miyamoto, Michael M
Brocchieri, Luciano

Subjects

Subjects / Keywords:
caenorhabditis -- evolution -- genetic -- microsatellite -- mutation -- nematode
Biology -- Dissertations, Academic -- UF
Genre:
Zoology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
When we observe the natural world we cannot help but notice the amount of variation all around us. Where does this variation come from? What maintains it? Traditionally most of the attention has focused on the role of natural selection and/or genetic drift as main evolutionary forces responsible for differences in standing genetic variation among taxa. That is, differences among taxa are due to variation in the strength or efficiency of selection and/or in the differences in effective population size among groups. However, much less attention has been paid to the alternative view that differences among taxa are reflections of their underlying rate of mutation. The following three studies examine how differential mutational properties among and within closely related species manifests in varying levels of standing genetic variation observed in nature.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Matthew P Salomon.
Thesis:
Thesis (Ph.D.)--University of Florida, 2011.
Local:
Adviser: Baer, Charles F.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043343:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 GENETIC VARIATION IN CAENORHABDITID NEMATODE WORMS By MATTHEW PHILIP SALOMON A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCT OR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Matthew Philip Salomon

PAGE 3

3 To my brother, Craig

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank the members of my graduate committee for all their support over the course of the past six years. Each o f my committee members helped me to mature as a scientist, and for that I am very grateful: I truly appreciate the patience shown by Dr. Luciano Brocchieri as he assisted me in developing my programing skills, the open door to Dr. Ed ward ere I could always receive impromptu advice), the big picture perspe ctive and encouragement that Dr. Ja mie Gilooly always provided, the guidance in science and life that Dr. Michael Miyamoto offered, and the amazing opportunity provided to me by Dr. Charle s convey my appreciation for the friendship and support that Charlie has provided, nor can I begin to express how much it means to me that he believed in me through this whole process. I would like to thank my best friend and wi fe, Gigi Ostrow, for always being there to support me over the past six years. Also, I would also like to thank all my fr iends for their support throughout my education I was very fortunate to have the help of my brother Keith Salomon always was t here to help me with any computer programing challenges I came across. Finally, I would like to thank my mother and father for everything they have done for me throughout my entire life. Without their love and support none of this would have been possibl e.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 LIST OF ABBREVIATIONS ................................ ................................ ............................. 9 ABSTRACT ................................ ................................ ................................ ................... 10 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 11 2 COMPARING MUTATIONAL AND STANDING GENETIC VARIABILITY FOR FITNESS AND SIZE IN CAENORHABDITIS BRIGGSAE AND C. ELEGANS ....... 14 Methods and Material s ................................ ................................ ............................ 16 Wild Isolates ................................ ................................ ................................ ..... 16 Mutation Accumulation Lines and Fitness Assays ................................ ............ 17 Body Size ................................ ................................ ................................ ......... 18 Data Analysis ................................ ................................ ................................ .......... 19 Mutational Variance ................................ ................................ .......................... 19 Sta nding Genetic Variance ................................ ................................ ............... 20 Results ................................ ................................ ................................ .................... 23 Fitness ................................ ................................ ................................ .............. 23 Body Volume ................................ ................................ ................................ .... 27 Discussion ................................ ................................ ................................ .............. 30 3 SPONTANEOUS MUTATIONAL AND STANDING GENETIC (CO)VARIATION AT DINUCLEOTIDE MICROSATELLITES IN CAENORHABDITIS BRIGG SAE AND C. ELEGANS ................................ ................................ ................................ .. 34 Materials and Methods ................................ ................................ ............................ 37 Mutation Accumulation Lines ................................ ................................ ............ 37 Choice of Loci and Primer Design ................................ ................................ .... 37 Genotyping ................................ ................................ ................................ ....... 38 Data Analysis ................................ ................................ ................................ .......... 41 Mutation Rate ................................ ................................ ................................ ... 41 Mutational Spectrum ................................ ................................ ........................ 43 Whole Genome Distributions of STR Loci ................................ ........................ 43 Comparison of Mutational and Standing Variation ................................ ........... 44 Results ................................ ................................ ................................ .................... 45 Mutation Rate ................................ ................................ ................................ ... 45

PAGE 6

6 Variation within Species ................................ ................................ ................... 45 Variation between Species ................................ ................................ ............... 46 Mutational Spectrum ................................ ................................ ........................ 47 Genomic Mutational Properties ................................ ................................ ........ 48 The Relationship between Mutational and Standing Genetic Variation ............ 49 Discussion ................................ ................................ ................................ .............. 49 Comparison of Mutation Rate Among Species/Strains ................................ ..... 49 Comparison of Indel Spectrum among Species/Strains ................................ ... 51 Relationship between Mutational and Standing Genetic Variation ................... 52 Taxon Specific Differences i n Mutability of Different Repeat Types ................. 53 Extrapolation to Genome wide Mutation Rate ................................ .................. 55 4 THE RATE AND SPECTRUM OF DI NUCLEOTIDE AUTOSOMAL AND X CHROMOSOME MICROSATELLITE MUTATIONS IN TWO SPECIES OF CAENORHABDITID NEMATODE WORMS THAT DIFFER IN REPRODUCTIVE STRATEGY ................................ ................................ ................................ ............ 63 Material and Methods ................................ ................................ ............................. 65 Mutation Accumulation Lines ................................ ................................ ............ 65 Selection of Microsatellite Loci ................................ ................................ ......... 66 Genotyping ................................ ................................ ................................ ....... 68 Genotyping of Natural Isolates ................................ ................................ ......... 69 Data Analysis ................................ ................................ ................................ .......... 70 Variation in Mutation R ates between Species ................................ .................. 70 Mutational Spectrum ................................ ................................ ........................ 71 Correlation of Per Locus Mutation Rate to Standing Genetic Variation ............ 71 Results ................................ ................................ ................................ .................... 71 Variation between Species in Di nucleotide Mutation Rate .............................. 71 Va riation between Autosomes and X Chromosome ................................ ......... 72 Indel Spectrum ................................ ................................ ................................ 72 Correlation to Standing Genetic Variation ................................ ........................ 72 Discussion ................................ ................................ ................................ .............. 73 Comparison of Mutation Rate between Species ................................ ............... 73 Comparison of Mutation Rate Among Chromosomes ................................ ...... 74 Comparison of Indel Spectrum between Species ................................ ............. 75 Correlation with Standing Genetic Variation ................................ ..................... 76 Conclusions ................................ ................................ ................................ ............ 77 5 SUMMARY ................................ ................................ ................................ ............. 88 LIST OF REFERENCES ................................ ................................ ............................... 90 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 97

PAGE 7

7 LIST OF TABLES Table page 2 1 Total Fitness (W). ................................ ................................ ............................... 32 2 2 Body volume. ................................ ................................ ................................ ...... 33 3 1 Summary of per generation mutation rate for all loci assayed in C. briggsae and C. elegans .. ................................ ................................ ................................ 58 3 2 Summary of the indel spectrum.. ................................ ................................ ........ 59 3 3 Inferred genome wide mutational properties. ................................ ..................... 60 4 1 PCR pri mers used to amplify all loci in Caenorhabditis elegans and C. remanei ................................ ................................ ................................ ............. 78 4 2 SAS code used to fit the generalized linear model to test for variation in mutation rates between C. remanei and C. elegans ................................ ........... 84 4 4 Summary of the indel spectrum.. ................................ ................................ ........ 86

PAGE 8

8 LIST OF FIGURES Figure page 3 1 Relationship between observed mutation rate and number of perfect repeats for each repeat type in the two strains C. briggsae and C. elegans .................... 61 3 2 Genome wide distribution of dinucleotide S TR loci in the C. elegans and C. briggsae genomes. ................................ ................................ ............................. 62 4 1 Boxplots of di nucleotide microsatellite distributions for five species of Caenorhabditis .. ................................ ................................ ................................ 87

PAGE 9

9 LIST O F ABBREVIATIONS H 2 Broad sense heritability. I G Total genetic variance scaled by the square mean. I M Per generation change in the mean with mutation accumulation. Molecular mutation rate. N e Effective population size. t P Persistence time. S Average selec tion coefficient against a new mutation. U Genomic mutation rate for fitness. V E Environmental component of variance. V G Total genetic variance.

PAGE 10

10 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy GENETIC VARIATION IN CAENORHABDITID NEMATODE WORMS By Matthew Philip Salomon August 2011 Chair: Charles F. Baer Major: Zoology When we observe the natural world we ca nnot h elp but notice the amount of variation all around us. Where does this variation come from? What maintains it? Traditional ly most of the attention has focused on the role of natural selection and/or genetic drift as main evolutionary forces responsible f or differences in standing genetic variation among taxa. That is, differences among taxa are due to variation in the strength or efficiency of selection and/or in the differences in effective population size among groups. However, much less attention has been paid to the alternative view that differences among taxa are reflections of their underlying rate of mutation. The following three studies examine how differential mutational properties among and within closely related species manifests in varying le vels of standing genetic variation observed in nature.

PAGE 11

11 CHAPTER 1 INTRODUCTION When we observe the natural world we cannot help but notice the vast amount of genetic variation all around us. Whether we observe this variation at the level of the phenotype o r at molecular level, it is remarkable just how variable organisms are within a population or between different species. Attempting to explain this variability has been a driving motivation for many biologists, especially in the field of evolutionary gene tics. Because of this, much of the energies of evolutionary biologists have focused on answering two fundamental questions: Where does variation come from? And what evolutionary forces maintain it? In general, most of the attention has focused on the role of natural selection and/or genetic drift as the main evolutionary forces responsible for differences in standing genetic variation among taxa. That is, differences among taxa are due to variation in the strength or efficiency of selection and/or in the differences in effective population size among groups. However, much less attention has been paid to an alternative view, that differences among taxa may reflect differences in the underlying mutational process. The focus of t he three studies presented h ere, are an attempt to examine how different mutational properties among and within closely related species manifest as varying levels of standing genetic variation. The majority of this work has relied on estimating mutational properties in several sets o f long term mutation accumulation (MA) lines of closely related species of Rhadiditid nematode worms and has explored how these estimates compare to levels of standing genetic variation in natural populations. Prior work in the Baer lab has

PAGE 12

12 demonstrated t hat, between the two related nematode species Caenorhabditis elegans and C. briggsae, C. briggsae accumulates mutations at twice the rate of C. elegans The first study looks at how different mutational properties between two closely related species affe ct levels of standing genetic variation for two quantitative traits, comparing the mutational variation estimated from mutation accumulation lines to the levels of standing genetic variation in a worldwide collection of natural isolates of both species to estimate the persistence times of new mutations affecting quantitative traits (fitness and body si ze). This work is motivated by the theory that at mutation (purifying) selection balance (MSB) in a large population, the standing genetic variance for a tra it ( V G ) is predicted to be proportional to the mutational variance for the trait ( V M ); V M is proportional to the mutation rate for the trait. Thus, the ratio V M /V G predicts the average strength of selection ( S ) against a new mutation. By comparing V M and V G for lifetime fertilizing rhabditid nematodes, Caenorhabditis briggsae and C. elegans the role of mutation can be contrasted between these two species to look at its effect on levels of standing genetic variation. The goal of the second study is to complement the quantitative genetic results and examine whether the difference in mutation rates between C. elegans and C. briggsae which were estimated from phenotypic traits, are reflect ed at the molecular level. To test this, estimates were generated of the rate and spectrum of di nucleotide microsatellite repeats in four sets of 250 generation mutation accumulation (MA) lines, two sets in the species Caenorhabditis briggsae and two set s in C. elegans These estimates were then compared to the standing variation at the same set of di nucleotide

PAGE 13

13 microsatellite loci for each species. In addition, the mutational properties of microsatellites are also compared to the cumulative effects of mutations on fitness in the same MA lines. The third study examines how mating system (selfing vs. outcrossing) and chromosomal context (autosome vs. sex chromosome) affect the rate and spectrum of di nucleotide microsatellite mutations using a set of MA l ines derived from the outcrossing species of nematode worm C. remanei Theory predicts that natural selection should lead to a reduced mutation rate in selfing taxa and this study provides an ideal experimental test, at the molecular level, of this theor etical prediction. In addition, this study examines if mutation rates at a given locus are reflected in the number of alleles at the same locus in natural populations, thus allowing for comparisons on how differences in mating systems contribute to levels of standing genetic variation in related taxa.

PAGE 14

14 CH APTER 2 COMPARING MUTATIONAL AND STANDING GENETIC VARIABILITY FOR FITNESS AND SIZE IN CAENORHABDITIS BRIGGSAE AND C. ELEGANS The genetic variation present in a population or species is a composite function of mutation, population size, and natural selection. Historically, efforts to understand differences (or similarities) between groups in genetic variation have focused on the interplay between population size and natural selection (Ohta 1973; Houle 1989; Byers and Waller 1999; Gillespie 2000; Lynch 20 07 ). Considerably less attention has been paid to the possibility that differences among groups are due to systematic differences in the underlying rate of mutation. Although it has been known for a long ti me that mutation rates differ among taxa (Sturte vant 1937 ; Drake et al. 1998; Baer et al. 20 07 ), the extent to which variation in mutation rate underlies variation among taxa in the standing genetic variation is poorly understood, particularly for quantita tive traits. The relationship between the standing genetic variance ( V G ) and the per generation input of genetic variance by mutation (the mutational variance, V M ) has a straightforward interpretation under two evolutionary scenarios. Under a determinis tic mutation (purifying) selection balance (MSB) model, V G where S is the average selection coefficient against a new mutation (Barton 1990; Crow 1993; Houle et al. 1996). Put another way, the ratio can be interpreted as the "persistence time" ( t P ) of a new mutati on, i.e., the expected number of generations a mutant allele is present in the (infinite) population before it is eliminated by selection (Crow 1993; Houle et al. 1996). The more deleterious the mutant allele, the faster it is removed from the population by selection. At the opposite extreme, under a strict neutral model at

PAGE 15

15 mutation drift equilibrium (MDE), for self fertilizing taxa, V G N e V M where N e is the genetic effective population size (Lynch and Hill 1986). For a quantitative trait, V M = UE(a 2 ) where U is the genomic mutation rate and a is the additive phenotypic effect of a new mutation (Lynch and Walsh 1998, p. 329). The uni fying factor in these different scenarios is the mutational variance, V M Under both the MSB and MDE scenarios, we expect V G to be proportional to V M and thus the persistence time t P = to be constant if selection is uniform. Changes in the relationship between V G and V M among groups must be due to the action of natural selection. Thus, if the persistence time differs between groups, the difference must be due to historical differences in the strength or efficiency of natural selecti on. This principle has been demonstrated by Houle et al. (1996), who found that the average persistence time for life history traits was about half that for morphological traits in a variety of taxa, consistent with the expected stronger correlation of li fe history traits with fitness Average persistence times differed significantly between species. However, the traits considered varied between species, the species were phylogenetically disparate and included taxa not likely to be at equilibrium and/or to have experienced recent strong artificial selection (e.g., crop plants and inbred lines of mice). To our knowledge, there has been no comparison of mutational variance and standing genetic variance for the same traits in natural populations of related taxa. In this study we report the standing genetic variation for two quantitative traits lifetime reproduction weighted by survivorsh and designate W ) and body size in worldwide collections of two species of rhabditid nematodes, Caenorhabditis briggsae and C. elegans Several lines of evidence

PAGE 16

16 suggest that the mutation rate in C. briggsae i s greater than that of C. elegans for these traits (Baer et al 20 05 2006; Ostrow et al. 20 07 ) and for microsatellites (Phillips et al. 2009), and perhaps for single nucleotide substitutions (D. Denver, CFB, et al., unpublished data). Thus, we predict th at the standing genetic variance (V G ) should be consistently greater in C. briggsae than in C. elegans If it is not, it suggests that idiosyncratic natural selection (e.g., genetic draft; Gillespie 2000) is of primary importance in shaping the standing g enetic variation. Methods and Materials Wild I solates We initially obtained all the (at the time) publicly available strains of wild caught nematodes in the species Caenorhabditis briggsae (6 strains) and C. elegans (40 strains) from the Caenorhabditis G enetics Center at the University of Minnesota in the spring of 20 05 Subsequent to our initial assay in 20 05 additional C. briggsae strains became publicly available. We obtained 50 additional strains of C. briggsae from various sources in the spring of 20 07 Each strain is descended from a single wild caught individual that was allowed to reproduce to large population size and then cryopreserved. Upon receipt, each strain was allowed to expand to large population size (~ 2 generations) under sta ndard conditions of worm husbandry (Wood 1988), at which time three replicate sub lines were initiated from a single individual. Each sub line was inbred for six generations by randomly picking a single L4 stage (juvenile) worm and allowing it to self fertilize. This inbreeding protocol is identical to the initial stage of our mutation accumulation (MA) protocol (Baer et al. 20 05 ) and was done both to assure similar starting conditions of wild strains and MA stocks and to account for genetic variation resulting from within strain heterozygosity.

PAGE 17

17 Mutation Accumulation Lines and Fitness A ssays Details of the mutation accumulation and fitness assay protocols have been reported elsewhere (Vassilieva et al. 1999; Baer et al. 2005 2006). All 40 C. elegans strains and six of the C. briggsae strains were assayed in the summer of 20 05 ; the remaining 50 C. briggsae strains were assayed in the summer of 20 07 Worms were assayed under standard conditions (20 C, fed on the OP50 strain of E. coli ) except that density of agar plates was 30% greater to prevent worms from burying. Worms were counted using the same protocol as in Baer et al ( 20 05 ). At the beginning of the assay, each sub line was replicated 10 times and taken through an additional three generations of sing le worm transfer to account for parental and grand parental effects. If a worm did not reproduce at the first generation the replicate was replaced; if the worm did not reproduce subsequent to the first generation the replicate was not included in the ass ay. Sample sizes therefore differ between strains and sub lines. We define "Total Fitness" ( W ) of a worm as the lifetime reproductive output of an individual; W = 0 for worms that died prior to maturation or failed to reproduce. Some plates became contam inated with mold prior to counting. Mold contamination was scored as None/Some/Heavy = 0/1/2 in 20 05 and None/Present = 0/1 in 20 07 On average, plates with mold contamination had fewer worms than uncontaminated plates. There are two potential non exclu sive explanations: we know that worms are more difficult to see on plates with mold present, leading to predictable undercounts. We suspect, but cannot prove, that worms eat mold spores and newly germinated molds, such that mold grows more quickly on plat es with fewer worms. Based on extensive observation, we believe, but again cannot prove, that this mold does not have direct deleterious effects on the worms. To statistically account for the

PAGE 18

18 effects of mold, we constructed a "mold index" (MI) by weighti ng the density of mold (0/1/2) by the average fraction of total reproduction contributed by that day's reproduction. For example, for C. elegans in 20 05 the first day's reproduction (R1) accounted for 53.0% of total reproduction, R2 accounted for 40.7% a nd R3 accounted for 6.3%. Thus, if the three plates representing an individual worm's reproductive output were scored 2/0/1 representing heavy mold, no mold, and some mold on days 1, 2, and 3, respectively, the MI would be (2)(0.53)+(0)(0.407)+(1)(0.063) = 1.123. We included MI as a covariate in subsequent analyses of fitness; the effect was essentially zero for C. briggsae in 07 ; it was marginally significant (0.10 < P < 0.11) for C. briggsae in 20 05 and highly significant for C. elegans (P < 0.0001) in 20 05 Body S ize Body volume was assayed using a slight modification of the protocol outlined in Ostrow et al. ( 20 07 ). For each inbred line in each strain, we randomly chose half of the replicates in the fitness assay for inclusion in the body size analysis. Approximately 10 age synchronized young adult worms (72 74 hrs post laying) were randomly picked into a 1.5 ml microcentrifuge tube containing a fixative solution of 4% gluteraldehyde buffered with PBS. Fixed worms were then pipetted onto a sli de micrometer and digitally photographed at 20X magnification using a Leica MZ75 dissecting microscope fitted with a Leica DFC280 camera controlled by the Leica IM50 software package ( Leica Microsystems Imaging Solutions Ltd). Digital images were first ma nually procesed by removing the background surrounding each worm using Adobe Photoshop (version 6), leaving only the worm/s in the image. Edited images were then batch processed using a custom macro written in the ImageJ64 software package ( http://rsb.info.nih.gov/ij/ ) (see supplemental information for ImageJ64 macro details).

PAGE 19

19 After processing, the measured outline of each worm was visually inspected and all worms that were damaged (e.g., broken during pipetting) were removed from the final analysis. A subset of the images were analyzed by manually adjusting the threshold of the image and then outlining the worm using the "Analyze Particles" option in ImageJ; no significant difference between manually analyzed and batch processed images were found (data not shown). The area ( A ) and perimeter ( P ) of each worm were calculated and used to estimate body volume ( S ) under the assumption that the worm is cylindrical using the equation from Azevedo et al. 2002 (note that a typographical error in the original publication omitted the exponent in the numerator): S = Data Analysis Mutational Variance For traits under directional selection (direct or indirect), the most meaningful measure of genetic vari ation is the genetic variance divided by the square of the trait mean. This quantity establishes the upper bound on the rate of response to selection and is commonly referred to as the "opportunity for selection", I G where I G = and represents the trait mean (Crow 1958; Houle 1992; Wade 2006). The mutational variance V M is half the among line component of variance divided by the number of generations of mutation accumulation (Lynch and Walsh 1998, p. 331). Th us, I M = = where t is the number of generations of MA, V L,i is the among line

PAGE 20

20 component of variance after i generations of MA and is the trait mean at generation i Values of I M presente d here are averages of the two strains of each species at t MA = 200 and are from reanalysis of data reported elsewhere (Baer et al. 20 05 2006; Ostrow et al. 07 ). Empirical 95% confidence intervals for I M were calculated using a bootstrap resampling metho d outlined in Baer et al. ( 20 05 ). Briefly, a pseudo data set was initially constructed by sampling the data with replacement at the level of line (i.e., all replicates within a line were included), maintaining the block structure of the original data. Me ans and variance components of the pseudo data set were estimated separately for MA and control lines within each of the four strains by REML as implemented in the MIXED procedure of SAS v. 9.2. For the trait W we used the model y = Block + Line + Error ; for body volume we used the model y = Block + Line + Replicate(Line) + Error The calculation was repeated 1000 times; the upper and lower 25 pseudo estimates establish the approximate 95% confidence interval. The average of the two strains within each species for each pseudo replicate is taken as the species average. Standing Genetic Variance Variance components were estimated for each species using restricted maximum likelihood (REML) as implemented in the MIXED procedure of SAS v. 9.2. Since differen t strains of C. briggsae were assayed in different years ( 20 05 20 07 ), for the trait W we initially analyzed the model y = MI + Year + Strain ( Year ) + Inbred_Line ( Strain ( Year )) + error with mold index ( MI ) as a covariate, year considered a fixed effect and the other effects random. Means did not differ significantly among years, so subsequent analyses were done without regard to assay year. For the trait body volume we initially considered the model y = Year + Strain ( Year ) +

PAGE 21

21 Inbred_Line ( Strain ( Year )) + Re plicate ( Inbred_Line ( Strain ( Year ))) + error C. briggsae measured in 20 05 were marginally smaller than those measured in 20 07 so we retained year in the model for subsequent analyses. Population genetic structure introduces a potential complication into the analysis. Strictly speaking, the approximation V G is a statement about within population variation. However, the model tacitly assumes that deleterious mutations never reach appreciable frequency in the population, so it is reasonable to assume that sub populations do not diverg e substantially due to genetic drift, and positive selection is ignored in any case. Both C. elegans and C. briggsae show a species wide clade structure, with two deep clades in C. elegans (Denver et al. 2003) and three in C. briggsae (Dolgin et al. 2008) The clades in C. briggsae largely reflect geography, with the three lineages representing Temperate Trop ical and Equa torial clades (Dolgin et al 2008), whereas the deep clades in C. elegans are not geographically structured. In addition, some collec tions contain several individuals from the same collecting location, but many locations include only a single individual. Almost half (19/40) of the C. elegans strains were collected in a single location (Roxel; see supplementary Table 3). Moreover, beca use of the nature of Caenorhabditis life history (self fertile, very short generation time) it is possible that some or all of the strains within a collecting location are descended from the same ancestral worm only a few generations back. To accommodate the variable collecting structure, we further subdivide the data into "locations", some of which contain multiple strains and some of whi ch do not For the trait W the full model is: y = MI + Clade + Location(Clade) + Strain(Location(Clade)) + Inbred_Lin e(Strain(Location(Clade))) + error with MI as a covariate, clade as a fixed

PAGE 22

22 effect and the others random. Clade identity is unknown for 6/40 C. elegans lines from two locations. The effect of clade was not significant for either trait in either species ( C. briggsae P>0.13 or greater in all cases) so we omitted clade from further analyses. In the above analysis, the environmental component of phenotypic variance ( V E ) is represented by the error (i.e., within inbred line) variance. Under an additive model, the total genetic variance ( V G ) is represented by half the sum of the remaining components of variance, and can be partitioned into within and among group components. Note that we assume that each inbred line is homozygous at all loci, which canno t be strictly true. The among inbred line component of variance is twice the genetic variance within each strain resulting from polymorphism in the ancestral worm and the among strain component of variance represents twice the genetic variation among indi viduals within a sampling location. Standard errors and 95% confidence limits for I G were calculated using a delete one jackknife protocol in which each strain was sequentially deleted from the data and the mean and variance components of the redacted da ta set re calculated as described above (Knapp et al. 1989). Confidence limits were calculated using the jackknife standard error and the usual Student's t distribution formulation (Sokal and Rohlf 1981, p. 145). Standard errors of persistence time ( I G /I M ), average selection coefficient ( I M /I G ), and the ratios of the mutational and standing variances between species ( I M,Cbr /I M,Cel and I G,Cbr /I G,Cel ) were determined using the Delta method for the variance of a ratio where and CV(x) is the coef ficient of sampling variation (the

PAGE 23

23 ratio of the standard error to the estimated value) of x (Lynch and Walsh 1998, equation A1.19b; Vassilieva et al. 1999). 95% confidence limits were calculated as above. We also report the broad sense heritability, H 2 d efined as the total genetic variance scaled as a fraction of the environmental variance, i.e., H 2 = V G /V E Results Fitness Summary statistics are presented in Table 1. First, we can safely rule out the mutation drift equilibrium (MDE) scenario. At MDE, V G N e V M ; given the observed V G and V M N e would have to be on the order of a few dozen individuals to explain the results, an implausibly small number (Cutter et al. 2006). This is unsurprising, given that we expect lifetime reproductive output to be c losely related to fitness; however, ruling out MDE is a necessary first condition. Under the null hypothesis that the standing genetic variance is entirely explained by the mutational variance, we predict the ratio of the standing variances in the two sp ecies, I G,Cbr /I G,Cel should equal the ratio of mutational variances, I M,Cbr /I M,Cel or put another way, the persistence times should be the same in the two species. The ratio of the mutational variances of C. briggsae to C. elegans I M,Cbr /I M,Cel is 3.99, with the 95% bootstrap confidence interval between 1.78 and 8.01. The observed species wide value of I G,Cbr /I G,Cel is 1.85, with the asymptotic 95% confidence interval between 0 and 5.07. Thus, although the ratio of the standing variances in the two spe cies is somewhat less than predicted from the respective mutational variances (i.e., too little variance in C. briggsae and/or too much in C. elegans ), the null hypothesis of I G,Cbr /I G,Cel = 3.99 cannot be rejected.

PAGE 24

24 Looking across species and popul ations, with one exception (the Viosne population of C. briggsae to which we will return), estimated (homozygous) selection coefficients ( I M /I G ) are quite consistent and fall within a relatively narrow range of a few percent (Table 1, last row). Broad se nse heritabilities are on the order of 5 15%. These results are similar to analogous results from Drosophila melanogaster and Daphnia pulex which suggest heterozygous selection coefficients of mutations affecting components of fitness (e.g., viability) o n the order of a few percent, and comparable heritabilities (Houle et al. 1996). Unfortunately, our results cannot be directly compared to results from other taxa, for two reasons. First, because there are no similar estimates of lifetime reproductive su ccess ( fitness is much easier to measure in worms than in most other organisms because reproduction is both rapid and confined to a few days), and second, because these Caenorhabditis species are (believed to be) predominantly selfing, the relevant selection coefficient against new mutations is presumably the homozygous effect, whereas in obligately outcrossing taxa such as Drosophila it is the heterozygous effect that is estimated by V M /V G To our knowled ge, there are no analogous data from any other predominantly selfing organism. Selection coefficients inferred from the ratio of mutational to standing variance (= V M /V G ) can be compared to those calculated directly from the MA data (typically r eferred to as E( a ) in the MA literature). Selection coefficients calculated from MA data are widely believed to be overestimates, perhaps gross overestimates, because mutations of very small effect are difficult to detect with the available methods (Keigh tley and Eyre Walker 1999; Davies et al. 1999). However, the standing genetic variance has

PAGE 25

25 presumably accumulated over a long time, such that the accumulation of many alleles of small effect would contribute to the total genetic variance. If so, we expec t V G to be much larger than V M and the inferred selection coefficient to be very small. In fact, the selection coefficients inferred from this study (~0.02) are somewhat smaller than those estimated from the MA data (~0.05 0.2; Vassilieva et al. 2000; Bae r et al. 20 05 ; Begin and Schoen 2006), perhaps by as much as an order of magnitude. This implies that estimates of genomic mutation rates ( U ) calculated from MA data are underestimates of similar order. This conclusion is reinforced by indirect estimates of U inferred from direct sequencing of MA lines using the method of Kondrashov and Crow (1993), in which (diploid) U for C. elegans was estimated to be on the order of 1 per generation (Denver et al. 2004). The relationship V G (and thus t P = ) is valid only when the population is (1) large, and (2) at mutation selection balance (Keightley and Hill 1988). Together, these two assumptions imply that the standing genetic variation observed within a sing le population will be similar to the genetic variation present in the entire species, because deleterious alleles will never achieve appreciable frequency in any population, precluding divergence due to fixation of slightly deleterious alleles. If positiv e selection and/or genetic drift had caused populations to diverge, there should be substantially more variation present in the species as a whole than in any individual population. Again with one exception, the results appear to lend credence to this ass umption. The point estimate for the standing genetic variance for fitness ( I G ) in the worldwide collection of C. elegans not including the Roxel population (N=21 lines) is 0.011; it is twice that in the Roxel population alone ( I G = 0.026, N=19 lines). Th e species wide

PAGE 26

26 standing genetic variance I G for fitness in C. briggsae (N=50 lines) is 0.027; within the Merlet population (N=12 lines) it is 0.058. The non significant effect of clade in either species is consistent with the deterministic MSB scenario. The inconvenient exception is the Viosne population of C. briggsae (N=12 lines), which is genetically depauperate ( I G = 0.0015). Taken at face value, the point estimate of the selection coefficient ( S = I M /I G ) is 0.59, implying very strong purifyin g selection acting solely within this population. A more plausible scenario is that the worms in the Viosne sample are not at any kind of equilibrium, having descended from a single hermaphroditic founder in the very recent past. In fact, given the repro ductive biology of Caenorhabditis, we find it somewhat surprising that the other populations do not exhibit the same pattern. The fact that the average lifetime reproductive success ( ) we report here for C. elegans (~135) is substant ially less than is typically reported (>200, e.g., Hodgkin and Doniach 1997) deserves comment. The low fitness cannot be primarily attributed to undercounts caused by moldy plates, because the total fecundity of individuals that reproduced entirely on pla tes with no mold was not appreciably larger than on plates that did have mold (an average difference of ~7 worms, or about 5%). It seems likely that some combination of systematic undercounts for reasons unrelated to mold and/or some factor in our worm hu sbandry contributes to low fecundity. However, many previous fitness assays with mutation accumulation lines using essentially identical techniques have not resulted in similarly low counts. The fact that some lines had fecundity that was within the norm al range and some lines (and inbred lines within lines) had very low fitness (e.g., < 20 offspring) suggests that there might be inbreeding

PAGE 27

27 depression, although a previous study with a subset of these wild isolates of C. elegans found no evidence for inbre edin g depression (Dolgin et al. 2007 ). An alternative explanation is that different (sub)lines have differences in the extent of heteroplasmy of deletions in the mitochondrial genome, which are known to be correlated with fitness and are much more prevale nt in C. briggsae than in C. elegans (Howe and Denver 2008). Body V olume Summary statistics are presented in Table 1. The ratio of the mutational variances for body size in the two species, I M,Cbr /I M,Cel is 1.69, with the 95% bootstrap confide nce interval between 0.43 and 3.61. The observed species wide value of I G,Cbr /I G,Cel is 1.92, with the asymptotic 95% confidence interval between 0 and 4.57, very close to the value predicted under the null hypothesis of equal ratios of standing genetic a nd mutational variances. Two patterns emerge from the data on body volume. First, estimated (homozygous) selection coefficients ( I M /I G ) are very similar in all cases and are nearly equal in the two species The Viosne population of C. briggsae is again l ess genetically variable than the others, although the difference is less than for fitness. Just as for fitness, the species wide genetic variance for body size is not substantially larger than the genetic variance present within individual populations, l ending credence to the MSB interpretation of the relationship between standing genetic and mutational variance. Second, and interestingly, the inferred selection coefficients for body volume are of the same order as those for fitness, and if anything are slightly larger. At first glance this seems counterintuitive; we expect "Total Fitness" (a function of fecundity and survivorship) to be under strong direct selection. A possible resolution is that the

PAGE 28

28 genetic architectures of fitness and body volume dif fer in such a way that many alleles have small effects on fitness, whereas only alleles with larger effects cause body size to vary. These species of Caenorhabditis are believed to be primarily self fertilizing in nature, and are expected to be largely homozygous. However, in C. briggsae for both fitness and body volume, approximately 25% of the total genetic variance is among inbred lines within a line; the among inbred line component is significantly different from 0 for body size but not for fitness Presumably, the among inbred line variance results from residual heterozygosity in the ancestor, although new mutations arising during the six generations of inbreeding could also contribute. Conversely, for the worldwide collection of C. elegans the fraction of the genetic variance attributable to variation among inbred lines within a line is about 2% for fitness and 0 for body volume. In the Roxel population of C. elegans however, about half the genetic variance for fitness is among inbred lines, a lthough the REML estimate of the among inbred line component of variance is 0 for body volume. A prosaic explanation is that some of the C. elegans lines were kept in lab culture before cryopreservation, thus more of the residual genetic variation has bee n purged in C. elegans than in C. briggsae The qualitative difference of the Roxel population from the species wide collection of C. elegans reinforces that interpretation. If in fact some of the genetic variation originally present in C. elegans has be en purged subsequent to collection, it implies that the estimates of persistence times are underestimates. If differences in mutational variance between species are due to differences in mutation rate and not the distribution of effects and/or the mutation al target size, the

PAGE 29

29 ratio I M,Cbr /I M,Cel is expected to be equal for all traits. Species wide I M,Cbr /I M,Cel is 3.99 for total fitness and 1.76 for body volume; the difference is not significant. The ratio of the standing genetic variances, I G,Cbr /I G,Cel does not differ between traits (Species wide I G,Cbr /I G,Cel I G,Cbr /I G,Cel between the two traits is at least suggestive that similar factors (e.g., differences in mutation rate) shape the standing genetic variance for both traits. An impo rtant caveat, however, is that the values of the mutational properties (i.e., I M ) assigned to each species are derived from estimates from only two starting genotypes. We can put legitimate confidence limits on the estimates, but they represent a fixed ef fect, i.e., the sampling universe is the two strains represented in this experiment. In reality the mutational variance is a random effect and we have little understanding of the scope of the variation in mutational properties within and between species; it is entirely possible that, on average, the mutational properties of C. elegans and C. briggsae are identical in every way and the variation we observe is simply due to sampling a very small number (two) of starting genotypes. This consideration is of c ourse not unique to Caenorhabditis. Finally, some perspective is in order with respect to power. The way we analyzed the data, by nesting lines within locations, is very conservative, providing a sample size of only 15 or 16, respectively. If we are will ing to accept that genetic variation among locations is not much greater than within locations (the Viosne population of C. briggsae notwithstanding), we can legitimately increase power by resampling over lines rather than locations. However, the results for the basic statistics I G and H 2 do not change substantially. For example, the upper 95% confidence limit on I G in C. elegans

PAGE 30

30 decreases from 1.9 times the point estimate to 1.6 times the point estimate with an increase in sample size from 15 to 40 ( the point estimates are within a few percent). This exercise is obviously not the same as actually sampling an additional 25 locations, but it does suggest that doing so might not change the results much. Discussion Two primary results emerge from this st udy. First, the strength of selection acting on mutations affecting both fitness and body size is consistently inferred to be on the order of a few percent. This result is broadly compatible with results from other taxa. Second, the total genetic varian ce in a worldwide collection does not appear to be very much greater than the genetic variance within sampling locations (with one exception). Taken together, these results suggest that genetic variation for these traits is maintained by mutation (purifyi ng) selection balance. However, there is an alternative possibility. The relative consistency of genetic variance within and between populations and species, and especially between traits, suggests that recurrent hitchhiking events genetic draft (Gille spie 2000) may play a predominant role in structuring the genetic variation in these species. Genetic draft is likely to be particularly important in predominantly self fertilizing taxa. Moreover, the relative consistency of persistence time ( V G /V M ) a cross disparate taxa and traits (~ 50 for life history traits; Houle et al. 1996; this study) is intriguing. Draft theory predicts relative independence of standing molecular genetic variation from population size (Gillespie 2000). Equivalent theory for quantitative traits does not exist, but the parallels are obvious. Comparisons of standing and mutational variation between taxa and traits provide the best way to tease apart the relative contributions of neutral and non neutral processes in shaping qua ntitative genetic variation. We envision two classes of studies

PAGE 31

31 that would be particularly informative, especially in tandem. First, the best characterized metazoan species ( Drosophila melanogaster, Daphnia pulex, Caenorhabditis ) all have large effective population sizes, such that the deterministic MSB formulation is plausible. It would be extremely interesting to perform the kind of study we report here in groups with known large differences in population size. Second, it would be useful to consider m ultiple traits with different expected levels of selection, in the spirit of Houle et al. (1996). Discerning among the alternative possibilities (e.g., draft, uniform mutational properties) will require that studies include very many genotypes f rom multip le populations.

PAGE 32

32 Table 2 1 Total Fitness (W). See text for details of calculations. 95% confidence interval follows point estimate in parentheses. Abbreviations are: U : % per generation change in the mean with mutation accumulation; IM: per generation increase in the genetic (mutational) variance, scaled by the square of the mean; VLOC: component of genetic variance among locations (N = # of locations); VLINE: component of genetic variance among lines within locations (N = # of lines): VINLINE: compone nt of genetic variance among inbred lines within lines; VE: environmental (= error) component of variance; VG: total genetic variance; : mean lifetime reproductive output; IG: total genetic variance scaled by the square of the mean; H2: broad sense herit ability; tP: persistence time; S: average selection coefficient against new mutations. Estimate U 10 3 I M 10 4 V LOC (N) V LINE (N) V INLINE V E V G I G H 2 t P (= I G / I M ) S C briggsae (all lines) 2.89 ( 3.17, 2.60) 8.96 (4.22, 13.91) 252.8 (16) 68.3 (51) 129.4 (0, 287.6) 2034.2 225.3 (20.9, 429.6) 90.8 (80.8, 100.8) 0.027 (0.0008, 0.054) 0.11 (0.007, 0.21) 30.5 (0, 65.0) 0.033 (0, 0.070) Cbr (Merlet) 392.8 (12) 187.9 (0, 562.7) 1634.3 290.4 (0, 779.0) 71.0 (55.1, 86.8) 0.058 (0, 0.163) 0.17 (0, 0.49) 65.2 (0, 188.3) 0.015 (0, 0.044) Cbr (Viosne) 0.13 (12) 23.0 (0, 119.1) 1853.4 11.6 (0, 59.1) 87.4 (82.4, 92.4) 0.0015 (0, 0.008) 0.006 (0, 0.033) 1.7 (0, 8.8) 0.5 9 (0,1) C. elegans (all lines) 1.07 ( 1.38, 0.75) 2.24 (1.34, 3.30) 185.1 (13) 280.8 (34) 73.5 (0, 316.6) 4113.1 269.7 (0,548.5) 140.5 (123.8, 157.1) 0.0137 (0, 0.0290) 0.07 (0.0013, 0.130) 61.0 (0, 134.9) 0.016 (0, 0.036) Cel (Roxel only) 399.5 (19) 306.9 (0,1171.2) 4433.6 353.2 (0, 779.1) 116.3 (97.1, 135.6) 0.026 (0, 0.063) 0.08 (0, 0.19) 116.8 (0, 291.0) 0.009 (0, 0.021) Cel (Roxel omitted) 131 (12) 192.4 (15) 28.9 (0, 197.8) 3864 176.4 (0, 418.4) 145.1 (129.5, 160.7) 0.0084 (0, 0.020) 0. 05 (0, 0.11) 37.4 (0, 92.0) 0.027 (0, 0.066)

PAGE 33

33 Table 2 2 Body volume. See text for details of calculations. 95% confidence interval follows point estimate in parentheses. : mean body volume (mm3), all other abbreviations are the sa me as in Table 1. Estimate U 10 3 I M 10 4 V LOC (N) V LINE (N) V INLINE V REP V E V G (x 10 9 ) (x 10 3 ) I G (x 10 3 ) H 2 t P (= I G / I M ) S C. briggsae (all lines) 1.43 ( 1.77, 1.10) 2.48 (0.30, 4.66) 7.85 E 9 (16) 7.03 E 9 (51) 4.53 E 9 (1.49, 7.57 E 9) 4.04 E 8 2.48 E 8 9.71 (4.14, 15.3) 1.23 (1.15, 1.30) 6.45 (2.46, 10.44) 0.15 (0.05, 0.25) 26.0 (0, 55.1) 0.038 (0, 0.081) Cbr (Merlet) 1.44 E 8 (11) 5.83 E 9 (0, 1.47 E 8) 3.0 2 E 8 2.14 E 8 10.10 (0, 25.2) 1.06 (0.96, 1.15) 9.02 (0, 21.93) 0.20 (0, 0.50) 36.4 (0, 99.2) 0.027 (0, 0.075) Cbr (Viosne) 3.83 E 9 (12) 4.18 E 9 (0, 1.71 E 8) 4.28 E 8 2.54 E 8 4.00 (0, 11.41) 1.20 (1.14, 1.27) 2.76 (0, 7.82) 0.06 (0, 0.17) 11.2 (0, 34.1) 0.090 (0, 0.275) C. elegans (all lines) 0.68 ( 0.96, 0.40) 1.54 (0.89, 2.20) 6.71 E 10 (13) 2.08 E 8 (34) 5.06 E 11 (0, 1.36 E 9) 1.12 E 7 8.86 E 8 10.74 (4.26, 17.23) 2.15 (2.06, 2.23) 2.33 (0.86, 3.87) 0.053 (0.018, 0.089) 15.2 (3.3, 26.9) 0.066 (0.014 0.118) Cel (Roxel only) 2.08 E 8 (19) 0 1.42 E 7 1.04 E 7 10.41 (0, 24.83) 2.15 (20.56, 22.50) 2.25 (0, 5.35) 0.04 (0, 0.10) 14.6 (0, 35.7) 0.069 (0, 0.169) Cel (Roxel ommitted) 2.12 E 9 (12) 1.86 E 8 8.51 E 11 1.01 E 7 7.55 E 8 1 0.42 (8.3 E 10, 20.02) 2.12 (2.03, 2.22) 2.32 (0, 7.55) 0.10 (0.01, 0.20) 10.31 (0, 21.3) 0.097 (0, 0.201)

PAGE 34

34 CHAPTER 3 SPONTANEOUS MUTATIONAL AND STANDING GENETIC (CO)VARIATION AT DINUCLEOTIDE MICROSATELLITES IN CAENORHABDITIS BRIGGSAE AND C. ELEGANS For m any reasons, understanding evolution requires understanding mutation the rate at which mutations occur, the molecular spectrum, and their effects on fitness. First, the standing genetic variation within a population ( H ) is a composite function of the ef fective population size ( N e ) and the mutation rate ( ): at equilibrium, (Hartl and Clark 20 07 ) Differences in the standing genetic v ariation between populations or species, or between regions of the genome in the same species, may be due to differences in N e in mutation rate, or both; N e itself depends on many factors, including natural selection (Hill and Robertson 1966) Similarly, the rate of neutral divergence ( k ) between taxa is equal to the neutral mutation rate ( 0 ) (Kimura 1968). Differences between lineages in the rate of molecular evo lution may be due either to differences in the absolute mutation rate ( ) or to differences in the fraction of mutations that are effectively neutral, which is a function of N e Second, the evolution of genome size and/or composition may depend both on na tural selection (e.g., small genomes may be favored due to the increased speed of replication) and on the mutational process (e.g., a deletion bias will lead to a reduction in genome size). Differences among taxa in genome size and/or composition, or in t he properties of particular genomic components (such as introns) may result from the effects of selection, mutation, or both. Third, the cumulative effect on fitness of deleterious mutations depends on both the rate ( U ) and the distribution of fitness effe cts ( g[a] ) (Lynch a nd Walsh 1998) and those parameters are of utmost importance in evolutionary theory. However, the rate

PAGE 35

35 and distribution of effects are confounded both statistically (Begin and Schoen 2006) and conceptually (Baer, Miyamoto, and Denver 20 07 ) and taxa that differ in the degree to which they suffer the effects of deleterious mutation may have different mutation rates, different distributions of mutational effects, or both. The common theme of these examples is that the manifestation of mutational pr ocesses is almost always confounded with natural selection and/or population size, from which it follows that an unambiguous characterization of mutational processes can greatly facilitate understanding of evolution. The most effective way to dissociate m utational processes from selection is to allow mutations to accumulate at very small N e thereby minimizing the efficiency of selection (Kimura 1962; Kondrashov, Ogurtsov, and Kondrashov 2006) Here we report the results of a comparative study of the mutational properties of dinucleotide short tandem repeat STR, or microsatellite loci in two species of Rhabditid nematode, Caenorhabditis briggsae and C. elegans Mutations were allowed to accumulate at N e ions; selection has thus been "turned off" as much as is possible. We target STRs for scrutiny for three reasons. First, we are interested in the relationship between the mutation rate at a well defined class of molecular loci and the overall impact of ne w mutations on fitness. We have previously documented significant variation in the cumulative effects of new mutations on fitness and body size between and potentially within C. briggsae and C. elegans (Baer et al. 20 05 ; Baer et al. 2006; Ostrow et al. 20 07 ; Baer 2008) The weight of the evidence suggests a scenario in which C. briggsae declines in fitness at about twice the rate as C. elegans However, the mutational decay of fitness may differ between groups due to a difference in the

PAGE 36

36 distribution of mutational effects rather than in mutation rate. To date there is very limited information on the relationship between the rate and spectrum of new mutations at the molecular level ( ) and the genomic mutation rate for fitness ( U ). It would be of considerable interest to identify an easily screened class of marker loci whose mutational properties vary with U in a consistent way. Second, we are interested in the relationship between standing variation and mutation ra te. Almost all studies that report variation in "mutation rate" infer mutation rate indirectly, from standing genetic variation and/or divergence among taxa at a class of loci assumed to be evolving neutrally. Any inference derived from such a study is o nly as robust as the underlying assumptions. There have been remarkably few studies (we know of only one in a eukaryote) in which the standing variance at a set of loci has been directly compared to the demonstrated mutation rate at the same set of loci. A strong positive correlation between the standing variance and the demonstrated mutation rate provides the best possible justification for inferring mutation rate from standing variation. STR loci are ideal for this purpose because their high mutation r ate provides much greater power than could be obtained from other classes of loci (e.g., base substitutions at single nucleotides). Third, an influential model of genome evolution invokes a general mutational bias in favor of small deletions relative to insertions as a driving force behind the evolution of genome size (Petrov 2001; Petrov 2002) A survey of random nuclear mutations in the C. elegans genome found a significant excess of short insertions relative to deletions (Denver et al. 2004) contrary to the phylogenetic pattern obs erved in nuclear pseudogenes (Witherspoon and Robertson 2003) Similarly, a survey of STR mutations

PAGE 37

37 in the N2 strain of C. elegans showed a significant insertion bias (Seyfert et al. 2008) although repeat motifs were not uniformly represented, nor was an effect of repeat motif tested in that study. Finally, our most fundamental motivation is "geno mic natural history". The study is part of an ongoing effort to understand the factors underlying taxonomic variation in the genomic mutation rate. Evolutionary theory provides clear guidance regarding the evolution of mutation rate with respect to matin g system and chromosomal context (reviewed in Drake et al. 1998; Sniegowski et al. 2000; Baer, Miyamoto, and Denver 20 07 ) but there have been very few empirical studies conducted in a systematic comparative context The two species studied here have very similar life histories, thus there is no a priori reason to expect systematic differences in the strength of selection on mutation rate. Materials and Methods Mutation Accumulation Lines The MA protocol has been de scribed in detail elsewhere (Vassilieva and Lynch 1999; Baer et al. 20 05 ) Briefly, highly inbred stocks of each strain were replicated 100 times and perpetuated by single hermaphrodite transfer for 250 generations This protocol results in a genetic effective population size of N e result of occasionally having to use backup stocks of worms when the original worm did not survive), thereby minimizing the efficiency of natural selection and ensuring that all but the most deleterious mutations behave accordi ng to neutral dynamics. Choice of Loci and Primer D esign C. briggsae genome (strain AF16) by BLAST search against the NCBI nr database (ca.

PAGE 38

38 October 2002) for the oli gonucleotide sequence XX (5) where XX is the dinucleotide sequence AC, AG, AT, CG, using the "short, nearly exact match" algorithm. The dinucleotide repeat and 200 bp of upstream and downstream flanking sequence were saved and screened for duplicates by p airwise BLAST search of the flanking sequence. From the list of unique sequences we chose at random 96 loci of at least five repeats, allowing at most one nucleotide indel over the entire repeat sequence. Primers were designed using Primer3 software (Rozen and Skaletsky 2000) using the default parameters with an optimum fragment length of 250, a minimum(maximum) allowable fragment length of 150(350) bases, and a minimum distance of 10 base s between the repeat and the primer termini. Loci for C. elegans were chosen from those previously published by (Sivasundar and Hey 2003) and (Frisse 1999) and supplemented with loci ch osen randomly from the C. elegans genome (WS137). Presence and (approximate) length of microsatellite loci were confirmed by direct sequencing of cloned PCR products for most loci in both species ( Appendix A ) PCR products were cloned into TOPO TA cloni ng vectors (Invitrogen, Carlsbad CA) and Interdisciplinary Center for Biotechnology Research (ICBR). Sequences were aligned in Sequence Viewer 4 (CLC Bio, Cambridge MA) using default parameters. Microsatellite repeat number was determined by taking the average of at least two sequencing reads per locus and searching for dinucleotide repeat motifs with the PHOBOS algorithm (Christoph Mayer, Ruhr Universitt Bochum ). Genot yping Genomic DNA was extracted from two replicate cultures of each MA line and the ancestral control stock using a modified protocol of (Williams et al. 1992) We

PAGE 39

39 employed a nested PCR strategy with fluorescently tagged primers, via a modification of the "three primer" method of (Schuelke 2000) PCR reactions of 15 l were done in 96 well plates, using 1 ul of DNA sample, 60 pmol of selective primer, 6 pmol of M13 tail primer, 60 pmol of labeled M13 primer, 1.5 mM MgCl2, 10 mM of dNTPs, and 0.375 units of Eppendorf Taq polymerase. Reactions were initially run for 10 cycles of 40 seconds denaturing at 94C, 40 seconds annealing at 60C, and 40 seconds extension at 72C; the annealing temperature was then decreased to 48C and the r eaction was continued for an additional 30 cycles. Three different fluorescent labels were used (fam, hex and ned), with only a single label used for a given reaction (= locus). Products labeled with different fluorescent tags were pooled and analyzed usi ng an Applied Biosystems 3730XL DNA analyzer (The Center for Applied Genomics, Hospital for Sick Children, Toronto, ON, Canada). Data were analyzed using Genemapper 3.0 software (Applied Biosystems) and GeneMarker (SoftGenetics). Fragment length was esta blished relative to a known size standard ladder (GeneScan 500, Applied Biosystems). We employed an iterative binning procedure to identify putative mutants. In the first iteration we calculated the mean fragment length for all replicates. Fragments tha t deviated by > 1.5 bases from the mean were removed from the dataset and the mean recalculated. Alleles that differed by > 1.5 bases from the re calculated mean were scored as putative mutants. Putative mutants were then re amplified from an independent DNA extraction and re genotyped as above. Putative mutants that had the same fragment length in both reactions were scored as mutant alleles; putative mutants that did not have the same fragment length in both reactions were considered false positives an d scored as non

PAGE 40

40 mutant. Averaged over all loci, the initial false positive rate was approximately 40%, with a final false positive rate equal to ( p / L )(0.40), where p is the probability of observing a mutant allele at a locus, L is the number of MA lines g enotyped at a locus and assuming a complete mutational bias to the observed allele. Averaged over all loci, the final false positive rate is on the order of 0.5%. A conservative estimate of the false negative rate is to inflate the observed fraction of mutant alleles by the initial false have underestimated the true mutation rate by 20% if there is no mutational bias and as much as 40% if there is a complete mutational bias to the wild type allele. Th e only solution to the false negative problem is to genotype each line twice at each locus, which would have been prohibitively expensive. Reported values of mutation rates are uncorrected values The possibility of contamination is an inherent problem in MA experiments; the most likely cause is mis labeling of plates or tubes, e.g., line 421 is inadvertently labeled 412. Although our MA protocol was explicitly designed to make mis labeling immediately detectable, no system is perfect. We found no lines that had high C. briggsae >2 in C. elegans ) that shared the identical set of mutations. As an additional test, we fit the distribution of the number of mutations among lines to a Poisson distribution; non independence of m utations in lines would increase the variance above the Poisson expectation. The number of lines differed among loci, so we used the weighted mean number of lines for each repeat type as the sample size. In three of the four strains the distribution of n umbers of mutations was an excellent fit to the Poisson (goodness of fit chi square, P > 0.18 in all cases). In PB306

PAGE 41

41 there was a marginally significant excess of lines with one mutation and a deficit of lines with two or more mutations (obs/exp. 0 = 45/4 goodness of fit = 4.59, P > 0.03). Undetected contamination would have the effect of reducing the actual number of lines surveyed, thus potentially biasing the es timated mutation rate downward Data Analysis Mutation Rate Allelic state was initially modeled as a binomially distributed random variable X with state 0 = wild type and state 1 = variant (length differences among variant alleles are not considered); each locus is assumed to constitut e an independent manifestation of the mutational process. The null hypothesis is no difference among species or strains in the binomial parameter p = Pr(X=1). The mutation rate can be approximated by p / t where t is the number of generations of MA. The full data set can be represented by an n m matrix with the rows representing the n MA lines and the columns representing the m loci. Since different loci were examined in the two species, loci are nested within species. Differences among groups were assessed via generalized linear mixed model as implemented in SAS v. 9.1 PROC GLIMMIX, using a logit link function (http://support.sas.com/rnd/app/papers/glimm ix.pdf). Significance of approximate F tests for fixed effects was determined by the residual pseudo likelihood method (Wolfinger and O'Connell 1993) ; degrees of freedom were calculated by the Kenward Rogers method. Length specific mutation rates were calculated by estimating the least squares mean of the binomial parameter for each strain/repeat type combination and dividing by the n umber of generations of MA.

PAGE 42

42 We first tested for variation between strains within each species. In principle, strain is a random effect, but two strains cannot provide a meaningful estimate of the within species variance, so strain is treated as a fixed effect. The initial model was p = rep_num + rep_type + strain + locus ( rep_type ( strain )) + all interactions, where p i s the binomial parameter, rep_num is the number of dinucleotide repeats and rep_type is the dinucleotide motif (AC, AG, AT). Strain rep_type and their interactions are categorical fixed effects, locus is a categorical random effect, and rep_num is a cont inuous covariate. To account for overdispersion of the data, the among locus (residual) component of variance was estimated separately for each rep_type / strain combination. Among locus variance in mutation rate was assessed by likelihood ratio test (LRT) comparing the (pseudo)likelihoods of the models with and without the residual variance term. Twice the difference in the negative log likelihood of the two models is chi square distributed with degrees of freedom equal to the difference in the number of para meters between the two models. We next tested for differences among species using the model p = rep_num + rep_type + species + strain(species) + locus ( rep_type ( species )) + all interaction terms; the among locus component of variance is estimated separ ately for each rep_type / strain combination as described previously. A complication is that the within species analysis revealed significant interactions with strain in C. elegans but not in C. briggsae (see Results) and the fixed effect model fits a singl e effect of strain nested within species. To account for the variation in the effects of strain between the two species, we pooled the two strains of C. briggsae and compared the pooled data to C. elegans using the same model as above.

PAGE 43

43 Mutational Spectr um Mutations were characterized as insertions or deletions (without respect to length), and the proportion of deletions q was calculated for each locus in each strain, where q = #deletions/total # of mutations. Allelic state (insertion or deletion) is mod eled as a binomially distributed random variable, with the null hypothesis of no difference among groups in the binomial parameter q Differences among groups were analyzed using PROC GLIMMIX with the logit link function. We initially tested for differen ces between strains within species, using the model q = rep_num + rep_type + strain + all interactions + locus ( rep_type ). The analysis failed to converge, so we removed repeat number from the model, subsuming repeat number in the among locus variance. Th at model also failed to converge, so we considered differences among strains for each repeat type separately, using the model q = strain + locus employing a Bonferroni We next tested for differences between spec ies; the full model is q = species + rep_type + species rep_type + locus ( rep_type ( species )). The full model did not converge, so we considered differences among species for each repeat type separately, using the model q = species + s train ( species ) + locus ( species ), employing a Bonferroni random effect. Wh ole Genome Distributions of STR L oci To examine the genome wide abundance and distribution of dinucleotide microsatelli te repeats we performed in silica searches of whole genome sequences for both C. elegans (Wormbase version WS189) and C. briggsae (Wormbase version WS191). Because the current build of the C. briggsae genome (WS191) contains

PAGE 44

44 larity but cannot be placed exactly on a particular chromosome assembly we omitted these sequences from the analysis. The inclusion of these random sequences increases the overall number of STR loci, but does not change the relative abundances of each rep eat type (data not shown). This strategy provides a conservative estimate of the genome wide distribution of STR loci in C. briggsae All dinucleotide STRs of 5 perfect repeat units were identified using the PHOBOS algorithm (Christoph Mayer, Ruhr Univ ersitt Bochum, http://www.ruhr uni bochum.de/spezzoo/cm/cm_phobos.htm ). The PHOBOS parameters for all searches were: search method = imperfect, minimum unit length = 2, maximum unit length = 4, indel score = 2, recursion depth = 7, minimum score = 8. H ere we present only perfect repeats of 5 repeat units. The expected genome wide mutation rate G was calculated as: G = AC p AC + AG p AG + AT p AT where i is the expected mutation rate of repeat type i and p i is the proportion of repeat type i in the g enome. To estimate i we determined the average repeat number n for repeat type i and determined the expected mutation rate for a repeat of length n from the linear regression of the per locus mutation rate on repeat number, averaged over the two strains of each species. Regressions were done using the MIXED procedure in SAS v. 9.1, including locus as a random effect. Comparison of Mutational and Standing V ariation Six natural isolates ("strains") of C. briggsae were genotyped at 32 loci; these strain s were the only wild strains of C. briggsae that were publicly available at the time. Strains were obtained from the Caenorhabditis Genetic Center stock collection at the University of Minnesota and cryopreserved upon receipt. All genotyping was performe d

PAGE 45

45 as described above for the MA lines. We calculated the locus specific effective number of alleles n e,i at locus i under both the step wise mutation model (SMM) (Kimura and Ohta 1975) and the infinite alleles model (IAM) (Kimura and Crow 1964) using the Microsatellite Analysis (MSA) software package (Dieringer and Schlotterer 2003) We used published values of n e for 19 loci in 23 strains of C. elegans (Sivasundar and Hey 2003) To assess the relationship between standing genetic va riation and mutation rate, we first calculated the correlation between the per locus mutation rate in the two strains within each species using SAS v.9.1 PROC MIXED with the TYPE=UNR covariance structure. The per locus mutation rate was significantly posi tively correlated between the two strains in each species ( C. briggsae r = 0.41, P < 0.002; C. elegans r = 0.65, P < 0.0001), so we used the average of the two strains. We then calculated the Spearman's correlation between n e,i in the wild isolates and i using SAS PROC CORR. Results Mutation R ate Locus by locus statistics of the mutational properties (rate and spectrum) are presented in Appendix B a nd among locus averages are presented in Table 1; the distribution of mutation rates for each repeat type/ strain combination are shown in Figure 1. Variation within S pecies Overall mutation rate does not differ between strains in either species. The large residual among locus component of variance in both species ( C. briggsae LRT chi square = 146.3, df = 6, P<0.0001; C. elegans LRT chi square = 26.1, df = 6, P <

PAGE 46

46 0.0003) is biologically relevant, because it means that there are locus specific effects on mutation rate beyond the simple ones of repeat number and repeat type. Further, there is significant variat ion between strains in the among locus variance in C. elegans but not in C. briggsae ( C. elegans LRT chi square = 5.4, df = 1, P < 0.03; C. briggsae LRT chi square = 1.8, df = 1, P > 0.17). Mutation rate increases with repeat number in both species, altho ugh the effect is more pronounced in C. elegans than in C. briggsae ( C. elegans average slope of the regression of on repeat number = 3.84 10 6 P < 0.0001; C. briggsae average slope = 3.43 10 6 P < 0.03). In addition, in C. elegans there is a marginally significant interaction between repeat number and repeat type (P < 0.04), indicating that the quantitative effect of repeat number on mutation rate varies depending on the particular repeat type (depicted in Figure 1). There are marginally significant main effects of repeat type in both species (0.03 < P < 0.05), but the rank order differs between species (Table 1). In C. briggsae the rank order averaged over strains is AG > AC > AT. In C. elegans t he rank order averaged over strains is AC > AG > AT, but there is a significant interaction between strain and repeat type (P < 0.02). The interaction between strain and repeat type results from the difference between strains in the average length correcte d AG mutation rate (4.3 x 10 5 in N2 vs. 0.82 x 10 5 in PB306). The qualitative rank order for N2 is AG > AC > AT; for C. elegans there is a marginally significant (P > 0.02) three way interaction between repeat number, repeat type and strain. Variation between Species There is a highly significant difference in overall mutati on rate between the two species (P < 0.002), with C. briggsae having an average length corrected mutation rate almost three fold higher than that of C. elegans (5.64 x 10 5 /generation vs. 1.98 x 10 5

PAGE 47

47 /generation). Further, there is a significant (P < 0.0 1) interaction of repeat number with species. However, the slope of the regression of mutation rate on repeat number differs by only about 10% between the two species, which suggests that the effect of repeat length is probably not qualitatively different in the two species. There is a marginally significant (P<0.03) interaction between repeat type and species. The source of the interaction can be primarily attributed to the much higher AG mutation rate in C. briggsae than in C. elegans Finally, there is a marginally significant (P<0.03) three way interaction between repeat number, repeat type, and species. The preceding between species analysis in which strain is considered a fixed effect fits an average effect of strain nested within species, but in reality some of the effects of strain differ between the two species, there being several significant interactions with strain in C. elegans but not in C. briggsae When the two strains of C. briggsae are pooled and compared to (unpooled) C. elegans the results are nearly identical; in particular, the main effect of species remains highly significant (P < 0.001). Mutational Spectrum The indel spectrum differs between species for two of the three repeat types (AC, P < 0.015; AG, P < 0.001; experiment wide with the bias being toward deletions in C. briggsae and towards insertions in C. elegans (Table 2, last column). In neither case is there a significant difference between strains within either species (P > 0. 11 in all cases). The pattern differs for AT dinucleotides; there is a consistent insertion bias in C. briggsae (HK104, q = 0.2, PB800, q = 0), whereas the two strains of C. elegans have opposite indel biases (N2, q = 0; PB306, q = 1). However, there are fewer AT loci than AC or AG in the data set for C. elegans and

PAGE 48

48 we were unable to assess the significance of the differences among groups at AT repeat loci. Overall, the data provide a poor fit to the strict stepwise mutation model (Table 2). Averaged ove r strains and repeat types, the fraction of mutations that are insertions or deletions of a single repeat is very similar in the two species (73% in C. briggsae 71% in C. elegans ). This result is quite consistent with those reported by Seyfert et al. (2008) from the N2 strain of C. elegans For loci which are comparable between the two studies (AC dinucleotides of < 100 repeats) the fraction of single step mutations is 56% in our study and 65% in theirs. Genomic Mutational P roperties We can extrapolate from our experimental results to make inferences about the genome wide mutational properties of the two species (Table 3). The complete distri butions of perfect dinucleotide STR loci are presented in Figure 2; the estimated total for C. briggsae is probably an underestimate due to our use of the more conservative C. briggsae omitted from the anal ysis (see Methods). In the C. elegans genome, there are AC with an average length of ~7 repeats, 35% are AG (~ 8 repeats), 26% are AT( ~8 repeats), and 5% are CG. In C. briggsae there are (approximately) 4408 STR loci, of which (approximately) 26% are AC with an average length of ~7 repeats, 58% are AG (~10 repeats), 14% are AT(8 repeats) and 3% are CG. Using the species average point estimates of the linear regression parameters calculated from the mutation data, the expected number of mutations at dinucleotide STRs per generation in C. briggsae is about twice that of C. elegans

PAGE 49

49 The Relationship between Mutational and Standing Genetic Variation Standing genetic variat ion in the six wild strains of C. briggsae is summarized in Supplementary Table S4. The correlation between the locus specific mutation rate and n e the effective number of alleles at that locus (i.e., the standing genetic variance) is significantly posit ive in both species, but almost twice as great in C. elegans (Spearman's r = 0.88, n = 19, P < 0.0001) as in C. briggsae (Spearman's r = 0.51, P < 0.003). If the mutation rate of C. briggsae is in fact twice that of C. elegans the expectation is that the re will be twice as much standing genetic variance in C. briggsae as in C. elegans However, because of the geographic disparity between our sample of wild C. briggsae strains and the sample of wild C. elegans of Sivasundar and Hey (2003) and because the global population genetic structure differs between the two species (Cutter et al. 2006; Dolgin, Felix, and Cutter 2008) comparison of standing genetic variation between the tw o data sets is not meaningful. Discussion Comparison of Mutation Rate among Species/Strains The primary motivation of this study is to compare the mutational properties (rate and spectrum) between strains and species, toward the end of understanding the factors underlying variation in those properties. Results from several experiments lead to the conclusion that, on average, the cumulative effects of new mutations on fitness (and body size) accrue about twice as fast in these two strains of C. briggsae as in these two strains of C. elegans (Baer et al. 2006; Ostrow et al. 20 07 ) "Cumulative the MA parlance) and in the increase in genetic variance due to the input of new mutations, V M M are functions of both the rate and distribu tion of

PAGE 50

50 phenotypic effects of new mutations (Lynch and Walsh 1998, pp. 328 335) and statistically separating the effects of the rate and distribution of effects is notoriously difficult because the sampling variances of the two are negatively correlated (Begin and Schoen 2006) The ~ two fold difference between the two species in mutation rate supports the conclusion that it is a difference in mutation rate per se that underlies the greater cumulative mutational effects in these strains of C. briggsae (although of course the distribution of effects may differ as well). More generally, our results support the intuitive conclusion that there is a close correspondence between the genomic mutation rate for fitness, U and the molecular mutation rate, There is a caveat to the conclusion that the mutation rate is higher in C. briggsae In a MA experiment, mutational variance (V M and n e ) is proportional to the effective population size, N e Our experiment was designed to ha ve N e = 1, by transferring a single hermaphrodite worm every generation. However, when the focal individual failed to reproduce, we "went to backup", and picked a worm from the previous generation (or, occasionally, from two generations previous), thereby the increasing the census size above 1. When census size fluctuates over time, N e is a function of harmonic mean population size (Ha rtl and Clark 20 07 p. 121) In the case where some generations have census size of 1 and other generations are large, the harmonic mean is insensitive to differences of many orders of magnitude of the large size generations and depends only on the ratio t (1): t (large), where t represents number of generations of given size. From this calculation, it turns out that the HK104 strain of C. briggsae had a larger N e had to go to backup more often in that strain than in the other three strains. A caveat to

PAGE 51

51 this caveat, however, is that selection acts to reduce N e (Hill and Robertson 1966) and if selection were stronger in HK104 than in the other strains (which seems likely), then N e would actually be closer to one than we infer from census size. The fact that the mutational properties of the HK104 and PB800 strains of C. briggsae are very similar, both in this study and in our previous studies, suggest that the potential difference in N e between HK104 and the other three strains is not a ma jor factor. Comparison of I ndel Spectrum among Species/S trains Many, but by no means all, studies of the STR mutational spectrum report a bias toward insertions (summarized in Ellegren 2004; Paun and Horandl 2006) For two of the three repeat types (AC, AG), the direction of the indel spectrum differed significant ly between the two species: the bias was toward deletions in C. briggsae ( AC = 0.80, AG = 0.77) and toward insertions in C. elegans ( AC = 0.42, AG = 0.21). The pat tern at AT repeats was more variable (Table 2, last column), but the combination of fewer loci sampled in C. elegans and a substantially lower observed mutation rate for AT vs. AC and AG in C. briggsae limits the strength of inference about AT repeats. Th e overall insertion bias observed in C. elegans and particularly N2, is consistent with previous findings of a mutational insertion bias in the N2 strain, both at STR loci (Frisse 1999; Seyfert et al. 2008) and for random nuclear sequence (Denver et al. 2004) Denver et al. speculated that the qualitative difference between the indel s pectrum of mutations accumulated in an MA experiment and those observed over evolutionary time (Witherspoon and Robertson 2003) may be due to the effects of selection. A possible alternative exp lanation, given the results of this study, is that the ancestral mutational bias was toward deletion and that the C. elegans lineage evolved a bias toward

PAGE 52

52 insertion in recent time. If so, the apparent discrepancy between the MA and evolutionary patterns c an be resolved without invoking natural selection. However, the median size of insertion substitutions observed by Witherspoon and Robertson (+2 nucleotides) was smaller than the median deletion ( 7 nucleotides) and the means were even more disparate, so we caution that conclusions drawn from these STR data may not be relevant to the genome at large. Relationship between Mutational and Standing Genetic V ariation At mutation drift equilibrium, the standing genetic variance at a locus is proportional to the mutation rate under both the IAM ( 4 N e ) and the SMM ( ). In the absence of perturbing forces (i.e., natural selection), N e is the same at all loci, so differences in standing genetic variance among loci must be due to either to differences in mutation rate or to natural selection (sampling variance notwithstanding). The mutation rate is usually known only imprecisely and is usually assumed to be uniform across loci, and differences among loci or classes of l oci in the standing genetic variance is typically attributed to differences in the strength or efficiency of selection (e.g., Sabeti et al. 2006) Of the large body of studies of the mutational properties of STR lo ci (reviewed in Ellegren 2004) few of thos e that measure mutations directly (i.e., from the distribution over a pedigree or from reporter constructs) have attempted formal comparisons of the relative mutation rates of different repeat types, and those that draw inferences indirectly from the stand ing genetic variance or from comparisons of substitutions between species cannot unambiguously partition the effects of selection from those of mutation.

PAGE 53

53 Our data show a (variably) strong positive correlation between the per locus mutation rate and the standing variance at the locus, but the relationship is much stronger in C. elegans (Spearman's r = 0.88, P < 0.0001) than in C. briggsae (Spearman's r = 0.51, P < 0.003). A possible source of the discrepancy between the two species is that we only includ ed six strains of C. briggsae whereas Sivasundar and Hey (2003) had 23 stra ins of C. elegans Alternatively, it is known that the population structure differs between C. elegans and C. briggsae and our sample of strains from C. briggsae incorporates samples from two major clades (Cutter et al. 2006) If the migration rate (4 N e m ) differed among regions of the genome (there is no reason to expect it would), it could potentially reduce the correlation between standing genetic variance and mutation rate. Nevertheless, this is an important result because it demonstrates that, on average, the standing genetic variation at a locus does substantially reflect the underlying mutation rate. We know of one other study in which direct estimates of mutation rate were compared to sta nding variation at the same set of loci. Vigoroux et al. (2002) reported a Spearman's r of 0.42 of heterozyosity with mutation rate at a set of 98 STR loci in a collection o f 193 maize plants (Matsuoka et al. 2 002) Thus, studies that employ indirect methods of inference of mutation rate are justified. This was not a foregone conclusion for example, recall the discrepancy between the indel spectra inferred from direct and indirect studies of C. elegans an d it remains to be verified for classes of loci other than STRs. Taxon Specific Differences in Mutability of Different Repeat T ypes The most comprehensive study of the mutational properties of STRs is that of Kelkar et al. (2008) who indirectly inferred the mutational properties of a very large number(> 950,000 loci of four or more repeats) of orthologous dinucleotide STR loci in

PAGE 54

54 the human and chimpanzee genomes. Comparison of our study with their vastly larger one is instructive in several respects. First, the fact that we (and Vigouroux et al. 2002) observe a positive relationship between mutation rate and standing variatio n validates their inferences, i.e., there is no evidence that their data are positively misleading because of hidden biases. Second, they observe substantial (order of magnitude) residual variation among loci in the mutation rate, after accounting for the effects of repeat number and type (= motif). Thus, the among locus variance in mutation rate that we observe experimentally appears to be an honest manifestation of biologically relevant properties that operate over long evolutionary time scales. Numero us studies have found both direct (i.e., position effects; (Lichtenauer Kaligis et al. 1993) and (mo re often) indirect evidence that the mutation rate varies with local genomic context (e.g., Hardison et al. 2003; Lercher, Chamary, and Hurst 2004; Arndt, Hwa, and Petrov 20 05 ) Various explanations have been offer ed; one that appears particularly convincing is that mutation rates are higher in regions of closed chromatin (Prendergast et al. 20 07 ) although the sp ecific mechanism is not known. An intri guing disparity between our results and the findings of Kelkar et al. (2008) is the difference in the relative magnitudes of mutation rates of the different repeat types. In the human/chimp genome, AT dinucleotid es mutate significantly faster than AC or AG repeats. Our data from C. briggsae show that AT repeats have a significantly lower mutation rate than AC and AG repeats, and the standing variance at AT repeats in C. briggsae is lower than for AG repeats, whic h have the highest observed mutation rate, although nothing like the predicted three fold dif ference Kelkar et al. posit that the higher mutation rate at AT repeats results from the smaller number of hydrogen bonds

PAGE 55

55 in double stranded AT repeats relative to AC or AG repeats. If we provisionally accept that the difference between our data and the human/chimp is real and not Type I error on our part resulting from our vastly smaller sample size, it leads to the conclusion that "DNA is not just DNA", i.e., t hat DNA with the same sequence mutates in different ways in different taxa. Extrapolati on to Genome wide Mutation Rate Two properties of the genomic distribution of dinucleotide STRs differ qualitatively between (the AF16 strain of) C. briggsae an d (the N2 strain of) C. elegans (Figure 2). First, the fraction of AG repeats is much greater in C. briggsae than in C. elegans (58% vs. 35%) and there are only half as many AT repeats in C. briggsae as in C. elegans (14% vs. 26%), and second, the average AG locus is over two repeats longer in C. briggsae than in C. elegans (10.1 vs. 7.6 repeats; Table 3). Taken together and extrapolating over the genomic distribution from the linear regression parameters inferred from our MA study, we infer that the per locus dinucleotide STR mutation rate is about twice as great in C. briggsae as is the expected total number of dinucleotide STR mutations (0.24/gen as in C. elegans (0.12/gen). There are obviously many sources of uncertainty in those calculations. Never theless, the results are remarkably consistent with the body of evidence inferred indirectly from the cumulative phenotypic effects of MA. Given the short average length of perfect dinucleotide STRs and their relative paucity in the Caenorhabditis genome (compare to the ~950,000 orthologous dinucleotide STR loci in the human/chimp genome), it is unlikely that differing properties of perfect dinucleotide STRs in the two species is the sole cause of the different cumulative effects of MA. Rather, the diffe rence in the mutational properties of STR loci

PAGE 56

56 is probably a byproduct of some more fundamental difference in the mutational input and/or output. One obvious possibility is that some property of the DNA repair machinery differs consistently between the tw o species. The two species are believed to have diverged on the order of 100 million generations ago, roughly on the timescale of the divergence of humans and rodents (Cutter 2008) Significant differences in various aspects of the DNA repair process are known to exist between humans and rodents, and between more closely related taxa (Eis en and Hanawalt 1999) and it is certainly possible that differences exist between the two Caenorhabditis species. However, there is no concrete evidence for any such difference. A second possibility, for which there is some evidence, albeit indirect, i s that some aspect of oxygen free radical metabolism differs between the two species, or at least between the strains included in this experiment. Reactive oxygen species (ROS) are normal byproducts of cellular metabolism, and oxidative stress has been im plicated in microsatellite instability (Jackson and Loeb 2000; Lee et al. 2006) Howe and Denver (2008) have documented the presence of heteroplasmy for a deletion in the mitochondrial NADH dehydrogenase 5 (ND5) gene. N D5 functions in ROS metabolism, and there is evidence that individuals with defective ND5 suffer increased ROS damage. The CGC stocks of HK104 and PB800 used by Howe and Denver both have low frequencies of the ND5 deletion, but the immediate ancestor of o ur HK104 MA lines apparently evolved a high frequency of the ND5 deletion during the inbreeding leading up to the MA experiment (D. Denver, personal communication). Integrated over the genomic distribution of dinculeotide STRs, it is estimated that the gen omic mutation rate at dinculeotide STRs in C. briggsae is roughly twice that of C.

PAGE 57

57 elegans This finding is entirely consistent with the body of evidence from the cumulative mutational effects on the phenotype, and provides one of the first direct demonst rations of a relationship between molecular and phenotypic mutational properties for a non mutator genotype. Further, we find the indel spectrum differs between repeat types and species, in contrast to many (but certainly not all) previous studies that ha ve found a general insertion bias at STR loci. Finally, we find that the per locus mutation rate is significantly positively correlated with the standing genetic variation in both species. This result, which was also found in maize by Vigoroux et al. (2002) provides empirical justification for using the standing genetic variance as a proxy for the mutation rate.

PAGE 58

58 Table 3 1 Summary of per generation mutation rate C. briggsae and C. elegans "Composite" repeats have > 1 repeat type in the locus in question); composite loci were omitted from the statistical analyses. ge mutation rate estimated by least squares mean; SEM in parentheses. See Methods for details of the general linear mixed model. C. briggsae C. elegans Repeat Type HK104 PB800 N2 PB306 AC N loci ( lines) 11 (91) 11 (93) 13 (79) 16 (81) ave. repeat # 14.0 14.2 16.5 23.1 OBS x 10 5 6.28 5.57 3.08 8.20 LS x 10 5 (SEM) 6.65 (3.33) 4.55 (2.98) 2.43 (1.31) 7.09 (3.32) AG N loci ( lines) 30 (95) 30 (94) 15 (86) 14 (80) ave. repeat # 21.7 22.4 18.7 18.2 OBS x 10 5 10.6 11.6 4.85 2.99 LS x 10 5 (SEM ) 9.79 (2.47) 9.86 (2.93) 4.34 (1.95) 0.82 (0.58) AT N loci ( lines) 14 (82) 12 (82) 8 (59) 9 (61) ave. repeat # 12.1 11.5 16.5 16.8 OBS x 10 5 1.96 3.57 2.98 1.78 LS x 10 5 (SEM) 2.18 (1.27) 4.49 (2.71) 1.59 (0.85) 0.89 (0.57) Composite N loci ( lines) 3 (87) 3 (92) ave. repeat # 21.0 21.0 OBS x 10 5 2.81 12.4

PAGE 59

59 Table 3 2 Summary of the indel spectrum. "Composite" loci have > 1 repeat type; composite loci were omitted from the statistic al analyses. For each repeat type, row headings are: N loci, the number of loci genotyped for a given repeat type with the mean number of lines genotyped ( ) in parentheses; Deletion (Insertion) > 1 is the number of mutant alleles > 1 repeat unit (2 bp) shorter (longer) than the ancestral allele; Deletion (Insertion) = 1 is the number of mutant alleles 1 repeat unit (2 bp) shorter (longer) than the ancestral allele. Indel Bias q is the proportion of mutations that are deletions. C. briggsae C. elegans Repeat Type HK104 PB800 N2 PB306 AC N loci ( lines) 11 (91) 11 (93) 13 (79) 16 (81) Deletion > 1 3 3 2 3 Deletion = 1 8 9 2 8 Insertion > 1 0 0 2 4 Insertion = 1 4 2 3 10 Indel bias q 0.733 0.857 0.44 4 0.400 AG N loci ( lines) 30 (95) 30 (94) 15 (86) 14 (80) Deletion > 1 3 7 0 0 Deletion = 1 59 49 4 1 Insertion > 1 1 6 1 2 Insertion = 1 12 19 11 3 Indel bias q 0.827 0.700 0.250 0.167 AT N loci ( l ines) 14 (82) 12 (82) 8 (59) 9 (61) Deletion > 1 0 0 0 1 Deletion = 1 1 0 0 1 Insertion > 1 3 4 0 0 Insertion = 1 1 6 3 0 Indel bias q 0.200 0 0 1 Composite N loci ( lines) 3 (87) 3 (92) Deletion > 1 0 2 Deletio n = 1 2 7 Insertion > 1 0 0 Insertion = 1 0 0

PAGE 60

60 Table 3 3. Inferred genome wide mutational properties. Regression parameters are determined from the linear regression of per locus mutation rate against repeat number. E( is the weighted mean of the three repeat type specific values. Species Repeat type ~N loci ( % ) Mean repeat number Slope Intercept E( ) Expected # of mutations/gen C. briggsae AC 1340 ( 25.5 ) 7.3 6.9 1 x 10 6 4.0 x 10 5 9.8 x 10 6 0.06 AG 3056 ( 58.1 ) 10.2 2.34 x 10 6 6.0 x 10 5 8.4 x 10 5 0.14 AT 714 ( 13.6 ) 7.9 2.87 x 10 9 3.1 x 10 5 3.1 x 10 5 0.03 CG 152( 2.9 ) Total 5262 5.7 x 10 5 0.24 C. elegans AC 1930 ( 34.6 ) 7.3 1. 41 x 10 6 3.1 x 10 5 4.1 x 10 5 0.04 AG 1955 ( 35.0 ) 7.6 2.68 x 10 6 1.0 x 10 5 1.0 x 10 5 0.04 AT 1439 ( 25.8 ) 7.7 5.87 x 10 6 7.0 x 10 5 4.5 x 10 5 0.03 CG 262 ( 4.7 ) Total 5586 2.3 x 10 5 0.12

PAGE 61

61 Figure 3 1. Relationship b etween observed mutation rate ( OBS ; dependent variable) and number of perfect repeats (independent variable) for each repeat type in the two strains C. briggsae and C. elegans Panels A C are of AC, AG, and AT repeats in the HK104 (diamonds) and PB800 (s quares) strains of C. briggsae Solid and dashed lines are the best fit linear regression of OBS on repeat number in HK104 and PB800, respectively. Panels D F are of AC, AG, and AT repeats in the N2 (diamonds) and PB306 (squares) strains of C. elegans Solid and dashed lines are the regression of OBS on repeat number in N2 and PB306, respectively.

PAGE 62

62 Figure 3 2. Genome wide distribution of dinucleotide STR loci in the C. elegans and C. briggsae genomes. Only perfect repeats are reported. Y axis is the number of repeats. X axis is divided into bins of five repeats, with all loci greater than 60 repeats pooled. Panel A is the distribution of STR dinucleotide loci in the C. briggsae genome, Panel B is the C. elegans genome.

PAGE 63

63 CHAPTER 4 THE RATE AND SPECTRUM OF DI NUCLEOTIDE AUTOSOMAL AND X CHROMOSOME MICROSATELLITE MUTATI ONS IN TWO SPECIES OF CAENORHABDITID NEMATODE WORMS THAT DIFFER IN REPRODUCTIVE STRATEGY To what degree natural selection has shaped the rate of spontaneous mutations among differen t taxa remains an unresolved question in evolutionary biology. While mutation rates are known to vary among and within taxa (Drake et al. 1998; Lynch 2010), the relative importance of natura l selection versus non adaptive and physiologic al processes has y et to be determined (Lynch 2008) Theoretical investigations into the evolution of mutation rates provide two general predictions (Kondrashov 1988, 1995; Drake et al. 1998). First, selection to reduce the deleterious mutation rate should be stronger in as exual and selfing organisms than in sexual ones. In a diploid asexual organism, the strength of selection favoring an allele that modifies the mutation rate by a factor of U is approximately U whereas in an outcrossing sexual taxon the strength of sele ction on such a modifier allele is approximately h U where h is the average strength of selection against deleterious mutations in heterozygotes. Second, selection to reduce the mutation rate should be stronger in an obligately selfing sexual organism than in an obligate outcrossing organism. In an obligately selfing sexual taxon, the strength of selection acting on a modifier of the mutation rate is (1/2) U if deleterious mutations are not completely recessive Thus, the strength of selection on modifiers of the mutation rate in selfing taxa relative to outcrossing taxa is greater by a factor of about 2 h However, the possibility of an increase in mutation rate may exist if a mutator of mutation rate rises in frequency along with a beneficial mutation through hitchhiking.

PAGE 64

64 Similar reasoning applies to modifiers of sex linked and autosomal mutation rates in taxa with defined sex chromosomes (McVean and Hurst 1997). Partially recessive dele terious alleles at loci on the hemizygous chromosome impose a greater fitness cost than autosomal alleles with the same effect. Therefore, selection on modifiers of the sex chromosomal mutation rate is stronger than selection on modifiers of the autosomal mutation rate. This theory leads to several clear empirical predictions: all else equal (1) asexual taxa should evolve a lower genomic mutation rate than related sexual taxa, (2) obligately (or predominantly) selfing taxa should have a lower mutation rat e than related obligately (or predominantly) outcrossing taxa, and (3) the X linked mutation rate should be lower than the autosomal mutation rate in taxa with X/Y sex determination. While the theoretical predictions are clear, to what extent do these the oretical predictions hold in real life? Have obligately selfing species ev olved lower mutation rates than their outcrossing relatives? Members of the nematode genus Caenorhabditis provide an ideal system to examine questions of how mutation rates vary amo ng closely related species with different reproductive strategies. The ancestral reproductive state within the genus Caenorhabditis is outcrossing (gonochorism), however self fetilization (hermaphroditism) has evolved independently at least three times in the genus, with species C. elegans C. briggsae (Kiontke et al. 2004) and in the newly described species (C. Braendle per. comm.) being hermaphroditic. Here we present results from comparisons of di nucleotide microsatellite mutation rates for two autosomes and the X chromosome in the outcrossing species C. remanei

PAGE 65

65 and in a strain of C. elegans that was maintained by male female mating. We demonstrate that the overall di nucleotide mutation rate in the historically outcrossing species, C. remanei is indeed greater than that in the historically selfing species C. elegans Our results are consistent with the theoretical prediction that natural selection to reduce the spontaneous mutation rate for di nucleotide microsatellite repeats has bee n stronger in the selfing species. Material and Methods Mutation Accumulation Lines All MA lines used in this study were previously described in Baer et al. ( 2010 ) Briefly, highly inbred stocks of each strain were replicated and perpetuated by transferri ng a single female and male worm each generation for ~ 100 consecutive generations. This protocol results in a genetic effective population size of N e approximation is the result of occasionally having to use backup stocks of worms when the original worm did not survive, see Baer et al. 2010 for details on N e ), thereby minimizing the efficiency of natural selection and ensuring all but the most d eleterious mutations behave according to neutral dynamics. In addition, the MA lines used in the present study were subjected to additional generations of MA past those assayed in Baer et al. ( 2010 ) as noted below. Two sets of the MA lines reported in Baer et al. ( 2010 ) were used in this study. To represent an outcrossing reproductive system, a set of MA lines derived from the PB2282 strain of Caenorhabditis remanei that had undergone 122 generations of MA were used. In addition, a strain of C. elegans in which the capability for self fertilization was blocked was also included. This strain, hereafter referred to as C. elegans fog 2 was constructed by introgressing the fog 2 mutation (Schedl and Kimble 1988) into the

PAGE 66

66 canonica l N2 genetic background (Vassilieva and Lynch 1999; Baer et al. 2005) via backcrossing for 12 generations (see Baer et al. 2010 for details). The fog 2 mutation ability to generate s perm and thus renders a hermaphroditic individual into a functional female. The C. elegans fog 2 MA lines were subject to a total of 200 generations of MA. The greater number of generations in the C. elegans fog 2 MA lines resulted from the slowing of ge neration time in the C.remanei MA lines as the MA process progressed. Selection of Microsatellite Loci The goal of this study was to compare how mutational properties differ with respect to reproductive system and chromosome type and thus we choose to sel ect loci that would maximize the probability of observing enough mutations to make such comparisons. From previous work, we have shown that di nucleotide microsatellite mutation rates in Caenorhabditis are dependent on both repeat type and repeat length ( Phil l ips et al. 2009). Therefore, we chose to focus on AG di nucleotide microsatellite repeats in both species and to match loci with respect to repeat length between the two species as much as possible. Furthermore, AG di nucleotide repeats are the most abundant repeat type in all five of the currently available Caenorhabditis genome assemblies (Figure 1). In addition, to test if the rate and spectrum of di nucleotide microsatellite mutations differed with respect to chromosome type between C. remanei an d C.elegans fog 2, loci from two autosomes were selected to compare to loci selected from the X chromosome. For the two autosomes, we chose to include the IV chromosome, which is known to be highly heterozygous in a different inbred strain derived from th e same wild isolate of C. remanei (Barriere et al. 2009), as well as an

PAGE 67

67 additional autosome (chromosome II) selected randomly from the remaining four autosomes. All perfect di nucleotide microsatellites with 5 repeats (10 bp in length) or greater were iden tified in the published genomes of C. elegans (build WS205), and C. reamnei (build WS205) using the PHOBOS algorithm version 3.3.12 (Christoph Mayer, Ruhr Universitt Bochum ). The PHOBOS parameters for searches in both species were: M imperfect, u minim um repeat length = 2, U maximum repeat length = 2, m mismatch score = 6, r recursion depth = 7, s minimum length score = 8, f number of bases flanking a repeat = 250 bp. These results were further filtered by repeat perfection and length using a set of custom Perl scripts. At present the draft genome build of C. remanei does not include assignment of contigs to individual chromosomes and therefore the chromosomal context of each microsatellite locus had to be assigned based on sequence similarity to the most closely related species for which chromosome information is available, C. briggsae Two criteria were used to assign the C. remanei loci to a putative chromosome number based on sequence similarity to the C. briggsae genome assembly. First, BLA ST searches were used to identify the single best hit for the 250 bp of flanking sequence surrounding each C. remanei locus to the C. briggsae (build WS205) genome. All BLAST parameters were left as defaults. Second, the single best BLAST hit for each of the C. remanei WS205 contigs was found in the C. briggsae genome assembly. From these two BLAST searches, all di nucleotide microsatellite loci identified in C. remanei were assigned to a putative chromosome number if: (1) the flanking sequence surroundi ng each locus and (2) the contig from

PAGE 68

68 which the locus was identified both had a best single hit BLAST match to the same C. briggsae chromosome. Microsatellite mutation rates are known to positively correlated with the number of repeats (Ellgran 2004) and t herefore, to increase the probability of observing a mutation at a given locus, we selected microsatellite loci from two different size classes based on the 90 th to 95 th and 96 th to 99 th percentiles of the length distribution of each species. To amplify e ach locus, PCR primers were designed using the Primer 3 software (Rozen and Skaletsky 2000) for each locus (plus 250 bp on either side of the locus) to generate an in silico fragment size was cons trained to between 100 bp and 400 bp for all loci. Predicted than the focal perfect AG di nucleotide repeat, with a period size of 1 bp to 100 bp using the PHOBOS algorith m version 3.3.12 (Christoph Mayer, Ruhr Universitt Bochum ). The PHOBOS parameters for searches in both species were: M imperfect, u minimum repeat length = 2, U maximum repeat length = 100, m mismatch score = 6, r recursion depth = 7, s minimum le ngth score = 8, f number of bases flanking a repeat nucleotide repeat were removed from the list. From the remaining list, 10 loci from both the 90 th to 95 th percentile bin and the 96 th to 99 th percentile bin for autosomes II and IV were selected. For the X chromosome, 15 loci were selected per bin. PCR prim er information for all loci is presented in Table 1. Genotyping Genomic DNA was extracted from two replicate cult ures of each MA line, as well as the ancestral control stock, using the Qiagen 96 well DNeasy Blood and Tissue kit

PAGE 69

69 following the manufacturers protocol (Qiagen, USA). We employed a nested PCR strategy with fluorescently tagged primers via a modification o f the "three primer" method of (Schuelke 2000) Multiplexed PCR reactions of 15 l were performed in 96 well plates, using 1 ul of DNA template, 60 pmol of selective primer, 6 pmol of M13 tail primer, 60 pmol of labeled M13 primer, and 7.5 ul of Qiagen Type it Microsatellite PCR kit master mix (Qiagen, USA). Four to five loci were amplified together per multiplex reaction with ~ 50 bp o f spacing separating each locus. Reactions were initially run for 10 cycles of 40 seconds denaturing at 94C, 40 seconds annealing at 60C, and 40 seconds extension at 72C; the annealing temperature was then decreased to 48C and the reaction was continu ed for an additional 20 cycles. Two different fluorescent labels were used (FAM and NED), with only a single label used for a given multiplex. PCR products were analyzed using an Applied Biosystems 3730XL DNA analyzer (Interdisciplinary Center for Biotech nology Research, Univer sity of Florida, USA ). Fragment length was established relative to a known size standard ladder (GeneScan 600, Applied Biosystems USA ). All genotypes were manually inspected using the GeneMarker version 1.6 software (SoftGenetics USA ). We employed an iterative binning procedure to identify putative mutants. In the first iteration we calculated the mean fragment length for all replicates. Fragments that deviated by > 1.5 bases from the mean were removed from the dataset and the mean recalculated. Alleles that differed by > 1.5 bases from the re calculated mean were scored as putative mutants. Genotyping of Natural I solates Seventeen wild isolates of C. remanei were included in this study to estimate levels of standing genetic va riation for di nucleotide microsatellite repeats present in

PAGE 70

70 nature. Stocks of C. remanei strains JU1087, JU1086, JU1084, JU1082, JU724, MY37, MY32, MY31, MY28, PB4641, PB229, PB228, PB227, PB219, PB212, PB206, and SB146 were obtained from the Caenorahbdit is Genetics Center and collection information is available on their web site ( http://www.cbs.umn.edu/CGC/ ; University of Minnesota, USA). Upon receipt of these strains, genomic DNA was isolated and each strain wa s genotyped as described above for the MA lines. Data A nalysis Variation in Mutation Rates between S pecies Mutation rates were estimated by modeling the allelic state as a binomially distributed random variable X with two states, state 0 = wild type and st ate 1 = variant (length differences among variant alleles were not considered). The null hypothesis is that no difference among C. remanei and C. elegans in the binomial parameter p = Pr(X=1) exists. The per locus mutation rate can be approximated by p / t where t is the number of generations of MA. Loci were treated as a random effect and nested within chromosome which in turn is nested within species to account for the fact that loci were not chosen based on sequence homology and thus are not matched between the two species by evolutionary origin. A generalized linear mixed model was used to fit the model using the PROC GLIMMIX procedure in SAS version 9.2 with a logit link function. A residual pseudo likelihood F test method was used to test for sig nificance of fixed effects (Wolfinger and O'Connell 1993) with degrees of freedom calculated by the Kenward Rogers method. Differences between the two species was modeled as p = species + repeat_number + chromosome + error The code used to fit t he above model is presented in Table 2

PAGE 71

71 Mutational S pectrum Mutations were characterized as insertions or deletions (without respect to length), and the proportion of deletions q was calculated for each locus in each strain, where q = #deletions/total # of mutations. Allelic state (insertion or deletion) is modeled as a binomially distributed random variable, with the null hypothesis of no difference among groups in the binomial parameter q Variation in the indel spectrum between species was modeled simi larly as above, with the final model being q = species + repeat_number + all interaction terms, with locus treated as a random effect. Correlation of Per Locus Mutation Rate to Standing Genetic V ariation The relationship between the mutation rate at a give n locus and the standing genetic variation at the same locus was estimated for 56 loci in 17 wild isolates of C. remanei The locus specific effective number of alleles was calculated using the Microsatellite Analysis software package (Dieringer and Schlo tterer 2003) under both the stepwise mutation model (SMM) (Kimura and Ohta 1964) and infinite alleles model the per locus mutation rate and the SMM and IAM effective number of alleles at each locus using the PROC CORR procedure in SAS v.9.2. In addition, we controlled for the effect of different repeat lengths at each locus by accounting for the repeat number at g the PROC CORR procedure in SAS v.9.2. Results Variation between Species in Di nucleotide Mutation R ate Estimates of mutation rates between species are summarized in Table 3. There is a significant difference in overall di nucleotide microsatellite mutat ion rate between

PAGE 72

72 C.remanei and C. elegans fog 2 (P < 0.01), with C. remanei having an average mutation rate that is approximately seven fold higher than that of C. elegans fog 2 (8.0 x 10 5 /generation vs. 1.2 x 10 5 /generation). There is a significant p ositive association between repeat length and mutation rate in both species, with the effect being greater in C. elegans fog 2 Variation between Autosomes and X C hromosome While mutation rates did differ between species, there was no significant effect of chromosome type with mutation rates of both autosomes and the X chromosome not differing significantly (P = 0.18) (summarized in Table 3) Indel S pectrum The indel spectrum does not differ significantly between the two species (P = 0.37). For both C.rema nei and C. elegans fog 2 there was an excess of insertions. In addition, the data provide a good fit to the strict stepwise mutation model, with only two mutation s deviating from an increase or decrease of a single dinucleotide repeat unit (summarized in Table 4). Correlation to Standing Genetic V ariation The raw correlation between the per locus mutation rate and the effective number of alleles at that locus present r=0.43, P < 0.05 ). However, when rep eat number is taken into consideration the partial correlation between the mutation rate at a given locus and standing genetic variation is

PAGE 73

73 Discussion Comparison of Mutation Rate between S pecies The goal of this study was to contrast the mutational properties of di nucleotide microsatellite repeats in two closely related species of Caenorhabditis that differ in reproductive strategies in order to test if mutation rates differ between reproductive strategies as pr edicted by theory. Two previous studies have looked at the mutational properties of closely related species that differ in reproductive strategy, however these two studies have provided conflicting results. The first study to directly test the role of re productive strategy in closely related species was that of Schoen (2005). In this study, the author established two sets of MA lines from members of the plant genus Amsincka the outcrossing species A. douglasiana and the predominately selfing species A. gloriosa After 11 generations (~4 years) of MA, Schoen found no significant difference in the deleterious mutation rate ( U ) for several quantitative characters, suggesting that the rate of deleterious mutations did not differ between the selfing and outc rossing species of Amsincka in a detectable way. Contrary to this, Baer et al. (2010) established sets of MA lines from four outcrossing species of nematode worms in the genus Caenorhabditis After ~ 100 generations of MA, Baer et al. (2010) observed a r oughly four fold decline in fitness between the outcrossing species as compared to a historically selfing control. This result is consistent with the interpretation that the outcrossing species of Caenorhabditis have a greater deleterious mutation rate fo r fitness than their selfing relative. However, the possibility that a significant amount of residual heterozygosity may have existed in the progenitors of the outcrossing species MA lines makes it difficult to rule out the effects of inbreeding depressio n on the decline in fitness observed in these lines (Barriere et al. 2008). In addition, estimating

PAGE 74

74 mutational properties from quantitative traits in MA experiments is limited to those mutations of intermediate effect and mutations of small effect may rea dily escape detection (Halligan and Keightley 2009). Here we present molecular level data on mutational properties that are in good agreement to those previously obtained for the fitness. We have previously shown that differences between closely related s pecies in di nucleotide microsatellite mutation rates are consistent with the decline in fitness of the same MA lines (Phillips et al. 2009). In the current study, the average di nucleotide microsatellite mutation rate in the outcrossing species C. remane i was found to be approximately six times that of the historically selfing species C. elegans fog 2, a very similar pattern to the fitness data. Our estimates for C. elegans fog 2 mutation rates are consistent with those from a previous study of di nucleo tide microsatellite mutation rates in the N2 geneotype of C. elegans (1.2 x 10 5 / generation in the current study versus 1.98 x 10 5 /generation) (Phillips et al. 2009). Comparison of Mutation Rate among C hromosomes While a significant difference in overa ll di nucleotide microsatellite mutation rate was detected between the two species, no significant effect of chromosome type (autosome vs. X chromosome) was detected in either species. There are two plausible reasons for this observation, one experimental and one biological. First, assuming a difference truly exists between chromosome types, it is possible that the present study lacks the statistical power to detect any difference between chromosome types. Given the rarity of mutations at any particular locus, more loci on both types of chromosome are needed to confidently reject the possibility of differential mutation rates between chromosome types. Alternatively, it is possible that a modifier of the X chromosome

PAGE 75

75 mutation rate has not had sufficient t ime to operate in C. elegans given the 0.32 X 10 6 to 23.3 X 10 6 generation since the establishment of selfing in this species (Cutter 2006). Asexual, as well as predominately selfing taxa, tend to be short lived linages compared to related outcrossing tax a. This reduced longevity is thought to be a result of the increasing mutational load that, in turn, leads to an inevitable decline in fitness and the eventual exti nction of the lineage (Lynch and Gabriel 1983 ). Therefore it is possible that there has not been sufficient time for C. elegans populations to reach the necessary equilibrium required for the effects of a modifier of X chromosome mutation rates to become detectable Comparison of Indel Spectrum between S pecies In general, studies of the mutational properties of microsatellite repeats commonly observe a bias towards mutations that lead to the expansion of the number of repeats through insertions (Ellegren 2004). Two previous studies of the mutational properties of di nucleotide microsatellites in C. elegans have shown a significant bias towards insertions (Seyfert et al 2008; Phillips et al. 2009). The results of this study support the conclusion that C. elegans doe s indeed have an insertion bias at di nucleotide microsatellite loci. Similarly, C. remanei had a greater number of insertions compared to deletions. The insertion bias observed for both species in this study is contradictory to the deletion bias shown i n substitution patterns within mariner transposons between C. elegans and C. briggsae (Witherspoon and Robertson 2003). In addition, Philips et al. (2009) observed a strong deletion bias in di nucleotide microsatellite loci in C. briggsae the sister spec ies to C. remanei The discrepancy between patterns of indel bias accumulated over long evolutionary time spans, such as substitutions in

PAGE 76

76 pseudogenes, and more recent patterns observed in MA experiments, raises an interesting possibility that indel bias h as recently changed in C. elegans and C. remanei There may be two possible explanations for such a shift. First, it is possible that the selection pressure has shifted in such a way to no longer favor deletions, but instead to favor insertion. Denver e t al. (2004) suggested that such a shift in selection might explain the insertion bias that was observed in random nuclear loci they sequenced in a set of C. elegans MA lines. Alternatively, one of the central models of genome size evolution states that a mutational equilibrium will exist when the amount of DNA loss by frequent small deletions equals the input of DNA sequence by more, rare, large scale insertions (Petrov 2002). It is possible that both C. elegans and C. remanei are not, at present, in an equilibrium state between the rate of insertions and deletions. Correlation with Standing Genetic V ariation The interpretation of the relationship between mutation rates and standing genetic variation is difficult. The raw correlation between the per locu s mutation rate and the effective number of alleles at that locus among the 17 wild isolates was significant. This pattern is consistent with the previously observed co rrelation between the per locus mutation rate and standing genetic variation in C. eleg ans and C. briggsae (Phillips et al. 2009). However, when repeat number is taken into consideration no significant relationship remains. One possible explanation is the uncertainty of the exact repeat length for each locus in the PB2282 genotype used in this study. All loci were designed from a different geneotype of C. remanei (strain EM 4641 ) Alternatively, it is possible that we simply lack the statistical power to detect a moderate positive partial correlation of the magnitude of the point estimate from this study (and from that in C. briggsae Phillips et al. 2009). We are currently sequenc ing several complete genomes of the

PAGE 77

77 PB2282 genotype used in this study using Illumina technology. From this data we will be better able to get an exact repeat s ize for each locus. Until then, there is reason to believe based on the similarity of the C. remanei data to that of C elegans and C. briggsae that a positive relationship between the per locus mutation rate and level s of standing genetic variation do es exist. Conclusions The current study provides empirical support for the theoretical prediction that natural selection plays a greater role in shaping the rate of spontaneous mutations across the genomes of selfing than in outcrossing species. In additi on, these results are consistent with our previously observed patterns of the mutational properties at the phenotypic level in the same set of MA lines. This provides further evidence for a close relationship between the rates of spontaneous mutations est imated at both the phenotypic and molecular levels in Caenorhabditis Conversely, it appears that natural selection has not led to a reduced spontaneous mutation rate between autosomes and the X chromosome in either of the two Caenorhabditis species inclu ded in this study, although the statistical power of this study may simply be insufficient to detect a difference. While mutation rates did differ between species, the indel spectrum did not, with both species showing an excess of insertion mutations. Ho wever, the current study utilized a relatively small number of loci, and future studies using higher throughput, whole genome DNA sequencing methods will be needed to definitively determine if mutation rates differ by chromosome type in Caenorhabditis

PAGE 78

78 T able 4 1 PCR primers used to amplify all loci in Caenorhabditis elegans and C. remanei Chr = chromosome number in C. elegans and reference contig number with assigned chromosome number in parentheses for C. remanei Start = the genome coordinates of th e beginning of the microsatellite repeat. Repeat number is the number of di nucleotide repeats, i.e. repeat number of 8 = 16bp. PCR product sizes are indicated in the last column. Sp ecies L ocus Chr. Start Repeat number Forward primer Reverse primer PCR p roduct C el Cel_1 II 7227732 8 CCGAATAAAAGGGAACGGAG CAATGACGTGGCAAAAGAGA 324 Cel_2 II 12961355 8 CCACCCCAAAATGACCATAG ATTGTCACATTTCGCTGCTG 169 Cel_3 II 7850841 9 GGTAACATCAAATGTCCGGG TTGAGCAAGTGTGGCTGTTC 396 Cel_4 II 3838988 9 CAGAAAAATAGGCGGACCAA AA CTCCTCTACTGCGCCTCA 351 Cel_5 II 3952501 8 CAGACACTCACAGCGTTGGT CTCCGGTTCCGAATTATCAA 329 Cel_6 II 4391268 9 TTTCATCAGAGCACGATTGC ATGCGATGTTTGGTTCATCA 397 Cel_7 II 10366804 9 TCCCATGTTTCTTGTGGTCA TTGGTTGACCAATTTTTAGGTG 208 Cel_8 II 10743591 10 GTGCCA AACCACAACATGAA GCCCACTTACTCTCGTCTCG 247 Cel_9 II 10612895 10 TCCCCTTCTCCCTCTTCATT GGATGGGAGGAGCACAAATA 257 Cel_10 II 11890727 10 TTCCCGCAATACCAAATCTC GGGCCACCTCAACTAAACAA 230 Cel_11 II 1989829 11 TTGAAAAGCCGATTGGAAAC TTCAGTGCACGGAGAGTCTG 353 Cel_12 II 15194037 11 AGAGCAGCACACACAAATCG CTCGTAATCCTCTCTCCCCC 270 Cel_13 II 10549040 12 TCTTCCACACGCTCACAGAC CCCCATCTTCTCCATTTCAA 363 Cel_14 II 14765429 13 ATAGTTAGGCCTGACGGAGC TTAATGTTCCCGCGAAAAAG 230 Cel_15 II 10547953 15 GTGCATCGGTGGGAGACTAT TCCTTTGTT ATGGCACCCTC 200 Cel_16 II 9497222 9 CCATCTAGGTACGCAATTCCA GATGAGTTGGAGCCCTTCAG 177 Cel_17 II 11391680 2 GGAATTGAGGAAGCGAACAG CCGCTTCAACATTCACATTG 392 Cel_18 II 12052795 22 TGGCCCTTCAACTGAACTTT ATCTGGTGAGAACCTGGTGG 338 Cel_19 II 15264823 24 CCGCGCAA ATATTGACTTTT TTTCCCGTTGAGATACAGGC 321 Cel_20 II 5322006 25 AAATCCACAGTGCTTTTGGG CTCCCTTTCTCTGTACCCCC 285 Cel_21 IV 12947009 9 AACAGCGCTGAGCTATTTCG CTCACGATTTCGTGGGTCTT 239 Cel_22 IV 6676681 8 CCCAGACTTCCCAACTCAAA CTGGCCCGTTAGACCAATAA 109 Cel_23 IV 5172466 9 TCTCCGATTGTGAGCATCTG TGGGCGAAAACTATTGAACTTT 374

PAGE 79

79 Table 4 1 Continued Sp ecies L ocus Chr. Start Repeat number Forward primer Reverse primer PCR product Cel_24 IV 12754725 8 AAGGGGATGGGAGAGAAGAA ACGAGGAAATGCGTATGGAC 218 Cel_25 IV 7983643 8 CGCAG CCGTTTTAATTTTGT GGTTTCGGAGAGTTTGACCA 185 Cel_26 IV 7390527 9 GGACCCAGACTGGCATAAAA CGGGAAATGAAGGAACTTGA 154 Cel_27 IV 4490492 9 TAAAACCGGAAGACCACTGC AGAGACGTCGCTTCTTCTGC 198 Cel_28 IV 13469567 9 GCTATATGAAACTTGGCGGG CCCTTCCGTCCAATACCTTT 370 Cel_29 I V 1523670 10 TTTCAGCCAGCTGGAATTTT CACTTGGCAAAGAGATGGGT 178 Cel_30 IV 2753761 10 ATTTTCCCGGAGGAGTTACG GTATCACGGCGAGAGGAGAG 128 Cel_31 IV 2080792 11 ACGTGGACGGAAATTGTGTT TTTTAAAGTTCCGGCAAACC 381 Cel_32 IV 11364280 12 TTCGTTTGACTGTCTGCGTC CGGAAGCTTTTTGT GTCTCC 193 Cel_33 IV 1616951 13 TATCAACCGCCCGTCTTATC AGCCAACCGGTGAGTATTTG 343 Cel_34 IV 3742521 14 TTCCCTATGCTGCCTCTCAT AGAGACCGACGACGAGATGT 316 Cel_35 IV 14547429 16 AGTTCCCGTGAAGCTTGAAA AACCAATCAGCGCCTTCTAA 335 Cel_36 IV 11899513 16 CTTTTATTCCGCC TCCAGTG ATTACACAGGAAACAGGCGG 364 Cel_37 IV 5561641 19 CTTTTCAACGACCTCGACAG TATTTCCCTCAATTCGTCGG 180 Cel_38 IV 7279971 25 GCGAAACGGAAATGTTGAAT ATGGACAAACGGAATAAGCG 346 Cel_39 IV 67795 26 TGCACTCCAGTTTCTTGTGC TCCGAAATCCTGGAGATTCA 309 Cel_40 IV 445451 5 30 TGCTTCTTCTCCTTCACCGT TTTGCATTCTTCCGCTCTCT 186 Cel_41 X 11249733 8 ATCACGCGGAACACATTACA ACTTGCAATTTCGCTTTCGT 321 Cel_42 X 2920621 8 TTGTGTCAGCTCCAATCTGC TTTGTGCAGCCATCATAAGG 222 Cel_43 X 12670382 9 GGGCTTCTATGGCAACACAT TCTCAACTGTCACTCGCACC 356 Cel_44 X 13940928 8 GCTTCTCCGAATATGCCAAA TTTGGTTCGATACCAGTAGCA 285 Cel_45 X 14561516 8 ATGCACGTCAGTTCCCTTCT CGGAGAAATGGGATCGAGT 309 Cel_46 X 2641220 8 AAAAGAAGGCTGCTCCACAA TCATAAGCCTTGTCACATCCA 220 Cel_47 X 3355405 8 CGTACGACACTTTTCGGGTT AAATTTGTCGGG GGAAGAGT 281 Cel_48 X 4506943 10 CCGAGGTGTGGAAATAACTTG TCAAAATCGGGCATTCTAGG 309 Cel_49 X 12080930 10 GAAGGCGTCTTTCTGTCTGC GTACCGCCGAAAGGTAATGA 340

PAGE 80

80 Table 4 1 Continued Sp ecies L ocus Chr. Start Repeat number Forward primer Reverse primer PCR product C el_50 X 15340980 9 GATCGTCTAACCTTTTGCCG AATTGTTTGGGGGAGGAAAC 273 Cel_51 X 5733980 9 AATGAGCCTGGGAATGTCTG CCCTACCTCACCTAAAGCCC 177 Cel_52 X 1199052 10 ATCATGGGCACTAAAGCTGG TCCCACCTCTGCTCTCATCT 241 Cel_53 X 10808511 9 TCCTCCAGTTCCTGGTGTTC GCGGTCAAATAAA CTGGCAT 284 Cel_54 X 17514630 10 CCAGGTGGAAATAGGGGTTT TCGATTCCGGATGCTTATTC 288 Cel_55 X 12013797 10 GCTTTCTACCGCCAATATGC AAAAATGGGCGGAGCTTAAC 279 Cel_56 X 13264748 10 CCTCCGCTCTACCAACTGAG GGCACTTTTCACGCTTCTTC 160 Cel_57 X 3867976 11 GGACAAGAGTGGCGA TGAAT CCTTCTTCTACATGGGGCAA 310 Cel_58 X 940771 12 AAGGTGAAACGAGGTTGTGG GGAAATGGCGAAATTGAAAA 370 Cel_59 X 10629304 12 GTAGGTTAGTCGTGGTCCGC TCCCATTTGGTCTCTCCATC 162 Cel_60 X 16684711 13 GGTGCAAGGAATTTGACGTT TCGAATTACGGGACAGAACC 335 Cel_61 X 7379218 1 3 TTTCCAATAAATCCCACCCA CCACTATTTCGGGCTTCAAA 246 Cel_62 X 1520216 14 CCCAGCAAACCCACTAGGTA CCCTCCGAACACACTTGAAT 157 Cel_63 X 16339303 16 CCAGTCACGTGGAAACGTC AAATGTCTCTCGGCTCTCCA 209 Cel_64 X 984580 19 TTCCGTGGCTTTGAAAACTT TACAGCTGCGGATTCTGATG 241 Cel _65 X 7527688 20 TTTGGAAAAATGGGTATCGC TCGAGCCAATAAAACCCATC 181 Cel_66 X 1224249 21 GAAAGAGCGACATACGGAGC ATTTACCGCACACCCATGAT 342 Cel_67 X 4319206 24 CTCCGAGAGCACCGTAGTTC CACTACACGAGGAAGTGCGA 287 Cel_68 X 9225274 26 TGTGGACCATCAAACCTCAA TACCGGTGGGGTAT GGTAGA 323 Cel_69 X 11913941 28 CACGGTTTTTGTTCCGTTCT CCTCAATTCCTGCGTTGAAT 326 Cel_70 X 4982083 28 TCATCCACCATTCTTACGCA ACGACCAGAACGAAATACGG 221 C rem Crem_1 Contig1(II) 1505667 8 ACATTGGCAGATCTTCCGTC TCATACCTGTGGATTGCGAA 398 Crem_2 Contig6(II) 148970 8 AGTTCCCATGAGATGCCAAA TCACTCCTCCTCGTTTCACC 224 Crem_3 Contig6(II) 1652084 8 GCGACTTTTGGAGAATGAGC TGACTCCATCACATCCCAGA 198 Crem_4 Contig1(II) 470444 8 TGAGAGGAGATGGAGAGGGA GGCTTTATTCTGCTTGCCTG 350 Crem_5 Contig17(II) 361211 8 AATTGGCTTCCATTTTCGTG CA GCACCAACAACTTCCAGA 333

PAGE 81

81 Table 4 1 Continued Sp ecies L ocus Chr. Start Repeat number Forward primer Reverse primer PCR product Crem_6 Contig17(II) 63610 9 TTGGGTGGGTTCTCCTACTG ATATGGTTCGAACGGCAAAG 200 Crem_7 Contig101(II) 82047 10 GACCGACGGTAAGTGATGCT CC CCGTAAATCTACCCCAGT 215 Crem_8 Contig1(II) 1356960 10 TCTCCGGTCTATTGCACACA CCATCATTCCAACCAGTTCC 193 Crem_9 Contig242(II) 86558 10 GCCCCCATCCATATATAGCC CATCACGATGTCTGCGTCTC 291 Crem_10 Contig176(II) 119754 11 GTGGCAGCAGTGACAGAAAA TCTCTCGCTCAAGGGATTGT 1 82 Crem_11 Contig95(II) 223194 11 AGGCTCAGCAAAAACCAAGA TTTCCAAAGAAGGGCAAGTG 190 Crem_12 Contig1(II) 2064941 11 GAAGAGCGGATAAAAGCGTG CGCTTGGATATGCGAAATCT 211 Crem_13 Contig1(II) 1017753 12 GTCAGAGAAAAGTGGGACGC AGAGAGCATGAGACCGGAAA 299 Crem_14 Contig 1(II) 1955413 12 CTTTCTCCGGATTCATTCCA TGAGGATCATTTTCGAACCC 196 Crem_15 Contig23(II) 959355 18 TTAGACACCCCCGTCACTTC GGAGGGAGTGAACGGTACAA 160 Crem_16 Contig423(II) 6744 18 GCCAACCTGGTAACCGTCTA CGCCCTTCTCAATTTCTCAG 268 Crem_17 Contig1(II) 179644 21 ATTT GCCAAAACCGAAACTG TTTCAGAACACCTCCGGAAC 346 Crem_18 Contig39(II) 731944 11 CGGAGAAGGAGTGTGTTGGT TAATGTTCGATGGCTCCTCC 247 Crem_19 Contig14(II) 515033 15 TCCGGTAGGTCTTCATGGAC GACTCACTCCGCCTCAACAT 273 Crem_20 Contig57(II) 137400 33 AAGTTCCAAACGAATCGTCG AT TGATTTTATAGGCCGGGG 330 Crem_21 Contig18(IV) 1255264 8 CGCCTTTTCATAATCGCAA TTTGGGACGTTCGAGTTTTC 349 Crem_22 Contig817(IV) 4150 8 GCGAATGAAGTGTGTGATGG AACTGATCGCATCTGGTTCC 355 Crem_23 Contig1538(IV) 4365 8 TGGTTGGTGGATGAACTGAA GAGGTGGATGGATATGGTCG 292 Crem_24 Contig88(IV) 82980 9 AAATTGGCGTAGAATGTCGC TTTCGTAGAACGTCACAGCG 218 Crem_25 C ontig18(IV) 364230 9 GGAGGGAGACTCAAAAAGGG TACCAACCAAATCCCCTTGA 372 Crem_26 Co ntig62(IV) 238124 10 CCAACTACCTGTGGCCATCT GAAGACACTTGCTTTTCGGC 179 Crem_27 Contig96(IV) 209462 10 AGCAAACTTTCGGAGCAAAA TCTGTGGGGAGAGAAAAGGA 307 Crem_28 Contig652(IV) 18340 10 GGTAATTGAATCGACACGGG TCGAATACCGCAAGCTTTTT 248 Crem_29 Contig18(IV) 161029 10 TGCTTTTGAGCACATTTTCTG CGGTTCGAACTCGAAATCAT 326 Crem_30 Contig18(IV) 405201 11 ACGTGTC GTGTGCTCTTTTT TCGATGCAACTGAACCTGTC 348 Crem_31 Contig126(IV) 36257 10 TGTAGGCGTGATGGTGAGAG AGGGAGAAACCTCGGTCAAT 205

PAGE 82

82 Table 4 1 Continued Sp ecies L ocus Chr. Start Repeat number Forward primer Reverse primer PCR product Crem_32 Contig19(IV) 130079 11 GGC TCTCTGTACACTTCCCG AGGCAAACGAAGGGAAAGAT 239 Crem_33 Contig383(IV) 33924 11 GGTAAGCAGCTCCGAAAGTG AAAATAGTGAGCCCCGTCCT 365 Crem_34 Contig1203(IV) 9684 11 TCTTCAATTCAATTTCCGGTG TTCAAGGAATTCCGTTTTCG 186 Crem_35 Contig275(IV) 10682 13 AAATAAATAGTGCGCGTGGG TCAGCACATTTTCCCACAAA 212 Crem_36 Contig1062(IV) 2230 13 ATCCAATTCAATCCTCACCG GGGACGTCTTCAGACGAGAG 128 Crem_37 Contig127(IV) 202882 21 AATGGACACCTCAATTCCCA GTCTAACAGTCTGCGCTCCC 267 Crem_38 Contig88(IV) 204840 23 GGAAACGGCGACATAAGGTA CTGTCGTCGTCGTTGTCA GT 209 Crem_39 Contig1397(IV) 7906 30 TTCCGTTATCGCATCCTTTC TTTGCACTCCGAATTGACCT 339 Crem_40 Contig18(IV) 825684 31 CCCCTCCTGTCTTCATTCAA ATGCATGGAGGCATTTTCTC 237 Crem_41 Contig408(IV) 2373 43 TGTTTTTAGTTGGTTCCGCC GTCAATTGAGAAACGCGTCA 313 Crem_42 Con tig0(X) 2394041 8 CTAACAAATTTGGCGTGCCT GCTTCTCCACCCATTTTCAA 396 Crem_43 Contig0(X) 4331840 8 CCGGTTGTCACTTCCAATCT ATATGGCTGCCCTTTACACG 236 Crem_44 Contig0(X) 354475 9 TAATTGACGAGCACTTTGCG TTCTTCCTTTGCCATCATCC 386 Crem_45 Contig110(X) 5708 9 CATGGCCAA ACATAGCATTG GCTTTGAGACCATTTCGAGC 240 Crem_46 Contig171(X) 67196 8 AATGGCTGTGATCCTGAACC ATAGGACAGGACCGACGATG 376 Crem_47 Contig50(X) 43231 8 TTCGCGAGAGAGGAAGAGAG CCGGGAAAAAGTGGTAGTGA 253 Crem_48 Contig63(X) 33361 8 TGTTGGTTTTCCCACATTAGG TCCGCGAAAAGTTC TTTGAT 378 Crem_49 Contig0(X) 2245153 9 CGTTGGTTACGCATCATTTG GGCCCTCTTTCATTTTCTCC 270 Crem_50 Contig27(X) 729555 9 TCGGAAAACTCTCGAAAACG GGTGGAGGGTATAGGGGAAA 149 Crem_51 Contig27(X) 362881 8 CTGCCTGGAAAATTGAGGAA ATTTCGGCCACTCACAAAAC 286 Crem_52 Cont ig0(X) 3582349 9 GGGTATGCGAACTTCACTTCA TTCAAGAAAATGAGCCACCC 305 Crem_53 Contig0(X) 2286485 8 TCACAAATGTGGCGTTTGAT ATCCTTCGTCGTTTCACGAT 254 Crem_54 Contig24(X) 446000 8 TTTCTATGTGCCCCGTTAGG GAGAAAACGCACAAAGAGCC 290 Crem_55 Contig27(X) 602465 9 AAATGAA TCCCGGGGAATAG TATGAGCAAAACGTAGGGGG 308 Crem_56 Contig50(X) 31793 9 GGAAAACCACTGACCCGATA GCCGTGATACGGAACAGATT 262 Crem_57 Contig15(X) 952829 10 ATTACGCCCGTAAAACTCCC CGTCGTAAACTTCGTGAGCA 400

PAGE 83

83 Table 4 1Continued Sp ecies L ocus Chr. Start Repeat number Forw ard primer Reverse primer PCR product Crem_58 Contig31(X) 88169 10 AGCCGTTCCTGAGCAACTAA CGGCAGTCTTTTTCCAAATC 380 Crem_59 Contig31(X) 466824 9 GAACCTGTCATGTGCCAGAA CAGCGGACACTCAGAAAACA 362 Crem_60 Contig93(X) 87084 10 TGCACTTCCTTATGGATGGA ATTCCCACACCT TTTCTCCC 160 Crem_61 Contig93(X) 317705 10 GTGTGCTCCGCAGACAGTAA AAAGAAACGAAATGCGATGG 271 Crem_62 Contig110(X) 6088 11 CATTCCGCGAAATTTCTGAT GCGATTTTTCTGCATTTTCC 324 Crem_63 Contig31(X) 217239 11 TTTTTCTCCACACCACCCTC ATCGCGCTCTTCACATTTTT 178 Crem_64 Contig0(X) 3553370 11 CTCACGGATCCCTTTGTGTT GCCCATTGTGTTTTTCGAGT 345 Crem_65 Contig63(X) 106732 10 ACACATTCGCATCACCAGAA CTTTACACTTTTCGCGCTCC 377 Crem_66 Contig208(X) 113813 11 TGAGAAACGCATTACGTGGA TCTCCGCTGCAATAACACAC 318 Crem_67 Contig31(X) 592786 11 GGGACTGACTTGCTTTCGTC GTTTCCGCGTTAGCAGAGAG 206 Crem_68 Contig0(X) 2916438 12 GACGTGTGCCTCTCTTTTCC GCGCTACACGTCCTTCTTTC 298 Crem_69 Contig31(X) 470920 11 GTGGTGTCTTCTCTCTCGGC CGAAACGAATAGGAATCGGA 168 Crem_70 Contig0(X) 3864041 14 TTTATCCCAAAACACCGCAT CTATTGCCACAAAAACCCGT 301 Crem_71 Contig24(X) 445852 18 CCCATCCCACTCCACATATC CCTAACGGGGCACATAGAAA 304 Crem_72 Contig145(X) 228387 34 TTTTTGCCACATAGCCACCT CCTGCTGGTGACCAAGGTAT 268

PAGE 84

84 Table 4 2 SAS code used to fit the generalized lin ear model to test for variation in mutation rates between C. remanei and C. elegans fog 2 Bold terms are SAS code key words and lowercase words are the parameters specified for this model. Variables are, species, the number of repeats at a locus, chromosome number, and locu s. PROC GLIMMIX data=Outcross_msats pconv=0.001; NLOPTIONS maxiter=40; CLASS species locus chromosome; MODEL p/N = species|repeat_number|chromosome / SOLUTION dist=binomial LINK=logit ddfm=kenwardroger; RANDOM _resid_ / subject=locus group=chromosome(speci es); LSMEANS species|chromosome /ilink; RUN;

PAGE 85

85 Table 4 3 Summary of the per generation mutation rate for all loci in Caenorhabditis elegans and C. remanei OBS is the average mutation rate estimated from the raw LS is the mutation rate estimated by the least squares means method. MA lines of C. elegans fog 2 were genotyped at 200 generation of MA, while the C. remanei MA lines were genotyped at 1 22 generations of MA Chromosome C. elegans C. remanei II N loci 15 16 Ave. N lines 64 46 Ave. repeat # 12.85 12.1 OBS (SEM) 0.52E 05 (0.52E 05 ) 3.32E 05 (2.41E 05) LS (SEM) 0.42E 05 (0.44E 05 ) 3.50E 05 (3.30E 05) IV N loci 18 14 A ve. N lines 64 46 Ave. repeat # 13.05 14.33 OBS (SEM) 3.98E 05 (2.77E 05) 6.34E 05 (2.36E 05) LS (SEM) 2.50E 05 (1.80E 05) 1 5 7E 0 5 (6.50E 05) X N loci 27 25 Ave. N lines 64 46 Ave. repeat # 12.93 10.1 OBS (SEM) 1.72E 05 (0.76E 05 ) 2.89E 05 (1.36E 05) LS (SEM) 1.80E 05 (1.00E 05) 9.40E 05 (6.50E 05)

PAGE 86

86 Table 4 4 Summary of the indel spectrum. For each repeat type, row headings are: N loci, the number of loci genotyp ed for a given repeat type; the mean number of lines g enotype d ; Deletion (Insertion) > 1 is the number of mutant alleles > 1 repeat unit (2 bp) shorter (longer) than the ancestral allele; Deletion (Insertion) = 1 is the number of mutant alleles 1 repeat unit (2 bp) shorter (longer) than the ancestral allele. Insert ion bias is the proportion of mutations that are insertions. Chromosome C. elegans C. remanei II N loci 15 16 Ave. N lines 64 46 Deletion > 2bp 0 1 Deletion = 2bp 0 0 Insertion > 2bp 0 0 Insertion = 2bp 1 2 Insertion bias 1.00 0.67 IV N loci 18 14 Ave. N lines 64 46 Deletion > 2bp 0 0 Deletion = 2bp 2 0 Insertion > 2bp 1 1 Insertion = 2bp 6 2 Insertion bias 0.78 1.00 X N loci 27 25 Ave. N lines 64 46 Deletion > 2bp 0 1 Deletion = 2bp 2 0 Insertion > 2bp 0 0 Insertion = 2bp 3 3 Insertion bias 0.60 0.75

PAGE 87

87 Figure 4 1. Boxplots of di nucleotide microsatellite distributions for five species of Caenorhabditis Among all five species, AG reapeats are the most abundant. The width of the boxes corresponds to the variance i n repeat number within a given group. Extreme values have been removed for clarity.

PAGE 88

88 CHAPTER 5 SUMMARY Do differences in the mutational properties of different taxa influence the levels of standing genetic variation observed in nature? The overall result s of the three studies described here suggest they do. First, when examining how differences in mutational properties influence levels of standing genetic variation and averaged over traits, species, and populations within species, the relationship betwee n V G and V M is quite stable and consistent with the hypothesis that differences among groups in standing variance can be explained by differences in mutational input. With one exception, the variance present in a worldwide sample of these species is simil ar to the variance present within a sample from a single locale. These results are consistent with species wide MSB and uniform purifying selection, but genetic draft (hitchhiking) is a plausible alternative possibility. The results of this study illustr ated that differences in the mutational properties are indeed reflected in levels of standing genetic variation at the phenotypic level. Additionally, the observed levels of standing genetic variation were consistent with the hypothesis of mutation select ion balance acting to maintain variation in fitness and body size in both species. Similar to the phenotypic data, the di nucleotide microsatellite mutation rate of C. briggsae was indeed approximately two times that of C. elegans Furthermore, the mutati on rate and spectrum differed significantly between the two species, with the repeat motif AG having the highest mutation rate. Additionally, the indel bias was significant between the two species with C. elegans showing a significant insertion bias. Int egrated over the whole genome the mutation rate of C. briggsae is about twice that of C. elegans consistent with the cumulative mutational effects on fitness observed

PAGE 89

89 previously. The per locus mutation rate is significantly positively correlated with the standing genetic variation at the same locus in both species, providing justification for the common practice of using the standing genetic variance as a surrogate for the mutation rate. Finally, the third study provides support that natural selection has shaped the rate of spontaneous mutations to different degrees in species that differ in their reproductive strategies. The findings of this study agree with the previously observed phenotypic patterns assayed in the same set of MA lines. While the resul ts of this study are consistent with what is predicted by theory at the species level, no support for natural selection shaping the rate of spontaneous mutations at the chromosomal level was found. With the rapid advances in DNA sequencing technology that are occurring at an ever increasing rate, the ability to more accurately quantify the mutational process is just around the corner. In the near future, the use of highly parallel DNA sequencing methods will allow for the interrogation of the mutati onal process at the scale of the whole genome. In addition, it soon will be possible to extend the genomic techniques now reserved for model organism to a greater diversity of organisms, thus allowing for a more complete picture of the degree of variation in mutational properties across the tree of life. Armed with these data, a clearer picture of the processes that underlie the origin and maintenance of genetic variation will begin to emerge and, undoubtedly, the role of different mutation pr ocesses amon g taxa will be found to play a major role.

PAGE 90

90 LIST OF REFERENCES Amos, W, Flint J, Xu X. 2008. Heterozygosity increases microsatellite mutation rate, linking it to demographic history. BMC Genet. 9:72. Amos, W, Sawcer S, Feakes R, Rub insztein D. 1996. Microsatellites show mutational bias and heterozygote instability. Nat Genet. 13:390 391. Arndt, PF, Hwa T, Petrov DA. 2005. Substantial regional variation in substitution rates in the human genome: importance of GC content, gene density and tel omere specific effects. J of Mol Evol. 60:748 763. Azevedo, R, Keighdey P, Lauren Maatta C, Vassilieva L, Lynch M, Leroi A. 2002. Spontaneous mutational variation for body size in Caenorhabditis elegans Genetics. 162:755 765. Baer, CF, Joyner M atos J, Ostrow D, Grigaltchik V, Salomon MP, Upadhyay A. 2010. Rapid decline in fitness of mutation accumulation lines of gonochoristic (outcrossing) Caen orhabditis nematodes. Evolution. 64:3242 3253. Baer, CF. 2008. Does mutation rate depend on itself. P LoS Biology. 6: 52. Baer, C, Miyamoto M, Denver D. 2007. Mutation rate variation in multicellular eukaryotes: causes and consequences. Nat. Rev Genet. 8:619 631. Baer, C, Phillips N, Ostrow D, Avalos A, Blanton D, Boggs A, Kell er T, Levy L, Mezerhane E. 2 006 Cumulative effects of spontaneous mutations for fitness in Caenorhabditis: role of genotype, e nvironment and stress. Genetics. 174:1387 1395. Baer, C, Shaw F, Steding C, et al. 2005. Comparative evolutionary genetics of spontaneous mutations affectin g fitness in rhabditid nema todes. Proc Nat Acad Sci U S A. 102:5785 5790. Barriere, A, Yang S P, Pekarek E, Thomas CG, Haag ES, Ruvinsky I. 2008. Detecting heterozygosity in shotgun genome assemblies: Lessons from obligately outcros sing nematodes. Genome Res. 19:470 480. Barton, N. 1990. Pleiotropic models of quantitative var iation. Genetics. 124:773 782. Bgin, M, Schoen DJ. 2006. Low impact of germline transposition on the rate of mildly deleterious mutation in C aenorhabditis elegans. Genetics. 174:212 9 2136. Byers, D, Waller D. 1999. Do plant populations purge their genetic load? Effects of population size and mating history on inbreed ing depression. Annu Rev Ecol Syst. 30:479 513.

PAGE 91

91 Crow, J. 1958. Some possibilities for measuring s electi on intensities in man. Am. Anthro. 60:1 13. Crow, J. 1993. Mutation, mean fitness, and genetic load. Oxford Surveys in Evolutionary Biology 9:3 42. Cutter, A D 2006. Nucleotide polymorphism and linkage disequilibrium in wild populations of the partial selfer C aenorhab ditis elegans Genetics. 172:171 184. Cutter, AD, Flix M A, Barrire A, Charlesworth D. 2006. Patterns of nucleotide polymorphism distinguish temperate and tropical wild isolates of Caenorhabditis briggsae Genetics. 173:2021 2031. Cutter, AD. 2008. Div ergence times in Caenorhabditis and Drosophila inferred from direct estimates of the n eutral mutation rate. Mol Biol Evol. 25:778 786. Cutter, AD, Wasmuth, JD, Washington, NL. 2008. Patterns of molecular evolution in Ceanorhabditis preclude ancient origin s of selfing. Genetics. 178:2093 2104. Davies, EK, Peters AD, Keightley PD. 1999. High frequency of cryptic deleterious mutations in Caenorhabditis elegans Science. 285:1748 1751. Denver, DR, Morris K, Thomas WK. 2003. Phylogenetics in Caenorhabditis el egans : an analysis of divergence and outcrossing. Mol Biol Evol. 20:393 400. Dieringer, D, Schlotterer C. 2003. MICROSATELLITE ANALYSER (MSA): a platform independent analysis tool for large microsatelli te data sets. Mol Ecol Notes 3:167 169. Dolgin, ES, Charlesworth B, Baird SE, Cutter AD. 2007. Inbreeding and outbreeding depression in Caen orhabditis nematodes. Evolution. 61:1339 1352. Dolgin, ES, Felix M A, Cutter AD. 2008. Hakuna Nematoda: genetic and phenotypic diversity in African isolates of Caenor habditis elegans and C briggsae Heredity. 100:304 315. Drake, J, Charlesworth B, Charlesworth D, Crow J. 1998. Rates of spontaneous mutation. Genetics. 148:1667 1686. Eisen, JA, Hanawalt PC. 1999. A phylogenomic study of DNA repair genes, proteins, a nd processes. Mut Res. 435:171 213. Ellegren, H. 2004. Microsatellites: simple sequences with complex evo lution. Nat Rev Genet. 5:435 445.

PAGE 92

92 Gillespie, J. 2000. Genetic drift in an infinite population: The ps eudohitchhiking model. Genetics. 155:909 919. Halli gan, DL, Keightley, PD. 2009. Spontaneous mutation accumulation studies in evolutionary genetics. 40:151 172. Hardison, RC, Roskin KM, Yang S, et al. 2003. Covariation in frequencies of substitution, deletion, transposition, and recombination during euthe rian evolution. Genome Res. 13:13 26. Hill, WG, Robertson A. 2009. The effect of linkage on limits to artificial selection. Genet Res. 8:269 294. Hodgkin, J, Doniach T. 1997. Natural variation and copulatory plug formation in Caenorhabditis elegans Gene tics. 146:149 164. Houle, D. 1989. Allozyme associated h eterosis in Drosophila Melanogaster Genetics. 123:789 801. Houle, D. 1992. Comparing evolvability and variability o f quantitative traits. Genetics. 130:195 204. Houle, D, Morikawa B, Lynch M. 1996 Comparing mut ational variabilities. Genetics. 143:1467 1483. Howe, DK, Denver DR. 2008. Muller's Ratchet and compensatory mutation in Caenorhabditis briggsae mitochondrial gen ome evolution. BMC Evol Biol. 8:62. Jack son, A. 2000. Microsatellite instabil ity induced by hydrogen peroxide in Escherichia coli. Mut Res Mol Mech Mut. 447:187 198. Keightley, P, Eyre Walker A. 1999. Terumi Mukai and the riddle of delet erious mutation rates. Genetics. 153:515 523. Keightley, P, Hill W. 1988. Quantitative genetic variability maintained by mutation stabilizing selection salance in finite populations. Genet Res. 52:33 43. Kelkar, YD, Tyekucheva S, Chiaromonte F, Makova KD. 2008. The genome wide determinants of human and chimpanzee microsatel lite evolution. Genome R es. 18:30 38. Kimura, M. 1962. On the probability of fixation of mutant genes in a population. Genetics. 47:713 719. Kimura, M. 1964. The number of alleles that can be maintained in a finite population. Genetics. 49:725 738.

PAGE 93

93 Kimura, M, Ota T. 1975. Dist ribution of allelic frequencies in a finite population under stepwise production of neutral alleles. Proc Nat Acad U S A. 72:2761 2764. Kiontke, K, Gavin N, Raynes Y, Roehrig C, Piano F, Fitch D. 2004. Caenorhabditis phylogeny predicts convergence of herm aphroditism a nd extensive intron loss. Proc Nat Acad U S A. 101:9003 9008. Knapp, S, Bridges W, Yang M. 1989. Nonparametric confidence interval estimators for heritability and e xpect ed selection response. Genetics. 121:891 898. Kondrashov, A. 1988. Delet erious mutations and the evolution of sexual reproduction. Nature. 336:435 440. Kond rashov, AS. 1995. Modifiers of m utation selection balance general approach and the e voluti on of mutation rates. Genet Res. 66:53 69. Kondrashov, F, Og urtsov A. 2006. Sele ction in favor of nucleotides G and C diversifies evolution rates and levels of polymorphism at mammalian synonymous sites. J Theor Biol. 240:616 626. Lee, DH, Esworthy RS, Chu C, Pfei fer GP, Chu FF. 2006. Mutation a cc umulation in the Intestine and colon of mice deficient in two intracellular glutathione p eroxidases. Cance r Res. 66:9845 9851. Lercher, MJ, Chamary J V, Hurst LD. 2004. Genomic regionality in rates of evolution is not explained by clustering of genes of comparable expr ession profile. Genome R es. 14:1002 1013. Lewis, JA, Fleming, JT. 1995. Basic culture methods. Pp 4 29 in Epstein, HF and Shakes, DC eds. Methods in Cell Biology, Vol. 48. Caenorhabditis elegans: modern biological anal ysis of an organism. Academic Press London. Lichte nauer Kal igis, EGR, Dijke lvdV Dulk Hd, Putte Pvd, Giphart Gassler M, Tasseron de JG. 1993. Genomic position influences spontaneous mutagenesis of an integrated retroviral vector containing the hprt cDNA a s target for mutagenesis. Hum Mol Genet. 2:173 182. Lynch, M. 2010. Evolution of the mutation rate. Trend Genet. 26:345 352. Lynch, M. 2008. The cellular, developmental and population genetic determinants of mutation rate evolution. Genetics. 180:933 943. Lynch, M. 2007. The frailty of adaptive hypotheses for the origins of organismal complexity. Proc Nat Acad U S A. 104:8597 8604.

PAGE 94

94 Lynch, M, Hill W. 1986. Phenotypic evoloution by neutral mutation. Evolution 40:915 935. Lynch, M, Walsh B. 1998. Genetics and analysis of quantitative traits. Sinauer, Sunderland MA. Lynch M, Gabriel, W. 1983. Phenotyoic evolution and parthenogenesis. Am Nat. 122:745 764. Matsuoka, Y, Vigouroux Y, Goodman MM, Sanc hez G J, Buckler E, Doebley J. 2002. A single domestication for maize shown by multilocus microsatellite genotyping. Proc Nat Acad U S A. 99:6080 6084. McVean, G, Hurst L. 1997. Evidence for a selectively favourable reduction in the mutation rate of the X chromosome. Nature. 386:388 392. Ohta, T. 1973. Slightly deleterious mutant substitutions in evolution. Nature 246 :96 98. Ostrow, D, Phillips N, Avalos A, Blanton D, Boggs A, Keller T, Levy L, Rosenbloom J, Baer C. 2007. Mutational bias for body size i n rhabditid nematodes. Genetics. 176:1653 1661. Paun, O, Hrandl E. 2006. Evolution of hypervariable microsatellites in apomictic polyploid lineages of Ranunculus carpaticola : directional bias at dinucleotide loci. Genetics. 174:387 398. Petrov, D. 2002. Mutational equilibrium model of genome size evolution. Theor Pop Biol. 61:531 544. Petrov, DA. 2001. Evolution of g enome size: new approaches to an old problem. Trend Genet. 17:23 28. Phillips, N, Salomon MP, Custer A, Ostrow D, Baer CF. 2009. Spontaneous mutational and standing genetic (co)variation at dinucleotide microsatellites in Caenorhabditis briggsae and Caeno rhabditis elegans Mol Biol Evol. 26:659 669. Prendergast, JGD, Campbell H, Gilbert N, Dunlop MG, Bickmore WA, Semple CAM. 2007. Chromatin structure and evolution in the human g enome. BMC Evol Biol. 7:72. Rozen, S, Skaletsky H. 2000. Primer3 on the WWW f or general users and for biologist programmers. Humana Press Totowa, N J. Sabeti, PC. 2006. Positive natural selection in the human l ineage. Science 312:1614 1620.

PAGE 95

95 Schedl, T, Kimble J. 1988. fog 2, a germ line specific sex determination gene required fo r hermaphrodite spermatogenesis in Caenorhabditis elegans G enetics. 119:43 61. Schoen, DJ. 2005. Deleterious mutation in related species of the plant genus Amsinckia with contra sting mating systems. Evolution. 59:2370 2377. Schuelke, M. 2000. An economi c method for the fluorescent la beling of PCR fragments. Nat B iotech. 18:233 234. Seyfert, AL, Cristescu MEA, Frisse L, Schaack S, Thomas WK, Lynch M. 2008. The rate and spectrum of microsatellite mutation in Caenorhabditis elegans and Daphnia pulex. Genet ics. 178:2113 2121. Sivasundar, A, Hey J. 2003. Population genetics of Caenorhabditis elegans : The paradox of low polymorphism in a widespread species. Genetics 163:147 157. Sniegowski, P, Gerrish P, Johnson T, Shaver A. 2000. The evolution of mutation rates: separating causes from consequences. BioEssays 22:1057 1066. Sokal, R, Rohlf F. 1981. Biometry: the principles and practice of statistics in biological research. W. H. Freeman New York, NY Sturtevant, A. 1937. Essays on evolution I On the effect s of selection on mutation ra te. Quart Rev Biol. 12:464 467. Tian, D, Wang Q, Zhang P, Araki H, Yang S, Kreitman M, Nagylaki T, Hudson R, Bergelson J, Chen J Q. 2008. Single nucleotide mutation rate increases close to insertions/ deletions in eukaryotes. N ature. 455:105 108. Vassilieva, L, Hook A, Lynch M. 2000. The fitness effects of spontaneous mutations in Ca enorhabditis elegans. Evolution. 54:1234 1246. Vassilieva, L, Lynch M. 1999. The rate of spontaneous mutation for life history traits in Caenorhab ditis elegans Genetics. 151:119 129. Vigouroux, Y, Jaqueth J, Matsuoka Y, Smith O, Beavis W, Smith J, Doebley J. 2002. Rate and pattern of mutation at microsatellite loci in maize. Mol Biol Evol. 9:1251 1260. Williams, B, Schrank B, Huynh C, Sho wnkeen R Waterston R. 1992. A genetic mapping s y stem in Caenorhabditis elegans based on p olymorphic sequence tagged sites. Genetics. 131:609 624.

PAGE 96

96 Witherspoon, D, Robertson H. 2003. Neutral evolution of ten types of mariner transposons in the genomes of Caenorhab ditis elegans and Caenorhabditis briggsae J Mol Evol. 56:751 769. Wolfinger, R, Oconnell M. 1993. Generalized linear mixed models a pseudo likelihood approach. J Stat Comp Sim. 48:233 243. Wade, MJ. 2006. Natural selection. Pp 49 64 in Evolutionary ge netics : concepts and case studies edited by Fox, CW and Wolf, JB. Oxford University Press, Oxford, NY. Wood, W. 1988. The Nematode Caenorhabditis elegans. Cold Spring Harbor Laborartory, Cold Spring Harbor, NY.

PAGE 97

97 BIOGRAPHICAL SKETCH Matt was born in L os Angeles California in 1975. Matt began his college career at Glendale Community College in Glendale California an d completed a Bachelor of Science in b iology at the University of La Verne in La Verne California. After completing his undergraduat e degree at La Verne, Matt entered the Master of B iology program at the California State University Northridge w h ere he worked under the guidance of Larry Research Program. After graduating from C alifornia S tate U niversity N orthridge Matt entered the PhD progr am in the D epartment of Zoology at the University of Florida working under Charles F. Baer.