Role of Zinc and Zinc Transporters in Liver Regeneration

MISSING IMAGE

Material Information

Title:
Role of Zinc and Zinc Transporters in Liver Regeneration
Physical Description:
1 online resource (129 p.)
Language:
english
Creator:
Beker Aydemir,Tolunay
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Biochemistry and Molecular Biology (IDP)
Committee Chair:
Cousins, Robert J
Committee Members:
Bungert, Jorg
Kilberg, Michael S
Law, Brian K
Sitren, Harry S

Subjects

Subjects / Keywords:
hepatocyte -- liver -- phosphatase -- proliferation -- regeneration -- zinc -- zip14
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Chronic liver disease and cirrhosis rank twelfth and fifth among the leading causes of death in the America and Europe, respectively. Zinc deficiency has been observed in acute and chronic liver disease, thus zinc supplementation has been used in a few clinical trials for treatment of chronic liver injury. Zinc supplementation enhances the patient?s responsiveness to treatment as determined by measuring the level of liver enzymes in serum. However, with this measurement method it has not been possible to delineate a role for zinc/zinc transporters in the regeneration process. Hepatocyte proliferation is the main event in liver regeneration. Zinc is involved in cell proliferation both as a structural and as a regulatory factor in many mitogenic signaling pathways, and its homeostasis in cells is maintained by zinc transporters. Zinc transporter, Zip14, expression is inducible by proinflammatory cytokines, and the priming step of liver regeneration is cytokine-dependent. Using 70% partial hepatectomy as an in vivo model of liver regeneration, Zip14 upregulation and increased hepatic zinc have been shown. Results reveal that increased hepatic zinc caused inhibition of PTP1B, enhancement of c-Met phosphorylation and consequently, enhanced hepatocyte proliferation. Identical results were obtained with Zip14 overexpression. The hepatic zinc increase and subsequent hepatocyte proliferation in response to partial hepatectomy were diminished in ZIP14-knockout mice. In this study, Zip14 was identified as a main transporter for the hepatic zinc uptake during liver regeneration. Therefore, zinc and Zip14 could be considered as new therapeutic targets for new approaches that take advantage of the regenerative capacity of the liver for the treatment of chronic liver diseases.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Tolunay Beker Aydemir.
Thesis:
Thesis (Ph.D.)--University of Florida, 2011.
Local:
Adviser: Cousins, Robert J.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-02-29

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043332:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 ROLE OF ZINC AND ZINC TRANSPORTERS IN LIVER REGENERATION By TOLUNAY BEKER AYDEMIR A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF D OCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Tolunay Beker Aydemir

PAGE 3

3 For peace

PAGE 4

4 ACKNOWLEDGMENTS Writing an acknowledgment became the most difficult part of my dissertation since I am having a hard time finding suitable words to fully describe my gratitude. My first and most sincere acknowledgement must go to my mentor Dr. Cousins for providing the greatest training that any graduate student could ever imagine (in my opinion). He was always approachable and accessible (24/7) and always willing to go the extra mile to help me. His endless energy, enthusiasm, and dedication inspired me and many people around me throughout my doctoral training. He set the perfect example in my life, as a scientist and person, and for that I would like to g ive him my heartfelt thanks. Next, I would like to thank my committee members, Drs. Michael S. Kilberg, Jorg Bunger t, Brian K. Law, and Harry S. Sitren for their invaluable inputs, advice and critiques. I would also like to thank past lab member, Dr. Juan P. Liuzzi, and present lab members Dr. Shou Mei Chang, Moon Suhn Ryu, Greg Guthrie and in particular Alyssa Maki for her help in correcting the English spelling and grammar in my dissertation. Virginia Mauldin deserves the much appreciation for her mother ly friendship and support. Lastly, I would like to thank my family and friends for their unconditional love and support that they provided me through my entire life. The most special thanks goes to my love, Fikret, for sleeping on the very uncomfortable c ouch for many nights just to be right next to me, while I was writing this dissertation and making the beautiful handmade notebooks for me.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ 4 TABLE OF CONTENTS ................................ ................................ ................................ 5 LIST OF TABLES ................................ ................................ ................................ ........... 7 LIST OF FIGURES ................................ ................................ ................................ ........ 8 LIST OF ABBREVIATIONS ................................ ................................ .......................... 10 ABSTRACT ................................ ................................ ................................ .................. 12 1 INTRODUCTION ................................ ................................ ................................ ... 14 Liver Regeneration ................................ ................................ ................................ 14 Cytokine Dependent Pathway ................................ ................................ ......... 16 Growth Factor Dependent Pathway ................................ ................................ 17 Cell Cycle and Gene Expression after Partial Hepatectomy ............................ 20 Termination of Liver Regeneration ................................ ................................ .. 24 Zinc and Zinc Transporters ................................ ................................ .................... 26 Zinc, Zinc Transporters and Liver Regeneration ................................ .................... 28 2 MATERIAL AND METHODS ................................ ................................ ................. 33 Animals ................................ ................................ ................................ ................. 33 Genotyping ................................ ................................ ................................ ............ 34 Partial Hepatectomy ................................ ................................ .............................. 34 Cell Culture and Treatments ................................ ................................ .................. 35 Macrophage Conditioned Medium ................................ ................................ ......... 35 Interleukin 6 Enzyme Linked Immunos orbent Assay ................................ ............. 36 Measurement of Serum and Cell/Tissue Zinc Concentration ................................ 36 Alanine Amino Transferase Assay ................................ ................................ ......... 37 RNA Isolation and Quantitative Real Time Polymerase Chain Reaction ................ 37 Zinc Transporter Antibodies ................................ ................................ ................... 38 Immunoblotting ................................ ................................ ................................ ...... 38 Bromodeoxyuridine Assay ................................ ................................ ..................... 40 Tyrosine Protein Phosphatase 1B Assay ................................ ............................... 40 Zip14 Overexpression ................................ ................................ ........................... 41 Deoxyribonucleic Acid Pull Down Assay ................................ ................................ 42 3 ZINC ENHANCES LIVER REGENERATION ................................ ......................... 46 Introductory Remarks ................................ ................................ ............................ 46

PAGE 6

6 Results ................................ ................................ ................................ .................. 50 Hepatic Zinc Increases in Response to Partial Hepatectomy .......................... 50 Zinc Transporters are Differentially Expressed in Response to Partial Hepatectomy ................................ ................................ ................................ 51 Zinc Supplementation Enhances Liver Regeneration ................................ ...... 52 Discussion ................................ ................................ ................................ ............. 55 4 ZINC ENHANCES C MET PHOSPHORYLATION BY INHIBITION OF PR OTEIN TYROSINE PHOSPHATASE 1B ................................ ........................... 76 Introductory Remarks ................................ ................................ ............................ 76 Results ................................ ................................ ................................ .................. 81 Zinc Inhibits Protein Tyrosine Phosphatase 1B Activity ................................ ... 81 Zinc Enhances c Met Phosphorylation ................................ ............................ 82 Discussion ................................ ................................ ................................ ............. 83 5 ZIP14 FACILITATES HEPATIC ZINC UPTAKE DURING LIVER REGENERATION ................................ ................................ ................................ .. 89 Introductory Remarks ................................ ................................ ............................ 89 Results ................................ ................................ ................................ .................. 93 Overexpressed Zip14 Enhances Hepatocyte Proliferation .............................. 93 ZIP KO Caused Decrease in Hepatocyte Prolife ration ................................ .... 94 Transcriptional Regulation of Zip14 during liver regeneration .......................... 96 Discussion ................................ ................................ ................................ ............. 96 6 CONCLUSIONS AND FUTURE DIRECTIONS ................................ .................... 107 LIST OF REFERENCES ................................ ................................ ............................ 112 BIOGRAPHICAL SKETCH ................................ ................................ ......................... 129

PAGE 7

7 LIST OF TABLES Table page 2 1 ZIP transporter primer/probe sequences ................................ ........................... 43 2 2 ZnT transporter primer/p robe sequences ................................ .......................... 44 2 3 Other primer/probe sequences ................................ ................................ .......... 45 2 4 ZIP and ZnT transporter antibody sequences ................................ .................... 45 2 5 List of Antibodies ................................ ................................ ............................... 45

PAGE 8

8 LIST OF FIGURE S Figure page 3 1. Proliferation marker change in response to part ial hepatectomy. ...................... 59 3 2. Changes in hepatic zinc in response to partial hepatectomy. ............................ 60 3 3. Differential expression of zinc tra nsporters in response to partial hepatectomy.. ................................ ................................ ................................ .... 61 3 4. Changes in Zip6 and Zip14 expression in response to partial hepatectomy. ..... 62 3 5. Changes in ZnT7 and ZnT8 expression in response to partial hepatectomy. ..... 63 3 6. Changes in hepatic zinc in response t o both dietary zinc and partial hepatectomy. ................................ ................................ ................................ ..... 64 3 7. Effect of dietary zinc on liver function after partial hepatectomy.. ...................... 65 3 8. Effect of dietary zinc on liver regeneration. ................................ ........................ 66 3 9. Dose and time dependent effect of zinc treatment on AML12 proliferation in response to hepatocyte growth factor stimulation. ................................ ............. 67 3 10. Effec t of in vitro zinc treatment on AML12 proliferation in response to hepatocyte growth factor stimulation.. ................................ ............................... 68 3 11. Effect of in vitro zinc treatment on deoxyribonucleic acid replication in res ponse to hepatocyte growth factor stimulation. ................................ ............. 69 3 12. In vitro simulation of initiation of liver regeneration in vivo. ................................ 70 3 1 3 Effect of lipopolysaccaride on interleukin 6 production by RAW macrophages and the influence of conditioned medium on Zip14 expression. ........................ 71 3 14. Effect of macrophage conditioned medium on Zi p14 expression. ...................... 72 3 15. Validation of zinc transporter expression pattern in the in vitro model of liver regeneration initiation. ................................ ................................ ....................... 73 3 16. Effect of Zip14 expression on the intracellular zinc concentration of AML12 hepatocytes. ................................ ................................ ................................ ...... 74 3 17. Effect of macrophage conditioned media on AML12 hepatocyte proliferation. ... 75 4 1. Validation of phosphatase assay. ................................ ................................ ...... 86 4 2. Inhibitory effect of zinc on protein tyrosine phosphatase 1b activity. .................. 87

PAGE 9

9 4 3. Effect of zinc on c Met signaling pathway. ................................ ......................... 88 5 1. Effect of Zip14 overexpression on AML12 hepatocyte proliferation. ................ 100 5 2. Effect of Zip14 overexpression on c Met signaling pathway. ........................... 101 5 3. Genotyping of mouse tail samples.. ................................ ................................ 102 5 4. Validation of Zip14 knock out.. ................................ ................................ ........ 103 5 5. Effect of Zip14 k nock out on hepatic zinc in response to partial hepatectomy. 104 5 6. Effect of Zip14 knock out in liver regeneration. ................................ ................ 105 5 7. Transcriptional regulation of Zip14 during liver regeneration. .......................... 106 6 1. Shematic representation of invo lvement of zinc and Zip14 in liver regeneration ................................ ................................ ................................ .... 111

PAGE 10

10 LIST OF ABBREVIATION S AAS Atomic Absorbtion S pectrophotometry ALT Alanine Amino T ransferase AE Acrodermatits E nteropathica BrDU 5 bromo 2' deoxyuridine cAMP Cyclic AMP CCl4 Carbon Tetra C hloride CD1 Cyclin D1 CDF C ation Diffusion F acilitator Cdk Cyclin Dependent K inase DTT Dithiothreitol EGF Epidermal Growth F actor elF4E Eukaryotic Initiati on F actor 4E HB EGF Heparin Binding Epidermal Growth F actor HGF Hepatocyte Growth F actor IGFR Insulin L ike Growth Factor R eceptor IR Insulin R eceptor IL6 Interleukin 6 LDLT Live Donor Liver Transplantation LPS Lipopolysaccharide LR Liver R egenerat ion Met Mesenchy mal epithelial Transition F actor MMP Matrix M etalloprotease MRE Metal response element mRNA Messenger Ribonucleic A cid

PAGE 11

11 MT Metallothionein MTF 1 Metal Response Element Binding Transcription F actor 1 PCNA Proliferating Cell N uclear A ntigen PHx Partial H epatectomy PMSF P henylmethanesulfonylfluoride PI3K Phosphatidylinositol 3 kinase PTP1B Protein Tyrosine P hosphatase 1B RTK Receptor T yrosine K inase qPCR Quantitaive Polymerase Chain R eaction SLT Split Liver Transplantation S NP Single Nucleotide P olymorphism TBP TATA B ox binding P rotein TGF Transforming Growth F actor TM Transmembrane Tumor Necrosis F actor alpha TPEN Tetrakis (2 pyridylmethyl) Ethylenediamine ZIP Zrt Irt like Zinc Transporter S uper family ZnA Zinc A dequate ZnD Zinc D eficient ZnH Zinc H igh ZnT Zinc T ransporter

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for th e Degree of Doctor of Philosophy ROLE OF ZINC AND ZINC TRANSPORTERS IN LIVER REGENERATION By Tolunay Beker Aydemir August 2 011 Chair: Robert J. Cousins Major: Medical Science Biochemistry and Molecular Biology Chronic liver disease and cirrhosis rank twelfth and fifth among the leading causes of death in the America and Europe respectively. Zinc deficiency has been observed in acute and chronic liver disease, thus z inc supplementation has been used in a few clinical trials for treatment of chronic liv er injury. Zinc supplementation esponsiveness to treatment as determined by measuring the level of liver enzymes in serum However, with this measurement method it has not been possible to delineate a role for zinc/zinc transporter s in the regeneration process. Hepatocyte proliferation is the main event in liver regeneration. Zinc is involved in cell proliferation both as a structural and as a regulatory factor in many mitogenic signaling pathways, and its homeostasis in cells is mai ntained by zinc transporters. Zinc transporter, Zip14 expression is inducible by proinflammatory cytokines and the priming step of liver regeneration is cytokine dependent. Using 70% partial hepatectomy as an in vivo model of l iver regeneration, Zip14 up regulation and increased hepatic zinc have been shown. R esults reveal that increased hepatic zinc caused inhibition of PTP1B, enhancement of c Met phosphorylation and consequently enhanced hepatocyte proliferation. Identical results were obtained with Zip 14 overexpression. The

PAGE 13

13 hepatic zinc increase and subsequent hepatocyte proliferation in response to partial hepatectomy were diminished in ZIP14 knockout mice. I n this study, Zip14 was identified as a main transporter for the hepatic zinc uptake during liv e r regeneration. Therefore, zinc and Zip14 could be considered as new therapeutic target s for new approaches that take advantage of the regenerative capacity of the liver for the treatment of chronic liver diseases.

PAGE 14

14 CHAPTER1 INTRODUCTION Liver Regeneratio n Liver Regeneration (LR) is compensatory hyperplasia after cell/tissue loss to restore original mass and architecture. Loss of liver mass can be induced by s urgical removal of tissue or administering hepatotoxic chemicals (e.g., carbon tetrachloride) Par tial hepatectomy (PHx) was used in this dissertation project, as this procedure is the model that most clearly demonstrates the regenerative capacity of the liver. In the model, 2/3 (~70%) of the rodent liver is removed and the remnant liver enlarges until the mass of the liver is restored. T he reproducibility of PHx and precision of timing of the sequence of ensuing events has made PHx the preferred approach for the experimental study of liver regeneration. The PHx technique is also important because it re sembles regeneration following resection of the liver in a clinical setting. In adult liver hepatocytes are in G 0 phase of the cell cycle and rarely divide (1 ) However after PHx approximately 95% of hepatocytes that are normally quiescent enter the S phase of ce ll cycle. PHx triggers a sequence of events that proceed in an orderly fashion and can be observed from 5 min to 5 7 days after surger y Hepatocytes are the first cells to enter into deoxyribonucleic acid ( DNA ) synthesis. After 70% PHx hepatocytes of the remnant liver undergo one round of DNA synthesis, which peaks at approximately 36 h for the mouse. A second smaller percent of cells enter into a second round of DNA synthesis and establish the original number of hepatocytes. The proliferation of hepatocyt es advance from periportal to pericentral areas ( 2 ) To totally appreciate the regeneration process, knowledge about structural unit of liver, its cells and their localization in the structure is helpful. The structural unit of the

PAGE 15

15 l iver i s called the liver lobule The blood supply for this structure comes from portal vein and hepatic artery, which becomes mixed at the edge of portal tract (bile duct and branches of the hepatic artery and hepatic portal vein) where the liver sinusoids are found. Blood travels through sinusoids from portal tract to central vein. Liver sinusoids between hepatocytes and endothelial cells ( 3 ) There are four different cell types found lining the sinusoid. (1) Endothelial cells, the majority of the lining cells of the sinusoids, do not have a basement membrane. They are specialized fenestrated endothelial cells. This structure allows direct contact between hepatocytes and plasma for metabolic processes. (2) Hepatic stellate cells reside in the subendothelial space, between the basolateral surface of hepatocytes and si nusoidal endothelial cells. In normal liver, stellate cells store vitamin A droplets in their cytoplasm and play an important role in liver inflammation because of their ability to recruit inflammatory cells through expression of adhesion molecules and sec retion of chemokines and cytokines. (3) Kupffer cells are liver macrophages. They are mainly located in the lumen of hepatic sinus oids, where they particulate foreign materials from the portal circulation ( 4 ) (4) He patocytes, paranchimal liver cells, extend along the sinusoids to the centriolobular region as polarized epithelial cells. Roughly 80% of the mass of the liver is composed of hepatocytes. These cell s are the main cell type in the liver and are where all metabolic events are carried out. Liver regeneration signaling process can be divided into three main pathways: (a) a cyto kine dependent pathway that is largely responsible for entry of quiescent hepa tocytes into the cell cycle (transition from G 0 G 1 ), (b) a growth factor dependent

PAGE 16

16 pathway that is responsible for cell cycle progression (progression through the G 1 phase to S phase), and (c) a still poorly described pathway that links metabolic signals w ith ribosome synthesis and DNA replication ( 5 ) Each of these pathways is required but not sufficient alone for regene ration. Interactions of these pathways are also essential for regenerative growth. Cytokine Dependent P athway Cytokines are involved in the initiation of liver regeneration. They prime hepatocytes to enter the cell cycle and to respond to the mitogenic eff ect of growth factors. The main participants in the cytokine network are t umor necrosis factor alpha (TNF nterleukin 6 (IL and IL 6 increase very rapidly after PHx, and are components o tumor necrosis factor receptor 1 ( TNFR1 ) nuclear factor kappa light chain enhancer of activated B cells ( ) IL 6 Signal transducer and activator of transcription 3 ( STAT3 ) pathway. Each component appears sequentially in the regenerating rodent liver during the first 12 h after PHx. The propose d pathway is that initially TNF plasma membrane of Kupffer cells causing an increase in IL 6 expression through the ( 6 ) IL 6 causes activation of ST AT3 and translocation to the nucleus in Kupffer cells and also in hepatocytes ( 7 ) PHx in mice lacking the TNFR1 is associated DNA synthesis ( 8 ) however, Injection of IL 6 prior the PHx restore d the DNA synthesis. IL6 k nock out ( KO ) mice also showed an impaired regenerative resp onse that is corrected by an IL 6 injection ( 9 ) Neit her TNF 6 is a direct mitogen for hepatocytes. They do not induce DNA synthesis in primary cultures in serum free medium nor do these mediators induce

PAGE 17

17 hepatocyte DNA synthesis when injected in the intact animals ( 10 ) H owever, mice over expressing IL 6 and its soluble receptor (IL 6 binds to a soluble receptor and the complex binds to the receptor gp130) have areas of periportal hepatocyte hyperplasia ( 11 ) Thus, even though these mediators are not direc t mitogens for hepatocytes, they are important contributors to the initiation of signaling pathways leading to proliferation of hepatocytes at the very early stage of regeneration. It is particula rly intere 6 increase after PHx since they are pro inlammatory cytokines and important mediators of the acute phase response. In PHx part of the liver is removed surgically thus there is no tissue damage or inflammation produced by the procedur e. However, there is increased portal blood pressure to remnant liver that may cause stress. The recovery from these stress conditions can resemble wound healing conditions following PHx ( 10 ) This process will be explained in below in the section describing very earl y events in liver regeneration following PHx. Growth Factor Dependent P athway In the wound healing scenario, the injury to the tissue results in disruption of capillary vascular networks and extravasation of blood, accompanied by local release of coagulati on factors, platelets and growth factors ( 12 ) This is cl early not the case following 70% PHx. In PHx 70% of the liver is surgically removed without damage to the residual tissue However, portal blood flow per unit of liver tissue is tripled. It has been shown that if the pressure of the portal vein is kept constant, there is a deficient activation of hepatocyte growth factor (HGF) and increased apoptosis. These changes after PHx closely resemble the wound healing process and suggest they are necessary for the initiation of regeneration. As seen in early stages of wound healing one of the

PAGE 18

18 first observed biochemical changes is increase in activity of urokinase plasminogen activator (uPA) ( 13 ) Even though the exact relationship between increased uPA and portal blood pressure in remnant liver is not clear in the PHx model, it has been shown in several cell types, including endotheli al cells, that there is an increase in uPA after mechanical stress associated with increased turbulent blood flow ( 14 ) Thus, alteration of vascular flow patterns alone can trigger some of the early events in regeneration process. uPA is present in extracellular matrix and its primary physi ological substrate is plasminogen. After PHx the increase in uPA activity is accompanied by activation of plasminogen to plasmin and as a result appearance of fibrinogen (a main part of the extra cellular matrix) degradation products ( 15 ) Other evidence that supports extra cellular matrix (ECM) remodeling at the very early stages of liver regenerati on is activation of metalloproteinase 9 (MMP9) and metalloproteinase 2 (MMP2) after PHx ( 16 ) Studies from wound healing and tumor biology have shown that matrix remodel ing causes signaling through in t egrins and is associated with release of locally bound growth factors and peptides that have signaling capacities ( 17 ) Hepatic ECM binds many growth factors. One of the main matrix binding growth factors in liver is HGF ( 18 ) Inactive, single chain HGF bound to hepatic biomatrix is locally released during matrix remodeling and is activated to its active for m by uPA (HGF and plasminogen have the same consensus sequence at their activation site) ( 19 ) Activated HGF is available locally, but it enters the circulation. HGF in liver is produced predominantly by the stellate cells, but also hepatic endothelial cells ( 20 ) HGF messenger ribonucleic acid ( mRNA ) increases not only in liver it also increases in lung and spleen ( 21 ) The signal

PAGE 19

19 triggering this extrahepatic participation is not clear. How ever, it has been shown that IL 6 stimulates production of HGF in responding cells ( 21 ) Thus IL 6 might be the candidate for this effect. Release and activation of HGF result in activation of c Met ( 22 ) MET (mesenchymal epithelial transition factor) is a proto oncogene that encodes a protein called c Met o r hepatocyte growth factor receptor (HGFR). c Met is a membrane receptor that is essential for embryonic development and wound healing and liver regeneration. HGF is the only known ligand of the c Met receptor. The epidermal growth factor receptor (EGFR) is also activated with the same kinetics as c Met ( 22 ) HGF and all the EGFR ligands (epidermal growth factor EGF, transforming growth factor alpha ( TG F ) heparin binding EGF like growth factor ( HB EGF) are direct mitogens for hepatocytes in chemically defined serum free medium ( 23 ) when injected alone into intact normal mice and rats ( 24 ) EGF are produced by hepatocytes and functions through an autocrine mechanism, as hepatocytes both produce the ligand and appropriate receptor binding ( 25 ) Mice with and develop tumors ( 26 ) On th affect liver regeneration ( 27 ) HB EGF is produced by endothelial cells and kupffer cells ( 28 ) Expression of HB EGF is greatly increased in regenerating liver after PHx. HB EGF transgenic mice with liver targeted over production have enhanced regeneratio n ( 29 ) whereas HB EGF KO mice h av e deficient regeneration respon se ( 30 ) In summary all the EGFR ligands are direct mitogens for hepatocytes. Moreover there is a great

PAGE 20

20 redundancy in the regeneration process, probably because of the overlap between various ligands of the EGF family. The only irreplaceable growth factor in the liver regeneration process is HGF because of the following reasons: (a) HGF levels in plasma increase 10 20 fold a fter PHx, (b) active HGF is consumed from intrahepatic stores and is followed by new HGF synthesis, (c) HGF causes a strong mitogenic response in vivo and in vitro, (d) the liver HGF receptor (c Met) becomes activated short after PHx and (e) targeted genet ic elimination of c Met expression in liver is associated with a very diminished or absent regenerative respond. The degrees of suppression of regeneration suggest that there are unique signaling pathways associated with c Met that are not compensated by E GFR or other mechanisms (the same dependency on c Met has also been found in wound healing ) ( 31 ) Cell Cycle and Gene Expression after Partial Hepatectomy There is evidence showing increases in cell cycle proteins after PHx. The cell cycle process is regulated by cyclin, cyclin d ependent kinases (cdk) and cell cycle inhibitors. Gene expression after PHx can be groupe d in two phases. (1) Activation of pre existing transcription factors (TF) to induce expression of immediate early and delayed early response genes during the priming phase of LR. (2) De novo synthesis of TFs to regulate mitosis, termination of proliferati on and size adjustment in the regenerating liver. Pre existing TFs are activated by post translational modification s without de novo protein synthesis. This allows rapid expression of genes that promote hepatocytes to leave their G 0 state and enter the ce ll cycle (G 0 G 1 transition). Thre e of the TFs that are first to be activa ted are NF B, STAT3 and activator protein 1 ( AP 1 ) (3 2, 33 ). These TFs stay activated for the first 5 hours after PHx. TNF l ipopolysaccharide ( LPS )

PAGE 21

21 complement factors, complement component C3a ( C3a ) and complement component 5a ( C5a ) and inter cellular adhesion molecule 1 ( ICAM ) activate NF B mediated transcription in Kupffer cells. Kupffer cell produce d IL6 binds to the IL6 receptor on hepatocytes and activates STAT3 dependent tran scription in hepatocytes. Activation of STAT3 causes an increase in expression of Myc, Fos, Jun, Gadd45 and e arly response 1 (E gr ) (34 ) Liver specific deletion of STAT 3 causes lower expression of cyclin D1 and cyclin E required for G 1 S transition of the cell cycle c Jun and c Fos bind to the AP 1 DNA binding site of early response genes. Conditional inactivation of Jun in the perinatal liver causes high morbidity and severe impairment of LR because of higher level s of cell cycle inhibitor p21 and stres s kinase p38 (35, 36 ) Decreased c Fos expression and delayed hepatic proliferation were observed in the cAMP responsive promoter element modulator (Crem) KO mice. As a result of diminished c Fos expression, cell cycle regulators cyclin A, B, D, E and cyc lin dependent kinase 1 ( Cdk1 ) were down regulated after PHx (37 ) Beta catenin ( 3 8 ) and notch 1 ( 3 9 ) intracellular domain appear in hepatocyte nuclei within 15 30 min after PHx. Elimination of the expression of these proteins by RNA interference decreases the regenerative response. Ligation of the lef t lateral and median lobes dur ing PHx surgery leads to hypoxia in the remaining lobes of the liver (40, 41 ) Hypoxia induced factor 1 translationally modified and 48 hours following PHx ( 42, 43 ) Conditional hepatic KO mice caused a delay in DNA replication ( 44 ) Additionally, liver specific K O mice develop severe hypoglycemia and accumulate more glycogen in the regenerating liver when compared

PAGE 22

22 to wild type ( WT ) mice Pepck and Pgk1 ( 45 ) At the same time, KO mice have a higher level of phosphorylated Akt and g lycogen synthase kinase 3 ( GSK ) kinases, leading to accelerated glycogen synthesis in regenerating liver. Thus the activity of HI meet ing the metabolic demand imposed by PHx. Ex pression of immediate early and delayed early response genes during the priming phase of LR leads to the do novo synthesis of TFs, thus starting the new cascade of transcriptional activity during the G 1 S and S G 2 transitions. The newly synthesized TFs inc lude Myc, CCAAT/en hancer binding proteins (C/EBP) and FoxM1 (46 ) Liver specific expression of c Myc transgene resulted in a 10 hour earlier hepatocyte proliferation during LR ( 47, 48 ) This result was correlated with early expression of cyclin A and Cdk1 genes. The C/EBP form a transcription factor family with key roles in the regulation of several hepatocyte specific genes. ( 36 ) Anti ( 1, 50 and 51 ) Additionally, K O mice displayed a 75% reduction in replicating hepatocytes and decreased expressions of Egr 1 TF, cyclin B and E following PHx ( 52 ) Increased hepatic expression of FoxM1 occurs during G1/S transition of the cell cycle and remained elevated throughout th e proliferation period, thus it displays the expression kinetics of delayed early TF. Liver specific expression of FoxM1 transgene revealed 8 hours acceleration of hepatocyte entry to S phase and mitosis ( 82 5 4 ) This accelerated proliferation was associ ated with an earlier expression of S phase phophatase and diminished induction of cdk inhibitor p21 in a regenerating liver.

PAGE 23

23 Conditional liver FoxM1 KO mice displayed a reduct ion in hepatocyte DNA replication and mitosis ( 55 ) Up regulation of Egr 1, Ets2 and Atf3 genes after the first 4 hours after PHx were found by high density microarray analysis ( 5 6 ). The Egr1 transcription factor was implicated in expression of the cell division cycle 20 (cdc20) gene, a key regulator of the anaphase promoting complex during mitosis ( 5 7 ) Egr1 KO mice displayed impaired metaphase to anaphase transition during mitosis. The Ets2 transcription factor interacts with C/EBP stimulation in primary mouse hepatocyte s Atf3 is a member of ATF/cAMP resp onsive element binding protein (CREB) TF family, and is highly up regulated. Atf3 expression stimulates proli feration of mouse hepatoma cells by Atf3 dependent activation of cyclin D1 transcription ( 5 8 ). Late response TFs control mitotic entry and progression during LR. G2 M transitions occur during the second day after PHx, and require expression of cyclin A, cy clin B, cyclin mediated kinases Cdk1, Cdk2 and the cdc25 family of phosphatases. Some of these genes such as cdc25a and cdc25b are induced by FoxM1 ( 55, 59 ). Transcriptional activity of FoxM1 was associated with increase d cyclin F and p55cdc, which ar e in volved in completion of mitosis during regeneration ( 6 0 in the G 2 responsible for cell cycle progression ( 6 1 KO mouse, the regulatory role of C/EBP p eroxisome proliferator activated receptor ( ) coactivator 6 2 ). gluco neo genesis and ketogenesis in the regen erati ng liver. These findings show the

PAGE 24

24 roliferative and metabolic functions during regeneration. In contrast with proliferative phase of liver regeneration ( 6 3 a multi protein complex with histone deacetylase 1 (HDAC1), cyclin D3 and Brm, silencing E2F dependent promoters to decrease hepatocyte proliferation ( 6 2 ). Termination of Liver R egeneration The regeneration process stops when the liver mass has been restored, however ; the exact stop signal has not known t o date. Because of its known anti mitotic properties, t ransforming growth factor ( ) has been the most a ttractive candidate. Despite its anti regeneration. At the same time however TGFRI and II expression is decreased markedly particularly during first 48 h. This decrease may explain why hepaocytes are ( 6 4 ) have normal termination of liver regeneration, unless there is a concurrent elimination of activin ( 6 4 ) Activin i s also a mito inhibitor and it is possible that termination of Regardless of its potential to terminate regeneration as a mito has a role in the assembly of hepatic tissue towards the end of r egen eration ,s timulat ing stellate cells to synthesize new ECM. It is possible that the reassembly of ECM and the sinusoidal capillary network provides matrix driven signaling through integrin to terminate regeneration.

PAGE 25

25 Enhanced hepatocyte proliferation and hepa tomegaly were reported in a liver specific KO of an ECM integrin linked kinase (ILK) ( 6 5 ). Changes in ECM actively signal to ILK, which then modulated expression of hepatic genes via TFs such as C/EBPs ( 6 5 ). C/EBP antagonizing fashion during LR. Thus C/EBP between proliferation and termination phases of LR. leads to gluconeogenesis and growth suppression during termin ation phase regulates transcription of E2F target genes during proliferation phase of LR. increased in quiescent ILK KO hepatocytes, mimicking the proliferating phase of LR ( 6 6 ). A d efect in the termination of LR in l iver specific ILK KO mice was also reported ( 6 6 ). The ILK KO liver exhibited sus tained cellular proliferation following PHx, causing the ILK KO mice to have 158% of their original weight compared to the normal 100% liver mass restoration in WT mice. In t he same study they also observed decreased level s of the phosphorylated Yes activator protein (YAP) in ILK KO mice at 3 14 days following PHx when compared to WT mice (66) YAP is an important effector of Mst1/2 signaling and in the dephosphorylated form binds to the promoter of target genes to promote cellular proliferation and tissue growth ( 6 7 68 ). YAP becomes inactive when it is phosphorylated. Mst1/2 mediated phosphorylation/inactivation of YAP was shown to limit organ size in Drosophila and mice ( 68 ) These results from ILK KO studies collectively suggested a role for ILK for the termination of LR through either regulation of C/EBP TFs or the Mts1/2 YAP pathway.

PAGE 26

26 Zinc and Zinc T ransporters Zinc is essential micronutrient that has been identified in mo re than 300 different enzymes including, alcohol dehydrogenase, alkaline phosphatase, matrix metalloproteinases, reverse transcriptase, RNA polymerases, and superoxide dismutase ( 69 70 ) Zinc finger proteins are a family of more than 2,000 transcription factors and accessory factor that bind specifically to DNA modify that binding and therefore regulate transcription. Zinc is also involved in intracellular sig naling and neurotransmission ( 71 72 ) Zinc transporter proteins maintain zinc homeostasis through tight regulation of zinc influx, efflux, and distribution to intracellular organelles. Zinc transporter proteins are essential for these metabolic and functional adjustments. Zinc transporters are found within two gene families, the ZIP (SLC39) and ZnT (SLC30) ( 73 74 ). ZIP transporters function in zinc influx into the cytosol, while ZnT family transporters function in zinc efflux from the cytosol. Zinc transporter contributions to cellular events can be illustrated through published data on dendric cell maturation ( 75 ) In this study it has been shown that dendric cell maturation required a decrease in intracellular zinc. This decrease was provided through a decrease in exp ression of the ZIP6. Increased ZIP8 expression during T cell activation was also s howed by our lab ( 76 ). The T cell activation process required increased cytoplasmic zinc while the zinc content of the lysosomal vesicles was decreased. ZIP8 localized on the lysosome functions in translocating zinc from the lysosome to cytoplasm and result in sustained cAMP response element binding protein (CREB) phosphorylation.

PAGE 27

27 Expression of zinc transporters change s depending on the need for zinc in the cell. Abnormality i n their expression causes diseases. Best known example of this is Acrodermatitis Enteropathica (AE). AE is caused by impaired zinc uptake in small intestine and is produced through a mutation of the ZIP4 gene. More recently it has been reported that a sing le nucleotide polymorphism (SNP) of ZnT8 is associated with type 2 diabetes with reduced insulin secretion ( 77 ) Zinc availability is important for tumor growth and progression. Zinc transporter involvement to different types of cancers has been reported. High Zip4 expression in pancreatic adenocarcinoma was shown ( 78 ) Forced expression of ZIP4 increased cell proliferation and pancreatic tumor volume in the nude mice model. In another study, ZIP6 and ZIP7 have been found to be associated with estrogen positive breast cancer and metastasis to lymph nodes ( 79 ) ZIP10 invo lvement to invasive behavior of breast cancer cells has also been reported ( 80 ) These fi ndings are particularly important since cancer development and liver regeneration process share many pathways that regulate cell proliferation and metastasis. Changes in zinc transporter expressions detected by microarray during liver regeneration have bee n reported ( 81 ) ZIP3, ZIP6, ZIP7, ZIP10, ZIP14, ZnT3, ZnT4, ZnT5, ZnT7 were increased and ZIP4, ZIP8, ZnT1 were decreased suggesting zinc transport was potentially involved in liver regeneration. Among the se zinc transporters ZIP14 is of specific interest to us since we previously reported that IL 6 results in ZIP14 up regulation in WT mice liver after injection of either LPS or turpentine ( 82 ) However, in IL6 KO mice there was an impaired induction of liver ZIP14. Relevant to liver re generation, in a small pilot study mice were injected with CCl4 (2mg /kg) and zinc

PAGE 28

28 transporter expression was measured. Result showed that ZIP14 had the highest induction among all others. Collectively these observations lead to the hypothesis that ZIP14 mi ght be the main player for zinc homeostasis and function in liver regeneration. Zinc, Zinc Transporters and Liver Regeneration As mentioned in earlier sections, liver regeneration is multi step process. In this section potential zinc and zinc transporter i nvolvement in specific steps will be discussed. One of the first steps in liver re generation is production of TNF As a result of binding of TNF pffer cells and hepatocytes, IL 6 is a zinc finger transcription factor that inhibits TNF ( 83 84 ) It has been shown in the HL 60 ( human pro myelocytic leukemia cell line that differentiates to the monocyte macrophage phenotype by PMA) cells that expression of A20 is zinc dependent ( 85 ) B iphasic effect of zinc on TNF was also shown in our lab (unpublished data) suggesting that zinc is an impo rtant component to regulate TNF Another early event in liver regeneration is elevated uPA activation. Activated uPA causes conversion of plasminogen to its active form plasmin, which is a proteolytic enzyme responsible for degrading ECM proteins. When plasmin detaches from the cell surface it becomes inactivated very quickly. A relatively new, histidine rich glycoprotein, has been found that tethers plasmin to the cell surface ( 86 ) The importance of this protein from a zinc perspective is that elevated levels of zinc are required to tether plasmin to the cell surface.

PAGE 29

29 Increased activation of MMP2 and MMP9 is also observed in early liver regenera tion. These are members of zinc depen dent endopeptidases family enzymes that collectively degrade ECM constituents. All the members of these family enzymes possess zinc containing catalytic domain meaning that they require zinc to be activa t ed. Degradation of ECM causes HGF release from the m atrix and activation to its active heterodimeric form by uPA. The activated form of HGF binds to its receptor c M et on the hepatocyte membrane. c Met is a tyrosine kinase receptor. Its activation through HGF binding induces c Met kinase catalytic activity, which triggers transphosphorylation of the tyrosines (Tyr) Tyr 1234 and Tyr 1235 in the int r acellular kinase domain ( 87 ) Consequent phosphorylation of tyrosine 1349 and 1356 at the docking domain engage various signal transducers, thus initiating a whole spectrum of biological activities The rat s arcoma ( RAS ) pathway mediates HGF induced scattering and proliferation signals. Of note, HGF, compared to most mitogens induces sustained RAS activation, and thus prolonged m itogen activated protein kinase ( MAPK ) activity. The MAPK cascade activation is the key signaling pathway involved in G1 phase progression. MAPK cascade is also activated by EGF. It has been shown that EGF dependent hepatocyte proliferation through MAPK pathway is delayed by inhibition of the metal responsive transcription factor 1 (MTF 1) which requires zinc for activation and nuclear localization ( 88 ) Another consequence of MTF 1 inhibition is increased production and activation inhibitor suggesting that MTF 1 might function as a it functions on

PAGE 30

30 ZIP10 expression ( 89 ) regeneration. Potential MTF effective liver regeneration. Another zinc transporter that its expression is regulated by MTF 1 is ZnT1. C. elegans cation diffusion facilitator (CDF) protein is a homologue of mammalian ZnT1, and responds to zinc in a mode consistent with activity as a zinc exporter ( 90 ) CDF 1 activity increases Ras mediated signaling. Similarly, CDF 1 and ZnT1 bind to Raf 1 and may be responsible for full activation of this downstream component of RAS pathway ( 91 ) This mechanism could be taking place in HG F induced RAS pathway in hepatocyte proliferation. The activation of c Met by HGF binding is also linked to cell growth and survival through activation of PI3 kinase/Akt. Interestingly, it has been found that zinc can also activate this pathway ( 92 95 ) Activation of Akt is via P13K, as it is prevented by P13K inhibitors. Furthermore, P13K activity was shown to be enhanced in cells exposed to zinc (92 95 ) Zinc is known to be a phosphatase inhibitor. The phosphatase and tensin homolog (PTEN) protein acts as a phosphatase in the Akt signaling resulting in inhibition of the p athway. One possibility for zinc to enhance the Akt activation might be through inhibition of PTEN since it has been shown that PTEN protein levels are lost in zinc treated airway epithelial cells ( 96 ) Akt the downstream target of PI3K exerts its anti apoptotic effects in a variety of ways, including phosphorylation and activation of IKKs (I KappaB Kinases). This results in I KappaB degr adation and allows to enter the nucleus and activate transcription of anti apoptotic genes.

PAGE 31

31 Activation of Met ty rosine kinase also activates phospholipase C that results in the elevation of intracellular calcium and activation of protein kinase C (PKC) pathways. PKCs are a family of serine/threonine kinases that are critical for signal transduction pathways involved in growth, differentiation and cell death. Zinc is found in the regulatory domain of PKC isoforms, where it is thought to influence the activity and translocation of PKC. HGF is also known to be a scatter factor, which increases the motility of a variety of cell types. HGF is produced by several tissues, including neoplasms; it can therefore provide a stimulus for increased motility of malignant cells. It has been reported that ZIP6 expression is related to metastasis to lymph nodes in breast cancer ( 97 ) ZIP6 is a downstream target for STAT3. The mechanism of ZIP6 involvement to breast cancer metastasis through e cadherin regulation is also reported ( 98 ) It was shown that silencing of ZIP6 caused down regulation of e cadherin while overexpression caused up regulation HGF signaling may induce signaling f or hepatocytes to gain mobility to reestablish original liver architecture during regeneration. Therefore, ZIP6 may have role in liver regeneration through regulation of hepatocyte cell motility. In conclusion al l observations discussed above led to the hy pothesis that zinc and one or more zinc transporters may have an important role in liver regeneration. To investigate this hypothesis, three specific aims were proposed in this dissertation project: Determination of changes in zinc transporter expression a nd which of those are zinc responsive during liver regeneration Exploration a role for zinc in the HGF pathway during hepatocyte proliferation

PAGE 32

32 Delineation of a specific role and regulation of ZIP14 during hepatocyte proliferation

PAGE 33

33 CHAPTER 2 MATERIAL A ND METHODS Animals Young adult (8 12 weeks) male C57BL / 6 strain mice were purchased from Charles Riv er Breeding Laboratories. Zip14 /+ and Zip14 +/+ mice were purchased from Mutant Mouse Regional Resource Center (MMRRC) Un iversity of California, Davis. A t argeted mutation in Zip14 gene ( exons 3 through 5) was generated in strain 129/SvEvBrd derived embryonic stem cells. The chimeric mice were bred to C57BL/6J a lbino mice to generate F1 Zip14 /+ mice. Zip14 / mice were obtained through further breeding of f ounder Zip14 /+ mice in the Genetic and Cancer Research Complex ( GCRC ) animal facility, University of Florida. Mice were given free access to tap water and received commercial rodent diets [Harlan Teklad 7912 030811M ] with a 12 h our light dark cycle. Proto cols were approved by the University of Florida Institutional Animal Care and Use Committee. The design of mice experiments in this dissertation project were composed of different dietary treatments and PHx Dietary treatments were low zinc (ZnD, <0.5 mg Zn/kg diet ), zinc adequate (ZnA, 30 mg Zn/kg diet ) and high zinc (ZnH, 180 mg Zn/kg diet ). In the first set of experiments mice were fed with ZnA diet for 4 days then underwent either PHx or a sham operation under anesthesia. Mice were sacrificed over a 4 8 h ou r s time course post PHx to collect blood and tissue. In the second set of experiments, after 4 days of acclimation with ZnA diet, mice were randomly assigned to be fed ZnA, ZnD or ZnH diets for a week then unde rwent PHx or a sham operation. Mice wer e sacrificed at 24 h our post PHx to collect blood and tissue. Five mice for the surgery and three mice for sham operations were used in all experiments. Mice were anesthetized by isoflurane inhalation for surgery, postoperative

PAGE 34

34 blood/tissue collection and euthanasia. The flow of 3 % isoflurane was at the rate of 2 L/min ( 99 ). Maintenance anesthesia dur ing surgery was achieved with 2 % isoflurane at the same flow rate. Genotyping Genomic DNA was extracted from mouse tail samples by using ZyGem PrepGEM kit. W ater (89 l), 10x Buffer GOLD (10 l) and prep GEM (1 l) were added to the tail sample. Mixture was incubated at 75C for 15 minutes and at 95C for 5 minutes. DNA containing supernatants were collected and used as a template in polymerase chain reaction ( PCR ) reactions. Two sets of primers were used F irst set was s pecifically design to amplify 164 bp wild type ( WT ) TCATGGACCGCTATGGAAAG sense primer GTGTCCAGCGGTATCAACAGAGAG A s econd set was specifically design ed to amplify 469 bp mutant DNA (sense primer TGCCTGGCACATAGAATGC GCAGCGCATCGCCTTCTATC for PCR amplifications and products were visualized in a 1.5% agarose gel. DNA that was only amplified by WT specific primers were WT mice, DNA that was only amplified by mutant specific primers were knockout ( KO ) and DNA that was amplified by both WT and mutant specific primers were heterozygous ( HET ) Partial Hepatectomy A rat partial hepatectomy method ( 100 ) was modified for the mouse PHx (99, 101 ) After appropriate steril ization of the surgery site, a 1.5 cm long, upper midline incision in the skin was made Once adequate exposure of the liver was obtained, partial resection of the liver was performed b y excisions of the left and medi an lobe by 5 0 vicryl sutures After excisions, the peritoneum was reapproximated with 5 0 vicryl

PAGE 35

35 suture s and skin was closed with 4 0 nylon suture s B uprenorphine (0.1mg/kg) analgesic, in sterile saline was injected subcut aneously. According to the design of experiments blood and tissue were collected either in a 48 h ou r s time course or at 24 h ou r s post PHx. Cell Culture and T reatments AML12 hepatocyte cell line (American Type Culture Collection, CRL 2254) was established f rom hepatocyte regulates normal growth in epithelial tissues through binding to the EGFRs. Therefore at serum starvation and for subsequent steps media was s upplemented with 100 ng/ml EGFR inhibitor (C albiochem). Expressio n of liver specific proteins decreases with time in culture. Thus AML12 hepatocytes were used only in the first ten passages. AML12 hepatocytes were maintained at 37C in 5% CO2 in DMEM/F 12 containing 10% (v/v) FBS, 40 ng/mL dexamethasone, ITS (insulin, transferrin, selenium) supplement (BD Biosciences) and penicillin, streptomycin (Cellgro). Before the treatments, AML12 hepatocytes were always serum starved for 20 hours. After serum starvation, AML12 hepatocytes were either pretreated with a combination of pyrithione and zinc or conditioned media that was collected from RAW264.7 mouse macrophage supernatants then HGF (Imgenex) f or either 30 minutes or 48 hour time period RAW264.7 mouse macrophages (American Type Culture Collection, TIB 71) were maintain ed 37C in 5% CO2 in DMEM containing 10% (v/v) FBS. Macrophage Conditioned Medium RAW 264.7 cells were frozen from the same passage in multiple vials (3x10 6 cell/vial). For each experiment a vial of cells was thawed and treatments and media collection were always conducted at the second passages. RAW264.7 cells were

PAGE 36

36 seeded at the density of 3 x10 6 cells /15 cm 2 plate and after 48 hours cells were incubated with either 20 g/ml LPS (Sigma) or without any supplement as a control for two hours. Supernatants wer e collected from both and mixed in 1:1 ratio with the medium usually used for hepatocytes. Supernatants that were collected from LPS treate d and control macrophages were denot ed as LPS CM and CM, respectively. AML12 hepatocytes were treated with either t hese mixtures or mixtures supplemented with 20 ng/ml IL6 (Prospec) for 2 to 4 hours. Interleukin 6 Enzyme Linked Immunosorbent Assay instructions for the enzyme linked immunosorbent a ss ay ( ELISA ) kit (eBioscience). Supernatants were obtained from LPS treated and control RAW264.7 cells. IL6 standards were provided with the kit and ranged between 0 250 pg/ml. Plates were coated with capturing antibody overnight at 4C. Blocking and detecti on antibo dy incubations with samples followed. Absorbances were read at 450 nm (Molecular Devices) after Avidin Horse Radish Peroxidase ( HRP ) and substrate incubations. Measurement of S erum and C ell/ Tissue Zinc C oncentration The blood was collected by ca rdiac puncture under anesthesia. Serum was obtained by a two stage centrifugation at 2000 x g for 10 min utes These serums were used for serum zinc and ALT measurements. Liver tissue was collected (~50mg) and digested in 2 ml HNO 3 for 3 h ours at 90C. AML1 2 hepatocytes were washed with wash buffer [ 0.9% sodium chloride ( NaCl ) 10 mM ethylenediaminetetraacetic a cid ( EDTA ) and 10 mM N 2 Hydroxyethylpiperazine N' 2 Ethanesulfonic Acid ( HEPES )] twice and scraped into the iced cold phosphate buffered s aline ( PBS ) Cells were centrifuged at 3000 rpm for 5 minutes then cell pellets were digested in 200 l HNO 3 for 2 h ours at

PAGE 37

37 80C. Serum, liver tissue and AML12 hepatocyte cellular zinc concentrations were measured by flame atomic absorption spectro photo metry (AAS). Absorbance values for tissue and cellular zinc were normalized to the wet tissue weight and total protein concentration measured by RC / DC assay (BioRad ), respectively. This method allowed us to obtain g zinc in gram protein/wet tissue. Alanine Amino Tran sferase Assay Serum alanine amino t ransferase ( ALT ) measurements were used for the assessment of liver health status of the mi ce following PHx or sham operations. S erum ALT levels were measured by a colorimetric end poin t method that is modified from World Health O rganization standard operating procedures for clinical chemistry. ALT is responsible for transfer of an amino group from alanine to an keto glutaric acid. The products that are produced by this reaction are glutamate and pyruvate. Therefore pyru vate standards were prepared in phosphate buffer (50 mM Na 2 HPO 4 2H 2 O, 16 mM KH 2 PO 4 at PH: 7.4) and used for formation of the standard curve. An a lanine substrate solution [ (1M DL alanine, 10 mM keto glutarate and 5 mM sodium hydroxide ( NaOH) ] was prepare d in phosphate buffer. The a lanine substrate and serum samples were incubated at 37C for 30 minutes. 2, 4 Dinitrophenylhydrazine ( DNPH ) [ (1 mM 2, 4 DNPH in hot 1 M hydrochloric a cid ( HCl) ] was added and incubated in room temperature for 20 minutes for the formation of hydrazone from the ketoacids. The r eaction was stopped with 0.4 M NaOH and absorbance was read at 510 nm (Molecular Devices) RNA Isolation and Quantitative Real Time Polymerase Chain Reaction At certain time points during post PHx or sha m operations, liver tissues were collected in RN ase Later (Ambion) and homogenized (Polytron Brinckman Instruments)

PAGE 38

38 in TriZol reagent (Ambion). Cells were harvested after indicated treatment conditions (above) in TriZol reagent as well. After total RNA iso lation, to protect against residual DNA contamination, all RNA samples were treated with Turbo DNA free reagents (Ambion) as described by the manufacturer. The total RNA concentrations were measured by optical density at 260 nm (Nanodrop) and then samples were diluted to a 2 l of the diluted sample was used. The primer/probe sequ ences are provided in Table 2 1, 2 2, 2 3. All the primers and probes were used at 900 and 250 nM, respectively. RNA reaction mixtures were incubated at 48C for 30 min utes followed by 95C for 15 min utes and amplification of 40 cycles at 95C for 15 s, and then 60C for 60 s. All assays were conducted as one step reverse transcriptase reactions (Applied Biosystems), with fluoresc ence measured with Applied Biosystems instruments. Relative quantitation for all assays used tata binding protein ( TBP ) mRNA as the normalizer. Zinc Transporter Antibodies Polyclonal rab bit antibodies against ZIP6, ZIP14 and ZnT8 were raised to the peptide s listed in the Table 2 4 Each was synthesized (Biosynthesi s) with an additional N terminal cysteine to facilitate conjugation to maleimide activated keyhole limpet hemocyanin (Pierce). The conjugated peptides were used to produce polyclonal antibodies in rabbits and IgG fractions were affinity purified (Pierce). Immunoblotting Liver tissue samples were flash frozen in liquid nitrogen at collection. Frozen liver tissues are homogenized in r adioimmunoprecipitation assay ( RIPA ) lysis buffer (Santa Cruz) con tain ing, protease inhibitor cocktail (Santa Cruz), phosphatase inhibitor (Santa Cruz) and p henylmethane sulfonyl f luoride ( PMSF ) (Santa Cruz) and incubated on ice

PAGE 39

39 for 15 minutes. Following indicated treatments (above), AML12 hepatocytes were washed and har vested into iced cold PBS that contained protease inhibitors (Roche). Cells were centrifuged at 3000 rpm for 5 minutes at 4 C and cell pellets are resuspended with iced cold lysis buffer (20mM Tris HCl pH:8, 137 mM NaCl, 10% glycerol, 1% Trit on X 100 and 2mM EDTA) containing protease inhibitor, pho s phatase inhibitor and PMSF. To remove tissue and cell debris, lysates were centrifuged at 400 x g and 14,000 x g for 10 minutes at 4C respectively. Upper fractions were transferred to the new tubes and total p rotein concentrations were m easured by RC/DC assay kit (BioR ad). Depending on the protein abundance either 25 or 40 mg total protein was denaturated in a 6 x sample buffer (350 mM Tris, pH6.8, 600 mM dithiothreito l ( DTT ) 10% sodium dodecyl sulfate ( SDS ) 0.012% Bromophenol blue and 30 % Glycerol) for 5 minutes at 90 C. Denaturated proteins were separated by either 10% or 12% sodium dodecyl sulfate polyacrylamide gel e lectrophoresis ( SDS PAGE ) based on to be evaluated size. Proteins were transferred to the nitr ocellulose membrane (Whatman) overnight at 30 volt s Protein transfer was confirmed by Ponceau Red staining (0.25% Ponceau stain red, 40% Methanol and 15% Glacial acetic acid). Next, mem branes were blocked with 5% non fat dry milk in TBS T for an hour on an orbit al shaker at room temperature. Time, antibody diluents and wash buffers were different for the prima ry antibody incubati ons and are listed in the Table 2 5 Membranes were then incubated with either anti rabbit (GE Healtcare) or anti mouse IgG ( GE Healthcare) secondary antibody (1/2000 dilution of an antibody in 5% non fat dry milk in tris buffered saline with t ween ( TBS T ) ) conjugated to horseradish peroxidase for one hour at room

PAGE 40

40 temperature. After three washes with TBS T for 5 minutes each, im munoreactivity was visualized by enhanced chemiluminesc ence (Thermo Scientific) and X ray film. Bromodeoxyuridine Assay A b romodeoxyuridine ( BrDU ) assay was conducted after AML12 hepatocytes were subjected to three d ifferent treatment conditions For the first two conditions, AML12 hepatocytes were seeded at the density of 2x 10 4 cell/ml in 96 well plate s (200l/well). After 24 hours of incubation cells were serum starved for 20 hours and pretreated with either 50 M p and 8 M ZnSO 4 for 30 minutes or macr ophage conditioned media for 2 hours. Cells were wa shed with wash buffer twice then 40 ng/ml HGF was added. For Zip14 overexpression AML12 hepatocytes were reverse transfected with pCMV SportZip14 vector by using Effectene transfection reagent (QIAGEN) (s ee Zip14 overexpression section). After 48 hours cells were serum starved for 20 hours then 40 ng/ml HGF was added. A B rDU cell proliferation assay (Calbiochem) protocol was followed thereafter. BrDU was added at the last 20 hours of incubation. Following fixation cells were incubated with anti BrDU primary antibody and peroxidase goat anti mouse secondary antibody. Color formation was obtained by addition of substrate and absorbance was measured at 450 nm (Molecular Devices) Tyrosine Protein P hosphatase 1B Assay AML12 hepatocytes were seeded at the density of 2x10 5 cell/ml and after a 24 hour incubation they were serum starved for 20 hours. Cells were either treated with 50 M pyrithione and Zn Ac etate at different concentrations for 30 minutes or macroph age conditioned medium for 2 hours. The nonspecific phosphatase inhibitor Sodium Orthovanadate (Na 3 VO 4 ) (Sigma) and p rotein tyrosine phosphatase 1B ( PTP1B ) specific inhibitors (Calbiochem, Cat# 539741), (Santa Cruz, Cat# sc 221378) were

PAGE 41

41 incl uded as positiv e controls. Next cells were washed with the w ash buffer twice and harvested in to iced cold PBS that was supplemented with protease inhibitor cocktail (Roche). Cell pellets were obtained by centrifugation at 3000 rpm for 5 minutes. Membrane proteins were is protocol for membrane protein extraction (BioVision). Briefly, cells were homogenized with a D ounce hom ogenizer using iced cold homogenizing buffer supplemented with protease inhibitor cocktail (BioVisi on). Membrane protein pe llets were obtained through a two step centrifugation at 700 x g for 10 min utes and at 10000 x g for 30 minutes. Pellets were dissolved in 20 l of 20 mM HEPES buffer that wa s supplemented with protease inhibitor cocktail (Roche). A 10 l lysate was incubated with phosphopeptide substrate [ELEF pY MDYE NH 2 ] (AnaS pec) in the 50 l final r eaction volume for 30 minutes at 30 C. Inorganic phosphate rele ase was measured using a colorimetric phosphate assay kit (Biovision). Briefly, phosph ate solution was added and after 30 minutes absorbance was measured at 650 nm in a plate reader (Molecular Devices) Total protein concentrations were m easured by RC/DC assay kit (BioR ad) and used as a normalizer. Zip14 Overexpression AML12 hepatocytes wer e reverse transfected with pCMV SportZip14 vector by using Effectene transfection reagent (QIAGEN). The protocol wa s modified from a 293 cell reverse transfection. Cells were plated at the density of 9.4 x 10 5 cell/ml at the same time of tran s fection. DNA ( 1 g ) was used for the pCMV SportZip14 and the empty control vector transfection Total transfecti on time was 96 hours and all secondary treatments were conducted between 24 96 hours of transfection. In the serum free treat ments medium was supplemented with 4 M zinc.

PAGE 42

42 Deoxyribonucleic A cid Pull Down Assay Hepatic n uclear extracts were prepared from both partially hepatectomized and sham operated m ice by using NE PER nuclear extraction kit (Thermo Scientific) Briefly, after washing with PBS supplemented with protease and phosphatase inhibitors, liver tissue was homogenized in CER I buffer and incub ated on ice for 10 minutes. After addition of CER II buffer a pellet was obtained by centrifugation at 16000xg for 5 minutes, and dissolved in NER buffer. Following multiple vortexing steps, lysates were centrifuged at 16000xg for 10 minutes Supernatants (nuclear extract) were collected and used in DNA binding experiments. The Zip14 promoter region (2 kb) was amplified biotinylated primers. Amplified DNA was further purified by using a PCR purification kit (Invitrogen). Purified PCR DNA was incubated with hepatic nuclear extracts and DNA bound proteins were isolated by using magnetically labeled streptavidin beads (Dyna beads from Invitrogen) DNA bound proteins were separated on SDS PAGE and bands were visualized by silver staining (Invitrogen)

PAGE 43

43 Table 2 1 Z IP transporter primer/probe sequences Transporter Sequence Zip1 Forward TCCTCAAGGTCATTCTGCTCCTA Reverse CCCTTTCTCTTGAAGCACCTTAGA Probe FAM CTGCTCACTGGCCTTCTCTTTGTCCAA BHQ1 Zip2 Forward CTGCTTGCTCTTCTGGTTCTCA Reverse GACCTGTAGCTGCATCCATCTG Probe FAM ACTGGGCTGTGGCCTTACTCCCATCTAC BHQ1 Zip3 Forward CTGGGCTACGCCGTTCTG Re verse GGGACGTGCTCTGTGTCCTT Probe FAM CTTTCTCAAGTGGTGAGCCCTGAATCCC BHQ1 Zip4 Forward CTCTGCAGCTGGCACCAA Reverse CACCAAGTCTGAACGAGAGCTTT Probe FAM CAATCTCCGACAGTCCAAACAGACCCAT BHQ1 Zip5 Forward GGGCAGCCTCATGTTTACCA R everse CCACATCAGCCGTCAGGAA Probe FAM CCCTATTGGAGGAGCAGCTAGTGCCC BHQ1 Zip6 Forward GCCACAGCCAGCGCTACT Reverse Probe FAM CGGCGTCCTTCAGCTCCTCTCGA BHQ1 Zip7 Forward AGGCATCAAACACCACCTGG Reverse T GCGGAGATCAGCACTGTG Probe FAM CTGTCACCCTCTGGGCCTACGCACT BHQ1 Zip8 Forward CTAACGGACACATCCACTTCGA Reverse CCCTTCAGACAGGTACATGAGCTT Probe FAM ACTGTCAGCGTTGTATCCCTCCAGGATG BHQ1 Zip9 Forward AAATTCCCGTTTGCTTGGAA Reverse CAGTTTCGAAAGGCGCTTAGG Probe FAM ACCACGCGTTTAAACA BHQ1 Zip10 Forward CGGCAGTCGGTCAGTATGC Reverse AACATGCCGGCAGTGATTG Probe FAM AACAACATCACACTCTGGAT BHQ1 Zip11 Forward CACTGAGTGGAAGGCATCTTTCT Reverse TGAGGTGTTGAAG TTGAGTCTAGTGA Probe FAM TCGAGGCTAACCCCTACTTGTCCCACC BHQ1 Zip12 Forward GGTTGTAAATTTGTCCTGCATGAA Reverse TTGGGCTTGGGTTGTGTTG Probe FAM CCTCCCATTCACCC BHQ1 Zip13 Forward AGGAATGTGAACTGGAAGAATGC Reverse GGTGTCAGCCAAGG GAAATAGT Probe FAM AAGCCATAATCCCC BHQ1 Zip14 Forward GTAAACCTTGAGCTGCACATTAGC Reverse TGCAGCCGCTTCATGGT Probe FAM TGGCCTCACCATCCTGGTATCCGT BHQ1

PAGE 44

44 Table 2 2 Z nT transporter primer/probe sequences Transporter Sequence ZnT1 Forward CACGACTTACCCATTGCTCAAG Reverse CTTTCACCAAGTGTTTGATATCGATT Probe FAM AGTCTGCTCTCATTCTTCTACAAACTGTCCCTAAGC BHQ1 ZnT2 Forward CCGACCAGCCACCAAGAC Reverse TGGAAAGCACGGACAACAAG Probe FAM CGGCTCGATGCCAGCCGAA BHQ1 Zn T3 Forward GGTGGTTGGTGGGTATTTAGCA Reverse CAAGTGGGCGGCATCAGT Probe FAM ACAGCTTGGCCATCAT BHQ1 ZnT4 Forward GCTGAAGCAGAGGAAGGTGAA Reverse TCTCCGATCATGAAAAGCAAGTAG Probe FAM CAGGCTGACCATCGCTGCCGT BHQ1 ZnT5 Forward CTGCTCGGCTTTGGTCATG Reverse CGGCCATACCCATAGGAGGA Probe TTTGCTGCCCTGATGAGCCGC BHQ1 ZnT6 Forward TCCCAGGACTCAGCAGTATCTTC Reverse GCCCCAGCAAGATCAATCAG Probe FAM TGCCCCGCATGAATCCGTTTG BHQ1 ZnT7 Forward CCTCTCTTTCGCT TTTGTGGAA Reverse GTGGAAGGAGTCGGAGATCAAG Probe FAM ACTCTACGGCATCTGGAGCAACTGCCT BHQ1 ZnT8 Forward TGGGTGGTATCGAGCAGAGAT Reverse ACACCAGTCACCACCCAGATG Probe FAM TCGGTGCCCTGCTGTCTGTCCTT BHQ1 ZnT9 Forward GCACTGGGCATCA GCAAAT Reverse GAAAAGCCGTACGGGTGAGA Probe FAM TGTTCAAACACCAGATCC BHQ1 ZnT10 Forward GCACTGGGCATCAGCAAAT Reverse GAAAAGCCGTACGGGTGAGA Probe FAM CTCTGAACTGGAGTGAGC BHQ1

PAGE 45

45 Table 2 3 Other primer/probe sequences Transpo rter Sequence MT Forward GCTGTGCCTGATGTGACGAA Reverse AGGAAGACGCTGGGTTGGT Probe AGCGCTGCCACCACGTGTAAATAGTATCG BHQ1 CD1 Forward AGCCAGCTGCAGTGCTGTAG Reverse CTGGTGGTGCCCGTTTTG Probe FAM CCCAAGTTCCCTAGCAAGCTGCCA B HQ1 PCNAForward GCGCAGAGGGTTGGTAGTTG Reverse CCCGATTCACGATGCAGAA Probe FAM CGCTGTAGGCCTTCGCTGCCG BHQ1 TBP Forward TCTGCGGTCGCGTCATT Reverse GGGTTATCTTCACACACCATGAAA Probe FAM TCTCCGCAGTGCCCAGCATCA B HQ1 Table 2 4 ZIP and ZnT transporter a ntibody sequences Antibody Sequence ZIP6 MIAHAHPQEVYNEY ZIP14 NSELDGKAPGTD ZnT8 CQKPVNKDQCP Table 2 5 List of Antibodies Antibody Company 1Ab Diluent Wash B. Time/Temp. CD1 Santa Cruz 5% milk in TBS T TBS T 2hr/RT PCNA Santa Cruz 5% milk in TBS T TBS T 2hr/RT ZIP6 In house 5% milk in TBS T TBS T O/N/4C ZIP14 In house 5% milk in TBS T TBS T O/N/4C ZnT7 In house 5% milk in TBS T TBS T O/N/4C ZnT8 In house 5% milk in TBS T TBS T O/N/4C c Met Upstate 5% milk in TBS Water O/N/4C pc Met Cell S ignaling 5% BSA in TBS T TBS T O/N/4C ERK1/2 Cell Signaling 5% BSA in TBS T TBS T O/N/4C pERK1/2 Cell Signaling 5% BSA in TBS T TBS T O/N/4C e lf4E Cell Signaling 5% BSA in T BS T TBS T O/N/4C Actin Sigma 5% milk in TBS T TBS T 1hr/RT Tubulin Abcam 5% milk in TBS T TBS T 1hr/RT

PAGE 46

46 CHAPTER 3 ZINC ENHANCES LIVER REGENERATION Introduct ory Remarks The liver is the largest internal organ in the human body, and it has many important functions in metabolic homeostasis. Among these one of the most important functions is metabolism and clearance of xenobiotics. The liver receives 80% of its blood directly from the small and most of the large intestine, spleen and pancreas thro ugh the portal vein while 20% of oxygenated blood is received through the hepatic artery. Because most of the liver blood supply is received via the portal vein, the liver is in the first line to be injured by ingested toxins. These toxins may cause acute or chronic liver injury depending on their persistence. In acute liver injury after elimination of the injurious agent the liver recovers lost mass without jeopardizing viability of the entire organism because of its unique ability to regenerate with hig h capacity ( 102 ) If acu te liver injury is continuous over an extended period of time it causes chronic liver injury. Progressive fibrosis is the hallmark of chronic liver injury; it can eventually result in cirrhosis, liver failure, or hepatic carcinoma. Fibrosis is pr edominantly viewed as a repercussion of the wound healing response that occurs after persistent liver injury. Recent studies suggest that early stage liver fibrosis is a reversible process ( 103 ) Thus new therapeutic approaches are mostly concentrated on drugs that can reverse fibrosis. Along with this new approach it is also recognized that enhancing regeneration capacity of the healthy part of the liver is an important component. By contrast cirrhosis or hepatic carcinoma is not a reversible process and is very difficult to treat. Until recent application of split liver transplantation and live related donor transplantation, whole liver transplantation was the only effective therapy

PAGE 47

47 available for these conditions. Split liver transplantation and live related donor transplantation have a common approach that takes advantage of regenerative capacity of the liver. After removal of the certain part of the recipient liver, a graft will be transplan ted. While a healthy graft would support the maintaining of liver functions, the liver reaches the original mass by regeneration ( 104 106 ) Effective regeneration is also important for the donor in live related donor transplantation. Given the fact that recipient livers are generally severely damaged their capacity for regeneration is lessened. Thus therapeutic approaches for the enhancement of regene ration are required. To develop such therapies a better understanding of the regeneration cascade is required. Zinc may be a factor upon which to develop new therapies. Zinc deficiency is one of the parameters that has been observed in people who suffer fr om acute and chronic liver disease and hepatocellular carcinoma ( 107 ) Zinc has been used in few clinical trials during the treatment of patients with chronic liver in jury and hepatocellular carcinoma ( 108 113 ) Result s from these studies showed that zinc enhances patient responsiveness to treatment and also decreases mortality. However, since these data are mostly obtained by testing liver enzymes it is not possible to delineate the exact function of zinc in the therap eutic process. Consequently, further investigation of zinc metabolism and function during these pathophysiologic states are needed. Zinc participates in a wide variety of cellular processes as a cofactor for many enzymes and influences gene expression thr ough transcription factors. Zinc may also affect mitogenic hormonal signal pathways that specifically direct cell proliferation. Zinc is present in the cell nucleus, nucleolus and chromosomes, and zinc stabilizes the structure of DNA, RNA and ribosomes ( 114 ) Numerous enzymes associated with RNA

PAGE 48

48 synthesis are also zinc metalloenzymes, including RNA polymerase. Proliferation of hepatocytes is the main event in liver regeneration. Since zinc is highly involved in proliferation at different steps it might be an important component of liver regeneration. Proliferative effect of zinc was reported in adult stem cells in the brain ( 115 ). Adult stem cells in the human brain have the capacity to undergo neurogenesis ( 116 ). When rats were fed with ZnD diet or NT2 cell line (human teratocarcinoma) was treated with Tetrakis (2 pyridylmethyl) Ethylenediamine ( TPEN ) a significant decrease in proliferation was detected by either Ki7 staining or BrDU incorporation, respectively. Zinc was shown to be stimula ting cell proliferation, differentiation and protein synthesis in pre osteoblas tic cells ( 117, 118 ). Differentiation of pre osteoblastic cells to osteoblastic cells consists of many steps. The first step is proliferation of pre osteoblastic cells until the y reach the cell number that expression of the osteogenic phenotype starts. In pre osteoblastic cell line, MC3T3 E1 proliferation was increased by time in a zinc concentration dependent manner as it was shown by a m ethylthiazol t etrazolium ( MTT ) prolifera tion assay ( 119 ). A m ore relevant study to zinc and LR was reported by Kang et. al. ( 120 ). In this study, LR in mice was induced by long term ethanol administration. During ethanol administration mice were further divided into two groups as control and zinc supplemented. Liver regeneration was assessed by immunohistochemical staining of p roliferating c ell n uclear a ntigen ( PCNA ) and BrDU incorparation. Results revealed much higher staining for both proliferation markers PCNA and BrDU, in the liver of the zin c supplemented group when compare to liver of the control group. They also showed

PAGE 49

49 lower serum ALT detection in zinc supplemented group of mice. Lower ALT detection in the zinc supplemented group agrees with the clinical trials in which zinc supplementatio n was used for the treatment of liver diseases. Z inc may enhance proliferation by influencing cytokine/growth factor signaling pathways. For instance enhanced proliferation in the T cells in response to interleukin 2 ( IL2 ) stimulation was shown ( 121 ). Aft er stimulation with IL2, cytosolic zinc was increased as a result of mobilizatio n of labile zinc from lysosomes to cytoplasm of T cells of the CTLL 2 line measured by zinc selective fluorescent probe FluoZin 3 An increase in cytosolic zinc caused an enh anced phosphorylation of extracellular signal related kinases ( ERK1/2 ) Enhanced ERK1/2 phosphorylation was not present when TPEN treatment wa s applied along with IL2. Since ERK1/2 was involved in proliferation and cell survival in response to IL2 ( 122 ), t hey measured proliferation. Result s showed a dose dependent inhibitory effect of zinc chelater, TPEN on T cells. Besides showing a necessity for the presence of zinc for proliferation related cytokine pathway this study sugge sts zinc transporter involve s to the mobilization of zinc from lysosomes to cytoplasm where zinc is needed In fact Aydemir et. al. previously showed the mobilization of zinc from lysosomes to cytoplasm was facilitated by the zinc transporter Zip8 in primary human T cells, when T c ells were activated through T cell receptor ( 76 ) Zinc homeostasis in cells is maintained through a tight regulation of zinc influx, efflux, and distribution to intracellular organelles ( 73, 74 ) Zinc transporter proteins are essential for th ese metabolic and functional adjustments. It has been shown in many cell systems that these transporters function in a tissue specific manner. Their localization also may differ in different tissue/cell systems and in response to specific

PAGE 50

50 stimuli Moreover for specific metabolic or cellular events different zinc transporter(s) might be needed to maintain zinc homeostasis. This need may be enhanced during pathophysiologic events. Thus determination of the chang es in zinc transporters during the liver regen eration process may provide a better understanding on the action of zinc within the context of cellular proliferation and organ growth. Therefore, I aimed in this chapter to examine if zinc enhances liver regeneration and if any transporter is differential ly expressed during the regeneration process using an in vivo PHx model and an in vitro AML12 hepatocyte cell line. Results Hepatic Zinc I ncrease s in R esponse to Partial Hepatectomy A 70% PHx causes remnant liver cells to proliferate until the original ti ssue mass is restored ( 10 123 ) Liv er hepatocytes are the first cell s that enter the G1 phase of the cell cycle ( 10 ). Hepatocyte proliferation peaks between 24 t o 48 hours depending on the mouse strain ( 124 ) There fore, I concentrated on first the 48 hour s post PHx. The e xpression of CD1 as a G1 phas e and PCNA as an S phase marker of two stages of cell cycle were measured Both CD1 and P CNA mRNA and protein expression were increased in a sequential manner after PHx (Figure 3 1B ). These result s confirmed th at the PHx s urgeries conducted in our lab are working properly to study liver regeneration. Liver is among those tissues that have a fast exchangeable zinc pool. A n increase in liver zinc concentration s in response to PHx have been report ed ( 125 ). These me asurements were analyzed at the earliest time point, a t 24 hours post PHx. However, I hypothesized that change s in liver zinc concentration might start earlier since zinc might be involve d in hepatocyte proliferation. Therefore, at the same time points o f CD1 and PCNA measurements, I also meas ured the total zinc concentration in

PAGE 51

51 serum and liver tissue by AAS. There were significant decreases in serum and an increase in liver zinc concentrations peaking at 10 hours post PHx (Figure 3 2). For further confi rmation zinc regulated gene metallothionein ( MT ) mRNA in liver tissue samples was measured. My result showed that MT mRNA was significantly up regulated at 10 hours post PHx (Figure 3 2) These results suggest that zinc might be a requir ed factor for the LR process. Zinc T ransporters are D ifferentially E xpress ed in R esponse to P artial Hepatectomy Changes in liver zinc content in response to PHx suggest that zinc transporters might have a role in the LR process. Since major changes in serum and liver tissue zinc concentrations were observed a t 10h post PHx differential expression of ZIP and ZnT zinc transporters were measured at the same time point (Figure 3 3 ). Zip1, Zip3, Zip6, Zip7, Zip10, Zip14 ZnT7 and ZnT8 were up regulated while Zip8 was the only t ransporter that was down regulated Among all the ZIP transporters, Zip6 and Zip14 had the most significant increase (p<0.001) in comparison to the sham control. Therefore, Zip6, Zip14 ZnT7 and ZnT8 mRNA and protein expressions in the 0 48 hour time perio d were measured by quantitative real time PCR ( qPCR ) and western blot, respectively (Fig ure 3 4, 3 5). All of up regulated transporters had the highest expression at 10 hour post PHx. We have previously reported that Zip14 is an IL6 regulated gene ( 82 ) Si nce LR process also start s with a cytokine (IL6 and TNF ) dependent pathway I hypothesized that Zip14 may play a major role in facilitating zinc mobilization to the hepatocytes. Zip14 up regulation started as early as 2 hours and at 24 hour s expression ha d returned to the same level as sham control (Figure 3 4 ). This

PAGE 52

52 result supported the hypothesis that zinc is required for proliferation at 24 hour post PHx and that is provided mainly by the zinc transporter Zip14. Zinc S upplementation E nhances L iver R ege neration Zinc supplementation has been used in a few clinical trials ( 108 113 ) during the treatment of liver diseases. In these studies, ALT measurements were used for the assessment of liver health status and r esults showed that the zinc supplemented grou p had lower serum ALT levels. A dietary zinc study was conducted t o test the effect of zinc supp lementation in mouse model (Figure 3 6A) At the end of feeding period PHx or sham operations were conducted. At 24 hours post PHx serum and liver tissue wer e collected. First, the changes in serum and hepatic zinc were measured by AAS (Figure 3 6). Serum and hepatic zinc concentration were lower in ZnD fed mice and were higher in ZnH fed mice, in comparison to ZnA fed mice. Next, serum ALT levels were measure d (Figure 3 7). The ZnH fed mice had significantly (p<0.001) lower serum ALT levels than ZnA fed mice suggesting that ZnH fed mice had improved liver function This finding did not specify the function of zinc in the process of proliferation, t hus, a prol iferation marker PCNA, was measure d in liver tissues (Figure 3 8 ). The livers of ZnH fed mice had significantly (p<0.001) higher PCNA mRNA and protein expression in comparison to the livers of ZnA fed mice To further investigate the mechanism in which z inc may play a role in LR, in vitro experiments were conducted with AML12 murine hepatocytes. First, AML12 hepatocytes were treated with 4 and 8 M zinc along with pyrithione After two washes with metal wash buffer (see Material and Methods) hepatocytes w ere treated with 40 ng/ml HGF. Hepatocytes were harvested at 24 and 48 hours, and PCNA mRNA was measured by qPCR (Figure 3 9). In both the 24 and 48 hour time points, a dose

PAGE 53

53 responsive effect of zinc pretreatment was seen in PCNA expression. The effect of zinc on AML12 hepatocyte proliferation was evident; however, a change in intracellular zinc by the pyrithione and zinc treatment needed to be confirmed through subsequent experiments. Therefore, following zinc and pyrithione treatment, total intracellular zinc concentrations were measured by AAS (Figure 3 10A). There was a 3 fold increase (p<0.001) in intracellular zinc concentration assuring that intracellular zinc concentration was increased. Next, the effect of zinc on hepatocyte proliferation was tested by the measurement of PCNA at th e mRNA and protein level (Figure 3 10B). Zinc (8 M ) pretreated hepatocytes had significantly (p<0.001) higher PCNA expression than only HGF treated hepatocytes. Further confirmation of the zinc effect on proliferation was obtained from a BrDU incorporation assay (Figure 3 11A, B). BrDU is a thymidine nucleotide analog and its incorporation into newly synthesized DNA is direct e vidence of DNA replication First, the dose response effect of HGF on AML12 hepatocyte s was tested and shown in Fig ure 3 11A. Next, BrDU incorporation was measured in 8 M zinc, pyrithione pretreated and HGF stim ulated AML12 hepatocytes (Figure 3 11B). The results revealed almost identical patterns of PCN A expression presented in Figure 3 10B, strongly suggesting that hepatocyte proliferation was enhanced by zinc. For a better simulation of the i n vivo initiation step of LR, I constructed a model where conditioned medium obtained from RAW cells were used to treat AML12 hepatocytes (Figure 3 12) LPS tr eatment causes RAW cells to produce cytokines such as IL6 and TNF similar to K upffer cells and innate immune system cells in response to PHx. Production of IL6 by LPS treated RAW cells was co n firmed by qPCR and ELISA (Figure 3 13A, B). Since Zip14 is IL6 regulated gene ( 82 ), Zip14 mRNA was measured

PAGE 54

54 in LPS CM treated AML12 hepato cytes (Figure 3 13C). Zip14 mRNA was 3 fold higher in LPS CM treated AML12 hepatocyte s. Even though this result suggested that RAW cell produced IL6 might induce Zip14 expression, further confirmation was necessary for the IL6 regulation of Zip14. Two approaches were used; IL6 supplementation a nd depletion from LPS CM (Figure 3 14A, B). Recombinant IL6 (20 ng/ml) was added to the LPS CM which enhanced Zip14 expression. For the deple tion of IL6 in the LPS CM, neutralizing IL6 antibody was used. When IL6 was depleted, the LPS CM induced Zip14 increase was diminished to the control level, confirming that IL6 regulated Zip14 up regulation was similar to LR initiation in vivo. This in vi tro model was further tested for expression levels of the MT and Zip1, Zip3, Zip6, Zip7, Zip10, Zip11 ( up regulated ZIP transporters during LR) (Figure 3 15). They were all significantly higher than the control in response to combination of LPS CM and IL6 treatment. To investigate physiological consequences of Zip14 up regulation total zinc and MT expression in AML12 hepatocytes were measured by AAS and qPCR, respectively. MT expression and t otal intr acellular zinc concentration were higher in both LPS CM and a combination of LPS CM and IL6 treated AML12 hepatocytes than CM treated control cells (Figure 3 16B, C) Next, the question was ask ed whether LPS CM pretreatment would affec t the proliferation of AML12 hepatocyte s. To test this possibility after ma crophage CM pretreatment, AML12 hepatocyte s were treated with HGF and PCNA expression was measured. Both mRNA and protein levels of PCNA were significantly higher in cells treated with the LPS CM alone and combined LPS CM and IL6 treated cells (Figure 3

PAGE 55

55 1 7 ). These result s collectively suggest that zinc improved liver function through enhanced proliferation of hepatocytes. Discussion The main findings of this chapter were (i) hepatic zinc concentration increased while serum zinc concentration decreased duri ng LR; (ii) at 10 hours post PHx, among the 14 ZIP transporters Zip1, Zip3, Zip6, Zip7 and Zip14 were up regulated while Zip8 was down regulated ; (iii) at 10 hours post PHx, among the 10 ZnT transporters only ZnT7 and ZnT8 were up regulated ; (iv) the liver was functioning better when mice were fed a ZnH diet; (v) LR was enhanced in the ZnH fed mice; (vi) enhancement in AML12 hepatocyte proliferation in response to HGF treatment was observed when cells were pretreated with either zinc or macrophage conditione d medium. Following PHx all the quiescent hepatocytes enter the G1 phase of the cell cycle ( 10 ) For the compensation of tissue lost due to 70% PHx approximately 1.66 cell divisions are necessary. In the PHx mod el all these events happen in a very synchro nized manner, however ; the proliferation rate changes by species. For instance, the peak time for DNA synthesis is at 24 hours post PHx in the rat while it can change between 36 48 hour postPHx for the mouse (124 ) To detect the most appropriate time for the measurement of hepatocyte proliferation during LR in the mouse, e xpression of CD1 as a G1 phas e marker and PCNA as an S phase marker of two stages of the cell cycle were measured DNA synthesis seemed to start at 24 hours post PHx. Thus, 24 hours post PHx was chosen as the best time to measure changes in proliferation in the following experiments. This decision enabled me to detect even small differences of proliferation between treatment groups before the system reached the maximal rate of proliferati on.

PAGE 56

56 The p riming step of LR resembles an acute phase res ponse during inflammation (10) Hypozincemia is one of the hallmarks of inflammation and redistribution of hepatic zinc during inflammation was reported. Taken together, these observations suggest th at hepa tic zinc may change during LR. A h epatic zinc increase was previously shown during LR at 24 hours postPHx ( 125 ) As it was emphasized above, proliferation of hepatocytes started at 24 hours after PHx suggesting that any change that could potential ly a ffect proliferation should happen earlier than 24 hours post PHx. This idea led to the novel finding that hepatic zinc started to increase as early as 10 hours post PHx and stayed elevated for up to 48 hours. Later time points were not the focus of thi s study. This novel finding is important in terms of the requirement of zinc in early steps of hep atocyte proliferation during LR in the mouse. Expression of zinc transporters was measured in response to PHx Finding an increase in ZIP transporters was exp ected because of the increased hepatic zinc accumulation observed. H igh up regulation in the relative expression of ZnT8 was a most interesting finding E xpression of ZnT8 is highly specific to the insulin producing cells of the pancreatic islets ( 126 ). Intracellular localization of ZnT8 was shown to be in granules that were in close proximity to the plasma membrane. Zinc is required for insulin crystallization and this required zinc transport to the granules is facilitated by ZnT8 ( 126 ) I nsulin is norm ally produced in pancreas and t h ymus However ; in a relatively new study, insulin mRNA and proinsulin positive cells were detected in liver, adipose tissue and bone marrow by RT PCR and immunohistochemistry, re s pectively ( 127 ) An i nsulin injection caused a reversal of liver atrophies and was associated with rapid hepatocyte proliferation ( 10 ) suggesting a role for insulin in the LR process.

PAGE 57

57 Taken together, besides obtaining endocrine insulin liver may produce insulin during LR and required zinc for insu lin crystallization could be transported by ZnT8. The d ietary zinc study revealed that ZnH fed mice had higher PCNA mRNA and protein when compared to ZnA fed mice. Therefore, zinc supplementation became the main focus for the following experiments. All tho ugh not a specific objective of this dissertation project there was a decrease in PCNA expression only in protein level in ZnD fed mice when compared to ZnA fed mice This result could be explained by possible post transcriptional /translational regulatio n of PCNA expression. Even though, PCNA expression is increased in mRNA and protein level in cycling cells ( 128 ), regulation via post t ranslational modi fications such as sumoylation and ubiqutinylation has also been reported ( 129 ) Ubiqutinylation of PCNA is necessary for its degradation Zinc involved control for ubiqutiny lation dependent degradation of the proteins was reported ( 130 ) Collectively, post translational regulation for PCNA in zinc deficient conditions might have caused a decrease in PCNA pr otein level in ZnD fed mice. In an effort to generate an in vitro model for the simulation of the initiation step of LR, macrophage conditioned media was used to pre treat AML12 hepatocytes. Macrophage conditioned media was obtained by an LPS treatment of m urine macrophage cell line, RAW264.7. IL6 was the most important component of macrophage conditioned media because of both its role in priming step of LR and regulatory role on Zip14 expression. The reason for the preference of conditional media over recom binant IL6 treatment was the controversy over the consistency of IL6 effect on hepatocytes proliferation in vitro. Both inhibitory ( 131, 132 ) and enhancing ( 133, 134 and 135 ) effects of IL6 on hepatocyte proliferation were reported. T he reason for thes e

PAGE 58

58 co ntroversies was shown by Sun et.al. ( 136 ) In their experiments, IL6 was added either to the hepatocytes alone or to hepatocytes that were c o cultured with non parenchymal cells. While the addition of IL6 inhibited proliferation in hepatocytes alone it en hanced proliferation in co cultured hepatocytes. These results suggested that the presence of non parenchymal cell s produced components were required for IL6 to have a proliferative effect on hepatocytes. They also showed that the IL6 effect was related to the HGF pathway. When co cultured hepatocytes were pretreated with c Met antibody then IL6 they detected a decrease in hepatocyte proliferation. Therefore, macrophage condition media was used along with HGF in the in vitro model used in my experiments.

PAGE 59

59 Figure 3 1. Proliferation marker change in response to partial hepatectomy (A) Study design for the time course experiment with C57BL6 mice. (B) Liver tissue was collected at the indicated times from partially hepatectomized and sham operated mi ce. RNA and protein were extracted and used for qPCR and western blot analysis for the detection of CD1 and PCNA expression. Values shown are means SD (n=5 for partial hepatectomized group and n=3 for sham operated group).

PAGE 60

60 Figure 3 2. Changes i n hepatic zinc in response to partial hepatectomy (A) Liver tissue was collected at the indicated times from partially hepatectomized and sham operated mice. Total zinc concentrations were measured by AAS. (B) Serum was collected at the indicated times from partially hepatectomized and sham operated mice, and total serum zinc concentrations were measured by AAS. (C) Liver RNA was extracted and used for qPCR to detect expression of MT. Values shown are means SD (n=5 for partial hepatectomized group and n=3 for sham operated group).

PAGE 61

61 Figure 3 3. Differential expression of zinc transporters in response to partial hepatectomy Liver RNA was extracted and used for the measurement of ZIP and ZnT transporter mRNA at 10 hours post PHx. Values shown are mean s SD ( *= P < 0.05 ; **=0.01; ***= P< 0.001). (n=5 for partial hepatectomized group and n=3 for sham operated group).

PAGE 62

62 Figure 3 4. Changes in Zip6 and Zip 14 expression in response to partial hepatectomy Liver tissue was collected at the indicated times f rom partially hepatectomized and sham operated mice. Total RNA and tissue lysates were prepared for qPCR and western blots, respectively. (A) A quantitative PCR. (B) Western blots. Values shown are means SD (n=5 for the partial hepatectomized group and n =3 for the sham operated group).

PAGE 63

63 Figure 3 5. Changes in ZnT7 and ZnT8 express ion in response to partial hepatectomy Liver tissue was collected at the indicated times from partially hepatectomized and sham operated mice. Total RNA and tissue lys ates were prepared for qPCR and western blots, respectively. (A) Quantitative PCR. (B) Western blots. Values shown are means SD (n=5 for the partial hepatectomized group and n=3 for the sham operated group).

PAGE 64

64 Figure 3 6. Changes in hepatic zin c in respo nse to both dietary zinc and partial hepatectomy (A) Experimental design of the dietary zinc study with C57BL/6 mice. (B) Tissue and serum were collected at 24 hours post PHx. After nitric acid digestion, the tissue zinc concentration was measu red by AAS. Serum zinc concentrations were measured by AAS as well. Total liver RNA was extracted and used for the qPCR and normalized to TBP mRNA. Values shown are means SD (n=5 for the partial hepatectomized group and n=3 for the sham operated group).

PAGE 65

65 Figure 3 7. Effect of dietary zinc on liver function after partial hepatectomy (A) Blood was collected at the indicated times from partially hepatectomized and sham operated mice. (B) After 4 days of acclimation, mice were fed with either a ZnA, ZnD or ZnH diet for a week. Next, mice underwent either partial hepatectomy or a sham operation. At 24 hours post PHx blood was collected. Serum was separated by two step centrifugation and used for ALT measurements. Values show n are means SD (n=5 for the partial hepatectomized group and n=3 for the sham operated group).

PAGE 66

66 Figure 3 8. Effect of dietary zinc on liver regeneration After 4 days of acclimation, mice were fed with either a ZnA, ZnD o r ZnH diet for one week. Next, mice underwent either partial hepatectomy or a sham operation. At 24 hours post PHx liver tissue was collected. Total RNA and tissue lysates were prepared to use for qPCR and western blots, respectively. Values shown are mean s SD (n=5 for the partial hepatectomized group and n=3 for the sham operated group).

PAGE 67

67 Figure 3 9. Dose and time dependent effect of zinc treatment on AML12 proliferation in response to hepatocyte growth factor stimulation. Following the 20 hours o f serum starvation, AML12 hepatocytes were pretreated with a combination of pyrithione and different concentrations of zinc for 30 minutes. Next, cells were washed and incubated with 40 ng/ml HGF. At 24 and 48 hours cells were harvested and total RNA was i solated to measure PCNA mRNA by qPCR with normalization to TBP mRNA. Values shown are means SD (n=3)

PAGE 68

68 Figure 3 10. Effect of in vitro zinc treatment on AML12 proliferation in response to hepatocyte growth factor stimulation. (A) Following 20 hours of serum starvation, AML12 hepatocytes were pretreated with a combination of pyrithione and 8 M zinc for 30 minutes. Next, cells were harvested and digested in nitric acid for 2 hours. Total zinc concentrations were measured by AAS. (B) After zinc pretreatment cells were incubated with HGF. At 48 hours cells were harvested, and total RNA and tissue lysates were isolated to measure PCNA mRNA and protein. Values shown are means SD (n=3 )

PAGE 69

69 Figure 3 11. Effect o f in vitro zinc treatment on deoxyribo nucleic acid replication in response to hepatocyte growth factor stimulation. Following the 20 hours of serum starvation, AML12 hepatocytes were stimulated by HGF either immediately (A) or after pretreatment of pyrithione and 8 M zinc (B). At the last 20 hours of the 48 hours of HGF stimulation, BrDU was added. BrDU incorporation to newly synthesized DNA was measured by reading the absorbance at 450nm. Values shown are means SD (n=3 )

PAGE 70

70 Figure 3 12. In vitro simulation of init iation of liver regener ation in vivo. RAW cells were treated by lipopolysaccharide to stimulate cytokine production. After 2 hours, supernatant was collected from control (CM) and LPS treated (LPS CM) cells and used for the treatment of AML12 hepatocytes.

PAGE 71

71 Figure 3 13. Effect of lipopolysaccaride on interleukin 6 production by RAW macrophages and the influence of conditioned medium on Zip14 expression (A) Control or LPS treated RAW cells were harvested and RNA was isolated for the measurement of IL6 mRNA by qPCR with n ormalization to TBP mRNA (B) At the time of harvest, supernatan ts (macrophage conditioned medium; LPS CM ) were collected and used to measure IL6 by ELISA assay (C) AML12 hepatocytes were incubated with macrophage conditioned media for the indicated times. Next, AML12 hepatocytes were harvested, and total RNA was isolated to measure Zip14 mRNA by qPCR. Values shown are means SD (n=3)

PAGE 72

72 Figure 3 14. Effect of macrophage conditioned medium on Zip14 expression. Macrophage conditioned media was obtained fro m either LPS treated or control RAW cells. (A) AML12 hepatocytes were incubated with macrophage conditioned medium for 2 hours. Cells were harvested and total RNA was isolated to measure Zip14 mRNA by qPCR, normalized to TBP mRNA. (B) LPS CM medium was pre incubated with either Rat IgG or IL6 specific antibody for an hour and used for the treatment of AML12 hepatocytes. After 2 hours of incubation, cells were harvested and total RNA was isolated to measure Zip14 mRNA by qPCR. Values shown are means SD (n=3 )

PAGE 73

73 Figure 3 15. Validation of zinc transporter expression pat tern in the in vitro model of liver regeneration initiation. AML12 hepatocytes were treated with either CM/LPS CM alone or in combination with the recombinant IL6 for 2 hours. Next, cells w ere harvested and total RNA was isolated to measure MT and Values shown are means SD (n=3)

PAGE 74

74 Figure 3 16. Effect of Zip14 expression on the intracellular zinc concentration of AML12 hepatocytes. Macrophage cond itioned media was obtained from either LPS treated or control RAW cells. (A) AML12 hepatocytes were incubated with macrophage conditioned media for 2 hours. Cells were harvested, and total RNA and cell lysates were prepared to measure Zip14 mRNA and protei n levels. (B) The same RNA samples were used to measure MT mRNA by qPCR. (C) After nitric acid digestion, total zinc concentrations of AML12 hepatocytes were measured by AAS. Values shown are means SD (n=3 9) Values with a different superscript are stat istically different (P < 0.05 0.001).

PAGE 75

75 Figure 3 17. Effect of macrophage conditioned media on AML12 hepatocyte proliferation. Macrophage conditioned media was obtained from either LPS treated or control RAW cells. (A) AML12 hepatocytes were incub ated with macrophage conditioned media for 2 hours, then washed and stimulated by 40 ng/ml HGF for 48 hours. Cells were harvested, and total RNA and cell lysate were prepared to measure PCNA mRNA and protein levels. Values shown are means SD (n=3) Value s with a different superscript are statistically different (P < 0.05 0.001).

PAGE 76

76 CHAPTER 4 ZINC ENHANCES C MET PHOSPHORYLATION BY INHIBITION OF P ROTEIN TYROSINE PHOSPHATASE 1B Introduct ory Remarks Liver regeneration is a process of compensatory hyperplasia in response to hepatic tissue loss, either from liver injury or from resection, until the original liver mass is restored. LR after PHx is carried out by proliferation of all the existing mature cellular populations, composing the intact organ ( 137 ). These ce ll populations include hepatocytes, biliary epithelial cells, endothelial cells, Kupffer cells and stellate cells. Among these, hepatocytes are the first to proliferate and are a major target for parenchymal regeneration. In normal adult liver, hepatocytes are usually quiescent and only 0.0012 to 0.01% of them undergo mitosis in any given time ( 138 ). However, after 70% PHx, 95% of the hepatocytes in the remnant liver participate in one or two proliferative events to restore the original number of hepatocyte s ( 137 ). To answer the question of what triggers hepatocytes to proliferate after PHx, extensive research h as been conducted in rodent models. In early studies, when isolated hepatocytes were transplanted into extrahepatic sites, these cells enter into DN A synthesis after PHx of the liver in the host ( 139 ). When rats were join ed in pairs through parabiotic circulation, hepatectomy in one member of the pair caused regeneration of the intact liver in the other member ( 140 ). These studies collectively provide d convincing evidence that a mitogenic signal for hepatocytes appeared in the blood during LR. An effort to identify blood borne hepatic mitogens arising during LR l ed to the discovery of the hepatocyte growth factor in 1984 ( 141 ).

PAGE 77

77 HGF is essential for LR HGF or HGF receptor, c Met, KOs are associated with embryonic lethality due in part to arrested hepatic development ( 142 ). Liver specific deletion of c Met caused severe impairment in LR after PHx. (143). HGF is synthesized as a pro HGF consisting of 728 amino acids, and mature HGF is formed by proteolytic cleavage ( 144 ). In mature HGF, cysteine ( Cys ) chain form an interchain bridge. Both the paracrine and endocrine effects of HGF are involved in LR after 70% PHx. The hepatic biomatrix contains a large amount of scattered inactive, pro HGF. Shortly after PHx, the hepatic biomatrix is subject to proteolysis, thus pro HGF is released. Released pro HGF is activated through proteolytic cleavage by uPA. Therefore, the amount of active HGF increases in the liver. Expression of HGF mRNA also increases in hepatic stella te cells, 3 to 6 hours after PHx and lasts for 24 hours. Besides an increased level of HGF in the liver, the plasma concentration of HGF rises, both in humans ( 145 ) and rodents ( 137 ). Previous studies showed that the sources of plasma HGF after PHx were d istant organs such as lungs, kidneys and spleen ( 146 147 ). This endocrine effect of HGF supported the initial idea that hepatocyte proliferation during LR is triggered by blood born mitogen, HGF. However, injection of HGF in normal rats through the portal vein caused only a relatively small number of hepatocytes to show DNA synthesis. This result suggested that hepatocytes in normal liver were not ready to respond to mitogenic signals without priming events that switched them into a responsive state ( 148 ). Priming events include cytokine dependent pathways that are largely responsible for the entry of quiescent hepatocytes into the cell cycle (transition from G 0 to G 1 ) ( 149 ).

PAGE 78

78 e xperiments with knockout mice suggested that TNFR1 and IL6 may be essential for full hepato cyte DNA synthesis during LR was suppressed ( 9 ). Additionally, STAT3, AP1, Myc, and cyclin D1 activation were markedly reduced. Changes, both in DNA synthesis and in cell cycle gene expression, were corrected by an injection of IL6 to the IL6 KO mice. Bes ides their importance on priming of hepatocytes for G 0 to G 1 conversion, regulation of HGF expression for the G 1 to S progression of hepatocytes ( 150 ). HGF acts via binding to the hepatocyte growth factor receptor, c Met, on hepatocytes during LR ( 151 ). The tyrosine kinase receptor c Met is a heterodimer composed of three port ions. The first portion is a jux tamembrane sequence that downregulates kinase activity following phosphorylation of Ser975. The second portion is a catalytic region that positively regulates kinase activity. The third portion is a mul tifunctional docking site at the carboxy terminal domain. HGF binding causes c Met receptor dimerization and trans phosphorylation of two catalytic residues at Tyr1234 and Tyr1235 in the kinase activation domain ( 152 ). The carboxy terminal tail has phospho rylation site at residues Tyr1349 and Tyr1356 ( 152, 153 155 ). These residues Tyr1349 and Tyr1356 when phosphorylated serve as a docking site for the recruitment of many adaptor proteins to

PAGE 79

79 activate downstream signaling pathways. The c Met receptor is also a substrate for the protein tyrosine phosphatases (PTP) ( 156 158 ). Such phosphatases oppose c Met signals by triggering dephosphorylation of tyrosine residues. PTPs are a family of e nzymes all characterized by their sensitivity to vanadate, ability to hyd rolyze p nitrophenylbphosphate, insensitivity to okadaic acid, and lack of metal io n requirement for ca talysis (159 ). PTPs can exert both positive and negative effects on a signaling pathway and play crucial physiological roles in a variety of mammalian ti ssues and cells ( 160 ). A relatively recent evaluation of the human genome suggested that humans have 112 PTPs ( 161 ), which include both the tyrosine specific and dual specific phosphatases. The tyrosine specific PTPs can be further categorized into recepto r like and intracellular. The intracellular PTPs, exemplified by PTP1B, contain a single catalytic domain and various amino or carboxyl terminal extensions. PTP1B contains an endoplasmic reticulum (ER) targeting signal sequence at its carboxyl terminus. Th is targeting signal anchors PTP1B to the cytoplasmic face of the ER ( 162, 163 ). PTP1B biochemically interacts with multiple receptor tyrosine k k inase s ( RTK ) including the insulin, insulin like growth factor (IGF), EGF and platelet derived growth f actor ( ) receptors ( 164 ). Recent studies show that internalization of the EGF and PDGF receptors is required for their localization with PTP1B ( 165 ), supporting a role for PTP1B in the dephosphorylation of internalized RTKs. Research has also shown that the affinity of PTP1B for a substrate containing double tyrosines is 70 fold higher than for a substrate containing single tyrosine ( 166 ). The se obsevations collectively l ed to the idea that c Met double tyrosine residues in the activation domain could be dephosphorylated by

PAGE 80

80 PTP1B. Research has shown in the PTP1B KO mouse model that the phosphorylation state of Tyr 1234/1235 is regulated by PTP1B ( 159 ). In response to HGF, injected via hepatic portal vein, phosphorylation of tyrosines 1234 and 1235 was ele vated in PTP1B KO mice when compared with WT mice. The HGF c Met pathway is essential for LR. Therefore the effect of partial hepatectomy was tested using PTP1B KO mice ( 167 ). BrDU incorporation studies revealed that there was increased liver cell prolife ration in PTP1B KO mice when compared with PTP1B WT mice. The PCNA levels increased after PHx in both genotypes and the magnitude of induction was higher in the absence of PTP1B. Moreover, c Met phosphorylation was enhanced in PTP1B KO mice liver after PHx These data collectively showed that PTP1B is involved in LR process after PHx, as a regulatory factor in the HGF c Met pathway. Phosphatases do not dephosphorylate their substrate continuously. Dephosphorylation is tightly controlled by mechanisms simila r to the ones that control phosphorylation ( 168 ). One of the controlling mechanisms for the regulation of PTP activity is oxidation of the sulfhydryl group of the catalytic cysteine of the enzyme. The PTPs employ a covalent catalysis, utilizing the thiol g roup of the active site cysteine (Cys215 for PTP1B) residue as the attacking nucleophile, to form a thiophosphoryl enzyme intermediate ( 169 ). This active site cysteine residue was particularly important for the discovery of new PTP1B inhibitors, since PTP1 B inhibition has a physiological importance. Liver and muscle from PTP1B KO mice show hyperphosphorylation of the Insulin receptor (IR) upon stimulation with insulin. These mice are resistant to weight

PAGE 81

81 gain caused by a high fat diet ( 170, 171 ), emphasizing the importance of PTP1B as a therapeutic target for the diabetes. Zinc has long been shown to be a PTP inhibitor ( 172 173 ). I n glial C6 cells, increased cellular influx of zinc augments general tyrosine phosphorylation, in particular phosphorylation of th e activating tyrosine residues of the IR and IGF1R ( 174 ). The phosphatase assays that were conducted with specific phosphopeptide substrates showed that zinc specifically inhibited PTP1B activity. Combining the facts that the HGF c Met pathway is essential for LR; c Met kinase domain phosphotyrosils are substrates for PTP1B; and zinc inhibits PTP1B activity, lead to the hypothesis that zinc might be enhancing LR through inhibition of PTP1B resulting in enhanced c Met phosphorylation. Results Zinc I nhibits Protein T yrosine Phosphatase 1B A ctivity It has been shown in PTP1B knockout mice that c Met receptor kinase phosphorylation sites are dephosphorylated by PTP1B ( 158 ) It has also been shown that zinc inhibits PTP1B enzymatic activity in glioma cells resu lting in enhanced phosphorylation of insulin like growth factor receptor ( IGFR ) ( 174 ) IGFR and c Met share a common feature of having two consecutive phosphorylation site s in their kinase domain. Interestingly, PTP1B has a 70 times higher affinity for the double phosphate domains than single phosphate domain ( 158 ). Consequently, I hypothesized that the contribution of zinc to the hepatocyte proliferation might be through inhibition of PTP1B activity during LR. In order to test PTP1B enzymatic activity, an in vitro phosphatase assay was established in the lab. In this assay, after treatments, cell lysates were prepared and were incubated with a phosphopeptide substrate. The phosphate ion

PAGE 82

82 release from the phosphopeptide was measured as an indicator of PTP1B e nzyme activity. The nature of the assay requires no usage of phosphatase inhibitors in the cell lysates, introducing the possibility of preexisting phosphate ion interference. To test whether zinc treatment caused any change in the amount of preexisting ph osphate ion in cell lysates, the first assay was done with the cell lysates containing phosphatase inhibitors to prevent any phosphatase enzyme activity. There was no difference between zinc pretreated and control cell lysates in the amount of phosphate io n (Figure 4 1). After validation of the assay, AML12 hepatocytes were incubated with different concentrations of zinc (2 32 M) and pyrithione, and then total cell lysates and membrane fractions were prepared for the measurement of the phosphate ion releas e from phosphopeptide substrate. Dose dependent inhibition of PTP1B activity by zinc was detected in both total and m embrane fractions (Figure 4 2A ). In the membrane fraction the effect was more pronounced possibly because PTP1B is a membrane bound prot ein. Thus further experiments were conducted with only membrane fractions. PTP1B enzymatic activity was diminished 60% in 8 M zinc pr etreated cells (Figure 4 2B). The a mount of inhibition by zinc was similar to the amount of inhibition by nonspecific NOV and PTP1B specific phosphatase inhibitors (Figure 4 2B ). A 40% decrease in PTP1B activity was detected in LPS CM and IL 6 treated cells, as well (Figure 4 2C ). These results collectiv ely showed that zinc inhibits PTP1B activity Zinc E nhances c Met Phospho rylation The inhibition of PTP1B may result in enhanced c Met phosphorylation. To test this hypothesis zinc/LPS CM and IL6 pretreatment, cells were treated with HGF and the changes in c Met kinase domain phosphorylation were measured by using phospho spec ific antibodies. The results revealed that there was a higher amount of

PAGE 83

83 phosphorylation of c Met in the zinc /LPS CM and IL6 pretreatment conditions in comp arison to their control (Figure 4 3 ). Protein c Met was used as a loading control and there was no c hange in the band intensities between treatment groups. c Met phosphorylation activates many downstream signaling pathways. Among them ERK1/2 was shown to be the main target during LR, since there was no change in ERK1/2 phosphorylation in c Met conditi onal KO mice after PHx. Therefore phosphorylation of ERK1/2 was visualized by western blot s Similar to c Met, ERK1/2 phosphorylatio n was higher in the zinc/LPS CM and IL6 treated conditions (Figure 4 3 ). Protein ERK1/2 was used as a loading control and there was no change in the band intensities between treatment groups. Eukaryotic initiation f actor 4E ( e lf4E ) was used as a loading control, as well. These results further proved the role of zinc in c Met activated hepatocyte proliferation pathway during L R process. Discussion The m ain findings of this chapter ar e that (i) zinc inhibited PTP1B phosphatase activity; (ii) c Met phosphorylation at the active site residues Tyr 1234 and Tyr 1235 were enhanced as a result of PTP1B inhibition; (iii) enhanced c Met activation caused increased phosphorylation in ERK1/2. Phosphatase assays were conducted to evaluate the effect of zinc on PTP1B activity. Total cellular membrane fractions were used as a source of endogenous PTP1B since PTP1B is a membrane bound enzyme. However, this approach did not eliminate the possibility that there could be other tyrosine phosphatases in the lysate. One solution t o solve this issue was the use of a PTP1B specific substrate in phosphatase assays. I used the highly potent ( kcat/Km of 2 .20.05x10 7 M 1 s 1 ) consensus peptide, ELEFpYMDYE as a substrate. This consensus peptide sequence

PAGE 84

84 was obtained from studies that used kinetic ( 175 ), structural ( 176 ) and alanine sc anning ( 177 ) approaches. The peptide corresponds to residues 988 998 in EGFR was used as a substrate in those initial studies These studies collectively showed that PTP1B could accommodate acidic (Glu/Asp), aromatic (Phe/Tyr), and hydrophobic (L eu) residues at the 1 position PTP1B preferred Leu at the 3 and Met at +1 position, and strongly preferred acidic residues (Glu/Asp) at +2 and aromatic residues (Phe/Tyr) at+3 positions. By using this specific peptide as a substrate, specificity of the assay was enhanced. PTP1B inhibition by zinc was further proven by the increased phos phorylation of physiological substrate of PTP1B, c Met kinase domain phosphotyrosils, as a result of zinc pretreatment (Figure 5 3) In this chapter, a dose dependent inhibition of PTP1B activity by zinc was shown. The possible mechanism for the zinc inhib ition of PTP1B could be related to the cysteine residue at in the active site of PTP1B. One of the controlling mechanisms of the PTP1B enzymatic activity is through reversible oxidation of this cysteine residue. Zinc interacts strongly with cysteines of pr otein such as metallothionein ( 178, 179 ). Therefore, zinc may possibly bind to the cysteine residue of PTP1B active site and cause the inactivation of enzymatic activity. This idea was supported by the fact that the inhibitory effect of zinc diminished whe n the reducing reagent, DTT, was included in the reaction (data not shown). DTT increases the redox potential, thus causing PTP1B to return to the active form. Such i nterplay between zinc and redox was shown previously with regard to sequestration and rele ase of zinc ions by cysteine rich metallothioneins ( 180 ).

PAGE 85

85 The inhibition of PTP1B activity caused increased phosphorylation the of c Met receptor at t he kinase domain Downstream of c Met signaling produces activat ion of Ras/ERK/MAPK PI3K/Akt, Rac/Pak, a nd Crk/Rap1 pathways ( 181, 182 ). Among these pathways, phosphorylation of the ERK1/2 was not detected in the regenerating liver of the conditional Met mutant mice ( 143 ) This suggested that c Met signaling contributes dominantly to ERK1/2 activation in the regen erating liver. Therefore, I cho se to investigate ERK1/2 phosphorylation to show the effect of zinc on the downstream signaling of c Met activation. Zinc inhibition of MAPK phosphatases resulted in increased phosphorylation of ERK1/2 in neural cells ( 183 ), raising the possibility that the increase in ERK1/2 phosphory lation could be independent from upstream c Met activation. This possibility was eliminated by further investigation of ERK1/2 phosphorylation in cells treated with zinc (without HGF) In t hese cells, there was no significant change in ERK1/2 phosphorylation between control and zinc pretreated cell preparation (data not shown). Therefore, I concluded that the increase in ERK1/2 phosphorylation was a downstream effect of HGF c Met activation after zinc pretreatment. In summary, a role of zinc appears essential in the HGF c Met pathway in hepatocyte proliferation demonstrated in this dissertation project. Zinc re gulates the HGF c Met pathway during hepatocyte proliferation through inhibition o f PTP1B phosphatase activity.

PAGE 86

86 Figure 4 1. Validation of phosphatase assay. (A) Representative standard curve of the phosphate assay. (B) Total cell lysates were prepared from AML12 hepatocytes after 30 minutes of pyrithione and zinc treatment. Phosphata se inhibitors were added to the lysis buffer, and free phosphate contaminations from the lysate were measured.

PAGE 87

87 Figure 4 2. In hibitory effect of zinc on protein tyrosine phosphatase 1b activity. (A) AML12 hep atocytes were treated with pyrithione and different concentrations of zinc for 30 minutes. Next, cells were harvested and total cell lysate (grey bar) and membrane fractions (black bar) were prepared. Lysates were incubated with phospho substrate and inorg anic phosphate release was measured. AML12 hepatocytes were treated with either prythione and 8 M zinc, along with phosphatase inhibitors for 30 minutes (B) or macrophage conditioned media for 2 hours (C). Next, cells were harvested and the total membrane fraction was used for the phosphatase assay.

PAGE 88

88 Figure 4 3. Effect of zinc on c Met signaling pathway. AML12 hepatocytes were treated with either two different concentrations of zinc or macrophage conditioned medium for 2 hours. Next, cells were harvested and total cell lysates were used for the detection of indicated proteins by western blot.

PAGE 89

89 CHAP TER 5 ZIP14 FACILITATES HE PATIC ZINC UPTAKE DU RING LIVER REGENERATION Introduct ory Remarks The Zip14 gene was first identified in an effort to accumulate inf ormation on the coding sequences of unidentified human genes in 1994 ( 184 ). In the study cDNA clones that carry unreported sequences at the 5 ends were isolated from human cDNA libraries and sizes of their inserts were then compared with those correspond ing transcripts by Northern hybridization. After sequence determination of these inserts, Zip14 was named KIAA0062 a mong 40 newly identified coding sequences. Sequence alignment studies revealed that Zip14 belongs to the LZT (LIV 1 subfamily of zinc tra nsporters) subfamily of the ZIP (ZRT/IRT related protein) transporter family proteins ( 185 ). ZIP transporters are responsible for the control of zinc transport into the cell cytosol and can be divided into four separate subfamilies ( 186 ): subfamily I is ma inly fungal and plant sequences, subfamily II consist s of mammalian, nematode and insect genes, the gufA subfamily is related to the gufA gene of Myxococcus xanthus and LIV 1 subfamily is related to the oestrogen regulated gene, LIV 1 LIV 1 is implicat ed in metastatic breast cancer ( 187 ). Its detection was associated with oestrogen receptor positive breast cancer ( 188 ) and with the metastatic spread of these cancers to the regional lymph nodes ( 189 ). Computer analyses of LIV 1 for secondary structure p rediction revealed that LIV 1 has six to eight transmembrane domains, a long extracellular N terminus, a short extracellular C terminus and numerous histidine rich repeats, relating LIV 1 to the ZIP family of zinc transporters ( 185 ). Multiple alignment ana lyses with an effort to find other members of

PAGE 90

90 LZT subfamily led to the discovery of Zip14, named LZT Hs4 at that time. The alignment analyses also revealed an important conserved motif (HEXPHE) among all the possible LZT proteins that were tested. This m otif localized in the TM domain V, similar to the HXXXE motif in the TM domain V of ZIP proteins. Another important similarity found between ZIP and LZT was a conserved HS motif in TM IV of the ZIP s and a HNF motif in TM IV of LZT proteins. The HS motif in the TM IV and the HXXXE motif in TM V of ZIP proteins a re thought to be part of the intramembrane metal binding site, which forms the pore region. Therefore, these sequence similarities suggested a zinc transport functio n for the LZT subfamily members, wi th one exception being Zip14 since Zip14 had a glutamic acid replacement of the first histidine residue of the conserved HEXPHE motif of LZT proteins. This replacement may allow for the transport of ions other than zinc ( 190 ). In fact, our lab has shown p reviously that Zip14 transports iron in Zip14 overexpressed HEK 293H cells ( 191 ). Cadmium and manganese transport function of Zip14 was also reported in transfected MFF cells ( 192 ). In this study transpo rt efficiency of two transcript variant s was tested. These transcript variants of Zip14 are the result of alternative splicing of either exon 4A or exon 4B. Mouse Zip14 exons 4A and 4B are both 170 bp long and share a 67% nucleotide identity. Transcripts of ZIP14A and ZIP14B encode two different proteins, both having 489 amino acids but dif ferent molecular masses. R esult s showed that Zip14A transfected cells had more efficient cadmium and manganese transport than Zip14B transfected cells. D iffering expression of exons 4A and 4B between normal and tumor samp les was also reported ( 193 ). Even

PAGE 91

91 though there was no difference in total Zip14 expression, the 4A/4B ratio was significantly lower in adenomas and carcinomas when compared to normal tissues. The f irst attempt to show a zinc transport function of Zip14 in transfected CHO cells revealed no change in intracellular zinc, unlike LIV 1(Zip6) transfected CHO cells ( 185 ). However, in later studies from the same research group showed that intracellular zinc concentration was increased in the Zip14 transfected CHO cells when they provided extracellular zinc to the cells ( 1194 ). This finding complies with the plasma membrane localization of Zip14 ( 190 194 and 82 ). The z inc transport ability of the Zip14 transfected cells was temperature dependent, suggesting a car rier mediated transport process. In the same study (Taylor et al. 2005) Zip14 was shown to run as a trimer in an SDS PAGE when reducing conditions were not present. This ability to form complexes is consistent with the formation of ion channels ( 195 ). C oncurrently, the z inc transport function of the mouse counterpart of Zip14 was shown by our lab in the transfected HEK 293H cells in the presence of 10 M extracellular zinc ( 82 ) In the same study the plasma membrane localization of Zip14 was also confirm ed Besides revealing zinc transport function and cell ular localization of Zip14, this study showed for the first time that Zip14 is a cytokine regulated gene. The idea was driven from the fact that hypozincemia was one of the consequences of an acute inf lammatory response ( 196 ). The hypozincemia i s thought to be a part of host defense mechanism. The physiological role of the hypozincemia is not known. Two possibilities are deprivation in the availability of zinc for any pathogenic microorganisms ( 197 ) or the provision of more zinc for cellular needs. During acute inflammation, acute phase proteins are synthesized by the liver. Redistribution of hepatic zinc and increased

PAGE 92

92 hepat ic MT were observed in cytokine injected rats ( 198 ) suggesting that serum zinc d epletion was caused by hepatic zinc uptake during inflammation. To investigate this hypothesis, mice were injected with LPS since it has long been know n that LPS lead s to production of acute phase response proteins in the liver ( 199 ). Hepatic MT levels wer e significantly higher in LPS injected mice in comparison to PBS injected control mice, suggesting hepatic zinc uptake was increased. To delineate which transporters were responsible for hepatic zinc uptake differential expression of ZIP and ZnT transport ers were measured in the liver. The most responsive zinc transporter was found to be Zip14, having a 3.1 fold increase in response to the LPS injection. Even though the LPS injection causes increased production of many acute ph ase response proteins IL6 i s viewed as the main proinflammatory cytokine responsible ( 200 ). Therefore, further experiments were done with IL 6 KO mice. Higher hepatic Zip14 and MT expressions and lower serum zinc were not detected in the IL6 KO mice in response to the LPS injection. These results suggested two important conclusions: Zip14 was an IL6 regulated gene, and Zip14 was the main transporter to facilitate hepatic zinc uptake during inflammation since MT up regulation and serum zinc down regulation were diminished in the IL6 K O mice. C ytokine regulation of Zip14 expression was supported by a recent study i n sheep pulmonary artery endothelial cells (SPAEC) ( 201 ). When SPAEC were treated with LPS a 5 fold increase in Zip14 expression was observed. The initial observations with the cytokine regulation of Zip14 and being the main transporter responsible for the hepatic zinc uptake during an inflammatory response ( 197 ) initiated the hypothesis that Zip14 may have a role in the priming step of the hepatocyte proliferation in LR s ince it is a cytokine dependent process. This idea was

PAGE 93

93 supported by the results that were presented in chapter 3 on Zip14 up regulation in response to PHx. Therefore in this chapter a specific role for Zip14 in the LR process and the regulation of Zip14 e xpression were investigated. Results To investigate a specific role of Zip14 in hepatocyte proliferation, two approaches were taken: Zip14 overexpression and a ZIP14 KO mouse. Overexpressed Zip14 E nhances H epatocyte P roliferation For the overexpression s tudies, AML12 hepatocytes were transiently transfected with either pCMV Sport6 Zip14 or pCMV Sport6 empty vector for 96 hours. Overexpression of Zip14 wa s confirmed by qPCR (p<0.001) and western blot analyses (Figure 5 1B). To test the effect of Zip14 over expression on hepatocyte proliferation, the following treatments were applied during the 96 hours of trans fection: hepatocytes were serum starved for 20 hours starting at 24 hours of transfection, and then hepatocytes were incubated with HGF for 48 hours. At the end of 96 hours, hepatocytes were harvested and PCNA expression was measured. Higher PCNA expression was detected in the ZIP14 overexpressed cells when compare to the empty vector transfected control cells (Fig 5 1C). For the further investigatio n of hepatocyte proliferation, a BrDU incorporation assay was conducted. Results showed significantly higher (p<0.001) BrDU incorporation in ZIP14 overexpressed cells when compare to empty vector transfected control cells (Figure 5 1A). The se results sugge sted that Zip14 overexpression enhanced AML12 hepatocyte proliferation. The p hysiological consequence of Zip14 overexpression was an increased intracellular zinc concentration ( 82 ). With the similar approach that I took in chapter 3, I hypothesized that th e overexpressed Zip14 facilitated an increase in intracellular zinc

PAGE 94

94 that may ha ve a role in PTP1B inhibition of HGF c Met pathway during hepatocyte proliferation. To test this hypothesis after 96 hours of Zip14 transfection hepatocyte s were harvested and membrane fractions were isolated. A phosphatase activity assay was conducted with these membrane fractions and a phosphopeptide substrate. The result showed a 40% decrease in PTP1B activity in the Zip14 overexpressed conditions (Figure 5 2A). With the supp ort of this result I further hypothesized that PTP1B inhibition may cause enhanced phosphorylation of tyrosine residues of the c Met kinase domain. To test this hypothesis, AML12 hepatocytes were incubated with HGF for 30 minutes after the 96 hours transf ection Thereafter, hepatocytes were harvested and proteins were analyzed by SDS PA GE. Enhanced phosphorylations of c Met kinase domain and of ERK1/2 were detected wh en Zip14 was overexpressed (Figure 5 2B). ZIP KO C aused D ecrease in H epatocyte P roliferati on A more concrete approach to test the role of the gene in a specific cellular event is to use a KO mouse model when available. Fortunately, a ZIP14 KO mouse became available during my dissertation research; consequently the contribution of Zip14 to the L R process was investigated directly Genotyping of the mice was conducted with two different sets of primers. Primers were specifically design to amplify either WT or mutant DNA (Figure 5 3). After genotyping, the ZIP14 KO was confirmed at both the protein and mRNA level. Intestine and liver tissues were chosen for the confirmation since these two tissues abundantly express Zip14 ( 194 82 ). Zip14 protein (Figure 5 3A) and mRNA (Figure 5 3B) showed a gradual decrease in the HET and KO mice when compare to W T mice. Next, PHx surgeries were conducted with ZIP14 KO and WT mice. In these sets of experiments, comparisons were made between prePHx and postPHx conditions

PAGE 95

95 instead of between sham and postPHx, because of the limitation in the number of ZIP14 KO mice. For that same reason, female mice were included in this experimental setting as well. There were two female and two male mice in total. At 24 hours postPHx, ZIP14 was up regulated at the mRNA and protein level in WT mice (Figure 5 4A). However, Zip14 was not detectable in either prePHx or postPHx liver (Figure 5 4A). To test the hypothesis that Zip14 might be responsible for the hepatic zinc increase during liver regeneration, MT expression (Figure 5 4B) and the hepatic zinc concentration (Figure 5 4C) we re measured by qPCR and AAS, respectively. A significant increase in hepatic MT expression in response to PHx in the WT mice was observed and that increase was significantly diminished in ZIP14 KO mice. Similar results were obtained from the hepatic zinc m easurement. Total hepatic zinc was significantly (p<0.001) increased in the WT in response to PHx. However, that increase in hepatic zinc was not present in ZIP14 KO mice, strongly suggesting that ZIP14 was the main zinc transporter that facilitates zinc m obilization to the liver during LR. Therefore, I hypothesized that the enhancement of regeneration that was caused by increased hepatic zinc may diminish in ZIP14 KO mice as a result of impairment in hepatic zinc transport. To test this hypothesis, PCNA ex pression was measured in prePHx and at 24 hours postPHX liver tissue. Zip14 mRNA was significantly (p<0.001) increased in WT mice and that increase was significantly diminished (p<0.01) in ZIP14 KO mice (Figure 5 6A). Similar results were observed in the p rotein level of ZIP14. The f emale mice had a 30% and male mice had a 60% decreases in PCNA expression in comparison to the WT mice at 24 hours postPHx (Figure 5 6B). Relative densitometry

PAGE 96

96 values of PCNA that were normalized to the tubulin controls from fou r mice were averaged and presented in Figure 5 6C. Transcriptional R egulation of Zip14 during liver regeneration The si gnificance of Zip14 in LR led to an investigation of the transcriptional regulation of Zip14 during LR. A DNA pull down assay was use d to identify possible transcription factors that regulate Zip14 transcription. In this assay 2 kb of the Zip14 purified afterwards (Figure 5 7A). Purified DNA was incubated with nuclear lysates from either partially hepatectomized or sham operated mice. DNA bound proteins were isolated by magnetic ally labeled streptavidin beads and run in SDS PAGE (Figure 5 7B). Even though there was a difference in the band pattern between hepatec tom ized mice and sh am control, these data are at the preliminary level and needed to be improved in terms of specificity. When conditions are optimized DNA bound proteins will be sent to the mass spectrometry facility for the determination of transcription factors that regu late Zip14 transcription during LR. Discussion The main findings of this chapter were (i) overexpressed Zip14 enhanced liver regeneration via inhibition of PTP1B phosphatase activity; (ii) c Met phosphorylation at the active site residues Tyr 1234 and Ty r 1235 were enhanced in Zip14 transfected hepatocytes; (iii) enhanced c Met activation caused increased phosphorylation in ERK1/2; (iv) ZIP14 KO mice had decreased hepatic zinc after PHx when compare d to WT mice ; (v) ZIP14 KO mice had decreased proliferati on in comparison to WT mice. LPS induction of Zip14 up regulation in SPA EC was reported ( 201 ). In that study they showed that LPS treatment caused the cells to become zinc deficient when

PAGE 97

97 measured by the zinc s elective fluorescent probe, FluoZin 3 The res earchers claimed that in order to compensate for zinc deficiency, Zip14 was up regulated They further supported this claim by showing an up regulation of Zip14 in the TPEN treated zinc deficient SPAEC. Even though hypozinc emia is one of the hallmarks of L R after PHx, there have not been any reports (including this dissertation study) regarding liver tissue zinc deficiency to date. Therefore, I concluded in this dissertation that the Zip14 up regulation was to provide required zinc for proliferation of hepa tocytes rather than compensating for liver tissue zinc deficiency. This conclusion was supported with the data from the dietary zinc study (chapter 3). In this study no change in Zip14 expression was observed between ZnD and ZnA fed mice in either prePHx or postPHx samples (data not shown). However, there was a significant decrease in Zip14 expression in the ZnH fed mice when compared to ZnA fed mice after PHx (data not shown). One of the most important finding s of this chapter is the decreased prolifera tion in ZIP14 KO mice. This decrease possibly resulted from impaired hepatic zinc transport since, unlike WT mice, no increase was observed in hepatic zinc between pre and post hepatectomy samples from ZIP14 KO mice. Additionally, when hepatic zinc concent rations were compared between WT and ZIP14 KO mice before PHx, there was no significant change between the two groups, suggesting that the ZIP14 KO genotype did not cause liver tissue zinc deficiency. This result could be from compensation by other ZIP tra nsporters, since four other transporter s were significantly up regulated during LR (Zip1, Zip3, Zip7, and Zip10 ) besides Zip14.

PAGE 98

98 Ev en though ZIP14 KO did not show zinc deficiency in liver tissue, proliferation was still imp aired, raising the idea that Zip 1 4 may have an additional role in the zinc transport function during LR. One of the possible roles for Zip14 could be related to adipogenesis during LR. Markedly increased hepat ocellular fat was detected at 12 to 24 hours post PHx mice. ( 202 ). To evaluate t he functional significance of hepatic adipogenic changes d uring the regenerative response, in that study the adipogenesis was suppressed either pharmacologically by leptin injection or by using hepatocyte specific glucocorticoid receptor ( GR ) KO mice. Both strategies led to a disruption of adipogenesis. L ess BrDU incorporation was detected after PHx, w hen adipogenesis was disrupted. Interestingly, Zip14 participation in the zi nc uptake during adipogenesis ha s been reported ( 203 ). Zip14 was up regulated in the early stages of adipocyte differentiation in 3T3 L1 cells. The time of Zip14 up regulation (10 hours post PHx) during LR, the time of the hepatocellular fat accumulation during (12 24 hours post PHx) LR and lastly Z ip14 participation in early stages of adipogenesis collectively suggest a role for Zip14 in early adipogenesis during LR. Another possible role for Zip14 in LR could be metallopro tease activity. Hepatic biomatrix degradation by metalloproteases is essential for the initiation of LR. Zip14 bel ongs to the LZT subfamily of the ZIP transporter family of proteins. The LZT subfamily proteins share the conserved HEXPHE motif. This motif is similar to consensus sequence for the catalytic zinc binding site of metalloprateases (HEXXH). In conventional m etalloproteases Zn 2+ co ordinates with two histidines, a water molecule f rom the first glutamic acid, and other residues downstream, depending on the subgroup ( 204 205 ). Even though in Zip14, the first histidine residue was replaced by glutamic

PAGE 99

99 acid resid ue in the conserved motif, there is still possibility for Zip14 to have metalloprotease activity depending on the substrate. Lastly, contribution of Zip14 to the LR process could be related to G protein coupled receptors (GPCR). Concurrently with the prep aration of this dissertation, Zip14 essentiality to systemic growth via control of GPCR was reported ( 206 ). They generated ZIP14 KO by deletion of exons 5 8 while the ZIP14 KO mouse that was used in this project was generated by deletion of exons 3 5. E ven though deletions were made in different exons, in both ZIP14 KO mice growth retardation was common feature. Their result showed that Zip14 plays important roles in mammalian growth and energy metabolism by regulating GPCR cAMP CREB signaling, suggestin g another zinc/zinc transporter regulated signaling pathway to study in LR.

PAGE 100

100 Figure 5 1. Effect of Zip14 overexpression on AML12 hepatocyte proliferation. AML12 hepatocyte s were transiently transfected with either an empty vector or the pCMV Sport Zip1 4 for 48 hours, then serum starved for 20 hours. Next, cells were incubated either with HGF and BrDU or HGF alone for 24 hours. (A) BrDU incorporation was measured at absorbance 450 nm. (B, C) Cells that were incubated with HGF alone were harvested, and RN A and cell lysates were prepared for measurement of Zip14 mRNA and PCNA expression, respectively. Values shown are means SD (n=3 5).

PAGE 101

101 Figure 5 2. Effect of Zip14 overexpression on c Met signaling pathway. AML12 hepatocyte s were transiently transfect ed with either an empty vector or the pCMV Sport Zip14 for 96 hours. (A) Total cell membranes were isolated and used for the phosphatase assay. The phosphate release was measured at absorbance 650 nm. (B) Cells were serum starved in the last 20 hours of t ransfection, and then were incubated with HGF for 30 minutes. Total cell lysates were used for the western blot analysis. Values shown are means SD (n=3).

PAGE 102

102 Figure 5 3. Genotyping of mouse tail samples. Genomic DNA was isolated from the mouse tail, an d 150 ng of the total DNA was used for the PCR reaction. The two sets of primers that were specifically design to amplify either WT or mutant DNA were used for the determination of mouse genotype.

PAGE 103

103 Figure 5 4. Validation of Zip14 knock out Intestine and liver tissues were colle cted from WT, HET and KO mice. T issue lysates and total RNA were prepared for western blot (A), and qPCR (B), respectively.

PAGE 104

104 Figure 5 5. Effect of Zip14 Knock out on hepatic zinc in response to partial hepatect omy PHx was performed on WT and Zip14 KO mice. Liver tissues were collected at the time of surgery from the resected part (PrePHx) and 24 hours after surgery (PostPHx). Total RNA and tissue lysates were isolated and used for Zip14 (A) and MT (B) mRNAdetec tion. (C) Tissues were digested by nitric acid and total zinc concentrations were measured by AAS. Values shown are means SD (n=4).

PAGE 105

105 Figure 5 6. Effect of Zip14 knock out in liver regeneration PHx was performed on WT and Zip14 KO mice. Liver t issues were collected at the surgery time from the resected part (PrePHx) and 24 hours after surgery (PostPHx). Total RNA and tissue lysates were isolated and used for qPCR (A) western blot (B) analyses, respectively. (C) The average relative densitometry values were obtained from individual mice (n=4).

PAGE 106

106 Figure 5 7. Transcription al regulation of Zip14 during liver regeneration (A) Zip14 Amplified DNA was purified and incubated with h epatic nu clear extracts that were isolated from either hepatectomized or sham operated mice. (B) DNA with bound proteins was isolated by magnetically labeled streptavidin beads and proteins were separated in SDS PAGE. Bound protei ns were visualized by silver stai ni ng.

PAGE 107

107 CHAPTER 6 CONCLUSIONS AND FUTURE DIRECTIONS The general aim of this research was to gain a better understanding of the involvement of zinc and zinc transporters in the LR process. To accomplish this task three specific aim s were proposed: Determin ation of changes in zinc transporter expression and which of those are zinc respo nsive during liver regeneration; exploration of a role for zinc in the HGF pathway during hepatocyte proliferation ; and d elineation of the specific role and regulation of ZIP1 4 during hepatocyte proliferation. To investigate these specific aims 70% partial hepatectomy was chosen as an in vivo model In parallel, in vitro AML12 hepatocytes were used for some experiments. As summarized in the model (Figure 6 1), t he results that were obtained from both in vivo and in vitro experiments revealed that increased hepatic zinc during LR, enhanced hepatocyte proliferation This increase in hepatic zinc was mainly facilitated by the most up regulated zinc transporter, Zip14 as confirmed with a ZIP14 KO mouse The hepatic zinc increase in response to PHx was not present in the ZIP14 KO mice. Zip14 up regulation was mainly caus e d by IL6 however; presence of the other non parenchymal cells produced factors was required To investigate the specific role for zinc and Zip14 in LR, the HGF c Met pathway was chosen. The inhibitory effect of zinc was detected on PTP1B phosphatase activity. PTP1B is the enzyme responsible for dephosphorylation of the c Met kinase domain. Zinc inhibition of PTP1 B enhanced c Met ERK1/2 pho sphorylation resulting in enhanced hepatocyte proliferation. The importance of the results in my dissertation is their applicability for the treatment of liver diseases. T hree decades a go, whole liver transplantation was the only o ption for those who suffer ed from chronic liver diseases. However, the field of liver

PAGE 108

108 transplantation is limited by the availability of donor organs. Therefore, new approaches to ta ke advantage of the regenerative capacity of the liver have been develop ed for the treatment of chronic liver diseases (208 ) These approaches include partial hepatectomy split liver tran splantation (SLT) and live donor liver transplantation (LDLT) The most important factor for survival after these surgeries is the regenerative capacity of the remnant liver ( 208 209 ) as it is reported in human (210, 211) and animal models (212 214 ). Enhanced liver regeneration is vital for the survival of the recipient a nd also for the donor in LDLT. Besides the success of these surgical appro aches, enhancement of LR is also required for the success of pharmacological approaches that aim to reverse fibrosis to treat liver diseases. Although PHx, S LT and LDLT offer the alternative curative option s many patients develop postoperative complicati ons because the remnant livers or grafts are too small or of poor quality to sustain sufficient organ function ( 208 ) This phenomenon is for In a partial liver graft mouse model, almost complete failure of hepatocyte proliferation was observed in the small graft (30%) receiving mice when compare d to 50% graft receiving mice (208 ) Similar observations were obtained from human cases ( 208 ) These o bservations led to the conclusion that defective liver regeneration is th e central mechanism of SFSS and focus should turn toward the relevant pathways of regeneration. Zinc may be a factor upon which to develop new therapies to enhance LR. Zinc supplementation was used in a few clinical trials and was shown to have a positiv e effect in liver function (108 113 ) All of the liver health assessments in those trials were done by the measurement of serum ALT levels. Thus, it is not clear if zinc has any

PAGE 109

109 effect on proliferation of hepatocytes. Proliferation of hepatocytes is the ma in event in LR (10). Zinc is involved in cell proliferation both as a structural element ( 91,215 219 ) and as a regulatory element in many mitogenic s ignaling pathways (71, 72 ). The HGF c Met pathway is essential in LR. In this dissertation, specific role s for zinc an d Zip14 in HGF c Met pathway were shown. In this dissertatio n, zinc and Zip14 were proposed as potential therapeutic targets to treat liver diseases since enhancement of liver regeneration by zinc was shown in response to PHx. However, unlike m urine PHx model s in human disease settings, there are important parameters to consider including functional mass of remnant liver, the age of the patient, and the presence of pre existing liver diseases. Depending on the type of pre existing liver disease the effect of zinc may change For instance if a patient has chronic hepatitis caused by hepatitis C virus (HCV) infection, zinc may have an effect on both enhancement of regene ra tion and clearance of the HCV at the same time. Inhibition of genome length HCV RNA replication by zi nc supplementation was shown in the HCV inoculated HuH 7 cell line ( 220 ) These in vitro data were supporte d with a number of clinical data s howing improved hepatic outcomes of chronic hepatitis C and liver cirrhosis when patients were supplemented with zinc along with drug therapy ( 112 ) Significantly lower cumulative incidence of hepatocellular carcinoma was also reported in the zinc responder patients when compared to non responder patients. Another important parameter to consid er for the determination of the right strategy for the LDLT is patient age Impaired liver regeneration in old livers was shown in basic and clinical studies (221, 222 ) Interestingly, zinc deficiency in the elderly was reported (223 ) The results that wer e presented here indicated that zinc was a required

PAGE 110

110 factor for regeneration. These observations may suggest that zinc supplementation for the older donors and recipients before liver surgeries may have a beneficial effect. To test this, zinc supplementatio n and PHx surgeries should be conducted with older mice in the future. In this dissertation project the main focus was zinc and Zip14. However there wer e five more ZIP transporter s that were significantly up regulated during LR. The specific role of these transporters in LR should be address ed in future studies. Additionally, in the ZIP14 KO m ouse model, expression of the rest of the ZIP transporters should be m easured to determine if there i s a compensatory mechanism for the maintenance of hepatic zinc lev el s d uring LR. In the ZIP14 KO model, alternative roles for Zip14 during LR (discussed in chapter 5) should be further investigated.

PAGE 111

111 Figure 6 1. Shematic representation of inv olvement of zinc and Zip14 in liver regeneration Kupffer and innate immune s ystem cells produced IL6 upregulates Zip14 at the priming step of LR. Zip14 up regulation causes an increase in hepatic zinc. Increased hepatic zinc enhances hepatocyte proliferation by enhanced c Met ERK1/2 phos phorylation via inhibition of PT P1

PAGE 112

112 LIST OF REFERENCES 1. Taub R, Greenbaum LE, & Peng Y (1999) Transcriptional regulatory signals define cytokine dependent and independent pathways in liver regeneration. Semin Liver Dis 19(2):117 127. 2. Rabes HM (1977) Kinetics of hepatocellular proliferation as a function of the microvascular structure and functional state of the liver. Ciba Found Symp (55):31 53. 3. Dansette PM, et al. (1998) Drug induced immunotoxicity. Eur J Drug Metab Pharmacokinet 23(4):443 451. 4. Naito M, Hasegawa G, Ebe Y, & Yamamoto T (2 004) Differentiation and function of Kupffer cells. Med Electron Microsc 37(1):16 28. 5. Nelsen CJ, Rickheim DG, Tucker MM, Hansen LK, & Albrecht JH (2003) Evidence that cyclin D1 mediates both growth and proliferation downstream of TOR in hepatocytes. J B iol Chem 278(6):3656 3663. 6. Fausto N (2000) Liver regeneration J Hepatol 32(1 Suppl):19 31. 7. Northemann W, et al. (1990) Production of interleukin 6 by hepatoma cells. Mol Biol Med 7(3):273 285. 8. Yamada Y, Kirillova I, Peschon JJ, & Fausto N (1997) Initiation of liver growth by tumor necrosis factor: deficient liver regeneration in mice lacking type I tumor necrosis factor receptor. Proc Natl Acad Sci U S A 94(4):1441 1446. 9. Cressman DE, et al. (1996) Liver failure and defective hepatocyte regenera tion in interleukin 6 deficient mice. Science 274(5291):1379 1383. 10. Michalopoulos GK (2007) Liver regeneration. J Cell Physiol 213(2):286 300. 11. Maione D, et al. (1998) Coexpression of IL 6 and soluble IL 6R causes nodular regenerative hyperplasia and adenomas of the liver. Embo J 17(19):5588 5597. 12. Schafer M & Werner S (2007) Transcriptional control of wound repair. Annu Rev Cell Dev Biol 23:69 92. 13. Kortlever RM & Bernards R (2006) Senescence, wound healing and cancer: the PAI 1 connection. Cel l Cycle 5(23):2697 2703. 14. Sokabe T, et al. (2004) Differential regulation of urokinase type plasminogen activator expression by fluid shear stress in human coronary artery endothelial cells. Am J Physiol Heart Circ Physiol 287(5):H2027 2034.

PAGE 113

113 15. Kim TH Mars WM, Stolz DB, Petersen BE, & Michalopoulos GK (1997) Extracellular matrix remodeling at the early stages of liver regeneration in the rat. Hepatology 26(4):896 904. 16. Kim TH, Mars WM, Stolz DB, & Michalopoulos GK (2000) Expression and activation o f pro MMP 2 and pro MMP 9 during rat liver regeneration. Hepatology 31(1):75 82. 17. Swindle CS, et al. (2001) Epidermal growth factor (EGF) like repeats of human tenascin C as ligands for EGF receptor. J Cell Biol 154(2):459 468. 18. Masumoto A & Yamamoto N (1993) Stimulation of DNA synthesis in hepatocytes by hepatocyte growth factor bound to extracellular matrix. Biochem Biophys Res Commun 191(3):1218 1223. 19. Mars WM, et al. (1995) Immediate early detection of urokinase receptor after partial hepatecto my and its implications for initiation of liver regeneration. Hepatology 21(6):1695 1701. 20. Schirmacher P, et al. (1993) The role of Ito cells in the biosynthesis of HGF SF in the liver. Exs 65:285 299. 21. Broten J, Michalopoulos G, Petersen B, & Cruis e J (1999) Adrenergic stimulation of hepatocyte growth factor expression. Biochem Biophys Res Commun 262(1):76 79. 22. Stolz DB, Mars WM, Petersen BE, Kim TH, & Michalopoulos GK (1999) Growth factor signal transduction immediately after two thirds partial hepatectomy in the rat. Cancer Res 59(16):3954 3960. 23. Block GD, et al. (1996) Population expansion, clonal growth, and specific differentiation patterns in primary cultures of hepatocytes induced by HGF/SF, EGF and TGF alpha in a chemically defined (HG M) medium. J Cell Biol 132(6):1133 1149. 24. Patijn GA, Lieber A, Schowalter DB, Schwall R, & Kay MA (1998) Hepatocyte growth factor induces hepatocyte proliferation in vivo and allows for efficient retroviral mediated gene transfer in mice. Hepatology 28( 3):707 716. 25. Mead JE & Fausto N (1989) Transforming growth factor alpha may be a physiological regulator of liver regeneration by means of an autocrine mechanism. Proc Natl Acad Sci U S A 86(5):1558 1562. 26. Webber EM, Wu JC, Wang L, Merlino G, & Faust o N (1994) Overexpression of transforming growth factor alpha causes liver enlargement and increased hepatocyte proliferation in transgenic mice. Am J Pathol 145(2):398 408.

PAGE 114

114 27. Russell WE, Kaufmann WK, Sitaric S, Luetteke NC, & Lee DC (1996) Liver regener ation and hepatocarcinogenesis in transforming growth factor alpha targeted mice. Mol Carcinog 15(3):183 189. 28. Kiso S, et al. (1995) Role of heparin binding epidermal growth factor like growth factor as a hepatotrophic factor in rat liver regeneration a fter partial hepatectomy. Hepatology 22(5):1584 1590. 29. Kiso S, et al. (2003) Liver regeneration in heparin binding EGF like growth factor transgenic mice after partial hepatectomy Gastroenterology 124(3):701 707. 30. Mitchell C, et al. (2005) Heparin b inding epidermal growth factor like growth factor links hepatocyte priming with cell cycle progression during liver regeneration. J Biol Chem 280(4):2562 2568. 31. Sanderson N, et al. (1995) Hepatic expression of mature transforming growth factor beta 1 in transgenic mice results in multiple tissue lesions. Proc Natl Acad Sci U S A 92(7):2572 2576. 32 Cressman DE, Diamond RH, & Taub R (1995) Rapid activation of the Stat3 transcription complex in liver regeneration. Hepatology 21(5):1443 1449. 33 FitzGeral d MJ, Webber EM, Donovan JR, & Fausto N (1995) Rapid DNA binding by nuclear factor kappa B in hepatocytes at the start of liver regeneration. Cell Growth Differ 6(4):417 427. 34. Li W, Liang X, Kellendonk C, Poli V, & Taub R (2002) STAT3 contributes to the mitogenic response of hepatocytes during liver regeneration. J Biol Chem 277(32):28411 28417. 35. Behrens A, et al. (2002) Impaired postnatal hepatocyte proliferation and liver regeneration in mice lacking c jun in the liver Embo J 21(7):1782 1790. 36. S tepniak E, et al. (2006) c Jun/AP 1 controls liver regeneration by repressing p53/p21 and p38 MAPK activity. Genes Dev 20(16):2306 2314. 37. Servillo G, Della Fazia MA, & Sassone Corsi P (1998) Transcription factor CREM coordinates the timing of hepatocyte proliferation in the regenerating liver. Genes Dev 12(23):3639 3643. 38. Monga SP, Pediaditakis P, Mule K, Stolz DB, & Michalopoulos GK (2001) Changes in WNT/beta catenin pathway during regulated growth in rat liver regeneration. Hepatology 33(5):1098 110 9. 39. Kohler C, et al. (2004) Expression of Notch 1 and its ligand Jagged 1 in rat liver during liver regeneration. Hepatology 39(4):1056 1065.

PAGE 115

115 40. Maeno H, et al. (2005) Expression of hypoxia inducible factor 1alpha during liver regeneration induced by p artial hepatectomy in rats. Liver Int 25(5):1002 1009. 41. Mitchell C & Willenbring H (2008) A reproducible and well tolerated method for 2/3 partial hepatectomy in mice. Nat Protoc 3(7):1167 1170. 42. Iyer NV, et al. (1998) Cellular and developmental cont rol of O2 homeostasis by hypoxia inducible factor 1 alpha. Genes Dev 12(2):149 162. 43. Elson DA, Ryan HE, Snow JW, Johnson R, & Arbeit JM (2000) Coordinate up regulation of hypoxia inducible factor (HIF) 1alpha and HIF 1 target genes during multi stage ep idermal carcinogenesis and wound healing. Cancer Res 60(21):6189 6195. 44. Tajima T, et al. (2009) HIF 1alpha is necessary to support gluconeogenesis during liver regeneration. Biochem Biophys Res Commun 387(4):789 794. 45. Choi JH, et al. (2005) Molecular mechanism of hypoxia mediated hepatic gluconeogenesis by transcriptional regulation. FEBS Lett 579(13):2795 2801. 46. Costa RH, Kalinichenko VV, Holterman AX, & Wang X (2003) Transcription factors in liver development, differentiation, and regeneration. H epatology 38(6):1331 1347. 47. Factor VM, Jensen MR, & Thorgeirsson SS (1997) Coexpression of C myc and transforming growth factor alfa in the liver promotes early replicative senescence and diminishes regenerative capacity after partial hepatectomy in tra nsgenic mice. Hepatology 26(6):1434 1443. 48. Morello D, Fitzgerald MJ, Babinet C, & Fausto N (1990) c myc, c fos, and c jun regulation in the regenerating livers of normal and H 2K/c myc transgenic mice. Mol Cell Biol 10(6):3185 3193. 49. Friedman JR, et al. (2004) Orthogonal analysis of C/EBPbeta targets in vivo during liver proliferation. Proc Natl Acad Sci U S A 101(35):12986 12991. 50. Diehl AM (1998) Roles of CCAAT/enhancer binding proteins in regulation of liver regenerative growth J Biol Chem 273(4 7):30843 30846. 51. Lekstrom Himes J & Xanthopoulos KG (1998) Biological role of the CCAAT/enhancer binding protein family of transcription factors. J Biol Chem 273(44):28545 28548. 52. Greenbaum LE, et al. (1998) CCAAT enhancer binding protein beta is re quired for normal hepatocyte proliferation in mice after partial hepatectomy. J Clin Invest 102(5):996 1007.

PAGE 116

116 53. Ye H, Holterman AX, Yoo KW, Franks RR, & Costa RH (1999) Premature expression of the winged helix transcription factor HFH 11B in regenerating mouse liver accelerates hepatocyte entry into S phase. Mol Cell Biol 19(12):8570 8580. 54. Wang X, Hung NJ, & Costa RH (2001) Earlier expression of the transcription factor HFH 11B diminishes induction of p21(CIP1/WAF1) levels and accelerates mouse hepatoc yte entry into S phase following carbon tetrachloride liver injury. Hepatology 33(6):1404 1414. 55. Wang X, Kiyokawa H, Dennewitz MB, & Costa RH (2002) The Forkhead Box m1b transcription factor is essential for hepatocyte DNA replication and mitosis during mouse liver regeneration. Proc Natl Acad Sci U S A 99(26):16881 16886. 56. Su AI, Guidotti LG, Pezacki JP, Chisari FV, & Schultz PG (2002) Gene expression during the priming phase of liver regeneration after partial hepatectomy in mice. Proc Natl Acad Sci U S A 99(17):11181 11186. 57. Liao Y, et al. (2004) Delayed hepatocellular mitotic progression and impaired liver regeneration in early growth response 1 deficient mice. J Biol Chem 279(41):43107 43116. 58. Allan AL, Albanese C, Pestell RG, & LaMarre J (2 001) Activating transcription factor 3 induces DNA synthesis and expression of cyclin D1 in hepatocytes. J Biol Chem 276(29):27272 27280. 59. Wang X, et al. (2002) Increased hepatic Forkhead Box M1B (FoxM1B) levels in old aged mice stimulated liver regener ation through diminished p27Kip1 protein levels and increased Cdc25B expression. J Biol Chem 277(46):44310 44316. 60. Mackey S, Singh P, & Darlington GJ (2003) Making the liver young again. Hepatology 38(6):1349 1352. 61. Wang H, et al. (2007) C/EBPbeta ac tivates E2F regulated genes in vivo via recruitment of the coactivator CREB binding protein/P300. J Biol Chem 282(34):24679 24688. 62. Wang H, et al. (2008) CCAAT/enhancer binding protein beta is a transcriptional regulator of peroxisome proliferator activ ated receptor gamma coactivator 1alpha in the regenerating liver. Mol Endocrinol 22(7):1596 1605. 63. Johnson PF (2005) Molecular stop signs: regulation of cell cycle arrest by C/EBP transcription factors. J Cell Sci 118(Pt 12):2545 2555. 64. Oe S, et al. (2004) Intact signaling by transforming growth factor beta is not required for termination of liver regeneration in mice. Hepatology 40(5):1098 1105

PAGE 117

117 65. Gkretsi V, et al. (2008) Liver specific ablation of integrin linked kinase in mice results in abnormal histology, enhanced cell proliferation, and hepatomegaly. Hepatology 48(6):1932 1941. 66. Apte U, et al. (2009) Enhanced liver regeneration following changes induced by hepatocyte specific genetic ablation of integrin linked kinase. Hepatology 50(3):844 85 1. 67. Pan D (2007) Hippo signaling in organ size control. Genes Dev 21(8):886 897. 68. Dong J, et al. (2007) Elucidation of a universal size control mechanism in Drosophila and mammals. Cell 130(6):1120 1133. 69 O'Dell BL (1992) Zinc plays both structur al and catalytic roles in metalloproteins. Nutr Rev 50(2):48 50. 70 Vallee BL & Falchuk KH (1993) The biochemical basis of zinc physiology. Physiol Rev 73(1):79 118. 71 Beyersmann D & Haase H (2001) Functions of zinc in signaling, proliferation and diffe rentiation of mammalian cells. Biometals 14(3 4):331 341. 72 Siemes C, et al. (2004) Normalized proliferation of normal and psoriatic keratinocytes by suppression of sAPPalpha release. J Invest Dermatol 123(3):556 563. 73 Cousins RJ, Liuzzi JP, & Lichten LA (2006) Mammalian zinc transport, trafficking, and signals. J Biol Chem 281(34):24085 24089. 74 Liuzzi JP & Cousins RJ (2004) Mammalian zinc transporters. Annu Rev Nutr 24:151 72. 75 Murakami M & Hirano T (2008) Intracellular zinc homeostasis and zinc signaling. Cancer Sci 99(8):1515 1522. 76 Aydemir TB, Liuzzi JP, McClellan S, & Cousins RJ (2009) Zinc transporter ZIP8 (SLC39A8) and zinc influence IFN gamma expression in activated human T cells. J Leukoc Biol 86(2):337 348. 77 Gohlke H, et al. (2008) SLC30A8 (ZnT8) Polymorphism is Associated with Young Age at Type 1 Diabetes Onset. Rev Diabet Stud 5(1):25 27.). 78 Li M, et al. (2007) Aberrant expression of zinc transporter ZIP4 (SLC39A4) significantly contributes to human pancreatic cancer pathogenes is and progression. Proc Natl Acad Sci U S A 104(47):18636 18641.

PAGE 118

118 79 Jiang WG, Hallett MB, & Puntis MCA (1993) Hepatocyte Growth Factor/Scatter Factor, Liver Regeneration and Cancer Metastasis. Brit J Surg 80(11):1368 1373. 80 Kagara N, Tanaka N, Noguchi S, & Hirano T (2007) Zinc and its transporter ZIP10 are involved in invasive behavior of breast cancer cells. Cancer Sci 98(5):692 697. 81 Otu HH, et al. (2007) Restoration of liver mass after injury requires proliferative and not embryonic transcription al patterns. J Biol Chem 282(15):11197 11204. 82 Liuzzi JP, et al. (2005) Interleukin 6 regulates the zinc transporter Zip14 in liver and contributes to the hypozincemia of the acute phase response. Proc Natl Acad Sci U S A 102(19):6843 6848. 83 Opipari AW, Jr., Boguski MS, & Dixit VM (1990) The A20 cDNA induced by tumor necrosis factor alpha encodes a novel type of zinc finger protein. J Biol Chem 265(25):14705 14708 (in eng). 84 Song HY, Rothe M, & Goeddel DV (1996) The tumor necrosis factor inducible zinc finger protein A20 interacts with TRAF1/TRAF2 and inhibits NF kappaB activation. Proc Natl Acad Sci U S A 93(13):6721 6725. 85 Prasad AS, Bao B, Beck FW, Kucuk O, & Sarkar FH (2004) Antioxidant effect of zinc in humans. Free Radic Biol Med 37(8):1182 1190. 86 Jones AL, Hulett MD, Altin JG, Hogg P, & Parish CR (2004) Plasminogen is tethered with high affinity to the cell surface by the plasma protein, histidine rich glycoprotein. J Biol Chem 279(37):38267 38276. 87 Pelicci G, et al. (1995) The motoge nic and mitogenic responses to HGF are amplified by the Shc adaptor protein. Oncogene 10(8):1631 1638. 88 Kimura T, et al. (2006) Role of metal responsive transcription factor 1 (MTF 1) in EGF dependent DNA synthesis in primary hepatocytes. J Cell Biochem 99(2):485 494. 89 Wimmer U, Wang Y, Georgiev O, & Schaffner W (2005) Two major branches of anti cadmium defense in the mouse: MTF 1/metallothioneins and glutathione. Nucleic Acids Res 33(18):5715 5727. 90 Bruinsma JJ, Jirakulaporn T, Muslin AJ, & Kornf eld K (2002) Zinc ions and cation diffusion facilitator proteins regulate Ras mediated signaling. Dev Cell 2(5):567 578. 91 Jirakulaporn T & Muslin AJ (2004) Cation diffusion facilitator proteins modulate Raf 1 activity. J Biol Chem 279(26):27807 27815.

PAGE 119

119 9 2 Walter PL, et al. (2006) Modulation of FoxO signaling in human hepatoma cells by exposure to copper or zinc ions. Arch Biochem Biophys 454(2):107 113. 93 Min YK, Lee JE, & Chung KC (2007) Zinc induces cell death in immortalized embryonic hippocampal c ells via activation of Akt GSK 3beta signaling Exp Cell Res 313(2):312 321. 94 Kim S, Jung Y, Kim D, Koh H, & Chung J (2000) Extracellular zinc activates p70 S6 kinase through the phosphatidylinositol 3 kinase signaling pathway. J Biol Chem 275(34):25979 25984. 95 Eom SJ, et al. (2001) Zn(2+) induces stimulation of the c Jun N terminal kinase signaling pathway through phosphoinositide 3 Kinase. Mol Pharmacol 59(5):981 986. 96 Wu W, et al. (2003) Zinc induced PTEN protein degradation through the proteaso me pathway in human airway epithelial cells. J Biol Chem 278(30):28258 28263. 97 Taylor KM (2000) LIV 1 breast cancer protein belongs to new family of histidine rich membrane proteins with potential to control intracellular Zn2+ homeostasis. IUBMB Life 49 (4):249 253. 98 Shen H, Qin H, & Guo J (2009) Concordant correlation of LIV 1 and E cadherin expression in human breast cancer cell MCF 7. Mol Biol Rep 36(4):653 659. 99 Greene AK & Puder M (2003) Partial hepatectomy in the mouse: technique and periopera tive management. J Invest Surg 16(2):99 102. 100 Higgins GM, Anderson RM (1931) Experimental Pathology of the Liver. Arch Path Lab Med (12):186 202. 101 Boyce S & Harrison D (2008) A detailed methodology of partial hepatectomy in the mouse. Lab Anim (NY) 37(11):529 532. 102 Malhi H & Gores GJ (2008) Cellular and molecular mechanisms of liver injury. Gastroenterology 134(6):1641 1654. 103 Wallace K, Burt AD, & Wright MC (2008) Liver fibrosis. Biochem J 411(1):1 18. 104 Quaglia A, et al. (2008) Liver af ter hepatocyte transplantation for liver based metabolic disorders in children. Cell Transplant 17(12):1403 1414. 105 Wang J, et al. (2002) Auxiliary partial liver grafting in rats: effect of host hepatectomy on graft regeneration, and review of literatur e on surgical technique. Microsurgery 22(8):371 377.

PAGE 120

120 106 Malago M, Hertl M, Testa G, Rogiers X, & Broelsch CE (2002) Split liver transplantation: future use of scarce donor organs. World J Surg 26(2):275 282. 107. Stamoulis I, Kouraklis G, & Theocharis S (2007) Zinc and the liver: an active interaction. Dig Dis Sci 52(7):1595 1612. 108. Weismann K, Christensen E, & Dreyer V (1979) Zinc supplementation in alcoholic cirrhosis. A double blind clinical trial Acta Med Scand 205(5):361 366. 109. Qu CX, et al. ( 2007) Chemoprevention of primary liver cancer: a randomized, double blind trial in Linxian, China. J Natl Cancer Inst 99(16):1240 1247. 110. Murakami Y, et al. (2007) Zinc supplementation prevents the increase of transaminase in chronic hepatitis C patient s during combination therapy with pegylated interferon alpha 2b and ribavirin. J Nutr Sci Vitaminol (Tokyo) 53(3):213 21. 111. Takagi H, et al. (2001) Zinc supplementation enhances the response to interferon therapy in patients with chronic hepatitis C. J Viral Hepat 8(5):367 37. 112. Matsuoka S, et al. (2009) Zinc supplementation improves the outcome of chronic hepatitis C and liver cirrhosis. J Clin Biochem Nutr 45(3):292 303. 113. Nagamine T, et al. (2000) Preliminary study of combination therapy with in terferon alpha and zinc in chronic hepatitis C patients with ge notype 1b. Biol Trace Elem Res 75(1 3):53 63. 114. Wu FY & Wu CW (1987) Zinc in DNA replication and transcription. Annu Rev Nutr 7:251 272. 115. Corniola RS, Tassabehji NM, Hare J, Sharma G, & Levenson CW (2008) Zinc deficiency impairs neuronal precursor cell proliferation and induces apoptosis via p53 mediated mechanisms. Brain Res 1237:52 61. 116. Eriksson PS, et al. (1998) Neurogenesis in the adult human hippocampus. Nat Med 4(11):1313 1317. 117. Hashizume M & Yamaguchi M (1993) Stimulatory effect of beta alanyl L histidinato zinc on cell proliferation is dependent on protein synthesis in osteoblastic MC3T3 E1 cells. Mol Cell Biochem 122(1):59 64. 118. Hashizume M & Yamaguchi M (1994) Effect o f beta alanyl L histidinato zinc on differentiation of osteoblastic MC3T3 E1 cells: increases in alkaline phosphatase activity and protein concentration. Mol Cell Biochem 131(1):19 24. 119. Seo HJ, Cho YE, Kim T, Shin HI, & Kwun IS (2010) Zinc may increase bone formation through stimulating cell proliferation, alkaline phosphatase activity and collagen synthesis in osteoblastic MC3T3 E1 cells. Nutr Res Pract 4(5):356 361.

PAGE 121

121 120. Kang X, Song Z, McClain CJ, Kang YJ, & Zhou Z (2008) Zinc supplementation enhance s hepatic regeneration by preserving hepatocyte nuclear factor 4alpha in mice subjected to long term ethanol administration. Am J Pathol 172(4):916 925. 121. Kaltenberg J, et al. (2010) Zinc signals promote IL 2 dependent proliferation of T cells. Eur J Im munol 40(5):1496 1503. 122. Gaffen SL (2001) Signaling domains of the interleukin 2 receptor. Cytokine 14(2):63 77.. 123. Michalopoulos GK & DeFrances MC (1997) Liver regeneration. Science 276(5309):60 66. 124 Hata S, Namae M, & Nishina H (2007) Liver de velopment and regeneration: from laboratory study to clinical therapy. Dev Growth Differ 49(2):163 170. 125 Milin C, et al. (2005) Metal tissue kinetics in regenerating liver, thymus, spleen, and submandibular gland after partial hepatectomy in mice. Biol Trace Elem Res 108(1 3):225 243, 126 Chimienti F, Favier A, & Seve M (2005) ZnT 8, a pancreatic beta cell specific zinc transporter. Biometals 18(4):313 317. 127. Kojima H, et al. (2004) Extrapancreatic insulin producing cells in multiple organs in diabet es. Proc Natl Acad Sci U S A 101(8):2458 2463. 128. Naryzhny SN (2008) Proliferating cell nuclear antigen: a proteomics view. Cell Mol Life Sci 65(23):3789 3808. 129. Hoege C, Pfander B, Moldovan GL, Pyrowolakis G, & Jentsch S (2002) RAD6 dependent DNA rep air is linked to modification of PCNA by ubiquitin and SUMO. Nature 419(6903):135 141. 130. Mao X, Kim BE, Wang F, Eide DJ, & Petris MJ (2007) A histidine rich cluster mediates the ubiquitination and degradation of the human zinc transporter, hZIP4, and p rotects against zinc cytotoxicity. J Biol Chem 282(10):6992 7000. 131. Satoh M & Yamazaki M (1992) Tumor necrosis factor stimulates DNA synthesis of mouse hepatocytes in primar y culture and is suppressed by transforming growth factor beta and interleukin 6. J Cell Physiol 150(1):134 139. 132. Moran DM, Mayes N, Koniaris LG, Cahill PA, & McKillop IH (2005) Interleukin 6 inhibits cell proliferation in a rat model of hepatocellular carcinoma. Liver Int 25(2):445 457. 133. Ren X, Hogaboam C, Carpenter A, & Colletti L (2003) Stem cell factor restores hepatocyte proliferation in IL 6 knockout mice following 70% hepatectomy. J Clin Invest 112(9):1407 1418.

PAGE 122

122 134. Kuma S, et al. (1990) Eff ect of human recombinant interleukin 6 on the proliferation of mouse hepatocytes in the primary culture. Immunobiology 180(2 3):235 242. 135. Ohira H, et al. (1996) Interleukin 6 induces proliferation of rat hepatocytes in vivo. J Hepatol 25(6):941 947. 13 6. Sun R, Jaruga B, Kulkarni S, Sun H, & Gao B (2005) IL 6 modulates hepatocyte proliferation via induction of HGF/p21cip1: regulation by SOCS3. Biochem Biophys Res Commun 338(4):1943 1949. 137. Michalopoulos GK & DeFrances MC (1997) Liver regeneration. Sc ience 276(5309):60 66. 138. Deng X, et al. (2009) Exploring the priming mechanism of liver regeneration: proteins and protein complexes. Proteomics 9(8):2202 2216. 139. Grisham JW, Leong GF, & Hole BV (1964) Heterotopic Partial Autotransplantation of Rat L iver: Technic and Demonstration of Structure and Function of the Graft. Cancer Res 24:1474 1495. 140. Moolten FL & Bucher NL (1967) Regeneration of rat liver: transfer of humoral agent by cross circulation. Science 158(798):272 274. 141 Nakamura T, Sakai K, & Matsumoto K (2011) Hepatocyte growth factor twenty years on: Much more than a growth factor. J Gastroenterol Hepatol 26 Suppl 1:188 202. 142 Schmidt C, et al. (1995) Scatter factor/hepatocyte growth factor is essential for liver development. Nature 3 73(6516):699 702. 143 Borowiak M, et al. (2004) Met provides essential signals for liver regeneration. Proc Natl Acad Sci U S A 101(29):10608 10613. 144 Nakamura T & Mizuno S (2010) The discovery of hepatocyte growth factor (HGF) and its significance for cell biology, life sciences and clinical medicine. Proc Jpn Acad Ser B Phys Biol Sci 86(6):588 610. 145 Tomiya T, et al. (1992) Serum hepatocyte growth factor levels in hepatectomized and nonhepatectomized surgical patients. Gastroenterology 103(5):1621 1624. 146 Kinoshita T, Hirao S, Matsumoto K, & Nakamura T (1991) Possible endocrine control by hepatocyte growth factor of liver regeneration after partial hepatectomy. Biochem Biophys Res Commun 177(1):330 335. 147 Yanagita K, et al. (1992) Lung may hav e an endocrine function producing hepatocyte growth factor in response to injury of distal organs. Biochem Biophys Res Commun 182(2):802 809.

PAGE 123

123 148 Webber EM, Godowski PJ, & Fausto N (1994) In vivo response of hepatocytes to growth factors requires an initi al priming stimulus. Hepatology 19(2):489 497. 149 Fausto N & Riehle KJ (2005) Mechanisms of liver regeneration and their clinical implications. J Hepatobiliary Pancreat Surg 12(3):181 189. 150 Khan KN, et al. (2005) Interleukin 6 and tumour necrosis fa ctor alpha mediated expression of hepatocyte growth factor by stromal cells and its involvement in the growth of endometriosis. Hum Reprod 20(10):2715 2723. 151 Trusolino L, Bertotti A, & Comoglio PM (2010) MET signalling: principles and functions in deve lopment, organ regeneration and cancer. Nat Rev Mol Cell Biol 11(12):834 848. 152 Rodrigues GA & Park M (1994) Autophosphorylation modulates the kinase activity and oncogenic potential of the Met receptor tyrosine kinase. Oncogene 9(7):2019 2027. 153 Pon zetto C, et al. (1993) A novel recognition motif for phosphatidylinositol 3 kinase binding mediates its association with the hepatocyte growth factor/scatter factor receptor. Mol Cell Biol 13(8):4600 4608. 154 Fixman ED, et al. (1997) Efficient cellular t ransformation by the Met oncoprotein requires a functional Grb2 binding site and correlates with phosphorylation of the Grb2 associated proteins, Cbl and Gab1. J Biol Chem 272(32):20167 20172. 155 Fixman ED, Naujokas MA, Rodrigues GA, Moran MF, & Park M ( 1995) Efficient cell transformation by the Tpr Met oncoprotein is dependent upon tyrosine 489 in the carboxy terminus. Oncogene 10(2):237 249. 156 Palka HL, Park M, & Tonks NK (2003) Hepatocyte growth factor receptor tyrosine kinase met is a substrate of the receptor protein tyrosine phosphatase DEP 1. J Biol Chem 278(8):5728 5735. 157 Machide M, Hashigasako A, Matsumoto K, & Nakamura T (2006) Contact inhibition of hepatocyte growth regulated by functional association of the c Met/hepatocyte growth factor receptor and LAR protein tyrosine phosphatase. J Biol Chem 281(13):8765 8772. 158 Sangwan V, et al. (2008) Regulation of the Met receptor tyrosine kinase by the protein tyrosine phosphatase 1B and T cell phosphatase. J Biol Chem 283(49):34374 34383. 159 Zhang ZY (2002) Protein tyrosine phosphatases: structure and function, substrate specificity, and inhibitor development. Annu Rev Pharmacol Toxicol 42:209 234.

PAGE 124

124 160 Van Vactor D, O'Reilly AM, & Neel BG (1998) Genetic analysis of protein tyrosine phosphata ses. Curr Opin Genet Dev 8(1):112 126. 161 Lander ES, et al. (2001) Initial sequencing and analysis of the human genome. Nature 409(6822):860 921. 162 Tonks NK (2003) PTP1B: from the sidelines to the front lines! FEBS Lett 546(1):140 148. 163 Cheng A, D ube N, Gu F, & Tremblay ML (2002) Coordinated action of protein tyrosine phosphatases in insulin signal transduction. Eur J Biochem 269(4):1050 1059. 164 Stuible M, Doody KM, & Tremblay ML (2008) PTP1B and TC PTP: regulators of transformation and tumorige nesis. Cancer Metastasis Rev 27(2):215 230. 165 Haj FG, Verveer PJ, Squire A, Neel BG, & Bastiaens PI (2002) Imaging sites of receptor dephosphorylation by PTP1B on the surface of the endoplasmic reticulum. Science 295(5560):1708 1711. 166 Salmeen A, And ersen JN, Myers MP, Tonks NK, & Barford D (2000) Molecular basis for the dephosphorylation of the activation segment of the insulin receptor by protein tyrosine phosphatase 1B. Mol Cell 6(6):1401 1412. 167 Revuelta Cervantes J, et al. (2011) Protein Tyros ine Phosphatase 1B (PTP1B) deficiency accelerates hepatic regeneration in mice. Am J Pathol 178(4):1591 1604. 168 . Fischer EH (1999) Cell signaling by protein tyrosine phosphorylation. Adv Enzyme Regul 39:359 369. 169 Guan KL & Dixon JE (1991) Evidence for protein tyrosine phosphatase catalysis proceeding via a cysteine phosphate intermediate. J Biol Chem 266(26):17026 17030. 170 Elchebly M, et al. (1999) Increased insulin sensitivity and obesity resistance in mice lacking the protein tyrosine phosphata se 1B gene. Science 283(5407):1544 1548. 171 Klaman LD, et al. (2000) Increased energy expenditure, decreased adiposity, and tissue specific insulin sensitivity in protein tyrosine phosphatase 1B deficient mice. Mol Cell Biol 20(15):5479 5489. 172 Brauti gan DL, Bornstein P, & Gallis B (1981) Phosphotyrosyl protein phosphatase. Specific inhibition by Zn. J Biol Chem 256(13):6519 6522.

PAGE 125

125 173 Maret W, Jacob C, Vallee BL, & Fischer EH (1999) Inhibitory sites in enzymes: zinc removal and reactivation by thionei n. Proc Natl Acad Sci U S A 96(5):1936 1940. 174 Haase H & Maret W (2003) Intracellular zinc fluctuations modulate protein tyrosine phosphatase activity in insulin/insulin like growth factor 1 signaling. Exp Cell Res 291(2):289 298. 175 Zhang ZY, et al. (1993) Substrate specificity of the protein tyrosine phosphatases. Proc Natl Acad Sci U S A 90(10):4446 4450. 176 Jia Z, Barford D, Flint AJ, & Tonks NK (1995) Structural basis for phosphotyrosine peptide recognition by protein tyrosine phosphatase 1B. Sc ience 268(5218):1754 1758. 177 Vetter SW, Keng YF, Lawrence DS, & Zhang ZY (2000) Assessment of protein tyrosine phosphatase 1B substrate specificity using "inverse alanine scanning". J Biol Chem 275(4):2265 2268. 178 Hamada T, Tanimoto A, & Sasaguri Y ( 1997) Apoptosis induced by cadmium. Apoptosis 2(4):359 367. 179 Coyle P, Philcox JC, Carey LC, & Rofe AM (2002) Metallothionein: the multipurpose protein. Cell Mol Life Sci 59(4):627 647. 180 Sensi SL, Ton That D, & Weiss JH (2002) Mitochondrial sequestr ation and Ca(2+) dependent release of cytosolic Zn(2+) loads in cortical neurons. Neurobiol Dis 10(2):100 108. 181 Ponzetto C, et al. (1994) A multifunctional docking site mediates signaling and transformation by the hepatocyte growth factor/scatter facto r receptor family. Cell 77(2):261 271. 182 Birchmeier C, Birchmeier W, Gherardi E, & Vande Woude GF (2003) Met, metastasis, motility and more. Nat Rev Mol Cell Biol 4(12):915 925. 1 83 Ho Y, et al. (2008) Selective inhibition of mitogen activated protein kinase phosphatases by zinc accounts for extracellular signal regulated kinase 1/2 dependent oxidative neuronal cell death. Mol Pharmacol 74(4):1141 1151. 184 Nomura N, et al. (1994) Prediction of the coding sequences of unidentified human genes. II. The coding sequences of 40 new genes (KIAA0041 KIAA0080) deduced by analysis of cDNA clones from human cell line KG 1. DNA Res 1(5):223 229. 185 Taylor KM & Nicholson RI (2003) The LZT proteins; the LIV 1 subfamily of zinc transporters. Biochim Biophys Acta 1 611(1 2):16 30.

PAGE 126

126 186 Gaither LA & Eide DJ (2001) Eukaryotic zinc transporters and their regulation. Biometals 14(3 4):251 270. 187 Manning DL, et al. (1995) Differential expression of oestrogen regulated genes in breast cancer. Acta Oncol 34(5):641 646. 1 88 McClelland RA, et al. (1998) Oestrogen regulated genes in breast cancer: association of pLIV1 with response to endocrine therapy. Br J Cancer 77(10):1653 1656. 189 Manning DL, et al. (1994) Oestrogen regulated genes in breast cancer: association of pL IV1 with lymph node involvement. Eur J Cancer 30A(5):675 678. 190 Heitzer M & Hallmann A (2002) An extracellular matrix localized metalloproteinase with an exceptional QEXXH metal binding site prefers copper for catalytic activity. J Biol Chem 277(31):282 80 28286. 191 Liuzzi JP, Aydemir F, Nam H, Knutson MD, & Cousins RJ (2006) Zip14 (Slc39a14) mediates non transferrin bound iron uptake into cells. Proc Natl Acad Sci U S A 103(37):13612 13617. 192 Girijashanker K, et al. (2008) Slc39a14 gene encodes ZIP1 4, a metal/bicarbonate symporter: similarities to the ZIP8 transporter. Mol Pharmacol 73(5):1413 1423. 193 Thorsen K, et al. (2011) Alternative splicing of SLC39A14 in colorectal cancer is regulated by the Wnt pathway. Mol Cell Proteomics 10(1):M110 00299 8. 194 Taylor KM, Morgan HE, Johnson A, & Nicholson RI (2005) Structure function analysis of a novel member of the LIV 1 subfamily of zinc transporters, ZIP14. FEBS Lett 579(2):427 432. 195 Green WN & Millar NS (1995) Ion channel assembly. Trends Neurosc i 18(6):280 287. 196 Moshage H (1997) Cytokines and the hepatic acute phase response. J Pathol 181(3):257 266. 197 Jurado RL (1997) Iron, infections, and anemia of inflammation. Clin Infect Dis 25(4):888 895. 198 Cousins RJ & Leinart AS (1988) Tissue sp ecific regulation of zinc metabolism and metallothionein genes by interleukin 1. Faseb J 2(13):2884 2890. 199 Faggioni R, et al. (1998) IL 1 beta mediates leptin induction during inflammation. Am J Physiol 274(1 Pt 2):R204 208.

PAGE 127

127 200 Siewert E, et al. (200 4) Interleukin 6 regulates hepatic transporters during acute phase response. Biochem Biophys Res Commun 322(1):232 238. 201 Thambiayya K, et al. (2011) LPS induced decrease in intracellular labile zinc, [Zn]i, contributes to apoptosis in cultured sheep pu lmonary artery endothelial cells. Am J Physiol Lung Cell Mol Physiol 300(4):L624 632. 202 Shteyer E, Liao Y, Muglia LJ, Hruz PW, & Rudnick DA (2004) Disruption of hepatic adipogenesis is associated with impaired liver regeneration in mice Hepatology 40(6 ):1322 1332. 203 Tominaga K, et al. (2005) SLC39A14, a LZT protein, is induced in adipogenesis and transports zinc. Febs J 272(7):1590 1599. 204 Hooper NM (1994) Families of zinc metalloproteases. FEBS Lett 354(1):1 6. 205 Rawlings ND & Barrett AJ (1995 ) Evolutionary families of metallopeptidases. Methods Enzymol 248:183 228. 206 Coleman JE (1998) Zinc enzymes. Curr Opin Chem Biol 2(2):222 234. 207 Hojyo S, et al. (2011) The zinc transporter SLC39A14/ZIP14 controls G protein coupled receptor mediated s ignaling required for systemic growth. PLoS One 6(3):e18059. 208 Clavien PA, et al. (2010) What is critical for liver surgery and partial liver transplantation: size or quality? Hepatology 52(2):715 729. 209 Lesurtel M, et al. (2006) Platelet derived ser otonin mediates liver regeneration. Science 312(5770):104 107. 210 Schmucker DL (2005) Age related changes in liver structure and function: Implications for disease ? Exp Gerontol 40(8 9):650 659. 211 Fausto N, Campbell JS, & Riehle KJ (2006) Liver regen eration. Hepatology 43(2 Suppl 1):S45 53. 212 Timchenko NA (2009) Aging and liver regeneration. Trends Endocrinol Metab 20(4):171 176. 213 Tian Y, et al. (2006) Kupffer cell dependent TNF alpha signaling mediates injury in the arterialized small for size liver transplantation in the mouse. Proc Natl Acad Sci U S A 103(12):4598 4603. 214 Furrer K, et al. (2011) Serotonin reverts age related capillarization and failure of regeneration in the liver through a VEGF dependent pathway. Proc Natl Acad Sci U S A 108(7):2945 2950.

PAGE 128

128 215 Chesters JK, Petrie L, & Vint H (1989) Specificity and timing of the Zn2+ requirement for DNA synthesis by 3T3 cells. Exp Cell Res 184(2):499 508. 216 Berg JM & Shi Y (1996) The galvanization of biology: a growing appreciation for t he roles of zinc. Science 271(5252):1081 1085. 217 Wu FY, Huang WJ, Sinclair RB, & Powers L (1992) The structure of the zinc sites of Escherichia coli DNA dependent RNA polymerase. J Biol Chem 267(35):25560 25567. 218 Hicks SE & Wallwork JC (1987) Effect of dietary zinc deficiency on protein synthesis in cell free systems isolated from rat liver. J Nutr 117(7):1234 1240. 219 Hard T, Rak A, Allard P, Kloo L, & Garber M (2000) The solution structure of ribosomal protein L36 from Thermus thermophilus reveal s a zinc ribbon like fold. J Mol Biol 296(1):169 180 220. Yuasa K, et al. (2006) Zinc is a negative regulator of hepatitis C virus RNA re plication. Liver Int 26(9):1111 1118 221 Ikegami T, et al. (2000) The impact of donor age on living donor liver tran sp lantation. Transplantation 70(12):1703 1707. 222 Zaman MB, et al. (2007) Lower expression of Nrf2 mRNA in older donor livers: a possible contributor to increased isch emia reperfusion injury? Transplantation 84(10):1272 1278 223. Haase H & Rink L (2009 ) The immune system and the impact of zi nc during aging. Immun Ageing 6:9

PAGE 129

129 BIOGRAPHICAL SKETCH Tolunay Beker Aydemi r was born and raised in Ankara Turkey Tolunay attended the Ankara University and acquired her Bachelor of Science degree in b iol ogy in 1999. In 2000, Tolunay began her master studies at the Ankara University, College of Medicine. During her master studies she came to Emory University with the student exchange program and continued her research there for two years. In 2004, sh e defended her master research in Turkey and moved to Gainesville Florida. At the end of 2004, she started to work in Dr. Cousins Lab as a biological scientist. In 2006, she was accepted to the Interdisciplinary PhD program (IDP) in the College of Medi cine. After a one year rotation in the IDP program, she joined to Dr. Cousins Lab again to pursue her degree in biochemistry and molecular b iology an advance concentration in IDP.