Indoxacarb Toxicology and Susceptibility Monitoring in the German Cockroach

MISSING IMAGE

Material Information

Title:
Indoxacarb Toxicology and Susceptibility Monitoring in the German Cockroach
Physical Description:
1 online resource (209 p.)
Language:
english
Creator:
Gondhalekar,Ameya D
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Entomology and Nematology
Committee Chair:
Scharf, Michael E
Committee Members:
Hahn, Daniel A
James, Margaret O
Valles, Steven M

Subjects

Subjects / Keywords:
biotransformation -- blattella -- german -- germanica -- indoxacarb -- selection -- susceptibility
Entomology and Nematology -- Dissertations, Academic -- UF
Genre:
Entomology and Nematology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
German cockroaches (Blattella germanica L.) are synanpthropic pests of medical and economic importance. Indoxacarb, a sodium channel-blocker insecticide, has been in widespread use for German cockroach control in the United States since 2006. Despite its widespread use, little is known about (1) indoxacarb susceptibility levels in German cockroach field populations, (2) indoxacarb biotransformation pathways in the German cockroach and (3) resistance mechanisms that may evolve following selection with indoxacarb. Lack of research in these areas has resulted in a considerable knowledge gap. Hence, research was undertaken to bridge this gap and develop a better understanding of indoxacarb toxicology in the German cockroach. Vial and oral diagnostic bioassays were developed for monitoring indoxacarb susceptibility levels in German cockroach field populations. Monitoring bioassays conducted with fourteen field-collected strains revealed that significant indoxacarb tolerance exists in nearly all sampled field populations. However, high magnitude resistance capable of causing control failures to formulated indoxacarb baits was detected in only one strain (CC45). Low-level indoxacarb tolerance in the Gainesville-Resistant (GNV-R) strain, which is highly resistant to organochlorine, organophosphate, carbamate, cyclodiene and phenylpyrazole insecticides, suggested that cross-resistance to indoxacarb may not be significant in field populations. In vivo biotransformation experiments confirmed that bioactivation of indoxacarb to its N-decarbomethoxylated metabolite (DCJW) occurs in the German cockroach. Also, both indoxacarb and DCJW appear to undergo extensive biotransformation to indanone ring-hydroxylated, oxadiazine ring-opened and other yet unidentified metabolites. Synergism bioassays and in vivo inhibition studies using enzyme inhibitors implied involvement of cytochrome P450 monooxygenases in formation of DCJW and other metabolites. Replicated laboratory selection studies with the Arbor Park (AP) strain showed that the indoxacarb resistance phenotype is moderately heritable and resistance can increase significantly following continuous exposure to indoxacarb. Preliminary studies with the selected lines suggested roles for esterases and P450s in indoxacarb resistance. Finally, the combined effects of target-site insensitivity and enhanced P450-mediated metabolism appear to be responsible for 37-fold fipronil (another insecticide used for cockroach control) resistance in the GNV-R strain that exhibits low-level indoxacarb tolerance. Together, these findings provide important new information on indoxacarb toxicology and resistance management in the German cockroach.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Ameya D Gondhalekar.
Thesis:
Thesis (Ph.D.)--University of Florida, 2011.
Local:
Adviser: Scharf, Michael E.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043314:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 INDOXACARB TOXICOLOGY AND SUSCEPTIBILITY MONITORING IN THE GERMAN COCKROACH By AMEYA DILIP GONDHALEKAR A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREME NTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Ameya Dilip Gondhalekar

PAGE 3

3 To my beloved parents, grandparents, brother and my lovely wife Mithila

PAGE 4

4 ACKNOWLEDGMENTS I take this opportunity to express my profound g ratitude to the chair to my committee, Dr. Michael E. Scharf. This Ph D project would not have reached its completion without the help and time to time guidance provided by Dr. Scharf. His work ethic, enthusiasm, dedication and philosophy toward science w ill provide me motivation and guidance throughout my professional career. I am thankful to all my doctoral committee members Dr. Daniel Hahn, Dr. Margaret James and Dr. Steven Valles for their expertise, constructive criticism and helpful suggestions throughout the course of my doctoral work. I am also grateful to Dr. Drion Boucias for teaching me different molecular techniques and for helpful discussions on various aspects of science that will guide me in my future endeavors. I would like to thank Dr. Phil lip Kaufman, for thoroughly reviewing my manuscripts and allowing me to use his laboratory instruments. The resistance monitoring study that I conducted would not have been possible wit hout the help from Dr. Faith Oi Dr. Rebecca Baldwin, Dr. Changlu Wang, Dr. Coby Schal, Dr. Jules Silverman and Dr. Daniel Suiter I thank them all for their valuable assistance in collecting German cockroach strains from different locations in Florida and the United States. Dr. David Powell and Dr. Jodie Johnson deserve spec ial thanks for their expertise in mass spectrometry which allowed me to identify the breakdown products of indoxacarb. I thank Dr. Pauline Lawrence, Steven Milian and Oscar Hernandez for help wi th the use of ultra centrifuge. I owe a great deal of thanks t o Matthew Forhan for his help with cockroach rearing and bioassay s throughout the course of my doctoral work. I thank my lab colleagues Matt, Zach, Andres, Cheol, Joe, Monique and Marsha for a very friendly atmosphere in

PAGE 5

5 the lab. I am very thankful to Cheol for getting me started with cockroa ch rearing and resistance work. I am thankful to DuPont Professional Products for providing research funding. I thank Dr. Clay Scherer and Dr. Raj Saran from DuPont Inc. for providing technical assistance and materials required for research. Special thanks to Dr. John Capinera for providing me financial support and lab space during the final year of my Ph. D program. I greatly appreciate the help from Debbie Hall which allowed me to meet various departmental and graduate school deadlines. And last but not the least, I am grateful to my parents, grandparents my brother, Alok and my wonderful wife, Mithila whose continuous encouragement kept me going on even in the most challenging times during my doctoral research work.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES .......................................................................................................... 11 LIST OF FIGURES ........................................................................................................ 13 ABSTRACT ................................................................................................................... 15 CHAPTER 1 REVIEW OF LITERATURE .................................................................................... 17 Pest Status of the German Cockroach .................................................................... 17 Cockroach Control Strategies ................................................................................. 18 Mode of Action and Metabolism of Indoxacarb ....................................................... 20 Fipronil Mode of Action and Resistance Mechanisms ............................................ 22 Insecticide Resistance Monitoring .......................................................................... 23 Insecticide Resi stance Mechanisms ....................................................................... 25 Rationale, Overall Goal and Objectives .................................................................. 28 2 DEVELOPMENT OF STRATEGIES FOR MONITORING INDOXACARB AND GEL BAI T SUSCEPTIBILITY IN THE GERMAN COCKROACH (BLATTODEA: BLATTELLIDAE) 1 .................................................................................................. 31 Materials and Methods ............................................................................................ 34 Cockroach Strains and Rearing ........................................................................ 34 Chemicals ......................................................................................................... 34 Bioassays ......................................................................................................... 35 Topical lethal dose (LD) bioassays ............................................................ 35 Gel bait lethal time (LT) bioassays ............................................................. 36 Vial lethal concentration (LC) bioassays .................................................... 36 Bait matrix LD bioassays ............................................................................ 38 Data Analyses .................................................................................................. 39 Results .................................................................................................................... 40 Topical Lethal Dose Bioassays ........................................................................ 40 Gel Bait Lethal Time Bioassays ........................................................................ 40 Vial Lethal Concentration Bioassays ................................................................ 41 Bait Matrix Lethal Dose Bioassays ................................................................... 42 Discussion .............................................................................................................. 43 Resistance Profile in the Gainesville Resistant (GNV R) Strain ....................... 43 Development of Monitoring Techniques ........................................................... 45 Vial bioassay development ........................................................................ 46 Bait matrix bioassay development ............................................................. 47

PAGE 7

7 3 IMPLEMENTATION OF TWO TIERED MONITORING TECHNIQUE FOR DETERMINING INDOXACARB SUSCEPTIBILITY LEVELS IN FIE LD COLLECTED GERMAN COCKROACH POPULATIONS ....................................... 57 Materials and Methods ............................................................................................ 59 Insect Collection and Rearing ........................................................................... 59 Chemicals ......................................................................................................... 61 Vial Diagnostic Bioassays ................................................................................ 61 Oral Diagnostic Bioassays ................................................................................ 62 Data Analyses .................................................................................................. 62 Results .................................................................................................................... 63 Diagnostic Concentration Based Vial Bioassays .............................................. 63 Diagnostic Dose Based Oral Bioassays ........................................................... 64 Discussion .............................................................................................................. 65 Tier 1 Vial Dia gnostic Bioassays ...................................................................... 65 Tier 2 Oral Diagnostic Bioassays ..................................................................... 67 Indoxacarb as a Tool for German Cockroach Control ...................................... 69 Factors that May Contribute Toward Rapid Development of Indoxacarb Resistance .................................................................................................... 69 4 IN VIVO BIOTRANSFORMATION OF INDOXACARB IN THE GERMAN COCKROACH ........................................................................................................ 77 Materials and Methods ............................................................................................ 79 Cockroach Strains and Rearing ........................................................................ 79 Ch emicals ......................................................................................................... 80 Oral Bioassays ................................................................................................. 80 Time Course Studies of In Vivo Indoxacarb Biotransformation ........................ 81 High Pressure Liquid Chromatography (HPLC) Analysis ................................. 83 HPLC / Electrospray Ionization (ESI) Mass Spectrometry ( MS ) ....................... 84 Synergism Bioassays ....................................................................................... 85 In Vivo Inhibition Experiments .......................................................................... 86 Statistical Analyses of HPLC Data ................................................................... 86 Results .................................................................................................................... 88 Relative Toxicity of Indoxacarb and its Bioactive Metabolite (DCJW) in Lab and Field Strains ........................................................................................... 88 In Vivo Biotransformation ................................................................................. 88 Internal organosoluble fraction ................................................................... 88 External fraction ......................................................................................... 89 HPLC / ESI MS Analysis of Unidentified Metabolites ....................................... 90 Synergism Bioassays and In Vivo Inhibition Studies to Identify Candidate Biotransformation Enzymes .......................................................................... 91 Synergism bioassays ................................................................................. 91 HPLCbased in vivo inhibition experiments ................................................ 91 Discussion .............................................................................................................. 93 Indoxacarb and DCJW Toxicity at the Organismal Level ................................. 93 Putative Metabolites of Indoxacarb .................................................................. 94

PAGE 8

8 Strain Dependent Differences in Biotransformation of Indoxacarb ................... 95 Enzymes Involved in Indoxacarb Biotransformation ......................................... 96 Potential Indoxacarb Resistance Mechanisms in the Campus Club 45 Strain 98 5 RESISTANCE RISK ASSESSMENT: HERITABILITY AND POTENTIAL MECHANISM S OF INDOXACARB RESISTANCE IN THE GERMAN COCKROACH FOLLOWING LABORATORY SELECTION ................................. 114 Materials and Methods .......................................................................................... 116 Cockroach Strains .......................................................................................... 116 Chemicals ....................................................................................................... 116 Selection Experiments .................................................................................... 117 Oral Bioassays ............................................................................................... 118 Vial Bioassays ................................................................................................ 119 Estimation of Realized Heritability (h2) ........................................................... 119 Enzyme Preparations ..................................................................................... 120 Glutathione Transferase (GST) Assay ........................................................... 121 Cytochrome Monooxygenase (P450) Assay .................................................. 121 Esterase Assay .............................................................................................. 122 Esterase Native Polyacrylamide Gel Electrophoresis (PAGE) ....................... 123 Quan titative Real Time Polymerase Chain Reaction (qRT PCR) ................... 123 Results .................................................................................................................. 125 Pattern of Resistance Development over Six Generations ............................. 125 Magnitude of Indoxacarb Resistance Following Six Generations of Laboratory Selection ................................................................................... 125 Realized Heritability (h2) Estimates ................................................................ 126 Detoxification Enzyme Activities ..................................................................... 126 Esterase Native PAGE ................................................................................... 127 Expression of Detoxification Genes ................................................................ 127 Discussion ............................................................................................................ 128 Impact of Laboratory Selections on Indoxacarb Resistance ........................... 128 Insights into Biochemical Mechanisms of Indoxacarb Resistance .................. 132 6 MECHANISMS UNDERLYING FIPRONIL RESISTANCE IN A MULTI INSECTICIDE RESIST ANT FIELD STRAIN OF THE GERMAN COCKROACH .. 144 Materials and Methods .......................................................................................... 146 Insects ............................................................................................................ 146 Chemicals ....................................................................................................... 147 Topical Bioassays .......................................................................................... 147 Injection Bioassays ......................................................................................... 148 Neurophysiology Equipment ........................................................................... 149 Dissections, Neurophysiological Recordings and Analyses ........................... 149 Detection of the Alanin e to Serine (A302S) Mutation ..................................... 151 Data Analyses ................................................................................................ 152 Results .................................................................................................................. 152 E ffect of Synergists on Fipronil Toxicity .......................................................... 152

PAGE 9

9 Neurological Impacts of Fipronil ..................................................................... 153 Detection of the A302S Mutation and its Relati onship with Nervous System Insensitivity to Fipronil ................................................................................. 154 Discussion ............................................................................................................ 155 Role of Metabolic Mechanisms in Fipronil Resistance ................................... 155 Presence of A302S Mutation and Target Site Insensitivity to Fipronil ............ 157 Evidence for Multiple Mechanisms of Fipronil Resistance .............................. 158 7 SUMMARY ........................................................................................................... 166 Overall Goal and Objectives ................................................................................. 166 Hypotheses and Results ....................................................................................... 166 Significance and Implications of Research ........................................................... 170 APPENDIX A PERFORMANCE OF THE INDOXACARB TOLERANT STRAINS IN NO CHOI CE BIOASSAYS USING FORMULATED ADVION BAIT ........................... 173 Materials and Methods .......................................................................................... 173 Strains, Rearing and Chemicals ..................................................................... 173 No Choice Gel Bait Bioassays ....................................................................... 173 Results and Discussion ......................................................................................... 174 B DECLINE OF INDOXACARB CROSS RESISTANCE IN THE FIELD COLLECTED ARBOR PARK STRAIN AFTER CONTINUOUS LABORATORY REARING ............................................................................................................. 176 Materials and Methods .......................................................................................... 176 Inse cts, Rearing and Chemicals ..................................................................... 176 Oral Dose Response Bioassays ..................................................................... 176 Results and Discussion ......................................................................................... 177 C GERMAN COCKROACH EXPRESSED SEQUENCE TAG (EST) LIBRARY: A TOOL FOR IDENTIFYING INSECTICIDE BIOTRANSFORMATION GENES ...... 179 Materials and Methods .......................................................................................... 179 Cockroach Strains and Rearing ...................................................................... 179 Construction of NonNormalized EST Library ................................................. 179 Se quencing of Clones .................................................................................... 180 Sequence Analysis ......................................................................................... 180 Results and Discussion ......................................................................................... 181 D RELATIVE EXPRESSION OF BIOTRANSFORMATION GENES IN CARCASS AND GUT TISSUES ............................................................................................. 188 Materials and Methods .......................................................................................... 188 Cockroach Strains and Rearing ...................................................................... 188

PAGE 10

10 Primer Design and Validation ......................................................................... 188 Dissections, Nucleic Acid Isolation and Synthesis .......................................... 189 Quantitative Real Time PCR (qRT PCR) ....................................................... 189 Results .................................................................................................................. 190 LIST OF REFERENCES ............................................................................................. 195 BIOGRAPHICAL SKETCH .......................................................................................... 209

PAGE 11

11 LIST OF TABLES Table page 1 1 Common insecticide gel bait s used for t he German cockroach .......................... 30 2 1 Topical lethal dose bioassay results for adult male German cockroaches. ........ 51 2 2 Gel bait lethal time bioassay results for adult male German cockroaches .......... 52 2 3 Indoxacarb vial lethal concentration bioassay results for adult male German cockroaches. ...................................................................................................... 52 2 4 Bait matrix lethal dose bioassay results for adult male German cockroaches. ... 53 3 1 Details of field collected German cockroach strains from the United States ...... 71 4 1 Oral toxicity of indoxacarb and its bioactive metabolite (DCJW) ....................... 101 4 2 Results of oneway Kruskal Wallis analyses for in vivo bio transformation studies with indoxacarb .................................................................................... 102 4 3 Molecular weights (MWs) and positive (+) electro spray ionization (ESI) mass spectrometry (MS) attributes of indoxacarb and its metabolites. ...................... 103 4 4 Analysis of variance (ANOVA) results for in vivo inhibition of indoxacarb biotransformation. ............................................................................................. 104 5 1 Summary of indoxacarb s election experim ents with the Arbor Park strain ....... 136 5 2 Magnitude and realized heritability (h2) of indoxacarb resistance in the Arbor Park strain following six generations of laboratory selec tion. ........................... 137 5 3 Surfacecontact (vial) toxicity of indoxacarb to pooled unselected and selected lines of the Arbor Park strain .............................................................. 138 5 4 Relative expression of putative detoxification genes. ....................................... 138 5 5 Standard deviation of critical threshold (CT ) values for the two reference genes and eight target genes. .......................................................................... 139 6 1 Effect of insecticide synergists on fipronil toxicity ............................................. 161 B 1 Oral toxicity of indoxacarb to the Arbor Park (AP) and Johnson Wax Susceptible (JWax S) strains ............................................................................ 178 C 1 List of biotransformation genes ......................................................................... 186

PAGE 12

12 D 1 List of quantitative real time polymerase chain reaction (qRT PCR) primers for reference and target genes ......................................................................... 192

PAGE 13

13 LIST OF FIGURES Figure page 1 1 Proposed bioactivation pathway of indoxacarb in lepidopteran and hemipteran insects ............................................................................................. 30 2 1 Indoxacarb concentrationmortality curves obtained in vial lethal concentration bioassays ..................................................................................... 53 2 2 Results of diagnostic concentration (DC) vial bioassays .................................... 54 2 3 Indoxacarb oral dosemortality curves as obtained in bait matrix lethal dose bioassays ........................................................................................................... 55 2 4 Results of diagnostic dose bait matrix bioassays. .............................................. 56 3 1 Results of diagnostic concentration (DC) vial bioassays at DC1 (30 g per vial or 0.44 g per cm2) ...................................................................................... 72 3 2 Results of diagnostic concentration (DC) vial bioassays at DC2 (60 g per vial or 0.88 g per cm2). ..................................................................................... 73 3 3 Results of diagnostic dose ( DD) oral bioassays at DD1 (1.0 g per insect). ...... 74 3 4 Results of diagnostic dose (DD) oral bioassays at DD2 (1.5 g per insect). ...... 75 3 5 Results of diagnostic dose (DD) oral bioassays at DD3 (2.5 g per insect). ...... 76 4 1 Representative high pressure liquid chromatography (HPLC) chromatograms from time course experiments .......................................................................... 105 4 2 Percent distribution of indoxacarb and indoxacarbmetabolite peaks (isolated from the organosoluble / internal fraction) on HPLC chromatograms. .............. 106 4 3 Percent distribution of indoxacarb and indoxacarbmetabolite peaks (isolated from the holding vial / external fraction) on HPLC chromatograms ................... 107 4 4 Putative bi otransformation pathways of indoxacarb ......................................... 108 4 5 Effects of the enzymeinhibiting insecticide synergists DEF (an esterase inhibitor) and PBO (a cytochrome P450 inhibitor) on oral toxicity of ind oxacarb to the Johnson Wax S usceptible (JWax S), Arbor Park (AP) and Gainesville Resistant (GNV R) strains ............................................................. 109 4 6 Effect of the enzymeinhibiting insecticide synergists DEF (an esterase inhib itor) and PBO (a cytochrome P450 inhibitor) on oral toxicity of indoxacarb to the Campus C lub 45 (CC45) strain ............................................ 110

PAGE 14

14 4 7 Representative HPLC chromatograms from the in vivo inhibition experiment (internal organosoluble fraction at 24 h post treatment) ................................... 111 4 8 In vivo inhibition of indoxacarb biotransformation by DEF and PBO in four German cockroach strains ................................................................................ 112 4 9 In vivo inhibition of indoxacarb metabolism by DEF (an esterase inhibitor) and PBO (a cytochrome P450 inhibitor) ........................................................... 113 5 1 Generationwise susceptibil ity testing of adult males of selected and unselected lines at three doses ........................................................................ 140 5 2 Generationwise susceptibility testing of adult males of selected and unselected lines at two diagnostic conc entrations ............................................ 141 5 3 Average chlorodinitrobenzene (CDNB) conjugation activity of glutathione transferases (GSTs) ......................................................................................... 141 5 4 Comparati ve p nitroanisole (PNA) O demethylation activity of cytochrome P450 monooxygenases (P450s) ....................................................................... 142 5 5 Comparison of general esterases from soluble protein fractions of the selected and unselected populations ................................................................ 143 6 1 Effect of bioassay method on synergism profiles .............................................. 162 6 2 Summary of electrophysiology recordings and alanine to serine (A302S) allele frequency measurements. ....................................................................... 163 6 3 Alignment (Clustal W) of a 245 base pair region of the Blattella germanica resistance to dieldrin ( Rdl) nucleotide sequence .............................................. 164 6 4 Logistic regression of the alanine to serine (A302S) mutation frequency (Y axis) by average departure of electrical activity from baseline determined in neurophysiological recordings (X axis) ............................................................. 165 A 1 Performance of the Johnson Wax S usceptible (JWax S) and indoxacarb tolerant (CB 2009 and CC45) field strains ........................................................ 1 75 C 1 Summa ry of German cockroach midgut and fat body expressed sequence tag (EST) library sequencing ............................................................................ 187 D 1 Representative 2% agarose gel showing polymerase chain reaction (PCR) products of the eight biotransformation genes and two reference genes ......... 193 D 2 Relative expression of the eight biotransformation genes ................................ 194

PAGE 15

15 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy INDOXACARB TOXICOLOGY AND SUSCEPTIBILITY MONITORING IN THE GERMAN COCKROACH By Ameya Dilip Gondhalekar August 2 011 Chair: Michael E. Scharf Major: Entomology and Nematology German cockroaches ( Blattella germanica L.) are synanpthropic pests of medical and economic importance Indoxacarb, a sodium channel blocker insecticide, has been in widespread use for German cockroach control in the United States since 2006. Despite its widespread use, little is known about (1) indoxacarb susceptibility levels in German cockroach field populations, (2) indoxacarb biotransformation pathways in the German cockroach and (3) resis tance mechanisms that may evolve following selection with indoxacarb. Lack of research in these areas has resulted in a considerable knowledge gap. Hence, research was undertaken to bridge this gap and develop a better understanding of indoxacarb toxicolog y in the German cockroach. Vial and oral diagnostic bioassays were developed for monitoring indoxacarb susceptibility levels in German cockroach field populations. M onitoring bioassays conducted with fourteen fieldcollected strains revealed that significa nt indoxacarb tolerance exists in nearl y all sampled field populations. However, high magnitude resistance capable of causing control failures to formulated indoxacarb bait s was detected in only one strain (CC45). Low level indoxacarb tolerance in the Gain esville Resistant ( GNV R ) strain, which is highly resistant to organochlorine, organophosphate,

PAGE 16

16 carbamate, cyclodiene and phenylpy razole insecticides, suggested that cross resistance to indoxacarb may not be significant in field populations. In vivo biotransformation experiments confirmed that bioactivation of indoxac arb to its N decarbomethoxylated metabolite (DCJW) occurs in the German cockroach. Also, both indoxacarb and DCJW appear to undergo extensive biotransformation to indanone ring hydroxylated, ox adiazine ring opened and other yet unidentified metabolites. Synergism bioassays and in vivo inhibition studies using enzyme inhibitors implied involvement of cytochrome P450 monooxygenases in formation of DCJW and other metabolites R eplicated laboratory selection studies with the Arbor Park (AP) strain showed that the indoxacarb resistance phenotype is moderately heritable and resistance can increase significantly following continuous exposure to indoxacarb. Preliminary studies with the selected lines sug gested roles for esterases and P450s in indoxacarb resistance Finally, the combined effects of target site insensitivity and enhanced P450mediated metabolism appear to be responsible for 37fold fipronil (another insecticide used for cockroach control) r esistance in the GNV R strain that exhibits low level indoxacarb tolerance. Together, these findings provide important new information on indoxacarb toxicology and resistance management in the German cockroach.

PAGE 17

17 CHAPTER 1 REVIEW OF LITERATURE Pest Status o f the German Cockroach Of the 4 000 cockroach species known today, about 50 are peridomestic or domestic and the German cockroach, Blattella germanica L. (Blattodea: Blattellidae) is predominant among them (Brenner 1995). German cockroaches are syna nth rop ic pests of economic, medical and veterinary importance (Schal & Hamilton 1990). They contaminate households, fo odstuffs, food processing areas and animal rearing facilities with their feces and body parts ( Brenner et al. 1995, Zurek and Schal 2003, Appel 2005) The mere presence of cockroaches in family dwellings can cause diminished psychological well being of the inhabitants (Brenner 1995). German c ockroaches are known to be carriers / vectors of pathogenic bacteria ( Salmonella, Escherichia, Shigella etc .), fungi, mold and certain viruses ( Ash and Greenberg 1980, Kopanic et al. 1994, Brenner 1995, Rosentreich et al. 1997). German cockroaches are also known to infest animal rearing facilities (especially swine rearing facilities) and may serve as mechanical vectors of pathogenic E. coli within these facilities (Zurek and Schal 2004). A llergen proteins associated with the feces and defensive excretions of the German cockroaches are considered as a leading cause of childhood asthma in the United States (IOM 2 000). The study of Pollart et al (1989) showed a direct association between exposure and sensitization to cockroach allergens and asthma. Recently, the major German cockroach allergens, Bla g 1 and Bla g 4 were shown to be produced in the midgut and male reproductive organs, respectively (Fan et al. 2005, Gore and Schal 2005). Certain sigma and delta class glutathione transferases (enzymes involved in insecticide resistance) from the German cockroach are also reported to exhibit IgE

PAGE 18

18 antibody binding activi ty, thus indicating the allergenic nature of the enzyme (Jeong et al. 2009). Considering these various problems related to German cockroach infestations there is no doubt that they are one of the leading urban pests (Brenner 1995). Extensive research has s hown that one of the most efficient ways of overcoming the problems posed by the German cockroach is their effective control (Schal and Hamilton 1990, Arbes et al. 2004, Miller and Meek 2004, Nalyanya et al. 2009). T hus, research targeted for evaluating or improving the available control strategies is essential. Cockroach Control Strategies As a consequence of the enactment of the Food Quality Protection Act (FQPA) (U.S. EPA 1996) methods used for the management of German cockroaches have changed drastical ly since the late 1990s. Residual sprays of insecticides (except chlorfenapyr and certain pyrethroids ) for the control of German cockroach es are now restricted in food handling and processing facilities, households, schools and animal rearing facilities. T he enactment of FQPA has also resulted in the phasingout of organophosphate and carbamate insecticides due to widespread resistance problems and environmental hazards posed by these insecticides. Thus, use of gel bait insecticides in the United States (U. S.) has been the main control strategy for German cockroaches over the last 12 to 15 years (Harbison et al. 2003). Although the use of gel bait insecticides became popular in the 1990s, the first use of toxic baits for cockroach control dates back to the 1860s (Frishman 1982). Toxic baits of phosphorus, boric acid and other compounds (used in the 19th century) were more effective in controlling American and other peridomestic cockroaches but were not useful for control of German cockroaches (Cheng and Cam pbell 1940). The efficacy of

PAGE 19

19 these formulations, however, was highly variable as they were homemade by pest control operators in small batches with different food products (Rust et al. 1995). Later, in the 1960s and 1970s, organophosphateand carbamatebased bait formulations that were developed had greater stability and offered much faster mortality than earlier baits, but their widespread adoption was limited by repellency and insecticide resistance (Buczkowski et al. 2001). However, the discovery of hydramethylnon, a slow acting, nonrepellent am i dinohydrazone insecticide with high oral efficacy against the German cockroach (Milio et al. 1986, Hollingshaus 1987) and s ubsequent improvements in the formulation, delivery and deployment of gel baits resulted in a new era of pest control technology. After the introduction of hydramethylnon baits in the 1980s several other bait products containing insecticides like abamectin, imidacloprid, fipronil and indoxacarb have been made available for cockroach control ( Table 1 1). B ait insecticides offer greater efficacy, reduced nontarget exposure to insecticides, longer persist ence, low odor and utility in insecticide sensitive areas ( Milio et al. 1986, Koehler and Patterson 1989, Ross 1993, Appel and Tanley 2000, A ppel 2003, Buckzwoski et al. 2001). High efficacy of gel baits is attributable to the high er dose of active ingredient (A.I.) present in the gel baits, novel modes of action of gel bait A.I.s and secondary / tertiary mortality caused by horizontal transf er of insecticides among conspecifics ( Reierson 1995, Buczkowski and Schal 2001, Holbrook et al. 2003, Wang et al. 2004, Buczkowski et al. 2001, 2008). Secondary or tertiary mortality due to horizontal transfer of insecticides is common in gregarious or se mi social insects like the German cockroach because the less mobile stages of the population (young nymphs) or unexposed individuals can receive insecticide through

PAGE 20

20 contact with treated insects, ingestion of excretions from treated insects (emetophagy), fe eding on fecal matter ( coprophagy ) and feeding on dead conspecifics ( necrophagy ) ( Kopanic and Schal 1997, 1999; Galhoff et al. 1999, Buczkowski and Schal 2001, Buczkowski et al. 2001 ). At present, Advion ( 0.6% indoxacarb) and Maxforce FC Select cockroach gel bait (0.01% fipronil) are the most widely used bait formulations for cockroach control. In 2010, a spray formulation of indoxacarb (Arilon 20% WDG) was also introduced for control of cockroaches, ants and termites in urban environments. Mode of A ctio n and Metabolism of Indoxacarb Indoxacarb, an oxadiazineclass insecticide was first commercialized for use in agriculture by the E.I. DuPont Company in the year 2000 under trade name Stewart and Avaunt (McCann et al. 2001). The S isomer (KN128) is t he active isomer of indoxacarb whereas the R isomer (KN127) has no insecticidal activity. The commercially available insecticide is a 75%S: 25%R mixture of the two enantiomers (Wing et al. 1998, 2000; McCann et al. 2001). The U.S. Environmental Protection Agency (EPA) classifies indoxacarb as a reduced risk insecticide that is less hazardous to humans, nontarget organisms and the environment (U.S. EPA 2000). Indoxacarb is a potent sodium channel blocker insecticide and is highly toxic to lepidopteran i nsects as well as some H emiptera Coleoptera and Blattodea (Wing et al. 2000, Appel 2003). In the case of lepidopteran larvae, there is a cessation of feeding upon ingestion of indoxacarb, followed by mild convulsions or passive paralysis from which there is no recovery (Wing et al. 1998). Although indoxacarb exhibits good contact activity in certain situations, it has been shown to be more active via ingestion (Bostanian et al. 2004, Wing et al. 1998). Recently, in 2006 and 2010 bait and spray

PAGE 21

21 formulations of indoxacarb respectively, have been introduced for the control of urban and turf pests like cockr oaches, ants and mole crickets. A key feature of indoxacarb is its novel bioactivation to an N decarbomethoxylated metabolite, DCJW (Figure 1 1), apparentl y mediated by esterase / amidase enzymes (Wing et al. 1998, 2000 ). Upon bioactivation, the active indoxacarb metabolite ( DCJW ) blocks insect neuronal sodium channels more potently than the parent compound, indoxacarb (Wing et al. 2000, Lapied et al. 2001, Zhao et al. 2005 b ). Also, the action of DCJW on insect sodium channels is irreversible, whereas the action of indoxacarb is completely reversible (Zhao et al. 2005 b Wing et al. 2000). The blocking of sodium channels by indoxacarb and DCJW causes a reducti on in amplitude of action potentials. Electrophysiological studies with rat and insect sodium channels expressed in Xenopus oocytes have shown that indoxacarb and DCJW specifically bind to sodium channels during inactivation stage of the action potential a nd that the binding site overlaps with that of the therapeutic sodium channel blockers like lidocaine and p henytoin (Wing et al. 1998, Lapied et al. 2001, Silver and Soderlund 2005, Song et al. 2006). However, the blocking action of indoxacarb and DCJW was found to be different from that of tetrodotoxin, which is a potent and naturally derived sodium channel blocking toxin (Lapied et al. 2001). Although the bioactivation of indoxacarb in lepidopteran and other insects is shown to be mediated by esterase / amidase enzymes (Wing et al. 1998, 2000; Alves et al. 2008), there are some reports which also indicate the role of esterases in the detoxification of indox acarb (Sayyed and Wright 2006). In contrast, s tudies with house flies Musca domestica indicate the involvement of cytochrome P450 enzymes in

PAGE 22

22 detoxification of indoxacarb (Shono et al. 2004). As a result, the exact mechanisms of indoxacarb bioactivation and detoxification still remain ambiguous, especially in the German cockroach Hence, studies investig ating indoxacarb biotransformation pathways in insects, including German cockroaches, are urgently needed. Fipronil Mode of Action and Resistance Mechanisms T he phenylpyrazole insecticide fipronil acts antagonistically with the resistance to dieldrin (Rdl) subunit of the amino butyric acid (GABA) receptor (Cole et al. 1993, Gant et al. 1998) and i s widely used as a contact and stomach insecticide. Fipronil poisoning symptoms include hyper excitation, convulsions, paralysis and ultimately death. Its mode of action is similar to cyclodiene insecticides that were widely used from the 1950s to 1970s. Whole cell patchclamp recordings with insect nerve preparations have demonstrated that fipronil can also inhibit ionotropic glutamategated chloride channels ( Zhao and Salgado 2010). In insects fipronil is known to undergo P450based sulfoxidation to a sulfone metabolite (Scharf et al. 2000, Durham et al. 2002) The sulfone metabolite of fipronil is equally toxic to insects as the parent compound fipronil (Hain zl et al., 1998, Scharf and Siegfried 1999, Zhao and Salgado 2010) Because fipronil and cyclodiene insecticides are thought to act at the same target site, the mechanisms of cyclodiene resistance that exist in insects also confer limited crossresistance to fipronil (Cole et al. 1993, 1995, Hosie et al. 2001, Le Goff et al. 2005). R esistance to cyclodiene insecticides in several insect species is known to be caused by a single alanine to serine substitution (A302S; commonly known as the Rdl mutation) at position 302 ( Drosophila melanogaster numbering) in the Rdl gene that encodes for the Rdl subunit of the GABA receptor (ffrenchConstant et al. 2000, Daborn

PAGE 23

23 et al. 2004, Hansen et al. 2005, Li et al. 2006). Although the use of cyclodiene insecticides has bee n discontinued since the early 1980s the frequency of the Rdl mutation and/or cyclodiene resistance in field and lab populations of diff erent insect taxa is still high (Cole et al. 1993, 1995 Scott and Wen 1997, ffrenchConstant et al. 2000, Holbrook et a l. 2003, Kristensen et al. 2005). In the German cockroach, cyclodieneresistant strains have been reported to exhibit 7to 17 fold resistance to fipronil. In certain insect species, enhanced metabolism of fipronil by P450s has also been linked to fiproni l resistance (Scott and Wen 1997, Valles et al. 1997, Wen and Scott 1999, How and Lee 2011). Insecticide Resistance Monitoring Resistance monitoring is central to insecticide resistance m anagement programs (ffrench Constant and Roush 1990). The methods used for a resistance monitoring program depend on the purpose of program. Most commonly, resistance monitoring has been used to confirm whether or not a control failure was caused by resistance (ffrenchConstant and Roush 1990). The other aims of resistance monitoring may be to measure and identify resistant genotypes, to provide accurate warning of impending resistance problems, to determine changes in the distribution or severity of resistance, or to test the effectiveness of resistance management tactics ( Brent 1986). A monitoring program to detect resistance levels well before control failures occur requires greater precision in estimating the frequency of resistant individuals than does a resistance documentation program (Roush and Miller 1986). Probit l e thal dose (LD) and slope estimates, although adequate for documenting resistance at high frequencies, are ineffective for detecting small changes in resistance frequency (ffrenchConstant and Roush 1990). In cases where resistance frequency is expected to be low

PAGE 24

24 and resistance is just starting to appear in a population, the best technique is to use a diagnostic dose or concentration that kills 99% of the susceptible population and a relatively lower number of resistant individuals. To get an accurate estimate of the susceptible LD99 it is better to use more than one laboratory population, as laboratory susceptible populations typically bear little resemblance to susceptible populations found in the field (Roush and Miller 1986). Using multiple susceptible po pulations for diagnostic concentration determination significantly increases the chances of accurately discriminating between susceptible a nd resistant field populations. The choice of an appropriate bioassay method that provides good discrimination between susceptible and resistant genotypes is another crucial component of resistance monitoring programs (ffrenchConstant and Roush 1990). In the case of spider mites, the leaf residue bioassay method effectively discriminated between resistant and susceptibl e populations but the standard slide dip assay method was unable to show significant resistance (Dennehy et al. 1983). Similarly, a particular strain of the German cockroach resistant to permethrin and fenvalerate by topical and residual techniques showed resistance to cypermethrin and deltamethrin only by topical tests (Scott et al. 1986). Thus, before selecting a method for large scale resistance monitoring it is often beneficial to test all relevant bioassay methods for their appropriateness. For the Ger man cockroach Scharf et al. (1995) suggested the use of jar tests (surface contact bio assays) in combination with topical tests to completely understand the resistance profile to neurotoxins like cypermethrin and chlorpyrifos For gel bait insecticides t hat act via ingestion, emphasis should be placed on bioassay methods that allow ingestion of toxicant and clear discrimination between

PAGE 25

25 resistant and susceptible genotypes. Holbrook et al. (2003) reported topical and oral methods to be equally effective in detecting fi pronil resistance in feral populations of the German cockroach. However, in the case of indoxacarb, which is known to be more active via ingestion (Wing et al. 1998), topical bioassays may not be suitable for resistance monitoring because of the lower contact activity of indoxacarb and exaggeration of resistance ratios provided by this method. In this case, a surface contact bioassay method, which is less labor intensive and allows ingestion of toxicant (Scharf et al. 1995) can be used in combi n ation with an oral bioassay method. Moreover, if a blank bait matrix treated with a diagnostic dose can be used in oral feeding tests it will also be helpful for simultaneously screening fieldcollected populations for potential behavioral (bait aversion) and physiological resistance to gel bait s (see below) Insecticide Resistance M echanisms Insecticide resistance in the German cockroach has been a significant hurdle preventing its successful control for decades. Chlordane resistance was the first report of insecticide resistance in the German cockroach (Grayson 1951). Since then, dozens of reports of resistance have been documented to almost all classes of conventional insecticides used for German cockroach control ( e.g., Scott and Matsumura 1981, Cochran 1989, Valles and Yu 1996, Scharf et al. 1997, Wu et al. 1998, Holbrook et al. 2003, Hemingway et al. 1993, Wei et al. 2001, Hansen et al. 2005). The broad categories of insecticide resistance mechanisms that have been reported in the German cockroach are: physiological resistance ( enhanced metabolism, altered target site sensitivity and reduced cuticular penetration) and behavioral resistance (insecticide and bait aversion) Of these, enhanced metabolism and target site insensitivity are the most

PAGE 26

26 common (S iegfried et al. 1990, Kaku and Matsumura 1994, Prabhakaran and Kamble 1995, Valles et al. 1996, Dong 1997, Scharf et al. 1998a, 1998 b ; Wu et al. 1998, Pridgeon et al. 2002). Enhanced metabolism involves increased expression or activity of insecticide meta bolizing enzymes like cytochrome P450 monooxygenases (P450s) esterases and glutathione transferases (GSTs). Higher activities and expression of these enzymes have been reported in different resistant strains of the German cockroach (Siegfr ied and Scott, 1992, Valles and Yu 1996, Scharf et al. 1998a, 1998b; Wu et al. 1998, Valles 1998). In the case of target site insensitivity, a point mutation(s) in the chloride channel confer s high levels of resistance to cyclodienes and limited cross resistance to fipronil (Kaku and Matsumura 1994, Hansen et al 2005) ; whereas mutations in the para homolog o us sodium channel contributes high levels of resistance to organochlorines (DDT) and pyrethroids (Dong 1997, Liu et al. 2000). Recently, using sitedirected muta genesi s it has been shown that E1689K mutation in B. germanica sodium channel is a molecular determinant of voltagedependent sodium channel inactivation and statedependent action of DCJW (S ong et al. 2006). Reduced cuticular penetration has been considered a m inor mechanism of insecticide resistance. But, it can amplify resistance levels in the presence of other resistance mechanisms like metabolism and target site insensitivity (Siegfried and Scott 1992). Fenvalerate resistance in the Mu n syana strain of Germ an cockroach was shown to be caused by a combination of reduced cuticular penetration and enhanced metabolism (Wu et al. 1998).

PAGE 27

27 Bait aversion (behavioral resistance) in the German cockroach to gel bait insecticides was originally caused by avoidance of sugars and other proprietary components present in bait matri ces (Silverman and Bieman 1993, Wang et al. 2004, 2006). The averse cockroaches avoid feeding on gel baits which ultimately leads to unsatisfactory control or even control failures C ontinuous impr ovements in baiting and bait matrix technologies however, have helped overcome this type of resistance. The abovementioned mechanisms of resistance ( except bait aversion resistance) have been documented mainly for residually applied contact insecticides like pyrethroids, organophosphates, carbamates, cyclodienes etc. However, to date significant levels of physiological resistance (capable of causing control failures) to gel bait insecticides have not been reported in the German cockroach (Valles and Br enner 1999, Holbrook et al. 2003, Wang et al. 2006). As such, the historical importance of insecticide resistance in the German cockroach has become largely forgotten by the urban pest management industry due to the effective and safe control provided by g el bait insecticides. Although there have been no reports of Advion resistance in the German cockroach, resistance to indoxacarb has been reported in laboratory selected strains of other insects. Selection of fieldcollected house flies with indoxacarb for three generations resulted in >118fold resistance over an unselected laboratory strain, apparently due to P450s (Shono et al 2004). Similarly, selection of Heliothis virescens larvae with indoxacarb for nine generations increased indoxacarb resistance by 55 fold as compared to an unselected population (Sayyed et al. 2008b ). In another study,

PAGE 28

28 indoxacarb resistance in the diamondback moth was found to be esterasebased (Sayyed and Wright 2006) Rationale, Overall Goal and Objectives The majority of insecti cide resistance research has been conducted when control failures against target insects have become widespread. However, because of the increased costs and time required for discovering and launching new insecticidal compounds with unique chemistries, new emphasis is being given to understanding basic toxicology and resistance risks well before resistance becomes rampant in target insects. Considering that insecticides have become the only major line of defense available against German cockroaches, underst anding the resistance risks and toxicology of insecticides used for cockroach control assumes even greater significance. At present, indoxacarbcontaining bait and spray formulations are being widely used for cockroach control and are providing satisfactor y control in most cases. However, considering the evolutionary capabilities of the German cockroach, the risks of resistance developing to indoxacarb are extremely high. Hence, the overall goal of this research was to develop an indepth understanding of i ndoxacarb toxicology in the German cockroach. To reach this overall goal the following objectives were pursued. 1) Determine indoxacarb susceptibility levels in German cockroach field populations. The goal of Chapter 2 was to develop bioassay techniques for m onitoring indoxacarb susceptibility levels in fieldcollected populations of the German cockroach. Additionally, comparative toxicity of eleven different insecticides to an indoxacarb nave field strain was also determined. The goal of chapter 3 was to use the monitoring technique developed under chapter 2 for determining indoxacarb susceptibility in fieldcollected cockroach populations from multiple locations within the U.S. The working hypothesis of this study was that the fieldcollected populations would show at least some degree of significant survivorship (in comparison to susceptible populations) in vial and oral diagnostic bioassays. 2) Elucidate in vivo biotransformation pathways of indoxacarb. For chapter 4 my working hypotheses were that extensive indoxacarb biotransformation occurs in

PAGE 29

29 the German cockroach, and that P450 enzymes will play some role in the biotransformation process. 3) Identify indoxacarb resistance mechanisms that build in populations following laboratory selection. The working hypothesis for chapter 5 was that one of the existing known mechanisms of insecticide resistance in the German cockroach will be responsible for increased indoxacarb resistance after selection. 4) Characterize fipronil resistance mechanisms in an indoxacarb nave fi eld strain. The goal chapter 6 was to identify mechanisms of highlevel fipronil resistance in a German cockroach field strain that exhibits low level indoxacarb tolerance. My working hypothesis was that higher level fipronil resistance ( i.e., >35x) in Ger man cockroaches is caused by multiple resistance mechanisms.

PAGE 30

30 Table 11. Common insecticide gel baits used for the German cockroach. Trade name and manufacturer Registration year Active ingredient Mode of action MaxforceProfessional Insect Control Roach Killer Bait Gel (Bayer) 1992 2.15% hydramethylnon Uncoupler of oxidative phosphorylation Prescription Treatment Avert Cockroach Gel Bait Formula 3 (Whitmire Micro Gen) 1997 0.05% abamectin Glutamate receptor agonist Maxforce FC Select Roach Killer Ba it Gel (Bayer) 1998 0.01% fipronil GABA receptor antagonist Pre Empt Professional Cockroach Gel Bait (Bayer) 1999 2.15% imidacloprid Nicotinic acetyl choline receptor agonist. Advion Cockroach Gel Bait (DuPont) 2006 0.6% indoxacarb Sodium channel bl ocker Figure 11. Proposed bioactivation pathway of indoxacarb in lepidopteran and hemipteran insects (Wing et al. 1998, 2000)

PAGE 31

31 1 Reprinted with per mission from Gondhalekar et al. (2011). CHAPTER 2 DEVELOPMENT OF STRAT EGIES FOR MONITORING INDOXACARB AND GEL BAIT SUSCEPTIBILITY IN THE GERMAN COCKROACH (BL ATT ODEA: BLATTELLIDAE) 1 The enactment of the Food Quality Protection Act (U.S. EPA 1996) and insecticide resistance problems associated with residual applications of carbamate, cyclodiene, organophosphate and pyrethroid insecticides (Scott and Matsumura 1981, Cochran 1989, Valles and Yu 1996, Scharf et al. 1997, Wu et al. 1998) have resulted in phasing out of many residual insecticides for Blattella germanica (L.) control. As a consequence, current control strategies for the German cockroach are mainly based on the use of gel bait formulations of insecticides like indoxacarb, fipronil, imidacloprid, abamectin and hydramethylnon (Buczkowski et al. 2001, Appel 2003, Holbrook et al. 2003, Wang et al. 2004). Bait insecticides offer increased efficacy, greater pest specificity, reduced nontarget hazards and utility in insecticide sensitive areas (Buczkowski et al. 2001, Appel 2003, Bieman and Scherer 2007) Moreover, due to the high concentration of active ingredient (A.I.) in gel baits, cockroaches are considere d less likely to develop high levels of physiological resistance to gel bait insecticides (Holbrook et al. 2003, Wang et al. 2004, Reierson 1995, Buczkowski and Schal 2001) In this regard, higher concentration of A.I in baits tends to overwhelm the resist ance mechanisms thereby suppressing the expression of resistance. All of these factors have led to widespread use of gel baits to control cockroaches in the United States for t he past 15 years (Harbison et al. 2003). In some cases, however, continuous use of bait insecticides for cockroach control has selected for behavioral resistance (Silverman and Bieman 1993, Wang et al. 2004, 2006). Subsequently, proprietary manipulations of bait matrix ingredients have

PAGE 32

32 overcome these cases of behavioral resistance ( Silverman and Bieman 1993, Wang et al 2004). In contrast, high level physiological resistance capable of causing control failures to gel bait insecticides has not yet been detected in the German cockroach (Holbrook et al 2003, Wang et al. 2004, 2006; Val les et al. 1997). Nevertheless, the adaptive nature and history of development of physiological resistance in German cockroaches are well documented (Scott and Matsumura 1981, Cochran 1989, Scharf et al. 1995, 1998b; Wu et al. 1998, Holbrook et al. 2003) a nd suggests that the risk for development of physiological resistance to gel bait A.I.s is eminent and should be carefully monitored. Advion cockroach gel bait (0.6% indoxacarb) was introduced in 2006 for use against B. germanica and other species of cock roaches. Unlike DDT and pyrethroids which act by prolonging the deactivation phase of insect sodium channels (Soderlund 2005, Dong 2007) indoxacarb has been shown to inhibit insect sodium channels by blocking the flow of sodium ions through the channels pore (Wing et al. 2000, Lapied et al. 2001, Zhao et al. 2005b, Song et al. 2006) Also, while the parent compound, indoxacarb, has reversible effects on insect sodium channels, it is metabolized to a potent N decarbomethoxylated metabolite (DCJW) that irre versibly inhibits current flow through insect sodium channels (Wing et al. 2000, et al. 2005b) It is proposed that indoxacarb is effective in controlling insects which have developed resistance to carbamates, organophosphates and pyrethroids (McCann et al 2001). A recent study by Chai and Lee (2010) showed that German cockroach field populations from Singapore resistant to organophos phates, carbamates, pyrethroids and fipronil were susceptible to indoxacarb. In another study, indoxacarb gel bait treatment s were

PAGE 33

33 reported to be effective in eliminating German cockroach infestations in a residential area where sprays of pyrethroids, insect growth regulators and other bait formulations had proven unsuccessful (Bieman and Scherer 2007) Indoxacarb is also known to be horizontally transferred in German cockroaches and is capable of causing not only secondary, but also tertiary and low level quaternary mortality (Buczkowski et al. 2008) As mentioned, Advion and other cockroach bait products are in widespread use for German cockroach control in the U.S. Despite such widespread use, studies to evaluate and establish reference susceptibility baselines for resistance monitoring are lacking, except for fipronil (Holbrook et al 2003) Knowledge obtained from such basel ine toxicity studies provides the basis for estimation of susceptibility shifts in German cockroach field populations that result from both physiological and behavioral mechanisms. Ultimately, the knowledge gained from such studies would enable the design of resistance management strategies to delay the onset of resistance (Scharf et al. 1998b) and thus extend the life of cockroach baits as an effective management tool. The broad goals of this study were: (1) to define the insecticide resistance profile in the Gainesville R (GNV R) strain of the German cockroach and (2) to use this strain and other labsusceptible and field strains to develop and compare bioassay methods for their utility in monitoring indoxacarb and Advion susceptibility. Initially, the re sistance profile in the GNV R strain to 11 different insecticides (including indoxacarb) and five formulated cockroach gel baits (including Advion) was determined by topical lethal dose (LD) and gel bait lethal time (LT) bioassay methods, respectively. Ne xt, baseline susceptibility of the Johnson Wax Suscep tible ( JWax S ) GNV R and two additional strains was determined by vial lethal concentration (LC) and gel bait matrix

PAGE 34

34 LD bioassays. These baseline toxicity data were then used to identify appropriate bio assay method(s) and to determine diagnostic concentrations and doses for future use in formal susceptibility monitoring programs on fieldcollected populations. Materials and Methods Cockroach Strains and R earing Four German cockroach strains were used in this study : JWax S, T164 backcross, GNV R and Arbor Park (AP). The JWax S strain was used as a susceptible laboratory strain. The T164 backcross strain originated from a backcross of the T164 strain (a glucose averse strain) with the Orlando strain (Silve rman and Bieman 1993) The GNV R strain was collected in 2006 from an apartment in Gainesville, FL, after control failures with Avert gel bait, pyrethroid aerosol and chlorfenapyr baseboard treatments. The GNV R strain was used as a reference field strain. The AP strain was also collected from an apartment complex in Gainesville, FL in December 2007 after control failures following c hlorfenapyr sprays All strains were maintained in the laboratory without selection as continuous mixedinstar cultures. Rear ing took place in 3.8 liter plastic containers with screened lids. Corrugated cardboard was provided for harborage. The rearing units were held in reachin environmental chambers at 25 1oC under a 12:12 (light : dark ) h our (h) photoperiod. Rodent diet (#8604, Harlan Teklad, Madison, WI), Ol Roy soft dog food (Wal Mart, Bentonville, AR) and water were provided ad libitum Chemicals Technical grade indoxacarb (99% pure) was supplied by DuPont ( Wilmington Delaware). All other technical grade insecticides were > 97% pure (cypermethrin, permethrin, DDT, dieldrin, fipronil, chlorpyrifos, propoxur, imidacloprid, abamectin and chlorfenapyr) and were purchased from Chem Service (West Chester, PA). Analytical

PAGE 35

35 grade acetone (Fisher Scientific, Pittsburgh, PA) was used to make stock solutions and serial dilutions of all insecticides. Five commercial cockroach gel baits were also evaluated. Advion cockroach gel bait (0.6% indoxacarb) and Advion blank bait matrix were supplied by DuPont (Newark, DE). Maxforce FC Se lect cockroach gel bait (0.01% fipronil), PreEmpt gel bait (2.15% imidacloprid), Avert cockroach gel bait (0.05% abamectin), and Siege gel bait (2% hydramethylnon) were obtained from a local distributor. Bioassays Topical lethal dose (LD) bioassays The topical bioassay method was used to determine the insecticide resistance profile and indoxacarb susceptibility in the GNV R strain (Table 21 ). This bioassay provided estimates of contact LD values in g insecticide per g body weight A dult males 1 to 4 w eekold of the JWax S and GNV R strains were separated from rearing units and placed in separate containers, 1 d ay (d) prior to bioassay treatments. Cockroach weights were determined on a Mettler AC100 balance (Mettler Instrument Corp, Highstown, NJ) just before insecticide application. The insects were anesthetized using CO2 in groups of ten and treated on the ventral abdomen with different concentrations of insecticides in acetone. A minimum of three to four concentrations providing 10 90% mortality were included for each insecticide. Controls received acetone alone. All treatments were replicated three to five times depending upon the availability of insects and consistency of response. Topi cal applications were made in 1 6001 di spenser equipped with a 50 (Hamilton, Reno, NV). After treatment, cockroaches were held in groups of ten in 100 x 15 mm plastic Petri plates (Fisher Scientific, Pittsburgh, PA) with vented lids, cardboard

PAGE 36

36 harborage, rodent diet and a water source. The Petri plates were held in rearing chambers at 25 1C and a photoperiod of 12:12 ( light : dark ) h. Toxicity was evaluated at 24 h intervals up to 72 h post treatment. Insects unable to right themselves when prodded and showing uncoordinated movement of appendages were considered dead. Gel bait lethal time (LT) b ioassays Gel bait feeding bioassays were performed to investigate potential tolerance of the GNV R strain to different formulated gel bait insecticides, as well as to evaluate the suit ability of this method for susceptibility monitoring. The protocol of Wang et al. (2004) was followed with slight modifications. Assays followed a no choice format, meaning that no alternative food was provided. T he JWax S strain was used as a susceptibl e strain. The inner top portion of side walls of 17.8 x 17.8 x 6 cm disposable plastic Glad boxes (Clorox Company; Oakland, CA) were coated lightly with a mixture of petroleum jelly and mineral oil (2:3) to prevent the cockroaches from escaping. For aerat ion, 1 cm diameter openings were made on side walls and covered with fine nylon mesh. Each assay replicate received a cottonplugged water vial, folded index cards as harborage, and a 5cm hexagonal polystyrene weighing dish (Fisher Scientific, Pittsburgh, PA) containing 0.5 g gel bait insecticide. Controls received rodent diet alone. Each treatment was replicated 4 to 10 times. Ten adult males (1to 4 week old) were anesthetized with CO2 and placed in each assay box and the boxes were held in rearing cham bers. Mortality was evaluated at 8 h intervals for the first 24 h and every 24 h thereafter up to 7 d. Vial lethal concentration (LC) b ioassays In this bioassay, insecticide exposure is due to direct contact with treated glass surfaces and by ingestion thr ough preening of contaminated body parts, thus providing

PAGE 37

37 lethal concentration ( LC ) estimates in g insecticide per vial. Bioassays were conducted in 50 mL type I glass shell vials (Fisher Scientific, Pittsburgh, PA) with an internal surface area 67.7 cm2. Vials were treated with 0.5 mL of indoxacarb in acetone and were manually rolled at a 45 angle in a fume hood until most of the acetone had evaporated (~ 60 sec). Vials were then rolled horizontally on a hot dog roller until completely dry (~ 30 mins). Manual rolling of the vials before placing them on the hot dog roller kept acetone from spilling. Control vials received acetone only. Adult male cockroaches, 1 to 4 w eekold, were anesthetized using CO2 and placed in groups of ten into dry vials. Vials w ith insects were plugged with cotton and held horizontally in rearing chambers. Mortality evaluations at 24, 48 and 72 h. were done as described above for topical bioassays To enable estimation of probit LC values and diagnostic concentrations, indoxacarb concentrationmortality data for the JWax S and GNV R strains were generated. Each concentration (800, 400, 200, 175, 150, 125, 100, 75, 50, 25, 12. 5, 6.25, 3.12, 1.56, 0.78, 0.39 and 0 g per vial or 0.5 mL) was replicated five to eight times. Several concentrations providing mortality between 75 to 100% were included to increase the accuracy of LC99 estimates (Robertson et al. 1984) Diagnostic vial bioassays were performed with the JWax S, T164 backcross GNV R, AP and strains to validate candidate diagn ostic concentrations. Six to ten replicates of ten adult males were tested for each strain at two diagnostic concentrations: DC1 = 30 g per vial (0.44 g per cm2), an d DC2 = 60 g per vial (0.88 g per cm2). To test the usefulness of the diagnostic concen trations in detecting susceptibility shifts that might

PAGE 38

38 occur in laboratory maintained field strains, validation bioassays were performed with all four strains at two times separated by six months (T1 and T2). Bait m atrix LD b ioassays This is a novel bioass ay in which the amount of insecticide ingested by each insect is precisely known, thus enabling the generation of dosemortality curves for estimating oral lethal dose ( LD ) values in g insecticide per insect. This bioassay utilized manually prepared pellets of Advion blank bait matrix (no insecticide), each weighing ~ 10 mg, treated individually with a range of concentrations of technical indoxacarb in 1 acetone. A PB 6001 dispenser equipped with a 50 pellets that were then allowed to dry for 10 to 15 min in a fume hood. Bait pellets weighing approximately 10 mg were large enough to be treated by a 1 L volume of acetone and small enough to be consumed in a single meal by the starved insects. Adult male cockroaches ( 1 to 4 w eekold), starved for 24 h were anesthetized with CO2 and placed individually with a treated pellet in a 1 oz. portion cup covered with a perforated lid (Sweetheart Cup Company Inc., Owings Mills, MD). Greater than 90% of test insects consum ed ent ire pellets within 2 h Controls received acetonetreated pellets only. The cups were held in rearing chambers Toxicity was evaluated at 24, 48 and 72 h and all treatments (in sets of 10) were replicated three to seven times. Mortality evaluations based on the number dead out of ten were made as described in topical bioassays Individuals that did not completely eat the treated pellets by 24 h were discarded. To eliminate effects of differential feeding time on toxicity, only 72 h data were used for mortal ity evaluations. Oral dosemortality curves were generated for the reference field strain (GNV R) and the susceptible strain (JWax S). As with vial bioassays, additional doses providing

PAGE 39

39 mortality between 75% and 100% were included to increase the precision of LD99 estimates (Robertson et al. 1984) The following doses were tested: 60, 45, 15, 3.75, 1.8 7, 0.94, 0.47, 0.23, 0.12, 0.06 and 0 g per pellet per insect. The resulting JWax S oral LD estimates were used to determine diagnostic doses for susceptibil ity monitoring. Oral diagnostic assays were also performed with the JWax S, T164 backcross, GNV R and AP strains to validate the suitability of identified diagnostic doses (DD) of 1.0, 1.5 and 2.5 g per insect. These diagnostic assays were conducted in concert with T2 vial diagnostic assays (see Vial LC bioassay method for details ). At least three replicates of 20 to 40 adult males were tested per diagnostic dose per strain. Data Analyses Probit analyses were performed using PROC PROBIT in the SAS softw are package (SAS Institute, Cary, NC). Replicates were corrected for control mortality by using Abbotts formula (Abbott 1925). Significance of probit LD, LC, or LT values was determined based on the criterion of nonoverlap of 95% confidence intervals (CI ). Resistance ratios (RR) were calculated by dividing the LD, LC, or LT values of the GNV R strain by corresponding LD, LC, or LT values of the JWax S strain. R esistance ratios obtained by the above method were considered to represent true resistance that could fold (Koehler and Patterson 1986, Valles et al. 1997) and tolerance if they were between 210 fold. Percentage mortality data from diagnostic assays were arcsine transformed and analyzed by analysis of v ariance (ANOVA) using a general linear model (PROC GLM, SAS Institute, Cary, NC), and means separated using Tukeys HSD test ( P < 0.05).

PAGE 40

40 R esults Topical Lethal Dose B ioassays The resistance profile of the GNV R strain to insecticides from ten diverse class es, relative to the JWax S strain, is shown in Table 21 Although toxicity assessments were made at 24, 48 and 72 h, only 72hour results are presented as these results provide the best fit to an expected probit model. Based on nonoverlap of 95% CIs with the JWax S strain, the GNV R strain showed either significant tolerance or resistance to all insecticides tested except abamectin (Table 2 1 ). Indoxacarb, chlorfenapyr and imidacloprid resis tance ratios were in the lower tolerance category (5.9, 5.7, an d 7.6fold, respectively). LD50 resistance ratios >10 fold were obtained for propoxur, chlorpyrifos, fipronil permethrin, cypermethrin, DDT and dieldrin (13.9, 25.6, 37.4, 77.2, 86.5, >100, and >100fold, respectively). With respect to DDT and dieldrin, r esistance was so extreme in GNV R that LD values could not be calculated because of less than 10% mortality at the highest test concentrations (DDT = 400 g per L; dieldrin = 256 g per L). Gel Bait Lethal Time B ioassays Susceptibility of the GNV R and JWax S strains to formulated gel bait insecticides was compared with no choice gel bait LT bioassays (Table 2 2). All tested gel baits caused significant and rapid toxicity in both strains, providing 95 to 100 % mortality by assay day 7 (data not shown). LT50 values for different gel baits ranged from 0.30 to 1.76 d. Advion LT50 values for the GNV R and JWax S strains (0.57 and 0.47 d, respectively) were not significantly different. Significant toxicity differences between strains only occurred for Maxforce FC select (fipronil) and Siege (hydramethylnon) baits; however, resistance ratios were less than 2.4fold in both cases.

PAGE 41

41 Vial Lethal Concentration B ioassays Indoxacarb concentrationmortality data were generated for the GNV R and JWax S strains using v ial bioassay method (Table 2 3 and Fig ure 2 1). Here again, although toxicity assessments were made at 24, 48 and 72 h, the best fit of data to a probit model occurred at only 72 hours. With LC50 and LC99 resistance ratios of 6.33and 4.90fold, the GNV R strain showed significant indoxacarb tolerance relative to the JWax S strain. The indoxacarb LC99 value (and 95% CI) for the JWax S strain was 27.19 (18.9843.56) g per vial. A concentration approximating this value was selected as a lower diagnostic co ncentration (DC1) for susceptibility monitoring. This proposed DC1 concentration of 30 g per vial or 0.44 g per cm2 consistently causes 99 to 100% mortality in the JWax S strain; whereas, significantly less mortality occurs with GNV R ( ~ 65%) (Fig ure 2 1 ). A higher diagnostic concentration (DC2) of 60 g per vial or 0.88 g per cm2, which is 2x the DC1 concentration, was also included to better estimate the extent of indoxacarb tolerance or resistance. At DC2, the JWax S strain exhibited 100% mortality wh ile mort ality of the GNV R strain was ~ 85%. In order to further test for the utility of the two candidate diagnostic concentrations, vial bioassays were conducted on four strains at two time points, T1 and T2 (Fig ure 2 2). The JWax S and T164 backcross st rains showed consistent 96 to 100% mortality at both diagnostic concentrations and both time points. In contrast, mortality of the GNV R and AP strains varied with concentration and/or time. With 60 to 70% mortality at DC1 and 80 to 90% at DC2, the GNV R s train showed significant tolerance relative to JWax S and T164 at both time points. The AP strain showed significantly more tolerance than GNV R for both diagnostic concentrations at T1, but reverted towards susceptibility and became indistinguishable from GNV R after 6 months at T2.

PAGE 42

42 Bait Matrix Lethal Dose Bioassays Feeding based dosemortality data were generated for the GNV R and JWax S strains using bait matrix LD bioassays (Table 2 4 and Fig ure 2 3). Only 72 h data were used for determining oral LD est imates. At the LD50 and LD99 levels, significant resistance ratios of 2.50and 3.16fold occurred for the GNV R strain, respectively relative to the JWax S strain. Oral diagnostic doses were developed around the JWax S LD99 estimate and its upper 95% CI which were 1.11 and 1.69 g per insect, respectively (Table 2 4). Three candidate diagnostic doses (DD) were developed: a low dose, DD1 = 1 g per insect; an intermediate dose, DD2 = 1.5 g per insect; and a higher dose, DD3 = 2.5 g per insect (Fig ure 2 3). DD1 is approximately equal to the estimated JWax S LD99, DD2 approx imates the upper fiducial limit and DD3 is 2.5 fold greater than the lowest diagnostic dose. As done with the vial bioassays, diagnostic bait matrix LD bioassays were conducted against the four strains JWax S, T164 backcross, GNV R and AP (Fig ure 2 4), but only at the T2 time point (see preceding section). At all diagnostic doses tested, the JWax S and T164 backcross strains displayed 100% mortality. For DD1 (1 g per insect), percent mortality for the GNV R strain was significantly lower than the JWax S, T164 backcross and AP strains (df = 5, 11, F = 24.63, P = 0.0006). At DD2 and DD3 (1.5 and 2.5 g per insect, respectively), percent mortality was not significantly different for any of the four strains (df = 5, 11, F = 2.90, P = 0.11 for DD2; df = 5, 11, F = 1.00, P = 0.49 for DD3).

PAGE 43

43 D iscussion Resistance Profile in the Gainesville Resistant (GNV R) S train Insecticide resistance has been known in the German cockroach for decades (Scott a nd Matsumura 1981, Cochran 1989, Valles and Yu 1996, Scharf et al. 1997, Wu et al. 1998, Holbrook et al. 2003, Hemingway et al. 1993, Wei et al. 2001, Hansen et al. 2005) and the extent of cross resistance among active ingredients is potentially high (Sco tt and Matsumura 1981, Holbrook et al 2003, Wei et al. 2001, Hansen et al. 2005). Knowledge of resistance levels in field strains can provide insights into the mechanisms of resistance existing in field populations that might confer cross resistance to newly introduced insecticide(s). The insecticide resistance profile in the GNV R strain was presented here to emphasize the potential risk for physiological cross resistance to indoxacarb that may currently exist. To my knowledge, the GNV R strain has never been exposed to indoxacarb in the field, hence knowledge of the resistance profile in such a strain could prove useful; especially in the future when indoxacarbnaive field populations may not exist. Topical LD bioassays were used for determining the resi stance profile in the GNV R strain (Table 2 1). GNV R displayed high levels of resistance to DDT and pyrethroids (70 to >100fold). Such high levels of resistance to these insecticides, which have similar modes of action, could be caused by long term selec tion with residual pyrethroid insecticides. The observed resistance to fipronil (~ 37fold) could be attributed to previous selection by fipronil containing gel baits or cross resistance conferred by earlier cyclodiene selection (Bennett and Spink 1968, Holbrook et al 2003, Scott and Wen 1997, Hansen et al. 2005). Chlorpyrifos and propoxur resistance in GNV R could have resulted from direct selection with these materials and likely are caused by

PAGE 44

44 enhanced metabolic detoxification (Scharf et al. 1998, Heming way et al. 1993, Valles et al. 1996) The tolerance to imidacloprid and chlorfenapyr detected in GNV R might be due to previous exposure of this strain to imidacloprid baits (PreEmpt gel baits) and baseboard sprays of chlorfenapyr, respectively; or alter natively, might be metabolic crossresistance resulting from selection by other materials as noted above. With respect to indoxacarb, significantly reduced susceptibility was observed even though it has apparently never been used against GNV R (RR50=5.88x) (Table 2 1). Therefore, it is likely that indoxacarb tolerance in GNV R is crossresistance resulting from selection by other insecticides. With respect to the newer gel bait insecticides abamectin, indoxacarb and imidacloprid the magnitude of difference in susceptibility between the JWax S and GNV R strains was low. Conversely, high levels of resistance to conventional contact insecticides strongly support previous conclusions that high level resistance develops after long term selection / exposure (Cochr an 1989, Scharf et al. 1997, 1998b). The current finding of indoxacarb tolerance in a field strain that is resistant to other insecticide classes is consistent with recent findings reported by Chai and Lee (2010) Since gel bait formulations of newer insecticides ( Table 22) that act via ingestion are predominantly used for German cockroach control (Harbison 2003), topical LD bioassays are unrealistic for assessing t oxicity of these insecticides. Hence, I conducted a comparison of different gel bait produc ts available in the market for German cockroach control through nochoice LT bioassays (Table 2 2). Low level resistance (or tolerance) in the GNV R strain was only found for fipronil and hydramethylnon. These results suggest that even though fipronil and hydramethylnoncontaining gel baits may

PAGE 45

45 not be completely effective against the GNV R strain, most other cockroach gel bait products should still be effective. This might be partly because of the high concentration of insecticide in the gel bait formulations (Holbrook et al. 2003, Wang et al. 2004) and/or because resistance is yet to be selected by these products specifically in the GNV R strain. Development of Monitoring Techniques Resistance monitoring using baseline pesticide doses or concentrations is considered essential for insecticide and acaricide resistance management (Staetz 1985). Because indoxacarb has only recently been introduced for German cockroach control, differences in susceptibility between field populations and susceptible laboratory st rains may be quite small; thus bioassay techniques used for such early stage susceptibility monitoring require considerable precision (Roush and Miller 1986) The topical LD bioassay method, although able to discriminate between laboratory and field strain s, is not realistic for indoxacarb / Advion susceptibility monitoring because German cockroach field populations are mainly exposed to indoxacarb via feeding. Thus, use of topical application bioassays for susceptibility monitoring may lead to mis scoring of field strains with reduced indoxacarb susceptibility. Also, because formulated Advion bait contains a high concentration of indoxacarb (0.6%), which may cause some contact and secondary toxicity (Holbrook et al. 2003, Buczkowski and Schal 2001, Buczko wski et al. 2008) feeding bioassays with formulated gel bait cannot prov ide sufficient specificity and resolution to be useful as a monitoring tool (Table 2 2). Below, I discuss the rationale for use of both vial LC and bait matrix LD assays in early stag e gel bait susceptibility monitoring programs.

PAGE 46

46 Vial bioassay development Ideal resistance monitoring methods are thought to be ones that exaggerate differences between resistant and susceptible field strains, while at the same time effectively simulating f ield exposure conditions (ffrench Constant and Roush 1991). Thus, I had two main criteria when selecting candidate bioassay methods for indoxacarb susceptibility monitoring. First, the methods should discriminate between susceptible strains and strains wit h evolving low level resistance or tolerance; and second, the method should allow ingestion of the insecticide. The vial bioassay method meets both these criteria. It provides discrimination between tolerant and susceptible strains and it allows ingestion of insecticide through grooming of the legs, tarsi, and antennae (Scharf et al. 1995) Another major advantage of the vial method is that it allows for statistically robust sampli ng while not being overly labor intensive. Thus, the vial bioassay is well su ited as a first tier method for largescale monitoring of indoxacarb susceptibility in German cockroach field populations. Two diagnostic concentrations of 30 and 60 g per vial were identified based on their relation to LC99 estimates for the susceptible JWax S strain (Table 2 3). These two diagnostic concentrations were able to discriminate between lab susceptible (JWax S and T164 backcross) and field (GNV R and AP) strains (Fig ure 2 2). The T164 backcross strain, which originated from a cross between the glucose averse T164 strain and the Orlando susceptible strain (Silverman and Bieman 1993), did not show statistically different responses from JWax S at two diagnostic concentrations and two time intervals. However, the mortality responses of the AP strai n increased significantly over time at both diagnostic concentrations (P < 0.05) (Fig ure 2 2). The AP strain was collected in 2007, after reported control failures to baseboard sprays of chlorfenapyr

PAGE 47

47 and other insecticides. These results showed that indoxacarb tolerance in the AP strain was quickly lost over the following 2 to 3 generations of laboratory rearing. These susceptibility changes were confirmed by comparing LD50 estimates from bait matrix LD bioassays that were obtained during the same time fram e ( Appendix B, Table B 1 ). These findings suggest that low level cross resistance or tolerance to indoxacarb may presently exist in field populations, but it may decline quickly in the absence of selection or in laboratory rearing programs. In contrast, indoxacarb tolerance in the GNV R strain, which was collected in 2006, appears to be stable. These results highlight the importance of testing field strains as soon as possible after collection. Overall, the studies presented here show that vial assays and diagnostic concentrations of 30 and 60 g per vial are suitable for early phase susceptibility monitoring. Bait matrix bioassay development Despite being well suited for detecting physiological resistance, vial bioassays can not allow assessment of behavioral resistance ( i.e. bait aversion) to bait products, which is wellprecedented in the German cockroach (Silverman and Bieman 1993, Wang et al. 2004, 2006). Thus, I also developed a more refined feeding bioassay that closely simulates field exposure to comm ercial baits and that can be used as a secondtier confirmatory bioassay for monitoring gel bait susceptibility by detecting both physiological and behavioral resistance. Additional advantage of the bait matrix bioassay is that it allows for accurate quant ification of oral LD values because the amount of insecticide ingested by each insect is precisely known. A similar bioassay for estimating LD values of hydramethylnon baits to the German cockroach was developed by Valles and Brenner (1999) who manipulated hydramethylnon concentrations in formulated baits by dilution with blank bait matrix. The GNV R indoxacarb oral LD

PAGE 48

48 values were lower than those obtained from topical bioassays, indicating increased indoxacarb toxicity through ingestion. However, indoxacar b resistance ratios obtained from the oral and topical LD bioassays were indistinguishable (Table 2 1, Table 2 4). Three candidate diagnostic doses (1.0, 1.5 and 2.5 g per insect) were identified based on JWax S oral LD99 estimates. Considering that the G erman cockroaches eat at least 1 mg of formulated bait in a single bout ( Reierson 1995, Holbrook et al. 2003), t he three diagnostic doses developed here (1.0, 1.5 and 2.5 g per insect) are 0.17x, 0.25x and 0.42x the concentration of indoxacarb in 1 mg of formulated Advion cockroach gel bait (0.6%; 6000 ppm). Moreover, because only a single pellet is offered per insect, the chances of resistance mechanisms being overwhelmed by repeated insecticide ingestion are avoided. These doses provide a means for accurate estimation of indoxacarb susceptibility in field populations and can be used for directly correlating field performance of indoxacarb baits. However, this method is considerably more labor intensive than vial bioassays and thus, is best used as a secondtier validation method to confirm the nature of significant susceptibility shifts identified in first tier vial bioassays. In addition, as blank Advion matrix is used in this bioassay, modifications can be made to enable identification of potential behavioral resistance to either the matrix or active ingredient. For example, to determine if shifts in matrix palatability have occurred, (1) feeding can be quantified, or (2) alternate matrices (rodent chow, bread, etc.) can be tested. Thus, with minor adjustments the bait matrix LD bioassay method would allow for differentiation between physiological and bait aversion resistance. The three candidate oral diagnostic doses were evaluated against th e JWax S, T164 backcross, GNV R and AP strains (Fig ure 2 4). A t the lowest diagnostic dose,

PAGE 49

49 GNV R had significantly greater survival than the other three strains; however, at the two higher doses, mortality levels for all strains were statistically identical. Thus, despite showing tolerance in vial LC assays and at t he lower oral diagnostic dose, the AP and GNV R strains were susceptible to the two higher oral diagnostic doses. The results corroborate with the results of formulated gel bait bioassays in which Advion LT50 values for the GNV R and JWax S strains were s tatistically identical. Clearly, unlike bioassay s with formulated gel baits, diagnostic bait matrix bioassays provide the sensitivity for detecting shifts in indoxacarb susceptibility via ingestion. In summary, t he objectives of this study were (1) to defi ne the insecticide resistance profile in the GNV R strain, which to my knowledge had never been exposed to indoxacarb and (2) to develop sufficiently sensitive bioassays for monitoring evolving indoxacarb resistance in German cockroach field populations. I nvestigations into the resistance profile of the GNV R strain revealed that this strain has high levels of resistance to a number of insecticide classes (including the phenylpyrazole fipronil) but only tolerance ( i.e., topical resistance ratios between 2 t o 10fold) to indoxacarb and other newer insecticides. In agreement, significantly reduced susceptibility in formulated gel bait LT bioassays was observed only for fipronil and hydramethylnon gel baits. Subsequently, indoxacarb baseline toxicity data were compared from topical LD, gel bait LT, vial LC, and bait matrix LD bioassays. After consideration of gel bait exposure route(s), logistic benefits of different assays, and baseline toxicity data from multiple bioassay methods, the vial LC and the bait matr ix LD bioassays were selected for evaluation as a twotiered monitoring strategy. This strategy entails: (Tier 1) testing recent fieldcollected populations in vial bioassays at two diagnostic concentrations; and

PAGE 50

50 (Tier 2) validating suspected susceptibilit y shifts identified in tier 1 by testing populations at three diagnostic doses in bait matrix feeding assays. First tier vial bioassays will allow rapid screening for physiological resistance to indoxacarb. Secondtier bioassays will provide a means for di rectly correlating to field performance of Advion, and will further allow for the identification of both physiological and behavioral resistance to both active ingredient and bait matrix Early identification of susceptibility changes in this manner will help to rapidly identify resistance mechanisms (Scharf et al. 1998b) identify and test effective counter measures (Scharf et al. 1997 1998b; Kaakeh et al. 1997) implement resistance management and prevent future widespread control failures.

PAGE 51

51 Table 21. Topical lethal dose bioassay results for adult male German cockroaches at 72 h post treatment. Eleven insecticides from ten classes were tested against one laboratory (JWax S) and one field strain (GNV R). Technical i nsecticide Strain n Slope ( SE) LD 5 0 1 (95% CI) RR50 2. Chi Square (df) 3. Indoxacarb JWax S 270 2.13 (0.32) 1.75 (1.14 2.26) -. -3.73 (7) GNV -R 339 1.94 (0.24) 10.30 (7.46 14.39) 5.88* 2.70 (8) Permethrin JWax-S 190 3.81 (0.63) 1.18 (0.96 1.43) -. -1.66 (4) GNV -R 210 3.73 (0.50) 91.12 (76.02 108.88) 77.22* 0.76 (4) Cypermethrin JWax-S 240 2.36 (0.58) 0.55 (0.39 0.75) -. -3.15 (5) GNV -R 390 2.07 (0.19) 47.60 (38.19 59.15) 86.54* 8.90 (6) DDT JWax-S 190 1.61 (0.22) 36.40 (24.3 51.75) -. -0.88 (3) GNV -R 210 -. -ND 4. (> 364) >100* -. -Fipronil JWax-S 240 5.99 (1.04) 0.07 (0.05 0.08) --. -1.50 (5) GNV -R 250 3.72 (0.66) 1.85 (1.46 2.22) 26.42* 6.44 (7) Dieldrin JWax-S 280 3.24 (1.08) 2.17 (0.46 4.17) -. -25.56 (5) 5. GNV -R 220 -. -ND 4. (>217) >100* -. -Chlorpyrifos JWax-S 280 2.01 (0.25) 2.12 (1.64 2.63) --. -6.9 (4) GNV -R 250 2.83 (0.49) 54.35 (36.06 75.67) 25.64* 10.88 (5) 5. Propoxur JWax-S 248 2.25 (0.26) 7.02 (5.48 8.77) -. -1.61 (5) GNV -R 300 1 .91 (0.19) 97.69 (76.55 126.11) 13.91* 10.16 (6) Imidacloprid JWax-S 250 1.29 (0.16) 10.09 (6.80 14.69) -. -6.80 (6) GNV -R 250 1.31 (0.15) 76.20 (54.17 108.70) 7.55* 4.15 (5) Abamectin JWax-S 330 3.25 (0.48) 0.07 (0.05 0.08) -5. 12 (8) GNV -R 290 2.67 (0.39) 0.09 (0.07 0.11) 1.28 1.95 (7) Chlorfenapyr JWax-S 270 3.45 (0.41) 5.48 (4.61 6.36) -. -5.28 (6) GNV -R 380 1.61 (0.22) 31.26 (16.34 50.80) 5.70* 12.5 (6) 5. 1 Lethal dose (LD 50 ) values with 95% confidenc e intervals. Values are expressed in g toxicant per g body w eight (Strain weights: JWax S = 45.6 mg per male, and GNV R = 56.3 mg per male). 2. Resistance ratios at LD50. = LD value of GNV R LD value of JWaxS 3. Chisquare and corresponding degrees of freedom. 4 LD50 values not determinable due to highlevel resistance. 5 Chisquare significantly different from expected. Asterisks indicate significance based on non over lap of 95% confidence intervals, n = total number of insects used in bioassays.

PAGE 52

52 Table 22. Gel bait lethal time bioassay results for adult male German cockroaches. Five commercial gel bait formulations were tested in nochoice bioassays against one laboratory (JWax S) and one field strain (GNV R). Gel bait insecticide Strain n Slope ( SE) LT50 1. (95% CI) RR 50 2. Chi -Square (df) 3. Advion (A.I. Indoxacarb) JWax-S 90 6.12 (0.78) 0.47 (0.41 0.52) -. -6.48 (8) GNV -R 90 4.67 (0.69) 0.57 (0.45 0.67) 1.12 13.50 (8) 4. Maxforce (A.I. Fipronil) JWax-S 100 5.13 (0.52) 0.28 (0.21 0.33) -. -0.45 (7) GNV -R 100 4.96 (0.42) 0.65 (0.60 0.70) 2.32 9.02 (7) Avert (A.I. Abamectin) JWax-S 70 3.40 (0.37) 0.61 (0.50 0.71) -. -8.92 (7) GNV -R 70 2.56 (0.37) 0.77 (0.47 1.05) 1.18 17.98 (7) 4. Pre -empt (A.I Imidacloprid) JWax-S 40 1.61 (0.32) 0.13 (0.04 0.24) -. -1.96 (7) GNV -R 40 2.41 (0.38) 0.30 (0.19 0.40) 2.30 6.59 (7) Siege (A.I. Hydramethylnon) JWax-S 40 4.26 (0.40) 1.21 (1.07 1.37) -. -4.16 (7) GNV -R 40 6.76 (0.79) 1.76 (1.57 1.94) 1. 45 3.33 (7) 1 Lethal time (LT 50 ) values with 95% confidence intervals expressed in days. 2. Resistance ratios at LT50. RR50 = LT50 of GNV R LT50 of JWax S. 3 Chisquare and corresponding degrees of freedom. 4 Chisquare value significantly differen t from expected Asterisks indicate significance based o n non overlap of 95% confidence intervals n = total number of adult males used in bioassays. Table 23. Indoxacarb vial lethal concentration bioassay results for adult male German cockro aches at 72 h post treatment. Results show responses of one laboratory strain (JWax S) and one field strain (GNV R). Strain n Slope ( SE) LC 50 (95% CL) 1. RR50 2. LC 99 (95% CI) 1. RR99 2. Chi Square (df) 3. JWax-S 1380 2.08 (0.13) 2.10 (1.75 2.5) -. -27.19 (18.98 43.56) -. -20.01 4. (13) GNV -R 870 2.32 (0.16) 13.3 (10.9 16.0) 6.33* 133.50 (98.72 198.03) 4.90* 19.35 4. (11) 1 Lethal concentration (LC 50 and LC 99 ) values at 72 h. expressed in g toxicant per vial 2 Resistance ratios at LC50 and LC99. RR = LC value of GNV R LC value of JWax S. 3 Chisquare and corresponding degrees of freedom. 4 Chisquare significantly different from expected. Asterisks indicate significance of resistance ratios. n = total number of adult males used in bioassays.

PAGE 53

53 T able 24. Bait matrix lethal dose bioassay results for adult male German cockroaches at 72 h post treatment. Results represent the responses of the laboratory (JWax S) and field (GNV R) strains to blank Advion bait matrix that was treated with a range of indoxacarb concentrations. Strain n Slope ( SE) LD 50 (95% CI) 1. RR 50 2. LD 99 (95% CI) 1. RR 99 2. JWax S 775 2.44 (0.21) 0.12 (0.11 0.14) -1.11 (0.82 1.69) -GNV R 353 2.17 (0.24) 0.30 (0.23 0.38) 2.50* 3. 51 (2.22 6.95) 3.16* 1. Lethal dose (LD 50 and LD 99 ) values with 95% confidence intervals at 72 h expressed as g toxicant per insect. 2 Resistance ratios at LD50, LD90 and LD99. RR = LD value of GNV R LD value of JWax S Asterisks indicat e s ignificant resistance ratios based on nonoverlap of 95% confidence intervals. n = total number of adult males used in bioassays Figure 21. Indoxacarb concentrationmortality curves obtained in vial lethal concentration bioassays (LEFT, percent scale; RIGHT, probit scale). Curves depict responses of a laboratory strain (JWax S) and a field strain (GNV R) at 72 h. Dashed vertical lines indicate the two candidate diagnostic concentrations of 30 and 60 g indoxacarb per vial.

PAGE 54

54 Figure 22. Results of diagnostic concentration (DC) vial bioassays. Bars represent percent mortality at 72 h. Two concentrations were tested (DC1 = 30 g indoxacarb per vial and DC2 = 60 g indoxacarb per vial) using 60 to 100 adult male German cockroaches at each concentration for each strain. Tests were done at two time points separated by 6 months (Time 1 and Tim e 2). Error bars represent SE values. Within concentration, bars with different letters are significantly different (Tukeys HSD test, P<0.05 ). The T164 back cross strain is referred to as T164 in this figure.

PAGE 55

55 Figure 23. Indoxacarb oral dosemortality curves as obtained in bait matrix lethal dose bioassays (LEFT, percent scale; RIGHT, probit scale). Curves depict the responses of the JWax S and GNV R strains at 72 h. Dashed vertical lines indicate the three candidate diagnostic doses of 1.0, 1.5 and 2.5 g indoxacarb per insect.

PAGE 56

56 Figure 24. Results of diagnostic dose bait matrix bioassays. Assays were conducted in concert with T2 vial assays (see Fig ure 2). Bars represent percent mortality at 72 h. Three doses (1.0, 1.5 and 2.5 g indoxacarb per insect) were tested using 100 to 120 adult males at each concentration for each st rain. Error bars represent SE values. The asterisk (*) indicates a st atistically different responses of the GNV R strain as compared to the susceptible JWax S strain at the dose of 1.0 g indoxacarb per insect (Tukeys HSD test, P<0.05 ).

PAGE 57

57 CHAPTER 3 IMPLEMENTATION OF TW O TIERED MONITORING TE CHNIQUE FOR DETERMINING INDOXACA RB SUSCEPTIBILITY LEVELS IN FIELD COLLECTED GERMAN COCKROACH POP ULATIONS Indoxacarb, an oxadiazine class sodium channel blocker insecticide is highly efficacious against a variety of insect pests and exhibits low mammalian and nontarget toxicity (Wing et al. 1998, 2000, 2004). For cockroach control in the United States (U.S.) indoxacarb is available as a gel bait (Advion; 0.6% indoxacarb) and spray formulation (Arilon; 20% indoxacarb). While the gel bait formulation has been used since 2006, the spray formulation was made available only recently in 2010. Because cockroach gel bait formulations are easy to use, pose less nontarget hazards and display high efficacy against cockroaches, they have become a popular choi ce among pest control operators (Harbiso n et al. 2003). Moreover, bait formulations (containing insecticides like indoxacarb, fipronil, imidacloprid, etc.) are considered less likely to be affected by resistance issues because of two reasons: (1) the high concentrations of insecticide present in them prevents expression of resistance (Holbrook et al. 2003, Wang et al. 2004) and (2) the unique chemistry of the gel bait active ingredients that allows their metabolic conversion to more toxic forms upon entry into the insect body (Wing et al. 1998, S charf et al. 2000). Historical data on insecticide resistance in the German cockroach, however, shows us that none of the insecticides used for its control have been resistance proof (Cochran 1995, Scharf and Bennett 1995). Thus, a legitimate concern for any new insecticidal chemistry for cockroach control is: how soon will resistance evolve? German cockroaches can not only develop physiological resistance to gel bait active ingredients but also are capable of developing behavioral resistance (bait aversi on) to inert

PAGE 58

58 components (eg. different sugars) of gel baits (Silverman and Bieman 1993, Wang et al.2004, 2006). Since the question is not if, but how soon cockroaches will develop resistance to a new insecticide, deployment of resistance management strateg ies that delay or reverse the evolution of resistance are of key importance. The fact that indoxacarb is a reducedrisk insecticide that is less hazardous to humans nontarget organisms and the environment (U.S. EPA 2000) further stresses the importance of implementing resistance management strat egies to preserve its efficacy. One important step before resistance management tactics can be implemented is to establish insecticide susceptibility levels in field populations of the target insect pest (Brent 1 986, ffrenchConstant and Roush 1990). Monitoring studies for determining physiological and/or behavioral resistance to gel baits in fieldcollected and resistant populations of the German cockroach have been conducted for abamectin (Cochran 1994), sulflur amid (Schal 1992), hydramethylnon (Valles and Brenner 1999) and fipronil (Valles et al. 1997, Scott and Wen 1997, Holbrook et al. 2003, Kristensen et al. 2005, Chai and Lee 2010). With respect to indoxacarb, a recent monitoring study by Chai and Lee (2010) estimated susceptibility levels in German cockroach populations from Singapore. However, indoxacarb susceptibility levels in German cockroach fieldpopulations from across the U.S. have not been evaluated. Monitoring studies mentioned above were either based on discriminatory diagnostic dose / concentrati on bioassays that would kill 99 to 100% of the susceptible individuals (allowing survival of resistant individuals), or traditional lethal doseor time response bioassays using technical grade insecticides or formulated baits. Only a few monitoring studies conducted in the past, except those by Cochran (1994) and Valles

PAGE 59

59 and Brenner (1999), have focused on simultaneous determination of physiological and behavioral (bait aversion) resistance to cockroach gel bait formulations. In a recent study I developed and validated a twotiered resistance monitoring strategy for estimating Advion / indoxacarb susceptibility in fieldcollected German cockroach populations (Gondhalekar et al. 2011) This strategy entails : (1) estimating physiological indoxacarb resistance or tolerance by testing descendants of fieldcollected populations at two diagnostic concentrations in surface contact v ial bioassays and (2) testing populations showing significant resistance or tolerance in vial bioassays at diagnostic doses in oral bait matrix bioassays which allow simultaneous screening for physiological and bait aversion resistance ( Gondhalekar et al. 2011). Although the twotiered indoxacarb susceptibility monitoring study noted above was validated using two indoxacarb nave field strains, indoxacarb susceptibility levels in German cockroach populations from geographically diverse areas of the U.S. are unknown. Hence, the goal of the present investigation was to screen descendants of 14 field collected German cockroach populations from the U.S. for susceptibility to indoxacarb using the twotiered monitoring technique developed by Gondhalekar et al. (2011) My hypothesis for this study was that the fieldcollected populations would show at least some degree of significant survivorship (in comparison to susceptible populations) in vial and oral diagnostic bioassays. Materials and Methods Insect Collection and Rearing The Johnson Wax (JWax S) and the T164 backcross strains were used as standard susceptible strains (Gondhalekar et al. 2011). Fourteen field strains from 13 different locations in 6 states from the U.S. were collected through collaboration with

PAGE 60

60 University researchers, pest control operators and personnel from DuPont Inc. (Table 3 1). At the time of collection, apartment dwellers or institutional officers were interviewed for information regarding pest control history at their location. Additionally, visual observation of the site was performed to detect deposits of cockroach g el baits. In locations with heavy infestation, cockroaches of different stages and sexes were handcollected. At sites with low to medium infestation levels jar traps with bread and beer were used (Artyukhina 1972). In brief 0.5 liter mason jars contai nin g 1 inch wide piece of beer soaked bread were placed overnight near population focal areas (near refrigerator, underneath the kitchen sink etc). German cockroaches of varied stages attracted to the fermenting smell of beer soaked bread climbed into the open mason jars and got trapped inside because of a thin layer of petroleum jelly and mineral oil (2:3) that coated the inner top portion of the jar. Cockroaches collected by the jar and hand collection methods were shipped overnight to the Insect toxicology laboratory at the University of Florida where they were reared according to the protocol given by Gondhalekar et al. (2011) Collection sizes varied from ~40 to 250 individuals (mixed stages) for most field populations except Bakersfield where a new colony was started from ~ 5 females and 5 large nymphs. Before initiation of susceptibility monitoring bioassays the strains were allowed to es tablish in the laboratory for 2 to 3 generations. This 2 to 3 generation holding period was performed to eliminate fiel d associated effects on insecticide susceptibility. The Gainesville Resistant ( GNV R ) Campus Club 45 ( CC45 ) and T164 strains were, however, reared in the toxicology laboratory or elsewhere for at least 2

PAGE 61

61 years or more before using them in monitoring studi es. A dult males (1to 4 weeks old) from F3 F5 generation were used in all bioassays. Chemicals Indoxacarb (99.1% active ingredient ) and Advion blank bait matrix were provided by DuPont Inc (Wilmington Delaware). Indoxacarb dilutions were prepared in analytical grade acetone. Acetone was purchased from Fisher Scientific (Pittsburgh, PA). Vial Diagnostic Bioassays This bioassay method allows screening of field strains for physiological resistance. Two d iagnostic concentrations (DC1 = 30 g per vial or 0.44 g per cm2 and DC2 = 60 g per vial or 0.88 g per cm2) determined and validated in a previous study by Gondhalekar et al. (2011) were tested against 2 susceptible and 14 fieldcollected strains using the vial LC bioassay format Type I glass shell vial s (50 mL; Fisher Scientific, Pittsburgh, PA) were treated with indoxacarb (30 or 60 g) in 0.5 mL acetone. After addition of acetone the vials were rolled manually at a 45 angle for 30 to 60 sec and then rolled horizontally on a hot dog roller until compl etely dry. Ten adult males anesthetized with ice or CO2 were then placed in a single vial and the vial was plugged with nonabsorbent cotton. Control vials were treated with acetone only. The bioassays were replicated ten times for each strain and diagnost ic concentration. Vials placed in the test tube holders were held horizontally in reachin environmental chambers at 25 1C temperature and 12:12 hour (h) light: dark cycle. Insects lying on their backs and unable to walk were considered as dead. Observations on knock down mortality were recorded every 24 h up to 72 h. Only 72 h data, however, were used for comparing mortality levels between strains.

PAGE 62

62 Oral Diagnostic Bioassays This bioassay method allows simultaneous testing for physiological as well as behavioral resistance to Advion bait s (Gondhalekar et al. 2011) Oral bioassays or bait matrix LD bioassays were conducted against lab susceptible and field strains at three diagnostic doses (DD1 = 1.0 g per insect, DD2 = 1.5 g per insect and DD3 = 2.5 g per insect). Pellets of Advion blank bait matrix weighing ~ 10 mg (wet weight) were prepared manually and treated with indoxacarb in 1 L acetone using a 50 L syringe attached to PB 600 1 dispenser (Hamilton, Reno, NV). These pellets were large enough t o be treated by 1 L volumes of acetone and small enough to be entirely eaten by the insects (Gondhalekar et al. 2011) The treated pellets were allow ed to dry in a fume hood for 15 to 20 min and then a single treated pellet was provided to an adult male starved for 1 d and held in a 1 oz. portion cup with aerated lid (Sweetheart Cup Company Inc. Owings Hill, MD). Control insects received pellets treated with acetone only. Eight to fourteen replicates of ten insects each were performed for each dose and str ain. Portion cups with insects were held in an environmental chamber at 25 1C temperature and 12:12 h light: dark cycle. Observations on feeding were performed at 2 and 24 h. During each observation number of insects that had completely consumed the bai t pellet were counted. Insects that did not eat the pellet completely at 24 h were not used for mortality observations. Observations on mortality were made at 24, 48 and 72 h. However, only 72 h observations were used for statistical comparison between str ains. Data Analyses Percent mortality data (72 h) from diagnostic vial and oral bioassays were arcsine transformed and analyzed by ANOVA using a general linear model, PROC GLM (SAS

PAGE 63

63 Institute, Cary, NC). Means were separated using all pairs Tukeys HSD tes t (P < 0.05). If required, bioassay data were corrected for control mortality using Abbotts formula (Abbott 1925). The term tolerance is used while referring to strains that exhibited < 50% survival at the highest oral diagnostic dose of 2.5 g per insect while the term resistance is used for strains that showed > 50% survival at the highest oral diagnostic dose. The term reduced susceptibility (with no particular reference to tolerance or resistance ) indicates situations where significantly diff erent mortality responses were observed in comparison to the laboratory susceptible strains Results Diagnostic Concentration Based Vial Bioassays Results of diagnostic concentration vial bioassays (DC1= 30 g per vial and DC2 = 60 g per vial) for 14 fiel d and 2 laboratory populations are depicted in Figures 31 and 3 2. As expected, 99 to 100 percent mortality was obtained in the susceptible JWax S and T164 backcross strains at both diagnostic concentrations ( Gondhalekar et al. 2011). Alternatively, mortality of field strains ranged from 4 to 97 percent, with the CC45 strain displaying highest level of reduced susceptibility followed by Merisel and CB 2009. The T164 strain was most susceptible to indoxacarb (83% and 97% mortality at DC1 and DC2, respectively). Although the Arbor Park ( AP ) and GNV R strain responses were statistically different than the susceptible populations, these strains were least tol erant to indoxacarb ( Gondhalekar et al. 2011). Overall, the survival rates of all but one (T164) fieldcollected strains were significantly different than that of the laboratory susceptible strains (ANOVA results: df = 24,159, F = 31.13, P = < 0.0001 for DC1 and df = 24, 159, F = 28.09, P = < 0.0001 for DC2). The results of this surface contact

PAGE 64

64 bioassay meth od show that reduced indoxacarb susceptibility, relative to standard laboratory strains, is prevalent field populations of the German cockroach. Diagnostic Dose Based Oral B ioassays German cockroach strains (Table 31) were also screened using three diagnostic doses (1.0, 1.5 and 2.5 g per insect) identified for oral or bait matrix LD bioassays ( Gondhalekar et al. 2011). None of the susceptible strain (JWax S and T164 backcross) individuals survived at any diagnostic dose (Figures 33, 3 4, and 35). Of th e fi eld strains, T164 and AP were the least tolerant with m ortality levels ranging from 97 to 100% at the lowest diagnostic dose. At DD1, DD2 and DD3, 12, 9 and 7, field strains, respectively, showed significantly different responses than the susceptible s trains (ANOVA results: df = 28, 188, F = 85.37, P = < 0.0001 for DD1; df = 28, 188, F = 35.74, P = < 0.0001 for DD2; df = 28, 188, F = 39.76, P = < 0.0001 for DD3). In general, susceptibility levels of field strains were higher in oral bait matrix bioassay s than in surface contact vial bioassays. As in vial diagnostic bioassays, the CC45 and the Cocoa Beach 2009 ( CB 2009) populations were the most resistant strains with less than 50% mortality at all diagnostic doses. Although the T164 strain was found to be susceptible in vial bioassays, this strain was included in the tier 2 oral bioassays because it displays aversion to glucose containing gel baits (Silverman and Bieman 1993). However, bait aversion (behavioral) resistance to Advion bait matrix was not evident in the T164 strain or any other s trains tested. Approximately 90 to 95% insects consumed the entire pellet with 2 h and the remaining 5 to 10% insects did so by 24 h (data not shown).

PAGE 65

65 Dis cussion Tier 1 Vial Diagnostic Bioassays Vial diagnostic bioas says provided a less labor intensive means for estimating physiological indoxacarb tolerance or evolving resistance resistance in German cockroach field populations (Gondhalekar et al. 2011). Reduced susceptibility to indoxacarb was observed in thirteen of fourteen field strains compared with standard insecticide susceptible laboratory strains (Figures 31 and 32). Although the T164 strain had a different response than the susceptible strains at DC1, this strain was susceptible at DC2. These results are not surprising because the T164 strain has been maintained in the laboratory without selection pressure for more than 2 decades and hence the tolerance levels to indoxacarb and other insecticides including indoxacarb are expected to be low. Indoxacarb tolerance and / or resistance detected in the thirteen field collected strains could have resulted from direct selection by Advion (0.6% indoxacarb) or cross resistance due to selection by other insecticides, or a combination of selection by different baits and i nsecticides including Advion. My own investigations confirmed that six field strains viz., CC45, Cocoa Beach 2008 ( CB 2008) Cocoa Beach 2009 ( CB 2009) Keystone, Texas and North Carolina Hog farm strain ( NC Hog) had indeed been exposed to indoxacarb bait s in the field (Table 31). As such, on the basis of available information it is safe to assume that seven field strains were cross resistant / tolerant t o indoxacarb and the remaining six strains (listed above) displayed tolerance and/ or resistance that w as likely caused by direct indoxacarb selection. Mortality levels in the apparent indoxacarb cross res istant strains ranged from 12.5 to 65% at DC1 and 27 to 81% at DC2 (Figures 31 and 32). The Meriwell and Plainfield 19C strains showed highest indoxacarb tolerance among the cross resistant

PAGE 66

66 strains. Information available from academic collaborators who helped in collection of these strains suggests that residual insecticides were mostly used for controlling the Meriwell and the Fairmont strain whereas a combination of residual insecticides and bait products (imidacloprid and hydramethylnon) were used for managing the Plainfield 19C and 9C strains. As shown previously in many different studies with the German cockroach, exposure to residual insecticides can select for different resistance mechanisms including penetration resistance (Wu et al. 1998, Scharf et al. 1997, 1998b; Pridgeon et al. 2002) Since the vial bioassay method is predominantly a surface contact bioassay method, penetration resistance (caus ed by selection with residual applications of pyrethroid, organophosphate, etc. insecticides) existing in the Meriwell and Plainfield 19C may have been responsible for indoxacarb cross resistance seen in these strains. Cross resistance to indoxacarb in another field strain, AP, was ver y high initially (10 to 20% mortality at DC1 and DC2) but was unstable and declined after 6 months o f laboratory rearing ( Gondhalekar et al. 2011 APPENDIX B). Alternatively, low level indoxacarb tolerance in the reference field strain, GNV R, appears to be stable and has not declined after 3 to 4 years of continuous laboratory rearing ( Gondhalekar et al. 2011). To check if the trend seen in the AP strain extends to other populations, indoxacarb tolerant or resistant strains (C C45, CB 2009 and Meriwell) are currently being reared in the laboratory without selection pressure and will be tested again after 2 to 3 generations. Among the field populations known to be exposed to Advion in the field (Table 31), the CC45 and CB 2009 strain s exhibited the highest indoxacarb resistance in the German cockroach reported to date. In contrast, despite of the known history of

PAGE 67

67 selection by indoxacarb baits, tolerance levels in the CB 2008, NC Hog, Texas and Keystone strains a ppear to be lower than the CC45 and CB 2009 strain s and even strains that are indoxacarb cross resistant (Meriwell, Plainfield 19C etc.). Such large differences between populations could be explained by frequency and/or length of insecticide selection pressure these strai ns have encountered (Scharf et al. 1997), as well as genetic differences between strains (Scott 1990). Certainly, length of selection has an impact on the resistance level in the CB 2009 strain. As explained in Table 31, two Cocoa Beach (CB) populations w ere collected from the same location at two time points separated by one year (denoted as the CB 2008 and CB 2009 strains) and my sources confirmed that Advion in combination with fipronil baits and residual sprays of chlorfenapyr, bifenthrin, etc. had been used at this location. Interestingly, diagnostic bioassays with adult males indicated that significant differences in indoxacarb resistance existed in between the CB 2008 and CB 2009 strains. The differences in resistance found between CB 2008 and CB 2009 clearly show that indoxacarb susceptibility levels in field populations can change quickly following selection with indoxacarb and/ or other insecticides. These field selection results strongly agree with results of laboratory selection studies conducted 15 years ago with residual organophosphate and pyrethroid insecticides (Scharf et al., 1998b). Tier 2 Oral Diagnostic Bioassays The bait matrix LD bioassay is relatively more labor intensive than the vial bioassay method, but can be used for detecting physiological as well as bait aversion or behavioral resistance ( Gondhalekar et al. 2011). Aversion to inert bait matrix ingredients is well precedented in the German cockroach and has caused control failures in the past (Silverman and Bieman 1993, Wang et a l. 2004, 2006). In the current study, I could

PAGE 68

68 not quantitatively measure the feeding response of insects because all the insects (adult males) completely ate the pellets by 24 h. These observations suggest that bait aversion resistance to Advion does not currently exist, at least not in the field populations that I tested. With respect to physiological resistance, the results obtained from oral diagnostic bioassays are directly comparable to field performance of Advion baits because of the similarities in mode of entry, i.e. via feeding (Gondhalekar et al. 2011). Moreover, as indoxacarb is generally known to be more toxic by ingestion (Wing et al. 1998, 2000), this method provides realistic estimates of susceptibility levels. Significant survival of as ma ny as 12 of 14 field strains at the susceptible LD99 dose (DD1 = 1.0 g per insect) was unexpected and reinforces vial assay findings showing that most of the field strains, irrespective of their insecticide exposure history, possess reduced susceptibility to indoxacarb. However, the comparativ ely lower number of strains (seven) showing significant survival at the highest diagnostic dose (2.5 g per insect) indicates that the extent of indoxacarb tolerance and / or resistance may not be very high in most of t he strains except CC45 and CB 2009. As a known history of Advion exposure exists for the CC45 and CB 2009 strains, resistance in these strains could be an outcome of direct selection by indoxacarb containing baits. The CC45 strain even shows significant s urvival when fed with formulated Advion baits in nochoice gel bait bioassays (Appendix A). Tolerant populations other than CC45 and CB 2009 showed 73 to 94% mortality at highest diagnostic dose (2.5 g per insect) and thus, these strains (Meriwell, Plain field 9C, Bakersfield, Keystone and Texas) are expected to be susceptible (exhibit only low level tolerance) to the formulated Advion baits that contain high amounts of indoxacarb (6 g per mg).

PAGE 69

69 I ndoxacarb as a T ool for German Cockroach C ontrol Advion (0 .6% indoxacarb) cockroach gel baits have been available commercially in the U.S. for the past 5 years. Most cockroach gel baits including Advion inherently contain high amounts of active ingredient that exceeds the LD99 value for the susceptible strain by several fold (Holbrook et al. 2003, Wang et al. 2004). Moreover, because, indoxacarb is a slow acting insecticide (Wing et al. 1998, 2000) repeated feeding on gel bait occurs and leads to ingestion of toxicant / indoxacarb in quantities surpassing the LD9 9 dose by several fold. German cockroaches are known to eat at least 1 mg of bait or diet in a single bout of feeding (Reierson et al. 1995, Holbrook et al. 2003). Thus, when a cockroach feeds on 1 mg of Advion it ingests 6 g indoxacarb which is about 6fold greater than the susceptible LD99 / lowest diagnostic dose of 1 g per insect (Gondhalekar et al. 2011) In addition, repeated feeding may increase the ingestion amounts to 12 or 24 g of indoxacarb and even the most resistant cockroaches are unlikely to survive at such high dose. Nonetheless, in nochoice gel bait bioassays with Advion, the CC45 strain which appears to be selected in the field with indoxacarb, shows ~ 30 % survival at 7 d (Appendix A). Thus, except in strains such as CC45 which might be extremely rare, Advion baits will likely provide reasonable levels of control in the years to come. Factors that May Contribute T oward Rapid Development of Indoxacarb Resistance In German cockroaches horizontal transfer of indoxacarb from primary reci pients (insects that directly feed on formulated bait) to conspecifics is thought to occur through contact with insecticide laden excretions, coprophagy (ingestion of feces), necrophagy (feed ing on dead conspecifics) and emetophagy (ingestion of regurgitat ed bait)

PAGE 70

70 (Buczkowski et al. 2008) Often, the secondary or tertiary recipients are exposed to a smaller amount of indoxacarb or its bioactive metabolite (DCJW) than the primary recipients (Buczkowski et al. 2008). Exposure to smaller doses of indoxacarb would essentially kill most of the susceptible individuals and allow selective survival of resistant individuals. And as shown before in the German cockroach ( Scharf et al. 1998b, Valles et al. 2003), selective survival or breeding of resistant individuals w ould foster rapid development of resistance. Instances of control failures caused by physiological resistance to cockroach gel insecticides including indoxacarb are thought to be rare (Valles and Brenner 1999, Wang et al. 2006, Gondhalekar et al. 2011). In contrast, as explained before, German cockroaches have developed resistance to almost every group of insecticide used as a spray or dust formulation (Cochran 1995, Scharf and Bennett 1995). Even in the current monitoring assays, more strains showed signif icantly reduced susceptibility in surface contact vial bioassays than in feeding tests. Holbrook et al. (2003) hypothesized that, fipronil (available only as gel bait formulation) would soon lose its effectiveness for cockroach control if deployed as a spr ay formulation. I think that the same hypothesis would be true in case of indoxacarb. To my surprise, however, in 2010 a spray formulation of indoxacarb (Arilon 20% indoxacarb) was launched for use against cockroaches, ants an d termites The lower recomme nded treatment rate of Arilon for cockroaches (2.02 g per cm2) is ~ 4.6 and 2.3fold greater than the lower and higher vial diagn ostic concentrations, respectively However, given the current tolerance levels of German cockroaches revealed in vial bioas says, widespread use of Arilon could significantly contribute to buildup of indoxacarb r esistance in field populations.

PAGE 71

71 Table 31. Details of field collected German cockroach strains from the United States. Strain Collection site (Town/City & State) Co llection site details Collection year Avg. strain weight (mg/insect) 1. T164 Gainesville, FL Apartment 1988 53.5 Gainesville Resistant (GNV R) Gainesville, FL Apartment 2006 59.0 Arbor Park (AP) Gainesville, FL Apartment 2007 52.0 NC Hog 2 Raleigh Area, NC Hog Farm 2007 55.4 Cocoa Beach 2008 (CB 2008)* 2 Cocoa Beach, FL High School 2008 59.0 Campus Club 45 (CC45) 2 Raleigh, NC Apartment 2007 58.5 Bakersfield Bakersfield, CA Apartment 2009 62.5 Cocoa Beach 2009 (CB 2009)* 2 Cocoa Beach, FL Hi gh School 2009 59.0 Fairmont Griffin, GA Apartment 2009 61.8 Keystone 2 Keystone Heights, FL Middle School 2009 64.5 Meriwell Griffin, GA Apartment 2009 62.2 Plainfield 9C Plainfield, NJ Apartment 2009 59.5 Plainfield 19C Plainfield, NJ Apartment 2009 60.8 Texas 2. Arlington, TX Apartment 2010 59.0 1. Average strain weight refers to average weight of 1 to 4 week old adult males that were used in vial and oral diagnostic bioassays. Strain weights were determined just before initiation of bioassays and hence the value represents average weight of starved (used in oral bioassays) as well as unstarved (used in vial bioassays) adult males. 2. Advion (0.6% indoxacarb) was used at these locations in combination with bait and spray formulations of other insecticides. Asterisks (*) indicate t he Cocoa Beach site strains that were collected at two time points (July 2008 and July 2009) separated by one year.

PAGE 72

72 Figure 31 Results of diagnostic concentration (DC) vial bioassays at DC1 (30 g per vial or 0.44 g per cm2). Bars represent knock down mortality at 72 h post treatment. Bars not connected with same letter are significantly different (Tukeys HSD test, P < 0.05 ). Error bars represent SE values. For each str ain 100 adult males were tested.

PAGE 73

73 Figure 32 Results of diagnostic concentration (DC) vial bioassays at DC2 (60 g per vial or 0.88 g per cm2). Bars represent knock down mortality at 72 h post treatment. Bars not connected with same letter are significantly different (Tukeys HSD test, P < 0.05 ). Error bars represent SE values. For each strain at least 100 adult males were tested.

PAGE 74

74 Figure 33. Results of diagnostic dose (DD) oral bioassays at DD1 (1.0 g per insect). Bars repre sent knock down mortality at 72 h post treatment. Bars not connected with same letter are significantly different (Tukeys HSD test, P < 0.05). Error bars represent SE values. For each strain 80 to140 adult males were tested.

PAGE 75

75 Figure 34 Re sults of diagnostic dose (DD) oral bioassays at DD2 (1.5 g per insect). Bars represent knock down mortality at 72 h post treatment. Bars not connected with same letter are significantly different (Tukeys HSD test, P < 0.05). Error bars represent SE val ues. For each strain 80 to 140 adult males were tested.

PAGE 76

76 Figure 35. Results of diagnostic dose (DD) oral bioassays at DD3 (2.5 g per insect). Bars represent knock down mortality at 72 h post treatment. Bars not connected with same letter ar e significantly different (Tukeys HSD test, P < 0.05). Error bars represent SE values. For each strain 80 to 140 adult males were tested.

PAGE 77

77 CHAPTER 4 IN VIVO BIOTRANSFORMATION OF INDOXACARB IN THE GE RMAN COCKROACH Cytochrome P450 monooxygenases (P450s) carboxylesterases (esterases) and glutat hione transferases (GSTs) are the most abundant detoxification enzymes found in insects (Bass and Field 2011). These enzymes act as a major line of defense against natural and synthetic xenobiotics including insecticides (Li et al. 2007, Bass and Field 2011). Detoxification reactions usually lead to formation of nontoxic metabolites with increased polarity, however, in the case of certain insecticides, bioactivation of the parent compound to a n apolar and more po tent metabolite by action of P450s and esterases is also common. Insecticides that initially exist in nontoxic or relatively less toxic forms and are bioactivated upon entry into the insect body are called pro insecticides (Prestwich 1990). Some examples of pro insecticides are organophosphates, chlorfenapyr and indoxacarb (Prestwich 1990, Black et al. 1994, Wing et al. 1998). The sodium channel blocker insecticide indoxacarb (a racemic mixture of 75 % active S enantiomer and 25 % inactive R enantiomer) is known to be bioactivated by esterase / amidase enzymes to an N decarbomethoxylated metabolite (DCJW) in lepidopteran and hemipteran insects (Wing et al. 1998, 2000; Alves et al. 2008). The bioactivated metabolite is more effective in blocking insect and mammalian sodium channels than the parent compound indoxacarb (Wing et al. 1998, Tsurubuchi et al. 2001, Zhao et al. 2005b). The differential biological activity of DCJW and indoxacarb appears to be partly explained by irreversible action of DCJW and reversible action of indoxacarb on insect sodium channels (Zhao et al. 2005b).

PAGE 78

78 Previous work on indoxacarb biotransformation in insects focused on determining the rate of DCJW formation, identifying the enzymes responsible for bioactivation and confirming the bioactivation phenomenon in different lepidopteran and hemipteran species (Wing et al. 1998, 2000; Alves et al. 2008). Except for its bioactivation to DCJW, biotransformation pathways of indoxacarb in insects remain unknown. In vertebrates (rats, cows, poultry etc.), alternatively, indoxacarb biotransformation pathways are well characterized (Scott 2000). In mammals and poultry both indoxacarb and DCJW are degraded by phase I and phase II enzymes like P450s, sulfotransferases and glucuronosyltransferases ( S cott 2000, Wing et al. 2004). Because of the central role that detoxification enzymes play in protecting living organisms from xenobiotics I expect that indoxacarb and DCJW must be undergoing extensive biotransformation in insects as well. Given the widespread use of gel bait (Advion; 0.6% indoxacarb) and spray (Arilon; 20% indoxacarb) formulations of indoxacarb for German cockroach control in the United States (Chapter 3), studies aimed at characterizing the biotransformation pathways of indoxacarb in this important target pest are much needed. Comparative biotransformation studies performed using susceptible and resistant strains should provide insights into potential indoxacarb resistance mechanisms that exist in the German cockroach Moreover, informat ion on candidate enzymes involved in indoxacarb bioactivation and degradation can be used for designing better control and resistance management strategies. For example, chemicals that induce or inhibit biotransformation enzymes / genes can be incorporated in bait matrix to improve efficacy of indoxacarb especially against tolerant cockroach populations. Thus, the

PAGE 79

79 overall goal of this study was to characterize in vivo biotransformation pathways of indoxacarb in susceptible and resistant strains of the German cockroach. My hypotheses for this study were that extensive indoxacarb biotransformation occurs in the German cockroach and that P450 enzymes will play some role in the biotransformation process. To test these hypotheses the specific objectives of this r esearch were: (1) determine relative toxicity of indoxacarb and DCJW in the German cockroach, (2) characterize in vivo biotransformation of indoxacarb in four cockroach strains that include one susceptible lab strain and three tolerant / resistant field st rains and (3) perform synergist bioassays and in vivo inhibition studies to identify candidate enzymes that are likely involved in indoxacarb biotransformation. Unlike conventional studies on insecticide metabolism in insects that were or are performed usi ng [14C] labeled molecules, this study was conducted using nonradiolabled indoxacarb and novel detection approaches; hence, we additionally explain the method development strategy in detail. Materials and Methods Cockroach S trains and R earing Four German cockroach strains were used in this study: Johnson Wax Susceptible (JWax S ), Arbor Park (AP), Gainesville Resistant (GNV R) and Campus Club 45 (CC45). The JWax S strain was used as a standard susceptible strain ( Gondhalekar et al. 2011). The AP, GNV R and CC45 are field collected strains (Table 31, Chapter 3) displaying varying levels of indoxacarb tolerance. The AP strain was highly tolerant to indoxacarb when collected from the field but after ~ 1 year of continuous laboratory rearing tolerance levels to indoxacarb decreased significantly (Gondhalekar et al. 2011, Appendix B ). The GNV R strain is extremely resistant to pyrethroids, DDT, dieldrin,

PAGE 80

8 0 fipronil and organophosphates but displays a low level, stable tolerance to indoxacarb ( Gondhalekar et al. 2011). The CC45 strain in contrast exhibits the highest known levels (~ 50 fold) of indoxacarb resistance in the German cockroach (Chapter 3). Rearing of mixedinstar cultures was performed using the protocol explained by Gondhalekar et al. ( 2011) Rearing c ontainers were maintained at 25 1 C temperature and under a 12:12 h (hour) light: dark cycle. All experiments were conducted under identical temperature and photoperiod conditions. A dult males (1 to 4 w eek old ) starved for 24 or 48 h, were used in all studies. Chemicals Piperonyl butoxide (PBO; 98.3% pure) and S,S,Strib utylphoshorotrithioate (DEF; 98% pure) were purchased from Chem Service (West Chester, PA). I ndoxacarb (99.1% active ingredient ) and Advion blank bait matrix were provided by DuPont Inc (Wilmington, DE). All other chemicals and analytical grade solvents were either purchased from Fisher Scientific (Pittsburgh, PA) or Sigma (St. Louis, MO). Oral B ioassays The oral bioassay technique that utilizes insecticide treated pellets of Advion b lank bait matrix (Gondhalekar et al. 2011) was used for estimating the relative toxicity of indoxacarb and DCJW to the JWax S and AP strains. Manually prepared pellets (~10 mg per pellet) of Advion blank bait matrix were individually treated with 1 L vol umes of indoxacarb or DCJW in acetone using a 50 L syringe attached to PB 600 1 dispenser (Hamilton, Reno, NV) and were allowed to dry for 10 to 15 min in fume hood. Single treated pellets were then provided to individual starved adult males starved for 2 4 h and held in 1 oz portion cups with aerated lids ( Sweetheart Cup Company Inc. Owings Hill, MD). Control insects received pellets treated with acetone only. A minimum

PAGE 81

81 of three to four insecticide concentrations providing mortality between 10 to 90 % were included for each treatment. At least three replicates of ten insects each were tested for each insecticide dose. Although about 90 to 95% of insects ate the treated Advion pellets within 2 h ( Gondhalekar et al. 2011) to minimize the effects of differential feeding rates on indoxacarb toxicity, insects that did not eat pellet s completely by 24 h were not used for mortality observations. Observations on knockdown mortality were made at 24, 48 and 72 h. Probit analyses of the 72 h mortality data, corrected for control mortality, were performed using the PROC PROBIT function in the SAS software package (SAS Institute, Cary, NC). Significance of lethal dose (LD50) values was determined based on nonoverlap of 95% confidence intervals (Scharf et al. 1995). Tox icity ratios were calculated as described in Table 41. Time C ourse Studies of I n V ivo Indoxacarb Bio transformation Oral bioassays were used for conducting timecourse experiments with one susceptible and three field strains noted above. Individual adult male cockroaches starved for 48 h were anesthetized by chilling on ice (for 5 to 10 mins) and transferred into 20 mL glass scintillation vials that contained a single Advion bait matrix pellet (~ 10 mg wet weight per pellet) treated with 6 g indoxacarb. Control insects were fed acetonetreated Advion pellets. The dose of 6 g per insect was selected because theoretically under field conditions when cockroaches feed on 1 mg of formulated Advion bait they acquire an indoxacarb dose of 6 g ( Gondhalekar et al. 2011, Chapter 3 ). After treatment, the vials were left undisturbed in the dark for ~ 20 min to allow the insects to completely feed on the bait pellets. Following this holding period, vials were checked for consumption of bait pellets and only those i nsects that had completely consumed the pellets were used for sampling at various time points. A longer starvation

PAGE 82

82 period ( i.e. 48 h) ensured that the insects immediately ate the pellets in entirety. Additionally, to achieve immediate feeding responses th e experiments were initiated just before the beginning of the scotophase ( i.e. dark cycle, 6:00 pm) when the feeding activity of cockroaches is known to be maximum. Insects in groups of ten were sampled at 0.5, 6, 12, 24, 48 and 72 h post treatment. The entire experiment was replicated three times for each of the four strains. During sampling each insect containing holding vial was rinsed with 0.5 mL acetone for ~ 5 sec. The acetone rinsate from ten such vials was pooled and purified using an acetoneprec onditioned solid phase extraction (SPE) column (glass Pasteur pipette plugged with glass wool and filled with 2 g silica gel). Five column volumes of acetone were passed through the SPE column to ensure complete elution of indoxacarb and its metabolites pr esent in the acetone rinsates. The purified acetone extract, hereafter referred to as external fraction was evaporated under nitrogen and reconstituted in 1 mL acetone for subsequent high pressure liquid chromatography (HPLC) analysis. The term external fraction refers to indoxacarb and metabolites extracted from the holding vial, insect feces and various body exudates (regurgitated bait and excreted secretions of the accessory glands) (Buczkowski et al. 2008). The whole body extracts, hereafter referr ed to as internal or internal organosoluble fractions were prepared for HPLC analysis using the method described by Wing et al. (1998). However, unlike the study by Wing et al. (1998) nonradiolabled indoxacarb was used. After isolating external fract ions as described above, groups of ten insects from each time point were homogenized in 13 mL of ethyl acetate (EtOAc): acetonitrile (ACNl): water (52:25:23) using a rotor stator style biohomogenizer. The

PAGE 83

83 homogenate was centrifuged for 10 min at 760 g and the organic layer was transferred into a new glass scintillation vial. The homogenate was then back extracted twice more with 10 mL EtOAc: ACNl (2:1). Organic fractions from the initial centrifugation and back extractions were pooled and evaporated under nitrogen to yield a viscous organic extract. The organic extracts were further diluted with 3 mL hexane (Hex) and loaded on Hex preconditioned SPE columns containing 2 g silica. To elute the lipids present in the sample, the SPE columns were washed with 3 c olumn volumes of Hex (1) and Hex: Ethyl ether (EE) (3:1). The resulting eluates were discarded and SPE columns were treated with 3 mL steps of Hex: EE (1:1), Hex: EE (1:3), EE (1) and EE: isopropanol (3:1). These latter eluate s, which contained indoxacarb and its metabolites, were pooled (final volume 12 mL) and evaporated under nitrogen and redissolved in 1 mL acetone for HPLC analysis. The absence of indoxacarb and its metabolites in the lipidcontaining Hex: EE eluate was also confirmed by HPLC analysis as described below. High Pressure Liquid Chromatography ( HPLC ) Analysis The external and internal organosoluble samples obtained from the timecourse experiment were transferred to 2 mL autosampler vials (Fisher Scientific, Pittsburgh, PA) and analyzed using a Shimadzu series HPLC (Shimadzu, Kyoto, Japan) consisting of two LC 20AT pumps, a CBM 20A communications bus module, a SPB M20A diode array detector, a DGU 20A3 degasser, and a SIL10AF autosampler. The autosampler 25 cm x 4 mm (Suppleco, Bellefonte, PA) after passing through a C18 guard column. Synchronized control of the various HPLC components was achieved through Shimadzu EZstart 7.4 SPI software. Analytes of interest were eluted using a series of

PAGE 84

84 ACNl + water gradients: (1) 20% ACNl from 0 to 5 min, (2) line ar gradient to 90 % ACNl from 5 to 13 min, (3) 90 % ACNl from 13 to 18 min, (4) linear gradient to 100% ACNl over 18 to 26 min, (5) 100 % ACNl from 26 to 31 min, (6) linear gradient to 20% ACNl over 31 to 36 min and (7) 20% ACNl from 36 to 41 mi n. A constant flow rate of 1 mL per min was used throughout. The diode array detector detected compounds with absorbance between 200 to 360 nm; however, a wavelength of 314 nm was used to detect peaks of indoxacarb and its metabolites (Zhang et al 2007) At this wavelength a minimal number of peaks from insect origin were detected and also this wavelength corresponds to the absorption maxima of DCJW (Zhang et al. 2007). The indoxacarb and DCJW peaks were identified by cochromatography against hig h purity technical grade standards (Figure 41). HPLC / Electrospray I onization (ESI ) Mass S pectrometry ( MS ) The internal organosoluble samples (treatment and control) and solvent (acetone) were analyzed via reverse phase gradient C18 HPLC / 314 nm UV with positive (+) ESI MS to determine accurate masses and putative structures of indoxacarb metabolites. HPLC / 314 nm UV detection was perf ormed with an Agilent (Palo Alto, CA) 1100 series system consisting of a G1322A degasser, G1312A binary pump and G1314A UV / Vis detector. Manual injections were made with a 25 uL Hamilton 1702 gastight syringe into a Rheodyne 7215 manual injector. Separations were performed on a Waters XTerra MS C18 column (3.5 m, 150 x 2.1 mm ; no guard column) using an ACNl (pump B) + water (pump A) grad ient with a flow rate of 0.2 mL per min. The gradient was as follows: (1) initial A: B = 95: 5 at time 0, (2) increased linearly to A: B=5: 95 in 45 mins, (3) A: B=5: 95 for 5 min, (4) increase linearly to A: B=0: 100 in 5 min, (5) A: B=0: 100 for 10 min, (6)

PAGE 85

85 linear gradient from A: B=0: 100 to A: B = 95: 5 in 10 min and (7) A: B = 95: 5 for 20 min to re equilibrate the column. All mass spectrometry data were obtained on a LCQ Classic quadrupole ion trap mass spectrometer (Thermo Scientific San Jose, CA) operating with a conventional ESI source. The ESI source was operated with nitrogen as a sheath and auxiliary gas at instrument settings of 65 and 5, respectively, and a heated capillary temperature of 250 C. Positive (+) ESI MS data were acquired with a spray voltage of 3.3 kV, heated capillary voltage of 20 V, and a tube lens offset of 0 V. In general MS spectra were acquired with 37.5% normalized collision energy, q CID = 0.25, and activation time of 30 ms. Isolation of the precursor ions was done with different isolation window widths (3 to exclude chlorine isotopes and 5 to 7 to include Cl isotopes). Synergism B ioassays Highest sublethal concentrations of synergist s (PBO = 100 g per insect or DEF = 30 g per insect) were used to t est the effect of synergist preapplication on oral toxicity of indoxacarb in both laboratory and field strains. Synergists diluted in 1 L volumes of acetone were topically applied to the 1st abdominal sternites of anesthetized adult male cockroaches usin g a 50 L # 80501 syringe attached to a PB 600 1 dispenser (Hamilton, Reno, NV). Approximately 1.5 h after synergist application the treated insects were exposed to indoxacarbtreated Advion blank bait matrix pellets as explained under oral bioassay method. A single indoxacarb dose of 0.25 g per insect was tested against the JWax S, AP and GNV R strains ; whereas three indoxac arb doses (0.25, 2.5 and 6.0 g per insect) were tested against the CC45 strain due to its high resistance Control insects were topically treated with acetone or synergists and exposed to acetonetreated bait pellets. Each treatment or dose consisted of ten insects

PAGE 86

86 and was replicated five times for each strain. Insects that did not completely eat the Advion blank bait matrix pellets at 24 h were not used for mortality evaluations ( see Oral bioassay method for additional details). Knockdown mortality (moribundity) observations were made every 24 h up to 72 h. The 72 h percent mortality data (corrected for control mortality using Abbotts formula ) were arcsine transformed and analyzed by analysis of variance (ANOVA) and means were separated using the Tukeys HSD test ( P < 0.05). In V ivo Inhibition Experiments Insects were topically treated with the enzymeinhibiting synergists PBO (100 g per insect) or DEF (30 g per insect) as explained above. Approximately 1.5 h after synergist treatment the insects were anesthetized on ice and individually transferred to 20 mL glass scintillation vials that contained a single Advion bait pellet treated with 6 g indoxacarb. Control insects were topically treated with acetone or PBO or DEF, but were fed with acetone treated bait pellets. Insects that did not completely feed on the baits within 20 min were discarded ( see Time course experiment metho ds for a detailed explanation). The bioassays continued for 24 h. After 24 h the insects were sampled and the external and internal organosoluble fractions were prepared and analyzed by HPLC following the procedures outlined above for time course experiments and HPLC analysis. Each treatment consisted of ten insect s and was replicated three times for each strain (four strains total). Statistical Analyses of HPLC D ata Retrieval and analyses of chromatography data were achieved using the computer based Shima dzu EZs tart 7.4 SPI software. For time course experiments, peak areas of indoxacarb and metabolite peaks at 314 nm were determined for each time period.

PAGE 87

87 From this data relative percent distributions of indoxacarb and / or related peaks for that particular ti me point were calculated. For example, at 0.5 h the only detectable peak on chromatograms was that of indoxacarb, and thus it accounted for 100% of the total peak area. Alternatively, at later time points as many as five indoxacarb and metabolite peaks wer e detected on chromatograms. Thus, in these cases the relative percent peak area of indoxacarb accounted for ~ 80% of the total peak area; whereas peak areas of DCJW and other metabolites accounted for the remaining ~ 20%. The data for change in relative peak area percent over time for each peak were analyzed using oneway nonparametric Kruskal Wallis tests ( P < 0.05) in JMP 8.0. Statistical comparisons were made within strain only. For in vivo inhibition experiments, peak areas for indoxacarb and related peaks were determined from each treatment, i.e., indoxacarb only + DEF and + PBO To determine changes in percent peak area caused by synergist treatment, the peak areas from + DEF and + PBO treatments were normalized to the indoxacarb peak area in the indoxacarb only treatment. As a result, the percent peak area for indoxacarb only treatments is always normalized at 100%. For statistical comparisons of the effect of synergist treatment on peak area, the data were log transformed and checked for normality (ShapiroWilks test) and equality of variances (Levenes test). The log transformed data were then analyzed by ANOVA and the means were separated using Tukeys HSD tests ( P < 0.05).

PAGE 88

88 R esults Relative Toxicity of Indoxa carb and its Bioactive Metabolite (DCJW ) in Lab and Field S trains Results of oral toxicity bioassays with indoxacarb and its bioactive metabolite DCJW to the JWax S and AP strains are shown in Table 41. Comparison of indoxacarb and DCJW LD50 values within strain (as indicated by Fold difference in toxicity ) revealed that both molecules are equally toxic to the German cockroach (JWax S and AP strains). However, when indoxacarb and DCJW LD50 values were compared between the JWax S and AP strains (as indicated by RR50 ), the AP strain was slightly more tolerant to DCJW than the JWax S strain. Thus, while indoxacarb and DCJW induce similar toxicities slight tolerance was observed against DCJW in the field strain. In Vivo Biotransformation Internal organosoluble fraction Following oral feeding of indoxacarb (6 g per insect), five different indoxacarb and indoxacarbmetabolite peaks were detected in the internal organosoluble fraction on HPLC chromatograms (Figure 41). At the 314 nm wavelength, no interfering insect origin peaks w ere detected on chromatograms, allowing unambiguous identification and quantification of indoxacarb related peaks (Figure 41). Only the indoxacarb peak was detectable in 0.5 h samples, whereas DCJW and three unidentified polar metabolite peaks eluting at 15.85, 16.06 and 16.5 min were detected beginning at 6 h post treatment. The indoxacarb and DCJW peaks were identified by cochromatography against technical grade standards (Figure 41). The fact that three unidentified metabolite peaks ( referred by reten tion times as 15.85, 16.06 and 16.5) were not

PAGE 89

89 detected in control insect samples and in 0.5 h treated insect samples confirms that they are biotransformation products of indoxacarb and/ or DCJW The relative amounts of indoxacarb in the organosoluble fracti on visibly decreased in all strains over the 72 h sampling period (Figure 42). This decrease in indoxacarb levels was significant in the 3 field strains, but not in the JWax S susceptible strain (see Table 42 for results of Kruskal Wallis one way analysi s). In the case of DCJW, relative percent peak areas increased significantly ov er time and were highest at 24 or 48 h in the three field strains. In the JWax S strain, however, percent peak area of DCJW showed no detectable increase from 6 to 72 h. The rel ative percent peak areas of three unidentified metabolites (15.85, 16.06 and 16.5) also showed a steady increase from 6 to 72 h in all the four strains, but as observed with indoxacarb and DCJW, this change in peak area over the sampling duration was signi ficant only in the three field strains. Overall, the distribution trends observed for indoxacarb and metabolites indicates that significantly higher indoxacarb biotransformation consistently occurs in the three field strains. External fraction The term ex ternal fraction refers to samples prepared form the acetone rinsates of insects and holding vials. All five peaks that were detected in the internal organosoluble fraction were also present in the external fraction. Only the indoxacarb peak was detected i n the 0.5 h sample and the DCJW peak was detected starting at 6 h post treatment. The peaks of unidentified metabolites were also detected starting at 6 h in the three field strains but were undetectable in the JWax S strain until the 24 h sampling point ( Figure 43)

PAGE 90

90 The trend of changes in relative percent peak area of indoxacarb, DCJW and unidentified metabolites over time in the external fraction was essentially identical to those seen in the organosoluble fraction (Figure 42). In general, in the exter nal fraction: (1) indoxacarb levels decreased over time, (2) DCJW increased up to 12 or 24 h and then decreased and (3) unidentified metabolites increased inconsistently over time. Interestingly, however, changes in levels of DCJW and the three unidentified metabolites in the external fraction were significant over time only for the CC45 strain (see Table 42 for Kruskal Wallis one way analysis results). These results indicate that significant excretion (through feces or other body exudates) of DCJW and the three unidentified metabolites is occurring in the CC45 strain but not in the other field strains (AP and GNVR) or the lab strain. HPLC / ESI MS Analysis of Unidentified Metabolites The 48 and 72 h internal organosoluble samples from treated and control insects were analyzed by HPLC (314 nm) / ( +) ESI MS to determine the molecular weights of unidentified metabolites. The detection of unidentified metabolites in treated insect samples was aided by two factors: (1) characteristic isotopic distributions of c hlorine in ESI produced ion chromatograms and (2) the unique absorption of metabolites at 314 nm. The parent compound indoxacarb and its bioactive metabolite contain one chlorine atom and all the unidentified metabolites were also found to be monochlorinated. The three unidentified metabolite peaks corresponded to seven potentially different compounds with four different molecular masses (Table 43). The 15.85 peak was composed of three compounds (mw 515, 457A and 457B), the 16.06 peak contained two compounds of the same mass (543), and the 16.5 peak contained two compounds of molecular weight 485.

PAGE 91

91 Putative structures of four of the seven unidentified metabolites based on the molecular weights determined by HPLC / ESI MS and indoxacarb biotransformation stu dies in mammalian systems are shown in Figure 44 Two of the three compounds eluting at 15.85 min appear to be oxadiazine ring opened metabolites of indoxacarb and DCJW viz., KG433 (mw 515) and JU873 (mw 457), respectively. Ring hydroxylated metabolites o f indoxacarb (5hydroxy indoxacarb; mw 543) and DCJW (5hydroxy DCJW; mw 485) are thought to be the major metabolites eluting at 16.06 and 16.5 min, respectively. Synergism Bioassays and In Vivo Inhibition Studies to Identify Candidate Biotransformation E nzymes Synergism bioassays Effects of the synergists PBO and DEF on indoxacarb toxicity in three field strains and the susceptible JWax S strain are shown in Figures 45 and 46 In the AP and GNV R strains PBO antagonized indoxacarb toxicity while DEF had no significant effect (ANOVA results: df = 6, 16, F = 14.16, P = 0.0024 for AP; df = 6, 14, F = 43.56, P < 0.0001 for GNV R). In the susceptible JWax S strain, indoxacarb toxicity did not change after synergist preapplication (ANOVA results: df = 6, 14, F = 2.57, P = 0.10). Similarly, in the CC45 strain, at 3 different indoxacarb concentrations (0.25, 2.5 and 6 g per insect) synergists did not impact indoxacarb toxicity (ANOVA results: df = 4, 8, F = 0.58, P = 0.70 for 2.5 g dose; df = 4, 8, F = 0.33, P = 0.84 for 6.0 g dose). HPLCbased in vivo inhibition experiments Internal fraction. Impacts of the synergists PBO and DEF on in vivo indoxacarb metabolism are depicted in Figure 48 PBO and DEF peaks did not interfere with detection and quantification of indoxacarb and metabolite peaks (Figure 47 ). In the

PAGE 92

92 internal organosoluble fraction, PBO significantly inhibited DCJW formation by ~ 2 to 3fold in all strains (se e Table 44 for ANOVA results).The esterase inhibitor DEF had no significant effects on DCJW levels in any strain. PBO significantly reduced levels of metabolites eluting at 16.06 and 16.5 min (putatively ring hydroxylated metabolites of indoxacarb and DCJW) and either significantly (JWax S and AP) or nonsignificantly (CC45 and GNV R) increa sed the levels of metabolites at 15.85 min (putative oxadiazine ring opened metabolites). On the other hand, DEF significantly inhibited the 16.5 peak in the GNV R strain but had no effect in the other three strains. In DEF pretreated insects the formatio n of peaks with RT of 15.85 and 16.06 increased significantly in all the strains except the JWax S strain where the percent area for 16.06 peaks remained the same. Both synergists either increased or had no significant effect on indoxacarb levels in the internal organosoluble fraction. External fraction. Because PBO inhibited DCJW formation in vivo significant decreases in DCJW excretion were expected at 24 h. Indeed, DCJW levels in the external fraction (in comparison to the indoxacarb only treatment) d ecreased after PBO pre treatment in all strains (see Table 4 4 for ANOVA results). Likewise, decreases in DCJW levels were seen that were accompanied by increas ed indoxacarb levels (Figure 49 ). Pre treatment with the esterase inhibitor DEF did not impact DCJW or indoxacarb levels in the external fraction. In fact, DCJW levels actually increased in the JWax S strain following treatment with DEF. In the external fraction, metabolite peaks were detectable in some treatments / strains and undetectable in other s (especially in the samples from PBO treatments); hence, data on quantification of these metabolites are not presented.

PAGE 93

93 Discussion Indoxacarb and DCJW Toxicity at the Organismal Level T oxic action of insecticides that are metabolically activated in the i nsect body is dependent on the potency of the parent insecticide and their bioactive metabolite(s) (Wing et al. 1998, 2000; Scharf at al. 1999b Tsurubuchi 2001, Zhao and Salgado 2010). Usually, at the molecular level ( i.e., at the target site), the bioact ive metabolites of insecticides are more potent than the parent compounds. For example, neurophysiology studies with both insect nerve preparations and heterologously expressed insect sodium channels have shown that the bioactive metabolite DCJW is more ef fective in blocking sodium channels than indoxacarb itself (Wing et al. 1998, Tsurubuchi et al. 2001, et al. 2005a). In this study, I found that at the organismal level DCJW and indoxacarb were equally toxic to the German cockroach. Similar results on orga nismal level toxicity of indoxacarb and DCJW have been reported for several lepidopteran insects that are important crop pests (Wing et al. 1998, Tsurubuchi et al. 2001). In contrast DCJW was 5 fold more toxic to houseflies than indoxacarb (Shono et al. 2 004). Although my bioassay results are not in agreement with findings of previous neurophysiology studies and bioassay results with houseflies, my bioassay results do not actually reflect true differences in toxicity. This is because in vivo formation of DCJW also occurs in indoxacarb treated insects, which makes the LD50 values of both compounds indistinguishable (Table 41). Nevertheless, observations made while conducting doseresponse bioassays with the German cockroach suggest that DCJW kills cockroa ches faster than indoxacarb (data not shown), a result that corresponds with the known molecular mode of action of DCJW at insect sodium channels (Wing et al. 1998, Zhao et al. 2005b).

PAGE 94

94 Interestingly, in comparison to the JWax S strain, the AP strain was found to be slightly more tolerant to DCJW. Toxicokinetic or target site related factors could be responsible for increased tolerance of the AP strain to DCJW. Further studies on toxicity of DCJW to German cockroach strains resistant to indoxacarb ( e.g., CC4 5; Chapter 3) will be essential to develop a better understanding of the mechanisms involved. P utative Metabolites of Indoxacarb Bioactivation of indoxacarb to DCJW has been experimentally shown to occur in lepidopteran, hemipteran and coleopteran insects (Wing et al. 1998, 2000; Alves et al. 2008). Here I show that indoxacarb is also bioactivated in vivo to DCJW in German cockroaches (Figure 41). In addition to verifying the bioactivation of indoxacarb in the German cockroach, I also identified putative b iotransformation products of indoxacarb, which to my knowledge are the first such identifications in insects. Previous work on the metabolic fate of indoxacarb has mainly been conducted in rats, cows, poultry, etc from an environmental risk assessment per spective ( Scott 2000, Wing et al. 2004). Apart from DCJW, as many as 20 indoxacarb metabolites were detected in plasma, body tissues, byproducts (milk and eggs) and excretory products (urine and feces) of animals that were orally dosed with a racemic mixture (3S+1R) of [14C] indoxacarb. The major metabolites identified in rats, cows and poultry were 5OH Indoxacarb, 5OH DCJW, oxadiazine ring opened met abolites of indoxacarb (KG433; S and R enantiomer ), DCJW (also known as JU873 ) and glucuronoid and sulphate conjugates ( Scott 2000, Wing et al. 2004). Based on the limited HPLC / (+) ESI MS studies that are available for reference, four of the seven putative metabolites recovered from the body tissues and feces of the German cockroach are proposed to be 5OH Indoxacarb, 5OH DCJW, KG433, and JU873 (Table 43 an d Figure 44 ). However, more indepth analyses of ESI

PAGE 95

95 produced mass spectra and/ or nuclear magnetic resonance (NMR) studies will be required to confirm the proposed structures of these metabolites and t o determine the structures of the other three unidentified metabolites These efforts are ongoing. S train D ependent D ifferences in Biotransformation of Indoxacarb Obvious differences in the rate of indoxacarb biotransformation existed between the German cockroach lab and field strains tested here (Figures 42 and 43). Over the sampling duration, significant amounts of DCJW and other metabolites were recovered from the internal organosoluble fraction of the field strains but not the JWax S laboratory strain In spite of uniformly higher DCJW formation in the field strains, toxicity bioassays indicated differential susceptibilities among these strains (Chapter 3; Table 41). In particular, while the GNV R and AP strains have low level indoxacarb tolerance, the CC45 strain displays the highest reported indoxacarb resistance known in the German cockroach. A plausible explanation for higher indoxacarb and/ or DCJW tolerance in field strains could be higher formation of other metabolites (hydroxy and ring opened me tabolites) which appear to be detoxification products of both indoxacarb and DCJW. However, the biological activity of these metabolites remains to be determined. Based on in vivo and in vitro tests, hydroxy metabolites of carbaryl and imidacloprid are known to have low level biological activity against insects (Scharf et al. 1999a, Tomalski et al. 2010). Alternatively, novel or preexisting target site modifications ( e.g., the kdr mutation which occurs in insect sodium channels), could be responsible for higher tolerance of field strains to indoxacarb and/ or DCJW, particularly in the case of CC45. In the external fraction, significant excretion of DCJW and other metabolites was exhibited by the CC45 strain. These findings agree with the known level of indox acarb resistance in the CC45 strain (Chapter 3) and the metabolite formation profile in the

PAGE 96

96 internal organosoluble fraction (Figure 42). Higher recovery of DCJW and other metabolites was also expected from the external fractions of the AP and GNV R strain s; however, an early onset of intoxication symptoms and quicker knockdown times (data not shown) during the timecourse experiments may have impacted excretion of detoxification products by the AP and GNV R strains. On the other hand, most of the CC45 stra in insects (7080%) were alive and showed minimal intoxication symptoms until 72 h The survival of the CC45 strain for longer duration in spite of higher DCJW formation suggests that highlevel indoxacarb resistance (~ 50 fold) in the CC45 strain might be caused by a combined effect of enhanced metabolism and target site modification. In contrast, only metabolic factors appear to be associated with low level indoxacarb and/ or DCJW tolerance in the GNV R and AP strains. Enzymes Involved in Indoxacarb Biotra nsformation Evidence from indoxacarb biotransformation studies in lepidopteran insects initially suggested that insect esterase / amidase enzymes are responsible for bioactivation of indoxacarb to DCJW (Wing et al. 1998, 2000; Alves et al. 2008). In contradiction to these results, synergist bioassays and in vivo inhibition experiments with the German cockroach provided evidence for cytochrome P450 based bioactivation. The classical P450 inhibitor PBO inhibited DCJW formation; whereas DEF, a stereotypical es terase inhibitor, had no effect. Synergism bioassay results for the AP and GNV R stra ins were in complete agreement; ( i.e., because DCJW is known to be a more potent inhibitor of insect sodium channels than indoxacarb (Zhao et al. 2005b), inhibition of DCJ W formation should cause antagonism of indoxacarb toxicity, which is what I observed) Thus, antagonism of indoxacarb toxicity by PBO implies that P450s are responsible for bioactivation of indoxacarb.

PAGE 97

97 Despite this convincing evidence, in vivo inhibition studies and bioassays using enzyme inhibitors like PBO and DEF only provide indirect evidence of candidate enzymes involved in biotransformation. For example, DEF may nonspecifically inhibit P450s and PBO may nonspecifically inhibit esterases (Valles et al. 1997, Khot et al. 2008). Moreover, although mammalian P450s are known carry out oxidative cleavage of carboxylic esters like pyridine (Guengerich et al. 1987, 1988), the type of modification that leads to bioactivation of indoxacarb to DCJW (N CO2CH3 t o N H) is unlikely to be carried out entirely by cytochrome P450s. Action of P450s on indoxacarb (at the site of bioactivation) may result in the following modification: N CO2CH3 to N COOH. Thus, although the above results suggest involvement of P450s in i ndoxacarb biotransformation, additional in vitro biotransformation studies with different subcellular fractions and in the presence and absence of cofactors (NADPH and GSH) will be essential for drawing stronger conclusions. Nevertheless, inhibition of putative ring hydroxylated metabolites of indoxacarb (5OH Indoxacarb; RT 16.06 min) and DCJW (5OH DCJW; RT 16.5 min) by PBO strongly su ggests the involvement of P450s in formation of these metabolites. This is because carbon hydroxylation is a very common P450mediated reaction and usually leads to formation of polar compounds that may be nontoxic (Guengerich 2001) or may exhibit limited biological activity (Scharf et al. 1999a, Tomalski et al. 2010). Treatment with an esterase inhibitor DEF led to increased 5OH Indoxacarb formation (RT 16.06 min) in the field strains; however, the factors that lead to this increase remain unknown. Also, formation of putative oxadiazine ring opened metabolites of indoxacarb and DCJW (KG433 and JU873, respectively) that ar e thought to be coeluting at 15.85 min

PAGE 98

98 increased following DEF and PBO pretreatment and this increase was more pronounced with DEF. Studies with rats have shown that KG433 and JU873 are produced by action of hepatic microsomal enzymes, which include P450s ( Scott 2000). Increased formation of KG433 and JU873 by PBO pretreatment suggests that PBO does not inhibit the P450 isoforms responsible for production of these metabolites. In addition, higher substrate availability due to inhibition of hydroxy metabolite formation by PBO may also have contributed to increased KG433 and JU873 formation. DEF induced increases in KG433 and JU873, however, were unexpected and the mechanisms that le d to this increase remain to be determined. These latter results imply that esterases may play a role in formation of novel metabolites. Again, given the somewhat inconclusive nature of results reported here, in vitro studies will be crucial for conclusively identifying the enzymes involved in indoxacarb biotransformation. Elucid ation of exact structures of metabolites through NMR or HPLC / negative ( ) ESI MS will further aid in identifying the exact role of detoxifying enzymes like P450s and esterases. Potential Indoxacarb Resistance Mechanisms in the Campus Club 45 Strain As me ntioned, the CC45 strain has a very high level of indoxacarb resistance estimated at approximately 50x (Chapter 3). Here we showed that this strain is capable of significantly bioactivating and detoxifying indoxacarb (Figure 42) probably due to increased activities of enzymes like P450s. Unlike other field strains tested here (AP and GNV R), higher excretion of DCJW and metabolites was also seen in the CC45 strain (Figure 43) perhaps due to longer survival times in the timecourse experiments Also, as ex pected, PBO and DEF caused significant inhibition of indoxacarb biotransformation (Figure 4 8 and Figure 49 ) providing additional evidence supporting

PAGE 99

99 the existence of enhanced metabolic capacities of the CC45 strain. Surprisingly, however, in synergism bi oassays at three different concentrations (0.25, 2.5 and 6.0 g per insect), neither PBO nor DEF altered indoxacarb toxicity to the CC45 strain. Thus, despite inducing significant changes in indoxacarb biotransformation, PBO and DEF did not have any effect on indoxacarb toxicity at the organismal level. Indirectly, these results strongly suggest that in addition to enhanced metabolism, target site based indoxacarb resistance mechanisms are also present in the CC45 strain. In summary, in this chapter it has been shown that extensive indoxacarb biotransformation occurs in the German cockroach. As shown in other insect species indoxacarb is also bioactivated to DCJW in German cockroaches. At least seven metabolites of indoxacarb and/ or DCJW, which likely are products of detoxification reactions, were also detected following in vivo treatment with indoxacarb. Four of these seven metabolites are putative indanone ring hydroxylated and oxadiazine ring opened compounds of indoxacarb and DCJW. Synergism bioassays and in vivo inhibition studies with PBO and DEF confirmed that cytochrome P450 monooxygenases play roles in indoxacarb and DCJW biotransformation. However, before drawing stronger conclusions on the role of specific enzyme families, additional in vitro meta bolism experiments and metabolite structure elucidation studies ( e.g. NMR) are essential. Finally, based on the results of in vivo biotransformation experiments, as well as in vivo inhibition studies and synergism bioassays, high level indoxacarb resistance in the CC45 strain appears to be caused by the combined effect of target site and metabolism related factors. On the other hand, low level indoxacarb and / or DCJW tolerance in the GNV R and AP strains is likely associated with enhanced metabolism. Future studies

PAGE 100

100 with the highly resistant CC45 strain should focus on understanding the mechanistic basis of target site insensitivity to indoxacarb and/or DCJW.

PAGE 101

101 Table 41. Oral toxicity of indoxacarb and its bioactive metabolite ( DCJW ) to the Johnson Wax Susc eptible ( JWax S ) and Arbor Park (AP) strains at 72 h. Insecticide Strain n Chi square (df ) 1 Slope ( SE) LD 50 (and 95% CI) 2 Fold difference in toxicity 3 RR 50 4 Indoxacarb JWax S 210 2.56 (4) 3.06 (0.56) 1.91 (1.49 2.55) -. -AP 210 6.30 (4 ) 3.05 (0.42) 3.27 (2.5 4.04) -1.71 DCJW JWax S 240 7.94 (5) 3.71 (0.55) 1.49 (1.28 1.70) 0.78 -AP 210 1.45 (4) 3.11 (0.45) 3.65 (2.88 4.42) 1.12 2.44* 1. Chi square and corresponding degrees of freedom. 2 Lethal dose ( LD50) values with 95% confidence interv indoxacarb per g ram body weight (Strain weights: JWax S = 47 mg/male and AP = 52 mg/male). 3 Fold difference in toxicity of DCJW relative to toxicity of indoxacarb at the LD50 level. Values were obtained by div iding DCJW LD50s with indoxacarb LD50s. 4 Resistance ratio at LD50. Ratios were determined by dividing LD50s of A P by LD50s of JWax S. Asterisks indicate significant ratios based on nonoverlap of LD50s. n = total number of adult males used in bioas says.

PAGE 102

102 Table 42. Results of oneway Kruskal Wallis analys es for in vivo biotransformation studies with indoxacarb. Strain Fraction Peak name d f Chisquare ( 2 ) P value 1. JWax S Internal organosoluble Indoxacarb 5 9.80 0.08 DCJW 5 8.88 0.11 15.85 5 10.49 0.06 16.06 5 10.57 0.06 16.5 5 8.72 0.07 External Indoxacarb 5 8. 26 0.14 DCJW 5 7.49 0.18 15.85 5 10.25 0.07 16.06 5 9.85 0.08 16.5 5 10.87 0.06 CC45 Internal organosoluble Indoxacarb 5 15.99 0.007 DCJW 5 15.47 0.009 15.85 5 14.98 0.01 16.06 5 16.03 0.007 16.5 5 15.89 0.007 External Indox acarb 5 12.90 0.02 DCJW 5 12.42 0.03 15.85 5 11.31 0.04 16.06 5 13.84 0.02 16.5 5 13.48 0.02 AP Internal organosoluble Indoxacarb 5 13.83 0.02 DCJW 5 14.56 0.01 15.85 5 13.46 0.02 16.06 5 13.98 0.02 16.5 5 14.67 0.01 Ex ternal Indoxacarb 5 11.24 0.04 DCJW 5 0.59 0.09 15.85 5 7.65 0.18 16.06 5 8.91 0.11 16.5 5 9.37 0.09 GNV R Internal organosoluble Indoxacarb 5 14.26 0.01 DCJW 5 13.39 0.02 15.85 5 14.61 0.01 16.06 5 14.87 0.01 16.5 5 14.98 0. 01 External Indoxacarb 5 8.75 0.12 DCJW 5 4.56 0.47 15.85 5 5.92 0.31 16.06 5 6.18 0.29 16.5 5 8.28 0.14 1. Peaks with P values < 0.05 are significant and are shown with an asterisk (*).

PAGE 103

103 Table 43. Molecular weights (MWs) and positive (+) electro spray ionization (ESI) mass spectrometry ( MS ) attributes of indoxacarb and its metabolites. Peak name1. No. of unidentified metabolites associated with each peak MWs of Metabolites Number of chlorines [M+H] [ Mina ] Product ions (+) ESI MS 15.85 3 515 1 516 538 281, 498, 281, 263 457 A 1 458 480 255, 237, 225, 205, 149 457 B 1 458 480 255, 237, 225, 177, 149 16.06 2 543 A 1 544 566 526, 323, 309, 279, 265, 251, 223, 218 543 B 1 544 566 526, 341, 323, 309, 266, 265, 233 16.5 2 485 A 1 486 508 283, 265, 208, 180 485 B 1 486 508 283, 265, 223, 208, 108 Indoxacarb 1 527.07 1 528 550 249, 496, 484, 452, 325, 293, 267, 249, 223, 217, 190, 164 CH2 analog of indoxacarb 1 541 1 542 564 263, 510, 498, 466, 339, 307, 281, 263, 237, 217, 207, 190 DCJW 1 469.07 1 470 492 267, 223, 207, 191, 150 1. Peaks are referred to / identified based on their retention times identified vi a reversed phase high pressure liquid chromatography (HPLC) ( see Figure 51). HPLC / (+) ESI MS analysis of the samples provided higher resolution of the peaks due to a longer Acetonitrile : water gradient. Thus, more than one metabolite was seen to be associated with each peak. Retention times of metabolites from HPLC / (+) ESI MS studies are not shown.

PAGE 104

104 Table 44 Analysis of variance (ANOVA) results for in vivo inhibition of indoxacarb biotransformation Strain Fraction Peak name d f F ratio P value 1. JWax S Internal organosoluble Indoxacarb 4,8 1.39 0.38 DCJW 4,8 28.23 0.003* 15.85 4,8 10.5 0.02* 16.06 4,8 6.94 0.04* 16.5 4,8 11.18 0.02* External Indoxacarb 4,8 1.42 0.37 DCJW 4,8 30.58 0.003* CC45 Internal organosoluble Indoxacarb 4,8 3.77 0.11 DCJW 4,8 33.44 0.003* 15.85 4,8 31.15 0.003* 16.06 4,8 59.98 0.0008* 16.5 4,8 18.05 0.008* External Indoxacarb 4,8 2.97 0.15 DCJW 4,8 7.42 0.04* AP Internal organosoluble Indoxacarb 4,8 3.21 0.14 DCJW 4,8 23.45 0.005* 15.85 4,8 11.32 0.01* 16.06 4,8 9.87 0.01* 16.5 4,8 8.56 0.04* External Indoxacarb 4,8 3.64 0.12 DCJW 4,8 28.40 0.003* GNV R Internal organosoluble Indoxacarb 4,8 2.94 0.16 DCJW 4,8 35.38 0.002* 15.85 4,8 36.94 0.002* 16.06 4,8 44.87 0.001* 16.5 4,8 51.53 0.001* External Indoxacarb 4,8 6.26 0.06 DCJW 4,8 24.70 0.004* 1. Peaks with P values < 0.05 are considered significant and are shown by asterisks (*).

PAGE 105

105 Figure 41. Representative high pressure liquid chromatography ( HPLC) chromatograms from timecourse experiments. (A) Overlaid chromatograms of internal organosoluble fractions. No peaks were detected in the untreated insect (control) samples, whereas, only indoxacarb peaks were detected in 0.5 h treated insect samples and five peaks corresponding to indoxacarb and its metabolites were detected in 72 h samples. (B) Chromatogram showing indoxacarb (RT 17.00 min) and DCJW (RT 17.50 min) peaks obtained using technical grade standards. Asterisks (*) indicate an impurity (putatively a CH2 analog of indoxacarb) present in the technical grade standard.

PAGE 106

106 Figure 42. Percent distribution of indoxacarb and indoxacarbmetabolite peaks (isolated from the organosoluble / internal fraction) on HPLC chromatograms following in vivo treatment of four cockroach strains with indoxacarb at 6 g per insect (n = 3 replicates of ten insects per replicate). Bars with different colors represent different time points at which insects were sampled. Only i ndoxacarb peaks were detected in 0.5h samples, whereas metabolites (DCJW, 15.85, 16.06 and 16.5) were detected beginning at 6h post treatment. P values with asterisks (*) indicate that significant changes in percent peak areas occurred over time for indi vidual compounds (Kruskal Wallis test, P < 0.05).

PAGE 107

107 Figure 43. Percent distribution of indoxacarb and indoxacarbmetabolite peaks (isolated from the holding vial / external fraction) on HPLC chromatogram s following in vivo treatment of four Germa n cockroach strains with indoxacarb at 6 g per insect ( n = 3 replicates of ten insects per replicate). B ars with different colors represent different time points at which insects were sampled. Only indoxacarb peak s were detected in 0.5 h samples, whereas metabolites (DCJW, 15.85, 16.06 and 16.5) were detected beginning at 6 or 24 h post treatment P values with asterisk s (*) indicate that significant change s in percent peak areas occurred over time for individual compounds (Kruskal Wallis test, P < 0.05 ).

PAGE 108

108 Figure 44 Putative biotransformation pathways of indoxacarb in the German cockroach, determined based on synergist studies and mass spectra obtained in the present study. Bioactivation of indoxacarb to DCJW by P450s leads to increase in pot ency of indoxacarb. Potential cytochrome P450 mediated indanone ring hydroxylation and oxadiazine ring opening of indoxacarb and DCJW leads to formation of relatively polar compounds. These polar compounds appear excretable, but their biological activity r emains to be determined. Potential roles for esterases were not established by the current work

PAGE 109

109 Figure 45 Effects of the enzyme inhibiting insecticide synergists DEF (an esterase inhibitor) and PBO (a cytochrome P450 inhibitor) on oral toxicity of indoxacarb to the Johnson Wax Susceptible ( JWax S ) Arbor Park (AP) and Gainesville Resistant ( GNV R ) strains. Bars represent 72 h percent mortality values at an indoxacarb dose of 0.25 g per insect (n = 5 replicates of ten insects per repli cate). The synergists PBO and DEF were topically administered 1.5 h before exposing the insects to indoxacarbtreated Advion blank bait matrix pellets (see methods section for details). P values less than 0.05 are indicative of significant differences among treatments (Tukeys HSD test).

PAGE 110

110 Figure 46 Effect of the enzymeinhibiting insecticide synergists DEF (an esterase inhibitor) and PBO (a cytochrome P450 inhibitor) on oral toxicity of indoxacarb to the Campus C lub 45 ( CC45 ) strain Bars represent 72 h percent mortality values at indoxacarb doses of 0.25, 2.5 and 6.0 g per insect (n = 3 replicates of ten insects per replicate). PBO and DEF were topically administered 1.5 h before providing insects with indoxacarbtreated Advion bl ank bait matrix pellets ( see methods section for details ). All P values were greater than 0.05, thus indicating no significant differences among treatments (Tukeys HSD test).

PAGE 111

111 Figure 47 Representative HPLC chromatograms from the in vivo inh ibition experiment (internal organosoluble fraction at 24 h post treatment). In each chromatogram traces from control insects (acetone, DEF or PBO treated) are overlaid with traces from treated insects. In acetone or DEF pretreated insects no peaks are vi sible in control insect samples. In PBO pretreated insects, a peak with RT of 17.78 min is seen in control and treated insect samples. The PBO peak, however, does not coelute or interfere with quantification of metabolite peaks. The peak areas of metabol ites (15.85, 16.06, 16.5 and DCJW) are somewhat similar in the top (indoxacarb only) and middle (+ DEF) chromatograms. Whereas, in the bottom (+ PBO) chromatogram peak areas of the metabolites 16.06, 16.5 and DCJW are reduced by PBO pretreatment (note the difference in Y axis scales of the chromatograms). Asterisks (*) indicate an impurity peak (putatively a CH2 analog of indoxacarb) present in the technical grade standard.

PAGE 112

112 Figure 48 In vivo inhibition of indoxacarb biotransformation by DEF and PBO in four German cockroach strains (n = 3 replicates of ten insects per replicate). Inhibitors were topically administered 1.5 h before exposing the insects to indoxacarbtreated Advion blank bait matrix pellets (6 g per pellet). The X axis represents peaks detected in the organosoluble / internal fractions on HPLC chromatograms. Vertical bars (Y axis) represent percent peak areas (at 24 h) in indoxacarb + inhibitor treatments normalized to indoxacarbonly treatments. For individual peaks within strai n bars with different letters are significantly different (Tukeys HSD test, P < 0.05). For ANOVA results refer to Table 44.

PAGE 113

113 Figure 49 In vivo inhibition of indoxacarb metabolism by DEF (an esterase inhibitor) and PBO (a cytochrome P450 inhibi tor) in four German cockroach strains (n = 3 replicates of ten insects per replicate). Inhibitors were topically administered 1.5 h before exposing the insects to indoxacarb treated Advion blank bait matrix pellets (6 g per pellet). The X axis represents peaks detected in the holding vial / external fractions on HPLC chromatograms. Vertical bars (Y axis) represent percent peak areas (at 24 h) in indoxacarb + inhibitor treatments normalized to indoxacarbonly treatments. For individual peaks (within strain ) bars with different letters are significantly different (Tukeys HSD test, P < 0.05). For ANOVA results refer to Table 44.

PAGE 114

114 C HAPTER 5 RESISTANCE RISK ASSES SMENT: HERITABILITY AND POTENTIAL MECHANISMS OF INDOXACARB RESIST ANCE IN THE GERMAN COCKROACH FOLLOWING LABORATORY SELECTION Insecticide resistance in insect pests of agricultural, veterinary, urban and public health importance is a serious problem worldwide. As many as 600 species of insects and mites have been reported to possess resistance to at least one synthetic organic insecticide (Georghiou and Lagunes Tejeda 1991, APRD 2011). Control failures caused as a result of resistance in target insects lead to repeated applications of the same or different insecticides, which not only increase the c osts of treatments, but also cause considerable deleterious impacts to the environment and natural enemy populations ( Tabashnik and Roush 1990). Considering the severity of the insecticide resistance problem, questions that arise with the introduction of a ny new insecticidal chemistry are: how soon will the target pest develop resistance, what will be the resistance mechanism(s) that may be selected in the insects and what will be the mechanism of inheritance of resistance alleles? (Shono et al. 2004). A nsw ers to these questions are important for designing resistance management strategies to delay the rate of resistance development (Scott 1990). For example, if resistance is known to be caused by over expressed cytochrome P450 monooxygenases (P450s) then synergists like piperonyl butoxide (PBO) can be used in combination with the insecticide to block the resistance mechanism and maintain insecticide efficacy (Georghiou 1983). The answers to the abovequestions can only be obtained by conducting investigations with insecticide resistant strains of a species of interest. For any newly introduced insecticide, true resistant strains likely are not available in the field. In such

PAGE 115

115 cases, performing laboratory experiments to select for resistance is the most widely accepted method (Tabashnik 1992) Indoxacarb, a reduced risk sodium channel blocker insecticide (Wing et al. 1998, 2000; U.S. EPA 2000), is an important tool that has been available for management of the German cockroach ( Blattella germanica L) for the past 4 5 years (Gondhalekar et al. 2011). In a recent monitoring study (Chapter 3), I found that indoxacarb resistance in certain German cockroach field populations from the United States (U.S.) may be on the rise (e.g., C ocoa B each 2009 population). In the same study, I was also able to identify a field strain, Campus Club ( CC45 ) which exhibits the highest level of indoxacarb resistance, reported to date. Preliminary resistance mechanism studies with the CC45 strain indicated that indoxacarb resistance may be associated with target site insensitivity (Chapter 4). However, it is well known that insecticide resistance mechanisms may vary from strain to strain. Hence, to investigate indoxacarb resistance mechanisms in another field strain of the German cockroac h (Arbor Park), I performed a replicated laboratory selection experiment using a bioassay method (feeding) that closely simulates field exposure conditions to indoxacarb baits. The selected strain was then used for: (1) determining the magnitude of resista nce by different bioassay methods, (2) estimating realized heritability of resistance and (3) investigating potential indoxacarb resistance mechanisms. The hypothesis that I tested here was that one of the existing known mechanisms of insecticide resistanc e in the German cockroach will be responsible for increased indoxacarb resistance after selection.

PAGE 116

116 Materials and Methods Cockroach S trains The field collected Arbor Park (AP) strain was used for selection experiments This strain exhibited significant indoxacarb cross resistance after collection from the field; however this cross resistance wa s unstable and declined after 6 to 8 months of continuous laboratory rearing ( Gondhalekar et al. 2011 Appendix B ). For conducting selection experiments approximately 1000 to 1200 small nymphs (1st and 2nd instar) were separated from the AP lab population, 2to 3 weeks before intiating selection bioassays The separated small nymphs were then divided into six equal subpopulations of 160 to 200 nymphs. Three of these sub populations were maintained as unselected control lines whereas the other three populations were subjected to indoxacarb selections when all the nymphs had molted into 4 or 5th instar stage (large nymphs). The large nymph stages were used for selection because they are known to be the most tolerant to insecticides of any cockroach life stages (Koehler et al. 1993). The AP strain subpopulations were reared according to the protocol described in Chapter 2 (Gondhalekar et al. 2011) at 25 1C and a 12:12 hour (h) light: dark photoperiod. All the bioassays performed in this study were carried out at the same temperature and photoperiod conditions used for rearing. In all bioassays with adult males, 1to 4 w eek old insects were used. Chemicals Techni cal gr ade indoxacarb (99.1% active ingredient ) was provided by DuPont Inc., (Wilmington, DE). All solvents were spectrophotometric or chromatography grade and were purchased from Fisher Scientific (Pittsburgh, PA) or Sigma (St. Louis, MO). Chlorodinitrobenzene ( CDNB), para nitrophenyl acetate (PNPA), paranitroanisole

PAGE 117

117 nicotinamide dinucleotide phosphate tetrasodium salt, NA), dithiothrietol (DTT), 1 phenyl 2 thiour ea (PTU), phenylmethylsulfonyl fluoride (PMSF), ethylene diamide tetra acetic acid (EDTA) and Fast Blue BB salt were purchased from Sigma (St. Louis, MO). Buffer reagents were purchased from local distributors. Selection E xperiments The o ral bioassay method described by Gondhalekar et al. ( 2011) was used for performing selections with certain modifications. In brief, prestarved large nymphs were held individually with indoxacarb treated pellets of Advion blank bait for 3 days (d) After 3 d the nymphs that had completely eaten the bait pellet were transferred to 17.8 x 17.8 x 6 cm disposable plastic Glad boxes (50 60 nymphs per box) with aerated lids and were held in these boxes for another 7 d. The sidewalls of the boxes were lightly greased with a mixture of petroleum jelly and mineral oil (2:3) to prevent cockroaches from escaping. The boxes contained cardboard harborage, a water source and rodent diet (#8604, Harlan Teklad, Madison, WI) At 3 d when the nymphs were transferred to plastic boxes, almost all nymphs exhibited symptoms of intoxication and were lying on their backs. However, over the next 7 d ~ 19 to 47% of nymphs completely recovered (were able to walk normally without showing any intoxication symptoms). These recovered nymphs, which varied between 19 and 47% for different generations and sub populations, were used as founders for the next generation. During the 7 d holding period, I assumed that the nymphs were also exposed to secondary deposits of indoxacarb and metabolites that were regurg itated or excreted by others in their cohort or themselves. This assumption is based on the finding that indoxacarbfed cockroaches are capable of regurgitating or excreting the parent compound and its

PAGE 118

118 metabolites (Buczkowski et al. 2008, Chapter 4). Moreover, it has been shown that the excreted or regurgitated residual deposits of indoxacarb and its metabolites are capable of causing secondary mortality in the conspecifics that come in contact with or feed on these deposits (Buczkowski et al. 2008). The selections were continued for six generations (Parental to F5). The details of doses and number of insects used for each round of selection are given in Table 51. Oral B ioassays To evaluate generation al effects of laboratory selection adult males from sel ected and unselected lines were tested using oral diagnostic bioassays at three indoxacarb doses (1.0, 1.5 and 2 .5 g per insect) identified by Gondhalekar et al. ( 2011). Three replicates (10 insects per replicate) were performed per dose per selected or unselected line (n = 90). Control treatments received acetone treated Advion blank bait pellets. Knockdown mortality data were recorded every 24 h up to 72 h. The 72 h data were arcsine transformed and analyzed by analysis of variance (ANOVA) and the means separated using paired t tests (P < 0.05). To determine the effect of six generations of selection on oral toxicity of indoxacarb, oral doseresponse bioassays were conducted with the unselected and F6selected lines. The protocol outlined by Gondhalekar et al. ( 2011) was followed without m odification At least four concentrations producing mortality between 10 to 90% were tested against each subpopulation. Each treatment consisted of ten insects and the bioassays were repeated three times for each sub po pulations. Probit analyses with the 72 h mortality data were performed using the PROC PROBIT function in SAS software package (SAS Institute, Cary, NC).

PAGE 119

119 Vial B ioassays To further investigate responses to selection, adult males of selected and unselected l ines from each generation were tested at two vial diagnostic concentrations (30 and 60 g indoxacarb per vial) as explained by Gondhalekar et al. ( 2011). Three replicates of ten insects were conducted per dose per strain (n = 90). Control treatments consisted of insects held in acetone treated vials. The 72 h mortality data were arcsine transformed and analyzed by ANOVA. Means were separated by paired t tests (P < 0.05). Additionally, concentrationresponse vial bioassays were performed to further character ize the effects of six rounds of selection on surfacecontact toxicity of indoxacarb. The procedure described by Gondhalekar et al. (2011) was followed with certain modifications. In brief, mortality data were collected up to 120 h instead of 72 h because only the 120 h data provided an acceptable fit to the expected probit model. Four to five concentrations providing mortality between 10 to 90% were included. Due to limited availability of F6 selected adult males, only one replicate (ten insects per replic ate) of eight concentrations (including control) was performed with each F6selected and unselected line; however, selected lines in this case were treated as individual replicates. Probit analyses of the pooled 120 h mortality data were completed with the SAS software package (SAS Institute, Cary, NC) with PROC PROBIT function. Estimation of R ealize d H eritability (h2) To determine the proportion of phenotypic variance in resistance caused by additive genetic variation, h2 (narrow sense heritability) estim ation was performed following the method given by Falconer (1989) and Tabashnik (1992). The calculation details are explained in footnotes of Table 52. In brief, two data types were used for

PAGE 120

120 calculating the h2 estimates : (1) probit estimates from the oral doseresponse bioassays with the F6selected and unselected populations (slope of the regression line and log10 of the LD50 values) and (2) the data for percentage of individuals surviving the selection dose. Three independent estimations of h2 were performed for the three selected lines. Enzyme P reparation s Protected sodium phosphate buffer (0.1 M, pH 7.5) containing 1 mM EDTA, 1mM DTT, 1mM PTU and 1mM PMSF, or unprotected sodium phosphate buffer (0.1 M, pH 7.5) without any of the above mentioned protease inhibitors was used as a homogenization buffer. Insect homogenates prepared in protected buffer were used for measuring cytochrome P450 activity in the microsomal fraction; whereas, homogenates prepared in unprotected buffer were used for measuring esterase and glutathione transferase (GST) activity in the soluble fraction. The procedure described by Scharf et al. (1998b) was followed for making enzyme / protein preparations. Decapitated adult males (1to 2 wk old) in groups of 10 were homogenized in 4 mL ice cold protected or unprotected sodium phosphate buffer using a motor operated Teflon pestle and glass mortar. The homogenate was centrifuged at 15,000 x g force for 10 min at 4C. The pellet obtained from this centrifugation was discarded and the super natant was filtered by passing through glass wool. The filtered supernatant was centrifuged at 110,000 x g force for 1 h at 4C to obtain the microsomal fraction (pellet) and soluble fraction (supernatant). The microsomal pellet was resuspended in icecold unprotected sodium phosphate buffer containing 20% glycerol. The microsomal and soluble protein fractions were divided into 200 or 500 L aliquots and stored at 80C until use. Protein content of the microsomal and soluble fractions was estimated by a co mmercial Bradford assay (Bio Rad, Hercules, CA) using bovine serum albumin as a

PAGE 121

121 standard and respective buffers as blank. Two independent protein preparations were made for each F6selected or unselected line. Enzyme activity assays (GST, P450 and esterase) were performed in triplicate for each protein preparation. Glutathione Transferase (GST) Assay Soluble protein fractions prepared using unprotected sodium phosphate buffer were used as the enzyme source for measuring GST activity toward model substrate C DNB (Scharf et al. 1998b). Assays were performed in a 96well microplate format and each reaction of 230 L inc luded 5 L soluble fraction (25 to 50 g protein) and 225 L sodium phosphate buffer (0.1 M, pH 7.5) containing 1mM CDNB and 5 mM reduced GSH (freshly prepared). Control reactions were performed in absence of GSH. The change in absorbance per minute at 344 nm was measured using a microplate reader in kinetic mode. Th e microplate reader had a built in algorithm for 1 cm path length correction and he nce a molar extinction coefficient of 9.6 mM1 cm1 for the product S (2,4 dint r o phenyl)glutathione was used for calculation of specific activity expressed as nanomoles of S (2,4 dint r o phenyl)glutathione/min/mg soluble protein. The specific activity between the F6 selected and unselected lines was compared using a nonparametric MannWhitney U test (P < 0.05). Cytochrome Monooxygenase (P450) Assay O demethylation of the model substrate PNA by P450s was determined using microsomal protein fractions prepared in protected sodium phosphate buffer. The protocol given by Bautista et al. (2008) was used with certain modifications. In a microplate format, each reaction consisted of 10 L microsomal protein fraction (25 to 50 g protein), 10 L reduced NADPH (3.0 mM; freshly prepared in sodium phosphate buffer, 0.1M, pH 7.5), and 200 L sodium phosphate buffer (0.1 M, pH 7.5) containing

PAGE 122

122 1.5 mM PNA. Control reactions received 10 L sodium phosphate buffer in place of reduced NADPH. Initially, protein and substrate were added to wells and the plate incubated at 30C for 10 min. After incubation, the reactions were initiated by adding 3.0 mM reduced NADPH (buffer was added to control wells), and the plates were again incubated at 30C for 5 min on a shaker (7090 rpm). Fo rmation of the product p nitrophenol (PNP) was monitored at 405 nm every 20 s for 10 min on a microplate reader. Because the microplate reader corrected for path length a standard extinction coefficient of 6.53 mM1 cm1 for the product PNP was used for sp eci fic activity calculations (nano moles of PNP/min/mg microsomal protein). Statistical comparisons of specific activities of the F6 selected and unselected lines were performed using a nonparametric MannWhitney U test (P < 0.05). Esterase Assay E sterase mediated hydrolysis of the model substrate PNPA was measured using the soluble protein fraction (Scharf et al. 1998b) prepared in unprotected homogenization buffer. Each reaction (microplate format) con tained 5 L soluble protein (25 to 50 g protein) and 225 L sodium phosphate buffer (0.1 mM, pH 7.5) containing 1 mM PNPA (freshly prepared). In control fractions 5 L buffer was added in place of soluble protein fraction. The reactions were monitored for the hydrolysis product, PNP, at 405 nm for 5 min at 20 s intervals using the microplate reader in kinetic mode. Again, as the microplate reader corrected for path length, a standard extinction coefficient of 6.53 mM1 cm1 for the product PNP was used for s pecific activity calculations (nano moles of PNP/min/ mg soluble protein). Specific activity values for the F6selected and unselected subpopulations were compared by using the nonparametric MannWhitney U test (P <0.05).

PAGE 123

123 Esterase Native Polyacrylamide Gel Electrophoresis (PAGE) To investigate if specific esterase isoforms were over expressed or induced in the F6 selected lines (in comparison to the unselected lines), esterase native PAGE was performed with the soluble protein fraction prepared in unprotected buffer (n = 3). The method developed by Scharf et al. (1998b) and Wheeler et al. (2010) was used with some modifications. Briefly, 50 g soluble protein was diluted with 2x volumes Native PAGE sample buffer (BioRad, Hercules, CA) and loaded onto nativ e PAGE gels (4.5% stacking and 7.5% resolving gels). Electrophoresis was conducted in native PAGE running buffer (Tris Glycine, pH 8.3) at 4C and lasted for 1.5 h at 120 V. Following electrophoresis the gels were incubated for 20 min at room temperature in 100 mL sodium phosphate buffer (0.1 M, pH 7.5) cont NA (final concentrations). After 20 min incubations the gels were stained by adding 20 mg Fast Blue BB salt dissolved in 1 mL of nanopure water (final concentration 0.02%). After approximately 5 min the gels were transferred to 10% acetic acid solution for destaining and preservation. Quantitative Real Time Polymerase Chain Reaction (q RT PCR) E xpression levels of eight putative detoxification genes identified from a German cockroach gut and fat body EST library (Appendix C ) w ere determined in the F6selected and unselected subpopulations. The list of qRT PCR primers for target genes and reference / control genes designed using Primer 3 is given in Table D 1 (Appendix D). Of the two different reference genes that were tested, eta actin (accession no. AY004248) showed most stable expression across different treatments (Table 55) and hence was used for normalization of C T (critical threshold) values of target genes.

PAGE 124

124 Total RNA extractions (SV total RNA isolation kit; Promega, Ma dison, WI) were conducted with 1 to 2 w eek old decapitated adult males (in groups of 10) of each F6selected and unselected lines following the manufacturers protocol. Synthesis of cDNA (iScriptTM cDNA synthesis kit; Bio Rad, Hercules, CA) was performed from 100 ng total RNA. Quantitative real time PCR (qRT PCR) was performed using an iCycler iQ real time PCR detection system (BioRad Hercules, CA ) with SybrGreen product tagging (2x SensiMix Sybr and Flourescein Kit; Quantace, Norwood, MA). Each 20 L q RT PCR reaction in a 96well format consisted of 10 L SybrGreen, 7 L nanopure water, 1L each of forward and reverse primer (0.5 M final concentration) and 1 L cDNA. The q RT PCR temperature program described by Scharf et al. (2008) was followed without modifications Three technical qRT PCR replicates were performed for each gene and cDNA preparation ( i.e., cDNAs from three selected and unselected lines). The qPCR data were analyzed by the 2method (Livak and Schmittgen 2001). First, the C T values of the target genes w ere normalized to the average CT value for the reference gene, eta actin ( actin ) to obtain values. The values for each target gene of the selected strain were then normalized to the average value (of the respective target gene) of the unselected strain. The values were then converted to 2to obtain relative expression. Pair wise comparisons of the values of selected versus unselected strai ns for each gene were performed using nonparametric MannWhitney U tests (P < 0.05).

PAGE 125

125 Results Pattern of Resistance Development over Six Generations Results of selection experiments from 3 lines of the AP strain are summarized in Table 5 1. Over six generations of selection the dose of indox acarb required for obtaining 60 to 70% mortality in large nymphs increased by 3.5fold. The average survival of nymphs over six generations did not significantly differ among the 3 lines (ANOVA results: df = 2, 17, F = 0.76, P = 0.48) and ranged from 31.62 to 36.81%. Indoxacarb selections had no effect on fecundity or overall health of the cockroaches (data not shown). Average body weight of adult males was similar (~ 52 mg per insect) between the selected and unselected lines. Oral and vial diagnostic bioassay results show that the mortality responses of the unselected and selected lines did not differ (P > 0.05) until the F3 generation (Figures 51 and 52). However, beginning with the F4 generation significant differenc es in mortality levels of the unselected and selected lines were detected in both vial and oral bioassays (P < 0.05). Surprisingly, despite selection via feeding, the magnitudes of differences in mortality levels of the selected and unselected strains were higher in vial (surface contact) bioassays than in oral (feeding) bioassays. Overall the results indicate that resistance was slow to develop initially through three generations but showed a sudden and significant increase starting at the F4 generation. M agnitude of Indoxacarb Resis tance Following Six Generations of Laboratory Selection In comparison to the unselected lines the three F6selected lines displayed uniform and significantly higher (4.2to 6.7fold) resistance to orally fed indoxacarb at the LD50 level (Table 5 2). These increases in LD50 values following selection fell into the

PAGE 126

126 tolerance category i.e. resistance ratios < 10fold. As also shown by selection results (Table 51), the LD50 values of the three F6selected lines did not vary si gnificantly from each other (based on nonoverlap of 95% confidence intervals). In vial concentrationresponse bioassays, however, the F6selected lines exhibited higher indoxacarb resistance levels (in the resistance category i.e. resistance ratios > 10fold) than seen in oral bioassays. The vial LC50 resistance ratio in the selected lines was 23.3fold as compared to the unselected lines (pooled data for 3 lines; see Table 53). The trend of higher indoxacarb resistance in vial bioassays was also seen in diagnostic bioassays that were conducted after each generation of selection (Figures 51 and 52). Lower indoxacarb tolerance in feeding assays is likely a result of indoxacarb being more potent when ingested, which overwhelms resistance mechanisms. R ealized Heritability (h2) Estimates R ealized heritability estimates were determined f ollowing six generations of selection The calculated heritability estimates were essentially identical between the three selected lines and ranged from 0.30 to 0.33 (Tabl e 52). The mean ( SE) of the heritability estimates was 0.32 ( 0.009), which indicates that the difference in estimates between the three lines was 0.3 percent. The data imply that the indoxacarb resistance phenotype is heritable and resistance could li kely increase to higher levels following laboratory selection. The projected rate of resistance development (1/R), i.e., the number of generations required for a 10fold increase in LD50 value, varied from approximately seven generations for line 2 to ten generations for line 3 (Table 52). Detoxification Enzyme Activities GST activity towards the model substrate CDNB was not different between the selected and unselected lines (Figure 53; MannWhitney U test: Z = 0.44, P = 0.66).

PAGE 127

127 The rate of P450 based O demethylation of PNA was reduced significantly by ~ 50% in the F6selected population (Figure 54; MannWhitney U test: Z = 3.53, P = 0.0004). In contrast, general esterase activity measured using PNPA was significantly elevated in the selected strains by 2.2 fold (Figure 55A; MannWhitney U test: Z = 3.53, P = 0.0004). These results imply a role for esterase and cytochrome P450 enzymes in indoxacarb tolerance in the three selected lines. Esterase Native PAGE Staining of general esterases with a mixture o and NA revealed differences in the profile and staining intensities of esterase isozymes between soluble protein fractions of the selected and unselected lines (Figure 55B). One esterase isozyme (esterase band E1) showed elevated activity in the selected lines and this activity was absent in the unselected lines. Two other isozymes (esterase bands E4 and E5) were also elevated in the selected lines. These esterase banding patterns correspond with the PNPA hydrolysis activity results showing ~ 2fold activity increases in selected lines, and provide additional support for the hypothesis that esterasemediated indoxacarb resistance is occurring in the selected lines. Expression of Detoxification Genes Relative quantification of mRNA levels of genes inv olved in xenobiotic biotransformation (Appendix C ) using qRT PCR revealed upregulation of one esterase and two P450 isoforms in the selected lines (Table 5 4 ). The carboxylesterase, CYP6AM2 and CYP6J2 genes were over expressed by ~ 2, 6 and 19fold, res pectively, in the selected lines (MannWhitney U test; P < 0.05). Relative expression of other putative detoxification genes ( CYP357C1 epoxide hydrolase, aldehyde dehydrogenase, aldehyde reductase and glucuronosyltransferase) was not significantly

PAGE 128

128 differe nt between the selected and unselected lines (MannWhitney U tests: P > 0.05). Overexpression of a carboxylesterase gene in the selected lines supports PNPA hydrolysis activity and esterase native PAGE findings presented above and further suggest an involv ement of esterases in indoxacarb resistance. Over expression of two P450 genes was in contrast to the reduced PNA O demethylation observed in the selected lines and may be a reflection of the diversity of P450 isoforms that are present in the German cockroach Discussion Impact of Laboratory Selections on Indoxacarb Resistance This was the first study that attempted to select for indoxacarb resistance in the German cockroach. Following laboratory selections, tolerance to orally fed indoxacarb increased significantly in the three subpopulations of the AP strain as compared to unselected lines. Indoxacarb selection studies in other insect species have been limited to lepidopteran ( Plutella xylostella L., Heliothis virescens F. and Spodoptera spp.) and diptera n insects ( Musca domestica L.). In these insects, indoxacarb resistance increased by 31to >100 fold following three to six generations of laboratory selection (Shono et al. 2004, Sayyed and Wright 2006, Sayyed et al. 2008a, 2008b; Nehare et al. 2010). Th us increases in indoxacarb tolerance in the AP strain (4.2to 6.7fold) after six generations of selection were not as high as reported previously in other insects Of the numerous factors that may be responsible for the observed species level differences, the exposure history of lepidopteran and dipteran species to intense insecticide selection pressure in the field appears to be the most important factor. In this regard, in the studies mentioned above the P. xylostella and S. litura strains used for

PAGE 129

129 lab oratory selections were heavily selected in the field with indoxacarb and other insecticides prior to collection (Sayyed and Wright 2006, Sayyed et al. 2008a). To my knowledge the AP strain was never exposed to indoxacarb in the field; it was collected aft er control failures to chlorfenapyr baseboard s prays were reported ( Gondhalekar et al. 2011). Interestingly, cross resistance / tolerance to orally fed indoxacarb in the AP strain was present initially after collection from the field (~ 4.4 fold as compare d to the Johnson Wax S usceptible strain; Appendix B ) but declined after 2 to 3 generations of continuous laboratory rearing and thereafter its indoxacarb susceptibility levels became indistinguishable from the Johnson Wax Susceptible (JWax S) strain (Appendix B). Selection studies with the three subpopulations of the AP strain were initiated after indoxacarb cross resistance / tolerance levels had declined and susceptibility had stabilized. Comparison of indoxacarb LD50 values for the F6selected AP populations (0.63 0.79 g per insect) with the LD50 value of the initially collected AP strain (0.53 g per insect; indicated as AP T1 in Table B 1) clearly shows that laboratory selection has reselected the AP strain to its original indoxacarb tolerance level The major difference, however, is that tolerance in the selected populations is an outcome of direct selection by indoxacarb whereas the initial indoxacarb cross resistance / tolerance in the AP strain was caused (apparently) by nonspecific selection wi th different insec ticides ( Gondhalekar et al. 2011, Appendix B ). As indicated by calculated realized heritability ( h2) values, the proportion of phenotypic variation caused by additive genetic effects in the three indoxacarbselected lines was 0.30 to 0.33 which is moderate to fairly high Realized heritability (h2) values are usually higher when frequencies of resistant alleles are at an intermediate level, and

PAGE 130

130 they tend to approach zero at allele frequencies of 0 or 100% (Falconer 1989, Tabashnik 1992). The h2 values obtained in this study indicate that alleles for indoxacarb resistance were selected in the AP strain and their frequencies are expected to increase if laboratory selections were continued. Moreover, the lack of increase in indoxacarb resista nce seen after the first three generations of selection, and then the sudden increase in resistance in subsequent selections (Table 51, Figures 51 and 52), suggests that lower frequencies of resistant alleles were present initially and increased thereaf ter. I hypothesize that the observed rapid increases in F4 tolerance levels are due to (1) higher selection pressure or (2) elimination of susceptible alleles. Alternatively, the doses and concentrations used to determine generational responses to selection were too high to detect small changes in indoxacarb tolerance that occurred after the first three rounds of selection. Theoretical estimates of the projected rate of resistance development ( i.e., the number of generations required for a 10fold increase in LD50) varied from seven generations for line 2 to ten generations for line 3 (Table 5 2). However, these estimates could not be compared to the empirical estimates because the lowest theoretical estimate was 7 generations (for line 2) and the three lines in the present study we re only selected for six generations. Nevertheless, the theoretical estimates were clearly not overestimated because none of the LD50 values in any of the three lines increased by more than 7fold in six generations. Thus, consider ing the three month generation time of German cockroaches and assuming that continuous indoxacarb selection pressure (allowing ~ 30% survival per generation) is applied, resistance ratios would be expected to increase by 10fold in approximately 2 3 year s time.

PAGE 131

131 This study also revealed pronounced bioassay dependent differences in indoxacarb toxicity estimation in the selected lines. The choice of bioassay method is known to have an impact on various insecticide toxicity parameters, including LD estimates a nd resistance ratios (Scott et al. 1996, Scharf et al. 1995). Certain bioassay methods tend to exaggerate the toxicity differences that exist between strains whereas others minimize the differences in toxicity (ffrenchConstant and Roush 1990, Scharf et al 1995). Although the three selected lines in the current study showed just 4.2to 6.7 fold tolerance to orally fed indoxacarb, the resistance ratios obtained in vial bioassays were much higher (~ 23 fold i.e., in the true resistance category ). These r esults were unexpected because the oral bioassay method was used for selection and thus, higher resistance levels to orally fed indoxacarb were anticipated. In the surfacecontact vial bioassay method, insects are predominantly exposed to the toxicant via contact; whereas, limited ingestion of the insecticide occurs via grooming of the body parts (Scharf et al. 1995). Thus reduced ingestion of indoxacarb in the vial bioassay method coupled with inherently higher efficacy of indoxacarb via feeding (Wing et al. 1998) may have been responsible for the observed differences in resistance ratios. Alternatively, because bait fed cockroaches are capable of regurgitating or excreting parent compounds and their metabolites (Buczkowski et al. 2001, 2008), exposure of cockroaches during selection to regurgitated or excreted secondary residual deposits indoxacarb and its active and nonactive metabolites may have selected for penetration resistance mechanisms. It is possible that ingestion of indoxacarb rapidly overwhelms resistance mechanisms, and thus limits expression of the resistance phenotype and reduces resistance ratios (as seen with oral bioassays).

PAGE 132

132 Insights into Biochemical Mechanisms of Indoxacarb Resistance Altered expression or activity of P450s, esterases and GSTs has often been associated with insecticide resistance in the German cockroach and other insects (Siegfried et al. 1990, Bull and Patterson 1993, Lee et al. 1994, Karunaratne and Hemingway 1996, Scharf et al. 1998b, Wu et al. 1998, Valles and Yu 1996, Valles 1998, Pridgeon et al. 2003). To test the hypothesis that these enzyme families might have evolutionarily responded to indoxacarb selection in the AP strain, we performed: (1) GST, P450 and esterase enzyme assays using model substrates, (2) esterase native PAGE to visualize esterase isoforms and (3) qRT PCR experiments to determine relative expression of certain detoxification enzymecoding genes. Glutathione transferase CDNB conjugation activity was similar between the F6selected and unselected lin es (Figure 53). These results were ant icipated because reports on GST associated insecticide resistance in the German cockroach have been rare or nonexistent (Wu et al. 1998, Scharf et al. 1998b, Valles 1998). Moreover, in vivo biotransformation experiments with indoxacarb in the unselected / parental AP strain did not provide any evidence for formation of glutathione conjugated metabolites (Chapter 4). In contrast, PNPA hydrolysis (esterase) activity was 2.2fold higher in the selected lines as compared to the unselected lines. Esterase native PAGE confirmed that the increased PNPA hydrolysis activity was caused by more highly elevated esterase isoforms E4 and / or E5 and lower level elevation of esterase isoform E1 in the F6selected lines. In addition, mRNA levels of a carboxylesterase gene identified from a German cockroach cDNA library (Appendix C) were 2fold higher in the selected lines. Thus, collectively, the enzyme assay, Native PAGE and qRT PCR studies provide

PAGE 133

133 compelling independent evidence that esterase based indoxacarb tolerance is present in the laboratory selected AP strain. The lack of evidence for esterase mediated indoxacarb biotransformation in the AP parental and GNV R strains (Chapter 4) further supports the notion that six rounds of s election has selected for elevated carboxylesterase activity in the AP strain. In accordance with our findings a laboratory selected strain of P. xylostella was reported to exhibit esterase associated resistance to indoxacarb (Sayyed and Wright 2006). To u nderstand the actual mechanisms of esterasemediated indoxacarb tolerance in the F6 selected AP strain, additional synergism studies and in vivo and in vitro biotransformation studies will be necessary. Surprisingly, PNA O demethylation (P450) activity was reduced by 2.0fold following indoxacarb selection. This is in contrast to the fact that higher activities of P450 enzymes are usually detected in insecticide resistant insect strains (Scharf et al. 1998a, 1998b; Wu et al. 1998, Valles and Yu 1996, Pridgeon et al. 2003). However, lower P450 activities have also been reported in cypermethrin selected German cockroaches (Scharf et al. 1998b) and methyl parathion resistant H. virescens (Konno et al. 1989). In cypermethrinselected German cockroaches, although reduced P450 ( N demethylation) activity was observed, total P450 content as measured by carbon monoxide difference spectra was actually elevated (Scharf et al. 1998b). In the case of methyl parathion resistant H. virescens larvae, lower P450 desulfurase activity was documented that led to a selective advantage via reduced formation of methyl paraoxon, which is the bioactive metabolite of methyl parathion (Konno et al. 1989). Evidence for P450based bioactivation of indoxacarb to DCJW was obtained in synerg ism tests and in vivo inhibition studies in four cockroach strains, including the

PAGE 134

134 parental AP strain (Chapter 4). Thus, given the likely involvement of P450s in indoxacarb bioactivation, reduced O demethylation activity in the selected lines could be contr ibuting toward lower DCJW formation and thereby increased tolerance to indoxacarb. Additional in vitro and in vivo biotransformation studies with the selected and unselected AP strains will be required to test this hypothesis. Quantification of mRNA levels of three P450 genes identified from a cockroach cDNA library ( CYP6AM2 CYP6J2 and CYP357C1 ; Appendix C) revealed that CYP6AM2 and CYP6J2 were up regulated in the selected lines by 6and 19fold, respectively. The exact roles of these P450s in the German cockroach are unknown; however, unless post translational modifications are occurring, it is unlikely that the upregulated P450s are responsible for reduced O demethylation activity. Alternatively, the two P450s upregulated in the selected lines may be i nvolved in formation of relatively polar and putatively nontoxic ring hydroxy or oxadiazine ring opened metabolites of indoxacarb and DCJW (Chapter 4). In support of this hypothesis, synergism bioassays with S. litura and M. domestica have shown evidence for P450mediated indoxacarb resistance (Shono et al. 2004, Sayyed et al. 2008a). Finally, it also possible that O demethylation of the model substrate PNA offers no predictive ability regarding indoxacarb biotransformation. Again, to verify these hypothes es, function al genomics studies with the upregulated P450 genes, as well as in vitro and in vivo biotransformation experiments with the selected lines are essential. Despite these uncertainties, the findings of this study on resistance mechanisms that res pond to indoxacarb selection are highly consistent with earlier studies in the German cockroach

PAGE 135

135 showing coselection of esterases and P450s by residual insecticide classes (Scharf et al. 1998b). In conclusion, experiments presented here showed that tolerance to orally fed indoxacarb can readily increase in the German cockroach following laboratory selection. Realized heritability estimates for three independently selected lines confirm that the phenotype for indoxacarb resistance is heritable. These finding s are in strong agreement with findings from susceptibility monitoring studies (Chapter 3) showing rapid selection for indoxacarb tolerance in the CB (Cocoa Beach) population that was fieldselected with Advion bait and other insecticides. The relatively high magnitude of resistance exhibited by the selected strain to residual deposits of indoxacarb (~ 23fold) is a matter of concern because, since 2010, indoxacarb has been available as a residual spray formulation for cockroach control. If a similar trend exists in field populations, low level tolerance to indoxacarb baits may significantly reduce the efficacy of the spray formulation. Finally, studies performed to investigate factors responsible for indoxacarb tolerance in the selected AP strain at the biochemical and molecular levels provided evidence for both esterase and cytochrome P450based resistance mechanisms. However, additional metabolism and molecular studies will be required to better understand the factors responsible for tolerance in the sel ected AP strain. Overall, this chapter provides evidence that (1) indoxacarb tolerance/ resistance is readily selectable in German cockroach field strains and (2) the observed tolerance apparently results common metabolic mechanisms associated with resistance to multiple other residual insecticide classes.

PAGE 136

136 Table 51. Summary of indoxacarb selection experiments with the Arbor Park strain. Selections were performed on large nymphs (4 or 5th instar) using a feeding bioassay format. Line/ Replicate Generatio n Dose (g/insect) n Number surviving at 7 10 d ays % Survival Average % survival over 6 generations ( SE) 1. 1 Parental 1.0 134 35 26.12 31.62. (2.15) F1 1.0 201 76 37.81 F2 1.25 286 90 31.46 F3 1.25 273 103 37.72 F4 2.5 409 106 25.92 F5 3.5 394 121 30.71 2 Parental 1.0 144 37 25.70 34.93. (2.57) F1 1.0 174 76 43.60 F2 1.25 380 119 31.31 F3 1.25 322 108 33.54 F4 2.5 318 114 35.85 F5 3.5 313 124 39.61 3 Parental 1.0 149 29 19.46 36.81. (3.99) F1 1.0 156 66 42.31 F2 1 .25 295 96 32.54 F3 1.25 322 127 39.44 F4 2.5 324 154 47.50 F5 3.5 313 124 39.61 1. Average percent survival over 6 generations did not vary significantly between the three selected lines (Tukeys test, P < 0.05). n = number of large nymphs used in bioassays.

PAGE 137

137 Table 52. Magnitude and realized heritability (h2) of indoxacarb resistance in the Arbor Park strain following six generations of laboratory selection. See Table 51 for selection details. Line / Replicate Strain n Chi square ( d f) 1. Slope ( SE) LD 50 ( 95 % CI) 2 RR 50 3 R 4 1/R 5 i 6 7 S 8 h 2 9 1 Unselected 210 0.92 (4) 3.25 (0.50) 0.14 (0.11 0.18) -. --. -. -. -F6 Selected 210 2.27 (4) 2.73 (0.33) 0.63 (0.5 0.77) 4.50* 0.11 9.10 1.12 0.33 0.37 0.30 2 Unselected 210 5.09 (4) 2.13 (0.32) 0.12 (0.09 0.16) -. --. -. -. -F6 Selected 210 0.81 (4) 2.86 (0.35) 0.80 (0.65 0.99) 6.67* 0.14 7.14 1.06 0.40 0.42 0.33 3 Unselected 210 4.83 (4) 3.80 (0.56) 0.19 (0.16 0.23) -. ---. -. -F6 Selected 210 0.93 (4) 3.05 (0.38) 0.79 (0.65 0.96) 4.16* 0.10 10.0 1.02 0.30 0.31 0.32 1. Chi square and corresponding degrees of freedom. 2. Oral lethal dose ( LD50) values at 72 h with 95% confidence intervals. Values are express Average weights of the unselected and selected lines were the same (52 mg per adult male). 3. Resistance ratios at LD50. Ratios were determined by dividing LD50s of F6 selected lines with LD50s of unselected lines. Ast erisks (*) indicates significant resistance ratios based on nonoverlap of LD50 confidence intervals. 4. Response to selection, R = [(log10 of final LD50 log10 of initial LD50) number of generations selected]. 5. Number of generations necessary for 10fold increase in LD50 value or resistance level. 6. Intensity of selection, i = table value from Appendix B (Falconer 1989) 7. 8. 9. Realized heritability, h2 = R/S (Falconer 1989, Tabashnik 1992) n = total number of adult males used in bioassays.

PAGE 138

138 Table 53. Surfacecontact (vial) toxicity of indoxacarb to pooled unselected and selected lines of the Arbor Park strain at 120 h. Ta ble 54. Relative expression of putative detoxific ation genes in the selected lines determined by qRT PCR experiments. Gene Relative expression (2 ) 1. Mann Whitney test 2. Unselected F6 selected Z score P value Esterase* 1.00 2.30 2.80 0.0051 CYP6AM2* 1.00 6.05 2.82 0.0049 CYP6J2* 1.00 19.23 2.80 0.0051 CYP357C1 1.00 1.14 0.46 0.65 Epoxide hydrolase 1.00 1.09 0.00 1.00 Aldehyde dehydro genase 1.00 0.85 0.74 0.47 Aldehyde reductase 1.00 0.85 0.00 1.00 Glucuronosyltransferase 1.00 1.35 1.2 0.23 1. Relative expression determined by 2 meth od (Livak and Schmittgen 2001). 2. Results of pair wise nonparametric MannWhitney tests pe rformed using values for the uns elected and F6selected lines. Asterisks (*) indicate genes which showed significantly higher expression in the F6selected lines. Strain 1. n Ch i square (df ) 2 Slope ( SE) LC 50 (and 95 % CI) 3 RR 50 4 Unselected 240 0.90 (5) 1.43 (0.24) 7.44 (3.95 11.24) -F6 Selected 240 8.20 (5) 2.54 (0.49) 173.61 (118.55 220.95) 23.33* 1. Due to limited availability of F6 Selected line adult males only one replicate of eight doses (including control) was performed with each unselected and F6selected line. Thus, the probit estimates represent the pooled responses of three lines. Pooling of the vial toxicity data was further justified by t he absence of significant differences in oral indoxacarb toxicity between the 3 selected lines (see Table 51). 2. Chisquare and corresponding degrees of freedom. 3. V ial lethal concentration ( LC50) values with 95% confidence intervals. Values are expre 4. Resistance ratio at LC50, determined by dividing the LC50 of the F6selected line with LC50 of the unselected line. The asterisk (*) indicates a significant resistance ratio based on nonoverlap of LC50 confidence intervals. n = total number of adult males used in bioassays.

PAGE 139

139 Table 55 Standard devi ation of critical threshold (CT) values for the t wo reference genes and eight target genes. Gene Standard deviation 1. actin 2. 0.31 Ribosomal protein L13a 2. 0.38 Esterase 1.33 CYP6AM2 1.83 CYP6J2 2.59 CYP357C1 0.50 Epoxide hydrolase 1.42 Aldehyde dehydrogenase 1.03 Aldehyde reductase 0.65 G lucuronosyltransferase 1.08 1. .Standard deviation of CT values for genes across all the technical and biological replicates of the F6selected and unselected lines. 2 Reference genes used in the qRT PCR experiments.

PAGE 140

140 Figure 51. Generationwis e susceptibility testing of adult males of selected and unselected lines at three doses (1.0, 1.5 and 2.5 g indoxacarb per insect) in oral diagnostic bioassays. Bars represent mean percent mortality values of three populations or lines (n = 90) at 72 h. D ata for all but the last generation is shown. Bars within generations with same letters are not significantly different (paired students t test, P < 0.05).

PAGE 141

141 Figure 52. Generationwise susceptibility testing of adult males of selected and unselected li nes at two diagnostic concentrations (30 and 60 g indoxacarb per vial) in vial bioassays. Bars represent mean percent mortality values of three populations or lines (n = 90) at 72 h. Insects from all but the last generation were tested. Bars within generation with same letters are not significantly different (paired students t test, P < 0.05). Figure 53. Average chlorodinitrobenzene (CDNB) conjugation activity of glutathione transferases (GSTs) from soluble protein fractions of the selected and uns elected lines. Bars with () standard errors represent average activity of three populations. MannWhitney U test indicated that the activities of F6selected and unselected lines were similar (P > 0.05).

PAGE 142

142 Figure 54. Comparative p nitroanisole (PNA) O demethylation activity of cytochrome P450 monooxygenases (P450s) from microsomal protein fractions of the selected and unselected lines. Bars with () standard errors represent average activity of three populations. MannWhitney U test indicated that the a ctivities of F6 selected and unselected lines were significantly different (P < 0.05).

PAGE 143

143 Figure 55. Comparison of general esterases from soluble protein fractions of the selected and unselected populations. (A) Average p nitrophenyl acetate (PNPA) hydr olysis activity of esterases in the F6selected and unselected populations. Bars with () standard errors represent average activity of three populations. MannWhitney U test indicated that the activities of selected and unselected lines were significantly different (P < 0.05). (B) Representative native PAGE of esterases from the F6selected and unselected populations. A mixtu naphthyl acetate was used as substrate and staining was performed by incubation with Fast blue BB salt. Of the six visible esterase isoforms (E1 to E6), E1, E4 and E5 appear to be over expressed or induced in the F6selected populations.

PAGE 144

144 C HAPTER 6 MECHANISMS UNDERLYING FIPRONIL RESISTANCE IN A MULTI INSECTICIDE RESISTANT FIELD STRAIN OF THE GERMAN COCKROACH German cockroaches ( Blattella germanica L.) are synapthropic pests that contribute significantly to childhood asthma, enteric pathogen transmission and diminished psychological well being (Ash and Greenberg 1980, Kopanic et al. 1994, Rosentreich et al. 1997, IOM 2000, Zurek and Schal 2004, Arbes et al. 2005). The most efficient way to overcome these issues associated with German cockroaches is their effective control (Schal and Hamilton 1990, Arbes et al. 2003, 2004; Miller and Meek 2004, Nalyanya et al. 2009). However, insecticide resistance is a major limiting factor in efficient control of German cockroaches and has been an area of active investigation for decades. The first studies on resistance to synthetic organic insecticides in German cockroaches were conducted in the early 1950s (Grayson 1951, 1953; Cochran et al. 1952, Heal et al. 1953, Fisk and Isert 1953). As i n many other insect species, the major mechanisms of insecticide resistance in the German cockroach include target site insensitivity caused by point mutations in ion channels (Kaku and Matsumura 1994, Dong 1997) and enhanced metabolism of insecticides by detoxification enzymes like cytochrome P450 monooxygenases (P450s) and general esterases (Siegfried et al. 1990, Prabhakaran and Kamble 1995, Valles et al. 1996, Scharf et al. 1998a 1998b; Wu et al. 1998, Pridgeon et al. 2002). In recent years, German cockroach control in the United States has been mainly based on use of bait formulations of insecticides like abamectin, fipronil, hydramethylnon, imidacloprid and indoxacarb (Buczkowski et al. 2001, 2008; Appel 2003, Holbrook et al. 2003, Harbison et al. 20 03, Wang et al. 2004). In general, lower levels of resistance to newer bait active ingredients (A.Is) have been reported in the

PAGE 145

145 German cockroach (Cochran 1990, Valles et al. 1997, Valles and Brenner 1999, Wang et al. 2004). An exception to this generalization was recently reported wherein a fieldcollected Gainesville R esistant (GNV R) strain was found to have ~ 37fold resistance to topically applied fipronil and significant tolerance (2.3fold) to orally fed Maxforce FC select cockroach gel bait (0.01 % fipronil) (Gondhalekar et al. 2011). Like cyclodiene insecticides, the phenylpyrazole insecticide fipronil acts antagonistically with the resistance to dieldrin (Rdl) subunit of the amino butyric acid (GABA) receptor (Cole et al. 1993, Gant et al. 1998). Cyclodiene resistance in several insect species is known to be caused by a single alanin e to serine substitution (A302S; commonly known as the Rdl mutation) at position 302 ( Drosophila melanogaster numbering) in the Rdl gene that encodes for the Rdl subunit of the GABA receptor (ffrench Constant et al. 2000, Daborn et al. 2004, Hansen et al. 2005, Li et al. 2006). Although the use of cyclodiene insecticides has been discontinued for many years, the frequency of the Rdl mutation in field and lab populations of different insect taxa is still high and confers limited cross resistance to fipronil (Cole et al. 1993, 1995; Scott and Wen 1997, ffrenchConstant et al. 2000, Holbrook et al. 2003, Kristensen et al. 2005, Gondhalekar et al. 201 1). Cockroach gel bait s containing fipronil have been commonly used in the United States for more than a decade. When the GNV R strain was collected in 2006, deposits of Avert gel bait (0.05 % abamectin) were detected in the apartment and the inhabitants confirmed the use of pyrethroid aerosols. Although clear evidence on use of fipronil for GNV R control is lacking, given their widespread use, it is reasonable to suspect that the GNV R strain must have been exposed to fipronil baits in the field.

PAGE 146

146 Consistent with this hypothesi s, the GNV R strain has 37fold resistance to fipronil (Gondhalekar et al. 2011), which is the highest level of fipronil resistance ever reported in the German cockroach. Reports on fipronil resistance ratios (7to 17fold) in cockroach strains never exposed to fipronil (Valles et al. 1997, Scott and Wen 1997, Holbrook et al. 2003, Kristensen et al. 2005) and resistance observed in the recently field collected GNV R strain (Gondhalekar et al. 2011) suggest that fipronil resistance in German cockroach field populations is on the rise. Holbrook et al. (2003) and Kristensen et al. (2005) predicted that widespread use of fipronil for cockroach control could possibly select for fipronil resistance mechanisms other than Rdl. This view is strengthened by the findings on the involvement of P450s in fipronil resistance in M. domestica (Wen and Scott 1999) and tropical bed bug, Cimex hemipterus (How and Lee 2011). To test the hypothesis that fipronil resistance in the GNV R strain is caused by multiple mechanisms my specific objectives were as follows: (1) perform synergist bioassays to investigate enzyme systems potentially involved in fipronil resistance, (2) conduct electrophysiological recordings using the suction recording electrode technique to ascertain the inv olvement of target site modification, and (3) sequence the region of the Rdl gene containing the A302S mutation to detect the presence and determine the frequency of the resistance associated mutation. Materials and M ethods Insects Two German cockroach str ains were used in this study: Johnson Wax S usceptible (JWax S) and GNV R. JWax S is a standard susceptible laboratory strain whereas, the GNV R strain is a multi insecticide resistant field strain collected from an apartment in Gainesville, FL after report ed control failures (Gondhalekar et al. 2011) Rearing was

PAGE 147

147 conducted in 3.8 liter plastic or glass containers held in a reachin environmental chamber at 25 1oC temperature and 12: 12 hour (h ) light : dark photoperiod. The inner top portion of the rearing units was lightly coated with a mixture of petroleum jelly and mineral oil (2:3) to keep the cockroaches from escaping. Each rearing unit contained corrugated cardboard harborages, a water source and rodent diet (No. 8604; Harlan Tek lad, Madison, WI). Che micals Piperonyl butoxide (PBO; 98.3 % pure), S,S,S tributylphoshorotrithioate (DEF; 98 % pure) and fipronil (97.1 % active ingredient ) were purchased from Chem Service (West Chester, PA). HEPES (4 (2 Hydroxyethyl) piperazine1 ethanesulfonic acid) sodium salt (99.5 % pure) was obtained from SigmaAldrich (Milwaukee, WI). All other chemicals and solvents were either purchased from Fisher Scientific (Pittsburgh, PA) or other local distributors. Topical B ioassays Topical bioassays were performed by application of 1 L volumes of fipronil or synergists in acetone to 1st abdominal sternites of adult males (1to 4 w eeks old) anesthetized with carbon dioxide (CO2) or ice. Topical applications were made using a 50 L 80501 syringe attached to a PB 600 1 dispenser (Hamilton, Reno, NV). Inse cticide synergists, PBO (100 g per insect) or DEF (30 g per insect) were applied 1 h before fipronil application. A minimum of three to four fipronil concentrations providing mortality between 10 to 90 % were included for each t reatment. Control insects were treated with acetone or synergists alone. Each bioassay consisted of 10 insects per dose and was replicated three to five times. Treated cockroaches were held in 100 x 15 mm plastic P etri dishes (Fisher Scientific, Pittsburgh, PA) with screened lids,

PAGE 148

148 corrugated cardboard, water and rodent food. The petri dishes were held in environmental chambers where temperature and photoperiod conditions were same to those used for rearing. Mortality was evaluated every 24 h up to 72 h. Ins ects lying on their backs and unable to right themselves upon disturbance were scored as dead. Injection B ioassays Topical treatment with insecticide synergists PBO, DEF etc. is known to alter the penetration rate of insecticides (Sun and Johnson 1972). Al tered penetration rate may lead to quasi synergism or antagonism of insecticide toxicity. I njection bioassays were conducted to check if PBO or DEF preapplication was causing such an effect on fipronil toxicity Fipronil injections were performed using a 50 L Hamilton syringe with a 28guage beveled edge needle attached to a PB 6001 dispenser (Hamilton, Reno, NV). For injections, the intersegmental membrane between the 2nd and 3rd abdominal sternite was pierced and 1 L fipronil in acetone was inject ed into anesthetized adult male cockroaches (Valles et al. 1997). A fipronil dose of 0.05 g per i nsect (for GNV R) and 0.0016 g per insect (for JWax S) was tested in injection bioassays. The fipronil doses used here displayed highest mortality differences in topical doseresponse bioassays with and without synergists. Synergists were applied topically to 1st abdominal sternites 1 h before fipronil injections. Controls received acetone or synergists alone. Positive controls included insects treated with sy nergists followed by topical fipronil treatment with doses mentioned above (0.05 or 0.0016 g per insect) Each treatment consisted of ten insects and was replicated three times. All other procedures and mortality evaluations were performed as explained above under topical bioassays.

PAGE 149

149 Neurophysiology E quipment Suction electrode holders (Cat. No. 641035) were used to hold recording and reference electrodes (Warner Instruments; Hamden, CT), which were fabricated from ~4 cm lengths of 0.5 mmdiameter gold wire (World Precision Instruments; Sarasota, FL). Recording and reference electrodes were fitted within 1.0mm borosilicate capillary tubing (World Precision Instruments) pulled to a fine point with a PUL1TM capillary puller (World Precision Instruments). Rec ording and reference electrodes were connected via a model 4001 capacitance compensation headstage (Dagan Inc.; Minneapolis, MN) and a Hum Bug 50/60 Hz Noise Eliminator (Quest Scientific Instruments Inc. North Vancouver, BC, Canada) to a model EX 1 differential amplifier (Dagan). The amplifier was interfaced with computerized digitizing hardware (PowerLab / 4SPTM; ADInstruments, Milford, MA) and software designed to function as an eight channel chart recorder (ChartTM version 3.5.7; ADInstruments). Recording chambers consisted of 35 mm tissue culture dishes filled to capacity with Sylgard silicone elastomer (Dow Corning; Midland, MI). Recording chambers were used for only a single recording and then discarded. Dissections, Neurophysiological R ecordings an d A nalyses Adult male German cockroaches (1 to 4 w ks old) were used for all neurophysiological recordings. Dissections and recordings were performed in physiological saline (185 mM sodium chloride, 10 mM potassium chloride, 5 mM calcium chloride, 5 mM mag nesium chloride, 5 mM HEPES sodium salt, and 20 mM glucose; pH 7.1). After removal of legs and wings, cockroaches were dissected longitudinally along the dorsal abdomen and thorax. Gut and fat body tissues were removed to expose the ventral nerve cord. The cockroach carcass was pinned open

PAGE 150

150 and the abdomen was filled with physiological saline. To position the pulled capillary tubing containing the recording electrode in contact with the first abdominal ganglion a micromanipulator (model MNJR; World Precision Instruments), was used. The reference electrode was placed into the physiological saline within the abdomen and activity was observed until a steady, referencesubtracted baseline was achieved. Spontaneous electrical activity was recorded for 10 mins fol lowing established protocols (Bloomquist et al. 1991, 1992; Scharf and Siegfried 1999, Durham et al. 2001, Song and Scharf 2006). R ecordings of spontaneous baseline electrical activity were achieved by setting a threshold with the counter function on the Chart software to obtain ~ 100 threshold surpassing electrical bursts per min. Baseline recordings continued for 5 min and were then stopped momentarily to allow 5 L of physiological saline containing 10 M fipronil to be gently pipetted onto the preparation. Spontaneous electrical activity was then recorded for an additional 5 min. Cockroach preparations in which antennal movement was not detected at the end of a recording were discarded and were not used for statistical analysis. Twenty individual recor dings were obtained for both the JWax S and GNV R strains. Physiological saline containing 0.4% v/v of the solvent carrier DMSO was tested as the experimental control and found to elicit no changes in neurological activity (n = 5 per strain). For each preparation (n = 20), average baseline activity was determined for the first 5 mins. Next, departures from average baselines were determined per minute during the 5 min fipronil recordings. From these data, an average departure from baseline was determined for each preparation, whereby values > 1 indicate neurological excitation and < 1 indicate neur ological inhibition (Scharf 2008). Average departure data

PAGE 151

151 were compared statistically between the JWax S and GNV R strains by nonparametric MannWhitney U test at the P < 0.05 significance level in JMP 8.0. Similar analysis was used to determine the statistical significance of average departure values from the baseline for each strain. Detection of the Alanine to Serine ( A302S ) M utation After each electrophysiology recording, cockroach heads from the JWax S and GNV R strains (n = 20) were cut of f and stored individually in 90% ethanol. These heads were later used individually for genomic DNA extraction using the DNAzol Genomic DNA isolation kit (Molecular Research Center, Inc., Cincinnati, OH) following the manufacturers protocol. A 245bp genomic region of the B. germanica Rdl gene encompassing the resistance associated A302S mutation was PCR amplified using the primers designed by Hansen et al. (2005) with certai n modifications (Fig ure 63). Each 20 L PCR reaction contained SybrGreen PCR Master Mix (2x SensiMix Sybr and Flourescein Kit, Quantace, Norwood, MA), ~ 50 ng genomic DNA, 10 M of forward and reverse primers, and nuclease free water. Temperature cycles f or PCR amplification were as follows: 94oC for 5 min followed by 35 cycles of 94oC for 30 sec, 64.3oC for 30 sec, and 72oC for 30 sec followed by a final extension step at 72oC for 10 min. A higher annealing temperature of 64.3oC was used to avoid primer dimer formation. The PCR products were purified using sodium acetateethanol precipitation (Sambrook et al., 1989) and sequenced directly or cloned and sequenced at the University of Floridas Genomics core facility. The resulting sequences were then compar ed by BLASTn and BLASTx against the NCBI nr database to detect the nucleotide and amino acid substitution, respectively.

PAGE 152

152 Data A nalyses Probit analyses of topical dosemortality data with and without synergists were performed in the SAS software package (SA S Institute, Cary, NC) using PROC PROBIT. If necessary, the dosemortality data were corrected for control mortality using Abbotts formula (Abbott 1925). As the difference between average strain weight of the JWax S and GNV R strains was about 12 mg (Tabl e 6 1), lethal dose (LD50 and LD90) values were corrected for body weight and expressed as g fipronil per g body weight. Resistance ratios were determined by dividing LD values of the GNV R strain with LD values of JWax S strain and were considered signif icant based on nonoverlap of corresponding LD values. Synergism ratios and their 95% confidence intervals were calculated using the procedure given by Robertson and Preisler (1992). These r atios were considered significant if their confidence intervals di d not include 1 (P < 0.05) Synergism ratios < 1 indicate synergism of fipronil toxicity and r atios > 1 indicate antagonism. Percent mortality data obtained from the injection bioassays and topical bioassays with and without synergists were arcsine trans formed and analyzed nonparametrically by the Kruskal Wallis test (P < 0.05) in JMP 8.0. Logistic regression analysis in JMP 8.0 was used to determine if the continuous independent variable, average departure of electrical acti vity from baseline had sign ificant predictive effect on presence or absence of the A302S mutation. Results Effect of S ynergists on F ipronil T oxicity Topical toxicity of fipronil at 72 h in the presence or absence of PBO or DEF is presented in Table 6 1. In the absence of any synerg ist, the fipronil LD50 resistance ratio for the GNV R strain was similar to that reported previously, i.e. ~ 36 to 37fold

PAGE 153

153 (Gondhalekar et al. 2011). At the LD50 level, preapplication of PBO or DEF reduced the magnitude of fipronil resistance in the GNV R strain to 18to 20 fold. Although decreases in fipronil resistance ratios in the GNV R strain were seen after PBO and DEF pre treatment, the responses of the JWax S and GNV R strains to synergist application were completely opposite. Both synergists nonsignificantly antagonized fipronil toxicity in the JWax S strain. In contrast, in the GNV R strain, fipronil toxicity was synergized by both PBO and DEF but only PBO caused significant synergism. Fipronil slope values and LD90 synergist ratios also reflec ted a similar trend of antagonism and synergism profiles in JWax S and GNV R, respectively. The effects of fipronil injections on antagonism / synergism profiles in the JWax S and GNV R strains are shown in Figure 6 1. In agreement with topical bioassays, PBO and DEF pretreatments caused significant antagonism of fipronil toxicity in JWax S (Kruskal Wallis one way analysis: 2 = 6.77, P = 0.033 for injection bioassays; 2 = 6.77, P = 0.033 for topical bioassays) and synergism of fipronil toxicity in GNV R ( 2 = 7.32, P = 0.025 for injection bioassays; 2 = 6.94, P = 0.031 topical bioassays). The findings of injection bioassays indicate that reduced penetration is not involved as a resistance mechanism and that synergist preapplication does not significantl y impact penetration of fipronil. Neurological I mpacts of F ipronil The suction electrode technique was used for recording neurophysiological activity from first abdominal ganglia of adult male German cockroaches (n = 20 per strain). The results of these st udies are depicted in Fig ure 6 2. The representative electrophysiological recording shows that application of 10M fipronil to the nerve

PAGE 154

154 preparation caused pronounced neuroexcitation in the JWax S strain (Fig ure 62A). Consistent with the visual evidence, average departure of electrical activity from baseline levels was higher in the JWax S strain (Mann Whitney U test: Z = 4.62, P < 0.0001) but in the GNV R strain it was similar to baseline activity levels ( Z = 0.56, P = 0.57) (Fig ure 6 2B). Additionally, comparison of average departure values for the susceptible and resistant strains using a nonparametric MannWhitney U test revealed that the mean responses of the two strains were significantly different ( Z = 3.69, P = 0.002) (Fig ure 6 2B). These result s are consistent with the hypothesis that target site modifications are responsible for the lack of fipronil induced neuroexcitation in the GNV R nervous system. Detection of the A302S M utation and its R elationship with N ervous S ystem I nsensitivity to F ipr onil A 245 bp region of the Rdl subunit of the GABA receptor (corresponding to exon 7 of D. melanogaster ) was PCR amplified and sequenced (Fig ure 6 3). Alignment of the wildtype Rdl cDNA sequence of B. germanica (Genbank: S76552) with the Rdl DNA sequences of the JWax S and GNV R strains revealed that the known A302S Rdl mutation was present only in GNV R. The A302S amino acid substitution resulted from a G to T single nucleotide polymorphism with an allele frequency of 85% in the GNV R strain (Fig ure 6 2C) No other nucleotide polymorphisms were detected within this 245bp region. Since DNA isolated from the heads of the same individual insects used in electrophysiology experiments was used for determining the allele frequency of A302S mutation, we were abl e to perform a logistic regression of the presence or absence of the mutation (binary data) versus neurological responses to fipronil (Fig ure 6 4). The

PAGE 155

155 logistic fit indicated that the independent variable, i.e., average departure of electrical activity fro m baseline had a significant predictive effect on the presence or absence of the A302S mutation in the Rdl gene ( 2 = 4.10, df = 1, P = 0.04). Discussion R ole of Metabolic Mechanisms in F ipronil R esistance Topical bioassay data presented here showed that f ipronil toxicity is synergized by PBO in the GNV R strain and antagonized in the JWax S strain. Antagonism of fipronil toxicity in JWax S is consistent with previous observations on two susceptible and seven resistant strains of the German cockroach (Scott and Wen 1997, Valles et al. 1997). However, synergism of fipronil toxicity as observed in the GNV R strain has not been previously reported in the German cockroach. Because oxidative conversion of fipronil to its bioactive sulfone metabolite is the major metabolic route of fipronil in insects (Scharf et al. 2000, Durham et al. 2002), the synergistic effect of PBO on fipronil toxicity in the GNV R strain was unexpected. Although metabolic biotransformation pathways of fipronil in the GNV R strain remain to be elucidated these results indicate that metabolic detoxification of fipronil is likely occurring in the GNV R strain. In M. domestica and C. hemipterus PBO and / or DEF were also found to significantly synergize fipronil toxicity (Cole et al. 1993, Scott a nd Wen 1997, Wen and Scott 1999, How and Lee 2011). Additional studies with the LPR strain of M. domestica further revealed reduced penetration and P450mediated detoxification as the major mechanisms of 15fold fipronil cross resistance (Wen and Scott 1999). The chemical structure of fipronil does not possess any ester linkages on which insect esterase enzymes are known to act (Oppenoorth 1985). In spite of this, the stereotypical esterase inhibitor DEF caused antagonism and synergism of fipronil

PAGE 156

156 toxicity in the JWax S and GNV R strains, respectively. In vitro inhibition studies conducted in German cockroaches have demonstrated that DEF can inhibit cytochrome P450s at micro molar concentrations (Valles et al. 1997). Hence, the antagonistic and synergistic e ffects of DEF on fipronil noted here may have been caused by nonspecific inhibition of P450s involved in fipronil activation or detoxification. In this regard, DEF could be competitively inhibiting P450s that act on the thioether group of fipronil to pot entially limit sulfone formation. In general, low magnitudes of fipronil antagonism / synergism ratios at the LD50 level (1.2 to 1.5 fold) were obtaine d in topical bioassays. The low level of antagonism observed in the JWax S strain was expected because fipronil and its sulfone metabolite are known to be equally toxic (Hainzl et al., 1998, Scharf and Siegfried 1999) and thus, inhibition of sulfone production may or may not result in large differences in toxicity. Although a lower degree of fipronil synerg ism was observed at the LD50 level in the GNV R strain, higher synergism ratios at LD90 (2 to 3 fold) and higher slope values in treatments receiving synergist preapplication clearly support that significant fipronil synergism and detoxification are occurring in the GNV R strain. Moreover, injection of fipronil did not change the observed synergism profiles in the susceptible and resistant strains, indicating that synergism of fipronil toxicity observed in GNV R is indeed true synergism and not quasi synergism (Sun and Johnson 1972) caused by altered penetration of fipronil due to synergist preapplication. Treatment with PBO and DEF reduced fipronil resistance ratios in the GNV R strain from 36 fold to about 18to 20 fold at the LD50 level and this decrease was even more pronounced at LD90 level However, these synergist induced changes in

PAGE 157

157 resistance levels should be interpreted cautiously because to a certain degree they were caused by differential synergism profiles in the JWax S and GNV R strains. Nonetheless, synergist preapplication did reduce resistance levels in the GNV R strain; thus my results support the idea that enhanced detoxification is responsible for at least some proportion (~ 18fold) of fipronil resistance in the GNV R strain. Pres ence of A302S M u tation and Target Site Insensitivity to F ipronil Electrophysiological studies provided definitive evidence that the GNV R strain nervous system is insensitive to fipronil. In contrast, rapid neuroexcitation after fipronil application was observed in the susceptible JWax S strain, which corresponds with previous findings and the established mode of action of fipronil (Cole et al. 1993, Gant et al. 1998, Scharf and Siegfried 1999, Zhao et al. 2003). As shown before in Drosophila spp. (Cole et al. 1995, Hosie et al. 2001, Le Goff et al. 2005), I hypothesized that the insensitivity of the GNV R nervous system to fipronil could be caused by the dieldrin resistance associated A302S substitution in the Rdl subunit of the GABA receptor. In strong agr eement with my neurophysiological findings, the A302S point mutation was detected in 85% (17 of 20) insects of the GNV R strain and was undetectable in the JWax S strain (n = 20). Logistic regression analysis also provided significant statistical support f or the association between the A302S mutation and target site insensitivity to fipronil in the GNV R strain. Although binding sites and mechanisms of action of fipronil and dieldrin on insect GABA receptors appear to be different (Deng et al. 1993, Gant et al. 1998, Zhao et al. 2003), heterologously expressed A302S or A301G Rdl mutants are less sensitive to fipronil than the wildtype receptors (Cole et al. 1995, Hosie et al. 2001, Le Goff et al. 2005). Similarly, wholecell patch clamp recordings with diel drin resistant German cockroaches revealed that GABA

PAGE 158

158 receptors of resistant cockroaches were 15fold less sensitive to fipronil sulfone (Zhao and Salgado 2010). In insects, apart from GABA gated chloride channels, fipronil and its sulfone metabolite are al so known to act on glutamategated chloride channels (GluCls) in the central nervous system ( Zhao et al. 2005a ). However, a recent study by Zhao and Salgado (2010) showed that GluCls may not be an important target of fipronil and fipronil sulfone in the German cockroach. Thus, based on my current understanding about interaction between GluCls and fipronil in the German cockroach, it does not appear that insensitive GluCl channels play a role in fipronil resistance in the GNV R strain. Evidence for Multiple Mechanisms of F i pronil Resistance Insecticide resistance caused by target site mutation(s) can interact either synergistically or additively with metabolic resistance factors (Raymond et al. 1989, Hardstone and Scott, 2010). In the current study, the GNV R strain with an A302S allele frequency of 85%, displayed 36fold fipronil resistance. Also, as determined in neurophysiological recordings, the A302S mutation frequency in the GNV R strain correlates significantly with target site insensitivity to fipronil. Interestingly, however, German cockroach strains from Denmark that poss essed a higher frequency (97.4 to 100%) of the resistant allele were only 15fold crossresistant to fipronil (Hansen et al. 2005, Kristensen et al. 2005). These differences suggest s trongly that additional factors other than the Rdl mutation are responsible for highlevel fipronil resistance in the GNV R strain. Fipronil cross resistance in US German cockroach strains from the prefipronil era was not affected by synergists (Valles et al. 1997, Scott and Wen, 1997) pointing toward the involvement of the Rdl locus in resistance. In contrast, in the GNV R strain,

PAGE 159

159 resistance to fipronil decreased due to apparent inhibition of cytochrome P450s, which to my knowledge is the first report of fipronil synergism in the German cockroach. Previously, cytochrome P450s have been implicated in fipronil resistance in M. domestica, C. hemipterus, and the rice stem borer, Chilo suppressalis (Wen and Scott 1999, Li et al. 2007, How and Lee 2011). The GN V R strain, which was collected 8 years after widespread use of fipronil began in the US, had likely undergone fipronil selection in the field. Direct selection by fipronil or other insecticides in the field may have further selected the GNV R strain for resistance mechanisms in addition to Rdl. For example, the laboratory selected Eyguieres 42 strain of D. simulans showed 20,000fold fipronil resistance which was associated with A301G and T350M point mutations in the Rdl subunit and an over expressed D1 glutath ione transferase (Le Goff et al. 2005) Also, a lab selected strain of the diamond back moth, Plutella xylostella displayed 300fold fipronil resistance that was only partially associated with the A302S mutation, and it was hypothesized that other mutations in the Rdl GABA receptor subunit might be contributing to fipronil resistance (Li et al. 2006). Although the possibility of occurrence of the T350M mutation in GNV R cannot be completely ruled out, it is unlikely that this mutation is present in the GNV R strain because the observed fipronil resistance in GNV R strain appears to be associated with the Rdl mutation and cytochrome P450s. Moreover, the T350M mutation has not been reported in any other insect species and it is not know if this mutati on can be selected under field conditions (Le Goff et al. 2005). In conclusion, from the evidence obtained in the current study highlevel fipronil resistance in the GNV R strain is likely caused by the combined effects of target site

PAGE 160

160 modification (A302S m utation in Rdl gene) and enhanced metabolism due to cytochrome P450 monooxygenases. Because the effect of P450 inhibition on fipronil toxicity only accounts for ~ 50 percent of fipronil resistance (at LD50 level PBO pretreatment reduced fipronil resistanc e in GNV R from 36 fold to 18fold), enhanced fipronil detoxification by P450s only accounts for about half of observed fipronil resistance in the GNV R strain. The remaining 50% of resistance is likely caused by the Rdl mutation. Additional studies to elucidate metabolic pathways for fipronil, to determine the interaction b etween fipronil resistance loci and to understand the genetics of fipronil resistance in the GNV R strain are now warranted.

PAGE 161

161 Table 61. Effect of insecticide synergists on fipronil tox icity to the JWax S and GNV R strains (72 h) in topical bioassays. Strain Treatment n Chi square (df) Slope LD 50 (95%CI) 1. SR 50 (95%CI)2. RR 50 3. LC 90 (95% CI) 1. SR 90 (95%CI)2. RR 90 3. JWax S Fipronil 220 5.20 (3) 6.45 (0.85) 0.028 (0.0260.030) . 0.043 (0.0380.053) . + DEF 180 3.42 (3) 4.92 (0.72) 0.038 (0.0340.045) 1.35 (0.992.11) 0.070 (0.0600.091) 1.62 (0.913.02) + PBO 180 1.35 (3) 4.93 (0.73) 0.034 (0.0300.038) 1.21 (1.001.68) 0.062 (0.0510.085) 1.44 (0.782.56) GNV R Fipronil 290 5.75 (5) 3.7 (0.48) 1.02 (0.851.19) 36.42* 2.25 (1.783.27) 52.32* + DEF 240 1.40 (5) 7.45 (1.05) 0.75 (0.680.81) 0.73 (0.511.05) 19.73* 1.10 (0.981.32) 0.48* (0.250.96) 15.71* + PBO 330 4.90 (6) 8.86 (1.70) 0 .63 (0.570.67) 0.65* (0.450.94) 18.53* 0.86 (0.790.98) 0.38* (0.210.78) 13.87* 1. Lethal dose ( LD 50 and LD 90 ) values with 95% confidence intervals ( g body weight ( Strain weights: JWax S = 47 mg per mal e, and GainesvilleR = 59 mg per male). 2. Synergist ratios at LD50 and LD90. SR50 or SR90 = LD value with synergist LD value without synergist. Confidence intervals (CI) for synergists were calculated according to the procedure described by Roberts on and Preisler (1992). Synergist ratios are considered significant if the 95% confidence intervals do not include 1 ( P < 0.05 ). 3. Resistance ratios at LD50 and LD90. RR50 or RR90 = LD value of GNV R LD value of JWax S. RR50 and RR90 ratios a re considered significant based on nonoverlap of LD50 or LD90 confidence intervals (CI). Asterisks (*) indicate significant SR50 or SR90 and RR50 or RR90 ratios are considered significant (see description in footnotes 2 and 3) n = number of ad ult males insects used in bioassays.

PAGE 162

162 0 20 40 60 80 100 0 20 40 60 80 100 Fipronil only + PBO + DEF % mortality at 72 h Injection bioassay Topical bioassay A. JWax S P < 0.033 P < 0.034 Fipronil only + PBO + DEF Injection bioassay Topical bioassay B. GNV R P < 0.031 P < 0.025 % mortality at 72 h Fig ure 61. Effect of bioassay method on synergism profiles in the JWax S (A) and GNV R cockroach strains (B). Vertical bars indicate percent mortality values at 72 h post treatment. For the JWax S stra in a concent ration of 0.0016 g per insect was tested whereas a concentration of 0.05 g per insect was tested against the GNV R strain (n = 30). The synergists PBO and DEF were topically administered 1 h before fipronil injections or topical applications. P values le ss than 0.05 indicate significant differences between treatments (Kruskal Wallis test).

PAGE 163

163 Fig ure 6 2. Summary of electrophysiology recordi ngs and alanine to serine ( A302S ) allele frequency measurements. (A) Representative neurophysiological recording showing effects of 10M fipronil on spontaneous nervous / electrical activity of the susceptible (JWax S) strain. Solid vertical black line indicates the ti me point (5 min) when recording was stopped momentarily and 10M fipronil was applied to nerve prepara tions. (B) The average departure of electrical activity from the baseline after fipronil application in the JWax S and GNV R strains. The baseline (1.0) is indicated by the horizontal dotted line. The responses of two strains were compared using a nonpara metric Mann Whitney U test ( Z = 3.69, P = 0.002). (C) Table showing the frequency of the A302S mutation found in the resistance to dieldrin (Rdl) GABA receptor subunit of the susceptible and resistant strains.

PAGE 164

164 Fig ure 63. A lignment (Clustal W) of a 245 base pair region of the B lattella germanica resistance to dieldrin ( Rdl) nucleotide sequence (Genbank accession number. S76552) with Rdl DNA sequences of the JWax S and GNV R strains. The asterisk (*) indicates the position of the resistanceass ociated alanine to serine (A to S) substitution at amino acid position 302 ( D. melanogaster numbering), detected only in the GNV R strain. Boxes denote forward and reverse primer sequences (from Hansen et al. 2005).

PAGE 165

165 Mutation Average departure from baseline Hit (mutation present) Miss (mutation absent) Fig ure 64. Logistic regression o f the alanine to serine ( A302S ) mutation frequency (Y axis) by average departure of electrical activity from baseline determined in neurophysiological recordings (X axis). The binary miss / hit data for the Rdl mutation and the corresponding values for independent variables, i.e., average departure of electrical activity from baseline for both strains (n = 40) were analyzed using logistic regression in JMP 8.0. Lower values of the independent variable were associated with the presence of the mutation (hit) whereas higher values were associated with an absence of the mutation (miss) (2 = 4.10, df = 1, P = 0.04).

PAGE 166

166 CHAPTER 7 SUMMARY Overall Goal and Objectives The overall goal of this dissertation was to develop better understanding of indoxacarb toxicol ogy in the German cockroach To achieve this overall goal, specific targeted investigations were conducted to (1) determine indoxacarb susceptibility levels in German cockroach field populations, (2) understand indoxacarb biotransformation pathways in the German cockroach (3) identify resistance / tolerance mechanisms that evolve following indoxacarb selection and (4) characterize fipronil resistance mechanisms in an indoxacarb nave field strain. The rationale for this research was that toxicologically rel evant information about German cockroachindoxacarb interactions would help in designing resistance management strategies for delaying the onset of resistance to indoxacarb and achieving effective cockroach control on a long term basis. Hypotheses and Resu lts A two tiered indoxacarb susceptibility monitoring strategy was developed a s a first step toward determining indoxacarb susceptibility levels in German cockroach field populations ( Gondhalekar et al. 2011). This strategy entails: (Tier 1) testing field collected populations in vial bioassays at two diagnostic concentrations; and (Tier 2) validating suspected susceptibility shifts identified in tier 1 by testing populations at three diagnostic doses in bait matrix feeding bioassays. With this approach, ti er 1 vial bioassays allow rapid screening of field strains for physiological resistance / tolerance and tier 2, with its novel feeding or oral bioassay method that simulates field exposure conditions to indoxacarb, allows simultaneous testing for physiolog ical and bait aversion (behavioral) resistance. Validation studies conducted with two field strains and two

PAGE 167

167 susceptible laboratory strains demonstrated that the monitoring strategy is sensitive enough to detect strains with reduced indoxacarb susceptibilit y well before field control failures begin occurring. Efforts are currently underway to register the twotiered monitoring strategy with IRAC (the Insecticide Resistance Action Committee) as a standard method of indoxacarb resistance det ection in the Germa n cockroach. As a second step towards a formal indoxacarb resistance monitoring program (Chapter 3), the twotiered technique was tested with fourteen field and two susceptible laboratory populations collected from thirteen different locations in the Unite d States (U.S.). My working hypothesis for this study was that the fieldcollected populations would show at least some degree of significant survivorship (in comparison to susceptible populations) in vial and oral diagnostic bioassays. In agreement with t his hypothesis, reduced indoxacarb susceptibility was detected in several field strains. In general, a higher number of strains displayed reduced susceptibility in tier 1 vial bioassays than in tier 2 oral bioassays. These observations are in support of pr evious findings that indoxacarb is more toxic via ingestion ( e.g., Wing et al. 1998). This monitoring study also enabled identification of a field strain, Campus Club 45 (CC45 ) that exhibits the highest known levels of indoxacarb resistance in the German cockroach know to date. Preliminary studies show that the CC45 strain exhibits significant survival when exposed to formulated Advion bait (0.6% indoxacarb) (Appendix A). Furthermore, vial and oral diagnostic bioassays with the Cocoa Beach 2008 and 2009 ( C B 2008 and CB 2009) populations demonstrated that indoxacarb tolerance can increase following field selection with indoxacarb and other insecticides.

PAGE 168

168 Finally, no evidence was found for bait aversion resistance to Advion bait matrix (data not shown). The a im of the second objective of this dissertation (Chapter 4) was to elucidate biotransformation pathways of indoxacarb in vivo For this objective, my working hypotheses were that extensive indoxacarb biotransformation occurs in the German cockroach and that cytochrome P450 monooxygenases (P450s) will play some role in the biotransformation process. The results obtained supported both hypotheses. Apart from confirming bioactivation of indoxacarb to the bioactive metabolite DCJW, in vivo biotransformation and mass spectrometry experiments proved that both indoxacarb and DCJW are further broken down into putative indanone ring hydroxylated products (5OH indoxacarb and 5OH DCJW), putative oxadiazinering opened compounds (KG433 and JU873) and three other yet u nidentified metabolites. All the metabolites reported here including DCJW are excretable through feces or some other unknown processes ( e.g., regurgitation and through secretions of male accessory glands). The tested field strains (CC45, Arbor Park and Gai nesville Resistant) displayed higher rates of DCJW and metabolite formation than the Johnson Wax Susceptible ( JWax S ) strain. However, only the CC45 strain showed significantly greater excretion of DCJW and other metabolites. Synergism bioassays and in viv o inhibition studies conducted using enzyme inhibitors piperonyl butoxide (PBO) and S,S,Stributylphosphorotrithioate (DEF) implied a role for P450s in formation of DCJW, ring hydroxylated and oxadiazine ring opened metabolites. Additional in vitro biotransformation studies, however, will be required to draw stronger conclusions about the role of P450s in DCJW formation. Also, although, PBO pretreatment inhibited DCJW and metabolite formation in the CC45

PAGE 169

169 strain, indoxacarb toxicity was not affected by PBO i n synergism bioassays. These results for the CC45 strain strongly imply that, along with enhanced metabolism, this strain also possess target site modification as a mechanism of indoxacarb resistance. Thus, future research related to indoxacarb resistance in the CC45 strain should focus on both metabolic and target site mechanisms. The third objective of this research (Chapter 5) was to characterize resistance mechanisms that evolutionarily respond to indoxacarb selection. My working hypothesis was that one of the existing known mechanisms of insecticide resistance in the German cockroach will be responsible for increased indoxacarb resistance after selection. The results of replicated selection studies were in support of my hypothesis. In the selected Arbor Park (AP ) strain, following 6 rounds of selection with orally fed indoxacarb, tolerance increased by 4.2 to 6.7fold in comparison with unselected lines. Bioassay dependent differences in resistance levels were also observed in the selected strain; in sur face contact vial bioassays the F6selected lines exhibited 23fold resistance to indoxacarb. Additionally, realized heritability (h2) estimates indicated that the indoxacarb resistance phenotype is heritable. Moreover, under continuous indoxacarb selection pressure (~ 30% survival per generation) resistance is likely to increase by 10fo ld in 7 10 generations (about 2 to 3 years under field conditions). Finally, biochemical and molecular evidence indicated that over expressed esterases, as well as upand / or downregulated P450 isoforms are likely associated with indoxacarb tolerance in the selected AP strain. Comparative toxicity studies conducted using several conventional insecticides and newer gel bait active ingredients demonstrated that the indoxacar b nave field

PAGE 170

170 strain Gainesville Resistant (GNV R) was highly resistant to DDT, pyrethroids, dieldrin, chlorpyrifos, propoxur and fipronil; but only exhibited low level tolera nce to indoxacarb, imidacloprid and abamectin (Gondhalekar et al. 2011). These results strongly suggested that indoxacarb cross resistance levels in strains never exposed to indoxacarb in the field may not be very high. Surprisingly, however, the GNV R strain displayed 37fold resistance to fipronil, which is the active ingredient of widely used cockroach baits (Maxforce FC Select Cockroach Gel Bait) Although fipronil has been used for German cockroach control for more than a decade, such high levels of fipronil resistance have not been reported. Hence, in the fourth objective of this dissertation (Chapter 6) studies were undertaken to investigate the mechanisms of fipronil resistance in the GNV R strain. The working hypothesis for this study was that higher level fipronil resistance ( i.e., >35x) in German cockroaches is caused by multiple resistance mechanisms. In agreement with this hypothesis fipronil resistance in the GNV R strain was found to be caused by the combined effects of target site modification (Alanine to Serine point mutation in the Rdl subunit of the GABA receptor), a nd enhanced metabolism by cytochrome P450s. S ignificance and Implications of Research This is the first study that conducted comprehensive research to understand toxicological aspects of indoxacarb in the German cockroach. As a consequence of this researc h, our knowledge about German cockroachindoxacarb interactions has significantly increased. Because these investigations were undertaken just after introduction of indoxacarb for cockroach control (200607), the obtained results can be directly used for designing resistance management strategies to delay the onset of resistance associated control failures. The resistance monitoring tec hnique developed

PAGE 171

171 here ( Gondhalekar et al. 2011) can be used for conducting surveys for indoxacarb resistance in German cock roach field populations, and based on the outcome, situationspecific control strategies can be adopted. Cockroach strains highly resistant to indoxacarb (CC45) identified through resistance monitoring studies caution us about impending resistance risks (C hapter 3). Moreover, strains like CC45, which represent extreme cases of resistance probably due to target site modifications, can be valuable tools for elucidating the modes of action of indoxacarb and other sodium channel toxins. The identification of br eakdown products of indoxacarb and DCJW (Chapter 4) for the first time in an insect species (specifically in the German cockroach) provides us insights into indoxacarb resistance mechanisms that might evolve in the German cockroach One potential direction of f uture research is to focus on identifying and silencing detoxification enzyme genes responsible for breakdown of indoxacarb and/ or DCJW ; this would ultimately help in improving efficacy of indoxacarb against tolerant populations. Furthermore, implicat ion of P450s in DCJW formation and piperonyl butoxide ( PBO ) induced antagonism of indoxacarb toxicity due to apparent inhibition of DCJW formation suggest that PBO, a commonly used synergist to enhance insecticide efficacy, cannot be used in combination wi th indoxacarb. L aboratory selections with the AP strain (Chapter 5) and field selection of the Cocoa Beach population (Chapter 3) show that indoxacarb resistance is heritable and readily selectable following continuous selection pressure; hence, resistance management is clearly necessary to prevent resistance buildup and eventual Advion bait control failures. Also, a relatively high magnitude of resistance was observed in the selected AP selected strain to residual deposits of indoxacarb (~ 23fold versus 4.2 to

PAGE 172

1 72 6.7 fold tolerance to orally fed indoxacarb). This is an additional cause of concern for the effectiveness of an indoxacarb spray formulation that was introduced in 2010 (Arilon). As seen with many other previously used insecticides, differences i n apparent indoxacarb tolerance / resistance mechanisms exhibited by the labselected AP strain and the CC45 field strain demonstrate that the combination and expression of indoxacarb resistance factors can vary from strain to strain. Thus, situationspeci fic efforts will be required to understand the suite of potential resistance mechanisms that will be selected by indoxacarb and how they can be overcome to achieve satisfactory long term control. Finally, in strains like GNV R that exhibit highlevel fipro nil resistance and low level indoxacarb tolerance ( Gondhalekar et al. 2011) an effective resistance management strategy may be to use indoxacarb baits in rotation with other bait products that contain different active ingredients ( e.g., imidacloprid, abamectin and hydramethylnon). Overall the findings of this research provide a critically required update on indoxacarb toxicology in the German cockroach that can be used for developing resistance management strategies and increasing the productive life of ecofriendly, biorational insecticides like indoxacarb.

PAGE 173

173 APPENDIX A PERFORMANCE OF THE INDOXACARB TOLERANT STRAINS IN NO CHOICE BIOASSAYS USING FORM ULATED ADVION BAIT The field collected strains, Campus Club 45 ( CC45 ) and Cocoa Beach 2009 ( CB 2009) exhibit ed highest levels of survival (> 50% survival at highest indoxacarb diagnostic concentration and dose) in the vial and oral bioassays (Chapter 3). To test if these strains were tolerant / resistant to the formulated Advion bait (0.6% indoxacarb), nochoic e gel bait bioassays were conducted. The hypothesis that I tested here was that both field strains would exhibit significant survival in nochoice bioassay using formulated Advion baits. Materials and Methods Strains, Rearing and Chemicals The Johnson Wax Susceptible ( JWax S ) strain and the fieldcollected CC45 and CB 2009 strains were used in nochoice bait feeding bioassays. Rearing was conducted using the standard procedure described in Chapter 2 (Gondhalekar et al. 2011). Adult males (1to 4 w eek old) were used in the bioassay tests. Advion (0.6% indoxacarb) bait was provided by DuPont Inc. (Wilmington, DE). No Choice Gel Bait Bioassays These bioassays were performed according to the protocol given by Wang et al. (2004) and Gondhalekar et al. (2011). Bioassays followed a nochoice format, meaning that no alternative diet, other than the formulated Advion bait was provided. Tests were conducted in disposable plastic Glad boxes (17.8 x 17.8 x 6 cm) with aerated lids. The inner top portion of side wal ls of the boxes was coated lightly with a mixture of petroleum jelly and mineral oil (2:3) to prevent the cockroaches from escaping. Each box contained a cottonplugged water vial, a cardboard harborage and

PAGE 174

174 0.5 g Advion bait in a 5 cm hexagonal plastic we ighing dish (Fisher Scientific, Pittsburgh, PA). Controls received rodent diet or Advion blank bait matrix alone. The cotton plugged water vial was replaced every two days. For each strain eight replicates were performed w ith ten insects per replicate. A d ult males anesthetized on ice, were placed in each assay box and the boxes were held in rearing chambers under standard rearing conditions. Knockdown m ortality was evaluated at every 24 h up to 7 d. The 3 d and 7 d percent mortality data were arcsine tran sformed and analyzed by analysis of variance (ANOVA) and the means were separated by Tukeys test (P < 0.05). Results and Discussion The average percent mortality of the three strains at 3 d and 7 d is shown in Figure A 1. The percent mortality levels of t he CC45 and CB 2009 strains were significantly different from the JWax S strain at the 3 d interval (ANOVA results: df = 9, 23, F ratio = 33.05, P < 0.0001). At 7 d, however, the mortality levels of only the CC45 strain were significantly different than those of the JWax S strain (ANOVA results: df = 9, 23, F ratio = 13.22, P < 0.0001). These results indicate that although the CB 2009 strain shows significantly higher survival in diagnostic bioassays (Chapter 3) and nochoice bait feeding bioassays at 3 d, it is unlikely to have significant longer term survival when exposed to the formulated indoxacarb bait. In contrast, the CC45 strain can tolerate high doses of indoxacarb found in the Advion bait and shows significant survival (~ 30%) at 7 d. Thus, based on these results it is possible that indoxacarbcontaining baits may not provide satisfactory control in field populations that exhibit indoxacarb resistance / tolerance similar to that observed in the CC45 strain.

PAGE 175

175 Figure A 1. Performance of the Johns on Wax Susceptible ( JWax S ) and indoxacarb tolerant (CB 2009 and CC45) field strains in Advion gel bait no choice bioassays. Bars represent percent mortality values after assay days 3 and 7. The bioassays were replicated eight times (10 insects per repl icate) for each strain. Within each time interval bars connected with different letters are significantly different (Tukeys HSD test, P < 0.05).

PAGE 176

176 APPENDIX B DECLINE OF INDOXACARB CROSS RESISTANCE IN THE FI ELD COLLECTED ARBOR PARK STRAIN AFTER CONTINUOUS LABO RATORY REARING Vial diagnostic bioassays at two concentrations (30 and 60 g indoxacarb per vial) indicated that initial indoxacarb cross resistance (tolerance) levels exhibited by the fieldcollected Arbor Park (AP) strain had declined following 2 to 3 generations of laboratory rearing without selection pressure (Gondhalekar et al. 2011). The goal of this experiment was to determine if changes in indoxacarb susceptibility as detected by surface contact (vial) bioassays in the AP strain were also detectable by feeding (oral) bioassays The hypothesis I tested here was that in oral bioassays, the laboratory reared AP strain would exhibit indoxacarb susceptibility levels similar to those of the susceptible laboratory strain. Materials and M ethods Insects, Rearing and Chemicals The field collected Arbor Park (AP) strain and the Johnson Wax Susceptible ( JWax S ) laboratory strain were used in this study. Rearing was conducted as described by Gondhalekar et al. ( 2011). Adult males (1to 4 w eek old) were used in the oral bioassays. Technical grade indoxacarb (99.1 % active ingredient ) and Advion blank bait matrix was provided by DuPont Inc. (Wilmington, DE). Indoxacarb dilutions were made in analytical grade acetone (Fisher Scientific, Pittsburgh, PA). Oral Dose Response Bioassays Oral / Advion blank bait matrix LD bioassays were conducted as explained by Gondhalekar et al. ( 2011). A series of indoxacarb doses (3.75, 1.87, 0.94, 0.47, 0.23, 0.11, 0.06 and 0 g indoxacarb per pellet) were tested. At least 3 to 4 of these doses were tested that provided mortalit y between 10 to 90%. Three replicates (ten insects per

PAGE 177

177 replicate) were performed for each dose and strain. Knockdown mortality was recorded at 24, 48 and 72 h. The 72 h data were analyzed by PROBIT analysis (SAS Institute, Cary, NC) using the PROC PROBIT function. Toxicity / resistance ratios and their significance were determined as explained in Table B 1. Bioassays were conducted at two time points (Time 1 and Time 2). Time 1 (T1) was 6 to 8 months after collecting the AP strain from the field. Time 2 (T2) was 6 to 8 months after T1. Results and Discussion Indoxacarb LD50 values for the AP strain at T1 were 4fold higher than those of the JWax S strain (Table B 1). At T2, however, the LD50, v alues of AP strain became indistinguishable from those of the JWax S strain based on overlap of 95% confidence intervals. Because indoxacarb was never used for the control of AP strain in the field ( Gondhalekar et al. 2011), the initial indoxacarb toleranc e exhibited by the AP strain was actually cross resistance resulting from selection by other insecticides used against the AP strain ( e.g., spray formulations of chlorfenapyr and certain pyrethroids). The results obtained here corroborate with the results of vial diagnostic bioassays, which also showed a decline in indoxacarb cross resistan ce in the AP strain ( Gondhalekar et al. 2011). As the AP strain was maintained in the laboratory without selection pressure the decrease in indoxacarb LD50 values and tox icity ratios for the AP strain indicate that initial indoxacarb cross resistance (tolerance) exhibited by the AP strain was unstable and declined in the absence of selection pressure. Loss of resistance / tolerance in absence of selection pressure is a ver y common phenomenon especially if fitness costs are associated with resistance (Roush and McKenzie 1987). Declines in indoxacarb crossresistance after continuous laboratory rearing have also been reported to occur in Heliothis virescens and Spodoptera lit ura (Sayyed et al. 2008a, 2008b).

PAGE 178

178 Table B 1. Oral toxicity of indoxacarb to the Arbor Park (AP) and Johnson Wax Susceptible ( JWax S ) strain s at two time points (T1 and T2) separated by 6 to 8 months. Strain n Slope Chi square (df) 1. LD 50 (95% CL) 1. RR 50 2. JWax S (T1) 3. 240 2.40 (0.29) 4.58 (5) 0.13 (0.11 0.16) -AP (T1) 3. 180 2.31 (0.33) 1.43 (3) 0.53 (0.41 0.69) 4.10* JWax S (T2) 3. 210 2.88 (0.33) 2.45 (4) 0.12 (0.09 0.14) -AP (T2) 3. 210 3.05 (0.42) 6.30 (4) 0.17 (0.13 0.21) 1.4 2 1. Chi square and corresponding degrees of freedom. 2 Oral lethal dose ( LD50) values at 72 h with 95% confidence intervals. Values are indoxacarb per insect. 3 Resistance ratios at LD5 0. Ratios were determined by dividing L D50s of AP at T1 or T2 with L D50s of JWax s at T1 or T2. 4 Time 1 (T1) was 6 to 8 months after collecting the AP strain from the field and Time 2 (T2) was 6 to 8 months after T1. Asterisk (*) indicates a significant resis tance ratio based on nonove rlap of LD5 0 confidence intervals. n = total number of insects used in bioassays.

PAGE 179

179 APPENDIX C GERMAN COCKROACH EXPRESSED SEQUENCE T AG (EST) LIBRARY : A TOOL FOR IDENTIFYING INSE CTICIDE BIOTRANSFORM ATION GENES The aim of this study was to identify insecticide biotransformation genes expressed in the midgut and fat bodies of the German cockroach. G el bait insecticides including Advion (0.6% indoxacarb) are more act ive via ingestion and generally must be ingested in order to be effective for their intended purpose. Additionally, the insect fat body is a highly active detoxification organ that is analogous to the vertebrate liver. Thus, knowledge of cockroach gut and fat body detoxification genes will provide a useful resource for identifying potential biotransformation pathways of bait insecticides like indo xacarb and resistance mechanisms that could evolve to them. Materials and Methods Cockroach Strains and Rearing Adult males, nongravid females, and large nymphs (45th instar) of the Gainesville Resistant (GNV R) strain were used in this study. The GNV R strain is highly resistant to DDT, dieldrin, pyrethroids, chlorpyrifos propoxur and fipronil, and possesses low level tolerance to indoxacarb, chlorfenapyr, imidacl oprid and abamectin ( Gondhalekar et al. 2011). Rearing was performed as d escribed previously ( Gondhalekar et al. 2011). Construction of Non Normalized EST Library Midgut and fat body tissues of 40 50 cockroaches (adult males, nongravid females and large nymphs ) were dis sected and used immediately for total RNA extraction with SV Total RNA Isolation Kit (Promega; Milwaukee, WI ). The protocol described by Tartar et al. (2009) was used. Approximately 100 g of total RNA was precipitated with an ethyl alcohol / ammonium acet ate / glycogen mixture and used for

PAGE 180

180 polyA RNA extraction using the PolyA Purist Kit (Ambion ; Austin, TX ). cDNA was synthesized from the polyA RNA ( 0.2 g) fraction and ligated into pDONRTM222 plasmid using the CloneMiner cDNA Library construction kit (Inv itrogen; Carlsbad, CA ). The transformed plasmids were then electroporated into competent ElectroMAXTM DH10BTM T1 phageresistant cells (Invitrogen; Carlsbad, CA ). The library was then cultured to yield a final titer of 1.5 X 107 cfu per mL and stored at 8 0oC until use. Sequencing of Clones For sequencing, frozen library aliquots were scraped and suspended in 1 mL SOC media, diluted and plated on LB agar plates containing 50 g per mL kanamycin. Inoculated plates were incubated at 37C for 1618 hr. Well sp aced medium sized colonies (n = 384) were selected at random and placed into 500 l LB media + 8 % glycerol containing 50 g per mL kanamycin within individual wells of four 96well plates. The culture plates were incubated in a shaker (200 rpm) at 37oC fo r 16 to 18 hours (h) and were then frozen at 80oC until sequencing. Clones were sequenced at the Interdisciplinary Center for Biotechnology Research (ICBR), University of Florida. Sequencing consisted of singlepass reactions from the 5 end of the cDNA, using the M13 forward primer. Sequence Analysis The Expressed sequence tags (ESTs) obtained after trimming the vector sequences were used as query sequences to search the Genbank transl ated nucleotide database (BLASTx ). Only sequences that were > 200 bp w ere included in the analyses. Blast hits for sequences were considered significant if their E value was 1 x 105 or smaller. The ESTs obtained for cytochrome P450 monooxygenases (P450s) were

PAGE 181

181 submitted to Dr. David Nelson (University of Tennessee) for accur ate identification and nomenclature assignments. Results and Discussion A summary of sequencing results is shown in Figure C 1A. Of the 384 clones that were sequenced, a total of 332 high quality sequences (> 200 bp in length) were obtained. BLASTx analysi s revealed significant hits for 169 sequences (51%). The distribution of ESTs with significant hits based on their function and tissue localization is shown in Figure C 1B. Only eight (4.74%) of the 169 ESTs were found to encode genes associated with xenobiotic / insecticide biotransformation (Table C 1). The eight ESTs that were putatively associated with insecticide biotransformation belonged to Cytochrome P450, carboxylesterase, epoxide hydrolase, glucuronosyl transferase, and aldehyde dehydrogenase / re ductase gene families. The three cytochrome P450 genes identified here ( CYP6AM2, CYP6J2 and CYP357C1) are most probably novel P450 ge nes from the German cockroach. Other than the P450s reported here, only six to eight other P450 genes have been previously identified from the German cockroach. Because the EST library was nonnormalized the proportion of housekeeping / ribosomal genes was high, which limited our ability to identify genes of interest ( i.e., biotransformation genes). Another reason for lower proportions of biotransformation genes identified here is that RNA from cockroaches untreated with insecticides / indoxacarb were used for library construction. Given that many biotransformation genes ( i.e., P450s, GSTs) are induced by insecticides, use of RNA isolated from insects treated with sublethal dose of an insecticide would likely have improved our chances of identifying a greater number of P450s or other biotransformation related genes. Nevertheless, the eight ESTs linked to insecticide biotransformation provide a valuable

PAGE 182

182 tool for comparative gene expression studies between indoxacarbtolerant and susceptible German cockroach strains Additionally, functional genomics studies can now be conducted to understand the roles of these genes in insectic ide biotransformation or insect physiology in general. The sequences and BLASTx identities of the eight biotransformation genes are shown below. 1 ) Carboxylesterase: Similar to Bombyx mori carboxylesterase15 (E value: 2.00 E 73) TTGGGATGTTACGAATAATT GTCTTG TTATTTCTTACATGCACGATTATTCTTGGACA GGATGACTCTTTACCGGAAG TTACAATTCAACAAGGCACACTCAAAGGATTTCGAT TAACTTCCAGGAAAGGAAGG GAATTTTTTGCTTTTCAGCG AATTCCTTATGCCAAGA GTCCTGTGGGAGATCTCAGA TTCAGGAGTCCTCAGCCGTT GGAGAAATGGGAAGG CGTGCTGGATGCGACGGAGGATGTTCCGAAGTGCACTCAA AAGGATACATTTCGA G GCCAGAACACTGCTTCTGGA CAGGAAGATTGCCTATTTAT TAATGTTTACACTCC ACGTATAGATGGACAAGACT TGCTGGATGTTATGGTGTAC ATTCATGGTGGGGGCT TTTTCGCCGGTTGGGGATCA AAACATGGTCCGGCGTACCT TATGGACCAGAACGTT GTTTATGTCAATTTCAACTA CAGACTTGGAGCGCTTGGTT TTCTGAGTACCGGAGAT TCTGAGTGTCCAGGTAATAA TGGACTCAAGGA TCAAGTGTTAGCACTAAAAT GGGT GAAGGAGAATATTGCAGCGT TCGGGGGAAATCCTGATAGT GTGACAATTTTTGGC GAAAGTGCTGGAGGTGCTAG TGTCCATTTCCACATGATAT CACCTGCCAGTAAAGG CTTATTTCACCGAGCGATAT CACAGAGTGGAACAGCCCTA AATGCATGGGCCTTGG CACTTGGTGGGTCAAATGTA GATAATGCTAAGAAATTGGC TGCGTCTTTCAACTGT CCAACTGAA CCAAGCAATGCTCTTGTCGA CTGCCTG 2) CYP6AM2 : N terminal 53% similar to Hodotermopsis sjostedti CYP6AM1 TTGGAAAATGTCCTAGTGAAAGATTTCGCTCATTTCCACG ATCGTGGATTCCACATG GACGAGGAAAAGGAACCTCT GTCCGGACATCTGTTCTTGT TGCCTGGGACAAGAT GGAGGAATCTCAGAGTCAAA CTATCTCCGACTTTTACATC TGGTAA AATGAAGATG ATGTTCCAGACATTGGTTGA TTGTGGAGTTGAACTAGGAGGCTTAGTAGAAAATAT GACAAGCGAGGGACAAATAA TTGAAATTAAAGATGTCTTA GCTAGATACAGCACTG ACATCATATCTTCTTGTGCA TTTGGGATTCAGTGCAATTC TTTGAAAAATCCAAACG CTGAATTTCGCCAATGGGGA AGAAAAATCTTTGAACCATC TATTAAATCGGGTATTG GTGGACTTATTAGGGCAACA TTTCCTAAAATTCTGGACTA CATTGATATTCCTGGAG TCGACAAAAATATCTCTAAATATTTCCAACAAATGGTGAAAGATACTGTCGAATATC GTGAGAAAAACAATGTCATC AGAAATGACTTTATGCAGCT TCTCATCCAATTGAAGA ATAAAGGTTTCGTTGCACCAGATCATCAAAACGGGTCTAC AAAGGCCGAGATCACA GATACAAGCAAATTGTCAAT GGGCAGTTTGGCGGCTCAAGCATTTGTGT TTTTCATT GCTGGCTTCGAGACATCATCCACTACAATGACATTTTGCT TGTATGAGCTTTCTTTG AACCATGACGTTCAAGAAAAACTTCGAGAAGAAATTCGGACGGTACTAAAAGAACA TGATGGAAAAATCACATATG ATTGTATTCAAGAAATGACT TACCTAG

PAGE 183

183 3 ) CYP6J2 : N terminal 53% similar to Blattella germanica CYP6 J1 TTGGCATTGGACTATCCATA T CCTTAATCATTGGTTTGTAC TTTTATTACACGAGAAA TTTTAACTTTTGGAAGCAAA GAGGGGTGACGTTTGTCAAA CCATTGCCTTTCCTCG GAAGTCTAAAAGAAGTAGCT TTACAAAGAATGACCATCGG ACACAAACTGAAGGCA CTTTATGAAGAATACAAGAA TGAACCCTATGTTGGAATAT ATTCGTTTGATAAACCT TCGTTGATGGTGCGAGATCT TGATTTGGTGAAGAATGTTTTGGTAAAGGACTCTCA AAACTTTCAGGATCATCTGG CAACCTTGGATGAAGATTTAGATCCTCTAGGAGCTA GAGGTCTGTTTACGATGAAG GGACAAAAGTGGAAACACAT GAGGAACGGTCTTAC CCCTACATTCACATCAGGAA AGATGAAACAAATGTTTTAT TTGGTAGAAAAGTGTGC TAAGGAACTAGATAAATACT TGGATTCGGCAACCGTTGGA GCTTCAGAAGTGGAAG TGAAAGAGGCTACGGCAAAA TACACAACAGACGTCATCGCTAGCTG CGCTTTTGG AATCGAAAGCAACACACTGA AAAATCCCAATGCTGAGTTT AGGCAACAACTTCGTA AATTCTTCATTGTTACACCG TTAAGAGGTTTAATAATATACCTGGCTTTAGTGGCAC CTAAACTTATCAAAACATTC CGCCTGCAATTCATGGAGAA AGGAGTCTATGATTTCA TCAGGAGCACAGTCTGGGAC ACAGCAAAATACAGGGAAGA AACAGGGATAACGCG TC GAGATTTTCTAGACAACTTG GTAGAATTGA 4) CYP357C1 : N terminal 47% similar to Laupala kohalensis CYP 357B2 TTGGGTTGTATTTATATTATCTTTCTTTCCCTTATTCGGATTCAGACAAGATCTGCCT AGCGTGAAGGTCTCACATGGGCGGATGTTGCACTGTACGTCTTAAATTGTAATTGT CTACCAAGTGCTAGCAGTAGAATACCAAACTTCATCGTGGGC AGGCCTTCAGAAGA GTTGTGATTGATCAAATTATTATAAGATTAGGATCATGGAAGTTATAGATATCGCAA CATGGTGGCCTCTTGGAGTTGTTCTACTTGGATGGATGATCTATTTATATCTTACAT GGAATTGGAACTATTGGAAAAACAGAGGCGTTCCATATATGAAACCTGTACTTCTTT TTGGAAATTTGAAAGAATCCACACTCCTTCAGAAGTTTATCGGACATGTGTATGATG ATATTTACAAGAAG TTTGAAGGACATAGATACGCCGGAATATTTGAACTGGGAAAG CCTTCGTTACTTATTAGAGATCCTGAACTCATCAAGGATGTACTTGTGAGAGAATTC TCAAAATTCCACGACAATGAGATATTCGTGGACCCGGATAATGACGCGATGTTTGG GCGCAATCCTTTCGTATTACGAGGAGAAAGATGGAAGGTAACTCGTTCGAGACTGA TGCCGGCATTTACTGTGGCAAAACTTAAACCTCTTTTT 5) Ep oxide hydrolase : Similar to Trichopulsia ni epoxide hydrolase (E value 1.00 E 70) TTGGGAACACAGTCTCAGTG ACATAGCACCAAAGATGGGG CTCCTAGGAAAACTTA TTCTTCTCGGATTTACACTG ACGGCTGTCGGCATTGGCTA TATAGCTCACAAAATG AATGAGATACCAGAAATTCC TGAACTTAAAAGTACCTGGT GGGGTGCTGGTGAACC TCGG AAAGTGGATGAATCCATCAG AAGCTTTAAAATTAATGTTC CAGATGAGGTATT ACAAGATTTAAAAAGACGTC TAGATAATCATTCACCTCTC ACACCACCAATGGAAAC CGTCAACTTTGAATATGGTTTCAACACAGATTATCTTAAG AAAGTTGTTGAATACTG GAAAACTAAATATAATTGGA GAGAACGAGAAGCATTTCTAAACAGTTTTCCCCAATT CAAAACAATTGTGGATGGTC TTGATCTGCATT TCATTCATGTCAAGCCACAG AAAGT AGATAAAAACACAAGAGTTC TTCCACTTCTCCTTCTTCAT GGTTGGCCAGGCTCAGT GAGAGAGTTTTATGAATTGA TTCCCCTTCTGACAACACCA CAAAAGAATGTGGACTT CGTTTTTGAAGTCATTGCAC CTTCACTGCCTGGATATGGA TTTTCTGAAGGGGCTT

PAGE 184

184 CAAAACCAGGATTGGGTGCG GCACAGATGGCGGTGGTAAT GAAGGATTTAATGGA GAGATT AGGATTCAAAAAGTTTTATG CCCAAGGTGGAGACTGGGGT GCTATTATTG TCCACAATATGGCCACTCTT TTCCCAGGAAGCTTACATGG TATCCATTCCAATATGT GTGTATCTAACTTTGTGAAA TCAACA 6 ) Aldehyde dehydrogenase: Similar to Aedes aegypti aldehyde dehydrogenase (E value 2.00 E 104) TTGGAGGCACCACAAATTAAATAC ACCAAGATCTTCATCAACAA TGAATTTGTGGAT GCAGTGTCAGGAAAGACATT TCCCACCATAAACCCTTCAA CAGGGAAGAAGATTGC AGACATTGCTGAAGGAGATA AGGCTGATGTTGACCGTGCT GTTGCTGCTGCTAGT GCTGCTTTCAAGATTGGCTC ACCTTACAGGAAAATGGATG CTTCAGAAAGAGGGAA ACTTCTTTACAAGTTGGCAG ATCTGATTGAACGTGATATT CAGACATTAGCTGCTT T GGAAAGCCTGGATAATGGAA AACCAGTTAAATTTGCTGCA TTTGATTTGATGGGCT GTGCCAAAAATTTGCGGTAT TATGCTGGTTGGTGTGACAA AGTTCATGGAAACACA ATACCTGCAGATGGACCATT GCTTTCTTTCACAAGGAAAG AGCCAGTAGGAGTTGT GGGGCAAATCATCCCATGGA ACTTCCCAGCAGTAATGCTT TGCTGGAAACTTGCTC CTGTACTTGCCACAGGTTGC ACAACAGTCAT CAAGCCAGCAGAACAAACAC CTCTA ACAGCTCTGCACATTGCTGC TCTCACAAAGGAGGCTGGTG TTCCTGCTGGTGTCG TCAATATTGTTCCAGGTTAT GGCCCTACAGCTGGTGGTGCAATTACAGCGCATCCG GACATCAGAAAAGTTGCCTT CACTGGTTCTACCGAGGTGG GACGAATTATTATGCA AGCAGCAGCCAAATCAAATT TGAAGAGAGTCTCTCTAGAA TTGGGTGGAAAAAGCC CTCTTGTC ATTTTTGGTGATGCTGATGTTGACAAGGCTGTGCAAATTT GCCATGAC GCA 7 ) Aldehyde reductase : Similar to Culex quinquefasciatus aldehyde reductase (E value 1.00 E 95) TGGCAAGGTTAAGTGGTAAT CATGTATTCTGTGAAGCTCA ACAACGGCAAGGACTT CCCTGTCCTGGGAGTAGGCA CTCTCTTCGCAACAAAGGCA GGAGAAGCGGAACAA CTGGTGAAAGATGCCATTGACATTGGATACCGTCACATTG ATACAGCTATGATATAT AGAAATGAAAATGAAGTTGG AGCCGGAATCAGAGCTAAGATAGCAGAAGGAGTTG TCAAGAGAGAAGACATTTTT CTAACTAGCAAGTTATGGTG CACATTTCATAAGCGG GAGATGGTGGTGGACGCTTGCAAGCAGACACTAAAAGATC ATGGTCTCGACTATC TGGACCTTTATCTTATCCAT TGGCCAAA TTCTTTTAAGGAAGGAGGTG ACCTTTGGC CAAAAGACTCAAATGGAAAAGTTCTGGTAACAGATGAAGACTATGTGGATACATGG AAAGGAATGGAAGAATGTGT GAAGCTGGGACTTACCAAAAGCATTGGTATCTCAAA TTTCAATTCACATCAAATTA ACAGAGTTCTAGCAGCAGCC ACTATAAAACCAGTAGT GAATCAGATTGAAGTTCATC CATATTTTAACCAGTCCAAA TTGATTGCATTCTGCAA G GAAAAGGGTATAGTAGTAAC AGCCTACAGCCCTCTTGGAA GTCCAAATGCTATTG CTAAGGAAGACACGCCTGCA CCTTTGCAAGACCCCAAGTT ACAAGAACTTGCCAAA AAATACAAGAAGTCAGTTGC TCAGATTATTTTGCGGTATC TGATTCAACATGGGACA GTGCCAATTCCTAAGTCATC AAGCAAAAAGAGACTTCAGG AGAAACTTGACATTTTT GATTTTGAAATC

PAGE 185

185 8) Glucuronosylt ransferase: Similar to Nasonia vitripenis glucuronosyltransferase (E value 1.00 E 07) TTGGCATCGAGTGAATACATATTTCATCACATTCCGAAGAGGGCGCCACTGCGTAG ACTACTGCTATACACGAGGTCGAGCAATTAAACAAAGGCATATCTAGGTTGAAGTC AGACTACTGCCGCTGTGACGGCATTAATGAGGATGAAGCACTTCCACATCATATTG A CGGGACTATTAATTACTATGTCTTGCGTAGACCACATGGACAGTTACAAGATTCTT GGACTGGTGCACTTAAATTCTAGGAGTCATTTCGTAATGTTTGAAGCCTTGTTTAAA GGACTTGCTGCAAAGGGCCATGAAGTTTATGTAATCAGTCATTTCCCACAAAAGGA GCAAATTCCAAATTACAAGGACATTAGCTTAGCAGGCTCGGTACCTCTTTCAGTAA ACAATTTTACTATGGATTTTGTTAAAGACTTTGGGTATTTTAACCTCTTAGACTATTT GTGGCATAACATAGTGGATATGTGTGATAAGTCTTTGGGCCATCCTTCATTTCAGAA GTTATTATCAAGCAACGATAAATTTGATCTTATCATTACTGAGATAGTAAGTCCAGA CTGTTTTTTATTTCTAACACAAAAATTTAACGCTCCAGCAATAAGCATGACAACTAGT

PAGE 186

186 Table C 1. List of biotransformation g enes identified from the EST library Sr.No. Gene name Number of ESTs representing the gene 1 Esterase 1 2 CYP6AM2 1 3 CYP6J2 1 4 CYP357C1 1 5 Epoxide hydrolase 1 6 Aldehyde dehydrogenase 1 7 Aldehyde reductase 1 8 Glucuronosyltransferase 1

PAGE 187

187 Figure C 1. Summary of German cockroach midgut and fat body expressed sequence tag (EST) library sequencing. (A) Table showing sequencing results and BLASTx analysis details. Only 51% of the high quality reads (> 200 bp) yielded a significant hit (E value < 105) using BLASTx. (B) Pie chart showing the percent distribution of ESTs with significant BLASTx database hits. The distribution is based in gene function / localization. A large number of ribosomal and mitochondrial genes were obtained as the library was not normalized to limit housekeeping genes. Only 8 of the 169 EST clones encoded for insecticide biotransformation genes.

PAGE 188

188 A PPENDIX D RELATIVE EXPRESSION OF BIOTRANSFORMATION GENES IN CARCASS AND GUT TISSUES This experiment was conducted to determine the expression of biotransformation genes identified in Appendix C in carcass and gut tissues of adult male German cockroaches. Quantitative real time polymerase chain reaction (qRT PCR) was used to estimate the expression of different genes in different tissues and strains. The hypothesis tested here was that biotransformation genes would show higher expression in gut tissue as compared to the carcass. Materials and Methods Cockroach Strains and Rearing The susceptible Joh nson Wax S usceptible (JWax S ) and the Gainesville Resistant strain ( GNV R ) were used in this study Total RNA isolated form a dult males (1to 2 week old) was used in all experiments conducted here. Rearing was performed in reachin environmental chambers as d escribed previously ( Gondhalekar et al. 2011). Primer Design and Validation Q uanti tative real time PCR (qRT PCR) primers for biotransformation (target) and reference genes were designed as described by Scharf et al. (2008) and by using the Primer 3 sof tware. The list of qRT PCR primers for target and refe rence genes is given in Table D 1. Primers were designed to provide products of 180 30 basepairs (bp), GC content of 45 to 55% and annealing temperatures ( Tm values ) in the range of 5 9 to 61C. The amplification of desired genespecific products and absence of primer dimers was confirmed by performing standard PCR reactions. cDNA synthesized from wholebody RNA of JWax S and GNV R strains was used as a template for PCR. Each 20 L

PAGE 189

189 PCR reaction contai ned 10 L SybrGreen PCR Master Mix (2x SensiMix Sybr and Flourescein Kit, Quantace, Norwood, MA), forward and reverse primers (0.5 M final concentration), 7 L nuclease free water and 1 L cDNA. Temperature cycles for PCR amplification were as follows: 94oC for 5 min followed by 35 cycles of 94oC for 30 sec, 60oC for 30 sec, and 72oC for 30 sec followed by a final extension step at 72oC for 10 min. The resulting PCR products were visualized on a 2% agarose gel. Dissections, Nucleic Acid Isolation and Synthesis Decapitated a dult males of the JWax S and GNV R strain were used Under a microscope, ventral portion of the abdomen was cut open with a pair of fine scissors and the gut was gently pulled out of the insect body in its entirety using forceps. The ca rcass ( head, gut) and gut tissues were immediately transferred to icecold RNA lysis buffer (Promega, Milwaukee, WI). For each strain ten dissections were performed followed by RNA isolations using the SV total RNA isolation kit ( Promega, Madison, WI) T he quality of RNA was visualized on a 1% agarose gel and then cDNA was synthesized using the iScriptTM cDNA synthesis kit ( Bio R ad, Hercules, CA). Each cDNA reaction contained 100 ng of total RNA. The dissections, RNA isolations and cDNA synthesis were repeated three times for each strain. Quantitative Real Time PCR (q RT PCR) Quantitative real time PCR (qRT PCR) was performed using an iCycler iQ real time PCR detection system (BioRad Hercules, CA ) with SybrGreen product tagging (2x SensiMix Sybr and Flour escein Kit; Quantace, Norwood, MA). Each 20 L qRT PCR reaction in a 96well format consisted of 10 L SybrGreen, 7 L nanopure water, 1L each of forward and reverse primer (0.5 M final concentration) and 1 L cDNA as template. The qPCR temperature progr am described by Scharf et al. (2008) was

PAGE 190

190 followed. The program consisted of an initial denaturing step at 95C for 10 min, followed by 45 cycles of 9 4C for 30 min, 60C for 30 sec and 72C for 30 sec, an ex tension step at 72C for 10 min and a final melting curve step (90 cycles of temperature reduction from 90C to 50C at a rate of 0.5C per 10 sec). Three technical qRT PCR replicates were performed for each gene and cDNA preparation (three independent cDNA preparations were made for each strain). The qP CR data were analyzed by the 2method (Livak and Schmittgen 2001). The reference gene, eta actin (accession no. AY004248) that showed most stable expression across different treatments was used for normalization of CT (critical threshold) values of target genes. First, the CT values of the target genes w ere normalized to the average CT value for the reference gene, eta actin ( actin) to obtain values. The values for each target gene of were then normalized to the average value (of the respective target gene) of the tissue showing lowest expression (carcass for all the genes). The values obtained by this method were then converted to 2to obtain relative expression. Pair wise comparisons of the values for the carcass and gut tissues were performed using nonparametric MannWhitney U tests (P < 0.05). Results Primer validation tests revealed that all the qRT PCR primers amplified genespecific products of desired size and no nonspecific amplification products or primer dimers were detected (Figure D 1). In partial agreement with my hypothesis, four of the eight genes showed significantly higher expression in gut tissue, whereas the expression levels of the other four genes were similar between the carcass and gut tissues (Figure D 2). In both strains, the esterase, CYP6AM2 and aldehyde reductase

PAGE 191

191 genes showed ~ 10to 100fold up regulation in the gut tissue relative to the carcass. The aldehyde dehydrogenase gene showed highest magnitude of difference in expression i.e., 300 500 fold higher expression in the gut tissue of both the strains. The qRT PCR protocol and primers developed in this experiment can be used for comparing the expression levels of these genes in indoxacarbresistant and susceptible or selected and unsel ected strains (see Chapter 6).

PAGE 192

192 T able D 1. List of quantitative real time polymerase chain reaction (qRT PCR) primers for reference and target genes Genes Forward primer Reverse primer Target genes Esterase acatttcgaggccagaacac gcgctccaagtctgtagttga C YP6AM2 atgacaagcgagggacaaat ttgccctaataagtccaccaa CYP6J2 gtgaaagaggctacggcaaa ggtgccactaaagccaggta CYP357C1 tggcctcttggagttgttct ccggcgtatctatgtccttc Epoxide hydrolase ttcacctctcacaccaccaa gcagatcaagaccatccaca Aldehyde dehydrogenase gctttcaagattggctcac c tttgtcacaccaaccagcat Aldehyde reductase tgtgtgaagctgggacttacc caagagggctgtaggctgtt Glucuronosyltransferase tctttgcgtagaccacatgga ccgagcctgctaagctaatg Reference / Control genes Actin ( Accession No. AY004248) caactgggatgacatggaga gaagcgtagagggacagcac Ribosomal protein L13a agacccaagtcacgcaagat tggtttggcaacaacatcag

PAGE 193

193 Figure D 1. Representative 2% agarose gel showing polymerase chain reaction ( PCR) products of the eight biotransformation genes and two reference genes. The product size ranged between 150210 bp. Primers designed for quantitative real time PCR (qRT PCR) were used ( see Table D 1). Whole body cDNA synthesized from total RNA of adult males (JWax S and GNV R strains) was used as a template. Lanes (L) contain 1 kb DNA ladder. The numbered lanes were loaded as follows: (1) esterase, (2) CYP6AM2 (3) CYP6J2 (4) CYP 3571, (5) epoxide hydrolase (6) aldehyde dehydrogenase, (7) aldehyde reductase, (8) glucuronosyltransferase, (9) actin and (10) ribosomal protein L13a. In lanes with negative sign in parenthesis ( ) control PCR reactions conducted without cDNA template were loaded.

PAGE 194

194 Figure D 2. Relative expression of the eight biotransformation genes in the carcass and gut tissues of adult males cockroaches of the GNV R and JWax S strains. eta actin values were normalized to the carcass tissue to obtain absolute expression ) to determine relative expression (Livak and Schmittgen 2001). Genes that are upregulated in gut tissue in comparison to carcass tissue are shown by dark grey colored boxes. Within gene and strain boxes connected by same letters are not significantly different (MannWhitney U tests, P < 0.05).

PAGE 195

195 LIST OF REFE RENCES Abbott, W. S. 1925. A method of computing the effectiveness of an insecticide. J. Econ. Entomol. 18: 265 267. Alves, A. P., W. J. Allgeier, and B. D. Siegfried. 2008. Effects of the synergist S,S,S tributyl phosphorotrithioate on indoxacarb toxicity and metabolism in the E uropean corn borer, Ostrinia nubilalis (Hubner). Pestic. Biochem. Physiol. 90: 26 30. Appel, A. G. 1995. Bla t tella and related species, pp. 1 19. In M. K. Rust, J. M. Owens, and D. A. Reierson (eds.), Understanding and controlling t he German cockroach. Ox ford University Press, New York, NY, USA. Appel, A. G., and M. J. Tanley. 2000. Laborato ry and field performance of an i midacloprid gel bait against German cockroaches (Dictyoptera: Blattellidae). J. Econ. Entomol. 93: 112 118. Appel A. G. 2003. Laborator y and field performance of an i ndoxacarb bait against German cockroaches (Dictyoptera: Blattellidae). J. Econ. Entomol. 96: 863 870. Appel, A. G., B. N. Dingha, L. Chen, and H. Y. Fadamiro. 2005. Physiological factors related to bait aversion in the German cockroach (Dict yoptera: Blattellidae), pp. 409 416. In C. Y. Lee and W. H. Robinson (eds.), Proceedings of the fifth international c onference on urban pests, 10 1 3 July 2005, Suntec, Singapore, P&Y Design Network, Penang, Malaysia. [APRD] Arthropod Pesticide Resistance Database. 2011 www.pesticideresistance.org Arbes S. J. Jr., M. Sever, J. Archer, E. H. Long, J. C. Gore, R. G. Santangelo, B. Vaughan, H. Mitchell, C. Schal, and D. C. Zeldin. 2003. Abatement of cockroach allergen (Bla g 1) in low income, urban housing: a randomized controlled trial. J. Allergy Clin. Immunol 112: 339 345. Arbes, S. J., M. Sever, J. Meht a, J. C. Gore, C. Schal, B. Vaughn, H. Mitchell, and D. C. Zeldin. 2004. Abatement of cockroach allergens (Bla g 1 and Bla g 2) in low income, urban housing: month 12 continuation results. J. Allergy Clin. Immunol. 113: 109 114. Artyukhina, I. N. 1972. Met hods of registration and criteria for evaluating the population density of cockroaches ( Bla t tella germanica L.). Med. Parazitol. Parazit. Bolezn. 41: 472 477. Ash, N., and B. Greenberg. 1980. Vector potential of the German cockroach (Dictyoptera: Blattelli dae) in dissemination of Salmonella enteriditis serotype typhimurium J. Med. Entomol. 17: 417 423.

PAGE 196

196 Bass, C., and L. M. Field. 2011. Gene amplification and insecticide resistance. Pest Manag. Sci. (in press). Bautista, M. A. M., T. Miyata, K Miura and T. Tanaka. 2009. RNA interference mediated knockdown of a cytochrome P450, CYP6BG1, from the diamondback moth, Plutella xylostella reduces larval resistance to permethrin. Insect Biochem. Mol Biol. 39: 38 46. Bennett, G. W., and W. T. Spink. 1968 Insectici de resistance of German cockroaches from various areas of Louisiana. J. Econ. Entomol. 61: 426 431. Bieman, D. N., and C. W. Scherer. 2007. Dethroning Roaches. Pest Contr Tech. 79: 76 78. Black, B. C., R. M. Hollingworth, K. I. Ahammadsahib, C. D. Kukel, a nd S.Donovan. 1994. Insecticidal action and mitochondrial uncoupling activity of AC 303,630 and rehalogenated pyroles. Pestic. Biochem. Physiol. 50: 115 128. Bloomquist, J. R., R. H. ffrench Constant, and R. T. Roush. 1991. Excitation of central neurons by dieldrin and picrotoxinin in insecticide susceptible and resistant Drosophila melanogaster Pestic. Sci. 32: 463 469. Bloomquist, J. R., R. T. Roush, and R. H. ffrenchConstant. 1992. Reduced neuronal sensitivity to dieldrin and picrotoxinin in a cyclodieneresistant strain of Drosophila melanogaster Arch. Insect. Biochem. Phys. 19: 17 25. Bostanian, N. J., C. Vincent, J. M. Hardman and N. Larocque. 2004. Toxic effects of indoxacarb to a predacious mirid and two species of predacious mites. Bulletin OILB /SROP 27: 31 35. Brenner, R. J. 1995. Economics and medical importance of German cockroaches, pp. 77 108. In M. K. Rust, J. M. Owens, and D. A. Reierson [eds.], Understanding and controlling the German cockroach. Ox ford University Press, New York, NY, USA Brent, K. J. 1986. Detection and monitoring of resistant forms: an overview, pp 298 312. In National Academy of Sciences (eds.), Pesticide resistance: strategies and tactics for management. National Academy Press, Washington DC, USA. B uczkowski, G., R. J Kopanic, and C. Schal. 2001. Transfer of ingested insecticides among cockroaches: effects of acti ve ingredient, bait formulation and assay procedures. J. Econ. Entomol. 94: 1229 1236. Buczkowski, G., and C. Schal. 2001. Emetophagy: fipronil induced regur gitation of bait and its dissemination from German cockroach adults to nymphs. Pestic. Biochem Physiol. 71: 147 155.

PAGE 197

197 Buczkowski G., C. W. Scherer, and G. W. Bennett. 2008. Horizontal transfer of bait in the German cockroach: Indoxacarb causes secondary and tertiary mortality. J. Econ. Entomol. 101: 894 901. Bull, D. L., and R. S. Patterson.1993. Characterization of pyrethroid resistance in a strain of the German cockroach. J. Econ. Entomol. 86: 20 25. Chai, R. Y., and C. Y. Lee. 2010. Insecticide resistance profiles and synergism in field populations of the German cockroach from Singapore. J. Econ. Entomol. 103: 460 471. Cheng, T. H., and F.L. Campbell. 1940. Toxicity of phosphorous to cockroaches. J. Econ. Entomol. 33: 193 199. Cochran, D. G., J. M. Grayson and M. Levitan. 1952. Chromosomal and cytoplasmic factors in transmission of DDT resistance in the German cockroach. J. Econ. Entomol. 45: 997 1001. Cochran, D. G. 1989. Monitoring for insecticide resistance in fieldcollected strains of the German cockr oach (Dictyoptera: Blattellidae). J. Econ. Entomol. 82: 336341. Cochran, D. G. 1994. Abamectin resistance potential in the German cockroach (Dictyoptera: Blattellidae). J. Econ. Entomol. 87: 899 903. Cochran, D. G. 1995. Insecticide resistance, pp. 171 19 2. In M. K. Rust, J. M. Owens, and D. A. Reierson (eds.), Understanding and controlling the German cockroach. Oxford University Press, New York NY, USA Cole, L. M., R. A. Nicholson, and J. E. Casida. 1993. Action of phenylpyrazole insecticides at the GAB A gated chloride channel. Pestic. Biochem. Physiol. 46: 47 54. Cole, L. M., R. T. Roush, and J. E. Casida. 1995. Drosophila GABA gated chloride channel: modified [3H]EBOB binding site associated wi mutants of Rdl subunit. Life Sci. 56: 756 767. Daborn, P., C. McCart, D. Woods, and R. H. ffrenchConstant. 2004. Detection of insecticide resistanceassociated mutations in cat flea Rdl by Taq Manallele specific amplification. Pestic. Biochem. Physiol. 79: 25 30. Deng, Y., C. J. Palmer, and J. E. Casida. 1993. House fly head GABA gated chloride channel: four putative insecticide binding sites differentiated by [3H]EBOB and [35S] TBPS. Pestic. Biochem. Physiol. 47: 98 112. Dennehy, T.J., E. E. Grafton Cardwell, J. Granett, and K. Barbour. 1983. Relevance of slide dip and residual bioassay comparisons to detection of resistance to spider mites. J. Econ. Entomol. 76: 1225 1230.

PAGE 198

198 Dong, K. 1997. A Single amino acid change in the para sodium cha nnel proteins associated with knock downresistance to pyrethroid insecticides in the German cockroach. Insect. Biochem. Mol Biol. 27: 93 100. Dong, K., S. M. Valles, M E. Scharf, B. Zeichner and G. W. Bennett.1998. Knockdown resistance (kdr) mutation i n pyrethroidresistant German cockroaches. Pestic. Biochem. Physiol. 60: 195 204. Dong, K. 2007. Insect sodium channels and insecticide resistance. Invert Neurosci. 7: 17 30. Durham, E. W., M. E. Scharf, and B. D. Siegfried. 2001. Toxicity and neurophysiological effects of fipronil and its oxidative sulfone metabolite on E uropean corn borer larvae (Lepidoptera: Crambidae). Pestic. Biochem. Physiol. 71: 97 106. Durham, E. W., B. D. Siegfried, and M. E. Scharf. 2002. In vivo and in vitro metabolism of fipronil by larvae of the E uropean corn borer Ostrinia nubilalis Pest Manag. Sci. 58: 799 804. Falconer, D. S. 1989. An introduction to quantitative genetics. Wiley, London, UK. Fan Y., J. C. Gore, K. O. Redding, L. D. Vailes, M. D. Chapman and, C. Schal. 2005. Tissue localization and regulation by juvenile hormone of hum an allergen Bla g 4 from the German cockroach, Blattella germanica (L.). Insect Biochem. Mol Biol. 14: 45 53. ffrench Constant, R. H., and R. T. Roush. 1990. Resistance detection and documentation: relative roles of pesticidal and biochemical assays, pp. 4 38. In R. T. Roush and B. E. Tabash n i k (eds.), Pesticide Resistance in Arthropods Chapman and Hall, New York, NY, USA. Fisk, F. W., and J. A. Isert. 1953. Comparative toxicities of certain organic insecticides to resistant and nonresistant strains of the German cockroach, Blattella germanica L. J. Econ. Entomol. 46: 1059 1062. Frishman, A. 1982. Cockroaches, pp 101 154. In: A.Mallis (eds.), Handbook of pest control. 6th ed. Franzak and Foster, Cleveland, OH, USA. Gahlhoff, J. E. Jr., D. M. Miller, and P. G. Koehler. 1999. Secondary kill of adult male German cockroaches (Dictyoptera: Blattellidae) via cannibalism of nymphs fed toxic baits. J. Econ. Entomol. 92: 1133 1137. Gant, D. B., A. E. Ch almers, M. A. Wolff, H. B. Hoffman and D. F.Bushey. 1998. Fipronil: action at the GABA receptor, pp. 147 156. In R. J. Kuhr and N. Motoyama (eds.) Pesticide and the future: minimizing chronic exposure of the humans and the environment. IOS press, Amsterd am, Netherlands.

PAGE 199

199 Georghiou, G. P., and A. Lagunes Tejeda 1991. The occurrence of resistance to pesticides in arthropods. FAO of the United Nations, Rome Italy. Gondhalekar, A. D., C. Song, and M. E. Scharf. 2011. Development of strategies for monitoring indoxacarb and gel bait susceptibility in the German cockroach (Blattodea: Blattellidae). Pest Manag. Sci. 67: 262 270. Gore J. C., and C. Schal. 2005. Expression, production and excretion of Bla g 1, a major human allergen, in relation to food intake in t he German cockroach, Blattella germanica. Med. Vet. Entomol. 19: 127 134. Gore, J. C., and C. Schal. 2007. Cockroach allergen biology and mitigation in the indoor environment. Annu. Rev. Entomol. 52: 439 463. Grayson, J. M. 195 1 Response of the German coc kro ach to sublethal concentrations of DDT and benzene hexachloride. J. Econ. Entomol. 44: 315 317. Grayson, J. M. 1953. Effects on the German cockroach of twelve generations of selection for survival to treatments with DDT and benzene hexachloride. J. Eco n. Entomol. 46: 124 127. Guengerich, F. P. 1987. Oxidative cleavage of carboxylic esters by cytochrome P 450. J. Biol. Chem. 262: 8459 8462. Guengerich, F. P., L. A. Peterson, and R. H. Bcker. 1988. Cytochrome P 450 catalyzed hydroxylation and carboxylic acid ester cleavage of Hantzsch pyridine ester. J. Biol. Chem. 263: 8176 8183. Guengerich, F. P. 2001. Common and uncommon cytochrome P450 reactions related to metabolism and chemical toxicity. Chem. Res. Toxicol. 14: 611 650. Hainzl, D., L. M. Cole, and J E. Casida. 1998. Mechanisms for selective toxicity of fipronil insecticide and its sulfone metabolite and desulfinyl photoproduct. Chem. Res.Toxicol. 11: 1529 1535. Hansen, K. K., M. Kristensen and K. M. V. Jensen. 2005. Correlation of a resistance asso ciated Rdl mutation in the German cockroach, Blat t ella germanica (L.), with persistent dieldrin resistance in two Danish field populations. Pest Manag. Sci. 61: 749 753. Harbison, B., R. Kramer, and J. Dorsch. 2003. Stayin Alive. Pest Contr. Tech. 83: 24 29. Hardstone, M. C., and J. G. Scott. 2010. A review of the interactions between insecticide resistance loci. Pestic. Biochem. Physiol. 97: 123 128. Heal, R. E., K. B. Nash, and M. Williams. 1953. An insecticide resistant strain of the German cockroach fr om Corpus Christi, Texas. J. Econ. Entomol. 46: 385 386.

PAGE 200

200 Hemingway, J., G. J. Small, and A. G. Monro. 1993. Possible mechanisms of organophosphorous and carbamate insecticide resistance in the German cockroach (Dictyoptera: Blattellidae) from different geographical areas. J Econ Entomol. 86: 1623 1630. Holbrook, G. L., J. Roebuck, C. B. Moore, M. G. Waldvogel and C. Schal. 2003. Origin and extent of resistance to fipronil in the German cockroach, Blattella germanica (L.) (Dictyoptera: Blattellidae). J Ec on. Entomol. 96: 1548 1558. Hollingshaus, J. G. 1987. Inhibition of mitochondrial electron transport by hydramethylnon: a new amidinohydrazone insecticide. Pestic. Biochem. Physiol. 27: 61 70. Hosie, A. M., H. A. Baylis, S. D. Buckingham and D. B. Sattell e. 1995. Actions of the insecticide fipronil, on dieldrinsensitive and resistant GABA receptors of Drosophila melanogaster Brit. J. Pharmacol. 115: 909 912. How, Y. F., and C. Y. Lee. 2011. Surface contact toxicity and synergism of several insecticides against different stages of the tropical bed bug, Cimex hemipterus (Hemiptera: Cimicidae). Pest Manag. Sci. 67: 734 740. [IOM] Institute of Medicine. 2000. Clearing the air: asthma and indoor air exposures. National A cademy Press, Washington DC, USA. Jeong, K. Y., K. J. Jeong, M. H. Yi, H Lee, C. S. Hong and, T. S. Yong. 2009. Allergenicity of sigma and delta class glutathione transferases from the German cockroach. Int. Arch. Allergy Immunol. 148: 59 64. Kaakeh, W., B. L. Reid, T. J. Bohnert, and G. W. Be nnett. 1997. Toxicity of fipronil in the German cockroach (Dictyoptera: Blattellidae), and the synergism between imdiacloprid and Metarhizium anisopliae (Imperfect fungi: Hyphomycetes). J. Econ. Entomol. 90: 473 482. Karunaratne, S. H. P. P., and J. Heming way. 1996. Different insecticides select multiple carboxylesterase isozymes and different resistance levels from a single population of Culex quinquefasciatus Pestic. Biochem. Physiol. 54: 4 11. Khot, A. C., G. Bingham, L. M. Field, and G. D. Moores. 2008 A novel assay reveals the blockade of esterases by piperonyl butoxide. Pest Manag. Sci. 64: 1139 1142. Koehler, P. G., and R. S. Patterson. 1986. A comparison of insecticide susceptibility in seven nonresistant strains of the German cockroach, Bla t tella germanica (Dictyoptera: Blattellidae). J. Econ. Entomol. 23: 298 299. Koehler, P. G., and R. S. Patterson. 1989. Effects of chitin synthesis inhibitors on German cockroach (Dictyoptera: Blattellidae) mortality and reproduction J. Econ. Entomol. 84: 229 237.

PAGE 201

201 Koehler, P. G., C. A. Strong, R. S. Patterson and S. M. Valles. 1993. Differential susceptibility of German cockroach (Dictyoptera: Blattellidae ) sexes and nymphal age classes to insecticides. J. Econ. Entomol. 86: 785 792. Konno, T., E. Hodgson, and W C. Dauterman. 1989 Studies on methyl parathion resistance in Heliothis virescens Pestic. Biochem. Physiol. 33: 189 199. Kopanic, R. J., B. W. Sheldon, and G. G. Wright. 1994. Cockroaches as vectors of Salmonella: laboratory and field trials. J. Food Protect. 57 : 125 132. Kopanic, R. J., Jr., and C. Schal. 1997. Relative significance of direct ingestion and adult mediated translocation of bait to German cockroach nymphs (Dictyoptera: Bl attellidae). J. Econ. Entomol. 90: 1073 1079. Kopanic, R. J., Jr., and C. Schal. 1999. Coprophagy facilitates horizontal transmission of bait among cockroaches (Dictyoptera: Blattellidae). Environ. Entomol. 28: 431 438 Kristensen, M., K. K. Hansen, and K. M. V. Jensen. 2005. Cross resistance between dieldrin and fipronil in the German cockroach. J. Econ. Entomol. 98: 1305 1310 Lapied, B., F. Grolleau and D. B. Sattelle. 2001. Indoxacarb, an oxadiazine insecticide, blocks insect neuronal sodium channels. Br. J. Pharmacol. 132: 587 5 95. Lee, H. R., J. W. Kim, J. R. Bang, and K. S. Choi. 1994. Studies on the selections, crossresistance and the esterase activity in the strain of German cockroach selected with dichlorvos. Korean J. Appl. Entomol. 33: 74 80. Le Goff, G., A. Hamon, J. B. Berge and M. Amichot. 2005. Resistance to fipronil in Drosophila simulans : influence of two point mutations in RDL GABA receptor subunit. J. Neurochem. 92: 1295 1305. Li, A., Y. Yang, S. Wu, C. Li, and Y. Wu. 2006. Investigation of resistance mechanisms to fipronil in diamondback moth (Lepidoptera: Plutellidae). J. Econ. Entomol. 99: 914 919. Li, X., Q. Huang, J. Yuan, and Z. Tang. 2007. Fipronil resistance mechanisms in the rice stem borer, Chilo suppressalis Walker. Pestic. Biochem. Physiol. 89: 169 174. Li, X., M. A. Schuler, and M. R. Berenbaum 2007. Molecular mechanisms of metabolic resistance to synthetic and natural xenobiotics. Annu. Rev. Entomol. 52: 231 253. Liu, Z., S. M. Valles and K. Dong. 2000. Novel point mutations in the German cockroach para sodium channel gene are associated with knockdown resistance ( kdr ) to pyrethroid insecticides. Insect Biochem. Mol Biol. 30: 991 997.

PAGE 202

202 Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real time quantitative PCR and 2T method. Methods. 25: 402 408. McCann, S. A., G. D. Annis, R. Shapiro, D. W. Piotrowski, G. P. Lahm, J. K. Long, K. C. Lee, M. M. Hughes, B. J. Myers, S. M. Griswold, B. M. Reeves, R. W. March, P. L. Sharpe, P. Lowder, W E Barnette, and K. D. Wing. 2 001. The discovery of indoxacarb: ox adiazines as a new class of pyrazoline type insecticides. Pest Manag. Sci. 57: 153 64. Miller, D., and F. Meek. 2004. Cost and efficacy comparison of integrated pest management strategies with monthly spray insecticide applications for German cockroach (Dictyoptera: Blattellidae) control in public housing. J. Econ. Entomol. 97: 559 569. Milio, J. F., P. G. Koehler, and R. S. Patterson. 1986. Laboratory and field evaluations of hydramethylnon bait formulations for control of American and German cockroaches. J. Econ. Entomol. 79: 1280 1286. Nalyanya, G., J. C. Gore, H. M. Linker, and C. Schal. 2009. German cockroach allergen levels in North Carolina schools: comparison of integrated pest management and conventional cockroach control. J. Med. Entomol. 46: 420 427. Nehare, S., B. S. Ghodki, G. K. Lande, V. Pawade and A. S. Thakare. 2010. Inheritance of resistance and cross resistance pattern in indoxacarb resistant diamondback moth Plutella xylostella L Entomol Res. 40: 18 25 Oppenoorth, F. J. 1985 Biochemistry and genetics of insecticide resistance, pp. 731 774. In G. A. Kerkut and L. I. Gilbert (eds.), Comprehensive insect physiology, biochemistry and pharmacology. Pergamon press, Oxford, UK. Pollart, S. M., M D. Chapman, G. P. Fiocco, G. Rose and T. A. E. Platts Mills. 1989. Epidemiology of acute asthma: IgE antibodies to common inhalant allergens as a risk factor for emergency room visits. J. Allergy Clin. Immunol. 83 : 875 882. Prabhakaran, S. K., and S. T. Kamble. 1995. Purification and characterization of an esterase isozyme from insecticide resistant and susceptible strains of German cockroach, Blattella germanica (L.). Insect Biochem. Mol. Biol. 25: 519 524. Prestwich, G. D.1990. Proinsecticides: Metabolically activated toxicants, pp 281 335. In E. Hodgson and R. J. Kuhr (eds.), Safer insecticides : d evelopment and use. Marcel Dekker, New York NY, USA Pridgeon, J. W., A. G. Appel, W. J. Moar, and N. Liu. 2002. Variability of resistance mechanisms in pyrethroid resist ant German cockroaches (Dictyoptera: Blattellidae). Pestic. Biochem. Physiol. 73: 149 156.

PAGE 203

203 Pridgeon, J. W., L. Zhang, and N. Liu. 2003. Overexpression of CYP4G19 associated with a pyrethroidresistant strain of the German cockroach, Blat t ella germanica. In sect Biochem. Mol. Biol. 314: 157 163. [U.S. EPA] U.S. Environmental Protection Agency. 1996. Public law 104 170. http://www.epa.gov/pesticides/regulating/laws/fqpa/gpogate.pdf [ U.S. EPA] U.S. Environmental Protection Agency. 2000. Indoxacarb: pesticide f act sheet. http://www.epa.gov/opprd001/factsheets/indoxacarb.pdf Raymond, M., D. G. Heckel, and J. G. Scott. 19 89. Interactions between pesticide genes: model and experiment. Genetics. 123: 543 551. Reierson, D. A. 1995. Baits for German cockroach control, pp. 231 265. In M. K. Rust, J. M. Owens, and D. A. Reierson (eds.), Understanding and controlling the German c ockroach. Oxfo rd University Press, New York, NY, USA. Robertson, J. L., K. C. Smith, N. E. Savin, and R. L. Lavigne. 1984. E ffects of dose selection and sample size on the precision of lethal dose estimates in dosemortality regression. J Econ Entomol. 77: 833 837. Robertson, J. R., and H. K. Preisler. 1992. Pesticide bioassays with arthropods. CRC Press, Boca Raton, FL, USA. Rosenstreich, D., P. Eggleston, M. Kattan, D. Baker, R. Slavin, P. Gergn, H. Mitchell, K. McNiff Mortimer, H. Lynn, D. Ownloy, and F Malveaux. 1997. The role of cockroach allergy and exposure to cockroach allergen in causing morbidity among inner city children with asthma. N. Engl. J. Med. 336: 1356 1363. Roush, R. T., and G. L. Miller. 1986. Considerations for design of insecticide r esistance monitoring programs. J. Econ. Entomol. 79: 293 298. Roush, R. T., and J. A. McKenzie. 1987. Ecological genetics of insecticide and acaricide resistance. Annu. Rev. Entomol. 32: 361 380. Rust, M. K. 1995. Factors affecting control with insecticides, pp: 149 170. In M. K. Rust, J. M. Owens, and D. A. Reierson (eds.), Understanding and controlling the German cockroach. Ox ford University Press, New York, NY, USA. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Concentrating nucleic acids: precipit ation with ethanol or isopropanol, pp E.10 E11. In J. E. Sambrook, E. F. Fritsch, and T. Maniatis (eds.), Molecular cloning: a laboratory manual, Vol. 3. Cold Spring Harbor Press, New York NY, USA. Sayyed, A. H., and D. J. Wright. 2006. Genetics and evidence for an esteraseassociated mechanism of resistance to indoxacarb in a field population of diamondback moth (Lepidoptera: Plutellidae). Pest Manag. Sci. 62: 1045 1051.

PAGE 204

204 Sayyed, A. H., M. Ahmed and M. A. Saleem. 2008a. Cross resistance and genetics of re sistance to i ndoxacarb in Spodoptera litura (Lepidoptera: Noctuidae). J. Econ. Entomol. 101: 472 479. Sayyed, A. H., M. Ahmed, and N. Crickmore. 2008b. Fitness costs limit the development of resistance to indoxacarb and deltamethrin in Heliothis virescens (Lepidoptera: Noctuidae). J. Econ. Entomol. 101: 1927 1933. Schal, C., and R. Hamilton. 1990. Integrated suppression of synanthropic cockroaches. Annu. Rev. Entomol. 35: 521 551. Schal, C. 1992 Sulfluramid resistance and vapor toxicity in fieldcollected German cockroaches (Dictyoptera: Blattellidae). J. Med. Entomol. 29: 207 215. Scharf, M. E., G. W. Bennett, B. L. Reid and C. Qiu. 1995. Comparisons of three insecticide resistance detection methods for the German cockroach. J. Econ. Entomol. 88: 536. Sch arf, M. E., and G. W. Bennett. 1995. Cockroach resistance IPM: a com mon sense approach. Pest Contr. Magazine. July: 38 41. Scharf, M. E., W. Kaakeh, and G. W. Bennett. 1997. Changes in an insecticide resistant fieldpopulation of German cockroach following exposure to an insecticide mixture. J Econ Entomol. 90: 38 48. Scharf, M. E., J. J. Neal, C. B. Marcus, and G. W. Bennett. 1998a Cytochrome P450 purification and immunological detection in an insecticide resistant strain of German cockroach. Insect Bio chem. Mol. Biol. 28: 1 9. Scharf, M. E., J. J. Neal, and G. W. Bennett. 1998b. Changes of insecticide resistance levels and detoxication enzymes following insecticide selection in the German Cockroach, Blattella germanica (L.). Pestic. Biochem. Physiol. 59: 67 79. Scharf, M. E., and B. D. Siegfried. 1999a. Toxicity and neurophysiological effects of f ipronil and fipronil s ulfone on the w estern corn rootworm (Coleoptera: Chrysomelidae). Arch. Insect Biochem. Physiol. 40: 150 156. Scharf, M. E., L. M. Meinke, R. J. Wright, L. D. Chandler, and B. D. Siegfried. 1999b. Metabolism of carbaryl by insecticideresistant and susceptible western corn rootworm populations (Coleoptera: Chrysomelidae). Pestic. Biochem. Physiol. 63: 85 96. Scharf, M. E., B. D. Siegfried, L J. Meinke, and L. D. Chandler. 2000. Fipronil metabolism, oxidative sulfone formation and toxicity among organophosphateand carba mate resistant and susceptible w estern corn root worm populations. Pest Manag. Sci. 56: 757 766.

PAGE 205

205 Scharf, M. E. 2008. Neurol ogical effects of insecticides and the insect nervous system, pp. 2596 2607. In J. L. Capinera (eds.), Encyclopedia of Entomology. Springer, New York, NY, USA. Scharf, M.E. X. Zhou, and M.A. Schwinghammer. 2008. Application of RNA interference in function al genomics studies of a social insect, pp. 205 229. In S. Barik (eds.), Methods in Molecular Biology, vol. 442: siRNA, shRNA and miRNA protocols. Humana Press, Totowa, NJ, USA Scott, J. G., and F. Matsumura. 1981. Characteristics of a DDT induced case of crossresistance to permethrin in Blattella germanica. Pestic. Biochem. Physiol.16: 21 27. Scott, J. G., S. B. Ramaswammy, F. Matsumura and K. Tanaka. 1986. Effect of method of application on resistance to pyrethroid insecticides in Bla t tella germanica ( Orthoptera: Blattellidae). J. Econ. Entomol. 79: 571 575. Scott, J. G. 1990. Investigating mechanisms of insecticide resistance: methods, strategies and pitfalls, pp. 4 38. I n R. T. Roush and B. E. Tabashni k (eds.), Pesticide Resistance in Arthropods Chap man and Hall, New York, NY, USA. Scott, J.G., and Z. Wen. 1997. Toxicity of fipronil to susceptible and resistant strains of German cockroaches (Dictyoptera: Blattellidae) and house flies (Diptera: Muscidae). J Econ Entomol 90: 1152 1156. Scott, M. T., 2 000. Comparative degradation and metabolism of indoxacarb, an oxadiazine insecticide. In Book of abstracts 219th ACS national meeting 26 30 March 2000, San Francisco, CA. American Chemical Society, Was hington DC, USA. Shono, T., L. Zhang and J. G. Scott. 2004. Indoxacarb resistance in the house fly, Musca domestica. Pestic. Biochem. Physiol. 80: 106 112. Siegfried, B. D., J. G. Scott, R. T. Roush, and B. C. Zeichner. 1990. Biochemistry and genetics of chlorpyrifos resistance in the German cockroach, Blatt ella germanica (L.). Pestic. Biochem. Physiol. 38: 110 121. Siegfried, B. D., and J. G. Scott. 1992. Insecticide resistance mechanisms in the German cockroach Bla t tella germanica (L.), pp. 218 230. In C. A. Mullin and J. G. Scott (eds.), Molecular mechanis ms of insecticide resistance. American Chemical Society, Washington DC, USA. Silverman, J., and D.N. Bieman. 1993. Glucose aversion in the German cockroach, Blattella germanica. J.Insect Physiol. 39: 925 933. Silv er K. S., and D. M. Soderlund. 2005. State dependent block of rat Nav1.4 sodium channels expressed in Xenopus oocytes by pyrazolinelike insecticides. Neurotoxicol 26: 397 405.

PAGE 206

206 Soderlund, D. 2005. Sodium channels, pp. 1 24. In L. I. Gilbert, K. latrou and S. S. Gill (eds.), Comprehensive i nsect science: pharmacology, Vol 5. Elsevier, Amsterdam, Netherlands. Song, W., Z. Liu, and K. Dong. 2006. Molecular basis of differential sensitivity of insect sodium channels to DCJW, a bioactive metabolite of the oxadiazine insecticide indoxacarb. Neurotoxicol. 27: 237 244. Song, C., and M. E. Scharf. 2008. Neurological disruption by low molecular weight compounds from the heterobycyclic and formate ester classes. Pestic. Biochem. Physiol. 92: 92 100. Staetz, C. A. 1985. Susceptibility of Heliothis virescens (F. ) (Lepidoptera: Noctuidae) to permethrin from across the cotton belt; a five year study. J Econ. Entomol. 78: 505 510. Sun, Y. P., and E. R. Johnson. 1972. Quasi synergism and penetration of insecticides. J. Econ. Entomol. 65: 349 353. Tabashnik, B. E., an d R. T. Roush. 1990 Introduction, pp. 1 3 I n R. T. Roush and B. E. Tabashni k (eds.), Pesticide Resistance in Arthropods Chapman and Hall, New York, NY, USA. Tabashnik, B. E. 1992. Resistance risk assessment: realized heritability of resistance to Bacillus thuringenesis in d iamondback mo th (Lepidoptera: Plutellidae), t obacco b udworm (Lepidoptera: Noctuidae) and colorado potato beetle (Coleoptera: Chrysonmelidae). J. Econ. Entomol. 85: 1551 1559. Tomalski, M ., W. Leimkuehler, C. Schal, and E. L. Vargo. 201 0. Metabolism of imidacloprid in workers of Reticulitermes flavipes Ann. Entomol. Soc. Am. 103: 84 95. Tsurubuchi, Y., A. Karasawa, A. Nagata, T. Shono, and Y. Konno. 2001. Insecticidal activity of oxadiazine insecticide indoxacarb and its N decarbomethox ylated metabolite and their modulations of voltagegated Na+ channels. Appl. Entomol. Zool. 36: 381 385. Valles, S. M., and S. J. Yu. 1996. Detection and biochemical characterization of insecticide resistance in the German cockroach. J. Econ. Entomol. 89: 21 26. Valles, S. M., S. J. Yu and P G Koehler. 1996. Biochemical characterization of mechanisms responsible for stage dependent propoxur tolerance in the German cockroach. Pestic. Biochem. Physiol. 54: 172 180. Valles, S. M., P. G. Koehler, and R. J. Br enner. 1997. Antagonism of fipronil toxici ty by piperonyl butoxide and S,S, S tributyl phosphorotrithioate in the German cockroach (Dictyoptera: Blattellidae). J. Econ. Entomol. 90: 1254 1258.

PAGE 207

207 Valles, S. M. 1998. Toxicological and biochemical studies with f ield populations of the German cockroach, Blattella germanica. Pestic. Biochem. Physiol. 62: 190 200. Valles, S. M., and R. J. Brenner. 1999. Variation in hydramethylnon susceptibility among insecticide resistant German cockroaches (Dictyoptera: Blattellidae). J Econ Entomol. 92: 617 623. Valles, S. M., O. P. Perera, and C. A. Strong. 2003. Relationship between the para knockdown resistance in the German cockroach using multiplex polymerase chain reaction to discern genotype. J Econ Entomol. 96: 885 891. Wang, C., M. E. Scharf, and G. W. Bennett. 2004. Behavioral and physiological resistance of the German cockroach to gel baits (Blattodea: Blattellidae). J. Econ. Entomol. 97: 2067 2072. Wang, C., M. E. Scharf, and G. W. Bennett. 2006. Genetic basis for resistance to gel baits, fipronil and sugar based attractants in German cockroaches (Dictyoptera: Blattellidae). J. Econ. Entomol. 99: 1761 1767. Wei, Y., A. G. Appel, W. J. Moar, and N. L iu. 2001. Pyrethroid resistance and cross resistance in the German cockroach, Blattella germanica (L). Pest Manag Sci. 57: 1055 1059. Wen, Z., and J. G. Scott. 1999. Genetic and biochemical mechanisms limiting fipronil toxicity in the LPR strain of house fly, Musca domestica. Pestic. Sci. 55: 988 992. Wheeler, M. M., M. R. Tarver, M. R. Coy, and M. E. Scharf. 2009. Characterization of four esterase genes and esterase activity from the gut of the termite Reticulitermes flavipes Arch. Insect. Biochem Physiol. 73: 30 48. Wing, K. D., M. E. Schnee, M. Sacher, and M. Connair. 1998. A novel oxadiazine insecticide is bioactivated in lepidopteran larvae. Arch. Insect Biochem. Physiol. 37: 91 103. Wing, K. D., M. Sacher, Y. Kagaya, Y. Tsurubuchi, L. Mulderig, M. `C onnair, and M. Schnee. 2000. Bioactivation and mode of action of the oxadiazine indoxacarb in insects. Crop Protect. 19: 537 545. Wing, K. D., J. T. Andaloro, S. F. McCann, and V. L. Salgado. 2004. Indoxacarb and the sodium channel blocker insecticides: chemistry, physiology and biology in insects, pp. 31 53. In L. I. Gilbert, K. Iatrou, and S. S. Gill (eds.), Comprehensive molecular insect science, vol. 6, Elsevier Pergamon, Oxford, United Kingdom. Wu, D., M. E. Scharf, J. J. Neal, D. R. Suiter, and G. W. Bennett. 1998. Mechanisms of fenvalerate resistance in the German cockroach, Blattella germanica (L.). Pestic Biochem Physiol. 61: 53 62.

PAGE 208

208 Zhang, H., Y. Wang, and R. Wang. 2007. HPLC determination of DCJW in rat plasma and its application to pharmacokine tics studies. Chromatographia. 66:493 497. Zhao, X., V. L. Salgado, J. Z. Yeh, and T. Narahashi. 2003. Differential actions of fipronil and dieldrin insecticides on GABA gated chloride channels in insect neurons. J. Pharmacol. Exp. Thr. 306: 914 924. Zhao, X., J. Z. Yeh, V. L. Salgado, and T. Narahashi. 2005a. Sulfone metabolite of fipronil blocks (gamma) amino butyric acidand glutamateactivated chloride channels in mammalian and insect neurons. J. Pharmacol. Exp. Ther. 314: 363 373. Zhao, X., T. Ikeda, V. L. Salgado, J. Z. Yeh, and T. Narahashi. 2005b. Block of two types of sodium channels in cockroach neurons by indoxacarb insecticides. Neurotoxicol. 26: 455 465. Zhao, X., and V. L. Salgado. 2010. The role of GABA and glutamate receptors in susceptibili ty and resistance to chloride channel blocker insecticides. Pestic. Biochem. Physiol. 97: 153 160. Zurek, L., and C. Schal. 2004. Evaluation of the German cockroach ( Blattella germanica) as a vector for verotoxigenic Escherichia coli F18 in confined swine production. Vet. Microbiol. 101: 263 267.

PAGE 209

209 BIOGRAPHICAL SKETCH Ameya Dilip Gondhalekar was born in 1982 in Mumbai, India and spent most of his formative years in Mumbai. Since a very young age, Ameya used to visit his native place (Dabhol, India) during s ummer vacations and help ed his g randparents in managing their m ango orchards. These visits developed his interest in biology insects and agriculture in general. To pursue his interests, he obtained a bachelors degree in agricultural sciences from Konkan Krishi Vidyapeeth (Dapoli, India) and masters degree in entomology from Mahatma Phule Krishi Vidyapeeth (Pune, India) After obtaining a masters degree in entomology, he worked as a research project assistant at the National Chemical Laboratory (NCL) in Pune, India. While at NCL he met his lovely wife, Mithila. In August 2007, Ameya moved to the United States and joined the Ph. D program in Entomology at the University of Florida. His doctoral research under the direction of Dr. Michael E. Scharf focused on indoxacarb toxicology in the German cockroach. He. Received his Ph.D from the University of Florida in the summer of 2011.