Epigenetic Regulation by SNAIL and Its Implication in Tumor Metastasis

MISSING IMAGE

Material Information

Title:
Epigenetic Regulation by SNAIL and Its Implication in Tumor Metastasis
Physical Description:
1 online resource (136 p.)
Language:
english
Creator:
Lin,Tong
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Genetics and Genomics
Committee Chair:
Lu, Jianrong
Committee Members:
Bungert, Jorg
Wu, Lizi
Brown, Kevin D

Subjects

Subjects / Keywords:
emt -- lsd1 -- snail
Genetics and Genomics -- Dissertations, Academic -- UF
Genre:
Genetics and Genomics thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Cellular transitions between epithelial and mesenchymal states have crucial roles in embryonic development and carcinoma progression, yet regulation of the morphological plasticity of cells is not well established. Recent studies identified the members of the Snail family of zinc finger transcription factors as central mediators of EMT and induce EMT in part by directly repressing epithelial markers such as E-cadherin, a gatekeeper of the epithelial phenotype and a suppressor of tumor invasion. However, the molecular mechanism underlying Snail-mediated transcriptional repression remains incompletely understood. The goal of my study is to identify the corepressors associated with Snail and characterize their roles in regulating Snail?s function. It is shown here that Snail physically interacts with the histone demethylase LSD1 (KDM1A) via the SNAG domain, and recruits LSD1 to epithelial gene promoters. LSD1 then reduces dimethylation of lysine 4 on histone H3 tails (H3K4m2), a covalent modification associated with active chromatin. I further showed that LSD1 is essential for Snail-mediated transcriptional repression and for maintenance of the silenced state of Snail target genes in invasive cancer cells. In the absence of LSD1, Snail fails to repress its targets. In addition, depletion of LSD1 in mesenchymal-like cancer cells results in partial de-repression of epithelial genes and elevated H3K4m2 levels at the E-cadherin promoter. These results underline the critical role of LSD1 in Snail-dependent transcriptional repression of epithelial markers and suggest that the LSD1 complex could be a potential therapeutic target for prevention of EMT associated tumor invasion.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Tong Lin.
Thesis:
Thesis (Ph.D.)--University of Florida, 2011.
Local:
Adviser: Lu, Jianrong.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043295:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 EPIGEN ETIC REGULATION MEDIATED BY SNAIL AND ITS IMPLICATION IN TUMOR METASTASIS By TONG LIN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Tong Lin

PAGE 3

3 To my parents and my beloved wife for always believing in me

PAGE 4

4 ACKNOWLEDGMENTS Foremost, I sincerely thank my advisor, Dr. Jianrong Lu, for giving me the opportunity to perform my Ph.D. training in his lab and for pushing me to learn and grow as a scientist. His wisdom, dedication and enthusiasm for science always inspire me I really appreciate his long term support and patience with my projects. I would like to thank my committee members, Drs J rg Bungert, Kevin Brown and Lizi Wu for participating all my committee meetings and providing suggestions on my projects. Their insightful discussions have broadened my mind on the research. I would also like to t hank all of the past and present members of the Lu lab. I want to thank Heiman Wang for helping with the orders, preparing solutions and performing routine experiments. She was a responsible lab manager and her work made our research easier. I want to than k Alison Ponn She is a n excellent assistant and has been intimately involved in my projects, working closely with me for three years. I thank Sushama Kamarajugadda for her friendship and for all of the discussions we had over the years. I want thank other members Dr. Qingsong Cai, Dr. Lingbao, Ai, Dr. Zhaozhong Li and Ming Tang for their helps. I wish you guys the best for the future. I would like to thank all the administrative and secretarial staff in the Genetics and Genomics program. I must thank our previous graduate coordinator Dr. Marta Wayne for the helps she made when I first arrived in this country. She tried very hard to make us live easier and the program run smoother. I want to thank Dr. Wilfred Vermerris for his effort to make our journal clu b more applicable. He taught us how to improve presentation skills and how to hunt a job in academia and industry. I would like to thank Hope Parmeter for all the assistance she provided and for organizing our birthday parties and summer trips.

PAGE 5

5 I would li ke to thank all my friends Shuibin Lin, Weiyi Ni, Chen Ling, Bing Yao, Can Zhang, Bo Liu, Guangyao Li, Ou Zhang, Ou Chen, Minzhao Liu and Wei Feng. I really enjoyed the time hanging out with them, playing basketballs and cards. They made my life in graduat e school much more memorable. I especially thank Shuibin for sharing reagents and information related to our projects these years. Last but not least, I sincerely thank my parents, Caiye Lin and Zhengjuan Guan, for their support and encouragement in every step in my life. Their dedication makes me become who I am today. I hope they would be proud of me. Finally, I would like to give my thanks to my lovely wife for her understanding and love during the past few years. She sacrificed her own career for the ch ance to stay with me. I am very grateful that she has been right beside me through up s and downs. She is my most precious treasure in my life.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 12 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 14 Cancer Biology ................................ ................................ ................................ ....... 14 The Properties of Cancer ................................ ................................ ................. 14 Cells of Origin in Cancer ................................ ................................ ................... 15 Clonal evolution model ................................ ................................ ............... 15 Cancer stem cell hypothesis ................................ ................................ ...... 16 Metastasis and Malignant Tumors ................................ ................................ .... 17 Epithelial Mesenchymal Transition ................................ ................................ ......... 18 Overview of EMT ................................ ................................ .............................. 1 8 EMT in Development ................................ ................................ ........................ 19 EMT and Tumor Progression ................................ ................................ ........... 20 Regulation of Epithelial Mesenchymal Transition ................................ ................... 23 Epithelial Junctions and E cadherin (CDH1) ................................ .................... 23 EMT Inducing Signals ................................ ................................ ....................... 25 The TGF superfamily ................................ ................................ ............... 25 Wnt signaling ................................ ................................ ............................. 26 The Notch pathway ................................ ................................ .................... 26 The NF B pathway ................................ ................................ ................... 27 The tyrosine kinase receptors signal ................................ .......................... 27 The Snail Family of Transcriptional Repressors ................................ ............... 28 Structure of mammalian Snail and Slug ................................ ..................... 28 The role of Snail in development and cancer ................................ ............. 29 Regulation of Snail family function ................................ ............................. 31 Epigenetics and Histone Modifications ................................ ................................ ... 33 Introduction to Epigenetics ................................ ................................ ............... 33 DNA Methylation ................................ ................................ .............................. 34 Histone Modificati ons ................................ ................................ ....................... 34 Acetylation ................................ ................................ ................................ 35 Phosphorylation ................................ ................................ ......................... 36 Methylation ................................ ................................ ................................ 36

PAGE 7

7 Lysine Specific Demethylase 1 (LSD1), ................................ ........................... 39 Epigenetic Therapy for Cancer ................................ ................................ ......... 40 Summary ................................ ................................ ................................ ................ 41 2 GENERAL MATERIAL AND METHODS ................................ ................................ 47 Ce ll Culture ................................ ................................ ................................ ............. 47 Plasmids Construction ................................ ................................ ............................ 47 Protein Isolation and Immunoblotting ................................ ................................ ...... 49 Co Immunoprecipitation (CoIP) and GST Pull Down Assay ................................ ... 50 RNA Isolation, Reverse Transcription, and Real Time PCR ................................ ... 52 Chromatin Immunoprecipitation (ChIP) Assay ................................ ........................ 53 Transfection and Luciferase Re porter Assay ................................ .......................... 55 Statistical Analysis ................................ ................................ ................................ .. 56 Immunofluorescence Staining ................................ ................................ ................. 56 In V ivo Tumor Xenograft ................................ ................................ ......................... 57 Lentivirus Production and Infection ................................ ................................ ......... 57 DNase Accessibility Assay ................................ ................................ ...................... 58 3 SNAIL RECRUITS LSD1 TO EPITHELIAL PROMOTERS DURING EMT ............. 63 Study Bac k ground ................................ ................................ ................................ .. 63 Results ................................ ................................ ................................ .................... 65 Snail Directly Represses Epithelial Genes in MCF10A ................................ ..... 65 Snail Downregulates H3K4m2 Levels at Epithelial Gene Promoters ................ 67 Snail Interacts with LSD1 ................................ ................................ ................. 67 Snail Recruits LSD1 to its Target Gene Promoters ................................ .......... 71 Summary ................................ ................................ ................................ ................ 72 4 LSD1 IS ESSENTIAL FOR SNAIL MEDIATED TRANSCRIPTIONAL REPRESSION ................................ ................................ ................................ ........ 81 Study Background ................................ ................................ ................................ .. 81 Results ................................ ................................ ................................ .................... 82 LSD1 is Required for Snail to Repress Epithelial Genes ................................ .. 82 LSD1 Mediates Snail Initiated EMT Process ................................ .................... 83 LSD1 is Essential for Maintenance of the Silenced State of Snail Target Genes ................................ ................................ ................................ ............ 85 E cadherin is Upregulated in LSD1 Depleted Tumors ................................ ...... 86 Summary ................................ ................................ ................................ ................ 87 5 ADDITIONAL EPIGENETIC EVENTS ASSOCIATED WITH SNAIL ....................... 95 Snail and DNA Methylation ................................ ................................ ..................... 95 Identi fication of the Snail Complex ................................ ................................ .......... 96 Purification of Factors Associated with Snail ................................ .................... 96 Validation of Snail and SFMBT1 Association ................................ ................... 98 Snail Reduces the Accessibility of E cadherin Promoter Region ...................... 99

PAGE 8

8 Summary ................................ ................................ ................................ .............. 100 6 CONCLUSIONS AND FUTURE DIRECTIONS ................................ .................... 106 LIST OF REFERENCES ................................ ................................ ............................. 112 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 136

PAGE 9

9 LIST OF TABLES Table page 2 1 List of primers used for real time RT PCR ................................ .......................... 61 2 2 List of primers used for other real time PCR ................................ ....................... 61 2 3 List of antibodies used for Westernblotting (WB), Immunofluorescence (IF), Immunoprecipitation (IP), and Chromatin Immunoprecipitation (ChIP) .............. 62

PAGE 10

10 LIST OF FIGURES Figure page 1 1 Two proposed models for cancer o rigination and progression ........................... 43 1 2 The role of EMT and MET in tumor emergence and progression. ...................... 44 1 3 Schematic representation of neural crest cell dissemination .............................. 45 1 4 Comparative scheme of main structural domains found in mammalian Snail and Slug. ................................ ................................ ................................ ............ 46 2 1 Cloning vector information for pGIPz lentiviral vector with mir30RNA. ............... 60 3 1 Ectopic expression of Flag tagged Snail in MCF10A cells. ................................ 74 3 2 Snail binds to epithelial prom oters ................................ ................................ ...... 75 3 3 Snail reduces H3K4m2 at its target gene promoters ................................ .......... 76 3 4 Snail physically interacts with histone demethylase LSD1 in vitro and in vivo .. .. 77 3 5 LSD1 is recruited to epithelial gene promoters by Snail ................................ ..... 80 4 1 LSD1 is essential for Snail mediated repression ................................ ................ 90 4 2 LSD1 mediates Snail initiated EMT process ................................ ....................... 92 4 3 LSD1 is required to maintain the silenced status of Snail target genes in invasive cancer cells ................................ ................................ ........................... 93 4 4 Mammary fat pad tumor xenograft assay. ................................ .......................... 94 5 1 Identification of the Snail complex ................................ ................................ .... 102 5 2 Confirmation of Sna il and SFMBT1/L3MBTL interaction ................................ .. 104 5 3 Snail reduces the accessibility of E cadherin promoter region. ........................ 105

PAGE 11

11 LIST OF ABBREVIATION S 4 HT 4 Hydroxyltamoxifen aza azacytidine ChIP Chromatin Immunoprecipitation CSC Cancer Stem Cell ECM Extracellular Matrix EGF Epidermal Growth Factor EMT Epithelial Mesenchymal Transition ER Estrogen Receptor FGF Fibroblast Growth Factor GST Glutathione S Transferase HDACi Histone Deacetylase inhibitor LSD1 Lysine Specific Demethylase 1 NF B Nuclear Factor kappa B PcG Polycomb Group PRC2 Polycomb Repressive Complex 2 RT PCR Reverse Transcriptase Polymerase Chain Reaction SC Stem Cell shRNA short hairpin RNA TGF Transforming Growth Factor beta TSS Transcription Start Site

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirem ents for the Degree of Doctor of Philosophy EPIGENETIC REGULATION MEDIATED BY SNAIL AND ITS IMPLICATION IN TUMOR METASTASIS By Tong Lin August 2011 Chair: Jianrong Lu Major: Genetics and Genomics Cellular transitions between epithelial and mesenchymal states have crucial roles in embryonic development and carcinoma progression, yet regulation of the morphological plasticity of cells is not well established. Recent studies identified the members of the Snail family of zinc finger transcription factors as central mediators of EMT and induce EMT in part by directly repressing epithelial markers such as E cadherin, a gatekeeper of the epithelial phenotype and a suppressor of tumor invasion. However, the molecula r mechanism underlying Snail mediated transcriptional repression remains incompletely understood. The goal of my study is to identify the corepressors associated with Snail and character ize function. It was shown here that Snail physically interacts with the histone demethylase LSD1 (KDM1A) via the SNAG domain, and recruits LSD1 to epithelial gene promoter s LSD1 then reduces dimethylation of lysine 4 on histone H3 tails (H3K4m2), a covalent modification associated with act ive chromatin. I further showed that LSD1 is essential for Snail mediated transcriptional repression and for maintenance of the silenced state of Snail target genes in invasive cancer cells. In the absence of LSD1, Snail fails to repress its targets. In ad dition, depletion of LSD1 in mesenchymal like cancer cells

PAGE 13

13 results in partial de repression of epithelial genes and elevated H3K4m2 levels at the E cadherin promoter. These results underline the critical role of LSD1 in Snail dependent transcriptional repr ession of epithelial markers and suggest that the LSD1 complex could be a potential therapeutic target for prevention of EMT associated tumor invasion.

PAGE 14

14 CHAPTER 1 INTRODUCTION Cancer Biology Cancer is the second most common ca use of death in the US, surpassed only by heart disease. The most predominant forms of cancer for male and female are prostate cancer and breast cancer respectively, followed by lung cancer for both genders. L ifetime risk of developing vari ous types of cancer among Americans is about 30% with more than one million new cases diagnosed each year ( American Cancer Society Atlanta, 2010 ) The incidence rates of cancer have been increasing over decades, while mortality has decreased, which is mostly due to advances in early detection and diagnosis. The Properties of Cancer The transformation of normal cells to malignant cancer cells is a complex multistep process, characterized by a sequence of genetic and epigenetic alterations. Each of these steps confers one or another form of increased physiological fitness to surrounding en vironments ( Foulds, 1954 ) Genomic instability is proposed as a fundamental characteristic of cancer cells and enables them to develop multiple specific hallmarks, by activating of oncogenes and inactivating of tumor suppressor genes. Cancer cells can acquire the capability to sustain proliferative signaling, to divide despite growth inhibitory signals, to be resistant to apoptotic events and to replicate immortally. In addition, malignant cells have the unique ability of inducing angiogenesis to provide for their own blood supply, as well as invading the surrounding tissue and metastasizing to distant organs ( Hanahan and Weinberg, 2000 ) Last but not least, two additional emerging hallmarks of ca ncer have recently been added to the list:

PAGE 15

15 reprogramming of energy metabolism favoring glycolysis under aerobic conditions in cancer cells, and evading immune destruction ( Hanahan and Weinberg, 2011 ) Cells of Origin in Cancer The origin of cancer cell populations has been much debated in cancer biology field for the past decade, as it has been noticed for a long time that tumor cells sh ow remarkable variability in different kind of aspects even within individual tumors, like cellular morphology, proliferative index, genetic lesions and therapeutic response ( Axelson et al., 2005 ; Heppner, 1984 ) Is the striking heterogeneity originated from a single cell? Or are there many points of origin to account for the various cell types found inside tumors? Understanding these questions could lead to more effective cancer therapies and prevention methods ( Marusyk and Polyak, 2010 ; Visvader, 2011 ) Currently, two popular conceptual ideas h ave been put forward to attempt to describe the establishment and maintenance of tumor heterogeneity, the clonal evolution model and the cancer stem cell hypothesis. Although these two theories share some similarities, they are fundamentally different noti ons with very different implications ( Campbell and Polyak, 2007 ; Polyak, 2007 ; Shackleton et al., 2009 ) Clonal e volution m odel The clonal evolut ion model was first proposed by Nowell in 1976 (Figure 1 1A). It states that cancer originates from a random single cell that over time has acquired various combinations of mutations, providing it with a selective growth advantage over adjacent normal cell s ( N owell, 1976 ) As the tumor progresses, genetic instability and uncontrolled proliferation allow the production of cells with additional mutations and hence new characteristics. Each of these new alterations may provide additional

PAGE 16

16 reproductive advantages over other cancer cells, such as resistant to apoptosis, and lead to a new clonal expansion. Thus, under favorable conditions, new subpopulations of variant cells are born, and other subpopulations may contract, resulting in tumor heterogeneity ( Crespi and Summers, 2005 ; Merlo et al., 2006 ) The succession of clonal expansions in part resembles a scheme of Darwinian evolution. According to this model, most aggressive cells drive tumor progression throughout the lifetime of a tumor. Any cancer cell can potentially become invasive and cause meta stasis or become resistant to therapies and cause recurrence. Cancer s tem cell h ypothesis The cancer stem cell (CSC) hypothesis (Figure 1 1B), which has received a great deal of attention recently, states that only a particular subset of tumor cells with stem cell like properties that have the ability to self renew and drive tumor initiation, progression and recurrence ( Pardal et al., 2003 ; Reya et al., 2001 ; Visvader and Lindeman, 2008 ) According to this model, the self renewal and differentiation potentials of CSCs, which is analogous to somatic stem cells (SC), lead to the production of all cell types inside a tumor, thereby generati ng tumor heterogeneity ( Polyak and Hahn, 2006 ; Visvader and Lindeman, 2008 ) These CSCs may be derived from normal SCs, as they are also long lived, making them more likely than other cells to acquire the multiple mutations needed to become cancer ( Miller et al., 2005 ) In addition, recent evidences showed that the epithelial mesenchymal transition, a complex developmental process, can also induce non CSCs to enter into a CSC like state ( Mani et al., 2008 ; Morel et al., 2008 ) Both of the cancer stem cell model and clonal evolution model suggest tumors originate from a single cell that has acquired multiple mutations and has gained

PAGE 17

17 unlimited proliferative potential. However, in the CSC model, normal stem and progenitor cells are considered the most lik ely targets of transformation, while no normal cells in particular are identified as such by the clonal evolution model. Another difference between these two model s is clonal evolution model supposes that any tumor cell has the potential to expand into a s ubpopulation and to be involved in tumor progression. Nevertheless, the CSC hypothesis indicates only a small pool of cells, with self renewal and tumor initiating capability, can contribute to tumor progression. So, based on the CSC model, efficiently eli minating the highly tumorigenic, stem cell like subpopulation would render the remaining tumor cells more susceptible to standard chemo or radio therapy treatment ( Tan et al., 2006 ; Wicha et al., 2006 ) Metastasis and Malignant Tumors Although epithelial cancers deriving from tissues that include breast, lung, colon, prostate and ovary constitute majority of cancers, metastasis is responsible for as much as 90% of cancer related death s Development of distant metastases from the original cancer is an almost incurable illness, yet the mechanism of it remai ns the most poorly understood component of cancer pathogenesis ( Steeg, 2006 ) Tumor metastasis consists of a series of discrete biological processes that m ove tumor cells from the primary site to distant location The complex metastatic cascade starts with a subset of tumor cells that acquire the ability to migrate and invade, althou gh it is still unaddressed whether this acquisition of malignant traits occu rs as an almost inevitable consequence when tumor reach certain size or as an accidental product thereof ( Chaffer and Weinberg, 2011 ) These cells alter their morphology as well as attachment to neighboring cells and to the extracellular matrix (ECM), degrade surrounding tissue, eventually liberate themselves from the primary tumor and begin to

PAGE 18

18 migrate on their own Then the dis seminated cells invade adjacent stromal compartments and move toward lymphatics or bloodstream. Afte r intravasation, they enter these vessels, survive both shear forces as well as suspension induced cell death (anoikis), and become circulating tumor cells (CTCs). At the distant organ, CTCs exit circulation by extravasation and invade into the microenvironment of the foreign tissue. Eventually, some of these cells successfully adapt to new environment in distant loci and form macrometastases ( Joyce and Pollard, 2009 ; Nguyen et al., 2009 ; Pantel and Brakenhoff, 2004 ) Although metastasis still remains one of the most enigmatic aspects of the disease, a lot of progress has been made in understanding its mechanisms from the past decade. One break through is the recognition of epithelial mesenchymal transition (EMT) as a prominent regulatory event in the initiation of invasion and metastasis program ( Chiang and Massague, 2008 ; Klymk owsky and Savagner, 2009 ; Thiery, 2002 ; Yang and Weinberg, 2008 ) Through EMT, transformed epithelial cells can acquire the abilities to invade, to resist apoptosis, and to disseminate. Besides, this multifaceted EMT program can be activated transie ntly or stably, and to different degrees, by carcinoma cell s during the course of invasion and metastasis (Figure 1 2) ( Barrallo Gimeno and Nieto, 2005 ; Polyak and Weinberg, 2009 ; Thiery, 2009 ) Epithelial Mesenchymal T ransition Overview of EMT Epithelia l and mesenchymal cells exhibit distinct phenotypic and functional characteristics ( Thiery and Sleeman, 2006 ) Epithelial cells establish close contacts with each other and have apical basal polarity through the sequential arrangement of tight junctions, adherens junc tions and desm osomes. M esenchymal cells typically do not

PAGE 19

19 establish stable cell cell contacts. However, the two cell types are interconvertable under certain circumstance s Epithelial cells can be reprogrammed into mesenchymal cells through a process known as epithelial mesenchymal transition (EMT) ( Hay, 19 95 ) During EMT, epithelial cells downregulate epithelial markers, lose their cell cell adhesion structures, modulate their polarity and rearrange their cytoskeleton, and concomitantly acquire enhanced migratory and invasive properties. Besides, EMT is not permanent but often reversible. The reverse process is termed mesenchymal epithelial transition ( Tinelli et al., 2009 ) The interconversion between epithelial and mesenchymal states underscores the enormous phenotypic plasticity of certain embryonic and adult cells, which is believed to be pivotal to many biological processes, such as embryonic morphogenesis, wound healing, organ fibrosis as well as cancer progression ( Thiery et al., 2009 ) E MT in D evelopment The phenomenon of EMT was first identified in the studies of the formation of chicken primitive streak and gradually found crucial for embryogenesis ( Hay, 1968 ; Trelstad et al., 1967 ) The development of metazoan organ systems starts with a single layer of epithelial cells. And the earliest example of an EMT program participating in embryogenesis is the formation of mesoderm. During gastrulation, a small population of epithelial cells at the primitive streak undergoes dramatic morphological changes, loses their epithelial cell cell contacts, transforms into migratory mesenchymal cells. Subsequently, these cells in gress through the primitive streak, migrate along the narrow extracellular space underneath the ectoderm to form the new mesoderm ( Viebahn, 1995 )

PAGE 20

20 B esides mesoderm formation, neural crest delamination (Figure 1 3) represents another prototypic developmental EMT event ( Yang and Weinberg, 2008 ) The neural crest is composed of a transient population of stem cell like progenitors that distinguishes the vertebrates from other metazoans. After gastrulation in vertebrates, the neural plate and the epidermal ectoderm are progressively defined along the rostrocaudal axis, and the neural crest develops at the boundary between these two territories ( Kulesa and Gammill, 2010 ) Through EMT, these multipotent neural crest cells emigrate extensively from the dorsal neural epithelium to sit es throughout the embryo where they give rise to a diverse array of derivatives that include craniofacial skeleton, most of the peripheral nervous system, melanocytes, as well as some endocrine cells ( Dupin et al., 2006 ; Taylor and Labonne, 2007 ) EMT and T umor Progression It took a long time for EMT to be recognized as a potential mech anism for carcinoma p rogression, although even now, not everyone is convinced about the relevance of thi s transition in cancer progression. This controversy in part is due to the absence of direct clinical evidence of capturing EMT process in human cancer patients. Besides, clinically, the majority of human metastases resemble primary carcinomas morphologica lly and retain characteristics of well differentiated epithelial cells, which raises the question whether EMT indeed occurred during the progression of tumors ( Thiery, 2002 ) Nevertheless, over the past decade, lines of evidence have emerged in understanding the role of the EMT in enabling metastatic dissemination. It is believed that by activating EMT program carcinoma cells can concomitantly acquire se veral aspects of malignancy associated properties. The most important one is the enhanced

PAGE 21

21 migratory and invasiveness for the initiation of metastasis. Currently complete or partial EMT like processes are documented in breast ( Trimboli et al., 2008 ) ovarian ( Verg ara et al., 2010 ) colon ( Brabletz et al., 2005 ) and esophageal ( Usami et al. 2008 ) cancer models. Epithelial cancer cells obtain higher mobility and disseminate from each other by transform ing to mesenchymal like phenotype in vitro ( Brown et al., 2004 ; Klymkowsky and Savagner, 2009 ; Shin et al., 2010 ) More importantly, increasing number of reports shows that EMT occurs in vivo as well while carcinoma progresses. EMT in vivo is frequently described as a portion of tumor cells that express low level s of epithelial markers such as E cadherin or ZO 1, and high level s of mesenchymal markers such as vimentin or fibronectin. In breast cancer, EMT was observed at the margins of canc er cell groups of up to 20% of tumors ( Dandachi et al., 2001 ) Similarly, a colon carcinoma study showed the presence of E cadherin negative cancer cells at the tumor invasive front, that selectively lost the basement membrane and were invading the surrounding stroma ( Brabletz et al., 2001 ) One technical difficult y in studying EMT in vivo is to distinguish mesenchymal cells derived from epithelial tumor cells after EMT from stromal cells or other tumor associated fibroblasts. To circumvent this problem, cytogenetic analysis was applied in some studies to confirm both the mesenchymal and epithelial compartments were originated from the same precursor cell population ( Halachmi et al., 2007 ) .The description of tumor cells that detach from the t umor mass into the adjacent stroma has recently provided morphological evidence o f EMT at invasive front of human tumors ( Pral l, 2007 ) Besides, direct in vivo imaging has also yielded evidence of EMT in cancer progression ( Wyckoff et al., 2007 )

PAGE 22

22 Besides the modification of the phenotype, EMT could also endow tumor cells with higher resistance to cell death and chemotherapy which is critical for these cells to survive in blood vessels upon detachment and intravasation. TGF can prevent tumor progression by directing cells to apoptosis, howeve r it will also promote EMT within certain context s ( Massague, 200 8 ) Interestingly, c ells exhibiting a sustained EMT can escape apoptosis after exposure to TGF for several weeks ( Gal et al., 2008 ) Members of the Snail family are known to confer re sistance to cell death by antagonizing the p53 pathway ( Barrallo Gimeno, 2005 ; Kurrey et al., 2009b ; Wu et al., 2005b ) This prosurvival activity can be extended to Twist, as it antagonize s the Myc mediated proapoptotic effect in neuroblastoma ( Puisieux et al., 2006 ) Simi larly, tumors undergoing EMT may resist conventional chemotherapy. For example, colon carcinoma epithelial cell lines made resistant to oxaliplatin exhibit a mesenchymal morphology and express several markers of EMT ( Yang et al., 2006a ) Both Snail and Twist expressions are found to be associated with resistance to paclitaxel treatment ( Kurrey et al., 2009b ; Yu et al., 2009a ; Yu et al., 2009b ) Interestingly, forced overexpression of miR 200c, a negative regulator of EMT, restores chemotherapeutic sensitivity ( Cochrane et al., 2010 ) Recently, emerging evidence indicates that expression of multiple induce rs of EMT in breast cancer cell lines increases the tumor initiating cell population as determined by mammosphere formation and cell surface markers ( Mani et al., 2008 ; Morel et al., 2008 ) This induced cancer stem cell like property with self renew al ability, is likely a critical feature required for ultimate colonization at distant metastatic sites.

PAGE 23

23 Overall, these lines of evidence suggest EMT induces a comprehensive program of properties that are necessary for tumor progression. Fi rst, EMT empowers epithelial tumor cells to disseminate from primary tumors and invade into neighboring tissues. Moreover, the heightened resistance to apoptosis that is generated by EMT is critical for circulating tumor cells to survive the voyage to seed in distant sites. Finally, the CSC like state endows these seeded cells to colonize and form macrometastases. Regulation of Epithelial Mesenchymal T ransition Epithelial J unctions and E cadherin (CDH1) Epithelial tissues are formed by a single layer of tightl y packed, polarized cells that are separated from adjacent tissues by a basal lamina. The structural integrity of epithelium depends upon the establishment and maintenance of stable epithelial junctions. These junctions consist of distinct protein complexes and provide contact with neighboring cells and the extracellular matrix (ECM) ( Tyler, 2003 ) There are four major types of cell junctions in vertebrates serving different functions within the epithelium: tight junction s adherens junction s desmosomal junction s and gap junction s (Figure 1 6 ). The tight junctions contain claudins and o ccludins, and function as a barrier to prevent passage of particles or solutes ac ross the epithelial layer. The pannexin/ c onnexin based gap junctions allow epithelial cells to communicate through the direct passage of small molecules between neighboring cells ( Shestopalov and Panchin, 2008 ) The desmosomes protect epithelial cells against shearing forces and contain two nonclassic cadherins: desmocollins and desmogleins. They share conserved extrac ellular cadherin (EC) domains with classic cadherins but have divergent cytoplasmic structures ( Delva et al., 2009 ; Desai et al., 2009 )

PAGE 24

24 The adherens junction is another critical element of the cell cell junctions. A major function of adherens junctions is to physically tether adjacent ce ll s to one another, as disruption of them causes loosening of cell cell contacts. Adherens junctions are composed of classical cadherins which comprise approximately 20 members and share a common domain organization ( Hulpiau and van Roy, 2009 ) E (epithelial) cadherin has a typical structure as a classical type I cadherin, which is mainly localized at adherens junctions ( Nollet et al., 2000 ) The mature E cadherin is composed of an extracellular domain that con sists of five tandemly repeated cadherin motif subdomains (EC domains) a single pass transmembrane domain and a highly conserved carboxyl terminal cytodomain ( Shapiro et al., 1995 ) The extracellular domain connects two E cadherin molecules by a calcium dependent homophilic interaction. And the cytoplasmic domain binds to beta catenin complex, w hich is linked to the actin cytoskeleton ( Niesse n, 2007 ) N ormal E cadherin expression and function are essential for the induction and maintenance of epithelial morphology ( Takeichi, 1991 ) E cadherin has also been considered a suppressor of tumor progression ( Berx and Roy, 2001 ; Perl et al., 1998 ) In breast cancer, loss of E cadherin correlates with enhanced invasiveness, metastatic potential and poor prognoses ( Heimann et al., 2000 ; Hunt et al., 1997 ; Siitonen et al., 1996 ) Aberrant expression of E cadherin has been frequently observed at the invasive front of human cancers by immunohistochemistry ( Wijnhoven et al., 2000 ) E cadherin has also been found involved in cell cell contact inhibition of cell growth by inducing cell cycle arrest ( St Croix et al., 1998 ) Loss of contact inhibition of prolifer ation allows tumor cells to escape from growth control signals.

PAGE 25

25 EMT Inducing S ignals Progress has been made in understanding the complex mechanism governing EMT. A number of distinct signaling pathways have been unraveled that are common to EMTs in both d evelopment and tumor progression, including TGF superfamily, Wnts, Notch, NF B, Tyrosine Kinase Receptors, and many others ( Thiery and Sleeman, 2006 ; Yang and Weinberg, 2008 ) And vast majority of these signali ng pathways known to trigger EMT converge at the induction of the E cadherin repressors. The TGF superfamily The transforming growth factor (TGF ) superfamily consists of related multifunctional cytokines, which include TGF s, activins and bone morphogenetic proteins (BMPs) ( Piek et al., 1999a ) Members of the TGF superfamily have been well established as potent inducers of EMT. In early stage s of development, mesoderm formation, an EMT rela ted e vent as we previously discussed is initiated mainly by members of the Nodal subfamily of TGF as demonstrated in both Xenopus and Zebrafish embryos ( Kimelman, 2006 ) Similarly, another TGF superfamily member, BMP, is required for neural crest induction ( Ra ible, 2006 ) In murine NMuMG mammary epithelial cells TGF promotes strong EMT through type I and type II receptor complex and activation of Smads ( Brown et al., 2003 ; Piek et al., 1999b ) In cultured canine kidney epithelial MDCK cells, activation of the TGF /Smad pathway has been shown to coordinate with Ras activation to promote a full EMT phenotype ( Grunert et al., 2003 ) Similar phenomena were also observed in another mouse mam mary epithelial cell line EpH4 ( Eger et al., 2004 ; Janda et al., 2002 ) Despite the large number of different EMT models regula ted by TGF the exact molecular mechanism of this regulation remains

PAGE 26

26 unclear. Some studies suggest TGF drive EMT may through transcriptionally upregulation of Snail and SIP1/ZEB2, two negative regulator s of E cadherin ( Comijn et al., 2001 ; Peinado et al., 2003b ) Wnt signal ing The canonical Wnt pathway is implicated in the initiation and maintenance of mesoderm formation. For instantce Wnt8 is required for the formation of dorsal mesoderm in Xenopus and Zebrafish ( Kelly et al., 1995 ; Smith and Harland, 1991 ; Sokol et al., 1991 ) And in Xenopus depletion of catenin re sults in failure to form neural crest ( Wu et al., 2005a ) In avian embryos, Wnt is also necessary and sufficient to induce neural crest cells ( Garcia Castro et al., 2002 ) In addition, accumulating e vidence indicates that hyperactivity of canonical Wnt pathway associated with breast cancer progression by triggering EMT like programs ( Ayyanan et al., 2006 ; Li et al., 2003 ; Reya and Clevers, 2005 ) catenin TCF complex activates EMT in human breast cancer cells in an Axin2 dependent manner by stabilizing Snai1 protein ( Yook et al., 2006 ) A colon cancer study showed plat elet derived growth factor (PDGF) stimulates EMT through the nuclear translocation of catenin in a Wnt independent manner ( Yang et al., 2006b ) The Notch pathway Not ch signaling regulates cranial neural crest cells indirec tly by inducing the expression of BMPs ( Cornell and Eisen, 2005 ) Overexpression of activated Notch1 induces EMT in immortalized endothelial cells ( Grego Bessa et al., 2004 ; Timmerman et al., 2004 ) Furthermore, both Snail and Slug are proposed as Notch targets in several reports ( High et al., 2007 ; Leong et al., 2007 ; Niessen et al., 2008 ; Timmerman et al.,

PAGE 27

27 2004 ) But unlike the TGF and Wnt pathways, activatio n of the Notch signaling pathw ay is not sufficient to promote EMT. Instead, Notch signaling in many cases needs to be coordinated with additional signaling inputs in order to induce an EMT in development and tumor progression. The NF B pathway The NF B pathway is activated in a range of human cancers and has been implicated in modulating the EMT program, through the induction of Snail transcription and protein stabilization ( Julien et al., 2007 ; Strippoli et al., 2008 ) Inhibition of NF B blocks EMT, and moreover, abrogates the metastatic potential of mammary epithelial cells in a mouse model system ( Huber et al., 2004 ) NF B also required for the insulin growth factor receptor (IGFR) pa thway induced EMT by indirectly upregulating ZEB1 in prostate carcinoma cells ( Graham et al., 2008 ) The tyrosine kinase receptors signal Signals from the tyrosine kinase receptors are also emerging as important regulators of EMT. For example FGF controls the EMT and morphogenesis of mesoderm at the primitive streak ( Ciruna and Rossant, 2001 ) Depletion of HGF or Met genes resu lts in the complete absence of muscle groups that derive from migratory precursor cells during mouse hypaxial skeletal muscle development ( Dietrich et al., 1999 ) Besides, epidermal growth factor (EGF) is known to induce both Snail and Twist expression ( Lee et al., 2008 ; Lo et al., 2007 ) and also promote E cadherin endocytosis ( Lu et al., 2003 ) Interestingly, vascular endo thelial growth factor (VEGF) forms a regulatory loop with Snail, orchestrating angiogenesis and EMT, two major events in tumor progression ( Peinado et al., 2004b ; Wanami et al., 2008 )

PAGE 28

28 The Snail Family of Transcriptional Repressors We just discussed numerous EMT inducing signals. In response to these contextua l signals, cells activate expression of certain transcription factors that execute the EMT process, and most of these factors are transcriptional repressors of the E cadherin gene. Snail/Slug, ZEB1/2, KLF8, and E47 factors bind to and repress the activity of the E cadherin promoter, whereas factors such as Twist, Goosecoid, FoxC2, and 14 3 3 repress E cadherin indirectly ( Thiery et al., 2009 ) Among all these transcription factors, the Snail family transcriptional repressors, especially Snail, are the most widely charact erized effectors of EMT and CDH1 expres sion All members in the Snail family are zinc finger transcription factors. The first member dSnail, was described in Drosophila melanogaster, where it was shown to be essential for the formation of the mesoderm ( Leptin, 1991 ) Subsequently, dSnail homologues have been found in many species including humans ( Paznekas et al., 1999 ) In ver tebrates, there are three members of the Snail family have been indentified to date: Snail (Snai1), Slug (Snai2), and Smuc (Snai3) ( Nieto, 2005 ) Structure of mammalian Snail and Slug The basic structures o f two major mammalian members of the Snail family Snail and Slug, are illustrated in Fi gure 1 5 They share a hi ghly conserved carboxyl terminus with multiple C2H2 type zinc fingers that function as sequence specific DNA binding motif. T he consensus binding site for Snail proteins contains a core of six bases, CAGGTG ( Batlle et al., 2000 a ; Cano et al., 2000b ; Inukai et al., 1999 ) which is identical to the so called E box, a binding site for basic helix loop helix (bHLH) transcri ption factors. On binding to DNA, Snail proteins are thought to ac t as transcriptional repressors ( Hemavathy et al., 2000a ) and their repressor capacity is largely dependent

PAGE 29

29 on the SNAG (Snail/Gfi) domain ( Grimes et al., 1996b ; Peinado et al., 2004a ) which is located at the extremely N ter minal end. The SNAG domain is constituted by the first 20 amino acids of Snail and is required for the binding of corepressor s such as Sin3A/HDAC and PRC2 complex ( Herranz et al., 2008 ; Peinado et al., 2004a ) The central region of the Snail proteins is serine proline rich a nd highly divergent Slug protein contains the so called slug domain in this region, but its function remains elusive. In contrast, two functionally different domains have been identified in the central region in Snail : the destruction box domain ( Zhou et al., 2004 ) and the Nuclear Export Signal (NES) domain ( Dominguez et al., 2003a ) Phosphorylation of serine/proline residues at these domains controls Snail protein stability, subcellular local ization and repressor activity. The role of Snail in development and cancer Members of the Snail family have been shown to be essential for various important developmental processes, including mesoderm formation, neural differentiation, cell fate and survi val decisions, and left right identities ( Hemavathy et al., 2000b ) Snail deficient embryos fail to gastrulate, and mesodermal cells are unable to downregulate E ca dherin accumulated at the streak (Carver et al.,2001; Nieto et al., 1994) Snail also has a fundamental role in EMT and metastasis. Aberrant expression of Snail or Slug contributes to the onset of an invasive phenotype in a wide variety of human cancers ( Peinado et al., 2007b ) E xpression of Snail correlates with high tumor grade and nodal metastasis, and is a prognostic marker for breast cancer patients ( Blanco et al., 2002 ; Cheng et al ., 2001 ; Martin et al., 2005 ) Snail is also associated with tumor recu rrence. In a conditional transgenic mouse model for the recurrence of

PAGE 30

30 HER2/neu induced mammary tumors, the recurrent mammary shows spontaneous upregulation of Snail with an EMT phenotype ( Moody et al., 2005 ) Recent functional studies reveal E cadherin as a major target for Snail ( Batlle et al., 2000b ; Cano et al., 2000a ) and Slug ( Bolos et al., 2003 ) There are three consecutive E boxes at the proximal promoter region of human E cadherin, and Snail or Slug can directly bind to this region and repress E cadherin expression. A comparative binding analysis for these E box elements at the E cadherin promoter showed that Snail binds with a higher affinity than Slug a nd E47 ( Bolos et al., 2003 ) More i mportantly, overexpression of Snail in epithelial cells increase s invasiveness in vitro, and coincides with the down regulation of E cadherin expression ( Batlle et al., 2000b ; Cano et al., 2000a ) Snail kn ockout mice died at gastrulation owing to the defects of EMT with sustained expression of E cadherin ( Carver et al., 2001 ) In addition to E cadherin, Snail also prevents the expression of various epithelium spec ific genes, such as Occludin and Claudins ( Ikenouchi et al., 2003 ) Cytokeratins ( De Craene et al., 2005a ) and Mucin1 ( Guaita et al., 2002 ) Given the central role of Snail in EMT, some reports showed Snail not only represses epithelial genes but also stimulat es mesenchymal gene transcription, although the mechanism by which Snail functions as an activator is not clear. It has been proposed that the activator effects of Snail are dependent on the repression of epithelial genes ( Solanas et al., 2008 ) Besides, in certain conditions, Snail might work as a direct activator. For example, it has been found that Snail interacts with catenin in the nucleus promoting transcriptional activation of Wnt target genes ( Stemmer et al., 2008 )

PAGE 31

31 In addition to regulating EMT, Snail and Slug can function as anti apoptotic factors in at least some ce llular context. Snail confers resistance to serum depletion induced and TNF a induced cell death in MDCK. In chick and mouse embryos, the expression of Snail genes is inversely correlated with cell death in different developing tissues ( Vega et al., 2004 ) Snail is associated with the inhibition of P TEN phosphatase, a p53 target, and prevents gamma radiation induced apoptosis ( Escriva et al., 2008 ) The other member, Slug, is also known for antagonizing p53 mediated apoptosis by binding to p53 downstream targets such as puma ( Kurrey et al., 2009a ; Wu et al., 2005b ) Therefore by promoting resistance to apopto sis, Snail family genes provide tumor cells an advantage to invade, migrate to distant tissues, and form metasta sis ( Barrallo Gimeno, 2005 ) Besides, Snail controls bone mass by repressing the transcription of Runx2 and vitamin D receptor (VDR) genes during osteoblast differentiation ( Frutos et al., 2009 ) Regulation of Snail family function Numer ous lines of evidence have shown that EMT inducing signaling cascades ex ecute their effect by inducing the expression Snail family transcription repressors ( De Craene et al., 2005b ) However, there is still limited information available about the factors directly contro lling Snail promoter Comparative analysis of the Snail and Slug promoter s reveals the pres ence of some interesting elements, such as AP1/AP4 sites, SMAD binding sites, LEF1 binding elements and E boxes ( Peinado et al., 2007b ) For example, the LEF/beta catenin complex is a downstream effecter of Wnt signaling, and the presence of a functional LEF/beta catenin binding site at xSnail/xSlug promoter has been characterized in vitro by electrophoretic mobility shift assay and in vivo by deletion studies ( Vallin et al., 2001 ) MyoD, a myogenic regulatory factor can induce the mSlug

PAGE 32

32 promoter, in which the binding was demonstrated with ChIP assays. Moreover, mSlug deficient mice shows defective muscle regeneration ( Zhao et al., 2002 ) In TGF induced EMT, Smad3/4 form complex wit h the high mobility group A2 (HMGA2). These two cooperatively bind to the Snail promoter and activate Snail transcription ( Thuault et al., 2008 ) Another e xample is HGF targets the early growth response 1 (Egr1) protein to the Snail promoter an d activates its expression in a MAPK1 dependent manner ( Grotegut et al., 2006 ) More recently, ncRNA a7, a long non coding RNA with enhancer like function, is also identified as a cis element activator of Snail. Depletion of ncRNA a7 reduces Snail level as well as the migratory ability of A549 cells ( rom et al., 2010 ) Besides transcriptional activation, Snail is also negatively regulated at the transcription al level T he most interesting example is that Snail ca n bind to the E boxes located within its own promoter and repress its own expression, creating a feedback loop. This self inhibitory effect provides cells with the capability of buffering and ensures a precise co ntrol of Snail activity which could be critical during embryonic development ( Peiro, 2006 ) It has been s hown that Snail is also negatively regulated by the estrogen receptor (ER) in breast cancer. ER activates transcription of MTA3 in response to estrogen signaling, which in turn recruits the Mi 2/NuRD corepressor complex to Snail promoter regulating Snail b y chromatin modifications. The absence of ER or MTA3 leads to aberrant expression of Snail and increased invasive growth of breast cancers ( Fujita et al., 2003 ) Snail is an unstable protein with a half life from 20 to 44 minutes. The function of Snail is also regulated at the protein stability and localization level s through the phos

PAGE 33

33 phorylation of a central portion of Snail protein ( Dominguez et al., 2003b ) For example, two phosphorylation motifs of GSK 3 have been identified within Snail. Phosphorylation of Snail on Ser 104 and 107 induces its nuclear export. Subsequent phosphor ylation on Ser 96 and 100 by GSK 3 facilitates the association of Snail with Trcp1 and thus leads to the ubiquitination and degradation of Snail ( Zhou et al., 2004 ) Different from Trcp1 that requires the previous phosphorylation of Snail, FBXL14, an other E3 ubiquitin ligase, interacts with Snail indep endent ly of phosphorylation and promotes i ts ubiquitination and proteosomal degradation ( Vinas Castells et al., 2009 ) Curiously, both ubiquitin ligases act through the modification of Lys 138 and 146 of Snail. Epigenetics and Histone Modifications Introduction to Epigenetics ( Waddington, 1957 ) Since then, the concept of epigenetics has evolved dramatically and extensively. Currently, epigenetics is mor e specifically referred as the study of any stable or heritable changes in phenotype or gene expression independent of changes in underlying DNA sequence ( Goldberg et al., 2007 ) of DNA methylation and histone modifications and the mechanisms by which such changes influence overall chromatin structure and gene expression

PAGE 34

34 DNA Methylation DNA methylation in vertebrates occurs almost exclusively at the cytosine within CpG dinucleoti des, and most CpGs in the genome are methylated ( Bird, 2002 ; Goll and Bestor, 2005 ) However, surprisingly, a recent genome wide DNA methylation profiling identified nearly one quarter of methylation occurs in non CpG contexts in embryonic stem cells. And this non CpG methylation disappears upon differenti ation ( Lister et al., 2009 ) CpGs tend to cluster in blocks, termed CpG islands, which are found in 60% of the proximal promoters of the human genes ( Strichman Almashanu et al., 2002 ; Takai and Jones, 2002 ) DNA methylation of these islands correlates with transcriptional silencing. The methylation of mammalian genomic DNA is catalyze d by DNA methyltransferases (DNMTs) that can be divided into maintenance and de novo DNMTs ( Siedlecki and Zielenkiewicz, 2006 ; Turkek Plewa and Jagodzinski, 2005 ) The pres ence of DNA methylation has been implicated in various cellular processes, including genomic imprinting, X chromosome inactivation, chromatin condensation, tissue specific gene expression and cell differentiation ( Bird, 2002 ) DNA methylation is also the most extensively studied ep igenetic phenomenon in cancer development. Carcinogenesis can result from aberrations of genomic methylation status of tumor suppressor genes or protooncogenes ( El Osta, 2003 ; Luczak and Jagodzinski, 2006 ) For example, DNA hypermethylation at promoter region of CDH1 or BRCA1 gene is frequently observed in different type of tumors ( Birgisdottir et al., 2006 ; Grady et al., 2000 ) Histone Modifications In eukaryotic cells, the nucleosome is the basic structural unit of chromatin. Each nucleosome is composed of 146 base pair of double stranded DNA wrapped around an

PAGE 35

35 octamer of core histones. Th e core histones are a group of small, highly conserved, basic proteins and consist of H2A, H2B, H3 and H4 ( Kornberg and Lorch, 1999 ) The N terminal tails of these histones are accessible to other nuclear proteins and subject to multiple covalent modifications, inc luding methylation, acetylation, phosphorylation and ubiquitination, which are involved in regulation of transcription, DNA repair, genome replication, and chromatin condensation ( Jenuwein and Allis, 2001 ; Strahl and Allis, 2000 ) For each of these covalent histone modifications, there are enzymes responsible for the dynamic activities that either add or r emove the particular chemical residues. The discovery of these enzymes, their substrate specificities and biological significance are of major interest in the field of epigenetics ( Kouzarides, 2007 ) A cetylation The acetylation of histones has been known for over forty years and has been correlated to active gene transcription in numerous studies ( Clayton et al., 2006 ) Acetylation generally occurs on the lysine residues at the N terminal tails of hist one H3 and H4 (6 residues on H3 and 5 residues on H4). Several families of enzymes have been identified responsible for writing or erasing of this modification, called histone acetyltransferases (HATs) and histone de acetylases (HDACs) respectively. HATs h ave been found as transcriptional coactivators, including GCN5, PCAF, CBP, p300, Tip60 ( Yang, 2004 ) w hereas HDACs have been identified as transcriptional corepressors ( Sterner and Berger, 2000 ) Recently, a genome wide mapping of HATs and HDACs This suggests HDACs may also play a role at active promoters by cont rolling acetylation levels and resetting chromatin after transcription ( Wang et al., 2009b )

PAGE 36

36 P hosphorylation Phosphorylation is another well established post translational histone modification. Phosphates can be added to both serine and threonine residues in each of the core histones and H1 ( Nowak and Corces, 2004 ) Numerous kinases have been identified that are responsible for mediation of this modification. One of great interests in early reports is the phosphorylation of Se r 10 at Histone H3 tail, which has been linked to chromosome condensation and segregation during mitosis and meiosis ( Gurley et al., 1978 ) Members of the aurora kinase family are known to govern this Ser 10 phosphorylation i n several organisms ( De Souza et al., 2000 ; Giet and Glover, 2001 ) Histone phosphorylation also shows a possible role in the induction of transcriptional induction of early response genes such as c fos and c jun, followin g stimulation of cell proliferation. They showed a conversion of MAP kinase pathways on the aurora B family members MSK1 and MSK2 to induce Ser 10 phosphorylation ( Mahadevan et al., 1991 ) However, the role of histone phosphorylation in gene activation is unclear. Phosphorylation mediated by histone kinases is counter balanced by the activity of protein phosphatase. Regulation of the level of histone phosphorylation is carried out via interplay between these two groups of enzymes. Type 1 protein phosphatase (PP1) is responsible for removing the phosphates from Ser 10 of H3 associated with mitosis ( Nowak and Corces, 2004 ) Moreover, evidence showed protein phosphatase type 2A (PP2A) activity is required for dephosphorylating histones involved in transcription regulation ( Nowak et al., 2003 ) M ethylation Histone methylation has received great attention since the last decade, due to its complexity and biological importance. The methylation can take place on the amino

PAGE 37

37 group of lysine residu es ( Murray, 1964 ) and the guanidino group of arginine resi dues on histone tails ( Paik and Kim, 1969 ) Histones H3 and H4 are the primary targets of methylation. Methylations o n residues including H3K4, K9, K14, K27, K36, K79, R2, R17, R26 as well as H4K20, K59, R3 have been studied extensively and linked to chromatin and transcriptional regulation as well as DNA damage response. Lysine methylation can occur at varying degrees either mono di or tri methylation; while arginine can be either mono or di methylated. The dimethylation of arginine also happens in either symmetric or asymmetric configuration ( Margueron et al., 2005 ; Martin and Zhang, 2005 ) Of these modifications, methylation at H3K4, H3K36 and H3K79 are associated with active promoters, whi le methylation at H3K9 and H3K27 are associated with silenced promoters ( Zhang and Reinberg, 2001 ) The first enzyme with histone methyltransferase activity was identified in the year 2000, which is almost over t hirty years later than the first discovery of histone lysine Drosophila Su(var)3 9, as a histone lysine methyltransferase with subject specificity towards lysine 9 on histone H3 ( Rea et al., 2000 ) In this study, they also mapped the cataly tic motif to the evolutionarily c onserved SET domain, which led to the discovery of numerous SET domain containing histone lysine methyltransferases such as Ezh2, MLLs, Nsd1 ( Schneider et al., 2002 ) Each of the SET containing HMTs uses S adenosyl L methionine (SAM) as the methyl group donor. Dot1 is the only identified non SET containing histone lysine methyltransferase and catalyzes methylation of K79 on histone H3 ( van Leeuwen et al., 2002 )

PAGE 38

38 Despite remarkable advances made in uncovering enzymes resp onsible for histone methylation the biological relevance of these markers ultimately depends on the recruitment of downstream effectors that read thes e covalent signals and in turn execute specific independent functions on the chromatin template. So far, various histone methyl binding proteins have been identified, many of which belong to distinct protein complexes. For example, BPTF is a component of t he NURF complex that is involved in ATP dependent chromatin remodeling. BPTF binds to tri methylated H3K4 through its PHD finger and facilitates transcriptional activation by increasing the promoter accessibility ( Mizuguchi et al., 1997 ) Transcription factor TFIID can also directly binds to the H3K4m3 mark via the PHD finger of TAF3 and regulate RNA polymerase II activity at target promoters ( Vermeulen et al., 2007 ) Heterochromatin protein 1 (HP1) is anothe r well studied histone methyl binding protein. It recognizes both di and tri methylated H3K9, the heterochromatin markers, and recruits DNA methyltransferases and Su(var)3 9 to the chromatin template. These enzymes put more repressive markers on neighbori ng nucleosomes to propagate a heterochromatin epigenetic signature ( Bannister et al., 2001 ; Nielsen et al., 2001 ) Unlike histone acetylation and phosphorylation, histone methylation was long considered static and enzymatically irreversible. It was proposed that histone methylation was erased by either passive dilution during replication, replacement of histone subunits, or proteolytic cleavage of modified tails ( Ahmad and Henikoff, 2002 ) The view was change d in 2004, with the discovery of lys ine specific demethylase 1 (LSD1) in a study of CtBP corepressor complex ( Shi et al., 2004 ) Immediately after that, numerous families of Jmjc domain containing histone lysine demethylase s were

PAGE 39

39 also uncovered, demonstrating this modification is dynamically regulated ( Shi and Whetstine, 2007 ) Lysine Specific Demethylase 1 (LSD1), LSD1, also named KDM1A, is the first identified lysine demethylase and belongs to the monoamine oxidase superfamily of flavin adenine dinucleotide (FAD) dependent enzymes. LSD1 contains an N terminal SWIRM domain commonly found in chromatin associated prot eins. The catalytic activity resides in the carboxyl terminal amine oxidase like AOL domain that contains two subdomains: a FAD binding subdomain and a substrate binding subdomain. The central region of LSD1 is the protruding TOWER domain which forms a sur face for binding of other partner proteins such as CoREST ( Anand and Marmorstein, 2007 ; Chen et al., 2006 ; Yang et al., 2006c ) LSD1 mediated demethylation is constrained on co nverting mono or di methylated lys 4 of H3 to unmethylated status, rather than tri methylated lys 4 of H3. The methylated H3K4 substrate, an amine form, is first oxidized to form an imine intermediated, which is then hydrolyzed to form the formaldehyde an d lysine. Two successive rounds of this reaction are required to generate unmodified lysine fr om its dimethyl form. Based on this chemical cha racteristic, this reaction requires at least one hydrogen on the amine substrate, which further confirms the inability of LSD1 to act on tri methylated H3K4 ( Shi et al., 2004 ; Stavropoulos et al., 2006 ) LSD1 generally acts as a transcriptional repressor by removing H3K4 dimethylation, which is an active chromatin marker. It was first identified in a study of the CtBP corepressor complex ( Shi et al., 2003 ) and then found in several different protein complexes involved in transcription al regulation and mediating distinct biological functions. Shi et al. showed LSD1 is associated with the CoREST/HDAC complex, and

PAGE 40

40 further studies indicated CoREST stabilizes LSD1 and facilitates its demethylase activity on native nucleosomes ( Lee et al., 2005 ; Shi et al., 2005 ) A recent report demonstrated LSD1 is an integral component of the NuRD nucleosome remodeling complex and helps regulate TGF signaling pathway. Expression of LSD1 inhibits the invasion of breast cancer cells in vi tro and suppresses breast cancer metastatic potential in vivo ( Wang et al., 2009a ) Furthermore, LSD1 also forms a complex with SIRT1, an NAD + dependent histone deacetylase, and coordinately represses genes regulated by the Notch signaling pathway ( Mulligan et al., 2011 ) A number of DNA binding transcription factors have been implicated in recruiting LSD1 to specific genomic locations. For example, Gfi proteins are key transcriptional repressors regulating hematopoiesis. It has been showed that Gfi 1/1b recruits LSD1/CoREST complex to majority of target gene promoters in a lineage specific pattern during hematopoietic differentiation ( Saleque et al., 2007 ) Another report showed LSD1 interacts with TLX and co regulates its target genes. TLX is an orphan nuclear receptor and regulates neur al stem cell maintenance and self renewal in both embryonic and adult brains. Inhibition of LSD1 activity leads to reduced neural stem cell proliferation ( Sun et al., 2010 ) Epigenetic Therapy for Cancer Over the past two d ecades, more and more aberrant epigenetic alterations have been linked to cancer progression. This was first evidenced by global changes in DNA methylation. Cancer cells show genome wide hypomethylation and site specific CpG island promoter hypermethylatio n, especially at promoters of tumor suppressors ( Esteller, 2008 ) Besides, misregulations of histone acetylation and methylation are also

PAGE 41

41 frequently observed in different types of cancers. For example HDAC1/2 has been associated to the etiology of colon cancer. And depletion of both HDAC 1 and HDAC2 leads to a complete block of tumor growth in mice ( Haberland et al., 2009 ) LSD1 was found significantly upregulated especially in lung, colon, and blad der cancer samples when compared to adjacent non cancer tissues, and that knockdown of LSD1 suppressed proliferation of lung and bladder cancer ce lls ( Hayami et al., 2010 ) In contrast to genetic mutations, epigenetic changes are potentially reversible. A g reat effort has been pla ced on developing drugs that target the enzymes that mediate azacytidine (azacytidine, deoxy azacytidine (decitabine, Dacogen), which are potent inhibitors of DNMTs. These two drugs have been approved by the US Food and Drug Administration (FDA) for patients with myelodysplastic syndrome and acute leukemia ( Kantarjian et al., 2006 ; Silverman et al., 2002 ) Moreove r, two HDAC inhibitors, vorinostat and romidepsin, have been approved by FDA for the rare cutaneous T cell lymphoma as well as other hematologic malignancies ( O'Connor et al., 2006 ; Piekarz et al., 2009 ) Besides these, drugs targeting other epigenetic enzymes, especially histone demethy lases, are also under development and received much atten tion. Inhibitors of monoamine oxidases, such as pargyline and tranylcypromine, have been used as inhibitors of LSD1 ( Huang et al., 2007 ) although no clinical trial has been reported yet. Summa ry Metastases, rather than primary tumors, are responsible for most cancer related deaths. However, mechanisms involved in cancer metastases are still poorly understood. Cumulative evidence demonstrated the developmental process EMT plays

PAGE 42

42 a critica l role in promoting metastasis by endowing tumor cells with higher migratory and invasive potential, enhancing resistance to apoptosis as well as g enerating tumor stem cell like properties with self renew al ability. The Snail family of zinc finger transcription factors Snail and Slug have been identified as direct repressors of a set of epithelial genes (e.g. E cadherin) and central mediators of E MT. Previous studies have shown that Snail induces repressive histone modifications at target promoters through interactions with histone modifying enzymes, in the histone deacetylases HDACs, the arginine methyltransferase PRMT5, and H3K27 methyltransferas e EZH2, a component of the Polycomb repressive complex 2 (PRC2) ( Herranz et al., 2008 ; Hou et al., 2008 ; Peinado et al., 2 004a ) These findings improved our understanding of Snail mediated repression and EMT. However, the significance of H3K4 methylation, which is critically involved in gene regulation, remains elusive in the molecular requ irements for Snail mediated EMT in human cancers, which may offer new targets for the therapeutic intervention a nd help us design more effective and specific anti invasive drugs.

PAGE 43

43 Figure 1 1. Two proposed models for cancer origination and progression (A) In the clonal evolution model, any normal cell can be a target for transformation. A cancer cell may acquire additional mutations and gain some growth advantage over other cancer cells, leading to a new clonal ex pansion. (B) In the cancer stem cell model, tumor initiating mutations likely occur in normal renew and also differentiate into other types of cells in a tumor. In both (A) and ( B), circles represent cells, stars represent mutations, and lightning bolts represent mutagenesis. A B

PAGE 44

44 Figure 1 2. The role of EMT and MET in tumor emergence and progression ( Thiery, 2002 ) Normal epithelia lined by a basement membrane can only proliferate locally. Genetic and epigenetic alterations cause carcinoma in situ. Further changes induce the dissemination of tumor cells, probably throu gh EMT. The cells intravasate into lymph or blood vessels and be transported to distant organs. In secondary sites, the circulating tumor cells can extravate and remain dormancy (micrometastasis) or form a new carcinoma through MET.

PAGE 45

45 Figure 1 3. Schematic representation of neural crest cell dissemination ( Sauka Spengler and Bronner Fraser, 2008 ) After neural tube formed, the neural crest (green) arises on either side of the dorsal aspect of the neural tube. These cells will undergo epithelial to mesenchymal transition and commit migration. Tr anscription factors such as Snail/Slug, Twist, and SoxE are implicated in the migratory behavior of neural crest.

PAGE 46

46 Figure 1 4. Comparative scheme of main structural domains found in mammalian Snail and Slug ( Peinado et al., 2007a ) Snail and Slug share a conserved carboxyl terminal zinc finger motif and amino terminal repressive SNAG domain. The central region is divergent between these two proteins. Snail has the destruction bo x and NES domain in that region, while Slug contains the SLUG domain.

PAGE 47

47 CHAPTER 2 GENERAL MATERIAL AND METHODS Cell Culture MCF7, HEK293 and HEK293FT cells were grown as monolayer culture in DMEM medium (Cellgro), supplemented with 2 mM L gluta mine (Cellgro) 100 g/mL streptomycin (MediaTech) 100 units/mL penicillin (MediaTech) and 10% (v/v) bovine calf serum (BCS, Hyclone ). They were cultured in tissue culture grade petri dishes. Tumorigenic MDA MD 231 cell s from ATCC were cultured in DMEM/F 12 medium (Cellgro), supplemented with 2 mM L glutamine (Cellgro) 100 g/mL streptomycin (MediaTech) 100 units/mL penicillin (MediaTech) and 10% (v/v) BCS (Hyclone ). The immortalized human breast epi thelial cell line MCF10A was cultured in DMEM/F12 medium (Cellgro) supplemented with 5% horse serum (Sigma), 20 ng/mL epidermal growth factor (EGF, Sigma), 10 g/mL insulin (Sigma), 0.5 g/mL hydrocortisone (Sigma), 100 g/mL streptomycin and 100 units/mL pen icillin. To establish MCF 10A Snail stable cell line linearized p cDNA3 Snail Flag plasmid was transfected into MCF10A cells using Lipofectamine2000 reagent. 48 hours later, cells were plated on 10cm petri dishes with l ow density (100 1000 cells/dish ) and selected with 1 u g/mL puro mycin (Sigma). Individual clones were isolated 10 days after selection and the overexpression of Snail Flag was confirmed by immunoblotting with antibody against Flag peptide. All cells were grown in 5% CO 2 at 37 o C Plasmids Construction SNAG GST and GST ZF The first 50 amino acids of Snail with SNAG domain was amplified by polymerase chain reaction (PCR) using the pCMV.SPORT6 Snail (purchased from

PAGE 48

48 Invitrogen) construct as template. Phusion TM high fidelity DNA polymerase (Finnzymes, F 530) was used for PCR and the reaction program was: 98 o C X 30 sec initial denaturation; 30 cycles of 98 o C X 10 sec, 58 o C X 20 sec, 72 o C X 30 sec; 72 o C X 7 min final ex tension The PCR product was subject to restriction enzyme digestion with NdeI and XhoI, and then ligat ed into the modified pGEX KG vector (made by the Lu laboratory) which can fuse GST to the C terminal end of target proteins. The zinc finger region of Snail was cut from pACT Snail ZF plasmid, which originally was cloned in the Lu laboratory for the purpos e of yeast two hybrid screening, and then was subcloned into conventional pGEX KG (GE healthcare) vector. Snail Flag and Snail P2A Flag Wildtype Flag tagged Snail construct was generated by using the full length Snail cDNA as template with the following PC GATTTAGGTGACACTATAG CCAAGAATTCA CTTGTCATCGTCGTC CTTGTAGTCGC GGGGACATCCTGAGCAG g epitope is highlighted with underline T his PCR product was cloned into pcDNA3 expression vector. The P2A mutant was generated by the QuikChange II Site Directed CGACCACTATG GCG CGC TCTTTCCTCGTC AAAGAGCG CGC CATAGTGGTCGAGGCAC (Reverse). Mu tation site is indicated underline d E cad L uciferase Reporter Human E cadherin proximal promoter region ( 115 --+52) that contains the three consecutive E boxes was amplified by PCR using human genomic DNA as template GGAA TCTAGA GGGGTCCGCGCTGCTGA GGAA CTCGAG TCTGAACTGACTTCCGCA

PAGE 49

49 was digested by XbaI and XhoI, the restriction digest sites of which are highlighted in underline in the primer sequences. And the fragment was cloned into the pGL3 basic vector (Prome ga). pCSCGW2 Snail F Lentivirus C onstruct The Snail F fragment was cut by EcoRI and NheI from pBeta Snail F plasmid, and the ends were blunted by using DNA polymerase I, large fragment (Klenow, NEB). The pCSCGW2 lentivirus expression vector, a gift from D r. Lizi Wu, was digest ed with XhoI and NheI, and followed by Klenow treatment. Then, these two plasmids were gel purified and ligated with T4 ligas e (NEB) at room temperature overnight. pGIPz Snail ER Lentivirus C onstruct In order to co express Snail ER and shRNAs targeting LSD1, the pGIPz lentivirus shRNA vector (Figure 2 1) containing specific knockdown sequence against endogenous LSD1 was used as the backbone. The estrogen receptor gene was cloned from pBP3 hbER* ( Littlewood et al., 1995 ) which only contains the hormone binding domain of mouse estrogen receptor (amino acides 281 599). Then Snail ER fusion gene was cut from pcDNA3 together with the CMV promoter by SpeI and NotI, and inserted into pGIPz bac kbones cut with XbaI and NotI, where the SpeI end matches the XbaI end. Positive clones were selected on LB agar plates with 50 g/mL ampicillin and 25 g/mL zeocin. All other protein overexpression plasmids were achieved by cloning corresponding cDNA in to pcDNA3 mammalian expression vector (Invitrogen). Protein Isolation and Immunoblotting Total pro tein lysates were isolated by first washing cells in cold PBS twice, then adding 50 200 L lysis buffer (50mM Tris pH7.5, 1mM EDTA, 1% (v/v) SDS, 1% 2

PAGE 50

50 mercapt oethanol, 20mM dithiothreitol). The samples were boiled for 10 minutes to ensure complete lysis of cells. All protein concentrations were measured by the Bradford protein assay. Then equal amount of protein lysates were analyzed by immunoblot. The samples were resolved by first adding appropriate amount of 6X loading buffer (4x Tris SDS pH 6.8, 30% glycerol, 10% SDS, 0.6M dithiothreitol, 0.012% bromophenol blue) and boiled for 5 minutes. The samples were loaded onto polyacrylamide gel for electrophoration in 1X running buffer (25mM Tris, 190mM glycine, 0.2% SDS). The gel was then electrotransferred onto polyvinylidene fluoride (PVDF) membrane using Trans Blot Semi Dry Electrophoretic transfer Cell (BioRad) in 1X transfer buffer (20mM Tris, 192mM glycine, 20 %methanol). After transfer, membranes were incubated in 5% (w/v) non fat dry milk in TBST (30mM Tris pH 7.5, 200mM NaCl, 0.05% (v/v) Tween 20) blocking solution for 1 hour at room temperature. Blocked membranes were probed with diluted primary antibody in 3% milk TBST solution for 1 hour at room temperature, or overnight at 4 o C The membranes were then washed 3 times in TBST at room temperature for 15 minutes each. They were next incubated in 1:10000 diluted peroxidase conjugated second secondary antibodies in TBST for 1 hour at room temperature. The membranes were then washed 3 times in TBST again. Bound antibodies were detected by applying Pierce ECL substrate solution (Thermo Scientific) and exposing the membrane to X ray film. Co I mmunoprecipit ation (Co IP) and GST Pull Down A ssay T ransfected HEK293 cells were washed once in PBS and collected in IP buffer (20mM Tris pH 7.4, 1mM EDTA, 150 mM NaCl, 0.5%NP40, 1 X prote ase inhibitor cocktail (Roche)) then subject to sonication for 15 sec X 3 times at output 2 (Branson,

PAGE 51

51 Sonifier 450). Unlysed cells were separated by centrifuging at 13,000 rpm for 10 min utes The supernatant, which is the whole cell lysate, was then incubated with 15 L anti Flag agarose b eads (Sigma) for overnight at 4 o C with gentle rocking. The beads were pellet down at 3,000 rpm for 5 min utes and washed for four times with washing buffer ( 20mM Tris pH 7.4, 1mM EDTA, 200 mM NaCl, 0.5% NP40). The bound proteins were strip p ed off from anti Flag agarose beads by boiling in loading buffer for 5 mi n utes and then separated on a 10% polyacrylamide gel and electro transferred to PVDF membrane for immunoblotting. Antibody against endogenous LSD1 (Millipore) was used to detect the presence of LSD1 protein in the immunoprecipitates. Anti Flag immunoblotti ng was also performed to check the immunoprecipitation efficiency. To detect endogenous Snail LSD1 interaction, similar Co immunoprecipitation procedure was applied on whole cell lysates from MDA MD 231 cells. Two different Snail antibodies (Santa Cruz an d Cellsignaling) were used to pull down endogenous Snail protein, and bound LSD1 protein was detected by a different antibody from Cellsignaling Technology. To express and purify GST fusion proteins, BL21 bacteria cells transformed with GST vector, SNAG G ST, or GST ZF plasmid were first inoculated into 2 mL LB medium containing 50 g Ampicillin at 37 o C with shaking for overnight. Next day, th e culture was enlarged to 100 mL and inc ubated for about additional 3 hours until OD reading reached 0.8 1.0 (600 nm absorbance). The protein expression was induced with 0.1mM IPTG and cultured for additional 4 hours. The cell s were harvested and GST protein s were purified using glutathione agarose beads (Sigma, G4510), according to manufacture r protocol. Purified pro teins were immobilized on the glutathione agarose beads and

PAGE 52

52 stored at 4 o C. SDS PAGE followed by Coomassie staining was performed to determine the quality and amount of fusion protein yield. Full length LSD1 protein was translated in vitro using TNT Quick Coupled Transcription/Translation System (Promega) and labeled with isotope 35 S. Final product (10 L for each pull down reaction) was incubated with the immobilized GST, SNAG GST, or GST ZF fusion protein at 4 o C with rotating for 3 hours in IP buffer (20 mM Tris pH 7.4, 1mM EDTA, 150 mM NaCl, 0.5%NP40, 1 X protease inhibitor cocktail (Roche)). The beads were washed three times with 500 L of IP buffer. The bound LSD1 protein was eluted by boiling in loading buffer (Tris HCl, pH7.5, 2% SDS, 50% glycerol, 10% beta mercaptoethanol), and subjected to SDS PAGE separation. After electrophoresis, the protein gel was dried and assessed by autoradiography. RNA Isolation, R everse Transcription, and Real T ime PCR Samples were collected and homogenized by vortex in 0.5 mL Trizol reagent (Invitrogen) to obtain total RNA. 0.1 mL of chloroform was added to each homogenized samples. The samples were then centrifuged at 12,000 x g for 15 minutes at 4 o C to separate aqueous and phenol chloroform ph ases. The aqueous phase was extracted from each sample to a new tube. The RNA was precipitated with the addition of 75% isopropanol (v/v) and centrifuged maximum speed at 4 o C for 10 minutes. The R NA pellets were washed with 1 mL of 75% ethanol and centrifu ged again to remove supernatant. The pellets were air dried for 5 minutes before dissolving in sterile filtered TE (10mM Tris pH 8.0, 1mM EDTA) and stored at 80 o C Approximately 1 g total RNA for each sample was added to a reaction cocktail containing DE PC treated ddH 2 O, 2.5 M dNTP, and 5 nM random primers to 16 L final

PAGE 53

53 volume. The mixture was incubated at 70 o C for 5 minutes, and quenched quickly on ice. 2 L of 10X RT buffer (NEB M MuLV), 1 L RNase inhibitor (Promega), and 1 L M MuLV Reverse Transcri ptase (NEB) were added to the reaction to a final volume of 20 L which was incubated at 42 o C for 1 hour. The reac tion was heat inactivated at 65 o C for 20 minutes, and was diluted to 200 L with ddH 2 O. 1 2 L of diluted template was used for real time PCR Each real time PCR reaction was composed of the following: 1 L cDNA generated from reverse transcription, 1 L of 5 M primer mix working solution, 8 L ddH 2 O, and 10 L of 2X SYBR Green PCR Master Mix (Applied Biosystems). Triplicates were done for each rea c tion and results were expressed as relative quantitation normalized to endogenous beta actin expression. Reactions with no template were also included on real time PCR plate for each set of primers as negative control. Gene expression fold differences were calculated as 2^( Ct), The thermal cycling parameters were as follows: 95 o C for 10 minutes, 40 cycles of 95 o C for 15 sec onds for denaturing step and 60 o C for 60 second for product extension, and a melting curve analysis was performed at the end of each run. StepOne (48 well), or StepOnePlus (96 well) real time PCR machines (Applied Biosystems) were used for data collection. Prime rs used were listed in Table 2 2 Chroma tin Immunoprecipitation (ChIP) A ssay I n general, both MCF10A and MC F10A Snail stable cells were cultured in indicated medium until confluent. Formaldehyde was added to the culture medium at a final concentration of 1% and incubated at room temperature for 10 min utes. Then 2.5M glycine was added to a final concent ration of 0.125M to stop the cross linking reac tion.

PAGE 54

54 Cross liked cells were washed once with cold PBS and scraped off the dish, and then washed with both pellet washing buffer 1 (0.25% TritonX 100, 10mM EDTA, 0.5mM EGTA, 10mM Tris pH8.0) and washing buffer 2 (0.2M NaCl, 1mM EDTA, 0.5mMEGTA, 10mM Tris pH8.0) successively. The cells were then re suspended in sonication buffer (1mM EDTA, 0.5mM EGTA, 10mM Tris pH8.0) and subjected to sonication to shear the chromatin. The sonication condition is: 20 sec ond at power 5 (B ranson, Sonifier 450) with two min utes cooling down on ice, 8 rounds in total. A small aliquo t of sonicated chromatin was reverse crosslinked and run on a 1.5% agarose gel to check the sonication efficiency, and the DNA length should be centered around app roximately 500bp, and primarily smaller than 1000b p. The sonicated samples were diluted in ChIP buffer (0.01% SDS, 1.0% TX 100, 1.0mM EDTA, 20mM Tris pH 8.1, 15 0 mM NaCl) and divided into 1 mL aliquots, each of which represents approximately 2.5 X 10 6 cell s, and incubated with specific antibo dies at 4 o C overnight. Non immune same species IgG was used as the non specific control. A 50 L aliquot of pre washed Protein A/G slurry (Invitrogen) was added to each aliquot and incubated for addit ional 2 hours at 4 o C with rotating. The beads were subjected to a series of washing steps to remove non specific binding, and finally incubated with elution buffer (1% SDS, 0.1M NaHCO 3 ) at room temperature for 30 min utes to elute the protein DNA complexes. Supernatant from the non specific Ig G immunoprecipitated sample serve d anal yses in later steps. DNA was released from the complexes by reverse cross linking at 65 o C with 200 mM NaCl for overnight. Reverse cross linke d DNA was in cubated with Prot einase K at 45 o C for 1 hour to remove proteins, purified by phenol/chloroform extr action. Final DNA sample was subjected to quantitative real time PCR by using

PAGE 55

55 StepOne PCR system (Applied Biosystem) and SYBR Green dye as detection reagent. ChIP qPCR primer s were listed in Table 2 3. T he condition for the PCR was : 94 o C X 15 min utes for initial denaturation; 94 o C X 15 sec, 60 o C X 45 sec for 40 cycles. After PCR, melting curve was added to ensure that a single product is amplified in t he reaction. The results were expressed as the ratio to input DNA. Transfection and Luciferase Reporter Assay For transfection, cells were seeded at ~60% confluency 18 hours prior to Transfection. They were transfected using TurboFect in vitro Transfection Reagent (Fermentas) acco g of DNA was diluted in 100 L of serum free DMEM. Then briefly vorte x TurboFect reagent and add 2 uL of it to the diluted DNA, and mixed by pipetting. The whole mix was incubated at room temperature for 20 30 minutes to form a cationic lipid mediated Transfection complex before adding to culture d cells. For the luciferase re porter assay, MCF7 cells were seeded in a 12 well plate at a density of 1.0 X 10 5 At 18 24 hours after plating, the cells were transfected as indicated above. 36 48 hr after transfectio n, cells were collected and assayed with Duo Glo luciferase assay system (Promega). For each well, 50 L of cell lysate was mixed with equal volume of Dual Glo luciferase reagent at room tempe rature for 15 min utes and measured for firefly luciferase activity in a luminometer (Pharmingen, Monolight 3010). Then, immediately, 50 L of Dual Glo Stop & Glo reagent was added to the mixture and mixed at room temperature for additional 15 min utes and the Renilla luminescence was measured, which was used as a reference to normalize transfection efficiencies in all

PAGE 56

56 experiments. At least three independent replications were performed for each experiment. Statistical Analysis Statistical analyses were der ived from at least three independent experiments. Error bars for three independent experiments were presented as the standard deviation t test. Immunofluorescence Sta ining Cells were grown directly onto glass cover slips in 6 well tissue culture plate and transfected with Snail GFP plasmid 24 hours before Immunofluorescence staining procedure. To stain for the endogenous LSD1, the cover slips were rinsed with PBS twice and cells were fixed in 3.7% formaldehyde/PBS solution at room temperature for 5 minutes. Then, the cells were rinsed with 0.1% NP 40/PBS 3 times. During the last of wash, the cell membrane was permeablized for 15 minutes at room temperature with 0.1% NP 40/PBS. Before the primary antibody, cells were blocked in 3%BSA/0.1%NP 40/PBS solution for 30 minutes. Next they were incubated with 1:200 diluted LSD1 antibody (Cellsignalling) in 3% BSA/0 .1%NP 40/PBS for overnight at 4 o C. They were then rinsed three ti mes with 0.1% NP 40/PBS for 5 minutes at room temperature followed by incubating with 1:500 diluted flurophore conjugated secondary antibodies (Invitrogen) in 3% BSA/0.1% NP 40/PBS solution for 1 hour at room temperature in the dark. Again, the cover slips were washed three times in 0.1% NP 40/PBS for 5 minutes at room temperature, followed by a quick rinse with water, and then counterstained with 200 g/mL of Hoechst 33342 for 5 minutes at room temperature. The cover slips were rinsed with water, and allow ed to air dry in the dark for couple minutes. The cover slips

PAGE 57

57 were mounted onto glass slides using Fluoromount G (Southern Biotech) and allowed to dry overnight at 4 o C in the dark. Glass was stored at 4 o C. All images were taken under Leica DM6000B fluoresc ence microscope (Leica) at the same magnitude. In Vivo Tumor Xenograft MDA231 pGIPz or MDA231 shLSD1 cells (5 X 10 6 ) were re suspended in a mixture of 100 L of serum free medium and Matrigel (BD Biosciences; 2:1 ratio) and injected into the fourth mammary gland fat pad of severe combined immunodeficient (SCID) mice aged at 6 to 8 weeks. T hen the growth of tumors was measured every week with a ruler for total of more than 60 day s, and the tumo r volumes was calculated with the following formula: volume (mm 3 ) = (4/3) * ( length/2 ) 3 The tumor growth rate was modeled by plotting tumor volumes against corresponding time points. And the difference of final tumor weight between LSD1 knocked down c ells and control cells was test with significance level =0.01. Lentivirus Production and Infection To generate lentiviral particles, the shRNA plasmids containing either specific knockdown sequence or non target sequence as contr ol were transiently transfected into the HEK293FT a transformed HEK293 cell line. Two lentiviral plasmids MD2G (envelope plasmid) and PAX (packing plasmid) were co transfected to facilitate virus production and packaging. 48 hours after transfection, the v irus containing media was collected and passed through a 45 m filter to exclude cell debris. The viral media was aliquoted and either used immediately to infect target cells, or stored at 80 o C. Target cells were plated 24 hours prior to lentiviral infec tion. Adherent cells were infected by replacing culture media with the infection cocktail, which consisted of 1:1

PAGE 58

58 viral media: culture media and 4 g/mL polybrene. After 24 hours of incubation, the infection cocktail was changed to fresh media for an addit ional 24 hours of recovery. Then the cells were treated with 1 g/m L puromycin dihydrochlorid (Cellgro) for a week to eliminate uninfected cells. The media was changed every 2 days. The transformed stable cells were stocked in freezing media (bovine serum albumin containing 10% v/v DMSO at 80 o C), or maintained in culture media with lower concentration of puromycin (0.2 0.5 g/mL ). DNase Accessibility Assay The DNase accessibility assay was performed as described ( Hempel and Ferrier, 2004 ) 2.5 5.0X10 5 cells were collected in cold PBS and washed twice by centrifuging at 1000 g for 5 minutes. Then cell pellet was suspended in buffer A (15 mM Tris pH 7.4, 60 mM KCl, 15 mM NaCl, 1 mM EDTA, 1 mM EGTA, 0.01% NP40) with protease inhibitor and incubated on ice for 5 minutes. The nuclei were isolated by centrifuging at 1500g at 4 o C fo r 10 minutes. Pelleted nuclei were re suspended in 200 L of 1X DNase reaction buffer (40 mM Tris HCl, 10 mM MgCl 2 1 mM CaCl 2 ) in preparation for digestion. Chromatin digestion reactions were carried out with 0 U and 5 U/mL DNase (Promega, M6101) at 30 o C for 30 minutes. Reactions were stopped by addition of 10 L of 0.5 M EDTA. After that, samples were in cubated with Proteinase K at 45 o C for overnight to remove proteins, and DNA was purified by phenol/chloroform extr action. Final DNA sample was subjected t o quantitative real time PCR by using StepOne PCR system (Applied Biosystem) and SYBR Green dye as detection reagent. The PCR program is the same as used in ChIP qPCR. Primers were de signed to amplify the regions flanking

PAGE 59

59 the transcription start sites of C DH1, HBB, or GAPDH. The level of resistance to DNase was calculated as the percentage of corresponding undigested sample.

PAGE 60

60 Figure 2 1. Cloning vector information for pGIPz lentiviral vector with mir30RNA. A). Vector map and unique restriction sites of pGIPZ vector. B). XbaI site before CMV promoter and NotI site immediat ely after GFP gene were used to insert Snail ER. The whole mRNA was driven by a single CMV promoter ensur ing coexpression of Snail ER and shRNAs. IERS Puro r cassette allows for selection of stable integrates. Abbreviations: cPPT is central polypurine tract facilitating lentiviral vector nuclear export, CMV is cytomegaloviral promoter, GFP is green fluorescenc e protein, IRES is internal ribosome entry site, Puro is puromycin. A. B XbaI NotI

PAGE 61

61 Table 2 1. List of primers used for real time RT PCR Target Name Forward Reverse Tm hSnail CACTATGCCGCGCTCTTTC GGTCGTAGGGCTGCTGGAA 60 o C hCDH1 CAGTGAACAACGATGGCA TT CTGGGCAGTGTAGGATGTG A 60 o C hCLDN7 GGATGATGAGCTGCAAAA TG CACCAGGGAGACCACCATT A 60 o C hKRT8 ACCCAGGAGAAGGAGCAG AT CTCCACTTGGTCTCCAGCAT 60 o C hACTB AGAAAATCTGGCACCACA CC AGAGGCGTACAGGGATAGC A 60 o C hGAPDH GACCACAGTCCATGCCAT CAC CATACCAGGAAATGAGCTTG AC 60 o C Table 2 2. List of primers used for other real time PCR Target Name Forward Reverse Tm Ecad_ 5kb CCAGGAGATGAAAGGGAC AA GGATCACAGACTCCAGGTTT C 60 o C Ecad_Pro AATCAGAACCGTGCAGGT CC ACAGGTGCTTTGCAGTTCCG 60 o C CLDN7 GGATGATGAGCTGCAAAA TG CACCAGGGAGACCACCATT A 60 o C KRT8 ACCCAGGAGAAGGAGCAG AT CTCCACTTGGTCTCCAGCAT 60 o C CDH1_T SS ATTCGAACCCAGTGGAAT CA TCACAGGTGCTTTGCAGTTC 60 o C HBB_TS S AAGCCAGTGCCAGAAGAG CCAAGGA CCCACAGGGCAGTAACGGC AGACTT 60 o C GAPDH_ TSS CGGCTACTAGCGGTTTTA CG CTTCAGGCCGTCCCTAGC 60 o C

PAGE 62

62 Table 2 3. List of antibodies used for Westernblotting (WB) Immunofluorescence (IF), Immunoprecipitation (IP), and Chromatin Immunoprecipitation (ChIP) Antibody Species Isotype Company Catalog Number Application Flag N/A Mouse IgG Sigma F 1804 WB, IP, ChIP Ecadherin Human Rabbit IgG Cell Signaling 4065 WB Occludin Human Rabbit IgG Thermo Scientific RB 10681 WB LSD1 Human Rabbit IgG Cell Signaling C69G12 WB, IF, ChIP Snail Human Mouse IgG Cell Signaling L70G2 WB Snail Human Rabbit IgG Cell Signaling C15D3 WB, IP Snail Human Rabbit IgG Santa Cruze sc 28199 IP Tubulin Human Mouse IgG Sigma T 6199 WB H3K4m2 Human Rabbit antiserum Millipore 07 030 WB, ChIP H3K4m3 Human Rabbit IgG Cell Signaling C42D8 WB, ChIP Alexa Fluor 594 Rabbit Donkey IgG Molecular Probes ( Invitrogen) A21207 IF HRP Donkey anti mouse Mouse Donkey IgG Jackson ImmunoResearch 715 035 150 WB HRP Donkey anti rabbit Rabbit Donkey IgG Jackson ImmunoResearch 715 035 152 WB

PAGE 63

63 CHAPTER 3 SNAIL RECRUITS LSD1 TO EPITHELIAL PROMOT ERS DURING EMT Study Bac k ground Over the last decade, significant progress has been made in understanding the mechanism underlying epithelial mesenchymal transition. The Snail family of zinc finger transcriptional repressors is known as the master regulator of EMT. Snail is located at th e hub of multiple signaling pathways leading to EMT. Upregulation of Snail can induce EMT by downregulating many epithelial cell markers ( Nieto, 2002 ) Snail family members are C2H2 type zinc finger transcription factors. They all share a highly conserved carboxyl terminal region with multiple zinc fingers, which are designated for sequence specific DNA binding. The bi nding motif for Snail members is identical to the so called E box, the consensus core binding site of basic helix loop helix (bHLH) transcription factors. The amino terminal region is much more divergent. In vertebrate members, a conserved repression domai n termed SNAG is identified. The SNAG domain extends to about 20 amino acids and is present in diverse transcriptional repressors including Gfi 1, IA 1, Gsh 1, and Ovo. The SNAG domain has been shown to be essential for repression mediated by Gfi 1 ( Grimes et al., 1996a ) and Snail ( Batlle et al., 2000b ) On binding to DNA, Snail primarily acts as a transcriptional repressor. The repressive activity depends not only on the zinc finger region, but also on the amino terminal SNAG domain. Epigenetic regulation has been recognized as a key mechanism controlling gene expression. Histone tails are subject to different types of modifications including phosphorylation, ubiquitinatio n, acetylation and methylation. Enzymes corresponding for these modifications have been found as either co activators or co repressors for

PAGE 64

64 numerous transcription factors ( Bernstein et al., 2007 ) Histone lysine methylation is of the most interest for many epigenetic studies, due to its high level of complexity. It was long considered irreversible until the discovery o f LSD1 as well as many other Jmjc domain containing histone demethylases, demonstrating this modification is dynamically regulated ( Shi and Whetstine, 2007 ) Chromatin immunoprecipitation (ChIP) assay has been emerging as one of the most powerful methods in the epigenetic field. ChIP has been widely used to capture both direct and indir ect association of proteins with specific genomic regions in the context of intact cells ( Wells and Farnham, 2002 ) The original chromatin structure is captured by formaldehyde induced cross linki ng. Then the chromosome is broken down into small pieces by either sonication or nuclease digestion. The DNA protein complex is subject to immunoprecipitation with corresponding antibodies. The abundance of specific proteins bound to interested genomic regions, e.g. promoter or enhancer, is eventually evaluated through quantitative polymerase chai n reaction. In this study, I further examined histone lysine methylation status changes induced by Snail at its target promoters, since the epigenetic regulation is expected to be critical in cont rolling their expression. The first in vitro EMT model was discovered by Stocker and Perryman using the Madin Darby canine kidney (MDCK) cells. MDCK is a polarize d epithelial cell line and can be experimentally converted into migratory fibroblasts in pe tri dish by incubation with conditioned medium from cultured fibroblasts ( Stoker and Perryman, 1985 ) After that study various EMT systems were established in different epithelial cell lines leading to an exponential discovery of EMT controlling signaling pathways and transcription

PAGE 65

65 factors. MCF10A is one of those excellent EMT model systems. MCF1 0A is an immortalized, non transformed epithelial cell line derived from human fibrocystic mammary tissue ( Soule et al., 1990 ) It lacks th e ability to either form tumors in nude mice or to grow in an anchorage independent manner. Parental MCF10A cells show classical epithelial morphology and grow as clusters of cells with extensive cell cell contacts. It also demonstrates substantial phenoty pic plasticity that it can be induced to mesenchymal like phenotype by various EMT regulating factors such as Snail, Slug, Twist and Zeb2 ( G jerdrum et al., 2009 ) This makes MCF10A easy for manipulating and a popular model in studying EMT. Results S nail Directly Represses Epithelial Genes in MCF10A in tended to map the histone modifications especially the methylation pattern at epithelial promoters in Snail induced EMT. It has been shown previously that forced expression of Snail drives EMT in several types of epithelial cells concomitantly with downreg ulation of epithelial markers. We decided to establish a Snail dependent EMT system in MCF10A cell line, an immortalized human mammary epithelial cell line which has widely been used as an EMT model system. Because it is known that amino terminal fusions d Flag construct in which the Flag epitope tag was fused to the carboxyl terminus of Snail. Linearized plasmid DNA was introduced into MCF10A cells by regular transfection, and stable clon es were obtained by puromycin selection for 5 6 consecutive weeks. Parental MCF10A cell shows cobblestone like morphology with extensive cell cell contacts (Figure 3 1A). However, the Snail expressing cells became scattered, contacted their

PAGE 66

66 neighboring cel ls only focally, and adopted a fibroblast like appearance typical of mesenchymal cells (Figur e 3 1B). This phenotypic change was accompanied with loss of expression of epithelial markers E cadherin and Occludin as shown by western blotting (Figure 3 1C). T hese observations indicate an epithelial to mesenchymal morphological transition in Snail expressing cells. The E recognized by Snail (Figure 3 2A) ( Nieto, 2002 ) Two additional epithelial genes claudin 7 ( CLDN7 ) and cytokeratin 8 ( KRT8 ) were selected, both of which were reported as direct targets of Snail ( De Craene et al., 2005a ; Ikenouchi, 2003 ) and also carry multiple E boxes at their promoters (Figure 3 2A). I verified whether Snail directly bound to the promoter s of these epithelial genes in vivo by chromatin immunoprecipitation (ChIP) assays. Chromatin from parental and Snail Flag expressi ng MCF10A cells was immunoprecipitated with a control immunoglobulin (IgG) and anti Flag antibodies. Then I performed quantitative polymerase chain reaction on the recovered DNA to determine the enrichment of the proximal promoter regions of the epithelial genes as compared with a 5kb upstream region ( 5kb) of E cadherin, which serves as a negative control. Occupancy of Snail was detected specifically in the promoters of E cadherin, CLDN7 and KRT8 in the Snail Flag cells (Figure 3 2B). To confirm that these epithelial genes are indeed inhibited by Snail, we conducted a similar ChIP assay to monitor the binding of RNA polymerase II at their promoters. Consistent with E cadherin expression, high levels of RNA polymerase II were detected at the E cadherin promo ter in MCF10A cells. In contrast, this binding was largely abolished in cells expressing Snail. Similar pattern was observed for the CLDN7 and

PAGE 67

67 KRT8 promoters (Figure 3 2C). These results suggest that Snail directly represses epithelial markers and induces EMT in MCF10A cells. Snail Downregulates H3K4m2 Levels at Epithelial Gene Promoters Having established an EMT model, I applied ChIP analysis to survey potential Snail induced histone modifications at the target promoters. As previously reported in other studies, I observed a reduction of H4 acetylation level and an induction of H3K27m3 level in the Snail expressing cells when compared to control MCF10A cells (data not shown). Both di and tri methylated H3K4 are associated with active transcription ( Kouzarides, 2007 ; Li et al., 2007 ) I then assessed the changes of active H3K4 methylation marks at the epithelial gene promoters caused by ectopic Snail expression by using an antibody specific for H3K4m2. Relatively high levels of H3K4m2 were detected at the promoter of the E cadherin, C LDN7, and KRT8 genes in MCF10A cells. However, this active mark was significantly decreased specifically at the promoter regions in the Snail stable cells (Figure 3 3A). Therefore, the levels of H3K4m2 in the E cadherin promoter correlated with E cadherin expression as shown by western blotting. At the same time, I also carried out a similar ChIP assay for the abundance of tri methylated H3K4 at E cadherin promoter. Surprisingly, I did not see a significant difference of this mark between parental and Snail expressing cells (Figure 3 3B). High levels of H3K4m3 were observed at the E cadherin promoter in both groups of cells, even though E cadherin is inactive in MCF10A Snail Flag stable cells. That indicates expression of Snail only leads to a specific decre ase of H3K4m2 at its target promoters. Snail Interacts with LSD1 Reduction in di methylated H3K4 mark cannot be mediated directly by any known Snail associated histone modifying enzymes. There are two types of histone

PAGE 68

68 demethylases are responsible for remo ving the methyl group from H3K4m2: LSD1, which belongs to the class of flavin adenine dinucleotide (FAD) dependent amine oxidases, and members of the JARID1 (KDM5) family of Jumonji (JmjC) domain containing demethylases ( Klose and Zhang, 2007 ; Shi, 2007 ) LSD1 is found as a co repressor for many transcription factors, and forms core ternary complex with HDAC1/2 and CoREST ( Lan et al., 2008a ) This complex, when recruited to chromatin template, can efficiently bind and modify nucleosomal substrates to repr ess transcription. Unlike JARID1, LSD1 cannot catalyze demethylation on tri methylated H3K4 ( Shi et al., 2004 ) Because Snail decreases the level of H3K4m2 but not H3K4m3, the LSD1 complex becom es a promising candidate to mediate the repressive function of Snail. Both of mammalian Snail and Slug share a highly conserved amino terminal termed SNAG domain. A recent report has demonstrated that Gfi 1, another SNAG domain containing protein, interact s with LSD1 corepressor complex, and a mutation in the SNAG domain of Gfi 1 abolishes this association ( Saleque et al., 2007 ) suggesting that SNAG is necessary for recruitment of the LSD1 complex. This study raises the possibility th at SNAG domain might be sufficient for interaction with the LSD1 complex, and thus Snail might regulate gene expression by recruiting the LSD1 complex to its target promoters to remove methyl groups from di methylated H3 lysine 4. To test the potential as sociation between the SNAG domain of Snail and the LSD1 complex, we performed the in vitro glutathione S transferase (GST) pull down assay. GST pull down assay is a relatively easy, straightforward method and extensively used to determine physical interact ion between two protei ns and to map interaction sites. Since the SNAG domain apparently does not tolerate any fusion to its

PAGE 69

69 amino terminus, we specifically placed GST at the carboxyl terminus of the SNAG GST fusion protein (Figure 3 4A). The recombinant SN AG GST and GST (control) proteins were produced and affinity purified from bacteria. Then these fusion proteins were incubated with whole cell lysates prepared from the mammalian HEK293 cells transfected with Flag LSD1. Unbound proteins were washed away, a nd the precipitates were subject to Western blotting analysis. Based on Western blotting with the anti Flag antibody, LSD1 was shown to be associated with SNAG GST but not GST alone (Figure 3 4C). Moreover, other components of the LSD1 core complex, the en dogenous CoREST and HDAC1 specifically bound to SNAG GST as well (Figure 3 4C). The result suggests that SNAG domain of Snail is sufficient to bind to the LSD1 complex. To elucidate whether this interaction is direct or not, and which subunit of the LSD1 c omplex mediates the interaction with Snail, I carried out similar GST binding assays. LSD1, CoREST, and HDAC1 proteins were produced by in vitro transcription and translation and labeled with 35 S, and then were incubated with GST, SNAG GST, and GST ZF. Neither CoREST or HDAC1 showed any signal after washing (data not shown), while LSD1 displayed readily detectable association with SNAG GST (Figure 3 4B), indicating that LSD1 is responsible for di rect interaction with the SNAG domain of Snail and the other components of the core LSD1 complex are recruited to Snail in an in directed manner. Besides, the specificity of the interaction was further confirmed by lack of binding between LSD1 and the carb oxyl terminal zinc finger motifs of Snail (Figure 3 4B). Furthermore, I also examined which region of LSD1 is involved in binding. A truncated LSD1 mutant that lacks the carboxyl terminal part of amine oxidase

PAGE 70

70 domain (AOD_C) was generate d And this mutant retains the ability to interact with SNAG domain (Figure 3 4D). To determine whether Snail and LSD1 might form complex in vivo I carried out co immunoprecipitation assays. In addition, my previous GST pull down assay indicated SNAG domain is sufficie nt to directly interact with LSD1. I want to further test if SNAG is also essential for the interaction. I made a point mutation in the SNAG domain, which changed the second proline to alanine (P2A), since this mutation has been shown to interrupt the repr essive capability of SNAG domain in both Snail and Gfi 1. Cellular extracts prepared from HEK293 cells transiently transfected with Flag tagged wildtype Snail or the P2A mutant form wer e subjected to immunoprecipitation with anti Flag antibodies. The prese nce of endogenous LSD1 was detected in the precipitates obtained only from cells expressing wildtype Snail, but not the P2A mutant (Figure 3 4E). This evidence supports the association between Snail and LSD1 in vivo, and suggests a functional SNAG domain i s required for this interaction. 2% of each lysates was saved before immunoprecipitation and loaded as input control, to ensure equal amount of protein was used for co IP and similar transfection efficiency. Moreover, the ability of Snail to interact with LSD1 was confirmed by immunoprecipitation assays between the endogenous proteins in the highly metastatic MDA MD 231 breast tumor cells. Endogenous LSD1 was found to be co immunoprecipitated with endogenous Snail in the immuocomplexes obtained with an anti Snail antibody but not IgG control (Figure 3 4F). Finally, Immunofluorescence was used to further confirm the association between Snail and LSD1, and also to monitor the subcellular localization of these two

PAGE 71

71 proteins. I generated a Snail GFP fusion prote in expressing plasmid and transfected it into MCF10A cells. Endoge nous LSD1 protein was detected by anti LSD1 primary antibody with fluor conjugated anti rabbit secondary antibody. Snail GFP exhibited a nuclear speckle pattern and found largely overlapped with LSD1 in nuclei (Figure 3 4G). Snail Recruits LSD1 to its Target Gene Promoters We have shown that Snail binds to the E cadherin promoter and causes reduction in H3K4m2 in Figure 3 1 and Figure 3 2. Given the interaction between Snail and LSD1, it is c onceivable that during EMT Snail may recruit LSD1 to the epithelial gene promoters where LSD1 catalyzes demethylation on the H3K4m2 mark. To validate this idea, I performed ChIP analysis to examine the relative fold of enrichment of LSD1 at the Snail targe t promoters. As expected, I observed a significant increased binding of LSD1 at the E cadherin, CLDN7, and KRT8 promoters, but not the 5kb upstream control region of E cadherin promoter in the Snail expressing cells compared to MCF10A control cells (Figure 3 5A). The levels of LSD1 binding inversely correlated with H3K4m2 (Figure 3 3A). Next, I tested if the occupancy of LSD1 at these promoters is dependent on Snail. Depletion of Snail was based on a lentivirus mediated RNA interference. MDA MD 231 cells we re infected with lentivirus carrying short hairpin RNA sequence specifically targeting human Snail. The knockdown efficiency of Snail was verified by RT PCR (Figure 3 5B&C). Then I compared LSD1 occupancy at epithelial gene promoters. Results showed the bi nding of LSD1 to the E cadherin and CLDN7 promoters decreased in the Snail knockdown cells (Figure 3 5D). The remaining signal of LSD1 might be because of the presence of Slug in these cells ( Hajra et al., 2002 ) Tak en together, the present data support of a model that Snail directly recruits LSD1 to

PAGE 72

72 the epithelial promoters via protein interaction and LSD1 in turn epigenetically modifies the promoter chromatin structure by demethylating the active H3K4m2 mark. Summary In this study, I used MCF10A as a model system. Ectopically expressing Snail in MCF10A induced epithelial to mesenchymal morphology change accompanied by downregulation of epithelial markers (Figure 3 1). Then I investigated the epigenetic mechanis m underlying Snail mediated transcriptional repression of epithelial genes by surveying repressive histone modifications. It has been recently reported that Snail interacted with the PRC2 complex and Snail mediated transcriptional repression associated wit h H3K27m3 ( Herranz et al., 2008 ) Trimethylation of H3K27 by the PRC2 complex enzymatic component EZH2 is related to gene silencing and facultative heterochromatin formation ( Schuettengruber et al., 2007 ) Consistently to previous studies, I detected high levels of H3K27m3 in the E cadherin promoter specifically in the Snail expressing cell s. In addition to that, I also observed a significant reduction of H3K4m2 at epithelial promoters (Figure 3 3), which indicates LSD1 as a potential candidate corepressor of Snail. To test this idea, I first performed GST pull down assays. I not only showed Snail physically interacts with LSD1, but also mapped the region of Snail involved in binding down to the amino terminal SNAG domain. The P2A mutation in SNAG domain disrupted Snail LSD1 association. Co immunoprecipitation assays further demonstrated that Snail and LSD1form endogenous complex (Figure 3 4). Furthermore, Chromatin immunoprecipitation experiments showed LSD1 was recruited to epithelial gene promoters by Snail and inversely correlated with H3K4m2 levels introduced by Snail. Depletion of Snail in MDA MD 231 cells reduced LSD1 enrichment at Snail target promoters.

PAGE 73

73 LSD1 is the first identified histone demethylase which removes methyl groups from lysi ne 4 of histone H3. Dimethyl H3K4 is a transcription activation chromatin mark enriched in the pro moter regions of activ ely transcribed genes and demethylation of this mark by LSD1 thus represses gene expression. Consistently, LSD1 is a componen t of various transcriptional co repressor complexes that often include HD AC1/2 and CoREST. The latter is a cofactor for LSD1 required for demethylation of nucleosomal substrat es. Having established the association between Snail and LSD1, my further studies will involve investigating the biological s ignificance of this association related to

PAGE 74

74 A B C Figure 3 1. Ectopic expression of Flag tagged Snail in MCF10A cells. (A). Phase contrast of wildtype MCF10A under microscope. (B). Phase contrast of MCF10A Snail Flag stable cell. (C). Snail downregulates epithelial markers E cadherin and Occludin. Protein lysates from control and Snail Flag MCF10A cells were probed by western blotting with indicated antibodies.

PAGE 75

75 0 0.5 1 1.5 2 2.5 3 IgG Pol II IgG Pol II A 0 1 2 3 4 5 6 IgG Flag IgG Flag Percent of Input MCF10A MCF10A SNA 0 0.5 1 1.5 2 2.5 IgG Flag IgG Flag B 0 0.5 1 1.5 2 2.5 3 3.5 4 IgG Pol II IgG Pol II Percent of Input MCF10A MCF10A SNA Ecad 5kb Ecad Pro CLDN7 KRT8 Ecad 5kb Ecad Pro CLDN7 KRT8 C Figure 3 2. Snail binds to epithelial promoters. (A). Diagrams of the proximal promoters of E cadherin, CLDN7 and KRT8. Vertical bars represent E boxes. Arrows indicate primers used in chromatin immunoprecipitation (ChIP) qPCR. (B). Snail is specifically enriched at t he proximal promoter of E cadherin, CLDN7 and KRT8 in vivo as shown by ChIP analysis. The results are represented as percentage of input chromatin and errors indicated S.D. from triplicate experiments. (C). Expression of Snail in MCF10A dissociates RNA pol ymerase II from target promoters.

PAGE 76

76 Figure 3 3. Snail reduces H3K4m2 at its target gene promoters. (A). Overexpression of Snail causes a reduction in H3K4m2 levels at the E cadherin, CLDN7, and KRT8 promoters, but not in the 5kb upstream region of E c adherin gene. The enrichment was determined by chromatin immunoprecipitation (ChIP) assay. IgG was used as negative control for immunoprecipitation. (B). The H3K4m3 mark at the E cadherin promoter is not significantly affected by Snail. (C). H3K27m3 is dra matically increased at the E cadherin promoter after overexpression of Snail.

PAGE 77

77 A C B D Figure 3 4. Snail physically interacts with histone demethylase LSD1 in vitro and in vivo (A). Schematic diagram of SNAG glutathione S transferase (GST) and GST ZF fusion proteins used in GST pull down assays. (B). LSD1 directly interacts with the SNAG domain. Full length LSD1 was in vitro translated and labeled with 35 S. The product was then mixed with GST, SNAG GST or GST ZF fusion proteins. Bound LSD1 was then detected by autoradiography after SAS PAGE. Coomassie staining shows the protein loading of GST, SNAG GST and ZF GST. (C). The S N AG domain is sufficient for association with the LSD1 Whole cell lysates prepared from HEK293 cells transfected with Flag LSD1 was incubated with GST or the SNAG GST fusion protein and followed by western blotting analysis using anti Flag, anti CoREST and anti HDAC antibodies. Coomassie staining of GST protei ns was shown.

PAGE 78

78 E F G Figure 3 4 continued. (D) The amino terminus of LSD1 interacts with SNAG. (E) The immunoprecipitation of whole cell lysates from HEK293 cells overexpressing Flag tagged wild type Snail or Snail P2A mutant was performed with anti Flag antibody. Western blotting with an anti LSD1 antibody showed the presence of LSD1 in the precipitates. Anti Flag western blotting indicates expression of wild type and mutant Snail. (F) Endogenous Snail and LSD1 form a complex in vivo. MDA MB 231 cells were lysed and incuba ted with two anti Snail antibodies (#1 from Santa Cruz, #2 from Cell Signaling) or control immunoglobulin G, followed by western blotting with the LSD1 antibody. (G) Immunofluorescence for Snail and LSD1 localization in nuclei. Snail was fused with GFP pro tein, and endogenous LSD1 was detected by anti LSD1 antibody.

PAGE 79

79 A 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 IgG LSD1 IgG LSD1 IgG LSD1 IgG LSD1 Percent of Input MCF10A MCF10A SNA KRT8 CLDN7 Ecad Pro Ecad 5kb 0.00 0.20 0.40 0.60 0.80 1.00 1.20 GIP shSnail Relative Snail mRNA level 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 IgG LSD1 IgG LSD1 Percent of Input Vector shSnail C B D CLDN7 Ecad Pro

PAGE 80

80 Figure 3 5. LSD1 is recruited to epithelial gene promoters by Snail. (A). Occupancy of LSD1 at the promoters of E cadherin, CLDN7, and KRT8 is increased in Snail expressing cells compared with control MCF10A cells as shown by chromatin immunoprecipitation (ChIP) analy sis with the LSD1 antibody. (B). Traditional RT PCR followed by agarose gel electrophoresis shows reduction of Snail in MDA MB 231 cells by a lentiviral short hairpin RNA. (C). The efficiency of Snail depletion was quantified by real time PCR. Relative Sna il RNA level was normalized to endogenous beta actin. (D). The enrichment of LSD1 at the E cadherin and CLDN7 promoters is reduced in MDA MB 231 cells depleted of Snail.

PAGE 81

81 CHAPTER 4 LSD1 IS ESSENTIAL FO R SNAIL MEDIATED TRANSCRIPTI ONAL REPRESSION Study Background The association of LSD1 to the chromatin template is extensively modulated by its interaction partners and local histone marks. LSD1 forms core complex with CoREST, BHC80 and HDAC1/2. This complex mediates the activation to repression transition of target promoters by the deacetylation of H3K9 and demethylation of H3K4 ( Lan et al., 2008b ) When the complex is recruited to the chromatin, HDACs first remove acetyl group from H3, allowing for CoREST binding of the hypoacetylated tail. Then LSD1 is brought closer to its substrate and demethylates H3K4m2 in a CoRES T dependent manner ( Lee et al., 2006 ) Finally, BHC80 bin ds to unmethylated H3K4 maintaining the complex at the promoter This on one hand prevents H3K4 remethylation, and on the other hand induces further demethylation of neighboring nucleosomes ( Lan et al., 2007 ) In Chapter 3 I have shown that Snail directly interacts with LSD1 via the amino terminal SNAG domain. During EMT, Snail recruits LSD1 to its target promoters and represses gene expression by removing the active H3K 4m2 mark. Besides, other evidence show s that LSD1 is highly expressed in clinically advanced breast tumors and in poorly differentiated neuroblastomas ( Lim et al., 2010 ; Schulte et al., 2009 ) Given the prominent role of Snail family members in initiation of EMT and tumor invasion, I am intere st ed in further exploring the biological functions of LSD1 in Snail mediated epithelial gene repression and regulation of EMT.

PAGE 82

82 Results LSD1 is Required for Snail to Repress Epithelial Genes Luciferase reporter assay has frequently been used to test the ac tivities of transcription factors and their associated partners. Since LSD1 might play a role in Snail mediated repression, I first built a luciferase reporter by cl oning E cadherin promoter in front of the luciferase gene. This reporter carries three E bo xes recognized by Snail. When transfected into the MCF7 epithelial cells, it could be strongly repressed by expression of exogenous Snail (Figure 4 1A). However, in the presence of LSD1, (Figu re 4 1A). Because ectopic expression of Snail potently repressed the E cadherin promoter in MCF7 cells, I speculated that the endogenous LSD1 complex might have contributed to Snail mediated gene repression. To examine whether exogenous Snail relies on end ogenous LSD1 for its repressive activity, I applied retrovirus based RNA interference (RNAi) to substantially deplete endogenous LSD1. MCF7 cells were infected with either control retrovirus or retrovirus containing short hairpin RNA against LSD1. Stable k nockdown MCF7 cells were selected by puromycin for more than a week. Then both control and LSD1 depleted cells were co transfected with Snail and reporter genes. As expected, in the absence of sufficient LSD1, Snail mediated inhibitory effect on the report er was essentially abolished (Figure 4 1C). Therefore, interference of endogenous LSD1 prevents the ability of Snail to repress E cadherin promoter To further investigate whether inhibition of endogenous epithelial genes by Snail also depended on LSD1, I transduced either control or LSD1 depleted MCF7 cells with lentivirus simultaneously expressing both Snail and GFP. GFP positive cells were

PAGE 83

83 sorted and purified by flow cytometry, and RNA expression of epithelial genes in these cells was analyzed by real t ime PCR. Similarly to luciferase reporter assays, ectopic expression of Snail dramatically reduced endogenous E cadhe rin, CLDN7, and KRT8 expression in MCF7 cells (Figure 4 1D). By contrast the repressive effect of Snail on these genes was significantly d iminished in cells depleted of LSD1 (Figure 4 1D). Together these observations suggest that Snail initiated de novo inhibition of epithelial genes is dependent on LSD1. LSD1 Mediates Snail Initiated EMT Process To further assess the role of LSD1 in Snail regulated EMT process, I decided to establish There are two indu cible systems commonly used for mammalian cells : the Tet on/off system and the estrogen receptor (ER) fusion system. The Tet on system permits a tight regulation of gene expression at the transcription level ( Gossen et al., 1995 ) In this system, the expression of t arget gene is controlled by the tetracycline response element (TRE), an enhancer usually placed immediately upstream of a minimal CMV promoter. In the presence of doxycycline, the transactivator rtTA, which is stably integrated into the genome in advance, binds to the TRE and activates the transcription of target gene. The Tet system has been shown ver y tight control of expression. H owever it depends on transcription and subsequent translation of the target gene resulting in a slow response to induct ion. In contrast, the ER system regulates the function of the pre expressed target protein and has a more immediate effect upon administration compare d to the Tet system. The estrogen receptor is a member of nuclear hormone receptor family, and has two maj or domains called the DNA binding domain (DBD) and the ligand binding domain (LBD). The LBD of ER has been widely used to fuse to

PAGE 84

84 different functional types of protein especially transcription factors to generate hormone dependent inducible systems ( Mattioni et al., 1994 ) In the absence of ligand, the ER fusion proteins are generally inactivated in the heat shock protein (Hsp) silencing complexes. The binding of ligand induces the conformation change of the LBD and subsequent dissoci ation of fusion protein from the inhibitory complexes renders a fully functional fusion protein ( Pratt, 1990 ; S mith and Toft, 1993 ) To build a Snail ER inducible system, I cloned a mutated li gand binding domain of the murine estrogen receptor to the carboxyl terminal of Snail. This modified LBD is unable to bind and be activated by estradiol yet remains response to activation by 4 hydroxy tamoxifen (4HT), a synthetic steroid ( Littlewood et al., 1995 ) The ectopic expression of the Snail ER fusion protein was achieved by the lentiviral infection, and positive cells were sorted out based on the co expressed GPF signal. Following tamoxifen addition, the MCF10A Snail ER cells developed a mesenchymal morphology similar to MCF10A cells stably expressing Snail (Figure 4 2B). Moreover, as anticipated, the Snail ER expressing MCF10A ce lls showed decrease d E cadherin expression after tamoxifen treatment for 4 days while the control MCF10 A cells have no response to tamoxifen (Figure 4 2A) To test if LSD1 is required in this Snail induced EMT system, I tried to deplete LSD1 in t he MCF10A Snail ER cells. Since the MCF10A cells are unable tolerate tw o rounds of virus infection, I could not directly infect the MCF10A Snail ER cells with another lentivirus carrying shRNAs against LSD 1 To overcome this problem, I build new constructs based on the pGIPz lentiviral plasmids, in which I replaced the original GFP gene on either the control vector or vectors carrying shRNA sequences against

PAGE 85

85 LSD1 with Snail ER fusion gene. With these constructs, I can express both Snail ER and shRNAs target ing LSD1 after one lentiviral infection. Figure 4 2C showed all these three plasmids: Snail ER control, Snail ER shLSD1 F1, and Snail ER shLSD1 H6 expressed decent level of Snail E R fusion protein. In addition t o that, the two constructs established on LSD 1 knockdown vectors successfully depleted LSD1 in Snail ER expressing MCF10A cells (Figure 4 2C). Then I treated these cells with 4HT at 200 M for 4 days. In the presence of endogenous LSD1, induction of Snail function can successfully repress E cadherin expression (Figure 4 2D) and consistently promote morphological change (data not shown). However, after depletion of LSD1, Snail failed to repress E cadherin after tamoxifen induction (Figure 4 2D). These data suggest LSD1 is required for the Snail regulated initiation of EMT process. LSD1 is Essential for Maintenance of the Silenced State of Snail Target G enes E cadherin and other epithelial genes are commonly silenced in highly invasive cancer cel ls such as MDA MB 231 or MDA MB 435. To investigate whether LSD1 is required for maintenance of the silenced status of these genes in MDA MB 231, I knocked down endogenous LSD1 with the same two lentiviral short hairpin RNAs as used in previous experiment (Figure 4 3A) As I expect, depletion of LSD1 lead to an increase of the E cadherin and CLDN7 RNA levels as indi cated by qRT PCR (Figure 4 3B), suggesting that disruption of LSD1 activity derepresses these genes. Moreover, treatment of MDA MB 231 cells wit Aza resulted in re activation of E cadherin as detected by RT PCR. And the upregulation of E cadherin mRNA level is comparable to the LSD1 knockdown effect (Figure 4 3C). Simultaneous Aza treatment a pparently had an additive effect on E cadherin

PAGE 86

86 activation (Figure 4 3C). Nevertheless, these elevated E cadherin levels in MDA MD 231 are still much lower than those in typical epithelial cells such as MCF7, indicating that E cadherin re activation is inco mplete. Similar partial derepression of E cadherin was reported when the PRC2 repressive complex was inactivated ( Herranz et al., 2008 ) The limited effect is most likely due to multiple repression mechanisms at the E cadherin promoter in the MDA MB 231 cells. Since LSD1 demethylates H3K4m2, I hypothesized that the increased expression of Snail targets could be due to the upregulation of the active H3K4m2 mark. Thus I analyzed H3K4m2 levels at the E cadherin promoter by ChIP assays in control and LSD1 depleted MDA MB 231 c ells. As a consequence, a dramatic increase of H3K4m2 specifically at the E cadherin promoter was observed in the LSD1 depleted cells (Figure 4 3D). These results imply that LSD1 is necessary to reinforce silencing of epithelial genes in these cells by con sistently erasing the H3K4m2 mark to prevent its accumulation at Snail targeted promoters. E cadherin is Upregulated in LSD1 Depleted T umors Depletion of LSD1 in MDA MB 231 cells resulted in partial depression of epithelial genes, but the relative expression levels remained low comparing to typical epithelial cells. The increased enrichment of H3K4m2 at the E cadherin promoter after LSD1 knockdown may not be sufficient t o activate E cadherin, but rather provide it with a poised status. The full activation of E cadherin could requi re additional signals which are missing in the in vitro culture system. I hypothesized that mesenchymal invasive tumor cells after depleting of LS D1 might be more readily to activate E cadherin and to undergo mesenchymal epithelial transition (MET) in vivo To test this idea, I first generated control and LSD1 depleted MDA MB 231 cells via lentiviral infection. Cells

PAGE 87

87 were injected into the abdominal mammary fat pad of immunocompromised mice and total five injections for each cell line. MDA MB 231 has been reported as an aggressive tumorigenic breast cancer cell line ( Moody et al., 2005 ) As expected, the tumors started to be visible after 4 5 weeks of injection. And then the growth of tumors was recorded every week. I found depletion of LSD1 p romotes tumor growth in vivo (Figure 4 4A). A recent study showed LSD1 negatively regulates TGF pathway ( Wang et al., 2009a ) Depletion of LSD1 in tumor cells might enhance the TGF pathway activity which in turns promotes cell proliferation. Next, E cadherin RNA level in tumor samples was examined by qRT PCR and knockdown of LSD1 showed roughly 5 fold upregulation of E cadherin expression (Figure 4 4B) This in vivo result indicates that the presence of LSD1 helps maintain the silencing of E cadherin in tumor cells. Summary In this chapter, I have shown that LSD1 serves as an e ssential effecto r of Snail dependent transcriptional regulation of epithelial mesenchymal transition as depletion ss its target promoters as well as to initiate EMT (Figure 4 1 & Figure 4 2) Besides, LSD1 is involved in maintaining the silenced status of these genes in invasive mesenchymal tumor cells (Figure 4 3) However the exact mechanism underlying Snail mediate d transcriptional repression could be complex. I only detected a partial derepres sion of E cadherin and have not observed any morphological reversion from mesenchymal phenotype to epithelial phenotype in LSD1 depleted MDA MB 231 cells. This indicates removing of LSD1 might not be sufficient to fully activate epithelial gene expression program. It is interesting to

PAGE 88

88 investigate other additional epigenetics regulations occurred at these promoters and to test whether they are mediated by Sna il genes.

PAGE 89

89 D

PAGE 90

90 Figure 4 1. LSD1 is essential for Snail mediated repression. (A). LSD1 augments cadherin promoter region containing three E boxes was cloned before luciferase gene. Luciferase assays were performed. Snail gene was transfected into MCF7 cells with or without LSD1 expressing plasmid. ( B ). Verification of LSD1 knockdown by western blotting. MCF7 cells were infected with retroviral empty vector pSuper or with short hairpin RNA targeting LSD1, followe d by western blotting assays. (C ). Depletion of LSD1 impairs the repressive activity of Snail in reporter based assays. E cadherin promoter region was cloned into pGL3 reporter vector and co transfected with Snail expressing plasmid into control or LSD1 deplet ed cells. Snail failed to repress the reporter gene in absence of LSD1. Error bars indicated S.D. from t hree independent experiments. (D ). LSD1 is essential for Snail mediated repression of endogenous epithelial genes. Expression of E cadherin, CLDN7, and KRT8 was determined by quantitative RT PCR.

PAGE 91

91

PAGE 92

92 Figure 4 2. LSD1 mediates Snail initiated EMT process. (A). Verification of Snail ER inducible system in MCF10A cells by western blotting. Both parental MCF10A and Snail ER expressing MCF10A were treated with 200 nM of 4 hydroxyl tamoxifen (4HT) for four days before harvested. (B). Phase contrast image of Snail ER expressing MCF10A cells before and after induction. (C). Depletion of LSD1 in MCF10A Snail ER cells. Western blotting indicates LSD1 knockdown efficiency and Snail ER expression. Tubulin was probed as loading control. Two independent shRNAs targeting LSD1 were used to exclude non specific t arget effects (D). Depletion of LSD1 abolished Snail induced downregulation of E cadherin. In control E cadherin. However, this activity was diminished in LSD1 depleted Snail ER expressing cells.

PAGE 93

93 Figure 4 3. LSD1 is required to maintain the silenced status of Snail target genes in invasive cancer cells. (A). Validation of LSD1 depletion in MDA MD 231 cells with two short hairpin RNAs against LSD1 by western blotting with denoted antibodies. (B). Expression o f E cadherin and CLDN7 is upregulated in MDA MD 231 cells depleted of LSD1. The RNA levels of the two genes were normalized to GAPDH by quantitative RT aZa treatment enhances depleted cells were tr eated with 5 E cadherin expression was showed by regular RT PCR. (D). LSD1 depletion in MDA MD 231 cells increases H3K4m2 levels specifically at the E cadherin promoters, as determined by chromatin immunoprecipitation (ChIP) assays.

PAGE 94

94 0.0 1.0 2.0 3.0 4.0 5.0 6.0 E cad Snail Slug Relative RNA level MDA231 wt MDA231 shLSD1 0 100 200 300 400 500 600 700 800 900 5 6 7 8 9 10 11 tumor volume (mm3) weeks after injection vector shLSD1 Figure 4 4. Mammary fat pad tumor xenograft assay (A).Tumor growth curve. 5x10 6 of control or LSD1 depleted MDA MB 231 cells were injected into each immunodeficient mice. Tumors started to be visible after five weeks of injection. The size of tumor was measured every week with a rule and the volume w as calculated based on the following formula: volume(mm 3 ) = ( 4/3)*p*(radius)^3 (B). E cadherin was upregulated in LSD1 depleted tumors. Mice were sacrificed after 11 weeks of injection. RNAs were extracted from tumor samples by Trizol reagent. Relative RNA levels were measured by real time RT PCR and were normalized to actin levels. Er ror bar indicates standard deviation from three independent experiments. A B

PAGE 95

95 CHAPTER 5 ADDITIONAL EPIGENETI C EVENTS ASSOCIATED WITH SNAIL Snail and DNA M ethylation In my study, I have highlighted the significance of the function. In a ddition to that, Snail has been reported to directly or indirectly associate with repressor complexes including HDAC, PRC2, and Ajuba PRMT5, through its SNAG domain ( Herranz et al., 2008 ; Hou et al., 2008 ; Peinado et al., 2003a ) It is interesting to determine whether all these components are all in the same complex, or they interact with Snail independently, as the activity. As a consequence of these interactions, Snail leaves multiple repressive histone modifications at its target genes, such as decreased H3K4m2, increased H3K27m3, and histone hypoacetylation. In addition to these modifications could there be any more epigenetic event that might be introduced by Snail? One possible candidate is DNA cytosine methylation a marker of gene silencing It has been long known that hypermethylation of the promoter sequence s of epit helial genes especially E cadherin occurs frequently in various breast cancer cell lines and primary ductal breast cancers ( Graff et al., 1995 ; Herman et al., 1996 ) However, in contrast to this well established event, the exact mechanisms that trigger the DNA methylation during cancer progression remains mystery. Interestingly, a study profiled E cadherin expression in di fferent mammary cell lines. It was found that E cadherin promoter methylation, but not mutational inactivation, was highly enriched in fibroblastic invasive cell lines, suggesting a potential association between E cadherin promoter methylation and EMT reprogramming during e volving of tumors ( Lombaerts et al., 2006 ) Moreover, sustained activation of the EMT program by TGF in primary

PAGE 96

96 human mammary epithelial cells (HMEC) induces de novo DNA methylation at the E cadherin promoter. And this methylation maintains after withdraw al of TGF ( Dumont et al., 2008 ) Given these lines of evidences, it is reasonable to think that Snail might play a role in introducing DNA methylation at the E cadherin promoter. I then surveyed DNA methylation at the E cadherin promoter in cells after EMT by bisulfate genomic sequencing with the help from Dr.Lingbao Ai. However, neither the MCF10A Snail cells nor th e MCF10A Snail ER cells after tamoxifen treatment showed any significant increase of DNA methylation comparing to their epithelial controls (data not shown) This indicates Snail probably does not have direct impact on DNA methylation. And DNA methylation itself at the E cadherin promoter could be a late onset and sporadic event as EMT progressed. Besides, de novo DNA methylation could also be prevented due to the presence of the H3K4m3 modification (Figure 3 3B) which has been shown to block the binding of the de novo DNA methyltransferase subunit DNMT3L to the H3 tail ( Ooi et al., 2007 ) Identif ication of the Snail Complex P urification of Factors Associated with Snail function, we undertook a proteomic approach to identify Snail associated proteins HEK293 cells were stably transfected with the Snail Flag construct. The stable expression of Snail was much lower than transient transfection and was comparable to endogenou s level s of Snail as in other mesenchymal cells. The purification was performed in collaboration with Dr.Huangxuan Shen based on the protocol developed i n the laboratory of Dr.Lizi Wu. The Snail Flag protein and associated polypeptides from nuclear extract s were isolated by anti Flag affinity chromatography. Then isolated products were visualized by

PAGE 97

97 SDS PAGE analysis and silver staining (Figure 5 1A). Expectedly, identification of Snail Flag interacting proteins by mass spectrometry indicated an abundant as sociation with components of the LSD1 CoREST CtBP corepressor complex (Figure 5 1B) which further confirms our previous disco very about the Snail LSD1 interaction. In addition to these factors, we also identified two interesting MBT domain contai ning prot eins SFMBT1 and L3MBTL SFMBT (known as Scm like with four mbt domains ) is a newly identified polycomb group (PcG) protein. Members of PcG regulate the transcription of developmental associated genes such as Hox genes by creating a repressive chromatin structure ( Schwartz and Pirrotta, 2007 ) Currently, there are three known PcG complexes: two well characterized classical PcG complexes (PRC1 and PRC2) and the recently recorded PhoRC ( Schwartz and Pirrotta, 2008 ) The main component of the PhoRC complex is Pleiohomeotic (Pho), homologous to the mammalian factor YY1. Ph o/YY1 is a sequence specific DNA binding protein and often associated with PcG complexes. It has been shown to mediate the recruitment of PcG complexes to Polycomb Response Elements (PREs) ( Mohd Sarip et al., 2006 ) Another essential component in the PhoRC complex is the SFMBT protein which forms heterodimer with Pho/YY1 and has been shown required for Hox gene silencing ( Klymenko et al., 2006 ) SFMBT is a potent repressor of transcription however besides this, l ittle is currently known about its biological function The mammalian v ersion of SFMBT was first cloned in the year 2000 ( Usui et al., 2000 ) So far, two structurally related human homologous (hSFMBT1 and hSFMBT2) have been identified. Both of these two proteins contain four tandem Malignant Brain Tumor (MBT) domains at amino terminal part and a conserved

PAGE 98

98 protein interacting Sterile Alpha Motif ( SAM) domain near the carboxyl terminus (Figure 5 2A). The MBT domain is found in several PcG proteins such as the lethal(3) malignant brain tumor like (L3MBTL) and the sex comb on midleg like2 (SCML2), and invariably exists in tandem arrays of two to four repeats It recognizes mono and di methylated lysines at a number of different positions on histone H3 and H4 tails ( Bonasio et al., 2010 ) In addition, all four MBT domains in SFMBT have been shown required for repressor activity indicating a higher order structure might be formed by the four MBT repeats ( Wu et al., 2007 ) Despite the repressive activity of SFMBT proteins in PcG complexes mediated transcriptional repression, little evidence currently is know n about their biological functions in var ious cellular processes. Some of the indications are from studies in Drosophila For example, Drosophila Sfmbt null mutant displays a classic Polycomb phenotype ( Klymenko et al., 2006 ) Besides, a genome wide RNAi screen in cultured Drosophila cells identified both dL3MBT and dSFMBT as key r egulators of E2F activity. They are recruited to E2F responsive promoters through physical interaction with E2F and are required for repression of endogenous E2F target genes ( Lu et al., 2007 ) Validation of Snail and SFMBT1 A ssociation To confirm physical association between Snail and SFMBT1 or L3MBTL, co immunoprecipitation assay s were performed in HEK293 cells expressing exogenous Snail and Flag epitope tagged two MBT proteins. Snail was co immunoprecipi tated with both Flag SFMBT1 and Flag L3MBTL with anti Flag antibody (Figure 5 2B). Whole cell lysates from HEK293 cells expressing only exogenous Snail protein were used as control for co immunoprecipitation. Human Snail has an analog named Slug. These two proteins share high level of structural similarity and functional redundancy ( Barrallo

PAGE 99

99 Gimeno and Nieto, 2009 ) Similarly, I found exogenous Slug is also associated with both Flag SFMBT1 and Flag L3MBTL in co immunoprecipitation analysis (Figure5 2C). To further confirm the interaction between Snail and SFMBT1, the cell lysates were subject to co immunoprecipitation with anti Snail antibody and the presence of Flag tagged SFMBT 1 in the precipitates was further verified by western blotting with anti Flag antibody. Consistent with previous result F SFMBT 1 was also found in the immune precipitated exogenous Snail complex (Figure5 2D). Snail Reduces the Accessibility of E cadherin Promoter Region I have shown that Snail forms complex with SFMBT1, which has been demonstrated as a potent transcriptional co repressor ( Wu et al., 2007 ) SFMBT1 is a component of the Pho repressor complex (PhoRC). It binds preferentially to mono or di methylated lysines on histone tails and is proposed to contribute to repression by compacting nucleosomal arrays ( Grimm et al., 2009 ) To test the idea that Snail may induce the chromatin structure change around the transcription start site of the E cadherin gene, I measured the relative accessibility to DNase digestion of this region befo re and after the induction of Snail function First, MCF10A Snail ER cells were treated with 4HT which consistently resulted in reduced expression of E cadherin and increased binding of Snail to the E cadherin promoter (Figure 5 3 A&B).Then n uclei were is olated from MCF10A Snail ER cells treated or not with 4HT and incubated with DNase. Digested DNA was extracted by phenol chloroform and was subjected to q PCR analysis to quantify the abundance of uncut DNA of the TSS of E cadh erin gene as well as in the T SS sites of GAPDH and HBB. Before the 4HT treatment, the region flanking E cadherin transcription start site was largely accessible to DNase digestion, similar to the consti tutively expressed GAPDH gene. T he hemoglobin beta gene that is

PAGE 100

100 silenced in MCF10A showed re lative high resistance to the enzyme (Figure 5 3C) Notably, 4HT treatment significantly inhibited the DNase access to the E cadherin TSS while had no affect on other two control regions. This result suggests that Snail induces a more condensed an d closed chromatin structure around the transcription start site of E cadherin gene. Summary In this chapter, I tried to identify additional epigenetic events associated with Snail. CpG dinucleotides at the E cadherin promoter region are frequently methyl ated in various aggressive cancers ( Graff et al., 1995 ) It has been reported that long term induction of EMT incre ased DNA methylation level at different epithelial promoters including E cadherin I asked whether Snail can contribute to the DNA methylation. However I failed to observe any increase in DNA methylation after overexpression of Snail. Next, we performed a proteomic a ssay to detect factors present in the Snail complex. Interestingly, in addition to the components of the LSD1 complex, we also identified SFMBT1 and L3MBTL in the immunoprecipitates (Figure 5 1).I further confirmed the interaction between Snail and these two proteins in HEK293 cells (Figure 5 2). Since both of SMBT1 and L3MBTL have nucleosomal compacting activity ( Bonasio et al., 2010 ) I compared the chromatin accessibility flanking the transcription start site of E cadherin between MCF10A Snail ER cells with or without 4HT treatment. Addition of 4HT induced binding of Snai l to the E cadherin promoter, resulting in a relatively closed form at the TSS region (Figure 5 3), which may contribute to the repression of E cadherin. For further studies, it is necessary to investi gate whether SFMBT1 is recruited by Snail to its targets during EMT, and whether the change in chromatin accessibility is

PAGE 101

101 general to other targets of Snail. Besides, both SFMBT1 and LSD1 were found in Snail immunoprecipitates, it is interesting to resolve the relation ship of these proteins, such as whether they form a big complex or SFMBT1 and LSD1 associate with Snail independently. Since t he role of SFMBT1 in car cinogenesis is rarely studied, we also plan to test if deplet ion of SFMBT1 has any effect on t he malignan t properties of tumors, including uncontrolled growth, invasiveness as well as metastasis.

PAGE 102

102 Figure 5 1. Identification of the Snail complex. (A). Flag tagged Snail was stably expressed in HEK293 cells, and nuclear extracts were prepared. Snail Flag and associated proteins were immunoaffinity purified and eluted with Flag peptide. Silver stained SDS PAGE gels showed that multiple polypeptides s pecifically associated with Snail Flag as compared to control extracts from untransfected cells. (B). Tandem mass spectrometry (MS MS) identified numerous interacting proteins, including multiple components of the LSD1/CoREST complex as well as two additio nal MBT proteins. Gene Name Peptide # MW (KDa) LSD1 59 93 Rcor1,2,3 92 53,50,56 GSE1 58 136 HDAC1,2 51 55,55 ZNF198 44 155 BHC80 20 79 ZNF217 18 115 CtBP1,2 12 48,49 SFMBT1 7 98 L3MBTL 3 84 A B

PAGE 103

103 A

PAGE 104

104 Figure 5 2. Confirmation of Snail and SFMBT1/L3MBTL interaction (A). Schematic representative of the structure of two human SFMBT homologous. Both of them have four MBT repeats at the amino terminal parts and a SAM domain at the carboxyl terminus, while hSFMBT2 has one nuclear localization signal motif in the middle. (B). W estern blotting shows co immunoprecipitation of Snail with Flag SFMBT1 and Flag L3MBTL. Snail was co transfected with either of the MBT proteins in HEK293 cells. The whole cell lysates were subject to immunoprecipitation with anti Flag antibody follo wed by western blotting with indicated antibodies. (C). Similar co immunoprecipitation assay shows Slug is associated with Flag SFMBT1 or Flag L3MBTL as well. (D). Co immunoprecipitation was performed with anti Snail antibody. And the presence of Flag SFMB T1 in the precipitates was verified by anti Flag antibody. Anti Snail western blotting indicates the immunoprecipitation efficiency of exogenous Snail.

PAGE 105

105 Figure 5 3. Snail reduces the accessibility of E cadherin promoter region. (A). MCF10A cells ectopically expressing Snail ER fusion protein were treated with 200 nM of 4HT for five days before harvest. Expression levels of E cadherin and Snail ER were verified by we stern blotting. The housing keeping gene glyceraldedyde 3 phosphate dehydrogenase (GAPDH) was probed as loading control. (B). Snail ER bound to E cadherin promoter region after 4HT treatment as shown by chromatin immunoprecipitation assay. (C). Nuclei were isolated from both untreated and 4HT treated MCF10A Snail ER cells and then digested with DNase. DNA was purified and followed by real time PCR quantification with primers corresponding to the transcriptional start site (TSS) of either HBB, GAPDH or CDH1. Uncut DNA template was shown as percentage of input DNA which was not digested with DNase. A B C

PAGE 106

106 CHAPTER 6 CONCLUSIONS AND FUTU RE DIRECTIONS Epithelial mesenchymal transition (EMT) is a key step during the early stage of tumor progression. Elucidation of the transcriptional and epigenetic regulatory mechanism that controls EMT is crucial for the development of successful therapeutic interventions for metastasis. The Snail family of zinc fing er transcriptional repressors is designated as the master regulator o f EMT. Snail can induce EMT by downregulating numerous epithelial cell markers ( Nieto, 2002 ) In this dissertation, I have investigated the epigenetic mechanism underlying Snail mediated transcriptional repression of these epithelial genes. It is shown that ectopically expressing Snail in MCF10A cells promotes epithelial to mesenchymal morphological changes accompanied by the downregulation of several epithelial markers. I discovered the histone demethylase LSD1 as a co repressor of Snail. During EMT, Snail directly interacts with LSD1 via its amino terminal SNAG domain and recruits the LSD1 complex to the E cadherin and o ther epithelial gene promoters, resulting in downregulation of the active H3K4m2 mark and promoter activity. I further showed depletion of LSD1 in epithelial cells substantially impairs LSD 1 serves as an essential effecto r of Snail dependent transcriptional repression of epithelial genes. Knockdown of LSD1 in invasive tumor cells derepresses epithelial genes. Moreover, recent studies showed that LSD1 is highly expressed in clinically advanced breast tumors ( Lim et al., 2009 ) Together with the prominent role of Snail family members in initiation of EMT and tumor invasion, targeting the enzymatic components of the LSD1 complex by pharmacological interventions may hold a great promise for anti invasive/metastatic therapy of tumors.

PAGE 107

107 Besides LSD1, we also identified additional co repressors of Snail by the proteomic approach. The promising candidates include two MBT domain proteins, SFMBT1 and L3MBTL. The MBT domain proteins are chromatin readers that can recognize the mono or di methylated histone tails and they can also remodel the chromatin stru cture by compacting nucleosomes. I first confirmed the presence of SFM BT1 and L3MBTL in the Snail complex. But different from LSD1 which has been shown to directly interact with Snail, I found SFMBT1 protein indirectly associated with Snail in a LSD1 dependent manner. However SFMBT1 seems not essential in maintaining the si lenced status of epithelial genes, as depletion of SFMBT1 in MDA MB 231 cells did not show any significant expression changes of Snail targeted epithelial genes. LSD1 catalyzes FAD dependent oxidation of amine containing substrates and is capable of demethylating mono and di methylated H3K4. But LSD1 is unable to catalyze the demethylation of H3K4m3, which has been regarded as a hallmark of active promoters. In my studies, I found in the Snail expressing MCF10A cells th at are negative for E cadherin the H3K4m3 mark still remains at high level s at the E cadherin promoter. Therefore, in contrast to H3K4m2, the H3K4m3 mark was not significantly reduced despite Snail expression and E cadherin repression. This observation is consistent with that no JARID1 family member was identified in purified Snail complex. Trimethylation of H3K27 by the PRC2 complex is associated with gene silencing and facultative heterochromatin formation. Snail was also reported to interact with the enzymatic component Ezh 2 of the PR C2 complex and Snail mediated transcriptional repression associated with H3K27m3 ( Herranz et al., 2008 ) In consistence with this

PAGE 108

108 finding, I detected high levels of H3K27m3 in the E cadherin promoter specifically in the Snail expressing cells. Thus, E cadherin promoter po ssesses high levels of both the active H3K4m3 and the repressive H3K27m3 mark in Snail expressing cells. Co Surveillance of histone methylations in my study showed Snail induces a bivalent histone modification state at the E cadherin promoter region. Bivalent genes are inactive, but are poised for activation. Bivalency is believed to represent a transition state between active and silenced in cells that have not yet commi tted to a particular development fate. It is noticed that EMT is not permanent but often reversible. The reverse process, known as mesenchymal epithelial transition (MET), is essential for embryonic development. EMT derived mesenchymal mesodermal and neura l crest cells are multipotent and give rise to diverse embryonic derivatives and cell types, including epithelial tissues ( Sauka Spengler and Bronner Fraser, 2008 ) More direct evidence of MET comes from developmental studies of kidney ontogenesis, somitogenesis, and secondary neurulation ( Davies, 1996 ; Lowery and Sive, 2004 ) during which a mesenchy mal cell population aggregates, condenses, develops cell cell adhesions and reverts to the epithelial state. MET is believed to be critical for cancer metastasis as well. Clinically, majority of human metastases resembles primary carcinomas morphologically and retain characteristics of well differentiated epithelial cells. This has been explained by a MET process occurring in the disseminated tumor cells ( Thiery, 2002 ) probably due to the lack of EMT inducing signals or selective advantage of cells with more epithelial properties at ectopic organ microenvironment.

PAGE 109

109 The inter conversion between epithelial and mesenchymal states is pivotal to embryonic development and malignant progression ( Polyak and Weinberg, 2009 ) However the molecu lar basis underpinning the phenotypic plasticity of cancer cells at EMT/MET remains largely a mystery. In our study, I found Sna il expression in epithelial cells results in a bivalently modified chromatin domain at the E cadherin promoter, which may resemble euchromatin rather than constitutive heterochromatin. Bivalent genes are poised for activation, suggesting that Snail mediate d repression of E cadherin is readily reversible. It is interesting to test whether this epigenetic plasticity may constitute the basis for rapid re activation of E cadherin during MET and facilitate the seeded tumor cells to exit dormancy status and form macrometastases in distant loci. Besides, the bivalent chromatin domains with colocalization of active H3K4m3 and repressive H3K27m3 marks are enriched in embryonic stem cell genome. An overwhelming number of developmentally important, lineage control ge nes exhibit the bivalent histone modification pattern in ES cells ( Azuara et al., 2006 ; Bernstein et al., 2006 ) Upon ES differentiation, bivalent domains resolve to monovalent status, that is in differentiated cells, key developmental regulators are marked by eith er active (H3K4m3) or repressive (H3K27m3) mark. Therefore, it has been proposed that bivalent domains silence developmental genes in stem cells while keeping them poised for activation during later differentiation, providing a basis for cellular plasticit y ( Mikkelsen et al., 2007 ) Recently ground breaking findings suggest that EMT generates stem cell traits, including expression of stem cell markers, formation of spheres, and acquisition of multi potency ( Mani et al., 2008 ; Morel et al., 2008 ) These observations have profound

PAGE 110

110 impact on our understanding of cancer metastasis. In particular, Snail is sufficient to reprogram immortalized human mammary epithelial cells into mammary stem cells ( Mani et al., 2008 ) however the underlying molecular mechanism is unknown. The discovery of a bivalent s tate at the E cadherin locus in Snail expressing cells offers a potential mechanistic explanation for how Snail induces stem cell traits during EMT. And the interpretation can be scaled up to a genome wide level with ChIP Chip or ChIP seq techniques. I hyp othesize that Snail induces cell stemness by reprogramming lineage important genes into a bivalent state. In addition to E cadherin, I envision that Snail may bind to many lineage regulating genes, especially those for epithelial differentiation, and impos e a bivalent histone modification pattern. This reprogramming process results in de differentiation of epithelial cells and acquisition of stem cell properties. As the key lineage regulators are poised for activation, the resultant stem like mesenchymal ce lls have the potential to revert to epithelial state or differentiate into other cell types, depending on environmental signals. The genome wide ChIP techniques may be applied to identify H3K3m3/H3K27m3 bivalent genes specifically induced by Snail. The res ult should offer unprecedented insight into the Snail mediated reprogramming process and acquisition of stemness. Thus it could have huge implications for illustrating the role and mechanism related to epigenetic control of stem cell feature and cancer met astasis. Epigenetic changes are increasingly recognized as a major characteristic of human cancers. Great improvement in understanding the epigenetic mechanisms involved in carcinogenesis over the past few years booms the development of epigenetic ca ncer therapies. Numerous drugs targeting different epigenetic

PAGE 111

111 modifications have shown clinical benefits in treating cancers ( Karberg, 2009 ) However one major issue with these current inhibitors is the lack of specificity which leads to unpredictable side effects. Treatment with these drugs results in global change s of gene expression patterns, not only those aberrantly expressed tumor related genes. To circumvent this problem, it is important to un derstand the detailed mechanism that target s these enzymes to their specific chromosomal locations. Here I showed the zi nc finger transcription factor Snail recruits histone demethylase LSD1 to its target promoters during EMT. So, in future studies design ing small molecules that s pecifically interrupt the Snail LSD1 interaction may hold great promise for preventing invasive potential of epithelial tumors while retaining the function of LSD1 related to other regular cellular processes.

PAGE 112

112 LIST OF REFERENCES Ahmad, K., and Henikoff, S. (2002). Epigenetic consequences of nucleosome dynamics. Cell 111 281 284. American Cancer Society Atlanta, G. (2010). American Cancer Society: Cancer Facts and Figures 2010. Anand, R., and Marmorstein, R. (2007). Structure and mechanism of lysine specific demethylase enzymes. J Biol Chem 282 35425 35429. Axel son, H., Fredlund, E., Ovenberger, M., Landberg, G., and Pahlman, S. (2005). Hypoxia induced dedifferentiation of tumor cells A mechanism behind heterogeneity and aggressiveness of solid tumors. Seminars in Cell & Developmental Biology 16 554 563. Ayyan an, A., Civenni, G., Ciarloni, L., Morel, C., Mueller, N., Lefort, K., Mandinova, A., Raffoul, W., Fiche, M., Dotto, G.P. et al. (2006). Increased Wnt signaling triggers oncogenic conversion of human breast epithelial cells by a Notch dependent mechanism. Proc Natl Acad Sci U S A 103 3799 3804. Azuara, V., Perry, P., Sauer, S., Spivakov, M., Jorgensen, H.F., John, R.M., Gouti, M., Casanova, M., Warnes, G., Merkenschlager, M. et al. (2006). Chromatin signatures of pluripotent cell lines. Nat Cell Biol 8 532 538. Bannister, A.J., Zegerman, P., Partridge, J.F., Miska, E.A., Thomas, J.O., Allshire, R.C., and Kouzarides, T. (2001). Selective recognition of methylated lysine 9 on histone H3 by the HP1 chromo domain. Nature 410 120 124. Barrallo Gimeno, A. (2005). The Snail genes as inducers of cell movement and survival: implications in development and cancer. Development 132 3151 3161. Barrallo Gimeno, A., and Nieto, M.A. (2005). The Snail genes as inducers of cell movement and survival: implications in d evelopment and cancer. Development 132 3151 3161. Barrallo Gimeno, A., and Nieto, M.A. (2009). Evolutionary history of the Snail/Scratch superfamily. Trends in Genetics 25 248 252. Batlle, E., Sancho, E., Franci, C., Dominguez, D., Monfar, M., Baulida, J ., and Garcia De Herreros, A. (2000a). The transcription factor snail is a repressor of E cadherin gene expression in epithelial tumour cells. Nature cell biology 2 84 89.

PAGE 113

113 Batlle, E., Sancho, E., Franci, C., Dominguez, D., Monfar, M., Baulida, J., and Her reros, A.G. (2000b). The transcription factor Snail is a repressor of E cadherin gene expression in epithelial tumour cells. Nat Cell Biol 2 84 89. Bernstein, B.E., Meissner, A., and Lander, E.S. (2007). The Mammalian Epigenome. Cell 128 669 681. Bernste in, B.E., Mikkelsen, T.S., Xie, X., Kamal, M., Huebert, D.J., Cuff, J., Fry, B., Meissner, A., Wernig, M., Plath, K. et al. (2006). A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125 315 326. Berx, G., and Roy, F.V. (2001). The E cadherin/catenin complex: an important gatekeeper in breast cancer tumorigenesis and malignant progression. Breast Cancer Res 3 289 293. Bird, A. (2002). DNA methylation patterns and epigenetic memory. Genes Dev 16 6 21. Birgisdottir, V., Stefansson, O.A., Bodvarsdottir, S.K., Hilmarsdottir, H., Jonasson, J.G., and Eyfjord, J.E. (2006). Epigenetic silencing and deletion of the BRCA1 gene in sporadic breast cancer. Breast Cancer Res 8 R38. Blanco, M.J., Moreno Bueno, G., Sarrio, D., Lo cascio, A., Cano, A., Palacios, J., and Nieto, M.A. (2002). Correlation of Snail expression with histological grade and lymph node status in breast carcinomas. Oncogene 21 3241 3246. Bolos, V., Peinado, H., Perez Moreno, M.A., Fraga, M.F., Esteller, M., a nd Cano, A. (2003). The transcription factor Slug represses E cadherin expression and induces epithelial to mesenchymal transitions: a comparison with Snail and E47 repressors. J Cell Sci 116 499 511. Bonasio, R., Lecona, E., and Reinberg, D. (2010). MBT domain proteins in development and disease. Seminars in Cell & Developmental Biology 21 221 230. Brabletz, T., Hlubek, F., Spaderna, S., Schmalhofer, O., Hiendlmeyer, E., Jung, A., and Kirchner, T. (2005). Invasion and metastasis in colorectal cancer: epi thelial mesenchymal transition, mesenchymal epithelial transition, stem cells and beta catenin. Cells Tissues Organs 179 56 65. Brabletz, T., Jung, A., Reu, S., Porzner, M., Hlubek, F., Kunz Schughart, L.A., Knuechel, R., and Kirchner, T. (2001). Variable beta catenin expression in colorectal cancers indicates tumor progression driven by the tumor environment. Proc Natl Acad Sci U S A 98 10356 10361.

PAGE 114

114 Brown, K.A., Aakre, M.E., Gorska, A.E., Price, J.O., Eltom, S.E., Pietenpol, J.A., and Moses, H.L. (2003). Induction by transforming growth factor b1 of epithelial to mesenchymal transition is a rare event in vitro. Breast Cancer Res 6 215 231. Brown, K.A., Aakre, M.E., Gorska, A.E., Price, J.O., Eltom, S.E., Pietenpol, J.A., and Moses, H.L. (2004). Induction by transforming growth factor b1 of epithelial to mesenchymal transition is a rare event in vitro. Breast Cancer Research 6 R215. Campbell, L.L., and Polyak, K. (2007). Breast tumor heterogeneity: cancer stem cells or clonal evolution. Cell Cycle 6 2332 2338. Cano, A., Perez Moreno, M.A., Rodrigo, I., Locascio, A., Blanco, M.J., Barrio, M.G., Portillo, F., and Nieto, M.A. (2000a). The transcription factor Snail controls epithelial mesenchymal transitions by repressing E cadherin expression. Nat Cell Biol 2 76 83. Cano, A., Perez Moreno, M.A., Rodrigo, I., Locascio, A., Blanco, M.J., del Barrio, M.G., Portillo, F., and Nieto, M.A. (2000b). The transcription factor snail controls epithelial mesenchymal transitions by repressing E cadherin expression. Natur e cell biology 2 76 83. Carver, E.A., Jiang, R., Lan, Y., Oram, K.F., and Gridley, T. (2001). The mouse snail gene encodes a key regulator of the epithelial mesenchymal transition. Molecular and cellular biology 21 8184 8188. Chaffer, C.L., and Weinberg, R.A. (2011). A Perspective on Cancer Cell Metastasis. Science 331 1559 1564. Chen, Y., Yang, Y., Wang, F., Wan, K., Yamane, K., Zhang, Y., and Lei, M. (2006). Crystal structure of human histone lysine specific demethylase 1 (LSD1). Proc Natl Acad Sci U S A 103 13956 13961. Cheng, C.W., Wu, P.E., Yu, J.C., Huang, C.S., Yue, C.T., Wu, C.W., and Shen, C.Y. (2001). Mechanisms of inactivation of E cadherin in breast carcinoma: modification of the two hit hypothesis of tumor suppressor gene. Oncogene 20 3814 3823. Chiang, A.C., and Massague, J. (2008). Molecular Basis of metastasis. N Engl J Med 359 2814 2823. Ciruna, B., and Rossant, J. (2001). FGF signaling regulates mesoderm cell fate specification and morphogenetic movement at the primitive streak. Dev Ce ll 1 37 49. Clayton, A.L., Hazzalin, C.A., and Mahadevan, L.C. (2006). Enhanced histone acetylation and transcription: a dynamic perspective. Mol Cell 23 289 296.

PAGE 115

115 Cochrane, D.R., Howe, E.N., Spoelstra, N.S., and Richer, J.K. (2010). Loss of miR 200c: A M arker of Aggressiveness and Chemoresistance in Female Reproductive Cancers. J Oncol 2010 821717. Comijn, J., Berx, G., Vermassen, P., Verschueren, K., van Grunsven, L., Bruyneel, E., Mareel, M., Huylebroeck, D., and van Roy, F. (2001). The two handed E bo x binding zinc finger protein SIP1 downregulates E cadherin and induces invasion. Mol Cell 7 1267 1278. Cornell, R.A., and Eisen, J.S. (2005). Notch in the pathway: the roles of Notch signaling in neural crest development. Semin Cell Dev Biol 16 663 672. Crespi, B., and Summers, K. (2005). Evolutionary biology of cancer. Trends Ecol Evol 20 545 552. Dandachi, N., Hauser Kronberger, C., More, E., Wiesener, B., Hacker, G.W., Dietze, O., and Wirl, G. (2001). Co expression of tenascin C and vimentin in human breast cancer cells indicates phenotypic transdifferentiation during tumour progression: correlation with histopathological parameters, hormone receptors, and oncoproteins. J Pathol 193 181 189. Davies, J.A. (1996). Mesenchyme to epithelium transition du ring development of the mammalian kidney tubule. Acta Anat (Basel) 156 187 201. De Craene, B., Gilbert, B., Stove, C., Bruyneel, E., van Roy, F., and Berx, G. (2005a). The transcription factor snail induces tumor cell invasion through modulation of the ep ithelial cell differentiation program. Cancer Res 65 6237 6244. De Craene, B., van Roy, F., and Berx, G. (2005b). Unraveling signalling cascades for the Snail family of transcription factors. Cell Signal 17 535 547. De Souza, C.P., Osmani, A.H., Wu, L.P. Spotts, J.L., and Osmani, S.A. (2000). Mitotic histone H3 phosphorylation by the NIMA kinase in Aspergillus nidulans. Cell 102 293 302. Delva, E., Tucker, D.K., and Kowalczyk, A.P. (2009). The desmosome. Cold Spring Harb Perspect Biol 1 a002543. Desai, B.V., Harmon, R.M., and Green, K.J. (2009). Desmosomes at a glance. J Cell Sci 122 4401 4407.

PAGE 116

116 Dietrich, S., Abou Rebyeh, F., Brohmann, H., Bladt, F., Sonnenberg Riethmacher, E., Yamaai, T., Lumsden, A., Brand Saberi, B., and Birchmeier, C. (1999). The r ole of SF/HGF and c Met in the development of skeletal muscle. Development 126 1621 1629. Dominguez, D., Montserrat Sentis, B., Virgos Soler, A., Guaita, S., Grueso, J., Porta, M., Puig, I., Baulida, J., Franci, C., and Garcia de Herreros, A. (2003a). Phosphorylation regulates the subcellular location and activity of the snail transcriptional repressor. Molecular and cellular biology 23 5078 5089. Dominguez, D., Montserrat Sentis, B., Virgos Soler, A., Guaita, S., Grueso, J., Porta, M., Puig, I., Bauli da, J., Franci, C., and Garcia de Herreros, A. (2003b). Phosphorylation Regulates the Subcellular Location and Activity of the Snail Transcriptional Repressor. Molecular and Cellular Biology 23 5078 5089. Dumont, N., Wilson, M.B., Crawford, Y.G., Reynolds, P.A., Sigaroudinia, M., and Tlsty, T.D. (2008). Sustained induction of epithelial to mesenchymal transition activates DNA methylation of genes silenced in basal like breast cancers. Proceedings of the National Academy of Sciences 105 14867 14872 Dupin, E., Creuzet, S., and Le Douarin, N.M. (2006). The contribution of the neural crest to the vertebrate body. Adv Exp Med Biol 589 96 119. Eger, A., Stockinger, A., Park, J., Langkopf, E., Mikula, M., Gotzmann, J., Mikulits, W., Beug, H., and Foisne r, R. (2004). beta Catenin and TGFbeta signalling cooperate to maintain a mesenchymal phenotype after FosER induced epithelial to mesenchymal transition. Oncogene 23 2672 2680. El Osta, A. (2003). The rise and fall of genomic methylation in cancer. Leukem ia 18 233 237. Escriva, M., Peiro, S., Herranz, N., Villagrasa, P., Dave, N., Montserrat Sentis, B., Murray, S.A., Franci, C., Gridley, T., Virtanen, I. et al. (2008). Repression of PTEN phosphatase by Snail1 transcriptional factor during gamma radiation induced apoptosis. Mol Cell Biol 28 1528 1540. Esteller, M. (2008). Epigenetics in cancer. N Engl J Med 358 1148 1159. Foulds, L. (1954). The experimental study of tumor progression: A review. Cancer Res 14 327 340.

PAGE 117

117 Frutos, C.A., Dacquin, R., Vega, S., Jurdic, P., Machuca Gayet, I., and Nieto, M.A. (2009). Snail1 controls bone mass by regulating Runx2 and VDR expression during osteoblast differentiation. EMBO J 28 686 696. Fujita, N., Jaye, D.L., Kajita, M., Geigerman, C., Moreno, C.S., and Wade, P.A. (2003). MTA3, a Mi 2/NuRD complex subunit, regulates an invasive growth pathway in breast cancer. Cell 113 207 219. Gal, A., Sjoblom, T., Fedorova, L., Imreh, S., Beug, H., and Moustakas, A. (2008). Sustained TGF beta exposure suppresses Smad and non Smad signalling in mammary epithelial cells, leading to EMT and inhibition of growth arrest and apoptosis. Oncogene 27 1218 1230. Garcia Castro, M.I., Marcelle, C., and Bronner Fraser, M. (2002). Ectodermal Wnt function as a neural crest inducer. Science 297 848 851. Giet, R., and Glover, D.M. (2001). Drosophila aurora B kinase is required for histone H3 phosphorylation and condensin recruitment during chromosome condensation and to organize the central spindle during cytokinesis. J Cell Biol 152 669 682. Gj erdrum, C., Tiron, C., Hoiby, T., Stefansson, I., Haugen, H., Sandal, T., Collett, K., Li, S., McCormack, E., Gjertsen, B.T. et al. (2009). Axl is an essential epithelial to mesenchymal transition induced regulator of breast cancer metastasis and patient survival. Proceedings of the National Academy of Sciences 107 1124 1129. Goldberg, A.D., Allis, C.D., and Bernstein, E. (2007). Epigenetics: a landscape takes shape. Cell 128 635 638. Goll, M.G., and Bestor, T.H. (2005). Eukaryotic cytosine methyltransfe rases. Annu Rev Biochem 74 481 514. Gossen, M., Freundlieb, S., Bender, G., Muller, G., Hillen, W., and Bujard, H. (1995). Transcriptional activation by tetracyclines in mammalian cells. Science 268 1766 1769. Grady, W.M., Willis, J., Guilford, P.J., Dun bier, A.K., Toro, T.T., Lynch, H., Wiesner, G., Ferguson, K., Eng, C., Park, J.G. et al. (2000). Methylation of the CDH1 promoter as the second genetic hit in hereditary diffuse gastric cancer. Nat Genet 26 16 17. Graff, J.R., Herman, J.G., Lapidus, R.G. Chopra, H., Xu, R., Jarrard, D.F., Isaacs, W.B., Pitha, P.M., Davidson, N.E., and Baylin, S.B. (1995). E cadherin expression is silenced by DNA hypermethylation in human breast and prostate carcinomas. Cancer Res 55 5195 5199.

PAGE 118

118 Graham, T.R., Zhau, H.E., Odero Marah, V.A., Osunkoya, A.O., Kimbro, K.S., Tighiouart, M., Liu, T., Simons, J.W., and O'Regan, R.M. (2008). Insulin like growth factor I dependent up regulation of ZEB1 drives epithelial to mesenchymal transition in human prostate cancer cells. Cance r Res 68 2479 2488. Grego Bessa, J., Diez, J., Timmerman, L., and de la Pompa, J.L. (2004). Notch and epithelial mesenchyme transition in development and tumor progression: another turn of the screw. Cell Cycle 3 718 721. Grimes, H.L., Chan, T.O., Zweidiler Mckay, P.A., Tong, B., and Tsichlis, P.N. (1996a). The Gfi 1 proto oncoprotein contains a novel transcriptional repressor domain, SNAG, and inhibits G1 arrest induced by interleukin 2 withdrawal. Mol Cell Biol 16 6262 6272. Grimes, H.L., Chan, T .O., Zweidler McKay, P.A., Tong, B., and Tsichlis, P.N. (1996b). The Gfi 1 proto oncoprotein contains a novel transcriptional repressor domain, SNAG, and inhibits G1 arrest induced by interleukin 2 withdrawal. Molecular and cellular biology 16 6263 6272. Grimm, C., Matos, R., Ly Hartig, N., Steuerwald, U., Lindner, D., Rybin, V., Muller, J., and Muller, C.W. (2009). Molecular recognition of histone lysine methylation by the Polycomb group repressor dSfmbt. EMBO J 28 1965 1977. Grotegut, S., von Schweinitz D., Christofori, G., and Lehembre, F. (2006). Hepatocyte growth factor induces cell scattering through MAPK/Egr 1 mediated upregulation of Snail. EMBO J 25 3534 3545. Grunert, S., Jechlinger, M., and Beug, H. (2003). Diverse cellular and molecular mecha nisms contribute to epithelial plasticity and metastasis. Nat Rev Mol Cell Biol 4 657 665. Guaita, S., Puig, I., Franci, C., Garrido, M., Dominguez, D., Batlle, E., Sancho, E., Dedhar, S., De Herreros, A.G., and Baulida, J. (2002). Snail induction of epit helial to mesenchymal transition in tumor cells is accompanied by MUC1 repression and ZEB1 expression. J Biol Chem 277 39209 39216. Gurley, L.R., D'Anna, J.A., Barham, S.S., Deaven, L.L., and Tobey, R.A. (1978). Histone phosphorylation and chromatin structure during mitosis in Chinese hamster cells. Eur J Biochem 84 1 15. Haberland, M., Johnson, A., Mokalled, M.H., Montgomery, R.L., and Olson, E.N. (2009). Genetic dissection of histone deacetylase requirement in tumor cells. Proc Natl Acad Sci U S A 106 7751 7755.

PAGE 119

119 Hajra, K.M., Chen, D.Y., and Fearon, E.R. (2002). The SLUG zinc finger protein represses E cadherin in breast cancer. Cancer Res 62 1613 1618. Halachmi, S., DeMarzo, A.M., Chow, N.H., Halachmi, N., Smith, A.E., and Linn, J.F. (2007). Genet ic alterations in urinary bladder carcinosarcoma: evidence of a common clonal origin. Eur Urol 37 350 357. Hanahan, D., and Weinberg, R.A. (2000). The hallmarks of cancer. Cell 100 57 70. Hanahan, D., and Weinberg, Robert A. (2011). Hallmarks of Cancer: The Next Generation. Cell 144 646 674. Hay, E.D. (1968). Epithelial Mesenchymal Interactions. (eds Fleischmajer, R & Billingham, RE), 31 35. Hay, E.D. (1995). An overview of epithelial mesenchymal transformation. Acta Anat (Basel) 154 8 20. Hayami, S., K elly, J.D., Cho, H., and Yoshimatsu, M. (2010). Overexpression of LSD1 contributes to human carcinogenesis through chromatin regulation in various cancers. Int J Cancer 10 1002 1013. Heimann, R., Lan, F., McBride, R., and Hellman, S. (2000). Separating fa vorable from unfavorable prognostic markers in breast cancer: the role of E cadherin. Cancer Res 60 298 304. Hemavathy, K., Asharf, S., and Tony Ip, Y. (2000a). Snail or slug family of repressors slowly going into the fast lane of development and cancer. Genes Dev 257 1 12. Hemavathy, K., Ashraf, S.I., and Ip, Y.T. (2000b). Snail/slug family of repressors: slowly going into the fast lane of development and cancer. Gene 257 1 12. Hempel, W.M., and Ferrier, P. (2004). Restriction endonuclease accessibilit y as a determinant of altered chromatin structure. Methods Mol Biol 287 53 63. Heppner, G.H. (1984). Tumor heterogeneity. Cancer Res 44 2259 2266. Herman, J.G., Graff, J.R., Myohanen, S., Nelkin, B.D., and Baylin, S.B. (1996). Methylation specific PCR: A novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A 93 9821 9826.

PAGE 120

120 Herranz, N., Pasini, D., Diaz, V.M., Franci, C., Gutierrez, A., Dave, N., Escriva, M., Hernandez Munoz, I., Di Croce, L., Helin, K. et al. (2008). Polycomb Complex 2 Is Required for E cadherin Repression by the Snail1 Transcription Factor. Molecular and Cellular Biology 28 4772 4781. High, F.A., Zhang, M., Proweller, A., Tu, L., Parmacek, M.S., Pear, W.S., and Epstein, J.A. (2007). An essen tial role for Notch in neural crest during cardiovascular development and smooth muscle differentiation. J Clin Invest 117 353 363. Hou, Z., Peng, H., Ayyanathan, K., Yan, K.P., Langer, E.M., Longmore, G.D., and Rauscher, F.J. (2008). The LIM Protein AJUB A Recruits Protein Arginine Methyltransferase 5 To Mediate SNAIL Dependent Transcriptional Repression. Molecular and Cellular Biology 28 3198 3207. Huang, Y., Greene, E., Murray Stewart, T., Goodwin, A.C., Baylin, S.B., Woster, P.M., and Casero, R.A. (200 7). Inhibition of lysine specific demethylase 1 by polyamine analogues results in reexpression of aberrantly silenced genes. Proceedings of the National Academy of Sciences 104 8023 8028. Huber, M.A., Azoitei, N., Baumann, B., Grunert, S., Sommer, A., Peh amberger, H., Kraut, N., Beug, H., and Wirth, T. (2004). NF kappaB is essential for epithelial mesenchymal transition and metastasis in a model of breast cancer progression. J Clin Invest 114 569 581. Hulpiau, P., and van Roy, F. (2009). Molecular evoluti on of the cadherin superfamily. Int J Biochem Cell Biol 41 349 369. Hunt, N.C., Douglas Jones, A.G., Jasani, B., Morgan, J.M., and Pignatelli, M. (1997). Loss of E cadherin expression associated with lymph node metastases in small breast carcinomas. Virch ows Arch 430 285 289. Ikenouchi, J. (2003). Regulation of tight junctions during the epithelium mesenchyme transition: direct repression of the gene expression of claudins/occludin by Snail. Journal of Cell Science 116 1959 1967. Ikenouchi, J., Matsuda, M., Furuse, M., and Tsukita, S. (2003). Regulation of tight junctions during the epithelium mesenchyme transition: direct repression of the gene expression of claudins/occludin by Snail. J Cell Sci 116 1959 1967. Inukai, T., Inoue, A., Kurosawa, H., Goi, K., Shinjyo, T., Ozawa, K., Mao, M., Inaba, T., and Look, A.T. (1999). SLUG, a ces 1 related zinc finger transcription factor gene with antiapoptotic activity, is a downstream target of the E2A HLF oncoprotein. Molecular cell 4 343 352.

PAGE 121

121 Janda, E., Lehmann K., Killisch, I., Jechlinger, M., Herzig, M., Downward, J., Beug, H., and Grunert, S. (2002). Ras and TGF[beta] cooperatively regulate epithelial cell plasticity and metastasis: dissection of Ras signaling pathways. J Cell Biol 156 299 313. Jenuwein, T. and Allis, C.D. (2001). Translating the histone code. Science 293 1074 1080. Joyce, J.A., and Pollard, J.W. (2009). Microenvironmental regulation of metastasis. Nat Rev Cancer 9 239 252. Julien, S., Puig, I., Caretti, E., Bonaventure, J., Nelles, L., van Roy, F., Dargemont, C., de Herreros, A.G., Bellacosa, A., and Larue, L. (2007). Activation of NF kappaB by Akt upregulates Snail expression and induces epithelium mesenchyme transition. Oncogene 26 7445 7456. Kantarjian, H., Issa, J.P., Rosenfeld, C.S ., Bennett, J.M., Albitar, M., DiPersio, J., Klimek, V., Slack, J., de Castro, C., Ravandi, F. et al. (2006). Decitabine improves patient outcomes in myelodysplastic syndromes: results of a phase III randomized study. Cancer 106 1794 1803. Karberg, S. (2 009). Switching on epigenetic therapy. Cell 139 1029 1031. Kelly, G.M., Greenstein, P., Erezyilmaz, D.F., and Moon, R.T. (1995). Zebrafish wnt8 and wnt8b share a common activity but are involved in distinct developmental pathways. Development 121 1787 17 99. Kimelman, D. (2006). Mesoderm induction: from caps to chips. Nat Rev Genet 7 360 372. Klose, R.J., and Zhang, Y. (2007). Regulation of histone methylation by demethylimination and demethylation. Nat Rev Mol Cell Biol 8 307 318. Klymenko, T., Papp, B., Fischle, W., Kocher, T., Schelder, M., Fritsch, C., Wild, B., Wilm, M., and Muller, J. (2006). A Polycomb group protein complex with sequence specific DNA binding and selective methyl lysine binding activities. Genes Dev 20 1110 1122. Klymkowsky, M.W. and Savagner, P. (2009). Epithelial Mesenchymal TransitionA Cancer Researcher's Conceptual Friend and Foe. The American Journal of Pathology 174 1588 1593.

PAGE 122

122 Kornberg, R.D., and Lorch, Y. (1999). Twenty five years of the nucleosome, fundamental particle o f the eukaryote chromosome. Cell 98 285 294. Kouzarides, T. (2007). Chromatin Modifications and Their Function. Cell 128 693 705. Kulesa, P.M., and Gammill, L.S. (2010). Neural crest migration: Patterns, phases and signals. Developmental Biology 344 566 568. Kurrey, N.K., Jalgaonkar, S.P., Joglekar, A.V., Ghanate, A.D., Chaskar, P.D., Doiphode, R.Y., and Bapat, S.A. (2009a). Snail and Slug Mediate Radioresistance and Chemoresistance by Antagonizing p53 Mediated Apoptosis and Acquiring a Stem Like Phenoty pe in Ovarian Cancer Cells. Stem Cells 27 2059 2068. Kurrey, N.K., Jalgaonkar, S.P., Joglekar, A.V., Ghanate, A.D., Chaskar, P.D., Doiphode, R.Y., and Bapat, S.A. (2009b). Snail and slug mediate radioresistance and chemoresistance by antagonizing p53 medi ated apoptosis and acquiring a stem like phenotype in ovarian cancer cells. Stem Cells 27 2059 2068. Lan, F., Collins, R.E., De Cegli, R., Alpatov, R., Horton, J.R., Shi, X., Gozani, O., Cheng, X., and Shi, Y. (2007). Recognition of unmethylated histone H 3 lysine 4 links BHC80 to LSD1 mediated gene repression. Nature 448 718 722. Lan, F., Nottke, A.C., and Shi, Y. (2008a). Mechanisms involved in the regulation of histone lysine demethylases. Curr Opin Cell Biol 20 316 325. Lan, F., Nottke, A.C., and Shi, Y. (2008b). Mechanisms involved in the regulation of histone lysine demethylases. Curr Opin Cell Biol 20 316 325. Lee, M.G., Wynder, C., Bochar, D.A., Hakimi, M.A., Cooch, N., and Shiekhattar, R. (2006). Functional interplay between histone demethylase a nd deacetylase enzymes. Mol Cell Biol 26 6395 6402. Lee, M.G., Wynder, C., Cooch, N., and Shiekhattar, R. (2005). An essential role for CoREST in nucleosomal histone 3 lysine 4 demethylation. Nature. Lee, M.Y., Chou, C.Y., Tang, M.J., and Shen, M.R. (2008 ). Epithelial mesenchymal transition in cervical cancer: correlation with tumor progression, epidermal growth factor receptor overexpression, and snail up regulation. Clin Cancer Res 14 4743 4750. Leong, K.G., Niessen, K., Kulic, I., Raouf, A., Eaves, C., Pollet, I., and Karsan, A. (2007). Jagged1 mediated Notch activation induces epithelial to mesenchymal transition through Slug induced repression of E cadherin. J Exp Med 204 2935 2948.

PAGE 123

123 Leptin, M. (1991). Twist and snail regulate fly mesoderm development Genes Dev 5 1568 1576. Li, B., Carey, M., and Workman, J.L. (2007). The role of chromatin during transcription. Cell 128 707 719. Li, Y., Welm, B., Podsypanina, K., Huang, S., Chamorro, M., Zhang, X., Rowlands, T., Egeblad, M., Cowin, P., Werb, Z. et al. (2003). Evidence that transgenes encoding components of the Wnt signaling pathway preferentially induce mammary cancers from progenitor cells. Proc Natl Acad Sci U S A 100 15853 15858. Lim, S., Janzer, A., Becker, A., Zimmer, A., Schule, R., Buettner, R., and Kirfel, J. (2009). Lysine specific demethylase 1 (LSD1) is highly expressed in ER negative breast cancers and a biomarker predicting aggressive biology. Carcinogenesis 31 512 520. Lim, S., Janzer, A., Becker, A., Zimmer, A., Schule, R., Buettner, R., and Kirfel, J. (2010). Lysine specific demethylase 1 (LSD1) is highly expressed in ER negative breast cancers and a biomarker predicting aggressive biology. Carcinogenesis 31 512 520. Lister, R., Pelizzola, M., Dowen, R.H., Hawkins, R.D., Hon, G., To nti Filippini, J., Nery, J.R., Lee, L., Ye, Z., Ngo, Q.M. et al. (2009). Human DNA methylomes at base resolution show widespread epigenomic differences. Nature 462 315 322. Littlewood, T.D., Hancock, D.C., Danielian, P.S., Parker, M.G., and Evan, G.I. (1 995). A modified oestrogen receptor ligand binding domain as an improved switch for the regulation of heterologous proteins. Nucleic Acids Res 23 1686 1690. Lo, H.W., Hsu, S.C., Xia, W., Cao, X., Shih, J.Y., Wei, Y., Abbruzzese, J.L., Hortobagyi, G.N., and Hung, M.C. (2007). Epidermal growth factor receptor cooperates with signal transducer and activator of transcription 3 to induce epithelial mesenchymal transition in cancer cells via up regulation of TWIST gene expression. Cancer Res 67 9066 9076. Lom baerts, M., van Wezel, T., Philippo, K., Dierssen, J.W., Zimmerman, R.M., Oosting, J., van Eijk, R., Eilers, P.H., van de Water, B., Cornelisse, C.J. et al. (2006). E cadherin transcriptional downregulation by promoter methylation but not mutation is rela ted to epithelial to mesenchymal transition in breast cancer cell lines. Br J Cancer 94 661 671. Lowery, L.A., and Sive, H. (2004). Strategies of vertebrate neurulation and a re evaluation of teleost neural tube formation. Mech Dev 121 1189 1197.

PAGE 124

124 Lu, J., Ruhf, M.L., Perrimon, N., and Leder, P. (2007). A genome wide RNA interference screen identifies putative chromatin regulators essential for E2F repression. Proceedings of the National Academy of Sciences 104 9381 9386. Lu, Z., Ghosh, S., Wang, Z., and H unter, T. (2003). Downregulation of caveolin 1 function by EGF leads to the loss of E cadherin, increased transcriptional activity of beta catenin, and enhanced tumor cell invasion. Cancer Cell 4 499 515. Luczak, M.W., and Jagodzinski, P. (2006). The role of DNA methylation in cancer development. Folia Histo ET Cyto 44 143 154. Mahadevan, L.C., Willis, A.C., and Barratt, M.J. (1991). Rapid histone H3 phosphorylation in response to growth factors, phorbol esters, okadaic acid, and protein synthesis inhibit ors. Cell 65 775 783. Mani, S.A., Guo, W., Liao, M.J., Eaton, E.N., Ayyanan, A., Zhou, A.Y., Brooks, M., Reinhard, F., Zhang, C.C., Shipitsin, M. et al. (2008). The epithelial mesenchymal transition generates cells with properties of stem cells. Cell 133 704 715. Margueron, R., Trojer, P., and Reinberg, D. (2005). The key to development: interpreting the histone code? Curr Opin Genet Dev 15 163 176. Martin, C., and Zhang, Y. (2005). The diverse functions of histone lysine methylation. Nat Rev Mol Cell B iol 6 838 849. Martin, T.A., Goyal, A., Watkins, G., and Jiang, W.G. (2005). Expression of the transcription factors snail, slug, and twist and their clinical significance in human breast cancer. Ann Surg Oncol 12 488 496. Marusyk, A., and Polyak, K. (20 10). Tumor heterogeneity: Causes and consequences. Biochimica et Biophysica Acta (BBA) Reviews on Cancer 1805 105 117. Massague, J. (2008). TGFbeta in Cancer. Cell 134 215 230. Mattioni, T., Louvion, J.F., and Picard, D. (1994). Regulation of protein a ctivities by fusion to steroid binding domains. Methods Cell Biol 43 Pt A 335 352. Merlo, L.M., Pepper, J.W., Reid, B.J., and Maley, C.C. (2006). Cancer as an evolutionary and ecological process. Nat Rev Cancer 6 924 935. Mikkelsen, T.S., Ku, M., Jaffe, D.B., Issac, B., Lieberman, E., Giannoukos, G., Alvarez, P., Brockman, W., Kim, T.K., Koche, R.P. et al. (2007). Genome wide maps of chromatin state in pluripotent and lineage committed cells. Nature 448 553 560.

PAGE 125

125 Miller, S.J., Lavker, R.M., and Sun, T.T. (2005). Interpreting epithelial cancer biology in the context of stem cells: tumor properties and therapeutic implications. Biochim Biophys Acta 1756 25 52. Mizuguchi, G., Tsukiyama, T., Wisniewski, J., and Wu, C. (1997). Role of nucleosome remodeling fa ctor NURF in transcriptional activation of chromatin. Mol Cell 1 141 150. Mohd Sarip, A., van der Knaap, J.A., Wyman, C., Kanaar, R., Schedl, P., and Verrijzer, C.P. (2006). Architecture of a polycomb nucleoprotein complex. Mol Cell 24 91 100. Moody, S.E ., Perez, D., Pan, T. c., Sarkisian, C.J., Portocarrero, C.P., Sterner, C.J., Notorfrancesco, K.L., Cardiff, R.D., and Chodosh, L.A. (2005). The transcriptional repressor Snail promotes mammary tumor recurrence. Cancer Cell 8 197 209. Morel, A.P., Lievre, M., Thomas, C., Hinkal, G., Ansieau, S., and Puisieux, A. (2008). Generation of breast cancer stem cells through epithelial mesenchymal transition. PLoS One 3 e2888. Mulligan, P., Yang, F., Stefano, L.D., Ji, J., Ouyang, J., Nishikawa, J.L., Toiber, D., Gill, G., Dyson, N.J., and Naar, A.M. (2011). A SIRT1 LSD1 corepressor complex regulates Notch target gene expression and development. mol Cell 42 1 11. Murray, K. (1964). The Occurrence of Epsilon N Methyl Lysine in Histones. Biochemistry 3 10 15. Nguye n, D.X., Bos, P.D., and Massagu, J. (2009). Metastasis: from dissemination to organ specific colonization. Nature Reviews Cancer 9 274 284. Nielsen, A.L., Oulad Abdelghani, M., Ortiz, J.A., Remboutsika, E., Chambon, P., and Losson, R. (2001). Heterochrom atin formation in mammalian cells: interaction between histones and HP1 proteins. Mol Cell 7 729 739. Niessen, C.M. (2007). Tight junctions/adherens junctions: basic structure and function. The Journal of investigative dermatology 127 2525 2532. Niessen, K., Fu, Y., Chang, L., Hoodless, P.A., McFadden, D., and Karsan, A. (2008). Slug is a direct Notch target required for initiation of cardiac cushion cellularization. J Cell Biol 182 315 325. Nieto, M.A. (2002). The Snail Superfamily of Zinc Finger Transc ription Factors. Nature Reviews Molecular Cell Biology 3 155 166.

PAGE 126

126 Nieto, M.A. (2005). The snail genes as inducers of cell movement and survival: implications in development and cancer. Development. Nollet, F., Kools, P., and van Roy, F. (2000). Phylogenetic analysis of the cadherin superfamily allows identification of six major subfamilies besides several solitary members. Journal of molecular biology 299 551 572. Nowak, S.J., and Corces, V.G. (2004). Phosphorylation of histone H3: a balancing a ct between chromosome condensation and transcriptional activation. Trends Genet 20 214 220. Nowak, S.J., Pai, C.Y., and Corces, V.G. (2003). Protein phosphatase 2A activity affects histone H3 phosphorylation and transcription in Drosophila melanogaster. M ol Cell Biol 23 6129 6138. Nowell, P.C. (1976). The clonal evolution of tumor cell populations. Science 1976 23 30. O'Connor, O.A., Heaney, M.L., Schwartz, L., Richardson, S., Willim, R., MacGregor Cortelli, B., Curly, T., Moskowitz, C., Portlock, C., Ho rwitz, S. et al. (2006). Clinical experience with intravenous and oral formulations of the novel histone deacetylase inhibitor suberoylanilide hydroxamic acid in patients with advanced hematologic malignancies. J Clin Oncol 24 166 173. Ooi, S.K.T., Qiu, C., Bernstein, E., Li, K., Jia, D., Yang, Z., Erdjument Bromage, H., Tempst, P., Lin, S. P., Allis, C.D. et al. (2007). DNMT3L connects unmethylated lysine 4 of histone H3 to de novo methylation of DNA. Nature 448 714 717. rom, U.A., Derrien, T., Bering er, M., Gumireddy, K., Gardini, A., Bussotti, G., Lai, F., Zytnicki, M., Notredame, C., and Huang, Q. (2010). Long Noncoding RNAs with Enhancer like Function in Human Cells. Cell 143 46 58. Paik, W.K., and Kim, S. (1969). Enzymatic methylation of histones Arch Biochem Biophys 134 632 637. Pantel, K., and Brakenhoff, R.H. (2004). Dissecting the metastatic cascade. Nature Reviews Cancer 4 448 456. Pardal, R., Clarke, M.F., and Morrison, S.J. (2003). Applying the principles of stem cell biology to cancer. Nat Rev Cancer 3 895 902.

PAGE 127

127 Paznekas, W.A., Okajima, K., Schertzer, M., Wood, S., and Jabs, E.W. (1999). Genomic organization, expression, and chromosome location of the human SNAIL gene (SNAI1) and a related processed pseudogene (SNAI1P). Genomics 62 42 4 9. Peinado, H., Ballestar, E., Esteller, M., and Cano, A. (2003a). Snail Mediates E Cadherin Repression by the Recruitment of the Sin3A/Histone Deacetylase 1 (HDAC1)/HDAC2 Complex. Molecular and Cellular Biology 24 306 319. Peinado, H., Ballestar, E., Esteller, M., and Cano, A. (2004a). Snail mediates E cadherin repression by the recruitment of the Sin3A/histone deacetylase 1 (HDAC1)/HDAC2 complex. Mol Cell Biol 24 306 319. Peinado, H., Marin, F., Cubillo, E., Stark, H.J., Fusenig, N., Nieto, M.A., and Cano, A. (2004b). Snail and E47 repressors of E cadherin induce distinct invasive and angiogenic properties in vivo. J Cell Sci 117 2827 2839. Peinado, H., Olmeda, D., and Cano, A. (2007a). Snail, Zeb and bHLH factors in tumour progression: an alliance a gainst the epithelial phenotype? Nat Rev Cancer 7 415 428. Peinado, H., Olmeda, D., and Cano, A. (2007b). Snail, Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype? Nature Reviews Cancer 7 415 428. Peinado, H., Quint anilla, M., and Cano, A. (2003b). Transforming growth factor beta 1 induces snail transcription factor in epithelial cell lines: mechanisms for epithelial mesenchymal transitions. J Biol Chem 278 21113 21123. Peiro, S. (2006). Snail1 transcriptional repre ssor binds to its own promoter and controls its expression. Nucleic Acids Research 34 2077 2084. Perl, A.K., Wilgenbus, P., Dahl, U., Semb, H., and Christofori, G. (1998). A causal role for E cadherin in the transition from adenoma to carcinoma. Nature 39 2 190 193. Piek, E., Heldin, C.H., and Dijke, P. (1999a). Specificity, diversity, and regulation in TGFb superfamily signaling. FASEB J 13 2105 2124. Piek, E., Moustakas, A., Kurisaki, A., Heldin, C.H., and ten Dijke, P. (1999b). TGF (beta) type I recept or/ALK 5 and Smad proteins mediate epithelial to mesenchymal transdifferentiation in NMuMG breast epithelial cells. J Cell Sci 112 ( Pt 24) 4557 4568.

PAGE 128

128 Piekarz, R.L., Frye, R., Turner, M., Wright, J.J., Allen, S.L., Kirschbaum, M.H., Zain, J., Prince, H.M ., Leonard, J.P., Geskin, L.J. et al. (2009). Phase II multi institutional trial of the histone deacetylase inhibitor romidepsin as monotherapy for patients with cutaneous T cell lymphoma. J Clin Oncol 27 5410 5417. Polyak, K. (2007). Breast cancer: orig ins and evolution. Journal of Clinical Investigation 117 3155 3163. Polyak, K., and Hahn, W.C. (2006). Roots and stems: stem cells in cancer. Nat Med 12 296 300. Polyak, K., and Weinberg, R.A. (2009). Transitions between epithelial and mesenchymal states : acquisition of malignant and stem cell traits. Nature Reviews Cancer 9 265 273. Prall, F. (2007). Tumour budding in colorectal carcinoma. Histopathology 50 151 162. Pratt, W.B. (1990). Interaction of hsp90 with steroid receptors: organizing some diverse observations and presenting the newest concepts. Mol Cell Endocrinol 74 C69 76. Puisieux, A., Valsesia Wittmann, S., and Ansieau, S. (2006). A twist for survival and cancer progression. Br J Cancer 94 13 17. Raible, D.W. (2006). Development of th e neural crest: achieving specificity in regulatory pathways. Curr Opin Cell Biol 18 698 703. Rea, S., Eisenhaber, F., O'Carroll, D., Strahl, B.D., Sun, Z.W., Schmid, M., Opravil, S., Mechtler, K., Ponting, C.P., Allis, C.D. et al. (2000). Regulation of chromatin structure by site specific histone H3 methyltransferases. Nature 406 593 599. Reya, T., and Clevers, H. (2005). Wnt signalling in stem cells and cancer. Nature 434 843 850. Reya, T., Morrison, S.J., Clarke, M.F., and Weissman, I.L. (2001). Stem cells, cancer, and cancer stem cells. Nature 414 105 111. Saleque, S., Kim, J., Rooke, H.M., and Orkin, S.H. (2007). Epigenetic Regulation of Hematopoietic Differentiation by Gfi 1 and Gfi 1b Is Mediated by the Cofactors CoREST and LSD1. Molecular Cell 2 7 562 572. Sauka Spengler, T., and Bronner Fraser, M. (2008). A gene regulatory network orchestrates neural crest formation. Nat Rev Mol Cell Biol 9 557 568.

PAGE 129

129 Schneider, R., Bannister, A.J., and Kouzarides, T. (2002). Unsafe SETs: histone lysine methyltra nsferases and cancer. Trends Biochem Sci 27 396 402. Schuettengruber, B., Chourrout, D., Vervoort, M., Leblanc, B., and Cavalli, G. (2007). Genome regulation by polycomb and trithorax proteins. Cell 128 735 745. Schulte, J.H., Lim, S., Schramm, A., Fried richs, N., Koster, J., Versteeg, R., Ora, I., Pajtler, K., Klein Hitpass, L., Kuhfittig Kulle, S. et al. (2009). Lysine specific demethylase 1 is strongly expressed in poorly differentiated neuroblastoma: implications for therapy. Cancer Res 69 2065 2071 Schwartz, Y.B., and Pirrotta, V. (2007). Polycomb silencing mechanisms and the management of genomic programmes. Nat Rev Genet 8 9 22. Schwartz, Y.B., and Pirrotta, V. (2008). Polycomb complexes and epigenetic states. Current Opinion in Cell Biology 20 266 273. Shackleton, M., Quintana, E., Fearon, E.R., and Morrison, S.J. (2009). Heterogeneity in Cancer: Cancer Stem Cells versus Clonal Evolution. Cell 138 822 829. Shapiro, L., Fannon, A.M., Kwong, P.D., Thompson, A., Lehmann, M.S., Grubel, G., Legrand J.F., Als Nielsen, J., Colman, D.R., and Hendrickson, W.A. (1995). Structural basis of cell cell adhesion by cadherins. Nature 374 327 337. Shestopalov, V.I., and Panchin, Y. (2008). Pannexins and gap junction protein diversity. Cell Mol Life Sci 65 37 6 394. Shi, Y. J., Matson, C., Lan, F., Iwase, S., Baba, T., and Shi, Y. (2005). Regulation of LSD1 Histone Demethylase Activity by Its Associated Factors. Molecular Cell 19 857 864. Shi, Y. (2007). Histone lysine demthylases: emerging roles in developmen t, physiology and disease. Nat Rev Genet 8 829 833. Shi, Y., Lan, F., Matson, C., Mulligan, P., Whetstine, J.R., Cole, P.A., Casero, R.A., and Shi, Y. (2004). Histone Demethylation Mediated by the Nuclear Amine Oxidase Homolog LSD1. Cell 119 941 953. Shi Y., Sawada, J., Sui, G., Affar, E.B., Whetstine, J.R., Lan, F., Ogawa, H., Luke, M.P., Nakatani, Y., and Shi, Y. (2003). Coordinated histone modifications mediated by a CtBP co repressor complex. Nature 422 735 738.

PAGE 130

130 Shi, Y., and Whetstine, J.R. (2007). Dynamic Regulation of Histone Lysine Methylation by Demethylases. Molecular Cell 25 1 14. Shin, S., Dimitri, C.A., Yoon, S. O., Dowdle, W., and Blenis, J. (2010). ERK2 but Not ERK1 Induces Epithelial to Mesenchymal Transformation via DEF Motif Dependent S ignaling Events. Molecular Cell 38 114 127. Siedlecki, P., and Zielenkiewicz, P. (2006). Mammalian DNA methyltransferase. Acta Biochimica Polonica 53 245 256. Siitonen, S.M., Kononen, J.T., Helin, H.J., Rantala, I.S., Holli, K.A., and Isola, J.J. (1996). Reduced E cadherin expression is associated with invasiveness and unfavorable prognosis in breast cancer. Am J Clin Pathol 105 394 402. Silverman, L.R., Demakos, E.P., Peterson, B.L., Kornblith, A.B., Holland, J.C., Odchimar Reissig, R., Stone, R.M., Nel son, D., Powell, B.L., DeCastro, C.M. et al. (2002). Randomized controlled trial of azacitidine in patients with the myelodysplastic syndrome: a study of the cancer and leukemia group B. J Clin Oncol 20 2429 2440. Smith, D.F., and Toft, D.O. (1993). Ster oid receptors and their associated proteins. Mol Endocrinol 7 4 11. Smith, W.C., and Harland, R.M. (1991). Injected Xwnt 8 RNA acts early in Xenopus embryos to promote formation of a vegetal dorsalizing center. Cell 67 753 765. Sokol, S., Christian, J.L., Moon, R.T., and Melton, D.A. (1991). Injected Wnt RNA induces a complete body axis in Xenopus embryos. Cell 67 741 752. Solanas, G., Porta de la Riva, M., Agusti, C., Casagolda, D., Sanchez Aguilera, F., Larriba, M.J., Pons, F., Peiro, S., Escriva, M., Munoz, A. et al. (2008). E cadherin controls beta catenin and NF kappaB transcriptional activity in mesenchymal gene expression. J Cell Sci 121 2224 2234. Soule, H.D., Maloney, T.M., Wolman, S.R., Peterson, W.D., Jr., Brenz, R., McGrath, C.M., Russo, J., Pauley, R.J., Jones, R.F., and Brooks, S.C. (1990). Isolation and characterization of a spontaneously immortalized human breast epithelial cell line, MCF 10. Cancer Res 50 6075 6086. St Croix, B., Sheehan, C., Rak, J.W., Florenes, V.A., Slingerland, J.M., and Kerbel, R.S. (1998). E Cadherin dependent growth suppression is mediated by the cyclin dependent kinase inhibitor p27(KIP1). The Journal of cell biology 142 557 571.

PAGE 131

131 Stavropoulos, P., Blobel, G., and Hoelz, A. (2006). Crystal structure and mecha nism of human lysine specific demethylase 1. Nat Struct Mol Biol 13 626 632. Steeg, P.S. (2006). Tumor metastasis: mechanistic insights and clinical challenges. Nature Medicine 12 895 904. Stemmer, V., de Craene, B., Berx, G., and Behrens, J. (2008). Sna il promotes Wnt target gene expression and interacts with beta catenin. Oncogene 27 5075 5080. Sterner, D.E., and Berger, S.L. (2000). Acetylation of histones and transcription related factors. Microbiol Mol Biol Rev 64 435 459. Stoker, M., and Perryman, M. (1985). An epithelial scatter factor released by embryo fibroblasts. J Cell Sci 77 209 223. Strahl, B.D., and Allis, C.D. (2000). The language of covalent histone modifications. Nature 403 41 45. Strichman Almashanu, L.Z., Lee, R.S., Onyango, P.O., P erlman, E., Flam, F., Frieman, M.B., and Feinberg, A.P. (2002). A genome wide screen for normally methylated human CpG islands that can identify novel imprinted genes. Genome Res 12 543 554. Strippoli, R., Benedicto, I., Perez Lozano, M.L., Cerezo, A., Lo pez Cabrera, M., and del Pozo, M.A. (2008). Epithelial to mesenchymal transition of peritoneal mesothelial cells is regulated by an ERK/NF kappaB/Snail1 pathway. Dis Model Mech 1 264 274. Sun, G., Alzayady, K., Stewart, R., Ye, P., Yang, S., Li, W., and S hi, Y. (2010). Histone Demethylase LSD1 Regulates Neural Stem Cell Proliferation. Molecular and Cellular Biology 30 1997 2005. Takai, D., and Jones, P.A. (2002). Comprehensive analysis of CpG islands in human chromosomes 21 and 22. Proc Natl Acad Sci U S A 99 3740 3745. Takeichi, M. (1991). Cadherin cell adhesion receptors as a morphogenetic regulator. Science (New York, NY 251 1451 1455. Tan, B.T., Park, C.Y., Ailles, L.E., and Weissman, I.L. (2006). The cancer stem cell hypothesis: a work in progress. Lab Invest 86 1203 1207. Taylor, K., and Labonne, C. (2007). Modulating the activity of neural crest regulatory factors. Current Opinion in Genetics & Development 17 326 331.

PAGE 132

132 Thiery, J.P. (2002). Epithelial mesenchymal transitions in tumour progression. Nature Reviews Cancer 2 442 454. Thiery, J.P. (2009). [Epithelial mesenchymal transitions in cancer onset and progression]. Bull Acad Natl Med 193 1969 1978; discussion 1978 1969. Thiery, J.P., Acloque, H., Huang, R.Y., and Nieto, M.A. (2009). Epithelial mesenchymal transitions in development and disease. Cell 139 871 890. Thiery, J.P., and Sleeman, J.P. (2006). Complex networks orchestrate epithelial mesenchymal transitions. Nat Rev Mol Cell Biol 7 131 142. Thuault, S., Tan, E.J., Peinado, H., Cano, A., Heldin, C.H., and Moustakas, A. (2008). HMGA2 and Smads co regulate SNAIL1 expression during induction of epithelial to mesenchymal transition. J Biol Chem 283 33437 33446. Timmerman, L.A., Grego Bessa, J., Raya, A., Bertran, E., Perez Pomares, J.M., Diez, J., Aranda, S., Palomo, S., McCormick, F., Izpisua Belmonte, J.C. et al. (2004). Notch promotes epithelial mesenchymal transition during cardiac development and oncogenic transformation. Genes Dev 18 99 115. Tinelli, A., Malvasi, A., Rahimi, S., Ne gro, R., Cavallotti, C., Vergara, D., Vittori, G., and Mettler, L. (2009). Myoma pseudocapsule: a distinct endocrino anatomical entity in gynecological surgery. Gynecol Endocrinol 25 661 667. Trelstad, R.L., Hay, E.D., and Revel, J.D. (1967). Cell contact during early morphogenesis in the chick embryo. Dev Biol 16 78 106. Trimboli, A.J., Fukino, K., de Bruin, A., Wei, G., Shen, L., Tanner, S.M., Creasap, N., Rosol, T.J., Robinson, M.L., Eng, C. et al. (2008). Direct evidence for epithelial mesenchymal tr ansitions in breast cancer. Cancer Res 68 937 945. Turkek Plewa, J., and Jagodzinski, P. (2005). The role of mammalian DNA methyltransferases in the regulation of gene expression. Cell Mol Biol Lett 10 631 647. Tyler, S. (2003). Epithelium the primary bu ilding block for metazoan complexity. Integr Comp Biol 43 55 63. Usami, Y., Satake, S., Nakayama, F., Matsumoto, M., Ohnuma, K., Komori, T., Semba, S., Ito, A., and Yokozaki, H. (2008). Snail associated epithelial mesenchymal transition promotes oesopha geal squamous cell carcinoma motility and progression. J Pathol 215 330 339.

PAGE 133

133 Usui, H., Ichikawa, T., Kobayashi, K., and Kumanishi, T. (2000). Cloning of a novel murine gene Sfmbt, Scm related gene containing four mbt domains, structurally belonging to the Polycomb group of genes. Gene 248 127 135. Vallin, J., Thuret, R., Giacomello, E., Faraldo, M.M., Thiery, J.P., and Broders, F. (2001). Cloning and characterization of three Xenopus slug promoters reveal direct regulation by Lef/beta catenin signaling. J Biol Chem 276 30350 30358. van Leeuwen, F., Gafken, P.R., and Gottschling, D.E. (2002). Dot1p modulates silencing in yeast by methylation of the nucleosome core. Cell 109 745 756. Vega, S., Morales, A.V., Ocana, O.H., Valdes, F., Fabregat, I., and Nieto M.A. (2004). Snail blocks the cell cycle and confers resistance to cell death. Genes & Development 18 1131 1143. Vergara, D., Merlot, B., Lucot, J.P., Collinet, P., Vinatier, D., Fournier, I., and Salzet, M. (2010). Epithelial mesenchymal transition in ovarian cancer. Cancer Lett 291 59 66. Vermeulen, M., Mulder, K.W., Denissov, S., Pijnappel, W.W., van Schaik, F.M., Varier, R.A., Baltissen, M.P., Stunnenberg, H.G., Mann, M., and Timmers, H.T. (2007). Selective anchoring of TFIID to nucleosomes by trime thylation of histone H3 lysine 4. Cell 131 58 69. Viebahn, C. (1995). Epithelio mesenchymal transformation during formation of the mesoderm in the mammalian embryo. Acta Anat (Basel) 154 79 97. Vinas Castells, R., Beltran, M., Valls, G., Gomez, I., Garci a, J.M., Montserrat Sentis, B., Baulida, J., Bonilla, F., de Herreros, A.G., and Diaz, V.M. (2009). The Hypoxia controlled FBXL14 Ubiquitin Ligase Targets SNAIL1 for Proteasome Degradation. Journal of Biological Chemistry 285 3794 3805. Visvader, J.E. (20 11). Cells of origin in cancer. Nature 469 314 322. Visvader, J.E., and Lindeman, G.J. (2008). Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nature Reviews Cancer 8 755 768. Waddington, C.H. (1957). The strategy of t he genes: a discussion of some aspects of theoretical biology (London: Allen & Unwin). Wanami, L.S., Chen, H.Y., Peiro, S., Garcia de Herreros, A., and Bachelder, R.E. (2008). Vascular endothelial growth factor A stimulates Snail expression in breast tumor cells: implications for tumor progression. Exp Cell Res 314 2448 2453.

PAGE 134

134 Wang, Y., Zhang, H., Chen, Y., Sun, Y., Yang, F., Yu, W., Liang, J., Sun, L., Yang, X., Shi, L. et al. (2009a). LSD1 Is a Subunit of the NuRD Complex and Targets the Metastasis Programs in Breast Cancer. Cell 138 660 672. Wang, Z., Zang, C., Cui, K., Schones, D.E., Barski, A., Peng, W., and Zhao, K. (2009b). Genome wide mapping of HATs and HDACs reveals d istinct functions in active and inactive genes. Cell 138 1019 1031. Wells, J., and Farnham, P.J. (2002). Characterizing transcription factor binding sites using formaldehyde crosslinking and immunoprecipitation. Methods 26 48 56. Wicha, M.S., Liu, S., an d Dontu, G. (2006). Cancer stem cells: an old idea -a paradigm shift. Cancer Res 66 1883 1890; discussion 1895 1886. Wijnhoven, B.P.L., Dinjens, W.N.M., and Pignatelli, M. (2000). E cadherin catenin cell cell adhesion complex and human cancer. British Jou rnal of Surgery 87 992 1005. Wu, J., Yang, J., and Klein, P.S. (2005a). Neural crest induction by the canonical Wnt pathway can be dissociated from anterior posterior neural patterning in Xenopus. Dev Biol 279 220 232. Wu, S., Trievel, R.C., and Rice, J. C. (2007). Human SFMBT is a transcriptional repressor protein that selectively binds the N terminal tail of histone H3. FEBS Letters 581 3289 3296. Wu, W. S., Heinrichs, S., Xu, D., Garrison, S.P., Zambetti, G.P., Adams, J.M., and Look, A.T. (2005b). Slug Antagonizes p53 Mediated Apoptosis of Hematopoietic Progenitors by Repressing puma. Cell 123 641 653. Wyckoff, J.B., Wang, Y., Lin, E.Y., Li, J.F., Goswami, S., Stanley, E.R., Segall, J.E., Pollard, J.W., and Condeelis, J. (2007). Direct visualization of macrophage assisted tumor cell intravasation in mammary tumors. Cancer Res 67 2649 2656. Yang, A.D., Fan, F., Camp, E.R., van Buren, G., Liu, W., Somcio, R., Gray, M.J., Cheng, H., Hoff, P.M., and Ellis, L.M. (2006a). Chronic oxaliplatin resistance induc es epithelial to mesenchymal transition in colorectal cancer cell lines. Clin Cancer Res 12 4147 4153. Yang, J., and Weinberg, R.A. (2008). Epithelial Mesenchymal Transition: At the Crossroads of Development and Tumor Metastasis. Developmental Cell 14 81 8 829.

PAGE 135

135 Yang, L., Lin, C., and Liu, Z.R. (2006b). P68 RNA helicase mediates PDGF induced epithelial mesenchymal transition by displacing Axin from beta catenin. Cell 127 139 155. Yang, M., Gocke, C.B., Luo, X., Borek, D., Tomchick, D.R., Machius, M., Otwin owski, Z., and Yu, H. (2006c). Structural basis for CoREST dependent demethylation of nucleosomes by the human LSD1 histone demethylase. Mol Cell 23 377 387. Yang, X.J. (2004). The diverse superfamily of lysine acetyltransferases and their roles in leukem ia and other diseases. Nucleic Acids Res 32 959 976. Yook, J.I., Li, X., Ota, I., Hu, C., Kim, H.S., Kim, N.H., Cha, S.Y., Fearon, E.R., and Weiss, S.J. (2006). A Wnt Axin2 GSK3beta cascade regulates Snail1 activity in breast cancer cells. Nat Cell Biol 8 1398 1412. Yu, L., Li, H.Z., Lu, S.M., Liu, W.W., Li, J.F., Wang, H.B., and Xu, W. (2009a). Alteration in TWIST expression: possible role in paclitaxel induced apoptosis in human laryngeal carcinoma Hep 2 cell line. Croat Med J 50 536 542. Yu, L., Li, H.Z., Lu, S.M., Liu, W.W., Tian, J.J., Li, J.F., Wang, H.B., and Xu, W. (2009b). [Role of TWIST in the apoptosis of Hep 2 cells induced by paclitaxel]. Zhonghua Er Bi Yan Hou Tou Jing Wai Ke Za Zhi 44 772 776. Zhang, Y., and Reinberg, D. (2001). Transcrip tion regulation by histone methylation: interplay between different covalent modifications of the core histone tails. Genes Dev 15 2343 2360. Zhao, P., Iezzi, S., Carver, E., Dressman, D., Gridley, T., Sartorelli, V., and Hoffman, E.P. (2002). Slug is a n ovel downstream target of MyoD. Temporal profiling in muscle regeneration. J Biol Chem 277 30091 30101. Zhou, B.P., Deng, J., Xia, W., Xu, J., Li, Y.M., Gunduz, M., and Hung, M.C. (2004). Dual regulation of Snail by GSK 3beta mediated phosphorylation in c ontrol of epithelial mesenchymal transition. Nat Cell Biol 6 931 940.

PAGE 136

136 BIOGRAPHICAL SKETCH Tong Lin was born in 1983 in a beautiful coastal city of Zhejiang Province, China. He grew up close to the seashore for 18 years, where one of his favorites is to take short ferries during weekends to feel the refreshing sea breezes. In 2002, he attended Fudan University, Shanghai, and spent four years of his college life in this modern and fast paced metropolitan. In his junior year, he joined the laboratory of Dr. Li Jin as an undergraduate research assistant, where he learned human population genetics. His research invol ved in mapping genes associated with hypertension or heroin addiction in Chinese population. In 2006, he luckily received an offer from the Genetics and Genomics program in University of Florida. He then flew thousands of miles away from home to pursue a g metastasis. His work resulted in a publication in Oncogene In August 2011, He received his Ph.D degree from th e Genetics and Genomics Program, College of Medicine, University of Florida Tong intends to keep investigating the role of chromatin structure in gene regulation, especially at genome wide scale. In the long term, he would like to find a research and deve lopment position in the pharmaceutical or biotechnology industry.