Role of Hedgehog Signaling and Bone Morphogenetic Proteins during Intervertebral Disc and Limb Development

MISSING IMAGE

Material Information

Title:
Role of Hedgehog Signaling and Bone Morphogenetic Proteins during Intervertebral Disc and Limb Development
Physical Description:
1 online resource (109 p.)
Language:
english
Creator:
Choi,Kyung-Suk
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Genetics (IDP)
Committee Chair:
Harfe, Brian D
Committee Members:
Swanson, Maurice S
Cohn, Martin J
Terada, Naohiro

Subjects

Subjects / Keywords:
aer -- bmp -- mouse -- notochord -- shh -- smo -- smoothened
Genetics (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Degeneration of the intervertebral discs, in particular the nucleus pulposus in the center of the disc, occurs as a person ages and can lead to intense pain. A classically identified notochordal cell population in the nucleus pulposus is thought to regulate disc homeostasis. In this study, we provide the first direct evidence that all cell types in the adult mouse nucleus pulposus are derived from the embryonic notochord. Additionally, rare isolated embryonic notochord cells were found to remain in the vertebral column and resembled notochordal remnants. The development and characterization of a mouse model that can be used to fate map nucleus pulposus precursor cells in any mutant background will be useful for uncovering the cellular and molecular mechanisms of disc degeneration. The vertebrae notochord is a transient rod-like structure that produces secreted factors that are responsible for patterning surrounding tissues. Here we demonstrate that hedgehog signaling is required for formation of the intervertebral discs. Removal of hedgehog signaling in the notochord resulted in the formation of an aberrant notochord sheath. In the absence of the notochord sheath, small nuclei pulposi were formed with most notochord cells dispersed throughout the vertebral bodies. Our data suggests that the formation of the notochord sheath requires hedgehog signaling and the notochord sheath functions as a wrapper around the notochord to constrain these cells along the vertebral column. In addition to our studies investigating the role of hedgehog signaling, we investigated the role of bone morphogenetic proteins 2 and 4 (BMP2 and BMP4) in the apical ectodermal ridge (AER). To investigate the role BMP ligands expressed in the AER play in limb development we selectively inactivated both Bmp2 and Bmp4 in this tissue. The autopods of mice lacking both of these genes contained extra digits, digit bifurcations and interdigital webbing due to a decrease in programmed cell death and an increase in cell proliferation in the underlying mesoderm. However, removal of both Bmp2 and Bmp4 in this tissue did not result in defects in proximal-distal patterning. Our data suggests that AER expression of Bmp2 and Bmp4 are required for digit patterning but not for limb outgrowth.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Kyung-Suk Choi.
Thesis:
Thesis (Ph.D.)--University of Florida, 2011.
Local:
Adviser: Harfe, Brian D.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043289:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 ROLE OF HEDGEHOG SIG NALING AND BONE MORP HOGENETIC PROTEINS DURING INTERVERTEBRA L DISC AND LIMB DEVE LOPMENT By KYUNG SUK CHOI A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLME NT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Kyung suk Choi

PAGE 3

3 To my wife and family

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my wife and my family in South Korea for their love and support. I thank my mentor Dr. Brian Harfe for his support, patience and enthusiasm. He is an exceptional scientist and a good mentor, loves to discuss research projects and other issues in the lab and provides a creative laboratory environment. I am also grateful to my advisory committee members Drs. Maurice Swanson, Martin Cohn, and Naohiro Terada for their patience and guidance. Their criticisms have made me a stronger and better scientist. I have been fortunate to work with outstanding lab members. They became good role models during the course of my graduate studies and continue to serve as excellent examples for what I can accomplish in my future career. I thank all former and present members of the Harfe lab: Dr. Jason Rock, Dr. Cortney Bouldin, Jen Maier, Dr. Danielle Maatouk, Ben Cole, Yasmin Mohiuddin, Dr. Chanmi Lee, Dr. Rui Zhang, and Kendra McKee for friendship and helpful discussions. Also, I thank members of the Cohn lab for technical support and helpful discussions. For their technical support, I acknowledge Dr. Byung Ho Kang and Karen Kelly in the University of Florida, ICBR. I thank Joyce Connors, Michelle Ramsey, Jenneene Spencer and Kristyn Minkoff for managing administrative aspects of my graduate work. Lastly, I thank Dr s. S. Paul Oh and Chan Wha Kim for their encouragement and support for my career and Pastors Ki Hong Kim in South Korea, Hee Young Sohn and Min Seok Sohn in Gainesville, Florida for their love, support and prayers.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 12 CHAPTER 1 INTERVERTEBRAL DISC DEVELOPMENT ................................ .......................... 14 Low Back Pain ................................ ................................ ................................ ........ 14 Structure of the Intervertebral Disc ................................ ................................ ......... 14 Development of the Intervertebral Disc ................................ ................................ ... 15 Molecular Signaling in Notochord and Intervertebral Disc Development ................ 16 Postnatal Changes in the Mature Nucleus Pulposus ................................ .............. 18 2 LIMB DEVELOPMENT ................................ ................................ ........................... 20 The Role of Sonic Hedgehog (Shh) in Limb Development ................................ ...... 20 The Role of Bone Morphogenetic Protein (Bmp) in the Limb ................................ .. 20 Shh Fgf Positive Feedback Loop ................................ ................................ ............ 22 The Role of En1, Wnt7a, and Lmx1b in Limb Development ................................ ... 22 3 IDENTIFICATION OF NUCLEUS PULPOSUS PRECURSOR CELLS AND NOTOCHORDAL REMNANTS IN THE MOUSE: IMPLICATIONS FOR DISC DEGENERATION AND CHORDOMA FORMATION ................................ .............. 24 Introduction ................................ ................................ ................................ ............. 24 Results ................................ ................................ ................................ .................... 26 Shh expressing Cells in the Mouse Embryo Fo rm the Nucleus Pulposus of the Intervertebral Discs. ................................ ................................ ................ 26 The Tamoxifen Inducible Allele ShhcreERT 2 Identifies the Embryonic Notochord as the Source of Nucleus Pulposus Cells. ................................ ... 28 The Adult Nuclei Pulposi is Composed Entirely of Shh Descendant Cells. ...... 29 Notochord Cells That Do Not End Up Residing in the Nucleus Pulposus F orm Notochordal Remnants in the Vertebral Column. ................................ 30 Discussion ................................ ................................ ................................ .............. 30 Materials and Methods ................................ ................................ ............................ 34 Strain Construction and Genotyping ................................ ................................ 34 Detection of Report Activity ................................ ................................ .............. 34

PAGE 6

6 4 HEDGEHOG SIGNALING IS REQUIR ED FOR FORMATION OF THE NOTOCHORD SHEATH AND PATTERNING OF NUCLEI PULPOSI WITHIN THE INTERVERTEBRAL DISCS ................................ ................................ ............ 39 Introduction ................................ ................................ ................................ ............. 39 Res ults ................................ ................................ ................................ .................... 41 Removal of Hedgehog Signaling from the Mouse Notochord ........................... 41 Removal of Hedgehog Signaling from Shh expressing Cells Result s in Loss of Caudal Skeletal Elements ................................ ................................ ......... 41 Loss of Caudal Structures upon Removal of Hedgehog Signaling Using the Shhgfpcre Allele ................................ ................................ ............................ 43 Removal of Hedgehog Signaling from Shh expressing Cells Did Not Affect Pax1 or Pax3 Expression in Rostral Somites ................................ ................ 43 Hedgehog Signaling is Required for Formation of Intervertebral Discs an d Normal Cell Proliferation in the Notochord ................................ .................... 44 Removal of Hedgehog Signaling Did Not Increase Cell Death in the Notochord ................................ ................................ ................................ ...... 45 Re moval of Hedgehog Signaling Resulted in Aberrant Migration of Notochord Cells during Intervertebral Disc Formation ................................ ... 45 T (Brachyury) is Not Expressed in Notochord Cells That Reside Outside Nucl ei Pulposi ................................ ................................ ............................... 46 Hedgehog Signaling is Required for Notochord Sheath Formation .................. 47 Removal of Hedgehog Signaling after Formation of the Notochord Sheath Does Not Affect Nuclei Pulposi Patterning or Growth ................................ ... 48 Proper Formation of Vertebrae is Required for the Transition of the Notochord into Nuclei Pulposi ................................ ................................ ....... 49 Discussion ................................ ................................ ................................ .............. 49 Role of Hedgehog Signaling within the Mouse Notochord ................................ 49 Role of the Notochord Sheath during Intervertebral Disc Formation ................ 51 Materials and Methods ................................ ................................ ............................ 53 Mice ................................ ................................ ................................ .................. 53 Histology and Immunohistochemistry ................................ ............................... 53 Cell Proliferation and Death Assay ................................ ................................ ... 54 Electron Microscopy ................................ ................................ ......................... 55 5 IN THE LIMB AER BMP2 AND BMP4 ARE REQUIRED FOR DORSAL VENTRAL PATTERING AND INTERDIGITAL CELL DEATH BUT NOT LIMB OUTGROWTH ................................ ................................ ................................ ........ 68 Introduction ................................ ................................ ................................ ............. 68 Results ................................ ................................ ................................ .................... 70 Msx2 Cre Inactivation of the Floxed Bmp2 and Bmp4 Alleles in the Limb AER ................................ ................................ ................................ ............... 70 Removal of Bmp2 and Bmp4 in the Limb AER Results in Polydactyly, Syndactyly and Retention of Interdigital Tissue but Does Not Cause Defects in Proximal Distal Patterning ................................ ............................ 72

PAGE 7

7 Removal of Ectodermal BMPs Resulted in Expansion of the AER and Delayed AER Regression ................................ ................................ .............. 73 Bmp2 and Bmp4 Expression in the AER is Required for Regulating Interdigital Apop tosis and Cell Proliferation ................................ ................... 74 Distal Gremlin Expression in the Limb Mesoderm Requires Expression of Bmp2 and Bmp4 in the AER ................................ ................................ ......... 75 Expression of Engrailed 1 in the AER and Specification of Ventral Ectodermal Structures Requires Bmp2 and Bmp4 Expression in the AER ... 75 Discussion ................................ ................................ ................................ .............. 76 AER Expression of Bmp2 and Bmp4 is Not Required for Limb Outgrowth ....... 77 Interdigital Apoptosis Requires Ectodermal Expression of Bmp Ligands ......... 78 The Role of Bmp Ligands in the AER ................................ ............................... 79 Materials and Methods ................................ ................................ ............................ 81 Mouse Strain Construction a nd Genotyping ................................ ..................... 81 Whole Mount RNA In Situ Hybridization, Lysotracker Staining, Skeletal Preparations and Cell Proliferation Analysis ................................ ................. 82 6 CONCLUDING REMARKS ................................ ................................ ..................... 93 APPENDIX A OLIGONUCLEOTIDES USED AS GENOTYPING PRIMERS ................................ 96 B PROBES USED FOR RNA IN SITU HYBRIDIZATION ................................ ........... 97 LIST OF REFERENCES ................................ ................................ ............................... 98 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 109

PAGE 8

8 LIST OF TABLES Table page A 1 Oligonucleotides used as genotyping primers. ................................ ................... 96 B 1 Probes used for RNA in situ hybridization. ................................ ......................... 97

PAGE 9

9 LIST OF FIGURES Figure page 3 1 Fate mapping Shh expressing cells in the axial skeleton using the Shhcre allele ................................ ................................ ................................ ................... 36 3 2 Fate map of Shh expressing cells using the Shhcre and the tamoxifen inducible ShhcreERT 2 alleles ................................ ................................ ............. 37 3 3 The nucleus pulposus and notochordal remnants in adult mice are composed of cells that have expressed Shh ................................ ................................ ........ 38 4 1 Removal of SMO in Shh expressing cells ................................ .......................... 56 4 2 Removal of SMO in the notochord results in caudal trunc ation of vertebrae ...... 57 4 3 Expression of Pax1 and Pax3 in rostral somites was not affected by removal of hedgehog signaling in the notochord ................................ .............................. 58 4 4 Removal of SMO in Shh expressing cells results in abnormal development of the intervertebral discs ................................ ................................ ....................... 59 4 5 Removal of hedgehog signaling resulted in a decrease in cell prolif eration in rostral mutant notochords ................................ ................................ ................... 60 4 6 Aberrant cell death did not occur upon removal of hedgehog signaling in the notochord ................................ ................................ ................................ ........... 61 4 7 Aberrant migration of notochord cells throughout the vertebral column upon removal of hedgehog signaling in the notochord ................................ ................ 62 4 8 Notochord cells that did not reside within nuclei pulp osi failed to express T ( Brachyury ). ................................ ................................ ................................ ........ 63 4 9 Hedgehog signaling is required for notochord sheath formation ........................ 64 4 10 Shh is require d for patterning the intervertebral discs ................................ ........ 65 4 11 Shh is required for formation but not maintenance of the notochord sheath ...... 66 4 12 Proposed role for the notochord sheath in forming nuclei pulposi of the intervertebral discs ................................ ................................ ............................. 67 5 1 Msx2 Cre removes floxed Bmp2 and Bmp4 alleles from the AER ...................... 83 5 2 Removal of Bmp2 and Bmp4 from the AER results in polydactyly, syndactyly and retention of interdigital tissue ................................ ................................ ....... 84

PAGE 10

10 5 3 AER expansion upon removal of Bmp 2 and Bmp4 ................................ ............. 85 5 4 Ectopic Fgf4 and Fgf8 expression occurs in double knockout limbs ................... 86 5 5 AER expression of Bmp2 and Bmp4 is req uired for regulating cell death, cell proliferation and Gremlin expression in the limb mesenchyme .......................... 87 5 6 Anterior expansion of Hox genes but not Hedeghog signaling occurs in the limb mesenchym e upon removal of Bmp2 and Bmp4 from the AER ................. 89 5 7 Bmp ligands expressed in the AER are required for dorsal ventral patterning ... 90 5 8 Model: Proposed role of BMP ligands in the AER ................................ ............. 91 5 9 Bmp expression in the mesenchyme is not altered in the double mutants ......... 92

PAGE 11

11 LIST OF ABBREVIATI ONS AER apical ectodermal ridge Bmp bone morphogenetic protein Bmpr bone morphogenetic protein receptor BrdU 5 bromo 2' deoxyuridine DNA deoxyribonucleic acid E embryonic day En1 engrailed1 Fgf fibroblast growth factor GFP green fluorescent protein Ihh In dian hedgehog IP intraperitoneal P postnatal day Ptch1 patched1 RNA ribonucleic acid Shh sonic hedgehog Smo smoothened TUNEL terminal deoxynucleotidyl transferase dUTP nick end labeling ZPA zone of polarizing activity

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ROLE OF HEDGEHOG SIG NALING AND BONE MORP HOGENETIC PROTEINS DURING INTERVERTEBRA L DISC AND LIMB DEVE LOPME NT By Kyung suk Choi August 2011 Chair: Brian D. Harfe Major: Medical Sciences Genetics Degeneration of the intervertebral discs, in particular the nucleus pulposus in the center of the disc, occurs as a person ages and can lead to intense pain. A cla ssically disc homeostasis. In this study, we provide the first direct evidence that all cell types in the adult mouse nucleus pulposus are derived from the embryonic n otochord. Additionally, rare isolated embryonic notochord cells were found to remain in the vertebral column and resembled notochordal remnants. The development and characterization of a mouse model that can be used to fate map nucleus pulposus precursor cells in any mutant background will be useful for uncovering the cellular and molecular mechanisms of disc degeneration. The vertebrae notochord is a transient rod like structure that produces secreted factors that are responsible for patterning surroundin g tissues. Here we demonstrate that hedgehog signaling is required for formation of the intervertebral discs. Removal of hedgehog signaling in the notochord resulted in the formation of an aberrant notochord sheath. In the absence of the notochord sheat h, small nuclei pulposi were formed with most notochord cells dispersed throughout the vertebral bodies. Our data suggests that

PAGE 13

13 the formation of the notochord sheath requires hedgehog signaling and the notochord notochord to constrain these cells along the vertebral column. In addition to our studies investigating the role of hedgehog signaling, we investigated the role of bone morphogenetic proteins 2 and 4 (BMP2 and BMP4) in the apical ectodermal ridge (AER). T o investigate the role BMP ligands expressed in the AER play in limb development we selectively inactivated both Bmp2 and Bmp4 in this tissue. The autopods of mice lacking both of these genes contained extra digits, digit bifurcations and interdigital web bing due to a decrease in programmed cell death and an increase in cell proliferation in the underlying mesoderm. However, removal of both Bmp2 and Bmp4 in this tissue did not result in defects in proximal distal patterning. Our data suggests that AER ex pression of Bmp2 and Bmp4 are required for digit patterning but not for limb outgrowth.

PAGE 14

14 CHAPTER 1 INTERVERTEBRAL DISC DEVELOPMENT Low Back Pain Low back pain will affect most people over the age of 65 in industrialized countries. In the U.S., tr eatment of low back pain is estimated to cost 50 100 billion dollars per year (reviewed in ( Katz, 2006 ) ). For the majority of people, bed rest will relieve most sy mptoms of back pain but in a small population of patients the condition will become chronic. Both the severity and incidence of back pain increase as people age. Most back pain is thought to originate from the degeneration of the intervertebral discs or through physical damage to the disc. This leads either to herniation of the middle part of the disc called the nucleus pulposus into the vertebral column and/or tears, bulging, and rupture of the annulus fibrosus, which surrounds the nucleus pulposus. Re duction in the thickness of the discs results in the compression of the vertebral facets, which then exert pressure on the nerve roots, leading to back pain (reviewed in ( Hunter et al., 2003a ) ). Structure of the Intervertebral Disc The intervertebral discs connect two adjacent vertebrae and provide shock absorption an d structural stability and flexibility to the spinal column. The intervertebral disc has three major components: the nucleus pulposus, the gelatinous inner core of the intervertebral discs; the annulus fibrosus, a fibrous capsule that surrounds the nucleu s pulposus; and the cartilaginous end plates, which are situated at the articular surfaces of the intervertebral disc and the adjacent vertebrae ( Humzah and Soames, 1988 ) The nuclei pulposi, which originate from the embryonic n otochord ( Walmsley, 1953 ; Choi et al., 2008 ) are composed primarily of proteoglycan, water and collagen type II and are

PAGE 15

15 located in the middle of each intervertebral disc (reviewed in ( Adams and Roughley, 2006 ) ). It is the nucleus pulposus that is thought to be required for the generation and main ( Setton and Chen, 2006 ) Damage to or loss of the nucleus pulposus as a person ages often leads to disc disease and ba ck pain ( Hunter et al., 2003a ) As the discs age or are damaged the nucleus pulposus is dramatically altered. Proteoglycan and water content decreases in the nucleus pulposus and collagen type II is replaced by type I collagen so that nuclei pulposi become more fibrous and contain less water. The annulus fibrosus is thought to originate from the sclerotome and surrounds the mature nucleus pulposus ( Bagnall et al., 1988 ; Huang e t al., 2000 ) The annulus fibrosus is composed of concentric lamellae of collagen fibers ( Adams and Roughley, 2006 ) With increased age, the annulus fibrosus stiffens and microstructura l clefts or tears commonly occur in the tissue. Two thin cartilage endplates are located between each intervertebral disc and vertebral body, which allows nutrients to diffuse from the vertebral body into the nucleus pulposus ( Urban et al., 2004 ) Development of the Intervertebral Disc In higher vertebrates, the notochord is a transient rod like structure that is located along the midline. In low vertebrates a nd in primitive fish the notochord persists throughout development and provides the structural integrity required for locomotion (reviewed in ( Stemple, 2005 ) ). Signals from the notochord serve as a signaling center to form the floor plate and ind uce the differentiation of ventral somites into the sclerotome. After the induction of sclerotome, cells of the sclerotome migrate and condense around the notochord to form an unsegmented perichordal tube. After formation of the perichordal tube the axia l mesenchyme exhibits a metameric pattern of

PAGE 16

16 more condensed and less condensed regions. More condensed regions give rise to inner annulus fibrosus and outer annulus fibrosus and less condensed regions develop into vertebral bodies ( Aszodi et al., 1998 ; Smits and Lefebvre, 2003 ) During annulus fibrosus formation, notochord cells are simultaneously removed from regi ons of the embryo containing the vertebral bodies and relocated to the intervertebral mesenchyme to form the nucleus pulposus through an unknown mechanism ( Walmsl ey, 1953 ; Choi et al., 2008 ) Interestingly, mouse mutants that formed aberrant cartilage around the vertebral column (but still had a normal notochord and notochord sheath) failed to remove notochord c ells from the vertebral bodies resulting in malformed intervertebral discs ( Wallin et al., 1994 ; Aszodi et al., 1 998 ; Lettice et al., 1999 ; Peters et al., 1999 ) These data support the hypothesis that a mechanical force driven by the forming vertebral bodies is responsible for pushing notochord cells into the intervertebral discs ( Theiler, 1988 ; Rufai et al., 1995 ; Aszodi et al., 1998 ; Smits and Lefebvre, 2003 ) Molecular Signaling in Notochord and Intervertebral Disc Development During embryogenesis the notochord prod uces signaling molecules to induce cell differentiation and to pattern the somites. Foxa2 is a forkhead/ winged helix transcription factor and is required for specifying the node and notochord. Foxa2 mutant mice did not form node and lacked notochord cel ls ( Ang and Rossant, 1994 ; Weinstein et al., 1994 ) Brachyury (T) a T box transcription factor, is expressed in the notochord and is required for cell differentiation and survival. Brachyury heterozygous mutants contained abnormal vertebrae posterior to the sacrum, which resulted in decreased tail length. Brachyury homozygote mutant embryos died at E10 due to d efects in mesoderm formation and notochord differentiation ( Herrmann et al., 1990 )

PAGE 17

17 Sonic hedgehog (SHH) is secreted from the notochord and patterns the somite s. In addition, secreted SHH induces Shh mRNA expression in the floor plate which results in propagate of the hedgehog signaling in neural tube (reviewed in ( Placzek, 1995 ) ). Interestingly, in Shh null mice the notochord is formed but is quickly dismantled during early development ( Chiang et al., 1996 ) ; thus, Shh is not required for initiation of the notochord but is required for maintenance of notochord structure. Shh is also expressed in nuclei pulposi in both pr enatal and early postnatal intervertebral discs ( DiPaola et al., 2005 ; Dahia et al., 2009 ) ; however, the role o f Shh in transforming the notochord into nuclei pulposi and in postnatal intervertebral discs is still unknown. Pax genes encode paired box transcription factors and are required for normal development of the axial skeleton. Pax1 is expressed in the scle rotome at E8.5 onward and Pax1 expression is restricted to the anlagen of the annulus fibrosus in later development ( Smits and Lefebvre, 2003 ) Pax1 homozygous mu tants have defects in the formation of vertebral bodies and intervertebral discs. In these mutants, the notochord was not removed from vertebral bodies and remained as a rod like structure between vertebrae. Collagen type II is mostly expressed in carti lage. In collagen type II mutant mice, the vertebral column was severely malformed and the notochord persists until birth ( Aszodi et al., 1998 ) The analysis of Pa x and Collagen mutants suggest that the formation of nuclei pulposi is indirectly affected by vertebral column formation. Sox5, Sox6 are expressed in the notochord and sclerotome derived tissues ( Smits and Lefebvre, 2003 ) Sox5 and Sox6 double mutant mice exhibited severe malformation of the axial skeleton and nuclei pulposi. In these mice, the notochord sheath failed to

PAGE 18

18 develop and the notochord underwent cell dea th ( Smits and Lefebvre, 2003 ) It has been suggested that the notochord sheath supports structural integrity of the notochord and resists the internal pressure of cells located in the notochord and the outer pressure produced from vertebral column. However, the origin and molecular mechanism of notochord sheath formation are still unknown. Postnatal Changes in the Mature Nucleus Pulposus Changes in the structure of the nucleus pulposus are a distinctive feature of disc degeneration. At birth, the nucleus pulposus is mostly composed of cells that are morphologically similar to the embryonic notochord and these cells have been referred notochordal cells are large (25 85 m in diameter) and are highly vacuolated ( Hunter et al., 2003a ; Hunter et a l., 2003b ) The vacuoles appear to contain glycoaminoglycans to control osmotic swelling pressure ( Adams et al., 1990 ) With increased age, these notochordal cells decrease in number and the population of chondrocyte like cells increases in a mature nucleus pulposus. These cells are called their similar morphology to cartilage chondrocytes. Chondrocyte like cells are smaller (~ 10 m in diameter) than notochordal cells and lack intercellular vacuoles ( Hunter et al., 2003a ; Hunter et al., 2003b ) In a number of species, notochordal cells have been observed to gradually disappear during adult life, and depletion of this cell population correlates tem porally with the onset of disc degeneration ( Maldonado and Oegema, 1992 ; Stevens et al., 2000 ; Hunter et al., 2003a ) Some studies suggested that notochordal cells in needle punctured mouse models sequentially transformed into chondrocyte like cells ( Yang et al., 2009a ) In addition, co culture studies of notochordal cells and chondrocyte like

PAGE 19

19 cells demonstrated that notochordal cells interact with chondrocyte like cells and stimulate proteoglycan production ( Aguiar et al., 1999 ) These data suggest that notochordal cells are progenitor cells of mature nucleus pulposus cells and may stimulate other cells in the nucleus pulp osus to maintain structure, integrity, and homeostasis of the disc.

PAGE 20

20 CHAPTER 2 LIMB DEVELOPMENT The Role of Sonic H edgehog (Shh) in Limb Development During early limb development, a number of molecular pathways establish the three axes of the limb. The secreted protein SHH plays an important role in limb pattering. Shh is expressed in a small domain of the posterior limb bud called the Zone of Polarizing Activity (ZPA). SHH protein is secreted from cells located in the ZPA and genera tes a posterior to anterior concentration gradient ( Riddle et al., 1993 ) Cells exposed to a high concentration of SHH for long periods of time generate more posterior like digits, while cells exposed to lower concentrations of SHH for shorter amounts of time generate more anterior like digits ( Yang et al., 1997 ; Harfe et al., 2004 ) In Shh null mice, no digits were formed in the forelimb and only digit 1 was formed in the hindlimb. These data demonstrate that digit 1 formation in the hindlimb is independent of Shh signaling ( Chiang et al., 2001 ) Shh is important during early digit patterning; however, Shh is no longer expressed after digit condensation begins ( Marti et al., 1995 ) Hence, it has been proposed Shh activates secondary signals that are responsible for patterning the forming digits. One candidate for the secondary signal functioning downstream of Shh are the Bmp protein family. The Role of Bone Morphogenetic Protein (Bmp) in the Limb Bmp2 is expressed in the posterior domain of the limb when Shh is expressed. Ectopic Shh expression in the anterior of the limb bud can induce anterior Bmp2 expression. These data suggest that Bmp2 is downstream of Shh signaling ( Yang et al., 1997 ) However, the function of Bmp2 in digit pattering cannot be studied using the null allele since Bmp2 null mice die before digits form ( Zhang and Bradley, 1996 )

PAGE 21

21 Another member of the Bmp family, Bmp7 has also been proposed to function downstream of Shh although Bmp7 expression does not overlap with Bmp2 in the early limb bud ( Yang et al., 1997 ) Mice that lack Bmp7 survive to birth and have partially penetrant preaxial polydactyly in the hindlimb. However, Bmp7 null mice did not contain a digit pattering defect ( Dudley and Robertson, 1997 ) It has been suggested that Bmp7 is not required for digit patterning or that other BMP protein expressed in the limb can compensate for the functio n of Bmp7 ( Dudley and Robertson, 1997 ) Bmp4 shares a high degree of homology with Bmp2 In the early limb bud, Bmp4 is expressed in both the anterior and poste rior mesoderm. The role Bmp4 plays in limb development cannot be investigated using a null allele since mice homozygous null for Bmp4 die before digit formation ( Winnier et al., 1995 ) A recent report demonstrated that mesodermally expressed Bmp2 and Bmp4 tog ether are required for completion of osteogenesis ( Bandyopadhyay et al., 2006 ) Bmp2 has been shown to play an essential role in the signaling cascade that is required for repairing bone fractures ( Tsuji et al., 2006 ) These data indicate that BMP proteins can compensate for each other but suggests that their funct ions do not overlapped completely. Bmp2, Bmp4, and Bmp7 in addition to being expressed in the limb mesoderm are also expressed in the AER in developing limbs. The functions of these proteins in this region of the limb are unclear but recent data have su ggested that BMPs expressed in the AER have different functions from mesodermally expressed Bmps ( Wang et al., 2004 ; Bandyopadhyay et al., 2006 ; Pajni Underwood et al., 2007 ; Maatouk et al., 2009 ) Examination of the role BMPs play in the AER h ave been done by misexpression of the Bmp antagonist, noggin, or by conditional removal of the Bmp receptor Bmpr1a

PAGE 22

22 Noggin overexpression in the AER resulted in syndactyly, postaxial polydactyly and ventralization of dorsal limb structures ( Wang et al., 2004 ) A recent report demonstrated that expression of Bmpr1a in the AER was required for AER induction and Fgf mediated cell survival ( Pajni Underwood et al., 2007 ) Shh Fgf Positive Fee dback Loop Vertebrate limb outgrowth is controlled by the Shh Fgf positive feedback loop ( Niswander et al., 1994 ) Shh expression in the ZPA upregulates Greml in expression in the adjacent mesenchyme which maintains Fgf4 expression in the AER. Gremlin is a Bmp antagonist that prevents Bmps from downregulating Fgf4 When Fgf4 and Gremlin expression decreases, Shh expression is downregulated and the rate of cell proliferation decreases ( Scherz et al., 2004 ) In the limb, cells that have one time expressed SHH, expand anteriorly (Harfe et al., 2004). Former Shh express ing cells cannot express Gremlin ( Scherz et al., 2004 ) As a result, the expansion of Shh descendants provides a barrier between Shh descendants and cells compet ent to express Gremlin The Shh Fgf feedback loop continues until SHH can no longer activate Gremlin The length of time this feedback loop is active in the limb may influence digit length ( Scherz et al., 2004 ) The Role of En1, Wnt7a, and Lmx1b in Limb Development During formation of the vertebrate limb, dorsoventral identity is controlled by signals emanating from the limb ectoderm. Engrailed 1 (En1) a homeod omain transcription factor, is expressed in the ventral ectoderm and ventral side of the AER ( Loomis et al., 1996 ) En1 represses Wnt7a expression in the ventral ectoderm, and restricts its expression to the dorsal ectoderm. WNT7A activates LIM homeodomain 1 ( lmx1 ) expression in the dorsal mesenchyme and Lmx1 specifies dorsal limb fates.

PAGE 23

23 Ectopic expression of Lmx1b induces the dorsalization of the limb ( Ri ddle et al., 1995 ; Vogel et al., 1995 ) Mice in which Wnt7a has been removed contain duplicated ventral structures in dorsal limb as a result of expression of En1 in the ventral structure ( Parr and McMahon, 1995 ) Lmx1b homozygote mutant mice showed dorsal to ventral transformation ( Chen et al., 1998 ) Bmps have been proposed to function upstream of En1 during dorsoventral patterning ( Soshnikova et al., 2003 ) Misexpression of the BMP antagonist Noggin resulted in lack of En1 expression in the ventral ectoderm ( Pizette et al., 2001 ) suggesting that, loss of Bmp signaling results in a dorsalized limb.

PAGE 24

24 CHAPTER 3 IDENTIFICATION OF NUCLEUS PULPOSUS PRECURSOR CELLS AND NOTOCHORDAL REMNANTS IN THE MOUSE: IMPLICATIONS FOR DISC DEGENERATION AND CHORDOMA FORMATION Introduction It has been estimated that two thirds of Americans will experience at least one episode of back pain in their lifetimes. The majority will recover within a month, however 4.5 million people a year will become disabled from back pain at a cost of $16 billion a year (health care costs and lost work time) ( Praemer, 1992 ; Pope, 1997 ) Both the severity and incidence of back pain increase as people age. The most common cause of back pain is degeneration of the intervertebral discs (reviewed in ( Hunter et al., 2003a ) ) This usually manifests itself in one of two ways; either through herniation of disc material into the vertebr al column or through the reduction of disc thickness. Reduction in the thickness of the discs results in the compression of the vertebral facets, which then exert pressure on the nerve roots, leading to back pain. In a normal vertebral column, the interv ertebral discs join adjacent vertebral bodies where they provide shock absorption and facilitate mobility of the spine ( Urban and McMullin, 1988 ; Hunter et al., 2003a ) Each disc has three major components; the nucleus pulposus, the gelatinous inner core of the intervertebral discs; the annulus fibrosus, a fibrous capsule that surrounds the nucleus pulposus and consists of concentric lamellae of collagen fibers; and the superior and inferior cartilaginous end plates, which are situated at the articular surfaces of the intervertebral disc and the adjacent vertebrae ( Humzah and Soames, 1988 ) It is the nucleus pulposus that is thought to be required for the generation and maintenance ( Setton and Chen, 2006 ) Da mage to or loss of the

PAGE 25

25 nucleus pulposus as a person ages often leads to disc disease and back pain ( Hunter et al., 2003a ) In humans, cells found in the adult nucleus pulposus are primarily small, chondrocyte like cells. In juvenile and adults, a second population of cells in the nucleus pulposus has been proposed t o function in disc renewal and homeostasis. These cells are much larger than the chondrocyte like cells and, although their cell lineage is unclear, classical histological studies described them as being of ( Walmsley, 1953 ) The coincident loss of the notochordal population of cells and the onset of disc degeneration during the life of many mammalian species suggests that this cell population may be involved in maintenance and/or repair of the disc ( Hunter et al., 2003a ) Over 60 years ago, the embryon ic nucleus pulposus was postulated to form from the embryonic notochord ( Walmsley, 1953 ) and studies in rat have supported this hypothesis ( Rufai et al., 1995 ) However, a number of more recent reports have suggested that the adult nucleus pulposus is only partially formed from the embryonic notoch ord or has a different origin entirely ( Kim et al., 2003 ; Vujovic et al., 2006 ) The ability to identify in vi vo the precursor cells of the nucleus pulposus would greatly aid in developing and characterizing mouse models of disc degeneration. rare type of tumor called a chordoma through an unknown mechanism ( Yamaguchi et al., 2004 ; Yamaguchi et al., 2005 ) It has been proposed that notoc hordal remnants are derived from the embryonic notochord since notochordal remnants are similar in size and shape to notochord cells and reside in the region of the embryo in which the

PAGE 26

26 embryonic notochord was present ( Yamaguchi et al., 2004 ; Yamaguchi et al., 2005 ) In mice, notochordal remnants have not been described, which has made it very difficult to create a mouse model for chordoma. Despite the clinical importance of nucleus pulposus cells, their embryonic origin has never been demonstrated by cell lineage analysis. In order to investigate whether the embryonic notochord gives rise to the entire nuc leus pulposus, we genetically marked these cells during early mouse embryogenesis and followed their lineage into adulthood. In order to generate this fate map, we took advantage of the Shhcre and ShhcreERT 2 mouse alleles we created previously ( Harfe et al., 2004 ) In mice containing the Shhcre or ShhcreERT 2 alleles, CRE is expressed in the notochord and activates expression of CRE inducible reporter alleles in thi s tissue. Using these alleles we obtained direct evidence that, in the mouse model system, the embryonic notochord directly gives rise to all cell types present in the nucleus pulposus of the intervertebral discs. A small number of notochord cells were a lso found to reside in the vertebrae between the intervertebral discs. These cells are the elusive mouse notochordal remnants. Results Shh expressing Cells in the Mouse Embryo F orm the Nucleus Pulposus of the Intervertebral Discs. To determine if the nucle us pulposus was derived from Shh expressing cells we took advantage of the Shhcre allele we had created previously ( Harfe et al., 2004 ) to fate map Shh expressing c ells, including those that reside in the notochord. The Shhcre allele was created by knocking into the Sonic hedgehog ( Shh ) gene the site specific recombinase gene cre Using this allele, CRE protein was expressed

PAGE 27

27 everywhere that Shh was normally express ed, including the embryonic notochord ( Harfe et al., 2004 ) Mice containing the Shhcre allele were crossed to the CRE reporter lines R26R or R26R:EYFP ( Soriano, 1999 ; Srinivas et al., 2001 ) In mice containing both the Shhcre and a reporter allele, CRE recombinase dr iven from the Shh promoter instigated activation of the reporter allele. Importantly, once reporter expression was activated, it continued to be expressed in cells in which the recombination event occurred, in this case all Shh expressing cells including the notochord, and in all descendants of these cells throughout the life of the animal (Fig. 3 1). In embryos that contained the Shhcre allele and either the LacZ (R26R allele) or EYFP reporter alleles, we observed reporter gene expression in the notochor d at embryonic day (E) 10.5 ( Harfe et al., 2004 ; Choi and Harfe, 2011 ) At E12.5, the notochord had begun to seg regate along the anteroposterior axis, and bulges of labeled cells were observed at the positions where the intervertebral discs will form (Fig. 3 1A). By E15.5, cells of the notochord had aggregated in areas where the nucleus pulposi were forming, and th e vertebral bodies were mostly devoid of Shhcre descendant cells (Fig. 3 1B). Interestingly, at E15.5 we observed small streams of labeled cells in the developing vertebral bodies (Fig. 3 1B). The majority of these cells were not present one day later (F ig. 3 1C). However, a small number of these cells remained between nucleus pulposi and could be visualized using the R26R reporter, which is more sensitive than the ROSA:EYFP reporter (see Fig. 3 3C). These data suggest that some notochordal cells do not end up residing in the nucleus pulposi but instead remain between the intervertebral discs.

PAGE 28

28 By E16.5, cells that expressed Shhcre had formed disc shaped condensations between the vertebrae (Fig. 3 1C). Expression of the reporter in Shhcre cells was observ ed as intense staining throughout the entire nucleus pulposus in newborns (Fig. 3 1D and Fig. 3 2A). By contrast, the annulus fibrosis, which surrounds the nucleus pulposus in the intervertebral discs, was found to be composed almost entirely of cells tha t had never expressed Shh (Fig. 3 2A). The Tamoxifen Inducible Allele ShhcreERT 2 Identifies the Embryonic Notochord as the Source of Nucleus Pulposus Cells. Since Shh is expressed in both the notochord and the nucleus pulposus until birth ( DiPaola et al., 2005 ) the Shhcre allele has the potential to activate reporter genes at early stages in the notochord, and at later stages in nucleus pulposus cells, irre spective of their embryonic origin. Thus, using the Shhcre allele, we could not exclude the possibility that notochord cells marked in E11.5 embryos may be eliminated by cell death, and that CRE is then re expressed in the fully formed nucleus pulposus. To test directly whether the notochord gives rise to all cell types in the nucleus pulposus, we used a temporally controlled Cre the tamoxifen inducible ShhcreERT 2 allele ( Harfe et al., 2004 ) to pulse label cells residing in the notochord but not the Shh expressing cells found during later development in the nucleus pulposus. The ShhcreERT 2 allele is identical to the Shhcre allele used in our initial fate map stud ies, except that CRE protein can be activated at discrete stages of embryonic development by injecting pregnant mothers with a single does of tamoxifen. Pregnant mothers carrying E8.0 pups were injected intraperitoneally with tamoxifen and the pups were e xamined at E13.5 to determine the fate of the notochord. At E13.5 all cells of the nucleus pulposus

PAGE 29

29 were labeled (Fig. 3 2B and data not shown), indicating that the entire nucleus pulposus is descended from the notochord. To verify that the injected tamo xifen was cleared from the embryo by E13.5, which is after notochord formation but prior to the formation of intervertebral discs, we analyzed reporter expression in external genitalia, in which the preputial glands are known to activate Shh at E13.5 ( Perriton et al., 2002 ; Seifert et al., 2008 ) Tamoxifen injections at E8.0 did not label the preputial glands, indicating that the tamoxifen was cleared from the mouse prior to E13.5, which is consistent with published reports that Cre activity is undetectable ~48 hours after tamoxifen injection ( Hayashi and McMahon, 2002 ) (Fig. 3 2C, D) These findings exclude the possibility that reporter gene expression is re activated in intervertebral discs after E13.5. The Adult Nuclei Pulposi is Composed Entirely of Shh Descendant Cells. To determine if the adult nucleus pulposus was composed entirely of cells that had at one time expressed Shh we examined adult discs from animals containing the Shhcre and R26R LacZ reporter alleles. In these > 19 month old animals, all cells of th e nucleus pulposus appeared to be labeled, suggesting that this tissue is derived entirely from cells that have expressed Shh (Fig. 3 3A, B). The nucleus pulposus appeared to be a homogeneous population of Shhcre descendant cells (i.e., non labeled cells c ould not be detected). Conversely, the annulus fibrosus, cartilaginous end plates and the adjacent vertebrae were largely devoid of Shhcre descendant cells (see below for exception to this finding). Taken together with the finding that the majority of c ells residing in the vertebral column and annulus fibrosus have never expressed Shh (they do not activate the cre inducible R26R reporter construct nor has Shh expression ever been reported in

PAGE 30

30 these tissues ( DiPaola et al., 2005 ) and our unpublished data), these results suggest that that cells originating in the vertebral column and/or the annulus fibrosus most likely do not contribute to the mouse nucleus pul posus. Notochord Cells That Do Not End U p Residing in the Nucleus Pulposus Form Notochordal Remnants in the Vertebral Column. Although the majority of notochord cells ended up within the nucleus pulposus, a small number of cells were found to reside in th e vertebral column, either in the vertebrae or, very rarely, in the annulus fibrosus (Fig. 3 2A and Fig. 3 3C). The location have been postulated to be present in humans but have never before been observed in mice. Notochordal remnants were found in all animals examined (n=12). These cells were first observed during embryonic nucleus pulposus formation and persisted throughout life, suggesting that notochordal remnants o bserved in adults arise during formation of the intervertebral discs. At all stages, notochordal remnants resided along the middle of each vertebra and were enriched on the ventral surface. Notochordal remnants were found along the entire length of the v ertebral column. Discussion At least two distinct cell types have been demonstrated to reside in the nucleus pulposus in humans; chondrocyte like cells and larger cells that have been referred to rger than chondrocyte like cells, notochordal cells have been reported to contain large vacuoles and express a number of proteins that are not found in chondrocyte cells ( Maldonado and Oegema, 1992 ) In a number of species, notochordal cells have been observed to gradually disappear during adult life, and depletion of this cell population correlates temporally with the onset

PAGE 31

31 of disc degeneration ( Maldonado and Oegema, 1992 ; Stevens et al., 2000 ; Hunter et al., 2003a ) These data have led to the proposal tha t notochordal cells may serve as nucleus pulposus stem cells. The developmental origin of the two cell types found in the nucleus pulposus is currently unclear. For example, it has been proposed that both notochordal and chondrocyte like cells are derive d from the notochord ( Walmsley, 1953 ; Hunter et al., 2003a ) that only notochordal cells come from the notoc hord ( Kim et al., 2003 ) or that neither of these cells types are noto chord derived ( Vujovic et al., 2006 ) The above conclusions were derived primarily from histological examinations of intervertebral discs. In the experiments reported here, we used novel mouse alleles to fate map the embryonic notochord. Our experiments provide the first direct evidence that the notochord is the sole source of cells that form the entire nucleus pulposus of the mouse intervertebral discs. In mice, it is unclear what the ratio of notochordal and chondrocyte like cells is in the mature nucleus pulposus. An electron microscopic study suggested that in four month old mice, the nucleus pulposus was composed of at least some notochordal cells ( Higuchi et al., 1982 ) Based on the presence of numerous matrix proteins in the adult nucleus pulposus, chondrocyte like cells are also likely present. Our finding that all cells examined in the adult nucleus pulp osus are derived from Shh expressing cells indicates that presumptive chondrocyte like cells of the nucleus pulposus are derived from Shh expressing notochord cells and, in contrast to previous suggestions, not from cells located in the surrounding Shh neg ative mesenchyme ( Kim et al., 2003 ) It is important to note that we cannot rule out the possibility that in organisms other then the

PAGE 32

32 mouse, the nucleus pulposus may be derived, at least in part from non Shh expressing tissues. In our experiments we used both the CRE inducible LacZ and EYFP reporters to mark the notochord and cells derived from this tissue. A number of mouse lines have been reported to undergo disc degeneration and/or premature aging ( Kuro o et al., 1997 ; Alini et al., 2008 ; Pignolo et al., 2008 ) However, the molecular defects g the Shhcre and ShhcrERT 2 alleles described in this report it is now possible to conclusively determine the fate and function of the notochord, and during later development the nucleus pulposus, during disc degeneration in these mouse lines. In addition t o using the reagents described in this report to characterize disc degeneration in vivo, the ability to label notochord and intervertebral disc cells at any stage of mouse develop will allow for the purification of these cells (for example using fluorescen ce activated cell sorting). Purified cells could then be cultured in vitro and reintroduced into degenerating discs or used in microarray experiments to identify novel genes expressed at different stages of nucleus pulposus formation. In humans, intraoss eous benign notochordal cell tumors have been identified in 20% of a random sample of 100 vertebral columns examined during autopsy. These benign tumors have been proposed to form from the embryonic notochord ( Yamaguchi et al., 2004 ) In this study, notochordal cell tumors were identified through microscopic examination and the smallest tumors identified w ere 1mm 2 The high incidence of notochordal cell tumors identified without the use of molecular markers suggests that the occurrence of these types of tumors in humans may be even higher. Our finding that

PAGE 33

33 notochordal remnants were present throughout the v ertebral column in all samples analyzed supports this hypothesis. In humans, intraosseous benign notochordal cell tumors formed form notochordal remnants are postulated to very rarely transform into malignant tumors called chordomas ( Mendenhall et al., 2005 ) In humans, it is rare for this type of tumor to occur in patients <40 years old ( Enomoto et al., 1986 ) Interestingly, chordomas have been reported to occur at a much lower rate then intraosseous benign notochordal cell tumors have been observed ( McMaster et al., 2001 ; Yamaguchi et al., 2004 ) The low occurrence of chordomas suggests that notochordal remnants lie dormant in most cases but may become malignant when stimulated, although the signals that initiate chordoma form ation are unknown. Interestingly, the most prevalent DNA alteration in human chordomas has been reported to be an amplification of 7q36, which occurs in 69% of these types of tumors ( Scheil et al., 2001 ) A similar chromosomal region has been proposed to contain a dominant oncogene in a family with familial chordomas ( Kell ey et al., 2001 ) In light of our findings that the Shh expressing notochord forms notochordal remnants and all cell types in the mature nucleus pulposus, it is interesting that the region of chromosome 7 implicated in chordoma formation contains the ge ne Shh ( Marigo et al., 1995 ) Since the occurrence of notochordal remnants in humans is much higher than the reported incidence of chordomas, a second event, possibly a mutation or environmental insult during later life, must occur to cause notochordal cells to form tumors. Mutations resulting in constitutive activation of the Shh signaling pathway have been shown to result in the formation of numerous types of cancers in humans ( McMahon et al., 2003 )

PAGE 34

34 and in mice, artificial overexpression of SHH in skin using a transgenic allele resulted in the development of a basal cell car cinoma like tumor ( Fan et al., 1997 ) An enhancer element responsible for notochord expression has been identified in mice ( Jeong and Epstein, 2003 ) If a similar enhancer element exists in humans, very rare activating mutations in this enhancer may result in overexpression (or sustained) expression of SHH in notochordal remna nts in older patients. These findings raise the possibility that ectopic expression of SHH in notochordal remnants may cause chordomas by inducing these cells to behave like nucleus pulposus stem cells. In addition, Brachyury ( Vujovic et al., 2006 ; Yang et al., 2009b ) Tsc1/2 ( Lee Jones et al., 2004 ) and p16/CDKN2A ( Hallor et al., 2008 ) have been indirectly implicated in chordoma formation. The identification of mouse noto chordal remnants raises the possibility of creating a mouse model of chordoma by altering expression of these genes in mouse notochordal remnants. Materials and Methods Strain Construction and Genotyping The creation and genotyping of Shhcre ShhcreERT 2 R 26R and R26R:EYFP alleles have been described previously ( Soriano, 1999 ; Srinivas et al., 2001 ; Harfe et al., 2004 ) Shhcre or ShhcreERT 2 mice were mated to mice containing reporter alleles to create double heterozygous male animals. These animals were either mated to wild type females or analyzed directly. Animals were handled in accordance with the University of Florida Institutional Animal Care and Use Committee. Detection of Report Activity A single injection of tamoxifen (6mg/40g body weight) was intraperitoneal (IP) injected into pregnant dams. This do se has been shown to produce complete

PAGE 35

35 recombination of floxed genes ( Hayashi and McMahon, 2002 ) LacZ staining was performed as described previously. EYFP was de tected using a Lecia MZ16 microscope and DFC300FX camera.

PAGE 36

36 Figure 3 1. Fate mapping Shh expressing cells in the axial skeleton using the Shhcre allele. The Shhcre allele was used to constitutively activate R26R :: EYFP in the notochord. EYFP is observed as green. (A D) Merged fluorescent and bright field images of the vertebral column. In all samples, a ventral view of the spinal column is shown. Embryos were harvested and all gut tissue was dissected away to visualize the underlying vertebral column. All images are locations where the nucleus pulposus of the intervertebral disc will form (the arrows denote the notochord). (B) By E15.5, clearly demarcated nucle i pulposi have formed from Shhcre expressing cells. Part of the notochord is still observed between the discs (arrow). (C, D) Cells that have expressed Shhcre are restricted to the nucleus pulposus and are mostly excluded from the vertebrae (v) at E16.5 (C) and at P0 (D). See Figure 3 2A and Figure 3 3B for exceptions. NP, nucleus pulposus; V, vertebral body. Reprinted with permission from Identification of nucleus pulposus precursor cells and notochordal remnants in the mouse: implications for disk degen eration and chordoma formation Choi KS, Cohn MJ, Harfe BD; Copyright 2008 Dev Dyn.

PAGE 37

37 Figure 3 2. Fate map of Shh expressing cells using the Shhcre and the tamoxifen inducible ShhcreERT 2 alleles. (A) 10 m transverse frozen section of the intervertebra l disc of a Shhcre ; R26R newborn mouse. Tissue was stained for the presence of galactosidase (blue). Note the entire nucleus pulposus is annulus fibrosus (AF). (B D) Distributi on of Shh descendant cells in ShhcreERT 2 ;R26R mice pulse labeled with tamoxifen at E8.0. Progeny were stained for galactosidase at E13.5. B, At E13.5 the nuclei pulposi of the intervertebral discs are forming. Ventral whole mount view is shown. All g ut tissue has been dissected away so that the vertebral column is visible. The inset in (B) shows three intervertebral discs (ventral view). Note that some cells of the notochord (arrows) are still present between the forming discs. (C, D) Whole mount i mages of genital tubercles at E13.5. At this stage of development, male and female external genitalia are indistinguishable. The preputial glands (asterisks) are labeled in embryos constitutively expressing CRE in all Shh producing cells (C). The absence of galactosidase in preputial glands of ShhcreERT 2 ; R26R embryos exposed to tamoxifen at E8.0 (D) indicates that the tamoxifen has been cleared from these embryos prior to E13.5, when Shh expression is initiated in these glands ( Perriton et al., 2002 ) The line of staining down the middle of the external genitalia in C and D is the urethra, which expresses Shh beginning at E9.75 ( Perriton et al., 2002 ) Reprinted with permission from Identification of nucleus pulp osus precursor cells and notochordal remnants in the mouse: implications for disk degeneration and chordoma formation Choi KS, Cohn MJ, Harfe BD; Copyright 2008 Dev Dyn.

PAGE 38

38 Figure 3 3. The nucleus pulposus and notochordal remnants in adult mice a re composed of cells that have expressed Shh (A) In a 19 month old Shhcre ; R26R mouse, the nucleus pulposus is labeled and the annulus fibrosus is negative. 10 m transverse paraffin section of an intervertebral disc stained for LacZ is shown. Cells wer e counterstained with nuclear fast red, which clearly marked the nuclei of cells. (B) 40X magnification of the cells of the nucleus pulposus were stained blue indicating that the nucleus pulposus is composed of cells that have expressed Shh (C) Notochordal remnants were found in adult vertebrae between each intervertebral disc in the Shhgfpcre ; R26R mouse. Inset in (C) shows notochord remnants. Ventral view of the vertebral column is shown. Adult animals were stained in whole mount for LacZ and then dissected. Whole mount picture is shown. V, vertebrae between the discs; NP, nucleus pulposus; AF, annulus fibrosus. Reprinted with permission from Identification of nucleus pulpo sus precursor cells and notochordal remnants in the mouse: implications for disk degeneration and chordoma formation Choi KS, Cohn MJ, Harfe BD; Copyright 2008 Dev Dyn.

PAGE 39

39 CHAPTER 4 HEDGEHOG SIGNALING IS REQUIRED FOR FORMATION OF THE NOTOCHORD SHEATH AND PA TTERNING OF NUCLEI PULPOSI WITHIN THE INTERVERTEBRAL DISCS Introduction Low back pain will affect most people over the age of 65 in industrialized countries. In the U.S., treatment of low back pain is estimated to cost 50 100 billion dollars per year (rev iewed in ( Katz, 2006 ) ). For the majority of people, bed rest will relieve most symptoms of back pain but in a small population of patients the condition will becom e chronic. Most back pain is thought to originate from degeneration of the intervertebral discs or through physical damage to the disc. This leads either to herniation of the middle part of the disc called the nucleus pulposus and/or tears, bulging, and rupture of the annulus fibrosus, which surrounds the nucleus pulposus (reviewed in ( Hunter et al., 2003a ) ). The intervertebral discs connect two adjacent vertebrae and provide structural stability and flexibility to the spinal column. The nuclei pulposi, which originate from the embryonic notochord ( Walmsley, 1953 ; Choi et al., 2008 ) are composed primarily of proteoglycan, water and collagen type II and are located in the mi ddle of each intervertebral disc (reviewed in ( Adams and Roughley, 2006 ) ). As the discs age or are damaged, the nucleus pulposus is dramatically altered. Proteoglycan and water content de creases in the nucleus pulposus and collagen type II is replaced by type I collagen so that nuclei pulposi become fibrous and contain less water. During mid embryogenesis in both mice and humans the notochord, a transient rod like structure that is located along the midline of embryos, becomes segmented and forms the intervertebral discs ( Walmsley, 1953 ; Choi et al ., 2008 ) In E12.5 to E15.5

PAGE 40

40 mouse embryos, notochord cells are removed from regions of the embryo containing the vertebral bodies and are relocated to the intervertebral mesenchyme through an unknown mechanism. Interestingly, mouse mutants that formed aberrant cartilage around the vertebral column but a normal notochord and notochord sheath failed to remove notochord cells from the vertebral bodies resulting in malformed intervertebral discs ( Wallin et al., 1994 ; Aszodi et al., 1998 ; Lettice et al., 1999 ; Peter s et al., 1999 ) These data support the hypothesis that a mechanical force driven by the forming vertebral bodies is responsible for pushing notochord cells into the intervertebral discs ( Theiler, 1988 ; Rufai et al., 1995 ; Aszodi et al., 1998 ; Smits and Lefebvre 2003 ) In numerous tissues, hedgehog signaling has been implicated in regulating pattern formation and cell proliferation and/or cell survival ( Jensen and Wallac e, 1997 ; Duprez et al., 1998 ; Britto et al., 2002 ) Previous studies have shown that Sonic Hedgehog ( Shh ) is expressed in nuclei pulposi in both pren atal and postnatal intervertebral discs ( DiPaola et al., 2005 ; Dahia et al., 2009 ) In addition, Indian Hedgeh og ( Ihh ) is expressed in condensing chondrocytes of the embryonic vertebral bodies and in the vertebral endplate during later development ( DiPaola et al., 2005 ) Both Shh and Ihh produce secreted proteins that bind the transmembrane protein PATCHED1 (PTCH1) resulting in activation of the hedgehog signaling pathway (reviewed in ( Ingham and McMahon, 2001 ) ). In mice containing a null allele of Shh the notochord formed but was quickly lost ( Chiang et al., 1996 ) Since the notochord was quickly lost in Shh null animals the role of hedgehog signaling m ay play in transforming the notochord into nuclei pulposi remains unknown. Ihh is not expressed in nuclei pulposi ( DiPaola et al., 2005 ) however, condition al removal of Ihh in chondrocytes of postnatal mice has been

PAGE 41

41 shown to result in loss of the annulus fibrosus and enlargement of the nucleus pulposus. These data suggest that Ihh may be required within growth plates for intervertebral disc homeostasis ( Maeda et al., 2007 ) To directly examine the role hedgehog signaling plays in the formation of nuclei pulposi we conditionally removed Smoothened ( Smo ), which is requi red for all hedgehog signaling, in all Shh expressing cells. In the vertebral column, Smo was removed from the mouse notochord and floor plate. Removal of Smo from the vertebral column, coupled with detailed fate mapping and molecular analysis in this mu tant background, allowed us to determine the role the hedgehog signaling pathway plays in transforming the notochord into nuclei pulposi. Results Removal of Hedgehog Signaling from the Mouse Notochord Mouse embryos in which hedgehog signaling was removed f rom all cells die prior to formation of the intervertebral discs ( Zhang et al., 2001 ) Previously, we had shown that the notochord forms the entire nucleus pulpos us of each disc in the mouse vertebral column ( Choi et al., 2008 ) To determine the role of hedgehog signaling during formation of nuclei pulposi, hedgehog signaling was removed from all Shh expressing cells including notochord and floor plate in the v ertebral column using a floxed mouse allele of Smo and the Shhgfpcre allele (Fig. 4 1A D) ( Long et al., 2001 ; Harfe et al., 2004 ) Removal of Hedgehog Signaling from Shh expressing Cells Results in Loss of Caudal Skeletal Elements To confirm that hedgehog signaling was removed from the notochord and floor plate in embryos homozygous for the floxed Smo allele and tha t contained the

PAGE 42

42 Shhgfpcre allele ( Smo f / f ; Shhgfpcre ), expression of Ptch1 was analyzed using Ptch1 lacZ mice ( Goodrich et al., 1997 ) PTCH1 is the receptor for SHH as well as a downstream target of hedgehog signaling. Using the Ptch1 lacZ allele we found that LacZ expression was absent in the caudal notochord and decreased in the neural tube in E9.5 Smo f / f ; Shhgfpcre embryos (Fig. 4 1D). In mutant embryos in wh ich hedgehog signaling was removed from Shh expressing cells, severe defects in the caudal axial skeleton were observed. Beginning at E12.5, mutant embryos were observed to contain a truncated and thinner tail (Fig. 4 2B), which became more pronounced dur ing postnatal development (Fig. 4 2D). In these mutant animals, skeleton analysis confirmed that no vertebrae formed caudal to the lumbar vertebra (Fig. 4 2F) and that numbers of axial cervical (C7) and thoracic (T13) vertebrae were not changed (n=3). To determine if loss of caudal skeleton elements in mutant embryos resulted from an increase in cell death, a lysotracker assay was performed on E11.5 embryos. An increase in cell death was detected in the caudal mutant somite and notochord in these embryos compared to normal controls (Fig. 4 2G J). Since the notochord plays an important role in patterning the developing somites, which produce skeletal elements during later development ( Fan and Tessier Lavigne, 1994 ; Johnson et al., 1994 ) we examined somitic expression of Pax1 and Pax3 Consistent with the loss of caudal skeletal elements Pax1 expression was diminishe d in tissue caudal to the hindlimbs (Fig. 4 3J). In contrast to the caudal region of the embryo, no increase in cell death was observed rostral to the hindlimb (see Fig. 4 6). Consistent with this observation, no apparent change in the expression pattern of Pax1 and Pax3 was observed in the rostral somites (Fig. 4 3A H).

PAGE 43

43 Loss of Caudal Structures upon Removal of Hedgehog Signaling Using the Shhgfpcre Allele In all experiments in which Smo was removed using the Shhgfpcre allele, we observed a progressive ro stral to caudal increase in severity of defects along the vertebral column. Caudal to the hindlimb, a drastic loss of skeletal elements was observed along with a decrease of Pax1 Previous work has suggested that the notochord is required to maintain Pax1 expression in the developing somites and that loss of the notochord results in the dorsalization of the somites ( Dietrich et al., 1993 ) It is unclear why in our experiments all skeletal elements caudal to the hindlimbs are lost in mutant embryos. One possibility is that a bu rst of hedgehog activity, prior to inactivation of this pathway, occurred during very early development and was sufficient for formation of more rostral structures. For our analysis of the role hedgehog signaling plays in the formation of nuclei pulposi, regions of the embryo were examined in which Pax1 and Pax3 expression and skeletal elements were normal. Removal of Hedgehog Signaling from Shh expressing Cells Did N ot Affect Pax1 or Pax3 Expression in Rostral Somites The notochord plays an important role in patterning the developing somites ( Fan and Tessier Lavigne, 1994 ; Johnson et al., 1994 ) To determine if def ects in intervertebral disc development resulted from improper patterning of the somites, Pax1 and Pax3 expression was examined. Pax1 and Pax3 are expressed in presomitic mesoderm and become progressively restricted to sclerotome and dermomyotome, respecti vely, during somite development ( Deutsch et al., 1988 ; Goulding et al., 1991 ) Pax1 and Pax3 RNA in situ hy bridization were performed on control and mutant E10.5 and E11.5 embryos. No apparent change in the expression pattern of Pax1 and Pax3 was observed in the rostral somites of E10.5 and E11.5 mutant embryos (Fig. 4

PAGE 44

44 3A H). This was the same region of the e mbryo in which defects in nuclei pulposi formation were found upon removal of hedgehog signaling from the notochord (see Figs. 4 1 and 4 6). Interestingly, in E11.5 embryos Pax1 expression was diminished in tissue caudal to the hindlimbs (Fig. 4 3J). Thi s is the same region of the embryo that fails to form skeletal elements. In contrast, Pax3 expression was not altered in the caudal somites of E11.5 mutant embryo upon removal of hedgehog signaling from the notochord (Fig. 4 3L). Hedgehog Signaling is Req uired for Formation of Intervertebral Discs and Normal Cell Proliferation in the Notochord Intervertebral discs are located between each vertebra in wild type mice. To determine the role hedgehog signaling played in formation of the intervertebral discs, n ewborn control and mutant vertebral columns were analyzed. Sections through mutant vertebral columns revealed that nuclei pulposi were smaller compared to control littermates (Fig. 4 4A D). Mutant intervertebral discs contained an annulus fibrosus but th is tissue appeared to have lost concentric lamellae within the annulus fibrosus, possibly as a result of the improper formation of nuclei pulposi in the center of the discs (Fig. 4 4E, F). In a number of organs hedgehog signaling is required for cell proli feration and/or cell survival ( Jensen and Wallace, 1997 ; Duprez et al., 1998 ; Britto et al., 2002 ) In these tissues, removal of hedgehog signaling often resulted in a decrease in cell proliferation and an increase in cell death. To determine whether removal of hedgehog signaling from the notochord resulted in a defect in cell proliferation, BrdU was administrated to pregnant dams three hours prior to harvest. BrdU assays were performed on the rostral regions of E11.5 wild type and mutant embryos. Using this

PAGE 45

45 assay, notochord cells in E11.5 embryos were found to proliferate at a lower rate than controls (Fig. 4 5). These data suggest that the observed smaller nuclei pulposi located in the rostral vertebral column in mutant mice may partially result from a decrease in the rate of cell proliferation of notochord c ells upon removal of hedgehog signaling. Rem oval of Hedgehog Signaling Did N ot Increase Cell Death in the Notochord To determine if removal of hedgehog signaling from the notochord caused these cells to undergo cell death, TUNEL assays were performed on E 12.5 14.5 mutant and wild type vertebral columns. At these stages of development, nuclei pulposi are forming from the notochord ( Choi et al., 2008 ) In the notochord and forming discs of E12.5 14.5 wild type and mutant mice, aberrant cell death was no t detected (Fig. 4 6). No ectopic cell death occurred in regions of mutant embryos that contained smaller nuclei pulposi indicating that cell death was not responsible for the formation of smaller nuclei pulposi upon removal of hedgehog signaling from the notochord. Removal of Hedgehog Signaling Resulted in Aberrant Migration of Notochord Cells during Intervertebral Disc Formation The mouse nucleus pulposus and annulus fibrosus are formed in highly condensed regions of intervertebral mesenchyme along the v entral midline of the embryo beginning at E12.5 ( Smits and Lefebvre, 2003 ) Over the next 3 days the notochord forms the nuclei pulposi of the intervertebral disc s. Notochord cells are normally excluded from regions of the vertebral column where vertebrae form. To determine if the aberrant nuclei pulposi found in mutant animals were due to defects in the transition of notochord cells into nuclei pulposi, the notoc hord in mutant animals was fate mapped using the ROSA26 reporter allele ( Soriano, 1999 ) In these animals, all

PAGE 46

46 cells arising from the notochord were marked allowing for a detailed analysis of the fate of notochord cells throughout development. At E12.5 a sligh tly thinner notochord was observed in mutant animals compared to controls (Fig. 4 7B), consistent with the observation that there is a decrease in cell proliferation in this tissue (see Fig. 4 5). In control E13.5 embryos, the notochord formed bulges betw een each vertebra where the future discs would form. In mutant embryos, this did not occur. Notochord cells continued to reside as a rod along the midline of the embryo. A small number of notochord cells were also found within the vertebral bodies (Fig. 4 7D). By E14.5 nuclei pulposi had formed from the notochord in control embryos with very few notochord cells still residing in vertebral bodies. However, in mutants few notochord cells were found to reside in the forming disc with most cells scattered throughout the vertebral column (Fig. 4 7F). In postnatal control animals, the nucleus pulposus was located inside the annulus fibrosus throughout the vertebral column. In contrast, mutant animals contained small nuclei pulposi with the majority of notoc hord cells dispersed throughout the vertebral column (Fig. 4 7H, J, L). T (Brachyury) is N ot Expressed in Notochord Cells That Reside O utside Nuclei Pulposi To examine the cellular fate of mutant notochord cells we performed immunohistochemistry using an anti T (Brachyury) antibody. In postnatal control embryos, notochord cells produced nuclei pulposi that expressed T (Brachyury) (Fig. 4 8C). Interestingly, while mutant notochord cells that resided within the discs did express T (Brachyury), cells outsid e the disc did not (Fig. 4 8D). These data suggest that mutant notochord cells that do not reside within a disc potentially lose nuclei pulposi/notochord like characteristics.

PAGE 47

4 7 Hedgehog Signaling is Required for Notochord Sheath Formation The notochord she ath is composed of extracellular matrix proteins which surround the notochord in E10.0 embryos ( Paavola et al., 1980 ) To determine if hedgehog signaling was required for notochord sheath formation, sections of E11.5 vertebral columns were stained with alcian blue to visualize the extracellular matrix composition surrounding the notochord. In control embryos the notochord sheath formed around the notochord in a rostral to caudal progression (Fig. 4 9A, C). Sheath formation occurred pr ior to cartilage condensation within the vertebral bodies. In mutant embryos a thin notochord sheath was observed in the rostral region of E11.5 embryos (Fig. 4 9B), however, no alcian blue staining was observed in the caudal region of mutant embryos (Fig 4 9D). In addition, the caudal notochord of mutants was abnormally flatted (Fig. 4 9D, H, N). Laminin, a inner component of the notochord sheath, was found to surround the caudal notochord in both wild type and mutant embryos indicating that at least s ome components of the sheath are still present in the absence of hedgehog signaling within the caudal notochord (Fig. 4 9E H). To determine if the ultrastructure of the notochord sheath was affected by the removal of hedgehog signaling, transmission electr on micrograph was performed on transverse section of E11.5 embryos. In wild type embryos, the notochord sheath consisted of a basal lamina layer and loosely organized collagen fibrils (Fig. 4 9I, K, M, O). In the rostral region of mutants, the notochord sheath consisted of basal lamina and a thin layer of collagen fibrils (Fig. 4 9J, L). In the caudal region of mutant embryos no electron dense material was observed (Fig. 4 9N, P).

PAGE 48

48 Removal of Hedgehog Signaling after For mation of the Notochord Sheath Doe s N ot Affect Nuclei Pulposi Patterning or Growth Removal of hedgehog signaling prior to sheath formation resulted in a deformed sheath and aberrant formation of nuclei pulposi. These data suggested that proper formation of a notochord sheath was essential for normal patterning of nuclei pulposi along the vertebral column. However, it was possible that nuclei pulposi were not patterned correctly due to loss of hedgehog signaling and not due to the absence of a notochord sheath. To test this hypothesis, he dgehog signaling was removed after sheath formation using the tamoxifen inducible Cre allele ShhcreERT 2 and the floxed Shh allele ( Dassule et al., 2000 ; Harfe et al., 2004 ) Tamoxifen was administered at E8.5 (before sheath formation), E9.5 (during sheath formation), E10.5 or E11.5 (after the sheath formation; in a normal embryo, the sheath is rst observed at E1 0.0 surrounding the notochord ( Paavola et al., 1980 ) ). To determine if hedgehog signaling was efficiently removed in Shh expressing cells after tamoxifen exposure, we analyzed expression of Shh and Ptch1 in E9.5 embryos that had been exposed to tamoxifen at E8.5 ( Zhu et al., 2008 ) Both Shh and Ptch1 expression were absent in the mutant notochord of treated embryos (Fig. 4 10B, D). Examination of the vertebral column of E11.5 control and Shh f /ShhcreERT 2 embryos in which hedgehog signaling had been removed after sheath formation occurred demonstrated that perdurance of the notochord sheath did not require hedgehog signaling (Fig. 4 11C, G). To determine if removal of hedgehog signaling from the notochord after sheath formation affected nuclei pulposi patterning, control and Shh f /ShhcreERT 2 notochords exposed to tamoxifen at E11.5 were fate mapped using the R26R reporter allele ( Soriano, 1999 ) In c ontrol and tamoxifen treated E11.5 embryos harvested at E18.5, no difference in

PAGE 49

49 nuclei pulposi formation was observed rostral to sacral vertebrae (Fig. 4 10I, N, S) indicating that hedgehog signaling is not required for formation of nuclei pulposi after th e sheath has formed. Proper Formation of Vertebrae is Required for the Transition of the Notochord into Nuclei Pulposi Removal of Shh from Shh expressing cells at E8.5 or E9.5 resulted in the continued presence of the notochord throughout the vertebral col umn and an absence of nuclei pulposi throughout embryonic development (Fig. 4 10E, G, K, L, P, Q). Unlike when Smo was removed from Shh expressing cells, notochord cells were not observed scattered throughout the vertebral column, even when the notochord sheath was abnormal. In addition, removal of Shh resulted in defects in formation of the vertebrae (Fig. 4 vertebrae formation correlated with earlier removal of Shh Removal of Shh at E10.5 resulted in formation of vertebrae but they lacked condensations (Fig. 4 experiment, nuclei pulposi began to form but notochord cells were still found to reside with the vertebral bodies (Fig. 4 10M). These data support the pr oposal that vertebrae may be responsible for forcing notochord cells into the forming intervertebral bodies (Fig. 4 12). Discussion Role of Hedgehog Signaling within the Mouse Notochord During normal mouse development the notochord sheath surrounds the ent ire notochord beginning at E10.0 ( Paavola et al., 1980 ) As the notochord begins to form visible nuclei pulposi at E12.5, the sheath remains around notochord cells. Our data directly addresses the role hedgehog signaling plays in for mation of the notochord

PAGE 50

50 sheath. In Shh null embryos, the notochord forms but then quickly disappears prior to sheath formation suggesting that hedgehog signaling is essential for maintaining a functional notochord ( Chiang et al., 1996 ) Since Shh null embryos are defective in hedgehog signaling throughout the entire embryo it was not possible to determine if loss of the notochord in these mutant animals was an ind irect consequence of loss of hedgehog signaling in other tissues. In our experiments, hedgehog signaling was removed from the notochord but was still present in tissues surrounding this structure. In these embryos, notochord cells persisted throughout em bryonic and postnatal development. These data indicate that hedgehog signaling is not required for maintenance of this structure but instead is essential for normal formation of the notochord sheath that surrounds the embryonic notochord. Its is importan t to note that the cre allele used in these experiments, Shhcre removes hedgehog signaling from the floor plate in addition to the notochord. While we currently have no evidence to support a role for hedgehog signaling within the floor plate in forming t he notochord sheath, it is possible that signaling molecules within the floor plate that are downstream of the hedgehog signaling pathway may be important for forming at least some aspects of the notochord sheath. Upon removal of all hedgehog activity, the sheath was disrupted but a ring of basal lamina was still found surrounding the notochord indicating that hedgehog signaling is not responsible for producing all components of the sheath. Laminin protein surrounding the hedgehog null notochord could be p roduced from non notochord cells, as suggested by experiments in zebrafish ( Parsons et al., 2002 ) A second possibility is

PAGE 51

51 that laminin is produced directly by notochord cells but does n ot require hedgehog signaling. Role of the Notochord Sheath during Intervertebral Disc Formation Although it is clear that a notochord sheath forms around the notochord in a number of different species including zebrafish, chick, mice and in humans the fu nction this structure plays during development has remained elusive ( Paavola et al., 1980 ; Camon et al., 1990 ; Gotz et al., 1995 ; Kimmel et al., 1995 ) During the transition of the along the midline of the embryo by the condensing vertebra into the forming discs ( Theiler, 1988 ; Rufai et al., 1995 ; Aszodi et al., 1998 ; Smits and Lefebvre, 2003 ) In embryos in which hedgehog signaling was removed from the notochord but contained normal verte bral bodies, notochord cells were observed to be scattered throughout the vertebral column. Mutant embryos that had a defective vertebral column, irrespective of if they had a normal notochord sheath, contained a rod like notochord suggesting that vertebr ae are needed to form normal discs. We propose that a possible function of the notochord sheath may be to form a 12). Prior to the notochord forming nuclei pulposi, our model suggests that the sheath is required to maintain the rod like structure of the notochord. In our experiments, loss of a functional sheath caused the notochord to flatten. During later wild type development, we propose that the sheath is flexible enough so that when the forming vert ebrae exert swelling pressure the sheath expands but still constrains notochord cells to the dorsal midline of the embryo. In regions of the embryo where the discs are forming, the notochord bulges outward and forms the nucleus pulposus of each interverteb ral disc. We propose that in

PAGE 52

52 the absence of a functional sheath, notochord cells are not constrained and become scattered throughout the vertebral column. Consistent with the proposed role for the notochord sheath in constraining notochord cells within t he midline of the vertebrate embryo, an increase in the aberrant migration of notochord cells correlated with the observed increasing caudal severity of defects in sheath formation. It is possible that abnormal nuclei pulposi formation observed upon remova l of hedgehog signaling results from some other, non sheath role for hedgehog signaling in this tissue. We cannot rule out the possibility that the hedgehog signaling pathway is responsible for activation of an unknown pathway(s) that is required for prop er migration of notochord cells into the forming nuclei pulposi, independent of the presence of a notochord sheath. Mechanical removal of the notochord sheath from around the notochord in normal embryos could directly address this question, however, this experiment is technically challenging due to the inaccessibility of the notochord during vertebrate embryonic development. Instead, we have taken a genetic approach to address this issue by removing hedgehog signaling after the notochord sheath has formed. In these embryos, the sheath was maintained and normal nuclei pulposi formation was observed. These data suggest that hedgehog signaling is required to specify formation of the notochord sheath but is not needed to maintain this structure during later e mbryogenesis. In wild type mice, the hedgehog signaling pathway remains present in nuclei pulposi throughout early postnatal life ( Dahia et al., 2009 ) The role this signaling pathway plays in the postnatal intervertebral discs is unknown.

PAGE 53

53 Materials and Methods Mice Mice containing the conditional floxed allele of Smo f/f Shhgfpcre ShhcreERT 2 and Shh f / f have been described previously ( Dassule et al., 2000 ; Long et al., 2001 ; Harfe et al., 2004 ) Smo f/f ; Shhgfpcre embryos were generated by crossing Smo f/f or Smo f/+ females with a Smo f/+ ; Shhgfpcre male. Shh f /ShcreERT 2 embryos were created by crossing Shh f / f or Shh f / + females with ShhcreER T 2 /+ males. For Shh f /ShcreERT 2 embryos, tamoxifen (Sigma) was gavaged at a concentration of 3mg/40g body weight in a pregnant female. In this report, Smo f / f ; Shhgfpcre or Shh f /ShhcreERT 2 animals are referred to as mutant. Embryos that were either Smo f/ f Smo f/+ Smo f/+ ; Shhgfpcre, Shh f/+ or Shh f/f were phenotypically wild type and were used as controls. In addition, embryos containing just the Shhgfpcre or ShhcreERT 2 allele were indistinguishable from wild type. The R26R reporter allele was used in all f ate mapping experiments ( Soriano, 1999 ) All mouse strains were on a mixed genetic background. Animals were handled in accordance with the University of Florida Institutional Animal Care and Use Committee. Histology and Immunohistochemistry Embryos were then d ehydrated through an ethanol series and embedded in paraffin (Fisher) or were incubated in 30% sucrose at 4 o C overnight and embedded in OCT (Sakura Finetek). Embryos were sectioned at 10 m in rostral (forelimb level) and in caudal (hindlimb level) region s of the embryos and stained with hematoxylin (Fisher) and eosin (Fisher). For alcian blue staining, sections were stained with alcian blue (pH 2.5, Sigma) for 15 min, were washed in running tap water for 10 min and were then counterstained with nuclear f ast red (Ricca chemical company). For picro sirius red

PAGE 54

54 staining, sections were stained with picro sirius red (Poly scientific) for 45 min and then were washed in acidified water (0.025% acetic acid). For immunohistochemistry, sections were stained with ra bbit anti laminin (DAKO) at 1:200, with rabbit anti galactosidase (Invitrogen) at 1:500, with rabbit anti T (Santa Cruz Biotechnology) at 1:200 or with rat anti bromodeoxyuridine (BrdU, Accurate chemicals) at 1:200. A Cy2 or Cy3 conjugated secondary ant ibody (Jackson immuno research laboratories) was used at 1:200. Images were captured using a Leica DMRE microscope (Leica Microsystems Inc.) or Olympus BX61WI confocal microscope and were analyzed using Volocity 5.4 (PerkinElmer). Cell Proliferation and D eath Assay To detect cell proliferation in E11.5 notochords, pregnant dams were injected with BrdU (50 g/g bodyweight) for 3 hours before harvest. Embryos were fixed and embedded in OCT (Sakura Finetek). Three wild type and three mutants were examined. T he numbers of BrdU positive cells within the notochord were counted from five different 10 m sections for each embryo. Unpaired student t test was used to test significance. For the TUNEL assay, embryos were fixed and embedded in paraffin (Fisher). Embry os were sectioned at 10 m. The TMR Red in situ cell death detection kit (Roche Diagnostics) was used following the manufacturers instruction. Cell death detection using Lysotracker (Molecular Probe 1:200) was performed following the manufacturers instru ction.

PAGE 55

55 Electron Microscopy Fixed tissues were processed with the aid of a Pelco BioWave laboratory microwave (Ted Pella). The samples were washed in 0.1M sodium cacodylate buffer followed by 1% tannic acid. The samples were post fixed with 2% OsO 4 water washed and dehydrated in a graded ethanol series followed by 100% acetone. Dehydrated samples were infiltrated in graded acetone/Spurrs epoxy resin and cured at 60 o C ( Ellis, 2006 ) Cured resin blocks were trimmed, thin sectioned and collected on formvar copper slot grids, post Sections were examined with a Hitachi H 7000 TEM (Hitachi High Technolo gies America, Inc.) and digital images acquired with a Veleta camera and iTEM software (Veleta Olympus Soft Imaging Solutions Corp.).

PAGE 56

56 Figure 4 1. Removal of SMO in Shh expressing cells. (A B) Analysis of Shhgfpcre expression in an E10.5 embryo. Wholemount (A) and section (B) of a Xgal stained Shhgfpcre;R26R embryo. Note that staining is observed in the notochord (n) and floor plate of the neural tube (nt). (C D) Analysis of Ptch1:lacZ expression revealed that hedg ehog signaling was absent in mutant notochords. Section of Ptch1:lacZ expression of E9.5 control ( Smo f/f ; Ptch1:lacZ )) and mutant ( Smo f/f ; Shhgfpcre ; Ptch1:lacZ ) embryos. Note that Ptch1:lacZ expression was absent in the mutant caudal notochord (arrow). In the neural tube a decrease in Ptch1:lacZ was observed compared to controls. Lower expression may be due to the inability of floor plate cells to respond to SHH secreted from the notochord since the Shhgfpcre allele removed SMO from the floor plate in ad dition to the notochord. Scale bars in B is 50 m, and C D are 20 m. notochord (n); neural tube (nt). Reprinted with permission from Hedgehog signaling is required for formation of the notochord sheath and patterning of nuclei pulposi within the interver tebral discs Choi KS, Harfe BD; Copyright 2011 Proc Natl Acad Sci U S A.

PAGE 57

57 Figure 4 2. Removal of SMO in the notochord results in caudal truncation of vertebrae. (A D) Bright field images of E12.5 and P0 wild type and mutant embryos in which Smo h as been removed from Shh expressing cells. An abnormally truncated and thinner tail (asterisk in B and D) was observed in the E12.5 and P0 mutant. (E, F) Skeleton preparation of control (E) and mutant (F) P0 mice. Note that there is no vertebrae formatio n caudal to lumbar vertebrae. (G J) Lysotracker assay of control and mutant E11.5 embryos. I and J are higher magnification of the boxed regions shown in G and H. An increase in cell death occurred caudal to the lumbar vertebra (arrowhead in H). Reprint ed with permission from Hedgehog signaling is required for formation of the notochord sheath and patterning of nuclei pulposi within the intervertebral discs Choi KS, Harfe BD; Copyright 2011 Proc Natl Acad Sci U S A.

PAGE 58

58 Figure 4 3. Expression of Pax1 and Pax3 in rostral somites was not affected by removal of hedgehog signaling in the notochord. (A H) Pax1 and Pax3 RNA in situ hybridization in E10.5 and E11.5 rostral embryos. Pax1 and Pax3 expression in the somites of rostral mutant E10.5 and E11.5 embry os was not altered compared to age matched normal embryos. (I L) Pax1 and Pax3 RNA in situ hybridization in E11.5 caudal embryos. Pax1 expression was diminished in the somite of caudal mutant E11.5 embryos (J). Pax3 expression was not changed in the cau dal somite of control and mutant E11.5 embryos (K, L). sclerotome (sc); dermomyotome (dm); neural tube (nt). Reprinted with permission from Hedgehog signaling is required for formation of the notochord sheath and patterning of nuclei pulposi within the i ntervertebral discs Choi KS, Harfe BD; Copyright 2011 Proc Natl Acad Sci U S A.

PAGE 59

59 Figure 4 4. Removal of SMO in Shh expressing cells results in abnormal development of the intervertebral discs. (A F) Histological analysis of a sagittal section of the thoracic vertebral column using picro sirius red and alcian blue staining. Close up view of nucleus pulposus (C, D) and annulus fibrosus (E, F). Mutant tissue contained a smaller nucleus pulposus than controls and concentric lam ellae were absent in the annulus fibrosus. Scale bars in A B are 100 m, and C F are 20 m. vertebral body (vb); nucleus pulposus (np); annulus fibrosus (af). Reprinted with permission from Hedgehog signaling is required for formation of the notochord sh eath and patterning of nuclei pulposi within the intervertebral discs Choi KS, Harfe BD; Copyright 2011 Proc Natl Acad Sci U S A.

PAGE 60

60 Figure 4 5. Removal of hedgehog signaling resulted in a decrease in cell proliferation in rostral mutant notochords. Representative transverse sections of the rostral vertebral column of E11.5 embryos are shown. (A B) BrdU staining of control (A) and mutant (B) sections. (C D) A merge picture of BrdU, DAPI, and Laminin (green). Laminin staining marked the inner layer of the notochord sheath and outlined the location of the notochord. At E11.5, the number of anti BrdU positive cells in mutant notochords was decreased (D). (E) Quantification of the number of anti BrdU positive cells/ total cells in the notochord demonstrat ed that the number of proliferating cells in mutant notochords was significantly decreased. Data are represented as means and the error bars represent the SD. A B are 200 m. p<0.05. Reprinted with permission from Hedgehog signaling is required for fo rmation of the notochord sheath and patterning of nuclei pulposi within the intervertebral discs Choi KS, Harfe BD; Copyright 2011 Proc Natl Acad Sci U S A.

PAGE 61

61 Figure 4 6. Aberrant cell death did not occur upon removal o f hedgehog signaling in the notochord. (A F) Sagittal sections of the rostral vertebral column of E12.5 14.5 embryos are shown. At E12.5 14.5, no ectopic cell death was detected in mutant notochords compared to controls upon removal of the hedgehog signa ling pathway. In E14.5 embryos, notochord cells that did not reside in nuclei pulposi underwent cell death in both control (E) and mutant (F) embryos (arrows). Dotted lines outline the location of the notochord. Nuclei were counterstained using DAPI. Sc ale bars in A F are 50 m. vertebral body (vb); intervertebral mesenchyme (im). Reprinted with permission from Hedgehog signaling is required for formation of the notochord sheath and patterning of nuclei pulposi within the intervertebral discs Choi KS, Harfe BD; Copyright 2011 Proc Natl Acad Sci U S A.

PAGE 62

62 Figure 4 7. Aberrant migration of notochord cells throughout the vertebral column upon removal of hedgehog signaling in the notochord. (A L) Cells were fate mapped using the cre inducible R26R allele. (A B) Notochord (blue cells) formed a rod like structure in both wild type and mutant animals until E12.5. In wild type E13.5 embryos (C) the notochord started to form a bulge between the vertebrae in regions where the intervertebral discs were forming. In mutants (D) the notochord remained as a rod like structure and a few cells were found to reside outside the notochord (arrows). By E14.5, notochord cells had formed nuclei pulposi in wild type animals (E) but retained a rod like structure in the muta nt (F). A number of mutant notochord cells (arrows) resided outside the notochord. In P0 wild type animals (G, I), notochord cells had formed the nucleus pulposus of each intervertebral disc. In contrast, mutant notochord cells (H, J) were randomly foun d throughout the intervertebral mesenchyme and vertebrae. (K L) Histological analysis of thoracic vertebrae from newborn mice demonstrated severe defects in nucleus pulposus structure and an increase in notochord cells residing in surrounding tissues. Sc ale bars in A F are 50 m and K L are 100 m. intervertebral mesenchyme (im); vertebral body (vb). Reprinted with permission from Hedgehog signaling is required for formation of the notochord sheath and patterning of nuclei pulposi within the intervertebr al discs Choi KS, Harfe BD; Copyright 2011 Proc Natl Acad Sci U S A.

PAGE 63

63 Figure 4 8. Notochord cells that did not reside within nuclei pulposi failed to express T ( Brachyury ). (A, C, E) In controls, most notochord cells (pos itive for galactosidase) gave rise to nuclei pulposi cells, outlined by dotted lines, and continued to express T ( Brachyury ). (B, D, F) In mutants, notochord cells were located throughout the vertebral column, annulus fibrosus and nucleus pulposus. T ( B rachyury ) expression was decreased in mutant notochord cells residing in forming nuclei pulposi. Notochord cells (arrowheads) that did not reside in nuclei pulposi did not express T ( Brachyury ). Scale bar = 50 m. All sections were from P0 newborn mice. Reprinted with permission from Hedgehog signaling is required for formation of the notochord sheath and patterning of nuclei pulposi within the intervertebral discs Choi KS, Harfe BD; Copyright 2011 Proc Natl Acad Sci U S A.

PAGE 64

64 Figure 4 9. Hedg ehog signaling is required for notochord sheath formation. Asterisks (*) indicate the location of the notochord sheath in all panels. (A D) Histological analysis of transverse sections of rostral and caudal notochords from E11.5 embryos. Control (A, C) notochords were surrounded by the notochord sheath, which was visualized with alcian blue stain. In mutants, a thin layer of the notochord sheath was observed in the rostral notochord (B). In the mutant caudal notochord, the notochord sheath was absent ( D). In both controls (E, G) and mutants (F, H) immnohistochemistry revealed that laminin surrounded the notochord. (I P) Transmission electron micrograph of the notochord sheath. K, L, O, and P are higher magnification of the notochord sheath. The notoc hord sheath of controls contained basal lamina and collagen fibrils (K, O). In the mutant, basal lamina and a thinner layer of collagen fibrils formed in the rostral notochord (L) but the collagen fibrils appeared to be absent in the caudal notochord (P). Scale bars in A H are10 m, I, J, M and N are 20 m, K, L, O and P are 0.5 m. notochord (n); notochord sheath (ns). Reprinted with permission from Hedgehog signaling is required for formation of the notochord sheath and patterning of nuclei pulposi wit hin the intervertebral discs Choi KS, Harfe BD; Copyright 2011 Proc Natl Acad Sci U S A.

PAGE 65

65 Figure 4 10. Shh is required for patterning the intervertebral discs. (A D) Section RNA in situ hybridization of Shh (using a probe against the floxed exon 2) and Ptch1 of E9.5 control ( ShhcreERT 2 ) and mutant ( Shh f /ShhcreERT 2 ) embryos. Shh and Ptch1 transcripts in E9.5 mutant embryos (B, D) were not detected 24 hours after tamoxifen (TM) injection. (E S) Fate mapping of cells that have expressed Shh during intervertebral disc formation. Control ( ShhcreERT 2 ;R26R) and mutant ( Shh f /ShhcreERT 2 ;R26R) embryos were harvested at E18.5 after a single TM injection at either E8.5, E9.5, E10.5 or 11.5. All images are ventral views of the vertebral column. (P) Loss of Shh in E8.5 embryos resulted in the truncation of the notochord in lumbar vertebrae (arrow). (L, Q, R) The notochord in mutants remained rod like and failed to form nuclei pulposi upon removal of Shh from E9.5 or E10.5 embryos. (N, S) Nuclei pulposi for mation was not affected by inactivation of Shh in E11.5 Shh from E8.5 to E10.5 in Shh expressing cells resulted in severe defects in formation of vertebral c olumns and lack of Shh from E11.5 embryos did not result in any phenotypic abnormalities in the vertebral regions rostral to the sacral vertebrae. Scale bar = 50 m Reprinted with permission from H edgehog signaling is required for formation of the notochord sheath and patterning of nuclei pulposi within the intervertebral discs Choi KS, Harfe BD; Copyright 2011 Proc Natl Acad Sci U S A.

PAGE 66

66 Figure 4 10. Continued Figure 4 11. Shh is requir ed for formation but not maintenance of the notochord sheath. (A H) Histological analysis of transverse section of E11.5 and E12.5 embryos after a single TM injection at E8.5, E9.5 or E10.5, respectively. (A, E) In controls, the notochord was surrounded by the notochord sheath (blue). (B, F) After removal of Shh from E8.5 embryos, a thin notochord sheath was observed surrounding the rostral notochord but was not present surrounding the caudal notochord. (C, D, G, H) Inactivation of Shh in either E9.5 or E10.5 embryos did not affect notochord sheath formation. Scale bar= 20 m. Reprinted with permission from Hedgehog signaling is required for formation of the notochord sheath and patterning of nuclei pulposi within the intervertebral discs Choi KS, Harf e BD; Copyright 2011 Proc Natl Acad Sci U S A.

PAGE 67

67 Figure 4 12. Proposed role for the notochord sheath in forming nuclei pulposi of the intervertebral discs. The notochord sheath (red line) begins to form around the notochord (blue line) at E10.0 (early). By E14.5 (late) most notochord cells reside within the intervertebral discs. It has been proposed that swelling pressure (denoted by arrows) exerted by the vertebral bodies serves to push notochord cells into the space between each vertebrae. Loss of a f unctional in notochord cells being scattered throughout the vertebral column and formation of small and misshapen nuclei pulposi. Loss of a functional sheath in the absence of swelling pressure results in the continued presence of the rod like notochord throughout embryonic development. It is important to note that the proposed model does not rule out the possibility that a currently unknown molecular or chemical pathway is res ponsible for moving notochord cells into the forming discs. Reprinted with permission from Hedgehog signaling is required for formation of the notochord sheath and patterning of nuclei pulposi within the intervertebral discs Choi KS, Harfe BD; Copyright 2011 Proc Natl Acad Sci U S A.

PAGE 68

68 CHAPTER 5 IN THE LIMB AER BMP2 AND BMP4 ARE REQUIRED FOR DORSAL VENTRAL PATTERING AND INTERDIGITAL CELL DEATH BUT NOT LIMB OUTGROWTH Introduction The developmental program that governs formation of the vertebrate lim b involves a carefully controlled balance between pathways leading to growth and differentiation, and pathways leading to cell death. Several signaling centers direct differentiation of the early limb bud along each of its three axes; proximal distal, dor sal ventral, and anterior posterior (reviewed in ( Tickle, 2003 ) ) The molecules expressed in these centers set off a complex network of signaling cascades that guide the proper organizat ion and patterning of the limb. Classical experiments identified a region of posterior mesenchyme in the limb bud that controlled the patterning of the vertebrate digits along the anterior posterior axis named the Zone of Polarizing Activity (ZPA) ( Saunders and Gasseling, 1968 ) Within this signaling center, cells secrete the protein Sonic Hedgehog (SHH), creating a posterior to anterior protein concentration gradient in the early li mb bud ( Riddle et al., 1993 ) The consequence of the SHH protein gradient is that cells in the posterior of the limb bud are exposed to higher concentrations of SHH over longer amounts of time than cells located in more anterio r positions ( Harfe et al., 2004 ) Cells exposed to high total amounts of SHH have been shown to form posterior digits while cells exposed to lower levels of SHH fo rm more anterior digits ( Yang et al., 1997 ) Limb outgrowth along the proximal distal axis is controlled by a separate signaling center, the Apical Ectodermal Ridg e (AER; reviewed in ( Tickle, 2003 ) ) The AER is a specialized layer of ectodermal cells located along the distal tip of the limb bud. Several members of the fibroblast growth factor (Fg f) family are expressed in the AER. One of

PAGE 69

69 these, Fgf8 is expressed throughout the AER and has been implicated in controlling limb outgrowth and may also function in patterning the most distal portion of the digits ( Lewandoski et al., 2000 ; Sanz Ezquerro and Tickle, 2003 ) Fgf4 is expressed in the posterior AER and is not required for normal limb dev elopment. However, in the absence of Fgf8 Fgf4 is required for proximal distal outgrowth of the limb ( Sun et al., 2000 ; Sun et al., 2002 ; Boulet et al., 2004 ) FGF proteins expressed in the AER have also been demonstrated to regulate the expression of genes in the limb mesenchyme required for proximal distal patt erning and for terminating limb bud outgrowth ( Mariani et al., 2008 ; Verheyden and Sun, 2008 ) Genes exp ressed in the AER and ZPA interact through a complex feedback loop involving FGF proteins in the AER and SHH, Bone Morphogenetic Proteins (BMPs) and the BMP antagonist GREMLIN in the underlying mesenchyme (reviewed in ( Panman and Zeller, 2003 ) ) Bmp si gnaling negatively regulates the feedback loop by inhibiting Fgf expression although it is not clear which BMP protein(s) function in this pathway. This signaling loop is important for regulating limb outgrowth and the breakdown of the loop has been propos ed to control limb size ( Scherz et al., 2004 ; Verheyden and Sun, 2008 ) The Bmp genes Bmp2 Bmp4 and Bm p7 are expressed in a dynamic pattern during limb development in both the mesenchyme and ectoderm and all three share an overlapping expression pattern in the AER (reviewed in ( Robert, 2007 ) ) The diversity of functions that are carried out by BMPs, combined with their distinct expression patterns suggests that BMPs in different locations of the limb may carry out discrete

PAGE 70

70 functions. To test this hypothesis we have investigated the role BMPs expressed within the AER play in patt erning the developing limb. To investigate BMP functions specifically in the AER, several groups have used a transgenic approach to express the BMP antagonist noggin in the AER ( Plikus et al., 2004 ; Wang et al., 2004 ) In these mice, polydactyly, syndactyly, an expanded AER and decreased cell death were observed. A similar result was obtained in the chick syste m ( Pizette et al., 2001 ) Since all BMPs are affected upon exposure to noggin, the roles of individual BMP ligands cannot be determined in these experiments. In addition, in these experiments it was possible that noggin inh ibited additional pathways besides the BMP signaling pathway and/or that BMP signaling was not completely abolished. To investigate the role of individual BMPs in the limb ectoderm, we have taken a conditional gene knockout approach. Using conditional flo xed alleles of Bmp2 and Bmp4 and a transgenic allele that expresses CRE recombinase in the AER we have disrupted expression of these genes, individually and in combination, specifically in the AER. We found that while removal of Bmp2 or Bmp4 in the AER ha d no apparent effect on limb patterning, the combined loss of both Bmp2 and Bmp4 resulted in severe polydactyly, syndactyly, retention of interdigital tissue and defects in dorsal ventral patterning. In addition to examining the morphological consequences of BMP loss, we have uncovered molecular defects in both the limb ectoderm and mesoderm. Surprisingly, no defects in proximal distal patterning were observed. Results Msx2 Cre Inactivation of the Floxed Bmp2 and Bmp4 Alleles in the Limb AER To investigat e the roles of individual Bmps in the limb AER, mice were created in which both Bmp2 and Bmp4 were removed from the AER using an Msx2 Cre transgene

PAGE 71

71 (see Materials and Methods). This transgene drives expression of CRE recombinase in the AER of the early li mb bud and at low levels in the ventral ectoderm ( Sun et al., 2002 ) As documented by several groups, the Msx2 Cre transgene is expressed earlier in the hindlimb ( 24 somite stage) than in the forelimb (28 somite stage) ( Sun et al., 2002 ; Pajni Underwood et al., 2007 ) To determine if the Msx2 Cre allele removed Bmp gene expression we performed section RNA in situ hybridizations on E10.5 mice in which both Bmp2 and Bmp4 had and Methods) In double mutant embryos Bmp2 and Bmp4 were absent in the hindlimb AER (Fig. 1A D). In the forelimbs, occasional patchy Bmp2 and Bmp4 expression was observed consistent with the reported delayed expression of the Msx2 Cre transgene in this tissue (data not shown). To determine if both Bmp2 and Bmp4 were absent from the same limb bud we performed double RNA in situs using probes for both genes on the same double mutant limb bud. In all cases (n=6), expression of both Bmp2 and Bmp4 were absent indicatin g that the Msx2 Cre transgene had successfully recombined both floxed alleles in the same limb bud (data not shown). Expression of a third Bmp, Bmp7 in the AER was not altered upon removal of Bmp2 and Bmp4 from the limb AER (Fig. 5 1E, F). Embryos carryi ng two floxed alleles of Bmp2 and Bmp4 ( Bmp2 c/c ; Bmp4 c/c ) and no Cre allele were phenotypically normal. These embryos expressed both Bmp2 and Bmp4 in the posterior mesenchyme and throughout the AER (Fig. 5 1A, C). Since the floxed alleles of neither Bmp2 nor Bmp4 altered gene expression, these mice were used

PAGE 72

72 Bmp2 and Bmp4 alleles and containing the Msx2 Cre allele did not result in a visible phenotype. Removal of Bmp2 and Bmp4 in the L imb AER Results in Polydactyly, Syndactyly and Retent ion of Interdigital Tissue but Does N ot Cause Defects in Proximal Distal Patterning The AER has been shown to play an important role in limb outgrowth and patterning ( Tickle, 2003 ) To determine the role AER expressed Bmp2 and Bmp4 played in this process we examined the limbs of double mutant animals. In these animals polydactyly, retention of interdigital tissue and syndactyly were ob served (Fig. 5 2H). In the forelimbs, double mutants contained an ectopic post axial digit (n=5/6 limbs; Fig. 5 2C). The ectopic digit contained 2 3 skeletal elements and was not attached to the metacarpal. The forelimbs of double mutant mice also conta ined bifurcations of at least one of the middle digits, usually at the distal end (n=6/6; Fig. 5 2C). The hindlimbs of double mutant mice were more severely affected than the forelimbs. Similar to the situation in the forelimbs, polydactyly, retention o f interdigital tissue and syndactyly were observed in the double mutant hindlimbs. However, unlike what was found in the forelimbs, the ectopic digit in the hindlimbs was usually a complete digit that attached to the metatarsal (n=5/6; Fig. 5 2F). In add ition, double mutant hindlimbs exhibited proximal and distal digit bifurcations (Fig. 5 2F). In the course of generating double mutants we also created animals in which various combinations of Bmp2 and Bmp4 alleles were removed from the limb AER. Mice tha t lacked either both alleles of Bmp2 or both alleles of Bmp4 from the AER were phenotypically wild type (Fig. 5 2B, E and data not shown). In addition, removal of one additional allele of either Bmp2 or Bmp4 in these genetic backgrounds did not produce a visible phenotype (data not shown).

PAGE 73

73 Bmp signaling from the mesenchyme has been shown to play an essential role in interdigital tissue regression ( Selever et al., 2004 ; Bandyopadhyay et al., 2006 ; Ovchinnikov et al., 2006 ) To determine if ectodermal Bmp expression was important for regression of t issue from between the forming digits we examined the interdigital tissue of double mutant mice. In animals in which both Bmp2 and Bmp4 were removed from the AER, interdigital tissue was retained between the digits. In severe cases, digits 1 4 were fused together (Fig. 5 2H). Digit 5 was never found to retain interdigital tissue with digit 4. Removal of Bmp2 and Bmp4 from the AER did not result in defects in proximal distal patterning (Fig 5 2I, J, n=6/6). Removal of Ectodermal BMPs Resulted in Expansion of the AER and Delayed AER Regression To determine the morphology of the AER upon removal of Bmp2 and Bmp4 E11.5 limbs were examined using CD44. A section through the AER of an E11.5 limb revealed an elongated and thinner AER (Fig. 5 3A, C and see Fig. 5 1). Fgf genes are expressed in the AER and are excellent markers for denoting the boundaries of the AER. In double mutant mice the expression domains of both Fgf4 and Fgf8 were expanded along both the dorsal ventral and anterior posterior axes in E10.5 E12.5 limbs buds (Fig. 5 3D and Fig. 5 4C, G, H). This phenotype is similar to what has been reported upon removal of the Bmp receptor Bmpr1a in the AER ( Pajni Underwood et al., 2007 ) However, unlike the receptor knockout we did not observe gaps in Fgf4 or Fgf8 expression in E11 .5 limb buds upon AER removal of Bmp2 and Bmp4 Limb buds in which a single allele of either Bmp2 or Bmp4 remained did not contain a noticeable dorsal ventral or anterior posterior expansion of the AER (Fig. 5

PAGE 74

74 3G, H). Ectopic Fgf expression was also obser ved in E11.5 E14.5 limb buds (Fig. 5 4C, D, G, H). Bmp2 and Bmp4 Expression in the AER is Required for Regulating Interdigital Apoptosis and Cell Proliferation Apoptosis between the digits requires BMP signaling. Since multiple BMPs and their receptors ar e expressed in both the limb ectoderm and mesoderm it has been unclear what role individual BMP ligands play in regulating apoptosis between the forming digits. To determine if the retention of interdigital tissue observed in mutant mice was caused by a d ecrease in apoptosis we stained animals with Lysotracker Red to mark cells undergoing cell death. Limbs in which Bmp2 or Bmp4 were removed contained no reduction in interdigital cell death (data not shown). This is consistent with the lack of any skeleta l or visible phenotypes in these genetic backgrounds (see Figs 5 2 and 5 3). Mutant mice in which both Bmp2 and Bmp4 were removed from the AER exhibited a drastic decrease in cell death with the anterior portion of the limb being more severely affected (F ig. 5 5A, B). Msx transcription factors are downstream targets of the BMP signaling pathway and have been shown to play a role in mediating regression of the interdigital mesenchyme via apoptosis ( Marazzi et al., 1997 ; Satokata et al., 2000 ; Wang et al., 2004 ) Mutant animals in which Bmp2 and Bmp4 were rem oved from the limb ectoderm lacked detectable Msx2 expression in the AER (Fig. 5 5C, D). Msx2 expression in the underlying mesoderm was also decreased (Fig. 5 5C F). In addition to a decrease in apoptosis, an increase in cell proliferation can result in webbing between the digits. To determine if there was a proliferation defect in the limbs of mice that lacked AER expression of Bmp2 and Bmp4 we used an anti phospohistone

PAGE 75

75 H3 antibody to detect cells that were actively dividing (Fig. 5 5I K). Double muta nt limbs were found to contain a significant increase in the number of proliferating cells underneath the AER (p=0.002) than their corresponding wild type littermates suggesting that AER expressed Bmps regulate both apoptosis and cell proliferation in the underlying limb mesoderm. Distal Gremlin Expression in the Limb Mesoderm Requires Expression of Bmp2 and Bmp4 in the AER The Bmp antagonist Gremlin is initially expressed in the distal limb bud mesenchyme underneath the AER ( Panman et al., 2006 ) As development progresses, Gremlin is excluded from the posterior limb bud due to the expansion of cells that have at one time expressed Shh ( Scherz et al., 2004 ) Gremlin expression is also excluded from the distal portion of the limb bud underneath the AER during limb development by Fgf signaling ( Verheyden and Sun, 200 8 ) Analysis of Gremlin expression in double mutant limb buds showed a striking decrease of distal, but not proximal Gremlin expression in the early limb bud mesenchyme compared to age matched littermates suggesting that AER expressed Bmps play a role i n regulating Gremlin (Fig. 5 5G, H). Hox gene expression but not hedgehog signaling was also expanded in the anterior mesenchyme of the limb buds (Fig. 5 6). Expression of Engrailed 1 in the AER and Specification of Ventral Ectodermal Structures Requires B mp2 and Bmp4 Expression in the AER Engrailed 1 ( En1 ) is a homeodomian containing transcription factor expressed in the ventral AER ( Joyner and Martin, 1987 ) Mice homozygous for a null allele of En1 contain both dorsal ventral and proximal distal defects ( Loomis et al., 1996 ; Loomis et al., 1998 ) In these mice, the AER is broadened and Fgf8 expression is expanded. The broadening of the AER i n En1 null embryos is similar to the phenotype we had observed

PAGE 76

76 upon removal of Bmp2 and Bmp4 in the AER (see Fig. 5 3D). To investigate if En1 expression was altered after AER removal of Bmps we performed En1 RNA in situ hybridizations on double mutant em bryos. In double mutant embryos lacking both Bmp2 and Bmp4 in the AER, En1 expression was absent from the AER (Fig. 5 7A, B). In the ventral ectoderm En1 expression is required to inhibit expression of Lmx1 a LIM homeodomain transcription factor expres sed in the dorsal mesoderm of wild type embryos ( Riddle et al., 1995 ) To determine if removal of Bmps from the AER affected dorsal ventral patterning we examined expression of Lmx1 In mutant embryos Lmx1 expression was expanded through the AER but not into the ventral ec toderm (Fig. 5 7.C, D). In animals in which dorsal ventral patterning has been reported to be altered, for example in Wnt7a null mice, tendons and sesamoid bones are found to be ectopically located on the dorsal side of the limb ( Parr and McMahon, 1995 ) In mice in which both Bmp2 and Bmp4 were removed from the AER, we observed tendons and sesamoid bones in their normal l ocation on the ventral side of the limb (Fig. 5 7E, F and data not shown). Interestingly, a distal dorsal ectodermal structure, the nail plate, was duplicated on the ventral side of the limb upon removal of Bmp2 and Bmp4 from the AER (Fig. 5 7G, H). Discu ssion In this report we investigated the role Bmp ligands in the AER play in the patterning of the vertebrate limb. Previous work by others has shown that Bmp signaling in the AER is essential for limb patterning. However, these studies were unable to ad dress the role that Bmp ligands expressed in the AER play in limb patterning. Using a conditional knockout approach, we demonstrated that both Bmp2 and Bmp4 were

PAGE 77

77 required within the AER for activation of the Bmp signaling pathway in this tissue. Surprisin gly, the phenotype observed upon removal of Bmp ligands from the AER did not resemble the previously reported Bmpr1a AER knockout. AER Expression of Bmp2 and Bmp4 is N ot Required for Limb Outgrowth The complete inactivation of Bmp signaling to the AER thr ough the conditional inactivation of Bmpr1a results in limb agenesis indicating that Bmp signaling to the AER is required for limb outgrowth ( Ahn et al., 2001 ; Pajni Underwood et al., 2007 ) However, in our experiments we did not observe any defects in limb outgrowth. It is often difficult to compare conditional knockout phenotypes due to the use of differ ent Cre alleles. However, we have used an identical Cre allele, Msx2 Cre, that Pajni Underwod et. al. (2007) used to inactivate Bmpr1a The striking difference in phenotypes observed could be a result of compensation from Bmp ligands present in the limb mesoderm and/or Bmp7 in the AER. Removal of different combinations of Bmps has been reported in the limb mesenchyme ( Selever et al., 2004 ; Bandyopadhyay et al., 2006 ) In these experiments, Bmps were still expressed in the AER but the AER was expanded in the anterior posterior direction and, at least in the case of Bmp4 removal from the mesenchyme, the A ER was broader ( Selever et al., 2004 ) These data suggest that Bmps expressed in the limb mesenchyme play a role in AER formation. If mesodermally expressed Bmp s can activate Bmp signaling in the AER through Bmpr1a as has recently been proposed ( Pajni Underwood et al., 2007 ) our data indicates that they are incapable of inducing expression of Msx2 a known target of the Bmp signaling pathway in the AER (at levels that can be detected by RNA in situ hybridization). In addition, mesodermally

PAGE 78

78 expressed Bmps apparently cannot rescue expression of En1 nor defects in AER maturation in mice in which Bmp2 and Bmp4 have been removed from the AER. The source of Bmp ligands that activate the Bmp signaling pathway within the AER is still unclear. Our data supports the hypothesis proposed by Ahn et al. (2001) that Bmp ligand expression in the lateral mesoderm and/or overlying ectoderm may be the source of Bmp activity required for limb outgrowth ( Ahn et al., 2001 ) Removal of additional combinations of Bmp ligands in the AER, limb ectoderm and/or lateral mesoderm could be performed to address this question. Int erdigital Apoptosis Requires Ectodermal Expression of Bmp Ligands Bmp signaling within the mesenchyme of the interdigital region has long been proposed to regulate programmed cell death between the forming digits ( Zou and Niswander, 1996 ; Marazzi et al., 1997 ) A recent model has been proposed in which interdigital cell death is controlled by Bmp ligand expressio n in the interdigital region ( Pajni Underwood et al., 2007 ) In this model, mesodermal Bmp ligands bind to BMPR1A in the AER and regulate FGF activity in the AER. Our data indicates that AER expressed Bmps are responsible for interdigital cell death and we propose that Bmps expr essed in the AER can activate the Bmp signaling pathway through AER expressed BMPR1A. In support of this hypothesis, mesenchymal BMP expression was not altered in the double mutants (Fig. 9). Our data does not rule out the possibility that mesodermal Bmp s are also required for interdigital cell death, however the lack of Msx2 expression, a known target of Bmp signaling in the Bmp2/Bmp4 null AER indicates that mesodermal Bmps cannot completely compensate for loss of Bmp expression in the AER.

PAGE 79

79 The Role of B mp Ligands in the AER In the AER of limbs that lacked Bmp2 and Bmp4 En1 was lost from the AER. En1 has been shown to be essential for maturation of the AER and removal of this gene from the entire limb has been reported to result in a wider AER, an expan sion of Fgf8 and the formation of ectopic AERs on the ventral side of the limb bud due to defects in dorsal ventral patterning ( Loomis et al., 1996 ; Loomis et al., 1998 ) Interestingly, the only dorsal ventral defects we observed upon removal of Bmp ligands from the AER were the presence of a nail plate, a dorsal structure, on the ventral side. These data sugge st that En1 expression in different regions of the limb may be required to repress specific dorsal structures. In the Bmp2 / Bmp4 null AER we observed a striking increase in Fgf4 and Fgf8 expression in the AER similar to what has been reported in En1 null em bryos ( Loomis et al., 1996 ; Loomis et al., 1998 ) The loss of En1 in the AER suggests that AER expressed BMP ligands function upstream of En1 It is not clear how this signaling cascade specifies En1 expression only in the ventral half of the AER, however, in a wild type limb once En1 is activated in the ventral AER this structure undergoes maturation and Fgf e xpression is limited. Removal of Bmp2 and Bmp4 or En1 specifically from the AER results in a failure in AER maturation. Based on our data and previous work from Pajni Underwood et al. (2007) we support the hypothesis that removal of BMP2/4 from the AER re sults in expansion of Fgf expression that then leads to an increase in cell proliferation and a decrease in apoptosis in the underlying mesoderm (Fig. 5 8). A recent report elegantly showed that an Fgf/ Gremlin inhibitory feedback loop triggers termination of limb bud outgrowth ( Verheyden and Sun, 2008 ) During early stages of limb development FGF levels are low and Gremlin is expressed directly

PAGE 80

80 underneath the AER where it inhibits Bmp signaling and maintains the Shh Fgf feedback loop. As limb development proceeds, Fgf signaling increases and distal Gremlin expression is repressed. Our data supports a role for AER mediated Bmp expression in this process. Upon removal of Bmp2 and Bmp4 from the AER we observe an increase in Fgf expression and a corresponding decrease in distal Gremlin expression in the limb bud mesenchyme. Our data does not rule out the possibility that BMP ligands expressed in the AER can bind to ectodermal and/or mesodermal Bmp receptors. Since Bmps are secreted molecules it is possible that Bmps produced in the AER bind Bmp receptors in the AER and in the underlying mesoderm. However, we favor a model in which AER expressed Bmps bind AER expressed receptors and directly activate Bmp signaling in this tissue. In this model, a decrease in Bmp signaling in the AER results in failure of the AER to undergo maturation resulting in a decrease in Gremlin expression underneath the AER. In support of this model, proximal Gremlin expression is not altere d upon removal of Bmp ligands from the AER suggesting that this domain of expression requires mesodermal and not ectodermal Bmp ligand expression. We found that Msx2 expression was downregulated in the AER upon removal of Bmp2 and Bmp4 from this tissue. This result is identical to what has been reported upon removal of Bmp signaling from the AER ( Bmpr1a knockout ( Pajni Underwood et al., 2007 ) ) suggesting that AER expressed Bmps activate Bmp signaling within the AER. Removal of Bmpr1a from the limb mesenchyme has also been report ed to cause a decrease in Gremlin expression. We propose that ectopic expression of Fgf genes in animals in which Bmp2 and Bmp4 have been removed from the AER is a consequence

PAGE 81

81 of the failure of proper AER maturation due to the lack of En1 and other unknow n targets. Materials and Methods Mouse Strain Construction and Genotyping The creation and genotyping of the conditional floxed alleles Bmp2 c/c and Bmp4 c/c have been described previously ( Kulessa and Hogan, 2002 ; Bandyopadhyay et al., 2006 ; Tsuji et al., 2006 ; Chang et al., 2008 ) The Msx2 Cre allele has also been described previously ( Sun et al., 2002 ) To create Bmp2 c/c ; Bmp4 c/c Msx2 Cre mice we first recombi ned the Msx2 Cre allele onto a chromosome containing the floxed Bmp4 c/c allele. The Msx2 Cre transgene has been reported to have inserted into chromosome 14 very close to the gene Bmpr1a ( Pajni Underwood et al., 2007 ) Bmp4 is located 12 million base pairs from Bmpr1a ( Shore et al., 1998 ) To generate mice containing the Bmp4 floxed allele in cis with the Msx2 Cre allele we mated mice heterozygous for both the Bmp4 floxed allele and the Msx2 Cre allele to Bmp4 homozygous females. Offspring obtained from this cross that were homozygous for the Bmp4 floxed allele and also contained the Msx2 Cre allele must have undergone a meiotic recombination event pl acing the Msx2 Cre allele in cis with the Bmp4 floxed allele. Screening of ~500 progeny revealed two mice, both males, which had undergone the desired recombination event. Males that were Bmp4 c/c Msx2 Cre were then mated to Bmp2 c/c homozygous females. M ales from this cross that were heterozygous for both floxed alleles and contained the Msx2 Cre allele were crossed to females homozygous for both the Bmp2 and Bmp4 floxed alleles to create Bmp2 c/c ; Bmp4 c/c Msx2 Cre animals in this report). Double mutant males were viable and were used to generate double mutant and control (lacking the Msx2 Cre allele) embryos

PAGE 82

82 for analysis. All mouse strains were on a mixed genetic background. Animals were handled in accordance with the U niversity of Florida Institutional Animal Care and Use Committee. Whole Mount RNA In Situ Hybridization, Lysotracker Staining, Skeletal Preparations and Cell Proliferation Analysis RNA whole mount in situ hybridization, Lysotracker Red (Molecular Probes) a nalysis and skeletal preparations were performed as described previously ( Wilkinson, 1992 ; Murtaugh et al. 1999 ; Karp et al., 2000 ; Chi et al., 2003 ) Probes used to detect Bmp2 and Bmp4 deletion were against the floxed regions of these genes and have been described previously ( Bandyopadhyay et al., 2006 ) At least three animals for each genotype were examined in all experiments. To detect cell proliferation levels in E11.5 hindlimbs anti phospohistone H3 antibody ( Cell Signaling Technology) was used at a 1:200 dilution. Three double mutants and three wild type animals were analyzed. The number of anti phospohistone H3 positive cells from three 10 m sectio ns of each embryo were counted within a standardized sized box located at the distal edge of the limb (underneath the AER). Unpaired student t test was used to test significance. All comparisons between mutant and wild type embryos were done with embryos from the same litter.

PAGE 83

83 Figure 5 1. Msx2 Cre removes floxed Bmp2 and Bmp4 alleles from the AER. Section RNA in situ hybridizations for Bmp2 (A, B), Bmp4 (C, D) and Bmp7 (E, F) in wild type ( Bmp2 c / c ; Bmp4 c / c ) and double mutant ( Bmp2 c / c ; Bmp4 c / c Msx2 Cre) hindlimb buds. Animals homozygous for both the floxed Bmp2 and Bmp4 alleles were wild type (see text). Double mutant and the corresponding wild type limb buds from littermates are shown. A 20 m sagittal section containing th e AER is shown. Insets are a zoomed view of the AER. Note the expanded AER present in the double mutants (B, D, F). All limbs are from E10.5 embryos. Comparison between mutant and wild type limb buds were done with littermates. Mutant limbs, compared to wild type littermates were usually larger. This was most likely caused by an increase in cell proliferation and a decrease in cell death (see text). Reprinted with permission from In the limb AER Bmp2 and Bmp4 are required for dorsal ventral patterning and interdigital cell death but not limb outgrowth Maatouk DM, Choi KS, Bouldin CM, Harfe BD ; Copyright 2009 Dev Biol.

PAGE 84

84 Figure 5 2. Removal of Bmp2 and Bmp4 from the AER results in polydactyly, syndactyly and retention of interdigital tissue. Skeletal preparations of wild type (A, D) and mutant (B, C, E, F) fore and hindlimbs of newborn mice. Removal of both Bmp4 alleles (B, E) or both Bmp2 alleles (data not shown) in the AER did not result in the production of a visible phenotype. Two examples of t he skeletal defects present in the double mutants are shown (C, F). Bright field images of adult Bmp4 c / c Msx2 Cre (G) and Bmp2 c / c ; Bmp4 c / c Msx2 Cre hindlimbs (H). Note the absence of webbing in Bmp4 c / c Msx2 Cre limbs. No proximal distal defects were observed in limbs in which both Bmp2 and Bmp4 had been removed from the AER (I, J). Reprinted with permission from In the limb AER Bmp2 and Bmp4 are required for dorsal ventral patterning and interdigital cell death but not limb outgrowth Maatouk DM, Cho i KS, Bouldin CM, Harfe BD ; Copyright 2009 Dev Biol.

PAGE 85

85 Figure 5 3. AER expansion upon removal of Bmp2 and Bmp4 (A, C) A section stained for CD44 through the AER of an E11.5 limb revealed an elongated and thinner AER in limb buds in w hich Bmp2 and Bmp4 had been removed from the AER. (B, D) In double mutant limb buds Fgf8 expression was expanded both in the dorsal ventral and anterior posterior directions. (E H) No ectopic expression of Fgf8 was observed in limbs that contained at lea st a single wild type allele of either Bmp2 or Bmp4 Reprinted with permission from In the limb AER Bmp2 and Bmp4 are required for dorsal ventral patterning and interdigital cell death but not limb outgrowth Maatouk DM, Choi KS, Bouldin CM, Harfe BD ; Copy right 2009 Dev Biol.

PAGE 86

86 Figure 5 4. Ectopic Fgf4 and Fgf8 expression occurs in double knockout limbs. In double mutant E11.5 14.5 limb buds Fgf8 (A D) and Fgf4 (E H) expression was expanded both in the dorsal ventral and anterior posterior directions. In addition, expression of Fgf4 (F, H) and Fgf8 (B, D) was observed to persist for an expanded amount of time. Reprinted with permission from In the limb AER Bmp2 and Bmp4 are required for dorsal ventral patterning and interdigital cell death but not limb outgrowth Maatouk DM, Choi KS, Bouldin CM, Harfe BD ; Copyright 2009 Dev Biol.

PAGE 87

87 Figure 5 5. AER expression of Bmp2 and Bmp4 is required for regulating cell death, cell proliferation and Gremlin expressi on in the limb mesenchyme. (A, B) Lysotracker red assay to measure cell death in E13.5 hindlimb buds. Removal of both alleles of Bmp2 and Bmp4 in the AER resulted in a decrease in cell death (compare A and B). The decrease was more pronounced in the ant erior of the limb where almost all cell death was abolished (insets in A and B). Box insets are close up views of the anterior limb. (C, D) In limbs in which both Bmp2 and Bmp4 were absent in the AER, Msx2 was not expressed in this tissue but was still p resent in the mesenchyme. In both E11.5 (C and D) and E12.5 (E and F), lower amounts of Msx2 was present in the limb mesenchyme upon removal of Bmp2 and Bmp4 (G, H) Distal Gremlin expression in the limb mesenchyme was reduced in E10.5 hindlimb buds in w hich Bmp2 and Bmp4 were removed from the AER. Proximal expression was not altered. Lines indicate the distance from the AER to distal limit of Gremlin expression. (I K) Bmp ligands expressed in the AER are required for regulating cell proliferation in th e underlying mesenchyme. Removal of both alleles of Bmp2 and Bmp4 resulted in an increase in cell proliferation (compare I and J). Images shown are transverse sections of the distal end of an E10.5 limb bud. (K) Quantification of the number of anti phos pohistone H3 positive cells demonstrated that there was a significant increase in the number of proliferating cells in double mutant limbs (*p value = 0.002). Reprinted with permission from In the limb AER Bmp2 and Bmp4 are required for dorsal ventral pat terning and interdigital cell death but not limb outgrowth Maatouk DM, Choi KS, Bouldin CM, Harfe BD ; Copyright 2009 Dev Biol.

PAGE 88

88 Figure 5 5. Continued

PAGE 89

89 Figure 5 6. Anterior expansion of Hox genes but not Hedeghog signaling occ urs in the limb mesenchyme upon removal of Bmp2 and Bmp4 from the AER. Hoxa13 and Hoxd11 13 expression was expanded in the anterior of E11.5 (A H) and E12.5 (I L) limb buds in which both Bmp2 and Bmp4 were removed from the AER (arrowheads). Expression of Shh (M, N) and the Hedgehog target gene Ptch1 (O, P) were not altered upon removal of Bmp2 and Bmp4 from the AER. All images shown are of hindlimbs. Reprinted with permission from In the limb AER Bmp2 and Bmp4 are required for dorsal ventral patterning an d interdigital cell death but not limb outgrowth Maatouk DM, Choi KS, Bouldin CM, Harfe BD ; Copyright 2009 Dev Biol.

PAGE 90

90 Figure 5 7. Bmp ligands expressed in the AER are required for dorsal ventral patterning. (A) En1 is expre ssed in the AER of E11.5 hindlimb buds. (B) Upon removal of both Bmp2 and Bmp4 from the AER, En1 expression was abolished in the AER of E11.5 limb buds. (C, D) Lmx1b a gene expressed only in the dorsal mesoderm, was ectopically expressed in the ventral mesoderm in double mutant limbs (arrows in D). A E11.5 hindlimb buds. (E, F) The positions of tendons, a ventral mesodermal structure, were not altered in double mutants. Transverse section through an E15.5 limb is shown. vt=ventra l tendon. (G, H) Sagittal section of a one month old limb showing the presence of an ectopic nail plate (n) on the ventral side of a limb in which Bmp2 and Bmp4 were removed from the AER. Reprinted with permission from In the limb AER Bmp2 and Bmp4 are re quired for dorsal ventral patterning and interdigital cell death but not limb outgrowth Maatouk DM, Choi KS, Bouldin CM, Harfe BD ; Copyright 2009 Dev Biol.

PAGE 91

91 Figure 5 8. Model: Proposed role of BMP ligands in the AER. (A) In wild type limb buds Bmp2 and Bmp4 expressed in the AER activate the Bmp signaling pathway through the Bmp receptor Bmpr1a cell autonomously. Activation of this pathway results in En1 and Msx2 expression in the AER. (B) Removal of Bmp2 and Bmp4 from the AER results in loss of En1 and Msx2 expression which causes a failure in AER maturation leading to an expanded AER in both the dorsal ventral and anterior/posterior directions. The expanded AER expresses Fgf genes at elevated levels leading to a decrease in distal Gremlin ex pression, a decrease in cell death and an increase in cell proliferation in the underlying mesenchyme. In the mesenchyme the BMP signaling pathway is still functional upon AER Bmp removal. Model shows to regression of distal Gremlin expression ( Verheyden and Sun, 2008 ) See text for additional details. Reprinted with permission from In the limb AER Bmp2 and Bmp4 are required for dorsal ventral patterning and i nterdigital cell death but not limb outgrowth Maatouk DM, Choi KS, Bouldin CM, Harfe BD ; Copyright 2009 Dev Biol.

PAGE 92

92 Figure 5 8. Continued Figure 5 9. Bmp expression in the mesenchyme is not altered in the double mutants. In E13.5 limbs, Bmp2 (A, B), Bmp4 (C, D) and Bmp7 (E, F) were expressed in the interdigital tissue in double mutants. Reprinted with permission from In the limb AER Bmp2 and Bmp4 are required for dorsal ventral patterning and interdigital cell death but not limb outgrowth Maatouk DM, Choi KS, Bouldin CM, Harfe BD ; Copyright 2009 Dev Biol.

PAGE 93

93 CHAPTER 6 CONCLUDING REMARKS This study investigated how signaling molecules control morphogenesis of the intervertebral disc and vertebrate limb. In Chapter 3 we demonstr ated that the entire nucleus pulposus originates from the embryonic notochord. Prior to this study, the origin of nucleus pulposus was under debate. To address this question, we generated a fate map of notochord cells using the Shhcre allele and R26R rep orter allele and confirmed that the notochord gives rise to the entire nucleus pulposus during embryogenesis. To determine if the adult nucleus pulposus was derived from the embryonic notochord we fate mapped notochord cells using the Shhcre allele and ex amined reporter expression in skeletally mature animals. From our data we concluded that mature nucleus pulposus cells (chondrocyte like cells) are derived from the embryonic notochord but not from the surrounding mesenchyme. It is important to note that not all notochord cells give rise to the nucleus pulposus. Some notochord cells that did not end up in the nucleus pulposus formed notochordal remnants (Chapter 3). These notochordal remnants were first found during the transition from the notochord to n ucleus pulposus. Most notochordal remnants underwent apoptosis but some of them persisted throughout life. A rare tumor called chordoma is thought to arise from these notochordal remnants. Although it is unclear how notochordal remnants cause chordoma, the identification of notochordal remnants in mice might make it possible to generate a mouse model for the study of chordoma in vivo In addition to fate mapping notochord cells, we determined the role hedgehog signaling plays in the formation of interver tebral discs (Chapter 4). We genetically

PAGE 94

94 abolished Smoothened (Smo) from all Shh expressing cells and demonstrated that hedgehog signaling from the notochord was required for the formation of the notochord sheath. The notochord sheath is essential for mai ntaining the rod like structure of the notochord. Moreover, the notochord sheath might support the structure of notochord from swelling pressure from vertebral bodies and internal swelling pressure from vacuolization of cells located within the notochord. We also investigated the temporal role of Shh signaling during the formation of the intervertebral disc (Chapter 4) by removing Shh signaling at different time points. We propose that Shh signaling regulates the formation of the intervertebral disc in t wo phases. Initially, Shh signaling regulates the formation of the notochord sheath in order to maintain the structure of the notochord. The later, second phase of Shh signaling indirectly regulates the migration of notochord cells into the forming. Our data cannot exclude the possibility that hedgehog signaling regulates unknown pathways that are responsible for the migration of notochord cells into intervertebral regions. In addition to intervertebral disc development, we investigated the role of BMP signaling in the AER (Chapter 5). Bmp2, Bmp4 and Bmp7 are expressed in the AER. Removal of individual Bmps did not show defects in limb patterning suggesting that individual BMP proteins may play partially redundant roles during limb development. To in vestigate the role of Bmp2 and Bmp4 we genetically removed Bmp2 and Bmp4 in the AER. Our result showed that Bmp2 and Bmp4 are required for normal cell proliferation in the mesenchyme, normal cell death in the interdigital region and dorsoventral boundary formation in the limb. However, Bmp2 and Bmp4 signaling are not required

PAGE 95

95 for limb outgrowth. It is possible that Bmp7 might compensate for loss of Bmp2 and Bmp4 expression in the AER. In this work we have identified and characterized signaling molecules that play essential roles during patterning of the intervertebral discs and limbs. Knowledge of the role hedgehog signaling and Bmp signaling play in the formation of these structures will allow us to begin to understand that signaling pathways required for formation of these structures during normal development. This is a required first step for developing therapies to heal damaged discs and limbs.

PAGE 96

96 APPENDIX A OLIGONUCLEOTIDES USED AS GENOTYPING PRIMERS Table A 1. Oligonucleotides used as genotyping primers. Allele Name Sequence Bmp2 Bmp2 F 5' GTGTGGTCCACCGCATCAC Bmp2 Bmp2 R 5' TGCCATCATCACTTCCTGAC Bmp4 Bmp4 F 5' AGACTCTTTAGTGAGCATTTTCAAC Bmp4 Bmp4 R 5' AGCCCAATTTCCACAACTTC Bmp7 Bmp7 wt F 5' ACCCCAGGTCAAGACACCAAA Bmp7 Bmp7 wt R 5' AGGCGCTGAATTGTCAGCTA Bmp7 Bmp7 floxed R 5' CAGCAGCCTCTGTTCCACATACAC Cre Cre F 5' TGACGGTGGGAGAATGTTAAT Cre Cre R 5' GCCGTAAATCAATCGATGAGT Eyfp Eyfp wt F 5' GGAGCGGGAGAAATGGATATG Eyfp Eyfp wt R 5' AAAGTCGCTCTGAGTTGTTAT Eyfp Eyfp mutant R 5' AA GACCGCGAAGAGTTTGTC Msx2cre Msx2cre F 5' AACATCTTCAGGTTCTGCGG Msx2cre Msx2cre R 5' GACTTTTCAGTTTGGGCG R26R R26R wt F 5' AAAGTCGCTCTGAGTTGTTAT R26R R26R wt R 5' GGAGCGGGAGAAATGGATATG R26R R26R mutant R 5' GCGAAGAGTTTGTCCTCAACC Shh Shh floxed F 5' ATGCT GGCTCGCCTGGCTGTGGAA Shh Shh floxed R 5' GAAGAGATCAAGGCAAGCTCTGGC Smo Smo wt F 5' CCACTGCGAGCCTTTGCGCTAC Smo Smo wt R 5' CCCATCACCTCCGCGTCGCA Smo Smo floxed F ATGGCCGCTGGCCGCCCCGTG Smo Smo floxed R 5' GGCGCTACCGGTGGATGTGG

PAGE 97

97 APPENDIX B PROBES USED FOR RNA IN SITU HYBRIDIZATION Table B 1. Probes used for RNA in situ hybridization. Gene name Plasmid number Restriction enzyme Antisense polymeras e Bmp2 BH63 SacII SP6 Bmp2 BH219 XbaI T3 Bmp4 BH62 HindIII T7 Bmp7 BH33 HindIII T7 En1 BH213 ClaI T7 Fgf4 BH144 BamHI T3 Fgf8 BH61 PstI T7 Gremlin BH75 PstI T3 Hoxa13 Bh84 NcoI SP6 Hoxd11 Bh143 SalI T7 Hoxd12 BH172 BamHI T7 Hoxd13 BH216 XhoI Sp 6 Lmx1b BH71 HindIII T3 Msx2 Bh215 BamHI T7 Pax1 BH264 T7 T3 PCR T3 Pax3 BH259 T7 T3 PCR T7 Ptch1 BH141 BamHI T3 Shh BH39 HindIII T3 Shh exon2 BH271 HindIII T7

PAGE 98

98 LIST OF REFERENCES Adams, D. S., Keller, R. and Koehl, M. A. (1990) 'The mechanics of notochord elongation, straightening and stiffening in the embryo of Xenopus laevis', Development 110(1): 115 30. Adams, M. A. and Roughley, P. J. (2006) 'What is intervertebral disc degeneration, and what causes it?', Spine (Phila Pa 1976) 31(18): 2151 61. Aguiar, D. J., Johnson, S. L. and Oegema, T. R. (1999) 'Notochordal cells interact with nucleus pulposus cells: regulation of proteoglycan synthesis', Exp Cell Res 246(1): 129 37. Ahn, K., Mishina, Y., Hanks, M. C., Behri nger, R. R. and Crenshaw, E. B., 3rd (2001) 'BMPR IA signaling is required for the formation of the apical ectodermal ridge and dorsal ventral patterning of the limb', Development 128(22): 4449 61. Alini, M., Eisenstein, S. M., Ito, K., Little, C., Kettle r, A. A., Masuda, K., Melrose, J., Ralphs, J., Stokes, I. and Wilke, H. J. (2008) 'Are animal models useful for studying human disc disorders/degeneration?', Eur Spine J 17(1): 2 19. Ang, S. L. and Rossant, J. (1994) 'HNF 3 beta is essential for node and notochord formation in mouse development', Cell 78(4): 561 74. Aszodi, A., Chan, D., Hunziker, E., Bateman, J. F. and Fassler, R. (1998) 'Collagen II is essential for the removal of the notochord and the formation of intervertebral discs', J Cell Biol 143 (5): 1399 412. Bagnall, K. M., Higgins, S. J. and Sanders, E. J. (1988) 'The contribution made by a single somite to the vertebral column: experimental evidence in support of resegmentation using the chick quail chimaera model', Development 103(1): 69 85. Bandyopadhyay, A., Tsuji, K., Cox, K., Harfe, B. D., Rosen, V. and Tabin, C. J. (2006) 'Genetic analysis of the roles of BMP2, BMP4, and BMP7 in limb patterning and skeletogenesis', PLoS Genet 2(12): e216. Boulet, A. M., Moon, A. M., Arenkiel, B. R. and Capecchi, M. R. (2004) 'The roles of Fgf4 and Fgf8 in limb bud initiation and outgrowth', Dev Biol 273(2): 361 72. Britto, J., Tannahill, D. and Keynes, R. (2002) 'A critical role for sonic hedgehog signaling in the early expansion of the developing brai n', Nat Neurosci 5(2): 103 10. Camon, J., Degollada, E. and Verdu, J. (1990) 'Ultrastructural aspects of the production of extracellular matrix components by the chick embryonic notochord in vitro', Acta Anat (Basel) 137(2): 114 23.

PAGE 99

99 Chang, W., Lin, Z., K ulessa, H., Hebert, J., Hogan, B. L. and Wu, D. K. (2008) 'Bmp4 is essential for the formation of the vestibular apparatus that detects angular head movements', PLoS Genet 4(4): e1000050. Chen, H., Lun, Y., Ovchinnikov, D., Kokubo, H., Oberg, K. C., Pepic elli, C. V., Gan, L., Lee, B. and Johnson, R. L. (1998) 'Limb and kidney defects in Lmx1b mutant mice suggest an involvement of LMX1B in human nail patella syndrome', Nat Genet 19(1): 51 5. Chi, C. L., Martinez, S., Wurst, W. and Martin, G. R. (2003) 'The isthmic organizer signal FGF8 is required for cell survival in the prospective midbrain and cerebellum', Development 130(12): 2633 44. Chiang, C., Litingtung, Y., Harris, M. P., Simandl, B. K., Li, Y., Beachy, P. A. and Fallon, J. F. (2001) 'Manifestatio n of the limb prepattern: limb development in the absence of sonic hedgehog function', Dev Biol 236(2): 421 35. Chiang, C., Litingtung, Y., Lee, E., Young, K. E., Corden, J. L., Westphal, H. and Beachy, P. A. (1996) 'Cyclopia and defective axial patternin g in mice lacking Sonic hedgehog gene function', Nature 383(6599): 407 13. Choi, K. S., Cohn, M. J. and Harfe, B. D. (2008) 'Identification of nucleus pulposus precursor cells and notochordal remnants in the mouse: implications for disk degeneration and c hordoma formation', Dev Dyn 237(12): 3953 8. Choi, K. S. and Harfe, B. D. (2011) 'Hedgehog signaling is required for formation of the notochord sheath and patterning of nuclei pulposi within the intervertebral discs', Proc Natl Acad Sci U S A 108(23): 948 4 9. Dahia, C. L., Mahoney, E. J., Durrani, A. A. and Wylie, C. (2009) 'Intercellular signaling pathways active during intervertebral disc growth, differentiation, and aging', Spine 34(5): 456 62. Dassule, H. R., Lewis, P., Bei, M., Maas, R. and McMahon, A. P. (2000) 'Sonic hedgehog regulates growth and morphogenesis of the tooth', Development 127(22): 4775 85. Deutsch, U., Dressler, G. R. and Gruss, P. (1988) 'Pax 1, a member of a paired box homologous murine gene family, is expressed in segmented struc tures during development', Cell 53(4): 617 25. Dietrich, S., Schubert, F. R. and Gruss, P. (1993) 'Altered Pax gene expression in murine notochord mutants: the notochord is required to initiate and maintain ventral identity in the somite', Mech Dev 44(2 3 ): 189 207

PAGE 100

100 DiPaola, C. P., Farmer, J. C., Manova, K. and Niswander, L. A. (2005) 'Molecular signaling in intervertebral disk development', J Orthop Res 23(5): 1112 9. Dudley, A. T. and Robertson, E. J. (1997) 'Overlapping expression domains of bone morph ogenetic protein family members potentially account for limited tissue defects in BMP7 deficient embryos', Dev Dyn 208(3): 349 62. Duprez, D., Fournier Thibault, C. and Le Douarin, N. (1998) 'Sonic Hedgehog induces proliferation of committed skeletal musc le cells in the chick limb', Development 125(3): 495 505. Ellis, E. A. (2006) 'Solutions to the Problem of Substitution of ERL 4221 for Vinyl Cyclohexene Dioxide in Spurr Low Viscosity Embedding Formulations.', Microscopy Today 14(4): 32 33. Enomoto, A., Yoshida, A., Harada, T., Maita, K. and Shirasu, Y. (1986) 'Chordoma like tumor in the tail of a mouse', Nippon Juigaku Zasshi 48(4): 845 9. Fan, C. M. and Tessier Lavigne, M. (1994) 'Patterning of mammalian somites by surface ectoderm and notochord: evid ence for sclerotome induction by a hedgehog homolog', Cell 79(7): 1175 86. Fan, H., Oro, A. E., Scott, M. P. and Khavari, P. A. (1997) 'Induction of basal cell carcinoma features in transgenic human skin expressing Sonic Hedgehog', Nat Med 3(7): 788 92. Goodrich, L. V., Milenkovic, L., Higgins, K. M. and Scott, M. P. (1997) 'Altered neural cell fates and medulloblastoma in mouse patched mutants', Science 277(5329): 1109 13. Gotz, W., Osmers, R. and Herken, R. (1995) 'Localisation of extracellular matrix components in the embryonic human notochord and axial mesenchyme', J Anat 186 ( Pt 1): 111 21. Goulding, M. D., Chalepakis, G., Deutsch, U., Erselius, J. R. and Gruss, P. (1991) 'Pax 3, a novel murine DNA binding protein expressed during early neurogenesi s', Embo J 10(5): 1135 47. Hallor, K. H., Staaf, J., Jonsson, G., Heidenblad, M., Vult von Steyern, F., Bauer, H. C., Ijszenga, M., Hogendoorn, P. C., Mandahl, N., Szuhai, K. et al. (2008) 'Frequent deletion of the CDKN2A locus in chordoma: analysis of ch romosomal imbalances using array comparative genomic hybridisation', Br J Cancer 98(2): 434 42. Harfe, B. D., Scherz, P. J., Nissim, S., Tian, H., McMahon, A. P. and Tabin, C. J. (2004) 'Evidence for an expansion based temporal Shh gradient in specifying vertebrate digit identities', Cell 118(4): 517 28.

PAGE 101

101 Hayashi, S. and McMahon, A. P. (2002) 'Efficient recombination in diverse tissues by a tamoxifen inducible form of Cre: a tool for temporally regulated gene activation/inactivation in the mouse', Dev Biol 244(2): 305 18. Herrmann, B. G., Labeit, S., Poustka, A., King, T. R. and Lehrach, H. (1990) 'Cloning of the T gene required in mesoderm formation in the mouse', Nature 343(6259): 617 22. Higuchi, M., Kaneda, K. and Abe, K. (1982) 'Age related changes i n the nucleus pulposus of intervertebral disc in mice. An electronmicroscopic study', Nippon Seikeigeka Gakkai Zasshi 56(4): 321 9. Huang, R., Zhi, Q., Brand Saberi, B. and Christ, B. (2000) 'New experimental evidence for somite resegmentation', Anat Embr yol (Berl) 202(3): 195 200. Humzah, M. D. and Soames, R. W. (1988) 'Human intervertebral disc: structure and function', Anat Rec 220(4): 337 56. Hunter, C. J., Matyas, J. R. and Duncan, N. A. (2003a) 'The notochordal cell in the nucleus pulposus: a revie w in the context of tissue engineering', Tissue Eng 9(4): 667 77. Hunter, C. J., Matyas, J. R. and Duncan, N. A. (2003b) 'The three dimensional architecture of the notochordal nucleus pulposus: novel observations on cell structures in the canine intervert ebral disc', J Anat 202(Pt 3): 279 91. Ingham, P. W. and McMahon, A. P. (2001) 'Hedgehog signaling in animal development: paradigms and principles', Genes Dev 15(23): 3059 87. Jensen, A. M. and Wallace, V. A. (1997) 'Expression of Sonic hedgehog and its putative role as a precursor cell mitogen in the developing mouse retina', Development 124(2): 363 71. Jeong, Y. and Epstein, D. J. (2003) 'Distinct regulators of Shh transcription in the floor plate and notochord indicate separate origins for these tissu es in the mouse node', Development 130(16): 3891 902. Johnson, R. L., Laufer, E., Riddle, R. D. and Tabin, C. (1994) 'Ectopic expression of Sonic hedgehog alters dorsal ventral patterning of somites', Cell 79(7): 1165 73. Joyner, A. L. and Martin, G. R. (1987) 'En 1 and En 2, two mouse genes with sequence homology to the Drosophila engrailed gene: expression during embryogenesis', Genes Dev 1(1): 29 38.

PAGE 102

102 Karp, S. J., Schipani, E., St Jacques, B., Hunzelman, J., Kronenberg, H. and McMahon, A. P. (2000) 'Indian hedgehog coordinates endochondral bone growth and morphogenesis via parathyroid hormone related protein dependent and independent pathways', Development 127(3): 543 8. Katz, J. N. (2006) 'Lumbar disc disorders and low back pain: socioeconomic fac tors and consequences', J Bone Joint Surg Am 88 Suppl 2: 21 4. Kelley, M. J., Korczak, J. F., Sheridan, E., Yang, X., Goldstein, A. M. and Parry, D. M. (2001) 'Familial chordoma, a tumor of notochordal remnants, is linked to chromosome 7q33', Am J Hum Gen et 69(2): 454 60. Kim, K. W., Lim, T. H., Kim, J. G., Jeong, S. T., Masuda, K. and An, H. S. (2003) 'The origin of chondrocytes in the nucleus pulposus and histologic findings associated with the transition of a notochordal nucleus pulposus to a fibrocart ilaginous nucleus pulposus in intact rabbit intervertebral discs', Spine (Phila Pa 1976) 28(10): 982 90. Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995) 'Stages of embryonic development of the zebrafish', Dev Dyn 203( 3): 253 310. Kulessa, H. and Hogan, B. L. (2002) 'Generation of a loxP flanked bmp4loxP lacZ allele marked by conditional lacZ expression', Genesis 32(2): 66 8. Kuro o, M., Matsumura, Y., Aizawa, H., Kawaguchi, H., Suga, T., Utsugi, T., Ohyama, Y., Kurab ayashi, M., Kaname, T., Kume, E. et al. (1997) 'Mutation of the mouse klotho gene leads to a syndrome resembling ageing', Nature 390(6655): 45 51. Lee Jones, L., Aligianis, I., Davies, P. A., Puga, A., Farndon, P. A., Stemmer Rachamimov, A., Ramesh, V. an d Sampson, J. R. (2004) 'Sacrococcygeal chordomas in patients with tuberous sclerosis complex show somatic loss of TSC1 or TSC2', Genes Chromosomes Cancer 41(1): 80 5. Lettice, L. A., Purdie, L. A., Carlson, G. J., Kilanowski, F., Dorin, J. and Hill, R. E (1999) 'The mouse bagpipe gene controls development of axial skeleton, skull, and spleen', Proc Natl Acad Sci U S A 96(17): 9695 700. Lewandoski, M., Sun, X. and Martin, G. R. (2000) 'Fgf8 signalling from the AER is essential for normal limb development ', Nat Genet 26(4): 460 3. Long, F., Zhang, X. M., Karp, S., Yang, Y. and McMahon, A. P. (2001) 'Genetic manipulation of hedgehog signaling in the endochondral skeleton reveals a direct role in the regulation of chondrocyte proliferation', Development 128 (24): 5099 108. Loomis, C. A., Harris, E., Michaud, J., Wurst, W., Hanks, M. and Joyner, A. L. (1996) 'The mouse Engrailed 1 gene and ventral limb patterning', Nature 382(6589): 360 3.

PAGE 103

103 Loomis, C. A., Kimmel, R. A., Tong, C. X., Michaud, J. and Joyner, A. L. (1998) 'Analysis of the genetic pathway leading to formation of ectopic apical ectodermal ridges in mouse Engrailed 1 mutant limbs', Development 125(6): 1137 48. Maatouk, D. M., Choi, K. S., Bouldin, C. M. and Harfe, B. D. (2009) 'In the limb AER Bmp2 and Bmp4 are required for dorsal ventral patterning and interdigital cell death but not limb outgrowth', Dev Biol 327(2): 516 23. Maeda, Y., Nakamura, E., Nguyen, M. T., Suva, L. J., Swain, F. L., Razzaque, M. S., Mackem, S. and Lanske, B. (2007) 'Indian Hedgehog produced by postnatal chondrocytes is essential for maintaining a growth plate and trabecular bone', Proc Natl Acad Sci U S A 104(15): 6382 7. Maldonado, B. A. and Oegema, T. R., Jr. (1992) 'Initial characterization of the metabolism of interver tebral disc cells encapsulated in microspheres', J Orthop Res 10(5): 677 90. Marazzi, G., Wang, Y. and Sassoon, D. (1997) 'Msx2 is a transcriptional regulator in the BMP4 mediated programmed cell death pathway', Dev Biol 186(2): 127 38. Mariani, F. V., A hn, C. P. and Martin, G. R. (2008) 'Genetic evidence that FGFs have an instructive role in limb proximal distal patterning', Nature 453(7193): 401 5. Marigo, V., Roberts, D. J., Lee, S. M., Tsukurov, O., Levi, T., Gastier, J. M., Epstein, D. J., Gilbert, D. J., Copeland, N. G., Seidman, C. E. et al. (1995) 'Cloning, expression, and chromosomal location of SHH and IHH: two human homologues of the Drosophila segment polarity gene hedgehog', Genomics 28(1): 44 51. Marti, E., Takada, R., Bumcrot, D. A., Sasak i, H. and McMahon, A. P. (1995) 'Distribution of Sonic hedgehog peptides in the developing chick and mouse embryo', Development 121(8): 2537 47. McMahon, A. P., Ingham, P. W. and Tabin, C. J. (2003) 'Developmental roles and clinical significance of hedgeh og signaling', Curr Top Dev Biol 53: 1 114. McMaster, M. L., Goldstein, A. M., Bromley, C. M., Ishibe, N. and Parry, D. M. (2001) 'Chordoma: incidence and survival patterns in the United States, 1973 1995', Cancer Causes Control 12(1): 1 11. Mendenhall, W. M., Mendenhall, C. M., Lewis, S. B., Villaret, D. B. and Mendenhall, N. P. (2005) 'Skull base chordoma', Head Neck 27(2): 159 65. Murtaugh, L. C., Chyung, J. H. and Lassar, A. B. (1999) 'Sonic hedgehog promotes somitic chondrogenesis by altering the ce llular response to BMP signaling', Genes Dev 13(2): 225 37.

PAGE 104

104 Niswander, L., Jeffrey, S., Martin, G. R. and Tickle, C. (1994) 'A positive feedback loop coordinates growth and patterning in the vertebrate limb', Nature 371(6498): 609 12. Ovchinnikov, D. A., Selever, J., Wang, Y., Chen, Y. T., Mishina, Y., Martin, J. F. and Behringer, R. R. (2006) 'BMP receptor type IA in limb bud mesenchyme regulates distal outgrowth and patterning', Dev Biol 295(1): 103 15. Paavola, L. G., Wilson, D. B. and Center, E. M. ( 1980) 'Histochemistry of the developing notochord, perichordal sheath and vertebrae in Danforth's short tail (sd) and normal C57BL/6 mice', J Embryol Exp Morphol 55: 227 45. Pajni Underwood, S., Wilson, C. P., Elder, C., Mishina, Y. and Lewandoski, M. (20 07) 'BMP signals control limb bud interdigital programmed cell death by regulating FGF signaling', Development 134(12): 2359 68. Panman, L., Galli, A., Lagarde, N., Michos, O., Soete, G., Zuniga, A. and Zeller, R. (2006) 'Differential regulation of gene e xpression in the digit forming area of the mouse limb bud by SHH and gremlin 1/FGF mediated epithelial mesenchymal signalling', Development 133(17): 3419 28. Panman, L. and Zeller, R. (2003) 'Patterning the limb before and after SHH signalling', J Anat 20 2(1): 3 12. Parr, B. A. and McMahon, A. P. (1995) 'Dorsalizing signal Wnt 7a required for normal polarity of D V and A P axes of mouse limb', Nature 374(6520): 350 3. Parsons, M. J., Pollard, S. M., Saude, L., Feldman, B., Coutinho, P., Hirst, E. M. and Stemple, D. L. (2002) 'Zebrafish mutants identify an essential role for laminins in notochord formation', Development 129(13): 3137 46. Perriton, C. L., Powles, N., Chiang, C., Maconochie, M. K. and Cohn, M. J. (2002) 'Sonic hedgehog signaling from the ur ethral epithelium controls external genital development', Dev Biol 247(1): 26 46. Peters, H., Wilm, B., Sakai, N., Imai, K., Maas, R. and Balling, R. (1999) 'Pax1 and Pax9 synergistically regulate vertebral column development', Development 126(23): 5399 4 08. Pignolo, R. J., Suda, R. K., McMillan, E. A., Shen, J., Lee, S. H., Choi, Y., Wright, A. C. and Johnson, F. B. (2008) 'Defects in telomere maintenance molecules impair osteoblast differentiation and promote osteoporosis', Aging Cell 7(1): 23 31. Pize tte, S., Abate Shen, C. and Niswander, L. (2001) 'BMP controls proximodistal outgrowth, via induction of the apical ectodermal ridge, and dorsoventral patterning in the vertebrate limb', Development 128(22): 4463 74.

PAGE 105

105 Placzek, M. (1995) 'The role of the no tochord and floor plate in inductive interactions', Curr Opin Genet Dev 5(4): 499 506. Plikus, M., Wang, W. P., Liu, J., Wang, X., Jiang, T. X. and Chuong, C. M. (2004) 'Morpho regulation of ectodermal organs: integument pathology and phenotypic variation s in K14 Noggin engineered mice through modulation of bone morphogenic protein pathway', Am J Pathol 164(3): 1099 114. Pope, M. H. (1997) Occupational hazards for low back pain. in J. W. Frymoyer (ed.) The adult spine Philadelphia, PA: Lippincott. Praem er, A. P., Furner, S., and Rice, D.P. (1992) Musculoskeletal conditions in the United States. : American Academy of Orthoscopic Surgery. Riddle, R. D., Ensini, M., Nelson, C., Tsuchida, T., Jessell, T. M. and Tabin, C. (1995) 'Induction of the LIM homeobox gene Lmx1 by WNT7a establishes dorsoventral pattern in the vertebrate limb', Cell 83(4): 631 40. Riddle, R. D., Johnson, R. L., Laufer, E. and Tabin, C. (1993) 'Sonic hedgehog mediates the polarizing activity of the ZPA', Cell 75(7): 1401 16. Robert, B. (2007) 'Bone morphogenetic protein signaling in limb outgrowth and patterning', Dev Growth Differ 49(6): 455 68. Rufai, A., Benjamin, M. and Ralphs, J. R. (1995) 'The development of fibrocartilage in the rat intervertebral disc', Anat Embryol (Berl) 192( 1): 53 62. Sanz Ezquerro, J. J. and Tickle, C. (2003) 'Fgf signaling controls the number of phalanges and tip formation in developing digits', Curr Biol 13(20): 1830 6. Satokata, I., Ma, L., Ohshima, H., Bei, M., Woo, I., Nishizawa, K., Maeda, T., Takano Y., Uchiyama, M., Heaney, S. et al. (2000) 'Msx2 deficiency in mice causes pleiotropic defects in bone growth and ectodermal organ formation', Nat Genet 24(4): 391 5. Saunders and Gasseling (1968) Ectodermal mesodermal interactions in the origin of limb symmetry Baltimore: Willilams &Wilkins. Scheil, S., Bruderlein, S., Liehr, T., Starke, H., Herms, J., Schulte, M. and Moller, P. (2001) 'Genome wide analysis of sixteen chordomas by comparative genomic hybridization and cytogenetics of the first human c hordoma cell line, U CH1', Genes Chromosomes Cancer 32(3): 203 11. Scherz, P. J., Harfe, B. D., McMahon, A. P. and Tabin, C. J. (2004) 'The limb bud Shh Fgf feedback loop is terminated by expansion of former ZPA cells', Science 305(5682): 396 9.

PAGE 106

106 Seifert, A. W., Harfe, B. D. and Cohn, M. J. (2008) 'Cell lineage analysis demonstrates an endodermal origin of the distal urethra and perineum', Dev Biol 318(1): 143 52. Selever, J., Liu, W., Lu, M. F., Behringer, R. R. and Martin, J. F. (2004) 'Bmp4 in limb bud mesoderm regulates digit pattern by controlling AER development', Dev Biol 276(2): 268 79. Setton, L. A. and Chen, J. (2006) 'Mechanobiology of the intervertebral disc and relevance to disc degeneration', J Bone Joint Surg Am 88 Suppl 2: 52 7. Shore, E. M., Xu, M., Shah, P. B., Janoff, H. B., Hahn, G. V., Deardorff, M. A., Sovinsky, L., Spinner, N. B., Zasloff, M. A., Wozney, J. M. et al. (1998) 'The human bone morphogenetic protein 4 (BMP 4) gene: molecular structure and transcriptional regulation', Cal cif Tissue Int 63(3): 221 9. Smits, P. and Lefebvre, V. (2003) 'Sox5 and Sox6 are required for notochord extracellular matrix sheath formation, notochord cell survival and development of the nucleus pulposus of intervertebral discs', Development 130(6): 1 135 48. Soriano, P. (1999) 'Generalized lacZ expression with the ROSA26 Cre reporter strain', Nat Genet 21(1): 70 1. Soshnikova, N., Zechner, D., Huelsken, J., Mishina, Y., Behringer, R. R., Taketo, M. M., Crenshaw, E. B., 3rd and Birchmeier, W. (2003) Genetic interaction between Wnt/beta catenin and BMP receptor signaling during formation of the AER and the dorsal ventral axis in the limb', Genes Dev 17(16): 1963 8. Srinivas, S., Watanabe, T., Lin, C. S., William, C. M., Tanabe, Y., Jessell, T. M. and Costantini, F. (2001) 'Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus', BMC Dev Biol 1(1): 4. Stemple, D. L. (2005) 'Structure and function of the notochord: an essential organ for chordate development', Develop ment 132(11): 2503 12. Stevens, J. W., Kurriger, G. L., Carter, A. S. and Maynard, J. A. (2000) 'CD44 expression in the developing and growing rat intervertebral disc', Dev Dyn 219(3): 381 90. Sun, X., Lewandoski, M., Meyers, E. N., Liu, Y. H., Maxson, R E., Jr. and Martin, G. R. (2000) 'Conditional inactivation of Fgf4 reveals complexity of signalling during limb bud development', Nat Genet 25(1): 83 6. Sun, X., Mariani, F. V. and Martin, G. R. (2002) 'Functions of FGF signalling from the apical ectode rmal ridge in limb development', Nature 418(6897): 501 8.

PAGE 107

107 Theiler, K. (1988) 'Vertebral malformations', Adv Anat Embryol Cell Biol 112: 1 99. Tickle, C. (2003) 'Patterning systems -from one end of the limb to the other', Dev Cell 4(4): 449 58. Tsuji, K., Bandyopadhyay, A., Harfe, B. D., Cox, K., Kakar, S., Gerstenfeld, L., Einhorn, T., Tabin, C. J. and Rosen, V. (2006) 'BMP2 activity, although dispensable for bone formation, is required for the initiation of fracture healing', Nat Genet 38(12): 1424 9. U rban, J. P. and McMullin, J. F. (1988) 'Swelling pressure of the lumbar intervertebral discs: influence of age, spinal level, composition, and degeneration', Spine 13(2): 179 87. Urban, J. P., Smith, S. and Fairbank, J. C. (2004) 'Nutrition of the interve rtebral disc', Spine (Phila Pa 1976) 29(23): 2700 9. Verheyden, J. M. and Sun, X. (2008) 'An Fgf/Gremlin inhibitory feedback loop triggers termination of limb bud outgrowth', Nature 454(7204): 638 41. Vogel, A., Rodriguez, C., Warnken, W. and Izpisua Bel monte, J. C. (1995) 'Dorsal cell fate specified by chick Lmx1 during vertebrate limb development', Nature 378(6558): 716 20. Vujovic, S., Henderson, S., Presneau, N., Odell, E., Jacques, T. S., Tirabosco, R., Boshoff, C. and Flanagan, A. M. (2006) 'Brachy ury, a crucial regulator of notochordal development, is a novel biomarker for chordomas', J Pathol 209(2): 157 65. Wallin, J., Wilting, J., Koseki, H., Fritsch, R., Christ, B. and Balling, R. (1994) 'The role of Pax 1 in axial skeleton development', Devel opment 120(5): 1109 21. Walmsley, R. (1953) 'The development and growth of the intervertebral disc', Edinb Med J 60(8): 341 64. Wang, C. K., Omi, M., Ferrari, D., Cheng, H. C., Lizarraga, G., Chin, H. J., Upholt, W. B., Dealy, C. N. and Kosher, R. A. (20 04) 'Function of BMPs in the apical ectoderm of the developing mouse limb', Dev Biol 269(1): 109 22. Weinstein, D. C., Ruiz i Altaba, A., Chen, W. S., Hoodless, P., Prezioso, V. R., Jessell, T. M. and Darnell, J. E., Jr. (1994) 'The winged helix transcrip tion factor HNF 3 beta is required for notochord development in the mouse embryo', Cell 78(4): 575 88. Wilkinson, D. G. (1992) Whole mount in situ hybridization to vertebrate embryos. in D. G. Wilkinson (ed.) In Situ Hybridization: A practical approach. O xford: IRL Press. Winnier, G., Blessing, M., Labosky, P. A. and Hogan, B. L. (1995) 'Bone morphogenetic protein 4 is required for mesoderm formation and patterning in the mouse', Genes Dev 9(17): 2105 16.

PAGE 108

108 Yamaguchi, T., Suzuki, S., Ishiiwa, H. and Ueda, Y. (2004) 'Intraosseous benign notochordal cell tumours: overlooked precursors of classic chordomas?', Histopathology 44(6): 597 602. Yamaguchi, T., Watanabe Ishiiwa, H., Suzuki, S., Igarashi, Y. and Ueda, Y. (2005) 'Incipient chordoma: a report of two ca ses of early stage chordoma arising from benign notochordal cell tumors', Mod Pathol 18(7): 1005 10. Yang, F., Leung, V. Y., Luk, K. D., Chan, D. and Cheung, K. M. (2009a) 'Injury induced sequential transformation of notochordal nucleus pulposus to chondr ogenic and fibrocartilaginous phenotype in the mouse', J Pathol 218(1): 113 21. Yang, X. R., Ng, D., Alcorta, D. A., Liebsch, N. J., Sheridan, E., Li, S., Goldstein, A. M., Parry, D. M. and Kelley, M. J. (2009b) 'T (brachyury) gene duplication confers maj or susceptibility to familial chordoma', Nat Genet 41(11): 1176 8. Yang, Y., Drossopoulou, G., Chuang, P. T., Duprez, D., Marti, E., Bumcrot, D., Vargesson, N., Clarke, J., Niswander, L., McMahon, A. et al. (1997) 'Relationship between dose, distance and time in Sonic Hedgehog mediated regulation of anteroposterior polarity in the chick limb', Development 124(21): 4393 404. Zhang, H. and Bradley, A. (1996) 'Mice deficient for BMP2 are nonviable and have defects in amnion/chorion and cardiac development', Development 122(10): 2977 86. Zhang, X. M., Ramalho Santos, M. and McMahon, A. P. (2001) 'Smoothened mutants reveal redundant roles for Shh and Ihh signaling including regulation of L/R symmetry by the mouse node', Cell 106(2): 781 92. Zhu, J., Nakamura, E., Nguyen, M. T., Bao, X., Akiyama, H. and Mackem, S. (2008) 'Uncoupling Sonic hedgehog control of pattern and expansion of the developing limb bud', Dev Cell 14(4): 624 32. Zou, H. and Niswander, L. (1996) 'Requirement for BMP signaling in interdigital apoptosis and scale formation', Science 272(5262): 738 41.

PAGE 109

109 BIOGRAPHICAL SKETCH Kyung suk Choi was born in Busan, South Korea in 1975. He is the you ngest of the two sons of Byung cook Choi and Young h ee Ahn. He was interested in biology and chemi stry since high school. Kyung s nd interested in developmental biology and stem cell biology. After graduating, he worked for Samsung Biomedical Research Institute in 2005. He then moved to the United S tates to join the Interdisciplinary Program (IDP) in biomedical sciences at the University of Florida, College of Medicine in Gainesville, Florida. During his graduate career, he studied the development of the intervertebral disc and vertebrate limb using genetically modified mice. He received his Ph.D. from the University of Florida in August 2011.