Role of TGF-beta Signaling in the Pathogenesis of Vascular Diseases

MISSING IMAGE

Material Information

Title:
Role of TGF-beta Signaling in the Pathogenesis of Vascular Diseases
Physical Description:
1 online resource (97 p.)
Language:
english
Creator:
Han,Chul
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Physiology and Pharmacology (IDP)
Committee Chair:
Oh, Suk P
Committee Members:
Raizada, Mohan K
Sayeski, Peter P
Terada, Naohiro

Subjects

Subjects / Keywords:
alk1 -- cardiovascular -- genetic -- hht -- hypertension -- pathology -- pulmonary -- smad1 -- tgf -- vascular
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Genetic mutations causing diverse genetic vascular diseases have been found in the genes that encode components of the transforming growth factor-beta (TGF-beta) signaling pathway, suggesting that TGF-beta signaling is essential for homeostasis of the vascular system. To explore the role of TGF-beta signaling in the pathogenesis of a couple of vascular diseases, our laboratory developed genetic mouse models for two major vascular diseases, pulmonary arterial hypertension (PAH) and hereditary hemorrhagic telangiectasia (HHT). PAH is a rare but fatal disease that increases pulmonary pressure due to thickening of pulmonary arterial walls. Although deficiency of bone morphogenetic protein type II receptor (BMPR2) in TGF-beta signaling is known as a genetic contributor, whether dysfunction of SMAD1, one of the canonical transducers of BMPR2 is critical for PAH development remains unknown. We hypothesized that deficiency of SMAD1 would lead to PAH and tested the hypothesis using Smad1-conditional knockout (cKO) mice. The Smad1 gene was deleted in endothelial cells or smooth muscle cells using L1cre and Tagln-cre lines respectively. We discovered that these Smad1-cKO mice develop PAH, suggesting that SMAD1 could be a critical downstream mediator of BMPR2 in PAH. HHT2 is a vascular disease with arteriovenous malformations (AVMs) and visceral hemorrhages due to ALK1 deficiency. Our previous studies showed that wounding plays an essential role in AVM development in the Alk1-deficient context. We investigated the involvement of two major wound-healing responses: inflammation and angiogenesis. We found that either LPS (for inflammation) or VEGF (for angiogenesis) could recapitulate the wound-induced AVM formation in Alk1-deficient skin. The inhibition of angiogenesis with VEGF-neutralizing antibody (Ab) significantly inhibited both LPS- and wound-induced AVMs and ameliorated internal bleedings in Alk1-deficient mice, suggesting a critical role for angiogenic stimulation in AVM development. These data provide a better scientific basis for the therapeutic effect of a VEGF blockade (Bevacizumab) for epistaxis, GI bleeding, and liver AVMs in HHT patients. Our data also demonstrated that the skin AVM model by Alk1-conditional knockout mice is reliable for preclinical screening of drug candidates for epistaxis and GI bleedings.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Chul Han.
Thesis:
Thesis (Ph.D.)--University of Florida, 2011.
Local:
Adviser: Oh, Suk P.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043274:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 ROLE of TGF SIGNALING IN THE PATHOGENESIS OF VASCULAR DISEASES By CHUL HAN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Chul Han

PAGE 3

3 To my loving wife, parents, and brother

PAGE 4

4 ACKNOWLEDGMENTS Most o f all, I thank God for giving the chance to have these great mentor s in my life T heir thoughtful guidance made me to enjoy my journey from a curious boy to a young scientist Dr s. Seongman K ang and Hyangshuk Rhim taught me the alphabet of scientific research beginning from gene cloning a nd cell culture. Most of all, they emphasiz ed keeping a consistent attitude not to make a big deal of the smallest things Even now it is one of my most important attitudes toward s cience. Truly, Dr. S. Paul Oh was a great m entor to me L ike a fathe r, he showed a big picture w hen I was perflexed, or uncertain about what I was doing. He encouraged me to get th rough difficult moments when I was depressed and humbled me when I am doing well. L ike a friend he gave me high five s whene ver I made even small success Like a big brother, he has been a good listener even for complains about trivial things. Most of all, he and I share the same passion and enthusiasm for the science. I am very proud to be his disciple and h e is my role model both as a person and as a scientist I also thank my thesis committee members, Drs. Mohan Raizada Naohiro Terada and Peter Sayeski for providing passionate assistance during my graduate career. Since I had a laboratory rotation in Dr. Terada s lab, he ha s been always open to me. He made me enjoy talk ing with him about any topics Even when I asked stupid questions, he g ave me wise answers. I appreciate Dr. Raizada s passion ate and sh arp suggestions for me Whenever I h ad a committee meeting I looked forw ard to his creative questions and comments. Furthermore, h e showed me how to live younger by keeping his humor. I thank Dr. Sayeski s thoughtful consideration. When ever I requested something, he always helped me with all his available resources He has been a good listener. I am also inde bted to past and current Oh lab members for productive discussions and for

PAGE 5

5 comfortable environment Dr. K won Ho Hong taught me important concepts and techniques necessary for the pulmonary hypertension project I appreci ate his invaluable suggestions about be ing a great scient ist who can see the big picture. Halong is my good colleague and lab member. I appreciate her open mind edness and friendship Dr. Sung Ok P ark helped me a lot expand my knowledge and learn many tech nique s necessary for the HHT study. Her positive attitude help me appreciate for even the small est things. I like Yong H wan Kim s perfectionism as well as his careful cons ideration of me and others. I was able to enjoy the lab life much more because of his unlaughable jokes. I thank Dr. Peter Dickie for his wisdom, patience, and mentorship. Whenever I shared trouble s and difficulties, h e always pointed ou t what I missed and did not forget to give me critical suggestions for future experiment s He edited m y writings for my poor English and encouraged me to focus on the contents I am very grateful to Korean students in the interdisciplinary program As Korean students, we not only shared the common troubles as foreign students but also intensively discussed a bout contemporary scientific issues and our own experimental data. The s e active meeting s were very helpful to improve my critical thinking skills Specially, I appreciate Sewoon Choi. He helped me with my research in imaging analysis. Furthermore, he is on e of the people I can talk openly without any hesitation Thanks to the gathering s I had wi th him, I was able to reduce half of my stress by sharing my joy and sadness spare her suggestions and encouragement as a PhD to fill my deficiencies as a PhD

PAGE 6

6 s tudent. I would like to give love and thank s to my mother father, and younger brother w ho have been supporting throughout

PAGE 7

7 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ .......... 10 LIST OF FIGURES ................................ ................................ ................................ ........ 11 ABSTRACT ................................ ................................ ................................ ................... 12 CHAPTER 1 SMAD1 DEFICIENCY IN EITHER ENDOTHELIAR OR SMOOTH MUSCLE CELLS RESULTS IN PULMONARY ARTERIAL HYPERTENSION ....................... 14 Introduction ................................ ................................ ................................ ............. 14 Pulmonary Arterial Hypertension (PAH) ................................ ........................... 14 Pathology of Pulmonary Arterial Hypertension ................................ ................. 14 Current Treatment Options for PAH ................................ ................................ 16 Prostacyclin (prostaglandin I 2 ) ................................ ................................ ... 16 Endothelin 1 receptor antagonists ................................ ............................. 17 Nitric oxide (NO) and cyclic GMP (cGMP) ................................ ................. 18 Calcium channel blocker ................................ ................................ ............ 18 Pathologic Mechanism of PAH ................................ ................................ ......... 19 Involvement of BMP signaling based on genetic studies ........................... 19 TGF ................................ ................................ ...... 20 Endothelial dysfunction in PAH ................................ ................................ .. 21 Compromised immune response and inflammation ................................ ... 22 Role of TGF .................. 22 Is SMAD Important Signaling Mediator for PAH Caused by BMPR2 Deficiency? ................................ ................................ ................................ .... 23 Endothelial BMPR2 Deficient PAH Mouse Model ................................ ............ 24 Deletion of Smad1 Gene in ECs or SMCs ................................ ........................ 24 Results ................................ ................................ ................................ .................... 25 SMAD1/5/8 Phosphorylation was Impaired in the Lungs of Pulmonary Hypertensive L1cre(+); Bmpr2 2f/2f Mice. ................................ ......................... 25 Smad1 Deletion in Pulmonary ECs or SMCs by L1cre or Tagln cre ................ 26 Some Mice with the Smad1 Deletion in Pulmonary ECs or SMCs Exhibited Elevated Pulmonary Pressure and Right Ventricul ar Hypertrophy. ............... 26 Positive Distal Arteries and Medial Wall Thickness Were Increased in the Smad1 Mutant Mice. ................................ ................. 27 Isolation of Pulmonary Endothelial Cells Carrying R26 creER/+ ; Bmpr2 2f/2f Allele .. 27 Deletion of Bmpr2 Gene and Impaired BMP Signaling ................................ ..... 28 Enhanced TGF Deficient pECs ................................ .... 29 Opposing Balance Between TGF and BMP S ignaling s in pECs ................... 29

PAGE 8

8 Discussion ................................ ................................ ................................ .............. 30 SMAD1 is a Downstream Mediator of BMP Signaling in Pathogenesis. ........... 30 SMAD1 Involvement in the Pathogenesis of PAH ................................ ............ 31 SMAD1 Deficiency in ECs has a Greater Impact on PAH Than That in SMCs ................................ ................................ ................................ ............ 32 Incomplete Penetrance of PAH in Smad1 Conditional KO Mice ....................... 33 Imbalance in TGF ...................... 33 T hickening of the Smooth Muscle Layer Might not be Sufficient to Lead to High Pulmonary Pressure ................................ ................................ ............ 35 Smad1 cKO Mice and Inducible Bmpr2 KO pECs are Useful Resources fo r Future Mechanism Research, Drug Screening and Preclinical Study. .......... 36 2 THERAPEUTIC EFFECT OF VEGF BLOCKADE ON ARTERIOVENOUS MALFO RMATIONS (AVMS) IN AN ANIMAL MODEL FOR HEREDITARY HEMORRHAGIC TELANGIECTASIA ................................ ................................ ..... 46 Introduction ................................ ................................ ................................ ............. 46 Hereditary Hemorrhagic Telangiectasia (HHT) ................................ ................. 46 Limitation of Current Therapeutic Interventions in HHT ................................ .... 47 Genetic Studies in HHT ................................ ................................ .................... 47 Genetic Mouse Models for HHT ................................ ................................ ....... 47 Secondary Hits are Required for AVM Development. ................................ ...... 48 Results ................................ ................................ ................................ .................... 49 Vascular Endothelial Growth Factor (VEGF) or Lipopolysaccharide (LPS) can Induce De Novo AVMs in Alk1 Deficient Subdermal Vessels. ................ 49 VEGF and LPS Stimulated Angiogenesis. ................................ ........................ 50 VEGF Blockade Suppressed Wound Induced AVM in Alk1 Deficient Subdermal Vessels. ................................ ................................ ...................... 51 VEGF Blockade Alleviated Internal Bl eeding and Low Hemoglobin Occurring in Alk1 Deficient Mice. ................................ ................................ .. 51 VEGF Blockade Suppressed LPS Induced AVMs in Alk1 Deficient Subdermal Vessels. ................................ ................................ ...................... 52 TNF ...................... 53 Discussion ................................ ................................ ................................ .............. 53 Therapeutic Potential of Anti Angiog enic Drugs in HHT ................................ ... 53 Therapeutic Potential of Anti Inflammatory Intervention ................................ ... 54 Inflammatory Stimulation Associated with Angiogenesis is Important for Inducing AVM Formation. ................................ ................................ .............. 55 3 MA TERIALS AND METHODS ................................ ................................ ................ 65 Smad1 Conditional Knockout Mice ................................ ................................ ......... 65 Hemodynamic Analysis ................................ ................................ ........................... 65 Right Ve ntricular Hypertrophy (RVH) ................................ ................................ ...... 66 Pulmonary Vessel Morphometry ................................ ................................ ............. 66 Establishment of Immortalized Pulmonary Endothelial Cells ................................ .. 67 Semi Quantitative RT PCR ................................ ................................ ..................... 68

PAGE 9

9 West ern Blotting ................................ ................................ ................................ ..... 68 Alk1 Conditional Knockout Mice ................................ ................................ ............. 69 Preparation of PLGA Microparticles ................................ ................................ ........ 69 Injection of PLGA Particles into Subdermal Area ................................ .................... 70 Skin Wound Generation and VEGF Antibody Treatment ................................ ........ 71 Latex Dye Injection and Image Processing ................................ ............................. 71 Hemoglobin Concentration and Hemorrhage Index ................................ ................ 72 Hypertrophy of the heart ................................ ................................ ......................... 72 Stat istical Analysis ................................ ................................ ................................ .. 73 4 CONCLUDING REMARKS AND FUTURE DIRECTIONS ................................ ...... 74 LIST OF REFERENCES ................................ ................................ ............................... 77 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 97

PAGE 10

10 LIST OF TABLES Table page 1 1 Primers for genomic and semi quantitative PCR reaction ................................ .. 37 2 1 The number of mice with hemorrhage in saline and VEGF antibody treated groups ................................ ................................ ................................ ................ 57

PAGE 11

11 LIST OF FIGURES Figure page 1 1 BMP response was severely impaired in the lungs of PH mice [ L1cre(+); Bmpr2 f/f ] ................................ ................................ .............................. 38 1 2 Smad1 de letion in L1cre(+); Smad1 f/f and Tagln cre(+); Smad1 f/f mice. ............... 39 1 3 Smad1 deletion in SMCs and ECs resulted in elevation of RVSP and RV hypertrophy.. ................................ ................................ ................................ ....... 40 1 4 Elevated pulmonary pressure is associated with pulmonary vascular remodeling. ................................ ................................ ................................ ......... 41 1 5 Deletion of Bmpr2 gene in pulmonary endothelial cells (pECs) .......................... 42 1 6 Bmpr2 deleted pECs display ed a reduce d response to BMP4 but not BMP7 .... 43 1 7 Reduced BMP response induced overactivation of TGF ................ 44 1 8 BMP and TGF form an opposing balance in pECs. .......................... 45 2 1 Angiogenic or inflammatory stimulation induces AVMs in Alk1 deficient adult subdermal vessels but not Alk1 wild type vessels ................................ .............. 58 2 2 Angiogenesis blockade (VEGF neutralizing antibody) suppressed wound induced AVM formation in Alk1 defi cient adult subdermal vessels. .................... 59 2 3 Angiogenesis blockade improved hemoglobin levels and visceral hemorrhage in Alk1 deficint adult mice.. ................................ ............................. 60 2 4 Angiogenesis blockade suppressed LPS induced AVMs in Alk1 deficient mice ................................ ................................ ................................ .................... 61 2 5 TNF Alk1 deficient mice. ................................ 62 2 6 Quantification of AVM formatio n by various stimuli in Alk1 deficient subdermal vessels. ................................ ................................ ............................. 63 2 7 Lung (top) and GI bleeding (bottom) was categorized into three g roups (weak, moderate, and severe) depending on the severity. ................................ 64

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ROLE of TGF SIGNALING IN THE PATHOGENESIS OF VASCULAR DISEASES By Chul Han August 2011 Chair: S. Paul Oh Major: Medical Sciences Physio logy and Pharmacology Gene tic mutations causing diverse genetic vascular diseases ha ve been found in the genes that encode components of the transforming growth factor ( TGF ) signaling pathway suggesting that TGF essential for hom e ostasis o f the vascular system T o explore the role of TGF signaling in the pathogenesis of a couple of vascular diseases, our laboratory developed genetic mouse models for two major vascular diseases pulmonary arterial hypertension (PAH) and hereditary hemorrhagic telangiectasia (HHT) PAH is a rare but fatal disease that increases pulmonary pressure due to thickening of pulmonary arterial walls Although d eficiency of bone morphogenetic protein type II receptor (BMPR2) in TGF signaling is known as a g enetic contributor, whether dysfunction of SMAD1 one of the canonical transducers of BMPR2 is critical for PAH development remains unknown. We hypothesized that d eficiency of SMAD1 would lead to PAH and tested the hypothesis using Smad1 con ditional knocko ut (cKO) mice. The Smad1 gene was de leted in endothelial cells or smooth muscle ce lls using L1cre and Tagln cre lines respectively. We discovered that these Smad1 c KO mice develop PAH, suggesting that SM AD1 could b e a critical downstream mediator of BMPR2 in PAH. HHT2 is a vascular disease with arteriovenous

PAGE 13

13 malformation s (AVMs) and visceral hemorrhages due to ALK1 deficiency. Our previous studies showed that wounding play s an essential ro le in AVM development in the A lk 1 deficient context. We investigated the involvement of tw o major wound healing responses: inflammat ion and angiogenesis. We found that either LPS (for inflammation) or VEG F (for angiogenesis) could recapitulate the wound induced AVM formation in A lk 1 deficient skin. The inhib it ion of angiogenesis with VEGF neutralizing antibo dy (Ab) significantly inhibited both LPS and wound induced AVMs and ameliorated internal bleeding s in Alk1 deficient mice s uggesting a critical role for angiogenic st imulation in AVM development. These dat a provide a better scientific basis for the therapeutic effect of a VEGF blockade (Bevacizumab) for epistaxis, GI bleeding, and liver AVMs in HHT patients. Our data also demonstrated that the skin AVM model by Alk1 conditional knockout mice is reliable for preclinical screening of drug candidates for epistaxis and GI bleedings.

PAGE 14

14 CHAPTER 1 SMAD1 DEFICIENCY IN EITHER ENDOTHELI AR OR SMOOTH MUSCLE CELLS RESULTS IN PULMONARY ARTERIAL H YPERTENSION Introduction Pulmona ry Arterial Hypertension (PAH) Pulmonary Arterial Hypertension (PAH) (formerly primary pulmonary hypertension PPH ) is rare but fatal lung vascular disease and is characterized by sustained elevation of mean pulmonary arterial pressure (PAP) and increased pulmonary vascular resistance leading to right heart failure. PAH is one of 5 types of pulmonary hypertension (PH) which is caused by chronic thrombosis, embo lization, elevated left ventricular end diastolic pressure, lu ng disease/hypoxemia or valve disease. While PH is diagnosed by the sole criterion being a resting mean PAP > 25 mmHg, diagnosis of PAH is required two additional criteria : more than 3 Wood unit s of pulmonary vascular resistance (PVR), and less than 15 mmHg of pulmonary capillary wedge pressure without other causes of PH. PAH is subclassified into idiopathic PAH (IPAH), heritable PAH (HPAH), and PAH associated with other diseases (APAH). Other di seases include congenital heart defect, portal hypertension, HIV infection, connective tissue disease, appetite suppressant drug use 1 Pathology of Pulmo nary Arterial Hypertension The basic pathological phenotype of PAH is a narrowing and thickening of small pulmonary vessels. All PAH patients exhibit pulmonary vascular remodeling of all layers of the vessel: intimal thickening, smooth muscle cell hypertrophy, adventitial fibrosis a nd occluded vessels by in situ thrombosis 2 The intimal layer is a single layered lining of endothelial cells (ECs) between the internal elastic lamina and lumen. Normally, ECs are q uiescent but in PAH lungs, they are activated, rapidly proliferat ing and fo rm

PAGE 15

15 neointima layers Myofibroblast is one of major cell types in the neointima and expresses sm MA) and vimentin instead of EC makers such as CD31 and the von Willebrand factor (vWF) 3 Although the origin of the myofibroblasts remains unknown, in vitro data s uggest that myofibroblasts are likely originated from vascular SMC or transdifferentiated from EC. 4 5 Plexiform lesions are commonly observed in the severe form of PAH showing multiple capillary like channels in a pulmonary artery 6 They contain several cell types including ECs, myofibroblast, and connective tissues 7 ECs are the most responsible cell types for initiation of plexiform lesions through monoclonal proliferation of tumorlet like clusters of ECs A study showed that ECs with BMPR2 mutation are more susceptible to apoptotic stimulus and after repeated apoptosis, the surviving ECs are apoptos is resistant and undergo considerable proliferation and develop plexiform lesions 8 Vascular SMCs are a predominant cell type of the medial layer and normally unresponsive to mitogen s 9 Hyperplastic SMCs are a common phenotype in all the different forms of PAH. In precapillary vessels, cells inside internal elastic lamina appear to be involved in differentiation into SMCs 10 and in distal vessels lacking elastic lamina, pericyte and interstitial fibroblast surrounding lung parenchyma seem to contribute to muscularization 11 Remodeling of a dventitia layer by increase of fibroblasts is associated with induction of many proinflammatory cytokines including monocyte chemoattractant protein (MCP) 1, macrophage inflammatory protein (MIP) 2, interleukin (IL) 6 12 Endothelial level of prostacyclin ( prostaglandin I 2 ), an endogenous vasodilator, an inhibitor of platelet aggregation and a suppresso r of vascular SMCs proliferation, was shown to be decreased in patients with PAH 13 The mechanism

PAGE 16

16 involved in this observation could be that lowered expression of prostacyclin synt hase impaires balance between prosta cyclin and thromboxane A2, a vasoconstrictor and a potent stimulator of platelet aggregation 14 Thromb otic lesions in PAH are associated with imbalanced ratio of prostacyclin and thromboxane A2 and potential outcome of the serotonin pathway 15 16 Current T reatment O ptions for PAH The incidence of PAH is 2 3 cases per million people every year 17 There is age variability for the initial onset of PAH 18 19 Without proper treatments, mortality is predicted within 3 years after diagnosis. Up to now, the following tre atments are available and have been used widely Prosta cyclin (prostaglandin I 2 ) One of the most extensively and succ essfully used therapies for PAH patients is to increase the level of prostacyclin with exogenous prostanoids. Fatty acid cyclooxygenase metabolizes arachidonic acid to prostaglandin H 2 a substrate for both prostacyclin (prostaglandin I 2 ) synthase and thromboxane synthase. Prostacyclin is expressed by prostacyclin synthase in endothelial cells and works as a vasodilator through stimulation of cyclic AMP (cAMP) and inhibits proliferation of SMCs 20 On the other hand, thromboxane A2 ( TxA2 ) is produced by throboxane synthase in platelet and endothelial cells and stimulates vasoconstric tion and platelet aggregation PAH patients showed decreased prostacyclin metabo lites and increase of TxA2 production 14 indicating that endothelial dysfunction and platelet activation in PAH might impair the balance between vasodilator s and vasoconstrictor s Continuous intravenous infusi on of epoprostenol ( Floran ) started in the early 1980s, has shown to decr ease pulmonary vascular resistance (PVR), increased cardiac output, and improve d exercise capacity

PAGE 17

17 and overall survival rates 21 23 Due to poor stability, high expense, and side effects from intravenous treatment of epoprostenol 24 more stab le analogs and alternative delivery of prostacyclin were developed: subcutaneous (treprostinil), oral (beraprost), or inhaled (iloprost) delivery of prot acyclin analog s 25 27 Recent combination therapy of prostanoid and a PDE5 inhibitor was effective in improving pulmonary hemodynamic change and exercise toleran ce in PAH 28 2 9 Endothelin 1 receptor a ntagonists Endothelin 1 (ET 1) works as a vasoconstrictor via 2 type s of receptors ( ETA and ETB ) and has a mitogenic effect on SMC s 30 31 Both receptors are expressed in SMCs and mediate vasoconstriction while ETB in ECs promotes vasodilation through NO and prostacyclin production 32 33 PAH patients exhibit ed high levels of lung and circula ting ET 1 34 35 Endothelin receptor antagonist such as Bosentan ( a nonselective ET receptor antagonist ), sitaxsentan and ambrisentan (selective ETA receptor blocker ) were FDA approved and showed significant but moderate improvement in pulmonary hemodynamics and 6 minute walk distance 36 39 However, there is no clear evidence showing advantage of selective ETA antagonism over combined antagonism for both ETA and ETA. Liver toxicity and teratogenicity are class ic side effects. Despite a re port that bosentan monotherapy increased survival 40 more robust dat a for survival are necessary for clinical trials. Since the endothelins are produced from pro endothelin by endothelin converting enzyme, inhibitors for endothelin converting enzyme could be an alternative approach to blocking overproduction of endothelin in PAH. Studies with this inhibitor (eg, daglutri l) have been conducted in systemic hypertension and heart failure 41 and application for PAH patients are being investigated.

PAGE 18

18 Nitric o xide (NO) and cyclic GMP (cGMP) NO produced by endothelial NO synthase (eNOS) dilates blood vessel in the pulmonary circulation. Endothelium derived NO s timulates soluble guanylate cyclase (sGC) to produce intracellular cGMP in SMCs 42 I ncreased cGMP activates cGMP dependent protein kinase (cGKI) and decrease s the sensitivity of myosin to calcium induced contraction and lowers concentration of calcium released from the sarcoplasm ic reticulum 42 P hosphodiesterase type 5 (PDE5) the target of sildenafil opposes NO dependent vessel dilation by suppressing the rise of NO induced cGMP 43 NOS expression and NO bioavailability were shown to be reduced in the lungs of PAH patients. 44 46 Furthermore, PDE5 is upregulated in the hypoxia mediated animal model for PAH which worsens cGMP availability 47 48 Endogenous NOS inhibitors, asymmetrical and symmetrical dimethylarginines (ADMA and SDMA) appeared to be more abundant in PAH 49 50 Thus, Inhaled NO gas dilates pul monary arteries, which lowers vascular re sistance, PA press ure, and RV afterload 51 52 T he oral delivery of s i l denafil citrate an inhibitor of PDE5, improved exerc ise capacity and hemodynamics in PAH patients 53 Calcium channel blocker I ntracellular calcium and calcium mediated signals play a crucial role in smooth muscle contraction 54 55 A study has shown that a high dose of calcium channel blockers have a beneficial effect on the survival of some PAH patients 56 However, i t should be used very carefully because calcium channel blockers are only convincingly effective in the 5% of patients who showed an acute vasoactive response to vasoreactivity testing 56 57

PAGE 19

19 In summary, c urrent t reatments for this disease alleviate symptoms and improve heart functions but are not a cure of the disease. B etter understand ing on the pathogenetic mechanism s of disease would allow development of drugs targeting the cure. Patholog ic M echanism of PAH Involvement of BMP signaling based on genetic studies Genetic studies have found the linkage of a locus for the gene, named PPH1 to chromosome 2q31 32 in 1997 58 59 and later showed that Bone Morphogenetic Prote in type 2 Receptor ( BMPR2 ), one of the receptors in sup erfamily signaling is responsible for heritable PAH in an autosomal dominant manner 60 63 A heterozygous BMPR2 mutation w as found in nearly 70% of HPAH patients and also in 25% of sporadic IPAH patients. 63 65 67 The levels of B MPR 2 mRNA and proteins are markedly reduced in the lung s of PAH patients with heterozygous B MPR 2 mutation s 64 indicating that BMPR2 mutation s are associated with hap loinsufficiency P enetrance of disease is low and disease express ivity varies even within members of a fami ly Estimates showed that only a bout 20% of individuals wit h BMPR2 mutation develops PAH during their entire life This low penetrance in PAH suggests that a dditional factors such a s inflammation may be neces sary for clinical manifestations of PAH in addition to the genetic predisposition. While Bmpr2 +/ mice displayed mild PAH phenotype, a denovirus mediated pulmonary overexpression of 5 lipoxygenase (5 LO), a mediator of inflammation, or a chronic infusion of serotonin (5HT) develop ed full blown PAH in Bmpr2 +/ mice 68 69 Interestingly, BMPR2 is downregulated in the lung tissues and cells from idiopathic PAH patients without Bmpr2 mutation 64 70 implying a wide range of influence of BMPR2 deficiency to other forms of

PAGE 20

20 PAH. Furthermore, B MPR 2 signaling plays an important role in the proliferation of local endothelial cells and the migration and local proliferation of smooth muscle cells 8 71 Taken together, impaired BMP signaling due to BMPR2 deficiency would be a considerable contribut or for PAH development. TGF perfamily signaling TGF including cell proliferation, migration, ap optosis, pattern formation, and immunosupression. TGF TGF proteins (BMPs), growth and dif ferentiation factors (GDFs), activins/inhibins and m lle rian inhibiting substance (MIS) / anti Mllerian hormone (AMH ) 72 74 TGF transduction is initiated by binding of ligands to heteromeric complex of transm embrane serine/threonine type 2 and type 1 receptors Once ligands bind to a type 2 receptors, the ligand type 2 receptor complex recruits and trans phosphorylates type 1 receptor, which, in turn, activates receptor regulated SMADs (R SMADs): SMAD2/3 for TGF and SMAD1/5/8 for BMPs. R SMADs then form a complex with a common partner, SM AD4 (Co SMAD) and enter the nucleus and initiate transcription of target genes. On the other hand, there is mounting evidence demonstrating that independent ly of SMADs, TGF signaling can be transduced through mediators other than SMADs such as the mitoge n activated protein kinases (MAPKs), including p38MAPK, p42/44MAPK (ERK1/2), and c Jun N terminal kinase/stress acti vated protein kinase (JNK/SAPK) 75 76 For instance, exogenous BMP ligands stimulate phosphorylation of p3 8MAPK and p42/44MAPK, and affect prolifera tion of SMCs 70 77

PAGE 21

21 Endothelial dysfunction in PAH The endothelium is the cells lining the interior surface of blood vessels in the entire circulatory syst em. Endothelial c ells function in many aspect s of vascular biology : vasoconstriction and vasodilation and hence the control of blood pressure blood clotting ( thrombosis & fibrinolysis ), atherosclerosis formation of new blood vessels ( angiogenesis ), inflammation and swelling ( oed ema ) and also control of the passag es of materials and blood cells (permeability). Thus, endothelial dysfunction may result in increased coagulation proliferation, and vasoconstriction 78 81 Endothelial dysfunction seems to play an integral role in mediating the structural changes in the pulmonary vasculature. Disordered endothelial cell prolifera tion along w ith concurrent neoangiogenesis results in the formation of glomeruloid structures known as the plexiform lesions, which were found in the pulmonary vessels of patients with severe PAH 82 In vitro studies with endothelial cells suggest a plausible mechanism of angioproliferative change of ECs in PAH Loss of BMPR2 function cannot protect ECs from apoptosis representing a possible initiating step and increased apoptosis of ECs promoted appearance of the apoptosis resistant cells 8 83 In add ition, an altered prod uction of various endothelial vasoactive mediators such as Nitric oxide (NO), prostacylin, endothelin 1 (ET 1), serotonin, and thromboxane, has been increasingly recognized in patients with PAH 14 34 84 86 Since change of these mediators can affect the growt h of the smooth muscle cells, alteration in their production may facilitate the development of pulmonary vascular hypertrophy. Thus, it is conceivable that the beneficial effects of currently available treatments for PAH, such as prostacyclin, NO, and ET ant agonists, result in part from restoring the balance betwee n these mediators. Furthermore, e n dothelial dysfunction may bring about a change in the EC permeability

PAGE 22

22 and allow direct contact of serum proliferative mediators with the subendothelium, leading to cell proliferation in the medial and advential layers 87 89 C ompromised i m mune r esponse and i nflammation Pulmonary hypertension has been associated with connective tissue disease 90 human immunodeficiency virus (HIV) 9 1 and auto antibodies 92 Mononuclear cell infiltration was often observed in the PAH vascular lesions 64 Inflammatory cells including macrophag es and lymphocytes are highly accumulated in the plexiform lesions of hypertensive pulmonary vessels 7 Induction of many proinfl a mmatory cytokines and chemoki nes, such as monocyte chemoattractant protein (MCP) 1, macrophage inflammatory protein (MIP) 1 IL 6, RANTES, fractalkine has been implicated in PAH 12 93 97 In the classical PH animal model, Monocrotalline (MCT a pyrrolizidine alkaloid plant toxin ) injected rats elevated pulmonary pressure with apoptosis of ECs and SMCs and massive mononuclear infiltration into the perivascular region s of pulmonary arterioles 98 99 Therefore, the observations f rom a variety of h uman and animal studies suggest a compelling conclusion that intact immune system is required to maintain homeostasis of pulmonary circulation. In other words, dysregulated immunity could be an environmental second hit for clinical mani festation of PAH in individuals with Bmpr2 mutation. Role of TGF / BMP B alance in P ulmonary V ascular H omeostasis Only 20% disease penetrance in individuals with Bmpr2 mutation implies that the Bmpr2 mutation is necessary but not sufficient alone for clinical manifestation of PAH. This fact suggests that other genetic or environmental modifiers are necessary for initiation and progression of PAH. TGF could be a possible candidate of modifiers in PAH.

PAGE 23

23 BMP and TGF ling form an opposing balance in pulmonary vascular homeostasis 100 Thus, BMPR2 deficiency may result in predominant TGF which favors fibrosis and smooth muscle cel l growth. R ecent studies suggest that an imbalance between TGF s to PAH development Activation of BMP signaling suppresses proliferation of pulmonary vascular smooth muscle cells 64 Furthermore, TGF early onset of PAH and increased penetrance of heritable PAH 101 Zaiman et al reported that increased TGF monocrotaline induced PH 102 Long et al showed that suppression of TGF via activin receptor like kinase 5 inhibitor prevents development and progression of PAH in the monocrotaline model 103 Impaired BMP signaling from BMPR2 deficiency would not be sufficient to develop PAH and when in conjunction with predominance of TGF finally would elevate pulmonary pres sure. Is SMAD I mportant S ignaling M ediator for PAH C aused by BMPR2 D eficiency? Human genetic studies have identified various BMPR2 mutations throughout the exons coding for the BMPR2 protein 104 These data imply that d eficiency of BMPR2 is a crucial genetic factor in the PAH development However, which downstream signaling molecules of BMPR2 such as MAPKs or SMADs contribute to PAH is still unknown. Mutations in the kinase domain ( about 50% of total mutations) suggested that downstream SMAD signaling play a role for PAH development because of its reduced SMAD dependent transcriptional activity 105 However, mutation s in cytoplamic tail domain ( about 20 % of total mutations) such as R899X leave SMAD signaling intact, indicating that the cytoplas mic tail of BMPR 2 may not be essential for transduction of BMP signals through S MAD s 106 107 In other words, S MAD deficiency may not be

PAGE 24

24 associated with the pathogenesis of PAH. James West et al addressed this question using transgenic mice expressing BMPR2 R899X transgene in smooth muscle 108 In these mice, truncated BMPR2 proteins with a tail domain mutation were overexpressed in smooth muscle cells by doxycycline treatment from 4 weeks of age. They elevated right ventricular systolic pressure, associated with extensive pruning, musculariz ation of pulmonary arterioles and perivascular infiltration of immune cells, not affecting SMAD activity. These in vivo results suggest that the SMAD deficiency may not be asso ciated with PAH caused by BMPR2 deficiency. Endothelial BMPR2 D eficient PAH M ou se M odel Previously we produced Bmpr2 conditional knockout (cKO) mice [L1cre(+); Bmpr2 f/f or +/f ] by deleting the Bmpr2 gene in the pulmonary endothelium using the novel L1cre line 109 A subset of mice exhibited elevated right ventricula r systolic pressure (RVSP) and right ventricular hypertrophy (RVH) which are the representative phenotypes of pulmonary hypertensive (PH) mice 110 and these PH mice showed increased muscularization of pulmonary arterioles and thickening of vessel wall compared to non PH mice and controls. Deletion of S mad1 G ene in ECs or SMCs SMAD1 is a canonical signal transducer of BMPR2 and its reduced activity has been associated with PAH Yang et al showed tha t phosphorylation of SMAD1 was reduced in the pulmonary arterial SMCs of PAH patients with BMPR2 mutation 70 Thus, w e hypothesized that SMAD1 is a contributing downstream mediator of BMPR2 in the pathogenesis of PAH. To test this hypothesis, we produced Smad1 cKO mice by deleting Smad1 gene in the pulmonary endothelial cells (pECs) or smooth muscle ce lls (SMCs) using L1 cre and Tagln cre lines, respectively and found that Smad1 deletion in

PAGE 25

25 pECs or SMCs can develop PAH in mice with muscularization of pulmonary vessels suggesting that SMAD1 may be a critical downstream molecule in PAH. Recent studies reported that enhanced TGF impaired BMP signaling 103 111 113 In Bmpr2 deleted pulmonary endothelial cel ls we found that a reduced BMP response resulted in a predominant TGF supporting the role of a balance between TGF of pulmonary blood pressure 100 Results SMAD1/5/8 Phosphorylation was Impaired in the Lungs of Pulmonary H ypertensive L1cre(+); Bmpr2 2f/2f M ice We have previously shown that about 40% of mice in which Bmpr2 gene was specifically deleted in endothelial cells by L1cre exhibited pulmonary hypertensive phenotype 110 To assess the extent to which the conditional Bmpr2 deletion affects on its downstream SMAD1/5/8 signaling, lungs of cre negative controls, Non PH L1cre(+); Bmpr2 2 f/2f PH L1cre(+); Bmpr2 2 f/2f mice were immunostained with anti phospho SMAD1/5/8 antibodies (Fig. 1 1 A through 1 1 F). While pSMAD1/5/8 positive cells were readily detected in the cre negative controls (Fig. 1 1 A through 1 1 B) and Non PH Bmpr2 mutants (Fig. 1 1 C), they appeared to be much less in the PH Bmpr2 mutants (Fig. 1 1 D through 1 1 F). Consistent with this immunostaining result, the levels of SMAD1/5/8 phosphorylation in the whole lung samples were significantly reduced in the PH Bmpr2 mutants compared to the cre negative controls and Non PH Bmpr2 mutants (Fig. 1 1 G H). These data s uggested to us that impaired SMAD1 signaling may play a pivotal role in the pathogenesis of pulmonary arterial hypertension associated with Bmpr2 deficiency.

PAGE 26

26 Smad1 Deletion in P ulmonary ECs or SMCs by L1cre or Tagln cre To investigate the role of SMAD1 in the pathogenesis of PAH, we exploited conditional knockout approaches for deleting the Smad1 gene in endothelial cells or smooth muscle cells by L1cre or Tagln cre lines, respectively, because Smad1 null mice were embryo nic lethal 114 Both L1cre(+); Smad1 f/f and Tagln cre(+); Smad1 2f/2f mice we re viable and normal compared to their cre negative littermates. We analyzed the Cre activity by detecting the Smad1 null allele in several organs of 2 month old mice, including the lung, heart, liver, kidney, and spleen. Consistent with our expectations b ased on our previous reports 109 110 the Cre mediated Smad1 deletion was detected primarily in the lungs of L1cre(+); Smad1 f/f mice, and found in most organs of Tagln cre(+); Smad1 f/f mice ( Fig 1 2 ). Some M ice with the Smad1 Deletion in Pulmonary ECs or SMCs Exhibited Elevated Pulmonary Press ure and Right Ventricular H ypertrophy. To assess the pulmonary pressure, we measured the right ventricular systolic pressure (RVSP) of L1cre(+); Smad1 f/f Tagln cre(+); Smad1 f/f and their age matched cre( ) control mice. While RVSPs of controls were cluster ed in a 20 27 mmHg range, those of L1cre(+); Smad1 f/f and Tagln cre(+); Smad1 f/f mice were scattered in a wide range (Fig. 2A) from 22 to 45 mmHg. About 40% (14/35) of L1cre (+); Smad1 f/f mice and 12% (4/33) of Tagln cre(+); Smad1 f/f mice had their RVSPs great er than 30 mmHg, and we designated them as pulmonary hypertensive (PH) group (Fig. 1 3 A). The mean RVSPs of L1cre(+); Smad1 f/f (28.1 mmHg) was significantly higher than that of cre( ); Smad1 2f/2f (23.9 mmHg). Fulton index, the ratio of RV free wall weight ov er septum plus left ventricular free wall weight, was used to estimate RV hypertrophy. The Fulton index of L1cre(+); Smad1 f/f and Tagln cre(+); Smad1 f/f mice was significantly greater

PAGE 27

27 than that of cre( ); Smad1 f/f controls (Fig. 1 3 B). It was greater in the PH mice than that in N PH mice, indicating that sustained elevation of pulmonary pressure might have resulted in RV hypertrophy in the PH groups (Fig. 1 3 C). There was no difference in systemic blood pressure among three groups (F ig. 1 3 D). Positive Distal Arteries and Medial Wall Thickness Were I ncreased in the Smad1 Mutant M ice. To examine whether the elevated RVSP and RV hypertrophy in the Smad1 mutants is associated with pulmonary vascular remodeling, anti actin positive pulmonary arteries ranging from 30 and the wall thickness was measured. The PH group L1cre(+); Smad1 f/f mice showed positive pulmonary arterioles and thicker arterial walls compared to the N PH group and the cre( ); Smad1 f/f (Fig. 1 4 B, E, F). In Tagln cre(+); Smad1 f/f mice, however, both PH and N PH groups showed a higher number of muscularized vessels and thicker walls compared to the cre( ); Smad1 f/f controls. Isolati on of Pulmonary Endothelial Cells C arrying R26 creER/+ ; Bmpr2 2f/2f A llele It has been hypothesized that an opposing balance between TGF signalings is critical for homeostasis of p ulmonary vasculature and that imbalance of TGF contribute to the pathogenesis of PAH 100 In order to investigate this hypothesis and to examine the extent to which Bmpr2 deficiency impact on this balance, we established a n in vitro model as follows. We isolated pulmonary ECs (pECs) from the lung of R26 creER/+ ; Bmpr2 2f/2f recombinase function. Three days of culture of the pECs with medium co 4 hydroxy tamoxifen (OH TM) efficiently deleted exons 4 and 5 of the Bmpr2 gene (Fig.

PAGE 28

28 1 5 A). When the Bmpr2 deleted cells were subsequently cultured with OH TM free media for 10 days, no overgrowth of undeleted cell p opulations were observed (Fig. 1 5 B). Henceforth, Bmpr2 intact and deleted cells will be designated as Bmpr2 2f/2f and Bmpr2 1f/1f cells, respectively. To examine whether OH TM treatment and Bmpr2 deletion affected the expression of other genes involved in TGF characteristics, semi quantitative RT PCR analyses were performed. Expression of EC specific markers including Nos3, Tie2, Eng, and Flk1 were maintained in Bmpr2 1f/1f pECs (Fig. 1 5 D ). Bmpr2 transcript level was undetectable while transcripts for other TGF Bmpr2 1f/1f pECs (Fig. 1 5 C ). Deletion of Bmpr2 Gene and Impaired BMP S ignaling In order to assess the extent to which Bmpr2 deletion affects BMP signaling, BMP4 or BMP7 was added to Bmpr2 2f/2f and Bmpr2 1f/1f cells at various doses (0, 5, 25, 50 ng/ml) after 15 hr serum starvation. First, we examined the protein level of BMPR2 in these cells. While BMPR2 was readily detected i n Bmpr2 2f/2f cells, BMPR2 protein was undetectable in Bmpr2 1f/1f cells (Fig 1 6 A, B). Level of phosphorylation of SMAD1/5/8 was augmented in a dose dependent manner in Bmpr2 2f/2f cells whereas it was suppressed at all BMP4 doses in Bmpr2 1f/1f cells (Fig. 1 6 A, C), indicating that the BMP4 signaling is impaired in Bmpr2 1f/1f pECs. BMP7 signaling can be compensated by ACVR2A in BMPR2 depleted pulmonary artery SMCs (PASMCs) 77 As shown in Fig. 1 6 D, phosphorylation of SMAD1/5/8 was elevated in a dose dependent manner in both Bmpr2 2f/2f and Bmpr2 1f/1f cells, suggesting that BMP7 signaling can be compensated in Bmpr2 1f/1f pECs.

PAGE 29

29 Enhanced TGF D eficient pECs To investigate whether i mpaired BMP signaling affects TGF examined the basal level of SMAD2 phosphorylation in Bmpr2 2f/2f and Bmpr2 1f/1f cells cultured in medium containing 10% fetal bovine serum (F ig 1 7 A). The level of SMAD2 phosphorylated in Bmpr2 1f/1f c ells was much higher than that in Bmpr2 2f/2f cells. To test if Bmpr2 deficient cells are more sensitive to TGF phosphorylation as a response to TGF (F ig 1 7B ) While both Bmpr2 2f/2f and Bmpr2 1f/1f cells showed a dose dependent augmentation of pSMAD2, the level of SMAD2 phosphorylation was significantly higher in Bmpr2 1f/1f cells at 1 and 2 ng/ml TGF 1 compared to Bmpr2 2f/2f cells, su ggesting that impaired BMP signaling may potentiate the TGF Opposing Balance Between TGF and BMP S ignaling s in pECs To investigate whether BMP and TGF signaling form an opposing balance in pECs we examined whether TGF induced SMAD2 phosphorylation is suppressed by BMP treatment in pECs. TGF 1 ( 0, 0. 1, 1, and 2 ng/ml) and BMP4 (25 ng/ml) or BMP7 (25 ng/ml) were treated for 30 min after serum starvation in Bmpr2 2f/2f and Bmpr2 1f/1f cells T he level of SMAD2 phosphoryla tion by 1 and 2 ng/ml of TGF 1 treatment in Bmpr2 2 f/ 2 f cells was decreased by either BMP4 or BMP7 implying that BMP and TGF have a competitive relationship by opposing each other (Fig. 1 8). However, TGF mediated SMAD2 phosphorylation in Bmpr2 1f/1f cells was not affected by BMP4 treatment, suggesting that BMP4 signaling is mediated mainly through BMPR2 (Fig. 1 8A) Interestingly, BMP7 could suppress overactivated TGF signaling in Bmpr2 deficient pECs as well as Bmpr2 intact pECs, suggesting that BMP7 signaling is not mediated

PAGE 30

30 mainly through BMPR2 and also mediated by other type 2 r eceptors such as ACVR2a (Fig. 1 8B) Discussion In this study, we showed that genetic ablation of Smad1 in pECs or SMCs predisposes mice to PAH, suggesting that impaired SMAD1 signaling is relevant to the pathogenesis of PAH. Furthermore, the findings of reduced SM AD1/5/8 activation and the over activation of TGF deficient pECs suggests that a predominance of TGF genetically disturbed balance between TGF and BMP signaling, may be an important facto r triggering PAH development. SMAD1 i s a Downstream M ediator of BM P S ignaling in P athogenesis. SMAD1 is a canonical downstream mediator of the BMP pathway that functions in a variety of cellular and developmental events. Therefore, reduced BMP activity i n association with the reduced expression of its receptors is accompanied by decreased phosphorylation of SMAD1/5/8 in the development of diseases. Liu et al found that pSMAD1/5/8 and BMPR 1 b were decreased in malignant glioma tissues compared with normal brain tissues 115 Yang et al reported that the activated form of SMAD1 is deficient in the pulmonary vasculature of patients with a BMPR2 mutation suggesting that inactivation of SMAD1 plays a role in the PAH pathogenesis 70 Our data demonstrate that Smad1 deletion in either ECs or SMCs ca n induce PH in mice, implying that SMAD1 may be an important downstream signaling molecule of BMPR2 in PAH development.

PAGE 31

31 SMAD1 I nvolvement in the P athogenesis of PAH Our data showing the role of SMAD 1 in PAH may appear to be con flict with the previous data from James West s group demonstrated that overexpression of tail domain BMPR2 mutant (R899X) not affect ing the SMAD1 acti vation resulted in PAH 108 However, f rame shift and nonsense mutations consist of 70% of total mutations of BMPR2 gene and interestingly, approximately one quarter of this type mutations are collected in the cytoplamic tail domain. Nonsense mutation decay (NMD) is a cellular mechanism to destroy defective RNA transcripts with nonsense mutation to block the production of truncated proteins 116 Thus, most of BMPR2 mRNAs with the cytopla smic tail mutation are destroyed through NMD mediated processing, leading to BMPR2 deficiency 104 117 In James West s studies, truncated BMPR2 was not destroyed by NMD and showed normal SMAD1 activation. Thus, their mutant mice may not represent human PAH patients carrying a cytoplasmic tail muation of BMPR2 Otherwise, t his discrepancy suggests that some BMPR2 associat ed PAH might be SMAD dependent (mutation in the kinase domain) and some are not (mutation in the tail domain). M utations in the tail domain have been shown to interrupt interactions between BMPR2 and the dynein light chain Tctex 1 as well as LIMK1, a key r egulator of actin dynamics 118 119 Thus, the cytoplamic tail mutation may contribute to PAH development by disrupting these interactions with potentially critical signaling molecules in SMAD independent manner. As an alterna tive interpretation, SMAD1 signaling is critical in ECs, not in SMCs for PAH development. Hansmann et al presented a novel anti proliferative axis in PAH 120 spontaneously developed PAH with elevated RVSP, RVH, and increased muscularization of the distal pulmonary arteries. This was independent of SMAD1/5/8

PAGE 32

32 phosphorylation. Li et al suggested a novel role of NOTCH3 in controlling proliferation of SMCs and in maintaining SMCs in an undifferentiated state 121 They found that the severity of disease in human PAH patients and rodent PH models correlated with the amount of NOTCH3 prote in in vascular SMCs of the lung, suggesting that NOTCH3 signaling pathway in SMCs is crucial for the development of PAH. Even though it still remains unknown whether NOTCH3 and PPAR signaling in ECs are also critical contributors to PAH pathogenesis, up to now, our data with Smad1 cKO mice demonstrated that SMAD1 deficiency in ECs is a important contributing factor for spontaneous PAH development. SMAD1 D eficiency in ECs has a G rea ter I mpact on PAH T han T hat in SMCs Mice with endothelial Smad1 deletion showed 40% penetrance while mice with Smad 1 deficiency in SMCs displayed 13% penetrance. Why did endothelial deletion make a greater influence on PAH pathogenesis compared to deletion in SMCs? Malfunctioning of SMCs usually increase their growth rate, leading to thickening of vessel wall, whereas endothelial dysfunction contributes to PAH pathogenesis in various ways. Disordered endothelial proliferat ion forms neoinitimal layers 82 and disrupted balance of vasoactive mediators exacerbate s vasoconstriction 14 34 84 86 and inc reased cell permeability allows serum growth factors to affect SMC pr oliferation and release of mitogen such as serotonin from ECs induces smooth muscle hyperplasia 122 and the number of occluded vessels are increased by in situ thrombosis 2 Therefore, because of these various effect s of ECs, Smad1 deletion in ECs may accelerate PAH development compared to Smad1 deletion in SMCs.

PAGE 33

33 Incomplete P enetrance of PAH in Smad1 C onditional KO M ice All the mice with endothelial or smooth muscle Smad1 deletion did not develop PAH. O nly a subset of mice showed PH phenotypes including eleva tion of RVSP and thickening of smooth muscle layer. First SMAD1/5/8 could be functionally redundant and compensate for the absence of other molecules Cre mediated genetic ablation of either Smad1 or Smad5 in ovarian granulosa cells results in normal reproductive function but that combined loss of Smad1 and Sma d5 results in fertility defects and granulosa cell tumors 123 S MAD 1, S MAD 5, and S MAD 8 function redundantly in activating regression of the M llerian duct mesoepithelium 124 Second, additional environmental insult would be required for the manifestation of PAH w ith genetic predisposition. Inflammation has been associated with PAH as an influencing environmental factor I nflammatory cells including macrophages and lymphocytes were accumulated and many proinflammatory cytokines were induced in the PAH vascular lesions 7 12 64 93 97 Thus, if treated with inflammatory stimulants such as IL 6 125 and 5 lipoxygenase (5 LO) 68 Smad1 cKO mice may show increased penetrance. Conversely, blocking inflammatory activation could be therapeutically beneficial for PAH patients Studies with animal models support this. Platelet activating factor ( PAF ) antagonists an anti inflammat ory drug inhibit ed pulmonary vascular remodeling induced by hypobaric hypoxia in rats 126 Inhibition of 5 lipoxygenase activating protein (FLAP) suppressed hypoxia induced pulmonary vasoconstriction in vitro and the development of chronic hypoxic pulmon ary hypertens ion in rats 127 Imbalance in TGF alings in PAH P athogenesis Many studies have been focused on impaired BMP signaling to explain PAH pathogenesis. However, as dysfunction of BMP pathway alone is not sufficient to

PAGE 34

34 develop PAH, r ecent studies suggest a role of imbalance in TGF / BMP signaling for PAH development because BMP and TGF pulmonary vascular homeostasis 128 BMPR2 deficient pulmonary vessels lose control of overactivation of TGF leading to predominan ce of TGF 101 103 129 Based on these reports, we hyp othesized that BMPR2 d eficiency results in overactivated TGF monstrate that BMPR2 d eficiency directly elevates TGF in vivo sys tem because even though our Bmpr2 or Smad1 cKO mice exhibit TGF pSMAD2/3, it could be a secondary effect of PAH. Hence, we isolated and immortalized pECs from a R26 creER+/ ; Bmpr 2 2f/2f m ous e, in which tamoxifen treatment induce s Bmpr2 deletion. This inducible system is advantageous because we can exclude strain and individual difference using the same parental cells Bmpr2 deleted pECs showed the low level of pSMAD1/5/8 by BMP4 treatment and enhanced phosphorylation of SM AD2 not only at the basal level but also by TGF 1 treatment compared with Bmpr2 intact pECs, supporting our hypothesis that BMPR2 d eficiency overactivates TGF in pECs. In addition, we found a marked reduction of total SMAD2 with an acc ompanyin g high level of pSMAD2. This may have arisen because activated SMAD2 is multi ubiquitinated and is degraded by the proteosome 130 132 These results from pECs present the possibility of the future therapeutic options to restore TGF /BMP imbalance. Recent reports support our results and suggest potential candidates for inhibitor of TGF pathway. Inhibition of TGF signaling by ALK5 inhibitor, IN 1233 prevented PAH in the monocrotalin treated rat which showed increased TGF activity 103 T he angiotensin II type 1 recepto r (AT1) blocker, losartan

PAGE 35

35 averted aortic aneurysm in a mouse model of Marfan syndrome ( MFS ), which is associated with increased TGF signaling 133 In the aspect of BMP activation, Irrespective of BMPR2 deficiency pECs activated SMAD1/5/8 in response to BMP7. This intact BMP7 response was also shown in SMCs with Bmpr2 deletion 77 Therefore, restoration of pSMAD1/5/8 by BMP7 could b e beneficial to PAH patients with BMPR2 deficiency T hickening of the Smooth Muscle Layer Might not be Sufficient to Lead to High Pulmonary P ress ure The PH group in L1cre(+); Smad1 2f/2f mice showed thickened vessel walls, implying that high pulmonary pressure was associated with the muscularization of pulmonary arterioles. However, Tagln cre(+); Smad1 2f/2f mice including N on PH and PH groups showed thickening of the vascular smooth muscle layer, suggesting that SMAD1 dysfunction in SMCs directly affected proliferation of vascular smooth muscles. Yang et al reported that SMAD1 dysfunction promoted MAPK signaling leading to aggressive proliferation of PASMCs 70 More importantly, our result suggests that thickening of the smooth muscle layer might not be sufficient to lead to high pulmonary pressure in the absence of related endothelial dysfunction. We speculate that SMAD1 deficiency in pECs results in endothelia l dysfunction. Pulmonary endothelial dysfunction induces sustai ned constriction of blood vessels due to an increase of vasoconstrictors such as endothelin or decrease of vasodilators such as eNOS or prostacyclin. These alterations of vasoactive molecules w ere readily observed in PAH patients 14 44 134 135 and PH animal models 136 138 C ontinued vascular constriction leads to high pulmonary pressure and results in thickening of the v ascular smooth muscle layer. However, although Smad1 deletion in SMCs induces thickening of smooth muscle layer, unaffected

PAGE 36

36 endothelial cells may enable vessels to dilate more in response to the high blood pressure gained from thickened blood vessels. Ther efore, thickening of the smooth muscle layer might not be sufficient to sustain high pulmonary blood pressure. Smad1 cKO M ice and I nducible Bmpr2 KO pECs are U seful R esource s for F uture M echanism R esearch, D rug S creening and P reclinical S tudy. In this study, we developed two useful resources for PAH studies; Smad1 cKO mice and inducible Bmpr2 KO pECs. I n the future, these mice and pECs will be usefully utilized for mechanistic research to find downstream targets of BMPR2/SMAD1 pathway for novel PAH ther apy and when candidate drugs are developed or preexisting medicines with potential effect are not tried to PAH patients, we can get valuable information about efficacy and effectiveness of candidate drugs for PAH using t hese materials.

PAGE 37

37 Table 1 1 Primers for genomic and semi quantitative PCR reaction Genomic PCR Smad1 A CACCTGTGCCCCCTCCAAGT Smad1 B GAGCTCTGCTCCGCCACTCA Alk1 F CAGCACCTACATCTTGGGTGGAGA Alk1 R ACTGTTCTTCCTCGGAGCCTTGTC Bmpr2 2A CACACCAGCCTTATACTCTAGATAC Bmpr2 6R CACATATCTGTTATGAAACTTGAG Bmpr2 2C TTATTGTAAGTACACTGTTGCTGTC L1cre F GTTTTCCTTTGAAAAACACGATGA L1cre R ATCAGGTTCTTGCGAACCTCATCA Tagln cre F CTCCTTCCAGTCCACAAACGAGC Tagln cre R GGGCGATCCCTGAACATGTCC R26R F GTCGTTTTACAACGTCGTGACT R26R R GATGGGCGCATCGTAACCGTGC RT PCR Gapdh F CAATGCATCCTGCACCACCAA Gapdh R GTCATTGAGAGCAATGCCAGC Bmpr2 F GTTGACAGGAGACCGGAAACAG Bmpr2 R GGAGACTCAGATATTTGCACAG Tgfbr2 F TTGCCTGTGTGACTTCGGGCT Tgfbr2 R CTATTTGGTAGTGTTCAGCGA Acvr2a F CGTTCGCCGTCTTTCTTATC Acvr2a R AGGATTTGAAGTGGGCTGTG Alk1 F TCATGGTGCACAGTGGTGCTG Alk1 R CAAATCCCGCTGCTTCTCCTG Alk2 F AGTCATGGTTCAGGGAGACG Alk2 R TGCAGCACTGTCCATTCTTC Alk3 F TAAAGGCCGCTATGGAGAAG Alk3 R CCAGGTCAGCAATAAGCAA Alk6 F CACTCCCATTCCTCATCAAA Alk6 R TTCCAATCTGCTTCACCATC F CGGAAGCGCATCGAAGCCATCC R GCAAGCGCAGCTCTGCACGG Nos3 F TTCCGGCTGCCACCTGATCCTAA Nos3 R AACATATGTCCTTGCTCAAGGCA Tie2 F CTCATCTGTGGACGCTGGATG Tie2 R GGCACTGAGTGGATGAAGGAG Eng F TGCACTCTGGTACATCTATTC Eng R TGGATTGGGCAGTTCTGTAAA Flk1 F AGAACACCAAAAGAGAGGAACG Flk1 R GCACACAGGCAGAAACCAGTAG

PAGE 38

38 Figure 1 1 BMP response was severely impaired in the lungs of PH mice [ L1cre (+); Bmpr2 f/f ] (A F) The levels of pSMAD1/5/8 and SMAD1 were examined to compare BMP response among lungs of cre negative controls (A,B) N PH (C) and PH mice (D F) (G H) The level of pSMAD1/5/8 was significantly decreased in the PH lungs compared to controls and N PH lungs.

PAGE 39

39 Figure 1 2 Smad1 deletion in L1cre(+); Smad1 f/f and Tagln cre(+); Smad1 f/f mice. Deleted Smad1 allele was examined in various organs of Smad1 conditional KO (cKO) mice and cre negative control mice by genomic PCR analysis. Null Smad1 was detected at 300 bp. A primer set amplifying the Alk1 locus (190 bp) was used as a control for the PCR amplification. Genomic segment between 2 loxp sites including exon2 was deleted by cre recombinase activated by tamoxifen leading to production of PCR product by a primer set (Smad1 A and Smad1 B).

PAGE 40

40 Figure 1 3 Smad1 deletion in SMCs and ECs resulted in elevation of RVSP and RV hypertrophy. ( A ) closed circles indicate RVSP of each mouse. More than 30 mmHg of RVSP was designated as pulmonary hypertensive pressure. 40% of L1cre(+);Smad1f/f mice and about 12% of Tagln cre(+);Smad1f/f mice were pulmonary hypertensive. RVSP of L1cre(+);Smad1f/f was signifi cantly higher compared to either that of controls or that of Tagln cre(+);Smad1f/f ( B ) Systemic blood pressure was not significantly different by genotypes of mice. ( C ) Both Smad1 cKO mouse lines showed significant RV hypertrophy compared to cre negative controls. ( D ) W hen mice were divided into non pulmonary hypertensive (N PH) and pulmonary hypertensive (PH) groups, RV hypertrophy of PH mice was significantly higher than cre negative controls and N PH mice of each cKO group. Statistical differences (p<0 .05) were indicated by asterisks above each bar

PAGE 41

41 Figure 1 4 Elevated pulmonary pressure is associated with pulmonary vascular remodeling. ( A D ) pulmonary arterioles were visualized by staining with anti arrowheads) is shown at higher magnification at the left bottom corner of each mice of each Smad1 cKO mice showed muscularized vessels (E) and thickened vessel walls (F) compared with cre negative controls. In terestingly, N PH group of Tagln cre(+); Smad1 f/f also exhibited muscularized vessels with thickened vessels walls. indicate s significant statistical difference (p<0.05) compared to cre negative controls.

PAGE 42

42 Figure 1 5 Deletion of Bmpr2 gene in pulmonary en dothelial cells (pECs) ( A ) pECs were treated with tamoxifen (TM) for 3 days. As shown in the diagram, TM enables cre recom binase to loop out the genomic segment containing 6R primer binding sequence and exon 4 5 which is flanked by two loxp sites (triangles). This deleted allele can produce a PCR product with the 2A 2C primer pair. Deletion of Bmpr2 gene was examined using the 2A 6R primer pair. ( B ) Following growth in TM free media, reappearance of an intact Bmpr2 gene in TM treated pECs was examined using prime r pairs for the deleted allele [ 2A 2C ] and the intact allele [ 2A 6R ] The mRNA levels of TGF signaling molecules (C) and endothelial markers (D) were examined by semi quantitative RT PCR to determine whether tamoxifen treatment for Bmpr2 deletion affected expression of other molecules in TGF characteristic.

PAGE 43

4 3 Figure 1 6 B mpr2 deleted pECs displayed a reduced response to BMP4 but not BMP7. ( A ) BMP4 (0 50 ng/ml) was added to Bmpr2 intact ( Bmpr2 2f/2f ) and Bmpr2 deleted ( Bmpr2 1f/1f ) cells for 30 minutes after serum s tarvation. The levels of pSMAD1 / 5 / 8 were examined to evaluate the BMP4 response. ( B ) The protein levels of Bmpr2 were determined for Bmpr2 2f/2f and Bmpr2 1f/1f cells. ( C ) BMP4 actin in Bmpr2 2f/2f and Bmpr2 1f/1f cells. ( D ) BMP7 (0 50 ng/ml) was added to Bmpr2 intact ( Bmpr2 2f/2f ) and Bmpr2 deleted ( Bmpr2 1f/1f ) cells for 30 minutes after serum s tarvation. The levels of pSMAD1 / 5 / 8 were determined to evaluate differences in response to BMP7. The BMP7 response was quantified by the ratio actin in Bmpr2 2f/2f and Bmpr2 1f/1f cells.

PAGE 44

44 Figure 1 7 Reduced BMP response induced overactivation of TGF ( A ) The levels of pSMAD2 were examined to compare basal TGF Bmpr2 2f/2f and Bmpr2 1f/1f cells under normal media condition without additional actin in Bmpr2 2f/2f and Bmpr2 1f/1f cells. ( B ) In order to compare TGF Bmpr2 2f/2f and Bmpr2 1f/1f cells, TG F 2 ng/ml) was added for 30 minutes after serum starvation. TGF actin in Bmpr2 2f/2f and Bmpr2 1f/1f cells.

PAGE 45

45 Figure 1 8 BMP and TGF form an opposing balance in pECs (A) Activation of TGF was supp ressed by either BMP4 or BMP7 in Bmpr2 intact pECs. 1 (0 2 ng/ml) was treated on Bmpr2 2f/2f and Bmpr2 1f/1f cells for 30 minutes after serum starvation. TGF r actin However, (B) this sup pression was induced only by BMP7, not by BMP4 in Bmpr2 deficient pECs

PAGE 46

46 CHAPTER 2 THERAPEUTIC EFFECT OF VEGF BLOCKADE ON ARTERIOVENOUS MALFORMATIONS (AVMS) IN AN ANIMAL MODEL FOR HEREDITARY HEMORRHAGIC TELANGIECTASIA Introduction Hereditary Hemorrhagic Telangiectasia (HHT) Hereditary Hemorrhagic Telangiectasia (HHT) is an inherited autosomal dominant vascular disease affecting 1 in 5,000~8,000 individuals worldwide 139 141 The disease is characterized by epistaxis (spontaneous and recurrent nosebleeds), mucocutaneous telangiectases as well as arteriovenous malformations (AVMs) in the brain, lungs, and visceral organs including the liv er and GI tract 142 145 An AVM is a direct connection between arteries and veins without intervening capillaries 142 and is an underlying defect associated with recurrent nose bleeding, telangiectases, and visceral hemorrhaging. In AVMs, high velo city arterial blood invades venous vascular beds creating turbulent and swirling flows leading to tortuous and irregular vascular remodeling. When these blood vessels rupture, it results in chronic and severe anemia due to massive blood loss. Brain and lun g hemorrhages are life threatening and the major cause of death in young patients 146 147 To compensate for the lost blood from GI and nose bleedi ng, patients receive regular blood transfusions and/or iron supplementation therapy. More than 90% of HHT patients experience recurrent nosebleeds by their 60s 148 and this affliction impacts profoundly on the patients quality of life 149 150 All the pati procedure for completely blocking nostrils said that the quality of their lives was improved following the surgery 151

PAGE 47

47 Limitation of Current Therapeutic I nterventions in HHT Therapeutic treatments are available to alleviate telangiectasia and visceral lesions. Embolization can prevent blood flow to AVM lesions by occluding blood vessels with metal coils and is effective for pulmonary and cereb ral AVMs 152 153 For acute nosebleeds, packing is a common method and in chronic and recurrent nose bleeding, procedure are applied depending on the unique condition of the patient 154 Systemic hormonal treatments or prothrombotic strategies using antifibronolytic agents have been useful in limiting excessive hemorrhag ing 155 156 However, the mechanism of hormonal efficacy remains unknown and the negative impacts of prothrombogenic agents must be considered before treatment 15 7 Thus, the development of therapies targeting the pathogenic mechanisms underlying AVM formation remains an urgent issue. Genetic S tudies in HHT H eterozygous mutations in HHT causing genes have been identified: ENG for HHT1 158 160 ALK1 for HHT2 161 162 and SMAD4 for Juve nile Polyposis and HHT (JP HHT). 163 Over 80% of HHT patients possess heterozygous mutations in one of these genes, while mutations at additional loci are responsible for the remaining 20%. These loci include the HHT3 locus (chromosome 5) 164 and the HHT4 locus (chromosome 7) 165 even though causative genes remain unidentified. Genetic Mouse M odels for HHT The role of ALK1 in HHT pathogenesis has been explored using genetically modified mouse models 166 167 Heterozygous Alk1 null mice displayed HHT like phenotypes such as age dependent subcutaneous and mucocutaneous vascular lesions as well as hemorrhages in the lungs, GI tract, liver, brain and spleen.

PAGE 48

48 Penetra nce, however, was not complete and symptoms when observed were not as severe as observed in humans. Homozygous Alk1 knockout (KO) mice died in utero displaying vascular defects such as hyper dilated blood vessels and AVMs 166 168 Targeted Alk1 deletion in endothelial cells of transgenic mice resulted in AVMs and hemorrhages in the vascular beds of brain, lung and GI tract 109 Recently, our lab demonstrated that the conditional deletion of Alk1 in ad ult mice using the tamoxifen inducible RosacreER driver recapitulated HHT phenotypes common in human patients, such as severe hemorrh aging and low hemoglobin levels. 169 Secondary Hits are Required for AVM D evelopment. AVM lesions in HHT patients and Alk1 muta nt mice appear in selective organs such as the lung, GI tract, liver and brain despite the global presence of ALK1 or ENG mutations. Even in the same organ, some vascular beds form AVMs and hemorrhage while other vessels remain normal in appearance. This s uggests that genetic predisposition is not sufficient to cause disease and other genetic or environmental factors play a role. When excisional wounds were performed on the dorsal skin and ear of Alk1 de novo AV to the wounded area 169 Vessels removed from the wounded area were unaffected. This was evidence to suggest that ALK1 deficiency and injury combined to induce the vascular lesion. Angiogenesis is variably regulated by processes associated with wound healing. These include the actions of infiltrating inflammatory cells, the turnover of extracellular matrix via matrix metalloproteinase (MMP) secretion, and the local activity of growth factors and cytokines produced by endogenous and recruited cells 170 Which event is most critical for AVM formation in Alk1 deficient blood vessels is a question we addressed in this study. We focused on LPS induced inflammation and

PAGE 49

49 growth factor induced angiogenesis. Mucocutaneous telangiectasia occur s frequently on the lips, tongue, and nose which are constantly exposed to infection. Increased levels of inflammatory markers factors such as MMP9 and interleukin 6 (IL 6) have been demonstrated in brain AVM tissue 171 172 Inflammatory cells including neutrophils and macrophages/microglia were frequently identified in the vascular walls of AVM tissue 173 In ad dition, the tissues and plasma of HHT patients contain high levels of vascular endothelial growth factor (VEGF). Vessel density was also increased 174 175 Brain AVMs usually develop congenitally during vascularization. Some case reports showed that anti angiogenesis therapy using bevazicumab and thalidomide worked well to prevent epistaxis and liver AVMs 176 177 In this report, we demonstrate that inflammation or direct angiogenic stimulation can induce AVMs in Alk1 deficient subdermal ves sels. Angiogenic stimulation is a necessary sequella to inflammation in the induction of AVM formation. Then, angiogenesis bl ockade using a VEGF neutralizing antibody is effective in alleviating wound induced AVMs and internal bleeding in GI tract and lungs in ALK1 deficient adult mice. Taken together, our findings suggest that angiogenesis blockades could be promising and funda mental medication in future clinical trials for HHT patients. Results Vascular Endothelial Growth Factor (VEGF) or Lipopolysaccharide (LPS) can I nduce De N ovo AVMs in Alk1 Deficient Subdermal V essels. In order to examine whether inflammation or angiogenesi s can induce AVM formation in Alk1 deficient mice, VEGF or LPS was administered to mice in the form of PLGA particles implanted subdermally under the dorsal skin. LPS PLGA and VEGF PLGA particles were injected into cre negative mice as a control to assess whether

PAGE 50

50 either agent alone could induce vascular lesions in the absence of an Alk1 deficiency. After 7 days, blue latex dye was infused through the left heart to visualize the blood vessels and to locate arterial venous (AV) shunts. The dye should be prohi bited from traversing capillary beds unless an AV shunt is present. The particles formed an orange round aggregation on the subdermal area because of rhodamine. After removing particle aggregates, the skin was cleared to reveal the vascular network. In Alk 1 wild type mice, a higher vascular density was evident around LPS and VEGF particle injected areas compared to neighboring regions, but vascular malformation such as AV shunts were not observed (Fig. 2 1A, B). PLGA particles themselves occasionally induce d higher vascular densities around implantation sites in Alk1 deficient mice but did not induce AV shunts. This was demonstrated in tamoxifen treated R26 creER/+ ; Alk1 2f/2f mice in which PBS PLGA was implanted into the dorsal skin. PBS PLGA had no affect on subdermal vessels (Fig. 2 1C) or, on rare occasions, induced a moderate level of abnormal vasculature (Fig. 2 1D). When VEGF PLGA was injected into Alk1 deficient skin, tortuous, irregular, and excessive vasculature developed around the particles and surrounding veins were dilated and contained latex dye, indicating the presence of AV shunts (Fig. 2 1E). LPS PLGA particles also induced a comparable level of tortuous vessels and AV shunting (Fig. 2 1F). VEGF and LPS Stimulated A ngiogenesis. VEGF is a strong angiogenic stimulator in vascularization 178 179 and tumors 180 and LPS has been to stimulate angiogenesis 181 182 Therefore, we questioned whether VEGF or LPS released from PLGA particles elicited an angiogenic response. We observed the vascular morphology around VEGF or LPS PLGA injected area 4 days following PLGA particle injection. Sprouting blood vessels were seen to be drawn

PAGE 51

51 towards the VEGF and LPS particles (Fig. 2 1G, H). This result was consistent with angiogenesis being a common, and necessary, element to both VEGF and LPS induced AVM formation. It could also be a critical factor in wo und induced AVMs. VEGF Blockade Suppressed Wound Induced AVM in Alk1 Deficient Subdermal V essels. To test the participation of VEGF in the development of inflammation induced or wound induced AVM formation, experiments were repeated in the presence of VEG F neutralizing antibody to block angiogenesis. Alk1 deficient and wounded mice were simultaneously treated with VEGF antibody or saline alone. The local vasculature was evaluated 9 days following the application of the wound. Saline treated control mice exhibited a typical AV shunts with excessive, tortuous, and dilated vessels surrounding the wound ed area (Fig. 2 2A top panels ). In contrast, AV shunts were only occasionally observed in VEGF antibody treated animals and there were fewer tortuous and irr egular vessels near the wound (Fig. 2 2A, bottom panels). Blood vessels positive for latex dye were quantified to measure the severity of AVMs in saline treated and VEGF antibody treated groups. The VEGF antibody treated group (mean: 17.38 % vessel area) d isplayed a reduction in vessel content of approximately 40% in mean vessel area relative to saline treated group (17.38 % versus 29.04 %, respectively). Thus VEGF antibody was capable of suppressing AVM formation in Alk1 deficient subdermal vessels respon ding to a wound (Fig. 2 2B). VEGF Blockade Alleviated Internal Bleeding and Low Hemoglobin O ccurring in Alk1 Deficient M ice. Alk1 deleted mice (tamoxifen treated R26 creER/+ ; Alk1 2f/2f mice) die within 2 3 weeks of tamoxifen treatment displaying severe GI, lung, and uterine hemorrhage 169 Since AVMs are a major cause of bleeding in HHT, we questioned whether

PAGE 52

52 angiogenesis blockade would suppress visceral bleeding in Alk1 deficient mice. VEG F antibody (or saline, as a control) was injected into R26 creER/+ ; Alk1 2f/2f mice following tamoxifen treatment. After 9 days, the concentration of blood hemoglobin was determined as an indirect measure of internal hemorrhaging. Normal mice had hemoglobin l evels at 15 17 g/dl (data not shown). Alk1 deficient mice treated with saline exhibited significantly lower hemoglobin levels (mean: 8.6 g/dl) indicative of severe hemorrhaging. On the other hand, VEGF antibody treated mice displayed near normal levels of hemoglobin (13.8 g/dl), suggesting that internal bleeding was greatly reduced by VEGF antibody treatment (Fig. 2 3A). Thoracic and abdominal cavities were explored for direct evidence of hemorrhaging. In addition, heart size was compared as well because poorly oxygenated blood due to severe hemorrhage would force the heart to work harder to maintain oxygen levels, leading to enlargement of the heart. The relative severity of GI and lung bleeding and heart enlargement was categorized as weak, mo derate, or severe ( Fig. 2 7 ). The saline treated group showed moderate to severe bleeding in the lungs and GI tract (1 1/12 animals; T able 2 1, Fig. 2 3B). The majority of the VEGF antibody treated group displayed weak GI and lung hemorrhaging (9/12 mice; T able 2 1, Fig 2 3B ). The hearts of saline treated group were more enlarged compared to the VEGF antibody treated group (Fig. 2 3B) suggestive that severe hemorrhaging in the mock protected group adversely affected the size of the heart. VEGF Blockade Suppressed LPS I nduced AVMs in Alk1 Deficient Subdermal V essels. To determine whether inflammation alone, in the absence of angiogenesis, could induce AVMs in Alk1 deficient mice, LPS particles were implanted in subdermal sites and animals were simultaneously treated wit h VEGF antibody to block angiogenesis.

PAGE 53

53 VEGF antibody suppressed AVM formation associated with LPS implantation and mock treatment with vehicle (saline; Fig. 2 4A through 2 4 D). This result indicates that LPS induced AVM formation is linked to angiogenic st imulation. TNF Inflammatory stimulation largely independent of an angiogenic response was evaluated with the implantation of TNF PLGA particles into Alk1 deficient mice. TNF is less actively involv ed in the monocyte induced angiogenesis compared to other inflammatory cytokines such as IL 8 183 A higher vascular density was observed around TNF ver, it did not provoke severe form of AVMs shown around LPS particles (Fig. 2 5D through 2 5 F) Discussion Although HHT is a genetic disease, vascular lesions appear only in limited vascular beds, indicating that localized secondary genetic or environmenta l insult is involved in development of AVMs Recently, we have demonstrated that wound could induce AVMs in the subdermal vessels of a mouse model of HHT2 169 In the present study, we showed that angiogenic stimulation by VEGF or LPS could mimic th e wound effect for de novo AVM formation in subdermal vessels of ALK1 deficient mice ( Fig. 2 6). We further demonstrated that treatment with VEGF neutralizing antibody could inhibit both wound and LPS induced AVMs (Fig. 2 6) and could alleviate the inter nal bleeding in the Alk1 conditional KO model These data attest to the use of angiogenesis blockade for treating epistaxis and GI bleeding in HHT patients. Therapeutic P otential of Anti A ngiogenic D rugs in HHT Recent anecdotal clinical evidence suggests that a nti angiogenic drugs can be an effective therapy for HHT The first ground breaking report came from an Australian

PAGE 54

54 group showing VEGF neutralizing antibody, Bevacizumab (Avastin) treatment effectively regressed hepatic AVMs 177 More recently, Bevacizumab treatment was shown to be effective for pancreatic AVMs 184 GI bleeding 185 186 and epistaxis 187 190 in HHT patients. Lebrin et al showed that thalidomide known to have anti angiogenic and anti inflammatory functions, enhanced mural cell recruitment in Eng+/ mouse model, and alleviated the frequency and severity of nos ebleeds in HHT patients 176 V arious side effects of Bevacizumab including cardiac failure, GI bleeding, wound healing complication, and arterial thrombo embolic events have been reported 191 In order to reduce side effects thro ugh systemic administration of B evacizumab, topical application to na sal area using spray has been tried and shown to be effective 192 193 Therapeutic Potential of Anti Inflammatory I ntervention More than 90% of patients experience nosebleeds that stem from nasal Telangiectasia, 194 indicating that the nasal muc osa is very susceptible to AVM formation. We speculate that chronic inflammation infection and immune activation in the nose might be related to the high susceptibility. Inflammatory cytokines gene expression was implicated in AVM formation as the promoter polymorphisms in IL IL 6, TNF presentation of intracranial hemorrhage 171 195 197 More recently, Torsney et al showed that inflammation in the ears and eyelids almost invariably caused bleeding from thin walled dilated vessels in the E ng +/ mouse 198 Our skin wound model demonstrated that AVMs form only in the wound areas in Alk1 deficient mice 169 and here we showed that LPS could mimic the wound effect.

PAGE 55

55 Inflammatory Stimulation Assoc iated with A ng iogenesis is Important for Inducing AVM F ormation. LPS is an endotoxin that provokes an acute inflammatory response by releasing proinflammatory cytokines including tumor necrosis factor ( TNF ) IL 6, IL 8. 199 TNF flammatory response by recruiting immune cells, induces additional proinflammatory cytokines such as IL 1 and IL 6 and inhibits apoptosis of inflammatory cells 200 201 We show that LPS can induce angiogenic stimulation in the context of an inflammatory response. Neovascularization and recruitment of sprouting blo od vessels occurred around LPS injected sites. Mattsby Baltzer et al have suggested that endotoxin mediated neovascularization is a component of inflammation and wound healing 181 LPS is associated with increased angiogenesis, vascul ar permeability, tumor cell invasion, and VEGF expression in macrophages 182 202 TNF 203 Activation of the Eck RPTK by its inducible ligand B61 i s involved in TNF induced angiogenesis 204 We showed that the AVMs formed by LPS were more severe than those by TNF Perhaps it happened because LPS might have provoke d stronger inflammatory stimulat ion by releasing various proinflammatory cytokines (including TNF induced inflammation, leading to more intensive angiogenic stimulation. For instance, it was shown that production of IL 8 which may be play a role in a more lasting my eloid cell driven angiogenesis could be induced by LPS, but not TNF 183 Taken together, our data suggest that blocking angiogenesis or inflammation could be an effective therapy for epistaxis and GI bleeding in HHT patients. Number of FDA approved drugs inhibiting angiogenesis or inflamm ation is rapidly increasing. In addition

PAGE 56

56 to angiogenesis blockade and inflammatory inhibitors, drugs targeting some other aspect of AVM formation such as antifibrinolytic agent (Tranexamic acid) 156 205 antioxidants (N Acetyl Cystein) 206 estrogen analogs (Raloxifene) 207 have been suggested for treating HHT. The preclinical model presented here would be an invaluable resource with which these potential drugs can be screen ed for effectiveness in preventing skin de novo AVMs and GI bleeding. Thus, inflammation prevention could be therapeutic for HHT patients suffering nosebleeds.

PAGE 57

57 T able 2 1. The number of mice with hemorrhage in saline and VEGF antibody treated group s Saline (n=12) VEGF Ab (n=12) GI bleeding Weak 1 7 Moderate 6 3 Severe 5 2 Lung bleeding Weak 2 9 Moderate 5 2 Severe 5 1 Liver AVM Weak 11 10 Moderate 0 1 Severe 1 1 Lung, GI bleeding and liver AVM of each mouse were categorized into three groups (weak, moderate, severe) and the number of groups was counted in saline treated (n=12) and VEGF treated (n=12) Alk1 deficient mice.

PAGE 58

58 Figure 2 1. Angiogenic or inflammatory stimulation induces AVMs in Alk1 deficient adult subdermal vessels but not Alk1 wild type vessels. VEGF PLGA and LPS PLGA were implanted under dorsal skin as an angiogenic or inflammatory stimulus, respectively. Tamoxifen (TM) was intraperitoneally injected to effect Alk1 deletion. A fter 7 days, blue latex dye was infused through the heart to visualize blood vessels in the dorsal skin and particle injected skins were cleared (see methods). (A B) VEGF (A) and LPS (B) particles did not induce AVMs in Cre negative controls ( R26 +/+ ; Alk1 2f /2f + TM) bearing wild type Alk1 alleles. (C D) PBS PLGA was implanted to investigate whether PLGA itself can induce AVM formation in Alkl deficient mice ( R26 creER/+ ; Alk1 2f/2f + TM). PBS PLGA did not induce AVMs (C) or rarely formed abnormal vasculature ( D). (E F) VEGF (E) and LPS (F) particles induced severe AVMs and tortuous vessels in ALK1 depleted vessels ( R26 creER/+ ; Alk1 2f/2f +TM). VEGF (G) and LPS (H) particles induced angiogenesis by recruiting sprouting vessels toward particles as seen 4 days post implantation of loaded particles. At left bottom are higher magnifications of recruited sprouting vessels. Scale bars in each panel indicate 1 mm.

PAGE 59

59 Figure 2 2. Angiogenesis blockade (VEGF neutralizing antibody) suppressed wound induced AVM formation in Al k1 deficient adult subdermal vessels. (A) Saline or VEGF antibody (Ab) were injected into Alk1 deficient adult mice (R26creER/+;Alk12f/2f ) to block angiogenesis. AVMs were induced by incisional wound of dorsal skin. VEGF Ab suppressed wound induced AVMs c ompared to saline treated group. Tamoxifen (TM) was treated to effect Alk1 deletion. VEGF Ab (bottom panels) suppressed wound induced AVMs compared to saline treated animals (top panels). (B) The severity of AVMs formed surrounding wound sites was calculat ed as the percentage of vessel area containing latex dye (MATLAB program). Panels on the left are representative of one experimental comparison. The graph on the right is a compilation of all data showing a significant reduction in the percentage of vessel area in VEGF treated group compared to the saline treated group. Scale bars in each panel indicate 1 mm.

PAGE 60

60 Figure 2 3. Angiogenesis blockade improved hemoglobin levels and visceral hemorrhage in Alk1 deficint adult mice. (A) Hemoglobin concentration was m easured in saline treated (n=12) and VEGF treated (n=12) Alk1 deficient mice 9 days after tamoxifen treatment to effect Alk1 deletion. VEGF blockade improved hemoglobin levels in Alk1 deficient mice relative to the saline treated group. (B) The severity of GI and lung bleeding (top) was expressed as a severity index based on direct observation and categorization. H ypertrophy of the heart (bottom) was expressed as a ratio of heart volume and tibia length ( l/cm) VEGF blockade significantly suppressed related hemorrhaging and heart enlargement in Alk1 deficient mice.

PAGE 61

61 Figure 2 4. Angiogenesis blockade suppressed LPS induced AVMs in Alk1 deficient mice. LPS particles formed aggregates on subdermal surfaces in both saline treated (A) and VEGF antibody treated (B) Alk1 deficient mice. After skins were cleared to enhance the visualization of blood vessels, AVMs were appar ent in saline treate d mice (C) but not mice treated with VEGF antibody (D). Scale bars in each panel indicate 1 mm.

PAGE 62

62 Figure 2 5. TNF Alk1 deficient mice. TNF particles were implanted under dorsal skin in tamoxifen treated Alk1 deficient mice ( R26 creER/+ ; Alk1 2f/2f ). Vessels were observed after 7 days with the latex dye. TNF treated mice (A, B and D, E) are compared with an LPS treated mouse (C and F) before (A C) and after (D F) the clearing of aggregated particles. TNF However, AVMs formed by TNF induced by LPS (F). Scale bars in e ach panel indicate 1 mm.

PAGE 63

63 Figure 2 6. Quantification of AVM formation by various stimuli in Alk1 deficient subdermal vessels. VEGF and LPS treated groups significantly promoted AVM formation compared to PBS treated group. TNF gnificantly induce AVM formation in Alk1 deficient mice. LPS induced AVM formation was suppressed by VEGF neutralizing antibody (V Ab).

PAGE 64

64 Figure 2 7 Lung (top) and GI bleeding (bottom) was categorized into three groups (weak, moderate, and severe) depending on the severity. Partial or focal hemorrhaging belonged to the weak level (left). Vast areas of hemorrhaging were categorized as severe (right). Intermediate levels of hemorrhaging were grouped as moderate (middle).

PAGE 65

65 CHAPTER 3 MATERIALS AND METHODS Smad1 Conditional Knockout M ice Generation of a conditional Smad1 allele ( Smad1 f ) was previously described 208 Generation of the Tg( Alk1 cre) L1 (L1cre) line has also been described 109 Tg( Tagln cre) and R26R mice were purchased from the Jackson Laboratory. Smad1 f/f mice were intercrossed with L1cre or Tagln cre lines. The L1cre(+); Smad1 f/+ or L1cre(+); Smad1 +/2f ;R26R males were further intercrossed with Smad1 f/f ;R26R females to produce L1cre( ); S mad1 f/f and L1cre(+); Smad1 f/f Tagln cre( ); Smad1 f/f and Tagln cre(+); Smad1 f/f were produced by the same breeding scheme. More than half of the control and experimental mice contained the R26R allele to monitor the Cre activity. PCR primer sets and conditi ons for detecting the conditional as well as null alleles of Smad1 were previously described 208 Primer sets for the genotype of L1cre, Tagln cre, or R26R are shown in Table 1 1 Hemodynamic A nalysis To evaluate pulmonary artery pressure, right ventricula r systolic pressure (RVSP) was measured by right heart catheterization through the right jugular vein. Each mouse was anesthetized by isoflurane (1 2 %) and placed in the supine position. A 1 2 cm incision was made in the neck to expose the right jugular v ein. The Mikro Tip pressure transducer (SPR 835, Millar Instrument) was inserted into right external jugular vein and advanced into the right ventricle. Systemic blood pressure was recorded non invasively using the tail cuff method. A pneumatic pulse senso r was placed on the tail distal to an occlusion cuff controlled by a Programmed Electro Sphygmomanometer (PE 300, Narco Bio Systems), which is connected to the Powerlab system (ADinstrument). All

PAGE 66

66 electrical outputs from the tail cuff, the pulse sensor and transducer were recorded and analyzed by the Powerlab 8/30 data acquisition system and associated Chart software (ADinstrument). Right Ventricular Hypertrophy (RVH) After hemodynamic analysis, mice were euthanized and using syringe generated flow, the pulmonary circulation was perfused with PBS containing heparin (3 units/ml). The hearts were isolated and outflow tracts and atria were removed. The right ventricle was cut out from the heart by the spring scissor and the right ventricle and the remaining left ventricle (LV) plus septum (S) were weighed. Right ventricular hypertrophy was determined by the ratio of RV/LV+S. Pulmonary Vessel M orphometry After the hemodynamic analysis, the left lung was inflated with PBS for 20 minutes followed by formalin at a constant inflation pressure of 23cmH2O, fixed with 4% paraformaldehyde overnight, and paraffin embedded. Each lung sample was transversely sliced i aldrich, mouse monoclonal, 1:800) using M.O.M kit (Vector laboratories) to visualize the vascular smooth muscle layer. To determine muscularizati on of pulmonary vessels, peripheral blood vessels ranging from 30 Zeiss Axioplan 2 optical microscope. The counted vessels were categorized as as fully muscularized (75 100% of medial layer covered by anti muscularized (1 74% of medial layer is covered by anti nonmuscularized vessels at the level of alveolar ducts. The percentage of pulmonary vessels in each category was calculated by dividing the number of vessels by the total

PAGE 67

67 number of counted vessels in the same field. To calculate the percentage of wall thickness (WT), circular and fully muscularized vessels were selected. WT1 (the thickness between the outer boundary and the in layer) was measured at one point of the vessel wall and WT2 at the point which was diametrically opposite, guided by Openlab 5.03 Beta software (Improvision Inc.). External diameter (ED) was also measured at the same ve ssel. The percentage of medial wall thickness was calculated as (WT1 + WT2) x100/ED. Establishment of Immortalized Pulmonary Endothelial C ells Whole lungs were removed from an eight week old R26 CreER/+ ; Bmpr2 2f/2f mouse and washed in HEPES followed by addi tional washing in DMEM. Lung tissues were finely minced using a sterile scalpel. The chopped tissues were subjected to serial digestion using 2 ml of a 1X trypsin solution [0.25% trypsin, 0.5 M EDTA (pH 8.0) in DMEM] at 37C, with frequent shaking, for thr ee times at 8 minutes each. Trypsin digestion was inactivated by adding 6 ml of normal endothelial cell media (ECM) [10% fetal bovine serum, 1 mg/ml heparine 0.1 mg/ml endothelial mitogen (Biomedical technologies), 1 mM non essential aminoacids (Cellgro), 1 mM sodium pyruvate, 50 units/ml penicillin/streptomycin] After the large debris sinking down, the supernatant was carefully collected and plated into 2 wells of a 6 well culture plate. For immortalization, when the culture reached 50% confluency post i solation, they were transfected with 4.0 g of SV40 DNA: ATCC (VRMC 3), pUCSV40 B2E 209 210 using After a couple of passages, the endothelial cells were sorted out by Fluorescence Activated Cell Sorting (FACS) using Dio Ac LDL (Biomedical technologies) and lectin (Sigma aldrich). For deleting the Bmpr2 gene, the immortalized pulmonary ECs were plated on 6 well plates

PAGE 68

68 (2x10 5 hydroxy tamoxifen (Sigma aldrich) for 3 days. Thereafter the cells were cultured with 4 hydroxy tamoxifen depleted growth medium. Primers (table 1) detecting null allele of Bmpr2 ( Bmpr2 1f/1f ) were used to confirm the deletion of Bmpr2 by tamoxifen. Semi Q uantitative RT PCR To determine the levels of transcripts of endothelial cell specific markers and genes involved in TGF Bmpr2 intact ( Bmpr2 2f/2f ) an d Bmpr2 deleted ( Bmpr2 1f/1f ) pECs were harvested at 100% confluency from a 25 cm 2 culture flask. Total RNAs from the cells were extracted using the NucleoSpin RNA purification The cDNAs were synthesized using SuperScript III First of cDNA was used as a template for PCR amplification for 25 cycles: denaturation at 94C for 45 seconds, annealing at 60C for 45 seconds and extension at 72C fo r 1 minute. The transcription level of each gene was normalized to Gapdh expression. The primers used for RT PCR analysis are shown in T able 1 1 Western B lotting Pulmonary ECs were harvested with a Chemicon lysis buffer containing 50 mM Tris (pH 6.8), 1 mM EDTA and 2% SDS and sonicated. Lysates were spun down at 13000 rpm for 15 minutes. The concentration of protein was determined using the Bio PAGE and transferred to nitrocellulos e membranes (Bio rad). Membranes were incubated with the primary antibody followed by the horseradish peroxidase linked secondary antibody. A chemiluminescent detection reagent (ECL PlusTM, Amersham Pharmacia Biotech Inc.) was used to visualize proteins. T he antibodies used for Western blotting analysis are

PAGE 69

69 the following: SMAD1 (rabbit polyclonal, 1:1000), SMAD2 (mouse monoclonal, 1:1000), pSMAD2 (rabbit polyclonal, 1:1000), pSMAD1/5/8 (rabbit polyclonal, 1:1000) from Cell actin (mouse monoclon al, 1:10,000) from Sigma aldrich, BMPR2 (mouse monoclonal, 1:500) from BD Transduction Laboratories, Secondary antibodies include: mouse (1:5000) and rabbit (1:5000) from Sigma aldrich. Alk1 C ond itional Knockout M ice Establishment of the Alk1 2f allele in l aboratory mice was described previously 109 R26 creER/+ allele carrying mice were purchased from The Jackson Laboratory By crossing R26 creER/+ line with Alk1 2f/2f mice, R26 creER/+ ; Alk1 2f/2f mice were produced and 2 4 month old mice were used in all experiments. The inactivation of the Alk1 gene in adult mice was accomplished by treating animals as previously described 169 All in vivo procedures were conducted in accordance with animal use guidelines established by the University of Florida Institutional Animal Care and Use Committee. Preparation of PLGA M icroparticles Poly (d,l lactide co glycolide) (PLGA), 50:50 composition with inherent viscosity 0.55 0.75 dl/g in hexafluoroisopropanol, HFIP (Lactel) was used to generate the particles. The emulsion stabilizer, poly vinyl alcohol (PVA) (MW ~ 100,000 g/mol) was purchased from Fi sher Science. Phosphate buffered saline (PBS) solution (Hyclone) was used as the aqueous phase to form the emulsions while methylene chloride (Fisher Scientific) was used as an organic solvent to dissolve PLGA polymer. Microparticles were formed using a st andard water oil water solvent evaporation technique 211 212 Briefly, a 3% solution of PLGA polymer in methylene chloride was generated. 1 ml of 3% PLGA (Sigma Aldrich) in PBS, Fisher Scientific

PAGE 70

70 systems) in PBS for TNF Al drich) in PBS for LPS PLGA at 26,500 rpm for 60 seconds using a tissue miser homogenizer (Fisher Scientific) to form the primary emulsion. The primary emulsion was added to 10 ml of 5% PVA solution in PBS and the homogenizing was continued at 19,500 rpm fo r 120 seconds to form the secondary emulsion. Then, the secondary emulsion was added to 100 ml of 0.5% PVA made in dIH 2 O. The particles thus formed were agitated using a magnetic stirrer for 16 hours to evaporate residual methylene chloride. The remaining solution was centrifuged at 10,000 rpm for 10 minutes to collect microparticles which were subsequently washed three times with PBS. The particle suspension in 5 ml of PBS was then flash frozen in liquid nitrogen and stored at 20 0 C until used. Injection of PLGA Particles into S ubdermal A rea The recipient mice ( R26 creER/+ ; Alk1 2f/2f and R26 +/+ ; Alk1 2f/2f ) were anesthetized by placing them within an induction chamber and introducing 4.0% isoflurane, and out of the chamber, anesthesia was maintained by 2.0% 3.0% isoflurane using a nose cone. area of the mid dorsal skin using 29 gauge 0.3 m l syringe (Monoject). Tamoxifen (TM, Sigma aldrich) was injected intraperitoneally at a dose of 2.5 mg/25 g of body weight for Alk1 gene deletion. Then, 0.6 ml of the blue latex dye (Connecticut Valley Biological Supply Co.) was injected via the left heart 7 days after TM injection to visualize the blood vessels.

PAGE 71

71 Skin Wound Generation and VEGF Antibody T reatment The recipient mice ( R26 creER/+ ; Alk1 2f/2f ) were anesthetized as described above. The hairs on the back of the mice were shaved and one 2 mm diamete r full thickness excisional wounds were inflicted on the mid dorsum using a 2 mm dermal biopsy punch (Miltex). The wounds were left unsutured, and betadine was applied to the wounds. No analgesics or antibiotics were given in order not to affect the wound healing process. TM was injected intraperitoneally at a dose of 2.5 mg/25 g of body weight and VEGF neutralizing antibody (100 of saline was serially injected on the first, 4 th and 7 th day of post wounding. On the 9 th day of post wounding, 0.6 ml of the blue latex dye was injected via the left heart. Latex Dye I njection a nd Image P rocessing Mice were anesthetized with intraperitoneal injection of ketamine/xylazine (100 mg/15 mg/kg of body weight) a nd abdominal and thoracic cavities were opened. To perfuse all the blood out, heparin (200 unit/ml, Sigma aldrich) in 10 ml PBS was infused through the left ventricle of the heart at 120 ml/hour using a syringe pump (KD scientific) after a small cut was ma de on the left atria. Then, 10 ml of PBS dilator mixture containing heparin (10 unit/ml, Sigma Aldrich), papaverine (0.04 mg/ml, Sigma Aldrich), aldrich) was infused through the same hole made on the left ventricle t o maximize dilation of blood vessels. To fix the dilated vessels 10 ml of 10% formalin was infused through the same hole on the left ventricle. Then, 0.6 ml of the blue latex dye was slowly and steadily injected into the hole of left ventricle with a 26 g auge 1 ml syringe. Then, the hair removal cream (Veet) was put on the shaved back skin of dye injected mice and the hairs were completely removed after 10 min utes incubation. The mice were washed briefly in water and fixed with 10%

PAGE 72

72 formalin overnight. Afte r fixation, the dorsal skin was peeled off, stretched, and flattened on the Styrofoam. The flattened skin was dehydrated by methanol series (20%, 50%, 75%, and 100%, each for 20 min utes ) and cleared with organic solvent (benzyl alcohol/benzyl benzoate, 1:1 ; Sigma aldrich). Blood vessels containing the latex dye in the cleared skin were imaged via a CCD camera (Leica) and processed by MATLAB (MathWorks) as described previously 169 Hemoglobin Concentration and Hemorrhage I ndex 2 3 drops of blood w ere collected from the tails of VEGF antibody treated (N=12) and saline treated mice (N=12) and soaked up by microcuvettes (STANBIO Laboratory). The concentration of hemoglobin was measured by the hemoglobin photometer (Hemopoint H2, STANBIO Laboratory) us ing the blood soaked microcuvettes. Then, after anesthesia with ketamine/xylazine, abdominal and thoracic cavities were opened and hemorrhages of lungs and gastrointestinal tract and the size of the heart were observed and categorized into three levels: we ak, moderate, and severe conditions according to the d egree of severity ( Fig ure 2 6 ). Hemorrhage levels were graded: 1.0 for weak, 2.0 for moderate, and 3.0 for severe level. The mean values were expressed as severity index. Hypertrophy of the heart After latex dye injection through the heart, hearts were taken and all the blood vessels connecting to the heart were removed. Hearts were submerged in 1.5 ml tube containing 500 l PBS and increased volume of PBS was measured as a volume of heart. Right le gs of mice were cut out in the middle of femur and were skinned off and were put in 1M NaOH overnight for digestion of tissues surrounding bones. After digestion, tissues were easily removed and the foot bone and broken femur were

PAGE 73

73 separated from the tibia by slowly pulling them. The length of whole tibia was measured by the caliper. Statistical A nalysis T test was used to determine a statistical significance between two groups, and one way Anova was used for more than 3 groups, and multiple pairwise comp arisons were made by post hoc tests (Tukey) using the Sigmaplot.

PAGE 74

74 CHAPTER 4 CONCLUDING REMARKS AND FUTURE DIRECTIONS Current therapeutic interventions for both PAH and HHT diseases are restricted to alleviate severe symptoms because they are not based on mechanistic pathology. There is a pressing need for more effective and pathology specific therapies. In PAH studies, I showed that l oss of SMAD1 function in ECs or SMCs predisposes mice to pulmonary hypertension and Impaired BMP signa ling makes TGF activated and leads to an imbalance of TGF pECs, which might be a critical factor for PAH development. From these results, I can suggest several therapeutic targets. First, reduced SMAD1 acti vity may be associated with PH development. Therefore, inhibiting phosphatase activity could be effective to maintain SMAD1 phosphorylation and its activity although it should be specific to SMAD1/5/8, not SMAD 2/3. Second, recovering from imbalance state o f TGF / BMP signaling would be therapeutic for PAH patients by suppressing over activated TGF TGF antagonists such as the angiotensin II type 1 receptor (AT1) blocker, Losartan 133 or the activin recetor like kinase 5 inhibitor, SB525334 213 may have therapeutic benefit. In addition to this, I found that BMP7 response was intact in Bmpr2 deleted pECs. Thus, treatment of BMP7 ligand could compensate for reduced level of pSMAD1/5/8 from BMPR2 deficiency. To determine whet her over activation of TGF response is a critical factor for PAH development in vivo we are planning to test whether inhibition of TGF models Smad1 or Bmpr2 cKO mice by additionally deleting genes involved in TGF

PAGE 75

75 signaling such as Tgfbr2 and Smad4 or treatment with inhibitors blocking TGF signaling, such as Activin Receptor Like Kinase 5 (ALK5) inhibitor 103 Endothelial S mad 1 deletion did not result in 100% penetracne in PH, indicating that environmental or genetic second hits are required for PAH development. As shown in Figure 1 1 I observed the marked reduction of SMAD1/5/8 phos phorylation in the lungs of PH mice, suggesting that the complete loss of SMAD1 activity in the whole lung may be essential to manifest PAH phenotype. Thus, by mating L1cre(+); Smad1 f/f with Tagln cre(+); Smad1 f/f we can delete Smad 1 gene both in endothelial and smooth muscle cells. Although these double cre KO mice did not block SMAD 1 activity in the whole lung, we can expect synergistic effect of smooth muscle thickening and endothelial dysfunction and may expect increase of penetra nce. In HHT studies, I demonstrated that inflammation or angiogenesis are sufficient to induce AVMs as second hits for ALK1 deficiency. In terms of therapeutic aspect, antagonizing inflammatory or angiogenic pathway may be effective for HHT patients. I sh owed that VEGF neutralizing antibody can prevent AVM formation and internal bleeding in Alk1 deficient adult mice. Even though effective anti inflammatory reagents are not available, IL 9 neutralizing antibody could be a useful reagent to test because IL 9 is essential factor for inflammation induced angiogenesis Up to now, many studies have focused on assessing increased response to angiogenic stimulation in Alk1 deleted endothelial cells. However, what makes this increased sensitivity as a result of Alk1 deficiency remains unclear. To address this question, we have many useful resources: pulmonary endothelial cells (pECs) mice carrying Alk1 2f/2f and Alk1 1f/1 f allele respectively, and microarray data from pECs

PAGE 76

76 ( Alk1 2f/2f and Alk1 1f/1 f ). I showed VEGF signaling is required for AVM formation with Alk1 deficiency. With above materials, examining whether Alk1 can suppress downstream of VEGF signaling or modulate interaction of VEGF and VEGF receptors and other possible hypotheses would be i nteresting and invaluable research to find novel therapeutic targets.

PAGE 77

77 LIST OF REFERENCES 1. Simonneau G, Galie N, Rubin LJ, Langleben D, Seeger W, Domenighetti G, Gibbs S, Lebrec D, Speich R, Beghetti M, Rich S, Fishman A. Clinical clas sification of pulmonary hypertension. J Am Coll Cardiol 2004;43:5S 12S 2. Highland KB. Pulmonary arterial hypertension. Am J Med Sci 2008;335:40 45 3. Yi ES, Kim H, Ahn H, Strother J, Morris T, Masliah E, Hansen LA, Park K, Friedman PJ. Distribution of o bstructive intimal lesions and their cellular phenotypes in chronic pulmonary hypertension. A morphometric and immunohistochemical study. Am J Respir Crit Care Med 2000;162:1577 1586 4. DeRuiter MC, Poelmann RE, VanMunsteren JC, Mironov V, Markwald RR, Gi ttenberger de Groot AC. Embryonic endothelial cells transdifferentiate into mesenchymal cells expressing smooth muscle actins in vivo and in vitro. Circ Res 1997;80:444 451 5. Arciniegas E, Sutton AB, Allen TD, Schor AM. Transforming growth factor beta 1 promotes the differentiation of endothelial cells into smooth muscle like cells in vitro. J Cell Sci 1992;103 ( Pt 2):521 529 6. Pietra GG, Edwards WD, Kay JM, Rich S, Kernis J, Schloo B, Ayres SM, Bergofsky EH, Brundage BH, Detre KM, et al. Histopatholog y of primary pulmonary hypertension. A qualitative and quantitative study of pulmonary blood vessels from 58 patients in the national heart, lung, and blood institute, primary pulmonary hypertension registry. Circulation 1989;80:1198 1206 7. Tuder RM, Gro ves B, Badesch DB, Voelkel NF. Exuberant endothelial cell growth and elements of inflammation are present in plexiform lesions of pulmonary hypertension. Am J Pathol 1994;144:275 285 8. Teichert Kuliszewska K, Kutryk MJ, Kuliszewski MA, Karoubi G, Courtman DW, Zucco L, Granton J, Stewart DJ. Bone morphogenetic protein receptor 2 signaling promotes pulmonary arterial endothelial cell survival: Implications for loss of function mutations in the pathogenesis of pulmonary hypertension. Circ Res 2006;98:209 217 9. Stenmark KR, Mecham RP. Cellular and molecular mechanisms of pulmonary vascular remodeling. Annu Rev Physiol 1997;59:89 144 10. Meyrick B, Reid L. The effect of continued hypoxia on rat pulmonary arterial circulation. An ultrastructural study. Lab Invest 1978;38:188 200 11. Jones R, Jacobson M, Steudel W. Alpha smooth muscle actin and microvascular precursor smooth muscle cells in pulmonary hypertension. Am J Respir Cell Mol Biol 1999;20:582 594

PAGE 78

78 12. Minamino T, Christou H, Hsieh CM, Liu Y, Dhawan V, Abraham NG, Perrella MA, Mitsialis SA, Kourembanas S. Targeted expression of heme oxygenase 1 prevents the pulmonary inflammatory and vascular responses to hypoxia. Proc Natl Acad Sci U S A 2001;98:8798 8803 13. Said SI. Mediators and modulators of pulmonary arterial hypertension. Am J Physiol Lung Cell Mol Physiol 2006;291:L547 558 14. Christman BW, McPherson CD, Newman JH, King GA, Bernard GR, Groves BM, Loyd JE. An imbalance between the excretion of thromboxane and prostacyclin metabolites in pulmonary hypertension. N Engl J Med 1992;327:70 75 15. Perros F, Dorfmuller P, Humbert M. Current insights on the pathogenesis of pulmonary arterial hypertension. Semin Respir Crit Care Med 2 005;26:355 364 16. Herve P, Humbert M, Sitbon O, Parent F, Nunes H, Legal C, Garcia G, Simonneau G. Pathobiology of pulmonary hypertension. The role of platelets and thrombosis. Clin Chest Med 2001;22:451 458 17. Gaine S. Pulmonary hypertension. Jama 200 0;284:3160 3168 18. Trembath RC, Thomson JR, Machado RD, Morgan NV, Atkinson C, Winship I, Simonneau G, Galie N, Loyd JE, Humbert M, Nichols WC, Morrell NW, Berg J, Manes A, McGaughran J, Pauciulo M, Wheeler L. Clinical and molecular genetic features of pu lmonary hypertension in patients with hereditary hemorrhagic telangiectasia. N Engl J Med 2001;345:325 334 19. Dorigo U, Fontvieille D, Humbert JF. Spatial variability in the abundance and composition of the free living bacterioplankton community in the p elagic zone of lake bourget (france). FEMS Microbiol Ecol 2006;58:109 119 20. Clapp LH, Finney P, Turcato S, Tran S, Rubin LJ, Tinker A. Differential effects of stable prostacyclin analogs on smooth muscle proliferation and cyclic amp generation in human pulmonary artery. Am J Respir Cell Mol Biol 2002;26:194 201 21. Higenbottam T, Wheeldon D, Wells F, Wallwork J. Long term treatment of primary pulmonary hypertension with continuous intravenous epoprostenol (prostacyclin). Lancet 1984;1:1046 1047 22. Bar st RJ, Rubin LJ, Long WA, McGoon MD, Rich S, Badesch DB, Groves BM, Tapson VF, Bourge RC, Brundage BH, et al. A comparison of continuous intravenous epoprostenol (prostacyclin) with conventional therapy for primary pulmonary hypertension. The primary pulmo nary hypertension study group. N Engl J Med 1996;334:296 302

PAGE 79

79 23. Sitbon O, Humbert M, Nunes H, Parent F, Garcia G, Herve P, Rainisio M, Simonneau G. Long term intravenous epoprostenol infusion in primary pulmonary hypertension: Prognostic factors and surv ival. J Am Coll Cardiol 2002;40:780 788 24. Sitbon O, Humbert M, Simonneau G. Primary pulmonary hypertension: Current therapy. Prog Cardiovasc Dis 2002;45:115 128 25. Humbert M, Sanchez O, Fartoukh M, Jagot JL, Sitbon O, Simonneau G. Treatment of severe pulmonary hypertension secondary to connective tissue diseases with continuous iv epoprostenol (prostacyclin). Chest 1998;114:80S 82S 26. Okano Y, Yoshioka T, Shimouchi A, Satoh T, Kunieda T. Orally active prostacyclin analogue in primary pulmonary hypert ension. Lancet 1997;349:1365 27. Hoeper MM, Schwarze M, Ehlerding S, Adler Schuermeyer A, Spiekerkoetter E, Niedermeyer J, Hamm M, Fabel H. Long term treatment of primary pulmonary hypertension with aerosolized iloprost, a prostacyclin analogue. N Engl J Med 2000;342:1866 1870 28. Ghofrani HA, Wiedemann R, Rose F, Olschewski H, Schermuly RT, Weissmann N, Seeger W, Grimminger F. Combination therapy with oral sildenafil and inhaled iloprost for severe pulmonary hypertension. Ann Intern Med 2002;136:515 522 29. Simonneau G, Rubin LJ, Galie N, Barst RJ, Fleming TR, Frost AE, Engel PJ, Kramer MR, Burgess G, Collings L, Cossons N, Sitbon O, Badesch DB. Addition of sildenafil to long term intravenous epoprostenol therapy in patients with pulmonary arterial hyper tension: A randomized trial. Ann Intern Med 2008;149:521 530 30. Alberts GF, Peifley KA, Johns A, Kleha JF, Winkles JA. Constitutive endothelin 1 overexpression promotes smooth muscle cell proliferation via an external autocrine loop. J Biol Chem 1994;26 9:10112 10118 31. Rich S, McLaughlin VV. Endothelin receptor blockers in cardiovascular disease. Circulation 2003;108:2184 2190 32. Hosoda K, Nakao K, Hiroshi A, Suga S, Ogawa Y, Mukoyama M, Shirakami G, Saito Y, Nakanishi S, Imura H. Cloning and expressi on of human endothelin 1 receptor cdna. FEBS Lett 1991;287:23 26 33. Ogawa Y, Nakao K, Arai H, Nakagawa O, Hosoda K, Suga S, Nakanishi S, Imura H. Molecular cloning of a non isopeptide selective human endothelin receptor. Biochem Biophys Res Commun 1991;178:248 255

PAGE 80

80 34. Giaid A, Yanagisawa M, Langleben D, Michel RP, Levy R, Shennib H, Kimura S, Masaki T, Duguid WP, Stewart DJ. Expression of endothelin 1 in the lungs of patients with pulmonary hypertension. N Engl J Med 1993;328:1732 1739 35. Wagner O F, Vierhapper H, Gasic S, Nowotny P, Waldhausl W. Regional effects and clearance of endothelin 1 across pulmonary and splanchnic circulation. Eur J Clin Invest 1992;22:277 282 36. Channick RN, Simonneau G, Sitbon O, Robbins IM, Frost A, Tapson VF, Badesch DB, Roux S, Rainisio M, Bodin F, Rubin LJ. Effects of the dual endothelin receptor antagonist bosentan in patients with pulmonary hypertension: A randomised placebo controlled stud y. Lancet 2001;358:1119 1123 37. Rubin LJ, Badesch DB, Barst RJ, Galie N, Black CM, Keogh A, Pulido T, Frost A, Roux S, Leconte I, Landzberg M, Simonneau G. Bosentan therapy for pulmonary arterial hypertension. N Engl J Med 2002;346:896 903 38. Barst RJ, Rich S, Widlitz A, Horn EM, McLaughlin V, McFarlin J. Clinical efficacy of sitaxsentan, an endothelin a receptor antagonist, in patients with pulmonary arterial hypertension: Open label pilot study. Chest 2002;121:1860 1868 39. Barst RJ, Langleben D, Fro st A, Horn EM, Oudiz R, Shapiro S, McLaughlin V, Hill N, Tapson VF, Robbins IM, Zwicke D, Duncan B, Dixon RA, Frumkin LR. Sitaxsentan therapy for pulmonary arterial hypertension. Am J Respir Crit Care Med 2004;169:441 447 40. McLaughlin VV, Sitbon O, Bade sch DB, Barst RJ, Black C, Galie N, Rainisio M, Simonneau G, Rubin LJ. Survival with first line bosentan in patients with primary pulmonary hypertension. Eur Respir J 2005;25:244 249 41. Tabrizchi R. Slv 306. Solvay. Curr Opin Investig Drugs 2003;4:329 3 32 42. Griffiths MJ, Evans TW. Inhaled nitric oxide therapy in adults. N Engl J Med 2005;353:2683 2695 43. Mehta S. Sildenafil for pulmonary arterial hypertension: Exciting, but protection required. Chest 2003;123:989 992 44. Giaid A, Saleh D. Reduced ex pression of endothelial nitric oxide synthase in the lungs of patients with pulmonary hypertension. N Engl J Med 1995;333:214 221 45. Ghofrani HA, Pepke Zaba J, Barbera JA, Channick R, Keogh AM, Gomez Sanchez MA, Kneussl M, Grimminger F. Nitric oxide path way and phosphodiesterase inhibitors in pulmonary arterial hypertension. J Am Coll Cardiol 2004;43:68S 72S

PAGE 81

81 46. Archer SL, Djaballah K, Humbert M, Weir KE, Fartoukh M, Dall'ava Santucci J, Mercier JC, Simonneau G, Dinh Xuan AT. Nitric oxide deficiency in f enfluramine and dexfenfluramine induced pulmonary hypertension. Am J Respir Crit Care Med 1998;158:1061 1067 47. Cohen AH, Hanson K, Morris K, Fouty B, McMurty IF, Clarke W, Rodman DM. Inhibition of cyclic 3' 5' guanosine monophosphate specific phosphodi esterase selectively vasodilates the pulmonary circulation in chronically hypoxic rats. J Clin Invest 1996;97:172 179 48. Jernigan NL, Resta TC. Chronic hypoxia attenuates cgmp dependent pulmonary vasodilation. Am J Physiol Lung Cell Mol Physiol 2002;282 :L1366 1375 49. Bulau P, Zakrzewicz D, Kitowska K, Leiper J, Gunther A, Grimminger F, Eickelberg O. Analysis of methylarginine metabolism in the cardiovascular system identifies the lung as a major source of adma. Am J Physiol Lung Cell Mol Physiol 2007;2 92:L18 24 50. Pullamsetti S, Kiss L, Ghofrani HA, Voswinckel R, Haredza P, Klepetko W, Aigner C, Fink L, Muyal JP, Weissmann N, Grimminger F, Seeger W, Schermuly RT. Increased levels and reduced catabolism of asymmetric and symmetric dimethylarginines in p ulmonary hypertension. FASEB J 2005;19:1175 1177 51. Frostell CG, Blomqvist H, Hedenstierna G, Lundberg J, Zapol WM. Inhaled nitric oxide selectively reverses human hypoxic pulmonary vasoconstriction without causing systemic vasodilation. Anesthesiology 1993;78:427 435 52. Frostell C, Fratacci MD, Wain JC, Jones R, Zapol WM. Inhaled nitric oxide. A selective pulmonary vasodilator reversing hypoxic pulmonary vasoconstriction. Circulation 1991;83:2038 2047 53. Galie N, Ghofrani HA, Torbicki A, Barst RJ, Ru bin LJ, Badesch D, Fleming T, Parpia T, Burgess G, Branzi A, Grimminger F, Kurzyna M, Simonneau G. Sildenafil citrate therapy for pulmonary arterial hypertension. N Engl J Med 2005;353:2148 2157 54. Golovina VA, Platoshyn O, Bailey CL, Wang J, Limsuwan A, Sweeney M, Rubin LJ, Yuan JX. Upregulated trp and enhanced capacitative ca(2+) entry in human pulmonary artery myocytes during proliferation. Am J Physiol Heart Circ Physiol 2001;280:H746 755 55. Somlyo AP, Somlyo AV. Signal transduction and regulation i n smooth muscle. Nature 1994;372:231 236 56. Rich S, Kaufmann E, Levy PS. The effect of high doses of calcium channel blockers on survival in primary pulmonary hypertension. N Engl J Med 1992;327:76 81

PAGE 82

82 57. Sitbon O, Humbert M, Jais X, Ioos V, Hamid AM, Provencher S, Garcia G, Parent F, Herve P, Simonneau G. Long term response to calcium channel blockers in idiopathic pulmonary arterial hypertension. Circulation 2005;111:3105 3111 58. Nichols WC, Koller DL, Slovis B, Foroud T, Terry VH, Arnold ND, Siemieniak DR, Wheeler L, Phillips JA, 3rd, Newman JH, Conneally PM, Ginsburg D, Loyd JE. Localization of the gene for familial primary pulmonary hypertension to chromosome 2q31 32. Nat Genet 1997;15:277 280 59. Mo rse JH, Barst RJ. Detection of familial primary pulmonary hypertension by genetic testing. N Engl J Med 1997;337:202 203 60. Deng Z, Morse JH, Slager SL, Cuervo N, Moore KJ, Venetos G, Kalachikov S, Cayanis E, Fischer SG, Barst RJ, Hodge SE, Knowles JA. F amilial primary pulmonary hypertension (gene pph1) is caused by mutations in the bone morphogenetic protein receptor ii gene. Am J Hum Genet 2000;67:737 744 61. Lane KB, Machado RD, Pauciulo MW, Thomson JR, Phillips JA, 3rd, Loyd JE, Nichols WC, Trembath RC. Heterozygous germline mutations in bmpr2, encoding a tgf beta receptor, cause familial primary pulmonary hypertension. Nat Genet 2000;26:81 84 62. Newman JH, Wheeler L, Lane KB, Loyd E, Gaddipati R, Phillips JA, 3rd, Loyd JE. Mutation in the gene for bone morphogenetic protein receptor ii as a cause of primary pulmonary hypertension in a large kindred. N Engl J Med 2001;345:319 324 63. Thomson JR, Machado RD, Pauciulo MW, Morgan NV, Humbert M, Elliott GC, Ward K, Yacoub M, Mikhail G, Rogers P, Newman J, Wheeler L, Higenbottam T, Gibbs JS, Egan J, Crozier A, Peacock A, Allcock R, Corris P, Loyd JE, Trembath RC, Nichols WC. Sporadic primary pulmonary hypertension is associated with germline mutations of the gene encoding bmpr ii, a receptor member of the tgf beta family. J Med Genet 2000;37:741 745 64. Atkinson C, Stewart S, Upton PD, Machado R, Thomson JR, Trembath RC, Morrell NW. Primary pulmonary hypertension is associated with reduced pulmonary vascular expression of type ii bone morphogenetic protein receptor. Circulation 2002;105:1672 1678 65. Ald red MA, Vijayakrishnan J, James V, Soubrier F, Gomez Sanchez MA, Martensson G, Galie N, Manes A, Corris P, Simonneau G, Humbert M, Morrell NW, Trembath RC. Bmpr2 gene rearrangements account for a significant proportion of mutations in familial and idiopath ic pulmonary arterial hypertension. Hum Mutat 2006;27:212 213

PAGE 83

83 66. Cogan JD, Vnencak Jones CL, Phillips JA, 3rd, Lane KB, Wheeler LA, Robbins IM, Garrison G, Hedges LK, Loyd JE. Gross bmpr2 gene rearrangements constitute a new cause for primary pulmonary h ypertension. Genet Med 2005;7:169 174 67. Cogan JD, Pauciulo MW, Batchman AP, Prince MA, Robbins IM, Hedges LK, Stanton KC, Wheeler LA, Phillips JA, 3rd, Loyd JE, Nichols WC. High frequency of bmpr2 exonic deletions/duplications in familial pulmonary arte rial hypertension. Am J Respir Crit Care Med 2006;174:590 598 68. Song Y, Jones JE, Beppu H, Keaney JF, Jr., Loscalzo J, Zhang YY. Increased susceptibility to pulmonary hypertension in heterozygous bmpr2 mutant mice. Circulation 2005;112:553 562 69. Long L, MacLean MR, Jeffery TK, Morecroft I, Yang X, Rudarakanchana N, Southwood M, James V, Trembath RC, Morrell NW. Serotonin increases susceptibility to pulmonary hypertension in bmpr2 deficient mice. Circ Res 2006;98:818 827 70. Yang X, Long L, Southwood M, Rudarakanchana N, Upton PD, Jeffery TK, Atkinson C, Chen H, Trembath RC, Morrell NW. Dysfunctional smad signaling contributes to abnormal smooth muscle cell proliferation in familial pulmonary arterial hypertension. Circ Res 2005;96:1053 1063 71. Humbe rt M, Morrell NW, Archer SL, Stenmark KR, MacLean MR, Lang IM, Christman BW, Weir EK, Eickelberg O, Voelkel NF, Rabinovitch M. Cellular and molecular pathobiology of pulmonary arterial hypertension. J Am Coll Cardiol 2004;43:13S 24S 72. Shi Y, Massague J. Mechanisms of tgf beta signaling from cell membrane to the nucleus. Cell 2003;113:685 700 73. Massague J. How cells read tgf beta signals. Nat Rev Mol Cell Biol 2000;1:169 178 74. Derynck R, Zhang YE. Smad dependent and smad independent pathways in tgf beta family signalling. Nature 2003;425:577 584 75. Nohe A, Keating E, Knaus P, Petersen NO. Signal transduction of bone morphogenetic protein receptors. Cell Signal 2004;16:291 299 76. Massague J. Integration of smad and mapk pathways: A link and a link er revisited. Genes Dev 2003;17:2993 2997 77. Yu PB, Beppu H, Kawai N, Li E, Bloch KD. Bone morphogenetic protein (bmp) type ii receptor deletion reveals bmp ligand specific gain of signaling in pulmonary artery smooth muscle cells. J Biol Chem 2005;280: 24443 24450

PAGE 84

84 78. Aird WC. Endothelial cell heterogeneity. Crit Care Med 2003;31:S221 230 79. Aird WC. Endothelial cell dynamics and complexity theory. Crit Care Med 2002;30:S180 185 80. Titheradge MA. Nitric oxide in septic shock. Biochim Biophys Acta 1999;1411:437 455 81. Vallance P, Chan N. Endothelial function and nitric oxide: Clinical relevance. Heart 2001;85:342 350 82. Cool CD, Stewart JS, Werahera P, Miller GJ, Williams RL, Voelkel NF, Tuder RM. Three dimensional reconstruction of pulmonary art eries in plexiform pulmonary hypertension using cell specific markers. Evidence for a dynamic and heterogeneous process of pulmonary endothelial cell growth. Am J Pathol 1999;155:411 419 83. Taraseviciene Stewart L, Kasahara Y, Alger L, Hirth P, Mc Mahon G, Waltenberger J, Voelkel NF, Tuder RM. Inhibition of the vegf receptor 2 combined with chronic hypoxia causes cell death dependent pulmonary endothelial cell proliferation and severe pulmonary hypertension. FASEB J 2001;15:427 438 84. Fagan KA, Fouty BW Tyler RC, Morris KG, Jr., Hepler LK, Sato K, LeCras TD, Abman SH, Weinberger HD, Huang PL, McMurtry IF, Rodman DM. The pulmonary circulation of homozygous or heterozygous enos null mice is hyperresponsive to mild hypoxia. J Clin Invest 1999;103:291 299 85. Steudel W, Ichinose F, Huang PL, Hurford WE, Jones RC, Bevan JA, Fishman MC, Zapol WM. Pulmonary vasoconstriction and hypertension in mice with targeted disruption of the endothelial nitric oxide synthase (nos 3) gene. Circ Res 1997;81:34 41 86. Gerac i MW, Gao B, Shepherd DC, Moore MD, Westcott JY, Fagan KA, Alger LA, Tuder RM, Voelkel NF. Pulmonary prostacyclin synthase overexpression in transgenic mice protects against development of hypoxic pulmonary hypertension. J Clin Invest 1999;103:1509 1515 8 7. Christou H, Yoshida A, Arthur V, Morita T, Kourembanas S. Increased vascular endothelial growth factor production in the lungs of rats with hypoxia induced pulmonary hypertension. Am J Respir Cell Mol Biol 1998;18:768 776 88. McQuaid KE, Keenan AK. End othelial barrier dysfunction and oxidative stress: Roles for nitric oxide? Exp Physiol 1997;82:369 376 89. Bogatcheva NV, Garcia JG, Verin AD. Molecular mechanisms of thrombin induced endothelial cell permeability. Biochemistry (Mosc) 2002;67:75 84

PAGE 85

85 90. F isher MR, Mathai SC, Champion HC, Girgis RE, Housten Harris T, Hummers L, Krishnan JA, Wigley F, Hassoun PM. Clinical differences between idiopathic and scleroderma related pulmonary hypertension. Arthritis Rheum 2006;54:3043 3050 91. Mehta NJ, Khan IA, M ehta RN, Sepkowitz DA. Hiv related pulmonary hypertension: Analytic review of 131 cases. Chest 2000;118:1133 1141 92. Isern RA, Yaneva M, Weiner E, Parke A, Rothfield N, Dantzker D, Rich S, Arnett FC. Autoantibodies in patients with primary pulmonary hypertension: Association with anti ku. Am J Med 1992;93:307 312 93. Humbert M, Monti G, Brenot F, Sitbon O, Portier A, Gr angeot Keros L, Duroux P, Galanaud P, Simonneau G, Emilie D. Increased interleukin 1 and interleukin 6 serum concentrations in severe primary pulmonary hypertension. Am J Respir Crit Care Med 1995;151:1628 1631 94. Dorfmuller P, Zarka V, Durand Gasselin I Monti G, Balabanian K, Garcia G, Capron F, Coulomb Lhermine A, Marfaing Koka A, Simonneau G, Emilie D, Humbert M. Chemokine rantes in severe pulmonary arterial hypertension. Am J Respir Crit Care Med 2002;165:534 539 95. Monti G, Magnan A, Fattal M, Rai n B, Humbert M, Mege JL, Noirclerc M, Dartevelle P, Cerrina J, Simonneau G, Galanaud P, Emilie D. Intrapulmonary production of rantes during rejection and cmv pneumonitis after lung transplantation. Transplantation 1996;61:1757 1762 96. Fartoukh M, Emilie D, Le Gall C, Monti G, Simonneau G, Humbert M. Chemokine macrophage inflammatory protein 1alpha mrna expression in lung biopsy specimens of primary pulmonary hypertension. Chest 1998;114:50S 51S 97. Balabanian K, Foussat A, Dorfmuller P, Durand Gasselin I, Capel F, Bouchet Delbos L, Portier A, Marfaing Koka A, Krzysiek R, Rimaniol AC, Simonneau G, Emilie D, Humbert M. Cx(3)c chemokine fractalkine in pulmonary arterial hypertension. Am J Respir Crit Care Med 2002;165:1419 1425 98. Schermuly RT, Dony E, Gh ofrani HA, Pullamsetti S, Savai R, Roth M, Sydykov A, Lai YJ, Weissmann N, Seeger W, Grimminger F. Reversal of experimental pulmonary hypertension by pdgf inhibition. J Clin Invest 2005;115:2811 2821 99. Ghofrani HA, Seeger W, Grimminger F. Imatinib for t he treatment of pulmonary arterial hypertension. N Engl J Med 2005;353:1412 1413 100. Newman JH, Phillips JA, 3rd, Loyd JE. Narrative review: The enigma of pulmonary arterial hypertension: New insights from genetic studies. Ann Intern Med 2008;148:278 28 3

PAGE 86

86 101. Phillips JA, 3rd, Poling JS, Phillips CA, Stanton KC, Austin ED, Cogan JD, Wheeler L, Yu C, Newman JH, Dietz HC, Loyd JE. Synergistic heterozygosity for tgfbeta1 snps and bmpr2 mutations modulates the age at diagnosis and penetrance of familial pulm onary arterial hypertension. Genet Med 2008;10:359 365 102. Zaiman AL, Podowski M, Medicherla S, Gordy K, Xu F, Zhen L, Shimoda LA, Neptune E, Higgins L, Murphy A, Chakravarty S, Protter A, Sehgal PB, Champion HC, Tuder RM. Role of the tgf beta/alk5 signaling pathway in monocrotaline induced pulmonary hypertension. Am J Respir Crit Care Med 2008;177:896 905 103. Long L, Crosby A, Yang X, Southwood M, Upton PD, Kim DK, Morrell NW. Altered bone morphogenetic protein and transforming growth factor beta signaling in rat models of pulmonary hypertension: Potential for a ctivin receptor like kinase 5 inhibition in prevention and progression of disease. Circulation 2009;119:566 576 104. Machado RD, Aldred MA, James V, Harrison RE, Patel B, Schwalbe EC, Gruenig E, Janssen B, Koehler R, Seeger W, Eickelberg O, Olschewski H, Elliott CG, Glissmeyer E, Carlquist J, Kim M, Torbicki A, Fijalkowska A, Szewczyk G, Parma J, Abramowicz MJ, Galie N, Morisaki H, Kyotani S, Nakanishi N, Morisaki T, Humbert M, Simonneau G, Sitbon O, Soubrier F, Coulet F, Morrell NW, Trembath RC. Mutations of the tgf beta type ii receptor bmpr2 in pulmonary arterial hypertension. Hum Mutat 2006;27:121 132 105. Machado RD, Pauciulo MW, Thomson JR, Lane KB, Morgan NV, Wheeler L, Phillips JA, 3rd, Newman J, Williams D, Galie N, Manes A, McNeil K, Yacoub M, Mi khail G, Rogers P, Corris P, Humbert M, Donnai D, Martensson G, Tranebjaerg L, Loyd JE, Trembath RC, Nichols WC. Bmpr2 haploinsufficiency as the inherited molecular mechanism for primary pulmonary hypertension. Am J Hum Genet 2001;68:92 102 106. Nishihara A, Watabe T, Imamura T, Miyazono K. Functional heterogeneity of bone morphogenetic protein receptor ii mutants found in patients with primary pulmonary hypertension. Mol Biol Cell 2002;13:3055 3063 107. Nohe A, Hassel S, Ehrlich M, Neubauer F, Sebald W, Henis YI, Knaus P. The mode of bone morphogenetic protein (bmp) receptor oligomerization determines different bmp 2 signaling pathways. J Biol Chem 2002;277:5330 5338 108. West J, Harral J, Lane K, Deng Y, Ickes B, Crona D, Albu S, Stewart D, Fagan K. Mic e expressing bmpr2r899x transgene in smooth muscle develop pulmonary vascular lesions. Am J Physiol Lung Cell Mol Physiol 2008;295:L744 755

PAGE 87

87 109. Park SO, Lee YJ, Seki T, Hong KH, Fliess N, Jiang Z, Park A, Wu X, Kaartinen V, Roman BL, Oh SP. Alk5 and tgf br2 independent role of alk1 in the pathogenesis of hereditary hemorrhagic telangiectasia type 2. Blood 2008;111:633 642 110. Hong KH, Lee YJ, Lee E, Park SO, Han C, Beppu H, Li E, Raizada MK, Bloch KD, Oh SP. Genetic ablation of the bmpr2 gene in pulmona ry endothelium is sufficient to predispose to pulmonary arterial hypertension. Circulation 2008;118:722 730 111. Akhurst RJ. Tgf beta signaling in health and disease. Nat Genet 2004;36:790 792 112. Grainger DJ, Heathcote K, Chiano M, Snieder H, Kemp PR, Metcalfe JC, Carter ND, Spector TD. Genetic control of the circulating concentration of transforming growth factor type beta1. Hum Mol Genet 1999;8:93 97 113. Drumm ML, Konstan MW, Schluchter MD, Handler A, Pace R, Zou F, Zariwala M, Fargo D, Xu A, Dunn J M, Darrah RJ, Dorfman R, Sandford AJ, Corey M, Zielenski J, Durie P, Goddard K, Yankaskas JR, Wright FA, Knowles MR. Genetic modifiers of lung disease in cystic fibrosis. N Engl J Med 2005;353:1443 1453 114. Lechleider RJ, Ryan JL, Garrett L, Eng C, Deng C, Wynshaw Boris A, Roberts AB. Targeted mutagenesis of smad1 reveals an essential role in chorioallantoic fusion. Dev Biol 2001;240:157 167 115. Liu S, Tian Z, Yin F, Zhang P, W Y, Ding X, Wu H, Wu Y, Peng X, Yuan J, Qiang B, Fan W, Fan M. Expression and functional roles of smad1 and bmpr ib in glioma development. Cancer Invest 2009;27:734 740 116. Khajavi M, Inoue K, Lupski JR. Nonsense mediated mrna decay modulates clinical outcome of genetic disease. Eur J Hum Genet 2006;14:1074 1081 117. Austin ED, Loyd JE, Phillips JA, 3rd. Genetics of pulmonary arterial hypertension. Semin Respir Crit Care Med 2009;30:386 398 118. Machado RD, Rudarakanchana N, Atkinson C, Flanagan JA, Harrison R, Morrell NW, Trembath RC. Functional interaction between bmpr ii and tctex 1, a light chain of dynein, is isoform specific and disrupted by mutations underlying primary pulmonary hypertension. Hum Mol Genet 2003;12:3277 3286 119. Foletta VC, Lim MA, Soosairajah J, Kelly AP, Stanley EG, Shannon M, He W, Das S, Massague J, B ernard O. Direct signaling by the bmp type ii receptor via the cytoskeletal regulator limk1. J Cell Biol 2003;162:1089 1098

PAGE 88

88 120. Hansmann G, de Jesus Perez VA, Alastalo TP, Alvira CM, Guignabert C, Bekker JM, Schellong S, Urashima T, Wang L, Morrell NW, Rabinovitch M. An antiproliferative bmp 2/ppargamma/apoe axis in human and murine smcs and its role in pulmonary hypertension. J Cl in Invest 2008;118:1846 1857 121. Li X, Zhang X, Leathers R, Makino A, Huang C, Parsa P, Macias J, Yuan JX, Jamieson SW, Thistlethwaite PA. Notch3 signaling promotes the development of pulmonary arterial hypertension. Nat Med 2009;15:1289 1297 122. Eddah ibi S, Guignabert C, Barlier Mur AM, Dewachter L, Fadel E, Dartevelle P, Humbert M, Simonneau G, Hanoun N, Saurini F, Hamon M, Adnot S. Cross talk between endothelial and smooth muscle cells in pulmonary hypertension: Critical role for serotonin induced sm ooth muscle hyperplasia. Circulation 2006;113:1857 1864 123. Pangas SA, Li X, Umans L, Zwijsen A, Huylebroeck D, Gutierrez C, Wang D, Martin JF, Jamin SP, Behringer RR, Robertson EJ, Matzuk MM. Conditional deletion of smad1 and smad5 in somatic cells of m ale and female gonads leads to metastatic tumor development in mice. Mol Cell Biol 2008;28:248 257 124. Orvis GD, Jamin SP, Kwan KM, Mishina Y, Kaartinen VM, Huang S, Roberts AB, Umans L, Huylebroeck D, Zwijsen A, Wang D, Martin JF, Behringer RR. Function al redundancy of tgf beta family type i receptors and receptor smads in mediating anti mullerian hormone induced mullerian duct regression in the mouse. Biol Reprod 2008;78:994 1001 125. Steiner MK, Syrkina OL, Kolliputi N, Mark EJ, Hales CA, Waxman AB. Interleukin 6 overexpression induces pulmonary hypertension. Circ Res 2009;104:236 244, 228p following 244 126. Ono S, Westcott JY, Voelkel NF. Paf antagonists inhibit pulmonary vascular r emodeling induced by hypobaric hypoxia in rats. J Appl Physiol 1992;73:1084 1092 127. Voelkel NF, Tuder RM, Wade K, Hoper M, Lepley RA, Goulet JL, Koller BH, Fitzpatrick F. Inhibition of 5 lipoxygenase activating protein (flap) reduces pulmonary vascular reactivity and pulmonary hypertension in hypoxic rats. J Clin Invest 1996;97:2491 2498 128. Eickelberg O, Morty RE. Transforming growth factor beta/bone morphogenic protein signaling in pulmonary arterial hypertension: Remodeling revisited. Trends Cardiov asc Med 2007;17:263 269 129. Ruiz Ortega M, Rodriguez Vita J, Sanchez Lopez E, Carvajal G, Egido J. Tgf beta signaling in vascular fibrosis. Cardiovasc Res 2007;74:196 206 130. Lo RS, Massague J. Ubiquitin dependent degradation of tgf beta activated smad 2. Nat Cell Biol 1999;1:472 478

PAGE 89

89 131. Lin X, Liang M, Feng XH. Smurf2 is a ubiquitin e3 ligase mediating proteasome dependent degradation of smad2 in transforming growth factor beta signaling. J Biol Chem 2000;275:36818 36822 132. Bonni S, Wang HR, Causin g CG, Kavsak P, Stroschein SL, Luo K, Wrana JL. Tgf beta induces assembly of a smad2 smurf2 ubiquitin ligase complex that targets snon for degradation. Nat Cell Biol 2001;3:587 595 133. Habashi JP, Judge DP, Holm TM, Cohn RD, Loeys BL, Cooper TK, Myers L, Klein EC, Liu G, Calvi C, Podowski M, Neptune ER, Halushka MK, Bedja D, Gabrielson K, Rifkin DB, Carta L, Ramirez F, Huso DL, Dietz HC. Losartan, an at1 antagonist, prevents aortic aneurysm in a mouse model of marfan syndrome. Science 2006;312:117 121 13 4. Mikhail G, Chester AH, Gibbs JS, Borland JA, Banner NR, Yacoub MH. Role of vasoactive mediators in primary and secondary pulmonary hypertension. Am J Cardiol 1998;82:254 255 135. Selimovic N, Andersson B, Bergh CH, Sakiniene E, Carlsten H, Rundqvist B. Endothelin 1 across the lung circulation in patients with pulmonary arterial hypertension and influence of epoprostenol infusion. J Heart Lung Transplant 2009;28:808 814 136. Ozaki M, Kawashima S, Yamashita T, Ohashi Y, Rikitake Y, Inoue N, Hirata KI, Ha yashi Y, Itoh H, Yokoyama M. Reduced hypoxic pulmonary vascular remodeling by nitric oxide from the endothelium. Hypertension 2001;37:322 327 137. Li H, Chen SJ, Chen YF, Meng QC, Durand J, Oparil S, Elton TS. Enhanced endothelin 1 and endothelin receptor gene expression in chronic hypoxia. J Appl Physiol 1994;77:1451 1459 138. Frasch HF, Marshall C, Marshall BE. Endothelin 1 is elevated in monocrotaline pulmonary hypertension. Am J Physiol 1999;276:L304 310 139. Bideau A, Plauchu H, Brunet G, Robert J. Epidemiological investigation of rendu osler disease in france: Its geographical distribution and prevalence. Popul 1989;44:3 22 140. Kjeldsen AD, Vase P, Green A. Hereditary haemorrhagic telangiectasia: A population based study of prevalence and mortalit y in danish patients. J Intern Med 1999;245:31 39 141. Abdalla SA, Letarte M. Hereditary haemorrhagic telangiectasia: Current views on genetics and mechanisms of disease. J Med Genet 2006;43:97 110 142. Marchuk DA, Srinivasan S, Squire TL, Zawistowski JS Vascular morphogenesis: Tales of two syndromes. Hum Mol Genet 2003;12 Spec No 1:R97 112

PAGE 90

90 143. Bertolino P, Deckers M, Lebrin F, ten Dijke P. Transforming growth factor beta signal transduction in angiogenesis and vascular disorders. Chest 2005;128:585S 590S 144. Shovlin CL, Guttmacher AE, Buscarini E, Faughnan ME, Hyland RH, Westermann CJ, Kjeldsen AD, Plauchu H. Diagnostic criteria for hereditary hemorrhagic telangiectasia (rendu osler weber syndrome). Am J Med Genet 2000;91:66 67 145. Sabba C, Pascull i G, Cirulli A, Gallitelli M, Virgilio G, Resta F, Guastamacchia E, Palasciano G. Hereditary hemorrhagic teleangiectasia (rendu osler weber disease). Minerva Cardioangiol 2002;50:221 238 146. Krings T, Chng SM, Ozanne A, Alvarez H, Rodesch G, Lasjaunias P L. Hereditary haemorrhagic telangiectasia in children. Endovascular treatment of neurovascular malformations. Results in 31 patients. Interv Neuroradiol 2005;11:13 23 147. Morgan T, McDonald J, Anderson C, Ismail M, Miller F, Mao R, Madan A, Barnes P, Hud gins L, Manning M. Intracranial hemorrhage in infants and children with hereditary hemorrhagic telangiectasia (osler weber rendu syndrome). Pediatrics 2002;109:E12 148. Shovlin CL. Hereditary haemorrhagic telangiectasia: Pathophysiology, diagnosis and treatment. Blood Rev 2010;24:203 219 149. Shah RK, Dhingra JK, Shapshay SM. Hereditary hemorrhagic telangiectasia: A review of 76 cases. Laryngoscope 2002;112:767 773 150. Karapantzos I, Tsimpiris N, Goulis DG, Van Hoecke H, Van Cauwenberge P, Danielides V. Management of epistaxis in hereditary hemorrhagic telangiectasia by nd:Yag laser and quality of life assessment using the hr qol questionnaire. Eur Arch Otorhinolaryngol 2005;262:830 833 151. Geisthoff UW, Fiorella ML, Fiorella R. Treatment of recurrent epistaxis in hht. Curr Pharm Des 2006;12:1237 1242 152. Shovlin CL, Jackson JE, Bamford KB, Jenkins IH, Benjamin AR, Ramadan H, Kulinskaya E. Primary determinants of isc haemic stroke/brain abscess risks are independent of severity of pulmonary arteriovenous malformations in hereditary haemorrhagic telangiectasia. Thorax 2008;63:259 266 153. Soderman M, Andersson T, Karlsson B, Wallace MC, Edner G. Management of patients with brain arteriovenous malformations. Eur J Radiol 2003;46:195 205

PAGE 91

91 154. Faughnan ME, Palda VA, Garcia Tsao G, Geisthoff UW, McDonald J, Proctor DD, Spears J, Brown DH, Buscarini E, Chesnutt MS, Cottin V, Ganguly A, Gossage JR, Guttmacher AE, Hyland RH, Kennedy SJ, Korzenik J, Mager JJ, Ozanne AP, Piccirillo JF, Picus D, Plauchu H, Porteous ME, Pyeritz RE, Ross DA, Sabba C, Swanson K, Terry P, Wallace MC, Westermann CJ, White RI, Young LH, Zarrabeitia R. International guidelines for the diagnosis and mana gement of hereditary haemorrhagic telangiectasia. J Med Genet 2011;48:73 87 155. Yaniv E, Preis M, Hadar T, Shvero J, Haddad M. Antiestrogen therapy for hereditary hemorrhagic telangiectasia: A double blind placebo controlled clinical trial. Laryngoscope 2009;119:284 288 156. Morales Angulo C, Perez del Molino A, Zarrabeitia R, Fernandez A, Sanz Rodriguez F, Botella LM. [treatment of epistaxes in hereditary haemorrhagic telangiectasia (rendu osler weber disease) with tranexamic acid]. Acta Otorrinolaringo l Esp 2007;58:129 132 157. Shovlin CL, Sulaiman NL, Govani FS, Jackson JE, Begbie ME. Elevated factor viii in hereditary haemorrhagic telangiectasia (hht): Association with venous thromboembolism. Thromb Haemost 2007;98:1031 1039 158. Lastella P, Sabba C Lenato GM, Resta N, Lattanzi W, Gallitelli M, Cirulli A, Guanti G. Endoglin gene mutations and polymorphisms in italian patients with hereditary haemorrhagic telangiectasia. Clin Genet 2003;63:536 540 159. McAllister KA, Grogg KM, Johnson DW, Gallione C J, Baldwin MA, Jackson CE, Helmbold EA, Markel DS, McKinnon WC, Murrell J, et al. Endoglin, a tgf beta binding protein of endothelial cells, is the gene for hereditary haemorrhagic telangiectasia type 1. Nat Genet 1994;8:345 351 160. McDonald MT, Papenber g KA, Ghosh S, Glatfelter AA, Biesecker BB, Helmbold EA, Markel DS, Zolotor A, McKinnon WC, Vanderstoep JL, et al. A disease locus for hereditary haemorrhagic telangiectasia maps to chromosome 9q33 34. Nat Genet 1994;6:197 204 161. Johnson DW, Berg JN, Ga llione CJ, McAllister KA, Warner JP, Helmbold EA, Markel DS, Jackson CE, Porteous ME, Marchuk DA. A second locus for hereditary hemorrhagic telangiectasia maps to chromosome 12. Genome Res 1995;5:21 28 162. Johnson DW, Berg JN, Baldwin MA, Gallione CJ, Ma rondel I, Yoon SJ, Stenzel TT, Speer M, Pericak Vance MA, Diamond A, Guttmacher AE, Jackson CE, Attisano L, Kucherlapati R, Porteous ME, Marchuk DA. Mutations in the activin receptor like kinase 1 gene in hereditary haemorrhagic telangiectasia type 2. Nat Genet 1996;13:189 195

PAGE 92

92 163. Gallione CJ, Repetto GM, Legius E, Rustgi AK, Schelley SL, Tejpar S, Mitchell G, Drouin E, Westermann CJ, Marchuk DA. A combined syndrome of juvenile polyposis and hereditary haemorrhagic telangiectasia associated with mutations in madh4 (smad4). Lancet 2004;363:852 859 164. Govani FS, Shovlin CL. Fine mapping of the hereditary haemorrhagic telangiectasia (hht)3 locus on chromosome 5 excludes ve cadherin 2, sprouty4 and other interval genes. J Angiogenes Res 2010;2:15 165. Bayr ak Toydemir P, McDonald J, Akarsu N, Toydemir RM, Calderon F, Tuncali T, Tang W, Miller F, Mao R. A fourth locus for hereditary hemorrhagic telangiectasia maps to chromosome 7. Am J Med Genet A 2006;140:2155 2162 166. Oh SP, Seki T, Goss KA, Imamura T, Yi Y, Donahoe PK, Li L, Miyazono K, ten Dijke P, Kim S, Li E. Activin receptor like kinase 1 modulates transforming growth factor beta 1 signaling in the regulation of angiogenesis. Proc Natl Acad Sci U S A 2000;97:2626 2631 167. Urness LD, Sorensen LK, Li DY. Arteriovenous malformations in mice lacking activin receptor like kinase 1. Nat Genet 2000;26:328 331 168. Srinivasan S, Hanes MA, Dickens T, Porteous ME, Oh SP, Hale LP, Marchuk DA. A mouse model for hereditary hemorrhagic telangiectasia (hht) type 2 Hum Mol Genet 2003;12:473 482 169. Park SO, Wankhede M, Lee YJ, Choi EJ, Fliess N, Choe SW, Oh SH, Walter G, Raizada MK, Sorg BS, Oh SP. Real time imaging of de novo arteriovenous malformation in a mouse model of hereditary hemorrhagic telangiectasia. J Clin Invest 2009;119:3487 3496 170. Velnar T, Bailey T, Smrkolj V. The wound healing process: An overview of the cellular and molecular mechanisms. J Int Med Res 2009;37:1528 1542 171. Chen Y, Pawlikowska L, Yao JS, Shen F, Zhai W, Achrol AS, Lawton MT, Kwok PY, Yang GY, Young WL. Interleukin 6 involvement in brain arteriovenous malformations. Ann Neurol 2006;59:72 80 172. Chen Y, Fan Y, Poon KY, Achrol AS, Lawton MT, Zhu Y, McCulloch C E, Hashimoto T, Lee C, Barbaro NM, Bollen AW, Yang GY, Young WL. Mmp 9 expression is associated with leukocytic but not endothelial markers in brain arteriovenous malformations. Front Biosci 2006;11:3121 3128 173. Chen Y, Zhu W, Bollen AW, Lawton MT, Barb aro NM, Dowd CF, Hashimoto T, Yang GY, Young WL. Evidence of inflammatory cell involvement in brain arteriovenous malformations. Neurosurgery 2008;62:1340 1349; discussion 1349 1350

PAGE 93

93 174. Sadick H, Naim R, Sadick M, Hormann K, Riedel F. Plasma level and ti ssue expression of angiogenic factors in patients with hereditary hemorrhagic telangiectasia. Int J Mol Med 2005;15:591 596 175. Sadick H, Naim R, Gossler U, Hormann K, Riedel F. Angiogenesis in hereditary hemorrhagic telangiectasia: Vegf165 plasma concen tration in correlation to the vegf expression and microvessel density. Int J Mol Med 2005;15:15 19 176. Lebrin F, Srun S, Raymond K, Martin S, van den Brink S, Freitas C, Breant C, Mathivet T, Larrivee B, Thomas JL, Arthur HM, Westermann CJ, Disch F, Mager JJ, Snijder RJ, Eichmann A, Mummery CL. Thalidomide stimulates vessel maturation and reduces epistaxis in individuals with hereditary hemorrhagic telangiectasia. Nat Med 2010;16:420 428 177. Mitchell A, Adams LA, MacQuillan G, Tibballs J, vanden Driesen R, Delriviere L. Bevacizumab reverses need for liver transplantation in hereditary hemorrhagic telangiec tasia. Liver Transpl 2008;14:210 213 178. Asahara T, Takahashi T, Masuda H, Kalka C, Chen D, Iwaguro H, Inai Y, Silver M, Isner JM. Vegf contributes to postnatal neovascularization by mobilizing bone marrow derived endothelial progenitor cells. EMBO J 19 99;18:3964 3972 179. Wang Y, Nakayama M, Pitulescu ME, Schmidt TS, Bochenek ML, Sakakibara A, Adams S, Davy A, Deutsch U, Luthi U, Barberis A, Benjamin LE, Makinen T, Nobes CD, Adams RH. Ephrin b2 controls vegf induced angiogenesis and lymphangiogenesis. N ature 2010;465:483 486 180. Kerbel RS. Tumor angiogenesis. N Engl J Med 2008;358:2039 2049 181. Mattsby Baltzer I, Jakobsson A, Sorbo J, Norrby K. Endotoxin is angiogenic. Int J Exp Pathol 1994;75:191 196 182. Harmey JH, Bucana CD, Lu W, Byrne AM, McDon nell S, Lynch C, Bouchier Hayes D, Dong Z. Lipopolysaccharide induced metastatic growth is associated with increased angiogenesis, vascular permeability and tumor cell invasion. Int J Cancer 2002;101:415 422 183. Koch AE, Polverini PJ, Kunkel SL, Harlow L A, DiPietro LA, Elner VM, Elner SG, Strieter RM. Interleukin 8 as a macrophage derived mediator of angiogenesis. Science 1992;258:1798 1801 184. Oosting S, Nagengast W, de Vries E. More on bevacizumab in hereditary hemorrhagic telangiectasia. N Engl J Med 2009;361:931; author reply 931 932 185. Flieger D, Hainke S, Fischbach W. Dramatic improvement in hereditary hemorrhagic telangiectasia after treatment with the vascular endothelial growth factor (vegf) antagonist bevacizumab. Ann Hematol 2006;85:631 63 2

PAGE 94

94 186. Retornaz F, Rinaldi Y, Duvoux C. More on bevacizumab in hereditary hemorrhagic telangiectasia. N Engl J Med 2009;361:931; author reply 931 932 187. Simonds J, Miller F, Mandel J, Davidson TM. The effect of bevacizumab (avastin) treatment on epistax is in hereditary hemorrhagic telangiectasia. Laryngoscope 2009;119:988 992 188. Bose P, Holter JL, Selby GB. Bevacizumab in hereditary hemorrhagic telangiectasia. N Engl J Med 2009;360:2143 2144 189. Davidson TM, Olitsky SE, Wei JL. Hereditary hemorrhagi c telangiectasia/avastin. Laryngoscope 2010;120:432 435 190. Brinkerhoff BT, Poetker DM, Choong NW. Long term therapy with bevacizumab in hereditary hemorrhagic telangiectasia. N Engl J Med 2011;364:688 689 191. Buscarini E, Manfredi G, Zambelli A. Bevac izumab to treat complicated liver vascular malformations in hereditary hemorrhagic telangiectasia: A word of caution. Liver Transpl 2008;14:1685 1686; author reply 1687 1688 192. Chen St, Karnezis T, Davidson TM. Safety of intranasal bevacizumab (avastin) treatment in patients with hereditary hemorrhagic telangiectasia associated epistaxis. Laryngoscope 2011;121:644 646 193. Karnezis TT, Davidson TM. Efficacy of intranasal bevacizumab (avastin) treatment in patients with hereditary hemorrhagic telangiecta sia associated epistaxis. Laryngoscope 2011;121:636 638 194. Plauchu H, de Chadarevian JP, Bideau A, Robert JM. Age related clinical profile of hereditary hemorrhagic telangiectasia in an epidemiologically recruited population. Am J Med Genet 1989;32:291 297 195. Kim H, Hysi PG, Pawlikowska L, Poon A, Burchard EG, Zaroff JG, Sidney S, Ko NU, Achrol AS, Lawton MT, McCulloch CE, Kwok PY, Young WL. Common variants in interleukin 1 beta gene are associated with intracranial hemorrhage and susceptib ility to brain arteriovenous malformation. Cerebrovasc Dis 2009;27:176 182 196. Achrol AS, Pawlikowska L, McCulloch CE, Poon KY, Ha C, Zaroff JG, Johnston SC, Lee C, Lawton MT, Sidney S, Marchuk DA, Kwok PY, Young WL. Tumor necrosis factor alpha 238g>a pr omoter polymorphism is associated with increased risk of new hemorrhage in the natural course of patients with brain arteriovenous malformations. Stroke 2006;37:231 234

PAGE 95

95 197. Pawlikowska L, Poon KY, Achrol AS, McCulloch CE, Ha C, Lum K, Zaroff JG, Ko NU, J ohnston SC, Sidney S, Marchuk DA, Lawton MT, Kwok PY, Young WL. Apolipoprotein e epsilon 2 is associated with new hemorrhage risk in brain arteriovenous malformations. Neurosurgery 2006;58:838 843; discussion 838 843 198. Torsney E, Charlton R, Diamond AG Burn J, Soames JV, Arthur HM. Mouse model for hereditary hemorrhagic telangiectasia has a generalized vascular abnormality. Circulation 2003;107:1653 1657 199. Martich GD, Boujoukos AJ, Suffredini AF. Response of man to endotoxin. Immunobiology 1993;18 7:403 416 200. Scallon BJ, Moore MA, Trinh H, Knight DM, Ghrayeb J. Chimeric anti tnf alpha monoclonal antibody ca2 binds recombinant transmembrane tnf alpha and activates immune effector functions. Cytokine 1995;7:251 259 201. Wong M, Ziring D, Korin Y, Desai S, Kim S, Lin J, Gjertson D, Braun J, Reed E, Singh RR. Tnfalpha blockade in human diseases: Mechanisms and future directions. Clin Immunol 2008;126:121 136 202. Botero TM, Mantellini MG, Song W, Hanks CT, Nor JE. Effect of lipopolysaccharides on va scular endothelial growth factor expression in mouse pulp cells and macrophages. Eur J Oral Sci 2003;111:228 234 203. Leibovich SJ, Polverini PJ, Shepard HM, Wiseman DM, Shively V, Nuseir N. Macrophage induced angiogenesis is mediated by tumour necrosis f actor alpha. Nature 1987;329:630 632 204. Pandey A, Shao H, Marks RM, Polverini PJ, Dixit VM. Role of b61, the ligand for the eck receptor tyrosine kinase, in tnf alpha induced angiogenesis. Science 1995;268:567 569 205. Sabba C, Gallitelli M, Palasciano G. Efficacy of unusually high doses of tranexamic acid for the treatment of epistaxis in hereditary hemorrhagic telangiectasia. N Engl J Med 2001;345:926 206. de Gussem EM, Snijder RJ, Disch FJ, Zanen P, Westermann CJ, Ma ger JJ. The effect of n acetylcysteine on epistaxis and quality of life in patients with hht: A pilot study. Rhinology 2009;47:85 88 207. Albinana V, Bernabeu Herrero ME, Zarrabeitia R, Bernabeu C, Botella LM. Estrogen therapy for hereditary haemorrhagic telangiectasia (hht): Effects of raloxifene, on endoglin and alk1 expression in endothelial cells. Thromb Haemost 2010;103:525 534

PAGE 96

96 208. Huang S, Tang B, Usoskin D, Lechleider RJ, Jamin SP, Li C, Anzano MA, Ebendal T, Deng C, Roberts AB. Conditional knocko ut of the smad1 gene. Genesis 2002;32:76 79 209. Lednicky JA, Butel JS. Tissue culture adaptation of natural isolates of simian virus 40: Changes occur in viral regulatory region but not in carboxy terminal domain of large t antigen. J Gen Virol 1997;78 ( Pt 7):1697 1705 210. Stewart AR, Lednicky JA, Butel JS. Sequence analyses of human tumor associated sv40 dnas and sv40 viral isolates from monkeys and humans. J Neurovirol 1998;4:182 193 211. Acharya AP, Clare Salzler MJ, Keselowsky BG. A high throughpu t microparticle microarray platform for dendritic cell targeting vaccines. Biomaterials 2009;30:4168 4177 212. Choe SW, Acharya AP, Keselowsky BG, Sorg BS. Intravital microscopy imaging of macrophage localization to immunogenic particles and co localized tissue oxygen saturation. Acta Biomater 2010;6:3491 3498 213. Thomas M, Docx C, Holmes AM, Beach S, Duggan N, England K, Leblanc C, Lebret C, Schindler F, Raza F, Walker C, Crosby A, Davies RJ, Morrell NW, Budd DC. Activin like kinase 5 (alk5) mediates ab normal proliferation of vascular smooth muscle cells from patients with familial pulmonary arterial hypertension and is involved in the progression of experimental pulmonary arterial hypertension induced by monocrotaline. Am J Pathol 2009;174:380 389

PAGE 97

97 BIOGRAPHICAL SKETCH Chul Han was born in Da ejon, South Korea in 19 75 He is the oldest of two sons born to Jeong gun Han and Duk ae Lee Chul attended Korea University from 1994 2003 where he studied molecular biology and biochemistry and earned a Bac helo r of Science in genetic engineering in 2001 and a Master of Science in molecular medical science in 2003 He served in the air force for two and half years (1998 2000). After graduation, Chul worked as a research scientist in the Samsung medical center (20 03 2006). Then he moved to Gainesville, Florida and joined the Interdisciplinary Program in Biomedical Sciences at the University of Fl orida College of Medicine. Chul did his graduate work in Dr. S. Paul Oh of Functional Geno mics and Physiology and complet ed his Ph.D. dissertation in August 20 11