Regulation of Rice Immunity

MISSING IMAGE

Material Information

Title:
Regulation of Rice Immunity
Physical Description:
1 online resource (160 p.)
Language:
english
Creator:
Chen,Qiang
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Plant Pathology
Committee Chair:
Song, Wen-Yuan
Committee Members:
Rollins, Jeffrey A
Jones, Jeffrey B
Rathinasabapathi, Bala

Subjects

Subjects / Keywords:
developmental -- mapk -- resistance -- rice -- temperature -- xanthomonas -- xoo
Plant Pathology -- Dissertations, Academic -- UF
Genre:
Plant Pathology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
XA21 confers resistance to bacterial blight of rice caused by Xanthomonas oryzae pv. oryzae (Xoo). The resistance progressively increases from susceptible juvenile stages to fully resistant adult stages. In this study, we have demonstrated that XA21- mediated resistance can be fully activated in juvenile plants by manipulating growth conditions. Resistance is triggered under low temperature while lost under high temperature. Distinctive resistant responses under different growth temperatures are independent of XA21 protein abundance, or Ax21 activity. The resistance is reduced dramatically by the addition of abscisic acid and jasmonic acid, but not significantly affected by application of other hormones, including indole-3-acetic acid (IAA), salicylic acid (SA), gibberellic acid (GA), brassinosteroid (BR), cytokinin (CTK), and ethylene (ET). Mitogen activated protein kinases (MAPKs) are important components of plant defense responses. This study also investigated the role of OsMPK3 and OsMPK6 in the resistance to bacterial blight disease of rice. While OsMPK3 is induced by Xoo infection, OsMPK6 protein abundance, in contrast, is not affected. A 48-KDa protein corresponding to OsMPK6 is activated by Xoo inoculation specifically in susceptible plants. The activation process is disrupted by the Xoo resistance genes Xa21 and xa13. Genetic analyses show that loss of OsMPK3 does not alter the response to the challenge of Xoo. However, down-regulation of OsMPK6 by antisense (AS) leads to an enhanced resistance to Xoo, accompanied with constitutive expression of pathogenesis related (PR) genes. OsMPK6AS plants display dwarfism and produce smaller seeds. The dwarfism can be rescued by application of gibberellic acid. Change of metabolic related protein accumulation in OsMPK6AS plants has been identified by a proteomics approach, indicating that OsMPK6 is involved in rice development in addition to the defense response.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Qiang Chen.
Thesis:
Thesis (Ph.D.)--University of Florida, 2011.
Local:
Adviser: Song, Wen-Yuan.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043268:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 REGULATION OF RICE IMMUNITY By QIANG CHE N A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Qiang Chen

PAGE 3

3 To my parents, for their unconditional love

PAGE 4

4 ACKNOWLEDGMENTS I would like to express my gratitude to all those who gave me the possibility to complete this thesis. I am deeply indebted to my supervisor y committee chair, Dr. Wen Y uan Song, for his encouragement guidance and support during my doctoral study I am greatly encouraged by his scientific attitude. He is always willing to share his experience and knowledge when I experience difficulties; forgiving when I make mistakes; and encouraging when I am down. I woul d li ke to acknowledge Dr s Jeffrey B Jones, Jeffrey A Rollins, Bala Rathinasabapathi for serving on my committee their academic assistance and expertise I woul d also like to show my appreciation for Dr Lawerence E. Datnoff for his support I woul d like t o give my special thank s to all members working in Song lab, Xiuhua Chen, Xiaoen Huang and Terry A. Davoli, who afforded me sharing and help in all kinds of issues. I acknowledge Dr Sixue Chen and his lab members for their helping in the proteomics study. I a m grateful to all faculty and staff in the Department of Plant Pathology for their help I personally thank all my friends here in Gainesville and in China, for thei r friendship accompanying me. I wish all of them more success in their future career an d study. Most importantly I woul d like to thank my parents and sisters in China for their unconditional love. Without their support, I would not have be en able to pursue my study here

PAGE 5

5 TABLE OF CONTENTS page ACKNOWL EDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 LIST OF ABBREVIATI ONS ................................ ................................ ........................... 10 ABSTRACT ................................ ................................ ................................ ................... 14 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 16 1.1 Plant Immunity ................................ ................................ ................................ .. 16 1.1.1 PTI ................................ ................................ ................................ ........... 16 1.1.2 Effector Triggered Susceptibility (ETS) ................................ .................... 20 1.1.3 Effector Triggered Immunity (ETI) ................................ ........................... 22 1.1.4 Defense Signaling ................................ ................................ ................... 29 1.2 Bacterial Blight of Rice ................................ ................................ ...................... 36 1.2.1 Effectors ................................ ................................ ................................ .. 37 1.2.2 R Proteins ................................ ................................ ................................ 42 1.3 XA21 Ax21 system ................................ ................................ ........................... 45 2 CHARACTERIZATION OF DEVELOPMENTAL REGULATION OF Xa21 MEDIATED RESISTANCE ................................ ................................ ..................... 54 2.1 Background Information ................................ ................................ .................... 54 2.2 Materials and Methods ................................ ................................ ...................... 58 2.2.1 Plant M aterials a nd G rowth C onditions ................................ ................... 58 2.2.2 Xoo I noculation and B acteria l P opulation D etermination ......................... 59 2.2.3 Bacterial Population Study ................................ ................................ ...... 59 2.2.4 Protein Extraction ................................ ................................ .................... 60 2.2.5 Immunodetection ................................ ................................ ..................... 60 2.2.6 RNA I solation ................................ ................................ .......................... 61 2.2. 7 Microarray Analysis ................................ ................................ ................. 62 2.3 Results ................................ ................................ ................................ .............. 63 2.3.1 XA21 mediated Resistance w as Activated a t t he Seedling Stage ........... 63 2.3.2 Temperature was t he Key Environmental Regulator o f XA21 Mediated Resistance at the Seedling Stage ................................ ................................ 65 2.3.3 Activation of XA21 mediated Resistance Requires Constant Low Temperature Treatm ent ................................ ................................ ................ 66 2.3. 4 Temperature Effect o f XA21 Mediated Resistance w as Independent o f Pathogen Activity o r XA21 Abundance ................................ ......................... 67

PAGE 6

6 2.3.5 High Temperature Deregulates Expression of Rice Genes Related to Defense Responses ................................ ................................ ...................... 69 2.3. 6 Inhibition of X A21 Mediated Resistance at Seedling Stage by JA and ABA Application ................................ ................................ ............................ 70 2.4 Discussion ................................ ................................ ................................ ........ 71 3 ROLE OF MAPKS IN RICE DEFENSE RESPONSE AND DEV E LOPMENT ......... 90 3 .1 Background Information ................................ ................................ .................... 90 3 .2 Material and Methods ................................ ................................ ....................... 93 3.2.1 Sequence Analysis ................................ ................................ .................. 93 3 .2. 2 Plant Growth ................................ ................................ ............................ 93 3.2.3 Identification of Homozygous T DNA Insertion Mutants .......................... 94 3.2.4 Immunoprecipitation ( IP) Assay ................................ ............................... 96 3.2.5 Analysis of Osmpk3 and Osmpk6 Protein and Activity ............................ 96 3.2.6 RNA Hybridization ................................ ................................ ................... 97 3 .2.7 Polymerase Chain Reaction (PCR) ................................ ......................... 98 3.2.8 Generation of Osmpk6 Antisense (AS) and Overexpressing (OX) Plants ................................ ................................ ................................ ............ 98 3.2.9 Agrobacterium M ediated T ransformation. ................................ ............. 100 3.2.10 Plant Proteomics Analysis ................................ ................................ ... 102 3 .3 Results ................................ ................................ ................................ ............ 105 3 .3.1 Os MPK 3 a nd O sM PK6 a re Putative Orth ologues o f At MPK 3 a nd At MPK 6 ................................ ................................ ................................ ....... 105 3 .3.2 OsMPK3 and OsMPK6 are Differentially Controlled i n Rice Xoo Interactions ................................ ................................ ................................ .. 105 3 .3.3 Os MPK6AS Plants a re Partly Resistant t o Xoo ................................ ..... 107 3 .3. 4 OsMPK6 is Involved in Plant Development ................................ ........... 110 3 .3.5 GA Treatment Rescued t he Dwarfism in MPK6AS P lants ..................... 112 3.3.6 MPK6AS Plants Displayed Altered Protein Accumulation Invo lved in Multiple Processes ................................ ................................ ...................... 112 3.3.7 OsMPK6OX Plants Display Abnormal Growth ................................ ...... 114 3 .4 Discussion ................................ ................................ ................................ ...... 114 4 SUMMARY AND FUTURE PERSPECTIVES ................................ ....................... 141 LIST OF REFERENCES ................................ ................................ ............................. 143 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 160

PAGE 7

7 LIST OF TABLES Table page 1 1 Comparison of PTI, ETI and XA21 Ax21 systems ................................ .............. 53 2 1 Biotic st ress related genes upregulated by high temperature treatment ............. 86 2 2 Biotic stress related genes downregulated by high temperature treatment ........ 87 3 1 Primers used in this study ................................ ................................ ................ 121 3 2 Fold change of proteins in MPK6AS compared to TP309 plants ...................... 139

PAGE 8

8 LIST OF FIGURES Figure page 1 1 The principles of plant immunity to bacterial pathogens. ................................ .... 51 1 2 Models of recognition between effectors and R proteins. ................................ ... 52 2 1 Activation of XA2 resistance at the seedling stage. ................................ ............ 78 2 2 Validation of XA2 1 resistance at the seedling stage in Xa21 donor lin e IRBB21 at 26 27 ................................ ................................ ................................ 79 2 3 Investigation of environment al factors in XA21 resistance at the seedling stage. ................................ ................................ ................................ .................. 80 2 4 E ffect of t empe rature on XA21 resistance. ................................ ......................... 81 2 5 Reversible regulation of X A 21 resistance by temperature at the seedling stage. ................................ ................................ ................................ .................. 82 2 6 Analysis of pathogen and XA21 level at low (L) and high (H) temperatures. ...... 83 2 7 Valcano plot of microarray data. ................................ ................................ ......... 84 2 8 Summary of gene s regulated by high temperature (31 32 C) ............................ 85 2 9 Effect of hormone application on X A 21 mediated resistance. ............................ 88 2 10 Inhibition of X A 21 mediated resistance by JA and ABA. ................................ .... 89 3 1 ClustalW phylogenetic analysis of Arabidopsis, rice MAPKs TaMPK3 and Ta M PK6 ................................ ................................ ................................ .......... 122 3 2 Information of OsMPK3 and OsMPK6 specific antibodies. ............................... 123 3 3 Detection of OsMPK3 and OsMPK6 in inoculated TP309 and 4021 3 plants. .. 124 3 4 Induction of OsMPK6 activity in IR24 and IRBB13 plants after challenge with PXO99a tested by in gel kinase assay. ................................ ............................ 125 3 5 Identification of OsMPK3 knock out mutants. ................................ ................... 126 3 6 Inoculation of OsMPK3 knock out mutants at adult stage with PXO99a. .......... 127 3 7 Generation of OsMPK6AS plants. ................................ ................................ .... 128 3 8 Inoculation of OsMPK6 AS plants at the adult stage with Xoo strain PXO99a. 129

PAGE 9

9 3 9 Inoculation of OsMPK6 AS T1 plants with PXO99a at adult stage. .................. 130 3 10 OsMPK6 plants displaying dwarf phenotype. ................................ ................... 131 3 11 Small panicles produced by T0 OsMPK6AS plants. ................................ ......... 132 3 12 Smaller seeds produced by T0 OsMPK6AS plants. ................................ ......... 133 3 13 Bushy and dwarf phenotype of T1 OsMPK6AS plants at young stage. ............ 134 3 14 Dwarf phenotype and smaller panicle length of OsMPK6AS T1 plants cosegregated with antisense. ................................ ................................ ........... 135 3 15 Smaller seeds from OsMPK6AS T1 plants. ................................ ...................... 136 3 16 GA treatment of TP309 and MPK6AS plants. ................................ ................... 137 3 1 7 Phenotype of MPK6OX plants. ................................ ................................ ......... 138

PAGE 10

10 LIST OF ABBREVIATION S AB Agrobacterium induction ABA abscis i c acid AD activation domain APHIS Animal Plant Health Inspection Service ARR age related resistance AS a ntisense Ax21 activation of Xa21 BAK1 BRI1 associated kinase 1 bHLH basic helix loop helix BR brasinosteroid BSA bovine serum albumin c fu colony forming units CRR central repeat region CTAB cetyltrimethylammonium bromide CTK cytokinin dNTP d eoxyribonucleotide triphosphate dpi days post inoculation EDTA e thylenediaminetetraacetic acid EF e longation factor EFR elongation factor receptor EGTA ethylene glycol tetraacetic acid EPS exopolysaccharide ET ethylene ETI effector triggered immunity

PAGE 11

11 ETS effector triggered susceptibility FL fluorescen t light FLS2 flagellin sensi tive 2 GA gib b errelic a cid GUS glucuronidases H high temperature Hpi hour post inoculation HR hypersensitive response IAA indo 3 acetic acid ICBR Interdisciplinary Center for Biotechnology Research IEF isoelectric focusing IP i mmunoprecipitation IRRI International Rice Research Institute i TRAQ isobaric tag for relative and absolute quantitation JA jasmonic acid KR1 Korean Race 1 L low temperature LRR leucine rich repeat MAMP microbe associated molecular pattern MAPK mitogen activated protein kinase MAPKK, MEK, MKK MAPK kinase MAP KKK, MAP3K, MEKK MAPK kinase kinase MBP myelin basic protein MH metal halide light MKS1 MAP kinase substrate 1

PAGE 12

12 MS Murashige and Skoog NB nucleo (tide) binding NLS nuclear localization signal OX o verexpressing PAMP pathogen associated molecular pattern PCR p olymerase chain reaction PMSF phenylmethanesulfonylfluoride PR pathogenesis related PRR Pattern recognition receptor PSA peptone sucrose agar Pst Pseudomonas syringae pv. tomato PTI PAMP triggered immunity PVP polyvinylpyrrolidone QS quorum sensing R gene resistance gene R protein resistance protein RLK receptor like kinase RNAi RNA interferencing ROS Reactive oxygen species RVD repeat variable diresidue SA salicylic acid SAR systemic acquired resistance SCX strong cation exchange SDS PAGE sodium dodecyl su lfate polyacrylamide gel electrophoresis SIPK SA induced protein kinase

PAGE 13

13 SPCH SPEECH L ESS ssDNA salmon sperm DNA T1SS Type 1 secretion system T2SS Type 2 secretion system T3SS Type 3 secretion system TALes transcription activator like effectors TCA trichloro acetic acid TMV tobacco mosaic virus WIPK wounding induced protein kinase Xac Xanthomonas axonopodis pv citri XB X A 21 binding protein Xoo Xanthomonas oryzae pv. oryzae YM yeast extract mannitol ME mercaptomethano l

PAGE 14

14 Abstract o f Dissertation Presented t o the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy REGULATION OF RICE IMMUNITY By Qiang C hen August 2011 Chair: Wen Yuan Song Major: Plant Pathology X A 21 confers resistance to bacterial blight of rice caused by Xanthomonas oryzae pv. oryzae ( Xoo ) The resistance progressively increases f rom susceptible juvenile stages to full y resistan t adult stages. In this study we have demonstrated that X A 2 1 mediate d resistance can be fully activated in juvenile plants by manipulating growth conditions. Resistance i s triggered under low temperature while lost under high temperature. Distinctive resistant responses under different growth temperatures a re independent o f XA21 protein abundance or Ax21 acti v ity The resistance i s reduced dramatically by the addition of abscisic acid and jasmonic acid, but not significantly affected by application of other hormones, including indo le 3 acetic acid (IAA) salicylic acid (SA ) gibberellic acid (GA) brassinosteroid (BR) cytokinin (CTK) and ethylene (ET) Mitogen activated protein kinases (MAPKs) are important components of plant defense response s T his study also investigated the role of OsMPK3 and OsMPK6 in the resistance to bacterial blight disease of rice. While OsMPK3 i s induced by Xoo infection, OsMPK6 pr otein abundance, in contrast, i s not affected. A 48 KDa protein corresponding to OsMPK6 i s activated by Xoo inoculation specifically in susceptible

PAGE 15

15 p lants. The activati on process i s disrupted by the Xoo resistance genes Xa21 and xa13 Gene tic analyses show that loss of OsMPK3 does not alter the response to the challenge of Xoo However, down regulation of Os MPK 6 by antisense ( AS ) le a d s to an enhanced resistance to Xoo a ccompanied with constitutive expression of pathogenesis related ( PR ) genes. OsMPK6 AS plants display dwarfism and produce smaller seeds The dwarfism can be rescued by application of gibberellic acid. Change of metabolic related protein accumulation in OsMP K6AS plants has been identified by a proteomics approach indicating that OsMPK6 i s involved in rice development in addition to the defense response.

PAGE 16

16 CHAPTER 1 INTRODUCTION 1.1 Plant Immunity With the explosion of world population, it is of vital impor tance to maintain high yield s and a stable quality of crops to m eet the ever increasing need f or food supply. P lants as a major source of nutrients and energy, are subject to huge economic losses due to various disease s Plants, unlike animals, are sessil e and lack active strategies or adaptive immune systems to cope with pathogen attack. Instead, plants have developed unique approaches to protect themselves from pathogen attack I n the evolving war against pathogens, plants generally rely on two major cat egories of innate immune responses, phrased in classical plant pathology as basal or horizontal resistance and resistance ( R ) gene mediated resistance or vertical resistance (Boller and Felix, 2009) The terms pathogen associated molecular pattern (PAMP) triggered immunity (PTI) and effector triggered immunity (ETI) are now being increasingly used to describe the plant immune architectu re, because the former is elicited by conserved elements identifying a whole class of microbes while the latter is triggered by specific effectors (Jones and Dangl, 2006) (Fig. 1 1) 1.1.1 PTI Pathogen associated molecular patterns (PAMPs). PAMPs are molecul ar signatures conserved across different species activating plant basal de fense (Boller and Felix, 2009) The presence of PAMPs is detected by hosts at the very early infection stage The best studied exampl es of PAMPs identified from plant pathogen s include flg22, a conserved series of peptide s at the N terminal of bacteria l flagellin (Gomez Gomez and Boller, 2000) ; EF Tu elongation factors i nvolved in protein synthesis mostly

PAGE 17

17 studied in Agrobac terium (Zipfel et al ., 2006) ; and chitin, the primary component of fungal cell wall s (Bent and Mackey, 2007) Generally, PAMPs are required to maintain a normal microbial life cycle (Jones and Dangl, 2006) For example, flagellin encodes a core component of the flagellum required for bacteria l movement (Gomez Gomez and Boller, 2000) Bacteria with mutated flg22 display reduced virulence and impair ed mot i lity (Dodds and Rathjen, 2010) F lagellin is evolutionarily stable whether the microbe is pathogenic or not. As a result, t he phrase microbe associated molecular pattern (MAMP) is now gaining favor over PAMP, but the term PAMP will be used throughout the dissertation, consistent with the term PTI (Bent and Mackey, 2007) PTI has long been underappreciated because of the challenges to experimentally validate the importance of PTI in the plant microbe interaction s (Boiler and He, 2009) Although there are numerous experiments showing the induction of defense responses by purified or synthetic PAMP compounds, it is an artificial circumstance different from natural infection in terms of dosage as well as infection sites (Bent and Mackey, 2007) The indispensible role of PAMPs in pathogen viability makes it unachievable to analyze the PAMP knock out mutants D ue to the impaired viability of PAMP mutants reduced pathogenicity rather than increased infection will be ob served with PAMP mutants (Bent and Mackey, 2007) The first piece of compelling evidence wa s provided by mutation of the cognate receptor protein recogniz ing flg22 (Bent and Mackey, 2007) The significant contribution of flg22 recognition to resist ance i s well exe mplified by the fact that knock out of the flg22 receptor ma k e s the plants more vulnerable to bacterial infection (Zipfel et al ., 2004)

PAGE 18

18 Pattern recognition receptors (PRRs). Plant proteins responsible for recognition of PAMPs are termed pattern recognition receptors ( PRRs) (Boller and Felix, 2009) It is speculated that plants possess a large collection of PRRs to ensure the immunity to the hundred s of the microbes in the environment Nevertheless, most information to date on PRRs is mainly based on the study of flagellin sensi tive 2 (FLS2) and elongation factor receptor (EFR) T he majority of the PRRs remain to be discovered (Bent and Mackey, 2007) FLS2 and EFR are both membrane receptor like kinase (RLK) proteins with an extracellular leucine rich repeat (LRR) domain and an intracellular kinase domain ( Gomez Gomez and Boller, 2000; Chinchilla et al ., 2006; Bent and Macke y, 2007) The Arabidopsis thaliana genome contain s up to 610 members of the RLK gene family, many of which are involved in biotic stress, indicating the possible presence of additional PAMP PTI combinations (Lehti Shiu et al ., 2009) The interplay between PRRs and PAMPs occur in the extracellular spaces (Dodds and Rathjen, 2010) PTI is a quick but weak defense re sponse, also referred to as non host resistance, based on the fact that it is primarily responsible for resistan ce to non adapted pathogens (Dodds and Rathjen, 2010) A concept encompassed in PAMP and PTI is the universal presence and detection of the signals (Dodds and Rathjen, 2010) As a matter of fact, PAMP s and PRRs are both under natural selection, and an individual plant can mount immune response s only to a certain set of potential PAMPs (Dodds and Rathjen, 2010) Sequence analyse s of flagellin domain s in Xanthomonas campestris pv. campestr is revealed amino acid differences sufficient to evade recognition by hosts (Sun et al ., 2006) Flg22 from Agrobacterium tumefaciens cannot

PAGE 19

19 trigger PTI in Arabidopsis as effectively as th at from Pseudomonas (Felix et al ., 1999) Instead, the EF Tu proteins are dominant elicitors carried by A. tumefaciens triggering PTI. Correspondingly, PAMP perception in different species is variable. The recognition of EF Tu has only been discovered in Brassica (Kunze et al ., 2004; Dodds and Rathjen, 2010) FLS2 signaling The best studied example of PTI is the response triggered by the recognition of flg22 by FLS2 (Chinchilla et al ., 2006) Flg22 is the highly conserved 22 amino acid motif at the N terminus of flagellin protein, the main building block of bacteria l flagellum (Felix et al ., 1999) The conserved 22 amino acid residues are sufficient for the recognition by FLS2 and the immune signaling (Felix et al ., 1999; Gomez Gomez and Boller, 2000; Asai et al ., 2002) The extracellular LRR domain of FLS2 is dedicated t o flg22 perception through direct binding while the kinase domain is responsible for the subsequent phosphorylation of the partner substrates to trigger the downstream pathways (Gomez Gomez and Boller, 2000) FLS2 represents a conserved, ancien t gene family as the FLS2 homolog in rice also re tain s the ability to sense flagellin (Chinchilla et al ., 2006) FLS2 mutants exhibit increased susceptibility to spray application of Pseudomonas syringae but not to infiltration of P. syringae (Zipfel et al ., 2004) suggesting a protective role of FLS2 at the early infection stage. When FLS2 perceives the presence o f flg22, FLS2 assemble s an active complex with brassinosteroid insensitive1 associated kinase1 (BAK1) and undergo endocytosis, triggering the downstream signal pathways comprised of a quick rearrangement of host transcriptome, activation of the mitogen act ivated protein kinase (MAPK) cascades, induction of WRKY transcription factors, expression of pathogenesis related ( PR )

PAGE 20

20 genes, deposition of callose and production of anti microbial compounds (Robatzek et al ., 2006 ; Chinchilla et al ., 2007) Notably, flg22 treatment induces the expression of EFR, the cognate receptor of EF Tu (Jones and Dangl, 2006) Consistently, the majority of genes induced by flg22 treatment are also upregulated by EF Tu perception, indicating convergent downstream components shared by different PTI responses (Jones and Dangl, 2006) Although PTI is a primitive weak defense response, it establishe s the first barrier to most microbes in addition to the preformed physical barriers (Bent and Mackey, 2007) 1.1.2 Effector T riggered S usceptibility ( ETS ) To successfully invade plants, microbes secrete various effectors to overcome PTI for disease development (Fig. 1 1 ) Effectors are pathogen derivatives dampening PTI and contributing to virulence through interacti on with hosts (Jones and Dangl, 2006) M ost knowledge on effectors comes from research on bacterial effector proteins secreted by the type 3 secretion system ( T3SS ) (Chang et al ., 2004; Grant e t al ., 2006) T3SS is a needle like structure in gram negative bacteria, translocating the infection related effector proteins into the host cell cytosol (Lahaye and Bonas, 2001) Bacteria impaired in T3SS are non pathogenic implying the vital ro le of T3SS or T3 effectors in pathogenesis (Buttner and He, 2009) On average, 15 to 20 effectors are delivered into host cells by an individual bacteria strain (Jones and Dangl, 2006) In stark contrast to PAMPs, the repertoire of effectors secreted by an individual species are under diversifying selection and do not always perform house keeping functio ns (Bent and Ma ckey, 2007) Effectors of individual strains demonstrate great diversity as well as redundancy (Bent and Mackey, 2007; Dodds and Rathjen, 2010) In most cases,

PAGE 21

21 effectors are functionally interchangeable (Bent and Mackey, 2007) Exceptions also exist as in the cases of the major virulence factors identified in Xanthomonas species in which mutation of a single effecto r gene can severely r educe the virulence of Xanthomona s strains (Shen and Ronald, 2002; Yang and White, 2004) The host targets of effectors vary greatly depending on the specific effectors, specifying the virulence mechanism. A major group of effectors target PTI enzymatically (Grant et al ., 2006 ) AvrPto B carries a kinase domain at the N terminus and a ubiquitin ligase domain at the C terminus (Hauck et al ., 2003; Rosebrock et al ., 2007; Shan et al ., 2008) AvrPto B interacts physically with FLS 2 to inhibit the kinase activity of FLS2 and to interfere with the oligomerization between FLS2 and BAK1, both of which are required for FLS2 signaling (Xiang et al ., 2008) Consequently, the downstream PTI respons es ar e suppressed, providing direct evidence that virulence effectors inhibit PTI for pathogenensis (Hauck et al ., 2003; He et al ., 2006) A few PTI components have been reported to serve as substrates of AvrPtoB m ediated ubiquitination and degradation in vivo such as FLS2 and EFR lysM receptor kinase CERK1 (Rosebrock et al ., 2007; Gimenez Ibanez et al ., 2009; Hann et al ., 2010) HopAI1 is a phospha tase secreted by P. syrin gae disengag ing activated MAPK s to disrupt the FLS2 signaling and defense response (Zhang et al ., 2007) Besides PRR s and MAPK s effectors can target other components of P TI. A number of effectors have been report ed to suppress P AMP induced callose deposition and cell wall thickening (de Torres et al ., 2006) HopM1 deactivate s a small G pr otein involved in vesicle traffic and inhibit s callose deposition (Nomura et al ., 2006) Multiple type 3 ( T3 ) effectors, including AvrE, HopM1, HopF2 and HopG1, from Pseudomonas syringae pv. tomato ( Pst ) DC3000 in hibit

PAGE 22

22 vascular flow into minor vein s in leaves essential for resistance (Oh and Co llmer, 2005) Pseudomonas adopts another strategy by producing a jasmonate mimic coronatine to suppress the salicylic acid and abscisic acid pathway s to prevent stom ata closure and defense response s (Brooks et al ., 2005) Besides targeting host defense response s hijacking host transcription machinery is another important mechanism involved in pathogenesis. The typical examples are transcription activator like effectors (TALes) secreted by Xanthomonods (Boch and Bonas, 2010; Bogdanove et al ., 2010) PthXo1 from Xanthomonas oryzae pv. oryzae ( Xoo ) induces the expression of a sugar transporter in rice to ensure nutrient suppl ies for bacteria to multiply (Yang et al ., 2006; Chen et al ., 2010b) The induction of the transporter family is required for successful disease symptom development M utation of either the virulence factor or the target s ugar transporter will turn the otherwise compatible reaction incompatible (Yang et al ., 2006) The introduction of another effector which p ossess es the ability to induce a second member of the sugar transporter family will complement pathogenesis (Antony et al ., 2010) Another TALe AvrBs3 targets a basic helix loop helix ( b H L H ) transcription factor responsible for cell size regulation and generates a hypertrophy phenotype (Kay et al 2007) 1.1.3 Effector Triggered Immunity ( ETI ) To counteract the large collection of various virulence effectors, plants have developed a surveillance system to monitor pathogen activity (Fig. 1 1) If effectors are trapped by a plant surveillance syste m a second layer of resistance, ETI will be triggered (Jones and Dangl, 2006 ) The recognized effectors are named avirulence effectors because the avirulence function always supercede s the virulence activity (Bent and Mackey, 2007) ETI is specific to certain race(s) of pathogens secreting effectors

PAGE 23

23 and confer s higher level s of resistance alw ays accompanied by a hyperse nsitive response (HR) (Bent and Mackey, 2007) HR is a localized cell death restricted to the infection area, presumably confining pathogen growth, but the dispensability of HR in resistance is still controversial (Greenberg and Yao, 2004) In 1986, bacterial hrp mutants were first generated from P.syringae Hrp mutants not only lacked the infectivity, but also the ability to trigger the HR respon se, providing the first link between virulence effectors and resistance (Lindgren et al ., 1986) R esistance proteins. Plant proteins responsible for recognizing effectors are called resistance (R) proteins as originally defined in the classical gene for gene hypothesis (Flor, 1942) The interaction s between R protein s from the host and cognate Avr gene product s from the pathogen are required to trigger the resistance response. The vast majority of R proteins fall into the category of NB LRR proteins, carrying a nucleotide binding domain (NB) and an extracellular leucine rich repeat (LRR) domain (Jones and Dangl, 2006) NB and LRR domain carrying protein s are also involved in PAMP perception in animals (Jones and Dangl, 2006) NB LRR proteins have demonstrated resistance to diverse pathogens including virus es bacteria, fung i and oomycetes (Jones and Dangl, 2006) In contrast to PRRs, R proteins are under diversifying selection R receptor like kinases, kinases, receptors, and other proteins are also involved in the recognition of effectors. The first cloned R gene is Pto conferring resistance to the causal agent of bacterial spot in tomato, Pst DC3000 (Martin et al ., 1994) Pto encodes a serine threonine kinase interacting directly with AvrPto (Martin et al ., 1994) Th is interaction will be recognized by a Pto interacting pr otein P rf and trigger the resistance responses (Pedley and Martin, 2003)

PAGE 24

24 Ligand receptor model. Hypothes e s explaining the mechanism of the interaction s between Avr and R proteins have been modified with increas ing knowledge o f Avr R proteins and their interaction s (Fig.1 2). The most straightforward model is the ligand receptor model in which R prote in s phy sically interact with Avr proteins and the interaction s trigger the downstream signal transduction pathway resulting in a resistan t response (Nimchuk et al ., 2003) The ligand receptor model stems partly from the fact that NB LRR proteins dominate R proteins reported to date. The LRR domains, which are always involved in protein protein interaction s, specif y the recognition of effectors (Dodds and Rathjen, 2010) The first supporting observation of the ligand receptor mode l is that NB LRR proteins encoded by Flax L genes interact with AvrLs in yeast two hybrid assays (Dodds et al ., 2006) Moreover, differences in recognition specificity between seven polymorphic AvrL variants and th ree L protein derivatives can be correlated with the interaction specificity between NB LRR and effectors, arguing for an antagonistic coevolution between the host and pathogen (Dodds et al ., 2006) Direct binding between Pita and AvrPita ha s also been demonstrated both in vitro and in yeast two hybrid assays, supporting the ligand receptor model (Jia et al ., 2000; Dodds and Rathjen, 2010) An interesting case is the interpl ay between Cf9 and Avr Cf 9. Cf9 encodes a receptor like protein, while Avr Cf 9 is an elicitor polypeptide that is secreted by Cladosporium fulvum into the intercellular space s of tomato tissues (de Wit, 1995) This provides an ideal platform to validate the ligand receptor model. However, no proof has been provided so far showing the direct interaction between Cf9 and Avr9 (Dodds and Rathjen, 2010) This result raises the possibility of indirect recognition of effectors by R proteins. Indirect interaction is also supported by the l ack of evidence for the direct

PAGE 25

25 interaction s between many other R proteins and corresponding effectors In particular, many effect or proteins are secreted in the intercellular spaces while the cognate R proteins are cytosol localized proteins without direct access to effectors (Dodds and Rathjen, 2010) Different models for indirect recognition have therefore been proposed and are described below Guard model. The best de scribed model for indirect interaction is the guard model. The princip l e of the guard model is that the plant R proteins monitor the presence of pathogens indirectly through the change s c aused by the pathogen infecti on (Dangl and Jones, 2001) As a k ey c omponent encompassed in the guard model an accessory protein associated with the R prot ein is present and mediates recognition between the R protein and the Avr effector I n the absence of R proteins effectors possess virulence functions by target ing the accessory protein (guardee) for successful colonization Correspondingly, R proteins ar e developed by plants to monitor the modification induced by pathogen s or more specifically pathogen effectors and subsequently trigger the defense responses (Jones and Dangl, 2006) Indirect interactions have been reported in a number of R Avr combinations. One of the best acknowledged example s of guardee is RIN4 targeted by mul tiple effectors. In the AvrRPM1 and RPM1 interaction, RIN4 is phosphorylated by AvrRPM1 (Marathe and Dinesh Kumar, 2003) T he phosphorylation event can be detected by RPM1 which forms an exclusive protein complex with RIN4 and activate s RPM1 m ediated resistance (Mackey et al ., 2002) Likewise, degradation of RIN4 by protease effector AvrRpt2 pr ompt s the defense response directed by RIN4 associated protein RPS2 (Axtell and Staskawicz, 2003) In the absence of the R proteins, as illustrated in the rpm1 rps2

PAGE 26

26 double mutant, RIN4 is targeted by the effectors to suppress PTI (Mackey et al ., 2002; Mackey et al ., 2003) Thus, plants build up a stronger defense response through R proteins to guard against the pathogens attempting to inhibit PAMP signal ing. However, besides RIN4, there are other virulence factors targeted by effectors AvrRpm1, AvrRpt2 and AvrB because mutation of rin4 d oes not diminish the virulence activity of the effectors in the rpm1/rps2/ rin4 mutant (Belkhadir et al ., 2004) The g uard model describes a sophistica ted mechanism adopted by plants, (Marathe and Dinesh Kumar, 2003) As indicated in the guard model, different effectors with complete ly independent origin s or function s c an target the same protein. The target c an be recognized by multiple R proteins and vice versa, a single R protein c an recognize more than one modified targets As a result, this strategy involves a relatively small R gene repertoire to defend a broad diversity of pathogens, explaining evolution a ri ly how plants adapt to faster evolving pathogens (Dodds and Rathjen, 2010) However, a contr adictory evolution force lies within the guard model. The presence of the guardee or the target protein is indispensible for the virulence function of the effectors or the Avr proteins (Dodds and Rathjen, 2010) To minimize the pathogen effect, natural selection favors decreased activity of the guardee in the absence of R genes (van der Hoorn and Kamoun, 2008) However, in the presence of R genes, strong interaction with R proteins is a requisite for perception and defense of the pathogen (van der Hoorn and Kamoun, 2008) A number of studies show that target proteins are under selection to evade the interaction with effectors. For example, a

PAGE 27

27 recessive allele of xa13 is present with a mutation in the promoter region so it cannot be induced/ targeted by the cognate effector pt hXo1 (Yang et al ., 2006) Decoy model. There is growing support for the decoy model proposed to release the evolutionary constraint of tar get protein function vs effector recognititon In the decoy model, a decoy protein is present mimicking the target of the Avr effector to trap the pathogen together with the activities of R proteins, but the decoy itself has no significant role in either s usceptibility or resistance without t he presence of R proteins ( van der Hoorn and Kamoun, 2008) The decoy protein could be an outcome of a duplication event of the effector target or from independent evolution solely for perception of pathogen s (Dodds and Rathjen, 2010) Effector proteins, target proteins, decoys and R proteins are all involved in an evolution ary race. The decoy model i s well exemplified by the perception of effector Avrpto. AvrPto directly ta rgets FLS2 to inhibit PTI for virulence (de Torres et al ., 2006) The kinase domain of FLS2 is closely related to Pt o and Pto competes with FLS2 for the interaction with AvrPto (Zipfel and Rathjen, 2008) The binding of Pto and AvrPto will be detected by Pto associated protein Prf and consequ ently activate defense response s (Pedley and Martin, 2003) Another case in point is Bs3 driven re sistance. AvrBs3 is a transcription factor like protein secreted by T3SS of Xanthomonas campestris pv vesicatoria the causal agent of bacterial spot on tomato (Bonas et al ., 1989) AvrBs3 functions inside plant cell s by binding to the promoter regions of host genes and induce s host gene expression (Marois et al ., 2002) AvrBs3 induces expression of UPA20 for the hypertrophy symptom in susceptible plants and upregulates the Bs3 gene in the incompatible reaction s (Marois et al ., 2002; Kay et al ., 2007; Romer et al ., 2007) The expr ession of

PAGE 28

28 Bs3 cannot be detected without AvrBs3, indicating the dispensability of Bs3 in the normal plant life cycle (Romer et al ., 2007) It is reasonable to postulate that Bs3 is the decoy, competing with the vir ulence target UPA20 for AvrsBs3 binding (van der Hoorn and Kamou n, 2008) There is evidence showing that an AvrBs3 homologue AvrHah1 induces Bs3 and initiates defense response s as well, showing that Bs3 traps more than one pathogen effector s (Schornack et al ., 2008) Bait and switch model. I n the decoy model, the decoy functions solely as a trap, instead of as the virulence target of the effectors. The decoy model fails to explain that Pto activates Prf and th at RIN4 contributes to the stability of RPM1 (Pedley and Martin, 2003; Belkhadir et al ., 2004) As a result, a two step recognition, the bait and switch model has been proposed (Collier and Moffett, 2009) The bait protein, which interacts with the R protein, acts as a cofactor. The recognition between the effector and the bait switch es R proteins from an inact ON consequently activate defense signaling (Collier and Moffett, 2009) This model provides a n alternative e xplanation of how NB LRR proteins perceive the Avr effectors through an altered co factor. Co factors are involved in priming as well as autoinhibition of NB LRR proteins (Mackey et al ., 2002; Mucyn et al ., 2006) For instance, ablation of RIN4 le a d s to the autoactivation of RPS2 and RPM1 (Belkhadir et al ., 2004) The switch is flipped when the presence of Avr effectors trigger a conformational change of the bait protein and releases the autoinhibition on cognate R proteins (Collier and Moffett, 2009) A fter the signaling activation t he R protein undergo es cess by the intramolecular interactions, preparing for the next round of recognition (Collier and Moffett, 2009)

PAGE 29

29 Currently most of the models are b ased on limited number of examples, mainly from the NB LRR type of R proteins. However, how the NB LRR proteins are activated is still under investigation. It is a challenge to fully understand the events as distinct mechanisms may be adopted as exemplifi ed in the two drastic recognition events (direct and indirect) described earlier. There are also cases that cannot be fully explained by the models described above. For example, Pto kinase phosphorylates AvrPto, and deactivates its E3 ubiquitin ligase acti vity (Ntoukakis et al ., 2009) This is the only example so far in which plants take advantage of a strategy (Dodds and Rathjen 2010) Another interesting example is the co effect of the Arabidopsis R proteins RPS4 and RRS1, responsible for resistance to bacteria Pseudomonas syringae and Ralsotnia solanacearum respectively (Birker et al 2009) Co presence of RPS4 and RRS1 are required to specify the resistance to fungus Collectotrichum higginsianum despite the fact that RPS4 and RRS1 activate the same signal pathways (Birker et al ., 2009) The precise mechanism s for the specificity remain s an open question. Similarly, a pair of NB LRR genes RPP2A and RPP2B have to cooperate in an unknown way for resistance to the oomycete pathogen Pe ranospora parasitica (Sinapidou et al ., 2004) So far, no single Avr product interacting with both RPP2A and RPP2B have been identified ; it is therefore possible that multiple avr/effector products are involved in the activation of the defense response (Sinapidou et al ., 2004) 1.1.4 D efense S ignaling Both PTI and ETI converge on the multifaceted downstream signali ng for a common defense response, but vary in the magnitude (Dodds and Rathjen, 2010) Ion flux chan ge is one of the earliest detectable component s of defense response s (Boller,

PAGE 30

3 0 1995) It can be detected as early as 0.5 2 min after pathogen perception (Boller, 1995) A rapid influx of calcium from the apoplast is induced by P AMPs leading to a quick increase of calcium concentration in the cytoplasm (Blume et al ., 2000) The function of this Ca + is still u nclear. A p ossible explanation is that it serve s as a second signal to activate Ca + dependent protein kinases (Ludwig et al ., 2005) Another early response is the burst of active oxygen species (Chinchilla et al ., 2006) Reactive oxygen species (ROS) can function directly as antibiotic compounds as well as secondary messengers to activate stress responses (Apel and Hirt, 2004) MAPK cascades. Numerous st udies have demonstrated the importance of activation of mitogen activated protein kinase (MAPK) cascade s in the defense response (Pitzschke et al ., 2009a) The MAPK cascades are u niversally present in eukaryote s relaying and amplifying signal s from extracellular receptors to intracellular responses (Rodriguez et al ., 2010) The MAPK cascades are composed of minimally MAPK kinase kinases (MAPKKKs, also called MAP3Ks or MEKKs), MAPK kinases (MAPKKs, also called MKKs or MEKs) and MAPKs (or MPKs). The MAPK cascades are activated by a series of sequential phosphorylations. MAPKs ar e switched on by MKKs, which are turned on through phosphorylation by MAPKKKs activated by stimulated receptors (Rodriguez et al ., 2010) Only a few MAPK cascades have been thoroughly studied. Adapting an eleg ant transient expression system in protoplasts, a MAPK module At MEKK1 At MKK4/5 At MPK3/6 ha s been established, responsible for signal transduction following flg22 perception in Arabidopsis (Asai et al ., 2002) The a ctivation of this module is followed by the activation of WRKY transcription factors and PR gene expressions (Asai et al ., 2002) The role s of At M A P K3 and At MA P K6 ha ve been clearly

PAGE 31

31 confirmed in other defense system s (Pitzschke et al ., 2009a) At MPK3 controls the (Gudesblat et al ., 2007 a b ) Guard cell sp ecific silencing of At MAPK3 allow s enhanced growth of Pst mutant defective in producing coronatine to overcome the stomata defense (Gudesblat et al ., 2007 a b ) The presence of At M A PK3/6 is required for the biosynthesis of camalexin and resistance to Botrytis cinerea in Arabidopsis (Ren et al ., 2008) indicating a compulsory role of At M A PK3/6 in multiple defense strategies in PTI. Genetic studies propose another MAPK cascade, consisting of At MEKK1 At MKK1/2 At MPK4, as a negative regulator of the defense response (Ichimura et al ., 1998) Elimination of either At MEKK1or At MPK4 fostered salicylic acid ( SA ) accumulation and PR gene expression, implying that this cascade inhibit s the defense response by blocking the S A pathway (Ichimura et al ., 2006; Suarez Rodriguez et al ., 2007) This cascade is also involved in ROS homeostasis as indicated by the significant overlapping in the genes deregulated by At MEKK1 and ROS signaling i n addition to the high level s of ROS accumulated in the mutants (Nakagami et al ., 2006; Gao et al ., 2008 ; Pitzschke et al ., 2009b) At MEKK1 employs a unique shortcut by directly interacting with WRKY53 and pr omoting its DNA binding activity (Miao et al ., 2007) Three direct substrates of At MPK4 have been studied including WRKY33, WRKY25 and MAP k inas e substrate 1 (MKS1) (Andreas son et al ., 2005) WRKY33 can be uncoupled with an inhibitive complex with MKS1 upon phosphorylation of MKS1 by activated MPK4 (Andreasson et al ., 2005; Qiu et al ., 2008) The released WRKY33 suppresses the expres sion of genes responsible for phytoalexin production and resistance, providing a mechanism of how a plant MAPK can play a negative role in defense response by regulating gene

PAGE 32

32 expression (Qiu et al ., 2008) A number of M A PKs have been shown to be induced by avirulent pathogens and involved in ETI (Pitzschke et al ., 2009a) MAPKKKa have been shown to be essential for Pto mediated HR responses in separate studies (del Pozo et al ., 2004) Ex tensive research has been carried out to dissect the MAPK signaling in dicots, the study of MAPKs in monocots, however, la gs behind and show s both conservati on and divergence of functions for M A PKs. TaMPK3 and OsMPK3 are both activated in compatible interaction s but under go a deg radation or deactivation process in incompatible reactions, suggesting a negative role of MPK3 in wheat and rice d efense response s (Xiong and Yang, 2003; Rudd et al ., 2008) OsMPK3 and OsM PK6 a re both activated by fungal chitin elic i tors following activation of OsMKK4 The activity of OsM KK4 regulates cell death and diterpenoid phytoalexin production in a n OsMPK6 dependent manner (Kishi Kaboshi et al ., 2010) Hormone signaling. H ormone pathway s are also important components involved in the defense response. Imbalance of various ho rmones i s observed after pathogen attack, including SA, jasmonic acid (JA), ethylene (ET), abscis i c acid (ABA), giberrel ic acid (GA), cytokinin (CTK), bra s sinosteroid (BR), auxin [ indo le 3 acetic acid (IAA) ] (Bari and Jones, 2009) Among all, SA, JA and ET signaling play a central role in regulating defense response s (Glazebrook, 2005; Bari and Jones, 2009) SA i s induced by biotrophic pathogen and proposed as a crucial signal molecule in systemic acquired resistance (SAR) for activation of PR genes and resistance to biotrophs (Grant a nd Lamb, 2006) Exo genous application of SA induce s PR gene expression and broad spectrum resistance (Grant and Lamb, 2006) Introduction of the nahG gene

PAGE 33

33 responsible for SA degradation into Arabidopsis plants dramatically reduce s SA accumulation and the resistance level (Heck et al ., 2003; van Wees and Glazebrook, 2003) However endogenous SA accumulation in rice is maintained at high level s and d o es not respond to pathogen infection, indicating the diver gence of SA signaling in monocots from that of dicots (Silverman et al ., 1995) JA and ET pathway s are, i n contr ast more often correlated with resistance to necrotroph s (Bari and Jones, 2009) I n the natural environment, plants concomitantly face the challenge of numerous microbes, which cannot be simply classified as purely biotrop h or necrotroph (Bari and Jones, 2009) Consequently, plants have to orchestrate different signaling for resistance according to the pathogen. Despite the evidence that SA and JA ET pathway s generally act antagonistically, there is evidence showing a synergisti c effect between SA and JA ET pathway (Bari and Jones, 2009) Overlap of the downstream genes has also been reported, reinforcing the idea of interdependence between different hormone pathways (Tsuda et al ., 2009) A study applyin g multiple mutants from both pathways has shown that SA and JA ET coope rate to amplify the otherwise weak response in PTI while function redundantly in ETI (Ts uda et al ., 2009) The weak signal and requirement for multiple components in PTI explains why effectors can efficiently block the PTI. Interruption of any of these components can disrupt the response. In contrast, ETI is a stronger response and has a com pensatory effect, making it a robust barrier to pathogen infection (Dodds and Rathjen, 2010) Auxin contributes to the regulation of defense respon ses to various pathogens in a n manner independent from JA or SA. Marker genes in SA or JA pathway s a re not altered in auxin signaling mutants (Bari and Jones, 2009) The mechanism s of how

PAGE 34

34 auxin is in volved in the d efense response are poorly understood. A possible explanation is that auxin exerts its effect by modulating the synthesis and catabolism of other hormones and consequent ly the defense response (Paponov et al ., 2008) Auxin has been reported to promote susceptibility to pathogens, wh ereas decreased auxin signaling elevates resistance, implying a dil emma between development al and resistance program s of plants (Navarro et al ., 2006) The role of ABA in the defense response varies depending on the nature of the pathogen. For example, ABA enhances the resistance of tobacco to tobacco mosaic virus ( TMV ) while suppresses the defense response to B. cinerea and Pst (Audenaert et al ., 2002) ABA is involved in defense response through regulating stomata closure, cell wall metabolism, production of ROS, and defense related gene expression (Bari and Jones, 2009) The parti cipation of GA in the defense response is mainly mediated by the GA response repressors DELLA protein (Navarro et al ., 2008) Stabilization of DELLAs are involved in the growth inhibition effect of flg22 treatment (Navarro et al ., 2008) DELLA mutants display elevated resistance to necrotrophs and attenuated resistance to biotrophs with an altered balance between the SA and JA pathway s (Navarro et al ., 2008) Regulating ROS le vels is another mechanism through which GA functions to modulate immunity. Higher levels of ROS accumulation and represse d ROS detoxification enzymes have been observed in DELLA mutants (Achard et al ., 2008) Higher levels of active GA caused by muta tion of GA deactivating enzyme i s associated with compromised resistance to Xoo (Yang et al ., 2008) while an increased level of GA in imp aired GA receptor mutants le a d s to elev ated resistance to Magnaporthe grisea (Tanaka et al ., 2006) Significant overlapping has been reported between genes regulated by

PAGE 35

35 Plasmodiophora brassicae and those involved in CTK homeostasis, indicating a key role of CTK in disease development (Siemens et al ., 2006) BR has been reported to increase the resistance to various pathogens including TMV, Pst M. grisea and Xoo in both dicots and mono cots in a SA independent way (Nakashita et al ., 2003) The most intriguing discovery is the dual role of BRI1 associate d kinase 1 (BAK1) in the interplay between BR signaling and defense path way s (Chinchilla et al ., 2007; Heese et al ., 2007) BAK1 was identified based on its association with the brassinosteroid receptor BRI1 and its crucial role in BR signaling. On the other hand, BAK1 serves as a core ceptor of FLS2 and EFR and forms an active signaling complex in a ligand dependent manner to initiate the defense response (Chinchilla et al ., 2007) Mutation of BAK1 promote s pathogen growth and abolishe s the ROS burst which cannot be rescued by application of BR, indicating that BAK1 is positively involved in the defense response in a BR independent manner (Kemmerling et al ., 2007) The final output of defense responses in clude callose deposition, PR gene expression and HR responses (Boller and Felix, 2009) There are other byproducts of pathogen recogn ition that may not be required for resistance. A shift from the growth to the defense program might be initiated when the defense response begins (Zipfel et al ., 2004) It is very interesting to note how pathogens take advantage of these downstream s ignaling processes for disease development. MAPK cascades are targets of numerous effectors as describe d earlier in 1.1.2. A set of effectors function by interfering with cell wall thickening. GA was originally identified as produced by Gibberella fujikuro i the causal agent of foolish seedling disease in rice ( Kurosawa 1926) Pst manipulates the plant defense response by producing a JA mimic coronatine to inhibit the SA pathway

PAGE 36

36 (Cui et al ., 2005) BAK1 is a direct virulence target of AvrPto and AvrPtoB to interfere with the common component s of PTI signaling (Shan et al ., 2008) 1.2 Bacterial Blight of Rice Rice Xoo interaction. Rice is one of the most widely cultivated crops and the main s ource of nutrients and calories essential to human activit ies Bacte rial blight of rice caused by Xanthomonas oryzae pv. oryzae ( Xoo ), is the most devastating bacterial disease of rice in both irrigated and upland rice ( O u 1985; Mew, 1987) Bacterial blight c an reduce rice yield up to 20~50% in rice growing regions and cause over 50% in economic loss depending on the cultivar, climate and other conditions (IRRI: www.irri.org ). Due to its potential threat to rice product ion, Xoo i s listed as select agent in the U.S. by Animal Plant Health Inspection Service (APHIS) ( www. aphis .usda.gov) Xoo enters plants mostly through natural openings or wounds and stays within the xylem tissues. The early signs on infected rice leaves a re water soaked symptoms due to the degradation of cell s and the release of water. As the disease progresses, leaves shrink wilt and become chloro tic as xylem tissues are clogged by the pathogen and its derivatives after 6 7 days. Breeding programs introd ucing resistance ( R ) genes have become the primary strategy for control of bacterial blight. Almost thirty R genes from various sources have been identified conferring resistance to different races of Xoo Among them, six R genes have been cloned Differen t from the classical NB LRR category of R proteins, R proteins conferring resistance to bacterial blight are diverse (White and Yang, 2009) XA1 is the only NB LR R type of R protein identified thus far in rice responsible for resistance to Xoo (Yoshimura et al ., 1998) Xa21 and Xa26 encode receptor like kinases (RLK) (Song et al ., 1995 ; Sun et al ., 2004; Xiang et al ., 2006) while the ot her three R proteins, XA27, XA5 and XA13, do not conform to the classical

PAGE 37

37 R protein structures (Chu et al ., 2006a; Yang et al ., 2006) Cor respondingly, effector s deploye d by Xanthomonods are secreted by multiple strategies including T 3 SS as well as type 1 secretion system ( T 1SS ) and type 2 secretion system ( T2 SS ) (Jha et al ., 2007; White and Yang, 2009) The broad diversi ty of R proteins discovered and effectors i nvolved in the rice Xoo relationship implies that distinctive machiner ies ha ve eme rged in the evolution. 1.2.1 Effectors The virulence arsenals of Xoo consist s of different components including adhesion synthesis exopolysaccharide (EPS) production, regulation of pathogenicity factor ( rpf ) gene clusters T1SS, T2SS and T3SS (Jha et al ., 2007; Salzberg et al ., 2008; White and Yang, 2009) T1 SS is responsible for direct tran sport of proteins from bacteria l cytoplasm through the membrane in to the extracellular environment. T 1 SS is required for Ax21 activity and activation of XA21 mediated immunity (da Silva et al ., 2004) Transport thr ough T 2 SS mediates a two step secretion system machinery: the initial translocation into the periplasmic space and final transport across the outer membrane directed by a multimeric complex pore. I n Xoo strain PXO99a o nly a single copy of the T2SS subunit s has been detected, in contrast to the two T2SSs encoded in X anthomonas campestris pv campestris and Xanthomonas axonopodis pv citri ( Xac ) (Salzberg et al ., 2008) T2 effectors, consisting mainly of cell wall deg rading enzymes such as cellulose, contribute to virulence as exemplified by severely reduced virulence activit ies of T2SS muta nts (Bttner and Bonas, 2010) Multiple mutation s but not single mutation of T2 effectors lead to attenuated vir ulence, indicating the functional redundancy o f the T 2 effector s (R ay et al ., 2000) Purified T2 effectors and soluble elicitors have been reported to induce a HR and defense response s (Jha et al ., 2007) A

PAGE 38

38 very interesting interplay between T2S S and T3SS has been disc overed us ing genetic strateg ies A T3 SS mutant was identified which could trigger the defense response in a T2SS dependent manner, while immune response induced by type 2 effector s were depressed by type 3 effectors (Jha et al ., 2007) proteobacteria, Xanthomonas relies heavily on the T3SS for pathogenencity. T ype 3 effectors from Xanthomonas were classified into 39 groups according to sequence and stru cture similarities and 23 of the se are present in the Xoo genome (White et al ., 2009) TALe is the largest family of T3 effectors identified in Xanthomonas (White and Yang, 2009) TALes are f ound only in Xanthomonas species and less related homologues in Ralstonia solanacearum (Alfano and Collmer, 2004; Cunnac et al ., 2004; Heuer et al ., 2007) TALe members share conserved T3 secretion signals at the ir N terminus At the C termin us there are three nuclear localization signals (NLS) and an acidic activation domain (AD), which are typical eukaryotic transcription factor structures (Szurek et al ., 2001) With accu mulating evidence showing the functional significance of the TALes in pathogenicity, the mechanism s by which TALes recognize and man ipulate the host targets arouse d wide interest. The presence of typical eukaryotic nuclear localization signals indicates th at TALes may function inside the plant cell nucleus (Zhu et al ., 1998; Yang et al ., 2000; Szurek et al ., 2001) The functional importance of nuclear localization has been verified in studies of AvrXa7 and AvrXa10 (Zhu et al ., 1998; Yang et al ., 2000) Mutation of the activati on domain result s in the malfunction of TALes, indicating that AD is indispensable for a functional TALe (Zhu e t al ., 1998; Boch and Bonas, 2010)

PAGE 39

39 Each TALe protein carries a central repeat region (CRR) consisting of almost perfect 34 or 35 amino acid repeats (Bonas et al ., 1989; Szurek et al ., 2001; Boch and Bonas, 2010) The number of repeats varies among family members from 1.5 to 33.5 contributing to host recognition specificity (Boch et al ., 2009; Bogdanove et al ., 2010) Some of the repeats may not be functional as a minimum requirement of 6.5 repeats is sufficient for the DNA binding activity of a single TALe (Boch et al ., 2009) Once TALes reach the plant cell nucleus, the CRR directly binds to the host DNA and activates host gene e xpression. The binding specificity between the central repeats and the promoter region determines the specificity of its host targets (Boch and Bonas, 2010) The CRR is highly conserved among all members except for the highly variable amino acid s at positions 12 and 13 (referred to as repeat variable diresidues, RVDs), which define the specificity of the binding to its host targets (Boch and Bonas, 2010; Bogdanove et al ., 2010) When CRR i s swapped between TALes, the host specifi city associated with t he TALe i s switched, consistent with the origin of the repetitive region (Yang et al ., 2000; Yang and White, 2004) It is predicted that CRR forms a solenoid superhelical fold that wraps around the DNA (Bogdanove et al ., 2010) Sequencing of Xoo strains reveals an unusually h igh copy number of TALes in the Xoo genome (Kim et al ., 2008) Xoo strain PXO99a carries 19 TALe members more than in most Xanthomonas species (Salzberg et al ., 2008 ; Ochiai et al ., 2005; Furutani et al ., 2009) Nearly all of the 19 members in PXO99a are distinguishable by the polymorphism of the two variable amino acid residues n TALes by Xoo indicates its potential importance in fitness and virulence (White and Yang, 2009) Function of TALes can be unique and unexchangable. Currently, f our TALes

PAGE 40

40 have been reported as major pathogen i city determinants due to the ir indisp ensability for the strains secreting them, including pthXo1 from PXO99 a AvrXa7 secreted by PXO86, PthXo2 and PthXo3 (Swarup et al ., 1992; Duan et al ., 1999; Bai et al ., 2000; Yang and White, 2004; Yang et al ., 2006 ; White and Yang, 2009) PthXo1 is the only major virulence factor identified in strain PXO99 a up to now (White and Yang, 2009). PthXo1 functions mainly through inducing the susceptibility gene Xa13 a cellular sugar transporter for nutrient supply (Yang et al ., 2006; Chen et al ., 2010b) In the absence of PthXo1, the high induction of Xa13 by PXO99 i s abolished, along with loss of disease symptom s (Yang et al ., 2006) This study provides direct evidence that in addition to attacking the plant immune system, bacteria can also manipulate host metabolism for its own benef its and pathogen e sis. O ther TALes contribute to pathogen i city in a more subtle way under certain conditions ( White and Yang, 2009) No detectable d ifference has been discovered for the pthXo7 deficient mutant s of PXO99a. Intriguingly, introduction of pthX o7 enables Xoo strain PXO86 to overcome resistance conferred by the recessive R gene xa5 (Sugio et al ., 2007) In contrast to PthX o1 that induces the dominant allele of Xa13 PthXo7 does not change the expression pattern of Xa5 ( ) (Sugio et al ., 2007) However, PthXo7 upregulate s the expression of a paralogue of located on chromosome 1 (Gu et al ., 2005) Nevertheless, the involvement of PthXo7 in xa5 mediated resistance is still inconclusive. The significance of induction and the role of in susceptibility are still under investigation. PthXo6 elevate s the transcription of host gene OsTFX1 (Sugio et al ., 2007). OsTFX1 is a member of the bZIP family of transcription factors, which are

PAGE 41

41 involved in the regulation of many developmental and physiological processes. The dependence on PthXo6 for virulence can be overcome by ectopic expression of OsTFX1 OsTFX1 is inducible by multiple Xoo strains, suggesting that induction of OsTFX1 is a common phenomen on of bacterial blight T he targeting of transcription factors in rice plants suggests that modulating host transcription machinery is an important strategy deployed by Xoo for virulence activity. AvrXa7 is required for pathogenicity of Xoo strain PXO86 ( B ai et al ., 2000; Yang et al ., 2000) In addition to its Xa7 dependent avirulence activity, AvrXa7 is required for the full virulence of PXO86 (White and Yang, 2009) AvrXa7 mutant s retain only weak virulence (White and Yang, 2009) Two avrXa7 homologous in PXO99 a pthXo4 and pthXo5 m aintain the virulence, but a re not able to trigger Xa7 mediated resistance (Yang et al ., 2005). An AvrXa7 derivative has been generated maintaining the Xa7 dependent activity but without any virulence activity (White and Yang, 2009) Another derivative i s deprived of both virulence and Xa7 dependent avirulence activity. However, it acquired the ability to trigger the resistance response on the otherwise susceptible l ine IR24, but not on another susceptible line Nipponbare. A number of TALes have been identified as avirulence factors when the TALes are recogniz ed by the host s after entering the plant cells. Plant s can recognize TALes and respond by building up defense response s AvrXa7 is a major virulence factor in a compatible reaction and activates Xa7 mediated immunity in the presence of Xa7 (Yang and White, 2004) AvrXa27, another TALe, elicits Xa27 mediated d efense responses by inducing the expression of Xa27 (Gu et al ., 2005 ) As stated above, the functions of TALes are quite diverse, ranging from major pathogenicity factors, to weak virulence

PAGE 42

42 factors, to avirulence f actors. Occasionally, a single TALe member can play opposite roles in different hosts as in the case of AvrXa7 (Bonas et al ., 1989; Marois et al ., 2002) A system at ic mutant screening was carried out to identify pa thogenic T3 factors other than TALes in PXO99a By screening 18 non TAL e T3 effector mutants, XopZ was iden tified as contribut ing to the virulence of strain PXO99a. PXO99 a possess es two identical copies of XopZ in its genome playing a redundant function in suppressing PTI. XopZ is a protein of unknown function conserved across different Xanthomonas species, indicat ing the importance of this gene (Song and Yang, 2010) 1.2.2 R P roteins R proteins responsible for resistan ce to Xoo are diverse in terms of both structure and function. Xa21 was the first cloned R gene for bacterial blight of rice as well as the first example of the RLK class of R genes. Xa21 expression is not changed by pathogen infection in either compatible or incompatible interactions, indicating that Xa21 is likely to be regulated at the posttranscriptio nal level (Century et al ., 1999) Since the cloning of Xa21 a n increasing number of XA21 binding proteins have been identifi ed associated with XA21 stability or activity and consequently alter XA21 mediated resistance (Wang et al ., 2006; Park et al ., 2008) However, how the Xa21 mediated signal is transduced and regulated is still under investigation. In contrast to Xa21 and the majority of R genes that are expressed constitutively, Xa27 expres sion is induced exclusively in incompatible interaction s when challe nged by the pathogen harboring corresponding AvrXa27 (Gu et al ., 2005) Constitutive expression of Xa27 confers resistance to otherwise compatible strains, independent of AvrXa27, confirming tha t expression of the Xa27 gene is crucial for the resistance response. The resistant and susceptible alleles of Xa27 harbor identical coding region s the product of which is toxic

PAGE 43

43 to rice. Pathogen s delivering AvrXa27 can exclusively induce Xa27 expression and consequently cause a hypersensitive response in plants carrying Xa27 The different expression pattern between Xa27 and xa27 is specified by the varian ce in the promoter regions. Mutation of avrXa27 can turn the incompatible interaction with Xa27 carry ing plants int o a compatible reaction, without causing any detectable change in fitness or virulence of the pathogen (Gu et al ., 2005; Ochiai et al ., 2005). AvrXa27 belongs to the TAL e family When the NLS or AD of avrXa27 is mutated, the resistant respons e cannot be activated, confirming that the transcriptional activation of the Xa27 by AvrXa27 is the key step in initiating the resistance response (Gu et al ., 2005 ) Most R genes identified to date are dominant or semi dominant. R ecessive r genes such as xa5 and xa13 are rarely reported (Iyer and McCouch, 2004; Chu et al ., 2006a; Yang et al ., 2006; Iyer Pascuzzi and McCouch, 2007; Kottapalli et al ., 2007) Xa5 ( ) encodes the gamma subunit of general eukaryotic transcription factor IIA located on chromosome 5 (Iyer and McCouch, 2004) This is the very first exampl e of general transcription factors involved in resistance. The difference between the resistant and susceptible alleles result s from two nucleotide substitutions leading to an amino acid change (I yer and McCouch, 2004) Pathogen s adapted to the resistance by deploying TALes inducing a second form of the gamma subunit of OsTFIIA on chromosome 1 (Sugio et al ., 2007) The protein product of Xa13 shares high similarity to members of the MtN3 family from plants and animals, and is therefore named Os8N3 (Yang et al ., 2006) RNA interferencing (RNAi) of Xa13 results in lo ss of fertility accompanied with resistance, indicating that Xa13 is involved in regulation of pollen development (Chu et al ., 2006b) Xa13 is induced by virulent pathogen infe ction,

PAGE 44

44 or more specifically by P thXo1 to facilitate the pathogen amplification and disease development (Iyer Pascuzzi and McCouch, 2007) Failure to induce the dominant alleles will lead to lack of disease symptom s and consequently a resistant response. The dominant alleles are therefor e designated as susceptib le genes required for disease (Kottapalli et al ., 20 07) The resistance mediated by xa13 arises from the interference of the Xa13 induction by PthXo1 ( Yang et al ., 2006) T he difference between the dominant susceptible and recessive resistant allele s lies in the promoter region s A mutation in the promoter of the susceptible allele makes it non inducible by pthXo1 and initiates a resistance response confirming that the switch between the resistant and susceptible response lies mainly at the transcriptional level (Ch u et al ., 2006b) Homozygous xa13 confers resistance to strains solely relying on PthXo1 for virulence. When a pthXo1 homolog AvrXa7 was heterologously introduced into strain PXO99, it was able to overcome the resistance conferred by xa13 (Bai et al ., 2000; Yang et al ., 2006) A recent finding shows that Xa13 ( Os8N3 ) belongs to a large gene family of sugar transporters SWEET Pathogen s may take advantage of this cellular sugar transporter to ensure nutrient supply essential for the successful multiplication of the pathogen The presence of other family members of the SWEET gene family provides the possibility for other effectors to complement the pthXo1 mutant. Introduction of AvrXa7 into the PXO99a pthXo 1 m utant could rescue its pathogen i city and cause wild type disease symptom s (Antony et al ., 2010) The target of A vrXa7 is a member of the SWEET gene family as well implying the importance of the nutrient supply for successful pathogen in vasion (Antony et al ., 2010)

PAGE 45

45 Another interesting discovery concerning R gene functions is that different R genes do not necessarily work independently or in parallel They may co operate in the signal pathway and one R gene may lie downstream of another. For example, Os Xa27 by AvrXa27 (Gu et al ., 2009) In the xa5/xa5 background, Xa27 induction and Xa27 mediated resistance i s clearly attenuated (Gu et al ., 2009 ) R esistance mediated by x a5 i s reduced in the homozygous Xa27 plants As TALes target host transcription, it is reasonable to speculate that TALes may work on the general transcription factors for th is purpose. How the specificity is control led remains to be elucidated. The diversity of the R genes and distinctive mechanism s involved in the resistance response underlines the importance and challenges in studying the interplay between rice and Xoo. 1.3 X A 21 Ax21 system In the early 1970s, Xa21 was first identified in a wild rice species O ryza long i stam in ata from Africa conferring broad spectrum resistance to diverse races of Xanthomonas oryzae pv oryzae foun d in Asia and Africa (Park et al ., 2010a) Later, Xa21 was isolate d by Song and colleagues with a map based cloning approach (Song et al ., 1995) When the Xa21 gene was introduced into an otherwise susceptible line, plants showed a high level of resistance to all strains carrying the cognate effector (Wang et al ., 1996) Xa21 encodes a receptor kinase protein a family of proteins which are widely involved in pathogen pattern recognition and innate immunity in both plants and animals (Song et al ., 1995; Park et al ., 2010a) XA21 carries an extracellular leucine rich repeat domain (LRR) a transmenbrane domain, a juxtam embrane domain and a cytoplasmic kinase domain (Song et al ., 1995) The presence of LRR domain s which are involved in protein protein interaction s indicates the potential involvement of

PAGE 46

46 XA21 in direct pathogen signal recognition. The role of LRR domain s in pathogen p erception was confirmed in the study of another member of the Xa21 gene family Xa21D (Wang et al ., 1998) XA 21D carries only the presumed extracellular LRR domain and confers partial resistance with a spectrum iden tical to X A 21, indicating the determinant role of LRR domain s in race specific pathogen recognition by the Xa21 gene family. The kinase domain, however, may contribute to signal transduction by phosphorylation of the downstream components. Substitution of the autophosphorylation residu es Ser686, Thr688 and Ser689 d oes not affect the autophosph orylation activity, but affect s the stability of X A 21 protein and abolishes the resistance mediated by Xa21 (Xu et al ., 2006) Mutation of the Thr 705 residue in the juxtamembrane le a d s to an impaired ability in autophosphorylation and interrupt s interaction s with four XA 21 binding proteins and consequently the defense response These findings support the crucial role of autopho sphorylation in XA21 mediated resistance (Chen et al ., 2010d) T he importance of XA21 mediated immunity ha s focused significant effort into the study of XA21 signaling A system at ic yeast two hybrid assay using X A 21 protein as bait yielded a number of protei ns that bind to XA 21. These X A 21 binding proteins (XBs) were biochemically distinct and differentially i nvolved in XA21 mediated resistance XB3 is an E3 ubiquitin ligase carrying a signature RING finger domain, phosphorylated by XA21 (Wang et al ., 2006) XB3 is required for the stability of X A 21. Reduced XB3 protein abundanc e by RNA interferencing render s only partial resistance in Xa21 carrying plants. It is reasonable to speculate that XB3 contributes to XA21 signaling by mediat ing the degradat ion of negative regulators of X A 21 by ubiquitination. XB25

PAGE 47

47 interacts wit h X A 21 both in vitro and in vivo and contributes to X A 21 mediated resistance. However, the mechanism of the XB25 contribution to the resistance is still unknown, but likely involves the ankyrin domain present in XB25. I n contrast to XB3 and XB25, all othe r XA21 binding partners reported so far are negatively involved in XA21 mediated resistance A BiP3 protein has been discovered in the Xa21 protein complex by immunoprecipitation followed by QC M S/MS (Park et al ., 2010b) Ectopic expression of OsBiP3 causes d elayed XA 21 accumulation and compromised XA21 mediated resistance XB15 fall s in to protein phosphotase 2C group and works a s a serine threonine pho spha tase (Park et al ., 2008) XB15 reverses the autophosphorylation activity of XA21 in a temporal and dosage dependent manner in vitro Overexpression of X B15 downregulate s resistance to Xoo mediated by XA 21 I n c ontrast, cell death and constitutive PR gene expression are observed in plants with reduced level s of XB15 XB24, however, keeps XA21 in an inactive state by enhancing the autophosphorylation of XA21 in the absence of effectors (Chen et al ., 2010c) XB24 carries an ATPase domain and functions mainly before the recognition of Ax21 T he presence of the cognate effectors triggers the dissociation of XA21 from XB24 to activate XA21 signaling and meanwh ile promotes the interaction between XA21 and X B 15. The involvement of transcription factors in X A 2 1 mediated immunity i s established through the study of OsWRKY62, also named XB10 because of its interaction with XA21 (Peng et al ., 2008) Differ ing from the Arabido psis WRKY transcription factors AtWRKY22 and AtWRKY29 which are induced by recognition of flg22 by FL S2 XB10 is negatively involved in XA21 mediated immunity. OsWRKY62 overexpressing plants displayed suppress ed PR gene expression and consequently compromised PTI and ETI All of

PAGE 48

48 this information collected from XA21 binding proteins suggests that X A 21 acti vity and signaling is controlled and balanced by a well coordinated complex at multiple levels. Since the cloning of Xa2 1, effort has been appli ed t o identify ing the effector triggering the XA21 mediated immunity. A forward genetics approach was applied t o screen Xoo mutants with impaired activation of Xa21 immunity (Ax21) activity A number of mutants have been obtained with mutation in genes involved in either the Type 1 secretion system or sulfation (Lee et al ., 2006; Park et al ., 2010a) Although previous trials fail ed to specify the Ax21 gene, it provided valuable hints that Ax21 is a sulfated product secreted by T1SS (da Silva et al ., 2004) A biochemical approach was then applied analyzing bioactive components in the supernatants of avirulent strain PXO99a (Lee et al ., 2009) A peptide with XA21 immunity triggering activity was discovered and identified by LC MS/MS T he Ax21 ge ne was isolated accordingly. A x 21 is a putative quorum sensing (QS) signal and mediat es the control of required for A x 21 activity ( rax ) gene expression in a dens ity dependent manner (Lee et al ., 2006) Substitution of tyrosine, a putative sulfation site with alanine abolish es the a bility to trigger Xa21 signali ng, confirming that sulfation i s r equired for a functional Ax21. The 17 amino acid peptide at the N terminus of the A x 2 1 protein contain ing the sulfated tyrosine is sufficient to initiate XA21 signaling. The di rect binding between XA21 and A x 21 has been shown by co immunoprecipittaion, implying the direct percep tion of Ax21 by X A 21. Ax21 is unique because it is an evolutio narily stable T1SS effector. The core 17 amino acid residues are conserved in all Xanthomonas species examined and a putative ortholog is present in other bacteria including the opportunistic human

PAGE 49

49 pathogen Stenotrophomonas maltophilia (Lee et al ., 2009) The con s er v ed Ax21 is contradictory to the traditional definition of avirulence effectors challeng ing the distinction between PTI and ETI. A comparison i s drawn to demonstrate the difference among PTI, ETI, and t he Xa21 Ax21 system (Tab le 1). Xa21 i s originally identified as the first R gene conferring resistance to Xoo because plants with XA21 display high level of resistance (Song et al ., 1995) PTI, in contrast, is a w eak defense response. Although Ax21 is con served, similar to PAMPs, Ax21 activity is specified by a sulfation system in a limited number of strains (Park et al ., 2009) These character istic s keep X A 21 Ax21 linked to ETI. However, Xa21 Ax21 resembles PTI in that Xa21 is a receptor kinase, structura lly close to PRRs (Song et al ., 1995) So far, the only RLK type R proteins identified are X A 21 and X A 26. Most of the R proteins fall into the NB LRR category. R ecent research has un cover ed that various forms of Ax21 can be recognized by FLS2 in Arabidopsi s and trigger a response highly similar to flg22 (Danna et al. 2011) The re are also unique features making X A 21 Ax21 system difficult to categorize as either PTI or ETI In stark contrast to most of the effectors contributing to virulence and PAMPs cruc ial for bacteria l life cycle s Ax21 is a putative QS signal dispensable for bacteria (Lee et al. 2006) However, Xoo strain Korean Race 1 (KR1) with impaired Ax21 activity does not grow as vigorously indicat es the fitness contribution of Ax21. Moreover, most of the PAMPs are not actively secreted and are recognized by PRRs in the extracellular spaces. Effectors are secreted into the host cell cytoplasm and recognized there by R proteins. Ax21 is secret e d by T1SS and the recog nition takes place extracellul arly.

PAGE 50

50 All of th is information point s to th e concept that PTI and ETI are not necessarily independent defense responses The classical definition of PTI and ETI are being questioned and further studies are ne eded for better understanding o f the se definitio ns and plant pathogen interactions

PAGE 51

51 Fig ure 1 1. The principles of plant immunity to bacterial pathogen s Bacteria propagate exclusively in the intercellular spaces of plant tissue and secrete PAMPs in the extracellular spaces. PAMPs are recognized b y cell surface PRRs and trigger PTI. Interaction with BAK1 is required for the initiation of PTI signaling, such as activation of MAPK cascades, and reprogramming of host transcriptome mediated by transcription factors including WRKY transcription factors. Concurrently, a number of effectors are delivered to target host protein s and inhibit the PTI process. These effectors are typicall y delivered into cytosol by T3SS but extracellular effectors have also been reported. Effective effectors allow the signifi cant amplification of bacteria and this process is termed ETS. Plants develop R proteins including NB LRR proteins, RLKs to recognize the effectors and mount a stronger ETI.

PAGE 52

52 Figure 1 2. Models of recognition between effectors and R proteins. R protein s can directly bind to and recognize the effectors as in the ligand receptor model or an indirect recognition i s initiated with the help of an accessory protein. In the guard model, the accessory protein is the virulence target guarded by the R protein. T he accessory protein is a decoy, mimicking the virulence target solely to trap the effectors in the decoy model. I n both the guard and decoy model s t he modified accessory protein is recognized by the R protein. A two step recognition initiation process is described in the bait and switch model. to a conformational change of the R protein and switches the R protein to the

PAGE 53

53 Table 1 1 Comparison of PTI, ETI and XA21 A x 21 system s PTI ETI XA21 AX21 Effectors Required for no rmal physiology Contribute to pathogenencity, mainly synthesized in the presen ce of host Part of life cycle, QS signal(fitness cost) Conserved Strain specific Core molecular conserved, sulfation system specifies the host recognition T ypically n ot acti vely secreted Secreted by T3SS Secreted by T1SS Receptors RLK Mostly NB LRR RLK Extracellular recognition Mostly intracellular recognition Likely extracellular No resistant responses in most cases Resistant response Dominant resistant responses in mos t cases

PAGE 54

54 CHAPTER 2 CHARACTERIZATION OF DEVELOPMENTAL REGULA TION OF XA21 MEDIATED RESISTANCE 2.1 Background Information Plant disease is the result of a t ripartite war as well conceptualized by the concept of the disease triangle (Stevens, 1960) E ach point of the tr iangle environment, pathogen, and host is equally important in determining the outcome of a disease. A susceptible ho st, a virulent pathogen and a favorable environment are indispensible components for disease development Absence of any one of the fac tors results in no disease. For example, a virulent pathogen may not be able to cause disease in a susceptible plant when the environment is not favorable. Targeting any one of the se factors can block disease development and provide s a possible strategy f or disease resistance. On the host side, plant growth and development, in addition to genotype, have be en known to contribute to resis tance. The same holds true for pathogens. Environment al factors such as temperature, humidity and light play an important role in plant microbe interactions as well. Plants lack spe cialized mobile defen s e cells, and rely solely on innate immunity involv ing all cell types to survive the environment (Jones and Dangl, 2006) To minimize the damage brought on by stress signal s there is a delicate control of balance between plant development and the defen se response. E arly knowledge on the crosstalk between disease and plant development is from the altered plant growth and development c aused by disease infection. M odified growth and development a re accompanied by a promotion of pathogen nutrient as well as suppression of host immune response. These discoveries le a d to the hypothesis that plant development and

PAGE 55

55 defense responses are, instead of two independent pathway s directly or indirectly connected to each other into an integrated system (Chung et al ., 2008) Plant growth and development has been associated with both effector triggered immunity (ETI) and PAMP triggered immunity (PTI) In general, plants display more resistance at later phases, either abruptly or gradually (Develey Ri viere and Galiana, 2007) A few terms have been adopted to describe the acquisition of resistance related to mature seedling (Whalen, 2005) Ma ize has shown increased resistance at adult stages to the rust fungus Puccinia sorghi (Abedon and Tracy, 1996; Abedon, 1996) The transition from juvenile ve getative stage to adult stage is critical for acquired ad ul t resistance. Rice plants show gradually decreased sensitivity to Xoo attack as plant s mature in a non race specific manner. Two cloned R genes Xa21 and Xa3 / Xa26 also confer age related resistance to Xoo (Mew, 1 987; Mark et al ., 1994; Cao et al ., 2007) There are, ne vertheless, reports of increased susceptibility as plants mature For example, adult plants are more vulnerable to infection by Phytophthora infestans (Peterson and Mills, 1953) A gro wing body of examples of A RR has been repor ted in both monocots and dicots to various pathogens including virus, bacteria and fungi, but the mechanisms controlling ARR have yet to be explored. Hormones are important signal molecules produced w ithin plants to regulate growth and dev elopment. Plant hormones are classified into eight categories: auxin, gibberellic acid (GA), cytokinin (CTK), brassinosteroid (BR), abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), and ethylene (ET). Among them, SA, JA and ET

PAGE 56

56 have been shown a s major signal molecules in plant defense response s It has been demonstrated that SA is critical for systemic acquired resistance (SAR) and pathogenesis related ( PR ) gene induction in dicots such as Arabidopsis (Grant and Lamb, 2006) By contrast, endogenous SA in rice is maintained at a high level and pla y s a limited role in the induced defense response (Silverman et al ., 1995) JA, as well as ET, is more ofte n involved in resistance to necrotrophs. Recently, roles of other hormones in the plant defense pathway have attracted attention. ABA is one of the most often studied hormones having various effects depending on the pathogen and the host. ABA antagonistica lly regulates SA induced resistance in tobacco, allowing for promoted growth of Botrytis cinerea (Audenaert et al ., 2002) When indo le 3 acetic acid (IAA) wa s applied exogenously to rice plants, the resistance to bacterial blight wa s strongly inhibited (Ding et al ., 2008) In addition to the host, environment al conditions are also an important aspect involved in plant pathogen interactions. The effect of t emperature one of th e most commonly reported factors influencing host pathogen interactions, varies with each pathosystem More often, elevated temperature s lead to decreased disease resistance (de Jong et al ., 2002) For example, resistance to TMV conferred by the tobacco N gene i s sensitive to temperatures higher than 28C (Wang et al ., 2009) In general, high temperature s favor the spread of rice bacterial blight (Webb et al ., 2010a) However, there are also instances where resistance increase s with elevat ed temperatures. Rice bacterial blight is less severe overal l on rice lines carrying the Xa7 gene at higher temperatures (Webb et al ., 2010b)

PAGE 57

57 Xa21 was the first cloned resistance ( R ) gen e responsible for resistance to bacterial blight of rice. Xa21 encodes a receptor kinase conferring resistance to all Xoo races harboring the corresponding effector, activator of Xa21 mediated immunity ( Ax21 previously designated as AvrXa21 ) (Song et al ., 1995; Lee et al ., 2009) However, XA21 mediated resistance i s believed to increase gradually with plant maturity. Plants exhibited minimal resistance at the two leaf stage and confer full resistance at the booting stage (Mark et al ., 1994) PR gene expression i s induced only in challenged adult plants, but not in susceptibl e young plants (Ponciano et al ., 2006) This trait of developme ntal regulation limits its potential application as a plant breeding strategy, because rice plants are more susceptible to Xoo infection at younger st ages. The shift to adult resistance i s partly due to an increased Xa21 expression level at the adult stage s (Zhao et al ., 2009) Zhao and colleagues (2009) first reported the XA21 mediated resistance at the seedling stage through a transgenic expression line B acterial amplific ation i s s evere ly limited in the transgenic plants expressing Xa21 but not in the Xa21 donor line IRBB21. The elevated Xa21 expression level i s associated with an increased resistance response (Zhao et al ., 2009) Recently, overexpression of Xa21 has been e mployed as an alternative strategy to overcome the developmental regulation of XA21 mediated resistance in two separate studies, confirming the role of increased Xa21 expression in the resistant response (Chen et al ., 2010a; Park et al ., 2010c) By creating transgenic plants expressing Xa21 driven by the maize ubiquitin promoter, Xa21 confer s resistance in an Ax 21 dependent manner at the seedling stage. In this study, XA21 mediated resistance was established at the seedling stage. The effect of environmental factors and supplementary hormone treatments were

PAGE 58

58 studied to determine the possible involvement of other factors in the developmental regulation of XA21 mediated resist ance High temperature, JA and ABA were identified as suppressors of XA21 mediated resistance at the seedling stage. 2.2 Materials and Methods 2.2.1 Plant M aterial s a nd G rowth C onditions Rice ( O ryza sativa L.) Indica lines, IR24 and IRBB21 were provided as a c o urtesy by the International Rice Research Institute (IRRI) Japonica lines TP309 its isogenic XA21 transgenic plants 4021 3, U0 137 and 716 10 were created in this lab carrying Xa21 driven under its native promoter (Wang et al ., 2006, Xu et al ., 200 6) Before germination, rice seeds were surface sterilized by soaking in 70% ethanol for 5 minutes followed by full strength bleach for 30 minutes. Sterilized seeds were washed in distilled H 2 O for 5 times and put with endosperm side down onto 1/2 Murashig e and Skoog (MS) medium [ a mmonium nitrate (NH 4 NO 3 ) 1,650 mg/L, p otassium nitrate (KNO 3 ) 1,900 mg/L, m agnesium sulfate (MgSO 4 7H 2 O) 370 mg/ L, c alcium ch loride (CaCl 2 2H 2 O) 440 mg/L, p otassium phosphate (KH 2 PO 4 ) 170 mg/L, f errous sulfate (FeSO 4 7H 2 O) 27.8 mg / L, Na 2 EDTA 2H 2 O 37.2 mg/L, m anganese sulfate (MnSO 4 4H 2 O) 22.3 mg/L, z inc sulfate (ZnSO 4 7H 2 O) 8.6 mg/L, b oric acid (H 3 BO 3 ) 6.2 mg/L, p otassium iodide (KI) 0.83 mg/L, c obalt chloride (CoCl 2 6H 2 O) 0.025 mg/L, c upric sulfate (CuSO 4 5H 2 O) 0.025 mg/ L, s odium molybdate (Na 2 MoO 4 2H 2 O) 0.25 mg/L, i nositol 100 mg/L, g lycine (recrystallized) 2.0 g/L, n icotic acid 0.5 mg/L, p yridoxineHCl 0 .5 mg/L, t hiamine HCl 0.1 mg/ L, s ucrose 3 0 g/ L, Phytogel (Sigma, St Louis, MO) 2.5 g/ L, pH 5.7 5.8]. Seedlings were grown for 7 days at 26 27 C with a 15 h light and 9 h dark photoperiod under fluorescent light with a light intensity between 1 6 0 180 1 m 2 and 50 60% humidity. A ll seedlings were then transferred in to water and maintained under the same

PAGE 59

59 condition for an addit ional week until reaching the two leaf stage for pathogen inoculation and protein extraction unless otherwise specified. 2.2.2 Xoo I noculation and B acterial P opulation D etermination Seedling s at the two leaf stage were inoculated by the scissor dip method as described by Song et al ( 1995 ). Xoo strains PXO99a carrying Ax21 and Korean Race 1 (KR1) without Ax21 activity were used for inoculation. Xoo strains were streaked on semi selective solid p eptone sucrose agar (PSA) media (10 g/L peptone, 10 g/L sucrose 1 g/L glutamic acid monosodium salt, 16 g/L bacto agar, 15 mg/L cycloheximide) and incubated at 28C for three days. I f strain PXO99a was used 0.1 mM 5 azacytidine was added into the media For inoculation, bacteria l culture was suspended in H 2 O ; and t he concentration was adjusted to a final optical density of A 600 =0.5 [ 5.0x10 7 colony forming units (cfu) per m L ]. Sterilized scissors dipped into the bacteria suspension were used to cut the leaf at about 1/10 leaf length from the tip. Lesion length and whole leaf length were measured at 12 days after inoculation. Resistanc e was assay ed by the percentage of infected area calculated based on the ratio o f lesion length to leaf length. 2.2.3 Bacterial Population Study For Xoo bacterial population studies, whole i noculated leaves were collected at indicated time points. Collect ed leaf samples were ground thoroughly in 10 m L sterile tap water with a mortar and pestle in the presence of sterilized sand The g round material was diluted and plated onto PSA plates Colonies on plates were counted after incubation at 28C for 3 days a nd the bacteria l population s were calculated and expressed as cfu /leaf. Bacterial populations were assessed by l o g 10 (cfu/leaf).

PAGE 60

60 2.2.4 Protein Extraction Total rice p roteins were extracted from two leaf stage rice plants as described by Xu et al (2006) More than five leaves from different individuals were used for each preparation. About 100 mg of leaf tissue was ground in liquid nitrogen to a fine powder. W ell ground leaf tissue was then thawed in an equal volume of protein extraction buffer [ 20 mM Tris HCl, pH8.0; 150 mM NaCl; 1 mM e thylenediaminetetraacetic acid ( EDTA ) ; 0.1% Triton X 100; 0.2% p roteinase inhibitor (Sigma Aldrich) 5% v/v mercaptomethanel ( ME) 0.1 M phenylmethanesulfonylfluoride ( PMSF) ] by rocking at 4C for 1 h Cell debris was re moved by centrifugation at 12 000 rpm, 4 C for 10 min. Supernatant containing protein was transferred to a new tube and quantified by Bradford protein assay based on the standard. Prepared protein was boiled with 1x SDS protein loading buffer [31.25 mM Tri s HCl (pH 6.8), 5% glycerol, 1% SDS. 2.5% ME 0.05% bromophenol blue] for 5 minutes and stored at 20C. 2.2.5 Immunodetection For protein b lot analysis, approximately 20 g of protein per lane was separated on 6.5% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE) at 80 V fo r 30 min followed by 120 V for 180 min. Separated protein was equilibrated in transfer buffer (20% methanol, 25 mM Tris, 188 mM glycine) for 10 min before transfer to equilibrated PVDF membrane (methanol 15 s, H 2 O 2 min, transfer buffer 5 min) (Millipore C orporation, Bedford, MA, USA) The transfer was conducted using Mini Trans Blot Cell (Bio Rad, Hercules, CA) at 100 V for 1 h in the transfer tank containing 800 mL of transfer buffer amended with 300 L 20% SDS The membrane was rinsed with TBS ( 100 mM Tr is HCl, pH7.9; 150mM NaCl) to remove any gel residue s and incubated in 5% non fat dried milk in TTBS ( TBS, 0.1% Tween 20) for 1h to eliminate

PAGE 61

61 the non specific binding followed by a 10 min wash in TTBS. The membra ne was then incubated in anti myc (1:1000) in 3% bovine serum albumin (BSA) at 4C overnight followed by three 10 min washes in TTBS. Incubation with secondary a ntibody was performed in 5% non fat dried milk containing anti mouse IgG (1:3000) at room temperature for 1h. The membrane was washed thre e times in 100 m L TTBS for 10 min each before developing, using an ECLPlus kit (Amersham Bioscience, Piscatsway, NI, USA). 2.2.6 RNA I solation RNA was isolated from 100 m g of leaf tissue with RNeasy mini kit (Qiagen, Valencia, CA) according to the manufact In brief, well ground plant tissue was suspend ed in of b ME and vortexed vigorously. The lysate was transferred to a QIAshredder spin column and centrifuged for 2 min at full speed. The supernatant of the flow through was mixed with 0.5 volume of 100% ethanol. The sample was transferred to an RNeasy spin column and centrifuged for 30 s at 10,000 rpm. The column was washed once with 700 of b uffer RW1 and twice with 500 of b uffer RPE. The RNA sample was eluted with 30 free water and subjected to DNA digestion w ith TURBO DNA TX). For a 100 L reaction, up to 20 g RNA was mixed with 10 L TURBO DNase buffer, 2 units of DNase and incubated at 37 C for 20 30 min To stop the reaction, 10 L DNase Inactivation Reagent was added. After incu bating at room temperature for 2 min, the mixture was centrifuged down and the supernatant was transferred to a new tube.

PAGE 62

62 2.2. 7 Microarray A nalysis For the microarray analysis, 4021 3 plants were germinated and grown as described in 2.2.1 until seedlings r each the two leaf stage. Seedlings were grown at 26 27 C or 31 32 C respectively for another three days and leaf samples were collected from multiple individuals for RNA preparation. DB Micro array ( G2519F, Agilent Technologies Santa Cl ara, CA ) w as used for transcriptome analysis. RNA was prepared from three independent experiments as described above and fluorescence labeled as instruct ed by the manufacturer A dye swapping (Cy3 and Cy5) labeling system was adopted to compensate for diff erences between dye s All microarray labeling, hybri di z ation, and raw data extraction were performed by the Interdisciplinary Center for Biotechnology Research ( ICBR ) at the University of Florida. All data acquired were further analyzed with Genespring GX software (ver. 11.5 ; Agilent). For normalization e ach measurement was shift ed to 75 .0 percentile of each data set to normalize for slide bias ; and a baseline transformation was carried out on the medium value of all measurements in that sample Readings w i th intensities less than the 20 perce ntile of the overall readings were not in cluded in the subsequent analys e s. A further statistic al analysis was performed to screen data within the range of p <0.05 with an unpaired t test, and a false discovery rate (FD R) <0.05 using the Benjamini Hochberg method. A cut off of > 2.0 fold change was then applied to select genes significantly changed by high temperature treatment compared to the low temperature. A ll entities were imported into G enespring for gene ontology ( GO ) analysis

PAGE 63

63 2.3 Results 2.3.1 XA21 mediated Resistance w as Activated a t t he Seedling Stage Rice lines used in this study paimari ly include d susceptible line TP309, and resistant line 4021 3 which is an isogenic line of TP309 carrying Xa21 myc driven by its native promoter. Plants were inoculated at the two leaf stage with avirulent pathogen PXO99 a expressing active Ax 21 Lesion development was scored at 12 days post inoculation (dpi) As early as 6 days after inoculation, TP309 plants displayed discolor ation and water soaked symptom s in areas adjacent to the inoculation sites. No early disease symptom s were observed on 4021 3 plants challenged with PXO99a. At 12 days after inoculation, leaves on TP309 plants were entire ly curled and wilt ed as in a typica l susceptible reaction Conversely, when 4021 3 plants were challenged with PXO99 a disease expansion was severely restricted. A small area of necrosis was visible, with lesion area s less than 20% of the leaf, indicating that 4021 3 plants were resistant t o PXO99 a attack (Fig. 2 1A, 2 1 B). To validate the resistance observed at the seedling stage, two other lines expressing Xa21 under their native promoter s U0 137 and 716 10 were tested for resistance. D isease symptom s were constrained in U0 137 and 716 1 0 plants, similar to that observed in 4021 3 plants, confirming that at the seedling stage the presence of Xa21 was able to confer resistance (Fig. 2 1 B) In addition TP309 and Xa21 expressing plants were inoculated with a virulent strain KR1, which is im paired in the sulfation system required for Ax 21 activity (Burdman et al ., 2004) In stark contrast to the resistance observed in Xa21 expressing plants challenged with PXO99a, all plant s tested were susceptible to infection by KR1 including the TP309 and Xa21 expressing plants ( Fig. 2 1 A, 2 1 B ). Lesion development was c omparable among all plants inoculated with KR1. The susceptibility to KR1,

PAGE 64

64 regardless of the presence of Xa21 impl ies th at the resistance establis hed on Xa21 expressing plants in this study i s dependent on expressing of Ax 21 Consistent with the different lesion length s observed, the bacterial population of PXO99 a in the 4021 3 plants was 100 fold less compared to that in the TP309 plants (Fig. 2 1 C ). Two days after inoculation, a significant differe nce was detected between PXO99a inoculated TP309 plants and 4021 3 plants. In TP309 plants, bacterial population s reached 9.3 10 7 cfu / leaf at 6 dpi while in 4021 3 plants, the maximum population detected was 9.210 5 cfu/leaf. The bacterial population decrease d after 6 dpi in the TP309 leaves. This is probably due to the lack of available nutrient s in dying fully diseased leaves consistent with the susceptible reaction observed in TP309 plants. In contras t, bacterial population s in 4021 3 plants were maintained a t a stable level though 8 dpi (Fig. 2 1C) IRBB21 is a near isogenic introgr ession line of IR24 developed at IRRI containing the Xa21 gene. Zh ao et al (2009) reported a failure to activate resistan ce i n IRBB21 plants at the seedling stage stat ing that the resistance in transgenic seedling plants was possibly due to a higher copy number of Xa21 To test if IRBB21 is resistant u nder the conditions described in this study, IR24 and IRBB21 plants were inoculated with PXO99a. When IRBB21 plants were grown at 26 27 C after inoculation, All plants infected with the avirulent pathogen exhibited a strictly confined disease lesion comparable to the transgenic plants 4021 3 (Fig. 2 2 ) The results confirm that under the conditions used in this study, X A 21 mediated resistance can be activated at the seedling stage independent of genetic background or copy number of the Xa21 gene.

PAGE 65

65 Because all plants containing XA21 exhibited similar level s of resistance, the tran sgenic line 4021 3 was selected for subsequent studies. 2.3.2 Temperature w as t he Key Environmental Regulator o f XA 21 Mediated Resistance a t the Seedling Stage As indicated in the concept of the disease triangle, the environment is a key component in plant pathogen interactions. Different growth conditions were tested to verify the importance of various environment al factors in XA21 seedling resistance. 4021 3 plants were grown in different growth media, under varying temperatures, and/ or under various ligh t sources immediately after inoculation with PXO99a. No change in response to PXO99a infection w as detected when the light sources was switched from fluorescent light (FL) with a light intensity of 160 180 1 m 2 to metal halide light ( M H ) with a light intensity of 220 230 1 m 2 (Fig. 2 3 A). Likewise, resistance was unaffected by growth media. When the plants were grown in soil instead of water after inoculation, 4021 3 plants remained highly re sistant to PXO99a infection with a mean lesion area below 10% (Fig. 2 3 A) T hese strongly indicate that the resistance response observed was independent of growing medium, light source or intensity. On the other hand, 4021 3 p lants grown at a moderately el evated temperature showed attenuated resistance and enhanced l esion development. When temperature reached 31 3 2 C, resistance mediated by the Xa21 gene was completely abolished under fluorescent light (Fig. 2 3 B) This tre nd was repeatedly observed when th e plants under metal halide light at 26 27 C were compared to those at 31 3 2 C validating the crucial role of temperature in XA21 mediated resistance Under all conditions tested, a constant susceptible reaction was observed on TP309 plants, supporting th at alteration of the resistance response was not due to the v ariation in virulence of PXO99a

PAGE 66

66 All 4021 3 leaves inoculated under high temperatures exhibited discoloration, withering and water soaking, similar to the TP309 plants (Fi g. 2 4 A) The bacteria l populations in the 4021 3 plants under the high temperature were comparable to those in the TP309 plants. At 6 dpi, bacterial population s reached up to over 310 7 cfu/leaf in the 4021 3 plants grown at high temperature as well as in the TP309 plants (Fig 2 4B ). The results from the bacteria population study verified that the lesion s d eveloped at high temperatures w ere likely associated with higher bacterial population as opposed to high temperature damage to the plants The conclusion is further supporte d by the result from the temperature swap experiments that resistance can be re activated by low temperature treatment as described below. These results together suggest that higher temperatures a re more conducive to d isease development and inhibit XA21 me diated resistance at the seedling stage. 2.3.3 Activation of XA21 mediated Resistance Requires Constant Low Temperature Treatment A temperature swap experiment was carried out to better understand the temperature effect on XA21 mediated resistance. Six g ro ups of 4021 3 plants were maintained at low temperature s ( 26 27C ) after inoculation with PXO99a One group of plants w as transferred to 31 32 C each day from 1 day to 6 days after inoculation All plants were then maintained at 31 32 C until scored at 12 dpi to assess disease development. An extra group was kept at low temperature as a control. Alt hough little lesion development was observed when plants were initia lly kept at the low temperature s all plants showed full susceptibility after transferred to the high temperature s Plants consistently developed full lesion at 12 d pi regardless how long they had been kept at the low temperature s (Fig 2 5 ). In general growth at low

PAGE 67

67 temperature for 6 days is sufficient to trigger the resistance as shown by the b acterial population in Fig.2 1 C Nevertheless plants transferred to the high temperature s at 6 dpi lost the resistance indicating that the pre exist ing XA 21 resistance wa s blocked at high temperature s In reciprocal experiments plants were gradually tr ansferred to 26 27 C from 31 32 C, from 1 dpi to 6 dpi and scored for lesion development at 12 dpi. Disease development i n these plants was wel l correlated with the duration of plants kept at high temperature s (Fig. 2 5 ) The longer plants were maintained at high temperature s the m ore severe the disease development was Seedlings transferred to low temperature s at 1 or 2 dpi were highly resistant, while plants transferred to low temperature s after 3 dpi showed various level of susceptibility, depending on the time it wa s moved No resistance was detectable i n plants kept at high te mperature s for 5 days Disease development was disrupt ed o nce plants were moved back to low temperature s confirming the activation of XA21 signaling and resistance responses by low temperature treatment. A similar temperature swap experiment was performed on TP309 plants. No temperature effect was observed on TP309 plants, as eviden ced by uniform lesion development observed on all the TP309 plants regardless of the temperature t reatment (Fig. 2 5 ). These results confirmed that the low temperature induced resistan ce displayed by 4021 3 plants i s due to XA21 signaling, rather than altered basal defense. 2.3. 4 Temperature Effe ct o f XA21 Mediated Resistance w as Independent o f Pathoge n Activity o r XA21 Abundance One possible explanation f or increased disease development at high er temperature s may be growth promotion of PXO99 a To test this hypothesis, PXO99a

PAGE 68

68 w as grown o n PSA medium and incubated at the resistant (26 27C) and suscepti bl e (31 32C) temperatures described above. C olon y size was measured after 3 days to compare the growth rate (Fig. 2 6 A). Despite the variation s observed, colonies grown at low temperature reached an average diameter of 13 m m while colonies cultured at hi gh temperature s were approximately 10 m m in diameter. The f aster growth speed under low temperature diminish ed the possibility that enhanced susceptibility at high temperature were attributed to i ncreas ed bacteria l growth. Another hypothesis is that high t emperat ure disrupts the activity of Ax21. To test the Ax 21 activity, adult 4021 3 plants were inoculated with PXO99a at 31 32 C. A x 21 function was not affected by high growth temperature at 31 32 C as indicated by the high level of resistance observed on t he adult 4021 3 plants (Fig. 2 6 B) All these data supported the hypothesis that the susceptible reaction w as mainly due to alteration of the plant defense response instead of a temperature effect on the pathogen growth rate or impaired A x 21 activity. Alth ough Xa21 was cloned as early as in 1995, the mechanism by which Xa21 triggers the resistance response remains obscure. Zhao et al (2009) reported that different Xa21 expression level s contribute to the developmental regulation of XA21 resistance by monit oring Xa21 transcript level in different developmental stages in transgenic and introgression XA21 lines The XA21 protein level was thus examined in 4021 3 plants growing at 26 27C or 31 32 C. Leaf tissues were collected at 3, 6, and 9 days after plants were transferred to the specified temperatures for analysis. No distinguis hable difference of XA21 abundance was identified across all of the plants tested. The stable XA21 level suggests a limited role of XA21 protein accumulation in temperature regulatio n of XA21 mediated resistance (Fig. 2 6 C ). A significant amount of

PAGE 69

69 XA21 was detected in 4021 3 plants even under the susceptibl e cond i tions suggesting that, other factor(s), rather than XA21 accumulation is the key element controlling the temperature e ffect on XA21 mediated resistance. 2.3.5 High T emperature D eregulates E xpression of R ice G enes R elated to D efense R esponses To identify downstream responses possibly involved in the temperature effect of XA21 signaling, a genome wide microarray experiment was performed Non inoculated r ice leaves from 4021 3 plants were collected at 3 days following maintena nce at low ( 26 27C ) or high temperature s ( 31 32C ) for transcript analysis The vol c ano plot ( Fig. 2 7) illustrates the distribution of the data points and the significance of difference s in expression levels. In total, out of 29 983 genes, there are 935 (3.1%) genes upregulated and 881 (2.9%) downregulated by the high temperature treatment with a >2 fold change Among the genes regulated by high temper atu re treatment, the largest group s are composed of genes in volved in metabolism and cell cycle (Fig. 2 8 ) In addition, a pproximately 340 stress responsive genes were de regulated by temperature Among them, there are 31 biotic stress related genes upreg ul ated by high temperature, primaril y involved in thioredox in or signal transduction (Tab le 2 1). T wenty three of the down regulated genes were biotic stress responsive, including PR genes, redox regulated genes OsWRKY77 ( Os01g40260 ) transcription factor res ponsive to pathogen infection (Tab le 2 2 ) Noticeably the OsPR10 gene ( Os03g18850 ) was downregulated more than 100 fold by the high temperature treatment. A c hitinase encoding gene was downregulated more than 18 fold. However, none of the gene s i dentified in XA21 signaling so far was significantly regulated by temperature s tested in this study (Parker et al. 2010a)

PAGE 70

70 2.3. 6 Inhibition of X A21 M ediated R esistance at S eedling S tage by JA and ABA A pplication Numerous examples have demonstrated the vital role o f plant hormones in defense responses. Previous studies revealed that exogenous IAA application cause d enhanced susceptibility to Xoo in rice plants (Ding et al ., 2008) To investigate the possible crosstalk betwee n hormones and XA 21 signaling different hormones were exogenously applied to 4021 3 plants IAA, GA CTK, BR, SA, JA, or ABA (Sigma, St Louis, MO) was added directly to water immediately prior to inoculation to design at ed concentrations according to prev ious reports (Ding et al 2008) A co ntrol group of TP309 and 4021 3 plants in H 2 O w ere included to provide a baseline of PXO99a virulence and XA21 function. For ethylene treatment, plants were placed in a transparent sealed tank, and ethylene was injected into the tank to reach the desired concentration. Control plants were grown in a n identical tank without ethylene injection. All plants were inoculated with PXO99 a and scored as described above. Plants treated with hormones, displayed promoted or suppress ed growth in different degrees compared to the water treated control plants, depending on the given hormone and concentration, indicating that the hormones supplied were taken effectively by plants. N o significant effect of IAA treatment was observed. Amon g all of the hormones tested, only JA and ABA affect ed the resistance of the 4021 3 plants to PXO99 infection (Fig. 2 9, 2 10 ). The effect of ABA and JA treatment was dosage dependent: lesion length increased with elevated ABA /JA concentration s For exampl e, p lants treated with 1 M or 10 M ABA showed dramatically reduced resistance, compared to water treated control 4021 3 plants W hen applied at 100 M ABA completely block ed the XA21

PAGE 71

71 mediated resistance w ith lesion covering the entire leaf. Only ABA, b ut not the JA application eliminated the resistance (Fig. 2 9) To confirm that the increase in lesion length s were caused by enhanced bacterial multiplication in planta bacterial population s in inoculated 4021 3 plants were evalua ted. In agreement with t he partial resistance observed, t he bacterial population in 5 M ABA or 100 M JA treated 4021 3 plants are ten fold more than those in the water treated 4021 3 plants but lower than in the susceptible TP309 plants (Fig. 2 10 C ) 2.4 Discussion In general, plants deploy two strategies for defense response s namely PTI elicited by conserved P AMP s and ETI ( also termed gene for gene resistance ) mediated by specific interaction s between R genes and effectors (Jones and Dangl, 2006) With accumulating knowledge on the interaction s between R genes and their corresponding Avr genes, the d istinction between P TI and ETI is less clear (Park et al ., 2010a) Although Xa21 i s recognized as the first cloned R gene in rice it encod es a receptor kinase a family of proteins extensively involv ed in PAMP perception (Song et al ., 1995) It sho uld be noted that A x 21, the effector corresponding to X A 21 i s conserved among different Xanthomonas species characteristic of PAMPs (Chen et al ., 2010d) Ax21 triggers basal defense through FLS2 in Arabid opsis, in parallel to flg22 (Danna et al. 2011). R ecent progress has made the XA 21 Ax21 system an ideal platform to investigate concepts of distinct PTI a nd ETI independent pathways in host pathogen interactions. However, the fact that the resistance is only observable in adult plants severely limits the se stud ies (Century et al ., 1999; Thomma et al ., 2011) Althoug h overexpression of the Xa21 gene is able to partly overc o me the developmental regulation of the resistance, the side effect of the constitutive expression has not been

PAGE 72

72 assessed (Chen et al ., 2010a; Park et al ., 201 0b) Here, we show activation of the resistance at the seedling stage without genetic modification, which can greatly facilitate further studies The modification of the resistant response by changing environment al condition s or by applying hormones confi rmed the amenability of the system. The discovery of temperature as a switch of the resistance response enables dissecting the molecular mechanism s involved in the regulation of the XA21 resistance. A few st udies have been carried out to test the developme ntal regulation of X A 21 mediated resistance. Century et al (1997) first reported that the increased resistance upon maturity was independent of Xa21 expression levels. Ponciano et al (2006) discovered that the PR gene expression was only induced in the re sistant reactions. It is therefore assumed that the XA21 resistance is mainly regulated by post transcriptional modification of Xa21 or by operation of the downstream components. T he X A 21 mediated resistance at the seedling stage was first described in Xa2 1 transgenic plants but not in the introgression line IRBB21 carrying Xa21 (Zhao et al ., 2009) It has been reported that t he Xa21 level i s higher in the transgenic lines than in the donor line. I n the transgenic l ines Xa21 level i s stabl y maintained at a high level throughout the development, well correlated with the resistance observed at different development stages in the transgenic plants In the donor line IRBB21 however, Xa21 level increase s with plant matu rity (Zhao et al ., 2009) Together, t hese discoveries link XA21 mediated resistance to Xa21 expression which i s further supported by the recent discovery that overexpression of Xa21 can partly abrogate the juvenil e susceptibility in Xa21 carrying plants (Chen et al ., 2010a; Park et al ., 2010b) In this study, we f oun d that XA21 transcript s and protein s are stable and comparable under both the

PAGE 73

73 susceptible and re sistant conditions indicating the alteration of resistance by temperature i s mainly due to other factors rather than XA21 abundance The Xa21 expression hypothesis failed to justify another discovery in this study: all Xa21 carrying plants including IRB B21 a re resistant to the avirulent pathogen, irrespective of genetic background or copy number. The output of this study is consistent wi th the hypothesis that the post translational modification or regulation of downstream pathways plays a n important rol e in XA21 signaling When considered as a whole the Xa 21 pathway is regulated at multiple levels including Xa21 expression and other possible mechanisms Interruption of any k ey step in this regulation c ascade can lead to a susceptible or partial resistan ce reaction. Age related resistance has been reported in many R gene mediated resistances. In most cases, plants are more resistant at the adult stage. Significant effort has been applied to study the mechanism s of the developmental control of resistance. Due to the complexity involved in developmental regulation, few studies have been successful. Acquired resistance of maize to Puccinia at the adult stage is controlled by the major transition from the juvenile to the adult stage (Abedon and Tracy, 1996) When the Corngrass 1 gene contro lling the transition was mutated, the adult resistance was delayed accordingly with the extended juvenile stage. Although the factors controlling the development al effect of XA21 mediated resistance are still unknown we have established resistance in all the Xa21 expressing lines tested at the two leaf stage by a moderately low growth temperature treatment. While developmental regulation of XA21 mediated resistance was overcome by low temperature, high temperature inhibition of XA21 mediated resistance was not effective on adult plants. The presence of XA21 in

PAGE 74

74 adult plants confers resistance to Xoo in the field with temperatures normally higher than 31 32 C. An inte r regulation of XA21 signaling i s therefore proposed betw een temperature and development Alt ered resistance was also observed when JA or ABA was applied. ABA has been reported to increase in Arabidopsis under high temperatures (Toh et al ., 2008) It is possible that high temperature attenuated the resista nce in an ABA or JA dependent way. T ogether these results highlight a complex crosstalk between plant development, hormone and environmental conditions in XA2 1 mediated resistance. Among all the environment al factors tested in this study, temperature pl ays a pivotal role in XA21 mediated resistance at the seedling stage. Sensitivity to temperature has been associated with both PTI and ETI in a system atic study of temperature on interactions between Arabidopsis and Pst (Wang et al ., 2009) The tomato Cf 4 or Cf 9 mediated HR is suppressed by incubation at 33C but rescued at low temperatures (de Jong et al ., 2002). Because the high temperature treatment can significantly reduce the binding of AVR9 to a plasma memb rane site in suspension cells, it has been hypothesized that the temperature regulated factor is located at the A vr 9 perception level (de Jong et al ., 2002). However, this may not be the case for XA21 mediated resistance. As the A x 21 receptor, XA21 level s are temperature insensitive. At adult stages, neither Xoo infection nor the resistance is affected by high temperatures. The mechanism by which temperatur e modulat es ETI mediated by the tobacco N gene and the Arabidopsis SNC1 gene has been attributed to th e subcellular localization or transportation of NB LRR protein s at different temperatures (Zhu et al ., 2010) Posttranslational modification of NB LRR proteins such as sumoylatio n i s critical for the

PAGE 75

75 localization and the resistance. This is in agreement with our discovery that temperature exerts its effect on XA21 mediated resistance through posttran slational modification and/or do wnstream components. I nconsistent localization of XA21 has been reported by two different groups (Chen et al ., 2010a; Park et al ., 2010b) suggesting the probable importance of subce llular transportation of XA21 Consistent with the hypothesis that compartmenta liza tion of XA21 may contribute to XA21 signaling, a number of genes involved in protein localization were d e regulated under resistant and susceptible conditions (Fig. 2 8 ) i ncluding genes encoding chaperones. Further supporting this hypothesis, a chaperone interacting directly with XA21 (OsBiP3) i s involved in XA21 stability and the XA21 mediated resistance response (Park et al. 20 1 0) Microarray analysis also reveal ed that in inoculated 4021 3 plants grown at higher temperature s, OsBiP3 express ion level was four fold higher compared to those at lower temperature s (Chen et al ., unpublished data) We hypothes ize that temperature is linked to XA2 1 resistance possibl y through th e subcellular localization of XA21 and subsequently XA21 sig n a ling capacity Because XA21 signaling capability can be influenced by multiple factors, including XA21 levels, the downstream proteins associated with XA21, and even the XA21 sequences determini ng the interactions with certain binding proteins, this hypothesis offers an explanation for the multi faceted control of XA21 resistance and the importance of both XA21 levels and a n unidentified factor(s) in XA21 resistance. Microarray analysis of transc riptome dynamics re veals significant difference s in gene expression s at different temperatures Notic e ably among the genes regulated by high temperature, there are a number of defense related genes, strongly suggesting the

PAGE 76

76 interplay between biotic stress response s and abiotic stress responses. Although the question of how the transcriptional change of these genes contribute s to the resistance remain s to be answered, the results of the microarray experiment provide a list of candidate genes important in XA2 1 signaling Besides antimicrobial genes such as PR10 and chitinase, a numbe r of signaling genes are also regulated by temperature including serine threonine kinases and WRKY transcription factors. All these genes could be interesting candidates involved i n the regulation of XA21 signaling. Despite the finding that no XA21 binding protein genes were identified as being significantly regulated by temperature, expressions of genes involved in th e subcellular localization we re induced or suppressed by high tem perature treatment s supporting the hypothesis that compartment alization of XA21 could be an important part of the XA21 signaling Meanwhile, a n array experiment was carried out as described in 2.2.7 on 4021 3 plants grown under high temperatures or low te mperatures for 3 days after inoculation (Chen et al ., unpublished data). In these preliminary studies, OsBIP3 the XA21 interacting chaperone involved in XA21 resistance was upregulated by high temperature in inoculated 4021 3 plants. A more than 12 fold upregulation of Os8N3 by high temperature treatment was also observed in inoculated plants Os8N3 is a suscepti bility gene required for the infection of Xoo A combination of the two datasets may provide clue on the mec hanisms of temperature effect on XA21 signaling. Plant hormones play various and important roles in stress responses including pathogen attack and extreme temperature fluctuation Previous studies have demonstrated that elev ated accumulation of free IAA or t opical IAA application inhibits res istance to Xoo infection (Ding et al ., 2008) However, IAA application in this study did

PAGE 77

77 not significantly alter the XA21 mediated resistance It is possible that IAA regulation i s independent from XA21 mediated re sistance XA21 may employ novel strategies in order to o vercome pathogen attack, which are not affected by the application of IAA. JA has been extensively studied as a signal molecule in defense response s and is involved in resistance to necrotrophic patho gen attack JA accumulation has been observed in plants challenged by pathogen s. Exogenous application of JA c an induce defense related gene expression and resistance response s Nevertheless, an antagonistic effect between JA and SA signaling has been repo rted. Pseudomonas syringae produce s the JA Ile mimic coronatine to suppress the SA triggered defense response and le a d s to enhanced susceptibility (Zhao et al ., 2003) In this study, JA application also compromises the XA21 mediated resistance, underlying this is still unknown. Rice plants expressing nah G and d efective in SA accumulation show decreased resistance, indicating a protective role of SA in rice (Silverman et al ., 1995) It would be interestin g to investigate if the attenuated resistance caused by application of JA is due to inhibition of the SA pathway. The role of ABA in plant disease resistance responses varies depending on the specific pathogen and the host (Bari and Jones, 2009) The exact molecular mechanism of how ABA exerts its effect on resistance is still unclear. When a MAPK in ABA signaling was knocked down in rice plants, plants showed increased tolerance to abiotic stress and enhanced dise ase resistance (Xiong and Yang, 2003) The cross talk between abiotic and biotic stress responses might play a significant role. This may partly explain the fact that the resistance was negatively impacted by high temperatures as well as by the application of ABA.

PAGE 78

78 Figure 2 1. Activation of XA2 resistance at the seedling stage. A) Wild type and Xa21 expressing lines inoculated with avirulent pathogen PXO99a or virulent pathogen KR1 showing lesion development. Pi ctures were taken at 12 days post inoculation. B) Lesion area of wild type and Xa21 carrying plants. Each data point represents the average lesion area of 10 individual leaves scored at 12 dpi. C) Growth of PXO99a in TP309 and 4021 3 plants. The bacterial populations were separately determined in three leaves and an average was presented. Error bars indicate standard deviation.

PAGE 79

79 Figure 2 2. Validation of XA2 1 resistance at the seedling stage in Xa21 donor line IRBB21 at 26 27 C A) Lesion development on susceptible line IR24 ( O s ativa ssp indica ) and near isogenic Xa21 donor line IRBB21 inoculated with avirulent pathogen PXO99a. B) Lesion area of IR24 and IRBB21 plants. Each data point represents the average lesion area of 10 leaves from multiple indivi dual s Error bars indicate standard deviation. All data were collected at 12 dpi

PAGE 80

80 Figure 2 3. Investigation of environment al factors in XA2 1 resistance at the seedling stage. A) Lesion area of plants transferred to soil or water under fluorescent ligh t (FL) or metal halide light ( M H ) at 26 27 C after inoculation with PXO99a. B) Lesion area of plants maintained at low temperature s (L, 26 27C), or high temperature s (H, 31 32 C ) under fluorescent light or metal halide light after inoculation with PXO99a. Each data point represents the average lesion area of 10 individual leaves scored at 12 dpi. Error bars indicate standard deviation.

PAGE 81

81 Figure 2 4. E ffect of t emperature on XA2 1 resistance A) Lesion development on TP309 and 4021 3 plants grown under f luorescent light at low (L) or high (H) temperatures after inoculation with PXO99a. Pictures were taken at 12 dpi. B) Growth of Xoo PXO99a in TP309 and 4021 3 plants grown under low and high temperatures. The bacterial populations were determined separatel y i n three leaves and an average i s presented. Error bar s represent standard deviation.

PAGE 82

82 Figure 2 5 Reversible regulation of X A 21 resistance by temperature at the seedling stage TP309 and 4021 3 plants were kept at low growth temperature (L, 26 27C ) or high growth temperature (H, 31 32 C ) for the indicated period after inoculation and transferred to H or L temperatures respectively. Mean lesion area of more than 10 individuals scored at 12dpi is shown along with standard deviation.

PAGE 83

83 Figure 2 6 Analysis of patho gen and XA21 level at low (L) and high (H) temperatures. A) Comparison of PXO99a growth rate at L or H temperatures. B) Lesion development in TP309 and 4021 3 adult plants under H temperature inoculated with PXO99a. Pictures were taken at 12 dpi. C) Detection of XA21 protein. Black arrow shows the band corresponding to XA21. Proteins were isolated from multiple 4021 3 individuals gr o wn for 3, 6, or 9 days at L or H temp eratures and detected by anti myc antibody

PAGE 84

84 Figure 2 7 Valcano p lot of microarray data. Each dot represents a data on the array with p <0.05. Genes with a higher expression level at high temperature has a positive difference, and lower expression with a negative difference. The green vertical line shows the cut off of 1 /2 and 2 fold change.

PAGE 85

85 Figure 2 8 Summary of genes regulated by high temperature (31 32 C) Genes were selected based on the criteria of p <0.05, FDR<0.05 and a >2 fold change.

PAGE 86

86 Table 2 1 Biotic stress related genes upregulated by high temperature tr eatment TIGR ID Putative Function Absolute f old change Os01g22249 Peroxidase precursor, putative, expressed 7.53 Os01g59840 Os1bglu3 beta glucosida se homologue, 2.46 Os01g67580 Multidrug resistance associated protein, putative, expressed 3.07 O s01g73170 Peroxidase precursor, putative, expressed 2.79 Os01g73200 Peroxidase precursor, putative, expressed 3.09 Os02g32690 Pleiotropic drug resistance protein 15, putative, expressed 3.32 Os02g36450 Transporter family protein, putative, exp res sed 8.24 Os03g02260 Dnak family protein, putative, expressed 2.60 Os03g08900 MATE efflux family protein, putative, expressed 4.83 Os03g27990 STRUBBELIG RECEPTOR FAMILY 7 precursor, putative, expressed 2.30 Os03g30950 Acyl desaturase, chlorop las t precursor, putative, expressed 7.32 Os03g32314 Allene oxide cyclase 4, chloroplast precursor, putative, expressed 2.26 Os04g47780 Transmembrane amino acid transporter protein, putative, expressed 2.08 Os04g50950 Peptide transporter PTR2, putativ e, expressed 6.47 Os04g52900 ABC transporter family protein, putative, expressed 2.44 Os05g03070 Transporter, putative, expressed 5.01 Os05g11730 CGMC includes CDA MAPK, GSK3, and CLKC kinases, expressed 2.69 Os05g29710 RING H2 finger protein, putative, expressed 3.22 Os05g46220 Mitochondrial carrier protein, putative, expressed 2.09 Os06g11210 12 oxophytodienoate reductase, putative, expressed 23.72 Os06g15370 Peptide transporter PTR2, putative, expressed 4.08 Os06g20920 SAM depende nt carboxyl methyltransferase, putative, expressed 4.50 Os06g31220 Mitogen activated protein kinase 17, putative, expressed 2.29 Os06g33080 Peroxidase precursor, putative, expressed 6.43 Os06g33090 Peroxidase precursor, putative 7.34 Os06g33100 Peroxidase precursor, putative, expressed 8.65 Os06g44620 AMP binding domain containing protein, expressed 2.07 Os06g47760 Phytosulfokine receptor precursor, putative, expressed 2.39 Os08g37432 MATE efflux family protein, putative, expressed 2.05 Os09g16330 Pleiotropic drug resistance protein, putative, expressed 4.23 Os09g29310 Zinc finger, C3HC4 type domain containing protein, expressed 2.03 Os10g01100 Receptor like protein kinase, putative, expressed 2.73 Os10g20470 MATE efflux fami ly protein, putative, expressed 2.68

PAGE 87

87 Table 2 2 Biotic stress related genes down regulated by high temperature treatment TIGR ID Putative Function Absolute f old change Os01g06876 Cf 2, putative, expressed 5.63 Os01g06900 Verticillium wilt disease res istance protein Ve2, putative, expressed 2.56 Os01g22352 Peroxidase precursor, putative, expressed 5.01 Os01g40260 Os WRKY 77 having WRKY and zinc finger domains, 5.65 Os01g47470 Serine/threonine protein kinase, putative expressed 2.55 Os01g65830 Acyl desaturase, chloroplast precursor, putative, expressed 10.05 Os01g67630 Peptide transporter PTR2, putative, expressed 4.09 Os02g02540 Glutamate receptor, putative, expressed 2.37 Os02g11760 Pleiotropic drug resistan ce protein, putative, expresse d 8.41 Os02g14840 Potassium channel KAT1, putative, expressed 2.74 Os02g21009 Sodium/calcium exchanger protein, putative, expressed 8.93 Os02g46970 AMP binding domain containing protein, expressed 13.50 Os02g55560 Prot ein phosphatase 2C, putative, expressed 2.24 Os03g18850 Pathogen related protein ( ji O s PR 10 ) 118.19 Os03g46070 Thaumatin, putative, expressed 15.97 Os05g04170 AMP binding enzyme, putative, expressed 3.48 Os06g08880 Glutamate receptor 2.7 precursor, putative, expressed 3.30 Os0 7g42960 Phospho 2 dehydro 3 deoxyheptonate aldolase, chloroplast precursor, 3.86 Os08g39100 Protein phosphatase 2C, putative, expressed 2.63 Os08g40170 Cyclin dependent kinase B2 1, putative, expressed 2.48 Os08g44870 MATE efflux family protein, put ative, expressed 2.25 Os09g36580 Thaumatin, putative, expressed 2.53 Os10g39680 Similar to chitinase 17.62

PAGE 88

88 Figure 2 9 Effect of hormone application on X A 21 mediated resistance. Hormones were applied at the indicated concentration s Water treate d TP309 and 4021 3 plants were included as negative and positive control s respectively. An average score of lesion area taken at 12dpi from more than 10 leaves i s shown. Error bars represent standard deviation.

PAGE 89

89 Figure 2 10 Inhibition of X A 21 mediat ed resistance by JA and ABA. JA was applied at 5 M and ABA was applied at 100 M to 4021 3 plants. Water treated TP309 and 4021 3 plants were included as negative and positive control s respectively. A) Lesion development on inoculated plants. Pictures wer e taken at 12dpi. Red arrow show s the position where the lesion stop s B) Lesion area of plants treated with JA and ABA. The mean value of more tha n 10 leaves scored at 12 dpi i s presented. C) Growth of Xoo in plants treated with JA and ABA. An aver age of three individual leaves i s presented. Error bars represent standard deviation.

PAGE 90

90 CHAPTER 3 ROLE OF MAPKS IN RIC E DEFENSE RESPONSE A ND DEV E LOPMENT 3 .1 Background Information Mitogen activated protein kinase (MAPK) cascades are universal modules amplifying e xternal stimuli and transmitting in tracellular signal transduction in eukaryotes (Rodriguez et al ., 2010 ) The phosphorylation events mediated by MAPK cascades are central switch es to initiat e appropriate biochemical reaction s and physiological program s responsive to stimuli At the end of the module, the activated MAPKs translocate into the nucleus or other cellular organelles and phosphorylate a wide variety of substrates through the serine threonine kinase domain (Zhang et al ., 2006) It has been sh own that MAPK s activate g enes involved in diverse biological process es determining the function al specificity of a given MAPK. In plants, MAPK cascades have been associat ed with developmental, physiological, biotic and abiotic stress responses. Twenty MAP Ks have been identified in the Arabidopsis genome, and 17 reported in rice ( Oryza sativa ) (Hamel et al ., 2006) AtMPK3, AtMPK4 and AtMPK6 are the best characterized MAPKs associated with defense response s in a ser ies of studies (Zhang et al ., 2006) AtMPK3, AtMPK4 and AtMPK6 a re strongly elicited by the bacteria flagellin component derivative flg22, followed by activation of pathogenesis related ( PR ) gene expression (Asai et al ., 2 002; Pitzschke et al ., 2009a) Hypersensitive response and pathogenicity (H a rpin) proteins and h ydrogen peroxide (H 2 O 2 ) signaling have the ability to trigger AtMPK4 and AtMPK6 as well (Desikan et al ., 2001) Genetic analysis show s that AtMPK3 and AtMPK6 play a redundant role in FLS2 mediated immunity (Pitzschke et al ., 2009a) Mutation of AtMPK3 or AtMPK6 d oes not alter resistance

PAGE 91

91 signif icantly. AtMPK4, nevertheless, i s negatively involved in the defense response (Ichimura et al ., 2006) Loss of At MPK4 results in abnormally high level s of SA accumulation and constitutive expression of PR genes. Tobacco wounding induced protein kinase (WIPK) and SA induc ed protein kinase (SIPK) can be stimulat ed in the incompatible interaction s in the presence of the N gene conferring resistance to tobacco mosaic virus (TMV) or Cf 9 gene recognizing fungal Avr9 (Romeis et al ., 1999 ; Zhang and Klessig, 2001) In recent years, genetic analysis ha s been widely used to study the role of MAPKs in plant development with the well developed knock out, knock down and overexpression technologies in different plant species (Rodrig uez et al ., 2010 ) NRK in tobacco has been shown to participate in cytokinesis and cell plate formation by activating a microtubule associated protein and releasing it from the phragmoplast (Sasabe et al ., 2006) Arabidopsis MPK3 and MPK6 have demonstrated crucial roles in multiple develop mental processes. MPK3 and MPK6 are aligned downstream of YODA proteins crucial to embryo development. In the mpk3/mpk6 plants, normal integument development of ovules i s disrupt e d with arrested cell divisions at later stages, resulting in in fertility (Wang et al ., 200 8 ) Additionally, AtMPK3 and AtMPK6 function redundantly in stomata development in a dosage dependent manner (Wang et al ., 200 7 ) I n mpk3/mpk6 double mutants cell specification of stomata a re interrupted and consequently result in cluster ed stomata formation. Conversely when M PK 3/M PK 6 is constitutively activated, cell fate specification in stomata development is suppressed and no stomatal differentiation will occur A bHLH transcription factor SPEECH L ESS (SPCH) has been uncovered as a su bstrate phosphorylated by AtMPK3 and AtMPK6 in

PAGE 92

92 stomata development (Lampard et al ., 2008) Multiple phosphorylation sites a re targeted by AtMPK3, resulting in degradation of SPCH, while another phosphorylation residue used by MPK6 exist s for positive regulation. In addition to the shared functions of AtMPK3 and AtMPK6, At MPK6 perform s a role in floral organ and embryo development independent of MPK3 (Bush and Krysan, 2007) AtMPK6 also function s in leaf senescence downstream of AtMKK9 (Zhou et al ., 2009) Mutation of A tMPK6 or AtMKK9 significantly delay s leaf senescence Limited information on the role of M A PK s in monocots is ava ilable. Rice OsMPK3 ( previously designated as OsMAPK5) i s activated exclusively in susceptible reactions by the rice blast pathogen Magnaporthe a grisea but not in resistant responses (Xiong and Yang, 2003) The knockdown of OsMPK3 promotes resistance to M.grisea but no observable change in growth or development has been reported on either OsMPK3 overexp ression ( OX ) or antisense ( AS ) plants. TaMPK3 but not TaMPK6 is negatively involved in the interactions between wheat and Mycosphaerella graminicola ( Rudd et al ., 2008 ) In this study, the role s of OsMPK3 and OsMPK6 in the rice Xoo interaction s were asse ssed in the compatible and incompatible interactions. OsMPK6, but not OsMPK3 was specifically activated when challenged by virulent pathogen s When OsMPK6 level was suppressed, plants displayed enhanced resistance to Xoo infection confirming the negative role of OsMPK6 in rice Xoo interactions. OsMPK6 was required for normal plant development as evident by dwarf plants, smaller grains and a lter ed protein accumulation s observed on the OsMPK6AS plants compared to wild type TP309 plants

PAGE 93

93 3 .2 Material and Met hods 3 .2.1 Sequence Analysis Phylogenetic analys es were carried out based on the deduced amino acid sequences of the rice MAPKs, the Arabidopsis MAPKs, and the wheat MAPK s (TaMPK3, TaMPK6) using the ClustalW program from EMBL EBI ( http://www.ebi.ac.uk/clustalw ) using the neighbor joining method The rice gene accession numbers in the rice genome database (http://rice.plantbiology.msu.edu/) are Os03g17700 (OsMPK3), Os10g38950 (OsMPK4), Os06g06090 (OsMPK6), Os06g4 8590 (OsMPK7), Os02g05480 (OsMPK14), Os11g17080 (OsMPK16), Os06g49430 (OsMPK17 1), Os02g04230 (OsMPK17 2), Os01g43910 (OsMPK20 1), Os05g50560 (OsMPK20 2), Os06g26340 (OsMPK20 3), Os01g47530 (OsMPK20 4), Os05g49140 (OsMPK20 5), Os05g50120 (OsMPK21 1) and Os 01g45620(OsMPK21 2). The Arabidopsis gene accession numbers in the Arabidopsis genome database ( http://www.arabidopsis.org/ ) are At1g10210 (AtMPK1), At1g59580 (AtMPK2), At3g45640 (AtMPK3), At4g01370 (AtMPK4), At4 g11330 (AtMPK5), At2g43790 (AtMPK6), At2g18170 (AtMPK7), At1g18150, (AtMPK8), At3g18040 (AtMPK9), At3g59790 (AtMPK10), At1g01560 (AtMPK11), At2g46070 (AtMPK12), At1g07880 (AtMPK13), At4g36450 (AtMPK14), At1g73670 (AtMPK15), At5g19010 (AtMPK16), At2g01450 ( AtMPK17), At1g53510 (AtMPK18), At3g14720 (AtMPK19), and At2g42880 (AtMPK20). The wheat gene accession number s in the Genbank are ABS11090 (TaMPK3) and AAO16560 (TaMPK6). 3 .2. 2 Plant Growth All seeds were sterilized and germinated on 1/2 MS medium as descri bed in 2.2.1 and transferred to soil in the greenhouse at 14 days after germination. For gibberellic

PAGE 94

94 acid (GA) treatment, sterilized seeds were germinated on 1/2 MS medium, supplemented with different concentrations of GA. 3 .2.3 Identification o f Homozygo us T DNA Insertion Mutants DNA extraction. For DNA extraction fine ly ground leaf powder was suspended in equal volume of prewarmed (65C) freshely prepared extraction buffer [0.35M sorbitol, 0.1 M Tris HCl, pH 8.2, 6 mM Na 2 Ethylenediaminetetraacetic aci d (EDTA); 0.2 M Tris HCl, pH 7.5, 0.05 M EDTA, 2 M N aCl, 2% cetyltrimethylammonium b romide (CTAB); 2% sarkosyl; 0.02 M NaHSO 3 ]. Homonogized samples were incubated at 65 C for 45 min with interval vortex for complete lysis. A mixture of chloroform and isoam yl alcohol (V:V=24:1) was added to the lysis and mixed well to precipitate the protein, followed by a centrifugation at 10,000 rpm, 5 min to remove cell debris. The aqueous phase was transferred to a new tube and mixed with equal volume s of prechilled isop ropanol to pre cipitate the DNA. The precipita t e was collected by centrifugation at 10,000 rpm for 10 min The DNA was washed three times in 70% ethanol and air dried T o fully suspend the pellet, 50 L H 2 O was adde d and any insoluble contents were removed by centrifugation Southern b lot analysis. Up to 50 g of plant genomic DNA was completely digested with appropriate enzyme s and separated finely on a 0.8% agarose gel. The gel was soaked in 500 mL 0.25 M HCl for 12 minutes at room temperature with gentle agitation for depurinati on. A denaturation step was carried out immediately after the depurination by soaking the gel in 500 mL denaturation solution (0.5 M NaOH, 1.0 M NaCl) two times 15 min each. Finally the gel was neutraliz ed with two 15 min washes in 500 mL neutralization solution (0.5 M Tris pH 7.5, 1.5 M NaCl). The membrane (IMMOBILON NY+, Millipore, Billerica, MA) was moistured with water and equilibrated

PAGE 95

95 with 10 X SSC buffer (1.5 M sodium chloride and 150 mM trisodium citrate, pH 7.0) for at leas t 10 min. The DNA was then transferred to the membrane with upward capillary transfer method in 10X SSC buffer overnight. The membrane was rinsed in 6X SSC for 5 min to remove any agarose fragments and air dried completely. The blotted DNA was cross linked to the membrane with a UV Link with an exposure energy of 5,000 microJoules/cm 2 P robe s for Southern Blot were prepared by PCR using gene specific primers. Purified PCR fragment s w ere labeled with Prime IT II Random Primer Labeling Kit (Str a tagene, Santa 2 O was added to a maximum 100 ng DNA to make a total volume of 24 L. Probe DNA was mixed with 10 L random oligonucleotide primers and boiled at 100C for 5 min. The d enatured DN A sample was mixed with 10 L 5 X Primer buffer for dCTP, 1 L Exo( ) Klenow enzyme (5 U/ L), and 32 P] d CTP at 3000 Ci/mmol. After incubation at 37C for 1 2 h, the labeled probe mixture was denatured by boiling for 5 min. Before hybridization, t he membrane wa s first incubated in pre hybridization solution {4X SSC, 5X D (PVP), 10 g/L bovine serum albumin (BSA)], 0.5 % SDS, 100 g/mL denatured salmon sperm DNA (ssDNA)} at 42 C for 2 3 hour s For hybridization, the membrane was incubated at 42 C overnight in 15 mL hybridization buffer (50% formaldehyde, 1% SDS, 4X SSC, 100 g/mL denatured ssDNA) with a denatured radioisotope labeled probe After hybridization, the blot was washed as follows to eliminate any nonspecific binding. The blot was first rinsed in 50 mL washing solution I (0.5X SSC, 1% SDS) followed by

PAGE 96

96 150 m L wash ing solution I at 42C for 15 min. A more stringent wash was then carri ed out in 300 m L pre warmed w ash ing solution I at 60 C for 15 min. A final wash was performed with 300 m L pre warmed w ash ing solution II (0.1 X SSC, 1% SDS) at 60C for 30 min. The blot was dried briefly and exposed between intensifying screens overnight to several days in a 80C freezer. 3 .2.4 Immunoprecip itation ( IP ) Assay Plant protein s used for i mmunoprecipitation w ere prepared as described in 2.2.4. Up to 200 g of total protein extract w as diluted into 200 L IP buffer (150 mM NaCl, 50 mM Tris HCl pH7.5, 5 m M EDTA, 1% Triton, 0.2% protein ase inhibitor, 0.4 mM DTT, 2 mM NaF and 2 mM Na 3 VO 3 ) To eliminate any nonspecific binding possibly generated by the direct link between resin and protein s 10 L Protein A/G agarose (Santa Cruz Biotechnology, Santa Cruz, CA) was added to the protein suspension and rock ed at 4C for 2 3 h. The mixture was centrifuged at 1,000 rpm 4 C for 1 min and the precipitant was discarded. The supernatant was then mix ed with 3 L OsMPK6 specific antibody and rock ed at 4 C overnight. Another 10 L Protein A/G agarose was added to th e protein sample, followed by rocking at 4C for another 2 3 h. The protein was harvested by centrifugation at 1,000 rpm 4 C for 1 min. The precipitat e was washed four times with 1 mL IP buffer without Triton. The final product was suspended in 1X SDS pro tein sample buffer for further analysis. 3 .2.5 Analysis o f Osmpk3 a nd Osmpk6 Protein a nd Activity OsMPK3 and OsMPK6 protein s were detected with specific antibody as described in 2.2.5. The in gel kinase activity assay was performed essentially as described by Zhang and Klessig (1997) with some modifications to detect the kinase activ ity. Briefly, 40 g total protein, or immunoprecipitat ed protein from 400 g total protein, was

PAGE 97

97 fractionated on a 10% SDS PAGE embedded with 0.25 mg/mL bovine brain myelin basic protein (MBP) (Sigma, St Louis, MO). After electrophoresis, the SDS was removed by washing the gel three times, 30 min each at room temperature with SDS removing buffer (25 mM Tris HCl, pH 7.5; 0.5 mM DTT; 0.1 mM Na 3 VO 4 ; 5 mM NaF; 0.5 mg/mL BSA; and 0.1% Triton X 100). The MAPKs in the gel were then allowed to renature overnight at 4C with three changes of renaturing buffer (25 mM Tris HCl, pH 7.5; 1 mM DTT, 0.1 mM Na 3 VO 4 ; and 5 mM NaF). The gel was preincubated in 30 mL reaction buffer [25 mM Tris, pH 7 .5; 2 mM ethylene glycol tetraacetic acid ( EGTA); 12 mM MgCl 2 ; 1 mM DTT; and 0.1 mM Na 3 VO 4 ] at room temperature for 30 min. The phosphorylation of MBP was performed in reaction buffer with the addition of 0.2 M 32 P ATP (3000 Ci/mmol) a t room temperature for 60 min. The gel was washed in washing buffer [5% trichloroacetic acid (TCA) and 1% sodium pyrophosphate] at room temperature for at least three times for 60 min each. Finally, the gel was dried on filter paper and autoradiographed. 3 .2.6 RNA Hybridization Total RNA was prepared as described in 2.2.6. Total RNA was denatured in RNA loading buffer [ 0.16% saturated aqueous Orange G solution 0. 8% 0.5 M EDTA, pH 8.0 7.2% l 37% formaldehyde 20% glycerol 30.8% formamide 40% 10 X MOPS/ED TA (0.02M MOPS, 5 mM NaOAc, 1 mM EDTA, pH 7.0) ] by heat ing at 65C for 10 min and cool ing down on ice for 1 min. Denatured total RNA w as separated on 1.2 % MOPS gel ( 1.2% agarose, 1X MOPS/EDTA 5.37% formaldehyde ) in 1X MOPS/EDTA electrophoresis buffer wi th 6% formaldehyde. T o remove the formaldehyde t he gel was washed three times in water 15 min each. Gel transfer, membrane crosslinking and probe labeling was performed as for Southern Blot. For prehybridiz ation, the blot was

PAGE 98

98 incubated in hybridization s olution (0.5 M NaHPO 4 pH 7.2; 1% BSA; 1 mM EDTA; 7% SDS) at 42 C for 1 h. H ybridization was carried out at 42 C overnight in hybridization solution supplemented with radioisotope labeled probe The blot was then washed in low stringency washing buffer (40 mM NaHPO 4 pH 7.2, 0.5 % BSA, 1 mM EDTA, 5 % SDS) for 10 min at room temperature, high stringency washing buffer (40 mM NaHPO 4 pH 7.2, 1 mM EDTA, 1 % SDS) for 10 min at room temperature, and twice at 65C for 10 min. 3 .2.7 Polymerase Chain Reaction (PCR) Gene specific primers used in th i s study a re listed in Table 3 1. PCR was carried out with High Fidelity Taq polymerase (NewEngland Biolab, Ipswich, MA). A 20 L reaction in sterile distilled water was prepared with 1 X enzyme buffer [20 mM Tris HCl (pH 8.4 ), 500 mM KCl], 0.2 mM d eoxyribonucleotide triphosphate (dNTP) mix, 1.5 mM MgSO 4 0.2 M primers, 100 ng template DNA and 1 unit Taq polymerase After heat activation of the enzyme at 94C for 5 minutes, a reaction cycle of 94C for 30 seconds, 58C for 30 seconds and 72C for 90 seconds was repeated 25 times, followed by 72C for 10 minutes in a n Epp e ndo r f P ersonal Thermocycler. The PCR product (10 L ) was separated through 1% agarose gel electrophoresis. 3 .2.8 Generation o f Osmpk6 Antisense ( AS ) a nd Over expressing ( OX ) Plants To make a knock down plants with the antisense ( AS ) end region of OsMPK6 with high specificity was chosen to construct antisense and sense fragments. The fragment spanning nucleotides 775 to 1161 was amplified in bo th directions with PCR primer pairs OsMPK6ASF/R and OsMPK6SF/R respectively. The produced sense and antisense fragments were inserted into vector pCmHu (Wang et al ., 2006) with restriction sites Eco RV Spe I and Xho I Hind III with a GUS loop in between.

PAGE 99

99 The construct was delivered into Agrobacterium tumefaciens EHA105 with electroporation for rice transformation. Full length cDNA of OsMPK6 was cloned from the BAC clone (OsJNBa0085L11), w ith primers as listed in T able 3 1. BAC DNA was isolated from a 40 mL ba cteria culture using a Fosmidmax TM DNA instructions. Bacteria l cells were collected and completely resuspend ed with 3 mL chilled solution 1 for lysis followed by additio n of 6 mL of solution 2 and 4.5 mL of chilled solution 3. The mixture was incubated on ice for 15 min and centrifuged at 15,000 g, 4C for 15 min. The supernatant containing the DNA was transferred to a fresh tube and precipitated with 8.1 mL isopropanol a t room temperature. The precipita t e was collected by centrifugation at 15,000 g, 4C for 15 min, air dried at room temperature for 3 5 minutes, and dissolved in 500 L T.E. buffer. The RNase treatment was performed by mixing t he DNA with 18 L RNase and in cubat ing at 37C for 1 h T he total volume was adjusted to 1 mL with T.E. buffer and an equal volume of chilled solution 4 was added. The mixture was centrifuged at 15,000 g, 4C for 15 min, and the supernatant containing the DNA was transferred to a fresh tube. DNA precipitation w as carried out by adding 4 mL 100% ethanol followed by centrifugation. The DNA pellet was air dried for 5 7 min and dissolved in 200 L T.E. An overn ight incubation was conducted for better dissolvation of DNA. A fusion PCR strate gy was used to clone the full length cDNA due to the high GC of OsMPK6 Primer pairs OsMPK6 1/9 and OsMPK6 7/8 were used to amplify exon1 and exon 2 from BAC DNA re spectively. Primer pairs

PAGE 100

100 OsMPK6 1/7 were then used to bridge exon 1 a nd exon 2 with the PCR product from the two previous PCR reactions. A denature and low temperatur e annealing step (95C 5 min; 37 C, 1 min) was added before the normal PCR cycles allow ing annealing of the overlapping area. The rest of the full length cDNA was amplified with primers OsMPK6 2 / 4 The PCR product was cloned into pSC (Stratagene, Santa Clara, CA ) and pieced together with Eco RV site present in the joint region between exon 2 and exon 3 to obtain the full length cDNA of OsMPK6. The cloned OsMPK 6 sequence was confirmed by sequencing at the DNA sequencing core (ICBR) at University of Florida. Bam HI and Spe I digestion sites were in troduce d to the of the cDNA respectively, to make the cDNA compatible to vector pCmHu. The construct was introduced into A.tumerfaciens and transformed into rice callus. 3.2.9 Agrobacterium M ediated T ransformation. OsMPK6 AS or OX transgenic plants were generated by a standard rice transformation protocol as described by Wang et al (2006). Immature seeds (15 20 days after flowering) were harvested dehusked, and surface sterilized in 75% ethanol for 2 5 minutes, followed by full strength bleach for 2 hours. Sterilized seeds were rinsed in sterile water five times before further process ing For callus indu ction, e mbryos were separated from the seeds and placed on callus induction medium N6D2 [macro N6, micro Fe EDTA, B 5 vitamin s, 30 g/L sucrose, 0.5 g/L L proline, 0.5 g/L L g lutamine, 0.3 g/L casein hydrolysate, 2 mg/L 2,4 D (2,4 dichlorophenoxyacetic acid ), 2.5 g/L P hytagel, pH 5.8 ], and grown in the dark at 25 C for 7 8 days. Agrobacterium strain EHA105 carrying the corresponding construct was cultured in 3 mL of yeast extract mannitol (YM) media ( 0.4 g/L yeast extract, 10 g/L mannitol 0.1 g/L NaCl, 0.2 g/L MgSO 4 .7H 2 O, 0.5 g/L K 2 HPO 4 3H 2 O, pH 7.0) at 28 30 C for 24 hours and a 1 mL

PAGE 101

101 culture was subcultured into 50 mL liquid Agrobacterium induction ( AB ) medium (3 g/L K 2 HPO43H 2 O, 1 g/L NaH 2 PO4, 300 mg/L MgSO 4 7H 2 O, 150 mg/L KCl, 10 mg/L CaCl 2 2.5 mg/L FeS O 4 7H2O, 5 g/L glucose, pH 7.0) to grow for an additional 16 hours. Agrobacteria cells were collected and resuspended in liquid AAM (macro AA, micro Fe EDTA, AA vitamin s 68.5 g/L sucrose, 36 g/L glucose, 0.5 g/L casine hydrolysate, pH 5.2) containing 200 mM/L acetosyringone to an optical density of 0.5 at OD 600 Calli were incubated with the bacteria suspension for 30 min allowing Agrobacterium to in fect the calli. After inoculation, calli were bl ot dried on sterilized Whatman filter paper and transferred to N6D2C (N6D2, 10 g/L glucose, pH 5.2) containing 200 mM/L acetosyringone covered with sterilized Whatman fi lter paper to co cultivate for three days. To select positive transformants, c alli were maintain ed on selection medium (N6D2 supplemented with 25 every two weeks. The calli were maintained on selection medium in the dark at 25 C for six weeks and transferred to preregeneration medium (macro N6, micro N6+Fe EDTA, B 5 vitamin, 30 g/L sucrose, 0.5 g /L L proline, 0.5 g/L L glutamine, 0.3 g /L casine hydrolysate, 2.5 g/L P hytagel, pH 5.8) and cultured in the dark at 25 C for 7 10 days. The calli were next mov ed to regeneration medium (N6D2, 30 g/L sucrose, 0.3 g/L casine hydrolysate, 2 mg/L 6 BA, 0.2 mg /L NAA, 0.2 mg/L ZT, 0.5 mg/L KT and 2.5 g/L phytagel, pH 5.8), and cultured in a light/dark cycle (16 hours light/8 hours dark) at 25 C for up to four weeks for shoot and organ development The newly developed 5 10 cm seedlings were grown on rooting mediu strong root system. Seedlings with a well developed root system were maintained in soil in the greenhouse and later characterized by PCR or immuno blot assays

PAGE 102

102 3 .2. 10 Plant Proteomics Analysis P rotein extracti on with phenol Protein for isobaric tag for relative and absolute quantitation (iTRAQ) labeling was prepared from 500 mg of leaf samples with phenol method as described by Sheffield et al ., ( 2006) Leaf samples were collected from two leaf stage plants and at least three leaves were pooled together to en sure an adequate amount of plant material. Collected leaf samples were ground in liquid nit rogen into fine powder with mortar and pestle. T o mix the leaf powder with 1.25 mL phenol saturated with Tris HCl pH 8.8 and an equal volume of phenol extraction buffer (0.1 M Tris HCl ME, 0.9 M sucrose) was added with additional grinding To ensure complete lysis t he extract was transferred to a 50 mL tube and agitated at room temperature for 60 90 min after complete thawing. The homogenate was centrifuged at 5,000 g, 10 C for 10 min allowing for the separation of the aqueous ph ase and the organic phenol phase. T he upper clear phenol phase was transferred to a new tube. T wo additional phenol extraction s w ere perfomed by adding 1 mL of Tris HCl (pH8.8) saturated phenol to the bottom phase, vortexing, agitation for 30 min and centr ifugation. The supernatant from the three extractions were combined and then precipitated by adding at least 5 volumes of ice col d 0.1 M ammonium acetate in 100 % methanol. After precipitation at 20 C overnight, the precipitat e s were collected by centrifug ing at 20,000 g, 4 C for 20 min. The precipita t e s were washed twice with 4 mL of 0.1 M ammonium acetate in methanol followed by two washes in 4 mL 80% acetone. At least 20 min of incubation at 20 C was allowed between any two wash es Vortex ing or sonicati on could also be used to break the pellet for better dissolv ation The pellet was va cuum dried and dissolved in 0.5 1 mL isoelectric focusing (IEF) equilibration buffer (Applied Biobiosystems, Foster City, CA ) by vortexing at room temperature for

PAGE 103

103 60 90 min A final centrifugation was carried out at 20,000 g, 15 C for 1h to remove the insoluble components. Protein q uantification. Quantification of proteins was completed with CB X TM protein assay (G Bioscience, MO, USA) following the on s Two aliquots with 5 L and 10 L of protein samples respectively were mixed with 1 mL of prechilled CB X TM by vortexing. The protein was collected by centrifuging at 16,000 g, 4 C for 5 min. The supernatant CB X TM was removed carefully without distur bing the pellet. To dissolv e the protein 50 L of CB X Buffer I and 50 L of CB X Buffer II were added in order followed by vortex ing at room temperature for 10 min. The dissolved sample was mixed with 1 mL CB X Assay Dye and incubated for 5 min at room t emperature before measuring the OD at wavelength of 595 nm with water as a blank. The concentration of the protein was calculated accordingly. iTRAQ l abeling. For each replicate, from each preparation was used for labeling. Three replica tes were included in the assay from both wild type and OsMPK6AS plants. The samples were alkylated, reduced, trypsin digested, and labeled using the iTRAQ Reagents 8 plex kit according to the manufacturer's instructions (Applied Biosystems, Foster City, CA ). R eplicates of the wild type samples were labeled with iTRAQ tags 116, 118 and 119, and the OsMPK6 AS preparations were labeled with tags 115, 117 and 121, respectively. For labeling, 20 L of the dissolution buffer was added to each of the protein sampl es. The protein was then added with 1 L of denaturant and vortexed to mix. Reduc tion was carried out after denatur ing by adding 2 L of reducing agent followed by incubation at 60 C for 1 h. B efore trypsin digestion

PAGE 104

104 1 L of cysteine blocking reagent wa s added to the sample followed by incubation at room temperature for 10 min to block the cysteine. For trypsin digestion, all protein samples were mixed with 10 L trypsin solution and incubated at 37 C overnight. Before labeling, the labeling reagents wer e reconstituted into 50 L isoproponal. The freshly prepared labeling reagents were then added to each protein sample and incubated at room temperature for 2 h. All samples were combined at the end of reaction vacuum dried a nd then stored at 20 C All sa mples were desalted using SPE column for further analysis. SPE column (Whatman Inc., Piscataway, NJ) were washed twice with 0.5 mL acetonitrile and equilibrated twice with 0.5 ml of 0.1% fomic acid before use. Samples were resuspended in 600 L of 0.1% fo mic acid and loaded i nto equilibrated column. The column was washed twice with 500 L of 0.1 % fomic acid and the samples were eluted with 200 L 0. 02 % fomic acid in acetonitrile followed by a final elution with 200 L acetonitrile. The eluted peptide mix tures were dried down and dissolved in strong cation exchange (SCX) solvent A [25% (v/v) acetonitrile, 10 m M ammonium formate, pH 2.8]. The peptides were fractionated on an Agilent HPLC system 1100 using a polysulfoeth L /min with a linear gradient of 0 20% solvent B [ 25% (v/v) acetonitrile, 500 m M ammonium formate ] over 50 min followed by ramping up to 100% solvent B in 5 min and holding for 10 min. The absorbance at 214 nm was monitored, and a total of 32 fractions were collected. Reverse phase Nanoflow HPLC and tandem m ass s pectrometry. P rotein identification quantification and data acquisition were conducted at the proteomics core

PAGE 105

105 in ICBR facility at the University of Florida A protein with at least three spectra was included to ensure generation of a valid p value < 0.05 and an error factor <2 in the analysis. 3 .3 Results 3 .3.1 Os MPK 3 a nd O sM PK6 a re P utative Or th olog ue s o f At MPK 3 a nd At MPK 6 Newly discovered features of XA21 signaling, particularly the fact that Ax21 is conserved among different Xanthomna s species, suggest that XA21 may function in parallel to the FLS2 pathway. AtMPK3 and AtMPK6 are redundantly f unctioning downstream of FLS2 To study the possible involvement of rice ortholog s of AtMPK3 and AtMPK6 in disease resistance of rice, a phylogenetic analysis with amino acid sequences was performed with clustalw to compare the rice MAPK family, Arabidopsi s MAPK family TaMPK3 and TaMPK6 (Fig 3 1). In total, 17 MAPKs have been reported in the rice genome (Hamel et al ., 2006) OsMPK3 (Os03g17700 previously reported as OsMAPK5) and OsMPK6 (Os06g06090) share highest sequence similarity with Arabidopsis AtMPK3 and AtMPK6 respectively OsMPK3 and OsMPK6 are phylogenetically close to AtMPK3 and AtMPK6 as well (Hamel et al ., 2006) Based on this finding, t he role of these two MAPK s in rice immunity was hence assessed in the following studies. 3 .3.2 OsMPK3 and OsMPK6 a re Differentially Controlled i n Rice Xoo Interaction s To study the potential influence of Xoo o n OsMPK3 and OsMPK6, antibodies specifically recognizing OsMPK3 and OsMP K6 were obtained. OsMPK3 specific antibody was kindly provided by Dr Jason Rudd (Rothameted R esearch, UK). The antibody was raised against the N terminal region of TaMPK3, corresponding to amino acid residues 2 15 sharing 100% identity with OsMPK3 (Fig 3 2 A) (Rudd et al ., 2008)

PAGE 106

106 F or specific detect ion of OsMPK6 AtMPK6 antibody (S igma, St Louis, MO) was purchased because of the high similarity at the C terminal region used as antigen (Fig 3 2 B). To assess the sp ecificity of MPK3 and MPK6 antibody His tagged recombinant full length MPK3 and MPK6 protein were expressed in E.coli and detected with MPK3 and MPK6 antibody Both antibod ies recognize d specifically with their cognate recombinant protein and n o cross rea ction with OsMPK6 or OsMPK3 was detected (Fig 3 2 C ). The antibodies were therefore regarded as specific and used in the following immun o blot detection and immunoprecipitation experiments The induction of OsMPK3 and OsMPK6 w as investigated in TP309 and 4021 3 plants after inoculation with Xoo strain PXO99a. L eaf segments approximately 1 cm in size adjacent to the inoculation site s were collected at 0, 2, 4, 8 and 24 h post inoculation (hpi) for protein preparation and OsMPK3 / 6 detection (Fig 3 3 A). Cons istent with low OsMPK3 level s reported by Xiong et al (2003) the basal level of OsMPK3 was at the limits of visuable detection OsMPK3 protein abundance was elevated dramatically by pathogen challenge within 24 hpi, and the induc tion was consistently obse rved in both the compatible and incompatible interactions. In stark contrast to OsMPK3, a significant amount of endogenous OsMPK6 was detectable in non treated resistant and susceptible plants. The protein abundance was stable and not influenced by pathoge n inoculation on either of the plant lines Posttranslational phosphorylation is a crucial step for regulation of MAPK activities and various studies have shown that plant MAPKs are regulated at the kinase activity level instead of by the abundance of p r otein In gel kinase assay was thus applied to investigate the potential change in MAPK activity. A single band at about the

PAGE 107

107 48 k Da position corresponding to OsMPK6 was detected following inoculation of the susceptible host TP309 (Fig 3 3A) A detectable induction of kinase activity was observed as early as 2 hpi and a strong boost occurred at 24 hpi in TP309 plants. No activation of this 48 k D a kinase by the pathogen was observed in 4021 3 plants carrying XA21 To confirm the identity of this protein, the total protein extract was subjected to immunoprecipitation with MPK6 antibody followed by an in gel kinase assay (Fig 3 3 B). The protein with the phosphorylation activity was immunoprecipitated by anti MPK6 antibody sug gesting that the band detected wa s likely OsMPK6. The identity of the activated kinase was further confirmed in latter studies in OsMPK6 AS plants as exemplified by failure to detect the activated kinase in the MPK6AS plants (Fig 3 3C). To test the dependence of Xa21 to inhibit the activ ation of OsMPK6, IRBB13 plants (courtesy of Dr. Bing Yang, Iowa State University, USA) carrying the recessive r gene xa13 conferring resistance to Xoo strain PXO99a were inoculated in comparison with susceptible IR24 plants. A disruption of MPK6 activity w as observed in IRBB13 plants (Fig. 3 4) I n the IR24 plants OsMPK6 was strong ly stimulat ed at 24 hpi, but not in the IRBB13 plants, suggesting a n inhibiting role of xa13 in OsMPK6 activity. 3 .3.3 Os MPK6AS Plants a re Partly Resistant t o Xoo Although resis tant and susceptible plants display no detectable difference i n OsMPK3 protein or activity, OsMPK3 knock down plants displayed enhanced resistance to rice blast and to the bacterial pathogen Burkholderia glumae (Xiong and Yang, 2003) The role of OsMPK3 in rice Xoo interaction s was therefore studied using OsMPK3 knock out plants. OsMPK3 T DNA insertion mutant plants in Donjing background (11344R and 01618L) were obtaine d from POSTECH Biotech Center at Pohang University of Science and Technology, Pohang, Kor ea ( http://signal.salk.edu/cgi

PAGE 108

108 bin/RiceGE ). Two T DNA mutants were obtained with insertion s in the first exon, splicing site between the second exon and second intron respectively (Fig 3 5 A). To screen sequence includ ing nucleotides 1502 2566 was amplified from rice genomic DNA as a gene specific probe to hybridize with the genomic DNA which was completely digested with Hind III (Fig 3 5 B). Homozygous mutants for either allele ( mpk3 1 mpk3 2 ) were identified as shown by the shifted position of the single band detected by S outhern blot. An immune blot was conducted to detect the protein change in the mutant plants (Fig 3 5C). OsMPK3 specific antibody did not detect any Os MPK3 protein accumulation in either mutant verifying that both mutants are null mutants. No obvious phenotypic difference was observed in the null mutants. When mutants mpk3 1 and mpk3 2 were inoculated with pathogen PXO99a, all plants demonstrated normal disease development, comparable to wild type (WT) Dongjing plants (Fig 3 6) After 12 days, lesion length of up to 15 cm developed in both mpk3 mutants and WT plants The shorter lesion s observed in the mpk3 1 mpk3 2 and WT plants compared to the TP309 plants were due to the relative ly small size of WT, mpk3 1 and mpk3 2 The difference in OsMPK6 activity in compatible and incompatible interaction s prompted us to study the p otential role of OsMPK6 in resistance to Xoo No OsMPK6 T DNA mutants were avail able at POSTECH Biotech Center OsMPK6 AS plants were therefore generated to investigate the function of OsMPK6 i n rice Xoo interaction s A gene specific region at the a cDNA spanning a p ortion of exon 4, exon 5 and exon 6 w as selected for specif ic antisense knockdown (Fig 3 7 A). In total, 54 T0 plants were generated from more than 30 independent transformation events. In the majority

PAGE 109

109 of transgenic plants, the OsMPK6 level was dramatically reduced compared to that of the wild type plants as show n by immunoblot with MPK6 specific antibody (Fig 3 7 B data not shown ). The MPK6 AS induced gene silencing seems specific, as OsMPK3 accumulation was not affected in the AS plants ( Fig 3 7 C ). Three randomly selected MPK6AS plants with reduced MPK6 accumu lation w ere challenged with PXO99a at six week s of age to test resistance. L esion development was partially constrained in all three plants inoculated (Fig 3 8 A, 3 8 B). On average, the lesion length on MPK6AS plants was a pproximately 5 cm By contrast, in susceptible TP309 plants, lesion s developed up to 18 cm, while in the resistant 4021 3 plants lesion s were barely observable (< 1 cm) Bacterial population studies confirmed the intermediate level of resistance observed in the OsMPK6AS plants MPK6 AS pla nts supported significantly less bacteria l growth compared to the TP309 plants (Fig 3 8C). The mean bacterial population in TP309 plants at 8 dpi accumulated up to 10 9 cfu/leaf, while in the 4021 3 plants, bacteria remained at a relatively low level (10 6 cfu/leaf). In OsMPK6AS plan ts, ba cteria numbered around 10 7 cfu/leaf, corresponding to the partial resistance demonstrated by the lesion length s observed. Regulation of PR gene expression has been extensively associated with resistance response s Similarly Northern Blot with a PR10 specific probe confirm ed that P R 10 is constitutively express ed in OsMPK6AS plants (Fig 3 8 D). The resistance was observed repeatedly in the T1 plants (Fig 3 9) verifying the genetic stability of the resistance in the AS plant s. The kinase activity in the inoculated MPK6 AS plants w as tested by an in gel kinase assay. T he induction of kinase activity was reduced noticeably in MPK6 AS plants compared to the TP309 plants (Fig 3 3 C) No substantial activation was detected

PAGE 110

110 in AS pla nts, suggesting that reduced protein accumulation led to decreased activity. This discovery also confirmed that the kinase activated by Xoo infection in TP309 plants was OsMPK6. 3 .3. 4 OsMPK6 is Involved i n Plant Development In addition to the enhanced resi stance, a ll of the OsMPK6AS T0 plants with decreased OsMPK6 protein abundance showed reduced plant height s with shorter panicle length s and smaller grain size (Fig. 3 10 to 3 16 and data not shown), implying that OsMPK6 i s required for normal plant develop ment. T wo OsMPK6AS transgenic plants with normal OsMPK6 accumulation displayed normal growth compared to TP309 plants, indicating that the reduced size was due to decreased OsMPK6 level s rather than tissue culture or environmental conditions. Although var iation has been observed amon g individuals, all OsMPK6AS plants were dwarf excluding the possibility that the reduced growth was caused by the position effect of the T DNA insertion. The vector used to generate the OsMPK6AS lines, pCmHu, modified from pCA MBIA, has been extensively used to produce transgenic rice plants in our lab but no similar phenotype has been observ ed, indicating that it i s not a common phenotype due to transgenic effect s Three representative individuals of OsMPK6AS and TP309 plants were measured to collect quantitative data. The height of TP309 plants measured approximately 120 cm on average while the height of the AS plants fell into the range of 65 to 80 cm (Fig. 3 10) The panicle length of the AS line s w as reduced up to 50% (Fig. 3 11). All panicles collected from TP309 plants were longer than 20 cm. Variation was observed among panicles from AS lines. Among the three AS lines measured, AS1 plants carried comparatively larg er panicles while those from AS2 plants were as short as 1 0 cm. The architecture of the panicles was affected and the distance between

PAGE 111

111 branches w as reduced in the AS lines, consistent with the shorter panicles (Fig. 3 11B). In addition, the seeds produced by AS plants were si gnificantly smaller than those of the WT plants. Seed length, width and thickness data were collected from 50 seeds produced by each individual plant (Fig. 3 12). Grain weight w as measur ed after the seeds were dried at 42C for 3 days and 1000 grain weight w as calculated accordingly. The dif ference between AS seeds and WT seeds was statistically significant with a p value<0.05 as shown in Student t test. The 1000 grain weight decreased from approximately 25 g to less than 20 g. The se phenotypes were observed repeatedly in the T1 genera tion of OsMPK6AS plants (Fig. 3 14 to 3 15). De layed germination was observed in the AS lines and smaller plant sizes were detected at the seedling stage. Interestingly, all AS plants showed bushy and dwarf phenotype s at the booting stage, but the tiller number i n the AS plants were not significantly altered after maturation c ompared to that of wild type (Fig. 3 13 ), indicating a disruption of normal plant develop ment by antisense of OsMPK6. This statement was supported by the fact that the dwarf and small grain p henotype co segregated with the AS Among twenty T1 individuals tested, four showed wild type phenotype with normal seeds and sixteen were dwarf with smaller seeds (Fig. 3 14), following a 3:1 ratio (16:4, chi square = 0.267, p =0.61). The dwarfism correlat ed well with reduced OsMPK6 accumulation and all plants with wild type level s of OsMPK6 were of normal phenotypes In agreement with the previous observation, smaller seeds were observed in all the AS lines, but not in the segregat ed wild type lines (Fig. 3 15).

PAGE 112

112 3 .3.5 GA Treatmen t Rescue d t he Dwarfism in MPK6AS P lants Dwarfism observed in rice plants ha s been associated with deficient GA synthesis or perception (Li et al. 2011) To test if the dwarfism observed in OsMPK6AS plants was caused by impaired GA synthesis or signaling, wild type TP309 plants and OsMPK6AS plants were germinated on MS medium supplemented with different concentrations of GA. Plant heights and root length were measured from at least 15 individuals to evaluate the GA response. No eff ect on either WT or AS lines was detected when GA was applied at low concentrations (10 8 10 10 or 10 12 M) (data not shown). When GA was applied at 10 6 or 10 4 M, the growth of both lines was promoted, suggesting that AS plant s respond normally to GA (F ig. 3 16). One week after germination, growth of OsMPK6AS lines treated with 10 6 M or 10 4 M GA were dramatically increas ed compared to control treated plants. The length of both root and leaf sheath s in the AS lines were comparable to that of WT plants, imply ing GA treatment could rescue the dwarf phenotype. The results obtained in this experiment suggest that dwarfism in AS plants were due to a lack of active GA. 3 .3.6 MPK6AS Plants Displayed Altered Protein Accumulation Involved i n Multiple Process es Th e altered resistance of rice to Xoo and abno rmal plant development indicates important and diverse role s for OsMPK6. Therefore, the role of OsMPK6 was further analyzed by proteomic analysis in MPK6AS and in WT plants Based on the consistent performance of OsMPK6AS lines in their physiological phenotype and disease resistanc e, a representative AS line, AS 1 with a moderate phenotype was used for proteomics analysis. Three biological replicates were used for each sample, consisting of a pool of more than fiv e leaves from different T2 homozygous individuals at the two

PAGE 113

113 leaf stage. In total, 457 proteins were identified from both WT and AS lines with more than two peptides evident for each protein (1605 peptides) in total. The expression of 61 proteins w as signi ficantly changed ( p <0.05) in the AS lines compared to the WT with a cut off of > 1.3 fold change. The proteins were classified according to the ir biological function (Table 3 2). OsMAPK6 is involved p r imari ly in photosynthesis, carbohydrate metabolism, prot ein and amino acid synthesis and metabolism. Proteins invo lved in photosynthesis comprise the largest group identified (39%). The abundance of the majority of the protein s in the photosynthesis category w as reduced in the OsMPK6AS lines O nly 5 out of the 25 photosynthesis related protein s were upregulated. Consistent with the abnormal growth observed, a significant reprogramming of primary metabolism was also detected when the AS lines were compared with the wild type plants Twenty proteins related to pri mary metabolism and carbohydrate synthesis were identified as differentially expressed in AS lines. The third largest group identified wa s associated with protein or amino acid metabolic process es All identified proteins associated with metabolism were up regulated in AS lines except for a Ribosomal_S10 super family protein. The protein synthesis process might be activated for the defense response as described by Mahmood et al ( 2006) Oxidative signaling is an important response to both biotic and abiotic stress. The abundance of a thioredoxin protein was reduced while the accumulation of a catalase like protein was promoted in plants with decreased MPK6 protei n. In addition, calcium binding proteins, DNA/RNA binding proteins and translation elongation factors were identified, implying that OsMPK6 is involved in multiple processes in plants. No protein involved in GA pathway was identified as

PAGE 114

114 deregulated by MPK 6, although GA deficiency has been related to the dwarfism o f MPK6AS plants. This is likely due to the overall low abundance of signaling proteins. 3 .3.7 OsMPK6OX Plants Display Abnormal Growth OsMPK6 was overexpressed using a rice ubiquitin promoter in TP 309 plants to get a comprehensive understanding of OsMPK6 function. Nine transgenic plants were produced from seven individual Agrobacterium mediated transformation events. P rotein accumulation was dramatically elevated in 8 out of the 9 OsMPK6OX individua l s, although the protein level varied from plant to plant (Fig 3 17) Among all the plants, OsMPK6 accumulation was drama tically increased in OsMPK6OX 1 to 5 and OX 7 plants. When the T0 transgenic plants were transf err ed into soil in the greenhouse, none of the plants gre w normally or reached maturity (Fig. 3 17 and data not shown ). Among them, OX 5 and 7 grew to a comparatively bigger size while OX 2, 3 and 4 died within a few weeks. OX 5 and 7 plants survived but remained at the vegetative growth stage for more than seven months By contrast, n ormal rice plants started flowering and setting seed s in three months, and began to senesce in five month s Except for plant OX 1, no flowering was observed in the OX lines. No healthy seeds were produced in any o f the OX plants. All th is data argue s that overexpression of OsMPK6 in rice severely inter rupt s normal plant physiology and that OsMPK6 plays a crucial role in orchestrating development al process es 3 .4 Discussion MAPKs are important components of signal mo dul es involved in diverse plant physiological and developmental processes. A number of MAPKs have been reported to participat e in defense responses in different plant species. Here, we report that OsMPK6 plays a negative role in resistance to Xoo by demo nst r a ting its differential

PAGE 115

115 activation in resistant and susceptible reactions and the altered resistance in MPK6AS plants. This study provides yet another example of MAPKs in the disease resistance response s in a distinctive way as compared to its ortholog ue in Arabidopsis Xoo causes the most destructive bacterial disease of rice worldwide. Significant effort has been appli ed to study the interaction s between rice and Xoo However, the hypothetical signaling components for both susceptibility and resistanc e remain largely obscure. A group of effectors, TAL effectors secreted by T3SS play a predominant role in the infection process by reprogramming the plant transcriptome (White and Yang, 2009) The induction of the susceptibility gene Os8N3 ( Xa13 ) by major virulence factor pthXo1 is required for a compatible interaction (Yang et al ., 2006) Os8N3 has r ecently been identified as an intercellular sugar transporter providing nutrient s for bacteria l multiplication. OsMPK6 i s activated in the susceptible reactions downstream of Os8N3 under the conditions tested in this study. The role of this activ ation in s usceptible reaction s i s still unknown. One reasonable guess is that OsMPK6 serve s as a coordinator to balance plant development and defense program s as sho wn by the altered development of OsMPK6AS plants. However, no difference was observed in OsMPK6 prote in accumulation imply ing that OsMPK6 i s not a direct target of TALes. Xoo might turn on OsMPK6 by targeting the MAPKKK upstream of MAPK or t hrough some other mechanism. To resist Xoo infection, rice deploy s a sophisticated system consisting of both domina nt and recessive resistance genes. XA21 is a receptor kinase conferring resistance to broad spectrum resistance to almost all Xoo races identified in the Philipine s (Song et al. 1995) and xa13 is a recessive r gene with a mutation at the

PAGE 116

116 promoter region that disturbs the induction of Os8N3 by pthXo1 (Yang et al. 2006) Activation of OsMPK6 was suppressed in the resistance mediated by both Xa21 and xa13 suggesting OsMPK6 is a common pathway component shared by multiple R g enes. This observation support s the importance of OsMPK6 in the resistance response. However, OsMPK6AS plants confer only partial resistance to Xoo infection. As no OsMPK6 null mutants a re available, it i s impossible to exclude the possibilit y that the partial resistance i s due to undete ctable activity of OsMPK6 remaining in the AS lines. A second explanation would be the possible presence of a redundant protein or multiple signaling pathways lying downstream of resistance genes. Specific interr uption of OsMPK6 signaling leave s other prot eins and OsMPK6 independent pathways intact supporting an intermediate level of bacteria l multipli cation. These factors together suggest that OsMPK6 is targeted by pathogen s as well as a component of resistance pathways. OsMPK3 has been reported as a nega tive regulator of resistance to M. grisea (Xiong and Yang, 2003) but mutation of OsMPK3 does not alter the interaction with Xoo (Fig. 3 6) This c an be attributed to functional redundancy among MAPK family members Another possibility is that OsMPK3 and OsMPK6 are responsible for resistance to different pathogen s The cooperation between OsMPK3 and OsMPK6 may allow broader spectrum resistance to a wide range of pathogens. While we identified OsMPK6 by the different iated activat ion in compatible and incompatible interactions, its putative orthologue in Arabidopsis has been shown to be involved in multiple program s including defense respo nse to various stress es and plant development (Asai et al ., 2002; Pitzschke et al ., 2009a) The result obtained in this study is in agreement with the discovery in Arabidopsis in that MPK3 is regulated at

PAGE 117

117 multiple levels including posttranslational modification while MPK6 is primarily regulated at the posttranslational level. Although MPK3 and MPK6 are involved in defense signaling in both Arabidopsis and rice, significant differences have been observed in the two species. AtMPK 3/ 6 a re redundantly located in one of the best established MAPK modu le s MEKK1 MKK4/5 MPK3/6 activated by flg22 treatment (Asai et al. 2002) Ac tivation of AtMPK3 and AtMPK6 is essential for PR gene expression and PTI respons e to flg22. Mutation of either AtMPK3 or AtMPK6 d oes not significantly alter the response because o f the functional redundancy of these two MAPKs. In ric e, however, OsMPK3 and OsMPK6 a re negatively involved in resistance to M.grisea and Xoo respectively (Xiong et al. 2003) In terms of development, t he role s of AtMPK3 and AtMPK6 are diverse including t heir parallel function in ovule development and in ethylene signaling. Double mutation of mpk3/mpk6 is lethal, indicat ing the indispensability of the two proteins and other possib le functions yet to be identified. Besides the shared function with AtMPK3, A tMPK6 has demonstrate d role s in JA signaling, development of floral organ s and embryo s and leaf senescence downstream of AtMKK9. In rice plants, o verexpression or RNA interferenc e of OsMPK3 does not cause observable physiological phenotype s but OsMPK3 le vel s are well correlated with tolerance to environmental stress including cold and drought treatments (Xiong et al. 2003). OsMPK6 i s required for normal rice development seed pro duction and possibly GA signaling. In stark contrast to the overlapping func tion between AtMPK3 and AtMPK6 in Arabidopsis, decreased O sMPK3 activity itself i s sufficient for enhanced resistance to rice blast and increased sensitivity to abiotic stress. Here we re port that reduction of OsMPK6 i s responsible for resistance to Xoo in fection and abnormal plant

PAGE 118

118 development. Similar to the div ergent function between OsMPK3 and OsMPK6 observed in rice, the putative MPK3 orthologue in wheat i s strongly induced in compatible interactions but not in incompatible interactions with Mycosphaere lla graminicola TaMPK6, however, i s not affected by M. graminicola. Notabl y, OsMPK3 and OsMPK6 a re both activated by a chitin elicitor, indicating a potential redundant function shared by OsMPK3 and OsMPK6. The differing and complex roles of MAPKs in diff erent plant species suggests continued evolution of MAPK function after the div ergence of monocots and dicots. While a classical view of defense response highlight s defense specific signaling, more attention is now being focused on the integration of defen se system s and plant development al process es On the one hand, path ogen invasion strategies alter plant development for successful colonization. On the other hand, plants adjust the ir development al program to minimize the potential damage. A number of gene s involved in both developmental process es and defense response s have been identified, supporting the speculation that plants may revers e the imbalance caused by pathogen infection. Multiple Arabidopsis mutants with constitutive defense response display re tardation and defective growth. In this study, OsMPK6AS plants display suboptimal development and seed production in addition to enhanced resistance. The antagonistic effect between development and resistance has been previously reported with mutation of A tMPK4 a negative regulator of SAR (Petersen et al ., 2000) Dwarfism observed in AtMPK4 mutants i s associated with elevated SA accumulation and increased resistance, because expression of the nahG gene can part ial l y rescue the phenotype. Dwarfism in OsMPK6 i s nevertheless linked to distorted carbohydrate metabolism and

PAGE 119

119 photosynthesis as demonstrated in the proteomic s study. Carbohydrate metabolism and photosynthesis are important targets of pathogens for the purpose of obtaining nutrients Meanwhile, upregulat ion of carbohydrate me tabolism s a re required for phytoalexin biosynthesis and antimicrobial activity (Kishi Kaboshi et al ., 2010) The modifica tion of OsMPK6 activity by the pathogen and the subsequent chan ge in carbohydrate metabolism i s hence regarded as the output of a give and take between the pathogen and the plant. The role o f OsMPK6 in plant development i s proposed partly based on the find ing that overexpression of OsMPK6 severely interfer ing with normal rice development suggesting that overexpression of signaling components may disturb the signaling transduction. T ogether t he observations described above support that m aintaining OsMPK6 a ctively at a stable level is crucial for maintaining normal plant growth and development. GA is an important hormone regulating plant growth and development. An increasing amount of evidence support s the role of GA in defense responses. Arabidopsis plants with mutation of the DELLA protein exhibit enhanced resistance to Pst and increased susceptibility to necrotrophs (Robert Seilaniantz et al. 2007) Overexpression of a GA deactivating enzyme gene in rice results in increas ed resistance to both Xoo and M. grisea indicating a negative role of GA in the rice defense response s (Yang et al. 2008). OsMPK6AS plants display a deficiency in GA signaling and enhanced resistance. The enhanced resistance is probably due to impaired GA signaling, and OsMPK6 appears t o be a n connection between GA signaling and defense signaling GA was first identified as be ing produced by the causal agent of rice bakanae disease. Increased endogenous GA concentration compromise s

PAGE 120

120 resistance to Xoo (Yang et al. 2008) It is therefor e p roposed that GA signaling can be a virulence target of pathogen infection. This also provides a possible mechanism as to why OsMPK6 is induced by pathogen s It would be interesting to test the GA concentration in Xoo challenged plants and OsMPK6AS plants t o validate this hypothesis. Although the OsMPK6 function ha s been investigated in this study by analyz ing its expression pattern and generating transgenic plants, limited information on the mechanism or the upstream and downstream components of OsMPK6 sign aling is available. If OsMPK6 functions through a MAPK cascade, its upstream MAPKKK and MAPKK await to be discovered. T o date, most knowledge on MAPK cascades is based on studie s on dicots, particular ly Arabidopsis. In Arabidopsis, multiple MAPKKs a re invo lved in the activation of AtMPK6, depending on the stimul us AtMKK1 MKK4/5 a re responsible for AtMPK3/6 activity downstream of flg22 perception by FLS2 (Asai et al. 2002) AtMPK6 i s activated in senescence in an AtMKK9 dependent manner and respond s to JA signaling through activation of AtMKK3 ( Zhou et al. 2009) A module has been reported in rice with MKK4 upstream of MPK3/6 involved in phytoalexin synthesis responsive to chitin elicitors (Kishi Kaboshi et al ., 2010) Constitutive activation of OsMKK4 caused transc r iptional change of genes involved in sugar metabolism, secondary metabolite s and phytoalexin biosynthesis. Significant overlapping of the genes regulated by OsMKK4 and OsMPK6 (1 1 out of 61), suggest s that OsMKK4 may serve as an upstream activator of OsMPK6 in the rice Xoo interaction s However, the exact activator(s) of OsMPK6 remains to be conclusively identified.

PAGE 121

121 Table 3 1 Primers used in this study Name Sequence ( ) OsMPK6 1 GGATCCGGGTCGACCATGGACGCCGGGGCGCAG OsMPK6 2 GCGGCCGCCCAAGGCTGAAATAGAACACCAG OsMPK6 3 ATCCAAATCCGAATCCGGCCATGGA OsMPK6 4 CATATGAATAGAATCAATCCAAGGCTGA OsMPK6 5 CACGAGAATATTGTTGCCATAAGGGA OsMPK 6 7 TTGAATGAATTCCTTTGTGGAGGAGG OsMPK6 8 AAGGGCGCC TACGGCATCGTCTGCTCGGCGCTCAACTCGGAGA OsMPK6 9 CGATGCCGTAGGCGCCCTTGCCGA F CTGGTGTTCTATTTCAGCCTTGGA R GAATGGCATAGCAGCTACCCAGGA MPK6S F GGATATC ATGGAACTCATGGATCGTAAACC MPK6S R GGACTAGT CTACTGGTAATCAGGGTTGAACGC MPK6AS F GGCTCGAGGATC CTAC TGGTAATCAGGG TTGAACGC MPK6AS R GGAAGCTT ATGGAACTCATGGATCGTAAACC PR10F ATGGACGCGTCCGCCATGC PR10R GGCGAATTCGGCAGGGTGAGC

PAGE 122

122 Figure 3 1 ClustalW phylogenetic analysis of Arabidopsis, rice MAPKs TaMPK3 and Ta M PK6

PAGE 123

123 Figure 3 2. I nformation of OsM PK3 and OsMPK6 specific antibodies A) Sequence alignment of N terminal se quence of OsMPK3, OsMPK4, OsMPK 6 AtMPK3, AtMPK4, AtMPK6, TaMPK3 and TaMPK6. Amino acid residues used for MPK3 antibody generation a re underlined in red B) Sequence alignment of C t erminal sequence of OsMPK3, OsMPK4, OsMPK 6 AtMPK3, AtMPK4, AtMPK6, TaMPK3 and TaMPK6. Amino acid residues used for MPK6 antibody generation a re underlined in red C) Immuno detection of OsMPK3, OsMPK6 expressed in E.coli antibodies

PAGE 124

124 Figure 3 3. Detection of OsMPK3 and OsMPK6 in inoculated TP309 and 4021 3 plants. A) Detection of MPK3, MPK6 protein abundance and kinase activity in TP309 and 4021 3 plants at 0,2,4,8 and 24 hpi. B) In gel kin ase assay with proteins and 24 hpi in TP309 and 4021 3 plants. C) Detection of MPK6 activity in TP309 and MPK6AS plants at 0 and 24 hpi. Commassie blue stain of prote in gel i s included as the loading contr ol.

PAGE 125

125 Figure 3 4. Induction of OsMPK6 activity in IR24 and IRBB13 plants after challenge with PXO99a tested by in gel kinase assay. Commassie blue stain of prote in gel i s included as the loading control.

PAGE 126

126 Figure 3 5. Identification of OsMPK3 knock out mutants. A) Schematic of OsMPK3 gene struc ture. Grey filled box represent s exon and black line represent s codon and stop codon a re lableled. HindIII digestion sites used for S outhern blot a re shown. Dashed arr ows show the region used for probe sequence for S outhern blot. show s the location of the T DNA inserti on in the mutants. B) Southern b lot showing identification of the homozygous mutants. C) Immunoblot of OsMPK3 in ho mozygous T DNA mutants. WT: wild type Dongjing plants HT: heterozygous mutants. mpk3 1 and mpk3 2 represent two different alleles of the T DNA insertion.

PAGE 127

127 Figure 3 6 Inoculation of OsMPK3 knock out mutants at adult stage with PXO99a. A) Represent ative leaves showing lesion development in mpk3 1 and mpk3 2 homozygous mutants. B) Lesion length of inoculated mpk3 1 and mpk3 2 homozygous mutants. The mean value of more than 10 leaves i s shown. Error bars represent standard deviation All data were ta k en at 12 dpi. TP309 and 4021 3 a re included as susceptible and resistant control s respectively. WT: wild type Dongjing plants used for generation of T DNA mutants.

PAGE 128

128 Figure 3 7 Generation of OsM PK6AS plants. A) Schematic structure of the OsMPK6 gene. G rey filled box es represent exon s and the black line s represent intr on s The s tart codon and stop codon a re lableled. Pink lines show the region used for antisense. B) Immunoblot of OsMPK6 in OsMPK6 AS lines. Po nceau S stain of the membran e i s included as t he loading control. C) Immunoblot of OsMPK3 in OsMPK6 AS lines. Red arrow indicate s the position of OsMPK3 and indicate s the position of OsMPK6.

PAGE 129

129 Figure 3 8. Inoculation of OsMPK6 AS plants at the adult stage with Xoo strain PXO99a. A) Representativ e leaves showing lesion development in MPK6AS plants. B) Lesion length of inoculated leaves on MPK6AS plants. The mea n value of more than 10 leaves i s shown. C) Bacterial population in MPK6AS plants. The mean value of three re p licates i s shown. Error bars represent standard error. All data were tak en at 12 dpi. TP309 and 4021 3 a re included as susceptible and resistant control respectively. D) Detection of PR10 expression in TP309 and MPK6AS plants.

PAGE 130

130 Figure 3 9. Inoculation of OsMPK6 AS T1 plants with PXO99a at adult stage. Number s 1 8 represent eight T1 individuals. Average lesion length of all leaves on a single plant i s shown. Error bar represent s standard error.

PAGE 131

131 Figure 3 10. OsMPK6 plants displaying dwarf phenotype. A) Picture of fully matured TP309 and OsMPK6AS plants AS1, AS2 and AS3. B) Plant height of fully matured TP309 and OsMPK6AS plants.

PAGE 132

132 Figure 3 11. Small panicles produced by T0 OsMPK6AS plants. A) Smaller panicle size on OsMPK6AS plants AS1, AS2 and AS3. B) Panicle structure of TP309 and MPK6AS1 plants. C) Panicle length on OsMPK6AS plants AS1, AS2 and AS3. The mean value of all panic les produced on a single plant i s shown. Error bar s represent standard deviation.

PAGE 133

133 Figure 3 12. Smaller seeds produced by T0 OsMPK6AS plants. A ) Unhusked and dehusked seeds o f TP309 and OsMPK6AS plants AS1, AS2 and AS3. B) Seed length, width, thickness and 1000 grain weight of seeds from TP309 and OsMPK6AS plants AS1, AS2 and AS3. The mean value of fifty see ds produced on a single plant i s show n. Error bar s represent standard deviation.

PAGE 134

134 Figure 3 13. Bushy and dwarf phenotype o f T1 OsMPK6AS plants at young stage. A) T1 OsMPK6AS and TP309 plants at 4 and 7 weeks old. B) Tiller number of T1 OsMPK6AS and TP309 plants at mature stage. Error ba r s represent standard deviation. 0 1 2 3 4 5 TP309 AS

PAGE 135

135 Figure 3 14. Dwarf phenotype and smaller panicle length of OsMPK6AS T1 plants cosegregated with antisense. Numbers 3 33 represent different individuals. CK: TP309. +: normal MPK6 protein accumulation, : no detectabl e MPK6 protein.

PAGE 136

136 Figure 3 15. S maller seeds from OsMPK6AS T1 plants. The mean value o f 20 seeds from each line i s presented. Error bar s represent standard deviation. Numbers 3 33 represent different individuals. CK: TP309. +: normal MPK6 protein accum ulation, : no detectable MPK6 protein.

PAGE 137

137 Figure 3 16. GA treatment of TP309 and MPK6AS plants. Root length (S) and leaf sheath length (B) of TP309 plants and MPK6AS plants were measured one week after treatment with GA. The mean value of more than 10 individual plants i s shown for each treatment and control Error bar s represent standard error. CK: water treated control. 0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0 TP309 MPK6AS 0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0 TP309 MPK6AS

PAGE 138

138 Figure 3 1 7 Phenotype of MPK6OX plants. A) Confirmation of MPK6 proteins in MPK6 OX plants. Ponceau S stain of the membrane i s included as the loading control. B ) Growth deficiency of MPK6OX plants.

PAGE 139

139 Table 3 2 Fold change of p roteins in MPK6AS compared to TP309 plants TIGR ID Name Rep1 Rep2 Rep3 Response to stress Os02g33450 Thioredoxin like protein 0.57 Os03g17690 L ascorbate peroxodase 1 0.52 1.51 Os03g03910 Catalase like protein 1.45 Carbohydrate metabolic processes Os01g45274 Carbonic anhydrase 1.64 0.52 Os02g15750 Hydroxyproline rich glycoprotein like protein 0.36 Os0 2g52940 Putative inorganic pyrophosphatase 0.42 1.75 Os03g03720 Glyceraldehyde 3 phosphate dehydrogenase 2.20 2.43 Os03g16050 Fructose 1,6 bisphosphatase 1.59 Os04g16680 Sedoheptulose 1,7 bisphosphatase precursor 1.45 Os04g38600 Glyceraldehyde 3 phosphate dehydrogenase A 1.82 1.88 Os05g01970 Putative 3 beta hydroxysteroid dehydrogenase/isomerase 0.46 Os05g41640 Phosphoglycerate kinase 0.35 Os06g04270 Putative transketolase 3.07 Os06g40640 Putative fru ctose bisphosphate aldolase 1.64 Os08g14440 Uridylyltransferase related protein 0.43 Os08g29170 Putative oxidoreductase, zinc binding 0.35 2.21 Os09g36450 Putative Triosephosphate isomerase, chloroplast precursor 2.06 Os10g353 70 Protochlorophyllide reductase B 2.40 Os11g07020 Fructose bisphosphate aldolase 1.70 0.54 Os12g01530 Ferritin 1 2.50 3.21 Photosynthesis Os01g31690 Chloroplast oxygen evolving enhancer protein 0.38 Os01g65902 cytochrome f [Oryz a sativa] 0.63 0.62 0.64 Os 0 2g 0115 0 Hydroxypyruvate reductase 1.33 1.47 Os02g10390 putative chlorophyll a/b binding protein type III precursor [Oryza sativa Japonica Group] 0.10 1.28 Os02g51470 putative H(+) transporting ATP synthase [Ory za sativa Japonica Group] 0.64 Os03g36540 Magnesium chelatase ATPase subunit I 2.31 Os03g39610 Chlorophyll a/b binding protein 0.70 Os04g16740 ATP synthase CF1 alpha chain 0.23 0.56 Os04g38410 Chlorophyll a/b binding protein C P26 precursor 0.39 0.70 Os05g22614 NADB_Rossmann domain containing rptein 0.17 0.49 Os06g39708 Photosystem II 47kDa protein 2.30

PAGE 140

140 Table 3 2 C ontinued TIGR ID Name Rep1 Rep2 Rep3 Os06g43850 Putative ATP synthase delta chain 0.26 Os07g04840 23 kDa polypeptide of photosystem II 0.28 Os07g32880 Putative ATP synthase gamma chain 1 0.58 Os07g37240 Chlorophyll a/b binding protein 0.45 0.65 Os08g25900 PsbP 0.30 0.44 Os10g21266 ATP synthase subunit beta 0.21 0.54 Os10g21268 Ribulose 1,5 bisphosphate carboxylase/oxygenase 2.88 2.74 Os10g35030 Putative IAP100 0.52 1.58 Os11g13890 Chlorophyll a/b binding protein CP26 precursor 0.34 Os11g47970 RuBisCO activase small isoform precursor 1.56 Os12g17600 Ribulose bisphosphate carboxylase small chain C 0.55 0.48 Os12g17910 RuBisCO subunit binding protein alpha subunit, chloroplast precursor 2.19 2.63 Protein metabolic and modification processes Os02g38210 Translational elongati on factor Tu 1.96 Os02g57670 Putative 50S ribosomal protein L9 1.79 2.86 Os03g08010 Elongation factor 1 alpha 2.21 2.27 Os03g14530 Ribosomal_S10 super family protein 0.44 Os03g52840 Putative glycine hydroxymethyltransferase 1.3 9 1.51 Os04g56400 Plastidic glutamine synthetase 1.41 Os05g32220 Chloroplast ribosomal protein L1 1.67 1.64 Os06g09679 Putative chaperonin 21 precursor 3.51 Os06g45820 ATP dependent zinc metalloprotease FTSH 2 1.39 1.57 Os 07g01760 Putative alanine aminotransferase 3.04 2.59 Os07g37830 Putative peptidyl prolycis trans isomerase protein 2.25 Os08g39300 Putative aminotransferase 1.50 0.70 Os09g10760 Putative plastid specific ribosomal protein 2 precursor 1.49 Transcription related Os08g44290 Putative nucleic acid binding protein 0.19 Transporter related Os06g14324 Caleosin super family protein 0.76 0.71 Os09g19734 Voltage dependent anion channel 0.40 0.64 Unknown Os10g30870 Hy pothetical protein 1.66

PAGE 141

141 CHAPTER 4 SUMMARY AND FUTURE P ERSPECTIVES In this study, developmental regulation of XA21 mediated resistance was investigated. XA21 mediated resistance was established at the two leaf stage in multiple XA21 containing plants In contrast to the recent hypothesis that transcription is a key regulator of XA21 resistance, the resistance activation is independent of XA21 protein accumulation. The activation requires constant low temperature treatment and could be blocked by eleva ted t emperature s (31 32 C), but not other environment factors. The temperature effect on the resistance was independent of XA21 level or Ax21 activity In addition, JA and ABA application lead to compromised resistance. These results together present a mul tifaceted regulat ion of XA21 resistance and highlight the crosstalk among development, hormone and environmental factors in th e pathosystem mediated by Xa21. The role of MAPKs in the interactions between rice and Xoo was studied for a better understanding of XA21 signaling OsMPK3 protein was inducible by Xoo infection, while OsMPK6 responded to Xoo infection at posttranslational level. OsMPK6 activation was interrupted by the presence of R genes including Xa21 and xa13 Correspondingly, MPK6AS plants exhib ited enhanced resistance to Xoo suggesting a negative role of OsMPK6 in resistance to Xoo Meanwhile, dwarfism and smaller grains were observed on OsMPK6AS plants. GA app lication could rescue the dwarf phenotype, indicating a deficiency in GA signaling s ynthesis or degradation in OsMPK6 AS plants. OsMPK6 was identified as a n integrated switch of resistance response and plant development through GA signaling.

PAGE 142

142 Rice Xoo interactions w ere associated with development and hormone signaling in b oth studies XA21 signaling was developmentally regulated. L ow level of OsMPK6 conferred resistance to Xoo infection while causing retarded growth of rice pants. The altered resistance and plant development may be linked to GA signaling. However, more evidence is needed to support this hypothesis, for example, change of endogenous GA level or expression level of genes involved in GA pathways in inoculated plants and MPK6AS plants. There are other possible crosstalks between defense signaling and developmental programs as sho wn by inhibition of XA21 signaling by temperature, JA and ABA. This work also added to our current knowledge on regulation of XA21 signaling as a multifaceted process However, the mechanisms underlying how developmental programs and growth temperatures a ffect the resistance remain obscure. Xa21 expression, posttranslational modification of XA21, and downstream factors are proposed as vital for XA21 signaling by different groups. Among all reports on developmental regulation of XA21 signaling genetic appr oach es w ere barely applied. Sensitivity to temperature provides a strategy for large sca l e genetic screening of mutants T emperature insensitive mutants will help us dissect the key factors involved in XA21 signaling Nevertheless, a quick and high through put screening platform has to be established to facilitate the screening. One possib le approach would be to apply a downstream reporter gene, using glucuronidases ( GUS ) stain or an other quick detection technique F urther investigation on the developmental control of XA21 signaling of the mutants will provide knowledge on the inter regulation between environmental factors and developmental programs.

PAGE 143

143 LIST OF REFERENCES Abedon, B.G., and Tracy, W.F. (1996). Corngrass 1 of Maize ( Zea mays L. ) delays development of adult plant resistance to common rust ( Puccinia sorghi Schw.) and European c orn b orer ( Ostrinia nubilalis Hub ner ) The Journal of Heredity 87, 219 223. Achard, P., Renou, J.P., Berthom, R., Harberd, N.P., and Genschik, P. (2008). P lant DELLAs restrain growth and promote survival of adversity by reducing the levels of reactive oxygen species. Curr Biol 18, 656 660. Alfano, J.R., and Collmer, A. (2004). Type III secretion system effector proteins: double agents in bacterial disease an d plant defense. Annu Rev Phytopathol 42, 385 414. Andreasson, E., Jenkins, T., Brodersen, P., Thorgrimsen, S., Petersen, N.H., Zhu, S., Qiu, J.L., Micheelsen, P., Rocher, A., Petersen, M., Newman, M.A., Bjrn Nielsen, H., Hirt, H., Somssich, I., Mattsson, O., and Mundy, J. (2005). The MAP kinase substrate MKS1 is a regulator of plant defense responses. EMBO J 24, 2579 2589. Antony, G., Zhou, J., Huang, S., Li, T., Liu, B., White, F., and Yang, B. (2010). Rice xa13 recessive resistance to bacterial blight i s defeated by induction of the disease susceptibility gene Os 11N3. Plant Cell 22, 3864 3876. Apel, K., and Hirt, H. (2004). Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annual Review of Plant Biology 55, 373 399. Asai, T ., Tena, G., Plotnikova, J., Willmann, M.R., Chiu, W.L., Gomez Gomez, L., Boller, T., Ausubel, F.M., and Sheen, J. (2002). MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415, 977 983. Audenaert, K., De Meyer, G.B., and Hfte, M.M. (20 02). Abscisic acid determines basal susceptibility of tomato to Botrytis cinerea and suppresses salicylic acid dependent signaling mechanisms. Plant Physiol 128, 491 501. Axtell, M.J., and Staskawicz, B.J. (2003). Initiation of RPS2 specified disease resis tance in Arabidopsis is coupled to the AvrRpt2 directed elimination of RIN4. Cell 112, 369 377. Bai, J., Choi, S.H., Ponciano, G., Leung, H., and Leach, J.E. (2000). Xanthomonas oryzae pv. oryzae avirulence genes contribute differently and specifically to pathogen aggressiveness. Mol Plant Microbe Interact 13, 1322 1329. Bari, R., and Jones, J. (2009). Role of plant hormones in plant defence responses. Plant Molecular Biology 69, 473 488.

PAGE 144

144 Belkhadir, Y., Nimchuk, Z., Hubert, D.A., Mackey, D., and Dangl, J.L. (2004). Arabidopsis RIN4 negatively regulates disease resistance mediated by RPS2 and RPM1 downstream or independent of the NDR1 signal modulator and is not required for the virulence functions of bacterial type III effectors AvrRpt2 or AvrRpm1. Plant Cel l 16, 2822 2835. Bent, A.F., and Mackey, D. (2007). Elicitors, effectors, and R genes: The new paradigm and a lifetime supply of questions. Annual Review of Phytopathology 45, 399 436. Birker, D., Heidrich, K., Takahara, H., Narusaka, M., Deslandes, L., Na rusaka, Y., Reymond, M., Parker, J.E., and O'Connell, R. (2009). A locus conferring resistance to Colletotrichum higginsianum is shared by four geographically distinct Arabidopsis accessions. Plant J 60, 602 613. Blume, B., Nurnberger, T., Nass, N., and Sc heel, D. (2000). Receptor mediated increase in cytoplasmic free calcium required for activation of pathogen defense in parsley. Plant Cell 12, 1425 1440. Boch, J., and Bonas, U. (2010). Xanthomonas A vrbs3 f amily Type III Effectors: discovery and function Annu Rev Phytopathol 8 419 436 Boch, J., Scholze, H., Schornack, S., Landgraf, A., Hahn, S., Kay, S., Lahaye, T., Nickstadt, A., and Bonas, U. (2009). Breaking the code of DNA binding specificity of TAL type III effectors. Science 326, 1509 1512. Bogdano ve, A.J., Schornack, S., and Lahaye, T. (2010). TAL effectors: finding plant genes for disease and defense. Curr Opin Plant Biol 4, 394 401 Boiler, T., and He, S. (2009). Innate immunity in plants: an arms race between pattern recognition receptors in pla nts and effectors i n microbial pathogens. Science 324, 742 744. Boller, T. (1995). Chemoperception of microbial signals in plant cells Annual Review of Plant Physiology and Plant Molecular Biology 46, 189 214. Boller, T., and Felix, G. (2009). A renaissan ce of elicitors : Perception of microbe associated molecular patterns and danger signals by pattern recognition receptors Annual Review of Plant Biology 60, 379 406. Bonas, U., Stall, R.E., and Staskawicz, B. (1989). Genetic and structural characterization of the avirulence gene avrBs3 from Xanthomonas campestris pv. vesicatoria Mol Gen Genet 218, 127 136. Brooks, D.M., Bender, C.L., and Kunkel, B.N. (2005). The Pseudomonas syringae phytotoxin coronatine promotes virulence by overcoming salicylic acid depe ndent defences in Arabidopsis thaliana. Mol Plant Pathol 6, 629 639.

PAGE 145

145 Burdman, S., Shen, Y., Lee, S.W., Xue, Q., and Ronald, P. (2004). RaxH/RaxR: a two component regulatory system in Xanthomonas oryzae pv. oryzae required for AvrXa21 activity. Mol Plant Mi crobe Interact 17, 602 612. Bush, S.M., and Krysan, P.J. (2007). Mutational evidence that the Arabidopsis MAP kinase MPK6 is involved in anther, inflorescence, and embryo development. Journal of Experimental Botany 58, 2181 2191. Buttner, D., and He, S.Y. (2009). Type III protein secretion in plant pathogenic bacteria. Plant Physiol 150, 1656 1664. Bttner, D., and Bonas, U. (2010). Regulation and secretion of Xanthomonas virulence factors. FEMS Microbiol Rev 34, 107 133. Cao, Y., Ding, X., Cai, M., Zhao, J ., Lin, Y., Li, X., Xu, C., and Wang, S. (2007). The expression pattern of a rice disease resistance gene xa3/xa26 is differentially regulated by the genetic backgrounds and developmental stages that influence its function. Genetics 177, 523 533. Century, K.S., Lagman, R.A., Adkisson, M., Morlan, J., Tobias, R., Schwartz, K., Smith, A., Love, J., Ronald, P.C., and Whalen, M.C. (1999). Short communication: developmental control of Xa21 mediated disease resistance in rice. Plant J 20, 231 236. Chang, J.H., Go el, A.K., Grant, S.R., and Dangl, J.L. (2004). Wake of the flood: ascribing functions to the wave of type III effector proteins of phytopathogenic bacteria. Curr Opin Microbiol 7, 11 18. Chen, F., Gao, M., Miao, Y., Yuan, Y., Wang, M., Li, Q., Mao, B., Jia ng, L., and He, Z. (2010a). Plasma membrane localization and potential endocytosis of constitutively expressed XA21 proteins in transgenic rice Molecular Plant 3 917 926. Chen, L.Q., Hou, B.H., Lalonde, S., Takanaga, H., Hartung, M.L., Qu, X.Q., Guo, W.J ., Kim, J.G., Underwood, W., Chaudhuri, B., Chermak, D., Antony, G., White, F.F., Somerville, S.C., Mudgett, M.B., and Frommer, W.B. (2010b). Sugar transporters for intercellular exchange and nutrition of pathogens. Nature 468, 527 532. Chen, X., Chern, M. Canlas, P.E., Ruan, D., Jiang, C., and Ronald, P.C. (2010c). An ATPase promotes autophosphorylation of the pattern recognition receptor XA21 and inhibits XA21 mediated immunity. Proc Natl Acad Sci U S A 107 8029 8034 Chen, X., Chern, M., Canlas, P.E., Jiang, C., Ruan, D., Cao, P., and Ronald, P.C. (2010d). A conserved threonine residue in the juxtamembrane domain of the XA21 pattern recognition receptor is critical for kinase autophosphorylation and XA21 mediated immunity. J Biol Chem 285, 10454 10463

PAGE 146

146 Chinchilla, D., Bauer, Z., Regenass, M., Boller, T., and Felix, G. (2006). The Arabidopsis receptor kinase FLS2 binds flg22 and determines the specificity of flagellin perception. Plant Cell 18, 465 476. Chinchilla, D., Zipfel, C., Robatzek, S., Kemmerling B., Nurnberger, T., Jones, J.D.G., Felix, G., and Boller, T. (2007). A flagellin induced complex of the receptor FLS2 and BAK1 initiates plant defence. Nature 448, 497 U412. Chu, Z., Fu, B., Yang, H., Xu, C., Li, Z., Sanchez, A., Park, Y.J., Bennetzen, J .L., Zhang, Q., and Wang, S. (2006a). Targeting xa13 a recessive gene for bacterial blight resistance in rice. Theor Appl Genet 112, 455 461. Chu, Z., Yuan, M., Yao, J., Ge, X., Yuan, B., Xu, C., Li, X., Fu, B., Li, Z., Bennetzen, J.L., Zhang, Q., and Wan g, S. (2006b). Promoter mutations of an essential gene for pollen development result in disease resistance in rice. Genes Dev 20, 1250 1255. Chung, K., Igari, K., Uchida, N., and Tasaka, M. (2008). New perspectives on plant defense responses through modula tion of developmental pathways. Molecules and Cells 26 107 112. Collier, S.M., and Moffett, P. (2009). NB LRRs work a "bait and switch" on pathogens. Trends Plant Sci 14, 521 529. Cui, J., Bahrami, A.K., Pringle, E.G., Hernandez Guzman, G., Bender, C.L., Pierce, N.E., and Ausubel, F.M. (2005). Pseudomonas syringa e manipulates systemic plant defenses against pathogens and herbivores. Proc Natl Acad Sci U S A 102, 1791 1796. Cunnac, S., Occhialini, A., Barberis, P., Boucher, C., and Genin, S. (2004). Invento ry and functional analysis of the large Hrp regulon in Ralstonia solanacearum : identification of novel effector proteins translocated to plant host cells through the type III secretion system. Mol Microbiol 53, 115 128. da Silva, F.G., Shen, Y., Dardick, C ., Burdman, S., Yadav, R.C., de Leon, A.L., and Ronald, P.C. (2004). Bacterial genes involved in type I secretion and sulfation are required to elicit the rice Xa21 mediated innate immune response. Mol Plant Microbe Interact 17, 593 601. Danna CH Millet YA Koller T Han SW Bent AF Ronald PC Ausubel FM ., (2011). The Arabidopsis flagellin receptor FLS2 mediates the perception of Xanthomonas Ax21 secreted peptides Proc Natl Acad Sci U S A 10, 9286 9291 Dangl, J.L., and Jones, J.D. (2001). Plant pathogens and integrated defence responses to infection. Nature 411, 826 833.

PAGE 147

147 de Jong, C.F., Takken, F.L., Cai, X., de Wit, P.J., and Joosten, M.H. (2002). Attenuation of Cf mediated defense responses at elevated temperatures correlates with a decrease in elicitor binding sites. Mol Plant Microbe Interact 15, 1040 1049. de Torres, M., Mansfield, J.W., Grabov, N., Brown, I.R., Ammouneh, H., Tsiamis, G., Forsyth, A., Robatzek, S., Grant, M., and Boch, J. (2006). Pseudomonas syringae effector AvrPtoB suppresse s basal defence in Arabidopsis. Plant J 47, 368 382. de Wit, P.J. (1995). Cf9 and Avr9, two major players in the gene for gene game. Trends Microbiol 3, 251 252. del Pozo, O., Pedley, K.F., and Martin, G.B. (2004). MAPKKKalpha is a positive regulator of ce ll death associated with both plant immunity and disease. EMBO J 23, 3072 3082. Desikan, R., Hancock, J., Ichimura, K., Shinozaki, K., and Neill, S. (2001). Harpin induces activation of the arabidopsis mitogen activated protein kinases AtMPK4 and AtMPK6. P lant Physiology 126 1579 1587. Develey Riviere, M., and Galiana, E. (2007). Resistance to pathogens and host developmental stage: a multifaceted relationship within the plant kingdom. New Phytologist 175 405 416. Ding, X., Cao, Y., Huang, L., Zhao, J., X u, C., Li, X., and Wang, S. (2008). Activation of the indole 3 acetic acid amido synthetase GH3 8 suppresses expansin expression and promotes salicylate and jasmonate independent basal immunity in rice. Plant Cell 20, 228 240. Dodds, P.N., and Rathjen, J. P. (2010). Plant immunity: towards an integrated view of plant pathogen interactions. Nature Reviews Genetics 11, 539 548. Dodds, P.N., Lawrence, G.J., Catanzariti, A.M., Teh, T., Wang, C.I.A., Ayliffe, M.A., Kobe, B., and Ellis, J.G. (2006). Direct protei n interaction underlies gene for gene specificity and coevolution of the flax resistance genes and flax rust avirulence genes. Proc Natl Acad Sci U S A 103, 8888 8893. Duan, Y.P., Castaeda, A., Zhao, G., Erdos, G., and Gabriel, D.W. (1999). E xpression of a single, host specific, bacterial pathogenicity gene in plant cells elicits division Molecular Plant Microbe Interact 12, 556 560. Felix, G., Duran, J.D., Volko, S., and Boller, T. (1999). Plants have a sensitive perception system for the most conserved domain of bacterial flagellin. Plant Journal 18, 265 276.

PAGE 148

148 Flor H.H. (1942). Inheritance of p athogenicity in Melampsora lini Phytopath 32 653 669 Furutani, A., Takaoka, M., Sanada, H., Noguchi, Y., Oku, T., Tsuno, K., Ochiai, H., and Tsuge, S. (2009). I dentification of novel type III secretion effectors in Xanthomonas oryzae pv. oryzae Mol Plant Microbe Interact 22, 96 106. Gao, M., Liu, J., Bi, D., Zhang, Z., Cheng, F., Chen, S., and Zhang, Y. (2008). MEKK1, MKK1/MKK2 and MPK4 function together in a mi togen activated protein kinase cascade to regulate innate immunity in plants. Cell Res 18, 1190 1198. Gimenez Ibanez, S., Hann, D., Ntoukakls, V., Petutschnig, E., Lipka, V., and Rathjen, J. (2009). AvrPtoB targets the LysM receptor kinase CERK1 to promote bacterial virulence on plants Current Biology 19 423 429. Glazebrook, J. (2005). Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu Rev Phytopathol 43, 205 227. Gomez Gomez, L., and Boller, T. (2000). FLS2: An LRR rece ptor like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Molecular Cell 5, 1003 1011. Grant, M., and Lamb, C. (2006). Systemic immunity. Curr Opin Plant Biol 9, 414 420. Grant, S.R., Fisher, E.J., Chang, J.H., Mole, B .M., and Dangl, J.L. (2006). Subterfuge and manipulation: type III effector proteins of phytopathogenic bacteria. Annu Rev Microbiol 60, 425 449. Greenberg, J.T., and Yao, N. (2004). The role and regulation of programmed cell death in plant pathogen intera ctions. Cell Microbiol 6, 201 211. Gu, K., Tian, D., Qiu, C., and Yin, Z. (2009). Transcription activator like type III effector AvrXa27 depends on OsTFIIAgamma5 for the activation of Xa27 transcription in rice that triggers disease resistance to Xanthomon as oryzae pv. oryzae Mol Plant Pathol 10, 829 835. Gu, K., Yang, B., Tian, D., Wu, L., Wang, D., Sreekala, C., Yang, F., Chu, Z., Wang, G.L., White, F.F., and Yin, Z. (2005). R gene expression induced by a type III effector triggers disease resistance in rice. Nature 435, 1122 1125. Gudesblat, G.E., Iusem, N.D., and Morris, P.C. (2007a). Guard cell specific inhibition of Arabidopsis MPK3 expression causes abnormal stomatal responses to abscisic acid and hydrogen peroxide. New Phytol 173, 713 721. Gudesblat G.E., Iusem, N.D., and Morris, P.C. (2007b). Arabidopsis MPK3, a Key Signalling Intermediate in Stomatal Function. Plant Signal Behav 2, 271 272.

PAGE 149

149 Hamel, L., Nicole, M., Sritubtim, S., Morency, M., Ellis, M., Ehlting, J., Beaudoin, N., Barbazuk, B., Kless ig, D., Lee, J., Martin, G., Mundy, J., Ohashi, Y., Scheel, D., Sheen, J., Xing, T., Zhang, S., Seguin, A., and Ellis, B. (2006). Ancient signals: comparative genomics of plant MAPK and MAPKK gene families. Trends in Plant Science 11 192 198. Hann, D.R., Gimenez Ibanez, S., and Rathjen, J.P. (2010). Bacterial virulence effectors and their activities. Current Opinion in Plant Biology 13, 388 393. Hauck, P., Thilmony, R., and He, S.Y. (2003). A Pseudomonas syringae type III effector suppresses cell wall base d extracellular defense in susceptible Arabidopsis plants. Proc Natl Acad Sci U S A 100, 8577 8582. He, P., Shan, L., Lin, N.C., Martin, G.B., Kemmerling, B., Nrnberger, T., and Sheen, J. (2006). Specific bacterial suppressors of MAMP signaling upstream o f MAPKKK in Arabidopsis innate immunity. Cell 125, 563 575. Heck, S., Grau, T., Buchala, A., Mtraux, J.P., and Nawrath, C. (2003). Genetic evidence that expression of NahG modifies defence pathways independent of salicylic acid biosynthesis in the Arabido psis Pseudomonas syringae pv. tomato interaction. Plant J 36, 342 352. Heese, A., Hann, D.R., Gimenez Ibanez, S., Jones, A.M.E., He, K., Li, J., Schroeder, J.I., Peck, S.C., and Rathjen, J.P. (2007). The receptor like kinase SERK3/BAK1 is a central regulat or of innate immunity in plants. Proc Natl Acad Sci U S A 104, 12217 12222. Heuer, H., Yin, Y.N., Xue, Q.Y., Smalla, K., and Guo, J.H. (2007). Repeat domain diversity of avrBs3 like genes in Ralstonia solanacearum strains and association with host preferen ces in the field. Appl Environ Microbiol 73, 4379 4384. Ichimura, K., Casais, C., Peck, S.C., Shinozaki, K., and Shirasu, K. (2006). MEKK1 is required for MPK4 activation and regulates tissue specific and temperature dependent cell death in Arabidopsis. J Biol Chem 281, 36969 36976. Ichimura, K., Mizoguchi, T., Irie, K., Morris, P., Giraudat, J., Matsumoto, K., and Shinozaki, K. (1998). Isolation of ATMEKK1 (a MAP kinase kinase kinase) interacting proteins and analysis of a MAP kinase cascade in Arabidopsis Biochem Biophys Res Commun 253, 532 543. Iyer, A.S., and McCouch, S.R. (2004). The rice bacterial blight resistance gene xa5 encodes a novel form of disease resistance. Mol Plant Microbe Interact 17, 1348 1354. Iyer Pascuzzi, A.S., and McCouch, S.R. (200 7). Recessive resistance genes and the Oryza sativa Xanthomonas oryzae pv. oryzae pathosystem. Mol Plant Microbe Interact 20, 731 739.

PAGE 150

150 Jha, G., Rajeshwari, R., and Sonti, R.V. (2007). Functional interplay between two Xanthomonas oryzae pv. oryzae secretion systems in modulating virulence on rice. Mol Plant Microbe Interact 20, 31 40. Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P., and Valent, B. (2000). Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. Emb o Journal 19, 4004 4014. Jones, J.D.G., and Dangl, J.L. (2006). The plant immune system. Nature 444, 323 329. Kay, S., Hahn, S., Marois, E., Hause, G., and Bonas, U. (2007). A bacterial effector acts as a plant transcription factor and induces a cell size regulator. Science 318, 648 651. Kemmerling, B., Schwedt, A., Rodriguez, P., Mazzotta, S., Frank, M., Qamar, S.A., Mengiste, T., Betsuyaku, S., Parker, J.E., Mssig, C., Thomma, B.P., Albrecht, C., de Vries, S.C., Hirt, H., and Nrnberger, T. (2007). The B RI1 associated kinase 1, BAK1, has a brassinolide independent role in plant cell death control. Curr Biol 17, 1116 1122. Kim, J.G., Park, D., Kim, B.C., Cho, S.W., Kim, Y.T., Park, Y.J., Cho, H.J., Park, H., Kim, K.B., Yoon, K.O., Park, S.J., Lee, B.M., an d Bhak, J. (2008). Predicting the interactome of Xanthomonas oryzae pathovar oryzae for target selection and DB service. BMC Bioinformatics 9, 41. Kishi Kaboshi, M., Okada, K., Kurimoto, L., Murakami, S., Umezawa, T., Shibuya, N., Yamane, H., Miyao, A., Ta katsuji, H., Takahashi, A., and Hirochika, H. (2010). A rice fungal MAMP responsive MAPK cascade regulates metabolic flow to antimicrobial metabolite synthesis. Plant J 63, 599 612. Kottapalli, K.R., Kottapalli, P., Agrawal, G.K., Kikuchi, S., and Rakwal, R. (2007). Recessive bacterial leaf blight resistance in rice: complexity, challenges and strategy. Biochem Biophys Res Commun 355, 295 301. Kunze, G., Zipfel, C., Robatzek, S., Niehaus, K., Boller, T., and Felix, G. (2004). The N terminus of bacterial elo ngation factor Tu elicits innate immunity in Arabidopsis plants. Plant Cell 16, 3496 3507. Kurosawa E. (1926). Experimental studies on the nature of the substance secreted by the "bakanae" fungus. Nat Hist Soc Formosa 16, 213 227. Lahaye, T., and Bonas, U. (2001). Molecular secrets of bacterial type III effector proteins. Trends Plant Sci 6, 479 485. Lampard, G.R., MacAlister, C.A., and Bergmann, D.C. (2008). Arabidopsis stomatal initiation is controlled by MAPK mediated regulatio n of the bHLH SPEECHLESS. Science 322, 1113 1116.

PAGE 151

151 Lee, S.W., Han, S.W., Bartley, L.E., and Ronald, P.C. (2006). From the a cademy: Colloquium review. Unique characteristics of X anthomonas oryzae pv. oryzae AvrXa21 and implications for plant innate immunity. Proc Natl Acad Sci U S A 103, 18395 18400. Lee, S.W., Han, S.W., Sririyanum, M., Park, C.J., Seo, Y.S., and Ronald, P.C. (2009). A type I secreted, sulfated peptide triggers X A21 mediated innate immunity. Science 326, 850 853. Lehti Shiu, M., Zou, C., Hanada, K., and Shiu, S. (2009). Evolutionary history and stress regulation of plant receptor like kinase/pelle genes Plant Physiology 150 12 26. Li J ., Jiang J ., Qian Q ., Xu Y ., Zhang C ., Xiao J ., Du C ., Luo W ., Zou G ., Chen M ., Huang Y ., Feng Y ., Cheng Z ., Yuan M ., Chong K (2011) Mutation of rice BC12/GDD1, which encodes a kinesin like protein that binds to a GA biosynthesis gene promoter, leads to dwarfism with impaired cell elongation. Plant Cell 23 628 6 40 L indgren, P., Peet, R., and Panopoulos, N. (1986). Gene cluster of pseudomonas syringae pv phaseolicola controls pathogenicity of bean plants and hypersensitivity on nonhost plants. Journal of Bacteriology 168 512 522. Ludwig, A.A., Saitoh, H., Felix, G., Freymark, G., Miersch, O., Wasternack, C., Boller, T., Jones, J.D.G., and Romeis, T. (2005). Ethylene mediated cross talk between calcium dependent protein kinase and MAPK signaling controls stress responses in plants. Proc Natl Acad Sci U S A 102, 10736 1 0741. Mackey, D., Holt, B.F., Wiig, A., and Dangl, J.L. (2002). RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1 mediated resistance in Arabidopsis. Cell 108, 743 754. Mackey, D., Belkhadir, Y., Alonso, J.M., Ec ker, J.R., and Dangl, J.L. (2003). Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2 mediated resistance. Cell 112, 379 389. Mahmood, T., Jan, A., Kakishima, M., and Komatsu, S. (2006). Proteomic analysis of bacteri al blight defense responsive proteins in rice leaf blades. Proteomics 6, 6053 6065. Marathe, R., and Dinesh Kumar, S.P. (2003). Plant defense: One post, multiple guards?! Molecular Cell 11, 284 286. Mark, M., E., L.J., Rebecca, N., and F., W.F. (1994). Ana lysis of the interaction between Xanthomonas oryzae pv. oryzae and rice cultivars IR24 and IRBB21 Phytop athology 84 392 397

PAGE 152

152 Marois, E., Van den Ackerveken, G., and Bonas, U. (2002). The X anthomonas type III effector protein AvrBs3 modulates plant gene e xpression and induces cell hypertrophy in the susceptible host. Mol Plant Microbe Interact 15, 637 646. Martin, G.B., Frary, A., Wu, T., Brommonschenkel, S., Chunwongse, J., Earle, E.D., and Tanksley, S.D. (1994). A member of the tomato Pto gene family con fers sensitivity to fenthion resulting in rapid cell death. Plant Cell 6, 1543 1552. Mew, T.W. (1987). Current status and future prospects of research on bacterial blight of rice Annual Review of Phytopathology 25, 359 382. Miao, Y., Laun, T.M., Smykowski A., and Zentgraf, U. (2007). Arabidopsis MEKK1 can take a short cut: it can directly interact with senescence related WRKY53 transcription factor on the protein level and can bind to its promoter. Plant Mol Biol 65, 63 76. Mucyn, T.S., Clemente, A., Andr iotis, V.M., Balmuth, A.L., Oldroyd, G.E., Staskawicz, B.J., and Rathjen, J.P. (2006). The tomato NBARC LRR protein Prf interacts with Pto kinase in vivo to regulate specific plant immunity. Plant Cell 18, 2792 2806. Nakagami, H., Soukupov, H., Schikora, A., Zrsk, V., and Hirt, H. (2006). A Mitogen activated protein kinase kinase kinase mediates reactive oxygen species homeostasis in Arabidopsis. J Biol Chem 281, 38697 38704. Nakashita, H., Yasuda, M., Nitta, T., Asami, T., Fujioka, S., Arai, Y., Sekimat a, K., Takatsuto, S., Yamaguchi, I., and Yoshida, S. (2003). Brassinosteroid functions in a broad range of disease resistance in tobacco and rice. Plant J 33, 887 898. Navarro, L., Bari, R., Achard, P., Lisn, P., Nemri, A., Harberd, N.P., and Jones, J.D. (2008). DELLAs control plant immune responses by modulating the balance of jasmonic acid and salicylic acid signaling. Curr Biol 18, 650 655. Navarro, L., Dunoyer, P., Jay, F., Arnold, B., Dharmasiri, N., Estelle, M., Voinnet, O., and Jones, J.D. (2006). A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 312, 436 439. Nimchuk, Z., Eulgem, T., Holt, B.F., and Dangl, J.L. (2003). Recognition and response in the plant immune system. Annu Rev Genet 37, 579 609. Nomura, K., Debroy, S., Lee, Y.H., Pumplin, N., Jones, J., and He, S.Y. (2006). A bacterial virulence protein suppresses host innate immunity to cause plant disease. Science 313, 220 223. Ntoukakis, V., Mucyn, T.S., Gimenez Ibanez, S., Chapman, H.C., Gutierrez, J. R., Balmuth, A.L., Jones, A.M., and Rathjen, J.P. (2009). Host inhibition of a bacterial virulence effector triggers immunity to infection. Science 324, 784 787.

PAGE 153

153 O u, SH. (1985). Rice Diseases. In Association Applied Biology Surrey, UK. Oh, H.S., and Collm er, A. (2005). Basal resistance against bacteria in Nicotiana benthamiana leaves is accompanied by reduced vascular staining and suppressed by multiple Pseudomonas syringae type III secretion system effector proteins. Plant J 44, 348 359. Paponov, I.A., Pa ponov, M., Teale, W., Menges, M., Chakrabortee, S., Murray, J.A., and Palme, K. (2008). Comprehensive transcriptome analysis of auxin responses in Arabidopsis. Mol Plant 1, 321 337. Park, C., Han, S., Chen, X., and Ronald, P. (2010a). Elucidation of XA21 m ediated innate immunity. Cell Microbiol 12, 1017 1025. Park, C.J., Bart, R., Chern, M., Canlas, P.E., Bai, W., and Ronald, P.C. (2010b). Overexpression of the endoplasmic reticulum chaperone BiP3 regulates XA21 mediated innate immunity in rice PLoS One 5, e9262. Park, C.J., Peng, Y., Chen, X., Dardick, C., Ruan, D., Bart, R., Canlas, P.E., and Ronald, P.C. (2008). Rice XB15, a protein phosphatase 2C, negatively regulates cell death and XA21 mediated innate immunity. PLoS Biol 6, e231. Park, C.J., Lee, S.W. Chern, M., Sharma, R., Canlas, P.E., Song, M.Y., Jeon, J.S., and Ronald, P.C. (2010c). Ectopic expression of rice Xa21 overcomes developmentally controlled resistance to Xanthomonas oryzae pv. oryzae Plant Sci 179, 466 471. Pedley, K.F., and Martin, G.B (2003). Molecular basis of Pto mediated resistance to bacterial speck disease in tomato. Annu Rev Phytopathol 41, 215 243. Peng, Y., Bartley, L.E., Chen, X., Dardick, C., Chern, M., Ruan, R., Canlas, P.E., and Ronald, P.C. (2008). OsWRKY62 is a negative regulator of basal and Xa21 mediated defense against Xanthomonas oryzae pv. oryzae in rice. Mol Plant 1, 446 458. Petersen, M., Brodersen, P., Naested, H., Andreasson, E., Lindhart, U., Johansen, B., Nielsen, H.B., Lacy, M., Austin, M.J., Parker, J.E., Sha rma, S.B., Klessig, D.F., Martienssen, R., Mattsson, O., Jensen, A.B., and Mundy, J. (2000). Arabidopsis MAP kinase 4 negatively regulates systemic acquired resistance. Cell 103, 1111 1120. Peterson, L.C., and Mills, W.R. (1953). Resistance of some America n varieties to late blight of potatos. American Potato Journal 30, 65 70. Pitzschke, A., Schikora, A., and Hirt, H. (2009a). MAPK cascade signalling networks in plant defence. Curr Opin Plant Biol 12, 421 426.

PAGE 154

154 Pitzschke, A., Djamei, A., Bitton, F., and Hir t, H. (2009b). A major role of the MEKK1 MKK1/2 MPK4 pathway in ROS signalling. Mol Plant 2, 120 137. Ponciano, G., Yoshikawa, M., Lee, J.L., Ronald, P.C., and Whalen, M.C. (2006). Pathogenesis related gene expression in rice is correlated with development ally controlled XA21 mediated resistance against Xanthomonas oryzae pv. oryzae Physiological and Molecular Plant Pathology 69, 131 139. Qiu, J.L., Fiil, B.K., Petersen, K., Nielsen, H.B., Botanga, C.J., Thorgrimsen, S., Palma, K., Suarez Rodriguez, M.C., Sandbech Clausen, S., Lichota, J., Brodersen, P., Grasser, K.D., Mattsson, O., Glazebrook, J., Mundy, J., and Petersen, M. (2008). Arabidopsis MAP kinase 4 regulates gene expression through transcription factor release in the nucleus. EMBO J 27, 2214 2221. Ray, S.K., Rajeshwari, R., and Sonti, R.V. (2000). Mutants of Xanthomonas oryzae pv. oryzae deficient in general secretory pathway are virulence deficient and unable to secrete xylanase. Mol Plant Microbe Interact 13, 394 401. Ren, D., Liu, Y., Yang, K.Y. Han, L., Mao, G., Glazebrook, J., and Zhang, S. (2008). A fungal responsive MAPK cascade regulates phytoalexin biosynthesis in Arabidopsis. Proc Natl Acad Sci U S A 105, 5638 5643. Robatzek, S., Chinchilla, D., and Boller, T. (2006). Ligand induced endoc ytosis of the pattern recognition receptor FLS2 in Arabidopsis. Genes Dev 20, 537 542. Robatzek, S., Bittel, P., Chinchilla, D., Kochner, P., Felix, G., Shiu, S.H., and Boller, T. (2007). Molecular identification and characterization of the tomato flagelli n receptor LeFLS2, an orthologue of Arabidopsis FLS2 exhibiting characteristically different perception specificities. Plant Molecular Biology 64, 539 547. Rodriguez, M.C., Petersen, M., and Mundy, J. (2010). Mitogen activated protein kinase signaling in p lants. Annu Rev Plant Biol 61, 621 649. Romeis, T., Piedras, P., Zhang, S., Klessig, D., Hirt, H., and Jones, J. (1999). Rapid Avr9 and Cf 9 dependent activation of MAP kinases in tobacco cell cultures and leaves: Convergence of resistance gene, elicitor, wound, and salicylate responses. Plant Cell 273 287. Romer, P., Hahn, S., Jordan, T., Strauss, T., Bonas, U., and Lahaye, T. (2007). Plant pathogen recognition mediated by promoter activation of the pepper Bs3 resistance gene. Science 318, 645 648. Roseb rock, T.R., Zeng, L.R., Brady, J.J., Abramovitch, R.B., Xiao, F.M., and Martin, G.B. (2007). A bacterial E3 ubiquitin ligase targets a host protein kinase to disrupt plant immunity. Nature 448, 370 U313.

PAGE 155

155 Rudd, J.J., Keon, J., and Hammond Kosack, K.E. (2008 ). The wheat mitogen activated protein kinases TaMPK3 and TaMPK6 are differentially regulated at multiple levels during compatible disease interactions with Mycosphaerella graminicola Plant Physiol 147, 802 815. Salzberg, S.L., Sommer, D.D., Schatz, M.C., Phillippy, A.M., Rabinowicz, P.D., Tsuge, S., Furutani, A., Ochiai, H., Delcher, A.L., Kelley, D., Madupu, R., Puiu, D., Radune, D., Shumway, M., Trapnell, C., Aparna, G., Jha, G., Pandey, A., Patil, P.B., Ishihara, H., Meyer, D.F., Szurek, B., Verdier, V ., Koebnik, R., Dow, J.M., Ryan, R.P., Hirata, H., Tsuyumu, S., Won Lee, S., Seo, Y.S., Sriariyanum, M., Ronald, P.C., Sonti, R.V., Van Sluys, M.A., Leach, J.E., White, F.F., and Bogdanove, A.J. (2008). Genome sequence and rapid evolution of the rice patho gen Xanthomonas oryzae pv. oryzae PXO99A. BMC Genomics 9, 204. Sasabe, M., Soyano, T., Takahashi, Y., Sonobe, S., Igarashi, H., Itoh, T.J., Hidaka, M., and Machida, Y. (2006). Phosphorylation of NtMAP65 1 by a MAP kinase down regulates its activity of micr otubule bundling and stimulates progression of cytokinesis of tobacco cells. Genes & Development 20, 1004 1014. Schornack, S., Minsavage, G.V., Stall, R.E., Jones, J.B., and Lahaye, T. (2008). Characterization of AvrHah1, a novel AvrBs3 like effector from Xanthomonas gardneri with virulence and avirulence activity. New Phytol 179, 546 556. Shan, L.B., He, P., Li, J.M., Heese, A., Peck, S.C., Nurnberger, T., Martin, G.B., and Sheen, J. (2008). Bacterial effectors target the common signaling partner BAK1 to d isrupt multiple MAMP receptor signaling complexes and impede plant immunity. Cell Host & Microbe 4, 17 27. Sheffield, J., Taylor, N., Fauquet, C., and Chen, S.X. (2006). The cassava ( Manihot esculenta Crantz) root proteome: Protein identification and diffe rential expression. Proteomics 6, 1588 1598. Shen, Y., and Ronald, P. (2002). Molecular determinants of disease and resistance in interactions of Xanthomonas oryzae pv. oryzae and rice. Microbes Infect 4, 1361 1367. Siemens, J., Keller, I., Sarx, J., Kunz, S., Schuller, A., Nagel, W., Schmlling, T., Parniske, M., and Ludwig Mller, J. (2006). Transcriptome analysis of Arabidopsis clubroots indicate a key role for cytokinins in disease development. Mol Plant Microbe Interact 19, 480 494. Silverman, P., Seskar, M., Kanter, D., Schweizer, P., Metraux, J.P., and Raskin, I. (1995). Salicylic Acid in Rice (Biosynthesis, Conjugation, and Possible Role). Plant Physiol 108, 633 639. Sinapidou, E., Williams, K., Nott, L., Bahkt, S., Tr, M., Crute, I., Bittner Eddy, P., and Beynon, J. (2004). Two TIR:NB:LRR genes are required to specify resistance to Peronospora parasitica isolate Cala2 in Arabidopsis. Plant J 38, 898 909.

PAGE 156

156 Song, C., and Yang, B. (2010). Mutagenesis of 18 type III effectors reveals v irulence function of XopZ(PXO99) in Xanthomonas oryzae pv. oryzae Mol Plant Microbe Interact 23, 893 902. Song, W.Y., Wang, G.L., Chen, L.L., Kim, H.S., Pi, L.Y., Holsten, T., Gardner, J., Wang, B., Zhai, W.X., Zhu, L.H., Fauquet, C., and Ronald, P. (1995 ). A receptor kinase like protein encoded by the rice disease resistance gene, Xa21 Science 270, 1804 1806. Stevens, R.B. (1960). Plant Pathology, an Advanced Treatise, Vol. 3. J.G. (N.Y.: Academic Press), pp. 357 429. Suarez Rodriguez, M.C., Adams Philli ps, L., Liu, Y., Wang, H., Su, S.H., Jester, P.J., Zhang, S., Bent, A.F., and Krysan, P.J. (2007). MEKK1 is required for flg22 induced MPK4 activation in Arabidopsis plants. Plant Physiol 143, 661 669. Sugio, A., Yang, B., Zhu, T., and White, F.F. (2007). Two type III effector genes of Xanthomonas oryzae pv. oryzae control the induction of the host genes OsTFIIAgamma1 and OsTFX1 during bacterial blight of rice. Proc Natl Acad Sci U S A 104, 10720 10725. Sun, W., Dunning, F., Pfund, C., Weingarten, R., and B ent, A. (2006). Within species flagellin polymorphism in Xanthomonas campestris pv campestris and its impact on elicitation of Arabidopsis FLAGELLIN SENSING2 dependent defenses. Plant Cell 18 764 779. Sun, X., Cao, Y., Yang, Z., Xu, C., Li, X., Wang, S., and Zhang, Q. (2004). Xa26 a gene conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase like protein. Plant J 37, 517 527. Swarup, S., Yang, Y., Kingsley, M.T., and Gabriel, D.W. (1992). An Xanthomonas citri pathog enicity gene, pthA pleiotropically encodes gratuitous avirulence on nonhosts. Mol Plant Microbe Interact 5, 204 213. Szurek, B., Marois, E., Bonas, U., and Van den Ackerveken, G. (2001). Eukaryotic features of the Xanthomonas type III effector AvrBs3: pro tein domains involved in transcriptional activation and the interaction with nuclear import receptors from pepper. Plant J 26, 523 534. Tanaka, N., Matsuoka, M., Kitano, H., Asano, T., Kaku, H., and Komatsu, S. (2006). gid1, a gibberellin insensitive dwarf mutant, shows altered regulation of probenazole inducible protein (PBZ1) in response to cold stress and pathogen attack. Plant Cell Environ 29, 619 631. Thomma, B.P., Nurnberger, T., and Joosten, M.H. (2011). Of pamps and effectors : The b lurred PTI ETI d i chotomy. Plant Cell 23, 4 15.

PAGE 157

157 Toh, S., Imamura, A., Watanabe, A., Nakabayashi, K., Okamoto, M., Jikumaru, Y., Hanada, A., Aso, Y., Ishiyama, K., Tamura, N., Iuchi, S., Kobayashi, M., Yamaguchi, S., Kamiya, Y., Nambara, E., and Kawakami, N. (2008). High tem perature induced abscisic acid biosynthesis and its role in the inhibition of gibberellin action in Arabidopsis seeds. Plant Physiol 146, 1368 1385. Tsuda, K., Sato, M., Stoddard, T., Glazebrook, J., and Katagiri, F. (2009). Network properties of robust im munity in plants. PLoS Genet 5, e1000772. van der Hoorn, R.A.L., and Kamoun, S. (2008). From Guard to Decoy: A new model for perception of plant pathogen effectors. Plant Cell 20, 2009 2017. van Wees, S.C., and Glazebrook, J. (2003). Loss of non host resis tance of Arabidopsis NahG to Pseudomonas syringae pv. phaseolicola is due to degradation products of salicylic acid. Plant J 33, 733 742. Wang, G.L., Song, W.Y., Ruan, D.L., Sideris, S., and Ronald, P.C. (1996). The cloned gene, Xa21 confers resistance to multiple Xanthomonas oryzae pv. oryzae isolates in transgenic plants. Mol Plant Microbe Interact 9, 850 855. Wang, G.L., Ruan, D.L., Song, W.Y., Sideris, S., Chen, L., Pi, L.Y., Zhang, S., Zhang, Z., Fauquet, C., Gaut, B.S., Whalen, M.C., and Ronald, P.C. (1998). Xa21D encodes a receptor like molecule with a leucine rich repeat domain that determines race specific recognition and is subject to adaptive evolution. Plant Cell 10, 765 779. Wang, H.C., Ngwenyama, N., Liu, Y.D., Walker, J.C., and Zhang, S.Q. (2 007). Stomatal development and patterning are regulated by environmentally responsive mitogen activated protein kinases in Arabidopsis. Plant Cell 19, 63 73. Wang, H.C., Liu, Y.D., Bruffett, K., Lee, J., Hause, G., Walker, J.C., and Zhang, S.Q. (2008). Hap lo insufficiency of MPK3 in MPK6 mutant background uncovers a novel function of these two MAPKs in Arabidopsis ovule development. Plant Cell 20, 602 613. Wang, Y., Bao, Z., Zhu, Y., and Hua, J. (2009). Analysis of temperature modulation of plant defense ag ainst biotrophic microbes. Mol Plant Microbe Interact 22, 498 506. Wang, Y.S., Pi, L.Y., Chen, X., Chakrabarty, P.K., Jiang, J., De Leon, A.L., Liu, G.Z., Li, L., Benny, U., Oard, J., Ronald, P.C., and Song, W.Y. (2006). Rice XA21 binding protein 3 is a ub iquitin ligase required for full Xa21 mediated disease resistance. Plant Cell 18, 3635 3646. Webb, K.M., Garcia, E., Cruz, C.M.V., and Leach, J.E. (2010a). Influence of rice development on the function of bacterial blight resistance genes. European Journal of Plant Pathology 128, 399 407.

PAGE 158

158 Webb, K.M., Ona, I., Bai, J., Garrett, K.A., Mew, T., Vera Cruz, C.M., and Leach, J.E. (2010b). A benefit of high temperature: increased effectiveness of a rice bacterial blight disease resistance gene. New Phytol 185, 568 576. Whalen, M. (2005). Host defence in a developmental context. Molecular Plant Pathology 6 347 360. White, F.F., and Yang, B. (2009). Host and pathogen factors controlling the rice Xanthomonas oryzae interaction. Plant Physiol 150, 1677 1686. White, F. F., Potnis, N., Jones, J.B., and Koebnik, R. (2009). The type III effectors of Xanthomonas Mol Plant Pathol 10, 749 766. Xiang, T.T., Zong, N., Zou, Y., Wu, Y., Zhang, J., Xing, W.M., Li, Y., Tang, X.Y., Zhu, L.H., Chai, J.J., and Zhou, J.M. (2008). Pseud omonas syringae effector AvrPto blocks innate immunity by targeting receptor kinases. Current Biology 18, 74 80. Xiang, Y., Cao, Y., Xu, C., Li, X., and Wang, S. (2006). Xa3 conferring resistance for rice bacterial blight and encoding a receptor kinase li ke protein, is the same as Xa26 Theor Appl Genet 113, 1347 1355. Xiong, L., and Yang, Y. (2003). Disease resistance and abiotic stress tolerance in rice are inversely modulated by an abscisic acid inducible mitogen activated protein kinase. Plant Cell 15, 745 759. Xu, W.H., Wang, Y.S., Liu, G.Z., Chen, X., Tinjuangjun, P., Pi, L.Y., and Song, W.Y. (2006). The autophosphorylated Ser686, Thr688, and Ser689 residues in the intracellular juxtamembrane domain of XA21 are implicated in stability control of rice receptor like kinase. Plant J 45, 740 751. Yang, B., and White, F.F. (2004). Diverse members of the AvrBs3/PthA family of type III effectors are major virulence determinants in bacterial blight disease of rice. Mol Plant Microbe Interact 17, 1192 1200. Yan g, B., Sugio, A., and White, F.F. (2006). Os8N3 is a host disease susceptibility gene for bacterial blight of rice. Proc Natl Acad Sci U S A 103, 10503 10508. Yang, B., Zhu, W., Johnson, L.B., and White, F.F. (2000). The virulence factor AvrXa7 of Xanthomo nas oryzae pv. oryzae is a type III secretion pathway dependent nuclear localized double stranded DNA binding protein. Proc Natl Acad Sci U S A 97, 9807 9812. Yang, D.L., Li, Q., Deng, Y.W., Lou, Y.G., Wang, M.Y., Zhou, G.X., Zhang, Y.Y., and He, Z.H. (200 8). Altered disease development in the eui mutants and Eui overexpressors indicates that gibberellins negatively regulate rice basal disease resistance. Mol Plant 1, 528 537.

PAGE 159

159 Yoshimura, S., Yamanouchi, U., Katayose, Y., Toki, S., Wang, Z.X., Kono, I., Kura ta, N., Yano, M., Iwata, N., and Sasaki, T. (1998). Expression of Xa1 a bacterial blight resistance gene in rice, is induced by bacterial inoculation. Proc Natl Acad Sci U S A 95, 1663 1668. Zhang, J., Shao, F., Li, Y., Cui, H., Chen, L., Li, H., Zou, Y., Long, C., Lan, L., Chai, J., Chen, S., Tang, X., and Zhou, J.M. (2007). A Pseudomonas syringae effector inactivates MAPKs to suppress PAMP induced immunity in plants. Cell Host Microbe 1, 175 185. Zhang, S., and Klessig, D. (2001). MAPK cascades in plant defense signaling. Trends in Plant Science 520 527. Zhang, T., Liu, Y., Yang, T., Zhang, L., Xu, S., Xue, L., and An, L. (2006). Diverse signals converge at MAPK cascades in plant. Plant Physiology and Biochemistry 274 283. Zhao, J., Fu, J., Li, X., Xu, C., and Wang, S. (2009). Dissection of the factors affecting development controlled and race specific disease resistance conferred by leucine rich repeat receptor kinase type R genes in rice. Theor Appl Genet 119, 231 239. Zhao, Y., Thilmony, R., Bender, C .L., Schaller, A., He, S.Y., and Howe, G.A. (2003). Virulence systems of Pseudomonas syringae pv. tomato promote bacterial speck disease in tomato by targeting the jasmonate signaling pathway. Plant J 36, 485 499. Zhou, C.J., Cai, Z.H., Guo, Y.F., and Gan, S.S. (2009). An arabidopsis Mitogen Activated Protein Kinase cascade MKK9 MPK6, plays a role in leaf senescence Plant Physiology 150, 167 177. Zhu, W., Yang, B., Chittoor, J.M., Johnson, L.B., and White, F.F. (1998). AvrXa10 contains an acidic transcrip tional activation domain in the functionally conserved C terminus. Mol Plant Microbe Interact 11, 824 832. Zhu, Y., Qian, W.Q., and Hua, J. (2010). Temperature modulates plant defense responses through NB LRR proteins. PLoS Pathogens e1000844. Zipfel, C., and Rathjen, J.P. (2008). Plant immunity: AvrPto targets the frontline. Current Biology 18, R218 R220. Zipfel, C., Robatzek, S., Navarro, L., Oakeley, E.J., Jones, J.D., Felix, G., and Boller, T. (2004). Bacterial disease resistance in Arabidopsis through flagellin perception. Nature 428, 764 767. Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J.D.G., Boller, T., and Felix, G. (2006). Perception of the bacterial PAMP EF Tu by the receptor EFR restricts Agrobacterium mediated transformation. Cel l 125, 749 760.

PAGE 160

160 BIOGRAPHICAL SKETCH Qiang Chen was born and raised in Shaoyang, Hunan, China. S he received her bachelor s degree in the Department of P lant P rotection from China Agricultural University. She received her in a join t program between China Agricultural University and Missouri State University. In 2007, Chen joined the D e partment of Plant Pathology for her Ph.D and successfully completed her program in August, 2011