Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2013-08-31.

MISSING IMAGE

Material Information

Title:
Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2013-08-31.
Physical Description:
Book
Language:
english
Creator:
Seo,Soo Jung
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Genetics (IDP)
Committee Chair:
Lewin, Alfred S
Committee Members:
Wallace, Margaret R
Hauswirth, William W
Grant, Maria A

Subjects

Subjects / Keywords:
Genetics (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility:
by Soo Jung Seo.
Thesis:
Thesis (Ph.D.)--University of Florida, 2011.
Local:
Adviser: Lewin, Alfred S.
Electronic Access:
INACCESSIBLE UNTIL 2013-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043263:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 GENE RATION OF A MOUSE MODEL OF AGE RELATED MACULAR DEGENERATION BY INDUCTION OF OXIDATIVE STRESS IN THE RETINAL PIGMENT EPITHELIUM By SOO JUNG SEO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FL ORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 Soo J ung Seo

PAGE 3

3 To my two Daniels, My husband Daniel J ames Gibson and my son Daniel E unseo Gibson

PAGE 4

4 ACKNOWLEDGMENTS I would like to give my appreciation to Dr. Alfred Lewin, for the understanding, patience, support and encouragement for my personal life and science. I would also like to thank all of my committe e members, Drs. William Hauswirth, Maria Grant and Peggy Wallace, f or their great guidance and advices. patience and guidance from all L ewin lab members. I would like to give special th anks to M andy C onners and K yle J ones who greatly hel ped me to finish my experiment s And to Mark Kreb s who helped me to interpret my data and gave me scientific advices. In addition, I thank Dr. Marina Gorbatyuk from whom I have learned a great deal about science and life. also got great friendship in the L A lison, Paulette Diego, Li and Haoyu, they are very good friend and coworker. from Dr. Issam Mc D oom with OCT Doug Smith with electron and fluorescent microscopy and Dr. Jian W en Liu for his help with sub retinal injection s I would like to give great appreciat ion to my husband, Dani el James Gibson for sharing tough time together while we raise our son during our P h.D work. He constantly encouraged and supported me to finish my dissertation and also gave me good scientific advices and ideas doing my project. A nd to my 3 year old, biggest son, Daniel Eunseo Gibson for tolerating difficult situations for his own and growing very well. My son gave me mental strength and energy to finish my Ph .D work. Finally, I would like to thank t o my parents, my mom and dad, for helping me raise my son and always pray for me and my family.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 15 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 17 Age Related Macular Degeneration ................................ ................................ ........ 17 Pathological Characteristics of AMD ................................ ................................ ....... 19 Drusen ................................ ................................ ................................ .............. 19 Lipofuscin and Subretinal Auto Fluorescence ................................ .................. 20 Risk Factors Leading to AMD ................................ ................................ ................. 21 RPE The Primary Site of AMD Pathology ................................ .............................. 24 Reactive Oxygen Species (ROS) ................................ ................................ ............ 26 Oxidative Stress and AMD ................................ ................................ ...................... 27 Animal Models for AMD ................................ ................................ .......................... 31 Antioxidants ................................ ................................ ................................ ............ 35 Cre Induced Recombination for Generating an Animal Model ................................ 36 Adeno Associated Virus as a Gene Delivery Tool ................................ .................. 38 Ribozymes ................................ ................................ ................................ .............. 40 Projects ................................ ................................ ................................ ................... 42 2 REDUCTION OF SOD2 IN THE RPE VIA SUBRETINAL INJECTION OF AAV1 VMD2 CRE INTO SOD2F/F MICE ................................ ................................ ......... 53 Opening Remarks ................................ ................................ ................................ ... 53 Materials and Methods ................................ ................................ ............................ 56 Experimental Animals ................................ ................................ ....................... 56 Injection of AAV Vectors ................................ ................................ ................... 56 Detection of Cre Expression ................................ ................................ ............. 57 Detection of Cre M ediated Recombination ................................ ....................... 58 Electroretinographic Analysis ................................ ................................ ........... 58 Electron Microscopy ................................ ................................ ......................... 59 Optical Coherence Topomology ................................ ................................ ....... 59 Results ................................ ................................ ................................ .................... 60 Expression of Cre Recombinase in the RPE ................................ .................... 60

PAGE 6

6 Subretinal Injection of VMD2 Cre AAV1 Leads to Recombination in the RPE ................................ ................................ ................................ ............... 60 Reduction of Electrophysiological Responses ................................ .................. 61 Measurement of ONL Thickness ................................ ................................ ...... 61 Assessment of Histological Changes ................................ ............................... 62 Ultrastructural Analysis of the Re tina ................................ ............................... 62 Concluding Statements ................................ ................................ ........................... 63 3 REDUCTION OF SOD2 IN THE RPE BY USING TET ON SYSTEM FOR CRE MEDIATED RECOMBINATION ................................ ................................ .............. 76 Opening Remarks ................................ ................................ ................................ ... 76 Materials and Methods ................................ ................................ ............................ 76 Animals ................................ ................................ ................................ ............. 76 Introduction with Doxycycline ................................ ................................ ........... 77 Screening for the Rd Allele ................................ ................................ ............... 78 Expression of Cre by Dox ycycline ................................ ................................ .... 78 Immunohistochemical Analysis of Cre Mediated Recombination by Doxycycline ................................ ................................ ................................ ... 79 Genomic DNA Analysis of SOD2 Recombinatio n by Cre ................................ 80 Measurement of MnSOD Levels ................................ ................................ ...... 80 Autofluorescence Analysis ................................ ................................ ............... 81 DHE Staining ................................ ................................ ................................ .... 81 RPE Flat Mount Morphological Analysis ................................ ........................... 82 Other Methods ................................ ................................ ................................ .. 82 Results ................................ ................................ ................................ .................... 82 ............... 82 MnSOD Level After Inducing Cre at Adult Stage ................................ .............. 83 Detection of Galactosidase Expression ................................ ......................... 84 Expression of Cre in VMD2 Cre Mice After Doxycycline Induction ................... 85 SOD2 Recombination Analysis by PCR Using Genomic DNA ......................... 85 Examination of Reduced Levels of SOD2 Protein by RPE Flat Mount ............. 86 Increased Levels of Oxidative Stress in VMD2 CreTg SOD2 fl/fl Mice in the RPE ................................ ................................ ................................ ............... 86 Morphological Changes of RPE ................................ ................................ ....... 87 OCT Measurement of ONL Thickness ................................ ............................. 87 Reduction of Electrophysiological Responses ................................ .................. 88 Increased Autofluore scence of RPE ................................ ................................ 88 Examination of the Fundus ................................ ................................ ............... 89 Histological Examination ................................ ................................ .................. 90 Ultrastructural Analysis of the Retina ................................ ............................... 90 Concluding Statements ................................ ................................ ........................... 90 4 REDUCTION OF MnSOD IN THE RPE BY SUBRETINAL INJECTION OF VMD2 RZ432 AAV1 ................................ ................................ .............................. 110 Opening Remarks ................................ ................................ ................................ 110

PAGE 7

7 Materials and Methods ................................ ................................ .......................... 111 Fluorescein Angiography ................................ ................................ ................ 111 AAV Injections ................................ ................................ ................................ 111 Fundus Analysis ................................ ................................ ............................. 112 Other Methods ................................ ................................ ................................ 112 Results ................................ ................................ ................................ .................. 112 Expression of Rz432 in the RPE ................................ ................................ .... 112 Reduction of Electrophysiological Responses ................................ ................ 113 Fundus Analysis ................................ ................................ ............................. 114 Examination of Retinal Vascular Changes ................................ ..................... 114 Examination of Retinas by OCT ................................ ................................ ..... 115 RPE Morphological Analysis ................................ ................................ .......... 115 Identification of In creased Expression of Complement Factors ...................... 116 Examination of Histological Damage of the Outer Retina ............................... 116 Ultrastructural Analysis o f the Outer Retina ................................ .................... 117 Concluding Statements ................................ ................................ ......................... 117 5 CONCLUSIONS ................................ ................................ ................................ ... 135 Summary ................................ ................................ ................................ .............. 135 Comparison to Other Animal Models of AMD ................................ ....................... 136 Future Studies ................................ ................................ ................................ ...... 137 Closing Remarks ................................ ................................ ................................ .. 140 LIST OF REFERENCES ................................ ................................ ............................. 142 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 164

PAGE 8

8 LIST OF TABLES Tabl e page 2 1 The deoxyribonucleic acid ( DNA ) oligonucleotides used for genotyping. ........... 66 2 2 The polymerase chain reaction ( PC R ) conditions used for genotyping. ............. 66 2 3 The DNA oligonucleotides used for genomic DNA PCR. ................................ .... 66 2 4 The PCR conditions for analyzi ng recombination of manganese superoxided dismutase ( MnSOD ) ................................ ................................ .......................... 66

PAGE 9

9 LIST OF FIGURES Figure page 1 1 The macula and fovea. ................................ ................................ ....................... 45 1 2 Changes i n the retina in dry and wet age related macular degeneration ( AMD ) ................................ ................................ ................................ ................ 46 1 3 Drusen formation ................................ ................................ ................................ 47 1 4 Development of a drusen map ................................ ................................ ........... 47 1 5 Loss of central vision in AMD ................................ ................................ ............ 48 1 6 A representation of disease prevalence with age ................................ ............... 49 1 7 Tetracycline mediated regulation of gene expression ................................ ........ 49 1 8 The unique microenvironment of the photoreceptor/ retin al pigment epithelium ( RPE ) complex. ................................ ................................ ................................ .. 50 1 9 Visual cycle ................................ ................................ ................................ ......... 51 1 10 The structure of the hammerhead ribozyme. ................................ ...................... 52 2 1 Genotyping results of superoxide dismutase 2 ( SOD2 ) fl/+ and SOD2 fl/fl .............. 67 2 2 The recombinant adeno associated virus ( AAV ) cassettes used ........................ 67 2 3 Localization of vitelliform macular degeneration 2 ( VMD2 ) Cre green fluorescent protein ( GFP ) expression at 6 weeks post injection. ........................ 68 2 4 Validation of VMD 2 Cre tissue specificity ................................ .......................... 69 2 5 Scotopic full field electroretinograms ( ERGs ) of SOD2 fl/fl mice injected with Cre or GFP control vector ................................ ................................ ................... 70 2 6 Measurement of the thickness of the outer nuclear layer (ONL) ........................ 71 2 7 Optical coherence tomography ( OCT ) measurement of ONL thickness ............ 72 2 8 Retinal morphology of SOD2 fl/fl mice injected with VMD2 Cre ........................... 72 2 9 Electron microscopic analysis of SOD2 fl/fl injected with VMD2 Cre AAV1 or VMD2 GFP AAV1 as a control. ................................ ................................ .......... 73 2 10 RPE light micrographs. ................................ ................................ ....................... 74

PAGE 10

10 2 11 nths after Cre injection. ................................ ................................ ................................ ....... 75 3 1 Regulated deletion of SOD2 ................................ ................................ ............... 96 3 2 Breeding scheme of VMD CreTg mice with SOD2 fl/fl mice ................................ .. 96 3 3 Screening for retinal degeneration ( rd ) mutant. ................................ .................. 97 3 4 Doxycycline toxicity was tested in 2 month old SOD2 fl/fl mice by administrati ng doxycycline ................................ ................................ .................. 97 3 5 Induction of Cre at 3 month does not lead to efficient reduction of SOD2. ......... 98 3 6 Cre mediated recombination was showed by immunostaining of galactosidase in the ROSA26:LacZ Cre mice ................................ .................... 98 3 7 Detection of galactosidase expression in the ROSA26 Cre mice .................... 99 3 8 Expression of Cre in VMD2 Cre mice after doxycycline induction .................... 100 3 9 SOD2 recombination analysis by polymerase chain reaction ( PCR ) using genomic deoxyribonucleic acid ( DNA ) ................................ ............................. 101 3 10 Cre mediated recombination in the SOD2 fl/fl VMD2Cre+ mice lead to reduction of manganse superoxide dismutase ( MnSOD ) protein levels in the RPE. ................................ ................................ ................................ ................. 102 3 11 Increased levels of dihydroethidium ( DHE ) in VMD2 CreTg SOD2 fl/fl mouse .. 102 3 12 Increased levels of 8 hydroxy 2 deoxyguanosine ( 8 OHdg ) in 2 month old VMD2 CreTg SOD2 fl/fl mice ................................ ................................ ............. 103 3 13 Change of RPE morphologies ................................ ................................ .......... 104 3 14 As SOD2 knockout mice age, the ONL thickness was progress ively decreased ................................ ................................ ................................ ......... 104 3 15 Scotopic full field ERGs of VMD2 CreTg SOD2 fl/fl mice with and without doxycycline administration ................................ ................................ ................ 105 3 16 Increased auto fluorescence in RPE of VM D2 CreTg SOD2 fl/fl ........................ 106 3 17 Funduscopic examination of 6 week old VMD2 CreTg SOD2 fl/fl mice. ............. 107 3 18 Light micrographs of retinas of VMD2 CreTg SOD2 fl/fl mice ............................. 108 3 19 Ultrastructure changes in the outer retina at 7 mon ths after doxycycline treatment ................................ ................................ ................................ .......... 109

PAGE 11

11 4 2 Expression of VMD2 ribozyme 432 ( Rz432 ) GFP in the RPE .......................... 123 4 3 Scotopic full field ERGs of C57BL/6 mice injected with AAV1 VMD2 Rz432 or GFP control vector ................................ ................................ ....................... 124 4 4 Funduscopic changes of Rz432 injected eyes ................................ ................. 125 4 5 To visualize the retinal vasculature, fluorescei n was injected intravenously into mice ................................ ................................ ................................ ........... 126 4 6 Foci of hyperfluorescence indicate RPE cell loss and retinal degeneration in scarring and atropic retinal lesions ................................ ................................ ... 127 4 7 By fundus microscope, atrophy like damaged retinal region was examined in Rz432 inject ed eye 15 months post injection ................................ ................... 128 4 8 Quantization of the thickness of the ONL ................................ ......................... 129 4 9 Thinning of ONL thickness as mice age measured by OCT. ............................ 130 4 10 RPE flat mount was examined for their morphology with zonula occludins 1 ( ZO 1 ) staining ................................ ................................ ................................ .. 131 4 11 Cryosections of Rz432 treatment were used for Immunostaining to examine levels of complement factors.. ................................ ................................ .......... 132 4 12 Light microscopic analysis of retin as treated with VMD2 Rz432 AAV1 ............ 133 4 13 Ultrastructure changes in the retina a t 8months after Rz432 treatment ............ 134

PAGE 12

12 LIST OF ABBREVIATION S 8 OHdG 8 hydr oxy 2 deoxyguanosine A2E P yridinium bis retinoid AAV Adeno a ssociated v irus AMD Age r e lated macular degeneration APOE Apolipoprotein E AREDS Age Related Eye Diseases Study ARMS2 A ge related maculopathy susceptibility 2 BEST1 B estrophin 1 BF F actor B BSA B ovine serum albumin C2 Complement component 2 Ccl 2 C hemokine ligand 2 CEP C arboxyethylpyrrole CFH C omplement factor H CMV C ytomegalovirus Ccr 2 C hemokine receptor 2Cc2 complement component 2 CNV Choroidal neovascularization DAPI 4' 6 Diamidino 2 phenylindole DHA D ocosahexanoic acid DHE D ihydroethidium DTT D ithiothreitol DUOX D ual oxidase EDCCS Eye Disease Case Control Study

PAGE 13

13 E GFP E nhanced green fluorescent protein EGTA E thylene glycol tetraacetic acid e YFP Enhanced yellow fluorescent protein ELOVL4 E longation of very long chain fatty acids 4 ERG E lectroretinogram GA G eographic atrophy GFP Green fluorescent protein H 2 O 2 H ydrogen peroxide HNE 4 hydroxy 2 nonenal INL I nner nuclear layer IS I nner segments ITRs I nverted terminal repeats MDA M alondialdehyde MSA M ouse S erum A lbumin NO N itric oxide NADPH N icotinamide adenine dinucleotide phosphate OCT O ptical coherence t omography ONL O uter nuclear la yer OH H ydroxyl radical ONOO P eroxynitrite anion ORF O pen reading frame OS O uter segments PBS P hosphate buffered saline

PAGE 14

14 PBST P hosphate buffered saline Tween 20 PFA P araformaldehyde POD H orseradish peroxidase PR P hotoreceptor PRSS11 High temperature requirement factor A1 PUFA Polyunsaturated fatty acid rtTA Reverse tetracycline controlled t ransactivator TGF Transforming growth factor RAP Retinal angiomatous proliferation RNS Reactive nitrogen species ROS Reactive oxygen s pecies RPE Retinal pigment epithelium SDS S odium dodecyl sulfate SNP Genome single nucleotide polymorphism SOD1 Cytoplasmic copper/zinc superoxide dismutase SOD2 M itochondrial manganese superoxide dismutase SOD3 E xtracellular iron superoxide dismuta se tetO T et racycline operon TetR Tetracycline repressor TIMP3 T issue inhibitor of metalloproteinase 3 VEGF Vascular endothelial growth factor VMD2 Vitelliform macular dystrophy 2 VLDLR Very low density lipoprotein receptor

PAGE 15

15 Abstract of Dissertation P resented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy GENE RATION OF A MOUSE MODEL OF AGE RELATED MACULAR DEGENERATION BY INDUCTION OF OXIDATIVE STRE SS IN THE RETINAL PIGMENT EPITHELIUM By Soo J ung Seo August 2011 Chair: Alfred S. Lewin Major: Medical Sciences Genetics Age related macular degeneration (AMD) is one of the most common irreversible causes of severe loss of vision in all developed co untries It gradually destroys the macula, which is the small portion of the central retina needed for seeing objects clearly for common daily tasks such as reading and driving. The pathophysiology of AMD is complex and includes genetic, environmental and immunological factors Oxidative stress in the retinal pigment epithelium (RPE) is hypothesized to be a major contributor to the development of age related macular degeneration (AMD). Mitochondrial manganese superoxide dismutase (MnSOD ) is a critical an tioxidant protein that scavenges the highly reactive superoxide radical. I propose that specific reduction of MnSOD in the RPE will increase the level of reactive oxygen species in the retina/RPE/choroid complex leading to pathogenesis of the early signs of AMD. Three different strategies for reducing MnSOD in the RPE were pursued. First, mice in which a critical exon of the SOD2 gene which encodes MnSOD, was flanked by loxP sites, floxed SOD2 mice, were subjected to a subretinal injection of a deno ass ociated virus (AAV) expressing the Cre recombinase gene using the RPE specific vitelliform macular degeneration 2 ( VMD2 ) promoter in order to stimulate recombination resulting in loss of

PAGE 16

16 functional MnSOD by deletion of exon 3. In the second approach, I sought disruptive recombination by breeding a tetracycline on ( Tet On ) VMD2 Cre mice with floxed SOD2 mice allowing induction of Cre expression, and thereby recombination, by the introduction of doxycycline to food. In the third approach, an SOD2 specific hammerhead ribozyme (Rz), again delivered by AAV and driven by the VMD2 promoter was injected subretinally into wild type C57 Bl/6 mice In all three approaches, reduction of MnSOD led to increased oxidative stress and significant changes in the histology of outer retina. These changes include thickening of Bruch s membrane, shortening of outer nuclear layer, mitochondrial abnormality and an increased level of lipofuscin Retinal function, as measure by electroretinography (ERG) was gradually diminished in the eyes in which SOD2 was deleted. In the Rz432 treated mice, leaking blood vessel s subretinal spots similar to drusen and retinal atrophy were observed by fundus microscopy. The specific reduction of MnSOD in the RPE led to increased oxidative st ress in the RPE and histological changes of retina similar to those seen in AMD. This is an RPE directed approach to model a disease that has been associated with oxidative stress in people. We plan to use these models to test both pharmacological and ge ne based treatments for dry AMD.

PAGE 17

17 CHAPTER 1 INTRODUCTION Age Related Macular Degeneration Age related macular degeneration (AMD) is the leading cause of legal blindness in the developed countries, affecting 10 20% of people over the age of sixty five 1 2 The prevalence of AMD is approximately 1.5% in individuals of European descent o ver the age of 50, and increas e s progressively with age, reaching approximately 10% in indivi duals aged 75 years or older 1 3 Because the p ercentage of older people is increasing in developed countries vision loss associated with AMD is expected to bec ome a major public health issue AMD affects the macula which is the region of the retina where the fovea resides The fovea is responsible for the sharp central, field of vision needed to read or to drive (Fig ure 1 1). Early AMD is characterized by the presence of light colored spots in the retina known as drusen Drusen are thought to indicate dysfunction of a monolayer of cells located behi nd the neural retina known as the retinal pigment epithelium (RPE). RPE cells progressively accumulate remnants of lysosomal bodies which give rise to highly auto fluorescent lipofuscin Increasing numbers of large drusen predispose to the development of two different pathways; dry AMD and neovascular or wet AMD (Fig ure 1 2) The number and density of RPE cel ls in the macula also decrease and there is thickening and loss of the normal archi tecture of Bruch's membrane Symptom s of earl y AMD start with blurred vision, decreased contrast sensitivity, abnormal dark adaptation and the need for brighter light or additional magnification to read As dry AMD progresses it enters a state of disease, known as geographic atrophy Geographic at rophy is characterized by RPE cell death accompanied by

PAGE 18

18 overlying photoreceptor atrophy. During geographic atrop hy the retina become s hyper pigmented and RPE hypertrophy and multinucleated giant cells are observed 4 Geographic atrophy leads to gradual loss of vision because photoreceptors overlying areas of RPE atrophy are metabolically dependent on RPE cells. In dry AMD, intense autofluorescence is seen at the border of geographic atrophy 5 Geographic atrophy is responsible for 20% of the legal blindness from AMD 6 Although development to neovascular AMD is not common (representing 10 15% of the overall prevalence of AMD), it is responsible for the majority of blindness resulting from AMD 7 8 I n advanced non ne ovascular AMD patient s a gradual vision loss develop s over months to years. However, in neovascular AMD patients, sudden vision loss within days to weeks occurs as a result of subretinal hemorrhage or fluid accumulation. N eovascular AMD begins with dama ge to the outer retina and RPE which recruit s inflammatory and angiogenic responses leading to neovascularization. There are two distinct types of neovascular AMD, choroidal neovascularization (CNV) and retinal angiomatous proliferation (RAP). In CNV, t here is an abnormal proliferation of choroidal vessels underneath the retina. CNV is associated with increased levels of vascular endothelium growth factor ( VEGF ) which stimulate endothelial cell proliferation and migration 9 During neovascular AMD, the subretinal RPE space is invaded by new blood vessels growing from the choriocapillaris can cause hemorrhages eventually form s a disciform scar. In RAP, the vas cular process originates within the neurosensory retina and form intraretinal neovascularization and retinal retinal anastomoses. With time, RAP merges with the choroidal circulation to form retinal choroidal anastomosis 10

PAGE 19

19 RAP is present in approximately 12% to 15% of patients with newly diagnosed neovascular AMD 11 It remains unanswered why some patients develop atrophic AMD while others develop the neovascular form of the disease. Several studies suggested that differences in the micr oenvironment created by senescent RPE cells, which secrete a number of cytokines and growth factors, might lead to choroidal neovacularization VEGF has been shown to play a pivotal role in the growth of the abnormal blood vessels characterizing the form of AMD 11 Increased VEGF gene expression stimulates angiog enesis and is su fficient for CNV development 12 13 Clinical studies showed that RPE cells in CNV membranes isolated from A MD patients had positive staining for VEGF 14 15 Therapeutic agents that block VEGF levels have proven to be successful in the inhibition of CNV and restoration of visual function which indicate the association of VEGF in the pathogenesis of CNV in wet AMD 16 Recently, Hinton, et al suggested that bone morphogen etic protein 4 ( BMP4 ) via oxidative stress induced RPE senescence, may be a molecular switch participating in the pathway decision that determines which form of late AMD develop 17 Pathological C haracteristics of AMD Drusen Drusen are the extra cellular accumulation of lipoproteinaceous material between membrane ( Figure 1 3) Bruch's membrane is comprised of the basement membrane of the RPE and the inner most layer of the choroid The presence of drusen on the fund us is a hallmark of the early stages of AMD. As the number and size of the drusen deposits increase they can result in damage to the RPE, inflammation and the expression and release of angiogenic cytokines such as VEGF 18

PAGE 20

20 Therefore, the presence of drusen i s considered a significant risk factor for the deve lopment AMD and vis ual deficit. Investigations into the composition of drusen deposits have revealed the presence of proteins with roles in immune modulation such as vitronectin and apolipoprotein E 19 20 Other components of drusen include acute phase proteins (C reactive protein, vitronectin, antichymotrypsin, amyloid P component, and fi brinogen), complement pathway components (C3, C5 and C5b 9 complex) complement inhibitor (clusterin), apolipoprotein B and E, mucopolysaccarides, lipids, mannose, and sialic acid 21 22 The composition of drusen suggest that the deposits are formed by and immune mediated process. The immune response is believed to be triggered when cellular debris derived from compromised RPE cells becomes sequestered between the RPE and Bruch s membrane. Failure to eliminate the entrapped material generates a local pro inflammatory signal that trigger s subsequent cascades includi ng local upregulation of cytokines, acute phase reactants, pro inflammatory mediators and activation of the complement cascade These stimulatory processes constitute nucleation site for drusen formation. And accumulation of these molecules may induce VEGF production by RPE cells thus possibly mediating the development of CNV 23 Lipofuscin and S ubretinal A uto F luorescence An essential function of RPE is the phagocytosis of constantly shed photoreceptor outer segment (OS) disks followed by the degradation and release of the completely degraded material at the basal cell side. Lipofuscin found within the RPE is composed of the incom pletely digested photorecep tor OS waste materials. These waste materials consist of lipid peroxides, proteins and a mixture of auto fl uorescent material s The

PAGE 21

21 materials comprising lipofuscin have been shown to be capable of generating a series of reactive oxygen species (ROS) incl uding singlet oxygen, hydrogen peroxide, and superoxide anions 24 25 With age lipofuscin accumulates in the lysosomal compartment and oxidative stress has been postulated in this process 26 27 Various t oxic molecules such as malondialdehyde (MDA), 4 hydroxynonenal (HNE) and advanced glycation end products (AGE s ) ,have been found within lipofuscin 28 One component of the autofluorescent mater ial found in lipofuscin is the pyridinium bis retinoid N retinylidene N retinylethanolamine ( A2E ) A2E is a lipophilic quaternary amine that forms from two molecules of all trans retinal and one molecule of phosphatidylethanolamine, both of which are comp onents of the outer segment membrane of photoreceptor. The accumulation of A2E slows phagolysosomal digestion of the OS and decreases the capacity of RPE to resist oxidative stress. Moreover, A2E levels affect mitochondrial oxidative phosphorylation and membrane potential and reduce intracellular antioxidant enzymes like superoxide dismutase ( SOD ) and catalase. A2E self regenerates singlet oxygen, forming A2E epoxide which damages deoxyribonucleic acid ( DNA ) The accumulation of lipofuscin has been show n to precede the death of photoreceptor cells and the deterioration of the RPE. Although no there is no direct evidence of causality, lipofuscin levels in RPE cells are correlated with histopathologic characteristics of macular AMD 29 30 and loss of photoreceptor cells 31 Risk F actors L eading to AMD AMD is a multifactorial disease in which both environmental and genetic factors contribute to disease initiation and progression As the name implies, AMD is close ly associated with advanced age (Fig ure 1 6 ) The pre valence of the early stage of AMD in people aged 43 54 years of age is 8% and increases dramatically to 30% among

PAGE 22

22 people 75 years or order. Similarly, the prevalence of the advanced stages of AMD increase s from 0.1% among people 43 to 54 years old up to 7 .1% among people 75 years or order 32 The incidence of AMD is more common in people with light pig mentation ( Caucasians ) than among darkly pi gmented people (black Africans) Differences in iris pigmentation and macular pigment are thought to contribute to the increased susceptibility among whites 33 Other risk factors include obesity, high d ietary intake of vegetable fat and low dietary intake of antioxidants and zinc 34 Epidemiological studies found that smoking and lifetime exposure to sunlight are also risk factors for AMD, and that both are related to oxida tive stress 35 Although the etiology of AMD is complex, the genetic risk factors are indicated by twin and family studies 36 39 Recent investigations sought to identify genetic risk factors related with the incidence of AMD. Among these, genes associated with the complement system have been reported to substantially increase the risk of AMD. The key finding was that a single nu cleotide polymorphism (SNP) variation in complement factor H ( CFH ) was correlated with the risk of developing AMD 40 42 Microarray based whole genome single nucleo tide polymorphism (SNP) genotyping technology using cases of individuals of northern European descent from the Age Related Eye Disease Study ( AREDS ) population revealed a polymorphism in CFH located within the chromosomal region 1q32 43 44 The polymorphism resulted in a change in CFH 402 encoding a tyrosine to a histidine (Y402H). This SNP codon chang e was found to increase the risk of AMD by a factor of 2.1 to 4.6 with one copy of the polymorphism. Complement factor H is a key inhibitor of the alternative complement pathway which acts both by increasing the decay of the alternative pathway C3 convert ase and by

PAGE 23

23 serving as a co factor for the proteolysis of C3b 45 Of additional interest is that environmental risk factors for AMD, such as smoking and influenc e the level of complement factors in serum. In addition to the CFH polymorphism, other gene loci have also been li nked to m o dified risk for AMD Variants encoding other regulatory proteins of the alternative pathway include factor B (BF) and complement c omponent 2 (C2) genes. Factor B and C2 are activators of the classical complement pathway and are located 500 base pairs apart on human chromosome 6q21. Two variants of BF include a lysine 9 to histidine (L9H) and arginine 32 to glutamate (R32Q). C 2 als o has two identified variants, encoding a glutamic acid 318 to aspartic acid (E318D) variant and a variant found in intron 10. The R32Q variant of BF and the variant in intron 10 of C2 have both been ntribute to reduce risk of AMD. This evidence of decreased risk of AMD concurrent with reduced activity of proteins with roles in the immune response further support the theory of AMD being immune mediated. Other polymorphisms localized within a region o f 10q26 have been demonstrated to account for a large part of the risk for AMD 46 47 There are at least thr ee genes associated within the 10q26 region which are known to be related with risk for AMD : Pleckstrin Homology Domain containing Protein Family A member 1 ( PLEKHA1 ) age related maculopathy susceptibility 2 ( LOC387715/ARMS2 ), and high temperature requir ement factor A1 ( HTRA1/PRSS11 ). LOC387715/ARMS2 encodes a hypothetical protein of unknown function. Rivera et al. found that the A69S single nucleotide

PAGE 24

24 polymorphism ( rs10490924 ) in exon 1 of the LOC387715/ARMS2 gene was the susceptibility allele of AMD 48 HTRA1 encodes a member of a family of serine proteases expressed in both mouse and human retinas 49 51 It regulate s the degradation of extracellular matrix proteoglycans and overexpression of HTRA1 may play a role in alter i ng the integrity of matrix, as seen in wet AMD. HTRA1 also binds and inhibits transforming growth factor (TGF ), an important regulator of extracellular matrix deposition and angiogenesis 52 I mmunohistochemistry analysis of Caucasian patients with wet AMD showed po sitive staining for HtrA1 in the drusen 53 A single nucleotide polymorphism ( rs11200638 ) in the promoter region of the HTRA1 gene was found to be significantly associated with susceptibility to AMD 53 55 RPE T he P rimary Site of A MD Pathology Several lines of evidence suggest that progressive dysfunction of the retinal pigment epithelium ( RPE ) is central to the pathogenesis of age related macular degeneration ( AMD ) 56 57 The RPE is a monolayer of pigmented cells surrounded retina from the choriocapillaris. The RPE plays an important role in maintaining the health of the retina by controlling fluid, nutrient, and waste transport between the choroid and the retina. RPE cells make extensive contacts with the outer segments of the photoreceptors. T hrough the se association s, the RPE cells exchange photopigments with, uptake metabolic wastes from, and transfer nutrients to the photoreceptors. A key exchange between the RPE cells and the photoreceptors is a

PAGE 25

25 specialized form of phagocytosis in which the distal e nds of photoreceptor outer segments are pinched off, engulfed, and metabolized on a daily basi s This daily exchange is essential to the renewal and continued health and function of the photoreceptors. Furthermore, RPE plays key roles in maintaining the integrity of the retina which include absorption of light and protection against photo oxidation, re isomerization of all trans retinal into 11 cis retinal ( Figure 1 9 ) and secretion of various essential factors for the structure of the retina. RPE also s tabilizes ion composition in the subretinal space, which is important for the maintenance of photoreceptor excitability With these different complex functions, the RPE is essential for visual function of photoreceptor. Since t he function and metabolism of photoreceptors closely depend on the integrity of the retinal pigment epithelium, d ysfunction of the retinal pigment epithelium can lead to photoreceptor degeneration and can contribute to the loss of vision, as is also seen in the age related macular d egeneration 58 Age related alterations in retinal pigment epithelial (RPE) pigmentation 59 may result in increased photo oxidative stress and subsequent loss of both RPE and photoreceptor c ells 60 Reduction in the density of RPE cells, accumulation of lipofuscin in the retinal pigment epithelium and the failure of outer segment phagocytosis by the RPE may contribute to inherited retinal degenerations and are suggested to be involved in the pat hogenesis of ag e related macular degeneration. Recently, clinical data suggested linear relationship between RPE atrophy and loss of choriocapillaris in g eographic atr ophy (GA) form of AMD patients. An inbred rat strain with known sensitivity to oxidativ e stress ( OXY S rats ) has been demonstrated to have a dysfunctional RPE with several AMD like phenotypes

PAGE 26

26 including accumulation of lipofuscin, reduction of electroretinography (ERG) and ultrastructural changes 61 There is increasing evidence to support a role for mitochondrial damage and dysfunction in AMD 62 Pathological changes of mitochondria including great mitochondrial DNA ( mtDNA ) damage and reduced repair capacity was RPE and AMD 63 64 Reactive O xygen S pecies (ROS ) ROS are highly reactive molecules which can lead to oxidative damage of proteins, nucleic acids and lipids. ROS includes free radicals such as the superoxide anion ( O 2 ), the hydroxyl radical (OH ), peroxynitrite anion (ONOO ) hydroperoxyl radical (HO), peroxyl radical (ROO ) and alkoxyl radical (RO ), as well as oxygen species such as singlet oxyg en ( 1 O 2 ), and strong oxdizing agents like hydrogen peroxide ( H 2 O 2 ) 65 ROS within the body are formed as normal processes, including glycolysis and the Krebs cycle. ROS are generated in multiple compartments and by mult iple enzymes which includes proteins within the plasma membrane, such as nicotinamide adenine dinucleotide phosphate ( NADPH ) oxidases, and dual oxidase (DUOX) 66 oxygen metabolism in peroxisomes by various of enzymes 67 and endoplasmic reticular enzymes such as cyclooxygenases. ROS are also formed by the immune system such as phagocyte NADPH ox idase (NOX2) complex to defend against invading pathogens However, mitochondria contribute to the vast majority of cellular ROS (at approximately 90%). M itochondrial ROS generation is a consequence of oxidative phosphorylation, which electrons leak from complexes I and III resulting the formation of O 2 68 The O 2 acts as a precursor to several other ROS For example, O 2 reacts with NO to generate ONOO that can cause

PAGE 27

27 lipid peroxidation 69 Superoxide ( O 2 ) can also be converted into H 2 O 2 by SOD via dismutation reaction. Hydrogen peroxide can generate highly reactive OH via the Fenton reaction. Hydrogen peroxide and ONOO are highly diffusible through the mitochondrial membrane, which allows further oxidative reactions with other cellular compartments 70 Superoxide ( O 2 ) damage to Fe S centers of mitochondrial subunits of complexes I, II and III as well as aconitase which initiate a mitochondrial bioenergetics crisis. Furthermore, mtDNA is highly susceptible t o oxidative damage, as it is not protected by histones, and is more prone to errors in replication owing to a less effective repair system than that for nuclear DNA 71 Reactive oxygen damage result s in point mutations and deletions to mt DNA. Reactive oxygen species can also damage lipid s by a lipid peroxidation process. Most of cell membranes are composed of polyunsaturated fatty acids (PUFAs). Since they carry highly react ive hydrogen atoms, these oxidi z ed lipids can cause further damage by combining with other molecules, leading to modifi cation of their function 72 73 Other sources of ROS include environmental factors such as sun light exposure, pollution and tobacc o. Particularly the eye is exposed to the damaging effects of light. Oxidative S tress and AMD Se veral experimental and clinical findings have indicate d that oxidative mechanisms co ntribute to the initiation and progression of AMD 21 74 The Age Related Eye Disease Study (AREDS) confirmed that antioxidants (plus zinc) can reduce the risk of developing advanced AMD The retina and pigmented epithelium are tissue that are unique in the body in that they are co nstantly exposed to both light energy and to high oxygen concentrations, both of which are potent source of free radicals ( Figure 1 8 ) Additionally, the retina contains high levels of polyunsaturated fats (PUFAs) such as

PAGE 28

28 docosahexaenoate (DHA). Under con ditions of high oxidative stress, PUFAs are susceptible to oxidation and the resulting lipid peroxidation products are toxic to the retina. Carboxyethylpyrrole (CEP) is an example of toxic lipid peroxidation product that is produced by the oxidation of DH A containing phospholipids. CEP has its toxic effect by forming adducts with proteins which then accumulate in the outer retina and in the drusen from AMD affected patients 21 Further evidence for the presence of CEP adducted proteins in the retina is provided by the Hollyfield group which has found that mice immunized with CEP adducted albumin membrane, develop drusenoid chan ges under the RPE and also develop RPE atrophic like change s 75 76 Another reactive oxygen protein m odification includes c arboxymethyl l ysine, which is a product of lipoprotein peroxidation or seq uential oxidation and glycation. Carboxymethly lysine has also been found in drusen deposit s 21 77 O xidative stress related modifications have been found in specific proteins as well, including modifi cations to tissue inhibitor of metalloproteinases 3 ( TIMP 3 ) an d vitronectin both of which have also been found within drusen deposits 21 The high oxidative stress within the retina can create toxic oxidative modifications to macromolecules found in the retina. Healthy retinas appear to be able to handle the oxidative stress without disease. However, as people get older, there is a reduction in antioxidative enzymes and macular pigment density in the RPE both of which are key mechanisms for coping with oxidative stress. Of primary importance is the decrease in RPE pigment, which function s both as a filter for ROS generating short wavelength light and as a direct antioxidant through its two major c arotenoids, lute in and zea xanthin 78 The carotenoids have their antioxidant effect primarily by scavenging singlet oxygen

PAGE 29

29 and to a lesser extent by quench ing the triplet state of photosen sitizers and by delay ing the peroxidation of membrane phospholipids 79 80 R esults from the Age Related Eye Di sease Study demonstrate an advantageous effect of high doses of antioxidants (vitamin C, vitamin E, c arotene ) in preventing the progression from early stage to late stage AMD 81 P hagocytic process of the RPE generates reactive oxygen species through the NADPH oxida se system. Reduction in levels of the NADPH oxidase subunit p22phox, reduces choroidal neovascularization in the laser induced model of CNV 82 Increased levels of ROS induces RPE apoptosis through loss of mitochondrial membrane potential, cytochrome c release and caspase activation. Reactive oxygen species damage have been implicated to increase the expression of connective tissue growth factor, plasminogen activa tor inhibitor 1, collagen type IV and fibronectin in RPE cells AMD 83 Systemi c levels of protein carbonyl, 8 hydroxyl 2 deoxyguanosine and total oxidation state were found to be increased in the wet AMD affected patients compared with health controls Several clinical studies have shown that mitochondrial dysfunction is associated with pathogenesis of AMD. In the eyes of AMD patie n ts, a significant decrease in the number and area of RPE mitochondria was found 84 In addition, changes of s everal mitochondrial proteins involved in mitochondrial translation, import of nuclear encoded proteins, and adenosine triphosphate ( ATP ) synthase activity ha ve been identified in AMD patient s 85 By the fact that mitochondria produce the majority of endogenously formed ROS in most cells and consistent with these data that the mitochondria contribute to cellular degeneration leading to AMD, oxidative damage

PAGE 30

30 cou ld be the main factor in pathogenesis of AMD. Iron, which is a generator of oxidative damage, has been suggested as a potent factor for exacerbating AMD 86 Mice with retinal iron overload resulting from knockout of ceruloplasmin and its homologue he phaest in exhibit retinal degeneration with some features of AMD 87 Smoking, a common mechanism for generating oxidative stress, has been implicated as a major risk factor for AMD such that smoking nearly triples AMD incidence 88 89 C igarette smoke is a comp lex mixture of more than 5,000 chemicals, in which individual components of cigarette smoke have been shown to induce oxidative stress in RPE 90 91 Smoking is an important chronic contributor to nitric oxide ( NO ) exposure 89 92 Patients with AMD have signi fi cantly higher plasma NO levels than control subjects 93 Nitric oxide itself is a relatively unreactive radical H owever, it is able to form other reactive intermediates including nitrite (NO2 ), peroxynitrite (ONO O ), NO 2 and N 2 O 3 that can modify proteins, lipids and other compounds. Nitrite is one of the major NO metabolic products and has been used as a marker of NO production 94 95 In addition to ROS generation, smoking depletes plasma antioxidant levels and macular pigment 96 Loss of RPE cells due to oxidative damage caused by cigarette smoke exposure contribute s to AMD pathogenesis 97 98 Fujihara et al, has shown that in a mouse model with cigarette smoke exposure, there were increased oxidative damage with ultrastructural de generation to the RPE and Bruch membrane, and RPE cell apoptosis 99 The role of oxidative stress in AMD pathogenesis has been examined by generating transgenic mice targeting superoxide dismutase enzymes Imamura et al. showed that Sod1 / mice have accelerated age related pathologic changes in the retina

PAGE 31

31 including drusen, thickening of Bruch's membrane, and CNV 100 These pathological changes were seen after 7 months of age and it progressed as mi ce got older Justilien et al. utilized AAV ribozyme mediated knockdown of S od 2 in the RPE of wild type mice. The Sod2 knockdown mice had RPE and Bruch's membrane changes and accumulated A2E and lipofuscin granules in the RPE 101 Animal Models for AMD Although mouse does not have a macula, mouse models for AMD provide vast amounts of information which help s with the understanding of human AMD. T he genes rel evant to disease found in AMD mouse model have provided genetic information about corresponding human disease, and the physiological processes of mouse model has been found in human disease. A number of candidate genes that are suspected to be involved in AMD pathogenesis have been manipulated and showed pathological phenotypes relevant to AMD. These mouse models show some of the key pathological events seen in human AMD such as drusen formation, lipofuscin and thickened Bruch s membrane. For example in mice with a mutation in the e longation of very long chain fatty acids 4 ( ELOV L4 ) protein increased lipofuscin accumulation has been found 102 ELOVL 4 is involved in the elongation of very long chain fatty acids and mutations in ELOVL4 were sh own to be asso c iated with Stargardt like macular degeneration ( STGD ) and autosomal dominant macular degeneratio n 103 Transgenic mice expressing mutant form of human ELOVL4 develop vacuolization in the RPE, undigested outer segments in the subretinal space and pigment granule deposits formation at two months of age. In the tissue in hibitor of metalloproteinase 3 knock in mouse ( Timp3 S156C/S156C ) and the apolipoprotein E knock out mouse ( ApoE / ) the presence of basal laminar deposit s was observed 104 T issue i nhibitor of metalloproteinase 3 was observed in the outer

PAGE 32

32 aspect of basal lamina and linear deposits (BLD) in CNV patients 105 A p oint mutation in TIMP3 was found in Sorsby fundus dystrophy (SFD) patients. In the Timp3 + /S156C mice local disorientation of the RPE apical processes and reduced thickness of basal microvilli has been reported. Apolipoprotein E (apoE ) is th e major apolipoprotein of the central nervous system ( CNS ) and liver and an important regulator of cholesterol and lipid transport. Epidemiological studies have addressed the association between variants of APOE gene and AMD. There have been reported a p rotective effect for AMD in APOE 4 carriers and a detrimental effect in APOE 2 carriers 106 107 The AMD an imal model which was created by combining three established AMD risk factors ( advanced age, a high fat cholest erol rich diet and apo E knock in ) showed retinal degeneration with the hallmarks of AMD 108 The AMD associated pathologies documented in this animal model include sub retinal and c horoidal neovascularization. Based on the evidence indicating the involvement of immunological processes in AMD pathology, several studies have demonstrated the association between single nucleotide polymorphisms ( SNPs ) in genes encoding immunologic molecules and AMD. In particular, CX3CR1, the specific receptor for Cx 3CL1 chemokine, was decreased in the AMD macula compa red with the macula of normal eyes and the SNPs in CX3CR1 gene are associated with AMD 109 The other importa nt factor involved in immunologic response leading to AMD pathogenesis is CCL2 (MCP 1, a CC chemokine). It plays a role in homeostatic, immunoregulatory pathway in AMD pathogenesis 110 AMD mouse model deficient in both Cx3Cr1 and Ccl2 showed typical pathologic feature s of AMD

PAGE 33

33 including choroidal neovascularization, elevations of A2E in the RPE, enhanced expression of CD46 and microglia and degeneration of retina 111 However, Ccl2 / Cx3cr1 mice were generated by systemic deletion of two important factors involved in immune response. The phenotypes seen in Ccl2 / Cx3cr1 mice might be generic consequences of dy sregulation of immune system. AMD is closely related with advanc e age. In Ccl2 / Cx3cr1 mice the AMD like phenotypes were seen early in their life span. Therefore, Ccl2 / Cx3cr1 mice might be not a good AMD model. Some animal models have been made by environmental stimulation such as high fat diet, exposu re of smoking, and intensive light. Mice which were exposed to cigarette smoke showed drusen like material on Bruch s membrane 112 The APO B100 mouse, when combined with a high fat diet and blue/green light exposure, showed the presence of basal linear deposits 113 As shown above, some animals present one or more of the features of early AMD, but do not progress to the adv anced stages of dry or wet AMD. The animal models which progress to dry form of AMD includes mcd/ mcd transgenic mouse 114 and C57BL/6J mice with mouse serum albumin (MSA) adducted with CEP 76 There a re several mouse models which exhibit the wet form of AMD including: Ccd2 / 23 115 Cp / Heph /y 116 rho/rt TRE/VEGF and IRBP/rtTA TRE/VEGF 117 m ouse models. As mention ed above, dysregulati on of complement pathway has been implicated in the pathogenesis of AMD. Based on this fact AMD mouse models with mani pulated complement factors have been generated. For example, chimeric complement factor H ( Cfh ) transgenic mouse l ines which utilize human CFH sequence (with either 402Y or 402H) led to AMD like characteristics such as subretinal drusen like deposits, increased

PAGE 34

34 numbers of lipofuscin granules and C3d stainig in sub RPE region 118 The role of CFH in relation to AMD has also been analyzed by generating CFH deficient mice 119 Complement factor H defici ent mice exh ibited reduced visual acuity, an increase in autofluorescent subretinal deposits and accumulation of complement C3 in the retina ; all of which suggest s that CFH dysfunction might lea d to retinal changes such consistent with the symptoms of AMD. In addition to the genetic models, there are also well established physical methods for creating exudative AMD animal model s, including the use of light or lasers to induce choroidal neovascul arization (CNV). In human AMD, exposure to light is reported in epidemiological studies to be a risk factor. Excessive amounts of light energy produces photochemical damage to retinal neurosensory cells by generating ROS which consequently leads to oxidat ive damage to the cells in the retina Long term light induced ROS damage to B ruch membrane can stimulate CNV by fostering a proangiogenic environment in the retina. As a model for exudative AMD, light damage was induced by exposing albino mice to 1000 lux of white light 120 Laser photocoagulation ablates the photoreceptor outer segments, RPE, choriocapillaris and portions of the anterior choroid. Follow ing laser induced damage, fibroblasts proliferate and the RPE and vascular endothelial cells form a neovascular lesion. To induce choroidal neovascularization, a laser is used to burn a region between retinal vessels around the optic nerve head 121 122 Because newly formed vessels are more permeable, neovascular development can be monitored with fluorescein an giography to assess vessel leakage. By this criteria, choroidal neovascularization peaks at approximately 2 to 4 weeks after laser burn.

PAGE 35

35 Antioxidants Oxidative stress (OS) results when production of reactive oxidative species exceeds the capacity of cellu lar antioxidant defenses to remove these toxic species Mitochondria are the primary site of oxygen consumption and the major source of reactive oxygen species most of them originating from the mitochondrial respiratory chain. While uncontrolled ROS can damage many cellular process and functions, there exists a protective systems of antioxidants which can neutralize the damaging effects of ROS. This system includes a wide range of enzymes such as s uperoxide dismutases ( SOD s) glutathione peroxidase (GPX) catalase, peroxiredoxin and thioredoxin, as well as non enzymatic compounds, such as vitamin C,vitamin E and the carotenoids 123 126 The s uperoxide dismutases are the primary ROS scavenging enzymes of the cell 127 The SODs catalyze the dismutation of superoxide radicals to hydrogen peroxide and molecular oxygen There are three forms of SODs; copper/zinc dependent SOD (SOD1) in the cytosol, manganese dependent SOD ( MnSOD or SOD2) in the mitochondrial matrix, and extra cellular SOD ( SOD3) Among the three SOD isoforms, MnSOD is the only SOD that has been demonstrated to be essential for the survival of aerobic organisms 128 Glutat hione peroxidase is other key enzymes engaged in the detoxification of ROS. The GPX peroxidase activity is responsible for reduc ing lipid hydroperoxides and hydrogen peroxide. Glutathione peroxidase exist in two forms Glutathione peroxidase 1 (GPX1) is the major isoform and localized primarily in the cytosol, with small fraction also present in the mitochondrial matrix The other form is known as p hospholipid hydroperoxide GPX (PHGPx) and it is localized primarily in the inner membrane of

PAGE 36

36 mitochondria 129 130 These enzymes use reduced glutathione (GSH) to reduce hydrogen peroxide to water with the fo rmation of glutathione disulfide (GSSG). Another enzyme which detoxifies hydrogen peroxide is p eroxiredoxin (PRX) which catalyzes the reduction of hydrogen peroxide to water using thioredoxin as a reducing agent. Two forms of PRX are found in mitochondr ia (PRX III and PRX V), 131 and both forms of PRX are found in the mitochondrial matrix. Catalases are heme containing enzymes that convert hydrogen peroxide (H 2 O 2 ) to water and O 2 and they are mostly localized in peroxisomes, mitochondria and the endoplasmic reticulum. Non enzymatic antioxidants such as carotene, vitamin C and vitamin E come from the diet or from dietary supplement s Vitamin C is wat er soluble molecule and potent scavenging agents in the aqueous phase of the cytoplasm Beta carotene and vitamin E are lipid soluble molecules and act as antioxidants within lipid environments. In the eye, the macula accumulates unusual carotenoids, zeaxanthin and lutein. These compounds give the macula it characteristic yellow color and provide antioxidant defense as well as shielding from blue light 132 Cre I nduced R ecombination for G enerating an A nimal M odel T ransgenic mice which harbor altered genomic loci or foreign transgenes have provided important inform ation about many biological processes. However, not all biological processes can be studied by gene knock out or transgene expression strategies due to the embryonic lethal phenotypes To overcome these problems, mouse genetics were developed to manipula te specific genes so that gene s can be switched in time and tissue specific manner. The earliest attempts to develop such genetic systems used a single transgenes with inducible promoters. However, this

PAGE 37

37 approach gave rise to undesirable results such as l eakiness and pleiotropic effect 133 T o imp rove these problems, binary transgenic system, in which gene expression is controlled by the interaction of effector and target transgene, was developed. The most widely used binary transcription transactivation systems are the tetracycline dependent reg ulatory systems ( Figure 1 7 ) The effector is a fusion of sequences that encode the VP16 transactivation domain and the E.coli tetracycline repressor (TetR) protein. VP16 is known to be an exceptionally strong transcriptional activator that functions in m any cellular environments These fusion proteins bind to the operator sequences ( tet O) of the tet operon in a tetracycline dependent manner. There are two versions of this system ; tet racycline off ( tet off ) and tet racycline on ( tet on ) system s In the te t off system, the tetracyclin e controlled transactivator can not bind DNA when tetracycline (or an analog like doxycycline) is present, whereas in a tet on system, reverse tTA (rtTA) binds DNA only when tetracycline is present. The usage of the rtTA system results in tighter control of cre e x pression when compared with the tTA system 134 The inducer currently used in transgenic mice is doxycycline (Dox) which penet rates various tissues, crosses the placenta and the blood brain barrier, and can be found in the milk of feeding mothers. Various routes by which Dox can be administered are used such as injection, food and drinking water. There are two commonly used si te specific recombinases, Cre from bacteriophage P1 135 and Flp from s accharomyces cerevisiae 136 Both recombinases catalyse a recombination event between two 34 base pair recognition sites (loxP and FRT, respectively) which have different DNA sequence s but th e secondary structure. To manipulate an endogenous gene in a temporally and spatially controlled manner, an

PAGE 38

38 essential region of a target gene is flanked by loxP site ( floxed ) so that tissue specific C re expression results in the inactivation of this alle le. By crossing a mouse line which has a floxed gene of interest to an effector mouse line that expresses cre in a tissue specific manner results in the specific gene being inactivated in the desired tissue To prove the tissue specific Cre mediated gene inactivation, reporter mice in which a histological marker can be activated by C re mediated recombination, are used. The reporter mice have gene s which can be activated following Cre mediated recombination to remove a pre mature stop codon. The reporter mouse constructs can employ reporter enzymes such as galactosidase 137 or fluorescent proteins such as enhanced yellow fluorescent protein (e YFP) or enhanced green fluorescent protein ( e GFP) 138 Another approach for achievin g temporal control of C re mediated recombination is the use of viral vectors, such as adenovirus 139 140 or herpes simplex to deliver C re 141 By virus mediated transfer of C re targeted gene inactivation can be achieved without the need for crossbreeding the loxP gene altered mice with transgenic mouse expressing C re recombinase. Furthermore, for inactivating genes specifically in the eye regions, one eye can serve as a control as the other eye can be injected with C re so that genetic variations can be avoided. Adeno Associated Virus as a G ene D elivery T ool Adeno a ssociated v irus (AAV) is a small, non enveloped virus that packages a single stranded DNA genom e. It is a member of the Parvoviradae family 142 and is classified as the genus Dependovirus because infection by AAV require s a helper virus. In the presence of a helper virus, AAV integrate s into the chromosome preferentially at locus 19q13.4 143 The AAV genome has 145 kb inverted terminal repeats (ITRs) that

PAGE 39

39 flank two open reading frames (ORFs). Inverted terminal repeat s are cis acti ng sequence s which are the origin of replication and serve as primer s for second strand synthesis by DNA polymerase. The ITRs are also essential for AAV genome packaging, transcription and site specific integration. The first ORF contains the Rep gene, which encodes for Rep proteins ( Rep78, Rep68, Rep52 and Rep40 ) The se proteins regulate AAV gene expression, DNA replication, accumulation of viral DNA used for packaging within AAV cap sids. The second ORF contains the Cap gene, which encodes three viral capsid proteins (VP1, VP2, and VP3). The capsid proteins are assembled at a molar ratio of 1:1:10 to form an icosahedral structure. A deno associated virus has been used as a gene ther apy vector due to its ability to enter the target cell, transfer to the nucleus and be expressed for a long period of time 144 145 Furthermore, wild type AAV, a tiny ssDNA parvovirus, is not associated with any pathology in humans To improve the efficiency of AAVs for gene therapy, several modifications has been applied to enhance their utility. Recombina nt AAVs are generated by deleting the entire wild type viral coding regions ( rep and cap ) so that they are replication deficient and lack immunogenecity and by inserting the gene of interest flanked by viral ITRs. A second plasmid that encodes rep and c ap proteins and the adenoviral helper genes is co transfected with the ITR containing plasmid in order to produce recombinant the virus. To achieve tissue tropism, it is possible to exchange capsid types among the common AAV serotypes In addition capsi d shuffling and novel sequence variants have increased the number of AAV type available for gene therapy 146 148 Tissue specific gene expression can also be achiev ed by the use of cell type specific promoters For this reason, recombinant AAV has been widely used for

PAGE 40

40 gene transfer to animals and to human patients 149 Specifically, AAV mediated gene delivery into the eye has been used successfully to treat a wide range of eye related di sorders and in animals and in human patients 150 156 There are different AAV serotypes which target different tissues depending on the cell surface receptors, i ntracellular processing, and capsid structure 157 For example, following subretinal injectio n, AAV serotype 1 infects primarily the RPE, while AAV5 infects both photoreceptors and the RPE. Subretinal injections of AAV2 in mice consistently transduced retinal pigmented epithelium (RPE) cel ls and some photoreceptor cells 158 160 And subretinal injection of AAV5 and AAV2/5 transduces both RPE and photoreceptor cells, with higher levels of g ene expression in the RPE layer 159 AAV2/1 (similar to AAV2/6) was found to transduc e m ostly RPE, with limited gene transfer to photoreceptor cells, M ller cells, and ce lls in the inner nuclear layer Procedures for deliver y of AAV to the retina have been well established 161 and the effect of gene delivery can be evaluated by noninvasive methods such as electroretinography (ERG), ophthalmoscopy, and optical coherence tomography (OCT) Ribozyme s Ribonucleic acid dependent gene silencing is the most widely used gene knockdown approach and is based on cell administration of antisense, ribozyme or RNA interfering short. Ribozymes are catalytic RNAs that mediate the cleavage or ligation of specific RNA molecules by transesterification or hydrolysis of phosphat e groups 162 They have a lso been found to catalyze the aminotransferase activity of the ribosome 163 Several naturally occurring classes of ribozyme s have been identified. These incl ude the hammerhead, hepatitis delta virus (HDV), hairpin and Neurospora Varkud satellite (Vs) 164 169 and group I intron 170 172 ribozymes These are small RNA

PAGE 41

41 structures of ~40 160 nucleotides that cataly z e site specific self cleavage. They act only at specific phos phodiester bonds by using base pairing and other interactions to align the cleavage site within the ribozyme active site. The hammerhead ribozyme, smallest of the catalytic ribozymes at approximately 3 5 nucleotides long is the most efficient self cleavin g sequence that has be en isolated from randomized pools of RNA 173 Hammerhead RNA self cleavage motifs consi st of three helices (called Stems I, II and III) flanking a junction comprised of 15 conserved nucleotides that form the catalytic core 174 Two of the three helices (typically Stem II and S tem I) are capped by connecting loops, giving this self cleaving RNA sequence a secondary structure that resembles the shape of a hammer head. The trans acting hammerhead is composed of a catalytic core stabilized by a hairpin structure (stem II) and two flanking arms that are used to hybridize to its target to form stems I and III (targeting domain) 175 The catalytic domain is a highly conserved, single stranded structure that connects stem I to stem II and ste m II to stem III, respectively 176 The ribozyme sequence in the targeting domain rep hammerhead ribozyme and confers the target specificity. Because the trans acting ribozymes can specifically cleave other RNA molecules by modification of the substrate recognition domains, such ribozymes have been exten sively studied as potential therapeutics 177 Recently, the cry stal structure of a hammerhead ri bozyme derived from s chistosoma mansoni contain s the rate enhancing peripheral domain has a catalytic core that is very different from the catalytic core hammerhead, which lacks a peripheral domain 178 The RNA secondary structure of the s chistosom a hammerhead consists of the three helices and catalytic core that define

PAGE 42

42 the minimal hammerhead as well as a hairpin loop at the end of stem II and a bulged loop in an extended stem I ( Figure 1 10 ) T he hammerhead can be designed to cleave any target harboring the consensus NUX cleavage triplet (N= any nucleotide; U= uridine; X= any nucleotide except guanine). Its specificity and efficiency is determined by the two binding arms that base pair with the sequences flanking the X in the target. 179 Following the cleavage of the RNA backbone, the reaction products diff use away from the active site leaving the ribozyme free to complete another reaction cycle. Because of their sequence specificity and multiple turnover or catalytic properties, ribozyme has been wildly used towards the better understanding 180 184 and therapy of diseases such as suppression of viral infection 185 187 therapy of muscle and brain diseases 188 Projects RPE oxidative stress is hypothesized to be a major contributor to the develop ment of age related macular degeneration (AMD). In this project, I hypothesize that increased oxidative damage to the RPE will lead to the pathogenesis of the early signs of AMD such as atrophy of the RPE, as well as to the late stage of AMD which involve s neovascularization. To prove it, I chose to specifically down regulate SOD2 in the RPE. The s uperoxide dismutase 2 gene ( SOD2 ) codes for a mitochondrial manganese superoxide dismutase ; which is an enzyme that catalyzes the dismutation of superoxide ani ons to molecular oxygen and hydrogen peroxide in the mitochondrial matrix. This enzyme is the first step in the metabolic defense against cellular oxidative stress. O xidative stress induced AMD animal model s have been emerg ing such as SOD1

PAGE 43

43 knock out mice 100 However, it took almost 12 month for this animal model to present with an AMD like phenotype and due to the systemic deficiency of SOD1 from fertilizati on, the source of oxidative stress cannot be explained in this model Recently, another oxidative stress induced AMD animal model, utilizing an SOD2 specific ribozyme was developed 101 This model showed an AMD like phenotype earlier than the SOD1 knockout mice did with significant histological changes presented within the retina after only 4 month s B ased on these reports, I expect ed that my animal model would recapitulate the human AMD pathology I hypothesized that specific reduction of MnSOD in the RPE would increase the level of reactive oxygen species in the retina/RPE/choroid complex and lead to pathogenesis of the early signs of AMD To achieve MnSOD2 reduction, I used three methods. The first was to use a floxed allele of SOD2 but to deliver the Cre gene to the RPE using AAV and a VMD2 promoter. The second approach was to u se the Cre lox sys tem to delete SOD2 in the RPE at the DNA level following the induction of Cre expression with doxycycline. The third approach was an AAV delivered ribozyme, similar to the approach used previously, but this time using an RPE specific promoter derived from the VMD2 gene After generating RPE specific knock down of MnSOD, the mice were observed for t heir retinal phenotypes. RPE damage created by knoc k down of MnSOD le d to the loss of photoreceptor cells and reduction of dark adapted full field electroretin ogram (ERG) response Light and electron microscopic analysis indicated several histological changes in the retina/RPE complex such as increased thickness of RPE, accumulation of lipofuscin and vacuole formation.

PAGE 44

44 Funduscopy and fluoresc e in angiography s howed retinal lesions including presence of several white spots and abnormal blood vessels.

PAGE 45

45 A B Figure 1 1. The macula and fovea A) The macula contains the xanthophylic pigments, zeaxanthin and lutein that gives it a hyperpigmentated yellowish ap pearance. B) The retinal cells in the center of the macula are highly concentrated in cone cells so that it maximize the amount of light captured by it photoreceptors (fovea ).

PAGE 46

46 A B C Figure 1 2. Changes in the retina in dry and wet AMD. A) a norma l retina. B) Dry AMD is characterized by the presence of drusen, thickened BM, RPE atrophy and hypertrophy. C) In wet AMD, there is abnormal growth of vasculature through choroid to retinal space. (Lotery, 2010).

PAGE 47

47 A B Figure 1 3. Drusen formation. A ) fundus microscopy of drusen B) schematic diagram of drusen formation underneath the RPE. Drusen inhibits the transfer of oxygen and nutrients from choroid and waste materials from photoreceptors (http://convergence.ucsb.edu/article/vision thing) Fig ure 1 4. Development of a drusen map. A) Fundus photograph of a 74 year old man, showing the area mapped in a 3DOCT scan. On each B scan B), the beginning,end, and height of each drusen was documented and plotted on a corresponding line in the map C). (I nvest Ophthalmol Vis Sci. 2010 Dec;51(12):6715 21).

PAGE 48

48 A B Figure 1 5. Loss of central vision in AMD. A) Normal vision, B) vision as seen by an AMD patient due to the injuries in the macula.

PAGE 49

49 Figure 1 6. A representation of disease prevalence with ag e. The incidence of both early and late AMD greatly increases in all individuals at a late age (age 80 and above). I ndividuals with genetic susceptibility variants and those who have been exposed to environmental risk factors exhibit the disease at much e arlier age (age 60 and above). (Annu. Rev. Genomics Hum. Genet. 2009.) Figure 1 7. Tetracycline mediated regulation of gene expression Doxycycline binds to inactive rtTA which convert into active rtTA. Active rtRA binds to tetO promoter which induces expression of cre.

PAGE 50

50 Figure 1 8. The unique microenvironment of the photoreceptor/RPE complex. Due to its location between the sensory retina and the choroid, the RPE/photoreceptor complex exists in a highly oxidativ e micro environment.

PAGE 51

51 Figure 1 9. Visual cycle. Light transduction starts with photon absorption by rhodopsin. The process of light absorption underlies the stereochemical change of 11 cis retinal into all trans retinal. All trans retinal is metabol ized into all trans retinol and transported to the RPE. In the RPE retinol reisomerized to 11 cis retinal and then redelivered to the photoreceptors.

PAGE 52

52 A B C D Figure 1 10. The structure of the hammerhead ribozyme. A) shows schematic diagrams o f the secondary structures of the minimal and full length hammerheads B) shows an all atom representation of the tertiary structure of the full length hammerhead. A distal contact between Stems I and II in the full length hammerhead, shown schematically in A), stabilizes the active site structure, the details of which are shown in C). D) shows a proposed transition state structure extrapolated from C). (Molecular Cell 23, 447 450, August 18, 2006).

PAGE 53

53 CHAPTER 2 REDUCTION OF SOD2 IN THE RPE VIA SUBRETIN AL I NJECTION OF AAV1 VMD2 CRE INTO SOD2F/F MIC E Opening Remarks The superoxide dismutases (SOD) catalyze the conversion of O 2 to H 2 O 2 and thus help prevent the buildup of toxic O 2 levels. Three SOD isoforms are expressed in mammalian cells: (i) copper/zinc SOD ( encoded by the SOD1 gene ), which is located in the cytoplasm; (ii) manganese SOD ( SOD2 gene ), which is localized in the mitochondrial matrix; (iii) extracellular SOD ( SOD3 gene ). A small fraction of CuZn SOD is also reported to be present in the inte rmembrane space of mitochondria 189 190 Mitochondria are both a major source of ROS production from the respiratory chain as well as a major target of ROS induced cellular injury. Thus, mitochondrial Mn SOD is thought to play an important role in cellular defense against oxidative damage by ROS Loss of MnSOD in SOD2 knockout mice results in embryonic or e arly postnatal lethality that varies with genetic background 128 191 The phenotypes of these mice include se vere dilated cardiomyopathy within several weeks after birth and exhibited striking lipid deposits in the liver And significant reduction in the activity of mitochondrial respiratory enzymes including complex I, complex II, or complex III, as well as the citric acid cycle (TCA) enzyme aconitas e were reported Sandbach et al. used an antioxidant compound to keep SOD2 knockout mice alive for 20 21 days, and these mice exhibited thinning of both the inner and outer retina and pale swollen mitochondria in th e RPE 192 However, s ince MnSOD deficient mice died within several weeks after birth, the investigation of the pathological consequences of increased superoxi de in the adult retina or the impact of increased oxidative stress physiological ageing process was not possible. Therefore, the control of SOD2

PAGE 54

54 knockout in a spatiotemporal manner might help in understanding the role of MnSOD in animal model. For this purpose, the cre loxP system was used to induce site specific DNA recombination in specific tissue (RPE). The bacteriophage P1 recombinase Cre catalyzes reciprocal recombination at a specific locus of loxP. The lox sequence is composed of two 13 base pa ir (bp) inverted repeats separated by an 8 bp spacer region. Upon binding to the inverted repeats, Cre synapses with a second lox site and then cleaves the DNA in the spacer region to initiate strand exchange with the synapsed lox partner. No additional f actors are required in the recombination reaction The SOD2f/f mice we used contained loxP sites flanking exon 3 of SOD2 193 Exon 3 encodes 39 amino acids which are involved in homodimerization, tetramer formation, and manganese binding. Li, et al showed that deletion of exon 3 of SOD2 leads to complete inactivation of the enzyme 128 For the introduction of Cre into SOD2f/f mice specifically in the RPE, we employed two methods: subretinal injection of VMD2 Cre packaged into AAV1 and induction of Cre by crossin g of SOD2f/f mice with mice that express Cre only in the RPE under control of the tetracycline reverse transactivator. Since Cre protein has been shown to carry determinants that allow it to target the eukaryotic nucleus, an exogenous nuclear localization signal (NLS) is not necessary 194 The advantage of using AAV vector to deliver Cre is that we can use the other eye of same mouse as a control. The gene VMD2 enc odes the protein bestrophin 1( B est 1 ) which has been hypothesized to be a member of a family of calcium ion ( Ca 2+ ) activated chloride ( Cl ) channels and regulators of ion transport 195 198 The mutations in the BEST1 gene cause

PAGE 55

55 a variety of degenerative eye diseases in human that exhibits some histopathologic similarities to age related macular degeneration 199 Both Petrukhin et al 200 and Marquardt et a l 201 examined the distribution of BEST1 mRNA in humans P etrukhin et al examined the distribution of BEST1 mRNA by Northern blot and found expression in retina/RPE, brain, spinal cord, and testis, while Marquardt et al identified VMD2 mRNA only in retina/RPE and the human RPE derived cell line ARPE 19. However high levels of mRNA expression cannot be taken as evidence of protein expression. Later on, several groups demonstrated that Best1 protein is expressed b y and localized to the basolateral plasma membrane of the RPE in macaque and porcine eyes 202 in humans 203 canine 204 and mouse eyes 205 B estrophin mRNA expression has been found to be high during the late phase of embryonic development and early postnatal stages Also, the bestrophin protein was first detected in the RPE on postnatal day 10 and was more pronounced at P11 205 In this chapter, I will present the phenotypes of mice observed after subretinal inj ection of AAV1 VMD2 Cre into the SOD2 f l /f l mouse. To visualize the successful transduction of the R PE, an AAV virus expressing both Cre and GFP was used for subretinal injection. The Cre mediated recombination was confirmed by using reporter mouse strain which contains a floxed PGK n eo mycin resistance cassette and an enhanc ed yellow fluorescent protein ( e YFP ) gene inserted into the Gt(ROSA)26Sor locus. To examine the phenotypes of Cre injected mice, dark adap ted full field electroretinogr phy (ERG), light and electron microscopy, SD OCT and fundus analysis were performed.

PAGE 56

56 Materials and Methods Experimental A nimals For this experiment, we used SOD2 floxed mice which were generously provided to us by Professor Scharffetter Kochanek (University of Ulm). The mice were maintained in a 12h:12h light/dark regime. To detect the presence of the floxed gene, genotyping using tail bi o psies was performed. DNA was extracted by adding 100 l Extraction Solution and 25 l Tissue Prep Solution (RED Extract & Amp kit, Sigma). The tail in the solution was incubated at room temperature for 15 minutes and then at 95 o C for 5 minutes. The reaction was stopped by adding 100 l Neutralization Soluti on. By using the primer s for detecting floxed gene (Table 2 1) The PCR product of SOD2 fl/fl showed 1090 bp and SOD2 fl/+ showed 1090 bp and 900 bp (Figure 2 1). PCR was performed using the PCR condition as described in Table 2 2. Injection of AAV Vect ors Adeno associated virus serotype 1 was selected for these experiments because it preferentially infects RPE cells following subretinal injections 206 All vir uses used in these experiments were prepared in the Hauswirth laboratory as pseudotypes. That is, AAV2 ITR sequences flanked the VMD2 CRE and VMD2 GFP genes, but the helper plasmids provided the capsid proteins of AAV1 207 Before inject ions of AAV, 1% atropine sulfate solution (Bausch and Lomb, Tampa, FL) was placed topically on the eyes of the mice. Prior to injections, the mice were anesthetized using a ketamine/xylazine mixture and their eyes further dilated with 2.5% phenylephrine HCl. The eyes then received a drop of 2.5% hypromellose opthalmic demulcent solution Groups of mice were injected

PAGE 57

57 subre 12 particles per ml of AAV 1 VMD2 Cre or a GFP only (AAV1 VMD2 GFP ) construct. Briefly, under direct observation with a Nikon SM2800 operating microscope (Nikon, Melville, NY), a 28 gauge hypodermic needle was used to puncture the cornea to create an aperture. A blunt 32 gauge needle on a Hamilton syringe was then inserted through the opening, and vector injected slowly into the subretinal space in the posterior retina VPP antibiotic ointment (Akorn, Buffalo Grove, IL) was place d on the eyes of the mice following injection to prevent infection. Injections for this experiment were performed by Dr. Jian wen Liu. Detection of Cre E xpression At 6 weeks post injection, mice treated with AAV Cre or AAV GFP were euthanized by an overd ose ketamine/xylazine mixture followed by cervical dislocation. Their eyes were quickly removed and rinsed briefly in PBS. The eyes were fixed in freshly made 4% paraformaldehyde solution at 4C overnight. Following fixation, the eyes were incubated in 30% sucrose for overnight. Eyes were embedded in Tissue Tek OCT compound embedding medium (Sakura Finetek, Torrance, CA) and frozen by storing in 20 o C followed by 80 o C Frozen serial sections (12 m) were cut with a Microm H550 cryostat (Microm, Walld orf, Germany) through the entire eye and mounted on Superfrost/Plus microscope slides (Fisher Scientific, Pittsburgh, PA). The sections were air dried for 30 minutes and mounted using Vectashield mounting medium with DAPI (Vector Laboratories, Burlingame, CA). The extent to which the retinas were transduced was determined by native GFP fluorescence. Green fluorescent protein expression in the retinal sections was documented using a Leica TCS SP2 AOBS Spectral Confocal Microscope with Leica Confocal Softwa re Version 2.61, Build 1537.

PAGE 58

58 Detection of Cre M ediated R ecombination To confirm that the subretinally injected VMD2 Cre (AAV1) could induce recombination in the RPE, the virus was subretinally injected into a reporter strain which contains a floxed PGK ne o cassette and an e YFP gene inserted into the Gt(ROSA)26Sor locus. The eYFP gene is preceded by stop codon flanked by lox P sites. As a control, VMD2 GFP (AAV1) was injected into the left eye. Deletion of stop codon by C re will lead to the expression of eYFP gene using the ubiquitous ROSA26 promoter. One month post injection, the mice were sacrificed and the eyes were removed The eyes were processed for frozen section s as described above The sections were examined for the e YFP signal using the Leica TCS SP2 AOBS laser scanning spectral confocal microscope. Electroretinographic A nalysis The full field or flash ERG (ffERG) consists of a negative deflection, called the a wave, which is associated with the photoreceptors and a positive b wave, thought to be produced by ON bipolar cell depolarization Scotopic ffERG elicit rod dominated photoreceptor function responses and photopic conditions elicit cone function responses Electroretinograms (ERG) were recorded using a UTAS ER 2000 V isual Electrodiagnos tic System ( LKC Systems Inc., Gaithersburg, MD) For dark adapted ERG s, a nimals were dark adapted overnight prior to analysis, and all procedures were performed under dim red light. The mice were anes thetized by IP injection of a mixture of ketamine and xylazine, and eyes were dilated with 1.0% atropine. Gold contact lens electrodes were placed on the eyes with 1% methylcellulose a reference electrode was placed subcutaneously be tween the shoulder blades and a ground electrode subcutaneously in a hind l eg. The mice were placed on a platform and their heads

PAGE 59

59 completely inside a Ganzfeld illumination dome. F ull field ERGs were obtained in the dark adapted state by flashing increasing intensities of light ( 0.02 0.18 and 2.68 cd s/m 2 ) into the eye s of the mice. The electrical responses of the retinas were recorded simultaneously from both eyes using the UTAS E 2000 Visual Electrodiagnostic System. Intervals between flashes (15 to 60 seconds) were increased with increasing flas h intensities. Five recording s we re taken and averaged per flash intensity. Electron M icroscopy For electron microscopy, at 15 months after treatment, 4 mice from each treatment group were given an overdose of sodium pentobarbital and then immediately perfused with 4% paraformaldehyde and 2% glutaraldehyde in 0.1 M PBS buffer (pH 7.4). The eyes were removed and immersed in 4% paraformaldehyde and 2% glutaraldehyde for further fixation overnight. Eyes were postfixed with 1% osmium tetroxide, 0.1 M sodi um cacodylate HCl buffer (pH 7.4), and dehydrated through a series of increasing ethanol concentrations leading up to propylene oxide. Eyes were embedded in epoxy resin which was polymerized at 60 o C. For morphometric measurements, 1 m thick sections we re cut along a vertical meridian containing the optic nerve. S ections of 80 to 100 nm were cut and examined by transmission electron microscopy ( H 7000; Hitachi ). Optical Coherence Topomology S pectral domain OCT systems (SD OCT) provides high resolution an alysis of retinal architecture previously achieved only through histology. It uses light waves backscattered from within a sample and processed to develop a high resolution, depth resolbed image for analyzing internal microstructure. Spectral domain O CT is able to acquire hgh speed, high resolution, high density 3 dimensional images. Using a Bioptigen SD OCT ( Bioptigen, Research Triangle Park, NC ) we measured thickness of

PAGE 60

60 the outer nuclear layer (ONL) between the outer plexiform layer (OPL) and the exte rnal limiting membrane (ELM). The OPL appeared as a light stripe and the ELM as a very thin light stripe. Mice were anesthetized by IP injection of ketamine/xylazine mixture dose (0.1 l/20g) and eyes were dilated with 1.0% atropine The mouse was held on the OCT platform and image acquisition is processed by utilizing the live video fundus Results Expression of Cre R ecombinase in the RPE To confirm tha t the subretinal injection of VMD2 Cre expresses in the RPE, we u tilized the expression of GFP ( Figure 2 2 ). Six weeks after injection of the virus, the mice were euthanized and their eyes were processed for cryosectioning. The extent of virus transduction into the retinas of the mice was determined by native GFP fluorescence. In the VMD2 Cre GFP injected eyes, GFP signal was detected only in the RPE ( Figure 2 3 ) confirming the specificity of this promoter and route of injection Subretinal I njection of VMD2 Cre AAV1 L ead s to R ecombination in the RPE To determine if trans duction with AAV1 expressing Cre recombinase led to recombination specifically in the RPE region, we utilized reporter mouse strain which contains a floxed PGK neo cassette and an e YFP g ene inserted into the Gt(ROSA)26Sor locus. The floxed neo cassette contains a strong stop sequence which prevents the transcription of e YFP Removal of the PGK neo cassette allows expression of the marker protein. One month post injection of the virus in to the right eye of the reporter mouse, e YFP signal was examined. As a control, left eyes were injected with AAV1 VMD2 GFP. The e YFP signal was detected specifically in the RPE region of the right eye only indicating recombination had occurred ( Figure 2 4 ) G reen

PAGE 61

61 fluorescent protein was not detected in the control eye because of the spectral selectivity used with the scanning confocal microscope. Reduction of Electrophysiological Responses Although early AMD is not characterized by loss of ERG response, a growing body of research has shown retinal dysfunction with macular RPE changes or soft drusen using multifocal ERG, and the ERG changes correlated with the extent and severity of fundus changes 208 Scotopic ffERGs elicit rod dominated photoreceptor function responses and photopic conditions elicit cone function responses. Holopigian et al. demonstrat ed reduction of amplitude of the ffERG with increasing ages for normal subjects, as well as those with AMD under photopic and scotopic conditions 209 T herefore, we measured both scotopic, and photopic ERG response of VMD2 Cre injected SOD 2 f l /f l mice. First, scotopic electroretinography was performed1, 3, and 6 month s post injection of VMD2 Cre into SOD2 f l /f l mice to measure the response of the impact of SOD2 deleti on on the response to different intensities of light stimuli. Figure 2 5 shows the ratio of a and b wave response of VMD2 Cre to GFP control eyes following 0.18 cd s/m 2 intensity flashes of light. A progressive loss of the a and b response ratio was obs erved between 1 and 6 months post injection. No significant changes were observed in a or b wave response at the 1 or 3 months post injection time point. However, by 6 months post injection, VMD2 Cre treated eyes of SOD 2 f l /f l showed significant loss of ERG response, with an average of 35 % and 30 % decrease in a and b waves respectively compared to control treated eyes ( Figure 2 5 ) Measurement of ONL Thickness To examine the histological changes after deleting SOD2 in the RPE, light microscopic analysis was performed and ONL thickness w as measured The ONL of

PAGE 62

62 the retinal contains the cells bodies of the photoreceptors, and death of photoreceptors results in thinning of the ONL The progressive thinning of the ONL in Cre treated retinas was quantitated by measuring the thickness of the ONL. Measurements were taken at 400 micron increments from the optic nerve to the peripheral retinal on the inferior and superior portions of the retina. By 9 months after injection, there was a 30 50% reduction in ONL t hickness across retinas treated with Cre versus GFP control ( Figure 2 6 ). This result was also confirmed using SD OCT to measure ONL thickness at 1 year post injection ( Figure 2 7 ), at which point an average 30% reduction in thickness was measured. Asses sment of Histological Changes Histological damage in the retinas of treated mice was assessed by light microscopic analysis. One year post injection of VMD2 Cre thickening of RPE and thicker subretinal debris were observed ( Figure 2 8 ). In addition to t his RPE hyperpigmentation which is a hall mark of age related changes of RPE and changes of outer rod segment s (OS) such as disorganization and vacuole formation were observed by 15 month s post injection by low magnification electron microscopy ( Figure 2 9 ) Interestingly, 1 year after injecting VMD2 Cre druse n like sub RPE deposit s were detected ( Figure 2 1 0 ). To examine the source of thickening of RPE, we decided to do electron microscopic analysis of retina. Ultrastructural A nalysis of the R etina E lectron microscopic analysis revealed that by 15 month s our mouse model accumulated sub RPE deposit associated with degenerating membranous folds. The content of the deposits appeared to be homogenous and the deposits were located between the plasma memb rane and basement membrane of the RPE which is basal

PAGE 63

63 laminar deposit ( Figure 2 11 ). These deposit formation s w ere similar to those observed in Efemp1 knock in mice 210 Mitochondrial changes were also noticeable; in Cre treated mice, mitochondria were more fragmented and less de nse possibly by loss of cristae ( Figure 2 11 ) Conclu ding S tatements The purpose of this study was to test the hypothesis that oxidative stress in the RPE could contribut e to the development of AMD. To increase oxidative stress, I knocked down arisi ng from oxidative phosphorylation in the mitochondria. Based on the observation that the primary lesion of AMD lies in the RPE 211 212 MnSOD was deleted specifically in the RPE. This study was the follow up research of testing AAV1 CBA Rz432 which target s the mRNA of MnSOD 101 Instead of knock ing down the MnSOD at the mRNA level, we devised method to knock down the MnSOD in the DNA level. To achieve this, we used subretinal injection of AAV1 VMD2 Cre into SOD2 f l /f l mice Recently, Kaneko, et al showed the result of subretinal injection of AAV1 VMD2 Cre into Dicer f/f mice to knock down the level of Dicer in the RPE 213 AAV1 serotyp e specifically target s RPE layer follow ing subretinal injection 214 To assess the extent of successful transduction of VMD2 Cre we constructed a vector which also expresses CBA GFP which show ed over 90% transduction of C re in the RPE. The induction of recombination was confirmed by using reporter strain which express eYFP upon expression of C re. I attempted to measure the reduction of MnSOD by standard western blot. However, the extent of redu ction was not able to be calculated because several

PAGE 64

64 nonspecific bands To examine the levels of SOD2 reduction by cre introduction, measurement of the level of SOD 2 reduction at the RNA and protein need to be done. However, given evidence of recombinatio n and presence of eye changes, it is reasonable to conclude that the SOD2 protein is likely reduced or at least nonfunctional. F ull field ERG measurement showed reduction of both scotopic a and b wave starting by 6 month post injection It is unlikely t his ERG response is due to injection damage which is usually indicated by a rapid loss of ERG response due to massive cell loss in the injured retina By using OCT analysis we eliminated mice in which retinas were detached which might have been caused by injection damage. Histological analysis showed in VMD2 Cre injected SOD 2 f l /f l mice, thickness of RPE was increased and thicker subretinal debris was examined. In the Cre injected eyes, the histological analysis indicated reduced cytoplasmic density and presence of multigiant nuclei which might lead to the increased thickness of RPE. Occasionally, sub RPE deposit was examined which might have been drusen like deposit s Furthermore, in VMD2 Cre injected SOD 2 f l /f l mice, lipid droplet, vacuole formation in RPE region was examined by ultrastructural analysis. were also prominent. and basal l inear deposit. Our mouse model in which MnSOD is depleted in the RPE indicates that increased oxidative burden to the RPE lead to pathological features seen in AMD. In particular, we observed progressive loss of retinal electrophysiological function, dru sen like deposit formation and accumulation of basal laminar deposit s Measurement of the thickness of the ONL showed loss of photoreceptor cells.

PAGE 65

65 Morphological changes of ONL were speculated as microglial invasion. To verify the activation of microglia l cell, immunostaining using microglial cell specific markers is needed. Although we detected some of the characteristics of AMD in this mouse model, the subretinal injection is not ideal method to deliver Cre The facts that the inection limits the vir al transduction to a focal region at the injection site s and that the injection can affect the retina by detaching it from the RPE. To better refine this mouse model, we used genetic methods which will be the subject of Chapter 3.

PAGE 66

66 Table 2 1 The DNA oligonucleotides used for genotyping Primer name Primer Sequence MnF GTGACATCTGGCTGACGAGGG MnR AGAAAGTCACCTCCACACACAGA PDE sense 5' CATCCCACCTGAGCTCACAGAAAG 3' PDE anti sense 5' GCCTACAACAGAGGAGCTTCTAGC 3' creF2 5' TGACGGTGGGAGAATGTTAAT 3' creR1 5' GCCGTAAATCAATCGATGAGT 3' Table 2 2 The PCR conditions used for genotyping Gene PCR Timeline Cycles SOD2 fl/fl Temp (C) 95 95 68 68 68 30 Time 1 min 30 sec 30 sec 2.5 min 10 min PDE T emp (C) 95 95 52 68 68 35 Time 1 min 30 sec 30 sec 1.5 min 10 min Cre Temp (C) 94 94 55 72 72 30 Time 2 min 1 min 2 min 2 min 10 min Table 2 3 The DNA oligonucleotides used for genomic DNA PCR Primer name Primer Sequence Cre F GTGACATCTGGCTGACGAGGG Cre R AGAAAGTCACCTCCACACACAGA SOD2 exon 3 F 5' CATCCCACCTGAGCTCACAGAAAG 3' SOD2 exon 3 R 5' GCCTACAACAGAGGAGCTTCTAGC 3' Table 2 4. The PCR conditions for analyzing recombination of MnSOD Gene PCR Timeline Cy cles MnSOD2 Temp (C) 95 95 6 3 6 3 6 3 30 Time 1 min 30 sec 30 sec 2.5 min 10 min

PAGE 67

67 Figure 2 1 Genotyping results of SOD2 f l / + and SOD2 f l /f l PCR was performed to detect floxed exon 3 of SOD2 (#1: pst marker, #2 16: SOD2 fl/+ #17: SOD2 fl/fl #1 8 : water control). A B C Figure 2 2 The recombinant AAV cassettes used to produce A) VMD2 Cre B) VMD2 Cre GFP C) VMD2 GFP viral vectors Constructs were packaged in AAV serotype 1 capsids. TR, inverted terminal repeats; VMD2 vitelliform macular dystrophy 2 ; SD/SA splice donor/acceptor site

PAGE 68

68 A B Fig ure 2 3 Localization of VMD2 Cre GFP expression at 6 weeks post injection. Picture on the left shows DAPI counter s taining for cell nuclei (blue),a nd the picture on the right is a retinal sectio n from an eye treated with AAV VMD2 Cre GFP

PAGE 69

69 A B C Fig ure 2 4 Validation of VMD 2 Cre tissue specificity. A) Diagram of reporter strain which contains a floxed PGK neo cassette and an enhanced yellow fluorescent pro tein ( e YFP) gene inserted into the Gt(ROSA)26Sor locus. Upon subretinal injection of VMD2 Cre(AAV1), the stop codon flanked by loxP s ite is deleted and eYFP signal is present B ) VMD2 Cre GFP. C ) VMD2 GFP

PAGE 70

70 A B C Fig ure 2 5 Scotopic full field ERGs of SOD2 fl/fl mice injected with Cre or GFP control vector. ERGs were measured at 1, 3and 6 months post injection. Right eyes were injected by VMD2 Cre (AAV1) and left eyes were injected by VMD2 GFP (AAV1). Mice treated with cre show progressive loss of ER G response that is significant by 6 months. A) representative graph of ERG measured at 6 month post injection. B & C) G raph s show ing the ratio of the maximum B) a wave and C) b wave amplitudes of cre to GFP control treated. ( p value for a wave =0.001, p va lue for b wave = 0.007, n=7) Error bars represent standard error of the mean Statistical analysis was performed by paired t test. 0.00 0.25 0.50 0.75 1.00 1M 3M 6M Response Ratio (Right/Left) Time Points (months) A Wave 0.00 0.25 0.50 0.75 1.00 1M 3M 6M Response Ratio (Right/Left) Time Points (months) B Wave

PAGE 71

71 A B Figure 2 6 Measurement of the thickness of the outer nuclear layer. Using the optic nerve head as a landm ark, measurements were taken at 400 m increments from the optic nerve on both the superior and inferior portions of the retina. Error bars represent standard error of the mean ( *=p<0.005 A : control treated, B : VMD2 Cre treated, 9 month s post injection )

PAGE 72

72 A B C Figure 2 7 OCT measurement of ONL thickness. 1 year post injection of VMD2 Cre ONL thickness was measured. About 30% reductio n of ONL thickness was observed ( n = 7 p=0.02 ) A B Figure 2 8 Retinal morphology of SOD2 f l /f l mice i njected with VMD2 Cre 1 Year after injecting VMD2 Cre affected retinas showed increased thickness of RPE and areas of thicker subretinal debris.

PAGE 73

73 A B C D Fig ure 2 9 Electron microscopic analysis of SOD2 f l /f l injected with VMD2 Cre AAV1 or VMD2 GFP AAV1 as a control. Retinal sections at 15 month after Cre injection are shown. A) and C) are from the control eyes, while B) and D) are from the VMD2 Cre injected eyes. VMD2 Cre injected retinas show changes of outer segment such as disorganization a nd vacuole formation (blue arrow in B)

PAGE 74

74 A B C Figure 2 1 0 RPE light micrographs. A) The retina of a control mouse, B) and C) The r etinas of SOD2 f l /f l mice treated with VMD2 Cre One year after injecting VMD2 Cre into SOD2 f l/fl mice, light microscopic analysis showed d rusen deposits forming under the RPE (red arrows).

PAGE 75

75 A B C D Fig ure 2 1 1 Ultrastructure changes in the RPE and Bruc s after C re injection. Retinal sections at 15 month aft er treatment of Cre injection or GFP control are shown. Cre treated retinas show accumulated basal laminar deposits (arrow) associated with degenerating membranous (A: control, B,C,D: Cre injected eyes)

PAGE 76

76 CH APTER 3 REDUCTION OF SOD2 IN THE RPE BY USING TET ON SYSTEM FOR CRE MEDIATED RECOMBINATI ON Opening Remarks While the delivery of Cre recombinase using AAV led to deletion of SOD2 and reduction of MnSOD in infected cells, this approach was subject to vari ability associated with subretinal injection of virus. Therefore we used a second approach for generation of RPE specific MnSOD knockout utilizing Tet On VMD2 Cre mice. Previously, Dr. Yun Zhang Le at the University of Oklahoma generated tetracycline ind ucible RPE specific Cre mice using 3 kb promoter of the human VMD2 gene 215 The human VMD2 gene (also known as BEST1 ) is known to be expressed preferentially in th e RPE. The VMD2 promoter was used to direct the expression of the tetracycline inducible transactivator gene rtTA The rtTA gene drives the expression of the tetO controlled Cre gene in the presence of doxycycline ( Figure 3 1 ) These transgenic mice wer e normal in size, histological morphology of the retina and ERG 215 We sought disruptive rec ombination by breeding a Tet On VMD2 Cre mice with floxed SOD2 mice allo wing induction of Cre expression, by the feeding doxycylcine food to nursing dams. This method of induction led to increased oxidative stress in the retina and to many of the features of atrophic AMD, including damaged RPE cells and disorganization of Bru It was also associated with death of the overlying photoreceptors, which is similar to advanced atrophic AMD or geographic atrophy. Materials and Methods Animals The i nducible RPE specific Cre transgenic mice ( VMD2 CreTg (+/ ) ) were kindly p rovided by Dr. Yun Zheng Le ( University of Ok lahoma Health Sciences Center).

PAGE 77

77 These transgenic mice express the Cre recombinase in the retinal pigment epithelium under the control of the reve rse tetracycline transactivator ( Figure 3 1). T he P VMD2 rtTA and tetO P hCMV cre DNA fragments were co injected into zygotes permitting the co integration of both transgenes into a single chromosome To generate SOD2 f l /f l Cre transgenic mice, SOD 2 f l /f l mice ( on the C57BL/6 background ) were bred with Tet On VMD2 CreTg (+ / ) ( FVB/N background mice ) The resulting VMD2 cre Tg(+/ ) SOD2 f l /+ p ups were inbred to generate VMD2 CreTg (+/ ) SOD2 f l /f l VMD2 creTg (+/ ) SOD2 f l f l were inbred again to have VMD2 CreTg (+/ ) SOD2 f l /f l or VMD2 CreTg (+/+) SOD2 f l /f l ( Figure 3 2). The result ing mice showed variable genetic background and exhibited inconsistent morphological and phenotypic results. To obtain a homogenous genetic background, the transgenic VMD2 CreTg (+/ ) and the SOD2 f l /f l mice were separately bred with C57BL/ 6 mice for 6 ge neration s, and the resulting strains were crossed to provide VMD2 creTg (+/ ) SOD2 f l /f l on the C57BL/6J background ( Figure 3 2) Introduction with Doxycycline We tried several methods for delivery of doxycycline A t first, as suggested by Dr. Le, d oxycycl ine was given by gavage feeding at a dosage of 0.4mg per gram bodyweight for two days from postnatal day 4 or 5 (P4 or P5) Gavage feeding of such youn g pups was associated with high mortality (50%). Therefore we introduced doxycycline at a dosage of 5 mg/ml in 5% sucrose drinking water from pregnancy to 3 weeks old The mice showed variable phenotypes possibl y due to the inconsistent induction in utero However, the genetic background of mice was non uniform at this stage also (see above). We therefo re modified our induction of Cre expression by providing female mice with doxycycline chow from Bioserv ( at a dosage of 200 mg/kg )

PAGE 78

78 for two weeks starting on the day of delivery. This method had worked well for the Mandel group 216 Screening for the Rd Allel e For generating the VMD2 Cre transgenic mice, FVB/N background mice were used. Since the FVB/N background mice are homozygous for the retinal degener ation allele Pde6b rd rd mutant screening was performed. Rd mouse has nonsense mutation in exon 7 of the Pde6b gene encoding the beta subunit of cyclic guanosine monophosphate PDE ) Digestion with restriction enzyme DdelI facilitates the identification of the genetic background with respect to PDE as (+/+), ( rd/+ ) or ( rd/rd ). Mice wild type at the PDE loci do not contain the DdeI restriction site, mice with h eterozygous ( rd/+ ) at the PDE loci contain one DdeI site in the rd all ele, and mice homozygous for the rd mutation ( rd/rd ) contain one DdeI site in each rd allele. Screening was performed genotype with PCR and DdeI digestion which shows 300 bp band for +/+ mice, 300 bp as well as 170 bp bands for rd/+ mice and 170 bp and 13 0 bp bands for rd/rd mice ( Figure 3 3). Expression of C re b y D oxycycline To analyze and localize Cre expression, immunostaining western blotting and RPE flat mount staining were performed using r abbit a nti Cre p olyclonal a ntibody ( Novus Biologicals) V MD2 CreTg (+/ ) and SOD2 f l /f l mice were introduced doxy cycline in drinking water from P 1 to P14 After that, their eyes were enucleated, and some were processed for cryosectioning. Immunohistochemistry using anti Cre antibody was performed. RPE lysates w ere isolated from other induced eyes, and western blot s were performed using r abbit a nti Cre p olyclonal a ntibody at a ratio of 1 : 1000 in phosphate

PAGE 79

79 buffered saline tween 20 ( PBS T ) buff er For RPE flat mount staining, VMD2 CreTg (+/+) SOD2 f l /f l and VMD2 Cre Tg (+/+) SOD2 f l / + mice with administration of doxycycline in food were used. For Cre staining, rabbit anti C re polyclonal antibody was used followed by 488 anti rabbit secondary antibody ( Jackson immunoresearch ). Immunohistochemical A nalysis of Cre M ediat ed R ecombination by D oxycycline To show doxycycline c ould induce expression of C re in the RPE ROSA26 VMD2 Cre mice were generated by crossing the VMD2 CreTg (+/ ) mice with ROSA26 lacZ mice 137 In this reporter strain, a loxP flanked cassette that normally prevents the expression of lacZ but once cre is activated via system ic doxycycline delivery, the inhibitory sequence is removed and lacZ is expressed, reporting Cre recombination activity. We used two methods to detect galactosidase expression. First, u sing anti goat antibody for galactosidase (Santa Cruz) immunosta ining were used for examining the expression of galactosidase. Immunostaining was useful for identifying galactosidase in the pigmented mice. As a control, ROSA26 VMD2 Cre mice without doxycycline induction were used. Second, we used direct measurem ent of galactosidase activity using bromochloro indolyl galactopyranoside ( X gal) staining. For X gal staining, eyes were enucleated and fixed in 0.2% glutaraldehyde, 2mM Mg C l 5mM ethylene glycol tetraacetic acid ( EGTA ) in phosphate buffered saline ( PB S ) for 30 min at ro om temperature. After dissection of RPE, tissues were incubated in wash buffer (PBS containing 5mM EGTA, 0.01% sodium deoxycholate and 0.02% Nonidet P 40) for 30 min at room temperature. A nd then, tissue was incubated in wash buffer co ntaining 5mM K 3 Fe(CN) 6 5mM K 4 Fe(CN) 6 and 1mg/mL X gal overnight at 37 o C To visualize X

PAGE 80

80 gal staining in the RPE, pigment was bleached by incubation in KMnO 4 (0.25% in water) for 5 min at room temperature Subsequently, tissue was incubated in o x alic acid (1% in water) for 20 min at room temperature R PE flat mount was prepared and X gal staining was visualized using bright field microscope. Genomic DNA A nalysis of SOD2 R ecombination by Cre To examine if doxycycline administration was able to mediate de letion of exon3 of SOD 2, primers for exon3 of the SOD2 flox allele were designed and used for genomic DNA PCR. Genomic DNA from the RPE of a mouse following doxycycline induction and from a mouse without doxycycline induction were iso lated and used for PCR reaction ( DNeasy blood &tissue kit, Qiagen ) The PCR condition for this analysis was described in Table 2 4. Measurement of MnSOD L evels To detect levels of MnSOD, I euthanized 6 VMD2 CreTg (+/+) SOD2 f l /f l mice 4 weeks after doxycycline induction. T hei r eyes were quickly removed, and rinsed briefly in PBS. The anterior chamber and excess tissue was also discarded. The neural retina containing the RPE/ choroid was dissected using a dissecting microscope. Posterior eye cups containing the RPE/choroid we Quantification of total retinal proteins was accomplished by the Lowry method 217 using a RC protein detection kit (Bio Rad; Hercules, CA) Twenty micrograms of retinal lysates and posterior eye cup lysates were separated on 12% SDS polyacrylamide gel s ( Bio Rad Laboratories, Hercules, CA) Proteins were electr otransferred to a nitrocellulose membrane. The membrane was blocked for 1 hr at room temperature in blocking buffer ( Li Cor Biosciences, Lincoln, NE ) followed by incubation with a 1:2000 dilution of polyclonal rabbit anti MnSOD

PAGE 81

81 antibody (Alpha Diagnostic International Inc., San Antonio, TX) or 1:5000 of monoclonal mouse anti actin in blocking buffer at 4 C overnight. Membranes were washed 3 times for 5 min each in Phosphate Buffered Saline Tween 20 ( PBS T ) and incubated with an infrared dye labeled anti rabbit IgG (1:10,000 for detection of MnSOD) and anti mouse (1:10,000 for detection of actin) at room temperature in PBS T for 1 hour. Bands were detected using an imaging system (Odyssey imaging system; Li Cor Biosciences). Each MnSOD signal was normalized to the a ctin signal from the same sample, and the normalized values were expressed as a percentage of the MnSOD/ a ctin ratio. Autofluorescence A nalysis Four month old VMD2 CreTg (+/+) SOD2 f l /f l and SOD2 f l /f l m ice were sacrificed and their eyes were enucleated. Froz en serial sections (12 m) were prepared as described in C hapter 2 Cryosections were air dried on slides for 30 to 40 minutes Sections were washed in dH 2 O to eliminate OCT. Samples were again air dried for 30 minutes and then mounted in fluorescent mo unting medium (Fluormount; Electron Microscopy Sciences, Fort Washington, PA). Wavelength scans were performed using 405 and 488nm laser lines of laser scanning confocal microscope ( Leica TCS SP2 AOBS ). DHE S taining To detect intracellular ROS, we used DHE probe (Molecular Probes, Eugene, OR) Dihydroethidium (DHE) was used to detect intracellular superoxide (O 2 ). Superoxide oxidizes DHE to ethidium, which generates a red fluorescent signal. Fluorescence emission occurs at ar ound 600nm.DHE was dissol ved in DMSO at the concentration of 10 g/ml. Mice were given intraperitoneal injections (5 g/mg) of freshly prepared DHE ( hydroethidine Invitrogen,Carlsbad CA) and euthanized after 18 hours. Eyes were

PAGE 82

82 rapidly removed and frozen in OCT compound Tissues were processed for cryomicroscopy, an d observed under a fluorescence microscope. RPE Fl at M ount M orphological A nalysis Mice were euthanized by overdose injection of ketamine/xylene mixture and e yes were enucleated, cornea, le ns and neural retina were removed. Then eyes were fixed with 4% par aformaldehyde for 1 hour at RT followed by immersion in ice cold methanol for 1 hr. Eye cups were then rinsed in PBS, preincubated in 10% normal goat serum for 1 hour. The eye cups were incubated in rabbit anti ZO 1 antibody at 1:500 (Invitrogen), then 2 hours in fluorophore conjugated secondary antibody at 1:500 (invitrogen). After rinses in PBS, four radial cuts were made and the eye cups were flattened and mounted on glass slides with Vectashield mounting medium (Vector Laboratories). The images were taken with a confocal microscope. Other Methods E lectroretinography was used to measure changes in the ability of the retina to respond to light. Spectral domain OCT and light and electron microscopy were used to measure changes in the retinal cell laye rs. All of the details about these methods are described in Chapter 2. Results Testing D oxycycline by ERG and F undus Imaging Doxycycline is a member of the tetracycline group of antibiotics that is clinically useful due to its broad ant imicrobial properties 218 It has a much longer half life in the human body than tetracycline itself. Doxycycline has been used not only as antibiotic agents but also as regulator of transgene expression of Tet tetracycline controlled transcriptional activation. Tetracycline derivatives have good

PAGE 83

83 penetration of the blood brain barrier are anti inflammatory 219 and possess anti apoptotic activities Due to these properties, it has been considered as a therapeutic agent for retinal disease such as AMD and diabetic retinopathy 220 Although it is a neuroprotective agent, it has also been shown to have variable or even contradictory results in different animal models of neurodegeneration 221 Tetracycline impairs mitocho ndrial function and interrupts the microglial activation in higher doses 222 s erious adverse effect s such as visual loss were described during long term or high d ose systemic minocycline therapy 223 The effects of various doses of minocycline were tested in RPE cell line. A t low concentrations of minocycline, the drug stimulated the chemotaxis and inhibited the proliferation of RPE cells and at higher concentrations it decreased the viability of RPE cells through the induction of cell necrosis 224 To confirm that our usage of doxycyline is within the non toxic l evels, we analyzed scotopic ERG amplitudes and recorded fundus images for 2 month s after giving doxycycline to SOD2 f/f mice. Without the Cre transgene, the SOD2 ge ne should be expressed normally in these mice. As indicated in the Materials and Methods, these We detected no differences of ERG response and on in retinal presentation in SOD 2 f l /f l mice given with doxycycline compared to control mice which were not given doxycycline ( Figure 3 4 ) MnSOD L evel A fter I nducing Cre at A dult S tage Since AMD is the disease of later stages of life, we wanted to test if we could delete the SOD2 at adult sta ge by inducing C re at 3 month s of age After inducing providing doxycycline in the drinking water for 2 weeks, starting at P90, mice were euthanized two weeks later and western blot analysis was performed to measure the level of MnSOD. Unlike t he result of inducing cre from P 1, induction of C re at 3 month

PAGE 84

84 did not lead to significant reduction of MnSOD levels ( Figure 3 5 ). This result can be explained by the fact that the VMD2 mRNAs are reported to be expressed predominantly during neonatal stages and the ir proteins are mostly expressed from P 1 to P 15 205 Therefore, VMD2 promoter mediated expression of C re should be expressed effectively before the adult stage Detection of G al actosidase E xpression To verify that the induction of C re by doxycycline is capable of inducing recombination, we used a reporter strain, Rosa26 lacZ mice. In this strain, galactosidase gene is preceded by a splice acceptor and poly adenylation sites which are flanked by two loxp sites. By inducing C re, the stop codon is deleted by loxP mediated recombination, and therefore galactosidase gene is expressed. By mating the reporter strain with Cre expressing transgenic mice, we gene rated Rosa26 lacZ cre VMD2 Cre Tg mice. After inducing C re by doxycycline administration for two weeks the mice were euthanized and processed for cryosection ing Immunostaining with a nti galactosidase antibody showed that in the Rosa26 lacZ / VMD2 Cr e Tg galactosidase was expressed in the RPE region but not in the Rosa26 lacZ mice lacking the VMD2 Cre transgene ( Figure 3 6 ). Induction of cre gene was also proved by X gal staining. The chromogenic agent used, X gal is cleaved by galactosidase and it produces galactose and 5 bromo 4 chloro 3 hydroxyindole. T he latter is then oxidized into 5,5' dibromo 4,4' dichloro indigo, an insoluble blue product Thus by X gal staining, expression of galactosidase can be detected indirectly. One month aft er delivering doxycycline, lacZ expression was assessed in RPE whole mounts. Since ROSA26cre mice had black background,

PAGE 85

85 the pigmentation of the RPE was bleached to visual ize the blue product. We found strong staining in a subpopulation of RPE cells in mi ce containing the Cre transgene but not in cre negative littermates ( Figure 3 7 ) And no staining was observed in whole mount s of the neural retina indicating that the Cre expression is specific to the RPE as expected using this promoter. Expression of Cre in VMD2 Cre M ice A fter D oxycycline I nduction To confirm that administr ation of doxycycline by food could lead to induce expression of cre recombinase, immunohistochemistry,western blot and RPE flat mount staining for Cre were performed. One month afte r introducing doxycycline into SOD2 f/f and VMD2 Cre Tg mice Cre expression was assessed by immunohistochemistry and western blotting. However, no positively stained RPE cells in retinal sections were detected although western blotting result showed the pr esence of C re positive band in the VMD2 Cre Tg lysate. Since Cre recombinase is a nuclear protein, C re localization was examined by co staining with DAPI using RPE flat mount Figure 3 8 showed in VMD2 CreTg (+/+) SOD2 f l /f l mice, Cr e recombinase(green) was expressed but no in the control. However, due to the failure of DAPI staining, detection of Cre recombinase in the nucleus was not able to be observed. SOD2 R ecombination A nalysis b y PCR U sing Genomic DNA The VMD2 C reTg SOD2 f l /f l mouse was designed to Cre mediated recombination of exon 3 of SOD2 gene. To verify doxycycline induced Cre was able to delete the exon 3 of SOD2 by Cre in vivo, genomic DNA was analyzed by PCR. Genomic DNA of RPE choroid complex from both doxycycline induced and non induced V MD2 CreTg (+/+) SOD2 f l /f l were extracted. Using specific primers for detecting exon 3 deletion, PCR analysis was performed. In the doxycycline induced VMD2 CreTg (+/+) SOD2 f l /f l mice, the

PAGE 86

86 exon 3 was deleted resulting in a 1.4 kb PCR product but not in co ntrol mice which showed wild type allele of 2.2 kb ( Figure 3 9 ) Examination of Reduced Levels of SOD2 Protein by RPE Flat Mount Manganese superoxide dismutase levels were observed by RPE flat mount staining with anti SOD2. Six week old VMD2 CreTg (+/+) SOD2 f l /f l and VMD2 CreTg (+/+) SOD2 f l / + mice which were given doxycycline were used. To visualize the hexagonal morphology of RPE, zonula occuldins 1 ( ZO 1 ) staining was performed The staining result indicated that the level of MnSOD in the VMD2 CreTg (+/ +) SOD2 f l /f l mice were reduced compared with the level of MnSOD in the VMD2 CreTg (+/+) SOD2 f l / + mice ( Figure 3 10 A & B ). The staining result showed there is not complete loss of MnSOD in the VMD2 CreTg (+/+) SOD2 f l /f l mice L acZ staining also indicated that C re expression did not occur throughout the RPE, indicating that we should not expect a complete loss of MnSOD protein. Increased Levels of Oxidative Stress in VMD2 CreTg SOD2 fl/fl Mice in the RPE To test deletion of SOD2 in the RPE can lead to increased levels of oxidative stress, we used two markers for detecting ROS, DHE and 8 hydroy 2 deoyguanosine ( 8 OHdG ) 8 hydroy 2 deoyguanosine is biomarker of oxidative damage to DNA. Dihydro ethidium specifically reacts with intracellular superoxide and is con verted to the red fluorescent compound ethidium in nuclei I n the RPE and retinas of VMD2 CreTg (+/+) SOD2 f l /f l DHE fluorescence was increased compared with non transgenic SOD2 f l /f l mice ( Figure 3 1 1 ) Of note, the increase in DHE staining was observed bo th in the RPE and in the photoreceptor layer of SOD2 deleted mice. To compare the level of 8 OHdG in VMD2 CreTg (+/+) SOD2 f l /f l and SOD2 f l /f l mice, RPE flat mount staining with an antibody recognizing 8 OHdG was performed. T he

PAGE 87

87 distribution of 8 OHdG staini ng pattern was around nucleus, possibly within mitochondria. The overall labeling intensity was higher in the VMD2 CreTg (+/+) SOD2 f l /f l compared with control mice although relative intensity of 8 OHdG staining was not homogeneous among cells ( Figure 3 1 2 ) Interestingly, cell s that were larger and more irregular in shape had more 8 OHdG immune reactivity. M orphological C hanges of RPE To assess changes in the RPE related with SOD2 knockout in the RPE, RPE flat mount staining with ZO 1 antibody was perform ed. RPE tight junctions consist of a complex of proteins including claudins, occludin, and ZO 1 Occludin is a transmembrane protein and ZO 1 is a peripheral ad aptor protein, linking occludin with the actin cytoskeleton. Therefore, occludin and ZO 1 are considered as markers of tight junction structure between RPE cells 225 VMD2 CreTg (+/+) SOD2 f l /f l mice induced with doxycycline were used for whole mounts of RP E to examine geometric changes of RPE. Among the regular hexagonal RPE cells, irregularly shaped cells such as were examined. One distinguish ing feature of RPE morphology was the increased numbers of binucleated and larger RPE cells ( Figure 3 1 3 ) The mechanism for forming these features is unknown, but bi nucleation and enlargement of RPE were shown to be associated with the drusen in human AMD samples 18 T hese results suggest that VMD2 CreTg (+/+) SOD2 f l /f l mice might recapitulate this feature of the RPE response in human AMD OCT M ea surement of ONL T hickness Spectral domain optical coherence tomography (SD OCT) was used for measurement of ONL thickness. By 2 month s after ind uction of C re, there was no

PAGE 88

88 statistically significant differences of ONL thickness between SOD2 fl/fl with C57 BL/6J background control and VMD2 CreTg (+/+) SOD2 f l /f l mice. The ONL thickness was also observed at 3 and 10 month s post induction. As mice age, there was progressive decrease of ONL thickness in VMD2 CreTg (+/+) SOD2 f l /f l mice as opposed to SOD2 fl/fl con trol mice ( Figure 3 1 4 ). However, we have not had produced a sufficient number of mice on the C57Bl/6 background to test the reproducibility of this finding. These experiments are still in progress, as more mice become available. Reduction of E lectrophys iological R esponses Historically, ERG has not been used as a diagnostic method for AMD. However, some research groups have found the significant differences between AMD patients and normal controls not only in the cone mediated ERG but also in the rod med iated ERG 226 228 Brunner described the scotopic b wave as a diagnostic tool in macular disease 229 To see if there is rod mediated ERG change in our animal model, we performed ERG measurement of VMD2 CreTg (+/+) SOD2 f l /f l mice with and without doxycycline introduction by 2 and 3 month post doxycycline treatment. Unl ike the ERG results of Cre injected and ribozyme injected mice, only b wave of ERG was reduced a t 2 and 3 month s post doxycycline treatment ( Figure 3 1 5 ). These results are now being repeated with VMD2 CreTg (+/+) SOD2 fl/fl mice bred to a C57Bl/6 background Increased A utofluorescence of RPE It has been suggested that increased lipofuscin content of the RPE is associated with AMD phenotypes 230 Recently, Hollyfile sub affected eyes and age matched control eyes 231 Recent data of fundus autofluorescence suggested that the spectrum in regions with drusen is shifted toward shorter wavelegnths 232

PAGE 89

89 RPE deposits contribute to the autofluorescent spectrum of the fundus when excited wit h 364 or 488 nm ligh t. Using the spectra 408 and 488 nm, w e examined the autofluorescence spectra of choroid and RPE of our mouse model. With both wavelengths, approximately 10 times increased spectra of RPE and choroid were observed in 4 month old VMD2 CreTg (+/+) SOD2 f l /f l mice as compared with control mice ( Figure 3 1 6 ) Examination of the F undus Earlier in this study, examination of fundus was difficult due to the FVB/N background of VMD2 Cre mice. In addition to this, the fundus of VMD2 C reTg SOD2 f l /f l mice showed var iable phenotypes in which some pups from same mom showed normal fundus image and some showed abnormal blood vessel formations. The exact mechanism leading to this variable fundus image s was unclear, but I speculat e that inconsistent genetic background of pups from VMD2 C reTg x SOD2 f l /f l breeding might be the reason Therefore, we started to breed VMD2 C reTg and SOD2 f l /f l mice to C57BL/6 respectively to have consistent genetic background. Using back crossed VMD2 C reTg SOD2 f l /f l mice, we performed fundus analysis. At 6 weeks of age the fundus microscopy of these mice showed several white deposit formations distribute d in focal re gions ( Figure 3 1 7 ) Moreover increased tortuosity of retinal blood vessels were seen in the area surrounding white deposits. These results imply that complete deletion of MnSOD in the mouse RPE may lead to pathological phenotypes associated with retinal degenerative disease as early as 6 weeks old. However, histological analysis of these eyes has not been performed to identify the cause of the pigmentary abnormalities in these young mice. Consequently, whether these spots correspond to drusen or to reticular pseudodrusen remains to be established

PAGE 90

90 Histological E xamination After establishing the VMD2 C reTg SOD2 f l /f l mice on a C57Bl/6 background histological analysis was performed from age 6 weeks old. Retinal pigment epithelium thickness was increased and the retina melanin granules tend to occupy more a pical portions of the cytoplasm ( Figure 3 18) Also observed was the tip s of the photoreceptors are dissociated from the RPE in these sections implying a defect in the function of the RPE or in the apical microvilli of the cells. The length of photoreceptor outer segments is also reduced, suggesting defects in maintenance of the structure of these cells. Ultrastructural A nalysis of the R etina Ultrastructural analysis of retinas treated with and without doxycycline was performed after the 7 month time point. Several changes were observed in the RPE region of retina treated w ith doxycycline including disorganization of rod photoreceptor outer segment s altered infoldings of basement membrane of RPE, disorganized ( Figure 3 19) Altered mitochondrial morphology such as increase d size was also observed ( Figure 3 19D) Again, a t t hat time point, the mice with consistent genetic background were not enough to make conclusions about the EM analysis. C onclu ding Statements Oxidative stress in the RPE has long been hypothesized to pla y a major role in the development of AMD due to the high oxidative environment of the retina fundus. Numerous studies have described the responses of oxidative damage induced RPE cell 233 235 However, cell culture studies are limited by differences in the environment of RPE cells in culture and in the intact eye s F or example, cell culture does not mode l

PAGE 91

91 RPE and choroidal endothelium on the basal side and the association of RPE microvilli and photoreceptor outer segments on the apical side. Oxidative damage induced AMD mouse model would facilitate the better understand ing of the mechanism of AMD pathogenesis. Several studies were pursued to generate and characterize the oxidative damage induced AMD mouse models such as the SOD1 / mouse 100 mice with iron overload 87 mice exposed to cigarette smoke 99 and oxidative damage induced inflammation model after i mmunization with mouse serum albumin adducted with carbo xyethylpyrrole 75 These animal models were generated by systemic manipulation of genes or environments, so there are limitations in terms of interpreting the data. To improve the strategies of generating AMD mouse models with oxidative damage, specific targeting of RPE cells would be a better strategy. In our approach, we choose to knock out MnSOD in the RPE due to it s vital role in protecting oxidative stre ss. Previously, Justilien et al used a ribozyme to block the expression of MnSOD and showed morphological and phenotypical characteristics similar to dry AMD 1 01 This approach led to approximately 60% reduction of MnSOD level. To further knock dow n the level of MnSOD, we chose C re mediated recombination of S OD2 C onditional Cre/loxP system is a powerful tool to regulate specific genes in spatial and tempo ral manner. This approach has been used extensively by several groups to achieve specific gene knock out in particular cell types 236 To characterize the in vivo response of the RPE to a reduction in MnSOD, we generated mice with an RPE selecti ve knock out of SOD2 by using C re mediated recombination system. We reasoned that complete loss of RPE MnSOD might mimic changes associated with

PAGE 92

92 AMD patient. Intriguingly we found that our mouse model lacking MnSOD in RPE region undergo es a series of morphological changes, many of which are reminiscent of those documented in human retinal degenerative disease. We validated our moue model system by : (1) verifying the reco mbination event, (2) demonstrating the reduction of MnSOD level, and (3) documenting increased oxidative damage. To confirm that the method of doxycycline administration works in mediating RPE specific C re induction and recombination, we used ROSA26 LacZ / V MD2 Cre mouse and examined galactosidase activity by immunostaining and X gal staining after inducing Cre. When these mice were treated with doxycycline, lacZ was expressed in RPE where C re was expressed. The staining results revealed that in ROSA26 / VMD2 Cre mice, lacZ was expre ssed only in RPE not in retina demonstrating RPE specific C re induction of our mouse model. The SOD2 gene was evaluated with genomic DNA PCR using specific primer s for the flanking region of exon 3 The PCR res ult showed doxycycline induced C re expressi on in the RPE media ted recombination of exon 3 of SOD 2 The expression of MnSOD2 was measured by staining RPE flat mounts using anti SOD2 antibody The result showed a reduction in levels of MnSOD. The level of oxidative stress was examined by using dih ydroethidium (DHE ) an d 8 hydro x y 2 deoyguanosine (8 OHdG) staining. In the VMD2 C reTg SOD2 f l /f l mice, increased levels of DHE indicate d a high level of superoxide production in the RPE and photoreceptors Liang et al revealed that in old rodent s ther e are increased levels of DNA damage marker, 8 OHdG in the RPE, preferentially in the mitochondrial DNA 237 E levated 8 OHdG levels were also found in donor eyes from AMD patient s compared to a ge matched controls 238 Our result showed the level of 8 OHdG staining was increased in RPE of VMD2 C reTg

PAGE 93

93 SOD2 f l /f l compared to control. The pattern of 8 OHdG staining using RPE flat mount se ems to be mitochondrial pattern. To verify this distribution staining with mitochondrial marker s such as 3 hydroxyacyl CoA Dehydrogenase Type 2 ( ERAB ) or c ytochrome c oxidase subunit I (MTCOI ) will be needed. Distribution of hypopigmentation of RPE as early as 6 weeks after C re induction seen in fundus analysis indicated that increased oxidative burden to the RPE may lead to some of the pathologies observed in dry AMD. In particular, we observed histological changes including disorganization of outer segment s altered infoldings of the basement membrane of RPE, decreased cytoplasmic density in RPE. Decreased ONL thickness in C re induced mice indicated chronic oxidative damage in the RPE leads to loss of photoreceptors. Loss of PR has been reported to be a key player in GA progression 239 Recently, Bearelly et al analyzed photoreceptor(PR) layer loss at the margins of GA using a spectral domain OCT and found that PR loss occurred in 65% of GA cases 240 When C57BL/6J background VMD2 C reTg SOD2 f l /f l mice we re examined for their histol ogy m elanin granules appeared shifted toward apical side of RPE which is typical phenomenon after injury or disease. Shifting of melanin granules may be a general indication of RPE stress and this phenotype was seen in p27kip1 knockout mice 241 Ret inal pigment epithelium morphology was examined by preparing flat mounts of RPE. In wild type RPE, the normal epithelium consists of relatively uniform polygonal cells. In our RPE specific SOD2 knockout by contrast, RPE cells were often larger in diamet er and less regular in outline were examined. This alteration might be an epithelial mesenchymal transition (EMT) like phenotype in which their cuboidal morphology changed to a

PAGE 94

94 flattened structure lacking the clear morphological hallmarks of RPE cells 236 These observations must be confirmed by examining EMT morphological markers such as GFAP, vimentin and N cadherin 242 The sporadic distribution of larger cells could also be due to spreading of adjacent cells toward dead cells in the absence of cell proliferation. Some of the RPE cells seem t o be elevated in flat mount prepar ation. S ince RPE cells are highly phagocytic, the dead RPE cells are likely to be phagocytosed by the adjacent RPE cells, which result in the extrusion of the dead cell into the subretinal space. Similar phagocytic RPE r esponse to damaged cells has been reported during healing of small wounds induced by laser photocoagulation in rabbit RPE 243 Electroretinogram measurement s showed only b wave E RG response was reduced but not a wave However, these findings were made at early stages following induction (2 and 3 months) and in mice of heterogeneous genetic background. This may reflect the case of patients with early AMD, for which inconsistent ERG results have been reported. We will repeat the long term ERG analysis using the mice with C57BL/6J background. Results with our other methods of MnSOD depletion (see chapters 2 and 4) indicate a loss of both a wave and b wave response. Clinical auto fl uorescence techniques have been used to monitor the two major pigments of the RPE: lipofuscin and melanin. T heir distribution is detected by s hort wavelength fundus auto fl uorescence ( SW FAF excitation 488 nm) and near infrared fundus auto fl uorescence ( NIR FAF excitation 787 ) respectively 244 It is believed that lipofuscin accumulation precedes photoreceptor degeneration, and is responsible for visual deficits, abnormal retinal sensitivity measurements in the central visual field, and

PAGE 95

95 slower rates of dark a daptation associated with age related maculopathy 245 247 Therefore, lipofuscin accumulation represents a common downstream pathogen ic mechanism in macular an d retinal degeneration. Using a lambda scan at exci tation wave 405 and 488 t he intensity of autofluorescence in the RPE and choroid showed increased autofluorescence levels in our SOD2 knockout mouse model. Despite the variability of genetic background of our transgenic VMD2 C reTg SOD2 f l /f l mice th eir phenotypic characteristics of our mouse model recapitulate the pathology of human AMD. T o have a better idea of our mouse model, further characterization of C57BL/6J background VMD2 C reTg SOD2 f l /f l mo use need s to be done. Additionally, validating that the phenotype is arising due to the loss of MnSOD additional models of MnSOD reduction will be described.

PAGE 96

96 Fig ure 3 1. Regulated deletion of SOD2 ( 1) targeting vector for generating SOD2 f l /f l m ice. Exon 3 of SOD2 was floxed by two loxp site ( 2) Cre expression system is based on the tet on system which rtTA binding to CMV promoter induce cre transcription. (A: upon doxycycline introduction, rtTA doxycycline complex binds to CMV promoter which in duces transcription of cre, B:transgenic constructs, rtTA expression is driven by RPE specific VMD2 promoter). Invest Ophthalmol Vis Sci. 2008 Mar;49(3):1248 53 Fig ure 3 2. Breeding sch eme of VMD C reTg mice with SOD2 f l /f l mice After genotyping, mice without Cre gene were discarded and only mice with Cre gene were used further breeding.

PAGE 97

97 Figure 3 3 Screening for rd mutant DNA was extracted from tail sample and performed PCR using primer for detecting rd mutant. 300 bp band for +/+ mice, 300 bp as well as 170 bp bands for rd/+ mice and 170 bp and 130 bp bands for rd/rd mice rd/+ Figure 3 4 Doxycycline toxicity was tested in 2 month old SOD2 f l /f l mice by administrating doxycycline. Fundus analysis and ERG recordings results show ed there were no significant differences between mice w ith an d without doxycycline induction. ( n = 4)

PAGE 98

98 A B Figure 3 5 Induction of Cre at 3 month does not lead to efficient reduction of SOD2 SOD2 protein levels from the RPE of SOD2 fl/fl VMD2Cre + with doxycycline (at 3 month) and without doxycycline were analyz ed. A) The Western blot and B) the quantification of SOD2 protein. There was no statistical significant reduction of SOD2 in the SOD2 fl/fl VMD2Cre + mice which were given doxycycline. A B Figure 3 6 Cre mediated recombination was showed by immunostaining of galactosidase in the RO SA26 / LacZ Cre mice (red: anti gal, blue: DAPI)

PAGE 99

99 A B C D E F Figure 3 7 Detection of galactosidase expression (blue) in the ROSA26 Cre mice with induction of doxycycline by x gal staining. A C) ROSA26 / LacZ VMD2CreTg mice, D E) ROSA26 / LacZ mice, (A C and D,E ; 10x, D:4x)

PAGE 100

100 A B C Fig ure 3 8 Expression of C re in VMD2 Cre mice after doxycycline induction. After administration of doxycycline into VMD2 Cre Tg and SOD2 f l /f l mice, A) W estern blot was performed using anti cre antibody. Cre was detected only in VMD2 Cre mouse (Cre + / ) not SOD2 f l /f l mouse (Cre / ) B ) & C ) Expression of C re was also analyzed by RPE flat mount staining with anti C re B ) VMD2 Cre Tg SOD2 f l /f l with doxycycline, C ) VMD2 Cre Tg SOD2 f l /f l w/o doxycycline

PAGE 101

101 Fig ure 3 9 SOD2 recombination analysis b y PCR using g enomic DNA RPE genomic DNA was extracted from VMD2 Cre Tg SOD2 f l /f l and SOD2 f l /f l mice. After deletion of exon3, 1.4kb of PCR product was detected in genomic DNA of VMD2 Cre Tg SOD2 f l /f l mouse.

PAGE 102

102 A B Figure 3 10 Cre mediated recombinati on in th e SOD2 f l /f l VMD2Cre + mice lead to reduction of MnSOD protein levels in the RPE. A ) & B ) Reduction of SOD2 in VMD2 C reTg SOD2 f l /f l mice was verified by RPE flat mount stained with SOD2 and ZO 1. A ) VMD2 Cre Tg SOD2 f l /f l ,B ) Non transgenic SOD2 f l /f l (r ed : anti SOD2, green: anti ZO1). A B Figure 3 1 1 Increased levels of DHE in VMD2 C reTg SOD2 f l /f l mouse. Mice were given intraperitoneal injections of DHE and euthanized after 18 hours. Tissues were prepared for cryosection and observed under a fluo rescence microscope (blue : DAPI, red : DHE ) A ) SOD2 f l /f l B ) VMD2 C reTg SOD2 f l /f l

PAGE 103

103 A B Figu re 3 1 2 Increased levels of 8 OHdg in 2 month old VMD2 C reTg SOD2 f l /f l mice RPE flat mount was stained with anti ZO1 and anti 8 ohdg to measure the level o f oxidative damage in DNA (green : anti ZO1, red : anti 8 ohdg ) A ) VMD2 C reTg SOD2 f l / + B) VMD2 C reTg SOD2 f l /f l

PAGE 104

104 A B Figure 3 1 3 Change of RPE morphologies. RPE flat mount was prepared from 4 month old mice and stained with anti ZO 1. In VMD2 C re Tg SOD2 f l /f l mice treated with B) doxycycline the RPE seem s to be larger than A) the control ( SOD2 f l /f l mice treated with doxycycline ) A B Figure 3 1 4 As SOD2 knockout mice age the ONL thickness was progressively decreased A ) 3 month s B ) 10 month s Left panel: control right panel : VMD2 C reTg SOD2 f l /f l

PAGE 105

105 A B C Figure 3 1 5. Scotopic full field ERGs of VMD2 C reTg SOD2 f l /f l mice with and without doxycycline administration. ERGs were measured at 2 and 3 month post doxycycline treatment. VMD2 C reTg SOD2 f l /f l mice given doxycycline shows 30% reductio n of b wave of ERG (P < 0.05)

PAGE 106

106 A B C D Figure 3 16. Increased a uto fluorescence in RPE of VMD2 CreTg SOD2 f l /f l 4 month old VMD2 CreTg SOD2 f l /f l mice together with SOD2f l /f l m ice as a control were used for cryosection. Wavelength scans were performed using 405 and 488nm laser lines of laser scanning confocal microscope (Leica TCS SP2 AOBS).

PAGE 107

107 A B C D Figure 3 1 7 F unduscopic examination of 6 w eek old VMD2 CreT g SOD2 f l /f l mice. Subretinal deposit formation and tortuosity of retinal blood vessel was examined in the VMD2 CreTg SOD2 f l /f l mice 6 weeks after inducing C re.

PAGE 108

108 A B C D Figure 3 1 8 Light micrographs of retinas of VMD2 C reTg SOD2 f l /f l mice Re tinas at 4 month after doxycycline treatment or control are shown (60x) B) In the doxycycline treated retinas, the RPE thickness was increased and the photorec eptor outer segment was detached from the RPE In the doxycycline treated VMD2 C reTg SOD2 f l /f l mice s ubretinal deposit s w ere occasionally observed ( white arrow )

PAGE 109

109 A B C D Figure 3 1 9 Ultrastructure changes in the outer retina at 7 mon ths after doxycycline treatment. In B) and D) doxy cycline treated group compared to A) and C) control the RPE melanin granule moved to the apical portions and RPE appeared damaged with loss of cytoplasmic space. The outer segments of increased. A ) and C ) SOD2 f l /f l B ) and D ) VMD2 C reTg SO D2 f l /f l wit h doxycycline induction A ) and B ) x5000, C ) and D ) x20,000

PAGE 110

110 CHAPTER 4 REDUCTION OF M nSOD IN THE RPE BY SUBR ETINAL INJECTION OF VMD2 RZ432 AAV1 Opening Remarks Our last strategy to increase oxidative stress in the RPE was to utilize riboz yme mediated knockdown of MnSOD in the RPE o f wild type mice. Previously Qi et al designed a hammerhead ribozyme against SOD2 to cleave the murine SOD2 mRNA. This ribozyme cleaves after nucleotide 432 (Rz432) of the mouse SOD2 transcript and was tested for its catalytic activity in vitro 248 Justilien et al tested the subretinal injection of AAV1 expressing Rz432 under the control of the hybrid CMV enhancer and beta act in proximal promoter into C57BL/6J mice and DBA 1J mice. They followed these mice for 4 months and observed phenotypes related to those seen in people with atrophic AMD including reduction of electroretinograph response d egeneration of the RPE thickenin g of Bruch's membrane, s hortening and disorganization of the photoreceptor outer and inner segments and i ncreased autofluorescence and elevated levels of A2E 1 01 To improve this strategy, we used RPE specific VMD2 promoter for expressing Rz432 in the RPE via an AAV vector and examined long term phenotypes ( up to 15 month s ). After subretinal delivery of VMD2 Rz432 using AAV1, I investigated the age related p henotypic and morphological changes of the outer retina thr ough electroretinogram, light and electron microscopic analysis, fundus analysis and SD OCT measurement of ONL thickness. Dark adapted full field electroretinogram (ERG) detected a time dependent decrease in the response to light. L ight and electron photoreceptor cells in ribozyme treated eyes. Retinal pigment epithelium morphological

PAGE 111

111 assays featured with abnormal distribution of RPE nucle i implicating the process of epithelial to mesenchymal transition ( EMT ) Fundus microscopic examination showed drusen like deposit formations which increased in number by age and geographic atrophy was predominately seen in the inferior region These results suggest Rz 432 treated mice shows many of the key element of human AMD and demonstrate a critical role of MnSOD in preventing age related macular degeneration. Materials and Methods Fluorescein A ngiography Fluorescein angiography is a tec hnique for visualizing the blood vessels in the retina, which utilizing the fluorescence emission of fluorescein dye. Fluorescein (0.02 ml of 25% fluorescein, Hub Pharmaceuticals, Rancho Cucamonga, CA) delivered once through intraperitoneal injection. On e minute after injection, we began taking images every minute which continued until the fluorescein was clearly visible. Choroidal neovascularization was evaluated based on the fluorescence leakage. AAV I njections Four weeks old C57BL/6J mice were injec ted with VMD2 Rz432 GFP expressing AAV1. Ten minutes before the injections, 1% atropine sulfate solution was placed topically on the eyes of the mice. The mice were anesthetized using ketamine/xylazine solution as previously described Groups of mice we re injected subretinally with 1 l of 2.5x10 12 particles per ml of ribozyme or CBA GFP as a control Using a Nikon SM2800 operating microscope (Nikon, Melville, NY), a 28 gauge hypodermic needle was used to puncture the cornea to create an aperture. A blu nt 32 gauge needle on a Hamilton syringe was inserted through the hole and vector was injected into the subretinal space. Ribozyme expressing vector and control vector were described in Figure 4 1 The mice

PAGE 112

112 injected with ribozyme and control were subjecte d to analyzing ERG (3 and 6 month s post injection), fluorescein angiography (7 and 15 month s post injection), fundus (7,12,15 month s post injection ) SD OCT (9,14,15,17 month post injection) and eventually euthanized for light and electron microscopic anal ysis (7 and 8 month s post injection) Fundus Analysis We use a Micron III retinal imaging microscope from Phoenix Research Laboratories to monitor pathological changes in the RPE. Mice were anesthetized by intraperitoneal (IP) injection of ketamine/xyl azine mixture (0.1 l/20g mouse) and eyes were dilated with 1.0% atropine. The vibrissae were trimmed with fine scissors to prevent them from obscuring the photograph. The mouse was held on its side on the microscope platform. Focusing was achieved by moving the mouse. T he mouse position and angle were altered to study different parts of the fundus. Other Methods Electroretinography was used to measure changes in the ability of the retina to respond to light. Spectral domain OCT and light and electron microscopy were use d to measure changes in the retinal cell layers. All of the details about these and other methods used are described in chapters 2 and 3. Results Expression of Rz432 in the RPE To target RPE for expressing Rz432, VMD2 Rz432 plasmids were packaged into AAV 1 After subretinal injection, the expression of VMD2 Rz432 GFP was confirmed by fundus analysis. By 4 month s post injection, GFP fluorescent signal was clearly seen in the Rz432 injected eye by digital fundus imaging using the Micron III fundus microscop e

PAGE 113

113 ( Figure 4 2 ) However, control eye s which were injected with AAV CBA GFP did not show strong GFP fluorescence in the fundus image. There are two likely explanations for the difference in fluorescence intensity: (1) The VMD2 promoter likely drive m ore GFP production in the RPE than the CBA promoter or (2) t he absorption spectrum of r hodopsin overlaps almost completely with excitation spectrum of GFP, and photoreceptors are intact in the eyes treated with the control virus. To test the long term ex pression of Rz432, we examined the GFP signal of 15 month old mice injected with Rz432. Cryosections of Rz432 treated mice were used to see GFP. Strong GFP signal were seen in the RPE area of Rz432 treated mice ( Figure 4 2 ) Reduction of Electrophysio logical Responses To assay the effect of Rz432 on the ability of the retinas of mice to respond to light, 3 weeks old C57BL/6 mice were injected subretinal ly with AAV1 expressing VMD2 Rz 432 in the right eyes. As a control left eyes were injected with AAV 1 expressing CBA GFP ( n = 7). At 3 and 6 months post injection, full field, scotopic electroretinography were performed to measure the response of Rz432 and GFP treated retinas to different intensities of light stimuli. Progressive loss of a wave and b wave respons e was observed between 3 and 6 months post injection ( Figure 4 3) By 3 month s post injection, an average 50% decrease in a wave amplitude and a 40% decrease in b wave amplitude were observed And by 6 month post injection, about 61% and 51% decrease of a and b wave were observed respectively ( Figure 4 3 ) This reduction in ERG amplitude was greater than that reported by Justilien et al. used the same ribozyme but a different promoter to drive its synthesis ( CMV beta actin ). Thus this phenotype is consi stent with AMD.

PAGE 114

114 Fundus A nalysis Geographic atrophy (GA) is characterized by the development of areas of outer retinal atrophy that slowly enlarge over time. Atrophic areas of retina are associated with retinal sensitivity resulting in a loss of vision. By 4 month s post injection areas of retinal lesion resembling atrophy were observed in the fundus microscope. These areas were coincident with the area in which GFP signals were seen. The number and size of retinal lesion regions were increased by 15 m onth post injection. A cardinal pathological feature of age related macular degeneration (AMD) is the deposition of extracellular material between the retinal pigment epithelium (RPE) and Bruch's membrane, pathologically described as sub RPE deposits. By 7 month post injection, a pattern of white spots were detected throughout the inferior pole. By 9 month post injection, mice fundus examination showed increased numbers of spots extending beyond the vascular arcades along with atrophic region ( Figure 4 4 ) To see if these deposits were subretinal deposit which reside in between the RPE and BM, OCT examination was performed as described below. Examination of R etinal V ascular C hanges The tortuosity of retinal blood vessels is a typical diagn ostic indicator for a number of retinal pathologies 249 It is one of the most important prognostic indicators in retinopathy of prematurity (ROP). It has been known that upregulation of vascu lar endothelial growth factor (VEGF) in a diabetic retinopathy induces retinal vascular damage such as microaneurysms, hemorrhage, venous beading and tortuosity and loops in the arteries and veins 250 Fluorescein angiography of my treated mice showed that the c ontrol eye had radially arranged arteries and veins which did not leak. However, tortuosity of retinal blood vess els were seen in 7 month old Rz 432 treated

PAGE 115

115 mice by examining the blood vessels using angiography Around the tortuous retinal blood vessels, blood leakage was also seen. One of the retinal blood vessels close to the optic nerve was discontinuous. Retinal hemorrhage in the inferior region of opt ic nerve was also seen by 1 year post injection By 15 month s not only tortuosity of blood vessels, but aneurysms in areas of geographic atrophy with thinned retinal vasculature and venous beading were detected by angiography ( Figure 4 5 ) Foci o f subr etinal hemorrhage in RPE s carring and atrophic retinal lesions were observed by 17 month post injection ( Figure 4 6 ) These pathological changes of vessels are very similar to those in vldlr / mice which shows retinal angiomatous proliferation phenotype 30 31 34 As the new retinal vessels anastomose with the c hor oidal vasculature as mice age, i t was unclear if the phenotypes seen in our mouse model is either retinal angiomatous proliferation 10 or choroidal neovascul arization Examination of R etinas by OCT Since we observed several white spots in the fundus image, SD OCT analysis of areas with white spots was performed to see if t hese spots are drusen. In mice 7 and 17 month post injection SD OCT images revealed several drusen like elevations b eneath the RPE ( Figure 4 7 ). This resemble s SD OCT images seen in AMD patients 251 Fourtee n months after injecting the AAV ribozyme, ONL thickness was measured by OCT. Similar to the result of Cre injected mice, 30% reduction of ONL thickness was observed in Rz 432 treated eyes compared to control eyes ( Figure 4 8) As the mice aged, the thickness of ONL was gradually decrease d ( Figure 4 9) RPE M orphological A nalysis Four month s post injection of VMD2 Rz432 flat mount staining using antibody against ZO 1 was performed for visualizing RPE tight junctions and the outline of RPE

PAGE 116

116 cells. Compared with control eye, the ZO 1 stai ning in the VMD2 Rz432 injected mice showed that individual RPE cells became enlarged and irregular in shape with clumps of several RPE cells ( Figure 4 10 ) Their nuclei were moved to the edge of the RPE cells. Another interesting observation was binuclea tion of RPE which was shown to be associated with equatorial drusen 18 Id entification of Increased Expression of Complement Factors Recent studies suggested that complement activation is related with an early event in drusen biogenesis. Numerous complement factors like C3, C5, CD46 and MAC were found to be molecular constitue nts of drusen 252 suggesting involvement of disordered immune system in AMD. In the SOD1 knockout mouse which recapitulate s some feature of the AMD phenotype, increased levels of vitronectin, C3 and c luster of differentiation 64 ( CD46 ) were observed in the subretinal region 100 Complement factor C3 plays a central role in the activation of complement pathway. Cluster of differentiation 64 i s a ligand of complement factors C3b and C4b and inactivates these components, thus protecting the host cells from damage by complement. To examine if complement factor expressi on was increased in our mouse model, we performed the immunohistochemistry for markers of drusen, including vitronectin, C3 and CD46. Increased levels of CD46 throughout the RPE area of Rz432 treated eye were detected but not in control eye, indicating po ssible enhanced complement activation ( Figure 4 1 1 ) Levels of C3 were also increased under the RPE region in Rz432 treated eye. However, no vitronectin accumulation was observed. Examination of Histological Damage of the Outer Retina Degenerative chang es of the RPE and retina has been reported in human eyes donated by AMD patients Previously, we have observed the h istology of early time

PAGE 117

117 points ( up to 4 month s ) after injecting the Rz432 The analysis revealed de pigmentation and atrophy of the RPE sho rtened outer (OS) and inner segments (IS) of p hotoreceptors and the thinning of the outer nuclear layer (ONL ) 101 To look at the long term effects of Rz432, we examined the histology after 7 month s of Rz432 treatment. By 7 month s after injecting VMD2 Rz432 RPE thickness was shown to be increased possibly due to the accumulation of extracellular materials a nd undigested waste materials ,a nd decreased thicknes s of outer segments ( OS ) inner segments ( IS ) and outer nuclear layer ( ONL ) were observed. In addition to these, subretinal deposits and detached OS were observed in Rz432 treated mice ( Figure 4 1 2 ) Ultrastructural Analysis of the Outer Retina Degenera tion of retinas and RPE was also examined by electron microscopy by 8 month s post injection. Several changes were observed in the RPE of retinas treated with ribozyme, including i increased subretin al folding Mitochondrial changes were also distinct such as fragmentation and loss of cristae ( Figure 4 1 3 ) Conclu ding Statements The purpose of this study was to improve the method s and examine for longer period of time of the impact of an AAV deliver ed SOD2 specific ribozyme 101 We employed RPE specific VMD2 promoter instead of cytomegalovirus beta actin ( CBA ) promoter in the Rz432 vector and examined the phenotype and mor phology of retinas for over 1 year Unlike other oxidative damage mediated AMD mouse models in which these mice changes are observed after 1 year 76 100 253 the AMD like changes in our ribozyme induced oxidative stress model resembling AMD lesions began early. At 3 month s dark adapt ed rod ERG measurement s showed reduced a wave and b wave

PAGE 118

118 response in which the extent of reduction was increased by 6 month. A linear decline in amplitude of the ERG response with age was reported in AMD patients 254 However, previous ly reported AMD mouse model s showed varying impact on the ERG response F or example, knock out mouse of both Ccl2 and Ccr2 showed no significant changes in the ERG response 23 and in mice with an Efemp1 mutation, the ERG response was not altered even if mice exhibited structural abnormalities 255 Our mouse model showed alteration in ERG response consistent with the phenotype of AMD patient s At 7 months post injection, f undus microscopic analysis showed a pattern of small white spots in inferior reg ion which increased in number by 9 month s This pattern of spots were similar to that seen in rd mutant mice 256 In addition atrophic retinal lesions were shown by 4 month s post injection, and these lesions were increased in size by 15 month s We found more spots and retinal lesions in the inferior region of the retina. The inferior portion of the retina is exposed to more environmental light than the superior hemisphere. Therefore, the more severe changes that we observed in the inferior may be due to increased susceptibility to light mediated retinal damage resulting from a lack of MnSOD. Several ultrastructural changes of outer retina including thickened BM and RPE, loss of PR and increased folding of RPE are casua lly seen in human AMD patients. Thickening of BM is thought to be caused by incomplete clearance of waste material discharged outward by the RPE, causing deposit buildup. Subsequently, this causes inhibition of metabolic exchange and fluid movement which is important in the pathogenesis of AMD. The histopathology of Rz432 injected mice mimics the phenotypes described above including i

PAGE 119

119 membrane and increased subretinal folding Mitochondrial changes such as fragmentation and loss of cristae were also appar ent From histological studies, it has been suggested that lo ss of photoreceptor cells occur s progressively in early stage AMD 257 258 Optical coherence tomography measurements of ONL thickness of the Rz432 treated mice were shown that there was progressive loss of p hotoreceptors, possibly as a consequence of RPE dysfunction. RPE morphological studies by staining the RPE f lat mounts with ZO 1 showed that nuclei of RPE cells were concentrated along the RPE tight junction s away from the center. Also, some of the cells had fragmented nuclei which might be interpreted as the cells were either dead or dying. Interestingly, thi s RPE change of nucleus is very similar to be seen in Ccl2 / / Cx3cr1 / mouse (by Dr. Mark Krebs ). From the pers pective that the injury occurr ing in Ccl2 / / Cx3cr1 / mouse is related to microglial activation 259 this RPE change might be a consequence of microglial movement. Increased activation of complement factors, C3 and CD46 were detected in the Rz 432 treated eye. CD 46 staining was seen in entire RPE of Rz4 32 treated eyes but not in control eyes. These findings are compatible with human AMD eyes in which CD46 localizes on RPE cells adjacent to and overlying drusen 260 Complement factor C3 activation was examined in the subretinal area in which drusen is found in AMD patient s This result is correlated with the fact that drusen possess substructural domains that contain activation specific fragments of complement co mp o nent C3. Bioactive fragments of C3 (C3a) and C5 (C5a) has been shown to induce vascular endothelial growth factor expression in RPE cells which can explain the presence of soft drusen are a risk factor for CNV in AMD eyes 261 Since our

PAGE 120

120 immunostaining results of C3 and CD46 does not show high differences between Rz432 treated and control, we need to confirm this result with further experiments proba bly using RPE flat mount staining of complement factors. Immunostaining using cryosection has limitations such that it is hard to get sections of damaged RPE region. Therefore, instead of using good sections for staining, examining the whole RPE area mig ht be better to see the overall increased levels of complement factors. To observe the retinal vascular changes of Rz432 treated eyes, fluorescein angiograph y was performed. By 7 month s post injection of Rz432, pathological features such as readily iden tifiable, isolated leaky lesions were examined. By 15 month s post injection, vascular tortuosity of blood vessels was also observed. These characteristics are s imilar to be seen in the human diabetic retinopathy which shows retinal pathology including mi croaneurysms, vessel leakage, and tortuosity. In diabetic complications, oxidative stress plays a pivotal role in which metabolic abnormalities of diabetes cause mitochondrial superoxide overproduction 262 Considering Rz 432 treatment was to increase superoxide production, these vascular changes could be due to the oxidative stress response. Because VEGF is involved in vascular changes in diabetic retinopathy it will be worth wihle to examine VEGF level s in mouse model. The hyperfluorescence seen in fluorescein angiography can be due to eith er choroidal neovasculation or retinal angiomatous proliferation (RAP) in which retinal capillaries proliferate originating from the re tina and extend ing posteriorly into the subretina l space, eventually communicating with choroidal new vessels. This condition is present in approximately 12% to 15% of patients with newly diagnosed neovascular AMD 263 46 47

PAGE 121

121 Further work will be needed to distinguish if t hese vascular changes are either CNV or RAP. T he region with hyperfluorescence corresponded to the region of damaged RPE. Since a confluent RPE monolayer normally masks choroidal hyperfluorescence whereas loss of RPE function exposes it, it might just the consequence of geographic RPE atropy. Fund us microscopic examination showed hyperfluorescent spots were distributed in Rz432 treated mice. To verify it these spots are subretinal or sub RPE deposit, we observed these particular areas with OCT. Optical coherence tomography examination of 9 month old Rz432 treated mouse with hyperfluorescent spots showed elevation of materials underneath retinal space indicating subretinal deposits formation. In 15 month old mouse with atropic like lesion, a sub RPE deposit, presumably a n Al though these results need to be confirmed by immunostaining for drusen markers or histology for the presence of deposits underneath RPE, it suggests that Rz432 treated form of AMD. Overall, our system models chronic oxidative stress in th e RPE which led to progressive functional and histological changes to the retina recapitulating phenotypes of AMD

PAGE 122

122 A B Fig ure .4 1. Maps of recombinant AAV vector A) VMD2 SOD2Rz432 GFP B) CBA GFP viral vectors Constr ucts were packaged in AAV serotype 1 capsids. TR inverted terminal repeats; VMD2 vitelliform macular dystrophy 2 ; SD/SA splice donor/acceptor site

PAGE 123

123 A B Fig ure 4 2 Expression of VMD2 Rz432 GFP in the RPE. A) A representative funduscopic examinati on of GFP expression at 4 month s post injection. B) A retinal section from an eye treated with VMD2 Rz432 GFP 15 month s post injection. Cells expressing the vector are shown in green.

PAGE 124

124 Fig ure 4 3 Scotopic full field ER Gs of C57BL/6 mice injected with AAV1 VMD2 Rz432 (right eye) or GFP control vector (left eye) ERGs were measured at 3 and 6 months post injection. Mice treated with Rz432 show progressive loss of ERG response that is significant by 3 months post injection The graph shows the ratio of the maximum a wave and b wave amplitudes of Rz432 to GFP control treated ( p<0.05, n = 7). Error bars represent standard error of the mean.

PAGE 125

125 A B C D Figure 4 4. Funduscopic changes of Rz432 injected eyes. Increased numbers of white s pots were observed as mice age A ) and B ) 7 month s post injection. C ) and D ) 15 month s post injection These are same eyes at different time points.

PAGE 126

126 Fig ure 4 5 To visualize the retinal vasculature, fluorescein was in jected (I.V.) into mice. Fluorescein angiography was performed 10 min post injection of fluorescein. Increased tortuosity of retinal blood vessels was observed by 7 month s and thinned retinal vasculature and venous beading were examined by 15 month s post i njection. ( A rrow s indicate venous beading) A ) and B ) are from the same mouse as are C ) and D )

PAGE 127

127 Figure 4 6 Foci of hyperfluorescence indicate RPE cell loss and retinal degeneration in scarring and atr opic retinal lesions. The damaged area increased in size as the mice aged.

PAGE 128

128 A B C D Fig ure 4 7 By fundus microscope, atrophy like damaged retinal region was examined in Rz432 inje cted eye 15 month s post injection The particular region of retina was observed by OCT. S everal deposits were examined such as subretinal deposit and sub RPE deposit A ) F unduscopy of Rz432 injected eye, 15 month s post injection B ) S ubretinal deposit form ation in the affected area C ) and D ) drusen like formation in the affected area

PAGE 129

129 Figure 4 8 Quantization of the thickness of t he outer nuclear layer OCT measurement of ONL thickness 14 month s post injecting Rz432, ONL thickness was examined by OC T. 30% reduction of ONL thickness w as observed compared to control (p=0.003)

PAGE 130

130 Control Rz432 Figure 4 9 T hinning of ONL thickness as mice age measured by OCT Compared to ONL thickness by 9 month old age, decreased thickness of ONL was examined by 17 month old ag e, (upper panel: 9month old, lower panel: 17 month old).

PAGE 131

131 A B Figure 4 10 RPE flat mount was examined for their morphology w ith ZO 1 staining. Morphological changes of RPE derived from Rz432 treated mouse showed displacement of nucleus to peripheral region and larger RPE cells (blue: DAPI, green: ZO1)

PAGE 132

132 A B C D Figure 4 1 1 Cryosections of Rz432 treatment were use d for Immunostaining A) & B) with anti C3 and C) & D) with anti CD46 antibodies to examine levels of complement factors. I ncreased levels of complement factors (C3 and CD46) were detected in Rz432 treate d mice (C3 : Red, CD46 : Green ) A ) and C ) are contro l s B ) and D ) Rz 432 treated mice

PAGE 133

133 A B Figure 4 1 2 L ight microscopic analysis of retinas treated with VMD2 Rz432 AAV1 A) control, B) VMD2 Rz432 AAV1 injected. D ecreased ONL length and increased RPE thickness was examined i n the VMD2 Rz432 AAV1 treated (7M )

PAGE 134

134 A B C D Figure 4 1 3 Ultrastructure changes in the retina at 8months after Rz432 treatment. A ) and C) control, B ) and D) VMD2 Rz432 AAV1 injected. In Rz432 treated retinas compared to control injected retinas, there is increased thickening in th (blue arrow) and lipid droplet formation (red arrows) were observed In B )

PAGE 135

135 CHAPTER 5 CONCLUSIONS Summary Age related macular degene ration is a common ocular disease characterized by loss of vision in the center of the visual field. The prevalence of AM D is increasing, and it is recognized as one of the major blinding disease in the world 8 264 Although treatment for CNV exists, no effective therapy is available for GA. Hence, knowing the molecular pathway that leads to AMD developmen t might help to find therapeutic targets. From this perspective, animal models modifying specific pathway may help to find proper targets. In this study, I showed in mice that excessive oxidative burden on the RPE contribute to the development of AMD. Specifically, I used three different approaches to achieve RPE specific reduction of MnSOD. Subretinal injection of VMD2 Cre AAV1 to SOD2 f l /f l mice, induction of C re by doxycycline administration to VMD2 C reTg SOD2 f l /f l mice and an AAV ribozyme mediated knockdown the mRNA of MnSOD in the RPE of wild type mice. Although t hese different methods did not show exactly the same results my overall conclusion was that knocking down MnSOD in the RPE led to the AMD like retinal lesions We observed a progressive loss of ERG response, histological changes including vacuolization, s membrane and reduction of ONL thickness. Funduscopic changes include increased numbers of white spots as mice age which might be subretinal or sub RPE deposit s With fluorescein angiography, vascular changes such as venous beading and vascular tortuosity were observed Furthermore, c hanges of RPE morphology such as shedding

PAGE 136

136 of RPE and displacement of RPE nuclei to peripheral reg ion s were phenomena that appear in other animal models of AMD Comparison to Other Animal Models of AMD Animal models of AMD could contribute to understand ing the pathogenic mechanism and to find ing therapeutic targets for AMD. For these reasons, t here have been intensive e fforts to generate mouse models of AMD by manipulating candidate genes and by using physical methods. Mostly, mice have been used as models of age related macular degeneration because of their genetic malleability, despite the fact that they do not have a macula. For the genetic method, systemic deletion of candidate genes or over expressions of specific genes in mice has been used to generate AMD like pathology. These include Ccl 2/Ccr 2 Abcr Vldlr and ceruloplasmin (Cp) / hephaestin (Hp) knock out mice and transgenic mice with over expression of VEGF 122 There are many hypotheses explaining how AMD develop s including complement activation, macrophage chemot axis, altered lipid metabolism and increased the role of oxidative damage. As oxidative stress has been proposed as a main mechanism leading the pathogenesis of AMD, s everal genetic mod els has been created by increasing the levels of oxidative stress such as C p/Hp d ouble knock out mouse 116 and SOD1 knock out mo use 100 Compared to the animal models of AMD mentioned above our mouse model was generated combining three factors which were shown to be involv ed in pathogenesis of AMD. They include, (1) targeting RPE as a main pathologi cal tissue, (2) gener ating increased oxidative stress and (3) mitochondria l source of oxidative stress. The advantage of our mouse model is that w e can delet e MnSOD at a specific time point either early or later in life time by administrating dox ycycline or injecting VMD2 Cr e

PAGE 137

137 Therefore, we can examine the pathological phenotypes depending on the timing of oxidative damage. In addition to being able to control the site and timing of oxidative stress, our mouse model also create s a more relevant disease phenotype. As was seen fr om the various experiments in RPE flat mounts, the pathological effects were not distributed homogen e ously throughout the RPE. Instead, the effects were distributed in t he AMD patients. While the oxidative mode ls of AMD presented here have benefits over current AMD mouse models t here are different advantages and disadvantages amongst the models The primary advantage of the models using Cre mediated recombination is tha t the recombination is irreversible leading to the permanent down regulation of MnSOD, whereas the ribozyme based strategy requires constant metabolic activity (i.e. ribozyme transcription and activity) for MnSOD suppression. Another distinguishing factor is whether a subretinal injection is required or not. The transgenic mouse model using d oxycycline induction does not require an injection and therefore does not cause any damage to the retina However, while the doxycycline induced, Cre mediated, recom bination has two key advantages over the other two models it sacrifices the ability to use the contralateral eye as a control. Since the models present with similar phenotypes and the key differences have been noted, a rational choice of which model to use can be made on a case by case basis. Future Studies Due to the variability our genetic mice background and consequent ly, variability of phenotype we had to breed VMD2Cre Tg SOD2 f l /f l mice with C57BL/6 for 6 generations. Since these newest versio n of VMD2Cre Tg SOD2 f l /f l on the C57BL/6

PAGE 138

138 background mice are only now available further characterization of these mice using similar method is necessary. In addition, the SOD2 f l /f l mice for injecti on of AAV1 VMD2 Cre have been breeding with C57BL/6 to h ave consistent genetic background and recently we have obtained pups from this breeding. We will use the methods de s cribed in this dissertation to observe their phenotypes as the mice age using fundus, OCT and histology. In the VMD2 Rz432 injected eyes, I examined the abnormal RPE morphology such as purs e string and movement of nucle i to the peripheral regions of RPE cells These phen otypes are very similar to those observed in the RPE of Ccl2 / Cx3cr1 / mice. The mechanism behind these changes is unc lear H owever by the fact that the phenotypes found in Ccl2 / Cx3cr1 / mice are related with microglial activation, this might be the consequence of an immune response stimulated by RPE damage To have better understand ing the mechanism behind this st aining with microglial markers such as CD11b might be helpful since microglial activation in the subretinal space is reported to evoke some features of AMD 29 To better understand the mechanism of vascular changes observed in Rz432 injected mice retinal and RPE flat mount will be used for staining with isolectin B4 to examine the vasculature and to analyze the location of retinal vasculature using a multiphoton microscope. If the growth of vasculature is originated from retinal, it could be retinal angiomatous proliferation ( RAP ) otherwise, it might be choroidal neovascularization ( CNV ) For the R z 432 injected mice, we have been testing drugs to treat the retinal degeneration (see below). H owever, having subretinal injection wi thout damage is sometimes challenging Therefore, noninvasive methods such as using VMD2Cre Tg

PAGE 139

139 SOD2 f l /f l mice for testing drugs or gene therapy might be better. Once we set our breeding and have enough pups with C57BL/6 background, we will use these mic e for testing drugs and gene therapy for antioxidant genes. In my mouse model, knocking down MnSOD seems to lead the cardinal features of AMD such as drusen, CNV, autofluorescence and histological changes of retina RPE. To better characterize my mous e model in biochemical perspective protein oxidative marker like protein carbonyl and lipid peroxidation marker like malondialdehyde will be necessary to assess the levels of oxidative stress. Although MnSOD is essential for defending cellular superoxide production and deficiency of MnSOD might trigger high oxidative stress levels, there are other compon ent s to overcome oxidative stress, such as glutathione peroxidase and cytoplasmic CuZnSOD So examining other oxida tive stress response molecules will lea d us to better understand the mechanisms of our mouse model As we created an in vivo model of chronic oxidative stress in the RPE layer of the retina the next step is to test antioxidant drug or perform gene therapy using this model. Currently, our lab has begun testing several therapeutic genes and compounds using our mouse model. First, we will test subretinal injection of therapeutic genes. These include siRNA against p22phox one of subunits of NADPH oxidase which is one of the main generator of s uperoxide in the RPE 265 and sequ estosome 1 ( SQSTM1), an activator of antioxidant response element ( ARE ) The ARE is a cis acting element found in the promoters of genes encoding the two major detoxication enzymes, g lutathione S t ransferase A2 ( GSTA2 ) and N ADPH: q uinone o xidoreductase 1 ( NQO1 ) 266 267 Several elements are found to be upregulated by ARE such as NF E2

PAGE 140

140 related factor 2 ( NRF2 ) 268 and sequestosome 1 ( SQSTM1 ) 269 Among those genes, we wil l test overex pression of AAV1 SQSTM1 in the RPE to defend against oxidative stress in our SOD2 deletion model. Another approach is to test newly discovered compound Al 1, the inducer of ARE that activates Nrf2 by covalently modifying Keap1, the negative regulator of Nrf2 270 By administrating this compound through gavage feeding or subcutaneous injection, we will examine the extent of protection of this compound against oxidative stre ss in the RPE and retinal damage. Finally, we have test ed subcutaneous injection of 5 HT 1A agonist N,N dipropyl 2 aminotetralin (8 OH DPAT) in our mouse model. The 5 HT 1A agonist protects RPE cells from 7 ketocholesterol induced oxidative stress and topical application of 5 HT 1A agonist protected the rat retina from blue light damage. Our results showed that daily subcutaneous injection of 8 HO DPAT reduced the rate of ERG decline, reduced the accumulation of autofluorescent material and preserved the thickness of the ONL in mice treated with the SOD2 spe cific Rz432. Closing Remarks In last 5 years, there has been considerable research to develop treatment for AMD. Although the treatment for CNV exist s none exist for dry AMD which may also lead to blindness if the disease progresses to geographic at rophy Numerous studies have been pursuing the pathogenesis of AMD and these studies may ultimately lead to the identification of new therapeutic targets. Biochemical and histological studies of AMD have implicated oxidative stress as a main factor to lead ing to AMD. Mouse model with chronic oxidative damage in the RPE will be useful to test various antioxidant chemicals and efficacy of gene therapy for AMD.

PAGE 141

141 In closing, we have generated an in vivo model of chronic oxidative stress in the RPE layer of the retina. The oxidative d amage mediated changes in the retina RPE choroid complex of these mice lead to AMD like lesions. Using our mouse model, several therapeutic approaches have been tested. Our AMD model should help to understand the disease mech anism and to test various therapeutic approaches.

PAGE 142

142 LIST OF REFERENCES 1. Laitinen, A. et al. Prevalence of major eye diseases and causes of visual impairment in the adult Finnish population: a nationwide population based survey. Acta Ophthalmol 88 463 71 (2010). 2. Landers, J., Henderson, T. & Craig, J. The prevalence and causes of visual impairment in indigenous Australians within central Australia: the Central Australian Ocular Health Study. Br J Ophthalmol 94 1140 4 (2010). 3 Friedman, D.S. et al. Prevalence of age related macular degeneration in the United States. Archives of ophthalmology 122 564 72 (2004). 4. Huang, Y., Qiao, F., Atkinson, C., Holers, V.M. & Tomlinson, S. A novel targeted inhibitor of the alternative path way of complement and its therapeutic application in ischemia/reperfusion injury. J Immunol 181 8068 76 (2008). 5. Han, M. et al. Age related structural abnormalities in the human retina choroid complex revealed by two photon excited autofluorescence imag ing. Journal of biomedical optics 12 024012 (2007). 6. Ferris, F.L., 3rd, Fine, S.L. & Hyman, L. Age related macular degeneration and blindness due to neovascular maculopathy. Archives of ophthalmology 102 1640 2 (1984). 7. Munoz, B. et al. Causes of bli ndness and visual impairment in a population of older Americans: The Salisbury Eye Evaluation Study. Archives of ophthalmology 118 819 25 (2000). 8. Vingerling, J.R. et al. The prevalence of age related maculopathy in the Rotterdam Study. Ophthalmology 10 2 205 10 (1995). 9. Aiello, L.P. et al. Vascular endothelial growth factor in ocular fluid of patients with diabetic retinopathy and other retinal disorders. The New England journal of medicine 331 1480 7 (1994). 10. Yannuzzi, L.A. et al. Retinal angioma tous proliferation in age related macular degeneration. Retina 21 416 34 (2001). 11. Lafaut, B.A., Aisenbrey, S., Vanden Broecke, C. & Bartz Schmidt, K.U. Clinicopathological correlation of deep retinal vascular anomalous complex in age related macular de generation. The British journal of ophthalmology 84 1269 74 (2000). 12. Spilsbury, K., Garrett, K.L., Shen, W.Y., Constable, I.J. & Rakoczy, P.E. Overexpression of vascular endothelial growth factor (VEGF) in the retinal pigment epithelium leads to the de velopment of choroidal neovascularization. The American journal of pathology 157 135 44 (2000).

PAGE 143

143 13. Wang, B., Atherton, P., Patel, R., Manning, G. & Donnelly, R. Antiangiogenic effects and transcriptional regulation of pigment epithelium derived factor in diabetic retinopathy. Microvascular research 80 31 6 (2010). 14. Lopez, P.F., Sippy, B.D., Lambert, H.M., Thach, A.B. & Hinton, D.R. Transdifferentiated retinal pigment epithelial cells are immunoreactive for vascular endothelial growth factor in surgica lly excised age related macular degeneration related choroidal neovascular membranes. Investigative ophthalmology & visual science 37 855 68 (1996). 15. Green, W.R. & Enger, C. Age related macular degeneration histopathologic studies: the 1992 Lorenz E. Z immerman Lecture. 1992. Retina 25 1519 35 (2005). 16. Noel, A., Jost, M., Lambert, V., Lecomte, J. & Rakic, J.M. Anti angiogenic therapy of exudative age related macular degeneration: current progress and emerging concepts. Trends in molecular medicine 13 345 52 (2007). 17. Xu, J. et al. Transcriptional regulation of bone morphogenetic protein 4 by tumor necrosis factor and its relationship with age related macular degeneration. The FASEB journal : official publication of the Federation of American Societ ies for Experimental Biology (2011). 18. Al Hussaini, H., Schneiders, M., Lundh, P. & Jeffery, G. Drusen are associated with local and distant disruptions to human retinal pigment epithelium cells. Exp Eye Res 88 610 2 (2009). 19. Li, C.M., Clark, M.E., C himento, M.F. & Curcio, C.A. Apolipoprotein localization in isolated drusen and retinal apolipoprotein gene expression. Invest Ophthalmol Vis Sci 47 3119 28 (2006). 20. Anderson, D.H., Mullins, R.F., Hageman, G.S. & Johnson, L.V. A role for local inflamma tion in the formation of drusen in the aging eye. Am J Ophthalmol 134 411 31 (2002). 21. Crabb, J.W. et al. Drusen proteome analysis: an approach to the etiology of age related macular degeneration. Proc Natl Acad Sci U S A 99 14682 7 (2002). 22. Crabb, J.W. et al. Drusen proteome analysis: an approach to the etiology of age related macular degeneration. Proceedings of the National Academy of Sciences of the United States of America 99 14682 7 (2002). 23. Ambati, J. et al. An animal model of age related macular degeneration in senescent Ccl 2 or Ccr 2 deficient mice. Nat Med 9 1390 7 (2003). 24. Gaillard, E.R., Atherton, S.J., Eldred, G. & Dillon, J. Photophysical studies on human retinal lipofuscin. Photochem Photobiol 61 448 53 (1995).

PAGE 144

144 25. Rozanowska M. et al. Blue light induced singlet oxygen generation by retinal lipofuscin in non polar media. Free Radic Biol Med 24 1107 12 (1998). 26. Davies, S. et al. Photocytotoxicity of lipofuscin in human retinal pigment epithelial cells. Free Radic Biol Med 31 256 65 (2001). 27. Rozanowska, M. et al. Blue light induced reactivity of retinal age pigment. In vitro generation of oxygen reactive species. J Biol Chem 270 18825 30 (1995). 28. Schutt, F., Bergmann, M., Holz, F.G. & Kopitz, J. Proteins modified by malondialdehyde, 4 hydroxynonenal, or advanced glycation end products in lipofuscin of human retinal pigment epithelium. Invest Ophthalmol Vis Sci 44 3663 8 (2003). 29. Feeney Burns, L., Hilderbrand, E.S. & Eldridge, S. Aging human RPE: morphometric analy sis of macular, equatorial, and peripheral cells. Investigative ophthalmology & visual science 25 195 200 (1984). 30. Weiter, J.J., Delori, F.C., Wing, G.L. & Fitch, K.A. Retinal pigment epithelial lipofuscin and melanin and choroidal melanin in human eye s. Investigative ophthalmology & visual science 27 145 52 (1986). 31. Dorey, C.K., Wu, G., Ebenstein, D., Garsd, A. & Weiter, J.J. Cell loss in the aging retina. Relationship to lipofuscin accumulation and macular degeneration. Investigative ophthalmology & visual science 30 1691 9 (1989). 32. Swaroop, A., Chew, E.Y., Rickman, C.B. & Abecasis, G.R. Unraveling a multifactorial late onset disease: from genetic susceptibility to disease mechanisms for age related macular degeneration. Annual review of genomi cs and human genetics 10 19 43 (2009). 33. Wolf Schnurrbusch, U.E. et al. Ethnic differences in macular pigment density and distribution. Investigative ophthalmology & visual science 48 3783 7 (2007). 34. Chen, Y., Bedell, M. & Zhang, K. Age related macu lar degeneration: genetic and environmental factors of disease. Molecular interventions 10 271 81 (2010). 35. Khan, J.C. et al. Age related macular degeneration and sun exposure, iris colour, and skin sensitivity to sunlight. The British journal of ophtha lmology 90 29 32 (2006). 36. Heiba, I.M., Elston, R.C., Klein, B.E. & Klein, R. Sibling correlations and segregation analysis of age related maculopathy: the Beaver Dam Eye Study. Genetic epidemiology 11 51 67 (1994). 37. Seddon, J.M., Ajani, U.A. & Mitc hell, B.D. Familial aggregation of age related maculopathy. American journal of ophthalmology 123 199 206 (1997).

PAGE 145

145 38. Allikmets, R. Molecular genetics of age related macular degeneration: current status. European journal of ophthalmology 9 255 65 (1999). 39. Klaver, C.C. et al. Genetic risk of age related maculopathy. Population based familial aggregation study. Archives of ophthalmology 116 1646 51 (1998). 40. Lin, J.M. et al. Complement factor H variant increases the risk for early age related macular degeneration. Retina 28 1416 20 (2008). 41. Nonyane, B.A. et al. An ecological correlation study of late age related macular degeneration and the complement factor H Y402H polymorphism. Invest Ophthalmol Vis Sci 51 2393 402 (2010). 42. Edwards, A.O. et a l. Complement factor H polymorphism and age related macular degeneration. Science 308 421 4 (2005). 43. Barral, S. et al. Expanded genome scan in extended families with age related macular degeneration. Investigative ophthalmology & visual science 47 545 3 9 (2006). 44. Seddon, J.M., Santangelo, S.L., Book, K., Chong, S. & Cote, J. A genomewide scan for age related macular degeneration provides evidence for linkage to several chromosomal regions. American journal of human genetics 73 780 90 (2003). 45. Ha geman, G.S. et al. A common haplotype in the complement regulatory gene factor H (HF1/CFH) predisposes individuals to age related macular degeneration. Proc Natl Acad Sci U S A 102 7227 32 (2005). 46. Andreoli, M.T. et al. Comprehensive analysis of comple ment factor H and LOC387715/ARMS2/HTRA1 variants with respect to phenotype in advanced age related macular degeneration. American journal of ophthalmology 148 869 74 (2009). 47. Kaur, I. et al. Variants in the 10q26 gene cluster (LOC387715 and HTRA1) exhi bit enhanced risk of age related macular degeneration along with CFH in Indian patients. Investigative ophthalmology & visual science 49 1771 6 (2008). 48. Rivera, A. et al. Hypothetical LOC387715 is a second major susceptibility gene for age related macu lar degeneration, contributing independently of complement factor H to disease risk. Human molecular genetics 14 3227 36 (2005). 49. Tocharus, J. et al. Developmentally regulated expression of mouse HtrA3 and its role as an inhibitor of TGF beta signaling Development, growth & differentiation 46 257 74 (2004).

PAGE 146

146 50. Miyake, K. et al. Association of TCF7L2 polymorphisms with susceptibility to type 2 diabetes in 4,087 Japanese subjects. Journal of human genetics 53 174 80 (2008). 51. Lotery, A. & Trump, D. Progress in defining the molecular biology of age related macular degeneration. Human genetics 122 219 36 (2007). 52. Oka, C. et al. HtrA1 serine protease inhibits signaling mediated by Tgfbeta family proteins. Development 131 1041 53 (2004). 53. Yang, Z et al. A variant of the HTRA1 gene increases susceptibility to age related macular degeneration. Science 314 992 3 (2006). 54. Chen, H. et al. Association of HTRA1 polymorphism and bilaterality in advanced age related macular degeneration. Vision resear ch 48 690 4 (2008). 55. Weger, M. et al. Association of the HTRA1 625G>A promoter gene polymorphism with exudative age related macular degeneration in a Central European population. Molecular vision 13 1274 9 (2007). 56. Zarbin, M.A. Current concepts in the pathogenesis of age related macular degeneration. Arch Ophthalmol 122 598 614 (2004). 57. Ding, X., Patel, M. & Chan, C.C. Molecular pathology of age related macular degeneration. Prog Retin Eye Res 28 1 18 (2009). 58. Zhao, C. et al. mTOR mediated dedifferentiation of the retinal pigment epithelium initiates photoreceptor degeneration in mice. J Clin Invest (2010). 59. Boulton, M. & Dayhaw Barker, P. The role of the retinal pigment epithelium: topographical variation and ageing changes. Eye 15 384 9 (2001). 60. Simo, R., Villarroel, M., Corraliza, L., Hernandez, C. & Garcia Ramirez, M. The retinal pigment epithelium: something more than a constituent of the blood retinal barrier -implications for the pathogenesis of diabetic retinopathy. Journal of biomedicine & biotechnology 2010 190724 (2010). 61. Markovets, A.M. et al. Alterations of retinal pigment epithelium cause AMD like retinopathy in senescence accelerated OXYS rats. Aging 3 44 54 (2011). 62. Jarrett, S.G., Lewin, A.S. & Boulton, M.E. The importance of mitochondria in age related and inherited eye disorders. Ophthalmic research 44 179 90 (2010). 63. Wang, A.L., Lukas, T.J., Yuan, M. & Neufeld, A.H. Increased mitochondrial DNA damage and down regulation of DNA repair enzymes in aged rodent retinal pigment epithelium and choroid. Molecular vision 14 644 51 (2008).

PAGE 147

147 64. Wang, A.L., Lukas, T.J., Yuan, M. & Neufeld, A.H. Age related increase in mitochondrial DNA damage and loss of DNA repair capacity in the neural retina. Neurobiology of aging 3 1 2002 10 (2010). 65. Gomes, A., Fernandes, E. & Lima, J.L. Fluorescence probes used for detection of reactive oxygen species. J Biochem Biophys Methods 65 45 80 (2005). 66. Lambeth, J.D. NOX enzymes and the biology of reactive oxygen. Nat Rev Immunol 4 181 9 (2004). 67. Antonenkov, V.D., Grunau, S., Ohlmeier, S. & Hiltunen, J.K. Peroxisomes are oxidative organelles. Antioxid Redox Signal 13 525 37 (2010). 68. Balaban, R.S., Nemoto, S. & Finkel, T. Mitochondria, oxidants, and aging. Cell 120 483 95 (20 05). 69. Rubbo, H., Batthyany, C. & Radi, R. Nitric oxide oxygen radicals interactions in atherosclerosis. Biol Res 33 167 75 (2000). 70. Jarrett, S.G., Lin, H., Godley, B.F. & Boulton, M.E. Mitochondrial DNA damage and its potential role in retinal degen eration. Prog Retin Eye Res 27 596 607 (2008). 71. Cai, J., Nelson, K.C., Wu, M., Sternberg, P., Jr. & Jones, D.P. Oxidative damage and protection of the RPE. Prog Retin Eye Res 19 205 21 (2000). 72. Lundberg, W.O. Lipids of biologic importance; peroxida tion products and inclusion compounds of lipids. Am J Clin Nutr 6 601 3 (1958). 73. Harman, D. Aging: a theory based on free radical and radiation chemistry. J Gerontol 11 298 300 (1956). 74. Shen, J.K. et al. Oxidative damage in age related macular dege neration. Histol Histopathol 22 1301 8 (2007). 75. Hollyfield, J.G. et al. Oxidative damage induced inflammation initiates age related macular degeneration. Nat Med 14 194 8 (2008). 76. Hollyfield, J.G., Perez, V.L. & Salomon, R.G. A hapten generated fro m an oxidation fragment of docosahexaenoic acid is sufficient to initiate age related macular degeneration. Mol Neurobiol 41 290 8 (2010). 77. Ishibashi, T. et al. Advanced glycation end products in age related macular degeneration. Archives of ophthalmol ogy 116 1629 32 (1998). 78. Bonilha, V.L. Age and disease related structural changes in the retinal pigment epithelium. Clin Ophthalmol 2 413 24 (2008).

PAGE 148

148 79. Packer, L. Antioxidant action of carotenoids in vitro and in vivo and protection against oxidatio n of human low density lipoproteins. Ann N Y Acad Sci 691 48 60 (1993). 80. Bohm, F., Tinkler, J.H. & Truscott, T.G. Carotenoids protect against cell membrane damage by the nitrogen dioxide radical. Nat Med 1 98 9 (1995). 81. A randomized, placebo contro lled, clinical trial of high dose supplementation with vitamins C and E and beta carotene for age related cataract and vision loss: AREDS report no. 9. Arch Ophthalmol 119 1439 52 (2001). 82. Li, Q. et al. Downregulation of p22phox in retinal pigment epit helial cells inhibits choroidal neovascularization in mice. Molecular therapy : the journal of the American Society of Gene Therapy 16 1688 94 (2008). 83. Yu, A.L. et al. Subtoxic oxidative stress induces senescence in retinal pigment epithelial cells via TGF beta release. Investigative ophthalmology & visual science 50 926 35 (2009). 84. Feher, J. et al. Mitochondrial alterations of retinal pigment epithelium in age related macular degeneration. Neurobiol Aging 27 983 93 (2006). 85. Nordgaard, C.L., Kar unadharma, P.P., Feng, X., Olsen, T.W. & Ferrington, D.A. Mitochondrial proteomics of the retinal pigment epithelium at progressive stages of age related macular degeneration. Invest Ophthalmol Vis Sci 49 2848 55 (2008). 86. Dunaief, J.L. Iron induced oxi dative damage as a potential factor in age related macular degeneration: the Cogan Lecture. Invest Ophthalmol Vis Sci 47 4660 4 (2006). 87. Hadziahmetovic, M. et al. Ceruloplasmin/hephaestin knockout mice model morphologic and molecular features of AMD. I nvest Ophthalmol Vis Sci 49 2728 36 (2008). 88. Neuner, B. et al. Smoking history and the incidence of age related macular degeneration -results from the Muenster Aging and Retina Study (MARS) cohort and systematic review and meta analysis of observationa l longitudinal studies. Addict Behav 34 938 47 (2009). 89. Murdaugh, L.S., Wang, Z., Del Priore, L.V., Dillon, J. & Gaillard, E.R. Age related accumulation of 3 nitrotyrosine and nitro A2E in human Bruch's membrane. Experimental eye research 90 564 71 (2 010). 90. Alcazar, O., Cousins, S.W. & Marin Castano, M.E. MMP 14 and TIMP 2 overexpression protects against hydroquinone induced oxidant injury in RPE: implications for extracellular matrix turnover. Invest Ophthalmol Vis Sci 48 5662 70 (2007).

PAGE 149

149 91. Jia, L. et al. Acrolein, a toxicant in cigarette smoke, causes oxidative damage and mitochondrial dysfunction in RPE cells: protection by (R) alpha lipoic acid. Invest Ophthalmol Vis Sci 48 339 48 (2007). 92. Borland, C. & Higenbottam, T. Nitric oxide yields o f contemporary UK, US and French cigarettes. Int J Epidemiol 16 31 4 (1987). 93. Evereklioglu, C. et al. Nitric oxide and lipid peroxidation are increased and associated with decreased antioxidant enzyme activities in patients with age related macular deg eneration. Doc Ophthalmol 106 129 36 (2003). 94. Farrell, A.J., Blake, D.R., Palmer, R.M. & Moncada, S. Increased concentrations of nitrite in synovial fluid and serum samples suggest increased nitric oxide synthesis in rheumatic diseases. Ann Rheum Dis 5 1 1219 22 (1992). 95. Gaston, B. et al. Endogenous nitrogen oxides and bronchodilator S nitrosothiols in human airways. Proc Natl Acad Sci U S A 90 10957 61 (1993). 96. Dietrich, M. et al. Smoking and exposure to environmental tobacco smoke decrease some plasma antioxidants and increase gamma tocopherol in vivo after adjustment for dietary antioxidant intakes. Am J Clin Nutr 77 160 6 (2003). 97. Dunaief, J.L., Dentchev, T., Ying, G.S. & Milam, A.H. The role of apoptosis in age related macular degeneratio n. Arch Ophthalmol 120 1435 42 (2002). 98. Hollyfield, J.G. Age related macular degeneration: the molecular link between oxidative damage, tissue specific inflammation and outer retinal disease: the Proctor lecture. Invest Ophthalmol Vis Sci 51 1275 81 ( 2010). 99. Fujihara, M., Nagai, N., Sussan, T.E., Biswal, S. & Handa, J.T. Chronic cigarette smoke causes oxidative damage and apoptosis to retinal pigmented epithelial cells in mice. PLoS One 3 e3119 (2008). 100. Imamura, Y. et al. Drusen, choroidal neov ascularization, and retinal pigment epithelium dysfunction in SOD1 deficient mice: a model of age related macular degeneration. Proc Natl Acad Sci U S A 103 11282 7 (2006). 101. Justilien, V. et al. SOD2 knockdown mouse model of early AMD. Invest Ophthalm ol Vis Sci 48 4407 20 (2007). 102. Karan, G. et al. Lipofuscin accumulation, abnormal electrophysiology, and photoreceptor degeneration in mutant ELOVL4 transgenic mice: a model for macular degeneration. Proc Natl Acad Sci U S A 102 4164 9 (2005). 103. S tone, E.M. et al. Clinical features of a Stargardt like dominant progressive macular dystrophy with genetic linkage to chromosome 6q. Archives of ophthalmology 112 765 72 (1994).

PAGE 150

150 104. Dithmar, S., Curcio, C.A., Le, N.A., Brown, S. & Grossniklaus, H.E. Ult rastructural changes in Bruch's membrane of apolipoprotein E deficient mice. Invest Ophthalmol Vis Sci 41 2035 42 (2000). 105. Lommatzsch, A. et al. Are low inflammatory reactions involved in exudative age related macular degeneration? Morphological and i mmunhistochemical analysis of AMD associated with basal deposits. Graefe's archive for clinical and experimental ophthalmology = Albrecht von Graefes Archiv fur klinische und experimentelle Ophthalmologie 246 803 10 (2008). 106. Baird, P.N., Guida, E., Ch u, D.T., Vu, H.T. & Guymer, R.H. The epsilon2 and epsilon4 alleles of the apolipoprotein gene are associated with age related macular degeneration. Investigative ophthalmology & visual science 45 1311 5 (2004). 107. Souied, E.H. et al. The epsilon4 allele of the apolipoprotein E gene as a potential protective factor for exudative age related macular degeneration. American journal of ophthalmology 125 353 9 (1998). 108. Malek, G. et al. Apolipoprotein E allele dependent pathogenesis: a model for age relate d retinal degeneration. Proceedings of the National Academy of Sciences of the United States of America 102 11900 5 (2005). 109. Tuo, J. et al. The involvement of sequence variation and expression of CX3CR1 in the pathogenesis of age related macular degen eration. The FASEB journal : official publication of the Federation of American Societies for Experimental Biology 18 1297 9 (2004). 110. Forrester, J.V. Macrophages eyed in macular degeneration. Nature medicine 9 1350 1 (2003). 111. Tuo, J. et al. Murin e ccl2/cx3cr1 deficiency results in retinal lesions mimicking human age related macular degeneration. Investigative ophthalmology & visual science 48 3827 36 (2007). 112. Wang, A.L. & Neufeld, A.H. Smoking mice: a potential model for studying accumulation of drusen like material on Bruch's membrane. Vision Res 50 638 42 (2010). 113. Espinosa Heidmann, D.G., Sall, J., Hernandez, E.P. & Cousins, S.W. Basal laminar deposit formation in APO B100 transgenic mice: complex interactions between dietary fat, blue light, and vitamin E. Invest Ophthalmol Vis Sci 45 260 6 (2004). 114. Rakoczy, P.E. et al. Progressive age related changes similar to age related macular degeneration in a transgenic mouse model. Am J Pathol 161 1515 24 (2002).

PAGE 151

151 115. Kuziel, W.A. et al. S evere reduction in leukocyte adhesion and monocyte extravasation in mice deficient in CC chemokine receptor 2. Proc Natl Acad Sci U S A 94 12053 8 (1997). 116. Hahn, P. et al. Disruption of ceruloplasmin and hephaestin in mice causes retinal iron overload and retinal degeneration with features of age related macular degeneration. Proc Natl Acad Sci U S A 101 13850 5 (2004). 117. Ohno Matsui, K. et al. Inducible expression of vascular endothelial growth factor in adult mice causes severe proliferative reti nopathy and retinal detachment. The American journal of pathology 160 711 9 (2002). 118. Ufret Vincenty, R.L. et al. Transgenic mice expressing variants of complement factor H develop AMD like retinal findings. Invest Ophthalmol Vis Sci 51 5878 87 (2010) 119. Coffey, P.J. et al. Complement factor H deficiency in aged mice causes retinal abnormalities and visual dysfunction. Proceedings of the National Academy of Sciences of the United States of America 104 16651 6 (2007). 120. Rohrer, B., Guo, Y., Kunch ithapautham, K. & Gilkeson, G.S. Eliminating complement factor D reduces photoreceptor susceptibility to light induced damage. Investigative ophthalmology & visual science 48 5282 9 (2007). 121. Edelman, J.L. & Castro, M.R. Quantitative image analysis of laser induced choroidal neovascularization in rat. Experimental eye research 71 523 33 (2000). 122. Okamoto, N. et al. Transgenic mice with increased expression of vascular endothelial growth factor in the retina: a new model of intraretinal and subretina l neovascularization. The American journal of pathology 151 281 91 (1997). 123. Muller, F.L., Lustgarten, M.S., Jang, Y., Richardson, A. & Van Remmen, H. Trends in oxidative aging theories. Free Radic Biol Med 43 477 503 (2007). 124. Mari, M., Morales, A ., Colell, A., Garcia Ruiz, C. & Fernandez Checa, J.C. Mitochondrial glutathione, a key survival antioxidant. Antioxidants & redox signaling 11 2685 700 (2009). 125. Cox, A.G., Winterbourn, C.C. & Hampton, M.B. Mitochondrial peroxiredoxin involvement in a ntioxidant defence and redox signalling. The Biochemical journal 425 313 25 (2010). 126. Kalinina, E.V., Chernov, N.N. & Saprin, A.N. Involvement of thio peroxi and glutaredoxins in cellular redox dependent processes. Biochemistry. Biokhimiia 73 1493 510 (2008).

PAGE 152

152 127. Klug, D., Rabani, J. & Fridovich, I. A direct demonstration of the catalytic action of superoxide dismutase through the use of pulse radiolysis. J Biol Chem 247 4839 42 (1972). 128. Li, Y. et al. Dilated cardiomyopathy and neonatal letha lity in mutant mice lacking manganese superoxide dismutase. Nat Genet 11 376 81 (1995). 129. Esworthy, R.S., Ho, Y.S. & Chu, F.F. The Gpx1 gene encodes mitochondrial glutathione peroxidase in the mouse liver. Arch Biochem Biophys 340 59 63 (1997). 130. P anfili, E., Sandri, G. & Ernster, L. Distribution of glutathione peroxidases and glutathione reductase in rat brain mitochondria. FEBS Lett 290 35 7 (1991). 131. Seo, M.S. et al. Identification of a new type of mammalian peroxiredoxin that forms an intram olecular disulfide as a reaction intermediate. J Biol Chem 275 20346 54 (2000). 132. Bone, R.A., Landrum, J.T., Guerra, L.H. & Ruiz, C.A. Lutein and zeaxanthin dietary supplements raise macular pigment density and serum concentrations of these carotenoids in humans. The Journal of nutrition 133 992 8 (2003). 133. Yarranton, G.T. Inducible vectors for expression in mammalian cells. Curr Opin Biotechnol 3 506 11 (1992). 134. St Onge, L., Furth, P.A. & Gruss, P. Temporal control of the Cre recombinase in tr ansgenic mice by a tetracycline responsive promoter. Nucleic Acids Res 24 3875 7 (1996). 135. Sauer, B. & Henderson, N. Cre stimulated recombination at loxP containing DNA sequences placed into the mammalian genome. Nucleic Acids Res 17 147 61 (1989). 13 6. O'Gorman, S., Fox, D.T. & Wahl, G.M. Recombinase mediated gene activation and site specific integration in mammalian cells. Science 251 1351 5 (1991). 137. Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet 21 70 1 (1999). 138. Srinivas, S. et al. Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev Biol 1 4 (2001). 139. Rohlmann, A., Gotthardt, M., Willnow, T.E., Hammer, R.E. & Herz, J. Sustained somatic gene inactivat ion by viral transfer of Cre recombinase. Nat Biotechnol 14 1562 5 (1996).

PAGE 153

153 140. Anton, M. & Graham, F.L. Site specific recombination mediated by an adenovirus vector expressing the Cre recombinase protein: a molecular switch for control of gene expression J Virol 69 4600 6 (1995). 141. Brooks, A.I., Muhkerjee, B., Panahian, N., Cory Slechta, D. & Federoff, H.J. Nerve growth factor somatic mosaicism produced by herpes virus directed expression of cre recombinase. Nat Biotechnol 15 57 62 (1997). 142. Bern s, K.I. & Giraud, C. Biology of adeno associated virus. Curr Top Microbiol Immunol 218 1 23 (1996). 143. Kotin, R.M., Linden, R.M. & Berns, K.I. Characterization of a preferred site on human chromosome 19q for integration of adeno associated virus DNA by non homologous recombination. EMBO J 11 5071 8 (1992). 144. Stieger, K. & Lorenz, B. Gene therapy for vision loss -recent developments. Discovery medicine 10 425 33 (2010). 145. Colella, P. & Auricchio, A. AAV mediated gene supply for treatment of dege nerative and neovascular retinal diseases. Current gene therapy 10 371 80 (2010). 146. Li, W. et al. Engineering and selection of shuffled AAV genomes: a new strategy for producing targeted biological nanoparticles. Molecular therapy : the journal of the American Society of Gene Therapy 16 1252 60 (2008). 147. Maheshri, N., Koerber, J.T., Kaspar, B.K. & Schaffer, D.V. Directed evolution of adeno associated virus yields enhanced gene delivery vectors. Nature biotechnology 24 198 204 (2006). 148. Petrs Sil va, H. et al. High efficiency transduction of the mouse retina by tyrosine mutant AAV serotype vectors. Molecular therapy : the journal of the American Society of Gene Therapy 17 463 71 (2009). 149. Allocca, M., Tessitore, A., Cotugno, G. & Auricchio, A. AAV mediated gene transfer for retinal diseases. Expert Opin Biol Ther 6 1279 94 (2006). 150. Boye, S.E. et al. Functional and behavioral restoration of vision by gene therapy in the guanylate cyclase 1 (GC1) knockout mouse. PLoS One 5 e11306 (2010). 151 Thomas, P.B. et al. Adeno associated virus mediated IL 10 gene transfer suppresses lacrimal gland immunopathology in a rabbit model of autoimmune dacryoadenitis. Investigative ophthalmology & visual science 51 5137 44 (2010). 152. Li, X. et al. Gene the rapy rescues cone structure and function in the 3 month old rd12 mouse: a model for midcourse RPE65 leber congenital amaurosis. Investigative ophthalmology & visual science 52 7 15 (2011).

PAGE 154

154 153. Sharma, A., Tovey, J.C., Ghosh, A. & Mohan, R.R. AAV serotype influences gene transfer in corneal stroma in vivo. Experimental eye research 91 440 8 (2010). 154. Hauswirth, W.W. et al. Treatment of leber congenital amaurosis due to RPE65 mutations by ocular subretinal injection of adeno associated virus gene vector : short term results of a phase I trial. Human gene therapy 19 979 90 (2008). 155. Cideciyan, A.V. et al. Human gene therapy for RPE65 isomerase deficiency activates the retinoid cycle of vision but with slow rod kinetics. Proceedings of the National Acad emy of Sciences of the United States of America 105 15112 7 (2008). 156. Simonelli, F. et al. Gene therapy for Leber's congenital amaurosis is safe and effective through 1.5 years after vector administration. Molecular therapy : the journal of the America n Society of Gene Therapy 18 643 50 (2010). 157. Dinculescu, A., Glushakova, L., Min, S.H. & Hauswirth, W.W. Adeno associated virus vectored gene therapy for retinal disease. Hum Gene Ther 16 649 63 (2005). 158. Ali, R.R. et al. Adeno associated virus ge ne transfer to mouse retina. Hum Gene Ther 9 81 6 (1998). 159. Auricchio, A. et al. Exchange of surface proteins impacts on viral vector cellular specificity and transduction characteristics: the retina as a model. Hum Mol Genet 10 3075 81 (2001). 160. B ennett, J. et al. Stable transgene expression in rod photoreceptors after recombinant adeno associated virus mediated gene transfer to monkey retina. Proc Natl Acad Sci U S A 96 9920 5 (1999). 161. Timmers, A.M., Zhang, H., Squitieri, A. & Gonzalez Pola, C. Subretinal injections in rodent eyes: effects on electrophysiology and histology of rat retina. Molecular vision 7 131 7 (2001). 162. Haseloff, J. & Gerlach, W.L. Simple RNA enzymes with new and highly specific endoribonuclease activities. Nature 334 585 91 (1988). 163. Alifano, P. et al. Ribonuclease E provides substrates for ribonuclease P dependent processing of a polycistronic mRNA. Genes Dev 8 3021 31 (1994). 164. Buzayan, J.M., Hampel, A. & Bruening, G. Nucleotide sequence and newly formed phosp hodiester bond of spontaneously ligated satellite tobacco ringspot virus RNA. Nucleic Acids Res 14 9729 43 (1986).

PAGE 155

155 165. Buzayan, J.M., Gerlach, W.L. & Bruening, G. Satellite tobacco ringspot virus RNA: A subset of the RNA sequence is sufficient for autoly tic processing. Proc Natl Acad Sci U S A 83 8859 62 (1986). 166. Forster, A.C. & Symons, R.H. Self cleavage of plus and minus RNAs of a virusoid and a structural model for the active sites. Cell 49 211 20 (1987). 167. Khan, A.U. & Lal, S.K. Ribozymes: a modern tool in medicine. J Biomed Sci 10 457 67 (2003). 168. Saville, B.J. & Collins, R.A. A site specific self cleavage reaction performed by a novel RNA in Neurospora mitochondria. Cell 61 685 96 (1990). 169. Sharmeen, L., Kuo, M.Y., Dinter Gottlieb, G & Taylor, J. Antigenomic RNA of human hepatitis delta virus can undergo self cleavage. J Virol 62 2674 9 (1988). 170. Cech, T.R., Zaug, A.J. & Grabowski, P.J. In vitro splicing of the ribosomal RNA precursor of Tetrahymena: involvement of a guanosine nu cleotide in the excision of the intervening sequence. Cell 27 487 96 (1981). 171. Cech, T.R. Self splicing of group I introns. Annu Rev Biochem 59 543 68 (1990). 172. Fiskaa, T. & Birgisdottir, A.B. RNA reprogramming and repair based on trans splicing gr oup I ribozymes. N Biotechnol 27 194 203 (2010). 173. Salehi Ashtiani, K. & Szostak, J.W. In vitro evolution suggests multiple origins for the hammerhead ribozyme. Nature 414 82 4 (2001). 174. Scott, W.G. Biophysical and biochemical investigations of RNA catalysis in the hammerhead ribozyme. Q Rev Biophys 32 241 84 (1999). 175. Conaty, J., Hendry, P. & Lockett, T. Selected classes of minimised hammerhead ribozyme have very high cleavage rates at low Mg2+ concentration. Nucleic Acids Res 27 2400 7 (1999) 176. Citti, L. & Rainaldi, G. Synthetic hammerhead ribozymes as therapeutic tools to control disease genes. Curr Gene Ther 5 11 24 (2005). 177. Peracchi, A. Prospects for antiviral ribozymes and deoxyribozymes. Rev Med Virol 14 47 64 (2004). 178. Marti ck, M. & Scott, W.G. Tertiary contacts distant from the active site prime a ribozyme for catalysis. Cell 126 309 20 (2006). 179. Lavrovsky, Y., Chen, S. & Roy, A.K. Therapeutic potential and mechanism of action of oligonucleotides and ribozymes. Biochem M ol Med 62 11 22 (1997).

PAGE 156

156 180. Kashani Sabet, M., Funato, T., Florenes, V.A., Fodstad, O. & Scanlon, K.J. Suppression of the neoplastic phenotype in vivo by an anti ras ribozyme. Cancer Res 54 900 2 (1994). 181. Leopold, L.H., Shore, S.K., Newkirk, T.A., R eddy, R.M. & Reddy, E.P. Multi unit ribozyme mediated cleavage of bcr abl mRNA in myeloid leukemias. Blood 85 2162 70 (1995). 182. Bauer, G. et al. Inhibition of human immunodeficiency virus 1 (HIV 1) replication after transduction of granulocyte colony s timulating factor mobilized CD34+ cells from HIV 1 infected donors using retroviral vectors containing anti HIV 1 genes. Blood 89 2259 67 (1997). 183. Welch, P.J. et al. A potential therapeutic application of hairpin ribozymes: in vitro and in vivo studie s of gene therapy for hepatitis C virus infection. Gene Ther 3 994 1001 (1996). 184. Grzelinski, M. et al. Enhanced antitumorigenic effects in glioblastoma on double targeting of pleiotrophin and its receptor ALK. Neoplasia 11 145 56 (2009). 185. Haasnoo t, J., Westerhout, E.M. & Berkhout, B. RNA interference against viruses: strike and counterstrike. Nat Biotechnol 25 1435 43 (2007). 186. Macpherson, J.L. et al. Long term survival and concomitant gene expression of ribozyme transduced CD4+ T lymphocytes in HIV infected patients. J Gene Med 7 552 64 (2005). 187. Anderson, J. et al. Safety and efficacy of a lentiviral vector containing three anti HIV genes -CCR5 ribozyme, tat rev siRNA, and TAR decoy -in SCID hu mouse derived T cells. Mol Ther 15 1182 8 ( 2007). 188. Mastroyiannopoulos, N.P., Uney, J.B. & Phylactou, L.A. The application of ribozymes and DNAzymes in muscle and brain. Molecules 15 5460 72 (2010). 189. Sturtz, L.A., Diekert, K., Jensen, L.T., Lill, R. & Culotta, V.C. A fraction of yeast Cu,Zn superoxide dismutase and its metallochaperone, CCS, localize to the intermembrane space of mitochondria. A physiological role for SOD1 in guarding against mitochondrial oxidative damage. The Journal of biological chemistry 276 38084 9 (2001). 190. Kawama ta, H. & Manfredi, G. Different regulation of wild type and mutant Cu,Zn superoxide dismutase localization in mammalian mitochondria. Human molecular genetics 17 3303 17 (2008). 191. Lebovitz, R.M. et al. Neurodegeneration, myocardial injury, and perinata l death in mitochondrial superoxide dismutase deficient mice. Proceedings of the National Academy of Sciences of the United States of America 93 9782 7 (1996).

PAGE 157

157 192. Sandbach, J.M. et al. Ocular pathology in mitochondrial superoxide dismutase (Sod2) defici ent mice. Investigative ophthalmology & visual science 42 2173 8 (2001). 193. Strassburger, M. et al. Heterozygous deficiency of manganese superoxide dismutase results in severe lipid peroxidation and spontaneous apoptosis in murine myocardium in vivo. Fr ee Radic Biol Med 38 1458 70 (2005). 194. Le, Y., Gagneten, S., Tombaccini, D., Bethke, B. & Sauer, B. Nuclear targeting determinants of the phage P1 cre DNA recombinase. Nucleic Acids Res 27 4703 9 (1999). 195. Hartzell, C. et al. Looking chloride chann els straight in the eye: bestrophins, lipofuscinosis, and retinal degeneration. Physiology (Bethesda) 20 292 302 (2005). 196. Hartzell, H.C., Qu, Z., Yu, K., Xiao, Q. & Chien, L.T. Molecular physiology of bestrophins: multifunctional membrane proteins lin ked to best disease and other retinopathies. Physiol Rev 88 639 72 (2008). 197. Marmorstein, A.D. & Kinnick, T.R. Focus on molecules: bestrophin (best 1). Exp Eye Res 85 423 4 (2007). 198. Sun, H., Tsunenari, T., Yau, K.W. & Nathans, J. The vitelliform m acular dystrophy protein defines a new family of chloride channels. Proc Natl Acad Sci U S A 99 4008 13 (2002). 199. Marmorstein, A.D. & Marmorstein, L.Y. The challenge of modeling macular degeneration in mice. Trends Genet 23 225 31 (2007). 200. Petrukh in, K. et al. Identification of the gene responsible for Best macular dystrophy. Nat Genet 19 241 7 (1998). 201. Marquardt, A. et al. Mutations in a novel gene, VMD2, encoding a protein of unknown properties cause juvenile onset vitelliform macular dystro phy (Best's disease). Hum Mol Genet 7 1517 25 (1998). 202. Marmorstein, A.D. et al. Bestrophin, the product of the Best vitelliform macular dystrophy gene (VMD2), localizes to the basolateral plasma membrane of the retinal pigment epithelium. Proc Natl Ac ad Sci U S A 97 12758 63 (2000). 203. Mullins, R.F., Oh, K.T., Heffron, E., Hageman, G.S. & Stone, E.M. Late development of vitelliform lesions and flecks in a patient with best disease: clinicopathologic correlation. Arch Ophthalmol 123 1588 94 (2005). 204. Guziewicz, K.E. et al. Bestrophin gene mutations cause canine multifocal retinopathy: a novel animal model for best disease. Invest Ophthalmol Vis Sci 48 1959 67 (2007).

PAGE 158

158 205. Bakall, B. et al. Expression and localization of bestrophin during normal m ouse development. Invest Ophthalmol Vis Sci 44 3622 8 (2003). 206. Pang, J.J. et al. Comparative analysis of in vivo and in vitro AAV vector transduction in the neonatal mouse retina: effects of serotype and site of administration. Vision research 48 377 85 (2008). 207. Zolotukhin, S. et al. Production and purification of serotype 1, 2, and 5 recombinant adeno associated viral vectors. Methods 28 158 67 (2002). 208. Scullica, L. & Falsini, B. Diagnosis and classification of macular degenerations: an appr oach based on retinal function testing. Doc Ophthalmol 102 237 50 (2001). 209. Lu, F. et al. HTRA1 variant increases risk to neovascular age related macular degeneration in Chinese population. Vision research 47 3120 3 (2007). 210. Marmorstein, L.Y., McL aughlin, P.J., Peachey, N.S., Sasaki, T. & Marmorstein, A.D. Formation and progression of sub retinal pigment epithelium deposits in Efemp1 mutation knock in mice: a model for the early pathogenic course of macular degeneration. Hum Mol Genet 16 2423 32 ( 2007). 211. Kiel, J.W. & Reiner, A.J. Morphometric analysis of the choroid, Bruch's membrane, and retinal pigment epithelium in eyes with age related macular degeneration. Investigative ophthalmology & visual science 38 1290 2 (1997). 212. Green, W.R., Mc Donnell, P.J. & Yeo, J.H. Pathologic features of senile macular degeneration. 1985. Retina 25 615 27 (2005). 213. Kanda, A. et al. A variant of mitochondrial protein LOC387715/ARMS2, not HTRA1, is strongly associated with age related macular degeneration. Proceedings of the National Academy of Sciences of the United States of America 104 16227 32 (2007). 214. Auricchio, A. et al. Exchange of surface proteins impacts on viral vector cellular specificity and transduction characteristics: the retina as a mod el. Human molecular genetics 10 3075 81 (2001). 215. Le, Y.Z. et al. Inducible expression of cre recombinase in the retinal pigmented epithelium. Invest Ophthalmol Vis Sci 49 1248 53 (2008). 216. Manfredsson, F.P. et al. Tight Long term dynamic doxycycli ne responsive nigrostriatal GDNF using a single rAAV vector. Molecular therapy : the journal of the American Society of Gene Therapy 17 1857 67 (2009). 217. Lowry, O.H., Rosebrough, N.J., Farr, A.L. & Randall, R.J. Protein measurement with the Folin pheno l reagent. The Journal of biological chemistry 193 265 75 (1951).

PAGE 159

1 59 218. Pasquale, T.R. & Tan, J.S. Update on antimicrobial agents: new indications of older agents. Expert Opin Pharmacother 6 1681 91 (2005). 219. Maier, K. et al. Multiple neuroprotective mechanisms of minocycline in autoimmune CNS inflammation. Neurobiol Dis 25 514 25 (2007). 220. Krady, J.K. et al. Minocycline reduces proinflammatory cytokine expression, microglial activation, and caspase 3 activation in a roden t model of diabetic retinopathy. Diabetes 54 1559 65 (2005). 221. Wirostko, E., Wirostko, W.J. & Wirostko, B.M. Age related macular degeneration is an inflammatory disease possibly treatable with minocycline. Acta Ophthalmol Scand 82 243 4 (2004). 222. Y ang, L.P., Zhu, X.A. & Tso, M.O. Minocycline and sulforaphane inhibited lipopolysaccharide mediated retinal microglial activation. Mol Vis 13 1083 93 (2007). 223. Mansson, R. et al. Re evaluation of mitochondrial permeability transition as a primary neuro protective target of minocycline. Neurobiol Dis 25 198 205 (2007). 224. Hollborn, M., Wiedemann, P., Bringmann, A. & Kohen, L. Chemotactic and cytotoxic effects of minocycline on human retinal pigment epithelial cells. Invest Ophthalmol Vis Sci 51 2721 9 (2010). 225. Zhou, J. et al. Neutrophils compromise retinal pigment epithelial barrier integrity. J Biomed Biotechnol 2010 289360 (2010). 226. Marcus, M., Merin, S., Wolf, M. & Feinsod, M. Electrophysiologic tests in assessment of senile macular degenera tion. Ann Ophthalmol 15 235 8 (1983). 227. Jackson, G.R., McGwin, G., Jr., Phillips, J.M., Klein, R. & Owsley, C. Impact of aging and age related maculopathy on inactivation of the a wave of the rod mediated electroretinogram. Vision Res 46 1422 31 (2006 ). 228. Holopigian, K., Seiple, W., Greenstein, V., Kim, D. & Carr, R.E. Relative effects of aging and age related macular degeneration on peripheral visual function. Optom Vis Sci 74 152 9 (1997). 229. Walter, P., Widder, R.A., Luke, C., Konigsfeld, P. & Brunner, R. Electrophysiological abnormalities in age related macular degeneration. Graefes Arch Clin Exp Ophthalmol 237 962 8 (1999). 230. Holz, F.G., Bellman, C., Staudt, S., Schutt, F. & Volcker, H.E. Fundus autofluorescence and development of geograp hic atrophy in age related macular degeneration. Investigative ophthalmology & visual science 42 1051 6 (2001).

PAGE 160

160 231. Marmorstein, A.D., Marmorstein, L.Y., Sakaguchi, H. & Hollyfield, J.G. Spectral profiling of autofluorescence associated with lipofuscin, Bruch's Membrane, and sub RPE deposits in normal and AMD eyes. Invest Ophthalmol Vis Sci 43 2435 41 (2002). 232. Delori, F.C., Fleckner, M.R., Goger, D.G., Weiter, J.J. & Dorey, C.K. Autofluorescence distribution associated with drusen in age related macu lar degeneration. Investigative ophthalmology & visual science 41 496 504 (2000). 233. Miyamoto, N. et al. Transcriptional regulation of activating transcription factor 4 under oxidative stress in retinal pigment epithelial ARPE 19/HPV 16 cells. Invest Op hthalmol Vis Sci (2010). 234. Burke, J.M. Epithelial phenotype and the RPE: is the answer blowing in the Wnt? Prog Retin Eye Res 27 579 95 (2008). 235. Sheline, C.T., Zhou, Y. & Bai, S. Light induced photoreceptor and RPE degeneration involve zinc toxicit y and are attenuated by pyruvate, nicotinamide, or cyclic light. Mol Vis 16 2639 52 (2010). 236. Kim, J.W., Kang, K.H., Burrola, P., Mak, T.W. & Lemke, G. Retinal degeneration triggered by inactivation of PTEN in the retinal pigment epithelium. Genes Dev 22 3147 57 (2008). 237. Liang, F.Q. & Godley, B.F. Oxidative stress induced mitochondrial DNA damage in human retinal pigment epithelial cells: a possible mechanism for RPE aging and age related macular degeneration. Exp Eye Res 76 397 403 (2003). 238. T otan, Y. et al. Oxidative macromolecular damage in age related macular degeneration. Curr Eye Res 34 1089 93 (2009). 239. Curcio, C.A., Medeiros, N.E. & Millican, C.L. Photoreceptor loss in age related macular degeneration. Invest Ophthalmol Vis Sci 37 1 236 49 (1996). 240. Bearelly, S. et al. Spectral domain optical coherence tomography imaging of geographic atrophy margins. Ophthalmology 116 1762 9 (2009). 241. Defoe, D.M., Adams, L.B., Sun, J., Wisecarver, S.N. & Levine, E.M. Defects in retinal pigment epithelium cell proliferation and retinal attachment in mutant mice with p27(Kip1) gene ablation. Mol Vis 13 273 86 (2007). 242. Georgiadis, A. et al. The tight junction associated signalling proteins ZO 1 and ZONAB regulate retinal pigment epithelium ho meostasis in mice. PLoS One 5 e15730 (2010). 243. Roider, J., Michaud, N.A., Flotte, T.J. & Birngruber, R. Response of the retinal pigment epithelium to selective photocoagulation. Arch Ophthalmol 110 1786 92 (1992).

PAGE 161

161 244. Pilotto, E. et al. Short wavelen gth fundus autofluorescence versus near infrared fundus autofluorescence, with microperimetric correspondence, in patients with geographic atrophy due to age related macular degeneration. Br J Ophthalmol (2010). 245. Leonard, D.S., Zhang, X.G., Panozzo, G. Sugino, I.K. & Zarbin, M.A. Clinicopathologic correlation of localized retinal pigment epithelium debridement. Invest Ophthalmol Vis Sci 38 1094 109 (1997). 246. Kellner, S. et al. Lipofuscin and melanin related fundus autofluorescence in patients with ABCA4 associated retinal dystrophies. Am J Ophthalmol 147 895 902, 902 e1 (2009). 247. Schmitz Valckenberg, S. et al. Fundus autofluorescence and fundus perimetry in the junctional zone of geographic atrophy in patients with age related macular degenerat ion. Invest Ophthalmol Vis Sci 45 4470 6 (2004). 248. Qi, X., Lewin, A.S., Hauswirth, W.W. & Guy, J. Optic neuropathy induced by reductions in mitochondrial superoxide dismutase. Invest Ophthalmol Vis Sci 44 1088 96 (2003). 249. Dougherty, G., Johnson, M .J. & Wiers, M.D. Measurement of retinal vascular tortuosity and its application to retinal pathologies. Med Biol Eng Comput 48 87 95 (2010). 250. Tee, L.B. et al. VEGF induced choroidal damage in a murine model of retinal neovascularisation. Br J Ophthal mol 92 832 8 (2008). 251. Schlanitz, F.G. et al. Performance of drusen detection by spectral domain optical coherence tomography. Investigative ophthalmology & visual science 51 6715 21 (2010). 252. Hageman, G.S. et al. An integrated hypothesis that cons iders drusen as biomarkers of immune mediated processes at the RPE Bruch's membrane interface in aging and age related macular degeneration. Prog Retin Eye Res 20 705 32 (2001). 253. Zhao, Z. et al. Age related retinopathy in NRF2 deficient mice. PloS one 6 e19456 (2011). 254. Gerth, C. The role of the ERG in the diagnosis and treatment of Age Related Macular Degeneration. Documenta ophthalmologica. Advances in ophthalmology 118 63 8 (2009). 255. Luhmann, U.F. et al. The drusenlike phenotype in aging Ccl 2 knockout mice is caused by an accelerated accumulation of swollen autofluorescent subretinal macrophages. Investigative ophthalmology & visual science 50 5934 43 (2009).

PAGE 162

162 256. Hawes, N.L. et al. Mouse fundus photography and angiography: a catalogue of no rmal and mutant phenotypes. Molecular vision 5 22 (1999). 257. Sarks, S.H. Ageing and degeneration in the macular region: a clinico pathological study. Br J Ophthalmol 60 324 41 (1976). 258. Hogan, M.J. Role of the retinal pigment epithelium in macular d isease. Trans Am Acad Ophthalmol Otolaryngol 76 64 80 (1972). 259. Ross, R.J. et al. Immunological protein expression profile in Ccl2/Cx3cr1 deficient mice with lesions similar to age related macular degeneration. Experimental eye research 86 675 83 (200 8). 260. Johnson, L.V., Leitner, W.P., Staples, M.K. & Anderson, D.H. Complement activation and inflammatory processes in Drusen formation and age related macular degeneration. Exp Eye Res 73 887 96 (2001). 261. Nozaki, M. et al. Drusen complement compone nts C3a and C5a promote choroidal neovascularization. Proc Natl Acad Sci U S A 103 2328 33 (2006). 262. Giacco, F. & Brownlee, M. Oxidative stress and diabetic complications. Circ Res 107 1058 70 (2010). 263. Freund, K.B. et al. Sequenced combined intrav itreal triamcinolone and indocyanine green angiography guided photodynamic therapy for retinal angiomatous proliferation. Arch Ophthalmol 124 487 92 (2006). 264. Mitchell, P., Smith, W., Attebo, K. & Wang, J.J. Prevalence of age related maculopathy in Aus tralia. The Blue Mountains Eye Study. Ophthalmology 102 1450 60 (1995). 265. Bedard, K. & Krause, K.H. The NOX family of ROS generating NADPH oxidases: physiology and pathophysiology. Physiological reviews 87 245 313 (2007). 266. Li, Y. & Jaiswal, A.K. R egulation of human NAD(P)H:quinone oxidoreductase gene. Role of AP1 binding site contained within human antioxidant response element. The Journal of biological chemistry 267 15097 104 (1992). 267. Friling, R.S., Bensimon, A., Tichauer, Y. & Daniel, V. Xen obiotic inducible expression of murine glutathione S transferase Ya subunit gene is controlled by an electrophile responsive element. Proceedings of the National Academy of Sciences of the United States of America 87 6258 62 (1990). 268. Tanito, M., Agbag a, M.P. & Anderson, R.E. Upregulation of thioredoxin system via Nrf2 antioxidant responsive element pathway in adaptive retinal neuroprotection in vivo and in vitro. Free radical biology & medicine 42 1838 50 (2007).

PAGE 163

163 269. Liu, Y. et al. A genomic screen f or activators of the antioxidant response element. Proceedings of the National Academy of Sciences of the United States of America 104 5205 10 (2007). 270. Hur, W. et al. A small molecule inducer of the antioxidant response element. Chemistry & biology 17 537 47 (2010).

PAGE 164

164 BIOGRAPHICAL SKETCH Soo J ung Seo was born in Pusan South K orea to Kyung J in Seo and Ye S oon Lee as a first daughter of their 3 children. In the spring of 200 2 she earned a Bachelor of Science in biology and food technology from the Han dong University She received scholarship for three semesters. In August of 200 2 she began pursue her m aster s degree in GIST (Gwangju institute of science and technology) and conducted research on characterizing genes involved in Alzheimer s disease. Fol lowing her master s degree, she worked as a technician in POSTECH ( Pohang science and technology institute ) and GIST (Gwangju institute of science and technology) conducting stem cell project as a part of work for generating transgenic mouse While she wo rked as a Brain Korea 21 fellowship from Korea Ministry of Education and Human Resources Development Predoctoral Fellowship from Korea Science and Engineering Foundation from 2005 to 2007. She moved to America on August 1, 2005 to continue her biomedical research in University of Florida. She received presidential fellowship from University of Florida. Soojung conduc ted her dissertation research under the guidance and mentorship of Dr. Alfred Lewin. Soojung married her classmate from her first IDP ( Interdisciplinary Program of Biomedical Sciences ) lab class, Daniel J ames Gibson on December 12, 2006, had first son Dani el E unseo Gibson on January 12, 2008 and second son Devon J inseo Gibson on Feburary 8 2011. Following the completion of her dissertation research, Soojung plans to pursue further training as a post doctoral researcher.