Fibroblast Growth Factor Signal Requirement for Bovine Oocyte Maturation and Developmental Competence

MISSING IMAGE

Material Information

Title:
Fibroblast Growth Factor Signal Requirement for Bovine Oocyte Maturation and Developmental Competence
Physical Description:
1 online resource (149 p.)
Language:
english
Creator:
Zhang,Kun
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Animal Molecular and Cellular Biology
Committee Chair:
Ealy, Alan
Committee Members:
Hansen, Peter J
Johnson, Sally
Resnick, James L

Subjects

Subjects / Keywords:
bmp15 -- cattle -- embryo -- fgf -- oocyte
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre:
Animal Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Poor reproductive efficiency in cows impacts profitability in the dairy industry. Inferior oocyte quality is one major contributor to reproductive failure in cows. Superior oocyte quality relies on an optimal ovarian follicle environment, which is regulated by various endocrine, paracrine, and autocrine factors. Accordingly, a series of studies have been conducted to evaluate the fibroblast growth factor (FGF) signal requirement for bovine oocyte maturation and developmental competence. The first study was to determine if FGF10 is an oocyte competence factor. FGF receptor 1 (FGFR1) transcripts predominated in cumulus cells whereas FGFR2 was most abundant in oocytes. FGF10 addition during in vitro maturation improved the nuclear maturation rate, promoted cumulus expansion, and increased developmental potential. These characteristics were compromised by addition of FGF10 antibody. In addition, FGF10 influenced the expression of CTSB, SPRY2 in cumulus cells and BMP15 in the oocyte. The second study was to describe how FGF2 may facilitate oocyte maturation and improve subsequent embryo development. FGF2 (?0.5 ng/ml) increased the percentage of blastocysts at day 7 post-IVF. FGF2 increased cumulus expansion index scores and nuclear maturation rate after 21 h. Also, 0.5 and 5 ng/ml FGF2 reduced the proportion of apoptotic cumulus cells after 21 h culture. The third study evaluated the role of comprehensive FGFR signal in oocyte maturation and developmental potential. FGFR1 and R2 were dynamically expressed throughout in vitro maturation process and responsive to FSH. Meiotic maturation and cumulus expansion was inhibited by the addition of a FGFR inhibitor, SU5402. This effect was associated with reduced MAPK activity in oocytes. SU5402 and another FGFR inhibitor, PD173074, both inhibited the developmental potential of oocytes. The last study was completed to determine if FGF2 and FGF10 were still able to increase embryo development when using serum-containing maturation medium. The percentage of embryos with ?8-cells was improved by FGF10 but not by FGF2. At day 7 and 8 post-IVF, the blastocyst rate and the advanced blastocyst (expanded and hatched) rate were increased by FGF10. The percentage of blastocysts at day 7 was increased by oocyte supplementation with FGF2. Overall, results indicate that FGFR signaling is involved in regulating oocyte maturation, cumulus expansion and subsequent embryonic development. The characterization of this signaling could lead to the identification of potential markers of oocyte quality and the development of strategies to control female fertility in mammals.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Kun Zhang.
Thesis:
Thesis (Ph.D.)--University of Florida, 2011.
Local:
Adviser: Ealy, Alan.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043203:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 FI BROBLAST GROWTH FACTOR SIGNAL REQUIREMENT FOR BOVINE OOCYTE MATURATION AND D EVELOPMENTAL COMPETENCE By KUN ZHANG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Kun Zhang

PAGE 3

3 To my parents and my family

PAGE 4

4 ACKNOWLEDGMENTS The completion of this work has been made possible due to the excellent guidance of Dr. Alan Ealy, who is my major advisor. I was deeply impressed when I met Dr. Ealy for the first time af ter coming to the US. He is so easy going that I feel like one of my close friends. As an excellent mentor, Dr. Ealy is always ready to help and give suggestions on my projects. I have achieved a lot from communications with him and because of the great freedom he provided us in the lab. Dr. Ealy is very supportive of my pr ofessional development and has given me plenty of wonderful advices. As an international student, I h ave also felt warmth every time he gave me praise and encouragement after finishing each oral presentation and earning even a little progress in work. Dr. Ealy is an exceptional PI who make everyone happy in the lab. I will never forget my wonderful experience in his lab. I would like to extend my sincere thanks to my committee members: Dr. Peter Hansen, Dr. Sally Johnson and Dr. James Resnick for their men torship a nd suggestions throughout my Ph D study. Dr. Hansen is one of the best mentors that I have ever seen in my life. He is the role model of what a good scientist and good mentor should be. I am truly grateful for the opportunity he offered me to compl ete the majority of my project in his IVF laboratory and specially thank him for the a dvice when I had to switch laboratorie s after the first year of my Ph D study. Dr. Johnson is extremely supportive of my projects and career development. I am truly grate on my project. I have learned a lot by communicating with Dr. Johnson and have been especially impressed by her i ntelligence and knowledge It is my great pleasure to hav e the opportunity to get adv ice fr om Dr. Resnick throughout my Ph feedback and insightful

PAGE 5

5 questions. Appreciation is also extended for his kind suggestions during my postdoctoral job searching. Overall, I feel proud to have worked with this talented group of people. Special thanks are also extende d to Dr. Karen Moore, who was my first mentor during my Ph D training I am sincerely grateful for the opportunity to join the AMCB program with the help of Dr. Moore. During the hug e transition from China to the US, Dr. Moore gave me tremendous help and suggestions to help me overcome the culture shock and get use d to the new environment. I am also deeply thankful of the help from Ewa Hug h es and Joe Kramer in Dr. I would like to thank Dr. William Thatcher for his care about my projects and PhD study. It will be wonderful to remember that the many times I talked with Dr. Thatcher over lunch I have learned a lot from his insightful questions and comments during semi nars and have been impressed by his hard working approach I feel fortunate to have been able to learn from him. would like to thank all the lab mates for their diverse help during my stay in the lab, including Dr. Qi En Yang, Dr. Kathleen Pennington, Flavia Cooke, Susan Rodgers, Dr. Manabu Ozawa and Paula Morelli. It has been my ple asure to work with this enthusiastic and talented group of young scientists. Sincere thanks are also extended t friendly, productive and highly efficient. I am truly grateful for me how to do bov ine IVF. The completion of the work would not be made possible in so short time without the high efficient team work for sharing media and doing IVF. The team includes Dr. Aline Bonilla, Luciano Bonilla, Dr. Manabu Ozawa, Dr. Miki Sakatani, Sarah Fields, K yle

PAGE 6

6 Dobbs, James Moss, Dr. Silvia Carambula, Dr. Jeremy Block, Dr. Barbara Loureiro and William Rembert. I would like to express grateful thanks to all the friends I met at UF. I have spent an enjoyable time in the Department of Animal Sciences. Thank all my Chinese friends, Dr. Ju Li, Sha Tao, Dan Wang, Wenli Sun for their encouragement and sharing ideas. Last but not least, I am extremely grateful of the endless support and encouragement from my wife, Dr. Shaohua Wang. I t hank her for the understanding and sacrifice during my pursuit of the Ph.D. It is so fortunate for me to work and live with this intelligent colleague and life part n er. Throughout my study so far, I have been deeply indebted to my brother, Dr. Yunhai Zhang, for his great help and suppo rt. No word s can be found to describe my extreme thankfulness to my parents, who are ordinary peasants in the elder brother and me t o finish high education. It is rare ly seen in rural China. Therefore, i t is always one of my motivations to make them proud of me.

PAGE 7

7 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ............... 4 LIST OF TABLES ................................ ................................ ................................ ......................... 10 LIST OF FIGURES ................................ ................................ ................................ ....................... 11 LIST OF ABBREVIATIONS ................................ ................................ ................................ ........ 12 ABSTRACT ................................ ................................ ................................ ................................ ... 14 CHAPTER 1 LITERATURE REVIEW ................................ ................................ ................................ ....... 16 Subfertility in High Producing Dairy Cows ................................ ................................ ........... 17 The Situation ................................ ................................ ................................ ................... 17 Factors Contributing to Declining Fertility ................................ ................................ ..... 17 Contribution of Oocyte Quality to Cow Fertility ................................ ............................ 19 Regulation of Female Germ Cell Development ................................ ................................ ..... 20 Germline Specification and Migra tion ................................ ................................ ............ 21 The Onset of Meiosis Initiation and Meiotic Arrest ................................ ........................ 23 Formation of the Primordial Follicles ................................ ................................ ............. 24 Activation and Recruitment of Primordial Follicles ................................ ....................... 24 Preantral Folliculogenesis ................................ ................................ ............................... 26 Antral Follicle Development ................................ ................................ ........................... 27 Final Oocyte Growth and Maturation ................................ ................................ .............. 30 Preovulatory Follicles ................................ ................................ ................................ ...... 30 Follicle Selection ................................ ................................ ................................ ............. 31 Ovulation ................................ ................................ ................................ ......................... 31 Cumulus Expansion ................................ ................................ ................................ ......... 3 2 Resumption of Meiosis During the LH surge ................................ ................................ .. 33 Cytoplasmic Maturation ................................ ................................ ................................ .. 36 Potential Markers of Oocyte Quality ................................ ................................ ............... 40 In V itro Maturation of Bovine Oocytes ................................ ................................ .................. 41 IVM ................................ ................................ ................................ ................................ 41 Factors Impacting IVM Efficiency ................................ ................................ .................. 41 IVF and IVC ................................ ................................ ................................ .................... 42 Low IVM Efficiency and Potential Solutions ................................ ................................ 42 Fibroblast Growth Factors ................................ ................................ ................................ ...... 43 FGF and Reproduction ................................ ................................ ................................ ........... 44 Working Hypothesis ................................ ................................ ................................ ............... 46 Rationale and Significance ................................ ................................ ................................ ..... 47

PAGE 8

8 2 FGF10 ENHANCES BOVINE OOCYTE MATURATION AND DEVELOPMENTAL COMPETENCE IN VITRO ................................ ................................ ................................ .... 49 Materials and Methods ................................ ................................ ................................ ........... 50 Bovine IVM, Fertilization, and Embryo Culture ................................ ............................. 50 Nuclear Maturation, Cumulus Expansion and Apoptosis Following Oocyte Maturation ................................ ................................ ................................ .................... 52 Differential Staining in Blastocysts ................................ ................................ ................. 53 Real time Quantitative (q) RT PCR ................................ ................................ ................ 53 Statistical Analyses ................................ ................................ ................................ .......... 54 Results ................................ ................................ ................................ ................................ ..... 55 FGFR Transcript Profiles in Cumulus Cells and Oocytes ................................ ............... 55 FGF10 Supplementation During IVM Improves Embryo Development ........................ 56 Blocking Endogenous FGF10 Action During Oocyte Maturation Reduces Subsequent Embryo Development ................................ ................................ ............... 57 Effects of FGF10 on Oocyte Maturation ................................ ................................ ......... 57 Effects of FGF10 on Cumulus Expansion ................................ ................................ ....... 58 Effects of FGF10 on Cumulus and Oocyte Gene Expression ................................ ......... 59 Discussion ................................ ................................ ................................ ............................... 59 3 SUPPLEMENTATION WITH FGF2 PROMOTES MATURATION AND SUBSEQUENT DEVELOPMENTAL COMPETENCE OF CULTURED BOVINE CUMULUS OOCYTE COMPLEXES ................................ ................................ ................... 72 Materials and Methods ................................ ................................ ................................ ........... 73 Reagents and Animal Assurances ................................ ................................ ................... 73 Bovine IVM, Fertilization and Culture ................................ ................................ ........... 74 Nuclear Maturation, Cumulus Expansion and Apoptosis Following Oocyte Maturation ................................ ................................ ................................ .................... 75 Real time Quantitative (q) RT PCR ................................ ................................ ................ 75 Statistical Analyses ................................ ................................ ................................ .......... 76 Results ................................ ................................ ................................ ................................ ..... 77 FGF2 Supplementation During IVM Benefits Subsequent Embryo Development ........ 77 FGF2 Regulates Meiotic Maturation of Bovine Oocytes In vitro ................................ ... 77 FGF2 Increases Expansion and Reduces Apoptosis of Cumulus Cells .......................... 78 Discussion ................................ ................................ ................................ ............................... 79 4 DISRUPTION OF FG F ReCEPTOR SIGNALING IN CUMULUS OOCYTE COMPLEXES REDUCES MEIOTIC MATURATION AND SUBSEQUENT DEVELOPMENTAL COMPETENCE OF BOVINE OOCYTES ................................ ........ 87 Materials and Methods ................................ ................................ ................................ ........... 88 Reagents and Animal Assurance ................................ ................................ ..................... 88 IVM, Fertilization and Culture ................................ ................................ ........................ 89 Nuclear Ma turation Determination ................................ ................................ .................. 90 Quantitative, Real Time RT PCR Analysis of Cumulus Cells and Oocytes .................. 90 Statistical analyses ................................ ................................ ................................ ........... 91

PAGE 9

9 Results ................................ ................................ ................................ ................................ ..... 92 FGFR mRNA Abundance in COCs ................................ ................................ ................ 92 FGFR mRNA Abundance is not Dependent on MAPK3/1 ................................ ............. 93 Interrupting FGFR Signaling During Oocyte Maturation Compromises Embryo Development ................................ ................................ ................................ ................ 94 FGFR Signaling and Oocyte Meiotic Maturation ................................ ........................... 95 Discussion ................................ ................................ ................................ ............................... 95 5 SUPPLEMENTING OOCYTE MATURATION MEDIUM WITH FGFS IMPROVES IN VITRO PRODUCTION OF BOVINE EMBRYOS ................................ ......................... 105 Materials and Methods ................................ ................................ ................................ ......... 106 Reagents ................................ ................................ ................................ ........................ 106 COCs Collection and Oocyte IVM ................................ ................................ ................ 107 IVF and IVC ................................ ................................ ................................ .................. 107 Nuclear Maturation and Cumulus Expansion ................................ ................................ 108 Differential Staining in Blastocysts ................................ ................................ ............... 108 Real time Quantitative (q) RT PCR ................................ ................................ .............. 109 Statistical A nalyses ................................ ................................ ................................ ........ 110 Results ................................ ................................ ................................ ................................ ... 110 FGF10 Promotes Bovine Oocyte Developmental Competence In vitro ....................... 110 FGF10 Treatment During IVM Does Not Affect the Expression of Selective Transcripts Implicated in Cumulus and Oocyte Competence ................................ .... 111 FGF2 Promotes Bovine Oocyte Developmental Competence In vitro ......................... 111 Discussion ................................ ................................ ................................ ............................. 112 6 GENERAL DISCUSSION ................................ ................................ ................................ ... 118 LIST OF REFERENCES ................................ ................................ ................................ ............. 124 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ....... 149

PAGE 10

10 LIST OF TABLES Table page 2 1 Primers used for qRT PCR. ................................ ................................ ............................... 65 3 1 The effect of supplementing FGF2 during COC maturation on subsequent in vitro development. ................................ ................................ ................................ ...................... 83 5 1 Effects of FGF10 supplementation during IVM on subsequent in vitro embryo development. ................................ ................................ ................................ .................... 115 5 2 The effect of FGF10 supplementation during IVM on ICM and TE numbers at day 8 post IVF. ................................ ................................ ................................ .......................... 116 5 3 Effect of FGF2 supplementation during IVM on subsequent in vitro embryo development. ................................ ................................ ................................ .................... 117

PAGE 11

11 LIST OF FIGURES Figure page 2 1 Expression profiles of FGFRs in bovine cumulus cells and oocytes prior to maturation. ................................ ................................ ................................ ......................... 66 2 2 In vitro development of bovine embryos is enhanced by adding FGF10 to medium during oocyte maturation. ................................ ................................ ................................ .. 67 2 3 Evidence for an endogenous source of FGF10 during oocyte maturation in vitro ........... 68 2 4 FGF10 impacts oocyte progression through meiosis and first polar body extrusion. ....... 69 2 5 FGF10 does not stimulate maturation in denuded o ocytes. ................................ ............... 70 2 6 The effect of FGF10 supplementation on expression profiles of selective transcripts in cumulus cells and oocytes. ................................ ................................ ............................. 71 3 1 The effect of FGF2 supplementation during IVM on oocyte maturation.. ........................ 84 3 2 The effect of FGF2 supplementation during IVM on cumulus expansion.. ...................... 85 3 3 The effect of FGF2 supplementation during IVM on cumulus cell apoptosis.. ................ 86 4 1 Changes in transcript abundance for FGFR1 and R2 splice variants in cumulus cells from COCs cultured in the presence or absence of FSH ................................ ................. 100 4 2 The FSH dependent increase in FGFR mRNA abundance is not MAPK dependent. .... 101 4 3 Disruption of FGFR signaling during IVM with SU5402 compromises subsequent embryo development in vitro ................................ ................................ .......................... 102 4 4 Disruption of FGFR signaling during IVM with PD173074 compromises subsequent embryo development in vitro ................................ ................................ ........................... 103 4 5 Meiotic maturation of oocytes is delayed by disruption of FGFR signaling during IVM. ................................ ................................ ................................ ................................ 104 6 1 Summary of the FGF signaling requirement for the oocyte maturation and developmental competence. ................................ ................................ ............................. 123

PAGE 12

12 LIST OF ABBREVIATION S AMH Anti Mullerian Hormone ART Assited Reproductive Technology BMP Bone Morphogen et ic Protein BSA Bovine Serum Albumin BSS Bovine Steer Serum CL Corpus Luteum COC Cumulus Oocyte Complex dbcAMP dibutyryl cyclic AMP DNMT DNA Methyltransferase dpc day post coitum EGA Embryonic Genome Activation EGF Epidermal Growth Factor ERK Extracellular signal R egulated Kinase FGF Fibroblast Growth Factor FSH Follicle Stimulating Hormone GDF9 Growth Differentiation Factor 9 GLM General Linear Model HPG Hypothalamus Pituitary Gland ICM Inner Cell Mass IGF Insulin like Growth Factor IVF In vitro Fertilization IVM In vitro Maturation LH Luteinizing Hormone MAPK Mitogen A ctivated Protein Kinase

PAGE 13

13 mSOF modif ied Synthetic Oviduct Fluid NEB Negative Energy Balance OMM Oocyte Maturation Medium PGC Primordial Germ Cell PI3K Phosphoinositide 3 K inase PKA Protein Kinase A PR Progesterone Receptor PVA P ol yvinyl Alcohol PVP Polyvinyl P yrrolidone RA Retinoic Acid SNP Single Nucleotide Polymorphism StAR Steroidogenic Acute Regulatory protein TCM Tissue Culture Medium TE Trophectoderm ZP Zona Pellucida

PAGE 14

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy FIBROBLAST GROWTH FACTOR SIGNAL REQUIREMENT FOR BOVINE O OCYTE MATURATION AND DEVELOPMENTAL COMPETENCE By Kun Zhang August 2011 Chair: Alan D. Ealy Major: Animal Molecular and Cellular Biology Poor reproductive efficiency in cows impacts profitability in the dairy industry. I nferior oocyte quality is one major contributor t o reproductive failure in cows. Superior oocyte quality relies on an optima l ovarian follicle environment, which is regulated by various endocrine paracrine and autocrine factors. Accordingly a series of studies have been conducted to evaluate the fibroblast growth factor (FGF) signal requirement for bovine oocyte maturation and developmental competence. The first study was to determine if FGF10 i s a n oocyte competence factor. FGF receptor 1 (FGF R1 ) transcripts predominated in cumulus cells whereas FGFR2 was most abundant in oocytes. FGF10 addition during in vitro maturation improved the nuclear maturation rate, promoted cumulus expansion, and increased developmental potential These characteristics w ere compromised by addition of FGF10 antibody In addition, FGF10 influenced the expression of CTSB SPRY2 in cumulus cells and BMP15 in the oocyte. The second study was to describe how FGF2 may facilitate oocyte maturation and improve subsequent embryo development. FGF2 ( ) increa sed the percentage of blastocysts at day 7 post IVF. FGF2 increased cumulus expansion index scores and nuclear maturation rate

PAGE 15

15 after 21 h. Also, 0.5 and 5 ng/ml FGF2 reduced the proportion of apoptotic cumulus cells after 21 h culture. The third study evaluate d the role of comprehensive FGFR signal in oocyte maturation and developmental potential. FGFR1 and R2 were dynamically expressed throughout in vitro maturation process and responsive to FSH. M eiotic maturation and cumulus expansion was inhibited by the addition of a FGFR inhibitor, SU5402. This effect was associated with red uced MAPK activity in oocytes. SU5402 and another FGFR inhibitor, PD173074, both inhibit ed the developmental potential of oocytes The last study was completed to determine if FGF2 and FGF10 were still able to increase embryo development when using serum containin g maturation medium. The percentage of embryos wi cells was improved by FGF10 but not by FGF2 At day 7 and 8 post IVF, the blastocyst rate and the advanced blast ocyst (expanded and hatched) rate were increased by FGF10. The percentage of blastocysts at day 7 was increased by oocy te supplementation with FGF2. Overall, results indicate that FGFR signaling is involved in regulating oocyte maturation, cumulus expans ion and subsequent embryonic development. The characterization of this signaling could lead to the identification of potential markers of oocyte quality and the development of strategies to control female fertility in mammals.

PAGE 16

16 CHAPTER 1 LITERA TURE REVIEW The general public is somewhat knowledgeable of several r eproductive technologies including in vitro fertilization (IVF) and the advent of several provocative discoveries such as the cloning technologies that gave us Dolly. These achievements were made possible due to substantial progress achieved in our basic understanding of oocyte maturation, sperm capacitation, fertilization and manipulation of gametes in vitro over the past 40 years. O ocyte quality plays an important role in determining embryonic fate (survival or death). T he contribution of the oocyte and the sperm to the formation of the zygote is not equivalent. Importantly, the oocyte provides the majority of cytoplasmic factors to nurture early embryonic development until embryonic genome activation (EGA). However, our understanding of oocyte maturation, especially in regards to cytoplasmic maturation, is far from complete This lack of knowledge compromises our ability to adequately mature human and bovine oocytes in vitr o and limits the overall fertility of domestic animals, and oocyte quality may be especially important for the lactating dairy cow because poor oocyte quality is considered a main contributing factor for the declining fertility over the past sixty years. B ased on these and other observations that will be described in this literature review, it is imperative that new discoveries in the regulation of oocyte growth, maturation and acquisition of developmental competence be completed. The knowledge gained in th is field will conceivably lead to improve d efficienc ies of assisted reproductive technologies (ART) in humans, cattle, and other mammals, including endangered and extinct animals. These insights also may be used to reduce embryonic and fetal loss es in vari ous species.

PAGE 17

17 Subf ertility in High Producing Dairy Cow s The Situation Dramatic improvements in milk yield per cow have been achieved over the past six decades. However, this achievement has come at the cost of declining fertility [1 5] Reductions in fertility of dairy cattle have been observed in several countries and regions regardless of the production system and irrespective of continuous or seasonal calving schemes [1, 6] Accordingly, one of the greatest challenges for animal reproduction biologists is to understand what has gone awry during the reproductive process in these lactating animals. Factors Contribut ing to Declining Fertility Various f actors are linked with infertility of high producing dairy cows. These include genetics, physiology, developmental programming, management, and environment. What follow s is a brief overview of how each of these factors impact dairy cow fertility. Genetics : During the past sixty years, high producing cows have been selected primarily based on milking merit and limited attention has been placed on reproductive capability [1] In addi tion, there has been an increase in the inbreeding coefficient, an estimate of the percentage of two identical alleles inherited by an animal [7, 8] I nbreeding can increase the chances of offspring being impacted by deleterious genes, which may account for the reduction of fe rtility in high yielding cows [8, 9] Therefore, selection for reproductive traits (e.g. daughter pregnancy rates) has been used to minimize infertility even though t he heritability of the reproduction merit is low [7] Furthermore, there are indications that embryonic fate is influenced by specific genes. For example, STAT5 and FGF2 single nucleotide polymorphisms (SNPs) are correlated with embryo survival in cattle [10, 11] These facts collectively implicate the importance of genetic background on the reproductive performance in cows.

PAGE 18

18 Physiologic factors : During the early postpartum period, high producing cows undergo negative energy balance (NEB) and during this time they are susceptible to various metabolic (e.g. ketosis, parturient paresis) and pathogenic (e.g. mastitis, retained placenta) disorders, any of which can reduce fertility [12, 13] Notably, p ostpartum cows under NEB have increased concentratio ns of non esterified fatty acids [12] and low glucose as well as insulin like growth factor 1 ( IGF1 ) all of which are found to be correlated with poor oocyte developmental competence [4] Developmental factors : After fertilization, the presumptive zygote is subjec t to a series of developmental achievements and maternal tests it must meet for pregnancy to continue to term. Only ~35% of bred cows will be pregnant by day 28 post breeding, and a large portion of pregnancy losses occurs in this first month of gestation because of problems associated with fertilization and pre and peri implantation embryo development [5] Th e root causes of these failures are numerous and may in clude problems associated with oocyte and follicle development and suboptimal uterine conditions [3 5] Managerial influences : The reduced fertility of high producing cows may also be contributed by inappropriate management [14] High producing herds have better reproductive pe rformance than low producing herds [14] This may be linked with better nutrition and reproductive management in high producing cows. The maintenance of uterine health is also critical for the cow fertility. The uterus is susc eptible to bacterial contamination, especially at parturition or in following days. A meta analysis of 23 studies shows that cows with endometritis have increased mean days open and decreased pregnancy rate [15] Moreover, s uperovulation and synchronization using hormones are also correlated with poor embryonic survival in cows [16, 17]

PAGE 19

19 Environmental factors : The reduced fertility of cows has been associated with environmental stress, especially heat stress. Heat stress affects the repr oductive system weeks before ovulation by damaging follicular function and oogenesis [18] Additionally, oocyte maturation, fertilization and preimplantation embryos are very susceptible to heat stress [19] Therefore, various attempts have been made to prevent embryo loss during periods of elevated temperatures in lactating dairy cows [20 22] Included among these strategies are embryo transfer and pharmacological treatment of embryo with antioxidants or IGF1 for improving thermotolerance [22, 23] Contribution of Oocyte Quality to Cow Fertility Oocyte compe tence refers to the capability of an oocyte to resume meiosis, undergo fertilization and complete early embryo development a nd develop to healthy offspring [24] In vivo oocytes acquire their developmental competence during the course of folliculogenesis, which is controlled by endocrine and paracrine factors [25] This acquisition can be achieved in vitro albeit at a lower efficiency [26] Oocyte incompetence is a major contributing factor for infertility in cattle [27] One study i mplicates the developmental competence of the oocyte is reduced in modern, high producing dairy cows [13] One reason for such in competence likely reflects oocyte maturation during high production [28] Outcomes appear to be e xacerbated with extensive NEB in post partum period [3] After parturition, energy output surpasses the energy input rapid ly due to milk production, and therefore NEB is established. During this period, nutrients ingested may preferentially be diverted to other biological functions such as milking other than reproduction, and hence limit the growth and development of the oocy te [29] S tressful environmental conditions, such as heat stress undoubtedly contributes to oocyte in competence [19] In vivo evidence has shown th at reduced proportion of viable embryos is

PAGE 20

20 seen in super ovulated heifers that exposed to heat stress (above 41.0 C) during estr o us [30] Meanwhile, direct effects of elevated temperature to reduce oocyte competence are observed in vitro [31 33] This is likely mediated by disruption of nuclear maturation and reorganization of cytoskeleton elements (i.e. microtubules) as well as induced apoptosis in the oocyt es [32, 34] Hormonal regiment used to synchronize estr o us and ovulation also conceivably im pact oocyte competence. For example, GnRH administration to is associated with d ecreased pregnancy rates and increased late embryonic/fetal mortality [17] One potential explanation is that oocyte development is incomplete when small follicles follicle diameter [35] Oocytes matured in vitro are less competent than their in vivo counterparts. Holm et al. has shown that the development of bovine zygotes produced from in vitro maturation ( IVM ) derived oocytes is reduced relative to in vivo control s [36] Studies utilizing IVM derived embryos often contain low pregnancy rate and abnormal fetal development (Large Offspring Syndrome) [37 42] Hence, IVM condition s conceivably impact the short and long term development of IVM derived embryos. Consequently, it is imperative that IVM conditions be optimized The acquisition of competence for the oocytes is a ser ies of systematic events occurring from the specification of germ cell to the extrusion of oocyte from the ovarian follicle. To better l earn and potentially manipulate oocyte quality, it is important to understand how a fertilizable oocyte is generated in vivo Regulation of Female Germ Cell Development Oogenesis, or the process of generating fertilizable oocytes, is a dynamic process that is controlled by a variety of physiological, cellular and molecular events. The oocyte grows, matures and acquires de velopmental competence in the follicle This niche dictates oocyte

PAGE 21

21 quality and competence One important feature of oocyte quality relates to resumption of meiosis and the preparation of the oocyte cytoplasm for early embryo development. Although great progress has been made in describing th ese developmental events numerous questions remain including understanding how paracrine factors impact oogenesis and oocyte competence Herein, the major events that occur during folliculogenesis and oogenesis are reviewed. Descriptions will include germline formation and their migration to the genital ridge, factors that drive folliculogenesis and oogenesis, and our current understanding of meiotic and cytoplasmic maturation. Germline Specification a nd Migration The oocyte is originated from t he primordial germ cell (PGC) Our current understanding of the mechanism of early oogenesis events such as PGC formation and migration has been generated primarily from mice. The PGCs originally are located in t he proximal epiblast and can be distinguished from somatic cells by responding to inductive signals from the embryonic ectoderm [43, 44] For example, bone morphogenetic protein 4 ( BMP4 ) and 8b are major extrinsic factors that stimulate the formation of PGC precursors at E6.5 in the mouse [45, 46] Several other members of the TGF family also play an important role in regulation of PGC mitosis [47] BMP2 and 4 are capable of promoting the proliferation of PGC cultured in vitro [48] BMP deleted mice have decreased number of germ cells after 11.5 dpc [47] Between E6.5 7.5, the PGC is specified towards germline expression This commitment is thought controlled by proteins PRDM1 and 14 [49 51] PRDM1 and 14 are transcriptional re gulators that contain a PRDI BF1 RIZ domain, the structural relative of histone methyltransferase. They are both expressed as early as E6.5 in PGC precursors in mice and dependent on BMP4 signaling. PRDM1 heterozygotes have reduced number of PGCs while

PAGE 22

22 hom ozygotes have no PGCs at E7.5. PRDM14 null mice are infertile due to arrested PGC development in the absence of PRDM14. During PGC specification, several major events occur including repression of somatic cell gene expression, induction of PGC enriched gene expression and pluripotency gene expression [49, 51, 52] Particularly, Hoxa1 and Hoxb1 are predominant in somatic epiblast cells but undetectable in PGCs. However, they are expressed in PGC like cells collected from PRDM1 null mice. PRDM14 mutant mice have reduced expression of lineage restricted DPPA3 and the pluripotency gene, So x2 Also, PRDM1 mutant mice have no expression of PGC specific Nanos3 Thus, PRDM1 and PRDM14 regulate PGC specification by manipulating the gene expression program. Next, PGCs enter the tissue that will develop into the gonads and the ovary or testis for ms soon thereafter. P GC migrates to gonad and colonize s the ovary at E10.5 in mice. It is poorly understood how migration is initiated and modulated but it appears that KIT ligand and SDF1 function as chemoattractant s during migration [53 55] PGCs express c KIT receptor whereas hindgut cells, neighboring somatic cells during migration, contain the KIT ligand [56] The c KIT/KIT ligand signaling is believed to promote the proliferation and migration of PGCs [56, 57] In vitro migration assays show that KIT ligand is an effective chemoattractant for the PGCs from E10.5 and 11.5 mice embryos. During this process, p hosp hatidylinositol 3 kinase (PI3K)/AKT and SRC kinases are involved in mediating KIT ligand effects on PGCs [54] During migration and entry of PGCs into the genital ridge, dramatic epigenetic reprogramming events occur, including global DNA demethylation, removal of imprinting and reactivation of inactivated X chromosome s in female fetuses [58, 59] Th e biological relevance of epigenetic regulation is under inte nsive investigation DNA methylation is the addition of a

PAGE 23

23 promoters of genes. The modification, catalyzed by the family of DNA methyltransferases (DNMT), primarily causes the transcrip tional silencing of genes. It is dynamic as two waves of DNA demethylation/methylation pattern occur throughout early embryogenesis [58, 59] At the morula stage, DNA methylation status is erased for all but a few genes (i.e. imprinted genes). Then de novo DNA re methylation occurs before implant ation. Shortly after that, a second wave of demethylation takes place. Again this demethylation is genome widely and occurs only in germ cells during migration and colonization. However, it remains unclear how global DNA demethylation is completed during P GC development [60, 61] The Onset of Mei o sis Initiation and Meiotic Arrest Upon en try to the genital ridge, PGCs undergo several rounds of proliferation before beginning meiosis. Millions of germ cells are generated after these mitotic divisions are complete and meiosis begins. The mitosis meiosis switch occurs at E13.5 in mice and arou nd 30 days of gestation in cattle [62, 63] S ignal ing from neighboring somatic cells is required for this initiation. One meiotic inducing molecule is retinoic acid (RA) [64] which is expressed by the gonadal neighboring somatic cells of both sexes but it only indu ces meiosis of germ cells in the fetal ovary. Germ cells in the fetal testis are protected from entering meiosis because several factors that degrade RA, including CYP26, are produced in the testes. The patterns of oocyte meiotic progression appear simila r among mammals. O ogonia arrest at the diplotene stage of meiosis I and remain at this stage until after puberty, which can be months or years away. During this early period of meiosis, homologous recombination occurs on 13 14 dpc in mice and in the 10 11t h week of gestation in humans. These events are liable to the regulation of diverse proteins involved in DNA double strand breaks, synapsis and crossover (reviewed by [65] ). Thus, mis regulation of these events during meiosis could result in

PAGE 24

24 aneuploidy that is one of the major fac tors conduce to low oocyte quality in humans as they age [65] Formati on of the Primordial Follicles A series of events precedes follicle formation after meiotic arrest. During prenatal development, o ocytes are clustered to form germ cell nests and are connected by intercellular bridges with each other. Coinciding with the breakdown of germ cell nests, massive germ cell loss occurs perinatally, [66, 67] Members of BCL protein family are primarily involved in this process that is achieved by programmed cell death [68, 69] However, the biological relevance of this massive loss of germ cells has not been described. For unknown reasons, the breakdown of germ cell nests occurs after birth in mice and in the second trimester of human gestation, and the individual oocyte is enclosed by a single layer of pre granulosa ce lls to form the primordial follicles. important for germ cell nest breakdown and the formation of primordial follicles [70] Additionally, maternal hormones and certain transcription factors are involved in the formation of primordial follicles [71 73] Activation and Recruitment of Primordial Follicles During the remainder of prenatal development and early postnatal life, oocytes and follicles remain dormant. Upon puberty, subsets of activated primordial follicles are recruited to fulfill the mission to produce a viable oocyte. Oocyte specific expres sion of transcription factors: Nobox, Lhx8, S ohlh1/2 are critical for the transition f rom primordial to primary follicle [74 76] Mice lacking any of these factors are sterile. The progression to primary follicle is disrupted despite the fact that these mutants contain a similar number of primordial follicles. Furthermore, these phenotypes have been l inked with reduced KIT/KITL signaling. Oocyte expression of KIT and pre granulosa KIT ligand production is crucial for the transition from primordial to primary

PAGE 25

25 follicle stage in mice. The interaction of this ligand with its receptor potentially changes gr anulosa cell shape from squamous to cuboidal [ 77 79] This effect is likely mediated by the induction of the PI3K/AKT signaling pathway and subsequent inactivation of forkhead box O3 (FOXO3) [80] In FOXO3 mutan t mice, follicle growth is widespread and these mice lack primordial follicles [81] Anti mullerian hormone (AMH) [82] and the chemokine (SDF 1) and its receptor (CXCR4) also mediate recruitment of primordial follicles [83, 84] Several additional paracrine factors also appear to function as mediators of primordial follicle development. The recruitme nt of primordial follicles is promoted by various factors including BMP4 [85] LIF [86] PDGF [87] GDNF [88] FGF2 [70] and FGF7 [89] In one study, increases in the proportion of growing follicles and decreases in numbers of primordial follicles (i.e. not growing) were found in ovaries from 4 day old rats cultured in vitro with FGF2, BMP4, LIF, PDGF, GDNF or FGF7 [70] Administration of BMP7 to the rat ovaries also stimulates follicle devleopment [90] In ca ttle, there is a lack of consistency for when primordial follicles first appear, although recen t evidence suggests that primordial follicles are first observed around the beginning of the second trimester of pregnancy [91] Several of the same mediators found to be important for mediating primordial follicle development in mice also appear important for this process in cattle [92] Steroids, namely estrogen and progesterone, show inhibitory effect on activation of primordial follicles in cattle [91, 93] Yang and Fortune have shown that maximum production of steroids by ovaries is det ected at day 80 of gestation when meiosis has not yet been initiated, and decreased to undetectable level by day 160 when meiosis begins and follicle formation takes place [91] Hence, it has been hypothesized that maternal hormone s are negative regulators of

PAGE 26

26 follicle development. Indeed, treatment of fetal ovarian pieces collected between day 90 and 140 of gestation with estradiol and progesterone reduced the proportion of activated (primary) follicles [92] T his evidence is consistent with the findings on in vivo pattern of secre tion of steroids by the ovaries. Preantral Follic u logenesis After primordial follicles are established at 1 2 d after birth in mice and in utero in cattle, a subset of follicles will develop into p reantral follicle s. This process involves oocyte growth (i.e. increase in oocyte diameter) proliferation of granulosa cells into multiple layers and the development of theca cells. The major mediators of these processes are derived from the oocyte and somatic cells (granulosa and theca cells). Gonadotropins do not appear important for preantral follicle dev el opment. For example, normal preantral folliclulogenesis is seen in mice [94, 95] Extensive stu dies over the past decade reveal that the oocyte plays an active role in controlling preantral folliculogenesis [96 99] One well known experiment was carried out by Eppig to determine if the oocyte impacts the follicle developmental rate. In this study, secondary oocytes were collected and mixed with somatic cells from the primordial f females [100] Finally, a ccelerated folliculogenesis is observed in re aggregated ovaries while the development of follicles is normal in re aggregated control ovaries consisting of oocytes and somatic cells both from primordial follicles This result clearly indicates oocyte derived factors are critical for follicle development [100] A host of oocyte signals is found with in the TGF Notably, BMP15 and growth differentiation factor 9 ( GD F9 ) play very important roles in

PAGE 27

27 regulating the folliculogenesis. These factors are produced by the oocyte and act on the neighboring cumulus and granulosa cells to regulate glycolysis, amino acid transportation cholesterol synthesis and ultimately mainta in the metabolism and development of the oocyte [96] GDF9 knockout mice are infertile with follicles arrested at primary follicle stage [101] Mouse BMP15 targeted disruption causes subfertility with a defective cumulus phenotype [102] Also, BMP15 over expression in mice reveals the growth promoting role of BMP15 in ovarian follicles [103] Linkage analysis shows that s pontaneous BMP15 mutations also affects ovulation rate in sheep [104] Interestingly, the homozygotic mutation results in ovarian failure, but the heterozygotic mutation causes increased ovulation rate. It is possible that more antral follicles are responsive to LH in th e presence of 50% of the normal level of BMP15 by compromising proliferation of granulosa cells and reducing production of steroids and inhibin in follicles. It is also likely that reduced level of BMP15 affect the actions of other oocyte secreted factors, such as GDF9, on granulosa cell proliferation and differentiation. Thus, these changes in the follicles may result in the increase of ovulation rate in the heterozygotic mutant. Antral Follicle Dev el opment Dramatic morphological and biochemical changes take place during antral follicle development. From the primary to preovulatory stage, the meiotically arrested oocyte grows dramatically from 30 to 125 M in diameter in cattle [105] The fluid filled structure, known as the antrum, is established within the follicle. T he sensitivity of follicles to gonadotropin beco mes apparent although paracrine and autocrine factors, notably IGF1 and epidermal growth factor (EGF) like molecules, still function. Thus, follicle development is modulated by a more dynamic and complicated network of signaling to ensure the production of viable oocytes and steroids.

PAGE 28

28 The antrum consists of a fluid filled space that is established by fluid derived from serum and by induction of an osmotic gradient between the follicle and the serum in the thecal vascular [106] Recent evidence has shown that aquaporin, a membrane channel protein, is involved in promoting passive movement o f fluids through granulosa cells to establish the antrum [107] In vivo follicles that have antra shown increased expression of aquaporin 7 and 8 [108] A fter formation of the antrum, follicles require FSH and LH for normal development [25] FSH and LH are pituitary gonadotropins that are heterodimeric glycoproteins containing a FSH not only promotes proliferation and differentiation of granulosa cells, but prevents apoptosis in granulosa cells stimulates estradiol production and LH receptor expression in granulosa cells, and suppresses follicular atresia [109] Various positive/negative feedback loops in the hypothalamic pituitary gonadal (HPG) axis manipulate follicle development and selection as well as pregnancy establishment. E stradiol negatively feedback s on the HPG axis to decrease secretion of FSH. Additionally, growth factors (i.e. inhibin, activin) derived locally from the ovary also regulate production of FSH [109] Estradiol production is one of the milestone events i n folliculogenesis. Its production is crucial for the growth, differentiation and survival of ovarian follicles and in triggering the surge of gonadotropins surrounding estrus and ovulation [110] E stradiol production is stimulated by FSH in follicles I ntrafollicular estradiol production is linked to variation of follicle numbers during follicular waves, which is positively associated with improved oocyte quality [111] This result implies tha t appropriate estradiol production is important for the oocyte to acquire competence during folliculogenesis. The regulation of gonadotropin induced estradiol production (steroidogenesis) in granulosa cells occurs in cooperation with the theca cells throug h a process known as the cell, two

PAGE 29

29 [52] Thecal cells produce ample amounts of androgens but lack aromatase (CYP19A1) the key enzyme responsible for the conversion of estradiol precursor (androstenedione) to estrogens. In contrast, granulosa cells contain CYP19A1 but are deficient of CYP17A1, the key enzyme necessary to produce the estradiol precursor. Thus theca and granulosa cells rely on each other to produce estradiol in granulosa cells. These key steriodogenetic genes are respo nsive to gonadotropins. LH induces the expression of CYP17A1 and St AR in theca cells whereas FSH stimulates CYP19A1 in granulosa cells. Oocyte secreted factors are also involved in the regulation of antral follicle development. Several BMPs appear crucial for development. Notably, BMP15 and BMP6 prevent spontaneous apoptosis occurring in bovine cumulus cells by inducing the expression of anti apoptotic gene, Bcl2 [112] Moreover, DNA synthesis in mural granulosa cells of antral follicles is promoted by oocyte signal, namely GDF9 [113] O ocytes modulate several ac tivities of cumulus cells. O ocyte derived paracrine factors are required for the ovarian follicular response to LH, which is mediated by EGFR signaling [114] It has been hypothesized that oocyte stimulates the expression of EGFR in the cumulus cells and thus enables them responsive to LH induced EGF in mural granulos a cells. This mechanism has been validated by a recent report that oocyte factors, namely BMP15, stimulat e EGFR level in cumulus cells by a SMAD2/3 dependent pathway [115, 116] Growth factors secreted from follicular somatic cells also play a critical role in antral follicle development. One factor that has been characterized is IGF1. Although derived primarily from an extraovarian source, it is also produced locally in ovarian s omatic cells and stimulates steroidogenesis and granulosa cell proliferation in cooperation with gonadotropins [117] Mice lacking IGF1 are infertile with follicles arrested at the preantral stage [118] Both IGF2 and type

PAGE 30

30 1 IGFR m RNA are detected in follicles as early as preantral stage in cattle [119] In vitro IGF1 induces bovine preantral follicle growth [120] The complete IGF system is functional during early antral stage development [121] IGF binding proteins (IGFBP) derived locally are probably responsible for the regulation of functions of IGFI and II [122] IGFBP2 is expressed by granulosa cells whereas IGFBP4 mRNA is detected in theca cells in cattle [123] Fortune et al. has shown that IGFBP level in follicular fluid is negatively associated with emergence of the dominant follicle [124] Final Oocyte Growth and Maturation Due to the acquisition of LH receptor s in granulosa cells as well as the increased production of estradiol, LH program of gene expression becomes predominant in the follicle and cons equently the FSH program is turned off. Then, the majority of the follicles in the growing pool will undergo atresia, which is induced primarily by the reduction of FSH secretion. Only a dominant follicle or a few selected follicles (dependent on species) reach the preovulatory stage and are prepared for ovulation. Finally, the LH surge triggers the termination of preovulatory follicle development and initiates the ovulation, cumulus expansion, the meiotic resumption and luteinization. Preovulatory F olli cles Preovulatory follicles are characterized by their large volume size and the stage specific gene activation of the ovarian somatic cells. The increase of the follicle size is contributed to the proliferation of the granulosa cells in response to FSH an d the expansion of the antral compartment. In terms of gene expression, more than 7000 genes are upregulated in either theca or granulosa cells in bovine preovulatory follicles [125] In particular, high concentration of LH receptor is achieved in granulosa/cumulus cells in preovulatoy follicle so that it can enable the follicle responsive to the L H surge and initiate the downstream events.

PAGE 31

31 Follicle Selection There is generally one dominant follicle selected to undergo final differentiation and ovulation in cattle. Other unselected follicles will die by atresia. It is still poorly understood how the follicle is selected and how dominance is determined. The follicle continues to grow after recruitment into the growing pool and becomes responsive and dependent on FSH after the early antral stage with a diameter of 1 3 mm. Then, a rapid increase of the volume is observed in a cohort of antral follicles due to the cyclic release of FSH. As noted above, the increased production of estradiol and inhibin feedback on the HPG axis to suppress the secretion of FSH. When the reduction of FSH reaches a certain e xtent, growth of subordinate follicles are arrested and the atresia is trigged in these follicles. One follicle from the growing pool acquires the dominance due to unknown reasons. This dominant follicle grow s under the control of LH pulse s controlled by progesterone concentrations [126] If this selection occurs during the luteal phase of the estrus cycle (with hig h progesterone), dominance will disappear due to inadequate LH pulsatility [127] Accordingly, secretion of estradiol a nd inhibin in the follicles is decreased, which release the inhibition on FSH production. Therefore, a new wave of follicle development will follow in response to a new FSH surge [126, 128] Conversely, if dominance is acquired in the follicular phase of the estr o us cycle, the high frequency of LH pulse will dictate the dominant follicle to continue growing and undergo the process of ovulation. Ovulation Triggered by increased serum estradiol concentration the LH surge rapidly acts on granulosa cells to turn off follicular gene expression and initiate the expression of genes necessary of ovulation and luteinization [129] The process of ovulation inv olves large amount s of prostaglandin production, synthesis of a hyalur onan rich extracellular matrix, proteolytic

PAGE 32

32 degradation of the follicular wall and final extrusion of the oocyte [129] Based on these characteristics, ovulation is very similar to an inflammation like process. For example, like during ovulation, expression of matrix associated genes is promoted at sites of inflammation [130] Several transcriptional regulators are required for LH induced ovulation. One of these factors is progesterone receptor (PR) [131] In response to the LH s urge, PR expression is rapidly initiated in the mural granulosa cells of preovulatory follicles [132] This evidence implicates the importance of progesterone signaling during the process of ovulation. Indeed, PR null mice show normal cumulus expansion but do not undergo ovulation [133] Similar results are observed when PR are blocked with pharmacological drugs [25] Cumulus Expansion Expansion (mucification) of cumulus cells is required for normal ovulation and fertilization [134] C umulus expansion in vivo is induced i n response to the LH surg e Likely, this process is also induced by the presence of FSH or EGF in the maturation medium in vitro The chemical reaction that causes this involves the secretion of hyaluronan that disperses into the extracellular matrix and makes the cumulus cells st icky. There are various factors involved in the regulation of this process. Several genes, namely H as 2 P tgs 2 P tx3 and T nfaip 6 are critical for production, stabilization and linkage of hyaluronan [52] Hyaluronan synthase 2, the product of Has2 is responsi induced protein 6, the product of Tnfaip6 is required for the formation of chemical crosslinks between hyaluronan and the serum derived molecule, inter trypsin inhibitor. Pen traxin 3, the product of Ptx3 synthase 2, the product of Ptgs2 catalyzes the synthesis of prostaglandin and acts upstream of

PAGE 33

33 TNFAIP6. Mice deficient in each of these genes have ab normal, a lack of cumulus expansion ( Ptgs2 Tnfaip6 and Ptx3 ) or are embryonic lethal ( H as2 ) [135 138] It is still not com pletely known how these proteins act with each other to achieve the formation of the matrix. These genes are up regulated by the LH surge through action mediated by EGF like molecules. Conti et al. have found that the LH surge results in a rapid increase o f EGF like molecules, Areg Ereg and Btc which encode amphiregulin, epiregulin, and betacellulin, respectively in granulosa cells [114] Indeed, all these molecules alone are sufficient to induce cumulus expansion in vitro through stimulating the expression of Ptgs2 Has2 and Tnfaip6 D ownstream of LH surge EGF like molecules is mitogen activated protein kinase ( MAPK ) signaling C umulus expansion is suppressed in follicles of MAPK conditional knockout mice [139] Consistently, gona ndotropin and EGF induced cumulus expansion in vitro is prevented by pharmacological blockade of MAPK signaling with U0126 [140] Both LH and EGF like molecules also result in the activation (phosphorylation) of MAPK3/1 [140] The o ocyte also plays an active role in the process of cumulus expansion [52] To define the role of oocyte on the cumulus expansion, the classical oocytectomized (OOX) model has been widely used, in which the oocyte is removed via microsurgery. The expansion of cumulus cells in OOX complex is inhibited in the presence of expansion inducing molecules (i.e. FSH, EGF, cAMP analog) in vitro [141] However, inhibition is released when the OOX complex is cocultured with denuded oocytes. As oocyte secreted factors, BMP15 and GDF have been identified to restore the cumulus expansion in OOX complex. Resumption of Meiosi s D uring the LH surge T he oocyte resumes meiotic maturation after inducti on by the LH surge. The sequence of events occurring during this process includes germ vesicle breakdown (GVBD) chromatin condensation, spindle formation and ultimately the extrusion of the first polar body. The final

PAGE 34

34 asymmetric cell division, which allows more distribution of maternal factors in oocytes, is achieved by a cortical migration of spindle that is dependent on actin microfilaments and actin binding protein formin 2 [142 145] Meiotic maturation is required for normal development as immature oocytes are in capable of generating repeated Ca 2+ response upon fertilization [146] The LH dependent resumption in meiosis is mediated by EGF like molecules [114] As discussed above, the LH su rge results in a rapid increase of EGF like molecules, Areg Ereg and Btc in granulosa cells [114] These EGF like molecules are sufficient for meiosis reentry and required for LH action in preovulatory follicles [114] It has also been shown that EGF supplementation improves cumulus expansion and nuclear maturation in cattle in vitro [147] Hence EGF is recognized as a regular supplement to the cattle oocyte maturation medium (OMM) in vitro As addressed above, MAPK is critical to mediate the role of LH sur ge in downstream events, such as cumulus expansion and meiosis reentry. After EGFR is activated upon binding with mature EGF like molecules, MAPK (3/1) is stimulated. D efects in meiosis resumption, ovulation, cumulus expansion and luteinization are seen in mice with MAPK3/1 conditional knockout in granulosa cells [139] Although oocyte MAPK is not the only mechanism that leads to GVBD, MAPK in follicular somatic cells is required for the gonadotropin induced reentry to first meiosis division [139] Specifically, MAPK3/1 (ERK1/2) activity in oocytes is increased throughout oocyte maturation in vitro and In vivo [148] One of MAPK upstream kinases in vertebrate oocyte is MOS. MOS, a germ cell specific Ser/Thr protein kinase, is the product of proto oncogene c mos [149] It has been shown that i ncreased MAPK activity could be observed by i njection of mos RNA to the oocyte [148] Also, this re sults in a higher oocyte maturation rate

PAGE 35

35 in bovine [148] This observation highlights the importance of MAPK signaling in meiotic maturation. The maintena nce of meiotic arrest and its resumption after the LH surge are regulated primarily by m aturation promoting factor (MPF) This factor is responsible for the G 2 /M transition of the cell cycle. MPF consis ts of cyclin dependent kinase 1 (CDK1) and cyclin B. I n preovulatory follicles, oocyte MPF is maintained at a low activity to prevent the breakdown of the nuclear envelope and chromatin condensation that are required for the entry into the first meiotic division [150, 151] However, removing an oocyte from the antral follicle will induce these processes to reinitiate the meiosis Thus, there are inhibitory factors in the mural gran ulosa cells that maintain the low level of MPF that achieve the meiotic arrest [152, 153] Wee1b and Cdc25b are two direct upstream regulators of MPF activity. They are respon sible for phosphorylation/dephosphorylation of CDK1 respectively [65] Specifically, CDK1 is inhibited by phosphorylation on Thr14 and Tyr15. Genetic and in vitro evidence show that Wee1b and Cdc25b regulate the activity of CDK1 in oocyte [154, 1 55] In addition, the regulation of Cyclin b1 is also important for meiosis arrest at MI. It is regulated by APC, which is negatively regulated by Emi1 [65] Cyclic AMP is a major player in the regulation of the meiotic progression and functions upstream of MPF. M eiosis arrest is closely associated with the higher level of cAMP in oocytes. Reduced concentration of oocyte cAMP leads to meiosis resumption [156] Thus, the mechanisms underlying meiosis arrest and resumption are generally surrounding how cAMP is regulated in oocytes and the downstream and upstream of cAMP. The o ocyte has endogenous machinery to maintain intracellular cAMP homeostasis. PDE3A, an oocyte specific phoshpodiesterase, is responsible for reduction of cAMP in oocytes

PAGE 36

36 after activation by LH surge [157] Oocyte PDE3A activity is suppressed by the cGMP signaling initiated from granulosa cells, which thus maintain the meiotic arrest of oocytes [158] Recently, natriuretic peptide precursor type C (NPPC) and natriuretic peptide receptor 2 have been found to be expressed in mural and cumulus granulosa cells, respectively [159] NPPC increases cGMP concentration in both oocyte and cumulus cells through NPR2, which is a guanylyl cyclase. Meanwhile, NPPC inhibits meiotic resumption in vitro NPPC or NPR2 mutant mice have precocious meiosis resumption [159] It suggests NPPC might be the long sought inhibitory molecule that derived from mural granulosa cells that line the wall of follicles. The inhibitory effect of cAMP on meiosis resumption is mediated by the ac tivation of PKA signaling pathway and then followed by the inactivation of MPF. However, i t remains unclear whether PKA directly regulate the two direct regulators of MPF Wee1b and Cdc25b Cytoplasmic Maturation Cytoplasmic maturation is required for oocy te competence. Major components of this process involves reorganization in cytoplasmic organelles, changes in mRNA transcription and protein translation as well as post translational modification of proteins [160] The regulation of cytoplasmi c maturation is poorly known as well as its markers. One of the main features of oocyte maturation involves mitochondria remodeling. This probably helps to ensure sufficient energy supply. The mitochondri a are redistributed in clusters around the pronucle i of zygotes [42] The distribution of mitochondria is believed to impact embryonic development. Mitochondria are important for oocyte sur v ival. Microinjection of mitoch ondria to oocytes reduces oocyte apoptosis [161] Therefore, the membrane pote ntial of mitochondria, indicative of mitochondria health, and number of mitochondria are thought to be potential predictors of oocyte competence [42]

PAGE 37

37 The location of cortical granules also changes during final oocyte maturation. These organelles are generated from the Golgi complex and consist of a plasma membrane containing various proteins, structure molec ules and glycosaminoglycans [162] The c ortical granule migrates to the inner surface of the ooplasm membrane in preparation for fertilization [163] The role of this shift is primarily to block polyspermy [162] Once the penetration of sperm occurs, the cortical granule will be rele ased to the perivitelline space between the oocyte outer membrane and the zona pellucida. This process is induced by a cascade of events that triggers the increased intracellular calcium concentration. The released cortical granule functions on zona pelluc ida to modify the zona sperm receptor and results in zona hardening and hence block the penetration of more sperms. One other dramatic change during oocyte maturation is mRNA transcription. T he genome wide synthesis of mRNA is increased in growing oocytes and then ceases around the time of GVBD [164, 165] After this point, some mRNA is degraded whereas other RNA is not degraded quickly but rather is stored and utilized for several days as the oocyte is fertilize d and prepares to begin the synthesis of new embryonic mRNA. The stabilization of RNA is achieved by selective [166] Upon fertilization, more than 90% of maternal transcripts disappear before the first clea vage in mouse [167] Some critical mRNA is stored for supporting fertilization and/or early embryogenesis. The translation of these stored mRNA is regulated by the polyadenylation, cis acting CPE, CPE binding protein and/or maskin (reviewed by [168] ). Along with the activation of the embryonic genome soon after fertilizatio n, the translation of maternal RNA will be suppressed, which is believed to be regulated by deadenylation and/or binding with MSY2, a Y box protein [169, 170]

PAGE 38

38 It is likely that the stage specific translation during oocyte maturation and early embryogenesis is regulated by the po lyadenylation in bovine. In vitro evidence shows that polyadenylation and translation activation of mRNAs encoding proteins necessary for GVBD and chromatin condensation take place within 6 h after culture of the bovine cumulus oocyte complexes (COCs) [171] Indeed, gonadotropin induced meiotic maturation is prevented when the bovine COCs are treated with adenosine analogue cordycep tin, which inhibits the polyadenylation [171] S everal maternal factors have been identified that play important roles in early embryogenesis [172] In cattle, several oocyte molecules have been found important for oocyte maturation and developmental competence. The bovine o ocyte specific gene, JY 1 promote s progesterone production in granulosa cells and is required for successful early embryogenesis [173] Another important oocyte maturation factor is f ollistatin Kno ck down of locally produced f ollistatin in the bovine oocyte by microinjection of siRNA to zygote reduces the number of zygotes developing to 8 16 cell stage and inhibits blastocyst formation [174] Using the similar approach, several other factors have been linked with oocyte maturation. These include Importin 8 [175] and NOBOX [176] The dynami c s of gene transcription throughout oocyte maturation, fertilization and early embryogenesis is also subject to the epigenetic regulation. The epigenetics is defined as [177] Epigenetic modification involves the DNA methylation, histone modification as well as small non coding RNA. Various lines of evidence have shown that these modifications are relatively dynamic during oogenesis and early embryogenesis [60]

PAGE 39

39 As mentioned above, DNA methylation is a major epigenetic modification that involved in the transcriptional silencing of genes. There are several DNMTs. Among these, DNMT1 is the one responsible for maintaining methylation in DNA and DNM T3a and 3b are responsible for the de novo synthesis of DNA methylation. The oocyte has a specific isoform of DNMT1, DNMT1o, which is predominantly located in the oocyte cytoplasm. DNA methylation is associated with the developmental potential of the oocytes and embryos. It is reported that higher level of DNA methylation in the c loned embryos may account for the low development efficiency in animal cloning [178] The dynamic pattern of DNA methylation is observed in the transition from oocyte maturation to early embryogenesis [60] After fertilization, genomic DNA of pater nal origin undergoes active demethylation while the maternal genome is passively demethylated. An intriguing question is how two different demethylation patterns occur in the same zygote. In addition the methylation status of some sequences is well mainta ined during preimplantation development such as imprinting centers [179] and some repetitive sequences [180] It is still a mystery what the mechanism is for distinguishing sequences to be demethylated and those to be maintained. De novo and maintenance DNA methylation throughout the whole genome is recovered during the period of perimplantation to build tissue specific methylation status. Histone modif ication is also very important for the oocyte and early embryogenesis. Various modifications of histone undergo dramatic change hours after fertilization in mice. In terms of the function, for example, h igh level of histone arginine methylation catalyzed by CARM1, in 4 cell stage embryos will predispose blastomeres to contribute to the pluripotent cells of ICM [18 1]

PAGE 40

40 Potential Markers of Oocyte Quality M arkers of oocyte quality have been sought out to improve our selection of oocytes that will develop into embryos and provide viable offspring. M icroscopic evaluation of the COC is used to assess whether oocytes h ave the potential to mature normally in culture. Specifically, the intactness of the cumulus cells and integrity of the ooplasm is examined in many IVM systems [182] Post maturation assessments also are useful markers of oocyte quality. Most attempts have been made by using cumulus cell expansion and polar bod y extrusion as non inv asive markers of oocyte potential. G lutathione has been thought as a potential marker of cytoplasmic maturation. Its concentration in oocytes increases throughout final maturation [183 185] Glutathione is the major cytosolic molecule that p rotect cell s from oxidative damage by reducing reactive oxygen species (ROS) within mitochondria metabolism [183] A ttempts have been made to use low molecular weight thiols such as cysteamine to induc e the production of glutathione and thereby improve emb ryonic competence in development [42] Several molecules are linked with the developmental potential of oocytes in different species. The identification of these predicable markers will enable us to improve the reproduction efficiency in both human clinics and agricultural industry. In human, Cdc42 Hsd3b1, Fdx1, Serpine2 and Cyp19a1 a re more highly expressed in follicular somatic cells asso ciated with clinical pregnancies [186] and mRNA abundance of Pck1, Nfib and Bcl2L11in cumulus cells is indirectly associated w ith oocyte developmental competence [187] In cattle, two independent laboratories det ermined that cathepsin B ( CTSB ) expression in cumulus cells is negatively associated with the oocyte developmental competence [188 190] CTSB belongs to the cathepsin f amily of lysosomal cysteine proteinase, which has been involved in diverse biological activities [191 195] G enom e wide gene expression analyzes have generated several

PAGE 41

41 potential markers for oocyte competence [196 198] Among these differentially expressed transcripts are EGFR TNFAIP6 HAS2 CD44 [197] However, no firm causal relationship has been determined f or any of these candidate genes In V itro Maturation of B ovine Oocytes Maturation of oocytes in vitro is an important technology for human and animal ART. In this section procedures of IVM/IVF/IVC will be briefly reviewed as well as the factors affecting the IVP efficiency and potential solutions. IVM This technique refers to the matur ation of oocytes in culture T he starting materials, bovine ovar ies, are generally derived from ovaries obtained at the slaughterhouse and transported to IVF laboratories in saline solution. Such transportation can take hours t o complete. O ocyte used in IVM procedures generally are collected from mid sized follicles [199] These follicles contain g erminal vesicle stage oocytes and are appropriate for in vitro culture Oo cyte developmental competence is positively correlated with the size of the follicle [200] therefore, small sized follicles are avoided. Meantime, large sized follicles are presumably too old to culture in vitro in large animals. The oocytes used for IVM can also be obtained by ovum pick up (OPU). Factors Impacting IVM Efficiency A variety of factors are considered when developing an IVM system [42, 201] In cattle, tissue culture medium ( TCM ) 199 is commonly used as the basic maturation medi um. Various supplements are also used to mimic the in vivo follicular environment, and many laboratories use serum (e.g. bovine steer serum [BSS] ), FSH and selective growth factors (like EGF) [202] Successful IVM can be achieved under serum free maturation conditions [203] Several defined conditions include bovine serum albumin (BSA), PVA, or PVP i n place of serum [204 ] In our

PAGE 42

42 laboratory, the day 8 blastocyst rate is 20 50% when the oocytes are cultured in serum free conditions. IVF and IVC Fertilization and culture of embryos in vitro (IVF and IVC) are widely applied in human clinics and agriculture industry [201] For example in cattle, after maturation, the COCs are co incubated with Percoll purified spermatozoa in a culture dish with medium that induces sperm activation in vitro [199] A pool of frozen semen from three different bulls is used to reduce t he development al variation between replicates, after 8 10 hours of incubation, the putative zygotes are removed from the cumulus cells by vortexing in hyaluronidase [199] Then they are cultured in potassium simplex optimized medium (KSOM) or synthetic oviductal fluid (SOF) based medium for another 7 8 days before tra nsferring to the uterus or used in research [205] Low IVM Efficiency and Potential Solutions As mentioned above, the developmental competence of IVM/IVF derived embryos is poor compared with when oocyte maturation and fertilization occurs in utero [40, 206] IVP blastocysts have somewhat lower pregnancy rates at day 32 and increased pregnancy loss after first diagnosis than embryos collected from superovulated cattle [26, 40] One cause is likely due to the gamete sources and, at least in part to inadequacy of in vitro environment during IVM, IVF and IVC One outcome is that the cytoplasmic and molecular maturation of oocytes is relatively low. This problem likely accounts for most of the embryo loss and pregnancy failure observed after embryo transfer [26] Th us development of optimal oocyte maturation conditions is critical for improving in vitro production efficiency. Attempts to impro ve IVM efficiency have focused on manipulating maturation conditions so they more closely resemble the follicular niche environment. One way to do this is by supplement ing factors that exist in the follicle but may be absent in COCs maturing in vitro

PAGE 43

43 Some supplements include cAMP analogs ( i.e. dibutyrul cyclic AMP (dbcAMP)), and PDE3 inhibitors (i.e. hypoxanthine) [207, 208] These are used to regulate the cAMP level of oocytes. Their addition successfully improves embryo cleavage and developmental potential probably be cause i ncreased cAMP delays spontaneous maturation and leaves more time for the oocyte to ach ieve cytoplasmic maturation Examining follicular fluid containing factors is also of interest. Midkine, one heparin binding factor, improves oocyte developmental potential when added to the IVM medium. More role in folliculogenesis and/or oogenesis For example, the presence of EGF or IGF1 in the maturation medium impro ves the cytoplasmic maturation of bovine oocytes and promotes oocyte developmental potential [147, 209] In summary, the efficiency of IVM of oocytes is critical for t he entire IVP efficiency for use in human clinics and agriculture industry. However, the current IVM protocols still limit the developmental competence of oocytes. A growing body of evidence has demonstrated that IVM efficiency could be improved through op timization of various conditions, such as the search of beneficial supplements to the maturation medium. One recent outcome of such search is the family of fibroblast growth factors (FGFs) Fibrob la st Growth Factors At least 22 genes encode various FGFs th at function as important paracrine regulators of proliferation, morphogenesis and angiogenesis in various tissues [210, 211] Five FGF receptor ( FGFR ) genes are found and four of these gene products ( FGFR1 4 ) belong to the tyrosine kinase family of receptors [211] FGFR1 R3 generates two major isoforms: b and c and several other minor subtypes by alternative splicing events Some FGFs bind to multiple FGFR while FGFRs can bind to multiple FGFs. FGFs are well known for binding heparing or hepran sulfate

PAGE 44

44 proteoglycans to stabilize their interaction with their receptors and protect from proteolysis [212] FGF and R eproduction Various FGFs and their receptors are expressed within oocytes and follicular somatic cells in cows, mice and pigs [213 215] Over the past twenty years, the FGFR signaling has been linked with reproductive functions in mammals such as sex specification, primordial follicle activation and granulosa cell differentiation. Accumulative evidence implicates the FGF system as an important regulatory system for folliculogenesis and oogenesis. FGF2 is well studied for its role in folli cle development. FGF2 is dramatically up regulated in theca cells and granulosa cells during bovine follicle final maturation in vivo [216] Gilbert et al. showed that FGF2 is upregulated by GnRH challenge in vivo [217] These data indicate FGF2 is important for follicle final maturation or ovulation. One other study showed that FGF2 and it s cognate receptor are dynamic expressed in the oocyte during maturation in vitro [218] Granulosa cell production of FGFs, most notably FGF2 [219, 220] are linked to granulosa cell proliferation, LH receptor expression and primordial follicle development [221 224] FGF2 SNPs were associ ated with bovine oocyte developmental competence [11] In an earlier study, heparin binding fractions screened from bovine follicular fluid were demonstrated to be beneficial for oocyte competence when supplemented to IVM medium [225] It was later confirmed tha t midkine, one heparin binding factor potentially exists in follicular fluid, stimulates embryo development after IVF when supplemented during IVM [226] Another FGF that has been examined for its role in oogenesis is FGF7. This protein is detected in theca c ells of primordial follicles in rats and localized in granulosa cells in bovine preantral follicles. FGF7 promote s activation of primordial follicles, enhance s growth of preantral follicles and inhibit s apoptosis in growing follicles in rats [89, 227] It was also shown

PAGE 45

45 that FGF7 modulates the KITL/KIT signaling, which is a crucial stimulator of early stage follicle s. Another member of the FGF7 subfamily of FGFs is FGF10. This factor is of particular interest as a candidate of oocyte competence factor. FGF10 mRNA is detected in both theca cells and oocytes in cattle [228] Interestingly, FGF10 mRNA concentration is associated with health status of follicle. Specifically, FGF10 mRNA abundance is obviously higher in healthy follicle than atretic follicles [228] The cognate receptor for FGF10 and FGF7 FGFR2b, is dynamically regulated by FSH in granulosa cells [228] Recently, it was determined that FGF10 inhibits FSH induced estradiol production and another FSH signaling target (angiotensin type 2 receptor) in bovine granulosa cells cultured in vitro [228, 229] This result suggests FGF 10 could inhibit n granulosa cells. Collectively it is reasonable to expect that FGF10 is another heparin binding factor that promotes oocyte competence. Another subfamily of FGFs that have been examined recently is the FGF8 subfamily. This grouping consists of FGF8, 17 an d 18, all of which have been linked with mammalian follicle development. FGF8 is produced by the oocyte in mice and acts cooperatively with BMP15 to promote glycolysis in cumulus cells [141, 230] This fact is importa nt as the mouse oocyte is incapable of glycolysis and requires cumulus cells to provide energy substrate such as pyruvate to support oocyte growth. FGF8 mRNA is also detected in follicular somatic cells in cattle, indicating its paracrine and autocrine fun ction during folliculogenesis [231] FGF18 mRNA is detected in theca cells and absent in oocytes in cattle [232] The level of FGF18 mRNA in theca cells is greater in subordinate follicles than dominant follicles [232] The expression of steroidogeni c genes in granulosa cells are inhibited by FGF18 [232] This suggests FGF18 may be associated with the atre s ia FGF18 enhanced apoptosis of granulosa cells cultured

PAGE 46

46 in vitro [232] FGF17 mRNA is located primarily in oocytes rather than follicular somatic cells in cattle [233] The expression of FGFRs is critical for the function of FGF signaling. FGFR1, 2 and 3 mRNA are detected in both theca cells and granul osa cells whereas FGFR4 mRNA is only found in theca cells in cattle [216, 234] FGFR3c mRNA is also detected in bovine oocytes [234] However, FGFR2b and R4 mRNA are absent in bovine oocytes [234, 235] FGF2b and R3c mRNA abundance are increased along with follicle development [234] Nonetheless, FGFR4 mRNA abundance is reduced in theca cells when the follicle size increases [231] All of these evidences indicate the potential functional role of FGFR signali ng in folliculogenesis. Although the expressio n profiles of FGFs and FGFRs have been described extensively in rodents and ruminants, there are few reports of functional roles for these signals during the final stages of folliculogenesis. A more complete d escription of FGF dependent signaling is, therefore, needed to understand how these paracrine factors function during the later stages of folliculogenesis and determine if this insight may be used to reduce the incidence of infertility in cattle and other mammals. Working Hypothesis Ever increasing e vidence suggests that FGFs and their receptors participate in regulating follicle development [141, 228, 231] The expression profile of most FGFs in ovarian cells has been characterized but no efforts have been made to use this information to improve oocyte competence especially in regards to IVM systems W e propose that theca granulosa and oocyte derived FGFs can improve oocyte maturation and subsequent competence These FG F effects likely impact cumulus cells Th us, morphological and biochemical changes induced in cumulus cells may communicate with the oocyte to regulate the oocyte maturation, the refore influencing developmental competence.

PAGE 47

47 O ur overall hypothesis is that follicular and oocyte sources of FGFs take part in regulating granulosa and cumulus function and contribute to the follicular conditions that determine oocyte competence Rationa le and Significance The decline of reproductive efficiency has a profound negative impact on the profitability of dairy cattle industry. The economic value of pregnancy in dairy industry can be calculated by the added value of lifetime milk production and value of the offspring in pregnant cows compared with the costs of re breeding, feeding, and replacing cows that are not pregnant. A recent study determined that an average added value of $278 can be achieved when lactating dairy cows are pregnant [236] Each pregnancy l oss results in an average loss of $640 [237] Therefore, strategies that a im to improve fertility or reduce pregnancy loss are needed. Completion of the proposed research may be used to develop schemes that enhance fertility in dairy cattle. New knowledge may be gained regarding the regulation of oocyte maturation and the acquis ition of developmental competence in cattle. Understanding of this biological basis of oocyte competence during IVM could lead to new methods to improve oocyte quality in cows by manipulating cellular and molecular mechanism of follicle development and ooc yte growth and maturation. It may be possible to manipulate the embryonic developmental environment (reproductive tract) in the first days after insemination to ensure reproductive success. Second, a FGF based strategy of genetic selection for fertility ma y be developed to improve reproductive performance in modern, high producing dairy cows. The use of genetic selection based on milk production has led rapid gains in milk yield. However, performance for other traits, notably female fertility, has declined [2] Recently, several reports indicate FGF2 SNPs affect cow fertility [10, 11] Lastly, FGFs may be supplemented to conventional OMM to improve in vitro

PAGE 48

48 production efficiency in dairy cattle. Oocyte maturation in vitro is one important technology for genetic improvement and reproductive management of dairy c ows and other animals [26] Many technologies, suc h as in vitro production and somatic cell nuclear transfer, are dependent on oocyte maturation. Fully competent oocytes are determinants of the entire efficiency of these in vitro technologies. FGFs may improve the oocyte maturation and/or embryonic develo pment to enhance reproductive performance.

PAGE 49

49 CHAPTER 2 FGF 10 ENHANCES BOVINE O OCYTE MATURATION AND DEVELOPMENTAL COMPETENCE IN VITRO Oocyte competence is defined as the intrinsic ability of oocytes to resume meiosis, accept spermatozoa for fertilization, cleave after fertilization, and facilitate proper embryonic development that leads to the production of healthy offspring [24, 238] Proper follicle development is vital for oocyte competence, and folliculogenesis is controlled by a variety of endocrine and intraovarian factors [25, 98, 238] The oocyte plays an active role in regulating folliculogenesis. Specific members of the transforming growth factor BMP15 and growth GDF9, are produced within the oocyte and act on cumulus and granulosa cells to regulate folliculogenesis and oogenesis. GDF9 is vital for folliculogenesis. GDF9 null mice are infertile and follicles fail to develop past the primary follicle stage [101] Targeted disruption of BMP15 yields a subfertile phenotype in mice characterized by poor oocyte competence [102] BMP15 over expression promotes follicular development in mice [103] Also, specific BMP15 mutations in sheep improve ovulation and lambing rates [104] Another large class of paracrine acting factors that has received some recent attention for their abili ties to regulate follicular development and oocyte maturation are the FGFs. At least 22 genes encode various FGFs that function as important paracrine regulators of proliferation, morphogenesis and angiogenesis in various tissues [239, 240] Several FGFs are expressed within oocyte s and follicular somatic cells. FGF8 is produced by the mouse oocyte and acts cooperatively with BMP15 to promote glycolysis in cumulus cells in antral follicles [141, 230] Granulosa cell production of FGFs, most notably FGF2 [219, 220] is linked to primordial follicle development, granulosa cell proliferation and LH receptor expression [221 224]

PAGE 50

50 There also is evide nce for FGFs providing a paracrine link between theca cel ls and granulosa/cumulus cells. FGF7 and FGF10 are produced by thecal cells in cattle [228, 235] and their primary receptor partner, FGFR2b, presides on granulosa cells [228] FGF10 also is detected within the oocyte [228] Studying the roles of these thecal and oocyte derive d molecules is of particular interest since in vitro oocyte maturation systems lack thecal cells and their products, and the lack of these molecules may contribute to poor oocyte competence outcomes in IVP systems for cattle, humans and potentially other m ammals [38, 98, 238] The importance of FGF10 as a paracrine acting mediator of oocyte competence was examined in this work. FGF1 0 is an important mediator of mesenchymal epithelial communication in various organs and tissues [241 243] Also, intraovarian FGF10 concentrations are associated positively with health status of bovine follicles [228] Studies presented herein determined that FGFRs utilized by F GF10 are expressed in cumulus cells and oocytes and that providing FGF10 during IVM promotes bovine oocyte maturation, cumulus expansion and the rate of embryo development in vitro Further studies were completed to provide insight into mechanisms controlled by FGF10 during oocyte maturation. Materials and Methods Unless stated otherwise, reagents were purchased from Sigma Al drich Co. (St. Louis, MO, USA). All studies were completed in accordance and with the approval of the institutional animal care and use committee at the University of Florida. Bovine IVM Fertilization, and Embryo Culture Bovine oocyte IVM, IVF and IVC were completed as described previously [38, 124] In brief, ovaries from beef and dairy cattle were obtained from Central Beef Packing Co. (Center Hill, FL, USA) and washed several time s with 0.9% [w/v] sodium chloride supplemented with 100 U/ml penicill in and 0.1 mg/ml streptomycin. COCs were collected, and groups of 10 12

PAGE 51

51 OMM (TCM199 Corp., Carlsbad, CA, USA] sup plemented with 25 g/ml bovine FSH [Bioniche Life Sciences, Belleville, Ontario, Canada], 2 g/mlestradiol 17 gentamicin sulfate, 1 mMglutamine, 1 mg/ml pol yvinyl alcohol (PVA). Maturation medium was supplemented with v arying concentrations of recombinant human FGF10 (Invitrogen Corp.; 0.5 to 50 ng/ml prepared in TCM199 FGF10 polyclonal, IgG purified [SC 7375] or control IgG [SC 2028], Santa Cruz Biotechnology Inc., SantaCruz, CA, USA). In one study, IVM was completed using denuded oocytes. For this, COCs were vortexed for 4 min to remove cumulus before maturation. After 21 22 h at 38.5C in 5% CO2 in humidified air, COCs were transferred to fertilization medium and exposed to Percoll gradient purified bovine spermatozoa [38, 124] The same pool of semen from three bulls wa s used throughou t the studies. After 8 to10 h at 38.5C (5% CO2 in humidified air), cumulus cells were removed by vortexingin 1000 U/ml hyaluronidase and denuded putative zygotes were placed in groups of 25 synthetic oviduct fluid (mSOF; Millipore, Bi llerica, MA, USA) containing 25 g/ml gentamicin sulfate, 0.4 mM sodium pyruvate, 2.77 mM myo inositol, 0.5 mM sodium citrate, 1 mM alanyl glutamine, 5.3 mM sodium lactate syrup, 10 l/ml non essential amino acids, 20 l/ml essential amino acids and 4 mg/ml fatty acid free BSA). Drops were covered with mineral oil and maintained at 38.5C in 5% CO2, 5% O2 and 90% N2 for 8 days. The proportion of cleaved zygotes and proportion of embryos containing 8 16 blastomeres was recorded on day 3 post IVF. The proportion and stage of blastocysts (early, regular, expanded, hatching & hatched) was recorded at days 7 and 8 post IVF.

PAGE 52

52 Nuclear Maturation, Cumulus Expansion and Apoptosis Following Oocyte Maturation After maturation, the degree of cumulus expansion in C OCs were scored visually by phase contrast microscopy on a 1 to 3 scale (1=poor expansion characterized by few morphological changes compared with before maturation; 2=partial expansion characterized by fair expansion but notable clusters lacking expansion ; 3=complete or nearly complete expansion) as described previously [244] To assess progression through meiosis after IVM, oocytes were denuded by vortexing for 4 min in saline after 6 or 21 h of maturation. Chromatin condensation status was determined at 6 h and meiotic staging and 1st polar body extrusion was completed at 21 h. At both time points, oocytes were fixed with 4% (w/v) paraformaldehyde (Polysciences Inc., Warrington, PA, USA), permeabilized with 0.1% Triton X 100 and stained for 15 min with 1g/ml Hoechst 33342(Invitrogen Corp. ). Chromatin status and meiotic stagin g was determined with epifluorescence microscopy as described previously [32, 245] The presence of 1st polar body extrusion was determined under stereomicroscopy. In some studies, COCs were processed after IVM to determine the percentage of TUNEL positive cumulus cells. For this, COCs were wa shed in 0.01 M PBS (pH 7.2) containing 1 mg/ml PBS PVP and fixed in 4% (w/v) paraformaldehyde. COCs were permeabilized in 0.5%(v/v) Triton X 100, 0.1% (w/v) sodium citrate for 30 min at RT in a humidified box. Positive and negative controls were incubated in 50l RNase free DNase (50 U/ml; New England Biolabs, Ipswich, MA, USA) at 37C for 1 h. COCs were incubated in 25l drops of the TUNEL reaction mixture containingFITC conjugated dUTP and terminal deoxynucleotidyl transferase (Roche Applied Sciences, Ind ianapolis, IN, USA) for 1 h at 37C in the dark. Negative controls were incubated in the absence of the enzyme terminal deoxynucleotidyltransferase. COCs were mounted on slides and analyzed w ith

PAGE 53

53 epifluorescence mi croscopy. The proportion of TUNEL positive cumulus cells was calculated by dividing the number of TUNEL positive nuclei with total nuclei numbers in each of four fields under 200 fold magnification. Differential Staining in Blastocysts Differential staini ng for trophectoderm (TE) versus inner cell mass (ICM) cells were completed as described previously [21] In brief, blastocysts obtained at day 8 post IVF we re incubated with 100g/ml RNase A (Qiagen, Valencia, CA, USA) for 1h and transferred in as little solution as possible into 100g/ml propidium iodide (PI; Invitrogen Corp.), 0.2% Triton X 100 and 1 mg/ml polyvinyl pyrrolidone ( PVP ) in PBS for 30 sec. Afte r three washes in PBS PVP, embryos were placed into a solution containing 10 g/ml Hoechst 33342, 4% paraformaldehyde and 1 mg/ml PVP in 0.01 M PBS (pH 7.2) for 15min. After a final series of washes, blastocysts were placed into glycerol drops on microscop e slides and TE and ICM cells were counted by using epifluorescence microscopy. Real time Quantitative (q) RT PCR Cumulus cells and oocytes (n=25 to 30/group) were separated from each other by vortexing either immediately after isolating COCs from follic les (0 h; no maturation) after 6 or 21 22 h after beginning IVM. Denuded oocytes were removed and washed thrice in PBS PVP. Cumulus cells were transferred to microcentrifuge tubes and centrifuged at 700 g for 2 min at room temperature to remove residual solution. Both oocytes and cumulus cells were snap frozen in liquid nitrogen and stored at 80C. tcRNA was extracted from cumulus cells using the RNeasy Micro Kit (Qiagen, Valencia, CA, USA) and from oocytes using the PicoPure tm RNA Isolation Kit (MDS Analytical Tech nologies, Sunnyvale, CA, USA). RNA concentrations were determined using a NanoDrop 2000 Spectrophotometer (Thermo Sc ientific, Wilmington, DE, USA). RNA (10 ng/reaction for

PAGE 54

54 cumulus samples; entire RNA sample for oocyte samples) was incubated in RNase free DNase(New England Biolabs Inc.) and reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosyste ms Inc., Foster City, CA, USA). Primer sets (Table 2 1)were used in combination with a SYBR Green detection syste m and a 7300 Real Time PCR System (Applied Biosystems Inc.) to provide relative quantities of specific transcripts in cumulus and oocyte transcripts. Primers were used at a concentration of 200 nM and were mixed with RT products and SybrGreen PCR Master Mi x (Applied Biosystems Inc.). After an initial activation/denaturation step (50C for 2 min, 95C for 10 min), 40 cycles of a 2 step amplification protocol (60C for 1 min, 95C for 15 sec) were completed. A dissociation curve analysis (60 to 95C) was used to verify the amplification of a single product. Amplicons derived from newly synthesized primer pairs were sequenced (UF DNA Sequencing Facility) to ensure correctness of amplification. Each sample was run in triplicate and a fourth reaction lacking expo sure to reverse transcriptase was included to verify the absence of genomic contamination. Relative amounts of 18S RNA was used as an internal control for quantifying relative gene expression. In one study, the ratio of target to reference RNA was used t o determine relative expression (2 CT[target]/2 CT[reference]). The remaining studies used the comparative threshold cycle (CT) approach to determine relative abundance [246] T for each transcript was calculated (target CT 18SCT) and used to calculate the fold change (2 Statistical Analyses All ana lyses were completed with least squares analysis of variance (LS ANOVA) using the general linear model (GLM) of the Statistical Analysis System (SAS for Windows, version 9.0; SAS Institute Inc., Cary, NC, USA). Statistical analyses used arcsin transformed percentage data generated from each replicate (experimental unit = average percentage within each

PAGE 55

55 replicate). Differences in individual means were separated further by completing pair wise comparisons (probability of difference analysis [PDIFF]; SAS Instit ute Inc.). Percentage data were graphed using non transformed values and SEMs. Differential staining data were analyzed using embryo as the experimental unit, and data were analyzed to describe the effect of FGF10 treatment on TE and ICM cell numbers and p roportion of ce lls that were ICM (ICM/Total). COC expansion was analyzed in two ways: 1) The mean COC expansion index was calculated for each treatment within each replicate and 2) the proportion of COCs observed within each of the non parametric rankings (1, 2 and 3). When analyzing qRT PCR data, either log transformed presented either as the ratio of target to reference RNA or as fold differences from control v alues. Results FGFR Transcript Profiles in Cumulus Cells and Oocytes Four genes encode FGFRs in mammals (FGFR1 4), and alternatively spliced variants for three of these FGFRs provide an extensive diversity of extracellular domains that bind various FGFs [247, 248] Some FGFs bind to multiple FGFR s (e.g. FGF1, FGF2) whereas others, like FGF10, associate primarily with only a few receptor subtypes. FGF10 associates primarily with one spliced variant of FGFR2, termed R2b, and one spliced variant of the FGFR1 group, termed R1b [247 249] An initial study was completed to describe the relative expression of these and other FGFRs in cumulus cells and oocytes. COCs were harvested and cumulus and oocytes were separated without IVM Quantitative RT PCR was completed to assess the relative expression of the b and c spliced variant forms of FGFR1 and R2 as well as FGFR3 (pri mers recognized both R3b and R3c) and R 4 (no splice variants exist). In cumulus cells (Figure 2 1A), amounts of R1b transcripts were greater (P<0.05) than either of the R2 isoforms and R3 and R4. The abundance

PAGE 56

56 of R1c was intermediate b etween R1b and the ot her FGFRs. In oocytes (Fig ure 2 1B), R2b and R2c mRNA levels were markedly greater (P<0.05) than the other FGFR transcripts, and R3 transcripts were barely detected. FGF10 Supplementation D uring IVM Improves Embryo Development The role of FGF10 during oocyte maturation initially was examined by collecting cumulus oocyte complexes from slaughterhouse derived ovaries and completing IVM fertilization and culture. Methods described previously were used [38, 124] with the exception that OMM lacked serum (instead it contained 1% [w/v] PVA). FGF10 supplementation during oocyte maturation did not impact clea vage rates (Figure 2 2A), but supplementation with 0.5 ng/ml FGF10 increased (P<0.05) the percentage of cleaved embryos at the 8 16 ce ll stage by day 3 post IVF (Figure 2 2B). In addition, 0.5 ng/ml FGF10 increased (P<0.05) the percentage cleaved embryos t hat developed to blastocysts on d ay 7 post IVF (Figure 2 2C). The percentage of cleaved embryos that formed expanded, hatching or hatched blastocysts (collectively termed as advanced blastoycsts) on day 8 post IVF also were greater (P<0.05) for oocyte cult ures containing 0.5 ng/ml FGF10 th an non treated controls (Figure 2 2D). A biphasic response to FGF10 supplementation was evident throughout the study. Specifically, effects on percentage of 8 16 cell embryos, blastocysts on day 7 and advanced blastocysts on day 8 were not observed when 5 or 5 0 ng/ml FGF10 was provided (Figure 2 2B, C, D). Differential staining was completed on a subset of blastocysts (n=17 28 blastocysts) to investigate whether FGF10 supplementation during oocyte maturation affects num bers of inner cell mass (ICM) and trophoblast cells. Exposing COCs to 0.5 ng/ml did not affect the numbers of ICM, trophoblast, overall cell numbers or ICM:trophoblast ratio at day 8 post IVF (37.2 4.1 vs. 42.8 2.3 ICM/blastocyst, 134.8 7.8 vs. 122 8.7 trophoblast/blastocyst for controls and 0.5 ng/ml treatments, respectively).

PAGE 57

57 Bl ocking Endogenous FGF10 Action D uring Oocyte Maturation Reduces Subsequent Embryo Development Thecal cells are the predominant source for FGF10 in bovine follicles but t he oocyte also produces FGF10 in antral follicles [228] Anti FGF10 IgG was used to determine the importance of oocyte derived FGF10 during IVM In the first study, the e ffectiveness of anti FGF10 IgG at blocki ng FGF10 actions was examined. Providing an excess of anti fold excess compared with 0.5 ng/ml FGF10)did not affect cleavage rates or rates of early embryonic development (data not shown) but it ef fectively blocked FGF10 (0.5 ng/ml) from increasing (P<0.05) blastocy st rates on day 7 post IVF (Figure 2 3A). Anti FGF10 also reduced (P<0.05) the percentage of cleaved blastocysts when compared with non treated controls (Figure 2 3A). A second study was completed to further define the developmental events impacted by anti FGF10 treatment in the abs ence of supplemental FGF10 (Figure 2 3B). Anti FGF10 treatment did not affect cleavage rates, but there was a tendency for rates of cleaved embryos reaching the 8 16 cell stage on day 3 post IVF to be decreased (P=0.08) in response to anti FGF10 (45 8.8% vs. 37.2 13.4% for control vs. anti FGF10 treatment).On day 7 post IVF, fewer (P<0.05) blastocysts resulted from oocytes exposed to anti addition, providing a 3.9 fold molar excess of FGF10 (50 ng/ml) reversed the negative effect of anti FGF10 on day 7 blastocyst rates. Effects of FGF10 on Oocyte Maturation The physiological basis for the newly described FGF10 effec ts was explored by determining if FGF10 supplementation affects oocyte maturation and cumulus expansion. The percentage of oocytes reaching telophase I or metaphase II (TI/MII) after 21 22 h of maturation also was influenced by FGF10 supplementation (Figur e 2 4A). Supplementation with 0.5 or 5 ng/ml FGF10 did not affect the percentage of TI/MII oocytes but exposure to 50 ng/ml FGF10

PAGE 58

58 increased (P<0.05) the percentage of TI/MII o ocytes compared with controls. The percentage of oocytes extruding their first po lar body was influenced by FGF10 supplementation (Fig ure 2 4A). Supplementation with 0.5 and 50 ng/ml FGF10 but not 5 ng/ml FGF10 increased (P<0.05) first polar body extrusion ra tes as compared to the control. A related study was completed to determine if endogenous sources of FGF10 impact bovi ne oocyte maturatio n(Figure 2 4B). Supplementing anti IVM did not affect the percentage of TI/MII oocytes and first polar body extrusion rates atv21h post maturation. The ontogeny of oocyte ma turation was examined by describing how FGF10 affects chromatin cond ensation during IVM (Figure 2 4C). Adding 50 ng/ml FGF10 increased (P<0.05) the proportion of oocytes containing condensed chromatin after 6 h. Supplementation with 0.5 ng/ml FGF10 or anti FGF10 did not affect the percentage of oocytes with condensed chromatin. In a final study, oocytes devoid of cumulus cells were matured in the matured in vitro in the presence or absence of FGF10 or anti FGF10 to examine the site of FGF10 action on oocyte maturation (Fig ure 2 5). Providing 50 ng/ml FGF10 decreased (P<0.05) the percentage of TI/MII oocytes at 21 h p ost IVM. Adding 5 ng/ml FGF10 or anti FGF10 did not affect the percentage of TI/MII oocytes. Also, none of the treatments affected first polar b ody extrusion rates. Effects of FGF10 on Cumulus Expansion FGF10 also impacted cumulus expansion rates during IVM (data not shown) The first study examined the dose response effect of FGF10 supplementation on the degree of cumulus expans ion (rank scoring from 1 to 3). A biphasic response to increasing FGF10 concentrations was observed When examining the mean cumulus index score for each treatment, cumulus expansion was increased (P<0.05) in oocytes matured in medium containing 0.5 ng/ml but not greater c on centrations of FGF10. Data also were analyzed to determine the proportion of C OCs in each rank category The proportion of oocytes with fully or near fully expanded cumulus

PAGE 59

59 (index score=3) was greater (P<0.05) in oocytes supplemented with 0.5 ng/ml FGF10 than controls but not when greater amounts o f FGF10 were supplemented TUNEL analysis was completed on a subset of the COCs used in these experiments, and supplementation with FGF10 did not affect percentage of apoptotic cumulus cells at 21 h post maturation (data not shown). The effect of endogenous FGF10 on cumulus expa nsion rates was examined by anti FGF10 supplementation As described in the previous study, adding 0.5 ng/ml FGF10 increased (P<0.05) cumulus expansion score and co supplementation with anti cked (P<0.05) this effect In a subsequent s tudy, providing anti FGF10 in the absence of exogenous FGF10 reduced (P<0.05) the mean COC expansion score Effects of FGF10 on Cumulus and Oocyte Gene Expression To examine the molecular basis of FGF10 actions during oocyte maturation, expression profiles for candidate genes were completed on cumulus cells and oo cytes after 21 h of maturation. Changes in the relative abundance of only a few transcripts were evident in cumulus cells and oocytes after 21 h of maturati on (Fig ure 2 6 ). Adding 0.5 ng/ml FGF10 d ecreased (P<0.05) concentrations of CTSB and S PRY2 mRNA in cumulus cells (Figure 2 6 A) and increased (P<0.05) BMP15 mRNA abundance in oocytes ( Figure 2 6 B). A second study was completed to describe how FGF10 impacts candidate gene expr ession after 6 h of m aturation. No changes in transcript abundance were detected in the subset of the cumulus specific transcripts (CTSB, EGFR, FSHR, HAS2, SPRY2) and all of the oocyte specific transcripts (data not shown). Discussion Embryos generated from IVM and fertilizati on procedures usually are less able to produce viable offspring than in vivo derived embryos in cattle and humans [25, 38, 250] The absence of s pecific thecal derived products during IVM and development may be one reason for these

PAGE 60

60 reductions in oocyte and embryo competence This work determined that at least one thecal and oocyte derived product, FGF10, improves embryogenesis when provided during in vitro oocyte maturation. The first study described the types of FGFRs expressed in bovine cumulus cells and oocytes as they begin IVM. Transcripts for each of the four genes were rea dily evident in cumulus cells. Oocytes also contained transcripts for all four receptor classes, although very little FGFR3 mRNA was detected. As described previously, FGF10 reacts primarily with R1b and R2b with high affinity and with several other FGFRs with much lower affinities [247 249] Transcripts for R1b and R2b were detected in both tissues and R1b mRNA was the predominant FGF10 r eceptor partner in cumulus cells whereas R2b was mor e prevalent in oocytes. These differences in expression profiles likely are an important feature to the various FGF10 responses observed in COCs. Cleavage rates were unaffected in oocytes supplemented with FGF10 during IVM but subsequent in vitro embryo development rates were improved. The most obvious post fertilization effects included; 1) the proportion of embryos reaching the 8 16 cell stage on day 3, and 2) the proportion of embryos reaching the blastocyst stage on day 7 and advanced blastocysts on day 8 post IVF. It remains unclear exactly how FGF10 treatment promotes embryo development, but exposure to FGF10 did not affect blastomere numbers at day 8 suggesting that the embryotrophic effects of FGF10 do not require improvements in blastomere numbe rs on days 7 and 8. Similar outcomes were observed by others [251, 252] In those studies, bovine oocyte quality affected subsequent blastocyst yields mo re so than blastocyst quality. Perhaps FGF10 enhances the ooplasm microenvironment by altering concentrations of specific molecules that promote embryo development during the first few cleavage events. EGA occurs at

PAGE 61

61 the 8 to 16 cell st age in bovine embryos [253] Improvements in embryo development were detectable that this time, and it is quite possible that enhancements in the early developing embryo created a greater proportion of competent 8 16 cell embryos that continued to develop to blastocys ts. Biphasic oocyte responses were evident when FGF10 was added to maturation medium. Observing maximal responses with 0.5 ng/ml indicates that FGF10 likely interacts with high affinity FGFRs (i.e. R1b and/or R2b)to elicit its response (ED50 = 0.1 to 1 ng/ ml; [247, 254] ). Similar biphasic dose responses to FGF supplementation, and other paracrine acting factors for that matter, are evident in various cell types [255 259] This phenomenon could ha ve been caused by receptor down regulation events associated with ligand overloading [257] Alternatively, this effect could reflect differential receptor usage that could have prompted secondary signaling systems that interfered with the primary signaling response [255, 260, 261] Subsequent investigation into how FGF10 improves oocyte competence determined that FGF10 improves several aspects of oocyte m aturation. One of the interesting findings was the ability of FGF10 to improve cumulus ex pansion. The magnitude of FGF10 effects on cumulus expansion scores and the percentage of COCs that were fully expanded after 21 h were not great, likely because expansion rates already were fairly great to begin with, but they did occur when using the same concent ration of FGF10 observed to improve subsequent embryo development (0.5 ng/ml). An endogenous source of FGF10 also appears important for cumulus expansion in cattle. In situ hybridization work in bovine follicles found copious amounts of FGF10 mRNA in theca l cells and immunoreactive FGF10 protein throughout the thecal and granulosa layers [228] Oocytes also contain FGF10 transcripts [228] The IgG treatments employed for this work likely targeted oocyte derived FGF10 and any residual thecal derived FGF10 that remained bound to

PAGE 62

62 extracellular matrix within COCs. The IgG neutralizati on appeared specific for FGF10. This IgG was used previously to neutralize FGF10 actions on mouse incisor growth [262] In the present work, providing IgG molecules prevented supple mented FGF10 from stimulating cumulus expansion and subsequent embryo development rates, and providing molar excesses of FGF10 partially overcame the neutralization effects of FGF10 IgG on embryonic devel opment to the blastocyst stage. Also, providing FGF1 0 IgG in the absence of supplemental FGF1 0 decreased cumulus expansion. These observations implicate modifications in cumulus cell activity as a potential source for FGF10 induced increases in oocyte competence FGF10 also affects severa l aspects of oocyte maturation. FGF10 improved the percentage of oocytes containing condensed chromatin after 6 h of maturation and oocytes progressing to TI/MII and extruding their first po lar body after 21 h. However, the concentrations of FGF10 needed to observe some of t hese responses were greater than those needed to improve subsequent embryo development. With the exception of the polar body extrusion outcomes, other benefits to oocyte meiotic matur ation required 50 ng/ml FGF10. Providing anti FGF10 did not a ffect meioti c maturation rates. Also, maturation rates of denuded oocytes w ere reduced by FGF10 treatment. Meitoic maturation and polar body extrusion occurs, albeit retarded, in the absence of cumulus cells [147, 263] Therefore, it appears that the rate of oocyte maturation is not a critical component to FGF10 dependent improvement s in bovine oocyte competence Also, cumulus cells appear vital for improvements in oocyte maturation occurring after providing large concentrations of FGF10. To further understand how FGF10 improves oocyte competence a series of transcripts identified by others as putative competence markers in cumulus and oocytes were examined. Sever al cumulus specific transcripts are linked to oocyte competence The gene encoding

PAGE 63

63 cathepsin B (CTSB) contained an interesting FGF1 0 dependent expression pattern. Several cathepsin transcripts, including CTSB and CTSZ, are inversely rela ted to oocyte quali ty. In one study, cumulus derived from COCs of prepubertal heifers, a model of poor oocyte competence contained more CTSB mRNA than COCs from mature cows [190] Oocyte quality and post fertilization development could be improved by exposing COCs to a membrane permeable cathepsin inhibitor [190] In another study, cows with a low rate of antral follicle development contained greater amounts of CTSB mRNA than cows with higher numbers of antral follicles [111] In the present work, CTSB mRNA abundance decreased in cumulus from COCs exposed to FGF10.CTSZ, by contrast, exhibited no FGF10 dependent changes in transcript abundance. FGF10 supplementation also reduced cumulus concentrations SPRY2 mRNA. This is not surpris ing given that SPRY2 is a modulator of FGF signaling [116] The remaining cumulus competence mark ers were not impacted by FGF10. Included in this work were the following transcripts: EGFR and FSHR, receptors essential for normal oocyte maturation and cumulus expansion [197, 264] ; HAS2, a key player in cumulus expansion [113, 197] ; KITL, a component of stem cell survival and oocyte growth [265] ; and INHBA, an inhibin subunit [197] Several oocyte competence factors remained largely unaffected by FGF10 trea tment. I ncluded among these were FST [174, 266] ,GDF9 [113] ,JY1 [173] and H2A [264, 267] FGF10 supplementation did, however, impact BMP15expression. BMP15 is linked with oocyte competence Supplementation with BMP15 during IVM improves subsequent blastocyst rates in bovine oocytes [266] Therefore, it is possible that FGF10 improves oocyte competence through BMP15. A more complete understanding of gene expression changes are needed to more d oocyte during maturation.

PAGE 64

64 It remains unclear what extent using a heterologous recombinant protein had on the outcomes. The human FGF10 protein chosen for this work is 94% identical in amino acid sequence to bovine FGF10. It reacts with approximately the same potency as other FGFs on various tissues, although a subtle reduction in activity was observed when comparing the potency of this protein against other FGFs (FGF1, 2, 7) for their ability to stimulate interferon tau production in bovine TE [268] It is presumed that human FGF10 reacts with the same FGFR subtypes as bovine FGF10, although that has not been verified. It remains possible, therefore, that certain aspects of FGF10 activity during oogenesis were not identified by using human FGF10 in bovine COCs. In summary, work presented herein provides evidence that thecal and oocyte derived FGF10 improves oocyte competence Providing FGF10 to bovine COCs during IVM improved oocyte maturation, cumulus expansion and subsequent embryo development The mechanisms controlled by FGF10 have not been elucidated. A closer examination of metabolic, transcriptomic and proteomic changes regulated by FGF10 is warranted. However, based on present findings, FGF10 likely acts on cumulus cells in ways that impr ove their ability to regulate meiosis and provide ooplasm with components of importance for early embryonic survival.

PAGE 65

65 Table 2 1 Primers used for qRT PCR. Transcript Primer sequence (5' to 3') Oocyte BMP15 For: GTCAGCAGCCAAGAGGTAGTG Rev: CCCGAGGACATACTCCCTTAC FST For: CAGAGCTGCAAGTCCAGTACCA Rev: CATGTAGAGCTGCCTGGACAGA GDF9 For: GGGAAATGTGTTCCTTGCTAATTC Rev: AGCAGCAAAACCAAAGGAAGAA H2A For: GTCGTGGCAAGCAAGGAG Rev: GATCTCGGCCGTTAGGTACTC JY1 For: TTGGAACTTCCATGGACGACC Rev: ATTTGCTGGTGATCCCAAGAG Cumulus CTSB For: CGATGCCCGGGAACAGT Rev: GAGCACAGGATCCCTGATC CTSZ For: GGGAGAAGATGATGGCAGAAAT Rev: TCTTTTCGGTTGCCATTATGC EGFR For: ACCCTGATCTGGAAGTTTGCA Rev: TCGAGACCTGGCCCTTCAC FSHR For: TGGTCCTGTTCTACCCCATCA Rev: GAAGAAATCCCTGCGGAAGTT HAS2 For: TAAATGTGGCAGGCGGAAGAAGG Rev: GTCTTTGTTCAAGTCCCAGCAGCA INHBA For: GCTACCACGCCAACTACTGTGA Rev: AGAGGGATGAGCCCGATGT KITL For: AATGGGCAGCCGTAGCATT Rev: TCCAGTAAAAGGCCCCAAAA SPRY2 FGFRs R1b R1c R2b R2c R3 R4 For: CACGTGCTGTCTCTGGATCAG Rev: GGCCCCTCCGTGTACTCA For: ACGTCCTGGTGACGGAGG Rev: CCGGTGCCATCCATTTGA For: ACTGCTGGAGTTAATACCACCG Rev: GCAGAGTGATGGGAGAGTCC For: GTGGAAAAGAACGGCAGTAAATA Rev: GAACTATTTATCCCCGAGTGCTTG For: CACCACGGACAAAGAAATTG Re v: ATGCAGAGTGAAAGGATATCCC For: GCAGCGGCTACAGGTGCTCA Rev: CAGGCCGCGTCCAGTAAGGG For: GCAGACGCTCCTCACCCGAC Rev: CGAGACTCACGAGGCCAGCG Note: The relative standard curve approach (5 serial dilutions of a follicular/oocyte RNA pool) was used to verify primer efficiencies. The following primers sets were designed previously: CTSB and CTSZ [190] ; BMP15 [ 269] ; JY1 and FSHR [111] ; H2A [270] ; HAS2 [197] ; FGFR1b [271] ; FGFR1c and R2c [272] ; FGFR2b [273] Remaining primers were designed using Primer Express Software (version 3.0; Applied Biosystems Inc.).

PAGE 66

66 Figure 2 1. Expression profiles of FGFRs in bovine cumulus cells an d oocytes prior to maturation. Cumulus and oocytes were separated before maturation, tcRNA was extracted and qRT PCR was completed. Log transformed ratios of the target mRNA to reference RNA ( 18S ) were used for statistical analysis A ) : FGFR abundance profiles in cumulus cells (each replicate contained cells derived from 20 COCs; 3 replicate st udies ). B ) : FGFR profiles in denuded oocytes (20 oocytes/replicate; 3 replicate studies). Different superscripts within each transcript represent differences observed due to treatments (P<0.05).

PAGE 67

67 Figure 2 2. In vitro development of bovine embryos is enhanced by adding FGF10 to medium during oocyte maturation. COCs were matured for 21 22 h in maturation medium containing 1 mg/ml PVA (no serum) and either 0, 0.5, 5 or 50 ng/ml FGF10, the n were fertilized and cultured. Presumptive zygotes were inspected visually using a stereomicroscope to assess embryo development status at specific times. A ) The proportion of zygotes that cleaved at 72 h post IVF. B ) The proportion of cleaved zygotes at 72 h post IVF that cont ained between 8 and 16 cells. C) The propo rtion of oocytes (left side) or cleaved embryos (right side) that reached the blast ocyst stage by day 7 post IVF. D) The proportion of oocytes (left side) or cleaved embryos (right side) that reached advanced blastocyst stages on day 8 post IVF (expansion, hatching, hatched). All values represent means and SEMs from 8 replicate studies, each containing from 20 to 33 zygotes/treatment group. Different superscripts within each panel represent differences observed due to treatments (P<0.05).

PAGE 68

68 Figure 2 3. Evidence for an endogenous source of FGF10 during oocyte maturation in vitro COCs were cultured in maturation medium in the presence or absence of anti FGF10. FGF10 was included in some samples to verify the effectiveness of the anti FGF10 treatment. Control IgG (labe led as IgG) also was included. A) The effects of providing anti during COC maturation on blastocyst formation on day 7 pos t IVF (n=7 replicate studies). B) Limiting the effec ts of anti FGF10 by providing excess FGF10 (50 ng/ml) (n=4 replicate studies). Different superscripts within each panel represent differences observed due to treatments (P<0.05). Data are presented as the percentage of oocytes that developed to blastocyst s on day 7 post IVF.

PAGE 69

69 Figure 2 4. FGF10 impacts oocyte progression through meiosis and first polar body extrusion. A, B) : After 21 22 h, cumulus was removed and denuded oocytes were processed to determine the proportion of oocytes reaching telophas e I (TI), meiosis II (MII; B only) and extruding their first polar body (1 st PB). A) The effect of FGF10 supplementation during IVM on oocyte maturation (n=6 replicate studies; 8 10 oocytes/treatment/study ). B ) The effect of adding anti FGF10 (or control I gG; each at 10 oocytes/treatment/study ). C ) After 6 h of maturation, cumulus was removed and denuded oocytes were processed to determine the proportion of oocytes containing condensed chromatin (n=5 replicate studies; 15 20 oocytes/treatment/study). Different superscripts represent differences obs erved due to treatments (P<0.05).

PAGE 70

70 Figure 2 5. FGF10 does not stimulate maturation in denu ded oocytes. Cumulus was removed from oocytes before maturation, and denuded oocytes were incubated in maturation medium containing FGF2 (0, 0.5 or 50 ng/ml) or FGF2 or control IgG) (n=6 replicate studies; 15 20 oocytes/treatment/study). After 21 22 h, the proportion of oocytes reaching TI or MII and undergoing 1 st PB extrusion was determined. Different superscripts represent differences obser ved due to treatments (P<0.05).

PAGE 71

71 Figure 2 6. The effect of FGF10 supplementation on expression profiles of selective transcripts in cumulus cells and oocytes. COCs were cultured for 21 h in maturation medium containing or lacking 0.5 ng/ml FGF10. C umulus cells and oocytes were separated, tcRNA was extracted from e ach and qRT PCR was completed. A ) Expression profiles for cumulus cells (n=5 samples/treatment; each sample contained c umulus cells from 20 25 COCs). B ) Expression profiles for oocytes (n=6 pools/treatment; each pool contained 20 T values were used for statistical analysis, and data are reported based on fold change ( SEM) relative to the control (no FGF10 treatment). Astericks (*) indicates differences observed between tre atment groups for a given transcript (P<0.05).

PAGE 72

72 CHAPTER 3 SUPPLEMENTATION WITH FGF2 PROMOTES MATURA TION AND SUBSEQUENT DEVELOPMENTAL COMPET ENCE OF CULTURED BOV INE CUMULUS OOCYTE COMPLEXES A suitable follicular environment is needed to generate an oocyte that can be successfully fertilized and eventually produce a healthy offspring. Several paracrine and autocrine factors within the follicular niche control oocyte maturation and play crucial roles in dictating subsequent embryo competence [25, 98, 238] One group of paracrine and autocrine factors that have been examined recently for their involvement with folliculogenesis and oo genes is are FGFs Numerous FGFs exist in mammals, and a majority of these molecules function as local ( i.e. paracrine, autocrine, intracrine) and endocrine mediators of mitogenesis, morphogenesis and angiogenesis in various cell types [239, 240] The receptors that associate with FGFs (terme d FGFRs) are multigenic, and products for each of the four major FGFR genes contain receptor tyrosine kinase activity within their intracellular domains [247, 248] Numerous alternative splicing events occur within the extracellular region of these receptors to generate a complicated array of lig and receptor interactions. Various FGFs and FGFRs have been detected in oocytes and follicular somatic cells of cattle [203, 216, 228, 231, 235] pigs [215] m ice [141, 213, 230] and women [219, 220] FGFs are involved in various biological processes during follicu logenesis in rodents including primordial follicle activation and regulation of granulosa and cumulus cell mitosis, apoptosis and glycolysis [141, 222, 223, 274] Several ac tivities for FGFs have been described in cattle and other ruminants during follicle development and oogenesis. An FGF of recent interest is FGF10. This molecule is produced by theca cells and oocytes in c attle and its primary receptor partner s FGFR 1c and FGFR2 b, are produced by granulosa and cumulus cells [203, 228, 235] Concentrations of

PAGE 73

73 FGF10 mRNA were greater in healthy, growing bovine follicles than in follicles undergoing atresia [228] In another study, FGF10 supplementation sustained survival and increased development of cultured preantral caprine follicles [275] Recently, FGF10 has been implicated as an oocyte co mpetence factor. Supplementing b ovine COCs with FGF10 during IVM increased subsequent embryonic development [203] The concept that selective factors found within the follicular niche can be used to improve in vitro production (IVP) of bovine embryos was examined further in this work by describing how FGF2 supplementation during oocyte maturation affects oocyte and embryo development. Immunoreactive FGF2 localizes to theca and granulosa cells in bovine follicles, and the relative abundance of FGF2 mRNA increases during follicle growth and after GnRH treatment in cattle [272, 276] Also, mRNA concentrations of FGF2 increase during bovine IVM [218] and selective FGF2 single nucleotide polymorphisms (SNPs) are linked with IVF success rate in ca ttle [11] Therefore, we proposed that providing FGF2 during IVM would benefit oocyte maturation in ways that subsequently impact embryo development during in vitro cu lture (IVC). Materials and Methods Reagents and Animal Assurances Recombinant bovine FGF2 was purchased from R&D Systems (Minneapolis, M N, USA). TCM 199, Hoechst 33342 and primers used for qRT PCR were purchased from Invitrogen Corp. (Carlsbad, CA, USA). Follicle stimulating hormone (FSH) was purchased from Bioniche Life Sciences (Belleville, Ontario, Canada ). mSOF was purchased from Millipore ( Cat# BSS 078 D Billerica, MA USA ). Paraformaldehyde (16% [w/v] ultrapure grade) was purchased from Polysciences Inc. (Warrington, PA, USA). RNase free DNase was purchased from New England Biolabs (Ipswich, MA, USA). T he t erminal deoxynucleotidyl transferase dUTP n ick end l abeling ( TUNEL) ki t was purchased from Roche Applied Sciences (Indianapolis, IN, USA).

PAGE 74

74 The RNeasy Micro Kit was purchased from Qiagen (Valencia, CA, USA). The High Capacity cDNA Reverse Transcription Kit and SYBR Green PCR Master Mix were purchased from Applied Biosystems I nc. (Foster City, CA, USA). All other reagents were purchased from Sigma Aldrich Co. (St. Louis, MO, USA). All studies were completed in accordance with and with the approval of the I nstitutional A nimal C are and U se C ommittee at the University of Florida Bovine IVM Fertilization and Culture Procedures were completed as described previously [38, 124, 203] Briefly ovaries were obtained from Central Beef Packing Co. ( Center Hill, FL, USA). Cumul us oocyte complexes (COCs) were collected and groups of 10 12 OMM (TCM199 (unless otherwise stated) 2 g/ml estradiol 17 sodium pyruvate, 50 g /ml gentamicin sulfate, 1 mM glutam ine, 1 mg/ml PVA Maturation medium was supplemented with varying concentrations of recombinant bovine FGF2 ( 0.5 to 50 ng/ml ) prepared in TCM199 and 1% [w/v] bovine serum albumin (BSA) In one study, IVM was completed using denuded oocytes. For this, COCs were vortexed for 4 min to remove cumulus cells After 21 h at 38.5C in 5% CO 2 in humidified air, COCs were transferred to fertilization medium and exposed to Percoll gradient purified bovin e spermatozoa. The same pool of semen from three bulls was used throughout the studies. After 8 to10 h at 38.5C (5% CO 2 in humidified air), cumulus cells were removed by vortexing in 1000 U/ml hyaluronidase and denuded zygotes were placed in groups of 25 [277] Drops were covered with mineral oil and maintained at 38.5C in 5% CO 2 5% O 2 and 90% N 2 for 8 days. At day 3 post IVF, t he proportion of cleave 8 blastomeres was recorded The proportion of blastocysts and sta ge of blastocyst development (early, regular,

PAGE 75

75 expanded, hatching and hatched) was recorded at days 7 and 8 post IVF On day 8, blastocysts were fixed with 4% [w/v] paraformaldehyde, permeabilized with 0.1% [v/v] Triton X 100 and stained for 15 min with 1g /ml Hoechst 33342 [60] Blastocysts were mounted on slides and number of nuclei per blastocyst was recorded. Nuclear Maturation, Cumulus Expansio n and Apoptosis Following Oocyte Maturation After 21 h of maturation, the degree of cumulus expansion in COCs were scored visually by phase contrast microscopy on a 1 to 3 scale (1=poor expansion characterized by few morphological changes compared with before maturation; 2=partial expansion characterized by fair expansion but notable clusters lacking expansion; 3=complete or nearly complete expansion) [60, 244 ] To assess progression through meiosis during or after IVM, oocytes were denuded by vortexing for 4 min in saline after 6 or 21 h of maturation. O ocytes were fixed with 4% [ w/v ] paraformaldehyde, permeabilized with 0.1% [v/v] Triton X 100 and stained for 15 min with 1g/ml Hoechst 33342. M eiotic staging at 21 h was determined with epifluorescence microscopy as described previously [32, 245] First polar body extrusion was determined by using stereomicroscopy. In one stud y COCs were processed after IVM to determine the percentage of TUNEL positive cumulus cells using FITC conjugated dUTP and chst 33342 as a counterstain. COCs were mounted on slides and analyzed with epifluorescen ce microscopy. The proportion of TUNEL positive cumulus cells was calculated by dividing the number o f TUNEL positive nuclei with total nuclei numbers within each COC Real time Q uantitative (q) RT PCR Repeat pipetting was used to separate c umulus cells and oocytes from each other (n=25 to 30/group) 6 or 21 h after beginning IVM. Denuded oocytes were removed and washed thrice in PBS PVP. Cumulus cells were transferred to micro centrifuge tubes centrifuged at 700 g for 2

PAGE 76

76 min at room temperature to remove residual solution snap frozen in liquid nitrogen and stored at 80C. Total cellular (tc) RNA wa s extracted from cumulus cells using the RNeasy Micro Kit. RNA concentrations and i ntegrity of RNA (A 260 /A 280 w as determined using a NanoDrop 2000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA ). Each tcR NA sample (10 ng/reaction) wa s incubated in RNase free DNase and reverse transcribed using the High Capacity cDNA Reverse Transcription Kit. Primers used for this work included CTSB [190] EGF R and SPRY2 [60] FSHR [111] HAS2 [197] BCL2, BAX and BAD [202] and XIAP and FAS [278] Primers were used at a concentration of 200 nM and were mixed with RT products and SYBR Green PCR Master Mix. After an initial activation/denaturation step (50C for 2 min, 95C for 10 min), 40 cycles of a 2 step amplification pro tocol (60C for 1 min, 95C for 15 sec) were completed using a 7300 Real Time PCR System. A dissociation curve analysis (60 to 95C) was used to verify the amplification of a single product. Each sample was run in triplicate and a fourth reaction lacking e xposure to reverse transcriptase was included to verify the absence of genomic contamination. Relative amounts of 18S RNA was used as an internal control for quantifying relative gene expression. No treatment or time dependent changes in 18S RNA abundance relative to tcRNA concentration was detected in these studies. T he ratio of target to reference RNA was used to determine relative expression (2 CT[target] /2 CT[reference] ) [60] Statistical A nalyses All analyses were completed with least squares analysis of variance (LS ANOVA) using the GLM of the Statistical Analysis System (SAS for Windows, version 9.0; SAS I nstitute Inc., Cary, NC, USA). All percentage data were arcsin e transformed before analysis. Either o rthogonal contracts or pair wise comparisons (probability of difference analysis [PDIFF]; SAS Institute Inc.) were completed to separate means Percentage data are presented as non transformed values and SEMs. COC expansion was analyzed by examini ng the mean COC

PAGE 77

77 expansion index ( calculated for each treatment within each replicate ) and by examining the proportion of COCs observed within each of the non para metric rankings (1, 2 and 3). The ratio of target to reference RNA was used to analyze qRT PCR data. Results FGF2 Supplementation D uring IVM Benefits Subsequent Embryo Development To describe whether oocytes benefit from FGF2 supplementation during oocyte maturation in vitro COCs were matured in medium containing different concentrations of FGF2 (0.5, 5, 50 ng/ml or carrier only controls). Subsequently, COCs were fertilized and cultured in the absence of supplemental FGF2. Fully defined maturation medium was used ( i.e. serum was replaced with 1 mg/ml PVA). As shown in Table 3 1, numerical differences that did not approach significance were evident for the percentage of presumptive zygotes that cleaved when COCs were cultured with FGF2. To adjust for these minor differences in cleavage rates, su bsequent embryo data were examined based on the number of cleaved embryos. at day 3 post IVF, but increases (P=0.02) in the percentage of cleaved embryos that became b lastocysts at day 7 post IVF were observed when comparing all the FGF2 treatments with the control ( i.e. contrasting 0.5, 5 and 50 ng/ml FGF2 versus control). At day 8, FGF2 supplementation did not affect the percentage of total blastocysts, the percentage of advanced blastocysts or blastomere numbers. FGF2 Regulates M eiotic M aturation o f B ovine O ocytes In vitro A series of studies were completed to understand how FGF2 supplementation may be acting during in vitro oocyte maturation. The first set of studi es examined oocyte meiotic maturation (Fig ure 3 1). Supplementation with 0.5, 5 or 50 ng/ml FGF2 increased (P=0.05) the percentage of oocytes wi th polar bodies after 21 h (Figure 3 1A) Effects of FGF2

PAGE 78

78 supplementation on meiotic maturation also were observ ed. Pair wise comparison analysis indicated that exposure to 5 ng/ml increased the percentage of oocytes that developed to metaphase II (MII) when compared with the control (P=0.03) (Fig ure 3 1B). However, exposure to 0.5 or 50 ng/ml FGF2 did not affect me iotic maturation. Follow up studies were completed to determine if these positive effects of FGF2 supplementation on meiotic maturation required cumulus cells and FSH supplementation. In one study, oocytes were denuded by rapid vortexing and cultured in medium containing 0 or 5 ng/ml FGF2. Supplementation with FGF2 did not affect the percentage of oocytes extruding their first polar body (71 8 vs. 56 8% for 0 and 5 ng/ml FGF, respectively) or achieving the MII stage (78 6 vs. 57 9% for 0 and 5 ng/ ml FGF, respectively). In a second study, cumulus cells were not removed but COCs were matured in medium lacking FSH. In these cultures, supplementation with FGF2 did not affect the percentage of oocytes extruding their first polar body or reaching MII aft er 21 h (40 3 vs. 35 5 for polar body extrusion and 33 5 vs. 32 5 for meiosis II for 0 and 5 ng/ml FGF2, respectively). FGF2 Increases Expansion and Reduces Apoptosis of Cumulus Cells The effects on FGF2 on cumulus cell activity and gene expressi on were examined to describe how beneficial effects of FGF2 may be achieved during COC maturation. Cumulus expansion is a goo d predictor of oocyte competence for fertilization and subsequent embryo development [147, 190, 279] FGF2 supplementation during COC maturation had some minor influ ences on cumulus expansion (Figure 3 2). When compared with the control, supplementation with 0.5 ng/ml FGF2 increased (P=0.04) the percentage of COCs that were fully expanded ( i.e. score=3). Supplementation with 5 or 50 ng/ml FGF2 did not affect expansion scores.

PAGE 79

79 A separate study determined that FGF2 supplementation also may act on the cumulus to limit cumulus cell a poptosis (Figure 3 3). COCs were cultured with 0, 0.5 o r 5 ng/ml FGF2 for 21 and the percentage of TUNEL positive cumulus nuclei were then determined Supplementation with either concentration of FGF2 redu ced (P=0.03) the percentage of TUNEL positive cumulus cells when compared with the non treated control. To follow up on this observation, the influence of FGF2 supplementation on expression profiles of several apoptosis related genes w as examined after 6 a nd 21 h of maturation. Supplementation with 5 ng/ml FGF2 did not affect the relative abundance of BCL2 XIAP BAX BAD and FAS in cumulus cells at either time point (data not shown). A final study was completed to determine if FGF2 supplementation altered the expression of selective cumulus expressed transcripts associated with oocyte competenc e [113, 116, 190, 197, 264] For this, COCs were cultured in 0 or 5 ng/ml FGF2 for 6 or 21 h, COCs were vortexed to liberate cumulus cells and RNA was extracted from cumulus cells Subsequ ent qRT PCR analysis did not detect FGF2 dependent differences in the relative abundance of CTSB SPRY2 EGFR FSHR and HAS2 mRNA after 6 or 21 h of culture (data not shown). Discussion Bovine IVM/IVF/IVC procedures generate embryos that usually are infer ior at producing viable offspring than in vivo derived embryos. Pregnancy rates at day 28 32 usually are reduced and subsequent pregnancy losses are increased following transfer of IVP embryos to recipients at day 7 post estrus when compared with inseminat ed cows [38, 280] This work tested whether addition of selective biological agents during IVM would improve subsequent embryogenesis. Recent work from this laboratory determined that FGF10 supplementation during IVM increased subsequent embryo development in vitro [60] This FGF is produced by thecal cells and oocytes in antral follicles, and concentrations of FGF10 are positively related to health status of the

PAGE 80

80 follicle [228, 235] Our interest in examining FG F2 as a second oocyte competence factor stemmed from descriptions of FGF2 being expressed within the follicle, with notable expression within theca, granulosa and cumulus cells [272, 276] and by observing transcripts for several FGFR isotypes that bind FGF2 in cumulus cells and oocytes [60] The consequences of providing supplemental FGF2 during IVM on subsequent embryo development were very specific. Treatment of COCs with FGF2 did not impact cleavage rates, early embryo development or overall development of blastocysts, but increased the onset of blastocyst formation at day 7. Cell numbe rs at day 8 post IVF were not different in embryos derived from FGF2 treated COCs, indicating that FGF2 did not mediate initial blastocyst formation by altering blastomere division rates. Small increases in advanced blastocyst rates at day 8 were observed in embryos from FGF2 treated COCs (4 vs. 9 to 11%; see Table 3 1). Similar increases in blastocyst rates that are not accompanied by changes in blastomere numbers also were observed after supplementing FGF10 to COCs [60] Observing increases in the onset of blastocyst development are significant because more pregnancies are maintained to term from early forming blastocysts versus blastocysts forming later following IVF [281, 282] Several FGF2 dependent alterations in oocyte maturation were observed in this work. Its ability to promote first polar body extrusion was observed at all of the FGF2 concentrations tested (0.5 to 50 ng/ml) whereas benefits on progression of oocytes to metaphase II was only observed in COCs provided 5 ng/ml FGF2. The involvement of FSH in these FGF2 dependent effects was examined by removing this supplement from the culture system. As also shown by others, rates of oocyte maturation were re duced in the absence of FSH [283] Treatment with FGF2 did not affect oocyte maturation in absence of FSH. This could indicate that FSH controls FGF dependent events during maturation. A definitive role for FSH in controlling FGFR

PAGE 81

81 expression during folliculogenesis has not been described but FSH increases FGFR1 mRNA abundance in cultured rat sertoli cells [284] and GnRH treatment, which induces LH and FSH surges, increases FGFR1 mRNA abundance in bovine follicular cells [272] Both of the major splice variant forms of FGFR1 (R1b and R1c) exhibit high affinity interactions with FGF2 [247] A second cul ture model used to examine the effects of FGF2 during IVM involved removing cumulus cells before maturation. Granulosa cells and presumably cumulus cells produce FGF2 during bovine oocyte maturation in vivo [272, 276] and removal of cumulus cells allowed for describing if any direct eff ects of FGF2 on oocytes exist. No FGF2 responses were detected in denuded oocyte cultures. Several parameters were examined to describe how FGF2 acts indirectly via cumulus cells to mediate oocy te competence Cumulus cells exchange signaling molecules, en ergy substrate and others with oocyte by communicating through gap junctions [98] Transcripts identified by others as putative cumulus markers of oocyte competence were examined in an effort to understand how FGF2 regulates oocyte competence Cathepsin B ( CTSB ) mRNA and protein abundance is inversely related to oocyte quality in cattle [190] Other cumulus specific transcripts are important for normal oocyte maturation and cumulus expansion ( EGFR FSHR HAS2 SPRY2 ) [113, 197, 264] FGF2 supplementation did not affect the abundance of any of these transcripts. The lack of detectable changes in these transcripts after FGF2 treatment indicates that FGF2 must act through alt ernative path ways to impact oocyte competence It also was interesting to observe that FGF2 limits cumulus cell apoptosis. Cumulus cells undergo spontaneous apoptosis during IVM [285] The mechanism controlling this activity has not been identified. The expression of several candidate markers of cell survival was not affected by FGF2 treatment.

PAGE 82

82 In summary, this work shows for the first time t hat supplementing FGF2 during IVM stimulates various aspects of oocyte maturation and cumulus activity. This treatment also benefits subsequent developmental competence and specifically promotes the onset of blastocyst formation in cultured bovine embryos The specific mechanisms controlled by FGF2 during oocyte ma turation that confers competence to form blastocysts has not been described, and future examinations into the actions of FGF2 should include further investigation into how this factor affects cu mulus cell activity and components of the ooplasm after maturation.

PAGE 83

83 Table 3 1. The effect of supplementing FGF2 during COC maturation on subsequent in vitro development. Parameter 1 FGF2 (ng/ml) P Value 2 0 0.5 5 50 Day 3: % Cleaved Zygotes 3 82 2 78 1 77 4 73 3 0.14 cell Embryos 4 59 9 65 6 58 5 68 2 0.59 Day 7: % Blastocysts 4 16 3 30 2 26 2 29 7 0.02 Day 8: % Blastocysts 4 38 8 46 6 40 3 38 8 0.69 Day 8: % Advanced Blastocysts 4 4 2 13 3 11 2 9 5 0.22 Blastomere Number (Day 8) 124 8 121 8 129 10 129 9 0.96 1 For embryo development data, n=4 replicate studies; 26 to 35 COCs/replicate. For cell number assessment, n=26 to 34 blastocysts examined over 4 replicate studies. 2 Represents the comparison (via Orthogonal contrast analysis) of controls (no FGF2) versus oocytes cultured in 0.5, 5 or 50 ng/ml FGF2. 3 Based on the percentage of total oocytes. 4 Based on the percentage of cleaved embryos.

PAGE 84

84 Figure 3 1. The effect of FGF2 supplementation during IVM on oocyte maturation. COCs (n=10 22/replicate; 7 replicate studies) were cultured in maturation medium containing FSH and 0, 0.5, 5 or 50 ng/ml FSH. After 21 h, cumulus cells were removed by vortexing and the percentage of o ocytes that extrude d their first polar body ( A) and achieve d MII (B) was determined. A ) A significant difference between controls and all FGF2 treatment groups was detected by using Orthogonal contrasts (P=0.05). B) P ercentage of oocytes that reached MII d iffered between the control and oocytes exposed to 5 ng/ml FGF2. The other FGF2 treatments did not differ from the control.

PAGE 85

85 Figure 3 2. The effect of FGF2 supplementation during IVM on cumulus expansion. COCs (n=10 22/replicate; 6 replicate studie s) were cultured in maturation medium containing FSH and 0, 0.5, 5 or 50 ng/ml FSH. After 21 h, cumulus expansion scores were assigned to each COC (rank from 1 to 3 based o n no or little expansion, moderate ex pansion, or complete expansion) and the percen tage of COCs in each category were compared between treatments. There was an increase (P=0.04) in the percentage of fully expanded cumulus (score 3) in COCs incubated win medium containing 0.5 ng/ml FGF2 when compared with controls. The other FGF2 treatme nts did not differ from controls in their relative portion of cumulus expansion.

PAGE 86

86 Figure 3 3. The effect of FGF2 supplementation during IVM on cumulus cell apoptosis. COCs (n=25 35 /replicate ; 4 replicate studies) were cultured in maturation medium containing FSH and 0, 0.5, 5 or 50 ng/ml FSH. After 21 h, COCs were fixed and processed to determine the percentage of TUNEL positive cumulus cells in each COC. A significant difference between controls and both FGF2 treatment groups was detected by using Orthogonal contrasts (P=0.03).

PAGE 87

87 CHAPTER 4 DISRUPTION OF FGF RE CEPTOR SIGNALING IN CUMULUS OOCYTE COMPLEXES REDUCES MEIOTIC MATU RATION AND SUBSEQUEN T DEVELOPMENTAL COMPETENCE OF BOVINE OOCYTES FGFs control various aspects of embryonic, fetal and adult physiology. They are best known as mediators of cell proliferation and differentiation, organogenesis, angiogenesis and tumorigenesis [211, 239] Most FGFs act as paracrine factors in various tissues although some FGFs serve as endocrine factors and control vitamin D metabolism, kidney function and bone mineralization while others fu nction primarily as intracrine mediators of cell survival [286, 287] Multiple FGF transcripts are expressed in bovine oocytes ( FGF8/10/17 ), theca cells ( FGF2/7/10/18 ) and granulosa cells ( FGF2, 8, 18 ) [228, 231, 233, 276] Several FGF receptor variants ( FGFRs ) are expressed in bovine theca, granulosa and cumulus c ells and in oocytes [228, 231, 276, 288] Four genes encode these tyrosine kinase receptors mammals ( FGFR1 /2/3/4 ), and alternative splicing in three of these receptors ( FGFR1 /2/3 ) generate numerous receptor subtypes [211, 247] One splicing event occurs within the third extracellular immunoglobulin like domain of FGFR1/2/3 and this generates receptor subtypes known as IIIb / IIIc or b/c variants that bind FGFs with various a ffinities. For example, the FGFR2b subtype (also known as keratinocyte growth factor receptor) reacts with the FGF7 subfamily of ligands (FGF3, 7, 10, 22) whereas the FGFR2c subtype interacts with other FGFs ( e.g. FGF2, 4, 6, 9) [211, 247] There is mounting evidence that locally produced FGFs are important for folliculogenesis. In mice, oocyte derived FGF8 acts cooperatively with BMP15 another oocyte derived factor, to stimulate glycolysis in cumulus cells [141] Theca and oocyte derived FGF2 regulates LH receptor expression in granulosa cells and primordial follicle development [223, 224] Follicle development and estrogen production also are increased in human ovarian tissue cultures

PAGE 88

88 conta ining FGF2 [221] In cattle, the steroidogenic capacity of granulosa cel ls is regulated by FGF7, 10 and 18, all of which are produced primarily by theca cells [228, 232, 235, 276] Recently this laboratory found that supplementing FGFs during in vitro oocyte maturation (IVM) increase the overall success of in vitro bovine embryo production [60, 289] Since theca cells are not utili zed during IVM of cumulus oocyte complexes (COCs), we proposed that supplementing theca derived FGFs would improve the ability of the oocytes to mature, be fertilized and develop into viable embryos. Supplementing FGF10 during IVM increased bovine oocyte c ompetence [60] Specifically, FGF10 supplementation during IVM did not greatly affect oocyte maturation and fertilization success but increased embryo development rates to the blastocyst stage. Similar findings were described when FGF2 was su pplemented to bovine COCs during IVM [289] Endogenous sources of FGFs ( i.e. FGFs derived from cumulus cells or oocytes) also appear important for oocyte competence during in vitro embryo production. Neutralizing FGF10 activity during IVM by IgG capture did not affect oocyte maturation or fertilization but reduced subsequent embryo development [60] The present work was completed to better understand the functional importance of FGFs during the final stages of oocy te maturation in cattle. Specific objectives were to describe whether gonadotropins affect the expression of specific FGFR isotypes in cumulus cells and oocytes during IVM and to examine whether blocking FGFR activity with pharmacological inhibitors during IVM affects oocyte maturation, fertilization and embryo development. Materials and Methods Reagents and Animal Assurance TCM 199, Hoechst 33342 and primers used in qRT PCR were purchased from Invitrogen Corp. ( Carlsbad, CA, USA ). FSH was purchased from Bioniche Life Sciences ( Belleville,

PAGE 89

89 Ontario, Canada ). mSOF was purchased from Millipore ( Billerica, MA USA ) The pharmacological inhibitors of FGFRs were purchased from Symansis, Shanghai, China (SU5402) and EMD Chemicals, Gibbstown, NJ (PD173074). P arafo rmaldehyde (16% [w/v] ultrapure grade) was purchased from Polysciences Inc. ( Warrington, PA, USA) RNase free DNase was purchased from New England Biolabs (Ipswich, MA, USA). The RNeasy Micro Kit was purchased from Qiagen (Vale ncia, CA, USA) and the PicoPu re TM RNA Isolation Kit was purchased from MDS Analytical Technologies ( Sunnyvale, CA, USA) The High Capacity cDNA Reverse Transcription Kit and SYBR Green PCR Master Mix were purchased from Applied Biosystems Inc. (Foster City, CA, USA). RIPA buffer H alt Protease Inhibitor Cocktail and Halt Phosphatase Inhibitor Cocktail were purchased from Thermo Scientific (Pittsburgh, PA USA ) AlexaFluor 594 was purchased from Molecular Probes Inc. (Eugene, OR, USA). All other reagents were purchased from Sigma Aldrich Co. (St. Louis, MO, USA). All experiments were carried out in accordance with the approval of the institutional animal care and use committee at the University of Florida. IVM Fertilization and Culture Oocyte maturation, fertilization and embryo cul ture in vitro were completed as described previously [38, 124, 203] Briefly, ovaries were obtained from a local slaugh terhouse ( Central Packing, Center Hill, FL, USA). COCs were collected and pools of 10 12 COCs were placed in OMM ( 25 g/ml bovine FSH [unless stated otherwise], 2 g/ml estradiol 17 mM glutamine, 1 mg/ml PVA). Pharmacological in hibitors of FGFR kinases (SU5402, PD 173074) were prepared in DMSO and supplemented to OMM immediately before use (0.25% and 0.005% DMSO final dilution, respectively). In one study, denuded oocytes were generated

PAGE 90

90 before maturation by vortexing COCs 4 min t o remove cumulus cells. Maturation was completed for 21 h at 38.5C in an atmosphere of 5% CO 2 in humidified air. After maturation, COCs were placed in fertilization medium and incubated with Percoll gradient purified bovine spermatozoa for 8 to10 h at 3 8.5C (5% CO 2 in humidified air ) [60] A pool of semen from three bulls was used for all studies. After fertilization, cumulus cells were removed by vortexing in 1000 U/ml hyaluronidase and putative zygotes were cultured in groups of 25 30 in SOF ( 25 g/ml gentamicin sulfate, 0.4 mM sodium pyruvate, 2.77 mM myo inositol, 0.5 mM sodium citrate, 1 mM alanyl glutamine, 5.3 mM sodium lactate syrup 10 l/ml non essential amino acids, 20 l/ml essential amino acids and 4 mg /ml fatty acid free BSA) [277] Drops were covered with mineral oil and maintained at 38.5C in 5% CO 2 5% O 2 and 90% N 2 for 8 days. Nuclear Maturation Determination To assess progression through meiosis during or after IVM, oocytes were denuded by vortexing for 4 min in saline after 21 h of maturation. O ocytes were fixed with 4% [ w/v ] paraformaldehyde, permeabilized with 0.1% [v/v] Triton X 100 and stained for 15 min with 1g/ml Hoechst 33342. M eiotic staging at 21 h was determined with epifluorescence microscopy as described pr eviously [32, 245] First polar body ex trusion was determined under stereomicroscopy. Quantitative, Real Time RT PCR Analysis of Cumulus Cells and Oocytes Cumulus cells and oocytes (n=20/group) were separated from each other either immediately after COC isolation and prior to maturation (0 h) or at 6 or 21 h after IVM by vortexing for 4 min Denuded oocytes were washed thrice in PBS PVP snap frozen in liquid nitrogen and stored at 80 C until use. Cumulus cells were centrifug ed ( 700 g for 2 min ) to remove residual solution and were snap frozen in liquid nitrogen and stored at 80C until use.

PAGE 91

91 Total RNA was isolated from cumulus cells using the RNeasy Micro Kit and from oocytes using the PicoPure TM RNA Isolation Kit. RNA concentrations and integrity (A 260 /A 280 determined by using the Nano Drop 2000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA). RNA (10 ng/reaction for cumulus samples; entire sample for oocytes) was treated with RNase free DNas e and reverse transcribed using the High Capacity cDNA Reverse Transcription Kit. The SYBR Green detection system and a 7300 Real Time PCR System (Applied Biosystems Inc.) was used to provide relative quantities of specific transcripts in cumulus and oocy te transcripts. Primers (200 nM) were described previously [60] After an initial activation/denaturation step (50C for 2 min, 95C for 10 min), 40 cycles of a 2 step amplification protocol (60C for 1 min, 95C for 15 sec) were completed. A dissociation curve analysis (60 to 95C) was used to verify the amplification of a single product. Each sample was run in triplicate and a fourth reaction lacking exposure to reverse transcriptase was included to verify the absence of genomic contaminatio n. Relative amounts of 18S RNA was used as an internal control. Statistical analyses All data were analyzed by analysis of variance ( A NOVA) using the GLM of the Statistical Analysis System (SAS for Windows, version 9.0; SAS Institute Inc., Cary, NC, USA). Percentage data were arcsin e transformed before analysis. Differences in individual means were separated further by completing pair wise comparisons (probability of difference analysis [PDIFF]; SAS Institute Inc.). Percentage data were graphed using non t ransformed values and SEMs. The qRT PCR data were analyzed after determining the ratio of target to reference RNA (2 CT[target] /2 CT[reference] ) [60] Data are presented as fold changes over 0 h controls by using the comparative threshold cyc le (C T ) approach where the T value for each transcript was determined (target C T 18S C T ) and used to calculate the fold change (2 ) [246]

PAGE 92

92 Results FGFR mRNA A bundance in COCs Recent work described the relative abundance of various FGFR transcr ipts in bovine cumulus cells and oocytes before COC culture [60] Cumulus cells contained high amounts of both FGFR1 spliced variant mRNAs ( R1b / R1c ) and moderate amounts of the spliced FGFR2 mRNA variants ( R2b/R2c ) whereas oocytes contained l arge amounts of R2b / R2c and moderate amounts of R1b / R1c Since notable increases in bovine granulosa/cumulus FGFR mRNA abundances occur around the time of ovulation [272] we proposed that changes in FGFR1 and FGFR2 mRNA abundances would occur in bovine cumulus cells and oocytes during IVM. Cumulus cells were separated from oocytes by vortexing either before COC culture or after 6 or 21 h of culture and RNA was extracted from groups of cumulus cells and oocytes. Samples collected before culture served as reference controls for initial transcr ipt abundance of R1b R1c R2b and R2c Supplementation with FSH increased (P<0.05) the abundance of each FGFR is otype after 6 h of culture (Fig ure 4 1). This beneficial effect was observed when cumulus cells from FSH treated COCs were compared with non FS H treated samples and cumulus cells collected before culture. The FSH effect was transient for three of the four transcripts. Abundance of R1b R1c and R2b mRNA were not different between FSH treated and untreated samples after 21 h of culture whereas R2c mRNA was greater (P<0.05) in cumulus cells exposed to FSH than those not exposed to this gonadotropin. Changes in the relative abundance of FGFRs also were detected over time in culture. The R2c transcript containe d the most dynamic changes (Fig ure 4 1D) with increased (P<0.001) R2c mRNA abundance after 6 h of culture in the absence of FSH (14 5 fold change versus 0 h control) and a further increase (P<0.001) after 6 h in cultures containing FSH (71 15 fold change versus 0 h control). The relative ab undance of R2c mRNA in cumulus cells was less after

PAGE 93

93 21 h of culture than at 6 h (P<0.05) but mRNA abundance at 21 h remained greater (P<0.001) than that for cumulus cells collected before culture (12 4 fold change versus 0 h control) and FSH supplementat ion increased (P<0.01) R2c mRNA abundance at this time point (35 6 fold change versus 0 h control). Additional studies were completed to further characterize the FGFR1 and FGFR2 expression profiles in cumulus cells. In one study, a lower concentration o f FSH was examined for its ability to mediate FGFR mRNA abundance in cumulus cells. FSH (1 g/ml) was added to the medium and COCs were cultured for 6 h before cumulus cell removal. Increases (P<0.05) in R1b R1c R2b and R2c transcripts were observed when compared with cumulus cells from COCs lacking FSH exposure (2.1 0.3, 2.0 0.3, 42.7 13.9 and 21.0 4.0 fold increase for each respective variant). In another study, COCs were cultured in medium lacking FSH but containi ng 3 g/ml LH After 6 h, the relative abundance of cumulus R1b R1c R2b and R2c transcripts did not differ between LH treated and non treated COCs (data not shown). Supplementation with FSH did not affect mRNA abundance of R1b R1c R2b and R2c in ooc ytes (data not shown). No changes in abundance of R1b R1c and R2b transcripts were detected in oocytes after 6 or 21 h of culture, and R2c mRNA abundance decreased (P<0.05) after 21 h of culture in oocytes derived from FSH supplemented and non supplemente d COCs (0.55 08 fold change versus 0 h control). FGFR mRNA A bundance is not D ependent on MAPK3/1 FSH dependent activation of mitogen activated kinase pathways, and specifically ERK1/2 dependent systems (termed MAPK3/1), are required for resumption of oocyte meiosis and cumulus cell activation in mice [140, 290] A study was completed to determine if FSH utilizes MAPK3/1 to stimulate FGFR mRNA abundance in bovine cumulus cells (Fig ure 4 2). Addition of U0126, a n inhibitor of MAPK3/1 activation, to COCs during culture did not affect

PAGE 94

94 FSH induced and non FSH induced concentration s of R1b R1c R2b and R2c mRNA in cumulus cells after 6 h (Fig ure 4 2). The effectiveness of the inhibitor was verified by observing that it could block the FSH dependent increase in SPRY2 mRNA, a MAPK3/1 responsive feedback inhibitor of FGF signaling [249] (Fig ure 4 2E). Interrupting FGFR S ignaling D uring Oocyte Maturation Compromises Embryo Development To describe the significance of FGFR signals during COC maturation, sequential studies were completed with two pharmacological inhibito rs of FGFR kinase activity ( Fig ure 4 3 and 4 4). Both inhibitors (SU5402 and PD173074) were added at the beginning of IVM and COCs were washed after maturation to remove inhibitors before fertilization. Fertilization and subsequent embryo culture occurred in me dia lacking inhibitors. A range of concentrations were examined for each inhibitor, and the largest concentration of each inhibitor prevented FGF2 dependent gene expression in bovine trophoblast cells (25 M SU5402 and 1 M PD173074) [277, 291] No exogenous FGFs were provided during IVM/IVF/IVC. The percentage of cleaved embryos at day 3 post IVF was not affected by SU5402 treatment during oocyte maturation (Fig ure 4 3A). However, e (Fig ure 3A). Also, the percentage of embryos that reached the blastocyst stage at day 7 and 8 post ure 3B). Exposure to lower concentrations of SU5402 did not affect embryo development potential at days 3, 7 or 8. Exposure to PD173074 during oocyte maturation did not affect the percentage of cleaved embryos at day 3 post cells (Figure 4 4A) Exposure to 100 nM PD173074 tended (P=0.09) hereas exposure to 10 nM of the inhibitor did

PAGE 95

95 not affect this outcome. At day 7 post the percentage of cleaved embryos that were blastocysts (Fig ure 4 4 B). At day 8, blastocyst formation was reduced when reduced after exposure to 100 nM of the inhibitor (P=0.07) and was not affected by exposure to 10 nM of inhibitor. FGFR Signaling and Oocyte Meiotic Maturation The ramifications of blocking FGFR activity during COC culture were examined by surveying how exposure to the FGFR inhibitors affected the meiotic maturation of oocytes (Fig ure 4 5). Incubation with 25 M SU5402 decreased (P<0.05) the percentage of oocytes that extruded the first polar body and achieved metaphase II (MII) whereas incubation with 1 M PD173074 did not affect polar body extrusion and MII rates. To clarify how FSH supplementation impacts the ability of the FGFR inhibitors to mediate oocyte maturation, a study w as completed using maturat ion medium that lacked FSH (Figure 4 5B ). Fewer oocytes extruded their first polar body and achieved MII when FSH was not added to maturation medium, and SU5402 exposure further decreased (P<0.05) both parameters whereas exposure to PD173074 did not affect oocyte maturation. Discussion This work provides evidence that dynamic changes in cumulus FGFR expression occurs during in vitro oocyte maturation and inhibiting FGFR kinase activity during IVM negatively affects bovine embryo d evelopment. To our know ledge this is the first report describing that oocyte competence is dependent on endogenous FGF signaling during the final stages of oocyte maturation preceding fertilization. Bovine follicles and oocytes contain several FGFR isoty pes [228, 272, 276] and this laboratory determined that FG FR1b /c were highly abundant in cumulus cells and FG FR2b /c

PAGE 96

96 were highly abundant in denuded oocytes [60] Each of these FGFR s responded to FSH in cumulus cells, and profound increases in mRNA abundances were found after 6 h of COC maturation when using FSH concentrations commonly used for IVM c ulture (25 g/ml) or lower amounts of FSH (1 g/ml). The FGFR2b/c isotypes were very responsive to FSH treatment. The relative abundances of the R2b/c transcripts also were increased during the first 6 h of COC maturation in the absence of FSH, albeit at r educed levels. Most of the current findings are consistent with previous ob servations. FSH increased R2b and R3c mRNA abundance in cultured bovine granulosa cells [228, 231] Also, induction of a gonadotropin surge in cattle induced a transient increase in R1c mRNA concentrations in follicular cells (theca and granulosa) [272 ] However, no changes in R2c mRNA abundance were noted in that study. Collectively, previous and cur rent findings suggest that COC maturation in the presence of FSH enhances cumulus cell responsiveness to FGFs that bind to FGFR1 and FGFR2 receptor subtypes ( e.g. FGF7 and 10 for R2b; FGF2 for R2c). However, not all of the FGFR expression profiles describe d during IVM necessarily exist in follicular cells during peri ovulatory follicle development in vivo Each of the FGFR transcripts was greater in abundance in cumulus cells after 6 h of COC maturation than either before culture and after 21 h of maturat ion. This biphasic response to COC culture and FSH supplementation was not examined further, but similar findings were observed in follicles from cattle after GnRH challenge [272] In that study, greatest concentrations of FGFR1c after GnRH treatment. Other dynamic changes in granulosa cells that may drive this FGFR expression pattern include changes in st eroid and prostaglandin production [272] Alternatively, FGFR expression and activity are tightly regulated by several intracellular feedback inhibitors

PAGE 97

97 [211, 239] and changes in this activity also may explain the temporal expression patterns of these receptors. No increases in cumulus FGFR mRNA levels were evident after COC exposure to LH. In mice, LH induces the production of EGF like molecules in granulosa cells and these factors ultimately regulate the resumption of meiosis and ovulation [114] Also, no FSH dependent or independent increases in FGFR mRNA abundance were e vident in oocytes at 6 or 21 h. These observations implicate FSH dependent activation of cumulus cells as the predominant modifier of FGFR transcript abundance in COCs during IVM. A follow up study determined that the FSH dependent increases in cumulus ce ll FGFR mRNA levels were not altered after blocking MAPK3/1 activation. MAPK 3/1 signaling is essential in granulosa cells for fertility in female mice [139, 140, 290] Current evidence indicates that cAMP dependent liberation of catalytic PKA from its regulatory subunits increases MAPK3/1 phosphorylation status by mechanisms that are not fully understood but appear to involve reducing the activities of phosphotyrosine phosphatases that s erve as feedback inhibitors for MAPKs [158, 290] Two sequential studies utilized two pan FGFR kinase inhibitors to examine the importance of FGFR activity dur ing IVM on subsequent embryo development. Both inhibitors are competitive inhibitors of ATP binding within tyrosine kinase regions, and both inhibitors contain high affinity for FGFR kinases. Each inhibitor was used at concentrations effective at blocking FGFR activation in other tissues [292 295] including bovine trophoblast cells [277, 291] No differences in cleavage rates were detected at day 3 post IVF when COCs were cultured with blastocysts at days 7 and 8 were detected with either SU5402 or PD173074. Complementary

PAGE 98

98 outcomes were observed by supplementing COCs with FGF10 during IVM [60] Supplementing FGF10 during bovine IVM did not affect cleavage rates but increased the proportion of 8 cell embryos at day 3 and blastocysts at day 7 post IVF. It is important to note that the studies with FGFR inhibitors were completed without providing exogenous FGFs. The maturation medium was fully defined and devoid of serum, and the only sources of FGFs were derived from oocytes or cumulus cells. Bovine oocytes and cumulus cells p roduce several FGFs [228, 2 31, 233, 276] Also, theca derived FGFs probably also contribute to FGF activity even after COCs are removed from their follicles because several FGFs have high affinity for transmembrane and extracellular heparin sulfate proteoglycans and will be seque stered within the cumulus layers [211, 239] The necessity for these endogenous FGFs during COC maturation is consistent with previous findings examining the need for endogenous FGF10 during IVM [60] In that work, antibody capture of FGF10 during IVM reduced subsequent embryo develop ment. A final series of studies were completed to examine whether inhibiting FGFR kinase activity affects bovine oocyte maturation. S U5402 inhibit ed the percentage of first polar body extrusion and progression to MII after maturation but PD173074 did not affect either outcome. These effects were noted in the presence and absence of supplemental FSH. One reason for these disparate outcomes is that these inhibitors could act through non FGFR targets. These inhibitors are not exclusive for FGFRs, and perhap s SU5402 reacted with other tyrosine kinase receptors ( e.g. EGFR) to mediate oocyte meiosis differently than PD173074. Alternatively, perhaps greater amounts of PD173074 were needed to detected effects with this inhibitor. In a previous study, greater conc entrations of FGF10 were needed to improve meiotic maturation of oocytes than were needed to improve subsequent embryo development rates [60] These outcomes may

PAGE 99

99 reflect differential usage of FGFR subtypes for controlling meiotic maturation and oocyte competence Regardless of the reason for these disparate outcomes, a firm conclusion about the role of FGFs in controlling oocyte meiotic maturation cannot be made at the present time. In summary, this work shows that FGFR expression profiles i n cumulus cells are regulated by FSH in the final stages of oocyte maturation and blocking FGFR activity during IVM impacts subsequent embryo development. We speculate that FGFs are improving oocyte competence during IVM by acting on cumulus cells to affe ct the accumulation of maternal transcripts, proteins and metabolites deposited in oocytes prior to ovulation so that oocytes are able to survive until EGA The specific transcripts that serve as downstream regulators of this activity have yet to be identi fied. U nderstanding the underlying mechanisms mediated by FGFs during COC culture ma y a viable embryo and ultimately produce a viable offspring.

PAGE 100

100 Figure 4 1. Changes in tran script abundance for FGFR1 and R2 splice variants in cumulus cells from COCs cultured in the presence or absence of FSH. Bovine COCs were collected at cumulus cells were separated from oocytes by vortexing either before culture (0 h) or 6 or 2 1 h after beginning IVM Medium either contained or lacked 25 g/ml FSH in COCs cultured for 6 or 21 h. Abundance of transcripts for R1b R1c R2b and R2c (A through D, respectively) was determined by qRT PCR. Values are expressed as fold change relative to mR NA abundance of each transcript at 0 h. Differences superscripts within each panel indicate differences (P<0.05 ; n= 15 COCs/time point/replicate, 3 replicate studies ).

PAGE 101

101 Figure 4 2. The FSH dependent increase in FGFR mRNA abundance is not MAPK depende nt. COCs were treated with or without 25 g/ml FSH and with or with 10 M U0126, a MAPK3/1 inhibitor. After 6 h of maturation, cumulus cells were separated from oocytes by vortexing and qRT PCR was used to examine abundance of transcripts for R1b R1c R2 b and R2c (A through D, respectively) and SPRY2 (E). Data are expressed as fold changes relative to the samples from COCs not treated with FSH or U0126. Differences superscripts within each panel indicate differences (P<0.05 ; n= 15 COCs/replicate; 4 replica te studies).

PAGE 102

102 Figure 4 3. Disruption of FGFR signaling during IVM with SU5402 compromises subsequent embryo development in vitro contained carrier only (DMSO). After maturation, COCs were washed to remove inhibitors, oocytes were fertilized and presumptive zygotes were cultured. A) After 3 days, the percentage of cleaved embryos and the cleaved embryos that con B) At days 7 and 8 p ost IVF, the percentage of cleaved embryos that were blastocysts was determined Different superscripts in each graph denote differences (P<0.05; n= 30 COCs/treatment/replicate; 6 replicate studies).

PAGE 103

103 Figure 4 4 Disruption of FGFR signaling during IVM with PD173074 compromises subsequent embryo development in vitro FSH and PD173074 Controls contained carrier only (DMSO). After maturation, COCs were washed to remove inhibitors, oocyte s were fertilized in vitro and pres umptive zygotes were cultured. A) After 3 days, the percentage of cleaved embryos and the cleaved embryos that cont B) At days 7 and 8 post IVF, the percentage of cleaved embryos that w ere blastocysts was determined Different superscripts in each graph denote differences (P<0.05; n= 30 COCs /treatment/replicate; 7 replicate studies).

PAGE 104

104 Figure 4 5. Meiotic maturation of oocytes is delayed by d isruption of FGFR signaling during IVM. A ) and B ) COC were cultured in medium containing 25 (A) or 0 (B) and either PD1 73074, or carrier only (DMSO). After 21 h, cumulus cells were separated from oocytes and the percentage of oocytes with extruded polar bodies and perc entage of oocytes that matured to the metaphase II (MII) stage was determined ( n= 10 COCs/treatment/replicate; 4 replicate studies).

PAGE 105

105 CHAPTER 5 SUPPLEMENTING OOCYTE MATURATION MEDIUM WITH FGFS IMPROVES IN VITRO PRODUCTION OF B OVINE E MB R YOS Problems associated with oocyte quality contributes to infertility in cattle, humans and other mammals [27, 98] The competence of oocytes to become fertilized and develop conceptuses that will maintain viable pregnancies to term are reduced when oocytes are matured in vitro In cattle, fewer blastocysts develop from oocytes matured in vitro than oocytes matured in vivo [251] and fewer pregnancies result from transferring in vitro produced (IVP) embryos to cattl e than using in vivo generated embryos or inseminating cows [30, 38, 296] The premise of work presented he rein is that embryo transfer success rates may be improved in cattle by optimizing oocyte cultures in ways that increase the proficiency of oocyte maturation, fertilization and/or early embryo development. The oocyte grows within a follicular niche and ac quires developmental competence through a series of events controlled by various endocrine, paracrine and autocrine factors (reviewed by [25] ). Supplementation of OMM with molecules found in the follicular niche improves oocyte maturation rate and subsequent embryo production effic iency. EGF supplementation during IVM improves bovine oocyte maturation cumulus expansion, fertilization rates and eventual development of blastocysts [147] Similarly, supplementing vascular endothelial growth factor (VEGF) to b ovine COCs during IVM increa ses subsequent fertilization and embryo development rates [297, 298] Supplementing BMP15 or GDF9 individually or together during IVM does not affect fertilization rate of bovine oocytes but increases in vitro blastocyst development [266] Several FGFs have been implicated as mediators of folliculogenesis and oogenesis in cattle [231, 234] One FGF that has received recent attention as a putative regulator of follicle and oocyte development is FGF10. This factor is produced by theca cells and the oocyte and its

PAGE 106

106 primary receptor partner is produced by granulosa/cumulus cells [60, 228] Another FGF of inter est is FGF2. Expression of this factor is up regulated in theca and granulosa cells during the final stages of folliculogenesis preceding ovulation [216, 217] and in cumulus cells during IVM [218] Also, certain s ingle nucleotide polymorphisms (SNPs) for FGF2 associate with reduced IVF and embryo development potential [11] Recently this laboratory determined that both these FGFs appear to be important for oocyte maturation. One recent study found that endogenous sources of FGF10 are required for optimal bovine cumulus oocyte complex (COC) maturation in vitro and supplementing FGF10 during bovine IVM increases subsequent IVP embryo development (Chapter 2) [60] Another study determined that FGF2 supplementation during IVM increases subsequent bovine embryo development ( Chapter 3). Previous work describing FGF2 and FGF10 actions when supplemented during IVM were completed in serum free conditions. Most IVP embryo production systems include serum in OMM to achieve maximal embryo production. To explore the potential inclus ion of FGFs during IVM as a scheme for improving oocyte competence studies were completed to determine if FGF2 and FGF10 supplementation to OMM containing serum improves oocyte maturation and subsequent in vitro embryo development. Materials and Methods R eagents Recombinant bovine FGF2 was purchased from R&D Systems (Minneapolis, MN, US A). Recombinant human FGF10, TCM 199, Hoechst 33342 and primers used in qRT PCR were purchased from Invitrogen Corp. (Carlsbad, CA, USA). FSH was purchased from Bioniche Lif e Sciences (Belleville, Ontario, Canada). mSOF was purchased from Millipore ( Billerica, MA USA ). Paraformaldehyde (16% [w/v] ultrapure grade) was purchased from Polysciences Inc. (Warrington, PA, USA). Mouse anti Cdx2 was purchased from Biogenex (San Ramon, CA) and

PAGE 107

107 FITC labeled goat anti mouse IgG was purchased from AbCam (Cambridge, MA). RNase free D Nase was purchased from New England Biolabs (Ipswich, MA, USA). The Terminal deoxynucleotidyl transferase dUTP nick end l abeling ( TUNEL) kit was purchased from Roche Applied Sciences (Indianapolis, IN, USA). The RNeasy Micro Kit was purchased from Qiagen ( Valencia, CA, USA) and the PicoPure TM RNA Isolation Kit was purchased from MDS Analytical Technologies (Sunnyvale, CA, USA). The High Capacity cDNA Reverse Transcription Kit and SYBR Green PCR Master Mix were purchased from Applied Biosystems Inc. (Foster City, CA, USA). All other reagents were purchased from Sigma Aldrich Co. (St. Louis, MO, USA). All studies were completed in accordance and with the approval of the institutional animal care and use committee at the University of Florida. COCs Collecti on and O ocyte IVM O varies were collected from Central Beef Packing Co. (Center Hill, FL, USA). They were then washed with 0.9% [w/v] sodium chloride supplemented with 100 U/ml penicillin and 0.1 mg/ml streptomycin. COCs were harvested and groups of 10 12 C OCs were matured drops of OMM ( TCM199 10% BSS 25 g/ml bovine FSH 22 g/ml sodium pyruvate, 50 g/ml gentamicin sulfate, 1 mM glutamine) V arying concentrations of FGF2 or FGF10 were added to OMM immediately before begi nning COC maturation. Both proteins were prepared in TCM199 containing 1% [w/v] BSA and stored in aliquots at 20C until use. COCs were cultured for 21 h at 38.5C in 5% CO 2 in humidified air. IVF and IVC The IVF and IVC procedures were carried out as des cribed previously [203] Briefly, COCs were incubated with Percoll gradient purified bovine spermatozoa in fertilization medium supplemented with PHE (0.5 mM penicillamine, 0.25 mM hypotaurine, and 25 M epinephrine

PAGE 108

108 in 0.9% [w/v] NaCl). A pool of semen from three bulls was used each time. After 8 h at 38.5C (5% CO 2 in humidified air), cumulus cells were separated from oocytes by vortexing in 1000 U/ml hyaluronidase. Putative zygotes were cultured in groups of 25 ops of mSOF; Millipore, Billerica, MA USA ) containin g 25 g/ml gentamicin sulfate, 0.4 mM sodium pyruvate, 2.77 mM myo inositol, 0.5 mM sodium citrate, 1 mM alanyl glutamine, 5.3 mM sodium lactate syrup, 10 l/ml non essential amino acids, 20 l/ml essential amino acids and 4 mg/ml fatty acid free BSA. Drop s were covered with mineral oil and maintained at 38.5C in 5% CO 2 5% O 2 and 90% N 2 for 8 days. Nuclear M aturation and Cumulus E xpansion After maturation, t he degree of cumulus expansion in COCs was scored visually by phase contrast microscopy on a 1 to 3 scale (1=poor expansion characterized by few morphological changes compared with before maturation; 2=partial expansion characterized by fair expansion but notable clusters lacking expansion; 3=complete or nearly complete expansion) [60, 244] To assess meiotic stage a fter maturation, oocytes were denuded by vortexing for 4 min in saline O ocytes were fixed with 4% [ w/v ] paraformaldehyde, permeabilized with0.1% [v/v] Triton X 100 and stained for 15 min with 1g/ml Hoechst 33342. M eiotic staging was determined with epifluorescence microscopy as described previously [32, 245] Differential Staining in B lastocysts Blastocysts obtained at day 8 post IVF were incubated with 4% [w/v] paraformaldehyde for 30 min. After three washes, they were incubated with 0.5% [v/v] Triton X 100and 1 mg/ml PVP in PBS for 20min. Blastocysts then were blocked with 5% BSA for 1 h before incubation with mouse anti Cdx2 IgG at 4C overnight and FITC labeled goat anti mouse IgG at room temperature for 1 h Blastocysts were counterstained with 1 g/ml Hoechst 33342 for 15 min and were placed into glycerol drops on microscope slides Total cell numbers (all Hoechst stained

PAGE 109

109 nuclei), TE ( FITC stain ed nuclei) and ICM cells (total minus TE) were determined by using a Zeiss Axioplan 2 epifluorescence microscope (Zeiss, Gttingen, Germany) with FITC and DAPI filter. Digital images were acquired using the AxioVision software and a high resolution black and white AxioCam MRm digital camera (Zeiss). Real time Q uantitative (q) RT PCR At the end of the maturation period cu mulus cells and oocytes were separated by repeat ed pipetting (n=25 to 30/group) Den uded oocytes were removed and washed thrice in PBS PVP. Cumulus cells were transferred to microcentrifuge tubes and centrifuged at 700 g for 2 min at room temperature to remove residual solution. Both oocytes and cumulus cells were snap frozen in liquid nitrogen and stored at 80C. Total cellular (tc) RNA was extracted from cumulus cells using the RNeasy Micro Kit and from oocytes using the PicoPure TM RNA Isolation Kit RNA concentrations and integrity (A 260 /A 280 of cumulus samples were determined using a NanoDrop 2000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA). Limited amounts of RNA prevented determination of RNA quality in the oocyte samples. Each tcRNA sample (10 ng/reaction for cumulus samples; entire RNA sample for oocytes ) was incubated in RNase free DNase and reverse transcribed using the High Capacity cDNA Reverse Transcription Kit. Primers used for this work were reported previously [60, 111, 190, 197, 270] Primers were used at a concentration of 200 nM and were mixed with RT products and SYBR Green PCR Master Mix. After an initial activation/denaturation step (50C for 2 min, 95C for 10 min), 40 cycles of a 2 step amplifi cation protocol (60C for 1 min, 95C for 15 sec) were completed using a 7300 Real Time PCR System. A dissociation curve analysis (60 to 95C) was used to verify the amplification of a single product. Each sample was run in triplicate and a fourth reaction lacking exposure to reverse transcriptase was included to verify the absence of genomic contamination. Relative amounts of 18S RNA was used as an internal control for quantifying

PAGE 110

11 0 relative gene expression. The ratio of target to reference RNA was used to d etermine relative expression (2 CT[target] /2 CT[reference] ) [60] Statistical A nalyses All analyses were carried out with least squares analysis of variance (LS ANOVA) with the GLM of the Statistical Analysis System (SAS for Windows, versio n 9.0; SAS Institute Inc., Cary, NC, USA). Statistical analyses used arcsin e transformed percentage data generated from each replicate (experimental unit = average percentage within each replicate). Differences in individual means were separated further by completing pair wise comparisons (probability of difference analysis [PDIFF]; SAS Institute Inc.). Percentage data were graphed using non transformed values and SEMs. Results FGF10 P romotes Bovine Oocyte Developmental Competence In vitro Previous work by this laboratory determined that supplementing FGF10 to serum free OMM benefits oocyte and embryo development in culture [60] This study determined if similar effects were possible when OMM contained serum. COCs were collecte d and cultured in OMM containing 10% BSS and different concentrations of FGF10 (0.5, 5 or 50 ng/ml or carrier only control). After maturation, COCs were fertilized and cultured in the absence of supplemental FGF10. As outlined in Table 3 1, supplementation with FGF10 did not affect the percentage of cleaved zygotes present at day 3 post IVF. Providing 50 ng/ml FGF10 increased (P=0.04) the cells at day 3 when compared with control. Supplementing lower concentration Development to the blastocyst stage also was influenced by FGF10 supplementation. Specifically, supplementation with 50 ng/ml FGF10 but not lower FGF10 concentrations increased (P=0.03) the percenta ge of blastocysts observed at day 7 and 8 post IVF. Also,

PAGE 111

111 exposure to 0.5, 5 or 50 ng/ml FGF10 increased (P<0.05) the percentage of advanced blastocysts and the percentage of expanded blastocysts at day 7 post IVF whereas none of these FGF10 treatments ben efited advanced blastocyst rates at day 8. An additional study determined that supplementation with 50 ng/ml FGF10 did not affect total cell number, the number of TE and ICM, and the ICM to TE ratio when compared with controls at day 8 post IVF (Table 5 2 ). Immunoreactivity to Cdx2 anti sera was used to distinguish TE from non TE cells. Additional studies examined how FGF10 supplementation affects oocyte and cumulus maturation status in vitro Incubation with 50 ng/ml FGF10 during maturation did not influe nce the percentage of oocytes achieving metaphase II (89 5 vs. 79 8 for 0 vs. 50 ng/ml FGF10, respectively) and did not alter cumulus expansion (data not shown) FGF10 Treatment During IVM Does Not Affect the Expression o f Se lective Transcripts Implica ted in Cumulus and Oocyte Competence Numerous cumulus and oocyte specific genes have been implicated as mediators of COC maturation and oocyte competence Selective transcripts were examined to determine if FGF10 regulated their abundance during COC ma turation [111, 113, 173, 190, 197, 264, 266, 267, 299, 300] No changes in the relative abundance of oocyte specific transcripts ( BMP15, FST, GDF9, HIST2H2AC JY1 ) or cumulus specific transcripts ( C TSB CTSZ, EGFR FSHR HAS2, INH BA, KITLG, SPRY2) were detected after 21 h of maturation in OMM containing BSS and either 0 or 50 ng/ml FGF10 (data not shown). FGF2 Promotes Bovine Oocyte Developmental Competence In vitro A study was completed to determine whether supplementation of serum containing OMM with FGF2 improves subsequent in vitro embryo development (Table 5 3). Supplementing with 0.5, 5 or 50 ng/ml FGF2 did not affect the percentage of cleaved embryos and embryo s that

PAGE 112

112 percentage of blastocysts at day 7 but not at day 8. None of the other FGF2 treatments affected blastocyst formation. FGF2 supplementation did not affect the perce ntage of advanced blastocysts at day 8. Discussion The proficiency of IVP systems to generate high quality, transferable bovine embryos is a major limitation to the widespread incorporation of IVP embryos in commercial settings. Pregnancy rates and pregna ncy retention to term usually are lower following transfer of IVP derived embryos than for inseminated cows and cows receiving embryos from multiple ovulation strategies [30, 38] Also, a prevalence of extended gestation lengths, excessive birth weights and skewed gender ratios still exists in pregnancies derived from IVP embryos [301, 302] Improvements in IVM technologies may provide opportunities to improve the overall percentage of transferable IVP embryos and, more importantly, improve the competence of these embryos to maintain pregnancies to term and yield a viable offspring. This work and previous observations [60] show that FGF10 supplementation during IVM improve s blastocyst yields in bovine IVP embryo production systems. Regardless of whether OMM contained or lacked serum, supplementation with FGF10 did not affect cleavage rates but cell embryos at day 3, blastocysts and advanced bl astocysts. However, differences in FGF10 mediated effects during oocyte maturation were observed dependent on whether OMM contained or lacked serum. Neither oocyte progression to metaphase II nor cumulus expansion scores were affected by FGF10 supplementat ion in the presence of serum. Also, none of the cumulus and oocyte specific transcripts chosen for analysis based on previous reports of their involvement with oocyte quality and competence were altered by FGF10 in the presence of serum. In previous work, FGF10 supplemented to serum free OMM stimulated oocyte maturation and cumulus expansion [60] It also altered the

PAGE 113

113 abundance for certain cumulus ( CTSB SPRY2 ) and oocyte ( BMP15 ) transcripts. Such disparities indicate that FGF10 dependent impr ovements in embryo development rate do not require changes in rates of oocyte meiotic maturation, cumulus expansion or selective gene expression. Supplementation with FGF10 during IVM did not affect total blastomere numbers and the number of TE and ICM ce lls at day 8 post IVF. Previous work testing FGF10 effects in OMM without serum also failed to detect effects on blastomere numbers in blastocysts [60] These observations are consistent with the contention that quality of the oocytes dictate s blastocyst yield more so than the quality of the blastocyst [25 1] The mechanisms used by FGF10 to manipulate COC maturation in ways that ultimately improve embryo development remain speculative. Observing increases in embryo development as early as the 8 cell stage suggest that perhaps FGF10 improves the developm ental potential of IVP embryos by optimizing early embryo development. EGA occurs at the 8 to 16 cell stage in bovine embryos, and prior to this time the zygote must rely on maternally derived mRNA, proteins and other molecules for regulating development [253] It is quite possible that FGF10 impacts some aspect of the maternal control over early embryo development and this activity improves the proportion and timing of embryo development in vitro FGF10 exerted similar outcomes when supplemented to maturation mediu m containing or lacking serum supplementation, but there was a marked difference in the effective concentration ranges for FGF10 under these conditions. Removing serum from maturation medium reduced the effective dose for FGF10 (0.5 ng/ml without serum). I n the presence of serum 50 ng/ml FGF10 was needed in most cases to detect differences from controls. This outcome likely indicates that an inhibitory factor is present in the BSS. Heparin and heparan sulfate are detectable in serum and plasma [303] and several FGFs, including FGF10, have a great affinity for these molecules

PAGE 114

114 [304] Under normal situations heparin and heparan sulfate are crucial co factors for FGF binding to receptors, but excesses in these molecules can limit FGF actions [304] Alternatively, other FGF inhibitory factors may exist in serum. The identity of these molecules was not pursued in the work. The effects of suppleme nting FGF2 during IVM were less pronounced than for FGF10 supplementation. An increase in blastocyst development was detected at day 7 post IVF when supplementing 0.5 ng/ml FGF2 during COC maturation. Greater amounts of FGF2 did not affect blastocyst forma cell embryos at day 3 and advanced blastocyst formation. Previous work examining FGF2 supplementation during IVM in serum free conditions found no improvements in fertilization and early e mbryo development rates but detected greater blastocyst development rates when provided at various concentrations (0.5 to 50 ng/ml) (Chapter 3). It is reasonable to speculate that limited effects observed with FGF2 supplementation resulted from the presenc e of an inhibitory molecule in serum. In conclusion, providing FGF10 during IVM of bovine COCs increase blastocyst production. No special modifications to OMM are needed to detect FGF10 dependent effects on embryo development, but the FGF10 dosage must be increased in OMM containing serum for this treatment to be beneficial. FGF2 supplementation during IVM did not greatly impact subsequent embryo development in this work, indicating that this FGF is not as effective as FGF10 to increasing oocyte quality an d early embryo development.

PAGE 115

115 Table 5 1. Effects of FGF10 supplementation during IVM on subsequent in vitro embryo development. Parameter 1 FGF 10 (ng/ml) 0 0.5 5 50 30 h: % Cleaved Z ygotes 2 27 7 a 24 6 a 26 6 a 29 6 a Day 3: % Cleaved Zygotes 2 71 4 a 77 3 a 74 4 a 7 2 3 a cell Embryos 3 54 12 a 58 12 a b 57 12 a b 61 13 b Day 7: % Blastocysts 3 37 3 a 40 4 a b 39 2 a b 49 4 b Day 7 : % Advanced Blastocysts 3 15 4 a 25 3 b 28 4 b 3 0 4 b Day 8: % Blastocysts 3 51 3 a 54 4 ab 51 4 a 59 3 b Day 8: % Advanced Blastocysts 3 38 4 ab 42 3 ab 36 3 a 46 4 b 1 For embryo development data, n=6 replicate studies; 26 to 35 COCs/replicate. 2 Based on the percentage of total oocytes. 3 Based on the percentage of cleaved embryos. Different superscripts within each row ( i.e. parameter) represents differences.

PAGE 116

116 Table 5 2 The effect of FGF10 supplementation during IVM on inner cell mass and TE cell numbers at day 8 post IVF. Cell Number 1 FGF10 (ng/ml) 0 50 Total 131 6 126 5 Trophectoderm 108 6 104 4 Inner Cell Mass 23 2 22 1 Ratio Inner Cell Mass /T rophectoderm 0.23 0.01 0.23 0.01 1 n=60 61 blastocysts examined over 6 replicate studies.

PAGE 117

117 Table 5 3 Effect of FGF2 supplementation during IVM on subsequent in vitro embryo development. Parameter 1 FGF2 (ng/ml) 0 0.5 5 50 Day 3: % Cleaved Zygotes 2 61 8 a 64 10 a 58 9 a 64 7 a cell Embryos 3 54 4 a 67 5 a 65 8 a 58 4 a Day 7: % Blastocysts 3 28 5 a 41 3 b 34 8 ab 35 11 ab Day 8: % Blastocysts 3 36 10 a 51 3 a 49 10 a 49 10 a Day 8: % Advanced Blastocysts 3 10 4 a 10 2 a 15 8 a 11 3 a 1 For embryo development data, n=3 replicate studies; 26 to 35 COCs/replicate. 2 Based on the percentage of total oocytes. 3 Based on the percentage of cleaved embryos. Different superscripts within each row ( i.e. parameter) represents differences.

PAGE 118

118 CHAPTER 6 GENERAL DISCUSSION The ability of oocytes to resume meiosis, become fertilized and generate viable pregnancies, also called oocyte competence, is controlled during folliculogenesis by various endocrine, paracrine and autocrine factors. Having a better understanding of the ac quisition of competence for cultured oocytes utilized for reproductive technologies may provide new strategies for improving in vitro reproductive technologies in humans and agricultural animals. This dissertation focused on describing how specific paracr ine factors affect the developmental potential of bovine embryos generated by IVM/IVF/IVC procedures. These procedures are of special concern because pregnancy rates following embryo transfer are often reduced for cows receiving IVP embryos when compared w ith inseminated cows [38, 280] Recent studies implicate FGFs as important regulators of folliculogenesis. Thus, a series of studies were designed to define the role of FGFs in the oocyte maturation and subsequent embryo development. The aim of the first and second project was to determine if FGF 2 and FGF 10 can improve bovine oocyte competence after their supplementation to OMM Exposing cumulus oocyte comple xes to FGF 10 during IVM increase d the percentage of e mbryos at the 8 16 cell stage on day 3 and blastocysts on day 7 post IVF. Exposure to FGF2 increased blastocyst rates but did not affect the proportion of embryos at the 8 16 cell stage This result is i nteresting as EGA takes place at the 8 to 16 cell stage in bovine embryos [253] Perhaps improvements in blastocyst formation by FGF10 are mediated by improving early embryo competence (i.e. before the 8 cell stage) whereas the beneficial effects of FGF2 act through later events of embryogenesis. However, in both studies, there was no effect of FGF2 and FGF10 on either the total cell number per blastocyst or the proportion of ICM out of total cell number. These observation are

PAGE 119

119 consistent with previous studies [251, 252] In those studies, bovine oocyte quality affected subsequent blastocyst yields more so than blastocyst quality. It is likely that FGF2/10 improves the ooplasm microenvironment by changing specific molecules that enhance embryo developme nt during the first few rounds of cleavag e. To better understand the effects of FGF2 and 10, oocyte maturation and cumulus expansion were examined Both FGF2 and FGF10 increased the percentage of oocytes reaching metaphase II in intact COCs. However, these effects were compromised when using oocytes removed from cumulus before culture. This indicates that the enhancement in the meiotic maturation by FGF2 and 10 is mediated by cumulus cells. Cu mulus expansion was improved by FG F10 or FGF2 and FGF2 reduced the proportion of apoptotic cumulus cells after culture. We examined if FGF2 and 10 affected the expression of genes related to cumulus expansion and apoptosis. None of the genes examined were influenced by either FGF. Further studies are needed to define how these FGFs impact the cumulus cell transcriptome and also to understand how post transcriptional regulation of mRNAs may be influenced by FGFs. Based on available evidence, it appears that the beneficial effects of FGF 2 a nd 10 on oocyte competence was attributed, at least in part, to the improved meiotic maturation or cumulus expansion and survival. Given the FGF10 used in this work is human recombinant, the specificity of FGF10 dependent effects on oocyte maturation and cumulus expansion were evaluated. The use of anti FGF10 IgG prevented the FGF10 dependent effects on maturation and cumulus expansion compared with the non immune IgG control. Also, exposure to individual supplementation of anti FGF10 IgG also inhibited me iotic maturation and cumulus expansion. Thus, both exogenous and endogenous FGF10 are beneficial for the COC maturation in vitro

PAGE 120

120 The involvement of FSH in FGF2 and 10 dependent effects was also evaluated by removing this supplement from the culture system Previous studies show that rates of oocyte maturation were reduced in the absence of FSH [283] Treatment with FGF2 and 10 did not affect oocyte maturation in absence of FSH. This implicates that FSH controls FGF dependent events during maturation.. The expression pattern of FGFRs and the role of FSH were described. After 6 h of culture, R1b, R1c, R2b and R2c mRNA abundance were increased in cumulus cells but not in oocytes when COCs were cultured with FSH. However, this ef fect was compromised after 21 h of culture. The similar phenomena have been seen in follicles from cattle after GnRH treatement [272] Specifically, increased FGFR1c mRNA abundance was detected 4 h after GnRH challenge than befo steroid and prostaglandin production [272] Alternatively, FGFR expression and activity are tightly regulated by several intracellular feedback inh ibitors [211, 239] and such activity could explain the temporal expression patterns of these receptors. A follow up study showed that the FSH dependent increases in cumulus cell FGFR mRNA levels were not mediated by MAPK3/1 signaling, which is required in granulosa cells for fertility in female mice [139, 140, 290] However, the increase of sprouty2 mRNA in response to FSH is mediated by MAPK3/1 Another important aspect of this work was to examine whether FGF2 and 10 improv ed oocyte competence by mediating the actions of other cumulus and oocyte competence factors. FGF10 influenced the expression of CTSB and SPRY2 in cumulus cells and BMP15 in oocytes. Nonetheless, none of these genes were affected by FGF2. Similar finding s have been observed in previous studies. For example, CTSB mRNA abundance has been found negatively associated

PAGE 121

121 with the oocyte competence in cattle. Exposure to BMP15 during IVM improves blastocyst formation. These other studies and ours implicate FGF10 m aybe one upstream molecules of those oocyte competence factors. revealed tha t both FGFs of interest are beneficial for oocyte devel opmental potential. This prompted us to decipher what abou t the roles of other FGFs during oocyte maturation. Also, we discovered that FGF10 present within COCs were functionally significant. Preventing its activity by antibody capture limited bovine oocyte competence etermine if preventing FGF10 and potentially other FGFs from acting on COCs during IVM affects oocyte maturation, fertilization and subsequent embryo development. After maturation, COCs were washed and fertilized and cultured in the absence of inhibitors. cell embryos and blastocyst formation. Collectively, the gain of function and loss of function studies indicated that FGF signaling is very important for induction of oocyte maturation and cumulus expansion and thus critical for the subsequent embryo development. Several implications may be possible from this work. First and foremost, we speculate if supplementing FGF2 or FGF10 to maturation medium during in vitro culture of bovine COCs might res ult in embryos that are better suited for transfer into recipient cows. One set of studies determined that supplementing FGF2 or 10 to OMM containing serum, the oocyte medium formulation commonly used for IVP, improves blastocyst development rates. FGF10 a ppeared to be better suited for improving embryo development than FGF2. The predominat endpoint used in most laboratories for evaluating the developmental potential of the IVP embryo is blastocyst formation, which is also used in this work. However,

PAGE 122

122 the f ull potential has to be examined through embryo transfer. Thus, further work is needed to The second potential application from this work is selection of the high yielding cows based on the genetic sequence of FGF2/10. Several recent studies have reported SNPs of FGF2 or STAT5 in cows are associated with embryos survival [11, 305] In addition, BMP15 homozygous mutation in sheep reduces ovulation rate while heterozygous mutation increases this rate [104] Perhaps, the selection of cows based on FGF2/10 sequence will improve the reproductive efficiency. Our work may have relevance to human IVF clinics. The use of IVM in human clinics is limited due to the low efficiency of IVM. The reproductive physiology and embryo developmental pattern as well as ART in women is similar with those in the cow (both are single ovulating sp ecies) than the mouse [306, 307] Thus, the outcomes in this work implicates FGF2/10 are conceivably to improve oocyte com petence in women. To conclude, this work indicates that improvements with in vitro embryo production efficiency in c attle can be made by supplementing COCs with FGF10 and FGF2 to a lesser extent (Figure 6 1) T his work also provides a novel insight into the importance of FGFRs and locally derived FGF2 and 10 duri ng oocyte maturation in cattle. Their subsequent impact on in vitro embryo development implicates them as notew orthy oocyte competence factors.

PAGE 123

123 Figure 6 1. Summary of the FGF si gnaling requirement for the oocyte maturation and developmental competence. Paracrine factors FGFs (i.e. FGF2/10) secreted from either the oocyte or follicular somatic cells (theca cells and granulosa cells) act on the cumulus cells to affect cumulus expan sion and change specific molecules (i.e. CTSB Sprouty 2 ) or potentially other functions. The remodeling of the cumulus cells by FGFs may influences the oocyte microenvironment by communicating through the gap junctions between the oocyte and the cumulus c ells. For example, one important oocyte signal BMP15 is up regulated by FGF10. Also, FGF appears activates ERK1/2, the essential components for mammal fertility, by phosphorylation. By these changes, the oocyte quality is improved and thus the future embry os are viable. The FGF signaling is under the control of FSH. For example, FGFR1 mRNA is increased by FSH during oocyte maturation. T: theca cells; CG: cumulus granulosa cells; MG: mural granulosa cells.

PAGE 124

124 LIST OF REFERENCES 1. Lucy MC. Reproductive loss in high producing dairy cattle: where will it end? J Dairy Sci 2001; 84: 1277 1293. 2. Lucy MC. Fertility in high producing dairy cows: reasons for decline and corrective strategies for sustainable improvement. Soc Reprod Fertil Suppl 2007; 64: 237 254. 3. Walsh SW, Williams EJ, Evans AC. A review of the causes of poor fertility in high milk producing dairy cows. Anim Reprod Sci 2011; 123: 127 138. 4. Leroy JL, Van Soom A, Opsomer G, Goovaerts IG, Bols PE. Reduced fertility in hig h yielding dairy cows: are the oocyte and embryo in danger? Part II. Mechanisms linking nutrition and reduced oocyte and embryo quality in high yielding dairy cows. Reprod Domest Anim 2008; 43: 623 632. 5. Leroy JL, Opsomer G, Van Soom A, Goovaerts IG, Bol s PE. Reduced fertility in high yielding dairy cows: are the oocyte and embryo in danger? Part I. The importance of negative energy balance and altered corpus luteum function to the reduction of oocyte and embryo quality in high yielding dairy cows. Reprod Domest Anim 2008; 43: 612 622. 6. Dillon P, Berry DP, Evans RD, Buckley F, Horan B. Consequences of genetic selection for increased milk production in European seasonal pasture based systems of milk production. Livestock Science 2006; 99: 141 158. 7. Hans en PJ. Improving dairy cow fertility through genetics. In: 44th Florida Dairy Production Conference; May 1, 2007; Gainesville, FL. 23 29. 8. Hansen LB. Consequences of selection for milk yield from a geneticist's viewpoint. J Dairy Sci 2000; 83: 1145 1150. 9. Notter DR. The importance of genetic diversity in livestock populations of the future. J Anim Sci 1999; 77: 61 69. 10. Khatib H, Maltecca C, Monson RL, Schutzkus V, Rutledge JJ. Monoallelic maternal expression of STAT5A affects embryonic survival in ca ttle. BMC Genet 2009; 10: 13. 11. Wang X, Schutzkus V, Huang W, Rosa GJ, Khatib H. Analysis of segregation distortion and association of the bovine FGF2 with fertilization rate and early embryonic survival. Anim Genet 2009; 40: 722 728. 12. Roche JF. The e ffect of nutritional management of the dairy cow on reproductive efficiency. Anim Reprod Sci 2006; 96: 282 296. 13. Roche JR, Friggens NC, Kay JK, Fisher MW, Stafford KJ, Berry DP. Invited review: Body condition score and its association with dairy cow pro ductivity, health, and welfare. J Dairy Sci 2009; 92: 5769 5801.

PAGE 125

125 14. LeBlanc S. Assessing the association of the level of milk production with reproductive performance in dairy cattle. J Reprod Dev 2010; 56 Suppl: S1 7. 15. Fourichon C, Seegers H, Malher X Effect of disease on reproduction in the dairy cow: a meta analysis. Theriogenology 2000; 53: 1729 1759. 16. Hyttel P, Callesen H, Greve T, Schmidt M. Oocyte maturation and sperm transport in superovulated cattle. Theriogenology 1991; 35: 91 108. 17. Per ry GA, Smith MF, Lucy MC, Green JA, Parks TE, MacNeil MD, Roberts AJ, Geary TW. Relationship between follicle size at insemination and pregnancy success. Proc Natl Acad Sci U S A 2005; 102: 5268 5273. 18. Hansen PJ. To be or not to be -determinants of embr yonic survival following heat shock. Theriogenology 2007; 68 Suppl 1: S40 48. 19. Hansen PJ. Effects of heat stress on mammalian reproduction. Philos Trans R Soc Lond B Biol Sci 2009; 364: 3341 3350. 20. Bonilla AQ, Oliveira LJ, Ozawa M, Newsom EM, Lucy MC Hansen PJ. Developmental changes in thermoprotective actions of insulin like growth factor 1 on the preimplantation bovine embryo. Mol Cell Endocrinol 2011; 332: 170 179. 21. Block J, Wrenzycki C, Niemann H, Herrmann D, Hansen PJ. Effects of insulin like growth factor 1 on cellular and molecular characteristics of bovine blastocysts produced in vitro. Mol Reprod Dev 2008; 75: 895 903. 22. Block J, Fischer Brown AE, Rodina TM, Ealy AD, Hansen PJ. The effect of in vitro treatment of bovine embryos with IGF 1 on subsequent development in utero to Day 14 of gestation. Theriogenology 2007; 68: 153 161. 23. Hansen PJ. Exploitation of genetic and physiological determinants of embryonic resistance to elevated temperature to improve embryonic survival in dairy catt le during heat stress. Theriogenology 2007; 68 Suppl 1: S242 249. 24. Sirard MA, Richard F, Blondin P, Robert C. Contribution of the oocyte to embryo quality. Theriogenology 2006; 65: 126 136. 25. Binelli M, Murphy BD. Coordinated regulation of follicle development by germ and somatic cells. Reproduction, Fertility and Development 2009; 22: 1 12. 26. Gandolfi F, Brevini TA. RFD Award Lecture 2009. In vitro maturation of farm animal oocytes: a useful tool for investigating the mechanisms leading to full te rm development. Reprod Fertil Dev 2009; 22: 495 507. 27. Santos JE, Thatcher WW, Chebel RC, Cerri RL, Galvao KN. The effect of embryonic death rates in cattle on the efficacy of estrus synchronization programs. Anim Reprod Sci 2004; 82 83: 513 535.

PAGE 126

126 28. Sni jders SE, Dillon P, O'Callaghan D, Boland MP. Effect of genetic merit, milk yield, body condition and lactation number on in vitro oocyte development in dairy cows. Theriogenology 2000; 53: 981 989. 29. Peter AT, Vos PL, Ambrose DJ. Postpartum anestrus in dairy cattle. Theriogenology 2009; 71: 1333 1342. 30. Putney DJ, Drost M, Thatcher WW. Influence of summer heat stress on pregnancy rates of lactating dairy cattle following embryo transfer or artificial insemination. Theriogenology 1989; 31: 765 778. 31. Edwards JL, Hansen PJ. Elevated temperature increases heat shock protein 70 synthesis in bovine two cell embryos and compromises function of maturing oocytes. Biol Reprod 1996; 55: 341 346. 32. Roth Z, Hansen PJ. Disruption of nuclear maturation and rearra ngement of cytoskeletal elements in bovine oocytes exposed to heat shock during maturation. Reproduction 2005; 129: 235 244. 33. Edwards JL, Hansen PJ. Differential responses of bovine oocytes and preimplantation embryos to heat shock. Mol Reprod Dev 1997; 46: 138 145. 34. Edwards JL, Saxton AM, Lawrence JL, Payton RR, Dunlap JR. Exposure to a physiologically relevant elevated temperature hastens in vitro maturation in bovine oocytes. J Dairy Sci 2005; 88: 4326 4333. 35. Arlotto T, Schwartz JL, First NL, Le ibfried Rutledge ML. Aspects of follicle and oocyte stage that affect in vitro maturation and development of bovine oocytes. Theriogenology 1996; 45: 943 956. 36. Holm P, Booth PJ, Callesen H. Kinetics of early in vitro development of bovine in vivo and i n vitro derived zygotes produced and/or cultured in chemically defined or serum containing media. Reproduction 2002; 123: 553 565. 37. Park YS, Kim SS, Kim JM, Park HD, Byun MD. The effects of duration of in vitro maturation of bovine oocytes on subsequent development, quality and transfer of embryos. Theriogenology 2005; 64: 123 134. 38. Loureiro B, Bonilla L, Block J, Fear JM, Bonilla AQ, Hansen PJ. Colony stimulating factor 2 (CSF 2) improves development and posttransfer survival of bovine embryos produc ed in vitro. Endocrinology 2009; 150: 5046 5054. 39. Block J, Bonilla L, Hansen PJ. Effect of addition of hyaluronan to embryo culture medium on survival of bovine embryos in vitro following vitrification and establishment of pregnancy after transfer to re cipients. Theriogenology 2009; 71: 1063 1071.

PAGE 127

127 40. Hansen PJ, Block J, Loureiro B, Bonilla L, Hendricks KE. Effects of gamete source and culture conditions on the competence of in vitro produced embryos for post transfer survival in cattle. Reprod Fertil De v 2010; 22: 59 66. 41. Block J, Bonilla L, Hansen PJ. Efficacy of in vitro embryo transfer in lactating dairy cows using fresh or vitrified embryos produced in a novel embryo culture medium. J Dairy Sci 2010; 93: 5234 5242. 42. Banwell KM, Thompson JG. In vitro maturation of Mammalian oocytes: outcomes and consequences. Semin Reprod Med 2008; 26: 162 174. 43. Saitou M, Yamaji M. Germ cell specification in mice: signaling, transcription regulation, and epigenetic consequences. Reproduction 2010; 139: 931 942 44. Surani MA, Durcova Hills G, Hajkova P, Hayashi K, Tee WW. Germ line, stem cells, and epigenetic reprogramming. Cold Spring Harb Symp Quant Biol 2008; 73: 9 15. 45. Ying Y, Qi X, Zhao G Q. Induction of Primordial Germ Cells from Murine Epiblasts by Sy nergistic Action of BMP4 and BMP8B Signaling Pathways. Proceedings of the National Academy of Sciences of the United States of America 2001; 98: 7858 7862. 46. Ying Y, Liu XM, Marble A, Lawson KA, Zhao GQ. Requirement of Bmp8b for the generation of primord ial germ cells in the mouse. Mol Endocrinol 2000; 14: 1053 1063. 47. De Felici M, Scaldaferri ML, Lobascio M, Iona S, Nazzicone V, Klinger FG, Farini D. Experimental approaches to the study of primordial germ cell lineage and proliferation. Hum Reprod Upda te 2004; 10: 197 206. 48. Pesce M, Gioia Klinger F, De Felici M. Derivation in culture of primordial germ cells from cells of the mouse epiblast: phenotypic induction and growth control by Bmp4 signalling. Mech Dev 2002; 112: 15 24. 49. Ohinata Y, Payer B, O'Carroll D, Ancelin K, Ono Y, Sano M, Barton SC, Obukhanych T, Nussenzweig M, Tarakhovsky A, Saitou M, Surani MA. Blimp1 is a critical determinant of the germ cell lineage in mice. Nature 2005; 436: 207 213. 50. Yamaji M, Seki Y, Kurimoto K, Yabuta Y, Yu asa M, Shigeta M, Yamanaka K, Ohinata Y, Saitou M. Critical function of Prdm14 for the establishment of the germ cell lineage in mice. Nat Genet 2008; 40: 1016 1022. 51. Saitou M, Barton SC, Surani MA. A molecular programme for the specification of germ ce ll fate in mice. Nature 2002; 418: 293 300. 52. Edson MA, Nagaraja AK, Matzuk MM. The mammalian ovary from genesis to revelation. Endocr Rev 2009; 30: 624 712. 53. Ara T, Nakamura Y, Egawa T, Sugiyama T, Abe K, Kishimoto T, Matsui Y, Nagasawa T. Impaired colonization of the gonads by primordial germ cells in mice lacking a

PAGE 128

128 chemokine, stromal cell derived factor 1 (SDF 1). Proc Natl Acad Sci U S A 2003; 100: 5319 5323 54. Farini D, La Sala G, Tedesco M, De Felici M. Chemoattractant action and molecular signaling pathways of Kit ligand on mouse primordial germ cells. Dev Biol 2007; 306: 572 583. 55. Molyneaux KA, Zinszner H, Kunwar PS, Schaible K, Stebler J, Sunshine M J, O'Brien W, Raz E, Littman D, Wylie C, Lehmann R. The chemokine SDF1/CXCL12 and its receptor CXCR4 regulate mouse germ cell migration and survival. Development 2003; 130: 4279 4286. 56. Besmer P, Manova K, Duttlinger R, Huang EJ, Packer A, Gyssler C, Bac hvarova RF. The kit ligand (steel factor) and its receptor c kit/W: pleiotropic roles in gametogenesis and melanogenesis. Dev Suppl 1993: 125 137. 57. Buehr M, McLaren A, Bartley A, Darling S. Proliferation and migration of primordial germ cells in We/We m ouse embryos. Dev Dyn 1993; 198: 182 189. 58. Hayashi K, Surani MA. Resetting the epigenome beyond pluripotency in the germline. Cell Stem Cell 2009; 4: 493 498. 59. Surani MA, Hajkova P. Epigenetic Reprogramming of Mouse Germ Cells toward Totipotency. Col d Spring Harb Symp Quant Biol. 60. Wu SC, Zhang Y. Active DNA demethylation: many roads lead to Rome. Nat Rev Mol Cell Biol 2010; 11: 607 620. 61. Tahiliani M, Koh KP, Shen Y, Pastor WA, Bandukwala H, Brudno Y, Agarwal S, Iyer LM, Liu DR, Aravind L, Rao A. Conversion of 5 methylcytosine to 5 hydroxymethylcytosine in mammalian DNA by MLL partner TET1. Science 2009; 324: 930 935. 62. Pepling ME. From primordial germ cell to primordial follicle: mammalian female germ cell development. Genesis 2006; 44: 622 632 63. Wrobel KH, Suss F. Identification and temporospatial distribution of bovine primordial germ cells prior to gonadal sexual differentiation. Anat Embryol (Berl) 1998; 197: 451 467. 64. Menke DB, Koubova J, Page DC. Sexual differentiation of germ cells in XX mouse gonads occurs in an anterior to posterior wave. Dev Biol 2003; 262: 303 312. 65. Jones KT. Meiosis in oocytes: predisposition to aneuploidy and its increased incidence with age. Hum Reprod Update 2008; 14: 143 158. 66. Block E. Quantitative mor phological investigations of the follicular system in women; variations at different ages. Acta Anat (Basel) 1952; 14: 108 123.

PAGE 129

129 67. Baker TG. A Quantitative and Cytological Study of Germ Cells in Human Ovaries. Proc R Soc Lond B Biol Sci 1963; 158: 417 433 68. Perez GI, Tao XJ, Tilly JL. Fragmentation and death (a.k.a. apoptosis) of ovulated oocytes. Mol Hum Reprod 1999; 5: 414 420. 69. Rucker EB, 3rd, Dierisseau P, Wagner KU, Garrett L, Wynshaw Boris A, Flaws JA, Hennighausen L. Bcl x and Bax regulate mou se primordial germ cell survival and apoptosis during embryogenesis. Mol Endocrinol 2000; 14: 1038 1052. 70. Skinner MK. Regulation of primordial follicle assembly and development. Hum Reprod Update 2005; 11: 461 471. 71. Chen Y, Jefferson WN, Newbold RR, Padilla Banks E, Pepling ME. Estradiol, progesterone, and genistein inhibit oocyte nest breakdown and primordial follicle assembly in the neonatal mouse ovary in vitro and in vivo. Endocrinology 2007; 148: 3580 3590. 72. Liang L, Soyal SM, Dean J. FIGalpha a germ cell specific transcription factor involved in the coordinate expression of the zona pellucida genes. Development 1997; 124: 4939 4947. 73. Soyal SM, Amleh A, Dean J. FIGalpha, a germ cell specific transcription factor required for ovarian follicl e formation. Development 2000; 127: 4645 4654. 74. Choi Y, Ballow DJ, Xin Y, Rajkovic A. Lim homeobox gene, lhx8, is essential for mouse oocyte differentiation and survival. Biol Reprod 2008; 79: 442 449. 75. Rajkovic A, Pangas SA, Ballow D, Suzumori N, Ma tzuk MM. NOBOX deficiency disrupts early folliculogenesis and oocyte specific gene expression. Science 2004; 305: 1157 1159. 76. Toyoda S, Miyazaki T, Miyazaki S, Yoshimura T, Yamamoto M, Tashiro F, Yamato E, Miyazaki J. Sohlh2 affects differentiation of K IT positive oocytes and spermatogonia. Dev Biol 2009; 325: 238 248. 77. Packer AI, Hsu YC, Besmer P, Bachvarova RF. The ligand of the c kit receptor promotes oocyte growth. Dev Biol 1994; 161: 194 205. 78. Parrott JA, Skinner MK. Kit ligand/stem cell facto r induces primordial follicle development and initiates folliculogenesis. Endocrinology 1999; 140: 4262 4271. 79. Reynaud K, Cortvrindt R, Smitz J, Bernex F, Panthier JJ, Driancourt MA. Alterations in ovarian function of mice with reduced amounts of KIT re ceptor. Reproduction 2001; 121: 229 237. 80. Reddy P, Shen L, Ren C, Boman K, Lundin E, Ottander U, Lindgren P, Liu YX, Sun QY, Liu K. Activation of Akt (PKB) and suppression of FKHRL1 in mouse and rat oocytes by

PAGE 130

130 stem cell factor during follicular activation and development. Dev Biol 2005; 281: 160 170. 81. Castrillon DH, Miao L, Kollipara R, Horner JW, DePinho RA. Suppression of ovarian follicle activation in mice by the transcription factor Foxo3a. Science 2003; 301: 215 218. 82. Einspanier R, Lau er B, Gabler C, Kamhuber M, Schams D. Egg cumulus oviduct interactions and fertilization. Adv Exp Med Biol 1997; 424: 279 289. 83. Durlinger AL, Gruijters MJ, Kramer P, Karels B, Ingraham HA, Nachtigal MW, Uilenbroek JT, Grootegoed JA, Themmen AP. Anti Mul lerian hormone inhibits initiation of primordial follicle growth in the mouse ovary. Endocrinology 2002; 143: 1076 1084. 84. Holt JE, Jackson A, Roman SD, Aitken RJ, Koopman P, McLaughlin EA. CXCR4/SDF1 interaction inhibits the primordial to primary follic le transition in the neonatal mouse ovary. Dev Biol 2006; 293: 449 460. 85. Nilsson EE, Skinner MK. Bone morphogenetic protein 4 acts as an ovarian follicle survival factor and promotes primordial follicle development. Biol Reprod 2003; 69: 1265 1272. 86. Nilsson EE, Kezele P, Skinner MK. Leukemia inhibitory factor (LIF) promotes the primordial to primary follicle transition in rat ovaries. Mol Cell Endocrinol 2002; 188: 65 73. 87. Nilsson EE, Detzel C, Skinner MK. Platelet derived growth factor modulates t he primordial to primary follicle transition. Reproduction 2006; 131: 1007 1015. 88. Dole G, Nilsson EE, Skinner MK. Glial derived neurotrophic factor promotes ovarian primordial follicle development and cell cell interactions during folliculogenesis. Repr oduction 2008; 135: 671 682. 89. Kezele P, Nilsson EE, Skinner MK. Keratinocyte growth factor acts as a mesenchymal factor that promotes ovarian primordial to primary follicle transition. Biol Reprod 2005; 73: 967 973. 90. Lee WS, Otsuka F, Moore RK, Shima saki S. Effect of bone morphogenetic protein 7 on folliculogenesis and ovulation in the rat. Biol Reprod 2001; 65: 994 999. 91. Yang MY, Fortune JE. The capacity of primordial follicles in fetal bovine ovaries to initiate growth in vitro develops during mi d gestation and is associated with meiotic arrest of oocytes. Biol Reprod 2008; 78: 1153 1161. 92. Fortune JE, Yang MY, Muruvi W. In vitro and in vivo regulation of follicular formation and activation in cattle. Reprod Fertil Dev 2011; 23: 15 22.

PAGE 131

131 93. Nilss on EE, Skinner MK. Progesterone regulation of primordial follicle assembly in bovine fetal ovaries. Mol Cell Endocrinol 2009; 313: 9 16. 94. Abel MH, Wootton AN, Wilkins V, Huhtaniemi I, Knight PG, Charlton HM. The effect of a null mutation in the follicle stimulating hormone receptor gene on mouse reproduction. Endocrinology 2000; 141: 1795 1803. 95. Dierich A, Sairam MR, Monaco L, Fimia GM, Gansmuller A, LeMeur M, Sassone Corsi P. Impairing follicle stimulating hormone (FSH) signaling in vivo: targeted di sruption of the FSH receptor leads to aberrant gametogenesis and hormonal imbalance. Proc Natl Acad Sci U S A 1998; 95: 13612 13617. 96. Eppig JJ. Oocyte control of ovarian follicular development and function in mammals. Reproduction 2001; 122: 829 838. 97 Eppig JJ, Chesnel F, Hirao Y, O'Brien MJ, Pendola FL, Watanabe S, Wigglesworth K. Oocyte control of granulosa cell development: how and why. Hum Reprod 1997; 12: 127 132. 98. Gilchrist RB, Lane M, Thompson JG. Oocyte secreted factors: regulators of cumul us cell function and oocyte quality. Hum Reprod Update 2008; 14: 159 177. 99. Matzuk MM, Burns KH, Viveiros MM, Eppig JJ. Intercellular communication in the mammalian ovary: oocytes carry the conversation. Science 2002; 296: 2178 2180. 100. Eppig JJ, Wiggl esworth K, Pendola FL. The mammalian oocyte orchestrates the rate of ovarian follicular development. Proc Natl Acad Sci U S A 2002; 99: 2890 2894. 101. Dong J, Albertini DF, Nishimori K, Kumar TR, Lu N, Matzuk MM. Growth differentiation factor 9 is require d during early ovarian folliculogenesis. Nature 1996; 383: 531 535. 102. Yan C, Wang P, DeMayo J, DeMayo FJ, Elvin JA, Carino C, Prasad SV, Skinner SS, Dunbar BS, Dube JL, Celeste AJ, Matzuk MM. Synergistic roles of bone morphogenetic protein 15 and growth differentiation factor 9 in ovarian function. Mol Endocrinol 2001; 15: 854 866. 103. McMahon HE, Hashimoto O, Mellon PL, Shimasaki S. Oocyte specific overexpression of mouse bone morphogenetic protein 15 leads to accelerated folliculogenesis and an early onset of acyclicity in transgenic mice. Endocrinology 2008; 149: 2807 2815. 104. Galloway SM, McNatty KP, Cambridge LM, Laitinen MP, Juengel JL, Jokiranta TS, McLaren RJ, Luiro K, Dodds KG, Montgomery GW, Beattie AE, Davis GH, Ritvos O. Mutations in an ooc yte derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage sensitive manner. Nat Genet 2000; 25: 279 283. 105. Hyttel P, Fair T, Callesen H, Greve T. Oocyte growth, capacitation and final maturation in cattle. Theriog enology 1997; 47: 23 32.

PAGE 132

132 106. Rodgers RJ, Irving Rodgers HF. Formation of the ovarian follicular antrum and follicular fluid. Biol Reprod 2010; 82: 1021 1029. 107. Huang HF, He RH, Sun CC, Zhang Y, Meng QX, Ma YY. Function of aquaporins in female and male reproductive systems. Hum Reprod Update 2006; 12: 785 795. 108. West Farrell ER, Xu M, Gomberg MA, Chow YH, Woodruff TK, Shea LD. The mouse follicle microenvironment regulates antrum formation and steroid production: alterations in gene expression profiles. Biol Reprod 2009; 80: 432 439. 109. Messinis IE, Messini CI, Dafopoulos K. The role of gonadotropins in the follicular phase. Ann N Y Acad Sci 2010; 1205: 5 11. 110. Quirk SM, Cowan RG, Harman RM, Hu CL, Porter DA. Ovarian follicular growth and a tresia: the relationship between cell proliferation and survival. J Anim Sci 2004; 82 E Suppl: E40 52. 111. Ireland JJ, Zielak Steciwko AE, Jimenez Krassel F, Folger J, Bettegowda A, Scheetz D, Walsh S, Mossa F, Knight PG, Smith GW, Lonergan P, Evans AC. V ariation in the ovarian reserve is linked to alterations in intrafollicular estradiol production and ovarian biomarkers of follicular differentiation and oocyte quality in cattle. Biol Reprod 2009; 80: 954 964. 112. Hussein TS, Froiland DA, Amato F, Thomps on JG, Gilchrist RB. Oocytes prevent cumulus cell apoptosis by maintaining a morphogenic paracrine gradient of bone morphogenetic proteins. J Cell Sci 2005; 118: 5257 5268. 113. Gilchrist RB, Ritter LJ, Myllymaa S, Kaivo Oja N, Dragovic RA, Hickey TE, Ritv os O, Mottershead DG. Molecular basis of oocyte paracrine signalling that promotes granulosa cell proliferation. J Cell Sci 2006; 119: 3811 3821. 114. Park JY, Su YQ, Ariga M, Law E, Jin SL, Conti M. EGF like growth factors as mediators of LH action in the ovulatory follicle. Science 2004; 303: 682 684. 115. Su YQ, Sugiura K, Li Q, Wigglesworth K, Matzuk MM, Eppig JJ. Mouse oocytes enable LH induced maturation of the cumulus oocyte complex via promoting EGF receptor dependent signaling. Mol Endocrinol 2010; 24: 1230 1239. 116. Sugiura K, Su YQ, Li Q, Wigglesworth K, Matzuk MM, Eppig JJ. Fibroblast growth factors and epidermal growth factor cooperate with oocyte derived members of the TGFbeta superfamily to regulate Spry2 mRNA levels in mouse cumulus cells. B iol Reprod 2009; 81: 833 841. 117. Pescador N, Stocco DM, Murphy BD. Growth factor modulation of steroidogenic acute regulatory protein and luteinization in the pig ovary. Biol Reprod 1999; 60: 1453 1461. 118. Baker J, Hardy MP, Zhou J, Bondy C, Lupu F, Be llve AR, Efstratiadis A. Effects of an Igf1 gene null mutation on mouse reproduction. Mol Endocrinol 1996; 10: 903 918.

PAGE 133

133 119. Armstrong DG, Baxter G, Hogg CO, Woad KJ. Insulin like growth factor (IGF) system in the oocyte and somatic cells of bovine preantr al follicles. Reproduction 2002; 123: 789 797. 120. Gutierrez CG, Ralph JH, Telfer EE, Wilmut I, Webb R. Growth and antrum formation of bovine preantral follicles in long term culture in vitro. Biol Reprod 2000; 62: 1322 1328. 121. Webb R, Garnsworthy PC, Campbell BK, Hunter MG. Intra ovarian regulation of follicular development and oocyte competence in farm animals. Theriogenology 2007; 68 Suppl 1: S22 29. 122. Webb R, Garnsworthy PC, Gong JG, Armstrong DG. Control of follicular growth: local interactions and nutritional influences. J Anim Sci 2004; 82 E Suppl: E63 74. 123. Webb R, Campbell BK. Development of the dominant follicle: mechanisms of selection and maintenance of oocyte quality. Soc Reprod Fertil Suppl 2007; 64: 141 163. 124. Fortune JE, Rivera G M, Yang MY. Follicular development: the role of the follicular microenvironment in selection of the dominant follicle. Anim Reprod Sci 2004; 82 83: 109 126. 125. Skinner MK, Schmidt M, Savenkova MI, Sadler Riggleman I, Nilsson EE. Regulation of granulosa a nd theca cell transcriptomes during ovarian antral follicle development. Mol Reprod Dev 2008; 75: 1457 1472. 126. Adams GP, Matteri RL, Ginther OJ. Effect of progesterone on ovarian follicles, emergence of follicular waves and circulating follicle stimulat ing hormone in heifers. J Reprod Fertil 1992; 96: 627 640. 127. Kasa Vubu JZ, Dahl GE, Evans NP, Thrun LA, Moenter SM, Padmanabhan V, Karsch FJ. Progesterone blocks the estradiol induced gonadotropin discharge in the ewe by inhibiting the surge of gonadotr opin releasing hormone. Endocrinology 1992; 131: 208 212. 128. Adams GP, Matteri RL, Kastelic JP, Ko JC, Ginther OJ. Association between surges of follicle stimulating hormone and the emergence of follicular waves in heifers. J Reprod Fertil 1992; 94: 177 188. 129. Richards JS, Pangas SA. The ovary: basic biology and clinical implications. J Clin Invest 2010; 120: 963 972. 130. Richards JS, Liu Z, Shimada M. Immune like mechanisms in ovulation. Trends Endocrinol Metab 2008; 19: 191 196. 131. Richards JS. Ge netics of ovulation. Semin Reprod Med 2007; 25: 235 242.

PAGE 134

134 132. Natraj U, Richards JS. Hormonal regulation, localization, and functional activity of the progesterone receptor in granulosa cells of rat preovulatory follicles. Endocrinology 1993; 133: 761 769. 133. Lydon JP, DeMayo FJ, Funk CR, Mani SK, Hughes AR, Montgomery CA, Jr., Shyamala G, Conneely OM, O'Malley BW. Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities. Genes Dev 1995; 9: 2266 2278. 134. Chen L, Russell PT, Lars en WJ. Functional significance of cumulus expansion in the mouse: roles for the preovulatory synthesis of hyaluronic acid within the cumulus mass. Mol Reprod Dev 1993; 34: 87 93. 135. Varani S, Elvin JA, Yan C, DeMayo J, DeMayo FJ, Horton HF, Byrne MC, Mat zuk MM. Knockout of pentraxin 3, a downstream target of growth differentiation factor 9, causes female subfertility. Mol Endocrinol 2002; 16: 1154 1167. 136. Dinchuk JE, Car BD, Focht RJ, Johnston JJ, Jaffee BD, Covington MB, Contel NR, Eng VM, Collins RJ, Czerniak PM, et al. Renal abnormalities and an altered inflammatory response in mice lacking cyclooxygenase II. Nature 1995; 378: 406 409. 137. Fulop C, Szanto S, Mukhopadhyay D, Bardos T, Kamath RV, Rugg MS, Day AJ, Salustri A, Hascall VC, Glant TT, Mike cz K. Impaired cumulus mucification and female sterility in tumor necrosis factor induced protein 6 deficient mice. Development 2003; 130: 2253 2261. 138. Camenisch TD, Spicer AP, Brehm Gibson T, Biesterfeldt J, Augustine ML, Calabro A, Jr., Kubalak S, Kle wer SE, McDonald JA. Disruption of hyaluronan synthase 2 abrogates normal cardiac morphogenesis and hyaluronan mediated transformation of epithelium to mesenchyme. J Clin Invest 2000; 106: 349 360. 139. Fan HY, Liu Z, Shimada M, Sterneck E, Johnson PF, Hed rick SM, Richards JS. MAPK3/1 (ERK1/2) in ovarian granulosa cells are essential for female fertility. Science 2009; 324: 938 941. 140. Su YQ, Wigglesworth K, Pendola FL, O'Brien MJ, Eppig JJ. Mitogen activated protein kinase activity in cumulus cells is es sential for gonadotropin induced oocyte meiotic resumption and cumulus expansion in the mouse. Endocrinology 2002; 143: 2221 2232. 141. Sugiura K, Su YQ, Diaz FJ, Pangas SA, Sharma S, Wigglesworth K, O'Brien MJ, Matzuk MM, Shimasaki S, Eppig JJ. Oocyte der ived BMP15 and FGFs cooperate to promote glycolysis in cumulus cells. Development 2007; 134: 2593 2603. 142. Brunet S, Verlhac MH. Positioning to get out of meiosis: the asymmetry of division. Hum Reprod Update 2011; 17: 68 75. 143. Dumont J, Million K, Su nderland K, Rassinier P, Lim H, Leader B, Verlhac MH. Formin 2 is required for spindle migration and for the late steps of cytokinesis in mouse oocytes. Dev Biol 2007; 301: 254 265.

PAGE 135

135 144. Leader B, Lim H, Carabatsos MJ, Harrington A, Ecsedy J, Pellman D, Ma as R, Leder P. Formin 2, polyploidy, hypofertility and positioning of the meiotic spindle in mouse oocytes. Nat Cell Biol 2002; 4: 921 928. 145. Verlhac MH, Lefebvre C, Guillaud P, Rassinier P, Maro B. Asymmetric division in mouse oocytes: with or without Mos. Curr Biol 2000; 10: 1303 1306. 146. Jones KT, Carroll J, Merriman JA, Whittingham DG, Kono T. Repetitive sperm induced Ca2+ transients in mouse oocytes are cell cycle dependent. Development 1995; 121: 3259 3266. 147. Lonergan P, Carolan C, Van Langend onckt A, Donnay I, Khatir H, Mermillod P. Role of epidermal growth factor in bovine oocyte maturation and preimplantation embryo development in vitro. Biol Reprod 1996; 54: 1420 1429. 148. Fissore RA, He CL, Vande Woude GF. Potential role of mitogen activa ted protein kinase during meiosis resumption in bovine oocytes. Biol Reprod 1996; 55: 1261 1270. 149. Papkoff J, Verma IM, Hunter T. Detection of a transforming gene product in cells transformed by Moloney murine sarcoma virus. Cell 1982; 29: 417 426. 150. Doree M, Hunt T. From Cdc2 to Cdk1: when did the cell cycle kinase join its cyclin partner? J Cell Sci 2002; 115: 2461 2464. 151. Jones KT. Turning it on and off: M phase promoting factor during meiotic maturation and fertilization. Mol Hum Reprod 2004; 1 0: 1 5. 152. Edwards RG. Maturation in vitro of mouse, sheep, cow, pig, rhesus monkey and human ovarian oocytes. Nature 1965; 208: 349 351. 153. Pincus G, Enzmann EV. The Comparative Behavior of Mammalian Eggs in Vivo and in Vitro : I. the Activation of Ov arian Eggs. J Exp Med 1935; 62: 665 675. 154. Han SJ, Chen R, Paronetto MP, Conti M. Wee1B is an oocyte specific kinase involved in the control of meiotic arrest in the mouse. Curr Biol 2005; 15: 1670 1676. 155. Lincoln AJ, Wickramasinghe D, Stein P, Schul tz RM, Palko ME, De Miguel MP, Tessarollo L, Donovan PJ. Cdc25b phosphatase is required for resumption of meiosis during oocyte maturation. Nat Genet 2002; 30: 446 449. 156. Richard FJ, Tsafriri A, Conti M. Role of phosphodiesterase type 3A in rat oocyte m aturation. Biol Reprod 2001; 65: 1444 1451. 157. Liang CG, Su YQ, Fan HY, Schatten H, Sun QY. Mechanisms regulating oocyte meiotic resumption: roles of mitogen activated protein kinase. Mol Endocrinol 2007; 21: 2037 2055.

PAGE 136

136 158. Zhang M, Ouyang H, Xia G. The signal pathway of gonadotrophins induced mammalian oocyte meiotic resumption. Mol Hum Reprod 2009; 15: 399 409. 159. Zhang M, Su YQ, Sugiura K, Xia G, Eppig JJ. Granulosa cell ligand NPPC and its receptor NPR2 maintain meiotic arrest in mouse oocytes. Sci ence 2010; 330: 366 369. 160. Krisher RL. The effect of oocyte quality on development. J Anim Sci 2004; 82 E Suppl: E14 23. 161. Perez GI, Trbovich AM, Gosden RG, Tilly JL. Mitochondria and the death of oocytes. Nature 2000; 403: 500 501. 162. Ferreira EM, Vireque AA, Adona PR, Meirelles FV, Ferriani RA, Navarro PA. Cytoplasmic maturation of bovine oocytes: structural and biochemical modifications and acquisition of developmental competence. Theriogenology 2009; 71: 836 848. 163. Conner S, Leaf D, Wessel G. Members of the SNARE hypothesis are associated with cortical granule exocytosis in the sea urchin egg. Mol Reprod Dev 1997; 48: 106 118. 164. Bachvarova R, De Leon V, Johnson A, Kaplan G, Paynton BV. Changes in total RNA, polyadenylated RNA, and actin mRNA during meiotic maturation of mouse oocytes. Dev Biol 1985; 108: 325 331. 165. Piko L, Clegg KB. Quantitative changes in total RNA, total poly(A), and ribosomes in early mouse embryos. Dev Biol 1982; 89: 362 378. 166. Paynton BV, Rempel R, Bachvarova R Changes in state of adenylation and time course of degradation of maternal mRNAs during oocyte maturation and early embryonic development in the mouse. Dev Biol 1988; 129: 304 314. 167. Hamatani T, Carter MG, Sharov AA, Ko MS. Dynamics of global gene exp ression changes during mouse preimplantation development. Dev Cell 2004; 6: 117 131. 168. Gosden R, Lee B. Portrait of an oocyte: our obscure origin. J Clin Invest 2010; 120: 973 983. 169. Davies HG, Giorgini F, Fajardo MA, Braun RE. A Sequence Specific RN A Binding Complex Expressed in Murine Germ Cells Contains MSY2 and MSY4. Developmental Biology 2000; 221: 87 100. 170. Gu W, Tekur S, Reinbold R, Eppig JJ, Choi YC, Zheng JZ, Murray MT, Hecht NB. Mammalian male and female germ cells express a germ cell spe cific Y Box protein, MSY2. Biol Reprod 1998; 59: 1266 1274. 171. Krischek C, Meinecke B. In vitro maturation of bovine oocytes requires polyadenylation of mRNAs coding proteins for chromatin condensation, spindle assembly, MPF and MAP kinase activation. An im Reprod Sci 2002; 73: 129 140.

PAGE 137

137 172. Li L, Zheng P, Dean J. Maternal control of early mouse development. Development 2010; 137: 859 870. 173. Bettegowda A, Yao J, Sen A, Li Q, Lee KB, Kobayashi Y, Patel OV, Coussens PM, Ireland JJ, Smith GW. JY 1, an oocy te specific gene, regulates granulosa cell function and early embryonic development in cattle. Proc Natl Acad Sci U S A 2007; 104: 17602 17607. 174. Lee KB, Bettegowda A, Wee G, Ireland JJ, Smith GW. Molecular determinants of oocyte competence: potential f unctional role for maternal (oocyte derived) follistatin in promoting bovine early embryogenesis. Endocrinology 2009; 150: 2463 2471. 175. Tejomurtula J, Lee KB, Tripurani SK, Smith GW, Yao J. Role of importin alpha8, a new member of the importin alpha fam ily of nuclear transport proteins, in early embryonic development in cattle. Biol Reprod 2009; 81: 333 342. 176. Tripurani SK, Lee KB, Wang L, Wee G, Smith GW, Lee YS, Latham KE, Yao J. A novel functional role for the oocyte specific transcription factor n ewborn ovary homeobox (NOBOX) during early embryonic development in cattle. Endocrinology 2011; 152: 1013 1023. 177. Prather RS, Ross JW, Isom SC, Green JA. Transcriptional, post transcriptional and epigenetic control of porcine oocyte maturation and embry ogenesis. Soc Reprod Fertil Suppl 2009; 66: 165 176. 178. Santos F, Zakhartchenko V, Stojkovic M, Peters A, Jenuwein T, Wolf E, Reik W, Dean W. Epigenetic marking correlates with developmental potential in cloned bovine preimplantation embryos. Curr Biol 2 003; 13: 1116 1121. 179. Doherty AS, Bartolomei MS, Schultz RM. Regulation of stage specific nuclear translocation of Dnmt1o during preimplantation mouse development. Dev Biol 2002; 242: 255 266. 180. Gaudet F, Rideout WM, 3rd, Meissner A, Dausman J, Leonh ardt H, Jaenisch R. Dnmt1 expression in pre and postimplantation embryogenesis and the maintenance of IAP silencing. Mol Cell Biol 2004; 24: 1640 1648. 181. Torres Padilla ME, Parfitt DE, Kouzarides T, Zernicka Goetz M. Histone arginine methylation regula tes pluripotency in the early mouse embryo. Nature 2007; 445: 214 218. 182. Goovaerts IG, Leroy JL, Jorssen EP, Bols PE. Noninvasive bovine oocyte quality assessment: possibilities of a single oocyte culture. Theriogenology 2010; 74: 1509 1520. 183. de Mat os DG, Furnus CC. The importance of having high glutathione (GSH) level after bovine in vitro maturation on embryo development effect of beta mercaptoethanol, cysteine and cystine. Theriogenology 2000; 53: 761 771.

PAGE 138

138 184. Ali AA, Bilodeau JF, Sirard MA. Anti oxidant requirements for bovine oocytes varies during in vitro maturation, fertilization and development. Theriogenology 2003; 59: 939 949. 185. Luciano AM, Lodde V, Beretta MS, Colleoni S, Lauria A, Modina S. Developmental capability of denuded bovine ooc yte in a co culture system with intact cumulus oocyte complexes: role of cumulus cells, cyclic adenosine 3',5' monophosphate, and glutathione. Mol Reprod Dev 2005; 71: 389 397. 186. Hamel M, Dufort I, Robert C, Gravel C, Leveille MC, Leader A, Sirard MA. I dentification of differentially expressed markers in human follicular cells associated with competent oocytes. Hum Reprod 2008; 23: 1118 1127. 187. Assou S, Haouzi D, Mahmoud K, Aouacheria A, Guillemin Y, Pantesco V, Reme T, Dechaud H, De Vos J, Hamamah S. A non invasive test for assessing embryo potential by gene expression profiles of human cumulus cells: a proof of concept study. Mol Hum Reprod 2008; 14: 711 719. 188. Balboula AZ, Yamanaka K, Sakatani M, Hegab AO, Zaabel SM, Takahashi M. Cathepsin B acti vity is related to the quality of bovine cumulus oocyte complexes and its inhibition can improve their developmental competence. Mol Reprod Dev 2010; 77: 439 448. 189. Balboula AZ, Yamanaka K, Sakatani M, Hegab AO, Zaabel SM, Takahashi M. Intracellular cat hepsin B activity is inversely correlated with the quality and developmental competence of bovine preimplantation embryos. Mol Reprod Dev 2010; 77: 1031 1039. 190. Bettegowda A, Patel OV, Lee KB, Park KE, Salem M, Yao J, Ireland JJ, Smith GW. Identificatio n of novel bovine cumulus cell molecular markers predictive of oocyte competence: functional and diagnostic implications. Biol Reprod 2008; 79: 301 309. 191. Broker LE, Kruyt FA, Giaccone G. Cell death independent of caspases: a review. Clin Cancer Res 200 5; 11: 3155 3162. 192. Leist M, Jaattela M. Triggering of apoptosis by cathepsins. Cell Death Differ 2001; 8: 324 326. 193. Lalmanach G, Diot E, Godat E, Lecaille F, Herve Grepinet V. Cysteine cathepsins and caspases in silicosis. Biol Chem 2006; 387: 863 870. 194. Rossi A, Deveraux Q, Turk B, Sali A. Comprehensive search for cysteine cathepsins in the human genome. Biol Chem 2004; 385: 363 372. 195. Gocheva V, Zeng W, Ke D, Klimstra D, Reinheckel T, Peters C, Hanahan D, Joyce JA. Distinct roles for cys teine cathepsin genes in multistage tumorigenesis. Genes Dev 2006; 20: 543 556.

PAGE 139

139 196. Assidi M, Dieleman SJ, Sirard MA. Cumulus cell gene expression following the LH surge in bovine preovulatory follicles: potential early markers of oocyte competence. Repro duction 2010; 140: 835 852. 197. Assidi M, Dufort I, Ali A, Hamel M, Algriany O, Dielemann S, Sirard MA. Identification of potential markers of oocyte competence expressed in bovine cumulus cells matured with follicle stimulating hormone and/or phorbol myr istate acetate in vitro. Biol Reprod 2008; 79: 209 222. 198. Hamel M, Dufort I, Robert C, Leveille MC, Leader A, Sirard MA. Genomic assessment of follicular marker genes as pregnancy predictors for human IVF. Mol Hum Reprod 2010; 16: 87 96. 199. Fear JM, H ansen PJ. Developmental changes in expression of genes involved in regulation of apoptosis in the bovine preimplantation embryo. Biol Reprod; 84: 43 51. 200. Hagemann LJ, Beaumont SE, Berg M, Donnison MJ, Ledgard A, Peterson AJ, Schurmann A, Tervit HR. Dev elopment during single IVP of bovine oocytes from dissected follicles: interactive effects of estrous cycle stage, follicle size and atresia. Mol Reprod Dev 1999; 53: 451 458. 201. Hansen PJ, Block J, Loureiro B, Bonilla L, Hendricks KE. Effects of gamete source and culture conditions on the competence of in vitro produced embryos for post transfer survival in cattle. Reprod Fertil Dev; 22: 59 66. 202. Fear JM, Hansen PJ. Developmental changes in expression of genes involved in regulation of apoptosis in th e bovine preimplantation embryo. Biol Reprod 2011; 84: 43 51. 203. Zhang K, Hansen PJ, Ealy AD. Fibroblast growth factor 10 enhances bovine oocyte maturation and developmental competence in vitro. Reproduction 2010; 140: 815 826. 204. Ali A, Sirard MA. Eff ect of the absence or presence of various protein supplements on further development of bovine oocytes during in vitro maturation. Biol Reprod 2002; 66: 901 905. 205. Nedambale TL, Dinnyes A, Groen W, Dobrinsky JR, Tian XC, Yang X. Comparison on in vitro f ertilized bovine embryos cultured in KSOM or SOF and cryopreserved by slow freezing or vitrification. Theriogenology 2004; 62: 437 449. 206. Lonergan P, Rizos D, Gutierrez Adan A, Fair T, Boland MP. Oocyte and embryo quality: effect of origin, culture cond itions and gene expression patterns. Reprod Domest Anim 2003; 38: 259 267. 207. Wassarman PM, Josefowicz WJ, Letourneau GE. Meiotic maturation of mouse oocytes in vitro: inhibition of maturation at specific stages of nuclear progression. J Cell Sci 1976; 2 2: 531 545.

PAGE 140

140 208. Eppig JJ, Ward Bailey PF, Coleman DL. Hypoxanthine and adenosine in murine ovarian follicular fluid: concentrations and activity in maintaining oocyte meiotic arrest. Biol Reprod 1985; 33: 1041 1049. 209. Artini PG, Battaglia C, D'Ambrogio G, Barreca A, Droghini F, Volpe A, Genazzani AR. Relationship between human oocyte maturity, fertilization and follicular fluid growth factors. Hum Reprod 1994; 9: 902 906. 210. Ornitz DM, Itoh N. Fibroblast growth factor s. Genome Biol 2001; 2: REVIEWS3005. 211. Turner N, Grose R. Fibroblast growth factor signalling: from development to cancer. Nat Rev Cancer 2010; 10: 116 129. 212. Ornitz DM. FGFs, heparan sulfate and FGFRs: complex interactions essential for development. Bioessays 2000; 22: 108 112. 213. Puscheck EE, Patel Y, Rappolee DA. Fibroblast growth factor receptor (FGFR) 4, but not FGFR 3 is expressed in the pregnant ovary. Mol Cell Endocrinol 1997; 132: 169 176. 214. Reynolds LP, Redmer DA. Expression of the angi ogenic factors, basic fibroblast growth factor and vascular endothelial growth factor, in the ovary. J Anim Sci 1998; 76: 1671 1681. 215. Schams D, Steinberg V, Steffl M, Meyer HH, Berisha B. Expression and possible role of fibroblast growth factor family members in porcine antral follicles during final maturation. Reproduction 2009; 138: 141 149. 216. Berisha B, Sinowatz F, Schams D. Expression and localization of fibroblast growth factor (FGF) family members during the final growth of bovine ovarian folli cles. Mol Reprod Dev 2004; 67: 162 171. 217. Gilbert I, Robert C, Dieleman SJ, Blondin P, Sirard MA. Transcriptional effect of the luteinizing hormone surge in bovine granulosa cells during the peri ovulation period. Reproduction 2011. 218. Bieser B, Stojk ovic M, Wolf E, Meyer H, Einspanier R. Growth factors and components for extracellular proteolysis are differentially expressed during in vitro maturation of bovine cumulus oocyte complexes. Biol Reprod 1998; 59: 801 806. 219. Ben Haroush A, Abir R, Ao A, Jin S, Kessler Icekson G, Feldberg D, Fisch B. Expression of basic fibroblast growth factor and its receptors in human ovarian follicles from adults and fetuses. Fertil Steril 2005; 84 Suppl 2: 1257 1268. 220. Knee RS, Pitcher SE, Murphy PR. Basic fibroblast growth factor sense (FGF) and antisense (gfg) RNA transcripts are expressed in unfertilized human oocytes and in differentiated adult tissues. Biochem Biophys Res Commun 1994; 205: 577 583.

PAGE 141

141 221. Garor R, Abir R, Erman A, Felz C, Nitke S, Fisch B Effects of basic fibroblast growth factor on in vitro development of human ovarian primordial follicles. Fertil Steril 2009; 91: 1967 1975. 222. Gospodarowicz D, Bialecki H. Fibroblast and epidermal growth factors are mitogenic agents for cultured granul osa cells of rodent, porcine, and human origin. Endocrinology 1979; 104: 757 764. 223. Nilsson E, Parrott JA, Skinner MK. Basic fibroblast growth factor induces primordial follicle development and initiates folliculogenesis. Mol Cell Endocrinol 2001; 175: 123 130. 224. Oury F, Darbon JM. Fibroblast growth factor regulates the expression of luteinizing hormone receptors in cultured rat granulosa cells. Biochem Biophys Res Commun 1988; 156: 634 643. 225. Ikeda S, Azuma T, S H, M. Y. In Vitro Maturation of Bov ine Oocytes with Fractions of Bovine Follicular Fluid Separated by Heparin Affinity Chromatography. Journal of Reproduction and Development 1999; 45: 397 404. 226. Ikeda S, Ichihara Tanaka K, Azuma T, Muramatsu T, Yamada M. Effects of midkine during in vit ro maturation of bovine oocytes on subsequent developmental competence. Biol Reprod 2000; 63: 1067 1074. 227. McGee EA, Chun SY, Lai S, He Y, Hsueh AJ. Keratinocyte growth factor promotes the survival, growth, and differentiation of preantral ovarian folli cles. Fertil Steril 1999; 71: 732 738. 228. Buratini J, Jr., Pinto MG, Castilho AC, Amorim RL, Giometti IC, Portela VM, Nicola ES, Price CA. Expression and function of fibroblast growth factor 10 and its receptor, fibroblast growth factor receptor 2B, in b ovine follicles. Biol Reprod 2007; 77: 743 750. 229. Portela VM, Goncalves PB, Veiga AM, Nicola E, Buratini J, Jr., Price CA. Regulation of angiotensin type 2 receptor in bovine granulosa cells. Endocrinology 2008; 149: 5004 5011. 230. Valve E, Penttila TL Paranko J, Harkonen P. FGF 8 is expressed during specific phases of rodent oocyte and spermatogonium development. Biochem Biophys Res Commun 1997; 232: 173 177. 231. Buratini J, Jr., Teixeira AB, Costa IB, Glapinski VF, Pinto MG, Giometti IC, Barros CM, Cao M, Nicola ES, Price CA. Expression of fibroblast growth factor 8 and regulation of cognate receptors, fibroblast growth factor receptor 3c and 4, in bovine antral follicles. Reproduction 2005; 130: 343 350. 232. Portela VM, Machado M, Buratini J, Jr., Zamberlam G, Amorim RL, Goncalves P, Price CA. Expression and function of fibroblast growth factor 18 in the ovarian follicle in cattle. Biol Reprod 2010; 83: 339 346.

PAGE 142

142 233. Machado MF, Portela VM, Price CA, Costa IB, Ripamonte P, Amorim RL, Buratini J, Jr Regulation and action of fibroblast growth factor 17 in bovine follicles. J Endocrinol 2009; 202: 347 353. 234. Buratini J, Jr., Glapinski VF, Giometti IC, Teixeira AB, Costa IB, Avellar MC, Barros CM, Price CA. Expression of fibroblast growth factor 8 a nd its cognate receptors, fibroblast growth factor receptor (FGFR) 3c and 4, in fetal bovine preantral follicles. Mol Reprod Dev 2005; 70: 255 261. 235. Parrott JA, Skinner MK. Developmental and hormonal regulation of keratinocyte growth factor expression and action in the ovarian follicle. Endocrinology 1998; 139: 228 235. 236. De Vries A. Economic value of pregnancy in dairy cattle. J Dairy Sci 2006; 89: 3876 3885. 237. Thurmond MC, Picanso JP, Jameson CM. Considerations for use of descriptive epidemiolog y to investigate fetal loss in dairy cows. J Am Vet Med Assoc 1990; 197: 1305 1312. 238. Li Q, McKenzie LJ, Matzuk MM. Revisiting oocyte somatic cell interactions: in search of novel intrafollicular predictors and regulators of oocyte developmental compete nce. Mol Hum Reprod 2008; 14: 673 678. 239. Itoh N. The Fgf families in humans, mice, and zebrafish: their evolutional processes and roles in development, metabolism, and disease. Biol Pharm Bull 2007; 30: 1819 1825. 240. Ornitz DM, Itoh N. Fibroblast grow th factors. Genome Biol. 2001; 2: REVIEWS3005. 241. Bazer FW, Spencer TE, Johnson GA, Burghardt RC, Wu G. Comparative aspects of implantation. Reproduction 2009; 138: 195 209. 242. Bellusci S, Grindley J, Emoto H, Itoh N, Hogan BL. Fibroblast growth factor 10 (FGF10) and branching morphogenesis in the embryonic mouse lung. Development 1997; 124: 4867 4878. 243. Sekine K, Ohuchi H, Fujiwara M, Yamasaki M, Yoshizawa T, Sato T, Yagishita N, Matsui D, Koga Y, Itoh N, Kato S. Fgf10 is essential for limb and lung formation. Nat Genet 1999; 21: 138 141. 244. Kobayashi K, Yamashita S, Hoshi H. Influence of epidermal growth factor and transforming growth factor alpha on in vitro maturation of cumulus cell enclosed bovine oocytes in a defined medium. J Reprod Fertil 1 994; 100: 439 446. 245. Marei WF, Wathes DC, Fouladi Nashta AA. The effect of linolenic Acid on bovine oocyte maturation and development. Biol Reprod 2009; 81: 1064 1072.

PAGE 143

143 246. Michael DD, Alvarez IM, Ocon OM, Powell AM, Talbot NC, Johnson SE, Ealy AD. Fibr oblast growth factor 2 is expressed by the bovine uterus and stimulates interferon tau production in bovine trophectoderm. Endocrinology 2006; 147: 3571 3579. 247. Pan Y, Carbe C, Powers A, Zhang EE, Esko JD, Grobe K, Feng GS, Zhang X. Bud specific N sulfa tion of heparan sulfate regulates Shp2 dependent FGF signaling during lacrimal gland induction. Development 2008; 135: 301 310. 248. Itoh N, Ornitz DM. Evolution of the Fgf and Fgfr gene families. Trends Genet 2004; 20: 563 569. 249. Miralles F, Czernichow P, Ozaki K, Itoh N, Scharfmann R. Signaling through fibroblast growth factor receptor 2b plays a key role in the development of the exocrine pancreas. Proc Natl Acad Sci U S A 1999; 96: 6267 6272. 250. Fitzgerald C, Zimon AE, Jones E E. Aging and reproductive potential in women. Yale J Biol Med 1998; 71: 367 381. 251. Rizos D, Ward F, Duffy P, Boland MP, Lonergan P. Consequences of bovine oocyte maturation, fertilization or early embryo development in vitro versus in vivo: implications for blastocyst yield and blastocyst quality. Mol Reprod Dev 2002; 61: 234 248. 252. Rizos D, Gutierrez Adan A, Perez Garnelo S, De La Fuente J, Boland MP, Lonergan P. Bovine embryo culture in the presence or absence of serum: implications for blastocyst d evelopment, cryotolerance, and messenger RNA expression. Biol Reprod 2003; 68: 236 243. 253. Betteridge KJ, Flechon JE. The anatomy and physiology of pre attachment bovine embryos. Theriogenology 1988; 29: 155 187. 254. Yu K, Herr AB, Waksman G, Ornitz DM. Loss of fibroblast growth factor receptor 2 ligand binding specificity in Apert syndrome. Proc Natl Acad Sci U S A 2000; 97: 14536 14541. 255. Garcia Maya M, Anderson AA, Kendal CE, Kenny AV, Edwards Ingram LC, Holladay A, Saffell JL. Ligand concentration is a driver of divergent signaling and pleiotropic cellular responses to FGF. J Cell Physiol 2006; 206: 386 393. 256. Li J, Reed SA, Johnson SE. Hepatocyte growth factor (HGF) signals through SHP2 to regulate primary mouse myoblast proliferation. Exp Cell Res 2009; 315: 2284 2292. 257. Murono EP, Washburn AL, Goforth DP, Wu N. Biphasic effect of basic fibroblast growth factor on 125I human chorionic gonadotropin binding to cultured immature Leydig cells. Mol Cell Endocrinol 1993; 92: 121 126.

PAGE 144

144 258. Halevy O Monsonego E, Marcelle C, Hodik V, Mett A, Pines M. A new avian fibroblast growth factor receptor in myogenic and chondrogenic cell differentiation. Exp Cell Res 1994; 212: 278 284. 259. Butterwith SC, Peddie CD, Goddard C. Regulation of adipocyte precurs or DNA synthesis by acidic and basic fibroblast growth factors: interaction with heparin and other growth factors. J Endocrinol 1993; 137: 369 374. 260. Hayashi H, Tsuchiya Y, Nakayama K, Satoh T, Nishida E. Down regulation of the PI3 kinase/Akt pathway by ERK MAP kinase in growth factor signaling. Genes Cells 2008; 13: 941 947. 261. Jin C, Wang F, Wu X, Yu C, Luo Y, McKeehan WL. Directionally specific paracrine communication mediated by epithelial FGF9 to stromal FGFR3 in two compartment premalignant prost ate tumors. Cancer Res 2004; 64: 4555 4562. 262. Harada H, Toyono T, Toyoshima K, Yamasaki M, Itoh N, Kato S, Sekine K, Ohuchi H. FGF10 maintains stem cell compartment in developing mouse incisors. Development 2002; 129: 1533 1541. 263. Homa ST. Effects of cyclic AMP on the spontaneous meiotic maturation of cumulus free bovine oocytes cultured in chemically defined medium. J Exp Zool 1988; 248: 222 231. 264. Caixeta ES, Ripamonte P, Franco MM, Junior JB, Dode MA. Effect of follicle size on mRNA expression i n cumulus cells and oocytes of Bos indicus: an approach to identify marker genes for developmental competence Reprod Fertil Dev 2009; 21: 655 664. 265. Cho JH, Itoh T, Sendai Y, Hoshi H. Fibroblast growth factor 7 stimulates in vitro growth of oocytes orig inating from bovine early antral follicles. Mol Reprod Dev 2008; 75: 1736 1743. 266. Hussein TS, Thompson JG, Gilchrist RB. Oocyte secreted factors enhance oocyte developmental competence. Dev Biol 2006; 296: 514 521. 267. Riley BM, Mansilla MA, Ma J, Daac k Hirsch S, Maher BS, Raffensperger LM, Russo ET, Vieira AR, Dode C, Mohammadi M, Marazita ML, Murray JC. Impaired FGF signaling contributes to cleft lip and palate. Proc Natl Acad Sci U S A 2007; 104: 4512 4517. 268. Cooke FN, Pennington KA, Yang Q, Ealy AD. Several fibroblast growth factors are expressed during pre attachment bovine conceptus development and regulate interferon tau expression from trophectoderm. Reproduction 2009; 137: 259 269. 269. Marina M, Isabelle D, Catherine G, Omran A, Steph D, Mar c AS. The influence of follicle size, FSH enriched maturation medium, and early cleavage on bovine oocyte maternal mRNA levels. Molecular Reproduction and Development 2006; 73: 1367 1379.

PAGE 145

145 270. Goossens K, Van Poucke M, Van Soom A, Vandesompele J, Van Zever en A, Peelman LJ. Selection of reference genes for quantitative real time PCR in bovine preimplantation embryos. BMC Dev Biol 2005; 5: 27. 271. Guerra DM, Giometti IC, Price CA, Andrade PB, Castilho AC, Machado MF, Ripamonte P, Papa PC, Buratini J, Jr. Exp ression of fibroblast growth factor receptors during development and regression of the bovine corpus luteum. Reprod Fertil Dev 2008; 20: 659 664. 272. Berisha B, Steffl M, Amselgruber W, Schams D. Changes in fibroblast growth factor 2 and its receptors in bovine follicles before and after GnRH application and after ovulation. Reproduction 2006; 131: 319 329. 273. Naimi B, Latil A, Fournier G, Mangin P, Cussenot O, Berthon P. Down regulation of (IIIb) and (IIIc) isoforms of fibroblast growth factor receptor 2 (FGFR2) is associated with malignant progression in human prostate. Prostate 2002; 52: 245 252. 274. Peluso JJ, Pappalardo A. Progesterone maintains large rat granulosa cell viability indirectly by stimulating small granulosa cells to synthesize basic fi broblast growth factor. Biol Reprod 1999; 60: 290 296. 275. Chaves RN, Lima Verde IB, Celestino JJ, Duarte AB, Alves AM, Matos MH, Campello CC, Name KP, Bao SN, Buratini J, Jr., Figueiredo JR. Fibroblast growth factor 10 maintains the survival and promotes the growth of cultured goat preantral follicles. Domest Anim Endocrinol 2010; 39: 249 258. 276. Berisha B, Sinowatz F, Schams D. Expression and localization of fibroblast growth factor (FGF) family members during the final growth of bovine ovarian follicles. Mol.Reprod.Dev. 2004; 67: 162 171. 277. Fields SD, Hansen PJ, Ealy AD. Fibroblast growth factor requirements for in vitro development of bovine embryos. Theriogenology 2011; 75: 1466 1475. 278. Paula Lopes FF, Boelhauve M, Habermann FA, Sinowatz F, Wolf E. Leptin promotes meiotic progression and developmental capacity of bovine oocytes via cumulus cell independent and dependent mechanisms. Biol Reprod 2007; 76: 532 541. 279. Anderson RA, Sciorio R, Kinnell H, Bayne RA, Thong KJ, de Sousa PA, Pic kering S. Cumulus gene expression as a predictor of human oocyte fertilisation, embryo development and competence to establish a pregnancy. Reproduction 2009; 138: 629 637. 280. Block J, Drost M, Monson RL, Rutledge JJ, Rivera RM, Paula Lopes FF, Ocon OM, Krininger CE, 3rd, Liu J, Hansen PJ. Use of insulin like growth factor I during embryo culture and treatment of recipients with gonadotropin releasing hormone to increase pregnancy rates following the transfer of in vitro produced embryos to heat stressed, lactating cows. J Anim Sci 2003; 81: 1590 1602.

PAGE 146

146 281. Hasler JF, Henderson WB, Hurtega PJ, Jin ZQ, McCauley AD, Mower SA. Production, freezing and transfer of bovine IVF embryos and subsequent calving results. In: Theriogenology, vol. 43; 1995: 141 152. 28 2. Rohmann E, Brunner HG, Kayserili H, Uyguner O, Nurnberg G, Lew ED, Dobbie A, Eswarakumar VP, Uzumcu A, Ulubil Emeroglu M, Leroy JG, Li Y, Becker C, Lehnerdt K, Cremers CW, Yuksel Apak M, Nurnberg P, Kubisch C, Schlessinger J, van Bokhoven H, Wollnik B. Mutations in different components of FGF signaling in LADD syndrome. Nat Genet 2006; 38: 414 417. 283. Fan HY, Sun QY. Involvement of mitogen activated protein kinase cascade during oocyte maturation and fertilization in mammals. Biol Reprod 2004; 70: 535 547. 284. Le Magueresse Battistoni B, Wolff J, Morera AM, Benahmed M. Fibroblast growth factor receptor type 1 expression during rat testicular development and its regulation in cultured Sertoli cells. Endocrinology 1994; 135: 2404 2411. 285. Ikeda S, Imai H, Yamada M. Apoptosis in cumulus cells during in vitro maturation of bovine cumulus enclosed oocytes. Reproduction 2003; 125: 369 376. 286. Itoh N. Hormone like (endocrine) Fgfs: their evolutionary history and roles in development, metabolism, and diseas e. Cell Tissue Res 2010; 342: 1 11. 287. Hori M, Shimizu Y, Fukumoto S. Minireview: fibroblast growth factor 23 in phosphate homeostasis and bone metabolism. Endocrinology 2011; 152: 4 10. 288. Zhang K, Hansen P, Ealy AD. Fibroblast growth factor 10 enhanc es bovine oocyte maturation and developmental competence in vitro. Reproduction. 289. Zhang K, Hansen PJ, Ealy AD. FGF2 promotes bovine oocyte meiotic maturation and developmental competence. Reprod Fertil Dev 2011; 23: 236. 290. Cottom J, Salvador LM, Mai zels ET, Reierstad S, Park Y, Carr DW, Davare MA, Hell JW, Palmer SS, Dent P, Kawakatsu H, Ogata M, Hunzicker Dunn M. Follicle stimulating hormone activates extracellular signal regulated kinase but not extracellular signal regulated kinase kinase through a 100 kDa phosphotyrosine phosphatase. J Biol Chem 2003; 278: 7167 7179. 291. Ozawa M, Ealy AD. Expression profiling of fibroblast growth factor receptors (FGFRs) and FGF4, and their roles during pre and peri implantation embryonic development in the bovi ne. Biology of Reproduction 2010; Special Issue 2010: 56. 292. Mohammadi M, Froum S, Hamby JM, Schroeder MC, Panek RL, Lu GH, Eliseenkova AV, Green D, Schlessinger J, Hubbard SR. Crystal structure of an angiogenesis inhibitor bound to the FGF receptor tyro sine kinase domain. EMBO J 1998; 17: 5896 5904.

PAGE 147

147 293. Mohammadi M, McMahon G, Sun L, Tang C, Hirth P, Yeh BK, Hubbard SR, Schlessinger J. Structures of the tyrosine kinase domain of fibroblast growth factor receptor in complex with inhibitors. Science 1997; 276: 955 960. 294. Dvorak P, Dvorakova D, Koskova S, Vodinska M, Najvirtova M, Krekac D, Hampl A. Expression and potential role of fibroblast growth factor 2 and its receptors in human embryonic stem cells. Stem Cells 2005; 23: 1200 1211. 295. Grand EK, C hase AJ, Heath C, Rahemtulla A, Cross NC. Targeting FGFR3 in multiple myeloma: inhibition of t(4;14) positive cells by SU5402 and PD173074. Leukemia 2004; 18: 962 966. 296. Pontes JH, Nonato Junior I, Sanches BV, Ereno Junior JC, Uvo S, Barreiros TR, Olive ira JA, Hasler JF, Seneda MM. Comparison of embryo yield and pregnancy rate between in vivo and in vitro methods in the same Nelore (Bos indicus) donor cows. Theriogenology 2009; 71: 690 697. 297. Luo H, Kimura K, Aoki M, Hirako M. Vascular endothelial gro wth factor (VEGF) promotes the early development of bovine embryo in the presence of cumulus cells. J Vet Med Sci 2002; 64: 967 971. 298. Luo H, Kimura K, Aoki M, Hirako M. Effect of vascular endothelial growth factor on maturation, fertilization and devel opmental competence of bovine oocytes. J Vet Med Sci 2002; 64: 803 806. 299. Robert C, Gagne D, Bousquet D, Barnes FL, Sirard MA. Differential display and suppressive subtractive hybridization used to identify granulosa cell messenger rna associated with b ovine oocyte developmental competence. Biol.Reprod. 2001; 64: 1812 1820. 300. Thomas FH, Vanderhyden BC. Oocyte granulosa cell interactions during mouse follicular development: regulation of kit ligand expression and its role in oocyte growth. Reprod Biol Endocrinol 2006; 4: 19. 301. Pereira MM, Machado MA, Costa FQ, Serapiao RV, Viana JH, Camargo LS. Effect of oxygen tension and serum during IVM on developmental competence of bovine oocytes. Reprod Fertil Dev 2010; 22: 1074 1082. 302. Numabe T, Oikawa T, K ikuchi T, Horiuchi T. Birth weight and birth rate of heavy calves conceived by transfer of in vitro or in vivo produced bovine embryos. Anim Reprod Sci 2000; 64: 13 20. 303. Engelberg H. Plasma heparin levels in normal man. Circulation 1961; 23: 578 581. 304. Ornitz DM. FGFs, heparan sulfate and FGFRs: complex interactions essential for development. BioEssays 2000; 22: 108 112.

PAGE 148

148 305. Khatib H, Monson RL, Schutzkus V, Kohl DM, Rosa GJ, Rutledge JJ. Mutations in the STAT5A gene are associated with embryonic s urvival and milk composition in cattle. J Dairy Sci 2008; 91: 784 793. 306. Telford NA, Watson AJ, Schultz GA. Transition from maternal to embryonic control in early mammalian development: a comparison of several species. Mol Reprod Dev 1990; 26: 90 100. 3 07. Adams GP, Pierson RA. Bovine model for study of ovarian follicular dynamics in humans. Theriogenology 1995; 43: 113 120.

PAGE 149

149 BIOGRAPHICAL SKETCH Kun Zhang was born in 1982 in Guo Y ang County, Anhui P rovince in China. As the youngest of three sons in the family, Kun graduated from No.1 Middle School of Bo Z hou with honors in 2000. H e then came to Beijing to attend China Agricultural University (CAU) for undergraduate study and earned a Bachelor of Agriculture degree in Animal Sciences in summe r of 2004. Following graduation he continued at CAU for graduate study in September of 2004. His research was focus ed on optimization of pig cloning system s under the supervision of Dr. Ning Li. In the summer of 2007, Kun moved to Florida and began his doctoral study in the Animal Molecular and Cellular Biology Graduate P rogram. From August, 2007 to August, 2008, h is project focused on characterizi ng the role of DNA methylation i n development of bovine cloned embryo s under the supervision of Dr. Karen Moore. After wards he switched to work with Dr. Alan Ealy to study the role of FGF signaling i n oocyte maturation and embryo development. After completing his do ctoral studies Kun will move to the University of Massachusetts at Amherst t o continue his research on reproductive biology. Kun is married to Shaohua Wang, who is a molecular biologist.