Characterization of Virulence Traits and the Underlying Regulatory Mechanisms of Xanthomonas Citri Subsp. Citri

MISSING IMAGE

Material Information

Title:
Characterization of Virulence Traits and the Underlying Regulatory Mechanisms of Xanthomonas Citri Subsp. Citri
Physical Description:
1 online resource (212 p.)
Language:
english
Creator:
Guo,Yinping
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Microbiology and Cell Science
Committee Chair:
Wang, Nian
Committee Members:
Preston, James F
Mou, Zhonglin
Graham, James H
Jones, Jeffrey B

Subjects

Subjects / Keywords:
adhesin -- attachment -- axonopodis -- canker -- citri -- citrus -- fitness -- flagellum -- galu -- hrpg -- hrpx -- mechanism -- microarray -- motility -- polysaccharides -- quorum -- regulatory -- rpfc -- rpff -- rpfg -- sensing -- t2ss -- t3ss -- transcriptome -- virulence -- xanthomonas
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre:
Microbiology and Cell Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Xanthomonas citri subsp. citri (XCC) is the causal agent of citrus canker which is one of the most serious diseases of citrus. Citrus canker has a significant impact on national and international citrus markets and trade. An understanding of virulence mechanism of XCC would assist the development of effective control measures against citrus canker. The goals of this study are to identify potential virulence traits of XCC and to characterize the underlying regulatory mechanisms coordinating gene expression in XCC during citrus canker infection. Transposon insertion mutagenesis showed that galU was required for biosynthesis of extracellular polysaccharides, capsular polysaccharide, biofilm formation, and virulence on host. Further study revealed that galU is critical for bacterial fitness in planta. To understand the regulatory mechanisms coordinating the expression of virulence traits in XCC, we designed and conducted genome-wide microarray analyses to identify genes under control of HrpG and HrpX, which are critical regulators for the pathogenicity of XCC. It showed that HrpG and HrpX not only control diverse virulence traits, but also regulate multiple cellular activities responding to the host environment, such as amino acid biosynthesis, oxidative phosphorylation, pentose-phosphate pathway, transport of sugar, iron and potassium, and the phenolic catabolism. To study the regulatory mechanism of quorum sensing on virulence traits of XCC, the mutants of the core genes of quorum sensing, rpfF, rpfC and rpfG genes, were constructed. Comparison of the transcriptomes of QS mutants with that of wild type stain revealed that QS temporally regulates the expression of a large set of genes, including genes involved in chemotaxis and flagellar biosynthesis, genes related to metabolism, and genes encoding virulence traits such as type II secretion system substrates, type III secretion system and effectors. Cross talk between the QS regulon and HrpG regulon has also been identified, suggesting that the interplay of global signaling network by HrpG and QS assists XCC to coordinate the expression of multiple virulence traits for modification and adaptation to the host environment during infection. Altogether, this study demonstrated the complexity of signaling pathways underlying the regulation of XCC virulence traits and the interplay between the regulatory cascades.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Yinping Guo.
Thesis:
Thesis (Ph.D.)--University of Florida, 2011.
Local:
Adviser: Wang, Nian.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043194:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 CHARACTERIZATION OF VIRULENCE TRAITS AND THE UNDERLYING REGULATORY MECHANISM S OF Xanthomonas citri subsp. citri By YINPING GUO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFIL LMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Yinping Guo

PAGE 3

3 To my parents, Zhi Zhang and Quanying Guo, and my husband Sha Tao

PAGE 4

4 ACKNOWLEDGMENTS I would like to express the deepest gra titud e to my academic advisor, Dr. Nian Wang, for the o pportunity to pursue my research in his lab. His constant guidance and support helped me to survive many difficulties throughout the journey to achieve my PhD I would also like to thank the mem bers of my c ommittee: Drs. Jeff r e y Jones, James Preston, James Graham, and Zhonglin Mou for their advice, attention, and time Special thanks go to Dr. Jeff r e y Jones for the o pportunity to learn mutagenesis technique in his lab. I also wish to thank all the former and creating a friendly and pleasa nt environment in which to work: Drs. Uma Shanker Sagaram, Jeong Soon Kim, Pankaj Trivedi, Qing Yan, Jinyun Li, Aswathy Sreedharan, Nagaraju Akula, Valente Aritua, Sunitha Kogenaru, Ms. Neha Jalan, Ms. Lin Yang, and Mr. Vladimir Kolbasov. Drs. Uma Shanker Sagaram, and Jeong Soon Kim assisted me with the characterization of the galU mutants. Ms. Lin Yang helped with the preparation of scanning electron microscope specimens. Mr. Vladimi r Kolba sov helped with the growth curve assay of quorum sensing mutants in planta. Drs. Pankaj Trivedi, Qing Yan, Jinyun Li and Ms. Neha Jalan held valuable scientific (sometimes not scientific) discussions with me. Special thanks are exten ded to friends a nd colleagues at the Citrus Research and Education Center, Department of Microbiology and Cell Science, and Department of Plant Pathology, ICBR at the University of Florida. I would like to acknowledge Ms. Diann Achor for teaching me how to operate the con focal scanning laser microscope and scanning electron microscope. I wish to thank Mr. Gerald Minsavage and Dr. Jos Francisco Lissoni Figueiredo Mr. Gerald Minsavage taught me

PAGE 5

5 how to generate deletion mutants. Dr. Jos Francisco Li ssoni Figueiredo generated the hrpX mutant. I am especially indebted to Drs. Yanping Zhang and Jason Li for the performance of microarray hybridization, microarray data normalization and statistical analysis. I also thank Drs. James Graham, William Dawson, Ron Brlansky, Larry Duncan and Micheal Davis and members of their labs for allowing me the use of their equipment. Finally, I wish to acknowledge my family members including my brothers, Gaofeng and Chuangfeng Guo, my grandmother Lanying Gao and my aunt X ujun Zhang for all their encouragement in my pursuance of my Ph.D. Thanks go to the memory of my grandfather Shuanzhu Zhang for his example and integrity. I would especially like to thank my parents, Zhi Zhang and Quanying Guo. Without their support and lo ve throughout my life, none of this would be possible. I most importantly thank my beloved husband and best friend, Sha Tao, for sticking with me through all the good and bad times, for having faith in me and for helping me to keep sane His love, support and constant patience have ta ught me so much about sacrifice and compromise.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 ABSTRACT ................................ ................................ ................................ ................... 12 CHAPTER 1 LITERATURE REVIEW ................................ ................................ .......................... 14 Citrus Canker ................................ ................................ ................................ .......... 14 Virulence Traits Used by XC C ................................ ................................ ................ 15 Bacterial Surface Structures Serve as a Dual Edged Sword Important Virulence Traits and Plant Immunity Inducers ................................ ............... 16 Extracellular polysaccharides ................................ ................................ ..... 17 Lipopolysaccharid es ................................ ................................ .................. 17 Capsular polysaccharides ................................ ................................ .......... 18 Type IV pili ................................ ................................ ................................ 19 Nonfimbrial ad hesins ................................ ................................ ................. 19 Flagellum ................................ ................................ ................................ ... 20 Secretion System s and Their Substrates ................................ ......................... 20 Type I secretion system ................................ ................................ ............. 21 Type II secretion system ................................ ................................ ............ 22 Type III secretion system ................................ ................................ ........... 22 Type IV secretion system ................................ ................................ ........... 24 Type V secretion system ................................ ................................ ............ 25 Type VI secretion system ................................ ................................ ........... 26 Regulatory Mechanisms Coordinating the Expression of Virulence Traits .............. 27 Quorum Sensing Plays Critical Roles in Plant Pathogenic Bacteria ................. 28 Regulators HrpG and HrpX ................................ ................................ .............. 31 RavS/RavR and ColS/ColR Two Component Systems ................................ .... 32 Project Goals and Objectives ................................ ................................ .................. 34 2 THE gal U GENE IS ESSENTIAL FOR POLYSACCHARIDE PRODUCTION, PATHOGENICITY AND GROWTH IN PLANTA OF Xanthomonas citri subsp. citri ................................ ................................ ................................ .......................... 35 Introduction ................................ ................................ ................................ ............. 35 Materials and Methods ................................ ................................ ............................ 36 Bacterial Strains and Growth Media ................................ ................................ 36 Construction of Xanthomonas citri subsp. citri Mutant Library .......................... 36 Rescue Cloning of Two Non Mucoid Mutants ................................ .................. 37

PAGE 7

7 Nucleic Acid Isolation and PCR ................................ ................................ ........ 37 Southern Blot Analysis ................................ ................................ ..................... 38 Complementation of the galU Mutant s ................................ ............................. 39 Quantitative Determination of EPS Production ................................ ................. 39 Capsule Assays ................................ ................................ ................................ 40 LPS Assays ................................ ................................ ................................ ...... 40 Biofilm Assays ................................ ................................ ................................ .. 41 Pathogenicity Assays on Plants ................................ ................................ ....... 41 Bacterial Growth Assays in Planta ................................ ................................ ... 42 RNA Extraction and Quantitative Reverse Transcription PCR (QRT PCR) ...... 42 Results ................................ ................................ ................................ .................... 44 Generation of the galU Mutants of XCC ................................ ........................... 44 The galU Gene Involvement with Polysaccharide Biosynthesis ....................... 45 The galU Gene Involvement with Biofilm Formation ................................ ......... 46 Pathogenicity Assays ................................ ................................ ....................... 46 Effects of Mu tation of the galU Gene on Gene Expression of Key Virulence Genes ................................ ................................ ................................ ........... 46 In Planta Growth of the galU Mutant ................................ ................................ 47 Discussion ................................ ................................ ................................ .............. 48 3 HrpG AND HrpX PLAY GLOBAL ROLES IN COORDINATING DIFFERE NT VIRULENCE TRAITS OF Xanthomonas citri subsp. citri ................................ ........ 59 Introduction ................................ ................................ ................................ ............. 59 Materials and Methods ................................ ................................ ............................ 61 Strains and Growth Conditions ................................ ................................ ......... 61 Generation of the hrpG Mutant ................................ ................................ ......... 61 Complementation of the hrpG Mutant ................................ .............................. 62 Pathogenicity Assay ................................ ................................ ......................... 63 RNA Extraction ................................ ................................ ................................ 63 XCC Oligonucleotide Microarray Design ................................ .......................... 64 Microarray Hybridization ................................ ................................ ................... 64 Microarray Data Analysis and Statistical Methods ................................ ............ 65 Quantitative RT PCR (QRT PCR) ................................ ................................ .... 66 Motility Assays ................................ ................................ ................................ .. 67 Results ................................ ................................ ................................ .................... 67 Generation of the hrpG Mutant ................................ ................................ ......... 67 M icroarray Analyses and Validation of Microarray Data ................................ ... 68 Functional Classification of Differentially Regulated Genes ............................. 69 Clusterin g Analysis ................................ ................................ ........................... 69 T3SS and T3SS Effectors ................................ ................................ ................ 71 T2SS Substrates ................................ ................................ .............................. 72 Sign al Transduction and Regulation ................................ ................................ 72 Chemotaxis and Bacterial Motility ................................ ................................ .... 73 Amino Acid Biosynthesis ................................ ................................ .................. 74 General Metabolism and Transport ................................ ................................ .. 75 Discussion ................................ ................................ ................................ .............. 76

PAGE 8

8 4 CHARACTERIZATION OF DSF MEDIATED QUORUM SE NSING REGULON AND ITS ROLE IN CITRUS CANKER INFECTION ................................ .............. 120 Introduction ................................ ................................ ................................ ........... 120 Materials and Methods ................................ ................................ .......................... 122 Bacterial Strains and Growth Conditions ................................ ........................ 122 Construction of Strains with Mutations in Genes Involved in DSF Mediated QS Signaling ................................ ................................ ............................... 122 Complementation of the rpfF rpfC and rpfG Mutants ................................ ..... 124 RNA Extraction ................................ ................................ ............................... 125 Microarray Hybridization ................................ ................................ ................. 125 Microarray Data Analysis and Statistical Methods ................................ .......... 126 Quantitative Real Time Two Step RT PCR (QRT PCR) ................................ 127 Motility Assays ................................ ................................ ................................ 128 Protease Activity Test ................................ ................................ ..................... 128 Pathogenicity Assay ................................ ................................ ....................... 128 Attachment Assays ................................ ................................ ......................... 129 Results ................................ ................................ ................................ .................. 131 Generation of DSF Mediated QS Mutants of XCC ................................ ......... 131 QS is Required for the Full Virulence of XCC in Citrus Host .......................... 132 Overview of Microarray Analysis ................................ ................................ .... 133 Chemotaxis and Flagellar Biosynthesis ................................ .......................... 135 Cell Membrane Surface Structure and Transporters ................................ ...... 136 T2SS Substrates ................................ ................................ ............................ 137 T3SS and Effectors ................................ ................................ ........................ 138 Signal Transduction and Regulation ................................ ............................... 138 Stress Resistance ................................ ................................ .......................... 139 Metabolism ................................ ................................ ................................ ..... 140 Regulation of gum genes ................................ ................................ ................ 141 The Attachment of XCC Was Reduced by QS Mutations ............................... 141 Discussion ................................ ................................ ................................ ............ 143 5 SUMMARY AND C ONCLUSIONS ................................ ................................ ........ 190 LIST OF REFERENCES ................................ ................................ ............................. 193 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 212

PAGE 9

9 LIST OF TABLES Table page 2 1 Bacterial strains and plasmids used in this study ................................ ............... 52 2 2 Primers used in this study. ................................ ................................ ................. 53 2 3 Genes and corresponding primers for QRT PCR analysis. ................................ 54 2 4 Comparison of gene expression of key virulence genes in the wild type and the galU mutant. ................................ ................................ ................................ 55 3 1 Bacterial strains and plasmids used in this study ................................ ............... 84 3 2 Primers used in this study ................................ ................................ .................. 8 5 3 3 Genes showing significant differential expression in hrpG and/or hrpX mutants compared with wild type strain. ................................ ............................. 86 3 4 Confirmed and putative type III secretion sys tem effectors ................................ 99 3 5 Confirmed and putative type II secretion system substrate proteins ................. 101 3 6 Regulatory genes under control o f HrpG and/or HrpX. ................................ ..... 103 3 7 Genes showing significant differential expression in both hrpG and hrpX mutants compared with wild type strain. ................................ ........................... 105 4 1 Bacterial strains and plasmids used in this study ................................ ............. 152 4 2 Primers used in this study ................................ ................................ ................ 154 4 3 Genes showing s ignificant differential expression in QS mutants compared with wild type strain. ................................ ................................ ......................... 156 4 4 Microarray validation by QRT PCR. ................................ ................................ 176 4 5 Genes overlapped in QS and HrpG regulons. ................................ .................. 177

PAGE 10

10 LIST OF FIGURES Figure page 2 1 Sequence analysis of EZ Tn5 insertion in the galU mutants.. ............................ 56 2 2 Effects of galU on the capsular polysaccharide and biofilm formation. ............... 57 2 3 Pathogenicity assays and growth of XCC strains in planta ................................ 58 3 1 Growth curves of XCC strains in XVM2 medium.. ................................ ............ 112 3 2 Pathogenicity assay of XCC strains by infiltration ................................ ............. 113 3 3 Diagram displaying the numbers of differentially expressed genes .. ................ 114 3 4 Comparison of gene expression by quantitative reverse transcription polymerase chain reaction.. ................................ ................................ .............. 115 3 5 Distribution of genes of the HrpG and HrpX regulons. ................................ ...... 116 3 6 Hierarchical clu stering of genes in the HrpG and HrpX regulons ...................... 117 3 7 Swarming assay on XVM2 medium. ................................ ................................ 118 3 8 Schematic model of HrpG and HrpX related regulation cascades of Xanthomonas genus. ................................ ................................ ........................ 119 4 1 Growth curves of the QS mutants and wild type stain in XVM2. ....................... 180 4 2 S chematic diagram of rpfF rpfC and rpfG in the genome of XCC ................... 181 4 3 Phenotype difference between QS mutants and wild type strain. ..................... 182 4 4 Mutants of rpfF, rpfC and rpfG reuced the produc tion of extracellular proteases ................................ ................................ ................................ ......... 183 4 5 Mutants of rpfF rpfC and rpfG reduced motility. ................................ ............... 184 4 6 The virulence of XCC in planta is impaired by the mutations of rpfF rpfC and rpfG ................................ ................................ ................................ ................. 185 4 7 Genes in QS regulon distribute into JCVI functional categories ....................... 186 4 8 Mutants of rpfF rpfC and rpfG reduced the attachment of XCC on abiotic and biotic surface. ................................ ................................ ................................ ... 187 4 9 Microscopic analysis of ba cterial attachment on abaxial surf ace of Duncan grapefruit leaves ................................ ................................ .............................. 188

PAGE 11

11 4 10 QRT PCR results of the expression of gumB and gumD genes of QS mutants relative to wild type strain ................................ ................................ .... 189

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHARACTERIZATION OF VIRULENCE TRAITS AND THE U NDERLYING REGULATORY MECHANISMS OF Xanthomonas citri subsp citri By Yinping Guo August 2011 Chair: Nian Wang Major: Microbiology and Cell Science Xanthomonas citri subsp. citri (XC C) is the causal agent of citrus canker which is one of the most seriou s diseases of citrus C itrus canker has a significant impact on national and international citrus markets and trade An understand ing of virulence mechanism of XC C would assist the development of effect ive control measures against citrus canker. The goals of this study are to identify potential virulence traits of XC C and to characterize the underlying regulato ry mechanisms coordinating gene expression in XCC during citrus canker infection Transposon insertion mutagenesis showed that galU was required for biosynthesis of ext racellular polysaccharides c apsular polysaccharide biofilm formation, and virulence on host. Further study revealed that g alU is critical for bacterial fitness in planta To understand the regulatory mechanism s coordinating the express ion of virulence traits in XCC we designed and conducted genome wide microarray analyses to identify genes under control of HrpG and HrpX, which are critical regulators for the pathogenicity of XC C. It showed that HrpG and HrpX not only control diverse vi rulence traits but also regula te multiple cellular activities responding to the host environment, such as amino acid biosynthesis, oxidative phosphorylation, pentose phosphate pathway, transport of sugar, iron and potassium, and the phenolic

PAGE 13

13 catabolism. T o study the regulatory mechanism of quorum sensing on virulence traits of XCC, the mutants of the core genes of quorum sensing, rpfF rpfC and rpfG genes, were constructed. Comparison of the transcriptomes of QS mutants with that of wild type stain reveale d that QS temporally regulates the expression of a large set of genes, including genes involved in chemotaxis and flagellar biosynthesis, genes related to metabolism, and genes encoding virulence traits such as type II secretion system subst r ates, type III secretion system and effectors. Cross talk between the QS regulon and HrpG regulon has also been identified suggesting that t he interplay of g lobal si gnaling netw ork by HrpG and QS assists XCC to coordinate the expression of multiple virulence traits for modification and adap ta tion to the host environment during infection. Altogeth er, this study demonstrated the complexity of signaling pathways underlying the regulation of XCC virulence traits and the interplay between the regulatory cascades.

PAGE 14

14 CHAPTER 1 LITERATURE REVIEW Citrus C anker The genus Xanthomonas is an important group of Gram negative plant pa thogenic bacteria, which infect approximately 124 monocotyledonous and 268 dicotyledonous plants (Leyns et al. 198 4; Chan and Goodwin 1999) Among the diseases caused by members of the genus Xanthomonas citrus canker is one of the most serious diseases of most commercial citrus cultivars resulting in significant losses worldwide. Citrus producing areas without ci tr us canker consider the pathogen a quarantine pest due to the potential threat to citrus production. Thus, citrus canker has a significant impact on national and international citrus markets and trade particularly fresh fruit (Gottwald et al. 2002) Citrus canker is caused by Xanthomonas citri subsp. citri ( XC C ) (syn. Xanth omonas citri ; Xanthomonas campestris pv. citri or Xanthomonas axonopodis pv citri ) (Cubero and Graham 2002; Schaad et al. 2006; Vauterin et al. 19 95 ) The Asiatic form or A type of citrus canker is the most virulent and affects the widest range of hosts, including Citrus spp. and many closely related rutaceous plants. Citrus canker disease is characterized by formation of necrotic raised lesion s on leaves, stems and fruits. The symptoms develop in the following steps (Graham et al. 2004) : ( 1) circular, water soaked lesions form on leaf, fruit, and stem tissues at the beginning; ( 2) the lesions become raised and blister like, and growing into white or yellow spongy pustules; and ( 3) the pustules darken and thick en into a corky canker. Under favorable conditions of high moisture and temperature, severe infection results in defoliation, dieback, badly blemished fruit, and premature fruit drop. The economic impact of citrus canker on cit r us industry is not only from the yield and quality reduction of the crop but also from the

PAGE 15

15 loss of markets, since infected fruit s become less valuable or unmarketable (Graham et al. 2004) The measures used to prevent and control citrus canker depend on the situation of canker infection in different citrus growing areas: i n regions w here citrus canker does not occur or has been eradicated, quarantine measures h ave been used to prohibit the introduction and spread of citru s canker; in regions where citrus canker is endemic, i ntegrated control measures have been applied including eradication of t rees, quarantine, production of pathogen free nursery trees, use of windbreaks, decontamination and spray of antibiotics and cop per based pro ducts (Graham et al. 2004) The eradication by removal of in fected and exposed trees is the most effective measure to eliminate citrus canker before its further spread. However, this practice has been suspended in Florida in 2006 because of the expa nsion of the epidemic statewi de caused by hurricanes in 2004 and 2005 (Gottwald and Irey 2007) Therefore, new strategies are needed for the management of ci trus canker in endemic areas of citrus canker. Although the canker disease is hard to era dicate, the disease cycle of XCC is relatively simple. During wet weather, bacteria ooze from exist ing lesions to provide inoculum for dispersal. Wind driven rain and contaminated equipment spread the inoculum over short distances to new growth and other plants XCC enters the host through natural openings, like stomata, or wounds. Aft er successful infection, it take s 7 60 days or more for highly visible symptoms to app ear (Gottwald et al. 2002) Virulence Traits U sed by XC C The complete genome o f XCC has been determined (da Silva et al. 2002) XCC strain 306 has one circular chromosome consisting of 5,175,554 base pairs (bp), and

PAGE 16

16 two plasmids: p XAC 33 (33,699 bp) and p XAC 64 (64,920 bp). There are 4,313 gene s in the chromosome of XCC, including 2,710 genes with assigned functions, 1 603 hypothetical genes and 62 structural RNA genes. The p XAC 33 has 21 genes with assigned functions and 21 hypothetical genes; the p XAC 64 has 39 genes with assigned functions and 34 hypothetical. Approximately 6% of XCC genes are involved in pathogenicity, virulence and adaptation, including genes encoding type III secretion system (T3SS) T3SS effectors cell wall degrading enzymes (CWDEs) toxins, bacterial adhesins and surface s tructural elements, as well as rpf (regulation of pathogenicity factors) genes which are related to cell cell signaling (da Silva et al. 2002) Those virulence traits play diverse roles in the different stages of XC C infection and can be defined into two categories: bacterial surface structures, and secretion systems and their substrates. Bacterial Surface S truc ture s S erve as a Dual Edged S word Important Virulence Traits and Plant Immunity I nducers A large set of gen es encoding cell surface structures have been identifi ed in XCC either by molecular or by in silico stu dies including genes encoding extracellular polysaccharides (EPS), lipopoly saccharides (LPS), capsular polysacchari des (CPS), type IV pili, adhesi ns, an d flagellum The se surface structures have been demonstrated to be involved in the infection process of XCC or other Xanthomonas spp. such as the attachment to the plant sur face protection of bacteria from environmental stresses and invasion of host inte rcellular space However, some of those s tructures may also contribute to pathogen associate molecular pattern s (PAMPs) which can be recognized by plant surface arrayed pattern recog nition receptor like kinases and induce PAMP triggered immunity (PTI), suc h as flagellin and LPS (Schneider and Collmer 2010)

PAGE 17

17 Extracellular polysaccharides EPS molecules appear to be released onto the cell surface with no visible means of a ttachment and form an amorphous layer on the outer surface (Roberts 1996) The EPS produced by xanthomonads, xanthan, consists of repeating pentasaccharide units with the manno se glucuronic acid 1,2) mannose 1,3) cellobiose structure (Jansson et al. 1975) The gum gene cluster, which consist s of 12 genes ( g umB to gumM ), is responsi ble for EPS production in Xanthomonas spp. Due to its hydrated and anionic properties, EPS contributes to the bacterial survival against environmental stresses, particularly dehydration. Moreover, EPS is a major component of biofil m of Xanthomonas spp. Mutation s in gum genes of Xanthomonas spp. cause the loss of EPS production abnormal biofilm structure and impaired epiphytic surviv al on hosts (Chou et al. 1997; Dunger et al. 2007; Rigano et al. 2007; Kim et al. 2009b) Besides the contribution to bacterial survival against environmental stresses, EPS is also important as virulence factor in some systems. EPS was shown to suppress callose deposition in the plant cell wall (Yun et al. 2006) Lipopolysaccharides LPS is a unique and major outer membrane component of G ram negative bacteria, which is a large mole cule consisting of three domains: a membrane associated lipid A, an d a core oligosaccharide and polysaccharide side chains (O antigen) T he gene clusters of Xa n thomonas spp. involved in LPS biosynthesis vary in nu mbers and sequence similarity (Lu et al. 2008) In XC C those genes are located in two region s: genes encoding transferases, epimerases, translocases, and derived sugar transporters are located in the first region, whearas xanAB and rmlDABC genes

PAGE 18

18 enc oding nucleotide sugar and dTDP L rhamnose biosynthesis are located in the second region (da Silva et al. 2002) LPS contribute s to the structural integrity of the bacteria and also serve s as protective barrier for bacteria against the attack of toxic chemicals in ho s tile environments. Mutations in LPS genes of XCC lead to impaired biofilm formation, increased sensitivity to environmental stresses an d reduction of virulence (Li and Wang 2011) However, LPS is well known as an endotoxin that elicit s strong immune responses in animals Furthermore, it has al so been implicated as a major PAMP triggering basal defense response s in plant which include oxidative burst, the production of reactive nitrogen species the production of antimicrobial compounds (phytoalexins), thickening of the plant cell wall and exp ression of pathogenesis related genes (Newman et al. 2007) Capsular polysaccharides CPS is a highly hydrated molecule composed of repeating monosaccharide s which are linked by glycosidic bond It is bound to the cell surface via covalent link to either phospholipid or lipid A molecule and constitute s the outer most layer (capsule) of the bacterial cell. Capsule s are found in a broad range of bacteria such as E scherichia coli Acinetobacter calcoaceticus Erwinia stewartii Klebsiella pneumonia (Roberts 1996) The functio ns of capsule include prevention of desiccation, adherence to surface or other cells, and resistance to specific and nonspecific host immunity (Roberts 1996) The role of CPS in plant pathogen interaction has not been fully elucidated. In XC C mutation o f opsX gene lead s to decreased EPS production, the loss of capsule, abnormal LPS and the loss of virulence in citrus. Furthermore, c apsule like structures around XCC were observed in infected Mexican lime and Yuzu leaves by transmission

PAGE 19

19 electron microscopy (Lee et al. 2009) These studies indicate that CPS is also important for XCC during infection. Type IV pili Type IV pili are filamentous appendages on cell surface and are responsibl e for bacterial twitch ing motility. They are also known as fimbrial adhesi ns for host colonization and adhesion in many animal and plant bacterial pathogens, such as Pseudomonas aeruginosa (Hahn 1997) and P sy ringae (Hirano and Upper 2000) Comparative genomic analysis revealed that a large set of gene s involved in t ype IV pilus biosyn thesis exist in XCC genome (da Silva et al. 2002) including fimA fimT and 26 pil genes ( pilA to pilY1 and pilZ ). Nonfimbrial adhesi ns Besides the fimbrial adhesi ns, b acterial attachment also can be achieved by non fimbrial adhesins, which are type V sec r etion system substrates such as the autotransporters of type V secretion system (e.g. Yad A in Yersinia spp.) and two partner secretion substrates (e.g. F ha A in Bordetella pertussis ) (Gerlach and Hensel 2007) Comparative genomic analysis revealed that XCC contains multiple genes encoding no nfimbrial adhesi ns such as xadA x adB and genes encoding filamentous hemagglutin ins (e.g. XAC FhaB and XAC FhaC ) Mutations in XAC FhaB caused the lack of adhesion to abiotic and biotic surfaces, abortion of biofilm formation and reduced virulence in XC C sug gesting that hemagglutinin proteins are important for tissue colonization (Gottig et al. 2009b ) Althou gh other nonfimbrial adhesi ns have not been intensively studied in XC C some of them have been reported to contr ibute to host attachment and are presumably involved in different infection stages in many plant pathogenic bacteria, such as XadA and XadB in X oryzae pv. oryzae (Das et al. 2009)

PAGE 20

20 HecA in Erwinia chrysanthemi (Rojas et al. 2002) HfxB and XadA in Xylella fastidiosa (Feil et al. 2007) Flagellum The f lagellum is a tail like projection which allow s the flagellated bacterium to swim towards nutrients, or to move away from harmful chemicals. The f l agellum is involved in surface attachment, biofilm formation, as well as in entering and exploiting hosts in many pathogenic bacteria such as Helicobacter pylori H. muslelae Campylobacter jejuni a nd V ibrio cholera (Josenhans and Suerbaum 2002) Non flagellated mutants showe d significantly reduced ability to colonize the hosts. XCC bears a single polar flagellum. Comparative genomic analysis revealed that XCC contains a full set of genes for flagellar biosynthesis and chemotaxis pathway (da S ilva et al. 2002) suggesting that flagell um plays an important role in the XCC life cycle. M utations in fliC and flgE in XCC which encode flagellin and hook respectively resulted in decreased swimming motility, abnormal biofilm structure, and r educed virulence in host (Malamud et al. 2011) The flagellum is also well known as PAMP s which induces defense response in plant s or immunity in animals. Several studies showed that the flagellar motility is dispensable for the full virulen ce when bacteria live in hosts (Malamud et al. 2011; Schreiber and Desveaux 2011) Therefore, bac teria have to manipulate diverse virulence traits for better growth in host and also suppress flagellar functions for avoidance of host defense response. Secretion System s and Their S ubstrates The transport of macromolecules across the bacterial cell membrane s is an important fu n ction in bacteria, particularly in pathogenic bacteria. This critical function is

PAGE 21

21 fulfilled b y secretion systems. To date, secretion sy s tems have been classifi ed into seven types in bacteria type I to type VII according to their composition, function and substrates (Tseng et al. 2009) Exce pt for type VII secreti on system which is specific to G ram positive bacteria, the other six secretion systems (type I to type VI) have been discovered in Gram negative bacteria. Comparative genomic analys es revealed that all six secretion systems exist in XCC (da Silva et al. 2002; Van Sluys et al. 2002; Shrivastava and Mande 2008) although not all the secretion systems have been well studied in this bacterium. Type I secretion system Type I sec r etion system ( T1SS ) which is S ec independent exports substrates in a one step process across both inner and outer membranes of bacteria. It consi sts of three major components: an ATP binding cassette (ABC) transporter in the inner membrane, a n outer membrane factor (OMF) se rving as a protein channel in the outer membrane, and membrane fusion protein (MFP) connecting the inner and outer membrane components. The ABC transporter specifically recognizes the C terminal uncleaved secretion signal of T1SS substrates and provides th e energy for the translocation by ATP hydrolysis. T1SS plays an important role in pathogenic bacteria by secreting toxins (e.g. hemolysins) lipases and proteases (Gerlach and Hensel 2007) T1SS has not been demonstrated to contribute to virulence of XCC yet. However, i n a close ly related species X. oryzae pv. oryzae ,T1SS is re q uired for transport of an avirulent factor AvrXa21 which can be recognized by its host receptor Xa21 resulting in a host resistan ce r esp onse (da Silva et al. 2004)

PAGE 22

22 Type II secretio n system Type II secretion system ( T2SS ) wa s first identified in K. oxytoca (d'Enfert et al. 1987) and later was found as a common secretion system in many Gram negative bacteria (Cianciotto 2005 ) A number of possi ble virulence factors are secre ted via T2SS, including cell wall degrading enzymes (CWDEs), proteases, l ipases and phosphatases. Unlike T1SS, i t is a Sec dependent system T2SS mediated translocation occurs in two steps: the substrates with a signal peptide are translocated across the inner membrane via the Se c pathway; and then they are exported across the outer membrane via the T2SS translocation pore which is formed by app roximately 12 15 components in the outer membrane (Sandkvist 2001) XCC ha s two independe nt T2SS which are encoded by xcs and xps gene clusters (da Silva et al. 2002) Moreover, a large number of genes encoding T2SS substrates are present in XCC genome, particularly CWDEs (e.g. 6 copies of genes encoding pectino lytic enzymes and 12 copies of genes encoding cellulolitic and hemicellulolytic enzymes). Despite the progress in study ing the T2SS the precise contribution of T2SS substrates to the virulence of XCC remains largel y unknown. Type III secretion system Type III secretion system (T3 SS) is a key pathogenicity factor employed by most Gram negative bacterial pathog ens. T3 SS is conserved in plant and anim al pathogenic bacteria such as Yersinia spp. Shigella flexneri Salm onella typhimurium E. coli Ervinia amylovora P. syringae Xanthomonas spp and Ralstonia solanacearum It consists of more than 20 proteins which form needle like complex to deliver effector proteins directly from the bacterial cytoplasm into the host c ells (Hueck 1998; Buttner and Bonas 2002) In plant pathogens, the T3 SS genes are called hrp (hypersensitive

PAGE 23

23 response and pathogenicity) genes and some are also refered to as hrc ( hypersensitive response and conserv ed) genes. Those genes are required both for bacterial pathogenicity and induction of hypersensitive response on hosts and non hosts, respectively (Lindgren et al. 1986; Alfano and Collmer 1997; Roine et al. 1997) The comparative genomic studies showed that the XCC genome has a hrp cluster which consists of 26 genes from hpa2 to hrpF (da Silva et al. 2002) The substrates secreted into host cells by T3SS are called T3SS e ffec tors, which are essential for the virulence of many plant pathogens. M any effectors have been identified as the products of avirulence genes that are recognized by corresponding plant disease resistance proteins e.g., AvrBs1 in Xcv (Ronald and Staskawicz 1988) With the increase of sequenced bacterial genomes, candidate effectors were identified based on homology to known effectors from other pa thogens by in silico prediction, e.g., xopC and xopJ (Nol et al. 2003) According to expe rimental and bioinformatic anal yses, 24 T3SS effecto rs have been found in XCC genome (Moreira et al. 2010 ) Due to functional redundancies among T3SS effectors, mutation of individual effector genes usually does not affect bacterial virulence except PthA (Roden et al 2004) P thA is a virulence determinant and can confer ability to cause canker like symptom to strains that cannot cause canker (Swarup et al. 1991) The major function of T3SS e ffector proteins is to optimize the host cell environment for bacterial growt h either by interfering with host defense responses or by modifying the normal cellular function of host proteins (Nomura et al. 2005; Grant et al. 2006 ) This can be a chieved by enzymatic activities of some T3SS ef fectors to modify host protein s and by transcription activato r activities of effectors in AvrBs3/PthA family

PAGE 24

24 to alter host transcriptom e Two fami lies of T3SS effectors have shown cysteine protease activity such as YopJ/AvrRxv family and XopD. For instance AvrXv4 from X. campestris pv. vesicatoria is a small ubiquitin related modifier (SUMO) protease in YopJ/AvrRxv family. It blocks the SUMO conjugation of plant proteins and subsequent proteolysis (Roden et al. 2004) The effectors in AvrBs3/Pth A family are transcription activa tors which target host transcription PthA is the first member of AvrBs3/Pth A family which was experimentally identified for its virulence activ ity (Swarup et al. 1991) The amino acid sequences of effecto rs of AvrBs3/Pth A family share striking features: a central repetitive region composed of nearly identica l repeats of usually 34 amino acids, and a nu clea r localization signal and an acidic ac tivation domain (Grlebeck et al. 2006) It has been demonstrated that AvrBs3 act s as a transcription activator and bind s to the promoter of upa20 which encodes a transcription factor that induce s plant cell hypertrophy (Kay et al. 2007) Type IV secretion system Type IV secretion system ( T4SS ) is a unique secre tion system which can transport macromolecules ( proteins or protein DNA complexes ) from bacterial cytoplasm into eukaryotic cells or other bacterial cells (Christie et al. 2005) As a one step secretion system, the T4SS apparatus span s both inner and outer membranes of the Gram negative bacterial cell and the cell envelop e of Gram positive bacterial cell. The well studied T4SS is the vir encoded system of Agrobacterium tumefaciens It delivers T DNA with protein from Ti plasmid of A. tumefac iens into the host to cause the formation of crown gall tumors. The homologous T4SS has been found in many bacteria, such as H. pylori (CAG; ComB), P. aeruginosa (TraS/TraB), Bordetella pertussis (Ptl), E. coli (Tra), Legionella pneumophila (Dot) (Christie et al. 2005) Moreover, it has been

PAGE 25

25 demonstrated that T4SS also transport s effector proteins into host cell to induce alteratio n of host cellular processes during infection. For insta nce, H. pylori translocate s effector protein CagA into host cell and cause inflammatory responses and cystoskeletal alterations (Backert and Meyer 2006) There are two T4SS gene clusters found in XC C one in the chromosome and the other in the plasmid p XAC 64 However, neither cluster allows a complete T4SS du e to the lack of v irB5 and virB7 in both clusters and the lack of virD4 in the plasmid (da Silva et al. 2002) The products of t hose missing genes are important compo nents for successful translocation of T4SS substr ates or for the structural complex of the secretion system : V irD4 is a coupling protein which forms oligomers and binds to single stranded DNA and double stranded DNA for translocation; VirB5 is a minor component of T4SS pilus which may mediate pilus biosy nthesis and is involved in adhesion; V irB7 is one component of the core co mplex and also links core complex and pilus constituents (Yeo and Waksman 2004) Therefore, it remains unclear if the two sets of T4SS are functional in XC C Type V secre tion system Type V secretion system ( T5SS ) i s the simplest secretion system with respect to the number of protein component s associated with the complex, and is also the largest family of protein translocating outer membrane porins in Gram negative bacteria (Yen et al. 2002) It is classified into three sub group s based on the secretion mechanisms: T5aSS is the autotransporter system; T5bSS is the two partner system and T5cSS is the oligomeric coiled coil adhesin (Oca) T5aSS is a module of a utotransporter protein containing three domains: a N terminal signal peptide, a passenger domain and a transl ocation unit at C terminal end. The autotranspoter protein with N terminal signal

PAGE 26

26 peptide is translocated from cytopla sm into periplasm via Se c system. The C terminal translocation unit inserts into the outer membrane and forms a beta barrel secondary structure which facilitates the translocation of the passenger domain into extracellular space. Afte r translocation to th e final des tiny, the passenger domain either remain s attached to the beta barrel as an adhesin, or is cleaved from the beta barrel and form s an active enzyme or toxin. I n contrast to the single polypeptide of T5aSS, T5bSS consists of two separate proteins (one passenger and one transporter) whe r e as T5cSS contains trimeric proteins for the formation of beta barrel secondary structure. A large number of protein s which are translocated via T5SS contribute to bacterial virulence, including enzymes ( proteases, peptidases, lipase esterase), toxins, and adhesi ns (Gerlach and Hensel 2007) As mentioned above a group of nonfimbrial adhesi ns are secret ed via T5SS Type VI secretion system A novel secretion system, type VI secretion system (T6SS) was identified and characterized in V. cholera (Pukatzki et al. 2006) and P. aeruginosa (Mougous et al. 2006) in 2006. Comparative genomic analysis reveale d the presence of T6SS in more than 25% of sequenced bacterial genomes, includ ing many proteobacteria, planctomycetes, and acidobacteria (Shrivastava and Mande 2008) For example, XC C X. campestris and X. oryza e share 14 out of the total 18 genes belonging to T6SS of V. choler a T6SS ha s been s peculated to evolve from the bacteriophage base plate due to the homol ogies shared by s everal subunits of T6SS and subunits of the bacteriophage T4 tail spike (Cascales 2008) Although the detailed assembly mechanism is not clear, the T6SS form s a phage tail spike like complex to inject effector proteins directly into host cyto plasm like T3SS and T4SS. It is required for virulence in animal and plant

PAGE 27

27 pathogenic bacteria such as V. cholera Edwardsiella tarda P. aeruginosa Burkholderia mallei A. tumefaciens Pectobacterium atrosepticum and X. oryza (Shrivastava and Mande 2008; Pukatzki et al. 2009) Regulatory Mechanisms Coordinating the Expression of V irulenc e T raits As we discussed above, a large number of virulence genes found in XCC genome are potential or known weapons employed by X CC for sucess ful citrus canker infection Bacteria have evolved global regulatory networks to coordinate the expression of the se virulence traints which help them adapt to the environmental changes and evade the host defense A few two component signal tra nsduction systems have been discovered to contribute to the global regulatory networks in Xanthomonas spp., including RavS/RavR, ColS/ColR, RpfC/RpfG (involved in quorum sensing (QS) ) re s ponse regulator HrpG. Two component systems usually consist of a mem brane bond histidine kinase sensor and a cytopla s mic response regulator. After perceiving a specific external signal, the histidine kinase sensor can be autophosphorylated and transfers a phosphoryl group to the receiver domain of cognate response regulato r. Subsequently, the activated response regulator induces physiological changes by regulating the expression of target genes. A number of important physiologi cal activities are under control of two component systems in bacteria, including cell motility, bi ofilm formation, QS, and virulence, nutrition uptake. Since the first two component system was discovered from E. coli (Ninfa and Magasanik 1986; Nixon et al. 1986) hundrend s of two component systems have been iden tified in bacteria, archaea and a few eukaryotic organisms, suggesting that two componnet system s are one of the dominant mechanisms employed for detection and transduction of external signal (Stock et al. 2000)

PAGE 28

28 Quorum Sensing Plays Critical Roles in Plant Pathogenic B acteria QS is one of the sophisticated mechanisms of cell to cell communications in response to fluctuation in cell population density. QS bacteria produce and release diffusible chemi cal signaling molecules into their environment. When the concentration of signaling molecules reaches a threshold, the bacteria detect and respond to this signal and alter their gene expression in order to regulate a diverse array of physiological activiti es. In the previous r eports, there are various QS circuits identified from over 25 species of Gram negative bacteria (Miller and Bassler 2001) Among these QS sy stems, xanthomonads utilize novel signaling molecules rather than N acyl derivatives of homoserine lactone ( N AHLs) which is used by most Gram negative bacteria. T wo different molecules for QS signaling were first discovered in X. campestris pv. campestris : ( 1) d iffusible signaling factor ( DSF ), which has been characteri zed as the unsaturated fatty acid cis 11 methyl dodecenoic acid (Wang et al. 2004) ; ( 2) d iffusible factor ( DF ), which is an uncharacterized butyrolactone molecule DF controls the production of the yellow pigment xanthomonadin and EPS (Poplawsky and Chun 1997) whereas DSF mediated QS pathway regulates the production of extracellular enzymes (including proteases, pectinases and endoglucanase) and extracellular polysaccharides (EPS) as well as biofilm formation (Tang et al. 1991; Barber et al. 1997; Slater et al. 2000; Torres et al. 2007) The two molecules have overlapping functions and both are needed for the full virulence of X. campestris pv. campestris Compare d to the DF mediated QS, DSF me diated QS has been studied extensively, To date, DSF has been found to be an important QS signal molecular in pathogens Xylella

PAGE 29

29 fastidiosa (Newman et al. 2004) Burkh olderia cenocepacia (Boon et al. 2008) and many Xanthomonas species (Chatterjee and Sonti 2002; Sicilian o et al. 2006) The DSF mediated QS pathway is conserved in those bacteria, in which rpf gene cluster is responsible for DSF production and signal transduction, including the core genes rpfF rpfC and rpfG (Chatterj ee a nd Sonti 2002; He et al. 2006 ; Siciliano et al. 2006) The rpfF gene encodes a putative enoyl CoA hydratase that catalyzes the synthesis of signal molecule DSF. Extracellular DSF is sensed by a two component signal transduction system consisting of th e sensor protein RpfC and response regulator RpfG. Studies of DSF mediated QS systems reveal that it has distinct regulatory functions among DSF producing bacteria, although DSF mediated QS pathway is conserved. For example, mutation in rpfF of X. campestr is pv. campestris lead s to defects in production of extracellular enzymes (e.g., proteases, pectinases and endoglucanase) and extracellular polysaccharides (EPS) as well as biofilm formation (Tang et al. 1991; Barbe r et al. 1997; Slater et al. 2000; Torres et al. 2007) whereas t he rpfF mutants of X. oryzae pv o ryzae with reduced virulence are profi c i ent for EPS and extracellular enzyme production (Chatterjee and Sonti 2002) In contrast to Xanthomonas spp., t he rpfF mutants of Xylella fastidiosa are deficient in DSF production but are hypervirulent in host (Newman et al. 2004) It s eems that the difference of DSF in regulation of diverse functions depends on plant pathogen species and their specific needs for infection. However, the understanding of the downstream signaling pathway of QS in the bacterial cell is fragmentary The demo nstration that the HD GYP domain of RpfG is a cyclic di GMP phosphodiesterase indicates cyclic di GMP i s a second messenger in DSF signal transduction (Dow et al. 2006; Ryan et al. 2006) Cyclic di GMP is

PAGE 30

30 synthesize d by proteins containing GGDEF domain which has diguanylate cyclase activity, whereas cyclic di GMP is degraded by proteins containing EAL or HD GYP domains which have phosphodiesterase. The high levels of cyclic di GMP promote biofilm formation, while low levels promote motility and transcription of virulence factors (Simm et al. 2004; Tischler and Camilli 2004; Rmling et al. 2005) One important target of cyclic di GMP is Clp (cAMP receptor protein like protein) w hich is a transcriptional activator. Microarray analyse s reveal that Clp is involved in the DSF mediated QS system in X. campestris pv. campestris (He et al. 2006; He et al. 2007 ) Cyclic di GMP binds to the Clp to prevent it from DNA binding and the induction of the expression of genes encoding extracellular enzymes, and genes involved in T3SS, and EPS biosynthesis (He et al. 2007). Two transcriptional factors, FhrR and Zur were identified in the transcr iptomic anal ysis of Clp regulon of X. campestris pv. campestris (He et al. 2007). FhrR controls the expression of genes encoding flagellar, T3SS and ribosomal proteins, while Zur regulates genes involved in iron uptake, multidrug resistance and detoxification (Huang et al. 2009) Transcriptome analysis of the RpfF regulon has significantly advanced understanding of the DSF me diated QS regulons in bacteria. One pioneer work done by Zhang and colleagues compared the gene expressio n profile of the rpfF mutant with the wild type strain of X. campestris pv. campestris using whole genome wide microarray analysis. In that study, 165 genes were identified as belonging to the QS regulon, which were classified into 12 functional groups inc luding genes encoding extracellular enzymes and genes involved in EPS production, flagellum synthesis, resistance to toxins and oxidative stress a nd aerobic respiration and other processes (He et al.

PAGE 31

31 2006 ) A later stu dy utilizing proteomic analysis revealed that 48 proteins were differentially regulated by QS in X. oryzae pv. orzicola 18 proteins of which were identified by mass spectrometry analysis to be involved in nitrogen transfer, protein folding, resistance to oxidative and flagellar synthesis (Zhao et al. 2011) However, c onsidering the c omplicated QS signal transduction cascade, a comprehensive understanding of the RpfC and RpfG regulons is lacking Regulators HrpG and HrpX In Xanthomonas spp., the expression of hrp gene cluster which encode s T3SS is positively controlled by regulators Hr pG and HrpX (Wengelnik and Bonas 1996; Wengelnik et al. 1996b ) HrpG is a response regulator of OmpR family and works with an unknown sensor k inase to detec t environmental signal s. Previous s tudies showed that the s ignificant induction of h rpG expression was observed only in minimal media or i n plant apoplast, rather than in rich media or on leaf surface (Wengelni k et al. 1996b ) The activated HrpG positively controls the expre ssion of h rpX whose product is an AraC type transcriptional activator. HrpX subsequently induce s the expression of hrp gene cluster (Wengelnik and Bo nas 1996) DNA affinity enrichment study revealed that HrpX binds to a conserved cis regulatory element which is present in the promoter regions of hrp operons (Koebnik et al. 2006) This element with consensus sequence ( TTCGC N 15 TTCGC ) was named the plant inducible promoter (PI P) Besides the PIP box, a nother conserved sequence element (YANNRT) is present in the 10 promoter region of most hrp operons (Ciesiolka et al. 1999; Cunn ac et al. 2004) However, a number of genes without a PIP bo x are also controlled by HrpX (Koebnik et al. 2006) indicating that PIP is not necessar y for the expression of genes in HrpX regulon.

PAGE 32

32 It seems that HrpX and HrpG not only regulate hrp genes, but also affect gene ex pression of other virulence factors, thus to coordinate the infection of the pathogen. The cDNA amplified fragment length polymorphism analysis in X. campestris pv. vesicatoria revealed that HrpG not only regulates the expression of hrp genes, but also po sitively controls T3SS effecto r and T2SS substrates. Recent studies showed that more type II secretion system (T2SS) substrate genes also belong to the HrpG and/or HrpX regulon (Furutani et al. 2004; Wang et al. 2008 ; Yamazaki et al. 2008) T2SS substrates including proteases, lipases and CWDEs might contribute to bacterial infection by degradation of the plant cell wall. Co r egulation of T3SS and T2SS may help bacteria overcome plant defenses and acquire nutrients f or growth in planta Despite the previous studies that have been performed to identify genes in the HrpG and/or HrpX regulon, no comprehensive study of the HrpG and HrpX regulons has been done in Xanthomonas spp RavS/RavR and ColS/ColR Two Component S yste ms Bioinformatic analysis of complete sequenced genomes of six Xanthomonas spp. revealed that each strain has a large number of genes encoding two component systems, which account for approximately 3% of the genome sequence in these bacteria (Qian et al. 2008a) .For instance, there are 114 genes in XCC genome encoding predicted sensor kinase and response regulators, 106 genes in X. campestris pv. campestris strains 8004 and ATCC33913, and 121 g enes in X. campestris pv. vesicatoria 85 10 (Qian et al. 2008a) B esides RpfC/RpfG (in DSF mediated QS) and response regulator HrpG that we discussed above, the well known two component system s involved in virulence of Xanthomonas spp. also include RavS/RavR, ColS/ColR.

PAGE 33

33 RavS/RavR two component system was first determine d to be involved in virulence of X. campestris pv. campestris strains ATCC33913 and XN1 (Qian et al. 2008b; He et al. 2009) The mutation of RavR orthologs resulted in decreased production of EPS and ext racellular proteases as well as reduced bacterial virulence on hosts. However, mutation of the RavR homolog in X. campestris pv. campestris strain 8004 does not affect virulence (Osbourn et al. 1990) This differen ce in virule nce suggests strain specific difference exist in the regulatory function of RavS/RavR (Qian et al. 2008b; He et al. 2009) RavS is a histidine kinase sensor containing two PAS domains in the N terminal sensor region while RavR is a response regulator containing both GGDEF and EAL domains. The presence of PAS domains in RavS suggests that RavS is involved in detection of signals from l ight, oxygen or redox potential (Hefti et al. 2004) Biochem ical analysis showed that RavR act s as an EAL domain associate d cyclic di GMP phosphodiesterase, suggesting that RavR control s virulence genes by regulating cyclic di GMP level which works similarly to RpfC/RpfG system (He et al. 2 009) Tanscriptomic analysis revealed that RavS/RavR controls more than 206 genes including hrp genes, genes involved in the productions of EPS, LPS and extracellular enzymes (He et al. 2009) Similar to the DSF mediated QS syste m, RavS/RavR system also employ s the global regulat or Clp to regulate virulence gene expression, suggesting that bacteria coordinate the production of virulence trai ts by sensing population density and environmental stimuli (He et al. 2009) ColS/ColR is another well studied two component system in Xanthomonas spp. I t was first discovered in the biocontrol bacterium P. fluorescens as a regulatory system con trolling the colonization of plant root s (Dekker s et al. 1998) Subsequently, this

PAGE 34

34 system has been found in many bacteria, particularly in plant pathogens such as P. syringae (Buell et al. 2003 ) R. solanacearum (Salanouba t et al. 2002) X. campestris (Zhang et al. 2008) X. oryzae (Lee et al. 2005) and XCC (da Silva et al. 2002; Ya n and Wang 2011) Co lS is a histidine kinase sensor containing a HAMP domain, and ColR is an OmpR type response regulator. Mutagenesis analysis conducted on XCC and X. campestris pv campestris revealed that ColS/ColR system contribute s to virulence by regulating the expressi on of genes involved in T3SS, LPS production, catalase activity and resistance to environmental stresses such as phenol, hydrogen peroxide and copper (Zhang et al. 2008; Yan and Wang 2011) Intriguingly, ColS/ColR s ystem, which is not under control of key regulators HrpG and HrpX, regulates only hrpC and hrpE operons from hrp gene clusters in both xanthomonads. This indicates that besides HrpG/HrpX, other signaling systems like ColS/ColR also partially contribute to the regulation of key virulence trait T3SS. Project Goals and Objectives The goals of this study are to identify potential virulence factors of XCC and to characterize the regulatory mechanisms underlying the coordination of gene expression in XCC for citr us canker infection. The objectives are to (1) identify and characterize avirulent mutant s from XCC Tn5 t r ansposon library; (2) characterize the HrpG and HrpX regulons using whole g enome microarray; and (3) define the DSF mediated QS regulon and the role o f QS in citrus canker disease cycle.

PAGE 35

35 CHAPTER 2 THE gal U GENE IS ESSENTIAL FOR POLYSACCHARIDE PRODUCTION, PATHOGENICITY AND GROWTH IN PLANTA OF Xanthomonas citri subsp. citri Introduction Genome sequencing of XCC has greatly advanced our understanding of the interaction between XCC and citrus. XCC encodes 4,313 genes, including 2,710 genes with assigned functions, 1,60 3 without known functions and 62 structural RNA genes (da Silva et al. 2002) About 6% of XCC genes are involved in pathogenicity, virulence, and adaptation. Even though 62.83% of the predicted open reading frames have been assigned functions, functional studies are necessary to experimentally characterize the genes related to XCC pa thogenesis and host adaptation. Transposon mutagenesis has been widely used for that purpose (Jacobs et al. 2003; Liberati et al. 2006; Salama and Manoil 2006; Laia et al. 2009) GalU is a UTP glucose 1 phosphate uridylyltransferase (s ynonym: UDP glucose pyrophophorylase), catalyzes the formation of UDP glucose fro m glucose 1 phosphate and UTP. UDP glucose is involved in synthesis of glucosylated surface structures as a substrate for glucosyltransferase, and serves as a glycosyl donor i n the enzymic biosynthesis of complex carbohydrates (Stimson et al. 1995) Mutations of the galU gene led to reduced virulence of a number of bacterial pathogens, including E. coli (Komeda et al. 1977; Ho and Waldor 2007) K. pneumoniae (Chang et al. 1996) Shigella flexneri (Sandlin et al. 1995) Actinobacillus pleuropneumoniae (Rioux et al. 1999) V. cholerea (Nesper et al. 2001) P. aeruginosa (Priebe et al. 2004) and Mesophilic A eromonas hydrophil a (Vilches et al. 2007) The reduced virulence of those galU mutants was mainly associated with the changes in lipopolysaccharides, capsular polysaccharides (CPS) or exopolysaccharides (EPS). GalU was also reported to be

PAGE 36

36 involved in adhesion of E.coli (G enevaux et a l. 1999) However, the role of the galU gene in the virulence of XCC and other plant pathogenic bacteria has not been studied. In this study, we characterized the galU gene of XC C This is part of our effort in characterizing critical genes involved in v irulence of XC C To our knowledge, it is the first report on galU for plant pathogenic bacteria. Materials and Methods Bacterial Strains and Growth M edia All the strains used in this study are listed in Table 2 1. XCC wild type 306 (rifamycin resis tant ) and mutant strains were grown in nutrient broth/agar (NB/NA) or NYG medium (Daniels et al. 1984) at 28C. E co li strains were grown in Luria Bertani (LB) medium at 37C. Antibiotics were used at the following concentrations (g/ mL ): ri famycin (Rif), 50; kanamycin (Km ), 50; ampicillin (Ap), 50; gentamicin (Gm), 5 and chloramphenicol (Cm), 35. Construction of Xanth omonas citri subsp. citri Mutant L ibrary EZ (Epicentre, Madison, WI U.S.A. ) was used to make the mutant library of XCC following t instructions. The recovered cells were diluted 500 1000 times and spread on NA plates containing Rif + Km a nd incubated at 28C for 2 3 days. Mutants were kept at 80C in 20% glycerol for future use. The mutant library was screened by pathogenicity assays (described later) on susceptible host, Duncan grapefruit ( Citrus paradisi Macf. cv. Duncan). The mutants that caused no or reduced symptoms were selected for further study.

PAGE 37

37 Rescue Cloning of Two Non Mucoid M utants Two non mucoid mutants D12 and F6 (Table 2 1) were chosen from the mutant library for further analysis based on the non pathogenic phenotype in pa thogenicity assays. To identify the insertion site of the two mutants D12 and F6, the rescue cloning method was used following the manufac Briefly, genomic DNA (1 g) of D12 and F6 transformants were digested overnight with Bam H1 and Sph 1 and end repaired (made blunt ended) using T4 DNA polymerase (New England Biolabs, Ipswich, MA, U.S.A) and 5' phosphorylat ed in order to be self ligated. The digested DNA was purified using Wizard SV Gel and PCR Clean Up System (Promega, Ma dison, WI U.S.A. ) and allowed to self ligate in the presence of T4 DNA ligase in 10 L volume for 4 hours at 16C. The ligation mix was electroporated into TransforMax EC100D pir + electrocompetent E. coli ( Epicentre ) Cells were immediately transferred in to a 17100 mm round bottom polypropylene tube which has 1 mL Super optimal broth with catabolite repression (SOC ) (Hanahan 1983) and gently mixed by pipetting. The cells were incubated for 1 h at 37C with gentle shaking and plated on LB agar containing Km Plasmid from Km resistant colonies was purified and sequenced with R6KAN 2 RP 1 and KAN 2 FP 1 primers ( Table 2 2). Sequencing was performed at Interdisciplinary Center for Biotechnology Research sequencing facility at the University of Florida. Using the genome sequence of the XCC strain (da Silva et al. 2002) trans poson insertion sites in F6 and D12 transform ants were identified by alignment of the mutated loci and the corresponding sequence of X CC 306 Nucleic Acid I solation and PCR Genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega) following the protocol for isola ting genomic DNA from bacteria. After DNA

PAGE 38

38 precipitation, the pellet was dried in a Vacufuge (Eppendorf, Westbury, NY U.S.A. ) for 5 min and dissolved in DNA rehydration solution supplied with the kit. Bacterial plasmid DNA w as isolated using Wizard miniprep DNA purification sy stem (Promega ). The concentration and purity of DNA was determined using an Agilent 8453 UV Visible spectrophotometer ( Agilent Technologies, Santa Clara, CA U S.A. ). All conventional PCR reactions were performed in a Bio Rad DNAEngine Peltier thermal cycler (Bio Rad, Hercules, CA U.S.A.). Amplification of the DNA was performed in 50 L total volumes with Taq DNA polymerase (Promega). The PCR conditions were 95C for 5 min followed by 40 cycles of 30 s of denaturation at 95C, 30 s of annealing at 52C, and 1 to 3 min of extension depending on the l ength of the amplicons at 72C. Southern Blot A nalysis For Southern blot hybridization, genomic DNA samples were purified once again (after isolation using Wizard Genomic DNA Purification Kit) using phenol:chloroform:isoamyl alcohol (25:24:1, v/v/v) and choloroform: isoamyl alcohol (24:1, v/v) following the standard molecular biology protocol (Sambrook and Russell, 2001) The DNA was precipitated, washed with 70% (v/v) ethanol and resuspended in was digested with Bgl II, subjected to electrophoresis on a 0.9% agarose gel and transferred to a positively charged nylon membrane (Roche, Indianapolis, IN U.S.A. ) according to standard procedures (Sambrook and Russell 2001) Probe generation, hybridization and chemiluminescent detection were performed using the DIG High Prime DNA Labeling and Detectio n Starter Kit II as recommended by manufacturer (Roche).

PAGE 39

39 Complementation of the galU M utants The entire galU gene with 624 bp upstream sequence and 388 bp downstream sequence was amplified from genomic DNA of XCC wild type strain 306 using PCR with primer s CGU F and CGU R which contain a Bam H1 restriction site (Table 2 2). The resulting 1.9 kb fragment was ligated to p CR 2.1 TOPO protocol (Invitrogen, Carlsbad, CA U.S.A.), resulting in pCGU1.1. From pCGU1.1 a Bam HI fragment containing the galU gene was isolated and cloned into similarly digested pUFR053 which was treated with Alkaline Phosphatase, Calf Intestinal (New England Biolabs, Ipswich, MA U.S.A. ) (El Yacoubi et al. 2007) resulting in pCGU2.1 (Table 2 1). The plasmid pCGU2.1 was transferred into the galU m utants D12 and F6 ( galU :Tn5) by triparental mating with helper E. coli strain containing pRK2013 (Swarup et al. 1991) The transconjugants were selected o n NA with Rif and Gm. The presence of pCGU2.1 was verified using PCR. Complementation assays were conducted for EPS and CPS production, mucoid phenotype on NA medium, pathogenicity, and growth of the galU mutant in planta using p lasmid pCGU2.1 containing a n intact galU gene. Empty vector pUFR053 without the galU gene was used as control. Quantitative Determination of EPS P roduction For measurements of the quantity of EPS in culture supernatants, bacterial cells were grown in NB supplemented with 2% D glucos e at 28C for 24 h with shaking at 200 rpm. Then 10 mL of cultures were taken and cells were removed by centrifugation (5000g for 20 min). Three volumes of 99% ethyl alcohol w ere added to the supernatants. The precipitated EPS was pelleted by centrifugat ion, dried and weighed (Vojnov et al. 1998) Three independent replicates were used for each strain. The test was performed three times independently and only results from one test were shown.

PAGE 40

40 Capsule A ssays Ba cteria were grown at 28C on N A with appropriate antibiotics. Samples were prepared by mixing and spreading a loop of bacteria with one drop of distilled water on a preclea ned slide, and air dried. The sample was stained with 1% crystal violet and washed w ith 20% copper sulfate supplied with the capsule stain kit ( Eng Scientific Inc., Clifton, NJ U.S.A. ) photographed using a light microscope Leica DMLB2 (Leica Microsystems Wetzlar GmbH, Germany) u nder oil immersion lens at 1000 magnification. LPS A ssays Bacteria were grown overnight at 28C in NB, M9 glucose medium (Clowe s and Hayes 1968) or XVM2 medium (Wengelnik et al 1996a ) Ten mL cultures were harvested at the exponential phase of growth and pelleted. LPS was isolated and treated with proteinase K (Nesper et al. 2000) and then separated by sodium dodecyl sulfate polyacrylamide g el electrophore sis (SDS PAGE). Briefly, LPS samples were mixed with an equal volume of Laemmli sample buffer, pH 6.8, containing 62.5 mM Tris HCl, pH 6.8, 2% SDS, 25% glycer ol, and 0.01% bromophenol blue. The mixtures were boiled for 5 min, and 20 L samples were loaded on precast Ready Gel Tris HCl polyacrylamide gels (86 mm 68 mm 1.0 mm) containing 4 and 15% acrylamide in the stacking and separating gels, respectively (Bio Rad Laboratories, Inc., Hercules, CA U.S.A. ). Electrophoresis was performed at 12 mA in the s tacking gels and 25 mA in the separating gels until the bromophenol blue was 1 cm above the bottom of the gel. Immediately after electrophoresis the gel was stained using silver stain kit (Bio Rad Laboratories).

PAGE 41

41 B iofilm A ssays Biofilm formation was quantif ied in borosilicate glass tubes as described previously (Pratt and Kolter 1998) Bacteria were grown in NB under shaking to mid exponential growth and the n diluted 1:10 in fresh NB containing appropriate antibiotics. One mL of diluted bacterial suspension was placed in each borosilicate glass tube (Fischer Scientific, Pittsburgh, PA U.S.A. ) and incubated without shaking for 48 h at 28C. Culture media were poured out, and attached bacterial cells were gently washed three times with distilled water, incubated at 60C for 20 min, and then stained with 1.5 mL 0.1% crystal violet for 45 min. The unbou nd crystal violet was decanted and th e wells were washed wit h water. The crystal violet stained cells were solubilized in 1.5 mL of ethanol acetone (80:20, v/v). Biofilm formation was quantified by measuring absorbance at 590 nm using Agilent 8453 UV Visible spectrophotometer. Ten replicates were use d for quantita tive measurement. Pathogenicity Assays on P lant s Pathogenicity assays were conducted in a quarantine greenhouse facility at Citrus Research and Education Center, Lake Alfred, FL U.S.A Assays were performed using fully expanded, immature leaves of Duncan grapefruit. XCC wild type and mutant strains used in this assay were grown under shaking conditions at 28C for overnight in NB and were suspended in sterile tap water and the concentrations were adjusted to 10 8 CFU/ mL For the pathogen icity assays, bacter ial suspension s of both 10 8 and 10 5 CFU/ mL were injection infiltrated into leaves with a needleless syringe (Viloria et al. 2004; Ryb ak et al. 2009) The test was repeated three times with similar results. Disease s ymptoms were photographed 5, 10, and 1 2 days post inoculation (DPI).

PAGE 42

42 Bacterial Growth A ssays in P lanta For bacterial growth assays in the intercellular spaces of citrus leaves, the concentration of starting inoculum was 10 6 CFU/ mL and whole leaves were ino culated by infiltration of the abaxial leaf surface with needleless syringe as described above. For co inoculation, wild type 306 and D12 were mixed together (1:1) before inoculation. Briefly, bacterial cell counts were performed in four biological replica tions at each sampling time point (0, 1, 2, 3, 4, 6, 8, or 10 DPI). Leaf disks from inoculated leaves were excised with cork borer (1 cm 2 leaf area), which then were ground in 1 mL sterile tap water. The samples were serially diluted and plated on NA plate s with appropriate antibiotics. The colonies were counted 48 hr after plating. The growth assays in planta were repeated three times independently with four replicates each time, but only one exp eriment was represented here. RNA Extraction and Quantitative Reverse T ranscription PCR (QRT PCR) Bacteria were grown in XVM2 medium at 28C with shaking at 200 rpm and 1 mL samples of culture were collected for XCC wild type and D12 at 13 hrs after inoculation. RNA was stabilized immediately by mixing with two volu me of RNAprotect bacterial reagent (Qiagen, Valencia, CA U.S.A. ) and incubated at room temperature for 5 min. Bacterial cells were centrifuged at 5000g for 10 min and cell pellets were stored at 80C prior to RNA extraction. Cell pellets were treated w ith lysozyme and RNA extractions were performe d using RNeasy mini kit (Qiagen ). Contaminated Genomic DNA was removed from RNA by treatment with a TURBO DNA free TM kit (Ambion, Austin, TX U.S.A. ). The concentration of RNA was determined with NanoDrop ND 1 000 spectrophotometer

PAGE 43

43 (NanoDrop technologies, Wilmington, DE U.S.A. ) and adjusted to 50 ng/ L for QRT PCR. Fifteen target genes were chosen for expression study with 16S rRNA as the endogenous control and the primers listed in Table 2 3 were designed from sequences on XCC genome using DNASTAR software (DNASTAR, Inc., Madison, WI U.S.A. ). One step QRT PCR was conducted on a 7500 Fast Real Time PCR System (Applied Biosystems, Inc., Foster City, CA U.S.A. ) using Quantitect TM SYBR Green RT PCR kit (Qiagen). The total reaction volume of one step QRT PCR was 25 L and contained 2 QuantiTect TM SYBR Green RT PCR Master Mix (12.5 L ), 10 M gene specific primers (1.25 L ), QuantiTect TM RT Mix (0.5 L ), and 50 ng of RNA template (1 L ). The reaction was incubat ed at 50C for 30 min, and at 95C for 15 min, cycled (40 times) at 94C for 15 s, 53C for 30 s, and 72C for 30 s. The melting curve analysis was applied to verify the specificity and identity of QRT PCR products. Three biological repeats were used for e ach strain. QRT PCR was repeated once with another three independent biological repeats. Totally, six independent biological repeats were used for each strain. The amount of fluorescence as a function of PCR cycle was plotted using 7500 Fast System SDS sof t ware and the threshold cycle (C T ) values for each gene were C T values of each target gene were calculated by subtracting the C T values of 16S rRNA (the endogenous control) from the C T values of the target genes. C T values of each gen e for D12 and wild type were subjected to simple t test using C T values of target genes for D12 were yielded using wild type as calibrator as described previously (Yuan et al. 2006) The relative quantification of

PAGE 44

44 target gene expression of D12 in XVM2 medium was generated using the formula 2 T as relative fold change in the transcript level with respect to the gene transcript level expression of wild type. Results Generation of the galU M utants of XC C Two non mucoid XCC mutants, F6 and D12 were selected from the XCC EZ Tn5 library. Comp ared to wild type 306 strain, the colonies of F6 and D12 on NA plates were smaller and less viscous. However, their growth rate was indistinguishable from wild type strain in NB broth (data not shown). The sites of transposon insertion in F6 and D12 mutan ts were determined by rescue cloning. Sequencing results indicated that EZ Tn5 was inserted between nucleotides 235 236 in D12 and between nucleotides 665 666 in F6 downstream of the translation start site (Fig ure 2 1A). The insertion of EZ Tn5 in the galU gene was confirmed by PCR analysis. PCR with gene specific primers ( galU F1+ galU R1) targeted the amplification of interior region of galU (Table 2 2). This resulted in a 0.84 kb amplicon with XCC 306 genomic DNA as template but produced approximately 2.8 kb amplicons with F6 and D12 as templates due to the insertion of the 1.938 kb EZ Tn5 transposon (Fig ure 2 1B). In addition, F6 and D12 transformants were confirmed to have a single copy of EZ Tn5 using Southern blot analysis (Fig ure 2 1C). Southern blot an alysis showed a DIG labeled 675 bp Kan2 DNA fragment hybridizing to a 7.3 kb band of D12 and to a 2.8 kb band of F6. The size difference of bands hybridized for D12 and F6 resulted from difference in the relative distance and location of the transposon insertion sites from the restriction site of Bgl II, which was used for digestion of the genomic DNA, in the galU gene. For D12, EZ TN5 (1.938 kb) was inserted into a Bgl II

PAGE 45

45 galU gene. For F6, EZ TN5 (1.938 kb) was inserted into a Bgl galU gene. Consequently, a 7.3 kb band and a 2.8 kb band were hybridized for D12 and F6, respectively. This confirmed the insertion of a single copy of EZ TN5 in the genomes of both F6 a nd D12 (Fig ure 2 1C). No hybridization was observed to the genomic DNA of XCC 306 wild type strain using the Kan2 probe. The galU Gene Involvement with Polysaccharide B iosynthesis In order to study the role of the galU gene in polysaccharide biosynthesis the major polysaccharides of XC C EPS, CPS, and LPS were investigated. Only one galU mutant, D12, was described here since no difference was observed between t he two galU mutants D12 and F6. Significant difference in EPS production was observed between X CC wild type (1.325 mg/ mL ) and D12 (0.012 mg/ mL ). Complementation with the plasmid pCGU2.1 containing the entire galU gene restored EPS p roduction of D12 (1.725 mg/ mL ). The empty vector pUFR053 did not affect EPS production (0.0175 mg/ mL ). D12 and wild typ e strains were stained using capsule stain kit and observed under microscope. XCC wild type strain was covered with capsule while capsule appeared to be absent in the galU mutant (Fig ure 2 2A). Complementation with plasmid pCGU2.1 restored the CPS phenoty pe of the D12 to wild type level. The empty vector pUFR053 did not complement the CPS production of D12 (Fig ure 2 2A). With proteinase K treatment, LPS pattern of the galU mutant strain was indistinguishable from that of wild type strain when they grew in NB, M9 glucose o r XVM2 medium (data not shown). The mucoid phenotype of D12 strain was restored to that of the wild type colonies on NA by complementation with plasmid pCGU2.1 but not with the empty vector pUFR053 (data not shown).

PAGE 46

46 The galU Gene Involvemen t with Biofilm F ormation Because of the significant effect of the galU gene on polysaccharide production, the galU gene was hypothesized to be involved in biofilm formation. As shown in Fig ure 2 2B, less biofilm was observed for the galU mutant compared to wild type strain. 10 replicates were used for quantitative measurement of biofilm. The absorbance of the crystal violet in biofilm staining ass ay of wild type strain (OD 590 = 0.811 0.083) was 12.5 times greater than that of the galU mutant strain D12 (O D 590 = 0.065 0.011). The biofilm formation of the D12 mutant strain was restored by complementation with plasmid pCGU2.1 containing the intact galU gene (OD 590 = 1.753 0.063) but not with the empty vector pUFR053 lacking the galU gene (OD 590 = 0.040 0.013). Pathogenicity A ssays Pathogenicity assays indicated that neither F6 nor D12 elicited a reaction on grapefruit while wild type strain caused typical necrotic raised lesions typical of citrus canker on the leaves at a high bacterial inoculation conc entration of 10 8 CFU/ mL (Fig ure 2 3A). Similar results were observed for bacterial inoculation at a lower concentration of 10 5 CFU/ mL (data not shown). Complementation with plasmid pCGU2.1 containing the entire galU gene restored the pathogenicity of D12 a nd F6 mutants and caused similar symptoms as wild type on grapefruit (Fig ure 2 3A). The empty vector pUFR053 without the galU gene did not complement the pathogenicity of both F6 and D12 and no symptoms were observed for both mutants on grapefruit leaves ( Fig ure 2 3A). Effects of M utation of the galU Gene on Gene Expression of Key Virulence G enes Loss of pathogenicity could result from down regulation of key virulence genes. In order to test whether mutation of the galU gene affect gene expression of key v irulence genes, QRT PCR assays were cond ucted. XVM2 medium is reported to mimic the

PAGE 47

47 environment of plant intercellular spaces and most virulence factors of Xanthomonas spp. can be induced in this medium (Wengelnik et al. 1996a ; Astua Monge et al. 2005 ) Therefore, D12 and wild type strains were grown in XVM2 medium, s ampled at exponential phase and compared for the expression of 15 genes at transcription level using QRT PCR. The 15 target genes include d genes encodin g enzymes involved in EPS and CPS biosynthesis, and virulence factors, such as type III secretion system ( T3SS ), effector proteins, and cell wall degrading enzymes (CWDE). For QRT PCR, the T C T values are more appropriate subjects for statistical a nalysis (Yuan et al. 2006) test was p C T of D12 and wild type strains C T values of target genes for D12 were yielded using wild type strain as calibrator. Table 2 4 shows that five genes were not differentially expressed in D12 and wild type strains when grown in XVM2, including three CWDE genes ( XAC 0160, celD and pglA ), kpsF for CPS biosynthesis, and one T3SS effector pthA However, the expression of seven genes was significantly up regulated in D12 compared to the wild type strain, including two avirulence genes ( avr X AC E1 and avrBs2 ), one T3SS component hrcV two T3SS regulator genes ( hrpG and hrpX ), one CWDE gene ( peh 1 ) and gumB for EPS synthesis. Three genes encoding for CWDEs ( XAC 0028, pelB and XAC 0165) were significantly down regulated at transcription level in D12 compared to the wild type strain. In Planta G rowth of the galU M utant Since mutation of the galU gene did not impair most key virulence genes of XC C loss of pathogenicity of the galU mutant was hypothesized to be due t o the lack of growth in planta. To t est this hypothesis, wild type and D12 mutant strains were tested for their growth in grapefruit leaves. Although no differences were observed between

PAGE 48

48 wild type and the galU mutants in the ability to grow in NB medium (data not shown), growth of the galU mutant D12 was significantly reduced in planta co mpared to the wild type strain. The wild type strain population increased to 410 8 CFU/cm 2 at 10 DPI, compared to a population of 610 2 CFU/cm 2 for the galU mutant D12 in planta (Fig ure 2 3B ). Strain D12 wit h complementation plasmid pCGU2.1 containing the entire galU gene grew to the same population level as the wild type in planta (Fig ure 2 3B). The empty vector pUFR053 without the galU gene did not restore the growth of D12 in planta To characterize whethe r wild type strain XCC affected the growth of the galU mutant in planta, wild type and D12 strains were co inoculated into grapefruit leaves as described previously. Co inoculation of wild type strain with D12 strain did not affect the growth of D12 in pla nta compared to D12 alone (Fig ure 2 3C). Discussion Multiple genes including galETKM galU and galR are involved in formation of the sugar nucleotide precursors, UDP galactose and UDP glucose for polysaccharide synthesis. The galETKM genes normally form an operon while galU and galR genes are no t clustered in the genome (Genevaux et al. 1999) The knockout of those genes affects the outer membrane properties of bacteria, and virulence to hosts in K. pneumoniae (Chang et al. 1996) Streptococcus pneumoniae (Mollera ch et al. 1998) and E. coli O157:H7 (Ho and Wa ldor 2007) In this study, a galU mutant of XCC was characterized for effects on synthesis of major polysaccharides, pathogenicity, and grow th in the intercellular spa ces. Apparently, t he galU gene in XCC is involv ed in EPS, and CPS production. This is consistent with the critical role of the UTP glucose 1 phosphate uridylyltransferase, which is responsible for synthesis of UDP glucose from

PAGE 49

49 glucose 1 phosphate and UTP a nd galactose and glucose interconversion through the Leloir pathway and plays a pivotal role in carbohydrate metabolism in different organisms (Frey 1996) The phenotype apparently resulted from mutation of the galU gene rather than ma lfunction of downstream genes. The galU gene is the last gene of one operon containing XAC 2295 encoding one hypothetical protein, XAC 2 294 encoding a lipopolysaccharide core biosynthesis protein, XAC 2293 encoding a dehydratase, and the galU (da Silva et al. 2002) The intergenic space between the galU and the downstream gene kefB is 174 bp. The gal U gene and the downstream kefB gene were predicted to belong to different operons based on operon prediction using SOFTBERRY (Softberry, Inc.). Thus, transposon mutation of the galU gene would not affect the function of the kefB gene Plus, defects of EPS production, mucoid phenotype, pathogenicity, and growth in planta of the galU mutant were complemented to wild type level using p lasmid pCGU2.1 containing an intact galU gene but not with the vector pUFR053 without the galU gene. The mutation of the galU gene blocks the EPS and CPS polysaccharides biosynthesis in XCC. Both EPS and CPS polysaccharides are important componen ts of bacterial outer surface. Capsular polysaccharides are linked to the cell surface while EPS molecules appear to be released onto th e cell surface with no visible means of attachment and form an amorphous layer of outer surface (Roberts 1996) The EPS produced by xanthomonads, xanthan, consists of repeating penta saccharide units with the mannose glucuronic acid 1,2) mannose 1,3) cellobiose structure (Jansson et al. 1975) Three sugar nucleoti des, UDP glucose, UDP glucuronic acid and GDP mannose, are required precursors for EPS synthesis. UDP glucose is the

PAGE 50

50 substrate for UDP glucuronic acid synthesis and also affects the intercellular concentration of UDP galatose (3). Mutation of the galU gene eliminated the synthesis of one of the major precursors, UDP glucose, and may also affect UDP glucuronic acid, for EPS synthesis in XCC. Therefore, EPS production is deficient in the galU mutant of XCC. Likewise, the deficiency of the major sugar nucleoti de precursor, UDP glucose, maybe UDP galatose and UDP glucuronic acid, resulting from mutation in GalU function, also accounts for the defect in CPS polysaccharide of the galU mutant. Previous study also indicates that GalU is involved in EPS and CPS polys accharides synthesis (Mollerach et al. 1998; Mollerach and Garca 2000; Boels et al. 20 01; Lai et al. 2001) The lack of pathogenicity of the galU mutant results from its inability to grow in planta rather than from its effect on virulence genes. In order to understand why the galU mutant lost pathogenicity, we first investigated the effect of the galU gene on the expression of genes encoding EPS and CPS biosynthesis proteins, and key virulence factors, such as type III secretion system ( T3SS ), effector proteins, and cell wall degrading enzymes (CWDE s ). Among them, t he T3SS effector PthA is the pathogenicity determinant for XCC required to cause canker symptoms on hosts (Brunin gs and Gabriel 2003) The gene expression of pthA remained the same level in the galU mutant as in wild type strain. Overall, non e of the virulence genes tested in this study showed reduced gene expression in the galU mutant except three CWDE genes whose involvement in virulence is still unknown in XCC. Growth assays indicate that the galU mutant grew poorly in the intercellular env ironment (Fig ure 2 3). This is probably due to deficiency in EPS and CPS polysaccharides synthesis which have been shown

PAGE 51

51 to act as a barrier to stress conditions (Roberts 1996) Caps ular polysaccharides have been reported to be essential for growth of the Erwinia amylovora in planta (Bugert and Geider 1995) Capsule like structures around XCC were demonstrated in infected Mexican lime and Yuzu leaves by transmission electron microscopy (Lee et al. 2009) Interestingly, co inoculation of wild type strain with D12 strain did not rescue the growth of D12 in planta Erwinia amylovora exop olysaccharide amylovoran mutants can be rescued by wild type strains presumably by enveloping the mutant in a biofilm ( Koczan et al. 2009) Apparently, the mechanism that the growth of the galU mutant was impaired i n planta was different from that of the amylovoran mutants of E. amylovora and remains to be explored. Interestingly, GalU represents a potential target for antimicrobial compounds screening to control citrus canker disease. Since GalU is required for XCC growth in planta, antimicrobial compounds inhibiting its activity should potentially render XCC vir tually avirulent. In addition, prokaryotic UTP glucose 1 phosphate uridylyltransferases appear to be completely unrelated to their eukaryotic counterparts an d have totally different structures even though they have almost identical catalytic properties (Hossain et al. 1994) This interesting feature suggests that putative antimicrobial inhibitors of GalU might not be harmful for human and the citrus host. In summary, our data provide insights of the roles of the galU gene in EPS, and CPS production as well as biofilm formation of XCC. Our study also suggests that the galU gene plays a pivotal role for XCC growth in the intercellu lar spaces of citrus leaves

PAGE 52

52 Table 2 1 Bacterial strains and plasmids used in this study Strain or plasmid Relevant characteristics Reference or source Strains E. coli F lac lac X 74 hsd R (r K m K + rec A 1398 end A 1 ton A Invitr ogen TransforMax EC100D pir + F mcr A hsd RMS mcr BC lac Z lac X 74 rec A 1 end A 1 ara D ara, leu )7697 galU gal K rps L nup G pir + (DHFR) Epicentre HB101 F supE 44, hsdS 20( r B m B ), recA 13, ara 14, proA 2, lacY 1, galK 2, rpsL 20, xyl 5, mtl 1, l euB 6, thi Boyer and Roulland Dussoix 1969 X. citri subsp citr i 306 Rif r c auses citrus canker on citrus da Silva et al. 2002 D12 galU :Tn5 derivative of strain 306, Rif r Km r This study F6 galU :Tn5 derivative of strain 306, Rif r Km r This study CD D12 containing pCGU2.1, Km r Cm r Gm r This study CF F6 containing pCGU2.1, K m r Cm r Gm r This study Plasmids pCR 2.1 TOPO TM PUC ori f1 ori lacZ + Km r Ap r Invitrogen pRk2013 ColE1 Km r Tra + conjugation helper plasmid Ditta et al. 1980 pUFR053 IncW Mob + mob (P) lac + Par + Cm r Km r shuttle vector El Yacoubi et al. 2007 pCGU1.1 galU gene from XCC 306 cloned in pCR 2.1 TOPO TM This study pCGU2.1 ga lU gene on Bam HI fragment from pCGU1.1 cloned in pUFR053 This study

PAGE 53

53 Table 2 2 Primers used in this study Primer a galU F1 AGACAGTGCCGAAAGAAATGCTGC galU R1 AACAGCGATCAGGCAACAATCAGC Kan2 F1 CGAGGCCGCGATTAAATTCCAACA Kan2 R1 AGGCAGTTC CATAGGATGGCAAGA KAN 2 FP 1 ACCTACAACAAAGCTCTCATCAACC R6KAN 2 RP 1 CTACCCTGTGGAACACCTACATCT CGU F AATGATggatccCTGCCAAAGCCTTGACGC CGU R AACAGAggatccAACATCACCACGCCCAAC a Lowercase nucleotides are not e xac t matches to the sequence and were introduced to a dd restriction enzyme site Bam H1.

PAGE 54

54 Table 2 3. Genes and corresponding primers for QRT PCR analysis Gene Product function a Component or protein Primer direction b c 16S rRNA R ibosome component F CGCTTTCGTGCCTCAGTGTCAGTGTTGG R GGCGTAAAGCGTGCGTAGGTGGTGGTT hrpG T3 SS T3SS regulator F GCCTTTCAATTCGCACGAGTTACACG R CACACGCCGGGGCTGGAAAAGA hrpX T3SS T3SS regulator F AGCGATCTCTGCGTTGTCCTAC R ATACGCATCTTCGGCCTCTTCCTGA hrcV T3SS T3SS component F GCGTTTGCGGCGTGCTTCATCT R CAATCTGGTGGTAGGCCTGGTCGTTTTCTT pthA T3SS T3SS effector F TGGCGTCGGCAAACAGTGGTC R TGCTCCGGGGTCAGGTTCAGG avrBs2 T3SS A virulence protein F CGCGCCAATCACGACAAGGACTACTAC R CGGGCCAGCGTGCGGTTTTC avr X ac E1 T3SS A virulence protein F TCGCGCTGGGCCGGAACATACC R GCGTCCGCGGCGATAACTCTTG XAC 0028 CWDE C ellulase F CGCTCCACGCTGCTTTTCAT R ATTCGGCACCGGACAGATTG XAC 0160 CWDE X ylanase F CATGGCCTGGCGGTCCTTGTGCT R GCGCGATCCGGCT GGCTTGTTC XAC 0165 CWDE X ylosidase F AGGGCGGGGCGTTGCTGTTCTAC R TCTTGCCGTCGGGACTGCTGTGA peh 1 CWDE E ndopolygalacturo nase F AGTGGCAACGCGTTTCTGACC R CGCCTGCGTTGTTGCCCTTGAC celD CWDE G lucan 1, 4 beta glucosidase F GATTTCGGCCGAGCGTCTGGA R GGATGCCG GCCTGGTTCTTCA pglA CWDE P olygalacturonase F CAGCGCCGACGTCACCTTGTA R GTAGCCGGGACGCGAATAGACC pelB CWDE P ectate lyase II F GAACTTCGGCGTGCGTGTGGTG R GTGAGCGAGGCGAAGATGGTGTTGTGGTC gumB EP S Polysaccharide exporter F CTGACCGAAATCGAGAAGGGCACCAATC R GCGCCACACCATCACAAGAGGAGTCAGTTC kpsF CPS Arabinose 5 phosphate isomerase F GCTTCACCGCCGACGACTTC R CGCTTGCGGCTCATTTCCATC a T3SS : type III secretion system; CWDE: cell wall degrading enzymes; EPS: extracellular polysaccharides; CPS: capsular polysacchar ide. b F: Forward; R: Reverse. c The primers are derived from internal sequences of corresponding genes

PAGE 55

55 Table 2 4. Comparison of gene expression of key virulence genes in the wild type and the galU mutant culturing grown in XVM2 using QRT PCR Gene Mean C T a SD 95% C onfidence interval P b Fold change c hrpG 1.6804 0.5275 2.3590, 1.0018 0.0003* 3.2052 hrpX 2.1666 0.5206 2.8363, 1.4968 < 0 .0001* 4.4896 hrcV 2.0417 0.4961 2.6799, 1.4035 < 0 .0001* 4.1173 pthA 0.2077 0.3894 0.7086, 0.2933 0.3774 1 .1548 avrBs2 2.1722 0.6046 2.9499, 1.3944 < 0 .0001* 4.5071 avr X ac E1 2.4682 1.0118 3.7699, 1.1665 0.0018* 5.5335 XAC 0028 2.2138 0.7257 1.2802, 3.1474 0.0004* 0.2156 XAC 0160 0.5413 1.3596 1.2078, 1.2903 0.5062 0.6872 XAC 0165 1.2379 0.3362 0.8054, 1.6705 < 0 .0001* 0.4240 peh 1 2.8464 0.9095 4.0164, 1.6764 0.0003* 7.1920 celD 0.4748 1.0723 0.9047, 1.8542 0.4609 0.7196 pglA 0.5460 0.8444 1.6322, 0.5402 0.2889 1.4600 pelB 1.2397 0.2500 0.9182, 1.5613 < 0 .0001* 0.4235 gumB 0.9043 0.5975 1.673 0, 0.1356 0.0255* 1.8716 kpsF 0.3704 0.9612 1.6069, 0.8661 0.5196 1.2927 a The mean C T was determined using six biological replicates. b Values are significant ly different when P is <0.05 c T he fold change in expression in D12 was calculated using 2 C T

PAGE 56

56 Figure 2 1. Sequence analysis of EZ Tn5 insertion in the galU mutants. A ) Genomic location of galU on the XCC chromosome and transposon insertion sites in the galU mutants. kefB encodes a transport protein, galU encodes a UTP glucose 1 pho sphat e uridylyltransferase, and XCC2293 encodes a dehydratase protein. Bg, Bgl II restriction site. B ) PCR analysis confirming insertion of EZ Tn5 into the galU gene: agarose gel electrophoresis of DNA amplified using primers galU F1 and galU R1 targeting the in terior region of the galU gene from XCC wild type 306, D12, and F6 strains. Lane 1, Invitrogen 1 Kb Plus DNA size marker; lane 2, D12, lane 3, F6, lane 4, XCC strain 306. C) Southern blot of DNA of XCC wild type strain 306 and galU mutants F6 and D12 diges ted with BglII. The membrane was probed with a 675 bp kan 2 gene fragment that was amplified using PCR with primers Kan F1 and Kan R1. W wild type.

PAGE 57

57 Figure 2 2 Effects of galU on the caps ular polysaccharide and biofilm formation. A) Capsule stained XC C strains observed with a light microscope (magnification, 1,000). B) Biofilm formation by XCC strains as determined using crystal violet staining.

PAGE 58

58 Figure 2 3. Pathogenicity assays and growth of XCC strains in planta All strains were infiltrated into l eaves with needleless syringes. A) Host responses of Duncan grapefruit inoculated with XCC strains. B) Growth of XCC wild type strain 306, galU mutant D12, CD (complemented mutant D12), and D12/pUFR053 ( D12 with empty vector pUFR053 in grapefruit leaves ) C) Growth of coinoculated XCC wild type strain 306 and galU mutant D12 in grapefruit leaves. wild type strain 306; D12; CD ; D12/ pUFR053. The in planta growth assays were repeated three times independently with four replicates each time, but the res ults of only one experiment are shown. The error bars indicate the standard errors of the means.

PAGE 59

59 CHAPTER 3 H rp G AND H rp X PLAY GLOBAL ROLES IN COORDINATING DIFFERE NT VIRULENCE TRAITS OF Xanthomonas citri subsp. citri Introduction The genus Xanthomonas is an important group of Gram negative plant pathogenic bacteria, which infects approximate ly 124 monocotyledonous and 268 dicotyledonous plants (Leyns et al. 1984; Chan and Goodwin 1999) This genus has become an important model organism for studying plant microbe interaction and for understanding bacter ial pathogenicity and virulence mechanisms (Buttner and Bonas 2010) Among the diseases caused by membe rs of the genus Xanthomonas citrus canker is one of the most serious diseases of most commercial citrus cultivars resulting in significant losses worldwide. Citrus canker is caused by Xanthomonas citri subsp. citri ( XC C ) (Cubero and Graham 2002; Schaad et al. 2006; Vauterin et al. 1995 ) XCC infects cit rus from rain splashed inoculums introduced directly through stomata or by wounds and grows in th e intercellular spaces of the spongy mesophyll ( Graham et al. 2004 ). Tremendous progress has been made regarding pathogenicity and virulence mechanisms of Xanthomonas The major genes involved in pathogenicity and virulence of Xanthomonas include type II I secretion system (T3SS) genes, genes encoding cell wall degrading enzymes (CWDEs), toxins, bacterial adhesins and surface structural elements, and rpf (regulation of pathogenicity factors) genes (da Silva et al. 20 02) Bacteria coordinate their virulence factors to overcome plant defenses, and manipulate the host for their survival in intercellular spaces. The hrpX gene, an AraC type transcriptional activator, and hrpG an OmpR family regulator, have been shown to be critical to the virulence of Xanthomonas and regulation of T3SS (Wengelnik and Bonas 19 96; Wengelnik et al. 1996b ) The T3SS and effectors secreted are critical for

PAGE 60

60 pathogenicity a nd initiation of many diseases. Xanthomonas hrp cluster encodes more than 20 proteins which together function to inject effectors across the bacterial membrane and directly into host cells ( B ttner and Bonas 2002; Brunings and Gabriel 2003) The expression of some structural genes of the T3SS and effector genes is regulated by HrpX (Wengelnik and Bonas 199 6) Expression of hrpX is activated by HrpG as reported for X. campestris pv. vesicatoria (Wengelnik et al. 1996 b ) It seems that HrpX and HrpG not only reg ulate T3SS and effector genes, but also affect gene expression of other virulence factors, thus to coordinate infection by the pathoge n. Recent studies showed that some type II secretion system (T2SS) substrate genes also belong to the HrpG and/or HrpX regulon (Furutani et al. 2004; Wang et al. 2008; Yamazaki et al. 2008) T2SS substrates includin g pr oteases, lipases and CWDEs may contribute to bacterial infection by degradation of the plant cell wall. Co regulation of T3SS and T2SS helps bacteria overcome plant defenses and acquire nutrients for growth in planta Although a few studies have been performed to identify genes in the HrpG and/or HrpX regulon, no comp rehensive study has been done with Xanthomonas spp In this study, we designed a genome wide XCC oligonucleotide microarra y for transcriptome analysis of the HrpX and HrpG regulons. Based on the microarray results, we expanded the knowledge of the HrpX and HrpG regulons with genes related to more functions such as chemotaxis and flagellar biosynthesis, transport, and a large set of unknown genes besides T3SS effector, and T2SS substrate ge nes We also found a cross talk between HrpG regulatory cascade and quorum sensing.

PAGE 61

61 Materials and Methods Strains and Growth C onditions All of the strains used in t his study are listed in Table 3 1 XCC hrpG mutant was generated in this study as described below and the hrpX mutant was generated and confirmed as described in the previous study (Figueiredo et al. 2011) Wild type strain 306 (rifamycin resistant) (da Silva et al. 2002) and mutant strains were grown in nutrient broth (NB), on nutrient agar (NA), or in NYG medium (Danie ls et al. 1984) at 28C. Escherichia coli strains were grown in Luria Bertani (LB) medium at 37C. Antibiotics were used at the following concentrations: rifamycin (Rif), 50 g/ mL ; kanamycin (Km ), 50 g/ mL ; ampicillin (Ap), 50 g/ mL ; spectinomycin (Sp), 50 g/ mL ; gentamicin (Gm), 5 g/ mL ; and chloramphenicol (Cm), 35 g/ mL Generation of the hrpG M utant The 1 ,180 bp kanamycin resistance gene kan R was isolated from pBSL15 plasmid by E co RI digestion, and ligated with similarly digested pGEM T easy vector. The plasmid was named pUSS01 1 when the kanR and lacZ are in the same transcription direction, and the plasmid was named pUSS01 2 when they are not in the same transcription direction. The pUSS01 2 was chosen for further manipulation. The 693 bp upstream region of hrpG (86 hrpG ) was amplified using genomic DNA of XCC 306 as template and primers AChrpG Nd e1F3 and AChrpG NSi1R2 (Table 3 2 ), and then cleaved with Nde I Nsi I. The Nde I Nsil I fragment was ligated into similarly digested pUSS01 2. The resulting construct was named as phrpGDV1 contains the upstream sequence of hrpG at downstream of Km. The 834 bp fragment containing 436 bp region downstream of and 398 bp of c oding region of hrpG was obtained by Apa I Sph I digestion of the 1 ,200 bp fragment amplified using genomic DNA

PAGE 62

62 of XCC 306 as template and primers AChrp G Apa1F2 and AChrpG R1 (Table 3 2 ). Then the 834 bp fragment was cloned into phrpGDV1 am of Km, which resulted in the construct phrpGDV1 carrying a mutated hrpG fragment consisting of Km cassette flanked by hrpG upstream and downstream fragments. The hrpG disruption fragment was cleave d out with Bam HI from phrpGDV1 and ligated with Bam HI cu t p OK1. The resulting recombinant construct, named as phrpGDV2, was transformed into E. coli (Huguet et al. 1998 ) and subsequently transformed into XCC 306. Transconjugants were selected on NYG medium supplemented with Rif and Sp. Positive colonies were replicated on both NA plates supplemented wi th 5% (w/v) sucrose, Sp and Rif, and NA with only Rif. The sucrose sensitive colonies were selected from NA Rif plate and dilution plated on NA containing Rif, Km and 5% sucrose to select for resolution of the construct by a second cross over event. The re sulting hrpG mutant was confirmed by PCR analysis with three pairs of primers, AChrpG Kpn1F4 and AChrpG Kpn1R4, AChrpG Apa1F2 and AChrpG SphR3, AChrpG F1 and AChrpG Nsi1R2 (Table 3 2 ). Complementation of the hrpG M utant The entire hrpG gene with 738 bp ups tream sequence and 399 bp downstream sequence was amplified from genomic DNA of XCC wild type strain 306 using PCR with primers AChrpG Kpn1F4 and AChrpG Kpn1R4 which contain a Kpn I restriction site (Table 3 2 ). The resulting 1 ,929 bp fragment was ligated t o PCR 2.1 TOPO following U.S.A. ), resulting in phrpG. From phrpG, a Kpn I fragment containing the hrpG gene was isolated and cloned into similarly digested pUFR053 which was treated with calf intestina l alkaline phosphatase (New England Biolabs, Ipswich, MA) (El Yacoubi et al. 2007) resulting in phrpGC. The

PAGE 63

63 plasmid phrpGC was transferred into the hrpG mutant by triparental mating with a helper E. coli strain co ntaining pRK2013 (Swarup et al. 1991) The transconjugants were selected on NA with Rif and Gm. The presence of phrpGC was verified using PCR. Pathogeni city A ssay Pathogenicity assays were conducted in a quarantine greenhouse facility at Citrus Research and Education Center, Lake Alfred, FL. Assays were performed using fully expanded, immature leaves of Duncan grapefruit. XCC wild type and mutant strains used in this assay were grown with shaking overnight at 28C in NB, centrifuged down and suspended in sterile tap water and the concentrations were adjusted to 10 8 CFU/ mL For the pathogenicity assays, bacterial s uspension s of both 10 8 and 10 5 CFU/ mL were infiltrated into leaves with needleless syringes (Viloria et al. 2004; Rybak et al. 2009) The test was repeated three times with similar results. Disease symptoms were photographed at 5 days, 10 days and 12 days po st inoculation (DPI). RNA E xtraction Single bacterial colonies were picked and grown in 5 mL NB at 28C for 24 h with shaking, and then transferred into 50 mL NB for overnight incubation. The bacterial cultures in middle exponential phase were centrifuged down, washed with XVM2 medium once, and inoculated in XVM2 medium with initial concentration OD 600 = 0.03. Bacteria were grown in XVM2 medium with shaking at 200 rpm at 28C and samples of culture were collected at three different time points, OD 600 0.25, 0.4 and 0.5 (marked with A, B and C, correspondingly) according to the growth curve in XVM2 (Fig ure 3 1 ). Four biological replicates were used for each strain per time point. RNA was stabilized immediately by mixing bacterial culture with two volumes of RN Apr otect bacterial

PAGE 64

64 reagent (Qiagen ) and incubated at room temperature for 5 min. Bacterial cells were centrifuged at 5000g for 10 min and cell pellet s were used for RNA extraction. Cell pellets were treated with lysozyme and RNA extractions were performe d usin g RiboPure TM bacteria kit (Ambion ). Contaminant g enomic DNA was removed from RNA by treatment with TURBO DNA free TM kit (Ambion ). RNA quantity was initially determined on a ND 8000 Nanodrop spectroph otometer (NanoDrop Technologies ) and RNA quality wa s assess ed using an Agilent 2100 bioanalyzer (Agilent Technologies). XCC Oligonucleotide Microarray D esign Based on the annotated genome sequence of XCC strain 306 (da Silva et al. 2002) 815 K DNA microarray chips covering the whole genome of XCC 306 were designed using Agilent's eArray custom design tool and produced by Agilent Tec hnologies (Agilent Technologies ). Each of 4 427 protein coding genes has three unique optimized 60 mer oligonucleotide probes in microa rray. Agilent's standard controls were printed on the array as well, allowing for measurement of proper hybridization conditions. Microarray H ybridization Microarray analysis using the Agilent microarray platform was performed at Interdisciplinary Center for Biotechnology Research (ICBR) Microarray Core Facility, the University of Florida. Labeled cDNA was generated using Fairplay III microarray lab eling kit (Agilent Technologies ). Five g of total RNA input was used to generate labeled cDNA according to t from 5 g of the total RNA with AffinityScript HC and random primer and then modified cDNA was labeled with either cy3 or cy5; labeled cDNA was purified following the manufacturer's instructions. Th e microarray analysis was performed using the Agilent

PAGE 65

65 815K XCC genome array. Four independent biological replicates were performed for three time point comparisons with dye swap design. A total of 300 ng of labeled cDNA per sample was used for the hybrid ization. A dye swap was performed to remove any bias from the labeling dyes. Hybridization was performed using Gene Expression Hybridiz ation Kit (Agilent Technologies in a hybridi zation oven for 17.5 h at 65C. The arrays were w recommended protocols. Briefly, arrays were washed wit h Gene Expression Wash Buffer 1 containing 0.005% Triton 102 for 1 min at room temperature and then washed with 37C warme d Gene Expression Wash Buffer 2 containing 0.005% Tr iton 102 for 1 min and dried with Agilent Stabilization and D r ying Solution. The arrays were scanned using a dual laser DNA microarray scanner (Mode l G2505C) (Agilent Technologies ). The data were extracted from scanned image using Feature Extrac tion 10.1.1.1 software (Agilent Technologie s ). Microarray Data Analysis and Statistical M ethods The raw data were imported into R environment and statistical tests were performed using BioConductor statistical software which is an open source and open deve lopment software project for analysis of microarray and other high throughput data based primarily on the R programming language (Gentleman et al. 2004) Data preprocessing and normalization were performed using the Linear Models for Microarray Data (LIMMA) package (Smyth 2004) Raw mean signal intensities from all microarray spots were background corrected and normalized usin g within array lowess approach. Log 2 transformed values were used for statistical analysis. Histograms, box plots and pair wise scatter plots were generated to e xamine data quality and comparability. A linear modeling approach and the empirical Bayes statistics as

PAGE 66

66 implemented in the LIMMA package (Smyth 2004) were then employed for differential expression analysis. The p values were adjusted using the Benjami ni and Hochberg method, designated as FDR (Benjam ini and Hochberg 1995) Differentially expressed genes were ra nked based on FDR, and genes with FDR less than 0.05 and a minimum absolute value of log 2 fold change greater than 0.585 (equivalent to 1.5 fold) were considered as significantly differentially expressed. If the gene has three probes and only one was filte red, the gene was removed from further analysis. The log 2 fold change values of the differentially expressed genes were averaged from the values of the two or three probes of the correspond ing genes, and shown in T able 3 3 Annotation for the differentiall y expressed genes were extracted from the Integrated Microbial Genome (IMG) database and the J. Craig Venter Institute (JCVI) database and manually verified. Hierarchical clustering analysis was performed with Cluster 3.0 using complete linking with un cen tered correlation distance (de Hoo n et al. 2004) The resulting dendograms were visualized using Java Treeview software (Sal danha 2004) All primary data from transcriptome experiments as well as experimental protocols used are available from Gene Expression Omnibus datasets, the National Center of Biotechnology Information (accession number GSE24016). Quantitative RT PCR (QR T PCR) To verify the microarray result, QRT PCR assays were conducted using the same set of RNA for microarray analysis. One g of aliquot RNA samples used for microarray were reverse transcribed using RETROscript kit with random hexamer primers (Ambion ) for two step QRT PCR. Gene spe cific primers listed in T able 3 2 were design ed to generate products 100 to 250 bp in length from sequences on XCC genome using DNASTA R software (DNASTAR ). Real time PCR was performed for all

PAGE 67

67 four biological replicates obtain ed at time point C on a 7500 Fast Real Time PCR System (App lied Biosystems ) using QuantiTect TM SYBR Gre en PCR kit (Qiagen ) endogenous controls. The relative fold change of gene expression was calculated by using the formula 2 T (Livak and Schmittgen 2001) The values of fold change were log 2 transformed to compare with values generated from m icroarray analysis. Motility A ssays The media for motility assays was XVM2 containing 0.3% agar for swimming and 0.7% agar for swarming. Bacteria were grown in NB overnight with shaking at 200 rpm, and then centrifuged down, washed and diluted to OD 600 = 0.3 in sterile water. One L suspension was spotted on the center of each swimming or swarming plate and incubated at room temperature. The assay was repeated three times independently in quadruplicate. Results Generation of the hrpG M utant The hrpG insert ion mutant was generated by double cross over homologous recombination in this study. The insertion of the Km cassette in hrpG was confirmed by PCR with three pairs of primers targeting different locations of inside and flanking regions of hrpG The hrpG insertion mutant lost pathogenicity in grapefruit and showed no symptoms (Fig ure 3 2 ). The complementation plasmid containing the intact hrpG gene restored its pathogenicity in planta The growth curves of both hrpG and hrpX mutants in XVM2 medium (Wengelnik et al. 1996a ) were similar to that of the wild type strain (Fig ure 3 1 ).

PAGE 68

68 Microarray Analyses and Validation of Microarray D ata In order to characterize the HrpG and HrpX regulons, microarray analyses were conduc ted to compare gene expression of the hrpG or hrpX mutants with that of the wild type stra in 306 at different growth phase s, respectively. The three time points used in this time course study, A (OD 600 = 0.25), B (OD 600 = 0.4), and C (OD 600 = 0.5) (Fig ure 3 1 ), represent three growth phases (two in exponential phase a nd one in early stationary phase ) of XCC in XVM2 medium. In this study, FDR=0.05 and absolute value of log 2 fold change =0.585 (equivalent to fold change 1 .5) were used as cut off value. For th e hrpG mutant, 99, 28 and 174 genes showed significant expression changes at time point A, B and C, respectively (Fig ure 3 3 ). Similarly, 53, 63 and 159 genes were differentially expressed in the hrpX mutant at the three corresponding time points (Fig ure 3 3 ). The greatest number of differentially expressed genes, and the greatest magnitude of changes, occurred at time point C in both mutants (Fig ure 3 3 ). Overall, 232 genes belonged to the HrpG regulon while 181 genes belong ed to the HrpX regulon (Table 3 3 ). HrpG and HrpX not only activated gene expression, but also repressed gene expression. For the hrpG mutant, 29, 9, and 95 genes were under expressed and 70, 19, and 79 genes were over expressed compared to the wild type strain at tim e points A, B, C, re spectively. Similarly, 42, 58, and 104 genes were under expressed and 11, 5, and 55 genes were over expressed in the hrpX mutant at the three corresponding time points (Fig ure 3 3 ). Two step quantitative RT PCR (QRT PCR) was used to validate the microarray data. Eight genes were chosen from Table 3 3 to compare data obtained fr om the two methods (Table 3 2 ), which showed under expression at time point C in both hrpG and hrpX mutant in microarray analysis. The resulting transcriptional ratio from QRT PCR

PAGE 69

69 ana lysis was log 2 transformed and compared with the average log 2 ratio values obtained by microarray analysis (Fig ure 3 4 ). Although the amplitude of fold changes between the two techniques is different for different genes, the general trend of gene expressio n is consistent. Functional Classification of Differentially Regulated G enes The 232 genes belonging to the HrpG regulon could be assigned to 18 functional categories according to the annotation from the JCVI role categories including amino acid biosynthe sis; biosynthesis of cofactors, prosthetic groups, and carriers; cell envelope; cellular processes; central intermediary metabolism; DNA metabolism; energy metabolism; fatty acid and phospholipid metabolism; mobile and extrachromosomal element functions; p rotein fate; protein synthesis; regulatory functions; transcription; transport and binding proteins; hypothetical proteins; unknown function; unclassified, and not in JCVI (which means that the gene is not assigned to any JCVI categories) (Fig ure 3 5 ). The 181 genes of the HrpX regulon were assigned into 17 of the same functional categories as HrpG except mobile and extrachromosomal element functions. About 53.4% (124 of 232) of genes of the HrpG regulon and 49.7% (90 of 181) genes of the HrpX regulon were in the categories of hypothetical protein, unclassified, unknown function, and not in JCVI. Clustering A nalysis Clustering analysis was performed to group genes with similar expression pattern. Genes with similar time dependent regulation patterns were assigned to the specific clusters. This enables the characterization of clearer and more meaningful expression patterns from a large array of differentially regulated gene s. Accordingly, five major clusters of genes were assigned (Fig ure 3 6 ).

PAGE 70

70 Cluster I: It consists of 104 genes showing under expression in the hrpX mutants at time point C Seventy three of them were also under expressed in the hrpG mutant at time point C. The genes in this cluster consist of genes encoding T3SS and T3SS effectors, T2SS su bstrates, and genes involved in amino acid biosynthesis, regulation pathway, and energy metabolism. Cluster II: Up regulated in both hrpG and hrpX mutants at time point C. This cluster is composed of 31 genes, including those related to amino acid biosynth esis, DNA metabolism, and thiamine biosynthesis, and 23 hypothetical genes. Cluster III: Up regulated only in the hrpG mutant at time point C but not in the hrpX muta nt at any phase It comprises of 44 genes encoding two component regulation systems, che motaxis and bacterial motility, amino acid biosynthesis, and sugar and starch metabolism. Cluster IV: Down regulated at any of the three time points of the hrpG mutant but not in the hrpX mutant. It contains 44 genes, including those related to energy meta bolism, cell envelope, substrate transport and binding, and regulation. Cluster V: Up regulated in the hrpX mutant only at time point C but not in the hrpG mutant. It includes 19 genes, consisting of those responsible for histidine biosynthesis, energy met abolism, and ABC transporter. Genes not in clusters included 48 genes showing altered expression at least at one time point in either hrpG or hrpX mutant. They encode proteins responsible for energy metabolism, regulation, substrate transportation, and pat hogenicity factors (PthA1 4).

PAGE 71

71 T3S S and T3SS E ffectors The whole hrp gene cluster which contains 24 genes ( XAC 0393 XAC 0417) were down regulated in both hrpG and hrpX mutants. The magnitude of down regulation of hrp genes in the hrpX mutant was greater than that in the hrpG mutant when c ompared at the same growth phase in XVM2. For instance, at time point C, the expression of hrp genes was down regulated 0.94 to 2.18 log 2 fold (1.92 to 4.53 fold) in the hrpG mutant, while it was down regulated 1.23 to 5.54 lo g 2 fold (2.35 to 46.53 fold) in the hrpX mutant. The expression of most putative and known T3SS effector genes was under HrpG and HrpX regulation. Among 24 putative and known T3SS effectors found in XCC genome (Morei ra et al 2010 ) 23 effectors belong to the Hr pG and/or HrpX regulon (Table 3 4 ). Except for the pthA1 4 and avr XAC E2 genes, the remaining 18 effector genes were down regulated in both mutants and grouped into Cluster I. The pthA1 4 genes showed altered expression (over expressed) at time point A and B in the hrpG mutant, while the avr XAC E2 genes was over expressed at time point A in the hrpG mutant. HrpX did not regulate the expression of pthA and avr XAC E2 genes. In addition, one putative effector gene, XAC 2990, was identified in this study. The protein sequence of this gene shares 45% identity to the putative T3SS effector RCFBP_mp20163 from Ralstonia solanacearum (Remenant et al. 2010) The products of both genes have a lipase domain which hydrolyzes ester linkages of triglycerides. It was reported that lipase acted as a virulence factor and played important roles in disease development caused by Fusarium graminearum (Feng et al. 2005) and Pseudomonas aeruginosa (Reimmann et al. 1997) Two genes, XAC 3225 and XAC b0007, sharing 99% identity with each other and encoding transglycosylase, belong to the HrpX regulon since their expression was down regulated in the hrpX mutant at time point C. It was reported t hat

PAGE 72

72 XAC 3225 shares high identity with hopAJ1 of P. syringae pv. tomato strain DC3000, which is a T3SS helper protein contributing to effector translocation (Oh et al. 2007; Moreira et al. 2010 ) Mutation of XAC 3225 reduced the disease symptoms on citrus (Moreira et al. 2010 ) T2SS S ubstrates Eight genes (Table 3 5 ) including virK ( XAC 0435), XAC 0552, phe 1 ( XAC 0661), xcp ( XAC 0795), XAC 0817, pglA ( XAC 2374), XAC 2831 and XAC 2835 which have been confirmed to encode T2SS substrate experimentally, showed under expression in both mutants except for pglA ( XAC 2374) which was under expressed only in the hrpX mutant at time point C. Two of them, pglA ( XAC 2374) and phe 1 ( XAC 0661) encode CWDEs. In addition, 21 genes were predicted as putative T2SS substrates in this study based on the clustering with the known T2SS substrates, homology to known secreted proteins, as well as sig nal peptide prediction (Table 3 5 ). All these 21 genes encoding putative T2SS substrates were up regulated by HrpX, and 12 of them were als o up regulated by HrpG (Table 3 5 ). In addition, XAC 2654 encoding a plant natriuretic peptide like protein in XCC ( XAC PNP) was under expressed in both hrpG and hrpX mutants. Especi ally at time point C in the hrpX mutant, its expression was more than five log 2 fold lower tha n that in the wild type strain. Signal Transduction and R egulation Several genes belonging to the two component system showed changed e xpression in this study (Ta ble 3 6 ). Two genes encoding sensor kinases, XAC 1488, and XAC 2192, and two genes encoding response regulators, rpfG ( XAC 1877) and XAC 2897, were up regulated in the hrpG mutant at time point C. Two genes ( XAC 1939 and XAC 1940) encoding GGDEF family proteins showed similar expression pattern as

PAGE 73

73 rpfG which break down an important bacterial intracellular secondary messenger, 3, 5 cyclic diguanylic acid ( cyclic di GMP ). Gene regS ( XAC 1798) encoding a two component system sensor protein showed over expression in the hrpG mutant at time point C. Gene stk XAC 1 ( XAC 1171) encoding a serine/threonine kinase showed under expression in both mutants at time point C Gene phoC ( XAC 4369) encoding phosphatase precursor was under expressed in the hrpX mutant at time point C. A few genes encoding transcriptional regulators were also differentially expressed in the study (Table 3 6 ) The expression of five genes ( rpoE ( XAC 1682), XAC 1555, XAC 2166, XAC 3445, and XAC 4272) encoding one sigma factor RpoE and four transcriptional regulat ors were changed in the hrpX mutant. The expression of three transcriptional regulatory genes, XAC 0917, phoU ( XAC 1573) and flgM ( XAC 1989) were changed only in the hrpG mutant. Two genes encoding transcription regulator, pcaQ ( XAC 0880) and XAC 1455, showed a ltered expression in both hrpX and hrpG mutants. Chemotaxis and Bacterial M otility A number of genes involved in motility and chemotaxis were regulated at transcription level in the hrpG mutant. The fliJ gene ( XAC 1950), one of the flagellar genes whose pr oduct responds to chemotactic stimuli, was up regulated in the hrpG mutant at time point A. Two genes, motB ( XAC 1908), encoding flagellar motor protein D, and fliO ( XAC 1945), encoding flagellar protein for flagellum apparatus, were under expressed in the h rpG mutant at time point B. At time point C, eight genes were over expressed in the hrpG mutant, including chemotaxis genes, cheA ( XAC 2865), encoding chemotaxis histidine protein kinase, cheW ( XAC 1906), encoding a coupling protein, cheY ( XAC 1904), encoding chemotaxis response regulator, and genes in early flagellar biosynthesis which are responsible for flagellum basal body assembly, such as flgF

PAGE 74

74 ( XAC 1982), encoding flagellar basal body rod protein, fliF ( XAC 1954), encoding flagellar M ring protein, fliI ( X AC 1951), encoding flagellum specific ATP synthase, and fliG ( XAC 1953) encoding flagellar motor switch protein. Gene flgM ( XAC 1989), encoding an anti sigma 28 factor which is a negative regulator of flagellin synthesis, was over expressed in the hrpG mutant at time point C. To test whether the expression changes of flagella genes we found from the microarray analysis led to motility changes in the hrpG mutant, both swarming and swimming assays were performed on XVM2 plates containing either 0.7% or 0.3% aga r. The hrpG mutant did not show different swimming ability on XVM2 supplemented with 0.3% agar in the incubation period (data not shown). Greater swarming ability of the hrpG mutant was observed 13 days after plating on XVM2 containing 0.7% agar (Fig ure 3 7 ). This result is consistent with the microarray analysis of the hrpG mutant that most of the differentially expressed genes related to flagellar biosynthesis were chang ed at the early stationary phase Amino Acid B iosynthesis Sixteen genes related to am ino acid biosynthesis showed altered ex pression in this study (Table 3 3 ). Eight genes ( XAC 1828 XAC 1835) involved in histidine biosynthesis were up regulated only in the hrpX mutant at time point C. Two genes, ilvC ( XAC 3451) and ilvG ( XAC 3452), involved in valine, leucine and isoleucine biosynthesis, showed similar expression pattern to histidine biosynthesis genes. Three genes, metE ( XAC 0336) involved in cysteine and methionine metabolism dapA ( XAC 1760) involved in lysine biosynthesis and asnB ( XAC 1433) i nvolved in alanine, aspartate and glutamate metabolism, showed expression changes in the hrpG mutant. Two genes involved in phenylalanine, tyrosine and tryptophan biosynthesis, tyrA

PAGE 75

75 ( XAC 1525) and pheA ( XAC 3647) showed expression changes in both hrpX and hr pG mutants. PheA is a chorismate mutase which is a key enzyme in shikimate pathway related to aromatic amino acid synthesis. It was reported that chorismate mutase was either translocated to the periplasm or secreted in some pathogenic bacteria (X ia et al. 1993; Calhoun et al. 2001; Sasso et al. 2005) The chorismate mutase found in X. oryzae pv. oryzae XKK.12 is involved in virulence on its host rice (Degrassi et al. 2010 ) General Metabolism and T ransport Many genes involved in general metabolism are regulated by HrpG and HrpX including those involved in energy metabolism, fatty acid and phospholipid metabolis m, and sugar transport (Table 3 3 ). Three genes GNL ( XAC 0548), fr uK ( XAC 2502), kdgK ( XAC 0143) involved in pentose phosphate pathway were differentially expressed in the hrpG mutant. Three genes encoding cytochrome C oxidase, which is the complex IV in oxidative phosphorylation, were under expressed in both mutants at ti me point A. The atpB ( XAC 3655) gene in oxidative phosphorylation was over expressed only in the hrpX mutant at time point C. Three genes in fatty acid and phospholipid metabolism, accD ( XAC 0264), fadE9 ( XAC 1313) and paaF ( XAC 1314) were over expressed in th e hrpG mutant at time point C Gene paaF also showed over expression in the hrpX mutant at time point A. Thirteen genes encoding transport and binding proteins were differentially expressed in either hrpG or hrpX mutant (Tabl e 3 3 ). Four genes encoding Ton B dependent receptors, XAC 3050, XAC 3489, XAC 3444, and XAC 1143, showed differential expression. These proteins are assembled in the outer membrane of Gram negative bacteria and are mainly known in the transport of iron siderophore complexes and vitamin B12 into the periplasm (Postle and Kadner 2003) In recent studies, novel

PAGE 76

76 substra tes of TonB dependent receptors were revealed, such as nickel, zinc, maltodextrin, and sucrose (Neugebauer et al. 2005; Blanvillain et al. 2007; Schauer et al. 2007) XAC 3489 shares 93% amino acid identity with XCC3 358 which plays a major role in pathogenicity. The XCC 3358 insertion mutant of X. campestris pv. campestris showed delayed symptom development compared to the wild type strain (Blanvillain et al. 2007) A few genes encoding transporters were differentially expressed in either hrpG or hrpX mutant, such as sugar transporters (e.g. fucP ( XAC 1556), suc1 ( XAC 3488) and fruA ( XAC 2503)), K + transporter kdpC ( XAC 0758), ABC transporter components ( XCC 0827 XAC 0828), and MFS t ransporter ( XAC 1705). Discussion DNA microarray has been widely used to study the transcriptional responses of many organisms to genetic and environmental perturbations (Ye et al. 2001; Dharmadi and Gonzalez 2004) In this study, we developed the first whole genome DNA microarray for XCC. In previous studies, two DNA microarray platforms have been designed and have played important roles in characterization the pathogenicity and virulence of XCC (Astua Monge et a l. 2005 ; Moreira et al 2010 ) However, both previous microarrays represented part of the genome. The first XCC microarray only contains 279 XCC genes associated with pathogenicity and virulence (Astua Monge et al. 2005 ), while the second XCC microarray only consists of 2,365 open reading frames (ORF s ) which corresponds to 52.7% of the annotated ORF s of the XCC genome ( Moreira et al. 2010 ). The microarray developed in our study represents all 4427 annotated protein codi ng ORF s In addition, we used 815K format so that 8 microarrays could be print ed on a single slide, which significantly reduce s the variation when multiple slides are used (Tseng et al. 2001) The reliability of this array has been

PAGE 77

77 proved with the following evidences: ( 1) gene expression of all randomly selected genes in the microarray result was validated in QRT PCR (Fig ure 3 4 ); ( 2) T3SS and T3SS effector genes which have been shown to be regulated by HrpX and HrpG (Wengelnik and Bo nas 1996; Wengelnik et al. 1996b ; Wengelnik et al. 1999) were identified in our study (T ables 3 3 and 3 4 ); ( 3) T2SS substrate genes which have been shown to be controlled by HrpX and HrpG were confirmed using this microarray (Tables 3 3 and 3 5 ). Thus, our microarray provides a robust and comprehensive tool for transcriptome analysis of XCC. HrpX and HrpG play important roles in coordinating different categories of genes. Firstly, they regulate pathogenicity and virulence genes to overcome the plant defense responses and survive in the intercellular spaces. The most well known HrpG and HrpX dependent vir ulence factors were distributed in cluster I (Fig ure 3 6 ), including T3SS ( hrp genes), T3SS effectors, T2SS substrates and XAC PNP. The major roles of T2SS substrates include degradation of the plant cell wall, cytotoxicity, adherence, spread and transmissi on (Cianciotto 2005 ) which might facilitate the assembly of extracellular appendages of secretion s ystems such as T3SS and therefore promote pathogenesis. T3SS translocates the T3SS effector proteins into plant cells which either suppress the host defense or interfere with host cellular processes. For instance, some T3SS effectors act as cysteine protea ses in plants such as XopD, a member of the YopJ/AvrRxv family (Nol e t al. 2002; Grant et al. 2006 ) Members of the AvrBs3/PthA family of transcriptional factors directly interact with the host transcription to mod ulate the host gene expression (Schornack et al. 2006) Our microarray data showed that pthA1 4 genes were not controlled by HrpX However, the expression of pthA1 4 genes

PAGE 78

78 was induced in the hrpG mutant at time point A and B. XCC employs XAC PNP to mimic host PNP and to systemically regulate plant homeostasis, resulting in a suppressed host defense responses, and a better survival en vironment for bacteria (Gottig et al. 2009 a ) Importantly, a significant induction of hrpG expression was observed when Xanthomonas spp. enter ed the plant apoplast (Zhang et al. 2009). Thus, HrpG coordinates multiple virulence factors in the XCC infection process. Secon dly, in addition to manipulation of plant defenses, XCC has to adapt its metabolism to the intercellular spaces, which are nutrient poor (Alfano and Collmer 1996) and laden with toxic substances (either preformed or induced) as part of the host defense responses (Osbourn 1996; Segura e t al. 1999) Our data showed that XCC regulates multiple cellular activities responding to the host environment, such as amino acid biosynthesis, oxidative phosphorylation, pentose phosphate pathway, transpo rt of sugar, iron and potassium and the phenolic compounds catabolism pathway through H rpX and HrpG. XCC activates the gene expression of sugar transporters thro ugh HrpX and HrpG in order to take up more sugars as a carbon and energy source, particularly sucrose, glucose and fructose, which are the most common sugars in the plant apoplast (Joosten et al. 1990; Rico et al. 2009) The activation of a phenolic catabolism pathway could convert toxic plant chemicals to less toxic compounds or even carbon sources. Thirdly, we also identified a large set of u nknown genes controlled by HrpG and HrpX. In all, 53.4% (124 out of 232 genes) of genes in the HrpG regulon and 49.7% (90 out of 181 genes) of genes in the HrpX regulon encode unknown proteins. Their roles are unknown in XCC infection. Nonetheless, the li st might provide targets for further study. Among the unknown proteins, some seem to play important roles in XCC virulence. For

PAGE 79

7 9 example, one putative effector gene, XAC 2990, was predicted in this study. The protein sequence of this gene shares 45% identity to the putative T3SS effector RCFBP_mp20163 from R. solanacearum (Rem enant et al. 2010) The regulation of HrpX and HrpG on multiple cellular activities is through both direct and indirect controls (Fig ure 3 8 ). For the T3SS and T3SS effector genes, five T3SS genes and eight T3SS effector genes have been shown to contain P IP boxes in t heir promoter regions (da Silva et al. 2002) HrpX was shown to interact with the PIP box (Koebnik et al. 2006) For other genes controlled by HrpX and HrpG but without PIP box, one putative explanation is that HrpX/HrpG control multiple regulatory genes (Table 3 6 and Fig ure 3 8 ), which in turn regulate those genes. Totally, HrpX and HrpG manipulate the gene expression of 21 regulatory genes an d one sigma factor gene (Table 3 6 ). Among the regulatory genes controlled by HrpG, rpfG encodes a response regulator (discussed below) in DSF mediated QS system (Tang et al. 1991; Barber et al. 1997) RpfG was reported to regulate ge nes involved in synthesis of extracellular enzymes and EPS and biofilm form ation (Slater et al. 2000). The regulation of flagellar genes might be related to the regulation of flgM and XAC 0917 by HrpG. Gene flgM ( XAC 1989) over expressed in the hrpG muta nt a t the early stationary phase encodes an anti sigma 28 factor which is involved in temporal regulation of flagellar biosynthesis (Yang et al. 2009) XAC 0917 is a TetR family member. It was reported that FhrR, a TetR family member, positively regulates expression of the genes encoding flagellar and ribosomal prot ein genes, and negatively regulates expression of hrp genes, under the control of Clp in X. campestris pv. campestris (He et al. 2007 ) The phoU gene encodes a transcriptional regulator which participates in phospha te transport and also

PAGE 80

80 negatively controls the expression of phosphate ABC transporter genes (Muda et al. 1992) The stk XAC 1 ( XAC 1171) gene encodes a se r in e/threonine kinase which plays important roles in a multitude of cellular processes, including cell division, proliferation, apoptosis, and differentiation (Manning et al. 2002) The HrpX and HrpG also manipulate the gene expression of multiple regulators including pcaQ ( XAC 0880), XAC 1455, XAC 1555, XAC 4272, XAC 3445, and XAC 2166, which have not been studied extensively in XCC. However, th eir homologs have been studied in other bacteria. For example, t he homolog of PcaQ ( XAC 0880), a LysR family transcription regulator, activated the expression of the pcaDCHGB operon which encodes enzymes involved in phenolic compounds catabolism in Agrobac terium tumefaciens A348, (Parke 1996) In agreement with the regulation of PcaQ, two genes encoding subunits of protocatechuate 4, 5 dioxygenase, pcaH ( XAC 0878) and ligA ( XAC 0879), were under expressed in both hrpX and hrpG mutants. Protocatechuate 4, 5 dioxygenase is the first ketoadipate pathway to use aromatic compounds as carbon sources (Parke 1996) XAC 1455 shares 85% identity of amino acid sequence with XC_2827, which belongs to MarR family transcriptional regulator in X. campestris pv. campestris 8004. The product of XC _2827, designated as HpaR, is involved in hypersensitive response (HR), pathogenicity, and extracellular protease production in X. campestris pv. campestris and was positively regulated by HrpG and HrpX (Wei et al. 2 007) Thus, it seems that HrpX and HrpG control multiple cellular activities through multiple regulatory genes. Our data suggest that a cross talk exists between HrpG and the QS system in XCC. The rpfG gene ( XAC 1877) was up regulated at the early stationa ry phase in the

PAGE 81

81 hrpG mutant. Two GGDEF genes showed similar expression pattern as rpfG which break down an important bacterial intracellular secondary messenger, 3, 5 cyclic diguanylic acid ( cyclic di GMP ). RpfG is the response regulator in DSF mediated QS system which mediates virulence, biofilm formation and many cellular activities in Xanthomonas spp. (Tang et al. 1991; Barber et al. 1997) RpfG contains an HY GYP domain which interacts with GGDEF proteins to me diate signal transduction to cyclic di GMP The cross talk between DSF mediated QS and HrpG regulon was also found in genome scale analysis of DSF regulon in X. campestris pv. campestris (He et al. 2006; He et al. 20 07 ) In addition, for the hrpG mutant, 99, 28 and 174 genes showed significant expression changes at time point A, B and C, respectively (Fig ure 3 5 ). Similarly, 53, 63 and 159 genes were differentially expressed in the hrpX mutant at the three correspond ing time points (Fig ure 3 5 ). The temporal changes of gene regulation might be related to QS QS is likely to be involved in controlling the timing and level of gene expression in the HrpG regulon Bacteria might balance DSF signal and host stimuli by timi ng the expression of virulence factors such as T3SS via subtle signal sensing mechanisms. The messenger cyclic di GMP might be the molecule which links QS and HrpG regulatory cascade. RpfG and GGDEF proteins control the concentration of the central messeng er cyclic di GMP The high levels of cyclic di GMP promote biofilm formation, while low levels promote motility and transcription of virulence factors (Simm et al. 2004 ; Tischler and Camilli 2004; Rmling et al. 2005 ) One important target of cyclic di GMP is Clp (cAMP receptor protein like protein) which is a transcriptional activator. Cyclic di GMP binds to the Clp to prevent from DNA binding and the expression of genes encoding extracellular enzymes, and genes inv olved in T3SS, and

PAGE 82

82 EPS biosynthesis (He et al. 2007). Two transcriptional factors, FhrR and Zur were identified in the transcriptomic analysis of Clp regulons of X. campestris pv. campestris (He et al. 2007). FhrR controls the expression of genes encoding flagellar, T3SS and ribosomal proteins, while Zur regulates genes involved in iron uptake, multidrug resistance and detoxification (Huang et al. 2009) Therefore, it is possible that bacteria temporally regulate th e cellular functions to adapt to different phase s of growth or infection through multiple signaling cascades including the QS system. Comparison of the HrpX and HrpG regulons at different time points gives us an insight of the dynamic expression of common genes shared by both regulons. Thirty three genes were shared by the two regulons at time point A, and 9 genes at time point B, while 104 common genes were found at time point C (Table 3 7 ). In general, 123 genes were overlapped in the two regulons at any of the three time points, which corresponds to 68% of HrpX regulon (123 out of 181), and 53% of HrpG regulon (123 out of 232). The most common genes were grouped into cluster I which contains genes encoding T3SS, T3SS effectors and T2SS substrates. Intere stingly, 58 genes in the HrpX regulon are HrpG independent, while 109 genes in the HrpG regulo n are HrpX independent (Table 3 7 ). As to the HrpG independent genes in HrpX regulon, further analysis reveals that 23 of them showed subtle expression changes (t he absolute value of log 2 fold change <0.585) with statistical significance FDR <0.05 in the hrpG mutant in at least one of the three time points (particularly 17 of the 23 g enes are in cluster I) (Table 3 3 ). As shown in Fig ure 3 6 the expression of gene s in Cluster I responded to hrpX mutation more rapidly and dramatically than to HrpG mutation based the log2 fold value. Thus, those 23 genes might also belong to the HrpG regulon but have weaker

PAGE 83

83 responses to HrpG. For the remaining 35 HrpG independent gen es in the HrpX regulon, one possibility is that the hrpX gene is regulated by other regulators besides HrpG. For instance, it was reported that Zur in X. campestris pv. campestris strain 8004 positively controls hrp gene expressions via HrpX (Huang et al. 2009) The HrpX independent genes in HrpG regulon were as we expected since HrpG is upstream of HrpX in the regulatory cascade. These genes in the HrpG regulon include 10 regulatory genes and 11 genes related to che motaxis and flagellar biosynthesis. Those regulatory genes contribute to controlling the large set of genes in the HrpG regulon and also indicate that HrpG is a master regulator in the pathogenesis process of XCC. In addition, we confirmed the repression e ffect of HrpG on bacterial motility due to the altered expression of genes involved in chemotaxis and flagellar biosynthesis by testing the motility of the hrpG mutant (Fig ure 3 7 ). This study is the first exhaustive genome wide analysis of HrpG and HrpX regulons in the Xanthomonas genus. We identified a large set of HrpX and/or HrpG dependent unknown or hypothetical proteins which might be candidate virulence genes, particularly the multiple ORFs in Cluster I. This study also provides us a global view of regulation cascades that control the expression of multiple virulence genes including T3SS, effector, and T2SS substrate genes during infection. Further microarray analysis of the mutants of the regulatory genes identified in this study will help us explo re the regulation circ uits of HrpG and HrpX regulons.

PAGE 84

84 Table 3 1 Bacterial strains and plasmids used in this study Strain or plasmid Relevant characteristics a Reference or source Strains E. coli F lac Z lac X 74 hsd R (r K m K + r ec A 1398 end A 1 ton A Invitrogen F lac Z lac ZYA arg F ) U169 rec A 1 end A 1 hsd R 17 (r K m K + ) pho A sup E thi 1 gyr A 96 rel A 1 Laboratory collection Huguet et al. 1998 X citri subsp. citri 306 Rif r Causes citrus canker on citrus da Silva et al. 2002 hrpG hrpG ::Km derivative of strain 306, Rif r Km r This study hrpX hrpX : pCR 2.1 TOPO derivative of strain 306, Rif r Km r AP r Figueiredo et al 2011 Plasmids pGEM T easy Ap r cloning vector, Promega pBSL15 Contains 1.2 kb Km cassette from pUC18, Ap r Km r Alexeyev 1 995 pCR 2.1 TOPO TM PUC ori f1 ori lacZ + Km r Ap r cloning vector Invitrogen pRK2013 ColE1 Kn r Tra + conjugation helper plasmid Ditta et al. 1980 pOK 1 sacB sacQ mobRK2 oriR6K Sp r Suicide vector, Huguet et al. 1998 pUFR053 IncW Mob + mob (P) lac Z + Par + Cm r Gm r shuttle vector El Yacoubi et al. 2007 pUSS01 2 Km cassette from pBSL15 cloned in pGEM T easy This study phrpGDV1 The NdeI NsilI fragment of upstream region of hrpG cloned to the downstream of Km cassette in pUSS01 2 This study phrpGDV1 The Apa I Sph I fragment containing 436 bp downstream region of hrpG cloned to the upstream of Km cassette in phrpGDV1 This study phrpGDV2 Km cassette flanked by the upstream and downstream region of hrpG from phrGDV1 cloned into pOK1 This study phrpG hrpG gene from XCC 306 cloned in pCR 2.1 TOPO TM This study phrpGC hrpG gene on Kpn I fragment from phrpG cloned in pUFR053 This study a Rif r K m r Ap r Cm r Gm r and Sp r indicate resistance to rifampicin, kanamyc in, ampicillin, chloramphenicol, gentamicin and spectinomycin, respectively.

PAGE 85

85 Table 3 2 Primers used in this study Primer a Primers used in mutagenesis and complementation AChrpG Nde1F3 TTCAAAcatatgGATCGCTGCATCGTCGG AChrpG Nsi1R2 AACTCG atgcatCTGGCGCAAACGATTGTA AChrpG Apa1F2 TTGTCGgggcccTTTGTGAGTGCGCCAA AChrpG R1 TGTTCCTGTTGACGCAGGATGC AChrpG Kpn1F4 ATAGGCggtaccGGAACGTCACTGCT AChrpG Kpn1R4 GAATTTggtaccCTCTCTGAAAGCCATCG AChrpG F1 GCTTGCCGTCCAGATAAACGGTAT AChrpG Sph1R3 TGTTCCgcatgcTGT TGACGCAGGATGC Primers used in QRT PCR 16s F CGCTTTCGTGCCTCAGTGTCAGTGTTGG 16s R GGCGTAAAGCGTGCGTAGGTGGTGGTT avrBs2 F CGCGCCAATCACGACAAGGACTACTAC avrBs2 R CGGGCCAGCGTGCGGTTTTC hrcV F GCGTTTGCGGCGTGCTTCATCT hrcV R CAATCTGGTGGTAGGCCTGGTCGTTTTCTT avrXac E1 F TCGCGCTGGGCCGGAACATACC avrXacE1 R GCGTCCGCGGCGATAACTCTTG avrXacE3 F ATGGAGGATGGCGGGCAGATGATGAATGTA avrXacE3 R CGATCTCGGCTCTGAATGCGTTTGTCCTG XAC3090 F ATCATCTCGGGCAGTTCGTTTATCA XAC3090 R AGGTGCCGGGCTTGTTTGCTGTTC hpaF F ACGCGCCTGTCCAATCTCA hpaF R CGGCATGCGCAACTCGGTCAATC peh 1 F AGTGGCAACGCGTTTCTGACC peh 1 R CGCCTGCGTTGTTGCCCTTGAC xynB F CGCAATCGCCGCAAACCA xynB R GCGCAGGCTTCACCAACTAC gyrA F CGTCACGTTGATCCGTTTGT gyrA R GCTTGCTTCGTCCACTCCCT a Lowercase nucleotides are not exact matches to the sequence and were introduced to add restriction enzyme sites.

PAGE 86

86 Table 3 3 Genes showing significant differential expression in hrpG and/or hrpX mutants compared with wild type strain at any of the three selected time points. Locus tag Gene symbol hrpGA /WA a hrpGB /WB a hrpGC /WC a hrpXA /WA a hrpXB /WB a hrpXC /WC a Description JCVI b Cluster c XAC3647 pheA 1.54 0.76 1.22 1.53 2.15 3.76 chorismate mutase Amino acid biosynthesis I XAC1525 tyrA NS NS 0.86 NS NS 0.76 prephenate dehydrogenase Amino acid biosynthesis I I XAC0802 NS NS 0.65 NS 0.61 1.79 sulfotransferase Amino acid biosynthesis I XAC4213 NS NS 0.69 NS NS 1.12 hypothetical protein Amino acid biosynthesis I XAC2947 apbE NS NS 0.93 NS 0.64 0.73 thiamine biosynthesis lipoprotein ApbE precursor Bios ynthesis of cofactors, prosthetic groups, and carriers II XAC2922 hrpW 1.77 NS 1.42 1.92 2.77 4.50 HrpW protein Cell envelope I XAC0661 peh 1 1.50 0.68 1.13 1.38 1.83 2.65 endopolygalacturonase Cell envelope I XAC2113 NS NS 0.91 NS NS 0.86 h ypothetical protein Cell envelope I XAC3878 1.06 NS 0.97 0.92 1.61 3.05 disulphide isomerase Cell envelope I XAC0076 avrBs2 NS NS 1.09 NS NS 1.98 avirulence protein Cellular processes I XAC0782 ftsQ 0.76 0.76 NS 0.74 NS NS cell division prote in Cellular processes NOT XAC0400 hpaA NS NS 1.23 NS 0.75 2.01 HpaA protein Cellular processes I XAC0403 hrcQ NS NS 1.12 NS 0.86 2.06 HrcQ protein Cellular processes I XAC0406 hrcU NS NS 1.66 0.65 1.05 2.53 type III secretion system protein Hr cU Cellular processes I XAC0397 hrpE 1.30 NS 1.03 NS 1.82 2.91 HrpE protein Cellular processes I XAC0394 hrpF 0.79 NS 1.59 NS 1.21 2.64 HrpF protein Cellular processes I XAC1265 hrpG 1.52 2.60 4.19 1.57 0.91 NS HrpG protein Cellular processes N OT XAC4340 yrbE 0.63 NS NS 0.64 NS NS toluene tolerance protein Cellular processes NOT XAC0878 pcaH 0.76 NS 1.10 0.76 1.00 2.33 protocatechuate 4,5 dioxygenase subunit beta Central intermediary metabolism I XAC0002 dnaN 0.59 NS 0.75 NS NS 0.70 DNA polymerase III subunit beta DNA metabolism II XAC3885 cox11 0.62 NS NS 0.68 NS NS cytochrome C oxidase assembly protein Energy metabolism NOT

PAGE 87

87 Table 3 3 Continued Locus tag Gene symbol hrpGA /WA a hrpGB /WB a hrpGC /WC a hrpXA /WA a hrpXB /WB a hrpXC /WC a Descr iption JCVI b Cluster c XAC3887 ctaD 0.60 NS NS 0.65 NS NS cytochrome C oxidase subunit I Energy metabolism NOT XAC0879 ligA 0.86 NS 1.14 NS 1.02 2.38 protocatechuate 4,5 dioxygenase subunit alpha Energy metabolism I XAC1439 tpmT NS NS 1.54 NS NS 1.3 3 thiopurine S methyltransferase Energy metabolism II XAC4327 uahA NS NS 0.79 NS NS 1.43 allophanate hydrolase Energy metabolism I XAC0363 vanA NS NS 0.61 NS NS 1.04 vanillate O demethylase oxygenase subunit Energy metabolism I XAC4252 xynB NS NS 0 .68 NS NS 1.13 xylanase Energy metabolism I XAC0562 mdcB NS NS 0.93 NS NS 0.72 malonate decarboxylase subunit beta Fatty acid and phospholipid metabolism II XAC1314 paaF NS NS 0.87 0.70 NS NS enoyl CoA hydratase Fatty acid and phospholipid metabolism NO T XAC2990 NS NS 0.61 NS NS 0.82 hypothetical protein Fatty acid and phospholipid metabolism I XAC0501 1.37 NS 1.35 0.93 1.95 3.20 hypothetical protein Hypothetical proteins I XAC0601 0.97 NS 0.98 NS 0.74 1.91 hypothetical protein Hypothet ical proteins I XAC0829 NS 0.74 NS NS NS 0.64 ABC transporter substrate binding protein Hypothetical proteins NOT XAC0916 NS NS 0.90 NS NS 1.13 hydrolase Hypothetical proteins I XAC1124 NS NS 0.62 NS 0.67 1.30 hypothetical protein Hypothetic al proteins I XAC1208 NS NS 0.99 NS 0.76 2.16 hypothetical protein Hypothetical proteins I XAC1689 0.75 NS 0.86 NS NS 0.89 hypothetical protein Hypothetical proteins II XAC2782 0.65 NS NS 0.67 NS NS hypothetical protein Hypothetical proteins NOT XAC2827 0.83 NS 0.85 NS NS 1.05 hypothetical protein Hypothetical proteins II XAC3222 NS NS 1.29 NS NS 1.12 hypothetical protein Hypothetical proteins II XAC4019 NS NS 0.76 NS NS 0.62 hypothetical protein Hypothetical proteins II XACb0011 avr Xac E3 0.98 NS 1.25 0.71 1.64 3.25 avirulence protein Not in JCVI I XACb0007 mlt 1.33 0.85 NS NS NS 0.86 COG2951M Not in JCVI I

PAGE 88

88 Table 3 3 Continued Locus tag Gene symbol hrpGA /WA a hrpGB /WB a hrpGC /WC a hrpXA /WA a hrpXB /WB a hrpXC /WC a Description JCVI b C luster c XACa0021 repA NS NS 0.82 NS NS 0.75 replication protein A Not in JCVI II XAC0099 1.09 NS 1.17 NS NS 1.33 hypothetical protein Not in JCVI II XAC0277 0.72 NS 1.20 NS 1.24 2.67 hypothetical protein Not in JCVI I XAC0315 0.80 NS 0.86 NS 0.71 1.63 hypothetical protein Not in JCVI I XAC0395 NS NS 1.22 NS 0.86 2.00 hypothetical protein Not in JCVI I XAC0543 1.68 0.74 1.42 1.72 3.44 5.12 hypothetical protein Not in JCVI I XAC0617 NS NS 1.67 NS NS 1.63 hypothetical protein No t in JCVI II XAC0786 NS NS 0.75 NS NS 0.61 hypothetical protein Not in JCVI II XAC0817 0.87 NS 0.61 NS 0.71 1.49 hypothetical protein Not in JCVI I XAC1172 0.73 NS 1.31 0.77 1.17 2.78 hypothetical protein Not in JCVI I XAC1241 1.26 NS 0 .88 NS 0.97 1.89 hypothetical protein Not in JCVI I XAC1412 NS NS 1.08 NS NS 0.95 hypothetical protein Not in JCVI II XAC1563 NS NS 1.51 NS NS 1.29 hypothetical protein Not in JCVI II XAC1572 NS NS 2.40 NS NS 1.62 hypothetical protein Not in JCV I II XAC1683 NS NS 0.65 NS NS 1.03 hypothetical protein Not in JCVI I XAC2357 NS NS 1.94 NS NS 1.95 hypothetical protein Not in JCVI II XAC2370 0.79 NS 0.87 NS 0.77 1.74 hypothetical protein Not in JCVI I XAC2425 NS NS 1.36 NS NS 1.24 hypo thetical protein Not in JCVI II XAC2442 NS NS 1.67 NS NS 1.39 hypothetical protein Not in JCVI II XAC2654 1.71 0.63 1.20 2.64 3.82 5.35 hypothetical protein Not in JCVI I XAC2786 1.44 NS 1.73 1.15 2.99 4.83 hypothetical protein Not in JCVI I XAC2787 NS NS 1.11 NS 0.96 2.46 hypothetical protein Not in JCVI I XAC2876 0.71 NS 0.81 NS 0.68 1.67 hypothetical protein Not in JCVI I XAC3085 NS NS 1.56 NS 1.72 3.87 hypothetical protein Not in JCVI I XAC3230 0.96 NS 1.04 NS 1.1 5 2.33 hypothetical protein Not in JCVI I XAC3291 NS NS 0.75 NS NS 0.87 hypothetical protein Not in JCVI II XAC3337 NS NS 0.70 NS NS 0.67 hypothetical protein Not in JCVI II XAC3646 1.30 0.74 1.02 0.91 1.52 2.59 hypothetical protein Not in JC VI I

PAGE 89

89 Table 3 3 Continued Locus tag Gene symbol hrpGA /WA a hrpGB /WB a hrpGC /WC a hrpXA /WA a hrpXB /WB a hrpXC /WC a Description JCVI b Cluster c XAC3666 0.95 0.81 NS NS NS 1.02 hypothetical protein Not in JCVI I XAC3984 NS NS 0.83 NS NS 0.88 hypothetical pr otein Not in JCVI II XAC4318 NS NS 0.59 NS NS 0.60 hypothetical protein Not in JCVI I XACa0013 0.76 0.62 0.68 NS NS 0.61 hypothetical protein Not in JCVI II XACb0034 NS NS 2.17 NS NS 1.93 hypothetical protein Not in JCVI II XACb0049 NS NS 0.8 3 NS NS 0.78 hypothetical protein Not in JCVI II XACb0057 0.63 NS 0.79 NS NS 0.83 hypothetical protein Not in JCVI II XAC0286 avrXac E1 0.90 NS 1.21 0.91 1.18 2.56 avirulence protein Protein fate I XAC0415 hrcC NS NS 1.58 NS NS 1.60 HrcC protein Protein fate I XAC0402 hrcR NS NS 1.26 NS 0.87 2.03 type III secretion system protein Protein fate I XAC0401 hrcS NS NS 1.52 NS 1.08 2.57 HrcS protein Protein fate I XAC0414 hrcT NS NS 1.16 NS 0.68 1.95 HrcT protein Protein fate I XAC0407 hrpB 1 1.23 NS 2.18 1.78 2.86 4.57 HrpB1 protein Protein fate I XAC0408 hrpB2 0.94 NS 1.90 1.11 1.95 3.72 HrpB2 protein Protein fate I XAC0410 hrpB4 0.92 NS 1.66 0.75 1.52 2.95 HrpB4 protein Protein fate I XAC0411 hrpB5 NS NS 1.34 NS 0.85 2.09 type III secretion system protein HrpB Protein fate I XAC0413 hrpB7 NS NS 1.11 NS 0.66 1.90 HrpB7 protein Protein fate I XAC1085 ppiD NS NS 0.85 NS NS 0.64 peptidyl prolyl cis trans isomerase Protein fate II XAC2831 NS NS 0.71 NS NS 0.97 extrace llular serine protease Protein fate I XAC0416 hpa1 1.93 NS 1.42 1.60 4.29 5.54 Hpa1 protein Protein synthesis I XAC0404 hpaP 0.70 NS 1.36 0.63 1.11 2.51 HpaP protein Protein synthesis I XAC3977 NS NS 1.38 NS NS 1.30 hypothetical protein Protei n synthesis II XAC0880 pcaQ 0.68 NS 0.85 NS 0.88 2.00 transcriptional regulator Regulatory functions I XAC1171 stkXac 1 0.98 NS 1.03 NS 0.78 2.03 serine/threonine kinase Regulatory functions I XAC1455 0.64 NS NS NS NS 1.20 MarR family transcript ional regulator Regulatory functions I

PAGE 90

90 Table 3 3 Continued Locus tag Gene symbol hrpGA /WA a hrpGB /WB a hrpGC /WC a hrpXA /WA a hrpXB /WB a hrpXC /WC a Description JCVI b Cluster c XAC3050 btuB NS NS 1.35 1.13 NS NS TonB dependent receptor Transport and binding pr oteins NOT XAC3444 btuB 0.94 NS NS 5.13 4.13 3.42 TonB dependent receptor Transport and binding proteins NOT XAC1556 fucP 0.71 NS NS 0.64 NS NS glucose galactose transporter Transport and binding proteins NOT XAC3489 fyuA NS NS 0.61 0.69 NS NS TonB dependent receptor Transport and binding proteins NOT XAC0412 hrcN NS NS 1.22 NS 0.82 2.10 type III secretion system ATPase Transport and binding proteins I XAC0827 nrtB 0.66 NS NS NS NS 0.73 permease Transport and binding proteins NOT XAC3170 bioI NS NS 0.73 NS NS 1.40 cytochrome P 450 hydroxylase Unclassified I XAC0417 hpa2 NS NS 0.94 NS NS 1.23 Hpa2 protein Unclassified I XAC0396 hpaB NS NS 1.67 NS 1.25 2.79 HpaB protein Unclassified I XAC0393 hpaF NS NS 1.32 NS NS 2.06 HpaF protein Un classified I XAC0409 hrcJ 1.03 NS 1.90 1.07 2.18 3.81 HrcJ protein Unclassified I XAC0405 hrcV NS NS 1.14 NS 0.84 1.85 HrcV protein Unclassified I XAC0399 hrpD5 0.74 NS 1.64 0.73 1.55 3.08 HrpD5 protein Unclassified I XAC0398 hrpD6 1.09 NS 1.72 NS 1.63 3.21 HrpD6 protein Unclassified I XAC1266 hrpXct 1.93 0.95 NS 1.60 1.97 1.58 HrpX protein Unclassified NOT XAC3225 mltB 1.36 0.84 NS NS NS 0.92 transglycosylase Unclassified I XAC2653 S NS NS 0.81 NS NS 0.73 phage related tail protein Un classified II XAC4326 uahA 0.81 0.67 NS NS NS 0.91 urea amidolyase Unclassified I XAC0435 virK 1.49 0.67 1.15 1.54 2.31 3.55 VirK protein Unclassified I XAC0552 0.99 NS 1.24 1.35 1.79 2.99 proteinase Unclassified I XAC0754 NS NS 0.88 NS 0.73 1.85 hypothetical protein Unclassified I XAC2123 NS NS 0.71 NS NS 0.65 hypothetical protein Unclassified II XAC2178 NS NS 0.71 NS NS 0.62 hypothetical protein Unclassified II XAC2853 2.03 0.97 0.88 2.40 4.00 5.08 cysteine protease Unclas sified I XAC3090 NS NS 0.93 NS 0.64 1.53 leucin rich protein Unclassified I

PAGE 91

91 Table 3 3 Continued Locus tag Gene symbol hrpGA /WA a hrpGB /WB a hrpGC /WC a hrpXA /WA a hrpXB /WB a hrpXC /WC a Description JCVI b Cluster c XAC4333 0.78 NS 1.30 NS 1.12 2.52 hy pothetical protein Unclassified I XAC0795 xcp 0.73 NS 0.81 0.62 0.81 1.83 protease Unclassified I XAC1433 asnB NS NS 0.79 NS NS NS asparagine synthetase B Amino acid biosynthesis III XAC1760 dapA NS NS 0.63 NS NS NS dihydrodipicolinate synthase Ami no acid biosynthesis IV XAC0336 metE NS NS 0.91 NS NS NS 5 methyltetrahydropteroyltrigluta mate -homocysteine methyltransferase Amino acid biosynthesis III XAC0306 gatA 0.66 NS NS NS NS NS amidase Biosynthesis of cofactors, prosthetic groups, and carrier s IV XAC0429 glgY NS NS 0.67 NS NS NS maltooligosyltrehalose synthase Cell envelope IV XAC0658 mreD 0.61 NS NS NS NS NS rod shape determining protein Cell envelope IV XAC3606 uptD NS NS 0.59 NS NS NS outer membran protein Cell envelope IV XAC0267 0.62 NS NS NS NS NS hypothetical protein Cell envelope IV XAC0677 NS NS 0.61 NS NS NS hypothetical protein Cell envelope IV XAC1749 0.67 NS NS NS NS NS hypothetical protein Cell envelope IV XAC4042 NS NS 0.68 NS NS NS hypothetical protein Cell envelope IV XAC3224 avrXac E2 0.84 NS NS NS NS NS avirulence protein Cellular processes NOT XAC2865 cheA NS NS 0.70 NS NS NS chemotaxis histidine protein kinase Cellular processes III XAC1904 cheY NS NS 0.99 NS NS NS chemotaxis response regulator Cellul ar processes III XAC1982 flgF NS NS 1.34 NS NS NS flagellar basal body rod protein FlgF Cellular processes III XAC1954 fliF NS NS 1.05 NS NS NS flagellar MS ring protein Cellular processes III XAC1953 fliG NS NS 1.09 NS NS NS flagellar protein Cellular processes III XAC1951 fliI NS NS 0.71 NS NS NS flagellar protein Cellular processes III XAC1950 fliJ 0.65 NS NS NS NS NS flagellar FliJ protein Cellular processes NOT

PAGE 92

92 Table 3 3 Continued Locus tag Gene symbol hrpGA /WA a hrpGB /WB a hrpGC /WC a hrpXA /WA a hr pXB /WB a hrpXC /WC a Description JCVI b Cluster c XAC1908 motB NS 0.98 NS NS NS NS flagellar motor protein MotD Cellular processes IV XAC0604 treA NS NS 0.62 NS NS NS trehalase Cellular processes III XAC3053 1.06 NS NS NS NS NS hypothetical protein Centr al intermediary metabolism IV XAC4223 rdgC NS 0.91 0.60 NS NS NS recombination associated protein DNA metabolism IV XAC0265 acdA 0.77 NS NS NS NS NS acyl CoA dehydrogenase Energy metabolism IV XAC0652 adhC NS NS 0.62 NS NS NS alcohol dehydrogenase cl ass III Energy metabolism III XAC2502 fruK 0.71 NS NS NS NS NS 1 phosphofructokinase (fructose 1 phosphate kinase) Energy metabolism IV XAC0548 GNL NS NS 0.80 NS NS NS gluconolactonase precursor Energy metabolism IV XAC0143 kdgK NS NS 0.60 NS NS NS 2 keto 3 deoxygluconate kinase Energy metabolism IV XAC3114 pqqG NS NS 0.70 NS NS NS pyrroloquinoline quinone biosynthesis protein PqqB Energy metabolism IV XAC1137 prpB NS 0.83 NS NS NS NS 2 methylisocitrate lyase Energy metabolism IV XAC3890 putA NS NS 0.94 NS NS NS bifunctional proline dehydrogenase/pyrroline 5 carboxylate dehydrogenase Energy metabolism III XAC0264 accD NS NS 0.89 NS NS NS acyl CoA carboxyltransferase beta chain Fatty acid and phospholipid metabolism III XAC1313 fadE9 NS NS 1.38 N S NS NS acyl CoA dehydrogenase Fatty acid and phospholipid metabolism III XAC2215 ea59 NS NS 0.68 NS NS NS hypothetical protein Hypothetical proteins III XAC1088 0.61 NS NS NS NS NS hypothetical protein Hypothetical proteins IV XAC2828 1.43 NS NS NS NS NS hypothetical protein Hypothetical proteins IV XAC2944 NS NS 0.64 NS NS NS hypothetical protein Hypothetical proteins III XAC2946 NS NS 0.65 NS NS NS hypothetical protein Hypothetical proteins III XAC3155 NS NS 0.72 NS NS NS hypothetical protein Hypothetical proteins IV XAC3763 NS NS 0.71 NS NS NS hypothetical protein Hypothetical proteins III

PAGE 93

93 Table 3 3 Continued Locus tag Gene symbol hrpGA /WA a hrpGB /WB a hrpGC /WC a hrpXA /WA a hrpXB /WB a hrpXC /WC a Description JCVI b Cluster c XAC3783 0. 88 NS NS NS NS NS hypothetical protein Hypothetical proteins NOT XAC1924 0.67 NS NS NS NS NS transposase Mobile and extrachromosomal element functions NOT XAC1945 fliO NS 1.38 NS NS NS NS flagellar protein Not in JCVI IV XAC2422 kfrA NS NS 0.81 NS NS NS plasmid related protein Not in JCVI III XAC2672 oar NS NS 1.13 NS NS NS Oar protein Not in JCVI III XACa0022 pthA1 0.82 0.81 NS NS NS NS avirulence protein Not in JCVI NOT XACa0039 pthA2 0.77 0.81 NS NS NS NS avirulence protein Not in JCVI NOT XACb 0015 pthA3 0.80 0.82 NS NS NS NS avirulence protein Not in JCVI NOT XACb0065 pthA4 0.80 0.76 NS NS NS NS avirulence protein Not in JCVI NOT XAC0260 NS NS 0.67 NS NS NS hypothetical protein Not in JCVI III XAC0549 NS NS 0.90 NS NS NS hypothetical pr otein Not in JCVI IV XAC0607 NS NS 0.63 NS NS NS hypothetical protein Not in JCVI IV XAC0747 0.77 NS NS NS NS NS hypothetical protein Not in JCVI NOT XAC1497 0.69 NS NS NS NS NS hypothetical protein Not in JCVI NOT XAC1971 NS NS 0.97 NS NS NS hypothetical protein Not in JCVI III XAC1972 NS NS 1.20 NS NS NS hypothetical protein Not in JCVI III XAC1990 NS NS 1.04 NS NS NS hypothetical protein Not in JCVI III XAC2929 0.82 NS NS NS NS NS hypothetical protein Not in JCVI IV XAC3131 NS N S 0.63 NS NS NS hypothetical protein Not in JCVI III XAC3268 0.66 NS NS NS NS NS hypothetical protein Not in JCVI NOT XAC3497 1.04 NS NS NS NS NS hypothetical protein Not in JCVI NOT XAC3523 0.67 NS NS NS NS NS hypothetical protein Not in JCVI IV XAC3636 NS NS 0.87 NS NS NS hypothetical protein Not in JCVI III XAC3680 NS NS 0.68 NS NS NS hypothetical protein Not in JCVI IV XAC4026 NS NS 0.70 NS NS NS hypothetical protein Not in JCVI III XAC4261 0.70 NS NS NS NS NS hypothetical protein Not in JCVI NOT XACa0002 0.68 NS NS NS NS NS hypothetical protein Not in JCVI NOT

PAGE 94

94 Table 3 3 Continued Locus tag Gene symbol hrpGA /WA a hrpGB /WB a hrpGC /WC a hrpXA /WA a hrpXB /WB a hrpXC /WC a Description JCVI b Cluster c XACa0030 NS NS 0.69 NS NS NS transp osase Not in JCVI III XACb0029 NS NS 0.94 NS NS NS hypothetical protein Not in JCVI III XACb0073 0.80 NS 0.70 NS NS NS hypothetical protein Not in JCVI NOT XAC2566 alg2 NS NS 0.93 NS NS NS glycosyltransferase Protein fate III XAC1521 grpE NS 0.63 NS NS NS NS heat shock protein GrpE Protein fate IV XAC3782 map 0.73 NS NS NS NS NS methionine aminopeptidase Protein fate NOT XAC0104 NS NS 0.73 NS NS NS metalloprotease Protein fate IV XAC1425 fasD NS NS 0.95 NS NS NS outer membrane usher protein F asD Protein synthesis III XAC1633 gcd 0.64 NS NS NS NS NS glucose dehydrogenase Protein synthesis IV XAC3089 NS NS 0.61 NS NS NS hypothetical protein Protein synthesis III XAC1989 flgM NS NS 1.00 NS NS NS flagellar protein Regulatory functions III X AC1573 phoU NS NS 1.14 NS NS NS phosphate regulon transcriptional regulator Regulatory functions III XAC1798 regS NS 0.60 NS NS NS NS two component system sensor protein Regulatory functions NOT XAC1877 rpfG NS NS 0.78 NS NS NS response regulator Regulat ory functions III XAC0917 0.73 NS NS NS NS NS transcriptional regulator Regulatory functions IV XAC1488 NS NS 0.95 NS NS NS sensor histidine kinase Regulatory functions III XAC2192 NS NS 0.76 NS NS NS two component system sensor protein Regulator y functions III XAC2897 NS NS 1.13 NS NS NS response regulator Regulatory functions III XAC3771 NS NS 0.67 NS NS NS hypothetical protein Regulatory functions III XAC1320 NS NS 0.72 NS NS NS regulatory protein Transcription IV XAC2503 fruA 0.81 NS 0.63 NS NS NS PTS system, fructose specific IIBC component Transport and binding proteins IV XAC1143 fyuA NS NS 0.93 NS NS NS TonB dependent receptor Transport and binding proteins III XAC3856 NS NS 0.73 NS NS NS hypothetical protein Transport and binding proteins IV XAC1906 cheW NS NS 1.11 NS NS NS chemotaxis protein Unclassified III

PAGE 95

95 Table 3 3 Continued Locus tag Gene symbol hrpGA /WA a hrpGB /WB a hrpGC /WC a hrpXA /WA a hrpXB /WB a hrpXC /WC a Description JCVI b Cluster c XAC0159 estA1 NS 0.64 NS NS NS N S carboxylesterase type B Unclassified NOT XAC1312 mmsA NS NS 1.69 NS NS NS methylmalonate semialdehyde dehydrogenase Unclassified III XAC1507 mobL NS 0.72 NS NS NS NS plasmid mobilization protein Unclassified IV XAC3228 orfS 0.64 NS NS NS NS NS coint egrate resolution protein S Unclassified IV XAC3229 orfT 0.69 NS NS NS NS NS cointegrate resolution protein T Unclassified IV XAC3605 uptE NS NS 0.67 NS NS NS outer membrane protein Unclassified IV XAC1315 NS NS 0.79 NS NS NS enoyl CoA hydratase Unc lassified III XAC1789 0.78 NS NS NS NS NS hypothetical protein Unclassified IV XAC2117 0.63 NS NS NS NS NS hypothetical protein Unclassified IV XAC2120 0.73 NS NS NS NS NS hypothetical protein Unclassified IV XAC3073 0.63 NS NS NS NS NS hypo thetical protein Unclassified NOT XAC3959 NS NS 0.98 NS NS NS hypothetical protein Unclassified NOT XAC0209 yojM NS NS 0.62 NS NS NS superoxide dismutase like protein Unclassified IV XAC1030 0.66 NS 0.76 NS NS NS hypothetical protein Unknown func tion IV XAC1939 NS NS 0.65 NS NS NS GGDEF family protein Unknown function III XAC1940 NS NS 0.82 NS NS NS GGDEF family protein Unknown function III XAC2483 1.21 NS NS NS NS NS hypothetical protein Unknown function IV XAC3314 0.61 NS NS NS NS N S hypothetical protein Unknown function NOT XAC1833 hisA NS NS NS NS NS 1.14 1 (5 phosphoribosyl) 5 [(5 phosphoribosylamino)methylid eneamino] imidazole 4 carboxamide isomerase Amino acid biosynthesis V XAC1831 hisB NS NS NS NS NS 1.19 imidazole glycerol phosphate dehydratase/histidinol phosphatase Amino acid biosynthesis V XAC1830 hisC NS NS NS 0.80 NS 1.18 histidinol phosphate aminotransferase Amino acid biosynthesis V

PAGE 96

96 Table 3 3 Continued Locus tag Gene symbol hrpGA /WA a hrpGB /WB a hrpGC /WC a hrpXA /WA a hrpXB /WB a hrpXC /WC a Description JCVI b Cluster c XAC1829 hisD NS NS NS 0.72 NS 1.02 histidinol dehydrogenase Amino acid biosynthesis V XAC1834 hisF NS NS NS NS NS 1.07 imidazole glycerol phosphate synthase subunit HisF Amino acid biosynthesis V XAC1828 hisG NS NS NS NS NS 0.87 ATP phosphoribosyltransferase Amino acid biosynthesis V XAC1832 hisH NS NS NS 0.66 NS 1.11 imidazole glycerol phosphate synthase subunit HisH Amino acid biosynthesis V XAC3451 ilvC NS NS NS NS NS 0.71 ketol acid reductoisomera se Amino acid biosynthesis I XAC3452 ilvG NS NS NS NS NS 0.67 acetolactate synthase 2 catalytic subunit Amino acid biosynthesis I XAC3340 cysG NS NS NS NS NS 0.68 siroheme synthase Biosynthesis of cofactors, prosthetic groups, and carriers V XAC4062 fh uA NS NS NS NS NS 0.68 TonB dependent receptor Cell envelope I XAC2374 pglA NS NS NS NS NS 0.78 polygalacturonase Cell envelope I XAC1142 NS NS NS 0.76 NS NS hypothetical protein Cell envelope NOT XAC0557 appA NS NS NS NS NS 0.80 6 phytase Central i ntermediary metabolism V XAC4369 phoC NS NS NS NS NS 0.68 phosphatase precursor Central intermediary metabolism I XAC0803 NS NS NS NS NS 0.66 methyltransferase DNA metabolism I XAC3312 NS NS NS 0.81 NS NS glycosyl hydrolase Energy metabolism NOT XAC3960 NS NS NS NS NS 0.90 oxidoreductase Energy metabolism V XAC3655 atpB NS NS NS NS NS 0.60 F0F1 ATP synthase subunit A Energy metabolism V XAC3869 bglX NS NS NS NS NS 0.60 beta glucosidase Energy metabolism V XAC3884 cox3 NS NS NS 0.67 NS NS cyt ochrome C oxidase subunit III Energy metabolism NOT XAC4251 hrmI NS NS NS NS NS 0.61 glucuronate isomerase Energy metabolism I

PAGE 97

97 Table 3 3 Continued Locus tag Gene symbol hrpGA /WA a hrpGB /WB a hrpGC /WC a hrpXA /WA a hrpXB /WB a hrpXC /WC a Description JCVI b Clu ster c XAC4221 NS NS NS NS NS 0.63 hydrolase Fatty acid and phospholipid metabolism V XAC1013 NS NS NS NS NS 0.61 hypothetical protein Hypothetical proteins V XAC4021 NS NS NS NS NS 0.65 hypothetical protein Hypothetical proteins I XAC1056 NS N S NS NS NS 0.67 hypothetical protein Not in JCVI V XAC1681 NS NS NS NS NS 0.77 hypothetical protein Not in JCVI I XAC1715 NS NS NS NS NS 0.66 hypothetical protein Not in JCVI I XAC2009 NS NS NS NS NS 1.31 hypothetical protein Not in JCVI I XAC 2517 NS NS NS NS NS 0.67 hypothetical protein Not in JCVI I XAC4063 NS NS NS NS NS 0.95 hypothetical protein Not in JCVI I XAC4321 NS NS NS NS NS 0.87 hypothetical protein Not in JCVI I XAC0108 atsE NS NS NS 0.67 NS NS AtsE Not in JCVI NOT XAC 2300 rpmJ NS NS NS NS NS 0.60 50S ribosomal protein L36 Not in JCVI V XAC1680 NS NS NS NS NS 0.72 serine protease Protein fate I XAC1014 NS NS NS NS NS 0.75 pseudouridylate synthase Protein synthesis V XAC2164 NS NS NS NS NS 0.61 hypothetical pr otein Protein synthesis I XAC1555 NS NS NS 0.65 NS NS transcriptional regulator Regulatory functions NOT XAC2163 NS NS NS NS NS 0.74 hypothetical protein Regulatory functions I XAC2166 NS NS NS NS NS 1.02 transcriptional regulator Regulatory fu nctions I XAC3445 NS NS NS 2.22 2.88 3.46 transcriptional regulator Regulatory functions NOT XAC3446 NS NS NS 0.71 NS NS hypothetical protein Regulatory functions NOT XAC4272 NS NS NS 0.62 NS NS LacI family transcription regulator Regulatory fun ctions NOT XAC1682 rpoE NS NS NS NS NS 0.82 RNA polymerase sigma E factor Transcription I XAC1705 NS NS NS NS NS 0.79 MFS transporter Transport and binding proteins I

PAGE 98

98 Table 3 3 Continued Locus tag Gene symbol hrpGA /WA a hrpGB /WB a hrpGC /WC a hrpXA /W A a hrpXB /WB a hrpXC /WC a Description JCVI b Cluster c XAC0758 kdpC NS NS NS 0.93 NS NS potassium transporting ATPase subunit C Transport and binding proteins NOT XAC0828 nrtCD NS NS NS NS NS 0.75 ABC transporter ATP binding component Transport and binding pr oteins V XAC3488 suc1 NS NS NS 0.89 NS NS sugar transporter Transport and binding proteins NOT XAC0340 NS NS NS NS NS 0.96 hypothetical protein Unclassified I XAC0418 NS NS NS NS NS 0.69 hypothetical protein Unclassified I XAC1651 NS NS NS NS NS 0.76 TonB like protein Unclassified I XAC2788 NS NS NS NS NS 0.73 hypothetical protein Unclassified I XAC2832 NS NS NS NS NS 0.83 hypothetical protein Unclassified I XAC4184 NS NS NS 0.61 NS NS oxidoreductase Unclassified NOT XAC0263 accC NS NS NS 0.61 NS NS biotin carboxylase Unclassified NOT XAC1835 hisI NS NS NS NS NS 1.06 bifunctional phosphoribosyl AMP cyclohydrolase/phosphoribosyl ATP pyrophosphatase protein Unclassified V XAC0757 kdpB NS NS NS 1.51 NS NS potassium transporting ATPa se subunit B Unclassified NOT XAC2165 NS NS NS NS NS 0.91 hydrolase Unknown function I a Log 2 fold chan ge was derived from mutant versus wild type at time points A, B, and C. NS = not significantly differentially expressed (|log 2 fold change| < 0.585 or false discovery rate > 0.05). b J. Craig Venter Institute (JCVI) functional categories. c Clusters were assigned based on clustering analysis. NOT = not assigned in any cluster. Genes highlighted in bold letter belong to HrpX regulon but showed subt le e xpression changes ( |log 2 fold change| < 0.585 with false discovery rate < 0.05) in hrpG mutant in at least one of the three time points.

PAGE 99

99 Table 3 4 Confirmed and putative type III secretion system effectors Effector family Locus tag Domain a Cluster Homolo gy Reference AvrBs2 XAC0076 pfam03009 GDPD I AvrBs2 in X. campestris pv. vesicatoria Kearney and Staskawicz 1990 AvrBs3(PthA1) XACa0022 pfam03377 Avirulence NC Al Saadi et al. 2007 AvrBs3(PthA2) XACa0039 pfam03377 Avirulence NC Al Saad i et al. 2007 AvrBs3(PthA3) XACb0015 pfam03377 Avirulence NC Al Saadi et al. 2007 AvrBs3(PthA4) XACb0065 pfam03377 Avirulence NC Al Saadi et al. 2007 HrpW (PopW) XAC2922 pfam03211 Pectate_lyase I Figueiredo et al. 2011 XopAD (Skwp,RSc3401) XAC4213 I Skwp from R. solanacearum Guidot et al. 2007 XopAE (HpaF/G/PopC) XAC0393 pfam00560 LRR_1 I Xcv8510 from X. campestris pv. vesic atoria Nol et al. 2002 XopAI (HopO1 (HopPto, HopPtoS), HopAI1 (HolPtoAI)) XAC3230 pfam01129 ART I XopE2 and XopE1 from X. campestris pv. vesicatoria Thieme et al. 2007 XopAK (HopAK1 (HopPtoK, HolPtoAB) C terminal domain) XAC3666 I HopAK1 from P. syringae pv. tomato Buell et al. 2003 XopE1 (AvrXacE1, HopX, AvrPphE) XAC0286 I AvrXacE1 and XopE1 from X. campestris pv. vesicatoria Thieme et al. 2007 XopE2 (AvrXacE3, AvrXccE1) XACb0011 I XopE2 from X. campestris pv. vesicatoria Thieme et al. 2007 XopE3 (AvrXacE2, HopX, AvrPphE) XAC3224 NC AvrXacE2 Hajri et al. 2009 XopF2 XAC2785 NS XopF2 from X. campest ris pv. vesicatoria Roden et al. 2004 XopI XAC0754 pf am00646 F box I Thiem e et al. 2007 XopK XAC3085 I XOO1669 from X. oryzae pv. oryzae Furutani et al. 2009 XopL XAC3090 pfam00560 LRR_1 I Song and Yang 2010 XopN (HopAU1) XAC2786 I XopN fro m X. campestris pv. vesicatoria Kim et al. 2009a XopP XAC1208 I XopP from X. campestris pv. vesicatoria Roden et al. 2004

PAGE 100

100 Table 3 4 Continued Effector family Locus tag Domain a Cluster Homology Reference XopQ (HopQ1) XAC4333 pfam01156 IU_nuc_hydro I XopQ from X. campestris pv. vesicatoria Roden et al. 2004 XopR XAC0277 I XOO4134 from X. oryzae pv. oryzae Furutani et al. 2009 XopV XAC0601 I XOO3803 from X. oryzae pv. oryzae Furutani et al. 2009 XopX (HolPsyAE) XAC0543 I XopX from X. campestris pv. vesicatoria Metz et al. 2005 XopZ (HopAS, AWR) XAC2009 I XOO2402 from X. oryzae pv. oryzae Furutani et al. 2009 XAC2990 pfam01764 Lipase_3 I RCFBP_mp20163 from R. solanacearum Remenant et al. 2010 a domain analysis by Pfam. I, cluster I; NC, not in clusters; NS, no significant change on expr ession

PAGE 101

101 Table 3 5 Confirmed and putative type II secretion system substrate proteins Locus tag Regulon S P a Domains b Description References Experimentally validated T2SS substrates XAC0435 HrpG & HrpX YES pfam06903 VirK VirK protein Yamazaki et al. 2008 XAC0552 HrpG & HrpX YES pfam00082 Peptidase_S8 pfam09286 Pro kuma_activ proteinase Yamazaki et al. 2008 XAC0661 HrpG & HrpX YES pfam00295 Glyco_hydro_28 endopolygalacturonase Yamazaki et al. 2008 XAC0795 HrpG & HrpX YES pfam00082 Peptidas e_S8; pfam09286 Pro kuma_activ protease Yamazaki et al. 2008 XAC0817 HrpG & HrpX YES pfam03422 CBM_6; pfam08306 Glyco_hydro_98M; pfam08307 Glyco_hydro_98C hypot hetical protein Yamazaki et al. 2008 XAC2374 HrpX YES pfam00295 Glyco_hydro_28 polygalacturonase Yamazaki et al. 2008 XAC2831 HrpG & HrpX YES pfam00082 Peptidase_S8; pfam01483 P_proprotein extracellular serine protease Yamazaki et al. 2008 XAC 2853 HrpG & HrpX YES pfam00112 Peptidase_C1 cysteine protease Yamazaki et al. 2008 Predicted T2S substrate XAC3451 HrpX YES pfam01450 IlvC; pfam07991 IlvN ketol acid reductoisomerase XAC3878 HrpG & HrpX YES pfam00085 Thioredoxin disulphide isomerase XAC4252 HrpG & HrpX YES pfam00331 Glyco_hydro_10 xylanase XAC4321 HrpX YES hypothetical protein; XCV4423, putative secreted protein; Thieme et al. 2005 XAC4327 HrpG & HrpX YES pfam01425 Amidase allophanate hydrolase XAC4369 HrpX YES pfam01569 PAP2 phosphatase precursor XAC0363 HrpG & HrpX YES pfam00355 Rieske vanillate O demethylase oxygenase subunit X AC0501 HrpG & HrpX YES pfam03583 LIP hypothecital protein, XAUB_33320, secreted lipase; Moreira et al. 2010 XAC0803 HrpX YES pfam08241 Methyltransf_11 methyltransferase XAC1241 HrpG & HrpX YES hypothetical protein; XALc_3071, hypothetical secreted protein; Pieretti et al. 2009 XAC2113 HrpG & HrpX YES pfam11737 DUF3300 hypothetical protein; XAUC_07560, secreted protein; Mor eira et al. 2010

PAGE 102

102 Table 3 5 Continued Locus tag Regulon S P a Domains b Description References XAC2370 HrpG & HrpX YES hypothetical protein; XCV2568, putative secredted protein; Thieme et al. 2005 XAC3647 HrpG & HrpX YES pfam01817 CM_2 chorismate mutase AroQ ; Degrassi et al. 2010 XAC0395 HrpG & HrpX YES hypothetical protein XAC0418 HrpX YES hypothetical protein XAC1124 HrpG & HrpX YES pfam08670 MEKHLA hypothetical protein XAC4021 HrpX YES pfam08811 DUF1800 hypothetical protein XAC2832 HrpX YES hypothetic al protein XAC4063 HrpX YES pfam11287 DUF3088 hypothetical protein XAC4318 HrpG & HrpX YES hypothetical protein a SP, signal peptide prediction using Phobius b domain analysis using Pfam database.

PAGE 103

103 Table 3 6 Regulatory genes under control of H rpG and/or HrpX. JCVI a Locus tag Gene symbol hrpGA/ WA b hrpGB/ WB b hrpGC/ WC b hrpXA/ WA b hrpXB/ WB b hrpXC/ WC b D escription Both R XAC1171 stkXac1 0.984 NS 1.031 NS 0.778 2.025 serine/threonine kinase R XAC0880 pcaQ 0.675 NS 0.854 NS 0.883 1.999 transcri ptional regulator R XAC1455 0.638 NS NS NS NS 1.195 MarR family transcriptional regulator HrpG regulon T XAC1320 NS NS 0.716 NS NS NS regulatory protein U XAC1939 NS NS 0.652 NS NS NS GGDEF family protein R XAC3771 NS NS 0.675 NS NS NS hypotheti cal protein; pfam03466 LysR substrate binding domain c R XAC2192 NS NS 0.759 NS NS NS two component system sensor protein R XAC1877 rpfG NS NS 0.780 NS NS NS response regulator U XAC1940 NS NS 0.817 NS NS NS GGDEF family protein R XAC1488 NS NS 0. 951 NS NS NS sensor histidine kinase R XAC1989 flgM NS NS 0.995 NS NS NS flagellar protein R XAC2897 NS NS 1.128 NS NS NS response regulator R XAC1573 phoU NS NS 1.139 NS NS NS phosphate regulon transcriptional regulator R XAC1798 regS NS 0.601 NS NS NS NS two component system sensor protein R XAC0917 0.734 NS NS NS NS NS transcriptional regulator HrpX regulon R XAC2166 NS NS NS NS NS 1.021 transcriptional regulator R XAC2163 NS NS NS NS NS 0.742 hypothetical protein; pfam07969 Amidohydrola se family c

PAGE 104

104 Table 3 6 Continued JCVI a Locus tag Gene symbol hrpGA/ WA b hrpGB/ WB b hrpGC/ WC b hrpXA/ WA b hrpXB/ WB b hrpXC/ WC b D escription R XAC3445 NS NS NS 2.221 2.879 3.457 transcriptional regulator R XAC3446 NS NS NS 0.708 NS NS hypothetical protein; pfam00486 Transcriptional regulatory protein, C terminal c R XAC4272 NS NS NS 0.617 NS NS LacI family transcription regulator R XAC1555 NS NS NS 0.653 NS NS transcriptional regulator T XAC1682 rpoE NS NS NS NS NS 0.822 RNA polymerase sigma E factor a JCVI functional categories. Categories: R = regulatory functions, T = transcription, U = unknown function. b Log 2 ratio of fold change was derived from mutants versus wild type at timepoints A, B, and C. NS: not significantly differentially expressed ( log 2 fold change < 0.585 or FDR > 0.05) c Pfam analysis of the hypothetical proteins.

PAGE 105

105 Table 3 7 Genes showing significant differential expression in both hrpG and hrpX mutants compared with wild type strain at selected time points. JCVI a Locus tag G ene symbol hrpGA /WA b hrpGB /WB b hrpGC /WC b hrpXA /WA b hrpXB /WB b hrpXC /WC b D escription Cluster c Genes with significant differential expression in both hrpG and hrpX mutant at time point A Amino acid biosynthesis XAC3647 pheA 1.54 0.76 1.22 1.53 2.15 3.76 chorismate mutase I Cell envelope XAC0661 peh 1 1.50 0.68 1.13 1.38 1.83 2.65 endopolygalacturonase I Cell envelope XAC2922 hrpW 1.77 NS 1.42 1.92 2.77 4.50 HrpW protein I Cell envelope XAC3878 1.06 NS 0.97 0.92 1.61 3.05 disulphide isome rase I Cellular processes XAC0782 ftsQ 0.76 0.76 NS 0.74 NS NS cell division protein NOT Cellular processes XAC1265 hrpG 1.52 2.60 4.19 1.57 0.91 NS HrpG protein NOT Cellular processes XAC4340 yrbE 0.63 NS NS 0.64 NS NS toluene tolerance protein NOT Central intermediary metabolism XAC0878 pcaH 0.76 NS 1.10 0.76 1.00 2.33 protocatechuate 4,5 dioxygenase subunit beta I Energy metabolism XAC3885 cox11 0.62 NS NS 0.68 NS NS cytochrome C oxidase assembly protein NOT Energy metabolism XAC3887 ctaD 0.60 NS NS 0.65 NS NS cytochrome C oxidase subunit I NOT Hypothetical proteins XAC0501 1.37 NS 1.35 0.93 1.95 3.20 hypothetical protein I Hypothetical proteins XAC2782 0.65 NS NS 0.67 NS NS hypothetical protein NOT Not in JCVI XAC0543 1.68 0.74 1.42 1.72 3.44 5.12 hypothetical protein I Not in JCVI XAC1172 0.73 NS 1.31 0.77 1.17 2.78 hypothetical protein I Not in JCVI XAC2654 1.71 0.63 1.20 2.64 3.82 5.35 hypothetical protein I Not in JCVI XAC2786 1.44 NS 1.73 1. 15 2.99 4.83 hypothetical protein I Not in JCVI XAC3646 1.30 0.74 1.02 0.91 1.52 2.59 hypothetical protein I Not in JCVI XACb0011 avrXacE3 0.98 NS 1.25 0.71 1.64 3.25 avirulence protein I Protein fate XAC0286 avrXacE1 0.90 NS 1.21 0.91 1. 18 2.56 avirulence protein I Protein fate XAC0407 hrpB1 1.23 NS 2.18 1.78 2.86 4.57 HrpB1 protein I Protein fate XAC0408 hrpB2 0.94 NS 1.90 1.11 1.95 3.72 HrpB2 protein I Protein fate XAC0410 hrpB4 0.92 NS 1.66 0.75 1.52 2.95 HrpB4 protein I Protein synthesis XAC0404 hpaP 0.70 NS 1.36 0.63 1.11 2.51 HpaP protein I

PAGE 106

106 Table 3 7 Continued JCVI a Locus tag Gene symbol hrpGA /WA b hrpGB /WB b hrpGC /WC b hrpXA /WA b hrpXB /WB b hrpXC /WC b D escription Cluster c Protein synthesis XAC0416 hpa1 1.93 NS 1.4 2 1.60 4.29 5.54 Hpa1 protein I Transport and binding proteins XAC1556 fucP 0.71 NS NS 0.64 NS NS glucose galactose transporter NOT Transport and binding proteins XAC3444 btuB 0.94 NS NS 5.13 4.13 3.42 TonB dependent receptor NOT Unclassified XAC0 399 hrpD5 0.74 NS 1.64 0.73 1.55 3.08 HrpD5 protein I Unclassified XAC0409 hrcJ 1.03 NS 1.90 1.07 2.18 3.81 HrcJ protein I Unclassified XAC0435 virK 1.49 0.67 1.15 1.54 2.31 3.55 VirK protein I Unclassified XAC0552 0.99 NS 1.24 1.35 1.7 9 2.99 proteinase I Unclassified XAC0795 xcp 0.73 NS 0.81 0.62 0.81 1.83 protease I Unclassified XAC1266 hrpXct 1.93 0.95 NS 1.60 1.97 1.58 HrpX protein NOT Unclassified XAC2853 2.03 0.97 0.88 2.40 4.00 5.08 cysteine protease I Genes with si gnificant differential expression in both hrpG and hrpX mutant at time point B Amino acid biosynthesis XAC3647 pheA 1.54 0.76 1.22 1.53 2.15 3.76 chorismate mutase I Cell envelope XAC0661 peh 1 1.50 0.68 1.13 1.38 1.83 2.65 endopolygalacturonase I Cellular processes XAC1265 hrpG 1.52 2.60 4.19 1.57 0.91 NS HrpG protein NOT Not in JCVI XAC2654 1.71 0.63 1.20 2.64 3.82 5.35 hypothetical protein I Not in JCVI XAC0543 1.68 0.74 1.42 1.72 3.44 5.12 hypothetical protein I Not in JCVI XAC3646 1.30 0.74 1.02 0.91 1.52 2.59 hypothetical protein I Unclassified XAC2853 2.03 0.97 0.88 2.40 4.00 5.08 cysteine protease I Unclassified XAC0435 virK 1.49 0.67 1.15 1.54 2.31 3.55 VirK protein I Unclassified XAC1266 hrpXct 1.93 0 .95 NS 1.60 1.97 1.58 HrpX protein NOT Genes with significant differential expression in both hrpG and hrpX mutant at time point C Amino acid biosynthesis XAC3647 pheA 1.54 0.76 1.22 1.53 2.15 3.76 chorismate mutase I Amino acid biosynthesis XAC0802 NS NS 0.65 NS 0.61 1.79 sulfotransferase I Amino acid biosynthesis XAC4213 NS NS 0.69 NS NS 1.12 hypothetical protein I

PAGE 107

107 Table 3 7 Continued JCVI a Locus tag Gene symbol hrpGA /WA b hrpGB /WB b hrpGC /WC b hrpXA /WA b hrpXB /WB b hrpXC /WC b D escription C luster c Amino acid biosynthesis XAC1525 tyrA NS NS 0.86 NS NS 0.76 prephenate dehydrogenase II Biosynthesis of cofactors, prosthetic groups, and carriers XAC2947 apbE NS NS 0.93 NS 0.64 0.73 thiamine biosynthesis lipoprotein ApbE precursor II Cell envel ope XAC2922 hrpW 1.77 NS 1.42 1.92 2.77 4.50 HrpW protein I Cell envelope XAC3878 1.06 NS 0.97 0.92 1.61 3.05 disulphide isomerase I Cell envelope XAC0661 peh 1 1.50 0.68 1.13 1.38 1.83 2.65 endopolygalacturonase I Cell envelope XAC2113 NS NS 0.91 NS NS 0.86 hypothetical protein I Cellular processes XAC0397 hrpE 1.30 NS 1.03 NS 1.82 2.91 HrpE protein I Cellular processes XAC0394 hrpF 0.79 NS 1.59 NS 1.21 2.64 HrpF protein I Cellular processes XAC0406 hrcU NS NS 1.66 0.65 1.0 5 2.53 type III secretion system protein HrcU I Cellular processes XAC0403 hrcQ NS NS 1.12 NS 0.86 2.06 HrcQ protein I Cellular processes XAC0400 hpaA NS NS 1.23 NS 0.75 2.01 HpaA protein I Cellular processes XAC0076 avrBs2 NS NS 1.09 NS NS 1.9 8 avirulence protein I Central intermediary metabolism XAC0878 pcaH 0.76 NS 1.10 0.76 1.00 2.33 protocatechuate 4,5 dioxygenase subunit beta I DNA metabolism XAC0002 dnaN 0.59 NS 0.75 NS NS 0.70 DNA polymerase III subunit beta II Energy metabolism X AC0879 ligA 0.86 NS 1.14 NS 1.02 2.38 protocatechuate 4,5 dioxygenase subunit alpha I Energy metabolism XAC4327 uahA NS NS 0.79 NS NS 1.43 allophanate hydrolase I Energy metabolism XAC4252 xynB NS NS 0.68 NS NS 1.13 xylanase I Energy metabolism X AC0363 vanA NS NS 0.61 NS NS 1.04 vanillate O demethylase oxygenase subunit I Energy metabolism XAC1439 tpmT NS NS 1.54 NS NS 1.33 thiopurine S methyltransferase II

PAGE 108

108 Table 3 7 Continued JCVI a Locus tag Gene symbol hrpGA /WA b hrpGB /WB b hrpGC /WC b hrpXA /W A b hrpXB /WB b hrpXC /WC b D escription Cluster c Fatty acid and phospholipid metabolism XAC2990 NS NS 0.61 NS NS 0.82 hypothetical protein I Fatty acid and phospholipid metabolism XAC0562 mdcB NS NS 0.93 NS NS 0.72 malonate decarboxylase subunit beta II Hypothetical proteins XAC0501 1.37 NS 1.35 0.93 1.95 3.20 hypothetical protein I Hypothetical proteins XAC1208 NS NS 0.99 NS 0.76 2.16 hypothetical protein I Hypothetical proteins XAC0601 0.97 NS 0.98 NS 0.74 1.91 hypothetical protein I Hypothetical proteins XAC1124 NS NS 0.62 NS 0.67 1.30 hypothetical protein I Hypothetical proteins XAC0916 NS NS 0.90 NS NS 1.13 hydrolase I Hypothetical proteins XAC4019 NS NS 0.76 NS NS 0.62 hypothetical protein II Hypothetical proteins XAC 1689 0.75 NS 0.86 NS NS 0.89 hypothetical protein II Hypothetical proteins XAC2827 0.83 NS 0.85 NS NS 1.05 hypothetical protein II Hypothetical proteins XAC3222 NS NS 1.29 NS NS 1.12 hypothetical protein II Not in JCVI XAC2654 1.71 0.63 1.20 2 .64 3.82 5.35 hypothetical protein I Not in JCVI XAC0543 1.68 0.74 1.42 1.72 3.44 5.12 hypothetical protein I Not in JCVI XAC2786 1.44 NS 1.73 1.15 2.99 4.83 hypothetical protein I Not in JCVI XAC3085 NS NS 1.56 NS 1.72 3.87 hypotheti cal protein I Not in JCVI XACb0011 0.98 NS 1.25 0.71 1.64 3.25 avirulence protein I Not in JCVI XAC1172 0.73 NS 1.31 0.77 1.17 2.78 hypothetical protein I Not in JCVI XAC0277 0.72 NS 1.20 NS 1.24 2.67 hypothetical protein I Not in JCVI XAC3646 1.30 0.74 1.02 0.91 1.52 2.59 hypothetical protein I Not in JCVI XAC2787 NS NS 1.11 NS 0.96 2.46 hypothetical protein I Not in JCVI XAC3230 0.96 NS 1.04 NS 1.15 2.33 hypothetical protein I Not in JCVI XAC0395 NS NS 1.22 NS 0 .86 2.00 hypothetical protein I Not in JCVI XAC1241 1.26 NS 0.88 NS 0.97 1.89 hypothetical protein I Not in JCVI XAC2370 0.79 NS 0.87 NS 0.77 1.74 hypothetical protein I

PAGE 109

109 Table 3 7 Continued JCVI a Locus tag Gene symbol hrpGA /WA b hrpGB /WB b hr pGC /WC b hrpXA /WA b hrpXB /WB b hrpXC /WC b D escription Cluster c Not in JCVI XAC2876 0.71 NS 0.81 NS 0.68 1.67 hypothetical protein I Not in JCVI XAC0315 0.80 NS 0.86 NS 0.71 1.63 hypothetical protein I Not in JCVI XAC0817 0.87 NS 0.61 NS 0.71 1.49 hypothetical protein I Not in JCVI XAC1683 NS NS 0.65 NS NS 1.03 hypothetical protein I Not in JCVI XAC4318 NS NS 0.59 NS NS 0.60 hypothetical protein I Not in JCVI XACa0013 0.76 0.62 0.68 NS NS 0.61 hypothetical protein II Not in JCVI X AC0786 NS NS 0.75 NS NS 0.61 hypothetical protein II Not in JCVI XAC3337 NS NS 0.70 NS NS 0.67 hypothetical protein II Not in JCVI XACa0021 repA NS NS 0.82 NS NS 0.75 replication protein A II Not in JCVI XACb0049 NS NS 0.83 NS NS 0.78 hypothetical protein II Not in JCVI XACb0057 0.63 NS 0.79 NS NS 0.83 hypothetical protein II Not in JCVI XAC3291 NS NS 0.75 NS NS 0.87 hypothetical protein II Not in JCVI XAC3984 NS NS 0.83 NS NS 0.88 hypothetical protein II Not in JCVI XAC1412 NS NS 1.08 NS NS 0.95 hypothetical protein II Not in JCVI XAC2425 NS NS 1.36 NS NS 1.24 hypothetical protein II Not in JCVI XAC1563 NS NS 1.51 NS NS 1.29 hypothetical protein II Not in JCVI XAC0099 1.09 NS 1.17 NS NS 1.33 hypothetical protein II Not in JCVI XAC2442 NS NS 1.67 NS NS 1.39 hypothetical protein II Not in JCVI XAC1572 NS NS 2.40 NS NS 1.62 hypothetical protein II Not in JCVI XAC0617 NS NS 1.67 NS NS 1.63 hypothetical protein II Not in JCVI XACb0034 NS NS 2.17 NS NS 1.93 hypothetical pr otein II Not in JCVI XAC2357 NS NS 1.94 NS NS 1.95 hypothetical protein II Protein fate XAC0407 hrpB1 1.23 NS 2.18 1.78 2.86 4.57 HrpB1 protein I Protein fate XAC0408 hrpB2 0.94 NS 1.90 1.11 1.95 3.72 HrpB2 protein I Protein fate XAC0410 hrpB 4 0.92 NS 1.66 0.75 1.52 2.95 HrpB4 protein I Protein fate XAC0401 hrcS NS NS 1.52 NS 1.08 2.57 HrcS protein I

PAGE 110

110 Table 3 7 Continued JCVI a Locus tag Gene symbol hrpGA /WA b hrpGB /WB b hrpGC /WC b hrpXA /WA b hrpXB /WB b hrpXC /WC b D escription Cluster c Prot ein fate XAC0286 avrXacE1 0.90 NS 1.21 0.91 1.18 2.56 avirulence protein I Protein fate XAC0411 hrpB5 NS NS 1.34 NS 0.85 2.09 type III secretion system protein HrpB I Protein fate XAC0402 hrcR NS NS 1.26 NS 0.87 2.03 type III secretion system p rotein I Protein fate XAC0414 hrcT NS NS 1.16 NS 0.68 1.95 HrcT protein I Protein fate XAC0413 hrpB7 NS NS 1.11 NS 0.66 1.90 HrpB7 protein I Protein fate XAC0415 hrcC NS NS 1.58 NS NS 1.60 HrcC protein I Protein fate XAC2831 NS NS 0.71 NS NS 0.97 extracellular serine protease I Protein fate XAC1085 ppiD NS NS 0.85 NS NS 0.64 peptidyl prolyl cis trans isomerase II Protein synthesis XAC0416 hpa1 1.93 NS 1.42 1.60 4.29 5.54 Hpa1 protein I Protein synthesis XAC0404 hpaP 0.70 NS 1.36 0.6 3 1.11 2.51 HpaP protein I Protein synthesis XAC3977 NS NS 1.38 NS NS 1.30 hypothetical protein II Regulatory functions XAC1171 stkXac1 0.98 NS 1.03 NS 0.78 2.03 serine/threonine kinase I Regulatory functions XAC0880 pcaQ 0.68 NS 0.85 NS 0.88 2.00 transcriptional regulator I Transport and binding proteins XAC0412 hrcN NS NS 1.22 NS 0.82 2.10 type III secretion system ATPase I Unclassified XAC2853 2.03 0.97 0.88 2.40 4.00 5.08 cysteine protease I Unclassified XAC0409 hrcJ 1.03 NS 1. 90 1.07 2.18 3.81 HrcJ protein I Unclassified XAC0435 virK 1.49 0.67 1.15 1.54 2.31 3.55 VirK protein I Unclassified XAC0398 hrpD6 1.09 NS 1.72 NS 1.63 3.21 HrpD6 protein I Unclassified XAC0399 hrpD5 0.74 NS 1.64 0.73 1.55 3.08 HrpD5 prote in I Unclassified XAC0552 0.99 NS 1.24 1.35 1.79 2.99 proteinase I Unclassified XAC0396 hpaB NS NS 1.67 NS 1.25 2.79 HpaB protein I Unclassified XAC4333 0.78 NS 1.30 NS 1.12 2.52 hypothetical protein I Unclassified XAC0393 hpaF NS NS 1.3 2 NS NS 2.06 HpaF protein I

PAGE 111

111 Table 3 7 Continued JCVI a Locus tag Gene symbol hrpGA /WA b hrpGB /WB b hrpGC /WC b hrpXA /WA b hrpXB /WB b hrpXC /WC b D escription Cluster c Unclassified XAC0754 NS NS 0.88 NS 0.73 1.85 hypothetical protein I Unclassified XAC040 5 hrcV NS NS 1.14 NS 0.84 1.85 HrcV protein I Unclassified XAC0795 xcp 0.73 NS 0.81 0.62 0.81 1.83 protease I Unclassified XAC3090 NS NS 0.93 NS 0.64 1.53 leucin rich protein I Unclassified XAC3170 bioI NS NS 0.73 NS NS 1.40 cytochrome P 4 50 hydroxylase I Unclassified XAC0417 hpa2 NS NS 0.94 NS NS 1.23 Hpa2 protein I Unclassified XAC2178 NS NS 0.71 NS NS 0.62 hypothetical protein II Unclassified XAC2123 NS NS 0.71 NS NS 0.65 hypothetical protein II Unclassified XAC2653 S NS NS 0.8 1 NS NS 0.73 phage related tail protein II a J. Craig Venter Institute (JCVI) functional categories. b Log 2 fold chan ge was derived from mutant versus wild type strain at time points A, B, and C. NS = not significantly differentially expressed (|log 2 fold change| < 0.585 or false discovery rate > 0.05). c Clusters were assigned based on clustering analysis. NOT = not assigned in any cluster.

PAGE 112

112 Figure 3 1. Growth curves of XCC strains in XVM2 medium. W: wild type XCC strain 306; hrpX: hrpX mutant; hrpG: hrpG mutant. The experiments were performed in triplicate and repeated three times with similar results and only one representative result was presented. The error bars represent the standard deviations of the means. Cell cultures were obtained at three different time points. A, B and C represent the time points of cell culture sampling, OD 0.25, 0.4 and 0.5, respectively.

PAGE 113

113 Fi gure 3 2. Pathogenicity assay of XCC strains by infiltration. 1: the mocked inoculation by sterile tap water; 2: wild type XC C strain 306; 3: hrpG mutant; 4: hrpG mutant carrying the complementation plasmid phrpGC. 5: hrpG mutant carrying the empty plasmid pUFR053. The assay was repeated three times independently using both 10 8 and 10 5 CFU/ mL concentrations. The experiments were repeated three times with similar results and only one result was presented. The leaf shown was inoculated with 10 8 CFU/ mL of strains and photographed on 5 DPI.

PAGE 114

114 Figure 3 3 Diagram displaying the numbers of differentially expressed genes resulting fr om the comparison of the hrpG mutant versus the wild type strain and the hrpX mutant versus wild type strain at selected timepoints. Genes with the absolute value of log 2 fold change >0.585 and false discovery rate <0.05 were selected as significantly diff erentially expressed genes. Black columns represent overexpressed genes in mutants and white columns represent underexpressed genes in either the hrpX or hrpG mutant. Numbers adjacent to the columns represent the numbers of genes in each condition.

PAGE 115

115 Fig ure 3 4. Comparison of gene expression by quantitative reverse transcription polymerase chain reaction (QRT PCR) and microarray. The log 2 fold change of each gene was derived from the comparison of either hrpX or hrpG mutant versus wild type at timepoint C Two genes, 16S rRNA and gyrA were used as endogenous controls in QRT PCR, both resulting in similar results. Only the QRT PCR results with 16s rRNA as endogeno us control are shown. Values of log2 fold change were means of four replicates. Experiments we re repeated three times with similar results and only one r esult was presented. Error bars indicate standard deviation. White bars represent the values from microarray and black bars represent the values from QRT PCR.

PAGE 116

116 Figure 3 5. Distribution of genes of the HrpG and HrpX regulons that were assigned into various J. Craig Venter Institute functio nal categories. White and black bars represent genes in the HrpX and HrpG regulon, respectively. indicates biosynthesis of cofactors, prosthetic groups, and ca rriers.

PAGE 117

117 Figure 3 6. Hierarchical clustering of genes in the HrpG and HrpX regulons based on similar time dependent expression patterns. Cl ustering analysis was performed with Cluster 3.0 using complete linking with uncentered correlation distance. Colu mns represent individual timepoint s and rows represent individual genes. Red bars indicate overexpression in mutants and green bars indicate underexpression in mutants. The color scale portrays log 2 fold change differences between the mutants and wild type strains. Genes with the absolute values of log2 fold change < 0.585 (|fold change| < 1.5) were displayed in black. Five major clusters were assigned as I, II, III, IV, and V

PAGE 118

118 Figure 3 7. Swarming assay on XVM2 medium containing 0.7% agar. Black columns represent wild type strain, gray columns represent the hrpG mutant, and white columns indicate the hrpX muta nt. DPI = days post inoculation. Experiments were performed in q uadruplicate and repeated three times with similar results; only one representative result was presented.

PAGE 119

119 Figure 3 8 Schematic model of HrpG and HrpX related regulation cascades of Xanthomonas spp HrpG is involved in four major aspects of r egulatory cascades: 1) Inducing the transcription of HrpX, which in turn activates the express ion of a large set of virulence genes HrpX represses the transcription of genes involved in histidine biosynthesis at the same time, and also reg ulates the transcription of some genes involved in signal transduction and regulation, as well as transport wh ich may resu lt in change of nutrient uptake and energy metabolism. 2) HrpG represses the transcription of genes involved in chemotaxis and flagellar biosynthesis in orde r to repress bacterial motility at the early stationary phase of growth. 3) HrpG also c ontrols the expression of genes related to signal transduction and regulation, tr ansport and general metabolism. 4) HrpG cross talks with DSF mediated QS pathway via repressing the transcription of RpfG and two GGDEF proteins at the early stationary phase of growth. Those proteins contribute the concentratio n of the central messenger cyclic di GMP One important target of cyclic di GMP is Clp which is a transcriptional activator. C yc lic di GMP binds to the Clp to prevent it from DNA binding and the expressi on of genes encoding extracellular enzymes, and genes involved in T3SS, and EPS biosynthesis. Blue lines indicate both positive and negative regulations occurring in different genes of the listed functional categories. + and represent positive and negati ve transcriptional regulation, respectively.

PAGE 120

120 CHAPTER 4 CHARACTERIZATION OF DSF MEDIATED QUORUM SENSING REGULON AND ITS ROLE IN CITRUS CANKER INFECTION Introduction Quorum sensing (QS) is a sophisticated mechanism allowing bacteria to communicate via the exchange of chemical signals and to alter the behavior in population wide scale. One un ique type of QS signal molecule a diffusible signal molecule (DSF) was identified in Xanthomonas campestris pv. campestri s (Barber et al. 1997) It has been char acterized as an unsaturated fatty acid, cis 11 methyl dodecenoic acid (Wang et al. 2004) which is distinct from N acyl derivatives of homoserine lactone ( N AHLs) used by most Gram negative bacteria for cell cell communication. DSF has been found to be an important QS signal molecular in pathogens Xylella fastidiosa (Newman et al. 2004) Burkholderia cenocepacia (Boon et al. 2008) and many Xanthomonas species (Chatterjee and Sonti 2002; Siciliano et al. 2006) The DSF mediated QS pathway is conserved in those bacteria, in which the rpf gene cluster is responsible for the DSF production and signal transduction, including the core genes rpfF rpfC and rpfG (Chatterjee a nd Sonti 2002; He et al. 2006 ; Siciliano et al. 2006) The rpfF gene encodes a putative enoyl CoA hydratase that catalyzes the synthesis of signal molecule DSF. Extracellular DSF is sensed by a two component signal transduction system consisting of the sensor protein RpfC and response regulator RpfG. Studies of DSF mediated QS systems reveal ed tha t it has distinct regulatory actions on biological functions among DSF producing bacteria, although DSF mediated QS pathway is conserved. For example, mutation in rpfF of X. campestris pv. campestris le a d s to the defects in the production of extracellular enzymes (e.g., proteases, pectinases and endoglucanase) and extracellular polysaccharides (EPS) as

PAGE 121

121 well as biofilm formation (Tang et al. 1991; Barber et al. 1997; Slater et al. 2000; Torres et al. 2007) while the rpfF mutants of X. oryzae pv. oryzae with reduced virulence are proficient for EPS and extracellular enzyme production (Chatterjee and Sonti 2002) In contrast to Xanthomonas spp., the rpfF mutants of Xylella fastidiosa are deficient in DSF producti on but are hypervirulent in the host (Newman et al. 2004) It seems that the difference of DSF in regulation of diverse functio ns depends on plant pathogen species and their specific needs for infection. Transcriptome analysis of the RpfF regulon has significantly advanced understanding of the DSF me diated QS regulons in bacteria. One pioneer study done by Zhang and his colleagues compared the gene expression profile of the rpfF mutant with the wild type strain of X. campestris pv. campestris using whole g enome wide microarray analysis (He et al. 2006) In that study, 165 genes were identif ied as belonging to the QS regulon, which were classified into 12 functional groups including genes encoding extracellular enzymes and genes involved in EPS production, flagellum synthesis, resistance to toxins and oxidative, a nd aerobic respiration (He et al. 2006) A later study utilizing proteomic analysis revealed that 48 proteins were differentially regulated by QS in X. oryzae pv. orzicola of which 18 proteins were identified by mass spectrometry analysis to be involved in nitrogen transfer, protein folding, resistance to oxidative and flagellar synthesis (Zhao et al. 2011) However, considering the complicated QS signal transduction cascade, a comprehensive understanding of the RpfC and RpfG regulons is lacking In this study, we aimed to further advance our understand ing of the QS regulator y network by characterizing the RpfF, RpfC, and RpfG regulons of one important model pathogen XCC through transcriptome analyses. We

PAGE 122

122 also investigated the roles of DSF mediated QS in the citrus canker disease c ycle and its involvement in early attac hment a nd in planta growth of XC C in citrus host. Materials and Methods Bacterial Strains and Growth C onditions All of the strains used in this study are listed in Table 4 1. XCC mutant strains were generated in this study as described below. Wild type strain 306 (rifamycin resistant) (da Silva et al. 2002) and mutant strains were routinely grown in nutrient broth (NB), on nutrient agar (NA), or in nutrient yeast glycerol (NYG) medium (Daniels et al. 1984) at 28C. The composition of XVM2 medium is described elsewhere (Wengelnik et al. 1996a ) Escherichia coli strains were grown in Luria Bertani (LB) medium at 37C. Antibiotics were used at the following concentrations: rifamycin (Rif), 50 g/ mL ; kanamycin (Km ), 50 g/ mL ; ampicillin (Ap), 50 g/ mL ; spectinomycin (Sp), 50 g/ mL ; gentamicin (Gm), 5 g/ mL ; and chloramphenicol (Cm), 35 g/ mL Construction of Strains with Mutations in Genes Involved in DSF Mediated QS S ignaling To construct the rpfF deletion mutant, the 1,610 bp fragment containing entire rpfF gene was amplified using genomic DNA of XCC 306 as template and primers rpfFF and rpfFR (Table 4 2 ). The fragment was cloned into pGEM T easy vector, resulting in the construct na med as pGEM rpfF. After digesting with Age I and Kpn I, the construct pGEM rpfF was blunt ended using T 4 DNA polymerase and self ligated as pGEM From pGEM Apa I Spe I fragment containing rpfF gene with internal deletion was transferred into Apa I Xba I digestd pOK1, resulting in pOK pOK eletion before conjugation. The pOK was transformed into E. coli (Huguet et al. 1998 ) and subsequently

PAGE 123

123 transferred into XCC 306 by triparental mating with helper E. coli strain containing pRK2013 (Swarup et al. 1991) Transconjugants were selected on NYG medium supplemented with Rif and Sp. Positive colonies were replicated on both NA plates supplemented with 5% (w/v) sucrose, Sp and Rif, and NA with only Rif. The sucrose sensitive colonies were selected from N A plate containing Rif and dilution plated on NA containing Rif, Km and 5% sucrose to select for resolution of the construct by a secon d cross over event. The resulting markerless deletion mutant of rpfF was confirmed by PCR and sequencing. To construct th e rpfC deletion mutant of XCC, the 3,017 bp fragment containing the entire rpfC gene was amplified using genomic DNA of XCC 306 as template and primers rpfCF and rpfCR (Table 4 2), and then cloned into pGEM T easy vector, resulting in pGEM rpfC. The constr uct pGEM rpfC was digested by BstE II to remove 1,116 bp from the interior of rpfC and then self ligated as pGEM Apa I Spe I fragment containing rpfC with internal deletion was transferred from pGEM Apa I Xba I cutted pOK1, generating pOK transferred into XCC 306 by triparental mating, and a deletion mutant of rpfC was selected using the method described above. The in frame deletion mutant of rpfG was constructed as follows. The 2,037 bp fragment containing the entire rpfG gene was amplified using genomic DNA of XCC 306 as template and primers rpfGF and rpfGR (Table 4 2), and then cloned into pGEM T easy vector, resulting pGEM rpfG. The pGEM rpfG was digested by BssH II to remove 648 bp from the int erior of rpfG and then self ligated as pGEM Apa I Spe I fragment containing rpfG with in frame deletion was transferred from pGEM

PAGE 124

124 with Apa I Xba I cutted pOK1 to generate pOK was transferred into XCC 306 by trip arental mating, and rpfG deletion mutant was selected using the method described above. Complementation of the rpfF rpfC and rpfG M utants To generate the complementation plasmid for rpfF mutant, the fragment containing the entire rpfF gene and its own pro moter was amplified using genomic DNA of XCC 306 as template and primers rpfFF and rpfFR (Table 4 2) The fragment was cloned into p CR 2.1 TOPO vector, resulting in the construct PCR rpfF. The Hind III Xba I fragment containing rpfF gene from PCR rpfF was b lunt ended by T4 DNA polymerase, and then cloned into pUFR053 which was digested by Hind III, and blunt ended and treated with calf intestinal alkaline phosphatase. The derivative construct, p53 rpfF, was transferred into rpfF mutant by triparental mating. The transconjugants were selected on NA with Rif and Gm. To construct the complementation plasmid for rpfC mutant, the entire rpfC gene was amplified from genomic DNA of XCC 306 using PCR with primers rpfC KpnF and rpfC KpnR which contain a Kpn I restrictio n site (Table 4 2). The fragment was cloned into p CR 2.1 TOPO vector, resulting in PCR rpfC. The Kpn I digested fragment containing rpfC gene was transferred from PCR rpfC into Kpn I site of pUFR053. The derivative construct p53 rpfC was transferred into rp fC mutant by triparental mating and selected on NA with Rif and Gm. To construct the complementation plasmid for rpfG mutant, an EcoR I fragment containing rpfG and its own promoter was transferred from pGEM rpfG, and ligated to EcoR I site of pUFR034, resul ting in p34 rpfG. The construct p34 rpfG was transferred into rpfG mutant by triparental ma ting, and selected on NA with Km

PAGE 125

125 RNA E xtraction Individual bacterial colonies were picked and grown in 5 mL NB at 28C for 24 h with shaking, and then transferred i nto 50 mL NB for overnight incubation. The bacterial cultures in exponen tial phase were centrifuged washed with XVM2 medium once, and inoculated in XVM2 medium with an initial concentration at OD 600 = 0.03. Bacteria were grown in XVM2 medium with constant shaking at 200 rpm at 28C and samples of culture were collected at 11 and 25 h, respectively according t o the growth curve in XVM2 (Figure 4 1). Four biological replicates were used for each strain per time point. RNA was stabilized immediately by mixing bacterial culture with two volumes of RNAprotect bacterial reage nt (Qiagen ) and incubated at room temperature for 5 min. Bacterial cells were centrifuged at 5000 g for 10 min and cell pellets were used for RNA extraction. Cell pellets were treated wit h lysozyme and proteinase K for 15 min, and RNA extractions were performed using RNeasy Mini kit (Qiagen). Contaminated Genomic DNA was removed from RNA by treatment with TURBO DNA free TM kit (Ambion ). RNA quantity was initially determined on a ND 8000 Na nodrop spectrophotometer (NanoDrop Tech nologies ) and RNA quality was assessed using the Agilent 2100 bioanalyzer (Agilent Te chnologies .). Microarray H ybridization Microarray analysis using the Agilent microarray platform was performed at Interdisciplinary Center for Biotechnology Research (ICBR) Microarray Core Facility, the University of Florida. Labeled cDNA was generated using Fairplay III microarray labeling kit (Agilent Technologies). Five g of total RNA input was used to generate labeled cDNA accord

PAGE 126

126 from 5 g of the total RNA with AffinityScript HC and random primer and then modified cDNA was labeled with either cy3 or cy5; labeled cDNA was purified following the manufacturer's instruct ions. The microarray analysis was performed using the Agilent 815K XCC genome array (Guo et al. 2011) Four independent biological replicates were performed for two time point co mparisons with dye swap design. A total of 300 ng of labeled cDNA per sample was used for the hybridization. A dye swap was performed to remove any bias from the labeling d yes. Hybridization was performed using Gene Expression Hybridization Kit (Agilent Technologies) according done in a hybridi zation oven for 17.5 h at 65C. The arrays were washed according to Briefly, arrays were washed with Gene Expression Wash Buffer 1 containing 0.005% Triton X 102 for 1 min at room temperature and then washed with 37C warmed Gene Expression Wash Buffer 2 containing 0.005% Triton X 102 for 1 min and dried by Agilent Stab ilization and D r ying Solution. The arrays were scanned using a dual laser DNA microarray scanner (Model G2505C) (Agilent Technologies). The data were extracted from scanned image using Feature Extraction 10.1.1.1 software (Agilent Technologies). Microarray Data Analysis and Statistical M ethods The raw data were imported into R environment and statistical tests were performed using BioConductor statistical software which is an open source and open development software project for analysis of microarray and o ther high throughput data based primarily on the R programming language (Gentleman et al. 2004) Data preprocessing and normalization were performed using the Linear Models for Microarray Data (LIMMA) package (Smyth, 2004) Raw mean signal intensities from all microarray spots were background corrected and normalized usin g within array lowess

PAGE 127

127 approach. Log 2 transformed valu es were used for statistical analysis. Histograms, box plots and pair wise scatter plots were generated to examine data quality and comparability. A linear modeling approach and the empirical Bayes statistics as implemented in the LIMMA package (Smyth 2004) were then employed for different ial expression analysis. The p values were adjusted using the Benjamini and Hochberg method, designated as false discovery rate (FDR) (Benjamini and Hochberg 1995) Di fferentially expressed genes were ranked based on FDR, and genes with FDR less than 0.01 and a minimum absolute value of log 2 fold change greater than 1 (equivalent to 2 fold) were considered as significantly differentially expressed. If the gene has three probes and only one was filtered, the gene was removed from further analysis. The log 2 fold change values of the differentially expressed genes were averaged from the values of the two or three probes of the corresponding genes, and shown in Table 4 3. An notation for the different ially expressed genes was extracted from the Integrated Microbial Genome (IMG) database and the J. Craig Venter Institute (JCVI) database and manually verified. All primary data from transcriptome experiments as well as experimen tal protocols used are available from Gene Expression Omnibus datasets, the National Center of Biotechnology Information ( accession number GSE29877 ). Quantitative Real Time Two S tep RT PCR (QRT PCR) To verify the microarray result, QRT PCR assays were cond ucted using the same set of RNA for microarray analysis. One g of aliquot RNA samples used for microarray were reverse transcribed using Q u antiTect Reverse Transcription kit with random hexamer primers (Qiagen) for two step QRT PCR. Gene specific primer s listed in Table 4 2 were designed to generate products 100 to 250 bp in length from sequences on

PAGE 128

128 XCC genome using DNASTAR software (DNASTAR). QRT PCR was performed for all four biological replicates of rpfG mutant and wild type strain obtained at 11 h on a 7500 Fast Real Time PCR System (Applied Bio systems ) using QuantiTect TM SYBR Green endogenous controls. The relative fold change of gene expression was calculated by us ing the formula 2 T (Livak and Schmittgen, 2001) The values of fold change were log 2 transformed to compare with values generated from microarray analysis. Motility A ssays The media for motility assays were NB or XVM2 containing 0.7% agar. Bacteria were grown in NB overnight with shaking at 20 0 rpm, and then centrifuged washed and diluted to OD 600 = 0.3 in sterile water. One L suspension was spotted on the center of plate and incubated at room temperature. The assay was repeated three times independently in quadruplicate. Protease Activity T est To measure the activity of extracellular proteases produced by bacteria, bacterial cells were grown in NB at 28C overnight with sh aking at 200 rpm, then centrifuged down, washed and diluted to OD 600 = 0.3 in sterile water. One L suspension was spotted on 5% skim milk NA plate and incubated at room temperature. The protease activity was detected as zones of hydrolysis around the colo nies. The assay was repeated three times independently in quadruplicate. Pathogenicity A ssay Pathogenicity assays were conducted in a quarantine greenhouse facility at Citrus Research and Educatio n Center, Lake Alfred, FL Assays were performed using fully expanded, immature leaves of Duncan grapefruit ( Citrus paradis i Macfadyen). XCC wild

PAGE 129

129 type and mutant strains used in this assay were grown with shaking overnight at 28C in NB, centrifuged down and suspended in sterile tap water and the concentrations wer e adjusted to 10 8 CFU/ mL For the pathogenicity assays, bacterial solutions of 10 8 10 5 or 10 4 CFU/ mL were infiltrated into leaves with needleless syringes (Viloria et al. 2004; Rybak et al. 2009) The test was rep eated three times with similar results. Disease symp toms were photographed at 6, 12 and 18 days post inoculation (DPI). For the lesion test, inoculated areas were marked on leaves and photographed on 18 DPI. Canker lesions from 10 inoculated leaves were qu antified and the inoculated areas were calculated using the program ImageJ version 1.44p (Abramoff et al. 2004) To mimic the natural infection process of XCC, bacterial suspensions of 10 8 CFU/ mL were inoculated by spraying on the abaxial surface of Duncan grapefruit leaves. The inocul ated plants were covered with plastic bags for 24 h to maintain 100% relative humidity, and then kept in greenhouse (approxi mate ly 5 0% relative humidity) for symptom development. A ttachment A ssays To measure the level of cells adhered to abiotic surface, b acteria grown overnight in NB or XVM2 medium were centrifuged and the cell pellets were washed and resuspended in 10 mM phosphate buffer (pH 7.0) to OD 600 = 1.0 (10 9 CFU/ mL ). Two hundred L of each bacterial suspension were aliquot ed in to 1.5 mL plastic m icrocentrifuge tubes and incubated for 6 h at 28C. The adherence was monitored by staining the attached bacteria with crystal violet (CV). Bacterial adhesion was measured after repetitive washing of the tubes to remove non adherent cells and staining with 0.1% CV for 45 min at room temperature. Excess stain was removed by washing under running tap water, and the CV stain was solubilized by the addition of 250 L volumes

PAGE 130

130 of 99% ethanol added to each tube. CV was quantified with Agilent 8453 UV visible spect rophotometer at 590 nm. The assay was repeated three times with 10 replicates each time. To observe the bacterial adherence to biotic surface, bacterial suspension ( OD 600 = 1.0 ) was prepared as described above. Twenty L o f bacterial suspension was plat ed on the abaxial surface of detached Duncan grapefruit leaf and then incubated f or 6 h in a moist chamber at 28 C. Inoculated leaves were washe d twice with sterile tap water and stained wit h CV as for the abiotic surface (Gottig et a l. 2009b ) To directly observe the bacterial adherence to leaf surface using confocal laser scanning microscope (CLSM), constitutive GFP expression plasmid pUFZ75 (Z hang et al. 2009) was transformed into bacteria by electroporation. No difference in growth or adhesion to leaf and plastic surface could be detected between GFP labeled bacteria and those lacking the GFP plasmid. The bacterial suspension was prepared an d dropped on detached leave as described above. The inoculated leaves were inc ubated in a moist chamber at 28 C, and observed at 1 h and 6 h post inocula tion, respectively. After washing twice with sterile tap water, inoculated areas were cut for microscop ic observation. Bacterial adhesion was visualized using Leica TCS SL confocal laser scanning microscope (Leica Microsystems Inc., Buffalo Grove, IL, U.S.A) with a 63 water objective in the microscope lab at Citrus Research and Education Center, Lake Alfre d, FL, U.S.A. Three excitation/emission lines were used in observation as follows: green (excitation 488 nm, emission 500 545 nm) for detection of GFP labeled strains, red (excitation 543 nm, emission 600 630 nm) for detection of cuticle, and blue

PAGE 131

131 (excitat ion 633 nm, emission 680 750 nm) for detection of chlorophyll. The assay was performed three times independently in quadruplicate. To further compare the location of bacterial cells relative to leaf tissue, we used a scanning electron microscope (SEM) in t he microscope lab at Citrus Research and Education Center. The leaves inoculated with bacteria for 6 h were washed twice with sterile tap water, and inoculated areas were cut (about 0.5 cm 2 ) and fixed in 3% glutaraldehyde in 0.1 M phosphate buffer (pH 7.2) overnight. The fixed leaf discs were washed three times with 0.1 M phosphate buffer (pH 7.2), post fixed in 2% OsO 4 in 0.1 M phosphate buffer (pH 7.2) for 4 h, and rinsed twice in 0.1 M phosph ate buffer (pH 7.2). After rinsing the leaf discs were subject ed to dehydration in a sequence of ethanol solutions (10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% and 100%) for 10 min each. The final wash in 100% ethanol was repeated three times. Leaf discs were critical point dried in LADD critical point dryer (LADD R esearch, Williston, VT, U.S.A.), and then fixed on stubs and coated with gold palladium using LADD sputter coater (LADD Research). SEM micrographs were taken in a Scanning Electron Microscope S 530 (Hitachi, Tokyo, Japan) at 20 kV. SEM analysis was perform ed twice, with six replicates for each sample. Results Generation of DSF M ediated QS M utants of XC C To investigate the role of DSF mediated QS in citrus canker infection, the deletion mutants of three critical genes rpfF rpfC and rpfG in the DSF signal sy nthesis and transduction were generated by doubl e cross over recombination (Figure 4 2). The deletions were confirmed by sequence analysis of the corresponding PCR products. The QS mutants cannot form compact pellets as wild type strain when centrifuged do wn

PAGE 132

132 from liquid media NB or XVM2 (Figure 4 3). To confirm the mutations in QS pathway, the three QS mutants were assayed for motility and extracellular protease production, which are well known phenotypes controlled by DSF mediated QS (Barber et al. 1997; Ryan et al. 2006) The QS mutants showed significant decrease in t he production of proteases (Figure 4 4) and w ere defect ive in the motility (Figure 4 5). T he phenotypes of a ll there mutants were restored to wild ty pe level following complementation with corresponding genes in trans (Figure 4 3, 4 4 and 4 5). QS is Required for the Full Virulence of XCC in Citrus H ost The role of QS in planta growth of XCC was evaluated by monitoring the population and symptoms of w ild type and QS mutants on Duncan grapefruit, which is a susceptible host of XCC. Both wild type and QS mutants were infiltrated into young leaves of Duncan grapefruit with the initial concentration of 10 8 CFU/ mL No difference was observed with respect to time of appearance of lesions, and the magnitude of lesions (Figure 4 6A). When 10 5 CFU/ mL was used as initial concentration, QS mutants produced fewer les ions formed than wild type (Figure 4 6B). However, the cell densities of QS mutants in planta were n ot significantly lower than wild type strain (about 50% less CFU/ mL data not shown). To quantify the difference in virulence between QS mutants and wild type, we used 10 4 CFU/ mL to inoculate Duncan grapefruit leaves, photographed the inoculated leave at 1 8 DPI and then calculated lesion number per cm 2 The total amount of lesions caused by the rpfF rpfC and rpf G mutant were 50%, 32%, and 20%, respectively, of that caused by the wild type strain in an area of 1 cm 2 (Figure 4 6C and D). Mutations of QS gen es significantly reduced the lesions formed in Duncan grapefruit leaves ( P <0.001, tested by one way ANOVA).

PAGE 133

133 The QS mutants also showed reduced virulence on spray inoculated grapefruit compared with wild type strain. They still cause d t ypical canker lesions but much fewer lesion s compared with wild type strain (Figure 4 6E). Overview of Microarray A nalysis To investigate the role of QS on global gene expression profile of XCC XVM2 medium was used in this study to mimic the intercellular space of plant cells. The growth of QS mutants and wild type strain were monitored in XV M2 (Figure 4 1). Two time points, 11 h and 25 h, were chosen to represent exponential and stationary phases, respectively. In this study, false discovery rate (FDR) = 0.01 and absolute valu e of log 2 fold change = 1.0 (equivalent to fold change of 2.0) were use d as the cut off value. At exponential phase, 119 (9 overexpressed and 150 underexpressed), 119 (4 overexpressed and 115 underexpressed), and 216 (63 overexpressed and 153 underexpresse d) genes showed significant expression change in rpfC rpfF and rpfG mutants relative to wild type strain, respectively (Table 4 3). The three QS mutants shared 101 (4 overexpressed and 97 underexpressed) differentially expressed genes at this phase. At st ationary phase, 43 (4 overexpressed and 39 underexpressed), 104 (21 overexpressed and 83 underexpressed), and 214 (36 overexpressed and 178 underexpressed) genes were differentially expressed in rpfC rpfF and rpfG mutants relative to wild type strain, res pectively (Table 4 3). Similarly, 33 (3 overexpressed and 30 underexpressed) genes showed altered expression in all three mutants at this time. Upregulation by QS (showing underexpression in QS mutants) was obviously dominant over downregulation (showing o verexpression in QS mutants) at both phases. Taking into account the different roles of the protein products of three rpf genes in QS pathway, the genes exhibited significantly differential expression in any of the three QS mutants

PAGE 134

134 were considered as being QS regulated. Accordingly, 255 (63 overexpressed and 192 underexpressed) genes and 265 (47 overexpressed and 218 underexpressed) genes showed differential expression at exponential and stationary phases in any of the three QS mutants compared to the wild type, respectively. Thus, a total of 441 genes were considered as QS regulated at one or more phases (Table 4 3), including 99 QS downregulated genes (showing overexpression in any of the three gene mutants at any of the two phases), and 341 QS upregulated genes (showing underexpression in any of the three gene mutants at any of the two phases), as well as 1 gene which was QS upregulated at exponential phase but QS d ownregulated at stationary phase. In other words, the expression of approximately 10% of all XCC genes is under the control of QS. The microarray data were validated using QRT PCR on a subset of genes over or underexpressed in the rpfG mutant relative to the wild type strain (Table 4 4). Functional analysis show ed that the 441 QS regulated genes represented diverse aspects of bacterial physiology, classified into 19 functional categories according to the annotation from the J. Craig Venter Institute (JCVI) role categories (Table 4 3 and Figure 4 7). The largest percentage of QS regulated transcri pts (44.2%, 195 of 441) consists o f unknown genes in the categories of hypothetical protein, unclassified, unk nown function and not in JCVI. Sixty three genes representing 22.4% of the 281 known or predicted ORFs were involved in cellular process es, includ ing 50 genes involved in chemotaxis and flagellar biosynthesis. Other functional categories with large numbers of QS regulated genes included genes encoding transport and bind ing proteins (9.7%; 35/362), genes involved in energy metabolism (8.3%; 42/504 ), genes involved in protein fate (9.2%; 22/239), genes related to transcription (8.9%; 7/79),

PAGE 135

135 genes involved in central intermediary met abolism (7.5%; 16/213), and genes encoding cell envelope (6.1%; 21/343). The QS regulon differed in the two growth phase s. Totally 255 genes were QS regulated at the exponential phase, whereas 265 genes were identified as being QS regulated at the stationary phase. Only 79 overlapped at both phases. The detailed information of the temporal regulation of diverse biological f unctions by QS was described below. Chemotaxis and Flagellar B iosynthesis One of the prominent transcriptional conse quences of QS inactivation in XC C was the differential expression of a large number of genes involved in chemotaxis and flagellar biosynthes is. There are four clusters of genes related to chemotaxi s and flagellar biogenesis in XC C genome (da Silva et al. 2002) which all exhibits QS regulated pattern in this study (Table 4 3). At exponential phase, the complex for flagellar basal body and hook structure assembly ( flgACDEFGHIJKL fliFGHIJKS ), and the late gene complex for flagellin and cap assembly ( fliC and fliD ) were significantly up regulated by QS. Besides these, the up regulated genes b y QS at this phase included regulator genes fliA flgM fleN and 28 chemotaxis genes (10 copies of ts r, 3 copies of cheA 2 ch e Y 3 cheW 2 cheR, 5 mcp che Z, cheV and parA ). At the stationary phase, only genes in the fliGHIJK cluster were up regulated. Th e expression of the genes involved in motor and flagellar basal body assembly ( fliELOQR flhB motB and flgB ) and the flgA gene involved in flagellar basal body P ring biogenesis were repressed by QS at this phase.

PAGE 136

136 Cell M e mbrane Surface Structure and T ran sporters Our microarray analysis revealed that QS is involved in the regulation of physiological adaption to the environmental changes by controlling the differential expression of a large set of genes encoding cell surface structure and transporters. At e xponential phase, 15 genes involved in iron uptake were down regulated by QS, including feoA feoB iroN fecA pfeA fpvA iucA 3 fhuA (XAC1435, XAC2185, XAC2941), XAC0492, XAC3178, fhuE (XAC3370 and XAC3498) and phuR For instance, the iucA gene encodin g an iron transporter was 3.37 log 2 fold overexpressed in the rpfG mutant than in the wild type strain (Table 4 3). The fhuE (XAC3498) gene, which encodes an outer membrane receptor for ferric iron uptake was 4.09 log 2 fold overexpressed in the rpfG mutant than in the wild type strain (Table 4 3). In contrast, the expression of 5 genes ( brf cirA btuB (XAC2600), XAC2864, and hppA ) involved in uptake of unknown substrates and czcD encoding a heavy metal transporter were up regulated by QS at the exponential phase. Nine transporter genes ( nrtB (XAC0827), nrtCD (CAC0828), ssuA (XAC0849 and XAC3198), ssuB (XAC0847 and XAC3196), ssuC (XAC0848 and XAC3197) and fyuA ) were down regulated, whereas 6 transporter genes ( betT kdpA kdpB kdpC bapA and XAC3855) were u p regulated by QS. The genes kdpA kdpB and kdpC encode subunits of potassium transporting ATPase and betT encodes high affinity choline transport. Genes encoding outer membrane components were also regulated by QS at the two growth phases. At the exponent ial phase, a few genes encoding cell surface appendages were down regulated, including two xadA genes (XAC3546 and XAC 3548) which encode T5SS adhesin like proteins, the pilM gene which is involved in type IV pilus assembly, as well as hmsF hmsR and hmsH w hich are involved in PgaA adhesin

PAGE 137

137 biosynthesis. However, three genes fimA encoding type IV pilin, pru encoding secreted protein which may serve as fimbriae tip adhesion, and XAC0270 encoding unknown membrane protein were up regulated at the exponential pha se. Nine genes encoding membrane surface components were up regulated at the stationary phase, including 2 mopB genes (XAC1012 and XAC1021) encoding outer membrane proteins, 2 blc genes (XAC2561 and XAC4259) encoding outer membrane lipoproteins, the ecnA g ene whose product directs the synthesis of a small cell envelop lippoprotein, and four hypothetical genes which are predicated as membrane proteins (XAC2139, XAC3844, XAC3845 and XAC3972). Only PgaA adhesion coding genes hmsF and hmsH as well as ompW enco ding outer membrane protein W, were down regulated at the stationary phase T2SS S ubstrates T2SS substrates include the extracellular enzymes such as proteases, lipases, and cell wall degrading enzymes (e.g., cellulases, pectinases). They are important viru lence traits for many plant pathogens, contributing to infection by degradation of the plant cell wall. Eight genes encoding extracellular enzymes including 4 protease genes ( XAC 1034, XAC 1512, XAC 2853 and XAC 2992), 3 cellulase genes ( egl ( XAC 0029), engXCA XAC 0346), and peh 1 encoding endopolygalacturonase were up regulated at both growth phases. Eleven T2SS substrate genes were differentially expressed at the exponential phase, including 10 genes up regulated by QS (2 xylanase genes ( XAC 0933 and XAC 0934), 3 cellulase genes ( egl ( XAC 0028), lamA and celS ), 2 pectate lyase genes ( pelB and pel ), 2 protease genes ( XAC 2763 and XAC 2831) and 1 amylase gene amy ( XAC 0798), as well as 1 down regulated protease gene XAC 3545. At the stationary phase, besides the 8 genes encoding extracellular

PAGE 138

138 enzymes as mentioned above, 3 more genes including xynB encoding xylanase pglA encoding pectate lyases and XAC 351encoding protease were up regulated by QS. One unique virulence factor X ac PNP ( XAC 2654) was also positively controlled by QS at stationary phase. X ac PNP is the homolog found only in XCC to plant natriuretic peptides (PNPs), which are extracellular molecules produced by plants to regulate plant responses in homeostasis and growth. It is secreted by XCC to suppressed host defense responses during infection via mimicking host PNP (Gottig et al. 2008) T3SS and E ffectors T3SS is utilized by plant bacterial pathogens to secrete effector protei ns directly into the host cell. T3SS transl ocon was encoded by a cluster of hypersensitive response and pathogenicity ( hrp ) genes. G enes encoding T3SS translocon and effectors were found in the QS regulon, including 8 structural genes and 9 effector genes. All those genes were up regulated by QS at either the exponent ial or stationary phas es. Three structural genes ( hrpB2 hrcJ and hpa1 ) and 2 effector genes ( XAC 0543 and XAC 2786) were up regulated at both phases; another two structural genes ( hrcC and hpaB ) were up regulated only at the exponential phase, whereas 3 structural genes ( hrpB1 hrpB4 and hrpB5 ) and 7 effector genes ( avr X ac E1 avr X ac E3 avrBs2 hrpW XAC 1208, XAC 4333 and XAC 3085) were up regulated only at the stationary phase. Signal Transduction and R egulation Several genes encoding trans criptional regulators and signal transduction system were differentially regulated by QS at both two growth phases. Three genes encoding two component systems (XAC1778, XAC1328 and XAC3273) and the rpoN gene (XAC1969) encoding RNA polymerase sigma 54 ) factor were up regulated at both growth phases, whereas one transcription factor gene XAC3445 was down regulated.

PAGE 139

139 Two genes ( rrpX XAC1320) encoding transcription regulators, algU encoding sigma factor RpoE nucA gene encoding endonuclease, and 7 regulato ry genes ( vieA entF XAC0424, XAC1993, flgM fliA and fleN ) were up regulated at the exponential phase, while one regulatory gene (XAC2382) encoding GGDEF protein was down regulated at the exponential phase. At the stationary phase, 3 transcription regula tory genes ( rbn hrpX and XAC0941) and four genes ( stkXac1 tspO, XAC0644 and XAC1670) encoding the two component system were up regulated by QS. Meanwhile, regulatory genes flbD and XAC1398 were down regulated. Stress R esistance Genes encoding enzymes for bacterial resistance to environmental stress particularly peroxide were differentially regulate by QS. Multiple oxidative resistance genes were up regulated by QS during growth in XVM2: 2 catB genes (XAC4029 and XAC4030) encoding catalases were up regulat ed at exponential phase, while srpA encoding catalase, cpo encoding non heme chloroperoxidase, and XAC1150 encoding peroxiredoxin were up regulated at the stationary phase; katE encoding catalase were up regulated at both growth phases. Three genes algU X AC1320 and mucD which homologies are involved in the heat stress resistance and alginate production in P. aeruginosa were up regulated at the exponential phase. Besides the differential expression of those genes for specific stress resistances, the cmfA g ene encoding conditioned medium factor was up regulated at the exponential phase and XAC2369 encoding general stress protein was up regulated at the stationary phase. Moreover, QS interacts with both genes at protein level: CmfA physically interacts with R pfC whereas XAC2360 physically interacts with RpfG (Andrade et al. 2006)

PAGE 140

140 Metabolism A large number of genes involved in metabolism, particularly in energy metabolism were differentially regulated by QS. A few gene s related to energy metabolism were up regulated by QS at both phases: aceA and aslB in TCA cycle; ybdR and fdh in fermentation; XAC 2896 and XAC 4182 in Electron transport; XAC 1178 and XAC 3738 encoding oxidoreductases. However, eight genes in energy metabol ism were up regulated only at the exponential phase including genes in TCA cycle ( pdhA pdhB ( XAC 0443 and XAC 0445) and fumB ), genes in sugar metabolism ( galM pqqG and ugt ) as well as pcaD whereas four genes in energy metabolism including qxtB and XAC 2983 in electron transport, fucA1 and ecaA were down regulated by QS only at this phase Twelve genes in energy metabolism were up regulated by QS at the stationary phase: XAC 0154 and XAC 0224 in sugar metabolism; XAC 0794 in fermentation; XAC 1174 in glycolysis; cyoB XAC 1476 and XAC 4269 in electron transport; rpfA in TCA cycle; gabD gloA glgX and XAC 2907 in other energy metabolism pathways. Gene cydA and cydB in electron transport were down regulated at stationary phase. In addition, many genes encoding hydrox ylase, oxidoreductase, and dehydrogenase, which are involved in energy metabolism and central intermediary metabolism were also up regulated by QS at stationary phase: bioI XAC 1187 and XAC 1188 encoding hydroxylases; XAC 1189 encoding ferredoxin; XAC 2051, y agR and yagS encoding oxidoreductases; yagT gcd yahK XAC 0158, XAC 1180 and XAC 2122 encoding dehydrogenases. Besides the genes in energy metabolism, several genes related to sulfur metabolism, amino acid met abolism, fatty acid metabolism and protein fate were also temporally controlled by QS : the gctA gene in fatty acid metabolism was up regulated at

PAGE 141

141 the expo nential phase; The genes lig2 lig3 and XAC 3037 in fatty acid metabolism were up regulated at the stationary phase; XAC 2948 and piuB genes in sulfur m etabolism were down regulated at the exponential phase; metA trpF and XAC 0802 in amino acid metabolism were up regulated at the stationary phase; XAC 2745, XAC 3368 and pfpI encoding proteases involved in protein degradation were up regulated at the station ary phase while XAC 0787 in the same group were down regulated at the stationary phase Regulation of gum genes The gum gene cluster is responsible for EPS biosynthesis and is reported under the regulation of QS in previous studies (He et al. 2006 ) Surprisingly, no gum genes were identified as being QS regulated. To address if this is due to the growth media, we used QRT PCR to compare the expression of gum genes in NB (rich medium) and XVM2 medium at the stationary phase. The gumB and gumD gene were selected for this test and showed lower transcript level in QS mutants than in wild type when bacteria were grown in NB. However, the transcript levels of those two genes in QS mutants were similar to those in wild type s train when bacteria were grown in XVM2 (F igure 4 1 0). This suggests that regulation of the expression of gum gene cluster by QS is medium dependent, and an alternative parallel signaling system may exist to coordinate t he expression of gum genes in XC C. Th e Attachment of XCC Was Reduced by QS M utations Given the significant effect of QS on expression of chemotaxis and flagellar genes as well as genes encoding membrane surface components such as type IV pilus, we investigated if QS mediates the bacterial att achment event in patho gensis. First, the wild type strain and QS mutants were tested for their early attachment ability on abiotic surface (hydrophobic). The wild type strain attached to the hydrophobic surface much

PAGE 142

142 better than the s e QS mutants, with more than 10 fold higher level of CV stain retained (Figure 4 8A and B). Most QS mutants ca nnot attach to the surface and their CV quantifications were similar to t he negative buffer control (Figure 4 8A and B). In addition, wild type strain grown in XVM2 perfo rmed better in attachment assay than those grown in NB. We also investigated the bacterial attachment on host leaf by plac ing the bacterial suspensions on the abaxial surface of Duncan grapefruit leaf. Similar to the results of attachment to abiotic surfac e, wild type strain grown in either XVM2 or NB attach ed to grapefruit leaf with CV stain remained, while the QS mutants were not able to attach to the leaf well showing basal level of CV stain as negative buffer control (Figure 4 8C). To exam the differenc e in attachment to leaf by individual cells, we used CLSM to observe the GFP labeled bacterial cells attached to leaf. The bacteria carrying the GFP plasmid did not affect the attachment to abiotic surface and biotic surface, or the virulence in planta (da ta not shown) Given the better performance of bacteria grown in XVM2, the GFP labeled strains were grown in XVM2 prior to leaf attachment assay. After 1h of incubation, wild type cells started to aggregate to microcolonies (Figure 4 9A). In contrast, a fe w individual cells of the QS mu tants could attach to leaf (Figure 4 9A ). After 6 h of incubation, many more wild type cells attached to leaf and for med matrix on leaf (Figure 4 9B and C), while QS mutants fo rmed microcolonies on leaf (Figure 4 9B). The lea f was scanned at different depths, which showed bacteria primarily located in the depression formed by the anticlinal wall of epidermal cells and around stomata, not on the top of periclin al wall of epidermal cells (Figure 4 9C). To confirm the observation we used scanning electron microscope to exam the leaf

PAGE 143

143 incubated with bacterial suspensions for 6 h. As shown in Figure 4 9D, many more wild type than QS mutants cells occupied in the depression between epidermal cells and around stomata Discussion DNA microarray has been widely used to study the transcriptional responses of many organisms to genetic and environmental perturbations (Ye et al. 2001; Dharmadi and Gonzalez 2004) In the present study, we studied the QS regulon using one whole genome DNA microarray for X C C 306 The reliability and robustness of this Agilent array have been confirmed in the transcriptome analyses of HrpG and HrpX regulons in our previous study (Guo et al. 2011) They were further validated in the present study. In this study, transcriptome analysis of the QS regulon identified ge nes involved in chemotaxis and flagellar biosynthesis, resistance to oxidative stress T2SS substrates biosynthesis, biosynthesis of T3SS and effector proteins, type IV pili, T5SS adhesions, energy metabolism, fatty acid metabolism, signal transduction and regulation, as well as genes encoding transporters (Table 4 3) Th e regulation of those genes was consistent with the physiological assays, including motility assay (Figure 4 5) protease assay (Figure 4 4) attachment assays on a biotic and biotic surface s (Figure 4 8) Transcriptome analysis of the QS regulon by combining the RpfF, RpfC, and RpfG regulon s has significantly advanced our understanding of the DSF med iated QS regulons in bacteria. Compared to the pioneer wo rk done by Zhang and colleagues on t he QS regulon of X. campestris pv. campestris (He et al. 2006), we have further characterized the RpfC and RpfG regulons which have not been characterized in the past besides the RpfF regulon at the exponential and the stationary phases. To simplify our an alysis, we have combined the RpfF, RpfC, and RpfC regulon s as the QS regulon.

PAGE 144

144 Thus, we were able to identify 441 genes which were regulated (up regulat ed or down regulated) by QS in XC C. Those g enes were involved in a broad range of biological functions in cluding genes encoding flagellar and chemotaxis biosynthesis biosynthesis of T3SS and T3SS effectors, type IV pili, T5SS adhesi ns, iron uptake, T2SS substrates, metabolism (energy metabolism, amino acid metabolism, and fatty acid metabolism ) and stress re sponse A large number of genes including genes encoding T3SS effectors, type IV pili, T5SS adhesions, stress response proteins and GGDEF proteins have not been reported previously to be regulated by QS and will further advance our understanding of the rol es of QS Importantly, we have identified some interesting difference between the QS regulons in XC C and in X. campestris pv. campestri s (1) M ost genes involved in iron uptake were d own regulated by QS in XC C whereas they were up regulated in X. campestri s pv. campestris (He et al. 2006 ) (2) Regulation of T3SS genes and T3SS effector genes were different between XC C and X. campestris pv. campestris: 8 T3SS genes ( hrp ) and 9 effector genes were up regulated at the two growth phases in XC C whereas 1 hrp gene was up regulated and 9 hrp genes were down regulated at both phases in X. campestris pv. campestris (He et al. 2006 ) (3) T he regulation pattern of flagellar biosynthesis in XC C is different from X. campestris pv. campestris (He et al. 2006 ) Most genes involved in flagella biosynthesis were up regulated at the exponential phase but nine were down reg ulated at stationary phase in XC C. In contrast, the flagella biosynthesis genes were up regulated at both phases in X. campestris pv. campestris These discrepancies could be due to the differences in the two species. The rpf cluster of X. campestris pv. campestris contains 9 genes where as

PAGE 145

145 XCC contains only 7 genes and lacks rpfI and rpfH genes (da Silva et al. 2002) The rpfH gene encodes a protein structurally related to the sensory input domain of RpfC, indicating that it may also participate in the DSF signal transduction (Slater et al. 2000) ; RpfI is involved in regulation of the exp ression of proteases and endoglu canase (Dow et al. 2000) Furthermore, the differe nce in downstream regulator s in the signaling cascade s may also contribute to the discrepancies: Two known regulators FhrR and Zur in QS cascade of X. campestris pv. campestris are not found in XC C QS regulon whereas the existence of HrpX is found in XC C QS regulon In X. campestris pv. campestris FhrR is responsible for the regulation of genes encoding flagella, T3SS and ribosom e proteins, and Zur controls the iron uptake, multidrug resistance, and detoxification ( He et al. 2007 ) Alternately, the discrepancies might be due to different growth media and culture conditions used in these studies: XVM2 was used in the present study which is a defined medium mimic k ing the apoplastic environment of plant leaf (Wengelnik et al. 1996a ) while YEB rich medium (no iron supplemented) was used for the QS study in X. campestris pv. campestris (He et al. 2006 ) XVM2 is supplemented with Fe 2 SO 4 whi ch might explain the differential regula tion of iron in the two systems Likely, the differential regulation of T3SS genes in the two studies results from the two media used since the expression of T3SS genes was induced in planta or by XVM2 and repressed by rich medium in X. campestris pv. vesicatoria (Schulte and Bonas 1992; Wengelnik and Bonas 1996) A d ramatic difference was observed between the QS regulons in the exponential and the stationary stage s In total, 255 genes belonged to the QS regulon at the exponential phase whereas 265 genes belonged to the QS regulon at the stationary

PAGE 146

146 phase in this present study. Only 79 genes overlapped at the two phases. Similar situation was also observed in the studies of QS regulon in Pseudomonas spp. (Schuster et al. 2003; Wagner et al. 2003; Schreiber and Desveaux 2011) T he expression of genes in flagellar biosynthesis and chemotaxis, type IV pili, T5SS adhesions, iron uptake were regulated at the exponential phase, whereas, genes encoding T3SS and effectors, fatty acid metabolism, amino ac id metabolism were regulated at the stationary phase. Many functions such as energy metabolism, T2SS substrate biosynthesis, transporters, regul ation are controlled in both phases. The differential regulation of biological functions during different growth phases suggest that bacteria adapt to environmental changes in different stages of infection. For example, f lagellum is critical for bacterial motility and initial attachment to surfaces, as well as biofilm formation. However, it is also one of pathogen associate molecule patterns (PAMP) which strongly induces plant defense response. Therefore, XCC adapts to the environment by activating the flag ella mediated motility during early stage, which might mimic the invasion stage of infection, and repressing flagellar biosynthesis at the stationary state, which might mimic the late stage of infection, thu s minimizing PAMP induced host defense response. (Ellermeier and Slauch 2003; Wolfgang et al. 2004; Schreiber and Desveaux 2011) A cross talk between T3SS and QS in XC C was observed in this study By comparing the QS and HrpG regulons (Guo et al. 2011) 62 genes were identified to be controlled by both systems (Table 4 5), including 11 genes involved in chemotaxis and flagellar biosynthesis, 8 genes encoding T2SS substrates, 8 genes encoding T3SS, 9 genes encoding T3SS effector s 4 genes encoding transporters, 3 transcription

PAGE 147

147 regulator genes and 6 genes related to energy metabolism, as well as 13 hypothetical genes Both HrpG and QS positively regulated the expression of genes encoding T2SS substrates, T3SS and T3SS effectors at the early stationary and stationary phases. However, HrpG and QS showed opposite effect on the expression of genes involved in chemotaxis and flagellar biosynthesis: 8 of 11 chemotaxis and flagellar genes were repressed by HrpG at the early stationary phase while they were induced by QS at the exponential phase. Likely, this may be the strategy utilized by XC C to minimize PAMP (including flagella) induced host defense by repressing flagellar biosynthesis and to suppress host defense by inducing T 3SS effectors at the same time. XC C might coor dinate its virulence traits through HrpX and QS and downstream regulators common to both systems such as hrpX stkXac1 and XAC1320 and flgM Genes encoding T2SS substrates, T3SS and T3SS effectors are possibly controlled by both systems through HrpX at tra nscription level, since those functions are HrpX depe n dent (Table 4 5) (Guo et al. 2011) Moreo ver, StkXac1 belonged to the HrpX regulon and may serve as a downstream regulator in controlling those biological functions Both systems may regulate flagellar biosynthesis by controlling the anti 28 factor FlgM, which is a negative regulator of flagell in synthesis Gene flgM was positively regulated by QS at the exponential phase, whereas it was negatively regulated by HrpG at the early stationary phase. FlgM regulates flagellar assembly by bindi ng to FliA, which results in inhibition of expression of g enes for the late stage of flagellar assembly and also protects FliA from the proteolysis of Lon protease (Barembruch and Hengge 2007) Once the flagellar hook basal body forms a T3SS like structure it secretes FlgM into the ext racellular space which results in the release of FliA and the activation of genes for

PAGE 148

148 flagellin assembly. Our data suggests that the temporal regulation of FlgM by HrpG and QS may be importa nt for the different stage s of XC C infection. In addition, the cro sstalk between the two systems might be underlined by intracellular level of the cyclic di GMP The expression of rpfG and 2 genes encoding GGDEF proteins (XAC1939 and XAC1940) were repressed by HrpG at the early stationary phase (Guo et al. 2011) Totally, 6 genes ( vieA rrpX XAC0424, XAC0644, XAC1993 and XAC2382) that encode products contain ing G GDEF or EAL or bot h domains were regulated by QS (Table 4 3 ) GGDEF domain is responsible for the mes senger cyclic di GMP production while HD GYP domain of RpfG (Ryan et al. 2006) and EAL domains are responsible fo r cyclic di GMP degradation Moreover, the protein protein interaction analysis showed that GGDEF domains of the products of two HrpG repressed genes (XAC1939 and XAC1940) and three QS regulated genes (XAC0424, XAC0644 and XAC2382) physically interact with HD GYP domain of RpfG (Andrade et al. 2006) resulting in variation of the concentration of cyclic di GMP. The cyclic di GMP signaling pathway controls multiple biological functions via Clp and downstream regulato rs Zur and FhrR (He et al. 2007 ) Those regulators might link the QS and HrpG pathways as a regulatory network which integrates the information from diverse environmental cues and response by regulating the expressi on of genes for virulence and fitness QS seems to play critical roles in attachment, entering and colonization of XC C disease cycle by coordinating diverse virulence traits and cross talking with other systems such as T3SS Even though we have not been bu ilding up the relationshi p between different growth phase s and dif ferent infection stages of XC C, it is very likely that the early infecti o n stage in planta resembles the exponential phase of growth in

PAGE 149

149 vitro since they both share low population of XCC and low DSF concentration. The differential regulation of diverse virulence traits by QS in the two different growth phases is supporting our notion that XCC is adapting to its environments through rapid changes in regulation. In first step of d isease cycle, X C C attached to citrus leaf (abixial surface at most times), QS positively regulates genes encoding flagellar and chemotaxis which enable the bacteria sense and swim to the depression where the anticlinal walls of the epidermal cells join. Those depression areas are relatively more abundant in water and nutrients compared to the top are a on leaf surface and protect XC C from sunlight damage and desiccation. XCC cells form microcolonies as earl y as 1 h after attachment (Figure 4 9A). Cells in the microcolonies are more capable of surviving environmental stresses than individual cells on leaf surface (Monier and Lindow 2003) Those microcolonies aggregate along the depression lines of the surface of epidermal cells (Figure 4 9 B and C), which may rely on the cell surface appendages. In a p revious study it was shown that the flagellar mutants of XC C cannot form mature biofilm on leaf surface and caused fewer lesions than wild type st r ain when spray inoculated them on citrus host (Malamud et al. 2011) The expression of genes encoding T2SS substrates was up regulated and the expression of genes encoding transporter was differential ly regulated (up or down regulated) during this process. T2SS substrates are degrading enzymes which promote the growth of bacteria in environmental niches and in hosts (Cianciotto 2005 ) Since leaf surface lack s nutrient s and water, XC C also activates on its transporter to acquire critical elements from environment. QS has been suggested to be important for X ca mpestris pv. campestris to enter the stomata by reverting stomatal closure, one innate immunity response of plant to

PAGE 150

150 bacterial infection. Suppression of stomatal response by X campestris pv. campestris requires an intact DSF/ rpf system including functiona l RpfF and RpfC (G udesblat et al. 2009) Like ly, QS plays similar roles in XC C by facilitat ing the bacteria to move and enter the host through stomata. T he l ow infection rates of the rpfF rpfC rpfG mutants com pared to the wild type strain XC C ( Figure 4 6E) using spray inoculation might be partly due to its effect on stomatal opening. XacPNP ha s been reported to increase stomata opening (Gottig et al. 2008) Interestingly, the x acPNP gene was up regulated by both HrpG and QS happened at the early stationary and stationary phases respectively even though not at the exponential phase (Table 4 5). QS seems to play roles for XCC survival in the intercellular s paces and cause disease. Once XC C enters the plant apoplast, it has to modify the intercellular space for better growth and to suppress plant defense response caused by PAMPs This is mainly achieved by HrpG and HrpX which induce the expression of multiple virulence traits such as T3SS and T3SS effectors, and repress flagellar biosynthesis at the same time (Guo et al. 2011) However, our analysis showed that the regulator HrpX, several hrp genes T3SS effector genes, and genes encoding T2SS sub strates also belong ed to QS regulon, suggesting that QS contributes to virulence via reg ulating those virulence traits. Milder symptoms were observed for the rpfF rpfC rpfG mutants compared to the wild type strain XCC ( Figure 4 6 A, B and C). This indicates that mutations of QS genes did not abolish the virulence of XC C, but reduced the virulence In conclusion, we have significantly advanced our understanding of the QS regulation by characterization of the RpfC and RpfG regu lons besides the RpfF regulon. RpfC and RpfG comprise the sensor kinase and the response regulator for d etection of

PAGE 151

151 the DSF signal and transduction to the downstream regula tors. New functions of QS were revealed such as the control of type IV pili, T5SS adhesi ns, T3SS effectors, and the negative regulation on iron uptake. Importantly, a cross talk be tw een QS and HrpG was observed. We also provided evidence for the roles of QS in attachment of leaf surface and virulence of XCC.

PAGE 152

152 Table 4 1. Bacterial strains and plasmids used in this study Strain or plasmid Relevant characteristics a Reference or source Strains E. coli F lac Z lac X 74 hsd R (r K m K + rec A 1398 end A 1 ton A Invitrogen F lac Z lac ZYA arg F ) U169 rec A 1 end A 1 hsd R 17 ( r K m K + ) pho A sup E thi 1 gyr A 96 rel A 1 Laboratory collection Host of pOK1; Huguet et al. 1998 X. citri subsp citri 306 Rif r c auses citrus canker on citrus da Silva et al. 2002 rpfF rpfF deletion mutant of strain 306, Rif r This study rpfC rpfC deletion mutant of strain 306, Rif r This study rpfG rpfG deletion mutant of strain 306, Rif r This study Plasmids pGEM T easy C loning vector; Ap r Promega pCR 2.1 TOPO TM C loning vector; PUC ori f1 ori lacZ + Km r Ap r Invitrogen p RK2013 C onjugation helper plasmid; ColE1 Tra + Km r Ditta et al. 1980 pOK1 S uicide vector; sacB sacQ mobRK2 oriR6 K Sp r Huguet et al. 1998 pUFR034 S huttle vector; IncW Mob + mob (P) lac Z + Par + Km r DeFeyter et al. 1990 pUFR053 S huttle vector; IncW Mob + mob (P) lac Z + Par + Cm r Gm r El Yac oubi et al. 2007 pUFZ75 Constitutive GFP expression vector; trp promoter cloned upstream of the GFP cassette; Km r Zh ang et al. 2009 pGEM rpfF 1,610 bp fragment containing entire rpfF cloned in pGEM T easy; Ap r This study pGEM pGEM rpfF with deletion of 744 bp from the interior of rpfF ; Ap r This study pOK Apa I Spe F cloned in pOK1; Sp r This study PCR rpfF 1,610 bp fragment containing entire rpfF cloned in pCR 2.1 TOPO TM ; Km r Ap r This study p53 rpfF blunt ended Hind III Xba I fragment containing rpfF from PCR rpfF cloned in pUFR053; Cm r Gm r This study

PAGE 153

153 Table 4 1. C ontinued Strain or plasmid Relevant characteristics a Reference or source pGEM rpfC 3,017 bp fragment containing entire rpfC cloned in pGEM T easy; Ap r This study pGEM pGEM rpfC with deletion of 1,116 bp from the interior of rpfC ; Ap r This study pO K Apa I Spe Sp r This study PCR rpfC 2,590 bp fragment including entire rpfC cloned in pCR 2.1 TOPO TM ; Km r Ap r This study p53 rpfC Kpn I fragment containing entire rpfC from PCR rpfC cloned in pUFR053; Cm r Gm r This study pGEM rpfG 2,037 bp fragment containing entire rpfG cloned in pGEM T easy; Ap r This study pGEM pGEM rpfG with deletion of 648 bp from the interior of rpfG ; Ap r This study pOK Apa I Spe from pGEM Sp r This study p34 rpfG EcoR I fragment containing entire rpfG from pGEM rpfG cloned to pUFR034; Km r This study a Rif r Km r Ap r Cm r Gm r and Sp r indicate resistance to rifampicin, kanamycin, ampicillin, chloramphenicol, g entamicin and spectinomycin, respectively.

PAGE 154

154 Table 4 2. Primers used in this study Primer a Primers used in mutagenesis and complementation rpfCF CAGCAGAGCGAAAGCGTCAAGCA rpfCR CGGCCCTGGCGCTCAATGAAAA rpfGF GCTTCGAGCTGTTCATCAACGGTAAGG rpf GR GCGAGACCGATGCCAAGACTGAGATT rpfFF GGGCGAAATCGTCAAGGTGGTCAT rpfFR GCGAGTTCATCCAGCAATGCCTCAG rpfC kpnF GGggtaccATCGGCTACGAACTGCT rpfC kpnR TGggtaccATACGTCGCATCTTCAGG Primers used in QRT PCR 16S F CGCTTTCGTGCCTCAGTGTCAGTGTTGG 16S R GGCGTAAAGCGTGCGTAG GTGGTGGTT XAC1266 hrpX F AGCGATCTCTGCGTTGTCCTAC XAC1266 hrpX R ATACGCATCTTCGGCCTCTTCCTGA XAC0407 hrpB1 F ACCCATGACAAGATTCAGGACGCT XAC0407 hrpB1 R CTTCCACGTAATTACCGCGCTTGA XAC0415 hrcC F ATACGTCGCCGACAACAAGGATCT XAC0415 hrcC R CGGAGATGTTTCGAATTTGCCGCT XAC0416 hap1 F ATTCTTTGAACACACAGCTCGGCG XAC0416 hap1 R TCGGCATTGTTGCTCTGCTGAA XAC0798 amy F GCATCAGCAACTACAACGACGCTT XAC0798 amy F TGAGATGGTCGAACGTCATGTGCT XAC1854 feoA F ATCGTGGATTCCGTGGAGGAT XAC1854 feoA R TGTAGCCCACCTGCACCAACAAT XAC1904 cheY F A CGTGAACATGCCCAACATGGA XAC1904 cheY R TGGCGATCAGCTGTTCTGGATTGA XAC1954 fliF F AGAAGCCTGGCTATCAATCGCTGT XAC1954 fliF R TGGTCGATCTTGTAGGGAATCTGC

PAGE 155

155 Table 4 2. Continued Primer a Xac1989 flgM F AAATCGAAGGCAATCTACCGACCG Xac1989 flgM R TGCCGTTCTGCAATGCATCCTTCA XAC2865 cheA F ACCATATCCATGCCCTGGTGGAAA XAC2865 cheA R TGCGTTGCAGATACGTCTGCAGTT XAC2922 hrpW F AGACGTCCGACCATTCCGACAAAT XAC2922 hrpW R TGTGAACCACGATCGGA CTGTTGA XAC3176 fecA F ACCCTCAACGCCAGTTATGCCTAT XAC3176 fecA R TGAAGTAATAGCCGGAAAGCGCGA XAC3240 fimA F TGCTTCCATAGCGATCCCGCAATA XAC3240 fimA R TGGTAGCAGTCGCAGTCAAACCAA XAC3385 pilM F AGCCACCAATTACATTCCGTACCC XAC3385 pilM R AAAGGCCTCCACGTCCATTACCTT X AC3548 xacdA F TGAAGCAAGTGCGCGCGATTAT XAC3548 xacdA R TTCGCTTCATTAACGCCTGACTCC XAC3990 srpA F TCGCGATCTCAATTACGACCCGTT XAC3990 srpA R GCGGCGATTGAACGATTGCGAATA XAC2585 gumB F CTGACCGAAATCGAGAAGGGCACCAATC XAC2585 gumB R GCGCCACACCATCACAAGAGGAGTCAGTTC X AC2583 gumD F AAACCAGGTCGAACAGGTCTGGAT XAC2583 gumD R AGCAGACCGAAATCGAACAGGTCA a Lowercase nucleotides are not exact matches to the sequence and were introduced to add restriction enzyme sites.

PAGE 156

156 Table 4 3. Genes showing significant differential expressi on in QS mutants compared with wild type strain at exponential and/or stationary phases. Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC0802 NS NS NS NS 1.21 NS sulfotransferase Amino acid b iosynthesis XAC3040 metA NS NS NS NS 1.16 NS homoserine O acetyltransferase Amino acid biosynthesis XAC2719 trpF NS NS NS NS NS 1.03 N (5' phosphoribosyl)anthranilat e isomerase Amino acid biosynthesis XAC2947 apbE NS NS 1.81 NS NS NS thiamine biosynth esis lipoprotein ApbE precursor Biosynthesis of cofactors, prosthetic groups, and carriers XAC3340 cysG NS NS NS NS NS 1.23 siroheme synthase Biosynthesis of cofactors, prosthetic groups, and carriers XAC1984 flgD 1.99 NS 1.76 NS NS NS flagellar basal body rod modification protein Cell envelope XAC1427 pru 1.57 1.36 1.36 NS NS NS protein U Cell envelope XAC3921 ugt 1.24 1.01 1.29 NS NS NS glucosyltransferase Cell envelope XAC0661 peh 1 1.05 1.07 1.99 1.18 1.38 NS endopolygalacturonase Cell envelope XAC3524 2.77 2.54 2.49 1.24 2.01 1.14 hypothetical protein Cell envelope XAC3240 fimA NS 1.44 NS NS NS NS fimbrillin Cell envelope XAC3546 xadA NS NS 1.72 NS NS NS outer membrane protein Cell envelope XAC3548 xadA NS NS 1.75 NS NS NS outer membrane protein Cell envelope XAC1813 hmsH NS NS 2.57 NS 1.29 1.38 HmsH protein Cell envelope XAC3180 iucA NS NS 3.37 NS NS NS iron transporter Cell envelope XAC3178 NS NS 3.58 NS NS NS hypothetical protein Cell envelope XAC2922 hrpW NS NS NS NS 1 .32 1.53 HrpW protein Cell envelope XAC2374 pglA NS NS NS NS 1.03 NS polygalacturonase Cell envelope XAC3354 ompW NS NS NS NS 2.03 1.74 outer membrane protein W Cell envelope XAC3845 NS NS NS NS NS 1.75 hypothetical protein Cell envelope XAC2139 NS NS NS NS NS 1.61 hypothetical protein Cell envelope XAC3844 NS NS NS NS NS 1.58 hypothetical protein Cell envelope

PAGE 157

157 Table 4 3. Continued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XA C1012 mopB NS NS NS NS NS 1.53 outer membrane protein Cell envelope XAC2561 blc NS NS NS NS NS 1.30 outer membrane lipoprotein Blc Cell envelope XAC3972 NS NS NS NS NS 1.21 hypothetical protein Cell envelope XAC4259 blc NS NS NS NS NS 1.16 lipocal in Cell envelope XAC1976 flgL 2.50 2.44 1.15 NS NS NS flagellar hook associated protein FlgL Cellular processes XAC1931 cheZ 2.25 1.57 1.29 NS NS NS chemotaxis related protein Cellular processes XAC1932 cheY 2.14 1.55 1.42 NS NS NS chemotaxis p rotein Cellular processes XAC2448 mcp 2.11 2.09 2.00 NS NS NS chemotaxis protein Cellular processes XAC2866 mcp 2.10 2.10 2.19 NS NS NS chemotaxis protein Cellular processes XAC1977 flgK 2.09 NS NS NS NS NS flagellar hook associated protein FlgK Cellular processes XAC1983 flgE 2.04 1.64 NS NS NS NS flagellar hook protein FlgE Cellular processes XAC1981 flgG 1.91 NS 1.94 NS NS NS flagellar basal body rod protein FlgG Cellular processes XAC1973 fliS 1.84 1.81 2.10 NS NS NS flagellar protei n Cellular processes XAC1979 flgI 1.84 NS 1.87 NS NS NS flagellar basal body P ring protein Cellular processes XAC1980 flgH 1.84 NS 1.83 NS NS NS flagellar basal body L ring protein Cellular processes XAC1978 flgJ 1.81 NS 1.55 NS NS NS flagellar r od assembly protein/muramidase FlgJ Cellular processes XAC1985 flgC 1.81 NS 1.65 NS NS NS flagellar basal body rod protein FlgC Cellular processes XAC2865 cheA 1.77 1.50 1.87 NS NS NS chemotaxis histidine protein kinase Cellular processes XAC1904 c heY 1.77 1.54 1.90 NS NS NS chemotaxis response regulator Cellular processes XAC2867 cheW 1.75 1.62 1.80 NS NS NS chemotaxis protein Cellular processes XAC1996 mcp 1.73 1.70 1.98 NS NS NS chemotaxis protein Cellular processes

PAGE 158

158 Table 4 3. Contin ued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC1211 katE 1.73 NS NS 1.44 1.51 2.20 catalase Cellular processes XAC1974 fliD 1.73 1.53 1.92 NS NS NS flagellar protein Cellular proces ses XAC3132 mcp 1.71 1.55 2.01 NS NS NS chemotaxis protein Cellular processes XAC1982 flgF 1.68 1.32 NS NS NS NS flagellar basal body rod protein FlgF Cellular processes XAC2447 cheW 1.67 1.30 1.60 NS NS NS chemotaxis protein Cellular processes XAC1930 cheA 1.66 1.30 1.03 NS NS NS chemotaxis related protein Cellular processes XAC1988 flgA 1.65 NS NS NS 1.55 1.44 flagellar basal body P ring biosynthesis protein FlgA Cellular processes XAC4029 catB 1.65 1.35 1.78 NS NS NS catalase precurs or Cellular processes XAC1987 cheV 1.64 1.44 1.85 NS NS NS chemotaxis protein Cellular processes XAC1893 tsr 1.64 1.70 1.70 NS NS NS chemotaxis protein Cellular processes XAC1950 fliJ 1.60 1.58 1.61 1.34 1.83 1.35 flagellar FliJ protein Cell ular processes XAC1895 tsr 1.57 1.56 1.83 NS NS NS chemotaxis protein Cellular processes XAC1951 fliI 1.54 1.30 1.47 NS 1.46 1.11 flagellar protein Cellular processes XAC1897 tsr 1.53 1.59 1.65 NS NS NS chemotaxis protein Cellular processes XAC1899 tsr 1.44 1.52 1.58 NS NS NS chemotaxis protein Cellular processes XAC1903 cheA 1.42 1.33 1.69 NS NS NS chemotaxis protein Cellular processes XAC1894 tsr 1.42 1.37 1.66 NS NS NS chemotaxis protein Cellular processes XAC0064 1.41 1.39 1.13 NS NS NS acetyltransferase Cellular processes XAC1907 parA 1.41 1.11 1.65 NS NS NS chromosome partioning protein Cellular processes XAC1953 fliG 1.41 1.24 1.81 1.09 1.45 NS flagellar protein Cellular processes XAC1902 tsr 1.40 1.51 1.3 6 NS NS NS chemotaxis protein Cellular processes XAC1952 fliH 1.38 1.24 1.42 NS 1.36 NS flagellar protein Cellular processes XAC3213 mcp1 1.33 1.39 1.35 NS NS NS chemotaxis protein Cellular processes XAC1949 fliK 1.33 1.49 1.71 1.24 1.52 1. 29 flagellar protein Cellular processes XAC0611 tsr 1.28 1.04 NS NS NS NS chemotaxis protein Cellular processes XAC1896 tsr 1.25 1.12 1.24 NS NS NS chemotaxis protein Cellular processes

PAGE 159

159 Table 4 3. Continued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC1954 fliF 1.23 1.05 1.74 NS NS NS flagellar MS ring protein Cellular processes XAC1900 tsr 1.22 1.26 1.32 NS NS NS chemotaxis protein Cellular processes XAC0443 pdhB 1.20 NS 1. 09 NS NS NS branched chain alpha keto acid dehydrogenase subunit E2 Cellular processes XAC1891 tsr 1.19 1.29 1.27 NS NS NS chemotaxis protein Cellular processes XAC1178 1.13 NS NS 1.89 1.95 2.63 oxidoreductase Cellular processes XAC1909 motC NS NS 1.10 NS NS NS flagellar motor protein Cellular processes XAC3385 pilM NS NS 1.06 NS NS NS fimbrial assembly membrane protein Cellular processes XAC0270 NS NS 2.03 NS NS NS hypothetical protein Cellular processes XAC0076 avrBs2 NS NS NS NS 1.07 N S avirulence protein Cellular processes XAC1941 fliR NS NS NS NS 1.17 NS flagellar biosynthetic protein Cellular processes XAC1937 flhB NS NS NS NS 1.32 NS flagellar biosynthesis protein FlhB Cellular processes XAC1908 motB NS NS NS NS 1.54 NS flagellar motor protein MotD Cellular processes XAC1955 fliE NS NS NS NS 1.94 1.78 flagellar protein Cellular processes XAC1986 flgB NS NS NS NS 2.03 NS flagellar basal body rod protein FlgB Cellular processes XAC1942 fliQ NS NS NS NS 2.07 NS flagellar biosynthe sis Cellular processes XAC1948 fliL NS NS NS NS 2.16 1.81 flagellar protein Cellular processes XAC0719 betB NS NS NS NS NS 1.21 betaine aldehyde dehydrogenase Cellular processes XAC3990 srpA NS NS NS NS NS 1.15 catalase Cellular processes XAC0718 bet A NS NS NS NS NS 1.02 choline dehydrogenase Cellular processes XAC0851 slfA NS NS NS NS NS 1.51 NADH dependent FMN reductase Cellular processes XAC0934 1.67 1.32 1.36 NS NS NS truncated xylanase Central intermediary metabolism

PAGE 160

160 Table 4 3. Continue d Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC0933 1.42 1.14 1.34 NS NS NS truncated xylanase Central intermediary metabolism XAC3738 1.28 NS NS 1.23 1.16 1.23 oxidoreductase Ce ntral intermediary metabolism XAC4036 piuB NS NS 1.77 NS NS NS iron uptake factor Central intermediary metabolism XAC2948 NS NS 2.22 NS NS NS sulfite reductase Central intermediary metabolism XAC2895 yagT NS NS NS NS NS 2.12 putative xanthine dehydro genase iron sulfur binding subunit Central intermediary metabolism XAC2894 yagS NS NS NS NS NS 2.08 oxidoreductase Central intermediary metabolism XAC1180 NS NS NS NS NS 1.68 short chain dehydrogenase Central intermediary metabolism XAC2893 yagR NS NS NS NS NS 1.62 oxidoreductase Central intermediary metabolism XAC1188 NS NS NS NS NS 1.49 hydroxylase molybdopterin containing subunit Central intermediary metabolism XAC2138 NS NS NS NS NS 1.34 L sorbosone dehydrogenase Central intermediary met abolism XAC2051 NS NS NS NS NS 1.29 oxidoreductase Central intermediary metabolism XAC0585 NS NS NS NS NS 1.23 hypothetical protein Central intermediary metabolism XAC2124 NS NS NS NS NS 1.18 hypothetical protein Central intermediary metabolism XAC1189 NS NS NS NS NS 1.16 ferredoxin Central intermediary metabolism XAC1187 NS NS NS NS NS 1.10 hydroxylase large subunit Central intermediary metabolism

PAGE 161

161 Table 4 3. Continued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC1890 cheR 1.46 1.43 1.49 NS NS NS chemotaxis protein methyltransferase DNA metabolism XAC2869 cheR 1.27 NS 1.34 NS NS NS response regulator for chemotaxis DNA metabolism XAC4060 czcD 1.25 NS NS NS NS NS h eavy metal transporter DNA metabolism XAC3915 radC NS NS NS NS 1.06 NS DNA repair protein RadC DNA metabolism XAC0035 NS NS NS NS NS 1.53 hypothetical protein DNA metabolism XAC1186 uvrA2 NS NS NS NS NS 1.24 excinuclease ABC subunit A DNA metabolis m XAC2875 nfi NS NS NS NS NS 1.23 endonuclease V DNA metabolism XAC0612 engXCA 4.38 4.58 4.29 2.06 3.09 1.89 cellulase Energy metabolism XAC1285 lamA 3.34 3.31 2.56 NS NS NS endo 1,3 beta glucanase Energy metabolism XAC0029 egl 3.19 3.32 3 .85 3.96 4.52 3.80 cellulase Energy metabolism XAC0028 egl 3.15 2.51 2.46 NS NS NS cellulase Energy metabolism XAC1927 aslB 2.35 2.51 2.73 1.67 2.65 3.51 Fe S oxidoreductase Energy metabolism XAC3507 celS 1.68 2.03 1.69 NS NS NS truncated cellulase S Energy metabolism XAC1975 fliC 1.58 1.79 1.71 NS NS NS flagellin Energy metabolism XAC3747 ybdR 1.49 NS NS 1.27 1.29 1.85 Zn dependent alcohol dehydrogenase Energy metabolism XAC1287 galM 1.40 1.42 NS NS NS NS aldose 1 epimerase En ergy metabolism XAC2896 1.40 NS NS NS NS 1.37 alcohol dehydrogenase Energy metabolism XAC3562 pel 1.35 1.22 NS NS NS NS pectate lyase Energy metabolism XAC0257 aceA 1.29 NS NS 1.35 NS NS isocitrate lyase Energy metabolism XAC0445 pdhB 1.27 NS 1.21 NS NS NS pyruvate dehydrogenase E1 beta subunit Energy metabolism XAC0446 pdhA 1.26 1.00 1.19 NS NS NS pyruvate dehydrogenase E1 alpha subunit Energy metabolism XAC0798 amy 1.17 1.21 NS NS NS NS alpha amylase Energy metabolism

PAGE 162

162 Table 4 3. C ontinued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC2028 fdh 1.11 NS NS NS 1.11 1.68 glutathione dependent formaldehyde dehydrogenase Energy metabolism XAC4079 ecaA 1.40 NS 1.06 NS NS N S a type carbonic anhydrase Energy metabolism XAC4327 uahA NS 2.41 NS NS 3.56 NS allophanate hydrolase Energy metabolism XAC2986 pelB NS 1.19 NS NS NS NS pectate lyase II Energy metabolism XAC1886 pcaD NS NS 1.98 NS NS NS beta ketoadipate enol lacto ne hydrolase Energy metabolism XAC3114 pqqG NS NS 1.13 NS NS NS pyrroloquinoline quinone biosynthesis protein PqqB Energy metabolism XAC1460 fumB NS NS 1.06 NS NS NS fumarate hydratase Energy metabolism XAC3072 fucA1 NS NS 1.06 NS NS NS alpha L fucosi dase Energy metabolism XAC2982 qxtB NS NS 1.09 NS NS NS quinol oxidase subunit II Energy metabolism XAC2983 NS NS 1.16 NS NS NS quinol oxidase subunit I Energy metabolism XAC1811 hmsR NS NS 1.95 NS NS NS N glycosyltransferase PgaC Energy metabolism X AC1259 cyoB NS NS NS 1.07 NS NS cytochrome O ubiquinol oxidase subunit I Energy metabolism XAC4252 xynB NS NS NS NS 1.12 NS xylanase Energy metabolism XAC2336 cydA NS NS NS NS 1.72 1.57 cytochrome D ubiquinol oxidase subunit I Energy metabolism XAC325 4 glgX NS NS NS NS NS 1.70 glycogen debranching enzyme Energy metabolism XAC0154 NS NS NS NS NS 1.50 alpha amylase Energy metabolism XAC0224 poxB NS NS NS NS NS 1.44 pyruvate dehydrogenase Energy metabolism XAC4269 NS NS NS NS NS 1.29 nuclear re ceptor binding factor related protein Energy metabolism XAC0794 NS NS NS NS NS 1.27 quinone reductase Energy metabolism XAC1476 NS NS NS NS NS 1.27 hypothetical protein Energy metabolism XAC1174 NS NS NS NS NS 1.24 hypothetical protein Energy m etabolism XAC1882 rpfA NS NS NS NS NS 1.13 aconitate hydratase Energy metabolism

PAGE 163

163 Table 4 3. Continued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC3632 gloA NS NS NS NS NS 1.10 lactoylgl utathione lyase Energy metabolism XAC2907 NS NS NS NS NS 1.09 hypothetical protein Energy metabolism XAC2469 gabD NS NS NS NS NS 1.03 succinate semialdehyde dehydrogenase Energy metabolism XAC2337 cydB NS NS NS NS NS 1.10 cytochrome D ubiquinol oxid ase subunit II Energy metabolism XAC0830 tauD NS NS NS NS NS 1.17 taurine dioxygenase Energy metabolism XAC0364 gctA NS NS 1.14 NS NS NS glutaconate CoA transferase subunit A Fatty acid and phospholipid metabolism XAC3037 NS NS NS NS NS 1.38 hydrola se Fatty acid and phospholipid metabolism XAC2414 lig3 NS NS NS NS NS 1.26 ATP dependent DNA ligase Fatty acid and phospholipid metabolism XAC1341 lig2 NS NS NS NS NS 1.03 ATP dependent DNA ligase Fatty acid and phospholipid metabolism XAC0846 msuC NS NS NS NS NS 1.04 FMNH2 dependent monooxygenase Fatty acid and phospholipid metabolism XAC1905 1.59 1.43 1.77 NS NS NS hypothetical protein Hypothetical proteins XAC3763 1.47 1.33 1.45 NS NS NS hypothetical protein Hypothetical proteins XAC120 9 1.33 NS NS NS NS NS hypothetical protein Hypothetical proteins XAC0753 1.31 NS 1.63 NS NS NS hypothetical protein Hypothetical proteins XAC1021 1.11 1.39 1.59 1.36 1.59 1.57 hypothetical protein Hypothetical proteins XAC1219 NS NS 1. 69 NS NS NS hypothetical protein Hypothetical proteins XAC0223 NS NS 1.04 NS NS NS hypothetical protein Hypothetical proteins XAC0531 NS NS 1.03 NS NS NS hypothetical protein Hypothetical proteins XAC2007 NS NS 1.01 NS NS NS hypothetical protei n Hypothetical proteins

PAGE 164

164 Table 4 3. Continued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC1856 NS NS 1.13 NS NS NS hypothetical protein Hypothetical proteins XAC2878 NS NS 1.21 NS NS N S hypothetical protein Hypothetical proteins XAC2383 NS NS 1.33 NS NS NS phosphate binding protein Hypothetical proteins XAC3619 NS NS 1.91 NS NS NS hypothetical protein Hypothetical proteins XAC0269 NS NS 2.45 NS NS NS hypothetical protein Hypoth etical proteins XAC2944 NS NS 2.59 NS NS NS hypothetical protein Hypothetical proteins XAC2943 NS NS 3.11 NS NS NS hypothetical protein Hypothetical proteins XAC2945 NS NS 3.42 NS NS NS hypothetical protein Hypothetical proteins XAC1208 NS NS N S NS 1.12 NS hypothetical protein Hypothetical proteins XAC3776 NS NS NS NS 1.10 2.16 hypothetical protein Hypothetical proteins XAC2052 NS NS NS NS NS 1.59 hypothetical protein Hypothetical proteins XAC2369 NS NS NS NS NS 1.45 general stress protein Hypothetical proteins XAC2491 NS NS NS NS NS 1.37 hypothetical protein Hypothetical proteins XAC1453 NS NS NS NS NS 1.36 hypothetical protein Hypothetical proteins XAC3981 NS NS NS NS NS 1.29 hypothetical protein Hypothetical proteins XAC3982 NS NS NS NS NS 1.28 hypothetical protein Hypothetical proteins XAC3983 NS NS NS NS NS 1.26 hypothetical protein Hypothetical proteins XAC1342 NS NS NS NS NS 1.24 mRNA 3' end processing factor Hypothetical proteins XAC2127 NS NS NS NS NS 1.22 hypothetical protein Hypothetical proteins XAC0186 NS NS NS NS NS 1.21 hypothetical protein Hypothetical proteins XAC2892 NS NS NS NS NS 1.19 hypothetical protein Hypothetical proteins XAC0185 NS NS NS NS NS 1.18 hypothetical protein Hypothetical proteins XAC1665 NS NS NS NS NS 1.00 hypothetical protein Hypothetical proteins XAC3402 NS NS NS NS NS 1.12 hypothetical protein Hypothetical proteins XAC0829 NS NS NS NS NS 1.24 ABC transporter substrate binding protein Hypothetical proteins

PAGE 165

165 Table 4 3. Continued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC3725 2.18 NS NS 1.97 1.22 NS hypothetical protein Mobile and extrachromosomal element functions XAC1321 mu cD NS NS 1.45 NS NS NS periplasmic protease Mobile and extrachromosomal element functions XAC2155 NS NS NS NS NS 1.75 hypothetical protein Mobile and extrachromosomal element functions XAC1926 2.28 2.43 2.56 1.50 2.55 3.52 hypothetical protei n Not in JCVI XAC1452 2.15 2.11 2.51 NS NS NS hypothetical protein Not in JCVI XAC3727 2.09 NS NS 1.27 1.24 NS hypothetical protein Not in JCVI XAC4026 1.91 1.74 2.29 NS NS NS hypothetical protein Not in JCVI XAC4030 catB 1.81 1.68 1. 86 NS NS NS catalase Not in JCVI XAC1034 1.80 2.06 1.76 NS 1.11 NS peptidyl Asp metalloendopeptidase Not in JCVI XAC1210 1.78 NS 1.12 1.26 1.25 1.34 hypothetical protein Not in JCVI XAC3219 1.56 1.77 2.06 1.71 2.18 2.11 hypothetical protein Not in JCVI XAC0543 1.51 1.19 1.95 2.50 2.80 2.59 hypothetical protein Not in JCVI XAC1928 1.49 1.32 1.66 NS 1.49 1.53 hypothetical protein Not in JCVI XAC3506 1.49 1.47 1.41 NS NS NS truncated cellulase S Not in JCVI XAC40 91 1.40 1.66 1.56 NS 1.22 NS hypothetical protein Not in JCVI XAC1990 1.36 NS 1.65 NS NS NS hypothetical protein Not in JCVI XAC3787 1.33 1.56 1.53 NS 1.40 1.16 hypothetical protein Not in JCVI XAC2786 1.32 NS 1.65 1.75 2.14 1.97 hypothetical protein Not in JCVI XAC2268 1.31 1.23 1.08 NS NS NS hypothetical protein Not in JCVI XAC3533 1.31 1.63 2.18 1.88 1.74 2.11 hypothetical protein Not in JCVI XAC1634 1.27 1.08 1.49 NS NS NS hypothetical protein Not in JCVI XAC3018 1.24 1.17 1.08 NS 1.13 NS hypothetical protein Not in JCVI XAC1972 1.22 1.21 1.19 NS NS NS hypothetical protein Not in JCVI

PAGE 166

166 Table 4 3. Continued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC4321 1.20 1.08 NS NS NS NS hypothetical protein Not in JCVI XAC0817 1.20 1.23 1.26 NS 1.26 NS hypothetical protein Not in JCVI XAC1971 1.15 1.21 1.17 NS NS NS hypothetical protein Not in JCVI XAC1778 1.15 1.18 1 .34 NS 1.06 NS sensor kinase Not in JCVI XAC1898 1.12 NS 1.36 NS NS NS hypothetical protein Not in JCVI XAC3745 1.12 NS NS 1.12 1.08 1.90 hypothetical protein Not in JCVI XAC3966 1.09 NS NS 1.09 NS 1.50 hypothetical protein Not in JCVI XAC3746 1.08 NS NS 1.07 1.05 1.89 hypothetical protein Not in JCVI XAC2027 1.06 NS NS NS 1.12 1.61 hypothetical protein Not in JCVI XAC3021 1.05 NS NS NS NS NS hypothetical protein Not in JCVI XAC1810 1.23 NS 2.35 NS NS 1.07 hypothetical protein Not in JCVI XAC3926 1.24 NS 1.57 NS NS NS hypothetical protein Not in JCVI XAC3523 2.06 2.00 2.33 NS 1.88 1.58 hypothetical protein Not in JCVI XAC3522 2.19 1.97 2.10 1.11 1.77 1.10 hypothetical protein Not in JCVI XAC3525 2.98 2.65 2. 54 2.04 2.47 1.55 hypothetical protein Not in JCVI XAC1995 NS 1.07 1.20 NS NS NS hypothetical protein Not in JCVI XAC0015 NS NS 1.31 NS NS NS hypothetical protein Not in JCVI XAC1235 NS NS 1.26 NS NS NS hypothetical protein Not in JCVI XAC190 1 NS NS 1.08 NS NS NS hypothetical protein Not in JCVI XAC2787 NS NS 1.07 NS 1.60 1.32 hypothetical protein Not in JCVI XACa0001 NS NS 1.09 NS NS NS hypothetical protein Not in JCVI XAC2887 NS NS 1.61 NS 1.26 NS hypothetical protein Not in J CVI XAC0272 NS NS 2.43 NS NS NS hypothetical protein Not in JCVI XAC0271 NS NS 2.53 NS NS NS hypothetical protein Not in JCVI XAC0822 NS NS 3.27 NS NS NS hypothetical protein Not in JCVI XAC0824 NS NS 3.68 NS NS NS hypothetical protein Not in J CVI XAC0825 NS NS 4.10 NS NS NS hypothetical protein Not in JCVI

PAGE 167

167 Table 4 3. Continued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC3513 NS NS NS 1.36 1.20 1.38 hypothetical protein Not in JCVI XAC2370 NS NS NS NS 1.42 1.08 hypothetical protein Not in JCVI XACb0011 avrXacE 3 NS NS NS NS 1.21 NS Not in JCVI XAC2026 NS NS NS NS 1.20 1.67 hypothetical protein Not in JCVI XAC2250 NS NS NS NS 1.19 NS hypothetical protein N ot in JCVI XAC3715 NS NS NS NS 1.12 1.53 hypothetical protein Not in JCVI XACb0028 NS NS NS NS 1.08 NS Not in JCVI XAC3085 NS NS NS NS 1.03 1.23 hypothetical protein Not in JCVI XAC0086 NS NS NS NS 1.06 NS hypothetical protein Not in JCV I XAC0239 NS NS NS NS NS 2.31 hypothetical protein Not in JCVI XAC3777 NS NS NS NS NS 2.29 hypothetical protein Not in JCVI XAC1353 NS NS NS NS NS 2.21 hypothetical protein Not in JCVI XAC3685 NS NS NS NS NS 2.14 hypothetical protein Not in JCVI XAC3684 NS NS NS NS NS 2.03 hypothetical protein Not in JCVI XAC0027 NS NS NS NS NS 1.92 hypothetical protein Not in JCVI XAC0587 NS NS NS NS NS 1.83 hypothetical protein Not in JCVI XAC3775 NS NS NS NS NS 1.71 hypothetical protein No t in JCVI XAC3970 NS NS NS NS NS 1.67 hypothetical protein Not in JCVI XAC1554 NS NS NS NS NS 1.66 hypothetical protein Not in JCVI XAC2654 NS NS NS NS NS 1.66 hypothetical protein Not in JCVI XAC1364 NS NS NS NS NS 1.66 hypothetical protei n Not in JCVI XAC2126 NS NS NS NS NS 1.64 hypothetical protein Not in JCVI XAC2793 NS NS NS NS NS 1.59 hypothetical protein Not in JCVI XAC2367 NS NS NS NS NS 1.56 hypothetical protein Not in JCVI XAC3866 NS NS NS NS NS 1.55 hypothetical pr otein Not in JCVI XAC2025 NS NS NS NS NS 1.54 hypothetical protein Not in JCVI XAC3971 NS NS NS NS NS 1.49 hypothetical protein Not in JCVI

PAGE 168

168 Table 4 3. Continued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W S t a Description JCVI b XAC3128 NS NS NS NS NS 1.48 hypothetical protein Not in JCVI XAC4007 NS NS NS NS NS 1.46 hypothetical protein Not in JCVI XAC2415 NS NS NS NS NS 1.35 hypothetical protein Not in JCVI XAC2559 NS NS NS NS NS 1.28 hypothet ical protein Not in JCVI XAC0131 NS NS NS NS NS 1.28 hypothetical protein Not in JCVI XAC3957 NS NS NS NS NS 1.24 hypothetical protein Not in JCVI XAC3748 NS NS NS NS NS 1.24 hypothetical protein Not in JCVI XAC2122 NS NS NS NS NS 1.16 dehy drogenase Not in JCVI XAC3657 NS NS NS NS NS 1.14 hypothetical protein Not in JCVI XAC0665 NS NS NS NS NS 1.11 hypothetical protein Not in JCVI XAC2057 NS NS NS NS NS 1.10 hypothetical protein Not in JCVI XAC0228 NS NS NS NS NS 1.09 hypothe tical protein Not in JCVI XAC1193 NS NS NS NS NS 1.08 hypothetical protein Not in JCVI XAC2445 NS NS NS NS NS 1.08 hypothetical protein Not in JCVI XAC3874 NS NS NS NS NS 1.08 hypothetical protein Not in JCVI XAC3682 NS NS NS NS NS 1.06 hyp othetical protein Not in JCVI XAC1354 NS NS NS NS NS 1.02 hypothetical protein Not in JCVI XAC0607 NS NS NS NS NS 1.42 hypothetical protein Not in JCVI XAC1945 fliO NS NS NS NS NS 1.43 flagellar protein Not in JCVI XAC2151 yapH 4.76 4.60 4.40 N S 1.79 1.08 YapH protein Protein fate XAC4182 3.16 2.88 2.87 NS 1.99 NS cytochrome C biogenesis protein Protein fate XAC0465 2.88 3.00 2.94 NS 1.20 NS metalloproteinase Protein fate XAC0540 1.76 1.90 1.58 NS 1.09 NS ribonuclease Prot ein fate XAC2763 1.75 2.32 2.39 NS NS NS extracellular protease Protein fate XAC2831 1.46 1.62 1.27 NS NS NS extracellular serine protease Protein fate XAC2482 rrpX NS NS 1.35 NS NS NS transcriptional regulator Protein fate

PAGE 169

169 Table 4 3. Conti nued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC0415 hrcC NS NS 1.12 NS NS NS HrcC protein Protein fate XAC0408 hrpB2 NS NS 1.08 NS NS 1.24 HrpB2 protein Protein fate XAC1512 NS NS 1.05 NS 1.20 1.41 serine peptidase Protein fate XAC0542 groEL NS NS 1.08 NS NS NS chaperonin GroEL Protein fate XAC0541 groES NS NS 1.12 NS NS NS co chaperonin GroES Protein fate XAC3545 NS NS 1.98 NS NS NS protease Protein fate XAC2745 NS NS NS 1.18 NS NS metallopeptidase Protein fate XAC1827 NS NS NS 1.34 NS NS hypothetical protein Protein fate XAC2932 pfpI NS NS NS NS NS 1.24 protease Protein fate XAC0407 hrpB1 NS NS NS NS NS 1.19 HrpB1 protein Protein fate XAC0410 hrpB4 NS NS NS NS NS 1.18 HrpB4 protein Protein fate XAC0286 avrXacE 1 NS NS NS NS NS 1.17 avirulence protein Protein fate XAC0411 hrpB5 NS NS NS NS NS 1.17 type III secretion system protein HrpB Protein fate XAC3368 NS NS NS NS NS 1.12 hypothetical protein Protein fa te XAC0787 NS NS NS NS NS 1.47 peptidase Protein fate XAC2992 2.36 2.54 2.69 1.97 2.58 2.55 endoproteinase Arg C Protein synthesis XAC0416 hpa1 NS NS 1.62 NS NS 1.03 Hpa1 protein Protein synthesis XAC0365 gctB NS NS 1.18 NS NS NS glutacona te CoA transferase subunit B Protein synthesis XAC1633 gcd NS NS NS NS NS 1.17 glucose dehydrogenase Protein synthesis XAC4006 trpS NS NS NS NS NS 1.08 tryptophanyl tRNA synthetase Protein synthesis XAC3181 lysA NS NS 2.50 NS NS NS diaminopimelate dec arboxylase Purines, pyrimidines, nucleosides, and nucleotides XAC2868 vieA 1.68 1.44 1.82 NS NS NS response regulator Regulatory functions XAC3922 entF 1.36 1.15 1.28 NS NS NS ATP dependent serine activating enzyme Regulatory functions

PAGE 170

170 Table 4 3. Continued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC1989 flgM 1.27 NS 1.63 NS NS NS flagellar protein Regulatory functions XAC3273 1.14 1.05 1.35 1.31 1.38 1.16 histidine kinas e response regulator hybrid protein Regulatory functions XAC1328 1.09 NS 1.29 NS 1.17 1.18 hypothetical protein Regulatory functions XAC1993 1.08 NS 1.34 NS NS NS hypothetical protein Regulatory functions XAC2382 1.10 NS 1.34 NS NS NS GGDEF family protein Regulatory functions XAC1812 hmsF 1.23 NS 2.53 NS 1.33 1.40 HmsF protein Regulatory functions XAC3445 NS NS 3.20 NS NS 3.01 transcriptional regulator Regulatory functions XAC1171 stkXac1 NS NS NS NS 1.13 NS serine/threonine kinase Regu latory functions XAC1398 NS NS NS NS 1.17 NS hypothetical protein Regulatory functions XAC1670 NS NS NS NS NS 1.51 response regulator Regulatory functions XAC1819 tspO NS NS NS NS NS 1.04 tryptophan rich sensory protein Regulatory functions XAC08 45 flbD NS NS NS NS NS 1.03 transcriptional regulator Regulatory functions XAC3769 nucA 2.37 2.82 2.59 NS NS NS endonuclease precursor Transcription XAC1933 fliA 1.95 NS NS NS NS NS RNA polymerase sigma factor Transcription XAC1969 rpoN 1.31 1.21 1.11 NS 1.07 1.11 RNA polymerase sigma 54 factor Transcription XAC1320 NS NS 1.50 NS NS NS regulatory protein Transcription XAC1319 algU NS NS 1.27 NS NS NS RNA polymerase sigma factor RpoE Transcription XAC0941 NS NS NS NS NS 1.28 transcripti onal regulator Transcription XAC3875 rbn NS NS NS NS NS 1.23 ribonuclease BN Transcription XAC2864 2.42 2.16 2.50 NS NS NS hypothetical protein Transport and binding proteins XAC2600 btuB 1.06 1.09 NS NS NS NS TonB dependent receptor Transport a nd binding proteins XAC2830 fhuA 1.04 1.15 NS NS NS NS TonB dependent receptor Transport and binding proteins

PAGE 171

17 1 Table 4 3. Continued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC1910 cirA NS 1.03 NS NS NS NS TonB dependent receptor Transport and binding proteins XAC1149 NS NS 2.29 NS NS 1.22 bacterioferritin Transport and binding proteins XAC3856 NS NS 1.82 1.53 1.49 1.84 hypothetical protein Transport and binding proteins XAC 1438 brf NS NS 1.65 NS NS NS bacterioferritin Transport and binding proteins XAC3440 hppA NS NS 1.09 NS NS NS membrane bound proton translocating pyrophosphatase Transport and binding proteins XAC1854 feoA NS NS 1.16 NS NS NS ferrous iron transport pro tein Transport and binding proteins XAC2185 fhuA NS NS 1.17 NS NS NS ferrichrome iron receptor Transport and binding proteins XAC1855 feoB NS NS 1.21 NS NS NS ferrous iron transport protein B Transport and binding proteins XAC3071 iroN NS NS 1.31 NS NS NS TonB dependent receptor Transport and binding proteins XAC3179 yceE NS NS 1.55 NS NS NS transport protein Transport and binding proteins XAC0492 NS NS 1.64 NS NS NS bacterioferritin associated ferredoxin Transport and binding proteins XAC3620 pfeA NS NS 1.87 NS NS NS outer membrane receptor FepA Transport and binding proteins XAC3176 fecA NS NS 2.40 NS NS NS citrate dependent iron transporter Transport and binding proteins XAC1435 fhuA NS NS 2.90 NS NS NS iron receptor Transport and binding protei ns XAC3370 fhuE NS NS 3.10 NS NS NS outer membrane receptor for ferric iron uptake Transport and binding proteins XAC0176 fpvA NS NS 3.27 NS NS NS ferripyoverdine receptor Transport and binding proteins

PAGE 172

172 Table 4 3. Continued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC2941 fhuA NS NS 3.50 NS NS NS TonB dependent receptor Transport and binding proteins XAC3498 fhuE NS NS 4.09 NS NS NS outer membrane receptor for ferric iron uptake Transpor t and binding proteins XAC0823 phuR NS NS 4.33 NS NS NS outer membrane hemin receptor Transport and binding proteins XAC3444 btuB NS NS 6.41 NS NS 3.44 TonB dependent receptor Transport and binding proteins XAC3855 NS NS NS NS NS 1.33 hypothetical pr otein Transport and binding proteins XAC0720 betT NS NS NS NS NS 1.16 high affinity choline transport Transport and binding proteins XAC0756 kdpA NS NS NS NS NS 1.15 potassium transporting ATPase subunit A Transport and binding proteins XAC2797 bapA N S NS NS NS NS 1.07 ABC transporter ATP binding protein Transport and binding proteins XAC0758 kdpC NS NS NS NS NS 1.03 potassium transporting ATPase subunit C Transport and binding proteins XAC3196 ssuB NS NS NS NS NS 1.27 ABC transporter ATP binding s ubunit Transport and binding proteins XAC0848 ssuC NS NS NS NS NS 1.29 ABC transporter permease Transport and binding proteins XAC3197 ssuC NS NS NS NS NS 1.35 ABC transporter permease Transport and binding proteins XAC0847 ssuB NS NS NS NS NS 1.43 ABC transporter ATP binding protein Transport and binding proteins XAC0828 nrtCD NS NS NS NS NS 1.48 ABC transporter ATP binding component Transport and binding proteins XAC0827 nrtB NS NS NS NS NS 1.49 permease Transport and binding proteins XAC3201 fyuA N S NS NS NS NS 1.74 TonB dependent receptor Transport and binding proteins XAC2853 2.98 2.99 3.80 3.40 4.20 4.02 cysteine protease Unclassified XAC3868 yliI 2.51 2.47 2.31 1.86 2.21 2.05 dehydrogenase Unclassified

PAGE 173

173 Table 4 3. Continued Locu s tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC3726 2.40 NS NS 2.20 1.56 1.03 hypothetical protein Unclassified XAC3014 rebB 1.59 1.62 1.27 NS 1.47 NS RebB protein Unclassified XAC0066 1.56 1.76 1.33 1.27 1.46 1.18 microcystin dependent protein Unclassified XAC0067 mdpB 1.46 1.66 1.27 1.45 1.47 1.13 microcystin dependent protein Unclassified XAC0065 1.39 1.60 1.33 NS NS NS microcystin dependent protein Unclassified XAC0346 1.31 2.00 1.88 1.84 2.42 2.07 degenerated cellulase Unclassified XAC3016 rebA 1.29 1.36 1.19 NS 1.30 NS RebA protein Unclassified XAC0435 virK 1.28 NS 1.61 1.77 2.14 2.03 VirK protein Unclassified XAC1177 1.25 NS NS 1.69 1. 79 1.83 hypothetical protein Unclassified XAC3015 rebB 1.24 1.31 1.27 NS 1.22 NS RebB protein Unclassified XAC1906 cheW 1.21 1.13 1.40 NS NS NS chemotaxis protein Unclassified XAC2832 1.21 1.44 1.19 NS NS NS hypothetical protein Unclassifie d XAC3019 1.20 1.10 NS NS NS NS hypothetical protein Unclassified XAC0444 1.18 NS NS NS NS NS hypothetical protein Unclassified XAC0330 cmfA 1.15 1.22 NS NS NS NS conditioned medium factor Unclassified XAC3017 rebB 1.08 1.21 1.11 NS 1.08 N S RebB protein Unclassified XAC1879 rpfF NS 5.66 NS NS 5.56 NS enoyl CoA hydratase Unclassified XAC4326 uahA NS 2.52 NS NS 2.94 NS urea amidolyase Unclassified XAC1234 NS NS 1.48 NS NS NS hypothetical protein Unclassified XAC1236 NS NS 1.46 N S NS NS hypothetical protein Unclassified XAC2536 NS NS 1.20 NS 1.03 NS hypothetical protein Unclassified XAC4199 NS NS 1.13 1.47 1.46 NS polyvinylalcohol dehydrogenase Unclassified XAC0396 hpaB NS NS 1.13 NS NS NS HpaB protein Unclassified X AC0409 hrcJ NS NS 1.08 NS NS 1.28 HrcJ protein Unclassified XAC3073 NS NS 1.04 NS NS NS hypothetical protein Unclassified

PAGE 174

174 Table 4 3. Continued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC3175 mphE NS NS 1.93 NS NS NS 4 hydroxy 2 oxovalerate aldolase Unclassified XAC0590 NS NS 1.93 NS NS NS inner membrane protein Unclassified XAC2942 NS NS 3.47 NS NS NS putative hydroxylase Unclassified XAC3177 NS NS 4.36 NS NS NS hypothetical protein Unclassified XAC2788 NS NS NS NS 1.08 NS hypothetical protein Unclassified XAC1266 hrpXct NS NS NS NS 1.06 NS HrpX protein Unclassified XAC3170 bioI NS NS NS NS 1.05 NS cytochrome P 450 hydroxylase Unclassified XAC4333 NS NS NS NS 1.02 NS hypothetical protein Unclassified XAC0682 NS NS NS NS NS 1.81 hypothetical protein Unclassified XAC0158 NS NS NS NS NS 1.77 L fucose dehydrogenase Unclassified XAC4008 ecnA NS NS NS NS NS 1.68 entericidin A Unclassified XAC0100 NS NS NS NS NS 1.56 hypothetical protein Unclassified XAC3367 NS NS NS NS NS 1.47 hypothetical protein Unclassified XAC0132 NS NS NS NS NS 1.31 hypothetical protein Unclassified XAC2049 NS NS NS NS NS 1.31 hypothetical protein Unclassified XAC0031 yahK N S NS NS NS NS 1.20 alcohol dehydrogenase Unclassified XAC0757 kdpB NS NS NS NS NS 1.11 potassium transporting ATPase subunit B Unclassified XAC3514 NS NS NS NS NS 1.11 serine protease Unclassified XAC3956 blc NS NS NS NS NS 1.10 outer membrane lip oprotein Blc Unclassified XAC3491 nonF NS NS NS NS NS 1.09 NonF related protein Unclassified XAC1175 NS NS NS NS NS 1.04 hypothetical protein Unclassified XAC4296 NS NS NS NS NS 1.02 epimerase Unclassified XAC3198 ssuA NS NS NS NS NS 1.12 alkane sulfonate transporter substrate binding subunit Unclassified XAC0849 ssuA NS NS NS NS NS 1.41 sulfonate binding protein Unclassified

PAGE 175

175 Table 4 3. Continued Locus tag Gene Symbol rpf C/W Ex a rpf F/W Ex a rpf G/W Ex a rpf C/W St a rpf F/W St a rpf G/W St a Description JCVI b XAC3200 NS NS NS NS NS 1.56 nitrilotriacetate monooxygenase component A Unclassified XAC0850 ssuD NS NS NS NS NS 1.57 alkanesulfonate monooxygenase Unclassified XAC3314 1.84 1.75 1.32 NS NS NS hypothetical protein Unknown function XAC1934 fleN 1.70 NS 1.78 NS NS NS flagellar biosynthesis switch protein Unknown function XAC0350 1.01 NS 1.30 NS NS NS hypothetical protein Unknown function XAC1218 yjdB NS NS 1.69 NS NS NS inner membrane protein Unknown function XAC1795 NS NS 1.25 NS NS NS hypothetical protein Unknown function XAC0424 NS NS 1.17 NS NS NS hypothetical protein Unknown function XAC2398 NS NS NS NS 1.32 NS hypothetical protein Unknown function XAC2483 NS NS NS NS 1.42 NS hypothetical protein Unknown function XAC4169 mltA NS NS NS NS NS 2.60 transglycosylase associated protein Unknown function XAC1150 NS NS NS NS NS 1.35 peroxiredoxin Unknown function XAC2035 cpo NS NS NS NS NS 1.29 non heme chloroperoxidase Unknown function XAC0422 NS NS NS NS NS 1. 28 ABC transporter substrate binding protein Unknown function XAC2446 NS NS NS NS NS 1.23 hypothetical protein Unknown function XAC2165 NS NS NS NS NS 1.13 hydrolase Unknown function XAC0644 NS NS NS NS NS 1.03 response regulator Unknown functi on a Log 2 fold chan ge was derived from mutant versus wild type. Ex, exponential phase; St, stationary phase. NS = not significantly differentially expressed (|log 2 fold change| < 1 or false discovery rate > 0.01). b J. Craig Venter Institute (JCVI) funct ional categories

PAGE 176

176 Table 4 4. Microarray validation by QRT PCR Locus tag qRT PCR log 2 fold change Microarray log 2 fold change XAC0403 0.95 0.79 XAC0407 1.25 0.94 XAC0415 1.74 1.12 XAC0416 1.94 1.62 XAC0798 1.47 0.88 XAC1265 1.26 0.83 X AC1854 1.37 1.16 XAC1904 2.58 1.90 XAC1954 1.83 1.74 XAC1989 2.26 1.63 XAC2865 3.15 1.87 XAC3176 2.74 2.40 XAC3385 0.75 1.06 a values represent transcript levels in rpfG mutant relative to those in wild type strain at exponential phase Av erages from three biological replicates are presented.

PAGE 177

177 Table 4 5. Genes overlapped in QS and HrpG regulons. Locus tag HrpG Ex a HrpG early St a QS Ex a QS St a HrpX regulon b Gene symbol D escription Transporter and binding protein XAC3444 + NS Y btuB To nB dependent receptor XAC3856 NS + + + N hypothetical protein XAC0827 NS NS Y nrtB permease XAC0829 + NS NS Y ABC transporter substrate binding protein T3SS and effectors XAC0416 + + + Y hpa1 Hpa1 protein XAC0410 + NS + Y hrpB4 HrpB4 protein XAC0408 + + + Y hrpB2 HrpB2 protein XAC0396 NS + + NS Y hpaB HpaB protein XAC0415 NS + + NS Y hrcC HrcC protein XAC0411 NS + NS + Y hrpB5 type III secretion system protein HrpB XAC0409 + + + Y hrcJ HrcJ protein XAC0407 + NS + Y hrpB1 Hr pB1 protein XAC0543 + + + Y hypothetical protein XAC2786 + + + Y hypothetical protein XAC1208 NS + NS + Y hypothetical protein XAC4333 + NS + Y hypothetical protein XAC3085 NS + NS + Y hypothetical protein XAC2922 + NS + Y hrpW HrpW protein XAC0286 + NS + Y avrXacE1 avirulence protein XACb0011 + NS + Y avrXacE3 avirulence protein XAC0076 NS + NS + Y avrBs2 avirulence protein

PAGE 178

178 Table 4 5. Continued Locus tag HrpG Ex a HrpG early St a QS Ex a QS St a HrpX regulon b Gene symbol D escr iption Chemotaxis and flagellar biosynthesis XAC1945 + NS NS N fliO flagellar protein XAC1908 + NS NS N motB flagellar motor protein MotD XAC2865 NS + NS N cheA chemotaxis histidine protein kinase XAC1951 NS + + N fliI flagellar protein XAC19 04 NS + NS N cheY chemotaxis response regulator XAC1954 NS + NS N fliF flagellar MS ring protein XAC1953 NS + + N fliG flagellar protein XAC1982 NS + NS N flgF flagellar basal body rod protein FlgF XAC1950 NS + + N fliJ flagellar FliJ protein XAC1989 NS + NS N flgM flagellar protein XAC1906 NS + NS N cheW chemotaxis protein T2SS substrates XAC0661 + + + Y peh 1 endopolygalacturonase XAC4252 NS + NS + Y xynB xylanase XAC2831 NS + + NS Y extracellular serine protease XAC2853 + + + Y cysteine protease XAC0817 + + + Y hypothetical protein XAC4327 NS + + + Y uahA allophanate hydrolase XAC2370 + NS + Y hypothetical protein XAC0435 + + + Y virK VirK protein Regulators XAC1171 + NS + Y stkXac1 serine /threonine kinase XAC1320 NS + + NS N regulatory protein XAC1266 + + NS + NA HrpX protein

PAGE 179

179 Table 4 5. Continued Locus tag HrpG Ex a HrpG early St a QS Ex a QS St a HrpX regulon b Gene symbol D escription Metabolism and others XAC0802 NS + NS + Y sulfotra nsferase XAC2947 NS NS Y apbE thiamine biosynthesis lipoprotein ApbE precursor XAC3114 NS + + NS N pqqG pyrroloquinoline quinone biosynthesis protein PqqB XAC1633 + NS NS + N gcd glucose dehydrogenase XAC3170 NS + NS + Y bioI cytochrome P 450 hydro xylase XAC4326 NS + + Y uahA urea amidolyase Hypothetical protein XAC2944 NS NS N hypothetical protein XAC3763 NS + NS N hypothetical protein XAC3523 + NS N hypothetical protein XAC2787 NS + + + Y hypothetical protein XAC0607 N S + NS N hypothetical protein XAC4026 NS + NS N hypothetical protein XAC1971 NS + NS N hypothetical protein XAC1990 NS + NS N hypothetical protein XAC1972 NS + NS N hypothetical protein XAC2654 + NS + Y xacPNP hypothetical protei n XAC3073 NS NS N hypothetical protein XAC2483 + NS NS N hypothetical protein XAC3314 NS + NS N hypothetical protein a Differential expression of genes controlled by HrpG or QS. Ex, exponential phase; Early St, early stationary stationar y phase; St, stationary phase. NS = not significantly differentially expressed (|log 2 fold change| < 1 or false discovery rate > 0.01). +, up regulation; down regulation b If the gene is in HrpX regulon. Y, yes; N n o; NA, not applicable.

PAGE 180

180 Figure 4 1. Growth curves of the QS mutants and wild type stain in XVM2. The assay was repeated three times independently in triplicate.

PAGE 181

181 Figure 4 2 Schematic diagram of rpfF rpfC and rpfG in the genome of XCC strain 306. The arrows represent the locations a nd orientations of the genes in the genome. The construction of rpf F rpfC and rpfG deletion mutants is described in Materials and Methods.

PAGE 182

182 Fig ure 4 3. Phenotyp e difference between QS mutants and wild type strain after cultures were centrifuged down at 4,000 g for 1 h. A ) Bacteria were grown in XVM2 for 25 h before centrifuge; B ) Bacteria were grown in NB for 25 h before centrifuge.

PAGE 183

183 Figure 4 4. M utants of rpfF, rpfC and rpfG reuced the production of extracellular proteases. A ) P rotease assay on skim milk plate for 6 DPI; B ) Quantitative results of prote ase production by strain using h alo diameter (outer layer of halo zone colony diameter ) as indicator. The assay was repeated three times independently in quadruplicate.

PAGE 184

184 Figure 4 5. Mutants o f rpfF rpfC and rpfG reduced motility compared to wild type strain. A ) Motility assay on XVM2 plate with 0.7% agar photographed at 6 DPI; B ) Motility assay on NB plate with 0.7% agar photographed at 6 DPI; C ) Quantification of motility result on XVM2 plat e with 0.7% agar at 6 DPI ; D ) Quantification of motility result on NB plate with 0.7% agar at 6 DPI; The assay was repeated three times independently in quadruplicate.

PAGE 185

185 Fig ure 4 6. The virulence of XCC in planta is impaired by the mutations of rpfF rp fC and rpfG A ) Duncan grapefruit leaves at 6 DPI with starting concentration of 10 8 CFU/ mL ; B ) Duncan grapefruit leaves at 18 DPI with starting concentration of 10 5 CFU/ mL ; C ) Duncan grapefruit leaves at 18 DPI with starting concentration of 10 4 CFU/ mL ; D ) Quantification of canker lesions in Duncan grapefruit leaves at 18 DPI with starting concentration of 10 4 CFU/ mL Error bars represent standard deviation. *, statistically significant difference ( ( P < 0.001, tested by one way ANOVA ) between mutants a nd wild type strain. Three independent assays were performed with ten leaves each time. E) spray inoculation of XCC strains on abaxial side of Duncan grapefruit leaves. Inoculated leaves were photographed at 20 DPI The 10 mM MgCl 2 solution was used as moc ked control.

PAGE 186

186 Figure 4 7. Genes in QS regulon distribute into various JCVI functional categories.

PAGE 187

187 Figure 4 8. Mutants of rpfF rpfC and rpfG reduced the attachment of XCC on abiotic and biotic surface A ) The attachment to abiotic surface of strains grown in NB or XVM2 media. A representative image of CV stain is shown. B ) Quantification of bacterial attachment to abiotic surface. Columns represent the mean of CV stain measured spectrophotometrically (A590 nm) and error bars are standard deviations. The means were calculated using 10 tubes for each strain. The assay was performed three times independently and the representative results from one experiment were shown. C ) The attachment to abaxial surface of Duncan grapefruit leaves of strains grown in NB or XVM2 media. The assay was performed three times with six leaves each time and similar results were obtained. Phosphate buffer (pH 7.2) was used as negative control in all assays.

PAGE 188

188 Figure 4 9. Microscopic analysis of bacterial attachment on abaxial surface of Duncan grapefruit leaves. GFP labeled stains grown in XVM2 were used in confocal laser scanning microscopy analysis (A, B and C). A ) The bacterial attachment to leaves at 1 h incubation. B ) The bacterial attachment to leaves at 6 h incubation. C ) A zoomed in image of GFP labeled wild type strain attached to leave at 6 h incubation. D ) Scanning electron microscopy analysis of bacterial attachment on leaf surface at 6 h incubation. Three independent experiments were performed for each strain with s imilar results. Scale bars in all images represent 20 m.

PAGE 189

189 Figure 4 10. QRT PCR results of the expression of gumB and gumD genes of QS mutants relative to wild type strain in NB and XVM2 medium. A ) Fold changes of gumB genes in QS mutant compared to wil d type in NB and XVM2. B ) Fold changes of gumD genes in QS mutant compared to wild type in NB and XVM2.

PAGE 190

190 CHAPTER 5 SUMMARY AND CONCLUSIONS The goals of this study are to identify potential virulence traits of XCC and to characterize the unde rlying regula tory mechanisms coordinating gene expression in XCC during infection. XCC is the causal agent of citrus canker which is one of the most serious diseases of citrus A large set of genes involved in virulence has been identified in XCC either by molecular or by in silico studies, including genes encoding EPS, LPS, CPS, type IV pili, adhesions, flagellum, and type I to VI secretion systems. However, the knowledge regarding the underlying regulatory mechanisms of XCC infection is still fragmentary. A better und erstanding of virulence and the underlying regulatory mechanism of XCC would assist the development of effective control measures against the citrus canker In order to identify potential virulence traits at large scale, we constructed an EZ Tn5 transposon mutant library of XCC. The two galU mutants were first identified from this library for their nonpathogenic phenotype in planta. This present study indicated that t he galU gene i s required for biosynthesis of EPS, CPS, an d biofilm formation. Further study showed that the l oss of pathogenicity of the galU mutant results from its inability to grow in planta rather than from its effect on virulence genes. Co inoculation of a galU mutant with wild type strain did not promote the growth of the galU mutant in pl anta. These data indicate that the galU gene contributes to XCC growth in the intercellular spaces and is involved in EPS and CPS synthesis and biofilm formation. P rokaryotic GalUs are completely unrelated to their eukaryotic counterparts and have totally different structures suggesting that GalU is a potential target of a ntimicrobial compounds to control citrus canker disease.

PAGE 191

191 To understand the underlying regulatory mechanisms coordinating virulence traits of XCC, we designed and conducted genome wide mic roarray analyses to characterize the genes under control of HrpG and HrpX, which are regulators for the induction of T3SS in X anthomonas spp Our analyses revealed that 232 genes and 181 genes belong to the HrpG and HrpX regulons, respectively sugg esting that both regulators act as global regulators in XCC, directly and indirectly con trolling multiple cellular activities responding to the host environment, such as amino acid biosynthesis, oxidative phosphorylation, pentose phosphate pathway, transport of s ugar, iron and potassium, and the phenolic catabolism. Our results suggest that HrpG and HrpX interplay with global signaling network and co ordinate the expression of multiple virulence factors for modification and adaption of host environment during XCC infection. To study the regulatory mechanism of QS on virulence and physiology of XCC, the mutants of the core genes of QS including rpfF rpfC and rpfG genes were constructed. P athogenicity assays showed that QS is required for the full virulence of XCC i n planta. Mutations in rpfF rpfC and rpfG decreased the production of extracellular proteases and bacterial motility. Comparison of the transcriptomes of QS mutants with that of wild type stain revealed that QS temporally regulates the expression of a lar ge set of genes, including genes involved in chemotaxis and flagellar biosynthesis, genes related to energy metabolism, genes encoding T2SS substrates, T5SS adhesins, type IV pili, T3SS and T3SS effectors. The temporal regulation of QS regulon suggests the important role of QS in different stages of citrus canker infection, including attachment, invasion and growth in host apoplast.

PAGE 192

192 A cross talk between HrpG and DSF mediated QS in XCC was observed in our study Both regulatory systems control the expression of genes encoding T2SS substrates, T3SS structure, T3SS effector proteins, transporters, transcription regulator genes related to energy metabolism, and genes involved in chemotaxis and flagellar biosynthesis. Due to the similar positive effect of HrpG a nd QS on the expression of genes encoding T2SS substrate s, T3SS structure and effectors, it is speculated that QS assists HrpG to magnify the expression of the critical virulence traits Moreover, their opposite effect on the expression of genes involved i n chemotaxis and flagellar biosynthesis suggests that XCC minimizes PAMP induced host defense by repressing flagellar biosynthesis and suppresses host defense by inducing T3SS effectors at the same time. We also proposed the possible intermediate junctions shared by two systems: shared regulatory genes such as hrpX and cyclic di GMP level which controlled by RpfG and the proteins containing GGDEF and/or EAL domains. All together, our study demonstrated that the complexity of signaling pathways underlying the regulation of XCC virulence and the interplay between the regulatory cascades. Further study of the identified potential virulence genes and the regulatory genes from the studies of HrpG regulon and QS regulon will give researcher greater insight into the virulence and underlying regulatory mechanisms of XCC, and will assist the development of effective control measures of citrus canker.

PAGE 193

193 LIST OF REFERENCES Abramoff, M.D., Magelhaes, P.J., and Ram, S.J 2004. Image p rocessing with I ma geJ. Biophotonics Int. 11:36 42. Al Saadi, A., Reddy, J.D., Duan, Y.P., Brunings, A.M., Yuan, Q., and Gabriel, D.W. 2007. All five host range variants of Xanthomonas citri carry one pthA homolog with 17.5 repeats that determines pathogenicity on citrus, b ut none determine host range variation. Mol. Plant Microbe Interact 20:934 943. Alexeyev, M.F. 1995. Three kanamycin resistance gene cassettes with different polylinkers. Biotechniques 18:52, 54, 56. Alfano, J.R., and Collmer, A. 1996. Bacterial pathogens in plants: life up against the wall. Plant Cell 8:1683 1698. Alfano, J.R., and Collmer, A. 1997. The type III (Hrp) secretion pathway of plant pathogenic bacteria: trafficking harpins, Avr proteins, and death. J Bacteriol 179:5655 5662. Andrade, M.O., A legria, M.C., Guzzo, C.R., Docena, C., Rosa, M.C., Ramos, C.H., and Farah, C.S. 2006. The HD GYP domain of RpfG mediates a direct linkage between the Rpf quorum sensing pathway and a subset of diguanylate cyclase proteins in the phytopathogen Xanthomonas a xonopodis pv citri Mol Microbiol 62:537 551. Astua Monge, G., Freitas Astua, J., Bacocina, G., Roncoletta, J., Carvalh o, S.A., and Machado, M.A. 2005 Expression profiling of virulence and pathogenicity genes of Xanthomonas axonopodis pv. citri J Bact eriol 187:1201 1205. Backert, S., and Meyer, T.F. 2006. Type IV secretion systems and their effectors in bacterial pathogenesis. Curr Opin Microbiol 9:207 217. Barber, C.E., Tang, J.L., Feng, J.X., Pan, M.Q., Wilson, T.J., Slater, H., Dow, J.M., Willia ms, P., and Daniels, M.J. 1997. A novel regulatory system required for pathogenicity of Xanthomonas campestris is mediated by a small diffusible signal molecule. Mol Microbiol 24:555 566. Barembruch, C., and Hengge, R. 2007. Cellular levels and activity of the flagellar sigma factor FliA of Escherichia coli are controlled by FlgM modulated proteolysis. Mol Microbiol 65:76 89. Benjamini, Y., and Hoch berg, Y. 1995. Controlling the false discovery rate: a practical and powerful a p proach to m ultiple testing J. Royal Stat. Soc. B 57:289 300.

PAGE 194

194 Blanvillain, S., Meyer, D., Boulanger, A., Lautier, M., Guynet, C., Denanc N., Vasse, J., Lauber, E., and Arlat, M. 2007. Plant carbohydrate scavenging through TonB dependent receptors: a feature shared by phytopathoge nic and aquatic bacteria. PLoS One 2:e224. Boels, I., Ramos, A., Kleerebezem, M., and de Vos, W. 2001. Functional analysis of the Lactococcus lactis galU and galE genes and their impact on sugar nucleotide and exopolysaccharide biosynthesis. Appl. Environ. Microbiol. 67:3033 3040. Boon, C., Deng, Y., Wang, L.H., He, Y., Xu, J.L., Fan, Y., Pan, S.Q., and Zhang, L.H. 2008. A novel DSF like signal from Burkholderia cenocepacia interferes with Candida albicans morphological transition. ISME J 2:27 36. Boyer, H ., and Roulland Dussoix, D. 1969. A complementation analysis of the restriction and modification of DNA in Escherichia coli J Mol Biol 41:459 472. Brunings, A.M., and Gabriel, D.W. 2003. Xanthomonas citri : breaking the surface. Mol Plant P athol. 4:141 157. Buell, C., Joardar, V., Lindeberg, M., Selengut, J., Paulsen, I., Gwinn, M., Dodson, R., Deboy, R., Durkin, A., Kolonay, J., Madupu, R., Daugherty, S., Brinkac, L., Beanan, M., Haft, D., Nelson, W., Davidsen, T., Zafar, N., Zhou, L., Liu, J., Yuan, Q ., Khouri, H., Fedorova, N., Tran, B., Russell, D., Berry, K., Utterback, T., Van Aken, S., Feldblyum, T., D'Ascenzo, M., Deng, W., Ramos, A., Alfano, J., Cartinhour, S., Chatterjee, A., Delaney, T., Lazarowitz, S., Martin, G., Schneider, D., Tang, X., Ben der, C., White, O., F raser, C., and Collmer, A. 2003 The complete genome sequence of the Arabidopsis and tomato pathogen Pseudomonas syringae pv. tomato DC3000. Proc Natl Acad Sci USA 100:10181 10186. Bugert, P., and Geider, K. 1995. Molecular analysi s of the ams operon required for exopolysaccharide synthesis of Erwinia amylovora Mol Microbiol 15:917 933. Buttner, D., and Bonas, U. 2002. Getting across -bacterial type III effector proteins on their way to the plant cell. EMBO (Eur. Mol. Biol. Organ .) J 21:5313 5322. Buttner, D., and Bonas, U. 2010. Regulation and secretion of Xanthomonas virulence factors. FEMS (Fed. Eur. Microbiol. Soc.) Microbiol Rev 34:107 133. Calhoun, D.H., Bonner, C.A., Gu, W., Xie, G., and Jensen, R.A. 2001. The emerging p eriplasm localized subclass of AroQ chorismate mutases, exemplified by those from Salmonella typhimurium and Pseudomonas aeruginosa Genome Biol 2: research 0030. Cascales, E. 2008. The type VI secretion toolkit. EMBO (Eur. Mol. Biol. Organ.) Rep 9:735 74 1.

PAGE 195

195 Chan, J.W., and Goodwin, P.H. 1999. The molecular genetics of virulence of Xanthomonas campestris Biotechnol Adv 17:489 508. Chang, H.Y., Lee, J.H., Deng, W.L., Fu, T.F., and Peng, H.L. 1996. Virulence and outer membrane properties of a galU mutant o f Klebsiella pneumoniae CG43. Microb Pathog 20:255 261. Chatterjee, S., and Sonti, R.V. 2002. rpfF mutants of Xanthomonas oryzae pv. oryzae are deficient for virulence and growth under low iron conditions. Mol Plant Microbe Interact 15:463 471. Chou, F .L., Chou, H.C., Lin, Y.S., Yang, B.Y., Lin, N.T., Weng, S.F., and Tseng, Y.H. 1997. The Xanthomonas campestris gumD gene required for synthesis of xanthan gum is involved in normal pigmentation and virulence in causing black rot. Biochem Biophys Res Co mmun 233:265 269. Christie, P.J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., and Cascales, E. 2005. Biogenesis, architecture, and function of bacterial type IV secretion systems. Annu Rev Microbiol 59:451 485. Cianciotto, N.P. 2005 Type II secr etion: a protein secretion system for all seasons. Trends Microbiol 13:581 588. Ciesiolka, L.D., Hwin, T., Gearlds, J.D., Minsavage, G.V., Saenz, R., Bravo, M., Handley, V., Conover, S.M., Zhang, H., Caporgno, J., Phengrasamy, N.B., Toms, A.O., Stall, R.E ., and Whalen, M.C. 1999. Regulation of expression of avirulence gene avrRxv and identification of a family of host interaction factors by sequence analysis of avrBsT Mol Plant Microbe Interact. 12:35 44. Clowes, R.C., and Hayes, W. 1968. Experiments in microbial genetics. Blackwell Scientific Publications, Oxford. Cubero, J., and Graham, J.H. 2002. Genetic relationship among worldwide strains of Xanthomonas causing canker in citrus species and design of new primers for their identification by PCR. Appl Environ Microbiol 68:1257 1264. Cunnac, S., Boucher, C., and Genin, S. 2004. Characterization of the cis acting regulatory element controlling HrpB mediated activation of the type III secretion system and effector genes in Ralstonia solanacearum. J Bact eriol 186:2309 2318. d'Enfert, C., Ryter, A., and Pugsley, A.P. 1987. Cloning and expression in Escherichia coli of the Klebsiella pneumoniae genes for production, surface localization and secretion of the lipoprotein pullulanase. EMBO (Eur. Mol. Biol. Or gan.) J 6:3531 3538.

PAGE 196

196 da Silva, A.C., Ferro, J.A., Reinach, F.C., Farah, C.S., Furlan, L.R., Quaggio, R.B., Monteiro Vitorello, C.B., Van Sluys, M.A., Almeida, N.F., Alves, L.M., do Amaral, A.M., Bertolini, M.C., Camargo, L.E., Camarotte, G., Cannavan, F., Cardozo, J., Chambergo, F., Ciapina, L.P., Cicarelli, R.M., Coutinho, L.L., Cursino Santos, J.R., El Dorry, H., Faria, J.B., Ferreira, A.J., Ferreira, R.C., Ferro, M.I., Formighieri, E.F., Franco, M.C., Greggio, C.C., Gruber, A., Katsuyama, A.M., Kishi, L .T., Leite, R.P., Lemos, E.G., Lemos, M.V., Locali, E.C., Machado, M.A., Madeira, A.M., Martinez Rossi, N.M., Martins, E.C., Meidanis, J., Menck, C.F., Miyaki, C.Y., Moon, D.H., Moreira, L.M., Novo, M.T., Okura, V.K., Oliveira, M.C., Oliveira, V.R., Pereir a, H.A., Rossi, A., Sena, J.A., Silva, C., de Souza, R.F., Spinola, L.A., Takita, M.A., Tamura, R.E., Teixeira, E.C., Tezza, R.I., Trindade dos Santos, M., Truffi, D., Tsai, S.M., White, F.F., Setubal, J.C., and Kitajima, J.P. 2002. Comparison of the genom es of two Xanthomonas pathogens with differing host specificities. Nature 417:459 463. da Silva, F.G., Shen, Y., Dardick, C., Burdman, S., Yadav, R.C., de Leon, A.L., and Ronald, P.C. 2004. Bacterial genes involved in type I secretion and sulfation are req uired to elicit the rice Xa21 mediated innate immune response. Mol Plant Microbe Interact 17:593 601. Daniels, M., Barber, C., Turner, P., Sawczyc, M., Byrde, R., and Fielding, A. 1984. Cloning of genes involved in pathogenicity of Xanthomonas campestris pv. campestris using the broad host range cosmid pLAFR1. EMBO (Eur. Mol. Biol. Organ.) J 3:3323 3328. Das, A., Rangaraj, N., and Sonti, R.V. 2009. Multiple adhesin like functions of Xanthomonas oryzae pv. oryzae are involved in promoting leaf attachment, entry, and virulence on rice. Mol Plant Microbe Interact 22:73 85. de Hoon, M.J., Imoto, S., Nolan, J., and Miyano, S. 2004. Open source clustering software. Bioinformatics 20:1453 1454. DeFeyter, R., Kado, C.I., and Gabriel, D.W. 1990. Small, stable sh uttle vectors for use in Xanthomonas Gene 88:65 72. Degrassi, G., Devescovi, G., Bigirimana, J., and Venturi, V 2010 Xanthomonas oryzae pv. oryzae XKK.12 contains an AroQgamma chorismate mutase that is involved in rice virulence. Phytopathology 100:262 270. Dekkers, L.C., Bloemendaal, C.J., de Weger, L.A., Wijffelman, C.A., Spaink, H.P., and Lugtenberg, B.J. 1998. A two component system plays an important role in the root colonizing ability of Pseudomonas fluorescens strain WCS365. Mol Plant Microbe Int eract 11:45 56. Dharmadi, Y., and Gonzalez, R. 2004. DNA microarrays: experimental issues, data analysis, and application to bacterial systems. Biotechnol Prog 20:1309 1324.

PAGE 197

197 Ditta, G., Stanfield, S., Co rbin, D., and Helinski, D. 1980 Broad host range D NA cloning system for gram negative bacteria: construction of a gene bank of Rhizobium meliloti Proc Natl Acad Sci US A 77:7347 7351. Dow, J., Fouhy, Y., Lucey, J., and Ryan, R. 2006. The HD GYP domain, cyclic di GMP signaling, and bacterial virulence to plants. Mol Plant Microbe Interact 19:1378 1384. Dow, J.M., Feng, J.X., Barber, C.E., Tang, J.L., and Daniels, M.J. 2000. Novel genes involved in the regulation of pathogenicity factor production within the rpf gene cluster of Xanthomonas campestris. Microbiology 146 ( Pt 4):885 891. Dunger, G., Relling, V., Tondo, M., Barreras, M., Ielpi, L., Orellano, E., and Ottado, J. 2007. Xanthan is not essential for pathogenicity in citrus canker but contributes to Xanthomonas epiphytic survival. Arch Microbiol 188:127 135. El Yacoubi, B., Brunings, A., Yuan, Q., Shankar, S., and Gabriel, D. 2007. In planta horizontal transfer of a major pathogenicity effector gene. Appl Environ Microbiol 73:1612 1621. Ellermeier, C.D., and Slauch, J.M. 2003. RtsA and RtsB c oordinately regulate expression of the invasion and flagellar genes in Salmonella enterica serovar Typhimurium. J Bacteriol 185:5096 5108. Feil, H., Feil, W.S., and Lindow S.E. 2007. Contribution of f im brial and afimbrial a dhesins of Xylella fastidiosa to attachment to surfaces and virulence to g rape. Phytopathology 97:318 324. Feng, J., Liu, G., Selvaraj, G., Hughes, G.R., and Wei, Y. 2005. A secreted lipase encoded by LIP1 is necessary for efficient use of saturated triglyceride lipids in Fusarium gram inearum Microbiology 151:3911 3921. Figueiredo, J.F.L., Minsavage, G.V., Graham, J.H., White, F.F., and Jones, J.B. 2011. Mutational analysis of type III effector genes from Xanthomonas citri subsp. citri Eur J Plant Pathol. doi : 10.1007/s10658 011 975 7 7. Frey, P.A. 1996. The Leloir pathway: a mechanistic imperative for three enzymes to change the stereochemical configuration of a single carbon in galactose. FASEB (Fed. Am. Soc. Exp. Biol.) J 10:461 470. Furutani, A., Takaoka, M., Sanada, H., Noguchi, Y., Oku, T., Tsuno, K., Ochiai, H., and Tsuge, S. 2009. Identification of novel type III secretion effectors in Xanthomonas oryzae pv. oryzae Mol Plant Microbe Interact 22:96 106. Furutani, A., Tsuge, S., Ohnishi, K., Hikichi, Y., Oku, T., Tsuno, K., I noue, Y., Ochiai, H., Kaku, H., and Kubo, Y. 2004. Evidence for HrpXo dependent expression of type II secretory proteins in Xanthomonas oryzae pv. oryzae J Bacteriol 186:1374 1380.

PAGE 198

198 Genevaux, P., Bauda, P., DuBow, M., and Oudega, B. 1999. Identification of Tn10 insertions in the rfaG rfaP and galU genes involved in lipopolysaccharide core biosynthesis that affect Escherichia coli adhesion. Arch Microbiol 172:1 8. Gentleman, R.C., Carey, V.J., Bates, D.M., Bolstad, B., Dettling, M., Dudoit, S., Ellis, B., Gautier, L., Ge, Y., Gentry, J., Hornik, K., Hothorn, T., Huber, W., Iacus, S., Irizarry, R., Leisch, F., Li, C., Maechler, M., Rossini, A.J., Sawitzki, G., Smith, C., Smyth, G., Tierney, L., Yang, J.Y., and Zhang, J. 2004. Bioconductor: open software development for computational biology and bioinformatics. Genome Biol. 5:R80. Gerlach, R.G., and Hensel, M. 2007. Protein secretion systems and adhesins: the molecular armory of Gram negative pathogens. Int J Med Microbiol 297:401 415. Gottig, N., Gara vaglia, B.S., Daurelio, L.D., Valentine, A., Gehring, C., Orellano, E.G., and Ottado, J. 2009a. Modulating host homeostasis as a strategy in the plant pathogen arms race. Commun Integr Biol 2:89 90. Gottig, N., Garavaglia, B., Daurelio, L., Valentine, A., Gehring, C., Orellano, E., and Ottado, J. 2008. Xanthomonas axonopodis pv. citri uses a plant natriuretic peptide like protein to modify host homeostasis. Proc Natl Acad Sci US A 105:18631 18636. Gottig, N., Garavaglia, B.S., Garofalo, C.G., Orellan o, E.G., and Ottado, J. 2009b. A filamentous hemagglutinin like protein of Xanthomonas axonopodis pv. citri the phytopathogen responsible for citrus canker, is involved in bacterial virulence. PLoS One 4:e4358. Gottwald, T.R., and Irey, M.S. 2007. Post h urric ane analysis of citrus canker II : predictive model estimation of disease spread and area potentially impacted by various eradication protocols following catastrophic weather events. Plant Health Progress doi :10.1094/PHP 2007 0405 01 RS Gottwald, T.R., Graham, J.H., and Schubert, T.S. 2002. Citrus canker : The pathogen and its impact. Plant Health Progress doi :10.1094/PHP 2002 0812 1001 RV. Graham, J.H., Gottwald, T.R., Cubero, J., and Achor, D.S. 2004. X anthomonas axonopodis pv. citri : factors affecting successful eradica tion of citrus canker. Mol. Plant Pathol. 5:1 15. Grant, S., Fisher, E., Chang, J., Mole, B., and Dang l, J. 2006 Subterfuge and manipulation: type III effector proteins of phytopathogenic bacteria. Annu Rev Microbiol 60:425 449. Gude sblat, G.E., Torres, P.S., and Vojnov, A.A. 2009. Xanthomonas campestris overcomes Arabidopsis stomatal innate immunity through a DSF cell to cell signal regulated virulence factor. Plant Physiol 149:1017 1027.

PAGE 199

199 Guidot, A., Prior, P., Schoenfeld, J., Carr ¨re, S., Genin, S., and Boucher, C. 2007. Genomic structure and phylogeny of the plant pathogen Ralstonia solanacearum inferred from gene distribution analysis. J Bacteriol 189:377 387. Guo, Y., Figueiredo, F., Jones, J., and Wang, N. 2011. HrpG and HrpX Play Global Roles in Coordinating Different Virulence Traits of Xanthomonas axonopodis pv. citri Mol Plant Microbe Interact 24:649 661. Grlebeck, D., Thieme, F., and Bonas, U. 2006. Type III effector proteins from the plant pathogen Xanthomona s and th eir role in the interaction with the host plant. J Plant Physiol 163:233 255. Hahn, H.P. 1997. The type 4 pilus is the major virulence associated adhesin of Pseudomonas aeruginosa -a review. Gene 192:99 108. Hajri, A., Brin, C., Hunault, G., Lardeux, F., Lemaire, C., Manceau, C., Boureau, T., and Poussier, S. 2009. A "repertoire for repertoire" hypothesis: repertoires of type three effectors are candidate determinants of host specificity in Xanthomonas PLoS One 4:e6632. Hanahan, D. 1983. Studies on trans formation of Escherichia coli with plasmids. J Mol Biol 166:557 580. He, Y.W., Boon, C., Zhou, L., and Zhang, L.H. 2009. Co regulation of Xanthomonas campestris virulence by quorum sensing and a novel two component regulatory system RavS/RavR. Mol Micr obiol 71:1464 1476. He, Y., Ng, A., Xu, M., Lin, K., Wang, L ., Dong, Y., and Zhang, L. 2007 Xanthomonas campestris cell cell communication involves a putative nucleotide receptor protein Clp and a hierarchical signalling network. Mol Microbiol 64:281 2 92. He, Y., Xu, M., Lin, K., Ng, Y., Wen, C., Wang, L., Liu, Z., Zhang, H., Dong, Y., Dow, J., and Zhang, L. 2006 Genome scale analysis of diffusible signal factor regulon in Xanthomonas campestris pv. campestris : identification of novel cell cell communi cation dependent genes and functions. Mol Microbiol 59:610 622. Hefti, M.H., Franoijs, K.J., de Vries, S.C., Dixon, R., and Vervoort, J. 2004. The PAS fold. A redefinition of the PAS domain based upon structural prediction. Eur J Biochem 271:1198 120 8. Hirano, S.S., and Upper, C.D. 2000. Bacteria in the leaf ecosystem with emphasis on Pseudomonas syringae a pathogen, ice nucleus, and epiphyte. Microbiol Mol Biol Rev 64:624 653. Ho, T.D., and Waldor, M.K. 2007. Enterohemorrhagic Escherichia coli O1 57:H7 gal mutants are sensitive to bacteriophage P1 and defective in intestinal colonization. Infect Immun 75:1661 1666.

PAGE 200

200 Hossain, S., Tanizawa, K., Kazuta, Y., and Fukui, T. 1994. Overproduction and characterization of recombinant UDP glucose pyrophospho rylase from Escherichia coli K 12. J Biochem 115:965 972. Huang, D.L., Tang, D.J., Liao, Q., Li, X.Q., He, Y.Q., Feng, J.X., Jiang, B.L., Lu, G.T., and Tang, J.L. 2009. The Zur of Xanthomonas campestris is involved in hypersensitive response and positive ly regulates the expression of the hrp cluster via hrpX but not hrpG Mol Plant Microbe Interact 22:321 329. Hueck, C.J. 1998. Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol Mol Biol Rev 62:379 433. Huguet, E., Hahn, K., We ngelnik, K., and Bonas, U. 1998 hpaA mutants of Xanthomonas campestris pv. vesicatoria are affected in pathogenicity but retain the ability to induce host specific hypersensitive reaction. Mol Microbiol 29:1379 1390. Jacobs, M., Alwood, A., Thaipisuttikul, I., Spencer, D., Haugen, E., Ernst, S., Will, O., Kaul, R., Raymond, C., Levy, R., Chun Rong, L., Guenthner, D., Bovee, D., Olson, M., and Manoil, C. 2003. Comprehensive transposon mutant library of Pseudomonas aeruginosa Proc Natl Acad Sci US A 100:14339 14344. Jansson, P., Kenne, L., and Lindberg, B. 1975. Structure of extracellular polysaccharide from Xanthomonas campestris Carbohydr Res 45:275 282. Joosten, M.H.A.J., Hendrickx, L.J.M., and De Wit, P.J.G.M. 1990. Carbohydrate composition of apoplastic fluids isolated from tomato leaves inoculated with virulent or avirulent races of Cladosporium fulvum (syn. Fulvia fulva ). Neth. J. Pl. Path. 96:103 112. Josenhans, C., and Suerbaum, S. 2002. The role of motility as a virulence fa ctor in bacteria. Int J Med Microbiol 291:605 614. Kay, S., Hahn, S., Marois, E., Hause, G., and Bonas, U. 2007. A bacterial effector acts as a plant transcription factor and induces a cell size regulator. Science 318:648 651. Kearney, B., and Staskawi cz, B.J. 1990. Widespread distribution and fitness contribution of Xanthomonas campestris avirulence gene avrBs2 Nature 346:385 386. Kim, J.G., Li, X., Roden, J.A., Taylor, K.W., Aakre, C.D., Su, B., Lalonde, S., Kirik, A., Chen, Y., Baranage, G., McLane, H., Martin, G.B., and Mudgett, M.B. 2009a. Xanthomonas T3S Effector XopN Suppresses PAMP Triggered Immunity and Interacts with a Tomato Atypical Receptor Like Kinase and TFT1. Plant Cell 21:1305 1323.

PAGE 201

201 Kim, S.Y., Kim, J.G., Lee, B.M., and Cho, J.Y. 2009b. Mutational analysis of the gum gene cluster required for xanthan biosynthesis in Xanthomonas oryzae pv oryzae Biotechnol Lett 31:265 270. Koczan, J.M., McGrath, M.J., Zhao, Y., and Sundin, G.W. 2009. Contribution of Erwinia amylovora exopolysaccharides amylovoran and levan to biofilm formation: implications in pathogenicity. Phytopathology 99:1237 1244. Koebnik, R., Kruger, A., Thieme, F., Urban, A., and Bonas, U. 2006. Specific binding of the Xanthomonas campestris pv. vesicatoria AraC type transcriptio nal activator HrpX to plant inducible promoter boxes. J Bacteriol 188:7652 7660. Komeda, Y., Icho, T., and Iino, T. 1977. Effects of galU mutation on flagellar formation in Escherichia coli J Bacteriol 129:908 915. Lai, Y., Peng, H., and Chang, H. 200 1. Identification of genes induced in vivo during Klebsiella pneumoniae CG43 infection. Infect Immun 69:7140 7145. Laia, M., Moreira, L., Dezajacomo, J., Brigati, J., Ferreira, C., Ferro, M., Silva, A., Ferro, J., and Oliveira, J. 2009. New genes of Xant homonas citri subsp. citri involved in pathogenesis and adaptation revealed by a transposon based mutant library. BMC Microbiol 9:12. Lee, B.M., Park, Y.J., Park, D.S., Kang, H.W., Kim, J.G., Song, E.S., Park, I.C., Yoon, U.H., Hahn, J.H., Koo, B.S., Lee, G.B., Kim, H., Park, H.S., Yoon, K.O., Kim, J.H., Jung, C.H., Koh, N.H., Seo, J.S., and Go, S.J. 2005. The genome sequence of Xanthomonas oryzae pathovar oryzae KACC10331, the bacterial blight pathogen of rice. Nucleic Acids Res 33:577 586. Lee, I., Kim, K., Hyun, J., Lee, Y., and Park, E. 2009. Comparative ultrastructure of nonwounded Mexican lime and Yuzu leaves infected with the citrus canker bacterium Xanthomonas citri pv. citri Microsc Res Tech 72:507 516. Leyns, F., De Cleene, M., Swings, J.G., and De Ley, J. 1984. The host range of the genus Xanthomonas The B otanical R eview 50:308 356. Li, J., and Wang, N. 2011. The wxacO gene of Xanthomonas citri ssp. citri encodes a protein with a role in lipopolysaccharide biosynthesis, biofilm formation, st ress tolerance and virulence. Mol Plant Pathol 12:381 396. Liberati, N., Urbach, J., Miyata, S., Lee, D., Drenkard, E., Wu, G., Villanueva, J., Wei, T., and Ausubel, F. 2006. An ordered, nonredundant library of Pseudomonas aeruginosa strain PA14 transpos on insertion mutants. Proc Natl Acad Sci US A 103:2833 2838. Lindgren, P.B., Peet, R.C., and Panopoulos, N.J. 1986. Gene cluster of Pseudomonas syringae pv. phaseolicola controls pathogenicity of bean plants and hypersensitivity of nonhost plants. J Bacteriol 168:512 522.

PAGE 202

202 Livak, K.J., and Schmittgen, T.D. 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2 T Method. Methods 25:402 408. Lu, H., Patil, P., Van Sluys, M.A., White, F.F., Ryan, R.P., Dow, J.M., Rabinowicz, P., Salzberg, S.L., Leach, J.E., Sonti, R., Brendel, V., and Bogdanove, A.J. 2008. Acquisition and evolution of plant pathogenesis associ ated gene clusters and candidate determinants of tissue specificity in X anthomonas PLoS One 3:e3828. Malamud, F., Torres, P.S., Roeschlin, R., Rigano, L.A., Enrique, R., Bonomi, H.R., Castagnaro, A.P., Marano, M.R., and Vojnov, A.A. 2011. The Xanthomonas axonopodis pv. citri flagellum is required for mature biofilm and canker development. Microbiology 157:819 829. Manning, G., Plowman, G.D., Hunter, T., and Sudarsanam, S. 2002. Evolution of protein kinase signaling from yeast to man. Trends Biochem. Sci. 2 7:514 520. Metz, M., Dahlbeck, D., Morales, C.Q., Al Sady, B., Clark, E.T., and Staskawicz, B.J. 2005. The conserved Xanthomonas campestris pv. vesicatoria effector protein XopX is a virulence factor and suppresses host defense in Nicotiana benthamiana Pl ant J 41:801 814. Miller, M.B., and Bassler, B.L. 2001. Quorum sensing in bacteria. Annu Rev Microbiol 55:165 199. Mollerach, M., and Garca, E. 2000. The galU gene of Streptococcus pneumoniae that codes for a UDP glucose pyrophosphorylase is highly po lymorphic and suitable for molecular typing and phylogenetic studies. Gene 260:77 86. Mollerach, M., Lopez, R., and Garcia, E. 1998. Characterization of the galU gene of Streptococcus pneumoniae encoding a uridine diphosphoglucose pyrophosphorylase: a gene essential for capsular polysaccharide biosynthesis. J Exp Med 188:2047 2056. Monier, J.M., and Lindow, S.E. 2003. Differential survival of solitary and aggregated bacterial cells promotes aggregate formation on leaf surfaces. Proc Natl Acad Sci US A 100:15977 15982. Moreira, L., Almeida, N.J., Potnis, N., Digiampietri, L., Adi, S., Bortolossi, J., da Silva, A., da Silva, A., de Moraes, F., de Oliveira, J., de Souza, R., Facincani, A., Ferraz, A., Ferro, M., Furlan, L., Gimenez, D., Jones, J., Kitajim a, E., Laia, M., Leite, R.J., Nishiyama, M., Rodrigues Neto, J., Nociti, L., Norman, D., Ostroski, E., Pereira, H.J., Staskawicz, B., Tezza, R., Ferro, J., Vin atzer, B., and Setubal, J. 2010 Novel insights into the genomic basis of citrus canker based on the genome sequences of two strains of Xanthomonas fuscans subsp. aurantifolii BMC Genomics 11:238.

PAGE 203

203 Mougous, J.D., Cuff, M.E., Raunser, S., Shen, A., Zhou, M., Gifford, C.A., Goodman, A.L., Joachimiak, G., Ordoez, C.L., Lory, S., Walz, T., Joachimiak, A. and Mekalanos, J.J. 2006. A virulence locus of Pseudomonas aeruginos a encodes a protein secretion apparatus. Science 312:1526 1530. Muda, M., Rao, N.N., and Torriani, A. 1992. Role of PhoU in phosphate transport and alkaline phosphatase regulation. J Ba cteriol 174:8057 8064. Nesper, J., Kapfhammer, D., Klose, K., Merkert, H., and Reidl J. 2000. Characterization of Vibrio cholerae O1 antigen as the bacteriophage K139 receptor and identification of IS1004 insertions aborting O1 antigen biosynthesis. J B acteriol 182:5097 5104. Nesper, J., Lauriano, C., Klose, K., Kapfhammer, D., Kraiss, A., and Reidl, J. 2001. Characterization of Vibrio cholerae O1 El tor galU and galE mutants: influence on lipopolysaccharide structure, colonization, and biofilm formatio n. Infect Immun 69:435 445. Neugebauer, H., Herrmann, C., Kammer, W., Schwarz, G., Nordheim, A., and Braun, V. 2005. ExbBD dependent transport of maltodextrins through the novel MalA protein across the outer membrane of Caulobacter crescentus J Bacter iol 187:8300 8311. Newman, M.A., Dow, J.M., Molinaro, A., and Parrilli, M. 2007. Priming, induction and modulation of plant defence responses by bacterial lipopolysaccharides. J Endotoxin Res 13:69 84. Newman, K.L., Almeida, R.P., Purcell, A.H., and Lin dow, S.E. 2004. Cell cell signaling controls Xylella fastidiosa interactions with both insects and plants. Proc Natl Acad Sci US A 101:1737 1742. Ninfa, A.J., and Magasanik, B. 1986. Covalent modification of the glnG product, NRI, by the glnL product, N RII, regulates the transcription of the glnALG operon in Escherichia coli Proc Natl Acad Sci US A 83:5909 5913. Nixon, B.T., Ronson, C.W., and Ausubel, F.M. 1986. Two component regulatory systems responsive to environmental stimuli share strongly conse rved domains with the nitrogen assimilation regulatory genes ntrB and ntrC Proc Natl Acad Sci US A 83:7850 7854. Nomura, K., Melotto, M., and He, S. 2005. Suppression of host defense in compatible plant Pseudomonas syringae interactions. Curr. Opin. Pl ant Biol. 8:361 368. Nol, L., Thieme, F., Gbler, J., Bttner, D., and Bonas, U. 2003. XopC and XopJ, two novel type III effector proteins from Xanthomonas campestris pv. vesicatoria J Bacteriol 185:7092 7102.

PAGE 204

204 Nol, L., Thieme, F., Nennstiel, D., and B onas, U. 2002. Two novel type III secreted proteins of Xanthomonas campestris pv. vesicatoria are encoded within the hrp pathogenicity island. J Bacteriol 184:1340 1348. Oh, H.S., Kvitko, B.H., Morello, J.E., and Collmer, A. 2007. Pseudomonas syringae ly tic transglycosylases coregulated with the type III secretion system contribute to the translocation of effector proteins into plant cells. J Bacteriol 189:8277 8289. Osbourn, A.E. 1996. Preformed antimicrobial compounds and plant defense against fungal a ttack. Plant Cell 8:1821 1831. Osbourn, A.E., Clarke, B.R., Stevens, B.J., and Daniels, M.J. 1990. Use of oligonucleotide probes to identify members of two component regulatory systems in Xanthomonas campestris pathovar campestris Mol Gen Genet 222:14 5 151. Parke, D. 1996. Characterization of PcaQ, a LysR type transcriptional activator required for catabolism of phenolic compounds, from Agrobacterium tumefaciens J Bacteriol 178:266 272. Pieretti, I., Royer, M., Barbe, V., Carrere, S., Koebnik, R., C ociancich, S., Couloux, A., Darrasse, A., Gouzy, J., Jacques, M.A., Lauber, E., Manceau, C., Mangenot, S., Poussier, S., Segurens, B., Szurek, B., Verdier, V., Arlat, M., and Rott, P. 2009. The complete genome sequence of Xanthomonas albilineans provides n ew insights into the reductive genome evolution of the xylem limited Xanthomonadaceae BMC Genomics 10:616. Poplawsky, A.R., and Chun, W. 1997. pigB determines a diffusible factor needed for extracellular polysaccharide slime and xanthomonadin production i n Xanthomonas campestris pv. campestris. J Bacteriol 179:439 444. Postle, K., and Kadner, R.J. 2003. Touch and go: tying TonB to transport. Mol Microbiol 49:869 882. Pratt, L., and Kolter, R. 1998. Genetic analysis of Escherichia coli biofilm formation : roles of flagella, motility, chemotaxis and type I pili. Mol Microbiol 30:285 293. Priebe, G., Dean, C., Zaidi, T., Meluleni, G., Coleman, F., Coutinho, Y., Noto, M., Urban, T., Pier, G., and Goldberg, J. 2004. The galU Gene of Pseudomonas aeruginosa i s required for corneal infection and efficient systemic spread following pneumonia but not for infection confined to the lung. Infect Immun 72:4224 4232. Pukatzki, S., McAuley, S.B., and Miyata, S.T. 2009. The type VI secretion system: translocation of e ffectors and effector domains. Curr Opin Microbiol 12:11 17. Pukatzki, S., Ma, A.T., Sturtevant, D., Krastins, B., Sarracino, D., Nelson, W.C., Heidelberg, J.F., and Mekalanos, J.J. 2006. Identification of a conserved bacterial protein secretion system in Vibrio cholerae using the Dictyostelium host model system. Proc Natl Acad Sci US A 103:1528 1533.

PAGE 205

205 Qian, W., Han, Z.J., and He, C. 2008a. Two component signal transduction systems of Xanthomonas spp.: a lesson from genomics. Mol Plant Microbe Interac t 21:151 161. Qian, W., Han, Z.J., Tao, J., and He, C. 2008b. Genome scale mutagenesis and phenotypic characterization of two component signal transduction systems in Xanthomonas campestris pv. campestris ATCC 33913. Mol Plant Microbe Interact 21:1128 1 138. Reimmann, C., Beyeler, M., Latifi, A., Winteler, H., Foglino, M., Lazdunski, A., and Haas, D. 1997. The global activator GacA of Pseudomonas aeruginosa PAO positively controls the production of the autoinducer N butyryl homoserine lactone and the form ation of the virulence factors pyocyanin, cyanide, and lipase. Mol Microbiol 24:309 319. Remenant, B., Coupat Goutaland, B., Guidot, A., Cellier, G., Wicker, E., Allen, C., Fegan, M., Pruvost, O., Elbaz, M., Calteau, A., Salvignol, G., Mornico, D., Mange not, S., Barbe, V., Mdigue, C., and Prior, P. 2010. Genomes of three tomato pathogens within the Ralstonia solanacearum species complex reveal significant evolutionary divergence. BMC Genomics 11:379. Rico, A., Jones, R., and Preston, G.M. 2009. Adaptati on to the plant apoplast by plant pathogenic bacteria. Pages 63 89 in: Plant pathogenic bacteria: Geno mic and molecular biology. N. S. Iacobellis, Collmer, A., Hutcheson, S.W., Mansfield, J. W., Morris, C. E., Murillo J., Schaad, N. W., Stead, D.E., Surico G., and Ullrich, M, eds. Kluwer Academic Caister Academic Press Dordrecht, The Netherlands. Rigano, L.A., Siciliano, F., Enrique, R., Sendin, L., Filippone, P., Torres, P.S., Questa, J., Dow, J.M., Castagnaro, A.P., Vojnov, A.A., and Marano, M.R. 2007. Biofilm formation, epiphytic fitness, and canker development in Xanthomonas axonopodis pv. citri Mol Plant Microbe Interact 20:1222 1230. Rioux, S., Galarneau, C., Harel, J., Frey, J., Nicolet, J., Kobisch, M., Dubreuil, J., and Jacques, M. 1999. Isolat ion and characterization of mini Tn10 lipopolysaccharide mutants of Actinobacillus pleuropneumoniae serotype 1. Can J Microbiol 45:1017 1026. Roberts, I. 1996. The biochemistry and genetics of capsular polysaccharide production in bacteria. Annu Rev M icrobiol 50:285 315. Roden, J.A., Belt, B., Ross, J.B., Tachibana, T., Vargas, J., and Mudgett, M.B. 2004. A genetic screen to isolate type III effectors translocated into pepper cells during Xanthomonas infection. Proc. Natl. Acad. Sci. USA 101:16624 166 29. Roine, E., Wei, W., Yuan, J., Nurmiaho Lassila, E.L., Kalkkinen, N., Romantschuk, M., and He, S.Y. 1997. Hrp pilus: an hrp dependent bacterial surface appendage produced by Pseudomonas syringae pv. tomato DC3000. Proc Natl Acad Sci US A 94:3459 3464

PAGE 206

206 Rojas, C.M., Ham, J.H., Deng, W.L., Doyle, J.J., and Collmer, A. 2002. HecA, a member of a class of adhesins produced by diverse pathogenic bacteria, contributes to the attachment, aggregation, epidermal cell killing, and virulence phenotypes of Erwinia chrysanthemi EC16 on Nicotiana clevelandii seedlings. Proc Natl Acad Sci US A 99:13142 13147. Ronald, P., and Staskawicz, B. 1988. The avirulence gene avrBs1 from Xanthomonas campestris pv. vesicatoria encodes a 50 kD protein. Mol Plant Microbe Interac t 1:191 198. Ryan, R., Fouhy, Y., Lucey, J., Crossman, L., Spiro, S., He, Y., Zhang, L., Heeb, S., Cmara, M., Williams, P., and Dow, J. 2006. Cell cell signaling in Xanthomonas campestris involves an HD GYP domain protein that functions in cyclic di GMP turnover. Proc Natl Acad Sci US A 103:6712 6717. Rybak, M., Minsavage, G.V., Stall, R.E., and Jones, J.B. 2009. Identification of Xanthomonas citri ssp. citri host specificity genes in a heterologous expression host. Mol Plant Pathol 10:249 262. Rmli ng, U., Gomelsky, M., and Galperin, M.Y. 2005. C di GMP: the dawning of a novel bacterial signalling system. Mol Microbiol 57:629 639. Salama, N.R., and Manoil, C. 2006. Seeking completeness in bacterial mutant hunts. Curr. Opin. Microbiol. 9:307 311. Sa lanoubat, M., Genin, S., Artiguenave, F., Gouzy, J., Mangenot, S., Arlat, M., Billault, A., Brottier, P., Camus, J.C., Cattolico, L., Chandler, M., Choisne, N., Claudel Renard, C., Cunnac, S., Demange, N., Gaspin, C., Lavie, M., Moisan, A., Robert, C., Sau rin, W., Schiex, T., Siguier, P., Thbault, P., Whalen, M., Wincker, P., Levy, M., Weissenbach, J., and Boucher, C.A. 2002. Genome sequence of the plant pathogen Ralstonia solanacearum Nature 415:497 502. Saldanha, A.J. 2004. Java Treeview -extensible vis ualization of microarray data. Bioinformatics 20:3246 3248. Sambrook, J., and Russell, D.W. 2001. Molecular cloning: a laboratory manual. Cold spring harbor laboratory press, Cold spring harbor. Sandkvist, M. 2001. Biology of type II secretion. Mol Microb iol 40:271 283. Sandlin, R., Lampel, K., Keasler, S., Goldberg, M., Stolzer, A., and Maurelli, A. 1995. Avirulence of rough mutants of Shigella flexneri : requirement of O antigen for correct unipolar localization of IcsA in the bacterial outer membrane. I nfect Immun 63:229 237. Sasso, S., Ramakrishnan, C., Gamper, M., Hilvert, D., and Kast, P. 2005. Characterization of the secreted chorismate mutase from the pathogen Mycobacterium tuberculosis FEBS (Fed. Eur. Biochem. Soc.) J 272:375 389.

PAGE 207

207 Schaad, N., P ostnikova, E., Lacy, G., Sechler, A., Agarkova, I., Stromberg, P., Stromberg, V., and Vidaver, A. 2006. Emended classification of xanthomonad pathogens on citrus. Syst Appl Microbiol 29:690 695. Schauer, K., Gouget, B., Carrire, M., Labigne, A., and de Reuse, H. 2007. Novel nickel transport mechanism across the bacterial outer membrane energized by the TonB/ExbB/ExbD machinery. Mol Microbiol 63:1054 1068. Schneider, D.J., and Collmer, A. 2010. Studying plant pathogen interactions in the genomics era: beyond molecular Koch's postulates to systems biology. Annu Rev Phytopathol 48:457 479. Schornack, S., Meyer, A., Rmer, P., Jordan, T., and Lahaye, T. 2006. Gene for gene mediated recognition of nuclear targeted AvrBs3 like bacterial effector proteins. J Plant Physiol 163:256 272. Schreiber, K.J., and Desveaux, D. 2011. AlgW regulates multiple Pseudomonas syringae virulence strategies. Mol Microbiol 80:364 377. Schulte, R., and Bonas, U. 1992. Expression of the Xanthomonas campestris pv. vesicatoria hrp gene cluster, which determines pathogenicity and hypersensitivity on pepper and tomato, is plant inducible. J Bacteriol 174:815 823. Schuster, M., Lostroh, C.P., Ogi, T., and Greenberg, E.P. 2003. Identification, timing, and signal specificity of Ps eudomonas aeruginosa quorum controlled genes: a transcriptome analysis. J Bacteriol 185:2066 2079. Segura, A., Moreno, M., Madueno, F., Molina, A., and Garcia Olmedo, F. 1999. Snakin 1, a peptide from potato that is active against plant pathogens. Mol P lant Microbe Interact 12:16 23. Shrivastava, S., and Mande, S.S. 2008. Identification and functional characte rization of gene components of type VI s ecretion system in bacterial genomes. PLoS One 3:e2955. Siciliano, F., Torres, P., Sendn, L., Bermejo, C. Filippone, P., Vellice, G., Ramallo, J., Castagnaro, A., Vojnov, A., and Marano, M.R. 2006. Analysis of the molecular basis of Xanthomonas axonopodis pv. citri pathogenesis in Citrus lemon Electron. J. Biotechnol. 9:200 204. Simm, R., Morr, M., Kader, A ., Nimtz, M., and Rmling, U. 2004. GGDEF and EAL domains inversely regulate cyclic di GMP levels and transition from sessility to motility. Mol Microbiol 53:1123 1134. Slater, H., Alvarez Morales, A., Barber, C.E., Daniels, M.J., and Dow, J.M. 2000. A t wo component system involving an HD GYP domain protein links cell cell signalling to pathogenicity gene expression in Xanthomonas campestris Mol Microbiol 38:986 1003.

PAGE 208

208 Smyth, G.K. 2004. Linear models and empirical bayes methods for assessing differentia l expression in microarray experiments. Stat. Appl. Genet. Mol. Biol. 3:Article 3. Stimson, E., Virji, M., Makepeace, K., Dell, A., Morris, H., Payne, G., Saunders, J., Jennings, M., Barker, S., and Panico, M. 1995. Meningococcal pilin: a glycoprotein subs tituted with digalactosyl 2,4 diacetamido 2,4,6 trideoxyhexose. Mol Microbiol 17:1201 1214. Stock, A.M., Robinson, V.L., and Goudreau, P.N. 2000. Two component signal transduction. Annu Rev Biochem 69:183 215. Swarup, S., Feyter, D., R., Brlansky, R.H ., Gabriel, and D.W. 1991. A pathogenicity locus from Xanthomonas citri enables strains from several pathovars of Xanthomonas campestris to elicit canker like lesions on citrus. Phytopathology 81:802 809. Tang, J.L., Liu, Y.N., Barber, C.E., Dow, J.M., Woo tton, J.C., and Daniels, M.J. 1991. Genetic and molecular analysis of a cluster of rpf genes involved in positive regulation of synthesis of extracellular enzymes and polysaccharide in Xanthomonas campestris pathovar campestris Mol Gen Genet 226:409 41 7. Thieme, F., Szczesny, R., Urban, A., Kirchner, O., Hause, G., and Bonas, U. 2007. New type III effectors from Xanthomonas campestris pv. vesicatoria trigger plant reactions dependent on a conserved N myristoylation motif. Mol Plant Microbe Interact 20 :1250 1261. Thieme, F., Koebnik, R., Bekel, T., Berger, C., Boch, J., Bttner, D., Caldana, C., Gaigalat, L., Goesmann, A., Kay, S., Kirchner, O., Lanz, C., Linke, B., McHardy, A., Meyer, F., Mittenhuber, G., Nies, D., Niesbach Klsgen, U., Patschkowski, T ., Rckert, C., Rupp, O., Schneiker, S., Schuster, S., Vorhlter, F., Weber, E., Phler, A., Bonas, U., Bartels, D., and Kaiser, O. 2005. Insights into genome plasticity and pathogenicity of the plant pathogenic bacterium Xanthomonas campestris pv. vesicat oria revealed by the complete genome sequence. J Bacteriol 187:7254 7266. Tischler, A.D., and Camilli, A. 2004. Cyclic diguanylate (c di GMP) regulates Vibrio cholerae biofilm formation. Mol Microbiol 53:857 869. Torres, P.S., Malamud, F., Rigano, L.A. Russo, D.M., Marano, M.R., Castagnaro, A.P., Zorreguieta, A., Bouarab, K., Dow, J.M., and Vojnov, A.A. 2007. Controlled synthesis of the DSF cell cell signal is required for biofilm formation and virulence in Xanthomonas campestris Environ Microbiol 9 :2101 2109. Tseng, G., Oh, M., Rohlin, L., Liao, J., and Wong, W. 2001. Issues in cDNA microarray analysis: quality filtering, channel normalization, models of variations and assessment of gene effects. Nucleic Acids Res 29:2549 2557.

PAGE 209

209 Tseng, T.T., Tyler, B.M., and Setubal, J.C. 2009. Protein secretion systems in bacterial host associations, and their description in the Gene Ontology. BMC Microbiol 9 Suppl 1:S2. Van Sluys, M.A., Monteiro Vitorello, C.B., Camargo, L.E., Menck, C.F., Da Silva, A.C., Ferro, J .A., Oliveira, M.C., Setubal, J.C., Kitajima, J.P., and Simpson, A.J. 2002. Comparative genomic analysis of plant associated bacteria. Annu Rev Phytopathol 40:169 189. Vauterin, L., Hoste, B., Kersters, K., and Swings, J. 1995. Reclassification of Xanth omonas Int. J. Syst. Bacteriol. 45:472 489. Vilches, S., Canals, R., Wilhelms, M., Salo, M.T., Knirel, Y.A., Vinogradov, E., Merino, S., and Tomas, J.M. 2007. Mesophilic Aeromonas UDP glucose pyrophosphorylase (GalU) mutants show two types of lipopolysacc haride structures and reduced virulence. Microbiology 153:2393 2404. Viloria, Z., Drouillard, D.L., Graham, J.H., and Grosser, J.W. 2004. Screening triploid anker. Plant Disease 88:1056 1060. Vojnov, A., Zorreguieta, A., Dow, J., Daniels, M., and Dankert, M. 1998. Evidence for a role for the gumB and gumC gene products in the formation of xanthan from its pentasaccharide repeating unit by Xanthomonas campestris Microbiology 144 ( Pt 6):1487 1493. Wag ner, V.E., Bushnell, D., Passador, L., Brooks, A.I., and Iglewski, B.H. 2003. Microarray analysis of Pseudomonas aeruginosa quorum sensing regulons: effects of growth phase and environment. J Bacteriol 185:2080 2095. Wang, L., Rong, W., and He, C. 2008. Two Xanthomonas extracellular polygalacturonases, PghAxc and PghBxc, are regulated by type III secretion regulators HrpX and HrpG and are required for virulence. Mol Plant Microbe Interact 21:555 563. Wang, L.H., He, Y., Gao, Y., Wu, J.E., Dong, Y.H., He, C., Wang, S.X., Weng, L.X., Xu, J.L., Tay, L., Fang, R.X., and Zhang, L.H. 2004. A bacterial cell cell communication signal with cross kingdom structural analogues. Mol Microbiol 51:903 912. Wei, K., Tang, D.J., He, Y.Q., Feng, J.X., Jiang, B.L., Lu, G.T., Chen, B., and Tang, J.L. 2007. hpaR a putative marR family transcriptional regulator, is positively controlled by HrpG and HrpX and involved in the pathogenesis, hypersensitive response, and extracellular protease production of Xanthomonas campestr is pathovar campestris J Bacteriol 189:2055 2062.

PAGE 210

210 Wengelnik, K., and Bonas, U. 1996. HrpXv, an AraC type regulator, activates expression of five of the six loci in the hrp cluster of Xanthomonas campestris pv. vesicatoria J Bacteriol 178:3462 3469. W engelnik, K., Marie, C., Russel, M., and Bonas, U. 1996a Expression and localization of HrpA1, a protein of Xanthomonas campestris pv. vesicatoria essential for pathogenicity and induction of the hypersensitive reaction. J Bacteriol 178:1061 1069. Wenge lnik, K., Rossier, O., and Bonas, U. 1999. Mutations in the regulatory gene hrpG of Xanthomonas campestris pv. vesicatoria result in constitutive expression of all hrp genes. J Bacteriol 181:6828 6831. Wengelnik, K., Van den Ack erveken, G., and Bonas, U. 1996b HrpG, a key hrp regulatory protein of Xanthomonas campestris pv. vesicatoria is homologous to two component response regulators. Mol Plant Microbe Interact 9:704 712. Wolfgang, M.C., Jyot, J., Goodman, A.L., Ramphal, R., and Lory, S. 2004. Pseudo monas aeruginosa regulates flagellin expression as part of a global response to airway fluid from cystic fibrosis patients. Proc Natl Acad Sci US A 101:6664 6668. Xia, T., Song, J., Zhao, G., Aldrich, H., and Jensen, R.A. 1993. The aroQ encoded monofunc tional chorismate mutase (CM F) protein is a periplasmic enzyme in Erwinia herbicola J Bacteriol 175:4729 4737. Yamazaki, A., Hirata, A., and Tsuyumu, S. 2008. HrpG regulates type II secretory proteins in Xanthomonas axonopodis pv. citri J. Gen. Plant Pathol. 74:138 150. Yan, Q., and Wang, N. 2011. The ColR/ColS two component system plays multiple roles in the pathogenicity of the citrus canker pathogen Xanthomonas citri subsp. citri J Bacteriol 193:1590 1599. Yang, T.C., Leu, Y.W., Chang Chien, H.C. and Hu, R.M. 2009. Flagellar biogenesis of Xanthomonas campestris requires the alternative sigma factors RpoN2 and FliA and is temporally regulated by FlhA, FlhB, and FlgM. J Bacteriol 191:2266 2275. Ye, R.W., Wang, T., Bedzyk, L., and Croker, K.M. 200 1. Applications of DNA microarrays in microbial systems. J Microbiol Methods 47:257 272. Yen, M.R., Peabody, C.R., Partovi, S.M., Zhai, Y., Tseng, Y.H., and Saier, M.H. 2002. Protein translocating outer membrane porins of Gram negative bacteria. Biochim Biophys Acta 1562:6 31. Yeo, H.J., and Waksman, G. 2004. Unveiling molecular scaffolds of the type IV secretion system. J Bacteriol 186:1919 1926.

PAGE 211

211 Yuan, J., Reed, A., Chen, F., and Stewart, C.J. 2006. Statistical analysis of real time PCR data. BMC Bio informatics 7:85. Yun, M.H., Torres, P.S., El Oirdi, M., Rigano, L.A., Gonzalez Lamothe, R., Marano, M.R., Castagnaro, A.P., Dankert, M.A., Bouarab, K., and Vojnov, A.A. 2006. Xanthan induces plant susceptibility by suppres sing callose deposition. Plant Ph ysiol. 141:178 187. Zhang, S.S., He, Y.Q., Xu, L.M., Chen, B.W., Jiang, B.L., Liao, J., Cao, J.R., Liu, D., Huang, Y.Q., Liang, X.X., Tang, D.J., Lu, G.T., and Tang, J.L. 2008. A putative colR(XC1049) colS(XC1050) two component signal transduction system i n Xanthomonas campestris positively regulates hrpC and hrpE operons and is involved in virulence, the hypersensitive response and tolerance to various stresses. Res Microbiol 159:569 578. Zhang, Y., Callaway, E.M., Jones, J.B., and Wilson, M. 2009. Visua lisation of hrp gene expression in Xanthomonas euvesicatoria in the tomato phyllosphere. Eur. J. Plant. Pathol. 124:379 390. Zhao, Y., Qian, G., Yin, F., Fan, J., Zhai, Z., Liu, C., Hu, B., and Liuao, F. 2011. Proteomic analysis of the regulatory function of DSF dependent quorum sensing in Xanthomonas oryzae pv. oryzicola Microb, Pathog. 50:48 55.

PAGE 212

212 BIOGRAPHICAL SKETCH Yinping Guo was born in Handan, Hebei, China. From 2000 to 2004 she attended Henan University of Technology, Zhengzhou, Henan, China, wher e she received the Bachelor of Science in bioengineering. In 2004, she was admitted for the Master of Science program in the Graduate University of Chinese Academy Sciences, Beijing, China. During this time, she worked on the multilocus phylogeny of Strept omyces genus under the supervision of Dr. Ying Huang in Institute of Microbiology, Chinese Academy of Sciences, Beijing, China. Yinping married Sha Tao on May 8th, 2007 in Zhengzhou, joined the Ph.D program in the Department of Microbiology and Cell Science at the University of Florida. She began working with Dr. Nian Wang on virulence regulatory mechanisms of the citrus canker pathogen Xanthomonas citri subsp. citri As a graduate st udent, Yinping has presented her work in numerous conferences and seminars including the 2009 and 2010 American Phytopathological Society Annual Meetings, 2010 Plant Production seminar at the Citrus Research and Education Center. She received 2009 2011 A.S Herlong Endowed Scholarship, and 2009 T. A. Wheato n Graduate Student Travel Award Yinping received her Ph.D. from the University of Florida in the summer of 2011.