Jak2 Tyrosine Kinase As a Potential New Target in the Treatment of Cancer and Cardiovascular Disease

MISSING IMAGE

Material Information

Title:
Jak2 Tyrosine Kinase As a Potential New Target in the Treatment of Cancer and Cardiovascular Disease
Physical Description:
1 online resource (160 p.)
Language:
english
Creator:
Kirabo,Annet
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences, Physiology and Pharmacology (IDP)
Committee Chair:
Sayeski, Peter P
Committee Members:
Baylis, Christine
Kasahara, Hideko
Ogle, William

Subjects

Subjects / Keywords:
angiotensin -- cancer -- cardiovascular -- g6 -- inhibitor -- jak2
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre:
Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Cardiovascular diseases including hypertension, stroke and heart attack are one of the leading causes of death in the world. These diseases often result from multiple risk factors including genetic background, environmental conditions and hematological disorders. Most of the available treatment approaches for cardiovascular diseases are targeted towards the renin-angiotensin-aldosterone system (RAAS) including direct renin inhibition, ACE inhibition, Angiotensin II type 1 receptor (AT1-R) blockade, and aldosterone receptor antagonism. However, many patients are non-responsive to the available treatments, and there is still need to identify new therapeutic targets for cardiovascular disease. The Jak2 signaling pathway is intricately coupled to the AT1-R signaling processes involved in hypertension. In addition, hyper-activation of the Jak2 signaling pathway is central to the pathogenesis of hematological malignancies, which also present an important predisposing factor for cardiovascular diseases such as stroke and heart attack. In this dissertation, we investigated the involvement of Jak2 in the pathogenesis of cardiovascular disease, and its potential as a therapeutic target. We report here that G6, a novel stilbenoid based inhibitor of Jak2 tyrosine kinase, has exceptional therapeutic efficacy in two different mouse models of Jak2-mediated hematological disease pathogenesis. In addition, we used the Cre-loxP system to conditionally eliminate Jak2 tyrosine kinase expression within the vascular smooth muscle cells (VSMC) of mice, followed by chronic infusion of Angiotensin II (Ang II). We found that mice lacking Jak2 in their VSMC are largely protected from Ang II-induced cardiovascular disease pathogenesis including hypertension and neointima formation following vascular injury. These studies suggest that Jak2 plays a critical role in the pathogenesis of cardiovascular disease via multiple, non-redundant mechanisms. As such, Jak2 may provide a rational therapeutic approach for patients with various forms of cardiovascular diseases.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Annet Kirabo.
Thesis:
Thesis (Ph.D.)--University of Florida, 2011.
Local:
Adviser: Sayeski, Peter P.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043174:00001


This item is only available as the following downloads:


Full Text

PAGE 1

JAK2 TYROSINE KINASE AS A POTENTIA L NEW TARGET IN THE TREATM ENT OF CANCER AND CARDIOVASCULAR DISEASE By ANNET KIRABO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORID A IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011 1

PAGE 2

2011 Annet Kirabo 2

PAGE 3

To my parents for their unfailing lo ve, encouragement, wisdom and support 3

PAGE 4

ACKN OWLEDGMENTS My deepest appreciation goes to my mentor Dr. Peter Sayeski. His excellent guidance, advice and support have made my res earch successful. I would also like to thank members of my Ph.D. supervisory committee; Drs. Chris Baylis, Hideko Kasahara, and William Ogle. Their support, guidance and critical analysis of my research will have a long-lasting im pact on the success of my career. Special thanks go to the various people who provided me with technical assistance in various aspects of my resear ch including Mr. Steve McClellan, Dr. Ann Fu, Ms. Naime Fliess, Mr. Marcus Moore, Mr. Patrick Kerns, Mr. Bruce Cunningham, Mr. Harold Snellen, Dr. Alva ro Gurovich, Dr. Jennifer Sa sser, Dr. Yagna Jarajapu, Dr. Jennifer Embury, Dr. Mary Re inhard, Dr. Heather Wamsley and Dr. Debra Ely. I thank my friends Natasha Moningka, Lakeshia Murphy, Lisa Morrison and Dr. Chastity Bradford for their support, adv ice and guidance. I also thank my lab mates Dr. Sung Park, Anurima Majumder, Kavitha G nanasambandan and Rebekah Baskin for their friendship, and for providing a conducive research environment. Lastly, I would like to thank members of my family. I thank my father Rev. Josiah Ddembe and my mother Mrs. Proscovia Ddem be. Their strict and loving upbringing has shaped me into who I am. Their constant assu rance that they trust my decisions, and that they are praying for me has enabled me to fly out of the nes t and be independent in a responsible way. I thank my brother s Robert Ddembe, Nelson Wandira and James Izimba Ddembe. They have always had my back and around them, I have nothing to fear. I thank my sisters Sa rah Mirembe, Gertrude Tumwebaze, Martha Alitubera, Prossy Musasizi and Naomi Mwesigwa for their love, prayers and moral support. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDG MENTS..................................................................................................4 LIST OF TABLES............................................................................................................9 LIST OF FI GURES ........................................................................................................10 ABSTRACT ...................................................................................................................12 CHAPTER 1 INTRODUC TION....................................................................................................14 Jak2 Tyrosine Kinase: A Potential Therapeutic Target for AT1 Receptor Mediated Cardiova scular Dis ease.......................................................................14 The Janus Kinase Family of Pr oteins ...............................................................16 Jak2 in Angiotensin II-Induced Cardiovascula r Diseas e...................................17 Pharmacological Jak2 Inhibition: An emerging Therapeutic Strategy in Jak2-mediated Diseases..................................................................................21 2 THE STILBENOID TYROSINE KINASE INHIBITOR, G6, SUPPRESSES JAK2V617F MEDIATED HUMAN PATHOLOGICAL CELL GROWTH IN VITRO AND IN VIVO ...................................................................................................................27 Materials and Methods............................................................................................28 Cell Culture...................................................................................................... .28 Phospho-STAT Analysi s..................................................................................28 In vivo Anim al Model........................................................................................28 Analysi s of Peripheral Blood Ce lls....................................................................29 His to-pathological Analysi s...............................................................................30 B one Marrow Flow Cytometry..........................................................................30 Bone Marrow Immunohist ochemistry...............................................................30 Statistical Analysi s............................................................................................31 Result s....................................................................................................................31 G6 Inhibits Jak2-V617F Dependen t Human Erythroleukemia Cell Proliferat ion...................................................................................................31 G6 Suppresses HEL Cell Growth by Inducing G1 Phase Cell Cycle Arrest and Apoptos is...............................................................................................33 G6 Inhibits Jak2-V617F-Dependent Cons titutive Activati on of STAT5.............34 G6 Reduces Blast Cells in the Peripher al Blood and the Spleen Weight to Body Weight Ratio in a Murine Model of Jak2-Dependent, Human Erythroleuk emia............................................................................................35 G6 Corrects a Pathologically Low Myel oid to Erythroid Ratio by Reducing the Number of Human Eryt hroleukemia Cells in the Bone Marrow of Mice...35 5

PAGE 6

G6 Reduces the Levels of phospho-ST AT5 and Induces Cellular Apoptosis in vivo ............................................................................................................37 G6 Treatment Results in Leukemic Regression and Nor malization of Hematopoiesis in the Sp leen.........................................................................38 Discussio n..............................................................................................................40 3 THE JAK2 INHIBITOR, G6, A LLEVIATES JAK2-V617F MEDIATED MYELOPROLIFERATIVE NEOPLASI A BY PROVIDING SIGNIFICANT THERAPEUTIC EFFICACY TO THE BONE MARROW.........................................55 Materials and Methods............................................................................................56 Animals.............................................................................................................56 Analysis of Peripher al Blood Cells....................................................................57 Interleukin-6 Analysi s.......................................................................................57 Histological Analysi s.........................................................................................58 Immunohistochem istry......................................................................................58 Determination of Jak2-V617F Allele Burden in the Bone Marrow.....................59 Clonogenic Assay.............................................................................................59 Statistical Analys is............................................................................................59 Result s....................................................................................................................60 G6 Provides Therapeutic Benefit in Peripheral Blood of Jak2-V617F MPN Mice..............................................................................................................60 G6 Reduces Extramedullary Hematopoi esis in Jak2-V617F MPN Mice..........61 G6 Provides Therapeutic Benefit to t he Spleen of Jak2-V617F MPN Mice......62 G6 Provides Therapeutic Benefit to the Bone Marrow of Jak2-V617F MPN Mice by Alleviating Megakaryo cytic and Myeloid Hyperplas ia.......................63 G6 Provides Therapeutic Benefit to the Bone Marrow in Jak2-V617F MPN Mice by Reducing the Pathological Levels of Phospho-Jak2 and Phospho-ST AT5............................................................................................64 G6 Provides Therapeutic Benefit to the Bone Marrow in Jak2-V617F MPN Mice by Significantly Reducing t he Mutant Jak2 A llelic Bu rden....................65 G6 Prevents Jak2-V617F Medi ated Clonogenic Growth..................................66 Discussio n..............................................................................................................66 4 VASCULAR SMOOTH MUSCLE JAK2 MEDIATES ANGIOTENSIN IIINDUCED HYPERTENSION VIA I NCREASED LEVELS OF REACTIVE OXYGEN SPE CIES................................................................................................81 Materials and Methods............................................................................................82 Animal s.............................................................................................................82 Blood Pressure Measurem ents........................................................................83 Aortic Contracti on/Relaxation...........................................................................83 Histolo gy...........................................................................................................83 NO Measur ements...........................................................................................83 H2O2 Detection.................................................................................................84 Rho Kinase Activity..........................................................................................84 Calcium Im aging...............................................................................................84 6

PAGE 7

Statistical Analys is............................................................................................ 84 Result s....................................................................................................................84 Generation of Mice with VSMC Deletion of Jak2..............................................84 Deletion of VSMC Jak2 Attenuates Ang II-Induced Hypertensio n....................85 VSMC Jak2 Null Mice were Protect ed from Ang II-Induced Aortic Wall Thickeni ng.....................................................................................................86 Deletion of VSMC Jak2 Correlates with Reduced Ang II-Induced Contraction of Aortic Rings and Increased Endothelium-derived Nitric Oxide.............................................................................................................87 Deletion of VSMC Jak2 Enhances Endothelium Dependent Aortic Relaxation due to Reduced ROS and Increased NO Av ailability..................88 Deletion of VSMC Jak2 Results in Reduced Rho-Kinase Activity and Intracellular Ca2+ Levels in Respon se to A ng II.............................................90 Deletion of VSMC Jak2 Prevents Angiotensin II-Induced Kidney Damage......91 Discussio n..............................................................................................................92 5 VASCULAR SMOOTH MUSCLE JAK2 DELETION PREVENTS ANGIOTENSIN II-MEDIATED NEOINTIMA FORMATION FOLLOWING INJURY IN MICE..........105 Materials and Methods..........................................................................................107 Animals ...........................................................................................................107 Generation of Kno ckout Mi ce.........................................................................107 Vascular Injury Model .....................................................................................108 Histology .........................................................................................................108 Immunohistochem istry....................................................................................109 Immunoblotti ng...............................................................................................109 Cell Prolifer ation.............................................................................................110 Cell Migrat ion.................................................................................................110 Statistical A nalysis ..........................................................................................111 Results ..................................................................................................................111 Deletion of VSMC Jak2 Prevents Ang II-Mediated Neointima Formation and Narrowing of the Vascular Lum en Following Injury.....................................111 Deletion of VSMC Jak2 Prevents Ang II-Mediated Vascular Fibrosis Following In jury...........................................................................................112 Deletion of VSMC Jak2 Prevent s the Loss of Smooth Muscle -actin in Response to Ang II-Mediat ed Vascular In jury.............................................113 Deletion of VSMC Jak2 Prevents Neointima Formation by Inhibiting Cell Proliferation and Induc ing Apopto sis...........................................................113 VSMC Jak2 Induces Neointima Formation by Increasing Phosphorylation of Jak2 and ST AT5.........................................................................................114 VSMC Jak2 Mediates Ang II-Induced Cell Proliferation and Migration...........115 VSMC Jak2 deletion is associated with reduced Ang II-mediated activation of STAT3 and STAT5..................................................................................116 Discussio n............................................................................................................117 7

PAGE 8

6 CONCLUSIONS AND PERSPECTI VES...............................................................128 Jak2 is Important in Mammalian Bi ology...............................................................128 Jak2 plays a Critical Role in the Pat hogenesis of Hematological Malignancies....129 Therapeutic Efficacy of Jak2 Inhibitors in Hematologica l Malignancies................130 G6 has Exceptional Bone Marro w Therapeutic Efficacy.......................................130 Conditional Deletion of Vascular Smooth Mu scle Cell Jak2 is Protective against Cardiovascular Diseas e Pathogenes is..............................................................132 Jak2 Mediates Cardiovascular Disease Pathogenesis via Multiple NonRedundant Mechanisms ....................................................................................133 Jak2 Contributes to Incr eased Presence of ROS...........................................133 VSMC Jak2 Expression Correlates wit h Reduced NO Avai lability.................135 VSMC Jak2 Expression Correlates with Increased Rho-kinase Activity.........135 VSMC Jak2 Expression Correlates with Increased Intracellular Calcium.......136 VSMC Jak2 Mediates Ang II-Induced Gr owth Factor Effects and Local Tissue Dam age...........................................................................................137 Jak2 Inhibitors and Their Potential for Cardiovascular Dis ease Therapy..............138 Conclusion s....................................................................................................139 LIST OF REFE RENCES.............................................................................................142 BIOGRAPHICAL SKETCH ..........................................................................................160 8

PAGE 9

LIST OF TABLES Table page 2-1 Mass spectrometry results showing plasma and tiss ue concentrations of G6 at euthanasia......................................................................................................54 3-1 Summary of peripheral blood analyse s showing erythrocyte and platelet indices of non-transgenic, and vehicle or G6 treated Jak2-V617F transgenic mice....................................................................................................................78 3-2 Summary of peripher al blood analyses showing leukocyte indices of nontransgenic, and vehicle or G6 trea ted Jak2-V617F tr ansgenic mi ce...................79 3-3 Mass spectrometry results showing plasma concentrations of G6 at euthanasia of Jak2-V617F transgenic mice........................................................80 6-1 Comparison of in vivo dosages of Jak2 inhibito rs in murine models.................141 9

PAGE 10

LIST OF FIGURES Figure page 1-1 The Classical Jak/STAT Signaling Pathway.........................................................23 1-2 Activation of the Jak2 signaling cascade via the AT1-receptor results in mitogenic growth responses ...............................................................................24 1-3 The mechanism by which Ang II mediates vaso constric tion...............................25 1-4 Proposed mechanisms through whic h Jak2 mediates Ang II-dependent vasoconstriction. .................................................................................................26 2-1 Model of Jak2-V617F mediated, human erythr oleukemia ..................................44 2-2 G6 inhibits Jak2-V617F depende nt HEL cell pr oliferation, in vitro ......................45 2-3 G6 suppresses HEL cell growth by inducing G1 phase cell cycle arrest............46 2-4 G6 induces the intrinsic apopt otic pathway in HEL ce lls.....................................47 2-5 G6 preferentially inhibits Jak2-V 617F dependent constitutive activation of STAT5. ...............................................................................................................48 2-6 G6 decreases the percentage of blast cells in the peripheral blood and reduces the spleen weight to body weight ratio in a mouse model of Jak2V617F mediated human er ythroleukem ia...........................................................49 2-7 G6 improves the M:E ratio in a mouse model of Jak2-V617F mediated human erythroleukemia by reducing HEL cell engraftment in the bone marrow. ..............................................................................................................50 2-8 G6 reduces the levels of phospho-ST AT5 and induces cellular apoptosis in the bone ma rrow.................................................................................................51 3-1 G6 provides therapeutic benefit in peripheral blood of Jak2-V617F transgenic mice....................................................................................................................71 3-2 G6 reduces extramedullary hematopoiesis in Jak2-V617F transgenic mice......72 3-3 G6 provides therapeutic benefit to the spleen of Jak2-V617F transgenic mice....................................................................................................................73 3-4 G6 provides therapeutic benefit to the bone marrow of Jak2-V617F transgenic mice by alleviating megakar yocytic and myeloid hyperplasia...........74 3-5 G6 reduces activation of Jak2 and STAT5 in Jak2-V617F transgenic mice.......75 10

PAGE 11

3-6 G6 reduces mutant allelic burden in bone marrow of Jak2-V617F transgenic mice ....................................................................................................................76 3-7 G6 prevents Jak2-V617F-mediated cyt okine-independent colony Formation.....77 4-1 Generation of mice with vascular sm ooth muscle cell specific deletion of Jak2....................................................................................................................96 4-2 The Jak2 protein is absent in vascula r smooth muscle cells of mutant mice......97 4-3 Deletion of vascular smooth muscle cell Jak2 attenuates Ang II-induced hypertens ion.......................................................................................................98 4-4 VSMC Jak2 null mice are protect ed from Ang II induced aortic wall thickening...........................................................................................................99 4-5 Deletion of vascular smooth muscle cell Jak2 correlates with reduced Ang II induced contraction of aortic rings.................................................................... 100 4-6 Deletion of vascular smooth muscle cell Jak2 correlates with increased levels of nitric oxide....................................................................................................101 4-7 Deletion of vascular smooth muscle cell Jak2 enhances endothelium dependent vascular relaxation due to reduced reactive oxygen species and increased nitric oxi de availabi lity......................................................................102 4-8 Deletion of vascular smooth muscle cell Jak2 results in reduced Rho-kinase activity and intracellular Ca2+ levels in respons e to Ang II................................103 4-9 VSMC Jak2 null mice are protected from Ang II-induced renal damage..........104 5-1 Deletion of VSMC Jak2 prevents Ang II-mediated neointima formation and narrowing of the vascular lumen following injury..............................................121 5-2 Deletion of VSMC Jak2 prevents A ng II-mediated fibrosis and loss of SMA following in jury..................................................................................................122 5-3 Deletion of VSMC Jak2 inhibits cell proliferation and induces apoptosis..........123 5-4 VSMC Jak2 induces neointima forma tion by increasing phosphorylation of Jak2 and ST AT5...............................................................................................124 5-5 VSMC Jak2 mediates Ang II-induced cell proliferation a nd migration..............125 5-6 VSMC Jak2 deletion reduces Ang II-mediated activation of STAT3 and STAT5 ..............................................................................................................127 11

PAGE 12

Abstract of Dissertation Pr esented to the Graduate School of the University of Florida in Par tial Fulf illment of the Requirements for t he Degree of Doctor of Philosophy JAK2 TYROSINE KINASE AS A POTENTIA L NEW TARGET IN THE TREATMENT OF CANCER AND CARDIOVASCULAR DISEASE By Annet Kirabo August 2011 Chair: Peter P. Sayeski Major: Medical Sciences -Physiology and Pharmacology Cardiovascular diseases including hyper tension, stroke and heart attack are one of the leading causes of death in the world. These diseases often re sult from multiple risk factors including genetic background, environmental conditions and hematological disorders. Most of the available treatment approaches for cardiovascular diseases are targeted towards the renin-angiotensin-aldosterone system (RAAS) including direct renin inhibition, ACE inhibition, Angiotensin II type 1 receptor (AT1-R) blockade, and aldosterone receptor antagonism. However, many patients are non-responsive to the available treatments, and there is still need to identif y new therapeutic targets for cardiovascular disease. The Jak2 signaling pathway is intricately coupled to the AT1-R signaling processes involved in hypertension. In addition, hy per-activation of the Jak2 signaling pathway is central to the pathogenes is of hematological malignancies, which also present an important predisposing fact or for cardiovascular diseases such as stroke and heart attack. In this dissertation, we investigated the involvement of Jak2 in the pathogenesis of cardiovascular disease, and its potential as a therapeutic target. We report here that G6, a nov el stilbenoid based inhibitor of Jak2 tyrosine kinase, has exceptional therapeutic efficacy in tw o different mouse models of Jak2-mediated 12

PAGE 13

13 hematological disease pathogenesis. In addition, we used the Crelox P system to conditionally eliminate Jak2 tyrosine ki nase expression within the vascular smooth muscle cells (VSMC) of mice, followed by ch ronic infusion of Angi otensin II (Ang II). We found that mice lacking Jak2 in their VSMC are largely protected from Ang II-induced cardiovascular disease pathogenesis incl uding hypertension and neointima formation following vascular injury. These studies suggest that Jak2 plays a critical role in the pathogenesis of cardiovascular disease via multiple, non-redundant mechanisms. As such, Jak2 may provide a rational therapeut ic approach for patients with various forms of cardiovascular diseases.

PAGE 14

CHAPTE R 1 INTRODUCTION 1Jak2 Tyrosine Kinase: A Potential Therapeutic Target for AT1 Receptor Mediated Cardiovascular Disease Cardiovascular diseases are among the leading causes of death in the United States and other developed countries and hypert ension is one of the major contributors to cardiovascular disease, end-organ damage, and death in the Western world [1]. The consequences of hypertension include myocardial ischemia, hypertensive heart disease, renal failure, peripheral atheroscler osis, and stroke. Central to these processes is the renin-angiotensin-aldosterone system (RAAS), which plays a major role in the pathophysiological processes leading to hypertension. Angiotensin II (Ang II) is the primary e ffecter hormone of the RAAS. There are two G protein-coupled receptor subtypes through wh ich Ang II mediates its actions; the Ang II type 1 receptor (AT1-R) and Ang II type 2 receptor (AT2-R) [2,3]. Most of the physiological and pathophysiological cardiovascular actions of Ang II are mediated through the AT1-R [4,5]. The AT2-R is expressed at very high levels in the developing fetus, but its expr ession is very low in the cardiovascular system of adults [6]. Under normal physiological conditions, Ang II mediat es responses that maintain electrolyte and blood pressure homeostasis. It affect s glomerular blood flow via arteriolar vasoconstriction in the kidney and increases renal tubular sodium and water reabsorption by stimulating synthesis and secretion of aldosterone. In addition, Ang II 1Reproduced with permission from Kirabo A, Sayeski PP (2010) Jak2 tyrosine kinase: a potential therapeutic target for AT1 receptor mediated cardiovascular disease. Pharmaceuticals 3: 3478-3493. 14

PAGE 15

stimulates release of vasopressin from the brain re sulting in increased water retention. It also drives the thirst res ponse. Finally, Ang II acts dire ctly on vascular smooth muscle cells (VSM C) resulting in vasocons triction and blood pressure regulation. In addition to its hemodynamic effects, Ang II has direct antinatriuretic effects in the kidney. In the proximal tubules, Ang II-me diated reabsorption of sodium is coupled to reabsorption of bicarbonate via activation of apical Na+/H+ exchange, basolateral Na+-HCO3 cotransport, and basolateral Na+/K+-ATPase and via insertion of H+-ATPase into the apical membrane. In the distal t ubules, Ang II increases amiloride-sensitive sodium reabsorption via ENaC on s odium channels. It also stimulates Na+/H+ exchange and the vacuolar H+-ATPase. In the collecting duct, A ng II also plays an important role in regulation of the epithelia l sodium channel. Ang II also regulates reabsorption of sodium in the collecting duct via aldosterone. It stimulates production of aldosterone in the zona glomerulosa of the adrenal cortex. Aldosterone then stimulates ion transport in the principal cells of the collecting duct by opening sodium and potassium channels in the luminal membrane, and incr easing the activity of Na+/K+-ATPase pump in the basolateral membrane. The antinatriuretic effe cts of Ang II on the various segments of the nephron have been reviewed [7]. Perturbation of the RAAS is associat ed with the pathogenesis of a number of cardiovascular diseases. Ang II action via the AT1-R is particularly vital in the pathogenesis of cardiovascular disease resulting from hypertension. This is mainly due to its vasoconstrictive actions on VSMCs resulting in increased peripheral resistance and hypertension [6]. Ang II also acts on it s receptors and mediates increased VSMC 15

PAGE 16

hyperplasia and hypertrophy, leading to incr eased peripheral vascular resistance. Most of the pathophysiologic effects result from chronic Ang II stim ulation which elicits growth promoting effects leading to vascular diseas e [8]. Ang II infusion exacerbates neointima formation in animals with vascular balloon catheter injury [9], which is inhibited by RAAS blockers [10]. In addition, Ang II increases protein synthesis in VSMCs [11] and it stimulates growth in a number of cell types including VSMC, fibroblasts, adrenal cortical cells, cardiac myocytes, renal proximal tubular cells and tumor cells [12]. In cultured VSMCs, Ang II promotes hyperplasia, hyper trophy and migration [13,14,15,16]. It has also been implicated in inflammation, endot helial dysfunction, atherosclerosis, hypertension and renal fibrosis [17]. Chr onic Ang II infusion in rodents induces VSMC proliferation in normal and injured vessels in vivo [9,18]. Interestingly, the growth factorlike Ang II-dependent responses are largely independent of its hemodynamic effects [19]. These studies suggest that Ang II acts as a growth factor under chronic exposure. However, the mechanisms that mediate the gr owth promoting effects of Ang II are still under scientific investigation. This dissertation is aimed at analyzing the involvement of the tyrosine kinase, Jak2, in AT1-R mediated cardiovascular disease, and its potential as a treatment option for cardiovascular disease. The Janus Kinase Family of Proteins There are four mammalian genes encoding the non-receptor Janus kinase (Jak) family of proteins; Jak1, Jak2, Jak3 and T yk2 [20]. They contain seven regions with significant sequence homology and collectively, these regions are referred to as the Jak homology domains (JH1-JH7) [21]. The JH 1 domain contains the tyrosine kinase domain, and is located within the carboxyl terminus of the protein. This domain binds ATP and harbors the phospho-transferase activity of the protein. The JH2 domain 16

PAGE 17

shows close homology to the JH1 domain, but lacks tyrosi ne kinase activity. It is therefore termed the ps eudokinase domain. Acting via a cis mechanism, the JH2 domain negatively regulates the kinase activi ty of the JH1 domain [21,22]. The JH3 and half of the JH4 domain encode an SH2 like mo tif whose function is not well understood [23]. Finally, the remaining half of the JH4 domain, along with the entirety of the JH5, JH6, and JH7 domains, collectively encode the FERM domain. The FERM domain directly mediates the interaction of the Jak kinases with other cellular proteins such as cytokine receptors [24,25,26]. The Jak kinases play a critical role in cytokine signaling. They transduce signals from the cell surface to the nucleus via the tyrosine phosphorylat ion of the Signal Transducers and Activators of Transcription (STAT) prot eins. Phosphorylated STATs translocate into the nucleus where they bind to cisinducible promoter elements and stimulate gene transcription (Fig ure 1-1). Insight into the in vivo function of each of the Jaks was gained via the generation of specific Jak kinase family knockout mice. Among the gene deletion models of the Ja k family members, Jak2 def icient mice exhibited the most severe phenotype. Jak2 null mice die embryonically around day E12.5 of gestation due to impaired erythropoiesis and pr ofound anemia [27,28]. These studies demonstrate that Jak2 is important in mouse development via erythropoietin receptordependent signaling. However, given the wide expression pattern of Jak2 in the body, there is still need to investigate its other biologically relevant functions as a mediator for cellular signaling in adult tissues. Jak2 in Angiotensin II-Indu ced Cardiovascular Disease Studies have shown that Ang II binding to the AT1-R triggers activation of Jak2, leading to intracellular signaling casc ades in VSMCs and cardiac myocytes 17

PAGE 18

[29,30,31,32,33,34,35,36,37]. A ng II stimulates Jak2 co-association to the AT1-R in VSMCs leading to phosphorylation of Jak2 at Tyr 1007/Tyr 1008, phosphorylation of the STATs, and translocation of th e STATs into the nucl eus [30,38,39,40], resulting in cell growth/proliferative re sponses (Figure 1-2). Blockade of the RAAS by either angiotensinconverting enzyme (ACE) inhibitors or AT1-R specific antagonists prevents injury-induced neointima format ion [10,41], and Ang II infusion exacerbates VSMC proliferation in arterial walls [9]. In addition, the genes of the RAAS are up regulated in neointima formation following vascular injury [42,43,44,45 ]. Interestingly, Jak2 has also been shown to play a role in other cardiovascular sign aling processes [46]. Fo r example, in VSMC, Jak2 plays a critical role in reactive oxygen species (ROS) dependent VSMC proliferation [47]. It is also involved in the pathogenesis of atheroscle rosis via its interaction with cytokines such as interleukin 8 [48]. In addition, Jak2 activation has been linked to neointima formation and vascular occlusion in ra t carotid arteries s ubjected to balloon injury, which is exacerbated by Ang II infusi on [49]. Although it is well established that Jak2 interacts with the AT1-R resulting in cell growth and hypertrophy, there is no in vitro or in vivo evidence suggesting that the AT1-R mediated growth effects are exclusively through Jak2 activation. Further studies need to be done to establish the relative involvement of Jak2 activation in comparis on to other pathways such as the mitogenactivated protein (MAP) kinase or pp60c-src kinase in AT1-R mediated cardiovascular remodeling. Jak2 not only mediates Ang II-dependent grow th promoting effects, but is also involved in Ang II-induced contractile responses, increased vascular tone and hypertension. The established mechanism by which Ang II mediates vasoconstriction 18

PAGE 19

involves t he heterotrimeric G protein-mediat ed pathway [50]. In VSMCs, the binding of Ang II to the AT1-R results in the activation of Gq [51] which leads to phospholipase C (PLC) activation. This releases inositol-1,4,5-triphosphate (IP3) and diacylglycerol (DAG) from plasma membrane derived phosphat idylinositol 4,5-bisphosphate [52]. Diacylglycerol stimulates protein kinase C (PKC) while IP3 binds to its receptor on the sarcoplasmic reticulum, allowing calcium efflux into the cytoplasm. Ang II also mediates an influx of external Ca2+ via calcium release activated calcium (CRAC) channels [53,54]. Ca2+ binds to calmodulin and activates myos in light chain kinase (MLCK), which phosphorylates the myosin light chain and enhances the interaction between actin and myosin, resulting in vasoconstriction [ 55]. The classical Ang II mediated signal transduction leading to vasoconstriction is summarized in Figure 1-3. Recently, Guilluy and colleagues demonstrated a role of Jak2 in the pathogenesis of hypertension [56]. The authors showed that Jak2 is involved in the Ang II-mediated activation of the Rho exchange factor, Arhgf1, resulting in enhanced vasoconstriction. It is not known whether the phosphorylation of Arhgef1 by Jak2 involves the Jak2 pool which is physically associated to AT1-R, or via an indirect mechanism. ROS mediate signaling pathw ays involved in hypertension and vascular pathology [57,58] and Ang II is involved in mediat ing oxidative stress and oxidant signaling [55,59,60,61]. Many of the pathol ogic effects of Ang II in blood vessels are mediated by the generation of ROS via activation of NAD(P) H oxidases [57]. Ang II stimulates the activity of membrane-bound NAD(P)H oxid ase in VSMCs and endothelial cells to produce ROS in the form of superoxide and hydrogen peroxide. G eneration of such molecules causes vascular inflammati on, fibrosis and endothelial dysfunction 19

PAGE 20

[17,57,62,63,64,65,66]. The Ang II-induced forma tion of ROS is not related to it s hemodynamic effects as it does not occu r in norepinephrine-induced hypertension [62,67]. Specifically, endothelia l dysfunction was observed in rats made hypertensive by Ang II infusion, but not norepinephrine infusion. Furthermore, the endothelial dysfunction correlated positively with incr eased superoxide production in the arteries [62,67,68]. ROS have been shown to mediate RhoA/Rho kinase-induced Ca2+ sensitization in pulmonary vascular smooth muscle followin g chronic hypoxia [69]. Superoxide generated by Ang II inactivates nitric ox ide (NO) in endothelial cells and VSMCs [70,71,72]. In addition, previous studies hav e shown that Rho kinase can be activated by increased ROS [69,73]. However, the mechanisms by which Ang II activates NAD(P)H oxidases to induce oxidative stress are still not well understood. A number of tyrosine kinases and phosphatases are known to be regulated by oxidative stress resulting in expression of inflammatory genes, endothelial dysfunction, VSMC growth, and extracellular matrix formation [57,59,62,63,74]. There is evidence that Jak2 plays a cr itical role in mediating ROS dependent VSMC proliferation [47]. Activation of Jak2 results in higher levels of ROS and Jak2 inhibition leads to a dramatic reduction in oxidative stress [75]. Mutations which cause constitutive activation of Ja k2, such as Jak2-V617F, increase the levels of ROS within cells, and inhibition of Jak2 leads to reduc tion of ROS in these same cells [75,76]. Hence, productions of ROS by the AT1-R, and Jak2 activation have been experimentally demonstrated. However, it is still not known whether Jak2 mediates Ang II-induced production of ROS via the AT1-R. There is still a need to elucidate the 20

PAGE 21

specific mechanisms by which Jak2 contribut es to production of ROS, and whether it plays a role in regulating NO availability. Furthermore, it is not known whether Jak2 can activate Rho kinase via ROS-dependent mechanisms. The proposed mechanisms through which Jak2 mediates vas oconstriction are represented in Figure 1-4. Pharmacological Jak2 Inhibition: An em erging Therapeutic Strategy in Jak2mediated Diseases Jak2 kinase function is critical for normal hematopoietic growth factor signaling [77]. On the other hand, hyper-kinetic Jak2 tyrosine kinase signaling causes several hematologic diseases including some forms of leukemia, lymphoma, and myeloma. Gain-of-function somatic mutations in the Jak2 allele are also known to be a causative agent in the pathogenesis of t he myeloproliferative neoplas ms (MPN) [78]. MPNs are clonal disorders of multipot ent hematopoietic progenitors characterized by increased hematopoiesis. They include polycythemia vera (PV), essential thrombocythaemia (ET) and primary myelofibrosis (PMF). MPNs have a relatively high prevalence with the number of cases ranging from about 130,000 to 150,000 in the United States [79]. The clinical symptoms of MPNs include bleeding, thrombosis, splenomegaly, and a propensity for malignant transform ation in the form of acute myeloid leukemia. One Jak2 mutation which causes MPNs is a valine to phenylalanine substitution at residue 617 (Jak2-V617F) within the pseudok inase domain. This mutation relieves the inhibitory potential that the JH2 domai n normally exerts on the JH1 kinase domain and the consequence of this lost inhibitory potential is constitutive activation of the Jak2 signaling pathway [80,81,82,83,84]. The Jak2-V 617F mutation has also been implicated in other Jak2 mediated human diseases su ch as chronic myelomonocytic leukemia, 21

PAGE 22

myelodysplastic syndrome, systemic mastocytosis, chronic neutrophilic leukemia, and acute myeloid leukem i a [85,86,87]. Based on the identification of activating Jak2 mutations in MPNs, great effort has been aimed at developing inhibitors that target Jak2 [88]. Accordingly, a number of small molecule Jak2 inhibitors, which have potent ial therapeutic efficacy against Jak2-mediated disorders, have been developed [89, 90,91,92,93,94,95, 96,97]. These com pounds inhibit the pathologic cell growth and signaling in cell lines transformed by Jak2 mutations in vitro in murine models in vivo and in bone marrow samples obtained from MPN patients and cultured ex vivo [89,97,98,99]. While some of these co mpounds are in preclinical stages of development [100], others are currently in clinical trials for the treatment of MPNs [89,101,102]. Early reports from thes e studies indicate that direct inhibition of Jak2 with small molecule inhibitor therapy improved some clinical measures such as spleen size and certain blood coun ts [101]. Side effects asso ciated with Ja k2 inhibitor therapy included fatigue, neurotoxicity, and ga strointestinal disturbances [101]. However, given the existing correlation between Jak2 kinase ac tivity and cardio vascular disease, perhaps changes in blood pressure or other cardiovascular readouts should be followed in these patients. In these studies, we hypot hesized that G6, a novel stilbenoid based inhibitor of Jak2 tyrosine kinase, has therapeutic efficacy in Jak2-mediated hematological disease pathogenesis. We also hypothesized that Jak2 plays a central role in the causation of Ang II-induced ca rdiovascular disease including hypertension and neointima formation. 22

PAGE 23

STAT STAT P P STAT STAT P P Transcription of genes involved in cell survival, migration and proliferation Jak Jak STAT STAT P P Cell Membrane Nuclear Membrane Ligandbinding to a cytokine receptor STAT STAT P P STAT STAT P P Transcription of genes involved in cell survival, migration and proliferation Jak Jak STAT STAT P P Cell Membrane Nuclear Membrane Ligandbinding to a cytokine receptor Figure 1-1. The Classical Jak/STAT Signalin g Pathway. Ligand binding causes cytokine receptors to dimerize which results in Jak phosphorylation, recruitment of the Signal Transducer and Acti vator of Transcription (STAT) signaling proteins, which are then tyrosine phosphorylated by the Jaks. The phosphorylated STATs dimerize, and translocate into th e nucleus where they bind to cisinducible promoter elements to st imulate gene transcription. 23

PAGE 24

Ang II activation of the AT1-R Jak2 P STAT STAT P P STAT STAT P P Transcription of genes involved in cell survival, migration and proliferationCell Membrane Nuclear Membrane Ang II activation of the AT1-R Jak2 P STAT STAT P P STAT STAT P P Transcription of genes involved in cell survival, migration and proliferationCell Membrane Nuclear Membrane Figure 1-2. Activation of the Jak2 signaling cascade via the AT1-receptor results in mitogenic growth responses. Angiotensin II binding results in phosphorylation of Jak2. Active Jak2 recruits and phosphor ylates STATs, which then dimerize, translocate into the nucleus, and mediat e the transcription of genes involved in cell survival, migration, and proliferation. 24

PAGE 25

Ca2+ MLCK MLCP Myosin p-Myosin Actin Contraction G PIP2 CaM DAG IP3+ PLC GAng II activation of the AT1-R Cell Membrane Ca2+ MLCK MLCP Myosin p-Myosin Actin Contraction G PIP2 CaM DAG IP3+ PLC GAng II activation of the AT1-R Cell Membrane Figure 1-3. The mechanism by which Ang II mediates vasoconstriction. The binding of Ang II to the AT1-R activates the heterotrimeri c G protein signaling pathway which leads to phospholipase C (PLC) activa tion. This releases inositol-1,4,5triphosphate (IP3) and diacylglycerol (DAG) from phosphatidylinositol 4,5bisphosphate (PIP2). IP3 binds to its receptor on the sarcoplasmic reticulum, allowing for Ca2+ efflux. Ang II also promot es an influx of external Ca2+ via calcium release activated calcium (CRAC) channels. Ca2+ binds to calmodulin and activates myosin light chain kinase (MLCK), which phosphorylates the myosin light chain and enhances the interaction between actin and myosin, resulting in enhanced vasoconstriction. 25

PAGE 26

26 Ca2+ MLCK MLCP Myosin p-Myosin Actin Rho Kinase Jak2 NOENDOTHELIAL CELL VASCULAR SMOOTH MUSCLE CELL Relaxation Contraction G Ang II activation of the AT1-R ROS Ca2+ MLCK MLCP Myosin p-Myosin Actin Rho Kinase Jak2 NOENDOTHELIAL CELL VASCULAR SMOOTH MUSCLE CELL Relaxation Contraction G Ang II activation of the AT1-R ROS Ca2+ MLCK MLCP Myosin p-Myosin Actin Rho Kinase Jak2 NOENDOTHELIAL CELL VASCULAR SMOOTH MUSCLE CELL Relaxation Contraction G Ang II activation of the AT1-R ROS Ca2+ MLCK MLCP Myosin p-Myosin Actin Rho Kinase Jak2 NOENDOTHELIAL CELL VASCULAR SMOOTH MUSCLE CELL Relaxation Contraction G Ang II activation of the AT1-R ROS Figure 1-4. Proposed mechanisms through which Jak2 mediates Ang II-dependent vasoconstriction. Ang II binding to the AT1-R activates Jak2 (it is not known whether this involves the Jak2 pool physically associated with the AT1-R). Activated Jak2 phosphorylates Arhgf1 re sulting in enhanced contraction via a Rho Kinase dependent mechanism. Jak2 is also believed to mediate intracellular increases in ROS. Higher levels of ROS increase intracellular Ca2+ sensitization, activate Rho Kinase, and scavenge endothelial nitric oxide all of which lead to enhanced VSMC contraction.

PAGE 27

CHAPTE R 2 2THE STILBENOID TYROSINE KINASE INHI BITOR, G6, SUPPRESSES JAK2-V617F MEDIATED HUMAN PATHOLOGICAL CELL GROWTH IN VITRO AND IN VIVO Hyper-kinetic Jak2 tyrosine kinase signali ng is a contributor to several human diseases including specific forms of leukemia, lymphoma, myeloma, and the myeloproliferative neoplasms (MPNs). MP Ns are clonal disorders of multipotent hematopoietic progenitors char acterized by increased hematopoiesis. The classic MPNs include polycythemia vera (PV), ess ential thrombocythaemia (ET) and primary myelofibrosis (PMF). A mutation resulting in a within the pseudokinase domain of Jak2 (Jak2-V617F) was identified in a la rge number of PV, ET, and PMF patients [80,81,82,83,84]. This mutation has also bee n reported in chronic myelomonocytic leukemia, myelodysplastic syndrome, systemic mastocytosis, chronic neutrophilic leukemia, acute myeloid leukemia, and eryt hroleukemia [85,86,87]. The mutation causes constitutive activation of the Jak2 signaling pathway when expressed in cells [81,82,83,84]. Furthermore, its expression in murine bone marrow results in a neoplastic phenotype [89,103,104]. Because of its pathogenicity in human di sease, the Jak2-V617F mutation is a target for therapeutic drug development. A number of laboratories have designed and/or identified small molecule inhibitors that have potential Jak2 therapeutic efficacy [89,90,91,92,93,94]. Additiona lly, our laboratory previously identified small molecule compounds with anti-Jak2 tyrosine kinase activity [95,96]. In our most recent work, 2Reproduced from Kirabo A, Embury J, Kiss R, Polgar T, Gali M, et al. (2011) The stilbenoid tyrosine kinase inhibitor, G6, suppresses Jak2-V617F-mediated human pathological cell growth in vitro and in vivo J Biol Chem 286: 4280-4291. 27

PAGE 28

structure-based virtual screeni ng was employed to identify a novel Jak2 inhibito r named G6 [97]. Using cell free systems, we found that G6 demonstrated good potency and specificity at suppressing Jak2-V617F kinase activity [97]. Based on that work, we hypothesized that G6 would have therapeutic efficacy agai nst Jak2-V617F mediated pathogenesis. Here, we tested this hypothe sis and found that G6 did indeed suppress Jak2-V617F mediated, human pathological cell growth in vitro and in vivo Materials and Methods Cell Culture Human erythroleukemia 92.1.7 (HEL) cells were purchased from ATCC (Rockville, MD). The cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum at 37C in a 5% CO2 humidified atmosphere. Cell proliferation assays, DNA cell cycle analysis, and annexin V/propidium iodide apoptotic levels were measured as we have described previously [96]. Phospho-STAT Analysis PhosphoSTAT1 [pY701], STAT3 [pY705 ], and STAT5a/b [pY694/699] ([pY694] for STAT5a and [pY699] for STAT5b) were sim ilarly measured using the STAT1, 3, 5a/b Phospho 3-Plex assay kit, a solid phas e sandwich immunoassay, following the manufacturers instructions (Invitrogen). T he spectral properties of the 3 bead regions specific for each analyte were monitored with a Luminex 100TM instrument. In vivo Animal Model The in vivo efficacy of G6 was determined usi ng a mouse model of Jak2-V617F mediated, human erythroleukemia. All ex perimental protocols were performed according to NIH standards established in the Guide for the Care and Use of Laboratory Animals and approved by the In stitutional Animal Care Use Committee at the University 28

PAGE 29

of Florida. This approach is outlined in Figure 2-1. Thirty six male adult (3 months old) NOD/SCID mice were purchased from Jackson Laboratory. After arrival and acclimation, baseline body we ights and peripheral blood samples were obtained and the mice were subsequently randomized into 6 groups (n=6 per group). Mice were inoculated intravenous ly via the lateral tail vein with 2 106 HEL cells expressing the Jak2-V617F mutation. Body weights and bl ood samples were obtained each week to monitor disease progression. Three weeks a fter HEL cell injection, the mice received daily intra-peritoneal injections of G6 at dosage rates of 0.1, 1 and 10 mg/kg/day, respectively, for 21 days. Three separate cont rol groups were also included. The first received HEL cells and subsequent daily in jections of vehicle alone (DMSO). The second group never received HEL cells, but received G6 at the 10 mg/kg/day dosage over the same three week period of drug adm inistration. The third group was completely nave to any treatment. After the three week period of drug or vehicle administration, all groups were euthanized by CO2 asphyxiation and cervical dislocation. Spleen weight to body weight ratios were obtained. A bone marrow aspirate from one femur was obtained for flow cytometry analysis and determi nation of HEL cell engraftment. Tissue samples (brain, lung, liver, kidney, spleen, and bone marrow) were fixed in 10% neutralbuffered formalin, embedded in paraffin, se ctioned, and stained with hematoxylin and eosin for histological analysis. Analysis of Peripheral Blood Cells A blood sample was obtained each week (~25 l) via sub-mandibular bleeding into a capillary tube. The samples were then smeared onto glass slid es and stained using DipQuick (Jorgensen Laboratories) Total white blood cell (W BC) counts, percentages of immature granular leukocytes, mono cytes and nucleated red blood cells (RBC) 29

PAGE 30

among the peripheral blood cells were counted via a light microscope by a veterinary pathologist. Histo-pathological Analy sis Hematoxylin and eosin stained sections ( liver, kidney, lung, brain, spleen, and bone marrow) were examined for normal histol ogical appearance as well as any lesions via standard light microscopy. Bone Marrow Flow Cytometry At the time of euthanasia, marrow was har vested from one femur and teased apart into single cell suspension in staining buffer by filtering it through a 50m nylon mesh following the manufacturers protocol (eBioscience). Cell suspensions were incubated on ice with APC conjugated ant i-human CD45 antibody (BD Bi osciences), washed, and subjected to flow cytometry. Bone Marrow Immunohistochemistry Immunochemistry was carried out on tissue fixed in 10% neutral-buffered formalin and paraffin-embedded. For detection of ac tive STAT5, mouse monoclonal anti phospho-STAT5a/b (Y694/99; Advantex BioR eagents LLP) was diluted 1:500 and incubated on sections overnight at 4C. Detection of the anti genantibody complexes was done by biotinylated secondary antibod ies and streptavidin-peroxidase complex (DAKO). Hematoxylin was used for counter staining. Antigen retrieval was done by heating (95C, 20 min) with the BioGenex AR10 re trieval buffer. The staining intensity was quantified using the NIS-El ement D software. Apoptotic cells in the tissue were identified via TUNEL. All TUNEL reagents were part of t he ApopTag Kit (Millipore). TUNEL-positive cells appeared as highly stained, brown nuclei against the methyl green counterstain. 30

PAGE 31

Pharmacokinetic and Pharmacod yna mic Analysis of G6 in Mice Baseline body weights and peripheral blood samples were obtained from threemonth-old male NOD SCID mice. The mice ( n= 12) were then injected in the tail vein with 2x106 HEL cells. Three weeks late r, peripheral blood samples were again obtained in order to confirm that the animals were in blast crisis. Once this was validated, the animals began receiving either vehicle control (DMS O) or G6 (1 mg/kg/day) via single, daily IP injections for the next 14 days ( n= 6 mice per group). The mice were subsequently euthanized and tissues (plasma, marrow, and spleen) were prepared. The concentration of G6 was determined via li quid chromatography-mass spectrometry using a quadratic standard curve ( r= 0.9902). Statistical Analysis Results are expressed as mean +/SEM. Statistical comparisons were performed by Students t test or the Mann-Whitney Rank Su m Test. Changes in peripheral blood cell counts and bone marrow cellularity followi ng HEL cell and drug treatment were analyzed by a repeated-measures ANOVA followed by Bonferroni and StudentNewman-Keuls post hoc test for multiple comparisons. p va lues of less than 0.05 were considered statistically significant. Results G6 Inhibits Jak2-V617F Dependent Human Erythroleukemia Cell Proliferation Using structure-based virtual screening, we recently identified a Jak2 tyrosine kinase inhibitor called G6 [97]. This st ilbenoid compound demonstrated good potency and specificity for Jak2 tyrosine kinase as it inhibited Jak2-V617F enzymatic activity (IC50 = 60 nM) while having no effect on c-Src ty rosine kinase activity at concentrations as high as 25 M [97]. Furthermore, it significantly inhibited the growth of cells whose 31

PAGE 32

proliferation was driven by the Jak2-V617F mutation while hav ing little to no effect on cells whose proliferation was driven by other mechanisms including a JAK3-A572V activating mutation, a c-Myc gene translocation, or immortalization via the SV-40 large T antigen [97]. As such, we hypothesized t hat G6 would suppress Jak2-V617F mediated pathological cell growt h. As a first estimate as to how well G6 could inhibit Jak2-V617F dependent pathologic cell growth, we utilized the HEL cell line in vitro This cell line is homozygous for the V617F mutation which induces constitutive Jak2 phosphorylation and drives HEL cell proliferation. Here, 5 x 104 HEL cells were treated with either DMSO or increasing concentrations of G6 for 72 hours. The num ber of viable cells was then determined. We found that G6 inhibited HEL cell grow th in a dose-dependent manner with an IC50 of ~4.0 M (Figure 2-2A). To determine if G6 could suppress HEL cell growth in a time dependent manner, cells were treat ed with 25 M of G6 for increasing periods of time. We found that G6 inhibited HEL cell grow th in a time dependent manner with 50% inhibition being achieved after ~12 hours of tr eatment (Figure 2-2B). We next wanted to determine whether the effects of G6 on HEL cell growth were reversible. For this, cells were exposed to 25 M of G6 for 0, 6, 24, 48 and 72 hours. At the end of each time point, the cells were collected, washed ext ensively, and allowed to grow for an additional 72 hours in the absence of any i nhibitor. Viable cell numbers were then determined. We found that for cells that were exposed to G6 for only 6 hours, nearly all of them were able to proliferate after drug removal (Figure 2-2C). Analysis of the recovery curve suggested that ~16 hours exposure to G6 prevented 50% of the cells from recovering. For those cells that we re exposed to G6 for 48 hours, virtually none 32

PAGE 33

were able to subsequently grow after the drug was removed from the media. This suggested that a 48 hour exposur e of the cells to G6 commi tted them to a fate from which they could not recover. Collectively, t hese data indicate that G6 inhibits HEL cell growth in both a doseand time-dependent m anner and expos ure of HEL cells to 25 M G6 for 48 hours is sufficient to prevent subsequent Jak2-V617F mediated, pathologic cell growth. G6 Suppresses HEL Cell Growth by Induc ing G1 Phase Cell Cycle Arrest and Apoptosis To determine the mechanism by which G6 reduces HEL cell growth, we first measured cell cycle properties as a function of G6 treatment. Specifically, 5 x 105 HEL cells were treated with G6 as a function of either dose or time Three independent experiments, each measured in triplicate, were averaged and the aggregate data were graphed as a function of G6 concentration or G6 exposure time. We found that G6 dose-dependently increased the per centage of cells in G1 phase (Figure 2-3A), decreased cells in S phase (Figure 2-3B), an d increased cells in apoptosis (Figure 23C). With respect to the time course study, we found that G6 promoted a timedependent increase in G1 phase (Figure 2-3D), a decrease in S phase (Figure 2-3E), and an increase in apoptosis (Figure 2-3F) when compared to DMSO control treated cells. The apoptosis measurements in Figures 2-3C and 2-3F represent fragmented DNA, which is only suggestive of late stage apoptosis. Therefore, to confirm this via alternate means, we used annexin V/propidi um iodide double staining. The values from three independent doseand time-course ex periments were tabulated and graphed. We found that G6 significantly induced apoptosis in both a dose(Figure 2-4A) and 33

PAGE 34

time(Figure 2-4B) dependent manner as measur ed by the number of cells that were annexin V positive and propi dium iodide negative. Collectiv ely, these data indicate that the mechanism whereby G6 reduces HEL cell growth is via marked cell cycle arrest and induction apoptosis. G6 Inhibits Jak2-V617F-Dependent Constitutive Acti vation of STAT5 We previously showed that G6 mediated re ductions in HEL cell numbers directly correlate with suppression of Jak2 kinase activity [97]. We now wanted to determine whether treatment with G6 and subsequent HEL cell growth inhibition also correlated with reduced STAT signaling. This is importa nt as it is possible that G6 could work through mechanisms that are independent of the Jak/STAT signaling pathway. Here, HEL cells were treated with either increasing concentrations of G6 or with 25 M G6 for increasing periods of time. The leve ls of phospho-STAT1 (pY701), phospho-STAT3 (pY705) and phospho-STAT5a/b (pY694/699) were then simultaneously measured. We found that the doseand time-dependent inhi bition of phospho-STAT1 had little to no correlation with the reduced levels of HEL cell growth (Figure 2-5A). The doseand time-dependent inhibition of phospho-STAT3 exhibited only a modest correlation with the reduced levels of HEL cell growth (Fi gure 2-5B). Finally, we observed that the doseand time-dependent inhibition of phosphoSTAT5a/b correlated very well with the G6-dependent inhibition of HEL cell growth (F igure 2-5C). Thus, these results suggest that STAT1, STAT3 and STAT5a/b are differ entially affected by G6 treatment, with STAT5 being the most sensitive. Furthermore, the r eductions in phospho-STAT5 correlate very well with G6 mediated reducti ons in HEL cell growth and inhibition of Jak2 kinase activity [97]. As such, our data suggest that G6 inhibits HEL cell growth via a Jak2/STAT5 dependent mechanism. 34

PAGE 35

G6 Reduces Blast Cells in the Peripheral Blood and the Spleen Weight to Body Weight Ratio in a Murine Model of Jak2-Dependent, Human Er ythroleukemia To test the in vivo efficacy of G6 at inhibiting Jak2-V617F pathologic cell growth, we generated a mouse model of human er ythroleukemia by injecting 2 106 HEL cells expressing the Jak2-V617F mutation into the tail vein of immuno-deficient NOD/SCID mice. We then treated the mice with incr easing concentrations of G6 in order to determine the therapeutic efficacy of the st ilbenoid compound. Mice injected with HEL cells followed by vehicle control injections rapidly developed a fully penetrant hematopoietic disease. Specifically, we found that injection of HEL cells resulted in the pathological appearance of blast cells in the peripheral blood and G6 treatment significantly reduced this pathological e ffect, in a dose-dependent manner (Figure 26A). To determine the efficacy of G6 at inhibi ting Jak2-dependent erythroleukemia via alternate means, spleen weight to body weight ratios were determined. We found that HEL cell injection and subsequent administrati on of vehicle control solution resulted in an increased spleen weight to body weight ratio and this deleterious effect was abrogated with G6 treatment (Fig ure 2-6B). These data indi cate that G6 suppresses Jak2-V617F mediated pathologic cell growth in vivo as evidenced by reduced blast cells in the peripheral bl ood and reduced spleen weight to body weight ratios. G6 Corrects a Pathologically Low Myeloi d to Erythroid Ratio by Reducing the Number of Human Erythroleukemia Cells in the Bone Marrow of Mice The in vivo anti-tumor activity of G6 was further investigated using histopathological analysis. Tissue sections fr om brain, liver, lungs and kidney appeared histologically normal and indistinguishable ac ross all six treatment groups suggesting that G6 is not globally cytotoxic even at the 10 mg/kg dosage (data not shown). 35

PAGE 36

Howeve r, quantification of cellular el ements of the bone marrow revealed marked changes; representative histological sections for each treatment group are shown (Figure 2-7A). In mice that received HEL cells followed by vehicle control, two distinct populations of neoplastic cells were observ ed. The first were consistent with erythroblast morphology. These cells were approximately 15 m with a dark gray blue round nucleus and moderate, bl uish cytoplasm (black arrows). The second population of cells was myeloid blasts (monoblasts or myeloblasts). These atypical myeloid cells were large (15-20 m) with irr egular nuclei that were frequently clefted. The chromatin pattern was finely stippled and lacy. Nucleoli were prominent and occasionally multiple. The nuclear to cytoplasmic rati o was high and the cytoplasm was pink (white arrows). The absolute numbers of myeloid and eryt hroid cells for each treatment group were determined (Figure 2-7B) and subsequently plotted as the myeloid to erythroid (M:E) ratio (Figure 2-7C). For the nave group of animals, the M:E ratio was ~1.4 (Figure 2-7C). Injection of HEL cells and subsequent treatment with vehicle control caused a significant reduction of the M:E ratio that was driven by myeloid suppression and increased numbers of erythroid cells. The 0.1 mg/kg dosage of G6 was without effect on the cellular composition of t he bone marrow as evidenced by the unchanged M:E ratio. However, for the 1 and 10 mg/kg doses, there was a significant correction of the M:E ratio that was driv en by restoration of myeloid cells and suppression of erythroid cells. With respect to the mice that received G6 alone, we observed a small reduction in erythroid cell num bers and a moderate reduction in myeloid cells. However, the M:E ratio of this group was not significantly different from that of the nave mice. 36

PAGE 37

We reasoned that the ther apeutic correction of the M: E ratio by G6 was due to reductions in the engraftment of the Jak2-V 617F expressing, human erythroleukemia cells in the bone marrow. To validate this we carried out flow cytometry analysis of bone marrow aspirates from the various treat ment groups in order to identify the percentage of cells that were human CD45 positive; a marker found on HEL cells, but not any mouse cells (data not shown). T he aggregate data for all animals were graphed as a function of treatment group (Figure 2-7D). We found that HEL cell injection alone resulted in robust bone marrow engraftment as evidenced by the appearance of human CD45+ cells in the aspirates. The 0. 1 mg/kg dose appeared to be without effect. Starting at the 1 mg/kg dosage however, there was an observable decrease in the percentage of human CD45+ cells am ong bone marrow mononuclear cells. Overall, the data in Fig. 2-7 demonstrate that intravenous injection of HEL cells into NOD/SCID mice results in marked Jak2-V617F mediated pathogenesis as evidenced by a skewing of the M:E ratio and the engraftment of the human leukemic cells in the bone marrow. However, G6 co rrected these pathologies as evidenced by reduced numbers of leukemic cells in the bone marrow and subsequent correction of the M:E ratio. G6 Reduces the Levels of phospho-STAT5 and Induces Cellular Apoptosis in vivo The data in Figures 2-2 to 2-5 demonstrate that in vitro, G6 suppresses pathologic HEL cell growth via a mechanism that invo lves inhibition of STAT5 phosphorylation and induction of apoptosis. We hypothesized that this also occurs i n vivo. To confirm this, we performed antiphospho STAT5a/b i mmuno-histochemistry on bone marrow sections of animals in all the treatment groups. Representative sections from all 37

PAGE 38

treatment groups are shown (Figure 2-8A). The relative phospho-STAT5 signal (brown colored stain) was then quantitated and graphed as a func tion of treatment group (Figure 2-8B). We found that HEL cell inje ction alone resulted in a significant increase in phospho-STAT5 staining, suggestive of an increased proliferative state. However, G6 treatment at the 1 and 10 mg/kg doses si gnificantly reduced this effect, suggesting that G6 suppresses STAT5 phosphorylation in vivo To determine whether G6 induces apoptosis in vivo bone marrow sections were analyzed via TUNEL staining. Representative sections fo r the six groups are shown (Figure 2-8C). The number of TUNEL pos itive cells per grid were then counted and plotted as a function of treatment group (F igure 2-8D). We f ound that G6 induced apoptosis in a dose-dependent manner. Overall, the data in Figure 2-8 demonstrate that in vivo G6 inhibits STAT5 phosphorylation and induces cellular apoptosis, two events that are essential for suppressing Ja k2-V617F mediated pathologic cell growth. G6 Treatment Results in Leukemic Regression and Normalization of Hematopoiesis in the Spleen To determine the effect of G6 on the spleen, histological sections were prepared and viewed at 10X (Figure 2-9A) and 100X (F igure 2-9B) magnifications. Mice that received HEL cells + DMSO displayed neoplas tic erythroid morphology when compared to nave animals. Specifically, we observ ed large cells with lacy, vesicular chromatin (white arrows). Mice that received HEL cells and the 0.1 mg/kg/day dosage exhibited fewer neoplastic cells. Mice receiving HEL cells and the 1 and 10 mg/kg/day dosages of G6 had even fewer neoplastic cells as well as increasing megakaryopoietic activity, signs of leukemic regression and normalization of hematopoiesis. Finally, in the cohort 38

PAGE 39

of mice that received G6 alone, four of the spleens were histologically normal, but two displayed some necrosis and edema. To obtain a quantitative meas ure for the efficacy of G6 in the spleen, the number of pathological erythroblast foci was dete rmined by computer assisted morphometric analysis using a standard microscope and then pl otted as a function of treatment group (Figure 2-9C). We found that G6 treatment provided signif icant therapeutic benefit as evidenced by a significant reduction in the number of erythroblast foci. Furthermore, these results had a positive correlation with spl een size; namely, the reduction in splenic erythroblast numbers directly correlated with decreased spleen size. Thus, the data in Figure 2-9 suggest that G6 provides therapeut ic benefit to the spleen in a mouse model of Jak2-V617F mediated human erythroleukemia. The Presence of G6 in the Plasma, Marrow and Spleen Correlates with Indicators of Therapeutic Efficacy Finally, we wanted correlate the presence of G6 in hematopoietic tissues with indicators of therapeutic efficacy. For this baseline body weights and peripheral blood samples were obtained from twelve NOD-SC ID mice. The mice were subsequently injected, intravenously, with 2x106 HEL cells. Three weeks later, peripheral blood samples were again obtained to confirm that t he animals were in blast crisis, at which time the animals began receivi ng either vehicle control (DMSO) or G6 (1 mg/kg/day) via single, daily IP injections. After 2 weeks of injection, analysis of peripheral blood samples indicated that the G6 -treated mice had significantly fewer blast cells in the peripheral blood when compar ed with the DMSO-injected mice (Figure 2-10A). The mice were euthanized the following day, and t he spleen weight to body weight ratios were determined for both treatment groups (F igure 2-10B). We found that for the mice 39

PAGE 40

that received G6, the spleen weight to body weight ratio was reduced by ~40% when compared with the mice that received vehicl e control. To correlate these efficacious indicators to the presence of G6, the c oncentration of G6 in the plasma, marrow and spleen was determined. Analysis of the plasma samples that were collected at baseline and after HEL cell injection, but prior to any vehicle/drug injection, completely lacked G6 (data not shown). For the te rminal plasma samples that were collected at euthanasia along with the marrow and spleen, G6 was completely absent in the samples that came from vehicle control-injected mice, but pres ent in the samples that came from G6treated mice (Table 2-1). Overall, the dat a in Figure 2-10 and Table 2-1 correlate therapeutic efficacy in the form of decreased blast cells in the peripheral blood and reduced spleen weight to body weight ratios with the presence of G6 in the plasma, marrow and spleen. Discussion The main finding of this work is th at G6 suppresses Jak2-V617F mediated hyperplasia, in vitro and in vivo Chemically, G6 is classified as a stilbenoid. Stilbenoids are diarylethenes, that is, a hydrocarbon consisting of an ethene double bond substituted with a phenyl group on both ca rbon atoms of the double bond. Stilbenoids are known to have beneficial properties includi ng anti-oxidative, anti-proliferative, and tumor suppressive effects [ 105,106,107]. Resveratrol, a nat urally occurring stilbenoid found in the skin of red grapes, reduces the incidence of cardiovascular disease [108]. Piceatannol, a naturally o ccurring phenolic stilbenoid, exhibits anti-tyrosine kinase activity. Specifically, it inhibits LMP2A, a tyrosine kinase associated with Epstein-Barr virus infections [109,110]. The significance of these reports is that there is marked 40

PAGE 41

precedent for stilbene compounds such as G6 possessing beneficial biological activity in general, and anti tyrosine kinase activity in particular. Evaluation of the in vivo data suggests that we hav e identified dosages of G6 that range from sub-therapeutic through toxic. Specifically, the 0.1 mg/kg/day dosage provided some observable benefit. This low dosage reduced the percentage of blast cells in the peripheral blood and leukemic cells in the spleen. However, it was unable to alleviate the splenomegly or significantly reduce the numbers of HEL cells in the marrow. The 1 mg/kg/day dosage was highly therapeutic as evidenced by reductions of blast cells in the peripheral blood, reduced sp lenomegaly, elimination of HEL cells from the marrow with correction of the M:E ratio, leukemic regression in the spleen, and signs of return of normal hematopoiesis. Additionally, animals treated at this dose displayed absolutely no signs of histologic al toxicity. Finally, while the 10 mg/kg/day dosage clearly provided leukemic therapeutic benefit, one animal receiving this dose exhibited some splenic necrosi s. However, the brains, lungs, kidneys, and livers from all these animals were histologically norma l, indicating the G6-mediated cytotoxicity might be targeted to hematopoietic organs at th is dose. For the mice that received the high dose of G6 alone, the marrow was hypo-ce llular with two of six animals exhibiting some bone marrow necrosis. Overall, the sp leen weight to body weight ratio for this cohort was increased (Figure 2-6B). Two of the six spleens fr om this group were necrotic and edematous. However, the brains lungs, kidneys, and livers from these mice were histologically normal. As such the data suggest that when given alone at the 10 mg/kg/day dosage, G6 can be cytot oxic to hematopoietic tissues. 41

PAGE 42

An important consideration is under standing the precise linkage between G6mediated Jak2 inhibition, suppression of STAT5 phosphorylati on and apoptosis within HEL cells as it relates to our xenograft model. Jak2/STAT signaling is known to positively regulate cell growth by directly increasing expression of the anti-apoptotic marker, Bcl-xL, via STAT-binding elements lo cated in its proximal promoter region [111,112]. In a recently published work, we repor ted that G6 inhibits HEL cell growth via the down regulation of Bcl-xL and this correlates with significantly reduced phosphoSTAT5 levels [113]. Furthermore, we showed t hat G6 treatment of HEL cells results in upregulation of pro-apoptotic Bim, and cleavage of pro-apoptotic Bid, from its inactive precursor to its active form [113] In our work here, we show that G6 treatment results in reduced STAT5 phosphorylation within HEL cells (Figure 2-5C) and within the bone marrow (Figure 2-8A and 2-8B). Additionally, we show here that tr eatment of HEL cells with G6 results in increased apoptosis (Fi gure 2-4A and 2-4B), and a dose-dependent increase of apoptosis levels within the bone ma rrow of treated mice (Figure 2-8C and 28D). As such, we believe that the underlyin g mechanism that allows G6 to provide therapeutic efficacy involves the direct inhibition of Jak2, the corresponding suppression of STAT5 phosphorylation, and apoptosis. Recent works have reported paradoxical effects regarding the efficacy of Jak2 inhibitors when tested in vitro versus in vivo For example, while the Jak2 inhibitor CEP701 exhibited good Jak2 efficacy in vitro Santos et al. reported it faile d to improve the marrow fibrosis or alleviate the burden of marrow derived Jak2-V617F mutant clones in humans suffering from PMF [114]. Similarl y, while the Jak2 inhibitor INCB16562 exhibited good Jak2 efficacy in vitro Koppikar et al reported that it was unable to 42

PAGE 43

reduce the number of maligna nt clones in the bone marrow using a mouse model of MPLW515L-induced th rombocytosis and myelofib rosis [115]. Finally, while the Jak2 inhibitor compound CYT387 ex hibited good Jak2 efficacy in vitro [93], work by Tyner et al showed that it was unable to e liminate Jak2-V617F mutant clones in vivo using a murine myeloproliferative neoplasm model [100]. Our work here is significant in that we show that G6 not only exhibits excellent therapeutic efficacy in vitro but also in vivo as measured by the critical elimi nation of mutant clones from t he marrow of mice (Figure 28D) and a corresponding correction of the M:E ra tio (Figure 2-7C). As such, this work suggests that stilbenoid based compounds su ch as G6 may possess unique Jak2 inhibitory properties that previous pyri midine based compounds lack. In summary, we show that the stilbenoid compound, G6, has therapeutic efficacy against Jak2-V617F mediated human pathogenesis in vitro and in vivo As such, this compound may have practical applications in Jak2-related re search and as a potential therapeutic agent. 43

PAGE 44

-1 0 1 2 3 4 5 6 HEL cells, IV 2x106 cells NOD/SCID, N = 36 6 groups (n=6) Blood sample Body weight G6/DMSO IP 1.No treatment 2.HEL+DMSO 3.HEL+0.1mg/kg G6 4.HEL+1.0mg/kg G6 5.HEL+10mg/kg G6 6.10mg/kg G6 Daily Euthanized Weeks Weight + Blood Sample weekly Figure 2-1. Model of Jak2-V617F mediated, human erythroleukemia: Four of the six groups (2, 3, 4, and 5) received 2 x 106 HEL cells via a single tail vein injection at Day 0. The disease was al lowed to progress for 3 weeks at which time the mice began receiving daily inje ctions of either vehicle control (DMSO) or G6 at the dosages of 0. 1, 1, and 10 mg/kg/day for the next 21 days. 24 hours after the last inje ction, the mice were euthanized and prepared for analysis. 44

PAGE 45

Number of viable cells (% Control)Time (Hours) Initial Exposure Time to G6 (Hours)B C AG6 ( M) 020406080 0 40 80 120 0.010.1110100 0 40 80 120 Number of viable cells (% Control) Number of viable cells (% Control) 02040608 0 0 40 80 120 Figure 2-2. G6 inhibits Jak2-V 617F dependent HEL cell proliferation, in vitro A) HEL cells were treated with increasing doses of G6 for 72 hours and the number of viable cells was determined. B) HEL cells were treated 25 M of G6 for 0, 6, 24, 48 and 72 hours and cell numbers were determined. C) HEL cells were treated with 25 M of G6 for 0, 6, 12, 24, 48 and 72 hours. At the end of each time point, the cells were placed in medi a lacking inhibitor fo r an additional 72 hours. The number of viable cells was then determined. Shown are mean +/SEM for three independent experiment s, each run in triplicate. 45

PAGE 46

051015202530 40 45 50 55 60 65 70 75 80 051015202530 15 20 25 30 35 40 051015202530 5 10 15 20 25 30 35 020406080 20 30 40 50 60 70 80 G6 DMSO 020406080 15 20 25 30 35 40 45 G6 DMSO 02040608 0 5 10 15 20 25 30 35 40 G6 DMSO Time (hours) Time (hours) Time (hours) G6 (M) G6 (M) G6 (M)G1 Phase (%) G1 Phase (%) S Phase (%) S Phase (%) Apoptosis (%) Apoptosis (%)A D BC F E Figure 2-3. G6 suppresses HEL cell growth by inducing G1 phase cell cycle arrest. HEL cells were treated with increasi ng doses of G6 for 72 hours or with 25 M G6 for increasing times. Cellula r DNA contents were then determined by flow cytometry. Three i ndependent experiments, each measured in triplicate, were averaged and the aggregate cell cycle data were graphed as a function of A-C) G6 concentration or D-F) G6 exposure time. Shown are the percentages of cells in G1 phase (A,D), S phase (B, E) and apoptosis (C, F). Shown are mean +/SEM. 46

PAGE 47

01020304050 0 5 10 15 20 25 Apoptosis (%)Time (Hours)B 0 5 10 15 20 25 30 35 0.010.1110100Apoptosis (%)G6 ( M)A Figure 2-4. G6 induces the intrinsic apopt otic pathway in HEL cells. For apoptotic measurements, A nnexin V/propidium iodide double staining was employed. The values from three independent A) dose response or B) time course experiments were graphed. 47

PAGE 48

0 1 2 3 4 5 6 7 0.5 1.5 2.50 hr 12 hr24 hr48 hr 72 hrG6 MP-STAT1 (units/ml) P-STAT1 (units/ml)* *0 3 .1256.259.37512.525 0 5 10 15 20 25 30 0 5 10 15 20 25 30 35P-STAT3 (units/ml) P-STAT3 (units/ml)03.1256.259.37512.525G6 M0 hr 12 hr24 hr48 hr 72 hr* * 0 10 20 30 40 50 60 70 80 0 20 40 60 80 100 120P-STAT5 (units/ml)03.1256.259.37512.5 25G6 MP-STAT5 (units/ml)0 hr 12 hr24 hr48 hr 72 hr* ** ** ** ** **C B A Figure 2-5. G6 preferentially inhibits Ja k2-V617F dependent constitutive activation of STAT5. HEL cells were treated with either increasing concentrations of G6 or with 25 M G6 for increasing periods of time. The levels of phospho-STAT1 (pY701), phospho-STAT3 (pY705) and phospho-STAT5a/b (pY694/699) were then simultaneously measured. Doseand time-dependent inhibition of A) phospho-STAT1, B) phospho-STAT3, and C) phospho-STAT5a/b are shown. *, p < 0.05 versus DMSO control. 48

PAGE 49

05101520 0 5 10 15 20 HEL+DMSO HEL+0.1 mg/kg G 6 HEL+1 mg/kg G6 HEL+10 mg/kg G6 % Blast Cell Counts Days of G6 Treatment * * 0.002 0.0022 0.0024 0.0026 0.0028 0.003 0.0032Na ve S CID H EL+D M S O HE L +0. 1 mg/k g G6 HEL+1 mg/kg G6 HEL+10 mg/kg G6 10 mg/kg G 6Spleen Wt : Body Wt Ratio# # # **B A Figure 2-6. G6 decreases the percentage of blast cells in the peripheral blood and reduces the spleen weight to body wei ght ratio in a mouse model of Jak2V617F mediated human erythroleukemia. A) Percentages of blast cells in the peripheral blood plotted as a function of both treatment group and days of treatment. *, p < 1.0 x10-4 vs. DMSO treated mice. B) The spleen to body weight ratio was obtained and plotted as a function of treatment group. #, p < 0.05 vs. nave mice; *, p < 0.05 versus. HEL+DMSO. 49

PAGE 50

Nave NOD-SCIDHEL + DMSOHEL + 0.1mg/kg G6 HEL + 1mg/kg G6HEL + 10mg/kg G610mg/kg G6 40 60 80 100 120 140 160 180Nave SCI D HEL + DMS O HE L +0.1 m g /kg G 6 HEL + 1 mg /k g G 6 HEL+10 mg/kg G 6 1 0 mg/kg G 6 Number of Cells Myeloids Erythroids 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6Na v e SC I D H EL + DMS O HEL+ 0 .1 mg/kg G 6 H E L+1 mg/k g G 6 H EL +1 0 m g/ kg G 6 1 0 m g/ kg G 6 M:E Ratio# # # #* * * *##** 0 5 10 15 20 25HEL+DMS O HEL+0.1 m g / kg G 6 HEL+1 mg/kg G6 HEL+10 mg/ k g G 6 10 m g /k g G 6 Human CD45+ Cells (%) AD B C Figure 2-7. G6 improves the M:E ratio in a mouse model of Jak2-V617F mediated human erythroleukemia by reducing HEL cell engraftment in the bone marrow. After a three week period of drug or vehicle administration, all groups were euthanized and histological sections of the femurs were prepared. A) Represent ative H&E stained bone marrow sections for each treatment group. B) The number of ma ture myeloid and erythroid cells was determined. #, p < 0.05 relative to nave ; *, p < 0.05 relative to HEL+DMSO. C) The myeloid and erythroid cell number s plotted as the M:E ratio. #, p < 0.05 relative to nave; *, p < 0.05 re lative to HEL+DMSO. D) The average percentages of human CD45+ cells pres ent in the bone marrow were plotted as a function of tr eatment group. 50

PAGE 51

Nave NOD-SCID HEL + DMSO HEL + 0.1mg/kg G6 HEL + 1mg/kg G6 HEL + 10mg/kg G6 10mg/kg G6 0.006 0.008 0.01 0.012 0.014N a ve S C I D H E L+DMS O H E L +0.1 m g / k g G 6 H E L+ 1 mg /k g G 6 HEL + 10 mg/kg G 6 10 mg/kg G 6 Phospho-STAT5* *# # # Nave NOD-SCID HEL + DMSO HEL + 0.1mg/kg G6 HEL + 1mg/kg G6 HEL + 10mg/kg G6 10mg/kg G6 0 20 40 60 80N a v e SCI D HE L+DMS O HEL+0. 1 mg /kg G 6 HE L+ 1 m g /kg G 6 H EL +10 mg / k g G 6 10 mg/kg G 6 # of TUNEL Positive Cells* *A B CD Figure 2-8. G6 reduces the levels of phos pho-STAT5 and induces ce llular apoptosis in the bone marrow. A) Represent ative anti phospho-STAT5 immunohistochemistry bone marrow sections from the indicated treat ment groups. B) Anti phospho-STAT5 stai ning was quantified and plotted as a function of treatment group. *p < 0.05 versus nave; #p < 0.05 versus HEL+DMSO. C) Representative TUNEL stained bone marrow sections from each treatment group. D) Bone marrow TUNEL positive cells were counted and plotted as a function of treatment group. *p < 0.05 versus HEL+DMSO. 51

PAGE 52

Nave NOD-SCID HEL + DMSO HEL + 0.1 mg/kg G6 HEL + 1 mg/kg G6HEL + 10 mg/kg G6 10 mg/kg G6 Nave NOD-SCID HEL + DMSO HEL + 0.1mg/kg G6 HEL + 1mg/kg G6 HEL + 10mg/kg G6 10mg/kg G6 Erythroblast Foci ( M2)*# ## # 0 1000 2000 3000 4000 5000 6000 7000N a v e SCI D H E L +D M S O HEL+0.1 mg/kg G 6 H E L +1 m g / k g G 6 H E L +1 0 m g /kg G 6 10 mg/kg G6AC B Figure 2-9. G6 treatment results in leukemic regression and normalization of hematopoiesis in the spleen. Histologi cal sections of the spleen were prepared from each treatment group and vi ewed at A) 10X magnification and B) 100X magnification. In jection of HEL cells resulted in the appearance of neoplastic cells in the spleen (arrowheads in panel B) and this was reduced with G6 treatment. C) The number of erythroblast foci were counted and plotted as a function of treatment group. *p < 0.05 versus nave; #p < 0.05 versus HEL+DMSO. 52

PAGE 53

Figure 2-10. Therapeutic indicators of G6 e fficacy correlate with the present of G6 in the plasma, marrow, and spleen. A) Percentages of blast cells in the peripheral blood plotted as a function of both treatment group and time. *, p 0.05 versus DMSO-treated mice. B) Spl een to body weight ratio was obtained and plotted as a function of treatment group. 53

PAGE 54

54 Table 2-1. Mass spectrometry results sho wing plasma and tissue concentrations of G6 at euthanasia. a Average of replicate injections. b Calculations based on average of four replicate inject ions back-calculated using analyte concentrations (mg/ml) divided by prepared tissue concentration (g/ml) resulting in mg/g of tissue concentrations. c <0 indicates peak quantitates were below t he 0 value of the standard curve. No Peak indicates no peak was observed in raw chromatography.

PAGE 55

CHAPTE R 3 THE JAK2 INHIBITOR, G6, A LLEVIATES JAK2-V617F MEDIATED MYELOPROLIFERATIVE NEOPLASIA BY PR OVIDING SIGNIFIC ANT THERAPEUTIC EFFICACY TO THE BONE MARROW Polycythemia vera (PV), essential thrombocythemia (ET), and primary myelofibrosis (PMF) are myeloproliferative neoplasms (MPN) lacking the Philadelphia chromosome. They are caused by the transf ormation of an early hematopoietic stem cell resulting in abnormal hematopoiesis [116,117]. These disorders are categorized according to the syndromes caused by the terminally differentiated hematopoietic cells such as increased production of red blood ce lls (PV), platelets (ET), and neutrophils with concomitant fibrosis of the bone marrow tissue (PMF). Clinically, these diseases are characterized by patholog ical peripheral blood syndromes such as leukocytosis, erythrocytosis, and thrombocytosis. These syndromes predispose patients to vascular diseases such as thrombosis, atheroscl erosis, coronary heart disease and cerebral ischemia [118,119,120,121,122]. In addition, patients with MPNs often have high levels of circulating inflammatory cytokines, such as interleukin-6 (IL-6) which have been associated with symptoms such as cachex ia and listlessness [123,124,125,126,127]. Moreover, MPNs can often transform to acute myeloid leukemia (AML ) [127]. Although these disorders can be fatal with a life expect ancy that can be as few as 5 years [128], currently available treatments are limited. The discovery of the Jak2-V617F mutation in most patients with MPN spurred the development of small molecule Jak2 inhibi tors via molecularly targeted drug discovery. In preclinical experiments, many of these small molecules exhi bited potent inhibition of Jak2-mediated pathological cell growth. Some have subsequently progressed to clinical trials where they exhibited some benefit by reducing clinical symptomologies associated 55

PAGE 56

with the MPN phenotype [129]. Ho weve r, none of these inhibitors have been reported to be curative as they have little to no e fficacy in the bone marrow and there is often a relapse of the clinical dis ease manifestations after withdr awal of treatment. Thus, current Jak2 inhibitors are largely palliativ e as they are unable to eradicate the Jak2 mutant burden in the bone marrow, which is t he primary predilectio n site of the MPN disease pathogenesis. Recently, we developed a st ilbenoid small molecule Jak2 inhibitor, G6, which exhibits potent inhibition of Jak2-V617F mediat ed pathological cell growth in vitro and ex vivo [96,112]. We subsequently reported that G6 has therapeutic potential in a NODSCID mouse model of Jak2-V 617F mediated hyperplasia as it eliminated the burden of tumorigenic Jak2-V617F cells from the host bone marrow [131]. Therefore, we hypothesized here, that G6 would be e fficacious against Jak2-V617F-mediated myeloproliferative neoplasia by providing si gnificant efficacy to a number of tissues including the bone marrow. To test this, we utilized a transgenic mouse model of Jak2V617F mediated myeloproliferative neoplasia and found that G6 treatment greatly alleviated the MPN phenotype by providing significant therapeutic benefit to the peripheral blood, liver, spleen and most notably, the bone marrow. As such, G6 appears to alter the natural history of Jak2-V617F mediated myeloproliferative neoplasia by providing significant effi cacy to the bone marrow where other Jak2 inhibitors have not. Materials and Methods Animals Transgenic male mice expressing the Jak2-V617F mutated enzyme in the hematopoietic system driven by the vav promoter and generat ed on a C57BL/6 56

PAGE 57

background strain were used in these ex periments [103]. All animal procedur es were approved by the Institutional Animal Care and Use Committee at the University of Florida. Animals were maintained in acco rdance with NIH standards established in the Guidelines for the Care and Use of Experimental Animals The transgenic mice were identified by PCR usin g primers TACAACCTCAGT GGGACAAAGAAGAAC and CCATGCCAACTGTTTAGCAACTTCA wh ich cover a 594 base-pair region in the coding sequence of Jak2-V617F [103]. At 3 months of age, a baseline peripheral blood sample was obtained from each mouse via sub-mandibular bleeding. The mice were then injected with either vehicle (n=6) or 10 mg/k g/day of G6 (n=6) fo r 28 days. Other blood samples were subsequently obtained after 14 and 28 days of vehicle or G6 treatment. Analysis of Peripheral Blood Cells Blood samples were obtained (~50 l) via sub-mandibular bleeding into tubes containing potassium salt of ethyl enediamine tetraacetic acid. Complete blood counts were obtained using a HESKA Vet ABC-Diff Hematology analyzer. Blood samples were then smeared onto glass slides and stai ned using DipQuick (Jorgensen Laboratories Inc. Loveland, CO). Interleukin-6 Analysis Blood samples were obtained (~50 l) via sub-mandibular bleeding into tubes containing potassium salt of ethylenediamine tetraacetic acid. Plasma was centrifuged at 10 000 g for 10 minutes and then stored at -80C for subsequent analysis. Plasma levels of IL-6 were measured using a comm ercially available mouse ELISA kit (Ray Biotech) according to the manufacturers instructions. 57

PAGE 58

Histological Analy sis Tissues (liver, spleen, and bone marrow) we re fixed overnight in formaldehyde. Femurs were decalcified for 16 hours. The tissues were subsequently dehydrated through a graded ethanol series, paraffin embedded and sectioned (4 m). The tissues were then stained with hematoxylin and eosin (H&E), and they were examined for normal histological appearance as well as any lesions via standard light microscopy by two independent veterinary pathologist bli nded to treatment groups. Bone marrow analysis was done acco rding to established guidelines [130]. The bone marrow was evaluated for necrosis, fibrosis, hemorrhage overall cellularity, M: E ratios and megakaryocytic counts. All ce ll counts were made at 600X HPF. Spleen se ctions were examined for evidence of extr amedullary hematopoies is (EMH) and a quantitative analysis of megakaryocytes was made. Live r sections were ex amined for evidence of EMH at 40X. Immunohistochemistry Immunohistochemistry on bone marrow samples was carried out as previously described [131]. Briefly, 5 m sections m ounted on gelatin-coated slides were dewaxed in ethanol, rehydrated, then blocked in 3% H2O2 followed by 5% normal goat serum. Sections were exposed to the primary antibody including anti-Jak2 (ab39636 Abcam), anti-phospho-Jak2 (Ab32101 Abcam), or anti-phospho-STAT5 (Ab32364 Abcam) overnight at 4oC. The sections were washed, and then treated with the biotinylated secondary antibody. After secondary antibody incubation, the samples were washed, exposed to the avidin-peroxidase reagent (Vectastain Elite, Vector Laboratories, Burlingame, CA), and reacted with diami nobenzidine to produce a brown reaction product. The sections were dehydrated in ethanol, mounted with Permount, and observed by light microscopy. 58

PAGE 59

Determination of Jak2-V617F Allele Burden in the B one Marrow RNA was isolated from bone marrow using the RNeasy Mini Kit (QIAGEN) and DNA contamination was removed using the RNase-free DNase set (QIAGEN). cDNA was synthesized using the high capacity cD NA Reverse Transcription Kit (Applied Biosystems) on 2 g RNA, at 60 C. Real-time PCR was performed in a Multicolor RealTime PCR Detection System using TaqMan gene expression assays (Applied Biosystems). PCR amplifications were performed in duplicate for human Jak2 (Hs01078124_m1) and mouse Jak2 (Mm00434577_m1) along with parallel measurements of mouse -actin cDNA as an internal c ontrol. The copy number of the human Jak2 sequence relative to actin was calculated using a standard curve technique. The allele burden wa s computed by calculating the ratio of the human Jak2 to the mouse Jak2 in the transgenic mice. Clonogenic Assay To determine the effectiveness of G6 in preventing the cytokine-independent survival and proliferation of bone marrow cells obtained from t he transgenic mice, bone marrow cells from Jak2-V617F transgenic mice were harvested, cultured ex vivo and exposed to 25 M of G6 for the indicated periods of time. The drug was then washed away from the cells and they were pl ated in MethoCult media lacking EPO and TPO. Five days later, the number of CFU-GM and CFU-E were counted and plotted as a function of treatment group. Statistical Analysis All results were expressed as mean +/ SEM. Statistical comparisons were performed by Students t test. Changes in peripheral blood cell counts were analyzed by a repeated-measures ANOVA followed by Bonferroni and Student-Newman-Keuls post 59

PAGE 60

hoc test for multiple comparisons. p values of less than 0.05 (2-t ailed) were considered statistically significant. Results G6 Provides Therape utic Benefit in Peripheral Blood of Jak2-V617F MPN Mice Here, we employed a previously estab lished transgenic mouse model of Jak2V617F mediated myeloproliferative neoplasia [133]. These mice express the human Jak2-V617F cDNA under the control of the marrow stem cell promoter, vav They exhibit a number of phenotypes that rec apitulate those observed in human MPN including constitutive Jak/STAT signa ling, myeloid neoplasia, leukocytosis, thrombocytosis, erythrocytosis, and splenom egaly. Complete blood counts (CBC) were first performed on three month old male mice to confirm the MPN phenotype. Mice fully manifesting the MPN phenotype were randomly assigned to one of two groups (n=6 per group) and then began receiving either 10 mg/kg/day of G6 or vehicle control solution. CBCs were subsequently collected on days 14 and 28 of treatment via mandibular vein bleeding and after 28 days of treatment, a ll the mice were euthanized and prepared for analysis. The CBC values were first examined by a repeated-measures analysis of variance to determine whether there were any significant differences between the two treatment groups (Table 3-1 and 3-2). Values from non-trans genic control mice are also shown for comparison. We found that there were significant therapeutic improvements in the erythrocyte and platelet indices including the red blood cell count (RBC), hematocrit (HCT), mean corpuscular volume (MCV), red blood cell distribution width (RDW), hemoglobin (HB), m ean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), platelet c ount (PLT), mean platelet volume (MPV) 60

PAGE 61

and platelet distribution width (PDW) (Tabl e 3-1). There were also significant improvements in the leukocyte indices in cluding the white blood cell count (WBC ), neutrophil count (NE), lymphocyt e count (LO) and monocyte c ount (MO) (Table 3-2). To confirm these observations via an alternat e means, terminal peripheral blood smears from all mice were examined in parallel (Figure 3-1A). In addition to validating many of the CBC values, examination of the slides revealed an increased appearance of large platelets in the vehicle treat ed MPN mice which were lacki ng in the G6 treated mice. Previous work has shown that MPN patient s have significantly elevated levels of inflammatory cytokines, such as IL-6, in the peripheral blood [126]. To determine whether this was also the case in our MP N mice and whether G6 could correct this, terminal plasma IL-6 concentrations from bo th groups of mice were determined (Figure 3-1B). We found that the pl asma concentrations of IL-6 were markedly elevated in the vehicle-treated MPN mice; for reference, th e values in non-transgenic mice are normally 35-43 pg/ml. However, we observed that G6 treatment completed normalized the plasma levels of IL-6 in the MPN mice. We next wanted to determine if the efficacious parameters observed in the peripheral blood of G6 treated mice correlat ed with the presence of the drug in the plasma. For this, mass spectrometry analysi s was performed on the terminal plasma samples and the levels of G6 were determined (Table 3-3). We found that G6 was detectable in plasma samples from all the mi ce that received the drug, but not in the plasma taken from mice that re ceived vehicle control solution. G6 Reduces Extramedullary Hematopoiesis in Jak2-V617F MPN Mice Another pathology observed in the Jak2-V617F MPN mice is an abnormally high degree of extramedullary hematopoiesis (EMH). Constitutive expression of the Jak261

PAGE 62

V617F transgene drives hematopoies is in a number of tissues including the liver. In order to determine whether G6 could reduce this Jak2-V617F mediated pathogenesis, post mortem liver sections were examined by light microscopy and the levels of EMH were quantified. Figure 3-2A shows representative liver sections from all conditions and Figure 3-2B shows the quantitative values of EMH plotted as a function of condition. We found that when compared to wild type mi ce, the MPN mice treated with vehicle control solution exhibited an increased level of EMH. However, this was corrected with G6 treatment. Overall, the data in Figure 3-2 indicate that G6 is efficacious in the liver given its ability to normalize the levels of EMH in Jak2-V617F MPN mice. G6 Provides Therapeutic Benefit to the Spleen of Jak2-V617F MPN Mice The Jak2-V617F mouse recapitulates many of the spleen pathologies observed in human MPN including splenomegaly and megak aryocytic hyperplasia. To determine the efficacy of G6 in the spleen, several parameters were measured. First, at euthanasia, spleens were immediately re moved from the mice and gross spleen weights were determined. Figure 3-3A shows representative spleens from each condition and Figure 3-3B shows the quantitativ e spleen weight to body weight ratios. We found that following 28 days of G6 treatment, the spleen size, which was significantly increased in Jak2-V617F MP N mice, was significantly reduced with G6 treatment. Histological sections through the sp leen revealed a disorganized splenic architecture in the Jak2-V617F MPN mice tr eated with vehicle control solution and this was alleviated with G6 treatment (Figure 3-3C). Examination of the sections at higher power revealed a marked megakaryocytic hyperplasia in the Jak2-V617F MPN mice which was absent in the G6 treated mice (Figure 3-3D). To quantitate this hyperplasia, 62

PAGE 63

the average numbers of megakaryocytes per high power field were plotted as a function of condition (Figure 3-3E). We found that G6 treatm ent returned the number of megakaryocytes to normal, non-transgenic leve ls. Collectively, the data in Figure 3-3 indic ate that, in a mouse model of Jak2 -V617F mediated myeloproliferative neoplasia, G6 provides significant therapeutic benefit to the spleen as determined by a significantly reduced spleen weight to body weight ratio, a restoration of normal splenic architecture, and an elimination of megakaryocytic hyperplasia. G6 Provides Therapeutic Benefit to th e Bone Marrow of Jak2-V617F MPN Mice by Alleviating Megakaryocytic and Myeloid Hyperplasia The ability of a drug to provide ther apeutic benefit in the bone marrow of MPN patients is critically important since this is th e site of initiation of disease pathogenesis. Additionally, this has been the point of failure for current gener ation Jak2 inhibitors. To assess the efficacy of G6 in the bone marro w, we first examined marrow sections. Figure 3-4A shows representative histological sections from each group. We found that when compared to non-transgenic controls, t he vehicle-treated Jak2-V617F MPN mice had a hyper-cellular marrow due to myeloid and megakaryocytic hyperplasia and this corresponded with the increased pl atelet counts observed in the peripheral blood (Table 3-1). However, G6 appeared to restore t he marrow to non-diseased conditions. To confirm this quantitatively, the average number of megakaryocytes per high power field were determined from all animals and plotted as a function of treatment group (Figure 34B). We found that in the Jak2-V617F MPN mice, G6 reduced the number of megakaryocytes in the marrow to near WT levels. It is well accepted that an altered M:E ratio is often one of the characteristic signs of Jak2-V617F-mediated myeloproliferative neoplasia. In order to determine whether 63

PAGE 64

G6 could correct the abnormally high M:E ra tio in the bone marrow of the Jak2-V617F MPN mice, we carried out a quantitative analysis of the myeloid and erythroid cells on the marrow sections (Figure 3-4C). We found that when compared to the WT mice, there was a robust increase in the M:E rati o in the vehicle treated Jak2-V617F MPN mice that w as driven by myeloid hyperplasia However, G6 treatme nt returned the M:E ratio to wild type levels. Altogether, the dat a in Figure 3-4 demonstrate that G6 has marked therapeutic benefit in the bone marrow. Specifically it reduced the pathologic increase in megakaryocytic and myeloid hyperplasia in the marrow as a consequence of which, the M:E ratio was completely normalized. G6 Provides Therapeutic Benefit to th e Bone Marrow in Jak2-V617F MPN Mice by Reducing the Pathological Levels of Phospho-Jak2 and Phospho-STAT5 In order to determine whether the t herapeutic benefit observed in the marrow with G6 treatment is a resu lt of reduced Jak/STAT signa ling, we carried out anti phospho-Jak2 and anti phospho-STAT5 immunohistochemistry staining of the bone marrow sections. Figure 3-5A shows repres entative images of the anti phospho-Jak2 immuno-histochemistry at two magnifications. Qualitatively, we found that bone marrow sections obtained from the Jak2-V617F MP N mice treated with vehicle control had a robust increase in phospho-Jak2 levels when compared to the wild type mice. However, the phospho-Jak2 staining was reduced to wi ld type levels in the Jak2-V617F MPN mice that were treated with G6. Thes e qualitative observations were supported quantitatively when the numbers of anti phosphoJak2 stained cells were counted and plotted as a function of treat ment group (Figur e 3-5B). The therapeutic effect within the bone marrow was further verified by the ability of G6 to reduce the levels of the proliferative marker phospho-STAT5. STAT5 is an 64

PAGE 65

immediate downstream target of Jak2 and is hyper-phosphorylated in Jak2-V617F express ing cells [113,131]. Figure 3-5C s hows representative bone marrow pictures of the anti phospho-STAT5 immuno-histochemistr y stained sections and Figure 3-5D shows the quantification of all sections plott ed as a function of treatment group. We similarly observed that when compared to wild type mice, the Jak2-V617F MPN mice that were given vehicle control soluti on had pathologically high levels of phosphoSTAT5. Again however, G6 fully corrected this pathogenesis by returning the phosphoSTAT5 levels to non-transgenic levels. In summary, the data in Figure 3-5 show t hat G6 has striking therapeutic efficacy in the bone marrow. Specifically, the Jak2 -V617F MPN mice have significantly elevated levels of phospho-Jak2 and its proliferative downstream target, phospho-STAT5. However, G6 treatment normalizes t hese values to non-diseased levels. G6 Provides Therapeutic Benefit to th e Bone Marrow in Jak2-V617F MPN Mice by Significantly Reducing the Mutant Jak2 Allelic Burden The greatest obstacle to current Jak2 inhibi tors is the inability of these drugs to eliminate Jak2-V617F mutant clones from the bone marrow. To determine the efficacy of this parameter in our MPN model, we m easured the mRNA levels of both the human Jak2-V617F mutant mRNA transcripts and endogenous mouse Jak2-WT transcripts. We found that while G6 treatment significant ly reduced the levels of the mutant V617F transcripts (Figure 3-6A), endogenous wild type transcripts were only slightly reduced by G6 treatment, and this change was not signi ficant (Figure 3-6B). Furthermore, we found that the ratio of these two parameter s (i.e., the mutant bur den within the marrow) was reduced, on average, by ~67% with G6 tr eatment when compared to Jak2-V617F MPN mice that received vehicle control injecti ons (Figure 3-6C). In addition, one-third 65

PAGE 66

of the G6 treated mice exhibi ted vi rtual elimination of all Jak2-V617F transcripts from the marrow. Thus, the data in Figure 3-6 dem onstrate that G6 significantly reduces the burden of Jak2-V617F mutant cells from t he bone marrow in a model of Jak2-V617F mediated myeloproliferative neoplasia. G6 Prevents Jak2-V617F Mediat ed Clonogenic Growth Lastly, we wanted to assess whether G6 can stop the clonogenic growth potential of Jak2-V617F transformed cells as this would be crucial to any ther apeutic possibility. For this, cells were harvested from t he bone marrow of Jak2-V617F MPN mice and cultured ex vivo in the presence of 25 M of G6 for either 0, 12, or 24 hours. The cells were then washed extensively to remove drug and plated in medium lacking EPO and TPO. Five days later, the number of gr anulocyte-macrophage co lony forming units (Figure 3-7A) and erythroid colony forming un its (Figure 3-7B) were counted and plotted as a function of time. We found that G6 si gnificantly suppressed the clonogenic growth potential of Jak2-V617F cells in a time dependent manner; 12 hours of drug exposure resulted in ~50% growth inhibition and 24 hours of drug exposure virt ually eliminated all subsequent clonogenic growth. As such, these re sults indicate that brief exposures of Jak2-V617F cells to G6 prevent subsequent clonogenic growth. Discussion Since the discovery of the Jak2-V617F mutation in most patients with MPN, a number of molecularly targeted Jak2 inhi bitors have been developed. However, the clinical benefits provided by these inhibito rs so far have largely been palliative due to their inability to eliminate malignant clones from the bone marrow. As such, these drugs have no ability to alter the natural history of the disease. Furthermore, those few drugs that have exhibited some efficacy in the marrow have done so only after numerous 66

PAGE 67

cycles of treatment [129]. The consequenc e of such frequent treatment regimens includes a number of undesirable side effects including myel otoxicity. Worse, there is a relapse of disease after cessation of treatment. Thus, the identification of Jak2 inhibitors that can provide significant bone marrow efficacy in the absence of repeated drug administration is highly desir able. We present here pre-clin ical data demonstrating that the Jak2 inhibitor, G6, provides except ional therapeutic efficacy against Jak2-V617F mediated myeloproliferative neoplasia. The drug significantly reduced the Jak2-V617F allele burden in the bone marrow. This reduc tion of the mutant burden in the marrow was concomitant with the elimination of myeloid hyperplasia, correction of the M:E ratio, normalization of the levels of phospho-Jak2 and phospho-STAT5, and an elimination of Jak2-V617F dependent clonogenic growth potential. Overall, these results indicate that G6 is highly efficacious in the bone marrow. In addition to providing exceptional bone marrow efficacy, G6 also corrected virtually every pathological MPN indicator in the peripheral blood including the red blood cell count, hematocrit, mean corpuscular volume, red blood cell distribution width, hemoglobin, mean corpuscular hemoglob in, mean corpuscular hemoglobin concentration, platelet count, mean platelet volume, platelet distribution width, white blood cell count, neutrophil count, lymphocyte count, monocyte count, and the levels of IL-6 (Table 3-1, Table 3-2 and Figure 3-1) It also eliminated the extramedullary hematopoiesis in the liver that was being driven by the Jak2-V617F transgene (Figure 3-2). Lastly, within the spleen, G6 alleviat ed splenomegaly, significantly reduced the megakaryocytic hyperplasia, and restored the norma l architecture to this tissue (Figures 67

PAGE 68

3-3 and 3-4). As such, G6 si gnificantly ameliorates or e liminates the pathogenesis of nearly every indicator of the MPN phenotype. We recently reported that G6 eliminates the Jak2-V617F mutant burden from the bone marrow using a HEL cell xenograft model of Jak2-V617F mediated hyperplasia [131]. This xenograft model has the advantage of closely r eplicating many aspects of human disease including a low tumor burden in the context of the endogenous marrow niche. One limitation of this model howev er, is the lack of the associated MPN phenotype. Our work here is signif icant in that we show that G6 is also highly effective in the bone marrow using a mouse m odel of Jak2-V617 F mediated, human myeloproliferative neoplasia. As such, t he comprehensive elimination of the mixed PV/ET phenotype from these Jak2-V617F mice suggests that G6 may have therapeutic potential for the treatm ent of MPN. Given the causative role of Jak2 ki nase in human disorders, Jak2 small molecules may have significant therapeutic po tential. Accordingly, within the past several years, a number of groups have devel oped Jak2 inhibitors. One problem with virtually all these compounds however, is that while they demonstrated excellent efficacy in vitro they have little to no efficacy in vivo [93, 100, 114,115]. This critical inability to reduce the mutant Jak2 burden in the bone marrow was the focus of a recent and sobering review describing current obstacles and limitations in this area of research [132]. Our work here is signifi cant because in addition to having in vitro efficacy [97,113], we now show t hat G6 has exceptional in vivo efficacy using a second, independent model of Jak2-V 617F mediated pathogenesis. 68

PAGE 69

Perhaps the single greatest problem with cu rrent generation Jak2 inhibitors is that they are merely palliative and not cura ti ve in any way [129,132]. In other words, while they alleviate a number of MPN asso ciated symptomologies, they do not alter the burden of mutant Jak2 clones in t he bone marrow and hence, cannot change the natural progression of the disease. The clear efficacy observed in the bone marrow with G6 treatment (Figures 3-4 to 3-6) suggests that the drug may in fact be curative rather than merely palliative. Furthermore, our obser vation that brief exposures of Jak2-V617F cells to G6 completely eliminate all subsequent Jak2-V617F dependent clonogenic growth (Figure 3-7), suggests that t he bone marrow efficacy may be permanent. G6 was identified using st ructure based virtual screening [97]. It belongs to a group of diarylethene compounds known as stilbenes. Previously, we demonstrated that the stilbenoid core element of G6 is critically essential for it therapeutic potential [131]. Stilbenes have therapeutic efficacy in a wid e variety of disease conditions including cancer, stress, cardiovascular, and vi ral diseases [105, 106,107,108,109,110]. Given that stilbenes such as resveratrol and pic eatannol are naturally occurring [108,109,110], they are likely to have limited side effects in vivo In the current study, we did not observe any apparent side effects associated with G6 treatment, suggesting that it may be suitable and safe for administr ation to humans with MPN. In conclusion, the results in this study demonstrated that the small molecule Jak2 inhibitor, G6, provides unique and superio r therapeutic benefit in the bone marrow using a mouse model of Jak2-V617F mediated myeloproliferative neoplasia. The bone marrow is the predilection site for MPN dis ease pathogenesis. Theref ore, this work is 69

PAGE 70

significant in that G6 may be a promising candidate for progression into clinic al trials for the treatment of MPN. 70

PAGE 71

WT MPN + Vehicle MPN + G6 0 50 100 150 200 250 300MPN + Vehicle MPN + G6Plasma IL-6 concentration (pg/ml) A B 40x 100x WT MPN + Vehicle MPN + G6 0 50 100 150 200 250 300MPN + Vehicle MPN + G6Plasma IL-6 concentration (pg/ml) A B 40x 100x Figure 3-1. G6 provides therapeutic benef it in peripheral blood of Jak2-V617F transgenic mice. A) Representative blood smears showing giant platelets at the indicated magnifications. B) Plasma interleukin-6 concentrations. *p=6.37x10-8 versus vehicle treated. 71

PAGE 72

0 1 2 3 4 5 6# of EMH/field WTMPN + VehicleMPN + G6AB 10X 20X 100X WTMPN + VehicleMPN + G6 0 1 2 3 4 5 6# of EMH/field WTMPN + VehicleMPN + G6AB 10X 20X 100X WTMPN + VehicleMPN + G6 Figure 3-2. G6 reduces extramedullary hematopoiesis in Jak2-V617F transgenic mice. A) Liver sections showing extramedullary hematopoiesis sites at the indicated magnifications. B) Number of extramedu llary hematopoiesis sites plotted as a function of treatment group. 72

PAGE 73

AWTMPN + VehicleMPN + G6 0 5 10 15 20Spln/Bwt(mg/g) ** B **WTMPN + VehicleMPN + G6 10 mm 10 mm 10 mm CWT MPN + VehicleMPN + G6 0 2 4 6 8 10 12 14 16 18# of Megakaryocytes/HPF * WT MPN + VehicleMPN + G6 WTMPN + VehicleMPN + G6D E Figure 3-3. G6 provides therapeutic benefit to the spleen of Jak2-V617F transgenic mice. A) Representative spleens. B) Sp leen weight to body weight ratios graphed as a function of treatment group. C) Histo logical sections through the spleen at lower magnification showi ng splenic architecture. D) Histological sections through the spleen at higher m agnification showing effect of G6 on megakaryocytic hyperplasia in transgenic mice. E) Number of megakaryocytes per high power field plo tted as a function of treatment group. **p <0.001 and p <0.05 versus vehicle treated. 73

PAGE 74

# of Megakaryocytes/HPF 0 2 4 6 8 10 12 14* *WT MPN + VehicleMPN + G6 WTMPN + VehicleMPN + G6A 0 2 4 6 8 10 12M:E RatioC ** **WTMPN + VehicleMPN + G6B Figure 3-4. G6 provides therapeutic benefit to the bone marrow of Jak2-V617F transgenic mice by alleviating megakaryocytic and myeloid hyperplasia. A) Bone marrow sections showing effect of G6 on megakaryocytic hyperplasia. B) Average number of megak aryocytes per high power field plotted as a function of treat ment group. C) M:E ratios plotted as a function of treatment group. p <0.05 and ** p <0.001 versus vehicle treated. 74

PAGE 75

phospho-Jak2 % phosho-Jak2 staining WTMPN + VehicleMPN + G6WTMPN + VehicleMPN + G6* A B 0 20 40 60 80 100 120% phospho-STAT5 staining phospho-STAT5WTMPN + VehicleMPN + G6C * DWTMPN + VehicleMPN + G6 40x 100x 40x 100x 0 10 20 30 40 50 60 70 80 90 100 Figure 3-5. G6 reduces activation of Jak2 and STAT5 in Jak2-V617F transgenic mice. A) Representative anti-phospho-Jak2 i mmunohistochemistry in bone marrow sections from the indicated treatment groups. B) Quantification of the antiphospho-Jak2 staining plotted as a function of treatment group. C) Representative anti-phospho-STAT5 i mmunohistochemistry in bone marrow sections. D) Quantificat ion of the anti-phospho-STAT5 staining plotted as a function of treatment group. *p <0.05 versus vehicle treated. 75

PAGE 76

0 0.5 1 1.5 2 2.5Jak2-V617F/ -Actin mRNA A BWTMPN + VehicleMPN + G6 0 0.5 1 1.5 2 2.5WT Jak2/ -Actin mRNAWTMPN + VehicleMPN + G6 0 0.5 1 1.5 2WTMPN + VehicleMPN + G6 *Jak2-V617F//WT Jak2C Figure 3-6. G6 reduces mutant allelic burden in bone marrow of Jak2-V617F transgenic mice. A) Number of Jak2-V617F mutant transcripts from the bone marrow of indicated treatment groups. B) Number of endogenous mouse Jak2 transcripts. C) Allelic burden in Jak2-V617F in the indicated treatment groups. p <0.05. 76

PAGE 77

77 0 5 10 15 20 25 30 35 01224CFU-ETime of G6 Ex posure (Hours) * B 0 5 10 15 20 25 30 35 01224CFU-ETime of G6 Ex posure (Hours) * B 0 5 10 15 20 25 30 35 01 22 4CFU-GMTime of G6 Ex posure (Hours) * A Figure 3-7. G6 prevents Jak2-V617F-medi ated cytokine-independent colony formation. A) Number of CFU-GM and B) number of CFU-E, plotted as a function of treatment group. p <0.05.

PAGE 78

Table 3-1. Summary of peripheral blood analyses showing erythrocyte and platelet indices of no n-transgenic, and vehicle or G6 treated Jak2-V617F transgenic mice. HB (g/dL) MCH (pg) MCHC (g/dL) Non Transgenic 11.9 0.1 12.3 0.2 28.1 0.4 Jak2V617F Vehicle G6 Vehicle G6 Vehicle G6 Baseline 14.3 0.3 14.4 0.6 10.6 0.1 10.6 0.1 27.1 0.2 26.9 0.3 Week 2 15.5 0.7 12.5 1.4# 11.3 0.1 11.8 0.2* 29.8 0.2* 29.8 0.3* Week 4 13.9 0.4 12.1 0.2 11.1 0.2 11.9 0.4#* 29.7 0.2 28.2 0.3#* PLT (K/L) MPV (fL) PDW (%) Non Transgenic 1198 151 4.0 0.4 30.2 0.6 Jak2V617F Vehicle G6 Vehicle G6 Vehicle G6 Baseline 2879 145 2802 234 5.3 0.1 5.3 0.1 28.7 0.4 28.9 0.4 Week 2 2732 465 1708 259#* 5.4 0.1 5.0 0.2# 25.9 1.2 28.1 1.5 Week 4 3311 313 1180 253#* 5.4 0.2 4.1 0.3#* 27.2 1.4 31.7 1.9# RBC (M/ L ) HCT (%) MCV (fL) RDW (%) Non Transgenic 9.7 0.1 42.4 0.2 43.7 0.3 18.3 0.5 Jak2V617F Vehicle G6 Vehicle G6 Vehicle G6 Vehicle G6 Baseline 13.5 0.4 13.7 0.7 53.0 1.3 53.5 1.9 39.3 0.3 39.3 0.5 20.4 0.3 20.5 0.2 Week 2 13.7 0.6 10.7 1.3#* 52.2 2.0 42.1 4.8#* 38.3 0.5 39.6 0.9 20.5 0.3 19.5 0.5 Week 4 12.6 0.5 10.3 0.5#* 47.2 1.4 43.0 0.5* 37.2 0.6 42.2 1.4#* 20.2 0.4 18.3 0.4#* RBC, red blood cells; HCT, he matocrit; MCV, mean corpuscula r volume; RDW, red blood cell distribution width; HB, hemoglobin; MCH, mean corpuscular hemoglo bin; MCHC, mean corpuscu lar hemoglobin concentrat ion; PLT, platelets; MPV, mean platelet volume; PDW, platelet distribution width. #p < 0.05 in reference to vehi cle treated; *p < 0.05 in reference to baseline. 78

PAGE 79

79 Table 3-2. Summary of peripheral blood analyses showing leukocyte indices of non-transgenic, and vehicle or G6 treated Jak2-V617F transgenic mice. WBC (K/L) NE (K/L) NE (%) Non Transgenic 9.1 0.9 2.4 0.3 23.4 2.3 Jak2V617F Vehicle G6 Vehicle G6 Vehicle G6 Baseline 16.8 1.6 14.8 0.9 5.3 0.5 5.8 0.9 34.1 2.6 34.9 2.9 Week 2 19.8 2.4 12.0 3.1# 6.2 0.9 4.3 1.1 31.3 2.2 30.0 2.6 Week 4 21.3 2.6 10.3 0.9# 7.5 1.1 2.7 0.3#* 35.1 1.1 27.3 3.6 WBC, white blood cells; NE, neutrophils; LY, lymphoc ytes; MO, monocytes; EO, eosinophils; BA, basophils. #p < 0.05 in reference to vehicle treated; *p < 0.05 in reference to baseline. LY (K/ L) LY (%) MO (K/L) MO (%) Non Transgenic 6.4 0.7 62.4 1.5 0.8 0.1 7.9 0.9 Jak2V617F Vehicle G6 Vehicle G6 Vehicle G6 Vehicle G6 Baseline 8.2 0.6 8.1 0.9 51.4 1.8 51.7 3.4 1.7 0.2 1.4 0.2 11.0 1.1 9.2 0.6 Week 2 10.3 1.3 6.7 1.5# 52.1 2.9 57.6 2.8 2.4 0.4 1.3 0.3# 12.2 1.2 9.3 1.1# Week 4 10.8 1.3 6.1 0.8# 50.7 0.9 59.0 3.8# 2.0 0.3 0.8 0.1# 9.13 0.3 8.0 0.8 EO (K/ L) EO (%) BA (K/L) BA (%) Non Transgenic 0.6 0.2 4.7 0.6 0.1 0.0 0.7 0.4 Jak2V617F Vehicle G6 Vehicle G6 Vehicle G6 Vehicle G6 Baseline 0.6 0.1 0.5 0.1 3.4 0. 8 3.9 0.3 0.0 0.0 0.0 0.0 0.1 0.0 0.3 0.1 Week 2 0.8 0.1 0.5 0.2 4.0 0. 6 2.6 0.7 0.1 0.0 0.1 0.1 0.5 0.2 0.6 0.1 Week 4 0.9 0.2 0.5 0.1 4.5 1. 0 4.7 0.6 0.1 0.0 0.1 0.0 0.6 0.2 0.1 0.0

PAGE 80

Table 3-3. Mass spectrometry results showing plasma concentrations of G6 at euthanasia of Jak2-V617F transgenic mice. Animal ID Plasma (g/mL)* Vehicle Treated 1 < 0 2 < 0 3 < 0 4 < 0 5 < 0 6 < 0 G6 Treated 1 48.6 2 0.155 3 0.036 4 0.025 5 0.030 Standard curve was quadratic (1/x2) r = 0. 9902 and range from 0.005-5.00g/mL. < 0 indicates, peak quantitates bel ow 0 value of the standard ca rve, *Average of replicate injections calculations by Analyst Software 1.4.2. 80

PAGE 81

CHAPTE R 4 3VASCULAR SMOOTH MUSCLE JAK2 MEDIATES ANGIOTENSIN II-INDUCED HYPERTENSION VIA INCREASED LEVELS OF REACTIVE OXYGEN SPECIES Hypertension is a major risk factor for ca rdiovascular disease (CVD) and death [1]. Angiotensin II (Ang II) plays a major role in the regulation of normal physiological responses of the cardiovascular system and the pathogenesis of hypertension. Previous studies have shown that Ang II stimulation of the AT1 receptor leads to increased activation of the Jak2 signaling pathway, and increased Jak2 activity correlates with various Ang II-mediated cardiovascular dis eases [29,30,31,32,33,34, 35,36,49,133,134]. Recent work demonstrated that the Rho exchange factor, Arhgef1, mediates the effects of Ang II on vascular tone and blood pressure [ 56]. It was demonstrated in this work that Jak2 may be involved in this in vivo process; however, this correlation was made using the Jak2 pharmacological inhibitor, AG490. Although AG490 is a potent inhibitor of Jak2, it also inhibits other tyrosine kinases [135,136]. It inhibits EGFR phosphorylation 1,000 times more potently than it inhibits Ja k2 [137]. Moreover, systemic administration of a pharmacological inhibitor is unable to discriminate between potential Jak2 target tissues such as brain, kidney, heart, or the vasculature. Reactive oxygen species (ROS) have been implicated in the pathogenesis of hypertension and Ang II is involved in mediating RO S-dependent signaling [55,59,60,61,138]. One mechanism by whic h ROS trigger hypertension is via scavenging of nitric oxide (NO) [139]. ROS also increase intracellular free Ca2+ levels, 3Reproduced with permission from Kirabo A, K earns PN, Jarajapu YP, Sasser JM, Oh SP, Grant MB et al. (2011) Vascular smooth muscle Jak2 mediates angiotensin IIinduced hypertension via increased levels of reactive oxygen species. Cardiovasc Res. 2011 Mar 22. [Epub ahead of print] 81

PAGE 82

which contribute to increased vascular tone [138]. In VSMC and endothelial cells, Ang II stimulates the activity of membrane-bound NAD(P)H oxidase producing ROS such as superoxide and hydrogen peroxide (H2O2) [17,57,62,63,64,65,66]. Superoxide generation in response to Ang II inactivate s NO in both these cell types [70,71,72]. Interestingly, the Ang II-induced formation of ROS is not dependent on its hemodynamic effects, since this phenomenon is not observed in norepinephrine-induced hypertension [62,67,68]. Furthermore, work in human leuk emia cells demonstrated that Jak2 is involved in ROS production as inhibition of Jak2 resulted in decreased ROS levels [75]. We hypothesized that the mechanism of Ang II-induced hypertension is by Jak2 tyrosine kinase activation within VSMC lead ing to increased ROS generation. Utilizing a conditional knockout mouse approach in which Jak2 was deleted from VSMC, we identified Jak2 as a key modulator of A ng II induced vascular contraction via a ROSdependent mechanism. Materials and Methods Animals Animals were maintained according to NIH standards established in the Guidelines for the Care and Use of Experimental Animals in a specific pathogen-free facility at the Laboratory Animal C enter of University of Florida. All protocols were approved by the Institutional Animal Care and Use Committee at the University of Florida. Mice harboring a floxed Jak2 allele were crossed with mice expressing Cre recombinase under the control of the SM22 promoter and the Jak2 null allele was identified using primers 5-G TCTATACACCACCACTCCTG and 5GAGCTGGAAAGATAGGTCAGC. 82

PAGE 83

Blood Pressure Measurements Mice were anesthetized by isoflurane (2%-5%, aerosolized) and surgically fitted with telemetry probes placed in the left carotid artery. Buprenorphine was the post operative analges ia (0.05 0.1 mg/kg every 6-12 hours for 48 hours, IP). After 10 days of recovery, baseline blood pressure meas urements were made. Mice were again anesthetized with isoflurane and micro-osmoti c pumps were placed subcutaneously for infusion of 1,000 ng/kg/min Ang II. Radio te lemetry recordings were then performed over the ensuing four week period. Aortic Contraction/Relaxation Mice were euthanized via CO2 asphyxiation followed by ce rvical dislocation. 2mm abdominal aorta ring segments were then mounted on a wire myograph in Krebsbicarbonate buffer equilibrated with 95% O2, 5% CO2 at 37C. The rings were allowed to equilibrate for 45 minutes, stimulated with different pharmacological agents and changes in contraction/relaxation were recorded. Following treatment with each vasoactive agent, the rings were allowed to recover for 30 minutes, with 6 washes during this time period. Histology Tissue samples were prepared and stained with hematoxylin and eosin or Massons trichrome. Immunohistologic al detection of anti-smooth muscle -actin was carried out using the Rat on Mouse AP-Po lymer Kit. The anti-Jak2 antibody was purchased commercially (Abcam #ab39636). NO Measurements Aortic rings were incubated with 7 M fluorescent dye 4-amino-5-methylamino2',7'-difluorescein (DAF-FM) aerated with 95% O2-5% CO2 at 37C for 45 minutes. 83

PAGE 84

Samples for basal accumulation of NO were taken. The rings were then treate d with Ang II (10 M) or Ach (10 M) for 30 minutes, remove d, dried, and weighed. Fluorescence was measured at an excitati on wavelength of 495 nm and an emission wavelength of 520 nm and normalized to tissue weight. H2O2 Detection H2O2 production was measured usi ng the Amplex Red Hydrogen Peroxide/Peroxidase Assay Kit and presented as the catalase-inhabitable signal normalized to total cellular protein. Rho Kinase Activity Rho kinase activity was determined using the CycLex Rho-kinase Assay Kit or directly measuring the phosphorylation levels of myosin phosphatase subunit 1 (MYPT1), a down stream target of Rho-kinase. Calcium Imaging Ca2+ levels within individual cells were det ermined via fura-2 loading and a cooled charge-coupled device camera fitted to a fluorescence microscope. Statistical Analysis Comparison of genotypes and treatm ents was performed by unpaired/paired Students t-test, analysis of variance followed by the Bonferroni ttest, or Friedmans test. Results Generation of Mice with VSMC Deletion of Jak2 The Crelox P system was used to ablate Jak2 within VSMCs. The schematic representation of the floxed Jak2 allele (F igure 4-1A) and the breeding strategy used to generate such mice (Figure 4-1B) are show n. The genotypes of all offspring were 84

PAGE 85

analyzed by PCR (Figure 4-1C). Mice homozygous for the floxed Jak2 allele were identified by the presence of a 310 bp band as opposed to the 230 bp band of the WT allele. Identification of SM22 Cre was confirmed by the presence of a 201 bp Cre specific amplicon. The site-specific recombi nation event to obtain the null Jak 2 allele was verified by a PCR assay of the abdomin al aorta using primers 278 and 279; the 355 bp band could only be generated afte r Cre mediated excision of the Jak2 start codon. In order to confirm that the SM22 promoter target s Cre expression to VSMC, our mice were crossed with the ubiqu itously expressed Rosa26 -galactosidase reporter mouse [144] and X-Gal staining was analyzed in tiss ue sections. VSMCs of renal arteries showed no staining in the SM22 Cre(-)Jak2fl/fl/Rosa26 control mice (Figure 4-1D, left). However, there was efficient Cre expressi on and recombination within VSMC leading to intensive X-Gal staining in the renal arteries of SM22 Cre(+)Jak2fl/fl /Rosa26 mice (Figure 4-1D). Overall, these data demonstr ate a high degree of Cre activity in VSMC. Having confirmed the appropr iate genetic manipulations within these mice, we next wanted to confirm the specific absenc e of Jak2 protein within VSMC. For this, immuno-histochemistry (IHC) was carried out on renal arteries of several genotypes to demonstrate differential Jak2 staining patterns (Figure 4-2). Collectively, these data demonstrate that the Cr e-mediated conditional deletion of the first coding exon of Jak2 within VSMC gives rise to mice that co rrespondingly lack Jak2 protein in VSMC. Deletion of VSMC Jak2 Attenuates Ang II-Induced Hypertension While it is well accept ed that the Ang II type AT1 receptor couples to Jak2 signaling [29,30,31,32,33,34, 133], the functional role of this interaction is not clearly understood and little is known about the direct role of Jak2 in blood pressure regulation. We hypothesized that Jak2 within VSMC pla ys a critical role in Ang II mediated 85

PAGE 86

hypertension. For all subsequent studies, we used two genotypes; SM22 Cre(-)Jak2fl/fl herein designated as control and SM22 Cre(+)Jak2fl/fl herein designated as the VSMC Jak2 null. Using telemetry blood pressure recordings, we found that the basal mean arterial pressure was slightly lower in VSM C Jak2 null mice, when compared to controls (Figure 4-3A). After two baseline recordi ngs, the mice were implanted with osmotic minipumps infusing Ang II at a rate of 1, 000 ng/kg/min for 28 days. Infusion of Ang II resulted in an increase in MAP in both groups. However the increase in VSMC Jak2 null mice was significantly lower (p < 0.001) com pared to that observed in the control group, both during the dark (Figure 43A) and the light (Figure 4-3B ) periods. Examination of the heart rate data indicated that the heart ra tes were not significantly different between the two groups during these same periods (Figure 4-3C and 4-3D). These results indicate that deletion of VSMC Jak2 attenuates Ang II induced hypertension, but has no effect on heart rate. VSMC Jak2 Null Mice were Pr otected from Ang II-Indu ced Aortic Wall Thickening Chronically elevated Ang II levels promot e pathological vascular wall remodeling in animals [141,142]. To determine the affects of Ang II infu sion on vascular remodeling in our mice, aortas from both genotypes we re prepared for analysis. Representative sections are shown as Figure 4-4A while the aggregate data for all animals is shown in Figure 4-4B. In the controls, Ang II infusion increas ed the aortic wall thickness relative to untreated littermate controls. However, th is Ang II-mediated pathological thickening was significantly reduced in the null mice. Computer assisted morphometric analysis indicated that the tunica inti ma thickness as a percentage of the total thickness, was similar in VSMC Jak2 null mice and controls (Figure 4-4C). In contrast, the percent tunica media thickness was significantly increased and the percent tunica adventitia 86

PAGE 87

thickness was significantly reduced in aortic wall sections of controls when compared to the null mice (Figure 4-4C). Collectively, t hese data indicate that VSMC Jak2 null mice are protected from pathological vascular remodeling that occurs as a consequence of chronic Ang II infusion. Deletion of VSMC Jak2 Correlates with Reduced Ang II-Induced Contraction of Aortic Rings and Increased Endothelium-derived Nitric Oxide Next, we wanted to determine whether VSMC Jak2 null mice have reduced Ang II-mediated aortic contraction when compared to controls. For this, abdominal aortic rings from control and null genotypes were isolated and their constrictive properties were measured. In response to KCl, there was no significant difference in the absolute contraction between the control and VSMC Jak2 null rings, suggesting that the contractile machinery was similar in both genot ypes (Figure 4-5A). In contrast, rings constricted with Ang II showed a marked di fference with Ang II inducing a forceful contraction in the control rings, but not in the null rings; a representative response is shown as Figure 4-5B while the aggregate dat a from all experiments are shown as Figure 4-5C. To determine if this effect was specific for Ang II or common to vasoactive molecules, aortic rings from both genotypes were constricted with the 1-adrenergic receptor agonist, phenylephrine. No significant difference in the phenylephrine induced contraction between the two genotypes was obs erved (Figure 4-5D). Additionally, pretreatment with the AT2 re ceptor blocker PD123319 or the Ang-(1) selective antagonist A-779, had no significant effect on the percent change between the Ang IIinduced constriction in Jak2 null and the control rings, indicating that the reduced contractile property of the VSM C Jak2 null rings in response to Ang II was independent of AT2 and Mas receptor si gnaling (data not shown). 87

PAGE 88

In order to determine if the endothelium pl ayed a role in the observed differences in the Ang II-mediated contract ion of the vessels, aortic ri ngs from both genotypes were either left intact or the endothelium was denuded prior to A ng II-mediated constriction. Removal of the endothelium increased the Ang II-induced aortic contraction of the null rings to levels that were similar to controls (Figure 4-6A). When the data were plotted as the percent change in constriction after EC removal, we found that the percent change between the endothelium intact and endotheliu m denuded aortic rings was significantly greater in VSMC Jak2 null mice, when compared to controls (Figure 4-6B). These results suggest that the inabilit y of the VSMC Jak2 null rings to contract in response to Ang II is likely due to endothelium derived inhibi tory factors. In order to determine whether NO was one such factor, rings were pre-treated with either vehicle or 1mM of the nitric oxide synthase (NOS) inhibitor L-NAME, followed by Ang II treatment. Pretreatment with L-NAME lead to a partial increase of the A ng II-dependent contraction of the null rings (Figure 4-6C). When the dat a were plotted as the percent change in contraction after L-NAME treatment, we fo und that rings from the null mice had a significantly greater increase in contraction when compared to controls (Figure 4-6D). Overall, these results indicate that del etion of VSMC derived Jak2 correlates with reduced Ang II-mediated contraction. Furthermore, the data support that there is increased bio-available NO in the rings of the null mice, which is likely responsible for part of the reduced Ang II-induc ed contraction in the aorti c rings of these animals. Deletion of VSMC Jak2 Enhances Endotheliu m Dependent Aortic Relaxation due to Reduced ROS and Increased NO Availability To understand the relationship between NO and ROS in this process, aortic rings were first constricted with phenylephrine (Phe) (10-6 M) to elicit an initial Phe-induced, 88

PAGE 89

maximal contraction. Increasing concentrations of acetylcholine (Ach) were then added, and the percent of Ach-mediated relaxation of the rings was determined. Ach caused a concentration-dependent relaxation of the ri ngs which was significantly enhanced in the null rings when compared to the controls (F igure 4-7A). However, when the endothelium was first denuded prior to Ang II stimulation, there was no relaxation in either set of rings, indicating that the relaxation was entirely endothelium dependent. Accordingly, these results support that deletion of VSMC Jak2 enhances endothelium dependent vascular relaxation in response to Ach. ROS have been implicated in the pat hogenesis of hypertension via the scavenging of NO [55,59,60,61,138,139]. In order to determine whether reduced levels of ROS were responsible for the improved endothelium dependent relaxation observed in the null mice, aortic rings were pr e-treated with the antioxidant, superoxide dismutase (SOD), followed by treatment with increasing concentrations of Ach. Preincubation with SOD improved aorti c relaxation of the control rings to levels that were comparable to that observed with the Jak2 null rings, indicating that the control rings had higher levels of ROS (Figure 4-7B). To determine whether there were inherent differences in the ability of VSMC to relax, aortic rings were pre-treated with the NO inhibitor L-NAME, and then treated with incr easing concentrations of the exogenous NO donor, DETA NONOate, a compo und that will directly relax the VSMC (Figure 4-7C). There was no significant difference in aorti c relaxation between control and null rings indicating that the impaired endothelium dependent aortic relaxation observed in the control mice was not due to an impai red ability of the VSMC to relax, per se 89

PAGE 90

We next measured NO levels directly and found that basal levels of NO were significantly greater in the aortic rings taken from null mice when compared to controls (Figure 4-7D). Similarly, Ang II (10) and Ach (10) caused greater increases in NO production in aortic rings of VSMC Jak2 nulls when compared to the controls (Figure 47D). Finally, levels of ROS were measur ed in cultured VSMC from both genotypes. Both at baseline and in respons e to Ang II, more H2O2 was detected in VSMC obtained from control mice than VSMC Jak2 nulls (Figure 4-7E). Collectively, the results in Figure 4-7 indicate that the aortic rings from VSMC Jak2 null mice have enhanced endothelium dependent relaxation when compared to cont rols. Furthermore, this enhanced relaxation correlates with decreased ROS and increased NO. Deletion of VSMC Jak2 Results in Reduced Rho-Kinase Activity and Intracellular Ca2+ Levels in Response to Ang II Rho kinase is a critical mediator of VSMC contraction [143,144,145]. As such, Ang II-dependent Rho kinase activity was meas ured in cultured VSMC derived from control and null mice. While Ang II treatm ent caused a time-dependent increase in Rhokinase activity in the control cells, it was co mpletely lacking in the VSMC Jak2 null cells (Figure 4-8A). To demonstrate this result another way, Western blot analysis was used to analyze the activation of myosin phosphatase subunit 1 (MYPT1), a down stream target of Rho kinase. As expected, Ang II treatment increased the phosphorylation of MYPT1 in a time-dependent manner in the cont rol cells (Figure 4-8B, top). However, VSMC Jak2 null cells completely lacked this e ffect (Figure 4-8B, top). Densitometry was then performed on all blots so that quantitative values co uld be compared between the two genotypes (Figure 4-8B, bottom). Control cells exhibited a robust Ang II-dependent phosphorylation of MYPT1 which was completely lacking in the VSMC Jak2 null cells. 90

PAGE 91

Lastly, given that ROS can increase intracellular Ca2+ levels and this can contribute to increased vascular tone [138], we hypothesized that the VSMC Jak2 null cells would have decreased intracellular Ca2+ levels compared to controls. To test this, control and VSMC Jak2 null cells were firs t depolarized with KCl and intracellular Ca2+ levels were determined. Both cells types generated a peak Ca2+ response that was virtually identical, indicating that the Ca2+ signaling machinery is comparable in both cell types (Figure 4-8C, top panels). However, when VSMC Jak2 null cells were treated with Ang II, intracellular Ca2+ elevation was significantly bl unted when compared to control cells (Figure 4-8C, bottom panels). All responses were then graphed as a function of both treatment and genotype (Fi gure 4-8D). We found that deletion of Jak2 within VSMC significantly blunted, but did not prevent Ang II-mediated intracellular Ca2+ elevation. In summary, the data in Figure 4-8 demonstrate that del etion of Jak2 within VSMC results in a less contractile phenotype when compared to control cells; namely, in response to Ang II, the Jak2 nulls cells have reduced Rho kinase activity, reduced MYPT1 phosphorylation, and reduced intracellular Ca2+ levels. Deletion of VSMC Jak2 Prevents Angiotensin II-Induced Kidney Damage End-organ damage is an import ant clinical sequel of hypertension and renal failure. Since mice lacking VSMC Jak2 had attenuated Ang II-induced hypertension, we hypothesized that they would be protected from kidney damage. Cross sections through the kidneys were stained with either trichrome (Figure 4-9A) or Periodic Acid Schiff (PAS) (Figure 4-9B). Trichr ome staining revealed pronounced interstitial (Figure 4-9A upper panel) and peri-glomerular fi brosis (Figure 4-9A lower panel) in the control when compared to the VSMC Jak2 null mice. PAS st aining revealed that glomeruli in the control mice were enlarged and showed sign s of degeneration when compared to the 91

PAGE 92

VSMC Jak2 null mice (Figure 4-9B). T here was also increased peri-vascular Tlymphocyte infiltration in the control mice tr eated with Ang II, but not in the Jak2 null mice (Figure 4-9C). Consistent with the pr otection from structural kidney damage, the Jak2 null mice developed less albiminuria after 4 weeks of Ang II infusion when compared to the control mice (Figure 4-9D). Urine albumin was undetectable in the control and Jak2 null mice that did not receive Ang II infusion (data not shown). Discussion Ang II-induced actions via the AT1 receptor are considered to play a major role in the pathogenesis of hypertension. However, the downstream signaling mechanisms through which Ang II exerts its actions ar e not fully understood. We have investigated the role of Jak2 in mediating Ang II-induc ed vasoconstriction and hypertension by using mice whose VSMC are devoid of Jak2. This st udy identifies Jak2 as a mediator of Ang II-induced vasoconstriction and hypert ension through multiple non-redundant mechanisms, by contributing to increased pres ence of ROS. To our knowledge, this is the first study to report that Jak2 is invo lved in the production of ROS in VSMC, thereby being centrally located to influence many of the singling molecules involved in modulating the Ang II-induced vasoac tive effects including NO, Ca2+ and Rho-kinase. Recent studies have demonstrated t hat the Rho excha nge factor, Arhgef1, mediates the effects of Ang II on vascular tone and blood pressure, and that Jak2, by phosphorylating Arhgef1 on Tyr 738, plays a ro le in this process [56]. Our data here both confirm and extend those observations as we show that VSMC Jak2 null cells are unable to activate Rho in response to Ang II (Figure 4-8A ). In addition to phosphorylation dependent Rho kinase activation, previous studies have shown that Rho kinase can be activated by increased ROS [69,73]. The cartoon in Figure 1-4 92

PAGE 93

integrates the signaling modalities involved in the Ang II and Jak2 mediated vascular contraction. Our work here i ndicates that Jak2 generates RO S. The higher levels of ROS reduce the levels of NO in the endothelium and increase the levels of Ca2+ in the VSMC, both of which lead to enhanced contracti on. Furthermore, Jak2 can activate Rho kinase via both ROS-dependent [69,73] and phosphorylati on-dependent mechanisms [56]. Collectively, these data indicate that while Jak2 is not required for Ang II contraction per se it plays an absolutely critical role in modulating overall Ang IIinduced vascular tone via multiple, non-redundant mechanisms. We believe that by contributing to the production of ROS, Jak2 is centrally located to mediate most of the mechanisms which are known to be mediated by Ang II. This might explain the dramatically reduced in vivo hypertensive response to Ang II in VSMC Jak2 null mice when compared to t he control group. It is possible that the reduced vascular pathology observed in the null mice (Figure 4-4) is due to the lower blood pre ssure in these animals. Previous studies however have shown that Ang II has growth factor-like properties that act independent of its hemodynamic effects. For example, Ang II induc es ROS production leading to endothelial dysfunction through mechanisms that are independent of its pressor actions and norepinephrine-induced hypertension fails to elicit these same deleterious outcomes [67,68]. Additionally, administra tion of renin-angiotensin system (RAS) inhibitors provide numerous cardio prot ective effects that are independent of blood pressure reduction [146]. Based on these obser vations, we hypothesize that the Ang IIinduced vascular pathology observed in the control mice occurs via a mechanism that is independent of its pressor e ffect and instead mediated by its growth factor-like 93

PAGE 94

properties acting through Jak2. Clearly however, this needs to be demonstrated experimentally. Studies have shown that in mice, Ang II is infused at a dose rate of 1,000 ng/kg/min to achieve the relevant pathophysiological effects [147,148,149]. Dose response studies of Ang II revealed that wh ile the infusion of a dose as low as 200 ng/min/kg into rats demonstrated increases in systolic pressure by approximately 40 mmHg, which was accompanied by devel opment of cardiac hypertrophy and a decrease in body weight [150], mice requir ed a dose of 1,000 ng/min/kg of Ang II to achieve discernible patho-physiological effect s similar to those observed in humans with Ang II mediated disease pathogenesis [151]. We recognize that the dosage of Ang II used in this study is very high and superphysiol ogical. As a result, th e high levels of Ang II used in these mice could lead to additi onal non-specific vaso-active effects independent of Ang II recept ors. Therefore, interpreta tion of these results in a physiological setting in humans where the bl ood Ang II levels are significantly lower needs to be done with caution. Thus, whether Jak2 mediates Ang-induced increase in vascular tone via NO, ROS, Rho-kinase or Calcium at physiological Ang II levels in vivo still needs to be elucidated. However, the slight ly lower blood pressure at baseline in the Jak2 null mice may suggest an effect of Jak2 even at normal circulating Ang II levels. Gain-of-function, somatic mutations in the Jak2 allele are known to cause various human diseases including the classical myeloproliferative neoplasms [78]. As a consequence, great effort has been made to develop small molecule inhibitors that target Jak2 and a limited number of these inhibito rs are currently in clinical trials. While changes in parameters such as spleen size blood counts, cytokine levels, fatigue, 94

PAGE 95

neurotoxicity, and gastrointesti nal disturbanc es were monitored, our results here suggest that changes in blood pressure may also serve as a key clinical parameter to follow. In conclusion, these studies identify a novel role of Jak2 tyrosine kinase in regulating vascular tone by increasing ROS. Elevated ROS leads to increased vasoconstriction and hypertension by scavenging endothelia l NO, increasing intracellular Ca2+, and increasing Rho kinase activity. Hence, this work strongly supports the consideration of Jak2 as a new therapeutic target fo r the management of hypertension. 95

PAGE 96

X Jak2fl/flSM22 Cre(+)X Jak2fl/fl SM22 Cre(+) Jak2fl/+ SM22 Cre(+) Jak2fl/fl X Jak2fl/flSM22 Cre(+)X Jak2fl/fl SM22 Cre(+) Jak2fl/+ SM22 Cre(+) Jak2fl/fl B H RHR R R 5 3 PGK-neo R R Jak2 wildtype Jak2 floxed Jak2 null LoxP site SM22 -Cre mediated recombination Exon 2 ATG 267268 267268 278279 278279 H RHR R R 5 3 PGK-neo R R Jak2 wildtype Jak2 floxed Jak2 null LoxP site SM22 -Cre mediated recombination Exon 2 ATG 267268 267268 278279 278279A +/+ -fl/fl+/+ +fl/fl+ Jak2 Allele: 310 bp 230 bp 201 bp 355 bp Jak2 null Jak2 allele +/+ -fl/fl+/+ +fl/fl+ Jak2 Allele 310 bp 230 bp 201 bp 355 bp Jak2 nullCSM22 Cre SM22Cre:C D E C D E SM22Cre(-)Jak2fl/fl Rosa26 gal SM22Cre(+)Jak2fl/fl Rosa26 gal SM22Cre(-)Jak2fl/fl Rosa26 gal SM22Cre(+)Jak2fl/fl Rosa26 galD Figure 4-1. Generation of mice with vascu lar smooth muscle cell specific deletion of Jak2. A) Cre-mediated deletion of the Ja k2 gene; arrows indicate location of primers. B) Breeding strategy to convert the floxed Jak2 allele into a vascular smooth muscle cell specific null Jak2 muta tion. C) Results of a PCR assay to verify the presence of a flox ed Jak2 allele (top), the SM22 Cre specific amplicon (middle) and the null Jak2 a llele in vascular smooth muscle cells (bottom). D) X-Gal staining of kidney tissue sections derived from Rosa26 gal mice with and without the SM22 Cre transgene. 96

PAGE 97

A B C D E F G H I J K L H&EAnti-SMAAnti-Jak2 SM22Cre(-) Jak2+/+ SM22Cre(-) Jak2FL/FL SM22Cre(+) Jak2+/+ SM22Cre(+) Jak2FL/FL A B C D E F G H I J K L H&EAnti-SMAAnti-Jak2 SM22Cre(-) Jak2+/+ SM22Cre(-) Jak2FL/FL SM22Cre(+) Jak2+/+ SM22Cre(+) Jak2FL/FL Figure 4-2. The Jak2 protein is absent in vascular smooth muscle cells of mutant mice. Representative renal artery pict ures for hematoxylin and eosin staining, immuno-histochemistry of anti-smooth muscle actin (SMA), and immunohistochemistry of anti-Jak2 fo r the indicated genotypes; SM22 Cre(-)Jak2+/+ (A-C), SM22 Cre(-)Jak2fl/fl (D-F), SM22 Cre(+) Jak2+/+ (G-I) and SM22 Cre(+) Jak2fl/fl (J-L). 97

PAGE 98

Light Period Time (Days) -5051015202530MAP (mmHg) 90 100 110 120 130 140 150 160 Control Null Dark Period Time (Days) -5051015202530MAP (mmHg) 100 120 140 160 Control Null Ang II Ang IIA B * ** ** ** ** ** ** ** ** ** ** ** **Light Period Time (Days) -5051015202530MAP (mmHg) 90 100 110 120 130 140 150 160 Control Null Dark Period Time (Days) -5051015202530MAP (mmHg) 100 120 140 160 Control Null Ang II Ang II Ang II Ang IIA B * ** ** ** ** ** ** ** ** ** ** ** **Dark Period Time (Days) -5051015202530Heart Rate (beats/min) 400 420 440 460 480 500 520 540 560 Control Null Light Period Time (Days) -5051015202530Heart Rate (beats/min) 400 420 440 460 480 500 520 540 560 Control Null C D Figure 4-3. Deletion of vascular smooth mu scle cell Jak2 attenuates Ang II-induced hypertension. Long-term radio-telemetric recording of mean arterial pressure was performed in VSMC Jak2 null (n =6) and age-matched controls (n=6). Two base line recordings were perfo rmed before the mice were implanted with Ang II mini pumps infusing 1,000 ng/ kg/min of Ang II (day 0). Further recording was continued over the ensuing 28 days. The values shown represent daily average 12-hour mean arte rial pressure recordings for the active dark period (A) and the resting light period (B). Heart rates were also plotted as a function of both genotype and time. The average 12-hour mean heart rate recordings for the active dar k period (C) and the resting light period (D) are shown. Data represent means +/SE ( p <0.05, ** p <0.01, ANOVA). 98

PAGE 99

0 20 40 60 80 100 Untreated Ang IITotal Wall Thickness ( M)ControlNull # *B Intima Media Adventitia0 20 40 60 80 100Control-Control+Null-Null+Ang II* *# #Relative Thickness (% Total)C Control Null g Control Null g A UntreatedAng II Figure 4-4. VSMC Jak2 null mice are prot ected from Ang II induced aortic wall thickening. A) Aortic histological sections from control and VSMC Jak2 null mice were stained with trichrome. B) T he total aortic wall thickness from each animal was measured and then plotted as a function of treatment and genotype. C) Aortic wall layers of t he intima, media, and adventitia were defined, and their thickness is pres ented as a percentage of the total wall thickness. Data represent means SE; n = 6. p < 0.05 vs. untreated control; # p <0.05 vs. Ang II treated contro l, paired Student's t-test. 99

PAGE 100

0 10 20 30 40 50 60 70Ang II-induced contraction (% KCl)* ControlNull 0 10 20 30 40 50 60 70Ang II-induced contraction (% KCl)* ControlNull 0 0.1 0.2 0.3 0.4 0.5KCl-induced contraction (g)Control Null 0 0.1 0.2 0.3 0.4 0.5KCl-induced contraction (g)Control NullA C B 0 20 40 60 80 100 120Phenylephrine-induced contraction (% KCl)Control Null 0 20 40 60 80 100 120Phenylephrine-induced contraction (% KCl)Control NullD Ang-II (10-7M) Null Contraction (g)Control 03060900306090Time (Seconds) AngII (10-7M) Null Contraction (g)Control 03060900306090Time (Seconds) Ang-II (10-7M) Null Contraction (g)Control 03060900306090Time (Seconds) AngII (10-7M) Null Contraction (g)Control 03060900306090Time (Seconds) Figure 4-5. Deletion of vascular smooth muscle cell Jak2 correlates with reduced Ang II induced contraction of aortic rings. A) KCl-induced absolute contraction of aortic rings from both genotypes. B) R epresentative profiles showing Ang II (10-7 M) induced contraction in aortic ri ngs obtained from Control and VSMC Jak2 null mice. C) Aggregate Ang II-induced contraction data plotted as a percent of KCl. D) Pheny lephrine-induced contraction plotted as a percent of KCl. Data represent means +/SE (* p < 0.05; n= 8, paired Student's t-test). 100

PAGE 101

0 50 100 150 200 250Ang II-induced Contraction (% Change after EC Removal)* Control Null 0 50 100 150 200 250Ang II-induced Contraction (% Change after EC Removal)* 0 50 100 150 200 250Ang II-induced Contraction (% Change after EC Removal)* Control Null 0 50 100 150 200 250Ang II-induced Contraction (% Change after EC Removal)* EC Intact EC Denuded EC Intact EC Denuded 0 20 40 60 80 100Ang IIinduced contraction (% KCl) * ControlNull 0 20 40 60 80 100Ang IIinduced contraction (% KCl) * *A EC Intact EC Denuded EC Intact EC Denuded 0 20 40 60 80 100Ang IIinduced contraction (% KCl) * * ControlNull 0 20 40 60 80 100Ang IIinduced contraction (% KCl) * *A 0 50 100 150 200 250 300Ang IIinduced Contraction (% Change after L NAME)Null Control* 0 50 100 150 200 250 300Ang II(% Change after L NAME)* 0 50 100 150 200 250 300Ang IIinduced Contraction (% Change after L NAME)Null Control* 0 50 100 150 200 250 300Ang II(% Change after L NAME)* 0 50 100 150 200 250 300Ang IIinduced Contraction (% Change after L NAME)Null Control* 0 50 100 150 200 250 300Ang II(% Change after L NAME)* Vehicle L-NAME Vehicle L-NAME 0 20 40 60 80 100 120 140ControlAng IIinduced contraction (% KCl) * * 0 20 40 60 80 100 120 140Ang IIinduced contraction (% KCl) * * NullC B D Figure 4-6. Deletion of vascular smooth muscle cell Jak2 correlates with increased levels of nitric oxide. A) Ang II (10-7 M) induced contraction data plotted as a percent of KCl either in presence or absence of the endothelium. B) The percent change in Ang II-induced contra ction between endothelial cell (EC) intact and EC denuded aortic rings. C) Ang II-induced contraction of aortic rings pretreated with vehicl e or N(G)-nitro-L-arginin e methyl ester (L-NAME) and plotted as a percent of KCl. D) The percent change in Ang II induced contraction between vehicle treated and L-NA ME treated aortic rings for both genotypes. Data represent means +/SE (* p < 0.05; n= 8, paired Student's ttest). 101

PAGE 102

-100 -80 -60 -40 -20 0 Control + SOD Null + SOD -120 -100 -80 -60 -40 -20 0 Control Null % Relaxation % RelaxationBC-3-4-5-6-7-8Log [Ach] (M)-3-4-5-6-7-8Log [DETA NONOate] (M) 0 20 40 60 80 100 120 140 0 20 40 60 80 100 120 140 # * # # * # # * # # Vehicle Ang II Vehicle Ang IICatalaseInhibitableH2O2(% of Baseline Control)Control Null 0 100 200 300 400 500 WT Control Jak2 NullBaselineAng II (10-7 M)Ach (10-6 M) * *DAF Fluorescence/mg Tissue 0 100 200 300 400 500 Control NullBaselineAng II (10-7 M)Ach (10-6 M) * *DAF Fluorescence/mg Tissue % of Baseline Control 0 100 200 300 400 500 WT Control Jak2 Null 0 100 200 300 400 500 WT Control Jak2 NullBaselineAng II (10-7 M)Ach (10-6 M) * *DAF Fluorescence/mg Tissue 0 100 200 300 400 500 Control Null 0 100 200 300 400 500 Control NullBaselineAng II (10-7 M)Ach (10-6 M) * *DAF Fluorescence/mg Tissue % of Baseline ControlDE -120 -100 -80 -60 -40 -20 0 Control, EC Denuded Null, EC Denuded Control, EC Intact Null, EC Intact % RelaxationA 3 4 5 6 7 8Log [Ach] (M) Figure 4-7. Deletion of vascular smooth muscle cell Jak2 enhances endothelium dependent vascular relaxation due to reduced reactive oxygen species and increased nitric ox ide availability. A) Dose-dependent acetylcholine induced relaxation, plotted as a percent of maximum phenylephrine (10-6 M) induced contraction with or without the endothelium. Data represent means +/SE ( n= 8). B) Dose-dependent acetylcholine in duced relaxation, plotted as a percent of maximum phenylephrine (10-6 M) induced contraction with superoxide dismutase pretreatmen t. Data represent means +/SE ( n= 8). C) Percent DETA NONOate induced relaxation in aortic rings pre-incubated with L-NAME. D) DAF fluorescence nitric ox ide measurements in aortic rings at baseline, or following Ang II (10) and acetylcholine (10) treatment (* p < 0.05 vs. control, paired Student's t-te st). E) Catalase inhibitable H2O2 in vascular smooth muscle cells obtained from control and Jack2 null mice at baseline, and in response to Ang II treatment (* p < 0.05 vs. vehicle control, # p <0.05 vs. control, unpair ed Student's t-test). 102

PAGE 103

* * A CControl Null 0 20 40 60KCl (96 mM) Ang II (10-7 M)Calcium; % increase over baseline* 0 20 40 60KCl (96 mM) Ang II (10-7 M)Calcium; % increase over baseline* Control Null 0 20 40 60KCl (96 mM) Ang II (10-7 M)Calcium; % increase over baseline* 0 20 40 60KCl (96 mM) Ang II (10-7 M)Calcium; % increase over baseline* Control Null Control Null Time of Ang II Treatment (Hours) 02 04 06 0 0 50 100 150 200 250 Control Null B 02040600204060 AngIITime (min) p-MYPT MYPT 02040600204060 AngIITime (min) p-MYPT MYPT* *Control Null 0 100 200 300 400 500 600 700 800 0 100 200 300 400 500 600 700 800AngII02040600204060Time (min) p MYPT/MYPT (% of non -treated Control) 0 100 200 300 400 500 600 700 800 0 100 200 300 400 500 600 700 800AngII02040600204060Time (min) p MYPT/MYPT (% of non -Rho-Kinase Activity (% of Baseline Control) Baseline KCl Baseline AngII KCl BaselineAngII Baseline Control Null Baseline KCl Baseline AngII KCl BaselineAngII Baseline Control NullD Figure 4-8. Deletion of vascular smooth muscle cell Jak2 results in reduced Rho-kinase activity and intracellular Ca2+ levels in response to Ang II. A) Time-dependent Ang II induced Rho kinase activity in vascular smooth muscle cells obtained for control and VSMC Jak2 nu ll mice. B) Representative immunoprecipitation/wester n blot analysis of phos pho-MYPT showing an Ang II-induced phosphorylation of MYPT by Rho-kinase (top). All blots were quantitated via densitometric analysis and graphed as a function of genotype and time (bottom) (* p <0.05 vs. untreated condition, Friedmans test). C) KCl and Ang II-induced increase in intracellular Ca2+ as measured by fura-2 fluorescent imaging in indivi dual cells. D) The average Ca2+ responses plotted as a function of treatment and genoty pe (p<0.05 vs. control, unpaired Student's t-test). 103

PAGE 104

104 Control Trichrome Trichrome Control NullPASA B CD3 D C 0 200 400 600 800 1000 1200Albumin (ng/day)ControlNull *D Control Trichrome Trichrome Control NullPASA B CD3 D C 0 200 400 600 800 1000 1200Albumin (ng/day)ControlNull *D Figure 4-9. VSMC Jak2 null mice are prot ected from Ang II-induced renal damage. A) Trichrome blue staining showing fibrosis in the interstitial (upper panel) and around glomeruli (lower panel) in the c ontrol and Jak2 null mice treated with Ang II. B) Periodic Acid Schiff staining showing glomerular degeneration and enlargement in the control mice, but not in the Jak2 null mice treated with Ang II. C) Immunohistochemistry of CD3 showing increased T-lymphocyte infiltration in control mice, but not in the Jak2 null mice. D) Urine albumin excretion in the Ang II treated control and Jak2 null mice. *p<0.05 versus Ang II treated control.

PAGE 105

CHAPTE R 5 4VASCULAR SMOOTH MUSCLE JAK2 DELETION PREVENTS ANGIOTENSIN IIMEDIATED NEOINTIMA FORMATION FOLLOWING INJURY IN MICE Damage to the vascular endothelial cell (E C) layer often caused by stenting, angioplasty, or bypass surgery is one of t he initial key events in the pathogenesis of various vascular diseases including neointim a formation, atherosclerosis, restenosis, and hypertension. It causes phenotypic sw itching of vascular smooth muscle cells (VSMC) from a contractile to a synthetic phenotype characterized by increased cell proliferation, migration, and production of extracellular matrix [152,153]. Neointima formation resulting in vascular EC injury is also characterized by a general loss of critical VSMC contractile ma rkers including smooth muscle -actin (SMA), myosin heavy chain (SM-MHC), SM22 and calponin (CNN) [153,154]. However, the mechanistic processes that trigger thes e phenotypic alterations are still not fully understood. Janus kinase 2 (Jak2) is well known fo r its role in hematopoiesis and cytokine signaling. Mice that are completely Jak2 null die at embryonic day 12.5 due to impaired hematopoiesis and profound anemia [27,28]. Conversely, mutati ons that lead to hyperkinetic Jak2 kinase activity result in va rious hematological diseases characterized increased cell proliferation and hematopoiesis [78]. As a c onsequence, numerous Jak2 inhibitors are currently under pr e-clinical and clinical investigation for their potential in the treatment of Jak2 mediated hematol ogical diseases, but to date, none have been approved. 4Reproduced with permission from Kirabo A, Oh SP, Kasahara H, Wagner KU, Sayeski PP (2011) Vascular smooth muscle Jak2 deletion prevents angiotensin II-mediated neointima formation following injury in mi ce J Mol Cell Cardiol. 50(6):1026-34. 105

PAGE 106

It is well accepted that the Jak2 signaling pathway couples to the angiotens in II type 1 receptor (AT1-R) [155]. However, the physi ological and/or pathological importance of this couplin g is poorly understood in the in vivo setting. Angiotensin II (Ang II) has been shown to exhibit growth promoting and migrat ion properties in cultured VSMCs [13,15]. In addition, chr onic infusion of Ang II induces VSMC proliferation in normal and injured vessels in vivo [9,18]. Unfortunately, there have been conflicting reports as to which kinase si gnaling pathway(s) mediat e(s) Ang II-induced cell proliferation and migrati on. For instance, some studies have shown that Ang II mediates its growth promoting effects vi a the Mitogen-Activated Protein (MAP) kinase pathway in vitro [14]. On the other hand, studies have reported a correlative involvement of the Jak/STAT signaling pathway in the growth factor-like signaling properties of Ang II and subsequent vascu lar neointima formation [49,156]. Previous attempts to determine the specific kinase pathway involved in Ang II-induced neointima formation have been limited by the lack of s pecific kinase inhibitors and the lack of conditional knockout animal models. For ex ample, AG490 has been used in these types of studies [49], but in addition to inhibiting Jak2, it also inhibits Jak3 and MAP kinase [157]. Thus, it is still unclear which kinas e signaling pathway acts downstream of the AT1-R to mediate VSMC proliferation, migration, and neointima formation. Previous studies have long shown that Ang II binding causes physical interaction of Jak2 with the AT1-R resulting in the subsequent acti vation of the Signal Transducers and Activators of Transcription (STAT) proteins [30]. Activated STATs in turn form homoand hetero-dimers which translocate into the nucleus and bind cis -inducible elements resulting in the activation of growth promoting genes [158,159]. However, 106

PAGE 107

there is no evidence indica ting that the pathological AT1-R-mediated growth effects occur exclusively through Jak2. The current study was aimed at determining whether Jak2 plays a central role in the pathogenes is of Ang II-mediated neointima formation following injury. Using an approach whereby we conditionally deleted Jak2 from the VSMC of mice, our data indicate fo r the first time that Jak2 pl ays a rate liming role in the causation of Ang II-induced neointima formation following vascular injury in vivo Materials and Methods Animals Male mice generated on an FVB backgr ound strain were used in these experiments. All procedures using laboratory animals were approved by the Institutional Animal Care and Use Committee at the Universi ty of Florida. Animals were maintained in accordance with NIH standards established in the Guidelines for the Care and Use of Experimental Animals. Generation of Knockout Mice VSMC deletion of Jak2 was achieved by cr ossing mice carrying loxP sites around the first coding exon of the Jak2 gene [160] with mice expressing Cre recombinase under the control of the SM22 promoter [161]. Specifica lly, male mice of genotype SM22 CreJak2fl/+ were crossed with Jak2fl/fl females, which resulted in mice whose VSMCs are devoid of Jak2 (SM22 Cre(+)Jak2fl/fl). Genotypin g was done by PCR using primers 5-GCTAAACATGCTTCATCGTCGGTC and 5CAGATTACGTATATCCTGGCAGCG in the Cre coding region, 5ATTCTGAGATTCAGGTCTGAGC and 5-CTCAC AACCATCTGTATCTCAC in the Jak2 coding region, and 5-GTCTATACACCACCACTCCTG and 5GAGCTGGAAAGATAGGTCAGC to identify the null Jak2 allele. Expression of VSMC 107

PAGE 108

SM22 Cre was confirmed by crossing mice expressi ng SM22 Cre(+)Jak2fl/fl with Rosa26 -galactosidase reporter mice, and XGal (5-bromo-4-chloro-3-indolyl -Dgalactoside) staining was analyzed as previously described [140]. Vascular Injury Model Iron chloride-induced vascular injury was ca rried out as previously described with a few modifications [162]. Briefly, mice at 3 months of age were anaesthetized using isoflurane. An incision was made directly on top of the right common carotid artery and vascular injury was induced by applying a ster ile Q-tip saturated with 10% ferric chloride (Sigma, St. Louis, MO, USA) for 3 minut es. The left common carotid artery was exposed by blunt dissection, but not injured and thus served as a contralateral control. At the same time, the animals received an Alzet Model 1004 osmotic minipump (Alzet Corp) for subcutaneous infusion of 1,000 ng/ kg/min of Ang II [151]. The incision was closed and the animals were allowed to recove r. To prevent thrombosis, animals were injected subcutaneously with 20 units of hepar in prior to surgery. Animals were euthanized at 7 days (n=6 for each genotype) or 14 days (n=6 for each genotype) following vascular injury. The carotid arte ries were fixed using 10% formalin and processed for histological dete rmination of neointima formation. Histology Tissue samples were prepared for histology as previously described [168]. Briefly, tissues were fixed overnight at 4C in 10% buffered formalin (Fisher Scientific, Pittsburgh, PA). The tissues were subs equently dehydrated th rough a graded ethanol series, paraffin embedded and sectioned. Five mi crometer sections were stained with hematoxylin and eosin (H&E) for morphological analysis. Transverse sections of the carotid arteries were subjected to morphometry for assessing the intima/media ratio (I/M 108

PAGE 109

ratio). Other tissues were stained with Massons trichrome using a kit (87019 RichardAllan Scientific) for analysis of fibrosis. Immunohistochemistry 5 micron sections mounted on gelatin-coated slides were dewaxed in ethanol, rehydrated, then blocked in 3% H2O2 followed by 5% normal goat serum. Sections were exposed to the primary antibody overnight at 4oC, washed, and then treated with the biotinylated secondary antibody. After secondary antibody incubation, the samples were washed, exposed to the avidin-perox idase reagent (Vectastain Elite, Vector Laboratories, Burlingame, CA), and react ed with diaminobenzidine to produce a brown reaction product. The sections were dehydr ated in ethanol, mounted with Permount, and observed by light microscopy. Immunohist ological detection of anti-smooth muscle -actin (CM001B) was carried out using t he Rat on Mouse AP-Polymer Kit (Biocare Medical) according to the manufacturers instructions. Anti-Jak2 (ab39636 Abcam), antiphospho-Jak2 (Ab32101 Abcam), anti-phos pho-STAT5 (Ab32364 Abcam), and Ki-67 (M7249 DAKO) immunohistochemical detection was performed as previously described [163]. Apoptosis detection was carried out using a TUNEL staining kit (S7100 Chemicon) according to the manufacturers instructions. Immunoblotting Protein sample was extracted from the homogenates of prim ary VSMC cultures and immunoprecipitated using STAT3 antibody (SC-482, Santa Cruz), or STAT5 antibody (SC-28685, Santa Cruz), followed by western-blotting using phospho-STAT3 antibody (SC-8059, Santa Cruz ), or phospho-STAT5 antibody (716900, Invitrogen) respectively, as previously described [164]. 109

PAGE 110

Cell Proliferation VSMCs from each genotype were isolated and cultured as described [165]. Ce ll proliferation was assessed on the basis of mitochondrial dehydrogenase activity of the cells using the MTT dyereduction assay [166]. In brief, after t he addition of ligand or vehicle, the cells were incubat ed with the MTT labeling solution (0.5 mg/mL) at 37C for 4 hours. The cells were then solubilized in 100 L of 0.1N HCl an d isopropyl alcohol, and shaken for 30 seconds on a plate rotato r. Absorbance at 540 nm was measured with the use of a microtiter plate reader with a reference wavelength of 690 nm. Cell counts were also carried out to determine th e number of viable cells using trypan blue exclusion. Cell Migration The migration of VSMCs was determined using a QCMTM 24-well colorimetric cell migration assay kit (Millipore) according to t he manufacturers instructions. Briefly, the cells were suspended in serum free media (DMEM) at a concentration of 1 x 106 cells/mL. 0.3 mL aliquots of the cell suspension were added to the top chambers of the transwell membranes with 8-m pores. The lower transwell compartments contained 0.5 mL of DMEM containing various mi gration factors including Ang II (10-7M), FBS (10%) or platelet-derived growth factor (PDGF-BB) (20 ng/ ml). Incubation was continued for 24 hours at 37C in a CO2 incubator. The adherent cells were then stained, washed, and allowed to air dry. The die was extracted from the cells, and optic density was measured at 560 nm. Apoptosis Annexin V/propidium iodide st aining was employed to determine early apoptosis in the control and the Jak2 nu ll VSMCs. VSMCs were serum-starved overnight and then 110

PAGE 111

treated with either vehicle, 10% FBS, 20 ng/ml PDGF or 10 7 M Ang II for 24 h. Cells (105) were re-suspended in 100 l of 1x binding buffer and apoptotic levels were determined via the FITC Anne xin V Apoptosis Detection Kit (BD Pharmingen) following the manufacturer's instructions and anal yzed on a FACSCalibur flow cytometer (BectonDickinson).Apoptotic cells were also identified using the terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) method which specifically labels the 3 -hydroxyl termini of DNA strand breaks. The TUNEL assay was carried out using the ApopTag Fluore scein In Situ Apoptosis Detection Kit (Millipore) according to the manufacturer's instructions. Statistical Analysis All results were expressed as means +/ SEM. Statistical comparison of the different genotypes were per formed by unpaired Students t test. P values of less than 0.05 were considered statistically significant. Results Deletion of VSMC Jak2 Prevents Ang II -Mediated Neointima Formation and Narrowing of the Vascula r Lumen Following Injury Vascular remodeling is a pathologic response to vascular injury characterized by VSMC proliferation, migrat ion, neointima formation, and a narrowing of the vascular lumen [167]. We wanted to determine whether VSMC Jak2-null mice are protected from neointima formation and narrowing of the vascular lumen following vascular injury. For this, the right carotid arteries of control (SM22 Cre(-);Jak2fl/fl) and VSMC Jak2-null (SM22 Cre(+);Jak2fl/fl) mice were subjected to iron chloride-induced vascular injury with simultaneous Ang II infusion. Left caro tid arteries were exposed via blunt dissection, but not subjected to iron ch loride-induced injury and thus served as 111

PAGE 112

contralateral controls. Mice were euthaniz ed 7 and 14 days later. H&E representative sections in Figure 5-1A show a clear increase in thickness of the neointima in the injured arteries of the control mice at day 7 and 14, but neither in the VSMC Jak2-null mice nor any of the contralateral arte ries. Using computer assisted quantitative morphometric analysis we found that compared to the non-injured contralateral carotid arteries, vascular injury induced significant increases in the intima/media ratio in the control mice at day 7 and 14, which was lack ing in the VSMC Jak2 null mice (Figure 51B). As a consequence, there was a signific ant narrowing on the carotid artery lumen in the injured arteries from the control mice while the VSMC Jak2-null mice were protected from this deleterious effect (Figure 5-1C). These collective results suggest that deletion of VSMC Jak2 prevents neointima forma tion and the subsequent narrowing of the vessel following vascular injury. Deletion of VSMC Jak2 Prevents Ang II-Mediated Vascular Fibrosis Following Injury Vascular fibrosis is an important com ponent of vascular injury response [168]. Thus, we quantified extracellular matrix (E CM) deposition using trichrome-blue staining of sections from iron chloride-injured contro l and Jak2 null mouse carotid arteries 7 and 14 days after injury. Representative sections indicated that the dens ity of trichrome blue staining was significantly reduced in the Ja k2 null mice at both time points when compared to the control group (Figure 5-2A ) and quantitative analysis of all sections found this difference to be significant (Figure 5-2B). Overall, these results suggest that deletion of VSMC Jak2 reduces Ang IIinduced ECM deposition following vascular injury. 112

PAGE 113

Deletion of VSMC Jak2 Prevents the Loss of Smooth Muscle -actin in Response to Ang II-Mediated Vascular Injury Vascular injury is known to reduce the expression of contractile markers within VSMC [152,153]. We hypothesized that the Jak2-null mice w ould be protected from the injury-induced loss of smooth muscle -actin (SMA). Immunohist ochemistry of injured carotid sections showed that there was a significant loss of SMA immunoreactivity (red stain) at both day 7 and day 14 in the cont rol mice when compared to the contralateral carotid artery (Figure 5-2C). However, SMA staining was preser ved in the injured carotid arteries in the Jak2 null mice, and was comparable to that observed in their contralateral arteries. Quantit ative analysis of all sections again found this difference between the two genotypes to be significant (Figure 5-2D). As such, these results suggest that VSMC Jak2-null mice are prot ected from the loss of the contractile phenotype that occurs following vascular injury. Deletion of VSMC Jak2 Prevents Neointim a Formation by Inhibiting Cell Proliferation and Inducing Apoptosis We hypothesized that a mechanism whereby deletion of VSMC Jak2 prevents neointima formation is via reduced cellular prolif eration. To determine this, the levels of the proliferative marker, Ki-67, were m easured in sections from each condition. Representative sections indicated an increase in the number of Ki-67 positive nuclei in the injured arteries of the control mice at day 7 and 14, but not in the VSMC Jak2 nullmice (Figure 5-3A). Quantification of Ki-67 positive nuclei across all sections found that when compared to the non-injured contralate ral arteries, injury caused significant increases in the number of Ki -67 positive cells in the cont rol mice at day 7 and 14 and this was lacking in the Jak2-null mice (Figur e 5-3B). These results suggest that deletion of VSMC Jak2 prevents neointima formation by inhibiting cell proliferation. 113

PAGE 114

Previous studies have shown that inducti on of apoptosis is a possible mechanism for the prevention of neointima formation [156 ,169]. Therefore, we wanted to determine whether the reduced neointima formation obs erved in the VSMC Jak2-null m ice correlates with increased apoptosis. Shown ar e representative TUNE L stained sections (Figure 5-3C; brown stained ce lls indicated by red arrows ) and the average number of TUNEL positive cells plotted as a function of treatment group (Fi gure 5-3D). There was no significant difference in the number of TUNEL positive cells observed in injured carotid arteries taken from the contro l group when compared to the non-injured, contralateral arteries. In contrast, there was a significant increase in the number of apoptotic cells 7 days after injury in the Jak2-null mice and this returned to near baseline levels by day 14. Al together, the results in Figure 5-3 suggest that VSMC Jak2 deletion prevents neointima fo rmation by inhibiting ce ll proliferation and inducing apoptosis in VSMCs. VSMC Jak2 Induces Neointima Formation by Increasing Phosphorylation of Jak2 and STAT5 Immunohistochemistry was carried out in order to determine the relative levels of Jak2, phospho-Jak2, and phospho-STAT5 (a downstr eam target of Jak2) in the injured and non-injured carotid arteries of both the control and VSMC Jak2-null mice (Figure 54). With respect to the control mice, we found that there we re readily detectable levels (brown stain) of Jak2, phospho-Jak2 and phos pho-STAT5 in the contralateral arteries and vascular injury increased this staining pa ttern both in the media and neointima. With respect to the VSMC Jak2-null mice, there was little to no staining for Jak2, phosphoJak2, and phospho-STAT5 both in the contrala teral control and the injured arteries. 114

PAGE 115

These results demonstrate that the reduc ed neointima formation observed in the VSMC Jak2-null mi ce correlates with reduced phosphor ylation of Jak2 and STAT5 in VSMC. VSMC Jak2 Mediates Ang II-Induced Ce ll Proliferation and Migration In order to determine whether the Jak2 dependent effects observed in vivo are specific for Ang II per se we isolated VSMC from control and VSMC Jak2-null mice and cultured them ex vivo The cells were subsequently tr eated with either vehicle, 10% FBS, platelet derived growth factor (PDG F), or Ang II, and then evaluated for cell proliferation and cell mi gration properties. For the contro l cells, FBS, PDGF, and Ang II all induced robust cell prolifer ation (Figure 5-5A). For the VSMC Jak2 null cells, FBS and PDGF induced robust cells proliferation while Ang II did not (Figure 5-5B), using MTT dyereduction assay. Similar results were obtained when we counted the number of viable cells using trypan blue exclusio n (Figure 5-5C and 5-5D). These results suggest that Jak2 mediates A ng II-induced VSMC pr oliferation. Next, we wanted to determine the role of Jak2 in VSMC migration in response to these same stimuli. We found that there wa s no significant difference in cell migration between the genotypes when the cells were tr eated with FBS or PDGF (Figure 5-5E). However, when the cells were treated with A ng II, cell migration in the Jak2-null cells was significantly attenuated when compared to the control cells (Figure 5-5E), suggesting that Jak2 mediates Ang II induced cell migration. Collectively, the data in Figure 5 correlate the specific loss of VSMC Jak2 with significantly impaired Ang IImediated VSMC proliferat ion and migration. VSMC Jak2 is Required for Ang II-Mediated Cell Survival The in vivo immunohistochemistry data indicate that Jak2 promotes cell survival as cells that lack Jak2 are more prone to apopt osis after injury (Figure 5-3C and 5-3D). 115

PAGE 116

Here, we wanted to determine whether this Jak2-dependent event was specific for Ang II. For this, primary cultures of VSMC from control and VSMC Jak 2-null mice were serum starved overnight. The following day, the cells were treated with the indicated ligands and early apoptosis was measured 24 h later. We found that in the control cells, ~10% of all cells treated with vehicle contro l solution were in early apoptosis (Figure 56A). Treatment with FBS, PDGF, and Ang II pr omoted cell survival as indicated by the lower levels of apoptosis in these cells. When the same experiment was performed in the VSMC Jak2-null cells, the abi lity of Ang II to decrease the levels of apoptosis was lost, thereby indicating a critical role for Jak2 in Ang II-mediated cell survival. To demonstrate this using an alternate approach, t he cells were treated in the same way, but this time apoptosis levels were measured via TUNEL stain, an i ndicator of both early and late apoptosis (Figure 5-6B). Similarly, we found that Jak2 is essential for promoting Ang II-mediated cell survival since the null cells were unable to decrease the levels of apoptosis in response to Ang II. As such, these data correlate with our in vivo data suggesting that the VSMC Jak2-null mice have reduced Ang II-mediated neointima formation due to increased apoptosis. VSMC Jak2 deletion is associat ed with reduced Ang II -mediated activation of STAT3 and STAT5 We next wanted to determine whether the activation of the Jak2/STAT signaling pathway is also specific for Ang II. For th is, we analyzed the relative abilities of FBS, PDGF and Ang II to induce phosphorylation of STAT3 and STAT5; both of which are mitogenic proteins and are downstream signa ling targets of Jak2. With respect to STAT3, ligand induced phosphorylation of STAT3 was significantly reduced in the null cells when compared to the control cells for all conditions (Figur e 5-7A and 5-7B). 116

PAGE 117

These results suggest that activation of STAT3 is primarily mediated by Jak2 since the absence of Jak2 renders the cells inc apable of phosphorylating STAT3 under any condition. In addition, we found that wit hin the control cells, the Ang II-induced phosphorylation of STAT3 was significantly increased, when compared to the other stimulating ligands. With respect to ST AT5, the phospho-STAT5 levels were not significantly different i n the FBS and PD GF treated control cells when compared to vehicle treated cells, but were significantly di fferent in the Ang II tr eated cells (Figure 57C and 5-7D). Furthermore, there was no significant difference in ligand induced phosphorylation of STAT5 amongst the Jak2-null cells (Figure 5-7C and 5-7D). As such, these results suggest that Jak2 is t he primary mediator of Ang II-induced phosphorylation of STAT5, and that activation of the Jak2/STAT5 pathway is specific for Ang II. Discussion Neointima formation is a pathologic consequence of vascular endothelial damage which often results from various risk factors including percutaneous vascular surgery procedures. We have investigated the im pact of VSMC deletion of Jak2 on the prevention of Ang II-mediated ne ointima formation following vascular injury in mice. This study identifies Jak2 as a critical mediator of the pathological processes involved in Ang II-mediated neointima formation. To our knowledge, this is t he first report to establish a causal relationship between Jak2 and Ang II-mediated neointima formation following vascular injury. Following endothelial da mage, the process of neointim a formation starts with an initiation of VSMC prol iferation and migration into the intima, followed by a sustained proliferation of VSMC in t he neointima [167,170]. This compromises the vascular lumen, 117

PAGE 118

and limits blood supply to distal areas of the vessel. Ang II pl ays a key role in mediating the processes involved in the pathogenes is of neointima formation following vascular injury [171]. However, the specific mechani sms involved in Ang II-mediated neointima formation remain largely unidentified. Ang II induces tyrosine-phosphorylation and activation of Jak2 in rat VSMC resulting in activation of its downstream signaling substrates, the STATs [30]. Subsequent st udies showed that the Ang II-induced activation of Jak2 results in proliferation of cultured VSMC [31]. We found that not only did VSMC Jak2 deletion prev ent Ang II-induced neointima fo rmation, but it also prevented the pathological phenotypic alterati ons induced by vascular injury including vascular fibrosis and loss of the contractile marker, SMA. The mechanisms by which VSMC Jak2 deletion prevents neointima formati on include inhibition of cell proliferation and migration. Furthermore, we found that Ang II-induced activation of the proliferative proteins, STAT3 and STAT5, is impaired in the VSMC Jak2-null cells. The Jak2mediated growth promoting and migratory effe cts are specific for Ang II since other ligands such as 10% FBS and PDGF did not lead to differential effects on cell proliferation and migration in the control and the Jak2-null cells. From these data, we conclude that Jak2 plays a rate liming role in the causation of Ang II-induced neointima formation following vascular injury in vivo It is well established that Ang II plays a key role in mediating neointima formation following vascular injury [171]. This provided us with an excellent model of examining the role of VSMC Jak2 deletion in an env ironment in which neointima formation following injury is exacerbated by chronic Ang II infusion. Although studies have shown that the Jak2 signaling pathway couples to the AT1-R resulting in VSMC proliferation in 118

PAGE 119

vitro [155], the only study to date examining the relati onship between Jak2 and neointima formation in vivo reported that Jak2 is only transiently expressed during the process of neointima formation [49]. The same study also reported that treatment of vascular strips with Ang II ex vivo enhances phosphorylation of Jak2 [49]. Therefore, until now, the pathophysiological link betwe en Jak2 and Ang II-mediated neointima formation has been only correlative and no st udy has implicated Jak2 in playing a causative role in Ang II -mediated vascular remodeling in vivo Placing the Cre recombinase cDNA under t he control of tissue specific promoters has allowed for the conditional deletion of genes such as Jak2. However, previous work has clearly demonstrated that t he pattern of Cre expression in the targeted tissue is a mosaicism [172,173]. In other words, most ce lls will express Cre, but some will not. The reason(s) for this is not fully understood, but it is thought that it may be due to modifying events such as epigenetic silencing of the transgene within a given cell [174,175]. Hence, the gene targeted for deletion, in this case Jak2, is not remo ved from the cell. Quantitative examinati ons of our anti-Jak2 immuno-hist ochemistry (Figure 5-4) as well as Rosa26/LacZ expression patterns (data not show n) indicate that Jak2 is deleted from ~95% of all VSMC in the carotid arteries of these mice. This degree of deletion is clearly enough to impair Jak2 function as det ermined by the significantly reduced VSMC migration, VSMC proliferati on, neo-intimal formation, and preservation of contractile markers, when compared to controls. Giv en that Jak2 has been implicated in a number of cardiovascular diseases including hy pertension, heart failure, and diabetes [56,176,177,178], we now have an ex cellent model for the future examination of the role of VSMC derived Jak2 in thes e and other disorders. 119

PAGE 120

In conclusion, the present study demonstrated for the firs t time that Jak2 plays a central role in the causation of Ang IIinduced neointima formation following vascular injury in vivo Therefore, inhibition of Jak2 may provide a potential prophylactic therapeutic strategy for prevention of neointima formation. In addition, Jak2 inhibition may prevent initiation and progr ession of neointima thickening following angioplasty and/or vascular stenting. 120

PAGE 121

0 0.5 1 1.5 2 Contralateral InjuredDay 7 Day 14 Day 14 Day 7 ControlNullIntima/Media Ratio **Day 7Day 14 Day 7Day 14Injured Contra-lateralControl Null 0 5000 10000 15000 20000 25000 30000 35000Lumen Area ( M2)Day 7Day 14Day 7Day 14Control Null * 0 5000 10000 15000 20000 25000 30000 35000Lumen Area ( M2)Day 7Day 14Day 7Day 14Control Null * A B C Figure 5-1. Deletion of VSMC Jak2 prev ents Ang II-mediated neointima formation and narrowing of the vascular lumen followi ng injury. A) H&E stained sections showing neointima formation in control mice. The dotted lines separate the intima from media. B) Intima/medi a ratio. C) Lumen area. *p<0.05 vs. contralateral control, **p<0. 01 vs. contralateral control. 121

PAGE 122

Day 7Day 14Day 7Day 14InjuredContralateralControl NullDay 7Day 14 Day 14 Day 7 Control Null C D 0 20 40 60 80 100 120 140 160 Contralateral Injured -SMA Staining Intensity (% of Contralateral Control)* *Control NullDay 7Day 14 A 0 40 80 120 160 200 *TrichromeBlue (Relative Density)Day 7Day 14Day 7Day 14ControlNullB Figure 5-2. Deletion of VSMC Jak2 prevent s Ang II-mediated fibrosis and loss of SMA following injury. A) Trichrome-blue stained sections showing increased collagen density in control mice. B) Quant ification of trichr ome-blue staining. C) Immunohistochemistry of SMA. D) Q uantification of SMA staining. *p<0.05 vs. contralateral non-injured artery. 122

PAGE 123

Day 7Day 14Day 7Day 14InjuredContralateralControl Null 0 5 10 15 20 25 30 Contralateral InjuredNumber of TUNEL positive cellsDay 7Day 14 Day 14 Day 7 Control Null C D Day 7Day 14Day 7Day 14InjuredContralateralControl NullNumber of Ki-67 positive cellsDay 7Day 14 Day 14 Day 7 Control Null A B 0 5 10 15 20 25 30 Contralateral Injured* Figure 5-3. Deletion of VSMC Jak2 inhibits cell proliferation and induces apoptosis. A) Representative sections showing immunohistochemistry of Ki-67. B) Quantification of the number of Ki-67-positive nuc lei. C) Representative sections showing immunohistochemistry of TUNEL. D) Quant ification of the number of TUNEL positive cells. *p<0 .05 vs. contra-lateral non-injured control. 123

PAGE 124

ContralateralInjuredContralateralInjured Control Jak2 Null Jak2 p-Jak2 p-STAT5 Figure 5-4. VSMC Jak2 induces neointim a formation by increas ing phosphorylation of Jak2 and STAT5. Immunohistochemistry of representative sections showing relative expression of Jak2, phospho-Jak2 and phospho-STAT5 in injured and non-injured carotid arteries of the control and the Jak2-null mice. 124

PAGE 125

Null Time (Hours) 020406080Cell Proliferation (OD 560) 0.0 0.5 1.0 1.5 2.0 2.5 FBS PDGF Ang II Vehicle Control Time (Hours) 020406080Cell Proliferation (OD 560) 0.0 0.5 1.0 1.5 2.0 2.5 FBS PDGF Ang II Vehicle A B 50 60 70 80 90 100 110 WT Control Jak2 NullFBS (10%)PDGF (20 ng/ml)Ang II (10-7M)Cell Migration: % of FBS Response in Control Cells* 50 60 70 80 90 100 110 WT Control Jak2 NullFBS (10%)PDGF (20 ng/ml)Ang II (10-7M)Cell Migration: % of FBS Response in Control Cells*Null Time (Hours) 020406080Number of viable cells (% of control) -50 0 50 100 150 200 250 FBS PDGF Ang II Vehicle Control Time (Hours) 020406080Number of viable cells (% of control) -50 0 50 100 150 200 250 FBS PDGF Ang II Vehicle C D E * * * ** * * * Figure 5-5. VSMC Jak2 mediates Ang II-i nduced cell proliferation and migration. VSMC were treated with 10% FBS, 20 ng/ml PDGF or 10-7M Ang II as indicated. Resulting cell proliferation of the control cells A) and VSMC Jak2 null cells B) is shown using MTT dyereduction assay. C) and D) cell proliferation using trypan blue exclusion. E) Cell migrat ion in these same cells. *p<0.05 vs. control. Shown are mean +/SEM for three independent experiments, each run in triplicate. 125

PAGE 126

Figure 5-6. Jak2 is required for Ang II-mediated VSMC survival. After overnight serum starvation, VSMC were treated with vehi cle control solution, 10% FBS, 20 ng/ml PDGF or 10 7 M Ang II as indicated. Twent y-four hours later, apoptosis levels were measured via annexin V/pr opidium iodide selection (A) or via TUNEL staining (B). p 0.05 versus vehicle treated, # p 0.05 versus control genotype. Shown are meanSEM for th ree independent ex periments, each run in triplicate. 126

PAGE 127

p-STAT5 STAT5 & # +/+ -/-+/+ -/-+/+ -/+/+ -/10% FBS PDGFAng II VehicleCD p-STAT5/STAT5 p-STAT3 STAT3****+/+ -/-+/+ -/-+/+ -/+/+ -/10% FBS PDGFAng II VehicleAB p-STAT3/STAT3 0 0.02 0.04 0.06 0.08 0.1 0.12 0.14 0.16 0.18 0.2Vehicle10% FBSPDGFAng II Control Null 0 0.02 0.04 0.06 0.08 0.1 0.12 0.14 0.16Vehicle10% FBSPDGFAng II Control Null# Figure 5-7. VSMC Jak2 deletion reduces Ang II-mediated activation of STAT3 and STAT5. A) Representative blots of phospho-STAT3 and STAT3. B) PhosphoSTAT3 quantification. C) Representative blots of phospho-STAT5 and STAT5. D) Phospho-STAT5 quantification. *p<0.05 versus ligand-treated control cells, #p<0.05 vs. vehicle-tr eated control cells, &p<0.05 vs. Ang II treated control cells. Shown are mean +/SEM for three independent experiments. 127

PAGE 128

CHAPTE R 6 CONCLUSIONS AND PERSPECTIVES Jak2 tyrosine kinase is an emerging ther apeutic target for various disorders including hematological malignancies and cardio vascular diseases. In this dissertation, we showed for the first time that G6, a small molecule Ja k2 inhibitor developed in our lab, has therapeutic efficacy against two independent mouse models of Jak2-mediated hematological malignancies. We also demonstra ted that mice lacking Jak2 within VSMC are largely protected from cardiovascular diseases including hypertension, kidney damage, and neointima formation following vascu lar injury. In addition to providing a new superior inhibitor of Ja k2-mediated disorders, the ma in significance of these studies is that they reveal Jak2 as a pot ential new therapeutic tar get for treatment of cardiovascular disease. A detailed account of the implications and perspectives of the studies in this dissertation is discussed below. Jak2 is Important in Mammalian Biology Jak2 tyrosine kinase plays a critical role in cytokine signaling and hematopoiesis. It is activated by many different growth fa ctors and cytokines incl uding erythropoietin (EPO), growth hormone (GH), prolactin (PRL), interferon (IFN) and interleukins (IL) [179,180]. Jak2 knockout mice die around embryonic day 12.5 due impaired erythropoiesis [27,28]. These reports suggest that Jak2 is essential for mammalian biology and development. Although Jak2 is ubiquitously expressed in all mammalian tissue, the biological and physiological importance of its expression in the individual tissue systems is largely unknown. Traditionally Jak2 is known to be localized in the cytoplasm associated with cytoki ne receptors, as well as the plasma membrane. Recent reports have, however, shown that Jak2 can be localized in the nucleus, where it is 128

PAGE 129

kinetically active, playing a role in nuclear factor stabilization and histone phosphorylation [181,182,183]. The physiological outcome of the nuclear actions of Jak2 is not fully unders tood. Understanding t he specific functioning of Jak2 would require creating tissue specific conditional Jak2 deletion animal mo dels. In addition, there is need to carry out tamoxifen-induced deletion of Jak2 at various stages of development in order to determine whether it is important at all sta ges of life. There is also need to develop specific Jak2 inhibito rs in order to gain insight into the in vivo roles of Jak2. Jak2 plays a Critical Role in the Pat hogenesis of Hematological Malignancies Despite its beneficial role in mammalian biology and development, aberrant Jak2 signaling has been linked to various human dis eases. Constitutive Jak2 signaling via either cytokine-autocrine signa ling or formation of Jak2 fusion proteins has been implicated in the causation of cancer [ 184,185,186]. Hyperkinetic Jak2 kinase activity has also been linked to a number of hematological mali gnancies including acute lymphoid leukemia and chronic myeloid leuk emia [85,86]. Somatic mutations in Jak2 are also responsible for the causation of MPN, which have a high prevalence in the United States. There are approx imately 22 cases of PV, 24 cases of ET, and 1.46 cases of PMF out of every 100,000 people, whic h amount to 65,243 pati ents with PV, 71,078 with ET, and 4,330 with PMF in the United States. Some cases of leukemia, lymphoma, and myeloma are Jak2-mediated, and these have a combined incidence of 48 per 100,000 in the United States. Despite the high incidence of Jak2-mediated neoplastic conditions, there are currently no effective treatments. The only available treatments for MPN are only palliative involving platel et-lowering agents such as phlebotomy, hydroxyurea, anagrel ide and interferon. Although these treatment strategies provide 129

PAGE 130

some temporary relief, they are not curative and they produce a wide range of undesirable side effects. Thus, there is need to develop molecularly targeted treatment options which are effective in eliminating the etiology of the disease, rather than providing temporary symptomatic relief. The discovery of the specific Jak2 mutations such as the Jak2-V617F mutation has brought us a step closer to achieving this goal. The Jak2-V617F has been associated with mo st patients with MPNs; ~98% of all PV cases, and ~50% of all ET and PMF cases [80,81,82,83,84]. As a consequence, this somatic cell gain of function mutation has been an important target for drug development. Therapeutic Efficacy of Jak2 Inhibito rs in Hematological Malignancies Although numerous attempts have been m ade to develop small molecule Jak2 inhibitors, their therapeutic potential in treating hematological malignancies is still questionable. Many of these compounds are very potent in inhibiting Jak2 in vitro with reasonable specificity, but they are unable to alleviate the disease burden in vivo For example, small molecule Jak2 inhibitors CEP-701, INCB16562 an d CYT387 exhibited significant efficacy in inhibi ting Jak2-V617F-mediated neoplasia in vitro and provided only palliative improvements in vivo [93, 100, 114]. There was a general failure of these compounds to alleviate the burden of bone marrow-derived Jak2-V617F mutant clones in vivo [100, 114,116,132]. Thus, there is still need to develop small molecule Jak2 inhibitors that have targeted therapeutic e fficacy in the bone marrow, which is the specific site of hematolog ical disease progression. G6 has Exceptional Bone Ma rrow Therapeutic Efficacy In this dissertation, we show that a small molecule Jak2 inhibitor, G6, demonstrates excellent therapeutic e fficacy using cell lines cultured in vitro and in vivo 130

PAGE 131

using two independent mouse models of Jak2-V617F-m ediated disease pathogenesis. This work is specifically significant because in contrast to other previously reported Jak2 inhibitors, G6 has excepti onal therapeutic efficacy in the bone marrow. Using both a NOD-SCID xenograft and a transgenic m ouse model of Jak2-V617F mediated myeloproliferative neoplasia, we demonstrate t hat G6 not only alleviates the palliative symptoms, but it is also able to significant ly eliminate the Jak2-V 617F mutant burden in the bone marrow. Specifically, G6 completely eliminated HEL cells from the bone marrow of recipient NOD-SCID mice. In a mouse model of Jak2-V617F driven MPN, G6 provided exceptional efficacy to both the plasma and spleen as determined by corrections of nearly every cellular compartment in the bl ood and the elimination of myeloproliferative neoplasia from the spleen. This in turn resulted in significant alleviation of splenomegaly in the transgenic mice. Furt hermore, within the marrow, G6 eliminated the myeloproliferative neoplasia phenotype. It also markedly decreased the levels of phospho-STAT5 and significantly reduced the levels of Jak2-V617F transcripts in the bone marrow of these MPN mice; in fact, 33% of the treated mice exhibited complete elimination of all Jak2-V617F transcripts from the marrow. These reductions collectively allowed for a normalization of the bone marrow as determined by corrections in the M:E ratios. Finally, brief exposures of Jak2-V 61F bone marrow cells to G6 eliminated their subsequent clonogenic ability thereby indicating a potent inhibitory effect of G6 on Jak2V617F expressing cells. In addition, the in vivo efficacy of G6 was attained at reasonably low doses (1-10 mg/kg/day) when compared to other small molecu le Jak2 inhibitors (Table 6-1). This is 131

PAGE 132

particularly important because high in vivo dose requirement of a drug can limit its clinical pot ential due to the high possibility of non-target actions. These results suggest that G6 provides superior efficacy agai nst Jak2-V617F mediated pathogenesis when compared to other inhibitors. Unlike other known Jak2 inhibitors, G6 has a unique chemical structure. It is classified among a group of compound known as stilbenes. These compounds such as resveratrol, pic eatannol and diethylstilb estrol, are reported to have anti-proliferative, ant i-oxidative, anti-neovasculari zation and tumor-suppressive effects [105,106,107]. Thus, the exceptional efficacy of G6 as a Jak2 inhibitor could be in part due to its unique chemical nature as a stilbenoid compound. Further studies need to focus on the pharmaco kinetic parameters of G6 in mice following a single administration of the effective dose. This is important in order to determine whether sufficient concentrations of G6 reach the important predilection sites of disease, and how it is metabolized in vivo Further studies to develop structural variants of G6 with increased target specif icity and solubility may enhance its potential as a therapeutic agent. Since oral administrat ion is often preferred compared to other routes, there is need to determine bioavaila bility of G6 following oral dosage. Conditional Deletion of Vascular Smooth Muscle Cell Jak2 is Protective against Cardiovascular Disease Pathogenesis In addition to using a pharmacological appr oach to demonstrating the involvement of Jak2 in human disease pathogenesis, we have also used a genetic strategy to demonstrate that Jak2 plays a critical ro le in the pathogenesis of cardiovascular disease. In this dissertation, we show t hat mice lacking Jak2 within VSMC are largely protected from cardiovascular diseases including hypertension and neointima formation 132

PAGE 133

following va scular injury. The mechanisms th rough which Jak2 mediates cardiovascular disease pathogenesis are discussed below in details. Jak2 Mediates Cardiovascular Disease Pathogenesis via Multiple Non-Redundant Mechanisms Cardiovascular diseases are believed to be the number one causes of death in the world. Although great effort and resource s have been dedicated to understanding the pathogenesis of these diseases, there is still an urgent need to investigate the signaling mechanisms involved in the causation of ca rdiovascular disease. Since the discovery that Jak2 couples to the AT1 receptor, there have been num erous reports implicating Jak2 in the pathogenesis of cardiovascular disease. The mechanisms through which Jak2 mediates cardiovascular disease are st ill not fully understood. In this dissertation, we have identified Jak2 as a mediator of Ang II-induced hypertension via multiple nonredundant mechanisms. We found that by cont ributing to the increased presence of ROS, Jak2 is centrally located to medi ate cardiovascular disease via multiple mechanisms. These mechanisms include ROS mediated scavenging of endothelial NO, increasing intracellular Ca2+, and increasing Rho-kinase activity. Jak2 Contributes to Increased Presence of ROS In this study, we found that compared to c ontrols, the mice that lack Jak2 in their VSMC have lower levels of ROS. Previous studies have also demonstrated that in human leukemia cells, inhibition of Jak2 resulted in decreased ROS levels [75]. However, the mechanism(s) by which Jak2 contributes to the in creased production of ROS is/are not known. NAD(P)H oxidase is the primary source of ROS in eukaryotic cells. There are 7 isoforms of NAD(P)H ox idases (Nox) including Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. The Nox fam ily of enzymes transports electrons across 133

PAGE 134

the plasma membrane leading to generation of ROS, whic h then mediate a wide variety of physiological and pathophysiological proc esses including cardiovascular disease [192]. The mechanisms for activation of Nox ar e not fully understood. We know that Ang II stimulates the activity of memb rane-bound Nox in VSMC and endothelial cells resulting in increased production of ROS such as superoxide (O2 ) and hydrogen peroxide (H2O2) [17,57,62,63,64,65,66]. It is possi ble that Jak2 may mediate Ang IIinduced production of ROS by direct activation of Nox but this still needs to be investigated. The ROS are comprised of three different reduction products of oxygen including superoxide, H2O2, and the hydroxyl radical (OH). The obvious differences in the molecular chemical properties of these reduction products dictate differential signaling functions [188]. Because superoxide has a negative charge, it is believed to be incapable of crossing the cell membrane vi a anion channels. However, studies have shown that superoxide can cross membrane lip id bi-layer via the chloride channel-3 (ClC-3) [189]. In this dissertat ion, we found that expression of Jak2 in VSMC resulted in a partial impairment of the endothelium dependent vasorelaxation in aortic rings. However, when the rings were pre-treated with the anti-oxidant superoxide dismutase (SOD), their vasorelaxation was dramatica lly improved (Figure 4-7). These results suggest that presence of Jak2 in VSMC resu lts in increase presence of superoxide, which scavenge endothelial NO, resulting in reduced vasorelaxation. It is not known whether superoxide scavenged NO extracellularly before diffusing into the VSMC or intracellularly. H2O2 is believed to be the main RO S involved in the pathogenesis of hypertension because it is freely permeable and is able diffuse outside of the cell and 134

PAGE 135

scavenge NO. Numerous studies have shown that free oxygen radi cals including H2O2 and OH can act directly on VSMC and modul ate vascular tone. They can induce vasoconstriction or vasodilatation depending on various factors such as concentration and the specific vessel type. The vascular effects of free oxygen radicals have been reviewed [190]. VSMC Jak2 Expression Correlates with Reduced NO Availability NO is a vasoactive substance produced from the endothelium by endothelial NO synthase (eNOS) [191,192]. It acts on VSM C by activating intracellular soluble guanylate cyclase (sGC) enzyme which converts guanosine triphosphate to cGMP, resulting in vasorelaxation [193]. Endothe lial dysfunction and low NO bioavailability is a major cause of cardiovascular diseases resu lting from hypertension. One of the main mechanisms resulting in low NO bioavailabi lity is scavenging by ROS [139]. Another mechanism is lack of BH4, which leads to eNOS dysfunction and a switch from NO release to the formation of oxygen radicals [194]. Ang II action increases production of ROS, which in turn inactivate NO in both VSMC and endothelial ce lls [70,71,72]. This Ang II-induced formation of ROS is independent of its hemodynam ic effects, since it is not observed in norepinephrineinduced hypertension [62,67,68]. In this dissertation, we report for the first time that increased Jak2 expression in VSMC results in reduced NO availability via a ROS dependent mechanism. VSMC Jak2 Expression Correlates with Increased Rho-kinase Activity Rho-associated kinase (Rho-kinase) is an ef fector molecule of the small GTPase Rho. It plays a pivotal role in vascular smoot h muscle contraction, cell adhesion and cell motility [195]. These processes are invo lved in the pathogenesis of cardiovascular disease including hypertension and coronar y artery spasm [196,197]. Rho-kinase 135

PAGE 136

regulates myosin light chain (MLC) by either direct phosphorylation or by inactivation of myosin phosphatase through the phosphorylation of myosin-binding subunit. As such, increased Rho-kinase activity increases smooth muscle contraction via regu lation of the phosphorylation state of MLC. In addition, Rho-kinase in creases intracellular Ca2+ sensitization in VSMC in response to agonist stimulation [198,199]. Ang II is known to activate Rho-kinase activity. Binding of Ang II to the AT1-R results in increased Rho-kinase activity and vasoconstriction by acting via the Rho exchange factor, Arhgef1 and Jak2 has been s hown to mediate this process [56]. Interestingly, previous studies have shown that Rho-kinase can be activated by increased ROS [69,73]. These results, and the data presented in this dissertation suggest that Jak2 mediates Ang II-induced vasoconstriction by activating Rho-kinase via both ROSand phosphorylat ion-dependent mechanisms. VSMC Jak2 Expression Correlates with Increased Intracellular Calcium Increase in intracellular Ca2+ is one of the major trigger s of contraction in VSMC. In response to an agonist such as Ang II, there is incr eased influx of Ca2+ into the cytoplasm. Ca2+ binds to calmodulin and activates myosin light chain kinase (MLCK), which phosphorylates the myosin light chain and enhances the interaction between actin and myosin, resulting in vasoconstriction [55]. ROS have been shown to mediate RhoA/Rho kinase-induced Ca2+ sensitization in pulmonary vascular smooth muscle following chronic hypoxia [69]. In addition, whole cell patch clamp studies have shown that oxidative stress induced by H2O2 increases the activity of L-type Ca2+ channels [200]. The ROS mediated increase in intracellular free Ca2+ contributes to increased vascular tone [138]. These data suggest that increased presence of ROS result in increased influx and sensitization of intracellular Ca2+. Here we found that presence of 136

PAGE 137

VSMC Jak2 resulted in increased presence of ROS, which in turn resulted in increased intracellular Ca2+. VSMC Jak2 Mediates Ang II-Induced Growth Factor Effects and Local Tissue Damage Vascular remodeling and kidney damage are k nown to play an important role in cardiovascular disease pathogenesis. In this investigation, we found that mice lacking the Jak2 tyrosine kinase in their VSMC are resistant to Ang II-induced vascular remodeling as manifested by increased thickne ss of the tunica media. We also found that these mice are protected from kidney damage and neointima formation following vascular injury. These local tissue effects of Ang II were associated with increased activation of the Jak-STAT pathway. However, it is still not known whether the local tissue effects of Ang II are independent of its hemodynamic effect s. Further studies need to be done in which control mice are in fused with Ang II, but their blood pressure reduced to levels observed in the VSMC Jak2 null mice. This can be achieved by treating the mice with a drug combination comprising of hydralazine, reserpine and thiazide, which are collectively referred to as the triple therapy. Hydralazine lowers blood pressure by increasing guanosine monophosphate levels resulting in decreased action of the second messenger IP3, and limiting calcium release from the sarcoplasmic reticulum Reserpine exerts its antihypertensive effects by acting as an antagonist to the vesicular monoamine tr ansporter ( VMAT ), there by preventing the sympathetic actions of catecholamines Thiazide is a diuretic and it lower blood pressure by blocking the thiazide-sensitive Na+-Cl symporter preventing reabsorption of sodium and chloride ions. The different actions of these drugs in hypertension have been reviewed [201]. 137

PAGE 138

The triple therapy drug combination will elim inate the pressor effects of Ang II while allowin g its local tissue actions. Jak2 Inhibitors and Their Potentia l for Cardiovascular Disease Therapy The pathogenesis of cardiovascular disease resulting from hypertension often involves a complex combination of causes including genetic and environmental factors [202]. The current pharmacological treatment s for hypertension are mainly targeted towards inhibition or prevention of action of vasoconstrictor hormones including Ang II. Treatment of resistant hyper tension currently entails choosing medications with complementary mechanisms of action such as optimizing diuretic use, and/or mineralocorticoid antagonism [203]. However, due to the multifactorial nature of the disease pathogenesis, there are still subsets of patients in whom available treatments are increasingly becoming ineffective. Treatment of resistant hypertension presents an increasing dilemma in the clinical setting, and patients with resistant hypertension have increased cardiovascular risk [203]. Therefore, there is still need to identify other genetic targets, to provide more individualized tr eatments for such patients. In addition, a number of patients are non-responsive to m ono-antihypertensive therapy and there is often need to use combination therapy [204]. Since Jak2 has been shown to regulate Ang II-mediated signa ling downstream of the AT1-R, it may represent a valuable new ta rget for anti-hypert ensive therapeutic strategies. AG490, a tyrphostin well known for inhibiting Jak2 [162] has been shown to prevent hypertension [56], and neointima formation [49] in animal models. As such, these studies and the studies presented in this dissertation implicate Jak2 as an important modulator of blood pressure and cardiovascular disease. Therefore, therapeutic approaches using inhibition of Jak2 to regulate Ang II-mediated AT1-R 138

PAGE 139

stimulation is an intriguing novel target for t he treatment of hypertens ion. This implies a potential new therapeutic target for multi-drug resistant hypertension. The realization of therapeutic benefit from Jak2 inhibition in ca r diovascular diseases may entail identifying optimized inhibitors with unique profiles to maxi mize therapeutic potential. In addition, given the potential side effects that may arise from Jak2 inhibition, there is need for a risk/benefit assessment of using Jak2 as a target in treatment of cardiovascular disease. Being a downstream signaling molecule of the AT1-R, Jak2 is well positioned, and may offer a new, more specific target in the treatment of Ang II-mediated cardiovascular diseases Ang II acts on the AT1-R resulting in the stimulation of multiple downstream signaling cascades, leading to various effects. Since Jak2 is a downstream signaling molecule of the AT1-R, it may present a more specific target for treatment of cardiovascular disease while avoiding side effe cts arising from inhibi tion of non diseased signaling pathways. Conclusions Jak2 plays a critical role in the pathogenes is of various human diseases including cancer and cardiovascular disease. A c onsiderable amount of research has been dedicated to developing drugs using Jak2 as a therapeutic target in hematological malignancies. Although numerous in vitro studies have demonstrated involvement of Jak2 in cardiovascular disease pat hogenesis, there is a general lack on in vivo evidence and very little attention has been given to this important signaling molecule as a treatment strategy in cardiovascular disease. In this dissertation, we have not only discovered a potential therapeut ic agent in Jak2-mediated neoplasia, but we have also found that Jak2 plays a causative role in Ang II-induced cardiovascular disease. Cardiovascular disease has complex and multi-factorial etiologies and is unlikely to be 139

PAGE 140

successfully treated with a single approach. Current standard therapies incl ude inhibition of the RAAS as well as enhancement of nitric oxide-mediated relaxation of VSMC. Jak2 is centrally located as a downstream signaling molecule of the AT1-R and it is involved in many of t he signaling cascades regulated by Ang II including oxidative stress. It appears that in a multi-factorial disease such as hypertension, Jak2 may provide a more specific target as a t herapeutic approach. Jak2 inhibition offers a potential base for further st udy and development of therapeut ic options to overcome cardiovascular disease and ultimately, may be considered as an adjunct or alternative to current therapeutic agents. 140

PAGE 141

Table 6-1. Comparison of in vivo dosages of Jak2 inhibitors in murine models. Inhibitor Name Administer ed In Vivo Dosage (mg/kg/day) Reference TG101348 60-120 mg/kg twice daily (oral) Wernig, G. et al. (2008) TG101209 100 mg/kg twice daily (oral) Pardanani, A. et al. (2007) CEP701 30 mg/kg twice daily (oral) Hexner, E. O. et al. (2008) INCB018424 180 mg/kg/day (oral) Quintas-Cardama, A. et al. (2010) P1 100 mg/kg/day (oral) Mathur, A. et al. (2009) CYT387 25-50 mg/kg twice daily (oral) Tyner, J. W. et al. (2010) WP1066 40 mg/kg every other day (ip) Iwamaru, A. et al. (2006) 141

PAGE 142

LIST OF REFERENCES 1. Hansson L, Zanchetti A, Carruthers SG, Dahl of B, Elmfeldt D, et al. (1998) Effects of intensive blood-pressure lowering and low-dose aspirin in patients with hypertension: principal results of t he hypertension optimal treatment (hot) randomised trial. Hot study group. Lancet 351: 1755-1762. 2. Duncia JV, Carini DJ, Chiu AT, Johnson AL Price WA, et al. (1992) The discovery of dup 753, a potent, orally active nonpeptide angiotens in ii receptor antagonist. Med Res Rev 12: 149-191. 3. Chiu AT, Mccall DE, Nguyen TT, Carini DJ, Duncia JV, et al. ( 1989) Discrimination of angiotensin ii receptor subty pes by dithiothreitol. Eur J Pharmacol 170: 117-118. 4. Chiu AT, Mccall DE, Price WA, Jr., W ong PC, Carini DJ, et al. (1991) In vitro pharmacology of dup 753. Am J Hypertens 4: 282s-287s. 5. Wong PC, Price WA, Jr., Chiu AT, Duncia JV, Carini DJ, et al. (1991) In vivo pharmacology of dup 753. Am J Hypertens 4: 288s-298s. 6. Matsubara H (1998) Pathophysiological role of angiotensin ii type 2 receptor in cardiovascular and renal diseases. Circ Res 83: 1182-1191. 7. Kobori H, Nangaku M, Navar LG, Nis hiyama A (2007) The intrarenal reninangiotensin system: from physiology to the pathobiology of hypertension and kidney disease. Pharmacol Rev 59: 251-287. 8. Katz AM (1992) Is angiotensin ii a growth factor masquerading as a vasopressor? Heart Dis Stroke 1: 151-154. 9. Daemen MJ, Lombardi DM, Bosman FT, Schwartz SM ( 1991) Angiotensin II induces smooth muscle cell proliferation in the nor mal and injured rat arterial wall. Circ Res 68: 450-456. 10. Powell JS, Clozel JP, Muller RK, Kuhn H, Hefti F, et al. (1989) Inhibitors of angiotensin-converting enzyme prevent myoi ntimal proliferation after vascular injury. Science 245: 186-188. 11. Chiu AT, Roscoe WA, Mccall DE, Timm ermans PB (1991) Angiotensin II-1 receptors mediate both vasoconstrictor and hypertrophic responses in rat aortic smooth muscle cells. Receptor 1: 133-140. 12. Timmermans PB, Wong PC, Chiu AT, Herblin WF, Benfield P, et al. (1993) Angiotensin II receptors and angiotensin II receptor antagonists. Pharmacol Rev 45: 205-251. 142

PAGE 143

13. Geisterfer AA, Peach MJ, Owens GK ( 1988) Angiote nsin II induces hypertrophy, not hyperplasia, of cultured rat aortic sm ooth muscle cells. Circ Res 62: 749-756. 14. Xi XP, Graf K, Goetze S, Fleck E, Hs ueh WA, et al. (1999) Central role of the MAPK pathway in ang II-mediated DNA synthesis and migration in rat vascular smooth muscle cells. Arterioscler Thromb Vasc Biol 19: 73-82. 15. Berk BC, Vekshtein V, Gordon HM, Tsu da T (1989) Angiotensin II-stimulated protein synthesis in cultured vascular smooth muscle cells. Hypertension 13: 305-314. 16. Fingerle J, Muller RM, Kuhn H, Pech M, Baumgartner HR (1995) Mechanism of inhibition of neointimal formation by t he angiotensin-converting enzyme inhibitor cilazapril. A study in balloon catheter-i njured rat carotid arteries. Arterioscler Thromb Vasc Biol 15: 1945-1950. 17. Mehta PK, Griendling KK (2 007) Angiotensin II cell si gnaling: Physiological and pathological effects in the cardiovascular system. Am J Physiol Cell Physiol 292: C82-97. 18. Su EJ, Lombardi DM, Wiener J, Daemen MJ, Reidy MA, et al. (1998) Mitogenic effect of angiotensin II on rat carotid ar teries and type II Or III mesenteric microvessels but not type I mesenteric mi crovessels is mediated by endogenous basic fibroblast growth factor. Circ Res 82: 321-327. 19. Griffin SA, Brown WC, Macpherson F, Mcgrath JC, Wilson VG, et al. (1991) Angiotensin II causes vascular hypertrophy in part by a non-pressor mechanism. Hypertension 17: 626-635. 20. Yamaoka K, Saharinen P, Pesu M, Holt VE, 3rd, Silvennoinen O, et al. (2004) The Janus Kinases (Jaks). Genome Biol 5: 253. 21. Saharinen P, Vihinen M, Silvennoinen O (2003) Autoinhibi tion of Jak2 Tyrosine Kinase is dependent on specific regions in its pseudokinase domain. Mol Biol Cell 14: 1448-1459. 22. Luo H, Rose P, Ba rber D, Hanratty WP, Lee S, et al. (1997) Mutation in the Jak Kinase JH2 domain hyperactivates drosophila and mammalian Jak-Stat pathways. Mol Cell Biol 17: 1562-1571. 23. Kampa D, Burnside J ( 2000) Computational and functional analysis of the putative SH2 domain in Janus Kinases. Biochem Biophys Res Commun 278: 175-182. 24. Girault JA, Labesse G, Mo rnon JP, Callebaut I (1998) Janus Kinases and focal adhesion kinases play in the 4.1 band: a superfamily of band 4.1 domains important for cell structure and signal transduction. Mol Med 4: 751-769. 143

PAGE 144

25. Tanner JW, Chen W, Young RL, Longmore GD, Shaw AS (1995) The conserved box 1 motif of cytokine receptors is r equired for association with Jak Kinases. J Biol Chem 270: 6523-6530. 26. Zhao Y, Wagner F, Frank SJ, Kraft AS (1995) The am ino-termi nal portion of the Jak2 protein kinase is necessary for binding and phosphor ylation of the granulocyte-macrophage colony-stimulating factor receptor beta c chain. J Biol Chem 270: 13814-13818. 27. Neubauer H, Cumano A, Muller M, Wu H, Huffstadt U, et al. (1998) Jak2 deficiency defines an essential developmental checkp oint in definitive hematopoiesis. Cell 93: 397-409. 28. Parganas E, Wang D, Stravopodis D, To pham DJ, Marine JC e a. (1998) Jak2 is essential for signaling through a variety of cytokine receptors. Cell 93: 385-395. 29. Bhat GJ Thekkumkara TJ Thomas WG Conrad KM Baker KM (1994) Angiotensin II stimulates sis-inducing fact or-like DNA binding activity. Evidence that the at1a receptor activates transcrip tion factor-stat91 and/or a related protein. J Biol Chem 269: 31443-31449. 30. Marrero MB, Schieffer B, Paxton WG, Heerdt L, Berk BC, et al. (1995) Direct stimulation of Jak/Stat pat hway by the Angiotensin II AT1 receptor. Nature 375: 247-250. 31. Marrero MB, Schieffer B, Li B, Sun J, Harp JB, et al. (1997) Role of Janus Kinase/Signal Transducer And Activator of Transcription and Mitogen-Activated Protein Kinase cascades in angiotensin IIand platelet-derived growth factorinduced vascular smooth muscle cell pr oliferation. J Biol Chem 272: 2468424690. 32. Ali MS, Sayeski PP, Dirksen LB, Hayzer DJ, Marrero MB, et al. (1997) Dependence on the motif yipp for the physical associatio n of Jak2 kinase with the intracellular carboxyl tail of the angiotensin II AT1 receptor. J Biol Chem 272: 23382-23388. 33. Mcwhinney CD, Hunt RA, Conrad KM, Dostal DE, Baker KM (1997) The Type I Angiotensin II receptor couples to Stat 1 and Stat3 activation through Jak2 kinase in neonatal rat cardiac myocytes. J Mol Cell Cardiol 29: 2513-2524. 34. Dostal DE, Hunt RA, Kule CE, Bhat GJ, Karoor V, et al. (1997) Molecular mechanisms of angiotensin II in modulating cardiac function: intracardiac effects and signal transduction pathways. J Mol Cell Cardiol 29: 2893-2902. 35. Pan J, Fukuda K, Kodama H, Makino S, Takahashi T, et al. (1997) Role of angiotensin II in activation of the Jak/St at pathway induced by acute pressure overload in the rat hear t. Circ Res 81: 611-617. 144

PAGE 145

36. Kodama H, Fukuda K, Pan J, Makino S, S ano M, et al. (1998) Bi phasic activation of the Jak/Stat pathway by angiotens in II in rat cardiomyocytes. Circ Res 82: 244250. 37. Mcwhinney CD, Dostal D, Baker K (1998) Angiotensin II ac tivates Stat5 through Jak2 kinase in cardiac myocytes J Mol Cell Cardiol 30: 751-761. 38. Frank GD, Saito S, Motley ED, Sasaki T, Ohba M, et al. ( 2002) Requirement of Ca(2+) and PKCdelta for Janus Kinase 2 activation by angiotensin II: involvement of pyk2. Mo l Endocrinol 16: 367-377. 39. Marrero MB, Paxton WP, Schieffer B, Ling BN, Bernstein KE (1996) Angiotensin II signalling events mediated by tyrosine phos phorylation. Cell Signal 8: 21-26. 40. Venema RC, Venema VJ, Eaton DC, Ma rrero MB (1998) Angiotensin II-induced tyrosine phosphorylation of Signal Transducer s and Activators of Transcription 1 is regulated by Janus-Activated Kinase 2 and Fyn Kinases and MitogenActivated Protein Kinase Phosphatas e 1. J Biol Chem 273: 30795-30800. 41. Prescott MF, Webb RL, Reidy MA (1991) Angiotensin-Converting Enzyme inhibitor versus angiotensin II, AT1 receptor ant agonist. Effects on smooth muscle cell migration and proliferation after balloon ca theter injury. Am J Pathol 139: 12911296. 42. Rakugi H, Jacob HJ, Krieger JE, Ingelfi nger JR, Pratt RE (1993) Vascular injury induces angiotensinogen gene expre ssion in the media and neointima. Circulation 87: 283-290. 43. Rakugi H, Kim DK, Krieger JE, Wang DS, Dzau VJ, et al. (1994) Induction of angiotensin converting enzyme in the neoi ntima after vascular injury. Possible role in restenosis. J Clin Invest 93: 339-346. 44. Iwai N, Izumi M, Inagami T, Kinoshita M (1997) Induction of renin in medial smooth muscle cells by balloon inju ry. Hypertension 29: 1044-1050. 45. Viswanathan M, Stromberg C, Seltzer A, Saavedra JM (1992) Balloon angioplasty enhances the expression of angiotensin ii at1 receptors in neointima of rat aorta. J Clin Invest 90: 1707-1712. 46. Sandberg EM, Ma X, Vonderlinden D, Godeny MD, Sayeski PP (2004) Jak2 tyrosine kinase mediates angiotensin II-dependent inactivation of Erk2 via induction of Mitogen-Activated Protein Ki nase Phosphatase 1. J Biol Chem 279: 1956-1967. 145

PAGE 146

47. Madamanchi NR, Li S, Patterson C, R unge MS (2001) Reactive Oxygen Species regulate heat-shock protein 70 via the Ja k/Stat pathway. Arterioscler Thromb Vasc Biol 21: 321-326. 48. Gharavi NM, Alva JA, Mouillesseau x KP, Lai C, Yeh M, et al. (2007) Role of the Jak/Stat pathway in the regulation of interleukin-8 transcription by oxidized phospholipids in vitro and in atherosclerosis in vivo. J Biol Chem 282: 3146031468. 49. Seki Y, Kai H, Shibata R, Nagata T, Yasukawa H, et al (2000) Role of the Jak/Stat pathway in rat carotid arte ry remodeling after vascular injury. Circ Res 87: 12-18. 50. Macrez-Lepretre N, Kalkbrenner F, Morel JL, Schultz G, Mironneau J (1997) G protein heterotrimer Galpha13beta1gamma 3 couples the angiotensin AT1a receptor to increases in cytoplasmic Ca2+ in rat portal vein myocytes. J Biol Chem 272: 10095-10102. 51. Ushio-Fukai M, Griendling KK, Akers M, Lyons PR, Alexander RW (1998) Temporal dispersion of activation of phospholi pase c-beta1 and -gamma isoforms by angiotensin ii in vascular smooth muscle ce lls. Role of alphaq/11, alpha12, and beta gamma g protein subunits. J Biol Chem 273: 19772-19777. 52. Rossier MF, Capponi AM (2000) Angi otensin II and calcium channels. Vitam Horm 60: 229-284. 53. Penner R, Fasolato C, Hoth M (1993) Calcium influx and its control by calcium release. Curr Opin N eurobiol 3: 368-374. 54. Parekh AB (2003) Store-operated Ca2+ entry: dynamic interplay between endoplasmic reticulum, mitochondria and plasma membrane. J Physiol 547: 333348. 55. Yan C, Kim D, Aizawa T, Berk BC ( 2003) Functional interplay between angiotensin II and nitric oxide: cyclic GMP as a key m ediator. Arterioscler Thromb Vasc Biol 23: 26-36. 56. Guilluy C, Bregeon J, Toumaniantz G, Rolli-Derkinderen M, Retailleau K, et al. (2010) The rho exchange factor arhgef1 mediates the e ffects of angiotensin II on vascular tone and blood pressure. Nat Med 16: 183-190. 57. Griendling KK, Sorescu D, Ushio-Fuka i M (2000) NAD(P)H oxidase: Role in cardiovascular biology and disease. Circ Res 86: 494-501. 146

PAGE 147

58. Ohtsu H, Frank GD, Utsunomiya H, E guchi S (2005) Redox -dependent protein kinase regulation by angiotensin II: mechani stic insights and its pathophysiology. Antioxid Redox Si gnal 7: 1315-1326. 59. Touyz RM (2004) Reactive Oxygen Species and angiotensin II signaling in vascular cells -implications in cardiovascular diseas e. Braz J Med Biol Res 37: 12631273. 60. Taniyama Y, Griendling KK (2003) Reactive Oxygen Species in the vasculature: molecular and cellular mechanisms. Hypertension 42: 1075-1081. 61. Ushio-Fukai M, Alexander RW, Akers M, Yin Q, Fujio Y, et al. (1999) Reactive Oxygen Species mediate the activation of ak t/protein kinase b by angiotensin II in vascular smooth muscle cells. J Biol Chem 274: 22699-22704. 62. Rajagopalan S, Kurz S, Munzel T, Tarpey M, Freeman BA, et al (1996) Angiotensin II-mediated hypertension in the rat incr eases vascular superoxide production via membrane nadh/nadph oxidase activation. Contribution to alterations of vasomotor tone. J Clin Invest 97: 1916-1923. 63. Zafari AM, Ushio-Fukai M, Akers M, Yin Q, Shah A, et al. (1998) Role of NADH/NADPH oxidase-derived H2O2 in angiotensin ii-induced vascular hypertrophy. Hypertension 32: 488-495. 64. Ushio-Fukai M, Zafari AM, Fukui T, Ishizaka N, Griendling KK (1996) P22phox is a critical component of the superoxidegenerating NADP/NADPH oxidase system and regulates angiotensin II-induced hypertrophy in vascular smooth muscle cells. J Biol Chem 271: 23317-23321. 65. Griendling KK, Minieri CA, Ollerenshaw JD, Alexander RW ( 1994) Angiotensin II stimulates NADP and NADPH oxidase ac tivity in cultured vascular smooth muscle cells. Circ Res 74: 1141-1148. 66. Zhang H, Schmeisser A, Gar lichs CD, Plotze K, Damme U, et al. (1999) Angiotensin II-induced superoxide anion generation in human vascular endothelial cells: role of membrane-bound NADH-/NADPH-oxid ases. Cardiovasc Res 44: 215-222. 67. Laursen JB, Rajagopalan S, Galis Z, Tarpey M, Freeman BA, et al. (1997) Role of superoxide in angiotensin II-induced but not catecholamine-induced hypertension. Circu lation 95: 588-593. 68. Harrison DG (1997) Endothelial function and oxidant stress. Clin Cardiol 20: Ii-1117. 147

PAGE 148

69. Jernigan NL, Walker BR, Resta TC (2008) Reactive Oxygen Species mediate rhoa/rho kinase-induced Ca2+ sensitiz ation in pulmonary vascular smooth muscle following chronic hypoxia. Am J Physiol Lung Cell Mol Physiol 295: L515529. 70. Gryglewski RJ, Palmer RM, Moncada S ( 1986) Superoxide anion is involved in the breakdown of endothelium-derived vascular relaxing factor. Nature 320: 454-456. 71. Rubanyi GM, Vanhoutte PM (1986) Supe roxide anions and hyperoxia inactivate endothelium-derived re laxing factor. Am J Ph ysiol 250: H822-827. 72. Dzau VJ (2001) Theodore Cooper Lecture: Tissue Angiotensin and pathobiology of vascular disease: A unifying hypo thesis. Hypertension 37: 1047-1052. 73. Jin L, Ying Z, Webb RC (2004) Activati on of Rho/Rho kinase signaling pathway by reactive oxygen species in rat aorta. Am J Physiol Heart Circ Physiol 287: H1495-1500. 74. Yasunari K, Kohno M, Kano H, Yokokawa K, Minami M, et al. (1999) Antioxidants improve impaired insulin-mediated gluc ose uptake and prevent migration and proliferation of cu ltured rabbit coronary smooth muscle cells induced by high glucose. Circulation 99: 1370-1378. 75. Walz C, Crowley BJ, Hudon HE, Gramlic h JL, Neuberg DS, et al. (2006) Activated Jak2 with the V617F point mutation promot es g1/s phase transition. J Biol Chem 281: 18177-18183. 76. Sattler M, Verma S, Sh rikhande G, Byrne CH, Pride YB, et al. (2000) The bcr/abl tyrosine kinase induces production of reacti ve oxygen species in hematopoietic cells. J Biol Chem 275: 24273-24278. 77. Ihle JN (1995) Cytokine recept or signalling. Nature 377: 591-594. 78. Delhommeau F, Pisani DF, James C, Casadevall N, Constantine scu S, et al. (2006) Oncogenic mechanisms in myeloproliferativ e disorders. Cell Mol Life Sci 63: 2939-2953. 79. Ma X, Vanasse G, Cartmel B, Wang Y, Selinger HA (2008) Prevalence of polycythemia vera and essential throm bocythemia. Am J Hematol 83: 359-362. 80. Baxter EJ, Scott LM, Campbell PJ, East C, Fourouclas N, et al. (2005) Acquired mutation of the tyrosine kinase Jak2 in human myeloproliferative disorders. Lancet 365: 1054-1061. 148

PAGE 149

81. James C, Ugo V, Le Coued ic JP, Staerk J, Delhommeau F, et al. (2005) A unique clonal Jak2 mutation leading to consti tutive signalling causes poly cythaemia vera. Nature 434: 1144-1148. 82. Levine RL, Wadleigh M, Cools J, Ebert BL, Wernig G, et al. (2005) Activating mutation in the tyrosine kinase Jak2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis. Cancer Cell 7: 387-397. 83. Kralovics R, Passamonti F, Buser AS, Teo SS, Tiedt R, et al. (2005) A gain-offunction mutation of Jak2 in myeloprolif erative disorders. N Engl J Med 352: 1779-1790. 84. Zhao R, Xing S, Li Z, Fu X, Li Q, et al. (2005) Identificati on of an acquired Jak2 mutation in polycythemia vera. J Biol Chem 280: 22788-22792. 85. Jelinek J, Oki Y, Gharibyan V, BuesoRamos C, Prchal JT, et al. (2005) Jak2 mutation 1849G>T is rare in acute leukemias but can be found in cmml, philadelphia chromosome-negative cml, and megakaryocytic leukemia. Blood 106: 3370-3373. 86. Jones AV, Kreil S, Zoi K, Waghorn K, Curt is C, et al. (2005) Widespread occurrence of the Jak2 V617F mutation in chronic myeloproliferative disorders. Blood 106: 2162-2168. 87. Levine RL, Loriaux M, Huntly BJ, Loh ML Beran M, et al. (2005) The Jak2V617F activating mutation occurs in chroni c myelomonocytic leukemia and acute myeloid leukemia, but not in acute lymphobl astic leukemia or chronic lymphocytic leukemia. Blood 106: 3377-3379. 88. Levine RI, Pardanani A, Tefferi A, G illiland DG (2007) Role of Jak2 in the pathogenesis and therapy of myeloproliferative disorder s. Nat Rev Cancer 7: 673-683. 89. Wernig G, Kharas MG, Okabe R, Moore SA, Leeman DS, et al. (2008) Efficacy of TG101348, a selective Jak2 inhibitor, in treatment of a murine model of Jak2V617F-induced polycythemia vera. Cancer Cell 13: 311-320. 90. Lipka DB, Hoffmann LS, Heidel F, Markova B, Blum MC, et al. (2008) LS104, a nonATP-competitive small-molecule inhibito r of Jak2, is potently inducing apoptosis in jak2v617f-positive cells. Mol Cancer Ther 7: 1176-1184. 91. Ferrajoli A, Faderl S, Van Q, Koch P, Ha rris D, et al. (2007) WP1066 disrupts janus kinase-2 and induces caspase-depende nt apoptosis in acute myelogenous leukemia cells. Cancer Res 67: 11291-11299. 149

PAGE 150

92. Gozgit JM, Bebernitz G, Patil P, Ye M, Pa rmentier J, et al. (2008) Effects of the Jak2 inhibitor, AZ960, on pim/bad/bcl-xl surviv al signaling in the human Jak2 V617F cell line set-2. J Biol Chem 283: 32334-32343. 93. Pardanani A, Lasho T, Smith G, Burns CJ, Fantino E, et al. (2009) CYT387, a selective J ak1/Jak2 inhibitor: in vitro assessment of kinase selectivity and preclinical studies using cell lines and primary cells from polycythemia vera patients. Leukemia 23: 1441-1445. 94. Antonysamy S, Hirst G, Park F, Sprengeler P, Stappenbeck F, et al. (2009) fragment-based discovery of Jak-2 inhi bitors. Bioorg Med Chem Lett 19: 279282. 95. Sandberg EM, Ma X, He K, Frank SJ, Os trov DA, et al. (2005) Identification of 1,2,3,4,5,6-hexabromocyclohexane as a small molecule in hibitor of Jak2 tyrosine kinase autophosphorylation [correction of autophophorylation]. J Med Chem 48: 2526-2533. 96. Sayyah J, Magis A, Ostrov DA, Allan RW, Braylan RC, et al. (2008) Z3, a Novel Jak2 tyrosine kinase small-molecule in hibitor that suppresses Jak2-mediated pathologic cell growth. Mol Cancer Ther 7: 2308-2318. 97. Kiss R, Polgar T, Kirabo A, Sayyah J, Figueroa NC, et al. (2009) Identification of a novel inhibitor of Jak2 tyrosine kinas e by structure-based virtual screening. Bioorg Med Chem Lett 19: 3598-3601. 98. Pardanani A, Hood J, Lasho T, Levine RL, Martin MB, et al. (2007) TG101209, a small molecule Jak2-selective kinase inhibitor potently inhibits myeloproliferative disorder-associated Jak2V617F and MPLW515l/k mutations. Leukemia 21: 16581668. 99. Hexner EO, Serdikoff C, Jan M, Swider CR, Robinson C, et al. (2008) Lestaurtinib (Cep701) is a Jak2 inhibitor that s uppresses Jak2/Stat5 signaling and the proliferation of primary erythroid cells from pati ents with myeloproliferative disorders. Blood 111: 5663-5671. 100. Tyner JW, Bumm TG, Deininger J, Wood L, Aichberger KJ, et al. (2010) Cyt387, a novel Jak2 inhibitor, induces hem atologic responses and normalizes inflammatory cytokines in murine myeloproliferative neoplasms. Blood 115: 52325240. 101. Verstovsek S (2009) Therapeutic potential of Jak2 inhibitors. Hematology Am Soc Hematol Educ Program: 636-642. 150

PAGE 151

102. Geron I, Abrahamsson AE, Barroga CF, Kavalerchik E, Gotlib J, et al. (2008) Selective inhibition of Jak2-driven eryt hroid differentiation of polycythemia vera progenitors. Cancer Cell 13: 321330. 103. Xing S, Ho WTT, Zhao WM, Ma JM, W ang SF, et al. (2008) Transgenic expression of Jak2(V617F) causes myeloproliferative disorders in mice. Blood 111: 51095117. 104. Lacout C, Pisani DF, Tulliez M, Gac helin FM, Vainchenker W, et al. (2006) Jak2V617F expression in murine hematopoi etic cells leads to mpd mimicking human PV with secondary myelof ibrosis. Blood 108: 1652-1660. 105. Larrosa M, Tomas-Barberan FA, Espi n JC (2003) Grape polyphenol resveratrol and the related molecule 4-hydroxystilbene induce growth inhibition, apoptosis, S-phase arrest, and upregulation of cyclins A, E, and B1 in human sk-mel-28 melanoma cells. J Agric Food Chem 51: 4576-4584. 106. Le Corre L, Chalabi N, Delort L, Bignon YJ, Bernard-Gallon DJ (2005) Resveratrol and breast cancer chemoprevention: mole cular mechanisms. Mol Nutr Food Res 49: 462-471. 107. Kimura Y (2005) New anticancer agents: in vitro and in vivo evaluation of the antitumor and antimetastatic actions of various compounds isolated from medicinal plants. In Vivo 19: 37-60. 108. Pace-Asciak CR, Hahn S, Diamandis EP Soleas G, Goldberg DM (1995) The red wine phenolics trans-resveratrol and quercetin block human platelet aggregation and eicosanoid synthesis: implications for protection against coronary heart disease. Clin Chim Acta 235: 207-219. 109. Geahlen RL, Mclaughlin JL (1989) Pice atannol (3,4,3',5'-tetrahydroxy-transstilbene) is a naturally occurring protei n-tyrosine kinase inhibitor. Biochem Biophys Res Commun 165: 241-245. 110. Swanson-Mungerson M, Ikeda M, Lev L, Longnecker R, Portis T (2003) Identification of lat ent membrane protein 2a (lmp2a) specific targets for treatment and eradication of epstein-barr virus (ebv)-associated diseases. J Antimicrob Chemother 52: 152-154. 111. Baker SJ, Rane SG, Reddy EP (2007) Hema topoietic cytokine re ceptor signaling. Oncogene 26: 6724-6737. 112. Socolovsky M, Fallon AE, Wang S, Br ugnara C, Lodish HF (1999) Fetal anemia and apoptosis of red cell progenit ors in Stat5a-/-5b-/Mice: a direct role for Stat5 in BCL-X(L) inducti on. Cell 98: 181-191. 151

PAGE 152

113. Majumder A, Govindasamy L, Magis A, Kiss R, Polgar T, et al. (2010) Structurefunction correlation of G6, a novel sm all molecule inh ibitor of Jak2: indispensability of the stilbenoid core. J Bi ol Chem 285: 31399-31407. 114. Santos FP, Kantarjian HM, Jain N, Mans houri T, Thomas DA, et al. (2010) Phase 2 study of CEP-701, an orally available Jak2 inhibitor, in patients with primary or post-polycythemia vera/essential thrombo cythemia myelofibrosis. Blood 115: 1131-1136. 115. Koppikar P, Abdel-Wahab O, Hedvat C, Marubayashi S, Patel J, et al. (2010) Efficacy of the Jak2 i nhibitor INCB16562 in a murine model of MPLW515linduced thrombocytosis and myel ofibrosis. Blood 115: 2919-2927. 116. Talarico L, Wolf BC, Kumar A, Wein traub LR (1989) Reversal of bone marrow fibrosis and subsequent development of polycythemia in patients with myeloproliferative disorders. Am J Hematol 30: 248-253. 117. Campbell PJ, Green AR (2006) The myel oproliferative disorders. N Engl J Med 355: 2452-2466. 118. Marchioli R, Finazzi G, Landolfi R, Kutti J, Gisslinger H, et al. (2005) Vascular and neoplastic risk in a large cohort of pati ents with polycythemia vera. J Clin Oncol 23: 2224-2232. 119. Harrison CN, Campbell PJ, Buck G, W heatley K, East CL, et al. (2005) Hydroxyurea compared with anagrelide in hi gh-risk essential thrombocythemia. N Engl J Med 353: 33-45. 120. Cervantes F, Alvarez-Larran A, Arella no-Rodrigo E, Granell M, Domingo A, et al. (2006) Frequency and risk factors for throm bosis in idiopathic myelofibrosis: analysis in a series of 155 patients from a single institution. Leukemia 20: 55-60. 121. De Stefano V, Za T, Rossi E, Vannucch i AM, Ruggeri M, et al. (2008) Recurrent thrombosis in patients with polycythemia vera and essential thrombocythemia: incidence, risk factors, and effect of treatments. Haemat ologica 93: 372-380. 122. Kiladjian JJ, Cervantes F, Leebeek FW, Ma rzac C, Cassinat B, et al. (2008) The impact of Jak2 and MPL mutations on diagnosis and prognosis of splanchnic vein thrombosis: a report on 241 cases. Blood 111: 4922-4929. 123. Wang JC, Chang TH, Goldberg A, No vetsky AD, Lichter S, et al. (2006) Quantitative analysis of growth factor production in the me chanism of fibrosis in agnogenic myeloid metaplasia Exp Hematol 34: 1617-1623. 152

PAGE 153

124. Schmitt A, Jouault H, Guic hard J, Wendling F, Drouin A, et al. (2000) Pathologic interaction between megakaryocytes and polymorphonuclear leukocytes in myelofibros is. Blood 96: 1342-1347. 125. Xu M, Bruno E, Chao J, Huang S, Finazzi G, et al. (2005) Constitutive mobilization of cd34+ cells into the peripheral blood in idiopathic myelofibrosis may be due to the action of a number of pr oteases. Blood 105: 4508-4515. 126. Panteli KE, Hatzimichael EC Bouranta PK, Katsaraki A, Se feriadis K, et al. (2005) Serum Interleukin (Il)-1, Il-2, Sil-2ra, Il -6 and thrombopoietin levels in patients with chronic myeloprolifer ative diseases. Br J Haematol 130: 709-715. 127. Tefferi A (2000) Myelofibrosis with my eloid metaplasia. N Engl J Med 342: 12551265. 128. Mesa RA, Silverstein MN, Jacobsen SJ, Wollan PC, Tefferi A (1999) Populationbased incidence and survival figures in essential thrombocythemia and agnogenic myeloid metaplasia: an ol msted county study, 1976-1995. Am J Hematol 61: 10-15. 129. Santos FP, Verstovsek S (2011) Jak2 inhibitors: What's the true therapeutic potential? Blood Rev 25: 53-63. 130. Elmore SA (2006) Enhanced histopathology of the bone marrow. Toxicol Pathol 34: 666-686. 131. Kirabo A, Embury J, Kiss R, Polgar T, Gali M, et al (2011) The stilbenoid tyrosine kinase inhibitor, G6, suppresses Jak2 -V617F-mediated human pathological cell growth in vitro and in vivo. J Biol Chem 286: 4280-4291. 132. Wadleigh M, Tefferi A (2010) Preclinical and clinical activity of ATP mimetic Jak2 inhibitors. Clin Adv Hematol Oncol 8: 557-563. 133. Bhat GJ, Thekkumkara TJ, Thomas W G, Conrad KM, Baker KM (1995) Activation of the Stat pathway by angiotensin II in T3cho/At1a cells. cross-talk between angiotensin II and interleukin-6 nuclear signaling. J Biol Chem 270: 1905919065. 134. Pan J, Fukuda K, Saito M, Matsuzak i J, Kodama H, et al. (1999) Mechanical stretch activates the jak/stat pathway in rat cardiomyocytes. Circ Res 84: 11271136. 135. Kleinberger-Doron N, Shelah N, Capone R, Gazit A, Levit zki A (1998) Inhibition of cdk2 activation by selected tyrphostins causes cell cycle arrest at late G1 and S phase. Exp Cell Res 241: 340-351. 153

PAGE 154

136. Oda Y, Renaux B, Bjorge J, Saifeddine M, Fujita DJ, et al. (1999) c-src is a major cytosolic tyrosine kinase in vascular ti ssue. Can J Physiol Pharmacol 77: 606617. 137. Levitzki A (1990) Tyrphostins--pot ential antiproliferat ive agents and novel molecular tools. Biochem Pharmacol 40: 913-918. 138. Paravicini TM, Touyz RM (2006) Redo x signaling in hypertension. Cardiov asc Res 71: 247-258. 139. Griendling KK, Sorescu D, Lassegue B, Ushio-Fukai M (2000) Modulation of protein kinase activity and gene expressi on by reactive oxygen species and their role in vascular physiology and pathophysiology. Arterioscler Thromb Vasc Biol 20: 2175-2183. 140. Mao X, Fujiwara Y, Orki n SH (1999) Improved reporter strain for monitoring Cre recombinase-mediated DNA excisions in mice. Proc Natl Acad Sci U S A 96: 5037-5042. 141. Falkenhahn M, Gohlke P, Paul M, Stoll M, Unger T (1994) The Renin-Angiotensin system in the heart and vascular wall: new therapeutic aspects. J Cardiovasc Pharmacol 24 Suppl 2: S6-13. 142. Tham DM, Martin-Mcnulty B, Wang YX, Da Cunha V, Wilson DW, et al. (2002) Angiotensin II injures the arterial wall causing incr eased aortic stiffening in apolipoprotein e-deficient mice. Am J Physiol Regul Integr Comp Physiol 283: R1442-1449. 143. Muthalif MM, Parmentier JH, Benter IF, Karzoun N, Ahmed A, et al. (2000) Ras/Mitogen-Activated Protein Ki nase mediates nor epinephrine-induced phospholipase D activation in rabbit aortic smooth muscle cells by a phosphorylation-dependent mec hanism. J Pharmacol Exp Ther 293: 268-274. 144. Sawada N, Itoh H, Ueyama K, Yamashita J, Doi K, et al. (2000) Inhibition of rhoassociated kinase results in suppressi on of neointimal fo rmation of ballooninjured arteries. Circulation 101: 2030-2033. 145. Begum N, Duddy N, Sandu O, Reinzie J, Ragolia L (2000) Regulation of myosinbound protein phosphatase by insulin in vascular smooth muscle cells: evaluation of the role of rho kinase and phosphatidylin ositol-3-kinase-dependent signaling pathways. Mol Endocrinol 14: 1365-1376. 146. Boos CJ, Dawes M (2004) ACE cardiovascular protection: europa versus hope. Cardiovasc Drugs Ther 18: 179-180. 154

PAGE 155

147. Huang F, Thompson JC, Wilson P G, Aung HH, Rutledge JC, et al. (2008) Angiotensin II increases vascula r proteoglycan content preceding and contributing to atherosclerosis de velopment. J Lipid Res 49: 521-530. 148. Inoue N, Muramatsu M, Jin D, Takai S, Hayashi T, et al. (2009) Involvement of vascular angiotensin II-forming enzymes in the progression of aortic abdominal aneurysms in angiotensin IIinfused apoe-de ficient mice. J Atheroscler Thromb 16: 164-171. 149. Henriques TA, Huang J, D'souza SS, Daugherty A, Cassis LA (2004) Orchidectomy, but not ovariectomy, r egulates angiotensin II-induced vascular diseases in apolipoprotein e-defici ent mice. E ndocrinology 145: 3866-3872. 150. Cassis LA, Marshall DE, Fettinger MJ Rosenbluth B, Lodder RA (1998) Mechanisms contributing to angiotensin II regulation of body weight. Am J Physiol 274: E867-876. 151. Daugherty A, Manning MW, Cassis LA (2000) A ngiotensin II promotes atherosclerotic lesions and aneurysms in apolipoprotein e-defic ient mice. J Clin Invest 105: 1605-1612. 152. Owens GK, Vernon SM, Madsen CS (1996) Molecular regulation of smooth muscle cell differentiation. J Hypertens Suppl 14: S55-64. 153. Owens GK, Kumar MS, Wa mhoff BR (2004) Molecular regulation of vascular smooth muscle cell differentiation in dev elopment and disease. Physiol Rev 84: 767-801. 154. Sobue K, Hayashi K, Nishida W (1999) Expressional Regulatio n of smooth muscle cell-specific genes in association with phenotypic modulation. Mol Cell Biochem 190: 105-118. 155. Kirabo A, Sayeski PP (2010) Jak2 tyrosi ne kinase: a potential t herapeutic target for AT1 receptor mediated cardiovascular disease. Pharmaceuticals 3: 3478-3493. 156. Shibata R, Kai H, Seki Y, Kato S, Wada Y, et al. (2003) Inhibi tion of Stat3 prevents neointima formation by inhibiting prolif eration and promoting apoptosis of neointimal smooth muscle cells. Hum Gene Ther 14: 601-610. 157. Meydan N, Grunberger T, Dadi H, Shahar M, Arpaia E, et al. (1996) Inhibition of acute lymphoblastic leukaemia by a Jak-2 inhibitor. Nature 379: 645-648. 158. Ihle JN (1996) STATs: Signal Transduce rs and Activators of Transcription. Cell 84: 331-334. 155

PAGE 156

159. Schieffer B, Bernstein KE, Marrero MB (1996) The role of tyrosine phosphorylation in angiotensin II mediated intracellular signaling and cell growth. J Mol Med 74: 85-91. 160. Krempler A, Qi Y, Triplett AA, Zhu J, Rui H, et al. (2004) Generation of a conditional knockout allele for the j anus kinase 2 (Jak2) gene in mice. Genesis 40: 52-57. 161. Li L, Miano JM, Mercer B, Ols on EN (1996) Expression Of the sm22alpha promoter in transgenic mice provides evidence for distinct transcriptional regulatory programs in vascular and visce ral smooth muscle cells. J Cell Biol 132: 849-859. 162. Wang X, Xu L (2005) An optimized murine m odel of ferric chloride-induced arterial thrombosis for thrombosis re search. Thromb Res 115: 95-100. 163. Chen G, Wu J, Sun C, Qi M, Hang C, et al (2008) Potential role of Jak2 in cerebral vasospasm after experimental subara chnoid hemorrhage. Brain Res 1214: 136144. 164. Sayeski PP, Ali MS, Harp JB, Marrero MB, Bernstein KE (1998) Phosphorylation of P130cas by angiotensin II is dependent on c-sr c, intracellular Ca2+, and protein kinase C. Circ Res 82: 1279-1288. 165. Ray Jl, Leach R, Herbert JM, Benson M (2001) Isolation of vascular smooth muscle cells from a single murine aorta. Methods Cell Sci 23: 185-188. 166. Denizot F, Lang R (1986) R apid Colorimetric assay fo r cell growth and survival. modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. J Immunol Methods 89: 271-277. 167. Schwartz SM, Reidy MA, O'brien ER ( 1995) Assessment of fa ctors important in atherosclerotic occlusion and rest enosis. Thromb Haemost 74: 541-551. 168. Wakabayashi K, Suzuki H, Sato T, Iso Y, Katagiri T, et al. (2006) Eplerenone suppresses neointimal formati on after coronary stent implantation in swine. Int J Cardiol 107: 260-266. 169. Shibata R, Kai H, Seki Y, Kato S, Morimatsu M, et al. (2001) Role of rhoassociated kinase in neointima formation after vascular injury. Circulation 103: 284-289. 170. Davis C, Fischer J, Ley K, Sarembo ck IJ (2003) The Role of inflammation in vascular injury and repair. J Thromb Haemost 1: 1699-1709. 156

PAGE 157

171. Laporte S, Escher E (1992) Neointima formation after vascu lar injury is angiotensin ii mediated. Biochem Bioph ys Res Commun 187: 1510-1516. 172. Palmiter RD, Wilkie TM, Chen HY, Brin ster RL (1984) Transmission distortion and mosaicism in an unusual transgenic m ouse pedigree. Cell 36: 869-877. 173. Wilkie TM, Brinster RL Palmiter RD (1986) Germline and somatic mosaicism in transgenic mice. Dev Biol 118: 9-18. 174. Long MA, Rossi FM (2009) S ilencing inhibits cre-mediated recombination of the z/ap and z/eg reporters in adult cells. Plos One 4: E5435. 175. Calero-Nieto FJ, Bert AG, Cocker ill PN Transcription-dependent silencing of inducible convergent transgenes in transgenic mice. Epigenetics Chromatin 3: 3. 176. Grote K, Luchtefeld M, Schieffer B ( 2005) Janus under stress--role of Jak/Stat signaling pathway in vascular diseases. Vascul Pharmacol 43: 357-363. 177. Lata K, Madiraju N, Levitt L Jak2 mu tations and coronary ischemia. N Engl J Med 363: 396-397. 178. Wang H, Li Y, Liu H, Liu S, Liu Q, et al. (2009) Peroxynitrite mediates glomerular lesion of diabetic rat via Jak/Stat signa ling pathway. J Endocrinol Invest 32: 844851. 179. Ihle JN, Witthuhn BA, Quelle FW, Yamamo to K, Silvennoinen O (1995) Signaling through the hematopoietic cytokine recept ors. Annu Rev Immunol 13: 369-398. 180. Valentino L, Pierre J ( 2006) Jak/Stat signal transducti on: regulators and implication in hematological malignancies. Biochem Pharmacol 71: 713-721. 181. Nilsson J, Bjursell G, Kannius-Janson M (2006) Nuclear Jak2 and transcription factor nf1-c2: a novel mechanism of pr olactin signaling in mammary epithelial cells. Mol Cell Biol 26: 5663-5674. 182. Lobie Pe, Ronsin B, Silvennoinen O, Ha ldosen LA, Norstedt G, et al. (1996) Constitutive nuclear localization of janus kinases 1 and 2. Endocrinology 137: 4037-4045. 183. Dawson MA, Bannister AJ, Gottgens B, Foster SD, Bartke T, et al. (2009) Jak2 phosphorylates histone h3y41 and excludes hp1alpha from chromatin. Nature 461: 819-822. 184. Lacronique V, Boureux A, Valle VD, Poirel H, Quang CT, et al. (1997) A Tel-Jak2 fusion protein with constitutive kinase ac tivity in human leukemia. Science 278: 1309-1312. 157

PAGE 158

185. Dagvadorj A, Collins S, Jomain JB, Abdu lghani J, Karras J, et al. (2007) Autocrine prolactin promotes prostate cancer cell growth via Janus Kinase-2-Sign al Transducer And Activator of Transcripti on-5a/B signaling pathway. Endocrinology 148: 3089-3101. 186. Reiter A, Walz C, Watm ore A, Schoch C, Blau I, et al (2005) The T(8;9)(P22;P24) is a recurrent abnormality in chronic and acut e leukemia that fuses pcm1 to Jak2. Cancer Res 65: 2662-2667. 187. Bedard K, Krause KH (2007) The Nox family of RO S-generating NADPH Oxidases: physiology and pathophysi ology. Physiol Rev 87: 245-313. 188. Pryor WA (1986) Oxy-radicals and relat ed species: their formation, lifetimes, and reactions. Annu Rev Physiol 48: 657-667. 189. Hawkins BJ, Madesh M, Kirkpatrick CJ Fisher AB (2007) Superoxide flux in endothelial cells via the chlo ride channel-3 mediates intr acellular signaling. Mol Biol Cell 18: 2002-2012. 190. Rubanyi GM (1988) Vascular effects of oxygen-derived free radicals. Free Radic Biol Med 4: 107-120. 191. Moncada S, Palmer RM, Higgs EA (1991) Nitric Oxide: Physiology, Pathophysiology, and Pharmacology. Pharmacol Rev 43: 109-142. 192. Moncada S, Higgs A (1993) The L-Arginine-Nitric Oxide pathway. N Engl J Med 329: 2002-2012. 193. Ignarro Lj (1989) Biological actions and properties of endothelium-derived nitric oxide formed and released from arte ry and vein. Circ Res 65: 1-21. 194. Radi R, Beckman JS, Bush KM, Freeman BA (1991) Peroxynitr ite oxidation of sulfhydryls. The cytotoxic potential of superoxide and nitr ic oxide. J Biol Chem 266: 4244-4250. 195. Fukata Y, Amano M, Kaibuchi K ( 2001) Rho-Rho-Kinase pathway in smooth muscle contraction and cytoskeletal r eorganization of non-muscle cells. Trends Pharmacol Sci 22: 32-39. 196. Uehata M, Ishizaki T, Satoh H, Ono T, Kawahara T, et al. (1997) Calcium sensitization of smooth muscle mediated by a rho-associated protein kinase in hypertension. Nature 389: 990-994. 158

PAGE 159

197. Shimokawa H, Seto M, Katsumata N, Am ano M, K ozai T, et al. (1999) Rho-Kinasemediated pathway induces enhanced myosin light chain phosphorylations in a swine model of coronary artery spasm. Cardiovasc Res 43: 1029-1039. 198. Hirata K, Kikuchi A, Sasaki T, Kuroda S, Kaibuchi K, et al. (1992) Involvement of rho p21 in the gtp-enhanced calcium ion sensit ivity of smooth muscle contraction. J Biol Chem 267: 8719-8722. 199. Gong MC, Iizuka K, Nixon G, Browne JP, Hall A, et al. (1996) Role of Guanine Nucleotide-Binding Proteins--Ras-family or trimeric proteins or both--In Ca2+ Sensitization of smooth muscle. Proc Natl Acad Sci U S A 93: 1340-1345. 200. Akaishi T, Nakazawa K, Sato K, Sait o H, Ohno Y, et al. (2004) Hydrogen peroxide modulates whole cell Ca2+ currents th rough L-type channels in cultured rat dentate granule cells. Neurosci Lett 356: 25-28. 201. Wright JM, Musini VM (2009) First-line drugs for hypertension. Cochrane Database Syst Rev: Cd001841. 202. Staessen JA, Wang J, Bianchi G, Birk enhager WH (2003) Essential hypertension. Lancet 361: 1629-1641. 203. Acelajado MC, Calhoun DA, Oparil S (2 009) Reduction of blood pressure in patients with treatment-resist ant hypertension. Expert Opin Pharmacother 10: 2959-2971. 204. Nesbitt SD Overcoming therapeutic inerti a in patients with hypertension. Postgrad Med 122: 118-124. 205. Anderson JE, Tefferi A, Craig F, Holmberg L, Chauncey T, et al. (2001) Myeloablation and autologous peripheral blood stem cell rescue results in hematologic and clinical responses in patients with myeloid metaplasia with myelofibrosis. Blood 98: 586-593. 159

PAGE 160

160 BIOGRAPHICAL SKETCH Annet Kirabo grew up in a small village of Kigulu county in Iganga district, Uganda. She attended various elementary schools in cluding Kaliro demonstration school, Iganga town council and Bishop Willis Demonstration School. Annet attained her ordinary level high school diploma at Iganga Secondary Sc hool and her advanced level high school diploma at Bukoyo Secondar y School where she majored in physics, chemistry and biology, with a minor in fine art. She graduat ed high school as a va ledictorian of her class in 1997 and she was selected as one of the top 2,000 high sc hool graduates to receive the Uganda government sponsored co llege education. Annet first developed interest in medical-related research when she was a student in the School of Veterinary Medicine, Makerere University, Uganda. U nder the supervision of Professor Ojock Lonzy, she carried out a gro ss and histo-pathological survey on the prevalence of Johnes disease in Uganda cattle. Annet graduated with a Bachelor of Veterinary Medicine in 2002 as the top student in her class and on the deans list. She then moved to the United States of Amer ica where she attained a Master of Science in Cell and Molecular Biology at St. Cloud State Universi ty, Minnesota. Her research as a masters student focused on the mechanistic interact ion between obesity and reproduction under the supervision of Dr. Oladel e Gazal. Annet performed her Ph.D. studies in the laboratory of Dr. Peter Sayeski, Department of Physiology and Functional Genomics, University of Florida College of Medicine, Ga inesville, Florida. Her research mainly focused on understanding involvement of Jak2 tyrosine kinase in human cardiovascular disease and hematological ma lignancies and how it coul d be a potential therapeutic target for these diseases. Annet graduated with a Ph.D. in August 2011.