Expression Patterns of Flowering Genes During Flower Induction and Determination in Sweet Orange (Citrus sinensis L. Osbeck)

MISSING IMAGE

Material Information

Title:
Expression Patterns of Flowering Genes During Flower Induction and Determination in Sweet Orange (Citrus sinensis L. Osbeck)
Physical Description:
1 online resource (125 p.)
Language:
english
Creator:
Chica,Eduardo J
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Horticultural Science
Committee Chair:
Albrigo, Leo G
Committee Co-Chair:
Chase, Christine D
Committee Members:
Folta, Kevin M
Syvertsen, James P
Wang, Nian

Subjects

Subjects / Keywords:
citrus -- csap1 -- csft -- cslfy -- cssl1 -- deficit -- floral -- gene -- induction -- regulation -- subtropical -- transcripts -- water
Horticultural Science -- Dissertations, Academic -- UF
Genre:
Horticultural Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
In recent years, several genes putatively involved in the regulation of floral induction have been identified in C. sinensis. However, the expression patterns of these genes in response to different treatments known to alter floral induction have not been investigated. As the first level of regulation for the expression of a given phenotype, characterizing transcript levels of C. sinensis flowering genes will be useful for developing models that could enable discovery of mechanisms regulating floral induction in C. sinensis and other species of subtropical origin. This study investigated patterns of transcript accumulation of putative flowering signal genes CsFT and CsSL1, and the floral identity genes CsAP1 and CsLFY in response to several drought, low temperature and gibberellin treatments known to alter floral induction in C. sinensis. Results supported a role for CsFT as an integrator of flowering signals initiated by low temperatures and water deficit whereas CsSL1 was responsive only to signals initiated by low temperatures. Accumulation of CsFT transcripts was proportional to the duration of floral-inductive water deficit and to levels of floral-inductive temperatures. Water deficit reduced CsAP1 and CsLFY transcript accumulation while trees were under water deficit but induced higher levels of CsAP1 and CsLFY transcripts after irrigation was resumed than in well-irrigated trees. The patterns of transcript accumulation of CsAP1 and CsLFY supported a role of these two genes as markers of floral initiation. Based on the patterns of accumulation CsAP1 and CsLFY transcripts, floral determination occurs right after floral induction and initiation of growth is required for their up-regulation. Accumulation patterns of CsAP1 and CsLFY transcripts corresponded to the basipetal gradient of flowering observed in C. sinensis shoots and the initiation of multiple flowering cohorts. Gibberellins and the presence of fruit both had a negative effect on the accumulation of CsFT transcripts and exogenous gibberellins also reduce the accumulation of CsAP1 and CsLFY transcripts in buds. Accumulation of CsFT transcripts changed diurnally, responded quickly to environmental stimuli, and required alternation of light and dark cycles in order to sustain increasing levels of CsFT transcripts accumulation. Results provide initial information about the regulation of flowering in C. sinensis at the transcript level and could be helpful to design models of how flowering is induced and regulated in C. sinensis, other citrus cultivars and other subtropical species.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Eduardo J Chica.
Thesis:
Thesis (Ph.D.)--University of Florida, 2011.
Local:
Adviser: Albrigo, Leo G.
Local:
Co-adviser: Chase, Christine D.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-02-29

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043166:00001


This item is only available as the following downloads:


Full Text

PAGE 1

EXPRESSIONPATTERNSOFFLOWERINGGENESDURINGFLOWERINDUCTIONANDDETERMINATIONINSWEETORANGE(CitrussinensisL.OSBECK)ByEDUARDOJ.CHICAADISSERTATIONPRESENTEDTOTHEGRADUATESCHOOLOFTHEUNIVERSITYOFFLORIDAINPARTIALFULFILLMENTOFTHEREQUIREMENTSFORTHEDEGREEOFDOCTOROFPHILOSOPHYUNIVERSITYOFFLORIDA2011

PAGE 2

2011EduardoJ.Chica 2

PAGE 3

ACKNOWLEDGMENTS Ithankmyadvisors,Dr.GeneAlbrigoandDr.ChristineChase,fortheirhelp,advice,supportandallthethingsIlearnedfromthemduringmygraduatestudies.Iconsidermyselffortunateforhavinghadtheopportunitytoworkundertheirguidance.ToDr.Albrigo,thanksalsoforhavingtakenthechallengeofhavingmetwiceashisstudentandforhisfriendshipthroughouttheseyears.IalsothankDrs.KevinFolta,JamesSyvertsenandNianWang,membersofmysupervisorycommittee,fromwhomIlearnedmanythingsandwhoseworksinspiredmetopursueever-highergoalsinscience.IamverygratefulalsotoDr.JacquelineBurnsforhavingallowedmetoconductthemajorityofmyanalysesinherlab.ToDr.Burnsandthemembersofherlab,thanksalsoforreceivingmeasanothermemberoftheirteamandforbeingasecondlab-homeforme.IamverygratefultootoDr.KarenKochforsparkinginmenewinterestsinscience,forherdedicationtoherstudents,andforkeyexchangesindevelopingideasthatservedasseedforthisstudy.Ithankalsomyfriendswhobecamefamilyduringmyyearsingraduateschool,theyaretoomanytonamebuttheyknowwhotheyare.FromeachofthesefriendsandcolleaguesIhavelearnedmuch,bothscienticallyandpersonally.IthankalsomyandLis'sfamilyinEcuadorfortheircontinuoussupportduringtheseyearsabroad.Finallyandmostespecially,IthankLisforgivingsensetoeverythingandforalwayssigningLis:-) 3

PAGE 4

TABLEOFCONTENTS page ACKNOWLEDGMENTS .................................. 3 LISTOFTABLES ...................................... 6 LISTOFFIGURES ..................................... 7 ABSTRACT ......................................... 9 CHAPTER 1INTRODUCTIONANDLITERATUREREVIEW .................. 11 1.1ShootMeristemDevelopmentalPrograms .................. 11 1.1.1VegetativeGrowth:MaintainingVegetativeIndeterminacy ..... 12 1.1.2PhaseChange:Re-programingtheMeristemtoProduceFlowers 15 1.1.3Inorescences:aHybridProgram ................... 17 1.2FloralInduction:aGeneralOverview ..................... 19 1.2.1AcquisitionofCompetence ...................... 19 1.2.2FloralInduction ............................. 21 1.3FloralInductionincitrus ............................ 24 1.3.1FactorsRegulatingFloralInductioninCitrus ............. 25 1.3.2CitrusOrthologsofArabidopsisFloweringGenes .......... 26 1.4HypotheticalModelfortheTranscriptionalRegulationofFloralInductionincitrus ..................................... 27 2EXPRESSIONPATTERNSOFFLOWERINGGENESINSWEETORANGEINRESPONSETOFLORAL-INDUCTIVEWATERDEFICITS .......... 32 2.1MaterialsandMethods ............................. 34 2.1.1PlantMaterial .............................. 34 2.1.2ExperimentalConditions ........................ 34 2.1.3qRT-PCR ................................ 37 2.1.4DataAnalysis .............................. 38 2.2ResultsandDiscussion ............................ 38 2.2.1Floral-inductiveWaterDecitUp-regulatesCsFTbutnotCsSL1. 38 2.2.2CsFTTranscriptAccumulationalsoIncreasesinTreesunderWaterDecitatFloral-inductiveTemperatures ................ 40 2.2.3WaterDecitReducetheTranscriptAccumulationofFloralIdentityGenesinBudsduringFloralInduction ................ 41 2.2.4OtherFactorsModifytheResponseofFloweringGenestoFloral-inductiveTreatmentsinFieldTrees .............. 43 3RELATIONSHIPBETWEENEXPRESSIONPATTERNSOFFLOWERINGGENES,FLOWERINGINTENSITYGRADIENTSANDFLOWERINGCOHORTSINSWEETORANGESHOOTS ........................... 57 4

PAGE 5

3.1MaterialsandMethods ............................. 59 3.1.1PlantMaterial .............................. 59 3.1.2ExperimentalConditions ........................ 59 3.1.3qRT-PCR ................................ 62 3.1.4DataAnalysis .............................. 62 3.2ResultsandDiscussion ............................ 63 3.2.1CsFTTranscriptsAccumulateatEqualLevelsinLeavesRegardlessofTheirPositionintheShoot. ..................... 63 3.2.2AccumulationofCsAP1andCsLFYtranscriptsisHigheratNodesClosertotheApex. ........................... 63 3.2.3TIBADisruptstheEstablishmentofFloweringGradients. ...... 64 3.2.4TranscriptAccumulationofFloralIdentityGenesafterIntermittentInductionisRelatedtoInitiationofFloweringCohorts. ....... 66 4OTHERFACTORSALTERINGTHEEXPRESSIONOFSWEETORANGEFLOWERINGGENESDURINGFLORALINDUCTION .............. 75 4.1MaterialsandMethods ............................. 76 4.1.1PlantMaterial .............................. 76 4.1.2ExperimentalConditions ........................ 76 4.1.3qRT-PCR ................................ 79 4.1.4DataAnalysis .............................. 80 4.2ResultsandDiscussion ............................ 80 4.2.1GibberellinsDown-regulatetheAccumulationofPutativeFloweringSignalsandFloralIdentityGenesTranscripts ............ 80 4.2.2FruitProximity .............................. 82 4.2.3EffectofLight/DarkCyclesonCsFTTranscriptAccumulation ... 83 4.2.4AccumulationofCsFTTranscriptsChangesThroughouttheDay 84 4.2.5EarlyChangesinTranscriptLevelsofCsFTinResponsetoFloralInductiveTemperatures ........................ 85 5CONCLUSIONS ................................... 98 APPENDIX:DESIGN,VALIDATIONANDOPTIMIZATIONOFqPCRASSAYS .... 102 REFERENCES ....................................... 107 BIOGRAPHICALSKETCH ................................ 125 5

PAGE 6

LISTOFTABLES Table page 1-1CitrusandPoncirustrifoliataorthologsofArabidopsisoweringgenes ..... 30 2-1Floweringcharacteristicsof`WashingtonNavel'citrustreesexposedtowaterdecit. ......................................... 49 2-2Floweringcharacteristicsof`WashingtonNavel'citrustreesexposedtowaterdecitatoralinductivetemperatures. ....................... 51 2-3Floweringcharacteristicsofeldgrown`Valencia'treesunderwaterdecitduringWinter. ..................................... 56 A-1PrimerpairsusedfortranscriptquanticationassaysbyqPCR. ......... 104 6

PAGE 7

LISTOFFIGURES Figure page 1-1Modelforthetranscriptionalregulationoforalinductionincitrus ........ 31 2-1ExpressionofCsFTandCsSL1in`Navel'treesunderwaterdecit. ...... 48 2-2ExpressionofCsFTandCsSL1in`Navel'treesunderwaterdecitatoralinductivetemperatures. ............................... 50 2-3ExpressionofCsAP1andCsLFYin`Navel'treesunderwaterdecit. ...... 52 2-4ExpressionofCsAP1andCsLFYin`Navel'treesunderwaterdecitatoralinductivetemperatures. ............................... 53 2-5Expressionofowering-relatedgenesineldgrown`Valencia'treesunderwaterdecitduringWinter. ............................. 54 2-6Expressionofowering-relatedgenesineldgrown`Valencia'treesunderwaterdecitduringSummer. ............................ 55 3-1Inorescencegradient,typesofnewgrowthandinorescencecohortsinC.sinensisspringush. ................................. 68 3-2Numberofinorescencesformedbynodepositioninthespring. ........ 69 3-3ExpressionofCsFTinleavesatdifferentpositions. ................ 70 3-4Expressionoforalidentitygenesinbudsatdifferentpositions. ......... 71 3-5NumberofinorescencesformedbypositionintheTIBA-treatedshoots. .... 72 3-6Expressionoforalidentitygenesinbudsunderintermittentoralinduction. 73 3-7Numberofinorescencesformedbypositioninpottedtreesunderintermittentinduction. ....................................... 74 4-1Expressionofowering-relatedgenesinbudstreatedwithgibberellicacid. .. 90 4-2ExpressionofCsFTinleavestreatedwithgibberellicacid. ............ 91 4-3ExpressionofCsFTinleaveslocatedatdifferentdistancesfromsinglefruits. 92 4-4ExpressionofCsFTunderextremephotoperiods. ................ 93 4-5ExpressionofCsFTatdifferenttimesoftheday. ................. 94 4-6ExpressionofCsFTaftertransfertooral-inductivetemperatures. ....... 95 4-7ExpressionofCsFTineldtreesafterthepassofacoldfront. ......... 96 4-8ChangesinexpressionofCsFTaftertransfertodifferenttemperatures. .... 97 7

PAGE 8

5-1Graphicalsummaryofconclusions ......................... 101 A-2Algorithmforthedesign,validationandoptimizationofqPCRassays ...... 103 A-3AmplicationspecicityofqPCRassays. ..................... 105 A-4LineardynamicrangeandamplicationefciencyofqPCRassays ....... 106 8

PAGE 9

AbstractofDissertationPresentedtotheGraduateSchooloftheUniversityofFloridainPartialFulllmentoftheRequirementsfortheDegreeofDoctorofPhilosophyEXPRESSIONPATTERNSOFFLOWERINGGENESDURINGFLOWERINDUCTIONANDDETERMINATIONINSWEETORANGE(CitrussinensisL.OSBECK)ByEduardoJ.ChicaAugust2011Chair:GeneAlbrigoCochair:ChristineChaseMajor:HorticulturalScienceInrecentyears,severalgenesputativelyinvolvedintheregulationoforalinductionhavebeenidentiedinC.sinensis.However,theexpressionpatternsofthesegenesinresponsetodifferenttreatmentsknowntoalteroralinductionhavenotbeeninvestigated.Astherstlevelofregulationfortheexpressionofagivenphenotype,characterizingtranscriptlevelsofC.sinensisoweringgeneswillbeusefulfordevelopingmodelsthatcouldenablediscoveryofmechanismsregulatingoralinductioninC.sinensisandotherspeciesofsubtropicalorigin.ThisstudyinvestigatedpatternsoftranscriptaccumulationofputativeoweringsignalgenesCsFTandCsSL1,andtheoralidentitygenesCsAP1andCsLFYinresponsetoseveraldrought,lowtemperatureandgibberellintreatmentsknowntoalteroralinductioninC.sinensis.ResultssupportedaroleforCsFTasanintegratorofoweringsignalsinitiatedbylowtemperaturesandwaterdecitwhereasCsSL1wasresponsiveonlytosignalsinitiatedbylowtemperatures.AccumulationofCsFTtranscriptswasproportionaltothedurationoforal-inductivewaterdecitandtolevelsoforal-inductivetemperatures.WaterdecitreducedCsAP1andCsLFYtranscriptaccumulationwhiletreeswereunderwaterdecitbutinducedhigherlevelsofCsAP1andCsLFYtranscriptsafterirrigationwasresumedthaninwell-irrigatedtrees.ThepatternsoftranscriptaccumulationofCsAP1andCsLFYsupportedaroleofthesetwogenesasmarkersoforalinitiation.Basedon 9

PAGE 10

thepatternsofaccumulationCsAP1andCsLFYtranscripts,oraldeterminationoccursrightafteroralinductionandinitiationofgrowthisrequiredfortheirup-regulation.AccumulationpatternsofCsAP1andCsLFYtranscriptscorrespondedtothebasipetalgradientofoweringobservedinC.sinensisshootsandtheinitiationofmultipleoweringcohorts.GibberellinsandthepresenceoffruitbothhadanegativeeffectontheaccumulationofCsFTtranscriptsandexogenousgibberellinsalsoreducetheaccumulationofCsAP1andCsLFYtranscriptsinbuds.AccumulationofCsFTtranscriptschangeddiurnally,respondedquicklytoenvironmentalstimuli,andrequiredalternationoflightanddarkcyclesinordertosustainincreasinglevelsofCsFTtranscriptsaccumulation.ResultsprovideinitialinformationabouttheregulationofoweringinC.sinensisatthetranscriptlevelandcouldbehelpfultodesignmodelsofhowoweringisinducedandregulatedinC.sinensis,othercitruscultivarsandothersubtropicalspecies. 10

PAGE 11

CHAPTER1INTRODUCTIONANDLITERATUREREVIEWFloralinductionmarksthebeginningofamajorshiftinthedevelopmentalprogramofoweringplants.Throughoralinduction,shootmeristemsofoweringplantsstopproducingindeterminatevegetativestructuresandstartgeneratingdeterminatereproductivestructuresintheformofowersandinorescences.Understandingthisshiftinthedevelopmentalprogramofoweringplantsisimportantforboth,biologicalandhorticulturalreasons.Biologically,thetimelygenerationofowersisamajorfactordeterminingevolutionarytnessandthebalanceoftheecosystemtowhichaspeciesbelongs.Horticulturally,oweringisakeyfactordeterminingfruitset,developmentandcropload.Istudiedchangesintheexpressionofasetofowering-relatedgenesinresponsetofactorsthataffectoweringintensityinsweetorangetrees(CitrussinensisOsbeck).TheobjectivewastodeterminewhetherbloomcharacteristicsinC.sinensiscouldbemodeledfromthepatternsoftranscriptaccumulationoftheseowering-relatedgenes.Thestartingpointofmystudywasahypotheticalmodel(section 1.4 )describinghowoweringisinducedinC.sinensisshootmeristems.Thismodelwasbuiltmostlybymerginginformationaboutthemolecularmechanismscontrollingoweringinmodelspecies(A.thaliana,Populussp.andAntirrhinumsp.)withinformationaboutenvironmentalregulationofoweringinC.sinensis.Fromthismodel,asetofhypotheseswasselectedandtestedexperimentally.Thefollowingthreesectionsreviewthefoundationsfortheproposedhypotheticalmodel. 1.1ShootMeristemDevelopmentalProgramsAllaerialplantstructuresoriginatefromshootmeristems.Thetypeofstructureformedineverygrowthcycleisdeterminedbydevelopmentalprogramsexecutedintheactiveshootmeristemanddevelopingprimordia.Inseedplants,twomajordevelopmentalprogramsdeterminewhethernewgrowthwillgoontoformingindeterminate 11

PAGE 12

vegetativestructuresordeterminatereproductivestructures.Bothmajordevelopmentalprogramsrelyheavilyontheestablishmentofspatialdomainsofexpressionandactivityofseveralgenes,proteinsandmetaboliteswithintheshootmeristem.Assumingthatthegenerationofindeterminatevegetativestructuresisthedefaultprogramexecutedinshootmeristems,shiftingtothedeterminatereproductiveprogramwillimplytwomajordevelopmentalchanges:rst,theshootmeristemmustloseitscapacitytoself-replicate(transitiontodeterminacy),and,second,themorphologyofvegetativestructuresshouldbemodiedinordertoformreproductivestructures(generationofreproductivestructures).Thefollowingsubsectionsreviewhowindeterminacyandvegetativecharacterismaintainedinnon-oweringshootmeristems,whatchangesinspatialdomainsofexpressionandactivityofgenes,proteinsandmetaboliteshavebeenassociatedwithchangingdevelopmentalprogramsinshootmeristemsandwhatarethedifferencesbetweenowerandinorescencedevelopment.Unlessnotedotherwise,theinformationpresentedinthefollowingsubsectionsisderivedfromliteratureonArabidopsisthalianabecausethesetopicsarebetterunderstoodinthisspecies. 1.1.1VegetativeGrowth:MaintainingVegetativeIndeterminacyDuringvegetativegrowth,leaves,internodesandaxillarymeristemsareproducedinamodular,reiterativefashionfromtheanksofanactiveshootmeristem( Sussex 1989 ).Inordertosustainindeterminatevegetativegrowth,shootmeristemsmust(1)maintainapoolofundifferentiatedcellstoperpetuatetheprocessand(2)activelygeneratenewvegetativestructuresthroughcelldifferentiation( BowmanandEshed 2000 ).Theproperexecutionoftheseactivitiesdependsontheintegrationofpositionalinformationthatdeterminesthefateofeachcellintheshootmeristem( LauxandMayer 1998 ).Basedoncyto-histologicaldata,theshootmeristemisorganizedinthreezones:(1)acentralzonelocatedatthetipofthemeristemwherecellsdividesparingly,(2)aperipheralzoneontheanksofthecentralzonewherecellsdividemoreoftenand 12

PAGE 13

(3)amedullaryzoneorpithmeristembeneaththecentralzoneandankedbytheperipheralzonewithdivisionsasintheperipheralzone( GiffordandCorson 1971 ).Thecellsfromthecentralzoneremainundifferentiatedwhereascellsintheperipheralzoneandpithmeristemstartdifferentiatingintospeciccelltypes( LauxandMayer 1998 ).Hence,maintenanceoftheundifferentiatedpopulationofcellsoccursinthecentralzonewhereasearlydifferentiation/organinitiationoccursintheperipheralzoneandpithmeristem.Inadditiontothecentral,peripheralandmedullaryzones,theshootmeristemcanalsobeorganizedinthreeconcentriclayers(L1,L2andL3,theoutermostisL1)ofcellsclonallyrelatedtoeachotherandoriginatingfromaminimalnumberofmothercells( StewartandDermen 1970 ).Theboundariesofthesezonesandlayersareapparentlydenedbyactivitydomainsofseveralproteinsandmetabolites.GeneticandmolecularevidenceindicatesthattheundifferentiatednatureofthecellsinthecentralzoneismaintainedbytheinteractionoftheproteinsencodedbytheSHOOTMERISTEMLESS(STM),WUSCHEL(WUS),CLAVATA1(CLV1),andCLAVATA3(CLV3)genes1.TheexpressionofSTMandWUSinthecellsofthecentralzonepromotescelldivisionandkeepthesecellsundifferentiated( Galloisetal. 2002 ; Lenhardetal. 2002 ; Longetal. 1996 ; Mayeretal. 1998 ).ShootmeristemsofmutantslackingeitherSTMorWUSareeitherlostordisorganizedanddysfunctional( BartonandPoethig 1993 ; Lauxetal. 1996 ).TheactivityofSTMandWUSisantagonizedbytheactivityofCLV1andCLV3( Clarketal. 1996 1995 1997 ; ReddyandMeyerowitz 2005 ).CLV1andCLV3arecomponentsofasignalingpathwaythatmaintainsmeristemsize( Brandetal. 2000 ; Clarketal. 1997 ; Fletcheretal. 1999 ; Stoneetal. 1998 )by 1Torefertogenes,mutantsandproteinsIwillbefollowingtheformatsintheGeneticNomenclatureGuideforArabidopsisthalianapublishedinTRENDSinGenetics( Meinkeetal. 1998 ).Briey,wild-typegenenameswillbewritteninusingitalicuppercaseletters(e.g.ABC),mutantallelesusingitaliclowercaseletters(e.g.abc)andproteinsusingnon-italicuppercaseletters(e.gABC). 13

PAGE 14

promotingdifferentiationduringorganformation( Laufsetal. 1998 ; LenhardandLaux 1999 ).DisruptionofthissignalingpathwayinmutantslackingCLV1resultsinover-sizedshootmeristemscomposedofmassesofundifferentiatedcells( Clarketal. 1993 1995 ; LeyserandFurner 1992 ).Thus,indeterminacy,enabledbyself-regenerationofafunctionalmeristem,ismaintainedatthegeneticlevelbytheinteractionsbetweenthecelldivisionandstemcellidentitypromotersSTM/WUSandthesignalsfromtheCLV1/CLV3pathway.Thegenerationofnewvegetativestructuresstartswiththeinitiationofprimordiapre-foundercells( Carraroetal. 2006 ).Thepre-foundercellsoriginatefromthecentralzoneoftheshootmeristemandshowupregulationofprimordiainitiationgenemarkerssuchasZWILLE( Moussianetal. 1998 ),PIN1( Vernouxetal. 2000 )andREVOLUTA( Otsugaetal. 2001 ).Thepre-foundercellsthentransitiontoprimordiafoundercells(4-10cells)locatedintheperipheralzoneofthemeristem( Reddyetal. 2004 ).FoundercellsshowdownregulationofKNOXgenes(thatareinvolvedinthemaintenanceofundifferentiatedmeristematiccells),andexpressionofprimordiainitiationmarkerssuchasAINTEGUMENTA(ANT)( Elliottetal. 1996 )orLEAFY(LFY)( Weigeletal. 1992 ).ANTandLFYarealsoinvolvedinorganidentity( Krizeketal. 2000 ; Weigeletal. 1992 ).Atthisstage,aboundarydomainfortheemergingprimordiaisestablishedandisdenedbytheexpressionofCUP-SHAPEDCOTYLEDONSgenes( Aidaetal. 1997 ; Vroemenetal. 2003 ).Thelaststageofprimordiaformationistheestablishmentofdorso-ventrality,followedbycelldifferentiation,proliferationandexpansion( Carraroetal. 2006 ).Theprocessesinthislaststagearecontrolledbygeneticprogramsspecictoeachtypeoforganformed( Blazquezetal. 2006 ).Thus,duringearlyorganmorphogenesis,meristematicidentityisrstlostinagroupoffoundercellsinthecentralzoneofthemeristemandthenorganidentityisdetermined.Thesetwoprocessesareundercontrolofseveralgeneticprogramsintegratingsignalsfromwithintheplantandtheenvironment. 14

PAGE 15

1.1.2PhaseChange:Re-programingtheMeristemtoProduceFlowersFloralinitiationinducesamajorchangeintheshootmeristem'sorganizationandphysiology.AftertheactivationofoweringsignalintegratorsAPETALA1(AP1)andLFY,themeristemstopsproducingleafprimordiaandinitiateoralorganprimordiainstead( MandelandYanofsky 1995 ; WeigelandNilsson 1995 ).Floralorganprimordiaoriginateinthemeristemasaseriesofconcentricwhorlswithsepalprimordiabeinginitiatedrstintheoutermostwhorl,followedbythepetalprimordia,thenthestamenprimordiaandnallythecarpelprimordiaintheinnermostwhorl( CoenandMeyerowitz 1991 ; Smythetal. 1990 ).Flowersandshootsshowstructuralhomology,andthusowerscanbeimaginedasshootsystemswithminimalinternodes,alteredphyllotaxyandmodiedleaves( CoenandCarpenter 1993 ; Esau 1977 ).Animportantdistinctionbetweenoralandshootmeristemsisthatwhereasshootmeristemsmaintainapopulationofundifferentiatedcellsandthusarecapableofindeterminategrowth,oralmeristemseventuallylosethispopulationofundifferentiatedcellsandbecomeincapableofundergoingfurthergrowth.Thus,duringthephasechangefromvegetativetoreproductivegrowth,shootmeristems:(1)arere-programedtoactivatedevelopmentalprogramsthatmodifythebasicmorphologyofleavestoproduceoralorgansintheemergingprimordia,and(2)loseindeterminacybyfailingtomaintainapopulationofundifferentiatedcellsinthecentralzone.AP1andLFYarethetargetsforoweringsignalsinitiatedbydifferentinternalandenvironmentaloweringpromoterstimuli( Blazquezetal. 1998 ; Ruiz-Garciaetal. 1997 ; Wagneretal. 1999 ).UpregulationofAP1andLFYestablishoralmeristemidentityinshootmeristems( MandelandYanofsky 1995 ; WeigelandNilsson 1995 ).Onceactivated,AP1andLFYreinforceeachother'sexpressionandinitiateoralmorphogenesis( Liljegrenetal. 1999 ; Parcyetal. 1998 ; Wagneretal. 1999 ).FloralmorphogenesisinmostangiospermscanbeexplainedbythesocalledABC+SEPmodel( Jack 2001 ).TheABC+SEPmodelconsidersthatgenesinvolvedinoral 15

PAGE 16

organmorphogenesiscanbeclassiedinfouractivityclasses( CoenandMeyerowitz 1991 ; Jack 2001 ).Genesbelongingtoeachoftheseactivityclassesareexpressedatspecictimesinspecicwhorlsoftheemergingprimordiaintheoralmeristemandtheinteractionoftheirproductsdenethetypeoforalorgantobeformedineachwhorl( Bowmanetal. 1991 ; CoenandMeyerowitz 1991 ; Jack 2001 ).AP1andAPETALA2(AP2)areclassAgenesandareexpressedinthetwooutermostwhorlsoftheoralmeristem(i.e.whorls1and22),APETALA3(AP3)andPISTILLATAareclassBgenesandareexpressedinthetwomiddlewhorls(i.e.2and3),andAGAMOUS(AG)isaclassCgeneexpressedinthetwoinnermostwhorls(i.e.3and4)( WeigelandMeyerowitz 1994 ).TheSEPALLATAgenes(SEP1/2/3)areexpressedinallfourwhorls(exceptSEP3thatisexpressedonlyinwhorls2-4)( FlanaganandMa 1994 ; MandelandYanofsky 1998 ; Savidgeetal. 1995 ).Then,accordingtothemodel,expressionofclassAintherstwhorlinitiatessepalprimordia,jointexpressionofclassAandclassBgenesinthesecondwhorlinitiatespetalprimordia,jointexpressionofclassBandclassCgenesinthethirdwhorlinitiatesstamenprimordiaandnallyexpressionofclassCgeneAGinthefourwhorlinitiatescarpelprimordiaandterminatesgrowthbyinactivatingWUS( MizukamiandMa 1995 ; WeigelandMeyerowitz 1994 ).TheexpressionofSEPgenesisrequiredbyclassBandclassCgenesactivity( Pelazetal. 2000 ).DeterminacyintheoralmeristemisachievedprimarilybyinactivationofWUSintheoralmeristem( Lenhardetal. 2001 ; Lohmannetal. 2001 ; Prunetetal. 2008 ).InactivationofWUSoccursprimarilythroughapositive-negativefeedbackloopbetweenAGandWUS( Lenhardetal. 2001 ).Inearlystagesofowerdevelopment,AGexpressionisactivatedbyLFYandWUS( Lohmannetal. 2001 ).Later,expressionofAGinactivatesWUSthroughtheactionofKNUCKLES,thatprovidestemporal 2A.thalianaoralmeristemsconsistsoffourwhorls 16

PAGE 17

integrationfortheprocess.GeneticevidenceindicatesthatotherpathwaysmightalsobeinvolvedintheinactivationofWUS( MingandMa 2009 ).Forinstance,SUPER-MANterminatesWUSexpressionindependentlyofAGthroughapathwaymediatedbyAPETALA3andPISTILLATA( Bowmanetal. 1992 ; Schultzetal. 1991 ).OthergenesinvolvedinoralmeristemdeterminacyincludeCRABCLAW,possiblyactingdownstreamofAG,APETALA3andPISTILLATA( BowmanandSmyth 1999 ; Leeetal. 2005 ),andthegroupofREBELOTE,SQUINTandULTRAPETALApossiblyactingupstreamofbothSUPERMANandAG( Carlesetal. 2004 ; Prunetetal. 2008 ).Regardlessofthevarietyofpotentialpathwaysandmechanism,inactivationofWUSseemstobeanecessaryconditionfordeterminacyinoralmeristem. 1.1.3Inorescences:aHybridProgramFlowerscanoccursinglyorinclustersforminganinorescence.Inorescencescanbedeterminateorindeterminatedependingonwhetheradditionalgrowthispossiblethroughthemaintenanceofanactivemeristem.Regardlessofthetypeofinorescenceformed,inorescencemeristemsaredifferentfromoralmeristemsinthatapopulationofundifferentiatedcellsinthecentralzoneismaintainedatleastuntilthetopologyoftheinorescenceisestablished;therefore,certainvegetativecharacterisstillconservedininorescencemeristems.Determiningwhethermeristemsinanemerginginorescencewilldevelopintoshoot-likeorowerstructuresseemstoberegulated(atthemolecularlevel)bytheinteractionsbetweenAP1,LFYandTERMINALFLOWER1(TFL1)( ShannonandMeeks-Wagner 1991 ).InorescencesofwildtypeArabidopsisareindeterminate,andthusmaintainapopulationofundifferentiatedcellsintheirapicalmeristems( Smythetal. 1990 ).Incontrast,ArabidopsismutantslackingTFL1producedeterminateinorescencesinwhichtheapicalmeristemproducesasingleower( Alvarezetal. 1992 ; SchultzandHaughn 1993 ; ShannonandMeeks-Wagner 1991 ),suggestingthatTFL1isinvolvedinmaintainingundifferentiatedapicalmeristems( Bradleyetal. 1997 ).TFL1isalso 17

PAGE 18

expressedduringthevegetativephase,anditsmutantshowsdelayedphasetransitionsduringdevelopment( Ratcliffeetal. 1998 ),suggestingthatTFL1isabroaderregulatorofplantdevelopment.Intheinorescencemeristem,TFL1isexpressedprimarilybelowthecentralzone( Alvarezetal. 1992 ; ShannonandMeeks-Wagner 1991 ).Inthecentralzone,TFL1repressestheexpressionoforalidentitygenesAP1andLFYbydelayingtheupregulationofAP1andLFYandmakingthemeristemlessresponsivetotheactivityofAP1andLFY( Ratcliffeetal. 1999 ).Thus,TFL1keepsthemeristemfromacquiringoralidentity( ShannonandMeeks-Wagner 1993 ).Inturn,intheperipheralzone,AP1andLFYinhibittheexpressionofTFL1( Liljegrenetal. 1999 ; Parcyetal. 2002 ; ShannonandMeeks-Wagner 1991 )andpromoteoralidentityintheaxillarymeristems( MandelandYanofsky 1995 ; WeigelandNilsson 1995 ).TFL1expressioninthecentralzoneoftheinorescencemeristemoccursbeforetheupregulationofAP1andLFYduringowerdevelopmentandrestrictsAP1andLFYtotheperipheralzoneofthemeristemwhereaxillarymeristemsareforming( Ratcliffeetal. 1999 ).Astheseaxillarymeristemsdevelop,theexpressionofAP1andLFYrestricttheupregulationofTFL1inlateralpositionsandestablishoralidentityinthesemeristems( Ratcliffeetal. 1999 ).IftheaxillarymeristemsformbeforeAP1andLFYareactivated,TFL1willbeactivatedrstandtheaxillarymeristemwilldevelopintoanaxillaryinorescence( Ratcliffeetal. 1999 ).Hence,meristemfateintheinorescencemeristemseemstobedeterminedbytherelativetimingofupregulationoforalidentitygenes(AP1andLFY)andTFL1andtheirmutualinhibition.BesidestheTFL1(AP1+LFY)regulatoryloopinA.thaliana,othermechanismscontrollingthefateofinorescencemeristemshaverecentlybeenreportedinotherspeciesbutarenotasextensivelydocumentedastheTFL1(AP1+LFY)loop( Bull-HerenuandClaen-Bockhoff 2011 ). 18

PAGE 19

1.2FloralInduction:aGeneralOverviewFloraldevelopmentrequirestheexecutionof3developmentalprocessesinshootmeristems.First,juvenilemeristemsunabletorespondtooralinductivestimulibecomecompetenttoowerastheplantages.Then,oralcompetentmeristemsbecomedeterminedtoowerbybeingexposedtooralinductivestimuli.Finally,oraldeterminedmeristemsinitiategrowandformeitherowersorinorescences( McDanieletal. 1992 )(reviewedinsection 1.1 ).Thespecicsofeachofthesedevelopmentalprocessesvariesgreatlyacrossspeciesandtheenvironmentinwhicheachspeciesdevelops.InthissectionIreviewthespecicsoftheprocessoforalcompetenceacquisitionandoralinductioninthemodelA.thalianaandotherspeciesinresponsetodifferentoweringstimuli. 1.2.1AcquisitionofCompetenceTheacquisitionoforalcompetenceistherstdevelopmentaltransitionrequiredtoinitiateowering( McDanieletal. 1992 ).Mostspecies,eitherannualorperennial,gothroughajuvenilephaseduringtheirdevelopmentinwhichmeristemsproduceonlyvegetativestructures(usuallywithdistinctivecharacteristicssuchasthorns,trichomedistribution,uniquephyllotaxyandleafshape)andareorallyincompetent( Poethig 1990 ).Thejuvenilephasemaylastfromdaysorweeksinmostherbaceousspeciestoseveralyearsinmostwoodyspecies( Poethig 1990 ).Theprincipalfactorassociatedtothejuvenile-to-adulttransitionisthedevelopmentalageoftheplant( LawsonandPoethig 1995 ).Thespecicsofthemechanismsregulatingthejuvenile-to-adulttransitionhavenotbeenstudiedasextensivelyasotherphasetransitions( AlbaniandCoupland 2010 ; Poethig 2003 ).However,themechanismregulatingthejuvenile-to-adulttransition,andthustheacquisitionoforalcompetence,seemstocontain2sub-processes:(1)acheckprocessforthedevelopmentalageoftheplanthatinitiatesorholdsthetransitiontotheadultphase,and(2)adevelopmentalprogramthatinduceschangesinthemorphologyandphysiologyofneworgansformed 19

PAGE 20

intheadultphase;thelatterprogramincludestheacquisitionoforalcompetenceinshootmeristems.Thecheckprocessforthedevelopmentalageoftheplantcouldbecontrolledbyspatialandtemporalsignals( BrunnerandNilsson 2004 ; Dayetal. 2002 ; LawsonandPoethig 1995 ).Supportfortheinvolvementofaspatialsignalcomesfromworksinwhichplantsizeratherthanagehasbeencorrelatedwiththejuvenile-to-adulttransition( Greenwoodetal. 2010 ; LongmanandWareing 1959 ; OliveraandBrowning 1993 ).Accordingtothishypothesis,juvenilityismaintainedbyasignalproducedintheroots( Greenwoodetal. 2010 ; McDaniel 1980 ; OliveraandBrowning 1993 ; SchwabeandAl-Doori 1973 ),then,astheplantgrows,thedistancebetweentherootandshoottipsincreasesandtheactivityofthejuvenilitysignalfromrootsdecreasesindistalmeristemspromotingthetransitiontotheadultphase( BrunnerandNilsson 2004 ; Dayetal. 2002 ; Greenwoodetal. 2010 ).Thishypotheses,however,ischallengedbyotherworksinwhichthejuvenile-to-adulttransitionisnotaffectedbyplantsizebutbyplantage( LawsonandPoethig 1995 ; Telferetal. 1997 ).Twoobstaclesfordeterminingtheexactmechanismforkeepingtrackofdevelopmentalageare(1)confoundingeffectsamongprocessesaffectedbybothplantsizeandage( LawsonandPoethig 1995 )and(2)thelackofareliablejuvenile-to-adulttransitionmarkerotherthanreproductivecompetence( Jones 1999 ).Still,evidencesupportsthehypothesisofsinglecentralmechanismthatkeepstrackofthedevelopmentalageoftheplant( Martnez-Zapateretal. 1995 ; Ratcliffeetal. 1998 ).Forinstance,geneticmanipulationofgenesregulatingoweringtimeinArabidopsisalsoalterotherphasetransitions( Ratcliffeetal. 1998 ; Steynenetal. 2001 ; WillmannandPoethig 2011 ).Inwoodyspecies,theeffectofmanipulatingoweringgeneexpressiononadultphasetransitionismoreobvioussincelengthyjuvenilephasesof7-15yearsareshortenedto1-2yearswhenoweringgenessuchasAP1,LFYorFLOWERINGLOCUST(FT)areover-expressed( Endoetal. 2005 ; Hsuetal. 2006 ; Penaetal. 2001 ).Othergenes 20

PAGE 21

alsoinvolvedintimingthetransitiontotheadultphaseinArabidopsisareEARLYFLOWERING1,HASTY,ZIPPY,andSQUINT( Berardinietal. 2001 ; Hunteretal. 2003 ; Scottetal. 1999 ; TelferandPoethig 1998 );mutantslackingthesegenesdevelopwithashorterjuvenilephasecomparetowild-typeplants.However,eventhoughthejuvenilephaseinmutantslackingZIPPYisshortenedandadultvegetativetraitsareexpressed,oralcompetenceisnotimmediatelyacquired,indicatingthatbothprocessescouldbeindependent( Hunteretal. 2003 ).Ontheotherhand,severalfactorsaffectingtheactualonsetoftheadultphasehavebeenidentied.InA.thalianaandmaize,transitiontotheadultphaseiscontrolledbytheexpressionofmicroRNAs(miRNAs)( Chucketal. 2007 ; Peragineetal. 2004 ; WuandPoethig 2006 ).ThesignaltriggeringthetransitiontotheadultphaseinA.thalianaandmaizeistheinactivationofmiRNAmiR156( Chucketal. 2007 ; Wuetal. 2009 ; WuandPoethig 2006 ).ExpressionofmiR156occursinleafprimordiaandmaintainsjuveniletraitsinthedevelopingleaf( Yangetal. 2011 ).MaintenanceofjuveniletraitsbymiR156occursbyrepressionofmembersoftheSBP/SBLfamilyoftranscriptionfactors( Chucketal. 2007 ; Gandikotaetal. 2007 ; Schwabetal. 2005 ; Schwarzetal. 2008 ; WuandPoethig 2006 ).SomemembersoftheSBP/SPLfamilyoftranscriptionfactorsregulatetheexpressionofseveraloweringgenessuchasAP1andLFY( Wangetal. 2009 ; Yamaguchietal. 2009 );thus,oralcompetencecouldberegulatedbythismechanism. 1.2.2FloralInductionFloralinductionistheprocessbywhichorallycompetentmeristemsbecomedeterminedtoower( McDanieletal. 1992 ).Floralinductionoccurswhencompetentmeristemsareexposedtostimulithatinitiatethedevelopmentofinorescencesandowers( Araki 2001 ).Thespecicstimuliinducingoweringvarydependingonthespecies,andareusuallysignalsofdevelopmentalandenvironmentalconditionsfavoringreproductivesuccess( Putterilletal. 2004 ).Inmodelplants,themost 21

PAGE 22

extensivelystudiedoralpromotingstimuliarechangesinphotoperiod,vernalization,phytohormonesanddevelopmentalage( Amasino 2010 ; Komeda 2004 ).SomecomponentsofthemolecularmechanismssensingandtransmittingoweringsignalsinArabidopsisseemalsotobeconserved,atleastpartially,inotherspecies( Benllochetal. 2007 ; Sablowski 2007 ).Photoperiodicinductionofoweringoccurseitherbyextendingorshorteningday-lengths.Long-dayplants(alsocalledshort-nightplants)owerastheday-lengthincreaseswhereasshort-dayplantsowerasthenightlengthincreases( Amasino 2010 ).Themechanismscouplingday-lengthsensingandoralinitiationseemtobesimilarinbothlong-dayandshort-dayspecies( HayamaandCoupland 2004 ; Turcketal. 2008 ).Inlong-dayArabidopsis,increasingday-lengthissensedbyCONSTANS(CO)whoseexpressioniscontrolledbythecircadianclockandpeaksbetween16handdusk( Suarez-Lopezetal. 2001 ).COproteinistargetedfordegradationbytheproteasomeunderdarkconditions( Valverdeetal. 2004 ),soCOisonlystablewhentheday-lengthislongenoughforlighttostabilizeCO( HayamaandCoupland 2004 ; YanovskyandKay 2002 ).COactsasatranscriptionfactorforfourothergenes.Twoofthesegenes,SUPRESSOROFOVEREXPRESSIONOFCO1(SOC1)andFTaremajorintegratorsofoweringsignals( Samachetal. 2000 ).COtriggerstheexpressionofFTinphloemofleaves( Anetal. 2004 ; Mathieuetal. 2007 ; TakadaandGoto 2003 ).Then,FTistransportedtotheshootmeristemthroughthephloem( Corbesieretal. 2007 ).IntheshootmeristemFTformsacomplexwiththetranscriptionfactorFD( Abeetal. 2005 ; Wiggeetal. 2005 )andactivatestheexpressionofAP1,LFYandSOC1( Abeetal. 2005 ; Michaelsetal. 2005 ; Wiggeetal. 2005 ; Yooetal. 2005 ).Inshortdayrice,oweringisinducedbyasimilarbutreversedphotoperiodsensingmechanism( HayamaandCoupland 2004 ; Turcketal. 2008 ).Themaindifferenceisthattheproductoftheshort-dayriceorthologofCO(Hd1)notonlyinducestheexpressionoftheFTortholog(Hd3a)underinductiveshortdays,butalsorepresses 22

PAGE 23

theexpressionofHd3aundernon-inductivelong-days( Kojimaetal. 2002 ; Turcketal. 2008 ; Yanoetal. 2000 ).Intemperateclimatesmanyspeciesrequireprolongedexposuretocoldtemperaturestoinitiateowering,aprocessknownasvernalization( Kimetal. 2009 ).Incontrasttotheeffectofchangesinphotoperiod,vernalizationenablesratherthaninducesowering( Bossetal. 2004 ).InArabidopsis,thevernalizationresponseismostlycontrolledbytheexpressionofFLOWERINGLOCUSC(FLC)andothermembersoftheFLCcladeinducedbythedominantalleleofFRIGIDA(FRI)( MichaelsandAmasino 1999 ; Ratcliffeetal. 2003 ; Scorteccietal. 2001 ).FLCdirectlyrepressestheexpressionoforalpromotersFT,FDandSOC1andthusblockoralinitiation( Helliwelletal. 2006 ; Hepworthetal. 2002 ; Searleetal. 2006 ).Inturn,theexpressionofFLCiscontrolledepigeneticallybytheexpressionofVERNALIZATION1(VRN1),VERNAL-IZATION2(VRN2)andVERNALIZATIONINSENSITIVE3(VIN3)throughhistonemodications( Gendalletal. 2001 ; Levyetal. 2002 ; SungandAmasino 2004 ).Oncethevernalizationrequirementismet,theexpressionlevelofFLCbecomesandremainslowandtheplantbecomessensitivetooralinductivesignals( Leeetal. 2000 ; Samachetal. 2000 ).Interestingly,whereascomponentsofthemechanismforphotoperiod-inducedoweringareatleastpartiallyconservedinmanyotherplantspecies,thecomponentsofthemechanismenablingoweringbyvernalizationinAra-bidopsisarenot,supportingthehypothesisofvernalizationrequirementshavingevolvedlaterthanphotoperiod-inducedowering( Kimetal. 2009 ).InArabidopsis,FLCisalsorepressed(andthusoweringisenabled)byseveralgenesknownasautonomous-pathwaygenes( Amasino 2010 ).Mutantslackingautonomous-pathwaygeneshavedelayedoweringandconferavernalizationrequirementevenintheabsenceofadominantFRIallele( MichaelsandAmasino 2001 ).Despitetheirname,autonomous-pathwaygenesdonotappeartobelongtoaformalpathwaywithadenedtopology,butinsteadtheyareasetofgenesgenerally 23

PAGE 24

involvedinpost-transcriptionalcontrolofgeneexpressionthroughseveralmechanisms( BaurleandDean 2008 ; Heetal. 2003 ; Macknightetal. 1997 ; Nohetal. 2004 ; Schomburgetal. 2001 ; Wangetal. 2007 ).Further,mostautonomous-pathwaygenesarenotexclusivelyinvolvedinFLCrepressionandoweringcontrolbutalsoinotherdevelopmentalprocesses( VeleyandMichaels 2008 ).Theroleofautonomous-pathwaygenesinenablingoweringseemstobetomaintainFLCexpressionatbasallevels( Amasino 2010 ).OtherfactorseitherpromotingorenablingoweringinArabidopsisaregibberellins( BlazquezandWeigel 1999 ; Wilsonetal. 1992 ),non-vernalizingtemperatures(i.e.>6C)( Balasubramanianetal. 2006 ; Blazquezetal. 2003 ; Kimetal. 2004 )lightquality( Hallidayetal. 2003 )andsalinity( Kimetal. 2007 ).Themechanismsbywhichthefactorsjustlistedregulateoweringtimehavenotbeendescribedasthoroughlyasthosementionedinthepreviousparagraphs.However,acommoneffectofthefactorslistedatthebeginningofthisparagraphistheregulationofFTeitherdirectlyorbyrepressionofFLC.Thisindicatesthatregardlessofthetriggeringstimulus,oweringsignalseventuallyconvergetoasetofintegratorgenesthatultimatelyup-regulateoralidentitygenes( Araki 2001 ). 1.3FloralInductionincitrusCitrustreesgrownfromseedbecomeorallycompetentonlyaftercompletingajuvenilephasethatmaylastfrom5to13years( DaviesandAlbrigo 1994 ).Then,oncethejuvenilephaseispast,citrustreesowereithercontinuouslyorseasonallydependingoncultivarsandenvironmentalconditions.Onlytwoenvironmentalfactorsareknowntoinduceoweringincitrus:lowambienttemperature( Moss 1969 )andwaterdecit( Cassinetal. 1969 ).Aswithmanyotherperennialspecies,thespecicmechanismsthatregulateoweringincitrushasnotbeenidentied.However,manycomponentsofthemechanismsregulatingoweringinmodelplants(primarilyAra-bidopsis)seemtobeconservedincitrusspecies.Inthissection,Ireviewtheeffectsof 24

PAGE 25

internalandenvironmentalfactorsknowntoaffectoweringincitrus,then,IpresenttheputativecitrusorthologsofArabidopsisoweringgenes. 1.3.1FactorsRegulatingFloralInductioninCitrusLowtemperaturesandwaterdecitaretheonlytwofactorsknowntoinduceoweringincitrus( Cassinetal. 1969 ).Otherfactorssuchasgibberellins,croploadorchangesinnitrogenmetabolismarealsoinvolvedinregulatingoralinduction,butdonotproperlyinduceowering;thesefactorsonlymodifythecharacteristicsoftheinducedbloom( KrajewskyandRabe 1995 ).Theintensityoforalinductionincitruscanbeinferredfromthecharacteristicsoftheinducedbloom.Thetwomaincharacteristicsofthecitrusbloomrelatedtotheintensityoforalinductionare:thenumberofinorescencesformedandthetypeofinorescenceformed(i.e.leaess,leafabundantandleafdecientinorescences)( Moss 1969 ; Sauer 1954 ).Ingeneral,theintensityoforalinductionduetolowtemperaturesandwaterdecitincitrusdependsonboththeintensityandtimeofexposuretothesestimuli( Cassinetal. 1969 ; Moss 1969 ; SouthwickandDavenport 1986 ).Floralinductionoccursattemperaturesbetween5and20C,withthestrongestinductionoccurringbetween10and15C( Garca-Luisetal. 1992 ; Moss 1969 ; ValienteandAlbrigo 2004 ).Theexactrangeoflevelsofwaterdecitinducingoweringhasnotbeenpreciselydened,however,moderatewaterdecitsaremoreeffectiveininducingoweringwithoutinducingundesirableleafloss( Cassinetal. 1969 ; SouthwickandDavenport 1986 ).Ontheotherhand,timeofexposuretoinductivestimuliisapparentlyadditivetotheintensityoftheoralinductivestimuli( Chica 2007 ).Both,lowtemperaturesandwaterdecit,caninduceoweringafterexposuresof2weeks,thentheresponsepeaksafter8-9weeks( Cassinetal. 1969 ; Chica 2007 ; Moss 1969 ; SouthwickandDavenport 1986 ).Althoughgibberellins,croploadandchangesinnitrogenmetabolismregulatetheintensityoforalinductionincitruswithoutactuallyinitiatingit,applicationofgibberellins 25

PAGE 26

( CooperandPeynado 1958 ; Garca-Luisetal. 1986 ; Monseliseetal. 1964 )andheavycropsloads( GoldschmidtandGolomb 1982 ; Moss 1971 ; ValienteandAlbrigo 2004 )reducetheleveloforalinductionwhereasapplicationsofnitrogen(intheformofurea)canincreasetheleveloforalinduction( Albrigo 1999 ; AliandLovatt 1994 ).Ithasbeenproposedthatreducedcarbohydrateavailabilityorincreasedgibberellinlevelscouldcontrolthenegativeeffectofcroploadonoralinduction( GoldschmidtandGolomb 1982 ; Koshitaetal. 1999 ).Ontheotherhand,thehigherlevelsofinductionafterapplicationoffoliarureahavebeenassociatedwithincreasedconcentrationofpolyamines( AliandLovatt 1995 ; Lovattetal. 1992 1988 ),which,inotherspecies,havebeenshowntopromoteowering( Havelangeetal. 1996 ; Huangetal. 2004 ; Wadaetal. 1994 ). 1.3.2CitrusOrthologsofArabidopsisFloweringGenesSeveral(putative)orthologsofArabidopsisowering-relatedgeneshavebeenidentiedandcharacterizedincitrus( Endoetal. 2005 ; Nishikawaetal. 2010 2009 2007 ; Pillitterietal. 2004a b ; TanandSwain 2007 ).Ingeneral,thesegenes(Table 1-1 )showhighsequencesimilarityattheaminoacidlevel(>60%)withtheirArabidop-siscounterparts,theirpatternsofexpressionsupporttheirhypotheticalinvolvementintheoweringprocessincitrus,andtheycomplementthemutantphenotypesofArabidopsismutantslackingtheirrespectiveortholog( Kobayashietal. 1999 ; Pillitterietal. 2004a b ; TanandSwain 2007 ).Also,overexpressionofsomeoftheseowering-relatedgenesfromcitrusorArabidopsisapparentlyreducethelengthofthejuvenilephaseandpromoteearlyoweringincitrus( Endoetal. 2005 ; Penaetal. 2001 ).Inaddition,manyofthesegenes(plussomeothers)havealsobeenisolatedandcharacterizedinanaturalearly-oweringmutantofacitruscloserelative,Poncirustrifoliata,andthepatternsofexpressionofthesegenesinthismutantsupporttheirinvolvementinregulatingtheoweringprocess( Lietal. 2010 ; Zhangetal. 2011 2008 2009a b ).However,eventhoughtheaboveevidencesupportsthehypothesis 26

PAGE 27

ofcitrusowering-relatedgenesorthologoustothoseinArabidopsisbeinginvolvedinregulatingtheoralinduction,thisevidenceisinsufcienttosupporttheconservationofmechanismsregulatingtheexpressionofthesegenes.Infact,thetypeoforalinductivestimuliandthetimeoforalinductionsupportthehypothesisofdifferentmechanismsregulatingtheexpressionofoweringgenesincitrusandArabidopsis. 1.4HypotheticalModelfortheTranscriptionalRegulationofFloralInductionincitrusEventhoughseveralputativeorthologsofArabidopsisoweringgeneshavebeenidentiedincitrus,themolecularmechanismthatcontroloweringinbothspeciesarelikelytobedifferent.FloweringinArabidopsis(andothermodelspecies)isinducedbychangesinphotoperiod( Turcketal. 2008 )butphotoperioddoesnotseemtoinuenceoweringincitrus( Moss 1969 ).Also,exposuretolowtemperaturesenablesoweringinArabidopsisthroughvernalizationwithoutproperlyinducingit(plantseitherowerordonot)( Kimetal. 2009 )whereasincitrus,lowtemperaturesdirectlyinduceowering(treesrespondtolevelsoflowtemperaturesandlengthofinductionquantitatively)( Moss 1969 ).Furthermore,incitrus,likeinseveralotherperennialspecies( AlbaniandCoupland 2010 ),gibberellinshaveanegativeeffectonoralinductionwhereasinArabidopsisgibberellinspromoteoweringundershortdays( Monseliseetal. 1964 ; Wilsonetal. 1992 ).Nonetheless,theexpressionpatternsofthecitrusorthologsofArabidopsisoweringgenes( Endoetal. 2005 ; Nishikawaetal. 2010 2009 2007 ; Pillitterietal. 2004a b ; TanandSwain 2007 ),thecomplementationofArabidopsismutantsbyinsertedcitrusoweringgenes( Nishikawaetal. 2007 ; Pillitterietal. 2004a ; TanandSwain 2007 ),andacceleratedoweringincitruswheneithercitrusorArabidopsisoweringgenesareover-expressed( Endoetal. 2005 ; Kobayashietal. 1999 ; Nishikawaetal. 2007 ; Penaetal. 2001 ; Pillitterietal. 2004a ; TanandSwain 2007 ).Thisindicatesthattheindividualfunctionofthesegenesisatleastpartiallyconservedinbothspecies.InthissectionIpresentanhypotheticalmodel(Fig. 1-1 ) 27

PAGE 28

toexplainthetranscriptionalregulationofoweringincitrus.Themodelreliesontheassumptionsof(1)functionalorthologybetweenArabidopsisandcitrusgenesand(2)citrusevolutionofregulatorysequencesofowering-relatedgenesthatrespondtosignalsgeneratedbylowtemperatureandwaterdecit.Floweringsignalsmustbeinitiatedbylowtemperatureand/orlowplantwaterstatussensingmechanismsbecausetheonlytwofactorsknowntoinduceoweringincitrusarelowtemperaturesandwaterdecit.Thesignalingpathwayinitiatedbylowtemperaturescouldbemorespecializedtoinduceoweringthanthesignalingpathwayinitiatedbywaterdecitsincelowtemperaturesinduceoweringmoreintenselythanwaterdecits( Cassinetal. 1969 ).Signalsinitiatedbyoral-inductivelowtemperatureseventuallyactivatefactorsthatup-regulateCsFTinleavesandstems( Nishikawaetal. 2007 ).CsFTcouldalsobeupregulatedbysignalsinitiatedbywaterstress,butthereisnopublishedevidencesupportingthishypothesis.SignalsfromeitherlowtemperatureorwaterdecitcouldalsobeintegratedbyCsSL1,thecitrusorthologofArabidopsis'sSOC1.InArabidopsis,SOC1isakeyintegratorofoweringsignalsfromdifferentregulatorypathways( LeeandLee 2010 ).EctopicexpressionofCsSL1inArabidopsissocmutantscausesearlyowering( TanandSwain 2007 ),indicatingthatCsSL1isfunctionallyconservedinbothspecies.However,thisistheonlyevidencesupportingaroleforCsSL1asanintegratorofoweringsignalsincitrus.IfCsSL1wereanintegratorofoweringsignalsfromdifferentpathwaysinCitrusasitisinArabidopsis,itsexpressionwouldlikelyincreasewhentreesareexposedtoinductivelowtemperaturesorwaterdecit.IfitisassumedthatCsFTandCsSL1areintegratorsofoweringsignals,theincreasedexpressionofCsFTandCsSL1shouldinitiatetheexpressionoforalidentitygenesCsAP1andCsLFY.However,expressionofCsAP1andCsLFYisnotinitiateduntiltheonsetofgrowth-promotingwarmertemperaturesandnon-limitingwateravailability( Pillitterietal. 2004a )indicatingthatactivationofCsAP1andCsLFY 28

PAGE 29

dependsalsoonenvironmentalsignalsoppositetothosethatregulatetheexpressionofCsFTandCsSL1.Ultimately,CsAP1andCsLFYinitiateoralorganorganogenesisinshootmeristems.However,citrusbloomsarenotcomposedofonlysingleowers.Instead,citrusbloomsareusuallyamixtureofsingleowers,leaesscymes,cymeswithvaryingleaf/owerratiosandalsovegetativeshoots.Thetypeofnewgrowthformedafteroralinductionisrelatedtoboththeintensityoftheinductivestimuliandthedurationoforalinduction( Moss 1969 ).Thus,thetypeofnewgrowthformedafteroralinductioncouldbedeterminedineachbudbyabalancebetweenfactorsconferringoralidentityandfactorsconferringvegetativeidentity.Inthemodelproposed,thefactorconferringoralidentityisthecombinedexpressionofCsLFYandCsAP1,whereasvegetativeidentityisconferredbytheexpressionofCsTFL1.ThishypothesisissupportedbythepatternsofexpressionofCsTFL1inadultcitrustreesafteroralinduction( Pillitterietal. 2004a )andthefunctionoftheTFL1fromArabidopsisasaregulatorofinorescencearchitectureanddevelopmentalphasetransitions( ContiandBradley 2007 ; Ratcliffeetal. 1998 ).ThemodelproposedinFigure 1-1 accountsforthecontroloforalorinorescenceinitiationatthemeristemlevel.However,besidesoral/inorescenceinitiationatthemeristemlevel,citrusalsoshowresponsestooralinductionattheshootlevel.Theshootlevelresponsetooralinductionincitrusistwofold:(1)Anbasipetalgradientoforalintensity(asreportedbythetypeofinorescenceformed)isestablishedinshoots( Sauer 1954 ; ValienteandAlbrigo 2004 ),and(2)multipleower/inorescencecohortsareinitiatedwhentreesareexposedtointermittentoralinduction( Simanton 1969 ; ValienteandAlbrigo 2003 ).Thus,amechanismshouldexistforthedistributionofoweringsignalsamongmeristemsonthesameshootsothatdifferentialoweringcanbeexpressed.Thismechanismishypothesizedtobeactivatedinmeristemsatmorebasalpositionsoftheshootaseithermeristemsinmoreapicalpositionreachahypothesizedmaximallevelofinductionorduringintermittentoralinduction. 29

PAGE 30

Table1-1. CitrusandPoncirustrifoliataorthologsofArabidopsisoweringgenes Citrus/P.trifoliataArabidopsisFunctioninArabidopsisReferences CiFTFTFloralsignalintegrator Endoetal. ( 2005 ); Kobayashietal. ( 1999 ); Matsudaetal. ( 2009 ); Nishikawaetal. ( 2010 2009 2007 )CsAP1AP1Floralidentity Nishikawaetal. ( 2009 2007 ); Penaetal. ( 2001 ); Pillitterietal. ( 2004a b )CsLFYLFYFloralidentity Nishikawaetal. ( 2009 2007 ); Pillitterietal. ( 2004a b )CsTFL1TFL1Floralrepressor Nishikawaetal. ( 2009 2007 ); Pillitterietal. ( 2004a b )CsWUSWUSMeristemidentity TanandSwain ( 2007 )CsSL1SOC1Floralsignalintegrator TanandSwain ( 2007 )CsAp3AP3Floralhomeosis TanandSwain ( 2007 )CuSEP1SEP1Floralhomeosis Nishikawaetal. ( 2010 )CuSEP3SEP3Floralhomeosis Nishikawaetal. ( 2010 )CuFULFULFloralhomeosis Nishikawaetal. ( 2010 )PtFTFTFloralsignalintegrator Zhangetal. ( 2009b )PtTFLTFL1Floralrepressor Zhangetal. ( 2009b )PtFLCFLCFloralrepressor Zhangetal. ( 2009a )PtSVPSVPFloralrepressor Lietal. ( 2010 ) 30

PAGE 31

Figure1-1. Hypotheticalmodelforthetranscriptionalregulationoforalinductionincitrus.FloralinductivesignalsinitiatedbytheexposuretocoldandwaterdecitareintegratedbyCsFTandCsSL1.CsFTandCsSL1initiatetranscriptionofCsAP1andCsLFY.Up-regulationofCsAP1andCsLFYinitiatesoralorganogenesisatgrowthpromotingtemperaturesandnon-limitingwatersuppply.ThetypeofinorescenceformeddependsonthebalancebetweentheexpressionofCsTFL1(vegetativecharacter)andoralidentitygenes(oralcharacter).Arrowheadsinlinesindicatepromotionwhereasatendsindicateinhibition. 31

PAGE 32

CHAPTER2EXPRESSIONPATTERNSOFFLOWERINGGENESINSWEETORANGEINRESPONSETOFLORAL-INDUCTIVEWATERDEFICITSCoolambienttemperatures(<20C)andwaterdecitaretheonlyfactorsknowntoinduceoweringinsweetorange( Cassinetal. 1969 ; Moss 1969 ).Inrecentyears,severalgenesthathypotheticallyregulateoweringincitrusspecieshavebeenidentiedbasedontheirsimilaritytooweringrelatedgenesinthemodelplantArabidopsis( Nishikawaetal. 2007 ; Pillitterietal. 2004a b ; TanandSwain 2007 ).Althoughchangesintranscriptlevelsofthesegeneshavebeencharacterizedinresponsetooralinductivetemperatures( Nishikawaetal. 2009 2007 ; Pillitterietal. 2004a ),nothingisknownabouttheirpatternofexpressioninresponsetooral-inductivewaterdecits.Floral-inductivewaterdecitsaretheonlysourceoforalinductionofcitrustreesgrowinginregionswithtropicalclimates( Cassinetal. 1969 )andanimportantsourceoforalinductioninregionswithhumidsubtropicalclimateswheretheycancomplementoral-inductivecooltemperaturesduringtheFallandWinter( Albrigoetal. 2006b ; Chica 2007 ).Waterdecitisalsotheprimarysourceoforalinductionformanyotherspeciesgrowingintropicalandsubtropicalclimates( AlbrigoandGalen-Sauco 2004 ).InthisstudyIinvestigatedthetranscriptaccumulationofcitrusoweringgenesinresponsetowaterdecit.Ihypothesizedthatcitrus'FLOWERINGLOCUST(CsFT)andSUPRESSOROFOVEREXPRESSIONOFCONSTANS1(CsSL1)transcriptsaccumulateinresponsetooweringsignalsinitiatedbyoral-inductivewaterdecits.CsFTistheputativecitrusorthologofArabidopsis'sFLOWERINGLOCUST(FT)( Kobayashietal. 1999 ; Nishikawaetal. 2007 ).InArabidopsis,theproteinencodedbyFTisamobileoweringsignaloriginatinginleavesinresponsetooral-inductivephotoperiodsandtransportedtotheshootapicalmeristemwhereitup-regulatestheexpressionoforalidentitygenes( Abeetal. 2005 ; Corbesieretal. 2007 ; Samachetal. 2000 ).InCitrusunshiu,theexpressionpatternsoftheputativeFTortholog 32

PAGE 33

(CiFT)supportthehypothesisofthisgenebeinginvolvedintheregulationofoweringincitrus( Nishikawaetal. 2009 2007 ).Inaddition,constitutiveexpressionofCiFTincitrus'closerelativePoncirustrifoliataresultedinextremelyearlyoweringwhichprovidesmoresupportforaroleofcitrus'FTorthologsasregulatorsofoweringtime( Endoetal. 2005 ).CsSL1istheputativeorthologofArabidopsis'SUPPRESSOROFOVEREXPRESSIONOFCONSTANS1(SOC1)( TanandSwain 2007 ).InArabidopsis,SOC1isakeyintegratorofoweringsignalsinitiatedbymultiplestimuli( LeeandLee 2010 ).TheexpressionpatternsofCsSL1incitrusinresponsetooralinductivestimulihavenotbeendescribed.However,introducingCsSL1inArabidopsissoc1mutantsinducedearlyoweringcomparedtothewildtypeandthelate-oweringsoc1mutant( TanandSwain 2007 ),supportingaroleforCsSL1intheregulationofowering.Ialsoinvestigatedwhetherthepatternoforalidentitygenes(CsAP1andCsLFY)transcriptaccumulationintreesexposedtooral-inductivewaterdecitinductionwassimilartothepatternoftranscriptaccumulationoftheseintreesexposedtooral-inductivecooltemperatures.InArabidopsis,up-regulationofAP1andLFYexpressionpromotestheinitiationoforalorgans( MandelandYanofsky 1995 ; WeigelandNilsson 1995 ).OrthologsofAP1andLFYhadbeenisolatedinC.sinensis( Pillitterietal. 2004b )andoverexpressionofthesegenesinC.unshiuresultedinacceleratedowering,suggestingaroleoftheseingenesintheregulationofoweringincitrus.InC.sinensistreesexposedtooralinductionbylowtemperatures,transcriptaccumulationofCsAP1andCsLFYremainunchangedfrominitiallevelsuntiltheoral-inductivetreatmentwasoverandtreesweretransferredtogrowthpromotingconditionswhenlevelsofCsAP1andCsLFYtranscriptsincreased( Pillitterietal. 2004a ).IhypothesizedthatasimilarpatternofaccumulationofCsAP1andCsLFYtranscriptswouldbeinducedbyexposuretooral-inductivewaterdecit.ThiscurrentworkpresentsevidencethatsupportsaroleofCsFTasanuniversalintegratorofoweringsignalsincitrus.Inadditiontoup-regulationofCsFT,whichis 33

PAGE 34

assumedtopromoteowering,waterdecitalsoreducesthesensitivityofbudstootherenvironmentalsignalspromotingowerbuddifferentiation,whichinturncouldinduceastrongeroweringresponseiforalinductioniscontinued.Theseresultsrepresentoneoftheearliestreportscharacterizingtheeffectsofwater-decitontheexpressionofoweringgenes. 2.1MaterialsandMethods 2.1.1PlantMaterialFieldexperimentswereconductedusingmature`Valencia'sweetorangetreesgraftedon`Carrizo'citrangeinanorchardattheUniversityofFlorida'sCitrusResearchandEducationCenterinLakeAlfred,Florida(285'N,8143'W)during2009and2010.Theorchardreceivedsimilarhorticulturalcareasinneighboringcommercialgrovesthroughouttheexperiments.Experimentsundercontrolledenvironmentswereconductedusingeither2-3yearoldpotted`Valencia'treesgraftedon`Swingle'citrumeloor2-3yearoldpotted`WashingtonNavel'cuttings.Allthetreesusedforexperimentsweretestedfororalcompetenceandweremaintainedinashadedgreenhousewithnaturalphotoperiods,non-limitingirrigationandstandardfertilizationwhennotinuseforexperiments.Thegrowthroomsinwhichthecontrolledconditionsexperimentswereconductedwereilluminatedwithwithuorescentlights(800molesm-2s-1atcanopylevel)witha11/13h(day/night)photoperiod. 2.1.2ExperimentalConditionsTodeterminethepatternsofCsFT,CsSL1,CsAP1andCsLFYtranscriptaccumulationduringoral-inductivewaterdecits,transcriptlevelsofthesegenesweremeasuredinpottedtreeskeptunderwaterdecitfor60daysinagrowthroomat23C.Waterdecitwasimposedbywithholdingirrigationuntilthedesiredlevelsofwaterdecitwasreached;then,thedesiredlevelofwaterdecitwasmaintainedbyirrigatingthetreesdailywithavolumeofwaterthatmatchedthedailyweightlossofthetree.Thewaterstatusofthetreeswasestimatedandmonitoredusingthemiddaystem 34

PAGE 35

waterpotential(SWP)measuredbythepressurechambermethod( McCutchanandShackel 1992 ; Scholanderetal. 1965 ).MiddaySWPintreesunderwaterdecitwas-2.00.12MPawhereasmiddaySWPinwellirrigated(control)treeswas-1.10.1MPa.Thedesiredlevelofwaterdecit(-2.0MPa)wasreachedbetweenday15and20sincethebeginningoftheexperiment.Ontheday60oftheexperiments,waterdecitwasinterruptedbyirrigatingthetreesuntilsoilsaturationtopromotegrowth;irrigationthecontinuedasinthewellirrigatedcontroltrees.Wellirrigatedcontrolswereirrigateduntilsoilsaturationevery3daysthroughouttheexperiment.Sampleswerecollectedevery10-12daysfromday0untilday74.Thisexperimentwasconductedusingacompletelyrandomizeddesignwith4treereplicates.Differencesintranscriptaccumulationoftheselectedgenesbetweenwellirrigatedandwaterdecittreeswereanalyzedusingarepeatedmeasurementsmodel.DifferencesinaccumulationofCsSL1,CsAP1andCsLFYtranscriptsafterre-irrigation(day63and74)betweentreesthathadreceivednormalirrigationorwaterdecitwereanalyzedusingt-test.Newgrowthcompositionwascharacterizedinalltheshoots(6-7nodeslong)formedduringthepreviousyearpresentonthetrees.Differencesinthecompositionofthenewgrowthbetweenwellirrigatedandwaterdecittreeswereanalyzedusingt-test.TodeterminethepatternsofCsFT,CsSL1,CsAP1andCsLFYtranscriptaccumulationduringoral-inductivewaterdecitatoral-inductivetemperatures,transcriptlevelsofthesegenesweremeasuredinpottedtreeskeptunderwaterdecitfor40daysinagrowthroomat12C.Thetreeshadbeenkeptinagrowthroomat23Cforabout1monthbeforetransfertotheroomat12C.Waterdecitwasimposedandmonitoredasdescribedbeforestarting77daysbeforethetransfertotheroomat12C.Wellirrigatedcontroltreesreceivedirrigationalsoasindicatedbefore.Ondaythe40afterthetransfertotheroomat12C,thetreesweretransferredbacktotheroomat23Candthewaterdecitwasinterruptedasdescribedbefore.Sampleswerecollectedevery9-10daysfromday0untilday39and3daysaftertheendofthewater 35

PAGE 36

decit/lowtemperaturetreatment.Thisexperimentwasconductedusingacompletelyrandomizeddesignwith4treereplicates.Differencesintranscriptaccumulationoftheselectedgenesbetweenwellirrigatedandwaterdecittreeswereanalyzedusingarepeatedmeasurementsmodel.DifferencesinaccumulationofCsSL1,CsAP1andCsLFYtranscriptsafterre-irrigationandtransferto23C(day43)betweentreesthathadreceivednormalirrigationorwaterdecitwereanalyzedusingt-test.Newgrowthcompositionwascharacterizedinalltheshoots(6-7nodeslong)formedduringthepreviousyearpresentonthetrees.Differencesinthecompositionofthenewgrowthbetweenwellirrigatedandwaterdecittreeswereanalyzedusingt-test.TodeterminethepatternsofCsFT,CsSL1,CsAP1andCsLFYtranscriptaccumulationinmaturetreesexposedtooralinductiveconditionsintheeld,transcriptlevelsofthesegenesweremeasuredinmaturetreesgrowingintheeldunderwaterdecitandnormalirrigationduringthefall/winterof2009-2010andthesummerof2010.Waterdecitwasinducedbycompletelywithholdingirrigationforthedurationoftheexperimentandcoveringthegroundbeneaththecanopyofthetreeswithasheetofwater-proofmaterial(Tyvek,DuPont).Thewaterstatusofthetreeswasestimatedandmonitoredasindicatedbefore.Inthefall/winterexperiment,treeswereexposedtothewaterdecittreatmentandnaturallyoccurringoral-inductivetemperaturesfrommid-Novemberuntillate-January.Inthesummerexperiment,treeswereexposedtowaterdecitfromJunetoAugust.Inbothexperiments,anothersetoftreesreceivedirrigationasinneighboringcommercialgroves.Attheendofbothexperiments,thesheetsofwater-proofmaterialwereremovedandthetreeswereirrigatedovernightfor3days;then,irrigationcontinuedasincontroltrees.Sampleswerecollectedevery7-10daysforthedurationoftheexperiments.Thisexperimentwasconductedusingacompletelyrandomizeddesignwith4treereplicates.Differencesintranscriptaccumulationoftheselectedgenesbetweenwellirrigatedandwaterdecittreeswereanalyzedusingarepeatedmeasurementsmodel.Differencesinaccumulationof 36

PAGE 37

transcriptsoftheselectedgenesatspecicsamplingtimesofinterestbetweentreesthathadreceivednormalirrigationorwaterdecitwereanalyzedusingt-test.Newgrowthcompositionwascharacterizedin25shoots(6-7nodeslong)selectedbeforethebeginingoftheexperimentthatwereformedduringthepreviousyear.Theshootsselectedfornewgrowthcharacterizationweredistributedevenlybetweenbothsidesofthehedgerow.Differencesinthecompositionofthenewgrowthbetweenwellirrigatedandwaterdecittreeswereanalyzedusingt-test.Inalltheexperiments,accumulationofCsFTtranscriptswasquantiedinleavessampleswhereasaccumulationofCsSL1,CsAP1andCsLFYtranscriptswasquantiedinbudsamples.Thechoiceoftissuesinwhichtranscriptsoftheselectedgeneswerequantiedwasmadebasedonthemostlikelyspatialdomainofgeneexpressionandproteinactivitypredictedbythehypotheticalmodelinsection 1.4 .Leafandbudssamplesconsistedofapoolofatleast6leavesorbudsfromseparateshootsoneachtreereplicate.Allsampleswerecollectedat15H00localstandardtime. 2.1.3qRT-PCRTotalRNAwasextractedusingaphenol-chloroformprecipitationmethodandpuriedusingsilicamembraneswithon-columnDNasedigestion(Qiagen).LeafsampleswereusedforanalysisofCsFTexpression,whereasbudsampleswhereusedforanalysisofCsSL1,CsAP1andCsLFYexpression.FivehundrednanogramsoftotalRNAwereusedforcDNAsynthesisina20lreactionwitholigodTprimers(SuperScriptIII,Invitrogen).OnemicroliterofthesynthesizedcDNAwasusedfortwo-step(95Cdenaturationand60Cfor1minuteannealingandextension)qPCRina20lreaction(SYBRPremixExTaqII,Takara)onaAppliedBiosystems7500FASTreal-timePCRsystem(LifeTechnologies)usingoptimizedqPCRassays(seeAppendix).PrimersforqPCRwere:5'-CGGCGGAAGGACTATGAC-3'and5'-TGTGAGAAAGCCAGAGAGGAA-3'(CsFT),5'-CAGCCAGAGAATCTAACAAACG-3'and5'-TCAGTTTTGTGGTGGTATTGCC-3'(CsSL1),5'-CCCTGGAGTGCAACAACCT-3' 37

PAGE 38

and5'-CTGATGTGTTTGAGAGCGGT-3'(CsAP1),and5'-TCTTGATCCAGGTCC-AGAACATC-3'and5'-TAGTCACCTTGGTTGGGCATT-3'(CsLFY).CsGAPDHwasusedasreferencegene(5'-GGAAGGTCAAGATCGCAATCAA-3'and5'-CGTCCCT-CTGCAAGATGACTCT-3').AllqPCRassayswerevalidatedforspecicamplicationandoptimizedforamplicationefcienciesbetween1.88and2.05withalineardynamicrangeof6log10cycles.ThesequenceoftheprimerstoamplifyCsLFYwasobtainedfrom Nishikawaetal. ( 2009 )whereasallotherprimersequencesweredesignedin-house.RelativegeneexpressionwascalculatedasafoldchangeratiousingPfaf'smethod( Pfaf 2001 )withsliding-windowefcienciescalculatedforeachreactionusingthesliwinfunctionintheqpcRRpackage( RitzandSpiess 2008 ). 2.1.4DataAnalysisMeanfoldchangeoftranscriptlevelsweretransformedtoalogarithmicscale(log2)forstatisticalanalysisbutdatainthegraphsrepresentstheuntransformeddata.Unlessnotedotherwise,alldifferencesreportedarestatisticallysignicant(p<0.05).AllstatisticalanalyseswereexecutedinR( RDevelopmentCoreTeam 2011 ). 2.2ResultsandDiscussion 2.2.1Floral-inductiveWaterDecitUp-regulatesCsFTbutnotCsSL1.TotestthehypothesisthattheoralsignalintegratorfunctionofCsFTandCsSL1isconservedincitrusandArabidopsis,Isubjectedagroupoftreestoamoderatewaterdecitfor60daysat23CandsampledleavesandbudseverytendaystomeasuretheexpressionofCsFTandCsSL1.IfeitherCsFTorCsSL1wereintegratorsofsignalsgeneratedbywaterdecit,theirexpressionwouldchangewhilethetreesremainunderwaterdecit.IassumedthatCsFTandCsSL1areactivecomponentsofthegeneticmechanismregulatingoweringincitrusbasedonArabidopsismutantcomplementationstudiesandexperimentswiththecitruscloserelativeP.trifoliataoverexpressingCiFT(equivalenttoCsFT)( Endoetal. 2005 ; TanandSwain 2007 ). 38

PAGE 39

Figure 2-1 showsthatprolongedexposuretowaterdecitup-regulatestheexpressionofCsFTbuthasnoeffectonthelevelofexpressionofCsSL1.Afterre-irrigatingthoroughlyattheendoftheexperiment,treesunderwaterdecitproducedaushofnewgrowthconsistingmostlyofinorescencesofdifferentleaftoowerratioasopposedtoalmostnogrowthinitiatedinwell-irrigatedcontroltrees(Table 2-1 ).ThisresultisconsistentwithCsFTactingasanintegratorofoweringsignalsinitiatedbywaterdecit.Furthermore,thisresultisconsistentwiththehypothesisthatCsFTisanuniversalintegratorofoweringsignalsinC.sinensissincewaterdecitandlowtemperaturesaretheonlystimuliknowntobeoralinductiveinC.sinensisandup-regulationofcitrusFTorthologshasbeenreportedinresponsetolowtemperatureselsewhere( Nishikawaetal. 2007 ).However,thelackofaneffectofwaterdecitonthelevelsofexpressionofCsSL1indicatesthatCsSL1isnotacentralintegratorofoweringsignalsasopposedtoitsArabidopsis'orthologSOC1( LeeandLee 2010 ).InArabidopsis,theproteinofFTisamobileoweringsignalgeneratedinleavesinresponsetooral-inductivephotoperiodsandtransportedthroughthephloemtotheshootapicalmeristem( Corbesieretal. 2007 ).IntheshootapicalmeristemFTcomplexeswithFD,abZIPtranscriptionfactorexpressedinthemeristem( Abeetal. 2005 )andactivatesthetranscriptionofSOC1andtheoralidentitygenesLEAFY(LFY)andAPETALA1(AP1)( Abeetal. 2005 ; Wiggeetal. 2005 ; Yooetal. 2005 ).SOC1isdirectlyregulatedbytheproductofFT( Moonetal. 2005 ; Yooetal. 2005 )andhighlevelsofFTmRNAarequicklyfollowedbyhighlevelsofSOC1mRNA( Yooetal. 2005 ).Inmyexperiments,increasedtranscriptlevelsofCsFTdidnotcorrespondtoincreasedlevelsofCsSL1duringoralinduction;CsSL1expressiononlyincreasedslightlyafterthetreeswerere-irrigated;atthistime,expressionofCsFTdecreasedtocontrollevels.Thus,itispossiblethatinC.sinensis,contrarytowhatoccursinArabidopsis,CsSL1isnotatargetfortheproductofCsFTorthatanothersignalgeneratedbywaterdecitinhibitstheexpressionofCsSL1downstreamofCsFT. 39

PAGE 40

2.2.2CsFTTranscriptAccumulationalsoIncreasesinTreesunderWaterDecitatFloral-inductiveTemperaturesSincebothwaterdecitandoral-inductivetemperaturesincreasetheexpressionofCsFT(thisworkand Nishikawaetal. ( 2007 )),CsFTcanbeauniversalintegratorofowering-promotingsignalscandidateinC.sinensis.Ithasbeenreportedthatwhenoral-inductivetemperaturesandwaterdecitareappliedsimultaneously,moreinorescencesareformedthanwheneitherstimulusoccursseparately( Chica 2007 ).ThisexperimenttestedthehypothesisthattheincreaseininorescencenumbersproducedbythesimultaneousexposureofC.sinensistreestooral-inductivetemperaturesandwaterdecitisrelatedtoasimilarincreaseintheexpressionofCsFT.ThepatternofexpressionofCsFTunderwaterdecitatoral-inductivetemperatures(15C)wascomparedtothatoftreesreceivingnormalirrigationalsoatoral-inductivetemperatureof15C.Figure 2-2 showsthattheexpressionofCsFTintreesunderwaterdecitatoral-inductivetemperatureswasmarkedlyhigherthanthatinwell-irrigatedtreesatthesametemperature,supportingthehypothesisofCsFTbeinganuniversalintegratorofoweringsignalsandafactordeterminingtheincreaseininorescencenumberreportedinmypreviouswork( Chica 2007 )andreplicatedinthisproject(Table 2-2 ).TheincreaseinthelevelofexpressionofCsFT(relativetoinitiallevels)washigherthantheincreaseobtainedbyoral-inductivetemperatureandwaterdecittreatmentsseparately(Figures 2-1 and 2-2 ).Unfortunately,whethertheeffectsofplantwaterstatusandtemperatureareadditiveorinteractwasnotinvestigatedduetotimeconstraintsandtechnicaldifcultiesrelatedtoapplyinganddeninglevelsofwaterstress,particularlywhenholdingplantsatdifferenttemperatures.AccumulationofCsSL1transcriptsintreesunderwaterdecitremainatorbelowinitiallevelsandincreasedonlyafterthetreeswerere-irrigatedandtransferredtotheroomatgrowthpromotingtemperatures 40

PAGE 41

(23C).However,accumulationofCsSL1transcriptsincreasedinwellirrigatedtreesat12C.TheseresultssupportthehypothesisthatCsFTcanbeauniversalintegratorofoweringsignalsinC.sinensis. Chica ( 2007 ); Moss ( 1969 ); SouthwickandDavenport ( 1986 )haveshownthatthelevelofinductionofcitrustrees(asindicatedbythenumberofinorescencesinitiatedwhengrowthisresumed)isproportionaltothedurationoforal-inductivetreatments.ThelevelofexpressionofCsFTisalsoproportionaltothedurationoftheoralinductivetreatmentsinFigures 2-1 and 2-2 .Thus,expressionofCsFTcouldbeanindicatorofthelevelofinductionofthebudsasitiscapableofintegratingsignalsfrombothoralinductivestimuli,assumingthatthelevelsofexpressionofCsFTcorrespondtolevelsofitsprotein.Also,levelsCsSL1transcriptsat12Cincreasedonlyinwellirrigatedtreeswhereastheyremainedatinitiallevelsintreesunderwaterdecit;therefore,itispossiblethatwaterdecithadnegativelyregulatedtheexpressionofCsSL1at12C.Then,theseresultsindicatethattheresponseofCsSL1towaterdecitwouldbeoppositetotheresponseofitsArabidopsisortholog(SOC1)tooralpromotingstimuli. 2.2.3WaterDecitReducetheTranscriptAccumulationofFloralIdentityGenesinBudsduringFloralInductionInArabidopsis,up-regulationoftheoralidentitygenesAP1andLFYintheshootapicalmeristemareearlyindicatorsoforalinitiation( MandelandYanofsky 1995 ; WeigelandNilsson 1995 )andfollowtheup-regulationofFTunderoral-inductivelongdays( Wiggeetal. 2005 ).Usingsamplesfromtheexperimentsdiscussedintheprevioustwosubsections,thechangesinexpressionofCsAP1andCsLFYduringwaterdecittreatmentsweretested.Basedonreportsinwhichover-expressionofAP1orLFYresultedinacceleratedowering( Penaetal. 2001 )andcomplementationofArabidopsisnullmutantphenotypesbyCsAP1andCsLFY( Pillitterietal. 2004b ).ThisexperimenttestswhetheraccumulationofCsAP1andCsLFYtranscriptsduring 41

PAGE 42

andafteroralinductionbywaterdecitissimilartotheaccumulationofthesegenes'transcriptsduringandafteroralinductionbylowtemperatures.Figures 2-3 and 2-4 showthatwaterdecittreatmentsconsistentlyreducedtheexpressionofCsAP1andCsLFYinthetwoexperiments.ExpressionofCsAP1andCsLFYintreesunderwaterdecitwasbetweenone-halftothree-quarterstheexpressionincontroltrees. Pillitterietal. ( 2004a )reportedthatexpressionofCsAP1andCsLFYduringtreatmentswithoral-inductivetemperaturesremainedunchangedwhentreeswereexposedtooral-inductivetemperaturesandtransientlyincreasedwhenthetreesweretransferredtogrowthpromotingtemperatures.AsimilarresponsewasobservedintheresultsinFigures 2-3 and 2-4 whereexpressionofCsAP1andCsLFYincreasedtransientlyafterre-irrigationand/ortransfertogrowthpromotingtemperatures.InArabidopsis,up-regulationofCsFTisfollowedbyup-regulationoforal-identitygenesintheshootmeristem( Wiggeetal. 2005 )andthedevelopmentoftheinorescence.Figures 2-1 2-2 2-3 and 2-4 showthatinC.sinensis,up-regulationofCsFTisnotfollowedbytheup-regulationofCsAP1orCsLFY,butinstead,up-regulationofCsAP1orCsLFYoccursonlyaftertheoralinductivestimulidisappearandgrowthpromotingconditionsoccur. Albrigoetal. ( 2006a 2002 )reportedthatperiodsofwarmtemperaturesduringthewinterinFloridaweregoodpredictorsofsubsequentbuddifferentiationinC.sinensistreesundereldconditions.ArapidreductioninCsFTlevelsaftertheinterruptionoforal-inductivetreatments(Figures 2-1 and 2-2 )wasconsistentwiththehypothesisthatbuddifferentiationoccursonlywhenoralinductionisinterruptedandgrowthpromotingconditionsoccur,asopposedtowhatoccursinArabidopsis,whereincreasedFTisfollowedbyoralbuddifferentiationevenwhentheoralinductivestimuliisstillpresent. 42

PAGE 43

2.2.4OtherFactorsModifytheResponseofFloweringGenestoFloral-inductiveTreatmentsinFieldTreesTheresponseofCsFTinexperimentswithpottedtreesandcontrolledconditionspresentedinFigures 2-1 and 2-2 wasnotalwaysconsistentwiththeresponseobservedinexperimentsinwhicheldgrowntreeswereused(Figures 2-5 and 2-6 ).Inthersteldexperiment(Figures 2-5 ),15year-old`Valencia'treesintheeldweresubjectedtowaterdecitduringtheWinterof2009-2010for75daysbywithholdingirrigationandusingrain-excludingmaterialunderthecanopyofthetrees.ThisexperimentwasdesignedtobesimilartotheexperimentreportedinFigure 2-2 .Inthesecondexperiment(Figure 2-6 )anothersetoftreesfromthesamegrovewassubjectedtowaterdecitasbeforefor60daysduringtheSummerof2010.ThisexperimentwasdesignedtobesimilartotheexperimentinFigure 2-1 .Inbothcases,theexpressionofCsFTincreasedduringthecourseoftheexperiment,butthemagnitudeoftheincrease(foldchange)wasnotashighastheoneobservedundercontrolledconditions.Furthermore,inthewinterexperiment,theexpressionofCsFTintreesunderwaterdecitwasnotdifferentthantheexpressionofCsFTinthewell-irrigatedcontroltrees,suggestingthatthechangesinexpressionofCsFTwasduetonaturallyoccurringoral-inductivetemperaturesratherthantothewaterdecittreatment.Nonetheless,treesunderwaterdecitduringthewinterproducedmoreinorescencesthanthewell-irrigatedcontrols(Figure 2-3 ),indicatingthattheeffectofwaterdecitinoralinductionwasstillconservedeventhoughnodifferencesweredetectedinCsFTtranscriptlevels.ExpressionofCsFTintreesunderwaterdecitduringthesummer(Figure 2-6 ),however,washighearlyintheexperimentandthendeclinedbutremainedhigherthanthewell-irrigatedcontrols.Afterirrigationwasresumed,thetreesintheSummerexperimentproducedonlyaminimalushcomposedofmainlyvegetativeshootsandafewinorescences(datanotshown). 43

PAGE 44

TheexpressionofCsFTintheWinterexperiment(Figure 2-5 ),showstwoperiods(early-Novembertoearly-Decemberandmid-Decembertomid-January)inwhichCsFTshowedanincreasingtrend.Intheseperiods,expressionofCsSL1increasedsimultaneouslywiththeexpressionofCsFTinthewell-irrigatedcontrolsbutremainedunchangedinthetreesunderwaterdecit.ThelackofresponseofCsSL1expressionintreesunderwaterdecitduringthetreatmentisconsistentwiththeresultsoftheexperimentsusingcontrolledconditionsandpottedtrees(Figures 2-1 2-2 ).ThelevelofexpressionofCsAP1andCsLFYintreesunderwaterdecitduringtheWinterwaslowerintreesunderwaterdecitthaninthecontrol,howevernostatisticallysignicantdifferencesweredetectedexceptforCsLFYintheSummerexperiment.ReducedexpressionofCsSL1,CsAP1andCsLFYintreesunderwaterdecitrelativetowell-irrigatedcontrolswasalsoobservedwhenwaterdecitwasappliedintheSummer.Expressionofthesegeneswasjustslightlyincreasedafterthetreeswerere-irrigated.Interestingly,amarkedpeakintheexpressionofCsAP1andCsLFYinwell-irrigatedtreesduringthewinterwasregisteredatasamplingdatethatcoincidedwiththeendofa4-daywarmspellwithaveragedaytemperatureshigherthan21C(Dec.162009).CsAP1showedanotherpeakonJanuary13(2010)whichcoincidedwithawarmingtrendafter4daysofsub-freezingtemperatures.Noneofthesepeaksweredetectedinsamplesfromtreesthatremainedunderwaterdecit. Nebaueretal. ( 2006 )reportedthatthecompetenceofbudsof3citrusspeciestorespondtooralinductivestimulichangesthroughtheseasons,andthatsensitivitytooralinductivetreatmentsislowestduringtheSummer.LowersensitivitytooralinductioncouldexplainthefailuretoinduceoweringbyexposingeldgrowntreestowaterdecitduringtheSummer.InthecaseoftheSummerexperiment,itisevidentthatsignalsinitiatedbywaterdecitproduceanup-regulationofCsFT.However,sincetheupregulationofCsFTtendedtodecreaseafterwards,eventhoughthetreesremainunderwaterdecit,itispossiblethatCsFTisatargetforotherphysiologicalprocesses. 44

PAGE 45

Ontheotherhand,eventhoughlevelsofCsFTwerereducedlaterintheexperiment,theseremainedalwayshigherthanthelevelsofwell-irrigatedtreesandstilloweringwasnotsuccessfullyinduced.IfbudsduringtheSummerarelesscompetenttorespondtooralinductivetreatments,expressionofCsAP1andCsLFYcouldbeindicatorsofsuchastatus.TheexpressionofCsAP1andCsLFYdidincreaseslightlyafterre-irrigationbutnottothelevelsobservedundercontrolledconditions(Figures 2-3 and 2-4 vs.Figures 2-5 and 2-6 ).Thus,itispossiblethatthesensitivityofthebudstooralinductivesignalscouldberegulatedbyotherfactorsinthebuds.IntheWinterexperiment,levelsofCsFTexpressionwerenotashighasthoseobservedatthebeginningoftheSummerexperimentbutwereconsistentwiththeproposedenvironmentalregulationofCsFT.ResultsfromtheWinterexperimentalsosupportthehypothesisthatowerbuddifferentiationoccursafterandnotduringoralinductioninresponsetogrowthpromotingconditions.Whenwaterdecitisappliedduringthewinter,theexpressionoftheoralidentitygenesCsAP1andCsLFYremainsconstantanddoesnotresponduntilgrowthpromotingtemperaturesoccurduringwarmperiods.SincelevelsofCsFTinwellirrigatedtreesandtreesunderwaterdecitwerealmostequivalent,itispossiblethattheincreasednumberofinorescencesformed(Figure 2-3 )couldhavebeencausedbywaterdecitkeepingthebudsdormantduringwarmperiods.C.sinensistreesoftenproducemorethanonecohortofinorescencesundernaturalconditionsinFlorida( Simanton 1969 ),usuallythesecohortsareinitiatedduringdiscretewarmperiodswhicharecommonofFlorida'smildwinters( Albrigoetal. 2006a 2002 )butgrowthisnotapparentuntilthebudsinitiategrowthinthespring.Onceinitiated,however,budswilldevelopshootsorinorescencesdependingontheaccumulationofinductivehoursatthetimeofthewarmperiod.Ifwaterdecitkeepsbudsfrominitiatingdifferentiation,inductionhourscouldcontinuetoaccumulateandcouldresultinmoreinorescencesbeingformedthanifwaterdecitisrelieved. 45

PAGE 46

TheseresultsshowthatCsFTisanintegratorofsignalsinitiatedbywaterdecitandloworal-inductivetemperaturesincitrus.Thiscouldbeoneoftheearliestreportsoftheregulationofowering-relatedgenesinresponsetowaterdecit.ItisinterestingthatCsFTcouldplayamajorroleintheregulationofoweringinC.sinen-sissinceoweringinC.sinensisisreportedlyinsensitivetochangesinphotoperiod( Cassinetal. 1969 ; Moss 1969 )whichisthemostinvestigatedpathwayregulatingFTexpressioninArabidopsis( Turcketal. 2008 ).Inaddition,thecomplexityofthepromoterregionofFT( Adrianetal. 2010 )supportsthehypothesisthattheregulationofFTcouldinvolveinputsfromprocessesotherthanphotoperiodandvernalization( ImaizumiandKay 2006 ).InC.sinensis,CsFTcouldhaveevolvedtoberesponsivetoenvironmentalstimulinaturallyoccurringinsubtropicalclimateswherecitruscouldhaveoriginated( GmitterandHu 1990 ).MyresultsalsoshowthatCsSL1,whoseArabidopsisorthologSOC1isakeyintegratorofoweringsignalsinitiatedbymultiplestimuliinArabidopsis,isresponsivetolowtemperaturebutnottowaterdecit.TheexpressionofCsSL1ispossiblynotonlynotaffectedbywaterdecitbutcouldactuallyberepressedsinceexpressionofCsSL1atoral-inductivetemperaturesincreasesinwell-irrigatedcontrolsbutremainsunchangedintreesunderwaterdecit.WaterdecitcouldalsorepresstheexpressionofothergenesinvolvedtheregulationofoweringinC.sinensismeristemssincetheexpressionofCsAP1andCsLFYwerealsoreducedintreesunderwaterdecit.LowlevelsofCsAP1andCsLFYwhileoral-inductivestimuliarepresent,andtransientup-regulationofthesegeneswhengrowth-promotingconditionsarere-established,indicatethatoraldifferentiationinC.sinensismaynotoccursimultaneouslytooralinductionasitdoesinArabidopsis( Wiggeetal. 2005 ).InadditiontoregulationofCsFT,anotherowering-promotingroleofwaterdecitcouldbetomaintainbudsfrominitiatingoraldifferentiation,ashappensduringwarmperiodsintheWinterhumidsubtropicalclimates.Inthiswork,theresponseofeldtreestooral-inductivetreatmentswasnotalwaysconsistentwithresultsobtained 46

PAGE 47

usingpottedtreesandcontrolledconditions.Otherfactors,suchasplantgrowthregulators,carbohydratebalanceandproductsofnitrogenmetabolismhavebeenshowntomodulatetheoweringresponseofcitrustrees( Albrigo 1999 ; AliandLovatt 1994 ; CooperandPeynado 1958 ; Moss 1971 )andarelikelytobeinvolvedintheregulationofowering-relatedgenes.Inaddition,itisalsolikelythatkeystepsoftheregulationofoweringincitrusmightnotberegulatedatthemRNAlevelbutattheproteinormetabolitelevelasithasbeenshowninsomecasesinArabidopsis( BlazquezandWeigel 1999 ; Corbesieretal. 2007 ).However,sincethetransitiontooweringinvolvesamajormodicationofthetree'sdevelopmentalpattern,characterizingchangesatthetranscriptlevelcouldprovideinsightsabouttheearliestprocessesbeingactivatedorrepressedduringthetransitionfromvegetativetoreproductivegrowth. 47

PAGE 48

Figure2-1. ExpressionofCsFTandCsSL1in2yearold`Navel'treesexposedtooral-inductivewaterdecit.Waterdecittreesstoppedreceivingirrigationonday0;then,whenthemiddaystemwaterpotentialreachedabout-2MPa(day15to20),thetreesstartedtoreceivedailyirrigationtomatchthedailyweightlossofthetree.Onday60(greyline),waterdecitwasinterruptedbyirrigatingthesoiltosaturation.Wellirrigatedtreeswereirrigatedtosaturationevery3daysthroughouttheexperiment.Figuresaremeansof4tree-replicatesS.E.GeneexpressionisrelativetothelevelsofeachgeneinWellirrigatedtreesonday0.Treewaterstatuswasmonitoredbymeasuringstemwaterpotentialandstomatalconductance. 48

PAGE 49

Table2-1. Floweringcharacteristicsof`WashingtonNavel'citrustreesexposedtowaterdecit.LaandLdreferrespectivelytoleafabundantandleafdecientinorescencesbasedontheirleaf/owerratios(La1,Ld<1).Singlereferstosingleowerswithoutleaves.FiguresaremeanspershootS.E.Theaveragenumberofnodespershootwas6.77.31 NewgrowthInorescencesLaLdLeaessSingleVegetativeFlowers Irrigated0.2.090.2.090.11.070.04.040.02.020.04.0300.39.19Waterdecit3.16.462.04.511.68.480.04.040.16.090.16.071.12.233.24.86 49

PAGE 50

Figure2-2. ExpressionofCsFTandCsSL1in2yearold`Navel'treesexposedtooral-inductivewaterdecitatoral-inductivetemperatures(15C).Waterdecittreesstoppedreceivingirrigationonday-7andkeptinachamberat23Cuntilday0.Onday0thetreesweretransferredtochamberat15CalongwithasetofWellirrigatedcontroltreesfor40days(lightgreyarea).Waterdecittreesdidnotreceiveirrigationuntilthemiddaystemwaterpotentialreachedabout-2MPa(day15to20),afterthispointWaterdecittreeswereirrigateddailytomatchthedailyweightlossofthetree.Onday40(darkgreyline),waterdecitwasinterruptedbyirrigatingthesoiltosaturationandbothgroupsoftreesweretransferredtothe23Cchambertopromotegrowth.Wellirrigatedtreeswereirrigatedtosaturationevery3daysthroughouttheexperiment.Figuresaremeansof3tree-replicatesS.E.GeneexpressionisrelativetothelevelsofeachgeneinWellirrigatedtreesonday-7.Treewaterstatuswasmonitoredbymeasuringstemwaterpotentialandstomatalconductance. 50

PAGE 51

Table2-2. Floweringcharacteristicsof`WashingtonNavel'citrustreesexposedtowaterdecitatoralinductivetemperatures(15C).LaandLdreferrespectivelytoleafabundantandleafdecientinorescencesbasedontheirleaf/owerratios(La1,Ld<1).Singlereferstosingleowerswithoutleaves.FiguresaremeanspershootS.E.Theaveragenumberofnodespershootwas6.16.27 NewGrowthInorescencesLaLdLeaessSingleVegetativeFlowers Irrigated2.21.071.47.081.08.050.07.030.25.030.07.040.55.113.35.12Waterdecit3.64.162.73.452.25.360.05.070.21.090.21.060.91.314.24.73 51

PAGE 52

Figure2-3. ExpressionofCsAP1andCsLFYin2yearold`Navel'treesexposedtooral-inductivewaterdecit.Waterdecittreesstoppedreceivingirrigationonday0;then,whenthemiddaystemwaterpotentialreachedabout-2MPa(day15to20),thetreesstartedtoreceivedailyirrigationtomatchthedailyweightlossofthetree.Onday60(greyline),waterdecitwasinterruptedbyirrigatingthesoiltosaturation.Wellirrigatedtreeswereirrigatedtosaturationevery3daysthroughouttheexperiment.Figuresaremeansof4tree-replicatesS.E.GeneexpressionisrelativetothelevelsofeachgeneinWellirrigatedtreesonday0.Treewaterstatuswasmonitoredbymeasuringstemwaterpotentialandstomatalconductance. 52

PAGE 53

Figure2-4. ExpressionofCsAP1andCsLFYin2yearold`Navel'treesexposedtooralinductivewaterdecitatoral-inductivetemperatures(15C).Waterdecittreesstoppedreceivingirrigationonday-7andkeptinachamberat23Cuntilday0.Onday0thetreesweretransferredtochamberat15CalongwithasetofWellirrigatedcontroltreesfor40days(lightgreyarea).Waterdecittreesdidnotreceiveirrigationuntilthemiddaystemwaterpotentialreachedabout-2MPa(day15to20),afterthispointWaterdecittreeswereirrigateddailytomatchthedailyweightlossofthetree.Onday40(darkgreyline),waterdecitwasinterruptedbyirrigatingthesoiltosaturationandbothgroupsoftreesweretransferredtothe23Cchambertopromotegrowth.Wellirrigatedtreeswereirrigatedtosaturationevery3daysthroughouttheexperiment.Figuresaremeansof3tree-replicatesS.E.GeneexpressionisrelativetothelevelsofeachgeneinWellirrigatedtreesonday-7.Treewaterstatuswasmonitoredbymeasuringstemwaterpotentialandstomatalconductance. 53

PAGE 54

Figure2-5. ExpressionofCsFT,CsSL1,CsAP1andCsLFYin15year-oldeld-grown`Valencia'treesunderwaterdecitduringWinter.WaterdecittreesreceivednoirrigationfromNovember15toJanuary28andhadthesoilundertheircanopycoveredbyasheetofimpermeablematerialforthesametime-period.Wellirrigatedtreesreceivedirrigationasneighboringcommercialgrovesthroughouttheexperiment.OnJanuary28,theimpermeablesheetswereremovedandWaterdecittreeswereirrigatedovernightfor3consecutivedays.Figuresaremeansof4tree-replicatesS.E.GeneexpressionisrelativetothelevelsofeachgeneinWellirrigatedtreesonNovember1st. 54

PAGE 55

Figure2-6. ExpressionofCsFT,CsSL1,CsAP1andCsLFYin15year-oldeld-grown`Valencia'treesunderwaterdecitduringSummer.WaterdecittreesreceivednoirrigationfromMay24toJuly23andhadthesoilundertheircanopycoveredbyasheetofimpermeablematerialforthesametime-period.Wellirrigatedtreesreceivedirrigationasneighboringcommercialgrovesthroughouttheexperiment.After60days(greyline),theimpermeablesheetswereremovedandWaterdecittreeswereirrigatedovernightfor3consecutivedays.Figuresaremeansof4tree-replicatesS.E.GeneexpressionisrelativetothelevelsofeachgeneinWellirrigatedtreesonday0. 55

PAGE 56

Table2-3. Floweringcharacteristicsofeldgrown`Valencia'treesexposedtowaterdecitduringWinter.LaandLdreferrespectivelytoleafabundantandleafdecientinorescencesbasedontheirleaf/owerratios(La1,Ld<1).Singlereferstosingleowerswithoutleaves.Figuresaremeanspershootof4tree-replicatesS.E.Theaveragenumberofnodespershootwas6.19.17 NewGrowthInorescencesLaLdLeaessSingleVegetativeFlowers Irrigation2.60.272.150.390.330.070.460.140.770.130.250.080.410.167.061.22Waterdecit3.740.253.460.280.790.060.820.181.130.10.330.080.280.0612.421.25 56

PAGE 57

CHAPTER3RELATIONSHIPBETWEENEXPRESSIONPATTERNSOFFLOWERINGGENES,FLOWERINGINTENSITYGRADIENTSANDFLOWERINGCOHORTSINSWEETORANGESHOOTSTheSpringushofsweetorangetreesgrowinginsubtropicalclimatesiscomposedofamixtureofinorescences,owersandvegetativeshootsformedinabasipetalgradientinoneyear-oldterminalshoots( Sauer 1954 ; ValienteandAlbrigo 2004 )(Figure 3-1A and 3-1B ).Inhumidsubtropicalclimates,theSpringushofsweetorangetreesisoftenmadeupofdiscretecohortsofnewgrowth(inorescencesorvegetativeshoots)initiatedatdifferenttimesinthesameterminalshootsduringtheprecedingWinter( ValienteandAlbrigo 2003 )(Figure 3-1C ).Theseobservationsledtothedevelopmentofthehypothesisthattheinitiationofmultipleinorescencecohortsandtheoweringgradientobservedinsweetorangeshootscouldbeanindicationofdynamicallychangingpatternsinthedistributionandactivityofoweringsignalsattheshootlevelinresponsetochangingenvironmentalconditions.SeveralputativeorthologsofArabidopsisoweringgeneshavebeenidentiedincitrusinthelasttenyears;amongthesearethecitrusorthologsofArabidopsis'soralidentitygenesAPETALA1(CsAP1)andLEAFY(CsLFY)( Pillitterietal. 2004b )andtheoweringrepressorTERMINALFLOWER1(CsTFL1)( Pillitterietal. 2004a ).InArabidopsis,increasedexpressionofLEAFY(LFY)intheshootmeristemisoneoftheearliestsignsoftheinitiationofowerdevelopmentandtheincreasedexpressionofAPETALA1(AP1)isanindicatoroforaldetermination( Hempeletal. 1997 ; Simonetal. 1996 ).Incontrast,theproductofArabidopsis'TERMINALFLOWER1(TFL1)isastrongsuppressorofAP1andLFYactivity( Ratcliffeetal. 1999 )andpreventsacquisitionoforalidentity( ShannonandMeeks-Wagner 1993 ).ThebalancebetweentheactivitiesofAP1,LFYandTFL1productsprobablycontrolthedeterminationofshootmeristemstoower( Hempeletal. 2000 ).Thus,assumingthatCsAP1,CsLFYandCsTFL1arealsodeterminantsoforalidentityincitrusastheyarein 57

PAGE 58

Arabidopsis,expressionpatternsofthesegenescouldhelpunderstandthedynamicoftheestablishmentoftheoweringgradientandtheinitiationofinorescencecohortsinsweetorange.Theestablishmentofoweringgradientsandtheinitiationofinorescencecohortscouldberegulatedbychangingproductionanddistributionpatternsofoweringsignalsorchangingsensitivitytothosesignalsinthemeristems.Arabidopsis'FLOWERINGLOCUST(FT)andSUPPRESSOROFOVEREXPRESSIONOFCONSTANS(SOC1)areintegratorsofoweringsignalsinitiatedbydifferentstimuli( LeeandLee 2010 ; Samachetal. 2000 ).FTitself,isamobileoweringsignalthatintegratesinformationfromphotoperiod-sensingsystemsandpromoteoweringbyup-regulationofLFYandAP1( Corbesieretal. 2007 ).PutativeorthologsofArabidopsis'FT(CsFT)andSOC1(CsSL1)havealsobeenidentiedincitrus( Nishikawaetal. 2007 ; TanandSwain 2007 ).ExpressionpatternsofCsFTandCsSL1couldindicatewhetherdifferentialproductionofoweringsignalscouldbeafactorinestablishingtheoweringgradientandtheinitiationofinorescencecohortsinsweetorangeshoots.Inthischapter,thepatternsofexpressionofputativecitrusoralidentitygenesandoralsignalintegratorsunderconditionsthataltertheoweringgradientandtheinitiationofoweringcohortsinsweetorangeshootswereinvestigated.Thehypothesestestedwerethattranscriptaccumulationoforalidentitygenesoccursinabasipetalgradientwithinshootsandthatexposuretogrowth-promotingconditionsandthenre-exposuretooral-inductiveconditionsincreasestheaccumulationoforalidentitygenestranscriptsinbudsatamorebasalposition.Anotherhypothesistestedinthischapterwasthattheestablishmentoftheoweringgradientinshootscouldbedisruptedbytreatmentswith1,2,3tri-iodobenzoicacid(TIBA),aknownauxintransportinhibitor( Niedergang-KamienandSkoog 1956 ).TIBAinhibitsauxintransportbyblockingtheauxinefuxcarriers( Geldneretal. 2001 )andreleasesapicaldominanceinaxillarybuds( Snyder 1949 ).Auxintransportwithinshootshasbeen 58

PAGE 59

relatedtotheestablishmentofapicaldominance( Everat-BourboulouxandBonnemain 1980 ; ThimannandSkoog 1934 ).Sincetheoweringgradientobservedincitrusshootsresemblesresponsescontrolledbyapicaldominance,itispossiblethatthistwophenomenaberelated. 3.1MaterialsandMethods 3.1.1PlantMaterialExperimentswereconductedundercontrolledenvironmentswereconductedusingeither2-3yearoldpotted`Valencia'treesgraftedon`Swingle'citrumeloor2-3yearoldpotted`WashingtonNavel'cuttingsorintheeldusingmature`Valencia'treesgraftedon`Carrizo'citrange.Allthepottedtreesusedforexperimentsweretestedfororalcompetenceandweremaintainedinashadedgreenhousewithnaturalphotoperiods,non-limitingirrigationandstandardfertilizationwhennotinuseforexperiments.Thegrowthroomsinwhichthecontrolledconditionsexperimentswereconductedwereilluminatedwithwithuorescentlights(800molesm-2s-1atcanopylevel)witha11/13h(day/night)photoperiod. 3.1.2ExperimentalConditionsTodeterminewhetherCsFTtranscriptsaccumulateinagradientinleavesatdifferentpositionswithinshoots,CsFTtranscriptswerequantiedinleavesfromshootsofeld-grownandpottedtreesunderoralinductiveandnonoral-inductiveconditions.LevelsofCsFTinleavesundernonoral-inductiveconditionsweredeterminedineld-growntreesinOctober(temperaturescontinuouslyabove20C)andinpottedtreeskeptinagrowthroomat23C.LevelsofCsFTinleavesunderoral-inductiveconditionsweredeterminedineld-growntreesinDecember(treeshadbeenexposedtonaturallyoccurringoral-inductivetemperaturessinceearlyNovember)andinpottedtreeskeptinagrowthroomat12Cfor1month.Thisexperimentwasconductedusingacompletelyrandomizeddesignwith4treereplicates.Differencesintranscriptaccumulationofthe 59

PAGE 60

selectedgenesbetweenwellirrigatedandwaterdecittreeswereanalyzedusingagenerallinearmodel.Todeterminewhethertranscriptsoforalidentitygenes(CsAP1andCsLFY)accumulateinagradientinbudsatdifferentpositionswithinshoots,CsAP1andCsLFYtranscriptswerequantiedinbudsonshootsofpottedtreesduringandafteroralinductionbylowtemperatures.Treesthathadbeenkeptat23Cforatleastonemonthweretransferredtoagrowthroomat12Candkeptatthistemperaturesfor30daystoinduceowering.Then,treesweretransferredbacktotheroomat23Ctopromotegrowth.Budsamples(stratiedbyposition)werecollectedbeforetransferthetransfertotheroomat12C,onthelastdayoftheoralinductivetreatmentand3daysafterthenaltransferto23C.Thisexperimentwasconductedusingacompletelyrandomizeddesignwith4treereplicates.DifferencesintranscriptaccumulationofCsAP1andCsLFYinbudsatdifferentpositionwereanalyzedusingagenerallinearmodel.DifferencesintranscriptaccumulationofCsAP1andCsLFYinbudsatthesamepositionbetweendays29and33wereanalyzedusingt-test.TodeterminewhethertheauxintransportinhibitorTIBAdisruptstheestablishmentofoweringgradientsinshoots,alanolinpaste(about30mg)thatcontained2,3,5-triiodobenzoicacid(TIBA,Sigma)a0.5%(w/w)concentrationwasappliedasaringaroundthemidsectionofeachinternodeofselectedshootsinpottedtrees.AnothersetofshootsinthesametreesweretreatedsimilarlywithalanolinpastewithoutTIBAasacontrol.Thetreeshadbeenkeptat23CforatleastonemonthbeforetheapplicationoftheTIBA-containingpasteandweretransferredtoagrowthroomat12Caftertheapplication.Thetreeswerekeptat12Cfor30daysandthentransferredbacktoaroomat23Ctopromotegrowth.ThenumberofbudsinitiatingoraldevelopmentinTIBA-treatedandcontrolshootswasrecorded.ThedistributionofbudsinitiatingoraldevelopmentbybudpositioninTIBA-treatedshootswascomparedtothedistributionofbudsinitiatingoraldevelopmentincontrolshootsusingthechi-squaretest. 60

PAGE 61

Totestwhetherpatternofaccumulationoforalidentitygenestranscriptswererelatedtotheinitiationofinorescencecohorts,CsAP1andCsLFYtranscriptswerequantiedinbudsofpottedtreesexposedtointermittentoralinduction.Treesthathadbeenkeptat23Cforatleastonemonthweretransferredtoagrowthroomat12Candkeptatthistemperaturesfor15days.Then,thetreesweretransferredbacktotheroomat23Cfor4daysandthetransferredagaintotheroomat12Cforanother10days.Then,thetreeswerenallytransferredtotheroomat23Ctopromotegrowth.Thistemperatureregimewasdesignedtomimicconditionsknowntoinducetheformationofinorescencecohortsintheeldinhumidsubtropicalclimates( ValienteandAlbrigo 2003 ).Budsamples(stratiedbyposition)werecollectedbeforetransfertheinitialtransfertotheroomat12C,onthelastdayofeachtemperatureperiod,and3daysafterthenaltransfertotheroomat23C.Thisexperimentwasconductedusingacompletelyrandomizeddesignwith4treereplicates.DifferencesintranscriptaccumulationofCsAP1andCsLFYinbudsatdifferentpositionwereanalyzedusingagenerallinearmodel.DifferencesintranscriptaccumulationofCsAP1andCsLFYinbudsatthesamepositionbetweenday14-18andday29-33wereanalyzedusingt-test.Thenumberofinorescencesformedbybudpositionwasrecordedandcomparedusingt-testsforeachbudpositionbetweentreesexposedtointermittentinductionorcontinuousinductioninalltheshoots(6-7nodeslong)formedduringthepreviousyearpresentonthetrees.Inalltheexperiments,accumulationofCsFTtranscriptswasquantiedinleavessampleswhereasaccumulationofCsSL1,CsAP1andCsLFYtranscriptswasquantiedinbudsamples.Thechoiceoftissuesinwhichtranscriptsoftheselectedgeneswerequantiedwasmadebasedonthemostlikelyspatialdomainofgeneexpressionandproteinactivitypredictedbythehypotheticalmodelinsection 1.4 .Leafandbudssamplesconsistedofapoolofatleast6leavesorbudsfromseparateshootsoneachtreereplicate.Allsampleswerecollectedat15H00localstandardtime. 61

PAGE 62

3.1.3qRT-PCRTotalRNAwasextractedusingaphenol-chloroformprecipitationmethodandpuriedusingsilicamembraneswithon-columnDNasedigestion(Qiagen).LeafsampleswereusedforanalysisofCsFTexpression,whereasbudsampleswhereusedforanalysisofCsSL1,CsAP1andCsLFYexpression.FivehundrednanogramsoftotalRNAwereusedforcDNAsynthesisina20lreactionwitholigodTprimers(SuperScriptIII,Invitrogen).OnemicroliterofthesynthesizedcDNAwasusedfortwo-step(95Cdenaturationand60Cfor1minuteannealingandextension)qPCRina20lreaction(SYBRPremixExTaqII,Takara)onaAppliedBiosystems7500FASTreal-timePCRsystem(LifeTechnologies)usingoptimizedqPCRassays(seeAppendix).PrimersforqPCRwere:5'-CGGCGGAAGGACTATGAC-3'and5'-TGTGAGAAAGCCAGAGAGGAA-3'(CsFT),5'-CCCTGGAGTGCAACAACCT-3'and5'-CTGATGTGTTTGAGAGCGGT-3'(CsAP1),and5'-TCTTGATCCAGGTCCAGAACATC-3'and5'-TAGTCACCTTGGTTGGGCATT-3'(CsLFY).CsGAPDHwasusedasreferencegene(5'-GGAAGGTCAAGATCGCAATCAA-3'and5'-CGTCCCTCTGCAAGATGACTCT-3').AllqPCRassayswerevalidatedforspecicamplicationandoptimizedforamplicationefcienciesbetween1.88and2.05withalineardynamicrangeof6log10cycles.ThesequenceoftheprimerstoamplifyCsLFYwasobtainedfrom Nishikawaetal. ( 2009 )whereasallotherprimersequencesweredesignedin-house.RelativegeneexpressionwascalculatedasafoldchangeratiousingPfaf'smethod( Pfaf 2001 )withsliding-windowefcienciescalculatedforeachreactionusingthesliwinfunctionintheqpcRRpackage( RitzandSpiess 2008 ). 3.1.4DataAnalysisMeanfoldchangeoftranscriptlevelsweretransformedtoalogarithmicscale(log2)forstatisticalanalysisbutdatainthegraphsrepresentstheuntransformeddata.Unlessnotedotherwise,alldifferencesreportedarestatisticallysignicant(p<0.05).AllstatisticalanalyseswereexecutedinR( RDevelopmentCoreTeam 2011 ). 62

PAGE 63

3.2ResultsandDiscussion 3.2.1CsFTTranscriptsAccumulateatEqualLevelsinLeavesRegardlessofTheirPositionintheShoot.Undernaturalconditions,inorescencesinC.sinensisshootsareformedinabasipetalgradientinshootsformedduringthepreviousyears( Sauer 1954 ; ValienteandAlbrigo 2004 )(Figure 3-2 ).Totestthehypothesisthatthereisgradientinthetranscriptlevelsoftheputativeowering-signalgeneCsFTinleavesatdifferentpositions,samplesofleavesborneatdifferentpositionsinselectedshoots(7-8nodeslongformedintheprevioussummerorspring)werecollectedbeforetheonsetoforalinductiveweatherandduringoralinductionandexpressionofCsFTwasmeasured.Figure 3-3 showsthatthelevelsofexpressionofCsFTinleavesof7-8nodeslongshootsformedduringthepreviousyearwasnotsignicantlydifferentamongleavesatdifferentpositionswithintheshoot.Ingeneral,thelevelofexpressionofCsFTtendedtobeloweratmorebasalpositions(4-7)butthistrendwasnotsignicant.NodifferencesinthelevelofexpressionofCsFTcouldbedetectedineithersamplescollectedbeforeorduringoralinduction.AssumingthatCsFTencodesamobileoweringsignalinC.sinensis,similartoFTinArabidopsis,andthattranscriptlevelsofCsFTcorrespondtolevelsoftheCsFTprotein,theseresultsareagainstthehypothesisthatoweringgradientsareestablishedbydifferentialproductionofoweringsignalsinleaves. 3.2.2AccumulationofCsAP1andCsLFYtranscriptsisHigheratNodesClosertotheApex.GiventhattheleveloftranscriptiontranscriptionofCsFTisnotdifferentinleavesatdifferentpositionswithinshoots,itwashypothesizedthattheestablishmentofoweringgradientscouldberelatedtodifferentialaccumulationoftranscriptsoforalidentitygenesinbudsatdifferentpositions.Totestthishypothesis,theexpressionoforalidentitygenesCsAP1andCsLFYwasmeasuredinbudsatdifferentpositionsafteroralinduction. 63

PAGE 64

Figure 3-4 showsthattheexpressionoforalidentitygenesCsAP1andCsLFYafteroralinduction(Day33)islowerinbasalbudsthanintheapicalbud.BasallevelsofexpressionofCsAP1andCsLFY(Day0)werenotstatisticallydifferentbetweenbudsatdifferentpositions.LevelsofCsAP1andCsLFYattheendoforalinduction(Day29)werealsonotdifferentinbudsatdifferentpositionsandwereslightlyreduced(notstatisticallysignicant)frombasallevels.ThelevelsofexpressionoftheputativeoweringrepressorCsTFL1werealsomeasuredbutnotanalyzedasCsAP1andCsLFYbecauseofsomereplicateshavinglevelsofCsTFLextendingbelowthedetectionrangeoftheqPCRassay.Ingeneral,levelsofexpressionofCsTFL1werehigher(morereactionsinwhichCsTFL1weredetected)inbudsatpositions7and5thaninpositions1and3(datanotshown).Together,theseresultssupportsthehypothesisthatoweringgradientsinC.sinensisarerelatedtoabasipetalgradientofexpressionoforalidentitygenesatdifferentbudpositionswhengrowthisresumedafteroralinduction. 3.2.3TIBADisruptstheEstablishmentofFloweringGradients.Resultsintheprevioussubsection( 3.2.1 )showedthatexpressionofCsAP1andCsLFYandoweringoccursasabasipetalgradientinshootsafteroralinduction.Sinceapicaldominanceispartlymediatedbythebasipetaltransportofauxinssynthesizedinyoungerandactivelygrowingorgansneartheapex( Chateldetal. 2000 ; Tanakaetal. 2006 ; ThimannandSkoog 1934 ),itwashypothesizedthattheauxindistributionwithinshootsisrelatedtotheestablishmentofoweringgradientsinC.sinensis.Totestthishypothesis,apicaldominancewasdisruptedinselectedshootsusingTIBA,anauxintransportinhibitor( Niedergang-KamienandSkoog 1956 ).TIBAhasbeenreportedtoreleaseapicaldominanceinaxillarybuds( Snyder 1949 ).Alanolinpastecontaining0.5%TIBAwasappliedinalltheinternodesinselectedshootsandtheshootswereexposedtooral-inductivetemperaturesandthentransferredtogrowthpromotingtemperaturestomeasureowering. 64

PAGE 65

TheTIBAtreatmentchangedtheoweringresponseofbudsundertheconditionstested(Figure 3-5 ).TIBA-treatedbudsproducedinorescencesatallbudpositions,whereasnon-TIBA-treatedbudsproducedinorescencesprimarilyinpositions1to3withnoinorescencesbeingformedatposition6and7.Furthermore,thetypeofinorescencesformedinTIBA-treatedbudswasexclusivelyleaess,whereasnon-TIBA-treatedshootsproducedamixtureofinorescencestypes(primarilyoftheleafytype,datanotshown). Moss ( 1969 )reportedthatmoreinorescencesandhigherproportionofleaessinorescencesareusuallyassociatedwithhigherlevelsoforalinduction.Thus,theTIBAtreatmentappliedtoshootsinthisexperimentalteredthemechanismcontrollingoralinductioninawaythatincreasedtheleveloforalinductionsensedbybuds.BudsatbasalpositionsinC.sinensisshootsdonotnormallyowerundernaturalconditions,however,ifapicalbudsareremovedbasalbudsrespondtooralinductionandproduceinorescenceswhengrowthisre-started( ChicaandAlbrigo 2011 ). Pillitterietal. ( 2004a ),andChapter 2 ofthisdissertationcontainevidencesupportingthehypothesisthatoralinitiation(asreportedbyup-regulationoforalidentitygenes)occursonlyrightaftertheonsetofgrowth-promotingconditions.TIBAinhibitsauxintransportbyblockingtheauxinefuxcarriers( Geldneretal. 2001 )andreleasesapicaldominanceinaxillarybuds( Snyder 1949 ).Sinceapicaldominanceinhibitthegrowthofbasalbuds( ThimannandSkoog 1933 )andup-regulationofCsAP1andCsLFYonlyoccurswhengrowthisresumed,itispossiblethattheTIBAtreatmentsinthisexperimentreleasedapicaldominanceinaxillarybudsandthus,allowedallthebudsintheshoottoinitiategrowthasinorescences.AnotherpossibleexplanationisthatthemovementoftheCsFTproteinwascontrolledbyauxinorauxin-relatedmechanisms.Auxin-mediatedapicaldominancehaspreviouslybeenrelatedtothedistributionofassimilatesandnutrients( DaviesandWareing 1965-06-01 ; PatrickandSteains 1987 ).Thus,itispossiblethatTIBAtreatmentsinducedtheaccumulationof 65

PAGE 66

CsFTinbasalaxillarybudswhichwasproducedintheleavesassociatedwiththesebudsinsteadofCsFTbeingtransportedandaccumulatedneartheapex. 3.2.4TranscriptAccumulationofFloralIdentityGenesafterIntermittentInduc-tionisRelatedtoInitiationofFloweringCohorts.UnderFlorida'shumidsubtropicalconditions,multiplecohortsofinorescencesareofteninitiatedbysporadicperiodsofwarmerweatherduringthefall/winter( ValienteandAlbrigo 2003 ).SinceexpressionofCsAP1andCsLFYwascorrelatedtotheinitiationofowering,itwashypothesizedthatlevelsofexpressionofthesetwogenescouldalsoberelatedtotheinitiationofmultipleoweringcohorts.Totestthishypothesis,theexpressionofCsAP1andCsLFYwasmeasuredatdifferentpositionswithintheshootinpottedtreessubjectedtointermittentoralinduction.Figure 3-6 showsthatwhentreesweretransferredfromcooloral-inductivetemperaturestowarmergrowth-promotingtemperaturesafter15daysofinduction,theexpressionofCsAP1andCsLFYincreasedasreportedinsubsection 3.2.2 (Day18).Transferringtreesbacktooral-inductivetemperaturesreducedthelevelofexpressionofCsAP1andCsLFY.ExpressionofCsAP1andCsLFYremainedlowuntilthetreeswerepermanentlytransferredtogrowth-promotingtemperatures(Day33).Afterthenaltransfer,thegradientintheexpressionofCsAP1andCsLFYwasreversedfrombud1to5whereasexpressioninbud7wasoutofthetrendbutstillhigherthanbasallevels.Moreinorescenceswereformedinbuds5and7oftreesexposedtointermittentinductionthanincontroltreesthatwereexposedtoun-interruptedinduction(Figure 3-7 ),supportingthehypothesisthatoweringcohortsareinitiatedwhenoralinductionisinterruptedbyperiodsofwarmerweatherwhichup-regulatestheexpressionofCsAP1andCsLFY.Theseresultsalsoshowthatbasalbudsarecapableofrespondingtooralinductionafterinitiationofoweringinbudsatmoreapicalpositions(whichisassumedtohaveoccurredbytheup-regulationofCsAP1andCsLFY). 66

PAGE 67

Tosummarize,resultsfromtheexperimentsofthischaptershowthattheestablishmentofoweringgradientswithinC.sinensisshootsandtheinitiationofmultipleoweringcohortsismorerelatedtothepatternofexpressionoforalidentitygenesCsAP1andCsLFYthantothepatternofexpressionoftheputativeoweringsignalgeneCsFT.FactorsassociatedwithauxintransportwithinshootswereinvolvedinregulatingtheestablishmentofoweringgradientsinC.sinensisshoots.Theinvolvementofauxin-relatedmechanismsintheregulationofoweringinC.sinensisisnewandwillrequirefurtherinvestigationtodetermineitsexactroleintheestablishmentofoweringgradients.TheresultspresentedinthischapterprovideusefulinformationformodelingthedynamicoforalinitiationinshootsofC.sinensis. 67

PAGE 68

A B CFigure3-1. Inorescencegradient,typeofnewgrowthandinorescencecohortsinC.sinensisspringush.A)Inorescencegradient,notethatinorescenceswereformedinthe4more-apicalnodesonly.B)Typesofnewgrowthinthespringush.Fromlefttoright:newvegetativeshoots,mixedinorescencesandleaessinorescences.Mixedinorescencescanbefurtherdividedinleaf-abundantandleaf-decientinorescencesdependingonwhethertheinorescenceshasmoreleavesthanowerorviceversa.C)Inorescencecohorts.Noteinorescenceswithfully-developedopenowersinmoreapicalpositionsanddevelopinginorescencesatmorebasalpositionsinthesameshoot(redsquares). 68

PAGE 69

Figure3-2. Numberofinorescencesformedbynodepositionineld-grown15year-old`Valencia'treeinthespringof2010.DataaremeansS.E.of4tree-replicates(25shoot-sub-replicatespertree). 69

PAGE 70

A BFigure3-3. ExpressionofCsFTinleavesatdifferentpositionsinshootsofeld-grown`Valencia'treesinOctoberandDecemberof2010(A)andpottedtreesat23Cor12C(B).ThelevelofexpressionofCsFTinleavesinOctoberandat23CisrepresentativeofthelevelsofCsFTinleavesnotexposedtooral-inductionwhereasthelevelofexpressionofCsFTinDecemberandat12CisrepresentativeoflevelsofCsFTofleavesunderoral-induction.DataaremeansS.E.of4tree-replicates(6shoot-sub-replicatespertree). 70

PAGE 71

Figure3-4. ExpressionofCsAP1andCsLFYinbudsatdifferentpositioninshootsof3-year-oldpotted`Valencia'trees.Treesweretransferredfromaroomat23Ctoaroomat12C(Day1).After29days,thetreesweretransferredbacktotheroomat23Ctopromotegrowth.DataaremeansS.E.of4tree-replicates(3shoot-sub-replicatespertree). 71

PAGE 72

Figure3-5. Numberofinorescencesformedbypositioninshootsofpotted3year-old`Valencia'treestreatedwith2,3,5-triiodobenzoicacid(TIBA).TIBA-treatedshootshadalanolinpastecontaining0.5%(w/w)ofTIBAappliedasaringaroundeachinternode,halfwaybetweennodes.ControltreeshadalanolinpastewithoutTIBAappliedasbefore.Bothsetsoftreesweretransferredtoaroomat12Cfor30daysandthentransferredtoanotherroomat23Ctopromotegrowth.Eachgroupconsistedof3trees.Dataaresumsofthenumberofinorescencesformedineachposition.ThedistributionsofinorescencesformedbybudpositionbetweenTIBA-treatedandcontrolshootswerestatisticallydifferent(chi-squaretest). 72

PAGE 73

Figure3-6. ExpressionofCsAP1andCsLFYinbudsatdifferentpositioninshootsof3-year-oldpotted`Valencia'treesunderintermittentoralinduction.Treesweretransferredfromaroomat23Ctoaroomat12C(Day1).Onday15,thetreesweretransferredtotheroomat23Candkepttherefor3days.Onday19thetreesweretransferredagaintotheroomat12Cuntilday30whenthetreeswerepermanentlytransferredto23C.DataaremeansS.E.of4tree-replicates(3shoot-sub-replicatespertree). 73

PAGE 74

Figure3-7. Numberofinorescencesformedbypositionin3year-old`Valencia'treesexposedtointermittentinduction.Treesweretransferredfromaroomat23Ctoaroomat12C(Day1).Onday15,thetreesweretransferredtotheroomat23Candkepttherefor3days.Onday19thetreesweretransferredagaintotheroomat12Cuntilday30whenthetreeswerepermanentlytransferredto23C.DataaremeansS.E.of4tree-replicates(3shoot-sub-replicatespertree). 74

PAGE 75

CHAPTER4OTHERFACTORSALTERINGTHEEXPRESSIONOFSWEETORANGEFLOWERINGGENESDURINGFLORALINDUCTIONAlthoughlowtemperaturesandwaterdecitaretheonlyfactorsknowntoinduceoweringinC.sinensis,otherfactorslikecropload,carbohydratelevels,gibberellinsandproductsofnitrogenmetabolismcanalsoaltertheleveloforalinduction( AlbrigoandGalen-Sauco 2004 ; KrajewskyandRabe 1995 ).Sincetheseotherfactors(cropload,etc.)modifytheleveloforalinductioninC.sinensistrees,itwashypothesizedthatsignalsinitiatedbythesefactorsintegratewiththeregulatorypathwaythatcontrolstheexpressionofcitrusoweringgenes.EventhoughC.sinensisoweringgenesareprobablyorthologoustoArabidopsisoweringgenes( Endoetal. 2005 ; Nishikawaetal. 2010 2009 2007 ; Pillitterietal. 2004a b ; TanandSwain 2007 ),themechanismscontrollingoralinductionareapparentlydifferentinbothspecies.Forinstance,althoughoweringinArabidopsisisinducedprimarilybychangesinphotoperiod( Valverdeetal. 2004 ),changesinphotoperioddonotseemtohaveanyeffectonoralinductionincitrus( Moss 1969 ).Furthermore,gibberellinspromoteoweringinAra-bidopsis( Blazquezetal. 1998 )buttheyproducetheoppositeeffectincitrus( Monseliseetal. 1964 ).TheeffectsoflowtemperaturesandwaterdecitontheexpressionofC.sinensisoweringgeneshavebeenreviewedandreportedearlierinChapter 2 ofthisdissertationandinthepublishedliterature( Nishikawaetal. 2007 ; Pillitterietal. 2004a ).InthischapterIpresentacollectionofexperimentsdesignedtodeterminetheeffectsofcropload,gibberellinsandlightontheexpressionofoweringgenesinC.sinensis.Also,Ipresentexperimentsthatdescribethechangesintheleveloftranscriptaccumulationofoweringgenesearlyintheoralinductionprocess.ResultsfromtheseexperimentsprovideinformationaboutthemolecularmechanismunderlyingtheeffectsofcroploadandgibberellinsonoweringinC.sinensis.Inaddition,theseresultsshowthatoweringgenesrespondrapidlyandarehighlysensitivetochanges 75

PAGE 76

inenvironmentalconditions.Together,theseresultsaddmoredetailstotheproposedhypotheticalmechanismbywhichoweringisinducedinC.sinensis. 4.1MaterialsandMethods 4.1.1PlantMaterialFieldexperimentswereconductedusingmature`Valencia'sweetorangetreesgraftedon`Carrizo'citrangeinanorchardattheUniversityofFlorida'sCitrusResearchandEducationCenterinLakeAlfred,Florida(285'N,8143'W)during2009and2010.Theorchardreceivedsimilarhorticulturalcareasinneighboringcommercialgrovesthroughouttheexperiments.Experimentsundercontrolledenvironmentswereconductedusingeither2-3yearoldpotted`Valencia'treesgraftedon`Swingle'citrumeloor2-3yearoldpotted`WashingtonNavel'cuttings.Allthetreesusedforexperimentsweretestedfororalcompetenceandweremaintainedinashadedgreenhousewithnaturalphotoperiods,non-limitingirrigationandstandardfertilizationwhennotinuseforexperiments.Thegrowthroomsinwhichthecontrolledconditionsexperimentswereconductedwereilluminatedwithwithuorescentlights(800molesm-2s-1atcanopylevel)witha11/13h(day/night)photoperiod. 4.1.2ExperimentalConditionsTodeterminetheeffectofgibberellinsontheaccumulationofCsAP1,CsLFY,CsSL1andCsWUStranscriptsinbudspreviouslyexposedtowaterdecit,transcriptsofthesegeneswerequantiedinbudsofpottedtreesfollowingaoral-inductivetreatmentbylowtemperatures.Treesthathadbeenkeptat23Cforatleastonemonthweretransferredtoagrowthroomat12Candkeptatthistemperaturesfor30daystoinduceowering.Onthelastdayoftheoral-inductivetreatment,a2.5ldropofa90ppmaqueoussolutionofgibberellicacid(GA,Acrosorganics)and0.5%Tween80(Fisher)wasappliedtobudsofpreviouslyselectedshoots.Thentreesweretransferredtoaroomat23Ctopromotebudgrowth.Onedayafterthetransfertotheroomat23C,adropofthesamegibberellicacidsolutiondescribedbeforewasappliedtothebudsof 76

PAGE 77

anothersetofpreviouslyselectedshoots.Anothersetofshootswastreatedwitha0.5%Tween80(Fisher)aqueoussolutionasacontrol.Threedaysafterthenaltransferto23C,thetreatedbudsweresampledfortranscriptquantication.Thisexperimentwasconductedusingacompletelyrandomizeddesignwith4treereplicates.DifferencesinlevelsoftranscriptaccumulationofCsAP1,CsLFY,CsSL1andCsWUSinbudstreatedwithgibberellinandcontrolbudswereanalyzedusinganalysisofvariance.TotestdeterminetheeffectofgibberellinsontheaccumulationofCsFTtranscripts,leavesfromthesametreesoftheexperimentdescribedinthepreviousparagraphweretreatedwiththesamegibberellicacidsolutiondescribedbeforeafter25daysat12C.Thegibberellicacidsolutionwasappliedusingcottonswabsandspreadingitonboththeadaxialandabaxialsurfaceoftheleaves.Anothergroupofleavesweretreatedwiththesamesolutionwithoutgibberellicacidascontrol.Onedayafterthetreatmentswereappliedtheleavesweresampledfortranscriptquantication.Thisexperimentwasconductedusingacompletelyrandomizeddesignwith4treereplicates.DifferencesinlevelsoftranscriptaccumulationofCsFTinleavesofgibberellin-treatedandcontrolleaveswereanalyzedusingat-test.TodeterminetheeffectoffactorsassociatedwithfruitontheaccumulationofCsFTtranscripts,leaveslocatedatdifferentdistancesfromfruitonthesamelimbunitweresampledineld-growntreesduringthewinterof2009.Thisexperimentwasconductedusingacompletelyrandomizeddesignwith4treereplicates.DifferencesinlevelsoftranscriptaccumulationofCsFTinleavesatdifferentpositionrelativetothenearestfruitwereanalyzedusingagenerallinearmodel.Inthefollowingspring,thenumberofinorescencesformedintheshootsfromwhichtheleavesweresampledwererecordedandanalyzedalsousingagenerallinearmodel.TotestwhethercyclesoflightanddarkaltertheaccumulationofCsFTtranscripts,CsFTtranscriptswerequantiedintreesexposedtonormalday/nightconditions(11/13hday/night),constantdarknessorconstantlightingrowthroomsat12C.Trees 77

PAGE 78

thathadbeenkeptat23Cforatleastonemonthwithaconstantphotoperiod(11/13hday/night)weretransferredtoanotherroomat12Cunderthe3lightregimespreviouslyindicated.Beforethetransfer,leavesweresampledtodeterminereferenceinitiallevelsofCsFTtranscripts.Threedaysafterthebeginningofthetreatments,leafsampleswerecollectedandCsFTtranscriptsquantied.Thisexperimentwasconductedusingacompletelyrandomizeddesignwith4treereplicates.Foreachtreatment,differencesintranscriptlevelsbetweensamplescollectedbeforethetransferand3daysafterthetransferwereanalyzedusingt-tests.Differencesbetweenthe3lightregimesonsamplescollected3daysafterthetransferwereanalyzedusinganalysisofvariance.TodeterminewhethertheaccumulationofCsFTtranscriptschangesthroughouttheday,leavessampleswerecollectedatdifferenttimesunderdifferentconditionsknowntomodifyoralinductioninC.sinensis.TodeterminelevelsofCsFTtranscriptsatnonoral-inductive23Candoral-inductive12C,pottedtreesexposedtothesetemperaturesfor15daysweresampledevery2hoursfrom06H00until18H00for3consecutivedays.TodeterminelevelsofCsFTintreesexposedtooral-inductivewaterdecitsandnaturallyoccurringoralinductivetemperatures,eld-growntreesweresampledduringthesummerof2010andthewinterof2010at08H00,15H00,18H00and21H00for3consecutivedays.Thisexperimentwasconductedusingacompletelyrandomizeddesignwith4treereplicates.DifferencesinaccumulationofCsFTtranscriptswereanalyzedusinganalysisofvariance.ToinvestigatewhetherthetimeatwhichoralinductivetemperaturesoccurhasaneffectontheaccumulationofCsFTtranscripts,transcriptsofCsFToftreestransferredfrom23Cto12Cateither07H00or15H00werequantiedbeforethetransfer,2hoursafterthetransfer,andat07H00and15H00onthenextday.DifferencesinCsFTtranscriptaccumulationbetweentreestransferredinthemorningorintheafternoonwereanalyzedusinganalysisofvariance.Toinvestigatetheshort-termresponseofCsFTtranscriptaccumulationtonaturallyoccurringreductionsintemperatureundereldconditions, 78

PAGE 79

treesweresampledat08H00and15H00duringthefallof20102daysbeforeandafterthepassingofacoldfrontthatreducednighttemperaturesbelow20C.DifferencesinCsFTtranscriptaccumulationinleavesbeforeandafterthepassingofthecoldfrontwereanalyzedbyt-test.Todeterminetheeffectoflevelsoforal-inductivetemperatureontheaccumulationofCsFTtranscripts,CsFTtranscriptswerequantiedonleavesoftreesafter3daysofexposuretoeither5,10,15,20or23C.Treesthathadbeenkeptat23Cforatleastonemonthbeforethetransfertoroomsateachtemperatureoftheindicatedtemperatures.Leavesweresampledbeforetransferandonday3afterthetransfer.Thisexperimentwasconductedusingacompletelyrandomizeddesignwith4treereplicates.DifferencesinCsFTtranscriptaccumulationinleavesatthe5temperatureswereanalyzedbyanalysisofvariance. 4.1.3qRT-PCRTotalRNAwasextractedusingaphenol-chloroformprecipitationmethodandpuriedusingsilicamembraneswithon-columnDNasedigestion(Qiagen).LeafsampleswereusedforanalysisofCsFTexpression,whereasbudsampleswhereusedforanalysisofCsSL1,CsAP1andCsLFYexpression.FivehundrednanogramsoftotalRNAwereusedforcDNAsynthesisina20lreactionwitholigodTprimers(SuperScriptIII,Invitrogen).OnemicroliterofthesynthesizedcDNAwasusedfortwo-step(95Cdenaturationand60Cfor1minuteannealingandextension)qPCRina20lreaction(SYBRPremixExTaqII,Takara)onaAppliedBiosystems7500FASTreal-timePCRsystem(LifeTechnologies)usingoptimizedqPCRassays(seeAppendix).PrimersforqPCRwere:5'-CGGCGGAAGGACTATGAC-3'and5'-TGTGAGAAAGCCAGAGAGGAA-3'(CsFT),5'-CAGCCAGAGAATCTAACAAACG-3'and5'-TCAGTTTTGTGGTGGTATTGCC-3'(CsSL1),5'-CCCTGGAGTGCAACAACCT-3'and5'-CTGATGTGTTTGAGAGCGGT-3'(CsAP1),5'-TCTTGATCCAGGTCCAGAACATC-3'and5'-TAGTCACCTTGGTTGGGCATT-3'(CsLFY),and5'-CCATGCACCAGAGACCAG-3' 79

PAGE 80

and5'-GTCTCCCATTTGACCACCA-3'(CsWUS).CsGAPDHwasusedasreferencegene(5'-GGAAGGTCAAGATCGCAATCAA-3'and5'-CGTCCCTCTGCAAGATGACTCT-3').AllqPCRassayswerevalidatedforspecicamplicationandoptimizedforamplicationefcienciesbetween1.88and2.05withalineardynamicrangeof6log10cycles.ThesequenceoftheprimerstoamplifyCsLFYwasobtainedfrom Nishikawaetal. ( 2009 )whereasallotherprimersequencesweredesignedin-house.RelativegeneexpressionwascalculatedasafoldchangeratiousingPfaf'smethod( Pfaf 2001 )withsliding-windowefcienciescalculatedforeachreactionusingthesliwinfunctionintheqpcRRpackage( RitzandSpiess 2008 ). 4.1.4DataAnalysisMeanfoldchangeoftranscriptlevelsweretransformedtoalogarithmicscale(log2)forstatisticalanalysisbutdatainthegraphsrepresentstheuntransformeddata.Unlessnotedotherwise,alldifferencesreportedarestatisticallysignicant(p<0.05).AllstatisticalanalyseswereexecutedinR( RDevelopmentCoreTeam 2011 ). 4.2ResultsandDiscussion 4.2.1GibberellinsDown-regulatetheAccumulationofPutativeFloweringSignalsandFloralIdentityGenesTranscriptsInArabidopsis,gibberellins(GA)promoteoweringbydirectlyup-regulatingtheoralidentitygeneLFYundershortdayconditions( Blazquezetal. 1998 ).Incitrushowever,exogenousGAinhibitoweringwhenappliedduringoralinduction( CooperandPeynado 1958 ; Garca-Luisetal. 1986 ; Monseliseetal. 1964 ).TotestthehypothesisthatGAregulatestheexpressionoforalidentitygenes(CsAP1andCsLFY)inC.sinensisandArabidopsisalthoughwithoppositeeffects,2.5lof90ppmsolutionofGAwereapplieddirectlytobudsofshoots6-7nodeslongofpottedC.sinensistrees. Pillitterietal. ( 2004a )reportedthattheexpressionoforalidentitygenesiskeptatbasallevelsduringoralinductionandtheirexpressionisonlyup-regulatedaftertransfertogrowthpromotingconditions.SimilarresultsarealsoreportedinChapter 80

PAGE 81

2 ofthisdissertation.Thus,itwasassumedthatthehypotheticaleffectofGAontheexpressionwouldbeeasiertodetermineduringthetransitionfromoral-inductivetogrowth-promotingconditions.Figure 4-1 showsthatapplicationofGAconsistentlyreducedtheexpressionofCsSL1,CsAP1andCsLFY.TheseresultssupportthehypothesisthatGAsignalsregulatetheexpressionofthesamegenesinC.sinensisandArabidopsisbutinoppositeways.DecreasedexpressionofCsAP1andCsLFYoccurredbothwhenGAwasappliedbeforeandafterthetransfertogrowth-promotingconditions,however,thereductionwasgreatestwhenGAwasappliedbeforethetransfer.BesidesCsSL1,CsAP1andCsLFY,theexpressionofthemeristemidentitygeneCsWUSwasalsomeasuredandsimilarlyreducedbyGAapplication. Guardiolaetal. ( 1982 )suggestedthattheapplicationofexogenousGAduringoralinductioncouldinducereversionoforalmeristemstovegetativemeristems. LordandEckard ( 1987 )reportedthathypotheticalinorescencereversiondidnotoccurifGAwasappliedwhensepalshadalreadydifferentiated.WhereasthereisnoconclusiveevidenceonwhetheractualinorescencereversionoccursinC.sinensis,itispossiblethatratherthaninducinginorescencereversion,GAdisruptoralidentitydeterminationbydown-regulatingCsAP1andCsLFY(reversionwouldnotoccursincenooralidentityhasnotbeendetermined).Assumingthatoral-buddifferentiationoccursattheonsetofgrowth-promotingconditions,greaterreductionofCsAP1andCsLFYexpressioninbudswhenGAisappliedbeforethetransfertogrowth-promotingconditionsthanwhenitisappliedonedayafterthetransfersupportsthehypothesisthatofGAdisruptsacquisitionoforalidentity.Sincethesamplesusedintheexperimentreportedhereconsistedofapoolofbudtissue,higherexpressionofCsAP1andCsLFYwhenGAwasappliedaftertransferthanbeforetransfercouldindicatethatsomeofthebudsinthepoolhadalreadyacquiredoralidentityandthuswerelessaffectedbyGAsignals. 81

PAGE 82

ApplicationofGAalsoreducedtheexpressionofCsWUS.InArabidopsis,theproductofWUS,alongwiththeproductsofSTMandtheCLAVATAclade,arekeycomponentsofthemechanismthatmaintainsmeristemsundifferentiatedandorganized( Galloisetal. 2002 ; Lenhardetal. 2002 ; Longetal. 1996 ; Mayeretal. 1998 ).Furthermore,WUSandLFYactivatetheexpressionofAG( Lenhardetal. 2001 ; Lohmannetal. 2001 )whichisrequiredfororalorganidentityinwhorls3and4( WeigelandMeyerowitz 1994 ).Thus,reducedexpressionofCsWUSprovidesfurthersupporttothehypothesisofGAdisruptingtheacquisitionoforalmeristemidentity.Besidesreducedexpressionoforalandmeristemidentitygenes,GAapplicationtoleavesduringinductionalsoreducedtheexpressionoforalsignalintegratorCsFT(Figure 4-2 ).InArabidopsis,applicationofGAiskeytoinduceoweringundernon-oral-inductiveshortdays( Blazquezetal. 1998 ).TheroleofGAonArabidop-sisoralinductionunderlongdaysislessclear( Mutasa-GottgensandHedden 2009 ),butapparentlyGAsignalsarealsorequiredforup-regulatingCsFT( HisamatsuandKing 2008 ).Thus,thedown-regulationofCsFTinresponsetoGAalsosupportsthehypothesisofGAinducingoppositeeffectsontheexpressionofoweringgenesinC.sinensisandArabidopsis. 4.2.2FruitProximityInC.sinensis,fruitinhibitsoralinductioninnearbyshoots( Moss 1971 )andtreescarryingheaviercropsusuallyowerlessprofuselythantreeswithlightercrops( ValienteandAlbrigo 2004 ).TheexactmechanismbywhichfruitinhibitsoweringinC.sinensishasnotbeenelucidated.Fruit-inducedreductionincarbohydratelevels Goldschmidtetal. ( 1985 ),higherconcentrationofgibberellinsinfruit-bearingbranches( Koshitaetal. 1999 )andchangesinnitrogenmetabolisminfruit-bearingbranches( Martnez-Fuentesetal. 2010 )havebeenrelatedtotheinhibitionofowering.Inthisexperiment,thehypothesisthatfruitinhibitstheexpressionoftheoweringsignalintegratorgeneCsFTwastested.Basedongenetictransformationandgeneexpression 82

PAGE 83

reports( Endoetal. 2005 ; Kobayashietal. 1999 ; Nishikawaetal. 2007 ),itwasassumedthatCsFTisinfactaoweringsignal,similartotheroleofitsorthologinArabidopsis( Corbesieretal. 2007 ),andthusreductionsinthelevelofexpressionofthisgeneinleavesnearbyfruitwouldindicatedisruptioninthemechanismproducingoweringsignals.TheexpressionofCsFTwasproportionaltothedistancebetweenfruitandleaves,indicatingthatthepresenceoffruitprobablyreducestheproductionofoweringsignals(assumingthatproteinexpressionisproportionaltotranscriptaccumulationforthisgene,Figure 4-3 .TheinhibitoryeffectoffruitonCsFToccursinagradientandwaspresentatleastasfaras30cmawayfromthefruit.Itispossiblethatexpressionoforalidentitygeneswerealsoaffectedbynearbyfruit,howeverthispossibilitywasnottested.Nonetheless,theseresultsindicatedthattheower-inhibitingfactorassociatedwithfruitatleastdisruptstheproductionofoweringsignalsinnearbyleavesandthus,couldpartiallyexplainthenegativeeffectoffruitonowering.Atthewholetreelevel,reducedoweringintreescarryingaheavycropcouldbeexplainedbyoverallreducedproductionofoweringsignalssinceheaviercropsimplyshorteraveragedistancesbetweenfruitandnearbyleavesthanlightercrops. 4.2.3EffectofLight/DarkCyclesonCsFTTranscriptAccumulationPhotoperiodisakeyregulatorofthetranscriptionofFTinArabidopsis( Turcketal. 2008 ).InArabidopsis,expressionofFTisup-regulatedbyCONSTANS(CO)inthephloemofleaves( Anetal. 2004 )andtheFTproteinistransportedtotheshootapicalmeristem( Corbesieretal. 2007 )where,alongwiththeproductofFD( Abeetal. 2005 ),activatestheexpressionoforalidentitygenesLFYandAP1( Samachetal. 2000 ).ExpressionofCOiscontrolledbytheplant'scircadianclockandpeakslateintheday( Suarez-Lopezetal. 2001 ).COtranscriptionisfollowedbytranslationoftheCOprotein,however,intheabsenceoflight,theCOproteinistargetedfordegradationintheproteosome( Valverdeetal. 2004 )anddoesnot 83

PAGE 84

up-regulateFT.Conversely,underoral-inductivelongdays,COisstabilizedbylightandeffectivelyup-regulatesFTandpromoteowering( Valverdeetal. 2004 ).SinceCsFTisapparentlythecitrusorthologofArabidopsisFT,itwashypothesizedthatlight/darkcyclescouldalsoregulateexpressionofCsFTeventhoughoralinductioninC.sinensisisconsideredtobephotoperiod-insensitive( Moss 1969 ).Inthisexperimenttreeswereexposedto2extremephotoperiodsfor3daysatoral-inductivetemperaturestotestwhetherdisruptinglight/darkcyclesalteredtheexpressionofCsFTcomparedtoanintermediatephotoperiod.Figure 4-4 showsthateitherconstantlightorconstantdarknessinhibitedtheexpressionofCsFTcomparedtotheintermediatephotoperiod.ThisindicatedthattheexpressionofCsFTrequiresalternationofperiodsoflightanddarkness. Moss ( 1969 )reportedthatoweringwasinducedinC.sinensistreesexposedtooral-inductivetemperaturesatdaylengthsrangingfrom8to16hours,proposingthatoralinductioninC.sinensisisprobablyinsensitivetophotoperiod.Furthermore, Cassinetal. ( 1969 )reportedthatC.sinensistreesarecapableofoweringandproducecommercialcropsevenattropicallocationswhereseasonalchangesindaylengtharenegligible.TheresultsinFigure 4-4 supportaroleforphotoperiodregulatingtheexpressionofCsFTandoralinduction(assumingthatCsFTisaoral-promotingsignalasinArabidopsis).SinceoweringinC.sinensiscanbeinducedinawiderangeofphotoperiods,oral-inductioninC.sinensismaynotbeassensitiveasoral-inductioninArabidopsisbutstillrequiresalternationofperiodsoflightanddarkness. 4.2.4AccumulationofCsFTTranscriptsChangesThroughouttheDayInArabidopsis,thephotoperiodicinductionofoweringreliesonthetranslationofCOproteinduringperiodsoflight( Turcketal. 2008 ).TheexpressionofFTusuallyfollowstheexpressionofCOunderoral-inductivelongdays( Suarez-Lopezetal. 2001 ).ThetranscriptionofCOisregulatedbycomponentsofthecircadianclock( Suarez-Lopezetal. 2001 )buttheactivityofCOisregulatedaftertranslation( Valverde 84

PAGE 85

etal. 2004 ).WhereasnoC.sinensisorthologofCOhasbeencharacterized,thegenomeofC.sinensiscontainsseveralsequenceswithhighdegreeofsequencesimilaritytoCOandCO-LIKEgenesinotherspecies(datanotshown).Furthermore,asreportedintheprevioussection( 4.2.3 ),theup-regulationofCsFTbyoral-inductivetemperaturesrequiresthealternationofperiodsoflightanddarkness,aresponsethatcouldbemediatedbyaputativeCsCOortholog.InthisexperimentthehypothesiswastestedthattheexpressionofCsFTchangesthroughouttheday,similartotheexpressionofFTinArabidopsis( Suarez-Lopezetal. 2001 ).Figure 4-5 showsthatexpressionofCsFTchangesthroughoutthedayinC.sinensisundertheconditionsevaluated.ExpressionofCsFTwashighestbetween13H00and15H00localstandardtime(LST,UTC-5)andthendecreasedsharply.TheexpressionofCsFToscillatedalsoundernon-oral-inductiveconditions(23CingrowthroomsandirrigatedtreesinSummer2010)buttheamplitudeofthepeakwassignicantlysmallerthanatoral-inductivetemperatures.ExpressionofCsFTstartedtodecreasebeforetheonsetofperiodsofdarksuggestingthatdiurnalchangesinexpressionmightberegulatedbysomeotherfactorbesideslight.Theup-regulationofCsFTdidnotoccurundereitherconstantlightordarkness(Subsection 4.2.3 )solight/darkcyclescouldstillbeinvolvedintheregulationofCsFT,thoughlessdirectly.CompleteinhibitionofCsFTup-regulationunderconstantlightordarknessconditionsdidnotsupportthehypothesisofdirectregulationofCsFTexpressionbythetree'sinternalclock.SincediurnalchangesintheexpressionofCsFTcouldbeinducedbyvariousfactors,thediurnalcyclingsupportsthehypothesisthatCsFTcouldberegulatedbyaputativeCOortholog. 4.2.5EarlyChangesinTranscriptLevelsofCsFTinResponsetoFloralInductiveTemperaturesTheexpressionofCsFThasbeenshowntochangeseasonallyintreesgrowingintheeldandinresponsetoarticialoralinductivetreatments(Nishikawaetal. 85

PAGE 86

2007,2009andChapter 2 ofthisdissertation).However,detailsabouttheearliestchangesintranscriptionofCsFTafterinitialexposuretooralinductivestimuliarelacking.AssumingthatCsFTisaoweringsignalasinArabidopsis,describingtheearliestresponsesofCsFTcouldhelpelucidatecharacteristicsofthemechanismregulatingCsFTexpressionandoralinduction.InthissetofexperimentschangesintheexpressionofCsFTtakingplacewithintherst3daysofexposuretooral-inductiveconditionsaredescribed.Figure 4-6 showstheexpressionofCsFTwithin24hoursoftransfertooral-inductivetemperatures.Inthisexperimenttreesweretransferredeitherinthemorningorintheafternoontotestwhetherprocessesoccurringearlyintheday(orduringtheevening/night)couldberelatedtoimmediateup-regulationofCsFT.ExpressionofCsFTwassignicantlyup-regulatedregardlessofthetimeatwhichtreesweretransferred,indicatingthatthetemperature-sensingmechanismregulatingCsFTexpressionisactivethroughouttheday.However,themagnitudeoftheup-regulationofCsFT2hoursafterthetransferwashigherintreestransferredat15H00LST,indicatingthatCsFTsensitivitytochangesintemperatureishigheratthistimethanearlierinthemorning.Furthermore,at17H00LSTthelevelofexpressionCsFTintreestransferredat07H00wasequivalenttothelevelofexpressionofCsFTintreestransferredat15H00LST,indicatingthattheeffectoftheexposuretooral-inductivetemperaturesfor10hthroughmostofthedayonCsFTwasequivalenttotheeffectofexposingthetreesfor2htooral-inductivetemperaturesintheafternoon.Onthenextday,thelevelofexpressionofCsFTintreestransferredat08H00LSTthedaybeforewasnodifferentthanthelevelofCsFTexpressionintreestransferredat15H00LSTthedaybeforeatanyofthetimessampled.DiurnalchangesinCsFTexpressionalsooccurredinthisexperimentasreportedbefore(Figure 4-5 ).ThelevelofexpressionofCsFTinmorningsamplesonthedayafterthetransferwereequivalenttothelevelofexpressionofCsFTat17H00onthedayofthetransfer.This 86

PAGE 87

mayindicatethatoralinductionisintensiedwithtimebymaintainingthelevelsofexpressionofCsFTreachedbytheendofthedayovernightandre-settingthediurnalcycleatcontinuouslyincreasinglevels.Thisresponsewasalsoobservedineld-growntreesduringthewinterof2010beforeandafterthepassingofcoldfrontsthatreducedambienttemperaturesbelowthehypotheticaloral-inductivethresholdof20C(Figure 4-7 ).Inthelattercase,coolingalsooccurredbytheendofthedayandthelowestlevelofthediurnaloscillationinCsFTexpressionwascontinuouslyshiftedinthetwodaysfollowingthedropinambienttemperatures.InC.sinensis,temperaturesrangingfrom5Ctoabout20Careconsideredtobeoral-inductive( Garca-Luisetal. 1992 ; Moss 1969 ; ValienteandAlbrigo 2004 ).Withinthisrange,temperaturesbetween10Cand15Cinduceoweringmostintensely.TotestwhethertranscriptaccumulationofCsFTissensitivetolevelsoftemperature,treeswerekeptatgrowth-promotingtemperaturesandthentransferredtoroomsatdifferentoral-inductivetemperaturesandexpressionofCsFTwasquantiedthreedayslater.Figure 4-8 showsthattheexpressionofCsFTwassensitivetolevelsoforal-inductivetemperatures.Consistentwithearlierreportsoforalinduction( Moss 1969 ),transcriptaccumulationofCsFTwashighestaftertransferto15C.Attemperatureslowerthan15CtranscriptaccumulationofCsFTwasalsoincreasedwhereastranscriptaccumulationat20Cwashigherbutnotstatisticallydifferentthantranscriptaccumulationat23C(growth-promotingnon-oral-inductive).TheseresultssupportthehypothesisofCsFTactingasaquantitativeandqualitativeintegratoroftemperature-regulatedoweringsignals.Resultsoftheexperimentsreportedinthischaptershowthatthenegativeregulationofoweringbygibberellins( Monseliseetal. 1964 )couldbeaconsequenceofreducedlevelsofexpressionofCsFT(assumedtobeaoral-promotingsignal)andreducedlevelsofexpressionoforalidentitygenesinbuds.Also,theseresultsshowthat,differentfromArabidopsis( Blazquezetal. 1998 ),gibberellinsnegativelyregulate 87

PAGE 88

theexpressionofCsLFYandCsAP1inC.sinensiswhichsupportsahypothesisfordivergingevolutionofmechanismsregulatingtheresponseofoweringgenestogibberellinsignals.Itwasalsoshownthatreducedlevelsoforalinductionassociatedwiththepresenceoffruitandcropload( Moss 1971 ; ValienteandAlbrigo 2004 ),couldbeaconsequenceofreducedexpressionofCsFTintheproximityoffruit.Eventhoughgibberellinlevelswerenotquantiedinthisstudy,higherconcentrationofendogenousgibberellinsnearfruit( Koshitaetal. 1999 )couldberelatedtothereducedlevelofexpressionofCsFTsinceapplicationofexogenousgibberellinreducetheexpressionofCsFT.Otherfactorsthathavebeenproposedaspossiblefactorsthatreducetheleveloforalinductioninfruit-bearingbranchessuchascarbohydrates( Garca-Luisetal. 1988 )andnitrogenmetabolism( Martnez-Fuentesetal. 2010 )werenottestedinthisstudy.TheresultspresentedinthischapteralsoshowthatC.sinensisrequiresalternationofcyclesoflightanddarknessfororalinduction,indicatingthatoralinductioninC.sinensisisnotinsensitivetophotoperiodsignals,butinsteadsensitivitytophotoperiodismuchreducedcomparedtootherspecies.Furthermore,themechanismregulatingoralinductioninC.sinensisseemsalsotoberegulatedbydiurnalcycleswithsensitivitytooralinductivesignalsbeinghighestintheafternoon-evening.Continuousincreaseintheleveloforalinductioncouldbeexplainedbycontinuouslyshiftingthelowestleveloftheoscillationovernight.Together,theresultspresentedinthisChapterofferdetailsabouttheregulationofowering-relatedgenesinC.sinensisbyfactorsknowntomodifytheleveloforalinduction.Someofthesefactors(i.e.gibberellinsandlight)inducecriticaldivergingresponsesinC.sinensisandthemodelArabidopsis.Thus,characterizingtheresponseofowering-relatedgenestothesefactorscouldhelpelucidatewherethedifferencesinthemechanismsregulatingoweringinC.sinensisandArabidopsiscouldbe.Inaddition,theearliestchangesintranscriptaccumulationofCsFT(assumedtobetheoral-promotingsignalinC.sinensis)inresponsetooral-inductivetemperature,were 88

PAGE 89

alsodescribedandprovideinsightsaboutthemechanismregulatingoralinductioninC.sinensis. 89

PAGE 90

Figure4-1. ExpressionofCsAP1,CsLFY,CsSL1andCsWUSinbudsof2yearold`Valencia'treestreatedwithgibberellicacidonedaybeforeoronedayaftertransferfromoral-inductivetogrowth-promotingconditions.Threesetsof3treeseachwereexposedtooral-inductivetemperatures(12C)for30days.Onthe30thdayoftheexperiment(pre-transfer)thebudsof4shootsinonesetoftreesweretreatedwith2.5lofa90ppmgibberellicacid0.5%Tween80solutionusingamicropipette.The3setsoftreeswerethentransferredtoachamberatgrowth-promotingtemperatures(23C).Onthe31stdayoftheexperiment(post-transfer),thebudsof4shootsinanothersetoftreesweretreatedwithgibberellicacidasbefore.Thebudsontheshootsofthetreesinthelastsetweretreatedwiththesamesolutionusedbeforeexceptthatthesolutiondidnotcontaingibberellicacid(Untreated).Budsampleswerecollectedonthe33rddayoftheexperiment(3daysaftertransfer).Figuresaremeansof3tree-replicatesS.E.GeneexpressionisrelativetothelevelsofeachgeneintheUntreatedbuds. 90

PAGE 91

Figure4-2. ExpressionofCsFTinleavesof2yearold`Valencia'treestreatedwithgibberellicacidduringoralinduction.Twosetsof4treeswereexposedtooral-inductivetemperatures(12C)for25days.Onday25,theleavesof4shootsinonesetoftreesweretreatedwitha90ppmgibberellicacid0.5%Tween80solutionusingacottonswab(+GA).Theleavesof4shootsintheothersetoftreesweretreatedusingasimilarsolutionwithoutgibberellicacid(Untreated).Leafdiscsfromshootsinbothsetoftreeswerecollectedbeforeapplicationofthetreatmentsandonthenextday.Figuresaremeansof4tree-replicatesS.E.GeneexpressionisrelativetothelevelsofCsFTinUntreatedleavesbeforetreatmentswereapplied. 91

PAGE 92

Figure4-3. ExpressionofCsFTinleavesof15yearold`Valencia'intheeldlocatedatdifferentdistancesfromsinglefruit.LeavesatlocatedatdifferentdistancesfromsinglefruitinthesamebranchweresampledinDecemberof2009on4branchesofthreedifferenttreesfromthesamegrove.Theleavessampledwerelocatedinshootsformedduringthepreviousyear.Thedistancetothenearestfruitwasmeasuredaddingupthelengthofindividualshootsegments(formedinprecedinggrowthcycles)separatingthefruitfromthesampledleaf.Tableontopofthegureindicatesthenumberofinorescencesthatformedinthesampledshootsinthespring.Figuresaremeansof3tree-replicatesS.E.(4shoot-subreplicates).GeneexpressionisrelativetothelevelsofCsFTinleaveslocatedinshootsat<10cmfromafruit. 92

PAGE 93

Figure4-4. ExpressionofCsFTinleavesof2yearold`Valencia'treesunderconstantlight,constantdarknessandanintermediatephotoperiod(Normalday,11hlight/13hdarkness)atoral-inductiveconditions(12C).Threesetsof3treeswereexposedfor3daystoeachofthelightregimes.Leavesweresampledbeforetransfertothegrowthroomsand3daysafter.Figuresaremeansof3tree-replicatesS.E.GeneexpressionisrelativetothelevelsofCsFTbeforethetransfer. 93

PAGE 94

Figure4-5. ExpressionofCsFTinleavesofpotted2yearold`Valencia'trees(Growthrooms)andeld-grown15yearold`Valencia'trees(Summer2010andWinter2010)atdifferenttimesduringtheday.Leafsampleswerecollectedatdifferenttimesover2daysfrom3differenttreesforeachconditionevaluated.Inthegrowthroomexperimenttreeswereexposedtoeither12or23Cconstantly,intheSummer2010(July)experiment,treeswereexposedtoeitherwaterdecitorreceivednormalirrigation,intheWinter2010(December)experimenttreesreceivednormalirrigationandwereexposedtonaturallyoccurringoral-inductivetemperatures.Dataaremeansof6tree-replicatesS.E.(2consecutivedays,3samplespertime-point).GeneexpressionisrelativetothelevelsofCsFTintherstsamplescollectedinthemorning(07H00or08H00).Black/whitehorizontalbarsatthebottomofeachgraphrepresentsthephotoperiod. 94

PAGE 95

Figure4-6. ExpressionofCsFTinleavesof3yearold`Valencia'treesaftertransfertooral-inductivetemperatures(12C).Twosetsof3treesmaintainedat23Cweretransferredeitherat07H00or15H00toagrowthroomat12C(oral-inductive).Leavesweresampledbeforetransfer,twohoursafterthetransferandonthenextday.Figuresaremeansof3tree-replicatesS.E.GeneexpressionisrelativetothelevelsofCsFTbeforethe08H00transfer. 95

PAGE 96

Figure4-7. ExpressionofCsFTinleavesofeld-grown15yearold`Valencia'treesduringthepassingofacoldfrontintheFallof2010(lledsquares).Basedonweatherforecasts,leavesweresampledtwodaysbeforeandtwodaysafterthepassingofacoldfrontthatcausedareductioninnighttemperaturesbelow20C(greyline).Leavesweresampledat08H00and15H00localstandardtime(UTC-5).Figuresaremeansof4tree-replicatesS.E.GeneexpressionisrelativetothelevelsofCsFTbeforeat08H00onOct.28. 96

PAGE 97

Figure4-8. ExpressionofCsFTinleavesof3yearold`Valencia'treesaftertransferto3oral-inductivetemperatures.Foursetsof3treeseachkeptat23Cweretransferredtogrowthroomsateither5,10or15Corkeptat23C.Leavesweresampledbeforetransfertothegrowthroomsat15H00and3daysafterthetransferatthesametime.Figuresaremeansof3tree-replicatesS.E.GeneexpressionisrelativetothelevelsofCsFTbeforethetransfer. 97

PAGE 98

CHAPTER5CONCLUSIONSTheobjectiveofmystudywastocharacterizechangesintranscriptaccumulationofC.sinensisowering-relatedgenesinresponsetotreatmentsknowntoalteroralinductionanddetermination.Figure 5-1 showsagraphicsummaryoftheconclusionsreachedfromtheresultsoftheexperimentsreportedinpreviouschapters.IfoundthattheexpressionofCsFTisup-regulatedbybothknownoral-inductivestimuliofC.sinensis,waterdecitandlowtemperatures.Up-regulationofCsFTafterexposuretolow-temperaturehadbeenreportedearlier( Nishikawaetal. 2007 )buttherehadbeennoreportsabouttheresponseofCsFT(oritsputativeorthologsinotherspecies)inresponsetooral-inductivewaterdecit.Furthermore,whenlowtemperatureandwaterdecitwerepresentatthesametime,accumulationofCsFTtranscriptswasinducedabovethelevelsobservedwheneachstimuluswaspresentseparately.This,suggeststhatCsFTcouldbeanintegratorofoweringsignalsinitiatedbybothoweringstimuliinC.sinensis.Furthermore,IalsoreportedthatexpressionofCsFTwasincreasedasthetimeunderoral-inductiveconditionsincreasedandwassensitivetolevelsoftemperature.Anothereffectofwaterdecitwastorepressup-regulationoforalidentitygenesCsAP1andCsLFYduringperiodsofwarmerweatherduringthewinter.ThisrepressionofCsAP1andCsLFYcouldkeepbudsundifferentiatedandresponsivetoadditionaloral-inductivesignalswhentemperaturesdecreaseagainlaterinthewinter.FloweringinC.sinensiscouldbeconsideredasaquantitativeresponsetolevelsoforalinductionintensity.MyresultssupportaroleforCsFTasaquantitativemarkeroforalinductionintensity.InthemodelspeciesArabidopsis,CsFT'sortholog,FT,isakeycomponentinthemechanismthatcontrolsowering( Turcketal. 2008 ).However,oweringresponsesofeachArabidopsisandC.sinensistooral-inductivestimuliintheotherspeciesdonotsupporttheexistenceofanexactcommonmechanismregulatingoweringinboth 98

PAGE 99

species( Amasino 2010 ; KrajewskyandRabe 1995 ).Consequently,itisproposedthatregulationofexpressionofCsFTinC.sinensisandFTinArabidopsishaveevolvedtorespondtodifferentenvironmentalstimuli.EvolutionofoweringcontrolmechanisminvolvingFTorthologshasbeenreportedinshort-dayrice( HayamaandCoupland 2004 ).EvenifFT-mediatedcontrolofoweringinC.sinensisandArabidopsisevolvedtorespondtodifferentenvironmentalstimuli,somecharacteristicsofthemechanismrelatedwithFTareconservedsuchasdiurnalchangesinthelevelofexpressionofCsFTandthedependenceonlighttoenableup-regulationofCsFT.CsFTexpressiondependenceoflight/darkcyclesindicatedthatalthoughnotassensitiveasArabidopsisandotherspeciesinducedtoowerbyspecicphotoperiods,oralinductioninC.sinensisisnottotallyinsensitivetophotoperiod.InadditiontoCsFT,IalsofoundthattheresponseofCsAP1andCsLFYtoexogenousgibberellinswasoppositetotheresponseofArabidopsis'AP1andLFYtosimilartreatments.Consistentwithreducedformationofinorescencesaftertheapplicationofgibberellins( Monseliseetal. 1964 ),expressionofCsAP1andCsLFY(whoseexpressionisassumedtodetermineoralidentityandinitiateoraldifferentiation)wassignicantlyreducedbytheapplicationofgibberellinstobuds.However,gibberellinapplicationinArabidopsisup-regulatestheexpressionofthesegenesandpromoteoweringundernon-oral-inductiveshortdays( Blazquezetal. 1998 ).MyresultsalsoshowthattheinhibitoryeffectofgibberellinsonthetranscriptaccumulationofCsAP1andCsLFYisgreaterbeforegrowthhasbeenstimulatedbywarmertemperatures,suggestingthatoraldeterminationandinitiationmightnotoccurwhileunderoral-inductiveconditionsandrequirethere-initiationofgrowth.ThepatternofexpressionofCsAP1andCsLFYwasmorerelatedtotheestablishmentofaoweringgradientandtheinitiationofmultipleoweringcohortsthanthepatternofexpressionofCsFT.Thissuggestedthatoweringgradientsarenotaconsequenceofbiasedproductionofoweringsignalsneartheapexbutmaybeaconsequenceof 99

PAGE 100

biaseddistributionofoweringsignalsand/oragradientinthesensitivityofbudsatdifferentpositionwithintheshoottooweringsignals.Amajorlimitationofthisstudywasthatitwasrestrictedtocharacterizetheexpressionofowering-relatedgenesatthetranscriptlevelanddidnotexploreotherlevelsofregulationoftheexpressionofthesegenes.RegulationoftheactivityofoweringgenesbeforeoraftertranscriptionisakeycomponentoftheoweringregulatorymechanismsinArabidopsisandotherspeciesinwhichthesemechanismshavebeenmorethoroughlyinvestigated( Adrianetal. 2010 ; DennisandPeacock 2007 ; Valverdeetal. 2004 ).However,regulationoftranscriptionisstillamajorfactorinthemechanismscontrollingoweringinmodelspecies,andcomparingthosepatternsoftranscriptaccumulationofowering-relatedgeneswiththoseinC.sinensisandmodelspeciescanhelpidentifywheremechanismsregulatingoweringinthesespeciesdiffer.AnotherpotentiallimitationofthisstudyisthatitreliesontheassumptionoforthologybetweengenesinC.sinensisandmodelspecies.Althoughreportsoftransgenicover-expression,Arabidopsismutantcomplementation,andexpressionpatternsdatasupportthisassumption( Endoetal. 2005 ; Kobayashietal. 1999 ; Nishikawaetal. 2007 ; Penaetal. 2001 ; Pillitterietal. 2004a ; TanandSwain 2007 ),theactivityandfunctionofthegenesusedinthisstudyhasnotbeenconrmedincitrus.Nonetheless,thisstudyprovidesusefulinformationfordevelopingmodelsofhoworalinductionandinitiationisregulatedatthegeneticlevelinC.sinensis.Someofthendingsofthisstudycouldalsoberelevanttoelucidatingtheoweringregulatorymechanismsinothercitruscultivarsandspeciesoriginatedinsubtropicalclimates. 100

PAGE 101

Figure5-1. Graphicalsummaryoftheconclusionsofthisdissertation. 101

PAGE 102

APPENDIXDESIGN,VALIDATIONANDOPTIMIZATIONOFqPCRASSAYS qPCRassaystoquantifyCsFT,CsSL1,CsAP1,CsLFYandCsWUStranscriptsinC.sinensisweredesignedfromC.sinensisandC.unshiusequencesofthesegenesavailableintheNCBI'sNucleotidedatabaseandoptimizedusingthealgorithminFigure A-2 .Foreachassay,primerpairsthatampliedproductsbetween60and200basepairs(bp)wereselected(Table A-1 ).Amplicationspecicityoftheseprimerswascheckedbyagarosegelelectrophoresis(Figure A-3A )andbygeneratingdissociationcurvesoftheampliedproductsonaAppliedBiosystems7500FASTreal-timePCRsystem(LifeTechnologies)(Figure A-3B ).Theampliedproductswerethenclonedintoavectorandsequencedtoconrmeachamplicon'sidentity.Amplicationefcienciesforeachassaywerecalculatedforeachreactionusingthesli.winfunction( RitzandSpiess 2008 )andbythedilutioncurvemethod(Figure A-4 ).ThelineardynamicrangeoftheqPCRassaysweredeterminedbythedilutioncurvemethod(Figure A-4 ).RNAwasextractedasindicatedintheMaterialsandMethodssectionofeachchapterinbatchesof30to50samples.Fromeachbatch,6sampleswererandomlyselectedtocheckRNAintegritybyelectrophoresisofglyoxylatedRNA.WhendegradationofRNAwassuspected,therestofthesamplesofthebatchwerecheckedasalreadyindicatedandthesuspecteddegradedRNAsamplesdiscarded.ReversetranscriptionreactionswererunasindicatedintheMaterialsandMethodssectionofeachchapterinbatchesof30samples.Ineachbatch,controlreactionsthatdidnotcontainreversetranscriptaseinthereactionmixwererunusing5randomlyselectedsamplestocheckforpotentialDNAcontaminationaftersubsequentamplicationbyqPCR.Noamplicationproductsweredetectedinanyofthesecontrolreactions. 102

PAGE 103

FigureA-2. Algorithmforthedesign,validationandoptimizationofqPCRassays. 103

PAGE 104

TableA-1. PrimerpairsusedfortranscriptquanticationassaysbyqPCR. TargetAmpliconlength(bp)Primers(5'!3')Reference CsFT173CGGCGGAAGGACTATGACThisdissertationTGTGAGAAAGCCAGAGAGGAAThisdissertationCsSL1120CAGCCAGAGAATCTAACAAACG TanandSwain ( 2007 )TCAGTTTTGTGGTGGTATTGCCThisdissertationCsAP1145CCCTGGAGTGCAACAACCTThisdissertationCTGATGTGTTTGAGAGCGGTThisdissertationCsLFY63TCTTGATCCAGGTCCAGAACATC Nishikawaetal. ( 2009 )TAGTCACCTTGGTTGGGCATT Nishikawaetal. ( 2009 )CsWUS143CCATGCACCAGAGACCAGThisdissertationGTCTCCCATTTGACCACCAThisdissertationCsGAPDH75GGAAGGTCAAGATCGCAATCAA Alferezetal. ( 2008 )CGTCCCTCTGCAAGATGACTCT Alferezetal. ( 2008 ) 104

PAGE 105

A BFigureA-3. AmplicationspecicityofqPCRassays.A)AgarosegelelectrophoresisofqPCRproductsofeachoftheassays.B)DissociationcurvesofqPCRproductsofeachassay. 105

PAGE 106

FigureA-4. LineardynamicrangeandamplicationefciencyofqPCRassays.Numbersaboveeachsymbolrepresentindividualreactionefciencycalculatedusingthesli.winfunctionintheqpcRRpackage( RitzandSpiess 2008 ) 106

PAGE 107

REFERENCES Abe,M.,Y.Kobayashi,S.Yamamoto,Y.Daimon,A.Yamaguchi,Y.Ikeda,H.Ichinoki,M.Notaguchi,K.Goto,andT.Araki.2005.FD,abZIPproteinmediatingsignalsfromtheoralpathwayintegratorFTattheshootapex.Science309:1052. Adrian,J.,S.Farrona,J.J.Reimer,M.C.Albani,G.Coupland,andF.Turck.2010.cis-RegulatoryelementsandchromatinstatecoordinatelycontroltemporalandspatialexpressionofFLOWERINGLOCUSTinArabidopsis.PlantCell22:1425. Aida,M.,T.Ishida,H.Fukaki,H.Fujisawa,andM.Tasaka.1997.Genesinvolvedinorganseparationinarabidopsis:Ananalysisofthecup-shapedcotyledonmutant.PlantCell9:841. Albani,M.C.andG.Coupland.2010.Comparativeanalysisofoweringinannualandperennialplants.In:M.C.Timmermans(ed.)PlantDevelopment,volumeVolume91,pp.323.AcademicPress. Albrigo,L..1999.EffectsoffoliarapplicationsofureaornutriphiteonoweringandyieldsofValenciaorangetrees.Proc.Fla.StateHort.Soc.112:1. Albrigo,L.G.,H.W.Beck,andJ.I.Valiente.2006a.Testingaoweringexpertsystemforthe'DecisionInformationSystemforCitrus'.ActaHort.707:17. Albrigo,L.G.andV.Galen-Sauco.2004.Flowerbudinduction,oweringandfruit-setofsometropicalandsubtropicalfruittreecropswithspecialreferencetocitrus.ActaHorticulturae632:81. Albrigo,L.G.,J.I.Valiente,andH.W.Beck.2002.Floweringexpertsystemdevelopmentforaphenologybasedcitrusdecisionsupportsystem.ActaHorticulturae584:247. Albrigo,L.G.,J.I.Valiente,andC.VanParysdeWit.2006b.Inuenceofwinterandspringweatheronyear-to-yearcitrusfruitsetandyieldvariationinsaopaulo,brazil.In:A.El-Otmani,M;Ait-Oubahou(ed.)ProceedingsoftheInternationalSocietyofCitriculture,volume1,pp.263.Agadir,Morocco. Alferez,F.,Y.Lluch,andJ.K.Burns.2008.PhospholipaseA2andpostharvestpeelpittingincitrusfruit.PostharvestBiologyandTechnology49:69. Ali,A.andC.Lovatt.1995.Relationshipofpolyaminestolow-temperaturestress-inducedoweringoftheWashingtonnavelorange(CitrusSinensisL.Osbeck).JournalofHorticulturalScience&Biotechnology70:491. Ali,A.G.andC.J.Lovatt.1994.Winterapplicationoflow-biuretureatothefoliageof`Washington'navelorangeincreasedyield.J.Amer.Soc.Hort.Sci.119:1144. Alvarez,J.,C.L.Guli,X.-H.Yu,andD.R.Smyth.1992.terminalower:ageneaffectinginorescencedevelopmentinArabidopsisthaliana.ThePlantJournal2:103. 107

PAGE 108

Amasino,R..2010.Seasonalanddevelopmentaltimingofowering.ThePlantJournal61:1001. An,H.,C.Roussot,P.Suarez-Lopez,L.Corbesier,C.Vincent,M.Pineiro,S.Hepworth,A.Mouradov,S.Justin,C.Turnbull,andG.Coupland.2004.CONSTANSactsinthephloemtoregulateasystemicsignalthatinducesphotoperiodicoweringofArabidopsis.Development131:3615. Araki,T..2001.Transitionfromvegetativetoreproductivephase.CurrentOpinioninPlantBiology4:63. Balasubramanian,S.,S.Sureshkumar,J.Lempe,andD.Weigel.2006.PotentinductionofArabidopsisthalianaoweringbyelevatedgrowthtemperature.PLoSGenetics2:e106. Barton,M.K.andR.S.Poethig.1993.FormationoftheshootapicalmeristeminArabidopsisthaliana:ananalysisofdevelopmentinthewildtypeandintheshootmeristemlessmutant.Development119:823. Baurle,I.andC.Dean.2008.DifferentialinteractionsoftheautonomouspathwayRRMproteinsandchromatinregulatorsinthesilencingofarabidopsistargets.PLoSONE3:e2733. Benlloch,R.,A.Berbel,A.Serrano-Mislata,andF.Madueo.2007.Floralinitiationandinorescencearchitecture:Acomparativeview.AnnalsofBotany100:659. Berardini,T.Z.,K.Bollman,H.Sun,andR.ScottPoethig.2001.RegulationofvegetativephasechangeinArabidopsisthalianabycyclophilin40.Science291:2405. Blazquez,M.,C.Ferrandiz,F.Madueno,andF.Parcy.2006.Howoralmeristemsarebuilt.PlantMolecularBiology60:855. Blazquez,M.A.,J.H.Ahn,andD.Weigel.2003.AthermosensorypathwaycontrollingoweringtimeinArabidopsisthaliana.NatureGenetics33:168. Blazquez,M.A.,R.Green,O.Nilsson,M.R.Sussman,andD.Weigel.1998.GibberellinspromoteoweringofarabidopsisbyactivatingtheLEAFYpromoter.PlantCell10:791. Blazquez,M.A.andD.Weigel.1999.Independentregulationofoweringbyphytochromebandgibberellinsinarabidopsis.PlantPhysiol.120:1025. Boss,P.K.,R.M.Bastow,J.S.Mylne,andC.Dean.2004.Multiplepathwaysinthedecisiontoower:Enabling,promoting,andresetting.PlantCell16:S18. Bowman,J.,H.Sakai,T.Jack,D.Weigel,U.Mayer,andE.Meyerowitz.1992.SUPER-MAN,aregulatoroforalhomeoticgenesinArabidopsis.Development114:599. 108

PAGE 109

Bowman,J.andD.Smyth.1999.CRABSCLAW,agenethatregulatescarpelandnectarydevelopmentinArabidopsis,encodesanovelproteinwithzincngerandhelix-loop-helixdomains.Development126:2387. Bowman,J.,D.Smyth,andE.Meyerowitz.1991.Geneticinteractionsamongoralhomeoticgenesofarabidopsis.Development112:1. Bowman,J.L.andY.Eshed.2000.Formationandmaintenanceoftheshootapicalmeristem.TrendsPlantSci5:110. Bradley,D.,O.Ratcliffe,C.Vincent,R.Carpenter,andE.Coen.1997.Inorescencecommitmentandarchitectureinarabidopsis.Science275:80. Brand,U.,J.C.Fletcher,M.Hobe,E.M.Meyerowitz,andR.Simon.2000.DependenceofstemcellfateinArabidopsisonafeedbackloopregulatedbyCLV3activity.Science289:617. Brunner,A.M.andO.Nilsson.2004.Revisitingtreematurationandoralinitiationinthepoplarfunctionalgenomicsera.NewPhytologist164:43. Bull-Herenu,K.andR.Claen-Bockhoff.2011.Openandclosedinorescences:morethansimpleopposites.JournalofExperimentalBotany62:79. Carles,C.C.,K.Lertpiriyapong,K.Reville,andJ.C.Fletcher.2004.TheULTRA-PETALA1genefunctionsearlyinArabidopsisdevelopmenttorestrictshootapicalmeristemactivityandactsthroughWUSCHELtoregulateoralmeristemdeterminacy.Genetics167:1893. Carraro,N.,A.Peaucelle,P.Laufs,andJ.Traas.2006.Celldifferentiationandorganinitiationattheshootapicalmeristem.PlantMolecularBiology60:811. Cassin,J.,J.Bourdeuet,A.Fougue,V.Furon,J.P.Gailland,J.Bourdelles,G.Montaguad,andC.Moreuil.1969.Theinuenceofclimateuponthebloomingofcitrusintropicalareas.In:H.D.Chapman(ed.)ProceedingsoftheFirstInternationalCitrusSymposium,volume1,pp.315.Riverside,California(USA). Chateld,S.P.,P.Stirnberg,B.G.Forde,andO.Leyser.2000.ThehormonalregulationofaxillarybudgrowthinArabidopsis.ThePlantJournal24:159. Chica,E..2007.StudiesonSomeFactorsAffectingFlowerBudInductioninSweetOrange(CitrussinensisOsbeck):Cold,DroughtandRemovalofTerminalBuds.UniversityofFlorida,Gainesville.Master'sthesis. Chica,E.J.andL.G.Albrigo.2011.Stimulatingoweringinbasalbudsofsweetorangesummershootsbyremovalofterminalbudsearlyintheowerbudinductionperiod.Proc.Fla.StateHort.Soc.(Accepted). 109

PAGE 110

Chuck,G.,A.M.Cigan,K.Saeteurn,andS.Hake.2007.TheheterochronicmaizemutantCorngrass1resultsfromoverexpressionofatandemmicroRNA.NatGenet39:544. Clark,S.,S.Jacobsen,J.Levin,andE.Meyerowitz.1996.TheCLAVATAandSHOOTMERISTEMLESSlocicompetitivelyregulatemeristemactivityinArabidopsis.Development122:1567. Clark,S.,M.Running,andE.Meyerowitz.1993.CLAVATA1,aregulatorofmeristemandowerdevelopmentinArabidopsis.Development119:397. Clark,S.E.,M.P.Running,andE.M.Meyerowitz.1995.CLAVATA3isaspecicregulatorofshootandoralmeristemdevelopmentaffectingthesameprocessesasCLAVATA1.Development121:2057. Clark,S.E.,R.W.Williams,andE.M.Meyerowitz.1997.TheCLAVATA1geneencodesaputativereceptorkinasethatcontrolsshootandoralmeristemsizeinArabidopsis.Cell89:575. Coen,E.S.andR.Carpenter.1993.Themetamorphosisofowers.PlantCell5:1175. Coen,E.S.andE.M.Meyerowitz.1991.Thewarofthewhorls:geneticinteractionscontrollingowerdevelopment.Nature353:31. Conti,L.andD.Bradley.2007.Terminalower1isamobilesignalcontrollingarabidopsisarchitecture.PlantCell19:767.10.1105/tpc.106.049767. Cooper,W.C.andA.Peynado.1958.Effectofgibberellicacidongrowthanddormancyincitrus.ProceedingsoftheAmericanSocietyforHorticulturalScience72:284. Corbesier,L.,C.Vincent,S.Jang,F.Fornara,Q.Fan,I.Searle,A.Giakountis,S.Farrona,L.Gissot,C.Turnbull,andG.Coupland.2007.FTproteinmovementcontributestolong-distancesignalinginoralinductionofArabidopsis.Science316:1030. Davies,C.R.andP.F.Wareing.1965-06-01.Auxin-directedtransportofradiophosphorusinstems.Planta65:139. Davies,F.S.andL.G.Albrigo.1994.Citrus.CABInternational,Wallingford,U.K. Day,M.E.,M.S.Greenwood,andC.Diaz-Sala.2002.Age-andsize-relatedtrendsinwoodyplantshootdevelopment:regulatorypathwaysandevidenceforgeneticcontrol.TreePhysiology22:507. Dennis,E.andW.Peacock.2007.Epigeneticregulationofowering.CurrentOpinioninPlantBiology10:520. 110

PAGE 111

Elliott,R.C.,A.S.Betzner,E.Huttner,M.P.Oakes,W.Tucker,D.Gerentes,P.Perez,andD.R.Smyth.1996.AINTEGUMENTA,anAPETALA2-likegeneofArabidopsiswithpleiotropicrolesinovuledevelopmentandoralorgangrowth.PlantCell8:155. Endo,T.,T.Shimada,H.Fujii,Y.Kobayashi,T.Araki,andM.Omura.2005.EctopicexpressionofanFThomologfromcitrusconfersanearlyoweringphenotypeontrifoliateorange(PoncirustrifoliataL.Raf.).TransgenicResearch14:703. Esau,K..1977.AnatomyofSeedPlants.JohnWileyandSons,2ndedition. Everat-Bourbouloux,A.andJ.-L.Bonnemain.1980.Distributionoflabelledauxinandderivativesinstemtissuesofintactanddecapitatedbroad-beanplantsinrelationtoapicaldominance.PhysiologiaPlantarum50:145. Flanagan,C.andH.Ma.1994.SpatiallyandtemporallyregulatedexpressionoftheMADS-boxgeneAGL2inwild-typeandmutantarabidopsisowers.PlantMolecularBiology26:581. Fletcher,J.C.,U.Brand,M.P.Running,R.Simon,andE.M.Meyerowitz.1999.SignalingofcellfatedecisionsbyCLAVATA3inArabidopsisshootmeristems.Science283:1911. Gallois,J.-L.,C.Woodward,G.V.Reddy,andR.Sablowski.2002.CombinedSHOOTMERISTEMLESSandWUSCHELtriggerectopicorganogenesisinArabidopsis.Development129:3207. Gandikota,M.,R.P.Birkenbihl,S.Hhmann,G.H.Cardon,H.Saedler,andP.Huijser.2007.ThemiRNA156/157recognitionelementinthe3'UTRofthearabidopsisSBPboxgeneSPL3preventsearlyoweringbytranslationalinhibitioninseedlings.ThePlantJournal49:683. Garca-Luis,A.,V.Almela,C.Monerri,M.Agusti,andJ.L.Guardiola.1986.InhibitionofoweringinvivobyexistingfruitsandappliedgrowthregulatorsinCitrusunshiu.PhysiologiaPlantarum66:515. Garca-Luis,A.,F.Fornes,A.Sanz,andJ.Guardiola.1988.Theregulationofoweringandfruitsetincitrus:relationshipwithcarbohydratelevels.IsraelJournalofBotany37:189. Garca-Luis,A.,M.Kanduser,P.Santamarina,andJ.L.Guardiola.1992.Lowtemperatureinuenceonoweringincitrus.Theseparationofinductiveandbuddormancyreleasingeffects.PhysiologiaPlantarum86:648. Geldner,N.,J.Friml,Y.-D.Stierhof,G.Jurgens,andK.Palme.2001.AuxintransportinhibitorsblockPIN1cyclingandvesicletrafcking.Nature413:425. Gendall,A.R.,Y.Y.Levy,A.Wilson,andC.Dean.2001.TheVERNALIZATION2genemediatestheepigeneticregulationofvernalizationinArabidopsis.Cell107:525. 111

PAGE 112

Gifford,J.,ErnestM..andJ.Corson,GeorgeE..1971.Theshootapexinseedplants.BotanicalReview37:143. Gmitter,F.andX.Hu.1990.ThepossibleroleofYunnan,China,intheoriginofcontemporarycitrusspecies(Rutaceae).EconomicBotany44:267. Goldschmidt,E.,N.Aschkenazi,Y.Herzano,A.Schaffer,andS.Monselise.1985.Aroleforcarbohydratelevelsinthecontrolofoweringincitrus.ScientiaHorticulturae26:159166. Goldschmidt,E.E.andA.Golomb.1982.Thecarbohydratebalanceofalternate-bearingcitrustreesandthesignicanceofreservesforoweringandfruiting.J.Amer.Soc.Hort.Sci.107:206. Greenwood,M.S.,M.E.Day,andJ.Schatz.2010.Separatingtheeffectsoftreesizeandmeristemmaturationonshootdevelopmentofgraftedscionsofredspruce(PicearubensSarg.).TreePhysiology30:459. Guardiola,J.L.,C.Monerri,andM.Agusti.1982.Theinhibitoryeffectofgibberellicacidonoweringincitrus.PhysiologiaPlantarum55:136. Halliday,K.J.,M.G.Salter,E.Thingnaes,andG.C.Whitelam.2003.PhytochromecontrolofoweringistemperaturesensitiveandcorrelateswithexpressionoftheoralintegratorFT.ThePlantJournal33:875. Havelange,A.,P.Lejeune,G.Bernier,R.Kaur-Sawhney,andA.W.Galston.1996.PutrescineexportfromleavesinrelationtooraltransitioninSinapisalba.PhysiologiaPlantarum96:59. Hayama,R.andG.Coupland.2004.Themolecularbasisofdiversityinthephotoperiodicoweringresponsesofarabidopsisandrice.PlantPhysiol.135:677. He,Y.,S.D.Michaels,andR.M.Amasino.2003.Regulationofoweringtimebyhistoneacetylationinarabidopsis.Science302:1751. Helliwell,C.A.,C.C.Wood,M.Robertson,W.JamesPeacock,andE.S.Dennis.2006.ThearabidopsisFLCproteininteractsdirectlyinvivowithSOC1andFTchromatinandispartofahigh-molecular-weightproteincomplex.ThePlantJournal46:183. Hempel,F.,D.Weigel,M.Mandel,G.Ditta,P.Zambryski,L.Feldman,andM.Yanofsky.1997.FloraldeterminationandexpressionoforalregulatorygenesinArabidopsis.Development124:3845. Hempel,F.D.,D.R.Welch,andL.J.Feldman.2000.Floralinductionanddetermination:whereisoweringcontrolled?TrendsinPlantScience5:17. 112

PAGE 113

Hepworth,S.R.,F.Valverde,D.Ravenscroft,A.Mouradov,andG.Coupland.2002.Antagonisticregulationofowering-timegeneSOC1byCONSTANSandFLCviaseparatepromotermotifs.EMBOJ21:4327. Hisamatsu,T.andR.W.King.2008.Thenatureoforalsignalsinarabidopsis.ii.rolesforoweringlocust(ft)andgibberellin.J.Exp.Bot59:3821.10.1093/jxb/ern232. Hsu,C.-Y.,Y.Liu,D.S.Luthe,andC.Yuceer.2006.PoplarFT2shortensthejuvenilephaseandpromotesseasonalowering.PlantCell18:1846. Huang,C.-K.,B.-S.Chang,K.-C.Wang,S.-J.Her,T.-W.Chen,Y.-A.Chen,C.-L.Cho,L.-J.Liao,K.-L.Huang,W.-S.Chen,andZ.-H.Liu.2004.ChangesinpolyaminepatternareinvolvedinoralinitiationanddevelopmentinPolianthestuberosa.JournalofPlantPhysiology161:709. Hunter,C.,H.Sun,andR.Poethig.2003.ThearabidopsisheterochronicgeneZIPPYisanARGONAUTEfamilymember.CurrentBiology13:1734. Imaizumi,T.andS.A.Kay.2006.Photoperiodiccontrolofowering:notonlybycoincidence.TrendsinPlantScience11:550. Jack,T..2001.RelearningourABCs:newtwistsonanoldmodel.TrendsinPlantScience6:310. Jones,C.S..1999.Anessayonjuvenility,phasechange,andheteroblastyinseedplants.InternationalJournalofPlantSciences160:S105S111. Kim,D.-H.,M.R.Doyle,S.Sung,andR.M.Amasino.2009.Vernalization:Winterandthetimingofoweringinplants.Annu.Rev.CellDev.Biol.25:277. Kim,H.-J.,Y.Hyun,J.-Y.Park,M.-J.Park,M.-K.Park,M.D.Kim,H.-J.Kim,M.H.Lee,J.Moon,I.Lee,andJ.Kim.2004.AgeneticlinkbetweencoldresponsesandoweringtimethroughFVEinArabidopsisthaliana.NatureGenetics36:167. Kim,S.-G.,S.-Y.Kim,andC.-M.Park.2007.Amembrane-associatedNACtranscriptionfactorregulatessalt-responsiveoweringviaFLOWERINGLOCUSTinArabidopsis.Planta226:647. Kobayashi,Y.,H.Kaya,K.Goto,M.Iwabuchi,andT.Araki.1999.Apairofrelatedgeneswithantagonisticrolesinmediatingoweringsignals.Science286:1960. Kojima,S.,Y.Takahashi,Y.Kobayashi,L.Monna,T.Sasaki,T.Araki,andM.Yano.2002.Hd3a,ariceorthologoftheArabidopsisFTgene,promotestransitiontooweringdownstreamofHd1undershort-dayconditions.PlantCellPhysiol.43:1096. Komeda,Y..2004.GeneticregulationoftimetoowerinArabidopsisthaliana.AnnualReviewofPlantBiology55:521. 113

PAGE 114

Koshita,Y.,T.Takahara,T.Ogata,andA.Goto.1999.Involvementofendogenousplanthormones(IAA,ABA,GAs)inleavesandowerbudinductionofSatsumamandarin(CitrusunshiuMarc.).ScientiaHorticulturae26:185. Krajewsky,A.andE.Rabe.1995.Citrusowering:acriticalevaluation.J.Hort.Sci.70:357. Krizek,B.A.,V.Prost,andA.Macias.2000.AINTEGUMENTApromotespetalidentityandactsasanegativeregulatorofAGAMOUS.PlantCell12:1357. Laufs,P.,O.Grandjean,C.Jonak,K.Kieu,andJ.Traas.1998.CellularparametersoftheshootapicalmeristeminArabidopsis.PlantCell10:1375. Laux,T.,K.Mayer,J.Berger,andG.Jurgens.1996.TheWUSCHELgeneisrequiredforshootandoralmeristemintegrityinArabidopsis.Development122:87. Laux,T.andK.F.X.Mayer.1998.Cellfateregulationintheshootmeristem.SeminarsinCell&DevelopmentalBiology9:195. Lawson,E.J.andR.S.Poethig.1995.Shootdevelopmentinplants:timeforachange.TrendsinGenetics11:263. Lee,H.,S.-S.Suh,E.Park,E.Cho,J.H.Ahn,S.-G.Kim,J.S.Lee,Y.M.Kwon,andI.Lee.2000.TheAGAMOUS-LIKE20MADSdomainproteinintegratesoralinductivepathwaysinArabidopsis.GenesandDevelopment14:2366. Lee,J.andI.Lee.2010.RegulationandfunctionofSOC1,aoweringpathwayintegrator.JournalofExperimentalBotany61:2247. Lee,J.-Y.,S.F.Baum,J.Alvarez,A.Patel,D.H.Chitwood,andJ.L.Bowman.2005.ActivationofCRABSCLAWinthenectariesandcarpelsofArabidopsis.PlantCell17:25. Lenhard,M.,A.Bohnert,G.Jurgens,andT.Laux.2001.TerminationofstemcellmaintenanceinarabidopsisoralmeristemsbyinteractionsbetweenWUSCHELandAGAMOUS.Cell105:805. Lenhard,M.,G.Jrgens,andT.Laux.2002.TheWUSCHELandSHOOTMERISTEM-LESSgenesfullcomplementaryrolesinArabidopsisshootmeristemregulation.Development129:3195. Lenhard,M.andT.Laux.1999.Shootmeristemformationandmaintenance.CurrentOpinioninPlantBiology2:44. Levy,Y.Y.,S.Mesnage,J.S.Mylne,A.R.Gendall,andC.Dean.2002.MultiplerolesofArabidopsisVRN1invernalizationandoweringtimecontrol.Science297:243. Leyser,O.H.M.andI.J.Furner.1992.CharacterisationofthreeshootapicalmeristemmutantsofArabidopsisthaliana.Development116:397. 114

PAGE 115

Li,Z.-M.,J.-Z.Zhang,L.Mei,X.-X.Deng,C.-G.Hu,andJ.-L.Yao.2010.PtSVP,anSVPhomologfromtrifoliateorange(Poncirustrifoliatal.raf.),showsseasonalperiodicityofmeristemdeterminationandaffectsowerdevelopmentintransgenicArabidopsisandtobaccoplants.PlantMolecularBiologypp.1. Liljegren,S.J.,C.Gustafson-Brown,A.Pinyopich,G.S.Ditta,andM.F.Yanofsky.1999.InteractionsamongAPETALA1,LEAFY,andTERMINALFLOWER1specifymeristemfate.PlantCell11:1007. Lohmann,J.U.,R.L.Hong,M.Hobe,M.A.Busch,F.Parcy,R.Simon,andD.Weigel.2001.Amolecularlinkbetweenstemcellregulationandoralpatterninginarabidopsis.Cell105:793. Long,J.A.,E.I.Moan,J.I.Medford,andM.K.Barton.1996.AmemberoftheKNOTTEDclassofhomeodomainproteinsencodedbytheSTMgeneofArabidopsis.Nature379:66. Longman,K.A.andP.F.Wareing.1959.Earlyinductionofoweringinbirchseedlings.Nature184:2037. Lord,E.M.andK.J.Eckard.1987.ShootdevelopmentinCitrussinensisl.(washingtonnavelorange).ii.alterationofdevelopmentalfateofoweringshootsafterga3treatment.BotanicalGazette148:17. Lovatt,C.,O.Sagee,andA.Ali.1992.Ammoniaand/oritsmetabolitesinuenceowering,fruitset,andyieldoftheWashingtonnavelorange.In:Proc.Intl.Soc.Citricult,volume1,pp.412. Lovatt,C.,Y.Zheng,andK.Hake.1988.Demonstrationofachangeinnitrogenmetabolisminuencingowerinitiationincitrus.IsraelJournalofBotany37:181. Macknight,R.,I.Bancroft,T.Page,C.Lister,R.Schmidt,K.Love,L.Westphal,G.Murphy,S.Sherson,C.Cobbett,andC.Dean.1997.FCA,agenecontrollingoweringtimeinarabidopsis,encodesaproteincontainingRNA-bindingdomains.Cell89:737. Mandel,M.A.andM.Yanofsky.1995.Agenetriggeringowerformationinarabidopsis.Nature377:522. Mandel,M.A.andM.F.Yanofsky.1998.TheArabidopsisAGL9MADSboxgeneisexpressedinyoungowerprimordia.SexualPlantReproduction11:22. Martnez-Fuentes,A.,C.Mesejo,C.Reig,andM.Agust.2010.TimingoftheinhibitoryeffectoffruitonreturnbloomofValenciasweetorange(Citrussinensis(L.)Osbeck).J.Sci.FoodAgric.90:1936. Martnez-Zapater,J.M.,J.A.Jarillo,M.Cruz-Alvarez,M.Roldan,andJ.Salinas.1995.Arabidopsislate-oweringfvemutantsareaffectedinbothvegetativeandreproductivedevelopment.ThePlantJournal7:543. 115

PAGE 116

Mathieu,J.,N.Warthmann,F.Kuttner,andM.Schmid.2007.ExportofftproteinfromphloemcompanioncellsissufcientfororalinductioninArabidopsis.CurrentBiology17:1055. Matsuda,N.,K.Ikeda,M.Kurosaka,T.Takashina,K.Isuzugawa,T.Endo,andM.Omura.2009.Earlyoweringphenotypeintransgenicpears(Pyruscommu-nisl.)expressingtheCiFTgene.JournaloftheJapaneseSocietyforHorticulturalScience78:410. Mayer,K.F.,H.Schoof,A.Haecker,M.Lenhard,G.Jurgens,andT.Laux.1998.RoleofWUSCHELinregulatingstemcellfateintheArabidopsisshootmeristem.Cell95:805. McCutchan,H.andK.Shackel.1992.Stemwaterpotentialasasensitiveindicatorofwaterstressinprunetrees(PrunusdomesticaL.cv.French).JournaloftheAmericanSocietyforHorticulturalScience117:607. McDaniel,C..1980.InuenceofleavesandrootsonmeristemdevelopmentinNicotianatabacumL.cv.Wisconsin38.Planta148:462. McDaniel,C.N.,S.R.Singer,andS.M.E.Smith.1992.Developmentalstatesassociatedwiththeoraltransition.DevelopmentalBiology153:59. Meinke,D.W.,J.M.Cherry,andM.Koornneef.1998.Arabidopsisthaliana.TrendsinGenetics14:S.24S.25. Michaels,S.D.andR.M.Amasino.1999.FLOWERINGLOCUSCencodesanovelMADSdomainproteinthatactsasarepressorofowering.PlantCell11:949. Michaels,S.D.andR.M.Amasino.2001.LossofFLOWERINGLOCUSCactivityeliminatesthelate-oweringphenotypeofFRIGIDAandautonomouspathwaymutationsbutnotresponsivenesstovernalization.ThePlantCell13:935. Michaels,S.D.,E.Himelblau,S.Y.Kim,F.M.Schomburg,andR.M.Amasino.2005.Integrationofoweringsignalsinwinter-annualarabidopsis.PlantPhysiol.137:149. Ming,F.andH.Ma.2009.Aterminatoroforalstemcells.Genes&Development23:1705. Mizukami,Y.andH.Ma.1995.SeparationofAGfunctioninoralmeristemdeterminacyfromthatinreproductiveorganidentitybyexpressingantisenseAGrna.PlantMolecularBiology28:767. Monselise,S.P.,R.Goren,andA.Halevy.1964.Chemicalinhibitionandpromotionofcitrusowerbudinduction.ProceedingsoftheAmericanSocietyforHorticulturalScience84:141. 116

PAGE 117

Moon,J.,H.Lee,M.Kim,andI.Lee.2005.Analysisofoweringpathwayintegratorsinarabidopsis.PlantandCellPhysiology46:292.10.1093/pcp/pci024. Moss,G.I..1969.Inuenceoftemperatureandphotoperiodonowerinductionandinorescencedevelopmentinsweetorange(Citrussinensisl.osbeck).JournalofHorticulturalResearch44:311. Moss,G.I..1971.Effectoffruitonoweringinrelationtobiennialbearinginsweetorange(Citrussinensis).JournalofHorticulturalScience46:177. Moussian,B.,H.Schoof,A.Haecker,G.Jurgens,andT.Laux.1998.RoleoftheZWILLEgeneintheregulationofcentralshootmeristemcellfateduringarabidopsisembryogenesis.EMBOJ17:1799. Mutasa-Gottgens,E.andP.Hedden.2009.Gibberellinasafactorinoralregulatorynetworks.JournalofExperimentalBotany60:1979. Nebauer,S.G.,C.Avila,A.Garca-Luis,andJ.L.Guardiola.2006.Seasonalvariationinthecompetenceofthebudsofthreecultivarsfromdifferentcitrusspeciestoower.Trees20:507. Niedergang-Kamien,E.andF.Skoog.1956.Studiesonpolarityandauxintransportinplants1,2.PhysiologiaPlantarum9:60. Nishikawa,F.,T.Endo,T.Shimada,H.Fujii,T.Shimizu,Y.Kobayashi,T.Araki,andM.Omura.2010.TranscriptionalchangesinCiFT-introducedtransgenictrifoliateorange(PoncirustrifoliataL.Raf.).TreePhysiol.30:431. Nishikawa,F.,T.Endo,T.Shimada,H.Fujii,T.Shimizu,andM.Omura.2009.DifferencesinseasonalexpressionofoweringgenesbetweendeciduoustrifoliateorangeandevergreenSatsumamandarin.TreePhysiol29:921. Nishikawa,F.,T.Endo,T.Shimada,H.Fujii,T.Shimizu,M.Omura,andY.Ikoma.2007.IncreasedCiFTabundanceinthestemcorrelateswithoralinductionbylowtemperatureinSatsumamandarin(CitrusunshiuMarc.).JournalofExperimentalBotany58:3915. Noh,B.,S.-H.Lee,H.-J.Kim,G.Yi,E.-A.Shin,M.Lee,K.-J.Jung,M.R.Doyle,R.M.Amasino,andY.-S.Noh.2004.DivergentrolesofapairofhomologousJumonji/Zinc-Finger-Classtranscriptionfactorproteinsintheregulationofarabidopsisoweringtime.PlantCell16:2601. Olivera,C.andG.Browning.1993.StudiesontheinductionofoweringinjuvenilePrunusAviumL..JournalofHorticulturalScience&Biotechnology68:731739. Otsuga,D.,B.DeGuzman,M.J.Prigge,G.N.Drews,andS.E.Clark.2001.REVO-LUTAregulatesmeristeminitiationatlateralpositions.ThePlantJournal25:223. 117

PAGE 118

Parcy,F.,K.Bomblies,andD.Weigel.2002.InteractionofLEAFY,AGAMOUSandTER-MINALFLOWER1inmaintainingoralmeristemidentityinArabidopsis.Development129:2519. Parcy,F.,O.Nilsson,M.A.Busch,I.Lee,andD.Weigel.1998.Ageneticframeworkfororalpatterning.Nature395:561. Patrick,J.W.andK.H.Steains.1987.Auxin-promotedtransportofmetabolitesinstemsofPhaseolusvulgarisl.:Auxindose-responsecurvesandeffectsofinhibitorsofpolarauxintransport.JournalofExperimentalBotany38:203. Pena,L.,M.Martin-Trillo,J.Juarez,J.A.Pina,L.Navarro,andJ.M.Martinez-Zapater.2001.ConstitutiveexpressionofarabidopsisLEAFYorAPETALA1genesincitrusreducestheirgenerationtime.NatBiotech19:263. Pelaz,S.,G.S.Ditta,E.Baumann,E.Wisman,andM.F.Yanofsky.2000.BandCoralorganidentityfunctionsrequireSEPALLATAMADS-boxgenes.Nature405:200. Peragine,A.,M.Yoshikawa,G.Wu,H.L.Albrecht,andR.S.Poethig.2004.SGS3andSGS2/SDE1/RDR6arerequiredforjuveniledevelopmentandtheproductionoftrans-actingsiRNAsinArabidopsis.Genes&Development18:2368. Pfaf,M.W..2001.Anewmathematicalmodelforrelativequanticationinreal-timeRT-PCR.Nucl.AcidsRes.29:e45. Pillitteri,L.J.,C.J.Lovatt,andL.L.Walling.2004a.IsolationandcharacterizationofaTERMINALFLOWERhomologanditscorrelationwithjuvenilityincitrus.PlantPhysiology135:1540. Pillitteri,L.J.,C.J.Lovatt,andL.L.Walling.2004b.IsolationandcharacterizationofLEAFYandAPETALA1homologuesfromCitrussinensisL.Osbeck'Washington'.JournaloftheAmericanSocietyforHorticulturalScience129:846. Poethig,R.S..1990.Phasechangeandtheregulationofshootmorphogenesisinplants.Science250:923. Poethig,R.S..2003.Phasechangeandtheregulationofdevelopmentaltiminginplants.Science301:334. Prunet,N.,P.Morel,A.-M.Thierry,Y.Eshed,J.L.Bowman,I.Negrutiu,andC.Trehin.2008.REBELOTE,SQUINT,andULTRAPETALA1functionredundantlyinthetemporalregulationoforalmeristemterminationinArabidopsisthaliana.PlantCell20:901. Putterill,J.,R.Laurie,andR.Macknight.2004.It'stimetoower:thegeneticcontrolofoweringtime.Bioessays26:363. 118

PAGE 119

RDevelopmentCoreTeam.2011.R:ALanguageandEnvironmentforStatisticalComputing.RFoundationforStatisticalComputing,Vienna,Austria.ISBN3-900051-07-0. Ratcliffe,O.,I.Amaya,C.Vincent,S.Rothstein,R.Carpenter,E.Coen,andD.Bradley.1998.Acommonmechanismcontrolsthelifecycleandarchitectureofplants.Development125:1609. Ratcliffe,O.,D.Bradley,andE.Coen.1999.Separationofshootandoralidentityinarabidopsis.Development126:1109. Ratcliffe,O.J.,R.W.Kumimoto,B.J.Wong,andJ.L.Riechmann.2003.AnalysisofthearabidopsisMADSAFFECTINGFLOWERINGgenefamily:MAF2preventsvernalizationbyshortperiodsofcold.PlantCell15:1159. Reddy,G.V.,M.G.Heisler,D.W.Ehrhardt,andE.M.Meyerowitz.2004.Real-timelineageanalysisrevealsorientedcelldivisionsassociatedwithmorphogenesisattheshootapexofArabidopsisthaliana.Development131:4225. Reddy,G.V.andE.M.Meyerowitz.2005.Stem-cellhomeostasisandgrowthdynamicscanbeuncoupledintheArabidopsisshootapex.Science310:663. Ritz,C.andA.N.Spiess.2008.qpcR:anRpackageforsigmoidalmodelselectioninquantitativereal-timepolymerasechainreactionanalysis.Bioinformatics24:1549. Ruiz-Garcia,L.,F.Madueno,M.Wilkinson,G.Haughn,J.Salinas,andJ.M.Martinez-Zapater.1997.Differentrolesofowering-timegenesintheactivationoforalinitiationgenesinarabidopsis.PlantCell9:1921. Sablowski,R..2007.FloweringanddeterminacyinArabidopsis.JournalofExperimentalBotany58:899. Samach,A.,H.Onouchi,S.E.Gold,G.S.Ditta,Z.Schwarz-Sommer,M.F.Yanofsky,andG.Coupland.2000.DistinctrolesofCONSTANStargetgenesinreproductivedevelopmentofArabidopsis.Science288:1613. Sauer,M.R..1954.Floweringinthesweetorange.AustralianJournalofAgriculturalResearch5:649. Savidge,B.,S.D.Rounsley,andM.F.Yanofsky.1995.TemporalrelationshipbetweenthetranscriptionoftwoarabidopsisMADSboxgenesandtheoralorganidentitygenes.PlantCell7:721. Scholander,P.F.,A.D.Hammel,A.D.Bradstreet,andE.A.Hemmingsen.1965.Sappressureinvascularplants.Science148:339. 119

PAGE 120

Schomburg,F.M.,D.A.Patton,D.W.Meinke,andR.M.Amasino.2001.FPA,ageneinvolvedinoralinductioninArabidopsis,encodesaproteincontainingRNA-recognitionmotifs.PlantCell13:1427. Schultz,E.A.andG.W.Haughn.1993.Geneticanalysisoftheoralinitiationprocess(FLIP)inarabidopsis.Development119:745. Schultz,E.A.,F.B.Pickett,andG.W.Haughn.1991.TheFLO10geneproductregulatestheexpressiondomainofhomeoticgenesAP3andPIinArabidopsisowers.PlantCell3:1221. Schwab,R.,J.F.Palatnik,M.Riester,C.Schommer,M.Schmid,andD.Weigel.2005.SpeciceffectsofmicroRNAsontheplanttranscriptome.DevelopmentalCell8:517. Schwabe,W.W.andA.H.Al-Doori.1973.Analysisofajuvenile-likeconditionaffectingoweringintheblackcurrant(Ribesnigrum).JournalofExperimentalBotany24:969. Schwarz,S.,A.Grande,N.Bujdoso,H.Saedler,andP.Huijser.2008.ThemicroRNAregulatedSBP-boxgenesSPL9andSPL15controlshootmaturationinarabidopsis.PlantMolecularBiology67:183. Scortecci,K.C.,S.D.Michaels,andR.M.Amasino.2001.IdenticationofaMADS-boxgene,FLOWERINGLOCUSM,thatrepressesowering.ThePlantJournal26:229. Scott,D.B.,W.Jin,H.K.Ledford,H.-S.Jung,andM.A.Honma.1999.EAF1regulatesvegetative-phasechangeandoweringtimeinarabidopsis.PlantPhysiol.120:675. Searle,I.,Y.He,F.Turck,C.Vincent,F.Fornara,S.Krober,R.A.Amasino,andG.Coupland.2006.ThetranscriptionfactorFLCconfersaoweringresponsetovernalizationbyrepressingmeristemcompetenceandsystemicsignalinginArabidop-sis.GenesandDevelopment20:898. Shannon,S.andD.R.Meeks-Wagner.1991.AmutationintheArabidopsisTFL1geneaffectsinorescencemeristemdevelopment.PlantCell3:877. Shannon,S.andD.R.Meeks-Wagner.1993.Geneticinteractionsthatregulateinorescencedevelopmentinarabidopsis.PlantCell5:639. Simanton,W.A..1969.Seasonalpatternofcitrusbloom.ProceedingsoftheFloridaStateHorticulturalSociety82:96. Simon,R.,M.I.Igeno,andG.Coupland.1996.ActivationoforalmeristemidentitygenesinArabidopsis.Nature384:59. 120

PAGE 121

Smyth,D.R.,J.L.Bowman,andE.M.Meyerowitz.1990.EarlyowerdevelopmentinArabidopsis.PlantCell2:755. Snyder,W.E..1949.Someresponsesofplantsto2,3,5-triiodobenzoicacid.PlantPhysiology24:195. Southwick,S.M.andT.L.Davenport.1986.Characterizationofwaterstressandlowtemperatureeffectsonowerinductionincitrus.PlantPhysiology81:26. Stewart,R.N.andH.Dermen.1970.Determinationofnumberandmitoticactivityofshootapicalinitialcellsbyanalysisofmericlinalchimeras.AmericanJournalofBotany57:816. Steynen,Q.J.,D.A.Bolokoski,andE.A.Schultz.2001.AlterationinoweringtimecausesacceleratedordeceleratedprogressionthroughArabidopsisvegetativephases.CanadianJournalofBotany79:657. Stone,J.M.,A.E.Trotochaud,J.C.Walker,andS.E.Clark.1998.ControlofmeristemdevelopmentbyCLAVATA1receptorkinaseandkinase-associatedproteinphosphataseinteractions.PlantPhysiol.117:1217. Suarez-Lopez,P.,K.Wheatley,F.Robson,H.Onouchi,F.Valverde,andG.Coupland.2001.CONSTANSmediatesbetweenthecircadianclockandthecontrolofoweringinArabidopsis.Nature410:1116. Sung,S.andR.M.Amasino.2004.VernalizationinArabidopsisthalianaismediatedbythePHDngerproteinVIN3.Nature427:159. Sussex,I.M..1989.Developmentalprogrammingoftheshootmeristem.Cell56:225. Takada,S.andK.Goto.2003.TERMINALFLOWER2,anarabidopsishomologofHETEROCHROMATINPROTEIN1,counteractstheactivationofFLOWERINGLOCUSTbyconstansinthevasculartissuesofleavestoregulateoweringtime.PlantCell15:2856. Tan,F.-C.andS.M.Swain.2007.FunctionalcharacterizationofAP3,SOC1andWUShomologuesfromcitrus(Citrussinensis).PhysiologiaPlantarum131:481. Tanaka,M.,K.Takei,M.Kojima,H.Sakakibara,andH.Mori.2006.Auxincontrolslocalcytokininbiosynthesisinthenodalsteminapicaldominance.ThePlantJournal45:1028. Telfer,A.,K.Bollman,andR.Poethig.1997.PhasechangeandtheregulationoftrichomedistributioninArabidopsisthaliana.Development124:645. Telfer,A.andR.Poethig.1998.HASTY:agenethatregulatesthetimingofshootmaturationinArabidopsisthaliana.Development125:1889. 121

PAGE 122

Thimann,K.V.andF.Skoog.1933.Studiesonthegrowthhormoneofplants.ProceedingsoftheNationalAcademyofSciences19:714. Thimann,K.V.andF.Skoog.1934.Ontheinhibitionofbuddevelopmentandotherfunctionsofgrowthsubstanceinviciafaba.ProceedingsoftheRoyalSocietyofLondon.SeriesB,ContainingPapersofaBiologicalCharacter114:317. Turck,F.,F.Fornara,andG.Coupland.2008.Regulationandidentityoforigen:Floweringlocustmovescenterstage.AnnualReviewofPlantBiology59:573. Valiente,J.I.andL.G.Albrigo.2003.Modelingoweringdateofsweetorangetreesincentraloridabasedonhistoricalweather.In:F.S.Davies,J.J.Ferguson,P.Timmer,E.Etxeberria,L.Duncan,C.McCoy,C.C.Childers,E.Baldwin,M.Ritenour,andF.Gmitter(eds.)ProceedingsoftheInternationalSocietyofCitriculture,volume1,pp.296.Orlando,Florida(USA). Valiente,J.I.andL.G.Albrigo.2004.Flowerbudinductionofsweetorangetrees[Citrussinensis(L.)Osbeck]:effectoftemperature,croploadandbudage.J.Amer.Soc.Hort.Sci.129:158. Valverde,F.,A.Mouradov,W.Soppe,D.Ravenscroft,A.Samach,andG.Coupland.2004.PhotoreceptorregulationofCONSTANSproteininphotoperiodicowering.Science303:1003. Veley,K.M.andS.D.Michaels.2008.Functionalredundancyandnewrolesforgenesoftheautonomousoral-promotionpathway.PlantPhysiol.147:682. Vernoux,T.,J.Kronenberger,O.Grandjean,P.Laufs,andJ.Traas.2000.PIN-FORMED1regulatescellfateattheperipheryoftheshootapicalmeristem.Development127:5157. Vroemen,C.W.,A.P.Mordhorst,C.Albrecht,M.A.C.J.Kwaaitaal,andS.C.deVries.2003.TheCUP-SHAPEDCOTYLEDON3geneisrequiredforboundaryandshootmeristemformationinarabidopsis.PlantCell15:1563. Wada,N.,M.Shinozaki,andH.Iwamura.1994.Flowerinductionbypolyaminesandrelatedcompoundsinseedlingsofmorningglory(Pharbitisnilcv.Kidachi).PlantandCellPhysiology35:469. Wagner,D.,R.W.M.Sablowski,andE.M.Meyerowitz.1999.TranscriptionalactivationofAPETALA1byLEAFY.Science285:582. Wang,J.-W.,B.Czech,andD.Weigel.2009.miR156-regulatedSPLtranscriptionfactorsdeneanendogenousoweringpathwayinArabidopsisthaliana.Cell138:738. Wang,X.,Y.Zhang,Q.Ma,Z.Zhang,Y.Xue,S.Bao,andK.Chong.2007.SKB1-mediatedsymmetricdimethylationofhistoneH4R3controlsoweringtimeinArabidopsis.EMBOJ26:1934. 122

PAGE 123

Weigel,D.,J.Alvarez,D.R.Smyth,M.F.Yanofsky,andE.M.Meyerowitz.1992.LEAFYcontrolsoralmeristemidentityinArabidopsis.Cell69:843. Weigel,D.andE.M.Meyerowitz.1994.TheABCsoforalhomeoticgenes.Cell78:203. Weigel,D.andO.Nilsson.1995.Adevelopmentalswitchsufcientforowerinitiationindiverse.Nature377:495. Wigge,P.A.,M.C.Kim,K.E.Jaeger,W.Busch,M.Schmid,J.U.Lohmann,andD.Weigel.2005.Integrationofspatialandtemporalinformationduringoralinductioninarabidopsis.Science309:1056. Willmann,M.R.andR.S.Poethig.2011.TheeffectoftheoralrepressorFLConthetimingandprogressionofvegetativephasechangeinArabidopsis.Development138:677. Wilson,R.N.,J.W.Heckman,andC.R.Somerville.1992.GibberellinisrequiredforoweringinArabidopsisthalianaundershortdays.PlantPhysiology100:403. Wu,G.,M.Y.Park,S.R.Conway,J.-W.Wang,D.Weigel,andR.S.Poethig.2009.ThesequentialactionofmiR156andmiR172regulatesdevelopmentaltiminginarabidopsis.Cell138:750. Wu,G.andR.S.Poethig.2006.TemporalregulationofshootdevelopmentinArabidop-sisthalianabymiR156anditstargetSPL3.Development133:3539. Yamaguchi,A.,M.-F.Wu,L.Yang,G.Wu,R.S.Poethig,andD.Wagner.2009.ThemicroRNA-regulatedSBP-BoxtranscriptionfactorSPL3isadirectupstreamactivatorofLEAFY,FRUITFULL,andAPETALA1.DevelopmentalCell17:268. Yang,L.,S.R.Conway,andR.S.Poethig.2011.Vegetativephasechangeismediatedbyaleaf-derivedsignalthatrepressesthetranscriptionofmiR156.Development138:245. Yano,M.,Y.Katayose,M.Ashikari,U.Yamanouchi,L.Monna,T.Fuse,T.Baba,K.Yamamoto,Y.Umehara,Y.Nagamura,andT.Sasaki.2000.Hd1,amajorphotoperiodsensitivityquantitativetraitlocusinrice,iscloselyrelatedtothearabidopsisoweringtimegeneCONSTANS.PlantCell12:2473. Yanovsky,M.J.andS.A.Kay.2002.Molecularbasisofseasonaltimemeasurementinarabidopsis.Nature419:308. Yoo,S.K.,K.S.Chung,J.Kim,J.H.Lee,S.M.Hong,S.J.Yoo,S.Y.Yoo,J.S.Lee,andJ.H.Ahn.2005.CONSTANSactivatesSUPPRESSOROFOVEREXPRESSIONOFCONSTANS1throughFLOWERINGLOCUSTtopromoteoweringinarabidopsis.PlantPhysiology139:770. 123

PAGE 124

Zhang,J.,X.Ai,L.Sun,D.Zhang,W.-W.Guo,X.Deng,andC.Hu.2011.Transcriptomeproleanalysisofoweringmolecularprocessesofearlyoweringtrifoliateorangemutantandthewild-type[Poncirustrifoliata(L.)Raf.]bymassivelyparallelsignaturesequencing.BMCGenomics12:63. Zhang,J.-Z.,Z.-M.Li,L.Liu,L.Mei,J.-L.Yao,andC.-G.Hu.2008.Identicationofearly-ower-relatedestsinanearly-oweringmutantoftrifoliateorange(Poncirustrifoliata)bysuppressionsubtractivehybridizationandmacroarrayanalysis.TreePhysiol28:1449. Zhang,J.-Z.,Z.-M.Li,L.Mei,J.-L.Yao,andC.-G.Hu.2009a.PtFLChomologfromtrifoliateorange(Poncirustrifoliata)isregulatedbyalternativesplicingandexperiencesseasonaluctuationinexpressionlevel.Planta229:847. Zhang,J.-Z.,Z.-M.Li,J.-L.Yao,andC.-G.Hu.2009b.Identicationofowering-relatedgenesbetweenearlyoweringtrifoliateorangemutantandwild-typetrifoliateorange(Poncirustrifoliatal.raf.)bysuppressionsubtractionhybridization(ssh)andmacroarray.Gene430:95104. 124

PAGE 125

BIOGRAPHICALSKETCH EduardoJoseChicaMartnezwasbornin1982inGuayaquil,Ecuador.In2005,heobtainedthedegreeofIngenieroAgropecuariofromtheEscuelaSuperiorPolitecnicadelLitoralinGuayaquil.In2007,heobtainedhisM.Sc.degreefromtheHorticulturalScienceDepartmentattheUniversityofFlorida.In2011,heobtainedhisPh.D.degreefromtheHorticulturalScienceDepartmentattheUniversityofFlorida. 125