Rational Drug Design Approaches Targeting the Mouse and Human Melanocortin Receptors

MISSING IMAGE

Material Information

Title:
Rational Drug Design Approaches Targeting the Mouse and Human Melanocortin Receptors
Physical Description:
1 online resource (374 p.)
Language:
english
Creator:
Haslach,Erica M
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Pharmaceutical Sciences, Pharmacodynamics
Committee Chair:
Haskell-Luevano, Carrie
Committee Members:
Keller-Wood, Maureen
Millard, William J
Edison, Arthur S
Dunn, Ben M

Subjects

Subjects / Keywords:
melanocortin -- obesity -- peptides -- snps
Pharmacodynamics -- Dissertations, Academic -- UF
Genre:
Pharmaceutical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
The predominance of obesity (body mass index >30) is a major health concern. Those considered to be obese are more prone to heart disease, diabetes, hypertension, cancer and many other problems. The melanocortin system is comprised of G-protein coupled receptors and a series of endogenous agonists and antagonists. The MC4R is involved in energy and weight homeostasis and food regulation and has become a drug target for the design of drugs for the treatment of obesity and related diseases. The interplay between the melanocortin agonists, antagonists and MC4R may be a potential significant therapeutic tool for obesity and related diseases. The first section reports the generation of mutant receptors based on the Asn123, Phe184, and Asp189 hMC4R residues. Each receptor was evaluated based on molecular recognition, receptor expression, and pharmacologically characterized with ligands. It is hypothesized that these receptor amino acids have specific interactions with the melanocortin agonists and antagonists. The determination of specific residues required for the ligand binding of agonists or antagonists will help in the design and discovery of molecules that find a balance between these two types of ligands and may act as therapeutic tools for the treatment of obesity. The second project investigates the use of screening combinatorial chemistry libraries, deconvolution, and synthesis of hits to identify lead compounds for a naturally-occurring hMC4R mutation that has been shown to cause obesity in human patients. The L106P hMC4R polymorphism has been reported as a heterozygous polymorphism in an obese patient. Endogenous melanocortin agonists have decreased affinity, while synthetic tetrapeptides were shown to exhibit potent activity. This mutation is located in the putative binding region for ligands and may be distorted due to the amino acid change. After multiple pharmacological screening steps, synthesis of hits, and characterization of new peptides has led to the identification of unique sequences that can elicit nanomolar agonist potency at this polymorphism. Overall, ligand SAR and site-directed mutagenesis of the MC4R will aid researchers in gaining further molecular insight to the inner workings of this complex pathway and advance the understanding of multifaceted disease states.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Erica M Haslach.
Thesis:
Thesis (Ph.D.)--University of Florida, 2011.
Local:
Adviser: Haskell-Luevano, Carrie.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2011
System ID:
UFE0043161:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 RATIONAL DRUG DESIGN APPROACHES TARGETING THE MOUSE AND HUMAN MELANOCORTIN RECEPTORS By ERICA MARIE HASLACH A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUI REMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Erica Marie Haslach

PAGE 3

3 To my family for their love and support

PAGE 4

4 ACKNOWLEDGMENTS First of all I want to express sincere gratitude to my advisor Dr. Carrie Haskel l Luevano, whose support, guidance and dedication to science and her students has helped me during the past years with my research and shaping me into the scientist I am today. I would like to thank my supervisory committee members: Dr. William Millard, D r. Maureen Keller Wood Dr. Ben Dunn, and Dr. Arthur Edison for their counsel. Second I want to thank all former and current lab members of the Haskell Luevano laboratory, my peers in the Pharmacodynamics and Medicinal Chemistry Departments, and other fri ends I have made during my time here, especially, to Jay Schaub and Anamika Singh for their friendship in and out of lab. Thanks for making my time here in Gainesville enjoyable. I want to thank Dr. Krista R. Wilson and Dr. Anamika Singh for teaching me pe ptide synthesis and Dr. Zhimin Xiang, Mr. Marvin Dirain and Dr. Hua Yao for teaching me molecular biology and pharmacology skills. I want to thank Marvin Dirain and Huisuo Huang for assisting me in the functional assays. I also want to thank Dr. Sally Lit herland (Diabetes and Obesity Research Center, Sanford Burnham Institute for Medical Research at Lake Nona) for her collaboration and training me to perform flow cytomet ry and deconvolution microscopy. Also, thanks to Dr. Robert Speth for his collaboration on peptide iodination (American Radiolabled Chemicals, St. Louis, MO). I would also like to thank Richard Houghten, Marc Guilianotti, Jon Appel Ginamarie Debevec, and Phaedra Geer from the Torrey Pines Institute for their collaboration on the L106P hMC4R targeted library project Most of all, I give ve ry special thanks to my family for all of their love, support and encouragement throughout my graduate studies. Special thanks go to my brother, Andrew for his help in proofreading this dissertation. I want to thank Uncle Michael and

PAGE 5

5 Aunt Lara for all the rides to and from the airport so I could visit PA. Finally I would like to thank my future husband, Matthew Meckes, whose love and support have helped me achieve my goal. I also acknowledge the University o f Florida and College of Pharmacy for supporting my education for the last 5 years and the NIH for providing grants that supported my research. I would like to acknowledge the Department s of Medicinal Chemistry and Pharmacodynamics for their supporting my education.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ .......... 10 LIST OF FIGURES ................................ ................................ ................................ ........ 12 ABSTRACT ................................ ................................ ................................ ................... 25 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 2 7 Obesity ................................ ................................ ................................ .................... 27 Overview of the Melanocortin System ................................ ................................ ..... 28 Melanocortin Receptors ................................ ................................ .................... 29 Melanocort in Agonists ................................ ................................ ...................... 31 Melanocortin Antagonists ................................ ................................ ................. 37 Melanocortin System and Obesity and Related Diseases ................................ ...... 39 Rational Drug Design Targeting Melanocortin System ................................ ........... 41 Structure Activity Relationship Studies ................................ ............................. 41 Receptor Mutagenesis ................................ ................................ ..................... 43 Contribution of the Research in this Dissertation towards Rational Drug Design ................................ ................................ ................................ ........... 45 2 GENERAL METHODOL OGIES 1: CHEMISTRY ................................ .................... 53 Merrifield Approach ................................ ................................ ................................ 53 Fmoc Solid Phase Peptide Synthesis ................................ ............................... 55 Microwave SPPS ................................ ................................ .............................. 55 SPPS Resins ................................ ................................ ................................ .... 56 Coupling Methods ................................ ................................ ............................ 58 Carbodiimides coupling ................................ ................................ .............. 59 Phosphonium and aminium coupling ................................ ......................... 60 Colorimetric Monitoring Methods ................................ ................................ ...... 61 Experimental Details ................................ ................................ ............................... 62 Synthesis of AGRP Derivatives ................................ ................................ ........ 62 Monocyclic solution cyclizatio n ................................ ................................ .. 63 Bicyclic cyclization ................................ ................................ ..................... 64 Tetrapeptide Library Targeting L106P hMC4R ................................ ................. 64 Ligand Purification and Analysis ................................ ................................ ....... 66 3 GENERAL METHODOLOGIES 2: MOLECULAR BIOLOGY ................................ .. 81 Epitope Tagged Receptors ................................ ................................ ..................... 81

PAGE 7

7 Site Directed Mutagenesis ................................ ................................ ...................... 82 Functional Reporter Gene Assay ................................ ................................ ............ 87 Compet itive Binding Assay ................................ ................................ ..................... 89 Flow Cytometry ................................ ................................ ................................ ....... 90 Experimental Details ................................ ................................ ............................... 91 MC4R In Vitro Receptor Mutagenesis ................................ .............................. 91 Generation of Stable Cell Lines ................................ ................................ ........ 92 cAMP Based Functional Bioassay ................................ ................................ .... 92 Data Analysis ................................ ................................ ................................ ... 93 I 125 NDP MSH Competitive Binding Studies ................................ ..................... 93 Flow Cytometry ................................ ................................ ................................ 94 4 DETERMINATION OF UNIQUE INTERACTIONS BETWEEN MC4R AND AGRP ................................ ................................ ................................ ...................... 99 Melanocortin Antagonists ................................ ................................ ........................ 99 AGRP Structure ................................ ................................ .............................. 100 AGRP Structure Activity Relationship Studies ................................ ................ 101 Homology Modeling of AGRP Derivatives Docked into MC4R Model ............ 104 Monocyclic Peptide Pharmacology and Modeling ................................ .......... 107 Bicyclic Peptide Pharmacology and Homology Molecula r Modeling .............. 109 Results of Human Melanocortin Mutant Receptors ................................ ............... 115 Competitive Displacement Binding Studies ................................ .................... 116 Cell Surface Expression of Flag hMC4 Receptors ................................ ......... 117 Functional Characterization of WT and Mutant Flag hMC4 Receptors .......... 118 Endogenous and synthetic agonist pharmacology of Asn123 hMC4R mutants ................................ ................................ ................................ 120 Endogenous and synthetic agonist pharmacology of Phe184 hMC4R mutants ................................ ................................ ................................ 122 Endogenous and synthetic agonist pharmacology of Asp189 hMC4R mutants ................................ ................................ ................................ 123 Discussion of Melanocortin Agonist Pharmacology with hMC4 M utant Receptors ................................ ................................ ................................ .......... 125 Asn123 hMC4R Mutants ................................ ................................ ................ 130 Phe184 hMC4R Mutants ................................ ................................ ................ 131 Asp189 hMC4R Mutants ................................ ................................ ................ 132 Functional Characterization of AGRP Derivatives with WT and Mutant hMC4R ... 134 Monocyclic AGRP Deri vatives ................................ ................................ .............. 134 Asn123 hMC4 Mutant Receptor Pharmacology ................................ ............. 135 Phe184 hMC4 Mutant Receptor Pharmacology ................................ ............. 136 Asp189 hMC4 Mutant Receptor Pharmacology ................................ ............. 137 Bicyclic AGRP Derivatives ................................ ................................ .................... 138 Asn123 hMC4 Mut ant Receptor Pharmacology ................................ ............. 139 Phe184 hMC4 Mutant Receptor Pharmacology ................................ ............. 140 Asp189 hMC4 Mutant Receptor Pharmacology ................................ ............. 141 Discussion of AGRP Derivatives with hMC4 Mutant Receptors ............................ 142 Control AGRP Derivatives ................................ ................................ .............. 143

PAGE 8

8 DArg 111 AGRP Derivatives ................................ ................................ ............. 144 DPhe 112 annd DPhe 113 AGRP Derivatives ................................ ...................... 146 Arginine Receptor Substitution ................................ ................................ ....... 149 Conclusion ................................ ................................ ................................ ............ 152 Asn123 hMC4 Mutant Receptors ................................ ................................ ... 152 Phe184 hMC4 Mutant Receptors ................................ ................................ ... 152 Asp189 hMC4 Mutant Receptors ................................ ................................ ... 153 Link between AGRP/MC4R and Obesity and Hypertension ................................ 154 Future Directions ................................ ................................ ................................ .. 155 5 DESIGN OF PEPTIDE LIBRARIES TARGETING THE L106P HUMAN MELANOCORTIN 4 RECEPTOR SINGLE NUCLEOTIDE POLYMORPHISM ..... 181 Pharmacological Characterization of L106P hMC4R ................................ ............ 185 SAR of Single Substituted Peptides at hMC4R and L106P hMC4R ..................... 191 His Substitution ................................ ................................ .............................. 191 Phe Substitution ................................ ................................ ............................. 193 Arg Substitution ................................ ................................ .............................. 194 Trp Substitution ................................ ................................ .............................. 195 SAR of Single Substituted Peptides at Mouse Melanocortin Receptors ............... 195 A dditional Combinatorial Chemistry Plate Screening ................................ ............ 197 Pharmacological Results of TPI1981 Peptides at hMC4R and L106P hMC4R ..... 201 P harmacological Results of TPI1981 Peptides at Mouse Melanocortin Receptors ................................ ................................ ................................ .......... 207 Discussion ................................ ................................ ................................ ............ 208 Ac X (pI)DPhe Arg Trp NH 2 (TPI1981 7 and 13) ................................ ........... 209 Ac X (pI)DPhe Arg (pI)DPhe NH 2 (TPI1981 5, 11, and 17) ............................ 212 Receptor Selectivity ................................ ................................ ........................ 213 Conclusion ................................ ................................ ................................ ............ 214 Future Directions ................................ ................................ ................................ .. 215 Experimental Details ................................ ................................ ............................. 216 Mini Mixture Experimental ................................ ................................ .............. 216 Pharmacological Characterization ................................ ................................ .. 217 6 CONCLUDING REMARKS ................................ ................................ ................... 244 Determination of Unique Interactions between hMC4R and AGRP ...................... 245 Identification of Potent Peptides at the L106P hMC4R Polymorphism ................. 2 45 APPENDIX A PRIMER SEQUENCES ................................ ................................ ........................ 252 B SEQUENCING FILES ................................ ................................ ........................... 253 C HIS TOGRAMS OF FACS DATA ................................ ................................ ........... 273 LIST OF REFERENCES ................................ ................................ ............................. 352

PAGE 9

9 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 373

PAGE 10

10 LIST OF TABLES Tab le page 1 1 Amino acid sequences of the endogenous and synthetic melanocortin agonists. ................................ ................................ ................................ ............. 49 1 2 Ligand potency for the f ive melanocortin subtypes ................................ ............. 51 2 1 Comparison of Boc and Fmoc structures and deprotection/cleavage conditions. ................................ ................................ ................................ .......... 68 2 2 Common types of resin used in SPPS. ................................ ............................... 71 2 3 Phosphonium and aminium based coupling reagents. ................................ ....... 77 2 4 Sequences of Monocyclic and bicyclic AGRP derivatives. ................................ 80 2 5 Microwave synthesizer coupling conditions. ................................ ....................... 80 2 6 Single substitution tetrapeptides targeting L106P hMC4R. ................................ 80 4 1 List of AGRP derivatives synthesized. ................................ .............................. 157 4 2 Sequences of endogenous and synthetic agonists used in developing a pharmac ologica l profile of new hMC4 mutant receptors. ................................ .. 157 4 3 Summary of the melanocortin agonists and Ac His DPhe Arg Trp NH 2 (VXF1 28) ligand pharmacology at the hMC4R mutants. ................................ 167 4 4 Summary of the monocyclic AGRP derivatives at the WT and hMC4R mutants. ................................ ................................ ................................ ............ 172 4 5 Summary of the bicyclic AGRP derivatives at the WT and hMC4R mutants. ... 176 5 1 Summary of the endogenous agonists and tetrapeptides pote ncies at the WT and L106P hMC4R ................................ ................................ ........................... 218 5 2 List of AAs i ncorporated to make 216,000 peptides in the preliminary screening process. ................................ ................................ ........................... 224 5 3 Selected AAs at defined positions that resulted from combinatorial chemistry library screening. ................................ ................................ .............................. 227 5 4 Peptides that were synthesized using substitutions based on combinatorial chemistry screening. ................................ ................................ ......................... 228 5 5 Summary of the pharmacological activity of single substituted library at the hMC4R and L106P. ................................ ................................ .......................... 230

PAGE 11

11 5 6 Summary of the pharmacological activity of single substituted library at the mouse receptors. ................................ ................................ .............................. 231 5 7 An example of the peptides that will be generated from mini mixture library split into six separate mixtures. ................................ ................................ ......... 233 5 8 Amino acids that were incorp orated at specific positions to make the mixture, EMH7 11. ................................ ................................ ................................ ......... 234 5 9 Amino acid sequences corresponding to the peaks observed in EMH7 11 HPLC analytical. ................................ ................................ ............................... 234 5 10 Absorbance values obtained from stimulation of EMH7 11 at WT hMC4R and L106P. ................................ ................................ ................................ .............. 235 5 11 AAs at specific positions identified from screening CC library for pepti des to target L106P hMC4R. ................................ ................................ ....................... 236 5 12 Tetrapeptides designed based on screening and deconvolution process of TPI 924 combinatorial chemistry plate. ................................ ............................. 237 5 13 Summary of the pharmacological activity of TPI1981 peptides at hMC4R and L106P hMC4R. ................................ ................................ ................................ 238 5 14 Summary of the pharmacological activity of TPI1981 peptides at mouse M CRs. ................................ ................................ ................................ .............. 239 5 15 TPI1981 tetrapeptides that exhibited antagonist activity at the mMC3R ........... 240 5 16 Potent tetrapeptides at the L106P h MC4R. ................................ ...................... 241

PAGE 12

12 LIST OF FIGURES Figure page 1 1 The Melanocortin system. ................................ ................................ .................. 47 1 2 Posttrans lational processing of POMC into the melanocortin agonist s. .............. 48 1 3 Structure of the melanocortin core tetrapeptide sequence with the side chains highlighted. ................................ ................................ .............................. 48 1 4 Unusual AAs used in Ac HFRW NH 2 SAR studies. ................................ ............ 49 1 5 Structures of melanocortin ligands with highlighted regions indicating important structural changes. ................................ ................................ ............. 50 1 6 Partial structures of the melanocortin antagonists, hAGRP and hAgouti, showing the C terminal region with the five disulfide bonds. .............................. 51 1 7 Flowchart of drug design process used in Chapter 4 from bio logically active peptide AGRP. ................................ ................................ ................................ .... 52 1 8 Flowchart of combinatorial chemistry drug design process used in Chapter 5 to i dentify lead compounds for specific receptor polymorphisms. ....................... 52 2 1 General scheme for peptide synthesis containing microwave conditions. .......... 68 2 2 Proposed mechanism for base catalylized removal of the N terminal Fmoc protection group. ................................ ................................ ................................ 69 2 3 Comparison of the manual and the microwave SPPS set ups. .......................... 70 2 4 Diketopiperizine formation during synthesis using a hydroxymethyl linker and proline as the first amino acid. ................................ ................................ ............ 72 2 5 Two common enantiomerizatio n reactions of amino acids, enolization and oxazolone formation. ................................ ................................ .......................... 72 2 6 Chemical structures of coupling reagents DCC and DIC. ................................ ... 72 2 7 Proposed mechanism of amino acid coupling using carbodiimide coupling reagents ................................ ................................ ................................ ............. 73 2 8 Mechanism of amino acid coupling using carbodiimides through symmetrical anhydride formation. ................................ ................................ ........................... 74 2 9 Proposed mechanism of amino acid coupling through active ester formation using carbodiimides and HOBt as coupling reagents. ................................ ........ 74

PAGE 13

13 2 10 Proposed mechanism of oxazolone formation leading to amino acid coupling when carbodiimides are used. ................................ ................................ ............ 75 2 11 Structures of phosphonium and aminium salts used in coupling reactions. ........ 75 2 12 Proposed amino acid activiation with HBTU coupling reagent an aminium salt. ................................ ................................ ................................ .................... 76 2 13 Proposed mechanism of primary amine detec tion using ninhydrin reagent. ....... 79 2 14 Complex formed from the reaction of chloranil with a secondary amine. ............ 79 3 1 Examples of c ompetitive binding, flow cytometry, and functional assay results. ................................ ................................ ................................ ................ 96 3 2 galactosidase reporter gene assay. ............. 97 3 3 Graphical representation of pharmacological curves. ................................ ......... 98 4 1 Sequenc es of AMGEN bicyclic peptides. ................................ ......................... 158 4 2 Sequence of Mini AGRP. ................................ ................................ ................. 158 4 3 Postulated antagonist hAGRP(111 113) RFF ami no acid interactions with hMC4R residues located in the TM proposed binding domain. ........................ 159 4 4 Postulated agonist DPhe Arg Trp amino acid interactions with the hMC4R residues located in the TM pr oposed binding domain. ................................ ..... 160 4 5 Amino acids used to generate the four N123 hMC4R mutations. ..................... 161 4 6 Amino acids used to generate the seven F184 hMC4R mutations. .................. 162 4 7 Amino acids used to generate the seven D189 hMC4R mutations. .................. 163 4 8 I 125 NDP MSH Compet itive Binding Affinities of WT and N123 hMC4R mutants. ................................ ................................ ................................ ............ 164 4 9 I 125 NDP MSH Competitive Binding Affinities of WT and F184 hMC4R mutants. ................................ ................................ ................................ ............ 164 4 10 I 125 NDP MSH Competitive Binding Affinities of WT and D189 hMC4R mutants. ................................ ................................ ................................ ............ 164 4 11 Fluorescence activated cell sorting (FACS) analysis of the hMC4 mutant receptors in stably expressed HEK 293 cells. ................................ .................. 165 4 12 Deconvolution microscopy image of WT Flag hMC4R and N123S Flag hMC4R ................................ ................................ ................................ ............. 166

PAGE 14

14 4 13 Dose response cu rves of WT and N123 hMC4R mutants characterized with melanocortin agonists. ................................ ................................ ...................... 168 4 14 Dose response curves of WT and F184 hMC4R mutants characterized with melanocortin agonists. ................................ ................................ ...................... 169 4 15 Dose response curves of WT and hMC4R D189 mutants characterized with melanocortin agonists. ................................ ................................ ...................... 170 4 16 Reverse turn structures found in peptide. ................................ ......................... 171 4 17 Competitive antagonist curves of EMH1 100 using MTII as the agonist. .......... 172 4 18 Dose response curves of the mono cyclic AGRP derivatives at the WT and N123 hMC4 mutant receptors. ................................ ................................ .......... 173 4 19 Dose response curves of the monocyclic AGRP derivatives at the WT and F184 hMC4 mutant receptors. ................................ ................................ .......... 174 4 20 Dose response curves of the monocyclic AGRP derivatives at the WT and D189 hMC4 mutant receptors. ................................ ................................ .......... 175 4 21 Competitive antagonist curves o f EMH2 93 using MTII as the agonist. ............ 176 4 22 Dose response curves of the bicyclic AGRP derivatives at the WT and N123 hMC4 mutant receptors. ................................ ................................ ................... 177 4 23 Dose response curves of the bicyclic AGRP derivatives at the WT and F184 hMC4 mutant receptors. ................................ ................................ ................... 178 4 24 Dose response curves of the bicyclic AGRP derivatives at the WT and D189 hMC4 mutant receptors. ................................ ................................ ................... 179 4 25 Summary of the studies conducted within Chapter 4. ................................ ....... 180 5 1 Schematic representation of the functional consequences of mutations that may occur within GPCR. ................................ ................................ .................. 218 5 2 Structures of THIQ, a potent, selective MC4R agonist ................................ ..... 219 5 3 Structures of the two tetrapeptides that were identified to exhibit nM full agonist potency at L106P hMC4R ................................ ................................ .... 220 5 4 Comparison of Leucine and Proline ................................ ................................ .. 221 5 5 Peptide dihedral angles defining secondary structures and backbone conformation.. ................................ ................................ ................................ ... 221 5 6 Proline depicted as helix breaker.. ................................ ................................ .... 222

PAGE 15

15 5 7 Schematic view of combinatorial chemistry.. ................................ .................... 223 5 8 Identification of lead compounds through repetitive synthesis and deconvolution. ................................ ................................ ................................ .. 223 5 9 Samples of combinatorial chemistry library plates screened at the L106P hMC4R.. ................................ ................................ ................................ ........... 225 5 10 Schematic representation of screening/deconvo lution/identification of hits/synthesis/characterization process. ................................ ........................... 226 5 11 Structures of the AAs identified to substitute within the Ac His DPhe Arg Trp NH 2. ................................ ................................ ................................ .................. 229 5 12 Dose response curves of control tetrapeptide (EMH4 90) and (3I) Tyr substituted peptide (EMH4 103) at WT hMC4R and L106P hMC4R. ............... 23 2 5 13 Dose response cu rves of (pCl)DPhe substituted peptide (EMH4 104) and (pI)DPhe substituted peptide (EMH4 105) at WT hMC4R and L106P hMC4R. 232 5 14 Basic peptide chain schematic shown incorporating mixtures at different positions. ................................ ................................ ................................ .......... 232 5 15 HPLC analytical showing four peaks corresponding to four peptides within the mixture EMH7 11. ................................ ................................ ....................... 234 5 16 Map key of TPI 924 combinatorial chemistry plate. ................................ .......... 236 5 17 Structure of DPhe (F 5). ................................ ................................ ................... 241 5 18 Dose response curves of TPI19 81 7 and 13 at hMC4R and L106P hMC4R. ... 241 5 19 Dose response curves of TPI1981 7 and 13 at hMC4R and L106P hMC4R. ... 242 5 20 Dose response curves of TPI1981 5, 11, and 17 at hMC4R and L106P hMC4R. ................................ ................................ ................................ ............ 242 5 21 Flowchart of the route taken to find potent peptides in screening a CC library. 243 C 1 Flag hMC4R in HEK cells FACS histogram ................................ ...................... 274 C 2 F184A Flag hMC4R in HEK cells FACS histogram ................................ .......... 275 C 3 F184A Flag hMC4R in HEK cells FACS histogram ................................ .......... 276 C 4 F184K Flag hMC4R in HEK cells FACS histogram ................................ .......... 277 C 5 F184K Flag hMC 4R in HEK cells FACS histogram ................................ .......... 278

PAGE 16

16 C 6 F184S Flag hMC4R in HEK cells FACS histogram ................................ .......... 279 C 7 F184S Flag hMC4R in HEK cells FACS h istogram ................................ .......... 280 C 8 F184Y Flag hMC4R in HEK cells FACS histogram ................................ .......... 281 C 9 F184Y Flag hMC4R in HEK cells FACS histogram ................................ .......... 282 C 10 F184W Flag hMC4R in HEK cells FACS histogram ................................ ......... 283 C 11 F184W Flag hMC4R in HEK cells FACS histogram ................................ ......... 284 C 12 Flag hMC4R in HEK cells FACS histogram ................................ ...................... 285 C 13 Flag hMC4R in HEK cells FACS histogram ................................ ...................... 286 C 14 F184A Flag hMC4R in HEK cells FACS histogram ................................ .......... 287 C 15 F184A Flag hMC4R in HEK cells FACS histogram ................................ .......... 288 C 16 F184H Flag h MC4R in HEK cells FACS histogram ................................ .......... 289 C 17 F184H Flag hMC4R in HEK cells FACS histogram ................................ .......... 290 C 18 F184K Flag hMC4R in HEK cells FA CS histogram ................................ .......... 291 C 19 F184K Flag hMC4R in HEK cells FACS histogram ................................ .......... 292 C 20 F184S Flag hMC4R in HEK cells FACS histogram ................................ .......... 293 C 21 F184S Flag hMC4R in HEK cells FACS histogram ................................ .......... 294 C 22 F184W Flag hMC4R in HEK cells FACS histogram ................................ ......... 295 C 23 F184W Flag hMC4R in HEK cells FACS histogram ................................ ......... 296 C 24 Flag hMC4R in HEK cells FACS histogram ................................ ...................... 297 C 25 Flag hMC4R in HEK cells FACS histogram ................................ ...................... 298 C 26 Flag hMC4R in HEK cells FACS histogram ................................ ...................... 299 C 27 Flag hMC4R i n HEK cells FACS histogram ................................ ...................... 300 C 28 D189A Flag hMC4R in HEK cells FACS histogram ................................ .......... 301 C 29 D189A Flag hMC4R in HEK cells FACS his togram ................................ .......... 302 C 30 D189E Flag hMC4R in HEK cells FACS histogram ................................ .......... 303

PAGE 17

17 C 31 D189K Flag hMC4R in HEK cells FACS histogram ................................ .......... 304 C 32 D189K Flag hMC4R in HEK cells FACS histogram ................................ .......... 305 C 33 D189N Flag hMC4R in HEK cells FACS histogram ................................ .......... 306 C 34 D189N Flag hMC4R in HEK cells FACS histogram ................................ .......... 307 C 35 D189Q Flag hMC4R in HEK cells FACS histogram ................................ ......... 308 C 36 D189Q Flag hMC4R in HEK cells FACS histogram ................................ ......... 309 C 37 D189R Flag hMC4R in HEK cells FACS histogram ................................ .......... 310 C 38 D189R Flag hMC4R in HEK cells FACS histogram ................................ .......... 311 C 39 D189S Flag hMC4R in HEK cells FACS histogram ................................ .......... 312 C 40 D189S Flag hMC4R in HEK cells FACS histogram ................................ .......... 313 C 41 N123A Flag hMC4R in HEK cells FACS histogram ................................ .......... 314 C 42 N123A Flag hMC4R in HEK cells FACS histo gram ................................ .......... 315 C 43 N123D Flag hMC4R in HEK cells FACS histogram ................................ .......... 316 C 44 N123D Flag hMC4R in HEK cells FACS histogram ................................ .......... 317 C 45 N123Q Flag hMC4R in HEK cells FACS histogram ................................ ......... 318 C 46 N123Q Flag hMC4R in HEK cells FACS histogram ................................ ......... 319 C 47 N123S Flag hMC4R in HEK cells FACS histogram ................................ .......... 320 C 48 N123S Flag hMC4R in HEK cells FACS histogram ................................ .......... 321 C 49 Flag hMC4R in HEK cells FACS histogram ................................ ...................... 322 C 50 Flag hMC4R in HEK cells FACS histogram ................................ ...................... 323 C 51 Flag hMC4R in HEK cells FACS histogram ................................ ...................... 324 C 52 Flag hMC4R in HEK cells FACS histogram ................................ ...................... 325 C 53 D189A Flag hMC4R in HEK cells FACS histogram ................................ .......... 326 C 54 D189A Flag hMC4R in HEK cells FACS histogram ................................ .......... 327 C 55 D189E Flag hMC4R in HEK cells FACS histogram ................................ .......... 328

PAGE 18

18 C 56 D189E Flag hMC4R in HEK cells FACS histogram ................................ .......... 329 C 57 D189K Flag hMC4R in HEK cells FACS histogram ................................ .......... 330 C 58 D189K Flag hMC4R in HEK cells FACS histogram ................................ .......... 331 C 59 D189N Flag hMC4R in HEK cells FACS histogram ................................ .......... 332 C 60 D189N Flag hMC4R in HEK cells FACS histogram ................................ .......... 333 C 61 D189Q Flag hMC4R in HEK cells FACS histogram ................................ ......... 334 C 62 D189Q Fl ag hMC4R in HEK cells FACS histogram ................................ ......... 335 C 63 D189R Flag hMC4R in HEK cells FACS histogram ................................ .......... 336 C 64 D189R Flag hMC4R in HEK cell s FACS histogram ................................ .......... 337 C 65 D189S Flag hMC4R in HEK cells FACS histogram ................................ .......... 338 C 66 D189S Flag hMC4R in HEK cells FACS histogram ................................ .......... 339 C 67 N123A Flag hMC4R in HEK cells FACS histogram ................................ .......... 340 C 68 N123A Flag hMC4R in HEK cells FACS histogram ................................ .......... 341 C 69 N123D Flag hMC4R in HEK cells FACS histogram ................................ .......... 342 C 70 N123D Flag hMC4R in HEK cells FACS histogram ................................ .......... 343 C 71 N123Q Flag hMC4R in HEK cells FACS histogram ................................ ......... 344 C 72 N123Q Flag hMC4R in HEK cells FACS histogram ................................ ......... 345 C 73 N123S Flag hMC4R in HEK cells FACS histogram ................................ .......... 346 C 74 N123S Flag hMC4R in HEK cells FACS histogram ................................ .......... 347 C 75 Flag hMC4R in HEK cells FACS Histogram ................................ ..................... 348 C 76 Flag hMC4R in HEK cells FACS histogram ................................ ...................... 349 C 77 Flag hMC4R in HEK cells FACS histogram ................................ ...................... 350 C 78 Flag hMC4R in HEK cells FACS histogram ................................ ...................... 351

PAGE 19

19 LIST OF ABBREVIATIONS A Ala, Alanine AA Amino Acid Abu Aminobutyric acid Acm Acetomidomethyl AcOH Aceti c Acid ACS American Chemical Society ACTH Adrenocorticotropin Hormone AGRP Agouti Related Protein APC Allophycocyanin ASP Agouti Signaling Peptide ATP Adenosine Triphosphate BBB Blood Brain Barrier BMI Body Mass Index Boc Tert Butyloxycarbonyl BOP Benzotriazol 1 Yl N Oxy Tris(Dimethylamino) Phosphonium Hexafluorophosphate BSA Bovine Serum Albumin C Cys, Cysteine cAMP Adenosine Monophosphate Chloranil 2,3,5,6 Tetrachloro 1,4 Benzoquinone CO 2 Carbon Dioxide CPE Carboxypeptidase E C RE cAMP Response Element

PAGE 20

20 D Asp, Aspartic Acid D CC Dicyclohexylcarbodiimide DCM Dichloromethane DIC Diisopropylcarbodiimide DIEA N,N Diisopropylethylamine DMAP 4 Dimethylaminopyridine DMEM Dulbecco Modified Eagle's Media DMF N,N Dimethylformamide D MSO Dimethyl Sulfoxide DNA Deoxyribonucleic Acid D 1 Napthylalanine D 2 Napthylalanine E Glu, Glutamic Acid EC 50 Half Maximal Effective Concentration Et 3 N Triethyl Amine F Phe, Phenylalanine FACS Fluorescence Activated Cell Sorti ng Falp Fat Tissue Specific Low Molecular Weight Protein FGD Familial Glucocorticoid Deficiency Fmoc 9 Fluorenylmethyloxycarbonyl FSC Forward Scatter Channel G Gly, Glycine GPCR G Protein Coupled Receptor

PAGE 21

21 H His, Histidine HATU N [(Dimethylamino) 1 H 1,2,3 Triazolo[4,5]Pyridine 1 methylmethanaminium Hexafluorophosphate N Oxide HBTU N [1H Benzotriazole 1 Yl)(Dimet hylamino)Methylamino)Methylene] N Methylmethanaminium Hexafluorophosphat e N Oxide HEK293 Human Embryonic Kidney Cell Line 293 HF Hydrogen Fluoride HOAt 1 Hydroxy 7 Azabenzotriazole HOBt 3 Hydroxybenzotriazole HPA Axis Hypothalamic Pituitary Adrenal Axis I Ile, Isoleucine IBMX Isobutylmethylxanthine IC 50 Half Maximal Inh ibitory Concentration ICV Intracerebroventricular IP 3 Inositol Triphosphate K Lys, Lysine KCl Potassium Chloride KO Knockout L Leu, Leucine M Met, Methionine MC1R Melanocortin 1 Receptor MC2R Melanocortin 2 Receptor MC3R Melanocortin 3 Receptor MC 4R Melanocortin 4 Receptor MC5R Melanocortin 5 Receptor

PAGE 22

22 MCR Melanocortin Receptor MeOH Methanol MgCl 2 Magnesium Chloride MRAP Melanocortin 2 Receptor Accessory Protein mRNA Messenger Ribonucleic Acid MSH Melanocyte Stimulating Hormone MT I Melanotan I MTII Melanotan II N Asn, Asparagine Na/NH 3 Sodium/Ammonia NaOH Sodium Hydroxide NAT N Acetyltransferase NDP MSH Norleucine, D Phenylalanine Melanocyte Stimulating Hormone Nle Norleucine nM Nanomolar NMP N Methyl Pyrollidinone OD Optical Densit y ONPG Ortho Nitropheny l Galactoside OtBu Tert Butyl Ester P Pro, Proline PC1 Prohormone Convertase 1 PC2 Prohormone Convertase 2 PKC Protein Kinase C

PAGE 23

23 POMC Proopiomelanocortin Q Gln, Glutamine R Arg, Arginine RAMP Receptor Activity Modifying Protein RP HPLC Reverse Ph ase High Performance Liquid Chromatography rRNA Ribosomal RNA RT Room Temperature RT PCR Real Time Polymerase Chain Reaction S Ser, Serine SAR Structure Activity Relationship SEM Standard Error Of The Mean SSC Side Scatter Channel SPPS Solid Phase Pe ptide Synthesis StBu Tert Butyl Thioether T Thr, Threonine TATU N [(Dimethylamino) 1H 1,2,3 Triazolo[4,5]Pyridine 1 Ylmethylene] N Methylmethanaminium Tetrafluoroborate N Oxide TBTU N [1H Benzotriazole 1 Yl(Dimeth ylamino)Methylene] N Methylmethanaminium Tetrafluoroborate N Oxide tBu Tert Butyl TFA Trifluoroacetic Acid THF Tetrahydrofuran Tic Amino 1,2,3,4 Tetrahydroisoquinoline Carboxylic Acid TM Transmembrane TPI Torrey Pines Institute

PAGE 24

24 tRNA Transfer RNA Trt Trityl UV Ultraviolet V Val, Valine W Trp, Tryptophan WHO World Health Organization WT Wild Type Y Tyr, Tyrosine MSH Alpha Melanocyte Stimulating Hormone MSH Beta Melanocyte Stimulating Hormone MSH Gamma Melanocyte Stimulating Hormone Micromolar

PAGE 25

25 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy RATIONAL DRUG DESIGN APPROACHES TARGETING THE MOUSE AND HUMAN MELANOCORTIN RECEPTORS By Erica Marie Haslach August 2011 Chair: Carrie Haskell Luevano Major: Pharmaceutical Sciences Pharmacodynamics The predominance of obesity (body mass index >30) is a major health concern. Those considered to be obese a re more prone to heart disease, diabetes, hypertension, cancer and many other problems. The melanocortin system is comp rised of G protein coupled receptors and a series of endogenous agonists and antagonists. The MC4R is involved in energy and weight homeostasis and food regulation and has become a drug target for the design of drugs for the treatment of obesity and relate d diseases. The interplay between the melanocortin agonists, antagonists and MC4R may be a potential significant therapeutic tool for obesity and related diseases. The first section reports the generation of mutant receptors based on the Asn123, Phe184, a nd Asp189 hMC4R residues. Each receptor was evaluated based on molecular recognition, rec eptor expression, and pharmacologically characterized with ligands. It is hy pothesized that these receptor amino acids have specific interactions with the melanocortin agonists and antagonists. The determination of specific residues required for the ligand binding of agonists or antagonists will help in the design and discovery of molecules that find a balance between these two types of ligands and may act as therapeuti c tools for the treatment of obesity.

PAGE 26

26 The second project investigates the use of screening combinatorial chemistry libraries, deconvolution, and synthesis of hits to identify lead compounds for a naturally occurring hMC4R mutation that has been shown to c ause obesity in human patients. The L106P hMC4R polymorphism has been reported as a heterozygous polymorphism in an obese patient. Endogenous melanocortin a gonists have decreased affinity, while synthetic tetrapeptides were shown to exhibit potent activity This mutation is located in the putative binding region for ligands and may be distorted due to the amino acid change. After multiple pharmacological screening steps, synthesis of hits, and characterization of new peptides has le d to the identification o f unique sequences that can elicit nanomolar agonist potency at this polymorphism. Overall, ligand SAR and site directed mutagenesis of the MC4R will aid researchers in gaining further molecular insight to the inner workings of this complex pathway and ad vance the understanding of multifaceted disease states.

PAGE 27

27 CHAPTER 1 INTRODUCTION Obesity Obesity has been recognized by the World Health Organization as one of the major global health problems for all ages, and this burden is becoming increasingly more harmful to society. 1 According to the Centers for Disease Control and Prevention, about two thirds of adults in the United States are either o verweight or obese. Obesity has become the second leading cause of preventable de ath in the United States 2 The rising incidence of obesity may be due to a combination of high fat diet, lack of exercise and genet ic pre disposition. Those considered obese are more prone to heart disease, type II diabetes, hypertension, cancer, stroke and many other health problems. 3,4 The body mass index (BMI) is used to quantitatively measure adiposity and is defined as an ilograms divided by the square of the height in meters (kg/m 2 ). 1 This tool can be used for the note that the BMI scale does not differentiate be tween fat mass and musc le mass T herefore, a BMI value may be skewed for those having a higher muscle mass than fat mass. A BMI value of 18.5 or less is considered as underweight, and a normal weight has a value of 18.5 24.9. Those considered as overweight have a BMI that is equ al or more than 25 and a BMI of 30 or greater is classified as obese. 2 4 The understanding of genetic factors influencing body weight regulation is homeostas is can be maintained through the control of genetic factors found within the melanocortin pathway. The melanocortin system is known to be involved in the regulation of body weight, energy homeostas is and cardiovascular function 5 15 Weight

PAGE 28

28 homeostasis can be maintained through the control of POMC, ASP, AGRP, and MC3R and MC4R, which are genetic factors found within the melanocortin pathway. 5 13,16 26 The modification of one of these factors can result in obesity and lead to obesity related diseases. 5 13,16 26 Overview of the Melanocortin System The melanocortin system (MC) participates in the regulation of a plethora of physiological pat hways including skin and hair pigmentation, steroidogenesis, energy and weight homeostasis, food intake, cardiovascular, sexual function and exocrine gland control. 5,8,9,15,27 43 The melanocortin system belongs to a superfamily of G protein couple d receptors (GPRCs) consisting of endogenous agonists, antagonists and five receptor subtypes 27 29,35,37,39,42 48 ( Figure 1 1 ). The transmembrane proteins GPCRs partake in vital rol es in cellular signaling to moderate many important physiological processes, including vision, smell, taste, behavior, memory, immune response, cellular differentiation, heart rate regulation and energy homeostasis. The GPCR superfamily encompasses the lar gest known f amily of cell surface receptors; for example, there are about 1000 genes that encode for this type of protein in the human genome 49 These helical transmembrane domains, an extracellular N terminus, an intracellular C terminus, and conserved residue motifs. 49 51 Stimulation of GPCRs c an occur through the use of different agents including light sensitive compounds, odorants, hormones, neurotransmitters, amino acids, nucleotides, peptides, and small molecules. 51,52 The binding o f a signal molecule to a GPCR results in a conformational change and intracellular activation of trimeric G proteins. These G proteins function as an on or off switch depending on which of the two guanine nucleotides is attached, guanosine diphosphate (GDP ) or guanosine

PAGE 29

29 triphosphate (GTP). When GDP is bound, the G protein is inactive and when GTP is bound the G protein is active. The change in conformation of the receptor leads to the release of GDP Then GTP binds to the receptor which results in the dis sociation of G into the subunits G and G that ultimately bind and regulate different cellular effectors. 50 53 There are six classes of GPCRs based on sequence homology and functional similarity, with the mel anocortin receptors belonging to the rhodopsin class. 27,49,51 The binding of an extracellular agonist to the GPCR results in a conformational change and induces the activation of the cyclic adenosine monophosphate ( cAMP) signal transduction pathway. 51,54 To date, five melanocortin receptor subtypes have been cloned and characterized within the melanocortin system. 27,28,35 37,45,48 Melanocortin Receptors The main role of the melanocortin 1 receptor (MC1R) is its involvement in skin pigmentation and hair coloration due to its expression on melanocytes. 27,30,31,55 57 It is also involved in the production of the melanin pigment. There are two types of melanin: eumelanin and pheomelanin. 30 The binding of MSH to the MC1R results in the production of eumelanin, a brown/black pigment. In the absence of MSH, pheomelanin is produced giving rise to a red/yellow pigmentation. 30 The MC1R has also been shown to be expressed by leukocytes, where it mediates the anti inflammatory properties of melanocortin pathway. 58 The melanocortin 2 receptor (MC2R) is the smallest mel anocortin receptor and is expressed in the adrenal cortex and adipocytes. 27,59 This receptor is involved in steroidogenesis by mediatin g the production of glucocorticoids and aldosterone. 27 It is unique because it is only stimulated by adrenocorticotropin hormone (ACTH) rather than

PAGE 30

30 by all of the endogenous melanocortin agonists. 27,60 62 Familial Glucocorti coid Deficiency (FGD), an autosomal recessive disorder, was first described in the 1960s and early reports speculate d that the disease might result from mutations in the MC2R. 63 67 The disease is characterized by no n responsiveness to ACTH, lowered glucocorticoid production, and elevated serum levels of ACTH. The disease normally presents in childhood with the onset of severe hypoglycemia and episodes of bacterial infection. These signs are accompanied by excessive s kin pigmentation. About 25% of FDG patients have mutations in MC2R, implying that other genetic causes have led to the same clinical phenotype. 68 70 The melancortin 3 receptor (MC3R) has been detected throughout th e body, specifically in the central nervous system, heart, pancreas and gastrointestinal tract. 5,35,44,48 The expression of this receptor in these various tissues suggests a possible role in the regulation of cardio vascular function, energy homeostasis and thermoregulation, however, its mechanism of action remains unknown 5,9 Knock out studies have shown that MC3R deficient mice have an increased fat mass and decreased lean mass, while maintaining the same body weight as th eir wild type (WT) littermates. 5,9 The melanocortin 4 receptor (MC4R) is detected primarily in the central nervous system and brain including the hypothalamus, spinal cord and cortex. 28,39,46,47 This receptor has been rep orted to be involved in energy homeostasis, obesity and appetite control in rodents and humans. 8 In c omparis on to their WT littermates, MC4R deficient mice are severely obese, hyperphagic, and developed hyperinsulinemia and hyperleptemia. 8,19 MSH stimulates the MC4R and results in

PAGE 31

31 a decrease in feeding behavior, however, MC4R knockout (KO) mice are unable to MSH and result in an obese phenotype due to increased feeding. 10 The endogenous anta gonist, agouti rel ated protein (AGRP) demonstrates to be a competitive antagonist of the MC4R to inhibit the stimulatory action of t MSH. 20,22 Transgenic mice were observed to exhibit an obese phenotype when the human AGRP was introduced to their genome, which is similar to the phenotype of MC4R deficient mice, therefore, proposing the hypothesis that AGRP is involved with obesity and hyperphagia within the MC4R. 8,13,20,22 Administration of the MC4R selective antagonists, Ro27 3225 and HS014, resulted in increased food intake and obese phenot ypes in mice 71,72 T hese changes indicate the involvement of the MC4R in feeding behavior, energy and weight homeostasis. 8 ,10,72 Based on these experimental studies, the MC4R has become a drug target for the design of drugs for the treatment of obesity. The MC4R has also been implicated in erectile function and sexual behavior. 40,41 The melanocortin 5 receptor (MC5R) has been linked to exocrine gland function and sebaceous gland lipid production. 33,34,37,42 The MC5R knockout mice resulted in diminished water repulsion on their skin and thermoregulation due to a decrease in sebaceous lipids. This receptor remains largely uncharacterized because of its expression in a multitude of tissues within the body. 33,37,42 44 Due to the variety of physiological responses mediated by the melanocortin receptors, this system prove s to be an important target for drug discovery and development. Melanocortin Agonists The prohormone proopiomelanocortin (POMC) gene encodes the endogenous melanocortin receptor agonists, a family of peptides that possess similar structural

PAGE 32

32 activity. 73 75 ( Figure 1 2 ) The POMC gene transcript is expressed in the brain, pituitary gland, immune system, skin, and several peripheral tissues. Prohormone convertases (PC1 2) posttranslationally process POMC at dibasic cleav age sites to generate the 1 2 melanocyte stimulating hormone (MSH) and adrenocorticotropin (ACTH) as indicated in Figure 1 2 74 Tissue specific processing of POMC is due to the presence of different PCs and result in different peptides. P rohormone C onvertase 1 is expre sse d in the anterior pituitary resulting in the production of ACTH, lipotropin (LPH), and a16 kDa N terminal fragment. Within the MSH and ACTH. 74 76 Table 1 1 details the sequences of melanocortin agonists, e ndogenous and synthetic. All of the melanocortin agonists contain a core tetrapeptide sequence, His Phe Arg Trp (HFRW), which is suggested to be important for molecular recognition and receptor stimulation. 77 80 Th e agonist, MSH is a thirteen amino acid peptide that is N terminally acetylated and C terminal amidated. 77,78,81 Its sequence corresponds to the first 13 N terminal amino acid residues of ACTH and is identical in all mamma ls. 82 The agonist, MSH is detectable in many regions of the central nervous system ( CNS ) and the periphery, such as skin, stomach, pancreas, kidneys, ovaries, and testis. 83 The most prominent physiologic MSH are skin pigmentation and regulation of energy homeostasis. 30 This endogenous agonist is a non selective ligand at the melanocortin receptors (MC1, MC3 5R). Extensive structure activity relationship (SAR) MSH, such as truncation studies, alanine scans, and D amino acid scans,

PAGE 33

33 led to the identification of the minimum active sequence and other potent ligand based on this peptide. 77 79,81,84 The minimum sequence was identified to be the tetrapeptide sequence Ac His Phe Arg Trp NH 2 and is found in all of the endogenous a gonists. 77 79 It is hypothesized that this sequence is i mportant for both molecular recognition and receptor stimulation. Additi onally, it is proposed that the bioactive conformation of this sequence incorporates a turn 85 87 Extensive SAR studies were performed on the tetrapeptide sequence, Ac His DPhe Arg Trp NH 2 to learn about the importance of each position stimulating the melanocortin receptors. 88 92 Each position was substituted with an alanine in a positional scanning approach. The substitution of His resulted in a peptide with a great reduction in potency at the receptors. 89 When DPhe was replaced by Ala, this resulted in a peptide that had a 1500 fold decrease agonist activity at the mMC1R and there was a complete loss of activity at the mMC3 5R at concentrations up to 100 88 Decreased potency was also observed at the four receptors when Arg was substituted with Ala. 91 At the last position, the use of Ala rather than Trp resulted in 220 fold decrease at the mMC1R, 2540 fold decrease in potency at the mM C4R, and 9700 fold decrease in potency at the mMC5R. There i s a complete loss of agonist activity at the mMC3R. 90 The use of various natural and unnatural amino acids at the His position, such as amino 2 naphthylcarboxylic acid (A nc ) showed to increase mMC4R selectivity over the mMC3R. See Figure 1 4 for the structure of Anc. The Anc incorporated ligand was a potent agonist at the mMC4R and a weak antagonist at the mMC3R. 89 Studies indicated that the His position may deter mine MC4R versus MC3R agonist selectivity. 89 Another study involved the incorporation of halogens at the para position of DPhe to see if

PAGE 34

34 fluorine (F), chlorine (Cl), bromine (Br ) or iodine (I) had an effect on affinity or potency. 88,92 The use of pF, pCl, and pBr substituted DPhe amino acids led to a slight improvement in ligand potency for mMC1R, mMC4R, and mMC5R. The larger halogen g an antagonist and partial agonist. It possessed potent full agonist activity at the mMC1R, mMC4R and mMC5R. Additionally, peptides with CF 3 at the para position or Cl at the meta position exhibit partial agonist/antagonism at the mMC3R. It is hypothesi zed that the halogenated peptides are resulting in mMC3R antagonists due to hydrophobicity and van der Waals interactions with other receptor residues in the postula ted hydrophobic binding pocket. 88,92 Structure act ivity studies at the Arg position revealed that the guanidinium side chain is important for receptor potency; however, this moiety is not necessary for agonist activity. The use of the amino acid homoArg resulted in a peptide that had a 56 fold increased a ffinity for the mMC4R over the mMC3R. 91 Other positional scanning approaches were undertaken with this sequence. For example, one study incorporated conforma tional constrained amino acids at the Trp position to induce restrict ion on the conformational fl ex ibility of the peptide backbone. 90 The use of biphenylalanine (Bip) or tetrahydroisoquinoline (Tic) at the Trp position within the tetrapeptide sequence led to the identification of peptides that resulted in selectivity for the M C1R a nd MC5R over the MC3R and MC4R. 90 See Figure 1 4 for the structures of Tic and Bip. Norleucine (Nle) D Phenylalanine (NDP) MSH, however, the Met 4 is replaced with the Nle amino acid to increase enzymatic stability and Phe 7 was substituted with DPhe to increase potency 93,94 This p eptide was shown

PAGE 35

35 to be highly potent and had prolonged activity in the classical frog ( Rana Pipiens ) and lizard ( Anolis carolinensis ) bioassay 94 Trunc ation studies on NDP MSH at the MC4R revealed that the minimum sequence for activity was Ac DPhe Arg Trp NH 2 and the inclusion of His showed that potency significantly increased at the receptors. 80 Additional SAR studies, such as truncation studies, identified Ser 1 Tyr 2 Ser 3 Lys 11 Pro 12 Val 13 to be non essential for molecular recognition and receptor stimulation while residues 4, 10, and 12 were determined to be importan t for the potency of the MSH and NDP MSH. 79,80,93 95 The endogenous agonist, MSH is a twenty two residue peptide that is not N terminally acetylated and C terminally amidated MSH (Table 1 1) 96 The normal maturation product of human POMC in non pit MSH in the octadecapeptide form (eighteen amino acids). Truncation studies involving MSH led to the production of two potent, non selective agonists, MSH (7 22) and MSH (9 22) This endogenous ligand i s proposed to play a r ole in inhibition of food intake. 96,97 MSH analogues that are generated from the processing of 1 2 3 MSH. 98,99 Further processing leads to the different sequenc es; 3 MSH is twenty three amino acids and is glycosylated at the Asn 15 residue and may be additional 2 MSH. The other analogue, 1 MSH is further truncated and C terminally amidated. 98,99 and MSH than the other melanocortin agonists. Adrenocorticotropin hormone (ACTH) is a thirty nine amino acid peptide with the first 1 24 residues being highly conserved in most mamma ls (Table 1 1) 57 It is interesting that even though all the endogenous agonists co ntain the core tetrapeptide

PAGE 36

36 sequence, HFRW, ACTH is the only lig and that can stimulate the MC2R. The ACTH agonist can also stimulate the other MCRs as well. ( Table 1 2) 62 It is hypothesized that the basic tetrapepti de, Lys Lys Arg Arg, at the C terminal, that MSH does not have, may be important for MC2R recognition and stimulation. 100 The introduction of a cyclic constraint into a peptide sequence can restrict the conformational flexibility of peptides. In addition, t he cyclic structure may lead to potent and selective ligands due to the stabilization of secondary structures. Cyclic peptides can be formed through four main methods by creating a bridge between: 1) two side chains, 2) side chain to N terminus, 3) side ch ain to C terminus, and 4) N to C terminus. Lactam or disulfide bridges are the most common forms of cyclization. The removal of Ser 1 Tyr 2 Ser 3 Lys 11 Pro 12 Val 13 amino acids in MSH led to the design of a potent linear derivative. 14,101 104 This linear derivative was designed including Nle, DPhe similar to NDP MSH, however, it also substituted Glu for Asp, the shorter acidic amino acid an d the basic Lys was used in place of Gly. 101 104 This linear compound, Ac [Nle 4 Asp 5 His 6 DPhe 7 Arg 8 Trp 9 Lys 10 ] demonstrated increased potency in comparison MSH. 101 104 It was demonstrated that this linear analogue adopts a folded conformation in which the side chain carboxyl group of Asp and the side chain of Lys were in close proximity to one another and a putative reverse turn occurs around the His DPhe Arg Trp residues. 101 104 This observation led to the addition of a lactam bridge between the side chains of Asp 5 and Lys 10 resulting in a 23 membered ring that MSH and a prolonged response in the frog skin assay and demonstrated increased potency in the lizard skin assay. 101 104 ( Table1 1, Figure 1 3 ) NDP

PAGE 37

37 MSH. 14,101 104 Cyclizing biologically active linea r peptides has provided evidence that conformationally restraining a peptide may have the p otential to increase stability, potency, selectivity, and have enhanced bioavailability. 14,87,101 107 Melanocortin Antagonists The melanocortin system is the only GPCR system known to date to be regulated by two nat urally occurring antagonists, agouti signaling protein (ASP) 56 and agouti related protein (AGRP). 20,22 Agouti and AGRP are paracrine signaling molecules, and are endogenous antagonists of the MC1R, MC3R and MC4R with subtype selectivity. 20,22,56,108 In addition, the melanocortin antagonists have been designated as orexigenic peptides suggesting that they induce an increase in food intake upon administration. 8,13,19,20,56,109 Agouti is a 131 amino acid peptide that regulates pigmentation in the MSH at the MC1R. 56,108 O verexpression of the agouti protein results in an increase in red/yellow pheomelanin pigment and a decrease in the normal brown/black eumelanin coloration in mice. 109 Also, an obese phenotype has been associated with these mouse strains. 56 Agouti is also a potent, competitive antagonist at the MC3R and MC4R. 56,108 In 1997, a gene was isolated and the protein that was encoded was found to be very similar to the melanocortin antagonist agouti. 13,20,22 It was named ag outi related protein (AGRP) and was shown to be primarily expressed in the adrenal gland and hypothalamus. 20 The agouti related protein is a polypeptide chain with 132 amino acids and within this chain there is a signal peptide sequence, aspartate (glutamate ) rich acidic middle portion and a conserved C terminal that contains ten cysteine residues. This antagonist, AGRP functions as a competitive antagonist in the brain receptors, MC3R and MC4R, and inhibits the actions of the melanocortin agonists and is

PAGE 38

38 po stulated to be involved in feeding behavior and energy homeostasis. 20 When the human AGRP gene was introduced into transgenic mice, these mice exhibited increased weight gain body length and food intake compared to their WT littermates. It has been reported that AGRP transgenic mice become obese, exhibiting a phenotype similar to that observed in the MC4R deficient mice. Therefore, it has been proposed that AGRP mediates its effects through the MC4R in the CNS. 13,20,22 In the absence of an agonist, it has been shown that AGRP may function as an inverse agonist at the MC4R and decreases basal cAMP levels. 110,111 There are differences in sequence between the two endogenous antagonists; however, the most significant similarity is the conserved cysteine rich C terminal domain (resid ues 87 132), see Figure 1 6 20,56,108,112 Within this region, there are ten cysteine residues that form five disulfide bonds. These disulfide bonds contribute to the stability of structure, potency and biological ac tivity. 113,114 The tripeptide, Arg Phe Phe, found in both antagonists has been identified to be important for antagonism at th e melanocortin receptors. 113 It is proposed that this sequence displays behaviors in antagonists that mimic the binding affinity of the cor e tetrapeptide, His Phe Arg Trp, in the melanocortin agonists. 115,116 Further discussion of the structure of AGRP can be found in Chapter 4. During the course of the development of NDP MSH and MT II, another synthe tic cyclic peptide was identified; however, it had antagonistic properties. The sequence of MT II is Ac Nle [Asp His DPhe Arg Trp Lys] NH 2 and when the DPhe group is replaced that led to the discovery of the an tagonist SHU9119. 14,104 When pharmacological ly characterized at the melanocortin receptors, this new ligand was shown to have potent antagonist activity at the mMC3R and

PAGE 39

39 mMC4R. Se e Figure 1 5 MSH, NDP MSH, MT II and SHU9119. Noteworthy effort has been made to enhance the knowledge regarding ligand receptor interactions of the melanocortin system through SAR of the endogenous hormones. 106 The ability to design more efficient, potent ligands that mimic the biological properties of the endogenous peptides is significant. Designing receptor targeted ligands that are selective, potent and drug like is very demanding and continuous research will aid the emergence of novel strategies to design compounds that will increase the understanding of the comp lex melanocortin pathway. Melanocortin System and Obesity and Related Diseases The melanocortin system has been identified to be involved in energy homeostasis, regulation of feeding behavior, obesity in rodents and humans. 5 13 The melanocortin pathway consists of five genetic factors, POMC, ASP, AGRP, and MC3R and MC4R that maintain energy and weight homeostasis. 5 14 The modification of one of these factors can result in ob esity and le ad to obesity related diseases. 5 14 Genetic modification of the gene transcript POMC, from which the endogenous agonists are derived, has been linked to obesity, adrenal insufficiency, and red hair. 12 When the coding region for the melanocortin agonists is removed from POMC, this results in mice that are hyperphagic, obese, show defective adrenal development and have altered pigmentation 12,25 The m elanocortin system is unique in that it has two naturally occurring antagonists, ASP and AGRP. 20,22,56 The mouse agouti protein, ASP, has been characterized as an antagonist of the skin MC1R and brain MC3R and MC4R. AGRP has been shown to antagonize MC3R and MC4R; when administered centrally it results

PAGE 40

40 in an increase in food intake. 8,13,20 22 In addition, the ectopic expression of the AGRP protein in transgenic mice results in hyperphagia and obesity. 20 13 The two centrally located receptors of the melanocortin system, MC3R and MC4R have been implicated in the regulation of energy and weight homeostasis. The MC3R knockout mice show ed increased fat mass and reduced lean mass, while maintaining a relatively normal body weight. 5,9 In addition, MC3R polymorphisms have been identified in the coding and pro moter regions of severely obese human patients. 5,9,23 However, the mechanism of the MC3R and its regulation of energy homeostasis still remain unclear. 5,9,23 The MC4R has bee n shown to be involved in energy and weight homeostasis. 8, 19 T his was substantiated by the observation that the targeted disruption of the MC4R gene in mice results in mice that were severely obese, hyperphagic, and developed hyperinsulinaemia and hyperleptemia. 8,19 In addition, the role of the MC4R in obesity is supported by the presence of naturally occurring polymo rphisms in human patients. 6,7,11,16,17,26,117 130 The melanocortin system has also been shown to be important in cardiovascular MSH leading to an increase in arterial pressure and heart rate. 15,131,132 Recently, Greenfield et al. demonstrated that the melanocortin system, specifically the MC4R, is involved in the regulation of human blood pressure. 15 Hypertension and blood pressure were observed to be lower in MC4R dysfunctional subjects in comparison to control subjects and could not be explained by changes in insulin levels indicating that the central melanocortinergic nature influences cardiovascu lar regulation. 15 The melanocortin agonists play a preventative role in human obesity; however, the administration of an

PAGE 41

41 agonist resulted in an increase in blood pressure in normal and overweight/obese patients with normal MC4R function. Therefore, this study demonstrated a link between the MC4R and cardiovascular regulation. 15 Another study examined the role of AGRP and blood pressure levels in rats. 131 Administration of AGRP decreased mean arterial pressure and heart rate, regardless of the increase in food intake and weight gain, suggesting t hat AGRP plays a protective role in cardiovascular function. 131 Tallam et al. also showed that MC4R knockout mice, although obese, hyperleptinemic, and hyperinsulinemic, were not hypersensitive. 132 The role of the melanocortin system in obesity, cardiovascular and other diseases makes it an attractive target for the design of drugs. Determining the interaction between these melanocortin fact ors can lead to a further understanding of obesity and cardiovascular diseases. Rational Drug Design Targeting Melanocortin System Through the advancement of molecular biology, genetics, and chemistry, potential lead compounds based on a known biological target can be designed to enha nce drug discovery and rational drug design efforts. This research investigates two experimental methods used to provide information about putative ligand receptor interactions for the design of drugs targeting the melanocorti n system: structure activity relationship (SAR) studies of peptides and receptor mutagenesis. Structure Activity Relationship Studies A common strategy in drug design is to comprehensively evaluate fac tors within a biological system. I n the case of the me lanocortin system there is a large focus on the endogenous agonists and antagonists and their interaction with the five GPCR subtypes. Modification of these endogenous effectors will provide insight to how the ligands a nd receptor are interacting, which m ay lead to hypotheses about down stream

PAGE 42

42 signaling. During analysis, the optimal amino acid sequence required for molecular recognition and receptor stimulation is a goal of SAR studies. The identification of this minimum sequence can lead to the design of analogues, peptidomimetics, and small molecules. There are many approaches to determine the ideal sequence needed for binding and activating the endogenous receptor. Truncation studies aid in determining the minimal peptide length necessary for binding and activation. Amino acids may be deleted sequentially from either end (N or C terminus) to determine their importance. galactosidase reporter gene assay, are employed to analyze the truncation peptides by obtaining agonist or antagonist activity 133 Changes in agonist and/or antagonist activity will reveal the significance of amino acid s within a par ticular sequence. 79 The next method of SAR is the alanine scan, which is another method to determine important residues within a peptide sequence. Alanine is one of the simplest amino aci ds with its side chain being a methyl group ( CH 3 ). This amino acid is a small, non polar, hydrophobic residue and due to its lack of reactivity, it is an ideal candidate to help optimize peptide sequences. This technique is conducted by performing a posi tional scan by replacing each amino acid one at a time with an alanine residue. It is hypothesized that the non reactivity of alanine causes it to rarely be directly involved in protein function; therefore, ligand receptor interactions may be disrupted due to the substitution of this residue within a sequence. Reduction or absence of activity associated with a substitution may lead to the deduction that th e position within the sequence is necessary either for binding, stimulation or a combination of both. No significant change in potency may mean that position within the sequence may not be

PAGE 43

43 an important position within the sequence Truncation and alanine scans are normally complementary methods to one another, supporting the importance of an amino acid in peptide sequences. 84 Another way to investigate the importance of an ami no acid at a certain position, the presence of a certain functional group or further support previous studies is to perform single and multiple su bstitutions within the sequence Amino acids may be replaced with those of opposite chemical properties. For example, hydrophilic residue (Arg) might be replaced with a hydrophobic one (Phe) to investigate the presence of a hydrophilic binding pocket, or v ice versa. 88 91,106 In addition, a technique used to gain information about sequences, specific amino acids, and secondary structure of a peptide is to stereochemically modify amino acids. 94,134 Most amino acids (AAs) are found in the L configuration in nature; therefore, the exchange of L AA for D AA can be used to examine changes in configuration and that effect on binding and stimulation. As mentioned earlier, the incorpora tion MSH, along with an additional substitution, lead to the identification of the potent NDP MSH. 94 Further information is gained f rom these substitutions that may provide insight of intermolecular interactions that are occurring between ligands and receptors. The presence of a binding pocket might be deduced from these studies. All the data obtained from SAR studies can be applied to generating a homology model of the receptor and lead to other proposed ligand receptor interactions that can be further investigated with additional peptide SAR studies or receptor mutagenesis. 55,116,135 140 Recep tor Mutagenesis Receptor mutagenesis is a receptor based drug design approach to determine ligand receptor interactions. Typically, once a biological system has been identified,

PAGE 44

44 ligands are designed to interact with a receptor system. However, this techniq ue employs the use of standard ligands at a mutant receptor to identify important residues or regions within a receptor. 117,121,122 A co mprehensive mutagenesis study that substitutes all receptor residues with all o f the standard amino acids and test the functional consequences is not experimentally feasible or practical. In 2009, Bromberg et al. introduced the concept of in silico modeling to provide insight into the relationships among sequences, structure and func tion. 141 Experimental methods are more reliable compared to predicting interactions through the use of computational studies; however, they are expensive and cumbersome to perform. The use of in silico modeling has been proposed to act as a rapid filter identifying residues and subsequent substitutions within a receptor that are functionally important. Modeling studies will never replace experim ental methods, though they can be incorporated into studies to provide a starting point. 141,142 Over 10 0 MC4R single nucleotide polymorphisms ( SNPs ) have been identified in human patients leading to a specific phenotype or disease, further supporting the importance of this receptor. 6,7,11,16,17,26,117 130 Receptor mutagenesis is an important tool in drug design. Naturally occurring mutations can be mimicked through the use of site directed mutagenesi s which can lead to identification of their interaction with known ligands and reason for inactivity. S tructure activity relationship studies can be performed to examine the molecular mechanism that is occurring due to a change in amino acid residue in a r eceptor. Then ligands can be designed that may correct for the inactivity that is proposed to be occurring at the polymorphic receptors. 117,121,122,141,142 Further discussion of this topic can be found in Chapter 3 and Chapter 5.

PAGE 45

45 Contribution of the Research in this Dissertation towards Rational Drug Design The demonstration that the melanocortin system is involved in obesity and related diseases has happened through the use of in vitro studies, animal models, feedi ng studies, and identification of naturally occurring polymorphisms in humans making it a viable drug target, especially the MC4R. This res earch is a two pronged approach; a chemistry perspective and a receptor pharmacology perspective. These research topi cs delve into peptide chemistry, peptide library design and receptor mutagenesis to (1) probe differentiation of agonist versus antagonist receptor pharmacology and (2 ) the restoration of inactivated mutant MC4Rs that have been linked to obese individuals. As noted above, the MC4R is involved in energy and weight homeostasis and food regulation and has become a drug target for the design of drugs for the treatment of obesity and related diseases. The interplay between the melanocortin agonists, antagonists and MC4R may be a potential significant therapeutic tool in obesity and related diseases. In Chapter 4, the research w as conducted to investigate specific interactions between agonists, antagonists and the MC4R. The melanocortin agonists are known to redu ce food intake, while the antagonists cause an increase in food intake. The determination of specific residues required for the ligand binding of agonists or antagonists will help in the design and discovery of molecules that find a balance between these two types of ligands and will act as therapeutic tools in the treatment of obesity. The research presented in Chapter 5 discusses the use of screening combinatorial chemistry libraries, deconvolution, and synthesis of hits to identify lead compounds for a naturally occurring mutation that has been shown to cause obesity in human patients.

PAGE 46

46 26,143 Natural mutations associated w ith diseases are remarkable from a clinical standpoint as they provide insights into the mechanism of pathogenicity and possible avenues for development of therapeutics. However, they can also provide the groundwork for more fundamental studies. They help us to decipher complex relationships between protein structure and function by identifying the major actors in the molecular machinery. Additionally, these mutations allow for the development of laboratory tools aiming at understanding specific processes. These general principles may be applicable to other genes in which rare mutations might be found to predispose humans to obesity. Overall, ligand SAR and site directed mutagenesis of the MC4R will aid researchers in gain ing further insight to the inner wor kings of this complex pathway and advance the understanding of multifaceted disease states.

PAGE 47

47 Figure 1 1. The Melanocortin s ystem

PAGE 48

48 Figure 1 2. Posttranslational processing of POMC into the melanocortin agonists (adapted from Irani et al. 83 ) Figure 1 3. Structure of the melanocortin core tetrapeptide sequence with the side chains highlighted

PAGE 49

49 Table 1 1. Amino acid sequences of the endogenous and synthetic melanocortin agonists. Agonist Sequence Endogenous Agonists MSH Ac Ser Tyr Ser Met Glu His Phe Arg Trp Gly Lys Pro Val NH 2 ACTH (1 24) Ser Tyr Ser Met Glu His Phe Arg Trp Gly Lys Pro Val Gly Lys Lys Arg Arg Pro Val Lys Val Tyr Pro MSH Ala Glu Lys Lys Asp Glu Gly Pro Tyr Arg Met Glu His Phe Arg Trp Gly Ser Pro Pro Lys Asp 1 MSH Tyr Val Met Gly His Phe Arg Trp Asp Arg Phe NH 2 2 MSH Tyr Val Met Gly His Phe Arg Trp Asp Arg Phe Gly OH Synthetic Agonists NDP MSH Ac Ser Tyr Ser Nle Glu His DPhe Arg Trp Gly Lys Pro Val NH 2 MT II Ac Nle c[Asp His DPhe Arg Trp Ly s] NH 2 Figure 1 4. Unusual AAs used in Ac HFRW NH 2 SAR studies

PAGE 50

50 Figure 1 5 Structures of melanocortin ligands with highlighted regions indicating important structural changes

PAGE 51

51 Table 1 2. Ligand potency for th e five melanocortin subtypes Receptor Ligand Potency MC1R MSH MC2R ACTH only MC3R MSH MC4R MSH = ACTH = MSH MC5R MSH Figure 1 6 Partial structures of the melanocortin antagonists, hAGRP and h Agouti, showing the C terminal region with the five disulfide bonds

PAGE 52

52 Figure 1 7 Flowchart of drug design process used in Chapter 4 from biologically active peptide AGRP. Red boxes indicate techniques employed in the resea rch conducted herein Figure 1 8 Flowchart of combinatorial chemistry drug design process used in Chapter 5 to identify lead compounds for specific receptor polymorphisms

PAGE 53

53 CHAPTER 2 GENERAL METHODOLOGIE S 1: CHEMISTRY Merrifield Approach Solid phase pept ide synthesis (SPPS) changed the scope of the production of synthetic peptides due to the work of Bruce Merrifield in 1963. 144 Merrifield introduced the concept of using an insoluble solid support to which the growing peptide chain is attached to during synthesis. Solution phase peptide synthesis is a highly labor intensive a nd costly method because this method requires extensive separation, purification and c haracterization at each step; low yields and side products were common. Solid phase peptide synthesis is preferred over solution phase due to several reasons. This method employs the use of excess reagents to drive reactions to completion producing high yields and decreased side reactions. Filtration and washing remove the excess reagent s, saving time and labor. Over the years, it has been shown that SPPS is acquiescent f or automation allowing the synthesis of peptides in a high throughput manner. 145 150 The solid phase synthetic strategy is illustrated in Figure 2 1 (with microwave SPPS conditions). Solid phase peptide synthesis e mploys the use of a solid resin bead to assemble a peptide chain from the C to N terminus. A commercially available li nker is attached to this resin. The carboxy l group of the C terminal amino acid is attached to a linker group, thereby attaching it to the resin. The N terminus of amino acids which is temporarily protected is removed prior to the addition of the next amino acid. Side chains of the amino acids are permanently protected until synthesis is complete and are removed once the peptide is cleaved from the resin. The second amino acid, with the N terminus protection, is then added to the reaction in excess with its carboxy group

PAGE 54

54 activated to generate an activated ester capable of amide bond formation depending on the coupling reagents employed 147 Amino acids and coupling reagents are added in excess during this technique to ensure the reaction is driven to completion reducing the chance of obtaining a truncated peptide. After the amino acid is successfully coupled to the resin, excess reagents are then removed from the reaction by filtration, and the resin is washed repeatedly with solvent. The N terminus protecting group of the dipeptide is then removed and the cycle of deprotecting and coupling continues until the desired sequence is made. The last step involves deprotection of the final N terminus protecting group. Once the intended peptide is completed, it is released from the solid support by cleavage of the linker from the resin and permanent orthogonal side chain protecting groups are removed. The peptide is then cleaved from the resin using a cocktail that contains reagents that will remove permanent side chain protecting groups. Scavenger reagents, such as water, alkyl silanes, phenol, and thiols, are included in the cleavage solution to reduce reactive intermediates that may result. 147 There are two main SPPS approaches: Boc (t butoxycarbonyl) 144,147,151 153 and Fmoc (9 Fluorenylmethoxycarbonyl) 154 solid phase peptide synthesis. See Table 2 1 for a comparison of structures and deprotection/cleavage conditions. The Merrifield or Boc synthetic strategy relies on t a mino group. This synthetic route employs the use of trifluoroacetic acid (TFA) to remove the Boc group. The permanent side chain protecting groups and peptide are liberated from the resin through a cleavage step with hydrofluoric acid (HF). Overall, the Bo c strategy relies on differential acid lability of side chain protecting groups. The Boc

PAGE 55

55 approach is not widely used anymore due to the danger and specialized equipment required for HF cleavage. 154 However, peptide chemistry was changed through the discovery of this technique and it continues to be advanced. 144,151 153 Fmoc Solid Phase Peptide Synthesis The Fmoc SPPS approach was introduced in 1970 and is more favorable due to the milder deprotection and cleavage conditions. 154 The Fmoc SPPS method makes use of an orthogonal side chain protecting group strategy with a base labile temporary protecting group and acid labile permanen t side chain protecting group on each amino acid. The amino group is protected by the base labile Fmoc group (Figure 2 1) that can be removed by using 20% piperidine in dimethylformamide (DMF) and the side chain protecting groups are not affected through this deprotection step. The peptide can then be rele ased from the resin with the use of TFA, a milder reagent compared to HF A dditional reagent scavengers are added to the cocktail solution to remove the side chain protecting groups. Fmoc chemistry is an efficient, safer alternative to the Boc strategy an d was used for the preparation of the peptides described herein. 154 Microwave SPPS The introduction of solid phase peptide synthesis changed the degree to which peptides were generated. Even with the use of excess reagents that can be washed away to drive a reaction to completion with decreased side reactions, manual peptide synthesis st ill has some disadvantages leading to the use of microwave energy to drive reactions to completion. 155 161 In the electromagnetic spectrum, microwave radiation is a form of energy low in the spectrum with a frequenc y of 300 to 300,000 megahertz. This form of energy falls below x rays, ultraviolet, visible and infrared within the

PAGE 56

56 electromagnetic spectrum. Due to the low frequency of microwave radiation, it induces bond rotation but not bond breaking. In peptide synth esis, microwave irradiation has been introduced to complete long peptide sequences with high degrees of yield and low degrees of racemization. 155 162 As peptides increase in amino acid length, the synthesis of the d esired peptide can become difficult. Usually peptides ranging from three to about twenty residues in length can be synthesized easily. However, as the peptide chain is being built stepwise onto the insoluble support (i.e. resin), the side chains may form a ggregates either with themselves or neighboring chains due to inter or intramolecular hydrogen bonding. 123,155,157,159 161 Microwave radiation used during the synthesis of peptides has become an efficient way to dr ive reactions to completion reducing aggregation. It has been shown to overcome common problems that arise in solid phase peptide synthesis, such as side reactions and aggregation, to achieve higher yields and greater purities of the desired compounds. 123,155,157,159 161 The use of microwave energy reduces synthesis time and reagent cost needed as well to complete synthesis. Microwave acceleration has proven to be a valuable tool that will only continue to become mo re prevalent in the future in both solid phase peptide synthesis and other chemical and biological techniques. 123,155,157,159 161 SPPS Resins Simplification of peptide synthesis occurred through the introduction of an insoluble, porous polymer to which the peptide chain is built upon. In addition, the critical step in peptide synthesis is the attachment of the first amino acid to the resin. An incomplete reaction in this first step will result in low yields, side re actions, and truncated peptides. Therefore, it is important to choose the best resin option for building

PAGE 57

57 a specific peptide chain. Resins vary in chemical composition, degree of cross linking, bead size, particle size distribution and amount of functionali ties that it can encompass. 147 An efficient resin has the ability to be physically stable and allow filtration of liquids due to the use of excess reagents in SPPS. Swell ing of resins in solvents, such as DMF (N,N Dimethylformamide), DCM (1,2 Dichloromethane) or NMP (N Methyl Pyrollidine), will permit removal of reagents. In addition, it must be inert to all reagents used during synthesis. Commonly used resins for peptide synthesis consist of 1% divinylbenzene cross linked polystyrene due to their readily ability to swell in synthesis solvents as those mentioned above. Resins are treated with linkers, which are functional units that act as a connection between polymer and amino acids. 147 The chain will remain covalently attached to the resin bead until cleaved using either HF or TFA, depending on the type of SPPS being employed. Cleavage o f the linker peptide chain from the resin will result in different C terminus functionalities depending of the type of resin used. 147 Normally, the C terminus will contai n an amide or acid. 147 Three commonly used resin classes are listed in Table 2 2, including linker, type of chemistry preferred, cleavage conditions, and functionality. T he first type are hydroxymethyl based resins which include examples such as Rink Acid 163 or Wang Resin. 164 Attaching amino acids to this resin require s esterification of the amino acid to a hydroxyl group, which is not easy to achieve. The attachment of Cys, His, Pro, Met, or Trp to this resin is especially difficult and may lead to side reactions. The next type of resin allows the initial amino acid coupling to readily occur through the use of aminomethyl based resins, such as Rink Amide. This type of resin contains a free

PAGE 58

58 amine that is coupled to the first amino acid forming amide bond, the normal peptide bond. 163 The last type of resins are ch lorotrityl based ones, such as 2 chlorotrityl. 165 Chlorotrityl resins are suggested if Cys, His, Pro, Met, and Trp are to be attached first on the peptide chain. The steric bulk of this type of resin can prevent diketopiperazide formation (Figure 2 4) during the attachment of the first two Fmoc amino acids, a serious problem in the synthesis of Fmoc Pro C terminal and Fmoc Pro Xxx C terminal peptides. 165 This can result in premature cleavage of a dipeptide, subsequently reducing the yield. This occurs with the use of Wang resins (hydroxymethyl based) due to the need to have the esterification reaction to attach the amino acid. In addition, Fmoc amino ac ids can be attached to 2 chlorotrityl chlori de resin with no racemization. The 2 chlorotrityl resins can be alternatives to Fmoc amino acid Wang resins where racemization of the first Fmoc amino acid is common as with Cys and His. 165 Pre loaded resins are ones that have the first amino acid attached reducing the chances of incomplete reaction that can occur during this step and could be detrimental to the rest of the synthesis. Pre loaded resins are sug gested if hydroxymethyl or chlorotrityl resins are needed for synthesis. This will avoid the first esterification step aiding in successful building of a peptide chain. A pre loaded resin was used in the synthesis of the AGRP monocyclic and bicyclic deriv atives as described herein A Leu Wang resin was enlisted for the synthesis of these peptides. Coupling Methods The peptide bond or amide bond is the condensation of one amino acid to another to create a peptide chain. This is a critical step during synth esis and the degree of completion of this reaction will affect the yield and side reactions that may occur.

PAGE 59

59 Therefore, it is crucial that each amino acid being coupled to the chain has a >99 % completion rate. Coupling of an amino acid requires the carboxy group of the incoming amino acid to be activated through the use of coupling reagents that will assist in a nucleophilic attack of the resin bound free amine to form the peptide bond. 147 Coupling reactions must proceed with minimal loss of stereostructural specificity of the amino acid. 147 Therefore, it is optimal to find a balance betwee n reactivity of amino acids and minimal racem ization. S ee Figure 2 5 for two common enantiomerization reactions of amino acids, enolization and oxazolone formation. Two main coupling strategies are used in peptide synthesis to activate the carboxylic acid of the amino acid, either addition of coupling reagents to the amino acid or use of pre activated amino acids. The utilization of coupling reagents is more commonly used for activation of amino acids with the use of carbodiimides, phosphonium or aminium sa lts. 147 Carbodiimides c oupling Carbodiimide activation has been the most commonly used coupling method since the introduction of SPPS in 1963 with N,N dicyclohexylcarbod iimide (DCC) and N,Ndiisopropylcarbodiimide (DIC) as the reagents of choice (Figure 2 6). 166 The reaction mechanism is summarized in Fig ure 2 7. The pathway involves the production of O acyl isourea in the presence of DIC with the amino acid to be coupled. The initial protonation of the carbodiimide may be prevented if a base is found in the reaction mixture, and will inhibit the formation of the fir st intermediate, O acylisourea. T he additional reactive species present can determine the route of which coupling can occur as shown in Figure 2 7. This intermediate may undergo conversion to N acyl urea because it is highly reactive and will de crease the amino acid available for coupling. As depicted, the O acyl isourea may react with a second amino acid to form a symmetrical

PAGE 60

60 anhydride. Formation of the amide bond occurs when this anhydride is attacked by the amino group of the resin bound amino acid. Symmetrical anhydrides are formed with the use of the solvent, DCM. (Figure 2 8 ). The O acyl isourea intermediate may react with the resin bound amino acid to form the desired amide bond. The presence of nucleophiles, such as HOAt (1 hydroxy 7 azabe nzotriazole) or HOBt (3 hydroxybenzotriazole) in solution will produce an active ester, OBt ester of the amino acid (Figure 2 9). Luckily, this intermediate is a good leaving group and subsequent amino acid attack of the O B t ester is released relatively fa st. 147 After amino acid activation, the addition of base is recommended to increase the rate of coupling reaction. In the synthesis process, DIC is preferred over DCC tod ay due to ease of use, the increased solubility of the urea formed and urea side products are much easier removed from the reaction mixture. However, the carbodiimide mediated coupling has been observed to lead to significant racemization of amino acids ( i.e. oxazolone formation). 147 The presence of coupling additives, such as HOBt or hydroxylamines, prevents these hig hly undesirable side reactions. 147 Phosphonium and a min i um c oupling Onium salts, phosphonium and aminium, are another widely used coupling method for the activation of carboxylic acids in the preparation of peptides. 147 The addition of a benezotriazole (HOBt and HOAt) with one of these salts will activate an amino acid. Figure 2 11 shows the most common onium salts used for amino acid acti vation in SPPS. The exact mechanism of onium based coupling of two amino acids is currently not known, however, it is postulated to proceed through highly reactive intermediates. 167 171 Phosphonium reagents may form the highly reactive acyloxyphosphonium salt, which continues on to form either an active ester or a

PAGE 61

61 symmetrical anhydride, depending on the presence of a hydroxybenzotriazole base. 167 170,172 For the aminium reagen ts, the acyloxyguanidino intermediate reacts with HOBt present in the reaction mixture. 167,168,171 The hypothesized mechanism of aminium salt activation is shown in Figure 2 12. In addition, aminium reagents may lea d to N terminal guanidine derivatives and chain termination. The use of BOP, phosphonium based coupling reagent (benzotriazol 1 yloxytris(dimethylamino) phosphonium hexafluorophosphate) leads to the highly toxic side prod uct hexamethylphosphorotriamide. 173 This coupling reagent was the first reagent high ly utilized in SPPS and a series of analogues (PyBOP or PrBrOP) have been developed that do not produce toxic side products. 174,175 In addition, the aminium based derivatives (HBTU, HATU, TBTU, and TATU) do n ot result in th ese toxic side products either. 176 Colorimetric Monitoring Methods During SPPS, it is helpful to monitor the completion of reactions to ensure the correct sequence is being synthesized and to reduce side reactions. Monitoring for the presence or absence of primary or secondary amines during SPPS can be performed through the use of two on resin colorimetric methods 147 : Kaiser test 177 and Chloranil test 178 It is important to note that these methods provide a dependable answer for short sequences (~2 25 residues) ; however, reliability of the tests is reduced for long or aggregated sequences. The Kaiser test is commonly used to detect the presenc e of primary amines that should be there on the latest amino acid in the peptide chain after Fmoc deprotection or absence of them after amino acid coupling. Ninhydrin is the main reagent used in this fast colorimetric method; it reacts with free primary am ines to 13). 177 If a free amine is present, the test will resu lt in a dark blue/purple color; however, the absence of a free amine will produce a

PAGE 62

62 yellow color indicating that the reaction has gone to completion. 177 Nin hydrin does not react with secondary amines; therefore, the Chloranil test is used to detect them, for example proline. Resin beads will produce a green blue when Chloranil (2,3,5,6 tetrachloro 1,4 benzoquinone) reacts with either primary or secondary ami nes to form 2,3,5 trichloro 6 (2 pyrrolidinyl vinyl) [1,4] in acetone. 178 Experimental Details Synthesis of AGRP Derivatives Peptide synthesis was performed using standard 9 fluorenylmethoxycarbonyl (Fmoc) methodology in a manual reaction vessel or on a CEM Discover SPS Microwave Peptide Synthesizer Figure 2 1 displays a general peptide synthesis scheme that was employed. The amino acids, Fmoc Lys(Boc), Fmoc Arg(Pbf), Fmoc DArg(Pbf), Fmoc Cys(Acm), Fmoc Tyr(tBu), Fmoc Cy s(Acm), Fmoc Phe, Fmoc DPhe, Fmoc Ala, Fmoc Asn(Trt), Fmoc Abu, Fmoc Thr(tBu), Fmoc Pro, Fmoc Asp(OtBu), Fmoc Val, Fmoc Gln(Trt), Fmoc Gly, Fmoc Leu, Fmoc Ser(tBu), Fmoc Glu(OtBu), and Fmoc His(trt) were purchased from Peptides International (Louisville, KY, USA). Table 2 5 displays the sequences of the AGRP derivatives synthesized (total 10 peptides). The monocyclic (EMH1 100, EMH1 120, and EMH3 25) and bicyclic peptides (EMH2 93, EMH3 45, EMH3 151, and EMH4 118) were assembled on Leu Wang resin (0.73 meq /g substit ution, 0.26 mmol scale). The resin was placed in a reaction vessel and allowed to s well for two hours or overnight in dichloromethane (DCM). All reagents were ACS grade or better. The Fmoc protecting groups were removed using 20% piperidine (Sigm a Aldrich) in N,N Dimethylformamide (DMF, Honeywell Burdick& Jackson), amino acid coupling (3 fold excess) was accomplished using Benzotriazol 1 yl oxy tris Phosphonium Hexafluorophosphate) (BOP, 3 fold excess) with a six fold addition of

PAGE 63

63 diisopropylethyla mine (DIEA). After each amino acid coupling and Fmoc deprotection step, the peptide sequence was monitored using the Kaiser/ninhydrin test. 177 Final peptide cleavage from the resin and amino acid side chain protecting group removal was performed using 82.5 % trifluoroacetic acid (TFA), 5% phenol (Sigma), 5% water, 5% 1,2 ethanedithiol (EDT, Fluka) and 2.5% triisopropylsilane (TIS, Aldrich) for 2 3 hours. After cleavage and side chain deprotection, the solution was concentrated and the crude peptide was preci pitated by addition of cold (4C) ethyl ether The crude peptides were centrifuged (Sorval Super T21 high speed centrifuge using the swing bucket rotor) at 4000 rpm for 5 minutes and 4C. The ether was decanted off and the crude peptide was washed using c old ( 4C), anhydrous diethyl ether and pelleted as before. Successive washings occurred to improve purity. The peptides were dried in vacuo for 48h. Peptide cyclization was performed using the following solution cyclization methods. Monocyclic s olution c yclization The peptides were cyclized as previously described. 134 Before cyclization, the linear peptides (EMH1 100, EMH1 120, and EMH3 25) were cleaved from the resin as discussed earlier. The crude, linear peptides were dissolved in glacial acetic acid water in a 4:1 ratio to a final concentration of 2mg/mL. Iodine (10 eq) was dissolved in methanol and added dropwise to the glacial acetic acid water mixture that contained the peptide. The reaction was stirred in the dark for 1 2 hours at room tempe rature and quenched by diluting with water (twice the amount of the total volume used for cyclization). The cyclized peptide was extracted with carbon tetrachloride (CCl 4 Acros) to remove excess iodine. The aqueous phase was rotovapped and lyophilized to obtain the crude cyclic peptide. Purification and analysis were performed as described below.

PAGE 64

64 Bicyclic c yclization The peptides were cyclized as previously described. 107 To produce two different disulfide bridges and ensure correct pairing for the bicyclic com pounds (EMH2 93, EMH3 45, EMH3 151, and EMH4 118), the corresponding thiol groups were protected with either Cys(trt) or Cys(Acm) groups. The trity l side chain protecting group was removed by the cleavage cocktail and the Acm remains stably attached under both acidic and basic conditions. 179 After cleavage, the linear peptide was purified and remained Acm protected. The purified peptide was oxidized in 20% dimethyl sulfoxide (DMSO, Sigma) in water to form the first disulfide bridge. The re action was performed in a 1:1 ratio of peptide (mg) to 20% DMSO in water (mL) for 24 48 hrs. The oxidation process was monitored using analytical RP HPLC for the disappearance of the linear peptide and the formation of the cyclized product in 10% to 90% ac etonitrile/water 0.1% TFA in 35 min at a flow rate of 1.5 mL/min. After oxidation cyclization, the peptide was lyophilized and the second disulfide bridge was formed following the iodine oxidation protocol described above for the monocyclic peptides. Tetr apeptide Library Targeting L106P hMC4R Peptides listed in Table 2 6 were synthesized using the following methods. Peptide synthesis was performed using standard 9 fluorenylmethoxycarbonyl (Fmoc) methodology in a CEM Discover SPS Microwave Peptide Synthesiz er. Figure 2 1 displays a general peptide synthesis scheme that was employed. Figure 2 3 displays a picture of the microwave synthesizer and set up. The amino acids, Fmoc His(trt), Fmoc DPhe, Fmoc Arg(Pbf), Fmoc Trp(Boc), Fmoc Tyr(tBu), Fmoc DArg(Pbf), Fmo c Tic (Synthetech), Fmoc DTic (Synthetech), Fmoc (pCl)DPhe, Fmoc (pI)DPhe (Synthetech), Fmoc (3I) Tyr(tBu) (Anaspec), Fmoc Lys(Boc), Fmoc (pCl)Phe, Fmoc (pNO 2 )DPhe, and

PAGE 65

65 Fmoc sp ecified. The tetrapeptides were assembled on Rink amide p methylbenzylhydrylamine (Rink amide MBHA, 0.37 meq/g substitution, 0.3 mmol scale). The resin was placed in a reaction vessel (25mL CEM reaction vessel) and allowed to swell for two hours or overnig ht in dichloromethane (DCM). All reagents were ACS grade or better. The Fmoc protecting groups were removed using 20% piperidine (Sigma Aldrich) in N,N Dimethylformamide (DMF) outside the instrument for two minutes and then deprotection solution was washed away. Additional 20% piperidine/DMF solution was added to the resin and further deprotected using the following conditions: Temperature = 75C, Power = 30 Watts (W), Time = 4 minutes with nitroge n bubbling the solution. After 3 5 minutes of a cooling down period, the reaction vessel was removed from the instrument to continue with synthesis. Amino acid coupling (3 fold excess) was accomplished using 2 (1H benzotriazol 1 yl) 1,1,3,3 tetramethyluronium hexafluor ophosphate (HBTU, 3 fold excess) with a 6 fold addition of N,N diisopropylethylamine (DIEA) and the desired amino acid (3 fold excess) dissolved in minimum DMF (DCM was not used in microwave synthesis). Table 2 5 indicates microwave synthesizer conditions for amino acids. Cysteine, Histidine and Argini ne have different conditions. 156,162 After 3 5 minutes of a cooling down period, the resin was washed and the method of deprotection and coupling was repeated until the desired chain was synthesized. After each amino acid coupling and Fmoc deprotection step, the peptide sequence was monitored using the Kaiser/ninhydrin test. 177 All peptides in library (Table 2 6) were N terminally acetylated with a 3:1 mixture of acetic anhydride and pyridine

PAGE 66

66 that bubbled with the resin bound peptide for 30 45 minutes. Final p eptide cleavage from the resin and amino acid side chain protecting group removal was performed using 95% trifluoroacetic acid (TFA), 2.5% triisopropylsilane (TIS), and 2.5% water for 2 3 hours at room temperature After cleavage and side chain deprotecti on, the solution was concentrated and the crude peptide was precipitated by addition of cold (4C) ethyl ether The crude peptides were centrifuged (Sorval Super T21 high speed centrifuge using the swing bucket rotor) at 4000 rpm for 5 minutes and 4C. Th e ether was decanted off and the crude peptide was washed using cold (4C), anhydrous diethyl ether and pelleted as before. Successive washings occurred to improve purity. The peptides were dried in vacuo for 48h Ligand Purification and Analysis The qual ity of the peptides was analyzed by using analytical high performance reversed phase liquid chromatography to access purity. From this assessment, a peak of interest was identified to be collected. Ligands were purified by Reverse Phase High Performance Li quid Chromatography (RP HPLC) using a Shimadzu chromatography system with a photodiode array detector and a semi preparative RP HPLC C18 bonded silica column (Vydac 218TP1010, 1.0 x 25 cm ). The volume of the purified peptide samples was then reduced on a r otavap followed by lyophilization The purified peptides were analyzed using RP HPLC with an analytical Vydac C18column (Vydac 218TP104). The purified peptides were at least >98% pure as determined by RP HPLC in two diverse solvent systems (10% acetonitril e in 0.1% trifluoroacetic acid/water and a gradient to 90% acetonitrile over 35 min or 10% methanol in 0.1% trifluoroacetic acid/water and a gradient to 90% methanol over 35 min). Molecular mass was

PAGE 67

67 determined by Mass Spectrometry on a Voyager DE Pro (Univ ersity of Florida Protein Core Facility).

PAGE 68

68 Figure 2 1. General scheme for peptide synthesis containing microwave condition s Table 2 1. Comparison of Boc and Fmoc structures and deprotection/cleavage conditions Boc Tert Butoxycarbonyl Fmoc F luorenyl methoxy carbonyl Deprotection Acidic Conditions (TFA) Basic Conditions (20% Piperidine/DMF) Cleavage Hydrofluoric Acid TFA, water, scavenger reagents Status Disfavored Preferred Structure

PAGE 69

69 Figure 2 2. Propose d mechanism for base catalylized removal of the N terminal Fmoc protection group

PAGE 70

70 Figure 2 3. Comparison of the manual and the microwave SPPS set up s.

PAGE 71

71 Table 2 2. Common types of resin used in SPPS Example L inker Type of Chemistry Functionality Cleavage Hydroxymethyl Based Resins Rink Acid Fmoc Acid TFA Wang Fmoc Acid TFA Aminomethyl Based Resins Rink Amide MBHA Boc Amide HF Rink Amide Fmoc Amide TFA Chlorotrityl 2 chlorotrityl Fmoc Acid TFA

PAGE 72

72 Figure 2 4. Diketopiperizine formation during synthesis using a hydroxymethyl linker and proline as the first amino acid Figure 2 5. Two common enantiomerization reactions of amino acids, enolization and oxazolone formation Figure 2 6. Chemical structures of coupling reagents DCC and D IC.

PAGE 73

73 Figure 2 7. Proposed mechanism of amino acid coupling using carbodiimide coupling reage nts

PAGE 74

74 Figure 2 8. Mechanism of amino acid coupling using carbodiimides through symmetrical anhydride formation. Figure 2 9. Proposed mechanism of amino acid coupling through active ester formation using carbodiimid es and HOBt as coupling reagents

PAGE 75

75 Figure 2 10.Proposed mechanism of oxazolone formation leading to amino acid coupling when carbodiimides are used. Figure 2 11. Structures of phosphon ium and aminium salts used in coupling reactions

PAGE 76

76 Figure 2 12. Proposed amino acid activiation with HBTU coupling reagent an aminium salt A) Possible mechanism of active ester form ation. B) Peptide chain termination due to N terminal guanidation side reaction.

PAGE 77

77 Table 2 3. Phosphonium and aminium based coupling reagents. Coupling Reagent Abbreviation Structure N [1H Benzotriazole 1 yl)(dimethylamino)methylamino)methylene] Nmeth ylmethanaminium hexafluorophosphate N oxide HBTU N [(Dimethylamino) 1H 1,2,3 triazolo[4,5]pyridine 1 ylmethylmethanaminium hexafluorophosphate N oxide HATU N [1H Benzotriazole 1 yl(dimethylamino)methylene] Nmethylmethanaminium tetrafluoroborate N oxide TBTU N [(Dimethylamino) 1H 1,2,3 triazolo[4,5]pyridine 1 ylmethylene] N methylmethanaminium tetrafluoroborate N oxide TATU Benzotriazol 1 yl N oxytris ( dimethylamino)phosphonium hexafluorophosphate BOP

PAGE 78

78 Table 2 3 Continued Benzotriazol 1 yl N oxy tris(pyrrolidino)phosphonium hexafluorophosphate PyBOP [Bromotris] (pyrrolidino)phosponium hexafluorophosphate PyBrOP (7 Azabenzotriazol 1 yloxy) tris(dimethylamino)phosphonium hexafluorophosphate AOP (7 Azabenzotria zol 1 yloxy) tris(pyrrolidino)phosphonium hexafluorophosphate PyAOP

PAGE 79

79 Figure 2 13. Proposed mechanism of primary amine detection using ninhydrin reagent Figure 2 14. Complex formed from the reaction of chloranil with a secondary amine

PAGE 80

80 Tabl e 2 4. Sequences of Monocyclic and bicyclic AGRP derivatives Name Sequence EMH1 100 DPAATAYc[CRFFNAFC]YARKL EMH1 120 DPAATAYc[C DArg RFFNAFC]YARKL EMH3 25 DPAATAYc[CR DPhe FNAFC]YARKL EMH2 93 c 1 [CUDPUATUYc 2 [CRFFNAFC] 2 YC] 1 RKL EMH3 45 c 1 [CUDPUATUYc 2 [C DArg FFNAFC] 2 YC] 1 RKL EMH3 151 c 1 [CUDPUATUYc 2 [CR DPhe FNAFC] 2 YC] 1 RKL EMH4 118 c 1 [CUDPUATUYc 2 [CRF DPhe NAFC] 2 YC] 1 RKL Table 2 5. Microwave synthe sizer coupling c onditions Amino Acid(s) Temperature Power Time His, Cys 50C 30W 5 minutes Arg 75C 30W 10 minutes All Other AAs 75C 30W 5 minutes Table 2 6. Single substitution tetrapeptides targeting L106P hMC4R Name Sequence EMH4 90 Ac His DPh e Arg Trp NH 2 EMH4 91 Ac Arg DPhe Arg Trp NH 2 EMH4 92 Ac Trp DPhe Arg Trp NH 2 EMH4 93 Ac Tyr DPhe Arg Trp NH 2 EMH4 94 Ac DArg DPhe Arg Trp NH 2 EMH4 99 Ac Tic DPhe Arg Trp NH 2 EMH4 100 Ac DTic DPhe Arg Trp NH 2 EMH4 101 Ac (pCl)DPhe DPhe Arg Trp NH 2 EMH4 102 Ac (pI)DPhe DPhe Arg Trp NH 2 EMH4 103 Ac (3I)Tyr DPhe Arg Trp NH 2 EMH4 95 Ac His Arg Arg Trp NH 2 EMH4 104 Ac His (pCl)DPhe Arg Trp NH 2 EMH4 105 Ac His (pI)DPhe Arg Trp NH 2 EMH4 96 Ac His DPhe Lys Trp NH 2 EMH4 106 Ac His DPhe Tic Trp NH 2 EMH 4 107 Ac His DPhe Arg Tic NH 2 EMH4 97 Ac His DPhe Arg (pCl)Phe NH 2 EMH4 98 Ac His DPhe Arg (pCl)DPhe NH 2 EMH4 108 Ac His DPhe Arg (pI)Phe NH 2 EMH4 109 Ac His DPhe Arg (pNO 2 )DPhe NH 2 EMH4 110 Ac His DPhe Arg Nal NH 2

PAGE 81

81 CHAPTER 3 GENERAL METHODOLOG IES 2: MOLECULAR BIO LOGY Epitope Tagged Receptors There is lack of information about where melanocortin receptors and accessory proteins are expressed in vivo because suitable specific anti bodies for these proteins are not readily available Northern blot s, RT PCR, and in situ hybridization suggest areas of receptor expression. Therefore, protein expression and neuroanatomical localization of these MCRs has not been quantified. Epitope tagging has been employed to characterize and localize the receptor by using biochemical and immunocytochemical methods. An epitope is a region of a molecule, such as a specific amino acid that stimulates the production of antibodies. The process of epitope tagging a receptor involves the introduction of a defined, short amin o acid sequence to the primary amino acid sequence of the receptor. The epitope tags have an antibody that has been produced previously. Normally, tags are about 10 15 amino acids in length to provide specificity of the antibody. The placement of the epito pe tag depends on the nature of experiment proposed and results expected and the structure GPCR itself. 180 The most commonly used epitope tags are HA, Myc, or FLAG tags. Usually, tags are placed at either the N or C termini of GPCRs. 180 The Flag tag is a commonly used tag and actually has three different monoclonal antibodies to it (M1, M2 and M5). These antibodies recognize different regions with in a protein. The M1 recognizes the tag sequence only when it is positioned at the N terminus of a protein and requires Ca2+ to bind to the tag. 180 The M5 disti nguishes the tag sequence when it is placed at the N terminus; however, it requires that the initiator Met is present. The M2 is not Ca2+ dependent and recognizes the sequence throughout

PAGE 82

82 th e protein or at the C terminus. 180 In the Haskell N terminus FLAG is used with the melanocortin receptors. 117 This novel tag has the sequence DYKDDDDK and is positioned at the extracellular N terminus of the melanocortin receptors. 117 The location of the tag outside the cell will allow fluorescent antibodies directed against it to provide cell surface expression monitoring. Green fluorescent protein (GFP) can be used to examine trafficking, localization and expression of the receptors within the cell. 180 The intr acellular localized C terminus has been hypothesized to be involved in phosphorylation, internalization and desensitization activities; therefore, the use of C terminal tags may be used to observe receptor regulation within cells. 180 Site Directed Mutagenesis Conventionally, drug discovery beings with the design of ligands to interact with a receptor syste m in a ligand base d approach. However, since the cloning of the first GPCR led to the i ntroduction of mutagenesis studies in the early 1980s, a receptor based drug design approach was launched as briefly discussed earlier. 181 183 The GPCRs are the largest family of seven trans membrane proteins and are involved in many diseases becoming the richest source of targets in drug design. 51 The cloning of GPCR genes, sequencing of human genome, mechanisms of function and signaling, and the development of the bovine rhodopsin and 2 adrenergic crystal stru cture s are notable advancements in the field. 51,181,182,184 189 The understanding of GPCR structure is based largely on the high resolution structures of the inactive stat e of rhodopsin. Even though the rhodopsin re ceptor family is the largest family of GPCRs, there is still great diversity of receptors within a family, especially at the N terminus. 51,182,184,185 However, the direct structural data of these proteins still rema in limited, mainly due to the lack of

PAGE 83

83 crystal structures. It is difficult to solve crystal structures of GPCRs because they are integral membrane bound structures. The key problems in acquiring GPCR structures include protein production, purification, stab ility and homogeneity. Flexibility is a property of GPCRs, which may be functionally important for the proteins facilitating conformational changes related to ligand binding and activation of the receptor, however, this is an obstacle in the formation of c rystals. The flexibility of GPCRs means that the protein is constantly moving and exist s in multiple, different conformations. 51,182 Since GPCRs do have conserve d structural features it was possible to develop a putative model of the melanocortin GPCR system loosely based on the structures of rhodopsin, NMR and receptor mutagenesis studies. 116,136,137,184 Site directed mu tagenesis is a technique that involves creating point mutations within the receptor DNA that will only modify one amino acid residue in the final translated protein. This method is an indirect way to examine the role of single amino acids or regions that a re involved in specific functions in GPCR signaling, ligand receptor interactions, receptor activation, signal transduction, receptor expression and regulation. It can be used to further examine ligand receptor interactions that may be postulated from homo logy molecular modeling studies 51 A receptor based drug design approach can be u sed to identify and/or support proposed ligand receptor interactions. In addition, amino acids may be substituted to explore the presence of binding pockets within a receptor. Site directed mutagenesis tests known ligands at mutant receptors to examine bin ding and functional consequences due to the substituted residue. Choosing a targeted amino acid residue within a receptor system to mutate is normally based on previous mutagenesis or

PAGE 84

84 modeling studi es. The first strategy would be identifying conserved amin o acids within the receptor family itself and among other similar GPCR families. The presence of conserved residues in a receptor family implies that these amino acid(s) is/ are necessary for an important function, such as ligand binding. However, it is als o proposed that different residu es among receptor subtypes lead to ligand selectivity and different downstream physiologically roles. As reviewed the melanocortin receptor subtypes respond differently to the endogenous agonists. 106,190,191 Another method in choosing amino acids to target in mutagenesis studies would be to select residues that have been of interest of other GPCR families. Site directed mutagenesis can also be used to study natural polymorphism found in animals and humans that lead to specific phenotypes or diseases. 117,121,122 Naturally occurring mutations may result in loss of function or constitutive activation of the receptor. The ability to mutate the rece ptor can be used to mimic natural polymorphisms and they can be pharmacologically characterized based on their interactions with known standard ligands. Ligands can then be designed based on the mutagenesis data that may restore function within the polymor phic receptor. 6,7,11,24,26,117,120 122 In addition, further insight to structure function relationships and the molecular mechanism that may be leading to a specific phenotype disease can be ascertained. Lack of aff inity for endogenous agonists/antagonists or a reduction in cell surface expression may be the mechanism leading to the inability of a receptor to function properly. If the protein is not folding properly or post translated processed, it may be degraded le a ding to the lack of expression. 68,192 A significant therapeutic tool in treating individuals with genetically inactive receptors is the discovery of a ligand that can convert an inactive receptor into

PAGE 85

85 a functional one. 122,193 Further discussion of SNPs and the beginning steps to restore activity in polymorphic receptors is found in Chapter 5. Similar approaches of ligand design can be applied to the receptor based drug desig n method. For example, an alanine scan can be performed in which residues of interest are replaced with the non reactive alanine amino acid to investigate the role of a receptor residue side chain. If binding of ligan ds and stimulation is changed, it can b e proposed that the specific residue is either involved in important ligand receptor interactions or plays a role in the signal transduction mechanism. Also, residues can be substituted with those of opposite chemical properties. For example, if there is a putative hydrophilic binding pocket and one of the residues participating within is changed to a hydrophobic group lacking a charge, then the ligand receptor interactions may be perturbed thus binding or potency may be altered. The analysis of the resul ts received from mutagenesis studies must take into consideration that a mutation may have a localized structural effect, disturb interactions required for ligand binding and functional activity, or obstruct the overall str ucture. In addition, the mutation may affect biosynthesis of the receptor, post translational processing, and trafficking to the cell surface, or a combination of these effects. 68,117,192 Complementary experiments are normally performed on mutant r eceptors: 1) fluorescence activated cell sorting measures cell surface expression, 2) radioactive competitive binding assay examines molecular recognition (binding), and 3) development of a pharmacological profile with known ligands to identify functional activity. 117 See Figure 3 1 for examples of results for these tests.

PAGE 86

86 Receptor mutagenesis studies of the melanocortin receptors has lead to the discovery of essential receptor residues providing important information about ligand receptor interactions, nature of binding pockets, especially for the mMC1R 55,137 and mMC4R 116,136,139,140,194 and plausible mechanisms of action for SNPs. 117,121,122 This information allows the further design of peptides and small molecules that can exclusively interact with the binding pockets or correct for inactivity at a naturally occurring polymorphism. The purpose of stud ying mutant receptor s is to determine specific ligand interactions taking another step towards rational drug design process. Site directed mutagenesis is performed through the use of a polymerase chain reaction (PCR) strategy involving two matching oligo nucleotide primers, a forward and reverse primer that incorporates the intended mutation. The PCR method i s used to amplify the plasmid DNA with the altered codon. The Pfu polymerase is used because it is a heat stable DNA polymerase and will minimize mist akes in copying the plasmid. 195 The resulting PCR product is treated with DpnI, a restriction enzyme, that cleaves only methylated DNA, to digest the methylated WT DNA. Since the PCR product was generated in vitro it is unmethylated and is not cut. Bacterial cells are transformed through the treatment of the mutated DNA and onl y this mutated DNA should survive in the transformation process. Sequencing of the plasmid DNA from clones selected after transformation will verify that the mutated sequence has been incorporated and free of PCR induced errors The receptor construct con taining the intended mutation is cut with restriction enzymes and subcloned into the mammalian expression vector pCDNA 3 The plasmid is stably transfected into HEK 293 cells after further verification of correct mutated receptor sequence has been performe d. In stable tran s fection, selective

PAGE 87

87 pressure is placed on the cell to incorporate the new plasmid and stably express it for long period of time. The antibiotic Geneticin, or G418, is isolated from Micromonospora rhodorangea and is used for this selective process 196,197 It is toxic to both prokaryotic and eukaryotic cells; however resistance may occur through transfection of the neomycin resistant gene that is normally found in plasmids designed for mammalian transfection 196,197 Stably transfected cell lines are preferred in the process of generating mutant receptors versus transient transfection. Although they can take up to 6 weeks to be produced, the cells produce the protein of interest in stable quant ities for a long period of time. Stably transfected cells can b e characterized and utilized in assays to provide insight to the receptor in question 117 Functional Reporter Gene Assay Pharmacological characterization of new ligands or standard ligands at mutant galactosidase reporter gene assay based on the ability of the receptor to generate a second messenger res ponse after ligand stimulation (Figure 3 2) 133 A reporter gene is a standard method to monitor the expression level of another less characterized gene. A reporter gene is one that is well chara cterized and can be easily identified and measured. galactosidase reporter gene assay has been chosen for pharmacological characterization because it is a non radioactive colorimetric assay. 133 galactosidase is utilized in this functional assay to galactosidase reporter gene is fused to five copies of cyclic AMP response element (CRE) that can det ect the activation of CRE binding protein (CREB). 133 An increase in intracellular cAMP concentrati ons will result in the phosphorylation of CREB by protein kinase A. 133 Measurement of Gs activatio n can be made possible by monitoring CREB gene expression. 133

PAGE 88

88 galactosidase activity increases in a linear relationship which can be measured through a colorimetric assay. Ortho Nitrophenyl galactosidase activity. The substrate ONPG is colorles s galactosidase will cause the hydrolysis of this molecule into galactose and ortho nitrophenol, with the latter compound exhibiting a yellow color that can be spectrophotometrically measured. 133 See Figure 3 2 for a summary of this process. A ligand can be characterized as an agonist and/or an antagonist with varying degre es of potency. An agonist is a ligand that activates the receptor when stimulated to result in cAMP production at the melanocortin receptors. The potency of agonists is reflected through an EC 50 value, which is the effective concentration of a ligand where 50% of its maximal response is observed in a dose response manner 198 A partial agonist is one that re aches maximal stimulation, however, does not achieve a full response compared to a full agonist. 198 Inv erse agonists exert the opposite pharmacological profile of an agonist ; there is a ligand induced reversal of constitutive activity. 198 An antagonist binds to a receptor; however, it does not stimulate the receptor to produce a response. 198 An agonist may compete with an antagonist to bind at the same site on the receptor. This will result in the displacement of the agonist and a decrease in potency. If a ligand does not produce a response, it does not mean it is an antagonist. Schild analysis is performed to determine if a ligand is a competitive antagonist. 199 An assay is exercised that uses both a known potent agonist and the prospective antagonist. Displacement of the agonist from the binding sites, resulting in a decrease in

PAGE 89

89 receptor activation will support the presence of an antagonist. A ligand may h ave mixed pharmacology, in which it will encompass partial agonist activity and antagonist activity. Graphical representations of pharmacological results are presented in Figure 3 3 The log concentration of the ligand is shown in the x axis and the percen t stimulation in the y axis. Competitive Binding Assay Molecular recognition and characterization of cell line surface receptor expression levels of mutant receptors are assessed through the use of radioactive labeling studies. The introduction of a diffe rent amino acid may disrupt proper protein folding and reduce cell surface expression levels; therefore, evaluating the ability of a receptor to recognize ligands is an important experimental tool. The NDP MSH ligand i s a synthetic melanocortin agonist tha t has shown to be highly potent and chemically stable upon iodination. The radiolabled l igand chosen was the isotope Iodine 125 which has a half life of 60 days. A tyrosine residue is needed to incorporate I 125 into the ligand. The NDP MSH ligand contains Tyr at the second position within the sequence. This reaction is performed according to the Chloramine T method. 200 In competitive binding assays, unlabe led peptide (cold) is used to competitively displace its labeled counterpart (hot) in a dose dependent response. The labeled peptide will only bind to proteins that are folded properly, processed and transported to the cell surface. Ligand receptor affin ity is quantified in IC 50 values, which are obtained through the generation of dose response curves by nonlinear regression where the maximum specific binding is normalized to 100%.

PAGE 90

90 Flow Cytometry Flow cytometry (FC) is an important technique that is comp lementary to I 125 NDP MSH competitive binding studies for the indication of molecular recognition of ligands through the measurement of cell surface expression. This method rapidly counts and examines microscopic particles that are found suspended in a str eam of fluid, one by one. 201 Fluorescent activated cell sorting (FACS) is a specialized type of FC that separates the cells in a suspension based on light scattering and size and color of their fluorescence. 201 Cells are labeled with a fluorescent dye that is coupled to a monoclonal antibody and binds to cell s that have the specific antigen. The cell suspension is directe d into the center of a rapidly flowing stream of liquid where it is separated into individual droplets with one cell per droplet. 201 A laser beam is directed onto the stream of liquid with a number of detectors aimed at a specific point where the stream passes through the light beam. Light striking each cell is scattered and is detected by the f orward scatter and side scatter channels, while the fluorescent dye emit s light at various frequencies providing information about the properties of the cell. The forward scatter channel (FSC) approximates cell size and is in line with the light beam. It c an distinguish between a live cell and debris. 201 The side scatter channel (SSC) provides details about the granularity and texture of the microscopic part icles 201 The combination of these detectors provides preliminary identification and measurements for differentiation of cell lines. Labeling with a fluore scent dye investigates cell structure and function. Photomultiplier tubes (PMT) collect both scattered and fluorescent light and converts them into electronic signals that result in a graphic display and statistical analysis of the measurements. 201 203

PAGE 91

91 Experimental Details MC4R In Vitro Receptor Mutagenesis Receptor mutagenesis was performed as previously described. 117,136 The human WT N terminal Flag tagged MC4R cDNA was gen erously provided by Dr. Robert Mackenzie 204 and was subcloned into the pBluescript plasmid (Stratagene) for subsequent mutagenesis. Site directed in vitro hMC4 receptor mutagenesis was performed using a polymerase chain reaction (PCR) based mutagenesis strategy introducing one amino acid change within each mutant receptor, as previously described by our laboratory. 117,136 The PCR reaction was performed by using Pfu turbo polymerase (Stratagene) and a complementary set of primer s were designed contai ning the nucleotide base pair changes resulting in the modified amino acid. The PCR reaction was executed under the following conditions: 95C 30 sec, 12 cycles of 95C 30 sec, 55C 1 min, 68C 9 min. The PCR product was purified (Qiaquick PCR Purificat ion Kit, Qiagen) after the completion of the reaction and eluted in water. Subsequently, the sample was cut with Dpn1 (Invitrogen) to eliminate any methylated WT DNA leaving only nicked circularized mutant DNA. The mutant hMC4R DNA was transformed into co presence of the desired mutant was verified by DNA sequencing. The plasmid DNA containing the mutant was cut with the restriction enzymes HindIII/XbaI and ligated into the HindIII/XbaI restr ictions sites of the pCDNA 3 expression vector (Invitrogen). Complete Flag MC4R sequences were confirmed free of PCR nucleotide base errors by DNA sequencing (University of Florida sequencing core facilities).

PAGE 92

92 Generation of Stable Cell Lines Human Embryonic Kideny 293 (HEK293) cells were maintained as described previously by our laboratory 136 in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal calf serum (FCS) and plated one day prior to transfection at 1x10 6 cell s/100 mm dish. Wild type and mutant DNA in the pCDNA 3 transfected using the calcium phos phate method. 205 Stable receptor populations were generated u sing G418 selection (0.7 1 mg/mL ) for subsequent bioassay analysis. 117,196,197 cAMP Based Functional Bioassay HEK 2 93 cells stably expressing WT and mutant recepto rs were transfected with galactosidase reporter gene as previously described. 133,136 Post transfection cells, 5000 15000, were plated into collagen treated 96 well plates and inc ubated overnight. Forty eight hours post transfection, the cells were stimulated with 3 0 4 10 12 M) or forskolin (10 4 M) control in assay medium for 6 hours. The assay medium contain ed Dulbecc o Modified Eagle's Media [DMEM 0.1 mg/mL bovine serum albumin (BSA) and 0.1 mM isobutylmethylxanthine (IBMX) ] Antagonists were profiled based on the ability of the ligand to competitively displace the MT II synthetic agonist in a dose dependent 136,199 The assay media was aspirated from the 96 (250 mM Tris HCl, pH 8.0 and 0.1% Triton X 100) was added. The plates were stored at 80C overnight. The plates containing the cell lysates w ere thawed the following day. For relative protein determination aliquots o l and transferred to another 96 well plate. The relative protein was determined by adding

PAGE 93

93 taken previously and the OD 595 was measured on a 96 well plate reader (Molecular buffered saline (PBS) with 0.5% mercaptoethano l, and 2 mg/mL of o Nitrophenyl D galactopyranoside (ONPG)] was added to each well and the plates were incubated at 37C. The sample absorbance, OD 405 was measured using a 96 well plate reader at several time points (Molecular Devices). Data po ints were normalized both to the relative protein content and non receptor dependent forskolin values. Assays were performed using duplicate data points and repeated in at least three independent experiments. Data A nalysis Agonist EC 50 antagonist pA 2 es timates, and their associated standard errors of the mean were determined by fitting the data to a nonlinear least squares analysis using the PRIS M program (v4.0, GraphPad Inc.) The antagonistic properties of the peptides were determined by the ability of the ligands to compet itively displace an agonist, MT II, in a dose dependent manner. The pA 2 values were generated using the Schild analysis method. 199 I 125 NDP MSH Competitive Binding Studies Iodination 125 of NDP MSH was prepared by Dr. Robert Speth (American Radiolabled Chemicals Inc., St. Louis, MO) using a modified Chloramine T method as previously desc ribed. 200 Human embryonic kidney 293 cells stably expressing the hMC4 WT and mutant receptors were plated (0.6 0.8) x 10 6 cells per well 1 3 days before stimulation in 12 well plates and were grown to full confluency. The peptide NDP MSH

PAGE 94

94 was used t o competitively displace the I 125 radiolabeled NDP MSH (150, 000 cpms per well) in a dose response manner MSH peptide concentration be in g tested and 150,000 cpms of I 125 radiolabled NDP MSH were added to the well and incubated at 37C for 1 hr. The assay media then was aspirated carefully and the cells were washed twice with freshly prepared assay buffer (DMEM and 0.1%BSA). The cells we re lysed with 0.5mL, 0.1M NaOH and 0.5mL 1% Triton X 100. The lysing reaction occurred for 10 15 minutes and the contents of each well were transferred to labeled tubes (16 x 150 mm). The contents of each tube were quantified on a n Ape x Automatic Gamma cou nter. Dose response curves (10 6 to 10 10 M) of NDP MSH and IC 50 values were generated and analyzed by the PRISM program (version 4.0, GraphPad Inc.) through a one site competition nonlinear least squares analysis. The per cent total specific binding was d etermined based upon the non specific values obtained using 10 6 M NDP MSH. Each experiment was performed using duplicate data points and repeated in at least two independen t experiments. The standard d eviations were derived from the IC 50 values from at le ast two independent experiments and using the PRISM program (v4.0, GraphPad Inc.) Flow Cytometry Flow cytometry analysis or fluorescence activated cell sorting (FACS) of the surface and intracellular expression of N terminally FLAG tagged WT and mutant h MC4 receptors was performed as described previously. 202,203 Flow cytometry experiments were performed at Sanford Burnham Medical Research Institute Lake Nona, FL in collaboration with Dr. Sally Litherland. Cell lin es were grown to near confluency and dissociated using dissociation buffer (Cell Stripper Non Enzymatic Cell Dissociation Solution, Cellgro) and incubated for 5 minutes at 4C. Cells were resuspended in sterile

PAGE 95

95 filtered FACS buffer (1%BSA, 0.1% Sodium Azi de, in 1X PBS, pH 7.2; Sigma Aldrich) and treated with 1mg unconjugated mouse IgG (Sigma Cat# 15381) to block nonspecific antibody binding (i.e. block Fc receptors). Cell surface receptor protein expression was determined through incubation at room tempera ture with an Allophycocyanin (APC) conjugated anti FLAG monoclonal antibody (Prozyme, San Leandro, CA Cat# PJ255 ). To detect total cellular receptor protein expression (surface and intracellular), surface labeled cells were fixed with 4% formaldehyde in 1 X PBS, subsequently permeabilized with saponin buffer [0.5% Saponin (Sigma) in FACS buffer, pH 7.2], and pelleted by centrifugation (600xg, 5 min, 25C). To label the total FLAG tagged cells, they were treated with the APC conjugated anti FLAG monoclonal a ntibody for an additional hour. Treatment with APC conjugated nonspecific IgG mouse antibody ( BP Pharingen Cat# 550854 ) served as isotype controls for the anti FLAG antibody APC conjugate monoclonal antibody to set the bac kground fluorescence staining. The BD Biosciences FACS Caliber Flow Cytometer was used to collect data for both stained cell percentages (surface and total) and a mean fluorescence per cell was measured from a minimum of 10,000 collected events for each sample. Each experiment was independ ently repeated two times with duplicate data points.

PAGE 96

96 Figure 3 1. Examples of competitive binding, flow cytometry, and functional a ssay r esults

PAGE 97

97 Figure 3 2. Schematic repre sentation of the galactosidase reporter gene assay

PAGE 98

98 Figure 3 3. Graphical representation of pharmacological curves

PAGE 99

99 CHAPTER 4 DETERMINATION OF UNI QUE INTERACTIONS BET WEEN MC4R AND AGRP All peptides were synthesized, purif ied and analytically characterized by Erica Haslach under the supervision of Dr. Carrie Haskell Luevano. Residue selection for mutagenesis and primer design was done by Dr. Carrie Haskell Luevano. The WT and mutant Flag hMC4Rs were generated by Dr. Zhimin Xiang Federico Portofilo and Amin Cheki (F184 series) and Erica Haslach (D189 and N123 series). Flow Cytometry for detection of receptor cell surface and total cell expression was performed by Erica Haslach in collaboration with Dr. Sally Litherland, Diab etes and Obesity Research Center, Sanford Burnham Institute for Medical Research at Lake Nona. Iodination of NDP MSH was done by Dr. Robert Speth, American Radiolabled Chemicals, St. Louis, MO. Competitive binding assays were performed by Erica Haslach Fu nctional assays were performed by Erica Haslach, Marvin Dirain, and Huisuo Huang. Functional assay data analysis was done by Dr. Carrie Haskell Luevano and Erica Haslach and binding data analysis was done by Dr. Carrie Haskell Luevano. Melanocortin Antagon ists As stated previously, the melanocortin system is the only GPCR known to date to be regulated by endogenous antagonists. The agouti protein and agouti related protein (AGRP) modulate melanocortin receptor function with MCR subtype selectivity (see Fi gure 1 5 for structures ) After the discovery of the antagonist agouti, AGRP was discovered through database searches for molecules with homology to agouti in 1997. 20,22 Agouti related protein was identif ied to be expressed primarily in the arcuate nucleus of the hypothalamus, the subthalamic region, and the adrenal cortex; with a small amount of expression observed in the lung and kidney. 13,20,22 This protein

PAGE 100

100 funct ions as a competitive antagonist at the central MC3R and MC4R, and inhibits the actions of the melanocortin agonists. 13,20,22 Its major physiological function is in the hypothalamus, where AGRP acts as a potent orex igenic (appetite stimulating) factor due to its ability to antagonize melanocortin agonists at MC3R and MC4R. In the absence of an agonist, it has been shown that AGRP is an inverse agonist at the MC4R and decreases basal cAMP levels. 22,110,111,206 It has been proposed that AGRP mediates obesity and hyperphagia through the MC4R due to the observation that an obese phenotype was exhibited by transgenic mice when the human AGRP gene was introduced into their genome. 13 This phenotype is similar to that of the MC4R knock out mice. 8,19,20,22 It is hypothesized that AGRP may be an important therapeutic target for both the understanding and treatment of obesity related disease s and the involvement of the melanocortin system in the neuroendocrine regulation of energy homeostasis AGRP Structure Agouti related protein is a polypeptide chain with 132 amino acids, consisting of a signal sequence, aspartate (glutamate) rich acidic middle portion, and a conserved C terminal region (Figure 1 5) 112,207 The tertiary sequence of hAGRP (87 132) has been characterized to contain three loops: 1) N terminal loop, residues 95 98 LGQQ; 2) Central loop containing residues critical for a ntagonism, residues 111 116; 3) C terminal l oop consisting of AGRP residues. 112,207 There are ten cysteine residues found in the C terminal region of both agouti 108 and AGRP 112 that leads to the formation of five disulfide bonds. The disulfide bonds within the C terminal contribute to the structure stability, potency and biological act ivity of these peptides. 108,112 115,208 Three hAGRP disulfide bonds (Cys87 Cys102, Cys94 Cys108, Cys101 Cys119) were identified to be involved in a mammalian inhibitor cysteine knot (ICK) motif in the C terminal reg ion that

PAGE 101

101 contributes to the conformation of the active loop. 209 Within the ICK motif, a three stranded anti parallel sheet was identified. Two strands of this structural feature form hairpin involving hAGRP residues (106 120), that has been observed to be important for the antagonistic activity of hAGRP (87 132). 112 AGRP S tructure Activity Relationship Studies The minimum structural requirements for melanocortin receptor antagonist activity were on e of the first SAR studies undertaken once AGRP was discovered. In 1999, Tota et al. demonstrated that the N terminal region of the peptide was not a structural region needed for high affinity binding to the MC3R and MC4R while the C terminal region was f ound to exhibit similar binding affinity and antagonistic pharmacology to the full hormone 113 Supplementary studies were conducted to iden tify which regions of the C terminal domain contribute to antagonistic activity 113 One of the disulfide loo ps, CRFFNAFC hAGRP (110 117 ) within the C terminus contains a conserved tripeptide, hAGRP (111 113) Arg Phe Phe (RFF), whose side chains appear to be important. It is proposed that RFF sequence displays properties in antagonists that mimic the molecular recognition and receptor stimul ation properties of the core tetrapeptide, His Phe Arg Trp, in the melanocortin agonists. 113,134,136 In addition, the RFF motif was shown to be important for binding and antagonist activity at the MC3R and MC4R. 113,134,136,210 The RFF residues were found to be located in an external loop surface as observed through examination of 1 H NMR of AGRP (87 132). 112,209 The location of these residues in the region may allow interactions with the postu lated melanocortin receptor binding pockets. 112,113,136,207,209 M inor changes were observed for hAGRP(87 132) binding affinity at the melanocortin receptors when residues in the N terminal loop and C terminal loop w ere modified. 113 These additional SAR studies

PAGE 102

102 f urther supports that the central portion of hAGRP (87 132) is important for molecular recogn ition and stimulation. M onocyclic peptides based on the octapeptide loop, [Cys Arg Phe Phe Asn Ala Phe Cys], containing the Arg Phe Phe triplet were synthesized by Tota et al 113 All the synthetic derivates were active; however, all exhibited a lower affinity for the MC3R than the MC4R. Within that same study, linear derivatives were designed and synthesized in which all Cys residues were re placed by Ser, a polar non aromatic hydroxyl amino acid. It was shown that all the peptides were basically inactive at both receptors. This study resulted in the reduction of the large peptide hAGRP (87 132), to a ten residue analogue, Y c[CRFFNAFC] Y tha t retained a similar pharmacological profile to the C terminal domain. This decapeptide did exhibit a decreased binding affinity at the MC4R with an IC 50 binding affinity of 57nM compared to the full length C terminal peptide at the MC4R ( IC 50 = 3 .5nM). Thi s decapeptide is significantly shorter than the full length protein; therefore, it is hypothesize d that this characteristic may be hindering the ability of the peptide to achieve the ideal conformation to bind efficiently. Or it may lack additional pharmac ophores found within AGRP that contribute to potent antagonist activity that were not identified through SAR studies. 113 Interesting resul ts were found when this monocyclic decapeptide was pharmacologically characterized at the mMC1R. 211 It was found to be less potent at the MC3R and MC4R ; however it was found to exhibit agonist activity at the mMC1R. This was not observed with the endogenous hAGRP protein. 211 Additional SAR studies were conducted on this cyclic decapeptide due to the interesting activity observed at the mMC1R. A novel peripheral skin MC1R antagonist was discovered w hen the disulfide

PAGE 103

103 bridge formed by Cys110 Cys117 of Y c[CRFFNAFC] Y was replaced by a lactam bridge through the use of Glu a nd Dpr (diaminopropionic acid). 211 This result is interesting because the endogenous AGRP protein does not bind agonize or antagonize at the mMC1R It is also an antagonist at the MC4R, however, was not functional at the MC3R or MC5R. 211,212 Regaining MC3R pharmacology was the goal of subsequence structure activity studies using this decapeptide template, Y c[CRFFNAFC] Y 213 Peptide analogues were synthesized in which the N and/or C terminal domain s were extended or i ncluded additional cyclization domains based on previous studies done by Amgen 214 T wo monocyclic peptide se quences consisting of 14 amino acids with both MC3R and MC4R antagonistic activity were discovered 213 Based on the pharm acological profile of these two peptides, Yc[CRFFNAFC]YARKL NH 2 and TAYc[CRFFNAFC]YAR NH 2 it was hypothesized that the extension of the C terminus of the decapeptide template is necessary to re establish MC3R antagonism. 213 In additi on, it was proposed that Arg 120 (hAGRP numbering) of the peptide is important for activity at MC3R due to a postulated ha irpin secondary structure involving hAGRP106 120 as indicated by NMR. 112,209 Two bicyclic hAGRP derived compounds that were d esigned to determine the minimal sequence needed for maintaining MC4R antagonism were presented by Amgen 214 The bic yclic compounds contained extensions of the decapeptide bey ond the active central loop, hAGRP(110 117), including two out of the five disulfide bonds found in the C terminal region of hAGRP(87 132). 214 The additional Cys residues that were not participating in disulfide bonds were substituted with the pseudo isote

PAGE 104

104 aminobutyric acid (Abu, U ), see Figure 4 1 structural comparison. The hAGRP (91 122) derivative, did not include the disulfide bond containing the active loop, RFFNAFC, but did exhibit decreased antagonisti c activity at the MC3R and MC4R The other bicyclic analogue, hAGRP(101 122 ) exhibited binding affinity that was equipotent to hAGRP (87 132), however, was a 80 fold less potent mMC4R antagonist. 107 The three dimensional structure of the C terminal domain of AGRP was det ermined by 2D NMR and from the studies discussed above. 107,112,113,207,209,211 214 acetyl AGRP (87 120, C105A) based on the hypothesis that the ICK domain found in the C terminal region of AGRP can maintain the antagonistic activity of this region. 112,209 This peptide is more commonly referred to as mini AGRP, which possesses four of the five endogenous disulfide bonds 209 Mini AGRP exhibited receptor binding affinity and antagonism similar to the full length C terminal hAGRP(87 132) at the melanocortin receptors. 209 The Millhauser group identified an unique mammalian inhibitor cysteine knot (ICK) within the structures of hAGRP(87 132) and mini AGRP. 209 The disulfide bonds involved in this particular ICK are Cys87 Cys102, Cys94 Cys108, and Cys101 119, have been identified previously as being important for structure and activity of hAGRP. 209 The design of this mini protein confirmed the hypothesis that N terminal loop of this ICK region and the tri peptide were sufficient for fu ll biological activity. 107,112,207,209 Homology Modeling of AGRP Derivatives Docked into MC4R Model Homology molecular modeling is a technique used to predict protein structure and is a useful tool in the design of selective ligands. Detailed structure information can provide insight to how proteins function and interact with receptors. The production of a model depends on the amino acid sequence alignment of the target and the use of a

PAGE 105

105 known protein structure that i s homologous to the one in question. 116,215 I n a previous study done by the Haskell Luevano lab, a m MC4R homology model was generated using the Rhodopsin structure template, NMR and receptor mutagenesis data. 116,136 A binding pocket for agonists and antagonist s has been postulated to be located among TM1,2, 3, 6, and 7. The highly conserved extracellular loop 1 (EL) comprised of the acidic motif Asp X Asp is arranged around the edge of the cavity formed TM helices 1,2,3, and 7. 116,136 The configuration of EL1 could potentially allow it be involved in this binding pocket, aiding in the binding of large, long peptides such as the antagonist AGRP. 116,136 From the model, postulated int eractions between hAGRP(87 132) and mMC4R were observed that will be applied to the human MC4R. These putative interactions were studied through the design of stereochemical modified ligands and receptor mutagenesis as discussed herein. These studies were adapted t o the human receptor to obtain information about the interactions of melanocortin agonists, antagonists, and receptor that may lead to the development of t herapeutic tools in the treatment of human obesity. An in vitro mutagenesis study done by H askell Luevano et al. of the m MC4R revealed data postulating the importance of a few conserved residues needed for molecular recognition within the MC4R. 136 These conserved residue s include Glutamic Acid (Glu) 92 (Transmembrane 3, TM3), Aspartic Acid (Asp) 114 (TM3) and Aspartic Acid (Asp) 1 18 (TM 3 ) with Glu 92 and Asp 118 specifically ne cessary for recognition and binding of hAGRP (83 132). The numbering for these conserved residues are as followed: G lutamic Acid (Glu) 100 ( TM3), Aspartic Acid (Asp) 122 (TM3) and Aspartic Acid (Asp) 1 26 (TM 3 ) The highly conserved residues, Glu 92 (TM2), As p1 14 (TM3) and

PAGE 106

106 Asp1 18 (TM3), in the MC4R were observed to form a negatively charged pocket, formed by transmembrane spanning helices 1, 2, 3, and 7 and capped by the acidic extracellular loop 1. A study conducted by Wilczynski et al., postulated MC4R hAGRP ( 87 132) interactions that were identified from the 3 D MC 4R AGRP homology model complex. 116,136 Modeling studies identified possible interactions of the hAGRP(111 113) Arg Phe Phe residues with MC4R receptor residue s. 116 Figure 4 3 displays the interactions of the RFF residues with hMC4R numbering 116 The negatively charged pocket formed by Glu 92 (TM2), Asp114 (TM3) and Asp1 18 (TM3 ) may interact with hAGRP Arg 111 It is hypothesized that a strong and stabilizing ionic bridge is formed between the basic guanidinium moiety of the Arg and the acidic side chains of the Glu and Asp residues 116,136,140 A collection of MC4R hydrophobic and aromatic p henylalanine (Phe) residues in TM4 6 have been postulated to form a hydrophobic binding pocket. Modeling proposed that the Phe 112 and Phe 113 re sidues are observed to interact with this aromatic hydrophobic rec eptor pocket consisting of the MC4R Phe1 76 (TM4), Phe 193 (TM5), Phe253 (TM6) and Phe254 (TM6). 116,136 Figure 4 3 displays the interactions of the RF F residues with hMC4R numbering 116 Homology modeling presented overlapping interactions within the postulated binding pockets between the melanocortin agonist key residues DPhe Arg Trp and the antagonist Arg Phe Phe residues in the MC4R. 116,136 Haskell Luevano et al. presented experimental data suggesting that the conserved MC4R residues, Glu 92 (TM2), Asp114 (TM3) and Asp1 18 (TM3 ) are importan t for melanocortin based peptide molecular recognition. 136 For example, Arg 8 of th MSH numbering) was

PAGE 107

107 observed to interact with these same MC4R acidic residues that interacted with the Arg 111 residue. 116 The postulated binding pocket for DPh e Arg Trp can be seen in Figure 4 4 (with hMC4R numbering) This further supports the hypothesis that the Arg Phe Phe residues biochemically mimic the DPhe Arg Trp residues. As mentioned earlier, the C terminus of hAGRP and mini AGRP exhibited similar mel anocortin pharmacology to the parent protein, therefore, it was hypothesized that not all disulfide bridges within the C terminal domain are necessary for activity. 209 In addition, monocyclic and bicyclic analogues of hAGRP (87 132) have been synthesized to determine the minimal sequence necessary for antagonism at the MC4R. 107,134 The structures of the derivatives synthesized in this project can be seen i n Table 4 1 Some of t hese ligands were previously pharmacologically characterized and docked into a 3D homology molecular model of MC4R to identify possible ligand receptor interactions or lack of interactions between AGRP and MC4R. 116 Monocyclic Peptide Pharmacology and Modeling The monocyclic pept ide, DPAATAY c[CRFFNAFC] YARKL was designed based on SAR studies and was then pharmacologically characterized. 113,134,213 Both ends of the decapeptide template were extended beyond the minimal sequence; in addition, it hairpin motif hAGRP(106 120) and the proposed active loop. It demonstrated high nM antagonism at the m MC3R and m MC4R and was a full agonist at the m MC1R. 134 Previously, it has been observed that addition of D amino acids modifies activity and potency of a compound, such as the substitution of DPhe at Phe 7 MSH, which produced a potent ligand known as NDP MSH (Ac Ser Tyr Ser Nle 4 Glu His DPhe 7 Arg Trp Gly Lys Pro NH 2 ). 94 I t was noted that the RFF region of AGRP is important for activity t herefore, a study was d on e by Joseph et al. in which a D amino

PAGE 108

108 acid scan was performed on the hAGRP Arg Phe Phe (111 113) region in the monocyclic hAGRP(103 122) in hopes of increasing antagonist potency at the MC3 and MC4 receptors. 134 Sequences of analogues synthesized in this study can be found in Table 4 1 The addition of the D stereo isomers resulted in the lost of antagonistic activity at the m MC3R and m MC4R, except for the D Phe 112 analogue 134 The pharmacology for the DArg 111 analogue indicated that it is a 6 fold less potent agonist at the mMC1R, became a m MC5R agonist, the maximal stimulation for MC3R was reduced to 70%, and it exhibited micromolar ( M) MC4R full agonist pharmacology as compared to the control monocyclic peptide In comparison to the control, the DPhe 112 compound showed a 10 fold increase in agonist potency at the m MC1R, maximal stimulation of the mMC3R and m MC4R were reduced and ther e was a 13 fold increase in potency at the m MC5R. The DPhe 113 analogue displayed an 8 fold increase in m MC1R and m MC5R potency and was a full M agonist at both the m MC3R and m MC4R. 134 The observation that the D amino acids converted t hese analogues into agonists led to the hypothesis that L amino acids are needed to maintain potent antagonism of AGRP derived peptides at m MC3R and m MC4R. 134 T hrough the use of the m MC4R homology model, interactions were postulated for the DArg 111 and DPhe 113 an alogues of the monocyclic peptide that may account for the conversion from an antagonist to agonist. Modeling studies demonstrated that DArg 111 ligand showed to have postulated additional interaction with the m MC4R Asn1 15 (Asn123 hMC4R) while DPhe 113 liga nd putati vely interacted with MC4R Phe176 ( Phe184 hMC4R) 116,134

PAGE 109

109 There is a postulated hydrophilic binding pocket in which Arg 111 forms electrostatic interactions with Glu and Asp residues of the receptor. When the DArg 111 monocyclic peptide was docked into the model, it was proposed that there is an Asn 115 (Asn123 hMC4R) residue that is partaking in the binding pocket which was not proposed as an interaction with the docking of the control monocyclic peptide. It is hypothesized that the receptor residues Asp 114 and Asn115 conformation the DArg side chain in the model. It was additionally postulated that the Asp 1 18 residue is distant from the DArg analogue, not participat in g in the binding pocket. The human MC4R Asn123 residue was examined in this mutagenesis project as discussed below. It is hypothesized that the conversion of pharmacology that is occurring with the stereochemical modified monocyclic ligands will take plac e when characterized at the human receptors. In addition, t his interaction with Asn123 may explain the conversion of the monocyclic hAGRP (103 122) antagonist into an MC4R agonist. 134 In examining the docking of the DPhe 112 and DPhe 113 monocyclic p eptides, it was hypothesized that there was a different type of interaction of DPhe 113 with mMC4R Phe176 (Phe184 hMC4R) 134 It had been hypothesized that there Phe176 participates within a hydrophobic binding pocket T his proposed different interac tion may potentially explain the conversion of the monocyclic DPhe 113 substituted peptide acting as an agonist rather than an antagonist. The hMC4R Phe184 residue was examined in this mutagene sis project as discussed below. Bicyclic Peptide Pharmacology an d Homology Molecular Modeling Amgen previously presented AGRP bicyclic compounds that were developed based on the C terminus of hAGRP template encompassing the minimal length and

PAGE 110

110 cyclizations, while retaining nM MC4R pharmacology. 214 The derivatives contained two endogenous disulfide b ridges and the other Cys residues were replaced with the aminobutyric acid (Abu, U) as mentioned earlier 214 The bicyclic peptide seen in Figure 4 1B was previously reported and when tested at the melanocortin receptors resulted in equipotent binding affinity to that o f hAGRP (87 132) at the MC4R. However, it was an 80 fold less potent antagonist at the MC4R. 107,116 D ocking of hAGRP(87 132) and this bicyclic peptide into the 3D homology molecular model of m MC4R was conducted. 107,116 The decrease in antagonist potency may be attributed to a postulated additional interaction that was observed for this bicyclic peptide during the homology molecular modeling study. The modeling proposed that t he Arg 111 of the bicyclic peptide interacts with Asn1 15 of MC4R, whereas this interaction was not observed for hAGRP(87 132). 107,116 Wilczynski et al. postulated MC4R hAGRP (87 132) interactions that were identifie d from the 3 D MC4R AGRP homology model complex. 116,136 Modeli ng studies identified possible additional interactions of the hAGRP(87 132 ) residues with MC4R receptor residues It was proposed that Asp189 hMC4R may f orm interactions with the AGRP fragment. The side chain of Asn 114 of hAGRP(87 132) was identified to f orm possible interactions with m MC4R Asp18 1 (hMC4R Asp189 ) side chain. 116 In addi tion, other modeling and cross linking studies have postulated a novel interaction between Cys196(TM5) and Asp189 (EL 2 ) with the N terminal region of the NDP MSH synthetic agonist. 216 The Asp189 receptor residue is posulated to be located in EL 2 of the hMC4R, therefore, this interaction supports the hypothesis that that for large peptides the EC loops may contribute to molecular recognition and receptor functional activity.

PAGE 111

111 The hMC4R Asp189 residue was examined in th is mutagene sis project as discussed below. The data presented supports the hypothesis that the entire 46 amino acid sequence of the C terminus of AGRP and all five endogenous disulfide bonds are not necessary for nM antagonistic behavior. It also demonstra tes that hypotheses can be proposed due to the identification of postulated ligand receptor interactions based on the use of ligands and 3D receptor homology molecular modeling. The use of stereochemical modifications and receptor mutagenesis will delve in to proposed three ligand receptor interactions with the hypotheses and experiments conducted as discussed below. The first experiment investigates if there is a distinction between the MC4R and AGRP interactions as compared to the overlapping interactions of the melanocortin agonist ligands with the MC4R. This is based on the homology modeling of proposed AGRP based ligand interactions with the MC4R indicating that a MC4R residue might differentiate the melanocortin agonist receptor interactions from the A GRP antagonist receptor interactions. 107,116,134 Previous research using the bicyclic A GRP derivativ e (Figure 4 1B ) resulted in the development of the hypothesis that the residue DArg 111 interacts with the h MC4R Asn 123 (N123) in transmembrane 3. 107,116 The MC4R Asn1 23 (TM3) is identical in the mouse and human MC1R, MC3, MC4, and MC5 receptor subtypes and has not been previously hypothesized to be involved in the postulated mela nocortin agonist MC4R binding pocket. It is hypothesized that the DArg 111 analogues of the AGRP derivatives interact with the h MC4R Asn123 residue and these different interactions contribute to the conversion from an antagonist to

PAGE 112

112 agonist pharmacology pro file. Therefore, it is hypothesized that there are specific AGRP MC4R ligand receptor interactions versus the melanocortin agonists MC4R interactions. This hypothesis was tested by mutating the MC4R Asn123 to Ala nine (Ala, A) Asp artic Acid (Asp, D) Gl ut ami n e (Gln, Q) and Ser ine (Ser, S) residues. See Figure 4 5 for the structures of these amino acids The compounds listed in Table 4 1 were pharmacologically characterized at each of these hMC4 mutant receptors, and binding affinity characterization was p erformed at the hMC4R WT and mutant receptors It is hypothesized that at the WT MC4R, the DArg 111 analogues of hAGRP ligands should display agonist activity if the proposed hAGRP DArg 111 MC4R Asn123 interaction is correct. In addition, agonist activity i s predic ted to be seen at the mutant Asn 123 Gln h MC4R. The ligands are predicted to display decreased potency at the mutant Ala, Asp, and Ser h MC4R and may remain as antagonist s The second experiment explores the involvement of Phe184 receptor residue in the putative hydrophobic binding pocket. The Phe184 (F184) receptor residue is identical in the human and mouse MC1, MC3, MC4 and MC5 receptor subtypes The mutation of m MC4R Phe 176 in t ransmembrane 4 (hMC4R F184) to Phe 176 Lys resulted in a mutant receptor that was able to bind hAGRP(87 132) but it lacked any functional antagonist or agonist pharmacology, while SHU9119 ( synthetic antagonist) and MTII ( synthetic agonist) retained pharmacological activity. 136 Modeling studies predict that the MC4R F176 interacts with Phe 112 and Phe 113 of hAGRP (87 132) in the hydrophobic binding pocket. 116 Other studies showed that the replacement of DPhe 112 for Phe 112 in monocyclic peptide caused the conversion of an antagonist into an agonist. 134 It is hypothesized that the MC4R F176 residue interacts different with the hAGRP ligand

PAGE 113

113 v ersus the melanocortin agonists 116,134 This hypothesis was tested herein by mutating F184 to Ala nine (Ala, A) His tidine (His, H), Lys ine (Lys, K) Arg inine (Arg, R) Ser ine (Ser, S) Tryptophan (Trp, W) and Tyr osine (Tyr, Y), See Figure 4 6 for the structures of the amino acids The compounds listed in Table 4 1 were pharmacologically characterized at each of these mutant receptors, and binding affinity char acterization was performed at the hMC4R WT and mutant receptors At the WT h MC4R, the DPhe 112 analogues of AGRP antagonists should remain antagonist to deem the hypothesis correct. Due to the biophysical properties of the specific amino acids at the mutat ed receptors, decreased ligand potency should also be noticed. Also, the potency and pharmacological activity of melanocortin based agonist ligands should be minimally modified since it is proposed that the MC4R F184 ligand interactions are specific for AG RP based ligands. The third experiment examines the importance of Asp189 (D189) and its participation in the agonist/antagonist binding pocket proposed. 116,136 In the human and mouse MC4R, the Asp189 (mMC4R D181) r esidue is conserved; however, sequence homology changes for the other receptor subtypes. For both the human and mouse receptor subtypes, Asp189 is replaced Glu at the MC3R and MC5R. It is hypothesize d that the hAGRP(87 132) Asn 114 interacts with the MC4R A sp189 residue in extracellular loop 2/ top of TM 5 resulting in potent pharmacology. 116 However, the bicyclic ligand residue Asn 114 is proposed to not participate in this receptor lig and interaction based on preliminary modeling studies suggesting an explanation for its 80 fold decrease in antagonistic potency. 107,116 This hypothesis was tested by mutating D189 to Ala, Glu, Gln, Asn, Lys, Arg, a nd Ser. See Figure 4 7 for the structures of the amino acids The

PAGE 114

114 compounds listed in Table 4 1 were pharmacologically characterized at each of these hMC4 mutant receptors, and binding affinity characterization was performed at the hMC4R WT and mutant rece ptors It is hypothesized that the potency of the ligands tested will decrease at the MC4R if this specific interaction, hAGRP Asn 114 MC4R Asp189, is necessary. Since the bicyclic peptide lacks this interaction, no change should be observed in ph armacolog y for this ligand. As discussed earlier, three different hMC4R (Asn123, Phe184, and Asp189) residues were selected based on previous SAR and homology molecular modeling data to delve into any specific relationships between the MC4R and AGRP. Site directed mutagenesis was performed to mutate these three hMC4R residues as previously discussed in Chapter 3. 117,136,204 This led to the generation of 18 new receptors as seen in Figure 4 5, Figure 4 6, and Figure 4 7 After generation of the mutated DNA and stable expression in HEK293 cells, the hMC4 mutant receptors were first evaluated for cell surface expression by flow cytometry /fluorescent activated cell sorting (FACS) molecular recognition through I 125 NDP MSH competi t ive binding studies. They were also pharmacologically char acterized for 2 MSH, and ACTH (1 24) ligands and synthetic peptides, NDP MSH MTII and VXF1 28 ( Table 4 2 ). Detailed analysis of each hMC4 m utant receptor with the three techniques, FACS, competitive binding assay, and functional assay is discussed below. Compe titive binding studies are performed to determine its affinity for a ligand; in this case, NDP MSH was used to determine receptor affi nity It is hyp oth esized that different results may arise when a residue is mutated in comparison to the control

PAGE 115

115 receptor The first scenario is that binding affinity and functional activity are similar to that observed for the WT control receptor and that the residue in question was not important for ligand binding or functional activity of the receptor. In addition, r esidue to which it has been mutated is similar in chemical properties or size to the WT receptor Another effect that may be observed is tha t binding affinity is similar to the WT rec eptor; however, there is a decrease or even absence of functional activity with the mutant receptor. It can be deduced from these results that the residue might be important for receptor activation mechanisms. A t hird situation that may be seen is there is no binding affinity and therefore, no functional activity proposing that the mutated residue is located in a putative binding pocket. Flow cytometry must be performed on the mutant receptors in the last case to d etermine if they are being expressed on the cell surface. A decrease in binding affinity and functional activity may mean that the receptor is being trapped intracellularly because of faulty synthesis or improper protein folding. One last scenario is that there is no binding affinity; however, the mutated receptor has functional activity with ligands. 117 This chapter is separated into two sections the 1) results and discussion of the characterization of the hMC4R mutant receptors with the endogenous and synthetic ligands and 2 ) results and discussion of the characterization of the hMC4R mutant receptors with the AGRP derivatives Results of Human Melanocortin Mutant Receptors Table 4 3 lists the eighteen human MC4R mutations generated in this study. A Flag tag wa s inserted at the N terminus of the h MC4R downstream of the Methionine start codon to allow for immunocytochemical detection of the relative receptor cell surface and total expression. The receptor residue mutation s were selected based upon previous mutage nesis studies of the mouse MC4R, structure activity relationship

PAGE 116

116 studies, and homology molecular modeling studies that indicated that these residues within the receptor may be important for ligand receptor interactions. 107,108,112,114 116,134,213,216,217 The results of the competitive disp lacement binding studies fluorescent activated cell sorting studies and ph armacological characterization with known ligands are discussed below. Competitive Displacement Binding Studies Table 4 3 summarizes the competitive binding affinity IC 50 values of the NDP MSH ligand at the WT and mutant hMC4 receptors, compared to the functional EC 50 values. NDP MSH has become the ligand of choice for these radioactive competitive binding studies at the melanocortin receptors because it is amendable for iodination; in addition, it is highly potent and biologically stable 200 Also, the IC 50 values can be compared to other binding studies in the literature. Non labeled NDP MSH was used to displace the radio labeled I 125 NDP MSH in a competitive manner The binding affinity dose response curves are illustrated in Figures 4 8 Figure 4 9 and Figure 4 10 The results indicate that most of the hMC4 mutant receptors were able to bind and be stimulated by NDP MSH with an either comparable or slightly decreased IC 50 value to the WT with the exception of two of the new hMC4 mutant receptors (N123S and F184R) In Figure 4 8 it is observed that N123S d oes not exhibit any binding affinity proposing that this hMC4 mutant receptor may not have affinity for the ligand or is not reaching the cell surface efficiently to bind. However, as discussed below, this receptor is reaching the cell surface and does have functional activity when stimulated with NDP MSH, VXF1 28 and MTII. All of the other N123 hMC4R mutants show to have a comparable binding affinity. In Figure 4 9 it is shown that F184R did not exhi bit a binding affinity for NDP MSH, while all the other hMC4 mutant receptor displayed a

PAGE 117

117 binding affinity that was comparable or slightly decreased to that of the WT hMC4R. In Figure 4 10 it is observed that D189R has a potent binding affinity towards NDP MSH, while all the other D189 hMC4R mutants are similar binding affinity to the WT receptor. Cell Surface Expression of Flag hMC4 Receptors The WT and mutant hMC4 receptors contain an extracellular Flag tag that was inserted between the Methionine start codon and the first receptor amino acid at the N terminus, as discussed earlier, this allows for immunohistochemical analysis relative receptor cell surface and total expression. 117,121 Fluorescence activated cell sorting (FACS) was performed to verify receptor cell surface expression and further support the competitive binding studies. Figure 4 11 summarizes the percentage of total cellular expression and receptor cell surface expression of the mutant Flag hMC4R receptors that were stably expressed in HEK293 cells, relative to the WT Flag hMC4R using immunocytochemical staining and flow cytometry. Examination of the cell s urface expression is important in the generation of mutant receptors because it can lend support as to the why a mutant has a loss of function phenotype or possess difference in ligand pharmacology in comparison to the WT receptor. Amino acid residues with in a receptor may be critical for proper receptor folding and stability of the protein, accurate insertion of the transmembrane helices into the cell membrane, correct post translational modification in the endoplasmic reticulum or transport to the cell su rface. Mutating a receptor residue may induce a negative effect on any of these roles a residue may play in the formation of the protein and interaction with ligands. Mutant receptors may thwart the receptor from being fully expressed in at the cell surfac e, and therefore, its abilit y to interact with ligands. Flow cytometry allows for quantification of the receptor protein within the cell. Figure 4 11 reveals that most of the hMC4 mutant

PAGE 118

118 receptors exhibit total cell surface expression and cell surface expr ession that is comparable or slight decreased to WT with the exception of two receptors (F184R and D189R) To support the data received from the competitive binding studies, the data received from the FACS experiments reported that N123S receptor is reach ing the cell surface and is being expressed efficiently in the cells. In Figure 4 12, the deconvolution micro scopy image of N123S Flag hMC4R (left) stably expressed in HEK 293 possess a similar expression level to that of the WT receptor (right) Th e F184R hMC4 mutant exhibited about ~70% surface expression, therefore, it is proposed that the receptor is not being fully trafficked to the cell surface and may explain the decrease in binding affinity for NDP MSH observed earlier The FACS experiments re vealed that D189R receptor is not reaching the cell surface efficiently (~50%), which is interesting considering that the binding studies indicated that this receptor has a strong affinity for NDP MSH Function al Characterization of WT and Mutant Flag hMC4 Rece ptors Each mutant Flag hMC4R was pharmacologically characterize d with the melanocortin endogenous and synthetic agonists The agonists used to develop a pharmacological profile for each mutant are listed in Table 4 2 The endogenous ligands are derived th rough the post translational processing of the hormone POMC. The MSH agonist is a 13 amino acid linear peptide that is N terminally acetylated and C terminally amidated. The ligand, MSH 2 MSH is a 12 amino acid peptide, neither one of these ligands are not modified at their N or C terminus. ACTH(1 24) is a truncated version of the endogenous peptide that is 39 amino acids in length. The agonist MSH represents the first thirteen amino acids of

PAGE 119

119 ACTH NDP MSH is based on the structure of MSH; however, within the 13 amino acid l inear peptide it substitutes Met 4 and LPhe 7 with Nle 4 and DPhe 7 This peptide has been shown to be very potent at the melanocortin receptors. VXF1 28 is the core tetrapeptide sequence that has been shown to be important for molecular recognition and recept or stimulation. It was included in this study to investigate ligand receptor interactions are mainly based upon the interaction of these fo ur amino acids in this sequence The MTII synthetic agonist is a pot ent, cyclic seven member ligand and was based on the structure of NDP MSH. A lactam bridge is formed between Asp 5 and Lys 10 the residues that surround the core tetrapeptide. All the endogenous ligands 2 MSH and ACTH) possess the natural LPhe 7 residue, while this has been replaced by the DPhe 7 in the synthetic peptides (NDP MSH, VXF1 28 and MTII) The functional activity EC 50 values (nM) of the agonists at the WT and Flag hMC4R mutants are summarized in Table 4 3 galactosidase reporter gene assay, which is a non radio active colorimetric assay. Table 4 3 is also a summary of the I 125 NDP MSH competitive binding assay results. Due to inherent experimental errors of the functional reporter gene assay used in this study potency changes of 1 3 fold were conside red as equipo tent, changes of 4 9 fold were defined as slightly increased or decr eased potency and changes of >10 fold were defined as significantly increased or reduced potency. One observation that is made when looking at Table 4 3 is that most the hMC4 mutant recept ors responded comparable to WT hMC4R to NDP MSH, except two of the receptors focused on above: F184R and D189R. Further discussion of the response of each mutant to each agonist can be found below.

PAGE 120

120 Endogenous and s ynthetic a gonist p harmacology of Asn 123 h MC4R m utants The Asn123 residue is proposed to be located within TM3 of hMC4R, which is proposed to b e part of the agonist binding pocket. 116,136 A summary of the agonist pharmacology data can be found in Table 4 3 Dose response curves for the N123 hMC4R mutants with the agonists can be seen in Figure 4 1 3 As discussed earlier, the substitution of a putative important residue for Ala performing an Ala scan, is normally one of the first steps in examining the impo rtance of a residue in a receptor. The replacement of a residue for Ala is a way to minimally disrupt the overall structure of the protein, while investigating the importance of the role of a specific side chain may play in ligand receptor interactions and /or intramolecular interactions with the receptor. Each residue evaluated within this study was mutated to Alanine. The change from Asn to Ala at the 123 position resulted in a receptor that showed decreases in agonist activity with all of the ligands test ed; except for NDP MSH and MT II which both exhibited agonist activities that were comparable to WT receptor. T his receptor exhibited a slight decrease in IC 50 compared to the WT receptor. The exchange of Asn for Asp incorporates a residue of the same si de c hain length, but it has a carboxylic acid rather than carboxamide as the functionality. It is hypothesized that the postulated binding pocket is composed of Asn, Asp and Glu residues ; therefore, there should not be a large change in agonist activity. T hes e results were observed when characterzed with the known ligands Slight increase s in agonist activity were detected with and 2 MSH. NDP MSH and MTII were equipotent at this receptor compared to the WT. Th e next mutation for N123 i nvolved Gln (Q), an amino acid with same functionality as the WT (carboxamide) ; however, it has a longer side chain (extra CH 2 ). The lon ger chain amino acid resulted in either equipotent or

PAGE 121

121 small increases in potency at all the agonists except ACTH(1 24) There is about a 10 fold decrease in potency with ACTH stimulating the receptor. Considering that this is the longest endogenous agonis t, the length of the peptide may be hindering its ability to bind and stimul ate this receptor mutant that has added length. It was observed that the hMC4R mutant N123S, the change to a serine group, demonstrated some interesting results. Serine bears a hy droxylic side chain; this uncharged polar group is normally found on the surface of a protein. It is hypothesized to disrupt helical structures when found within the transmembrane regions. The N123S receptor did not exhibit any binding activity for NDP MS H, however, FACS data showed that the N123S is reaching the cell surface and is being expressed indicating that the receptor is not being trapped intracellularly. The functional characterization of this N123S mutant displayed that the endogenous agonists w ere unable to stimulate this receptor, while the three synthetic peptides did stimulate the receptor. The activity of NDP MSH at N123S was comparable to all the other receptors, and both VXF1 28 and MTII elicited a decrease in potency, unlike a lack of res ponse like the o ther agonists. These two peptides differ from the endogenous agonists in that they incorporate DPhe rather then LPhe in the core tetrapeptide sequence, that has been previously shown to exhibit an increase in potency and interacts stronger with receptors than LPhe. 94 It is hypothesized that the different orientation that DPhe compared to LPhe would experience inside the binding pocket ma y be the reason for greater potency and longer activity. In the case of this hMC4 mutant receptor, the ability to exhibit a response (DPhe ligands) or not (LPhe ligands).

PAGE 122

12 2 Endogenous and s ynthetic a gonist p harmacology of Phe 184 hMC4R m utants The Phe184 re sidue is proposed to be located in TM4 in the hMC4R and is hypothesized to partake in a network of aromatic, Phe residues that form a hydrophobic binding pocket that interacts with the Phe Phe residues of AGRP ligands. 116,136 This residue was mutated to seven different residues with varying degrees of side chain properties to explore this interaction. A summary of the agonist pharmacology data can be found in Table 4 3. Dose response curves for the Phe184 hMC4R muta nts with the agonists can be seen in Figure 4 1 4 The change from a hydrophobic phenylalanine residue to the non reactive alanine, F184A resulted in a similar response to NDP MSH and MTII 2 MSH. In addition, there were minor decreases in agonist responses compared to the MSH, ACTH, and VXF1 28. The change from the Phe to a basic, histidine residue (F184H) resulted in a comparable response with NDP MSH and MTII with the WT receptor however, a drastic decrease in potency with the other agonists. There was 2 MSH and ACTH(1 24). Another change from hydrophobic, Phe, to a positively charged, basic residue, Lys, also led to a similar response to NDP MSH and MTII as the WT receptor with decreases in potency for the rest of the agonists. The decreased potency results were not as severe as observed for F184H and F184R. In analyzing the responses from another basic, cha rged residue, F184R, had a 5880 fold decrease i n potency with NDP MSH and had a severe decrease in potency at MTII, as well. It was unable to elicit a response with the other endogenous and synthetic agonists. Interestingly, the F184S receptor responded quite similarly to the agonists as the WT hMC4R especially to the t hree synthetic peptides, NDP MSH, VXF 1 28 and MTII There was a 3 2 MSH

PAGE 123

123 comparing F184S to the WT, with a 10 fold decrease in potency with ACTH. The incorporation of the hydrophobic Trp residue ra ther than the Phe at this position within the residue caused a disruption in agonist response as well. NDP MSH and MTII responded normally at this mutant receptor, but there were large fold decreases in MSH, and VXF1 28. There was a comp lete lack of agonist activity 2 MSH and ACTH The last hMC4R mutant that will be discussed for this series i s the F184Y. While Tyr is hydrophobic with the aromatic ring similar to Phe it contains a phenolic hydroxyl making it have a polar side chain moiety. The ligands, NDP MSH MTII MSH exhibited agonist activity was very comparable to the WT receptor with EC 50 values of 0.018 0.15 and 5.4, respectively. There was about a 2 4 fold MSH 2 MSH and th e tetrapeptide, VXF1 28. There was a larger decrease in potency with the longer agonist, ACTH(1 24) with an EC 50 =230 compared to the WT receptor that elicited an EC 50 =8.0. Endogenous and s ynthetic a gonist p harmacology of Asp 189 hMC4R m utants The Asp189 r eceptor residue is proposed to be located in EC loop 2 and hypothesized to participate in the proposed binding pocket and especially aid in the binding of longer, larger peptides. 116,136,216 A summary of the agonist pharmacology data can be found in Table 4 3. D ose response curves for the D189 hMC4R mutants with the agonists can be seen in Figure 4 1 4 In analyzing the pharmacological profile of D189A, it was observed that this substitution was slightly detrimental t o the stimulation of the receptor. The NDP MSH agonist elicited a potent response at this mutant receptor. Both MSH and VXF1 28 exhibited large decreases in potency compared to the WT receptor. There were smaller fold decreases in agonist potency when the receptor was stimulated with MTII, 2 MSH and ACTH(1 24). The replacement of Asp for Glu

PAGE 124

124 (E) at positio n 189 results in a profile that is similar to the WT receptor. This residue contains the same functional group (carboxylic acid), however, it has an increased side chain length It is hypothesized that this residue may not have an effect on the binding of the agonists studied herein, or presence of an acidic side chain may be necessary for the proper binding. The change from an acidic Asp to a basic residue Lys, D189K, resulted in a decrea se in potency with MSH and VXF1 28 and a more drastic response with 2 MSH, and ACTH, where there was only some stimulatory activity exhibited. The presence of an acid ic side chain may be a requirement to achieve a WT like pharmacological profile. The amide version of aspartic acid, Asn (N), and Gln (Q), the amide with a longer chain were also examined at this position. The D189N mutant receptor showed to have a negative effect on the binding of the known ligands. There is a great decreas e in potency with the use of most of the agonists, espe 2 MSH. However, the D189Q exhibited a profile that was comparable to the WT except for the agonist activity of ACTH. Once again, this peptide is long (24 residues) and may utilize this position to aid in binding. This trend has been found at all the mutant receptors as discussed below (Table 4 3 ), except D189E that contains the same moiety with just a longer chain. T he D189R mutant was a partial agonist when stimulated with NDP MSH (EC 50 = 0.15) The other agonists showed some stimulatory activi ty, however, it could not be quantified The change from Asp to Ser, D189S, was not as drastic as observed earlier with N123S. There were slight decreases in potency for all the agonists, except for ACTH, that exhibited about a 20 fold decrease in potency compared to WT receptor.

PAGE 125

125 Discussion of Melanocortin Agonist Pharmacology with hMC4 Mutant Receptors The MC4R has been identified to be involved in energy homeostasis and obesity. MSH stimulates the MC4R and results in a decrease in MSH and result in an obese phenotype due to increased feeding. 19 The endogenous antagon ist, agouti related protein (AGRP) demonstrated to be a competit ive antagonist MSH. 20,22 Previous studies have proposed that the receptor residues Asn123, Phe184, and Asp189 play different roles in ligand receptor i dentification, binding, and stimulation. 107,108,112,114 116,134,213,216,217 Site directed mutagenesis and structure activity relationship studies were two techniques utilized to explore amino acid residues of ligan ds and receptor that may be necessary for molecular recognition and function of the hMC4R. The functional characterization of the new hMC4 mutant receptors reveals that the substitution of certain positions within the hMC4R shows to be detrimental to the stimulation of the receptor with known ligands, while some do not demonstrate a great difference. The mutant receptors, N123D, N123Q, F184A, D189E, and D189Q rendered pharmacological profiles that were quite comparable to the WT hMC4R. While some of the mu tant receptors, N123S, F184R, D189R showed loss of activity when stimulated wi th the known ligands. Then there were mutant receptors in which some ligands responded normally, while others did not, in comparison to the WT receptor. For most of the mutant re ceptors, a similar trend was observed in which the endogenous agonists exhibited severely decreased potencies to absence of activity, while the synthetic agonists were better at stimulating the receptors. The decreased agonist activities at N123 and D189 w hen mutated to Ala supports that the side chains at positions 123 and

PAGE 126

126 189 in hMC4R may be important for the binding of the melanocortin agonists. However, the F184A receptor exhibited a similar profile with the agonists to that of the WT. It is speculated that this receptor may not be important for the binding and stimulation of the melanocortin agonists but has a more direct interaction with AGRP based antagonists 2 MSH in that it exhibited functional activities that resembled the synthetic agonists at the WT hMC4R and some of the mutant receptors. This agonist was shown to be more potent at N123D and N123Q than the WT. It was equipotent at N123A, F184A, F184S, F184Y, D189E D189Q, and D189S. Even though this peptide is similar in MSH has a longer N terminus and different Phe Arg composition may modify the conformation of the melanocortin core sequence. The MSH and all other peptides are ones that have analogous side chains to the WT. The N123Q receptor has the same side chain moiety at the WT with just a longer chain length. The N123D mutant receptor is the carboxylic acid rather than carboxamide side chain; however, it has the same chain length as the WT. The F184 receptors do not possess a similar trend in which that it is replaced by a simi lar side chain functional group. The use of Tyr (F184Y) is the only bulky, aromatic reside replacement, and the addition of the phenolic hydroxyl does make it a polar residue. The substitution with Ala with no change in potency may lead to the proposal tha t this residue does not have a strong interaction with the endogenous and synthetic agonists. In the proposed hydrophobic binding pocket, it is postulated to be a part of the hydrophobic network of Phe residues. It is

PAGE 127

127 putatively located on the outside of t he network of residues; there fore, the interaction may not be as strong for the shorter, agonist like peptides. Similarly, Ser differs from Ala in that one of the methylenic hydrogens is replaced by a hydroxyl group. This residue is considered to be hydrop hilic due to the hydrogen bonding capacity of the hydroxyl group. The D189 residue is postulated to be important for the binding of longer MSH and all the other ligands are D189E and D189Q with the side chains present leading to a similar trend observed with the N123 receptors. The D189E receptor has the same side chain as the WT, with just a slightly longer chain. The D189Q is the carboxamide functional group neutralizing the carboxyl gr oup but does have the the same chain length at D189E. For the N123 and D189 receptor mutations, it is speculated that amino acids that have analogous side chains in both conformation and polarity may be necessary for proper binding and stimulation. Inter estingly, NDP MSH agonist activity was comparable at most of the new mutant receptor to the WT hMC4R with the exception of two mutant receptors. The replacement with Arg is having a significant effect at both receptors with all the ligands The F184R muta nt receptor had a 5880 fold decrease in potency with the use of NDP MSH. In addition, the D189R mutant receptor exhibited partial agonism when stimulated with this ligand. VXF1 28, the tetrapeptide sequence, exhibited activity at most of the receptor s how ever, it is not as potent at the mutants compa red to the WT receptor. The decreased length of this agonist and removal of putative important amino acids may be attrib uted to its decreased activity

PAGE 128

128 Molecular recognition of peptides by receptors has been ac credited to the ligand pharmacophore (i.e. core tetrapeptide sequence), secondary structure and functionality of the amino acid side chains. Recently, Chapman et al. described interactions of the MC4R with NDP MSH, focusing on the interactions and residue in close proximity to the core tetrapeptide sequence amino acids His 6 DPhe 7 Arg 8 Trp 9 216 A covalent attachement approach and modeling were employed to explore interactions. Their studies proposed that the His 6 int eracts with DPhe 7 through arene arene stacking and there is backbone interaction with Arg 8 and Trp 9 Cross linking experiments showed that His 6 interacts with Asp122, Ile125, and Asp126 of the hMC4R. The DPhe 7 residue is proposed to interact in a pocket co mposed of Phe51 ( TM1), Glu100 ( TM2), Ile125 ( TM3), Asp126 ( TM3) and Ile129 ( TM3). Additionally, NMR studies of the LPhe containing and DPhe containing peptides suggest that they exist as mirror images of one another, with the LPhe residue of peptides putat ively interacting with residues in TM6 rather than TM3 These studies futher confirmed that Arg 8 electrostatically interacst with Asp122 and Asp126. In addition, it was suggested that the side chain of Arg 8 forms a hydrogen bond with Asp122 and a backbone interaction with Tyr287. Overlapping interactions have been observed for the Arg 8 of agonists and Arg 111 of antagonists. 134,136 It might be advantageous to generate mutant receptors at Tyr287 and test both melanocor tin based agonists and antagonists to see if this residue is specific for Arg 8 ( MSH numbering) or has an overlapping interaction with Arg 111 of the AGRP antagonists. The fourth amino acid in this sequence, Trp, is proposed to lie in close proximity to re sidues in the TM6 and TM7 The N terminus of the peptide was postulated to have interactions with both Asp189 and Cys196. The residues Asp122

PAGE 129

129 and Asp126 were shown to have interactions with this agonist sequence and although not seen, the close proximity of Asn123 may have an effect on binding of ligands as well. Common secondary structures found in peptides are reverse turns, where the peptide chain reverses its overall direction. Turns are organized in groups based on the separation between two residues. turn is a common reverse turn of specific orientation in which the direction of the peptide chain is reversed within four residues with the distance between the first and fourth residue defined as less than 7 (Figure 4 16 ) A hydrogen bond between t he carbonyl group of the first residue ( i ) and the amide of the third peptide bond ( i + 3) stabilizes this secondary structure within the peptide chain. turn structures are further categorized into to Type I or Type II based upon bserved between the side chains of residues i + 1 and i hairpin loop is a specialized type of a turn that consists of an anti sheet formed by sequential segments of the polypeptide chain that are connected by re latively tight reverse tu hai rpin structures may contain many type of turns therefore, are classified based on the number of residues that make up the turn. 218 Previous studi es have indicat ed turn like structure forms a round the core residues, His D Phe Arg Trp in melanocortin ligands ; however, it is still debated whether the turn happens between residues His DPhe or D Phe Arg. 138,216,219 Extensive NMR and mutagenesis studies have been performed to determine the type of turn found within peptides, the residues it forms around, and if the presence of the LPhe or DPhe results in different secondary structures Hogan et a l. propose th at the tetrapeptide sequence forms a Type II turn with the reversal occurring at DPhe

PAGE 130

130 Arg. 138 While, Cho et al. hypothesize that His Arg are the residues forming the turn conformation. 219 Through the use of NMR, it has been propose d MSH (LPhe ha irpin loop, while NDP turn instead. 138,216,219,220 It is hypothesized the presence of different secondary structures will result in a different interaction with receptors. A different type of orientation and interactions with different receptor residues may be occurring leading to vast degree of fold difference in potency with the use of DPhe versus LPhe ligands. turn structure found in NDP MSH is proposed to be the reason for the greater potency and MSH. 94,216,220 Asn 123 hMC4R Mutants The Asn123 residue is postulated to be located towards the top of TM3 with neighboring threonine and aspartic acid amino acids The Asn123 receptor residue is not affected in agonist potency when mutated to Asp or Gln; however, there are decreases in potency when Ala is used and drastic reductions in activity when Ser is substituted at this position. The decreased potency when the non reactive Ala amino acid is used supports the hypothesis that this residue may play a role in the bin ding and stimulation of a melanocortin based agonist ligand Although, the WT receptor incorporates carboxamide functionality, it shows to be able to p articipate in a similar manner when a carboxylic acid is employed. The binding pocket to which it is proposed to partake in contains other Asp and Glu residues 134 ; therefore, it is not surprising that when mutated to Asp there is no real change in b inding affinity, cell surface expression, and functional activity. It is hypothesized that the introduction of Ser within the transmembrane region is leading to a break or disruption within this helical structure. This hMC4R

PAGE 131

131 interrupting the correct conformational change and affecting ligand binding. As mentioned, the ligands containing the DPhe 7 versus the LPhe 7 would experience a different orientation within the binding pocket, so it is re asoned that the N123S mutant may be affecting the LPhe 7 ligand binding pocket when analyzing the pharmacologically profile of this mutant. The potency reduction with VXF1 28 compared to NDP MSH m ay be due to the additional amino acids of NDP MSH. Overall, it is postulated that the presence of a carboxamide or carboxylic acid moieties are essential at this position for retaining agonist activity with the melanocortin based ligands. Phe 184 hMC4R Mu tants The Phe184 residue is postulated to be located towards the top of TM4 with neighboring isoleucine and leucine amino acids. It is hypothesized that the potency and pharmacological activity of the melanocortin based agonist ligands should be minimally modified since it is proposed that the mMC4R F176 ligand interactions are specific for AGRP based ligands. 136 This was proposed based on studies with the mouse receptor isoforms, however, the use of the human MC4R led to different results. Most of the F184 mutants responded normally to NDP MSH. The F184A mutant exhibited a similar prof ile with these known ligands when compared to the WT receptor. With the largest decreases/complete loss of activity was found with the use of Arg in place of Phe. The change from a hydrophobic Phe residue to a hydrophilic Arg supports that there may be a h ydrophobic binding pocket, and thus the removal of one of the residues participating in it will affect the overall binding affinity. It may change the overall conformation of the binding pocket disrupting the normal binding pattern of a ligand. This residu e lacked binding affinity for NDP MSH, which further supports the decreased EC 50 value observed for this ligand. In addition, FACS revealed a diminished cell surface

PAGE 132

132 expression, postulating that there is some problem in the biosynthesis of this mutant. The other basic residues introduced at this position, His and Lys, showed great 2 MSH and ACTH as well further supporting that the presence of a hydrophobic, bulky aromatic group may be critical at this position. However, the use of Trp, another bulky group did not produce similar results as the WT receptor. This additional ring structure may be hindering the binding region for the ligand, thus leading to a reduction in potency. Asp 189 hMC4R Mutants The D189 resi due is postulated to be located with in extracellular loop 2 with neighboring serine amino acids.It is hypothesized to aid in the binding of larger, longer peptides, such as the AGRP based ligands. When D189 was mutated to Ala, there were decreases in poten cy for the endogen ous and synthetic agonists. The Ala scan of this receptor supports that this residue may play a role in the binding of the melanocortin based agonists. The lack of functionality led to a reduction in agonist potency. The use of Glu (E) an d Gln (Q) do not seem to affect the overall structure of receptor and thus have a similar pharmacological profile. There is a slight decrease in potency with the use of ACTH at D189Q. However, the D189N mutant did show agonist potency reductions with all o f the ligands, besides NDP 2 MSH to a maximal stimulation of 60% at the highest concentrations examined. There was a slight decreased binding affinity for this mutant and FACS data did not reveal any trafficking to the surface problem. This is an interesting result since this side chain is analogous to D189Q, but has the same chain length as the WT Asp residue. The amino acidsTyr Ser Asp Ser Ser is a short sequence incorporating the D189 residue in extracellular loop 2 Serine is similar in structure to Ala with the exception that

PAGE 133

133 this amino acid has a hydroxyl group over a methylene group. The reduction from a carboxylic acid to just a hydroxyl group may not be long enough to aid in the binding of ligands. Plus the rep eptive nature of this hydrophilic r esidue within this short sequence may not conducive for binding of a ligand. The use of basic residues at this position, Lys and Arg, did encounter some problems in binding and stimulation of the agonists. The D189R muta nt showed partial agonism with NDP MSH and a complete loss of activity with the other ligands tested. It is postulated that the amino acid change from an acidic Asp residue to a basic Arg is preventing the receptor from being expressed on the cell surface. It may not be properly synthesized, incorrect ly folded or not post translational modified in the correct manner which may lead to decreased stability of the protein. One last observatio n was that the most significant decreases in potency at these D189 m utant receptors were exhibited by 2 MSH and ACTH. In analyzing these sequences, they differ the most at the N terminus in comparison to other peptides, especially with the lack of Ac group. As briefly discussed earlier, the N terminus of NDP MSH was postulated to have interactions with bo th Asp189 and Cys196. It is hypothesized that the presence of the acetyl group may aid in the binding at the Asp189 residue. It may be beneficial to examine t he mutagenesis of Cys196 and characterization with these same ligands for further support of this proposed statement. Overall, it is hypothesized that the presence of an acidic side chain at this position may be necessary at this position for retaining proper agonist activity, especially for the binding of longer peptides.

PAGE 134

134 Func tional Characterization of AGRP Derivatives with WT and Mutant hMC4 R The AGRP derivatives were synthesized and characterized at the N123, F184, and D189 hMC4 mutant receptors. All peptides were pharmacologically characterized in agonist functional assays; additionally EMH1 100, EMH3 25, EMH2 93, and EMH3 151 were tested for antagonistic properties See Table 4 1 for the sequences of the peptides utilized in this study The functional activity EC 50 values (nM ) of the peptides at the hMC4R WT and mutant receptors are summarized in Table 4 4 (monocyclic peptides) and Table 4 5 (bicyclic peptides) Dose response curves can be fo und in Figure s 4 17 22 Monocyclic AGRP Derivatives Previously, the monocyclic control peptide (EMH1 100, herein) was shown to be an antagonist, however, the incorporation of a DArg 111 in the Arg Phe Phe tripeptide led to the discovery of a micromolar agonist at the m MC4R. 134 The stereochemical inversion of Phe 112 resulted in up to 75% stimulation at the m MC4R, while retaining antagonistic properties. 134 These three peptides were synthesized for this study to investigate key amino acids residues in the MC4R in their involvement in binding of the ligand and conversion of pharmacology. All monocyclic derivatives were tested as agonists at the hMC4R WT and mutant receptors Additionally, EMH1 100 and EMH3 25 were tested as antagonists a t the hMC4R WT and mutant receptors ( Table 4 4 ). At the WT hMC4R, the monocyclic control EMH1 100 was not an antagonist. However, this ligand was tested at the mouse MC 3 and MC4R to determine if there is a species specific response. This ligand did show micromolar antagonist activity similar to the previous reports of this peptide. 134 Figure 4 17 shows the competitive nature of EMH1 100 to displace the agonist MTI I at the mMC3R and mMC4R. In agreement with

PAGE 135

135 previous studies 134 the use of DArg 111 versus Arg 111 in the monocyclic peptide, resulted in a micromol ar agonist at the WT receptor. (EC 50 = 9055). The EMH3 25 ligand contains a DPhe 112 and was shown to e xhibit agonist activity (EC 50 = 3319). This peptide was not a competitive antagonist a t the hMC4R; however, it was an antagonist when tested at the mMC4R. Asn 123 hMC4 Mutant Receptor Pharmacology A summary of the pharmacological data can be found in Tab le 4 4 Dose response curves for the hMC4R WT and N123 mutants with the ligands can be seen in Figure 4 1 8 Modeling studies proposed that the positively charged Arg 111 of the monocyclic peptide interacts with negatively charged Asp and Glu residues in the TM2 and TM3 of m MC4R. 134 The postulated electrostatic interactions of Arg 111 and Glu100 (TM2), Asp122(TM3) and Asp126(TM3) appear to be necessary for both agonist and antagonist binding, as seen in Figure 4 3 However, it was observed that the DArg 111 analogue had an additional putative interaction with Asn123 (TM3) of hMC4R. 134 This residue was mutated to Ala, Asp, Gln, and Ser. At the N123A receptor, there was no agonist response with EMH1 100 which was expected because in previous studie s it was an antagonist 134 However, when tested as a n antagonist, a pA 2 could not be obtained. In comparison to the WT receptor, N123A exhibited decreased agonist potency with EMH1 120 and exhibited micromolar potency with EMH3 25, but no antagonist activity. The EMH1 100 and EMH1 120 ligands did not respond as agonists at the N123D receptor. However, micromolar agonist activity was observed for EMH3 25 ( EC 50 = 2363). This receptor responded similarly to WT when stimulated by endogenous and synthetic agonists as seen earlier.

PAGE 136

136 The N123Q receptor responded in a similar manner to the three monocyclic peptides like the WT receptor The DArg 111 analogue EMH1 120 was more potent at this receptor than at the WT. The amino acid Gln is similar to Asn in that t hey have the same side chain, except Gln has a longer chain. The additional methylene group does not have an affect on these peptides. The DPhe 112 analogue EMH3 25 exhibited 90% stimulation at N123S receptor, while all the other peptides did not produce a response. This receptor did not show any agonist activity when stimulated by the endogenous agonists; however, it did display a response to the synthetic agonists (NDP MSH, VXF1 28, and MTII). These peptides contain DPhe rather than LPhe. It is interesting that the peptide containing DPhe residue resulted in a re sponse, perhaps the DPhe monocyclic analogue and the synthetic agonists are participating in a different interaction than the LPhe peptides due to the different orientation of the peptide. Phe 184 hMC4 Mutant Receptor Pharmacology A summary of the pharmacological data can be found in Table 4 4 Dose response curves for the hMC4R WT and F184 mutants with the ligands can be seen in Figure 4 1 9 It was hypothesized that there is a specific interaction with the mMC4R F176 residue with the hAGRP ligan ds, and this residue has a different type of interaction with the melanocortin agonists. 136 The monocyclic peptides were pharmacologically characterized at these mutant receptors. The control monocyclic peptide EMH1 100 did not produce an agonist or antagonist response at an y of the F184 mutant receptors. The F184A receptor exhibited micromolar activity with both EMH1 120 and EMH3 25 (EC 50 =5714 and EC 50 =1999, respectively) The introduction of a His residue rather than a Phe resulted in only a percentage of stimulation with EMH1 120 and EM H3 25. Also, t here was some stimulatory activity with EMH3 25 at F184K,

PAGE 137

137 but neither of the other two peptides elicited a response at this receptor. Similarly, there was about a 40% maximal stimulation at up to 100 M concentrations with EMH3 25 at F184R. Mi cromolar activity was achieved with EMH1 120 and EMH3 25 at F184S that was comparable to the WT The use of a Trp residue rather than a Phe residue resulted in a receptor that elicited a micromolar response from EMH1 120 and EMH3 25 that were similar to th e responses elicited by the WT receptor. Whereas the use of the polar, aromatic phenyl ring of Tyr was only stimulated by EMH3 25, and not by the other two peptides. Asp 189 hMC4 Mutant Receptor Pharmacology A summary of the pharmacological data can be fo und in Table 4 4 Dose response curves for the hMC4R WT and D189 mutants with the ligands can be seen in Figure 4 20 Preliminary modeling studies indicate that this residue within the receptor is important for the binding of long peptides, s uch as the AGR P derivatives. 116,216 However, it was proposed that the bicyclic peptide does not interact with this residu e based on modeling studies. 116 This could be the reason as to why this peptide resulted in an 80 fold decrease in antagonistic potency compared to the hAGRP(87 132). 107,116 The AGRP derivatives were pharmacologically characterized at the D189 mutant receptors. This section will discuss the monocyclic peptides at the D189 mutant receptors. There was a lack of agonist activity with all of the monocyclic peptides at the D189A mutant receptor The absence of activity asso ciated with an Ala su bstitution leads to suggest that this residue within the MC4R may be necessary for binding of these AGRP like analogues. The D189E receptor has the same moiety side chain with just a longer chain compared to the WT. The ligands EMH1 10 0 and EMH1 120 did not

PAGE 138

138 respond at this receptor as agonists, while EMH3 25 exhibited micromolar activity that was comparable to the WT receptor (EC 50 =1339) The change from an acid Asp to a basic residue Lys, D189K, resulted in a lack of response from the monocyclic peptides, EMH1 100 and EMH1 120. There was about 70% maximal stimulation at up to 100 M concentrations at D189K with the use of EMH3 25. The carboxylic acid of Asp was changed to a carboxamide with the use of D189N and D189Q, with a longer chain. The monocyclic peptides exhibited similar responses with only EMH3 25 eliciting agonist activi ty at both receptors, with this peptide being more potent at the D189Q receptor (EC 50 = 1617) There was no response from any of the compounds at D189R, which is similar to the response observed with the endogenous and synthetic agonists. The final D189 mu tant is the change from Asp to Ser. An agonist response was only observed for EMH3 25, both EMH1 100 and EMH1 120 lacked activity at this mutant receptor. Bicyclic AGRP Derivatives All bicyclic derivatives were tested as agonists at the hMC4R WT and muta nt receptors ( Table 4 5 ). Similar responses were observed with the bicyclic derivatives at the WT hMC4R that were seen with the monocyclic derivatives. The control, Arg Phe Phe peptide EMH2 93 did not show any agonist activity; however, antagonist activit y was not observed either. This peptide was tested at the mMC3R and mMC4R to determine if there is a species specific response. A micromolar antagonist pA 2 value was observed when tested at the mouse receptors that w as similar to previous studies. 107 Dose resp onse curves of this peptide competitively displacing the agonist MTII can be seen in Figure 4 21. The other peptides in this series have never been synthesized or tested before at the mouse or human MC4R. The inclusion of DArg 112

PAGE 139

139 resulted in a micromolar a gonist (EMH3 45) at the WT The DPhe 112 analogue EMH3 151 did show some agonist activity, although it only stimulated the receptor 50% up to 100 M concentrations However, i t did not possess antagonist activity like its monocyclic counterpart A fourth peptide was synthesized in this group; it was the DPhe 113 bicyclic ligand (EMH4 118). The monocyclic analogue converted from an antagonist to micr omolar agonist (EC 50 =3700) with the inclusion of this stereochemically inverted amino acid at the mMC4R 134 At the WT hMC4R this peptide exhibited a similar response with an agonist EC 50 value of 4650nM. Asn 123 hMC4 Mutant Receptor Pharmacology A summary of the pharmacological data can be found in Table 4 5 Dose response curves for the hMC4R WT and N123 mutants with the ligands can be seen in Figure 4 22 The bicyclic peptides were pharmacologically characterized at the N123 mutants. The control peptide, EMH2 93, did not have an agonist response at N123A. The other three peptides did display some agonist activity. The DArg analogue EMH3 45 was able to stimulate N123A to 70% maximal stimulation at up to 100 concentrations. In addition, the DPhe 1 12 (EMH3 151) and DPhe 113 analogues (EMH4 118) were able to stimulate this mutant receptor 60% and 75% maximal stimulation, respectively, at up to 100 93 did not respond as an agonist at N123 D. Micromolar activity was shown when N123 D was stimulated with EMH3 45 ( EC 50 = 10960) and EMH4 118 ( EC 50 = 3071). The ligand EMH3 151 was shown to stimulate to 55% maximal stimulation at up to 100 The control peptide EMH2 93 exhibited agonist activity at the N123Q receptor; thi s was not observed at any of the other receptors. Micromolar activity was shown when N123Q was stimulated with EMH3 45 ( EC 50 = 12789), EMH3 151 (E C 50 =1342), and

PAGE 140

140 EMH4 118 ( EC 50 = 3071). There was no agonist activity observed with EMH2 93 at N123S, EMH3 45 (DArg 111 ) was able to stimulate N123S to 65% maximal stimulation at up to 100 analogues at the N123S receptor, even though activity was observed earlier with the DPhe 112 monocyclic derivative. Phe 184 hMC4 Mutant Receptor Pharmacology A summary of the pharmacologic al data can be found in Table 4 5 Dose response curves for the hMC4R WT and F184 mutants with the bicyclic ligands can be seen in Figure 4 23 The bicyclic peptides were pharmacologically c haracterized at the F184 mutant receptors The F184A receptor elic ited micromolar agonist responses from all the peptides, except for EMH2 93. For the F184H mutant receptor, only EMH3 45 and EMH4 118 exhibited some stimulatory agonist responses. Some stimulatory activity was observed for EMH3 45 and EMH4 118 at F184K. In terestingly, EMH3 45 was able to stimulate F184R to 65% maximal stimulation at up to 100 118 was able to stimulate F184R to 45% maximal stimulation at up to 100 concentrations. Micromolar responses were produced at the F184S rec eptor with all the bicyclic peptides, except for EMH2 93. There was a lack of response from EMH2 93 and EMH3 151 at F184W, while EMH3 45 and EMH4 118 displayed micromolar agonist responses (EC 50 = 7408 and 6700, respectively). The DArg 111 bicyclic peptide w as more potent at the F184W than the WT receptor. The F184Y receptor had some stimulatory activity with EMH3 151, and the other two peptides, EMH3 45 and EMH4 118 presented with micromolar responses at this mutant.

PAGE 141

141 Asp 189 hMC4 Mutant Receptor Pharmacolog y A summary of the pharmacological data can be found in Table 4 5 Dose response curves for the hMC4R WT and D189 mutant receptors with the bicyclic ligands can be seen in Figure 4 24 The bicyclic peptides were pharmacologically characterized at the D189 m utant receptors. The control, EMH2 93 did not produce a response at any of the D189 mutant receptors. Similarly with the monocyclic peptides, none of the bicyclic peptides resulted in agonist activity at the D189A mutant. The bicyclic peptides responded in a similar manner at D189E as they did at the WT control. The ligand EMH2 93 did not respond as an agonist; however, all the other peptides resulted in agonist activity. EMH3 45 and EMH4 118 displayed micromolar activity (EC 50 =17826 and 3125, respectively) and EMH3 151 was only able to stimulate the receptor to 55% maximal stimulation at up to 100 45 was the only bicyclic peptide that elicited a response, and it was only 50% maximal stimulation at up to 100 M concentrations. There was a lack of response from all the other peptides at this mutant receptor. At D189N, EMH3 45 and EMH4 118 were the only peptides that resulted in agonist responses. There was a decrese in potency with th e se peptides at this mutant receptor, D189 N, when compared to the WT one. Micromolar activity was observed with EMH3 45 and EMH4 118 at D1 89Q, with EMH3 151 resulting in a 50% maximal stimulation at up to 100 the compounds at D189R, which is similar to the response observed with the endogenous and synthetic agonists. The last mutant receptor, D189S elicited slightly increased responses when compared with the WT receptor with the bicyclic peptides, EMH3 45, EMH3 151, and EMH4 118. In that there were micromolar responses from

PAGE 142

142 EMH3 45 (EC 50 =1343) and EMH4 118 (9184), and EMH3 151 was only able to stimulate the receptor to a 60% maximal stimuation at up to 100 M concentrations. Discussion of AGRP Derivatives with hMC4 Mutant Receptors The melanocortin receptors are unique among the families of GPCRs with regard to the intracellular regulation of the ir receptors with endogenous antagonists, agouti 56 and AGRP. 20,22 It has been shown that AGRP has high affinity for both MC3R and MC4R and participates in energry homeostasis through its role to competitively antagonize the melanocortin agonists at these receptors. 20,200 Extensive studies have been performed to examine the structure and function of AGRP. 113,116,117,136,140,200 However due to the absence of crystal structures of the melanocortin receptors, there is little informati on about the exact orientation of the melanocortin ligands in the proposed binding pockets. The combination of homology models, site directed mutagenesis and SAR studies have provided information for both ligand binding and functional studies. 113,116,117,136,140,200 The study of the MCR antagonist interactions has featured a set of receptor residues forming the binding pocket for the agonists and antagonists. Through site directed mutagenesis, it was found that certa in mutations within the hMC4R (E100K, D122R, D126A,N,K, D122A,N/D126A,N, F184K, Y187C, F201S, and F262S) affect the binding and angonist properties of AGRP. 135,136,140 This led to the hypothesis that the R FF triplet may interact in a cluster of negatively charged residues in TM3 and aromatic residues in TM4, TM5 and TM6. 135,136,140 In addition, chimeric studies revealed that the extracellular loops (EL2 and EL3) are vital in t he binding of the larger fragment, AGRP(87 132). 116,136,140,221 Previous studies have proposed that hAGRP ( 111 113) Arg Phe Phe tripeptide are vital for the binding and antagonistic activity of hAGRP at the melanoc ortin

PAGE 143

143 receptors. 113,134,136,210 It is hypothesized that this tripeptide pharmacophore is located at hairpin turn structure. 113 While these residues are important for ligand receptor interactions, extension on both ends of the peptide are necessary for binding affinity and potency. 113 Two AGRP derivative templates were used in this project in SAR and site directed mutagenesis studies to gain more information about the ligand receptor interactions of AGRP and the MC4R. In a stereochemical substitution study, it was shown that the use of DArg converted antagonists into agonists at the mouse receptors. 134 As mentioned, there is hairpin turn secondary structure that these amino acids (RFF) are involved in however, wi th the stereochemical inversion of residues may alter the secondary structure being formed. 113 As discussed earlier with the agonist core s equence, His L/DPhe Arg Trp, it is postulated that the stereochemical orientation of the Phe residue plays an important role in the type of s econdary structure being formed 216 For example, it is proposed that a turn structure is being formed with hairpin turn with the LPhe residue. 138,216,219 The presence of an inverted residue may affect the conformation and thus the overall activity of the ligand at the receptor. Based on homology modeling, SAR, and site directed mutagenesis studies, three hMC4R receptor residues were chosen to further investigate. 107,116,134,136 The stereochemical modifications were made in the RFF region of monocyclic and bicyclic AGRP derivatives and tested at the hMC4R and mutant receptors to explore the conversion of pharmacology that was previously reported and gain information surrounding AGRP and its interactions with the MC4R 134 Control AGRP Derivatives The control monocyclic peptide (EMH1 100) did not exhibit agonist or antagonist activity at the WT or any of the mutant hMC4 receptors. It is hypothesized that this

PAGE 144

144 ligand may only have antagonistic properties at the mouse subtypes due to the lack of agonist displac ement observed in the assay It was never examined at the human receptors before ; therefore, the lack of response may due to the different isoform. A similar lack of response at the WT and mutant hMC4 receptors wa s observed with EMH2 93, the control bicyclic peptide. This peptide has been previously and herein shown to be an antagonist at the mMC4R. 107 Therefore, there may be a species specific response for this peptide as well These peptides may be weak antagonists at the human receptor, and therefore, due to the limitations of the assay, their antagonistic properties may not have been exhibited. In addition, all the hypotheses presented herein were generated based on data obt ained with the mouse receptors, therefore, v ariances in data obtained within this study may be attributed to the different isoforms employed. DArg 111 AGRP Derivatives The monocyclic analogue was shown to be converted from an antagonist to agonist with the DArg 111 substitution. 134 This pepti de EMH1 120, did show agonist activity at the hMC4 WT receptor and a few other mutant receptors as disussed below It is interesting to note that none of the D189 mutant receptors exhibit ed a response with this peptide. It was hypothesized that Asn123 hMC 4R is important in the binding of the DArg 111 derivative. Modeling studies proposed an additional i nteraction with the DArg ligand residue and Asn123 receptor residue in the putative hydrophilic binding pocket that also contains Glu100, Asp122 and Asp126. 134 This interaction was not postulated for the control peptide, therefore, it was hypothesized that this additional interaction is aiding in the conversion of pharmacology observed for this peptide. The Asn123 residue was mutated and it was observed that the mutant receptors N123D and

PAGE 145

145 N123S did not exhibit a response with this peptide. The N123A receptor elicited a 70% show agonist response with this peptide was N123Q This residue substitution of Gln is an amino acid with the same side chain except it has a longer chain length. The presence of a carboxamide residue at that position within the receptor may be necessary for agonist activity of this peptide. It was predi cted that N123Q would exhibit a similar response to that of the WT, and there would be decresed activity or absence at the other N123 mutant receptors. It is hypothesized that t his receptor resi d u e may not be the only factor in the reason as to why this DA rg substituted peptide converts from an antagonist to agonist. The same substitution was applied to the bicyclic peptide (EMH3 45) to 1 ) determine if the DArg substutition would convert the pharmacology in the bicyclic peptide and 2) if Asn123 is importan t in the pharmacological conversion of ligands The mutant receptors, N123D and N123Q, elicited a micromolar response with this peptide. In addition, the other two receptors, N123A and N123S, did show some stimulatory activity. This receptor residue may no t be specific for this bicyclic peptide DArg analogue. The presence of two disulfide bonds and different amino acid composition around the core region, DArg Phe Phe, may alter the conformation of this peptide when binding to the receptor. Additionally, i n a ligand docking modeling study conducted by Chai et al., it was proposed that Asn123 hMC4R is forming a hydrogen bond with Tyr 109 of hAGRP(87 132) aiding in the binding of this peptide to the receptor. 135 This ligand residue is present in the two templates examined in this study. The role of this residue

PAGE 146

146 may be examined in future studies to determine its importance in the binding of AGRP and like derivatives to the MC4R. At the Phe184 mutant receptors, EMH1 120 exhibited a response at F184A, F184H, F184S and F184W. There was a reduction or absence of activity with all the peptides at F184K and F184R, as discussed earl ier, the change from a hydrophobic to basic residues may attribute to the lack of response that is occurring with these mutant receptors. The aromatic, bulky group may be necessary for activity of ligands. There was a reduction in agonist activity with the known ligands as well at these two receptors as discussed earlier The bicyclic peptide displayed agonist activity at all the receptors, wth the F184K and F184R receptors only exhibiting some stimulatory activity with this peptide. The bicyclic peptide D Arg analogue (EMH3 45) exhibited activity at all the D189 mutants, except for D189A and D189R. These two mutant receptors did not respond to any of the AGRP derivatives and there was a reduction in activity when characterized with the known agonist ligands It is hypothesized that the presence of the F184 or D189 residue may not be important for the binding the DArg 111 analogues and their agonist activity. Those that did not elicit responses showed similar trends throughout the study by having reduced affin ity and potency for ligands. DPhe 112 annd DPh e 113 AGRP Derivatives The stereochemical inversion of DPhe 112 or DPhe 113 was previously examined in the monocyclic template. 134 It was found that DPhe 112 analogue was only able to stimulate the mMC4R to 7 5% maximal stimulation at up to 100 M concentrations while also remaining an antagonist (pA 2 = 6.56) 134 While the DPhe 113 peptide was a full micromolar agonist at the mMC4R having an EC 50 value of 3700 with no antagonist properties. 134 Ho mology modeling studies proposed that the DPhe 113 residue is

PAGE 147

147 participating in a different putative interaction with mMC4R Phe176 that was not observed for the control peptide. 134 While the the DPhe 112 remained in a hydrophobic interaction with hMC4R Phe261. 134 Another step in this project may be to investigate hMC4R residue Phe261 with these peptides. A site directed mutagenesis study could be performed on this residue in the future and then tested with these stereochemically modified peptides The DPhe 112 monocyclic analogue and DPhe 112 and DPhe 113 bicyclic analogues were synthesized in this study. The DPhe 112 monocyclic derivative showed to be an antagonist and have some agonist stimulatory activity at the mMC4R. However, this peptide showed to be a more potent agonist at the hMC4R than at the mMC4R however, there was a lack of antagonistic activity It also showed to have agonist activity at a majority of the mutant receptors, as discussed. Antagonist activity was unable to be determined for this peptide. The DPhe 112 bicyclic peptide was only able to stimulate the DPhe 113 bicyclic peptide exhibited micromolar agonist activity at the WT. T hese results are more comparable with the monocyclic DPhe 112 and DPhe 113 analogues at the mMC4R. 134 The monocyclic DPhe 112 peptide was equipotent at all the N123 mutants, except for N123S, in which had slightly decreased agonist activity. The DPhe 112 bicyclic derivative had a more reduced affect at the N1 23 mutants. The N123Q mutant receptor was the only one in which an EC 50 value could be determined with EMH3 151. Antagonist activity was not observed for this peptide at these mutant receptors either. The DPhe 113 bicyclic analogue was a micromolar agonist at the N123D and N123Q mutant receptors, with reduced agonist activity at N123A and lack of activity at the N123S. These last two receptors showed to have a dimished effect with the known

PAGE 148

148 ligands and most of the AGRP derivatives. The amino acid mutation ma y have a negative consequence on the ability of the mutant receptors to recognize and bind ligands. It is proposed that the Phe Phe residues of the AGRP derivatives have a specific interaction with hMC4R Phe184. Agonist activity was observed with EMH3 25 the F184 receptors, with slight reduction in activity with the mutant residues that replace the WT Phe residue with a basic residue (His, Lys, and Arg). The bicyclic DPhe 112 peptide did not stimulate the Phe184 receptors unlike the monocyclic derivative. T his residue may have more of an impact on the binding of the bicyclic peptide. A similar response was achieved with the DPhe 113 bicyclic analogue as the DPhe 112 monocyclic peptide at the Phe184 receptors. There was a reduction in agonist activity at the F1 84H, F184K, and F184R receptors, those in which a basic residue replaced the hydrophobic Phe. The other receptors elicited agoni st responses with this peptide that were similar to the WT or slightly decreased. The DPhe 112 monocyclic analogue exhibited act ivity at all the D189 mutants, except for D189A and D189R. These two mutant receptors did not respond to any of the DPhe AGRP derivatives, monocyclic or bicyclic, and there was a reduction in activity when characterized with the known agonist ligands. Ther e was a diminished response from all the D189 mutant receptors with EMH3 151 (DPhe 112 bicyclic). Slight agonist acitivty was observed with the WT, D189E, D189Q, and D189S receptors All of the D189 mutants responded to stimulation with EMH4 118, except D18 9A and D189R again. The se amino acid mutation s may affect the ability of these two receptors to participate in ligand receptor interactions. The lack of response from D189A further

PAGE 149

149 supports that this residue may be important for the binding of longer pepti des, such as these AGRP derivatives. Those mutants with similar side chain moieties or analogues did exhibit activity with these peptides that was comparable to the WT. The presence of a carboxylic acid (Asp or Glu) or a carboxamide (Asn or Gln) may be vit al for the recognition and binding of these derivatives. However, it may be more essential in the binding of agonist peptides rather than antagonist ligands. This receptor residue was examined because modeling data proposed that the Asn 114 residue interact s with Asp189 hMC4R for the hAGRP ( 87 132) fragment, while the bicyclic derivative did not have this postulated interaction. The control bicyclic peptide did not exhibit agonist or antagonist activity at the WT or D189 mutant receptors. Although, EMH2 93 d id not possess antagonistic activity at WT or mutant receptors, it is hypothesized that this residue may not partake in an interaction with this residue. A n SAR study on the Asn 114 residues of the monocyclic and bicyclic peptides may be another project to undertake and then test at these mutant receptors to further examine the role of this ligand receptor interaction. Arginine Receptor Substitution For both the F184 and D189 residues, when the WT hMC4R was mutated to Arg, there was a lack of response from most of the endogenous and synthetic agonists, except NDP MSH. In the competitive binding studies, F184R did not have an affinity for NDP MSH. The FACS study illustrated that this receptor has about a 60% cell surface expression, and its total receptor ex pression is also lower than the WT value. The F184R receptor exhibited some stimulatory activity for the m onocyclic and bicyclic peptides. In addition, no antagonist activity was observed for the peptides tested as antagonists at this receptor as well. It is hypothesized that the change from a

PAGE 150

150 hydrophobic, aromatic Phe residue to a basic, positively charged residue is disrupting the network of Phe receptor residues forming the postulated binding pocket. The D189R did not exhibit any agonist activity when s timulated with any of the monocyclic and bicyclic ligands The competitive binding studies indicate that it has a binding affinity for NDP MS H, although it displayed partial agonist activity with an EC 50 =0.15. The FACS data revealed that this mutant recept or is not efficiently reaching the cell surface. It is being expressed within the cell, yet it is not being transported to the cell surface. There was no antagonist activity displayed with the peptides tested as antagonists at this receptor. This receptor was mutated from an acidic, negatively charged amino acid to a basic, negatively charged amino acid with a longer chain length. In conclusion, the underlying hypothesis in this com plex project was to determine if there were specific interactions between th e MC4R and AGRP based ligands, with a focus on receptor residues that may be involved in the conversion of antagonists to agonists. The Asn123 residue was proposed to participate in the binding of DArg 111 analogues and aid in the discovery of a new agonist template based on previous studies with the mouse receptor. 134 There was agonist activity with the monocyclic DArg 111 analogue at the WT and N123Q hMC4Rs. These results support that this residue may assist in the binding and stimulation of this lig and. The bicyclic DArg 111 displayed micromolar agonist activity at the WT hMC4R. However, the bicyclic DArg 111 exhibited activity at all of the N123 hMC4Rs. Theref ore, these results do not support the hypothesis that this receptor residue is specific in t he conversion of pharmacology with

PAGE 151

151 DArg substituted peptides Although this ligand did not support the hypothesis, the discovery of another agonist template was identified Modeling studies predict that the mMC4R F176 (hMC4R F184) interacts with Phe112 a nd Phe113 of hAGRP (87 132) in the hydrophobic binding pocket. 134,136 The stereochemical inversion of DPhe 112 in the monocyclic peptide caused both agonist and antagonist activity at the mMC4R. 134 The incorpo ration of DPhe 113 into the monocyclic derivative led to a full conversion of pharmacology and was postulated to have a different interaction with mMC4R Phe176 134 The monocyclic DPhe 112 peptide elicited agonist responses at all of the Phe184 hMC4Rs. It was more potent at the WT hMC4R than the mMC4R. The DPhe 112 bicyclic peptide had decreased agonist or complete lack of response at the hMC4 Phe184 mutant receptors. The DPhe 113 bicyclic ligand exhibited agonist activity at all of the hMC4R F184 mutant s. It was hypothesized that the DPhe 112 and DPhe 113 ligands should exhibit agonist activity at the WT hMC4R with reduced potency and antagonist activity at the hMC4R Phe184 mutants. In addition, the melanocortin based agonists did not retain pharmacologic al profiles similar to the WT hMC4R at the Phe184 mutant receptors. The results do not support the hypothesis that this receptor residue is specific for AGRP based ligands. The hMC4R Asp189 residue, putatively located in extracellular loop 2, was postula ted to be important in the binding of larger peptides based on modeling studies with the mMC4R homology model and hAGRP(87 132). 116 It was hypothesized that the smaller ligands, the mon ocyclic and bicyclic peptides, would not be affected the mutation of hMC4R D189 due to their lack of interaction in modeling studies. 116 The control peptides (monocyclic and bicyclic) d id not exhibit agonist activity, but they did

PAGE 152

152 not elicit an antagonist response either at the hMC4R WT or D189 mutant receptors These results are inconclusive in supporting or refuting the hypothesis stated for this receptor residue. Due to weak interacti on between hAGRP (87 132) Asn 114 mMC4R Asp181, the predicted changes in activity and potency may not be observed due to the limitations of the assay. A binding study should be performed before stating the hypothesis is incorrect The DArg 111 monocyclic p eptides did not have agonist activity at the hMC4R D189 mutant receptors. There were varying degrees of selectivity with the stereochemically modified bicyclic peptides at t he hMC4R D189 mutant receptors. Conclusion Asn 123 hMC4 Mutant Receptors This recept or residue, Asn123, was mutated to investigate the role of this residue in the conversion of an antagonist to agonist based on previous modeling data. 213 It was hypothesized that DArg substituted AGRP derivatives have an additional interaction with this residue unlike the Arg substituted AGRP derivatives. The DArg monocyclic analogue did exhibit agonist activity at the WT an d N123Q, while the DArg bicyclic analogue elicited an agonist response at all the N123 mutants. Therefore, it is postulated that this ligand receptor interaction may be more specific for the monocyclic derivatives. The presence of a slightly longer peptide and two disulfide bonds may not lead to an interaction with this bicyclic residue. Phe184 hMC4 Mutant Receptors It was hypothesized that mMC4R Phe176 interacts differently with hAGRP ligands versus the melanocortin agonist based ligands based on the muta tion of mMC4R Phe176Lys. 136 This mutant receptor had binding affninty for hAGRP, b ut no functional activity. While the MC based ligands, MTII and SHU9119 retained normal

PAGE 153

153 pharmacological profiles at this mutant receptor 136 Modeling studies indicated a putative interaction of this receptor residue with the Phe Phe residues of monocyclic AGRP derivative 134,136 T h is hypothesis was investigated with the hMC4R Phe184 residue rather than the mouse receptor. The F184K receptor showed either equipotent or slight decreases when stimulated with the known ligands adding support to the hypothesis. In addition, most of the AGRP derivativ es exhibited decreases in potency or there was a complete absence of agonist activity. The DPhe 113 bicyclic ligand did possess agonist activity at the WT and at most of the mutant receptors. However, there was a decrease in potency at the F184 mutant recep tors with this peptide as predicted. In addition, the DPhe 112 analogues exhibited agonist activity at the WT and the F184 mutant receptors. The monocyclic derivative was previously shown to have agonist and antagonist properties 134 in this study, i t showed to be a more potent agonist and antagonist activity could not be quantified. It is hypothesized that this residue, Phe184 hMC4R, plays a role in the binding of the AGRP derivatives, especially, the DPhe 113 analogues. Asp 189 hMC4 Mutant Receptors It is hypothesized that hAGRP ( 87 132) residue Asn 114 interacts with the mMC4R Asp181 (hMC4R Asp189 ), interaction n ot observed wit h less potent bicyclic peptide based on preliminary modeling studies. 107,116 There wa s a lack of response from the control bicyclic peptide at the WT and mutant receptors in both the agonist and antagonist assay. It was hypothesized additionally that d ue to the weak int eractions between Asn114 Asp181, the predicted changes in activity and potency may not be observed due to the limitations of the assay. With there being no change in pharmacology, further studies with this project should involve a binding study with this

PAGE 154

154 peptide (and perhaps analogues) before it can be stated that this peptid e does not have an interaction with the D189 hMC4R residue. Link between AGRP/MC4R and Obesity and Hypertension As briefly discussed in Chapter 1, there is a link between AGRP, MC4R, obesity and hypertension. Greenfield et al. demonstrated that the melano cortin system, specifically the MC4R, is involved in the regulation of human blood pressure. 15 Hypertension and blood pressure were observed to be lower in MC4R d ysfunctional subjects in comparison to control subjects and could not be explained by changes in insulin levels indicating that the central melanocortinergic nature influences cardiovascular regulation. 15 The melanocortin agonists play a preventative role in human obesity; however, the administration of an agonist resulted in an increase in blood pressure in normal and overweight/obese patients with normal MC4R fun ction. 15 Another study examined the role of AGRP and blood pressure levels in rats. 131 Administration of AGRP decreased mean arterial pressure and heart rate, regardless of the increase in food intake and weight gain, suggesting that AGRP plays a protective role in cardiovascular function. 131 The interplay between the melanocortin agonists, AGRP, and the MC4 R are significant potential tools in both obesity and cardiovascular diseases. The preventative agonist effect on obesity and putative protective role of AGRP on blood pressure suggests that as researchers we need to find a balance between the two in regar ds to their interactions with the MC4R. These opposing forces between the melanocortin agonists and AGRP in regards to obesity and blood pressure may lead to further examining the molecular determinants of the receptor and its regulation.

PAGE 155

155 This research tak es a step in the direction of determining specific interactions found with the AGRP and MC4R as discussed herein. The conversion of the AGRP derivative antagonist into an agonist based on a stereochemical substitution with DArg 111 may aid in the developmen t finding a medium between these opposing forces. This pept ide has the AGRP like sequence; however, it has agonistic effects on the MC4R. 134 The AGRP protein has been implicated in developing an obese, hyperphagic phenotype, and the absence of AGRP may lead to an increase in blood pressure and hypertension. 131 Wu et al. conducted a study in which AGRP neurons were removed in mice that already have chronic blocking of melanocortin agonists to examine the role of AGRP inhib ition. 222 It was observed that feeding behavior, after AGRP ablation, is altered in a melanocortin signaling independent manner. 222 Based on these experimental studies, the agonis ts and antagonists play a complicated role within the melanocortin signaling pathway. Therefore, further understanding of ligand interactions with the MC4R may provide insight to the obesity and cardiovascular implications within this pathway. The regulati on of food intake, obesity, and energy homeostasis have a direct involvement with AGRP and MC4R, and this research hopes to gain new insight about the specific molecular interactions of AGRP with the melanocortin receptors. Future Directions The next step in this research is to perform homology molecular modeling with the information gathered from the work presented herein. Modeling studies will gain further insight to what might be happening with the change of amino acid s at the three specified hMC4R resi dues examined. In addition, EMH1 100 and EMH2 93 showed in these hMC4R studies to be neutral ligands, neither agonists nor antagonists. They have

PAGE 156

156 been previously shown to be antagonists at the mMC4R, which was shown herein. The next step would be to determ ine if these ligands bind to the receptor through the use of radioactive competitive binding studies. Previous studies have also investigated multiple stereochemical modifications at this tripeptide. 134 It is proposed to apply these multiple stereoc hemical inversions within the bicyclic peptide template to further investigate the role of D amino acids and ligand receptor interactions. AGRP has been shown to be a competitive antagonist at the MC3R in addition to the MC4R; therefore, the exact mutatio ns and pharmacological studies should be extended to the MC3R to help determine the presence of a binding pocket in this receptor. This additional experiment will aid in the understanding of the MC3R and may contribute extra support for the conclusions ded uced from the MC4R experiments.

PAGE 157

157 Table 4 1. List of AGRP derivatives synthesized Name Sequence m/z (M, calc) m/z (M+1, expt) Linear Cyclized Cyclized EMH1 100 DPAATAYc[CRFFNAFC]YARKL 2326.70 2327.80 4.0 6.8 11. 4 EMH1 120 DPAATAYc [C DArg RFFNAFC]YARKL 2326.70 2327.75 5.9 6.2 10.6 EMH3 25 DPAATAYc [CR DPhe FNAFC]YARKL 2326.70 2327.16 6.2 6.1 10.9 EMH2 93 c1[CUDPUATUYc 2 [CRFFNAFC]2YC] 1 RKL 2573.00 2574.98 5.9 7.8 12.1 EMH3 45 c1[CUDPUATUYc 2 [C DArg FFNAFC] 2 YC] 1 RKL 2573.00 2574.98 5.4 7.5 12.4 EMH3 151 c1[CUDPUATUYc 2 [CR DPhe FNAFC] 2 YC] 1 RKL 2573.00 2574.03 6.6 5.5 12.8 EMH4 118 c1[CUDPUATUYc 2 [CRF DPhe NAFC] 2 YC] 1 RKL 2573.00 2574.39 5.2 6.6 12.0 Table 4 2. Sequences of endogenous and synthetic agonists used i n developing a pharmacological profile of new hMC4 mutant recepto rs Name Sequence NDP MSH Ac Ser Tyr Ser Nle Glu His DPhe Arg Trp Gly Lys Pro Val NH 2 MSH Ac Ser Tyr Ser Met Glu His Phe Arg Trp Gly Lys Pro Val NH 2 MSH Ac Ala Glu Lys Lys Asp Glu Gly Pro Tyr Arg Met Glu His Phe Arg Trp Gly Ser Pro Pro Lys Asp NH 2 2 MSH Tyr Val Met Gly His Phe Arg Trp Asp Arg Phe Gly OH ACTH(1 24) Ser Tyr Ser Met Glu His Phe Arg Trp Gly Lys Pro Val Gly Lys Lys Arg Arg Pro Val Lys Val Tyr Pro Asn VXF1 28 Ac His DPh e Arg Trp NH 2 MTII Ac Nle c[Asp His DPhe Arg Trp Lys] NH 2

PAGE 158

158 Figure 4 1 Sequences of AMGEN bicyclic peptides. A. Peptide hAGRP(91 122), does not include the disulfide bond contai ning the active loop, RFFNAFC. B. hAGRP(101 122), peptide synthesized in this research, with a disulfide bond containing the active loop. C. Cys residues not participating in disulfide bonds aminobutyric acid (Abu, U) Figure 4 2. S equence of Mini AGRP

PAGE 159

159 Figure 4 3. Postulated antagonist hAGRP(111 113) RFF amino acid interactions with hMC4R residues located in the TM proposed binding domain

PAGE 160

160 Figure 4 4 Postulated agonist DPhe Arg Trp amino acid interactions with the hMC4R residues located in the TM proposed binding domain

PAGE 161

161 Figure 4 5. Amino acids used to generate the four N123 hMC4R mutations Asparagine (N) Polar, Un charged Aspartic Acid (D) Acidic Alanine (A) Nonpolar, hydrophobic Glutamine (Q) Polar, Uncharged Serine (S) Polar, Uncharged Site Directed Mutagenesis N123 hMC4R Mutations (4)

PAGE 162

162 Figure 4 6. Amino acids used to generate the seven F184 hMC4R mutations

PAGE 163

163 Figure 4 7. Amino acids used to generate the seven D189 hMC4R mutations

PAGE 164

164 Figure 4 8. I 125 NDP MSH Competitive Binding Affinities of WT and N123 hMC4R mutants Figure 4 9. I 125 NDP MSH Competiti ve Binding Affinities of WT and F184 hMC4R mutants Figure 4 10. I 125 NDP MSH Competitive Binding Affinities of WT and D189 hMC4R mutants

PAGE 165

165 Figure 4 11. Fluorescence activated cell sorting (FACS) an alysis of the hMC4 mutant receptors in stably expressed HEK 293 cells. The total cell receptor expression levels were determined using permeabilized cells measuring both cell surface and intracellular protein expression. The cell surface expression levels were determined using non permeabilized cells. Cell expression levels are presented relative to WT hMC4R.

PAGE 166

166 Figure 4 12. Deconvolution microscopy image of WT Flag hMC4R and N123S Flag hMC4R stably expressed in HEK 293 cells and labeled with anti Flag APC antibody on the cell surface. Red: Receptor Expression at Surface, Anti Flag APC Blue: DAPI Nuclear Cell Staining

PAGE 167

167 Table 4 3. Summary of the melanocortin agonists and Ac His DPhe Arg Trp NH 2 (VXF1 28) ligand pharmacology at the hMC4R mutants # Indicates the average from 14 independent experiments of HEK 293 cells stably expressing the wild type (WT) hMC4R. These W T values represent those obtained while running parallel experiments with the receptors reported in this study. The values indicated r epresent the mean of at least five independent experiments with the standard error of the mean indicated. >1,000 and <10,0 00 indicates that the endogenous agonists cates that some stimulatory agonist pharmacology resulted, but the maximal stimulation le vels were less than the non receptor dependent forskolin control level. M utation MSH EC 50 (nM) NDP MSH EC 50 (nM) ACTH EC 50 (nM) 2 MSH EC 50 (nM) MSH EC 50 (nM) VXF1 28 EC 50 (nM) MT II EC 50 (nM) I 125 NDP MSH Binding IC 50 (nM) WT hMC4R# 8.232.9 0.0500.020 8.01.0 910250 1.570.32 0.790.12 0.200.063 10.31.4 N123A 18.48.9 0.026 0.004 11015 30101190 3.351.07 6.12.0 0.0590.013 11.52.5 N123D 7.503.96 0.0400.010 123.5 17041 0.620.16 1.00.33 0.0430.0056 17.96.5 N123Q 2.721.08 0.0220.004 8135 740205 1.080.22 0.900.36 0.0700.018 13.56.6 N123S >1,000 0.890.18 > 1,000 >10,000 >1,000 29560 4.850.84 >1,000 F184A 5.901.88 0.0480.014 9.21.9 43080 1.750.36 1.240.60 0.110.043 8.22.1 F184H 220110 0.0920.014 >1,000 >10,000 1116.6 24035 0.210.039 5.91.2 F184 K 13030 0.140.03 250125 29201380 8014 11. 62.5 0.460.12 24.08.3 F184 R >1,000 294112 >1,000 >10,000 >1,000 >1,000 1871667 >1,000 F184 S 3817 0.0350.007 7615 25501110 4.71.7 0.780.17 0.0790.019 187.8 F184 W 32670 0.0570.017 >1,000 >10,000 10791 17032 0.160.035 8.72.6 F184 Y 5 .42.6 0.0180.007 23064 1580730 3.61.7 3.10.54 0.150.070 10.04.0 D189A 12020 0.440.08 27568 4400705 22096 240105 4.940.92 13.40.7 D189E 6.662.92 0.180.11 7.470.36 400115 2.261.24 1.20.3 0.0900.041 16.75.4 D189K 0.120.01 >10,000 7315 41078 0.340.11 17.43.9 D189N 8412 0.0720.014 19047 16069 30047 0.240.055 16.53.3 D189Q 5.41.9 0.0250.005 199.5 640400 1.20.3 1.30.32 0.0980.035 10.01.7 D189R >1,000 0.150.034 > 1,000 >10,000 >1,000 >1,000 50583661 1.120.7 D189S 11.87.8 0.0220.003 17090 1320400 2.30.8 4.62.0 0.0410.0095 8.90.07

PAGE 168

168 Figure 4 13. Dose response curves of W T and N123 hMC4R mutants characterized with melanocortin agonists

PAGE 169

169 Figure 4 14. Dose response curves of WT and F184 hMC4R mutants characterized with melanocortin agonists

PAGE 170

170 Figure 4 15. Dose response curves of WT and hMC4R D189 mutants characterized with melanocortin agonists

PAGE 171

171 Figure 4 torsion angles

PAGE 172

172 Tab le 4 4. Summary of the monocyclic AGRP derivatives at th e WT and hMC4R mutants Mutation EMH1 100 EMH1 120 EMH3 25 WT hMC4R # >1 0,000 90551244 3391977 N123A >10,000 49271536 N123D >10,000 >10,000 2363660 N123Q >10,000 2029389 1416149 N123S >10,000 >10,000 90% F184A >10,000 57141930 1999170 F184H >10,000 F184 K >10,000 >10,000 45 F184 R >10,000 >10,000 F184 S >10,000 62471608 36021015 F184 W >10,000 99811059 57411467 F184 Y >10,000 >10,000 3871966 D189A >10,000 >10,000 >10,000 D189E >10,000 >10,000 133980.5 D189K >10,000 >10,000 D1 89N >10,000 >10,000 273814957 D189Q >10,000 >10,000 1618303 D189R >10,000 >10,000 >10,000 D189S >10,000 >10,000 1343157 #Indicates the average from 6 independent experiments of HEK 293 cells stably expressing the wild type (WT) hMC4R. These WT value s represent those obtained while running parallel experiments with the receptors reported in this study. The values indicated represent the mean of three independent experiments with the standard error of the mean indicated. <10,000 indicate that the ligan ds were unable some stimulatory agonist pharmacology resulted, but the maximal stimulation levels were less than the non receptor dependent forskolin con trol level. Figure 4 17. Competitive antagonist curves of EMH1 100 using MTII as the agonist.

PAGE 173

173 Figure 4 18 Dose response curves of the monocyclic AGRP derivatives at the WT and N123 hMC4 mutant receptors

PAGE 174

174 Figure 4 19 Dose response curves of the monocyclic AGRP derivatives at the WT and F184 hMC4 mutant receptors

PAGE 175

175 Figure 4 20 Dose response curves o f the monocyclic AGRP derivatives at the WT and D189 hMC4 mutant receptors.

PAGE 176

176 Tab le 4 5. Summary of the bicyclic AGRP derivatives at th e WT and hMC4R mutants Mutation EMH2 93 EMH3 45 EMH3 151 EMH4 118 WT hMC4R# >10,000 225156232 46501006 N 123A >10,000 70% 60% N123D >10,000 109601315 55% 3071606 N123Q 522108 12790617 1342129 2263227 N123S >10,000 65% >10,000 >10,000 F184A >10,000 5399494 1010177 106743737 F184H >10,000 62791750 >10,000 F184 K >10,000 >10,000 F184 R >10,000 >10,000 F184 S >10,000 65521998 73794.5 1939411 F184 W >10,000 74081403 >10,000 67001491 F184 Y >10,000 5399494 75% 10501252 4 D189A >10,000 >10,000 >10,000 >10,000 D189E >10,000 178262033 55% 3126368 D189K >10,000 >10,000 >10,000 D189N >10,000 >10,000 256103563 D189Q >10,000 132551929 277594.0 D189R >10,000 >10,000 >10, 000 >10,000 D189S >10,000 131041043 9184348 #Indicates the average from 6 independent experiments of HEK 293 cells stably expressing the wild type (WT) hMC4R. These WT values represent those obtained while running parallel experiments with the receptors reported in this study. The values indicated represent the mean of three independent experiments with the standard error of the mean indicated. <10,000 indicate that the ligands were unable to stimulate the receptor polymorphisms at up to 10 some stimulatory agonist pharmacology resulted, but the maximal stimulation levels were less than the non receptor dependent forskolin control level. The pA 2 antagonist value was determined by the Schild analysis (pA 2 = log K i ) Figure 4 21. Competitive antagonist curves of EMH2 93 using MTII as the agonist.

PAGE 177

177 Figure 4 22 Dose response curves of the bicycli c AGRP derivatives at the WT and N123 hMC4 mutant recepto rs

PAGE 178

178 Figure 4 23 Dose response curves of the bicycli c AGRP derivatives at the WT and F184 hMC4 mutant recepto rs

PAGE 179

179 Figure 4 24 Dose response curv es of the bicycli c AGRP derivatives at the WT and D189 hMC4 mutant recepto rs

PAGE 180

180 Figure 4 25. Summary of the studies conducted within Chapter 4.

PAGE 181

181 CHAPTER 5 DESIGN OF PEPTIDE LI BRARIES TARGETING TH E L106P HUMAN MELANOCORTIN 4 RECE PTOR SINGLE NUCLEOTI DE POLYMORPHISM Combinatorial chemi stry libraries were provided by the Torrey Pines Institute. The first single substitution library of peptides were synthesized, purified and analytically characterized by Erica Haslach under the superv ision of Dr. Carrie Haskell Luevano. The second substitution library of peptides were synthesized, purified and analytically character ized by Torrey Pines Institute. The functional assays at the mouse melanocortin receptors were carried out by Marvin Dirai n and Huisuo Huang, technicians in the Haskell Luevano laboratory. The functional assays at the hMC4R and L106P hMC4R were carried out by Erica Haslach. Data analysis was performed by Dr. Carrie Haskell Luevano and Erica Haslach. Naturally occurring mutati ons within GPCRs, including the melanocortin system, lead to disease states within an organism. Mutations within the melanocortin 4 receptor lead to an obese phenotype that has been shown in both homozygous null mice and humans and have been shown to be re sponsible for most common monogenic cause of human obesity. 6,7,11,16,17,26,117 119,121 130,223 These mutations are rare with a 0.5 6% occurrence of hMC4R mutations in obese adults and children that result in in vitr o consequences. 6,7,26,117 119,121 130,203,223 In 1997, screening of human patients for mutations in MC4R occurred after the observation that the MC4R mice developed obesity and hyperphagia. 8 Over 100 natural single nucleotide polymorphisms (SNPs) have been identified within the melanocortin system that leads to this obese phenotype, therefore, it is imperative to analyze the modified protein structure and function. Due to the complexity of the melanocortin signaling network and the lack of crystal structure, the exact nature of residues related to a specific function remai n unknown.

PAGE 182

182 Demonstration of a pathogenic effect due to a rare mutation is necessary to be able implicate a mutation in a common disease, such as single nucleotide polymorphisms and the MC4R. In addition, it is vital that pathogenic mutations be distinguis hed from functionally insignificant ones. There are four main categories to which naturally occurring mutations are placed in based on their effect. There are three major functional defect groups hypothesized to be due to the presence of these residue muta tions within the MC4R that may lead to a pathogenic effect of these mutations and to be tested category. Figure 5 1 is a schematic representation of the functional consequences of mutations that may occur within GPCR. Changes within the amino acid sequence leading to truncated receptors or missense substitutions or frameshifts can severely alter the normal response of the receptor by impairing membrane expression, altering agonist activation, and decreasing constitutive activity. One major functional defec t due to MC4R mutations leading to an obese phenotype may be due to partial or complete intracellular retention of the full length protein receptor. 117,224 The ability of a receptor to bind a ligand is dependent on both cell surface expression and ligand affinity. These classes of mutant rec eptors may be fully synthesized, however, they are retained within t he endoplasmic reticulum and are unable to traffic to the cell surface. Due to the lack of further post translational 192 In other cases, receptor folding may be affected from the amino acid substitution or truncation. A change in rec eptor conformation will affect ligand binding, especially if the binding pocket is distorted. In addition, partial expression on the surface may reduce ligand affinity leading to a decreased agonist response. Some of the obesity causing

PAGE 183

183 MC4R mutations lea control system. Therefore, recovering cell surface expression of mutant MC4Rs could have a beneficial therapeutic value. Restoring this defect may include the use of one single compound inducing a different conformation. 122,225,226 Mutations may have an effect on ligand binding and/or signal transduction. 117,121,122 Molecular recognition and receptor stimul ation of a ligand is a function commonly compared among MCRs. The ability to find a potent and/or selective ligand is a major facet of drug discovery. The presence of a mutation may alter agonist activation due a change in receptor conformation or perhaps affecting the binding pocket. In most cases, MC4R mutants display diminished response that can range from an inability to produce a maximal response to a lack of response entirely. 117,121,122,225 A reduction in agon ist tone may lead to an obese phenotype, although little mechanistic information is known on why this specific mutation is causing the disease state. It is hypothesized that reduced receptor expression, decreased ligand affinity, a decrease in signal trans duction or a combination of all these effects may lead to a diminished agonist response. 117,121,225 Most often, mutations are taken to be loss of function leading to a disease state; however, it has been shown that there are mutations that are a gain of function for the MC4R that have negative results. 110,225 In vitro studies have shown that MC4R exhibits a c onstitutive activity in the absence of an agonist. 110 The endogenous melanocortin antagonist, AGRP, has been shown to act as an inverse agonist in the absence of an agonist to effect basal constitutive activity. 110 AGRP competitively antagonizes endogenous melanocortin agonists i n the brain MC3R and MC4R to prevent the signal

PAGE 184

184 transduction cascade. 110 The polymorphism L250Q has been identified in obese individuals that increase the constitutive activity of MC4R 24,117,203 There is a matter of debate ab out two other SNPs S127L, P230L 227 that exhibit constitutive activity. These data suggest that in the absence of a ligand, MC4R can exert a food intake inhibiting activity. 225,226 Finally, the last class involves mutations that do not provoke impairment or it is unknown of effect due to lack of testing. One of the functional consequences of a mutant receptor is reduced agonist functional activity, and it is hypothesized that may be linked to an obese phenotype in humans that possess the polymorphism. 117,121,122 Previous studies in our lab have been undertaken to identify synthetic ligands that can restore functional activity in hMC4R 2 MSH, ACTH(1 24)] potency. 122 In 2007, Xiang et al. demonstrated the ability of synthetic peptides and sm all molecules to rescue the functional ability of selected polymorphisms. 122 The ligands, NDP MSH, MT II, THIQ ( Figure 5 2 ) and the cyclic chimeric AGRP melanocortin agonist AMW3 130, Tyr c[Cys His DPhe Arg Trp Asn Ala Phe Cys] Tyr NH 2 elicited subnanomolar and nanomolar potency at the hMC4R polymorphisms (S58C, I102S, L106P, S127L, T150I, R165Q, R165W, L250Q, G252S, C271Y, Y287Stop, and I301T). 122 This provided background for the further design of ligands that may be able to rescue dysfunctional hMC4Rs and hopefully li gands that will specifically target one polymorphism. 122 Roubert et al. introduced novel pharmacological agonists that can efficiently activate MC4R mutants that have been shown to exhibit impaired agonist response. 193 Two compounds IRC 022493 and IRC 022511, were able to bind and activate hM C4R

PAGE 185

185 MSH at the WT hMC4R. The mutations studied, S127L, S58C, I102T, G 252 S were identified earlier in French patients that MSH potency compared to WT hMC4R. These pept ide ligands were previously shown to reduce food intake and body weight gain in normal rodents 10 In addition, the ligands exhibited a highe r affinity to MSH. 193 Developing anti obesity drugs for those who are genetically predisp osed to obesity is crucial. The restoration studies conducted by our lab and Roubert et al. allows researchers to be o ne st ep closer to finding a therapeutic target for obesity and further supports the study discussed herein. The Leu106Pro mutation has been hypothesized to be in extracellular loop one 26,141 or transmembrane two 117 within the human melanocortin 4 receptor. Due to the lack of crysta l structures of the melanocortin receptors, it remains unclear the exact placement of this residue. This residue has been found to be conserved across species (rat, murine, bovine, porcine and zebrafish); however, it is still unknown whether this mutation and effect are conserved. It is interesting to note, that the homologous mutation in murine MC1R, L98P, results in a constitutively active receptor; however, this was not observed with the L106P hMC4R in any studies conducted on this mutation. 26,117,228 Yeo et al. have shown that this mutation has been shown to lead to an obese phenotype in a human patient. 7 Pharmacological Characterization of L106P hMC4R In 2003, Yeo et al. published that L106P hMC4R was unable to respond to MSH stimulation, there was no cAMP response to increasing concentrations of the ligand. 26 In a receptor binding affinity study, it was observed that L106P hMC4R does not bind to both NDP MSH and AGRP. Yeo et al. demonstrated that the receptor was on the cell

PAGE 186

186 sur face, but in a low concen tration as compared to the WT MC4R. 26 In 2006, Xiang et al. demonstr ated that this point mutation was unable to elicit a full maximal response concentrations. The agonist MSH; it was only able to gen 2 MSH exhibited maximal responses, and the antagonist fragment hAGRP (87 132) was equipotent at the mutant receptor in comparison to the WT The L106P hMC4R resulted in statistically signif icant decreased NDP MSH, MT II, and THIQ agonist potency. In addition, it showed a 36% level of cell surface expression. Table 5 1 compares agonist and antagonist affinity the WT hMC4R and the L106P hMC4R. 117,229 In a study conducted to rescue functional activity and agonist potency of dysfunctional hMC4R polymor phisms, the L106P mutation was selected because it was previously identified to possess statistically significan t decreased agonist potency. 117,122,229 A cyclic peptide involving a disulfide bridge, Tyr c[Cys His DPhe Arg Trp Asn Ala Phe Cys] Tyr NH 2 (AMW3 130) was found to exhibit sub nM agonist potency at the L106P. 107,122,217 In addition, two tetrapeptides (Figure 5 3 ) were identified to exhibit nM full agonist potency at this mutant receptor. The successful identification of tetrapeptides that were able to restore activity at this r eceptor deemed this polymorphism worthy to continue studying. The polymorphism L106P hMC4R, is important to examine the actual amino acid change, not only the position of the residue. The 106 position within the hMC4R is occupied by a Leucine residue, wh ich is classified as a hydrophobic amino acid. With its isobutyl side chain also labels this amino acid as a branched chain amino acid due to its non linear aliphatic group. The mutation leads to the substitution with Proline, which is

PAGE 187

187 categorized as a hyd rophobic, non polar amino acid, however, it is unique because its side chain cyclizes to the backbone amide group. See Figure 5 4 for a comparison of the structures of these two amino acids. Proline is the only amino acid to have a secondary amino group, amino acids because they have a primary amino group and a carboxylic acid on the same conformation of its backbone and N bond of amino a cids (Figure 5 5 ). sheets and turns. Through t he use of a Ramachandran Plot, one can visualize dihedral structures. 218 The cyclic pyrr olidine side chain of proline imposes conformational rigidity 218 Due to the special arrangement of the proline residue, it is rarely found within sheets. Proline residues are found within the first turn of a n helix, however, if found in the middle of a helical structure it will disrupt the structure. This structural consequence classifies proline as a helix breaker. Helices are common secondary structure elements within peptides and proteins and exist in a spir al/coiled conformation. This motif is stabilized through intrachain hydrogen bonding that occurs between the backbone N H group and to the backbone C=O of the amino acid four residues earlier. Proline is the only amino acid that does not have a hydrogen at om to donate to form a bond, therefore, disrupting the

PAGE 188

188 hydrophobic network. It will actually induce a slight bend within the structure due to th e lack of hydrogen bonding ( Figure 5 6 ). To conclude, th ere are a few reasons that show proline being detrimenta helix: 1) Pyrrolidine ring is bulky and sterically inhibits the conformation of proline, the preceding and succeeding amino acids, and the overall helix structure. 2) Unable to participate in helix stabilization due to the absence of an amide proton. 230 Since a proline residue will induce a slight kink in a helix structure, it is hypothesized that amino acid will have key roles if found present within transmembrane helix. 230 First, it is proposed by Deber and Therien that the occurrence of a bend within a transmembrane domain co ntributed by a proline residue might have a structure role either upon the entire structure or assisting in positioning another amino acid. Second, the presence of proline could have a functional role. Lack of amide proton on proline leaves the carbonyl ox ygen at position i 4 open to bind to different substrates further affecting the signal transduction cascade. Proline may correct misfolded states in early helical conformations. 230 Taking into consideration the ability of proline to disrupt a helix and the lack of agonist response at the L106P hMC4R mutation has led to the hypothesis that the introduction of a proline in pla ce of a leucine residue at position 106 in hMC4 GPCR is distorting the receptor and further disrupting the normal ligand binding process. The location of Leu106 in TM2 or right after in EC loop 1 is not conducive to accommodate a proline residue. Proline is postulated to induce a conformation change leading to a modification in the binding pocket. Smaller, compact ligands were identified to restore activity 122 ; therefore,

PAGE 189

189 it is proposed to develop tetrapeptides that will regain activity at the L106P hMC4R mutati on. Designing a peptide library usually begins with a template sequence that is subsequently altered through various techniques, such as the incorporation of different amino acids encompassing opposite properties of the known sequence or substitution with D amino acids, with the goal of identifying lead compounds for a target. The use of combinatorial chemistry (CC) was employed to find a starting point for the design of a library for the mutant receptor, L106P hMC4R. Combinatorial chemistry is a tool that allows the synthesis of multiple reactions in one reaction vessel to create all possible synthetic products from a set of building blocks. (Figure 5 7 ) This technique involves fewer discrete steps providing a high yield of compounds. The screening process still remains as a limiting factor in drug design and discover y. Mixture based libraries lead to the creation of tens of thousands to billions of compounds making them powerful tools that through deconvolution may lead to the identification of active sing le compounds for important targets (Figure 5 8 ). 143,231 Mixture based libraries are experimentally designed to incorporate defined and mixture points of diversity, which allows for the identific ation of the functionality/amino acid at a specified position within the library. Following screening and data analysis, iterative deconvolution gradually decreases the number of compounds per mixture to progressively define positions. Unfortunately, decon volution necessitates repetitive synthesis and screening steps which is a costly and timely process. The practice of high throughput combinatorial chemistry libraries was accepted since its inception more than 20 years ago and has now become a common appli cation in the drug discovery process worldwide. 143,231

PAGE 190

190 The primary receptor screening utilized combinatorial chemistry plates provided by the Torrey Pines Institute for Molecular Studies (TPI) that contained 216,000 peptides incorporating amino acids listed in Table 5 2 at different positions with the melanocortin tetrapeptide, Ac His DPhe Arg Trp NH 2 as the template. A positional scanning approach was utilized, in which peptides would have one position defined while the other three positions were mixtures of amino acids. The compounds were screened at the mouse, human melanocortin receptors and multiple mutant forms of the hMC4Rs. The following mutant receptors were F51L, S58C, E61K, D90K, N97D, I102S, L106P, I127L, T150I, Y157S, I169T, A219V, and C271Y. These mutant receptors were selected because they were previously characterized as not responding normally to the endogenous agonist ligands as compared to the WT hMC4R. 117,121,122 The L106P obesity and related diseases. 7 This mutation will be focused on in this work to: 1) find peptides that stimulate the mutant receptors and 2) use as an example for proof of concept for the use of a combinatorial chemistry library. galactosidase reporter gene assay. 133 Figure 5 9 shows samples of screening combinatorial chemistry library plat es at the L106P hMC4R. All plates tested basal, forskolin and NDP MSH as controls (as indicated in figure) with the new compound mixtures in the center. The intensity of yellow color is proportional to degree of potency; with compounds being more potent w ill exhibit a stronger degree of yellow. Screening of the TPI library resulted in the identification of JRH887 9 and JRH322 18 as hits which are compounds that exhibit nanomolar potency (Table 5 1). These same two

PAGE 191

191 tetrapeptides were previously identified t o exhibit nM potency at the L106P hMC4R, supporting the concept of using the mixture based TPI combinatorial libraries to find lead compounds. 122 Deconvolution lead to the identification of amino acids at specific positions in the tetrapeptide template that may t arget the L106P hMC4R. (Figure 5 10 ) Table 5 3 lists the amino acids that were defined at the four different positions leading to twenty one peptides (sequences in Table 5 4). The library was synthesized (by E. Haslach) and pharmacologically characterized at following receptors: hMC4R, L106P hMC4R (assay performed by E. Haslach), and mouse MC1, 3, 4, and 5Rs (assay performed by M. Dirain). SAR of Single Substituted Peptides at hMC4R and L106P hMC4R The control, EMH4 90, exhibited an EC 50 value of 2.6 at th e WT hMC4R and a dramatic decrease is observed at the L106P mutant (EC 50 =215 ). The library contained substituted peptides at all four positions. The amino acids used ranged in different sizes, charges, and polarity as indicated in Table 5 3, Figure 5 1 1 A summary of the pharmacological activity of this library at the hMC4R and L106P can be seen in Table 5 5 and the mouse receptors (excluding mMC2R) pharmacological data can be seen in Table 5 6. The mMC2R was not tested due to previous studies in which it w as shown that this receptor is only stimulated by ACTH. 27,62 His S ubstitution Previous studies have indicated that the presence of the imidazole ring of His does not play a large role in the formation o f ligand receptor interactions; however, an amino acid is n eeded at that position for receptor selectivity. 89,106 The following describes the pharmacological response when His is substituted with nine different amino acids. The amino acids used to develop the new tetrapepti des include: Arg, Trp, Tyr, DArg, Tic,

PAGE 192

192 DTic, (pCl)DPhe, (pI)DPhe, (3I)Tyr. The use of Arg (EMH4 91) at the His position resulted in a potency ( EC 50 =1.06) that was comparable to the control; however, the use of the DArg (EMH4 94) causes a decrease in potenc y (EC 50 =40 ). The stereochemical inversion of Arg to DArg does not follow the trend that the D AA results in a more potent peptide as seen with Phe to DPhe, as in the incorporation in NDP MSH. 94 The same results were observed at the L106P hMC4R with the Arg and DArg substitutions of His. There is an increase in potency with the use of Arg (EC 50 =124 ), however, a decrease is seen with the DArg substituted p eptide leading to micromolar potency. The introduction of the hydrophobic Trp amino acid results in a peptide (EMH4 92) that causes a decrease in potency at the WT hMC4R, but an increase is exhibited at the L106P mutant in comparison to the control peptide The placement of Trp at the first position in the tetrapeptide sequence may aid in restoring activity at this mutant receptor. The peptide EMH4 93 contains a Tyr at the His position and exhibits an EC 50 value of 6.2 at the WT hMC4R. At the L106P hMC4R, E MH4 93 resulted in 2.5 fold decrease in potency compared to the control peptide. The following two tetrapeptides, EMH4 99 and EMH4 100 contain Tic and DTic, respectively, at the His position. There is a slight decrease in potency with the use of Tic at the WT hMC4R and a more dramatic decrease with the use of DTic at that same receptor. The same trend is observed at the L106P hMC4R with the DTic substituted peptide being less potent; however, both peptides exhibited micromolar activity at this mutant re ceptor. There large hydrophobic residues are not resulting in a manner to which the Trp substituted peptide at the L106P with a slight increase in potency.

PAGE 193

193 Perhaps, the presence of the indole moiety on Trp is providing an effect similar to the imidazole mo iety of His. The incorporation of halogenated amino acids at the His position were the last of the substitutions. The tetrapeptide EMH4 101 contained a (pCl ) DPhe and caused a decrease in potency at both the WT and polymorphic receptor in a similar manner The use of (pI)DPhe (EMH4 102) resulted in a similar response that was seen with the (pCl)DPhe substitution, in which, a decrease in potency was observed. However, the use of (3I) Tyr exhibited an increase in potency at the L106P hMC4R (EC 50 =43 ) and a sl ight increase in potency at the WT hMC4R compared to the control peptide (Figure 5 1 2 ). Comparing this peptide to the Tyr substituted one (EMH4 93), it was observed a 12 fold decrease in potency at the L106P receptor. The iodinated Phe amino acid did not h ave that effect at this receptor; perhaps the placement of the iodine on the different residues plays a larger role than expected. Phe Substitution Homology modeling, mutagenesis, and SAR data has led to the hypothesis that there is a binding pocket foun d within the MC4R for both agonists and antagonists located among TM1, 2, 3, 6, and 7. 136 It is proposed that there is a hydrophilic region in which Arg interacts with and a hydrophobic network for DPhe Trp of the tetrapeptide. 116,136 The Arg residue is postulated to interact with the acidic resi dues Asp122, Glu100, Asp126 forming a strong and stabilizing ionic bridge between the acidic side chains and guanidinium moiety of Arg. 116,136 Additionally, there is a putative complex of hydrophobic, aromatic Phe r esidues to interact with the DPhe Trp residues in the peptide sequence 116,136 The substitution of amino acids at these positions may further add to the information regarding this binding pocket.

PAGE 194

194 The aromatic phenyl ring of DPhe significantly contributes to the formation of the stable ligand receptor complex. 88,106 The DPhe position was substituted with three different amino acids: Arg, (pCl)DPhe, (pI)DPhe. Homology modeling of the mMC4R has resulted in the hypothesis that there is an aromatic network of Phe residues within the receptor in which the DPhe Trp amino acids of the tetrapeptide interact with in the proposed binding pocket. 116,1 36 At both receptors the Arg substituted tetrapeptide, EMH4 95, was the least potent peptide. The presence of the acidic side chain may not interact the intended way in the hydrophobic binding p ocket. However, the use of (pCl)DPhe (EMH4 104) results in th e most potent peptide in the library at both receptors. The peptide EMH4 105 contains the (pI)DPhe at the DPhe position and exhibits EC 50 values of 1.3 at the WT hMC4R and 97 at the L106P, which are both increases in potency (Figure 5 1 3 ). Both substituted am ino acids contain a DPhe group; however, the addition of a halogen that is improving the ability of the mutant receptor to respond to the peptide. It is hypothesized that since chlorine is smaller than iodine fits better in the proposed binding pocket l eading to a stronger affinity and agonist activity. Arg Substitution Previous studies have shown that removal of guanidinium side chain moiety results in decrease in MCR potency, but it is not critical for MCR agonist activity. 91,106,232 236 The homology modeling of the mMC4R has postulated the presence of a hydrophilic binding pocket in which Arg interacts with three mMC4R acidic residues, Glu100, Asp 122 and A sp126 116,136 The side chains of Glu and Asp are suggested to form a strong and stabilizing ionic bridge with Arg. 91 In this study, Arg was substituted with Lys and Tic. The acidic amino acid, Lys, causes a decrease in potency at both receptors. This amino acid has si milar structure to Arg, however, the guanidinium moiety of Arg

PAGE 195

195 proves to be more potent that Lys lacks. The substitution of Arg with Tic results in a decrease in potency at both receptors as well. The exchange of an acidic amino acid for a bulky, hydrophob ic group further supports the presence of the proposed hydrophilic pocket. 116,136 Trp Substitution The indole moiety of Trp in the tetrapeptide template is important for melanocortin receptor potency as demonstrate d by previous studies. 90,106 The Trp position was substituted with 5 different amino acids: (pCl)Phe, (pCl)DPhe, (pI)DPhe, (pNO 2 )DPhe, (pCl)DPhe resulted in the same trend in which the L AA is more potent at both re ceptors. However, at both the WT and polymorphic receptors, neither (pCl)Phe and (pCl)DPhe substituted tetrapeptides resulted in a more potent peptide in comparison to the cont rol. Slight decreases in potency were observed with EMH4 108 which contained a (pI)DPhe at the Trp position. The use of (pNO 2 decreases in potency at the WT and polymorphic hMC4R. SAR of Single Substituted Peptides at Mouse Me lanocortin Receptors The peptides were also pharmacologically characterized at the mouse melanocortin receptors, data can be found in Table 5 6. Mouse receptors are utilized for two main reasons: to examine receptor subtype selectivity between different is oforms and to assist in physiological relevance of these potential ligands as in vivo tools. Analysis of the response exhibited by the new ligands at the mouse receptors shows that substitution of His with any of the new amino acids does not bode well at t he mMC3R resulting in absence of activity or low amount. There is great receptor selectivity with these new ligands between the mMC3R and mMC4R. Overall, this

PAGE 196

196 receptor exhibited the least potent response from the new ligands among the mouse receptors. In comparison of the mMC4R and mMC5R, these two receptors exhibited normally a 1 3 fold difference in activity, with the mMC5R being less potent. Among the mouse, human and mutant receptors, there were six peptides (EMH4 91, EMH4 92, EMH4 93, EMH4 103, EMH4 103, EMH4 105) that were the most potent. The first four involve replacement at the His (first) position and the latter two incorporate halogenated DPhe groups over non substituted DPhe (Table 5 5, 5 6). In comparison of the hMC4R and mMC4R data, the pepti des are more potent at the human receptor; however, there is not a large difference in agonist activity, especially at the six potent peptides. Assessment of the mouse receptors shows that the MC4R elicits more potent results over the other three receptors However, the mMC5R has only slightly decreased EC 50 values in comparison to the mMC4R. The peptide EMH4 91 has an Arg residue at the first position and it was observed that there is a slight increase in potency at the mouse receptors in comparison to the control tetrapeptide (EMH4 90). The same trend was detected in which the stereochemically inversion of Arg (EMH4 91) to DArg (EMH4 94) at the first position does not elicit a more potent response. The introduction of the hydrophobic Trp amino acid result s in a peptide (EMH4 92) that causes a decrease in potency at mouse receptors, similar to the response observed with the hMC4R. Likewise the same trend was observed with the introduction of Tyr at the first position; it resulted in a decrease in potency at the mouse, human and mutant receptors. The last potent peptide found in this group incorporates a (3I) Tyr at the first position. The addition of the iodine to the Tyr actually showed to

PAGE 197

197 improve potency in comparison to the control at all the receptors, e xcept the mMC3R. This same trend was observed for both the human and mutant receptor. The last two potent peptides identified in this study substitute either (pCl)DPhe (EMH4 104) or (pI)DPhe (EMH4 105) at the DPhe (second) position. There is actually a dr amatic improvement in poten cy with the (pCl)DPhe, with a 17 fold increase at the mMC4R in comparison to the control tetrapeptide. There was not as large of fold increase in potency with the use of (pI)DPhe. Previous studies have examined this tetrapeptide before demonstrating that it retains similar agonist potencies at the mMC1R, mMC4R, and mMC5R. 88,92 This tetrapeptide exhibits mixed pharmacological results at the mMC3R, with being a partial agonist and having anta gonistic properties. 88,92 This peptide was only tested as an agonist in this particular study. Overall, EMH4 104 was the most potent peptide at all the receptors in which there was a (pCl)DPhe group at the second po sition, normally where DPhe is within the s equence. The role of phenyl ring in the tetrapeptide is to form stable ligand receptor complexes, it is hypothesized that the utilization of the halogenated DPhe amino acids is assisting the tight binding of the l igand to receptor. The halogens have electron withdrawing properties. The iodine and chlorine substitution on the phenyl ring may augment the aromatic aromatic (i.e. Van der Waals, hydrophobic, and electrostatic) interactions through the formation of elect ron donor acceptor complexes. The charge transfer may result in an electrostatic interaction providing a stabilizing force f or the ligand receptor complex. Additional C ombinatorial Chemistry Plate Screening The potent nM results that were hypothesized to b e produced from the screening process were not found (Table 5 5). After examining the data, it was reasoned that the

PAGE 198

198 amino acids chosen for the design of peptides were part of a mixture and that is why the potent peptides were not found with using only sin gle substitution. Rather, double and triple substitutions may be necessary in the tetrapeptide sequence to obtain potent peptides at L106P hMC4R. Therefore, a mini mixture library was designed based on previous studies to act as an additional preliminary s creening process to determine which mixtures of amino acids are leading to the potent peptides identified in the first screening process. 237 239 Once these substituted peptides are identified, the peptides would the n be individually synthesized and pharmacologically tested. The basic concept of this project was to have mixtures of amino acids at the respective positions, separate and isolate individual peptides through RP HPLC based on hydrophobicity of AAs, and then characterize them through mass spectrometry. In Figure 5 1 4 a basic peptide chain schematic is shown incorporating mixtures at different positions. It is hypothesized that the His position will ju st have one amino acid present; however, a mixture of amin o acids will be used at the other three positions. Once all the peptides were written out that were expected to be produced from this library, there was a total of 36 tetrapeptides just using the example where Tr p would be substituted for His. It was concl uded that there would be too many peptides to be able to properly separate through RP HPLC, in addition, some have the same or very similar mass spectrometry values that would make the identification process harder. After identifying peptides with similar mass spectrometry values, the library was split into six mixtures as shown in Table 5 7. The success of this mini library method is dependent upon obtaining a high yield in the synthesis and being able to separate the individual peptides. It is important t o note that reagents must be few and reactivity carefully matched, in addition separation and

PAGE 199

199 isolation of the products is a limiting process. Experimental details can be found later in the chapter. One peptide mixture was synthesized to support and valida te the use of this mini mixture library to identify potent residues. This mixture that was chosen to be synthesized was based on the previous single substitution tetrapeptide results, the placement of the Trp at the His position resulted in a peptide that stimulated both receptors. The mixture EMH7 11 was synthesized incorporating single amino acids or mixtures at the specified positions as indicated in Table 5 8. The RP HPLC analytical of this peptide can be seen in Figure 5 1 5 showing the presence of fou r defined peaks. Although the mixture experimental design predicted the formation of eight different peptides, it is hypothesized that some amino acids may have a faster coupling rate and dominate. The four peaks were collected and were evaluated using mas s spectrometry. Peptide sequences listed in Table 5 9 were found to be associated with the peaks from the HPLC analytical. Once the peptide was synthesized and cleaved from the resin, it was pharmacologically characterized at the hMC4R and L106P hMC4R in a dose dependent manner. Table 5 10 indicates the concentrations of the peptide used at the different receptor and the absorbance values obtained. It was observed that this mixture was potent at most of the concentrations at the hMC4R, while at the L106P it only stimulated the receptor about half the value at the hMC4R. There was a drastic decrease in potency as further dilutions were made. Although this peptide was not found to be potent at the L106P hMC4R, it provided two answers: 1) this specific mixture of amino acids does not potent stimulate this mutant receptor; 2) validates the mi ni mixture protocol designed.

PAGE 200

200 Simultaneously, the TPI was producing a similar, but larger combinatorial chemistry library using a mixture based method to be tested at the hMC 4R and L106P hMC4R to identify potent residues at the four positions of the tetrapeptide (TPI924 CC plate). Screening was performed at the WT and L106P hMC4 receptors. The WT These concentrations were used to produce a dose response curve. Figure 5 1 6 shows the map key of the plate, with the basal, for skolin and NDP controls and peptide mixtures located in the wells that contained the 924 prefix. Each mixture contained a constant residue at one position, while mixtures at the other three positions. The screening process led to a deconvolution step that discovered that the amino acids at the respective positions listed in Table 5 11 should lead to potent nM compounds at both receptors. This latest screening process lead to a tetrapeptide library composed of 36 members. After analyzing the library, it was concluded to first synthesize and test the peptides incorporating (pI)DPhe at the second position in the tetrapeptide. Previous SAR studies showed that the incorporation of (pI) DPhe within the melanocortin template, converted an agonist into a partial ago nist/antagonist only at mMC3R, while retaining agonist potencies similar to the control at the other mouse melanocortin receptor subtypes. 92 The iodine containing peptide dis played notable partial agonist activity (up to 50% maximal response) in addition to competitive antagonism at the mMC3R. This 18 member library was synthesized by the TPI and was subsequently pharmacologically analyzed at the WT hMC4R and L106P hMC4R. Addi tional peptides were synthesized

PAGE 201

201 by TPI to act as negative controls. All 39 tetrapeptide sequences can be found in Table 5 12. Pharmacological Results of TPI1981 Peptides at hMC4R and L106P hMC4R The following peptide library contains substitutions at all four positions with the following amino acids: R1) Tic, His, Arg; R2) (pI)DPhe; R3) Tic, Arg; R4) (pNO 2 )DPhe, (pI)Phe, and Tic. Summary of the pharmacological agonist data at the WT hMC4R and L106P hMC4R can be seen in Table 5 13. As described earlier, it has been hypothesized through SAR and modeling data, that each position in the melanocortin tetrapeptide has a role when binding to the receptor either having a specific moiety at a position or just the presence of an amino acid at the position. 88 91,106 At position 1, His is the normal amino acid in the melanocortin tetrapeptide sequence; therefore, any discrepancies in potency may be attributed to the other substitutions. Arginine is another basic residue, but di ffers in shape of side chain. The Arg residue has a n aliphatic linear side chain with capped by a complex guanidinium group. The last substitution at the first position involves the use of Tic, which is a hydrophobic bulky group. The replacement of DPhe with the halogenated analogue, antagonist/partial agonist at the mMC3R, while retaining agonist activity at the other receptors. 88,92 This position was kept constant in the library. At position 3 in the melanocortin tetrapeptide, Arg residue is found. The use of Arg in these peptides will act as a control to determine t he importance of the other positions and the new amino acids introduced. The other amino acid used at this residue is Tic, which is chemically opposite of Arg. This substitution may further support the presence of a hydrophilic binding pocket within the me lanocortin receptors. The final position

PAGE 202

202 within the tetrapeptides utilized (pNO 2 )DPhe, (pI)Phe, and Tic. This position is normally occupied by a Trp group, the indole moiety is important for melanocortin receptor potency. Evaluation of substituents attache d to a phenyl ring will be explored at this position by using the hydrophilic (NO 2 ) group and the halogen iodine. However, the (pI)Phe is the L conformation, while the (pNO 2 )DPhe is the D conformation. Therefore, electronic and stereochemical effects are i nvolved with the use of these amino acids. Another bulky, hydrophobic group will be analyzed at this position, Tic. Peptides TPI1981 2 and TPI1981 3 are constant at the first three positions, but differ at the fourth position. Having Tic at positions 2 an d 4 (TPI1981 2), showed a decrease in potency at the WT hMC4R, but did have maximal stimulation unlike at the observed in TPI1981 3, with Tic incorporated at three out of four positions did not perform as agonist well at either receptor. Both were shown to have some activity, about 40 may be detrimental to agonist activity at the receptors. It is hy pothesized that there is no residue interacting in the proposed hydrophilic binding, therefore, it is not stimulating the receptor in the same way as the tetrapeptide, Ac His Phe Arg Trp NH 2 Peptides 4, 5, and 6 contain Tic (pI)DPhe at positions one and t wo, respectively, but now the introduction of Arg with further diversity at position 4 are incorporated into this set. Tetrapeptide TPI1981 5 was shown to the most potent out of this set of three peptides; however, there was still a fold difference in decr eased potency in comparison to the control tetrapeptide and NDP MSH. These peptides are more potent and exhibit maximal stimulation having Arg at position three rather than Tic at that position. These

PAGE 203

203 results further support that the presence of a hydroph ilic residue may be necessary at position three for proper binding and conformation of the receptor for signal transduction cascade. The next set of peptides has His at the first position which is the same as the control. At the other three positions, (pI )DPhe is at the second position, and the first set contains a Tic at third spot with diversity at position four. Inte resting and exciting results were obtained with these peptides! An increase in potency was observed at both receptors, with TPI1981 7, that has the following sequence: Ac His (pI)DPhe Tic (pNO 2 )DPhe NH 2 It exhibited an EC 50 value of 0.16 at the WT, which is an increase from the control (EC 50 =0.50), and resulted in an EC 50 value of 14.0 at the polymorphic receptor. This is a large fold increa se in potency compared to the control tetrapeptide at this receptor. Looking at the peptide 1981 10, which is similar in sequence to 1981 7, except has an Arg at the third position like in the control peptide. Since the structure of this peptide is somewha residue at position two, Arg at position three. The two main differences include the addition of iodine to the DPhe residue and the placement of (pNO 2 )DPhe at the final position conseq uently decreasing potency; however, when in sequ ence with Tic, the residue (pNO 2 )DPhe may be having a strong effect on recognition and stimulation of both receptors as observed earlier. Interestingly, an opposite trend is observed with peptides TPI1981 8 and 11. When looking at the final two positions within the sequences, 1981 8 is Tic (pI)Phe and 1981 11 has Arg (pI)DPhe. TPI1981 8 shows to have a decrease in potency; however, 1981 11 has a much greater increase in potency in comparison to the control tetrapepti de at both receptors.

PAGE 204

204 Tetrapeptide TPI1981 9 that has two Tic residues at the end of the peptide both caused a great decrease in potency at both receptors. The repeat occurrence of this amino acid within the peptides is detrimental to exhibiting normal ac tivity. The extra bulkiness that Tic is adding to the sequence may be hindering the precise binding in the proposed binding pockets. The last peptide in this set, TPI1981 12 has Arg Tic as the final two residues in the peptide and this sequence shows to be unfavorable at both receptors leading to decreased agonist potency as shown in Table 5 13. The final set of peptides in this first library, TPI1981 13 through 18, employs Arg (pI)DPhe at the first two positions and interchanges Tic/Arg at the third posit ion and (pNO 2 )DPhe/ (pI)Phe/Tic at the final position. Two potent peptides, TPI1981 13 and 17 were discovered in this set for both receptors, following suit like above, they contain at the final two residues either Tic (pNO 2 ) (TPI1981 7 and 13) or Arg (pI) Phe (TPI1981 11 and 17). The same trend was observed with the use of these dipeptides, regardless of the residue at position one (His or Arg). Previous data did indicate that the presence of the imidazole ring of His does not play a large role in the forma tion of ligand receptor interactions; however, an amino acid is needed at that position for receptor selectivity. This trend was observed with the placement of Tic at position 1; however, it did not produce as potent agonist activities as seen with His or Arg. Therefore, it is hypothesized that a basic residue is necessary at the first position to result in agonist potency. There is a larger decrease in potency with the use of Arg at the first position and having the dipeptide, Tic (pI)Phe, unlike what was observed earlier for TPI1981 8, which has His at the first position. A similar trend was iden tified with the use of Arg

PAGE 205

205 (pNO 2 )DPhe as the final two amino acids within the sequence, and regardless of the amino acid found in position one, His (TPI1981 10) o r Arg(TPI1981 16). These two peptides exhibited comparable agonist activitie s to one another; however, not as potent as the control peptides. A dipeptide of Tic residues at the end of the tetrapeptide sequence, as in TPI1981 15, resulted in micromolar agon ist activity at both receptors, once again supporting the hypothesis that Tic is obstructing proper binding. The occurrence of two Arg residues within the sequence resulted in a peptides that exhibited increased agonist activity than the use of two or mor e Tic residues as observed earlier, except in TPI1981 18 which contains an Arg Tic. Throughout the library, it was shown that the neighboring of Tic Arg or Arg Tic does not afford a peptide with potent agonist activity at either receptor. The extra ring th at Tic contains may be hindering the flexibility and interaction that is usually present when Arg is next to a hydrophobic residue, such as Phe or Trp. The tetrapeptides TPI1981 1, 2 and 3 Non Acetylated (NA) have the same sequence as TPI1981 1, 2, and 3 except they lack having the N terminus acetylated. This group has been shown to be important for the molecular recognition and receptor stimulation. 106 However, in following the trend observed earlier that the placement of the dipeptide Tic (pNO 2 )DPhe at the end of the peptide are potent agonists. Comparable activities were observed for TPI9181 2 NA and TPI1981 2 at the hMC4R (EC 50 = 99.315.8, 11432.0, respectively) TPI1981 2 and 3 NA were not active at the L106P hMC4R, the addition of the acetylated group (1981 2 and 3) did not show much improvement to agonist activity.

PAGE 206

206 The negative control pep tides correspond to the peptide with the same number, except, all incorpo rate DPhe (F 5) ( Figure 5 17 ) at position 2 instead of (pI)DPhe and all peptides that contained a (pI)Phe at position 4 now have Phe (F 5). At both receptors, most of the negative con trol peptides exhibited some or absence of activi ty. Four peptides stood out as having interesting results that were not expected due to the incorporation of the highly fluorinated substituents. The peptide TPI1981 7 exhibited subnanomolar potency at the h MC4R, while there was a 53 fold decrease with the 1981 7 negative control peptide. Tetrapeptide TPI1981 7 at the L106P receptor displayed a 88 fold decrease in agonist activity compared to the WT receptor. There was a detrimental loss at the L106P with the incorporation of DPhe (F 5) at position 2 and (pI)Phe at position 4 in the negative control peptide. Similar trends were observed with TPI1981 8 and negative control. The two peptides were both more potent at the hMC4R than at the L106P receptor, and ther e was a great difference in potency in comparison. The peptide TPI1981 13 was a subnanomolar potent agonist at the hMC4R, however there was only an 8 fold difference in potency at the L106P hMC4R. This peptide was the most potent at mutant receptor. It co ntains Tic (pNO 2 )DPhe dipeptide at positions 3 and 4, which has showed to be consistent in producing potent peptides as indicated in this study. The negative control of this peptide showed to be potent at both receptors as well. It still had the same dipe ptide at the end, therefore, the DPhe (F 5) substituent may not be having a strong influence on the binding of the peptide. Tetrapeptide TPI1981 14 and its negative control were comparable at both receptors,

PAGE 207

207 but there was selectivity between receptors. The re was nanomolar potency at the hMC4R, but there was micromolar at the L106P hMC4R. Pharmacological Results of TPI1981 Peptides at Mouse Melanocortin Receptors All of the TPI1981 peptides were pharmacologically characterized at the mMC1, 3 5 receptors to identify selectivity between isoforms and receptors, data can be found in Table 5 14. The peptide TPI1981 2 has the sequence of Ac Tic (pI)DPhe Tic (pI)Phe NH 2 and was shown to have some activity and devoid of activity at the mMC1R and mMC3R, respectively. It was more potent at the mouse MC4R than the human and exhibited nM potency at the mMC5R. All the receptors did not show to have agonist activity with the negative control of this sequence. Tetrapeptides TPI1981 4 and 5 had sequences that were constant f or the first three positions and varied in the last one, Ac Tic (pI)DPhe Arg X NH 2 where X= ( pNO 2 )DPhe (4) or (pI)Phe (5). The (pNO 2 )DPhe containing peptide was more potent than the other at the mMC1R, however, this trend was opposite at the mMC4R and mM C5R with the (pI)Phe peptide (5) being more potent. Both of these peptides were devoid of activity at the mMC3R. These two peptides elicited antagonistic responses when tested at the mMC3R. Table 5 15 displays the pA 2 values obtained for these peptides whe n tested as antagonists competitively displacing the agonist MTII. However, they exhibited antagonist values that were comparable to the control peptide (EMH4 105, Ac His (pI)DPhe Arg Trp NH 2 ), which has shown in previous studies to have mixed pharmacology at the mMC3R. 88,92 The negative controls of both peptides poorly stimulated all the receptors, except for TPI1981 4 at the mMC4R providing an EC 50 =459. The peptide TPI1981 7, once again, is one of the most potent peptides at the receptors, all mouse receptor exhibited nM agonist activity with this peptide. The negative control of this peptide was also potent at

PAGE 208

208 the mMC1R, mMC4R, and mMC5R, and with micromolar agonist activity at the mMC3R. All receptors exhibited d ecreased agonist activities with the use of the TPI1981 7 negative control in comparison to TPI1981 7. Tetrapeptides TPI1981 8 12 exhibited nM potency at all of the mouse receptors, with no selectivity between receptors. There was sub nM potency at the mMC 4R and mMC5R with TPI1981 11 that incorporates the dipeptide Arg (pI ) Phe which also was shown earlier to produce potent results. In addition, TPI1981 13 was potent at these receptors as well, like the observation with the WT and polymorphic hMC4R This p eptide contains Tic (pNO 2 ) as the final two residues, which resulted in a trend where the use of this dipeptide produced potent outcomes. Its negative control produced decreased agonist activities; however, they were more potent than some of the other pept ides in the library. The rest of the peptides 14 18 exhibited micromolar potency at the mMC3R, where the rest of the receptors demonstrating potent, comparable EC 50 values. The tetrapeptides TPI1981 1, 2 and 3 Non Acetylated (NA) have the same sequence as TPI1981 1, 2, and 3 except they lack having the N terminus acetylated. The peptide TPI1981 1 could not be synthesized; therefore, there is no pharmacological data for it. The non acetylated peptide TPI1981 1 NA produced nM results at the mMC4R and mMC5R; t his is following the trend that the use of dipeptide Tic (pNO 2 ) DPhe at the end of the peptide results in potent agonists. There were decreases in activities for TPI9181 2NA and TPI1981 2 at the mMC4R and mMC5R. Discussion The study presented herein discus ses the use of screening combinatorial chemistry libraries to identify potent amino acids to form a tetrapeptide sequence that will produce potent results at a polymorphic receptor, L106P that was previously shown

PAGE 209

209 to exhibit reduced agonist activities 26,117 The inability to respond normally to endogenous ligands may be a cause in the genetic development of an obese phenotype. 117,121,122,155 Tetrapeptides were chosen as the length because it is hypothesized that the presence of Pro rather than Leu is distorting the postulated binding pocket, in which, this residue may be located within. The conformat ional change due to the mutation may only be able have room for a smaller compact peptide for normal binding and stimulation. Validation of the screen ing process was determined orted to 122 Repetitive cycles of screening, synthesis of hits, and pharmacological characterization actually led to the identification of peptides that resulted in potent agonist activities at the polymorphic receptor, L106P hMC4R. It was proposed that multiple substitutions within the tetrapeptide sequence were critical in finding ligands that target this polymorphic receptor. The latest library involved substitutions at all four positions with the following amino acids: R1) Tic, His, Arg; R2) (pI)DPhe; R3) Tic, Arg; R4) (pNO 2 )DPhe, (pI)Phe, and Tic. Five peptides were shown to have potent agonist activity at the receptors ex amined in this study (Table 5 16 ) Ac X (pI)DPhe Arg Trp NH 2 ( TPI1981 7 and 13 ) TPI1981 7 and 13 were fo und to be the most potent peptides in the new library of tetrapeptides and increased agonist activity in comparison to the control tetrapeptide. Their negative controls showed to be more potent than even others in the library, but only at the WT The only change with these sequences is the substitution of DPhe (F 5) as opposed to (pI)DPhe. There was a 53 fold and 30 fold decrease in potency with TPI1981 7 and 13 negative controls, respectively, at the hMC4R. There was a

PAGE 210

210 significant decrease in potency at th e L106P hMC4R, proposing that the DPhe (F 5) has a detrimental effect on the overall binding and stimulation of this mutant receptor. Dose response curves of TPI1981 7 and 13 at the WT and L106P hMC4R can be seen in Figure 5 1 8 and Figure 5 1 9 These two peptides have similar sequences, Ac X (pI)DPhe Tic (pNO 2 )DPhe NH 2 with variance at position 1, where X=His (7) or Arg (13). The single substituted peptides with either His (control, EMH4 90) or Arg ( EMH4 91) at the first position showed to exhibit compara ble agonist activities at both the WT and L106P. Tic was also used for the first position; however, TPI1981 1 could not be synthesized. Therefore, t he peptide with Tic at the first position can be compared only in the non acetylated analogue TPI1981 1 non acetylated ; it did produce nM agonist a ctivities at the hMC4R, with a decrease in potency at the L106P. However, the lack of the Ac group may have an effect on ligand binding. There were decreases in agonist activity when Tic was used in the positional sc an of the melanocortin tetrapeptide (EMH4 99), and there was a drastic decrease in potency when DTic was used (EMH4 100). The introduction of the (pI)DPhe amino acid had promise in leading to a potent peptide at the L106P, there was an increase in activity Therefore, the use of these substitutions (X1=His, Arg, or Tic) and the a ddition of the dipeptide Tic (pNO 2 ) DPhe results in an increase in act ivity. It is proposed that the dipeptide sequence at positions three and four aid in binding and stimulating the mutant receptor. Similar EC 50 values were observed for these two peptides (7 and 13) at all receptors, human, mutant, and mouse, thus the agonist pharmacology for these two ligands do not appear to be species specific (human vs. mouse). As seen previ ously, the replacement of (pI)DPhe for DPhe in the tetrapeptide sequence results in a potent

PAGE 211

211 agonist at the MC4R (human and mouse) and slightly decreased potent agonist at the 88,92 However, these peptides are more potent than the single substitutions of (pI)DPhe into the melanocortin tetrapeptide because of multiple substitutions. From modeling and SAR studies, it has been hypothesized that there is a hydrophil ic binding pocket in which Arg interacts with, and a hydrophobic binding pocket in which DPhe and Trp interacts with to result in agonist activity at the MC4R. 116,136 See Figure 4 4 for an illustration of the bindin g pocket. From the analysis of these two peptides that result in sub nM potency at the mouse and human MC4R, there may be a shift in receptor conformation due to ligand binding or alternate binding pocket that these ligands are participating within. This is proposed because at the Arg position 3, there is a bulky, conformational restrained Tic residue. A distorted binding pocket has already been hypothesized to be formed with the L106P receptor due to the Pro residue. This may cause a rearrangement of EC l oop 1 connecting TM2 and TM3, the proposed ligand binding region of the receptor. Proline has been identified as a helix breaker, inducing a slight bend or kink within the helix structure as seen in Figure 5 6 This new conformation may be forming a new bi nding pocket, in which compact ligands are more conducive to fit within as opposed to longer peptides. In compariso n to the sequences of TPI1981 8, 9, 14, and 15, the dipeptide of Tic (pNO 2 )DPhe produces the most potent agonists in the library as opposed to Tic Tic or Tic (pI)DPhe. Dramatic decreases in potencies were observed when the final position was changed to either Tic or (pI)Phe, regardless if a His or Arg was in position 1 and especially the placement of Tic at the first position. It is hypothesiz ed that the use of a

PAGE 212

212 His or Arg at the first position does not have an effect on the potency. A new interaction of ligand receptor may be occurring due to this new sequence. The polar nitro group acts as an electron withdrawing, when used in the para posit ion on the phenyl ring and may be a hydrogen bond acceptor when ligand receptor complexes are formed, while Tic may be interacting in a network of hydrophobic residues or conformationally restricting the flexibility of the peptide, perhaps facilitating bin ding and activation. Ac X (pI)DPhe Arg (pI)DPhe NH 2 ( TPI1981 5, 11, and 17 ) TPI1981 5, 11, and 17 are the other peptide set that produced dramatically increased agonist activities at the receptors, the polymorphic receptor especially. Dose response curves can be seen in Figure 5 20 These three peptides have similar sequences, Ac X (pI)DPhe Arg (pI)DPhe NH 2 with variance at position 1, where X=Tic (5), His (11) or Arg (17). Similar trends are observed with this set as with the one above, TPI1981 7 and 13 and with the use of Tic in the first positio n, results in a potent peptide; however, there is a drastic increase in agonist activity when His or Arg are utilized instead. The hMC4R exhibits sub nM activity with TPI1981 11 and 17, and L106P hMC4R results in a 76 fold and 61 fold increase with TPI1981 11 and 17, respectively, compared to the control tetrapeptide (EC 50 =22187.1 nM). These peptides are somewhat more analogous to the control tetrapeptide than TPI1981 7 and 13, by incorporating His/Arg at the f irst position, (pI)DPhe as the second residue, and the dipeptide, Arg (pI)Phe to fill up positions 3 and 4. It is hypothesized that these peptides are having a stronger interaction with the proposed binding pockets within the receptor that is allowing the peptides to be more potent than the control tetrapeptide. Although it is hypothesized that the mutation Leu to Pro results in a distorted binding region, the additional moieties present may facilitate the binding to this receptor. The peptide

PAGE 213

213 EMH4 105 just integrates the (pI)DPhe at the second position leads to comparable agonist activity with the control peptide at this mutant receptor. Halogens are exploited in peptide sequences to form ligand receptor interactions due to their electron withdrawing abili ties. 240 Iodine is the largest halogen and with an increase in size, there is an increase in lipophilicity. Therefore, due to its strong affinity for lipids, binding to GPCRs may be assisted through the use of halogenated residues. However, iodine is not found often in drug design because of a weak carbon iodide bond and the presence of increased population iodide ions may lead to adverse side effects within the body, especially at the thyroid gland. 218,241,242 Receptor Selectivity The peptides synthesized herein do not show to be species specific at the MC4R (human vs. mouse). Th e peptides were highly potent at the MC4R in comparison to the rest of the receptors. The extremely potent agonists, TPI1981 7, 11, 13, and 17 were observed to exhibit comparable EC 50 values among the mMC1R, mMC4R, hMC4R, and mMC5R. Therefore, these peptid es may be binding in a similar manner at all of these receptors. Most of the peptides did not stimulate the mMC3R, and those that did were not as potent when compared to all the other receptors. Previous studies indicate that the inclusion of (pI)DPhe res ults in an antagonist at the mMC3R, therefore, the lack of agonist activity of these peptides at this receptor may be due to that they are acting as antagonists. 88,92 Two tetrapeptides displayed antagontic activity, TPI1981 4 and TPI1981 5 at the mMC3R. At this time, we are performing further assays to test selected peptides as antagonists at the mMC3R. Little information is known about the physiological role of the MC3R; knock out mice possessed normal body weight w ith

PAGE 214

214 increased fat mass and decreased lean body mass. 9 There is a lack of ligands that are selective for the MC3R over the MC4R subtype. Unfortunately, this study did not result in a selective MC3R ligand. This study utilized the tetrape ptide template incorporating different amino acids at each position to identify potent peptides firstly at the L106P hMC4R. In addition, ligands were found to potently activate the hMC4R and mMCRs. Substituents employed varied in size, lipophilicity, and e lectronic effects to investigate potency, SAR trends, and receptor selectivity. Ligands were not identified to specifically correct for the single hMC4R polymorphism. It would be favorable to discover a ligand that functionally restores the activity of a p olymorphism that does not respond normally to the endogenous ligands that has a greater affinity for the mutation over the WT hMC4R. The specific targeting of the polymorphism will ensure that the addition of the new ligand would not distort the overall ho meostatic balance. Upsetting the physiological balance of food intake and energy homeostasis may occur if a ligand is not specific for restoring the mutation. It would be ideal to find a ligand that targets the polymorphism by acting like one of the endoge nous agonists while not disrupting the synthesis and role of the WT hMC4R protein. Conclusion Natural mutations associated with diseases are remarkable from a clinical standpoint as they provide insights into the mechanism of pathogenicity and possible av enues for the development of therapeutic tools. In addition, they provide ground level knowledge for fundamental studies. The study of mutant receptors is a powerful tool and allows researchers to start deciphering complex ligand receptor interactions by i dentifying the key actors in the molecular machinery. Development of laboratory tools

PAGE 215

215 aimed at understanding specific processes can also be acquired through the use of receptor mutagenesis. The general principles that are obtained can be further applied to other genes in which rare mutations will be found to predispose to humans to obesity. The focus of this study was two fold: 1) Ide ntify peptides that can rescue the dysfunctional polymorphic L106P hMC4R and 2) Validate the concept of using a combinatoria l chemistry to find lead compound s. In collaboration with the Torrey Pines Institute both aspects of the research were fulfilled in this study with the identification of TPI1981 7, 11, 13 and 17 (Table 5 1 6 ) resulting in nM potency at the L106P hMC4R F igure 5 2 1 displays a flowchart of the route taken to find potent peptides. Future Directions The last screening process led to the identification of 36 tetrapeptides; however, in this study only half were synthesized and characterized at the melanocortin receptors. Therefore, it might be advantageous to synthesize the other 18 tetrapeptides (and negative controls) to perhaps further identify potent peptides. These peptides incorporate (pCl)DPhe at the second position, and it was shown that the single subs titution of this amino acid in the melanocortin tetrapeptide (EMH4 104) led to potent peptides at all the receptors (hMC4R, L106P hMC4R, mMC1R, mMC3 5R). There is a 6 fold increase in potency with the use of (pCl)DPhe over (pI)DPhe. Homology molecular mode ling should be performed to look into the effect that Pro is causing within the structure of receptor and to explore the new ligand receptor interactions that were identified within this study. In addition, it may be beneficial to test these new tetrapepti des at other mutant receptors that were shown to have a reduced agonist tone, this will help in determining how these new ligands are binding. Finally, the techniques performed in this study may be applied to design libraries for other hMC4R

PAGE 216

216 polymorphisms and delve into finding the mechanism of action to which the mutant receptor is acting upon. Experimental Details Peptide synthesis of peptides EMH4 90 to EMH4 110 can be found in Chapter 2. The combinatorial chemistry plates were prov ided by Torrey Pines Institute. 143,231 The TPI combinatorial chemistry plates had mixtures within each well of a 96 well plate as shown in the map key (Figure 5 16 galactosida se reporter gene assay. 133 The stock plates had a concentration of 2 m g/mL and were diluted to 100, OD 405 was measured using a 96 well plate reader at several time points (Molecular Devices). Data points were normalized both to the relative protein content and non receptor dependent forskolin va lues. Assays were performed using duplicate data points. Mixture wells that elicited an absorbance value of 0.70 and greater at the Mini Mixture Experimental Mini mixture protocol was based on previous studies. 237 239 Mixture #1 (EMH7 11) was generated in this study (Table 5 6). Starting from 0.20 mmol of Rink Amide MBHA Resin, the peptide chain was assembled according to standard SPPS procedure with s ome modification. The peptide was made through the use of Discover SPS Microwave Peptide Synthesizer, following directions for synthesis with a microwave as described in Chapter 2. For the coupling at the mixture positions, a 3 molar excess of the coupling reagents, HBTU and DIEA, were used. A total combined 1.0mmol of Fmoc Xaa OH X4; Xaa: Tic (0.50mmol, Lys (0.50mmol) for X3] was used with molar ratios adjusted to

PAGE 217

217 compensate for the reactivity difference of the amino acids according to previous studies. 237 239 Since the amino acids used in this mixture have similar reactivities; it was proposed that an even distribution was appropriate After each coupling reaction, a ninhydrin test was performed to monitor the coupling reaction. After the last AA mixture was coupled and final deprotection was completed, the peptide was acetylated using a cocktail consisting of 3:1 mixture of acetic anh ydride and pyridine. Cleavage from the resin and analysis of the final product was conducted using the procedure described above for the synthesis of the single substituted library. P harmacological Characterization Preliminary screening was conducted usin g crude peptide in a dose response manner. The stock peptide (1 mL) was diluted to conce ntrations as listed in Table 5 9 galactosidase reporter gene assay. 133 The sample absorbance, OD 405 was measured using a 96 well plate reader at several time points (Molecular Devices). Data po ints were normalized both to the relative protein content and non receptor dependent forskolin values. Assays were performed using duplicate data points. Mixture wells that elicited an absorbance value of 0.70 and greater during the deconvolution process

PAGE 218

218 Figure 5 1. Schematic representation of the functional consequences of mutations that may occur within GPCR. EC: Extracellular; IC: Intracellular; ER: E ndoplasmic Reticulum Table 5 1. Summary of the endogenous agonists and tetrapeptides potencies at the WT and L106P hMC4R 117,122 EC 50 (nM) Peptide WT hMC4R L106P hMC4R MSH 0.65 0.19 50% at 1 M MSH 0.42 0.076 356 53 2 MSH 73 23 2660 370 ACTH(1 24) 0.65 0.15 40% at 1 M MT II 0.017 0.007 0.92 0.1 NDP MSH 0.030 0.0096 0.42 0.076 JRH887 9 0.93 0.31 91 15 JRH322 18 1.25 0.25 52.6 10.7 Antagonist (pA 2 ) hAGRP(87 132) 8.28 0.11 8.27 0.12

PAGE 219

219 Figure 5 2. Structures of THIQ, a potent, selective MC4R agonist 243

PAGE 220

220 Figure 5 3 Structures of the two tetrapeptides that were identified to exhibit nM full agonist potency at L106P hMC4R. 122

PAGE 221

221 Figure 5 4 Comparison of Leucine and Proline Figure 5 5 Peptide dihedral angles defining secondary structures and backbone conformation. T N bond of amino acids

PAGE 222

222 Figure 5 6 Proline depicted as helix breaker. Proline is the only amino acid that does not have a hydroge n atom to donate to form a bond, therefore, disrupting the hydrophobic network. It will actually induce a slight bend within the structure due to the lack of hydrogen bonding Mutate residue to Pro Kinking of the TM helix resulting from backbone rotational restrictions imposed by the Pro

PAGE 223

223 Figure 5 7 Schematic view of combinatorial chemistry. Multiple reactions are performed in one vessel to create all possible synthetic products. Figure 5 8 Identification of lead compounds through repetitive synthesis and deconvolution

PAGE 224

224 Table 5 2. List of AAs incorpo rated to make 216,000 peptides in the preliminary screening process Amino Acids Ala DAla Nle Asp DAsp DNle Glu DGlu Cha Phe DPhe DCha His DHis PyrAla Ile DIle DPyrAla Lys DLys ThiAla Leu DLeu Tic Met DMet DTic Asn DAsn (pCl)Phe Pro DPro (pCl)D Phe Gln DGln (pI)Phe Arg DArg (pI)DPhe Ser DSer (pNO 2 )Phe Thr DThr (pNO 2 ) D Phe Val DVal Nal Trp DTrp DNal Tyr DTyr Ala Met[O 2 ] Dehyd Pro Aminocaproic Acid Gly (3I)Tyr

PAGE 225

225 Figure 5 9 Samples of combinatorial chemistry library plates screened at the L106P hMC4R. All plates tested basal, forskolin and NDP MSH as controls center NDP MSH 10 6 10 12 M Controls

PAGE 226

226 Figure 5 10 Schematic representation of screening/deconvolution/identification of hits/synthesis/characterization process. Screening for Hits Mixture based Positional Scanning Approach Pharmacological Screening of 216,000 Peptides Ac X 1 X 2 X 3 X 4 NH 2 Synthes is of Individual Peptides in a Positional Scanning Approach Identification of Hits Pharmacological Characteriz ation of new tetrapeptide library

PAGE 227

227 Table 5 3. Selected AAs at defined positions that resulted from combinatorial chemistry library screening. Ac His DPhe Arg Trp NH 2 Arg Arg Lys Tic Trp (pCl)DPhe Tic (pCl)Phe Tyr (pI)DPhe (pCl)DPhe DArg (pI)DPhe Tic (pNO 2 )DPhe DTic Nal (pCl)DPhe (pI)DPhe (3I)Tyr

PAGE 228

228 Table 5 4. Peptides that were synthesized using substitutions based on combinatorial chemistry screening. Name Sequence Formula m/z (M, calc) m/z (M+1 expt) Solvent System 1 Solvent System 2 EMH4 90 Ac His DPhe Arg Trp NH 2 C 34 H 43 N 11 O 5 685.78 686.61 3.59 6.23 EMH4 91 Ac Arg DPhe Arg Trp NH 2 C 34 H 48 N 12 O 5 704.82 705.22 3.70 6.62 EMH4 92 Ac Trp DPhe Arg Trp NH 2 C 39 H 46 N 10 O 5 734.85 735.38 6.42 10.50 EMH4 93 Ac Tyr DPhe Arg Trp NH 2 C 37 H 45 N 9 O 6 711.81 712.42 5.24 8.98 EMH4 94 Ac DArg DPhe Arg Trp NH 2 C 34 H 48 N 12 O 5 704.82 705.53 3.83 6.51 EMH4 99 Ac Tic DPhe Arg Trp NH 2 C 38 H 45 N 9 O 5 707.82 708.47 6.60 10.41 EMH4 100 Ac DTic DPhe Arg Trp NH 2 C 38 H 45 N 9 O 5 707.82 708.42 6.64 10.42 EMH4 101 Ac (pCl)DPhe DPhe Arg Trp NH 2 C 37 H 44 ClN 9 O 5 7 30.26 731.44 6.93 10.95 EMH4 102 Ac (pI)DPhe DPhe Arg Trp NH 2 C 37 H 44 IN 9 O 5 821.71 822.43 7.33 11.43 EMH4 103 Ac (3I)Tyr DPhe Arg Trp NH 2 C 37 H 44 IN 9 O 6 837.71 838.47 7.17 11.19 EMH4 95 Ac His Arg Arg Trp NH 2 C 31 H 46 N 14 O 5 694.79 695.73 2.26 5.03 EMH4 104 Ac His (pCl)DPhe Arg Trp NH 2 C 34 H 42 ClN 11 O 5 720.22 720.52 4.29 7.39 EMH4 105 Ac His (pI)DPhe Arg Trp NH 2 C 34 H 42 IN 11 O 5 811.67 812.49 4.68 8.05 EMH4 96 Ac His DPhe Lys Trp NH 2 C 34 H 43 N 9 O 5 657.76 658.67 3.55 5.02 EMH4 106 Ac His DPhe Tic Trp NH 2 C 38 H 39 N 7 O 6 688. 31 711.46 (+23.15) 6.78 10.55 EMH4 107 Ac His DPhe Arg Tic NH 2 C 33 H 42 N 10 O 5 658.75 659.44 3.80 6.65 EMH4 97 Ac His DPhe Arg (pCl)Phe NH 2 C 32 H 41 ClN 10 O 5 681.18 681.46 4.26 7.61 EMH4 98 Ac His DPhe Arg (pCl)DPhe NH 2 C 32 H 41 ClN 10 O 5 681.18 681.45 6.22 7.22 EM H4 108 Ac His DPhe Arg (pI)Phe NH 2 C 32 H 41 IN 10 O 5 772.64 773.20 4.61 8.28 EMH4 109 Ac His DPhe Arg (pNO 2 )DPhe NH 2 C 32 H 41 N 11 O 7 691.74 692.14 3.46 11.46 EMH4 110 Ac His DPhe Arg Nal NH 2 C 36 H 44 N 10 O 5 696.80 697.33 4.46 8.07 solvent retention time)/ (solvent reten tion time)] in solvent system 1 [ 10% acetonitrile in 0.1% trifluoroacetic acid/water and agradient to 90% acetonitrile (ACN) ov er 35 min] or solvent system 2 [ 10% methanol (MeOH) in 0.1% trifluoroacetic acid/water a nd a gradient to 90% methanol over 35 min] An analytical Vydac C18 column (Vydac 218TP104) was used with a flow rate of 1.5 ml/min. The peptide purity was determined by HPLC at a wavelength of 214 nm.

PAGE 229

229 Figure 5 1 1 St ructures of the AA s identified to substitute within the Ac His DPhe Arg Trp NH 2

PAGE 230

230 Table 5 5. Summary of the pharmacological activity of single substituted library at the hMC4R and L106P Name Sequence hMC4R EC 50 (nM) L106P hMC4R EC 50 (nM) NDP MSH Ac Ser Tyr Ser Nle Asp His DPhe Arg Trp Gly Lys Pro Val NH 2 0.0220.003 0.560.04 EMH4 90 Ac His DPhe Arg Trp NH 2 2.61.6 21583 EMH4 91 Ac Arg DPhe Arg Trp NH 2 1.060.24 12428 EMH4 92 Ac Trp DPhe Arg Trp NH 2 32.17.9 170114 EMH4 93 Ac Tyr DP he Arg Trp NH 2 6.22.0 540195 EMH4 94 Ac DArg DPhe Arg Trp NH 2 405.1 1242 360 EMH4 99 Ac Tic DPhe Arg Trp NH 2 15.07.1 49401980 EMH4 10 0 Ac DTic DPhe Arg Trp NH 2 297 59 17920 1150 EMH4 101 Ac (pCl)DPhe DPhe Arg Trp NH 2 48.04.1 4440830 EMH4 102 Ac (pI)DPhe DPhe Arg Trp NH 2 76.535 4910 2630 EMH4 103 Ac (3I)Tyr DPhe Arg Trp NH 2 1.90.40 437.4 EMH4 95 Ac His Arg Arg Trp NH 2 75.219 4940770 EMH4 104 Ac His (pCl)DPhe Arg Trp NH 2 0.280.04 4816 EMH4 105 Ac His (pI)DPhe Arg Trp NH 2 1.30.47 97 48 EMH4 96 Ac His DPhe Lys Trp NH 2 40.416 6240506 EMH4 106 Ac His DPhe Tic Trp NH 2 20473 188005170 EMH4 107 Ac His DPhe Arg Tic NH 2 EMH4 97 Ac His DPhe Arg (pCl)Phe NH 2 17.04. 7 2096695 EMH4 98 Ac His DPhe Arg (pCl)DPhe NH 2 46.726 82304810 EMH4 108 Ac His DPhe Arg (pI)Phe NH 2 5.31.3 680150 EMH4 109 Ac His DPhe Arg (pNO 2 )DPhe NH 2 19520 23000 9400 EMH4 110 Ac His DPhe Arg Nal NH 2 28 0.95 42801120 Errors are the standard of the mean from at least three dif ferent independent experiments.

PAGE 231

231 Table 5 6. Summary of the pharmacological activity of single substituted library at the mouse receptors. Name Sequence mMC1R EC 50 (nM) mMC3R EC 50 (nM) mMC4R EC 50 (nM) mMC5R EC 50 (nM) NDP MSH Ac SYS Nle EH DPhe RWGKPV NH 2 0.0300.001 0.140.02 0.200.03 0.260.05 EMH4 90 Ac His DPhe Arg Trp NH 2 611122 672315 18.415 11094 EMH4 91 Ac Arg DPhe Arg Trp NH 2 7870 7760 705522 2.60.64 123114 EMH4 92 Ac Trp DPhe Arg Trp NH 2 55004100 14842 850350 EMH4 93 Ac Tyr DPhe Arg Trp NH 2 5232 210110 EMH4 94 Ac DArg DPhe Arg Trp NH 2 29802060 10544 61193 EMH4 99 Ac Tic DPhe Ar g Trp NH 2 115005210 2185899 42.96.8 560510 EMH4 100 Ac DTic DPhe Arg Trp NH 2 122001650 >10,000 2230 0708 140706525 EMH4 101 Ac (pCl)DPhe DPhe Arg Trp NH 2 195004480 >10,000 265225 29502575 EMH4 102 Ac (pI)DPhe DPhe Arg Trp NH 2 79702580 >10,000 24020 1440490 EMH4 103 Ac (3I)Tyr DPhe Arg Trp NH 2 1020240 >10,000 10.13.4 60.628.2 EMH4 95 Ac His Arg Arg Trp NH 2 21201540 26902090 36088 1060255 EMH4 104 Ac His (pCl)DPhe Arg Trp NH 2 14400 (n=1) 56.3 PA (n=2) 1.070.78 1.65 (n=2) EMH4 105 A c His (pI)DPhe Arg Trp NH 2 2470 (n=2) 227145 7.34.6 3.79 (n=2) EMH4 96 Ac His DPhe Lys Trp NH 2 87004910 103006900 17056 695582 EMH4 106 Ac His DPhe Tic Trp NH 2 1510 (n=1) 150008700 36515 6195 (n=2) EMH4 107 Ac His DPhe Arg Tic NH 2 1290510 36450 37000 1370 470 2140460 EMH4 97 Ac His DPhe Arg (pCl)Phe NH 2 35802780 11412.0 88.634 EMH4 98 Ac His DPhe Arg (pCl)DPhe NH 2 2035 (n=2) 455 (n=1) 18193.7 114 (n=2) EMH4 108 Ac His DPhe Arg (pI)Phe NH 2 760340 1700870 20.811 21.1 (n=2) EMH4 109 Ac His DPhe Arg (pNO 2 )DPhe NH 2 1930410 1705015200 3 3080 680445 EMH4 110 Ac His DPhe Arg Nal NH 2 3930226 11050 774.8 Errors are the standard of the mean from at least three different independent experiments. >10,000 indicate that no agonist melanocortin receptor pharmacology was obse rved at the highest concentrations examined.

PAGE 232

232 Figure 5 1 2 Dose response curves of control tetrapeptide (EMH4 90) and (3I) Tyr substituted peptide (EMH4 103) at WT hMC4R and L106P hMC4R Figure 5 1 3 Dose response curves of (pCl)DPhe substituted peptide (EMH4 104) and (pI)DPhe substituted peptide (EMH4 105) at WT hMC4R and L106P hMC4R Figure 5 1 4. Basic pe ptide chain schematic shown incorporating mixtures at different positions Trp Arg (pCl)DPhe (pI)DPhe Lys Tic Tic (pCl)Phe (pCl)DPhe (pI)DPhe (pNO2)DPhe Nal

PAGE 233

233 Table 5 7. An example of the peptides that will be generated from mini mixture library split into six separate mixtures Name Sequence m/z (M, calc) EMH4 90 Ac His DPhe Arg Trp NH 2 685.78 EMH4 92 Ac Trp DPhe Arg Trp NH 2 734.37 Mixture 1 EMH7 11 1 Ac Trp Arg Lys Tic NH 2 688.38 2 Ac Trp Arg Lys (pCl)Phe NH 2 710.34 3 Ac Trp Arg Tic (pCl)Phe NH 2 741.32 4 Ac Trp Arg Lys (pI)DPhe NH 2 802.28 5 Ac Trp Ar g Lys NH 2 726.4 6 Ac Trp Arg Tic NH 2 757.37 2 7 Ac Trp Arg Tic Tic NH 2 718.36 8 Ac Trp Arg Tic (pCl)DPhe NH 2 741.34 9 Ac Trp Arg Lys (pCl)DPhe NH 2 710.34 10 Ac Trp Arg Tic (pI)Phe NH 2 833.25 11 Ac Trp Arg Tic (pNO 2 )DPhe NH 2 752.34 12 Ac Trp Arg Lys (pNO 2 )Phe NH 2 721.37 3 13 Ac Trp (pCl)DPhe Lys Tic NH 2 713.31 14 Ac Trp (pCl)DPhe Lys (pCl)Phe NH 2 735.27 15 Ac Trp (pCl)DPhe Tic (pCl)Phe NH 2 747.28 16 Ac Trp (pCl)DPhe Lys (pI)DPhe NH 2 827.21 17 Ac Trp (pCl)DPhe Lys NH 2 751.33 18 Ac Trp (pCl)DPhe Tic NH 2 763.34 4 19 Ac Trp (pCl)DPhe Tic Tic NH 2 709.32 20 Ac Trp (pCl)DPhe Lys (pCl)DPhe NH 2 735.27 21 Ac Trp (pCl)DPhe Tic (pCl)DPhe NH 2 747.28 22 Ac Trp ( pCl)DPhe Tic (pI)DPhe NH 2 839.22 23 Ac Trp (pCl)DPhe Tic (pNO 2 )DPhe NH 2 758.31 24 Ac Trp (pCl)DPhe Lys (pNO 2 )DPhe NH 2 746.30 5 25 Ac Trp (pI)DPhe Lys Tic NH 2 805.25 26 Ac Trp (pI)DPhe Lys (pCl)Phe NH 2 827.21 27 Ac Trp (pI)DPhe Tic (pCl)Phe NH 2 858.18 28 Ac Trp (pI)DPhe Lys (pI)DPhe NH 2 919.14 29 Ac Trp (pI)DPhe Tic NH 2 874.24 30 Ac Trp (pI)DPhe Lys NH 2 844.25 6 31 Ac Trp (pI)DPhe Tic Tic NH 2 836.22 32 Ac Trp (pI)DPhe Lys (pCl)DPhe NH 2 827.21 33 Ac Trp (pI)DPhe Tic (pCl)DPhe NH 2 828.20 34 Ac Trp (pI)DPhe Tic (pI)DPhe NH 2 950.12 35 Ac Trp (pI)DPhe Tic (pNO 2 )DPhe NH 2 869.66 36 Ac Trp (pI)DPhe Lys (pNO 2 )DPhe NH 2 838.23

PAGE 234

234 Table 5 8. Ami no a cids that were incorporated at spe cific positions to make the mixture, EMH7 11 EMH7 11 Ac X 1 X 2 X 3 X 4 NH 2 Trp Arg Lys Tic Tic (pI)DPhe (pCl)DPhe Table 5 9. Amino acid sequences corresponding to the peaks observed in EMH7 11 HPLC analytical Sequence m/z (M, calc) m /z (M+1, expt) Peak 1 Ac Trp Arg Lys Tic NH 2 688.38 689.63 Peak 2 Ac Trp Arg Lys (pI)DPhe NH 2 802.28 803.83 Peak 3 Ac Trp Arg Lys NH 2 726.4 727.91 Peak 4 Ac Trp Arg Tic (pCl)Phe NH 2 741.32 742.96 Figure 5 1 5 HPLC analytical showing four peaks corresponding to four peptides within the mixture EMH7 11.

PAGE 235

235 Table 5 10 Absorbance values obtained from stimulation of EMH7 11 at WT hMC4R and L106P hMC4R L106P hMC4R Concentration of EMH7 11 Concent ration of EMH7 1.1574 0.4471 1.0728 0.1911 1.0047 0.1263 0.6047 0.1157 0.6733

PAGE 236

236 1 2 3 4 5 6 7 8 9 10 11 12 A Media 924.006 92 4.051 924.166 924.226 924.235 924.006 924.051 924.166 924.226 924.235 Media B Media 924.014 924.060 924.167 924.228 Media 924.014 924.060 924.167 924.228 NDP 10 12 M NDP 10 12 M C Media 924.018 924.074 924.168 924.229 Media 924.018 924.074 924.168 924.229 NDP 10 11 M NDP 10 11 M D Media 924.019 924.083 924.169 924.230 Media 924.019 924.083 924.169 924.230 NDP 10 10 M NDP 10 10 M E Forskolin 924.032 924.109 924.170 924.231 Forskolin 924.032 924.109 924.170 924.231 NDP 10 9 M NDP 10 9 M F Forskolin 924.046 924.1 11 924.171 924.232 Forskolin 924.046 924.111 924.171 924.232 NDP 10 8 M NDP 10 8 M G Forskolin 924.047 924.128 924.198 924.233 Forskolin 924.047 924.128 924.198 924.233 NDP 10 7 M NDP 10 7 M H Forskolin 924.049 924.134 924.221 924.234 Forskolin 924.049 924.1 34 924.221 924.234 NDP 10 6 M NDP 10 6 M Figure 5 1 6 Map key of TPI 924 combinatorial chemistry plate. Mixtures were found in wells with the 924 prefix Table 5 11. AAs at specific positions identified from screening CC library for peptides to target L10 6P hMC4R Position 1 Position 2 Position 3 Position 4 Peptide # AA EC 50 Peptide # AA EC 50 Peptide # AA EC 50 Peptide # AA EC 50 924.046 L Tic 1.209 924.109 D pClPhe 1.259 924.166 L Tic 1.226 924.233 1.354 D pNO 2 Phe 924.006 L His 1.060 924.111 D pIPhe 0.995 924.134 L Arg 1.067 924.230 0.881 L pIPhe 924.014 L Arg 1.034 924.226 0.853 L Tic

PAGE 237

237 Table 5 12. Tetrapeptides designed based on screening and deconvolution process of TPI 9 24 combinatorial che mistry plate Peptide # R1 R2 R3 R4 m/z (M+1, expt) 1981 1 Acetyl L Tic (pI)DPhe L Tic (pNO 2 )DPhe 842.68 1981 2 Acetyl L Tic (pI)DPhe L Tic (pI)Phe 923.58 1981 3 Acetyl L Tic (pI)DPhe L Tic L Tic 809.69 1981 4 Acetyl L Tic (pI)DPhe L Arg (pNO 2 )DPhe 839.68 1981 5 Acetyl L Tic (pI)DPhe L Arg (pI)Phe 920.58 1981 6 Acetyl L Tic (pI)DPhe L Arg L Tic 806.69 1981 7 Acetyl L His (pI)DPhe L Tic (pNO 2 )DPhe 820.63 1981 8 Acetyl L His (pI)DPhe L Tic (pI)Phe 903.55 1981 9 Acetyl L His (pI)DPhe L Tic L Tic 787.65 1981 10 Acetyl L His (pI)DPhe L Arg (pNO 2 )DPhe 817.63 1981 11 Acetyl L His (pI)DPhe L Arg (pI)Phe 898.53 1981 12 Acetyl L His (pI)DPhe L Arg L Tic 784.65 1981 13 Acetyl L Arg (pI)DPhe L Tic (pNO 2 )DPhe 839.68 1981 14 Acetyl L Arg (pI)DPhe L Ti c (pI)Phe 920.58 1981 15 Acetyl L Arg (pI)DPhe L Tic L Tic 806.69 1981 16 Acetyl L Arg (pI)DPhe L Arg (pNO 2 )DPhe 836.68 1981 17 Acetyl L Arg (pI)DPhe L Arg (pI)Phe 917.58 1981 18 Acetyl L Arg (pI)DPhe L Arg L Tic 803.69 1981 1 NonAc L Tic (p I)DPhe L Tic (pNO 2 )DPhe 801 1981 2 NonAc L Tic (pI)DPhe L Tic (pI)Phe 882 1981 3 NonAc L Tic (pI)DPhe L Tic L Tic 767 1981 1 negative control Acetyl L Tic D Phe (F 5) L Tic (pNO 2 )DPhe 806.73 1981 2 negative control Acetyl L Tic D Phe (F 5) L Tic L Phe (F 5) 851.69 1981 3 negative control Acetyl L Tic D Phe (F 5) L Tic L Tic 773.75 1981 4 negative control Acetyl L Tic D Phe (F 5) L Arg (pNO 2 )DPhe 789.71 1981 5 negative control Acetyl L Tic D Phe (F 5) L Arg L Phe (F 5) 848.69 1981 6 neg ative control Acetyl L Tic D Phe (F 5) L Arg L Tic 770.75 1981 7 negative control Acetyl L His D Phe (F 5) L Tic (pNO 2 )DPhe 784.69 1981 8 negative control Acetyl L His D Phe (F 5) L Tic L Phe (F 5) 831.66 1981 9 negative control Acetyl L His D Phe (F 5 ) L Tic L Tic 751.7 1981 10 negative control Acetyl L His D Phe (F 5) L Arg (pNO 2 )DPhe 781.69 1981 11 negative control Acetyl L His D Phe (F 5) L Arg L Phe (F 5) 826.64 1981 12 negative control Acetyl L His D Phe (F 5) L Arg L Tic 748.7 1981 13 negati ve control Acetyl L Arg D Phe (F 5) L Tic (pNO 2 )DPhe 803.74 1981 14 negative control Acetyl L Arg D Phe (F 5) L Tic L Phe (F 5) 848.69 1981 15 negative control Acetyl L Arg D Phe (F 5) L Tic L Tic 770.75 1981 16 negative control Acetyl L Arg D Phe (F 5 ) L Arg (pNO 2 )DPhe 800.74 1981 17 negative control Acetyl L Arg D Phe (F 5) L Arg L Phe (F 5) 845.69 1981 18 negative control Acetyl L Arg D Phe (F 5) L Arg L Tic 767.75

PAGE 238

238 Table 5 13. Summary of the pharmacological activity of TPI1981 peptides at hMC4R and L106P hMC4R. Peptide # Sequence hMC4R EC 50 (nM) L106P hMC4R EC 50 (nM) NDP MSH Ac SYS Nle EH DPhe RWGKPV NH 2 0.0420.012 0.670.072 VXF1 28 Ac His DPhe Arg Trp NH 2 0.500.081 22187.1 1981 2 Ac Tic (pI)DPhe Tic (pI)Phe NH 2 11432 1981 3 Ac Tic (pI)DPhe Tic Tic NH 2 1981 4 Ac Tic (pI)DPhe Arg (pNO 2 )DPhe NH 2 20.51.70 62569 1981 5 Ac Tic (pI)DPhe Arg (pI)Phe NH 2 4.420.93 43943 1981 6 Ac Tic (pI)DPhe Arg Tic NH 2 28130 2 76 0 1230 1981 7 A c His (pI)DPhe Tic (pNO 2 )DPhe NH 2 0.160.050 14.01.94 1981 8 Ac His (pI)DPhe Tic (pI)Phe NH 2 6.241.82 467118 1981 9 Ac His (pI)DPhe Tic Tic NH 2 31.04.95 3520 270 1981 10 Ac His (pI)DPhe Arg (pNO 2 )DPhe NH 2 5.940.71 45245.6 1981 11 Ac His (pI)DPh e Arg (pI)Phe NH 2 0.130.0088 2.880.30 1981 12 Ac His (pI)DPhe Arg Tic NH 2 95.324.7 6930 1 22 0 1981 13 Ac Arg (pI)DPhe Tic (pNO 2 )DPhe NH 2 0.320.19 2.770.46 1981 14 Ac Arg (pI)DPhe Tic (pI)Phe NH 2 230104 2220 490 1981 15 Ac Arg (pI)DPhe Tic Tic NH 2 2745 862 49000 6280 1981 16 Ac Arg (pI)DPhe Arg (pNO 2 )DPhe NH 2 6.620.27 65550.2 1981 17 Ac Arg (pI)DPhe Arg (pI)Phe NH 2 0.220.012 3.600.71 1981 18 Ac Arg (pI)DPhe Arg Tic NH 2 55.07.35 3170 410 1981 1 Non Acetylated Tic (pI)DPhe Tic (pNO 2 )DPhe 2.510.27 10414.3 1981 2 Non Acetylated Tic (pI)DPhe Tic (pI)Phe NH 2 99.315.8 9 1981 3 Non Acetylated Tic (pI)DPhe Tic Tic NH 2 619120 >10,000 1981 1 negative control Ac Tic DPhe(F 5) Tic (pNO 2 )DPhe 1079 190 >10,000 1981 2 negative control Ac Tic DPhe(F 5) Tic Phe (F 5) NH 2 >10,000 1981 3 negative control Ac Tic DPhe(F 5) Tic Tic NH 2 >10,000 1981 4 negative control Ac Tic DPhe(F 5) Arg (pNO 2 )DPhe 2090 661 >10,000 1981 5 negative control Ac Tic DPhe(F 5) Arg Phe (F 5) NH 2 >10,000 1981 6 negative control Ac Tic DPhe(F 5) Arg Tic NH 2 9099 2668 >10,000 1981 7 negative control Ac His DPhe(F 5) Tic (pNO 2 )DPhe 8.591.51 1 54 0 100 1981 8 negative control Ac His DPhe(F 5) Tic Phe (F 5) NH 2 80.322.3 45300 6890 1981 9 negative control Ac His DPhe(F 5) Tic Tic NH 2 7814 20 36 >10,000 1981 10 negative control Ac His DPhe(F 5) Arg (pNO 2 )DPhe >10,000 1981 11 negative control Ac His DPhe(F 5) Arg Phe (F 5) NH 2 >10,000 1981 12 negative control Ac His DPhe(F 5) Arg Tic NH 2 11483 22157 >10,000 1981 13 negative control Ac Arg DPhe(F 5) Tic (pNO 2 )DPhe 9.531.52 31625. 1 1981 14 negative control Ac Arg DPhe(F 5) Tic Phe (F 5) NH 2 16828.5 6920 1 18 0 1981 15 negative control Ac Arg DPhe(F 5) Tic Tic NH 2 8015 894 1981 16 negative control Ac Arg DPhe(F 5) Arg (pNO 2 )DPhe NH 2 1562 144 1981 17 negative control Ac Arg DPhe(F 5) Arg Phe (F 5) NH 2 >10,000 1981 18 negative control Ac Arg DPhe(F 5) Arg Tic NH 2 5843 997 >10,000 Errors are the standard of the mean from at least three different independent experiments. >10,000 indic ate that no agonist melanocortin receptor pharmacology was observed at the highest concentrations examined.

PAGE 239

239 Table 5 1 4 Summary of the pharmacological activity of TPI1981 peptides at mouse MCRs Peptide # Sequence mMC1R EC 50 (nM) mMC3R EC 50 (nM) mMC4 R EC 50 (nM) mMC5R EC 50 (nM) NDP MSH Ac SYS Nle EH DPhe RWGKPV NH 2 0.0570.016 0.100.019 0.100.015 0.0680.032 VXF1 28 Ac His DPhe Arg Trp NH 2 74.2 (n=2) 10518.1 4.400.50 4.390.76 1981 2 Ac Tic (pI)DPhe Tic (pI)Phe NH 2 >10,000 9.721.28 447126 1981 3 Ac Tic (pI)DPhe Tic Tic NH 2 >10,000 1981 4 Ac Tic (pI)DPhe Arg (pNO 2 )DPhe NH 2 19.22.37 >10,000 47.714.9 93.025.9 1981 5 Ac Tic (pI)DPhe Arg (pI)Phe NH 2 60.414.2 > 10,000 3.580.47 35.52.72 1981 6 Ac Tic (pI)DPhe Arg Tic NH 2 1439 511 1223 293 1253 229 1981 7 Ac His (pI)DPhe Tic (pNO 2 )DPhe NH 2 3.23 1.88 33.711.8 0.370.10 1.440.34 1981 8 Ac His (pI)DPhe Tic (pI)Phe NH 2 4.35 1.30 580131 31 .51.47 36.44.50 1981 9 Ac His (pI)DPhe Tic Tic NH 2 16.3 7.00 69.410.6 9.901.43 95.735.2 1981 10 Ac His (pI)DPhe Arg (pNO 2 )DPhe NH 2 166 94.0 16510.7 6.251.23 22.97.96 1981 11 Ac His (pI)DPhe Arg (pI)Phe NH 2 13.2 5.06 4.610.40 PA 0.760.27 0.540.11 1981 12 Ac His (pI)DPhe Arg Tic NH 2 51.3 29.9 159116 72.010.8 22273.6 1981 13 Ac Arg (pI)DPhe Tic (pNO 2 )DPhe NH 2 1.17 (n=2) 30.218.8 0.370.020 1.060.12 1981 14 Ac Arg (pI)DPhe Tic (pI)Phe NH 2 238 97.2 7794 2202 20672.1 364146 198 1 15 Ac Arg (pI)DPhe Tic Tic NH 2 457 141 12466 2456 2072 327 5030 1048 1981 16 Ac Arg (pI)DPhe Arg (pNO 2 )DPhe NH 2 236 (n=2 ) 3 71PA (n=1) 52.87.39 54.37.80 1981 17 Ac Arg (pI)DPhe Arg (pI)Phe NH 2 9.34 (n =2 ) 4.28 0.76 PA 2.970.74 2.491.02 1981 18 Ac Arg (pI)DPhe Arg Tic NH 2 12.0 (n=2 ) 5367 3052 2034.41 36150.2 1981 1 Non Acetylated Tic (pI)DPhe Tic (pNO 2 )DPhe 2032 378 9.38 3.77 12.73.61 1981 2 Non Acetylated Tic (pI)DPhe Tic (pI)Phe NH 2 1312 461 >10,000 394130 335128 1981 3 Non Acetylated Tic (pI)DPhe Tic Tic NH 2 2229 1286 >10,000 1171 538 3608 2088 1981 1 negative control Ac Tic DPhe (F 5) Tic (pNO 2 )DPhe >10,000 >10,000 2575 1056 1981 2 negative control Ac Tic DPhe(F 5) Tic Phe (F 5) NH 2 >10,000 >10,000 1981 3 negative control Ac Tic DPhe(F 5) Tic Tic NH 2 >10,000 >10,000 >10,000 1981 4 negative control Ac Tic DPhe(F 5) Arg (pNO 2 )DPhe 1120 315 45947.8 1981 5 negative control Ac Tic DPhe(F 5) Arg Phe (F 5) NH 2 >10,000 >10,000 1981 6 negative control Ac Tic DPhe(F 5) Arg Tic N H 2 40577 9192 >10,000 5176 1135 1981 7 negative control Ac His DPhe(F 5) Tic (pNO 2 )DPhe 864389 2646 707 10.13.68 33.56.27 1981 8 negative control Ac His DPhe(F 5) Tic Phe (F 5) NH 2 1810 623 7276 1928 98.550.8 23697.3 1981 9 nega tive control Ac His DPhe(F 5) Tic Tic NH 2 9152 2912 24766 6728 3852 1161 19880 5984 Errors are the standard of the mean from at least three different independent experiments. PA indicates partial agonism. >10,000 indicates that no agonist melanocor tin receptor pharmacology was observed at the highest concentrations examined.

PAGE 240

240 Table 5 1 4 Continued Peptide # Sequence mMC1R EC 50 (nM) mMC3R EC 50 (nM) mMC4R EC 50 (nM) mMC5R EC 50 (nM) 1981 10 negative control Ac His DPhe(F 5) Arg (pNO2)DPhe 7035 35 2 7528 562 6908 2868 1981 11 negative control Ac His DPhe(F 5) Arg Phe (F 5) NH2 1981 12 negative control Ac His DPhe(F 5) Arg Tic NH2 24781 4449 14493 2607 17836 16 37 1981 13 negative control Ac Arg DPhe(F 5) Tic (pNO 2 )DPhe 1022 97 2521 854 24.56.41 40.35.85 1981 14 negative control Ac Arg DPhe(F 5) Tic Phe (F 5) NH 2 1495 489 5909 1406 28059.1 62678.9 1981 15 negative control Ac Arg DPhe(F 5) Tic Tic N H 2 9634 2685 26990 4743 1981 16 negative control Ac Arg DPhe(F 5) Arg (pNO 2 )DPhe NH 2 658268 5282 2533 7414 882 1981 17 negative control Ac Arg DPhe(F 5) Arg Phe (F 5) NH 2 10227 4855 14287 2275 M 1981 18 negative control Ac Arg DPhe(F 5) Arg Tic NH 2 8436 3590 15469 4201 13830 1222 Errors are the standard of the mean from at least three different independent experiments.PA indicates partial agonism. >10,0 00 indicates that no a gonist melanocortin receptor pharmacology was observed at the highest concentrations examined. Table 5 15. TPI1981 tetrapeptides that exhibited antagonist activity at the mMC3R Peptide # Sequence mMC3R pA 2 Antagonist EMH4 105 (control) Ac His (pI)DPhe A rg Trp NH 2 6.01 0.22 TPI1981 4 Ac Tic (pI)DPhe Arg (pNO 2 )DPhe NH 2 5.79 0.24 TPI1981 5 Ac Tic (pI)DPhe Arg (pI)Phe NH 2 5.97 0.066 Errors are the standard of the mean from at least three different independent experiments. The pA 2 antagonist value wa s determined by Schild analysis (pA 2 = log K i )

PAGE 241

241 Figure 5 1 7 Structure of DPhe (F 5) Table 5 1 6 Potent tetrapeptides at the L106P hMC4R Peptide Sequence L106P hMC4R EC 50 (nM) NDP MSH Ac Ser Tyr Ser Nle Asp His DPh e Arg Trp Gly Lys Pro Val NH 2 0.670.072 VXF1 28 Ac His DPhe Arg Trp NH 2 22187.1 1981 7 Ac His (pI)DPhe Tic (pNO 2 )DPhe NH 2 14.01.94 1981 11 Ac His (pI)DPhe Arg (pI)Phe NH 2 2.880.30 1981 13 Ac Arg (pI)DPhe Tic (pNO 2 )DPhe NH 2 2.770.46 1981 17 Ac Arg (pI)DPhe Arg (pI)Phe NH 2 3.600.71 Figure 5 1 8 Dose response curves of TPI1981 7 and 13 at hMC4R and L106P hMC4R.

PAGE 242

242 Figure 5 1 9 Dose response curves of TPI1981 7 and 13 at hMC4R and L106P hMC4R. Figure 5 20 Dose response curves of TPI1981 5, 11, and 17 at hMC4R and L106P hMC4R.

PAGE 243

243 Figure 5 2 1 Flowchart of the route taken to find potent peptides in screening a CC library.

PAGE 244

244 CHAPTER 6 CONCLUDING REMARKS The involvement of GPCRs in many diseases has made them the single largest drug target. 51 About 30 % of the drugs on the market are designed to interact with these proteins However, the structure s of GPCRs still remain limited; their basic structure is known to involve helices with extracellular and intracellular loops. Due to their dynamic features, it is difficult to solve crystal structures of these proteins. Crystal structures represent the finest level of structural detail of GPCRs, allowing b inding pockets to be identified and for a better understanding of the ir molecular mechanism of action 137 The history of GPCRs and their involvement in drug discovery dates back to 1900. The naturally occurring adrenaline, epinephrine, was shown to act on adrenergic receptors a nd was patented by Parke Davis. 244 About 100 years later, the first X ray structure of a GPCR, rhodopsin, was solved. 184,185,189 In 2007, the s econd GPCR X 2 adrenergic receptor was introduced. 187,188 Recently, the active state X 2 adrenergic receptor w ere solved with the use of antibodies to stabilize them. 186 Creating a library of crystal structures of GPCRs will aid in the drug discovery process because every piece of information allows researchers to be one step closer in drug design and discovery Techniques such as str ucture activity relationship studies of ligands and mutagenesis studies are another way to understand GPCRs for those that do not have a solved crystal structure. However, researchers can utilize crystal structures of other GPCRs as a stepping stone in de veloping a model of another protein. The research presented herein strives to understand the melanocortin 4 receptor by employing these

PAGE 245

245 two methods in hopes of getting one step closer in determining the exact structure of the melanocortin receptors inter action with ligands and in the drug discovery process Determination of Unique Interactions between hMC4R and AGRP The relationship between the melanocortin agonists, the antagonists and receptors is complex. The melanocortin agonists are known to reduce food intake, while the antagonists cause an increase in food intake .This research carried out to determine if there are residues within the MC4R that are specific for AGRP based ligands. Also, to examine the role of these residues in the conversion of pha rmacology of AGRP based ligands when the Arg Phe Phe triplet was stereochemically inverted. Three hMC4R residues were examined, Asn123, Phe184 and Asp189 through the use of receptor mutagenesis. The hypothesis that these residues are specific for the AGRP based ligands was not fully supported when experimentally tested. Although, this study led to the discovery of a new agonist template; the bicyclic AGRP peptide converted from an antagonist to an agonist when the core sequence, Arg Phe Phe, is stereochemic ally modified. Identification of Potent Peptides at the L106P hMC4R P olymorphism Genetic studies of morbidly obese human patients and normal weight control patients have resulted i n the discovery of over 10 0 hMC4R single nucleotide polymorphisms observed in both homozygous and heterozygous forms. 6,7,11,16,17,26,117 130 Many researchers have been studying these hMC4R polymorphisms in attempts to understand the molecular mechanisms that might provide an explanation fo r the obese human phenotype. 6,7,11,16,17,26,117 130 The research presented herein studies the L106P hMC4R polymorphism proposed to be located within the binding region of the MC4R 26,117 It is hypothesized that the mutation from the amino acid Leu cine to Pro line

PAGE 246

246 is distort ing the receptor The conformational change due to th is mutat ion has an effect on the binding of endogenous ligands in that they have shown to have decreased affinity for the receptor. Although, t etrapeptides were shown to exhibit potent activity at this polymorphic receptor postulating that the smaller sequence le ngth can bind properly 122 It was hypothesized that screening a combinatorial chemistry tetrapeptide library that focused on this mutation may identify ligands that restore functional activity. Repetitive screening, deconvolution, and synthesis of hits led to the individual testing of 18 tetrapeptides (Ac X 1 X 2 X 3 X 4 NH 2 ). It was found that the incorporation of (pI) DPhe at X 2 along with either the dipeptide Tic (pNO 2 )DPhe or Arg (pI)Phe at positions X 3 X 4 led to n M potency at the L106P hMC4R. This study validated the use of screening combinatorial chemistry libraries and identifying molecules to restore function at naturally occurring human polymorphisms in obese patients. Before concluding my graduate research presented herein, there is an additional topic that I would like to discuss due to several encounters with it, and that being troubleshooting. Developing this as part of a skill set is a valuable asset in the maturity of an independent scientist. The ability to adapt to not only experimental error, but also to adjust when instruments do not work properly or if a technician finds a new position are important traits for independent researchers to develop. Troubleshooting is a task that inv olves the ability to logically and systematically identify the source of a problem and generate possible causes and answers to remedy the setback. The capability to identify a problem and offer solutions is a great attribute of a scientist; it shows the ability of the scientist to think critically not only on important scienti fic issue s, but also impediments in research. During my graduate career, there were times when the results

PAGE 247

247 galactosidase reporter gene assay did not compare with previous studies. A control group i s necessary in every experiment in case certain problems do arise. Two main examples that affected my graduate work are discussed below. MSH agonist to explore MSH residues, Glu 5 His 6 and Gly 10 may be important residues in designing MC3R selective ligands over MC4R. MSH and substituted analogues) were synthesized in Fmoc manual solid phase peptide synthesis. The peptides were pharmacologically characterized at the mouse receptors by Marvin Dirain, technician in Haskell Luevano lab from 2007 2010. After the data was worked up by Dr. Carrie Haskell Luevano, questions arose due to incorrect EC 50 MSH control peptide (EMH2 18). Sinc e EMH2 MSH, the data for the rest of the compounds were uncertain. Many possible problems were discussed as to why EMH2 18 was not responding comparably to past data, as seen below, with experimental data/note keepi ng/ additional reasons to refute each one. Peptide is not correct sequence: Ac Ser Tyr Ser Met Glu His Phe Arg Trp Gly Lys Pro Val NH 2 Every time a peptide is synthesized in the lab, there is a coupling reaction sheet to record washings, deprotection of Fmoc group, coupling of AA, ninhydrin tests. EMH 2 notebook (pg 38) shows that the correct order of AAs was recorded during the synthesis of EMH2 18. Mass spectrometry was performed on the Voyager DE Pro located in the University of Florida Protein Core Fa cility (before submission) to ensure the correct molecular weight (MW) of peptide. It was calculated that the MW of EMH2 18 was 1664.88 and the M+1 peak from the MALDI mass

PAGE 248

248 spectrometer was 1665.25 m/z. The retention time obtained from RP HPLC is another s tandard to compare. This peptide has been previously synthesized in the lab; the retention times from AE 1 (12.90) and EMH2 18 (13.08) were compared to be similar. Peptide is not pure: To ensure purity of peptides synthesized, they are analyzed using RP H PLC with an analytical Vydac C 18 column (Vydac 218TP104). The purified peptides were at least >98% pure as determined by RP HPLC in two diverse solvent systems (10% acetonitrile in 0.1% trifluoroacetic acid/water and a gradient to 90% acetonitrile over 35 min or 10% methanol in 0.1% trifluoroacetic acid/water and a gradient to 90% methanol over 35 min). Switched AAs during synthesis or transposed during reaction: The reaction coupling sheet doe s not show an error, MS supports correct molecular mass, and re tention time comparison supports the correct order of AAs used in synthesis. Bioassay problem: The other two controls, NDP MSH and forskolin exhibited similar data previous to other assays. Technician switched tubes of peptide samples during assay: In an alyzing the data, no other ligand tested in the assay provides the co MSH. The MSH compound was never tested. EMH switched sample with others before submission to CHL: All compounds were labeled with specific number, however, the other analogues ha ve different molecular weights and MS proved to be the correct mass.

PAGE 249

249 Racemization of peptide: If racemization occurred, there would be two peaks on the HPLC analytical chromatographs and a shift in retention time In both solvent systems (acetonitrile and methanol), one clean peak was observed. Sample Weight Inaccurate/ Incorrect concen tration of sample used in assay /Incorrect dilution: The dilution of the peptide is based on the amount of peptide, molecular weight, and TFA molecules. The dilution for EMH 2 18 was re calculated and compared to the original dilution (Dilution book 5, pg 40) providing the same answer After all the possible problems were identified, two steps were taken to try to answer the problem encountered. A sample of the peptide was t ested on the HPLC and determined that it was the correct The other step was to test a comp MSH peptide and EMH2 18 in the same bioassay at the same concentrations. Marvin Dirain performed this assay and was unable to produce comparable EC 50 values for both MSH. E ven though correct, reproducible data was exhibited for the other controls, forskolin and NDP MSH. As mentioned earlier, NDP MSH to overcome issues with the endogenous agonist. 94 The Met was replaced with an Nle to prevent oxidation and Phe was stereochemically inverted to DPhe to pro duce a more potent peptide. 94 It is proposed that the different orientation that DPhe found in NDP MSH would participate inside the binding pocket may be one explanation for the greater potency and long er activity of NDP MSH. 216 It is hypothesized that there is some experimental variation occurring in technique while performing this assay that we have not been able to identify yet. Unfortunately, these changes have led to

PAGE 250

250 reporting 10 fold error over 3 fold error in publications. It is s till being examined as to MSH is not being received in the bioassays. This first problem actually carried over to a second issue. Peptides are normally characterized at the mouse melanocortin receptors to explore receptor sub type se lectivity and to perhaps find a potential in vivo tool for the melanocortin system. Assays were being completed by Marvin Dirain obtaining data for a wide range of libraries of peptides. There were a few constant observations in the analysis of the data being produced After a few weeks, the mouse MC1 receptor was e xhibiting a high basal level and we were unable to obtain a consistent EC 50 value for the peptides. Also, through the use of control peptides, besides NDP MSH and forskolin, inconsistenci es were detected at the mouse MC3 receptor. For this receptor, a similar study was undertaken as described above in which potential problems were discussed either about the peptides themselves, concentration/dilution error, cell lines were switched, or a p roblem with the cell line itself. This time it was proposed that it was actually the cell line that was the basis for the problem we were experiencing Fortunately, this problem was easily remedied, unlike above which is still being investigated. Over th e years, many technicians, post docs, and students have created stocks for each of the mouse receptors. Searching through past notebooks and data, three potential stocks were chosen for each cell line that had previously reported correct data with known co mpounds. Marvin and I individually tested the new stocks with standard ligands to identify the best cell line stock. After receiving similar results, we both made new frozen stocks and these remain the cell lines used today in the lab. New mMC1R cells must be thawed every 2 3 weeks to avoid high basal levels; it is still unknown as to why this

PAGE 251

251 basal level increases faster at this receptor than at the other receptors. Overall, these setbacks hind er the advancement of research; however, the ability to trouble shoot by recognizing potential areas of concern and postulate solutions can only help broaden the skill set of a scientist. In conclusion, o besity is a major health concern for those of all ages, being the fifth leading risk for death. 1 The melanocortin system, especially the MC4R, has been shown to be involved in energy and weight homeostasis. A further understanding of this receptor and pathway is an important therapeutic tool in the treatment of obesity. These studies re present advances in identification of the binding pocket for agonists and antagonists in the melanocortin 4 receptor. This research has identified new agonists based on the sequence of an antagonist with the incorporation of D amino acids in the core pharm acophore region of the peptide. Due to the complicated relationship between the melanocortin systems, agonists, antagonists, obesity and related d iseases the functional abilitiy of these new ligands may play a significant role in development of therapeuti c tools. Also, this research provided an example of screening combinatorial chemistry libraries to identify ligands that can target polymorphic hMC4Rs to restore functional activity. The results in these studies should aid in the design of ligands for the melanocortin receptors. These MC4R mutations are rare; however, are affecting individuals throughout the world and having a part in taking a step due to this research is a nother highlight of my graduate career.

PAGE 252

252 APPENDIX A PRIMER SEQUENCES Appendix A cont ains the primer sequences used in the generation of Flag hMC4R receptor mutations. Mutation Primer Sequence N123A GCT AGC N123D GAT GTCATTGACT ATC N123Q CAG GTCATTGACTCGGTG CACCGAGTCAATGAC GTC N123S AGT GTCATTGACTCGGTG CACCGAGTCAATGAC ACT A F184A GCC GGC F184H CAC GTG F184K Forw AAG CTT F184R CGC CGC F184S TCC AT GGA F184W TGG CCA F814Y TAC TATCTGAGTAAATGAT GTA D189A GCCCATCATTTACTCA GCT GATGACAGCACTACT AGC D189E Forward: GCCCATCATTTACTCA GAG GATGACAGCACTACT CAC D18 9K GCCCATCATTTACTCA AAG AGTAGTGCTGTCATCATC GATGACAGCACTACT CTT D189N Forward: GCCCATCATTTACTCA AAT AGTAGTGCTGTCATC GATGACAGCACTACT ATT D189Q Forward: GCCCATCATTTACTCA CAG AGTAGTGC TGTCATC GATGACAGCACTACT CTG D189R Forward: GCCCATCATTTACTCA CGT AGTAGTGCTGTCATC GATGACAGCACTACT ACG D189S Forward: GCCCATCATTTACTCA AGT AGTAGTGCTGTCATC GATGACAGCACTACT ACT TGA

PAGE 253

253 APPENDIX B SEQUENCING FILES Appendix B contains all sequences of WT and mutant FlaghMC4 receptors. The first part of the page shows the receptor nucleotide sequences. On the second part the receptor nucleotide sequences are translated i nto the corresponding receptor amino acid sequences (open reading frames), with restriction enzymes sites included.

PAGE 254

254 WT FlaghMC4R/pCDNA 3 (made by Z.Xiang, Sequenced by F. Portillo ) AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGT GGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGCACCT CTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCA TCAG CTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCA AGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAAC CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAA TTGC AGTGGACAGGTACTTTACTATCTTCTATGCTCTCCA GTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT G TTC ATCATTTA CTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCC TCCC CGGCACTGGTGCCATCCGCCAAGGTGCCAATATG AAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCCTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAG AGAT CATCTGTTGCTATCCCCTGGGAGGCCTTTGTG ACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGA CGACGACAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ GTGGCACCCTACGTGTGAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAGAGGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTTCTTAGACGTAAG TGGGTACATGAAAAAGTAGACGTCGAACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGAT ACGGATGCACAGAGTTTCACAGTGAATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCAAAGTGTCA CTTATAACTATTACAGTAACTGAGCCACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D N V I D S V I C S S L L A S I C S S pDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACAT TATGACAGTTAAGCGGGTTGGGATCATCATAAGTTG 501 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGCCCAACCCT AGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT G TTC ATCATTTACTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ -------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGTACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L F I I Y S D S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACGACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCC 801 --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTCGCTAATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAACATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAG 1001 --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ ---1085 TCAGTTCTTGACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 255

255 N123A FlaghMC4R/pCDNA 3 AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATT CGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGCACCT CTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCA TCAG CTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACA AGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAAC CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGT GAATATTGAT GC T GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAATTGC AGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCA TAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCCC ATCATTTA CTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCC TCCC CGGCACTGGTGCCATCCGCCAAGGTGCCAATATGAAGGGA GCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCCTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAG AGAT CATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGT CTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGA CAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTGGCACCCTACGTGTGAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAGAGGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCGAACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGAT GCT GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGCCACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D A V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGC TTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTG 501 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACCTGTCCATG AAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCC CATCATTTACTCAGATAGTAGTGCTGTCATCATCTGCCT CATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGTACAAGAAGTGGTACG AC frame 1 > I W A A C T V S G I L F I I Y S D S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAG AGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACGACAGGAGGGGCCGTG ACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCC 801 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTCGCTAATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAACATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGC AGATATTAG 1001 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ---1085 TCAGTTCTTGACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 256

256 N123D FlaghM C4R/pCDNA 3 AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGC ACCT CTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTC TGGGTGTCATCAG CTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAG AAAC CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGT GAATATTGAT GA T GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAG CCTGCTTTCAATTGC AGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCCC ATCATTTA CTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAG AGGATTGCTGTCCTCCC CGGCACTGGTGCCATCCGCCAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTC CTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGA GGAAAACCTTCAAAGAGAT CATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAG AGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACT AGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCG AACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGAC TGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTGGCACCCTACGTGTGAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGG GAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 -------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAGAGGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAACCATTGTCATCACC 301 --------+ -------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCGAACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGAT G A T GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGCCACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D D V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTG 501 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCAC GGTTTCAGGCATTTT GCC CATCATTTACTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGT AAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGTACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L F I I Y S D S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGAGAGTACCGAAGAGAGATACA GGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACGACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCT GCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCC 801 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTCGCTAATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTG AATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGAT CCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAACATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC f rame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAA ACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAG 1001 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ---1085 TCAGTTCTTGACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAA CAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 257

257 N123Q FlaghMC4R/pCDNA 3 AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGC ACCT CTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGC TACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAG CTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAG AAAC CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGT GA ATATTGAT CAG GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAATTGC AGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCCC ATCATTTA CTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCT GGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCC CGGCACTGGTGCCATCCGCCAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTC CTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTG ATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAGAGAT CATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAG AGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTGGCACCCTACGTGTG AAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGCT TGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAGAGGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTAA CACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAA TGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCGAACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAGT GG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGAT CAG GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGCCACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D Q V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTG 501 --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCC CATCATTTACTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGTACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L F I I Y S D S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACGACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCC 801 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTCGCTA ATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTG CTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAACA TAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAG 1001 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ---1085 TCAGTTCTTG ACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 258

258 N123S FlaghMC4R/pCDNA 3 AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGC ACCT CTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCA TCAG CTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAG AA AC CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGT GAATATTGAT AGT GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAATTGC AGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCCC ATCA TTTA CTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCC TCCC CGGCACTGGTGCCATCCGCCAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTG TCCTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAG AGAT CATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGT CTAGAGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ GTGGCACCCTACGTGTGAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GG TGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAG AGGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCAC CCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCG AACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGA ATATTGAT AGT GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGC CACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D S V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATC ATCATAAGTTG 501 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCC CATCATTTACTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGTACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L F I I Y S D S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACGACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCC 801 --------+ --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ GGTTATACTTCCCTCGCTAATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAACATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAG 1001 --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ ---1085 TCAGTTCTTGACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 259

259 F184A FlaghMC4R/pCDNA 3 (made by Z.Xiang, Sequenced by F. Portillo ) AAGCTTGGTACCGAGCTCGGATCCACTAG TCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGCACCT CTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCA TCAG CTTGTTGGAGAATATCTTAGTGATTGT GGCAATAGCCAAGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAAC CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAA TTGC AGTGGACAGGTACTTTACTATCTTC TATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCC CATCATTTA CTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCC TCCC CGGCACTGGTGCCATCCGCCAAG GTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCCTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAG AGAT CATCTGTTGCTATCCCCTGGG AGGCCTTTGTGACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGAC TACAAGGACGACGACGACAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCA CTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTC TGATGGAG 101 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTGGCACCCTACGTGTGAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAGAGGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCGAACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGCCACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D N V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTG 501 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTT AACGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GC C CATCATTTACTCAGATAGTAGT GCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTG GTACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L A I I Y S D S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGG CCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAA CGACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTC TTGTCC 801 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTCGCTAATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 -------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAACATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCC TTTGTGACTTGTCTAGCAGATATTAG 1001 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ---1085 TCAGTTCTTGACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 260

260 F184H FlaghMC4R/pCDNA 3 (made by Z.Xiang, Sequenced by F. Portillo ) AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGC ACCT CTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAA AGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAG CTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAG AAAC CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACA GTGAATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAATTGC AGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT G CAC ATCATTTA CTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCA TGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCC CGGCACTGGTGCCATCCGCCAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTC CTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCAT ACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAGAGAT CATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAG AGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTGGCACCCTACG TGTGAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATC AGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAGAGGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCA CTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTT CAAATGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCGAACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAG TAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTT GCA 401 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGCCACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D N V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTG 501 --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT G CA C ATCATTTACTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ -------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGTACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L H I I Y S D S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACGACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCC 801 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTC GCTAATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTG TGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTG AACATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAG 1001 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ---1085 TCAGTT CTTGACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 261

261 F184K FlaghMC4R/pCDNA 3 (made by Z.Xiang, Sequenced by F. Portillo ) AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGA CGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGCACCT CTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCA TCAG CTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGC AGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAAC CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAA TTGC AGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCA TAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT G AAG ATCATTTA CTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCC TCCC CGGCACTGGTGCCATCCGCCAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGT TGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCCTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAG AGAT CATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATA TAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACC 1 -------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTGGCACCCTACGTGTGAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ -------+ CCACGATGCTCGTTGAAAAACAGAGAGGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCGAACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T 7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GATAATTTGTCATGTCTA TGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGCCACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D N V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTC TATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTG 501 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTA ATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT G AAG ATCATTTACTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGTACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L K I I Y S D S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCG CCAAGGTG 701 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACGACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCC 801 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTCGCTAATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAACATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAG 1001 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ---1085 TCAGTTCTTGACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 262

262 F184R FlaghMC4R/pCDNA 3 (made by Z.Xiang, Seque nced by F. Portillo ) AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGC ACCT CTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTG TTTGTGACTCTGGGTGTCATCAG CTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAG AAAC CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCAT CCATTTGCAGCCTGCTTTCAATTGC AGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT G CGC ATCATTTA CTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCT TCACATTAAGAGGATTGCTGTCCTCCC CGGCACTGGTGCCATCCGCCAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTC CTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGT CAAGAACTGAGGAAAACCTTCAAAGAGAT CATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAG AGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCT CGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCA CCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGC AGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTGGCACCCTACGTGTGAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACG GTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAGAGGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAACCATTGTCATCACC 301 -------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCGAACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ --------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGCCACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D N V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTG 501 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGG CAGCTTGCACGGTTTCAGGCATTTT G CGC ATCATTTACTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAA AACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGTACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L R I I Y S D S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGAGAGTACCGAA GAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACGACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTC TTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCC 801 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTCGCTAATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAA GAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTC AATCATCGATCCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAACATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATAC GTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T 7Ter Stu1 | | | | AGTCAAGA ACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAG 1001 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ---1085 TCAGTTCTTGACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGG AAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 263

263 F184S FlaghMC4R/pCDNA 3 (made by Z.Xiang, Sequenced by F. Portillo ) AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGC ACCT CTGG AACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAG CTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAG AAAC CA TTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAATT GC AGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT G TCC ATCATTTA CTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCC TCCC CGGCACTGGTGCCATCCGCCAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTC CT CA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAG AGAT CATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAG AGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T B sg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTGGCACCCTACGTGTGAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCT ACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAGAGGA CTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCAT GTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCGAACC GACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATAT TGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGCCACT AGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D N V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCA TAAGTTG 501 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT G TCC ATCATTTACTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGTACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L S I I Y S D S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACGACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCC 801 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ GGTTATACTTCCCTCGCTAATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAACATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAG 1001 --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ ---1085 TCAGTTCTTGACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 264

264 F184W FlaghMC4R/pCDNA 3 (made by Z.Xiang, Sequenced by F. Portillo ) AAGCTTGGTACCGAGCTCGGATCCACTAGTC CAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGCACCT CTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCA TCAG CTTGTTGGAGAATATCTTAGTGATTGTGG CAATAGCCAAGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAAC CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAA TTGC AGTGGACAGGTACTTTACTATCTTCTA TGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT G T GG ATCATTTA CTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCC TCCC CGGCACTGGTGCCATCCGCCAAGGT GCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCCTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAG AGAT CATCTGTTGCTATCCCCTGGGAG GCCTTTGTGACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTA CAAGGACGACGACGACAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACT TGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTG ATGGAG 101 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTGGCACCCTACGTGTGAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAGAGGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCGAACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGCCACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D N V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTG 501 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAA CGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT G T GG ATCATTTACTCAGATAGTAGTGC TGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGT ACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L W I I Y S D S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCC AGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACG ACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTT GTCC 801 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTCGCTAATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 -------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAACATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTT TGTGACTTGTCTAGCAGATATTAG 1001 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ---1085 TCAGTTCTTGACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 265

265 F184Y FlaghMC4R/pCDNA 3 (made by Z.Xiang, Sequenced by F. Portillo ) AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGC ACCT CTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGG CTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAG CTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAG AAAC CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTG AATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAATTGC AGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT G T A C ATCATTTA CTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGC TGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCC CGGCACTGGTGCCATCCGCCAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTC CTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACT GATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAGAGAT CATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAG AGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTGGCACCCTACGTGT GAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGC TTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAGAGGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTA ACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAA ATGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCGAACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAG TGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGATAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGCCACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D N V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTG 501 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT G T A C ATCATTTACTCAGATAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGTACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L Y I I Y S D S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACGACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCC 801 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTCGCT AATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGT GCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAAC ATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAG 1001 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ---1085 TCAGTTCTT GACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 266

266 D189A FlaghMC4R/pCDNA 3 AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGC ACCT C TGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCAT CAG CTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAG AAA C CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGT GAATATTGAT CAG GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAATTGC AGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCCC ATCAT T TA CTCA GC T AGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCC CGGCACTGGTGCCATCCGCCAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGT CCTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAG AGAT CATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTC TAGAGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ GTGGCACCCTACGTGTGAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGT GCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAGA GGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACC CATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCGA ACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAA TATTGAT CAG GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGCC ACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D N V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCA TCATAAGTTG 501 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCC CATCATTTACTCA GCT AGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGTACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L F I I Y S A S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACGACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCC 801 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTCGCTAATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAACATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAG 1001 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ---1085 TCAGTTCTTGACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 267

267 D189E FlaghMC4R/pCDNA 3 AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAA GGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGCACCT CTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCA TCAG CTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGCATTCACCCATGTACTTT TTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAAC CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGT GAATATTGAT CAG GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAATTGC AGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTG GGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCCC ATCATT TA CTCA G AG AGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCC CGGCACTGGTGCCATCCGCCAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGG CGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCCTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAG AGAT CATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAAATGGGGACAGAG CACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGG CCC Kpn1 BamH1 Eco R1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDo n | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTGGCACCCTACGTGTGAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ CCACGATGCTCGTTGAAAAACAGAGAGGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCGAACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGAT CAG GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GATAATTTG TCATGTCTATGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGCCACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D N V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTT ACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTG 501 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCAT GGTATTGTAATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCC CATCATTTACTCA G AG AGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGTACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L F I I Y S E S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGG TGCCATCCGCCAAGGTG 701 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACGACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCC 801 --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTCGCTAATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAACATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAG 1001 -------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ---1085 TCAGTTCTTGACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 268

268 D189K FlaghMC4R/pCDNA 3 AAGCTTGGTACCGA GCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGCACCT CTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCA TCAG CTTGTTGGAGAA TATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAAC CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGT GAATATTGAT CAG GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAATTGC AGTGGACAGG TACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCCC ATCATT TA CTCA A AG AGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCC CGGCACTG GTGCCATCCGCCAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCCTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAG AGAT CATCTG TTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTT GCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCT GCTGCTGCTGTTCCACTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCT TGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTGGCACCCTACGTGTGAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAGAGGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCGAACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGAT CAG GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGCCACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D N V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTG 501 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCC CATCATT TACTCA A AG AGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTA GTAGACGGAGTAGTGGTACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L F I I Y S K S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCC ACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAA GTGTAATTCTCCTAACGACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTT AATATTCTACATCTCTTGTCC 801 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTCGCTAATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG f rame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAACATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCT ATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAG 1001 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ---1085 TCAGTTCTTGACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 269

269 D189N FlaghMC4R/pCDNA 3 AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGC ACCT CTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGC AACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAG CTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAG AAAC CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGT GAATATTGAT CAG GTCATTGACTCGGT GATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAATTGC AGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCCC ATCATT TA CTCA A A T AGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTC CACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCC CGGCACTGGTGCCATCCGCCAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTC CTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATC CTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAGAGAT CATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAG AGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco 1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGA GCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTT CTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTGGCACCCTACGTGTGAAGAGACGTGGAGACCTTGGCGTCG TCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGT GGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAGAGGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCGAACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGAT CAG GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGCCACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D N V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTG 501 --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCC CATCATTTACTCA AAT AGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ATAGACCC GTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGTACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L F I I Y S N S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACGACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTA CCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCC 801 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTCGCTAATGGAACTGGTAGGACTAACCGCAG AAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTAT CTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAACATAGAGTATGACTAGTACACATTAAG TTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAG 1001 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ---1085 TCAGTTCTTGACTCCTTTTGGAAGTTTCTCTAGTA GACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 270

270 D189Q FlaghMC4R/pCDNA 3 AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGC ACCT CTGGAACCGCAGCAGTTACAGACTG CACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAG CTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAG AAAC CATTGTCATCACCCTATTAAACA GTACAGATACGGATGCACAGAGTTTCACAGT GAATATTGAT CAG GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAATTGC AGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCCC ATCATT TA CTCA C AG AGTAGTGCTGTCAT CATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCC CGGCACTGGTGCCATCCGCCAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTC CTCA GAATCCATATTGTGTGTGC TTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAGAGAT CATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAG AGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTGGCACCCTACGTGTGAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCTACGAGCAACTTTTTGTCTCTC CTGAGGTGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAGAGGACTCCACAAACACTGAGACCCA CAGTAGTCGAACAACCTCTTATAGAATCACTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTT GGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCGAACCGACACCGACTATACGACCACT CGCAAAGTTTACCTAGTCTTTGGTAACAGTAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGAT CAG GTCATTGACTCGGT GATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGCCACTAGACATCGAGGAACGAACGTA GGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D N V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTG 501 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCC CATCATTTACTCA C AG AGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGTACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L F I I Y S Q S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACGACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCC 801 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTCGCTAATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTA TAACACACACGAAGTACAGAGTGAAATTGAACATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAG 1001 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --1085 TCAGTTCTTGACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 271

271 D189R FlaghMC4R/pCDNA 3 AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTC CACCCACCGTGGGATGCACACTTCTCTGCACCT CTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCA TCAG CTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCT GATATGCTGGTGAGCGTTTCAAATGGATCAGAAAC CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGT GAATATTGAT CAG GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAATTGC AGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGG CAGCTTGCACGGTTTCAGGCATTTT GCCC ATCATT TA CTCA CGT AGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCC CGGCACTGGTGCCATCCGCCAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCC ATTCTTCCTCCACTTAATATTCTACATCTCTTGTCCTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAG AGAT CATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCT GCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sac1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACC 1 --------+ -------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACTTGAGGTGG frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ GTGGCACCCTACGTGTGAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAGAGGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTTCTTA GACGTAAGTGGGTACATGAAAAAGTAGACGTCGAACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACA GTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGAT CAG GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCA AAGTGTCACTTATAACTATTACAGTAACTGAGCCACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D N V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTAC CATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTG 501 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACCTGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGC CCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCC CATCATTTACTCA CGT AGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGTACAAGAAGTGGTACGAC frame 1 > I W A A C T V S G I L F I I Y S R S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACGACAGGAGGGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCC 801 --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTCGCTAATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAACATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGACTTGTCTAGCAGATATTAG 1001 --------+ --------+ -------+ --------+ --------+ --------+ --------+ --------+ ---1085 TCAGTTCTTGACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 272

272 D189S FlaghMC4R/pCDNA 3 AAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTG GTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGACGACGACGACAAGGTGAACTCCACCCACCGTGGGATGCACACTTCTCTGCACCT CTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCA TCAG CTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGC CAAGAACAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAAC CATTGTCATCACCCTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGT GAATATTGAT CAG GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAATTGC AGTGGACAGGTACTTTACTATCTTCTATGCTCTC CAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCCC ATCATT TA CTCA AGT AGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCC CGGCACTGGTGCCATCCGCCAAGGTGCCAATA TGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCCTCA GAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAG AGAT CATCTGTTGCTATCCCCTGGGAGGCCTTTG TGACTTGTCTAGCAGATATTAAATGGGGACAGAGCACGCAATATAGAAGCCGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGG CCC Kpn1 BamH1 EcoR1 Hind3 Acc65 | Sa c1 | Spe1 BstX1 | Nco1 SpAcc SpDon | | | | | | | | | | | AAGCTTGGTACCG AGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCGGCTTGCCGCCGCCATGGACTACAAGGAC GACGACGACAAGGTGAACTCCACC 1 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ TTCGAACCATGGCTCGAGCCTAGGTGATCAGGTCACACCACCTTAAGCCGAACGGCGGCGGTACCTGATGTTCCTGCTGCTGCTGTTCCACTTGAGGTG G frame 1 > S L V P S S D P L V Q C G G I R L A A A M D Y K D D D D K V N S T Bsg1 Bsg1 BsrD1 | | | CACCGTGGGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCCCTTGGAAAAGGCTACTCTGATGGAG 101 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GTGGCACCCTACGTGTGAAGAGACGTGGAGACCTTGGCGTCGTCAATGTCTGACGTGTCGTTACGGTCACTCAGGGAACCTTTTCCGATGAGACTACCTC frame 1 > H R G M H T S L H L W N R S S Y R L H S N A S E S L G K G Y S D G G Bsu36 | GGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGACTCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAA 201 --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ --------+ CCACGATGCTCGTTGAAAAACAGAGAGGACTCCACAAACACTGAGACCCACAGTAGTCGAACAACCTCTTATAGAATCACTAACACCGTTATCGGTTCTT frame 1 > C Y E Q L F V S P E V F V T L G V I S L L E N I L V I V A I A K N Bsm1 Pst1 SpDon | | | CAAGAATCTGCATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGATCAGAAACCATTGTCATCACC 301 --------+ --------+ --------+ --------+ --------+ --------+ -------+ --------+ --------+ --------+ GTTCTTAGACGTAAGTGGGTACATGAAAAAGTAGACGTCGAACCGACACCGACTATACGACCACTCGCAAAGTTTACCTAGTCTTTGGTAACAGTAGTGG frame 1 > K N L H S P M Y F F I C S L A V A D M L V S V S N G S E T I V I T T7Ter Ssp1 | | CTATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATATTGAT CAG GTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCA 401 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ -------+ GATAATTTGTCATGTCTATGCCTACGTGTCTCAAAGTGTCACTTATAACTATTACAGTAACTGAGCCACTAGACATCGAGGAACGAACGTAGGTAAACGT frame 1 > L L N S T D T D A Q S F T V N I D N V I D S V I C S S L L A S I C S SpDon Mfe1 Bts1 Bpm1 | | | || GCCTGCTTTCAATTGCAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTTGGGATCATCATAAGTTG 501 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGGACGAAAGTTAACGTCACC TGTCCATGAAATGATAGAAGATACGAGAGGTCATGGTATTGTAATACTGTCAATTCGCCCAACCCTAGTAGTATTCAAC frame 1 > L L S I A V D R Y F T I F Y A L Q Y H N I M T V K R V G I I I S C SpDon | TATCTGGGCAGCTTGCACGGTTTCAGGCATTTT GCC CATCATTTACTCA AGT AGTAGTGCTGTCATC ATCTGCCTCATCACCATGTTCTTCACCATGCTG 601 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ATAGACCCGTCGAACGTGCCAAAGTCCGTAAAACGTGTAGTAAATGAGTCTATCATCACGACAGTAGTAGACGGAGTAGTGGTACAAGAA GTGGTACGAC frame 1 > I W A A C T V S G I L F I I Y S S S S A V I I C L I T M F F T M L BspLU SpDon Eci1 | | | GCTCTCATGGCTTCTCTCTATGTCCACATGTTCCTGATGGCCAGGCTTC ACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCCATCCGCCAAGGTG 701 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ CGAGAGTACCGAAGAGAGATACAGGTGTACAAGGACTACCGGTCCGAAGTGTAATTCTCCTAACGACAGGAG GGGCCGTGACCACGGTAGGCGGTTCCAC frame 1 > A L M A S L Y V H M F L M A R L H I K R I A V L P G T G A I R Q G A PspOM BseY1 | | Ssp1 | | | | CCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTGCTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCC 801 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ GGTTATACTTCCCTCGCTAATGGAACTGGTAGGACTAACCGCAGAAACAACAGACGACCCGGGGTAAGAAGGAGGTGAATTATAAGATGTAGAGAACAGG frame 1 > N M K G A I T L T I L I G V F V V C W A P F F L H L I F Y I S C P SpDon BspE1 | | TCAGAATCCATATTGTGTGTGCTTCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTATGCACTCCGG 901 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ AGTCTTAGGTATAACACACACGAAGTACAGAGTGAAATTGAACATAGAGTATGACTAGTACACATTAAGTTAGTAGCTAGGAGACTAAATACGTGAGGCC frame 1 > Q N P Y C V C F M S H F N L Y L I L I M C N S I I D P L I Y A L R SpAcc Xmn1 T7Ter Stu1 | | | | AGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCTTTGTGA CTTGTCTAGCAGATATTAG 1001 --------+ --------+ --------+ --------+ --------+ --------+ --------+ --------+ ---1085 TCAGTTCTTGACTCCTTTTGGAAGTTTCTCTAGTAGACAACGATAGGGGACCCTCCGGAAACACTGAACAGATCGTCTATAATC frame 1 > S Q E L R K T F K E I I C C Y P L G G L C D L S S R Y

PAGE 273

273 AP PENDIX C HISTOGRAMS OF FACS DATA Histogram statistics were calculated relative to the isotype control as background. M1 = No label and isotype control peaks. M2 = Surface and total expression, peak only. M3 = Surface and total expression peaks + low end. M 4 = Surface and total expression peaks + high and low ends. Color Key: Purple (filled) peak = No label

PAGE 274

274 Figure C 1. Flag hMC4R in HEK cells FACS histogram

PAGE 275

275 Figure C 2. F184A Flag hMC4R in HEK cells FACS histogram

PAGE 276

276 Figure C 3. F184A Flag hMC4R in HEK cells FACS histogram

PAGE 277

277 Figure C 4. F184K Flag hMC4R in HEK cells FACS histogram

PAGE 278

278 Figure C 5. F184K Flag hMC4R in HEK cells FACS histogram

PAGE 279

279 Figure C 6. F184S Flag hMC4R in HEK cells FACS histogram

PAGE 280

280 Figure C 7. F184S Flag hMC4R in HEK cells FACS h isto gram

PAGE 281

281 Figure C 8. F184Y Flag hMC4R in HEK cells FACS h istogram

PAGE 282

282 Figure C 9. F184Y Flag hMC4R in HEK cells FACS h istogram

PAGE 283

283 Figure C 10. F184W Flag hMC4R in HEK cells FACS h istogram

PAGE 284

284 Figure C 11. F184W Flag hMC4R in HEK cells FACS h istogram

PAGE 285

285 Figure C 12. Flag hMC4R in HEK cells FACS h istogram

PAGE 286

286 Figure C 13. Flag hMC4R in HEK cells FACS h istogram

PAGE 287

287 Figure C 14. F184A Flag hMC4R in HEK cells FACS h istogram

PAGE 288

288 Figure C 15. F184A Flag hMC4R in HEK cells FACS h istogram

PAGE 289

289 Figure C 16. F184H Flag hMC4R in HEK cells FACS h istogram

PAGE 290

290 Figure C 17. F184H Flag hMC4R in HEK cells FACS h istogram

PAGE 291

291 Figure C 18. F184K Flag hMC4R in HEK cells FACS h istogram

PAGE 292

292 Figure C 19. F184K Flag hMC4R in HEK cells FACS h istogram

PAGE 293

2 93 Figure C 20. F184S Flag hMC4R in HEK cells FACS h isto gram

PAGE 294

294 Figure C 21. F184S Flag hMC4R in HEK cells FACS h istogram

PAGE 295

295 Figure C 22. F184W Flag hMC4R in HEK cells FACS h istogram

PAGE 296

296 Figure C 23. F184W Flag hMC4R in HEK cells FACS h istogram

PAGE 297

297 Figure C 24. Flag hMC4R in HEK cells FACS h istogram

PAGE 298

298 Figure C 25. Fl ag hMC4R in HEK cells FACS h istogram

PAGE 299

299 Figure C 26. Flag hMC4R in HEK cells FACS h istogram

PAGE 300

300 Figure C 27. Flag hMC4R in HEK cells FACS h istogram

PAGE 301

301 Figure C 28. D189A Flag hMC4R in HEK cells FACS h istogram

PAGE 302

302 Figure C 29. D189A Flag hMC4R in HEK cells FACS h istogram

PAGE 303

303 Figure C 30. D189E Flag hMC4R in HEK cells FACS h istogram

PAGE 304

304 Figure C 31. D189K Flag hMC4R in HEK cells FACS h istogram

PAGE 305

305 Figure C 32. D189K Flag hMC4R in HEK cells FACS h istogram

PAGE 306

306 Figure C 33. D189N Flag hMC4R in HEK cells FACS h istogram

PAGE 307

307 Figu re C 34. D189N Flag hMC4R in HEK cells FACS h istogram

PAGE 308

308 Figure C 35. D189Q Flag hMC4R in HEK cells FACS h istogram

PAGE 309

309 Figure C 36. D189Q Flag hMC4R in HEK cells FACS h istogram

PAGE 310

310 Figure C 37. D189R Flag hMC4R in HEK cells FACS h istogram

PAGE 311

311 Figure C 38. D189R F lag hMC4R in HEK cells FACS h istogram

PAGE 312

312 Figure C 39. D189S Flag hMC4R in HEK cells FACS h istogram

PAGE 313

313 Figure C 40. D189S Flag hMC4R in HEK cells FACS h istogram

PAGE 314

314 Figure C 41. N123A Flag hMC4R in HEK cells FACS h istogram

PAGE 315

315 Figure C 42. N123A Flag hMC4R in HE K cells FACS h istogram

PAGE 316

316 Figure C 43. N123D Flag hMC4R in HEK cells FACS h istogram

PAGE 317

317 Figure C 44. N123D Flag hMC4R in HEK cells FACS h istogram

PAGE 318

318 Figure C 45. N123Q Flag hMC4R in HEK cells FACS h istogram

PAGE 319

319 Figure C 46. N123Q Flag hMC4R in HEK cells FACS h istogram

PAGE 320

320 Figure C 47. N123S Flag hMC4R in HEK cells FACS h istogram

PAGE 321

321 Figure C 48. N123S Flag hMC4R in HEK cells FACS h istogram

PAGE 322

322 Figure C 49. Flag hMC4R in HEK cells FACS h istogram

PAGE 323

323 Figure C 50. Flag hMC4R in HEK cells FACS h istogram

PAGE 324

324 Figure C 51. Flag hMC4R in HEK cells FACS h istogram

PAGE 325

325 Figure C 52. Flag hMC4R in HEK cells FACS h istogram

PAGE 326

326 Figure C 53. D189A Flag hMC4R in HEK cells FACS h istogram

PAGE 327

327 Figure C 54. D189A Flag hMC4R in HEK cells FACS h istogram

PAGE 328

328 Figure C 55. D189E Flag hMC4R in HEK c ells FACS h istogram

PAGE 329

329 Figure C 56. D189E Flag hMC4R in HEK cells FACS h istogram

PAGE 330

330 Figure C 57. D189K Flag hMC4R in HEK cells FACS h istogram

PAGE 331

331 Figure C 58. D189K Flag hMC4R in HEK cells FACS h istogram

PAGE 332

332 Figure C 59. D189N Flag hMC4R in HEK cells FACS h istog ram

PAGE 333

333 Figure C 60. D189N Flag hMC4R in HEK cells FACS h istogram

PAGE 334

334 Figure C 61. D189Q Flag hMC4R in HEK cells FACS h istogram

PAGE 335

335 Figure C 62. D189Q Flag hMC4R in HEK cells FACS h istogram

PAGE 336

336 Figure C 63. D189R Flag hMC4R in HEK cells FACS h istogram

PAGE 337

337 Figure C 6 4. D189R Flag hMC4R in HEK cells FACS h istogram

PAGE 338

338 Figure C 65. D189S Flag hMC4R in HEK cells FACS h istogram

PAGE 339

339 Figure C 66. D189S Flag hMC4R in HEK cells FACS h istogram

PAGE 340

340 Figure C 67. N123A Flag hMC4R in HEK cells FACS h istogram

PAGE 341

341 Figure C 68. N123A Flag h MC4R in HEK cells FACS h istogram

PAGE 342

342 Figure C 69. N123D Flag hMC4R in HEK cells FACS h istogram

PAGE 343

343 Figure C 70. N123D Flag hMC4R in HEK cells FACS h istogram

PAGE 344

344 Figure C 71. N123Q Flag hMC4R in HEK cells FACS h istogram

PAGE 345

345 Figure C 72. N123Q Flag hMC4R in HEK cell s FACS h istogram

PAGE 346

346 Figure C 73. N123S Flag hMC4R in HEK cells FACS h istogram

PAGE 347

347 Figure C 74. N123S Flag hMC4R in HEK cells FACS h istogram

PAGE 348

348 Figure C 75. Flag hMC4R in HEK cells FACS Histogram

PAGE 349

349 Figure C 76. Flag hMC4R in HEK cells FACS h istogram

PAGE 350

350 Figure C 77. Flag hMC4R in HEK cells FACS h istogram

PAGE 351

351 Figure C 78. Flag hMC4R in HEK cells FACS h istogram

PAGE 352

352 LIST OF REFERENCES (1) World Health Organization Obesity and overweight 2011. < http://www.who.int/mediacentre/factsheets/fs311/en/index .html> (2) Department of Health and Human Services, CDC. Overweight and Obesity 2011. (3) Reinehr, T.; Hebebrand, J.; Friedel, S.; Toschke, A. M.; Brumm, H. et al. Lifestyle Intervention in Obese Children With Variations in t he Melanocortin 4 Receptor Gene. Obesity. 2009 17 382 389. (4) Mokdad, A. H.; Serdula, M. K.; Dietz, W. H.; Bowman, B. A.; Marks, J. S. et al. The Spread of the Obesity Epidemic in the United States, 1991 1998. J. Ameri. Med. Assoc. 1999 282 1519 1522. (5) Butler, A. A.; Kesterson, R. A.; Khong, K.; al., e. A Unique Metabolic Syndrome Causes Obesity in the Melanocortin 3 Receptor Deficient Mouse. Endocrinology. 2000 141 3518 3521. (6) Vaisse, C.; Clement, K.; Guy Grand, B.; Froguel, P. A frameshift mu tation in human MC4R is associated with a dominant form of obesity. Nat. Genet. 1998 20 113 114. (7) Yeo, G. S.; Farooqi, I. S.; Aminian, S.; Halsall, D. J.; Stanhope, R. G. et al. Frameshift mutation in MC4R associated with dominantly inherited human ob esity Nat. Genet. 1998 20 111 112. (8) Huszar, D.; Lynch, C. A.; Fairchild Huntress, V.; Dunmore, J. H.; Smith, F. J. et al. Targeted disruption of the melanocortin 4 receptor results in obesity in mice. Cell 1997 88 131 141. (9) Chen, A. S.; Marsh, D. J.; Trumbauer, M. E.; al., e. Inactivation of the Mouse Melanocortin 3 Receptor Results in Increased Fat Mass and Reduced Lean Body Mass. Nat. Genet. 2000 26 97 102. (10) Fan, W.; Boston, B. A.; Kesterson, R. A.; Hruby, V. J.; Cone, R. D. Role of Melano cortinergic Neurons in Feeding and the Agouti Obesity Syndrome. Nature 1997 385 165 168. (11) Farooqi, I. S.; Yeo, G. S.; Keogh, J. M.; Aminian, S.; Jebb, S. A. et al. Dominant and recessive inheritance of morbid obesity associated with melanocortin 4 re ceptor deficiency. J Clin Invest 2000 106 271 279. (12) Krude, H.; Gruters, A. Implications of proopiomelanocortin (POMC) mutations in humans: the POMC deficiency syndrome. Trends Endocrinol. Metab. 2000 11 15 22.

PAGE 353

353 (13) Graham, M.; Shutter, J. R.; Sarmi ento, U.; Sarosi, I.; Stark, K. L. Overexpression of AGRT leads to obesity in transgenic mice. Nat. Genet. 1997 17 273 274. (14) Hruby, V. J.; Lu, D.; Sharma, S. D.; al., e. Cyclic Lactam Alpha Melanotropin Analogues of Ac Nle4 c[Asp5 DPhe7, Lys10] Alpha Melanocyte Stimulating Hormone (4 10) NH 2 with Bulky Aromatic Amino Acids at Position 7 Show High Antagonist Potency and Selectiviy at Specific Melanocortin Receptors. J. Med. Chem. 1995 38 3454 3461. (15) Greenfield, J. R.; Miller, J. W.; Keogh, J. M.; Henning, E.; Satterwhite, J. H. et al. Modulation of Blood Pressure by Central Melanocortinergic Pathways. N. Engl. J. Med 2009 360 44 52. (16) Farooqi, I. S.; Keogh, J. M.; Yeo, G. S.; Lank, E. J.; Cheetham, T. et al. Clinical spectrum of obesity and m utations in the melanocortin 4 receptor gene. N. Engl. J. Med. 2003 348 1085 1095. (17) Annu. Rev. Med 2005 56 443 458. (18) Krude, H.; Biebermann, H.; Gruters, A. Mutations in the Human Proopiome lanocortin Gene. Ann. NY. Acad. Sci. 2003 994 233 239. (19) Marsh, D. J.; G., H.; D.;, H.; R.;, L.; K.A.;, Y. et al. Response of Melanocortin 4 Receptor Deficient Mice to Anorectic and Orexigenic Peptides. Nat. Genet. 1999 21 119 122. (20) Ollmann, M. M.; Wilson, B. D.; Yang, Y. K.; al., e. Antagonism of Central Melanocortin Receptors In Vitro and In Vivo by Agouti Related Protein. Science 1997 278 135 138. (21) Rossi, M.; Kim, M. S.; Morgan, D. G. A.; Small, C. J.; Edwards, C. M. B. et al. A C termin al fragment of Agouti related protein increases feeding and antagonizes the effect of alpha melanocyte stimulating hormone in vivo. Endocrinology 1998 139 4428 4431. (22) Shutter, J. R.; Graham, M.; Kinsey, A. C.; Scully, S.; Luthy, R. et al. Hypothalami c Expression of ART, a novel gene related to agouti, is upregulated in obese and diabetic mutant mice. Genes Dev. 1997 11 593 602. (23) Tao, Y. X.; Segaloff, D. L. Functional Characterization of Melanocortin 3 Receptor Variants Identify a Loss of Functio n Mutation Involving an Amino Acid Critical for G Protein Coupled Receptor Activation. J. Clin. Endocrinol. Metab. 2004 89 3936 3942. (24) Vaisse C; Clement K; Durand E; Hercberg S; Guy Grand B et al. Melanocortin 4 receptor mutations are a frequent and heterogeneous cause of morbid obesity. J. Clin. Invest 2000 106 253 262.

PAGE 354

354 (25) Yaswen, L.; Diehl, N.; Brennan, M.; Hochgeschwender, U. Obesity in the Mouse Model of Proopiomelanocortin Deficiency Responds to Peripheral Melanocortin. Nat. Med. 1999 5 106 6 1070. (26) Yeo, G. S. H.; Lank, E. J.; Farooqi, I. S.; Keogh, J.; Challis, B. G. et al. Mutations in the human melanocortin 4 receptor gene associated with severe familial obesity disrupts receptor function through multiple molecular mechanisms. Human Mo lecular Genetics 2003 12 561 574. (27) Mountjoy, K. G.; Robbins, L. S.; Mortud, M. T.; Cone, R. D. The Cloning of a Family of Genes that Encode the Melanocortin Receptors. Science 1992 257 1248 1251. (28) Mountjoy, K. G.; Mortrud, M. T.; Low, M. J.; Si merly, R. B.; Cone, R. D. Localization of the Melanocortin 4 Receptor (MC4 R) in Neuroendocrine and Autonomic Control Circuits in the Brain. Mol. Endocrinology. 1994 8 1298 1308. (29) Mountjoy, K. G. The human melanocyte stimulating hormone receptor has evolved to become "super sensitive" to melanocortin peptides Mol. Cell. Endocrinol 1994 102 R7 11. (30) Pawelek, J. M. Factors regulating growth and pigmentation of melanoma cells. J. Invest. Dermatol. 1976 66 201 209. (31) Valverde, P.; Healy, E.; Jac kson, I.; Rees, J. L.; Thody, A. J. Variants of the melanocyte stimulating hormone receptor gene are associated with red hair and fair skin in humans. Nat. Genet. 1995 11 328 330. (32) Chen, M.; Aprahamian, C. J.; Celik, A.; Georgeson, K. E.; Garvey, W. T. et al. Characterization of Human Melanocortin 3 Receptor Ligand Receptor Interaction. Biochemistry 2006 45 1128 1137. (33) Chen, W.; Kelly, M. A.; Opitz Araya, X.; Thomas, R. E.; Low, M. J. et al. Exocrine Gland Dysfunction in MC5 R Deficient Mice: Ev idence for Coordinated Regulation of Exocrine Gland Function by Melanocortin Peptides. Cell 1997 91 789 798. (34) Chen, W. B.; Kelly, M. A.; Opitz Araya, X.; Thomas, R. E.; Low, M. J. et al. Evidence for coordinated regulation of exocrine gland function by melanocortin peptides. Cell 1997 91 789 798. (35) Gantz, I.; Konda, Y.; Tashiro, T.; al., e. Molecular Cloning of a Novel Melanocortin Receptor. J. Biol. Chem. 1993 268 8246 8250. (36) Gantz, I.; Miwa, H.; Konda, Y.; al., e. Molecular Cloning, Expre ssion, and Gene Localization of a Fourth Melanocortin Receptor. J. Biol. Chem. 1993 268 15174 15179.

PAGE 355

355 (37) Gantz, I.; Shimoto, Y.; Konda, Y.; al., e. Molecular Cloning, Expression, and Characterization of a Fifth Melanocortin Receptor. Biochem. Biophys. R es. Commun. 1994 200 1214 1220. (38) Gantz, I.; Konda, Y.; Tashiro, T.; Shimoto, Y.; Miwa, H. et al. Molecular cloning of a novel melanocortin receptor. J. Biol. Chem. 1993 268 8246 8250. (39) Gantz, I.; Miwa, H.; Konda, Y.; Shimoto, Y.; Tashiro, T. et al. Molecular Cloning, Expression, and Gene Localization of a Fourth Melanocortin Receptor. J. Biol. Chem. 1993 268 15174 15179. (40) Hadley, M. E. Discovery that a melanocortin regulates sexual functions in male and female humans. Peptides 2005 10 16 87 1689. (41) Van der Ploeg, L. H.; Martin, W. J.; Howard, A. D.; Nargund, R. P.; Austin, C. P. et al. A role for the melanocortin 4 receptor in sexual function. Proc. Natl. Acad. Sci. U. S. A. 2002 99 11381 11386. (42) Van der Kraan, M.; Adan, R. A. H.; Entwistle, M. L.; Gispen, W. H.; Burbach, J. P. H. et al. Expression of Melanocortin 5 Receptor in Secretory Epithelia Supports a Functional Role in Exocrine and Endocrine Glands. Endocrinology 1998 139 2348 2355. (43) Griffon, N.; Mignon, V.; Facchinet ti, P.; Diaz, J.; Schwartz, J. et al. Molecular Cloning and Characterization of the Rat Fifth Melanocortin Receptor. Biochem. Biophys. Res. Commun. 1994 200 1007 1014. (44) Chhajlani, V. Distribution of cDNA for Melanocortin Receptor Subtypes in Human Ti ssues. Biochem. Mol. Biol. Int. 1996 38 73 80. (45) Chhajlani, V.; Wikberg, J. E. Molecular Cloning and Expression of the Human Melanocyte Stimulating Hormone Receptor cDNA. FEBS. Lett. 1992 309 417 420. (46) Kishi, T.; Aschkenasi, C. J.; Lee, C. E.; M ountjoy, K. G.; Saper, C. B. et al. Expression of melanocortin 4 receptor mRNA in the central nervous system of the rat. J. Comp. Neurol. 2003 457 213 235. (47) Liu, H.; Kishi, T.; Roseberry, A. G.; Cai, X.; Lee, C. E. et al. Transgenic mice expressing g reen fluorescent protein under the control of the melanocortin 4 receptor promoter. J. Neurosci. 2003 23 7143 7154. (48) Roselli Rehfuss, L.; Mountjoy, K. G.; Robbins, L. S.; al., e. Identification of a Receptor for Gamma Melanotropin and other Propiomel anocortin Peptides in the Hypothalamus and Limbic System. Proc. Natl. Acad. Sci. USA. 1993 90 8856 8860.

PAGE 356

356 (49) Howard, A. D.; McAllister, G.; Feighner, S. D.; Liu, Q.; Nargund, R. P. et al. Orphan G protein coupled receptors and natural ligand discovery. Trends Pharmacol. Sci. 2001 22 132 140. (50) Gether, U. Uncovering molecular mechanisms involved in activation of G protein coupled receptors. Endocr. Rev. 2000 21 90 113. (51) Kobilka, B. K. G Protein Coupled Receptor Structure and Activation. Biochim et Biophys. Acta. 2007 1768 794 807. (52) Bockaert, J.; Pin, J. P. Molecular Tinkering of G Protein Coupled Receptors: An Evolutionary Success. Embo J. 1999 18 1723 1729. (53) Unger, V. M.; Hargrave, P. A.; Baldwin, J. M.; Schertler, G. F. Arrangemen t of rhodopsin transmembrane alpha helices. Nature 1997 389 203 206. (54) Lagerstrom, M. C.; Schioth, H. B. Structural Diversity of G Protein Coupled Receptors and Significance for Drug Discovery. Nature Reviews 2008 7 339 357. (55) Lu, D.; Vage, D. I. ; Cone, R. D. A Ligand Mimetic Model for Constitutive Activation of the Melanocortin 1 Receptor. Mol. Endo. 1998 12 592 604. (56) Lu, D.; Willard, D.; Patel, I. R.; Kadwell, S.; Overton, L. et al. Agouti Protein is an Antagonist of the Melanocyte Stimula ting Hormone Receptor. Nature 1994 371 799 802. (57) Riniker, B.; Sieber, P.; Rittel, W.; Zuber, H. Revised amino acid sequences for porcine and human adrenocorticotrophic hormone. Nat. New. Biol. 1972 235 114 115. (58) Catania, A.; Lipton, J. M. The n europeptide alpha melanocyte stimulating hormone: a key component of neuroimmunomodulation. Neuroimmunomodulation 1994 1 93 99. (59) Halkerston, I. D. Cyclic AMP and adrenocortical function. Adv. Cyclic Nucleotide Res. 1975 6 99 136. (60) Boston, B. A. ; Cone, R. D. Characterization of melanocortin receptor subtype expression in murine adipose tissues and in the 3T3 L1 cell line. Endocrinology 1996 137 2043 2050. (61) Grunfeld, C.; Hagman, J.; Sabin, E. A.; Buckley, D. I.; Jones, D. S. et al. Character ization of adrenocorticotropin receptors that appear when 3T3 L1 cells differentiate into adipocytes. Endocrinology 1985 116 113 117.

PAGE 357

357 (62) Schioth, H. B.; Chhanjlani, V.; Muceniece, R.; Klusa, V.; Wikberg, J. E. Major Pharmaceutical Distinction of the AC TH Receptor from other Melanocortin Receptors. Life Sci. 1996 59 797 801. (63) Tsigos, C.; Arai, K.; Hung, W.; Chrousos, G. P. Hereditary isolated glucocorticoid deficiency is associated with abnormalities of the adrenocorticotropin receptor gene. J. Cli n. Invest 1993 92 2458 2461. (64) Tsigos, C.; Arai, K.; Latronico, A. C.; DiGeorge, A. M.; Rapaport, R. et al. A novel mutation of the adrenocorticotropin receptor (ACTH R) gene in a family with the syndrome of isolated glucocorticoid deficiency, but no ACTH R abnormalities in two families with the triple A syndrome. J. Clin. Endocrinol. Metab. 1995 80 2186 2189. (65) Weber, A.; Toppari, J.; Harvey, R. D.; Klann, R. C.; Shaw, N. J. et al. Adrenocorticotropin receptor gene mutations in familial glucocort icoid deficiency: relationships with clinical features in four families. J. Clin. Endocrinol. Metab. 1995 80 65 71. (66) Wu, S. M., Stratakis, C. A., Chan, C. H., Hallermeier, K. M., Bourdony, C. J. et al. Genetic heterogeneity of adrenocorticotropin (AC TH) resistance syndromes: Identification of a novel mutation of the ACTH receptor gene in hereditary glucocorticoid deficiency. Mol Genet Metab 1998 64 256 265. (67) Naville, D.; Barjhoux, L.; Jaillard, C.; Faury, D.; Despert, F. et al. Demonstration by transfection studies that mutations in the adrenocorticotropin receptor gene are one cause of the hereditary syndrome of glucocorticoid deficiency. J. Clin. Endocrinol. Metab. 1996 81 1442 1448. (68) Sebag, J. A.; Hinkle, P. M. Opposite Effects of the Me lanocortin 2 (MC2) Receptor Accessory Protein MRAP on MC2 and MC5 Receptor Dimerization and Trafficking. J. Biol. Chem. 2009 284 22641 22648. (69) Cooray, S. N.; Clark, A. J. L. Melanocortin receptors and their accessory proteins. Mol. Cell. Endocrinol. 2010 331 215 221. (70) Cooray, S. N.; Almiro Do Vale, I.; Leung, K. Y.; Webb, T. R.; Chapple, J. P. et al. The melanocortin 2 receptor accessory protein exists as a homodimer and is essential for the function of the melanocortin 2 receptor in the mouse y 1 cell line. Endocrinology 2008 149 1935 1941. (71) Benoit, S. C.; Schwartz, M. W.; Lachey, J. L.; Hagan, M. M.; Rushiong, P. A. et al. A Novel Selective Melanocortin 4 Receptor Agonist Reduces Food Intake in Rats and Mice Without Producing Aversive Cons equences. J. Neurosci. 2000 20 3442.

PAGE 358

358 (72) Schioth, H. B.; Muceniece, R.; Mutulis, F.; Bouifrouri, A.; Mutule, I. et al. Further Pharmacological Characterization of the Selective Melanocortin 4 Receptor Antagonist HS014: Comparison with SHU9119. Neurope ptides 1999 33 191 196. (73) Hadley, M. E.; Haskell Luevano, C. The Proopiomelanocortin System. Ann. N. Y. Acad. Sci. 1999 885 1 21. (74) Eipper, B. A.; Mains, R. E. Analysis of the common precursor to corticotropin and endorphin. J. Biol. Chem. 1978 253 5732 5744. (75) Mains, R. E.; Eipper, B. A. Biosynthesis of adrenocorticotropic hormone in mouse pituitary tumor cells. J. Biol. Chem. 1976 251 4115 4120. (76) Rosa, P. A.; Policastro, P.; Herbert, E. A cellular basis for the differences in regulati on of synthesis and secretion of ACTH/endorphin peptides in anterior and intermediate lobes of the pituitary. J. Exp. Biol. 1980 89 215 237. (77) Hruby, V. J.; Wilkes, B. C.; Hadley, M. E.; al., e. Alpha Melanotropin: The Minimal Active Sequence in the F rog Skin Bioassay. J. Med. Chem. 1987 30 2126 2130. (78) Castrucci, A. M.; Hadley, M. E.; Sawyer, T. K.; Wilkes, B. C.; Al Obeidi, F. et al. Alpha melanotropin: the minimal active sequence in the lizard skin bioassay. Gen. Comp. Endocrinol. 1989 73 157 163. (79) Haskell Luevano, C.; Sawyer, T. K.; Hendrata, S.; North, C.; Panahinia, L. et al. Truncation studies of alpha melanotropin peptides identify tripeptide analogues exhibiting prolonged agonist bioactivity. Peptides 1996 17 995 1002. (80) Haskell Luevano, C.; Holder J.R.; Monck, E. K.; al., e. Characterization of melanocortin NDP MSH agonist peptide fragments at the mouse central and peripheral melanocortin receptors. J. Med. Chem. 2001 44 2247 2252. (81) Harris, J. I.; Lerner, A. B. Amino acid sequence of the alpha melanocyte stimulating hormone. Nature 1957 179 1346 1347. (82) Gianoulakis, C.; Seidah, N. G.; Routhier, R.; Chretien, M. Biosynthesis and characterization of adrenocorticotropic hormone, alpha melanocyte stimulating hormone, and a n NH 2 terminal fragment of the adrenocorticotropic hormone/beta lipotropin precursor from rat pars intermedia. J. Biol. Chem. 1979 254 11903 11906. (83) Irani, B. G.; Holder, J. R.; Todorovic, A.; Wilczynski, A. M.; Joseph, C. G. et al. Progress in the d evelopment of melanocortin receptor selective ligands. Curr. Pharm. Des. 2004 10 3443 3479.

PAGE 359

359 (84) Sahm, U. G.; Olivier, G. W.; Branch, S. K.; Moss, S. H.; Pouton, C. W. Synthesis and biological evaluation of alpha MSH analogues substituted with alanine. P eptides 1994 15 1297 1302. (85) Hruby, V. J.; Wilkes, B. C.; Cody, W. L.; Sawyer, T. K.; Hadley, M. E. Melanotropins: Structural, Conformational and Biological Considerations in the Development of Superpotent and Superprolonged Analogs. Peptide Protein Rev. 1984 3 1 64. (86) Hruby, V. J.; Mosberg, H. I. Conformational and Dynamic Considerations in Peptide Structure Function Studies. Peptides 1982 3 329 336. (87) Haslach, E., Schaub, J.W., Haskell Luevano, C. Beta Turn Secondary Structure and Melancor tin Ligands. Bioorg. Med Chem 2009, 17 952 958. (88) Holder, J. R.; Bauzo, R. M.; Xiang, Z.; Haskell Luevano, C. Structure Activity Relationships of the Melanocortin Tetrapeptide Ac His DPhe Arg Trp NH 2 at the Mouse Melanocortin Receptors: Part Two Modifi cations at the Phe Position. J. Med. Chem. 2002 45 3073 3081. (89) Holder, J. R.; Bauzo, R. M.; Xiang, Z.; Haskell Luevano, C. Structure Activity Relationships of the Melanocortin Tetrapeptide Ac His DPhe Arg Trp NH 2 at the Mouse Melanocortin Receptors: Modifications at the His Position. J. Med. Chem. 2002 45 2801 2810. (90) Holder, J. R.; Xiang, Z.; Bauzo, R. M.; Haskell Luevano, C. Structure Activity Relationships of the Melanocortin Tetrapeptide Ac His DPhe Arg Trp NH 2 at the Mouse Melanocortin Recep tors: Modifications at the Trp Position. J. Medicinal Chemistry 2003 45 5736 5744. (91) Holder, J. R.; Xiang, Z.; Bauzo, R. M.; Haskell Luevano, C. Structure Activity Relationships of the Melanocortin Tetrapeptide Ac His DPhe Arg Trp NH 2 at the Mouse Mel anocortin Receptors. Part 3: Modifications at the Arg Position. Peptides 2003 24 73 82. (92) Proneth, B.; Pogozheva, I. D.; Portillo, F. P.; Mosberg, H. I.; Haskell Luevano, C. Melanocortin tetrapeptide Ac His DPhe Arg Trp NH 2 modified at the para positi on of the benzyl side chain (DPhe): importance for mouse melanocortin 3 receptor agonist versus antagonist activity. J. Med. Chem. 2008 51 5585 5593. (93) Sawyer, T. K.; Hruby, V. J.; Darman, P. S.; Hadley, M. E. [half Cys4,half Cys10] alpha Melanocyte s timulating hormone: a cyclic alpha melanotropin exhibiting superagonist biological activity. Proc. Natl. Acad. Sci. U. S. A. 1982 79 1751 1755.

PAGE 360

360 (94) Sawyer, T. K.; Sanfilippo, P. J.; Hruby, V. J.; Engel, M. H.; Heward, C. B. et al. 4 Norleucine, 7 D ph enylalanine alpha melanocyte stimulating hormone: a highly potent alpha melanotropin with ultralong biological activity. Proc. Natl. Acad. Sci. U. S. A. 1980 77 5754 5758. (95) Sawyer, T. K.; Hruby, V. J.; Wilkes, B. C.; Draelos, M. T.; Hadley, M. E. et al. Comparative biological activities of highly potent active site analogues of alpha melanotropin. J. Med. Chem. 1982 25 1022 1027. (96) Bertagna, X.; Lenne, F.; Comar, D.; Massias, J. F.; Wajcman, H. et al. Human beta melanocyte stimulating hormone rev isited. Proc. Natl. Acad. Sci. U. S. A. 1986 83 9719 9723. (97) Harrold, J. A.; Widdowson, P. S.; Williams, G. Beta MSH: a functional ligand that regulated energy homeostasis via hypothalamic MC4 R? Peptides 2003 24 397 405. (98) Van Strien, F. J.; Dev reese, B.; Van Beeumen, J.; Roubos, E. W.; Jenks, B. G. Biosynthesis and processing of the N terminal part of proopiomelanocortin in Xenopus laevis: characterization of gamma MSH peptides. J. Neuroendocrinol. 1995 7 807 815. (99) Bloom, F. E.; Battenberg E. L.; Shibasaki, T.; Benoit, R.; Ling, N. et al. Localization of gamma melanocyte stimulating hormone (gamma MSH) immunoreactivity in rat brain and pituitary. Regul. Pept. 1980 1 205 222. (100) Haskell Luevano, C.; Todorovic, A.; Gridley, K.; Sorenson N.; Irani, B. et al. The melanocortin pathway: effects of voluntary exercise on the melanocortin 4 receptor knockout mice and ACTH(1 24) ligand structure activity relationships at the melanocortin 2 receptor. Endocr. Res. 2004 30 591 597. (101) Al Obei di, F.; Castrucci, A. M.; Hadley, M. E.; Hruby, V. J. Potent and prolonged acting cyclic lactam analogues of alpha melanotropin: design based on molecular dynamics. J. Med. Chem. 1989 32 2555 2561. (102) Al Obeidi, F.; Hruby, V. J.; Castrucci, A. M.; Had ley, M. E. Design of potent linear alpha melanotropin 4 10 analogues modified in positions 5 and 10. J. Med. Chem. 1989 32 174 179. (103) Al Obeidi, F.; O'Connor, S. D.; Job, C.; Hruby, V. J.; Pettitt, B. M. NMR and quenched molecular dynamics studies of superpotent linear and cyclic alpha melanotropins. J. Pept. Res. 1998 51 420 431. (104) Al Obeidi, F.; Hadley, M. E.; Pettitt, B. M.; Hruby, V. J. Design of a New Class of Superpotent Cyclic alpha Melanotropins Based on Quenched Dynamic Simulations. J. Am. Chem. Soc. 1989 111 3413 3416.

PAGE 361

361 (105) Hruby, V. J. Conformational restrictions of biologically active peptides via amino acid side chain groups. Life Sci. 1982 31 189 199. (106) Holder, J. R.; Haskell Luevano, C. Melanocortin ligands: 30 years of st ructure activity relationship (SAR) studies. Med. Res. Rev. 2004 24 325 356. (107) Wilczynski, A.; Wang, X. S.; Bauzo, R. M.; Xiang, Z.; Shaw, A. M. et al. Structural Characterization and Pharmacology of a Potent (Cys101 Cys119, Cys110 Cys117) Bicyclic A gouti Related Protein (AGRP) Melanocortin Receptor Antagonist. J. Med. Chem. 2004 47 5662 5673. (108) McNulty, J. C.; Jackson, P. J.; Thompson, D. A.; Chai, B.; Gantz, I. et al. Structures of the agouti signaling protein. J. Mol. Biol. 2005 346 1059 10 70. (109) Bultman, S. J.; Michaud, E. J.; Woychik, R. P. Molecular characterization of the mouse agouti locus. Cell 1992 71 1195 1204. (110) Haskell Luevano, C.; Monck, E. K. Agouti Related Protein Functions as an Inverse Agonist at a Constitutively Acti ve Brain Melanocortin 4 Receptor. Regul. Pept. 2001 99 1 7. (111) Nijenhuis, W. A.; Oosterom, J.; Adan, R. A. AgRP(87 132) acts as an Inverse Agonist on the Human Melanocortin 4 Receptor. Mol. Endocrinol. 2001 15 164 171. (112) McNulty, J. C.; Thompson D. A.; Bolin, K. A.; Wilken, J.; Barsh, G. S. et al. High Resolution NMR Structure of the Chemically Synthesized Melanocortin Receptor Binding Domain AGRP(87 132) of the Agouti Related Protein. Biochemistry 2001 40 15520 15527. (113) Tota, M. R.; Smith T. S.; Mao, C.; MacNeil, T.; Mosley, R. T. et al. Molecular Interaction of Agouti Protein and Agouti Related Protein with Human Melanocortin Receptors. Biochemistry. 1999 38 897 904. (114) Wilczynski, A.; Joseph, C. G.; Haskell Luevano, C. Current Tren ds in the Structure Activity Relationship Studies of Endogenous Agouti Related Protein (AGRP) Melanocortin Receptor Antagonist. Med. Res. Rev. 2005 25 545 556. (115) Joseph, C. G.; Wilczynski, A.; Holder, J. R.; Xiang, Z.; Bauzo, R. M. et al. Chimeric ND P MSH and MTII melanocortin peptides with agouti related protein (AGRP) Arg Phe Phe amino acids possess agonist melanocortin receptor activity. Peptides 2003 24 1899 1908. (116) Wilczynski, A.; Wang, X. S.; Joseph, C. G.; Xiang, Z.; Bauzo, R. M. et al. I dentification of Putative Agouti Related Protein (87 132) Melanocortin 4 Receptor Interactions by Homology Molecular Modeling and Validation Using Chimeric Peptide Ligands. J. Med. Chem. 2004 47 2194 2207.

PAGE 362

362 (117) Xiang, Z.; Litherland, S. A.; Sorensen, N. B.; Proneth, B.; Wood, M. S. et al. Pharmacological characterization of 40 human melanocortin 4 receptor polymorphisms with the endogenous proopiomelanocortin derived agonists and the agouti related protein (AGRP) antagonist. Biochemistry 2006 45 7277 7 288. (118) Hinney, A.; Hohmann S; Geller F; Vogel C; Hess C et al. Melanocortin 4 receptor gene: case control study and transmission disequilibrium test confirm that functionally relevant mutations are compatible with a major gene effect for extreme obesit y. J. Clin. Endocrinol. Metab. 2003 88 4258 4267. (119) Vaisse, C.; Clement K; Durand E; Hercberg S; Guy Grand B et al. Melanocortin 4 receptor mutations are a frequent and heterogeneous cause of morbid obesity. J. Clin. Invest. 2000 106 253 262. (120) Vaisse, C.; Clement, K.; Durand, E.; Hercberg, S.; Guy Grand, B. et al. Melanocortin 4 receptor mutations are a frequent and heterogeneous cause of morbid obesity. J Clin Invest 2000 106 253 262. (121) Xiang, Z.; Proneth, B.; Dirain, M. L.; Litherland, S. A.; Haskell Luevano, C. Pharmacological Characterization of 30 Human Melanocortin 4 Receptor Polymorphisms with the Endogenous Proopiomelanocortin Derived Agonists, Synthetic Agonists, and the Endogenous Agouti Related Protein Antagonist. Biochemistry 2 010 49 4583 4600. (122) Xiang, Z.; Pogozheva, I. D.; Sorenson, N. B.; Wilczynski, A. M.; Holder, J. R. et al. Peptide and small molecules rescue the functional activity and agonist potency of dysfunctional human melanocortin 4 receptor polymorphisms. Bio chemistry 2007 46 8273 8287. (123) Yurtuc, E.; Yilmaz, A.; Ozkurt, Z.; Kolukisa, E.; Yilmaz, M. et al. Melanocortin 4 Receptor Gene Polymorphisms in Obese Patients. Biochem. Genet. 2009 47 295 300. (124) Hinney, A.; Remschmidt, H.; Hebebrand, J. Candid ate gene polymorphisms in eating disorders. Eur. J. Pharmacol 2000 410 147 159. (125) Hinney, A.; Schmidt, A.; Nottebom, K.; Heibult, O.; Becker, I. et al. Several mutations in the melanocortin 4 receptor gene including a nonsense and a frameshift mutati on associated with dominantly inherited obesity in humans. J. Clin. Endocrinol. Metab 1999 84 1483 1486. (126) Mergen, M.; Mergen, H.; Ozata, M.; Oner, R.; Oner, C. Rapid communication: a novel melanocortin 4 receptor (MC4R) gene mutation associated with morbid obesity. J. Clin. Endocrinol. Metab. 2001 86 3448 3451. (127) Gu, W.; Tu, Z.; Kleyn, P. W.; Kissebah, A.; Duprat, L. et al. Identification and functional analysis of novel human melanocortin 4 receptor variants. Diabetes 1999 48 635 639.

PAGE 363

363 (128) Dubern, B.; Clement, K.; Pelloux, V.; Froguel, P.; Girardet, J. P. et al. Mutational analysis of melanocortin 4 receptor, agouti related protein, and a melanocytestimulating hormone genes in severely obese children. J. Pediatr. 2001 139 204 209. (129) Sa ntini, F.; Maffei, M.; Ceccarini, G.; Pelosini, C.; Scartabelli, G. et al. Genetic screening for melanocortin 4 receptor mutations in a cohort of italian obese patients: description and functional characterization of a novel mutation. J. Clin. Endocrinol. Metab. 2004 89 904 908. (130) Larsen, L. H.; Echwald, S. M.; Sorensen, T. I.; Andersen, T.; Wulff, B. S. et al. Prevalence of mutations and functional analyses of melanocortin 4 receptor variants identified among 750 men with juvenile onset obesity. J. C lin. Endocrinol. Metab. 2005 90 219 224. (131) Tallam, L. S.; Kuo, J. J.; da Silva, A. A.; Hall, J. E. Cardiovascular, Renal and Metabolic Responses to Chronic Central Administration of Agouti Related Peptide. Hypertension 2004 44 853 858. (132) Tallam L. S.; Stec, D. E.; Willis, M. A.; da Silva, A. A.; Hall, J. E. Melanocortin 4 receptor deficient mice are not hypertensive or salt sensitive despite obesity, hyperinsulinemia, and hyperleptinemia. Hypertension 2005 46 326 332. (133) Chen, W.; Shields, T. S.; Stork, P. J. S.; Cone, R. D. A Colorimetric Assay for Measuring Activation of G s and G q Coupled Signaling Pathways. Anal. Biochem. 1995 226 349 354. (134) Joseph, C. G.; Wang, X. S.; Scott, J. W.; Bauzo, R. M.; Xiang, Z. et al. Stereochemical S tudies of the Monocyclic Agouti Related Protein (103 122) Arg Phe Phe Residues: Conversion of a Melanocortin 4 Receptor Antagonist into an Agonist and Results in the Discovery of a Potent and Selective Melanocortin 1 Agonist. J. Med. Chem. 2004 47 6702 6 710. (135) Chai, B. X.; Pogozheva, I. D.; Lai, Y. M.; Li, J. Y.; Neubig, R. R. et al. Receptor antagonist interactions in the complexes of agouti and agouti related protein with human melanocortin 1 and 4 receptors. Biochemistry 2005 44 3418 3431. (136) Haskell Luevano, C.; Cone, R. D.; Monck, E. K.; Wan, Y. P. Structure Activity Studies of the Melanocortin 4 Receptor by in Vitro Mutagenesis: Identification of Agouti Related Protein (AGRP), Melanocortin Agonist and Synthetic Peptide Antagonist Interaction Determinants. Biochemistry. 2001 40 6164 6179. (137) Haskell Luevano, C.; Sawyer, T. K.; Trumpp Kallmeyer, S.; Bikker, J.; Humblet, C. et al. Three Dimensional Molecular Models of the hMC1R Melanocortin Receptor:Complexes with Melanotropin Peptide Agoni sts. Drug Des. Discovery 1996 14 197 211.

PAGE 364

364 (138) Hogan, K.; Peluso, S.; Gould, S.; Parsons, I.; Ryan, D. et al. Mapping the Binding Site of Melanocortin 4 Receptor Agonists: A Hydrophobic Pocket Formed by I3.28(125), I3.32(129), and I7.42(291) is Critical for Receptor Activation. J. Med. Chem. 2006 49 911 922. (139) Pogozheva, I. D.; Chai, B. X.; Lomize, A. L.; Fong, T. M.; Weinberg, D. H. et al. Interactions of Human Melanocortin 4 Receptor with Nonpeptide and Peptide Agonists. Biochemistry 2005 44 11 329 11341. (140) Yang, Y. K.; Fong, T. M.; Dickinson, C. J.; Mao, C.; Li, J. Y. et al. Molecular Determinants of Ligand Binding to the Human Melanocortin 4 Receptor. Biochemistry. 2000 39 14900 14911. (141) Bromberg, Y.; Overton, J.; Vaisse, C.; Leibel, R. L.; Rost, B. In silico mutagenesis: a case study of the melanocortin 4 receptor. FASEB 2009 23 1 11. (142) Bromberg, Y.; Rost, B. SNAP: predict effect of non synonymous polymorphisms on function. Nucleic Acids Res. 2007 35 3823 3835. (143) Houghten, R. A.; Wilson, D. B.; Pinilla, C. Drug discovery and vaccine development using mixture based synthetic combinatorial libraries. Drug Discovery Today 2000 7 276 285. (144) Merrifield, R. B. Solid Phase Peptide Synthesis.1 The Synthesis of a Tetrapeptide. Journal Am. Chem. Soc. 1963 85 2149 2154. (145) Houghten, R. A. General method for the rapid solid phase synthesis of large numbers of peptides: Specificity of antigen antibody interaction at the level of individual amino acids. Proc. Natl. Acad. Sci. U .S.A. 1985 82 5131 5135. (146) Geysen, H. M.; Meloen, R. H.; Barteling, S. J. Use of peptide synthesis to probe viral antigens for epitopes to a resolution of a single amino acid. Proc. Natl. Acad. Sci. U.S.A. 1984 81 3998 4002. (147) Stewart, J., Youn g, J.D. Solid Phase Peptide Synthesis 2nd ed.; Pierce Chemical Co. : Rockford, IL, 1984. (148) Lam, K. S.; Salmon, S. E.; Hersh, E. M.; Hruby, V. J.; Kazmierski, W. M. et al. A new type of synthetic peptide library for identifying ligand binding activity. Nature 1991 354 82 84. (149) Houghten, R. A.; Pinilla, C.; Blondelle, S. E.; Appel, J. R.; Dooley, C. T. et al. Generation and use of synthetic peptide combinatorial libraries for basic research and drug discovery. Nature 1991 354 84 86.

PAGE 365

365 (150) Kerr, J. M.; Banville, S. C.; Zuckermann, R. N. Encoded combinatorial peptide libraries containing nonnatural amino acids. J. Am. Chem. Soc. 1993 115 2529 2531. (151) Merrifield, R. B. Solid Phase Peptide Synthesis 4. Synthesis of Methionyl Lysyl Bradykinin. J. Org. Chem 1964 29 3100 3102. (152) Merrifield, R. B. Solid Phase Peptide Synthesis 2. Synthesis of Bradykinin. J. Am. Chem. Soc. 1964 86 304 305. (153) Merrifield, R. B. Solid Phase Peptide Synthesis. 3. An Improved Synthesis of Bradykinin. Biochemistr y 1964 3 1385 1390. (154) Carpino, L.; Han, G. The 9 fluorenylmethoyxcarbonsy amino protecting group. J. Org. Chem 1972 37 3404 3409. (155) Yu, H. M.; Chen, S. T.; Wang, K. T. Enhanced Coupling Efficiency in Solid Phase Peptide Synthesis by Microwave I rradiation. J. Org. Chem 1992 57 4781 4784. (156) Bacsa, B.; Horvti, K.; Bsze, S.; Andreae, F.; Kappe, C. O. Solid phase synthesis of difficult peptide sequences at elevated temperatures: a critical comparison of microwave and conventional heating tech nologies. J. Org. Chem 2008 3 7532 7542. (157) Erdelyi, M.; Gogoll, A. Rapid Microwave Assisted Solid Phase Peptide Synthesis. Synthesis 2002 11 1592 1596. (158) Pedersen, S. L.; Srensen, K. K.; Jensen, K. J. Semi automated microwave assisted SPPS: Op timization of protocols and synthesis of difficult sequences. Biopolymers 2010 94 206 212. (159) Katritzky, A. R.; Khashab, N. M.; Yoshioka, M.; Haase, D. N.; Wilson, K. R. et al. Microwave assisted solid phase peptide synthesis utilizing N Fmoc protecte d (alpha aminoacyl)benzotriazoles. Chem. Biol. Drug Des. 2007 70 465 468. (160) Gorske, B. C.; Jewell, S. A.; Guerard, E. J.; Blackwell, H. E. Expedient synthesis and design strategies for new peptoid construction. Org. Lett. 2005 7 1521 1524. (161) Ma tsushita, T.; Hinou, H.; Fumoto, M.; Kurogochi, M.; Fujitani, N. et al. Construction of highly glycosylated mucin type glycopeptides based on microwave assisted solid phase syntheses and enzymatic modifications J. Org. Chem 2006 71 3051 3063. (162) Loff redo, C.; Assuncao, N. A.; Gerhardt, J.; Miranda, M. T. M. Microwave assisted solid phase peptide synthesis at 60 C: alternative conditions with low enantiomerization. J. Pept. Sci 2009 15 808 817.

PAGE 366

366 (163) Rink, H. Solid phase synthesis of protected peptid e fragments using a trialkoxy diphenylmethylester resin. Tetrahedron Letters 1987 28 3787 3790. (164) Wang, S. S. p alkoxybenzyl alcohol resin and p alkoxybenzyloxycarbonylhydrazide resin for solid phase synthesis of protected peptide fragments. J. Am. C hem. Soc. 1973 95 1328 1333. (165) Hoekstra, W. J.; Greco, M. N.; Yabut, S. C.; Hulshizer, B. L.; Maryanoff, B. E. Solid Phase Synthesis via N Terminal Attachment to the 2 Chlorotrityl Resin. Tetrahedron Lett. 1997 38 2629 2632. (166) Khorana, H. G. Th e Chemistry of Carbodiimides. Chem. Rev. 1953 53 145 166. (167) Barstow, L. E.; Hruby, V. J. Simple Method for Synthesis of Amides. J. Org. Chem. 1971 36 1305 1306. (168) Bates, A. J.; Galpin, I. J.; Hallett, A.; Hudson, D.; Kenner, G. W. et al. A new reagent for polypeptide synthesis: mu oxo bis (tris (dimethylamino) phosphonium) bistetrafluoroborate. Helv. Chim. Acta. 1975 58 688 696. (169) Carpino, L. A. 1 Hydroxy 7 azabenzotriazole. An efficient peptide coupling additive. J. Am. Chem. Soc. 1993 1 15 4397 4398. (170) Coste, J. C. Esterification of Carboxylic Acids Using Bop or Pybop. Tetrahedron Letters 1995 36 4235 4256. (171) Gawne, G.; Kenner, G. W.; Sheppard, R. C. Acyloxyphosphonium salts as acylating agents. Synthesis of peptides. J. Am. Chem. Soc. 1991 91 5669 5671. (172) Beyermann, M.; Henklein, P.; Klose, A.; Sohr, R.; Bienert, M. Effect of tertiary amine on the carbodiimide mediated peptide synthesis. Int. J. Pept. Protein Res. 1991 37 252 256. (173) Kim, M. H.; Patel, D. V. "BOP" as a reagent for mild and efficient preparation of esters. Tetrahedron Letters 1994 35 5603 5606. (174) Coste, J.; Le Nguyen, D.; Castro, B. PyBOP(R): A new peptide coupling reagent devoid of toxic by product. Tetrahedron Letters 1990 31 205 208. (175) Coste, J.; Dufour, M. N.; Pantaloni, A.; Castro, B. Brop: A new reagent for coupling N methylated amino acids. Tetrahedron Letters 1990 31 669 672. (176) Knorr, R.; Trzeciak, A.; Bannwarth, W.; Gillessen, D. New coupling reagents in peptide chemistry. T etrahedron Letters 1989 30 1927 1930.

PAGE 367

367 (177) Kaiser, E. C.; Bossinger, C. D.; Cook, P. I. Color Test for Detection of Free Terminal Amino Groups in the Solid Phase Synthesis of Peptides. Anal. Biochem. 1970 34 595 598. (178) Christensen, T. Qualitative Test for Monitoring Coupling Completeness in Solid Phase Peptide Synthesis Using Chloranil. Acta. Chem. Scand. B Organic Chemistry and Biochemistry 1979 33 763 766. (179) Veber, D.; Milkowski, J. D.; Varga, S. L.; Denkewalter, R. G.; Hirshmann, R. A Nov el Thiol Protecting Group for Cysteine. J. Am. Chem. Soc. 1972 94 5456 5461. (180) McIlhinney, R. Generation and use of epitope tagged receptors. Methods Mol. Biol. 2004 259 81 98. (181) Nathans, J.; Hogness, D. S. Isolation, sequence analysis, and int ron exon arrangement of the gene encoding bovine rhodopsin. Cell 1983 34 807 814. (182) Lefkowitz, R. J. Historical review: a brief history and personal retrospective of seven transmembrane receptors. Trends Pharmacol. Sci. 2004 25 413 422. (183) Dixon R. A.; Kobilka, B. K.; Strader, D. J.; Benovic, J. L.; Dohlman, H. G. et al. Cloning of the gene and cDNA for mammalian beta adrenergic receptor and homology with rhodopsin. Nature 1986 321 75 79. (184) Palczewski, K.; Kumasaka, T.; Hori, T.; Behnke, C A.; Motoshima, H. et al. Crystal structure of rhodopsin: A G protein coupled receptor. Science 2000 289 739 745. (185) Scheerer, P.; Park, J. H.; Hildebrand, P. W.; Kim, Y. J.; Krauss, N. et al. Crystal Structure of Opsin in its G protein Interacting C onformation. Nature 2008 455 497 502. (186) Rasmussen, S. G.; Choi, H. J.; Fung, J. J.; Pardon, E.; Casarosa, P. et al. Structure of a nanobody Nature 2011 469 175 180. (187) Rasmussen, S. G. F.; Choi, H. J.; Rosenbaum, D. M.; Kobilka, T. S., T; hian, F. S. et al. Crystal structure of the human 2 adrenergic G protein coupled receptor. Nature 2007 450 383 388. (188) Rosenbaum, D. M.; Cherezov, V.; Hanson, M. A.; Rasmussen, S. G.; Thian, F. S. et al. G PCR engineering yields high resolution structural insights into 2 adrenergic receptor function Science 2007 318 1266 1273. (189) McDowel, J. H.; Nawrocki, J. P.; Hargrave, P. A. Phosphorylation Sites in Bovine Rhodopsin. Biochemistry 1993 32 4968 4974

PAGE 368

368 (190) Irani, B. G.; Haskell Luevano, C. Feeding effects of melanocortin ligands -a historical perspective. Peptides 2005 26 1788 1799. (191) Wilson, K. R.; Todorovic, A.; Proneth, B.; Haskell Luevano, C. Overview of endogenous and synthetic melanocorti n peptides. Cell. Mol. Biol. 2006 52 3 20. (192) Webb, T. R.; Clark, A. J. Minireview: the melanocortin 2 receptor accessory proteins. Mol. Endocrinol. 2010 24 475 484. (193) Roubert, P.; Dubern, B.; Plas, P.; Lubrano Berthelier, C.; Alihi, R. et al. N ovel pharmacological MC4R agonists can efficiently activate mutated MC4R from obese patient with impaired endogenous agonist response. J. Endocrinology 2010 207 177 183. (194) Chai, B. X.; Neubig, R. R.; Millhauser, G. L.; Thompson, D. A., J; ackson, P. J. et al. Inverse Agonist Activity of Agouti and Agouti Related Protein. Peptides 2003 24 603 609. (195) Lundberg, K. S.; Shoemaker, D. D.; Adams, M. W.; Short, J. M.; Sorge, J. A. et al. High fidelity amplification using a thermostable DNA polymerase is olated from Pyrococcus furiosus Gene 1991 108 1 6. (196) Lodish, H.; Berk, A.; Kaiser, C. A.; Krieger, M.; Scott, M. P. et al. Molecular Cell Biology, 6 ed.; W.H. Freeman and Company: New York, 2008. (197) Wagman, G. H.; Testa, R. T.; Marquez, J. A.; We instein, M. J. Antibiotic G 418, a new Micromonospora produced aminoglycoside with activity against protozoa and helminths: fermentation, isolation, and preliminary characterization. Antimicrob. Agents Chemother. 1974 6 144 149. (198) Kenakin, T. Princip les: Receptor theory in pharmacology. Trends Pharmacol. Sci. 2004 25 186 192. (199) Schild, H. O. A new scale for the measurement of drug antagonism. Brit. J. Pharmacol. 1947 2 189 206. (200) Yang, Y. K.; Thompson, D. A.; Dickinson, C. J.; Wilken, J.; Barsh, G. S. et al. Characterization of Agouti related protein binding to melanocortin receptors. Mol. Endocrinol. 1999 13 148 155. (201) Ormerod, M. G. Flow Cytometry A Basic Introduction; Ormerod, M. G. Ed.; flowbook.denovosoftware.com 2008. (202) Li therland, S. A.; Xie, X. T.; Hutson, A. D.; Wasserfall, C.; Whittaker, D. S. et al. Aberrant prostaglandin synthase 2 expression defines an antigen presenting cell defect for insulin dependent diabetes mellitus. J. Clin. Invest. 1999 104 515 523.

PAGE 369

369 (203) P roneth, B.; Xiang, Z.; Pogozheva, I. D.; Litherland, S. A.; Gorbatyuk, O. S. et al. Molecular mechanism of the constitutive activation of the L250Q human melanocortin 4 receptor polymorphism. Chem. Biol. Drug Des. 2006 67 215 629. (204) Ho, G.; MacKenzie R. G. Functional characterization of mutations in melanocortin 4 receptor associated with human obesity. J. Biol. Chem. 1999 274 35819 35822. (205) Chen, C. A.; Okayama, H. Calcium Phosphate Mediated Gene Transfer: A Highly Efficient Transfection Syste m for Stably Transforming Cells with Plasmid DNA. Biotechniques 1988 6 632 638. (206) Chai, B. X., Neubig, R. R., Millhauser, G. L., Thompson, D. A., Jackson, P. J. et al.; Inverse agonist activity of agouti and agouti related protein. Peptides 2003 2 4 603 609. (207) Bolin, K. A.; Anderson, D. J.; Trulson, J. A.; Thompson, D. A.; Wilken, J. et al. NMR Structure of a Minimized Human Agouti Related Protein Prepared by Total Chemical Synthesis. FEBS Lett. 1999 451 125 131. (208) Bures, E. J., Hui, J.O. Young, Y, Chow, D.T., Katta, V., Rohde, M.F., Zeni, L., Rosenfeld, R.D., Stark, K.L., Haniu, M. Determination of disulfide structure in Agouti related protein (AGRP) by stepwise reduction and alkylation. Biochemistry 1998 37 12172 12177. (209) Jackson, P. J.; McNulty, J. C.; Yang, Y. K.; Thompson, D. A.; Chai, B., Gantz, I., et al. Design, Pharmacology, and NMR Structure of a Minimized Cystine Knot with Agouti Related Protein Activity. Biochemistry 2002 41 7565 7572. (210) Kiefer, L. L.; Ittoop, O. R .; Bunce, K.; Truesdale, A. T.; Willard, D. H. et al. Mutations in the Carboxy Terminus of the Agouti Protein Decrease Agouti Inhibition of Ligand Binding to the Melanocortin Receptors. Biochemistry 1997 36 2084 2090. (211) Haskell Luevano, C.; Monck, E. K.; Wanb, Y. P.; Schentrupa, A. M. The agouti related protein decapeptide (Yc[CRFFNAFC]Y) possesses agonist activity at the murine melanocortin 1 receptor. Peptides 2000 21 683 689. (212) Thirumoorthy, R.; Holder, J. R.; Bauzo, R. M.; Richards, N. G. J. ; Edison, A. S. et al. Novel Agouti related Protein (AGRP) Based Melanocortin 1 Receptor Antagonist. J. Med. Chem. 2001 44 4114 4124. (213) Joseph, C. G.; Bauzo, R. M.; Xiang, Z.; Shaw, A. M.; Millard, W. J. et al. Elongation Studies of the Human Agout i Related Protein (AGRP) Core Decapeptide (Yc[CRFFNAFC]Y) Results in Antagonism at the Mouse Melanocortin 3 Receptor. Peptides 2003 24 263 270.

PAGE 370

370 (214) Jarosinski, M. A.; Dodson, W. S.; Harding, B. J.; Hale, C.; McElvain, M. et al. Design and Synthesis of Simplified AGRP(65 112) Analogues: Protein Mimetics with Affinity at the Melanocortin Receptors. 17th American Peptide Symposium 2001. (215) Sun, H.; Fry, D. Molecular Modeling of Melanocortin Receptors. Curr. Top. in Med. Chem. 2007 7 1042 1051. (216) Chapman, K. L.; Kinsella, G. K.; Cox, A.; Donnelly, D.; Findlay, J. B. Interactions of the melanocortin 4 receptor with the peptide agonist NDP MSH. J. Mol. Biol. 2010 401 433 450. (217) Wilczynski, A.; Wilson, K. R.; Scott, J. W.; Edison, A. S.; Hask ell Luevano, C. Structure activity relationships of the unique and potent agouti related protein (AGRP) melanocortin chimeric Tyr c[beta Asp His DPhe Arg Trp Asn Ala Phe Dpr] Tyr NH2 peptide template. J. Med. Chem. 2005 48 3060 3075. (218) Voet, D.; Voet J. G. Biochemistry; 3rd ed.; John Wiley & Sons, Inc: Hoboken, NJ, 2004. (219) Cho, M.; Lee, C.; Lee, C.; Li, S.; Lim, S. et al. Structure and function of the potent cyclic and linear melanocortin analogues. J. Struct. Biol. 2005 150 300 308. (220) Lee, J. H.; Lim, S. K.; Huh, S. H.; Lee, D.; Lee, W. Solution structures of the melanocyte stimulating hormones by two dimensional NMR spectroscopy and dynamical simulated annealing calculations. Eur. J. Biochem. 1998 257 31 40. (221) Yang, Y. K.; Dickinson, C. J.; Zeng, Q.; Li, J. Y.; Thompson, D. A. et al. Contribution of melanocortin receptor exoloops to Agouti related protein binding. J. Biol. Chem. 1999 274 14100 14106. (222) Wu, Q.; Howell, M. P.; Cowley, M. A.; Palmiter, R. D. Starvation after AgRP n euron ablation is independent of melanocortin signaling. Proc. Natl. Acad. Sci. U. S. A. 2008 105 2687 2692. (223) Dubern, B.; Lubrano Berthelier, C.; Mencarelli, M.; Ersoy, B.; Frelut, M. L. et al. Mutational analysis of the pro opiomelanocortin gene in French obese children led to the identification of a novel deleterious heterozygous mutation located in the alpha melanocyte stimulating hormone domain. Pediatr. Res. 2008 63 211 216. (224) Lubrano Berthelier, C.; Durand, E.; Dubern, B.; Shapiro, A.; Da zin, P. et al. Intracellular retention is a common characteristic of childhood obesity associated MC4R mutations. Hum. Mol. Genet. 2003 12 145 153. (225) MacKenzie, R. G. Obesity associated mutations in the human melanocortin 4 receptor gene. Peptides 20 06 27 395 403.

PAGE 371

371 (226) Govaerts, C.; Srinivasan, S.; Shapiro, A.; Zhang, S.; Picard, F. et al. Obesity associated mutations in the melanocortin 4 receptor provide novel insights into its function. Peptides 2005 26 1909 1919. (227) Hinney A; Hohmann S; Ge ller F; Vogel C; Hess C et al. Melanocortin 4 receptor gene: case control study and transmission disequilibrium test confirm that functionally relevant mutations are compatible with a major gene effect for extreme obesity. J Clin Endocrinol Metab 2003 88 4258 4267. (228) Robbins, L. S.; Nadeau, J. H.; Johnson, K. R.; Kelly, M. A.; Roselli Rehfuss, L. et al. Pigmentation Phenotypes of Variant Extension Locus Alleles Result from Point Mutations that alter MSH Receptor Function. Cell 1993 72 827 834. (229) Xiang, Z., Litherland, S.A., Sorensen, N.B., Proneth, B., Wood, M.S., Shaw, A.M., Millard, W.J., Haskell Luevano, C. Pharmacological Characterization of 40 Human Melanocortin 4 Receptor Polymorphisms with the Endogenous Proopiomelanocortin Derived Agonist s and the Agouti Related Protein (AGRP) Antagonist. Biochemistry. 2006 45 7277 7288. (230) Deber, C. M.; Therien, A. G. Putting the breaks on membrane protein misfolding. Nat. Struct. Biol. 2002 9 318 319. (231) Houghten, R. A.; Pinilla, C.; Giuliano tti, M. A.; Appel, J. R.; Dooley, C. T. et al. Strategies for the Use of Mixture Based Synthetic Combinatorial Libraries: Scaffold Ranking, Direct Testing in vivo, and Enhanced Deconvolution by Computational Methods. J. Comb. Chem 2008 10 3 19. (232) Gri eco, P.; Balse Srinivasan, P.; Han, G.; Weinberg, D.; MacNeil, T. et al. Synthesis and biological evaluation on hMC3, hMC4 and hMC5 receptors of gamma MSH analogs substituted with L alanine. J. Pept. Res. 2002 59 203 210. (233) Bednarek, M. A.; Macneil, T.; Kalyani, R. N.; Tang, R.; Van der Ploeg, L. H. T. et al. Analogs of MTII, Lactam Derivatives of [alpha] Melanotropin, Modified at the N Terminus, and Their Selectivity at Human Melanocortin Receptors 3, 4, and 5. Biochem. Biophys.l Res. Comm. 1999 261 209 213. (234) Bednarek, M. A.; Silva, M. V.; Arison, B.; MacNeil, T.; Kalyani, R. N. et al. Structure function studies on the cyclic peptide MT II, lactam derivative of [alpha] melanotropin. Peptides 1999 20 401 409. (235) Bednarek, M. A.; MacNeil, T. ; Kalyani, R. N.; Tang, R.; Van der Ploeg, L. H. T. et al. Analogs of Lactam Derivatives of [alpha] Melanotropin with Basic and Acidic Residues. Biochem. Biophys. Res. Comm. 2000 272 23 28.

PAGE 372

372 (236) Cheung, A. W. H.; Danho, W.; Swistok, J.; Qi, L.; Kurylko G. et al. Structure Activity relationship of linear peptide Bu His DPhe Arg Trp Gly NH 2 at the human melanocortin 1 and 4 receptors: arginine substitution. Bioorg. Med. Chem. Lett. 2002 12 2407 2410. (237) Eichler, J.; Houghten, R. A. Identification o f substrate analog trypsin inhibitors through the screening of synthetic peptide combinatorial libraries. Biochemistry 2003 32 11035 11041. (238) Hirschmann, R.; Yao, W.; Cascieri, M. A.; Strader, C. D.; Maechler, L. et al. Synthesis of potent cyclic hex apeptide NK 1 antagonists. Use of a minilibrary in transforming a peptidal somatostatin receptor ligand into an NK 1 receptor ligand via a polyvalent peptidomimetic. J. Med. Chem. 1996 39 2441 2448. (239) Tjoeng, F. S.; Towery, D. S.; Bulock, J. W.; Whip ple, D. E.; Fok, K. F. et al. Multiple peptide synthesis using a single support (MPS3). Int. J. Pept. Protein Res. 1990 35 141 146. (240) Wermuth, C. G. The Practice of Medicinal Chemistry, 3rd Ed. ; Academic Press: London, 2008. (241) Kendall Taylor, P. Hyperthyroidism. Clin. Endocrinol. 1972 2 337 341. (242) Stanbury, J. B.; DeGroot, L. J. The Clinical Chemistry and Pathologic Physiology of Thyroid Tissue. Clin. Chem. 1967 13 542 553. (243) Sebhat, I. K.; Martin, W. J.; Ye, Z.; Barakat, K.; Mosley, R. T. et al. Design and Pharmacology of N [(3R) 1,2,3,4 Tetrahydroisoquinolinium 3 ylcarbonyl] (1R) 1 (4 chlorobenzyl) 2 [4 cyclohexyl 4 (1H 1,2,4 triazol 1 ylmethyl)piperidin 1 yl] 2 oxoethylamine (1), a Potent, Selective, Melanocortin Subtype 4 Recept or Agonist. J. Med. Chem. 2002 45 4589 4593. (244) Bennett, J. W. The Timeline: Adrenalin and cherry trees. Modern Drug Discovery 2001 4 47 48.

PAGE 373

373 BIOGRAPHICAL SKETCH Erica Haslach was born in Queens, New York in 1984 to Robert and Susan Haslach. Eric a attended Pleasant Valley School in Brodheadsville, PA from kindergarten through 12 th grade. She graduated high school in 2002 Summa c um Laude and was the recipient of the National Merit Scholarship, along with additional scholarships for college. Erica a ttended Shippensburg University in Shippensburg, PA from 2002 2006. She graduated with a major in Chemistry and a minor in Biology in 2006 with Summa cum Shippensburg, and received a 4.0 GPA two semesters. She was awarded the Shippensburg University Foundation Scholarship during her senior year in college. Erica was an active member of the Shippensburg University Chemistry Club, she was secretary during 2004 2005 and helped earned the club an Hono rable Mention at the American Chemical Society meeting in Atlanta, GA During 2005 2006, she took on the role as president of the club and helped earned the club an Outstanding Achievement Award at the ACS meeting in Boston, MA. In addition, she was awarde d the ACS American Universities and Colleges. During her senior year, Erica worked with Dr. Christina Martey Ochola and Dr. John Richardson to gain some research experience. In Fall 2006, she joined the Department of Medicinal Chemistry PhD graduate program at the University of Florida in Gainesville as a Grinter Fellow and transferred to the Department of Pharmacodynamics in 2008. Erica was the Pharmacodynamics Graduate Student Coun cil Representative from Spring 2008 Fall 2010. In 2010, Erica was awarded the prestigious Robert and Stephany Ruffolo Graduate Fellowship by the Pharmacodynamics faculty members. Erica worked under the supervision of Dr. Carrie

PAGE 374

374 Haskell Luevano to earn her PhD (August 2011) on rational drug design approaches towards the brain melanocortin receptors potentially leading to new treatment options for obesity.