<%BANNER%>

Mechanism Controlling Mmr-Dependent Apoptosis in Response to Sn1-Methylators

Permanent Link: http://ufdc.ufl.edu/UFE0043084/00001

Material Information

Title: Mechanism Controlling Mmr-Dependent Apoptosis in Response to Sn1-Methylators
Physical Description: 1 online resource (44 p.)
Language: english
Creator: Skehan, Ryan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: alkylator -- apoptosis -- atm -- cancer -- lymphoblast -- mismatch -- mnng -- msh6 -- p53 -- sn1
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: In this report we examine the role of the DNA mismatch repair protein MutS? in the activation of MNNG-induced apoptosis and uncover the signaling responsible for Sn1-alkylator induced apoptosis in this cell type. We use several methods to show that human lymphoblastoid cells with mutated MSH6 are unable to mount a robust apoptotic response upon treatment with low doses of alkylator, that mutations in MSH6 impair the proper phosphorylation of threonine 68 on Chk2, and also that p53 Serine 20 phosphorylation (but not Serine 15 phosphorylation) is almost completely abrogated in these mutant cells. Further, p53 and ATM deficient cells display defects in apoptosis activation. Finally, we compare our results with previous results from numerous laboratories to propose a pathway where mismatch repair and ATM dependent phosphorylation of Chk2, which in turn phosphorylates p53 serine 20 and allows p53 dependent and alkylator induced apoptosis to be activated.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Ryan Skehan.
Thesis: Thesis (M.S.)--University of Florida, 2011.
Local: Adviser: Brown, Kevin D.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-06-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043084:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043084/00001

Material Information

Title: Mechanism Controlling Mmr-Dependent Apoptosis in Response to Sn1-Methylators
Physical Description: 1 online resource (44 p.)
Language: english
Creator: Skehan, Ryan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: alkylator -- apoptosis -- atm -- cancer -- lymphoblast -- mismatch -- mnng -- msh6 -- p53 -- sn1
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: In this report we examine the role of the DNA mismatch repair protein MutS? in the activation of MNNG-induced apoptosis and uncover the signaling responsible for Sn1-alkylator induced apoptosis in this cell type. We use several methods to show that human lymphoblastoid cells with mutated MSH6 are unable to mount a robust apoptotic response upon treatment with low doses of alkylator, that mutations in MSH6 impair the proper phosphorylation of threonine 68 on Chk2, and also that p53 Serine 20 phosphorylation (but not Serine 15 phosphorylation) is almost completely abrogated in these mutant cells. Further, p53 and ATM deficient cells display defects in apoptosis activation. Finally, we compare our results with previous results from numerous laboratories to propose a pathway where mismatch repair and ATM dependent phosphorylation of Chk2, which in turn phosphorylates p53 serine 20 and allows p53 dependent and alkylator induced apoptosis to be activated.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Ryan Skehan.
Thesis: Thesis (M.S.)--University of Florida, 2011.
Local: Adviser: Brown, Kevin D.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-06-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043084:00001


This item has the following downloads:


Full Text

PAGE 1

1 MECHANISM CONTROLLING MMR DEPENDENT APOPTOSIS IN RESPONSE TO SN1 METHYLATORS By RYAN SKEHAN A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Ryan Skehan

PAGE 3

3 ACKNOWLEDGMENTS I thank my Mom, Liam, Grandad, Lisa Dyer, John Saydi, Ling Bao Ai, Eugene Izumchenko, Wan Ju Kim, and all the wond erful friends I have made at UF.

PAGE 4

4 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 3 LIST OF TABLES ................................ ................................ ................................ ............ 6 LIST OF FIGURES ................................ ................................ ................................ .......... 7 LIST OF ABBREVIATIONS ................................ ................................ ............................. 8 ABSTRACT ................................ ................................ ................................ ................... 11 CHAPTER 1 BACKGROUND AND SIGNIFICANCE ................................ ................................ ... 12 Introduction ................................ ................................ ................................ ............. 12 The Basic Mechanism of MMR ................................ ................................ ............... 12 Sn1 Alkylators ................................ ................................ ................................ ......... 13 MGMT ................................ ................................ ................................ ..................... 14 Mismatch Repair has Two Distinct Functions in Cancer Prevention ....................... 14 Alkylation Tolerance ................................ ................................ ............................... 15 Models for the DNA Damage Response to O6meG ................................ ............... 15 Apoptosis and DDR Signalling ................................ ................................ ................ 16 Origins of Cell Lines Used in this Inquiry ................................ ................................ 18 2 MATERIALS AND METHODS ................................ ................................ ................ 20 Cell Culture and Drug Treatments ................................ ................................ .......... 20 Immunoblotting ................................ ................................ ................................ ....... 21 RNAi and Vector Construction ................................ ................................ ................ 22 Nucleofection ................................ ................................ ................................ .......... 23 Cell Viability ................................ ................................ ................................ ............ 23 Caspase 3 Activity Assay ................................ ................................ ....................... 24 Annexin V ................................ ................................ ................................ ............... 25 RT PCR and Arrays ................................ ................................ ................................ 25 3 RESULTS ................................ ................................ ................................ ............... 26 Cell Viability Assay ................................ ................................ ................................ 26 PARP and Caspase 3 Cleavage ................................ ................................ ............. 27 Caspase 3 Activity Assay ................................ ................................ ....................... 28 Annexin V Flow Cytometry ................................ ................................ ...................... 29 p53 Signalling Status in Response to MNNG ................................ ......................... 30 Chk2 Phosphorylation Status ................................ ................................ .................. 32

PAGE 5

5 Knocking Down Chk2 Expression with shRNA Constructs ................................ ..... 33 Real time PCR p53 Signalling Arrays ................................ ................................ ..... 34 4 DISCUSSION ................................ ................................ ................................ ......... 36 Interpretation of Results ................................ ................................ .......................... 36 Proposed Mismatch Repair Dependent Apoptosis Pathway ................................ ... 38 Future Directions ................................ ................................ ................................ .... 39 LIST OF REF E RENCES ................................ ................................ ............................... 40 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 44

PAGE 6

6 LIST OF TABLES Table page 2 1 shRNA Oligonucleotides ................................ ................................ ..................... 22

PAGE 7

7 LIST OF FIGURES Figure page 3 1 MTS cell viability assay. Results show the percentage of viable treated and untreated cells 24 hours after treatment with 5 M MNNG. ................................ 26 3 2 PARP western blot. Results show the distribution of PARP cleavage fragments in cell extracts 24 hours after treatment with 5 M MNNG. ................. 27 3 3 Fluo rescent Caspase 3 cleavage assay. Results show the amount of fluorescence generated by the cleavage of a DEVD Amc substrate in cell extracts 24 hours after treatment with 5 M MNNG. ................................ ........... 28 3 4 Ann exin V flow cytometry. Results show the level of Annexin V accumulating on the outside of the cells 24 hours after treatment with 5 M MNNG. ................ 29 3 5 Phospho p53 western blots. These western bl ots show the total amount of p53, the level of p53 serine 15 phosphorylation, and the amount of p53 serine 20 phosphorylation of the wild type and deficient cells 8 hours after treatment with 5 M MNNG. ................................ ................................ ................ 30 3 6 Western blot assaying for Phospho Threonine 68 phosphorylation and comparing it to total Chk2 expression. ................................ ................................ 32 3 7 Screen of Chk2 RNA interference constructs and phenotypic effe cts of Chk2 RNAi. ................................ ................................ ................................ .................. 33 3 8 Selected apoptosis related RNA transcripts observed in TK 6 cells. .................. 34 4 1 Proposed MMR dependent pathw ay. ................................ ................................ 38

PAGE 8

8 LIST OF ABBREVIATION S A Adenine AMC 7 amino 4 methyl coumarin, a fluorescent molecule ATM AtaxiaTelangiectasia Mutated ATP Adenosine TriPhosphate ATR Ataxia telangiectasia and Rad3 Related BAX Bcl 2 Associat ed X protein BCL 2 B Cell Lymphoma 2 C Cytosine Chk2 Checkpoint Kinase 2 CMV CytoMegaloVirus DDR DNA Damage Response DDW Double Distilled Water DEVD Asp Glu Val Asp (the cleavage recognition site of Caspase 3) DMSO DiMethyl SulfOxide DSB Double St rand Break DTT DiThioThreotal EDTA EthyleneDiamineTetraacetic Acid EGTA Ethylene Glycol Tetraacetic Acid FBS Fetal Bovine Serum FITC Fluorescein IsoThioCyanate G Guanine GFP Green Fluorescent Protein GST Glutathione S Transferase

PAGE 9

9 HNPCC Hereditary NonPolyposis Colorectal Cancer Hprt Hypoxanthine guanine phosphoribosyltransferase LRDD Leucine Rich Death Domain MDM2 Mouse Double Minute 2 Homolog MGMT MethylGuanine MethylTransferase MLH1 MutL Homologue 1 MMR MisMatch Repair MNNG N METHYL N' NITR O N NITROSOGUANIDINE (MNNG) MNU Methyl NitrosoUrea MSH2 MutS Homologue 2 MSH6 MutS Homologue 6 P53AIP1 p53 regulated Apoptosis Inducing Protein 1 PAGE PolAcrylamide Gel Electrophoresis PARP Poly (ADP Ribose) Polymerase PBS Phosphate Buffered Saline P CNA Proliferating Cell Nuclear Antigen PCR Polymerase Chain Reaction PMS2 Post Meiotic Segration 2 PMSF PhenylMethylSulfonyl Fluoride RPA Replication Protein A RPMI Roswell Park Memorial Institute medium RT PCR Reverse Transcriptase Polymerase Chai n Reaction SDS Sodium Dodecyl Sulfate

PAGE 10

10 Ser Serine Sn1 Nucleophylic Substitution 1 T Thymidine Thr Threonine

PAGE 11

11 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirement s for the Degree of Master of Science MECHANISM CONTROLLING MMR DEPENDENT APOPTOSIS IN RESPONSE TO SN1 METHYLATORS By Ryan Skehan D ecember 2011 Chair: Kevin Brown Major: Medic al Science In this report we examine the induced apoptosis and uncover the signaling responsible for Sn1 alkylator induced apoptosis in this cell type. We use several methods to show that human lymphoblastoid cells with mutated MSH6 are unable to mount a robust apoptotic response upon treatment with low doses of alkylator, that mutations in MSH6 impair the proper phosphorylation of threonine 68 on Chk2, and also that p53 Serine 20 phosphorylation (but not Serine 15 phosphorylation) is almost completely abr ogated in these mutant cells. Further, p53 and ATM deficient cells display defects in apoptosis activation. Finally, we compare our results with previous results from numerous laboratories to propose a pathway where mismatch repair and ATM dependent phos phorylation of Chk2, which in turn phosphorylates p53 serine 20 and allows p53 dependent and alkylator induced apoptosis to be activated.

PAGE 12

12 CHAPTER 1 BACKGROUND AND SIGNI FICANCE Introduction Mismatch repair proteins are essential for the maintenance of gen ome stability and the rapid repair of heritable mutations that are induced by many exogenous and endogenous agents. Deficiencies in mismatch repair (MMR) proteins are highly correlated with deficiencies in DNA damage response (DDR) and mutations or deletio ns Lynch Syndrome, HNPCC, and manifestations of alkylation resistant malignant gliomas. DDR is characterized by cell cycle arrest and apoptosis subsequent to treatment wit h agents known to significantly alter DNA structure. In the case of Sn1 alkylating agents, DDR is dependent on the presence of fully functioning MMR for a wildtype response to these agents, the recruitment of MMR and DDR proteins to the site of damage, an d for appropriate activation of the signaling pathways that effect DDR. Unsurprisingly, many cancers have been discovered that are defective in one or more DDR components, and because so many of the treatments that are used against these cancers depend up on DNA damage and DDR, it is crucial that we advance our understanding of these mechanisms. The Basic Mechanism of MMR The mechanism of eukaryotic repair itself is broadly the same as it is in prokaryotes. In prokaryotes, MutS recognizes a mismatch which conducts the signal to MutL in an ATP dependent fashion and the MutS MutL heteroduplex recruits the endonuclease MutH which incises hemimethylated dGATC cites on the unmethylated strand and it is this strand break that directs unwinding and subsequent degr adation

PAGE 13

13 and repair activity by the exonuclease ExoI and Dna Pol II (Dao and Modrich, 1998) In eukaryotes, reconstituted in v itro systems have shown that the minimum molecular Exo1 RPA ATP (Dzantiev et al., 2004) inclusion of PCNA and RFC in the system (Kadyrov et al., 2006) Surprisingly, ExoI (a directed repair of heteroduplexes and a solution to this seeming impossibility remained elusive for many years until the discovery of a cryptic endonuclease activity in PMS2 that is dependent on PCNA and RFC. Investigation by the Modrich group showed that this endonuclease activity allowed properly reconstituted mismatch repair systems (ie MutS MutL Exo1 RPA PCNA RFC ATP strand and in live cells this single stranded region would presumably be filled in by DNA Pol (Kadyrov et al., 2006) Sn1 Alkylators Anticancer drugs of the Sn1 alkylator class (eg temozolomide) promiscuously methylate DNA, with some sites of methylation occurring with a much higher frequency than others (primarily N7 methylguanine and N3 methyladenine) ; however, the majority of these lesions are innocuous and easily repaired by base excision repair. One type of damage in particular, the O6meG lesion, is potently cytotoxic and mutagenic (Stojic et al., 2004) and with Sn1 alkylators O6meG is approximately ten to fifteen percent of the total lesion load (Wyatt and Pittman, 2006) The clinical rel evance of Sn1 alkylators is highlighted by the current treatment for glioblastoma multiforme, dramatic decreases in

PAGE 14

14 overall patient mortality are observed when the Sn1 alkylator temozolomide is combined with the surgical resection of tumors and radiotherap y (Stupp et al., 2005) MGMT O(6) methylguanine DNA methyltransferase (MGMT), repairs lesions resulting from alkylation of the exocyclic oxygen of guanines. MGMT irreversibly transfers the alkyl lesion to an active site in a stoichiometric, direct damage reversal pathway. MGMT works via a base flipping mechanism whereby an Arginine128 finger is involved in flipping out the O6meG nucleotide and stabilizing the extrahelical conformation. MGMT transfers the methyl grou p to an internal cysteine located at amino acid 145 and the entire MGMT molecule is subsequently poly ubiquitinated and degraded by the proteasome (Daniels et al., 2004) MGMT silencing is significantly correlated with decreased patient mortality when combined with temozolomide and radiotherapy (Stupp et al., 2005) MGMT over expression, on the other hand, leads to tumor resistance to alkylating chemotherapies (Hegi et al., 2005) and MGMT inhibitors like O6 benzyl guanine are actively being investigated to enhance the efficacy of the Sn1 alkylator class of drugs (Kaina et al., 2010) Mismatch Repair has Two Distinct Functions in Cancer Prevention The eukaryotic DNA mismatch repair system (MMR) has two distinct and important tumor suppressive functions. The first is th e suppression of mutagenesis via correction of DNA synthesis errors (Dzantiev et al., 2004) The second is the activation of cell cycle arrest or apoptosis with differences in activation of either response primarily based on cell type and the sp ecific nature of genotoxic damage incurred. Because our lab has observed apoptosis in response to MNNG in lymphoblastoid cells (Kim et al.,

PAGE 15

15 2005) the scope of this investigation was limited to the apoptotic functio ns of MMR that are commonly observed in this cell type. Alkylation Tolerance Mismatch repair is a pathway that promotes survival through its suppression of mutagenic events, thus the involvement of MMR proteins in killing cells with damaged DNA appears par adoxical. Nevertheless, it is clear that functional MMR is required for the lethality of certain types of DNA damage and the loss of key MMR proteins results in tolerance to the cytotoxic effects of some drugs. In the case of Sn1 alkylators in particular inactivation of MMR uncouples the presence of O6meG lesions from the activation of cell death and/or cell cycle arrest. Tolerance of DNA damage offers a survival strategy whereby the potentially lethal DNA lesions are not processed by MMR proteins and p ersistent DNA damage becomes uncoupled from cellular response (Karran, 2001) Indeed, deletion of MMR proteins in mammalian cells imparts ~100 fold more resistance to killing by Sn1 alkylators than matched MMR proficient cell lines (Stojic et al., 2004) (Stojic e t al., 2004) Models for the DNA Damage Response to O6meG To date, there are two main proposed hypotheses on how MMR dependent DDR is generated. The futile repair model was originally proposed by Karran and Bignami (Karran, 2001) (Karran and Bignami, 1994) and championed by the Jiricny group (Stojic et al., 2004) ; this model hypothesizes that the MMR system will attempt to repair O6meG lesions, but foll owing DNA replication this lesion is on the parental strand. MMR is directed to the newly synthesized one, the repair event itself will result in

PAGE 16

16 degradation of the nascent strand and in the subsequent reinsertion of a T opposite the unrepaired O6meG resi due that persists in the parental strand. This would trigger subsequent rounds of excision/resynthesis, until the replication fork arrests in the vicinity of the O6meG residues (Stojic et al., 2004) It is this ac cumulation of arrested forks that results in cell cycle arrest or apoptotic cascade signaling, likely via ATR and/or ATM (Stojic et al., 2004) The scaffolding model, on the other hand, builds upon previous work b y the Brown lab, the Modrich laboratory, and others that have seen the association of cell cycle arrest proteins with components of MMR in response to Sn1 alkylators (Adamson et al., 2005) (Brown et al., 2003) This model suggests that in addition to its repair responsibilities MMR proteins may have a detection and signaling capability that is important for a robust DDR response to Sn1 alkylating agents. Modified chromatin i mmunoprecipitation assays have shown that upon MNNG treatment ATR, Chk1, and TopBP1 are recruited in a MutS and MutL dependent fashion (Liu et al., 2010) and co immunoprecipitation experiments have shown that MNN G treatment induces both Chk1 and Chk2 to strongly associate with MSH2 (Adamson et al., 2005) Apoptosis and DDR Signalling Apoptosis is a highly conserved pathway that enables cells to undergo a tightly regulated d eath response when exposed to prodeath signaling (Degterev et al., 2003) It is characterized by cytoplasmic shrinkage, nuclear fragmentation, the migration of phosphatidylserine to the outer leaflet of the cell membrane loss of mitochondrial membrane potential, and initiation of the effector caspase cascade (Degterev et al., 2003) Loss of mitochondrial membrane potential especially is seen as a key event, as

PAGE 17

17 this induces the transloc ation of the apoptogenic protein cytochrome c into the cytoplasm, where it interacts with Apaf1 and activates the executioner caspases (Degterev et al., 2003) Upon treatment with ionizing radiation or radiomimetics like neocarzinostatin the ataxia telangiectasia mutated gene (McPherson et al.) directly phosphorylates p53 at the Serine 15 position (Banin et al., 1998) (Canman et al., 1998) which helps lead to activation of p53 by relieving it from association with MDM2. (Shieh et al., 1997) Various types of damage have been shown to induce the PI3k like kinase ATM to phosphorylate Chk2 at Thr68, and this phosphorylation event induces autophosphorylation by Chk2 at Thr 383 and Thr387 and results in the active form of Chk2 (Ahn et al., 2002) Among other things, monomerized Chk2 phosphorylates p53 at Ser20. P53 Ser20 phosphorylation has also been linked to decreased association wi th the E3 ubiquitin ligase MDM2 and thus leads to lower levels of p53 degradation and higher steady state levels of p53 in the cell (Hirao et al., 2000) (Chehab et al., 2000) DNA damage induces chromatin scaffolding proteins to reorganize to facilitate DNA repair; this facilitates the recruitmen t of repair factors and likely of signaling factors as well. ATM and ATR catalyze the phosphorylation of Serine 139 of a histone variant termed H2A.X that comprises 10% of the nuclear H2A in mammals (van Attikum and Gasser, 2005) and this phosphorylation event is associated with generating a vironment that promotes recruitment of repair proteins and (Lukas and Bartek, 2009) The deletion of the H2A.X gene in a mouse model showed that the initial short term localization of these repair proteins was unimpaired but that the sustained retention and

PAGE 18

18 accumulation of these proteins was severely blunted leading to the supposition that of DNA repair pr oteins at sites of damage, without serving as the primary recognition (Celeste et al., 2003) (van Attikum and Gasser, 2005) important for response to DSBs, it is not the most important event; merely the most visible event in a myriad of interactions that is at present only dimly understood. Origins of Cell Lines Used in this Inquiry Considerable care was t aken in the choice of cell lines for this set of experiments. Most of the cell lines we chose to use are a cadre of closely related, and already established cell lines that were all mutated and cloned from a single B lymphoblast line WI L2, derived from t he spleen of a normal patient with no observed cancers (Levy et al., 1968) All of these cell lines are characterized by an apparent inability to remove O6Me Guanine lesions (Goldmacher et al., 1986) which nicel y dispensed with the need to pretreat the cells with the MGMT blocking chemical O6 Benzyl Guanine. Our laboratory has previously found that the wild type version, TK6, is a good model for Sn1 alkylator induced apoptosis in response to low doses of MNNG (Kim et al., 2005) The MT 1 cell was isolated via frameshift mutagenesis upon treatment with ICR 191 and selection with MNNG, this reaction was conducted under conditions that yielded a very small number of hprt muta nts thus making it very likely that the phenotypes observed are due to a single mutation (Goldmacher et al., 1986; Kat et al., 1993) Subsequent investigation found that MT1 was deficient in strand specific mismatch repair and that mismatch repair could be restored by HeLa nuclear extract complementation (Kat et al., 1993) Further investigation has shown that MT1 contains important missense mutations in the ATPase site of both alleles of MSH6, which are not

PAGE 19

19 present in the alkylation sensitive parent cell line TK6. MSH6 has been shown to bind to G/T mismat ches (Palombo et al., 1995) which earned it its original name G/T Binding Protein. MSH6 has also been shown to bind to damaged DNA independent of MSH2, but MSH2 cannot bind to damaged DNA in the absence of MSH6 and MSH3, thus (Hong et al., 2008) The p53 mutated cell line WTK1 used here and previously by our group (Kim et al., 2005) was also mutated and cloned from the WI L2 line using extremely low exposure to ICR 191 (Benjamin et al., 1991) (Amundson et al., 1993) Pr evious work has shown that WTK1 contains a homozygous mutation in codon 237 of p53, which lies in a highly conserved region used for DNA binding (Xia et al., 1995) There were no TK6 related ATM deficient lymphoblasts that could be found for this inquiry; therefore we used WAR, a lymphoblastoid cell line isolated and cloned from the circulating blood of an ataxia telang iectasia patient (gift of Dr. Richard Gatti, UCLA). By combining existing data from this laboratory and a weight of evidence from other laboratories we are hypothesizing that MNNG treated lymphoblastoid cells are apoptosing in a mismatch repair dependent m apoptotic phenotype. Deficiencies in any of these molecules in this pathway lead to an inability to competently effect apoptosis.

PAGE 20

20 CHAPTER 2 MATERIALS AND METHOD S Cell Culture and Drug Treatments It is crucial that l ymphoblast cells be maintained in exceptionally good health. During this experimentation we observed that cells that have been excessively diluted or allowed to overgrow will not exhibit robust apoptotic responses. All lymphoblast tissue culture was cond ucted using RPMI with L Glutamine (HyClone) and supplemented with 10% fetal bovine serum (Gibco) and 100 units/mL of penicillin/streptomycin (It is important to test your batch of FBS to ensure that the lymphoblast cells grow rapidly in this particular lot number of FBS, and it is also a good idea to ensure that you use the same lot number of FBS throughout the experiment). Healthy, rapidly growing lymphoblastoid cells were split one to four (2.5mL old media to 7.5mL fresh media) and allowed to grow for 48 hours in a 25mL suspension flask; healthy cells split in this fashion will have changed the media to a yellowish color and attained a density of approximately 5X10^6 to 1X10^7 after 48 hours. Frozen stocks of lymphoblast cells were frozen in 80%RPMI/10%F BS/10%DMSO where indicated. Selection with hygromycin was accomplished at a final concentration of 500 g/mL. Sn1 alkylator treatment was conducted by splitting cells 1:4, allowing them to acclimate to the new media for 8 12 hours (overnight), and then 1M MNNG resuspended in DMSO is diluted in PBS to the appropriate concentration and immediately added to the cells to be treated. Care was taken to always dilute the MNNG from the 1M stock so as to avoid the possibility of degradation of this labile reagent. Cells were harvested at the indicated time points.

PAGE 21

21 After subjecting these sensitive cells to stress such as freezing or nucleofection, the lymphoblastoid cells were allowed to recover in conditioned RPMI media. Conditioned media was generated by growin g TK6 cells to a density of 5X10^6, centrifuging and sterile filtering this solution, and then diluting it 1:4 with fresh, sterile RPMI growth media. Immunoblotting SDS PAGE and immunoblotting were conducted as has been outlined previously by this laborat ory (Adamson et al., 2005) (Kim et al., 2005) Ten mL of lymphoblastoid cells grown in suspension and subjected to various drug treatments were transferred to a 15mL centrif uge tube and subjected to centrifugation for five minutes at 1200 rpm. Cells were then washed twice in 1 mL of ice cold PBS and resuspended in SDS lysis buffer ( 125 M Tris HCl, pH 7.5/5 M EDTA/5 M EGTA/10 M b glycerolphosphate/10 M NaF/10 M Na pyrop hosphate/1.0% SDS ). Samples were then placed into a heat block at 100 degrees Celsius for 5 minutes and then each sample was sonicated for 10 seconds, briefly centrifuged, boiled for 3 more minutes, and immediately placed on ice or into the 80 degree fre ezer. Protein concentration was determined using the bicinchonic assay method with Pierce BCA Protein Assay. Prior to electrophoresis, appropriate volume of cell lysate was diluted in 3X SDS sample buffer (150 mM Tris HCl pH 6.8, 10% mercaptoethanol, 20 % glycerol, 3% SDS, 0.01% bromphenol blue, 0.01% pyronin Y) and boiled for 5 minutes. Proteins were resolved on 7.5% polyacrylamide gel and then electrotransferred at 12 Volts overnight onto a nitrocellulose membrane. Membranes were probed with antibodi es directed against p53 (DO1, Santa Cruz), PARP (F2, Santa

PAGE 22

22 Cruz Biotechnology), phospho p53 Serine 15 (Cell Signalling Technology), phospho p53 Serine 20 (Cell Signalling Technology), and tubulin (DM1A, gift of D. W. Clevelend). Kirkegard and Perry provid ed peroxidase conjugated secondary antibodies and visualization was accomplished using Super West Pico (Pierce) was used to generate chemiluminescence and recorded with X ray film. RNAi and Vector Construction Table 2 1. shRNA Oligonucleotides shRNA name Oligonucleotide Sequence shChk2 #1 sense CGCGTCGAAAGCCAGCTTTACCTCTCCTTCAAGAGAGG AGAGGTAAAGCTGCTTTCTTTTTTCCAAC shChk2 #1 anti TCGAGTTGGAAAAAAGAAAGCCAGCTTTACCTCTCCTCT CTTGAAGGAGAGGTAAAGCTGGCTTTCGA shChk2 #2 sense CGCGTCGCTCTCTTGCTGAACCAATAGCTTCAAGAGAG CTATTG GTTCAGCAAGAGAGTTTTTTCCAAC shChk2 #2 anti TCGAGTTGGAAAAAACTCTCTTGCTGAACCAATAGCTCT CTTGAAGCTATTGGTTCAGCAAGAGAGCGA shChk2 #3 sense CGCGTCGTCATGAAGGTACTGCACAGCCTTCAAGAGAG GCTGTGCAGTACCTTCATGATTTTTTCCAAC shChk2 #3 anti TCGAGTTGGAAAAAATCATGAAGGTACTGCACAGCCTC TCT TGAAGGCTGTGCAGTACCTTCATGACGA shChk2 #4 sense CGCGTCGCTTTATAAGACAGTCCTCTTCTTCAAGAGAGA AGAGGACTGTCTTATAAAGTTTTTTCCAAC shChk2 #4 anti TCGAGTTGGAAAAAACTTTATAAGACAGTCCTCTTCTCT CTTGAAGAAGAGGACTGTCTTATAAAGCGA These oligonucleotides were all ordered from IDT tech nologies and each pair was annealed as described. DNA ol igonucleotides listed in Table 2 1 were purchased from Integrated DNA Technologies and resuspended in DDW, complementary pairs were mixed at equimolar conentrations and heated to 95 degrees, T4 DNA k inase plus ATP was used to add phospho groups to the ends of annealed double stranded oligonucleotide segments that have overhanging ends identical to MluI and XhoI overhangs. Following this they were ligated into a Genscript vector (pRNAT H1.4/Retro) tha t had been digested with MluI and XhoI. The vector pRNAT H1.4/Retro contains a CMV promoter that drives GFP and Hygromycin resistance, this is later used for chemical selection and visual

PAGE 23

23 confirmation of successful transgene expression. The shRNA express ion, in turn, is driven by an H1 promoter. Nucleofection Several methods were attempted for generating stable transgenic expression of the shRNA constructs, including several different Lipofectamine based approaches, transduction with lentiviruses, and nu cleofection. Our experience was that nucleofection using a Nucleofection Kit L from Amaxa provided the best results. Briefly, this was done by suspending 2 g of Qiagen prepared DNA in 95 L of Solution L and subsequently transfering this solution to an electrically conductive nucleofection cuvette. We used Amaxa program X 005 to transfer DNA into the cells, and quickly resuspended nucleofected cells in a 6 well dish with conditioned RPMI media. Four days after nucleofection visual confirmation of GFP e xpression was confirmed (approximately 30% of nucleofected cells showed green fluorescence)and 500 g/mL of hygromycin added to each well. Cells were grown in conditioned media plus hygromycin for a further two weeks after and then changed to a 200 g/mL m aintenance dose of hygromycin. Cell Viability Cell viability was determined using the CellTiter 96 AQ ueous Non Radioactive Cell Proliferation Assay (MTS) as directed by the manufacturer (Promega). Healthy, rapidly growing lymphoblastoid cells were split in a one to four ratio and allowed to grow for 48 hours. Cell density for each cell line was then determined using a hemocytometer and cells were diluted into fresh media to a concentration of 5 X 10^5 cells /mL and 100 L was dispensed into the appropria te wells on a 96 well tissue culture plate. Because lymphoblastoid cells can be very sensitive and seem to prefer conditioned media, it is

PAGE 24

24 important that you do not centrifuge cells to a pellet and resuspend the cells in entirely new media to attain the p roper cell density. Once in 96 well plates cells were allowed to acclimate for 12 hours, and then treated with the indicated dose of MNNG. Cells were cultured for the indicated period of time and following this, 15 l of MTS (3 (4,5 dimethylthiazol 2 yl) 5 (3 carboxymethoxyphenyl) 2 (4 sulphophenyl) 2H tetrazolium) mixed with PMS ( phenazine methosulfate) was pipetted into each well and the plate incubated at 37 o C for 2 hr. After incubation, absorbance was measured at 490nm using a microplate spectrophotom eter. Each experiment represents at least 8 independent measurements. Caspase 3 Activity Assay Activated Caspase 3 enzyme activity was measured using CaspACE Fluorometric Assay System (Promega). After 24 hours of MNNG treatment, the cells were washed wit h ice cold PBS and resuspended in a hypotonic cell lysis buffer (25mM HEPES (pH 7.5), 5mM MgCl2, 5mM DTT, 5mM EDTA, 2mM PMSF, 10g/m L leupeptin and 10g/ mL pepstatin) to a final concentration of 10^8 cells/mL. The cells were then lysed by exposure to four, one minute long freeze thaw cycles by dipping the base of each tube into 100% ethanol on a bed of dry ice. The cell lysate was then subjected to centrifugation at 16,000 x g in a Beckman benchtop centrifuge for 20 minutes at 4C and the supernatant fracti on was collected for use in the Caspase 3 activity assay. The assay was performed in an opaque, clear bottomed 96 well plate by combining 32 L caspase buffer, 2 L DMSO, 10 l 0.1 M DTT, and 10 l cell extract as directed by the manufacturer. Fluoresenc e was measured on a microplate reader with excitation at 360nm and emission measured at 460nm.

PAGE 25

25 Annexin V Either untreated or MNNG treated cells were stained for annexin V using the Annexin V FITC Apoptosis Detection Kit I (BD Biosciences) according to the 5 cells were pelleted and washed once with ice cold PBS and resuspended in 100 l of binding buffer (10 M Hepes, pH 7.4, 150 M NaCl, 5 M KCl, 1 M MgCl 2 and 2 M CaCl 2 ). Subsequently, 5 l of Annexin V FITC was added to the cells that were then incubated for 15 min at RT in the dark. After incubation, 400 L of binding buffer was added to the stained cells and the cells analyzed by flow cytometry. Data analysis was conducted using Cell Qu est software. RT PCR and Arrays RNA was extracted using the Trizol methodology combined with a final DNase step to ensure purity prior to RT PCR. Briefly, 10 mL of drug treated lymphoblastoid cells were centrifuged and resuspended in 1mL of Trizol, 200 L of chloroform was added, samples were vortexed and centrifuged at 16,000 rpm, the aqueous layer was mixed with an equal volume of isopropanol, centrifuged, and the precipitate was air dryed. Precipitated RNA was resuspended in reaction buffer ( 10 mM Tr is HCl 2.5 mM MgCl 2 0.5 mM CaCl 2 pH 7.6 at 25C ) and DNase I was added (M0303L, New England Biolabs) for 1 hour of reaction at 37 C, followed by extraction with phenol/chloroform and subsequent ethanol precipitation. 18S and 23S RNA integrity was verif ied by core facilities in the Interdisciplinary Center for Biotechnology Research using an Agilent 2100 Bioanalyzer. Once the integrity of the RNA sample was verified the samples were given to ICBR for use in a p53 Q PCR array (PAHS 027, SABiosciences).

PAGE 26

26 C HAPTER 3 RESULTS Cell Viability Assay Figure 3 1. MTS cell viability assay. Results show the percentage of viable treated and untreated cells 24 hours after treatment with 5 M MNNG. Our first step was to test the viability of our panel of lymphoblast lines at various concentrations of MNNG different time points after treatment, 24 hours was determined to be the optimum timepoint for demonstrating this phenotype. The CellTiter 96 AQ ueous Non Radioactive Cell Proliferation Assay uses a tetrazolium comp ound [3 (4,5 dimethylthiazol 2 yl) 5 (3 carboxymethoxyphenyl) 2 (4 sulfophenyl) 2H tetrazolium known as MTS. In the presence of viable cells, MTS is reduced by dehydrogenases to a soluble formazan product that absorbs strongly at 490 nm. Thus, cell cult ures with high numbers of viable cells will convert much of the MTS to its formazan product and the solution will change color and absorb strongly at 490nm. We observed the least absorbance (ie lowest viability) at a dosage of 5 M MNNG twenty four hours a fter

PAGE 27

27 treatment. The MTS assay showed that the wild type TK6 cells were much more sensitive to 5 M MNNG than the MSH6 mutant cells (MT 1), the p53 mutated cells (WTK1), or the ATM mutated lymphoblastoid cell line WAR (Fig. 3 1). PARP and Caspase 3 Cleavage Figure 3 2. PARP western blot. Results show the distribution of PARP cleavage fragments in cell extracts 24 hours after treatment with 5 M MNNG. We suspected that the decrease in viability observed in the wildtype TK6 cells was due to apoptosis. The refore, we decided to use western blotting to examine some common apoptotic markers. Pro caspase 3 is the major executioner caspase and it is cleaved into its active form by the activator caspases Caspase 8 and Caspase 9. One of the targets of activated Caspase 3 is the molecule PARP, which contains a consensus Casp 3 cleavage site (DEVD). I created total protein extracts from 5 M MNNG treated cells and untreated cells isolated 24 hours after treatment with MNNG or a mock PBS treatment. In the western bl ots we used antibodies against Caspase 3 and PARP. A notable increase in the amounts of cleaved Caspase 3 were observed in the 5 M wild type cells (TK 6), but little cleaved Casp 3 was observed in the MMR deficient, p53 deficient, or ATM deficient

PAGE 28

28 lines treated with MNNG (Fig. 3 2). Additionally, significant amounts of cleaved PARP were observed in the 5 M treated TK6 cells but not in the MMR deficient lymphoblasts, the p53 deficient lymphoblasts, or the ATM deficient lymphoblasts. Caspase 3 Activity Ass ay Figure 3 3. Fluorescent Caspase 3 cleavage assay. Results show the amount of fluorescence generated by the cleavage of a DEVD Amc substrate in cell extracts 24 hours after treatment with 5 M MNNG. The PARP and cleaved Casp 3 western blotting strongl y suggested that TK6 lymphoblastoid cells were activating apoptosis in response to 5 M MNNG, we next confirmed this interpretation using quantitative apoptosis assays. The CaspACE Fluorometric Assay System uses the fluorescent molecule AMC conjugated to a quenching molecule through a DEVD linker. Active Caspase 3 will cleave this linker

PAGE 29

29 and free the AMC from the quencher and allowing it to fluoresce at 460nm when it is excited by 360nm light. As with the PARP cleavage assay, all cell lines in this experi ment were treated with 5 M MNNG for 24 hours at which time cytoplasmic extracts were generated. All results are shown as a ratio of the amount of fluorescence measured in MNNG treated cells to the measured fluorescence noted in parallel cultures of untrea ted cells (Fig. 3 3). A five fold increase in Caspase 3 activity was measured in the wildtype TK6 cells but very modest changes were measured in the mismatch repair deficient cells (MT1), the p53 mutated cells (WTK1), or the ataxia telangiectasia lymphobl asts (WAR). Annexin V Flow Cytometry Figure 3 4. Annexin V flow cytometry. Results show the level of Annexin V accumulating on the outside of the cells 24 hours after treatment with 5 M MNNG. Annexin V is a phospholipid binding protein with a high aff inity for phosphatidylserine (Vermes et al., 1995) a species of phospholipid that is

PAGE 30

30 asymmetrically distributed on the inner leaflet of the plasma membrane but migrates rapidly to the outer leaflet of the cell mem brane when cells enter apoptosis. Flow cytometry using Annexin V conjugated to the fluorescent molecule FITC is a well established method for measuring apoptotic cells in a population. Under normal conditions, most of the TK6 (MSH6 wild type) cells demon strated little ability to bind Annexin V, however upon 5uM MNNG treatment a 15% increase in cells binding large amounts of Annexin V was observed (Fig. 3 4). The MSH6 mutant cell line MT1 showed little Annexin V binding under normal conditions, and 5uM MN NG treatment increased the number of cells binding large amounts of Annexin V by only 1%. p53 mutant (WTK1) and ATM deficient (WAR) cells showed 4% and 5% (respectively) increase in the number of cells showing high levels of Annexin V binding. p53 Signalli ng Status in Response to MNNG Figure 3 5. Phospho p53 western blots. These western blots show the total amount of p53, the level of p53 serine 15 phosphorylation, and the amount of p53 serine 20 phosphorylation of the wild type and deficient cells 8 ho urs after treatment with 5 M MNNG.

PAGE 31

31 We next conducted a set of western blots that allowed me to examine the status of the molecule p53 in lymphoblastoid cells. All western blots were done with the same set of extracts obtained from TK6, MT1, WTK1, and WAR cell lines treated in parallel with 5 M MNNG for 8 hours. Each of the four gels was loaded with the same concentration of total protein extract and a tubulin blot was performed in parallel to ensure accurate loading. By using antibodies against total p53 levels I was able to ascertain whether the total levels of p53 changed in response to MNNG 8 hours after treatment with MNNG. As expected, p53 levels rose approximately ten fold in the wild type TK6 cells, but no overall change was observed in the p53 mut ant or ATM deficient cells. An approximately 3 fold induction of total p53 was observed in the MT 1 cells (Fig. 3 .5) We also probed with antibodies specific for two different p53 phosphorylation events that occur during DNA damage response signaling. Spe cifically in response to damage, p53 is phosphorylated at the Serine 15 position by ATM; and it is phosphorylated at the Serine 20 position by Chk2 (Fig. 3 5) (Chehab et al., 2000) The p53 Serine 15 blots showed that the wild type TK6 cells phosphorylate p53 Serine 15 in response to MNNG (Fig. 3 5). MT 1 cells also robustly phosphory late p53 Ser15, though at a notably reduced level compared to Tk6, consistent with the fact that p53 upregulation is not as dramatic in this cell line. These experiments indicate that WTK1 cells have high constitutive levels of p53 Serine 15 phosphorylatio n and this is enhanced in response to damage. The WAR cells showed no p53 Serine 15 phosphorylation at all, consistent with ATM dependent phosphorylation of p53 during DDR.

PAGE 32

32 Analysis of p53 Serine 20 phosphorylation status in 5 M MNNG treated cells provide d distinct and interesting results (Fig. 3 5). Specifically, MMR deficient MT1 cells show a complete abrogation of p53 serine phosphorylation. Longer (data not shown) exposure of this blot did not indicate any Serine 20 phosphorylation of p53 in this li ne. In contrast, the MMR proficient TK6 and WTK1 both demonstrated increased Serine 20 phosphorylation in response to MNNG treatment with TK6 cells showing a marked increase in phospho Ser20 in respect to MNNG. Chk2 Phosphorylation Status Figure 3 6. Western blot assaying for Phospho Threonine 68 phosphorylation and comparing it to total Chk2 expression. Because monomerized, activated Chk2 is necessary to phosphorylate the Ser 20 position of p53 (Hirao et al., 20 00) (Chehab et al., 2000) and Chk2 Thr68 has been previously shown to be phosph oryated in response to MNNG (Adamson et al., 2005) we next decided to examine the Chk2 Thre68 phosphorylation status of Chk2 in these MNNG treated lymphoblasts (Ahn et al., 200 2) Here we examined the status of Chk2 Threonine 68 phosphorylation in response to treatment with a 5 M of alkylating agent at

PAGE 33

33 an 8 hour time point. Tubulin blots as well as total Chk2 blots were performed as controls to ensure that any increase in Thr eonine 68 phosphorylation was due to increased Chk2 phosphorylation rather than a result of improper gel loading. From these results, it is clear that the MMR deficient cells are completely unable to phosphorylate Chk2 threonine 68 in response to MNNG, whe reas the MMR proficient TK6 cells show a marked increase in threonine 68 phosphorylation compared to untreated controls (Fig. 3 6). Knocking Down Chk2 Expression with shRNA Constructs Figure 3 7. Screen of Chk2 RNA interference constructs and phenotypic effects of Chk2 RNAi. A) Chk2 western blot of TK 6 cells nucleofected with pRNAT H1.4/Retro constructs and selected with 500 g/mL hygromycin for 4 weeks. B) PARP western blot of TK 6 cells, Empty Vector, and Chk2 shRNA Construct #2. Because dysregulati on of Chk2 activation occurs in MMR deficient cells treated with MNNG, I sought to determine if Chk2 was required for MNNG activated apoptosis.

PAGE 34

34 were generated and these were cloned into the pRNAT H1.4/Retro vector, sequenced, and nucleofected into the TK6 cells. Nucleofected TK6 cells were then placed on selective media and after several weeks of hygromycin selection, expression was verified by e xamining all cells for GFP expression using a fluorescence microscope. GFP expression in each polyclonal population was approximately equal (Data not shown). The level of Chk2 protein was measured in each of the polyclonal populations and the shChk2 #2 co nstruct showed the most dramatic loss of Chk2 protein (Fig. 3 7a). shChk2 #2 polyclonal cells were subsequently used to examine MNNG induced apoptosis using the same PARP cleavage assay used earlier (Fig. 3 7b). Chk2 depleted cells were much less capable of mounting an apoptotic response to 5 M MNNG as compared to the empty vector control cells, or the TK6 cells with no vector at all. Real time PCR p53 Signalling Arrays Figure 3 8. Selected apoptosis related RNA transcripts observed in TK 6 cells.

PAGE 35

35 If MNNG treated lymphoblasts are activating apoptosis in a p53 dependent manner, then a number of apoptosis associated genes characterized as p53 transcriptional targets should be positively regulated and show an increase in expression in response to treatmen t with 5 M MNNG. Because a large number of p53 response elements (at least 146 canonical and noncanonical p53 response elements) have been verified as p53 targets (Menendez et al., 2009) we decided to use a human p53 signalling pathway PCR array (SABiosciences). This is a pre made, PCR plate that contains all of the primers, controls, and reagents necessary test for 84 different p53 regulated genes in a singl e 96 well plate based experiment. I isolated total RNA from TK6 cells 8 hours after treatment with 5 M MNNG, RNA integrity was confirmed using a 2100 Bioanalyzer (Agilent), and this RNA was subsequently applied to these high throughput microfluidic arrays The results demonstrated that a number of different p53 dependent genes ( p21, SESN1, CCNE2, PPM1D, BAX, GADD45A, LRDD, P53AIP1, EI24) were showing a ~2.5 or higher upregulation in response to MNNG treatment (Fig. 3 8). For example in agreement with ind ependently conducted RT PCR experiments, p21 showed a ~3.7 fold increase over control in the MNNG treated TK6 cells. This result assured us that the treated cells were activating p53 dependent response. As well, several well characterized pro apoptotic g enes showed a strong increase in accumulation as compared to the untreated TK6 cells. Specifically, Bcl 2 associated x protein (BAX) showed an approximately three fold increase over the untreated controls. As well, two other pro apoptosis genes Leucine R ich Repeats and Death Domain (LRDD) and p53 Apoptosis Inducing Protein 1 (p53AIP1) showed an increase of 2.5 and 2.3 fold respectively.

PAGE 36

36 CHAPTER 4 DISCUSSION Interpretation of Results The initial set of experiments showed that deficiencies in mismatch repai r, p53, and ATM all led to a decreased cytotoxic response to MNNG in human lymphoblasts. Moreover, deficiencies in any of these molecules resulted in a similar level of resistance to the alkylating agent MNNG, suggesting that these molecules may lie withi n a common apoptotic pathway. The p53 Serine 15 status observed in the four cell lines used in this inquiry provides clear evidence that this particular event is not dependent on the mismatch repair system. Further, my findings clearly indicate that ATM i s necessary for this phosphorylation of p53 consistent with other results. Additionally, these findings indicate that ATM is activated in an MMR independent manner following MNNG treatment similar to previous studies. In contrast, p53 Serine 20 phosphoryl ation is undetectable in MMR deficient MT 1 cells. Because Chk2 phosphorylates p53 at Serine 20 this suggests that the phosphorylation of p53 by Chk2 is deficient in mismatch repair deficient cells. It is unclear whether Ser 20 activation alone is suffic ient or if both p53 phosphorylation events are needed in order to effect mismatch repair dependent, alklylator induced apoptosis, this would have to be elucidated using a p53 S15A mutation in future experiments. Previous experiments by this laboratory have established that Chk2 co immunoprecipitates with the mismatch repair system in response to MNNG, and that this interaction is enhanced by the presence of damage (Adamson et al., 2005) The

PAGE 37

37 western blots in Figure 3 6 demonstrate that Chk2 threonine 68 phosphorylation is completely abrogated in the mismatch repair deficient cells. by the results obtained from shRNA based depletion of C hk2 in TK 6 cells (Figure 3 7). Here I show that shRNA Chk2 knockdown resulted in a complete block of MNNG induced apoptosis. These results are similar to previous experiments where MSH6, p53, and ATM deficiencies in lymphoblastoid cells were all shown t o block to MNNG induced apoptosis. Further, the combination of the results of the Chk2 threonine 68 blots and the apoptosis assay on Chk2 depleted cells implies cooperation between mismatch repair and ATM to phosphorylate Chk2. Finally, the p53 signallin g arrays that were performed on MNNG treated TK6 cells gave us several enticing candidates that may all be promoting mismatch repair dependent apoptosis in response to MNNG. A ~2 3 fold induction was observed in the expression of Bax, LRDD, and p53AIP1. Bax is a well known p53 inducible BH3 protein that binds to and deactivates the apoptosis inhibiting protein Bcl2 (Oltvai et al., 1993) and has also been shown to bind to the permeability transition pore complex on the mitochondrial cell membrane, likely allowing molecules like cytochrome c to escape and induce cell death (Marzo et al., 1998) LRDD has been shown to form a complex that results in the activation of Caspase 2, eventually leading to apoptosis and death (Tinel and Tschopp, 2004) Finally, ectopic expression of p53AIP1 in T98G cells leads to 35% more TUNEL positive cells than untransfected controls (Oda et al., 2000) and ectopic

PAGE 38

38 assayed using the MitoTracker Red CMXRos stain (Oda et al., 2000) Proposed Mismatch Repair Dependent Apoptosis Pathway Figure 4 1. Proposed MMR dependent pathway. Taken together, these data suggest that MNNG induced apoptosis in lymphoblastoid cells is mismatch repair, Chk2, p53, and ATM dependent. We propose that it is likely that all of t hese molecules lie within a common pathway illustrated in (Fig. 4 1). Combining our data with previous data in the field provides compelling evidence that this model is correct. In vitro, FLAG precipitated ATM was able to phosphorylate GST tagged Chk2 whi le a kinase dead form of ATM was unable to do the same, and SQ/TQ mutations in Chk2 leads to a total loss of Chk2 threonine 68 phosphorylation in vivo in response to ionizing radiation (Matsuoka et al., 1998; Matsuok a et al., 2000) Thus ATM is an established activator of Chk2 by phosphorylating threonine 68. Chk2 in p53 on serine 20 in vitro, that if p53 is phosphorylated in vitro by Chk2 cannot later

PAGE 39

39 associate with the p53 inhibitor Mdm2 in vitro (Chehab et al., 2000; Hirao et al., 2000) ATM has also been shown to phosphorylate serine 15 in vivo, and this activity is lacking in cell lines missing ATM (Banin et al., 1998; Canman et al., 1998) And finally, ATM proficient fibroblasts induce the accumulation of p53, phosphorylation of p53 serine 15, and demonstrate strand breaks via the comet assay; bu t ATM deficient fibroblasts do not demonstrate this capability (Adamson et al., 2002) Future Directions Based on the work I have presented here there are several obvious sets of experiments that need to be completed It is necessary to duplicate the results from the p53 signalling array with RT PCR against specific genes in TK6 cells and also to demonstrate that there is a deficiency in the expression of these p53 targeted apoptotic genes in response to MNNG in mism atch repair deficient cells, p53 deficient cells, and ATM deficient cells. In order to ensure that each of the molecules proposed to be in this pathway are required for MNNG induced apoptosis we would need to individually deplete expression of MSH6, p53, and ATM with RNA interference and duplicate at least one of the apoptosis assays for all of these shRNA based depletions. It would also behoove us to use those same shRNA based depletions to ensure that the upregulation of BAX, LRDD, and p53AIP1 are all M SH6, p53, and ATM dependent.

PAGE 40

40 LIST OF REF E RENCES Adamson, A.W., Beardsley, D.I., Kim, W.J., Gao, Y., Baskaran, R., and Brown, K.D. (2005). Methylator induced, mismatch repair dependent G2 arrest is activated through Chk1 and Chk2. Mol Bi ol Cell 16, 1513 1526. Adamson, A.W., Kim, W.J., Shangary, S., Baskaran, R., and Brown, K.D. (2002). ATM is activated in response to N methyl N' nitro N nitrosoguanidine induced DNA alkylation. J Biol Chem 277, 38222 38229. Ahn, J.Y., Li, X., Davis, H.L. and Canman, C.E. (2002). Phosphorylation of threonine 68 promotes oligomerization and autophosphorylation of the Chk2 protein kinase via the forkhead associated domain. J Biol Chem 277, 19389 19395. Amundson, S.A., Xia, F., Wolfson, K., and Liber, H.L. (1993). Different cytotoxic and mutagenic responses induced by X rays in two human lymphoblastoid cell lines derived from a single donor. Mutat Res 286, 233 241. Banin, S., Moyal, L., Shieh, S., Taya, Y., Anderson, C.W., Chessa, L., Smorodinsky, N.I., Pri ves, C., Reiss, Y., Shiloh, Y., et al. (1998). Enhanced phosphorylation of p53 by ATM in response to DNA damage. Science 281, 1674 1677. Benjamin, M.B., Potter, H., Yandell, D.W., and Little, J.B. (1991). A system for assaying homologous recombination at the endogenous human thymidine kinase gene. Proc Natl Acad Sci U S A 88, 6652 6656. Brown, K.D., Rathi, A., Kamath, R., Beardsley, D.I., Zhan, Q., Mannino, J.L., and Baskaran, R. (2003). The mismatch repair system is required for S phase checkpoint activa tion. Nat Genet 33, 80 84. Canman, C.E., Lim, D.S., Cimprich, K.A., Taya, Y., Tamai, K., Sakaguchi, K., Appella, E., Kastan, M.B., and Siliciano, J.D. (1998). Activation of the ATM kinase by ionizing radiation and phosphorylation of p53. Science 281, 1677 1679. Celeste, A., Fernandez Capetillo, O., Kruhlak, M.J., Pilch, D.R., Staudt, D.W., Lee, A., Bonner, R.F., Bonner, W.M., and Nussenzweig, A. (2003). Histone H2AX phosphorylation is dispensable for the initial recognition of DNA breaks. Nat Cell Biol 5, 675 679. Chehab, N.H., Malikzay, A., Appel, M., and Halazonetis, T.D. (2000). Chk2/hCds1 functions as a DNA damage checkpoint in G(1) by stabilizing p53. Genes Dev 14, 278 288. Daniels, D.S., Woo, T.T., Luu, K.X., Noll, D.M., Clarke, N.D., Pegg, A.E., a nd Tainer, J.A. (2004). DNA binding and nucleotide flipping by the human DNA repair protein AGT. Nat Struct Mol Biol 11, 714 720.

PAGE 41

41 Dao, V., and Modrich, P. (1998). Mismatch MutS MutL and helicase II dependent unwinding from the single strand break of an incised heteroduplex. J Biol Chem 273, 9202 9207. Degterev, A., Boyce, M., and Yuan, J. (2003). A decade of caspases. Oncogene 22, 8543 8567. Dzantiev, L., Constantin, N., Genschel, J., Iyer, R.R., Burgers, P.M., and Modrich, P. (2004). A defined huma n system that supports bidirectional mismatch provoked excision. Mol Cell 15, 31 41. Goldmacher, V.S., Cuzick, R.A., Jr., and Thilly, W.G. (1986). Isolation and partial characterization of human cell mutants differing in sensitivity to killing and mutatio n by methylnitrosourea and N methyl N' nitro N nitrosoguanidine. J Biol Chem 261, 12462 12471. Hegi, M.E., Diserens, A.C., Gorlia, T., Hamou, M.F., de Tribolet, N., Weller, M., Kros, J.M., Hainfellner, J.A., Mason, W., Mariani, L., et al. (2005). MGMT gen e silencing and benefit from temozolomide in glioblastoma. N Engl J Med 352, 997 1003. Hirao, A., Kong, Y.Y., Matsuoka, S., Wakeham, A., Ruland, J., Yoshida, H., Liu, D., Elledge, S.J., and Mak, T.W. (2000). DNA damage induced activation of p53 by the che ckpoint kinase Chk2. Science 287, 1824 1827. Hong, Z., Jiang, J., Hashiguchi, K., Hoshi, M., Lan, L., and Yasui, A. (2008). Recruitment of mismatch repair proteins to the site of DNA damage in human cells. J Cell Sci 121, 3146 3154. Kadyrov, F.A., Dzanti ev, L., Constantin, N., and Modrich, P. (2006). Endonucleolytic function of MutLalpha in human mismatch repair. Cell 126, 297 308. Kaina, B., Margison, G.P., and Christmann, M. (2010). Targeting O methylguanine DNA methyltransferase with specific inhibito rs as a strategy in cancer therapy. Cell Mol Life Sci 67, 3663 3681. Karran, P. (2001). Mechanisms of tolerance to DNA damaging therapeutic drugs. Carcinogenesis 22, 1931 1937. Karran, P., and Bignami, M. (1994). DNA damage tolerance, mismatch repair and genome instability. Bioessays 16, 833 839. Kat, A., Thilly, W.G., Fang, W.H., Longley, M.J., Li, G.M., and Modrich, P. (1993). An alkylation tolerant, mutator human cell line is deficient in strand specific mismatch repair. Proc Natl Acad Sci U S A 90, 6 424 6428.

PAGE 42

42 Kim, W.J., Beardsley, D.I., Adamson, A.W., and Brown, K.D. (2005). The monofunctional alkylating agent N methyl N' nitro N nitrosoguanidine triggers apoptosis through p53 dependent and independent pathways. Toxicol Appl Pharmacol 202, 84 98. L evy, J.A., Virolainen, M., and Defendi, V. (1968). Human lymphoblastoid lines from lymph node and spleen. Cancer 22, 517 524. Liu, Y., Fang, Y., Shao, H., Lindsey Boltz, L., Sancar, A., and Modrich, P. (2010). Interactions of human mismatch repair protein s MutSalpha and MutLalpha with proteins of the ATR Chk1 pathway. J Biol Chem 285, 5974 5982. Lukas, J., and Bartek, J. (2009). DNA repair: New tales of an old tail. Nature 458, 581 583. Marzo, I., Brenner, C., Zamzami, N., Jurgensmeier, J.M., Susin, S.A. Vieira, H.L., Prevost, M.C., Xie, Z., Matsuyama, S., Reed, J.C., et al. (1998). Bax and adenine nucleotide translocator cooperate in the mitochondrial control of apoptosis. Science 281, 2027 2031. Matsuoka, S., Huang, M., and Elledge, S.J. (1998). Linka ge of ATM to cell cycle regulation by the Chk2 protein kinase. Science 282, 1893 1897. Matsuoka, S., Rotman, G., Ogawa, A., Shiloh, Y., Tamai, K., and Elledge, S.J. (2000). Ataxia telangiectasia mutated phosphorylates Chk2 in vivo and in vitro. Proc Natl Acad Sci U S A 97, 10389 10394. McPherson, J.P., Lemmers, B., Hirao, A., Hakem, A., Abraham, J., Migon, E., Matysiak Zablocki, E., Tamblyn, L., Sanchez Sweatman, O., Khokha, R., et al. (2004). Collaboration of Brca1 and Chk2 in tumorigenesis. Genes Dev 18 1144 1153. Menendez, D., Inga, A., and Resnick, M.A. (2009). The expanding universe of p53 targets. Nat Rev Cancer 9, 724 737. Oda, K., Arakawa, H., Tanaka, T., Matsuda, K., Tanikawa, C., Mori, T., Nishimori, H., Tamai, K., Tokino, T., Nakamura, Y., et al. (2000). p53AIP1, a potential mediator of p53 dependent apoptosis, and its regulation by Ser 46 phosphorylated p53. Cell 102, 849 862. Oltvai, Z.N., Milliman, C.L., and Korsmeyer, S.J. (1993). Bcl 2 heterodimerizes in vivo with a conserved homolog, Ba x, that accelerates programmed cell death. Cell 74, 609 619. Palombo, F., Gallinari, P., Iaccarino, I., Lettieri, T., Hughes, M., D'Arrigo, A., Truong, O., Hsuan, J.J., and Jiricny, J. (1995). GTBP, a 160 kilodalton protein essential for mismatch binding activity in human cells. Science 268, 1912 1914.

PAGE 43

43 Shieh, S.Y., Ikeda, M., Taya, Y., and Prives, C. (1997). DNA damage induced phosphorylation of p53 alleviates inhibition by MDM2. Cell 91, 325 334. Stojic, L., Brun, R., and Jiricny, J. (2004). Mismatch re pair and DNA damage signalling. DNA Repair (Amst) 3, 1091 1101. Stupp, R., Mason, W.P., van den Bent, M.J., Weller, M., Fisher, B., Taphoorn, M.J., Belanger, K., Brandes, A.A., Marosi, C., Bogdahn, U., et al. (2005). Radiotherapy plus concomitant and adju vant temozolomide for glioblastoma. N Engl J Med 352, 987 996. Tinel, A., and Tschopp, J. (2004). The PIDDosome, a protein complex implicated in activation of caspase 2 in response to genotoxic stress. Science 304, 843 846. van Attikum, H., and Gasser, S. M. (2005). The histone code at DNA breaks: a guide to repair? Nat Rev Mol Cell Biol 6, 757 765. Vermes, I., Haanen, C., Steffens Nakken, H., and Reutelingsperger, C. (1995). A novel assay for apoptosis. Flow cytometric detection of phosphatidylserine expr ession on early apoptotic cells using fluorescein labelled Annexin V. J Immunol Methods 184, 39 51. Wyatt, M.D., and Pittman, D.L. (2006). Methylating agents and DNA repair responses: Methylated bases and sources of strand breaks. Chem Res Toxicol 19, 158 0 1594. Xia, F., Wang, X., Wang, Y.H., Tsang, N.M., Yandell, D.W., Kelsey, K.T., and Liber, H.L. (1995). Altered p53 status correlates with differences in sensitivity to radiation induced mutation and apoptosis in two closely related human lymphoblast lin es. Cancer Res 55, 12 15.

PAGE 44

44 BIOGRAPHICAL SKETCH Ryan Skehan was born in the United States in Florida. His childhood was enjoyable, traipsing through whatever woods w ere nearby for most of it, until he happened upon an overwhelming passion for reading that began to consume most of his spare time. Though born in Tallahassee, Florida; he has lived in Texas, Germany, Gainesville, and Daytona Beach. His parents divorced when he was six and from then on Ryan and his brother were raised by his mother. Being raised by a single mom who was also going back to school and finish ing her Associates and Bachelor degrees meant they had very little money, but their lives were happy regardless. beach lifeguard in the summers and a student during the academic school year. In school he excelled in all of his academic subjects, and received 22 college credits by the time he graduated. Ryan scored highly on all of his entrance exams and ended up at the alma mater of his mother, aunt, and uncle: The University of Florida. There he pursued a degree in microbiology and cell s cience while working a variety of fu ll time jobs that mostly involved laboratory work. After finishing school he worked for Kevin Brown while applying for graduate school and was accepted to the College of lege and a half years of a PhD, but was granted a m aster s d egree.