<%BANNER%>

Knockdown of Connective Tissue Growth Factor(ctgf), Transforming Growth Factor Beta 1 (tgf-B1) and Transforming Growth F...

Permanent Link: http://ufdc.ufl.edu/UFE0043062/00001

Material Information

Title: Knockdown of Connective Tissue Growth Factor(ctgf), Transforming Growth Factor Beta 1 (tgf-B1) and Transforming Growth Factor Beta Receptor 2 (tgf-Br2) by the Topical Application of Short Interfering Rna Molecules in Rabbit Corneal Fibroblasts
Physical Description: 1 online resource (121 p.)
Language: english
Creator: SRIRAM,SRINIWAS
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: CTGF -- RBCF -- SIRNA -- TGF -- TGFBR2
Biomedical Engineering -- Dissertations, Academic -- UF
Genre: Biomedical Engineering thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Purpose: Transforming Growth Factor ? (TGF-?) is a key mediator of the fibrotic response to wounding. It is up regulated during different types of wound healing in the eye, liver, and skin. Connective Tissue Growth Factor (CTGF) acts as a downstream mediator of TGF-? in promoting scar formation. Both CTGF mRNA and CTGF protein are induced by TGF-? in fibroblastic cells. The purpose of the study was to determine if short interfering RNAs (siRNAs) targeting TGF-?1, CTGF and type II receptor of TGF-?1 (TGF-?R2) could be used to suppress the action of TGF-? and CTGF. Methods: The mRNA sequences of human, mouse, rat and rabbits were aligned to compare their homology. Potent siRNA sequences designed from the coding region of the rabbit gene sequence specific to the growth factors being targeted were transfected into cultured rabbit corneal fibroblasts (RBCF). To observe knockdown, the growth factors were initially stimulated to increase their respective concentrations. The proteins and mRNA levels were then determined by Enzyme-linked immunosorbent assay (ELISA) and quantitative real time PCR (q-RT PCR). Results: Knockdown in the expression of all three growth factors was observed in the samples transfected with siRNAs. More specifically, TGF-?1 siRNAs caused a relative significant (p<0.05%) reduction of ~88% in the protein expression when compared to the scrambled control. The q-RT PCR results showed a similar significant mRNA level knockdown of ~94% for the same siRNA sample. Two TGF-?1 siRNA sequences that abrogated protein and mRNA level expressions in vitro were identified. Conclusions: TGF-?1 specific siRNAs were efficacious in knocking down the TGF-?1 action both in the protein and mRNA level. A direct application of siRNA into eyes to downregulate the TGF-?1 expression may provide a novel therapy for preventing corneal inflammation and scarring.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by SRINIWAS SRIRAM.
Thesis: Thesis (M.S.)--University of Florida, 2011.
Local: Adviser: Ogle, William.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-10-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043062:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043062/00001

Material Information

Title: Knockdown of Connective Tissue Growth Factor(ctgf), Transforming Growth Factor Beta 1 (tgf-B1) and Transforming Growth Factor Beta Receptor 2 (tgf-Br2) by the Topical Application of Short Interfering Rna Molecules in Rabbit Corneal Fibroblasts
Physical Description: 1 online resource (121 p.)
Language: english
Creator: SRIRAM,SRINIWAS
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: CTGF -- RBCF -- SIRNA -- TGF -- TGFBR2
Biomedical Engineering -- Dissertations, Academic -- UF
Genre: Biomedical Engineering thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Purpose: Transforming Growth Factor ? (TGF-?) is a key mediator of the fibrotic response to wounding. It is up regulated during different types of wound healing in the eye, liver, and skin. Connective Tissue Growth Factor (CTGF) acts as a downstream mediator of TGF-? in promoting scar formation. Both CTGF mRNA and CTGF protein are induced by TGF-? in fibroblastic cells. The purpose of the study was to determine if short interfering RNAs (siRNAs) targeting TGF-?1, CTGF and type II receptor of TGF-?1 (TGF-?R2) could be used to suppress the action of TGF-? and CTGF. Methods: The mRNA sequences of human, mouse, rat and rabbits were aligned to compare their homology. Potent siRNA sequences designed from the coding region of the rabbit gene sequence specific to the growth factors being targeted were transfected into cultured rabbit corneal fibroblasts (RBCF). To observe knockdown, the growth factors were initially stimulated to increase their respective concentrations. The proteins and mRNA levels were then determined by Enzyme-linked immunosorbent assay (ELISA) and quantitative real time PCR (q-RT PCR). Results: Knockdown in the expression of all three growth factors was observed in the samples transfected with siRNAs. More specifically, TGF-?1 siRNAs caused a relative significant (p<0.05%) reduction of ~88% in the protein expression when compared to the scrambled control. The q-RT PCR results showed a similar significant mRNA level knockdown of ~94% for the same siRNA sample. Two TGF-?1 siRNA sequences that abrogated protein and mRNA level expressions in vitro were identified. Conclusions: TGF-?1 specific siRNAs were efficacious in knocking down the TGF-?1 action both in the protein and mRNA level. A direct application of siRNA into eyes to downregulate the TGF-?1 expression may provide a novel therapy for preventing corneal inflammation and scarring.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by SRINIWAS SRIRAM.
Thesis: Thesis (M.S.)--University of Florida, 2011.
Local: Adviser: Ogle, William.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-10-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043062:00001


This item has the following downloads:


Full Text

PAGE 1

1 KNOCKDOWN OF CONNECTIVE TISSUE GROWTH FACTOR ( CTGF), TRANSFORMING GROWTH FACTOR BETA 1 (TGF B1) AND TRANSFORMING GROWTH FACTOR BETA RECEPTOR 2 (TGF BR2) BY THE TOPICAL APPLICATION OF SHORT INTERFERING RNA MOLECULES IN RABBIT CORNEAL FIBROBLASTS By SRINIWAS SRIRAM A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Sriniwas Sriram

PAGE 3

3 To mom and dad

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my two mentors, Dr. Alfred Lewin and Dr. Gregory Schultz, without whom my journey of scientific exploration would not have been nearly as fulfilling or complete. Their technical assis tance and practical guidance have been vital in the successful completion of my thesis. I would also like to thank my committee members Dr. William Ogle and Dr. Benjamin Keselowsky. Their expertise and advice have been indispensible to my success. I expr ess sincere gratitude to Paulette Robinson for all of her experimental advice, friendship and support. I greatly appreciate the numerous hours you took away from your busy schedule to train me in techniques related to my experiments. Finally, t he affirmati on provided by family and friends during this period also promoted the achievement of this project. My father lent support and guidance to me during this period and continues to be my role model as he has been throughout the years. My mother embraced me wi th open arms during the high and low points of this project as she has done during all of the projects life has presented. The help extended by these individuals as well as others too numerous to mention have been essential to my success.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 LIST OF ABBREVIATIONS ................................ ................................ ........................... 10 ABSTRACT ................................ ................................ ................................ ................... 11 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 13 RNA interference ................................ ................................ ................................ .... 13 Mechanism of RNAi ................................ ................................ .......................... 14 siRNA Design ................................ ................................ ................................ ... 14 siRNA Delivery ................................ ................................ ................................ 15 Some Concerns in Using RNAi Therapy ................................ .......................... 16 Corneal Wound Healing ................................ ................................ .......................... 17 ................................ 18 Activation of TGF 1 and Role of TGF R2 ................................ ..................... 19 Role of Conne ctive Tissue Growth Factor ................................ ........................ 20 2 METHODS ................................ ................................ ................................ .............. 29 siRNA Design ................................ ................................ ................................ ......... 29 Targeting Coding Region ................................ ................................ .................. 29 Off Target Effects ................................ ................................ ............................. 30 Cell Is olation and Culture ................................ ................................ ................. 30 Transfection Efficiency ................................ ................................ ..................... 30 Stimulation Experiment ................................ ................................ ........................... 31 TGF 1 Quantitation ................................ ................................ ........................ 31 CTGF and TGF R2 Protein Quantita tion ................................ ........................ 32 siRNA Knockdown Study ................................ ................................ .................. 32 CTGF, TGF 1 and TGF R2 Quantitation ................................ ............................ 33 Quantitation of CTGF, TGF, TGF R2 mRNA using q RT PCR ....................... 33 Statistical Analysis ................................ ................................ ............................ 33 3 RESULTS ................................ ................................ ................................ ............... 35 Experiment I ................................ ................................ ................................ ............ 36 Stimulation of TGF 1 ................................ ................................ ...................... 36

PAGE 6

6 TGF 1 Knockdown Experiment ................................ ................................ ...... 37 Experiment II ................................ ................................ ................................ ........... 38 Stimulation of CTGF ................................ ................................ ......................... 38 CTGF Knockdown Experiment ................................ ................................ ......... 39 Experiment III ................................ ................................ ................................ .......... 41 TGF R2 Knockdown Experiment ................................ ................................ ......... 41 4 DISCUSSION ................................ ................................ ................................ ......... 61 Experiment I ................................ ................................ ................................ ..... 62 Experiment II ................................ ................................ ................................ .... 63 Experiment III ................................ ................................ ................................ ... 64 5 CONCLUSIONS ................................ ................................ ................................ ..... 65 Overall C onclusions ................................ ................................ ................................ 65 Future Work ................................ ................................ ................................ ............ 65 APPENDIX A TGF 1 ALIGNMENT SEQUENCES ................................ ................................ ....... 68 B TGF R2 ALIGNMENT SEQUENCES ................................ ................................ ..... 83 C CTGF ALIGNMENT SEQUENCES ................................ ................................ ....... 111 LIST OF REFERENCES ................................ ................................ ............................. 117 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 121

PAGE 7

7 LIST OF TABLES Table page 2 1 Accession number of target growth factors ................................ ........................ 34 2 2 siRNA ta rget sequences ................................ ................................ ..................... 34 2 3 ................................ .......... 34 5 1 TGF 1 Knockdown percentages, protein and mRNA level ............................... 67

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Schematic of RNA interference ................................ ................................ .......... 22 1 2 Polymer based delivery system ................................ ................................ .......... 23 1 3 Corneal wound healing steps ................................ ................................ ............. 24 1 4 Major phases of wound healing and their associated pathologies ...................... 25 1 5 TGF activation and signaling systems ................................ ............................. 26 1 6 Domains of CTGF ................................ ................................ ............................... 27 1 7 Interaction of TGF and CTGF in fibrosis ................................ ......................... 28 3 1 Transfection reagent optimization results, knockdown percentage .................... 43 3 2 Transfection reagent optimization re sults, optimal balance factor. ..................... 43 3 3 TGF 1 stimulation, cell extract ................................ ................................ .......... 44 3 4 TGF 1 stimulation, media (Arrow mark indicates highest concentration) ......... 45 3 5 TGF 1 siRNA knockdown ELISA results ................................ .......................... 46 3 6 TGF 1 siRNA knockdown percentage, m edia (Arrow mark indicates highest knockdown) ................................ ................................ ................................ ........ 47 3 7 TGF 1 siRNA knockdown percentage, cell ................................ ....................... 48 3 8 TGF 1 siRNA knockdown q RT PCR results, knockdown ................................ 49 3 9 TGF 1 siRNA knockdown q RT results, ratio of expres sion ............................. 50 3 10 CTGF stimulation, cell ................................ ................................ ........................ 51 3 11 CTGF stimulation, media (Arrow mark indicates highest concentration) ............ 52 3 12 CTGF knockdown ELISA results ................................ ................................ ........ 53 3 13 CTGF siRNA knockdown percentage, media (A rrow mark indicates highest knockdown) ................................ ................................ ................................ ........ 54 3 14 CTGF siRNA knockdown percentage, cell ................................ ......................... 55 3 15 CTGF siRNA knockdown q RT results ................................ ............................... 56

PAGE 9

9 3 16 CTGF siRNA knockdown q RT results ................................ ............................... 57 3 17 TGF R2 siRNA knockdown ELISA results ................................ ........................ 58 3 18 TGF R2 siRNA knockdown percentage, media ................................ ................ 59 3 19 TGF R2 siRNA knockdown percentage, cell ................................ .................... 60

PAGE 10

10 LIST OF AB BREVIATIONS CCN2 / CTGF Connective Tissue Growth Factor ECM Extracellular matrix ELISA Enzyme linked immunosorbent assay GAPDH G lyceraldehyde 3 phosphate dehydrogenase HEPES 4 (2 hydroxyethyl) 1 piperazineethanesulfonic acid PBS Phosphate Buffered Saline RBCF Rabbit Corneal Fibroblasts siRNA Short Interfering Ribonuclease acid TGF Transforming Growth Factor Beta TGF R2 Transforming Growth Factor Type II Receptor

PAGE 11

11 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science KNOCKDOWN OF CONNECTIVE TISSUE GROWTH FACTOR (CTGF), TRANSFORMING GROWTH FACTOR BETA 1 (TGF B1) AND TRANSFORMING GROWTH FACTOR BETA RECEPTOR 2 (TGF BR2) BY THE TOPIC AL APPLICATION OF SHORT INTERFERING RNA MOLECULES IN RABBIT CORNEAL FIBROBLASTS By Sriniwas Sriram May 2011 Chair: William Ogle Major: Biomedical Engineering Purpose: Transforming Growth Factor ( TGF ) is a key mediator of the fibrotic response to wou nding. It is up regulated during different types of wound healing in the eye, liver, and skin. C onnective T issue G rowth F actor (CTGF) acts as a downstream mediator of TGF in promoting scar formation. Both CTGF mRNA and CTGF protein are induced by TGF in fibroblastic cells. The purpose of the study was to determine if short interfering RNAs (siRNAs) targeting TGF 1 CTGF and type II receptor of TGF 1 (TGF R2) could be used to suppress the action of TGF and CTGF. Methods: The mRNA sequences of hum an, mouse, rat and rabbit s were aligned to compare their homology. P otent siRNA sequences designed from the coding region of the rabbit gene sequence specific to the growth factors being targeted were transfected into cultured rabbit corneal fibroblasts (R BCF). To observe knockdown, t he growth factors were initially stimulated to increase their respective concentrations The proteins and mRNA levels were then determined by Enzyme linked immunosorbent assay ( ELISA ) and quantitative real time PCR (q RT PCR).

PAGE 12

12 Results: Knockdown in the expression of all three growth factors was observed in the samples transfected with siRNAs. More specifically, TGF 1 siRNAs caused a relative significant (p<0.05%) reduction of ~ 88% in the protein expression when compared to th e scrambled control. The q RT PCR results showed a similar significant mRNA level knockdown of ~ 94% for the same siRNA s ample. Two TGF 1 siRNA sequences that abrogated protein and mRNA level expressions in vitro were identified. Conclusions: TGF 1 specific siRNAs were efficacious in knocking down the TGF 1 action both in the protein and mRNA level. A direct application of siRNA into eyes to downregulate the TGF 1 expression may provide a novel therapy for preventing corneal inf lammation and scarring.

PAGE 13

13 CHAPTER 1 INTRODUCTION RNA interference Post transcriptional gene silencing (PTGS) is a method that silences gene expression by modifying mRNA using double standard RNA (dsRNA). This method termed, RNA interference (RNAi) is a cel lular mechanism that acts to change the gene expression at the post transcriptional level as opposed to the pre transcriptional level in DNA gene therapy where the changes are made before information is transcribed from the DNA ( Fire, 1999 ) It was first discovered in plants in the 1990s and has since been observed in animal cells. It utilizes the cells natural defen se against double stranded RNA, possibly related to an antiviral defense mechanism. Studies have also shown that siRNA mediated gene silencing is more effective than other antisense methods such as antisense oligodeoxynucleotides, ribozymes and DNAzymes ( Khan et al., 2004 ) There are many advantages of siRNA based therapy that makes the technology so desirable. Firstly, it can have a high degree of specificity and gene silencing efficiency. It is relatively non immunogenic in the correct dosage and can be made resistant to degradation via ribonucleases. Additionally, there is no integrat ion of siRNA with the host DNA, thus eliminating concerns for unintentional mutagenesis that is often a safety concern for gene therapy. While DNA gene therapy methods require DNA plasmid to reach the host cell nucleus to induce the desired gene expression RNAi occurs in the cytosol of a cell, allowing for easier delivery. These inherent advantages of RNAi makes it a more viable method of altering gene expression than other methods ( M artinez et al., 2002 )

PAGE 14

14 Mechanism of RNAi Long double stranded RNA (dsRNA) is processed to short interfering RNAs (siRNAs) by the action of a dsRNA specific endonuclease known as Dicer ( Bernstein et al., 2001 ; Hammond et al., 2001 ) The resultant siRNAs are 21 to 24 nucleotide in s ( Stevenson, 2004 ) The basic schematic of RNA interference is given in Figure 1 1. The requir ement for dsRNA processing by Dicer can be bypassed by incorporating exogenous synthetic siRNAs or endogenously expressing siRNAs into the RNA induced silencing complex (RISC). A helicase in RISC unwinds the duplex siRNA, which then pairs by means of its u nwound antisense strand to messenger RNAs (mRNAs) that bear a high degree of sequence complementarity to the siRNA ( Stevenson, 2004 ) The target mRNA is then cleaved leading to its subsequent knockdown. siRNAs and microRNAs (miRNAs) are two small RNAs in the RNAi pathway that are generated via processing of longer dsRNA and stem loop precursors ( Yin and Wan, 2002 ) Dicer enzymes play a critical role in the form ation of these two effectors by cleaving dsRNAs in an ATP dependent manner ( Angaji et al., 2010 ) siRNA programmed RISC (siRISC) silences expression by cleaving a perfectly complementary target mRNA, whereas miRNA induced silencing complexes (miRISC) inhibits translation by binding imperfect ( Chu and Rana, 2006 ) siRNA Design There are multiple considerations in order to achieve efficient RNAi in vivo by delivering exogenous siRNA. siRNA has to be designed to avoid unintended (off target) effects targeting only hybridization accessible regions within the target mRNA ( Walton

PAGE 15

15 et al., 2010 ) In addition, siRNA can also induce adverse effects such as immune responses or interferon responses through RNA activated Protein Kinase ( Samuel Abraham and Leonard, 2010 ) Therefore, a combination of computer algorithms and experimental validation should be employed to determine the optimized siRNA sequences that are complementary t o target mRNA while inducing minimal immune responses ( Amarzguioui and Prydz, 2004 ) siRNA Delivery siRNA can be delivered either exogenously to cells, or expressed endogenously via plasmid transfection or viral siRNA expression vectors. The types of target tissues and cells dictate the optimum administration routes of local versus systemic delivery. For example, siRNA can be directly applied to the eye, skin or muscle via local delivery, whereas systemic siRNA delivery is the only way to rea ch metastatic and hematological cancer cells. Local delivery offers several advantages over systemic delivery, such as low effective doses, simple formulation, low risk of inducing systemic side effects and facilitated site specific delivery ( Dykxhoorn et al., 2006 ) Therefore, if applicable, a more cost efficient strategy for siRNA delivery would be the local delivery method. Although, viral vectors act as efficient delivery systems they can potentially induce accidental gene expression changes following integration to host genome or induce toxic responses. Hence, a safer option would be to use the non viral delivery system if efficient delivery of exogenous siRNA to the cytoplasm can be achieved ( Shim and Kwon, 2010 ) Since, siRNAs are negatively charged and readily bind to cationic molecules, delivery carriers usually consist of cationic polymers, peptides or liposomes that form complex by ionic interactions ( Zimmermann et al., 2006 ) The resulting complex

PAGE 16

16 facilitates cellular uptake via the endocrytic pa thway, providing excellent protection of siRNAs from nuclease attack. Lipid based transfection reagents are the most common approach for nucleic acid delivery to cells in vitro. The cationic lipids in these reagents provide a suitable platform for incorpo rating the negatively charged siRNA. However, cationic lipid based reagents are considered too toxic for systemic siRNA delivery in vivo ( Peer et al., 2008 ) Similar to liposomes, cationic polymers can also serve as efficient transfection reagents because they can bind and condense nucleic acids into stabilized nanoparticles. Figure 1 1 shows t he encapsulation of siRNA in a polymer based delivery system ( Kim et al., 2009 ) Polyethyleneimine (PEI) is a synthetic polyme r that has been used in branched or linear forms of different lengths for nucleic acid delivery both locally as well as systemically ( Shim and Kwon, 2008 ) The Mirus TransIT TKO transfection reagent, a non liposomal cationic proprietary polymer/lipid formulation was used for all the transfections in the experiments ( Mirus, 2011 ) Some Concerns in Using RNAi Therapy I ndication of off target effects came from studies conducted by Merck Rosetta. Their results s howed that the expression levels of dozens of non targeted transcripts were altered when siRNAs were applied ectopically. They also suggested that even short complementary stretched of siRNAs with non targeted transcripts can affect their expression ( Jackson and Linsley, 2010 ) It was understood that microRNAs affect down regulation of target proteins and in some cases trigger non UTR, which in turn inhibits protein translation. It was quickly realized that ectopically applied siRNAs were affecting non targeted gene expression via microRNA like functions. This off targeting

PAGE 17

17 OMe modification at the secon d ribose from end of the siRNA. Although this solution should be used for all in vivo siRNA applications, it is not the case probably due to the long time it takes to develop a compound for clinical trials ( Jackson et al., 2006 ) There have a lso been reports in the literature showing that certain sequence motifs in siRNA triggers type I interferon production via activation of toll like receptors (TLRs) 7 and 8 thereby compromises the sequence specific knockdown effects of the RNAi pathway ( Hornung et al., 2005 ; Robbins et al., 2008 ) The promise of RNAi as a powerful new approach for therapeutic treatment of disease has propelled early stage clinical testing of siRNAs fo r a variety of diseases. Strategies must be developed to capitalize upon the endogenous mechanism without disrupting the natural pathway to achieve maximal benefit from RNAi therapeutics ( Tiemann and Rossi, 2009 ) Corneal Wound Healing The main purpose of the wound healing process is to regain the anatomical and functional abilities of the tissue in the fastest way. The corneal wound healing response is a complex cascade involving cytokine mediated interactions between the epithelial cells, stromal keratocy tes, corneal nerves, lacrimal glands, tear film and cells of the immune system ( Eraslan and Toker, 2009 ) Elsewhere in the body, wound healing culminates in scar formation and vascularization whereas one of the most crucial aspects of corneal wound healing is how the healing processes aim to minimize these end results, which would otherwise have serious visual consequences. Corneal epithelium responds rapidly to injury, healing a wound by migrating as a sheet to cover the defect and to reestablish its

PAGE 18

18 barrier function. Successful wound healing involves a number of processes including cell migration, cell proliferation, re stratification, as well as matrix deposition and tissue remodeling ( Lu et al., 2001 ) Figure 1 4, shows the major phases involved in corneal wound healing. Cell migration and proliferation wh ich are driven by growth factors released coordinately into the injury sites are particularly critical. Epithelium plays a central role in the wounded cornea, not only as a key cell type in repairing the cornea but also as the source of a number of growth factors ( Yu et al., 2010 ) A variety of growth factors are suggested to play a role in the regulation of corneal epithelial function and wound healing. We would be focusing on the role of TGF and CTGF. Transforming Growth Fa The TGF superfamily currently consists of more than 25 molecules, isolated from many species, encompassing a wide range of functions. They are multipotent cytokines that are important modulators of cell growth, inflammation, matrix synthesis and apoptosis ( O'Kane and Ferguson, 1997 ) Active TGF is a 25 linked homodimer. TGF Receptors I and II are transmembrane glycoproteins of 55 and 70 kDa. Betaglycan (TGF receptor III) is a cell surface proteoglycan that has both heparan and chondroitin sulfate chains on its extrac ellular domain ( Song et al., 2000 ) The TGF family of proteins are synthesized and secreted as large pro peptide molecules consisting of three regions; an amino terminal ( In addition, Latent TGF can contain a protein of variable size called the Latent TGF Binding Protein (LTBP). Unless an LTBP gene is co tr ansfected, there is little secretion of TGF even if the cells are transfected with the full (signal. pro and active domain)

PAGE 19

19 sequence. This indicates that the large latent complex (TGF plus the LAP and an LTBP) is a frequently secreted form. Both the L TBP and LAP must be removed before the mature protein can function, therefore activation of TGF is a crucial target for biological control of the molecule ( Saharinen et al., 1996 ) The multiple activators of latent TGF complex comprise of seemingly unrelated group of molecules. The three TGF isoforms TGF 1, TGF 2 and TGF 3 are quite similar in their effects in vitro yet in vivo the spatial and temporal distribution and actions of these isoforms is quite specific. TGF 1 is most abundant in all tissues and cells, then TGF 2 and least of all, TGF 3. TGF 2 is present mostly in bodily fluids such as saliva, amniotic fluid, breast milk and the eye whereas TGF 3 is not present at all in great amounts in either fluids or tissues Activation of TGF 1 and Role of TGF R2 The conversion of latent TGF to activ e TGF regulates the activity of the extracellular concentration of TGF This conversion takes place through a complex process of proteolytic activation and dissociation of latency protein subunits. Figure 1 5. Shows the basic steps involved in the acti vation of latent TGF Tissues contain significant quantities of latent TGF and activation of only a small fraction of this latent TGF generates maximal cellular responses ( Annes et al., 2003 ) The action of TGF is mediated by TGF receptor t ypes I (TGF R1) and II (TGF R2), both of which are serine and threonine kinases. The binding of TGF to TGF R2 initiates signal transduction, which is followed by its association with TGF R1. TGF R2 phosphorylates multiple serines and threonines in t`he cytoplasmic region of TGF R1. The activated TGF R1 in turn phosphorylates and activates the transcription factors, Smads ( Massague, 1998 ; Massague, 2000 )

PAGE 20

20 The important role of TGF in the wound repair has led to the use of anti TGF antibody ( Cordeiro et al., 1999a ) and antisense oligonucleotides ( Cordeiro et al., 2003 ) to block the TGF action. However, these studies in general have targeted the ligand rather than the receptor. Since, a major limiting step in the cellular activation of TGF appears to be the ligand engagement by TGF R2; we designed siRNAs targeting t his receptor. Role of Connective Tissue Growth Factor CTGF is upregulated in both fibroblasts and epithelium after corneal wound healing ( Blalock et al., 2003 ) Although it participates in the regulation of diverse biological processes related to growth and development, the overexpression of CTGF is correlated with severe fibrotic disorders, including fibrosis in skin, kidney, liver, lung, and vasculature CTGF was initially identified as a growth factor, then classified as a matricellular protein, and m ost recently appreciated as a matrix component ( Grotendorst, 1997 ) It is a member of the CCN 2 family of secreted, cell surface, and extracellular matrix (ECM) associated 35 to 40 kDa proteins. The diverse range of biological functions affected by CC N 2 proteins is enabled by a unique multi modular structure characteristic of the CCN 2 family whereby each protein is comprised of four functional domains. Ligands such as growth factors and cell surface proteins interact specifically and uniquely with each domain, enabl ing CTGF and other CCN 2 proteins to influence cellular functions through modulation, potentiation and integration of ligand signals, signal cross talk, and intracellular signaling pathways The different domains of CTGF are given in Figure 1 7.

PAGE 21

21 Grotendorst and Duncan reported that different domains of the CTGF protein are responsible for the mediation of the proliferation and differentiation/collagen synthesis activities of CTGF. The N terminal domain of CTGF mediates differentiation and collagen synthesis in concert with IGF 2. The C terminal domain of CTGF mediates cell proliferation in concert with EGF ( Grotendorst and Duncan, 2005 )

PAGE 22

22 Figure 1 1. Schematic of RNA i nterference (Source: Kim, S. S., Garg, H., Joshi, A. a nd Manjunath, N. (2009). Strategies for targeted nonviral delivery of siRNAs in vivo. Trends Mol Med 15, 491 500. )

PAGE 23

23 Figure 1 2. Polymer based delivery system (Source: Kim, S. S., Garg, H., Joshi, A. and Manjunath, N. (2009). Strategies for targeted non viral delivery of siRNAs in vivo. Trends Mol Med 15, 491 500.)

PAGE 24

24 Figure 1 3. Corneal wound h ealing s teps (Source: Eraslan, M. and Toker, E. (2009). Mechanisms of Corneal Wound Healing and its modulation following Refractive Surgery. Marmara Medical Jour nal 22, 169 178.)

PAGE 25

25 Figure 1 4. Major phases of wound healing and their associated pathologies (Source: wound healing. The International Journal of Biochemistry & Cell Biology Volume 29, 63 78.)

PAGE 26

26 Figure 1 5. TGF a ctivation and s ignaling systems (Source: Ruiz Ortega, M., Rodriguez Vita, J., Sanchez Lopez, E., Carvajal, G. and Egido, J. (2007). TGF beta signaling in vascular fibrosis. Cardiovasc Res 74, 196 206.)

PAGE 27

27 Figure 1 6 Domains of CTGF

PAGE 28

28 Figure 1 7. Interaction of TGF and CTGF in fibrosis

PAGE 29

29 CHAPTER 2 METHODS siRNA Design The first step in the design of a siRNA is to find the messenger RNA (mRNA) eq was used as they represent non redundant, curated and validated sequences. RefSeq mRNA sequences are referenced by unique accession numbers starting from NM or XM followed by 6 digits. Accession numbers for all the three growth factors being tested CT GF, TGF TGF R2 and GAPDH are given in Table 2 1 Targeting Coding Region For a siRNA to be effective, it should target the coding region of the gene. However, the coding region of the growth factors that is being targeted has not been sequenced in the rabbit genome. Hence, in order to improve the knockdown efficiency, three different species rabbit gene sequence s which were homologous to the coding regions of all the three species. The sequences were aligned using the software Vector NTI from Invitrogen. An initial pool of siRNA sequences were designed using the online tools of the companies Applied Biosystems and Thermo Scientific. The siRNA selections were based on the common guidelines, choosing around 21 nucleotides with TT overhangs that have 30 70% GC content. The most common sequences were then picked out and custom engineered from Dharmacon. The final t three growth factors are given in Table 2 2

PAGE 30

3 0 Off Target Effects significant homology with other genes or sequences in the genome. Hence, in order to minimize the off target effects, the sequences are searched for homology with other genes using the BLAST design tool from NCBI. There were no homologous regions to the sequences listed in the table. In addition, a nonspecific, scrambled siRNA duplex was used as a control to monitor the disruptive effects of transfection on the cell. Cell Isolation a nd Culture Primary fibroblasts were isolated from rabbit cornea. The corneas were peeled off from the eye, scrapped clean of debris and cut into sm all pieces. The cornea fragments were subsequently washed with serum (DMEM) and seeded onto 25 mm tissue culture plates using media prepared from a mixture of DMEM, 15% heat inactivated fetal bovine serum and 1.5% an tibiotic antimycotic (ABAM ). These rabbit fibroblast cells were incubated in 5% CO 2 at 37 o C. After 3 days, cells were emerging from the corneal fragments. The fragments were discarded and the cells were seeded onto T 75 flasks. The media was changed every 3 days and the cells were sub cultured if the confluency exceeded 80%. Transfection Efficiency reagents. However, to achieve maximum effectiveness, transfection optimization expe riments are required. In preparation for transfection, cells from T 75 flasks are trypsinized and plated onto 96 well plates. The cells were serum starved for 48 hours. The cells were transfected with GAPDH specific siRNA (2uM) duplex and a scrambled siR NA (2uM) using Mirus transfection reagent (0.3uL, 0.5uL and 0.7uL). The media was

PAGE 31

31 changed to normal growth medium after 6 hour and back to serum free after 24 hours. The cells were tested 48 hours after transfection using the KDalert Tm GAPDH analysis kit (Applied Biosystems). Also as controls, the corneal fibroblasts were either untreated or treated only with Mirus transfection reagent. KDalert Tm Stimulation Experiment To stimulate the expression CTGF, TGF 1 and TGF R2, rabbit corneal fibroblast cells were seeded and cultured in three 96 well plates. They were serum starved for 48 hours. CTGF was stimulated by treating one of the plates with TGF 1 (3 doses) while TGF 1 and TGF R2 were stimulated by treating the plates with v arying concentrations of estradiol (3 doses) dissolved in Absolute ethanol and salt solution. 24 hours after the final dose, the medium was collected in micro centrifuge tubes while cell lysates were extracted using cell lysis buffer prepared from PBS supp lemented with 0.1% Triton X and protease inhibitors (Roche Cat#1836153). The extracts were stored at 20 o C until further analysis. TGF 1 Quantitation The frozen samples were thawed on ice. An enzyme linked immunosorbent assay (ELISA) kit specific for the quantitation of TGF 1 was purchased from R&D Systems, Inc and used according to the protocol provided. A standard sandwich ELISA incorporating an immobilized primary antibody in each well of a 384 well Nunc plate was performed. The latent TGF 1 in sampl es must be activated to an immunoreactive form that can be detected by an ELISA. Hence, the samples were treated with 1N HCl and incubated at room temperature for 10 minutes. They were then neutralized by a mixture of 1.2N NaOH and 0.5M HEPES. The activate d samples were then added to plates seeded with primary antibody overnight. The plates were washed with a washing buffer

PAGE 32

32 (0.05% Tween20 in PBS) after each step to remove any non specifically bound proteins. A biotin linked secondary antibody was added and incubated with streptavidin conjugated to horseradish peroxide for 20 minutes. The reaction was visualized by the addition of a substrate solution (H 2 O 2 and tetramethylbenzidine) followed by the addition of a stop solution (2N H 2 SO 4 ). The plates are read o n a spectrophotometer at 450nm. CTGF and TGF R2 Protein Quantitation CTGF and TGF R2 protein quantitation were performed in a similar manner as previously described for TGF 1 Both the proteins do not require activation to be detected by the ELISA. The antibodies for the CTGF and TGF R2 were separately ordered from R&D Systems. siRNA Knockdown Study Two 96 well plates, one to test the protein level knockdown and the other to test the mRNA expression knockdown, were seeded for each of the three growth f actor. The cells were serum starved for 2 days and treated with three doses of TGF 1 (4ng/ mL per day) and estradiol (8ug/ mL per day) respectively. The plates are then transfected with siRNA (15nM, 30nM, 60nM and 90nM) using the previously optimized concentration of transfection reagent. Medium was changed to DMEM after 6 hours and then back to serum free after 24 hours post transfection. For testing protein expression, medium was collected i n micro centrifuge tubes and cell extracts were lysed using a cell lysis buffer prepared from PBS supplemented with 0.1% Triton X and protease inhibitors. The RNA samples were stabilized using an RNAlater RNA Stabilization Reagent (Qiagen, Inc., Cat. # 761 04). The samples were frozen at 20 o C until further use.

PAGE 33

33 CTGF, TGF 1 a nd TGF R2 Quantitation Quantitation o f CTGF, TGF, TGF R2 mRNA u sing q RT PCR A Qiagen RNeasy mini isolation kit (Qiagen, Inc., Cat. #74104) was used rections to extract RNA from the stabilized samples. The amount of RNA in the samples was determined using a ND 2000 1 position spectrophotometer (Thermo Scientific Nano drop). The probes and primers were optimized to get the final probe and primer concent ration. gene expression assays specific to CTGF, TGF, TGF R2 and the housekeeping gene GAPDH were acquired from Applied Biosystems, Inc. and combined with the reverse transcribed cDNA and the 2 fold concentrated Universal PCR Master Mix in a 96 well PCR reaction plate. Real Time PCR (RT PCR) was performed on an Applied recommended thermal cycling conditions. The relative gene expression of the growth factors was calcul ated using the 2 method. Statistical Analysis All statistical analyses were conducted using GraphPad prism version 5.00 for Windows (GraphPad Software, San Diego California USA, www.graphpad.com ). All observed s tatistical differences in this thesis that were in excess of a 95% confidence interval were considered statistically significant. For protein expression comparisons, Analysis of Variances (ANOVA) was performed between control, scrambled and all of the siRN A samples. Tukeys post hoc assessments were performed to elucidate the magnitude of the differences.

PAGE 34

34 Table 2 1. Accession number of target growth factors Growth Factor Species Accession Number CTGF Human Rat Rabbit Mouse NM_001901 NM_022266.2 AB217855.1 NM_010217 TGF R2 Human Rat Rabbit Mouse NM_001024847.2 NM_031132 BD061291.1 NM_009371 TGF 1 Human Rat Rabbit Mouse NM_000660 NM_021578 XM_002722312.1 NM_011577.1 Table 2 2 siRNA target sequences Growth Factor Target sequences CTGF AAGCTGACCTGGAAGAGAA AAGAAGAGCATGATGTTCA AAGAAGGGCAAGAAGTGCA TGF R2 GGAAAGAACATGTGAGCAA CGACAGGACTATAAAGATA CAAACTACCTACAGAGATT TGF 1 GCUGACACCCAGUGACACA GCTGAGAGGTGGAGAGGAA GGAGAGAGCTAAACAGAAG Table 2 3 RT PCR Primers and probe sequences Growth Factor Species Accession Number CTGF Forward Reverse Probe AGGAGTGGGTGTGTGATGAG CCAAATGTGTCTTCCAGTCG ACCACACCGTGGTTGGCCCT TGF R2 Forward Reverse Probe CGTCGAGACTCCATCTCAAA AAACAGCCCACAAATGTCAA TCAGCTTTGCACAAGGGCCCT TGF 1 Forward Reverse Probe CCTGTACAACCAGCACAACC CGTAGTACACGATGGGCAGT CTCCAGCGCCTGTGGCACAC GAPDH Forward Reverse Probe GAGACACGATGGTGAAGGTC ACAACATCCACTTTGCCAGA CCAATGCGGCCAAATCCGTT

PAGE 35

35 CHAPTER 3 RESULTS T ransfection reagent s were used to transfect the RBCF cells with the designed siRNAs. RBCF cells were cultured and seeded onto 96 well plates. Following 48 hours of serum starvation, the cells were transfected with pre designed commercially available GAPDH siRNA using the silencer siRNA transfection kit (Ambion). The KDalert Tm GAPDH Assay measures the conversion of NAD+ to NADH by GAPDH in the presence of phosphate and G 3 P. Under the re commended assay conditions, the rate of NADH production is proportional to the amount of GAPDH enzyme present. This assay can hence be used to quantitatively determine the amount of GAPDH protein in a sample. Optimal balance factor (OBF) takes into account both knockdown efficiency and the effect of a scrambled siRNA on cells. Different reagent concentrations were tested to optimize transfection complex formation ( Applied Bio systems, 2009 ) 615 Neg % knockdown = 615 Neg {1 00 [ 100 x ( 615 GAPDH / 615 Neg )]} It has been reported in the literature that estradiol stimulated the production of TGF ( Takahashi et al., 1994 ; Wira et al., 2002 ) TGF was similarly used as a stimulant for increasing the concentration of CTGF. In separate experiments, various concentrations of both the stimulants were tested. I t was found that a three day dose of estradiol (8ug/ mL ) and TGF (4ng/ mL ) as opposed to a single high dose resulted in an increase in the concentration of TGF and CTGF respectively More specifically, t he re was an increase in the protein concentration in the media when compared to the cell extract. This can probably be explained by the fact that both TGF 1 and CTGF are secreted proteins.

PAGE 36

36 Following stimulation, the protein level knockdown efficiency of the siRNA sequences was calculated by performing ELISA on the stimulated cell cultures Both the media and the cell extract were tested and compared against the controls to calculat e knockdown. The results were analyzed using ANOVA and the sequences with significant knockdown were further analyzed using q RT PCR. Custom designed probes and primers were designed for each of the three growth factors. The q RT PCR results showed that the re was reduced mRNA level expression in the samples when compared with the controls, confirming knockdown efficiency of the siRNA sequences. Experiment I Stimulation of TGF 1 The effect of estradiol on TGF 1 production by Rabbit corneal fibrobl asts in culture is given in Figure 3 3. Isolated Rabbit corneal fibroblast cells were treated with varying concentrations of estradiol for 1, 2, and 3 days and incubated in serum free media for 3 days. Following a change of media at 1 and 2 day of culture, media and cell extract was collected 24 h later (day 4 ). The isolated media and cell extract were collected and stored at 20 o C until assayed for TGF 1 as described in Materials and Methods (n =3). Figure 3 3 and Figure 3 4 show the result of ELISA on bot h the cell extract and media. In the cell extract, there was no major increase in the concentration of TGF 1 when compared to the controls. However in the media, at a stimulation concentration of 8ug/ mL per day, there was a definite increase in the levels of TGF 1 when compared to the controls.

PAGE 37

37 TGF 1 Knockdown Experiment Isolated Rabbit corneal fibroblast cells were treated with the previously optimized, 8 ug/ mL concentration of estradiol for 1, 2, and 3 days and incubated in serum free media for 3 days Following a change of media at day 1 of culture, the cells were transfected with the designed siRNA sequences. Four different concentrations of siRNA 15nM, 30nM, 60nM and 90nM were experiment ed for transfection. As optimized by the previous experiment, a concentration of 0.3uL of t ransfection reagent was used for all siRNA transfection. Six hours following transfection, the media was changed to normal growth media with 15% Fetal Bovine Serum to buffer the effect of transfection on the cells. 18 hours af ter the media change the cells are reverted back to serum free media. The remaining two doses of estradiol we re administered on days 2 and 3. The isolated media and cell extract were collected on Day 4 and stored at 20 o C until assayed for TGF 1 as described in Materials and Methods (n =3). Figure 3 5. gives the result of ELSIAs performed on the extracted media and cell extract. The graph shows the concentration of TGF 1 over different concentrations of siRNA. The arrow bars represent the standard d eviation and the symbol over the bars signify statistically significant data where p<0.05. It was observed that, when compared to controls, the concentration of TGF 1 was significantly reduced in the media of cells treated with siRNA sequences 1 and 2 a t concentrations of 15nM and 30nM. Although there was significant reduction in the TGF 1 concentration in the cell extract of cells treated with siRNA concentration of 15nM, none of the other samples show significant reduction. The results were further c orroborated by calculating the respective knockdown percentages of the siRNA treatments. Figure 3 6 and 3 7 give the media and cell extract

PAGE 38

38 knockdown percentages of the siRNA sequences. The results show that the highest knockdown percentage obtained by usi ng siRNA1 was 88% at a concentration of 30nM while siRNA 2 at concentrations of 60nM respectively gave a knockdown percentage of 89% in the media extract No knockdown exceeding 60% was observed in the cell extract of the samples. mRNA was extracted f rom samples in which there was significant knockdown observed. These samples were then subjected to q RT PCR to measure the mRNA protocol. GAPDH was used as the control Figure 3 8 gives the mRNA level knockdown percentages obtained by performing q RT PCR. The resulting knockdown percentages obtained were similar to those obtained from ELISA at the protein level. siRNA 1 at a concentration of 30nM showed a knockdown perc entage of 94% while siRNA 2 gave a knockdown percentage of 88% at a concentration of 60nM. Figure 3 9. shows the ratio of expression of the samples when compared to the scrambled cells. The cells without transfection had the highest ratio of expression of 1.0 when compared to the transfected cells. Although the scrambled siRNA were designed not to affect the expression, it does have a slight effect probably due to the stress on cells from the transfection process. Experiment II Stimulation of CTGF The effect of TGF 1 on CTGF production by Rabbit corneal fibroblasts in culture is given in Figure 3 9 Isolated Rabbit corneal fibroblast cells were treated with varying concentrations of TGF 1 for 1, 2, and 3 days and incubated in serum free media for 3 days Following a change of media at 1 and 2 day of culture, media and cell extract was

PAGE 39

39 collected 24 h later (day 4). The isolated media and cell extract were collected and stored at 20 o C until assayed for C TGF as described in Materials and Methods (n =3). Fig ure 3 10 and Figure 3 11 show the result of ELISA on both the cell extract and media. In the cell extract, there was no major increase in the concentration of C TGF when compared to the controls. However in the media, at a stimulation concentration of 4n g/ m L per day, there was a definite increase in the levels of TGF 1 when compared to the controls. Single high doses of 10 ng/ mL and 20 ng/ mL also failed to stimulate the production of TGF 1 Effective knockdown was calculated for all three administered siRN As based on the level of protein concentration in the controls. The mean knockdown percentage of the triplicates was calculated to get an average value. siRNA sequences 3 w as found to be effective in knocking down the protein concentration levels of C TGF The knockdown percentages were calculated relative to that of the scrambled siRNA. The knockdown percentages were similar to those calculated from the protein level concentrations. The triplicate samples were tested in duplicates. CTGF Knockdown Experiment Isolated Rabbit corneal fibroblast cells were treated with the previously optimized, 4 n g/ mL concentration of TGF 1 for 1, 2, and 3 days and incubated in serum free media for 3 days. Following a change of media at day 1 of culture, the cells were transfected with the designed siRNA sequences. Four different concentrations of siRNA 15nM, 30nM, 60nM and 90nM were experiment ed for transfection. As optimized by the previous experiment, a concentration of 0.3uL of t ransfection reagent was used for all siRNA transfection. Six hours following transfection, the media was changed to normal growth media with 15% Fetal Bovine Serum to buffer the effect of transfection

PAGE 40

40 on the cells. 18 hours after the media change the cells are reverted back to serum free med ia. The remaining two doses of TGF 1 are administered on days 2 and 3. The isolated media and cell extract were collected on Day 4 and stored at 20 o C until assayed for CTGF as described in Materials and Methods (n =3). Figure 3 12. gives the result of ELSI As performed on the extracted media and cell extract. The graph shows the concentration of CTGF over different concentrations of siRNA. The arrow bars represent the standard deviation and the symbol over the bars signify statistically significant data wh ere p<0.05. It was observed that, when compared to controls, the concentration of CTGF was significantly reduced in the media of cells treated with siRNA 3 at a concentration of 60nM. There was significant reduction in the CTGF concentration in the cell ext ract of cells treated with siRNA concentration of 90nM. However, the knockdown effects were observed only at a high concentration of siRNA and none of the other samples show significant reduction. The results were further corroborated by calculating the r espective knockdown percentages of the siRNA treatments. Figure 3 13 and 3 14 give the media and cell extract knockdown percentages of the siRNA sequences. The results show that the highest knockdown percentage obtained by using siRNA 3 was around 8 0% at a concentration of 6 0nM in the media extract No knockdown percentage exceeding 60% was observed in the cell extract of the samples. mRNA was extracted from samples in which there was significant knockdown observed. These samples were then subjected to q RT PCR to measure the mRNA protocol. GAPDH was used as the control Figure 3 15 gives the mRNA level

PAGE 41

41 knockdown percentages obtained by performing q RT PCR. Although, the q RT PCR results show some knockdown for siRNA 3 sequence s at 60nM concentration the standard deviation of the results were high Figure 3 16. shows the ratio of expression of the samples when compared to the scrambled cells. The cells without transfe ction had the highest ratio of expression of 1.0 when compared to the transfected cells. However, t he standard deviations of all the samples were high to make meaningful conclusions Experiment III TGF R2 Knockdown Experiment Isolated Rabbit corneal fibroblast cells were treated with the previously optimized, 8 u g/ mL concentration of estradiol for 1, 2, and 3 days and incubated in serum free media for 3 days. Following a change of media at day 1 of culture, the cells were transfected with the designed siRNA sequences. Four different concentrations of siRNA 15nM, 30nM, 60nM and 90nM were experiment ed for transfection. As optimized by the previous experiment, a concentration of 0.3uL of transfection reagent was used for all siRNA transfection. Six hours following transfection, the media was changed to normal growth media with 15% Fetal Bovine Serum to buffer the effect of transfection on the cells. 18 hours after the media change the cells are reverted back to serum free media. The remaining tw o doses of estradiol are administered on days 2 and 3. The isolated media and cell extract were collected on Day 4 and stored at 20 o C until assayed for TGF R2 as described in Materials and Methods (n =3). Figure 3 1 7 gives the result of ELSIAs performed o n the extracted media and cell extract. The graph shows the concentration of TGF R2 over different concentrations of siRNA. The arrow bars represent the standard deviation and the symbol over the bars

PAGE 42

42 signify statistically significant data where p<0.05. It was observed that, when compared to controls, the concentration of TGF R2 was significantly reduced in the media of cells treated with siRNA sequence 1 at a concentration of 90 nM. Although knockdown of TGF R2 concentration was observed in the cell ex tract of cells treated with siRNA there was no significant reduction observed. However, the knockdown effects were observed only at a high concentration of siRNA and none of the other samples show significant reduction. The results were further corroborat ed by calculating the respective knockdown percentages of the siRNA treatments. Figure 3 1 8 and 3 1 9 give the media and cell extract knockdown percentages of the siRNA sequences. The results show that the highest knockdown percentage obtained by using siRN A 1 was around 7 0% at a concentration of 9 0nM in the media extract No knockdown percentage exceeding 60% was observed in the cell extract of the samples. In all of the following graphs, standard deviation s are presented as air bars and statistically significant data are represented as where p < 0.01.

PAGE 43

43 Figure 3 1. Transfection r eagent optimization results, k nockdown percentage Figure 3 2. Transfection r eagent optimization result s, o ptimal b alance factor.

PAGE 44

44 Figure 3 3 TGF 1 stimulation c ell e xtract

PAGE 45

45 Figure 3 4. TGF 1 stimulation m edia (Arrow mark indicates highest concentration )

PAGE 46

46 Figure 3 5. TGF 1 siRNA knockdown ELISA r esults

PAGE 47

47 Figure 3 6. TGF 1 siRNA knockdown percentage, m edia (Arrow mark indicates highest knockdown)

PAGE 48

48 Figure 3 7. TGF 1 siRNA knockdown percentage c ell

PAGE 49

49 Figure 3 8. TGF 1 siRNA knockdown q RT PCR results knockdown

PAGE 50

50 Figure 3 9. TGF 1 siRNA knockdown q RT results ratio of expression

PAGE 51

51 Figure 3 10. CTGF s timulation, c ell

PAGE 52

52 Figure. 3 11 CTGF stimulation m edia (Arrow mark indicates highest concentration )

PAGE 53

53 Figure 3 12. CTGF knockdown ELISA r esults

PAGE 54

54 Figure 3 13. CTGF siRNA knockdow n percentage, m edia (Arrow mark indicates highest knockdown)

PAGE 55

55 Figure 3 14. CTGF siRNA knockdown percentage c ell

PAGE 56

56 Figure 3 15. CTGF siRNA knockdown q RT results

PAGE 57

57 Figure 3 16. CTGF siRNA knockdown q RT results

PAGE 58

58 Figure 3 17. TGF R2 siRNA knockdown ELISA r esults

PAGE 59

59 Figure 3 18. TGF R2 siRNA knockdown percentage, m edia

PAGE 60

60 Figure 3 19. TGF R2 siRNA knockdown percentage c ell

PAGE 61

61 CHAPTER 4 DISCUSSION The goal of this study was to evaluate the knockdown efficiencies of different custom designed siRNA sequences against TGF 1, TGF R2 and CTGF at the protein as well as the mRNA level. Literature reports that TGF regulated at wounded sites when compared to the normal tissue. It has also been shown that CTGF act s as a downstream mediator of TGF during the wound healing process ( Grotendorst, 1997 ) It was hypothesized that blocking the expression of CTGF and TGF would help regulate the scarring of tissues. The mRNA sequences of human, mouse, rat and rabbit s were aligned to check their homology. The coding regions of all the mRNA sequences were found to be highly similar. In this regard, potent siRNA sequences with high knockdown efficiency against each of the three identified growth factors were identified. Ocular fibrotic wound response is a major cause of impaired vision and blindness, especially following surgical treatment for glaucoma ( Migdal et al., 1994 ) Excessive post operative scarring often leads to failure of filtration surgery While conjuctival anti scarring treatments like mitomycin C and 5 fluorouracil benefit a number of patients, these agents are associated with potentially blinding complications includ ing hypotony, maculopathy and infection ( Cordeiro et al., 1999b ; Khaw et al., 1993 ) Therefore, an important target in preventing inflammation and fibrosis is to sequester mature TGF and CTGF Antibodies to TGF ( Jester et al., 1997 ) ,TGF R2 ( Khaw et al., 1993 ) and CTGF ( Blalock et al., 2003 ) have been reported to reduce conjuctival scarring. In addition, antisense oligonucleotides and ribozymes were also shown to be effec tive in wound healing in animal and cell culture studies ( Blalock et al., 2003 ; Cordeiro et al.,

PAGE 62

62 2003 ) However, the neutralizing antibody approach exhibits relatively weak effects in general as it may not gain full access to the targeted molecules ( Yamamoto et al., 2000 ) Antisense phosphorothioate oligonucleotides and ribozymes can be successful, but their effectiveness stability, and specificity are still in debate ( Stein, 2001 ) It should also be noted that the TGF 1 and CTGF produced in lachrymal glands secreted into tears would not b e altered by treatment of the cornea. The concentrations of the siRNA are generally in the range, whereas our present study shows that TGF 1 siRNA is efficacious at 15nM. Experiment I The production of TGF 1 was greater in the culture media of cells treated with estradiol when compared to the unstimulated controls. Although, the concentration of TGF 1 in the cell extract was higher than in the media, the amount of stimulation was lower ( Annes et al., 2003 ) In other words, the difference in the levels of concentration between the controls and the stimulated samples were higher in the media than in the cell extract. This could be due to the fact that TGF 1 is a secreted protein and a preset amount of la tent TGF 1 is already sequestered in the cell. Hence, in response to the stimulation this latent TGF 1 would be activated, initiating the cell response to the stimulation. This accounts for the high concentration of TGF 1 in the cell extract. The siRNA sequences were tested at various concentrations. Two of the designed siRNA sequences gave significant knockdown percentages at lower concentrations of 15nM and 30nM. The knockdown percentages were also similar when compared to both the media and cell extr act. siRNA 3 may not have targeted the coding region, which may be the reason for the lower knockdown percentages.

PAGE 63

63 The samples with significant knockdown percentages were subjected to q RT PCR analysis. The relative expression of stimulated cells without si RNA transfection was higher than the cells transfected with siRNA. Although the scrambled siRNA did not target a coding region and was not supposed to reduce the expression, there was a slight reduction in the average relative expression. This may be due t o the stress on a cell during the transfection process. The knockdown percentages were calculated from the relative expression. The results show that there is no knockdown observed in the controls. Also, the knockdown percentages of the siRNA sequences wer e similar to those observed in protein level using ELSIA. Experiment II The production of C TGF was greater in the culture media of cells treated with estradiol when compared to the unstimulated controls. CTGF being a secreted protein would be expected to have a higher concentration in the media than the cell extract. Only one of the three designed siRNA sequences (siRNA sequence 3) gave significant knockdown when compared to the controls. This may be due to the fact that the siRNA sequences designed did n ot target the coding region. In the cell extract, there were significant knockdown percentages at 90nM concentration of three siRNA sequences. However, these sequences might not be the most efficient in knocking down due to the high concentration of siRNA required for their effect. mRNA samples from siRNA sequence 3 along with a dummy inefficient siRNA was isolated and subjected to q RT PCR analysis. Although there was some knockdown observed, the results from the q RT PCR were inconclusive. The standard de viations of the controls were high due to low number of verifiable data. This may have been due to inefficient design of primer sequences.

PAGE 64

64 Experiment III The production of TGF R2 was greater in the cell extract of cells treated with estradiol when compare d to the unstimulated controls. TGF R2 being a membrane bound protein would be expected to have a higher concentration in the cell extract than the media ( Nakamura et al., 2004 ) None of the siRNA sequences showed significant knockdown when compared to the controls. siRNA sequence 1 showe d significant knockdown percentage in the media at a high concentration of 90nM. However, there was no corresponding knockdown in the cell extracts and hence was not verifiable. The reason for such low knockdown percentages may be that the sequences are no t targeting the coding region of the TGF R2 gene. mRNA samples from siRNA sequence 1 along with a dummy inefficient siRNA was isolated and subjected to q RT PCR analysis. No results were observed from the q RT PCR analysis. This may be due to inefficient design of primers or there might not have been a sufficient quantity of mRNA isolated from the samples. The experiments successfully indicate that the expressions of TGF 1, TGF R2 and CTGF can be silenced by efficiently designed siRNA sequences. Both the protein level concentrations as well as the mRNA expressions were tested and evaluated to prove this effect.

PAGE 65

65 CHAPTER 5 CONCLUSIONS Overall Conclusions In this study, we had investigated the knockdown percentages of three individual siRNA sequences designed against three growth factors namely TGF 1, CTGF and TGF R2. Prior to the knockdown experiments, the expression of these growth factors were stimu lated to mimic the cellular wound healing process. The siRNA sequences designed for TGF 1 gave significant knockdown in both the protein and mRNA level. Future Work CTGF acts as a downstream mediator of TGF in promoting scar formation. Both CTGF mRNA a nd CTGF protein are induced by TGF in fibroblastic cells. Hence, a siRNA sequence targeting TGF 1 should in theory knockdown the activity of CTGF. Protein and mRNA level expression of CTGF in the samples from TGF 1 siRNA knockdown experiments should be tested for CTGF knockdown. Although we observed some protein level knockdown in the CTGF knockdown experiments, the q RT PCR results were not verifiable. The primer sequences have to be redesigned and the q RT PCR analysis has to be repeated. Finally in the TGF R 2 experiments, we were not able to observe significant knockdown in the cell extract nor were we able to obtain q RT PCR results. Thus, the siRNA sequences and the primers have to be redesigned and tested again. The overall design of the experim ent can further be improved by testing the viability of delivering two siRNA sequences together at the same time. This may in theory knockdown both the growth factors at the same time, making it more efficient. Increasing the number of markers associated w ith the activity of growth factors can also

PAGE 66

66 increase the confidence with which the knockdown can be established. The final step in advancing the experiment would be to test the siRNA sequences in animal models. This would enable us to observe the off targe t effects of the siRNA sequences.

PAGE 67

67 Table 5 1. TGF 1 Knockdown percentages, protein and mRNA level Groups Media Cell extracts q RT PCR Results

PAGE 68

68 APPENDIX A TGF 1 ALIGNMENT SEQUENCE S

PAGE 69

69

PAGE 70

70

PAGE 71

71

PAGE 72

72

PAGE 73

73

PAGE 74

74

PAGE 75

75

PAGE 76

76

PAGE 77

77

PAGE 78

78

PAGE 79

79

PAGE 80

80

PAGE 81

81

PAGE 82

82

PAGE 83

83 APPENDIX B TGF R2 ALIGNMENT SEQUENC ES

PAGE 84

84

PAGE 85

85

PAGE 86

86

PAGE 87

87

PAGE 88

88

PAGE 89

89

PAGE 90

90

PAGE 91

91

PAGE 92

92

PAGE 93

93

PAGE 94

94

PAGE 95

95

PAGE 96

96

PAGE 97

97

PAGE 98

98

PAGE 99

99

PAGE 100

100

PAGE 101

101

PAGE 102

102

PAGE 103

103

PAGE 104

104

PAGE 105

105

PAGE 106

106

PAGE 107

107

PAGE 108

108

PAGE 109

109

PAGE 110

110

PAGE 111

111 APPENDIX C CTGF ALIGNMENT SEQUE NCES

PAGE 112

112

PAGE 113

113

PAGE 114

114

PAGE 115

115

PAGE 116

116

PAGE 117

117 LIST OF REFERENCES Amarzguioui, M. and Prydz, H. (2004). An algorithm for selection of functional siRNA sequences. Biochem Biophys Res Commun 316 1050 8. Angaji, S. A., Hedayati, S. S., Poor, R. H., Madani, S., Poor, S. S. and Panahi, S. (2010). Application of RNA interference in treating human diseases. J Genet 89 527 37. Annes, J. P., Munger, J. S. and Rifkin, D. B. (2003). Making sense of latent TGFbeta activation. J Cell Sci 116 217 24. Applied Biosystems (2009). KDalert GAPDH Assay kit. Bernstein, E., Caudy, A. A., Hammond, S. M. and Hannon, G. J. (2001). Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409 363 6. Blalock, T. D., Duncan, M. R., Varela, J. C., Goldst ein, M. H., Tuli, S. S., Grotendorst, G. R. and Schultz, G. S. (2003). Connective tissue growth factor expression and action in human corneal fibroblast cultures and rat corneas after photorefractive keratectomy. Invest Ophthalmol Vis Sci 44 1879 87. Chu C. Y. and Rana, T. M. (2006). Translation repression in human cells by microRNA induced gene silencing requires RCK/p54. PLoS Biol 4 e210. Cordeiro, M. F., Gay, J. A. and Khaw, P. T. (1999a). Human anti transforming growth factor beta2 antibody: a new glaucoma anti scarring agent. Invest Ophthalmol Vis Sci 40 2225 34. Cordeiro, M. F., Mead, A., Ali, R. R., Alexander, R. A., Murray, S., Chen, C., York Defalco, C., Dean, N. M., Schultz, G. S. and Khaw, P. T. (2003). Novel antisense oligonucleotides targeting TGF beta inhibit in vivo scarring and improve surgical outcome. Gene Ther 10 59 71. Cordeiro, M. F., Reichel, M. B., Gay, J. A., D'Esposita, F., Alexander, R. A. and Khaw, P. T. (1999b). Transforming growth factor beta1, beta2, and beta3 in vivo: effects on normal and mitomycin C modulated conjunctival scarring. Invest Ophthalmol Vis Sci 40 1975 82. Dykxhoorn, D. M., Palliser, D. and Lieberman, J. (2006). The silent treatment : siRNAs as small molecule drugs. Gene Ther 13 541 52. Eraslan, M. and Toker, E. (2009). Mechanisms of Corneal Wound Healing and its modulation following Refractive Surgery. Marmara Medical Journal 22 169 178. Fire, A. (1999). RNA triggered gene silenc ing. TIG 15 358.

PAGE 118

118 Grotendorst, G. R. (1997). Connective tissue growth factor: a mediator of TGF beta action on fibroblasts. Cytokine Growth Factor Rev 8 171 9. Grotendorst, G. R. and Duncan, M. R. (2005). Individual domains of connective tissue growth fa ctor regulate fibroblast proliferation and myofibroblast differentiation. FASEB J 19 729 38. Hammond, S. M., Boettcher, S., Caudy, A. A., Kobayashi, R. and Hannon, G. J. (2001). Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293 1146 50. Hornung, V., Guenthner Biller, M., Bourquin, C., Ablasser, A., Schlee, M., Uematsu, S., Noronha, A., Manoharan, M., Akira, S., de Fougerolles, A. et al. (2005). Sequence specific potent induction of IFN alpha by short interfering RNA in pla smacytoid dendritic cells through TLR7. Nat Med 11 263 70. Jackson, A. L., Burchard, J., Schelter, J., Chau, B. N., Cleary, M., Lim, L. and Linsley, P. S. (2006). Widespread siRNA "off target" transcript silencing mediated by seed region sequence complem entarity. RNA 12 1179 87. Jackson, A. L. and Linsley, P. S. (2010). Recognizing and avoiding siRNA off target effects for target identification and therapeutic application. Nat Rev Drug Discov 9 57 67. Jester, J. V., Barry Lane, P. A., Petroll, W. M., Olsen, D. R. and Cavanagh, H. D. (1997). Inhibition of corneal fibrosis by topical application of blocking antibodies to TGF beta in the rabbit. Cornea 16 177 87. Khan, A., Benboubetra, M., Sayyed, P. Z., Ng, K. W., Fox, S., Beck, G., Benter, I. F. and A khtar, S. (2004). Sustained polymeric delivery of gene silencing antisense ODNs, siRNA, DNAzymes and ribozymes: in vitro and in vivo studies. J Drug Target 12 393 404. Khaw, P. T., Doyle, J. W., Sherwood, M. B., Grierson, I., Schultz, G. and McGorray, S. (1993). Prolonged localized tissue effects from 5 minute exposures to fluorouracil and mitomycin C. Arch Ophthalmol 111 263 7. Kim, S. S., Garg, H., Joshi, A. and Manjunath, N. (2009). Strategies for targeted nonviral delivery of siRNAs in vivo. Trends Mol Med 15 491 500. Lu, L., Reinach, P. S. and Kao, W. W. (2001). Corneal epithelial wound healing. Exp Biol Med (Maywood) 226 653 64. Martinez, J., Patkaniowska, A., Urlaub, H., hrmann, R. L. and Tuschl, T. (2002). Single Stranded Antisense siRNAs guide target RNA cleavage in RNAi. Cell 110 563 574.

PAGE 119

119 Massague, J. (1998). TGF beta signal transduction. Annu Rev Biochem 67 753 91. Massague, J. (2000). How cells read TGF beta signals. Nat Rev Mol Cell Biol 1 169 78. Migdal, C., Gregory, W. and Hitchings, R. (1994). Long term functional outcome after early surgery compared with laser and medicine in open angle glaucoma. Ophthalmology 101 1651 6; discussion 1657. Mirus. (2011). TransIT TKO Transfection Reag ent protocol. Nakamura, H., Siddiqui, S. S., Shen, X., Malik, A. B., Pulido, J. S., Kumar, N. M. and Yue, B. Y. (2004). RNA interference targeting transforming growth factor beta type II receptor suppresses ocular inflammation and fibrosis. Mol Vis 10 703 11. O'Kane, S. and Ferguson, M. W. J. healing. The International Journal of Biochemistry & Cell Biology Volume 29 63 78 Peer, D., Park, E. J., Morishita, Y., Carman, C. V. and Shimaoka, M. (2008). Syst emic leukocyte directed siRNA delivery revealing cyclin D1 as an anti inflammatory target. Science 319 627 30. Robbins, M., Judge, A., Ambegia, E., Choi, C., Yaworski, E., Palmer, L., McClintock, K. and MacLachlan, I. (2008). Misinterpreting the therapeu tic effects of small interfering RNA caused by immune stimulation. Hum Gene Ther 19 991 9. Saharinen, J., Taipale, J. and Keski Oja, J. (1996). Association of the small latent transforming growth factor beta with an eight cysteine repeat of its binding p rotein LTBP 1. EMBO J 15 245 53. Samuel Abraham, S. and Leonard, J. N. (2010). Staying on message: design principles for controlling nonspecific responses to siRNA. FEBS J 277 4828 36. Shim, M. S. and Kwon, Y. J. (2008). Controlled delivery of plasmid DNA and siRNA to intracellular targets using ketalized polyethylenimine. Biomacromolecules 9 444 55. Shim, M. S. and Kwon, Y. J. (2010). Efficient and targeted delivery of siRNA in vivo. FEBS J 277 4814 27. Song, Q. H., Singh, R. P., Richardson, T. P., Nugent, M. A. and Trinkaus Randall, V. (2000). Transforming growth factor beta1 expression in cultured corneal fibroblasts in response to injury. J Cell Biochem 77 186 99. Stein, C. A. (2001). The experimental use of antisense oligonucleotides: a guide for the perplexed. J Clin Invest 108 641 4.

PAGE 120

120 Stevenson, M. (2004). Therapeutic potential of RNA interference. N Engl J Med 351 1772 7. Takahashi, T., Eitzman, B., Bossert, N. L., Walmer D., Sparrow, K., Flanders, K. C., McLachlan, J. and Nelson, K. G. (1994). Transforming growth factors beta 1, beta 2, and beta 3 messenger RNA and protein expression in mouse uterus and vagina during estrogen induced growth: a comparison to other estrogen regulated genes. Cell Growth Differ 5 919 35. Tiemann, K. and R ossi, J. J. (2009). RNAi based therapeutics current status, challenges and prospects. EMBO Mol Med 1 142 51. Walton, S. P., Wu, M., Gredell, J. A. and Chan, C. (2010). Designing highly active siRNAs for therapeutic applications. FEBS J 277 4806 13. Wir a, C. R., Roche, M. A. and Rossoll, R. M. (2002). Antigen presentation by vaginal cells: role of TGFbeta as a mediator of estradiol inhibition of antigen presentation. Endocrinology 143 2872 9. Yamamoto, K., Morishita, R., Tomita, N., Shimozato, T., Naka gami, H., Kikuchi, A., Aoki, M., Higaki, J., Kaneda, Y. and Ogihara, T. (2000). Ribozyme oligonucleotides against transforming growth factor beta inhibited neointimal formation after vascular injury in rat model: potential application of ribozyme strategy to treat cardiovascular disease. Circulation 102 1308 14. Yin, J. Q. and Wan, Y. (2002). RNA mediated gene regulation system: now and the future (Review). Int J Mol Med 10 355 65. Yu, F. S., Yin, J., Xu, K. and Huang, J. (2010). Growth factors and corn eal epithelial wound healing. Brain Res Bull 81 229 35. Zimmermann, T. S., Lee, A. C., Akinc, A., Bramlage, B., Bumcrot, D., Fedoruk, M. N., Harborth, J., Heyes, J. A., Jeffs, L. B., John, M. et al. (2006). RNAi mediated gene silencing in non human prima tes. Nature 441 111 4.

PAGE 121

121 BIOGRAPHICAL SKETCH Sriniwas Sriram was born in 1987 in Chennai, India. He graduated from Sathyabama University in 2002 with a bachelor of technology in biomedical engineering. He fulfilled his lifelong ambition of studying in the United States when he was granted admission to a graduate degree in the University of Florida. An internship in the Carnegie Melon University in the summer of 2010 piqued his interest in the field of RN A interference. Subsequently in the next semester he joined the lab of Dr. Schultz and began working on a treatment to control excessive corneal scarring He successfully defended his thesis and completed his graduate studies in May 2011. On a personal l evel, Sriniwas loves football and is a passionate fan of Chelsea football club. Watching Chelsea play live still remains one of his unfulfilled dreams.