<%BANNER%>

Th17 Associated Profiles in Type 1 Diabetes

Permanent Link: http://ufdc.ufl.edu/UFE0043024/00001

Material Information

Title: Th17 Associated Profiles in Type 1 Diabetes
Physical Description: 1 online resource (52 p.)
Language: english
Creator: MYHR,COURTNEY B
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: 1 -- AUTOIMMUNITY -- DIABETES -- EXPRESSION -- GENE -- IL17 -- IL18 -- IMMUNOLOGY -- POLARIZATION -- TH17 -- TYPE
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Th17 Associated Profiles in Type 1 Diabetes Conflicting reports exist in regards to the role of IL-17 producing T cells (Th17) in the non-obese diabetic mouse (NOD) model of type 1 diabetes. Both the neutralization of IL-17 and induction of IL-17 have previously been reported to prevent progression to disease under diverse experimental conditions. Furthermore, islet antigen specific Th17 cells can trigger diabetes in the NOD mouse, but in the process have been shown to convert to a Th1 phenotype. This suggests a transition between Th17 and Th1 immunity can contribute to disease formation. To date, there have been few reports on Th17 cells in human type 1 diabetes, and what studies have been published are largely focused on recently diagnosed cohorts. In this study, we characterized Th17 associated gene expression in type 1 diabetic patients with disease duration extending to 39 years. Surprisingly, given the reports in NOD mice, we did not find strong evidence for elevated Th17 profiles in unmanipulated peripheral blood or in vitro polarized T cells from type 1 diabetic patients. IL-17A transcripts were elevated in peripheral blood of type 1 diabetics, but there was no difference in expression of RORgamma, RORalpha, or IL-23. Additionally, we were unable to detect upregulation of these genes, including IL-17A, in na?ve T cells stimulated in the presence of Th17 polarizing cytokines. Due to the link between Th1 and Th17 cells in the pathogenesis of NOD mice, we also quantified transcript levels of genes involved in Th1 maturation. Interestingly, expression of IL18RAP, the beta subunit of the IL-18R, was downregulated in peripheral blood from type 1 diabetics, but upregulated during Th1 differentiation. Expression levels of IL-18 and the IL-18R alpha subunit were also dysregulated under polarization conditions. Due to these discrepancies, we measured serum IL-18 levels and found elevated levels in persons with type 1 diabetes. These findings suggest that, unlike the situation in NOD mice, elevated Th17 immunity is not associated with established type 1 diabetes in humans. In addition, these efforts highlight IL-18 and IL-18R dysregulation as a potential factor in the impaired immunoregulation of type 1 diabetes.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by COURTNEY B MYHR.
Thesis: Thesis (M.S.)--University of Florida, 2011.
Local: Adviser: Atkinson, Mark A.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043024:00001

Permanent Link: http://ufdc.ufl.edu/UFE0043024/00001

Material Information

Title: Th17 Associated Profiles in Type 1 Diabetes
Physical Description: 1 online resource (52 p.)
Language: english
Creator: MYHR,COURTNEY B
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: 1 -- AUTOIMMUNITY -- DIABETES -- EXPRESSION -- GENE -- IL17 -- IL18 -- IMMUNOLOGY -- POLARIZATION -- TH17 -- TYPE
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Th17 Associated Profiles in Type 1 Diabetes Conflicting reports exist in regards to the role of IL-17 producing T cells (Th17) in the non-obese diabetic mouse (NOD) model of type 1 diabetes. Both the neutralization of IL-17 and induction of IL-17 have previously been reported to prevent progression to disease under diverse experimental conditions. Furthermore, islet antigen specific Th17 cells can trigger diabetes in the NOD mouse, but in the process have been shown to convert to a Th1 phenotype. This suggests a transition between Th17 and Th1 immunity can contribute to disease formation. To date, there have been few reports on Th17 cells in human type 1 diabetes, and what studies have been published are largely focused on recently diagnosed cohorts. In this study, we characterized Th17 associated gene expression in type 1 diabetic patients with disease duration extending to 39 years. Surprisingly, given the reports in NOD mice, we did not find strong evidence for elevated Th17 profiles in unmanipulated peripheral blood or in vitro polarized T cells from type 1 diabetic patients. IL-17A transcripts were elevated in peripheral blood of type 1 diabetics, but there was no difference in expression of RORgamma, RORalpha, or IL-23. Additionally, we were unable to detect upregulation of these genes, including IL-17A, in na?ve T cells stimulated in the presence of Th17 polarizing cytokines. Due to the link between Th1 and Th17 cells in the pathogenesis of NOD mice, we also quantified transcript levels of genes involved in Th1 maturation. Interestingly, expression of IL18RAP, the beta subunit of the IL-18R, was downregulated in peripheral blood from type 1 diabetics, but upregulated during Th1 differentiation. Expression levels of IL-18 and the IL-18R alpha subunit were also dysregulated under polarization conditions. Due to these discrepancies, we measured serum IL-18 levels and found elevated levels in persons with type 1 diabetes. These findings suggest that, unlike the situation in NOD mice, elevated Th17 immunity is not associated with established type 1 diabetes in humans. In addition, these efforts highlight IL-18 and IL-18R dysregulation as a potential factor in the impaired immunoregulation of type 1 diabetes.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by COURTNEY B MYHR.
Thesis: Thesis (M.S.)--University of Florida, 2011.
Local: Adviser: Atkinson, Mark A.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0043024:00001


This item has the following downloads:


Full Text

PAGE 1

1 TH17 ASSOCIATED PROFILES IN TYPE 1 DIABETES By COURTNEY BLAIR MYHR A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UN IVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Courtney Blair Myhr

PAGE 3

3 ACKNOWLEDGMENTS Firstly, I must thank Dr. Mark Atkinson for volunteering his time to mentor me, and for his guidance and understanding over the years. The scope of his empathy, both profession ally and in his personal pursuits, is truly humbling and inspiring. My committee members, Drs. Eric Sobel, Sihong Song, Shannon Wallet, and Axel Heiser, have helped shape this research with their thoughtful insights. I have to thank my coworkers over the y ears for giving me the skills I have learned, while at the same time never letting a day go by without laughter. I am also grateful to Clive Wasserfall for helping pull it all together, and always keeping me on my toes. Finally, I have to thank my parents for taking it all in stride, no matter how unconventional I may be. Knowing they are there for me gives me the courage to forge my own path.

PAGE 4

4 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 3 LIST OF TABLES ................................ ................................ ................................ ............ 5 LIST OF FIGURES ................................ ................................ ................................ .......... 6 ABSTRACT ................................ ................................ ................................ ..................... 7 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ ...... 9 Type 1 Diabetes Background ................................ ................................ .................... 9 Etiology ................................ ................................ ................................ ............. 10 Autoimmunity ................................ ................................ ................................ .... 11 CD4+ T Cells ................................ ................................ ................................ .......... 13 T Helper Subsets in the Immune Response ................................ ..................... 13 T Helper 17 Cells in Autoimmunity ................................ ................................ ... 16 IL 12 Family Cytokines ................................ ................................ ..................... 18 Hypothesis ................................ ................................ ................................ .............. 18 2 MATERIALS AND METHODS ................................ ................................ ................ 20 Sample Acquisition ................................ ................................ ................................ 20 Autoantibody Determination ................................ ................................ .................... 20 Cytokine Determination ................................ ................................ ........................... 20 Cell Culture ................................ ................................ ................................ ............. 21 Quantitative PCR ................................ ................................ ................................ .... 22 Statistical Analysis ................................ ................................ ................................ .. 22 3 RESULTS ................................ ................................ ................................ ............... 25 Basal Gene Expression ................................ ................................ .......................... 25 Serum IL 17A Levels ................................ ................................ .............................. 25 Stimulated Gene Expression ................................ ................................ .................. 26 IL 18 Cytokine Levels ................................ ................................ ............................. 27 4 DISCUSSION ................................ ................................ ................................ ......... 39 LIST OF REFERENCES ................................ ................................ ............................... 43 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 52

PAGE 5

5 LIST OF TABLES Table page 2 1 Quantitative RT PCR primers. ................................ ................................ ............ 24 3 1 Characteristics of the basal gene expression study cohort. ................................ 28 3 2 Fold change in basal gene expression between type 1 diabetics and controls. 30 3 3 Characteristics of the stimulated gene expression study cohort. ........................ 33 3 4 Fol d change in anti CD3/anti CD28 stimulated gene expression between type 1 diabetics and controls. ................................ ................................ ............. 34 3 5 Fold change in Th 1 polarized gene expression between type 1 diabetics and controls. ................................ ................................ ................................ .............. 35 3 6 Fold change in Th17 polarized gene expression b etween type 1 diabetics and controls. ................................ ................................ ................................ ....... 36

PAGE 6

6 LIST OF FIGURES Figure page 1 1 Th 1 and Th17 polarizing cytokines ................................ ................................ ..... 19 3 1 Basa l gene expression discrepancies ................................ ................................ 31 3 2 Serum IL 17A concentra tion ................................ ................................ ............... 32 3 3 Stimulated gene expression trends ................................ ................................ .... 37 3 4 Serum IL 18 concentration ................................ ................................ ................. 38

PAGE 7

7 Abstract of Thes is P resented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science TH17 ASSOCIATED PROFILES IN TYPE 1 DIABETES By Courtney Blair Myhr May 2011 Chair: Mark Atkinson Major: Medical Sciences Conflicting reports exist in regards to the role of IL 17 producing T cells (Th17) in the non obese diabetic mouse (NOD) model of type 1 diabetes. Both the neutralization of IL 17 and induction of IL 17 have previously been report ed to prevent progression to disease under diverse experimental conditions. Furthermore, islet antigen specific Th17 cells can trigger diabetes in the NOD mouse, but in the process have been shown to convert to a Th1 phenotype. This suggests a transition b etween Th17 and Th1 immunity can contribute to disease formation. To date, there have been few reports on Th17 cells in human type 1 diabetes, and what studies have been published are largely focused on recently diagnosed cohorts. In this study, we charact erized Th17 associated gene expression in type 1 diabetic patients with disease duration extending to 39 years. Surprisingly, given the reports in NOD mice, we did not find strong evidence for elevated Th17 profiles in unmanipulated peripheral blood or in vitro polarized T cells from type 1 diabetic patients. IL 17A transcripts were elevated in peripheral blood of type 1 diabetics, but there was no difference in expression of ROR ROR or IL 23. Additionally, we were unable to detect upregulation of these genes, including IL 17A, in nave T cells stimulated in the presence of Th17 polarizing cytokines. Due to the link

PAGE 8

8 between Th1 and Th17 cells in the pathogenesis of NOD mice, w e also quantified transcript levels of genes involved in Th1 maturation. Interestingly, expression of IL18RAP, the beta subunit of the IL 18R, was downregulated in peripheral blood from type 1 diabetics, but upregulated during Th1 differentiation. Expressi on levels of IL 18 and the IL 18R alpha subunit were also dysregulated under polarization conditions. Due to these discrepancies, we measured serum IL 18 levels and found elevated levels in persons with type 1 diabetes. These findings suggest that, unlike the situation in NOD mice, elevated Th17 immunity is not associated with established type 1 diabetes in humans. In addition, these efforts highlight IL 18 and IL 18R dysregulation as a potential factor in the impaired immunoregulation of type 1 diabetes.

PAGE 9

9 CHAPTER 1 INTRODUCTION Type 1 Diabetes Background Type 1 diabetes, previously referred to as juvenile diabetes or insulin de pendent diabetes mellitus is an inflammatory autoimmune disease that is commonly diagnosed during childhood or adolescence, but m ay occur at any age. The global incidence of type 1 diabetes is increasing annually, with the greatest rise in cases among those aged 0 4 years (1) In the United States, an estimated 15,000 individuals under the a ge of 20 are diagnosed with the disease every year (2) The disease results from the in the pancreatic islets of Langerhans, which causes a permanent loss of insulin production. Insulin is a hormone required to maintain euglycemia, and is produced primarily n the absence of insulin signaling, cells will not absorb glucose from the bloodstream, causing the body to metabolize glycogen, protein, and lipids as energy sources The resulting blood glucose dysregulation is fatal in the absence of exogenous insulin t rea tment. Though current technologies allow for the relatively strict control of blood glucose levels through increased monitoring, hyper glycemic and hypoglycemic episodes over the course of a lifetime increase the risk of serious complications, including retinopathy, nephropathy, neuropathy, and cardiovascular disease (3, 4) To date, the only clinical procedure capable of re storing long term normoglycemia and alleviating the need for exogenous insulin tre atment has been islet or pancreas transplant ation However, the number of usable pancreata donated annually is vastly insufficient to provide treatment to the majority of those with type 1 diabetes and fewer than 10% of islet recipients remain

PAGE 10

10 insulin independent a fter 5 years (5) Due to these limitations, it is essential to develop Etiology The multifactorial etiology of type 1 diabetes is not fully understo od Studies have established that the disease has a genetic component, with first degree relatives of a person with type 1 diabetes being at greater risk of developing this disease than the general population (6) Additionally, monozy g o t ic twins h ave a disease concordance of approximate ly 50% (7) However, genetics alone cannot account for the increasing incidence of the disease, nor the incomplete penetrance among family members. Furthermore, the vast majority of new cases occur among th ose without any family history of the disease (6) An environmental factor, or a combination of such factors, must therefore also play a role in the etiology of type 1 diabetes. Genetic linkage studies have identified multiple loci associated with type 1 diabetes susceptibility, termed insulin dependent diabetes mellitus (IDDM) loci. The HLA region, IDDM1, represents 40 50% of familial genetic risk, with the greatest susceptibility conferred by HLA class II haplotype (8) Single nucleotide polymorphisms (SNPs) that confer susceptibility have al so been identified in genes located on the other IDDM loci, though each carries a smaller odds ratio than the HLA region. The insulin gene, IL2RA, and CTLA 4 are examples of such identified risk genes, and have established immunological roles (9 11) Additionally, genome wide association studies (GWA S ) have continually identified novel SNPs linked to type 1 diabetes. However, the majority of these putative risk genes have yet to be associated with a biological effect (i.e., a phenotype)

PAGE 11

11 Investigation s into environmental factors that are potentially linked to type 1 diabetes formation have largely focused on dietary components and pathogen lk and developing type 1 diabetes (12 15) Markers of viral infection have also been associated with diabetes, particularly ent eroviruses, which have even been detected with in islets (16 18) An inflammatory gut microbiome has also been implicated in immune activation (19 21) The high incidence of c onflicting reports in these studies raises the possibility that the variable genetic backgrounds of the study cohorts play a critical role in the effect of the environmental factors. All of this said, these components remain speculative and unproven; addit ional studies are required to define the exact role for environment in the pathogenesis of type 1 diabetes. Autoimmunity Type 1 diabetes was established as an autoimmune disease by the 1970s, with the discovery of islet cell cytoplasmic autoantibodies (ICA) and islet infiltrates in diabetic subjects (22, 23) In the decades since, a utoantibodies to the pancreatic antigens insulin, tyrosi ne phosphatase like protein (IA 2 A ), glutamic acid decarboxylase (GAD A ), and z inc transporter 8 (ZnT8) have also been well characterized in type 1 diabetes (24 26) However, due to the inability of autoantibodies to transfer disease in murine models, humoral immunity has not historically been seen as having a critical role in disease pathogenesis (27) Despite this, the presence of these anti islet cell autoantibodies ha s proven to be an accurate predictive marker for progression to disease onset, with a greater number of autoantibodies present indicative of greater risk (28)

PAGE 12

12 The current paradigm is that type 1 diabetes results from a T helper 1 (Th1) establishing this has been conducted in murine mo dels, particularly the non obese diabetic (NOD) mouse. Diabetes in the NOD mouse develops spontaneously with peak incidence between 10 12 weeks of age, and is characterized by an islet infiltrate similar in composition to what has been reported in human c ases (29, 30) However, there are multiple differences in disease presentation between mouse and man. In the NOD model, there is an acute progression from onset of autoimmunity to the complete destruction of islets, whereas this process is thought to take years in the majority of human cases, and intact islets have been found in humans (albeit in a minority of cases) decades after clinical diagnosis (31) Female mice are also more likely than males to progress to disease, a sex bias not present in the human disease. Perhaps the most telling discrepancy between human disease and the NOD mouse model is the efficacy of treatments. A number of interventions have been identified tha t prevent diabetes in the NOD mouse, as well as a growing list of methods to revers e established diabetes; however, clinical trials to prevent or reverse type 1 diabetes using these methods have proven unsuccessful ( 32) Murine models provide a means of studying the autoimmune response at a level untenable in humans and are a key resource in identifying factors that may contribute to human disease, but these findings cannot be assumed to apply equally to the human di sease process. In the NOD model, disease can be transferred through diabetogenic CD4+ helper T cells, and prevented through the ablation of CD8+ cytotoxic T cells (CTLs) (33, 34) NOD n atural history studies have de tected CTLs, CD4+ T cells, macrophages, B cells,

PAGE 13

13 and dendritic cells in islet infiltrates. Insulitis in cadaveric pancreata is more sporadic and less severe than in murine islets, and is predominantly composed of CTLs, though the other leukocyte subsets ha ve also been detected (35) to be mainly due to apoptosis induced by infiltrating autoreactive CTLs (36) Antigen presenting cells and CD4+ T ce lls in the infiltrate provide inflammatory signals through the production of cy tokines and chemokines, and also been shown to produce inflammatory cytokines under stress, suggesting a positive feedback loop leading to apoptosis (37) Analysis of gene expression from islets of subjects with type 1 diabetes has show n an upregulation of inflammatory genes present even in long standing diabetics (38) Due to the pivotal role of CD4+ T helper cells in producing inflammatory cytokines and activating CTLs, it is of great interest to det ermine whether inherent immunoregulatory discrepancies exist in T helper subsets among subjects with type 1 diabetes. CD4+ T Cells Depending on the stimuli it receives, a naive T cell may differentiate into a mature Th1 cell, T helper 2 (Th2) cell, induce d regulatory T (Treg) cell, or the more recently defined T helper 17 (Th17) cell. Each T helper subset is uniquely suited to induce an immune response to a particular range of pathogens, and can inhibit the activation of opposing T helper subsets. Tregs do wnregulate the function of T helper subsets, preventing or suppressing an immune response. T Helper Subsets in the Immune Response Prior to the elucidation of Tregs and Th17 cells, more than a decade of T cell immunology focused on the dichotomy between T h1 and Th2 cells. The local cytokine

PAGE 14

14 an antigen presenting cell (APC). APCs activated by viral antigens and other intracellular pathogens will produce type 1 interfe rons, IL 27, IL 12, and IL 18 which promote Th1 differentiation and function (39) During the process of differentiation, T cells will upregulate the Th1 lineage marker T bet ( TBX21 ), a transcription factor critical for Th1 function (40) Mature Th1 cells express the IL 18R and IL 23R, and produce the proinflammatory cytokines IFN 2. Collectively, these cytokines upregulate HLA class I and II expression on target cells, induce activation of CTLs, and induce microbicidal effector functions i n other leukocyte populations (41 43) Naive T cells differentiate into Th2 cells in the presence of IL 4, IL 6, IL 10 and IL 11, which are produced by APCs and granulocytes upon exposure to helminths (i.e., in natu ral biology) (39) Th2 cells express the lineage marke r GATA3, a transcription factor necessary for production IL 4, IL 5, IL 10, and IL 13 (44) These cytokines induce B cell activation and maturation IgE class switching, and granulocyte recruitment. The cytokines produced by Th1 and Th2 cells are mutually inhibito ry toward the differentiation and function of the other subset, which establishes a dichotomy in immune response (45) Traditionally, inflammatory autoimmune diseases such as type 1 diabetes, rheumatoid arthritis, and multiple sclerosis have been considered Th1 mediated, whereas asthma and allergies have been associated with an aberrant Th2 response. The role of the emerging Th17 subset in immune r esponse and autoimmunity has been widely investigated since its discovery in the early 2000s. Th17 cells are necessary for the clearance of certain viruses, bacteria, and fungi, and Th17 related responses have been associated with both classically defined Th1 and Th2 mediated

PAGE 15

15 autoimmune diseases (46 48) Murine Th17 differentiate robustly in the presence of IL 6 and (49) However, the differentiation conditions required to robustly induce a pure Th17 population in humans remain elusive It has been reported that IL 21, in addition to IL 6 and TGF such differentiation (50, 51) It is also possible that ligand interactions with antigen stimulated APCs are required for optimal Th17 differentiation (52) However, the literature regarding these notions is often conflicting, and many of these conditions also induce IFN roduce both IL 17A and IFN Due to the plurality of methods reported to expand human Th17 cells from naive or memory T cells, it is currently technically challenging to examine their in vitro function in human disease. Th17 ce lls produce IL 17A, IL 17F, IL 21, and IL 22, and express retinoic acid related orphan receptor(ROR) t and ROR : transcription factors that confer functionality (53) IL 17A has been the most widely studied molecul e due to its proinflammatory properties. IL 17A can be secreted as a homodimer or as a heterodimer with IL 17F, which is functionally redundant but less potent (54) The IL 17 receptors are ubiquitously expressed, with IL 17 ha ving pleiotropic effects on various cell types. Through its effects on leukocytes, IL 17 A induces the production of IL 6 IL 8 and other acute phase proteins, which in turn activa te and mobilize cells of the innate immune system. Th17 cells also produce IL 22, which induces an acute phase response, and IL 21, which has been shown to enhance Th1 and Th17 responses (55 57) As with the mutua l inhibition between Th1 and Th2 subsets, Th17 cells are capable of inhibiting and are inhibited by the other T helper subsets (58) However,

PAGE 16

16 there is evidence that Th17 cells have an increased resistance to functio nal suppression by Tregs (59) This effect may be due to IL 6, which is necessary for Th17 maturation and directly inhibits the suppressive capacity of Tregs (60) Tregs expr ess the transcription factor FoxP3, and are induced by TGF which can also induce Th17 cells (61) Cells expressing both FoxP3 and ROR t have been described, which may be a transient phenotype during maturation (62, 63) In the presence of inflammatory cytokines, FoxP3, an oft used marker of Treg, is downregulated, while FoxP3 itself can suppress expression of ROR t (64) The unique r elationship between Th17 cells and Tregs has yet to be fully elucidated. T Helper 17 Cells in Autoimmunity Interest in the pathogenicity of Th17 cells began after determining that knocking out IL 23 and i ts receptor, but not IL 12, is protective in murine models of rheumatoid arthritis and multiple sclerosis (65, 66) Due to the critical role IL 23 provides in Th17 maint enance, this initial finding led to numerous studies investigating the association of Th17 profile s in inflammatory aut oimmune diseases. Elevated Th17 profiles have been described in rheumatoid arthritis and multiple sclerosis and there is mounting evidence Th17 cells are pathogenic in murine models of those diseases (67, 68) However, relatively few studies have investigated the Th17 subset in type 1 diabetes. In the NOD mouse model, there have been conflicting reports as to the role of Th17 cells. Neutralizing IL 17A at 10 weeks of age, but not at 5 weeks, pr events diabetes onset in NOD mice, highlighting a temporal role in IL 17A action (69) Similarly, induction of IFN by antigen exposure upon hyperglycemia, but not prior to insulitis, was necessary to prevent progr ession to diabetes, and was dependent on IL 17A repression (70) These studies support a role for a Th1 response inhibiting a Th17

PAGE 17

17 response, thereby preventing diabetes. Yet, there are also reports associating Th17 profiles with a protective effect in NOD mice. Transfer of adjuvant induced splenocytes producing IL 17A into NOD/SCID mice has a protective effect, which is abolished upon neutralizing IL 17A (71) IL 17A and IFN have highly pleiotropic effects under different conditions, suggesting that the conflicting results in these models may be attributable to both the disease state during the time of treatment, as well as the quality of the regulatory response and anti in flammatory cytokines present. There is also evidence that the Th17 subset is highly plastic in the NOD mouse. In two independent studies, it was found that islet specific highly purified Th17 cells induced disease when transferred to recipient NOD/SCID m ice at a rate comparable to transfer of purified Th1 cells (72, 73) Intriguingly, recovered cells had converted to a Th1 phenotype and predominantly produced IFN Additionally, neutralization of IFN but not IL 17A, was protective. The potential for mature Th17 cells to convert to a Th1 phenotype suggests that disease initiation and progression may be transiently dependent on the different subsets, allowing fo r intervention by manipulation of T helper phenotypes. Studies of the Th17 subset in human type 1 diabetes have been mainly limited to new onset cohorts. Recently, new onset type 1 diabetics were shown to have a greater percentage of IL 17 A + T cells after in vitro stimulation (74) with an elevated expression of IL 17A, ROR t, and IL 22 transcripts compared to control subjects (75) Similarly, stimulated monocytes from type 1 diabetics produce greater amounts of Th17 polarizing cytokines (76) These findings provide evidence of elevated Th17 profiles in recently

PAGE 18

18 diagnosed subjects, but cannot rule out the possibility that the findings are reflective of ongoing inflammation as opposed to an inherent bias associated with type 1 diabetes. IL 12 Fam ily Cytokines Within the IL 12 family of cytokines, IL 12, IL 23, and IL 27 have been identified as potent inducers of Th1 or Th17 cells. These cytokines and their receptors are heterodimers with shared subunits (Fig. 1 1). IL 12 is composed of IL 12A and IL 12B, and shares the IL 12B subunit with IL 23; similarly, the IL 12R and IL 23R share a subunit. This link between IL 12 induced Th1 cells and IL 23 induced Th17 cells is what led to the initial discovery of Th17 cells (65, 66) Similarly, the IL 27R is composed of IL27RA and IL6ST, and shares the IL6ST subunit with the IL 6R. Based on the roles of IL 12 and IL 27 in the induction of Th1 cells, it is intriguing that they share subunits with IL 23 and IL 6, which are necessary for Th17 cells. In light of the apparent plasticity between Th1 and Th17 cells, it is of interest to determine if the IL 12 family cytokines are the effectors of this phenotypic plasticity. Hypothesis The proinflammatory function of Th17 cel ls in autoimmunity has necessitated the investigation of this subset in human type 1 diabetes. Based upon the mutually inhibitory nature of the Th1 and Th17 subsets, as well as the potential for Th17 cells to transdifferentiate into Th1 cells, we hypothesi zed that there is an inherent imbalance in the Th1 and Th17 subsets in type 1 diabetes. Furthermore, we hypothesized that this imbalance may be reflected in an altered regulation of the IL 12 family subunits during T cell maturation. To test these hypothes es, we have investigated the expression of Th1 and Th17 associated transcripts in both unmanipulated peripheral blood as well as during the differentiation of nave T cells under Th1 and Th17 polarizing conditions.

PAGE 19

19 Figure 1 1. Th1 and Th17 polarizing cy tokines. A simplified r epresentation of the subunits of select Th1 and Th17 polarizing cytokines.

PAGE 20

20 CHAPTER 2 MATERIALS AND METHOD S Sample Acquisition I nformed consents approved by the institutional review board s of the University of Florida and Nemour were obtained from all study participants or their legal guardians. Subjects recently immunized, sick at the time of blood draw, or those with a secondary autoimmune disease were excluded from the study. New onset subjects are define d as those diagnosed within 4 months of study inclusion. Control subjects are unrelated individuals without any first degree relatives with type 1 diabetes. Peripheral blood was collected by venipuncture; all samples were stored at ambient temperature and processed within 28 hours of collection. Autoantibody Determination Where indicated, autoantibodies to GAD (GADA) and IA2 (IA2A) were detected Subjects were considered posit ive when GADA > 5IU/mL and IA2A > 15IU/mL. Cytokine Determination Serum IL 17A levels were determined using a commercial ELISA kit (Quantikine Human IL 17 ELISA; R&D Systems, Minneapolis, MN). The manufacturer's protocol was modified for maximum sensitivi ty; the standard curve range was modified to 500pg/mL 7.8pg/mL, samples were incubated overnight at 4C, and the TMB detection step was extended to 90 minutes. Supernatant levels of IL 17A and IFN neat for IL 17A detection and diluted 1:10 for IFN 17A Duoset detects both IL 17A/A and IL 17A/F. IL 18 concentration was determined using a commercial kit

PAGE 21

21 (Human IL 18 Matched Antibody Pairs; eBioscience, San Diego, CA) according to manufacturer's recommendations. All ELISA samples were run in duplicate and analyzed using SOFTmax PRO software (Molecular Devices, Sunnyvale, CA). Cell Culture Cell populations were purified from heparinized blood within 20 28 hours after their collection. Nave T cells were negatively selected on a magnetic column (Miltenyi Biotec, Bergisch Gladbach, Germany) from peripheral blood mononuclear cells (PBMCs) obtained through dens ity gradient centrifugation (Ficoll; GE Healthcare, Piscataway, NJ). Monocytes were purified by negative selection via the addition of a monocyte enrichment antibody cocktail (Stemcell, Vancouver, BC, Canada) to whole blood prior to separation by density g radient. Naive T cells and monocytes were cultured in a 4:1 ratio in CTL serum free media (Cellular Technology Ltd., Cleveland, OH) supplemented with 14mM HEPES, 2mM L glutamine, penicillin (50ug/mL)/streptomycin (50ug/mL)/neomycin (100ug/mL) (Invitrogen, Carlsbad, CA), and 50uM 2 mercaptoethanol (Sigma, St. Louis, MO) at a final concentration of 6.25x10 5 /mL in 96 well U bottom plates (Costar, Cambridge, MA). Cells were stimulated with 5ug/mL soluble anti CD3, 2.5ug/mL soluble anti CD28, and 5ng/mL IL 2 alo ne, or with the addition of Th1 polarizing cytokines (5ug/mL anti IL 4 and 2.5ng/mL IL 12p70) or Th17 polarizing cytokines (10ng/mL IL (eBioscience). At 72 hours, supernatants were pooled from five replicate wells per con dition and frozen at 20C. Cells were immediately lysed and pooled for total RNA TX).

PAGE 22

22 Quantitative PCR Total RNA was isolated from either cultured cells (described above) o r PAXgene Blood RNA Tubes (Qiagen, Hilden, Germany). Peripheral blood collected in PAXgene tubes was immediate ly lysed and stabilized, and stored at 80C until RNA isolation (PAXgene Blood RNA Kit; Qiagen). DNase I treatment was included in the RNA isolat ion protocol of both cultured cells and PAXgene tubes. cDNA was generated from 500ng PAXgene RNA or 250ng cell culture RNA using SuperScript III First Strand Synthesis SuperMix (Invitrogen). cDNA was diluted 1:5 in nuclease free water (Ambion) and qPCR wa s performed using a LightCycler 480 (Roche Diagnostics, Indianapolis, IN) with 0.5uM forward and reverse primers, 2ul cDNA template, and 10ul PerfeCTa SYBR Green FastMix (Quanta Biosciences, Gaithersburg, MD). A comparative cycle threshold method with a cu t off of 35 cycles was used to determine mRNA copy number relative to the normalizer gene GAPDH. Data are expressed as 2 Ct where Ct = (Ct T ARGET G ENE Ct GAPDH ). Primers were derived from published literature, purchased commercially, or designed utilizin g the Universal ProbeLibrary (Roche ) (Table 2 1). All primers were validated by melt curve analysis and agarose gel visualization. Statistical Analysis Data analyses were performed in GraphPad Prism 5.1 (GraphPad, San Diego, CA). The Kolmogorov Smirnov t est was applied to determine normalcy. Normally distributed data sets consisting of two groups were analyzed by a 2 t test; otherwise, a Mann Whitney U test was applied. Data sets comparing more than two groups were analyzed using the Krus kal used to determine if gene expression was associated with disease duration. F or gene

PAGE 23

23 expression studies, multiple testing was corrected by the Benjamini Hochberg algorithm (77) A confidence interval (CI) of 95% was used to determine significance on all data sets.

PAGE 24

24 Table 2 1 Quantitative RT PCR primers Gene Forward primer Reverse primer Amplicon length EBI3 TGTTCTCCATGGCTCCCTAC GCTCCCTGACGCTTGTAAC 158 GAPDH ACAGTCAGCCGCATCTTCTT AATGAAGGGGTCATTGATGG 149 GATA3 GAACCGGCCCCTCATTAAG ATTTTTCGGTTTCTGGTCTG GAT 197 IL12A GAATGCAAAGCTTCTGATGG A TGGCAC AGTCTCACTGTTGAA 112 IL12B AGATGGTATCACCTGGACCT TG TCCTTTGTGACAGGTGTACT GG 114 IL12RB1 TGACCCTGCAGCTCTACAAC GCCAACTTGGACACCTTGAT 70 IL12RB2 GATCTTCGTTGGTGTTGCTC CAGA CACAGTCCCCTGTTCTCCCT TCTGT 73 IL17A TCATTGGTGTCACTGCTACT GCTGC TCGTGGGATTGTGATTCCTG CC 68 IL18 CCTCCTGGCTGCCAACTCT GAAGCGATCTGGAAGGTCTG AG 100 IL18R1 AGTTATGCATATTTGAAAGG GATGT TGAGTGGATTTCATCAACAA CA 62 IL18RAP CAGATATTCTGGATCCTGTC GAG TGCTTTGCAGCTAATAGTTA AAGG 74 IL1B GCTGAGGAAGATGCTGGTTC GTGATCGTACAGGTGCATCG 145 IL23A ATGATGTTCCCCATATC CAGTGTGG GCAAGCAGAACTGACTGTTG TCCCT 75 IL23R CTGAAACAGTTCCCCAGGTC ACATC GCAACTGTTAGCCCAGAATT CCATG 70 IL27A a 123 IL27RA GAGTTGGACCCTTGGGCGAC TT CGGTACTTTTGGCTCTGGAG GTGTA 94 IL6 CAGCAAAGAGGCACTGGCAG AA GGCAAGTCTCCTCATTGAAT CCAGA 95 IL6R a 150 I L6ST TGCAACATTCTTACATTCGG ACAGC TTTTCTGGAGGCAAGCCTGA AATTA 77 RORA4 TGTGATCGCAGCGATGAAAG ACAGTTCTTCTGACGAGGAC AGG 149 RORC TGACAGAGATAGAGCACCTG GTGCA AAGATGTTGGAGCGCTGCCG 100 TBX21 TGTGACCCAGATGATTGTGC TC AGTAAAGATATGCGTGTTGG AAGC 121 All sequences prese a Primers purchased from SABiosciences (Frederick, MD); sequences unknown.

PAGE 25

25 CHAPTER 3 RESULTS Basal Gene Expression To identify inherent immunological differences between type 1 diabetics and healthy contro ls, we analyzed the basal expression of 20 genes associated with Th1 and Th17 differentiation and function by qPCR. Subject cohorts were age matched (Table 3 1) to prevent complications due to age associated gene expression changes. Total RNA was isolated from unmanipulated peripheral blood from patients with type 1 diabete s ( n = 28, mean disease duration 7.61 years) and healthy controls ( n = 23). Six genes were significantly different between the two groups (CI=95%; p < 0. 015) ( Table 3 2 ). IL17A, IL6, IL6S T, and IL12B gene expression was elevated in patients with type 1 diabet e s, while basal gene expression of IL18RAP and IL12RB1 was decreased in patients with type 1 diabete s compared to healthy controls (Fig. 3 1) IL12B is the common subunit between IL 12 and IL 23, while IL6ST is the non specific subunit of the IL 6R, which are both associated with Th17 differentiat ion and function. However, IL6R and the unique subunit of IL 23 (IL23A) were not elevated. Furthermore, no difference was seen in the expressi on of Th17 transcription factors RORC and RORA4 between patients and controls. Gene expression did not correlate with disease duration or autoantibody status. Serum IL 17A Levels Having identified elevated IL 17A gene expression in peripheral blood, we ana lyzed serum IL 17A levels from subjects with established type 1 diabetes ( n = 13), new onset type 1 diabetes ( n = 10), and healthy controls ( n = 17) by ELISA. There was no significant difference between the groups (Fig. 3 2) Analysis was limited by the

PAGE 26

26 as subjects, and 7 healthy controls fell below the limit of detection. Stimulated Gene Expression To determine whether gene expression discrepancies exist in the context of imm une activation, we performed an in vitro stimulation assay. Naive T cells and monocytes from age matched type 1 diabetic subjects and healthy controls ( n = 10 ; Table 3 3) were cultured for 72 hours with TCR stimulus alone, or in the presence of Th1 or Th17 polarizing cytokines. Gene expression of 18 Th1 and Th17 associated genes was determined by qPCR (Tables 3 4, 3 5, 3 6) After correction for multiple testing (77) a p value of 0.0027 was required for significance (CI=95%), which was not reached under these conditions. However, analysis revealed four genes trending toward differential expression ( p < 0.05, NS ; Fig. 3 3 ). Under both TCR stimulation alone and Th1 polarizing conditions, expression of IL18 trended lower in patients with type 1 diabete s compared to healthy controls. Interestingly, the expression of IL18RAP, which was significantly decr eased in the peripheral blood of patients trended higher under the same two stimulation conditions. In the presence of Th17 polarizing conditions, IL18R 1 and IL23R gene expression trended higher in subjects with type 1 diabetes. IL 18R and IL 23R are expr essed on both mature Th1 and Th17 cells, and IL 18 has been shown to enhance the function of both T cell subsets (78, 79) In contrast to the basal gene expression data, the expression of Th17 associated genes did n ot trend higher in those with type 1 diabete s under any of the stimuli tested. Furthermore, there was no signific ant difference in IL 17A or IFN not shown). No correlation was found between transcript levels and disease duration or autoantibody status.

PAGE 27

27 IL 18 Cytokine Levels We did identif y multiple discrepancies in both basal and stimulated gene expression of IL 18 and IL 18R subunits between patients with type 1 diabete s and healthy controls. To d etermine if a discrepancy existed at the protein level, we measured serum IL 18 levels in a subset of the overall coho rt tested for basal gene expression (Table 3 1). Serum levels of IL 18 were significantly higher in patients with type 1 diabetes ( n = 24) compared to healthy controls ( n = 23; p = 0.036 ) (Fig. 3 4 ). Four patients and 9 controls fell below the standard cur ve (100pg/mL). Circulating IL 18 levels did not correlate with disease duration, age, or autoantibody status. IL 18 was not detectable in supernatants from the in vitro stimulated cell assay (data not shown).

PAGE 28

28 Table 3 1 Characteristics of the basal gene expression study cohort. Diagnosis Gender Age (y) Disease duration (y) Autoantibodies Serum IL 18 T1D F 7.67 3.25 GADA+ + T1D F 9.92 2.83 GADA+ + T1D F 10.96 4.92 + T1D F 11.58 10 .00 GADA+, IA2 A + + T1D F 11.75 4.08 + T1D F 12.5 0 8.25 G ADA+, IA2 A + + T1D F 12.17 10.5 0 GADA+, IA2 A + + T1D F 12.33 3.92 GADA+, IA2 A+ + T1D M 12.63 3.58 + T1D F 12.75 9.92 GADA+ + T1D F 12.87 0 .00 GADA+, IA2 A + + T1D F 13.14 2.08 GADA+, IA2 A + + T1D M 13.58 7.67 GADA+ + T1D F 14.41 8.33 GADA+, IA 2 A + + T1D M 15.9 0 2.83 + T1D F 16.06 5.66 GADA+ + T1D F 17.11 1.97 GADA+ + T1D M 17.9 0 7.57 ND T1D M 18.25 5.75 + T1D M 18.25 4.42 GADA+, IA2 A + + T1D M 18.67 14.92 IA2A+ + T1D M 19.5 0 11.58 GADA+, IA2 A + + T1D M 19.58 13.75 GADA+ + T1D M 19.83 7.61 GADA+, IA2 A+ + T1D F 22.61 3.68 ND T1D M 23.25 6.76 ND T1D M 24.5 0 22.67 GADA+ + T1D F 25.72 24.65 ND Control F 7.67 N/A + Control M 8.42 N/A + Control M 12.42 N/A + Control F 13.5 0 N/A + Control M 13.75 N/A + Control F 14 .00 N/A + Control F 15.17 N/A + Control M 15.58 N/A + Control M 15.67 N/A + Control F 16 .00 N/A + Control M 16.75 N/A + Control F 16.75 N/A + Control F 17.83 N/A + Control M 17.92 N/A +

PAGE 29

29 Table 3 1. Conti nued Diagnosis Gender Age (y) Disease duration (y) Autoantibodies Serum IL 18 Control M 18.33 N/A + Control F 21.42 N/A + Control M 21.64 N/A + Control F 21.91 N/A + Control M 22.63 N/A + Control M 22.92 N/A + Control F 23.29 N/A + Control M 23.94 N/A + Control F 24 .00 N/A + T1D, type 1 diabetes; N/A, not applicable; ND, not determined; F, female; M, male

PAGE 30

30 Table 3 2 Fold c hange in b asal g ene e xpression b etween t ype 1 d iabetics and c ontrols Gene Relative e xpres sion in t ype 1 d iabetics Relative e xpression in h ealthy c ontrols Fold c hange P v alue IL17 A 0.01032 (0.01634) 0.00554 (0.01281) 1.86 0.0010 IL6 0.00378 (0.00572) 0.00226 (0.00461) 1.67 0.0017 IL12B 0.00606 (0.01058) 0.00362 (0.00854) 1.67 0.0049 IL18RA P 0.00061 (0.00038) 0.00094 (0.00048) 0.64 0.0068 IL12RB1 0.01527 (0.00371) 0.01817 (0.00437) 0.83 0.0098 IL6ST 0.03340 (0.01660) 0.02242 (0.00810) 1.49 0.0121 IL27A 0.00411 (0.00672) 0.00255 (0.00422) 1.61 0.0249 IL23R 0.00186 (0.00310) 0.00130 (0.002 35) 1.43 0.0409 IL18 0.01023 (0.00989) 0.00748 (0.00683) 1.37 0.0736 TBX21 0.01792 (0.00706) 0.01480 (0.00690) 1.21 0.12 00 IL27RA 0.01087 (0.00328) 0.00932 (0.00265) 1.17 0.1398 RORC 0.00495 (0.00434) 0.00422 (0.00372) 1.17 0.1699 IL6R 0.18132 (0.0774 7) 0.14568 (0.03828) 1.24 0.198 0 IL23A 0.00692 (0.00736) 0.00526 (0.00461) 1.31 0.2081 IL1B 0.03717 (0.01300) 0.04213 (0.01832) 0.88 0.3157 RORA4 0.04016 (0.01491) 0.03630 (0.01367) 1.11 0.3433 IL12RB2 0.00132 (0.00059) 0.00121 (0.00072) 1.09 0.3439 I L18R1 0.00764 (0.00342) 0.00696 (0.00242) 1.1 0 0.427 0 EBI3 0.00013 (0.00009) 0.00014 (0.00008) 0.91 0.526 0 IL12A 0.00031 (0.00014) 0.00029 (0.00013) 1.08 0.5441 Basal gene expression presented as mean (standard deviation) of values norm alized to GAPDH e xpression. P values less than 0.015 are significant (CI=95%)

PAGE 31

31 Fi gure 3 1 Basal gene expression discrepancies. Transcript levels were quantified by qPCR from RNA isolated from peripheral blood in patients with type 1 diabetes (T1D, n = 28) and controls ( n = 23). A D) Gene expression of IL6, IL6ST, IL12B, and IL17A was elevated in T1D. E F) There was reduced gene expression of IL18RAP and IL12RB1 in T1D. Data are relative to GAPDH expression, presented as mean SD.

PAGE 32

32 Fi gure 3 2 Serum IL 17A concentra tion. IL 17A levels were measured in patients with type 1 diabetes ( n = 13), new onset type 1 diabetes ( n = 10), and healthy controls ( n = 17) by ELISA. Data shown are mean SD ( p = NS).

PAGE 33

33 Table 3 3 Characteristics of the stimulated gene expression study cohort. Diagnosis Gender Age (y) Disease duration (y) Autoantibodies T1D F 9.92 0.42 IA2A+ T1D F 12.5 0 8.35 GADA+, IA2A+ T1D M 15.17 3.83 GADA+ T1D F 15.33 4.42 T1D F 15.33 6 .00 GADA+ T1D M 15.92 3.08 T1D M 18.25 5.25 T1D M 19.58 13.25 GADA+ T1D F 31.83 0.17 T1D M 46.83 39 .00 GADA+ Control M 12.5 0 N/A Control F 13.5 0 N/A Control M 13.75 N/A Control F 14.5 0 N/A Control M 15.67 N/A GADA+ Control F 16.83 N/A Control F 17.83 N/A Control M 18.33 N/A Control M 33.5 0 N/A Control M 47 .00 N/A T1D, type 1 diabetes; N/A, not applicable; F, female; M, male

PAGE 34

34 Table 3 4 Fold c hange in anti CD3/anti CD28 stimulated g ene e xpression b etween t ype 1 d iabetics and c ontrols Gene Relative expression in t ype 1 d iabetics Relative expression in h ealthy c ontrols Fold c hange P v alue IL18 0.00011 (0.00005) 0.00019 (0.00007) 0.57 0.0103 IL18RAP 0.00009 (0.00006) 0.00004 (0.00002) 2.28 0.0233 TBX21 0.00927 (0.00460) 0.00647 (0.00261) 1.43 0.1109 IL18R1 0.000 39 (0.00012) 0.00031 (0.00008) 1.23 0.1387 IL23R 0.00024 (0.00022) 0.00013 (0.00012) 1.92 0.2263 IL1B 0.09017 (0.09409) 0.10911 (0.10718) 0.83 0.2428 RORC 0.00091 (0.00053) 0.00070 (0.00043) 1.31 0.2475 IL12A 0.00004 (0.00002) 0.00004 (0.00006) 0.95 0. 2701 IL12RB2 0.00927 (0.00538) 0.00710 (0.00436) 1.31 0.4359 IL27RA 0.00907 (0.01052) 0.00948 (0.00765) 0.96 0.4813 IL23A 0.00286 (0.00170) 0.00351 (0.00206) 0.82 0.683 0 IL12RB1 0.01115 (0.00745) 0.00916 (0.00492) 1.22 0.6842 IL12B 0.00015 (0.00020) 0 .00018 (0.00016) 0.85 0.7197 RORA4 0.01812 (0.01702) 0.01646 (0.00812) 1.1 0 0.7335 EBI3 0.00277 (0.00199) 0.00255 (0.00130) 1.09 0.7621 GATA3 0.01059 (0.00645) 0.00943 (0.00337) 1.12 0.7623 IL6 0.01000 (0.00900) 0.00893 (0.00673) 1.12 0.7708 IL6ST 0.0 2452 (0.03729) 0.01844 (0.02210) 1.33 0.8534 G ene expression presented as mean (standard deviation) of values normalized to GAPDH expression. Trends are genes with p < 0.05, not significant.

PAGE 35

35 Table 3 5 Fold c hange in Th1 polarized g ene e xpression b etwe en t ype 1 d iabetics and c ontrols Gene Relative expression in t ype 1 d iabetics Relative expression in h ealthy c ontrols Fold c hange P v alue IL18RAP 0.00028 (0.00012) 0.00017 (0.00004) 1.63 0.0119 IL18 0.00010 (0.00005) 0.00019 (0.00009) 0.52 0.0151 TBX 21 0.01751 (0.00479) 0.01412 (0.00349) 1.24 0.0868 IL12B 0.00021 (0.00017) 0.00035 (0.00024) 0.61 0.1722 IL1B 0.08682 (0.08814) 0.11625 (0.10066) 0.75 0.2883 IL23A 0.00256 (0.00148) 0.00346 (0.00258) 0.74 0.3761 IL23R 0.00076 (0.00054) 0.00056 (0.00042 ) 1.35 0.3763 RORC 0.00065 (0.00036) 0.00071 (0.00072) 0.93 0.4359 IL18R1 0.00062 (0.00015) 0.00057 (0.00017) 1.1 0 0.4527 IL27RA 0.00674 (0.00662) 0.00833 (0.00763) 0.81 0.6254 GATA3 0.00659 (0.00357) 0.00577 (0.00406) 1.14 0.6385 IL12A 0.00004 (0.000 02) 0.00005 (0.00004) 0.74 0.683 0 IL6ST 0.02121 (0.02245) 0.02143 (0.02286) 0.99 0.6842 IL6 0.01016 (0.00777) 0.01193 (0.00893) 0.85 0.7197 RORA4 0.02089 (0.00931) 0.02022 (0.00641) 1.03 0.7335 EBI3 0.00289 (0.00193) 0.00320 (0.00194) 0.9 0 0.7341 IL12 RB2 0.02360 (0.00722) 0.02493 (0.01108) 0.95 0.7548 IL12RB1 0.00872 (0.00632) 0.00832 (0.00691) 1.05 0.894 0 G ene expression presented as mean (standard deviation) of values normalized to GAPDH expression. Trends are genes with p < 0.05, not significant.

PAGE 36

36 Table 3 6 Fold c hange in Th17 polarized g ene e xpression b etween t ype 1 d iabetics and c ontrols Gene Relative e xpression in t ype 1 d iabetics Relative expression in h ealthy c ontrols Fold c hange P v alue IL18R1 0.00046 (0.00011) 0.00032 (0.00009) 1.45 0. 0048 IL23R 0.00042 (0.00036) 0.00015 (0.00013) 2.84 0.0358 IL18RAP 0.00008 (0.00005) 0.00004 (0.00002) 1.81 0.0751 TBX21 0.00808 (0.00510) 0.00510 (0.00304) 1.59 0.1296 GATA3 0.00921 (0.00286) 0.01120 (0.00375) 0.82 0.1978 IL18 0.00013 (0.00008) 0.000 17 (0.00008) 0.75 0.2647 IL12RB2 0.00820 (0.00567) 0.00569 (0.00412) 1.44 0.2715 IL1B 0.07780 (0.06941) 0.11658 (0.09628) 0.67 0.3416 IL12RB1 0.01001 (0.00397) 0.00858 (0.00361) 1.17 0.4114 IL27RA 0.00715 (0.00465) 0.00908 (0.00650) 0.79 0.4553 RORA4 0.01683 (0.00526) 0.01860 (0.00596) 0.9 0 0.4904 IL23A 0.00278 (0.00146) 0.00313 (0.00182) 0.89 0.6522 RORC 0.00158 (0.00085) 0.00159 (0.00116) 0.99 0.7394 IL12B 0.00009 (0.00011) 0.00012 (0.00015) 0.78 0.7802 IL6 0.00895 (0.00726) 0.01064 (0.00857) 0.8 4 0.8421 IL6ST 0.01785 (0.01164) 0.01889 (0.01823) 0.95 0.8818 IL12A 0.00003 (0.00002) 0.00006 (0.00009) 0.61 0.9048 EBI3 0.00283 (0.00172) 0.00296 (0.00191) 0.96 0.9674 G ene expression presented as mean (standard deviation) of values normalized to GAP DH expression. Trends are genes with p < 0.05, not significant.

PAGE 37

37 Fi gure 3 3 Stimulated gene expression trends. Transcript levels were quantified by qPCR from RNA isolated from stimulated cells at 72 hours. A D) Without polarizing cytokines and in the p resence of Th1 polarizing cytokines, gene expression of IL18 trended lower, and IL18RAP higher, in patients with type 1 diabetes (T1D, n = 10) compared to controls ( n = 10). E F) In the presence of Th17 polarizing cytokines, gene expression of IL23R and IL 18R1 trended higher in T1D. Data are relative to GAPDH expression, presented as mean SD.

PAGE 38

38 Figure 3 4 Serum IL 18 concentration IL 18 levels were measured from type 1 diabetics ( n = 24) and healthy controls ( n = 23) by ELISA. IL 18 levels were signif icantly elevated in type 1 diabetics (mean SD; p = 0.036).

PAGE 39

39 CHAPTER 4 DISCUSSION Despite the evidence for elevated Th17 associated profiles in inflammatory autoimmune diseases, research into the role of the Th17 subset in human type 1 diabetes has been limited, and mainly focused on those recen tly diagnosed with the disease Here we have expanded on these reports by analyzing Th1 and Th17 associated gene expression in two cohort s of subjects with dis ease duration extending up to 39 years beyond diagnosi s. We investigated Th1 and Th17 associated cytokines, receptors, and transcriptions factors as markers of the T cell subsets. Analyzing gene expression from peripheral blood allows for the measurement of in vivo transcript levels, but conclusions are compl icated by the heterogeneity of immune cells found in circulation Though we report elevated IL17A transcripts in type 1 diabetics, this observation may be due to an increased number of Th17 cells, greater production of IL17A in Th17 cells, and/or the produ ction of IL17A by other leukocyte subsets. However, basal expression of IL17A was previously found to be higher in isolated memory CD4+ cells from new onset subjects (75) ; elevated expression in peripheral blood may suggest that this finding also applies to established type 1 diabetics. We were unable to observe a concurrent rise in serum IL 17A levels in type 1 diabetics, which may be due to post transcriptional regulation of IL 1 7A production and secretion or a tec hnical function of the lower limits of detection of the assay Despite elevated IL17A transcripts, we found no significant difference in basal levels of RORC and RORA4, transcription factors peripherally expressed only in T cells. This suggests that there is no difference in the percentage of circulating Th17 cells in type 1 diabetics compared to controls.

PAGE 40

40 We investigated the phenotype of naive T cells stimulated under Th1 or Th17 polarizing conditions. Expression of RORC, RORA4, and TBX21 transcripts, as well as production of IL 17A and IFN that naive T cells from type 1 diabetics are not inherently more prone toward developing a Th1 or Th17 phenotype Similarly, there were no differences in the shared subunits of the I L 12 family cytokines and IL 6R, suggesting that dysregulation of these cytokines is not a factor in T cell differentiation. Transcript levels of cytokines associated with the maturation of Th1 and Th17 cells were also quantified. Though the study lacked t he power to achieve statistical significance with subtle differences there was a trend toward differential gene expression of IL18, both IL 18R subunits, and IL23R. IL 18 transcripts trended lower in type 1 diabetics compared to controls; however, IL 18 w as not detectable in cell culture, likely because the monocytes were not stimulated directly. Interestingly, transcript levels of IL23R trended higher in type 1 diabetics under Th17 polarizing conditions only. The IL23R is expressed on both mature Th1 and Th17 cells; elevated expression in type 1 diabetics under Th17 polarizing conditions may render the T cells more sensitive to IL 23. Further investigation is required to determine if this observation correlates with surface expression of IL 23R and what fu nctional implications it may have in regards to enhancing Th17 differentiation Surprisingly, differential transcript levels were most often noted for the IL 18 and IL 18R genes. IL 18 is classically associated with a Th1 response and the induction of IFN but has also been shown to syner gize with and enhance a Th17 response (80) Serum IL 18 levels were previously reported in a cohort of new onset type 1 diabetics, with elevated serum levels correlating with an i ncreasing number of autoantibodies (81)

PAGE 41

41 We have confirmed this finding in subjec ts with established type 1 diabete s, though this study did not find a similar trend with autoantibody status. Polymorphisms within the promoter region of IL 18 have been associated with type 1 diabetes in two of three cohorts investigated (82 84) and there is evidence that these SNPs modify IL 18 expression (85) A correlation between IL 18 promoter polymorphisms and elevated serum IL 18 levels in type 1 diabetics has yet to be investigated. The IL 18R, a heterodimer of IL18R1 / IL18RAP is expressed on mature T cells, neutrophils, and NK cells. Further research is required to determine which cell population is reflective of th e decreased basal IL18RAP levels observed in the peripheral blood in type 1 diabetics. A minor SNP in IL18RAP is associated with reduced transcript expression in peripheral blood, but this SNP is negatively correlated with type 1 diabetes, and is therefore unlikely the cause of reduced basal IL18RAP gene expression (86, 87) In contrast, we observed a trend toward increased expression of IL18RAP in stimulated naive T cells with and without IL 12 treatment in type 1 d iabetics. While the IL18R1 is constitutively expressed on naive T cells, the IL18RAP is upregulated as T cells mature and confers responsiveness to IL 18 (88, 89) Increased expression of IL18RAP during maturation m ay therefore indicate a bias in type 1 diabetics towards IL 18 induced T cell polarization, which is classically associated with Th1 function. Taken together, these data suggest that elevated Th17 profiles are not strongly associated with type 1 diabetes at the level of gene expression. Contradictory data focusing on new onset cases may be reflective of heightened inflammation occurring at the time of sample collection. This study has also identified a consistent discrepancy in

PAGE 42

42 IL 18/IL 18R transcript leve ls in type 1 diabetes suggesting a Th1 bias Provided these discrepancies can be corrob orated at the protein level, dysregulation of IL 18 and the IL 18R may play a substantial role in regulating autoimmunity in type 1 diabetes.

PAGE 43

43 LIST OF REFERENCES 1. Green A, Brutti G, Patterson CC, Dahlquist G, Soltesz G, Green A, Schober E, Weets I, Vandevalle C, Gorus F, Coeckelberghs M, Du Caju M, Christov V, Tzaneva V, Iotova V, Roglic G, Vavrinec J, Olsen BS, Svendsen AJ, Kreutzfeldt J, Lund E, Poodar T, Tuomilehto J, Karvonen M, Levy Marchal C, Czernichow P, Doutreix J, Giani G, Neu A, Bartsocas C, Kassiou K, Dacou Voutetaki C, Kafourou AC, Al Qadreh A, Karagianni C, Papazoglou N, Soltesz G, Thorsson AV, Laron Z, Gordon O, Albag Y, Shamis I, Ch iumello G, Pozzilli P, Visalli N, Sebastiani L, Marietti G, Buzzetti R, Songini M, Casu A, Marinaro A, Ricciardi R, Zedda MA, Milia A, Purrello F, Arpi M, Fichera G, Mancuso M, Lucenti C, Brigis G, Urbonaite B, De Beaufort C, Kocova M, Reeser M, Joner G, W oznicka D, Szybinski Z, Jarosz Chobot P, Kinaiska I, Abreu S, Menezes C, Pina EA, Ionescu Tirgoviste C, Michalkova D, Hlava P, Mikulecky M, Cernay J, Krzisnik C, Battelino T, Bratina Ursic N, Goday A, Dahlquist G, Schonle E, Patterson C, Greenlees R, Carso n D, Hadden D, Bingley P, Raymond N, McKinney P, Bodansky H, Stephenson C, Grp EAS. 2000. Variation and trends in incidence of childhood diabetes in Europe. Lancet 355: 873 6 2. Dabelea D, Bell RA, D'Agostino RB, Imperatore G, Johansen JM, Linder B, Liu LL Loots B, Marcovina S, Mayer Davis EJ, Pettitt DJ, Waitzfelder B, St WGSDY. 2007. Incidence of diabetes in youth in the United States. Jama Journal of the American Medical Association 297: 2716 24 3. Wang PH, Lau J, Chalmers TC. 1993. Meta analysis of eff ects of intensive blood glucose control on late complications of type I diabetes. Lancet 341: 1306 9 4. Nathan DM. 1993. Long term complications of diabetes mellitus. N Engl J Med 328: 1676 85 5. Ryan EA, Paty BW, Senior PA, Bigam D, Alfadhli E, Kneteman N M, Lakey JRT, Shapir AMJ. 2005. Five year follow up after clinical islet transplantation. Diabetes 54: 2060 9 6. Hamalainen AM, Knip M. 2002. Autoimmunity and familial risk of type 1 diabetes. Curr Diab Rep 2: 347 53 7. Kyvik KO, Green A, Beck Nielsen H. 1 995. Concordance rates of insulin dependent diabetes mellitus: a population based study of young Danish twins. BMJ 311: 913 7 8. Risch N. 1987. Assessing the role of HLA linked and unlinked determinants of disease. Am J Hum Genet 40: 1 14 9. Bell GI, Horit a S, Karam JH. 1984. A Polymorphic Locus near the Human Insulin Gene Is Associated with Insulin Dependent Diabetes Mellitus. Diabetes 33: 176 83

PAGE 44

44 10. Lowe CE, Cooper JD, Brusko T, Walker NM, Smyth DJ, Bailey R, Bourget K, Plagnol V, Field S, Atkinson M, Cla yton DG, Wicker LS, Todd JA. 2007. Large scale genetic fine mapping and genotype phenotype associations implicate polymorphism in the IL2RA region in type 1 diabetes. Nature Genetics 39: 1074 82 11. Nistico L, Buzzetti R, Pritchard LE, VanderAuwera B, Giov annini C, Bosi E, Larrad MTM, Rios MS, Chow CC, Cockram CS, Jacobs K, Mijovic C, Bain SC, Barnett AH, Vandewalle CL, Schuit F, Gorus FK, Tosi R, Pozzilli P, Todd JA. 1996. The CTLA 4 gene region of chromosome 2q33 is linked to, and associated with, type 1 diabetes. Human Molecular Genetics 5: 1075 80 12. Catassi C, Guerrieri A, Bartolotta E, Coppa GV, Giorgi PL. 1987. Antigliadin Antibodies at Onset of Diabetes in Children. Lancet 2: 158 13. Volta U, Bonazzi C, Pisi E, Salardi S, Cacciari E. 1987. Antiglia din and Antireticulin Antibodies in Celiac Disease and at Onset of Diabetes in Children. Lancet 2: 1034 5 14. Mayer EJ, Hamman RF, Gay EC, Lezotte DC, Savitz DA, Klingensmith GJ. 1988. Reduced Risk of Iddm among Breast Fed Children the Colorado Iddm Regi stry. Diabetes 37: 1625 32 15. Kostraba JN, Cruickshanks KJ, Lawler Heavner J, Jobim LF, Rewers MJ, Gay EC, Chase HP, Klingensmith G, Hamman RF. 1993. Early exposure to cow's milk and solid foods in infancy, genetic predisposition, and risk of IDDM. Diabet es 42: 288 95 16. Dippe SE, Miller M, Bennett PH, Maynard JE, Berquist KR. 1975. Lack of Causal Association between Coxsackie B4 Virus Infection and Diabetes. Lancet 1: 1314 7 17. Foulis AK, Farquharson MA, Cameron SO, McGill M, Schonke H, Kandolf R. 1990. A search for the presence of the enteroviral capsid protein VP1 in pancreases of patients with type 1 (insulin dependent) diabetes and pancreases and hearts of infants who died of coxsackieviral myocarditis. Diabetologia 33: 290 8 18. Roivainen M, Klingel K. 2009. Role of enteroviruses in the pathogenesis of type 1 diabetes. Diabetologia 52: 995 6 19. Vaarala O, Atkinson MA, Neu J. 2008. The "perfect storm" for type 1 diabetes the complex interplay between intestinal microbiota, gut permeability, and muc osal immunity. Diabetes 57: 2555 62 20. Westerholm Ormio M, Vaarala O, Pihkala P, Ilonen J, Savilahti E. 2003. Immunologic activity in the small intestinal mucosa of pediatric patients with type 1 diabetes. Diabetes 52: 2287 95

PAGE 45

45 21. Savilahti E, Ormala T, S aukkonen T, Sandini Pohjavuori U, Kantele JM, Arato A, Ilonen J, Akerblom HK. 1999. Jejuna of patients with insulin dependent diabetes mellitus (IDDM) show signs of immune activation. Clinical and Experimental Immunology 116: 70 7 22. Gepts W. 1965. Pathol ogic anatomy of the pancreas in juvenile diabetes mellitus. Diabetes 14: 619 33 23. Bottazzo GF, Florin Christensen A, Doniach D. 1974. Islet cell antibodies in diabetes mellitus with autoimmune polyendocrine deficiencies. Lancet 2: 1279 83 24. Kaufman DL, Erlander MG, Clare Salzler M, Atkinson MA, Maclaren NK, Tobin AJ. 1992. Autoimmunity to two forms of glutamate decarboxylase in insulin dependent diabetes mellitus. Journal of Clinical Investigation 89: 283 92 25. Lan MS, Wasserfall C, Maclaren NK, Notkin s AL. 1996. IA 2, a transmembrane protein of the protein tyrosine phosphatase family, is a major autoantigen in insulin dependent diabetes mellitus. Proceedings of the National Academy of Sciences of the United States of America 93: 6367 70 26. Wenzlau JM, Juhl K, Yu LP, Moua O, Sarkar SA, Gottlieb P, Rewers M, Eisenbarth GS, Jensen J, Davidson HW, Hutton JC. 2007. The cation efflux transporter ZnT8 (Slc30A8) is a major autoantigen in human type 1 diabetes. Proceedings of the National Academy of Sciences of the United States of America 104: 17040 5 27. Serreze DV, Fleming SA, Chapman HD, Richard SD, Leiter EH, Tisch RM. 1998. B lymphocytes are critical antigen presenting cells for the initiation of T cell mediated autoimmune diabetes in nonobese diabetic mic e. Journal of Immunology 161: 3912 8 28. Bingley PJ, Bonifacio E, Ziegler AG, Schatz DA, Atkinson MA, Eisenbarth GS. 2001. Proposed guidelines on screening for risk of type 1 diabetes. Diabetes Care 24: 398 29. Willcox A, Richardson SJ, Bone AJ, Foulis AK, Morgan NG. 2009. Analysis of islet inflammation in human type 1 diabetes. Clinical and Experimental Immunology 155: 173 81 30. Jansen A, Homodelarche F, Hooijkaas H, Leenen PJ, Dardenne M, Drexhage HA. 1994. Immunohistochemical Characterization of Monocyt es Macrophages and Dendritic Cells Involved in the Initiation of the Insulitis and Beta Cell Destruction in Nod Mice. Diabetes 43: 667 75 31. Keenan HA, Sun JK, Levine J, Doria A, Aiello LP, Eisenbarth G, Bonner Weir S, King GL. 2010. Residual Insulin Prod uction and Pancreatic beta Cell Turnover After 50 Years of Diabetes: Joslin Medalist Study. Diabetes 59: 2846 53

PAGE 46

46 32. Shoda LKM, Young DL, Ramanujan S, Whiting CC, Atkinson MA, Bluestone JA, Eisenbarth GS, Mathis D, Rossini AA, Campbell SE, Kahn R, Kreuwel HT. 2005. A comprehensive review of interventions in the NOD mouse and implications for translation. Immunity 23: 115 26 33. Yagi H, Matsumoto M, Kunimoto K, Kawaguchi J, Makino S, Harada M. 1992. Analysis of the Roles of Cd4+ and Cd8+ T Cells in Autoimmun e Diabetes of Nod Mice Using Transfer to Nod Athymic Nude Mice. European Journal of Immunology 22: 2387 93 34. Taki T, Nagata M, Ogawa W, Hatamori N, Hayakawa M, Hari J, Shii K, Baba S, Yokono K. 1991. Prevention of Cyclophosphamide Induced and Spontaneous Diabetes in Nod Shi Kbe Mice by Anti Mhc Class I Kd Monoclonal Antibody. Diabetes 40: 1203 9 35. Willcox A, Richardson SJ, Bone AJ, Foulis AK, Morgan NG. 2009. Analysis of islet inflammation in human type 1 diabetes. Clinical and Experimental Immunology 1 55: 173 81 36. Pinkse GG, Tysma OH, Bergen CA, Kester MG, Ossendorp F, van Veelen PA, Keymeulen B, Pipeleers D, Drijfhout JW, Roep BO. 2005. Autoreactive CD8 T cells associated with beta cell destruction in type 1 diabetes. Proc Natl Acad Sci U S A 102: 18 425 30 37. Maedler K, Sergeev P, Ris F, Oberholzer J, Joller Jemelka HI, Spinas GA, Kaiser N, Halban PA, Donath MY. 2002. Glucose induced beta cell production of IL 1 beta contributes to glucotoxicity in human pancreatic islets. Journal of Clinical Investi gation 110: 851 60 38. Planas R, Pujol Borrell R, Vives Pi M. 2010. Global gene expression changes in type 1 diabetes: insights into autoimmune response in the target organ and in the periphery. Immunol Lett 133: 55 61 39. Mosmann TR, Coffman RL. 1989. TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu Rev Immunol 7: 145 73 40. Szabo SJ, Kim ST, Costa GL, Zhang XK, Fathman CG, Glimcher LH. 2000. A novel transcription factor, T bet, directs Th1 lineage commitment. Cell 100: 655 69 41. Hoover DL, Nacy CA, Meltzer MS. 1985. Human monocyte activation for cytotoxicity against intracellular Leishmania donovani amastigotes: induction of microbicidal activity by interferon gamma. Cell Immunol 94: 500 11 42. Jo hnson DR, Pober JS. 1990. Tumor Necrosis Factor and Immune Interferon Synergistically Increase Transcription of Hla Class I Heavy Chain and Light Chain Genes in Vascular Endothelium. Proceedings of the National Academy of Sciences of the United States of A merica 87: 5183 7

PAGE 47

47 43. Steimle V, Siegrist CA, Mottet A, Lisowskagrospierre B, Mach B. 1994. Regulation of Mhc Class Ii Expression by Interferon Gamma Mediated by the Transactivator Gene Ciita. Science 265: 106 9 44. Zheng WP, Flavell RA. 1997. The transcri ption factor GATA 3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89: 587 96 45. Maggi E, Parronchi P, Manetti R, Simonelli C, Piccinni MP, Rugiu FS, De Carli M, Ricci M, Romagnani S. 1992. Reciprocal regulatory effects of IFN gamma and IL 4 on the in vitro development of human Th1 and Th2 clones. Journal of Immunology 148: 2142 7 46. Wong CK, Lit LCW, Tam LS, Li EKM, Wong PTY, Lam CWK. 2008. Hyperproduction of IL 23 and IL 17 in patients with systemic lupus erythematosus : Implications for Th17 mediated inflammation in auto immunity. Clinical Immunology 127: 385 93 47. Shen H, Goodall JC, Gaston JSH. 2009. Frequency and Phenotype of Peripheral Blood Th17 Cells in Ankylosing Spondylitis and Rheumatoid Arthritis. Arthritis a nd Rheumatism 60: 1647 56 48. Montes M, Zhang X, Berthelot L, Laplaud DA, Brouard S, Jin JP, Rogan S, Armao D, Jewells V, Soulillou JP, Markovic Plese S. 2009. Oligoclonal myelin reactive T cell infiltrates derived from multiple sclerosis lesions are enric hed in Th17 cells. Clinical Immunology 130: 133 44 49. Veldhoen M, Hocking RJ, Atkins CJ, Locksley RM, Stockinger B. 2006. TGF beta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL 17 producing T cells. Immunity 24: 179 89 50. Volpe E, Servant N, Zollinger R, Bogiatzi SI, Hupe P, Barillot E, Soumelis V. 2008. A critical function for transforming growth factor beta, interleukin 23 and proinflammatory cytokines in driving and modulating human T H 17 responses. Nature Im munology 9: 650 7 51. Yang L, Anderson DE, Baecher Allan C, Hastings WD, Bettelli E, Oukka M, Kuchroo VK, Hafler DA. 2008. IL 21 and TGF beta are required for differentiation of human T(H)17 cells. Nature 454: 350 U55 52. Ivanov II, Frutos RD, Manel N, Yos hinaga K, Rifkin DB, Sartor RB, Finlay BB, Littman DR. 2008. Specific Microbiota Direct the Differentiation of IL 17 Producing T Helper Cells in the Mucosa of the Small Intestine. Cell Host & Microbe 4: 337 49 53. Yang XXO, Pappu BP, Nurieva R, Akimzhanov A, Kang HS, Chung Y, Ma L, Shah B, Panopoulos AD, Schluns KS, Watowich SS, Tian Q, Jetten AM, Dong C. 2008. T helper 17 lineage differentiation is programmed by orphan nuclear receptors ROR alpha and ROR gamma. Immunity 28: 29 39

PAGE 48

48 54. Chang SH, Dong C. 2007 A novel heterodimeric cytokine consisting of IL 17 and IL 17F regulates inflammatory responses. Cell Research 17: 435 40 55. Strengell M, Matikainen S, Siren J, Lehtonen A, Foster D, Julkunen I, Sareneva T. 2003. IL 21 in synergy with IL 15 or IL 18 enha nces IFN gamma production in human NK and T cells. Journal of Immunology 170: 5464 9 56. Wei L, Laurence A, Elias KM, O'Shea JJ. 2007. IL 21 is produced by Th17 cells and drives IL 17 production in a STAT3 dependent manner. Journal of Biological Chemistry 282: 34605 10 57. Liang SC, Tan XY, Luxenberg DP, Karim R, Dunussi Joannopoulos K, Collins M, Fouser LA. 2006. Interleukin (IL) 22 and IL 17 are coexpressed by Th17 cells and cooperatively enhance expression of antimicrobial peptides. Journal of Experiment al Medicine 203: 2271 9 58. Nakae S, Iwakura Y, Suto H, Galli SJ. 2007. Phenotypic differences between Th1 and Th17 cells and negative regulation of Th1 cell differentiation by IL 17. Journal of Leukocyte Biology 81: 1258 68 59. Korn T, Reddy J, Gao W, Bet telli E, Awasthi A, Petersen TR, Backstrom BT, Sobel RA, Wucherpfennig KW, Strom TB, Oukka M, Kuchroo VK. 2007. Myelin specific regulatory T cells accumulate in the CNS but fail to control autoimmune inflammation. Nat Med 13: 423 31 60. Korn T, Mitsdoerffe r M, Croxford AL, Awasthi A, Dardalhon VA, Galileos G, Vollmar P, Stritesky GL, Kaplan MH, Waisman A, Kuchroo VK, Oukka M. 2008. IL 6 controls Th17 immunity in vivo by inhibiting the conversion of conventional T cells into Foxp3(+) regulatory T cells. Proc eedings of the National Academy of Sciences of the United States of America 105: 18460 5 61. Bettelli E, Carrier YJ, Gao WD, Korn T, Strom TB, Oukka M, Weiner HL, Kuchroo VK. 2006. Reciprocal developmental pathways for the generation of pathogenic effector T(H)17 and regulatory T cells. Nature 441: 235 8 62. Lee YK, Mukasa R, Hatton RD, Weaver CT. 2009. Developmental plasticity of Th17 and Treg cells. Current Opinion in Immunology 21: 274 80 63. Xu LL, Kitani A, Fuss I, Strober W. 2007. Cutting edge: Regula tory T cells induce CD4(+)CD25( )Foxp3( ) T cells or are self induced to become Th17 cells in the absence of exogenous TGF beta. Journal of Immunology 178: 6725 9 64. Zhou L, Lopes JE, Chong MMW, Ivanov II, Min R, Victora GD, Shen YL, Du JG, Rubtsov YP, Ru densky AY, Ziegler SF, Littman DR. 2008. TGF beta induced Foxp3 inhibits T(H)17 cell differentiation by antagonizing ROR gamma t function. Nature 453: 236 U14

PAGE 49

49 65. Murphy CA, Langrish CL, Chen Y, Blumenschein C, McClanahan T, Kastelein RA, Sedgwick JD, Cua DJ. 2003. Divergent pro and Antiinflammatory roles for IL 23 and IL 12 in joint autoimmune inflammation. Journal of Experimental Medicine 198: 1951 7 66. Cua DJ, Sherlock J, Chen Y, Murphy CA, Joyce B, Seymour B, Lucian L, To W, Kwan S, Churakova T, Zuraw ski S, Wiekowski M, Lira SA, Gorman D, Kastelein RA, Sedgwick JD. 2003. Interleukin 23 rather than interleukin 12 is the critical cytokine for autoimmune inflammation of the brain. Nature 421: 744 8 67. Aranami T, Yamamura T. 2008. Th17 Cells and autoimmun e encephalomyelitis (EAE/MS). Allergol Int 57: 115 20 68. Lubberts E. 2008. IL 17/Th17 targeting: on the road to prevent chronic destructive arthritis? Cytokine 41: 84 91 69. Emamaullee JA, Davis J, Merani S, Toso C, Elliott JF, Thiesen A, Shapiro AM. 2009 Inhibition of Th17 cells regulates autoimmune diabetes in NOD mice. Diabetes 58: 1302 11 70. Jain R, Tartar DM, Gregg RK, Divekar RD, Bell JJ, Lee HH, Yu P, Ellis JS, Hoeman CM, Franklin CL, Zaghouani H. 2008. Innocuous IFN gamma induced by adjuvant free antigen restores normoglycemia in NOD mice through inhibition of IL 17 production. Journal of Experimental Medicine 205: 207 18 71. Nikoopour E, Schwartz JA, Huszarik K, Sandrock C, Krougly O, Lee Chan E, Singh B. 2010. Th17 Polarized Cells from Nonobese Diabetic Mice Following Mycobacterial Adjuvant Immunotherapy Delay Type 1 Diabetes. Journal of Immunology 184: 4779 88 72. Bending D, De La Pena H, Veldhoen M, Phillips JM, Uyttenhove C, Stockinger B, Cooke A. 2009. Highly purified Th17 cells from BDC2.5NO D mice convert into Th1 like cells in NOD/SCID recipient mice. Journal of Clinical Investigation 119: 565 72 73. Martin Orozco N, Chung Y, Chang SH, Wang YH, Dong C. 2009. Th17 cells promote pancreatic inflammation but only induce diabetes efficiently in l ymphopenic hosts after conversion into Th1 cells. European Journal of Immunology 39: 216 24 74. Marwaha AK, Crome SQ, Panagiotopoulos C, Berg KB, Qin HL, Qin OY, Xu LX, Priatel JJ, Levings MK, Tan RS. 2010. Cutting Edge: Increased IL 17 Secreting T Cells i n Children with New Onset Type 1 Diabetes. Journal of Immunology 185: 3814 8 75. Honkanen J, Nieminen JK, Gao R, Luopajarvi K, Salo HM, Ilonen J, Knip M, Otonkoski T, Vaarala O. 2010. IL 17 Immunity in Human Type 1 Diabetes. Journal of Immunology 185: 1959 67

PAGE 50

50 76. Bradshaw EM, Raddassi K, Elyaman W, Orban T, Gottlieb PA, Kent SC, Hafler DA. 2009. Monocytes from Patients with Type 1 Diabetes Spontaneously Secrete Proinflammatory Cytokines Inducing Th17 Cells. Journal of Immunology 183: 4432 9 77. Benjamini Y, Hochberg Y. 1995. Controlling the False Discovery Rate a Practical and Powerful Approach to Multiple Testing. Journal of the Royal Statistical Society Series B Methodological 57: 289 300 78. Yoshimoto T, Takeda K, Tanaka T, Ohkusu K, Kashiwamura S, Okam ura H, Akira S, Nakanishi K. 1998. IL 12 up regulates IL 18 receptor expression on T cells, Th1 cells, and B cells: Synergism with IL 18 for IFN gamma production. Journal of Immunology 161: 3400 7 79. Sakai A, Sugawara Y, Kuroishi T, Sasano T, Sugawara S. 2008. Identification of IL 18 and th17 cells in salivary glands of patients with Sjogren's syndrome, and amplification of IL 17 mediated secretion of inflammatory cytokines from salivary gland cells by IL 18. Journal of Immunology 181: 2898 906 80. Infante Duarte C, Horton HF, Byrne MC, Kamradt T. 2000. Microbial lipopeptides induce the production of IL 17 in Th cells. Journal of Immunology 165: 6107 15 81. Hanifi Moghaddam P, Schloot NC, Kappler S, Seissler J, Kolb H. 2003. An association of autoantibody s tatus and serum cytokine levels in type 1 diabetes. Diabetes 52: 1137 42 82. Kretowski A, Mironczuk K, Karpinska A, Bojaryn U, Kinalski M, Puchalski Z, Kinalska I. 2002. Interleukin 18 promoter polymorphisms in type 1 diabetes. Diabetes 51: 3347 9 83. Novo ta P, Kolostova K, Pinterova D, Novak J, Treslova L, Andel M, Cerna M. 2005. Interleukin IL 18 gene promoter polymorphisms in adult patients with type 1 diabetes mellitus and latent autoimmune diabetes in adults. Immunol Lett 96: 247 51 84. Ide A, Kawasaki E, Abiru N, Sun F, Kobayashi M, Fukushima T, Takahashi R, Kuwahara H, Kita A, Oshima K, Uotani S, Yamasaki H, Yamaguchi Y, Eguchi K. 2004. Association between IL 18 gene promoter polymorphisms and CTLA 4 gene 49A/G polymorphism in Japanese patients with t ype 1 diabetes. J Autoimmun 22: 73 8 85. Giedraitis V, He B, Huang WX, Hillert J. 2001. Cloning and mutation analysis of the human IL 18 promoter: a possible role of polymorphisms in expression regulation. J Neuroimmunol 112: 146 52

PAGE 51

51 86. Smyth DJ, Plagnol V Walker NM, Cooper JD, Downes K, Yang JH, Howson JM, Stevens H, McManus R, Wijmenga C, Heap GA, Dubois PC, Clayton DG, Hunt KA, van Heel DA, Todd JA. 2008. Shared and distinct genetic variants in type 1 diabetes and celiac disease. N Engl J Med 359: 2767 77 87. Hunt KA, Zhernakova A, Turner G, Heap GA, Franke L, Bruinenberg M, Romanos J, Dinesen LC, Ryan AW, Panesar D, Gwilliam R, Takeuchi F, McLaren WM, Holmes GK, Howdle PD, Walters JR, Sanders DS, Playford RJ, Trynka G, Mulder CJ, Mearin ML, Verbeek WH, Trimble V, Stevens FM, O'Morain C, Kennedy NP, Kelleher D, Pennington DJ, Strachan DP, McArdle WL, Mein CA, Wapenaar MC, Deloukas P, McGinnis R, McManus R, Wijmenga C, van Heel DA. 2008. Newly identified genetic risk variants for celiac disease related to the immune response. Nat Genet 40: 395 402 88. Kunikata T, Torigoe K, Ushio S, Okura T, Ushio C, Yamauchi H, Ikeda M, Ikegami H, Kurimoto M. 1998. Constitutive and induced IL 18 receptor expression by various peripheral blood cell subsets as determined by anti hIL 18R monoclonal antibody. Cellular Immunology 189: 135 43 89. Kim SH, Reznikov LL, Stuyt RJ, Selzman CH, Fantuzzi G, Hoshino T, Young HA, Dinarello CA. 2001. Functional reconstitution and regulation of IL 18 activity by the IL 18R beta chain. Journ al of Immunology 166: 148 54

PAGE 52

52 BIOGRAPHICAL SKETCH A native Floridian, Courtney Myhr grew up in Coral Springs and attended the University of Florida as an undergraduate. She e arned a Bachelor of Science in m icrobiology in 2006, and promptly entered the Co program. She was accepted as a student by Dr. Mark Atkinson and has been investigating aberrancies in T cell immunology in type 1 diabetes.