<%BANNER%>

Functional Significance and Therapeutic Targeting of Chemokines and Chemokine Receptors in Glioblastoma

Permanent Link: http://ufdc.ufl.edu/UFE0042901/00001

Material Information

Title: Functional Significance and Therapeutic Targeting of Chemokines and Chemokine Receptors in Glioblastoma
Physical Description: 1 online resource (114 p.)
Language: english
Creator: LIU,CHE
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: CHEMOKINE -- CX3CR1 -- CXCR3 -- CXCR4 -- CXCR7 -- GLIOBLASTOMA -- NBI74330
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Human glioblastoma multiforme (GBM) is the most common primary brain tumor in adults. The goal of this study is to investigate the functions of several chemokine systems in glioblasotma biology. First, the role of the chemokine CX3CL1 and its receptor CX3CR1 in the GL261 murine model of malignant glioma was investigated. In situ hybridization analysis identified CX3CL1 and CX3CR1 expression in GL261 tumors. With CX3CR1 gene-disrupted C57BL/6 mice, a slight increase in the tumor growth rate in CX3CR1-/- mice was evident with similar numbers of microglia and CD4+, CD8+, Foxp3+, or Ly49G2+ lymphocytes within tumors established in CX3CR1+/- and -/- mice. These data indicate that CX3CR1 has little or no effect on either gliomagenesis or the migration of microglia and lymphocytes into GL261 tumors. Next, we examined the role of CXCR3 in glioma progression. Intracranial GL261 tumors express CXCL9 and CXCL10 in vivo. Glioma-bearing CXCR3-deficient mice had significantly shorter median survival time and reduced numbers of tumor-infiltrated natural killer and natural killer T cells as compared with control. In contrast, antagonism of CXCR3 with NBI-74330 prolonged median survival times of both tumor-bearing WT and CXCR3-deficient mice when compared with vehicle-treated groups. NBI-74330 treatment did not impact tumor infiltration of lymphocytes and microglia. A small percentage of GL261 cells were identified as CXCR3+, which was similar to the expression of CXCR3 in several grade IV human glioma cell lines. When cultured as gliomaspheres (GS), the human and murine lines increased CXCR3 expression; CXCR3 expression was also found in a primary human GBM-derived GS. Additionally, CXCR3 isoform A was expressed by all lines, whereas CXCR3-B was detected in T98G-, U118- and U138-GS cells. CXCL9 or CXCL10 induced in vitro glioma cell growth in GL261- and U87-GS as well as inhibited cell loss in U138-GS cells and this effect was antagonized by NBI-74330. The results suggest that CXCR3 antagonism exerts a direct anti-glioma effect and this receptor may be a potential therapeutic target for treating human GBM. In the last part of the project, we demonstrated that CCR3, CXCR3, CXCR4 and CXCR7 are expressed in primary human GBM cell lines. GBM cell lines can be grouped as CXCR4high-CXCR7low (GBM L0, L2, L3) and CXCR4low-CXCR7high (GBM L1, S3, S7). In addition, CCL5 and CXCL11 are also expressed by GBM L0 and L1. When GBM cell subtypes were isolated, all of them were capable of restoring their parental phenotypes regarding cell surface expression of CXCR4 and CXCR7. Moreover, CXCL12 induced cell migration while CXCL11 and CXCL12 promoted cell growth in GBM L0 and L1 cells.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by CHE LIU.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Harrison, Jeffrey K.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0042901:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042901/00001

Material Information

Title: Functional Significance and Therapeutic Targeting of Chemokines and Chemokine Receptors in Glioblastoma
Physical Description: 1 online resource (114 p.)
Language: english
Creator: LIU,CHE
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: CHEMOKINE -- CX3CR1 -- CXCR3 -- CXCR4 -- CXCR7 -- GLIOBLASTOMA -- NBI74330
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Human glioblastoma multiforme (GBM) is the most common primary brain tumor in adults. The goal of this study is to investigate the functions of several chemokine systems in glioblasotma biology. First, the role of the chemokine CX3CL1 and its receptor CX3CR1 in the GL261 murine model of malignant glioma was investigated. In situ hybridization analysis identified CX3CL1 and CX3CR1 expression in GL261 tumors. With CX3CR1 gene-disrupted C57BL/6 mice, a slight increase in the tumor growth rate in CX3CR1-/- mice was evident with similar numbers of microglia and CD4+, CD8+, Foxp3+, or Ly49G2+ lymphocytes within tumors established in CX3CR1+/- and -/- mice. These data indicate that CX3CR1 has little or no effect on either gliomagenesis or the migration of microglia and lymphocytes into GL261 tumors. Next, we examined the role of CXCR3 in glioma progression. Intracranial GL261 tumors express CXCL9 and CXCL10 in vivo. Glioma-bearing CXCR3-deficient mice had significantly shorter median survival time and reduced numbers of tumor-infiltrated natural killer and natural killer T cells as compared with control. In contrast, antagonism of CXCR3 with NBI-74330 prolonged median survival times of both tumor-bearing WT and CXCR3-deficient mice when compared with vehicle-treated groups. NBI-74330 treatment did not impact tumor infiltration of lymphocytes and microglia. A small percentage of GL261 cells were identified as CXCR3+, which was similar to the expression of CXCR3 in several grade IV human glioma cell lines. When cultured as gliomaspheres (GS), the human and murine lines increased CXCR3 expression; CXCR3 expression was also found in a primary human GBM-derived GS. Additionally, CXCR3 isoform A was expressed by all lines, whereas CXCR3-B was detected in T98G-, U118- and U138-GS cells. CXCL9 or CXCL10 induced in vitro glioma cell growth in GL261- and U87-GS as well as inhibited cell loss in U138-GS cells and this effect was antagonized by NBI-74330. The results suggest that CXCR3 antagonism exerts a direct anti-glioma effect and this receptor may be a potential therapeutic target for treating human GBM. In the last part of the project, we demonstrated that CCR3, CXCR3, CXCR4 and CXCR7 are expressed in primary human GBM cell lines. GBM cell lines can be grouped as CXCR4high-CXCR7low (GBM L0, L2, L3) and CXCR4low-CXCR7high (GBM L1, S3, S7). In addition, CCL5 and CXCL11 are also expressed by GBM L0 and L1. When GBM cell subtypes were isolated, all of them were capable of restoring their parental phenotypes regarding cell surface expression of CXCR4 and CXCR7. Moreover, CXCL12 induced cell migration while CXCL11 and CXCL12 promoted cell growth in GBM L0 and L1 cells.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by CHE LIU.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Harrison, Jeffrey K.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0042901:00001


This item has the following downloads:


Full Text

PAGE 1

1 FUNCTIONAL SIGNIFICANCE AND THERAPEUTIC TARGETING OF CHEMOKINES AND CHEMOKINE RECEPTORS IN GLIOBLASTOMA By CHE LIU A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORID A IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Che Liu

PAGE 3

3 To my wife and everyone I love

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my mentor, Dr. Jeff rey K. Harrison, for educating and training me regarding research, culture, and life. I appreciate Dr. Brent A. Reynolds, Dr. Brian K. Law, and Dr. Wolfgang J. Streit for servi ng on my committee and for the advice they have provided. I also wish to thank my colleagues Defang Luo, Kathy Laughlin, Kien Pham, and Cyrus Bhadha for everything they did along these years. I especially thank Neal Benson and Amy Poirier for their technica l help on my flow cytometry experiments. I am also thankful to everyone who has helped me in every respect. Most important, I would like to thank my wife Wei, and my parents. Without you I couldnt go this far. Thank you for y our support, patience, and unconditional love.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDG MENTS..................................................................................................4 LIST OF TABLES............................................................................................................8 LIST OF FI GURES .......................................................................................................... 9 ABSTRACT ................................................................................................................... 11 1 INTRODUC TION ....................................................................................................13 Glioblastoma Multif or me (GBM )..............................................................................13 Treatment .......................................................................................................... 13 Therapeutic Resistance and Heterogeneity of GBM .........................................15 Cancer Stem-Lik e Cells .......................................................................................... 16 Targeting Cancer St em-Like Ce lls ....................................................................18 Chemokines and Chemok ine Recept ors................................................................. 19 Chemokines, Chemokine Re ceptors, and Cancer .................................................. 20 CX3CR1-CX3 CL1 ............................................................................................21 CXCR3 and CXCL9, 10, 11 ..............................................................................21 CXCR4-CX CR7 ................................................................................................23 Other Chemokines ...........................................................................................25 Gliomasphere Model ...............................................................................................26 Murine Glioma 261 (GL261) M odel ......................................................................... 27 Significance and Spec ific Ai ms ...............................................................................28 2 MATERIALS AND METHODS ................................................................................31 Animals ................................................................................................................... 31 Cell Cult ure .............................................................................................................31 Reverse Transcription Polymerase Chain Reaction (RT-PCR) ............................... 32 Intracranial Injection of GL261 Glioma Cells ........................................................... 33 NBI-74330 Treat ment .............................................................................................34 Kaplan-Meier Surviv al Analys is ..............................................................................34 In Situ Hybridiz ation (ISH ) .......................................................................................34 Immunohistochem istry ............................................................................................35 CXCL10 Enzyme-Linked Imm uno sorbent A ssay....................................................35 FACS Anal ysis ........................................................................................................36 In Vitro Growth A nalysis ..........................................................................................36 Migration A ssay ......................................................................................................37 Primary Sphere Form ation Assa y ...........................................................................37 Statistical A nalysis ..................................................................................................38 3 ROLE OF CX3CR1 AND CX3CL1 IN GBM ............................................................40

PAGE 6

6 Results .................................................................................................................... 41 CX3CL1 and CX3CR1 Expres sion in GL261 Tumors ......................................41 Tumor Growth and Animal Survival Were Not Affected by CX3CR1 Deficien cy ......................................................................................................41 CX3CR1 Did Not Mediate Microglia Mi gration into Glioma Tissue ...................42 CX3CR1 Was Not Necessary for Ly mphocyte Infiltrati on into GL261 Gliomas .........................................................................................................43 Discussio n ..............................................................................................................43 4 ROLE OF CXCR3 AND IT S LIGA NDS IN GBM.....................................................52 Results .................................................................................................................... 53 Murine Glioma GL261 Ce lls Expressed CXCL10 In Vitro and GL261 Tumors Express CXCL9 and CXCL10 In Vivo .............................................. 53 Reduced Numbers of Tumor-Infiltrated Ly49G2+ NK and NKT Cells in GL261 Gliomas from CX CR3-Deficient Mice Was Associated with Decreased Animal Survival ...........................................................................53 CXCR3 Antagonism Suppressed G L261 Tumor Growth and Increased Animal Sur vival Independent of Host CXCR3 Ex pression............................54 CXCR3 and Its Ligands Were Expressed by Murine and Human Glioma Cells .............................................................................................................. 55 CXCL9 and CXCL10 Stimulated Growth of Murine and Human Gliomasphe res ..............................................................................................57 Discussio n ..............................................................................................................58 5 CXCR4 AND CXCR 7 IN GBM ................................................................................74 Results .................................................................................................................... 75 Primary GBM Cell Lines Had a Sm all Fraction of CCR3and CXCR3Expressing Cells ........................................................................................... 75 Primary GBM Cell Lines Showed Diffe rential Expression of CXCR4 and CXCR7 on the Cell Surface ...........................................................................76 CXCL11, CXCR4, CXCR7, but Not CXCL12 Were Expressed by GBM L0 and L1 Cells Independent of Their Surfac e CXCR4CXCR7 Heterogeneity.76 GBM L0 and L1 Subpopulations Formed Spheres and Retained the Parental Surface CXCR4-C XCR7 Hetero geneity ..........................................77 CXCL12 Induced GBM L0 and L1 Cell Migr at ion.............................................77 CXCL11 and CXCL12 Promoted GBM Ce ll Growth bu t Had No Effect on Primary Sphere Formation In Vitro................................................................ 78 Discussio n ..............................................................................................................78 6 GENERAL DISC USSION .......................................................................................90 Summary of Findings .............................................................................................. 90 Chemokines and Tumor-Infiltrate d Immune Cells in GBM ......................................91 Heterogeneity and Redundancy of Chem okine Receptors in GBM ........................92 Future Direc tions ....................................................................................................93

PAGE 7

7 Does CXCR7 Impact Cell Migration in GBM? ..................................................94 Do CXCR4 and CXCR7 Play Critical Ro les in GBM Ste m-Like Cells?.............94 Will CXCR4 or CXCR7 An tagonists Inhibit Tumor Growth of GBM Cells In Vitro and In Vivo ? ..........................................................................................95 LIST OF REFE RENCES ...............................................................................................96 BIOGRAPHICAL SKETCH .......................................................................................... 114

PAGE 8

8 LIST OF TABLES Table page 2-1 Predicted PCR product si zes ..............................................................................39 3-1 Numbers of tumor-infiltrated GFP+ and CD11b+ cells.........................................46 3-2 Numbers of tumo r-infiltrated ly mphocytes ........................................................... 46 4-1 % CXCR3+ population in adherent cell s and gliomasp heres...............................63 5-1 % CCR3+, CXCR3+, CXCR4+, and CXCR7+ populations in primary GBM cell lines ....................................................................................................................83

PAGE 9

9 LIST OF FIGURES Figure page 3-1 CX3CR1 was expr essed in GL261 tu mors..........................................................47 3-2 CX3CL1 was expre ssed in GL261 tu mors. .........................................................48 3-3 Tumorigenesis in CX3CR1+/and CX3CR1-/mice..............................................49 3-4 Infiltration of CX3CR1+/CD11b+ cells into G L261 glioma s...................................50 3-5 Lymphocytes were pres ent in GL261 tumors from CX3CR1+/and CX3CR1-/mice....................................................................................................................51 4-1 CXCL9 and CXCL10 were expressed in GL261 glioma cells and/or tumors .......64 4-2 GL261 tumor-beari ng CXCR3-defic ient mice had decreased survival rates and tumor-infiltrated NK and NKT ce lls..............................................................65 4-3 NBI-74330 suppressed tumo r growth in both WT and CXCR3-/mice.................66 4-4 NBI-74330 did not alter numbers of tumor-infiltrated cells nor CXCL9 and CXCL10 expre ssion............................................................................................67 4-5 CXCR3 and CXCL10 expression in murine and human glioma ce lls ..................68 4-6 Nestin and SOX2 expr ession in glio maspheres ..................................................69 4-7 CXCL10, CXCL11 and CXCR3 ex pression in GS cells.......................................70 4-8 Representative hi stograms of CXCR3 ex pressi on in gliomasp heres..................71 4-9 CXCR3 promot ed gliomas phere growth in vitro ..................................................72 4-10 NBI-74330 inhibited CXCR3nediated gliomaspher e growth ..............................73 5-1 CCR3 and CXCR3 expression in prim ary human GB M cell li nes........................84 5-2 CXCR4 and CXCR7 expression in primary huma n GBM cell li nes.....................85 5-3 CXCL11, CXCR4, and CXCR7 mRNA and intracellular protein expres sion in primary human GBM cell lines ............................................................................86 5-4 GBM cell subtypes recapitulat ed the original heter ogeneous express ion of CXCR4 and CXCR7 on cell membr ane..............................................................87 5-5 Effect of 10 nM CXCL11 or CXCL12 on GBM L0 and L1 cell migr ation ..............88

PAGE 10

10 5-6 Effect of 10 nM CXCL11 or CXCL12 on GBM L0 and L1 primary sphere formation a nd ce ll growth ...................................................................................89

PAGE 11

11 Abstract of Dissertation Pr esented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for t he Degree of Doctor of Philosophy FUNCTIONAL SIGNIFICANCE AND THER APEUTIC TARGETING OF CHEMOKINES AND CHEMOKINE RECEPTORS IN GLIOBLASTOMA By Che Liu May 2011 Chair: Jeffrey K. Harrison Major: Medical Sciences Physiology and Pharmacology Human glioblastoma multiforme (GBM) is the most common prim ary brain tumor in adults. The goal of this study is to invest igate the functions of several chemokine systems in glioblasotma biology. First, t he role of the chemokine CX3CL1 and its receptor CX3CR1 in the GL261 murine model of malignant glioma was investigated. In situ hybridization analysis identified CX3C L1 and CX3CR1 expression in GL261 tumors. With CX3CR1 gene-disrupted C57BL/6 mice, a slight increase in the tumor growth rate in CX3CR1-/mice was evident with simila r numbers of microglia and CD4+, CD8+, Foxp3+, or Ly49G2+ lymphocytes within tumors established in CX3CR1+/and -/mice. These data indicate that CX3CR1 has little or no effect on either gliomagenesis or the migration of microglia and lymphocytes into GL261 tumors. Next, we examined the role of CXCR3 in glioma progression. Intracranial GL261 tumors express CXCL9 and CXCL10 in vivo Glioma-bearing CXCR3-deficient mice had significantly shorter median survival time and reduced numbers of tumor-infiltrated natural killer and natural killer T cells as compared with control. In contrast, antagonism of CXCR3 with NBI-74330 prolonged median survival times of both tumor-bearing WT and CXCR3-deficient mice when compared with vehicle-treated groups. NBI-74330

PAGE 12

12 treatment did not impact tumor infiltrati on of lymphocytes and microglia. A small percentage of GL261 cells were identified as CXCR3+, which was similar to the expression of CXCR3 in several grade IV human glioma cell lines. When cultured as gliomaspheres (GS), the human and murine lines increased CXCR3 expression; CXCR3 expression was also found in a primary human GBM-derived GS. Additionally, CXCR3 isoform A was expressed by all lines, whereas CXCR3-B was detected in T98G-, U118and U138-GS cell s. CXCL9 or CXCL10 induced in vitro glioma cell growth in GL261and U87-GS as well as inhi bited cell loss in U138-GS cells and this effect was antagonized by NBI-74330. The re sults suggest that CXCR3 antagonism exerts a direct anti-glioma e ffect and this receptor may be a potential therapeutic target for treating human GBM. In the last part of the project, we demonstrated t hat CCR3, CXCR3, CXCR4 and CXCR7 are expressed in primary human GBM cell lines. GBM cell lines can be grouped as CXCR4high-CXCR7low (GBM L0, L2, L3) and CXCR4low-CXCR7high (GBM L1, S3, S7). In addition, CCL5 and CXCL11 are also expressed by GBM L0 and L1. When GBM cell subtypes were isolated, all of them were capable of restoring their parental phenotypes regarding cell surface expression of CX CR4 and CXCR7. Moreover, CXCL12 induced cell migration while CXCL11 and CXCL12 pr omoted cell growth in GBM L0 and L1 cells.

PAGE 13

13 CHAPTER 1 INTRODUCTION Glioblastoma Multiforme (GBM) Glioma is tumor that arises from the glia l tissue of the brain. One type of glioma, which arises from astrocytes is called astrocytoma. Astrocytomas are graded using a scale of I to IV according to their degree of malignancy. On this scale, grade IV astrocytoma, also known as glioblastoma multiforme (GBM) or glioblastoma, are the most aggressive tumor that contains areas of necrosis. GBM is the most common primary glioma in adults and about 50 % of t hese gliomas are GBM. In addition, 10 % of pediatric gliomas are also GBM. The integrity of the brain is influenced by the tumor growth and the accompanied increase in intr acranial pressure, which leads to several symptoms that include headaches, seizures, memory loss, and changes in behavior. Treatment Surgery is the first procedure in the treatme nt of GBM in order to remove as much tumor as possible and to provide tissues fo r confirming the diagnosis. Due to the highly infiltrative character of GBM, it is nearly impossible to surgically remove the tumor completely. To overcome this situation, radiation and chemotherapy are then utilized to target the remaining tumor cells. Despite th e substantial investigation to search for potential novel chemotherapeutic agents, only a few drugs have made it into clinical practice. An oral methylating cytotoxic drug, temozolomide, has shown a certain level of effectiveness and is now a standard chemotherapeutic agent to treat newly diagnosed GBM1. Bevacizumab, a monoclonal antibody against the vascular endothelial growth factor A (VEGF-A), is another drug that has been approved by the FDA2. Immunotherapy with immune response modula ting reagents, like vaccines, antibodies,

PAGE 14

14 cytokines, and drugs, has also been well studied. The mutated and aberrantly expressed proteins by tumor cells are potential targets that coul d be identified by the immune system. The marked presence of glioma-infiltrating microglia and lymphocytes supports the concept of ta rgeting the immune system to treat GBM. Interferons and TGF are examples of cytokines studied in tumor immunotherapy3. Cancer vaccines4 accompanied with dendritic ce ll (DC) based immunotherapy5,6 and adoptive transfer of T cells7,8 are other potential immune-based therapies under investigation. Despite the continuous efforts from resear chers to look for di fferent approaches for treating GBM, the outcomes of treatment have not significantly improved. The median survival of GBM patients with multi-fa ceted therapies is less than 16 months9,10. The 2 year-survival of patients tr eated with temozolomide is only 25% and recurrent brain tumors tend to be more aggressive than t heir parental tumors before treatment. The effect of bevacizumab does not last very l ong as the median duration of effect ranges from 3 to 6 months2,11. In addition, the bevacizumab based treatment for recurrent GBM has not shown any improv ement on patient survival12. Although immunotherapies have achieved some successes in treating certain types of cancers, like melanoma, renal cell cancer, and hematologic malignancies13, the blood-brain barrier (BBB) of the brain prevents immunotherapy-based r eagents from penetrating brain tissue, which results in the ineffectiveness of immunotherapy reagents. Most important, successful immunotherapy of GBM will need to overcome the highly immunosuppressive environment created by the tumor, that incl udes immunosuppressive cytokines such as TGF and interleukin 1014 and immune cells such as the regulatory T cell15. Thus, more

PAGE 15

15 thorough investigations to understand GBM biology are necessary to 1) decipher the mechanisms contributing to therapeutic resistance of GBM and 2) discover novel therapeutic targets to develop better drugs and treatments. Therapeutic Resistance and Heterogeneity of GBM One of the main reasons that GBM is resistant to mult iple therapies is the high level of heterogeneity within GBM cell populations. The rea lization that GBMs with similar histopathologic features can have different subtypes, and the heterogeneity of the molecular profile in GBM has lead to va riable responses to traditional brain tumor therapies. For instance, the heterogeneity of GBM contributes to temozolomide resistance. The MGMT gene, which encodes a DNA alkylating-repair enzyme, has been found to be methylated in 45% of GBM tissues examined16. The methylation state of the MGMT promoter determines whether tumor cells are responsive to temozolomide as tumor cells without MGMT promoter methyl ation are insensitive to temozolomide treatment. In the combinat ion of temozolomide and radi ation therapy, patients with MGMT-promoter methyl ation showed an improved 2 year-survival rate when compared with patients without MGMT promoter methylation (46 % v.s. 14 %)16. Therefore, MGMT methylation status may be one predictive marker for GBM and confirms that GBM with different molecular profiles may have varying levels of therapy resistance. Epidermal growth factor receptor (EGFR) is another example. EGFR has been examined as a therapeutic target since EGFR amp lification has been reported in GBM17. However, only 41 % of GBM samples showed EGFR gene amplification17, and mutated EGFR variants are commonly found in GBM with EGFR overexpression18. Therefore, EGFR heterogeneity could result in varied res ponses of GBM patients to EGFR-based treatments. The heterogeneity of GBM provi des a challenge for targeting a single

PAGE 16

16 molecule as a therapeutic approach. To dat e continuous efforts are being made to understand the molecular profile of GBM. Several micro-array analyses comparing gene expression patterns of GBM fr om patients have established t hat GBMs can be divided into 3 distinct molecular groups based on their gene expression profile: proneural, proliferative, and mesenchymal19,20. It was shown that pati ents with proliferative or mesenchymal glioblastomas have shorter life spans than those characterized by the proneural type, and glioblastomas tend to sh ift toward a mesenchymal subtype at recurrence. A more recent publication reported a higher diversity of molecular profiles of GBMs21. According to Verhaak et al., GBMs can be classified into four subtypes, namely classical, mesenchymal, proneural, and neural21. Interestingly, they reported that recurrent secondary tumors do not change their subtype class, which differs from what was suggested previously19. In addition, each subtype shows similar gene sets to distinct neural cell types. The proneural class is highly similar to an oligodenrocytic gene signature while the classical subtype is associated with an astrocytic signature. The mesenchymal group is associated with cultured astroglial signature, whereas the neural class shows the association with olig odendrocytic, astrocytic, and neuronal gene expression patterns. These differences in genetic profiles within GBMs indicate the necessity of developing a personalized and molecular subtype-specific therapeutic approach to treat GBM patients. Cancer Stem-Like Cells Another finding that provi des understanding of GBM heter ogeneity is the discovery of cancer stem-like cells (CSCs). Cancer st em-like cells are a smal l subset of cancer cells that share several similar properties with normal stem cells. It is believed that CSCs are also responsible for heterogenei ty and therapeutic resistance of cancers.

PAGE 17

17 CSCs were first found in l eukemia and multiple myeloma22-24. It was hypothesized that only a specific small population of canc er cells have tumor initiating capacity24 and are able to differentiate, which could increase the diversity of cancer cell populations. Growing evidence suggests that CSCs exist among different types of cancer, such as malignant melanoma25, colorectal cancer26, and brain tumors27. CD133, a neural and hematopoietic stem cell marker is found on the cancer stem-like cells and is widely used to identify CSCs among different cancer s. Other markers that are present in normal stem cells such as CD44, CD24, CD15, nestin, and SOX2 are also utilized in the identification and characteriza tion of CSCs. Previous e fforts to characterize CD133+ CSCs have realized that CD133+ levels correlated to the malignancy of human glioma and are associated with poor prognosis, wit h higher grade (III and IV) gliomas having enhanced CD133 expression28. Moreover, CD133+ CSCs isolated from human GBM were capable of tumor initiation while the CD133 GBM cells from the same patients were incapable of forming solid tumors27,29-31. These findings lead to the hypothesis that CSCs are the cells responsible for tumor initiation in vivo However, recent studies from colorectal cancer32 and glioma33-35 recognized that CD133CSCs, with their lower proliferation inde x and different molecula r profiles, also had tumo r initiatimg capacity. These studies raised controversy of CD133 as a CSC marker and revealed higher heterogeneity of CSCs than previously thought, suggesting the existence of different CSC populations. Studies to identify the CSC populaiton with other stem cell markers once again confirmed the heter ogeneous characteristics of CS Cs. Challenges to the CSC hypothesis have also been proposed. Quintana et al reported that when human melanomas were tranplanted into non-obese diabetic/severe combined

PAGE 18

18 immunodeficiency (NOD/SCID) interleukin-2 receptor gamma chain deficient ( Il2rg-/-), aks NSG mice, which are more highly i mmune-compromised than regular NOD/SCID mice, the detectable frequency of tumorigenic cells in melanoma increased by an average of 27 %36. This study suggests that the tumor initiating cells are actually more common in the cancer cell population. More important, this study showed that the assessment techniques and assays could dramatically affect results of CSC studies. In addition, the same group show ed in a recent publication t hat none of the 22 stem cell markers tested, including CD271 ( neural crest nerve growth factor receptor), are capable of enriching tumor initiating cells37. Interestingly Boiko et al. reported that in a different animal model ( T-, Band natural-k iller-deficient Rag2 /c / mice), CD271+ cells, isolated from 90 % of melanomas tested, successfully formed tumors, but CD271cells failed to form solid melanomas in vivo38. These data once again fueled the debate about the accuracy of assays used to characteri ze CSCs and whether tumor initiation is an exclusive property of these cells. Targeting Cancer Stem-Like Cells While controversy surrounds the concept of tumor initiating cells (CSCs), CSCs are still worthy targets in tr eating GBM. Firstly, GBM st em-like cells showed greater tumor initiating efficiency than non-stem cells. In the mouse model of GL261 glioma, as few as 100 CD133+ cells were capable of initiating gliomas while it required 10,000 CD133cells to form a solid tumor33. The impact of different immune-compromised animals on the frequency of tumor initiating ce lls also indicated that CSCs are more efficient to form tumo rs in the less immune-compromised environment36-39. Several studies have reported that CSCs exhibit properties of enhanced resistance to standard

PAGE 19

19 therapies in GBMs. After radiation, CD133+ cells were enriched in vitro and in vivo In addition, CD133+ cells preferentially activate enhanced DNA damage checkpoint mechanisms after radiation9. Moreover, CSCs tend to expr ess higher levels of genes associated with resistance to chemotherapy, such as BCRP1 and MGMT16 as well as the ATP binding cassette drug transporter40. Together, these findings suggest that GBM stem-like cells contribute to therapeutic resistance of GBM. Several signaling pathways involved in stem cell maintenance have been reported and their therapeutic importance has been investigated. Inhibition of the Notch signaling pathway depleted CD133+ cells and reduced gliomasphere formation of GBM stem-like cells41. EGF mediated growth signaling is anot her critical pathway in GBM. EGFR kinase inhibitors lowered GBM stem-like cell proliferation and gliomasphere formation in vitro42,43. However, EGFR antagonism-based clinical trials have not provided promising results given the heterogeneity of EGFR in GBM. Inhibitors of STAT3, BMP, TGF and Wnt signaling pathways are either in clinical trials or under current consideration. The forced differentiation of GBM stemlike cells has also been investigated44 as differentiated cells usually lose their l ong-term repopulation capacit y and are unable to initiate tumors in vivo Thus, promoting cell differentia tion could lead to successful development of GBM therapies. A previous st udy has shown that BMP4 treatment led to GBM differentiation and reduced tumor growth and invasion45. Other studies suggested that PTEN, a well-known tumor suppressor, is involved in GBM cell differentiation with inactivation of PTEN promoting an undifferentiated state of GBM46,47. Currently the mechanisms that underlie maintenance of GB M stem-like cells are unclear which prompts further study. Since heterogeneity is a typical feat ure in GBM, future treatment

PAGE 20

20 might require combination of therapies ta rgeting the various signaling pathways and proteins mentioned above. Chemokines and Chemokine Receptors Chemokines (chemotactic cytokines) are small proteins that were initially discovered in association with inflammatory responses and are now known to comprise a large family consisting of more than 40 pr oteins. Chemokines can be classified by the position of their first two cysteine residues (CC, CXC, C and CX3C) in their sequences. Chemokines are attractive molecules to medi ate the migration of responsive cells, such as immune cells, by inducing chemotaxis through G-protein coupled receptors expressed on the cell surface. Therefore, chemokines and their receptors control the homing of immune cells and draw great attention in the context of immune therapy to many diseases, including cancer. Both t he CC and CXC families have many members, while the C family has only two chemoki nes (XCL1, 2) and one receptor (XCR1), and the CX3C family has one chemokine (CX3 CR1) and one receptor (CX3CL1). Members of CXC chemokine family can be further classified according to the presence or absence of a Glu-Leu-Arg (ELR) motif48. This ELR motif is located at the N-terminus adjacent to the first cysteine amino acid residue. ELR+ CXC chemokines have opposite functions to ELRCXC chemokines r egarding angiogenesis49. The ELR+ chemokines promote angiogenesis by regul ating neutrophil migration49-51. On the other hand, ELRchemokines are angiostatic peptides49,52,53. Most chemokines ex ert their function as secreted proteins with the ex ception of CX3CL1 and CXCL1654. Chemokines show redundancy in terms of their binding specificit y, and activation of chemokine receptors results in activation of many downstream si gnaling pathways, such as ERK, PI3/AKT, p38, and JNK. The complexity of chemokine systems and the evidence that chemokines

PAGE 21

21 and their receptors are widely expressed by different types of cancers raise the possibility of targeting them in tumor treatments. Chemokines, Chemokine Receptors, and Cancer In cancers, chemokines have effects on tumor growth, angiogenesis, metastasis, and immune cell trafficking. Most effort s of researchers have been focused on the functions of chemokines and their receptors in tumor metastasis, immune cell trafficking, and angiogenesis. However, more studies suggest that tumor cells utilize chemokines and receptors to provide growth signals or modulate cell status in an autocrine or paracrine manner. Further understanding of the functions of chemokine systems in all aspects of tumor progression could prov ide future therapeutic possibilities. CX3CR1-CX3CL1 The chemokine receptor system CX3CR1 and its ligand CX3CL1 are known to be involved in immune responses that underlie various human diseases and their corresponding animal models. For instance, CX3CR1 is responsible for recruiting dendritic cells and a subset of monocytes in models of atherosclerosis55,56. CX3CR1 deficiency results in impaired microglia mi gration in a mouse model of age-related macular degeneration57. Enhanced neuronal cell loss is also evident in CX3CR1 deficient mice after systemic lipopolysaccharide injection, in toxin-induced Parkinsonism, and the SOD1-G93A transgenic mouse model of motor neuron disease58. A role for CX3CL1/CX3CR1 system in tumorigenesis has also been established. CX3CL1 has been shown to mediate both natural killer cell-dependent and T cell-dependent antitumor activity59-61. CX3CL1 also has angiogenic activity. Several groups have suggested that CX3CL1 increases angiogenes is through endothelial cell activation in the pathogenesis of r heumatoid arthritis62-64. Together, these data suggest that this

PAGE 22

22 chemokine system may be similarly in volved in tumor angiogenesis. Thus CX3CL1/CX3CR1 might be a suitable target in the development of novel therapies to treat cancer. CXCR3 and CXCL9, 10, 11 CXCR3 belongs to the CXC chemokine receptor sub-family and has three endogenous ligands, CXCL9 (MIG), CXCL10 (IP10) and CXCL11 (ITAC). This chemokine system has been reported to be in volved in tumor growth, metastasis, angiogenesis, and immune cell infiltration in to tumors. CXCR3 has been shown to be expressed by tumor cells such as melanoma65, ovarian66 and renal carcinoma67, breast cancer cells68-70, B-cell leukemia71, prostate72, colorectal73, and brain tumor cell lines74. In addition, the level of CXCR3 expression has been reported to correlate with poor prognosis of breast cancer patients75 and with tumor thickness in melanoma76. CXCR3 activation enhances tumor cell proliferation of myeloma77 and osteosarcoma78, and CXCR3 inhibition induces caspase-independent cell death78. Collectively, the data suggest that CXCR3 is involved in tumor growth in a variety of cancers. With respect to immune cell recruitment, CX CR3 is expressed by activated T cells, natural killer (NK), NKT cells and, within the central nervous system, microglia79-81. CXCR3+ lymphocyte recruitment, directed by CXCL10, can promote spontaneous regression of melanoma82, while CXCL11 increases tumo r-infiltrating lymphocytes and inhibits tumor growth in both breast cancer and T cell lymphoma83,84. Therefore, CXCR3-mediated homing of immune cells re presents a potential target for tumor therapy investigation. In addition to imm une cell trafficking, CXCR3 also mediates cancer cell metastasis by stimulating matrix metalloproteinase (MMP) production78. It

PAGE 23

23 has been known to regulate metastatic activity of melanoma75, breast cancer68, osteosarcoma78 and colorectal carcinoma85. As a receptor for ELRchemokine family members, CXCR3 has been demonstrated to block angiogenesis. For instance, CXCL10 is capable of attenuating CXCL8 and FGF-2 induced angiogenesis52. In vivo delivery of CXCL9 or CXCL10 inhibited angiogenesis within the tumor86,87. In humans, different isoforms of CXCR3, including CXCR3A, CXCR3B, CXCR3-alt, have been reported. Endothelial cells were found to express CXCR3B, which mediates the angiostatic response caused by CXCL91188. CXCR3B activation has been reported to induce apoptosis, which might explain the angiostatic effect of CXCR3 activation in endothelial cells. The recent demonstration that CXCL10 is expressed by murine89 and human glioma74 cell lines suggests that this chemokine could play important roles in brain tumor biology. CXCL10 is up-regulated in grade III and grade IV human glioma cells as compared to normal astrocytes74. Additionally, CXCR3 is also elevated in both grade III and grade IV human glioma cells and its activa tion can increase DNA synthesis of these cells in vitro74. The DNA synthesis enhancing effect of CXCL10 on glioma cells is abolished by CXCL10 neutralizing antibody74. While these in vitro results support a role for CXCR3 in malignant glioma, investigations of this receptor in glioma progression in vivo are absent and further study is necessary. CXCR4-CXCR7 CXCR4 and its ligand CXCL12 is one of the common chemokine receptor/chemokine pairs studied in tumor growth and metastasis of many tumors. CXCR4 and/or CXCL12 have been shown to be up-regulated in pancreatic cancer90, colon cancer91, ovarian cancer92, lymphoma93, medulloblastoma and glioma94-97.

PAGE 24

24 CXCL12 is also constitutively expressed in tissues such as liver, lung, lymph nodes, adrenal glands and bone marrow, which ma y explain the important role of CXCL12/CXCR4 in metastasis98. Inhibition of CXCR4/CXCL12 decreases the metastasis of osteosarcoma and melanoma99, as well as the growth of medulloblastoma and glioma96. In the context of glio ma, CXCR4 is elevated in GBM and grade III glioma compared with grade II glioma100. Inhibition of CXCR4-mediated pathway can inhibit human glioma growth, invasion, and pro-MMP2 activation101,102. Although CXCL12 belongs to the ELRfamily, several studies have shown that CXCL12 induces the migration, proliferation, capillary t ube formation as well as VEGF production in endothelial cells103-105. Furthermore, inhibition of CXCL12 and CXCR4 reduces tumor growth by blocking angiogenesis106. Recently, CXCL12 has been reported to be a ligand of another receptor, which is termed CXCR7107. CXCR7 also binds CXCL11107, which complicates deciphering the role of CXCR7 in tumor progression. CXCR7 is expressed by a variety of cancers, including breast cancer108,109, lung cancer109, and glioma110,111. Breast cancer lines stably overexpressing CXCR7 form larger tumors while other lines with CXCR7 silencing show decreased tumor volumes109. In lung cancer, CXCR7 not only promotes tumor growth but also enhances tumor metastasis109. Several publications suggest that CXCR7 contributes to tumor progression in directly via regulat ion of CXCR4-dependent activities. It has been demonstrated that CXCR7 regulates acute CXCR4 activation by depleting extracellular CXCL12 via CXCR7 internalization108,112. On the other hand, it has been shown that CXCR7 is a functional receptor and induces cell adhesion of malignant hematopoietic cells through ERK 1/2 and AKT pathway activation113. Another

PAGE 25

25 study of CXCR7 in glioma also suggests that CXCR7 is functional and exhibits antiapoptotic activity and thus promotes glioma tumor growth111. Therefore, the CXCL12CXCR4-CXCR7 axis in cancers could be mo re complicated and the direct and indirect activities of CXCR7 may play crit ical roles in tumor progression. Other Chemokines Other chemokines, such as CXCL1 and CX CL8, are increased in a variety of cancers114,115, and have been suggested to promote tumor growth by stimulating angiogenesis114,116. CXCL8 is one of the most t horoughly studied chemokines in the field of angiogenesis117,118. CXCL8 can induce proliferation and chemotaxis of human umbilical vein endothelial cells (HUVEC)117. In addition, CXCL8 can directly promote survival, proliferation, and capillary tube forma tion, and these effects can be inhibited by an anti-CXCL8 monoclonal antibody119,120. In addition, in ovarian cancer, levels of CXCL8 are correlated wit h blood vessel formation and poor survival121. Serum levels of CXCL8 are increased in prostate and breas t cancer patients, which suggests an important role of CXCL8 in these diseases122,123. CCR7/CCL21 are critical for a va riety of tumors in terms of metastasis into lymph nodes, including breast cancer124, melanoma125, colorectal cancer126, gastric carcinoma127, and esophageal cell carcinoma128. CCL21 is abundant in the lymph nodes and results in the trafficking of CCR7-expressing tumor cells toward the lymph nodes. Chemokines and receptors also play important roles in tumor-associated immunosuppression through the recruitment of immunosuppressive cells. In gastric cancer, the levels of chemokines CCL17 and CCL22 are correlated with the frequency of Foxp3+ Treg cells, a type of immunosuppressive cells, in the tumor129. CCL17 and CCL22 are able to induce the migration of Foxp3+ Treg cells in a concentration-

PAGE 26

26 dependent manner in vitro129. CCL22 and CCL2 are also expressed by human glioma cell lines and Treg cells from GBM patients have a more elevated level of CCR4 (CCL2 receptor) than Treg cells from control tissues130. Others have show n that both human and mouse pancreatic cancers express higher levels of CCR5 ligand CCL5, and Treg cells in the tumor microenvironment show CCR5 expression131. Disruption of the CCL5CCR5 axis by systemic administration of a CCR5 antagonist slows tumor growth via a Treg cell-mediated mechanism131. Gliomasphere Model In the field of cancer research, in vitro culture of tumor cell lines is an essential and important tool to investigate mechanisms related to tumorigenesis and progression. For decades, researchers have been using tumor cell lines cultured as a monolayer and supplemented with bovine serum. However, recent studies have raised doubts about cells cultured under these traditi onal conditions and indicate that they are not the best model system to understand mec hanisms of tumor formation in vivo Howard Fine and colleagues have proposed that GBM stem cells from the gliomasphere culture model have a considerable advantage over traditional serum-cultured models132. They compared primary human GBM cells cultur ed in stem cell-enr iched gliomasphere conditions (serum free medium supplemented with B27, human recombinant EGF, and bEGF) with GBM cells grown in the presenc e of DMEM supplemen ted with 10% fetal bovine serum. In their study they reported that gliomasphere culture conditions successfully maintained the tumorigenic potential of GBM cells while serum supplemented GBM cells lost this potential132. Moreover, primary GBM gliomaspheres kept their parental phenotypes and genot ypes when compared with serum-cultured GBM cells and glioma cell lines132. This concept was further investigated in a more

PAGE 27

27 recent study that examined the effect of long-term gliomasphere culture of 7 GBM cell lines from biopsies of glioblastoma patients133. It was found that long-term (10 passages) gliomasphere culture had only a modest affect on overall expression patterns of these cells, and each cell line maintained the indi vidual characteristics of their parental biopsies133. Therefore, each cell line could serve as a personalized model of the glioblastoma it was derived from, even after multiple passages. These findings indicate that the gliomasphere model has a greater genetic stability than the serum supplemented culture model. T hus, the gliomasphere model is useful in studying the biology of the primary GBMs and may lead to more clinically relevant results than serum supplemented cell culture m odels. However, it has been reported that relapsed glioblastomas have different genetic signat ures from the paired primary tumors19,134. Thus, even the gliomasphere culture of primary GBM may not reflect the genetic alteration(s) in the paired recurrent GBM because of the genetic stability of gliomasphere in vitro model. Therefore, estab lishing relapsed GBM-derived gliomaspheres and comparing them wit h the paired primary GBM-derived gliomaspheres may help elucidate the me chanisms that underlie GBM recurrence. Murine Glioma 261 (GL261) Model The GL261 mouse model of malignant glio ma is one of the most frequently used brain tumor animal models. GL261 tumors were orginally generated from an intracranial injection of 3-methylcholantrene into C57BL/6 mice135. The GL261 model shows similar features to human GBM. They are hyperva scular and highly proliferative and there is necrosis accompanied with VEGF and hypoxia-i nducible factor 1 (HIF1) induction. CD133+ cancer stem cells have also been found in the GL261 cell line33, similar to human GBM stem-like cells. In addition, the GL261 model shows a s ubstantial presence

PAGE 28

28 of immune cells, including microglia and lym phocyte subsets, that is similar to human GBM89. Although several studies have used the GL261 model for studying gliomagenesis and identifying potential therapeutic target s, there are few published studies reporting the roles of chemokine an d chemokine receptors in the GL261 mouse model of malignant glioma. For this reason, we have established this animal model to investigate the role of chemokines and re ceptors in glioblastoma tumorigenesis and progression. Significance and Specific Aims Chemokines and chemokine receptors play im portant roles in almost all step of tumorigenesis and tumor progression. As reviewed, chemokines can enhance tumor cell proliferation, prevent apoptotic activity, promote metastasis, and induce angiogenesis. In addition, the re cruitment of immunosuppressive cells into the tumor is also mediated by chemokines. In contrast chemokines also m ediate physiological activities that block tumor gr owth, such as the infiltration of inflammatory and antitumor immune cells into the tumor as well as exert angiostatic effects. Thus, investigating the functions of chemokines and receptors in cancer is beneficial for developing novel therapeutic methods for cancer treatment. Although chemokines have been widely studied in metastatic cancers like breast cancer and colorect al cancer, their importance in GBM biology is still unclear. The fact t hat a single chemokine receptor can pair up with multiple ligands and one chemokine can bind to more than one receptor increases the complexity of chemokine system in GB M and prompts further investigations. The focus of this dissertation is to provide a more thorough understanding of the functions of chemokines and chemokine receptors in GBM biology and reveal potential therapeutic targets for future treat ments of GBM patients.

PAGE 29

29 The specific aims in this study included: 1. Determine the expression of chemokines and chemokine receptors in murine and human GBM cells in vitro and in vivo The first question we addressed re lated to identifying chemokine and chemokine receptor expression in GBM in order to look for potential drugs. In this study, we utilized the murine GL261 glioma cell line and measured its expression pattern of chemokines and re ceptors. GL261 implantation and in situ hybridization allowed us to determine the expression profile in vivo To translate the results from GL261 cells in to human, the data were compared with several well-established human GBM cell lines as well as GBM patient-derived primary cell lines. In addition, in vitro gliomasphere and serum-cultured models were compared side by side regardi ng the expression of chemokine and chemokine receptors. 2. Evaluate the effect of host chemokine receptor deficiency on gliomabearing animal survival. One phenotype influenced by tumor growth is the host survival rate. Through GL261 cell implantatio n, we analyzed the impact of host chemokine receptor disruption on animals with intracranial tumors. Kaplan-Meyer survival analysis reflected tumor growth in wild type and chemokine receptor gene deficient mice while H&E staining of tumor sections provided information on tumor sizes. 3. Address the influence of chemokine receptor dysfunction on GBMinfiltrated microglia and lymphocytes.

PAGE 30

30 Certain chemokine receptors are expr essed and mediate the migration of microglia and lymphocytes into tumo rs. The chemokine expression profile determined in aim 1 provided us candidate chemokine receptors to study the recruitment of tumor-infiltrating imm une cells. Using multiple chemokine receptor deficient mice, we examined t he number of microglia and lymphocytes within GBM tumors from wild type and c hemokine receptor-disrupted animals. 4. Examine the growth effect of ch emokine stimulation on murine and human GBM cells. Chemokines are known to evoke prolif erative and survival signaling pathways via activation of phospho-ERK and phosph o-AKT pathway in a variety of cancers. In this study we determined the in vitro cell growth rates of murine and human GBM cells using the gliomaspher e model with and without chemokine stimulation. Total cell numbers we re counted to quantify cell growth. 5. Study the effect of chemokine receptor antagonism on tumor growth in vitro and in vivo Our final goal evaluated inhibiting chem okine receptors pharmacologically in order to test the possibility of us ing chemokine rec eptor antagonists as chemotherapy drugs. Murine and human GBM cells were co-incubated with chemokines and paired receptor inhibito rs to determine the tumor cell growth rates in vitro In addition, glioma-bearing anim als were treated with a specific chemokine receptor antagonist and Kaplan-Meyer survival analysis was performed to address this aim.

PAGE 31

31 CHAPTER 2 MATERIALS AND METHODS Animals Wild type (WT) C57BL/6 mice were obt ained from either Charles River Laboratories or Jackson Laboratories. CX3CR1-deficient ( / ) mice, backcrossed to the C57BL/6 background for greater than 10 generations, were obtained from JAX Laboratories. The generation of these mice has been previously described136. The protein coding sequence of the CX3CR1 gene was exchanged with GFP in heterozygous (one allele replaced) and homozygous (both alleles replaced) mice. In these mice, all cells normally expressing CX 3CR1 express GFP. Colonies of CX3CR1 / and +/ mice were maintained at the University of Florida. All mice used in studies presented herein were derived from breeding CX3CR1+/ and / mice; hence all comparisons were made between littermates. CXCR3-/mice, backcrossed 16 generations to the C57BL/6 background were generated as described previously137. All procedures involving mice were carried out in accordance with t he guidelines of the University of Florida Institutional Animal Care and Use Committee (IACUC). Cell Culture The GL261 glioma cell line was mainta ined in RPMI-1640 medium supplemented with 10 % heatinactivated FBS, 1 % penicil linstreptomycin, 4 mM L-glutamine. The A172 and U118 glioma cell lines were maintained in Dulbeccos modified Eagles medium (DMEM) supplemented with 10 % heat-inactivated fetal bovine serum (FBS), 1 % penicillinstreptomycin, 2 mM L-glutamine. The T98 G, U118 and U138 glioma cell lines were maintained in Eagles minimum essential medium supplemented with 10 % heat-inactivated FBS, 1 % penicillin streptom ycin, 1 % sodium pyruvate and 2 mM L-

PAGE 32

32 glutamine. All gliomaspheres (GS) were cultured in DMEM/F12 medium supplemented with 2 % B27, 20 ng/ml of epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF), 5 g/ml of heparin and 1 % penicillinstreptomycin. All the cells were grown in a humidified incubator at 37 C with 5 % CO2. DMEM, Eagles minimum essential medium, RPMI-1640, DMEM/F12 medium, B27, EGF, bFGF, L-glutamine and antibiotics were obtained from Gibco-BRL (Invitrogen). S odium pyruvate and heparin were purchased from SigmaA ldrich. FBS was from HyClone (Thermo Scientific). Reverse Transcription Polymer ase Chain Reaction (RT-PCR) Total RNA was isolated from glioma cells with the TRIzol reagent (Invitrogen) according to the manufacturers instru ctions. Genomic DNA contamination was removed by RQ1 RNase-free DNase treat ment (Promega). Total RNA was then quantified and stored at -80C. RNA (1 g) was retrotranscribed with iScript complementary DNA (cDNA) synthesis kit (Bio Rad). Synthesized cDNA was subjected to polymerase chain reaction analysis. Polyme rase chain reaction (PCR) was performed by heating for 96 C for 2 min, followed by amplification for 35 cycles: 96 C for 30s, 56 C for 1 min and 72 C for 1 min. Touchdow n PCR was utilized in some cases. For touchdown PCR, the annealing te mperature started at 65 C and was decreased by 1 C every cycle for 15 cycles and reached 50 C 50 C was then used for the remaining number of cycles. The paramet ers of denaturing and elongating temperatures were the same as regular PCR protocol. The followi ng primers were used: murine CXCL9: 5'CTCGGATCCGCCATGAAGTCCGCTGTTCTTTTC-3'(forward), and 5'TATGAATTCAAATTAACACTTTATGTTTTGTAG-3 '(reverse); murine CXCL10: 5'CCGGAATTCTCCCCATCAGCA CCATGAACCC-3'(forward), and 5'CTGCTCGAGGAGTAGCAGCTG ATGTGACC-3'(reverse); murine CXCL11: 5'-

PAGE 33

33 GCAGAATTCTGCAGCGGCTGCTGAGATGAACAG-3'(forward), and 5'GGACCTTCTAGAAAGTTCTGCAGC-3'(re verse); murine CXCR3: 5'GAGGTTAGTGAACGTCAAGTG-3'(forward), and 5'-GGGGTCCCTGCGGTAGATCTG3'(reverse); murine GAPDH: 5'-AAA TGGTGAAGGTCGGTGTG-3'(forward) and 5'TCTCCATGGTGGTGAAGACA-3'(re verse); human CXCL9: 5'TGCTGGTTCTGATTGGAGTG-3'(forward ) and 5'-CTGTTGTGAGTGGGATGTGG3'(reverse); human CXCL10: 5'-AACCTCCAG TCTCAGCACCA-3'(forward), and 5'TTTGAAGCAGGGTCAGAACA-3'(reve rse); human CXCL11: 5'CCTGGGGTAAAAGCAGTGAA-3'(forward), and 5'-TGGGGAAAGAAGTGTGTATTTG3'(reverse); human CXCR3-A and -B: 5'-ACCCAGCAGCCAGAGCAC-3'(forward), and 5'-GTTCAGGTAGCGGTCAAAGC-3'(re verse); human GAPDH: 5'CGAGATCCCTCCAAAATCAA-3'(forward), and 5'-TGCTGTAGCCAAATTCGTTG3'(reverse).Predicted PCR product sizes are listed in Table 2-1. Intracranial Injection of GL261 Glioma Cells GL261 glioma cells (25 cells in CX3CR1+/and -/mice; 1.65 cells in wild type and CXCR3-/mice) in a total volume not exceeding 3 L were injected 3 mm deep into the right cerebral hemisphere (1 mm posterior and 2 mm lateral from Bregma) of wild type C57/B6, CX3CR1+/ and /, and CXCR3-/mice. To determine tumor growth, glioma-bearing mice (3 weeks after GL261 cell injection) were euthanized using sodium pentobarbital (32 mg/kg) and subsequently pe rfused with 0.9 % saline followed by buffered 4 % paraformaldehyde (PFA). Brains were surgically removed and post-fixed with 4 % PFA. After fixation, tissues were incubated in 30 % sucrose solution at 4 C overnight followed by liquid ni trogen freezing. Frozen brains were then sectioned, thaw

PAGE 34

34 mounted on Superfrost/Plus slides (Fischer Scientific), and subjected to either hematoxilin and eosin (H&E) staining, in situ hybridization, or immunohistochemistry. NBI-74330 Treatment NBI-74330 was synthesized according to Medina et al. (Patent WO02083143, USA, 24 October 2002) and t he dosing protocol was performed as described previously138. Briefly, animals received 100 mg/k g/day of NBI-74330 in 1 % sodium docusate in 0.5 % 400Cp methylcellulose, injected subcutaneously, beginning from day 3 after surgery, for 12 days. A control group of mice were treated with vehicle only. KaplanMeier Survival Analysis For KaplanMeier survival analysis, per centages of surviving mice in each group of animals were recorded daily after G L261 glioma implantati on. The endpoint was defined by a lack of physical activity and a body weight reduction of greater than 15 %. The data were subjected to Log-rank analysis in order to determine if significant differences existed in survival between the experimental groups. In Situ Hybridization (ISH) In situ hybridization probes were generat ed by PCR using cDNA synthesized from total RNA extracted from GL261 glioma cell s. DNA fragments were cloned into pGEM-7 (Promega). To generate the antisense and s ense (c)RNA hybridization probes, plasmids were linearized and then subjected to in vitro transcription using either T7 or SP6 RNA polymerase in the presence of [ 33P]UTP. Brain sections were hybridized separately with antisense and sense probes. In all cases, no signals were detected in sections probed with sense riboprobes. After IS H, sections were apposed to film and subsequently dipped in LM-1 emulsion and stored at 4 C. Slides were developed (after exposure for 1 weeks), fi xed, and counterstained wit h hematoxylin and eosin.

PAGE 35

35 Immunohistochemistry For immunohistochemistry, brain sections were permeabilized with 0.5 % of Triton X-100 in phosphate-buffered saline (PBS) for 15 min at room temperature followed by blocking with 10 % goat serum in PBS fo r 30 min. In some cases (anti-Foxp3 immunohistochemistry), sections underwent an antigen retrieval treatment. In brief, slides were first permeabilized with 0. 5 % Triton X-100 followed by heating slides (immersed in a boiling water bath for 25 min) in a buffe r containing 10 mM Sodium Citrate, 0.05 % Tween 20, pH 6.0. Slides we re then cooled to room temperature for 20 min, washed with PBS three times, and finally subjected to standard immunohistochemistry procedures. The sections were incubated in primary antibodies at 4 C overnight. The following antibodies were used: rat anti-CD4 (dilution 1:50, BD Pharmingen), rat anti-CD8 (d ilution 1:50, Serotec), rat anti-Foxp3 (dilution 1:50, eBioscience), and rat anti-Ly49G2 (dilution 1:50, BD Pharmingen). The following day, sections were washed three times with PB S and incubated subsequently in goat anti-rat Alexa 594 (dilution 1:1000, Invitrogen) The sections were then washed three times with PBS and finally counterstained with 4,6-diamidino-2-phenylindole (DAPI, Sigma Aldrich). For quantification of CD4+, CD8+, CD11b+, Foxp3+ and Ly49G2+ cells, the number of cells per high-powered field in several sections from multiple animals were determined and the mean and standard error of the means calculated. The data were subjected to statistical analysis. CXCL10 Enzyme-Linked Immunosorbent Assay To quantitate CXCL10 protein secreted by GL261 cells, 105 cells were plated in a 12-well plate and grown for 24 h. Cells were then washed with PBS twice and incubated with 500 L serum-free medium. Cond itioned medium was co llected at 24 and 48 h and

PAGE 36

36 the CXCL10 concentration was measured by Mouse CXCL10/IP-10/CRG-2 Quantikine ELISA Kit (R&D Systems) according to the manufacturers protocol. CXCL10 concentration was normalized to the number of cells in the well and expressed as nanograms per milliliter per 106 cells. FACS Analysis Adherent (AD) glioma cells and GS we re harvested with 0.01 % ethylenediaminetetraacetic acid (EDTA) in PBS, pH 7. 4, washed with ice cold 0.5 % to 1 % bovine serum albumin (BSA) in PBS and subsequently blocked with 5 g/mL of mouse and rat IgG mixture for 15 min at room temperatur e. Cells were then incubated with specific antibody for 30 min on ice. Mouse anti-human CXCR3-PE (dilution 1:12, BD Biosciences), rat anti-mouse CXCR3-APC (dilution 1:12, R&D Sy stems), mouse antihuman Nestin-APC (dilution 1:40, R&D System s), mouse anti-Nestin-Alexa 647 (dilution 1:12, BD Biosciences), mouse anti-human/m ouse SOX2 (dilution 1:12, R&D Systems) were used. Samples were then washed and analyzed with BD LSR II system (BD Biosciences). Dead cells were excluded by 7AAD (eBioscience) or DAPI staining. All data were analyzed by FlowJo software version 7.6 (Tree Star). In Vitro Growth Analysis GS cells were plated in 12-well plates at different density and treated with either CXCL9 (1 nM or 10 nM), CXCL10 (1 nM or 10 nM) or the combination of EGF and bFGF (each at 20 ng/mL). Cells cultured in medium without growth factor supplements served as the control. Cell numbers were det ermined at days 3, 6 and 9. To investigate the effect of CXCR3 inhibition, ce lls cultured as described above with 1 M of NBI74330 were compared with samples without NBI-74330. Cell numbers were determined on day 6 or 9. All experiments were perfo rmed in triplicate and ar e representative of

PAGE 37

37 three independent experiments. Recombi nant mouse and human CXCL9 and CXCL10 were purchased from R&D Systems. For the in vitro growth of CXCL11 and CXCL12, primary human GBM cells were plated in 96-well plates at 2000 cells/wee and treated with eit her CXCL11 (10 nM), CXCL10 (10 nM) or without any chemokines as the control. All conditions contained 2 ng/ml EGF. Cell numbers were determined at day 10. Recombinant mouse and human CXCL11 and CXCL12 were pur chased from R&D Systems. Migration Assay Human primary GBM cell were trypsinized, counted, and 2000 cells were transferred to uncoated 8m cell culture inserts (BD Bioscience) in medium containing 2ng/ml of EGF and the assembly placed into 24-well plates cont aining 2ng/ml of EGF and 10nM of CXCL11 or CXCL12. After 48 h, non-migrating cells were removed from the top of the filter with a cotton swab, and migrating cells on the bottom of the filter were fixed with 4 % paraformal dehyde, stained with DAPI, and counted. Primary Sphere Formation Assay Primary sphere formation assays were performed to quantify stem-like cell frequency within primary GBM cells. Cells were plated in 96-well plates at a density of 2000 cells per well per 200 l medium containing either CXCL11 (10 nM) or CXCL10 (10 nM). Cells cultured in medium without chemokines served as the control. All conditions were supplemented with 2ng/ml EG F. Number of spheres formed at day 10 were counted. Statistical Analysis All statistical analyses were calculated using either Microso ft Excel or GraphPad Prism 5 software (GraphPad Software, La Jolla, CA). All data are presented as mean

PAGE 38

38 standard error of the mean. P-values were calculated using Students t-test with twotailed distribution. Survival data were subjected to log-rank test to determine statistically significant differences between groups. A P va lue <0.05 was considered significant and is indicated with asterisks in figures.

PAGE 39

39 Table 2-1. Predicted P CR product sizes (bp) CXCL9 CXCL10 CXCL11 CXCR3-ACXCR3-BGAPDH Murine 526 467 441 479 N/A 314 Human 651 603 768 484 728 727 N/A: not applicable.

PAGE 40

40 CHAPTER 3 ROLE OF CX3CR1 AND CX3CL1 IN GBM The chemokine receptor system CX3CR1 and its ligand CX3CL1 are known to be involved in immune responses that underlie various human diseases and their corresponding animal models. Fo r instance, CX3CR1 mediates recruitment of dendritic cells and a subset of monocytes in atherosclerosis55,56. CX3CR1 deficiency results in impaired microglia migration in age-related macular degeneration57. The function of CX3CL1/CX3CR1 system in tumorigenesis has also been examined. CX3CL1 has been shown to regulate natural killer cell-dep endent and T cell-dependent antitumor activity5961. Several groups have suggested that CX3CL1 increased angiogenesis through endothelial cell activation in the pat hogenesis of rheumatoid arthritis62-64, which suggests the potential of this chemokine syst em to be similarly involved in tumor angiogenesis. Thus CX3CL1/CX3CR1 might be a suitable target in the development of novel therapies to treat cancer. The specific functions of CX3CL1/C X3CR1 in gliomagenesis have not been established. In this study, we sought to determine the role of CX3CR1 in glioma formation and the associated recruitment of microglia and lymphocytes, using the GL261 murine model of glioma135,139. CX3CL1 and CX3CR1 expression were determined in GL261 tumors established in its syngeneic host, the C57BL/6 mouse. The role of this chemokine system was then c haracterized in CX3CR1 deficient C57BL/6 mice. The results indicate that CX3CR1 has little to no effect on glioma growth. Moreover the migration of microglia and CD4+, CD8+, Foxp3+, and Ly49G2+ lymphocytes into the tumor tissue was not impacted by the lack of CX3CR1.

PAGE 41

41 Results CX3CL1 and CX3CR1 Expression in GL261 Tumors CX3CR1 and CX3CL1 expression in GL261 glioma in vivo was established using the technique of in situ hybridization analys is. The results indicated that both CX3CR1 and CX3CL1 were expressed in GL261 gliomas analyzed from wild type C57BL/6 mice. Strong hybridization signals for CX3CR1 were evident throughout the tumor mass ( Figure 3-1, panels AC) and i ndicated that l evels of CX3CR1 mRNA are elevated within the tumor as compared to the surroundi ng normal brain tissue. Higher resolution analysis showed that these tumor infiltrat ed CX3CR1-expressing cells were relatively abundant ( Figure 3-1, panel E) and si milar in number to CD11b+ cells (Figure 3-1, panel G). These correlative results suggested that tu mor infiltrating microglia were the primary source of CX3CR1. In contrast, C X3CL1 hybridization signals were less prevalent. When present, CX3CL1-expressing cells were found near the perimeter of the tumor mass ( Figure 3-2). These CX3CL1-expressing ce lls were therefore hypothesized to be important for directing CX3CR1-expressing mi croglia into the tu mor from the brain parenchyma. Tumor Gr owth and Animal Survival Were Not Affected by CX3CR1 Deficiency The effects of CX3CR1-deficiency on GL261 glioma formation in vivo was then determined by characterizing tumor growth and animal survival in CX3CR1 deficient C57BL/6 mice. Tumor sections from GL261 bearing CX3CR1+/ and / mice, obtained 3 weeks after GL261 cell implantation, indicated that tumor size was slightly larger in homozygous ( / ) animals as compared to the heterozygous mice ( Figure 3-3A). This result suggested that GL261 tumor growth rate was slightly faster in CX3CR1 / mice. Consistent with the histological examination, KaplanMeier analysis of tumor bearing

PAGE 42

42 mice indicated a slightly shorte r life span of glioma-bearing CX3CR1 / mice than the life span of CX3CR1+/ mice ( Figure 3-3B). The median survival time of CX3CR1 / mice after GL261 cell implantation was 19 days, while that of CX3CR1+/ mice was 20 days (p = 0.0332). These survival times are also similar to what is observed in glioma-bearing wild type C57BL/6 mice (data not shown). CX3CR1 Did Not Mediate Microglia Migration into Glioma Tissue Microglia are the major CX3CR1-e xpressing cells in the brain140,141. To track the tumor infiltrating CX3CR1-expressing microgl ia we visualized GFP-expressing cells using fluorescence microscopy. Figure 3-4 shows abundant CX3CR1-expre ssing cells were found inside the tumors from both CX3CR1+/ and / mice. The CX3CR1 / mice showed similar numbers of microglia within the tumors as compar ed to tumors from heterozygous (+/ ) mice. Moreover, the mi croglia in the normal brain parenchyma from both +/ and / mice exhibited a comparable ramifi ed morphology, while microglia inside the tumors from both groups of mice displa yed similar morphological characteristics consistent with an activa ted phenotype (insets to Figure 3-4, panels AD). In both CX3CR1+/ and / mice, most GFP-expressing ce lls also expressed CD11b (Figure 3-4, panels E and F); no obvious differences in the CD11b expression pattern were observed between the two groups of mi ce. Quantitative anal ysis of both CD11b+ and GFP+ cells in the two animal groups indica ted that numbers of these cells did not significantly differ between CX3CR1+/ and / mice ( Table 3-1). These collective observations suggested that CX3CR1 defic i ency had no substantial effects on the recruitment, morphology, and level of ex pression of CD11b by CX3CR1-expressing microglia.

PAGE 43

43 CX3CR1 Was Not Necessary for Lymphocyte Infiltration into GL261 Gliomas To address the lymphocyte response to the glioma in CX3CR1 deficient mice, immunohistochemical analysis using severa l T lymphocyte markers was performed and the numbers of these cells were quantified in CX3CR1+/ and / mice. Figure 3-5 depicts a series of representative sections subjected to immunohis tochemistry from the two groups of animals, while Table 3-2 summarizes the quantitative analysis of several sections from multiple animals. CD4+, CD8+, Foxp3+, and Ly49G2+ cells were all present within GL261 tumors in both types of mice ( Figure 3-5). CD4+, CD8+, and Ly49G2+ cells were all GFP negative and indi cated that these tumor infiltrating lymphocyte populations do not express CX 3CR1. The regulatory T cell (Treg) subpopulation of CD4+ T cells, identified by staini ng sections with the anti-Foxp3 antibody, comprised about half of the numbers of CD4+ cells. These data are consistent with two previous reports on the pres ence of the Treg population in the GL261 model142,143. While there were no significant differ ences in the numbers of the specific tumor infiltrated CD4+, CD8+, Foxp3+, and Ly49G2+ cells between CX3CR1+/ and / glioma-bearing mice (Table 3-2), quantitative analysis of each of these cells indicated that tumors from CX3CR1 / mice exhibited a tendency toward fewer CD4+, CD8+, Foxp3+, and Ly49G2+ cells inside the tumors compar ed with numbers found in tumors from +/ mice. Nonetheless, CX3CR1 does not appear to be necessary for the recruitment of these lymphocyt e subsets into GL261 gliomas. Discussion In this study we have shown that CX3CR1 deficiency resulted in a slightly shorter life span of tumor bearing mice with no signifi cant differences in numbers of tumor infiltrated microglia and lymphocytes. These results favor a lack of effects of CX3CR1

PAGE 44

44 signaling on antiglioma activity as well as in the intratumoral recruitment of microglia and lymphocytes. Previous studies done in CX3CR1 deficient mice have pointed out that CX3CL1 and CX3CR1 are important for migration of macrophages, microglia and lymphocytes in vivo For example, CX3CR1-defici ent mice show an aberrant accumulation of microglia at subretinal areas that might cont ribute to age-related macular degeneration57,144. In addition, a reduction in the lesion size and accumulation of immune cells during atheroscl erosis were found in CX3CR1 / mice. Moreover, CX3CR1 deficient animals showed impaired re cruitment of NK cells in both EAE and in tumorigenesis60,145. Thus, it was somewhat surprisi ng to find that CX3CR1 deficiency did not impact glioma infiltration of CX3CR1-expressing microglia in vivo Equally unanticipated was the lack of morphological alte rations in tumor-associated microglia in CX3CR1 / mice given the results of Cardona et al. (2006)58 in which microglia from CX3CR1 deficient animals display a greater extent of activation in various models of neurotoxicity. While Log-rank statistical analysis indicat ed that the two survival curves were significantly different, suggesting that CX3C R1 deficiency may actually favor glioma growth, the difference in median survival time of 1 day indicates that CX3CR1 plays a small role in GL261 tumorigenesis. The four types of lymphocytes we examined here, though not significantly differ ent between the two groups of mice, all showed slightly fewer numbers in / mice than in +/ mice. This raises the possibility that CX3CR1 deficiency might have a global impact on the host's immune system and its ability to suppress glioma growth.

PAGE 45

45 One reasonable explanation for our results is that the function of CX3CR1 is masked by a highly immunosuppressive environment created by the GL261 glioma. TGF is one of the major immunosuppressive cytokines produced by tumors and contributes to immune tolerance of malignant cells146. Inhibition of TGF prevented the growth of EL-4 thymoma, B16.F10 melanoma147, and SMA-560 glioma147 in vivo TGF is known to be expressed in human and rodent gliomas148-150 and we have determined that TGF is present in GL261 gliomas in vivo (data not shown). Previous published results from our lab have shown that TGF up-regulates CX3CR1 expression in rat microglia although the signaling efficiency of th is receptor was markedly inhibited after CX3CL1 stimulation151. Therefore, CX3CR1 signaling in tumor infiltrated microglia from wild type or CX3CR1+/ mice might be blocked by the high levels of TGF present within the GL261 tumors. If CX3CR1 function is inhibited under these conditions, a lack of a microglial cell phenotype in CX3CR1 defici ent GL261 tumor bearing mice might be expected. Studies have shown that microgl ia under an immunosuppressive environment can still mediate phagocytosis and non-MHC restri cted cytotoxicity but lack the ability to secrete IL-1 IL-6, and TNF152,153. Given that CX3CR1 can regulate pro-inflammatory cytokine secretion as indicated by previous studies58, 154, the relationship between CX3CR1 signaling blockade and cytokine secretion by glioma infiltrating microglia should be further studied. It is possible that microglia from CX3CR1 deficient animals secrete higher levels of factors that might facilitate gl ioma growth and invasiveness more directly, e.g. tumor growth factors and extracellular proteases.

PAGE 46

46 Table 3-1. Numbers of tumor infiltrated GFP+ and CD11b+ cells GFP+ CD11b+ CX3CR1+/544 79 (6) 384 28 (6) CX3CR1-/561 54 (6) 396 62 (6) p value 0.42 0.5 Note: Shown are mean ( S.E.M.) numbers of tumor-infiltrated cells expressing either GFP or CD11b. Animal numbers for each group are indicated in the brackets. Table 3-2. Numbers of tumor-infiltrated lymphocytes CD4 CD8 Foxp3 Ly49G2 CX3CR1+/112 13 (13) 72.2 11.6 (11)58. 4 5.5 (12) 26.5 4.6 (10) CX3CR1-/102 14 (11) 53.9 8.8 (11) 48. 3 6.5 (12) 23.8 4.9 (12) p value 0.618 0.214 0.319 0.692 Note: Shown are mean ( S.E.M.) numbers of tumor-infiltrated lymphocytes. Animal numbers for each group are indicated in the brackets.

PAGE 47

47 Figure 3-1. CX3CR1 was expressed in GL261 tumors. AF) In situ hybridization (ISH) analysis of GL261 tumors using antisense (AC, E) and sense (D, F) CX3CR1 riboprobes. Panels AC are representative autor adiographs from three different tumor bearing mice, implanted with either 200,000 (A) or 100,000 (B,C) GL261 cells. Panels E and F depict representative fields from developed emulsion dipped slides. Arrows in panel E identify some of the specific hybridization signals. Normal ( n ) and tumor ( t ) tissues are indicated in the sense riboprobed sect ion (panel F). G) A representative tumor section stained with anti-CD11b.

PAGE 48

48 Figure 3-2. CX3CL1 was expressed in GL261 tumors. ISH analysis of GL261 tumors using anti-sense (A) and sense (B) CX3CL1/FKN riboprobes. Arrows show hybridization signals. Normal ( n ) and tumor ( t ) tissues are depicted in each figure panel.

PAGE 49

49 Figure 3-3. Tumorigenesis in CX3CR1+/ and / mice. A) Represent ative H&E stained sections from GL261 tumor bearing CX3CR1+/ and / animals. Two representative sections from at least eight different animals in each group are shown. B) KaplanMeier surviv al analysis of GL261 tumor bearing CX3CR1+/ and / animals. The median survival of the tumor bearing +/ ( N = 11) and / (N = 13) mice were 20 and 19 days, respectively. Log-rank analysis determined that the two curves were different ( p = 0.0332).

PAGE 50

50 Figure 3-4. Infiltration of CX3CR1+/Cd11b+ cells into GL261 gliomas. GFP-expressing cells at the perimeter of the tumor in +/ (A) and / (B) mice. Panels C and D show GFP-expressing cells inside the tumor in +/ and / mice, respectively. Insets of panels AD s how higher magnifications of GFPexpressing microglia in normal brai n parenchyma adjacent to the tumor (panels A and B) and GFP-expressing cells within the tumors (panels C and D). Sections depicted in panels A D were counterst ained with DAPI and the final pictures are a result of the merged images. Panels E and F depict CD11b expression by intratum oral GFP-expressing cells in +/ (E) and / (F) mice.

PAGE 51

51 Figure 3-5. CD4+, CD8+, Foxp3+, and Ly49G2+ cells were present in GL261 tumors from CX3CR1+/ and / mice. Representative fluorescence micrographs depicting tumor infiltration of lymphocytes from +/ (A, C, E, G) and / (B,D, F, H) mice. A, B) CD4+ cells; C, D) CD8+ cells; E, F) Foxp3+ cells; G, H) Ly49G2+ cells. Lymphocyte markers are defined by red fluorescence. Sections were counterstained with DAPI.

PAGE 52

52 CHAPTER 4 ROLE OF CXCR3 AND ITS LIGANDS IN GBM Recently, CXCR3 and CXCL10 have been r eported to be up-regul ated in grade III and grade IV human glioma cells as compared to normal astrocytes. The activation of CXCR3 can increase DNA synthesis of these cells in vitro While these in vitro results support a role for CXCR3 in malignant glioma, investigations of this receptor in GBM progression in vivo are absent and further study is necessary. In this study, we investigated the role of CXCR3 in glioma progression using the GL261 murine model of malignant glioma135,139,155. CXCL9 and CXCL10 expression were determined in GL261 cells and GL261 tu mors established in syngeneic C57BL/6 mice. CXCR3-deficient mice and a CXCR 3 antagonist, NBI-74330, were utilized to address the role of this receptor in glio ma progression. NBI-74330 is a small molecule selective CXCR3 antagonist156,157 and has been shown to attenuate atherosclerotic plaque formation by blocking the migration of CD4+ T cells and macrophages, as well as enhancing the immune suppressi on controlled by Foxp3+ Treg cells138. We found that CXCR3 deficiency in the host and CXCR 3 antagonism with NBI-74330 had different effects on GL261 glioma progr ession. However, NBI-74 330 exerted an anti-tumor progression effect not dependent on host expr ession of CXCR3, supporting a role for this receptor directly on glioma cells. T he glioma expression of CXCR3 was confirmed thru in vitro studies of the murine GL261 cells and then extended by characterization of several human glioma cells. Functional charac terization of tumor-e xpressed revealed a role for CXCR3 in promoting glioma prolifer ation. Taken together, our results indicate that CXCR3 is involved in glioma progre ssion and is a potential therapeutic target for glioma.

PAGE 53

53 Results Murine Glioma GL261 Cells Expressed CXCL10 In Vitro and GL261 Tumors Expressed CXCL9 and CXCL10 In Vivo Murine GL261 glioma cells are known to express CXCL10 as previously established using microarray analysis74 Thus, we utilized the GL261 murine model of malignant glioma to address the role of CXCR3 in glioma progression in vitro and in vivo By using RT-PCR, we determined that CX CL10 mRNA was expressed by cultured GL261 cells (Figure 4-1A); CXCL9 mRNA was undetectable. Since the in vivo expression of CXCR3 system has not been reported, we implanted GL261 cells into wild type C57BL/6 mice, and the expres sion of CXCL9 and CXCL10 mRNAs were detected by in situ hybridization analysis (F igure 4-1C). These data indicate that CXCL9 and 10 are expressed in GL261 glioma and might be involved in GL261 glioma progression. Reduced Numbers of Tumor-Infiltrated Ly49G2+ NK and NKT Cells in GL261 Gliomas from CXCR3-Deficient Mice Was Associated with Decreased Animal Survival To address the functional significance of host-expressed CXCR3 in glioma progression, we evaluated the effect of CXCR3 deficiency on GL261 tumor growth and tumor-bearing animal survival using CXCR3deficient mice. Kaplan-Meier survival analysis was carried out by comparing animal survival rates of wild type and CXCR3deficient mice implanted with GL261 cells. Th e results demonstrated that tumor-bearing CXCR3 deficient mice succumbed to tumor gr owth more rapidly than wild type mice (Figure 2A, p<0.0001). The median survival time of tumor-bearing CXCR3 deficient mice was significantly decreased to 18 days as compared with wild type mice (23 days).

PAGE 54

54 To access the possibility that the augm ented GL261 tumor growth in the CXCR3deficient mice resulted from malfunction of CXCR3 mediated homing of lymphocytes and/or microglia into the gliomas, we investigated numbers of tumor-infiltrated lymphocytes (CD4+, CD8+, Ly49G2+, Foxp3+ cells) as well as tumor-infiltrated CD11b+ microglia. The numbers of CD4+, CD8+ cells and microglia inside the tumor were not significantly different between wild type and CXCR3-deficient groups (Figure 4-2B). However, the number of Ly49G2+ cells inside the tumors from CXCR3-deficient mice was significantly reduced when compared to cell numbers in tumor sections from the wild type group (KO: 7.7 cells 1.3 cells per high powered field, n=9; WT: 28.9 cells 6.9 cells per high powered field, n=7, p= 0.0041)(Figure 4-2B). While there was a tendency for decreased numbers of Foxp3+ cells in tumors from CXCR3-deficient mice, the difference did not reach statistical signif icance (Figure 4-2B). In situ hybridization analysis determined that CXCL9 and CXCL10 m RNAs were detected in tumors from CXCR3-deficient mice, indicating that CX CR3 deficiency did not affect CXCL9 and CXCL10 expression (Figure 4-2C). CXCR3 Antagonism Suppressed GL261 Tumor Growth and Increased Animal Survival Independent of Host CXCR3 Expression To determine if pharmacological antagonism of CXCR3 mimicked CXCR3 deficiency in promoting GL261 glioma growth we evaluated the effect of a CXCR3 antagonist, NBI-74330, on GL261 glioma progre ssion. Wild type and CXCR3-deficient mice implanted with GL261 cells were treated with either NBI-74330 or vehicle as a control. Kaplan-Meier survival analysis sh owed that this CXCR3 antagonist prolonged survival of glioma-bearing WT animals (Figure 4-3A, p=0.0212) and increased median survival days from 20 days (vehicle) to 24 days (NBI-74330). Moreover, in CXCR3-

PAGE 55

55 deficient animals, CXCR3 ant agonism overcame the effect of CXCR3-deficiency and increased the rate of animal survival (Figure 4-3B, p=0.0028). The median survival time for CXCR3 antagonist treated group was increased to 23 days from a median survival time for vehicle treated group of 17 days. Tumor-i nfiltrated cells in tumors from vehicleand NBI-74330-treated wild type mice were also evaluated, and no significant differences in the numbers of tumor-infiltrated CD4+, CD8+, Foxp3+, Ly49G2+ cells or CD11b+ microglia were found (Figure 4-4A). In addition, expression of CXCL9 and CXCL10 was unaltered by NBI-74330 treatment (Figure 4-4B). CXCR3 and Its Ligands Were Expressed by Murine and Human Glioma Cells The effect of CXCR3 antagonism on tumor-bearing animal survival, which was independent of host CXCR3 expression, lead to the hypothesis that NBI-74330 inhibits glioma growth by exerting its effect on GL261 cells. Thus, we elucidated the expression of CXCR3 in GL261 cells by FACS analysis. A small fraction (8.4 % 0.5 %) of GL261 cells were determined to expr ess CXCR3 (Figure 4-5B). To extend the results in the murine model to human GBM, we examined the expression of CXCR3, and its ligands, in five commonly studied grade IV human glioma cell lines, namely the A172, T98G, U87, U118, and U138 cell lines. With RT-PCR, we determined that two human glioma cell lines, T98G and U87, expressed CXCL10 mRNA (Figure 4-5A). T98G showed the highest level of CXCL10 mRNA expression and U87 had a lower level of CXCL10. CXCL10 was undetectable in the other three human cell lines and all lines lacked both CXCL9 and CXCL11 mRNAs. In addition, CXCR3 was expressed on all of the human glioma cells, as assessed by FACS analysis (Figure 4-5B). The percentage of CXCR3+ cells in the various lines ranged from approximately 3 % to 8 %.

PAGE 56

56 It has been reported that human glioma cell lines, cultured as adherent cells in the presence of fetal calf serum, are phenotypic ally different from their matched primary human tumor-derived tumor stem cells158. In contrast, gliomaspheres (GS), derived from culturing cells under more defined conditions that include bFGF and EGF, have higher resemblance to primary human GBM132 and exhibit a stem cell phenotype characterized by nestin and SOX2 expression (Figure 4-6) Thus, we evaluated the expression of CXCR3, its ligands (CXCL9/10/11) in a pati ent GBM tissue-derived gliomasphere, GBM L0, and compared it with G L261 and other human glioma cell lines cultured as gliomaspheres. CXCL10 was expressed by GL261-GS and three of the human gliomasphere lines, including T98G-, U87-, U118-GS (Figure 4-7A). In addition, CXCL11, while undetectable in cells grown in media cont aining serum, was expressed by GL261-, T98G-, U87-, and U118-GS (Figure 4-7A). CXCR3 expression in the various gliomaspheres was determined by FACS analysi s. All gliomasphere cell lines as well as the GBM L0 expressed CXCR3, albeit at various levels (Figure 4-8). When compared with their matched serum-supplemented ce ll lines, the percentage of CXCR3expressing cells significantly increased in GL261, A172, T98G, U87, U118, and U138 gliomaspheres (Table 4-1). Two CXCR3 isoforms (CXCR3-A and -B) have been identified in human88,159 while only one form of CXCR3, most similar to the human A isoform, exists in the mouse genome. T he presence of CXCR3 isoforms in human gliomaspheres was characterized by RT-PCR. CXCR3-A was expressed by all cell lines examined with A172-, T98G-, U87-GS expressing the hi ghest levels of CXCR3-A (Figure 4-7B). CXCR3-B was detected in T98G-, U118-, and U138-GS cells (Figure 47B).

PAGE 57

57 CXCL9 and CXCL10 Stimulated Growth of Murine and Human Gliomaspheres. Because expression of CXCR3 was enhanced in gliomaspheres as compared to serum-supplemented cell lines and CXCR3 isofo rms were found in some of these cells, we compared the effects of CXCR3 activation on the cell growth of GL261-, U87-, U118-, U138-GS, and GBM L0 cells. Both CX CL9 and CXCL10 stim ulated growth of GL261and U87-GS by day 6 of incubation as compared to control (Figure 4-9); an impact on proliferation was not evident at the earliest time point measured (3 days). The growth effect of these chemokines was su stained thru day 9 (Figure 4-9). Cell numbers of U118and U138-GS continuously dec reased thru day 9, and both CXCL9 and CXCL10 attenuated the cell loss of U138-GS by day 9 while no significant effect was observed in U118-GS cells (Figure 4-9). In GBM L0, CXCL9-treated group had significant higher cell numbers by day 9 w hen compared with control group (Figure 4-9). CXCL10-treated group, showed similar tendency as the CX CL9-treated group, did not reach statistic significance (p=0.11). Adherent T98G cells were able to form spheres when initially seeded into the serum free, defined growth factor conditions but did not survive subsequently in the presence of CXCL9, CXCL10 or EGF/bFGF. A172-GS cells also formed spheres but did not proliferate in the presence of the CXCR3 ligands or EGF/bFGF. Co-incubation of CXCL9 or CX CL10 with NBI-74330 blocked the response to either CXCL9 or CXCL10 stimulation in GL261and U87-GS cells by day 6 and U138-GS cells by day 9 (Figure 4-10). A tren d for NBI-74330 to attenuate the CXCL9 or CXCL10 responses in GBM L0 cells was obser ved (CXCL9: p=0.14; CXCL10: P=0.16). NBI-74330 did not affect cell growth in ei ther the control or growth factor(s)supplemented groups, suggesting that NB I-74330 selectively inhibited CXCR3 activation.

PAGE 58

58 Discussion The role of CXCR3 in a variety of c ancers has gained considerable attention. However, the importance of CXCR3 and its ligands in tumorigenesis of human GBM is still unclear. Previous studies have shown that CXCR3 and CXCL10 are expressed by several human glioma cells lines74, while CXCL10 mRNA is also detected in the murine GL261 glioma cell line89. In human glioma cells, CXCL10 stimulates DNA synthesis and cell proliferation in vitro74. These data suggest an involvement of CXCR3 in glioma formation and progression, although an in vivo relationship of this chemokine system and glioma progression has not yet been estab lished. The results reported here indicate that human and murine glioma cell lines and tu mors express components of the CXCR3 chemokine system. More important, the increased presence of CXCR3+ cells in cultures enriched in glioma-initiating cells and suppression of the in vitro and in vivo growth of glioma by pharmacological antagonism of CX CR3 supports future consideration of this receptor as a target for GBM therapy. To investigate the in vivo function of CXCR3 in glioma progression, we initially established that GL261 cells expressed CXCL10 in vitro and CXCL9 and CXCL10 in vivo. The intra-glioma expression of these ch emokines prompted us to study the role of CXCR3 in glioma progression using two appr oaches, specifically CXCR3-deficeint mice and pharmacological antagonism. Glioma-beari ng CXCR3-deficient mice had lower survival rate and significantly fewer num bers of NK and NKT cells inside the tumor when compared to WT mice. The absence of tu mor-infiltrating NK and NKT cells is the likely reason for the enhanced tumor growth and shorter median survival time in the tumor-bearing CXCR3-deficient animals. T he reduction of NK and NKT cells in CXCR3deficient mice has also been documented in ocular herpes simplex virus type 1

PAGE 59

59 infection160 as well as pulmonary fibrosis161. However, it has been reported that CXCR3deficiency results in an impaired homeosta sis of NK and NKT cells, with unchallenged CXCR3-deficient mice having significantly reduced numbers of NK and NKT cells in lung, liver, and peripheral blood161. Thus, the reduction of NK and NKT cells in GL261 gliomas we observed is likely a result fr om a defect in NK and NKT cell homeostasis, and not from a specific alteration of CXCR3 mediated cell migration into the tumor. Altered migration of Foxp3+ T regulatory (Treg) cells in CXCR3-deficient mice has also been reported. In an experimental autoimmune encephalomyelitis model of multiple sclerosis, Treg cells are decreased in number and dispersed in lesions from CXCR3deficient mice162. These data, coupled with results showing an involvement of CD4+CD25+ regulatory T cells in suppression of anti-glioma immune responses in the GL261 model143,162, suggested a Treg phenotype in the g lioma bearing CXCR3-deficient animals might have been observed. While we found a tendency of Foxp3+ Treg cell reduction in tumors from CXCR3-deficient mice, the difference was not statistically significant. To circumvent the NK/NKT defect in t he CXCR3-deficient mice, a pharmacological approach, using NBI-74330, was undertaken. The selectivity of NBI-74330 for CXCR3 has been determined in previous studies. NBI-74330 inhibits CXCR3-agonist binding and CXCR3-mediated PLC activation but has li ttle or no effect on other chemokine and histamine receptors163. Our results are consistent with the pharmacological properties of this antagonist since NBI-74330 attenuated the re sponses of the gliomashepre cells to both CXCL9 and CXCL10 but had no effect on either control or EGF/bFGF supplemented groups. In contra st to the outcomes from CXCR3-deficient mice, NBI-

PAGE 60

60 74330 enhanced the survival rate of tumor bearing wild type mice with no impact on microglia and lymphocyte(s) infiltration. Tumor bearing CXCR3-deficient mice also displayed prolonged survival with NBI-74330 treatment, a result that suggested a CXCR3 inhibitory effect directly on the tu mor cells. Indeed, we found that GL261 cells express CXCR3 as do several human glioma cells. The lack of effect of CXCR3 antagonism on the numbers of tu mor-infiltrating microglia an d lymphocytes, cells known to express CXCR3, suggests that this receptor system is not the primary means by which these immune cells traffic into glio ma. Given that multip le chemokine systems have been shown to mediate microglia and ly mphocytes infiltration into the brain164-167, the influx of these cells into the glioma is likely mediated by other pro-migratory systems. The applicability of the murine GL261 m odel to human GBM was further validated with analysis of 5 different human GBM cells lines, A172, T98G, U87, U118, and U138. All of the human lines express CXCR3 protei n but showed varying levels of expression of CXCL10. CXCL10 was only detectable in T98G and U87. The variation of CXCL10 expression in human glioma lines had been docu mented that the lack of constitutive NFB activity in A172 results in undetec table CXCL10 expression, even with IFN stimulation168. On the other hand, T98G has been shown to have constitutive NFB activity and IFN treatment enhances CXCL10 expression in these cells. In addition, we analyzed the expression patterns of CXCR3 and its ligands in GL261 and human GBM lines cultured in a serum free, stem cell-enr iched condition. It has been suggested that phenotypes of these cells better recapitulate the cells in the glioma environment than cell lines cultured in the presence of serum132. Interestingly, we found that GL261 gliomaspheres and all of the human gliomaspheres had greater CXCR3+ population

PAGE 61

61 when compared to their matched serum-suppl emented cultures; a patient GBM tissuederived primary gliomasphere, GBM L0, al so contained a CXCR3 population. The positive correlation of CXCR3 expression a nd glioma malignancy has been suggested in human gliomas74, and GL261 gliomaspheres were confirmed to be more malignant than their matched adherent (AD) ce ll lines with serum supplement89. Moreover, the expression of CXCR3 ligands was also enhanced in some of the gliomasphere cell lines. For example, CXCL10 expression was detect ed in U118-GS but not in U118-AD cells. Furthermore, CXCL11 expression was det ected in GL261, T98G, U87, and U118 gliomaspheres as well as t he patient-derived GBM L0 cells, while this chemokine was undetectable in all of the adherent cells. T hus, the CXCR3 system may contribute to glioma malignancy. Insights into the role of CXCR3 in glioma progression came from in vitro studies where we determined that both CXCL9 and CXCL10 were able to enhance GL261 and U87 gliomasphere cell growth. This result is consistent with the DNA synthesis promoting effect found in other adherent human glioma cell lines74. In addition, CXCL9 and CXCL10 decelerated the lost of cells in U138 gliomaspheres by day 9. The growth and/or survival effects of CXCR3 activation on human gliomaspheres are correlated with their expression pattern of CXCR3 mR NA isoforms. Two human CXCR3 isoforms, CXCR3-A and -B, have been identified159,169. Stimulation of CXCR3-A activates ERK and AKT pathway, enhancing cell proliferation159, while CXCR3-B activation exerts proliferation inhibitory and angiostatic effects through p3888. In human myeloma cells, CXCL10 stimulation results in an anti-apoptotic effect on cell lines that have high CXCR3-A expression but not on cell lines with a predominance of CXCR3-B77. Our data,

PAGE 62

62 consistent with previous studies, indicate s that CXCR3 enhances cell growth in cell lines that express only CXCR3-A (U87-GS). In lines expressing both isoforms, the functional responses to CXCR3 agonists are more complex. The ratio of CXCR3-A and B isoforms has been postulated to det ermine the outcome. For example, CXCR3 activation reduces the lost of cells in U 138-GS cells (expresses higher level of CXCR3A than CXCR3-B) but has little or no effect on U118-GS cells (only shows slight difference of expression between CXCR3-A and -B). CXCL9 and CXCL10 stimulation also show tendency of increasing numbers of GBM L0 cells although it is not statistically significant. While GBM L0 also expresses CXCR3-A but not CXCR3-B, its mRNA level of CXCR3-A is relatively lower than other human gliomaspheres, which could potentially result in the difficulty of observing the effect of CXCL9 and CXCL10 on GBM L0 gliomaspheres. In summary, components of the CXCR3 syst em are expressed by glioma cells in vitro and in vivo The increased expression of CXCR3 in the more malignant population of gliomasphere cells, and the CXCR3 antagonist sensitive effects on the in vitro and in vivo growth of glioma, suggest that this chemokine system could be a unique target for human GBM therapy.

PAGE 63

63 Table 4-1. % CXCR3+ population in adherent cells and gliomaspheres GL261 A172 T98G U87 U118 U138 GBM L0 AD 8.4.5 4.7.2 3.3.7 3.8.0 4.0. 5 5.1.8 N/A GS 14.6.7 12.4.4 11.5.77.8 .4 8.7.2 10.0.7 5.6.6 p value 0.07 0.0013 0.02 0.03 0.01 0.04 N/A Note: Results are shown in mean S.E.M. from at least three independent experiments. Adherent cells (AD); Gliomaspheres (GS)

PAGE 64

64 Figure 4-1. CXCL9 and CXCL10 were expr essed in GL261 glioma cells and/or tumors. (A) RTPCR identified CX CL10 mRNA in GL261 cells in vitro GAPDH was used as a control. (B) CXCL10 ELISA showing CXCL10 protein secretion by GL261 cells in vitro at 24 and 48 h (C) CXCL9 and CXCL10 were expressed in intracranial GL261 tumors in vivo as determined by in situ hybridization analysis. Two representat ive sections, depicting expression of each chemokine, are shown.

PAGE 65

65 Figure 4-2. GL261 tumor-bearing CXCR3-deficient mice had decreased survival rates and tumor-infiltrated NK and NKT cells. (A) KaplanMeier survival analysis indicated that CXCR3-deficient mice (n = 10) have shorter life span than WT mice (n = 10, P < 0.0001). Filled squares: CXCR3-deficient mice; filled diamonds: WT mice. (B) Num bers of tumor-infiltrated CD4+, CD8+, Foxp3+, Ly49G2+ and CD11b+ cells were evaluated by immunohistochemistry. Gliomas from CXCR3-deficient mice had a significant reduction of Ly49G2+ (NK and NKT) cells in the tumor as co mpared with WT mice (**P < 0.01). WT: wild-type; KO: CXCR3-deficient mice (C) Intratumoral expression of CXCL9 and CXCL10 mRNA was not al tered by host CXCR3 deficiency. Shown are representative sections fr om WT and CXCR3-deficient gliomabearing mice subjected to in situ hybridization analysis.

PAGE 66

66 Figure 4-3. NBI-74330 suppressed tumor growth in both WT and CXCR3-deficient mice. (A) KaplanMeier survival analysis of glioma-bearing WT mice shows that NBI-74330 prolonged animal surviv al (n = 8), as compared with vehicle-treated mice (n = 8) (P = 0.0212). Filled squares: NBI-74330 treated; filled diamon ds: vehicle treated. (B) Kapl anMeier survival analysis shows that glioma-bearing CXCR3-defic ient mice treated with NBI-74330 (n = 7) had a higher survival rate than vehicle-treated glioma-bearing CXCR3-deficient mice (n = 6, P = 0.0028). Filled squares: NBI-74330 treated; filled diamon ds: vehicle treated.

PAGE 67

67 Figure 4-4. NBI-74330 did not alter number s of tumor-infiltrated cells nor CXCL9 and CXCL10 expression. (A) Similar numbers of tumor-infiltrated lymphocytes and microglia in GL261 gliomas from NBI-74330and vehicle-treated WT mice. Numbers of tumor-infiltrated CD4+, CD8+, Foxp3+, Ly49G2+ and CD11b+ cells were not affected by NB I-74330 when compared with vehicle treatment. (B) In vivo expression of CXCL9 and CXCL10 was not altered by NBI-74330 treatment. Shown are repres entative sections from vehicleand NBI-74330-treated glioma-bearing mice subjected to in situ hybridization analysis.

PAGE 68

68 Figure 4-5. CXCR3 and CXCL10 expressi on in murine and human glioma cell lines cultured in serum-containing media. (A) RTPCR identified CXCL10 mRNA in T98G and U87 cells in vitro GAPDH was used as a control. (B) Representative histograms from fluorescenceactivated cell sorting analysis showing CXCR3 expression by GL261, A172, T98G, U87, U118 and U138 cells in vitro Gray filled area, anti-CX CR3-APC (mouse) or antiCXCR3-PE (human) staining; blank area: isotype controls. GL261 had the highest CXCR3 expression level among all the glioma cell lines.

PAGE 69

69 Figure 4-6. Gliomaspheres derived from cu lturing cells under more defined conditions that include bFGF and EGF, had higher resemblance to primary human GBM and exhibited a stem cell phenotype characterized by nestin and SOX2 expression.

PAGE 70

70 Figure 4-7. CXCL10, CXCL11 and CXCR 3 expression in GS cells. (A) RTPCR identified in vitro expression of CXCL10 mRNA in GL261-, T98G-, U87and U118-GS cells and a patient GB M tissue-derived primary GS (GBM L0). In addition, CXCL11 is express ed by GL261-, T98G-, U87-, U118-GS and GBM L0 cells. GAPDH was used as a control. (B) RTPCR analysis identified in vitro expression of CXCR3 mRNA isoforms in murine and human GS cells. CXCR3-A was detected in all cells with A172-, T98Gand U87-GS cells expressing the highes t levels. CXCR3-B was detected in T98G-, U118and U138-GS cells. One form of CXCR3 mRNA was detected in GL261-GS cells; only the equivalent of CXCR3-A exists in mouse.

PAGE 71

71 Figure 4-8. Representative histograms from fluorescence-activated cell sorting analysis showing CXCR3 expression by GL261-, A172-, T98G-, U87-, U118-, U138-GS and GBM L0 cells. Gr ay filled area: anti-CXCR3-APC (mouse) or anti-CXCR3-PE ( human) staining. Blank area: isotype controls.

PAGE 72

72 Figure 4-9. GL261and U87-GS cells (2000 cells/ml) were incubated with 1 nM CXCL9 (open squares) or 1 nM CXCL10 (open triangles); U118-, U138-GS cells (5000 cells/ml) and GBM L0 (1000 cells/ml) were incubated with 10 nM CXCL9 (open squares) or 10 nM CX CL10 (open triangles). The control group was cultured in medium without c hemokines or growth factors (filled circles). All conditions contained 0. 1% dimethyl sulfoxide (NBI-74330 vehicle). Representative results of three individual experiments performed in triplicate are shown. CXCL9 and CXCL10 significantly enhanced GL261and U87-GS growth at day 6 and 9 (* P < 0.05, ** P < 0.01) and prevented U138-GS cell loss at day 9. CXCL9 st imulation significantly increased cell numbers of GBM L0 at day 9 (# P < 0.05); CXCL10-stim ulated group was not statistically significant as compared with control.

PAGE 73

73 Figure 4-10. Effect of 1 M NBI-74330 (black filled bars) and 0.1% dimethyl sulfoxide (open bars) on chemokineand growth factor-stimula ted GS growth. Representative results of three i ndividual experiments performed in triplicate are shown. NBI-74330 att enuated response of GL261-, U87and U138-GS to CXCL9 and CXCL10 but did not affect either control or growth factor-supplemented groups.

PAGE 74

74 CHAPTER 5 CXCR4 AND CXCR7 IN GBM As reported in chapter 4, we determined t hat several gliomasphere lines, including the primary GBM line 0 (GBM L0), expressed CXCL11 (Figur e 4-7). This prompted our interest to further evaluate the function of CXCL11 in glioblastoma since it has been shown to be a versatile chemokine. As ment ioned previously, CXCL11 is well known to be one of the ligands of CXCR3. In addition, CXCL11 has been demonstrated to interact with CCR3170, CCR5171 and CXCR7107. CCR3, CCR5, and CCR1 are three chemokine receptors that also share the same ligand, namely CCL5. Previous studies have shown that CXCL11 ac ted as an antagonist of CCR3170 and CCR5171, and inhibited CCL5-mediated cell migration171. CXCR7 binds CXCL11 and CXCL12 while CXCL12 also binds CXCR4. The activation of CXCR7 by CXCL11 exer ts an inhibitory effect on CXCL12-CXCR4 mediated tu mor cell transendothelial migration172. Thus, CXCL11 may have multiple functions through different chemokine re ceptor systems it interacts with. It has been reported that CXCR7 was express ed by differentiated GBM cells and exhibited anti-apoptotic activity while CX CR4 was expressed in GBM stem-like cells111. However, with substantial evidence of interactions between CXCR4 and CXCR7 through CXCL11 and CXCL12, we hypothesiz ed that the CXCR4-CXCR7 axis has multiple roles in GBM biology. In this study we sought to determine the roles of CXCR4 and CXCR7 in GBM by using primary pati ent-derived GBM cells. The expression of CXCR4 and CXCR7 as well as CCR1, 3, 5 was determined in 6 primary GBM lines (GBM L0, L1, L2, L3, S3, S7). Heter ogeneous expression of CXCR4 and CXCR7 was documented in GBM cells while all lines tested showed a small fraction of CCR3and

PAGE 75

75 CXCR3-expressing populations. GBM L0 and L1 we re then chosen as two model lines, and we found substantial levels of CXCL11, CXCR4, and CXCR7 mRNA as well as intracellular CXCR4 and CXCR7 proteins in GBM L0 and L1 cells. When cells were isolated according to their CXCR4 and CXCR 7 cell surface expression patterns, all subpopulation were able to form spher es. In addition, these subpopulations recapitulated the parental heterogeneous expr ession pattern of CXCR4 and CXCR7. Results from migration assay indicated that CXCL12 induced the mi gration of GBM L0 and L1 cells. Moreover, CXCL11 and CX CL12 enhanced GBM L0 and L1 cell growth but did not promote primary sphere formation Taken together, the data indicate that CXCL11 and CXCL12 promot e GBM progression. The re sults suggest that these chemokine systems should be considered as therapeutic targets for future drug development in GBM therapy. Results Primary GBM Cell Lines Had a Small Fraction of CCR3and CXCR3-Expressing Cells To investigate the functional significance of several chemokine receptors in GBM, we studied 6 GBM patient-deriv ed primary cell lines, namel y GBM L0, L1, L2, L3, S3, S7. By FACS analysis, we determined that all lines contained a small percentage of CCR3+ cells (Figure 5-1). In addition, there were also a small fraction of CXCR3+ cells in all of the GBM lines (Figure 5-1). Co-stain ing with CCR3 and CXCR3 specific antibodies revealed that amongst CCR3and CXCR3-expr essing cells, around 50% of them were CCR3+CXCR3+ (Figure 5-1), i.e. double positive for both receptors. Table 5-1 summarizes the percentage of CCR3and CXCR 3-expressing cell populations in GBM

PAGE 76

76 cell lines. CCR1 and CCR5 were undetectable in all of the GBM cell lines (data not shown). Primary GBM Cell Lines Showed Differential Expression of CXCR4 and CXCR7 on the Cell Surface To determine the expression of CXCR4 and CXCR7 in the GBM cell lines, we utilized FACS analysis with CXCR4and CXCR7-specific antibodies and found that all GBM cell lines expressed CXCR4 and CXCR7 on their cell surface (Figure 5-2). Interestingly, GBM cells showed different ex pression patterns of relative levels of CXCR4 and CXCR7 within each individual li ne. GBM L0, L2, and L3 had a relatively high level of CXCR4 and a low level of CX CR7 while GBM L1, S3, and S7 exhibited low levels of CXCR4 and high levels of CXCR7 (Figure 5-2; Table 5-1). Each cell line consisted of four subpopulations: CXCR4-CXCR7-; CXCR4+CXCR7-; CXCR4+CXCR7+; CXCR4-CXCR7+ (Figure 5-2). Theref ore, the expression pa tterns of CXCR4 and CXCR7 are heterogeneous within and amongst se veral human GBMs. For the following experiments, we used GBM L0 cells as a representative model GBM line for CXCR4highCXCR7low and the GBM L1 line as a model for CXCR4low-CXCR7high GBMs. CXCL11, CXCR4, CXCR7, but Not CXCL12 Were Expressed by GBM L0 and L1 Cells Independent of Their Surface CXCR4-CXCR7 Heterogeneity To determine the expression of chemokines CCL5, CXCL11, and CXCL12 in GBM L0 and L1, RT-PCR was performed and demons trated that CCL5 and CXCL11 were abundantly expressed by both cell li nes while CXCL12 was undetectable (Figure 5-3A). RT-PCR analysis showed that CXCR4 and CXCR7 mRNAs were present in the GBM L0 and L1 lines (Figure 5-3A), and the amount of mRNAs for thes e receptors did not correlate with the surface receptor levels of CXCR4 and CXCR7. To further address this phenomenon, we examined the intracellular le vels of CXCR4 and CXCR7 proteins in

PAGE 77

77 GBM L0 and L1 cells. FACS analysis of per meabilized cells determined that CXCR4 and CXCR7 were substantially expressed in the cytoplasm of most L0 and L1 cells (Figure 5-3B). GBM L0 and L1 Subpopulations Formed Spheres and Retained the Parental Surface CXCR4-CXCR7 Heterogeneity To test the hypotheses that 1) different CXCR4+ and/or CXCR7+ subpopulations within L0 and L1 are distinct fr om each other or 2) the diffe rential expression of surface CXCR4-CXCR7 are homeostatic and reversible, we isolated CXCR4+CXCR7and CXCR4-CXCR7populations from L0 cells as well as CXCR4-CXCR7+ and CXCR4-CXCR7populations from L1 cells (Figure 54A) and compared them with unsorted cells after further culture for 7 days. All the subpopulations is olated from L0 and L1 were able to form spheres (Figure 5-4C) and repopulate the four different subtypes of surface CXCR4-CXCR7 after 7 days (Figure 5-4B). In addition, cells from GBM L0 retained the CXCR4high-CXCR7low receptor profile while cells from GBM L1 restored the CXCR4lowCXCR7high expression pattern (Figure 5-4B). The pr ogeny of CXCR4+CXCR7GBM L0 cells had more CXCR4+ cells than cells from CXCR4-CXCR7and unsorted populations. There were also a higher percentage of CXCR7+ cells in cells from the L1 CXCR4-CXCR7+ cells when compared with double negative and unsorted populations. CXCL12 Induced GBM L0 and L1 Cell Migration CXCR4 and CXCR7 have been reported to regul ate cell migration in a variety of cell types112,172,173. To investigate the effects of CXCR4 and CXCR7 on GBM L0 and L1 cell migration, we measur ed the number of GBM cells that migrated through the membrane of a standard Boyden chamber assay under the stimulation of either 10 nM CXCL11 or CXCL12. CX CL12 (10 nM) significantly induced cell migration of both GBM

PAGE 78

78 L0 and L1 cells when compared to the non-treated controls (Figure 5-5). In contrast, CXCL11 treated groups in L0 and L1 showed a slight increase in the numbers of migrated cells but it was not statis tically significant (Figure 5-5). CXCL11 and CXCL12 Promoted GBM Cell Growth but Had No Effect on Primary Sphere Formation In Vitro Next, we evaluated the effects of CXC L11 and CXCL12 on GBM cell growth and sphere forming capacity. GBM L0 or L1 cells (2000) were seeded in 96 well plates and incubated with either 10 nM CXCL11 or CXCL12. Cells wit hout either of the two chemokines served as the control. The num bers of primary spheres were counted after 10 days and neither CXCL11 nor CXCL12 impac ted primary sphere formation of GBM L0 and L1 cells (Figure 5-6A). In contras t, CXCL11 and CXCL12 significantly enhanced cell growth of GBM L0 and L1 cells (Figure 56B). In GBM L0, the response to CXCL11 was greater than the response to CXCL12 in terms of cell gr owth while the effect of CXCL11 and CXCL12 were comparabl e in GBM L1 cells (Figure 5-6B). Discussion As the role of CXCR4 in a variety of cancers has been well studied, the recently reported receptor of CXCL12, namely CX CR7, has started to gain considerable attention. However, the im portance of CXCR4-CXCR7 axis in tumorigenesis of human GBM is still unclear. A previous study has s hown that CXCR4 is upregulated in stemlike GBM cells while CXCR7 is elevated in differentiated GBM cells111. The proposed function of CXCR7 is to prevent GBM cells from apoptosis, which may contribute to the resistance to therapy. However, it has also been suggested that CXCR7 could impact CXCR4-dependent by depleti ng extracellular CXCL12108,112. In addition, CXCR7 dimerizes with CXCR4 and impairs CXCR4-regulated G i activation174. Therefore, the

PAGE 79

79 CXCR4-CXCR7 axis could be involved in mu ltiple phenotypes of GBM biology. The results reported here indicate that hum an primary GBM lines express CXCR4 and CXCR7 in a heterogeneous manner on the cell surface while keeping intracellular levels of CXCR4 and CXCR7 constant. In addition, the cell surface expression of CXCR4 and CXCR7 are homeostatic. More important, CX CL12 induces cell migration of GBM L0 and L1 as CXCL11 and CXCL12 enhances L0 and L1 cell growth. Taken together, these data support further investigation of CXCR4-CXCR7 axis as a target for GBM therapy. In the primary GBM lines we examined, a ll have small fractions of CCR3and/or CXCR3-expressing cells. Moreover, RT-PCR showed that CCL5, the ligand of CCR3, and CXCL11, which binds both CCR3 and CXCR3 were expressed by GBM L0 and L1 cells. Since CXCL11 has been shown to be an antagonist of CCR3170, our data suggest that CCR3-CXCR3 axis might play important role in GBM biology. Next, when analyzed with extracellular and intracellular FACS, the differential expression of CXCR4 and CXCR7 on the ce ll surface of L0 and L1 was documented and an abundant level of intrac ellular CXCR4 and CXCR7 proteins were observed. The expression of CXCL11 and CXCR7 by GBM ce lls indicates that CXCL11 exerts its effects on tumor cells in an autocrine m anner. Although CXCL12 was undetectable in GBM cells by RT-PCR, it is known that CXCL12 is expressed by vascular endothelial cells in human GBM tissues100 Therefore, CXCL12 secreted by non-tumor cells is the likely source of this chemokine. When GBM cells were isolated according to the cell surface heterogeneity of CXCR4 and CXCR7, all sub-pop ulations of cells were able to restore the original

PAGE 80

80 CXCR4-CXCR7 cell surface expression pattern These results suggest that CXCR4 and CXCR7 on the cell membrane are not markers of distinct cell subpopulations. Instead, the differential CXCR4-CXCR7 expression on the cell membrane might be an indicator of cell status when cells respond to environmental stimuli. Indeed, the reversible state of tumor cells has been documented. In human melanoma, cell subtypes defined by 22 different markers are all capable of recapitulati ng the tumor heterogeneity37. Other studies suggest that several genes in melanoma are reversibly turned on and off, and this phenomenon is related to cell function175,176. Environmental changes, such as hypoxia and differentiation status, could alter the level of CXCR4 and CXCR7 in different models111,177-179, which also suggests the transitional expression of these two chemokine receptors in a manner related to cell function. Interestingly, the primary human GBM cell lines we studied can be cla ssified by their differential CXCR4-CXCR7 level on the cell surface, namely CXCR4high-CXCR7low (GBM L0, L2, L3) and CXCR4lowCXCR7high (GBM L1, S3, S7). An important question to understand is does the differential expression of CXCR4-CXCR7 reflect corresponding responses and functional significance of CXCL11 and CXCL12 in GBM? Further elucidation of CXCR4 and CXCR7 in GBM will help us in futu re development of novel therapies. To investigate the effects of CXC L11 and CXCL12 on GBM cells, GBM L0 and L1 cells were incubated with either CXCL11 or CXCL12 (each at 10 nM), and their effects on cell migration and growth were investigated Here we determined that regardless of the surface CXCR4-CXCR7 heterogeneity between GBM L0 and L1 lines, only CXCL12 significantly induced tumor cell migration. On the other hand, CXCL11 treated groups exhibited slight, but insignificant migrator y responses. Our results are consistent with

PAGE 81

81 other previously published studies180,181. The migration effect is more likely being mediated by CXCR4 instead of CXCR7 since CXCL 11 is ineffective in cell migration as we and other groups have shown113. However, recent studies revealed that CXCR7 is as important as CXCR4 in regulating cell migration. One hypothe sis is that CXCR7 removes CXCL12 from the surrounding cellular environment to create the concentration gradient so that cells can migrate via CXCR4112. Other studies indicate that CXCR7 controls the CXCR4-mediated migration by sustaining CXCR4 protein level173, dimerizing with CXCR4 on the cell surface to alter the intracellular G-protein coupling174, and potentially interacting with CXCR4 by -arrestin2 recruitment172. Since we showed here that CXCL12 could induce the migration of GBM cells, it is critical to investigate the mechanism and functional outcomes that under lie the interaction of CXCR4 and CXCR7 in GBM. With the exception of cell migration, our data suggests that both CXCL11 and CXCL12 promote cell growth of GBM L0 and L1 cells. In gliomas, CXCR4 has been well studied with respect of its ce ll growth enhancement capacity181,182. However, these studies did not examine the ex pression of CXCR7 in gliomas, which may have lead to an oversimplified conclusion. Indeed, our results indicate that not only CXCL12, but also CXCL11 is able to increase GBM cell growth in vitro which suggests a possible involvement of CXCR7 in cell growth. Alt hough CXCL11 can bind to CXCR3, the growth effect of CXCL11 is more likely to be mediated by CXCR7 since we have shown that neither CXCL9 nor CXCL10 promote GBM L0 growth (Figur e 4-9). To further address this question, we will use the CXCR4 specific antagonist (AMD3100) and CXCR7

PAGE 82

82 specific inhibitor (CCX733) to establish the functional significance of either of these receptors. A previous publication suggests that CXCR4 is highly associated with the glioma stem-like cells while CXCR7 is found on the more abundant population of GBM cells that display a differentiated phenotype111. The proposed functions of CXCR7 involve protection of the predominant population of glioma cells fr om apoptosis. However, since GBM L1 cells show a relatively high level of CXCR7, when cultured under conditions favoring stem cells, this model seems ov ersimplified. The functions of CXCR4 and CXCR7 in GBM stem-like cells are still unclear CXCR4 is known to regulate stem cell mobilization183,184 as well as maintain the stem cell pool through cell cycle regulation185. However, the importance of CXCR7 alone and with CXCR4 in cancer stem-like cells is under studied. Given the accumulated evid ence of CXCR7 involvement in CXCR4mediated activities, it would be important to examine the e ffect of CXCR7 on cancer stem-like cell biology in concert with CXCR 4. Here we found that CXCL11 and CXCL12 did not increase primary sphere formation in GBM L0 and L1 cells. In this experiment cells were divided into the various conditi ons and, as such, would be expected to have the same frequency of stem-like cells since t hey were derived from one culture flask. Since CXCL11 and CXCL12 promoted GBM cell growth, which may have included symmetric and asymmetric cell division of stemlike cells, alterations in the stem-like cell frequencies, by CXCL11 and CXCL12 stimulation, might not be reflected in the primary sphere formation assay. Therefore, the secondary sphere formation assay, which measures the stem cell frequency after chemok ine treatments, will more likely inform us if either CXCL11 or CXCL12 prom otes GBM stem-like cell renewal.

PAGE 83

83 Table 5-1. % CCR3+, CXCR3+, CXCR4+, and CXCR7+ populations in primary GBM cell lines GBM L0 GBM L2 GBM L3 GBM L1 GBM S3 GBM S7 CCR3+ 7.4.8 5.6.5 3.2. 6 13.6 9.1.1 7.7.8 CXCR3+ 3.9.4 2.3 5.6 8.9.3 9.4.3 8.6 CXCR4+ 43.9.2 42.2.7 37.8 7.5 8.4.3 12.2.3 CXCR7+ 15.3 14.2.9 6.1.2 45.8.7 18.5 23.2.3 Note: Results are shown in mean S.E.M. from at least three independent experiments.

PAGE 84

84 Figure 5-1. CCR3 and CXCR3 expression in primary human GBM cell lines. Representative histograms from fluorescenceactivated cell sorting analysis showing the expression of CCR3 and CXCR3 by all GBM cell lines. A fraction of CCR3+CXCR3+ cells were present in all GBM cell lines.

PAGE 85

85 Figure 5-2. CXCR4 and CXCR7 expr ession in primary human GBM cell lines. Representative histograms from fluorescenceactivated cell sorting analysis showing the expression of CXCR4 and CXCR7 in all GBM cell lines. Heterogeneous expression of CX CR4 and CXCR7 were evident in GBM cells in vitro GBM L0, L2 and L3 are CXCR4high-CXCR7low while GBM L1, S3, and S7 are CXCR4low-CXCR7high.

PAGE 86

86 Figure 5-3. CXCL11, CXCR4, and CXCR 7 mRNA and intracellular CXCR4 and CXCR7 protein expression in prim ary human GBM cell lines. (A) RTPCR analysis identified CCL5, CXCL11, CXCR4, CXCR7 mRNAs in GBML0 and L1 cells in vitro GAPDH was used as a control. (B) Representative histograms from fluorescence-acti vated cell sorting analysis showing intracellular CXCR4 and CXCR7 expression by GBM L0 and L1 cells in vitro Despite the differential expression of surface CXCR4 and CXCR7 on GBM L0 and L1, both cell lines show ed substantial coexistence of intracellular CXCR4 and CXCR7 in the majority of the cells.

PAGE 87

87 Figure 5-4. GBM cell subtypes recapitula ted the original heter ogeneous expression of CXCR4 and CXCR7 on cell membrane. (A) Cell subpopulations were isolated from GBM L0 and L1 based on their surface CXCR4-CXCR7 expression (B) Representative histogram s from fluorescence-activated cell sorting analysis showed that after 7 days, each isolated subpopulation was capable of restore thei r parental nature regarding cell surface CXCR4CXCR7 expression. (C) Representati ve images showing that isolated subtypes of GBM L0 and L1 cells were able to form spheres in vitro

PAGE 88

88 Figure 5-5. Effect of 10 nM CXCL11 or CXCL12 on GBM L0 and L1 cell migration. CXCL12 enhanced cell migration in GBM L0 and L1 cells while CXCL11 did not significantly promote cell migration of GBM cells.

PAGE 89

89 Figure 5-6. Effect of 10 nM CXC L11 or CXCL12 on GBM L0 and L1 primary sphere formation and cell growth. (A) CXC L11 and CXCL12 had no effect on primary sphere formation of GBM L0 and L1 cells. (B) CXCL11 and CXCL12 promoted cell growth of GBM L0 and L1 cells.

PAGE 90

90 CHAPTER 6 GENERAL DISCUSSION Glioblastoma multiforme, a WHO grade IV g lioma, is characterized by behavioral aggressiveness, sites of necrosis within the tumor, and a poor prognosis despite multimodality therapies. Fact ors such as intratumor al heterogeneity, mutational evolution, and a highly imm unosuppressive microenvironment are involved in the resistance to therapy of GBM. The main goal s of researchers who are looking for novel therapeutic targets are ident ifying genotypic and phenotypic markers and factors that create heterogeneity and therapeutic resistance. Chemotactic cytokines (chemokines) mediate a variety of functional activities in cancers, such as tumor gr owth, angiogenesis, metastasis and recruitment of immune and effector cells. In this study, we addre ssed the functions and therapeutic potentials of several chemokine systems and revealed that GBM cells show differential expression of chemokines and chemokine receptors in the manner of protein isoforms and cell surface receptor levels. The effects of c hemokines on immune cell trafficking, tumor cell growth, and tumor cell migration of GBM were evaluated. Summary of Findings In this study, we found that CX3CR1 and CXCR3 deficiency/blockade does not affect trafficking of tumor-infiltrating immune cells and microglia. Functional characterization revealed that CXCR3 exerts a growth-promoting effe ct directly on GBM cells, and a CXCR3 inhibitor succe ssfully attenuated tumor growth in vitro and in vivo Thus, CXCR3 is a potential therapeutic tar get to treat human GBM. In addition to CXCR3, the chemokine rec eptor CCR3, CXCR4, and CXCR7 were detected in primary human GBM cells. The GBM cells possess a differential CXCR4 and CXCR7

PAGE 91

91 expression profile on the cell surface. Our re sults indicate that CXCL12 induced GBM cell migration while CXCL11 and CXCL12 promoted GBM cell growth. Therefore, the therapeutic targeting of CXCR4 and CX CR7 in GBM requires further study. Chemokines and Tumor-Infiltrated Immune Cells in GBM In this study, we utilized CX3CR1-deficient and CXCR3 deficient mice as well as a CXCR3 specific antagonist wit h the GL261 mouse model of glioma to investigate the functions of CX3CR1 and CXCR3 in intrat umoral immune cell re cruitment. Our data suggest that dysfunction of single chemokine re ceptor has little to no effect on immune cell migration into gliomas. Although CXCR3 -deficient mice had reduced numbers of intratumoral natural killer (NK) and natural killer T (NKT) cells, this decrease is likely due to the impaired homeostasis of NK and NKT cell levels in the CXCR3-deficient mice161. The lack of an immune cell phenotype from chemokine receptor-deficient mice and antagonist treated mice may be explained by the redundancy of multiple chemokine receptors that coexist in immune cells and the variety of chemokines produced by tissues186. For example, lymphocytes can expre ss multiple chemokine receptors. Th1 cells express CXCR3 and CCR5 w hen Th2 cells have CCR3, CCR4, and CCR8187, and they respond and migrate toward the relevant chemokines188,189. Microglia have also been reported to express more than one chemokine receptor, such as CXCR1, CXCR3, CCR3, and CX3CR1190,191. Therefore, blocking only one specific chemokine receptor may not lead to a beneficial effect. Indeed, the combination of different chemokine receptor inhibitors has shown a greater impact on lymphocyte migration and immune responses than using a single chem okine receptor antagonist treatment192.

PAGE 92

92 Heterogeneity and Redundancy of Chemokine Receptors in GBM In this study, we demonstrated that mouse and human GBM cells exhibit differential expression of chemokine receptors. CXCR3+ and CXCR3cells are observed in mouse GL261 cells and human A172, T98G, U87, U118, U138, and GBM L0 cells. In primary GBM cell lines GBM L0, L1, L2, L3, S3, S7, heterogeneous levels of cell surface CXCR4 and CXCR7 are also documented. The cell surface levels of chemokine receptors show a flexibility that is influenced by environmental stimuli. For example, our study indicates that serum supplement ed culture medium will decrease CXCR3 expression in GBM cells. Serum supplem ented changes in CXCR4 and CXCR7 levels in GBM have also been documented111. By intracellular FACS, we found a significant intracellular presence of CXCR4 and CXCR7 that was independent from their surface expression pattern. Similar substantial intrac ellular expression of CXCR3 has also been reported193,194. Taken together, GBM cells may be able to form reversible functional subtypes of cells by chemokine receptor transportation and intern alization mechanisms. Interestingly, when we isolated CXCR4-CXCR7population from GBM L0 and L1 cell lines, both populations looked identical in th eir CXCR4-CXCR7 surface level and, when cultured under identical conditi ons, recapitulated their di stinct parental differential expression of CXCR4 and CXCR7 on the cell surface. In addition, we found that other subpopulations restored the uni que CXCR4-CXCR7 surface pr ofile of the lines they were derived from. These results indicate a more complicated mechanism in regulating cell surface chemokine receptor levels, whic h shows a memory-like characteristic. Another chemokine receptor heterogeneity we identified in several GBM cells included different variants of CXCR3, namely CXCR3A and CXCR3B. The expression of CXCR3 isoforms in GBM may increase t he difficulty to target CXCR3 as a standard

PAGE 93

93 therapeutic approach since CX CR3A enhances cell growth while CXCR3B induces apoptosis. Therefore, we should be careful when using CXCR3 antagonists to treat GBM patients and the screening of CXCR3 isofo rms in GBM patients may be necessary to determine if an antagonist will hav e the desirable beneficial effect. The existence of chemokine system redundan cy raises difficulties for researchers to understand the function of chemokine systems and makes targeting chemokine systems as a therapeutic approach more co mplicated. For example, CXCR3 ligands have been considered as potentia l anti-tumor drugs due to t heir angiostatic activity through CXCR3B88. However, CXCR3 ligands also inhibited CCR5-mediated monocyte migration171 and hence may interfere with the host immune response against cancer. Therefore, it is critical to consider the redundancy and interaction between chemokine systems when studying the functional significanc e of chemokine receptors. For instance, activation of CXCR7 alone does not induce cell migration107, but CXCR7 is involved in cell migration by interacting with CXCR4173. Thus, investigation of multiple chemokine systems simultaneously may lead to more relia ble understanding of their roles in human GBM. Future Directions The heterogeneity of CXCR4 and CXCR7 on the cell surface of GBM cells indicates the potential functional significance of these two chemokine receptors in the progression of human GBM. In this study we have demonstrated that CXCL12 induces GBM cell migration in vitro which may contribute to the inf iltrative characteristic of GBM cells. In addition, CXCL11 and CXCL12 both promote GBM cell growth. Therefore, targeting CXCL11/CXCL12/CXCR4/CXCR7 coul d be a possible therapeutic approach to

PAGE 94

94 treat GBM patients. Our futu re studies will focus on the interaction between these chemokine receptors. Does CXCR7 Impact Cell Migration in GBM? In this research we determi ned that CXCL12 is able to induce cell migration in GBM cells. However, we did not address t he question of whether CXCR4 or CXCR7 is responsible for CXCL12-regulated cell migr ation of GBM cells. Therefore, CXCL12dependent migration of GBM cells will need to be determined in the presence of either AMD3100, a CXCR4-specific ant agonist, or CCX733, a CXCR7specific inhibitor, to elucidate whether CXCL12 evokes the migr ation response through CXCR4 or CXCR7. If the cell migration is regulated by CXCR4, as most published information suggests, the next question to be addressed is whether CXCR7 is involved in CXCR4-mediated cell migration. To investigate this question, mi gration of GBM cells in the presence of CXCL11, CXCL12, and NBI-74330 (CXCR3 antagonist) will determi ne the impact of CXCR7 activation on CXCL12-CX CR4 induced migration. Do CXCR4 and CXCR7 Play Critical Roles in GBM Stem-Like Cells? In this study we have shown that CXCL 11 and CXCL12 have no effect on primary sphere formation of GBM L0 and L1 cells However, since CXCL11 and CXCL12 promote GBM cell growth, which may include symmetric and asymmetric cell division of stem-like cells, the stem-like cell frequency could be altered by CXCL11 and CXCL12 stimulation, which would not be reflected in the primary sphere formation assay. A previous study has suggested that the fr equency of stem cells, which should exhibit long-term proliferation ability, could be refl ected in the slope of the growth curve195. Therefore, GBM cells will be cultured in CXCL11 or CXCL12 combined with different antagonists, and the long-term growth curve analysis as well as the sphere formation

PAGE 95

95 ability at each passage will be measured. Re sults from these experiments will determine if CXCR4 and/or CXCR7 activation impacts stem-like cell frequency in GBM cells. Will CXCR4 or CXCR7 Antagonism I nhibit Tumor Growth of GBM Cells In Vitro and In Vivo ? Our results indicate that CXCL11 and CXCL12 promote GBM cell growth in vitro Further study using CXCR4 and CXCR7 antagonists to inhibit GBM cell growth in vitro and also in vivo would be beneficial in the search of new therapeutic targets for GBM patients. The in vitro effect would be evaluated by incubating GBM cells with the combination of chemokines and antagonists. Cell growth will be determined by counting total cell numbers. For the in vivo studies, GBM tumors will be established in immunecompromised NSG mice and the animals will be subsequently treated with either CXCR4 or CXCR7 inhibitors. The survival rate of tumor-bearing animals will be documented.

PAGE 96

96 LIST OF REFERENCES 1. WEN, P.Y. & KESARI, S. MALIGNANT GLIOMAS IN ADULTS. N ENGL J MED 359 492-507 (2008). 2. XU, T., CHEN, J., LU, Y. & WOLFF, J.E. EFFECTS OF BEVACIZUMAB PLUS IRINOTECAN ON RESPONSE AND SURVIVAL IN PATIENTS WITH RECURRENT MALIGNANT GLIOMA: A SYSTEMATIC REVIEW AND SURVIVAL-GAIN ANALYSIS. BMC CANCER 10, 252 (2010). 3. JOHNSON, L.A. & SAMPSON, J.H. IMMUNOTHERAPY APPROACHES FOR MALIGNANT GLIOMA FROM 2007 TO 2009. CURR NEUROL NEUROSCI REP 10, 259-266 (2010). 4. OKADA, H. ET AL. AUTOLOGOUS GLIOMA CELL VACCINE ADMIXED WITH INTERLEUKIN-4 GENE TRANSFECTED FIBROBLASTS IN THE TREATMENT OF PATIENTS WITH MALIGNANT GLIOMAS. J TRANSL MED 5 67 (2007). 5. KAWAKAMI, Y. ET AL. DENDRITIC CELL BASED PERSONALIZED IMMUNOTHERAPY BASED ON CA NCER ANTIGEN RESEARCH. FRONT BIOSCI 13, 1952-1958 (2008). 6. SACCHERI, F. ET AL. BACTERIA-INDUCED GAP JUNCTIONS IN TUMORS FAVOR ANTIGEN CROSS-PRESENTAT ION AND ANTITUMOR IMMUNITY. SCI TRANSL MED 2 44RA57 (2010). 7. PLAUTZ, G.E. ET AL. SYSTEMIC T CELL ADOPTIVE IMMUNOTHERAPY OF MALIGNANT GLIOMAS. J NEUROSURG 89, 42-51 (1998). 8. SCHMITZ, M. ET AL. IDENTIFICATION OF SOX2 AS A NOVEL GLIOMAASSOCIATED ANTIGEN AND POTENT IAL TARGET FOR T CELL-BASED IMMUNOTHERAPY. BR J CANCER 96, 1293-1301 (2007). 9. STUPP, R. ET AL. RADIOTHERAPY PLUS CONCOMITANT AND ADJUVANT TEMOZOLOMIDE FOR GLIOBLASTOMA. N ENGL J MED 352 987-996 (2005). 10. FURNARI, F.B. ET AL. MALIGNANT ASTROCYTIC GLIOMA: GENETICS, BIOLOGY, AND PATHS TO TREATMENT. GENES DEV 21, 2683-2710 (2007). 11. FRIEDMAN, H.S. ET AL. BEVACIZUMAB ALONE AND IN COMBINATION WITH IRINOTECAN IN RE CURRENT GLIOBLASTOMA. J CLIN ONCOL 27, 4733-4740 (2009). 12. JUNCK, L. BEVACIZUMAB ANTIANGIOGE NIC THERAPY FOR GLIOBLASTOMA. NEUROLOGY 76, 414-415 (2011). 13. ROSENBERG, S.A. PROGRESS IN HUMAN TUMOUR IMMUNOLOGY AND IMMUNOTHERAPY. NATURE 411 380-384 (2001).

PAGE 97

97 14. ROUSSEL, E., GINGRAS, M.C., GRIMM, E.A., BRUNE R, J.M. & MOSER, R.P. PREDOMINANCE OF A TYPE 2 INTRAT UMOURAL IMMUNE RESPONSE IN FRESH TUMOUR-INFILTRATING LYMP HOCYTES FROM HUMAN GLIOMAS. CLIN EXP IMMUNOL 105 344-352 (1996). 15. FECCI, P.E. ET AL. INCREASED REGULATORY T-CELL FRACTION AMIDST A DIMINISHED CD4 COMPARTMEN T EXPLAINS CELLULAR IMMUNE DEFECTS IN PATIENTS WITH MALIGNANT GLIOMA. CANCER RES 66, 32943302 (2006). 16. HEGI, M.E. ET AL. MGMT GENE SILENCING AND BENEFIT FROM TEMOZOLOMIDE IN GLIOBLASTOMA. N ENGL J MED 352 997-1003 (2005). 17. SMITH, J.S. ET AL. PTEN MUTATION, EGFR AMPLIFICATION, AND OUTCOME IN PATIENTS WITH AN APLASTIC ASTROCYTOMA AND GLIOBLASTOMA MULTIFORME. J NATL CANCER INST 93, 1246-1256 (2001). 18. BELDA-INIESTA, C., DE CASTRO CARPENO, J., SER ENO, M., GONZALEZBARON, M. & PERONA, R. EPIDERMAL GROWTH FACTOR RECEPTOR AND GLIOBLASTOMA MULTIFORME: MOLECULAR BASIS FOR A NEW APPROACH. CLIN TRANSL ONCOL 10, 73-77 (2008). 19. PHILLIPS, H.S. ET AL. MOLECULAR SUBCLASS ES OF HIGH-GRADE GLIOMA PREDICT PROGNOSIS, DELINEATE A PATTERN OF DISEASE PROGRESSION, AND RESEMBLE ST AGES IN NEUROGENESIS. CANCER CELL 9 157-173 (2006). 20. FREIJE, W.A. ET AL. GENE EXPRESSION PROFILING OF GLIOMAS STRONGLY PREDICTS SURVIVAL. CANCER RES 64, 6503-6510 (2004). 21. VERHAAK, R.G. ET AL. INTEGRATED GENOMIC ANALYSIS IDENTIFIES CLINICALLY RELEVANT SUBTYPES OF GLIOBLASTOMA CHARACTERIZED BY ABNORMALITIES IN PDGFRA, IDH1, EGFR, AND NF1. CANCER CELL 17, 98-110 (2010). 22. PARK, C.H., BERGSAGEL, D.E. & MCCULLOCH, E.A. MOUSE MYELOMA TUMOR STEM CELLS: A PR IMARY CELL CULTURE ASSAY. J NATL CANCER INST 46, 411-422 (1971). 23. BRUCE, W.R. & VAN DER GAAG, H. A QUANTITATIVE ASSAY FOR THE NUMBER OF MURINE LYMPHOMA CELLS CAPABLE OF PROLIFERATION IN VIVO. NATURE 199 79-80 (1963). 24. BONNET, D. & DICK, J.E. HUM AN ACUTE MYELOID LEUKEMIA IS ORGANIZED AS A HIERARCHY THAT ORIGINATES FROM A PRIMITIVE HEMATOP OIETIC CELL. NAT MED 3 730-737 (1997).

PAGE 98

98 25. KLEIN, W.M. ET AL. INCREASED EXPRESSION OF STEM CELL MARKERS IN MALIGNANT MELANOMA. MOD PATHOL 20, 102-107 (2007). 26. RICCI-VITIANI, L. ET AL. IDENTIFICATION AND EXPANSION OF HUMAN COLON-CANCER-INITIATING CELLS. NATURE 445 111-115 (2007). 27. SINGH, S.K. ET AL. IDENTIFICATION OF A CA NCER STEM CELL IN HUMAN BRAIN TUMORS. CANCER RES 63, 5821-5828 (2003). 28. REBETZ, J. ET AL. GLIAL PROGENITOR-LIKE PHENOTYPE IN LOW-GRADE GLIOMA AND ENHANCED CD133-EXPRESSION AND NEURONAL LINEAGE DIFFERENTIATION POTENTIAL IN HIGH-GRADE GLIOMA. PLOS ONE 3 E1936 (2008). 29. SINGH, S.K. ET AL. IDENTIFICATION OF HUMAN BRAIN TUMOUR INITIATING CELLS. NATURE 432 396-401 (2004). 30. HEMMATI, H.D. ET AL. CANCEROUS STEM CELLS CAN ARISE FROM PEDIATRIC BRAIN TUMORS. PROC NATL ACAD SCI U S A 100 15178-15183 (2003). 31. GALLI, R. ET AL. ISOLATION AND CHARACTERIZATION OF TUMORIGENIC, STEM-LIKE NEURAL PRECURSORS FROM HUMAN GLIOBLASTOMA. CANCER RES 64, 7011-7021 (2004). 32. SHMELKOV, S.V. ET AL. CD133 EXPRESSION IS NOT RESTRICTED TO STEM CELLS, AND BOTH CD133+ AND CD133METASTATIC COLON CANCER CELLS IN ITIATE TUMORS. J CLIN INVEST 118 2111-2120 (2008). 33. WU, A. ET AL. PERSISTENCE OF CD133+ CE LLS IN HUMAN AND MOUSE GLIOMA CELL LINES: DETAILED CHA RACTERIZATION OF GL261 GLIOMA CELLS WITH CANCER STEM CELL-LIKE PROPERTIES. STEM CELLS DEV 17, 173-184 (2008). 34. BEIER, D. ET AL. CD133(+) AND CD133(-) GLIOBLASTOMA-DERIVED CANCER STEM CELLS SHOW DIFFERENTIAL GROWTH CHARACTERISTICS AND MOLECULAR PROFILES. CANCER RES 67, 40104015 (2007). 35. OGDEN, A.T. ET AL. IDENTIFICATION OF A2B5 +CD133TUMOR-INITIATING CELLS IN ADULT HUMAN GLIOMAS. NEUROSURGERY 62, 505-514; DISCUSSI ON 514-505 (2008). 36. QUINTANA, E. ET AL. EFFICIENT TUMOUR FORMATION BY SINGLE HUMAN MELANOMA CELLS. NATURE 456 593-598 (2008). 37. QUINTANA, E. ET AL. PHENOTYPIC HETEROGENEITY AMONG TUMORIGENIC MELANOMA CELLS FROM PATIENTS THAT IS REVERSIBLE

PAGE 99

99 AND NOT HIERARCHICALLY ORGANIZED. CANCER CELL 18, 510-523 (2010). 38. BOIKO, A.D. ET AL. HUMAN MELANOMA-INITIATING CELLS EXPRESS NEURAL CREST NERVE GROWTH FACTOR RECEPTOR CD271. NATURE 466 133-137 (2010). 39. SCHATTON, T. ET AL. IDENTIFICATION OF CE LLS INITIATING HUMAN MELANOMAS. NATURE 451 345-349 (2008). 40. HIRSCHMANN-JAX, C. ET AL. A DISTINCT "SIDE POPULATION" OF CELLS WITH HIGH DRUG EFFLUX CAPACITY IN HUMAN TUMOR CELLS. PROC NATL ACAD SCI U S A 101 14228-14233 (2004). 41. FAN, X. ET AL. NOTCH PATHWAY BLOCKADE DEPLETES CD133-POSITIVE GLIOBLASTOMA CELLS AND INHI BITS GROWTH OF TUMOR NEUROSPHERES AND XENOGRAFTS. STEM CELLS 28, 5-16 (2010). 42. SOEDA, A. ET AL. EPIDERMAL GROWTH FACTOR PLAYS A CRUCIAL ROLE IN MITOGENIC REGULATION OF HUMAN BRAIN TUMOR STEM CELLS. J BIOL CHEM 283 10958-10966 (2008). 43. GRIFFERO, F. ET AL. DIFFERENT RESPONSE OF HUMAN GLIOMA TUMOR-INITIATING CELLS TO EPIDE RMAL GROWTH FACTOR RECEPTOR KINASE INHIBITORS. J BIOL CHEM 284 7138-7148 (2009). 44. BAO, S. ET AL. STEM CELL-LIKE GLIOMA CELLS PROMOTE TUMOR ANGIOGENESIS THROUGH VASCULAR E NDOTHELIAL GROWTH FACTOR. CANCER RES 66, 7843-7848 (2006). 45. PICCIRILLO, S.G. ET AL. BONE MORPHOGENETIC PROTEINS INHIBIT THE TUMORIGENIC POTENTIAL OF HUMAN BRAIN TUMOUR-INITIATING CELLS. NATURE 444 761-765 (2006). 46. ZHENG, H. ET AL. PTEN AND P53 CONVERGE ON C-MYC TO CONTROL DIFFERENTIATION, SELF-RENEWAL, AN D TRANSFORMATION OF NORMAL AND NEOPLASTIC STEM CELLS IN GLIOBLASTOMA. COLD SPRING HARB SYMP QUANT BIOL 73, 427-437 (2008). 47. ZHENG, H. ET AL. P53 AND PTEN CONTROL NEURAL AND GLIOMA STEM/PROGENITOR CELL RENEWAL AND DIFFERENTIATION. NATURE 455 1129-1133 (2008). 48. MURPHY, P.M. INTERNATIONAL UNION OF PHARMACOLOGY. XXX. UPDATE ON CHEMOKINE RECEPTOR NOMENCLATURE. PHARMACOL REV 54, 227-229 (2002).

PAGE 100

100 49. STRIETER, R.M. ET AL. CANCER CXC CHEMOKINE NETWORKS AND TUMOUR ANGIOGENESIS. EUR J CANCER 42, 768-778 (2006). 50. BELPERIO, J.A. ET AL. CXC CHEMOKINES IN ANGIOGENESIS. J LEUKOC BIOL 68, 1-8 (2000). 51. LUSTER, A.D. CHEMOKINES--CHEMO TACTIC CYTOKINES THAT MEDIATE INFLAMMATION. N ENGL J MED 338 436-445 (1998). 52. STRIETER, R.M., KUNKEL, S.L., ARENBERG, D.A., BURDICK, M.D. & POLVERINI, P.J. INTERFERON GAMMA -INDUCIBLE PROTEI N 10 (IP-10), A MEMBER OF THE C-X-C CHEMOKINE FAMILY, IS AN INHIBITOR OF ANGIOGENESIS. BIOCHEM BIOPHYS RES COMMUN 210 51-57 (1995). 53. MAIONE, T.E. ET AL. INHIBITION OF ANGI OGENESIS BY RECOMBINANT HUMAN PLATELET FACTOR-4 AND RELATED PEPTIDES. SCIENCE 247 7779 (1990). 54. MATLOUBIAN, M., DAVID, A., ENGEL, S., RYAN, J.E. & CYSTER, J.G. A TRANSMEMBRANE CXC CHEMOKINE IS A LIGAND FOR HIV-CORECEPTOR BONZO. NAT IMMUNOL 1 298-304 (2000). 55. LIU, P. ET AL. CX3CR1 DEFICIENCY IMPAIRS DENDRITIC CELL ACCUMULATION IN ARTE RIAL INTIMA AND REDUCES ATHEROSCLEROTIC BURDEN. ARTERIOSCLER THROMB VASC BIOL 28, 243-250 (2008). 56. TACKE, F., ET AL. MONOCYTE SUBSETS DIFFERENTIALLY EMPLOY CCR2, CCR5, AND CX3CR1 TO ACCUMULA TE WITHIN ATHEROSCLEROTIC PLAQUES. J CLIN INVEST 117 185-194 (2007). 57. COMBADIERE, C. ET AL. CX3CR1-DEPENDENT SUBRETINAL MICROGLIA CELL ACCUMULATION IS ASSOCIATED WITH CARDINAL FEATURES OF AGE-RELATED MACULAR DEGENERATION. J CLIN INVEST 117 2920-2928 (2007). 58. CARDONA, A.E. ET AL. CONTROL OF MICROGLIAL NEUROTOXICITY BY THE FRACTALKINE RECEPTOR. NAT NEUROSCI 9 917-924 (2006). 59. LAVERGNE, E. ET AL. FRACTALKINE MEDIATES NATURAL KILLERDEPENDENT ANTITUMOR RESPONSES IN VIVO. CANCER RES 63, 74687474 (2003). 60. YU, Y.R. ET AL. DEFECTIVE ANTITUMOR RESPONSES IN CX3CR1DEFICIENT MICE. INT J CANCER 121 316-322 (2007). 61. XIN, H. ET AL. ANTITUMOR IMMUNE RESPONSE BY CX3CL1 FRACTALKINE GENE TRANSFER DEPENDS ON BOTH NK AND T CELLS. EUR J IMMUNOL 35, 1371-1380 (2005).

PAGE 101

101 62. BLASCHKE, S. ET AL. PROINFLAMMATORY RO LE OF FRACTALKINE (CX3CL1) IN RHEUMATOID ARTHRITIS. J RHEUMATOL 30, 1918-1927 (2003). 63. NANKI, T., ET AL. INHIBITION OF FRACTALK INE AMELIORATES MURINE COLLAGEN-INDUCED ARTHRITIS. J IMMUNOL 173 7010-7016 (2004). 64. VOLIN, M.V. ET AL. FRACTALKINE: A NOVEL ANGIOGENIC CHEMOKINE IN RHEUMATOID ARTHRITIS. AM J PATHOL 159 1521-1530 (2001). 65. KAWADA, K. ET AL. PIVOTAL ROLE OF CX CR3 IN MELANOMA CELL METASTASIS TO LYMPH NODES. CANCER RES 64 4010-4017 (2004). 66. FURUYA, M. ET AL. UP-REGULATION OF CXC CHEMOKINES AND THEIR RECEPTORS: IMPLICATIONS FOR PROINFLAMMATORY MICROENVIRONMENTS OF OVARIAN CARCINOMAS AND ENDOMETRIOSIS. HUM PATHOL 38, 1676-1687 (2007). 67. SUYAMA, T., ET AL. UP-REGULATION OF THE INTERFERON GAMMA (IFNGAMMA)-INDUCIBLE CHEMOKINES IFN-INDUCIBLE T-CELL ALPHA CHEMOATTRACTANT AND MONOKINE INDUCED BY IFN-GAMMA AND OF THEIR RECEPTOR CXC RECEPTOR 3 IN HUMAN RENAL CELL CARCINOMA. CANCER 103 258-267 (2005). 68. WALSER, T.C. ET AL. ANTAGONISM OF CXCR3 INHIBITS LUNG METASTASIS IN A MURINE MODEL OF METASTATIC BREAST CANCER. CANCER RES 66, 7701-7707 (2006). 69. DATTA, D. ET AL. RAS-INDUCED MODULATION OF CXCL10 AND ITS RECEPTOR SPLICE VARIANT CXCR3-B IN MDA-MB-435 AND MCF-7 CELLS: RELEVANCE FOR THE DEVELOPMENT OF HUMAN BREAST CANCER. CANCER RES 66, 9509-9518 (2006). 70. GOLDBERG-BITTMAN, L. ET AL. THE EXPRESSION OF THE CHEMOKINE RECEPTOR CXCR3 AND ITS LIGAND, CXCL10, IN HUMAN BREAST ADENOCARCINOMA CELL LINES. IMMUNOL LETT 92, 171-178 (2004). 71. JONES, D., BENJAMIN, R.J., SHAH SAFAEI, A. & DORFMAN, D.M. THE CHEMOKINE RECEPTOR CXCR3 IS EXPRESSED IN A SUBSET OF B-CELL LYMPHOMAS AND IS A MARKER OF B-CELL CHRONIC LYMPHOCYTIC LEUKEMIA. BLOOD 95 627-632 (2000). 72. ENGL, T. ET AL. PROSTATE TUMOR CXC-CHEMOKINE PROFILE CORREL ATES WITH CELL ADHES ION TO ENDOTHELIUM AND EXTRACELLULAR MATRIX. LIFE SCI 78, 1784-1793 (2006). 73. KAWADA, K. ET AL. CHEMOKINE RECEPTOR CXCR3 PROMOTES COLON CANCER METASTASIS TO LYMPH NODES. ONCOGENE 26, 4679-4688 (2007).

PAGE 102

102 74. MARU, S.V. ET AL. CHEMOKINE PRODUCTION AND CHEMOKINE RECEPTOR EXPRESSION BY HUMAN GLIOM A CELLS: ROLE OF CXCL10 IN TUMOUR CELL PROLIFERATION. J NEUROIMMUNOL 199 35-45 (2008). 75. REARDON, D.A. ET AL. METRONOMIC CHEMOTHE RAPY WITH DAILY, ORAL ETOPOSIDE PLUS BEVACIZU MAB FOR RECURRENT MALIGNANT GLIOMA: A PHASE II STUDY. BR J CANCER 101 1986-1994 (2009). 76. MONTEAGUDO, C., MARTIN, J.M., JORDA, E. & LLOMBART-BOSCH, A. CXCR3 CHEMOKINE RECEPTOR I MMUNOREACTIVITY IN PRIMARY CUTANEOUS MALIGNANT MELANOMA: CORRELATION WITH CLINICOPATHOLOGICAL PR OGNOSTIC FACTORS. J CLIN PATHOL 60, 596599 (2007). 77. GIULIANI, N. ET AL. CXCR3 AND ITS BINDING CHEMOKINES IN MYELOMA CELLS: EXPRESSION OF ISOFORMS AND POTENTIAL RELATIONSHIPS WITH MYELOMA CELL PROLIFERATION AND SURVIVAL. HAEMATOLOGICA 91, 1489-1497 (2006). 78. PRADELLI, E. ET AL. ANTAGONISM OF CHEMOKI NE RECEPTOR CXCR3 INHIBITS OSTEOSARCOMA METASTASIS TO LUNGS. INT J CANCER 125 2586-2594 (2009). 79. CURBISHLEY, S.M., EKSTEE N, B., GLADUE, R.P., LALO R, P. & ADAMS, D.H. CXCR 3 ACTIVATION PROMOTES LY MPHOCYTE TRANSENDOTHELIAL MIGRATION ACROSS HUMAN HEPA TIC ENDOTHELIUM UNDER FLUID FLOW. AM J PATHOL 167 887-899 (2005). 80. WENDEL, M., GALANI, I.E., SURI -PAYER, E. & CERWENKA, A. NATURAL KILLER CELL ACCUMULATION IN TUMO RS IS DEPENDENT ON IFN-GAMMA AND CXCR3 LIGANDS. CANCER RES 68 8437-8445 (2008). 81. RAPPERT, A. ET AL. CXCR3-DEPENDENT MICR OGLIAL RECRUITMENT IS ESSENTIAL FOR DENDRITE LOSS AFTER BRAIN LESION. J NEUROSCI 24, 8500-8509 (2004). 82. WENZEL, J. ET AL. TYPE I INTERFERON-ASSOCI ATED RECRUITMENT OF CYTOTOXIC LYMPHOCYTES: A COMMO N MECHANISM IN REGRESSIVE MELANOCYTIC LESIONS. AM J CLIN PATHOL 124 37-48 (2005). 83. CHU, Y. ET AL. IN SITU EXPRESSION OF IFN-GAMMA-INDUCIBLE T CELL ALPHA CHEMOATTRACTANT IN BREAST CANCER MOUNTS AN ENHANCED SPECIFIC ANTI-TUMOR IM MUNITY WHICH LEADS TO TUMOR REGRESSION. CANCER IMMUNOL IMMUNOTHER 56 1539-1549 (2007). 84. HENSBERGEN, P.J. ET AL. THE CXCR3 TARGETING CHEMOKINE CXCL11 HAS POTENT ANTITUMOR ACTIVITY IN VIVO INVOLVING ATTRACTION OF

PAGE 103

103 CD8+ T LYMPHOCYTES BUT NOT INHIBITION OF ANGIOGENESIS. J IMMUNOTHER 28, 343-351 (2005). 85. ZIPIN-ROITMAN, A., ET AL. CXCL10 PROMOTES INVASION-RELATED PROPERTIES IN HUMAN COLORECTAL CARCINOMA CELLS. CANCER RES 67, 3396-3405 (2007). 86. SGADARI, C. ET AL. INTERFERON-INDUCIBLE PR OTEIN-10 IDENTIFIED AS A MEDIATOR OF TUMOR NECROSIS IN VIVO. PROC NATL ACAD SCI U S A 93, 13791-13796 (1996). 87. SGADARI, C. ET AL. MIG, THE MONOKINE INDUCED BY INTERFERONGAMMA, PROMOTES TUMOR NECROSIS IN VIVO. BLOOD 89, 2635-2643 (1997). 88. PETRAI, I. ET AL. ACTIVATION OF P38(MAPK) MEDIATES THE ANGIOSTATIC EFFECT OF THE CHE MOKINE RECEPTOR CXCR3-B. INT J BIOCHEM CELL BIOL 40, 1764-1774 (2008). 89. PELLEGATTA, S. ET AL. NEUROSPHERES ENRICH ED IN CANCER STEMLIKE CELLS ARE HIGHLY EFFECTIVE IN ELICITING A DENDRITIC CELLMEDIATED IMMUNE RESPONSE AGAINST MALIGNANT GLIOMAS. CANCER RES 66, 10247-10252 (2006). 90. KOSHIBA, T. ET AL. EXPRESSION OF STROMAL CELL-DERIVED FACTOR 1 AND CXCR4 LIGAND RECEPTOR SYST EM IN PANCREATIC CANCER: A POSSIBLE ROLE FOR TUMOR PROGRESSION. CLIN CANCER RES 6 35303535 (2000). 91. ZEELENBERG, I.S., RUULS-VAN STAL LE, L. & ROOS, E. THE CHEMOKINE RECEPTOR CXCR4 IS REQUIRED FOR OUTGROWTH OF COLON CARCINOMA MICROMETASTASES. CANCER RES 63, 3833-3839 (2003). 92. HALL, J.M. & KORACH, K.S. STRO MAL CELL-DERIVED FACTOR 1, A NOVEL TARGET OF ESTROGEN RECEPTOR ACTION, MEDIATES THE MITOGENIC EFFECTS OF ESTRADIOL IN OVAR IAN AND BREAST CANCER CELLS. MOL ENDOCRINOL 17, 792-803 (2003). 93. BERTOLINI, F. ET AL. CXCR4 NEUTRALIZATION, A NOVEL THERAPEUTIC APPROACH FOR NON-HO DGKIN'S LYMPHOMA. CANCER RES 62, 31063112 (2002). 94. BARBERO, S. ET AL. STROMAL CELL-DERIVED FACTOR 1ALPHA STIMULATES HUMAN GLIOBLASTOMA CELL GROWTH THROUGH THE ACTIVATION OF BOTH EXTRACELLULAR SIGNAL-REGULATED KINASES 1/2 AND AKT. CANCER RES 63 1969-1974 (2003).

PAGE 104

104 95. BONAVIA, R. ET AL. CHEMOKINES AND THEIR RE CEPTORS IN THE CNS: EXPRESSION OF CXCL12/SDF-1 A ND CXCR4 AND THEIR ROLE IN ASTROCYTE PROLIFERATION. TOXICOL LETT 139 181-189 (2003). 96. RUBIN, J.B. ET AL. A SMALL-MOLECULE ANTAGON IST OF CXCR4 INHIBITS INTRACRANIAL GROWTH OF PRIMARY BRAIN TUMORS. PROC NATL ACAD SCI U S A 100 13513-13518 (2003). 97. SCHULLER, U. ET AL. SUBTYPE-SPECIFIC EXPRESSION AND GENETIC ALTERATIONS OF THE CHEMOKIN ERECEPTOR GENE CXCR4 IN MEDULLOBLASTOMAS. INT J CANCER 117 82-89 (2005). 98. LUKER, K.E. & LUKER, G.D. FUNCTIONS OF CXCL12 AND CXCR4 IN BREAST CANCER. CANCER LETT 238 30-41 (2006). 99. KIM, S.Y. ET AL. INHIBITION OF THE CXCR4/CXCL12 CHEMOKINE PATHWAY REDUCES THE DEVELOPMENT OF MURINE PULMONARY METASTASES. CLIN EXP METASTASIS 25 201-211 (2008). 100. STEVENSON, C.B. ET AL. CXCR4 EXPRESSION IS ELEVATED IN GLIOBLASTOMA MULTIFORME AND CO RRELATES WITH AN INCREASE IN INTENSITY AND EXTENT OF PERITUM ORAL T2-WEIGHTED MAGNETIC RESONANCE IMAGING SIGNAL ABNORMALITIES. NEUROSURGERY 63 560-569; DISCUSSION 569-570 (2008). 101. YANG, L. ET AL. BLOCKING CXCR4-MEDIATED CYCLIC AMP SUPPRESSION INHIBITS BRAI N TUMOR GROWTH IN VIVO. CANCER RES 67, 651-658 (2007). 102. WU, M. ET AL. LRRC4 INHIBITS HUMAN GLIOBLASTOMA CELLS PROLIFERATION, INVASION, AND PRO MMP-2 ACTIVATION BY REDUCING SDF-1 ALPHA/CXCR4-MEDIATED ERK1/2 AND AKT SIGNALING PATHWAYS. J CELL BIOCHEM 103 245-255 (2008). 103. NEUHAUS, T. ET AL. STROMAL CELL-DERIVED FACTOR 1ALPHA (SDF1ALPHA) INDUCES GENE-EXPRESSION OF EARLY GROWTH RESPONSE-1 (EGR-1) AND VEGF IN HUMAN ARTERIAL ENDOTHELIAL CELLS AND ENHANCES VEGF INDUCED CELL PROLIFERATION. CELL PROLIF 36, 75-86 (2003). 104. KANDA, S., MOCHIZUKI, Y. & KANE TAKE, H. STROMAL CELL-DERIVED FACTOR-1ALPHA INDUCES TUBE-LI KE STRUCTURE FORMATION OF ENDOTHELIAL CELLS THROUGH PHOSPHOINOSITIDE 3-KINASE. J BIOL CHEM 278 257-262 (2003). 105. SALCEDO, R. & OPPENHEIM, J.J. ROLE OF CHEMOKINES IN ANGIOGENESIS: CXCL12/SDF-1 A ND CXCR4 INTERACTION, A KEY

PAGE 105

105 REGULATOR OF ENDOTHELIAL CELL RESPONSES. MICROCIRCULATION 10, 359-370 (2003). 106. GULENG, B. ET AL. BLOCKADE OF THE STROMAL CELL-DERIVED FACTOR-1/CXCR4 AXIS ATTENUAT ES IN VIVO TUMOR GROWTH BY INHIBITING ANGIOGENE SIS IN A VASCULAR ENDOTHELIAL GROWTH FACTOR-INDEPENDENT MANNER. CANCER RES 65, 5864-5871 (2005). 107. BURNS, J.M. ET AL. A NOVEL CHEMOKINE RECEPTOR FOR SDF-1 AND ITAC INVOLVED IN CELL SURVIVAL CELL ADHESION, AND TUMOR DEVELOPMENT. J EXP MED 203 2201-2213 (2006). 108. LUKER, K.E., STEELE, J.M., MI HALKO, L.A., RAY, P. & LUKER, G.D. CONSTITUTIVE AND CHEMO KINE-DEPENDENT INTERNALIZATION AND RECYCLING OF CXCR7 IN BREAST CANCER CELLS TO DEGRADE CHEMOKINE LIGANDS. ONCOGENE 29, 4599-4610 (2010). 109. MIAO, Z. ET AL. CXCR7 (RDC1) PROMOTES BREAST AND LUNG TUMOR GROWTH IN VIVO AND IS EXPRESSED ON TUMOR-ASSOCIATED VASCULATURE. PROC NATL ACAD SCI U S A 104 15735-15740 (2007). 110. CALATOZZOLO, C. ET AL. EXPRESSION OF THE NEW CXCL12 RECEPTOR, CXCR7, IN GLIOMAS. CANCER BIOL THER 11, 242-253 (2011). 111. HATTERMANN, K. ET AL. THE CHEMOKINE RECEPTOR CXCR7 IS HIGHLY EXPRESSED IN HUMAN GLIOMA CELLS AND MEDIATES ANTIAPOPTOTIC EFFECTS. CANCER RES 70, 3299-3308 (2010). 112. TORISAWA, Y.S., ET AL. MICROFLUIDIC PLATFORM FOR CHEMOTAXIS IN GRADIENTS FORMED BY CXCL12 SOURCE-SINK CELLS. INTEGR BIOL (CAMB) 2 680-686 (2010). 113. TARNOWSKI, M. ET AL. CXCR7: A NEW SDF-1BINDING RECEPTOR IN CONTRAST TO NORMAL CD34(+) PROGE NITORS IS FUNCTIONAL AND IS EXPRESSED AT HIGHER LEVEL IN HUMAN MALIGNANT HEMATOPOIETIC CELLS. EUR J HAEMATOL 85, 472-483 (2010). 114. MARJON, P.L., BOBROVNIKOVA-MA RJON, E.V. & ABCOUWER, S.F. EXPRESSION OF THE PRO-ANGIOGENIC FACTORS VASCULAR ENDOTHELIAL GROWTH FACTOR A ND INTERLEUKIN-8/CXCL8 BY HUMAN BREAST CARCINOMAS IS RESPONSIVE TO NUTRIENT DEPRIVATION AND ENDOPLASMIC RETICULUM STRESS. MOL CANCER 3 4 (2004). 115. PAYNE, A.S. & CORNELIUS, L.A. THE ROLE OF CHEMOKINES IN MELANOMA TUMOR GROW TH AND METASTASIS. J INVEST DERMATOL 118 915-922 (2002).

PAGE 106

106 116. NISHIE, A. ET AL. MACROPHAGE INFILTRATION AND HEME OXYGENASE1 EXPRESSION CORRELATE WITH AN GIOGENESIS IN HUMAN GLIOMAS. CLIN CANCER RES 5 1107-1113 (1999). 117. KOCH, A.E. ET AL. INTERLEUKIN-8 AS A MACROPHAGE-DERIVED MEDIATOR OF ANGIOGENESIS. SCIENCE 258 1798-1801 (1992). 118. STRIETER, R.M. ET AL. INTERLEUKIN-8. A CORNEAL FACTOR THAT INDUCES NEOVASCULARIZATION. AM J PATHOL 141 1279-1284 (1992). 119. LI, A., DUBEY, S., VARNEY, M.L., DAVE, B.J. & SINGH, R.K. IL-8 DIRECTLY ENHANCED ENDOTHELIAL CELL SU RVIVAL, PROLIFERATION, AND MATRIX METALLOPROTEINASES PRODUCTION AND REGULATED ANGIOGENESIS. J IMMUNOL 170 3369-3376 (2003). 120. LI, A. ET AL. AUTOCRINE ROLE OF INTERLEUKIN-8 IN INDUCTION OF ENDOTHELIAL CELL PROLIFERATION, SURVIVAL, MIGRATION AND MMP-2 PRODUCTION AND ANGIOGENESIS. ANGIOGENESIS 8 63-71 (2005). 121. YONEDA, J., ET AL. EXPRESSION OF ANGIOGE NESIS-RELATED GENES AND PROGRESSION OF HUMAN OVARIAN CARCINOMAS IN NUDE MICE. J NATL CANCER INST 90, 447-454 (1998). 122. BENOY, I.H. ET AL. INCREASED SERUM INTERL EUKIN-8 IN PATIENTS WITH EARLY AND METASTATIC BR EAST CANCER CORRELATES WITH EARLY DISSEMINATION AND SURVIVAL. CLIN CANCER RES 10, 7157-7162 (2004). 123. AALINKEEL, R. ET AL. GENE EXPRESSION OF ANGIOGENIC FACTORS CORRELATES WITH METASTATIC PO TENTIAL OF PROSTATE CANCER CELLS. CANCER RES 64, 5311-5321 (2004). 124. MULLER, A. ET AL. INVOLVEMENT OF CHEMOKINE RECEPTORS IN BREAST CANCER METASTASIS. NATURE 410 50-56 (2001). 125. WILEY, H.E., GONZALEZ, E.B., MAKI, W., WU, M.T. & HWANG, S.T. EXPRESSION OF CC CHEMOKINE RE CEPTOR-7 AND REGIONAL LYMPH NODE METASTASIS OF B16 MURINE MELANOMA. J NATL CANCER INST 93, 1638-1643 (2001). 126. GUNTHER, K. ET AL. PREDICTI ON OF LYMPH NODE METASTASIS IN COLORECTAL CARCINOMA BY EXPRESS IONOF CHEMOKINE RECEPTOR CCR7. INT J CANCER 116 726-733 (2005). 127. MASHINO, K. ET AL. EXPRESSION OF CHEMOKINE RECEPTOR CCR7 IS ASSOCIATED WITH LYMPH NODE META STASIS OF GASTRIC CARCINOMA. CANCER RES 62, 2937-2941 (2002).

PAGE 107

107 128. DING, Y. ET AL. ASSOCIATION OF CC CHEMOKINE RECEPTOR 7 WITH LYMPH NODE METASTASIS OF ESOPHAGEAL SQUAMOUS CELL CARCINOMA. CLIN CANCER RES 9 3406-3412 (2003). 129. MIZUKAMI, Y. ET AL. CCL17 AND CCL22 CHEMOKINES WITHIN TUMOR MICROENVIRONMENT ARE RELATED TO ACCUMULATION OF FOXP3+ REGULATORY T CELLS IN GASTRIC CANCER. INT J CANCER 122 22862293 (2008). 130. JORDAN, J.T. ET AL. PREFERENTIAL MIGRATION OF REGULATORY T CELLS MEDIATED BY GLIOMA-SECRETED CHEMOKINES CAN BE BLOCKED WITH CHEMOTHERAPY. CANCER IMMUNOL IMMUNOTHER 57 123-131 (2008). 131. TAN, M.C. ET AL. DISRUPTION OF CCR5-DEPENDENT HOMING OF REGULATORY T CELLS INHIBITS TU MOR GROWTH IN A MURINE MODEL OF PANCREATIC CANCER. J IMMUNOL 182 1746-1755 (2009). 132. LEE, J., ET AL. TUMOR STEM CELLS DERIVED FROM GLIOBLASTOMAS CULTURED IN BFGF AND EGF MORE CLOSELY MIRROR THE PHENOTYPE AND GENOTYPE OF PRIMARY TUMO RS THAN DO SERUM-CULTURED CELL LINES. CANCER CELL 9 391-403 (2006). 133. VIK-MO, E.O. ET AL. BRAIN TUMOR STEM CELLS MAINTAIN OVERALL PHENOTYPE AND TUMORIGENICITY AFTER IN VITRO CULTURING IN SERUM-FREE CONDITIONS. NEURO ONCOL 12, 1220-1230 (2010). 134. MARTINEZ, R., ROHDE, V. & SCHA CKERT, G. DIFFERENT MOLECULAR PATTERNS IN GLIOBLASTOMA MULTIFORME SUBTYPES UPON RECURRENCE. J NEUROONCOL 96, 321-329 (2010). 135. AUSMAN, J.I., SHAPIRO, W.R. & RALL, D.P. STUDIES ON THE CHEMOTHERAPY OF EXPERIMENTAL BR AIN TUMORS: DEVELOPMENT OF AN EXPERIMENTAL MODEL. CANCER RES 30, 2394-2400 (1970). 136. JUNG, S. ET AL. ANALYSIS OF FRACTALKINE RECEPTOR CX(3)CR1 FUNCTION BY TARGETED DELETION AND GREEN FLUORESCENT PROTEIN REPORTER GENE INSERTION. MOL CELL BIOL 20, 4106-4114 (2000). 137. HANCOCK, W.W. ET AL. REQUIREMENT OF THE CHEMOKINE RECEPTOR CXCR3 FOR ACUTE ALLOGRAFT REJECTION. J EXP MED 192 1515-1520 (2000). 138. VAN WANROOIJ, E.J. ET AL. CXCR3 ANTAGONIST NBI-74330 ATTENUATES ATHEROSCLEROTIC PLAQUE FORMATION IN LDL RECEPTOR-DEFICIENT MICE. ARTERIOSCLER T HROMB VASC BIOL 28, 251-257 (2008).

PAGE 108

108 139. SZATMARI, T. ET AL. DETAILED CHARACTERIZATION OF THE MOUSE GLIOMA 261 TUMOR MODEL FOR EXPERIMENTAL GLIOBLASTOMA THERAPY. CANCER SCI 97, 546-553 (2006). 140. HARRISON, J.K. ET AL. ROLE FOR NEURONALLY DERIVED FRACTALKINE IN MEDIATING INTERACTIONS BETWEEN NEURONS AND CX3CR1EXPRESSING MICROGLIA. PROC NATL ACAD SCI U S A 95, 10896-10901 (1998). 141. NISHIYORI, A. ET AL. LOCALIZATION OF FRACTALKINE AND CX3CR1 MRNAS IN RAT BRAIN: DOES FRACTALKINE PLAY A ROLE IN SIGNALING FROM NEURON TO MICROGLIA? FEBS LETT 429 167-172 (1998). 142. EL ANDALOUSSI, A., HAN, Y. & LESNIAK, M.S. PROLONGATION OF SURVIVAL FOLLOWING DEPLETION OF CD4+CD25+ REGULATORY T CELLS IN MICE WITH EXPE RIMENTAL BRAIN TUMORS. J NEUROSURG 105 430-437 (2006). 143. GRAUER, O.M. ET AL. CD4+FOXP3+ REGULATORY T CELLS GRADUALLY ACCUMULATE IN GLIOMAS DURING TUMOR GROWTH AND EFFICIENTLY SUPPRESS ANTIGLIOMA IMMUNE RESPONSES IN VIVO. INT J CANCER 121 95-105 (2007). 144. TUO, J. ET AL. MURINE CCL2/CX3CR1 DEFICIENCY RESULTS IN RETINAL LESIONS MIMICKING HUMAN AGE-RE LATED MACULAR DEGENERATION. INVEST OPHTHALMOL VIS SCI 48, 3827-3836 (2007). 145. HUANG, D. ET AL. THE NEURONAL CHEMOKINE CX3CL1/FRACTALKINE SELECTIVELY RECRUITS NK CELLS THAT MODIFY EXPERIMENTAL AUTOIMMUNE ENCEPHALOMYELITIS WITHIN THE CENTRAL NERVOUS SYSTEM. FASEB J 20, 896-905 (2006). 146. TEICHER, B.A. TRANSFORMING GROWTH FACTOR-BETA AND THE IMMUNE RESPONSE TO MALIGNANT DISEASE. CLIN CANCER RES 13, 6247-6251 (2007). 147. TRAN, T.T., ET AL. INHIBITING TGF-BETA S IGNALING RESTORES IMMUNE SURVEILLANCE IN THE SMA-560 GLIOMA MODEL. NEURO ONCOL 9 259270 (2007). 148. SAMUELS, V., BARRETT, J.M., BOCKMA N, S., PANTAZIS, C.G. & ALLEN, M.B., JR. IMMUNOCYTOCHEMICAL STUDY OF TRANSFORMING GROWTH FACTOR EXPRESSION IN BENIGN AND MALIGNANT GLIOMAS. AM J PATHOL 134 894-902 (1989). 149. BODMER, S. ET AL. IMMUNOSUPPRESSION AND TRANSFORMING GROWTH FACTOR-BETA IN GLIOBLASTO MA. PREFERENTIAL

PAGE 109

109 PRODUCTION OF TRANSFORMING GROWTH FACTOR-BETA 2. J IMMUNOL 143 3222-3229 (1989). 150. KIEFER, R., SUPLER, M.L., TOYKA, K.V. & STREIT, W.J. IN SITU DETECTION OF TRANSFORMING GROWTH FACT OR-BETA MRNA IN EXPERIMENTAL RAT GLIOMA AND REACTIVE GLIAL CELLS. NEUROSCI LETT 166 161-164 (1994). 151. CHEN, S., LUO, D., STREIT, W. J. & HARRISON, J.K. TGF-BETA1 UPREGULATES CX3CR1 EXPRESSION AND INHIBITS FRACTALKINESTIMULATED SIGNALIN G IN RAT MICROGLIA. J NEUROIMMUNOL 133 4655 (2002). 152. HUSSAIN, S.F., ET AL. THE ROLE OF HUMAN GLIOMA-INFILTRATING MICROGLIA/MACROPHAGES IN ME DIATING ANTITUMOR IMMUNE RESPONSES. NEURO ONCOL 8 261-279 (2006). 153. HUSSAIN, S.F., YANG, D., SUKI, D. GRIMM, E. & HEIMBERGER, A.B. INNATE IMMUNE FUNCTIONS OF MI CROGLIA ISOLATED FROM HUMAN GLIOMA PATIENTS. J TRANSL MED 4 15 (2006). 154. ZUJOVIC, V., BENAVIDES, J., V IGE, X., CARTER, C. & TAUPIN, V. FRACTALKINE MODULATES TNF-ALPHA SECRETION AND NEUROTOXICITY INDUCED BY MICROGLIAL ACTIVATION. GLIA 29, 305-315 (2000). 155. LIU, C., LUO, D., STREIT, W.J. & HARRISON, J.K. CX3CL1 AND CX3CR1 IN THE GL261 MURINE MODEL OF GLIO MA: CX3CR1 DEFICIENCY DOES NOT IMPACT TUMOR GROWTH OR INFI LTRATION OF MICROGLIA AND LYMPHOCYTES. J NEUROIMMUNOL 198 98-105 (2008). 156. JOPLING, L.A. ET AL. ANALYSIS OF THE PHARMACOKINETIC/PHARMACODYNAMI C RELATIONSHIP OF A SMALL MOLECULE CXCR3 ANTAGONIST, NBI74330, USING A MURINE CXCR3 INTERNALIZATION ASSAY. BR J PHARMACOL 152 1260-1271 (2007). 157. HEISE, C.E. ET AL. PHARMACOLOGICAL CHARACTERIZATION OF CXC CHEMOKINE RECEPTOR 3 LIGA NDS AND A SMALL MOLECULE ANTAGONIST. J PHARMACOL EXP THER 313 1263-1271 (2005). 158. DE WITT HAMER, P.C. ET AL. THE GENOMIC PROFILE OF HUMAN MALIGNANT GLIOMA IS ALTERED EARL Y IN PRIMARY CELL CULTURE AND PRESERVED IN SPHEROIDS. ONCOGENE 27, 2091-2096 (2008). 159. LASAGNI, L. ET AL. AN ALTERNATIVELY SPLICED VARIANT OF CXCR3 MEDIATES THE INHIBITION OF ENDO THELIAL CELL GROWTH INDUCED BY IP-10, MIG, AND I-TAC, AND AC TS AS FUNCTIONAL RECEPTOR FOR PLATELET FACTOR 4. J EXP MED 197 1537-1549 (2003).

PAGE 110

110 160. CARR, D.J., WUEST, T. & ASH, J. AN INCREASE IN HERPES SIMPLEX VIRUS TYPE 1 IN THE ANTERIOR SEGMENT OF THE EYE IS LINKED TO A DEFICIENCY IN NK CELL INFILTRATION IN MICE DEFICIENT IN CXCR3. J INTERFERON CYTOKINE RES 28, 245-251 (2008). 161. JIANG, D. ET AL. REGULATION OF PULM ONARY FIBROSIS BY CHEMOKINE RECEPTOR CXCR3. J CLIN INVEST 114 291-299 (2004). 162. MULLER, M. ET AL. CXCR3 SIGNALING REDUCES THE SEVERITY OF EXPERIMENTAL AUTOIMMUNE ENC EPHALOMYELITIS BY CONTROLLING THE PARENCHYMAL DISTRIBUTION OF EFFECTOR AND REGULATORY T CELLS IN THE CENTRAL NERVOUS SYSTEM. J IMMUNOL 179 2774-2786 (2007). 163. VERZIJL, D. ET AL. NONCOMPETITIVE ANTA GONISM AND INVERSE AGONISM AS MECHANISM OF AC TION OF NONPEPTIDERGIC ANTAGONISTS AT PRIMATE AND RODENT CXCR3 CHEMOKINE RECEPTORS. J PHARMACOL EXP THER 325 544-555 (2008). 164. KIM, J.V. ET AL. TWO-PHOTON LASER SCA NNING MICROSCOPY IMAGING OF INTACT SPINAL CORD AND CEREBRAL CORTEX REVEALS REQUIREMENT FOR CXCR6 AND NEUROIN FLAMMATION IN IMMUNE CELL INFILTRATION OF CORTICAL INJURY SITES. J IMMUNOL METHODS 352 89-100 (2010). 165. CROSS, A.K. & WOODROOFE, M. N. CHEMOKINES INDUCE MIGRATION AND CHANGES IN ACTIN POLYMERIZATION IN ADULT RAT BRAIN MICROGLIA AND A HUMAN FETAL MI CROGLIAL CELL LINE IN VITRO. J NEUROSCI RES 55, 17-23 (1999). 166. KOHLER, R.E. ET AL. ANTAGONISM OF THE CHEMOKINE RECEPTORS CXCR3 AND CXCR4 REDUCES TH E PATHOLOGY OF EXPERIMENTAL AUTOIMMUNE ENCEPHALOMYELITIS. BRAIN PATHOL 18, 504-516 (2008). 167. BALASHOV, K.E., ROTTM AN, J.B., WEINER, H.L. & HANCOCK, W.W. CCR5(+) AND CXCR3(+) T CELLS ARE INCREA SED IN MULTIPLE SCLEROSIS AND THEIR LIGANDS MIP-1ALPHA A ND IP-10 ARE EXPRESSED IN DEMYELINATING BRAIN LESIONS. PROC NATL ACAD SCI U S A 96, 68736878 (1999). 168. HIROI, M. & OHMORI, Y. CONS TITUTIVE NUCLEAR FACTOR KAPPAB ACTIVITY IS REQUIRED TO EL ICIT INTERFERON-GAMMA-INDUCED EXPRESSION OF CHEMOKINE CXC LIGAND 9 (CXCL9) AND CXCL10 IN HUMAN TUMOUR CELL LINES. BIOCHEM J 376 393-402 (2003). 169. EHLERT, J.E., ADDISON, C.A., BURDICK, M.D., KU NKEL, S.L. & STRIETER, R.M. IDENTIFICATION AND PARTIAL CHARACTERIZATION OF A VARIANT

PAGE 111

111 OF HUMAN CXCR3 GENERATED BY POSTTRANSCRIPTIONAL EXON SKIPPING. J IMMUNOL 173 6234-6240 (2004). 170. XANTHOU, G., DUCHESNES, C.E., WI LLIAMS, T.J. & PEASE, J.E. CCR3 FUNCTIONAL RESPONSES ARE REGULATED BY BOTH CXCR3 AND ITS LIGANDS CXCL9, CX CL10 AND CXCL11. EUR J IMMUNOL 33, 2241-2250 (2003). 171. PETKOVIC, V., MOGHIN I, C., PAOLETTI, S., UGUCCION I, M. & GERBER, B. ITAC/CXCL11 IS A NATURAL ANTAGONIST FOR CCR5. J LEUKOC BIOL 76 701-708 (2004). 172. ZABEL, B.A. ET AL. ELUCIDATION OF CXCR7 -MEDIATED SIGNALING EVENTS AND INHIBITION OF CXCR4-MEDIATED TUMOR CELL TRANSENDOTHELIAL MIGRATION BY CXCR7 LIGANDS. J IMMUNOL 183 3204-3211 (2009). 173. SANCHEZ-AL CANIZ, J.A. ET AL. CXCR7 CONTROLS NEURONAL MIGRATION BY REGULATING CHEMOKINE RESPONSIVENESS. NEURON 69, 77-90 (2011). 174. LEVOYE, A., BALABANIAN, K., BALEUX, F., BACHELERIE, F. & LAGANE, B. CXCR7 HETERODIMERIZES WITH CXCR4 AND REGULATES CXCL12MEDIATED G PROTEIN SIGNALING. BLOOD 113 6085-6093 (2009). 175. PINNER, S. ET AL. INTRAVITAL IMAGING R EVEALS TRANSIENT CHANGES IN PIGMENT PRODUCTION AND BRN2 EXPRESSION DURING METASTATIC MELANOMA DISSEMINATION. CANCER RES 69, 7969-7977 (2009). 176. ROESCH, A. ET AL. A TEMPORARILY DISTI NCT SUBPOPULATION OF SLOW-CYCLING MELANOMA CELLS IS REQUIRED FOR CONTINUOUS TUMOR GROWTH. CELL 141 583-594 (2010). 177. SCHUTYSER, E. ET AL. HYPOXIA ENHANCES CXCR4 EXPRESSION IN HUMAN MICROVASCULAR ENDOTHELIA L CELLS AND HUMAN MELANOMA CELLS. EUR CYTOKINE NETW 18, 59-70 (2007). 178. TARNOWSKI, M. ET AL. REGULATION OF EXPRESSION OF STROMALDERIVED FACTOR-1 RECEPTORS: CXCR4 AND CXCR7 IN HUMAN RHABDOMYOSARCOMAS. MOL CANCER RES 8 1-14 (2010). 179. LIU, H. ET AL. HYPOXIC PRECONDITIONING ADVANCES CXCR4 AND CXCR7 EXPRESSION BY ACTIVATING HIF-1ALPHA IN MSCS. BIOCHEM BIOPHYS RES COMMUN 401 509-515 (2010). 180. SCIACCALUGA, M. ET AL. CXCL12-INDUCED GLIOBLASTOMA CELL MIGRATION REQUIRES INTERMEDIATE CONDUCTANCE CA2+-ACTIVATED K+ CHANNEL ACTIVITY. AM J PHYSIOL CELL PHYSIOL 299 C175-184 (2010).

PAGE 112

112 181. DO CARMO, A. ET AL. CXCL12/CXCR4 PROMOTES MOTILITY AND PROLIFERATION OF GLIOMA CELLS. CANCER BIOL THER 9 56-65 (2010). 182. EHTESHAM, M., MAPARA, K.Y., ST EVENSON, C.B. & THOMPSON, R.C. CXCR4 MEDIATES THE PROLIFERATION OF GLIOBLASTOMA PROGENITOR CELLS. CANCER LETT 274 305-312 (2009). 183. PETIT, I. ET AL. G-CSF INDUCES STEM CELL MOBILIZATION BY DECREASING BONE MARROW SDF-1 AND UP-REGULATING CXCR4. NAT IMMUNOL 3 687-694 (2002). 184. KUCIA, M. ET AL. TRAFFICKING OF NORMAL STEM CELLS AND METASTASIS OF CANCER STEM CELLS INVOLVE SIMILAR MECHANISMS: PIVOTAL ROLE OF TH E SDF-1-CXCR4 AXIS. STEM CELLS 23 879-894 (2005). 185. SUGIYAMA, T., KOHARA, H., NODA, M. & NAGASAWA, T. MAINTENANCE OF THE HEMATOPOIETIC STEM CELL POOL BY CXCL12-CXCR4 CHEMOKINE SIGNALING IN BONE MARROW STROMAL CELL NICHES. IMMUNITY 25, 977-988 (2006). 186. VIOLA, A. & LUSTER, A.D. CHE MOKINES AND THEIR RECEPTORS: DRUG TARGETS IN IMMUNITY AND INFLAMMATION. ANNU REV PHARMACOL TOXICOL 48, 171-197 (2008). 187. O'GARRA, A., MCEVOY, L.M. & ZLOT NIK, A. T-CELL SU BSETS: CHEMOKINE RECEPTORS GUIDE THE WAY. CURR BIOL 8 R646-649 (1998). 188. STANFORD, M.M. & ISSEKUTZ, T.B. THE RELATIVE ACTI VITY OF CXCR3 AND CCR5 LIGANDS IN T LYMPHOCY TE MIGRATION: CONCORDANT AND DISPARATE ACTIVITIES IN VITRO AND IN VIVO. J LEUKOC BIOL 74, 791-799 (2003). 189. LARRUBIA, J.R. ET AL. THE ROLE OF CCR5/CXCR3 EXPRESSING CD8+ CELLS IN LIVER DAMAGE AND VIRAL CONTROL DURING PERSISTENT HEPATITIS C VIRUS INFECTION. J HEPATOL 47, 632-641 (2007). 190. FLYNN, G., MARU, S., LOUGHL IN, J., ROMERO, I.A. & MALE, D. REGULATION OF CHEMOKINE RE CEPTOR EXPRESSION IN HUMAN MICROGLIA AND ASTROCYTES. J NEUROIMMUNOL 136 84-93 (2003). 191. LIANG, K.J. ET AL. REGULATION OF DYNAMI C BEHAVIOR OF RETINAL MICROGLIA BY CX3CR1 SIGNALING. INVEST OPHTHALMOL VIS SCI 50, 4444-4451 (2009). 192. SCHNICKEL, G.T. ET AL. COMBINED CXCR3/CCR5 BLOCKADE ATTENUATES ACUTE AND CHRONIC REJECTION. J IMMUNOL 180 47144721 (2008).

PAGE 113

113 193. AKSOY, M.O. ET AL. CXCR3 SURFACE EXPRESS ION IN HUMAN AIRWAY EPITHELIAL CELLS: CELL CYCLE DEPENDENCE AND EFFECT ON CELL PROLIFERATION. AM J PHYSIOL LUNG CELL MOL PHYSIOL 290 L909-918 (2006). 194. GASSER, O., SCHMID, T.A. ZENHAEUSERN, G. & HESS, C. CYCLOOXYGENASE REGULATES CE LL SURFACE EXPRESSION OF CXCR3/1-STORING GRANULES IN HUMAN CD4+ T CELLS. J IMMUNOL 177 8806-8812 (2006). 195. DELEYROLLE, L.P. ET AL. DETERMINATION OF SOMATIC AND CANCER STEM CELL SELF-RENEWING SYMMETRIC DIVISION RATE USING SPHERE ASSAYS. PLOS ONE 6 E15844 (2011).

PAGE 114

114 BIOGRAPHICAL SKETCH Che Liu was born in 1978 at Taipei, Taiw an. He developed a gr eat interest in nature and ecology in his junior high school. He graduated from National Taiwan University in 2000, where he received a Bac helor of Science degree in zoology. He came to the United States in 2005 to purs ue his dream of doing bi ological research. Che Liu enrolled the University of Florida in 2006 and jointed the lab of Dr. Jeffrey K. Harrison in the summer of 2007. During his PhD he was focused on studying the functions of chemokines and receptors in c ancers, and eventually dedicated himself into looking for potential cures for human glioblastoma. Che Liu was active in his academic career. He had participated in several national conferences and received awards from the McKnight Brain Institute and from the International Student Center at UF. His scientific discoveries had been published in two biomedical journals. In the future he will devote himself to helping the community and human society as a scientist by his research.