Modified Albumin Mesospheres Delivery Systems for Intratumoral Therapy of Lung Cancer

MISSING IMAGE

Material Information

Title:
Modified Albumin Mesospheres Delivery Systems for Intratumoral Therapy of Lung Cancer
Physical Description:
1 online resource (121 p.)
Language:
english
Creator:
Lee, Hung-Yen
Publisher:
University of Florida
Place of Publication:
Gainesville, Fla.
Publication Date:

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Materials Science and Engineering
Committee Chair:
Goldberg, Eugene P
Committee Members:
Batich, Christopher D
Baney, Ronald H
Brennan, Anthony B
Castellano, Ronald K
Mohammed, Kamal

Subjects

Subjects / Keywords:
arginine -- cancer -- chemotherapy -- cisplatin -- endobronchial -- epha2 -- ephrin-a1 -- intratumoral -- iols -- microspheres
Materials Science and Engineering -- Dissertations, Academic -- UF
Genre:
Materials Science and Engineering thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract:
Lung cancer is the leading cause of cancer death in the whole world. To improve the efficacy of lung cancer treatment, one new procedure, endobronchial intratumoral chemotherapy (EITC), has been explored clinically in recent years. This technique has shown remarkable efficacy in reducing tumor burden and less complications of systemic toxicity combined. To further improve the effectiveness of intratumoral chemotherapy, various drug loaded albumin-based nano-meso-microspheres were designed here to prolong localized high concentrations of drugs and minimize any risk of systemic toxicity. In this report, three different kinds of delivery systems based on albumin microspheres were designed and prepared to kill lung cancer cells in three different approaches. In the first approach, the antitumor protein, ephrin-A1, as conjugated and loaded with the albumin mesospheres (AMS) for the first time for localized protein therapy. The functions of ephrin-A1 on inhibiting tumor growth were highly maintained after the conjugation. Cisplatin is one of the most commonly used metal-based chemotherapeutic drugs in cancer treatment; however, the low solubility of cisplatin in aqueous solution limits its efficacy and applications. In the second approach, the albumin based microspheres loaded with high cisplatin content (16% w/w) were prepared by a post-loading method and, most importantly, the toxicity of cisplatin fully remained after the loading process. In the third approach, the arginine/albumin mesospheres were synthesized as an antitumor agent since arginine has been reported to inhibit growth of cancer cells. The arginine/albumin microspheres showed a constant inhibiting effect on tumor growth. The arginine/albumin mesospheres are able to provide a prolonged high concentration of arginine in the microenvironment and minimize the undesired diffusion through systemic circulation. Moreover, the arginine-rich domains on the surface of microspheres are expected to kill cancer cells effectively as the arginine clusters. Studies in this dissertation provide the ideal methods to prepare the protein conjugated, metal-based drug loaded and functionally modified albumin microspheres. The data provides a promising foundation for future in vivo or clinical studies in lung cancer treatment. Furthermore, this work shows that albumin-based meso-microspheres have a promising potential to be widely applied into various kinds of treatments requiring targeted delivery.
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility:
by Hung-Yen Lee.
Thesis:
Thesis (Ph.D.)--University of Florida, 2012.
Local:
Adviser: Goldberg, Eugene P.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2013-08-31

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
lcc - LD1780 2012
System ID:
UFE0042824:00001


This item is only available as the following downloads:


Full Text

PAGE 1

1 MODIFIED ALBUMIN MESOSPHERES DELIVERY SYSTEMS FOR IN TRATUMORAL THERAPY OF LUNG CANCER By HUNG YEN LEE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012

PAGE 2

2 2012 Hung Yen Lee

PAGE 3

3 To my parents S zu Chuan Lee and Yi Ping Shang Kuan for their unconditional love and support throughout my entire academic career

PAGE 4

4 ACKNOWLEDGMENTS First, I would like to thank my advisor and committee chair, Dr. Eugene P. Goldberg for his knowledge, guidance, support and patience in all these years. He gave me the opportunity to pursue my PhD at UF and the encouragements on my research all the times. I woul d also like to thank my committee members, Dr. Kamal A. Mohammed, Dr. Anthony Brennan, Dr. Christopher Batich, Dr. Ronald Baney and Dr. Ronald K. Castellano for their guidance and advice. I would like to especially thank Dr. Kamal A. Mohammed and Dr. Nasr een Najmunnisa at department of medicine for their knowledge and guidance on all the biological experiments in t his work and also their care I also would like to thank Dr. Anthony Brennan for his occasional advices and r eminding of safety in the lab. Additionally I wish to acknowledge the following colleagues : Dr. Mohammed research group: Dr. BhagyaLaxmi Sukka Ganesh, Dr. Nazli Irani and Zita Burkhalter for their help and guidance on my experiments and their occasional laughter in the lab; Dr. Goldber g research group members past: Dr. Amin Elachchabi, Dr. Iris V. Enriquez, Dr. Samesha R. Barnes and Dr. Shema T. Freem an for their guidance and mentoring during m y first few years at this group. I would also like to thank Pa ul J. Martin for his help on my research in many areas I would also like to thank our administrative assistant, Jennifer L. Wrighton, for her immeasurable help with all kinds of questions I had during my whole graduate student life I woul d like to thank my parents for their uncondition al love and never ending moral and financial support throughout my education in the United State. I would like to thank my grandma for her delicate care in my childhood and through out all these years. I would like to thank my brother for his overseas suppo rt and encourage I would lik e to

PAGE 5

5 thank all my family and friends for their love and support. Especially thank to Dr. Steve Lin and Mrs. Lin for their generous care and guidance on profession and everything else in these years.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 14 CH A PTER 1 O VERVIEW ................................ ................................ ................................ ............ 16 Summary of Specific Aims ................................ ................................ ...................... 17 Study 1. Targeted Lung Cancer Therapy Using Ephrin A1 Loaded Albumin Mesospheres. ................................ ................................ ................................ ...... 18 Study 2. Cisplatin Loaded Microspheres for Lung Cancer Treatment. .................... 18 Study 3. Inhibition of Lung Cancer Tumor Growth by Arginine Incorporated Albumin Microspheres. ................................ ................................ ........................ 18 2 B ACKGROUND ................................ ................................ ................................ ...... 19 Lung Cancer ................................ ................................ ................................ ........... 19 Non Small Cell Lung Cancer (NSCLC) ................................ ............................ 19 Conventional Treatments for NSCLC ................................ ............................... 20 Intratumoral (IT) Chemotherapy ................................ ................................ .............. 22 Drawbacks o f Conventional Chemotherapy ................................ ..................... 22 IT Chemotherapy ................................ ................................ .............................. 22 Drug Loaded Albumin Microspheres for Cancer Treatment ................................ .... 23 Synthesis of Albumin Microspheres (AMS) ................................ ...................... 24 Loading Efficacy of AMS ................................ ................................ .................. 25 Release Behavio r of Loading Drugs from AMS. ................................ ............... 25 3 A RGETED LUNG CANCER THERAPY USING EPHRIN A1 LOADED ALBUMIN MICROSPHERES ................................ ................................ .................. 28 Introduction ................................ ................................ ................................ ............. 29 Protein Delivery ................................ ................................ ................................ 29 EphA2 Regulation in Cancers ................................ ................................ .......... 30 EphrinA1 Conjug ated Albumin Microspheres (AMS) ................................ ........ 30 Materials and Methods ................................ ................................ ............................ 31 Cell Lines and Reagents ................................ ................................ .................. 31

PAGE 7

7 Synthesis of BSA mesospheres (AMS) ................................ ............................ 31 Ephrin A1 Loading on AMS (EphrinA1 MS) ................................ ..................... 32 Particle Size Distributio n of AMS ................................ ................................ ...... 32 Surface Morphology of EphrinA1 MS ................................ ............................... 33 Cytotoxicity and Phagocytosis of AMS by A549 ................................ ............... 33 In Vitro Release Rate and Loading Efficiency of Ephrin A1 on AMS ................ 33 Western Blot Analysis ................................ ................................ ...................... 34 Ce ll Migration Assay ................................ ................................ ......................... 35 Three Dimensional Tumor Growth Assay ................................ ......................... 35 Results ................................ ................................ ................................ .................... 36 Synthesized AMS with Narrowed Size Distribution in Meso scale ................... 36 Low Cytotoxicity and High Phagocytosis of AMS ................................ ............. 36 Stabl e Conjugation between Ephrin A1 and AMS ................................ ............ 37 Release Rate of Ephrin A1 from Microspheres ................................ ................ 37 EphrinA1 MS Inhibited the FAK Expressi on and Cell Migration of NSCLC Cells ................................ ................................ ................................ .............. 38 EphrinA1 MS Inhibited Tumor Growth of NSCLC Cells ................................ .... 38 Discussion ................................ ................................ ................................ .............. 39 4 C ISPLATIN LOADED ALBUMIN MICROSPHERES ................................ ............... 50 Introduction ................................ ................................ ................................ ............. 51 Cisplatin ................................ ................................ ................................ ............ 51 Cisplatin in Solvent ................................ ................................ ........................... 52 Drug Delivery Systems for Cisplatin ................................ ................................ 53 Albumin Micros pheres for Cisplatin Delivery ................................ .................... 54 Effects of Polysaccharides to Cisplatin Loading ................................ ............... 54 Materials and Methods ................................ ................................ ............................ 55 Synthesis of Albumin Microspheres and Modified Albumin Microspheres ........ 55 Post loading of Cisplatin ................................ ................................ ................... 55 Measurement of Loading Efficiency and Cisplatin Release Rate ..................... 57 Cytotoxicity of Cisplatin Loaded Microspheres ................................ ................. 58 Cytotoxicity of Cisplatin Released from Cisplatin Loaded Microspheres .......... 58 Results ................................ ................................ ................................ .................... 59 Albumin Microspheres Loaded with Cisplatin through DMSO (CDDP/DMSO AMS) ................................ ................................ ..................... 59 Modified Albumin Microspheres Loaded with Cisplatin ................................ .... 61 Discussion ................................ ................................ ................................ .............. 62 5 I NHIBITION OF LUNG CANCER TUMOR GROWTH BY ARGININE INCORPORATED ALBUMIN MICROSPHERES ................................ .................... 76 Introduction ................................ ................................ ................................ ............. 77 Arginine to Cancer Cells ................................ ................................ ................... 77 Arginine Albumin Microspheres ................................ ................................ ........ 78 Materials and Methods ................................ ................................ ............................ 79 Cell Lines and Reagents ................................ ................................ .................. 79

PAGE 8

8 Synthesis of L Arginine/BSA mesospheres (AAMS) ................................ ........ 79 Surface Morph ology and Zeta Potential of AAMS ................................ ............ 80 Proliferation Rate of Lung Cancer Cells Treated with AAMS ............................ 80 Wound Healing (Cell Migration) Assay ................................ ............................. 80 Three Dimensional Tumor Growth Assay ................................ ......................... 81 Real Time PCR Analysis ................................ ................................ .................. 81 Western Blot Analysis ................................ ................................ ...................... 82 Apoptotic DNA Ladder Analysis ................................ ................................ ....... 82 Results ................................ ................................ ................................ .................... 82 AAMS with Narrowed Size Distribution in Meso scale and Increased Zeta Potential ................................ ................................ ................................ ........ 82 The Inhibiting Effect of Free Arginine and AAMS on Proliferation .................... 83 AAMS Inhibited Cell Migration of Lung Cancer Cells ................................ ....... 84 AAMS Inhibited Growth of Lung Cancer Tumors ................................ .............. 84 AAMS Inhibited Cell Growth Mainly through Necrosis ................................ ...... 84 Discussion ................................ ................................ ................................ .............. 85 6 C ONCLUSION ................................ ................................ ................................ ...... 101 APPENDIX: S ILICONE OIL ADHESION ON INTRAOCULAR LENSES (IOLs) .......... 103 Introduction ................................ ................................ ................................ ........... 103 Materials and Methods ................................ ................................ .......................... 104 Results and Discussion ................................ ................................ ......................... 105 Conclusion ................................ ................................ ................................ ............ 106 LIST OF RE FERENCES ................................ ................................ ............................. 111 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 121

PAGE 9

9 LIST OF TABLES Tabl e page 4 1 Loading efficiency and cytotoxicity of CDDP MS loaded through DMSO. .......... 75 4 2 Loading content and efficiency of cisplatin in AMS and modified AMS. .............. 75 5 1 Primers used in quantitative reverse transcriptase PCR analysis. ..................... 99 5 2 Gene expression in cells treated with arginine, AAMS and AMS. ..................... 100 A 1 Silicone oil coverage on IOLs (%) ................................ ................................ ..... 110 A 2 Contact angle of silicone oil on IOLs in saline solution () ................................ 110

PAGE 10

10 LIST OF FIGURES Figure page 2 1 Biopsy specimen of non small and small cell lung cancer. ................................ 26 2 2 Schematic diagrams of lymphatic drainage. ................................ ....................... 26 2 3 Synthetic strategy of AMS. ................................ ................................ ................. 27 2 4 Imaginary AMS formation in molecular level. ................................ ..................... 27 3 1 Synthetic strategy of ephrin A1 conjugated AMS. ................................ .............. 43 3 2 Particle size distribution of AMS. ................................ ................................ ........ 43 3 3 Cytotoxicity of AM S. ................................ ................................ ........................... 44 3 4 Phagocytosis of AMS. ................................ ................................ ........................ 44 3 5 Optical photomicrograph of FITC labeled AMS. ................................ ................. 45 3 6 Stable conjugation between ephrin A1 and AMS. ................................ .............. 45 3 7 Surface morphology of SEM images of conjugated AMS. ................................ .. 46 3 8 Release rate of ephrin A1 from EphA1 MS. ................................ ....................... 46 3 9 FAK expression in Western Blot analysis. ................................ .......................... 47 3 10 Cell migration of A54 9 cells. ................................ ................................ ............... 48 3 11 Images of 3 dimensional tumor growth in Matrigel. ................................ ............ 49 4 1 Mechanism of action of cisplatin administrated intrave nously. ........................... 67 4 2 Complexation of cisplatin and carboxyl g roup from acrylic acid residues ........... 67 4 3 Chemical structure of polysacchari des ................................ ............................... 68 4 4 In vitro release rate of cisplatin from CDDP/DMSO AMS(0). .............................. 68 4 5 Cytotoxicity of cisplatin loaded albumin microsphere s before and after PBS wash. ................................ ................................ ................................ .................. 69 4 6 The cytotoxicity of cisplatin released out from the cisplatin loaded albumin microspheres (CDDP/DMSO AMS). ................................ ................................ ... 69 4 7 Release rate of cisplatin from cisplatin loaded microspheres. ............................ 70

PAGE 11

11 4 8 Release rate of cisplatin in PBS and 10 g/mL lysozyme solution. .................... 71 4 9 Cell proliferation of lung cancer cells treated with cisplatin loaded microspheres. ................................ ................................ ................................ ..... 72 4 10 Optical Images of cisplatin loaded albumin based microspheres. ...................... 74 5 1 Chemical structure of arginine. ................................ ................................ ........... 88 5 2 Particle size distribution of arginine/albumin microspheres(AAMS) in PBS. ....... 88 5 3 SEM images of arginine/albumin microspheres (AAMS) ................................ ... 88 5 4 Cell proliferation of A549 treated with free arginine, AMS and AAMS. ............... 89 5 5 Cell proliferation of CRL 2081 treated with free arginine, AMS and AAMS. ...... 90 5 6 Cell proliferation of LLC treated with free arginine, AMS and AAMS. ................. 91 5 7 Cell proliferation of MAK9 treated with free arginine, AMS and AAMS. .............. 92 5 8 Cell migration of A5 49 cells treated with arginine, AMS and AAMS. .................. 93 5 9 Cell migration of CRL 2081 cells trea ted with arginine, AMS and AAMS ........... 94 5 1 0 Cell migration of MAK9 treated with arginine, AMS and AAMS. ......................... 95 5 11 The microscopic photographs of A549 tumor growth in matrigel ...................... 96 5 12 The microscopic photographs of CRL 2081 tumor growth in matrigel ............... 97 5 13 Gel electrophoresis of apoptotic DNA ladder.. ................................ .................... 98 A 1 Immersing IOLs by using dip coater. ................................ ................................ 107 A 2 Frontal view of silicone oil covered IOLs in BSS. ................................ .............. 107 A 3 Effect of vortexing on silicone oil adhesion on IOLs. ................................ ........ 108 A 4 Side view of silicone oil covered IOLs in BSS. ................................ .................. 108 A 5 The chart of silicone oil coverage versus silicone oil contact angle on IOLs in BSS and water contact angle. ................................ ................................ .......... 109 A 6 Advancing water contact angle v ersus hydration measured up to four weeks 109

PAGE 12

12 LIST OF ABBREVIATION S AAMS Arginine/albumin microsphere s AMS Albumin microspheres (Bovine serum albumin) Arg Arginine BSA Bovine serum albumin CAB Cellul ose acetate butyrate CDDP Cisplatin DCE 1,2 dichloroethane DNA Deoxyribonucleic acid DMSO Dimethyl sulfoxide ELIFA Enzyme linked immunoflow assay EITC E ndobronchial intratumoral chemotherapy EphA1MS Ephrin A1 loaded albumin microsphere FAK Focal adhesion kinase FBS Fetal bovine serum FITC Fluorescein isothiocyanate FT IR Fourier Transform Infrared GTA Glutaraldehyde ICP AE S Inductively coupled plasma atomic emission spectroscopy IT Intratumoral IOLs Intraocular lens es LDH Lactate dehydrogenase LLC Lewis lu ng carcinoma MS Meso microsphere NSCLC Non small cell lung carcinoma (or cancer)

PAGE 13

13 OM Optical microscope PBS Phosphate buffered saline PEG Poly(ethylene glycol) RNA Ribonucleic acid SCLC Small cell lung cancer carcinoma (or cancer) SEM Scanning electron mic roscopy UV Ultraviolet

PAGE 14

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MODIFIED ALBUMIN MESOSPHERES DELIVERY SYSTEMS FOR INTRATUMORAL THERAPY OF LUNG CANCER By Hung-Yen Lee August 2012 Chair: Eugene P. Goldberg Major: Materials Science and Engineering Lung cancer is the leading cause of cancer death in the whole world. To improve the efficacy of lung cancer treatment, one new procedure, endobronchial intratumoral chemotherapy (EITC), has been explored clinically in recent years. This technique has shown remarkable efficacy in reducing tumor burden and less complications of systemic toxicity combined. To further improve the effectiveness of intratumoral chemotherapy, various drug loaded albumin-based nano-meso-microspheres were designed here to prolong localized high concentrations of drugs and minimize any risk of systemic toxicity. In this report, three different kinds of delivery systems based on albumin microspheres were designed and prepared to kill lung cancer cells in three different approaches. In the first approach, the antitumor protein, ephrin-A1, as conjugated and loaded with the albumin mesospheres (AMS) for the first time for localized protein therapy. The functions of ephrin-A1 on inhibiting tumor growth were highly maintained after the conjugation. Cisplatin is one of the most commonly used metal-based chemotherapeutic drugs in cancer treatment; however, the low solubility of cisplatin in aqueous solution limits its

PAGE 15

15 efficacy and applications. In the second approach, the albumin based microspheres loaded with high cisplatin content (16% w/w) were prepared by a post loading method and, most importantly the t oxicity of cisplatin fully remained after the loading process. In the third approach, the arginine/albumin meso sph e res were synthesized as an antitumor agent since arginine has been re ported to inhibit growth o f cancer cells. T he arginine/albumin microsph eres showed a constant inhibiting effect on tumor growth The a rginine/albumin mesosphe res are able to provide a prolonged high concentration of arginine in the microenvironment and minimize the undesired diffusion through systemic circulation Moreover, t he arginine rich domains on the surface of microspheres are expected to kill cancer cells effectively as the arginine clusters Studies in this dissertation provide the ideal methods to prepare the protein conjugated metal based drug loaded and functional ly modified albumin microspheres. The data provides a promising foundation for future in vivo or clinical studies in lung cancer treatment. Furthermore, this work shows that albumin based meso microspheres have a promising potential to be widely applied in to various kinds of treatments requiring targeted delivery.

PAGE 16

16 CHAPTER 1 OVERVIEW Albumin microspheres or nanos pheres have attracted attention from scientists and pharmacologists for their potential of being the ideal delivery carrier for drugs and biomole cules such as DNA, RNA, proteins and peptides. In the last two d ecades, a lot of researches have focused on the modifications of albumin microspheres which were designed to be loaded with drugs or biological agents for localized cancer treatment. Compared to the particles composed of other materials, the biggest advantage of albumin microsphere is that the abundant and various functional groups on the amino acid residues enable it to be easily modified or loaded with a variety of functional biomolecules. In addition, even albumin is a protein which is soluble in water, there are about 40% of the amino acids in albumin are hydrophobic. This implies that the albumin microsphere s contain both hydrophilic and hydropho bic domains in the matrix and offers a high p otential to load drugs or biomolecules with a wide range of hydrophobicity. Among all cancers, lung cancer is now the leading cause of cancer death. One new procedure, intratumoral (IT) chemotherapy, has been explored clinically in recent years to improve lung cancer treatment. Through an intratumoral injection directly to the solid tumor sites, the albumin particles loaded with antitumor agents can provide a prolonged localized release to achieve a local high concentration of antitumor agents for improvin g the efficiency of treatment and minimizing unnecessary systemic diffusion. To achieve this, albumin microspheres with various load ing agents and modifications have been studied to improve their efficacy to kill cancer cells. To develop an effective trea tment based on the albumin microspheres intratumoral delivery system, albumin microspheres have been designed and prepared in different

PAGE 17

17 approaches to effectively inhibit the proliferation of lung can cer cells in vitro. Our work here suggests three novel al bumin microspheres systems which were introduced to improve cancer treatment by different mechanisms. The first kind of albumin microspheres was conjugated with an antitumor protein which specifically targets cancer cells and inhibits the proliferation wit hout causing systemic toxicity. The second kind of albumin micros pheres was modified with other kinds of biopo lymers to enhance in metal based anticancer drug loading efficiency and thus to improve the efficacy of anticancer drug in clinical cancer treatme nt. In the last delivery system, albumin was composed with L arginine, a natural amino acid, to form a microspher e having antitumor effect, and which can also be used as the delivery carrier of other drugs for higher efficacy. T he effectiveness of these al bumin microspheres to lung cancer were demonstrated here, by these studies we can also understand more about (1) the ability of albumin microspheres to restore the function of loaded or conjugated protein, (2) the loading behavior of albumin based microsph eres to metal based drugs and the influence of carrier matrix to drug efficacy (3) the antitumor effect of highly positively charged surfaces on albumin microspheres. Summary of Specific Aims The purpose of this research was to investigate the in vitro ef fectiveness of these microspheres on killing lung cancer cells, and thus to provide a foundation for further in vivo and clinical studies. Several specific aims that need to be achieved in these studies are listed as follows:

PAGE 18

18 Study 1. Targeted Lung Cancer Therapy Using Ephrin A1 Loaded Albumin Mesospheres. The albumin microspheres were synthesized in the size range of 5 to 10 m and then chemically incorporated with an antitumor protein, ephrin A1, which targets only cancer cells. Aim 1 1 : Preparat ion of A lbumin Microspheres in the Size Range of 5 to 10 m. Aim 1 2 : Stable Conjugation between Ephri n A1 and Albumin Microspheres. Aim 1 3 : In Vitro Inhibiting Effects of Ephrin A1 Loaded Albumin Micros pheres on Proliferation of Non s mall Cell Lung Cancer Cells. Study 2. Cisplatin Loaded Microspheres for Lung Cancer Treatment. The albumin microspheres were post loaded with cisplatin through DMSO and modified with polysaccharides, such as chitosan and chondro i tin, to enhance the loading efficiency of cisplatin, and furthermore, retain the cytotoxicity of released cisplatin. Aim 2 1 : Enhancement of Cisplatin Loading Efficiency in Albu min Microspheres by using Post l oading Method s. Aim 2 2 : Synthesis and Characterization of Cisplatin Loaded Polysacch arides Modified Albumin Microsph eres. Aim 2 3 : In Vitro Effectiveness of Cisplatin Loaded Microspheres on Killing Lung Cancer Cells. Study 3. Inhibition of Lung Cancer Tumor Growth by Arginine Incorporated Albumin Microspheres. The microspheres were composed by albumin a nd arginine to act as an antitumor agent by localized arginine release and the arginine rich surfaces on microspheres presented in the local environment. Aim 3 1 : Preparation and Characterizations of Arginine/Albumin Microspheres. Aim 3 2 : In Vitro Inhibit ing Effects of Arginine Albumin Microspheres on Proliferation of Lung Cancer Cells.

PAGE 19

19 CHAPTER 2 BACKGROUND Lung Cancer Lung cancer is one of the leading causes of death in the world. According to Cancer Facts & Figures 201 1 published by American Cancer S ociety, an estimated 221,130 new cases of lung cancer are expected in 2011 and totally 156,94 0 deaths caused by lung cancer, about 27 % of all cancer deaths, are expected to occur in the united states [1] The 1 year survival rate for lung cancer has been enhanced to up to 40% in these years due to the improved therapeutic and surgical technologies; however, the 5 year survival rate nowadays for all types of lung cancer is st ill only 16 % and has not been significantly improved in years. Non S mall Cell Lung Cancer (NSCLC) Lung cancer can be majorly classified into small cell lung cancer (SCLC) and non small cell lung cancer (NSCLC) based on their histological types. The classificat ion has great prognostic and therapeutic significance for the lung cancer patients in clinics. About 97% of lung cancers are carcinomas, which is an invasive malignant tumor consisting of transformed epithelial cells, thus NSCLC also refers to non small ce ll lung carcinoma. Clinically, approximately 14% of lung cancer patients are small lung cancer and 85 % of the patients are non small cell lung cancer [1] The y can be different iated by the size and appearance of the visible f eatures of malignant cells via light microscope. The histomorphology differentiation of NSCLC and SCLC can be distinguished from their histological and cytological parameters and are relatively coarse. The c ellular diameters of SCLC are in the range of 4 to 9 m, whereas the average cellular diameter

PAGE 20

20 of NSCLC varies from 16 to 40 m in different types of NSCLC. [2,3] The biopsy specimen of NSC LC and SCLC cells are shown in F igure 2 1 Non small cell lung cancers include three major sub types, squamous cell (epidermoid) carcinoma, adenocarcinoma, and large cell carcinoma, due to their similar prognos is and treatments. [4,5] The proportion of squamous cell carcinomas in all lung cancers is 25%. It used to be the most seen lung cancer cell type in North America in the past 20 years and is still the most common in European countries. [6] Squamous cell carcinoma usually arises near the central bronchus, grows more slowly than other lung cancer types, and sometimes a hollow cavitation can be found in the center of tumor due to necrosis. [4] Adenocarcinomas account for approximately 40%, which is the highest proportion, in lung cancers. [7] It usually originates from the peripheral area of lung tissue and grows more slo wly than other types of NSCLC. Approximately 10% of lung cancers are large cell carcinomas. These cancers grow large masses peripherally on lung tissue and sometimes in the central cavity. Conventional Treatment s for NSCLC Surgical R esection Surgical resection is considered to be the most effective therapeutic strategy to cure non small cell lung cancer patients. [8,9] However, to operate the resection surgery, the cancer tumor must be completely resectable and the patient s must be able to tolerate the surgical procedure. [10] The feasibility of surgery depends on the preoperative s taging of lung cancer patients, which covers three major issues including distant metastases, the state of the chest and mediastinum, and the physical condition of the patients. In general, stage I, II, and IIIA are considered potentially resectable and th e survival rates of stage I, II and IIIA after complete resection are 76%, 47% and 26 56%. [11] Sometimes the operability of surgical resection is quite limited in

PAGE 21

21 lung cancer patients especially for those in late stage. As a result, expanding the applicability of surgical resection to patients on margins of operability by improved technologies and surgical procedures has been an important issue to improve the s urvival rate of NSCLC patients. Conventional Chemotherapy Che motherapy is beneficial for cure and palliation in lung cancer patients in many stages with local advanced and metastatic diseases. [12] In general, chemotherap y has been preferred for treatment of lung cancer patients who are suitable for resection surgery before and after the operation, and for those patients who cannot tolerate surgery, chemotherapy is the major treatment to palliate the symptoms According to the clinical reports, c he motherap y regimens can sometimes provide longer survival times to NSCLC patients than with radiotherapy alone. [13,14] Preoperative chemotherapy, which is also known as neoadjuvant or induction chemotherapy, is g iven prior to surgery in order to cause tumor regression, micrometastasis reduction and improve the tissue conservation and eligibility of resection surgery. It had been reported that using preoperative chemother apy can significantly improve the survival rate of NSCLC patients. [15,16] By the addition of chemotherapy, the average survival time had been improved from 10 months to 14 months, and 5 year survival had been improved from 7% to 17%. [17,18] The chemotherapy following surgery, adjuvant chemotherapy, is given to patients with resected lung cancer in order to prevent the relapse and metastasis of cancer. In the last decade, it has been reported that the adjuvant chemotherapy for patients with resected early stage NSCLC showed higher than 20% survival benefit at 5 years and up to 30% relative reduction in the risk of death. [8]

PAGE 22

22 Intratumoral (IT) Chemotherapy Drawbacks of Conventional Chemotherapy Conventional chemotherapy is generally systemic, which means that the chemotherapeutic ant icanc er drugs travel through the bloodstream which affects cells all over the body. Although conventional systemic chemotherapy can benefit the survival of lung cancer patients, the toxicity of traditional systemic chemotherapy has severely limited the saf ety and effectiveness of such therapy due to the uncontrollable diffusion of chemotherapeutic drugs in body. Severe side effects such as internal bleeding, depression of immune system and organ damage can seriously influence the quality of life for patient s. As a result, prolonging the survival of cancer patients without damaging the vital functions to the point of death is one of the most important is sues in cancer treatment today. IT Chemotherapy Among th e lung cancer patients, central a irway obstruction such as respira tory distress, bleeding and atelectasis, is the major problem that can seriously influence the quality of life and increase the difficulty of cancer treatment. I T chemotherapy through a direct injection by using bronchoscopic needle cathet tumor size and relieve dyspnea symptoms. [19 24] To further improve the effectiveness and safety o f intratumoral chemotherapy, various microspheres formulations have been designed to prolong high intratumoral drug concentrations and minimize the systemic toxicity in body. Intratumoral injection of chemotherapeutic drugs has shown effective elimination of metastatic tumor cells that migrate through lymph system. [21] In previous study, the

PAGE 23

23 intratumo ral lymphatic treatment had been achieved by injection of cisplatin, one of the most commonly used chemotherapeutic drugs for lung canc er, into the endobronchial tumo rs of the NSCLC patients by using a bronchoscop ic catheter. Through t he lymphatic drainage, the tumo r debris carrying intratumo rally injected chemotherapeutic drugs can be transported into the regional lymph nodes and the lymphatic system to destroy the metastases or micrometastases. This indicates the potential efficacy of intratumo ral chemotherapy for cancer metastasis via the sent inel and regional lymph nodes. Drug Loaded Albumin Microspheres for Cancer Treatment Microspheres (MS) prepared from a variety of synthetic and biopolymers have been widely studied for their application in cancer treatment. [25,26] Among the various biodegradable particulate drug carriers available for consideration, we regard the most abundant natural plasma protein, serum albumin, as a most appealing biocompatible carrier for drug delivery. [27,28] Furthermore, the abundant functional groups on surfac e of HSA or BSA facilitate physi sorption and covalent coupling to functional polymers, proteins and biomolecules. [29] In previous animal studies, we have demonst rated the effectiveness of drug loaded bovine serum albumin micr ospheres for the treatment of a Lewis lung carcinoma and a mammary adenocarcinoma. [30] In view of this, drug loaded albumin microspheres are now being considered for bronchoscopic IT treatment of lung cancer to provide localized, continuous and prolonged super high drug release at target tumor sites. The goal is to provide more effective chemotherapy, to minimize systemic toxicity, and to improve surgical outcomes by preoperative reduction in tumor burden.

PAGE 24

24 Synthesis of Albumin Microspheres ( A MS ) The syn thesis of A MS is shown in F igure 2 3. AMS h ave been synthesized through a water in organic solvent emulsion system, which is similar to the traditional water in oil (W/O) emulsion system except that oil is replaced by organic solvent with low polarity. The water in organic solvent emulsion is more convenient and efficient than the W/O system because solvent can be removed more easily. In this emulsion system, the water phase (discontinuous phase) containing BSA and water soluble drugs can be dispersed into the organic solvent phase (continuous phase ) containing polymer stabilizers or surfactants to p roduce a stable emulsification. After emulsification, the AMS are solidified by chemical or ionic crosslinkers to maintain the stability of AMS in aqueous solution at body temperature. Glutara l dehyde (GTA ) is the most often used crosslinker in our group, because through the formation of imine bond, it provides high stability to AMS and enables the AMS surface to be more reactive for further modification. When GTA are introduced into the emulsion through th e organic solvent phase, GTA has to diffuse through the interface between water and organic solvent to react with BSA. As a result, most of the crosslink reactions happen on the surface area of AMS instead of in the matrix. This method provides more free r eactive aldehyde s on the surface of AMS After solidification, the AMS can be washed out by the addition of wash solvent into the emulsion system. The wash solvent must be miscible with water, organic solvent and stabilizers in the emulsification to form a homogeneous phase and exclude out the AMS The wash solvent not only removes the stabilizers on the surface of AMS but also significantly influence the surface properties of AMS Usually a solvent with low polarity will be used as wash solvent to prevent agglomeration among AMS happening

PAGE 25

25 during washing out. Figure 2 4 shows the imagination of AMS synthesis through emulsifica tion in molecular level. Loading Efficacy of AMS Generally speaking, all water soluble chemotherapeutic drugs and biomolecules includi ng protein, polysaccharides and nucleic acids can be effectively loaded into AMS The drugs and biomolecules can be loaded with AMS through in situ loading, during the formation of microspheres, and post loading, after the formation of microspheres. While dispersed in aqueous solution or high polar organic solvent, AMS can quickly swell and absorb the solutes in solution, especially in saline buffer solution. As a result, the in bulk loading efficiency of drugs or biomolecules in AMS can be influenced by th e swelling degree of AMS in the solvent, the solubility of the loaded molecules in solvent and most importantly, the molecular interaction between loaded molecules and polypeptide domains in AMS Release Behavior of Loading Drugs from AMS The drugs or bio active molecules which are incorporated into MS may be active on the MS surface and may be released from the MS by diffusion and by degradation of BSA matrix. From the molecular view, the release behavior of loaded molecules from the MS can be influenced b y three kinds of molecular interactions: loaded molecules to environmental solution, AMS to environmental solution and loaded molecules to AMS Furthermore, the release of loaded bioactive molecules from the MS is controllable as a function of partic le siz e distribution, BSA crosslink density, degradat ion rate of microspheres In particular, the drug release rate and rate of MS biodegradation can be effectively controlled by changing t he albumin crosslink density.

PAGE 26

26 Figure 2 1. Biopsy s pecimen of non smal l and small cell lung cancer. A) A biopsy specimen of non small cell lung cancer (hematoxylin eosin, original 200). B) A specimen demonstrating small cell lung cancer cells (hematoxylin eosin, original 400). [31] Figure 2 2. Schematic diag rams of lymphatic drainage. T umo r cell debris via lymphatic transport of intratumo rally injected cytotoxic drug to the lymph nodes and destroy metastases and micrometastases [21]

PAGE 27

27 Fig ure 2 3. Synthetic strategy of AMS Fi gure 2 4 Imaginary AMS formation in molecular level. The cartoon shows the emulsification in AMS synthesis in molecular level. Aqueous phases containing BSA (light orange area) are dispersed in organic solvent containing stabilizers (light blue area).

PAGE 28

28 CHAPTER 3 TARGETED LUNG CANCER THERAPY USING EPHRIN A1 LOADED ALBUMIN MICROSPHERES Toxicity and the systemic exposure of drugs is the major problem associated with cancer therapy. To overcome these affects alternative therapeutic strategies are needed. E ph rin A1, the ligand of EphA2 receptor tyrosine kinase, has been shown to suppress the growth of non small cell lung cancer (NSCLC) by down regulation of EphA2 receptor expression. In this study, ephrin A1 loaded albumin mesospheres (EphA1MS) were prepared t o provide localized and prolonged release of a high concentration of ephrin A1 at the tumor site and thereby improve therapeutic efficacy. The tumoricidal activity of EphA1MS was evaluated in vitro using an NSCLC A549 human lung adenocarcinoma epithelial c ell line. Hydrophilic albumin micro spheres were synthesized by an emulsion polymerization method using glutaraldehyde (GTA) as the cross linking agent. Since albumin MS were used to prepare conjugated proteins for the sustained and prolonged release of th erapeutic agents on the target site, we prepared EphrinA1 loaded MS (EphrinA1 MS) to target lung cancer cells. The morphological and dimensional characteristics of the EphrinA1 MS were studied by scanning electron microscopy and particle size analysis. In addition t he cytotoxicity and rate of phagocytic uptake of EphrinA1 by A549 cells were determined. Moreover, t he biological properties of Eph rinA 1 MS were examined by performing a cell migration assay, and a 3 dimensional tumor growth assay in A549 cells i n vitro Albumin MS exhibited low toxicity for A549 cells (above 90% cell viability) M ore than 80% of FITC labeled MS were phagocytosed within 2 hours of incubation. The release rate of EphrinA1 was determined by ELIFA. In addition, Eph rin A1 MS

PAGE 29

29 decreased the expressio n of the focal adhesion protein ( FAK ) within 24 hours more effectively than EphrinA1 alone Furthermore, Eph rin A1 MS showed s ignificant inhibition of NSCLC migration and tumor cell proliferation when compared to resting cells EphrinA1 MS atte nuated the growth of tumor colonies on soft agar. This study demonstrated that the Eph rin A1 MS developed may serve as a potential carrier for targeted delivery of tumor suppressive protein EphrinA1 with minimal cytotoxic effects and greater anti tumor ther apeutic efficacy against NSCLC. Introduction Protein Delivery Delivery of biomolecules, such as protein, DNA and RNA, for therapeutic purpose has attracted a lot of attentions in the last decade since the advancements in biotechnology allo w mass production of these biomo lecules. [32] However, the stability and effective concentration of these biomolecules are difficult to maintain in human bo dy due to the enzymatic lysis and rapid clearance from the bloodstream. [33 35] To protect the biomolecules from degradation and achieve an effective level of biomolecules in plasma, the capsulation of biomolecules i n various kinds of biodegradable particles has been widely ut ilized in targeted delivery. Protein delivery using nano and micro size MS based on various biodegradable polymers including poly(lactic co glycolic acid) (PLGA), lecithin and biocompatible hydr ogels has attracted significant research interest in recent years [36 39] Proteins have been loaded in the MS matrix, physically adsorbed on the surface, and covalently conjugated with reactive functional groups on the particle surface. [40 44] However, protein delivery using MS particles can be complicated by protein denaturation during preparation, storage and release, especially for some ionic polymers. [45,46] In this regard,

PAGE 30

30 albumin MS may prove more effective as a stabilizing matrix for adsorbed or conjugated proteins. EphA2 Regulation in Cancer s The Eph transmembrane tyrosine kinases are the largest family of receptor tyrosine kinas es (RTK), which play important roles in the formation of the embryonic circulatory system and control tumor angiogenesis. Among this family, EphA2 receptor tyrosine kinase had been discovered over expressed in various aggressive cancers and most of the NSC LC, but not significantly in normal tissue. [47 49] The over expression of EphA2 has been proved to relate to tumor growth, angiogenesis and metastasis. [24,50 52] It had been shown that through binding to the receptors on cell membrane with a glycosylphosphatidylinositol anchor, the ligand of EphA2, ephrin A1, can inhibit the proliferation and migration of lung cancer tumor cells by down regulation of EphA2 receptor expression. [53 55] Thus the recombinant ephrin A1/Fc can target only EphA2 in NSCLC and suppress tumor growth and invasion for NSCLC treatment and prevention. Moreover, the specific target of ephrin A1 to EphA2 can totally eli minate the systemic toxicity and conserve the adjacent normal lun g tissue. EphrinA1 Conjugated Albumin Microspheres ( AMS ) In a recent study, ephrin A1 was covalently immobilized on the surface of polyethylene glycol (PEG) based hydrogel and the capacity of ephrin A1 had been successfully retained while conjugated on the surface. [56] For the IT delivery purpose, ephrin A1 was conjugated on the surface o f spherical particles to provide a stable release through the hydrolysis happening on particle surface. Reported here is the synthesis of 5 10 m albumin meso s pheres by a water/organic solvent dispersion procedure developed in our laboratory. This particle size was selected based on our

PAGE 31

31 previous research indicating mesospheres were especially effective for IT i njection and tumor perfusion. As shown in F igure 3 1, e ph rin A1 was conjugated to the a lbumin MS by imine coupling of e ph rin A1 amino groups to free aldehyde groups which remain on albumin MS after glutaraldehyde crosslinking. The structure and composition of the EphA1 MS were characterized and antitumor activity was assayed using an A549 NSCLC human lung adenocarcinoma epithelial cell line. Materials and Methods Cell Lines and Reagents A549 cells, human lung adenocarcinoma epithelial cell line, were obtained from American Type Cell Collection (Manassas, VA). The A549 cells were cultured in RPMI 1640 medium (Sigma, St Louis, MO) containing 10% fetal bo vine serum (FBS), penicillin (100 U/ mL ), streptomycin (100 g/ mL ), fungizone (100 g/ mL ), 0.25% D glucose, 0.2% sodium bicarbonate and 1% sodium pyruvate. The recombinant mouse ephrin A1/Fc was purchased fro m R&D systems, Minneapolis, MN. Synthesis of BSA mesospheres ( AMS ) A 5% w/v solution of cellulose acetate butyrate (CAB) (butyryl content 16.5 19.0%, Sigma, St Louis, MO) in 1,2 dichloroethane (DCE) (certified ACS grade, Fisher) was used as the continuous organic phase.16.0 mL of the CAB/DCE solution was added to a 50 mL polystyrene centrifuge tube. 1 mL of a 10% w/v aqueous solution of bovine serum albumin (BSA ; Sigma Aldrich ) was added into the continuous phase. The mixture solution in the tube was vortexed to create a d ispersion solution at 3000 rpm for 3 min. To react with all lysine amino groups in BSA for cross linking, excess glutaraldehyde (GTA), 16% w/w EM grade glutaraldehyde to BSA (Electron Microscopy Science, Hatfield, PA), was added through DCE into the emulsion solution. The tube was placed

PAGE 32

32 o n rotator for 8 hours to complete crosslinking. The centrifuge tube was then filled with about 50 mL of acetone (ACS certified, Fisher) and then centrifuged at 2000 rpm for 10min to yield a clear supernatant fluid over a microspheres pellet. The acetone wa sh was repeated 3 times by dispersing MS in 50 mL of acetone and centrifuging each time. The appearance of MS was investigated by using optical microscop e (Olympus, Center Valley, PA). Ephrin A1 Loading on AMS (Eph rin A1 MS) About 1 mg fresh 16% GTA crossli nked AMS was dispersed in 50 L phosphate buffered solution (PBS) solution containing 50 g of ephrin A1 in a 1.5 mL centrifuge tube. Then the tube was placed on a shaker at room temperature for 4 hours and centrifuged. The supernatant was removed and the loaded AMS were washed twice by 1 mL acetone. The Eph rin A1 MS wer e air dried and stored at 4C. To demonstrate the stable conjugation between ephrin A1 and AMS the AMS were loaded with fluorescein isothiocyanate (FITC) labeled ephrin A1 and observed usin g fluorescence microscope. The ephrin A1 was labeled by using a FluoReporter FITC labeling kit (Invitrogen, Eugene, OR) After the loading process, the FITC ephrin A1 loaded AMS were vortexed vigorously in PBS to remove excess unconjugated ephrin A1. The samples were washed by using PBS and centrifuged repeatedly. Then the microspheres were incubated in PBS for 8 hours and washed by PBS before being observed under fluorescence microscope. Figure 3 1 shows the strategy of conjugating ephrinA1 on the surface of functionalized AMS Particle Size Distribution of AMS The particle size distribution of AMS in PBS was determined by Coulter LS 13320 Laser diffraction particle size analyzer (Beckman Coulter, Inc., Brea, CA). PBS was

PAGE 33

33 used as suspension fluid and AMS w ere dispersed in PBS and sonicated before measurement. The laser obscuration range was between 8 to 12% during measurement. Surface Morphology of Eph rin A1 MS The Eph rin A1 MS were coated with a thin layer of gold/platinum and mounted on a metal stub. The su rface morphology of AMS was investigated by scanning electron microscopy (SEM) with a JEOL JSM 6400 (Tokyo, Japan). Cytotoxicity and Phagocytosis of AMS by A549 The FITC labeled AMS was synthesized by using the mixture of 90% BSA and 10% albumin FITC conju gate (albumin human, Sigma). 1x10 6 cells were seeded in each well of the 24 well plate and incubated in the media containing various concentrations of FITC labeled AMS After the desired time of incubation, the media were discarded and the cells were washe d by using PBS until excess AMS were removed. The cells were then trypsinized, fixed by paraformaldehyde and dyed with Trypan blue before counted by hemocytometer un der a fluorescence microscope. Long term cytotoxicity of AMS was determined by using the Cy toTox ONE homogeneous membrane integrity assay (Promega Corp., Madison, WI). 5,000 cells were seeded in each well of the 96 well plate and incubated in media containing various concentrations of AMS The releases of lactate dehydrogenase (LDH) were measure d after 6, 24 and 48 hours. Every experiment was done in triplicates. In Vitro Release Rate and Loading Efficiency of Ephrin A1 on AMS The release rate of ephrin A1 from the Eph rin A1 MS was determined in PBS with 10 g/ mL lysozyme (Egg white, Fisher). In a 15 mL centrifuge tube, 1 mg of Eph rin A1 MS was dispersed in 10 mL 10 g/ mL lysozyme/PBS was made to simulate the actual

PAGE 34

34 concentration of lysozyme in serum. The tube was placed on a rotator and incubated at 37C. After 1, 2, 3, 5 and 7 days, 1 mL dispersi on solution were collected and filtered by using the centrifugal filters with 0.1 m hydrophilic membrane s (Ultrafree CL, Millipore, Billerica, MA ). The follow through was saved for the dete rmination of ephrin A1 release. Here the enzyme linked immunoflow assay (ELIFA) method was utilized to determine the concentration of released ephrin A1 in the dispersion solution. A nitrocellulose membrane was sandwiched between a 96 well sample plate and a vacuum chamber in the ELIFA system (Pierce Biotechnology, Rockf old, IL). The sample solutions containing released ephrin A1 were pulled through the membrane slowly by vacuum and left the erphrinA1 on the membrane. Then the reconstituted antibody, anti m Ephrin A1 (goat IgG, R&D systems, Minneapolis, MN), and secondary antibody were added and flew through the membrane. Finally the substrate solution was added and the flow through was collected in the 96 well microplate. The absorbance of each well was measured by using an ELISA plate rea der. To distinguish the release b ehavior of ephrin A1 conjugated on surface from that loaded in matrix, another batch of EphrinA1 MS was vortexed vigorously to wash off the ephrin A1 loaded in matrix before being dispersed into PBS solution. Western Blot Analysis Cells were cultured on 6 cm petri dishes to 80% confluence and then incubated with serum free RPMI 1640 media containing free recombinant ephrin A1 and Eph rin A1 MS. After desired time periods, the media were removed from dishes and each dish was washed by PBS. The cell lysates we re scraped in PBS and then centrifuged. After centrifuge, the supernatant was discarded and the cell lysates were lysed by RIPA buffer. To determin e the EphA2 receptor expression and FAK, proteins

PAGE 35

35 were resolved and detected by Western blotting using anti E phA2 antibody and anti FAK antibody (Cell signaling, Boston, MA) following the method as reported earlier [54] FAK is over expressed in various kinds of cancers. FAK is a cytoplasmic kinase involved in extracellular matrix (ECM )/ inte grin mediated signaling pathways. [57] In cancer cells, FAK has been shown to regulate cell growth, migration and invasion by promoting the dynamic regulation of focal adhesion and peripheral actin structures. [58] In cancer cell lines, the elevated cell growth and migration rate lead to increased phosphorylation of FAK. [59] Cell Migration Assay About 1x10 5 cells were seeded into each chamber of 4 chamber glass slide. After 48 to 60 hours of incubation, cells reached 100% confluency and then scratched by 200 L pipette tips to create a wound on cell monolayer. The cells were washed gently by PBS to remove cell debris before incubated in 10% FBS containing media with free recombinant ephrin A1 or Eph rin A1 MS. The wound areas were photo graphed every 6 hours and every expe riment was done in triplicates. Three Dimensional Tumor Growth Assay Matrigel (BD, Franklin Lakes, NJ) was diluted with serum free media in the ratio 1:1. 200 L of diluted matrigel solution containing free recombinant ephrin A1 or Eph rin A1 MS was added into each well of 24 well plate and then allowed to gel at 37C for at least 30 min. After gellization, A549 cells at a density of 5,000 cells per well were plated in 300 L of serum free media. Media were changed every 3 days. Randomly chosen fields in each well were photographed every two days until the tumor colonies were formed.

PAGE 36

36 Results Synthesized AMS with Narr owed Size Distribution in Meso s cale The AMS were synthesized and the particle size distribution was determi ned in volume percentage in PBS. The particle size distribution of AMS was shown in F igure 3 2. The particle size was controlled in the range of 2 to 10 m and about 60% of the microspheres are in 5 to 10 m. Only around 8% of the microspheres are smaller than 2 m. The highest point of the size distribution is at 5.35 m and the mean particle size is 4.2 m. The photomicrograph of AMS confirmed the result of particle size distribution as determined by laser diffraction system. Most AMS are in the size rang e of 4 to 6 m and surrounded by some small microsphe res which are around 1 to 2 m. Low Cytotoxicity and High Phagocytosis of AMS The cytotoxicity of AMS to A549 cells was determined by LDH assay. The LDH leakage (%) from cells in different concentration of AMS in 6, 24 and 48 hours was shown in Figure 3 3. In 6 hours of incubation with AMS the cells incubated with 0.1 mg/cm 2 and lower showed 10% more cell death than the cells incubated with media only, and with 0.2 mg/cm 2 AMS incubation, about 20% more cell death was shown. In 24 and 48 hours of incubation, cells incubated with AMS showed slightly increase of LDH leakage with increasing AMS concentration. When incubated with AMS lower than 0.1 mg/cm 2 A549 cells showed n o significant extra cell death. In 40 min utes of FITC labeled AMS incubation, above 60% of A549 cells had uptaken the microspheres wh ile high cell viability remained The phagocytic rate increased with the concentration of AMS and reached the limit. Then the phagocytic rate in a longer tim e was determined by using single concentration, 0.25 mg/cm 2 AMS

PAGE 37

37 In 2 hours of incubation, about 80% of A549 cells had phagocyted AMS inside the cells and over 90% of cells had been phagocyted in 4 hours. Stable Conjugation between Ephrin A1 and AMS AMS we re conjugated with FITC labeled ephrin A1, rinsed with PBS and then incubated in PBS for hours. After the incubation, the conjugated AMS were investigated under the fluorescence microscope and FITC labels can be significantly observed, which implies that s table conjugation between erphinA1 and AMS had been formed and the ephrin A1 conjugated AMS can stay stable in PBS. The SEM images of ephrin A1 conjugated AMS showed uniform spheres and smooth surface morphology on the microspheres. The particle size of mo st ephrin A1 conjugated AMS under SEM are 4 to 7 m and some small microspheres around 2 m can be found in the field. The particle size and surface morphology of albumin microspheres did not change after loaded with ephrin A1 Release Rate of Ephrin A1 fr om Microspheres The data was fitted with the logarithm ic trendline as shown in F igure 3 7. About 5 g of ephrin A1 can be released out from 1 mg Eph rin A1 MS (matrix loaded and surface conjugated) in 24 hours. The release of ephrin A1 accumulated to more th an 8 g in 7 days of incubation. After 14 days, the release amount reached about 10 g, which was assumed as the total loading amount of erphin A1 in EphrinA1 MS (10 g of ephrin A1 contained in per milligram of EphrinA1 MS ). However, for the prewashed Eph rinA1 MS (surface conjugated only), it showed lower ephrin A1 release at first 24 hours and each time point in 7 days. From the difference between EphrinA1 MS with and without prewash, it revealed that about 10% of loaded ephrin A1 was in the matrix and mo st of the ephrin A1 were conjug ated on the surface of AMS

PAGE 38

38 Eph rin A1 MS Inhibited the FAK Expression and Cell Migration of NSCLC Cells In A549 cells activation of EphA2 receptor with ephrin A1 and EphrinA1 MS resulted in a decreased FAK expression in 6 hour s. In the untreated A549 cells the expression of FAK remained in high level, which implies that the cells grew and spread normally within 48 hours. However, the cells treated with free recombinant ephrin A1 and EphrinA1 MS showed the similar result in West ern Blot analysis. They showed significant decrease in FAK expression after 6 hours of incubation and then gradual decrease within 48 hours. In addition, the cells were incubated with unloaded AMS and showed no inhibition on FAK expression within 48 hours. This demonstrates that the ephrin A1 on Eph rin A1 MS can effectively inhibit the growth and spreading of A549 cells via down regulation of FAK. In cell migration assay, the untreated cells almost closed up the wounded area in 18 hours. The cells treated wi th EphrinA1 MS showed slower cell migration rate than the untreated cells within 24 hours, just as the cells treated with free recombinant E phrin A1. When the A549 cells were treated with higher concentration of Eph rin A1 MS, the boundaries of cell monolaye r showed slower migration rate to heal up the wound gap, which indicates that the efficacy of Eph rin A1 MS can be enhanced by increasing the concentration. However, the cells treated with unloaded AMS showed slower cell migration rate than the untreated cel ls, which implies that the albumin microspheres itself may have some effects on inhibiting cell migration in vitro Eph rin A1 MS Inhibited Tumor Growth of NSCLC Cells A549 cells were seeded into cross linked matrigel network containing free recombinant E phr in A1, AMS and Eph rin A1 MS. The supernatant media were replaced by fresh serum free media every 3 days. After 6 days of incubation, a high density of

PAGE 39

39 tumor colonies can be observed in the matrigel containing only media and AMS However, the density of tumo r colonies in matrigel containing free ephrin A1 and high concentration of Eph rin A1 MS were lower than that in the untreated one. When the concentration of Eph rin A1 MS in matrigel was higher than 20g/ mL the number of tumor colonies was significantly redu ced, and almost no tumor colonies can be found in the area with high density of Eph rin A1 MS. Compared with the cells incubated with Eph rin A1 MS, the increases of number and size of tumor colonies in free ephrin A1 treated cells were more obvious after a lo nger time of incubation. This may be caused by the high retention of Eph rinA 1 MS observed in matrigel after times of media change, whereas free ephrin A1 can be washed out from matrigel more easil y. In the l ower row of F igure 3 11 it shows the spreading o f cells on matrigel. Obvious cell spreading can be found in untreated and ephrin A1 treated cells on the matrigel. However, cell spreading on matrigel was inhibited in the area containing high density of Eph rinA1 MS. Discussion The water in organic solvent emulsion system provides a convenient method for preparation of albumin microspheres. All the surfactants, emulsifiers and organic solvent in the emulsion system can be easily removed from the surface of albumin microspheres. The high surface hydrophilici ty, high dispersity and high stability in aqueous solution of synthesized AMS allow the AMS to be easily applied into biological system In this study the AMS were mostly controlled in the size range of 5 to 10 m to prevent fast protein release and diffus ion. However, particle size is one of the most important factors in delivery efficacy, protein release rate and particle uptake efficiency by cells and tissues. In the phagocytosis test of AMS by A549 cells, above 60% of cells had phagocytosed AMS in 40 mi n, and after 3 hours of incubation the percentage of

PAGE 40

40 cells phagocytosed AMS reached 90%. It is indicated that the AMS can be efficiently phagocytosed by A549 even the particle size is larger than 5 m; meanwhile, the cytotoxicity of AMS is low and can be n eglected when the concentrat ion of AMS is below 1 mg/ mL When AMS were dispersed in PBS solution containing ephrin A1, the AMS can be loaded with ephrin A1 both in matrix and on surface. Proteins can be loaded in matrix of microspheres by physical interact ion between loaded proteins and matrix and also can be chemically conjugated on the surface of AMS through imine formation. [28,29] Protein loading efficiency in matrix depends on the solubility of protein in solution, swelling degree of AMS in solution and affinity interaction between load and matrix. Howev er, the most important factor of the loading efficiency on surface is the density of aldehydes on AMS surface. The proteins loaded in matrix can be released out faster through diffusion and the ones loaded on surface will be released slowly through enzymat ic lysis. As a result, the ephrin A1 loaded in AMS can bind onto EphA2 receptor through two possible approaches, one is by the ephrin A1 which had been freely released in media and the other one is by the ephrin A1 whic h stays conjugated with AMS The Eph r in A1 MS we synthesized here contains about 10% of total loading ephrin A1 in the matrix and the rest of the proteins were conjugated on the surface of microspheres. The combination of matrix loading and surface conjugation of ephrin A1 in Eph rin A1 MS can p rovide a higher effective concentration in short time and a prolonged continuous release from the surface. Due to the high phagocytic rate of Eph rin A1 MS, the release of ephrin A1 can take place inside and outside the cell

PAGE 41

41 membrane at the same time, which differs from the general delivery method for ephrin A1 which can only diffuse free ephrin A1 in the environment outside the cells. This delivery method may improve the efficiency of lung cancer treatment by targeting EphA2. More over this can be used for v ariety of other cancers target proteins. Eph rin A1 MS can effectively inhibit cell spreading and migration of A549 cells in the in vitro models. When added into the wells plated with cells, the Eph rin A1 MS precipitated onto the bottom of wells in minutes an d stay on the monolayer of cells, which implies that the Eph rin A1 MS can release ephrin A1 right on top of monolayer of cells and provide a higher plain concentration close to target cells over time. In the present studies in vitro EphrinA1 MS can be plac ed right on the desired spot whereas the free ephrin A1 can only be added to the whole open environment. The microspheres showed a good retention on cell monolayer. In matrigel, the Eph rin A1 MS can be injected into certain spot and provide a localized high density of microspheres without being diffused away. Compared to Eph rin A1 MS, although at the beginning the free ephrin A1 added to the system can provide a faster and higher concentrated ephrin A1 binding to cells, the free ephrin A1 can diffuse into the circulation system and the concentrat ion can be diluted more easily. In the cell migration study, the wound treated with Eph rin A1 MS showed slower healing rate and the inhibition of cell migration enhanced with increasing concentration of Eph rin A1 MS. The same results had also been observed in 3 D tumor assay. The cell spreading is significant around the surface area of matrigel containing free ephrin A1 because the free ephrin A1 in surface area can be washed off easily after times of

PAGE 42

42 media change. Howeve r, cell spreading had not been found on the surface of matrigel containing Eph rin A1 MS due to the hi gher retention of microspheres. The albumin mesospheres we synthesized here can be a potential protein carrier for different delivery purposes. The high dis persity and stability in aqueous solution enable the Eph rin A1 MS to be applied in EITC and IT therapies for other cancers easily. More importantly, due to the elimination of systemic toxicity, Eph rin A1 MS can be more effective than conventional IT chemothe rapy because Eph rin A1 MS can be applied on cancer tumor with higher concentration and an overdose is not a concern here.

PAGE 43

43 Figure 3 1. Synthetic strategy of ephrin A1 conjugated AMS Ephrin A1 are conjugated on surface of AMS through the formation of ca rbon nitrogen double bond (imine). Figure 3 2 Particle size distribution of AMS Particle size distribution of AMS in PBS was measured by using Coulter Laser Diffraction particle sizer. About 60% of the microspheres are in 5 to 10 m. Particle size was further confirmed by optical microscope. (Scale bar represents 6 m )

PAGE 44

44 Figure 3 3. Cytotoxicity of AMS AMS showed low cytotoxicity to A549 cells within 2 days. Figure 3 4. Phagocytosis of AMS Above 80% of AMS phagocytic upt ake by cells within 3 hour s by using 0.25 mg/cm 2 concentration of AMS

PAGE 45

45 Figure 3 5. Optical photomicrograph of FITC labeled AMS The FITC labeled AMS were uptaken by A549 cell after 40 min incubation. (A) (B) Figure 3 6. Stable conjugation between ephrin A1 and AMS (A) Ephri n A1 was labeled with FITC first and then conjugated on AMS (B) After conjugation, the microspheres were washed by PBS and then incubated in PBS at 37C for 8 hours. Picture was taken after incubation by using fluorescence microscope.

PAGE 46

46 Figure 3 7. Surfac e morphology of SEM images of conjugated AMS (Scale bar represent 20 m (left) and 2 m (right).) Figure 3 8. Release rate of ephrin A1 from EphA1 MS. This figure shows the accumulate release of ephrin A1 in a 10 mL PBS suspension containing 1mg ephrin A1 loaded AMS and 10g/ mL lysozyme. Ephrin A1 loaded in the matrix provides a faster release to reach a high concentration at the beginning, whereas the ephrin A1 conjugated on the surface provide a slower and continuou s release into the environment. represents the microspheres loaded with ephrin mesospheres conjugated with ephrin A1 only on surface. The data was fitted with the logarithmic trendline.)

PAGE 47

47 Figure 3 9. FAK expression in Western Blot analy sis. EphrinA1 MS activation decreased focal adhesion kinase (FAK) expression in A549 cells within 48 hours. It demonstrated that EphrinA1MS can inhibit the spreading and growth of lung cancer cells as recombinant ephrin A1.

PAGE 48

48 (A) (B) Figure 3 10. Cell migration of A549 cells. (A) The control cells migrated over the wounded area within 18 hours, and the wound without tre atment almost closed up. However, the wound treated with recombinant ephrin A1 and EphrinA1MS showed inhibition on wound recovery. (B) The chart represents the wound healing rate with and without treatment. The wound treated with higher dose of EphrinA1MS showed enhanced inhibition on wound recovery. The data presented is mean of three independent experiments. (The control cells migrated and covered the whole wounded area before 24 hours. The dash line is the imagined extension of the solid line and the poi nt on the dash line shows the expected time that the wound healed up.)

PAGE 49

49 Figure 3 11. Images of 3 dimensional tumor growth in Matrigel. The tumor growth decreased in A549 cells activated with Eph rin A1 MS. The tumor images were taken afte r 6 and 12 days of cultures in M atrigel with serum free medium. Eph rin A1 MS and recombinant ephrin A1 showed smaller tumor colonies than the untreated cells (control). The lower row shows the spreading of cells. The untreated cells showed significant spreading on matrigel; however, the spreading was inhibited in the Eph rin A1 MS treated cells.

PAGE 50

50 CHAPTER 4 CISPLATIN LOADED ALBUMIN MICROSPHERES The low solubility of cisplatin in aqueous solution limits the treatment effectiveness and the application of cisplatin in various kinds of drug eluting devices. Although cisplatin has a high solubility in DMSO, the toxicity of cisplatin can be greatly reduced while dissolved in DMSO. In this study, t he c isplatin loaded albumin microspheres (CDDP/DMSO AMS) were prepared by post loading met hods an d showed high cisplatin content (16% w/w) and effective cytotoxicity to lung cancer cells Cisplatin were efficiently absorbed into the albumin microspheres (AMS) in a very short loading process in DMSO and most importantly, the toxicity of cisplat in was remained at 100% after the loading process This CDDP/DMSO AMS was designed for the intratumoral injection through the bronchoscopic catheter due to its high dispersity and stability in aqueous solution. This CDDP/DMSO AMS showed a fast cisplatin re lease within 24 ho urs in PBS and in the environment containing lysozyme In the in vitro study, CDDP/DMSO AMS show ed high effectiveness on killing the lung cancer cells including the non small cell lung cancer (NCL H23 and A549 ) malignant mesothelioma (CR L 2081) and the mouse lung carcinoma (Lewis lung carcinoma) cell lines. The albumin based microspheres provide an ideal loading matrix for cisplatin and ot her metal based drugs due to the high swelling degree and fast uptake rate in the organic solvents wi th high polarity In addition, to investigate the effects of polysaccharides, such as chitosan and chondroitin on enhancing loading efficiency and remaining cytotoxicity of cisplatin, the polysaccharide modified albumin microspheres were synthesized and l oaded with cisplatin in this study.

PAGE 51

51 I ntroduction Cisplatin Cisplatin, cis diamminedichloroplatinum(II), also known as CDDP, is the first metal coordination complex to have clinical anti tumor activity. It is one of the most commonly used chemotherapeutic drugs nowadays in the treatment of a variety of cancer tumors including lung, testicular, ovarian, lymphoma and glioma [60,61] Clinically, cisplatin is generally used with other chemotherapeutic drugs as primary and secondary treatments for various cancers. [62] In a series of adjuvant trials in patients with resected non sm all cell lung cancer (NSCLC), the combination of cisplatin with other agents, such as doxorubicin, etoposide and various kinds of vinca alkaloids including vinblastine, vincristine and etc., had shown a significant improvement on 5 year survival rate of th e NSCLC patients. [8] Cisplatin is transported across the plasma membrane through both passive diffusion and active transport. [63] Cisplatin is highly reactive in biological environment and binds to many biomolecules such as DNA, RNA, proteins and phospholipids. [64 66] The cause of the toxicity of cisplatin is difficult to determine since it binds to various kinds of biomolecules. However, the binding of cisplatin to DNA is thought as the most critical reaction leading to the toxicity for cancer tumors. [67] The Pt(II) of cisplatin remains coordinated to its chloride ligands while circulated in the blood with high chloride concentration. As shown in F igure 4 1 upon enterin g into cells, the chloride ligan ds of cisplatin are replaced by wate r molecules to form a positively charged species that can react with nucleophilic sites on DNA, RNA and proteins to form adducts. [68] To cause cellular apoptosis, cisplatin binds to the N7 atom of guanines in DNA to form intrastrand adducts, interstrand crosslinks or DNA protein crosslinkes. It

PAGE 52

52 has been suggested that the major lesions pro duced by cisplatin are intrastrand adducts, and the cellular resistance to cisplatin may be associated with interstrand crosslinks. [69] Although cisplatin is one of the most commonly used chemotherapeutic drugs for cancer treatments, some tumors acquire r esistance to cisplatin after the initial treatment and chronic cisplatin usage results in cisplatin accumulation in cancer cells and induces cisplatin resistance. [70] However, the higher dose of cisplatin is not clinically applicable to improve its efficiency due to the high toxicity of cisplatin. The usage of cisplatin combines with severe toxic side effects on cancer patients including neurosis, nephrosis, and h ematosis, along with gastrointestinal and renal toxicity. [71 75] In addition, it has been shown that only 10% of the cisplatin introduced into blood stream enter into the cells, and 90% of them are bound to the plas ma proteins outside the cells. [76] Cisplatin in Solvent Platinol a FDA approved cisplatin for inj ection, is administered to patients as a 1 mg/ mL concentration in aqueous solution containing 0.9% of sodium chloride and 1% of mannitol (Bristol Myers Squibb, Princeton, NJ). It is injected intravenously to patients in the range of 20 to 150 mg/m 2 (concentration of cisplatin in body area) for daily dosage o r one cycle, and whic h depends on the severity of patients. However, since the solubility of cisplatin is low in aqueous solutio n, the intravenous delivery through aqueous solution may result in cisplatin aggregation and cause the concentration uncontrollable in human body. Thus the anti tumor effect of cisplatin might be significantly reduced while delivered through aqueous enviro nment. Cisplatin can be easily dissolved into dimethyl sulfoxide (DMSO) to obtain an accurate solution concentration higher than 200 mg/ mL This has also been published

PAGE 53

53 as standard methodology by the National Cancer Institute for studying the biological e ffect of cisplatin. [77] While dissolved in DMSO, cisplatin binds rapidly to DMSO to form a cispla t in DMSO adduct and which has been reported to have reduced ability to bind to double stranded DNA. The combination therapy of cisplatin and DMSO was proposed to enhance cytotoxicity and reduce systemic side effects in early studies [78,79] ; however, it has been recently reported that cisplatin in DMSO showed reduced toxicity to tumor cells. [80 83] Drug Delivery Systems for Cisplatin In view of these limitations including low efficacy and severe side effects, efforts have been taken to develop an ideal system for cisplatin delivery to continuously provide a prolonged high c oncentration of cisplatin locally on tumor sites to overcome the low efficacy of cisplatin to tumors and minimize the systemic toxicity as well. To achieve this goal, many delivery systems based on polymeric liposomes, micelles and microspheres had been de signed for intravenous administration on the basis of the enhanced permeability and retention (EPR) effect. [84 89] It had been reported that the cisplatin entrapped or complexed in polymeric devices has improved eff icacy and reduced systemic toxicity. [90,91] Recently, some acrylic polymers containing a carboxyl group such as poly(acrylic acid ) and poly(methyl methacrylate) have attracted attentions due to their high tolerance in vivo and most importantly, their high reactivity to interact with other therapeutic agents. [92,93] The carboxyl groups on the polymer chains have a liable complexing ability toward cisplatin ( as shown in F igure 4 2 ), therefore the polymeric matrix stabilizes cisplatin and protects it from binding to other biomolecules in a biological environment. [90] Due to the slow exchange rate of carboxyl groups with water

PAGE 54

54 molecules, the complexation provides prolonged release of cisplatin from the polymeric microspheres and further reduces systemic toxicity. However, the activity of cisplatin might be influenced by the complexation between cisplatin and the carboxylate polymers. It had been shown that the activity of cisplatin was slightly reduced after released from the cisplatin loaded po lymeric carriers. [90,80] Albumin Microspheres for Cisplatin Delivery Among all the biocompatible a nd biodegradable polymeric micro s p heres, albumin microsphere has a high potential to be the ideal carrier for cisplat in delivery due to its abundant functional groups. The amino acids in albumin provide a variety of reactive functional groups, including abundant carboxyl groups and other side groups on the amino acid residues, in the matrix and on the surface of microsph eres. The amphiphilic nature of protein molecules allows the albumin microsphere to have hydrophilic and hydrophobic domains in the matrix and enables the microsphere to load with both hydrophilic and hydrophobic drugs or biomolecules. Furthermore, the loa ding efficiency of metal ion containing drugs can be greatly improved by using albumin based microspheres as drug carriers due to the negatively charged nature of albumin proteins. Effects of Polysaccharides to Cisplatin Loading The natural, biodegradable and highly biocompatible polysaccharides, chitosan and chondroitin have been proposed for use in various kinds of biomedical applications including drug delivery systems and tissue engineering. [94 98] Chitosan is a cationic biopolymer which is obtained by deacetylation of chitin. It has been reported that the cisplatin content increased with the increasing concentration of chitosan and chitin added into the drug carrying microspheres including chitosan a l b umin micros pheres [99 102] This may be explained by the intense ionic interaction between the negatively

PAGE 55

55 charged chitosan and chitin molecules and the cationic metal ions in cisplatin. Chondroitin sulphate is an anionic sulfat ed glycosaminoglycan which is obtained from mammalian connective tissue. Chondroitin microspheres have been made for various drug delivery purposes and controllable drug release had be en achieved. [98,103] Materials and Methods Synthesis of Albumin Microspheres and Modified Albumin Microspheres The albumin microspheres were prepared by usin g the same method described in C hapter 3. T o prepare the modified albumin microspheres, a 5% w/v solution of cellulose acetate butyrate (CAB) in 1,2 dichloroethane (DCE) was used as the continuous organic phase.16.0 mL of the CAB/DCE solution was added to a 50 mL polys tyrene centrifuge tube. To prep are the chondroitin, chitosan or polyethylene glycol (PEG) modified albumin microspheres, 1 mL aqueous solution containing 50 g bovine serum albumin and 50 g chondroitin sulfate (sodium salt from shark cartilage, Sigma, St Louis, MO ) or chitosan glycol (M P Biomedicals, Solon, OH) was added into the continuous phase in the tube The mixture solution in the tube was vortexed to create a d ispersion solution at 3000 rpm for 2 min. To solidify the microspheres 8 % w/w EM grade glutaraldehyde to BSA was added th rough DCE into the emulsion solution. The tube was placed on rotator for 8 hours to complete crosslinking. Then the microspheres were washed out and air dried by th e same procedures described in C hapter 3. The appearance of MS was investigated by using opt ical microscop e. Post l oading of Cisplatin The post loaded of cisplatin into the microspheres (MS) were performed in aqueous solution, PBS, and the polar aprotic organic solvent, dimethyl sulfoxide (DMSO). To prepare the MS loaded with cisplatin in PBS, a suspension solution

PAGE 56

56 containing about 10mg cisplati n in 200 g PBS was made as the loading solution. About 40 mg of MS were dispersed in a minimal amount of acetone in the 1.5 mL microcentrifuge tubes. In the MS dispersion in the tubes, 2 00 L of the loading solution containing cisplatin were added and well dispersed by vigorously vortexing. The MS dispersions were vortexed at room temperature for 72 hours and then centrifuged to remove the supernatant solution. The tubes containing residual MS and precipitat ed cisplatin were filled with acetone, vortexed and centrifuged. The washes were repeated twice to remove the excess ive cisplatin absorbing on the surface of MS After the last centrifugation, the layer of MS loaded with cisplatin were separated from the l ayer of precipitated cisplatin and then collected. The collected cisplatin loaded MS were air dried at room temperature and stored at 4 C for later analyses. To make the loading solution for MS loaded in DMSO, 40 mg of cisplatin were completely dissolved i nto 160 L of DMSO T he loading solution was prepared freshly right before use Loading MS with cisplatin in DMSO, about 40 mg of MS were dispersed in acetone in the 1.5 mL centrifuge tubes and then the loading solution above was added. The MS were well di spersed in the loading solution and vortexed at room temperature for 4 hours. Then the dispersions were centrifuged and the supernatant were removed. The tubes containing precipitated MS were filled with acetone, vortexed and centrifuged. The acetone washe s were repeated twice to remove the excessive cisplatin absorbing on the surface of MS. After wash, the cisplatin loaded MS were air dried at room temperature and stored at 4 C.

PAGE 57

57 Measurement of Loading Efficiency and Cisplatin Release Rate To measure the l oading efficiency of cisplatin in the MS, about 1to 2 mg of MS were placed in a 15 mL centrifuge tube and then digested with at least 5 mL digest solution containing papain, protease K, ethylenediaminetetraacetic acid (EDTA) and cysteine. The suspension so lutions containing MS and enzymes were placed on a rotator in an incubator at 37 C for days. After digestion, the suspension solutions were centrifuged to precipitate the debris of MS and the supernatants were collected for analysis. To determine the cisp latin release rate from the MS, the MS were incubated in PBS and 10 g/ mL lysozyme solution. A bout 1 to 2 mg of cispla tin loaded MS were placed in a 1 0 mL centr ifuge tube and dispersed with 5 0 L acetone The suspension solution was sonicated for 10 second s to make the MS well dispersed in acetone. Then the tube was filled with PBS or 10 g/ mL lysozyme solution to 10 mL and placed on a rotator in an incubator at 37 C. Aft er an incubation of 1, 3, 7 and 14 days, the suspension solution was centrifuged and 5 mL supernatants were collected and stored at 4 C for future analysis. After each collection, 5 mL fresh 10 g/ mL lysozyme solution were added into each tube. The concentrations of cisplatin in aqueous solutions were determined by using ICP/AES, Perkin Elm er Optima 3200 RL. The standard solutions were prepared by diluting the platinum standard for ICP (TraceCERT 1000 mg/L Pt in hydrochloric acid Fluka. ) Further digesting the collected supernatants by hydrochloric acid was not necessary because the maxim al concentrations of cisplatin in the supernatants (about 100 g/ mL ) were much lower than the solubility of cisplatin in water (2.35 mg/ mL ).

PAGE 58

58 Cytotoxicity of Cisplatin Loaded Microspheres A549 cells ( ATCC #CCL 185; human lung adenocarcinoma epithelial cell line ) NCI H23 (ATCC #CRL 5800 ; human lung adenocarcinoma epithelial cell line ) CRL 2081 ( malignant mesothelioma cell line ) and Lewis lung carcinoma cells were obtained from American Type Cell Collection (Manassas, VA). The cells were cultured in RPMI 1 640 medium (Sigma, St Louis, MO) containing 10% fetal bovine serum (FBS), penicillin (100 U/ mL ), streptomycin (100 g/ mL ), fungizone (100 g/ mL ), 0.25% D glucose, 0.2% sodium bicarbonate and 1% sodium pyruvate. The cytotoxic effects of cisplatin loaded mic rospheres on lung cancer cells were determined by using the WST 1 reagent (Roche, Indianapolis, IN). 1,500 to 3,000 cells were seeded in each well of the 96 well plate and incubated in media at 37C. After 24 hours of incubation, 10 L PBS containing 11 an d 22 g cisplatin loaded MS were added into each cell to make the concentration of cisplatin loaded MS in each well to be 100 and 200 g/ mL The proliferati on rates of the cells incubated with cisplatin loaded MS were measured by using a microplate reader after 48 hours of incubation Every experiment was done in triplicates. Cytotoxicity of Cisplatin Released from Cisplatin Loaded Microspheres To determine the toxicity of cisplatin that was released out from the cisplatin loaded microspheres, the cisplati n released in PBS were collected first and reconstitute to desired concentration. About 10 mg of cisplatin loaded microspheres were dispersed in 2 mL PBS at room temperature to allow the release of cisplatin. After days of incubation, the dispersion soluti ons were centrifuged and the supernatant solution were collected and stored at room temperature. The concentration of the supernatant solution

PAGE 59

59 were determined by using ICP AES and then diluted to 10 g/ mL in PBS. A 10 g/ mL cisplatin solution was also prep ared by directly dissolving cisplatin into PBS. About 6,000 H 23 (human lung adenocarcinoma epithelial cell line ) cells were seeded into each well of the 96 well plate with 10% FBS culture media. After 24 hours of incubation at 37 C 10 L PBS containing 1.1 g of cisplatin were added in to each well to acquire a final concentration of 10 g/ mL cisplatin in each well. After 4 8 hours of incubation, the proliferation of cells incubated with and without cisplatin were determined by using WST 1 reagents. Resul ts Albumin Microspheres Loaded with Cisplatin through DMSO (CDDP/DMSO AMS) Cisplatin Content in CDDP/DMSO AMS. The AMS were post loaded with cisplatin through DMSO. The results of cisplatin content and loading efficiency were shown in T able 4 1. By using D MSO as the loading solvent, the loading content of cisplatin in microspheres increased with the incubation time in DMSO. As the loading time was minimized within seconds, the loading content of cisplatin in AMS was around 16%. After 8 hours of incubation i n DMSO, the dissolved cisplatin in DMSO were completely absorbed into the microspheres. The cisplatin content was improved to 500 g in per milligram of cisplatin loaded microspheres and the loading efficiency was close to 100%. In Vitro Release of Cispla tin from CDDP/DMSO AMS The in vitro release rate of cisplatin from CDDP/DMSO AMS(0) was determined in PBS and 10 g/ mL lysozyme solution. In F igure 4 4, The AMS loaded with cisplatin through DMSO in a minimized loading time showed a range of cisplatin rel ease from 8 0 to 130 g per milligram of

PAGE 60

60 cisp latin loaded microspheres. In an enclosed release environment, the amount of release cisplatin in solution gradually decreased and eventually reach ed a stable level. The release profile s show that the cisplatin r elease was hindered in the release environment containing lysozyme However, lysozyme in the solution further release d out cisplatin from the cisplatin loaded MS over time. In Vitro Cytotoxicity of CDDP/DMSO AMS To test the in vitro toxicity of cisplatin loaded AMS, H 23 cells were incubated with 100 g/ mL microspheres for 48 hours. Figure 4 5 shows the cytotoxicity of cisplatin loaded AMS before and after PBS wash. The cisplatin loaded AMS through a minimized incubation time showed the highest toxicity an d reduced the cell proliferation of the lung cancer cells to about 20%. However, the toxicity of cisplatin loaded AMS decreased with increasing incubation time in DMSO during loading process. After 4 hours of incubation in DMSO, cisplatin loaded AMS showed great reduction in toxicity and the cell proliferation was increased to 70%. For the cisplatin loaded AMS washed by PBS, the microspheres without further release of cisplatin still showed 20 to 35% of cell death percentage. The unloaded AMS showed no cyto toxicity to lung cancer cells at a low concentration such as 100 g/mL Cytotoxicity of Released CDDP. Figure 4 6 shows the toxic ity of cisplatin which was released out from the CDDP AMS. The cisplatin dissolved in PBS showed high toxicity and reduced the cell proliferation to 6%. The cisplatin released from the CDDP/DMSO AMS with minimized loading time in DMSO showed the same toxicity to the cisplatin dissolved in PBS. After one hour of incubation in DMSO, the cisplatin released form CDDP/DMSO AMS showed reduced toxicity and the cell proliferation slightly increased to 10%. In F igure 4 6 (B) it shows the remaining cytotoxicity of the

PAGE 61

61 cisplatin released out from the CDDP/DMSO AMS. The cytotoxicity of cisplatin loaded in the microspheres decreased to about 50% after 8 hours of incubation in DMSO. The cytotoxicity of cisplatin remained at 96% within 1 hour of incubation. Modified Albumin Microspheres Loaded with Cisplatin Cisplatin Content in Microspheres. The AMS and modified microspheres were post loaded wi th cisplatin through PBS and DMSO. The results of cisplatin content and loading efficiency were shown in T able 4 2. The loading efficiency of cisplatin through DMSO in the chitosan and chondroitin modified microspheres were lower than the albumin microsph eres. The chondroitin modified microspheres showed low loading content of cisplatin. As shown in T able 4 2, b y using the PBS loading method, the microspheres including AMS, chitosan and chondroitin modified microspheres contain less than 100 g cisplatin in per milligram of cisplatin loaded microspheres. The loading efficiency of cisplatin in microspheres after 72 hours of incubation in the cisplatin/PBS dispersion were lower than 20%. Cisplatin Release from Modified Microspheres. The samples and conditio ns in the in vitro release studies were listed in T able 4 3 and the release profiles were shown in F igure 4 7 In the studies of cisplatin release rate the chitosan modified microspheres loaded through DMSO (CDDP/DMSO chitosanMS) showed highest cisplatin release in PBS and lysozyme solution. The albumin microsp heres loaded through DMSO (CDDP/DMSO AMS ) released out around 120 g cisplatin per milligram of loaded microspheres. CDDP/DMSO chitosanMS showed the highest cisplatin release

PAGE 62

62 around 150 g per millig ram. The CDDP/DMSO chitosanMS also showed highest enhancement of cisplatin release in the lysozyme solution. For the microspheres loaded though PBS, CDDP/PBS chondroitinMS showed the highest cisplatin release which was up to 20 g per milligram in lysozym e solution. However, the CDDP/PBS AMS and CDDP/PBS chitosanMS showed a low cisplatin release under 10 g per milligram. The release amount of cisplatin from CDDP/PBS chondroitinMS was significantly enhanced in lysozyme solution. The comparison of cisplatin release rate in PBS and lysozyme solution was shown in F igure 4 8. Cytotoxicity of Cisplatin Loaded Modified Microspheres. The cytotoxicity of cisplatin loaded AMS and modified microspheres were tested by using A549, CRL 2081 and LLC cells. In F igure 4 9 t he CDDP/DMSO AMS showed efficient inhibiting effect on the proliferation of lung cancer cells. The CDDP/DMSO chitosanMS showed similar toxicity to CDDP/DMSO AMS and CDDP/DMSO chondroitinMS showed reduced toxicity. However, for the microspheres loaded th rough PBS, CDDP/PBS chondroitinMS showed the most effective inhibition on the growth of lung cancer cells. The unloaded microspheres including AMS and the modified microspheres showed neglectable toxicity toward the lung cancer cells. Discussion To obtain a high loading efficiency of cisplatin in the albumin microspheres (AMS), the high solubility of cisplatin and high swelling degree of the AMS in the loading solvent are necessary. Solid cisplatin powder can be completely dissolved by DMSO. Compared to the other organic solvent, the swelling degree of AMS in DMSO is relatively high due to the high solubility of albumin in DMSO. However, the reduction in

PAGE 63

63 toxicity of cisplatin caused by the adduction with DMSO has been reported. In the previous studies, cispl atin were loaded into microspheres composed of albumin, chitosan or PLGA. [104,100,105,106,101,102,107,108] These cisplatin loaded microspheres were mostly prepared in situ in the organic solvent in which cisplatin h as low solubility, such as acetic acid, methylene chloride and dimethylformamide Cisplatin were usually sonicated and mixed with matrix molecules to form a dispersion solution in the discontinuous phase in emulsion systems. As a result, even high contents of cisplatin in microspheres up to 20% has been reported, the aggregation of cisplatin trapped in the synthesized microspheres was unavoidable. The uneven loading of cisplatin within the microspheres may cause unexpected cisplatin release in the body of c ancer patients. However, the post loading method by using DMSO in this report provides a molecularly even loading of cisplatin within albumin microspheres. In our study, by using the PBS as the loading solvent, the loading efficiency of cisplatin into the albumin based microspheres were lower than 18%, and the cisplatin contents were lower than 90 g per milligram of microspheres, even the loading time was prolonged to 72 hours. Furthermore, the excessive cisplatin aggregated on the surface of microspheres were hardly removed. Compared to PBS, DMSO showed an extremely high efficiency loading cisplatin into the AMS. Within seconds of loading time, 32% of loading efficiency and 160 g of cisplatin content in per milligram of microspheres can be achieved. In a prolonged loading time up to 8 hours, eventually the CDDP/DMSO solution was completely absorbed into the AMS. It showed around 100% of loading efficiency and the cisplatin content reached 50% (w/w) in the AMS.

PAGE 64

64 In order to clearly investigate the interact ion between the polysaccharides and cisplatin, the loading time was prolonged to 8 hours. In the modified microspheres, chitosanMS showed a similar loading efficiency to AMS in DMSO and the chondroitinMS showed a significantly lower loading efficiency comp ared to AMS. This difference in loading efficiency in DMSO may be caused by the lower swelling degree of the chondroitin domain in the microspheres. However, the chondroitinMS showed a higher loading efficiency in PBS than AMS, whereas the chitosanMS showe d a lower one. This implies that the negatively charged chondroitin sulfate were more effective on entrapping the positively charged cisplatin into the microspheres in aqueous environment. The release rate of cisplatin from the albumin based microspheres c an be influenced by the matrix materials, crosslink density and the release environment. In addition, the release profile of cisplatin from the surface area of the microspheres can be totally different from the release prolife from bulk. Generally, cisplat in are mainly loaded in the surface area of AMS whi le the loading time is low. In F igure 4 4, it shows that the cisplatin released from CDDP/DMSO AMS(0) reached 130 g per milligram of microspheres in PBS in 24 hours. The percentage of cisplatin release to content reached 82%. However, the release of cisplatin was hindered while the CDDP/DMSO AMS were dispersed in the environment containing 10 g/ mL lysozyme in PBS. This result wa s different from that shown in F igure 4 8. In the cisplatin loaded microsphere s prepared by using a long loading time, the release rate of cisplatin from the microspheres was slightly improved in the environment containing lysozyme. This implies that the release of cisplatin from the surface area of AMS may be influenced

PAGE 65

65 more easily by the proteins in the release environment. The release from bulk may be enhanced by the particle degradation caused by enzymes. In the modified microspheres, CDDP/DMSO chitosanMS showed the highest cisplatin release in PBS and lysozyme solution; even it has lower cisplatin content. The release percentage of cisplatin from chitosanMS was arou nd 35%, and that from AMS was 23%. Thus, it reveals that chitosan can be added into AMS for controlling the release rate of cisplatin. In the modified microspheres loa ded with cisplatin through PBS, CDDP/PBS chondroitinMS showed the highest cisplatin content and highest release rate. It may be caused by the aggregation consist of microsph eres and cisplatin as shown in F igure 4 10. The aggregation prevented the excessive cisplatin on the surface of microspheres to be washed off by acetone. Cytotoxicity is the most important characteristic to determine the efficacy and effectiveness of the drug loaded microspheres. In our study, cisplatin showed decreasing toxicity while i ncubated with DMSO over time. However, the remaining toxicity of the released cisplatin was maintained above 90% wit hin 1 hour of loading time. In F igure 4 5, it showed that the cytotoxicity of CDDP/DMSO AMS decreased with loading time in DMSO. However, it was also noticeable that the CDDP/DMSO AMS showed toxicity even no further cisplatin release from the microspheres after washed by PBS. This implies that the cisplatin conjugated on the surface of AMS might have some degree of ability to kill the cancer c ells through some chemical or physical interactions. In the mo dified microspheres, the chitosan and chondroitin did not show any apparent influence on the cytotoxicity of microspheres. The unloaded AMS, chitosanMS and chondroitinMS showed low cytotoxicity and did not cause visible cell death in the in

PAGE 66

66 vitro studies. In F igure 4 9, it shows that the CDDP/DMSO chitosanMS and CDDP/DMSO AMS both showed high effectiveness on killing the lung cancer cells. From the similar toxicity of CDDP/DMSO chitosanMS and A MS, it can be assumed that the polysaccharides in the microspheres showed no effects on stabilizing the cisplatin in DMSO during the post loading process. For the microspheres loaded through PBS, the CDDP/PBS chondroitinMS killed CRL 2081 and LLC cells eff ectively, whereas the other two microspheres showed low toxicity to all these cell lines. The CDDP/DMSO AMS were designed to be injected intratumorally through the bronchoscopic needle catheter. High concentration of CDDP/DMSO AMS is convenient to inject i nto the tumor sites due to its high dispersity in aqueous solution. The CDDP/DMSO AMS can be stored in the PBS saturated with cisplatin to prevent the early release of cisplatin before injection. In addition, injecting CDDP/DMSO AMS with the saturated cisp latin solution may lower cisplatin release rate and prolong the continuous release of cisplatin. Besides, n ot only cisplatin, t he AMS can also be an ideal loading matrix for the other metal based chemotherapeutic drugs, such as zinc protoporphyrin (ZnPP) a nd cobalt protoporphyrin (CoPP), which have a high solubility in DMSO. The loading efficiency of metal based drugs in AMS can usually reach almost 100% and high drug content can be obtained.

PAGE 67

67 Figure 4 1. Mechanism of action of cisplatin administrated i ntravenously. Adduct formation inhibits DNA replication, RNA transcription and results in apoptosi s. [68] Figure 4 2. Complexation of cisplatin and carboxyl group from acrylic acid residues. [90]

PAGE 68

68 (A) (B) Figure 4 3. Chemical structure of polysaccharides: (A) chondroitin sulfate and (B) chitosan Figure 4 4 In vitro release rate of cisplatin from CDDP/DMSO AMS(0) The release rate was determ ined in PBS and 10 g/ mL lysozyme solution.

PAGE 69

69 Figure 4 5. Cytotoxicity of cisplatin loaded albumin microspheres before and after PBS wash. Reduction in toxicity of cisplatin was found with increasing loading time in DMSO. The PBS washed CCDP/DMSO AMS had almost no further cisplatin release but showed apparent toxicity compared to unloaded AMS. The proliferation of H 23 cells after 48 hours of incubation with unloaded albumin microspheres was around 110%. (A) (B) Figure4 6 The cytotoxicity of cisplatin released out from the cisplatin loaded albumin microsp heres (CDDP/DMSO AMS). The figure (A) shows the cell proliferation of H 23 after 48 hours of incubation with 10 g/ mL cisplatin released out from the CDDP/DMSO AMS which were prepared with different loading time in DMSO. Cisplatin with loading time in 1 hour showed similar cytotoxicity (above 90%) to ci splatin in PBS. The figure (B) showed the percentage of remainin g toxicity of cisplatin with various loading time. The cytotoxicity of cisplatin was determined by the cell death caused by cisplatin incubation. The cytotoxicity of cisplatin in PBS was 100%

PAGE 70

70 (A ) (B ) (C ) ( D ) Figure 4 7. Release rate of cisplatin from cisplatin loaded microspheres. The cisplatin release rate at 1, 3 and 7 days was determined in PBS and 10 g/ mL lysozyme solution For the microspheres loaded through DMSO, chitosan modified albumin microspheres showed the highest cisplatin release and chondroitin modified ones showed the lowest release rate. For the microspheres loaded through PBS, the release rates correspond to t he cisplatin content in microspheres. ( _PBS means that the release rate was determined in PBS; _Lyso means that the release rate was determined in 10 g/ mL lysozyme/PBS solution.)

PAGE 71

71 Figure 4 8. Release rate of cisplatin in PBS and 10 g/ mL lysozyme solution. The cisplatin loaded microspheres showed higher release rate of cisplatin in the environment containing lysozyme.

PAGE 72

72 ( A ) Figure 4 9 Cell proliferation of lung cancer cells treated with cisplatin loaded microspheres. This figure shows (A) A549 (B) CRL 2081 and (C) LLC cells after 48 hours of incubation with 100 and 200 g/mL of cisplatin loaded microspheres. The CDDP/DMSO AMS and CDDP/DMSO chitosanMS showed high efficiency on killing lung cancer cells. Among the microspheres loaded through PBS the chondroitin modified microspheres (CDDP/PBD chondroitinMS) showed the highest cytotoxicity. All the unloaded microspheres showed low cytotoxicity. (Proliferation percentage = cell proliferation of microspheres treated cells /proliferation of untreate d cells %)

PAGE 73

73 (B ) (C )

PAGE 74

74 (A ) (B ) (C ) Figure 4 10. Optical Images of cisplatin loaded albumin based microspheres. This figure shows (A) AMS, (B) chitosanMS and (C ) chondroitinMS loaded with cisplatin through PBS. The cisplatin loaded AMS and chitosanMS showed clean particles without excessive cisplatin aggregation after washed with acetone. However, in the chondroitinMS, the particles cannot be dispersed well and t he aggregation of microspheres and cisplatin (the dark area) were observed.

PAGE 75

75 Table 4 1. Loading efficiency and cytotoxicity of CDDP MS l oaded through DMSO. Sam ples Loading Time (hrs) CDDP Content (g per mg of CDDP MS) Loading Efficiency (%) Cytotoxicit y of CDDP Loaded MS 1 (Cell Survival %) Remaining Toxicity of Released CDDP 2 (Toxicity %) CDDP/DMSO AMS(0) 0 163 32.6% 22% 100% CDDP/DMSO AMS(1) 1 223 44.6% 46% 96% CDDP/DMSO AMS(4) 4 369 73.8% 69% 63% CDDP/DMSO AMS(8) 8 531 106% 72% 46% 1. To determi ne the cytotoxicity of CDDP loaded MS, H 23 cells were incubated with 100 g/ mL CDDP loaded MS for 48 hours. The cell proliferation were measured and compared to the untreated cells. 2 H 23 cells were incubated with10 g/ mL CDDP that were released from t he CDDP loaded MS. Cell proliferation were determined after 48 hours of incubation and compared to CD DP which was dissolved in PBS. Table 4 2. Loading content and efficiency of cisplatin in AMS and m odified AMS. Composition of MS Matrix CCDP/MS Ratio (w/ w) Loading Solvent Loading Time (hrs) CDDP Content (g per mg of CDDP MS 1 ) Loading Efficiency (%) 100%BSA 1/1 DMSO 8 531 106% 1/1 PBS 8 72 14.4% 80%BSA + 20% chitosan 1/1 DMSO 8 430 86% 1/1 PBS 8 59 11.8% 80%BSA + 20% chondroitin 1/1 DMSO 8 297 59 .4% 1/1 PBS 8 86 17.2% 1. CDDP MS: CDDP loaded microspheres. Table 4 3. Cisplatin loaded m icrospheres. Samples Matrix Compos i tion Loading Solvent Loading Time CDDP/DMSO AMS 100% BSA DMSO 8 hours CDDP/DMSO chitosanMS 80% BSA + 20% chitosan DMSO 8 h ours CDDP/DMSO chondroitinMS 80% BSA + 20% chondroitin DMSO 8 hours CDDP/PBS AMS 100% BSA PBS 72 hours CDDP/PBS chitosanMS 80% BSA + 20% chitosan PBS 72 hours CDDP/PBS chondroitinMS 80% BSA + 20% chondroitin PBS 72 hours

PAGE 76

76 CHAPTER 5 INHIBITION OF LUNG CANCER TUMOR GROWTH BY ARGININE INCORPORATED ALBUMIN MICROSPHERES Arginine is one of the essential amino acid which involves in numerous biosynthetic pathways that significantly influence tumor growth. It has been demonstrated that arginine is effecti ve to inhibit proliferation of cancer cells when an appropriate dose is applied. Generally, induction of cell death requires high concentration of arginine while low concentration of arginine facilitates cell growth instead. In addition to the apoptosis in duced by metabolism of arginine, it has also been reported that in an ideal solution environment, arginine may assemble into arginine clusters to kill cancer cells. Therefore, to make the arginine an effective anticancer agent, arginine/albumin microsphere s were designed and synthesized to provide a localized high concentration release of arginine on tumor sites t hrough intratumoral injection. In addition, the AAMS are also expected to provide an arginine rich surface on microspheres, which is similar to th e arginine cluster, to effectively inhibit tumor growth. In this study, the arginine/albumin meso s pheres ( AAMS ) were synthesized through a water/organic solvent emulsion system and the surface properties were characterized. The in vitro effects of AAMS on human lung adenocarcinoma epithelial cell line, A549, and malignant mesothelioma cell line, CRL 2081 were determined here. AAMS showed significant inhibition on proliferation, cell migration and tumor growth of A549 and CRL 2081, while freely released argi nine at the same concentration showed prompting effects. The inhibiting effects of AAMS were also further confirmed by using Western Blot and real time PCR analyses. Our studies indicate that the synthesized AAMS has a more effective inhibiting effect on g rowth of lung cancer cells than freely released

PAGE 77

77 arginine. Furthermore, the AAMS can be an ideal delivery carrier for various chemotherapeutic drugs and biomolecules to impr ove the therapeutic efficacy. Introduction Arginine to Cancer Cells Arginine and its metabolic products are involved in biosynthetic pathways that influence carcinogenesis and tumor generation. [109,110] It has been demonstrated that arginine inhibits cell growth in some cancer cells including breast, lung and gastric cancer cell lines. [111 113] The mechanisms of in hibiting cancer cell growth by arginine are still not completely understood and the reactions induced by arginine in tumor biology are complex. The nitric oxide (NO) generated through arginine metabolism has been thought as an important molecule to influen ce the cancer cell and tumor growth. NO has been reported to stimulate or inhibit cell growth, through apoptosis, depending upon NO level and cell lines. [112 116] However, it has been reported recently that the conc entration and delivery environment is crucial to make arginine, especially L arginine, an efficient anticancer molecule. [117] Depending upon the environment in solution, arginine may assemble into molecular clusters displaying a hydrophobic surface by the alignment of its methylene groups. [118,119] The hydrophobic surface of arginine clusters may interact with cancer cells through disrupting membrane integrity and lead to necrosis. Unlike the metabolism of arginine, this non metabolic process avoids the development of tumor resistance and can be more efficient to kill different types of cancer cells if high concentration of arginine presents locally. Therefore, to make the arginine an effective anticancer agent, the delivery method is extremel y important to provide an ideal local environment of arginine.

PAGE 78

78 Arginine Albumin Microspheres T o provide a localized, continuous and prolonged super high drug release of arginine at target tumor sites intratumorally injecting biodegradable particles as de livery carrier to the tumor sites has been considered as an efficient delivery method. C onsidering the similar nature of amino acid and peptide, we regard the most abundant natural plasma protein, serum albumin, as a most appealing biocompatible carrier fo r the effective localized delivery of arginine. [27,28] The arginine can be chemically incorporated with BSA t hrough th e aldehyde groups on gl utaraldehyde and maintained in the matrix of microspheres; besides, the abundant aldehyde s on surface of BSA facilitate physi sorption and covalent coupling to arginine [27,29] Here, the arginine/BSA microspheres ( AAMS ) is designed to provide a localized release of arginine, an increased therapeutic effect, and ameliorate surgical outcomes by preoperative reduction in tumor burden. The AAMS are expected to provide not only the localized release of arginine, but also an arginine rich surface which is similar to the arginine cluster and effectively inhibit tumor growth. Thus, to locally inhibit the cancer tumors, t he arginine incorporated into MS may be active on the MS surface by forming hydrophobic, highly positively charged arginine rich domains and may be released from the MS by diffusion and by degradation of BSA matrix. The AAMS were synthesized through a water/organi c solvent emulsion system. P article size in the range of 5 to 10 m was selected for efficient IT injection and tumor perfusion. The anticancer effects of AAMS on lung cancer cell lines, A549 and CRL 2081, were investigated and compared with free release d L arginine.

PAGE 79

79 Materials and Methods Cell Lines and Reagents A549 cells ( human lung adenocarcinoma epithelial cell line ) CRL 2081 ( malignant mesothelioma cell line ) and Lewis lung carcinoma cells were obtained from American Type Cell Collection (Manassas, VA). MAK9 (mouse lung carcinoma cells) were the primary cell line isolated from cancerous mouse lung tissues. The cells were cultur ed in RPMI 1640 medium (Sigma, St Louis, MO) containing 10% fetal bovine serum (FBS), penicillin (100 U/ mL ), streptomycin (100 g/ mL ), fungizone (100 g/ mL ), 0.25% D glucose, 0.2% sodium bicarbonate and 1% sodium pyruvate. The L arginine were purchased fro m Sigma, St Louis. Synthesis of L Arginine/BSA mesospheres ( AAMS ) A 5% w/v solution of cellulose acetate butyrate (CAB) (butyryl content 16.5 19.0%, Sigma, St Louis, MO) in 1,2 dichloroethane (DCE) (certified ACS grade, Fisher) was used as the continuous o rganic phase.16.0 mL of the CAB/DCE solution was added to a 50 mL polystyrene centrifuge tube. 1 mL mixture solution containing 50 g of bovine serum albumin (BSA) (A2153, Sigma) and 50 g of L arginine were added into the continuous phase. The mixture solu tion in the tube was vortexed to create a dispersion so solution at 3000rpm for 2 min. 32% w/w EM grade glutaraldehyde to BSA (Electron Microscopy Science, Hatfield, PA), was added through DCE into the emulsion solution to solidify the microspheres. The tu be was placed on rotator for 8 hours to complete crosslinking. The centrifuge tube was then filled with about 50 mL of acetone (ACS certified, Fisher) and then centrifuged at 2000 rpm for 10min to yield a clear supernatant fluid over a microspheres pellet. The acetone wash was repeated 3 times by dispersing MS in 50 mL of acetone and centrifuging each time. The appearance of MS was

PAGE 80

80 investigated by using optical microscope (Olympus, Center Valley, PA ). The control sample, albumin microspheres (AMS), were pre pared by the same procedure. Surface Morphology and Zeta Potential of AAMS The AAMS were coated with a thin layer of gold/platinum and mounted on a metal stub. The surface morphology of AMS was investigated by scanning electron microscopy (SEM) with a JEO L JSM 6400 (Tokyo, Japan). The zeta potential of AAMS and AMS dispersed in molecular grade water were measured by using PALS Zeta Potential Analyzer (Brookhaven Instruments Corp., Holtsville, NY ). Proliferation Rate of Lung Cancer Cells Treated with AAMS The effect of AAMS on Cell proliferation was determined by using the WST 1 reagent (Roche, Indianapolis, IN). About 2,500 cells were seeded in each well of the 96 well plate and incubated in media containing various concentrations of AAMS free L arginine and AMS The proliferation rates were measured after 24, 48 and 72 hours. Every experiment was done in triplicates. Wound Healing (Cell Migration) Assay About 1x10 6 cells were seeded into each well of 6 well plate. After 48 to 60 hours of incubation, cell s reached 100% confluency and then were incubated with serum free media containing free arginine, AMS and AAMS After 24 hours of incubation, the cells were scratched by 200 L pipette tips to create a wound on cell monolayer and then washed gently by PBS to remove cell debris. The wounded cells were then incubated with fresh media containing 10% FBS. The wound areas were photographed every 24 hours and every experiment was done in triplicates.

PAGE 81

81 Three Dimensional Tumor Growth Assay Matrigel (BD, Franklin L akes, NJ) was diluted with serum free media in the ratio 1:1. 200 L of diluted matrigel solution containing AAMS AMS and free arginine were added into each well of 48 well plate and then allowed to gel at 37C for at least 30 min. After gellization, A549 and CRL 2081 cells at a density of 2,000 cells per well were plated in 200 L of serum free media. Media were changed every 3 days with 2% serum media. Randomly chosen fields in each well were photographed every two days until the tumor colonies were form ed. Real Time PCR Analysis Cells were cultured on 6 cm petri dishes to 70% confluence and then incubated with 2 mL serum free media containing 4 mg of AAMS AMS or free arginine. After 6 hours of incubation, the cells were harvested and the RNA was isolat ed and purified. The RNA was diluted with RNase free water to 100 ng/ L and then 2 g of total RNA were synthesized into combinational DNA (cDNA) by reverse transcription. After the reverse transcription reaction, the samples were diluted with RNase free w ater to 100 L 10 L of the diluted reaction product were mixed with 12.5 L of SYBR Green JumpStart Taq ReayMix, 0.25 L of internal reference dye, and 2.5 L of specific oligonucleotide primers (80 nM final concentration) to a total volume of 25 L for q uantification of the real time polymerase chain reaction (PCR). SYBR Green method on the Applied Biosystems 7500 Real Time PCR system (Carlsbad, California) was utilized to perform the quantification of real time PCR. The cDNA samples were amplified by 40 repeat cycles consisted of 15 seconds of denaturation at 94C, 1 minute of annealing at 60C and 1 minute of extension at 72C. The primers used for cDNA

PAGE 82

82 amplification including forward and reverse are shown in T able 5 1. All signals were normalized to the housekeeping gene H 18S. Western Blot Analysis Cells were cultured on 6 cm petri dishes to 70% confluence and then incubated with serum free media containing AAMS AMS and free arginine After 3, 6, 12 and 24 hours the media were removed from dishes and each dish was washed by PBS. The cell lysates were scraped in PBS and then centrifuged. After centrifuge, the supernatant was discarded and the cell lysates were lysed by RIPA buffer. To determine the EphA2 receptor expression, proteins were resolved and d etected by Western blotting using antibody (Cell signaling, Boston, MA). Apoptotic DNA Ladder Analysis Cells were cultured on 6 cm petri dishes to 70% confluence and then incubated with serum free media containing AAMS AMS and free arginine. After 6 hours of incubation, the cells were scraped off the bottom and collected into a 15 mL centrifuge tube. The supernatant media were also collected with the cells to prevent losing cell debris. The isolation of DNA from the treated cells was processed by using the apoptotic DNA ladder kit (Roche, Mannheim, Germany). DNA gel electrophoresis was operated by using 75 V for 1.5 hours in 1% agarose gell. The DNA ladders were visualized by placing the gel on an UV light source and photographed. Results AAMS with Narr owe d Size Distribution in Meso s cale and Increased Zeta Potential The volume percentage and number percentage particle size distribution of AAMS are shown in F igure 5 1. In the volume percentage size distribution, AAMS in PBS showed a mean particle size of ab out 5 m with a standard deviation of 6.6. The mode

PAGE 83

83 of the distribution lied around 4 and about 95% of AAMS were synthesized in the size range between 1 to 10 m. The SEM images of AAMS were shown in F igure 5 2. After acetone wash and then air dried, AAMS showed a rough surface under SEM. From the SEM images, it was observed that most of the AAMS appeared as spheres during the preparation. The particle size of AAMS was confirmed to be distributed within the range of 1to 10 m under SEM. The zeta potential o f AAMS and AMS were measured while dispersed in water. AMS had a negatively charged surface and the mean zeta potential is 37.58 mv. For the AAMS which had been incorporated with arginine, the particle surfaces are less negatively charged with a higher me an zeta potential value of 27.51 mv. The standard errors of the mean zeta potential values are both around 1.5. The Inhibiting Effect of Free Arginine and AAMS on Proliferation Within 24, 48 and 72 hours, free arginine did not induce significant cell dea th in A549 cells at a concentration of 4 mg/ mL (about 23 mM) or lower. AAMS and AMS reduced cell proliferation with increasing concentration in media. From the proliferation rate results in F igure 5 4, 5 5, 5 6 and 5 7 AAMS showed the most effective inhib iting effect on the cell proliferation in all the cell lines. While treated with 2 mg/ mL of AAMS 50% cell growth in all cell lines had been inhibited at 24 and 48 hou rs. It can also be found that AAMS was more effective on inhibiting the cell growth of CR L 2081 which exhibit fibroblast like morphology Generally, when the concentration of arginine was lower than 4 mg/ mL in media, arginine had no significant inhibiting e ffect on cell growth. However, while the concentration reached 4 mg/ mL or higher, argini ne dramatically reduce the living cell number to a low level (below 50%). At a concentration of 2 mg/ mL or higher, the inhibiting effect of AAMS on the cell growth was two times more effective than free arginine at 24, 48 and 72 hours.

PAGE 84

84 AAMS Inhibited Cell Migration of Lung Cancer Cells In the wound healing assay, a cell free wound area was created in the cell monolayer by scraping with a pipette tip as shown in F igure 5 8 to 5 10 The results of cell migration rate showed that at the concentration of 2mg/ m L AAMS effectively inhibited the edges of A549, CRL 2081 and MAK9 cells invading into the cell free area within 48 hours. However, the same concentration of free arginine in media had no inhibiting effect on cell migration of all these lung cancer cells; it even prompts cell migration and cause faster wound healing rate. The results also showed that AMS had a slight inhibiting effect on A549 and CRL 2081 but not on MAK9. AAMS Inhibited Growth of Lung Cancer Tumors The cells were seeded into crosslinked Ma trigel network containing 2mg/ mL free arginine, AMS and AAMS The pictures of A549, CRL 2081 an d MAK9 were taken after 7 or 5 days of incubation. The results of tumor growth in F igure 5 11 and 5 12 showed that the free arginine in media prompted the tumor growth of all these cell lines. The stimulation of arginine was significant on the number, size and morphology of tumor colonies. AAMS was effective to reduce the number and size of tumor colonies in Matrigel. From the morphology of CRL 2081 cells treated with AAMS it can be found that AAMS inhibited the tumor spreading from colonies and constrain the tumors into small round colonies AAMS Inhibited Cell Growth Mainly through Necrosis The results of gel electrophore sis of apoptotic DNA ladder in F igure 5 13 showed that apoptosis was not the major mechanism causing the cell death in AAMS treated cells. In A549 cells, the separate bands of low molecular weight DNA fragment s did not appear on the lane of AAMS treated cells and which implied that apoptosis was not the

PAGE 85

85 major mechanism causing cell death However, the separate bands of low DNA fragments were observed in arginine treated A549 cells. In CRL 2081 cells, continuous bands of DNA fragments were observed in the AAMS and arginine treated cells. The separ ate bands of low molecular weight DNA fragments at around 100 and 200 bp can be observed in untreated cells and AMS treated cells. Discussion Arginine has been reported to inhibit or facilitate the growth of cancer cells based on the metabolism of arginin e. [111,112,120] The mechanism of the cell death through the metabolic process of arginine has been shown to be apoptosis. [112,113] In previous study, arginine has been shown to inhibit the growth of gastric cancer cells in vitro through apoptosis with an incubation time of 24 hours. [112] In various kinds of tumor cells, the induction of apoptosis depends on the level of NO generated through the metabolism of arginine. Generally, the induction of apoptosis requires high concentration of NO and low NO concentration can lea d to resistance to the NO induced apoptosis. [115] However, a recent study by Shukla pointed out another possible mechanism of arginine inhibit ing tumor cell growth. [117] It has been indicated that the mechanism of cell destroying by arginine is via membrane damage leading to necrosis. In the in vitro study, cell membrane damage, deficiency of NO in supernatant and the absence of apoptotic gene expression had been observed to accompany with arginine induced cell death in various cancer cell lines. Th is indicates that necrosis, instead of the metabolically driven cell death, is the most likely mechanism by which arginine inhibits the growth of cancer cells. Disruption of cell membrane is the most likely mechanism that arginine effectively kills cancer cells. Arginine molecules in a concentrated arginine solution have a high

PAGE 86

86 tendency to aggregate and assemble into a molecular cluster due to the positively charged amphiphilic molecular structure. [118,119] With the highly positively charged and hydrophobic surface, the arginine cluster can disrupt the negatively charged cell membrane and become an effective antitumor reagent. However, th e local concentration and environment is a crucial factor to influence the cytotoxicity of arginine to cancer cells. In previous study, it is observed that arginine tends to aggregate and induce tumor death at least at a concentration of 10mM. [119] To achieve this, the delivery method of arginine to tumor sites is crucial to create a local environment with high concentration of arginine and make arginine an effective antitumor agent. In this report, we synthe sized the microspheres with 50% L arginine and 50% BSA (w/w). The arginine was incorporated with BSA in the matrix of microspheres and on the su rface as well. Compared to the AMS the surface of AAMS is more positively charged and stronger interaction betw een AAMS and cancer cells was observed during the experiments. The synthesized AAMS were expected to act as an antitumor agent by providing an arginine rich surface on microspheres, similar to the arginine cluster surface, and also locally releasing argini ne to the tumor sites. In this study, the AAMS showed a more effective inhibition on cell growth than freely released arginine. AAMS inhibited the growth of lung cancer cells including A 549, CRL 2081, LLC and MAK9 with a relatively low concentration; more over, the efficacy has been prolonged since the arginine incorporated within AAMS are less likely to be involved into metabolism. This indicates that the arginine incorporated on microspheres can be more effective to inhibit the growth of cancer cells than the free arginine in environment. However, the

PAGE 87

87 cytotoxicity of AAMS to normal cells was not a concern here since AAMS is designed to kill cancer cells through direct intratumoral injection instead of intravenous transport. The inhibition of tumor growth by AAMS was demonstrated by using the 3 denmensional tumor growth assay in Matrigel. The results showed that the AAMS effectively reduced the size and number of the tumor colonies in an incubation of 4 to 7 days, while the lung cancer cells treated with f ree arginine showed a prompted tumor growth. In CRL 2081, it is noteworthy that the AAMS in the environment not only reduced the number and size in tumor colonies but also had a significant influence on tumor morphology. In untreated cells and the cells tr eated with free arginine and AMS, the cells spread out from the tumor colonies and connected to other cells. However, it was observed that the cell spreading was inhibited in the cells treated with AAMS It has been demonstrated that arginine inhibited gro wth of gastric cancer cells with increased apoptosis but no effect on tumor cell invasion. [112] However, our study showed that the AAMS we synthesized has a promising inhibiting effect on the cell migration of lung cancer cells, whereas the free arginine prompted the cell migration.

PAGE 88

88 Figure 5 1. Chemical structure of arginine. Figure 5 2 Pa rticle size distribution of arginine/albumin microspheres( AAMS ) in PBS. Solid line represents the size distribution in volume percentage and dash line represents number percentage. The particle diameter (x axis) is shown using a logarithmic scale based on 10. (a) (b) Figure 5 3 SEM images of arginine/albumin microspheres ( AAMS ) (a) Surface morphology of air dried AAMS after acetone wash. (b) Dry AAMS at lower magnitude.

PAGE 89

89 ( A ) (B ) (C ) Figure 5 4. Cell proliferation of A549 treated with free arginine AMS and AAMS A t (A)24, (B)48 and (C )72 hours, AAMS showed more effective inhibiting effect on proliferation than free L arg inine. F ree arginie had no significant effect when the incubating concentraion was lower than 8 mg/ mL The inhibiting effects of t he same concentrations of free arginine and AAMS are compared in these charts. However, the AAMS contains no more than 50%(w/w) of arginine in the microsphere matrix, which implies that the arginine from AAMS is more effective inhibiting cell growth than t wo times more arginine freely released in environment.

PAGE 90

90 (A ) (B ) (C ) Figure 5 5. Cell proliferation of CRL 2081 treated with free arginine, AMS and AAMS A t (A)24, (B)48 and (C )72 hours, AAMS showed obvious inhibiting effect on cell proliferation whil e the AMS at the same concentration had no significant effect. At some concentrations, the proliferation rates of arginine treated cells were two times higher than that of AAMS treated cells.

PAGE 91

91 ( A ) (B ) (C ) Figure 5 6. Cell proliferation of LLC treated w ith free arginine, AMS and AA MS A t (A)24, (B)48 and (C )72 hours t he inhibiting effect of AAMS on LLC was significant and constant. At the concentraiton of 2 mg/ mL and higher, AAMS was more effective than arginine on inhibiting the proliferation of LLC cell line within 48 hours. The effectivenss of low concentration of arginine in culture media decreased with time and showed prompting effect after 72 hours of incubation

PAGE 92

92 (A ) (B ) (C ) Figure 5 7. Cell proliferation of MAK9 treated with free arginine, AMS and AAMS A t (A)24, (B)48 and (C )72 hours AAMS had significant inhibiting effect on the proliferation of MAK9 at low concentrations below 1 mg/ mL

PAGE 93

93 (A ) (B ) (C ) Figure 5 8 Cell migration of A549 cells treated with arginine, AMS and AAMS (A ) A AMS significantly inhibited the cell migration of A549 cells at the incubat ing concentration of 2 mg/ mL (B ) Within 48 hours, free arginine prompted the cell migration of A549 cells while AAMS inhibit ed the migration effectively. (C ) The microscopic photog raphs of wound areas on A549 cell monolayer. The cells were incubated with 4 mg AMS AAMS and free arginine in 2 mL culture media. (The relative migration distance is defined as the ratio of the migration distance under certain treatment at certain incuba tion time to the migration distance of control at 48 hours; the value of untreated A549, CRL 2081 and MAK9 at 48 hours are defined as 1.)

PAGE 94

94 (A ) (B ) (C ) Figure 5 9 Cell migration of CRL 2081 cells treated with arginine, AMS and AAMS (A ) The inhibitin g effect of AAMS on cell migration of CRL 2081 became obvious when the incubating concentrations of AAMS were higher than 1 mg/ mL (B ) Within 48 hours, AAMS effectively inhibited wound recovering on the CRL 2081 monolayer while free arginine at the same co ncentration had no significant ef fect on cell invasion. (C ) The microscopic photographs of wound areas on CRL 2081 cell monolayer. The cells were incubated with 4 mg AMS AAMS and free arginine in 2 mL culture medi a.

PAGE 95

95 (A ) (B ) Figure 5 10 Cell migra tion of MAK9 treated with arginine, AMS and AAMS. A t 24 and 48 hours of incubation in wound healing as say, t he inhibiting effect of AAMS and prompting effect of free arginine on cell migration wer e observed in MAK9 The cells were incubated with 4 mg AMS, AAMS and free arginine in 2 mL culture media containing 1 0% serum.

PAGE 96

96 Figure 5 11 The microscopic photographs of A549 tumor growth in matrigel The incubating concentration of free arginine, AMS and AAMS in matrigel was 2 mg/ mL After 7 days of incubation, the n umber of tumor colonies was prompted by free arginine in gel. However, the size and number of tumor colonies were significantly reduced by AAMS treatment, although the inhibiting effect of AMS on tumor growth was also observed.

PAGE 97

97 Figure 5 12 The micro scopic photographs of CR L 2081 tumor growth in matr igel The incubating concentration of free arginine, AMS and AAMS in matrigel was 2 mg/ mL After 5 days of incubation, v igorous tumor formation and cell spreading were observed in CRL 2081 cells treated wit h free arginine and without any treatment. Significant prompting effect of free arginine on tumor size and number was observed. In AAMS treated cells, the size and number of tumor colonies were significantly reduced and the cell spreading was totally inhib ited. The inhibiting effect of AMS on tumor growth was observed as well; however, cell spreading in AMS treated cells was still visible.

PAGE 98

98 Fig ure 5 13 Gel electrophoresis of apoptotic DNA ladder A549 and CRL 2081 cells were treated with AMS AAMS and fr ee arginine. The DNA was extracted from the treated cells after 6 hours of incubation. The result showed that apoptosis wa s not the major mechanism causing the death of AAMS treated cells. 100 b p DNA ladder ma r ker was used as the molecular size standard

PAGE 99

99 Table 5 1. Primers used in quantitative reverse transcriptase PCR a nalysis Note: S = sense primer; A = antisense primer Gene (Accession No.) Primer Product size (base pairs) EphA2 (NM_004431) TTCAGCCACCACAACATCAT TCAGACACCTTGCAGACCAG 263 Slug (BC_015895) AAGCATTTCAACGCCTCCAA AAGGTAATGTGTGGGTCCGA 358 H Ras GAGACCCTGTAGGAGGACCC GGGTGCTGAGACGAGGGACT 151 N Ras AACTGGTGGTGGTTGGACCA (S) ATATTCATCTTACAAAGTGGTCCTGGA 150 K Ras ACTGAATATAAACTTGTGGTAGTTGGACCT TCAAAGAATGGTCCTGGACC 357 H18S GATATGCTCATGTGGTGTTG (S) AATCTTCTTCAGTCGCTCCA (A) 236

PAGE 100

100 Table 5 2. Gene expression in cells treated with arginine, AAMS and AMS Gene Description Gene expression A549 CRL 2081 Arg AAMS AMS Arg AAMS AMS EphA2 A receptor tyr osine kinase that is overexpres sed by human cancers but expressed at low level in normal cells, and involved in crucial processes to malignant progression. 11.9 (+) 0.41 ( ) 0.26 ( ) 11.6 (+) 0.76 ( ) 0.23 ( ) Slug A Transcription factor that regulates the expression of tumor suppressors and associates with cell migration. 2.9 (+) 0.23 ( ) 0.23 ( ) 3.77 (+) 0.07 ( ) 0.22 ( ) H Ras Activation of Ras signaling causes cell growth, differentiation and survival. Ras are often deregulated in cancers, and which leads to increased invasion and metastasis, and decreased apoptosis. ------N Ras ------K Ras ---3.78 (+) -0.26 ( ) (+) = upregulation; ( ) = downregulation.

PAGE 101

101 C H APTER 6 CONCLUSION The present study demonstrates that ephrin A1 conjugated on the surface of AMS remained stable and efficient to inhibi t NSCLC cell growth and migration after being released locally from the microspheres via phagocytosis and degradation. Moreover, the low cytotoxicity and high phagocytic rate allow the AMS to be widely applied into various delivery systems. The present dat a provides a promising foundation for future in vivo studies and offers exciting avenue for the development of receptor targeted therapeutic drugs that may help to m anage the patients with NSCLC. The albumin microspheres loaded with cisplatin through DMSO, CDDP/DMSO AMS, showed a high loading efficiency of cisplatin and the drug content reached 16% (w/w). Most importantly, the toxicity of cisplatin remained at almost 100% after the short post loading process in DMSO. The CDDP/DMSO AMS showed high effectiven ess on killing lung cancer cells in the in vitro study. In addition, chitosan can be incorporated into the albumin microspheres to control the release rate of cisplatin This study provides an efficient approach to obtain high content of metal based drugs in albumin based delivery matrix. The arginine/albumin microspher es we synthesized here showed significant effectiveness on inhibiting growth and migration of the lung cancer ce lls including A549, CRL 2081, MAK9 and LLC cells. AAMS acted as a more effecti ve antitumor agent on the lung cancer cells than arginine. The AAMS showed constant inhibiting effects on the growth and migration of lung cancer cells; whereas the freely released arginine showed stimulation on cell growth and migration at some concentrat ions. This implies that creating a microenvironment with high concentration of arginine is a more effective

PAGE 102

102 approach to kill cancer cells. In addition, AAMS has a high potential to be applied into an intratumoral therapy for different types of canc er s due to its antitumor ability, stron g interaction with cells and most importantly, the high safety. All the albumin based meso or microspheres showed the ability to inhibit growth of lung cancer cells in these studies. In addition, the extensive applications of albumin based microspheres as a delivery carrier used for various purposes have been shown here. The high stability, low cytotoxicity, fast phagocytosis, and easy modification of albumin mesospheres enable them to be easily applied into any biomedical device and biological system. The works in this dissertation provide a promising foundation for further in vivo and clinical studies, and furthermore, open a view of the application of albumin based mesospheres into various delivery systems.

PAGE 103

103 APPENDIX SI LICONE OIL ADHE SION ON INTRAOCULAR LENSES (IOLS ) The aim of this study is to determine the interaction between silicone oil and various clinical ly used intraocular lenses (IOLs). Silicone oil remnant on IOLs after surgery can lead to visual loss and reoccu rrence of cataract for the patients. Therefor e, the degree of silicone oil adhesion on IOLs is an important property that influences the choosing of IOLs for implantation. In this study, the coverage area and contact angle of silicone oil on IOLs were inve stigated and measured in vitro. The results showed that silicone oil adhesion on IOLs increase d with increasing lens polymer hydrophobicity Santen, Alcon and Meridian IOLs showed significantly lower silicone oil coverage and higher silicone oil contact an gle than the others. Introduction Silicone oil has been widely used as an adjunct the vitreous fluid substitute, in the management of complicated retinal disorder and detachments. [121 123] I t has been reported that the interaction between silicone oil and the posterior lens capsule can induce the formation of cataract. [124 126] The silicone oil adhesion on IOLs has been reported to cause visual loss and aberration for the pat ients as well as obstruction during surgical operation. [127] During and after the lens implantation surgery, t he removal of the remaining silicone oil from the posterior sur face of IOLs can be extremely difficult due to the stro ng interaction [128 132] Although various physical and chemical methods for silicone oil removal from IOLs have been reported, effectively removing the adhered silicone oil without damaging the IOLs and ocular tissu es still cannot be clinically feasible. [133,134] Thus, choosing the IOLs with the surface properties, such as high hydrop hilicity and specific morphology is extremely important to avoid serious

PAGE 104

104 silicone oil adhesio n on IOLs. T o determine the surface of various IOLs and the interaction between IOLs and silicone oil, the in vitro studies including water and silicone oil contact angle as well as silicone oil adhesion on IOLs were investigated in this report Materials and Methods Three Santen X 60 IOLs, three ALCON AcrySof IOLs, three Sensar AMO IOLs three HOYA AF 1 IOLs three Meridian, Bausch & Lomb IOLs and c linical quality silicone oil (ADATO SIL OL 5000, Bausch & Lomb) was provided by company Alcon Unisol 4 balan ced saline solution (BSS) was used to rinse the IOLs. Before immersion into silicone oil, IOLs were rinsed in BSS and then placed on Kimwipes to remove all the BSS droplets on the surfaces. After 5 minutes of immersion in silicone oil, the IOLs were shake n gently and vortexed at 2000rpm for 1 minute to remove excess silicone oil. After vortex, as shown in F igure A 1, the IOLs were placed on petri dish and immersed vertically into BSS by using a dip coater (KSV DC) at the rate of 50mm/min. Pictures were tak en from top and side after immersion into BSS by using Optical Microscope (Axioplan 2 imaging, ZEISS) and Ram Hart goniometer (Model 200, Ram hart instrument co.). Three of each IOL were used in this experiment. To calculate the silicone oil coverage are a, the coverage area on both anterior and posterior surfaces were filled up manually and then calculated by using the image process program, ImageJ Contact angle of silicone oil on IOLs in saline solution were measured using ImageJ as well.

PAGE 105

105 Results and D iscussion Here the silicone oil adhesion on intraocular lenses was determined by using double immersion method, in which the IOLs were immersed in silicone oil first and then immersed again in saline solution. To measure the silicone o il coverage on IOL s b y using double immersion method, the coverage percentage can be influenced by lens materials, lens curvature, the amount of silicone oil adhered on IOLs and the immersion conditions into saline solution, such as speed and degree. Hence, the vortex shaking and mechanical dipping were applied in this study to obtain reproducible results. After the silicone oil covered IOLs were immersed into saline solution, all the silicone oil assembled into a big droplet on both anterior and posterior surfaces (as shown i n F i gure A 2 ) The area and contact angle of the silicone oil droplets relate to the interaction between IOL s and silicone oil. The smaller coverage area and higher contact angle correspond to less attractive interaction between the IOL and silicone oil su rfaces. In addition, the results of F igure A 3 showed that the coverage area and shape of silicone oil on IOLs remain the same after a vigorous vortex shaking in BSS. In the results shown in T able A 1 Santen, Alcon and Meridian IOLs showed significantly l ower silicone oil coverage and lower advancing water contact angle than Hoya and Sensar. The images of silicone oil contact ang le on IOLs in BSS are shown in F igure A 5. Lower silicone oil contact angle implies higher attracting interaction between silico ne oil and IOL surface. The contact angle of silicone oil on IOLs cannot be investigated in air because the strong interaction between silicone oil and IOLs cause wide spreading of silicone oil on IOLs. The results of silicone contact angle in T able A 2 co rresponded to the result of silicone oil coverage. However, it showed lower standard deviation than the

PAGE 106

106 results of silicone oil coverage. This is because the silicone oil coverage area on the IOLs can be influenced by the amount of silicone oil adhered on the IOLs before immersi ng into saline solution as well as the immersi on methods ; however the volume of silicone oil droplet and immersion procedure are both not crucial factor s with regard to silicone oil wetting of IOLs. This implies that this silicone o il contact angle method may provide a more efficient and reliable way to determine the interaction between silicone oil and IOLs. In F igure A 5, it shows that the silicone oil coverage on IOLs corresponds to the hydrophilicity of IOL surfaces. The IOLs wit h higher hydrophilic surface properties showed smaller silicone oil adherence on the surface and higher silicone o il contact angle. According to F igure A 6, although the advancing water contact angle on dry AVS IOLs is higher than that on dry Alcon IOLs, t he advancing water contact angle on hydrated AVS IOLs can be lower than that on dry Alcon IOLs. Thus it is explainable that the AVS (Santen) IOLs showed similar results with Alcon IOLs, and sometimes even better, since the AVS IOLs are stored and hydrated in saline and Alcon IOLs are stored in dry condition. Conclusion Silicone oil adhesion on IOLs appears to increase with increasing lens polymer hydrophobicity The IOLs with higher silicone oil coverage on the surface showed smaller silicone oil contact a ngle Santen (AVS) IOL exhibits slightly less silicone adherence than Acrysof, but markedly less th an Hoya and Sensar. No significant difference was found between silicone oil coverage of San ten IOL and a hydrophilic IOL (M eridian).

PAGE 107

107 Figure A 1. Immer sing IOLs by using dip coater. Figure A 2. Frontal view of silicone oil covered IOLs in BSS. The droplets on IOLs are silicone oil.

PAGE 108

108 (A ) (B ) (C ) Figure A 3. Effect of vortexing on s ilicone oil adhesion on IOLs. (A )Silicon e oil covered IOL in BSS, and (B ) silicone oil covered IOL in BSS after vortexed in BSS. Silicone oil covered IOLs were vortexed at 2000rpm for 1 minute in BSS. The results showed that the vortexing did not affect the distribution of silicone oi l adhered on the IOL surface. (C ) Image a nalysis (light blue: silicone oil coverage on the anterior surface; deep blue: coverage on the posterior surface). Figure A 4 Side view of silicone oil covered IOLs in BSS. The droplets on IOLs are silicone oil.

PAGE 109

109 Figure A 5 The chart of silicone oil coverage versus silicone oil contact angle on IOLs in BSS and water contact angle. Figure A 6. Advancing water c ontac t angle v ersus hydration measured up to four weeks The contact angle was measured using the sessile drop method. ( AMO = Sensar; AVS = Sentan; data were extracted contact angle report, 2006.)

PAGE 110

110 Table A 1. Silicone oil coverage on IOLs (%) IOLs Santen ALCON HOYA Sensar Meridian IOL 1 16.2 34.5 40.4 35.0 21.8 IOL 2 22.9 21.3 27.4 33.5 23.0 IOL 3 29.3 20.7 48.3 44.6 23.0 Average 22.8 2 5.5 38.7 37.7 22.6 Standard deviation 6.6 7.8 10.6 6.0 0.6 Advancing water contact angle on dry IOLs () 76 + 3 74 + 3 90 + 5 88 + 2 angle report 2006. Table A 2. Co ntact angle of silicone oil on IOLs in saline solution () IOLs Santen ALCON HOYA Sensar Meridian IOL 1 72 67 44 43 70 IOL 2 68 65 46 47 73 IOL 3 67 67 46 45 75 Average 69 66 45 45 73 Standard deviation 3.6 2.5 3.5 2.3 4.3

PAGE 111

111 LIST OF REFERENCE S 1. American Cancer Society. Cancer Facts & Figures 2011 Atlant a: American Cancer Society; 2011 2. Junker, K., et al. Pathology of Small Cell Lung Cancer. Journal of Cancer Research and Clinical Oncology 2000; 126: 361 368. 3. M ller, K. M., Menne, R. Small Cell Carcinoma of the Lung: Pathological Anatomy. Recent Results of Cancer Research 1985; 97: 11 24. 4. Hoffman, P. C., et al. Lung Cancer. The Lancet 2000; 355: 479 485. 5. Travis, W. D., et al. Lung Cancer. Can cer Supplement 1995; 75: 191 202. 6. Parkin, D. M., et al. Global Cancer Statistics. CA Cancer Journal Clinics 2005; 55: 74 108. 7. Charloux, A., et al. International Differences in Epidemiology of Lung Adenocacinoma. Lung Cancer 1997; 16: 133 43. 8. Molin a, J. R., et al. Non Small Lung Cancer: Epidemiology, Risk Factors, Treatment, and Survivorship. Symposium of Solid Tumors 2008; 83: 584 594. 9. Ginsberg, R. J., Rubinstein, L. V. Randomized Trial of Lobectomy Versus Limited Resection for T1 No Non Small L ung Cancer. Annual Thorac Surgery 1995; 60: 615 622. 10. Passlick, B. Initial Surgical Staging of Lung Cancer. Lung Cancer 2003; 42: 21 25. 11. Martini, N., et al. Incidence of Local Recurrence and Second Primary Tumors in Resected Stage I Lung Cancer. Gen eral Thoracic Surgery 1995; 109: 120 129. 12. Pfister, D. G., et al. American Society of Clinical Oncology Treatment of Unresectable Non Small Cell Lunhg Cancer Guideline: Updated 2003. Journal of Clinical Oncology 2004; 22: 330 353. 13. Morris, M., et al. Pelvic Radiation with Concurent Chemotherapy Compared with Pelvic and Para Aortic Radiation for High Risk Cervical Cancer. New England Journal of Medicine 1999; 340: 1137 1143. 14. Rose, P. G., et al. Concurrent Cisplatin Based Radiotherapy for Locally Ad vanced Cervical Cancer. New England Journal of Medicine 1999; 340: 1144 1153. 15. Larson, S. S., et al. Neoadjuvant Chemotherapy in Non Small Cell Lung Cancer. Ugeskr Laeger 1999; 161: 6169 6173.

PAGE 112

112 16. Felip, E., Rosell, R. Is the Evidence in Favor of Neoadj uvant Chemotherapy in Stage Iiia (N2) Non Small Lung Cancer Solid Enough? Monaldi Archives for Chest Disease 2000; 55: 305 310. 17. Komaki, R., et al. Induction Cisplatin/Vinblastine and Irradiation Versus Irradiation in Unresectable Squamous Cell Lung Can cer: Failure Patterns by Cell Type in Rtog 88 08/Ecog 4588. International Journal of Radiation Oncology Biology Physics 1997; 1997: 537 44. 18. Dillman, R. O., et al. Improved Survival in Stage Iii Non Small Cell Lung Cancer: Seven Year Follow up of Cancer and Leukemia Group B (Calgb) 8433 Trial Journal of the National Cancer Institute 1996; 88: 1210 15. 19. Goldberg, E. P., et al. Intratumoral Cancer Chemotherapy and Immunotherapy: Opportunities for Nonsystemic Preoperative Drug Delivery. Journal of Pharma cy and Pharmacology 2002; 54: 159 180. 20. Celikoglu, F., et al. Bronchoscopic Intratumoral Chemotherapy of Lung Cancer. Lung Cancer 2008; 61: 1 12. 21. Celikoglu, F., et al. Intratumoural Chemotherapy of Lung Cancer for Diagnosis and Treatment of Draining Lymph Node Metastasis. Journal of Pharmacy and Pharmacology 2010; 62: 287 293. 22. Celikoglu, F., et al. Intratumoral Administration of Cisplatin through a Bronchoscope Followed by Irradiation for Treatment of Inoperable Non Small Cell Obstructive Lung Ca ncer. Lung Cancer 2006; 51: 225 236. 23. Celikoglu, S. I., et al. Endobronchial Intratumoral Chemotherapy (Eitc) Followed by Surgery in Early Non Small Cell Lung Cancer with Polypoid Growth,Causing Erroneous Impression of Advanced Disease. Lung Cancer 2006 ; 54: 339 346. 24. Han, L. Q., et al. The Clinical Significance of Epha2 and Ephrin a 1 in Epithelial Ovarian Carcinomas. Gynecologic Oncology 2005; 99: 278 286. 25. Okada, H., Toguchi, H. Biodegradable Microspheres in Drug Delivery. Critical Reviews in Th erapeutic Drug Carrier Systems 1995; 12: 1 99. 26. Kawaguchi, H. Functional Polymer Microspheres. Progress in Polymer Science 2000; 25: 1171 1210. 27. Longo, W. E., Goldberg, E. P. Hydrophilic Albumin Microspheres. Methods in Enzymology 1985; 112: 18 26. 2 8. Longo, W. E., et al. Preparation of Hydrophilic Albumin Microspheres Using Polymeric Dispersing Agents. Journal of Pharmaceutical Sciences 1982; 71: 1323 1328.

PAGE 113

113 29. Jones, P. D. E., Illum, L. Attachment of Monoclonal Antobodies to Microspheres. Methods i n Enzymology 1985; 112: 67 84. 30. Almond, B. A., et al. Efficacy of Mitoxantrone Loaded Albumin Microspheres for Intratumoral Chemotherapy of Breast Cancer. Journal of Controlled Release 2003; 91: 147 155. 31. Patel, N. M., et al. Conventional Transbronch ial Needle Aspiration Decreases the Rate of Surgical Sampling of Intrathoracic Lymphadenopathy*. Chest 2007; 131: 773 778. 32. Putney, S. D. Encapsulation of Proteins for Improved Delivery. Current Opinion in Chemical Biology 1998; 2: 548 552. 33. Bartus, R. T., et al. Sustained Delivery of Proteins for Novel Therapeutic Products. Science 1998; 281: 1161 1162. 34. Langer, R. New Methods of Drug Delivery. Science 1990; 249: 1527 1533. 35. Putney, S. D., Burke, P. A. Improving Protein Therapeutics with Sustai ned Release Formulations. Nature Biotechnology 1998; 16: 153 157. 36. Grenha, A., et al. Microencapsulated Chitosan Nanoparticles for Lung Protein Delivery. European Journal of Pharmaceutical Sciences 2005; 25: 427 437. 37. Cohen, S., et al. Controlled Del ivery Systems for Proteins Based on Poly(Lactic Glycolic Acid) Microspheres. Pharmaceutical Research 1991; 8: 713 720. 38. Blanco, D., Alonso, M. J. Protein Encapsulation and Release from Poly(Lactide Co Glycolide) Microspheres: Effect of the Protein and P olymer Properties and of the Co Encapsulation of Surfactants. European Journal of Pharmaceutics and Biopharmaceutics 1998; 45: 285 294. 39. Bouillot, P., et al. Protein Encapsulation in Biodegradable Amphiphilic Microspheres. International Journal of Pharm aceutics 1999; 181: 159 172. 40. Stivaktakis, N., et al. Immune Responses in Mice of Beta Galactosiclase Adsorbed or Encapsulated in Poly(Lactic Acid) and Poly(Lactic Co Glycolic Acid) Microspheres. Journal of Biomedical Materials Research Part A 2005; 73A : 332 338. 41. Nam, Y. S., Park, T. G. Protein Loaded Biodegradable Microspheres Based on Plga Protein Bioconjugates. Journal of Microencapsulation 1999; 16: 625 637. 42. Takeoka, S., et al. Conjugation of Von Willebrand Factor Binding Domain of Platelet G lycoprotein Ib Alpha to Size Controlled Albumin Microspheres. Biomacromolecules 2000; 2: 290 295.

PAGE 114

114 43. Berner, V. K., et al. Conjugation of Protein Antigen to Microparticulate Beta Glucan from Saccharomyces Cerevisiae: A New Adjuvant for Intradermal and Ora l Immunizations. Applied Microbiology and Biotechnology 2008; 80: 1053 1061. 44. Keegan, M. E., et al. In Vitro Evaluation of Biodegradable Microspheres with Surface Bound Ligands. Journal of Controlled Release 2006; 110: 574 580. 45. Van De Weert, M., et al. Protein Instability in Poly(Lactic Co Glycolic Acid) Microparticles. Pharmaceutical Research 2000; 17: 1159 1167. 46. Determan, A. S., et al. Protein Stability in the Presence of Polymer Degradation Products: Consequences for Controlled Release Formula tions. Biomaterials 2006; 27: 3312 3320. 47. Walker Daniels, J., et al. Overexpression of the Epha2 Tyrosine Kinase in Prostate Cancer. Prostate 1999; 41: 275 280. 48. Ogawa, K., et al. The Ephrin A1 Ligand and Its Receptor, Epha2, Are Expressed During Tum or Neovascularization. Oncogene 2000; 19: 6043 6052. 49. Nakamoto, M., Bergemann, A. D. Diverse Roles for the Eph Family of Receptor Tyrosine Kinases in Carcinogenesis. Microscopy Research and Technique 2002; 59: 58 67. 50. Hafner, C., et al. Differential Gene Expression of Eph Receptors and Ephrins in Benign Human Tissues and Cancers. Clinical Chemistry 2004; 50: 490 499. 51. Nakamura, R., et al. Epha2/Efna1 Expression in Human Gastric Cancer. Cancer Science 2005; 96: 42 47. 52. Xu, F., et al. Predictive V alue of Epha2 and Ephrina 1 Expression in Oesophageal Squamous Cell Carcinoma. Anticancer Research 2005; 25: 2943 2950. 53. Nasreen, N., et al. Silencing the Receptor Epha2 Suppresses the Growth and Haptotaxis of Malignant Mesothelioma Cells. Cancer 2006; 107: 2425 2435. 54. Nasreen, N., et al. Receptor Epha2 Activation with Ephrina1 Suppresses Growth of Malignant Mesothelioma (Mm). Cancer Letters 2007; 258: 215 222. 55. Brannan, J. M., et al. Epha2 in the Early Pathogenesis and Progression of Non Small Cel l Lung Cancer. Cancer Prevention Research 2009; 2: 1039 1049. 56. Moon, J. J., et al. Synthetic Biomimetic Hydrogels Incorporated with Ephrin A1 for Therapeutic Angiogenesis. Biomacromolecules 2007; 8: 42 49. 57. Schaller, M. D., et al. Pp125fak, a Structu rally Distinctive Protein Tyrosine Kinase Associated with Focal Adhesions. Proceedings of The National Academy of Science of The United States of America 1992; 89: 5192 5196.

PAGE 115

115 58. Schlaepfer, D. D., et al. Control of Motile and Invasive Cell Phenotypes by F ocal Adhesion Kinase Biochimica et Biophysica Acta 2004; 1692: 77 102. 59. Meng, X. N., et al. Characterisation of Fibronectin Mediated Fak Signalling Pathways in Lung Cancer Cell Migration and Invasion. British Journal of Cancer 2009; 101: 327 334. 60. S elvakumaran, M., et al. Enhanced Cisplatin Cytotoxicity by Disturbing the Nucleotide Excision Repair Pathway in Ovarian Cancer Cell Lines. Cancer Research 2003; 63: 1311 1316. 61. Murata, T., et al. Molecular Mechanism of Chemoresistance to Cisplatin in Ov arian Cancer Cell Lines. International Journal of Molecular Medicine 2004; 13: 865 868. 62. O'dwyer, P. J., et al. Clinical Status of Cisplatin, Carboplatin, and Other Platinum Based Antitumor Drugs. In: B. Lippert, Editor, Cisplatin. Chemistry and Biochem istry of a Leading Anticancer Drug, Verlag CH, Basel 1999; 63. Sharp, S. Y., et al. Transport of Cisplatin and Bis Acetato Ammine Dichlorocyclohexyl Amine Platinum(Iv) (Jm216) in Human Ovarian Carcinoma Cell Lines: Identification of a Plasma Membrane Prot ein Associated with Cisplatin Resistance. Clinical Cancer Research 1995; 1: 981 989. 64. Sherman, S. E., Lippard, S. J. Structural Aspects of Platinum Anticancer Drug Interactions with DNA. Chemical Reviews 1987; 87: 1153 1181. 65. Pascoe, J. M., Roberts, J. J. Interactions between Mammalian Cell DNA and Inorganic Platinum Compounds .1. DNA Interstrand Crosslinking and Cytotoxic Properties of Platinum(Ii) Compounds. Biochemical Pharmacology 1974; 23: 1345 1357. 66. Speelmans, G., et al. The Interaction of t he Anti Cancer Drug Cisplatin with Phospholipids Is Specific for Negatively Charged Phospholipids and Rakes Place at Low Chloride Ion Concentration. Biochimica Et Biophysica Acta Biomembranes 1996; 1283: 60 66. 67. Zamble, D. B., Lippard, S. J. Cisplatin a nd DNA Repair in Cancer Chemotherapy. Trends in Biochemical Sciences 1995; 20: 435 439. 68. Kartalou, M., Essigmann, J. M. Mechanisms of Resistance to Cisplatin. Mutation Research 2001; 478: 23 43. 69. Zhen, W. P., et al. Increased Gene Specific Repair of Cisplatin Interstrand Cross Links in Cisplatin Resistant Human Ovarian Cancer Cell Lines. Molecular and Cellular Biology 1992; 12: 3689 3698.

PAGE 116

116 70. Reedijk, J. New Clues for Platinum Antitumor Chemistry: Kinetically Controlled Metal Binding to DNA. Proceedin gs of The National Academy of Science of The United States of America 2003; 100: 3611 3616. 71. Garattini, S. L. V., C. Perspectives in Cancer Chemotherapy European Journal of Cancer 2001 37: S128 S147 72. Lebwohl, D., Canetta, R. Clinical Development of Platinum Complexes in Cancer Therapy: An Historical Perspective and an Update. European Journal of Cancer 1998; 34: 1522 1534. 73. Ferguson, L. R., Pearson, A. E. The Clinical Use of Mutagenic Anticancer Drugs. Mutation Research Fundamental and Molecula r Mechanisms of Mutagenesis 1996; 355: 1 12. 74. Ekborn, A., et al. D Methionine and Cisplatin Ototoxicity in the Guinea Pig: D Methionine Influences Cisplatin Pharmacokinetics. Hearing Research 2002; 165: 53 61. 75. Decatris, M. P., et al. Platinum Based Chemotherapy in Metastatic Breast Cancer: Current Status. Cancer Treatment Reviews 2004; 30: 53 81. 76. Deconti, R. C., et al. Clinical and Pharmacological Studies with Cis Diamminedichloroplatinum(Ii). Cancer Research 1973; 33: 1310 1315. 77. Stern, S. T. Potter, T. M. Llc Pka Kidney Apoptosis Assay. Nanotechnology Characterization Laboratory 2005; 1 8. 78. Mickey, D. D., et al. Conventional Chemotherapeutic Agents Combined with Dmso or Dfmo in Treatment of Rat Prostate Carcinoma. Prostate 1989; 15: 221 2 32. 79. Jones, M. M., et al. Coadministration of Dimethyl Sulfoxide Reduces Cisplatin Nephrotoxicity. Anticancer Research 1991; 11: 1939 1942. 80. Casolaro, M., et al. Cisplatin/Hydrogel Complex in Cancer Therapy. Biomacromolecules 2009; 10: 944 949. 81. F ischer, S. J., et al. Cisplatin and Dimethyl Sulfoxide React to Form an Adducted Compound with Reduced Cytotoxicity and Neurotoxicity. Neurotoxicology 2008; 29: 444 452. 82. Dernell, W. S., et al. Apparent Interaction of Dimethyl Sulfoxide with Cisplatin R eleased from Polymer Delivery Devices Injected Subcutaneously in Dogs. Journal of Drug Targeting 1998; 5: 391 396. 83. Uno, Y., Morita, M. Mutagenic Activity of Some Platinum and Palladium Complexes. Mutation Research 1993; 298: 269 275.

PAGE 117

117 84. Maeda, H., et al. Tumor Vascular Permeability and the Epr Effect in Macromolecular Therapeutics: A Review. Journal of Controlled Release 2000; 65: 271 284. 85. Sasaki, H., et al. Antitumor Activity of 13,14 Dihydro 15 Deoxy Delta(7) Prostaglandin a(1) Methyl Ester Integ rated into Lipid Microspheres against Human Ovarian Carcinoma Cells Resistant to Cisplatin in Vivo. Cancer Research 1999; 59: 3919 3922. 86. Araki, H., et al. Antitumor Effect of Cisplatin Incorporated into Polylactic Acid Microcapsules. Artificial Organs 1999; 23: 161 168. 87. Itoi, K., et al. In Vivo Suppressive Effects of Copoly(Glycolic/L Lactic Acid) Microspheres Containing Cddp on Murine Tumor Cells. Journal of Controlled Release 1996; 42: 175 184. 88. Tokuda, K., et al. Design and Testing of a New Ci splatin Form Using a Base Material by Combining Poly D,L Lactic Acid and Polyethylene Glycol Acid against Peritoneal Metastasis. International Journal of Cancer 1998; 76: 709 712. 89. Mizumura, Y., et al. Cisplatin Incorporated Polymeric Micelles Eliminate Nephrotoxicity, While Maintaining Antitumor Activity. Japanese Journal of Cancer Research 2001; 92: 328 336. 90. Yan, X. L., Gemeinhart, R. A. Cisplatin Delivery from Poly(Acrylic Acid Co Methyl Methacrylate) Microparticles. Journal of Controlled Release 2005; 106: 198 208. 91. Yapp, D. T. T., et al. Cisplatin Delivery by Biodegradable Polymer Implant Is Superior to Systemic Delivery by Osmotic Pump or Ip Injection in Tumor Bearing Mice. Anti Cancer Drugs 1998; 9: 791 796. 92. Park, H., Robinson, J. R. Mec hanisms of Mucoadhesion of Poly(Acrylic Acid) Hydrogels. Pharmaceutical Research 1987; 4: 457 464. 93. Fournier, E., et al. Biocompatibility of Implantable Synthetic Polymeric Drug Carriers: Focus on Brain Biocompatibility. Biomaterials 2003; 24: 3311 3331 94. Sinha, V. R., et al. Chitosan Microspheres as a Potential Carrier for Drugs. International Journal of Pharmaceutics 2004; 274: 1 33. 95. Thanoo, B. C., et al. Cross Linked Chitosan Microspheres Preparation and Evaluation as a Matrix for the Control led Release of Pharmaceuticals. Journal of Pharmacy and Pharmacology 1992; 44: 283 286. 96. Sintov, A., et al. Cross Linked Chondroitin Sulfate Characterization for Drug Delivery Purposes. Biomaterials 1995; 16: 473 478. 97. Hari, P. R., et al. Chitosan/ Calcium Alginate Microcapsules for Intestinal Delivery of Nitrofurantoin. Journal of Microencapsulation 1996; 13: 319 329.

PAGE 118

118 98. Ganza Gonzalez, A., et al. Chitosan and Chondroitin Microspheres for Oral Administration Controlled Release of Metoclopramide. Eu ropean Journal of Pharmaceutics and Biopharmaceutics 1999; 48: 149 155. 99. Nishioka, Y., et al. Preparation and Release Characteristics of Cisplatin Albumin Microspheres Containing Chitin and Treated with Chitosan. Chemical & Pharmaceutical Bulletin 1989; 37: 3074 3077. 100. Nishioka, Y., et al. Release Characteristics of Cisplatin Chitosan Microspheres and Effect of Containing Chitin. Chemical & Pharmaceutical Bulletin 1990; 38: 2871 2873. 101. Wang, Y. M., et al. Optimization of the Formulation Design of Chitosan Microspheres Containing Cisplatin. Journal of Pharmaceutical Sciences 1996; 85: 1204 1210. 102. Akbuga, J., Bergisadi, N. Effect of Formulation Variables on Cis Platin Loaded Chitosan Microsphere Properties. Journal of Microencapsulation 1999; 16 : 697 703. 103. Rubinstein, A., et al. Chondroitin Sulfate a Potential Biodegradable Carrier for Colon Specific Drug Delivery. International Journal of Pharmaceutics 1992; 84: 141 150. 104. Tamura, T., et al. Relation between Dissolution Profiles and Tox icity of Cisplatin Loaded Microspheres. European Journal of Pharmaceutics and Biopharmaceutics 2002; 53: 241 247. 105. Nishioka, Y., et al. Preparation and Evaluation of Albumin Microspheres Adn Microcapsules Containing Cisplatin. Chemical & Pharmaceutical Bulletin 1989; 37: 1399 1400. 106. Nishioka, Y., et al. Preparation and Release of Cisplatin Albumin Microspheres Containing Chitin and Treated with Chitosa. Chemical & Pharmaceutical Bulletin 1989; 37: 3074 3077. 107. Kyo, M., et al. Effects of Preparati on Conditions of Cisplatin Loaded Microspheres on the in Vitro Release. Journal of Controlled Release 1995; 35: 73 82. 108. Huo, D. J., et al. Studies on the Poly(Lactic Co Glycolic) Acid Microspheres of Cisplatin for Lung Targeting. International Journal of Pharmaceutics 2005; 289: 63 67. 109. Lind, D. S. Arginine and Cancer. Journal of Nutrition 2004; 134: 2837S 2841S. 110. Caso, G., et al. Tumour Cell Growth in Culture: Dependence on Arginine. Clinical Science 2004; 107: 371 379. 111. Chochung, Y. S., et al. Growth Arrest and Morphological Change of Human Breast Cancer Cells by Dibutyryl Cyclic Amp and L Arginine. Science 1981; 214: 77 79.

PAGE 119

119 112. Nanthakumaran, S., et al. Inhibition of Gastric Cancer Cell Growth by Arginine: Molecular Mechanisms of Action. Clinical Nutrition 2009; 28: 65 70. 113. Wolf, C., et al. Molecular Basis for the Antiproliferative Effect of Agmatine in Tumor Cells of Colonic, Hepatic, and Neuronal Origin. Molecular Pharmacology 2007; 71: 276 283. 114. Ma, Q. Y., et al. The Effects of L Arginine on Crypt Cell Hyperproliferation in Colorectal Cancer. Journal of Surgical Research 1999; 81: 181 188. 115. Xie, K. P., Huang, S. Contribution of Nitric Oxide Mediated Apoptosis to Cancer Metastasis Inefficiency. Free Radical Biology and Medicin e 2003; 34: 969 986. 116. Reynolds, J. V. T., A. K. ;Zhang, S. M. ;Ziegler, M. M. ;Naji, A. ;Daly, J. M. Arginine, Protein Malnutrition, and Cancer. Journal of Surgical Research 1988 45 513 522 117. Shukla, J., et al. Arginine: Appropriate Dose and Delivery Environment Makes It an Anticancer Molecule. The Open Cancer Journal 2010; 3: 1 15. 118. Das, U., et al. Inhibition of Protein Aggregation: Supramolecular Assemblies of Arginine Hold the Key. PLoS One 2007 2: e1176. 119. Toyama, N., et al. Solvati on Structure of Arginine in Aqueous Solution Studied by Liquid Beam Technique. Chemical Physics Letters 2006; 419 369 373. 120. Park, K. G. M., et al. The Effect of L Arginine on the Growth and Metabolism of an Experimental Lung Cancer. Clin Res Clin Oncol 1990; 38: 1709 15. 121. Gonvers, M. Temporary Silicone Oil Tamponade in the Management of Retinal Detachment with Proliferative Vitreoretinopathy. American Journal of Ophthalmology 1985; 100: 239 245. 122. Federman, J. L., Schubert, H. D. Complications As sociated with the Use of Silicone Oil in 150 Eyes after Retina Vitreous Surgery. Ophthalmology 1988; 95: 870 876. 123. Apple, D. J., et al. Irreversible Silicone Oil Adhesion to Silicone Intraocular Lenses a Clinicopathologic Analysis. Ophthalmology 1996 ; 103: 1555 1561. 124. Korobelnik, J. F., et al. Cataract Surgery Following Silicone Oil Injection. Journal Francais D Ophtalmologie 1992; 15: 199 202. 125. Borislav, D. Cataract after Silicone Oil Implantation. Documenta Ophthalmologica 1993; 83: 79 82. 1 26. Baer, R. M., et al. Cataract Extraction Following Vitrectomy and Silicone Oil Tamponade. Eye 1995; 9: 309 312.

PAGE 120

120 127. Apple, D. J., et al. Silicone Oil Adhesion to Intraocular Lenses: An Experimental Study Comparing Various Biomaterials. Journal of Catar act and Refractive Surgery 1997; 23: 536 544. 128. Bartzschmidt, K. U., et al. Silicone Intraocular Lenses and Silicone Oil. Klinische Monatsblatter Fur Augenheilkunde 1995; 207: 162 166. 129. Senn, P., et al. Interaction between Silicone Oil and Silicone Intraocular Lenses: An in Vitro Study. Ophthalmic Surgery and Lasers 1997; 28: 776 779. 130. Mcloone, E., et al. Silicone Oil Intraocular Lens Interaction: Which Lens to Use? British Journal of Ophthalmology 2001; 85: 543 545. 131. Oner, F. H., et al. Inte raction of Intraocular Lenses with Various Concentrations of Silicone Oil: An Experimental Study. Ophthalmologica 2003; 217: 124 128. 132. Yaman, A., et al. Interaction with Intraocular Lens Materials: Does Heavy Silicone Oil Act Like Silicone Oil? Journal of Cataract and Refractive Surgery 2007; 33: 127 129. 133. Hoerauf, H., et al. Use of O44 as a Solvent for Silicone Oil Adhesions on Intraocular Lenses. Journal of Cataract and Refractive Surgery 1999; 25: 1392 1393. 134. Wong, S. C., et al. Use of Hydrox ypropylmethylcellulose 2% for Removing Adherent Silicone Oil from Silicone Intraocular Lenses. British Journal of Ophthalmology 2009; 93: 1085 1088.

PAGE 121

121 BIOGRAPHICAL SKETCH Hung Yen Lee was born in Taipei, Taiwan to Szu Chaun Lee and Yi Ping Shang Kwan in 1981 and grew up in Taipei. He recei ved his Bachelor of Science in applied c hemistry from the National Chiao Tung University, Hsinchu (NCTU) in May of 2003. While at NCTU, Hung Yen developed an interdisciplinary knowledge in chemistry and biotechnology, an d conducted research under the supervision of Dr. Feng Chih Chang. His senior research dealt with the polymeric composite materials based on Polyhedral Oligomeric Silsesquioxanes (POSS). After graduating from college, he took two years of obligatory milita ry s ervice as a chemistry officer, Second L ieutenant, in the Army of Taiwan. In 2005, Hung Yen came to the United States purs ing his graduate degree in the M at erials Science and Engineering D epartment at the University of Florida. In 2006, he started to join and worked on several projects related to synthesis and characterization of biopolymers. In 2007, he obtained his m aster degree in the biomaterials specialty and a fter that, he decided to further pur sue his PhD under the guidance of Dr. Eugene Goldberg. After four more years of working in the biomaterials center and pulmonary divisi on in Shands hospital, he complet ed his Ph.D. from the Universit y of Florida in 2012