<%BANNER%>

Potential Therapeutic Effect of IL-27 In a Sjogren's Syndrome-like Autoimmune Exocrinopathy

Permanent Link: http://ufdc.ufl.edu/UFE0042763/00001

Material Information

Title: Potential Therapeutic Effect of IL-27 In a Sjogren's Syndrome-like Autoimmune Exocrinopathy
Physical Description: 1 online resource (89 p.)
Language: english
Creator: LEE,BYUNG HA
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Sjogren?s syndrome (SjS) is a systemic autoimmune disease characterized, not only by a progressive chronic attack primarily against the salivary and lacrimal glands, but also by decreased salivary and lacrimal gland secretions, that result in severe dry mouth and dry eyes. Recent studies have suggested a role for the TH17 system, which is identified by secretion of its signature cytokine IL-17A, as one of the underlying pathogenic mechanisms of autoimmunity and inflammation. In the present study, I investigated whether a recombinant adeno-associated virus vector type 2 (AAV2) expressing mouse IL-27 (pTR-UF14-IL27) could inhibit and/or reverse the disease profile of SjS in SjS-susceptible (SjSs) C57BL/6.NOD-Aec1Aec2 (Aec1Aec2) mice, a model of spontaneous primary SjS. IL-27 is considered a naturally-occurring cytokine that regulates TH17 pro-inflammatory activities. Mice were inoculated at either pre- or post-onset of SjS with 2x1010 vector genomes (VG) of pTR-UF14-IL27 by tail vein injection for systemic delivery or retrograde cannulation via the submaxillary duct for local target delivery. Results indicate that Aec1Aec2 mice treated with IL-27-expressing rAAV vectors exhibited longterm elevated levels of IL-27 with concomitant reduced plasma levels of IL-17A compared with LacZ- or saline-treated mice out to 20 weeks post-inoculation. In addition, saliva flow rates remained generally higher in the IL-27-treated Aec1Aec2 mice, while anti-nuclear autoantibody (ANA) staining confirmed a weaker and altered nuclear staining pattern compared with the two control groups. The capacity of IL-27 to reduce SjS autoimmunity in the Aec1Aec2 mouse model was supported by a series of in vitro studies. These data support the concept that IL-27 can be used as a therapeutic agent for the regulation of TH17 pro-inflammatory activity in the autoimmune disease SjS, and possibly other diseases where the TH17 system has been shown to play an important role in the pathogenesis.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by BYUNG HA LEE.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Peck, Ammon B.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-10-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0042763:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042763/00001

Material Information

Title: Potential Therapeutic Effect of IL-27 In a Sjogren's Syndrome-like Autoimmune Exocrinopathy
Physical Description: 1 online resource (89 p.)
Language: english
Creator: LEE,BYUNG HA
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Sjogren?s syndrome (SjS) is a systemic autoimmune disease characterized, not only by a progressive chronic attack primarily against the salivary and lacrimal glands, but also by decreased salivary and lacrimal gland secretions, that result in severe dry mouth and dry eyes. Recent studies have suggested a role for the TH17 system, which is identified by secretion of its signature cytokine IL-17A, as one of the underlying pathogenic mechanisms of autoimmunity and inflammation. In the present study, I investigated whether a recombinant adeno-associated virus vector type 2 (AAV2) expressing mouse IL-27 (pTR-UF14-IL27) could inhibit and/or reverse the disease profile of SjS in SjS-susceptible (SjSs) C57BL/6.NOD-Aec1Aec2 (Aec1Aec2) mice, a model of spontaneous primary SjS. IL-27 is considered a naturally-occurring cytokine that regulates TH17 pro-inflammatory activities. Mice were inoculated at either pre- or post-onset of SjS with 2x1010 vector genomes (VG) of pTR-UF14-IL27 by tail vein injection for systemic delivery or retrograde cannulation via the submaxillary duct for local target delivery. Results indicate that Aec1Aec2 mice treated with IL-27-expressing rAAV vectors exhibited longterm elevated levels of IL-27 with concomitant reduced plasma levels of IL-17A compared with LacZ- or saline-treated mice out to 20 weeks post-inoculation. In addition, saliva flow rates remained generally higher in the IL-27-treated Aec1Aec2 mice, while anti-nuclear autoantibody (ANA) staining confirmed a weaker and altered nuclear staining pattern compared with the two control groups. The capacity of IL-27 to reduce SjS autoimmunity in the Aec1Aec2 mouse model was supported by a series of in vitro studies. These data support the concept that IL-27 can be used as a therapeutic agent for the regulation of TH17 pro-inflammatory activity in the autoimmune disease SjS, and possibly other diseases where the TH17 system has been shown to play an important role in the pathogenesis.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by BYUNG HA LEE.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Peck, Ammon B.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-10-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0042763:00001


This item has the following downloads:


Full Text

PAGE 1

1 POTENTIAL THERPEUTIC EFFECT OF IL 27 LIKE AUTOIMMUNE EXOCRINOPATHY By BYUNG HA LEE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREM ENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Byung Ha Lee

PAGE 3

3 To my wife and son, and all my family in Korea

PAGE 4

4 ACKNOWLEDGMENTS It is with great appreciation and sincere thanks that I acknowledge the following in dividuals for their professional or personal role in my academic journey. My main mentor Dr. Ammon B. Peck for your never ending enthusiasm and encouragement, especially in the difficult and stressful times. I also appreciate you teaching me all about the science and guiding me to become a researcher. My co mentor Dr. Seunghee Cha for letting me follows my own path by allowing me focus on My committee members Dr. Edward Chan, Dr. Shannon Wal let, and Dr, Richard Snyder for critical scientific guidance to keeping me on a right track. All my lab members, Dr. Cuong Nguyen for teaching me every detail things in science. Tegan Lavoie for helping me with the hundreds of sample. Ben Saylor for lab m anaging. Dr. Kaleb Pauley in Cha lab for helping me all personal and scientific questions. Wendy Carcamo in Chan lab for personal and scientific help. All members in Chan and Cha lab and all Korean IDP stduents. Last but not least I would like to thank my family: my parents for always being there for me, my mother in law for her worries on me, and all my family members in Korea. And finally, my wife Young Ju, for her love and dedicated supports on me.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 ABST RACT ................................ ................................ ................................ ..................... 9 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 11 ................................ ................................ ............................... 11 Etiologie s of SjS and SjS Like Disease ................................ ................................ ... 13 Genetic Predisposition for SjS ................................ ................................ .......... 14 The Role of T H 1, T H 2 and T H 17 Cells in the Pathogenesis of Sj S .................... 16 Summary ................................ ................................ ................................ ................ 21 2 MATERIAL AND METHODS ................................ ................................ .................. 25 Animals ................................ ................................ ................................ ................... 25 Animal Treatment for the Gene Therapy ................................ ................................ 25 Reagents ................................ ................................ ................................ ................ 26 Intracellular Cytokine Staining and Flow Cytometric Analysis ................................ 27 Histology ................................ ................................ ................................ ................. 28 Hematoxylin and Eosin (H&E) Staining ................................ ............................ 28 Histological Assessment of Salivary Glands ................................ ..................... 28 Immunohistochemistry Staining ................................ ................................ ........ 29 Immunofluorescence Staining ................................ ................................ .......... 29 Western Blotting ................................ ................................ ................................ ..... 30 In vitro Stimulation and Differentiation of T Cells ................................ ................... 30 Vectors for Gene Therapy ................................ ................................ ....................... 31 Recombinant AAV2 IL27 and AAV2 LacZ Vector Construction ....................... 31 Packaging of rAA V2 Vector Particles ................................ ............................... 31 Systemic / Target Delivery of AAV2 IL27 ................................ ......................... 32 Measurement of Stimulated Saliva Flow ................................ ................................ 33 Detection of Antinuclear Antibodies in the Sera ................................ ...................... 33 Cytokines Level of IL 27 and IL 17A from Peripheral Blood ................................ ... 33 Statistical Analyses ................................ ................................ ................................ 34 3 IL ................................ 37 Hypothesis behind the Pres ent Study ................................ ................................ ..... 39 Results ................................ ................................ ................................ .................... 39

PAGE 6

6 Elevated Numbers of Splenic IL 17A+ T H 17 Cells in Female Compared to Male Aec1Aec2 Mice ................................ ................................ .................... 39 Elevated Expression Levels of IL 17A in SG of Female Compared to Male Aec1Aec2 Mice ................................ ................................ ............................. 40 Expression of the T H 17 Regulatory Molecule, IL 27, in Aec1Aec2 Mice ........... 41 Reduced Expression of IL 27R (WSX 1) in Female Aec1Aec2 Mice ............... 42 Inability of IL 27 to Suppress the Activation a nd Differentiation of T H 17 Cell Populations of Female Aec1Aec2 Mice ................................ ......................... 43 Rapid Loss in IL 27 signaling Pathways in Splenic Leukocytes from Female but Not Male Aec1Aec2 Mice ................................ ................................ ........ 44 Summary ................................ ................................ ................................ ................ 45 4 EFFECTS OF IL 27 GENE THERAPY ON SJS IN A MOUSE MODEL .................. 52 Hypothesis b ehind the Present Study ................................ ................................ ..... 53 Results ................................ ................................ ................................ .................... 53 ..... 53 Stimulated saliva flow rates in systemic and targeted gene delivery models ................................ ................................ ................................ .... 54 Lymphocytic infiltrates in the salivary glands of systemic and tar get gene delivery group ................................ ................................ ................ 54 Anti nuclear antibody staining in the sera of systemic and target gene delivery groups ................................ ................................ ....................... 55 IL 27 and I L 17A Level in the Sera of Gene Delivered Mouse Group .............. 56 IL 27 and IL 17A Positive Spleen Cells (Splenocytes) in Gene Delivered Mouse Group ................................ ................................ ................................ 57 Summary ................................ ................................ ................................ ................ 57 5 CONCLUSIONS ................................ ................................ ................................ ..... 68 IL ................................ ..................... 68 IL ................................ ... 71 LIST OF REFERENCES ................................ ................................ ............................... 76 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 89

PAGE 7

7 LIST OF TABLES Table page 1 1 ........................ 22 4 1 Quantification of lymphocytic infiltrates in the salivary glands of gene delivered mouse group. ................................ ................................ ...................... 59 4 2 Staining patterns and quantitative anti nuclear antibody measurements in gene delivered mice groups. ................................ ................................ ............... 60

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Three phases of SjS like disease development ................................ .................. 23 1 2 A model of temporal interaction of TH1, TH2, and TH17 cells for the progression of SjS like disease. ................................ ................................ ......... 24 2 1 Plasmid map of pTR UF14 IL27 ................................ ................................ ......... 35 2 2 IL 27 p28 expression from pTR UF14 IL27 transfected HEK 293 cells .............. 36 3 1 Enumeration of IL 17A secreting T H 17 cells in spleens ................................ ...... 46 3 2 IL 17A expression in lymp hocytic foci of salivary glands ................................ .... 47 3 3 Expression of IL 27p28 in lymphocytic foci o f salivary glands ............................ 48 3 4 Detection of IL 1) in infiltrating leukoc ytes present in salivary glands ................................ ................................ ................................ ................. 49 3 5 Differential effects of IL 27 cytokine on T H 17 cell populations from male versus female C57BL/6.NOD Ae c1Aec2 mice ................................ ................... 50 3 6 Differential effects of IL 27 on signal transduction pathways during activation of leukocytes from male versus female C57BL/6.NOD Aec1Aec2 mice ............. 51 4 1 Stimulated saliva flow rate in sy stemic and target gene delivery ........................ 61 4 2 Lymphocytic infiltration in salivary glands from o ne of AAV2 IL27 delivered mo use ................................ ................................ ................................ ................. 62 4 3 Frequent anti nuclear antibody staining patterns in the sera of gene delivered mice groups. ................................ ................................ ................................ ....... 63 4 4 Comparisons of ant i nuclear antibody staining patterns in systemic delivery group. ................................ ................................ ................................ ................. 64 4 5 Comparisons of anti nuclear antibody staining patterns in target delivery group ................................ ................................ ................................ .................. 65 4 6 Level of IL 27 and IL 17A in sera from gene delivered mouse group ................. 66 4 7 Level of IL 27 and IL 17A in spleen cells (splenocytes) from gene delivered mouse group ................................ ................................ ................................ ....... 67

PAGE 9

9 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy POTENTIAL THERPEUTIC EFFECT OF IL 27 LIKE AUTOIMMUNE EXOCRINOPATHY By Byung Ha Lee May 2011 Chair: Ammon B. Peck Major: Medical Sciences Immunology and Microbiology only by a progres sive chronic attack primarily against the salivary and lacrimal glands, but also by decreased salivary and lacrimal gland secretions, that result in severe dry mouth and dry eyes. Recent studies have suggested a role for the T H 17 system, which is identifie d by secretion of its signature cytokine IL 17A, as one of the underlying pathogenic mechanisms of autoimmunity and inflammation. In the present study, I investigated whether a recombinant adeno associated virus vector type 2 (AAV2) expressing mouse IL 27 (pTR UF14 IL27) could inhibit and/or reverse the disease profile of SjS in SjS susceptible (SjS s ) C57BL/6.NOD Aec1Aec2 ( Aec1Aec2 ) mice, a model of spontaneous primary SjS. IL 27 is considered a naturally occurring cytokine that regulates T H 17 pro inflamma tory activities. Mice were inoculated at either pre or post onset of SjS with 2x10 10 vector genomes (VG) of pTR UF14 IL27 by tail vein injection for systemic delivery or retrograde cannulation via the submaxillary duct for local target delivery. Results i ndicate that Aec1Aec2 mice treated with IL 27 expressing rAAV vectors exhibited longterm elevated levels of IL 27 with concomitant reduced plasma levels of

PAGE 10

10 IL 17A compared with LacZ or saline treated mice out to 20 weeks post inoculation. In addition, sa liva flow rates remained generally higher in the IL 27 treated Aec1Aec2 mice, while anti nuclear autoantibody (ANA) staining confirmed a weaker and altered nuclear staining pattern compared with the two control groups. The capacity of IL 27 to reduce SjS autoimmunity in the Aec1Aec2 mouse model was supported by a series of in vitro studies. These data support the concept that IL 27 can be used as a therapeutic agent for the regulation of T H 17 pro inflammatory activity in the autoimmune disease SjS, and po ssibly other diseases where the T H 17 system has been shown to play an important role in the pathogenesis.

PAGE 11

11 CHAPTER 1 INTRODUCTION Syndrome Maintenance of oral and ocular health depends heavily on the salivary and lacrimal gland systems to secret e fluids, saliva and tear respectively, rich in a variety of proteins and lipids produced by both acinar and ductal tissues. Saliva and tear fluids contain multiple enzymes that break down nucleic acids and proteins, anti microbial substances like secreto ry Ig, histatins, cystatins and splunc molecules, plus growth factors like epidermal growth factor (EGF). Without these anti bacterial and physiological mechanisms for moisturizing and buffering the oral and ocular surfaces, a general decline in oral and ocular hygiene can occur leading to caries, loss of teeth and/or reduced vision. Xerostomia sicca, or dry mouth disease, and xerophthalmia, or dry eye disease, result respectively from basic changes in the saliva and tear flow rates, the composition of sa liva and tears, and/or combinations thereof. Underlying causes of xerostomia include the natural aging process, use of medications, asthma and mouth breathing, chemotherapy, radiation therapy, autoimmune attack against secretory tissues/glands of the mout h, thyroid dysfunction, kidney dialysis and/or stroke. Likewise, fundamental causes of xerophthalmia include the natural aging process, physical injury, surgical procedures, meibomian gland dysfunction and/or autoimmune attack against one or more of the m ultiple secretory tissues/glands of the eye 1 2 While there are multiple underlying causes for decreased sec retions of saliva and tears, one of the more severe causes of xerostomia sicca and xerophthalmia results from the autoimmune disease, known as recognized as a chronic, systemic autoimmune disease in which the immun e system

PAGE 12

12 targets initially the salivary and/or lacrimal glands, and eventually leading to the loss of secretory function 1 3 SjS classified as either primary SjS (pSjS) or secondary SjS (sSjS). pSjS is characterized by a chronic autoimmune attack involving both lacrimal and salivary glands in the absence of other autoimmune diseases, while sSjS is characterized by an autoimmune attack against the lacrimal and/or salivary glands in the presence of other autoimmune diseases, most often rheumatoid arthritis (RA), systemic lupus erythmatosus (SLE) or scleroderma 3 4 In addition to the salivary and lacrimal glands, other organs often affected include the entire GI tract, skin, the lungs, the vasculature, kidneys, bladder and the vagina. Involvement of the musculature often leads to fibromyalgia like symptoms and chronic fatigue. A clinical manifestation of 1. Like the other autoimmune connective tissue diseases, SjS shows a sexu al dimorphism with women affected 10 20 times more frequently than men, suggesting hormonal involvement 5 8 While not considered a lethal disease, between 4 10% of patients with SjS will develop non grade malignancies 9 12 Although no prevalence st udies were conducted in the US, the National Arthritis Data Workgroup recently estimated the number of individuals with pSjS in the USA is 1.3 million with a range of 0.4 3.1 million, placing SjS as one of the more common rheumatic and autoimmune diseases 13 Despite on going efforts to define the autoimmune basis of SjS, the underlying etiology of this disease remains elusive. However, over the past 20 years, in addition to extensive data gathered from studies of SjS patients, a diverse number of mouse strains have been developed to study the immuno pathophysiological nature of SjS. In

PAGE 13

13 this review, we will provide in depth analysis of predominant mouse models of SjS, as well as present recent insights on the pathogenesis of SjS including genetic contribution and interconnection of various effector T cells populations specifically CD4 + T H 17 memory cells. Etiologies of SjS and SjS Like Disease In 1933, Dr. Henrik Sjgren (1899 1986) presented data describing a cluster of women over age 40 years in a small Swedish town presenting with keratoconjunctivitis (KCS), with lymphoid infiltrations of the conjunctiva, cornea, lacrimal glands and parotid glands, a history of arthritis, swelling of the salivary glands and dryness of the oro and together formed the general basis for SjS. Since that time, extensive research has focused on iden tifying specific etiologies that may be directly involved in SjS development. A number of hypotheses have been postulated in attempting to resolve the complexity of SjS related dry mouth and eyes, including (a) the role of epithelial cells apoptosis, (b) the function of autoreactive T lymphocytes, (c) the role of autoreactive B cells, (d) the clinical observation of neurological dysfunction, and (e) the role of viral infection 14 16 Other factors such as androgen deficiency 6 17 18 and meibomian gland function 19 20 have expanded the search for answers. Most recently, new findings associated with genetic contributions to SjS and the possible involvement of the CD4 + T H 17 memory T cell system with the T H 1 and T H 2 system have opened new insights into the genetic predisposition and autoimmune aspect of SjS, and critical roles are upheld for this cell population, offer new and novel approaches for interventions.

PAGE 14

14 Genetic Predisposition for SjS Two elements considered essential for development and onset of autoimmune diseases such as SjS are (1) an underlying genetic susceptibility and (2) an environmental trigger for activating the immune system. Although environmental triggers responsible for initiating SjS remain elusive, it is intuitively obvious that genes of the major histocompatibility (MHC) are involv ed since MHC genes dictate basic development and of the immune system and ultimately the immune responses per se At the same time, non MHC genes and their products function to regulate most aspects of immune responses. Not surprising, therefore, studies using animal models of SjS indicate that disease susceptibility is multi genic encompassing many critical causal elements. Whether linked to MHC or non MHC genes, these elements remain mostly speculative 21 This is even less clear in humans d ue in part to the relatively weak tendency toward familial aggregation resulting from the lack of large twin and/or large cohort studies. Nevertheless, observations reported by Harley et al. 22 suggest that SjS susceptibility is linked to HLA DQ genes, specifically DQ1 and DQ2, when associated with the presence of anti SS A/Ro and anti SS B/La autoantibodies. Likewise, Gottenberg et al. 23 reported that the frequency of the HLA Caucasians with SjS was 13% higher than healthy non diseased individuals or patients with anti SSA/Ro antibody positive sera. In addition, patients with both anti SSA/Ro and anti SSB/La serum antib odies displayed a 44% frequency of HLA compared to 12% in patients negative for anti La and anti Ro, 19% in anti Ro positive patients and 10% in healthy controls. In a third report, a direct correlation between anti La antibodies and HLA A1, B8, DR 3 was reported in SjS patients 24 Considered as a whole, then, different MHC genetic linkages should be expected in different ethnic

PAGE 15

15 groups, a point clearly illustrated by the fact that Northern and Western European Caucasians and North Americans show a higher frequency of B8, DRw52 and DR3 genes, while Scandinavians and Greeks show linkages to predominantly DR2 and DR5 genes, respectively 21 Thus, these various linkages, while of interest, may result merely from the relative homogeneity of the populations studied. Perhaps more interesting, however, is the increasing number of reports identifying non MHC genes being linked to SjS susceptibility or a specific aspect of its pathogenesis. A few of these genes are: Apoe (apolipoprotein E) 25 Car2 (carbonic anhydrase 2) 26 Clu (clusterin) 27 Il7r (interleukin 7 receptor) 28 Il10 (interleukin 10) 29 Lyzs (lysozyme) 30 Mbl (mannose binding protein) 31 Tnfsf6 (tumor necrosis factor, soluble factor 6 or Fas) 32 (tumor necrosis factor alpha) 33 and Gstm1 (glutathione S transferase 1). GSTM1 has been reported to contribute to anti SS A autoantibody production 34 An additional linkage involves the Tap2 gene. TAP2 is critical for antigen processing and presentation by macrophages and dendr itic cells. In an examination of 108 SjS patients in Japan, Kumagai et al. 30 identified a number of polymorphisms in the Tap1 and Tap2 genes, with one unique b ase pair substitution at codon 577 of Tap2 showing a higher prevalence in SjS patients manifesting elevated anti Ro autoantibody. With several large scale SNP analysis studies just underway, genetic polymorphisms within specific genes linked to SjS susce ptibility, like that observed in Tap2 should begin to define those genes that alter a biological process that subsequently identifies the autoimmune genotype / phenotype. Additional genes, recently identified in microarray studies involving the C57BL/6.N OD Aec1Aec2 mouse model for pSjS and hypothesized to be involved in the underlying pathology, include several chemokines,

PAGE 16

16 cathepsins, cystatins, complement components, proteins involved in lipid and fatty acid homeostasis, genes regulating apoptosis, and l ymphotoxin genes represent potential candidate genes whose polymorphisms should be determined in the equivalent human genes. The Role of T H 1, T H 2 and T H 17 Cells in the Pathogenesis of SjS The conventional approach in attempting to simplify the complexity of many autoimmune diseases is to compartmentalize their etiologies into specific effector T cell subsets. With extensive data generated from the animal models mentioned above and human subjects, it is probably nave and premat ure to resolve the complexity of SjS based on specific T cell functions. Recently, we have proposed that SjS like disease in our NOD and C57BL/6.NOD Aec1Aec2 mouse models progresses through three distinct, but continuous, phases. In phase 1 (initiation o f glandular pathology), a number of aberrant genetic, physiological and biochemical activities associated with retarded salivary gland organogenesis and increased acinar cell apoptosis occur sequentially prior to and independent of detectable autoimmunity 35 In p hase 2 (onset of autoimmunity believed to result from the acinar cell apoptosis), leukocytes expressing pro inflammatory cytokines infiltrate the exocrine glands, thereafter establishing lymphocytic foci, first of T cell clusters followed by recruitment of B lymphocytes 36 In phase 3 (onset of clinical disease), loss of salivary and lacrimal gland secretory functions occur, most likely the result of antagonistic (a uto) antibodies reactive with the M3Rs 36 39 These three phases are illustrated in Figure 1 1. Previous studies carried out in both NOD. / and NOD. IL4 / m ice revealed that both IFN H 1 cells and IL 4 of T H 2 cells are critical cytokines for development of SjS like disease in these animal models 37 40 T H 1 cells release IFN

PAGE 17

17 mediated immunity through activation of macrophages, NK cells and CD8+ T cells, and this process is driven by IL 12 through activating the transcription factor signal tra nsducer and activator of transcription 4 (STAT4) resulting in the expression of the transcription factor T bet. An interesting aspect of IFN like disease is its effect on organogenesis of salivary glands by retarding cellular growth. Examination of NOD. / and NOD. / mice revealed normal acinar cell proliferation and maturation, as well as normal development of their salivary glands 41 Most i mpressively, both NOD. / and NOD. / mice failed to develop any aspect of SjS like disease of the salivary glands, including acinar cell apoptosis around 8 10 weeks of age and subsequent leukocyte infiltration of the salivary glands normally obse rved 10 weeks and beyond. This delay in acinar cell maturation, therefore, may prevent expression of cellular antigens at the critical time of self tolerance resulting in lack of proper clonal deletion. In addition to its early involvement in SjS, IFN appears to be critical for the early phase of the adaptive immune response, as well. Progressive lymphocyte infiltration is often seen in salivary lacrimal glands during the development of SjS. Cells present in these infiltrates are mostly T cells, especi ally during the early stages of disease and again during the very late stages, with highest numbers being CD4 + T helper cells and B cells. One of the critical functions of IFN glandular adhesion molecules such as vascular cell adhesion molecule 1 (VCAM 1), selectin, and LFA 1. Recently, we f ound that mRNA transcripts encoding CCL8, CCL19, CCL5, CXCL16 (an IFN regulated chemokine that attracts NK and memory T cells), CXCL9 and CXCL13 were all up regulated in the salivary glands of C57BL/6.NOD Aec1Aec2 mice at time of

PAGE 18

18 disease onset (unpublish ed data), correlating with dendritic cells, T cells and B cells infiltrations. As anticipated, elimination of IFN susceptible mice prevents the influx of lymphocytes into the glands, thereby eliminating the autoimmune response. Other T H 1 cytokines such as IL 18 might also play an important role in development of SjS. IL 18 is detected in CD68 + macrophages, ductal and acinar cells of SjS salivary glands 42 44 It is also secreted at significantly higher level in sera and saliva of SjS patients and NOD mice 44 45 Therefore, one might postulate that IL 18 produced by activated macrophages and T cells can stimulate the production of other inflammatory cytokines, chemokines and adhesion molecules to attract inflammatory cells to the glands. IL 4, a product of T H 2 cells, appears to be an essential factor during the early period of the adaptive immune response in SjS. Earlier studies using the NOD. IL4 / and NOD.B10 H2b.IL4 / mice indicated that secretory function of salivary glands was restored t o normal levels when the Il4 gene was genetically knocked out, despite the fact that these mice continued to exhibit the expected pathophysiological abnormalities and leukocyte infiltrations in the exocrine glands concomitantly with production of ANAs 37 46 These earlier data suggested that IL 4 plays an important role during the clinical phase, while having litt le or no effect on the pathology associated with the preclinical disease state. IL 4, whose intracellular signaling can follow either the STAT 6 or IRS pathway, appears capable of regulating physiological functions that subsequently modulate the secretory activities of exocrine glands. Interestingly, Il4 gene KO mice fail to produce IgG1 isotypic autoantibodies against M3R, yet produce normal levels of M3R of other isotypes, e.g., IgG2a, IgG2b, IgG3, IgM, and IgA, pointing to a

PAGE 19

19 possible critical role for I gG1 isotype switching 47 This observation was further supported from studies in which Stat 6 gene was knockout in with NOD.B10 H2b render ing the animal the inability to produce IgG1 immunoglobulin. As the result of this specific gene elimination, the mice failed to make IgG1 isotype against M3R. More importantly, purified IgG fractions isolated from sera of NOD.B10 H2b.Stat6 / mice were not able to temporary inhibit saliva flow rates when infused into naive C57BL/6 mice; while IgG fractions from wildtype parental mice were able to reduce saliva secretion in normal C57BL/6 48 Therefore, it is important to note that during the development of SjS, IL 4 is a critical effector cytokine, not only intimately involved in the proliferation and differentiation of B/T lymphocytes, but also actively effecti ng the isotypic switching mechanism to produce pathogenic IgG1 autoantibody channeling through the IL 4/STAT6 pathway. While the above observations suggested a requirement for both T H 1 and T H 2 cell associated functions for onset of clinical disease, our recent identification of CD4 + T H 17 memory cells within the lymphocytic foci present in the salivary and lacrimal glands of SjS susceptible C57BL/6.NOD Aec1Aec2 mice and human SjS patients indicates a much greater complexity 49 The T H 17 cell population is a subset of CD4 + memory effector T cells that appears to be distinct and unrelated to either the T H 1 or T H 2 cell lineages 50 54 T H 17 effector cells are characterized by their unique ability to secrete one or more cytokines belonging to the IL 17 family, a function under the control of the master transcription regu 55 Although the IL 17 family of cytokines consists of six members: IL 17A (IL 17), IL 17B, IL 17C, IL 17D, IL 17E (IL 25), and IL 17F, most attention has focused on IL 17A,

PAGE 20

20 especially in autoimmunity. These molecules are potent pro inflammatory cytokines which are actively involved in tissue inflammation via induction of pro inflammatory cytokines and che mokine expressions, such as IL 6, TNF alpha), MIP 2 (macrophage inflammatory protein 2), G CSF (granulocyte colony stimulating factor), CXCL1, CXCL2, CXCL5, IL 21, IL 22, NO (nitric oxide), PGE 2 (prostaglandin E2), MMP 3 (matrix me talloproteinase 3) and MMP 13 56 As part of the local inflammatory response, IL 17A is involved in the mobilization, maturation and migration of neutrophils via the release of IL 8 at the site of injury 49 Most importantly, the T H 17 cell population per se has been shown to be a tissue seeking T cell population in timately involved in autoimmune diseases, e.g., Crohn's disease 57 58 EAE (experimental autoimmune encephalomy elitis) 59 CIA (collagen induced arthritis) 59 and others. It will be i nteresting to determine if the T H 17 cell population is attracted to the exocrine glands by the chemokine CXCL16. Temporal interaction of T H 1, T H 2, and T H 17 cells is presented in Figure 1 2. As stated above, our recent studies have indicated the presence of the T H 17 cell population within the lymphocytic infiltrations appearing in exocrine glands of both SjS patients and C57BL/6.NOD Aec1Aec2 mice, correlating with higher levels of IL 6 and IL 17A found in saliva and sera of a few SjS patients. We current ly postulate that these T H 17 cells contribute to tissue destruction, in part from their up regulation of MMP activity, the latter known to be highly expressed in inflamed lacrimal and salivary glands during development of SjS and SjS like disease. This co ncept is further supported by our recent data using a newly generated set of C57BL/6.NOD Aec1Aec2R(n) recombinant inbred lines in which the Aec2 genetic region of C57BL/6.NOD Aec1Aec2

PAGE 21

21 mice has been redefined, identifying a shortened region essential for di sease. Residing within this newly defined Aec2 susceptibility locus is the gene encoding Tnfsf4 (commonly known as OX40L ). Although a number of distinct cell populations express OX40L, including activated dendritic cells 60 OX40L can function as a regulator factor for the maturation of T reg 1 cells 61 a cell population that produces IL 10 and INF T reg 1 cells, in conjunction with IL 27 producing dendritic cells, inhibit effector CD4 + T H 17 cells 62 Since Tnfsf4 expression is down regulated during the development of SjS like disease, we suggest that there is reduced T reg 1 cell function and IL 27 producing dendritic cell function that would normally regulate CD4 + T H 17 cell function, leading to activati on of effector CD4 + T H 17 cells during the development of the autoimmune attack against the exocrine gland tissues. If this concept proves accurate, and an imbalance in the T H 17 : T reg 1/DC IL27 ratio that favors the T H 17 population(s) in concert with activi ties of T H 1 and T H 2 cells populations is identified as an important element in disease development, then there is a new area to target intervention therapies. Summary SjS is an intricately multifaceted autoimmune disease, whose complexity is compounded by an elusive genetic contribution, unexplained changes in glandular homeostasis, an interconnection among different effector T cells populations (especially the recently described T H 17 cells), and an important but ill defined involvement of B lymphocytes an d antigen presenting cells. The development and application of various animal models co inciding with human studies will provide better insights into the pathogenesis of the disease, and eventually lead to better diagnostic approaches and novel therapies for the disease.

PAGE 22

22 Table 1 Primary Target organs Organs Manifestations Mouth Xerostomia: oral dryness; manifested by inability to swallw dry food without aid from liquid, unclear pronuci ation of words and/or chalky feeling in mouth Eyes Xerophtalmia: dry eyes; manifested by burning, sandy and ithy feeling, conjunctiva redness and increased photosensitivity Secondary Target organs Organs Manifestations General Low grade fever, weig ht loss, vasculitis, lymphadenopathy, lymphoma Respiratory Tract Cough, pharynx irritation GI Tract Parotid enlargement Genitourinary Tract Nephritis, dyspareunia, decreased sexual activity, splenmegaly Skin Ulcerations, dryness and itchiness, urt icaria, increased risk of epidermal abrasion and skin infection Muscle and Joint Muscle and joint pain, arthritis, myositis, fibromyalgia Neurological Hearing loss, peripheral neuropathy

PAGE 23

23 Figure 1 1. Three phases of SjS like disease development

PAGE 24

24 Figure 1 2. A model of temporal interaction of T H 1, T H 2, and T H 17 cells for the progression of SjS like disease.

PAGE 25

25 CHAPTER 2 MATERIAL AND METHODS Animals C57BL/6.NOD Aec1Aec2 ( Aec1Aec2 ) mice were bred and maintained under specific pathogen free conditi ons in the animal facility of Animal Care Services (ACS) at the University of Florida (Gainesville, FL, USA). Development of the Aec1Aec2 mouse and its SjS like disease phenotype are described elsewhere 63 Briefly, the Aec1Aec2 mouse was developed by introducing two genetic regions, one on chromosome 1 (designated Aec2 ) and the second on chromosome 3 (designated Aec1 ) derived from the NOD/LtJ mouse, into the SjS no n susceptible (SjS NS ) C57BL/6J mouse. All animals were maintained on a 12 hr light dark schedule and provided food and acidified water times indicated in the article, mice were euthanized by cervical dislocation after deep anesthetization with isoflurane and their organs and tissues freshly harvested for analyses. All experiments and analyses described in this article were performed using both male and female mice. Both t he breeding and use of these animals in the present Committee (IACUC). Animals. Animal Treatment for the Gene Therapy Aec1Aec2 mice at 6 week old divided into two differ ent groups to compare the effect of systemic versus local delivery. Again, systemic or local delivery group divided into three groups according to the treatments: saline, AAV2 LacZ, and AAV2 IL27. Each treatment group consists of 5 male and 5 female mice ( total 10 mice). Also, to compare the IL 27 gene therapy effect on the later disease developmental stage (clinical disease

PAGE 26

26 stage, Figure 1 1 in CHAPTER 1) with earlier disease developmental stage (pre disease stage), 14 weeks old mice were used with same se x and numbers in Aec1Aec2 mouse model. Mice were collected baseline saliva flow when they were at 6 weeks (for the pre disease group) and 14 week (for the clinical disease group) old before the treatment and all mice were sacrificed at 20 week of post gene delivery period. Gene therapy studies in Aec1Aec2 mice, as described herein, were approved by the Committee (IBC). Reagents Reagents used in this study include recombinant m ouse IL 27 (2799 ML), IL 6 (406 ML) and TGF RI 050) purchased from R&D Systems, the ABC Staining System (sc 2023) purchased from Santa Cruz Biotechnology, a Cytofix/Cytoperm TM Fixation/Permeabilization kit (#554714), Leukocyte Activation Cocktail co ntaining GolgiPlug (#555029) Biosciences, 4 20% linear gradient Tris HCl precast gels (161 1123) from Bio Rad Laboratories, ECL Advance Detection Kit (RPN2135) from Amersham Bioscience and ImmPACT TM DAB di luent (SK 4105), Avidin/Biotin Blocking kit (SP 2001), VECTASHIELD mounting medium with DAPI (H 1200) from Vector Laboratories. Antibodies used include goat anti mouse IL 27p28 (AF1834) rat anti mouse TCCR (WSX 1, MAB21091), carboxyfluorescein conjugated rat anti mouse WSX 1 (FAB21091F), and rat anti mouse IL 27 (IC1834F) purchased from R&D Systems, rabbit anti mouse IL 17A (H 132), rabbit anti mouse IL 32868), rabbit anti mouse CD11c (sc 28671), and AP conjugated goat anti mouse IgG (sc 200 8) from Santa Cruz Biotechnology, rat anti mouse F4/80 (MCAP497) from SeroTec, Alexa

PAGE 27

27 Fluor 488 donkey anti rabbit IgG (A21206), Alexa Fluor 647 goat anti mouse IgG (A21446), Alexa Fluor 594 rabbit anti rat IgG (A21211), and rat anti mouse CD4 PE Cy7 (MC D0412) from Invitrogen, the Stat Antibody Sampler Kit (#9939) and the Phospho actin (A 1978), HRP conjugated rabbit anti rat IgG (A 9542) and AP conjugated rabbit anti goat IgG (A 4187) antibodies from Sig ma Aldrich and anti mouse CD44 APC (17 0441), anti mouse CD69 FITC (11 0691), anti mouse CD62 L PE (12 0621), anti mouse IL 17A PE (12 7177), and anti mouse IFN gamma APC (17 7311) from eBioscience, and hamster anti mou se CD 28 (#553294), PE Cy5 conjugated rat anti mouse CD4 (#553050), and PE conjugated rat anti mouse IL 17A (#559502) from BD Biosciences, and FITC conjugated rat anti (#RM9001) from CalTag Laboratories. Intracellular Cytokine Staining and Flow Cytometric Analysis Single cell suspensions of spleen cells were prepared from male and female Aec1Aec2 and C57BL/6J mice as described elsewhere 48 and at the age s designated in the text. In brief, spleens were freshly explanted, gently minced through stainless steel sieves, suspended in phosphate buffered saline (PBS) and centrifuged (1200 rpm for 5 minutes). Erythrocytes were lysed by a 7 minute incubation in 0 .84% NH4Cl. The resulting leukocyte suspensions were washed two times in PBS, counted and resuspended in culture media (RPMI 1640 medium, 10% FBS, 2 mM L glutamine, 0.05 mercaptoethanol) to a density of 2 x 106 cells/ml. One million cells were pipet ted to individual wells of a 24 well microtiter plate pre coated with anti anti d cells were fixed

PAGE 28

28 and permeabilized using Cytofix/CytopermFixation/Permeabilization. The Flow cytometric acquisition for intracellular staining described in CHAPTER 3 was performed following staining with PE Cy5 conjugated anti mouse CD4, FITC conjugated anti IFN and PE conjugated anti IL 17A. The cells were counted on a FACSCalibur (BD) and analyzed by FCS Express (De Novo Software). The flow cytrometric acquisition for intra and extra cellular staining described in CHAPTER 4 was performed following s taining with FITC conjugated anti mouse IL 27, IL IL 17A, PE Cy7 conjugated anti mouse CD4, and APC conjugated anti IFN of cytokines from gene delivered mice. Also, FITC conjugated anti mouse CD69, PE conjugated anti mouse CD62 L, and APC conjugated anti mouse CD44 were used to examine developmental stages of T cells. The cells were counted on an ACCURI C6 Flow Cytometer (ACCURI ) and analyzed by FlowJo software (Tree Star, Inc.). Histology Hematoxylin and Eosin (H&E) Staining Salivary glands, Lungs, and kidneys of Aec1Aec2 and C57BL/6J mice were surgically removed from each mouse at time of euthanasia and placed in 10% phosphate buffered formalin for 24 hrs. Fixed tissues were embedded in paraffin and sectioned embedded sections were de paraffinized by immersing in xylene, followed by dehydration in ethanol. The prepared tissue sections were stained with H&E dye (Histology Tech Services, Gainesville, FL). Histological Assessment of Salivary Glands H&E stained sections were observed under a microscope for glandular structure and leukocyte infiltration. Lymphocytic foci (LF) were enumerated by three individuals in

PAGE 29

29 blinded fashion. LF were defined as aggregates of >50 leukocytes quanti fied per each histological section, adjacent sections were used for immunofluorescent staining. Immunohistochemistry Staining Tissue sections were deparaffinized, rehydrated, and blocked with hydrogen peroxide. For antigen retrieval, tissue sections were heated to 100C under pressure with 10 mM citrate buffer for 15 minutes. The sections were incubated with rabbit anti mouse IL 17A (1:100 dilution) or rat anti mouse WSX 1 (1:20 dilution) or goat anti mouse IL 27p28 (1:100 dilution) overnight at 4C. The sections were washed with PBS Tween and incubated 30 minutes at room temperature (RT) with goat anti rabbit IgG or rabbit anti rat IgG or rabbit anti goat IgG to detect IL 17A, WSX 1, and IL 27 p28, respectively. After additional washes, the slides were incubated with ABC reagent for diaminobenzidine (DAB) for a maximum of 1 minute and counterstained with hematoxylin for immunohistochemistry. Stained sections were observed at 200X magnification using a Zeiss A xiovert 200M microscope and images were obtained with AxioVs40 software (Ver. 4.7.1.0, Zeiss). Immunofluorescence Staining Tissue sections were deparaffinized, rehydrated, and blocked with hydrogen peroxide. For antigen retrieval, tissue sections were hea ted to 100C under pressure with 10 mM citrate buffer for 15 minutes. The sections were incubated with goat anti mouse IL 27 p28 (1:100 dilution) or rabbit anti mouse CD11c (1:100 dilution) or rat anti mouse F4/80 (1:100 dilution) or rat anti mouse B220 o r goat anti mouse CD3 to detect IL 27 p28, antigen presenting cells, macrophages, B cells, and T cells, respectively, overnight at 4C. The sections were washed two times with PBS Tween and incubated 30 minutes at room temperature (RT) fluorescent conjuga ted second antibodies. After

PAGE 30

30 additional washes, the slides were treated with mounting medium with DAPI. Stained sections were observed at 200X magnification using a Zeiss Axiovert 200M microscope and images were obtained with AxioVs40 software (Ver. 4.7.1 .0, Zeiss). Western Blotting Salivary glands freshly explanted from male and female Aec1Aec2 or C57BL/6J mice were lysed with Nonidet P40 (NP40) buffer (150 mM sodium chloride, 1.0% NP 40, pH 8.0 50mM Tris). Protein concentrations were determined by Bradf ord protein assay. The lysates were separated by electrophoresis on 4 20% linear gradient SDS PAGE precast gels, then transferred to PVDF membranes. Membranes were probed with specific primary antibodies, including anti STATs and anti pSTATs (1:1000 dilu tion), anti WSX 1 (1:500 dilution), and anti actin (1:20,000 dilution). The membranes were incubated with appropriate HRP or AP conjugated secondary antibodies. The signals were visualized using the ECL Advance Detection Kit. In vitro Stimulation and Differentiation of T Cells Single cell suspensions of splenocytes prepared from male and female Aec 1 Aec 2 and C57BL/6J mice were isolated and cultured as previously described 64 Two million cells were plated into individual wells of 24 well plates pre coated with anti CD3 (10 medium alone (unstimulated), recombinant (r) IL 27 (5 g/ml), rIL 27/rIL 6/rTGF 3 hrs or 24 hr. To examine the differentiation of T H 17 cells at 24 hr post stimulation, an aliquot of 24 hr stimulated splenocytes were permeabilized and stained intracellularly with PE Cy5 conjugated anti CD4, FITC conjugated anti IFN conjugate d anti IL 17A. Western blot analyses were also carried out with in vitro stimulated splenocytes probed

PAGE 31

31 actin, Stat1, Stat3, p Stat1, p Stat3, each at 1:1000 dilution and WSX 1 at 1:500 dilution. Vectors for Gene Therapy Recombi nant AAV2 IL27 and AAV2 LacZ Vector Construction The plasmid pTR UF14 IL27 vector (Figure 2 1) was constructed by inserting the two subunit of IL 27 fragments (EBI3 and p28) into the pTR UF14 plasmid. Two pairs of primers were used to clone EBI3 (Forward: AAACTAGT AGGTCCTTCCCTGGGGCCAG GT TTTGATATCAAGGATCCAGTCCCTCTTCAG AAAAAGCGGCCGCATGGGCCAGGTGACAGGA TTTGTCGAC TTAGGAATCCCAGGCTGAGCC associated virus vector plasmid, pTR UF14, containing AAV2 inverted terminal repeats and a CMV / chicken actin hybrid promoter was generously provided by Dr. Sergei Zolotukhin (Department of Pediatrics, University of Florida, FL, USA). The pTR UF14 IL27 plasmid was transfected into HEK 293 cells and expression of the IL 27 was determined by western blotting using anti mouse EBI3 antibody for EBI3 detection and by ELISA using Quantikine kit for mouse IL 27 p28 (R&D systems, USA) for p28 detection (Figure 2 2). In this study, we used rAAV2 LacZ encoding galactosidase 65 as an AAV2 vector control, which was provided by our collaborator, Dr. John Chiorini (National Institutes of Dental and Cranial Research, Nati onal Institutes of Health, MD, USA) Packaging of rAAV2 Vector Particles To generate rAAV serotype 2 vectors (rAAV2), we sent pTR UF14 IL27 plasmid vector to our collaborator, Dr. John Chiorini. They used the adenoviral helper packaging

PAGE 32

32 plasmid pDG. Plates (15 cm) of ~40% confluent HEK 293T cells were cotransfected with either pAAV LacZ or pTR UF14 IL27 according to standardized methods 66 Clarified cell lysates were adjusted to a refractive index of 1.372 by addition of CsCl and centrifuged at 38,000 rpm for 65 hr at 20C. Equilibrium density gradients were fractionated and fractions with a refra ctive index of 1.369 1.375 were collected. The particle titer was determined by Q PCR and the vector was stored at 80C. On the day of vector administration to Aec1Aec2 mice, the vector was dialyzed for 3 hr against saline. Systemic / Target Delivery of AAV2 IL27 For the target delivery, we used retrograde salivary gland cannulation method. Previous studies 67 69 have shown that retrograde salivary gland cannulation is an effective method to direct local gene expression in the salivary glands. In brief, each mouse was anesthetized with a ketamine (100 mg/ml, 1 ml/kg body weight; Fort Dodge Animal Health, Fort Dodge, IA) and xylazine (20mg/ml, 0.7ml/kg body weight; Ph oenix Scientific, St Joseph, MO, USA) cocktail by intraperitoneal injection. PE 10 polyethylene tubes were inserted into each of the two ductal orifices of the salivary ducts under the tongue. After securing the cannulas, the mouse received an intramuscula r injection of atropine (1 mg/kg), followed 10 min later by a slow, steady injection of viral vector. Each 10 vector genome (VG). The dosage was chosen based upon previous study 70 71 for extensive study of dosage optimization. The cannulas were removed 5 min later to ensure successful cannulation. For the systemic delivery, we injected same amount of VG by mouse tail vein injection. All animals were sacrificed at 20 weeks of post systemic or target delivery.

PAGE 33

33 Measurement of Stimulated Saliva Flow To measure stimulated saliva flow, each mouse was w eighed and injected cocktail intraperitoneal injection. Saliva was collected for 10 minutes from the oral cavity of individual mice using a micropipette starting 1 min after i njection of the secretagogue. The volume of each saliva sample was measured. Samples were stored at 80C until analyzed. Detection of Antinuclear Antibodies in the Sera Antinuclear antibodies (ANA) in the sera of mice were detected using HEp 2 ANA kit (IN OVA Diagnostics, San Diego, CA, USA). All procedures were performed 2 fixed substrate slides were overlaid with appropriate mouse sera diluted 1:50, 1:100, 1:200, and 1:400. Slides were incubated for 1 h at room temperature in a humidified chamber. After three washes for 5 min with PBS, the substrate slides were covered with Alexa 488 conjugated goat anti mouse IgG (H/L) (Invitrogen, Carlsbad, CA, USA) diluted 1:100 for 45min at room temperature. A fter three washes, fluorescence was detected by fluorescence microscopy at 200X magnification using a Zeiss Axiovert 200M microscope and all images were obtained with AxioVs40 software (Ver. 4.7.1.0, Zeiss) with constant exposure of 0.3 s (Carl Zeiss). In this study, three individuals in blind fashion enumerated the frequencies of staining pattern in 1:50 dilutions of sera from each experimental group and the scores of positive staining pattern in 1:400 dilutions. Cytokines Level of IL 27 and IL 17A from P eripheral Blood Measurement of IL 27 and IL 17A cytokine levels in sera samples were detected using Quantikine kit for mouse IL 27 p28 (R&D systems, USA) to detect IL 27 and IL

PAGE 34

34 17A mouse ELISA kit (Invitrogen, USA). All procedures were performed ac cording to Microplate Reader (Bio Rad, UK) Statistical Analyses Statistical evaluation was determined by using unpaired Student t test generated by the GraphPad Prism software ( GraphPa d Software ) The two tailed p value <0.05 was considered significant.

PAGE 35

35 Figure 2 1. Plasmid map of pTR UF14 IL27

PAGE 36

36 Figure 2 2. IL 27 p28 expression from pTR UF14 IL27 transfected HEK 293 cells. (A) Expression of IL 27 p28 in the pellets of mock trans fected or transfected with pTR UF14 or pTR UF14 IL27. (b) Expression of IL 27 in the supernatant from three transfected groups.

PAGE 37

37 CHAPTER 3 IL 27 CYTOKINE FUNCTION E Sjgren's syndrome (SjS), characterized by an autoimmune attack prim arily against the salivary and lacrimal glands leading to dry mouth and dry eye disease, affects primarily post menopausal women, indicating a critical role for sex hormones in development and/or onset of disease 5 6 72 Similar to other autoimmune rheumatic diseases, such as systemic lupus erythematosu s (SLE) and rheumatoid arthritis (RA), estrogen and prolactin have been shown to contribute directly to a loss of tolerance resulting in survival of autoreactive B cells 73 In patients with RA, estrogen has been reported to induce proliferation of macrophages and fibroblasts preceding unrestrained inflammation of local joint tissues 74 In a recently developed animal model of SjS, sexual dimorphism was shown to be associated with a genetic region defining a strong SjS susceptibility (SjSs) locus required for onset of st omatitis sicca in female mice 75 Despite these observations, the molecular mechanisms of how sex hormones actually influence predisposition and/or development o f an autoimmune response remain unknown. Recent focus on T H 17 cells and autoimmunity might provide clues to the etiology of SjS and sexual dimorphism. T H 17 cells and their secreted cytokines, IL 17A, IL 15, IL 21 and IL 22, are associated with multiple c haracteristics of autoimmunity, including experimental autoimmune encephalomyelitis (EAE), psoriasis, inflammatory bowel disease (IBD), RA, SLE, and SjS as they are strong inducers of inflammation. IL 17A can act on endothelium to secrete IL 8 that in tur n recruits neutrophils to sites of injury, while IL 22 can act on epithelium to induce secretion of multiple mediators of innate defensins. T H 17 cells are regulated by several distinct

PAGE 38

38 mechanisms, including retinoic acid and TGF ch favor differentiation of nave T cells to Foxp3+ T Reg cells), IL 4 (which favors differentiation to T H 2 cells) and IFN (which favors differentiation to T H 1 cells) 76 These directed differentiations negatively impact T H 17 cell development; thus, the micro environment established by the microflora and pathogens would be expected to influence the balance among the various CD4 + T cell populations. However, one of the more potent regulators of T H 17 cells is the cytokine IL 27. IL 27, a member of the IL 12 family of cytokines, is a heterodimeric protein comprised of two subunits, IL 27p28) and IL 27Ebi3) 77 Recent studies have shown that IL 27 is pleiotrophic, regulating hematopoietic stem cell differentiation, eliciting anti tumor activities, as well as promoting both pro and anti inflammatory activities 78 81 Although we have previously postulated that the macrophage and dendritic cell populations in our animal models of primary SjS are defective in promoting TR1 and Foxp3+ T Reg cells 82 the possible cont ribution of IL 27 in this phenomenon has never been considered. Thus, in the present study, we examined whether C57BL/6.NOD Aec1Aec2 mice, a well defined model of primary SjS disease, exhibit a defect in IL 27 regulation in light of the strong T H 17/IL 17A responses observed in the salivary glands during onset of disease. Results revealed, unexpectedly, that female mice have an apparent defect in their IL 27 signaling by failing to induce suppression of T H 17 cell development and activation, whereas in male mice IL 27 can suppress T H 17 cell functions. Therefore, the possibility that this differential response to IL 27 and/or IL 27R by male versus female mice is responsible for the more severe disease observed in the

PAGE 39

39 salivary glands of female mice and theref ore a basis for the sexual dimorphism observed in SjS and possibly other rheumatic diseases. Hypothesis behind the Present Study The current studies were carried out to determine if there were different expression of anti inflammatory cytokine, especiall y IL 27 from this study, and its signaling pathway through receptor (WSX 1 (IL inflammatory cells, which releasing IL 17 (T H 17 cells) from male and female of SjS mouse model. Based on a survey of the literature, I hyp othesize that there is abnormal function and/or less expression of IL 27 at the time of onset in SjS. Also, there are different expressions of IL 27 and/or its receptor may effect on the regulation of T H 17 cells and shows the sexual dimorphic progression o f SjS in Aec1Aec2 mice. Therefore, to address this hypothesis, I established two specific aims: (1) To examine levels of IL 27 and related signaling molecules in the Aec1Aec2 syndrome. (2) To investigate if IL 27 can regulate IL 17 producing T helper cells (T H 17) in the Aec1Aec2 in vitro Results Elevated Numbers of Splenic IL 17A+ T H 17 Cells in Female Compared to Male Aec1Aec2 Mice Similar to the human disease, Aec1Aec2 mice show differences in t he development of SjS based on gender; specifically, female mice exhibit an earlier leukocytic infiltration of the salivary glands (SG), a more rapid onset of salivary gland dysfunction, and a more severe clinical disease compared to male mice 75 Until recently, the T H 1 T cell population was considered the important effector cell in SjS, but our recent studies 83 84 have implicated a critical role for the T H 17 cell population(s),

PAGE 40

40 acting both directly and indirectly as regulatory and effector cells of disease. To explor e this point further, flow cytometric analysis was used to examine possible differences in the numbers of splenic T H 1 and T H 17 cells in male and female C57BL/6J and Aec1Aec2 mice at 4, 12, and 20 weeks (wks) of age. The ages chosen represent the pre disea se phase (3 6 wks of age), the early pre clinical phase (10 14 wks of age) and the clinical disease phase (>18 wks of age) defined in Aec1Aec2 mice 35 36 38 85 86 As presented in Figure 3 1, bot h ma le and female C57BL/6J mice had similar numbers of IFN well as IL 17A+ cells, present in their spleens at each of the three time points examined. Both sexes also showed marked increases in IFN (1.85% to 6.63% in males and 2.5% to 6.56% in females) with no changes in the numbers of IL 17A+ cells. In contrast, both male and female Aec1Aec2 mice showed an increase in IFN at 12 wks of age, plus an incr ease in IL 17A+ cells at 20 wks of age (from 0.47% to 5.47% in males and 0.38% to 9.31% in females). Thus, with onset of disease, female Aec1Aec2 mice had nearly twice the relative percent of IL 17A positive cells in their spleens compared to males. Elev ated Expression Levels of IL 17A in SG of Female Compared to Male Aec1Aec2 Mice Aec1Aec2 mice exhibit a primary SjS like disease profile characterized by loss of salivary gland secretory function subsequent to the appearance of lymphocytic foci (LF) in the glands or detection of circulating autoantibodies 63 Although, IL 17A is detected in the salivary glands of both male and female Aec1Aec2 mice, the comparative le vels of IL 17A between the two sexes has never been examined. Therefore, to determine the differential expression of IL 17A in the salivary glands of male and female mice at

PAGE 41

41 the onset of the clinical signs and to further correlates the levels of IL 17A+ T H 17 cells present in the spleens and SG of male and female Aec1Aec2 mice, a histological analysis of IL 17A+ T H 17 cells present in the SGs was performed at 20 wks of age in which lymphocytic infiltration has occurred. As presented in Figure 3 2A, male a nd female of control C57BL/6 mice did not develop any infiltrates in the salivary glands at 20 wks of age; consequently, no IL 17A positive cells were detected. Histological examination of male and female Aec1Aec2 mice revealed severe lymphocytic infiltra tions in the salivary glands and significant IL 17A+ cells were observed. Enumeration of IL 17A+ cells (Figure 3 2B) showed that LF of female Aec1Aec2 mice contained more than twice the relative numbers compared to male mice (13.24% vs 5.57%). These data support the previous findings in which significant increases of local IL 17A levels in the glands are highly correlated with the elevated systemic levels of IL 17A found in the spleen. More importantly, it provides new evidence that the higher levels of IL 17A were found in the SG of female compared to male mice at the onset of clinical signs in the SjS animal model. Expression of the T H 17 Regulatory Molecule IL 27, in Aec1Aec2 Mice T H 17 cell differentiation is strongly regulated by multiple systems. However, one of the most critical regulatory factors of T H 17 cell functions is the cytokine IL 27 secreted by activated macrophages and dendritic cells 78 87 IL 27 acts by down regulating the T H 17 cell transcription factor retinoic acid concomitantly up regulating the T bet transcription factor through Stat1 signali ng, thereby promoting a shift to IFN + T H 1 cells 88 Previous results indicated an elevated level of IL 17A expressed in the SG of female than male mice. As the result, it was imperative to examine the regulatory element of IL 17A expression by

PAGE 42

42 analyzing the levels of IL 27 cytokine in the glands. As presented in Figure 3 3, a number of IL 27p28 positive cells were found and most were present within and/or around the LF. In addition, with similar sizes of LF, IL 27p28 expression appeared to be slightly higher in female than male Aec1Aec2 mice at 20 wks of age by immunohistochemical staining, which is consistent with immunofluorescent microscopy. Furthermore, IL 27p28 appeared to co localiz e predominantly with macrophages and a few dendritic cells within the LF. Similar staining was performed for C57BL/6 mice, however, due to the lack of LF at 20 wks of age, nothing of significance was detected (data not shown). These data suggest small di fferences in the IL 27 p28 expression male and female Aec1Aec2 mice and demonstrate that IL 27p28 is being produced mainly by macrophages and a few dendritic cells found in the LF. Reduced Expression of IL 27R (WSX 1) in Female Aec1Aec2 Mice IL 27 function s by binding with IL 27R, a heterodimeric receptor consisting of the unique IL 1 encoded by the Il27ra gene) and the IL (or gp130 encoded by the Il6st gene). Mouse T and B lymphocytes, neutrophils, monocytes, mast cells, a nd NK cells all express WSX 1 78 89 as well as gp130. While IL 27 can bind directly to WSX 1, interactio n with the heterodimeric receptor is essential for successful IL 27 signal transduction 77 90 To determin e if WSX 1 is expressed in LF present in the SG of Aec1Aec2 mice at time of disease, immunohistochemical staining of SG sections from male and female Aec1Aec2 mice was performed. As shown in Figure 3 4A, WSX 1 was not present on the epithelial, acinar or ductal cells in the SG of 4 and 12 wks old mice. In contrast, WSX 1 was highly expressed on infiltrating cells in both male and female Aec1Aec2 mice at 20 wks of age. Interestingly, female Aec1Aec2 mice showed significantly less numbers of WSX 1 positive staining (25.7%)

PAGE 43

43 compared with male (54.8%) in salivary glands of at 20 wks of age (Figure 3 4B), the precise time at which these mice are showing clinical disease and the glands are being infiltrated with APC and T cells 29 91 92 Inability of IL 27 to Suppress the Activation and Differentiation of T H 1 7 Cell Populations of Female Aec1Aec2 Mice The increased number of T H 17 cells in female Aec1Aec2 mice during the development of disease, together with the apparent reduced levels of IL 27R, point to an imbalance in the regulation of T H 17 cells by IL 27. T o explore this further, splenocytes of SjSs Aec1Aec2 mice or of age and sex matched SjSNS control C57BL/6J mic e were treated with IL 27 alone, IL 6 plus TGF H 17 differentiation, or IL 6 and TGF 27 to determine the suppressive potential of IL 27 on differentiating T H 17 cells. The numbers of T H 17 cells synthesizing IL 17A were detected usin g flow cytometric analysis. Representative data, presented in Figure 3 5, illustrates that the presence of IL 27 resulted in decreased numbers of IL 17A secreting cells in both male and female C57BL/6J mice (4.26% and 3.56% respectively), as well as a sma ll decrease in male Aec1Aec2 mice (1.17%). In contrast, IL 27 had little effect on IL 17A secreting cell levels in spleens of female Aec1Aec2 mice. While stimulation of splenic leukocytes with IL 6 and TGF 17A secreting T cells in all four experimental groups, the presence of exogenous IL 27 suppressed the numbers of T H 17 cells in each spleen cell culture except for Aec1Aec2 female mice, whose numbers actually increased. Thus, differentiating T H 17 cells from Aec1Aec2 female mice appear to be refractive to the suppressive action of IL 27.

PAGE 44

44 Rapid Loss in IL 27 s ignaling Pathways in Splenic Leukocytes from Female but Not Male Aec1Aec2 Mice IL 27 (or the IL 27p28 subunit per se) exe rts the IL 27 associated biological effects by activating its heterodimeric IL 27R including WSX 1 and gp130. Signal transduction involves phosphorylation of Jak1, Jak2, Stat1, Stat3, Stat4 and Stat5 in T cells, NK cells and monocytes, but only Stat3 in m ast cells 93 However, only Stat1 or Stat3 activations are critical for the resulting bioactivity of IL 27 on nave T cells 94 which express IL 27R. Activation of Stat1 by Jak1 or Jak2 promotes T H 1 differentiation via the up regulation of T bet resulting in the production of IFN 27 inhibits the production of IL 2 and IL 6, thus down regulating the IL 6 dependent Stat3 t of T H 17 cells. To determine if the inability of IL 27 to suppress T H 17 cell populations in female Aec1Aec2 mice might be attributed to differential activation of the STAT signal transduction pathways following receptor : ligand interaction, splenic leuko cytes from male and female C57BL/6J or Aec1Aec2 mice were treated with IL 27 only, IL 6 plus TGF 6 and TGF 27 for either 30 min, 3 hrs or 24 hrs and examined for changes in levels of Stat1 or Stat3 phosphorylation. Lysates of male C57BL/6J and Aec1Aec2 splenic leukocytes, as well as lysates of female C57BL/6J splenic leukocytes, showed relative increased expressions of Stat1 and p Stat1 (Figure 3 6A), or Stat3 and p Stat3 (Figure 3 6B), over the 24 hr stimulation period, suggesting functional activation of signal transductions. In c ontrast, lysates of female Aec1Aec2 splenic leukocytes initially showed similar increased expressions of Stat1, p Stat1, Stat3 and p Stat3, but this was not maintained, resulting in an unexpected and rapid decrease in expressions of these molecules between the 3 and 24 hour stimulation time points.

PAGE 45

45 This unexpected result in the temporal expression levels of the STAT molecules in the cell lysates of female Aec1Aec2 mice necessitated an examination of events up stream of STAT signaling. As shown in Figure 3 6C, similar temporal expression patterns were identified for the IL 27R subunit WSX 1 as with the STAT molecules, most notable being a rapid loss of WSX 1 expression at the 24 hr time point in female Aec1Aec2 cells. These data define a clear distinction b etween male and female responses to IL 27 stimulation, pointing specifically to dissimilar responses between differentiated versus committed T H 17 cells present in both sexes of SjS S mice. Summary The immune system has evolved to maintain equilibrium betwee n inflammation and immune suppression, thus it is believed that imbalances between these two entities permit a breakdown in immune tolerance resulting in autoimmunity. The aim of the present in vitro study was to determine if IL 27, a major regulatory mol ecule of the T H 17/IL 17A system, is capable of suppressing the activation of T H 17 effector cells considered to play an important role in the development of rheumatic autoimmune diseases such as SjS. Results revealed that SjS s Aec1Aec2 female mice have hig her percentages of IL 17A secreting CD4 + T cells and lower expressions of IL27R than their male counterparts. In addition, in vitro experiments indicated that IL 27 is effective in suppressing of T H 17 cell activation in SjS s Aec1Aec2 male mice, but not in females, a point indirectly supported by a lack of sustained signal transduction through Stat1 and Stat3. Considered as a whole, these data show direct correlations between a differential regulation of T H 17 cells by IL 27 in male versus female Aec1Aec2 mi ce and disease severity.

PAGE 46

46 Figure 3 1. Enumeration of IL 17A secreting T H 17 cells in spleens. Splenic leukocytes from male and female C57BL/6J mice 4, 11 and 20 weeks of age, or Aec1Aec2 mice 4, 13 and 21 weeks of age were examined for the presence of intracellular IFN 17A. Splenocytes were activated in vitro with anti CD28 for 5 hours with Leukocyte Activation Cocktail containing GolgiPlug. Pooled samples of at least n=2 per sex and age group were used for each experiment. The data shown are representative of 5 independent experiments.

PAGE 47

47 Figure 3 2. IL 17A expression in lymphocytic foci of salivary glands. A. Immunohistochemical staining for IL 17A in salivary glands of 20 wks old C57BL/6J (female, n=6, male, n=6) and 20 wks o ld Aec1Aec2 mice (female, n=6, male, n=6). Negative controls were performed with rabbit IgG isotype. Percentages of IL 17A positive cells within leukocyte infiltrates in salivary glands of mal e and female Aec1Aec2 mice. Enumeration of IL 17A positive cells and total cells within leukocyte infiltrates was done with at least 3 infiltrates per gland section for both male (n=6) and female (n=6) mice. Percentage of cells is presented versus total number of cells. Error bars indicates standard error with **p<0.01.

PAGE 48

48 Figure 3 3. Expression of IL 27p28 in lymphocytic foci of salivary glands. Immunohistochemical staining for IL 27p28 (Brown color, arrows indicate representative positive staining) and immunofluorescence staining with F4/80, CD11c and IL 27p28 (red, green, and purple color, respectively) in salivary glands of male and female Aec1Aec2 mice at 20 weeks of age. Images were taken at 200X magnification for immunohistochemical staining an d 400X for immuno are representative of 3 independent experiments.

PAGE 49

49 Figure 3 4. Detection of IL 1) in infiltrating leukocytes present in salivary glands. A. Immunohistochemic al staining for WSX 1 in salivary glands of male and female Aec1Aec2 mice was carried out at the designated ages. The images are representative of at least 4 mice per sex and age group, and the experiment was performed twice for consistency. Images were t aken at 200X 27R positive cells within leukocyte infiltrates in salivary glands of male and female Aec1Aec2 mice at 20 weeks. Enumeration of IL 27R positive cells and total cells was done with at least 3 infiltrates per gland section for both male (n=6) and female (n=6). Percentage of cells is presented over total number of cells within leukocyte infiltrates. Error bars indicates standard error with **p<0.01.

PAGE 50

50 Figure 3 5. Differential ef fects of IL 27 cytokine on T H 17 cell populations from male versus female C57BL/6.NOD Aec1Aec2 mice. Splenocytes of 12 wks old male and female C57BL/6J and Aec1Aec2 mice were treated with IL 27 alone, IL 6 and TGF 6 and TGF 27. Medium only served as the non stimulated control. After 24 hours of stimulation, cells were incubated with Leukocyte Activation Cocktail containing GolgiPlug for an additi onal 5 hours. Cells were fixed, permeabilized stained with PE Cy5 conjugated anti CD4 and PE conjugated anti IL 17A, and enumerated using FCS Express. A pool sample of at least n=2 per sex and age group was used for each experiment. The data shown are representative of 3 independent experiments.

PAGE 51

51 Figure 3 6. Differential effects of IL 27 on signal tra nsduction pathways during activation of leukocytes from male versus female C57BL/6.NOD Aec1Aec2 mice. Splenocytes of 12 wks old male and female C57BL/6J and Aec1Aec2 mice were treated with IL 27 alone, IL 6 and TGF 6 and TGF 27. Medium only served as the unstimulated control. Cells were collected and lysed at 30 min, 3 hours and 24 hours post stimulation. Western blots were performed to detect Stat1, p Stat1 (A), Stat3, p Stat3 (B), WSX actin (D) protein levels. Pooled sa mples of at least n=2 per sex and age group was used for each experiment. The data shown are representative of 3 independent experiments.

PAGE 52

52 CHAPTER 4 EFFECTS OF IL 27 GENE THERAPY ON S JS IN A MOUSE MODEL IL 27, along with IL 12, IL 23, and IL 35, is a nov el cytokine of the IL 12 family. It is composed of two subunits, IL 12p40 related protein, Epstein Barr virus induced gene 3 (EBI3) and IL 12p35 related p28 protein (p28) 77 The orphan cytokine receptor WSX 1 (TCCR) and glycoprotein 130 (gp130) make up the dimeric signal transducing receptor for IL 27 90 IL 27 acts on C D4 + T cells and plays a pivotal role as a proinflammatory cytokine by activating the T H 1 response in the early phase of development for secretion of IFN mechanism appears to be the activation of signal transducer and activator of transcription protein 1 (STAT1). 93 IL 27 also as an anti inflammatory protein by suppressing IL 2, antagonizing IL 6 function and activating expression of suppressor of cytokine signaling (SOCS) protein 89 According to receptor knockout (WSX / ) studies for IL 27, abnormal signal transduction of IL 27 showed h yperproduction of various proinflammatory cytokines such as TNF 6 when challenged by T. cruzi 95 and T. gondii 96 Moreover, IL 27 can suppress the expression of forkhead box P3 (Foxp3) positive regulatory T cells 97 and can act as a negative regulator of human neutrophil function 98 Recent studies also confirmed that IL 27 has anti tumor effects 98 99 More recent reports have described the capability of IL 27 to suppress T H 17 cells by inhibiting T H 17 cell differentiation, thereby reducing severity of T H 17 mediated autoimmune disease 100 101 Also, our lab confirmed that IL 17A is the one of the expression of IL 17A in wild typ e C57BL/6 mice 83

PAGE 53

53 Gene delivery of IL 27 using adeno associated virus (AAV) based vectors has been shown to convey the advantage of long term gene expression in treated hosts and also gives an inherent feature 102 105 Also, previous studies of gene therapy using AAV have proven its safety and the ability to elicit a mi nimal inflammatory response compared with other types of gene delivery agents 106 109 Adeno associated virus type 2 (AAV2) is one of the most extensively studie d serotypes among 12 different AAV serotypes currently characterized 110 Thus IL 27, a potent inhibitor of T H 17 cell develop Hypothesis behind the Present Study The current studies were carried out to determine if increased level of IL 27, might effect the progression of SjS in Aec1Aec2 mice. I hypothesize tha t increased level of IL 27 in SjS at the time of disease onset, will be possible to suppress T H 17 cells and prevent and/or reverse disease progression from Aec1Aec2 mice. Therefore, to address this hypothesis, I established two specific aims: (1) To examin e disease profile for 27 delivery into the Aec1Aec2 syndrome. (2) To investigate if IL 27 gene therapy can regulate IL 17 producing T helper cells (T H 17) in the Aec1Aec2 in vivo Results Disease Profile Assessments Syndrome after Gene Delivery There are several sets of criteria for defining SjS in humans, but three are most critical: dryness, presence of ANAs and leukocytic infiltration of a minor salivary gland (MSG) 111 112 syndrome like disease in the Aec1Aec2 mouse model, generating a general disease profile without an overall assessment of severity per se

PAGE 54

54 Stimulated saliva flow rates in systemic and targeted gene delivery models Loss of saliva and tears are the main symptoms of th e SjS. To measure the effect of AAV2 IL27 on the SjS mouse model, I compared the stimulated saliva flow rates among three different treatments groups (saline, AAV2 LacZ, and AAV2 IL27). Figure 4 1 shows normalized stimulated saliva flow rates against the b ase line (pre treatment) flow rates. In the syst emic delivery group (Figure 4 1 A) of gene therapy, although, the saliva flow rate was higher than the other two groups (saline and AAV2 LacZ), the saliva flow rate in the pre disease group showed decreased co mpared to the pre treatment level (saliva flow rates were less than 1). However, AAV2 IL27 treatment on clinical disease group showed an increased saliva flow rate when compared with the pre treatment level (saliva flow rate s were more than 1) (Figure 4 1 A (a), (c)). Male and female mice showed different responses to the AAV2 LacZ and A AV2 IL27 treatments (Figure 4 1 A (b)) but AAV2 IL27 treatment appeared to affect the clinical disease profile similarly with the same increased saliva flow rates in male and female mice. Mice with targeted delivery of AAV2 IL27 showed increased saliva flow rates (saliva flow rates were more than 1), which resulted in saliva, flow rates significantly greater than seen in mice treated with either saline or the AAV2 LacZ rAAV vec tor. Both males and females showed, increase of saliva flow with AAV2 IL27 treatment (Figure 4 1 B). Lymphocytic infiltrates in the salivary glands of systemic and target gene delivery group The number of lymphocytic infiltrates seen in histological sectio ns of minor salivary glands is the one of the critical clinic diagnostic tests to identify primary SjS. In the Aec1Aec2 mouse model development and onset of autoimmunity in the salivary glands is believed to result from acinar cell apoptosis (see Figure 1 1) that signals an influx of

PAGE 55

55 leukocytes expressing pro inflammatory cytokines, establishing lymphocytic foci, first of T cell clusters followed by recruitment of B lymphocytes 92 113 Figure 4 2 shows a representative picture of lymphocytic infiltrations in salivary glands from a mouse inoculated with the AAV2 IL27 vector system. As discussed in previous studies 1 86 infiltrates mainly consist of activated T and B cells that form marginal zone like aggregates (Ri ght in Figure 4 2). Table 4 1 shows the quantification of lymphocytic infiltrates (foci) in the salivary glands of the different gene delivered mouse groups at 20 week post injection. Results show that there were no statistical difference between mice of s ystemic and targeted delivery groups, and among the saline, AAV2 LacZ, and AAV2 IL27 treated groups. Examination of other organs revealed that there were infiltrates in lacrimal glands, liver, lung, and kidney. Anti nuclear antibody staining in the sera of systemic and target gene delivery groups A balance between the induction of humoral responses against pathogen and maintaining tolerance against self antigen is critical for antibody production by activated B lymphocytes. Thus, abnormal production and reg ulation of antibodies against self antigens can be an early indication of tolerance failure. Moreover, inappropriate antibody production is a defining and primary step in many autoimmune diseases. For example, systemic lupus erythematosus (SLE), one of the well known autoimmune diseases, is fist characterized by high titers of anti nuclear antibodies (ANA) in sera. In most autoimmune diseases, production of ANA and autoimmune disease progression is highly conserved 114 116 ANA staining using the indirect immunofluorescence technique is the standard method to screen for the presence of ANA in patient sera 117 HEp 2

PAGE 56

56 cells, is the well established and preferred cell substrate for indirect immunofluorescence analysis of ANA 117 119 Figure 4 3 shows representative staining patterns of ANA in sera of the different gene delivered mouse groups. Table 4 2 shows the frequency of six different staining patterns with 1/50 diluted sera and the quantified antibody titers with 1/400 diluted sera. Speckled nucleus and diffuse cytoplasmic staining patterns were dominant among six staining p atterns in sera from mice inoculated systemically (i.v.). Within this experimental group, mice treated with AAV2 IL27 at the pre disease stage showed statistically less positive staining patterns compared with saline and AAV2 La cZ delivered groups (Figure 4 4 A). Also, AAV2 IL27 treatment on clinical disease stage showed relatively less positive staining than two controls but did not show statistical difference. In the other hands, AAV2 IL27 treatment on clinical disease stage showed less quantified score th an saline and AAV 2 LacZ treated mice (Figure 4 4 B). In the targeted delivery (Figure 4 5), speckled nucleus and mitotic chromosome staining patterns were dominant over other staining patterns. AAV2 IL27 treated mice in the target delivery group showed comp aratively less positive staining scores when considering mitotic chromosomal staining. IL 27 and IL 17A Level in the Sera of Gene Delivered Mouse Group Levels of IL 27 and IL 17A were measured in the sera of gene delivered mice at 20 weeks post gene deli very by ELISA. Mice inoculated in th e pre disease phase (Figure 4 6 A) shows that AAV2 IL27 delivered mice have increased levels of IL 27 at 20 weeks post injection, but decreased levels of IL 17A from 12 weeks post injection. In clinical disease gene deli very group (Figure 4 6 B) also showed increased level of IL 27 from 8 weeks of post injection periods comparatively earlier than pre disease gene

PAGE 57

57 delivery group and showed decreased levels of IL 17A from 12 weeks of post gene delivery period compared with l evels in mice receiving saline or AAV2 LacZ injections. In target delivery group (Figure 4 6 C), levels of IL 27 were also increased at 20 weeks of post injection period from AAV2 IL27 injection mice and IL 17A level was decreased from 8 weeks after target delivery. IL 27 and IL 17A Positive Spleen Cells (Splenocytes) in Gene Delivered Mouse Group Flow cytometry confirmed the positive numbers of IL 27 and/or IL17 splenocytes from gene delivered groups (Figure 4 7). CD4 + T cells were gated and the cells were analyzed for IL 27+ or IL 17A+ cells. AAV2 IL27 delivered mouse groups showed increased numbers of I L 27 positive splenocytes over saline and AAV2 LacZ delivered groups in both pre disease and clinical stage delivery groups by systemic I.V. injection. Alt hough, pre disease group showed increased positive numbers of IL 27, there were no difference in IL 17A positive splenocytes among treatment groups. However, AAV2 IL27 delivery in clinical disease stage showed decreased IL 17A positive splenocytes with inc rease of IL 27 positive splenocytes. Target delivery showed no difference of IL 27 and IL 17A positive splenocytes in each gene delivered groups. Summary In recent years, considerable progress has been made in the treatment of autoimmune diseases with IL 27, including experimental autoimmune encephalomyelitis (EAE) 120 and collagen induced arthritis (CIA). 121 These studies have focused primarily on the inhibitory effects of IL 27 on T H 17 cells, which release IL 17A. However, none of th e present study was to determine if IL 27, a major regulatory molecule of the T H 17/IL

PAGE 58

58 17A system, is capable of inhibiting and/or reversing disease development in the Aec1Aec2 mouse model of SjS. Results revealed that systemic delivery of AAV IL27 to SjS m ice at either the pre or clinical disease stage resulted in an increased saliva flow rate. However, treatment at the clinical disease stage proved more promising than pre disease stage, suggesting that long term the immune system can recover from a single injection of the IL 27 expressing rAAV vector. Also, anti nuclear antibody staining (ANA staining) from systemic delivery group of AAV IL27, confirmed that there was patt erns from pre and clinical disease stages, respectively. Cytokines level from sera confirmed increased of IL 27 in AAV2 IL27 delivery groups with a concomitant decrease in IL 17A levels. Treatment of IL 27 by target delivery at pre clinical disease stage staining pattern than control groups (saline and AAV2 LacZ). Taken together, these data show a good therapeutic potential for IL feas ibility of targeted injections during the clinical stage of disease. It is also possible that IL 27 may translate to a potential therapeutic treatment of other autoimmune diseases, e.g., psoriasis, rheumatoid arthritis, multiple sclerosis, and SLE, since i n these diseases there are increased numbers of T H 17 cells, which are producing IL 17A.

PAGE 59

59 Table 4 1. Quantification of lymphocytic infiltrates in the salivary glands of gene delivered mouse group. Delivery location Gene delivered time Delivered gene Average number of LF from organs Salivary glands Lacrimal glands Liver Lung Kidney Systemic delivery (I.V.) Saline 2.2 1.3 2.8 1.3 1.7 0.6 1 Pre disease stage AAV2 LacZ 3.0 2.4 2.0 1.4 1.2 0.4 1.2 0.4 AAV2 IL27 4.3 2.2 1.5 0.5 1 1.6 0.9 2.7 0.6 Clinical disease stage AAV2 LacZ 3.4 2.4 2.5 1.0 1 1 1.5 0.6 AAV2 IL27 3.3 1.4 4.5 5.0 1 1 2.5 2.1 Target delivery (salivary glands) Pre disease stage Saline 4.0 2.7 2 1.7 0.6 AAV2 LacZ 3.6 3.1 1.8 0.8 1 1.5 0.6 2.5 0.7 AAV2 IL27 2.8 2.4 1.8 0.5 2.0 1.4 1 Score: Mean STD

PAGE 60

60 Table 4 2. Staining patterns and quantitative anti nuclear antibody measurements in gene delivered mice groups. Score: Mean STD Speckled nucleus Homogenous nucleus Nuclear mitotic spindle Mitotic chromosome Diffuse cytoplasm Cytoplasmic filaments Delivery location Delivery timing Group (n) % Score % Score % Score % Score % Score % Score Systemic delivery (I.V.) Pre disease stage Before treatment (6), (6wks old) 100 0.5 0.5 100 0.71.0 Saline (6) 83 3.20.4 100 1.8 1.2 AAV2 LacZ (8) 63 3.20.4 50 30.8 25 0 38 2.70.6 75 2.70.5 AAV2 IL27 (8) 71 1.60.5 14 2 71 2.40.5 100 0.40.5 14 1 Clinical disease stage Before trea tment (7), (14wks old) 100 1.41.4 14 4 100 1.90.9 AAV2 LacZ (6) 83 2.81.3 17 4 17 4 67 2.31.5 83 30.7 AAV2 IL27 (7) 100 1.91.3 71 2.80.3 86 0.50.8 Target delivery (salivary glands) Pre disease stage Before treatmen t (8), (6wks old) 13 0 25 0 88 0 Saline (7) 100 1.70.8 86 3.20.8 AAV2 LacZ (9) 100 1.81.0 56 2.60.5 33 1.31.2 AAV2 IL27 (8) 50 1.30.5 13 2 75 0.71.0 38 0.30.6

PAGE 61

61 F igure 4 1. Stimulated saliva flow rate in systemic and target gene delivery. A. Systemic gene delivery group. B. Target gene delivery group. (a), (c), and (e): saliva flow rate in different treatment mouse group, (b), (d), and (f): comparison of male and f emale in each mouse group with same treatment.

PAGE 62

62 Figure 4 2. Lymphocytic infiltration in salivary glands from one of AAV2 IL27 delivered mouse. Left: H&E staining of salivary glands. Right: Immunofluorescence staining of lymphocytic infiltrates against ant i CD3 to detect T cells (green) and anti B220 to detect B cells (red).

PAGE 63

63 Figure 4 3. Frequent anti nuclear antibody staining patterns in the sera of gene delivered mice groups.

PAGE 64

64 Figure 4 4. Comparisons of anti nuclear antibody staining patterns in sy stemic delivery group.

PAGE 65

65 Figure 4 5. Comparisons of anti nuclear antibody staining patterns in target delivery group

PAGE 66

66 Figure 4 6. Level of IL 27 and IL 17A in sera from gene delivered mouse group. A: systemic delivery in pre disease stage, B: systemic delivery in clinical disease stage, C: target delivery in pre disease stage.

PAGE 67

67 Figure 4 7. Level of IL 27 and IL 17A in spleen cells (splenocytes) from gene delivered mouse group. S: saline delivered groups, Z: AAV2 LacZ delivered groups, 27: AAV2 IL27 d elivered groups.

PAGE 68

68 CHAPTER 5 CONCLUSIONS IL 27 Cytokine Function Syndrome SjS is an autoimmune disease that exhibits a strong sexual dimorphism with 90 95% of patients being females. Despite the fact that both female and male Aec1Aec2 mice develop a SjS like disease, a sex dimorphism is prevalent in this model in that female mice generally develop an earlier onset of pathology and a more severe disease of the salivary glands 75 This raises the possibility that the activation states of the disease causing cell populations in male and female mice are different. Perhaps pertinent to this possibility is the fact that our analysis of T H 17 cell populat ions in salivary glands at the clinical disease stage reveals a significant increase in infiltration of IL 17A positive cells in female compared to male mice. Furthermore, at time of disease onset (around 20 wks of age), spleens showed drastic differences in the percentages of T H 1, T H 17 and T H 1/T H 17 double positive cells with 52%, 11%, and 37%, respectively in males, but 37%, 13% and 50%, respectively in females. Elevated IFN observed in Aec1Aec2 SjS s animal models 40 and are known to activate adhesion molecules that attract lymphocytes to the salivary glands 122 Also, studies by Karpuzoglu Sahin and Haas have shown that elevated estrogen levels enhance synthesis and secretion of cytoki nes such as IFN higher numbers of CD4 + T cells 123 124 Howeve r, the most recent study by Khan et al. 125 ha s shown that elevated estrogen levels from wild type C57BL/6 mice enhanced IL 17A production and reduced secretion of cytokines such as IFN 27. Still, it is unclear whether or how sex steroids contribute to the differences in SjS disease progression observed between the sexes, especially in light of the fact that the current

PAGE 69

69 experimental design using relatively young mice would effectively eliminate any effect from onset of menopause in the female Aec1Aec2 mice. We have proposed that secreted products of T H 17 cells, such as IL 17A, could contribute to glandular secretory dysfunction 86 126 127 IL 21 in conjunction with IL 22 activates follicular T cells and rec ruit s B cells which are directly involved in the formation of germinal center like structures 91 IL 27 is a general suppressor of T H 17 cell development and acti vation by negatively targeting the T H 17 cell transcription factor 128 Simultaneously, it up regulates the T H 1 transcription factor T bet at the early T H 1 developmental stage 129 IL 27, in conjunction with IL 6, can mediate suppression through the induction of IL 10 that inhibits the response of autoreactive T cells 130 Although, we confirmed that IL 27 co exists with macrophages and dendritic cells within LF of SG from Aec1Aec2 mice, only a limited number of cells showed positive staining for IL 27 com pared with IL 17A positive cells. The dramatic shift from a suppressive presence of IL 27 to a pathogenic infiltration of T H 17 cells signals a change in the equilibrium that favors an exacerbation of the disease phenotype. A severe clinical phenotype is more evident in female mice where an elevated level of IL 17A w as evident and the number s of T H 17 cells, both locally and systemically, are increased, concomitantly with higher levels of IL 27 that fail to down regulate IL 17A levels. The culminations of these immunological events appear to define the dysregulation leading to the more severe pathology observed in female mice. Reduction of WSX 1 signaling and its related signaling pathway factors in the presence of IL 27 in female Aec1Aec2 mice reflect poss ible dysregulation of internal signaling pathways after binding with IL 27. A recent report from Hashimoto et al. 131

PAGE 70

70 indicates that soluble WSX 1 (sWSX 1), a splice variant of WSX 1, can replace full length WSX 1 and act as a functional subunit. As such, sWSX 1 would function as a potential IL 27R decoy for IL 27, wherein binding of sWSX 1 with IL 27 would then inhibit the direct suppressive activity of IL 2 7 on T H 17, or alternatively, shunt its cell signaling toward a different transduction pathway in female Aec1Aec2 mice. We have observed (unpublished data) that WSX 1 is released by leukocytes in our cultures and that cells from female Aec1Aec2 mice appear to release slightly greater quantities following stimulation with TGF 6, and IL 27. However, there is no evidence indicating this might be the reason for down regulated expression of WSX 1 on differentiating T H 17 cells in the presence of IL 27. No doubt that identifying the molecular basis governing membrane bound and secreted WSX 1 forms will help explain the sexual dimorphism in SjS and other related rheumatic diseases. In any event, results of the current study raise potential complications in t he effective intervention of IL 27 to down regulate SjS in female patients, especially if T H 17 cells turn out to be a major factor in the pathology and development of clinical disease. Lastly, the recent report from Yoshimura et al. 81 and confirmed by El Behi et al. 132 indicates that IL 27 is capable of suppressin g differentiation of CD4 + T cells to T H 17 effector cells, but have little or no effect on committed T H 17 cells even though the latter retain expression of IL 27 receptors and activate both Stat1 and Stat3. Thus, the failure of IL 27 to suppress committed T H 23/IL 23R activation. Although, El Behi et al. confirmed that committed T H 17 cells express functional WSX 1 in vitro, this model is now confounded by the fact that T H 17 cells from female Aec1Aec2 mice app arently down regulate their IL 27 receptors (WSX 1) in vitro

PAGE 71

71 in the presence of IL 27 after being differentiated by TGF 6. In addition, we have confirmed that leukocytes from Aec1Aec2 female mice express less WSX 1 compared with male s and this a pparently correlates with the appearance of increased numbers of committed T H 17 cells that are refractive to the action of IL 27. Furthermore, recent studies show that WSX 1 deficiency can exacerbate innate immune responses by infection through augmentati on of antigen presentation and T H 1 functions 95 96 133 We would conclude, therefore, that the lower expression of IL 27R in female Aec1Aec2 mice accelerates the pathogenesis of SjS and is responsible for the differences observed in the severity of disease between male and female Aec1Aec2 mice. IL 27 G ene Therapy Syndrome Mouse Model We have previously confirmed that IL 17A releasing T H 17 cells are one of the pathogen ic elements in SjS with induction of IL 17A into C57BL/6J mice. The findings suggested that over expressed IL 17A in the sali vary gland of C57BL/6J resembled the SjS disease profile with the appearance of lymphocytic foci, increased IL 17A levels, increased positive nuclear speckled staining patterns in antinuclear antibody profiles, and temporal loss of saliva flow 83 134 In CHAPTER 3, I presented data confirm ing the capacity of IL 27 for therapeutic use, although male s and femal e s showed different signal transduction pathway s against IL 27 treatment in vitro An IL 6/IL 12 family member, IL 27, which activates T bet, transcription factor for T H 1 cells, and STAT1 pathway can suppress the T H 17. IL on factor for T H 17 cells and thus inhibits expression of IL 17A 135 WSX 1, one of the receptors for IL 27, deficient mice showed greater susceptibility for EAE co mpared with wild type control mice and exhibited increased level s of IL 17A 100 The current studies were designed 1) to assess disease profile s for SjS after I L 27 gene delivery in the SjS mouse model, 2)

PAGE 72

72 to compare the treatment on different disease development stages, 3) to compare the delivery methods, and 4) to address the possible therapeutic use of IL 27 in the regulation of T H 17 cells. Normalized saliva f low rates post treatment, when compared against pre treatment were significantly enhanced in mice with local AAV2 IL27 delivery at a pre disease stage and its systemic delivery at clinical disease stage. Although, systemic AAV2 IL27 delivery at a pre dise ase stage showed greater saliva flow rate s than the other two control groups (saline and AAV2 LacZ), saliva flow rate s w ere decreased compared to the pre treatment If we consider sex difference s, the results were varied depend ing on the treatment. Some r esults showed that transduction efficiencies were varied when examining treatment at different ages or at different disease development stages or with different sex es in our mouse model This is similar to human clinical stud ies using AAV vector s by syste mic delivery 136 138 Thus, the different saliva flow rate s in pre disease mice group might be the different AAV2 IL27 transduction efficiency, which need s to b e examined. However, target ed AAV2 IL27 delivery into salivary glands of SjS mice at pre disease showed increased saliva flow rate compared tp its base line secretion at the beginning of the experiment. As stated in previous stud ies about the suitable tar get for gene delivery by AAV 139 140 I also found that target delivery into salivary glands might be m ore efficient than systemic delivery a t the pre disease stage of SjS. However, an underlying mechanism for IL 27 treatment increas ing saliva flow rate s is still to be defined. One possible mechanism is that IL 27 can reduce the autoantibody production, whi ch can bind to muscarinic receptor type 3 (M3R) by suppression o f T H 17 cells Autoantibody that binds to M3R can inhibit acetylcholine

PAGE 73

73 binding to M3R and can a ffect water secretion through calcium influx in the acinar cells Over production of antibodies c an have a profound effect on the function of major organ systems, including the salivary glands. A IL 17A secreting T H 17 cells can drive autoimmune responses by promoting the formation of spontaneous germinal centers in autoimmune BXD2 mice 141 One fascinating feature of SjS autoimmunity in both humans and most animal models is the formation of leukocyte aggregates in the salivary and lacrim al glands, referred to as either lymphoepithelial sialadenitis (LES) or lymphocytic foci (LF) or lymphocytic infiltrates 142 143 At times, these LF appear histologically to be germinal like centers, and may be indicative of a more pronounced and severe hypergammaglobulinemia 144 Although LF and LF scores are important criteria for clinical disease and depict the level of lymphocytic infiltrations of the exocrine glands, the scores often do not correlate with the severity of disease 44 Until recently, it was thought that salivary gland infiltrating leukocytes were mostly B lymphocytes and CD4 + T H 1 T helper cells. However, we recently reported that LF contain significant numbers of CD4 + T H 17 memory T cells plus IL 23 producing macrophages and/or dendritic cells 127 data that further confirm a similar immunity between human SjS and the SjS like disease exhibited by Aec1Aec2 mice. While Aec1Aec2 mice have proven to be an appropriate model for the study of autoimmune exocrinopathy, but similar to ot her mouse models, little attention has focused on possible systemic complications that often accompany SjS, especially those indicative of neurologic, respiratory and renal involvement. The results from AAV2 IL27 delivered mouse group confirmed this non

PAGE 74

74 co rrelation between saliva flow rate (Figure 4 1) and numbers of lymphocytic infiltrates (Table 4 1). To screen anti nuclear antibodies (ANA), the enzyme linked immunosorbent assay (ELISA) or fluorescent ANA test using cultured human esophageal squamous cell carcinoma cells, called HEp 2 cells, as the substrate are used. The latter is the most common, at present, method used in laboratories 145 146 The titer of a positive ANA staining is significant for diagnosis of autoimmune disease including SjS along with the frequencies of the staining pattern, which can be useful in the diagnos is of disease 147 Reduced score s of ANA from AAV2 IL27 treated mice may reflect a reduced production of autoantibodies in this set of SjS m ice Systemic delivery showed more staining patter n s than target delivery. Speckled nucleus and diffused cytoplasm were two major staining patterns from the AAV2 IL27 systemic and targeted delivery. Interestingly, AAV2 vector (AAV2 LacZ and AAV2 IL27) delivered mice showed mitotic chromosome staining patt ern but its meaning remains unclear It has been known that certain ANA staining patterns are associated with specific diseases. Nucleoplasmic speckled and nucleoplasmic mitotic patterns in correlates with antibodies to various ribonucleoproteins and is s een in mixed connective tissue disorder (MCTD), systemic syndrome (SjS) 148 149 Some speckled patterns correlate with antibodies to heteronuclear ribonucleoproteins (hnRNP), which can be found in SLE and SS A and SS B antibodies in SLE and SjS 146 149 Interestingly, a cytoplasmic staining pattern SjS 148

PAGE 75

75 Lastly, I detected elevated circulating levels of IL 27 in the sera of all AAV2 IL27 delivery groups ( CHAPTER 4 ), and decreased IL 17 levels in sera. We also detected increased level s of IL 27 in splenocytes of AAV2 IL27 de livered mice. The increased level s of IL 27 in AAV2 IL27 delivered mice might indicate a regulatory role on T H 17 cells in SjS mice. As we confirmed in previous stud ies, elevated level s of IL 17 induced pathogenic progression of SjS like disease in C57BL/6 m ice Controlled IL 17 level s by IL 27 have shown less pathogenesis in AAV2 IL27 delivered mice. However, there were no direct correlations, so far, between IL 27 and disease profile for SjS. In conclusion, I have prov id e d some proof of my hypothesis that in our syndrome mouse model, AAV2 IL27 gene therapy resulted in increased saliva flow rate and less positive anti nuclear auto antibody staining with reduced level s of IL 17 proinflammatory cytokine in sera and splenocytes. To get more effective r esults after IL27 gene therapy validating the use of AAV gene transfer with respect to disease stage and delivery method are need to be considered. G ene therapy using IL 27 is an important new and novel step toward finding effective therapies for the trea tment of

PAGE 76

76 LIST OF REFERENCES 1. Nguyen, C.Q., Cha, S.R. & Peck, A.B. Sjgren's syndrome (SjS) like disease of mice: the importance of B lymphocytes and autoantibodies. Front Biosci 12 1767 1789 (2007). 2. Han sen, A., Lipsky, P.E. & Dorner, T. New concepts in the pathogenesis of Sjogren syndrome: many questions, fewer answers. Curr Opin Rheumatol 15 563 570 (2003). 3. Fox, R.I. & Kang, H.I. Pathogenesis of Sjogren's syndrome. Rheum Dis Clin North Am 18 517 5 38 (1992). 4. Fox, R.I. & Michelson, P. Approaches to the treatment of Sjogren's syndrome. J Rheumatol Suppl 61 15 21 (2000). 5. Sullivan, D.A. Sex hormones and Sjogren's syndrome. J Rheumatol Suppl 50 17 32 (1997). 6. Sullivan, D.A. Androgen deficien cy & dry eye syndromes. Arch Soc Esp Oftalmol 79 49 50 (2004). 7. Toda, I., Wickham, L.A. & Sullivan, D.A. Gender and androgen treatment influence the expression of proto oncogenes and apoptotic factors in lacrimal and salivary tissues of MRL/lpr mice. C lin Immunol Immunopathol 86 59 71 (1998). 8. Carroll, M.C. The role of complement and complement receptors in induction and regulation of immunity. Annu Rev Immunol 16 545 568 (1998). 9. Ramos Casals, M. et al. Triple association between hepatitis C vi rus infection, systemic autoimmune diseases, and B cell lymphoma. J Rheumatol 31 495 499 (2004). 10. Ambrosetti, A. et al. Most cases of primary salivary mucosa associated lymphoid tissue lymphoma are associated either with Sjoegren syndrome or hepatitis C virus infection. Br J Haematol 126 43 49 (2004). 11. Voulgarelis, M. & Moutsopoulos, H.M. Lymphoproliferation in autoimmunity and Sjogren's syndrome. Curr Rheumatol Rep 5 317 323 (2003). 12. De Vita, S. et al. Characterization of prelymphomatous sta ges of B cell lymphoproliferation in Sjogren's syndrome. Arthritis Rheum 40 318 331 (1997). 13. Helmick, C.G. et al. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. Part I. Arthritis Rheum 58 15 25 (2008).

PAGE 77

77 14. Pflugfelder, S.C. et al. Epstein Barr virus infection and immunologic dysfunction in patients with aqueous tear deficiency. Ophthalmology 97 313 323 (1990). 15. Crouse, C.A., Pflugfelder, S.C., Cleary, T., Demick, S.M. & Atherton, S.S. Detection of E pstein Barr virus genomes in normal human lacrimal glands. J Clin Microbiol 28 1026 1032 (1990). 16. Fox, R.I., Luppi, M., Pisa, P. & Kang, H.I. Potential role of Epstein Barr virus in Sjogren's syndrome and rheumatoid arthritis. J Rheumatol Suppl 32 18 24 (1992). 17. Sullivan, D.A. et al. Does androgen insufficiency cause lacrimal gland inflammation and aqueous tear deficiency? Invest Ophthalmol Vis Sci 40 1261 1265 (1999). 18. Sullivan, D.A. et al. Androgens and dry eye in Sjogren's syndrome. Ann N Y Acad Sci 876 312 324 (1999). 19. Sullivan, D.A. et al. Androgen deficiency, Meibomian gland dysfunction, and evaporative dry eye. Ann N Y Acad Sci 966 211 222 (2002). 20. Shimazaki, J., Goto, E., Ono, M., Shimmura, S. & Tsubota, K. Meibomian gland dy sfunction in patients with Sjogren syndrome. Ophthalmology 105 1485 1488 (1998). 21. Bolstad, A.I. & Jonsson, R. Genetic aspects of Sjogren's syndrome. Arthritis Res 4 353 359 (2002). 22. Harley, J.B. et al. Anti Ro (SS A) and anti La (SS B) in patient s with Sjogren's syndrome. Arthritis Rheum 29 196 206 (1986). 23. Gottenberg, J.E. et al. In primary Sjogren's syndrome, HLA class II is associated exclusively with autoantibody production and spreading of the autoimmune response. Arthritis Rheum 48 224 0 2245 (2003). 24. Ricchiuti, V., Isenberg, D. & Muller, S. HLA association of anti Ro60 and anti Ro52 antibodies in Sjogren's syndrome. J Autoimmun 7 611 621 (1994). 25. Pertovaara, M. et al. Presence of apolipoprotein E epsilon4 allele predisposes to early onset of primary Sjogren's syndrome. Rheumatology (Oxford) 43 1484 1487 (2004). 26. Hu, S. et al. Salivary proteomic and genomic biomarkers for primary Sjogren's syndrome. Arthritis Rheum 56 3588 3600 (2007).

PAGE 78

78 27. Tsubota K, M.K., Obara K et al in Tear Film and Ocular Surface Taormina, Italy; (2007). 28. Teutsch, S.M., Booth, D.R., Bennetts, B.H., Heard, R.N. & Stewart, G.J. Identification of 11 novel and common single nucleotide polymorphisms in the interleukin 7 receptor alpha gene and their ass ociations with multiple sclerosis. Eur J Hum Genet 11 509 515 (2003). 29. Nguyen, C.Q., Sharma, A., She, J.X., McIndoe, R.A. & Peck, A.B. Differential gene expressions in the lacrimal gland during development and onset of keratoconjunctivitis sicca in Sj ogren's syndrome (SJS) like disease of the C57BL/6.NOD Aec1Aec2 mouse. Exp Eye Res 88 398 409 (2009). 30. Kumagai, S. et al. Association of a new allele of the TAP2 gene, TAP2*Bky2 (Val577), with susceptibility to Sjogren's syndrome. Arthritis Rheum 40 1685 1692 (1997). 31. Wang, H. et al. Mannose binding lectin polymorphisms in patients with Behcet's disease. J Dermatol Sci 36 115 117 (2004). 32. Bolstad, A.I., Wargelius, A., Nakken, B., Haga, H.J. & Jonsson, R. Fas and Fas ligand gene polymorphisms in primary Sjogren's syndrome. J Rheumatol 27 2397 2405 (2000). 33. Gottenberg, J.E. et al. Association of transforming growth factor beta1 and tumor necrosis factor alpha polymorphisms with anti SSB/La antibody secretion in patients with primary Sjogren 's syndrome. Arthritis Rheum 50 570 580 (2004). 34. Morinobu, A., Kanagawa, S., Koshiba, M., Sugai, S. & Kumagai, S. Association of the glutathione S transferase M1 homozygous null genotype with susceptibility to Sjogren's syndrome in Japanese individual s. Arthritis Rheum 42 2612 2615 (1999). 35. Berditchevski, F. Complexes of tetraspanins with integrins: more than meets the eye. J Cell Sci 114 4143 4151 (2001). 36. Kong, L. et al. Inappropriate apoptosis of salivary and lacrimal gland epithelium of i mmunodeficient NOD scid mice. Clin Exp Rheumatol 16 675 681 (1998). 37. Brayer, J.B. et al. IL 4 dependent effector phase in autoimmune exocrinopathy as defined by the NOD.IL 4 gene knockout mouse model of Sjogren's syndrome. Scand J Immunol 54 133 140 ( 2001). 38. Nguyen, K.H. et al. Evidence for antimuscarinic acetylcholine receptor antibody mediated secretory dysfunction in nod mice. Arthritis Rheum 43 2297 2306 (2000).

PAGE 79

79 39. Abdul Ajees, A. et al. The structure of complement C3b provides insights into complement activation and regulation. Nature 444 221 225 (2006). 40. Cha, S. et al. A dual role for interferon gamma in the pathogenesis of Sjogren's syndrome like autoimmune exocrinopathy in the nonobese diabetic mouse. Scand J Immunol 60 552 565 (200 4). 41. Batten, M. et al. TNF deficiency fails to protect BAFF transgenic mice against autoimmunity and reveals a predisposition to B cell lymphoma. J Immunol 172 812 822 (2004). 42. Sakai, A., Sugawara, Y., Kuroishi, T., Sasano, T. & Sugawara, S. Ident ification of IL 18 and Th17 cells in salivary glands of patients with Sjogren's syndrome, and amplification of IL 17 mediated secretion of inflammatory cytokines from salivary gland cells by IL 18. J Immunol 181 2898 2906 (2008). 43. Manoussakis, M.N. et al. Rates of infiltration by macrophages and dendritic cells and expression of interleukin 18 and interleukin 12 in the chronic inflammatory lesions of Sjogren's syndrome: correlation with certain features of immune hyperactivity and factors associated wi th high risk of lymphoma development. Arthritis Rheum 56 3977 3988 (2007). 44. Bombardieri, M. et al. Increased circulating levels and salivary gland expression of interleukin 18 in patients with Sjogren's syndrome: relationship with autoantibody product ion and lymphoid organization of the periductal inflammatory infiltrate. Arthritis Res Ther 6 R447 456 (2004). 45. Delaleu, N., Immervoll, H., Cornelius, J. & Jonsson, R. Biomarker profiles in serum and saliva of experimental Sjogren's syndrome: associat ions with specific autoimmune manifestations. Arthritis Res Ther 10 R22 (2008). 46. Gao, J. et al. Sjogren's syndrome in the NOD mouse model is an interleukin 4 time dependent, antibody isotype specific autoimmune disease. J Autoimmun 26 90 103 (2006). 47. Gao, J., Cha, S., Jonsson, R., Opalko, J. & Peck, A.B. Detection of anti type 3 muscarinic acetylcholine receptor autoantibodies in the sera of Sjogren's syndrome patients by use of a transfected cell line assay. Arthritis Rheum 50 2615 2621 (2004). 48. Nguyen, C.Q. et al. IL 4 STAT6 signal transduction dependent induction of the clinical phase of Sjogren's syndrome like disease of the nonobese diabetic mouse. J Immunol 179 382 390 (2007).

PAGE 80

80 49. Kastelein, R.A., Hunter, C.A. & Cua, D.J. Discovery and biology of IL 23 and IL 27: related but functionally distinct regulators of inflammation. Annu Rev Immunol 25 221 242 (2007). 50. Harrington, L.E. et al. Interleukin 17 producing CD4+ effector T cells develop via a lineage distinct from the T helper typ e 1 and 2 lineages. Nat Immunol 6 1123 1132 (2005). 51. Park, H. et al. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol 6 1133 1141 (2005). 52. Veldhoen, M., Hocking, R.J., Atkins, C.J., Locksley R.M. & Stockinger, B. TGFbeta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL 17 producing T cells. Immunity 24 179 189 (2006). 53. Bettelli, E. et al. Reciprocal developmental pathways for the generation of pat hogenic effector TH17 and regulatory T cells. Nature 441 235 238 (2006). 54. Mangan, P.R. et al. Transforming growth factor beta induces development of the T(H)17 lineage. Nature 441 231 234 (2006). 55. Ivanov, II et al. The orphan nuclear receptor ROR gammat directs the differentiation program of proinflammatory IL 17+ T helper cells. Cell 126 1121 1133 (2006). 56. Weaver, C.T., Hatton, R.D., Mangan, P.R. & Harrington, L.E. IL 17 family cytokines and the expanding diversity of effector T cell lineages Annu Rev Immunol 25 821 852 (2007). 57. Duerr, R.H. et al. A genome wide association study identifies IL23R as an inflammatory bowel disease gene. Science 314 1461 1463 (2006). 58. Hue, S. et al. Interleukin 23 drives innate and T cell mediated intes tinal inflammation. J Exp Med 203 2473 2483 (2006). 59. Cua, D.J. et al. Interleukin 23 rather than interleukin 12 is the critical cytokine for autoimmune inflammation of the brain. Nature 421 744 748 (2003). 60. Baum, P.R. et al. Molecular characteriz ation of murine and human OX40/OX40 ligand systems: identification of a human OX40 ligand as the HTLV 1 regulated protein gp34. EMBO J 13 3992 4001 (1994). 61. Ito, T. et al. OX40 ligand shuts down IL 10 producing regulatory T cells. Proc Natl Acad Sci U S A 103 13138 13143 (2006).

PAGE 81

81 62. Bettelli, E., Korn, T., Oukka, M. & Kuchroo, V.K. Induction and effector functions of T(H)17 cells. Nature 453 1051 1057 (2008). 63. Cha, S., Nagashima, H., Brown, V.B., Peck, A.B. & Humphreys Beher, M.G. Two NOD Idd as sociated intervals contribute synergistically to the development of autoimmune exocrinopathy (Sjogren's syndrome) on a healthy murine background. Arthritis Rheum 46 1390 1398 (2002). 64. Nguyen, C.Q., Kim, H., Cornelius, J.G. & Peck, A.B. Development of Sjogren's syndrome in nonobese diabetic derived autoimmune prone C57BL/6.NOD Aec1Aec2 mice is dependent on complement component 3. J Immunol 179 2318 2329 (2007). 65. Kaludov, N., Brown, K.E., Walters, R.W., Zabner, J. & Chiorini, J.A. Adeno associated v irus serotype 4 (AAV4) and AAV5 both require sialic acid binding for hemagglutination and efficient transduction but differ in sialic acid linkage specificity. J Virol 75 6884 6893 (2001). 66. Grimm, D., Kern, A., Rittner, K. & Kleinschmidt, J.A. Novel t ools for production and purification of recombinant adenoassociated virus vectors. Hum Gene Ther 9 2745 2760 (1998). 67. Kok, M.R. et al. Local adeno associated virus mediated interleukin 10 gene transfer has disease modifying effects in a murine model o f Sjogren's syndrome. Hum Gene Ther 14 1605 1618 (2003). 68. Kok, M.R. et al. Immune responses following salivary gland administration of recombinant adeno associated virus serotype 2 vectors. J Gene Med 7 432 441 (2005). 69. Lodde, B.M. et al. Effect of human vasoactive intestinal peptide gene transfer in a murine model of Sjogren's syndrome. Ann Rheum Dis 65 195 200 (2006). 70. Shai, E., Falk, H., Honigman, A., Panet, A. & Palmon, A. Gene transfer mediated by different viral vectors following direct cannulation of mouse submandibular salivary glands. Eur J Oral Sci 110 254 260 (2002). 71. Adesanya, M.R., Redman, R.S., Baum, B.J. & O'Connell, B.C. Immediate inflammatory responses to adenovirus mediated gene transfer in rat salivary glands. Hum Gene Ther 7 1085 1093 (1996). 72. Wickham, L.A. et al. Identification and hormonal control of sex steroid receptors in the eye. Adv Exp Med Biol 438 95 100 (1998).

PAGE 82

82 73. Grimaldi, C.M. Sex and systemic lupus erythematosus: the role of the sex hormones estroge n and prolactin on the regulation of autoreactive B cells. Curr Opin Rheumatol 18 456 461 (2006). 74. Cutolo, M. et al. New roles for estrogens in rheumatoid arthritis. Clin Exp Rheumatol 21 687 690 (2003). 75. Nguyen, C. et al. Sjogren's syndrome like disease of C57BL/6.NOD Aec1 Aec2 mice: gender differences in keratoconjunctivitis sicca defined by a cross over in the chromosome 3 Aec1 locus. Scand J Immunol 64 295 307 (2006). 76. Awasthi, A. & Kuchroo, V.K. Th17 cells: from precursors to players in inflammation and infection. Int Immunol 21 489 498 (2009). 77. Pflanz, S. et al. IL 27, a heterodimeric cytokine composed of EBI3 and p28 protein, induces proliferation of naive CD4(+) T cells. Immunity 16 779 790 (2002). 78. Yoshida, H., Nakaya, M. & Miyazaki, Y. Interleukin 27: a double edged sword for offense and defense. J Leukoc Biol 86 1295 1303 (2009). 79. Seita, J. et al. Interleukin 27 directly induces differentiation in hematopoietic stem cells. Blood 111 1903 1912 (2008). 80. Nagai, H. et al. Antitumor activities of interleukin 27 on melanoma. Endocr Metab Immune Disord Drug Targets 10 41 46 (2010). 81. Yoshimura, T. et al. Two sided roles of IL 27: induction of Th1 differentiation on naive CD4+ T cells versus suppression of proinflammat ory cytokine production including IL 23 induced IL 17 on activated CD4+ T cells partially through STAT3 dependent mechanism. J Immunol 177 5377 5385 (2006). 82. Nguyen, C.Q. et al. Identification of possible candidate genes regulating Sjogren's syndrome associated autoimmunity: a potential role for TNFSF4 in autoimmune exocrinopathy. Arthritis Res Ther 10 R137 (2008). 83. Nguyen, C.Q., Yin, H., Lee, B.H., Chiorini, J.A. & Peck, A.B. IL17: potential therapeutic target in Sjogren's syndrome using adenovir us mediated gene transfer. Lab Invest 91 54 62 (2011). 84. Nguyen, C.Q., Hu, M.H., Li, Y., Stewart, C. & Peck, A.B. Salivary gland tissue expression of interleukin 23 and interleukin 17 in Sjgren's syndrome: findings in humans and mice. Arthritis Rheum 58 734 743 (2008).

PAGE 83

83 85. Brayer, J. et al. Alleles from chromosomes 1 and 3 of NOD mice combine to influence Sjogren's syndrome like autoimmune exocrinopathy. J Rheumatol 27 1896 1904 (2000). 86. Lee, B.H., Tudares, M.A. & Nguyen, C.Q. Sjogren's syndrome : an old tale with a new twist. Arch Immunol Ther Exp (Warsz) 57 57 66 (2009). 87. Yoshida, H. & Miyazaki, Y. Interleukin 27 signaling pathways in regulation of immune and autoimmune responses. Int J Biochem Cell Biol 40 2379 2383 (2008). 88. Palmer, M .T. & Weaver, C.T. Autoimmunity: increasing suspects in the CD4+ T cell lineup. Nat Immunol 11 36 40 (2010). 89. Batten, M. & Ghilardi, N. The biology and therapeutic potential of interleukin 27. J Mol Med 85 661 672 (2007). 90. Pflanz, S. et al. WSX 1 and glycoprotein 130 constitute a signal transducing receptor for IL 27. J Immunol 172 2225 2231 (2004). 91. Nguyen, C.Q. et al. Differential gene expression in the salivary gland during development and onset of xerostomia in Sjogren's syndrome like dis ease of the C57BL/6.NOD Aec1Aec2 mouse. Arthritis Res Ther 11 R56 (2009). 92. Robinson, C.P. et al. Infiltrating lymphocyte populations and cytokine production in the salivary and lacrimal glands of autoimmune NOD mice. Adv Exp Med Biol 438 493 497 (199 8). 93. Villarino, A.V., Huang, E. & Hunter, C.A. Understanding the pro and anti inflammatory properties of IL 27. J Immunol 173 715 720 (2004). 94. D'Acquisto, F., Maione, F. & Pederzoli Ribeil, M. From IL 15 to IL 33: the never ending list of new pla yers in inflammation. Is it time to forget the humble aspirin and move ahead? Biochem Pharmacol 79 525 534 (2010). 95. Hamano, S. et al. WSX 1 is required for resistance to Trypanosoma cruzi infection by regulation of proinflammatory cytokine production. Immunity 19 657 667 (2003). 96. Villarino, A. et al. The IL 27R (WSX 1) is required to suppress T cell hyperactivity during infection. Immunity 19 645 655 (2003). 97. Huber, M. et al. IL 27 inhibits the development of regulatory T cells via STAT3. Int Immunol 20 223 234 (2008).

PAGE 84

84 98. Li, J.P. et al. Interleukin 27 as a negative regulator of human neutrophil function. Scand J Immunol 72 284 292 (2010). 99. Zhu, S., Lee, D.A. & Li, S. IL 12 and IL 27 sequential gene therapy via intramuscular electropor ation delivery for eliminating distal aggressive tumors. J Immunol 184 2348 2354 (2010). 100. Batten, M. et al. Interleukin 27 limits autoimmune encephalomyelitis by suppressing the development of interleukin 17 producing T cells. Nat Immunol 7 929 936 (2006). 101. Stumhofer, J.S. et al. Interleukin 27 negatively regulates the development of interleukin 17 producing T helper cells during chronic inflammation of the central nervous system. Nat Immunol 7 937 945 (2006). 102. Flotte, T.R. et al. Stable i n vivo expression of the cystic fibrosis transmembrane conductance regulator with an adeno associated virus vector. Proc Natl Acad Sci U S A 90 10613 10617 (1993). 103. Conrad, C.K. et al. Safety of single dose administration of an adeno associated virus (AAV) CFTR vector in the primate lung. Gene Ther 3 658 668 (1996). 104. Voutetakis, A. et al. Reengineered salivary glands are stable endogenous bioreactors for systemic gene therapeutics. Proc Natl Acad Sci U S A 101 3053 3058 (2004). 105. Voutetakis A. et al. Adeno associated virus serotype 2 mediated gene transfer to the parotid glands of nonhuman primates. Hum Gene Ther 18 142 150 (2007). 106. Wagner, J.A. et al. A phase I/II study of tgAAV CF for the treatment of chronic sinusitis in patients w ith cystic fibrosis. Hum Gene Ther 9 889 909 (1998). 107. Wagner, J.A. et al. Safety and biological efficacy of an adeno associated virus vector cystic fibrosis transmembrane regulator (AAV CFTR) in the cystic fibrosis maxillary sinus. Laryngoscope 109 266 274 (1999). 108. Flotte, T.R. et al. Phase I trial of intramuscular injection of a recombinant adeno associated virus alpha 1 antitrypsin (rAAV2 CB hAAT) gene vector to AAT deficient adults. Hum Gene Ther 15 93 128 (2004). 109. Moss, R.B. et al. Rep eated adeno associated virus serotype 2 aerosol mediated cystic fibrosis transmembrane regulator gene transfer to the lungs of patients with cystic fibrosis: a multicenter, double blind, placebo controlled trial. Chest 125 509 521 (2004).

PAGE 85

85 110. Daya, S. & Berns, K.I. Gene therapy using adeno associated virus vectors. Clin Microbiol Rev 21 583 593 (2008). 111. Vitali, C. et al. Classification criteria for Sjogren's syndrome: a revised version of the European criteria proposed by the American European Cons ensus Group. Ann Rheum Dis 61 554 558 (2002). 112. Daniels, T.E. & Whitcher, J.P. Association of patterns of labial salivary gland inflammation with keratoconjunctivitis sicca. Analysis of 618 patients with suspected Sjogren's syndrome. Arthritis Rheum 3 7 869 877 (1994). 113. Robinson, C.P. et al. Characterization of the changing lymphocyte populations and cytokine expression in the exocrine tissues of autoimmune NOD mice. Autoimmunity 27 29 44 (1998). 114. Ippolito, A. et al. Autoantibodies in system ic lupus erythematosus: comparison of historical and current assessment of seropositivity. Lupus 20 250 255 (2011). 115. Van Praet, J.T. et al. Specific anti nuclear antibodies in systemic sclerosis patients with and without skin involvement: an extended methodological approach. Rheumatology (Oxford) (2011). 116. Skare, T.L., Nisihara, R.M., Haider, O., Azevedo, P.M. & Utiyama, S.R. Liver autoantibodies in patients with scleroderma. Clin Rheumatol 30 129 132 (2011). 117. Wiik, A.S., Hoier Madsen, M., F orslid, J., Charles, P. & Meyrowitsch, J. Antinuclear antibodies: a contemporary nomenclature using HEp 2 cells. J Autoimmun 35 276 290 (2010). 118. Wiik, A.S. Anti nuclear autoantibodies: clinical utility for diagnosis, prognosis, monitoring, and planni ng of treatment strategy in systemic immunoinflammatory diseases. Scand J Rheumatol 34 260 268 (2005). 119. Tan, E.M. Antinuclear antibodies: diagnostic markers for autoimmune diseases and probes for cell biology. Adv Immunol 44 93 151 (1989). 120. Wan g, J. et al. Interleukin 27 suppresses experimental autoimmune encephalomyelitis during bone marrow stromal cell treatment. J Autoimmun 30 222 229 (2008). 121. Niedbala, W. et al. Interleukin 27 attenuates collagen induced arthritis. Annals of the Rheuma tic Diseases 67 1474 1479 (2008). 122. Wu, A.J., Chen, Z.J., Kan, E.C. & Baum, B.J. Interferon gamma induced JAK2 and STAT1 signalling in a human salivary gland cell line. J Cell Physiol 173 110 114 (1997).

PAGE 86

86 123. Karpuzoglu Sahin, E., Hissong, B.D. & An sar Ahmed, S. Interferon gamma levels are upregulated by 17 beta estradiol and diethylstilbestrol. J Reprod Immunol 52 113 127 (2001). 124. Haas, C., Ryffel, B. & Le Hir, M. IFN gamma receptor deletion prevents autoantibody production and glomerulonephri tis in lupus prone (NZB x NZW)F1 mice. J Immunol 160 3713 3718 (1998). 125. Khan, D., Dai, R., Karpuzoglu, E. & Ahmed, S.A. Estrogen increases, whereas IL 27 and IFN gamma decrease, splenocyte IL 17 production in WT mice. Eur J Immunol 40 2549 2556 (201 0). 126. Nguyen, C.Q. & Peck, A.B. Unraveling the pathophysiology of Sjogren syndrome associated dry eye disease. Ocul Surf 7 11 27 (2009). 127. Nguyen, C.Q., Hu, M.H., Li, Y., Stewart, C. & Peck, A.B. Salivary gland tissue expression of interleukin 23 and interleukin 17 in Sjogren's syndrome: findings in humans and mice. Arthritis Rheum 58 734 743 (2008). 128. Diveu, C. et al. IL 27 blocks RORc expression to inhibit lineage commitment of Th17 cells. J Immunol 182 5748 5756 (2009). 129. Takeda, A. et al. Cutting edge: role of IL 27/WSX 1 signaling for induction of T bet through activation of STAT1 during initial Th1 commitment. J Immunol 170 4886 4890 (2003). 130. Stumhofer, J.S. et al. Interleukins 27 and 6 induce STAT3 mediated T cell production o f interleukin 10. Nat Immunol 8 1363 1371 (2007). 131. Hashimoto, Y., Kurita, M. & Matsuoka, M. Identification of soluble WSX 1 not as a dominant negative but as an alternative functional subunit of a receptor for an anti Alzheimer's disease rescue facto r Humanin. Biochem Biophys Res Commun 389 95 99 (2009). 132. El behi, M. et al. Differential effect of IL 27 on developing versus committed Th17 cells. J Immunol 183 4957 4967 (2009). 133. Yoshida, H. et al. WSX 1 is required for the initiation of Th1 responses and resistance to L. major infection. Immunity 15 569 578 (2001). 134. Nguyen, C.Q. et al. Pathogenic effect of interleukin 17A in induction of Sjogren's syndrome like disease using adenovirus mediated gene transfer. Arthritis Res Ther 12 R220 (2010).

PAGE 87

87 135. Yang, J. et al. Epstein Barr virus induced gene 3 negatively regulates IL 17, IL 22 and RORgamma t. Eur J Immunol 38 1204 1214 (2008). 136. Maguire, A.M. et al. Age dependent effects of RPE65 gene therapy for Leber's congenital amaurosis: a phase 1 dose escalation trial. Lancet 374 1597 1605 (2009). 137. Koeberl, D.D. Age related efficacy with an AAV vector in Fabry disease mice. Mol Genet Metab 96 83 84 (2009). 138. Bostick, B., Ghosh, A., Yue, Y., Long, C. & Duan, D. Systemic AAV 9 tr ansduction in mice is influenced by animal age but not by the route of administration. Gene Ther 14 1605 1609 (2007). 139. Katano, H. et al. Enhanced transduction of mouse salivary glands with AAV5 based vectors. Gene Ther 13 594 601 (2006). 140. Voute takis, A. et al. Salivary glands as a potential gene transfer target for gene therapeutics of some monogenetic endocrine disorders. J Endocrinol 185 363 372 (2005). 141. Hsu, H. C. et al. Interleukin 17 producing T helper cells and interleukin 17 orchest rate autoreactive germinal center development in autoimmune BXD2 mice. Nature Immunology 9 166 175 (2008). 142. Xu, K.P., Katagiri, S., Takeuchi, T. & Tsubota, K. Biopsy of labial salivary glands and lacrimal glands in the diagnosis of Sjogren's syndrome J Rheumatol 23 76 82 (1996). 143. Agale, S.V., D'Costa, G.F., Hastak, M.S. & Shedge, R.T. Primary non Hodgkin's lymphoma of the salivary gland: a spectrum of lymphoepithelial sialadenitis, low grade B cell lymphoma of mucosa associated lymphoid tissue with transformation to high grade lymphoma. Indian J Pathol Microbiol 53 364 367 (2010). 144. Nordmark, G., Alm, G.V. & Ronnblom, L. Mechanisms of Disease: primary Sjogren's syndrome and the type I interferon system. Nat Clin Pract Rheumatol 2 262 269 ( 2006). 145. Saitta, M.R. & Keene, J.D. Molecular biology of nuclear autoantigens. Rheum Dis Clin North Am 18 283 310 (1992). 146. Adams, B.B. & Mutasim, D.F. The diagnostic value of anti nuclear antibody testing. Int J Dermatol 39 887 891 (2000).

PAGE 88

88 147. Tozzoli, R. et al. Guidelines for the laboratory use of autoantibody tests in the diagnosis and monitoring of autoimmune rheumatic diseases. Am J Clin Pathol 117 316 324 (2002). 148. Krapf, A.R. Atlas of immunofluorescent autoantibodies (Urban & Schwar zenberg, Mnchen ; Baltimore; 1996). 149. Sontheimer, R.D., McCauliffe, D.P., Zappi, E. & Targoff, I. Antinuclear antibodies: clinical correlations and biologic significance. Adv Dermatol 7 3 52; discussion 53 (1992).

PAGE 89

89 BIOGRAPHICAL SKETCH ByungHa Lee was born in Seoul, Republic of Korea. He graduated from the Korea University in Seoul, Korea where he earned a Bachelor of Science degree in the division of life sciences in 2001. At this time, ByungHa developed an interest in scientific research and deci ded to pursue a Master of Science degree in biopharmaceutical engineering in the laboratory of Dr. Chan developed novel insulin formulation to treat diabetes. During this time, ByungHa decided to continue his resea 2003, he continued his research from Samsung Biomedical Research Institute funded by Samsung Electronics, Seoul, Korea. At Samsung, while he worked as a project leader, he developed drug coated graft to prevent stenosis for haemodialysis patients. After five years of industry experience, ByungHa decided to pursue the research from academia. He was accepted to the Interdisciplinary Program in biomedical sciences at the University of Florida, USA. In th e summer of 2007, he married the love of his life, and moved to Gainesville, Florida to pursue his Ph.D.