<%BANNER%>

Physiological Function of Renal H+,K+-ATPases in Electrolyte and Acid-Base Homeostasis

Permanent Link: http://ufdc.ufl.edu/UFE0042727/00001

Material Information

Title: Physiological Function of Renal H+,K+-ATPases in Electrolyte and Acid-Base Homeostasis
Physical Description: 1 online resource (182 p.)
Language: english
Creator: GREENLEE,MEGAN M
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: KIDNEY -- METABOLIC -- POTASSIUM -- SODIUM
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Mineralocorticoid excess and dietary potassium (K+) depletion cause hypokalemia, metabolic alkalosis, and hypertension. These effects are thought to arise from urinary K+ and acid/proton (H+) loss and enhanced urinary sodium (Na+) retention. Hypokalemia activates H+,K+-ATPase-mediated K+ reabsorption and H+ secretion in the renal collecting duct. Studies have also shown that H+,K+-ATPases (in the colon) are required for maximal ENaC-mediated Na+ transport. Therefore, we hypothesized that H+,K+ ATPases and ENaC in the collecting duct functionally associate and cause the alkalosis and Na+-retaining effects of both mineralocorticoids and dietary K+ depletion. To test this hypothesis, we examined the stimulation of renal H+,K+-ATPase expression by the long-acting mineralocorticoid, desoxycorticosterone pivalate (DOCP). We also compared the systemic and renal response of wild type (WT), HKalpha1-/- and HKalpha1,2-/- mice to DOCP. Secondly, we compared the systemic and renal response of WT, HKalpha1-/- and HKalpha1,2-/- mice to dietary K+ depletion. Finally, we examined ENaC subunit expression, the effect of dietary Na+ depletion, and food restriction in the WT and knockout mice. We observed that DOCP stimulated renal medullary HKalpha2 expression in a K+ dependent manner. In contrast to WT and HKalpha1-/- mice, DOCP did not cause metabolic alkalosis and urinary Na+ retention in HKalpha1,2-/- mice. However, the double knockouts exhibited no significant defects in urinary K+ or Na+ retention during dietary K+ depletion. Finally, we observed that renal medullar alphaENaC subunit protein expression was less in HKalpha1,2-/- mice. The double knockouts also had a higher hematocrit during dietary Na+ depletion and displayed greater aldosterone excretion with food restriction, suggesting fluid volume loss and salt wasting. Overall, we conclude that renal H+,K+-ATPases, most likely HKalpha2-containing, are required for mineralocorticoid induced alkalosis and renal Na+ retention. The mechanism more than likely involves dysregulation of ENaC in the collecting duct. Our results are important for understanding mechanisms of renal salt transport and suggest that renal HKalpha2-containing H+,K+-ATPases may have an important role in blood pressure regulation.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by MEGAN M GREENLEE.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Wingo, Charles S.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-10-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0042727:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042727/00001

Material Information

Title: Physiological Function of Renal H+,K+-ATPases in Electrolyte and Acid-Base Homeostasis
Physical Description: 1 online resource (182 p.)
Language: english
Creator: GREENLEE,MEGAN M
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: KIDNEY -- METABOLIC -- POTASSIUM -- SODIUM
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Mineralocorticoid excess and dietary potassium (K+) depletion cause hypokalemia, metabolic alkalosis, and hypertension. These effects are thought to arise from urinary K+ and acid/proton (H+) loss and enhanced urinary sodium (Na+) retention. Hypokalemia activates H+,K+-ATPase-mediated K+ reabsorption and H+ secretion in the renal collecting duct. Studies have also shown that H+,K+-ATPases (in the colon) are required for maximal ENaC-mediated Na+ transport. Therefore, we hypothesized that H+,K+ ATPases and ENaC in the collecting duct functionally associate and cause the alkalosis and Na+-retaining effects of both mineralocorticoids and dietary K+ depletion. To test this hypothesis, we examined the stimulation of renal H+,K+-ATPase expression by the long-acting mineralocorticoid, desoxycorticosterone pivalate (DOCP). We also compared the systemic and renal response of wild type (WT), HKalpha1-/- and HKalpha1,2-/- mice to DOCP. Secondly, we compared the systemic and renal response of WT, HKalpha1-/- and HKalpha1,2-/- mice to dietary K+ depletion. Finally, we examined ENaC subunit expression, the effect of dietary Na+ depletion, and food restriction in the WT and knockout mice. We observed that DOCP stimulated renal medullary HKalpha2 expression in a K+ dependent manner. In contrast to WT and HKalpha1-/- mice, DOCP did not cause metabolic alkalosis and urinary Na+ retention in HKalpha1,2-/- mice. However, the double knockouts exhibited no significant defects in urinary K+ or Na+ retention during dietary K+ depletion. Finally, we observed that renal medullar alphaENaC subunit protein expression was less in HKalpha1,2-/- mice. The double knockouts also had a higher hematocrit during dietary Na+ depletion and displayed greater aldosterone excretion with food restriction, suggesting fluid volume loss and salt wasting. Overall, we conclude that renal H+,K+-ATPases, most likely HKalpha2-containing, are required for mineralocorticoid induced alkalosis and renal Na+ retention. The mechanism more than likely involves dysregulation of ENaC in the collecting duct. Our results are important for understanding mechanisms of renal salt transport and suggest that renal HKalpha2-containing H+,K+-ATPases may have an important role in blood pressure regulation.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by MEGAN M GREENLEE.
Thesis: Thesis (Ph.D.)--University of Florida, 2011.
Local: Adviser: Wingo, Charles S.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-10-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0042727:00001


This item has the following downloads:


Full Text

PAGE 1

1 PHYSIOLOGICAL FUNCTION OF RENAL H + ,K + ATPASES IN ELECTROLYTE AND ACID BASE HOMEOSTASIS By MEGAN M ICHELLE GREENLEE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2011

PAGE 2

2 2011 Megan M ichelle Greenlee

PAGE 3

3 ACKNOWLEDGMENTS First and foremost, I acknowledge and thank Jeremiah, my husband and best friend for he is the foundation upon which I stood during graduate school and still stand in life Secondly, I thank my parents, Michael and Deborah Greenlee, for their unfaltering love and encouragement. I most certainly could not have succeeded in my career and life goals without both of them by my side. I also thank the IDP program for providing me not only the opportunity to pursue science but also to develop strong friendships and collaborations. As for my coworkers, I first thank Jeanette Lynch for she suggested I start along the scientific path of whole animal studies, an area that has not only provided for a great dissertation but also greatly added to the field of renal and gastrointestinal phy siology I do appreciate her continuing support with laboratory techniques and long conversations about science. M ost of all I appreciate her companionship including taking coffee and lunch breaks together and discussing life issues (the good and bad ) Sh e was quite patient with me At times, she with a smile to survive my frustrations with graduate school and lab I will never forget her. Secondly, I thank Michelle Gumz. Not only did she provide great advice and mentored me in the l aboratory but she has become a really great friend of mine. I admire her passion for both science and family and her ability to see the good side of most situations. She has been my champion and, I believe, made me the scientist I am today. I hope for noth ing but the best in her new faculty position. As for my progress in graduate school, I sincerely thank my committee members, Brian Cain, Chris Baylis, and Jill Verlander. All three of them have offered such great suggestions and comments on my dissertatio n work and also, on my pursuit of a post

PAGE 4

4 doctoral fellowship It is surprising and extraordinary how much each one of them cares about my success. Above a ll, I thank Brian for teaching me how to perform experiments and to be a scientist. He is the reason w hy I ended up in graduate school and not pharmacy or medical school. I also thank him for this continued guidance and support in my graduate work. Finally, I thank my committee chair and mentor, Charles Wingo, for he provided me with vast resources to acc omplish my graduate dissertation project He also taught me a considerable amount about clinical observations that really helped me to understand and discuss my own data and that of other investigators. He allowed and encouraged my development as a scienti st by letting me design experiments, make mistakes, and then make even better experiments. Overall, I thank him for his immense support of both my work and life endeavors.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 3 TABLE OF CONTENTS ................................ ................................ ................................ .. 5 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRA CT ................................ ................................ ................................ ................... 18 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 20 Renal Physiology ................................ ................................ ................................ .... 20 Basic Struct ure of the Kidney ................................ ................................ ........... 20 Filtration ................................ ................................ ................................ ............ 21 Ion and Water (H 2 O) Transport ................................ ................................ ........ 23 Na + and H 2 O ................................ ................................ .............................. 23 K + ................................ ................................ ................................ ............... 25 Acids and bases ................................ ................................ ......................... 27 Hormonal Regulation ................................ ................................ ........................ 28 RAAS ................................ ................................ ................................ ......... 28 AVP ................................ ................................ ................................ ............ 30 ANP ................................ ................................ ................................ ........... 30 Endothelin ................................ ................................ ................................ .. 30 The Renal Collecting Duct ................................ ................................ ...................... 31 Structure and Function ................................ ................................ ..................... 31 Mechanisms and Regulation of Ion and H 2 O Transport ................................ ... 33 Na + ................................ ................................ ................................ ............. 33 H 2 O ................................ ................................ ................................ ............ 36 K + ................................ ................................ ................................ ............... 37 Acid base ................................ ................................ ................................ ... 38 The Renal H + ,K + ATPases ................................ ................................ ...................... 42 Discovery of H + ,K + ATPases ................................ ................................ ............ 42 Structure and Transport Characteristics ................................ ........................... 43 Genomic Organization ................................ ................................ ...................... 46 Tissue L ocalization ................................ ................................ ........................... 47 Physiological Function and Dietary Regulation ................................ ................ 50 Hormonal Regulation ................................ ................................ ........................ 52 Molecular Regulation ................................ ................................ ........................ 54 Physiolo gy of H + ,K + ATPase Null Mice ................................ ............................. 55

PAGE 6

6 Summary and Hypothesis ................................ ................................ ....................... 56 2 MATERIALS AND METHODS ................................ ................................ ................ 62 Anim als ................................ ................................ ................................ ................... 62 Genotyping ................................ ................................ ................................ ....... 62 Diets, Treatments, and Metabolic Studies ................................ ........................ 63 DOCP experiments ................................ ................................ .................... 64 K + depletion experiments ................................ ................................ ........... 65 Na + depletion experiments ................................ ................................ ......... 65 NH 4 Cl loading experiments ................................ ................................ ........ 65 Urinalysis ................................ ................................ ................................ ... 66 Fecal analysis ................................ ................................ ............................ 67 Cell Culture ................................ ................................ ................................ ............. 68 RNA ................................ ................................ ................................ ........................ 69 RNA Extraction ................................ ................................ ................................ 69 RT PCR ................................ ................................ ................................ ............ 71 Quantitative Real Time PCR (qPCR) ................................ ............................... 71 Protein ................................ ................................ ................................ .................... 72 Total Protein Extraction ................................ ................................ .................... 72 Membrane Protein Extraction ................................ ................................ ........... 73 Bicinchoninic acid (BCA) Assay ................................ ................................ ....... 73 Western Blot Analysis ................................ ................................ ...................... 74 Enzyme Immunoassay (EIA) ................................ ................................ ............ 75 In Silico Sequence Analyses ................................ ................................ ................... 76 Promoter Analysis ................................ ................................ ............................ 76 MicroRNA Target Analysis ................................ ................................ ............... 76 Statistical Analyses ................................ ................................ ................................ 77 3 EFFECT OF MINERALOCORTICOIDS ON RENAL H + ,K + ATPASES ................... 80 Results ................................ ................................ ................................ .................... 81 Mineralocorticoid Excess in WT Mice ................................ ............................... 81 Induction of Renal HK 2 Expression ................................ ................................ 82 Aldosterone Treatment in OMCD1 Cells ................................ .......................... 84 Mineralocorticoid Excess in HK Null Mice ................................ ...................... 84 Discussion ................................ ................................ ................................ .............. 87 4 ................................ .. 104 Results ................................ ................................ ................................ .................. 105 Dietary K + Depletion in HK Null Mice ................................ ............................ 105 Expression of Renal Acid Base Transporters in HK Null Mice ..................... 108 Dietary K + Depletion and Mineralocorticoid Excess in HK Null Mice ............ 109 Discussion ................................ ................................ ................................ ............ 110 5 MECHANISMS OF H + ,K + ATPASE MEDIATED NA + TRANSPORT ..................... 124

PAGE 7

7 Results ................................ ................................ ................................ .................. 126 ENaC Subunit Express ion in HK Null Mice ................................ .................. 126 Dietary Na + Depletion in HK Null Mice ................................ ......................... 126 Food Intake and Urinary Aldosterone Levels in HK mice ....................... 127 Discussion ................................ ................................ ................................ ............ 128 6 CONCLUSIONS AND FUTURE DIRECTIONS ................................ .................... 137 H + ,K + ATPase mediated Na + Retention ................................ ................................ 137 Potential Mechanism(s) of H + ,K + ATPase mediated Na + Transport ............... 137 Blood Pressure Phenotypes in HK Null Mice ................................ ............... 140 H + ,K + ATPase mediated K + Retention and Recycling ................................ ........... 142 Role of H + ,K + ATPases in Mineralocorticoid and Dietary K + dependent Control of K + Homeostasis ................................ ................................ .......... 142 K + Recycling by H + ,K + ATPases ................................ ................................ ..... 143 Role of H + ,K + ATPases in Sex Hormone Control of K + Homeostasis ............. 144 H + ,K + ATPase mediated H + Secreti on ................................ ................................ .. 145 Effects of Mineralocorticoids and Dietary K + Depletion on Acid Base Balance ................................ ................................ ................................ ....... 146 Gastrointestinal Effects on Urinary Acid Excretion ................................ ......... 147 Dietary Acid Dependent Regulation of Renal H + ,K + ATPases ........................ 148 MicroRNA Regulation of H + ,K + ATPases ................................ .............................. 14 9 Interaction between Vasopressin and Renal H + ,K + ATPases ............................... 149 Function of H + ,K + ATPases in Other Organ Systems ................................ ........... 151 Role of Gastric H + ,K + ATPases in Obesity and K + Reabsorption ................... 151 Role of H + ,K + ATPases in Bone Resorption and Ca 2+ Homeostasis .............. 153 Final Conclusions ................................ ................................ ................................ 154 LIST OF RE FERENCES ................................ ................................ ............................. 161 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 182

PAGE 8

8 LIST OF TABLES Table page 2 1 Primer sequences ................................ ................................ ............................... 78 2 2 Antibodies ................................ ................................ ................................ ........... 78 3 1 Body weight change in control and DOCP treated WT mice .............................. 91 3 2 Blood analysis of DOCP treatment in WT mice ................................ .................. 91 3 3 Physiological response to high K + (5%) diet and DOCP in WT mice .................. 91 3 4 ................................ ... 91 4 1 Blood chemistries for WT and 1 / mice on a K + depleted diet .................... 115 4 2 Quantitative analysis of renal acid base transporter mRNA expression profile 1,2 / mice fed a normal diet ................................ ....................... 115

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Model of collecting duct PC ................................ ................................ ................ 58 1 2 Model of collecting duct A type IC ................................ ................................ ...... 59 1 3 Model of collecting duct B type IC ................................ ................................ ...... 60 1 4 Model of collecting duct non A non B type IC ................................ ................... 61 2 1 Representative genotyping PCR gel ................................ ................................ ... 79 3 1 1 2 differs in mouse kidney .............. 92 3 2 expression in mice ................. 93 3 3 DOCP induced medullary HK 2 expression in a K + dependent manner ............. 94 3 4 The effect of DOCP to alter HK subunit mRNA expression is time dependent ................................ ................................ ................................ .......... 95 3 5 Chronic aldosterone treatment did not affect HK subunit expression in OMCD1 cells ................................ ................................ ................................ ...... 96 3 6 WT, HK 1 / and HK 1,2 / mice had similar body weight gain over eight days on a normal diet ................................ ................................ ................................ .. 97 3 7 Body weight and blood chemistries differ in DOCP 1 / and HK 1,2 / mice ................................ ................................ ................................ ....... 98 3 8 DOCP treatment differentially altered urinary Na + and K + retention in WT and mice ................................ ................................ ................................ ..... 99 3 9 Control and DOCP electrolyte excretion ................................ ................................ .......................... 101 3 10 treatment ................................ ................................ ................................ .......... 102 3 11 Putative HRE half sites are present in Atp4a and Atp12a promoters. .............. 103 4 1 1,2 / mice lost substantial body weight with dietary K + depletion ................ 116 4 2 Dietary K + depletion caused excessive fecal (not urinary) K + excretion in HK 1,2 / mice ................................ ................................ ................................ .... 117 4 3 Dietary K + depletion caused urinary Na + retention in WT and HK 1,2 / mice .... 118

PAGE 10

10 4 4 HK 1,2 / mice do not lose urinary K + or Na + at an earlier time point on a K + depleted diet ................................ ................................ ................................ ..... 119 4 5 Urinary acid excretion is abnormal in HK 1,2 / mice ................................ .......... 120 4 6 1 / mice exhibit more acidic urine than WT mice ................................ ........ 121 4 8 Dietary K + depletion with DOCP treatment caused body weight loss and renal hypertrophy in HK 1,2 / mice ................................ ................................ ............. 122 4 9 Combined dietary K + depletion and DOCP treatment caused metabolic alkalosis and hypernatremia in HK 1,2 / mice ................................ ................... 123 5 1 ENaC subunit mRNA expression is similar in WT and HK 1,2 / mice ............... 131 5 2 Medullary ENaC protein expression is reduced in HK 1,2 / mice .................... 132 5 3 Dietary Na + depletion increased blood hematocrit in HK 1,2 / mice .................. 133 5 4 HK 1,2 / mice display altered appetite, H 2 O intake, and urine volume on a normal diet ................................ ................................ ................................ ........ 134 5 5 HK 1,2 / mice lost considerable body weight when pair fed .............................. 135 5 6 Food restriction (pair feeding) caused HK 1,2 / mice to exhibit augmented urinary aldosterone excretion ................................ ................................ ........... 136 6 1 Proposed model of coupled ENaC mediated Na + reabsorption and H + ,K + ATPase mediated K + recycling in the collecting duct .............................. 155 6 2 An acid loaded diet did not further acidify urine from HK 1 / mice ................... 156 6 3 Mmu miR Atp12a (HK 2 ) gene ................................ ................................ ......................... 156 6 4 HK 1 / mice exhibit more concentrated urine and enhanced vasopressin excretion ................................ ................................ ................................ ........... 157 6 5 HK 1 / gain significantly more weight than WT over eight weeks ..................... 158 6 6 HK 1,2 / mice exhibited more severe gastric hypertrophy than HK 1 / mice ..... 159 6 7 HK 1,2 / mice excrete less urinary Ca 2+ than WT mice ................................ ..... 160

PAGE 11

11 LIST OF ABBREVIATION S Eq microequivalent(s) g microgram(s) L microliter(s) M micromolar m micrometer ADP adenosine diphosphate AE 1 2 anion exchanger 1 and 2 Aldo aldosterone Ang II angiotensin II ANOVA analysis of variance ANP atrial natriuetic peptide ATP adenosine triphosphate ATPase adenosine triphosphatase AQP1 4 aquaporin 1, 2, 3 and 4 AVP arginine vasopressin B binding of sample B o maximum binding BCA bicinchoninic acid BK big conductance potassium channel BLAST basic local alignment search tool bp basepair(s) C Celsius Ca 2+ calcium

PAGE 12

12 Ca 2+ ATPase calcium translocating adenosine triphosphatase CAII, CAIV carbonic anhydrase 2 and 4 cAMP cyclic adenosine monophosphate cDNA complementary deoxyribonucleic acid Cl chloride CO 2 carbon dioxide CpG cytosine phosphate guanidine Ct cycle threshold CTX cortex DNA deoxyribonucleic acid DNase deoxyribonuclease dNTPs deoxynucleotide triphosphates DOCP desoxycorticosterone pivalate EDTA ethylenediaminetetraacetic acid EIA enzyme immunoassay ENaC epithelial sodium channel ET 1 endothelin 1 ETAR endothelin a receptor ETBR endothelin b receptor Eq equivalent(s) g gram(s), gravitational force GAPD glyceraldehye 3 phosphatase dehydrogenase GFR glomerular filtrat ion rate

PAGE 13

13 H + hydrogen; proton; acid H + ATPase proton translocating adenosine triphosphatase H + ,K + ATPase proton and potassium translocating adenosine triphosphatase H 2 O water HCl hydrochloric acid HCO 3 bicarbonate Hct hematocrit H + ,K + ATPase subunit 1 H + ,K + ATPase 1 subunit 2 H + ,K + ATPase 2 subunit 1 / 1 null 1,2 / 1 2 null 2 / 2 null HK H + ,K + ATPase subunit HK / HK HRE hormone response element HRP horseradish peroxidase IC intercalated cell i.m. intramuscular IM inner medulla IMCD3 inner medullary collecting duct 3 cell line i.p. intraperitoneal K + potassium

PAGE 14

14 KCC potassium and chloride cotransporter KCl potassium chloride kDa kiloDalton(s) kg kilogram KHP potassium hydrogen phthalate L liter(s) l n natural log MAPK mitogen activated protein kinase Med medulla mEq miliequivalent(s) mg miligram(s) miRNA microribonucleic acid (microRNA, miR) mL mililiter(s) mM milimolar mmHg millimeters of mercury mOsm miliosmoles MR mineralocorticoid receptor mRNA messenger ribonucleic acid N number Na + sodium Na + ,K + ATPase sodium and potassium translocating adenosine triphosphatase NaCl sodium chloride NaK 1 Na + ,K + ATPase 1 s ubunit

PAGE 15

15 NaK 1 Na + ,K + ATPase 1 subunit NaOH sodium hydroxide NBC e1 electrogenic sodium bicarbonate cotransporter 1 NCBI National Center of Biotechnology Information NCC sodium and chloride cotransporter NDCBE sodium dependent (or driven) chloride and bicarbonate exchanger NF B nuclear factor light chain kappa of activated B cells NH 3 ammonia NH 4 + ammonium NH 4 Cl ammonium chloride NHE 1 sodium and hydrogen exchanger 1 NHE3 sodium and hydrogen exchanger 3 NKCC2 sodium, potassium, two chl oride cotransporter 2 NSB non specific binding NT no template nM nanomolar OM outer medulla OMCD 1 outer medullary collecting duct 1 cell line P probability of null hypothesis PBS phosphate buffered saline PC principal cell pCO 2 partial pressure of carbon dioxide PCR polymerase chain reaction

PAGE 16

16 PKA protein kinase A PKC protein kinase C P type phosphorylated type qPCR quantitative polymerase chain reaction R1 reaction 1 R2 reaction 2 RAAS renin angiotensin aldosterone system Rhbg Rhesus associated blood group factor b Rhcg Rhesus associated blood group factor c RNA ribonucleic acid RNase ribonuclease ROMK renal outer medullary potassium channel rpm revolutions per minute RT reverse transcriptase SCH 28080 Schering 28080 SDS sodium dodecyl sulfate SEM standard error of the mean Sp1 specificity protein 1 TBS tris buffered saline TBS S tris buffered saline with 0.05% Saddle Soap TESS Transcription Element Search Software TD Teklad TF transcription fac tor

PAGE 17

17 UTR untranslated region V1R vasopressin receptor 1 V1aR vasopressin receptor 1a V2R vasopressin receptor 2 V type vacuolar type WNK1 with no lysine kinase 1 WT wild type

PAGE 18

18 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy PHYSIOLOGICAL FUNCTION OF RENAL H + ,K + ATPASES IN ELECTROLYTE AND ACID BASE HOMEOSTASIS By Megan M ichelle Greenlee May 2011 Chair: Charles S. Wingo Major: Medical Science Physiology and Pharmacology Mineralocorticoid excess and dietary potassium ( K + ) depletion cause hypokalemia, metabolic alkalosis, and hypertension. These effects are thought to arise from urinary K + and aci d / proton ( H + ) loss and enhanced urinary sodium ( Na + ) retention. Hypokalemia a ctivate s H + ,K + ATPase mediated K + reabsorption and H + secretion in the renal collecting duct. Studies have also shown that H + ,K + ATPases (in the colon) are required for maximal ENaC mediated Na + transport Therefore, we hypothesized that H + ,K + ATPases and ENaC in the collecting duct functionally associate and cause the alkalosis and Na + retaining effects of both mineralocorticoids and dietary K + depletion To test this hypothesis we e xamined the stimulation of renal H + ,K + ATPase expression by the long acting mineralocorticoid desoxycorticosterone pivalate ( DOCP ). W e also compared the systemic and renal response of wild type ( WT ) HK 1 / and HK 1,2 / mice to DOCP Secondly, we compared the systemic and renal response of WT, HK 1 / and HK 1,2 / mice to dietary K + depletion Finally, we examined ENaC s ubunit expression the effect of dietary Na + depletion and food restriction in the WT and knockout mice. We observed that DOCP s timulate d renal medullary HK 2 expression in a K + dependent manner. In contrast to WT and HK 1 / mice, DOCP did not cause metabolic alkalosis

PAGE 19

19 and urinary Na + retention in HK 1,2 / mice However, the double knockouts exhibited no significant defects in urinary K + or Na + retention during dietary K + depletion Finally, w e observed that renal medullar ENaC subunit protein expression was less in HK 1,2 / mice T he double knockouts also had a higher hematocrit during dietary Na + depletion and displayed grea ter aldosterone excretion with food restrict ion, suggesting fluid volume loss and salt wasting. Overall, we conclude that renal H + ,K + ATPases most likely HK 2 containing, are required for mineralocorticoid induced alkalosis and renal Na + retention The mechanism more than likely involves dysregulation of ENaC in the collecting duct Our results are important for understanding mechanisms of renal salt transport and suggest th at renal HK 2 containing H + ,K + ATPases may have an important role in blood pr essure regulation.

PAGE 20

20 CHAPTER 1 INTRODUCTION Renal Physiology Organs of the urinary (or excretory) system include the kidneys, ureters, and urinary bladder. 1 T hese organs produce and eliminate urine in order to excrete excess metabolic products, toxins, electrolytes, fluid and more from the body. In contrast to the ureters and bladder which are responsible for urine elimination, t he kidneys are responsible for urine production, filtration of blood regulation of electrolyte acid base and fluid balance, and adjust ment of blood pressure The kidneys also generate and are influenced by hormones tha t control many of these functions. Basic Structure of the Kidney The kidneys are bilateral, bean shaped organs located in the retroperitoneal space. 1 A capsule covers and visceral fat surrounds each k idney. The hilus, a slit in the capsule, serves as the entry and exit site for the renal artery, vein, nerves and the ureter. The functional unit of the kidney is termed the nephron, which consists of the renal corpuscle followed by several tubular structu res in this order: the proximal convoluted tubule, proximal straight tubule, thin descending and thin ascending limbs of nephrons converge into the collecting duct sy stem, which consists of the connecting segment, initial collecting tubule, followed by the cortical, outer medullary and inner medullary collecting ducts. The renal corpuscle is the filtering unit whereas the nephron and collecting duct systems facilitate ion and fluid reabsorption and secretion to produce urine.

PAGE 21

21 K idney s have three distinct divisions called the cortex (the outer portion) outer medulla (the middle portion) and inner medulla (the inner portion) classified by the presence or absence of parti cular tubular structures 1 The cortex contains the renal corpuscles and most of the tubular segments except for the thin descending and lecting ducts. The cortex also contains several structures that compose the juxtaglomerular apparatus including the extraglomerular mesangial cells, macula densa cells adjacent to the thick ascending limb granular cells in the afferent arteriole and both the afferent and efferent arterioles All of these structures parti cipate in renal autoregulation and a tubuloglomerular feedback system to stabilize renal blood flow and glomerular filtration. The outer medulla contains proximal straight tubules, thin de scending limbs, medullary thick ascending limbs, and outer medullary collecting ducts. The outer medulla is further divided into the outer and inner stripe based on the confinement of proximal straight tubules only in the outer stripe. The inner medulla co ntains only thin descending and ascending limbs and inner medullary collecting ducts. Filtration Arterial blood reaches the renal corpuscle through a series of arteries that begin with the renal artery followed by the segmental, interlobar, arcuate, and interlobular arteries. 1 The interlobular arteries also called the cortical radial arteries, split into individual afferent arterioles which provide systemic blood to individual renal corpuscle s. The renal corpuscles consist of the glomerulus and space which function together to filter incoming blood 2 The differences in glomerular capillary and interstitial hyd rostatic and oncotic pressures determine the net force of glomerular filtration The glomerular capillary hydrostatic pressure and oncotic pressure

PAGE 22

22 in Bow he glomerular capillary oncotic pressure and hydrostatic press through the glomerular filtration barrier which includes the glycocalyx covered endothelial cells, epithelial podocytes, and the glomerular basement membrane. This filtration barrier prevents filtrat ion of most plasma protein s and other large macromolecules This restriction of plasma protein filtration i ncrease s glomerular capillary oncotic pressure and reduces filtration by the end of the glomerular capillaries The filtered blood next enters the efferent arteriole where the arteriolar resistance decreases intravascular hydrostatic pressure. Th is generation of low intravascular hydrostatic pressure creates favorable conditions for fluid and solute reabsorption by the peritubular capillaries and vas a recta that provide nutrients to surround ing tubules The interlobular, arcuate, interlobar and segmental veins return the filtered blood to the renal vein for recirculation. The glomerular filtration rate (GFR) is regulated by afferent and efferent art eriolar resistances and is ~ 125 mL/min in normal adult humans 2 and 360 to 1 700 L /min/g kidney weight in the mouse 3 Constriction of the afferent arteriole decreases GFR whereas efferent arteriolar constriction increases GFR. 2 GFR autoregulation which occurs in the afferent arteriole, sustains renal blood flow an d GFR over a very small range C onstrict ion or relax ation of the afferent arteriole occurs in response to altered systemic blood pressure or renal perfusion pressure and change glomerular capillary hydrostatic pressure to affect glomerular filtration. I nhe rent myogenic, Ca 2+ dependent response s of the arteriolar smooth muscle cells and a tubuloglomerular feedback system are responsible for vasoconstriction or vasodilation of the afferent arteriole In

PAGE 23

23 th e feedback system, macula densa cells detect changes i n salt and fluid composition in the thick ascending limb tubular fluid I n response, the cells secrete paracrine molecules that stimulate afferent arteriole contraction or relaxation Several other factors adjust renal blood flow and GFR including sympathetic nerve activity, the renin angiotensin aldosterone system (RAAS), arginine vasopressin (AVP), and atrial natriuetic peptide (ANP) 2 Renal sympathetic nerve activity increases in response to stressful situations including decreased plasma volume. The stimulated renal sympathetic nerves release norepinephrine which increases afferent and efferent arteriole resistance s decreasing GFR. RAAS, ANP, and AVP action will be discussed latter in thi s chapter. Ion and Water (H 2 O) Transport The renal tubules are primarily responsible for reabsorption of the filtered load including ions and H 2 O 1 However, t he tubu les also participate in ion secretion The tubular fluid remaining at the end of the collecting duct is essentially the final urine composition because the ureters and bladder modify the filtrate very little This section discusses the known mechanisms for sodium (Na + ) H 2 O potassiu m (K + ) and acid base transport within the nephron and collecting duct. Na + and H 2 O Na + is the most abundant cation in extracellular fluid with a concentration ranging from 142 145 mM in humans 4 Th e total body content of Na + determines extracellular fluid volume. Changes in extracellular fluid volume will affect circulati ng blood volume and, in turn, blood pressure. The kidney is the major organ that regulates total body Na + content. 5 The proximal tubule isosmotically reabsorbs ~ 67 % of filtered Na + through paracellular transport and

PAGE 24

24 both passive and active intracellular transport The Na + and hydrogen (H + ) exchanger named NHE3 a nd other Na + coupled cotransporters are responsible for passive intracellular Na + uptake at the apical plasma membrane The Na + ,K + adenosine triphosphatase ( ATPase ) and electrogenic Na + and bicarbonate (HCO 3 ) cotransporter (NBC e1 ) on the basolateral plasma membrane facilitate Na + exit into the interstit i um. Na + transport in the thin limbs is primarily passive and presumed to be t hrough paracellular mechanisms. In the thick ascending limb, an Na + ,K + ,2Cl cotransporter named NKCC2 and NHE3 on the apical plasma membrane mediate passive luminal Na + uptake with extrusion into the interstitium through a basolateral Na + ,K + ATPase. Paracellular transport of Na + also occurs within this segment. Overall, the loop of Henle reabsorbs approximate ly 25% of the filtered Na + load. Within the distal convoluted tubule, the apical Na + and Cl cotransporter (NCC) and basolateral Na + ,K + ATPase facilitate Na + reabsorption. The connecting segment, initial collecting tubule and cortical collecting ducts pos sess an apical epithelial Na + channel (ENaC) that facilitate s electrogenic Na + reabsorption with a basolateral Na + ,K + ATPase The distal co nvoluted tubule connecting segment, initial collecting tubule, and cortical collecting ducts absorb ~ 5% of the filtered Na + load. The final segments involved in Na + transport are the medullary collecting ducts where it appears ENaC and Na + ,K + ATPase reabsorb the remaining Na + (~3%) left in the filtered load. The amount of Na + left in the urine filtrate l argely depends on the dietary Na + load. In contrast to Na + transport cellular H 2 O transport always occurs passively through channels called aquaporins 4, 5 Di ssociatio n of Na + and H 2 O reabsorption in the thick ascending limb is used to create an osmotic gradient in the kidney 5 The

PAGE 25

25 osmolality of interstitial fluid increases from the cortex to the medulla and this is necessary for concentration of the urine filtrate. Urine concentration and dilution are regulated by the hormonal actions of vasopressin in the collecting duct. The proximal tubule has a large capacity for isosmotic Na + and H 2 O reabsorption A quaporin 1 (AQP1), constitutively present on both the apical and basolateral plasma membrane of proximal tubule cells is responsible for H 2 O transport in this segment. The thick ascending limb and distal convoluted tubule are relatively impermeable to H 2 O leading to H 2 O free Na + reabsorption in these segments The accumulated interstitial Na + is greatest in the medulla and progressively decreases by the end of the distal convoluted tubule Th e H 2 O free Na + reabsorption generates an osmotic gradient that is highest in the inner medulla and causes the distal tubular luminal fluid to be hyposmotic. The connecting segment, initial collecting tubule and collecting duct receive the hyposmotic filtrate and in the presence of AVP these segments reabsorb the majority of the remaining H 2 O in the filtrate AVP increases H 2 O reabsorption through the apical plasma membrane AQP2 channel. AVP release from the posterior pituitary inversely correlates with H 2 O intake such that H 2 O re striction increases and H 2 O loading decreases circulating AVP levels. These conditions produce a maximally concentrated urine or diluted urine, respectively. K + U nlik e Na + K + is the most abundant intracellular cation with a concentration of ~120 mM. 4 In contrast, e xtracellular fluid has a [K + ] of 3.5 to 5.0 mM The Na + ,K + ATPase generates this plasma membrane [K + ] gradient and thereby maintains cellular membrane potential The membrane potential is especially important for the development of an action potential in excitable cell s such as those found in the heart,

PAGE 26

26 muscle, and brain. The body regulates K + homeostasis through modulation of excretion and extracellular to intrace llular redistribution. 7, 8 The kidneys are the organ s with the major responsibility to maint ain K + balance. 7, 8 The proximal tubule reabsorbs ~ 80% of filtered K + through solvent drag and electrodiffusion In the thin descending limb, K + secretion occurs passively and paracellularly because of a high medullary [ K + ] gradient H igh medullary [K + ] is maintained by paracellular K + reabsorption in the thin and thick ascending limbs Paracellular K + reabsorption in thin ascending limb is driven by the high tubular [K + ] and decreasing interstitial [ K + ] gradient upon approach to the cortex. In the thick ascending limb, about half of K + reabsorption occurs through passive diffusion driven by a lumen positive voltage. The thick ascending limb also reabsorbs K + through NKCC2 on the apical plasma membrane and K + channels on the basolateral membrane A K + channel called ROMK (renal outer medullary K + ) is also present in the apical membrane to provi de for K + recycling within the thick ascending limb. Overall, the loop of Henle reabsorbs ~10% of the filtered K + Cells of t he connecting segment, initial collecting tubule and cortical and outer medullary collecting duct s secrete K + i nto the tubule lume n primarily through two apical K + channels, ROMK and BK (big conductance K + ) 6 and possibly through a K + and Cl cotransporter (KCC) 7, 8 Electrogenic Na + reabsorption through ENaC and the Na + ,K + ATPase generates a net negative luminal charge that drives K + secretion through ROMK and possibly other apical K + channels 7 In contrast, BK channels primarily respond to luminal flow rate. 9, 10 K + reabsorption occurs within intercalated cells (ICs) of the collecting duct system t hrough co upling of apical H + ,K + ATPases and

PAGE 27

27 basolateral K + channels. 11 H + ,K + ATPases also m ediate K + recycling in cooperation with ap ical K + channel s 12 The renal H + ,K + ATPases will be described in more detail in a later section. Dietary K + intake regulates urinary K + excretion through modulation of K + transport in the collecting tubules. 6, 13 A high K + diet favors K + secretion so that the kidney excretes 10 to 150 % of the filtered K + load. A low K + diet favors K + reabsorption so that the kidney excretes only 2 to 3% of the filtered load Acids and b ases The kidneys are important regulators of acid base balance and ensure that the body maintains blood pH aroun d 7.4. 14 In humans, a t ypical diet and normal metabolism create an acid load of ~70mmols acid or protons ( H + ) per day. The kidney responds to this acid load by increased urinary acid excretion and renal reabsorpt ion of all the filtered bicarbonate ( HCO 3 ). The proximal tubule reabsorbs ~ 80% of filtered HCO 3 14 In early parts of this segment, both the apical NHE3 and proton translocating ( H + ) ATPase secrete H + that titrate luminal HCO 3 Extracellular c arbonic anhydrase 4 (CAIV) catalyzes the conversion of H + and HCO 3 to H 2 O and carbon dioxide ( CO 2 ). CO 2 then diffuses across the cell membrane and intracellular carbonic anhydrase 2 ( CAII ) present in all tub ule cells, converts it back to H + and HCO 3 The apical NHE3 recycles the H + for further HCO 3 reclamation and a b asolateral NBCe1 transports the intracellular HCO 3 into the interstitium. In the late proximal tubule, NHE3 and H + ATPase secrete net H + The proximal tubule also produces new HCO 3 14, 15 Glutaminase in the proximal tubule converts glutamine to ammonium (NH 4 + ) and ketoglutarate. G luconeogenesis indirectly generates HCO 3 from ketogluturate in a 1:1 ratio with the N H 4 + Apical

PAGE 28

28 NHE3 and H + ATPase s secrete the new ly formed NH 4 + into the tubule lumen and basolateral NBCe1 transports the new ly formed HCO 3 into the interstitium. In the thick ascending limb, apical NHE3 and H + ATPas e s participate in net H + secretion and the basolateral Cl and HCO 3 exchanger, anion exchanger 2 ( AE2 ) reabsorbs the remaining intracellular HCO 3 The collecting duct is necessary for maximal urinary acidifi cation. 16 N et H + HCO 3 and ammonia ( NH 3 ) secretion are important in urinary acidification by the collecting duct. These transport processes depend upon the plasma membrane localization of H + HCO 3 and NH 3 secreting transporters. A pical H + ATPases or H + ,K + ATPases and basolateral Cl HCO 3 exchangers mediate net H + secretion in some cells whereas apical Cl HCO 3 exchangers and ba solateral H + ATPase mediate net HCO 3 secretion in other cells of the collecting duct. The mechanism of acid base transport in the collecting duct will be described in more detail in a later section. Hormonal Regulation Glomerular filtrat ion and renal ion and H 2 O transport are highly regulated processes Hormones are central to regulation of these processes and act in an endocrine, paracrine, and autocrine fashion to modulate renal filtration and transport. Several of these hormones and th eir actions in the kidney are described below. RA A S T he RA A S system functions to modulate renal blood flow glomerular filtration and renal Na + transport 2, 5 Low intravascular volume ac tivates central and renal baroreceptors which increase renal sympathetic nerve activity leading to renin secretion by granular cells of the afferent arteriole 17 L ess sodium chloride ( NaCl ) delivery to the macula densa cells also increases granular cell renin release. The released renin

PAGE 29

29 enzymatically converts circulating ang iotensinogen into angiotensin I A ngiotensin converting enzyme then cleaves plasma angiotensin I into the biologically active peptide, angiotensin II (Ang II). Ang II stimulates adrenal aldosterone and pituitary AVP release, vasoconstriction, and increase d proximal tubule NHE3 mediated Na + reabsorption. The adrenal glomerulosa cells produce the mineralocorticoid, a ldostero ne in response to Ang II or low circulating [K + ]. 18, 19 Aldo sterone acts on the distal convoluted tubule and collecting duct to facilitate Na + reabsorption through NCC 20 and ENaC. 21 It has also been shown to activate NHE3 mediated Na + reabsorption. 22 24 Combined, RAAS modulate s filtration and correct s circulating volume to maintain blood pressure and tissue perfusion. In addition t o increasing blood pressure, aldosterone excess results in hypokalemic metabolic alkalosis. 25 2 7 Aldosterone and other mineralocorticoids ha ve pronounced effects on K + homeostasis. Mineralocorticoids activate K + secretion in the cortical collecting duct 28, 29 and proximal colon 30 The hormones also modulate transcellular K + redistribution 31 Mine ralocorticoid induced K + secretion is only observed with chronic mineralocorticoid exposure not acute. 32 Mineralocorticoids also have not consistently been shown to increase urinary K + excretion. 28, 33 The effect of mineralocorticoids to promote K + secretion is thought to be secondary to electrogenic Na + reabsorption. Consistent with this concept, urinary K + excretion in animals on a normal diet is primarily amiloride sensitive (ENaC inhibitor) and Na + dependent. 34 However, with high K + intake and thus greater plasma aldosterone levels, the proportion of amiloride insensitive and Na + independent K +

PAGE 30

30 excretion increases. The evidence suggests that dietary K + intake has a greater impact on renal K + transport than aldosterone alone. The effect of aldosterone to cause metabolic alkalosis is thought to result from enhanced urinary acid excretion. A ldosterone stimulates ammoniagenesis in the proximal tu bule 35 The hormone also increas es acidification by the distal nephron and collecting duct. 36, 37 Several studies have shown aldosterone mediated stimulation of NHE3 and H + ATPase mediated H + secretion in these segments. 38 41 AVP The posterior pituitary releases AVP, also known as antidiuretic hormone, in response to increased plasma osmo lality or low intravascular volume. 17, 42, 43 In the collecting duct, AVP stimulates H 2 O reabsorption through AQP2 44 and can also increase ENaC mediated Na + reabsorption. 45 Thus, AVP corrects high plasma osmolality and low extracellular fluid volume 17 These actions also maintain or correct blood pressure. ANP Atrial myocytes synthesize and release ANP in response to increase d stretch or filling pressure within the atrium. 17 Thus, greater circulating fluid volume and blood pressure will stimula te ANP release. ANP acts in the kidney to promote Na + excretion by increasing GFR and renal blood flow, decreasing renin and AVP, and inhibiting ENaC mediated Na + reabsorption in the collecting duct. These actions stimulate natriuresis and diuresis to elim inate the extra circulating volume. Endothelin Endothelin 1 (ET 1) is a peptide hormone produced primarily in the renal medulla. 46 ET 1 action is unique because the hormone promotes systemic

PAGE 31

31 vasoconstriction 47 and natriuresis. 46 These two actions occur because of the differential localization and function of two endothelin receptors, A (ETAR) and B (ETBR). ETAR s are expressed in vascular sm ooth muscle cells and, upon binding ET 1, cause vasoconstriction. 48 E T 1 through ETBRs reduce s medullary Na + reabsorpt ion causing natriuresis 49, 50 Several studies now show that ET 1 enhances acidification by the proximal tubule and collecting duct 51, 52 ET 1 appears to be important in urinary acidification during acid challenges such as high protein intake Dietary acid loading increases ET 1 mRNA and protein expression in the kidney. 53, 54 The dietary acid induced ET 1 activates proximal tubule NHE3 54, 55 and collecting duct H + ATPase mediated H + secretion. 56 T he Renal Collecting Duct Fine regulation of the final urine content occurs in the collecting duct. 1 The collecting duct is a highly heterogeneous structure with many different cell types that perform distinct functions. Hormones such as those described above regulate transport within the collecting duct. Many renal diseases re sult from dysregulation of collecting duct transport. Structure and Function Cells within the c ollecting duct system are quite heterogeneous. In th e cortical and outer medullary collecting duct and initial portion of the inner medullary collecting duct t he majority cell type is called the principal cell (PC) and the minority cell type an intercalated cell ( IC ) The cells in the terminal portion of the inner medullary collecting d uct (IMCD) are called inner medullary collecting duct cells. The PCs, ICs a nd IMCD cells possess distinct ultrastructural and functional characteristics. The collecting duct ultrastructure has been most extensively examined in the rat and rabbit.

PAGE 32

32 PCs of the cortical, outer medullary, initial portion of the inner medullary collec ting ducts are structurally quite similar and possess a mostly flat apical plasma membrane and many infoldings on the basolateral plasma membrane but there are slight structural differences between the PCs of these segments 57 IMCD cells are very different than PCs in that the apical projections increas e in number, the cell height increases, and the basolateral plasma membrane infoldings decrease. PCs and IMCD cells are also distinguished by the expression and location of ENaC and AQP2 in the apical plasma membrane. Functionally, the PCs and IMCD cells p rimarily participate in Na + and H 2 O reabsorption PCs in the cortical and outer medullar collecting duct also participate in K + secretion. Figure 1 1 depicts the known transporters present in cortical collecting duct PCs. IC s in the cortical, outer medull ary, and inner medullary collecting ducts have greater mitochondrial density than PCs and possess numerous tubulovesicles microplicae, and microvilli at the apical plasma membrane 57 T here are three types of ICs that have been described in the mouse cortical collecting duct using immunohistochemistry an d electron microscopy : the A type, B type, and non A non B type. 16 The A type and non A non B type ICs possess many apical plasma membrane microprojections and apically localized cytoplasmic tubulovesicles. 57 The A type ICs also display subapical and apical plasma membrane H + ATPase localization. 16 In contrast to the A type ICs, the non A non B cells do not express basolateral AE1, but have an subapical and apical plasma membrane localization of the Cl and HCO 3 exch anger named pendrin. A type ICs are present in the cortical, outer and initial portion of the inner medullary collecting duct. The non A non B type ICs do

PAGE 33

33 not extend f a rther than the cortical collecting duct. In contrast, B type ICs have a flatter api cal membrane with fewer apical plasma membrane microprojections. 57 H + ATPas e localizes to the subbasolateral vesicles and basolateral plasma membrane and pendrin to the subapical vesicles and apical plasma membrane 16 B type ICs only appear in the cortical collecting duct and exhibit decrease d abundance a t distal portions of the cortical collecting duct with eventual disappearance by the o uter medullary collecting duct The A type IC is believed to participate in H + secretion, the B type HCO 3 secretion, and the non A non B type may participate in both local H + and HCO 3 secretion based on acid base transporter localization Figures 1 2, 1 3, and 1 4 depict transporters present in A B and non A non B type ICs respectively Mechanisms and Regulation of Ion and H 2 O Transport Dietary and hormonal influence o f ion and H 2 O transport in the collecting duct is quite im portant for maintenance of Na + H 2 O, K + and acid base homeostasis. Dysfunction and dysregulation of these transporters have many pathophysiological consequences, especially regarding blood pressure. Na + PC s are the primary cell types thought to be in volved in Na + transport in the collecting duct. 5 ENaC is present in the apical plasma membrane of these cells and in a concerted action with the basolateral Na + ,K + ATPase electrogenically reabsorbs Na + from t he luminal filtrate. ENaC is heteromultimeric and composed of an subunit. 21, 58 While t constitutively present at the apical plasma membrane traffic to the apical plasma membrane in response to certain stimuli including the mineralocorticoid, aldosterone The latter two subunits

PAGE 34

34 primarily regulate assembly and plasma membrane trafficking of functional ENaC channel s Under normal conditions, ENaC mediated Na + reabsorption in the collecting duct is low and sometimes undetectable 59 A ldosterone greatly stimulates P C mRNA and protein expression of ENaC Na + ,K + ATPase 1 subunit (NaK 1 ) and serum and glucocorticoid regulated kinase 1 (SGK 1) 60 63 To increase transcription of these genes, aldosterone binds the mineralocorticoid receptor (MR) causing the complex to translocate to the nucle u s 21, 26 In the nucleus, the aldosterone MR complex b inds to alter ing transcription. 64 Aldosterone also causes decreased retrieval of ENaC channels from the apical plasma membrane through SGK 1 mediated shutdown of retrieval/ degradation mechanisms 21, 58 Aldosterone rapidly stimulates activity of ENaC channels already in the apical plasma membrane through a phosphoinositide dependent mechanism. 65 A low Na + diet which produces secondary hyperaldosteronism, also increases ENaC subunit expression and apical plasma me mbrane abundance and stimulates Na + reabsorpti on through ENaC 59 The importance of ENaC to urinary Na + retention is highlighted by two different genetic diseases, pseudohypoaldosteronism type 1 58 In pseudohypoaldosteronism type 1 patients exhibit symptoms of low plasma aldosterone which include low blood pressure and urinary salt wasting I n reality the patien ts display hyperaldosteronism. The salt wasting phenotype results from genetic mutations in MR or ENaC subunits, which decrease channel activity and Na + reabsorption T he converse

PAGE 35

35 activate ENaC mediated Na + reabsorption. The excessive Na + retention leads to hypertension. Interestingly c ollecting duct specific knockout (Hoxb7 promoter) of the ENaC in mice does not appear to significantly impair urinary N a + retention under normal or Na + restricted conditions. 66 This is in contrast to data showing that whole body disruption of ENaC in mice cause s salt wasting during Na + restricted conditions 67 The differences between collecting duct specific knockout of the ENaC and total body ENaC knockout may be a consequence of the presence of ENaC channels in the connecting segment, in addition to the collecting duct Indeed, a recent study showed that connecting segment and collecting duct specific (AQP2 promoter) knockout of ENaC in mice caused increased urinary Na + excretion, polyuria, and greater plasma aldosterone levels than control mice under normal or Na + restricted conditions. 68 Taken together, the studies suggest particular importance of ENaC c hannels in the connecting segment for maintenance of Na + balance. Under normal conditions, a large majority of Na + transport in the collecting duct is insensitive to amiloride 69 However, it is sensitive to thiazide diuretics (NCC inhibitor) and this thiazide sensitivity is present despite the lack of evidence for NCC in collecting duct cells In fact, the e lectroneutral Na + dependent Cl HCO 3 exchanger (NDCBE) expressed in the collecting duct was recently found to be thiazide sensitive and to mediate electroneutral Na + reabsorption in ICs This transporter also display ed increased activity during dietary Na + restriction. These data indicate that ENaC is not the only Na + reabsorptive mechanism present in the collecting duct

PAGE 36

36 H 2 O PCs express an AVP regulated apical AQP2 channel that facilitates luminal H 2 O reabsorption. 44 AVP release increases in response to decreased H 2 O intake, increased plasma osmolality, and decreased effective circulating volume. In the collecting duct, AVP stimulates translocation and insertion of intr acellular AQP2 containing tubulovesicles into the apical plasma membrane of PCs increasing H 2 O reabsorption. This effect occurs through binding of AVP to basolateral AVP V2 receptors (V2R) in PCs, which subsequently increase cyclic adenosine monophosphate (c AMP ) levels. 70 The cAMP activated protein kinase A (PKA) phospho rylates AQP2 causing membrane translocation and insertion of the H 2 O channels. The V1aR AVP receptor is also expressed in the collecting duct. 71 V1 a R localizes to both PCs and ICs of the cortical collecting duct and exclusively in A type ICs in medullary collecting ducts. 72 However, the exact role of V1aR in H 2 O t ransport is not entirely clear. V1aR appears to antagonize V2R action in collecting duct cells. 73 The physiological effect of V1aR mediated antagonism of V2R to alter H 2 O homeostasis has not yet been investigated. Dysregulation of AQP2 results in altered urinary H 2 O excretion and disturbs H 2 O homeostasis. 44 An example of AQP2 malfunction is congenital nephrogenic diabetes insipidus, where mutations in AQP2 or V2R d isrupt trafficking of AQP2 channels to the apical plasma membrane. Thus, patients with this disease display decrease d urinary concentrating ability, polyuria and polydipsia. Conditions of hypokalemia have also been shown to decrease AQP2 expression leadi ng to acquired nephrogenic diabetes insipidus. 74

PAGE 37

37 AQP3 and AQP4 are present in the basolateral plasma membrane of PCs, where they facilitate H 2 O exit into the interstitium 44 AVP regulates AQP3 trafficking to the basolateral plasma membrane and knockout of AQP3 in mice produces nephrogenic diabetes insipidus. 75 In contrast, AVP has not been shown to regulate AQP4 and knockout of AQP4 in mice produces a much less severe H 2 O handling phenotype. 76 K + The collecting duct participates in both K + secretion and K + reabsorption. 6, 13, 77 K + secretion occurs in both PCs and ICs through two distinct K + channels ROMK and BK respectively 78 82 ROMK is present and active in the apical plasma membrane of PCs under normal conditions. 81 BK localizes to the apical plasma membrane of ICs 82 Although quiescent under normal conditions, i ncreased luminal flow rate and high dietary K + intake stimulate K + secretion through BK. 83, 84 As mentioned previously, t here is a large component of K + secretion in the collecting duct that is Cl dependent and potentially mediated by KCC s 8, 85 The identity of the KCC has not been determined. The only identifie d transporter for K + reabsorption in the collecting duct is the H + ,K + ATPase. 86, 87 H + ,K + ATPases are expressed and active in A and B type ICs 88, 89 These transporters are c omposed of an and subunit and two different subunits are expressed in the kidney. 87 The H + ,K + ATPase 2 (HK 2 ) subunit also localizes to th e apical plasma membrane of PCs in the cortical and outer medullar y collecting duct of rabbit 90 The role of H + ,K + ATPases in K + reabsorption by the collecting duct will be discussed later in this chapter. Dietary K + intake and hormones influence K + transport in the collecting duct. 77 High dietary K + intake stimulates expression a nd activity of ROMK and BK whereas a low K + diet shuts down K + secretion through these channels. The with no lysine kinase

PAGE 38

38 (WNK) system has also been shown to control ROMK activity in the collecting duct. 91 High dietary K + increases expression of a cleavage product of WNK1 called kidney specific WNK1, which i nhibits long WNK1 and p revent s WNK1 mediated inactivation of ROMK channels. 92 High dietary K + intake also increases circulating aldosterone levels. 77 S ome studies suggest that aldosterone is required for collecting duct K + secretion 28, 93 whereas many others do not. 29, 32, 78, 94, 95 Overall, t he data indicate a complicated interplay between dietary K + load and aldosterone to modify K + transport in the collecting duct. A low K + diet decreases K + secretion by ROM K and BK in the collecting duct 77 One potential mechanism involves repression of kidney specific WNK1 expression relieving inhibition of long WNK1 92 Long WNK1 can th en inactivate ROMK and shut down K + secretion Furthermore, low dietary K + stimulates mitogen activated protein kinase (MAPK) pathways at least partially through AngII, which inhibit ROMK and BK channel activity 96, 97 In contrast to the regulation of apical K + channels, a high dietary K + intake decreases and a low dietary K + intake increases K + reabsorptive activity and expression of H + ,K + ATPase s of the collecting duct 86, 87 This is described in more detail in a later section. Acid b ase Acid base transport primarily occurs within ICs of the collecting duct and involves complicated interplays between H + HCO 3 and NH 3 secretion. 36 Acid base transporters localize to specific membranes of each different iated IC subtype ( A B and non A ,non B type ; Figure 1 2, 1 3, and 1 4, respectively) 16 The plasma membrane distri b u t ion of these transporters is such that the connecting segment and c ortical collecting tubule

PAGE 39

39 can secrete net H + or HCO 3 as needed whereas the medullary collecting duct secretes net H + into the tubular fluid The expression and activity of these transporters depends upon dietary acid base intake, systemic acid base balanc e and hormonal status of the animal H + s ecretion and r eabsorption In A type and non A non B type ICs an apica l vacuolar(V) type H + ATPase mediates electrogenic H + secretion into the tubule lumen. 16 In B type ICs, H + ATPases localize to the basolateral plasma membrane where they reabsorb H + into the interstitium In the A and B type I Cs, t he H + ATPases coordinate net H + secretion or reabsorption with a Cl ,HCO 3 exchanger on the opposite membrane. The se Cl ,HCO 3 exchangers are discussed below. A and B type ICs also express apical H + ,K + ATPases that mediate H + secretion throughout the collecting duct. 86, 87 Involvement of H + ,K + ATPases in normal and stimulated H + secretion by the co llecting duct will be discussed later. V type H + ATPases are multisubunit complexes that have many different isoforms for each subunit 36 The B 1 and a 4 subunits specifically localize to ICs 98, 99 States of metabolic acidosis activate the apical H + ATPase and increase apical plasma membrane insertion of H + ATPase containing vesicular pools in A type ICs to achieve greater net H + secretion 100 105 C onditions of metabolic alkalosis activate the basolateral H + ATPase and increase basolateral plasma membrane insertion of intracellular H + ATPase containing vesicular pools in B type ICs to mediate greater net H + reabsorption 101, 106 108 Humans with null mutations in the B 1 H + ATPase subunit display distal renal tubular acidosis with an inability to acidify their urine despite the presence of metabolic acidosis. 99 In mice, knockout of the B 1 H + ATPase subunit produces alkaline

PAGE 40

40 urine but no systemic acid base disturbances unless t he mice are challenged by a dietary acid load. 109 The RAAS system is quite important for the regulation of H + ATPase mediated H + secretion. Both Ang II and aldosterone increase H + ATPase mediated H + secretion in A type ICs 38, 110, 111 Aldosterone has been shown to s timulat e H + ATPase activity rapidly (<15 min) through a non genomic mechanism in isolated outer medullary collecting ducts. 38 The hormone also appears to activate H + ATPases within 24 hr via an MR dependent mechanism using an in vitro renal cell line. 39 P atients with pseudohypoaldosteronism quite often present with symptoms o f distal renal tubular acidosis, assumed to result from decreased apical H + ATPase mediated H + secretion in A type ICs 58, 112 HCO 3 secretion and reabsorption. Cl ,HCO 3 exchangers present on the opposite side of the plasma membrane from the H + ATPase complement the net H + secretory or reabsorptive actions of the H + ATPase in A and B type ICs In A type ICs, basolateral AE1 mediates HCO 3 reabsorption and, similar to the apical H + ATPase, dietary acid loading stimulates AE1 activity, expression, and basolateral plasma membrane trafficking. 103, 106, 107 Thus, AE1 knockout mice and humans with AE1 mutations exhibit a distal ren al tubular acidosis. 113, 114 Conversely, in B type ICs, the apical Cl ,HCO 3 exchanger p en d rin mediates net HCO 3 secretio n 16, 115 Metabolic alkalosis dietary base loading dietary Na + and Cl restriction, and mineralocorticoids increase expression and apical localization of p endrin. 116 120 Mineralocorticoids stimulate net H + secretion by the collecting duct. However, the long acting mineralocorticoid, desoxycorticoster one pivalate (DOCP) accompanied with

PAGE 41

41 a greater NaCl intake has been shown to increase p endrin mediated HCO 3 secretion and density at the apical plasma membrane of B type ICs. 118 Pendrin activity appears to be required for maximal ENaC mediated Na + reabsorption potentially through a luminal HCO 3 dependent mechanism. 121, 122 In contrast to WT mice, p endrin null mice did not exhibit increased blood pressure with DOCP treatment. 118, 122 Several lines of evidence i ndicate that acid base transporters like pendrin and NDCBE, are no t only involved in regulation of acid base balance but also are required for Na + reabsorption and blood pressure regulation. NH 3 secretion. The collecting duct has a large capacity for NH 4 + secretion, mediated by simultaneous secretion of ammonia (NH 3 ) and H + 15 R hesus associated glycoproteins, Rhbg and Rhcg, are transporters that facilitate NH 3 secretion and both localize to the collecting duct Rhbg is present in the basolateral plasma membrane of cells in the distal tubule and collecting duct whereas Rhcg localizes to both the apical and bas olateral plasma membrane of these segments 123, 124 In the collecting duct, Rhbg and Rhcg staining is greatest i n A and non A non B type ICs but also present in PCs. In non A non B type ICs Rhcg only localizes to the apical plasma membrane. B type ICs do not appear to express Rhbg or Rhcg. In the inner medullary collecting duct, Rhbg and Rhcg are only localized to ICs present in the initial portion of this collecting duct segment Metabolic acidosis appears to stimulate both Rhbg a nd Rhcg expression and membrane localization. 125 127 Recently, investigators showed that HCl induced metabolic acidosis stimulated Rhbg expression in the kidney. 125 IC specific Rhbg knockout mice also displayed reduced urinary NH 3 excretion with acid lo ading. Similarly,

PAGE 42

42 the same group showed that Rhcg protein expression and apical localization increase with metabolic acidosis and that IC specific Rhcg knockout mice exhibit less urinary NH 3 excretion than control mice with HCl loading. 126, 128 These data demonstrate that both Rhbg and Rhcg are essential for acidosis induced NH 3 excretion. The Renal H + ,K + ATPases As described above, transporters within the renal collecting duct are quite important for the regulation of Na + H 2 O, K + and acid base balance. Several lines of evidence indicate that H + ,K + ATPases in the collecting duct are important in K + and acid base transport. Some data suggest that the H + ,K + ATPases may also directly or indirectly participat e in Na + transport. This section d iscusses the history and characteristics of H + ,K + ATPases and their r ole in renal solute transport. Discovery of H + ,K + ATPases In the 1970s, it was first recognized that gastric acid secretion was dependent on a K + stimu lated ATPase an activity discovered to be a H + ,K + ATPase in the apical plasma membrane of gastric parietal cells. 129, 130 T his discovery sp arked interest in whether the H + ,K + ATPase represented the mechanism of K + absorption in the colon and kidney. Distal colon plasma membrane s from rabbits w ere found to possess a K + stimulated ATPase and K + dependent H + secretion inhibited by S chering (SCH) 28080 similar to the gastric H + ,K + ATPase 131, 132 K + ATPase activities in the distal nephron and collecting duct of rats and rabbits w ere also found to be sensitive to the gastric H + ,K + ATPase inhibitor s, omeprazole and SCH 28080; and dietary K + restriction increased pump activity. 133, 134 These data only suggested the presence of an H + ,K + ATPase in the collecting duct. In 1989, Charles Wingo reported that active net H + secretion and K + absorption were both sensitive to omeprazole in the rabbit outer

PAGE 43

43 medullary collecting duct. 135 That study confirmed the presence and activity of H + ,K + ATPases in the collecting duct. All t hese observations fueled many years research into the physiological function and regulation of gast ric, colonic and renal H + ,K + ATPases Structure and Transport Characteristics H + ,K + ATPases are part of the type II class of phosphorylated (P) type ATPases which include the Na + ,K + ATPase, and calcium ( Ca 2+ ) ATPase 4 P type ATPases are named as such because of the phosphorylated intermediate produced during the ir enzymatic cycle. The P type ATPase enzymatic cycle involves conversion from an E1 ( adenosine triphosphate ( ATP ) bound) to E2 (phosph orylated) state. In the E1 confo rmation, ATP is bound to the pump and intracellular cations (H + in the case of H + ,K + ATPases ) enter the intracellular ion binding sites. The phosphate of ATP is used to phosphorylate the pump inducing a conformational change that occludes the bound cations from the intracellular and extracellular fluid. Another conformational change causes a shift into the E2 state where the occluded cations become exposed to the extracellular fluid. The conformational change also reduces the ion affinity for the pump releasing the H + into the extracellular fluid. At the same time, extracellular cations (K + in the case of the H + ,K + ATPases ) bind to the pump and dephosphorylation causes occlusion of these ions. Dephospho rylation allows ATP to rebind the enzyme shifting the pump into an E1 conformation This conformation exposes the occluded cations to the intracellular fluid and reduces their affinity for the pump Ion dissociation places the enzyme back in the starting E1 ATP bound conformation H + ,K + ATPases use the E1 E2 ATPase c ycle to secrete H + from the cell and absorb K + into the cell across their concentration gradients in an approximate 2H + :2K + ratio per hydrolyzed ATP 136

PAGE 44

44 P type ATPases are primarily composed of an and subunit. 4 However some accessory subunits have been identified for the Na + ,K + ATPase 137 The 10 transmembrane spanning subunit catalyzes ion translocation and contains the ATP bind ing and phosphorylation sites. 138 The single transmembrane spanning subunit regulates membrane trafficking, assembly, and degradation of the subunit. 139 141 Two distinct H + ,K + ATPase subunits have been described and two distinct gene s encode these subunits 86, 87 The murine Atp4a gene encodes the H + ,K + ATPase 1 (HK 1 ) subunit and murine Atp12a gene encodes the H + ,K + ATPase 2 (HK 2 ) subunit. In the mouse, the two H + ,K + ATPase subunits have 63% peptide sequence homology as determined by sequence comparison on the National Center for Biotechnology Information ( NCBI ) website ( www.ncbi.nlm.nih.gov ) The Atp4b gene encodes the only known H + ,K + ATPa se specific subunit (HK ). Several studies have shown that HK pairs with HK 1 and Na + ,K + ATPase 1 ( NaK 1 ) and/or HK subunit s pair with HK 2 140 146 In the kidney, most data suggests that NaK 1 is the partner for HK 2 H + ,K + ATPase specific activity ha s classically been studied using inhibitors. Based on tissue expression of HK subunit, t he gastric H + ,K + ATPase is assumed to only contain HK 1 subunits The gastric enzyme is sensitive to omeprazole and S CH 28080 but insensitive to ouabain 147 Th at study also s howed that amiloride inhibits the gastric HK 1 containing H + ,K + ATPase T he colonic H + ,K + ATPase is assumed to only contain HK 2 subunits In contrast, this enzyme m ay or may not be sensitive to SCH 28080 and is partially sensitive to ouabai n the canonical Na + ,K + ATPase inhibitor 132, 134, 142, 143, 148 151

PAGE 45

45 The crystal structure s for the E2 phosphorylated state and SCH 28080 bound gastric H + ,K + ATPase have recently been resolved. 152 154 It i s apparent from those studies that, in addition to its other responsibilities, the HK subunit is important for promotion of the catalytic cycle. I t s N termi nal tail interacts with the HK 1 subunit and prevent s cycle reversal 154 A crystal structure for the colonic H + ,K + ATPase has not been published. Homology modeling of rabbit HK 2 to the known Ca 2+ ATPase structure has shown that the two P type ATPases share significant structural homology 138 The crystal structure for the HK 2 containing H + ,K + ATPases may prove useful to further define the diverse inhibitor profiles and cati on specificities (as described below) of HK 1 and HK 2 containing H + ,K + ATPases H + ,K + ATPases were originally thought to secrete only H + and reabsorb only K + However, several studies now suggest that the both the HK 1 and HK 2 containing H + ,K + ATPases transport other cations. The first such studies observed that in addition to K + flux, S CH 28080 inhibited Na + flux in microperfused cortical collecting ducts from dietary K + and Na + restricted rabbits. 155, 156 This S CH 28080 sensitive Na + flux was also inversely correlated with luminal [K + ]. It has also been found that Na + stimulate s type III K + ATPase activity in microdissected collecting ducts from dietary K + depleted rats 148 This type III activity, defined as sensitivity to ouabain and low sensitivity to S CH 28080, was only present in K + restricted animals and the inhibitor profile of type III activity is consistent with an HK 2 contai n ing H + ,K + ATPase In vitro analysis of HK 2 contai n ing H + ,K + ATPase cation specificity in heterologous expression systems has also shown that both the rat and human enzymes can transport Na + on the K + binding site. 157 It was also observed that the gastric HK 1 containing H + ,K + ATPase transported Na + on the K +

PAGE 46

46 binding site. 158 However, the binding affinity of H + ,K + ATPases for Na + is much less than for K + To achieve a similar K + ATPase activity in in vitro expression systems or microdissected tubu le, it requires as much as 14 times more Na + than K + K + and NH 4 + have very similar biophysical properties 15 Therefore, it is not surprising that studies have also shown th e H + ,K + ATPases to transport NH 4 + on the K + binding site. This transport was first reported in the rat distal colon where NH 4 + a ptly substi tuted for K + in K + ATPase assays. 159 I n a heterologous expression system, NH 4 + and K + have been found to possess similar affinity for the H K 2 containing H + ,K + ATPase with NH 4 + actually ha ving greater efficacy for the pump 157, 160 Overall, these data suggest that H + ,K + ATPases have the ability to reabsorb Na + and NH 4 + in addition to K + Genomic Organization The cDNAs encoding for HK 1 HK and HK 2 have been cloned 161 163 In the mouse, the mRNA nucleotide sequence s for Atp4a which encodes HK 1 and Atp12a which encodes HK 2 are ~ 60% homologous. Atp4a localizes to chromosome 7 and has 22 exons. The human ATP4A gene localizes to chromo some 19 and also has 22 exons. Promoter analysis of the mouse Atp4a gene has not been published. However, promoter analyses for th is gene in other species have been reported 164, 165 Those studies identified putative c AMP response elements HK 1 reg ulation by cAMP and its associated signaling molecules will be discussed later. The mouse Atp12a gene is located on chromosome 14 and has 23 exons. The human gene ATP12A localizes to chromosome 13 and also has 23 exons. Promoter analysis of mouse Atp12a has demonstrated putative cAMP response elements, specificity protein 1( Sp1 ) sites HRE s and nuclear factor kappa light chain enhancer of

PAGE 47

47 activated B cells ( NF B ) sites 166 The regulation of HK 2 by these pathways will also be discussed later. A putative cytosine pho s phate guanine ( CpG ) island was flanking region of the human HK 2 gene ( ATP12A or ATP1AL1 ). 167 The methylation of a gene causes repression of gene expression. 168 However, a similar C pG island has not been detected in the proximal mouse Atp12a gene. 166 The gene Atp4b localizes to chromosome 8 and has 7 exons encoding the mouse HK The human gene ATP4B localizes to chromosome 13, similar to ATP12A from several spe cies have been cloned and characterized. 162, 169 171 The l transcription factor binding sites including a potential HRE. 171 Tissue Localization The stomach and colon were the first places where e xpression and activit y of HK 1 /HK and HK 2 containing H + ,K + ATPases were detected respectively Expression or activity of HK 1 containing H + ,K + ATPases has since been observed in the kidney cochlea, adrenal gland, and brain 88, 89, 172, 173 HK mRNA and protein expression ha ve been detected in the kidney and colon. 144, 174, 175 HK 2 containing H + ,K + ATPases have been detected in the kidney, prostate, uterus, skin, and brain. 176 179 The localization of these transporters in the kidney has been e xamined using pharmacology, expression analysis, and in situ hybridization, and immunolocalization. Expression or activity of renal HK 1 and HK 2 containing H + ,K + ATPases have been detected in the macula densa, proximal tubule, thick ascending limb, connecting segment, and the entire collecting duct. 88 90, 180 186 By in situ hybridization, HK

PAGE 48

48 transcripts have been localized to the proximal tubule, thick ascending limb, connecting segment, and entire collecting duct also. 175 The activity and expression of H + ,K + ATPases in the collecting duct has been the most well studied. H + ,K + ATPase activity (omeprazole and SCH 28080 sensitive ) was originally detected in the outer medullary collecting ducts of rabbit s fed a low K + diet. 135 Subsequent studies found HK 1 mRNA and protein expression in the cortex and medulla of rabbit, rat, and mouse. 180, 182, 186 Renal HK 2 m RNA and protein expression and activity (ouabain sensitive) in the rat, rabbit, and mouse are low under normal conditions but have been more readily detected in K + deplete animals 90, 181, 184, 185, 187, 188 Two studies of H + ,K + ATPase activity more closely defined the enzymatic characteristics and localization o f HK 1 and HK 2 containing H + ,K + ATPases in the proximal tubule, thick ascending limb, and collecting duct. T he first study examined pharmacological inhibition of K + ATPase activity in microdissected cortical and outer medullary collecting ducts, proximal tubules and thick ascending limbs from ra ts fed a normal or low K + diet. 148 Type I K + ATPase activity, defined as high sensitivity to S CH 28080 and insensitivity to ouabain, was observed in both segments of the collecting duct under norm al conditions. Type II activity which was relatively insensitive to S CH 28080 and sensitive to ouabain was detected in the proximal tubule and thick ascending limb of normal rats. Type III activity which was s ensitive to high ouabain and SCH 28080 was dete cted in the collecting duct of K + depleted rats. Type I and II activity significantly decreased in rats fed a low K + diet. The second study used HK knockout mice to decipher the identit ies of type I and type II I K + ATPase activity. 151 Under normal

PAGE 49

49 co nditions, type I activity was absent in HK 1 null (H K 1 / ) mice but still present in HK 2 null (HK 2 / ) mice. Under low K + conditions, type III activity was present in HK 1 / mice but absent in HK 2 / mice. This study did not address type II activity. It is important to note that these two studies were performed in different species. However, similar H + ,K + ATPase enzyme characteristics were observed. The two studies are consistent with only HK 1 containing H + ,K + ATPases being active in the collecting duct of normal animals and only HK 2 containing H + ,K + ATPases being active in the collecting duct of K + depleted animals The close homology of HK and Na + ,K + ATPase subunit peptide sequences have made it difficult to generate antibod ies specific for the different HK subunits. However, a few studies have examine d HK subunit protein localization by immunohistochemistry Immunolocalization experiments have detected unpolarized HK 1 expression in ICs of the cortical and outer medullary collecting duct in rat, rabbit, and human 185, 186 One study reported similar distribution of HK 1 and the H + ATPa se, with basolateral detection in B type ICs. 182 However, analysis of HK 1 like (S CH 28080 sensitive) H + ,K + ATPase mediated K + flux and HCO 3 reabsorption ( equamolar with H + secretion) in the cortical and outer medullary collecting duct of rabbits suggests that HK 1 containing H + ,K + ATPases reside predominately on the IC apical plasma membrane. 12, 155, 189 HK 2 immunoreactivity has been detected in the apical membrane of conn ecting segment cells and ICs of the rabbit collecting duct 90, 183 Immu nostaining appears to be greatest in the connecting segment. Qualitatively less apical plasma membrane staining in cortical collecting duct PCs and light staining in the thick ascending limb and macula densa have also been observed for HK 2 90

PAGE 50

50 Physiological Function and Dietary Regulation Many years research has shown that H + ,K + ATPase activity in the collecting duct selectively increases with dietary K + depletion. 86, 87 This activity includes greater K + flux and H + secretion. In particular, HK 2 mRNA and protein expression are dramatically up regulated in animals fed a low K + diet especially in the medulla 181, 187 One study has shown that HK 1 mRNA expression increased in the cortex of K + depleted rats. 190 No reports of HK 1 protein expression in K + depleted animals have been published. Under normal conditions, H + ,K + ATPases coupled with an apical K + channel in the collecting duct appear to facilitate net HCO 3 reabsorption via apical K + recycling. Data supporting this model c ame from the examination of H + ,K + ATPase mediated HCO 3 and K + flux in cortical collecting ducts from rabbits. 12 It was observed that apical application of the K + chan nel inhibitor, barium, decreased S CH 28080 sensitive HCO 3 flux. In a separate study, basolateral barium application inhibited S CH 28080 sensitive H + ,K + ATPase activity ( HCO 3 and K + flux ) in the cortical collecting duct of dietary K + restricted rabbits. 11 The latter study suggested t hat renal H + ,K + ATPase s mediate net K + reabsorption under dietary K + restrict ed conditions As described in earlier sections, both HK 1 and HK 2 containing H + ,K + ATPases exhibit Na + transport on the K + binding site and inhibition of H + ,K + ATPases by S CH 28080 reduces Na + flux in the collecting duct. A low NaC l diet has also been s hown to increase ouabain sensitive H + secretion, indicative of HK 2 containing H + ,K + ATPases in ICs of the rat cortical collecting duct. 191 A subsequent study that examined HK 2 mRNA and protein expression in the kidneys fr om Na + restricted rats observed no change in HK 2 expression. 192 It is possible that dietary Na + restriction

PAGE 51

51 augments HK 2 containing H + ,K + ATPase activity in the collecting duct via alterations of membrane trafficking or activity without changes in expression The H + ,K + ATPase inhibitors, omeprazole and S CH 28080, both inhibit HCO 3 reabsorption and H + secretion in the cortical, outer medullary, and inner medullary collecting duct. 135, 155, 193 194 Using HK 1 / HK 2 / and HK 1 and HK 2 double null (HK 1,2 / ) mice, our lab has more recently demonstrated that both A and B type IC s in the cortical collecting duct possess substantial H + ,K + ATPase mediated H + secretion via both HK 1 and HK 2 containing H + ,K + ATPases. 89 Some studies have observed increased H + ,K + ATPase activity in the collecting duct or greater HK subunit expression in kidney s from acidotic animals. Increased H + ,K + ATPase activity has been detected in collecting ducts from rats with chronic metabolic acidosis derived from di etary NH 4 Cl load ing lithium treatment and during respiratory acidosis. 193, 195 198 All of those s tudies observed stimulation o f S CH 28080 sensitive H + ,K + ATPase activity suggesting stimulation of HK 1 containing H + ,K + ATPases Other investigators have observed increased HK 2 mRNA expression in the medulla of NH 4 Cl loaded animals. 199 NH 3 can activate S CH 28080 and ou a bain sensitive H + ,K + ATPase H + secretion in ICs of the rabbit cortical collecting duct, suggesting that both H + ,K + ATPase isoforms are involved. 200, 201 A more recent study also in dicates that dietary acid induced acidosis stimulate s both HK 1 and HK 2 containing H + ,K + ATPases expression in the kidney. Differences in mRNA expression of many different acid base transporters were measured in isolated outer medullary collecting ducts from normal and NH 4 Cl loaded animals. 100 With in 3 days of an acid loaded diet, there was a ~15 and 2 fold stimulation of HK 1 and HK 2 mRNA expression respectively, in the mouse outer medullary

PAGE 52

52 collecting duct. With 2 weeks on an acid loaded diet, only HK 2 expression remained elevated (~3 fold). The accumulated evidence indicates t hat both the HK 1 and HK 2 containing H + ,K + ATPases participate in acidosis induced H + secretion by the collecting duct in a time dependent manner The studies suggest that HK 1 containing H + ,K + ATPases exhibit a more acute (earlier) response to acidosis whereas HK 2 containing H + ,K + ATPases exhibit a more prolonged response. Hormonal Regulation Aldosterone stimulate s luminal acidification by the dist al n ephron and collecting duct and only a few studies have examined the role of renal H + ,K + ATPase s in this effect. Early studies suggested that aldosterone activated H + ,K + ATPases in the collecting duct. 134, 202 However, subsequent analyses of H + ,K + ATPase activity in response to aldosterone produced negative results Most of the studies focused on early aldosterone effects (1 2 days) and used S CH 28080 inhibition to measure H + ,K + ATPase activity. 39, 4 1, 203 In one such study, H + ,K + ATPase mediated (S CH 28080 sensitive) ATPase activity was measured in microdi ssected cortical and medullary collecting ducts from adrenalectomized rats given zero, normal, or supraphysiological doses of aldosterone and a low, normal, or high dietary K + intake for a week 41 T he activity of S CH 28080 sensitive H + ,K + AT Pases did not correlate with aldosterone levels but inversely correlated with dietary K + intake. Also, a low NaCl diet has been found to increase SCH 28080 and ouabain sensitive H + ,K + ATPase mediated H + secret ion in rat collecting duct ICs 191 Since low NaCl diets increase plasma aldosterone, it seemed plausible that this was a mineralocorticoid effect. However, aldosterone replacement ( at the levels induced by 2 weeks of dietary NaCl deficiency ) in adrenalectomized rats did not increase S CH 28080 or ouabain sensitive

PAGE 53

53 H + ,K + ATPase mediated H + secretion. The results suggest th at chronic dietary Na Cl depletion induced H + ,K + ATPase activity is mineralocorticoid independent Ang II has direct effects on the collecting du ct to stimulate H + secretion. More specifically, Ang II appears to s timulate H + ATPase mediated H + secretion in A type ICs of the cortical collecting duct. 110, 111 However, no effect of Ang II on SCH 28080 sensitive H + ,K + ATPase act ivity in the collecting duct has been observed 204 Likewise, ET 1 induces distal nephron acidification through augmented apical H + ATPase mediated H + secretion 56 However, H + ,K + ATPase mediated H + secretion (S CH 28080 sensitive ) does not appear to be sensitive to the non selective ET 1 receptor antagonist, bosentan The data suggest that ET 1 does not regulate H + ,K + ATPase activity in the collecting duct However, t he effect of Ang II and ET 1 on specifically HK 2 containing H + ,K + ATPase activit y and expression has not been investigated. Recent data demonstrate that tissue k al l ikrein and the sex hormone, progesterone, regulate HK 2 containing H + ,K + ATPases in the kidney. Circulating tissue kal l ikrein levels were shown to directly correlate with dietary K + intake. 205 In this same study, t issue kal l ikrein null mice became hyperkal emic when given a large dietary K + load suggesting maladaptive renal K + excretion The data showed abnormal activatio n of H + ,K + ATPase activity and HK 2 mRNA expression in the cortical collecting duct of the knockout mice. Thus, tissue kal l ikrein appears to negatively regulate HK 2 containing H + ,K + ATPases Therefore, the knockout of tissue kallikrein in mice appears to cause excessive urinary K + retention through renal HK 2 containing H + ,K + ATPases.

PAGE 54

54 In contrast to tissue kal l ikrein recent evidence showed that plasma progesterone increase d with dietary K + restriction and that progesterone directly stimulate d urinary K + retention in mice 206 Progesterone also stimulate d HK 2 mRNA expression in an in vitro cell line and HK 2 / mice did not exhibit progesterone induced urinary K + retention. Although previously unrecognized, the se stud ies support important role s for hormones other than aldosterone to modify K + balance specifically through renal HK 2 containing H + ,K + ATPase mediated K + reabsorption Molecular Regulation As mentioned earlier, cAMP response elements have been detected in promoters of both the HK 1 and HK 2 genes in many species. This suggested that cAMP and its associated pathways are important to the regulation of H + ,K + ATPases A few studies have examined cAMP and C a 2+ dependent regulation of renal HK 1 and HK 2 gene expression or activity cAMP generating agents such as isoproterenol, calcitonin, and AVP have been shown to activate renal H + ,K + ATPase K + stimulated ATPase activity 207 In that study, cAMP through a PKA dependent mechanism increased type I H + ,K + ATPase activity in the cortical collecting duct of rats fed a normal K + diet. AVP mediated PKA activation was also shown to stimulate type III H + ,K + ATPase activity in collecting ducts from K + depleted rats. This same group later reported that cAMP also r egulated S CH 28080 sensitive H + ,K + ATPase activity through the extracellular signal regulated kinase cascade in addition to PKA 208, 209 cAMP response element binding protein has also been shown to bind to the HK 2 promoter and induce HK 2 gene expression in the mouse inner medullary collecting duct cell line (IMCD3). 210 Putative Sp1 and NF B response elements were also detected in the mouse Atp12a promoter. In IMCD3 cells, both Sp1 and NF B have been shown to bind to their

PAGE 55

55 proposed putative elements within the HK 2 gene prom oter. 211, 212 However, Sp1 increase d and NF B inhibit ed HK 2 gene expression. The physiological implications of Sp1 and NF B regulation of HK 2 have not been explored Physiology of H + ,K + ATPase Null Mice Gene targeting strategies have been used to create HK and HK subunit null mice. The genetic disruption of mouse Atp4a gen e involved insertion of a neomycin resistance gene into exon 8 with replacement of codons 360 390. 213 The removed nucleotide sequences encode for part of the fourth transmembrane and a conserved phosphorylation site (asparagine 385) essential for activity. HK 1 / mice exhibited normal plasma [ K + ] and [ HCO 3 ]. The knockouts displayed reduced gastric acidification or achloryhydria and increased gastric HK expression. HK 1 / also had gastrinemia abnormal parietal cell structure, and gastric metaplasia. HK / mice were generated by disruption of exon 1 in the Atp4b gene and replacement of 35 bp wit h the phosphoglycerate kinase I neomycin gene. 214, 215 Expression of HK mRNA and protein were not detected in stomachs from HK / mice Similar to HK 1 / mice HK / mice exhibited achloryhydria gastrinemia, and altered parietal cell ultrastructure The renal physiology of HK 1 / and HK / mice was not investigated in those studies. Mice with a HK transgene linked to the cytomegaolovirus promoter have been generated. 216, 217 The transgene has a mutation of tyrosine 20 to an alanine in the HK cytoplasmic tail peptide sequence. Replacement of tyrosine 20 with alanine caused constitutive expression of HK 1 /HK in the apical plasma membrane of gastric parietal cells. It was also shown that t he HK transgenic mice displayed excessive gastric acid secretion and developed ulcers 216 Furthermore, the transgenic mice ha d a slight

PAGE 56

56 hyperkalemia and reduced urinary K + excretion suggesting that renal HK /HK containing H + ,K + ATPases are physiological ly important to the regulation of K + homeostasis. 217 HK 2 / mice were generated by disruption of exon 20 of the Atp12a gene which encodes for important transmembrane segments 218 The knockout mice still exhibited mRNA expression of the mutated HK 2 transcript in t he colon but not in the kidney HK 2 / mice developed more severe hypokalemia and had excessive fecal K + wasting when fed a K + depleted diet consistent with the loss of colonic (HK 2 ) H + ,K + ATPase mediated K + reabsorption However, HK 2 / mice did not exhibit urinary K + loss or altered systemic acid base parameters on a normal or K + restricted diet Interestingly, HK 2 / mice also exhibit ed significant fecal K + loss with dietary Na + restriction. 219 Additionally, t he knockout mice showed fecal Na + loss and redu ced amiloride sensitive short circuit current in their colons, suggesting that HK 2 containing H + ,K + ATPases are required for maximal ENaC activity. Summary and Hypothesis Much research over the past 30 years has examined the physiological function of renal H + ,K + ATPases in K + and H + transport by the collecting duct. Although controversial, some evidence suggests that mineralocorticoids activate renal H + ,K + ATPases In contrast, i t is well established that dietary K + deple tion induces H + ,K + ATPase activity and expression in the collecting duct. Interestingly, b oth mineralocorticoids and dietary K + depletion cause hypokalemia, metabolic alkalosis, and stimulate urinary Na + retention resulting in increased blood pressure. 220, 221 Since many studies suggest that the renal H + ,K + ATPases part icipate either directly or indirectly in Na + reabsorption, we hypothesize that in addition to K + reabsorption and H + secretion,

PAGE 57

57 either or both of the renal H + ,K + ATPases are required for Na + reabsorption during mineralocorticoid excess and dietary K + depl etion.

PAGE 58

58 Figure 1 1. Model of collecting duct PC An apical ENaC channel reabsorbs Na + from the tubular fluid and the basolateral Na + ,K + ATPase extrudes the Na + into the interstitium. An apical ROMK channel mediates K + secretion and an apical HK 2 containing H + K + ATPase reabsorbs K + and secretes H + The apical AQP2 and basolateral AQP3 or AQP4 channels reabsorb H 2 O into the interstitium in response to V2R activation by vasopressin. V1aR inhibits the action of V2R and AVP.

PAGE 59

59 Figure 1 2. Model of collecting duct A type IC. This IC subtype primarily participates in net acid secretion. An apical H + ATPase (B 1 and a 4 ) secretes H + into the luminal fluid. The basolateral Cl ,HCO 3 exchanger, AE1, reabsorbs the remaining intracellular HCO 3 into the interstitium. Apical HK 1 and 2 containing H + ,K + ATPases reabsorb K + from and secrete H + into the lumen. The apical BK channel secretes K + in response to increased luminal flow. Rhcg, apical and basolateral, and basolateral Rhbg secrete NH 3 into the tubular fluid.

PAGE 60

60 Figure 1 3. Model of collecting duct B type IC. This IC subtype primarily participates in net base secretion. The apical Cl ,HCO 3 exchanger, Pendrin, secretes HCO 3 into luminal fluid. A basolateral H + ATPase (B 1 and a 4 ) r eabsorbs the remaining intracellular H + into the interstitium. Apical HK 1 and 2 containing H + ,K + ATPases reabsorb K + from and secrete H + into the lumen. The apical BK channel secretes K + in response to increased luminal flow.

PAGE 61

61 Figure 1 4. Model of collecting duct non A non B type IC. This IC subtype can mediate net acid or base secretion. The apical Cl ,HCO 3 exchanger, Pendrin, secretes HCO 3 into luminal fluid. The apical H + ATPase (B 1 and a 4 ) secretes H + into the lumen. Apical HK 1 2 containing H + ,K + ATPases reabsorb K + from and secrete H + into the lumen as well. The apical BK channel secretes K + in response to increased luminal flow. An apical Rhcg and basolateral Rhbg facilitate NH 3 secretion into the tubular fluid.

PAGE 62

62 CHAPTER 2 MATERIALS AND METHOD S Animals All animal use was approved by the Institutional Animal Care and Use Committee Gainesville, Florida and performed in accordance wi Guide for the Care and Use of Laboratory Animals. WT mice (C57BL/6J) were purchased from the Jackson Laboratory (Bar Harbor, Maine) or bred in house. HK 1 / and HK 1,2 / mice, originally acquired from Dr. Gary Shull (University of Cincinnati ), were bred in house. HK 1 / and HK 2 / mice were bred and backcrossed onto the C57BL/6J background strain to create HK 1,2 / mice. Both male and female mice ( 2 4 months old ) from each genotype were used in experimental studies as designated below. Genotyping Tail snips (~ 0.25 cm) were taken from individual mice under isoflura ne anesthesia and digested in a lysis buffer (0.2% sodium dodecyl sulfate or SDS, 0.2 M NaCl, 0.1 M Tris pH 7.5, 5 mM ethylenediaminetetraacetic acid or EDTA pH 8.0, 100 g/ml proteinase K) at 55 C overnight. The sample was centrifuged at 13,000 rpm for 5 min and supernatant removed. An equal volume of isopropanol was added to the supernatant and the sample was incubated on ice for 30 min. The genomic deoxyribonucleic acid ( DNA ) was pelleted at 4 C for 30 min at 13,000 rpm, supernatant removed, and washed in equal volume of 75% ethanol. DNA was again pelleted at room temperature for 10 min at 13,000 rpm, supernatant removed, and allowed to air dry overnight. The DNA pellet was dissolved in sterile H 2 O. T wo separate triplex

PAGE 63

63 polymerase chain reactions ( PCR ) were used to amplify genomic DNA from the Atp4a and Atp12a genes. Primer sequences are shown in Table 2 1. The HK 1 F, HK 1 R, and Neo primers were used to amplify genomic DNA from Atp4a and HK 2 F, HK 2 R, and Neo primers to amplify genomic DNA from Atp12a HotStart Taq polymerase (Qiagen, Valencia, CA) was used for DNA amplification The kit supplied a 10X PCR buffer, 25 mM magnesium chloride (MgCl 2 ) and 10 mM deoxynucleotide triphosphates (dNTPs) mixture. The reaction sample contained 1X buffer, 0.5mM MgC l 2 0.2 mM dNTPs, 200 nM of each primer, and 1 unit of polymerase. The reaction cycle was as follows: 1 cycle at 94C for 10 min ; 40 cycles of 94C for 30 s 56C for 30 s for Atp4a or 60C for 1 min for Atp12a 7 2C for 1 min for Atp4a and 30 s for Atp12a ; final 1 min extension at 72C. PCR products were separated on a 2% agarose gel containing 0.1% ethidium bromide. P hotographs were taken on Kodak Image Station 4000M using ultraviolet illumination (excitation 535nm and emission 600nm) As shown in Figure 2 1, WT mice displayed a 189 bp band for the Atp4a reaction whereas HK 1 / and HK 1,2 / mice displayed a 310 bp band due to the insertion of the neomycin gene. For the Atp12a reaction WT and HK 1 / mice displayed a 117 bp band whereas HK 1,2 / mice d isplayed a 307 bp band indicative of neomycin insertion. Diets, Treatments, and Metabolic Studies Mice were housed in either their normal cage with bedding or in a metabolic cage (Nalgene) as designated in each individual experiment. The animals either received a normal pelleted diet supplied by the housing facility ( Harlan Laboratories, Teklad (TD) 2016S/2018 0.25% Na + and 0.53% K + ) or a gel diet consisting of 45% powered food (see experiments below for details ), 1% agar, and 54% deoinized H 2 O. Food intake and body weight were measured daily. For metabolic cage experiments, 24 hr urine and

PAGE 64

64 fecal collections were performed. Urine was accumulated under H 2 O equilibrated mineral oil over the 24 hr period. At the end of the experiments, mice were ane sthetized with 3 4% isoflurane and arterial blood was quickly and anaerobically collected through aortic cannulation. Blood [Na + ], [K + ], [Cl ], pH, pCO 2 and hematocrit (Hct) were measured on a Stat Profile pHOx Plus C analyzer (Nova Biomedical; Waltham, M A) immediately after collection. Blood [HCO 3 ] was calculated on the instrument using the Henderson Hasselbalch equation (pH = 6.1 + log( [HCO 3 ] /[0.03*pCO 2 ]). Kidneys were removed, weighed, and immediately frozen in liquid nitrogen and stored at 80C. DOCP e xperiments F emale mice between 8 16 weeks were used for DOCP experiments For DOCP time course experiments and normal blood analysis, mice were fed normal lab chow and given free access to H 2 O One half the mice were given an intramuscular injection of 1.7 mg DOCP (Percorten V, Novartis Pharmaceuticals) under isoflurane anesthesia. For microperfusion and expression studies, another group of animals was treated with DOCP for eight days and sacrificed via Na + pentobarbital (i.p. 120 mg/kg) and cervical dislocation. One kidney was used for perfusion and the other for mRNA expression studies for day 8 of DOCP treatment For the high K + experiments, WT mice were fed a powdered diet ( TD 99131; 0.2% Na+ and 0.6% K + ) supplemented with potassium chloride ( KCl ) to total 5% K + for 11 days in normal cages The diet was made as a gel and mice were given free access to a H 2 O bottle On the third day, half of the mice were injected with DOCP. In the last experiment, WT, HK 1 / and HK 1,2 / mice were housed in metabolic cages for 13 days and fed a powdered diet ( TD 99131; 0.2% Na + and 0.6% K + ) made as a gel with free access to a H 2 O bottle HK 1 / and HK 1,2 / mice were pair fed with WT

PAGE 65

65 mice of a similar body weight. Mice were injected with DOC P on day 5 of the experiment. In addition to food intake and body weight, H 2 O intake was measured daily. K + depletion experiments M ale mice between 12 16 weeks were used for K + depletion experiments WT and HK 1,2 / mice were housed in metabolic cages for 8 days and fed a normal gel diet ( TD 99131) or a K + deplete d gel diet ( TD 99134 0.2% Na + and ~ 0% K + ) Both KCl and KHCO 3 were removed to create the K + depleted diet. In an alternate experiment, mice were pair fed a normal gel diet for 4 days then switched to a K + depleted gel diet for 4 days. H 2 O intake was from gel diet alone. In a separate experiment, WT, HK 1 / and HK 1,2 / mice were housed in normal cages and fed a K + depleted gel diet with free access to H 2 O for 11 days. After 3 days on the diet, one half the animals were injected with DOCP (1.7 mg). Na + depletion experiments M ale WT and HK 1,2 / mice between 12 16 weeks were fed a normal gel diet (TD 99131) ad libitum for 7 days in regular cages. The mic e were then placed in metabolic cages and pair fed the normal gel diet for 7 days and then switched to a Na + depleted gel diet (TD 03582 ~0% Na + and 0.6% K + ) for 7 days. Both NaCl and NaHCO 3 were removed to create the Na + depleted diet. H 2 O intake was fro m gel diet alone. NH 4 Cl loading experiments Male WT and HK 1 / mice between 12 16 weeks were pair fed a normal gel diet (TD 99131) for 4 days then switched to the same gel diet supplemented with 0.28 M NH 4 Cl for 6 days. H 2 O intake was from gel diet alone. Mice were housed in normal cages for the first 2 days then place d in metabolic cages for the remainder of the experiment.

PAGE 66

66 Urinalysis Collected urine was centrifuged at 1000 x g for 5 min to remove debris and separate u rine and oil. U rine pH was determined with an Accumet Model 25 pH meter (Fisher Scientific). Urine electrolytes ( [ Na + ], [ K + ], and [ Cl ]) were measured using ion sensitive electrodes on a Nova 16 clinical analyzer (Nova Biomedical, Waltham, MA). If concentr ation was too low for detection with Nova 16 instrument then u rine Na + and K + were measured by spectrophotometric analysis on a digital flame photometer (Cole Parmer, Model 2655 00 ; see protocol in fecal analysis ). Aliquoted u rine samples were f roze n at 8 0C for later use The Ammonia Reagent Set (Pointe Scientific Inc., Canton, MI) was used to determine [ NH 4 + ] in urine samples. This kit utilizes the enzymatic conversion of NH 4 + ketoglutarate, and reduced nicotinamide adenine dinucleotide phosphate to L glutamate, nicotinamide adenine dinucleotide phosphate, and H 2 O catalyzed by glutamate dehydrogenase. The enzymatic conversion results in a decrease in absorbance at 340 nm. Thawed urine samples were diluted in dei o nized H 2 O and [ NH 4 + ] standards were mad e from 50 to 250 M. The two reaction solutions pro vided with the kit were diluted in H 2 Blank (H 2 O), standards, and samples (40 L ) were pipetted in duplicate or triplicate onto a standard 96 well ultraviolet pla te. For the first reaction, 200 L of solution 1 was quickly mixed with each well and incubated for 7 min. The absorbance was read at 340 nm in a Spectr a Max M5 plate reader (Molecular Devices) For the next reaction, 10 L of solution 2 was added to each well, incubated for 7 min, and read at 340 nm. The reading of the first reaction (R1) was multiplied by 0.96 to correct for volume changes. The second reading (R2) was subtracted from the corrected R1 to calculate the change

PAGE 67

67 in absorbance (R1 R2). A standard curve was generated for the change of absorbencies of each standard and used to calculate the [ NH 4 + ] in the samples. To determine titratable acidity, equal volumes of 0.1M HCl and urine or blank (H 2 O) were boiled for 2 minu tes then cooled to 37 C. Titratable acidity (mol/day) was calculated as the difference between the moles of standardized 0.1 M sodium hydroxide ( NaOH ) used to titrate the sample and the blank to pH 7.4. Potassium hydrogen phthalate (KHP) was used to stan dardize 0.1 M NaOH using the indicator, phenolphthalein (2%) KHP (0.8 g) was dissolved in 50 ml deionized H 2 O and 4 drops of indicator were added. A measured volume of 0.1 M NaOH was used to titrate the KHP solution until the appearance of pink. At titra tion, t he moles of KHP in the solution equal s the moles of NaOH added. The moles and volume of NaOH added to the KHP solution were used to calculate the real molar concentration of prepared NaOH Urine [Ca 2+ ] was determined by modification of the Calcium (Arsenazo) Reagent Set (Pointe Scientific, Canton, MI). The kit utilizes the reaction of Ca 2+ and Arsenazo III reagent in a n alkaline solution to form a purple complex with absorbance at 650 nm. Standards were diluted in a range from 1 to 5 mM. St andards and samples (5 L ) were diluted and pipetted into a 96 well clear plate. The Arsenazo reagent (500 L ) was added to each well and incubated with sample for 10 min. The absorbance was read at 650 nm. A standard curve was generated and sample concent rations calculated. Fecal a nalysis Feces were weighed, baked overnight at 200 C in covered container, and weighed again. Dried fecal material was digested in 3 mL of 0.75 M nitric acid overnight at 37 C in a shaker The digested material was homogenized u sing a mortar and pestle and

PAGE 68

68 centrifuged at 1000 x g for 5 to 10 min to remove sediment. The supernatant was removed and stored at 20 C. [Na + ] and [K + ] in digested fecal samples (and some urine samples) were determined by analysis on a digital flame phot ometer (Model 2655 00, Cole Parmer Instrument Company). Standards (1000 ppm Na + or K + ) and samples were diluted in diluent provided by Cole Parmer. The stand ards were diluted to a range of 0 to 40 ppm for K + and 0 to 20 ppm for Na + The flame photometer was a llowed to equilibrate with a constant flow of diluent for 20 30 min before use. The appropriate spectrophotometric filter (Na + or K + ) was selected on front of photometer. The blank (diluent) was set to zero and the h ighest stand ard was set to a desired reading. Standards and samples were aspirated and a read in duplicate or triplicate. Standards were always rerun at the end of the experiment to correct for instrument drift. A standard curve was generated and the [Na + ] or [K + ] ca lculated for each sample. Cell Culture The immortal cell line, outer medullary collecting duct 1 ( OMCD 1 ), was used for cell culture experiments. Guntupalli and colleagues generated the OMCD 1 cell line from the inner stripe of the outer medullary collectin g duct of transgenic mice expressing the simian virus 40 T and large T antigens. 222 The cells exhibited phenotypic characteristics of outer medullary collecting duct ICs with microprojections and tubulovesicles near the plasma membrane and exhibited SCH 28080 sensitive K + flux and H + secretion, indicative of H + ,K + ATPases. 88, 222 In our studies, OMCD 1 cells were grown at 37 C on Costar transwell dishes to induce polarization. The cells were supplied with 4 (2 hydroxyethyl) 1 piperazineethanesulfonic acid buffered medium: nutrient mixture F 12 supplemented (Invitrogen) with 10% fetal bovine serum

PAGE 69

69 (Invitro gen) and 50 g/ml gentamycin (Sigma) Once the cells rea ched 100% confluenc y the cells were incubated in the same media without phenol red and supplemented with 10% cesium stripped fetal bovine serum for 24 hr. The cells were then treated with vehicle (et hanol) or 1 M aldosterone replaced daily for 7 days. On the last day, cells were washed with phosphate buffered saline (PBS) and RNA was collected as described below. RNA RNA Extraction TRIzol reagent (Invitrogen) was used to extract RNA from tissues and cells. Tissues were homogenized using a glass dounce in TRIzol reagent. Cells in transwells were incubated with TRIzol reagent for a few minutes, then detached using a cell scraper and pipet ted into a microcentrifuge tube. The homogenized tissue or cells were incubated at room temperature for 5 min. After the addition of a n appropriate amount of chloroform the sample was gently mixed three times and allowed to incubate for 2 3 min at room te mperature The sample was then centrifuged at 1 2 ,000 x g for 15 min at 4 C to separate the organic and aqueous phases The aqueous phase (top clear phase containing RNA) was placed in a new tube and the organic phase (bottom phenol layer containing protein) was stored at 4 C for protein extraction. Isopropanol was added to the aqueous phase to precipitate RNA and stored at 8 0 C overnight. The following day, the sample was thawed and centrifuged at 12,000 x g for 10 min at 4 C. The supernatant was removed and the pelleted RNA washed with 75% ethanol. The sample was centrifuged at 7500 x g for 5 min, supernatant removed, and th e pellet allowed to air dry for 5 10 min. The RNA pellet was dissolved in ribonuclease (RNase) free H 2 O and stored at 80 C. The RNA concentration was determined by

PAGE 70

70 analysis on a spectrophotometer. RNA samples were treated with deoxyribonuclease (DNase) to remove DNA contaminants (DNA Free, Ambion). Approximately 10 g RNA was diluted with a provided buffer to 50 L total volume and 1 L DNase 1 was added. The sample was incubated at 37C for 20 30 min and then 5 L inactivating reagent was added. The sampl e was incubated at room temperature for ~ 2 min and mixed often by flicking the tube. The inactivating reagent was separated from the RNA by centrifugation at 12,000 x g for 2 min. The supernatant containing RNA was removed and stored at 80C. The RNA con centration and quality were determined by spectrophotometric analysis (absorbance 260 nm/ 280 nm from 1.9 2.0). RNA (1 or 2 g) was converted to complementary DNA (cDNA) using SuperScript III First Strand Synthesis SuperMix for quantitative reverse transc riptase (RT) PCR (Invitrogen). RNA was mixed with a 2X reaction mixture and 6X enzyme mixture. The mixture was incubated at 25C for 10 min, 50C for 30 min, 85C for 5 min, then held at 4C. The cDNA was incubated in RNase H at 37C for 20 min to degrade any remaining RNA. The cDNA was diluted to 4 ng/ L and stored at 20C. The TaqMan MicroRNA RT Kit and TaqMan MicroRNA Assays (Applied Biosystems) were used to convert microRNA into cDNA. Each 15 L reaction included 1 mM dNTP, 3 units RT, RT buffer, 0. 25 units RNase inhibitor, 3 L primer, and 10 ng RNA. The primers were supplied with the specific TaqMan MicroRNA Assay used (mmu mir 505 assay # 001655 ; snoRNA 202, assay # 001232). The reaction mixture was incubated on ice for 5 min. The samples were then amplified using the following cycle parameters: 16 C for 30 min, 42 C for 30 min, 85C for 5 min, and held at 4C.

PAGE 71

71 RT PCR HotStartTaq DNA polymerase (Qiagen) was used for RT PCR. Primers (MMG15 to 18 and GAPDH F/R ) used for the reactions are shown in Table 1 1. The reaction mixture is the same as for genotyping except no additional magnesium chloride was added and 100 ng template DNA was used The reaction cycle included: 1 cycle of 95 C for 15 min; 30 37 (30 for GAPDH, 37 for HK 1 and HK 2 ) cycles of 94 C for 30 s 55 C for 1 min (65 C for GAPDHF/R primers) and 72 C for 1 min; 1 cycle of 72 C for 10 min then held at 4 C indefinitely. The PCR products were separated on a 2% agarose gel containing ethidium bromide. P hotographs were taken on Kodak Image Station 4000M using ultraviolet illumination (excitation 535nm and emission 600nm) Quantitative Real Time PCR (qPCR) TaqMan Gene Expression Assays (Applied Biosystems) were used for qPCR experiments The primer/probe sets used include Atp4a ( Mm00444423_m1 ) Atp12a ( Mm0131809_m1 ) Atp6v1b1 ( Mm00460320_g1 ) Atp6v0a4 ( Mm00459882_m1 ) Slc4a1 ( Mm00441492_m1 ) Slc26a4 ( Mm00442308_m1 ) Rhbg ( Mm00491234_m1 ) Rhcg ( Mm00451199_m1 ) Slc9a3 ( Mm01352473_m1 ) Slc9a2 ( Mm01237129_m1 ), Scnn1a ( Mm00803386_m1) Scnn1b (Mm00441215_m1) Scnn1g ( Mm00441228_m1 ), and Actb ( Mm00607939_s1) The 2X TaqMan Universal PCR Mix No AmpErase Ung, a 20X primer/probe set (see above), and 20 ng cDNA were used in a 25 L real time PCR reaction. The reaction was run in an Applied Biosystems 7500 Real Time PCR machine using the following cycle parameters: 1 cycle of 95 C for 10 min and 40 cycles of 95 C for 15 s and 60 C for 1 min. Each probe for every sample was run in duplicate. For qPCR of microRNA, the TaqMan MicroRNA Assays (Applied Biosystems) were used (as described previously) The 20X probe/primer set for

PAGE 72

72 mmu mir 505 or snoRNA 202, 2X TaqMan Universal PCR Mix No AmpErase Ung, and 1:15 dilution of microRNA cDNA product were mixed and run in duplicate. Th e c ycle threshold (Ct) method was used to determine relative expression. Ct values were normalized to the endogenous control gene, Act b for gene expression assays or snoRNA 202 for microRNA assays. The Ct was calculated by subtraction of each individ ual Ct ( experimental gene Ct endogenous gene Ct of each sample ) from the average Ct of the control samples. R elative fold change in expression was calculated using 2 Ct The fold change for control samples (c ontrol cortex, or WT ) is expressed as 1 o r 100% Protein Total Protein Extraction Ethanol was added to the o rganic layer reserved from RNA extraction to precipitate DNA. The sample was gently mixed and incubated at room temperature for 3 min. The sample was centrifuged at 2000 x g for 5 min at 4 C and the supernatant placed in a fresh tube. Protein was precipitated by the addition of isopropanol and incubation at room temperature for 10 min. The protein was pelleted by centrifugation at 12,000 x g for 10 min at 4 C. After removal of the supernatan t, the protein pellet was washed in 0.3 M guanidine HCl in 95% ethanol. The pellet was sonicated at 50% amplitude for < 10 s and incubated at room temperature for 20 min. The protein was repelleted by centrifugation at 7500 x g for 5 min at 4 C. The supern atant was removed and the pellet was washed 4 more times. After the last guanidine wash, the pellet was washed and sonicated twice in 95% ethanol. At the end of the washes, the pellet was allowed to air dry for 5 10 min. The protein was dissolved in 5% SDS and sonicated at 10% amplitude for 5 s. The sample was froze n overnight. After thawing, the sample was

PAGE 73

73 boiled for 5 min and centrifuged at 10,000 x g for 10 min to remove insoluble material. The supernatant was aliquoted and frozen at 80 C. Membrane Protein Extraction For membrane protein, frozen tissue was dissected and immediately dounced in a glass homogenizer in solution A (10 mM Tris pH 7.4, 1 mM EDTA, 50 mM sucrose with 0. 1 mg/ml Sigma protease inhibitor cocktail). After homogenization, an equal volume of solution B (10 mM Tris pH 7.4, 1 mM EDTA, 250 mM sucrose with 0. 1 mg/ml Sigma protease inhibitor cocktail) was added and gently mixed with homogenate. The sample was centrifuged at 1000 x g for 5 min at 4 C to remove nuclei. The supernatant was centrifuged twice more at 10,000 x g for 20 min at 4 C to remove organelles. The remaining supernatant was centrifuged at 37,000 rpm overnight at 4 C in the Ti70.1 rotor of a Beckman ultracentrifuge. The membrane pellet was gently dissolved in solution B without protease inhibitors and subsequently stored at 80 C. Bicinchoninic acid ( BCA ) Assay Both total protein and membrane protein concentration were determined by BCA assay (Thermo Scientific Pierce). Bovine serum albumin standard (2 mg/ml) was diluted over a range of 0.1 to 1.6 mg/m L Samples were diluted as appropriate. The standards and samples (10 L ) were run in triplicate. The standards and samples were pipetted into a 96 well clear plate and 200 L of the reaction solution ( 50 parts solution A to 1 part solution B ) were added to each well. The plate was covered with foil to protect from the light and incubated at 37 C for ~ 10 min. The absorbance at 540 nm was read on a plate reader (SpectraMax M5 Molecular Devices ). A standard curve was generated from the absorbance of the bovine serum albumin standards and used to calculate the sample protein concentration.

PAGE 74

74 W estern Blot Analysis Proteins (25 to 50 g) were denatured at 95 C for 10 min in lithium dodecyl sulfate sample buffer (NuPage LDS Sample Buffer, Invitrogen) with 5% 2 mercaptoethanol. The protein samples and protein ladder (Dual Color Precision Plus Protein Standard, Bio Rad) were loaded onto a 4 20% gradient or 7.5% Tris HCl polyacrilamide gel (Ready Gel, Bio Rad) in Tris glycine S DS buffer. The gels were run at 50 V until the ladder cleared the stacking gel then at 100 120 V until dye front reached the bottom of the gel. The proteins were transferred to polyvinylidene fluoride membranes in tris glycine methanol at 50 V for 3 hr at 4 C. The transferred proteins were washed in tris buffered saline (TBS) for 5 min then blocked in 2% Rodeo blocker (USB) in TBS with 0.05% Saddle Soap (USB) (TBS S) for 1 hr at room temperature. The membrane was incubated overnight in primary antibody (T able 2 2) diluted in blocking buffer. The membrane was washed twice in TBS S for 10 min each and incubated in secondary antibody (Table 2 2) for 1 hr at room temperature. The membrane was washed again in TBS S three times for 10 min each and rinsed in TBS. The membrane was incubated in Rodeo electrochemiluminescence reagent (USB) for 5 min. For detection, two methods were employed. The membrane was exposed to x ray film which was developed in a x ray developer or chemiluminescent light on the membrane was detected by a digital camera (Kodak 4000M). The detection time was dependent upon the protein amount and primary antibody used. To reprobe the same blot with a different primary antibody, the blot was incubated in stripping solution ( 2% SDS, 100 mM 2 merca ptoethanol 62.5 mM Tris (pH 6.7)) for 30 min at 70 C. The blots were washed in TBS twice for 5 min and then reblocked and probed as per above protocol.

PAGE 75

75 To compare expression between genotypes, d ensitometric values for each band detected with each primary antibody were measured using the Un Scan It Gel Analysis software (Silk Scientific). The densitometric valu es obtained for a band detected with an experimental primary antibody (anti ENaC and anti ENaC) were divided by the values obtained for the loading control primary antibody ( anti actin) to correct for protein loading differences between samples The percent differences in the corrected values were compared between WT (set at 100%) and knockout mice. E nzyme Immunoassay (EIA) The Aldosterone and AVP EIA Kits (Cayman Chemical) were used to determine urine concentrations of aldosterone and AVP. These kits utilize competitive binding of the hormone in a sample (or standard) and a hormone conjugated to acetylcholinesterase (tracer) to a hormone specific primary antibody. The bound antibody and hormone will bind to secondary antibody bound to the provide d 96 well plate. and the absorbance (yellow) is read at 410 nm. The concentr ation of hormone in the sample is therefore inversely proportional to the detected tracer. For aldosterone, the standards are diluted over a range of 7.8 to 1 000 pg/ml and, for vasopressin, 23.4 to 1500 pg/ml. The standards and samples are diluted in a pro vided EIA buffer and run in duplicate or triplicate. Several other controls include blank, non specific binding ( NSB, EIA buffer only ), binding maximum ( B o tracer and antibody) and total activity (tracer at development). The controls, standards, and samp les (50 L ) were pipetted onto the provided 96 well plate. Tracer and then antibody (50 L ) were added to all standards and samples and to the B o wells. The plate was covered with film and incubated at 4 C overnight. The plate was washe d 5 times with EIA w ash buffer and

PAGE 76

76 (200 L ) was added to each well. The plate was covered with plastic film and developed in the dark for 1.5 hr with shaking at 200 rpm. The absorbance at 410 nm was read on a plate reader (SpectraMax M5, Molecular Devices). T he NSB absorbance was subtracted from B o to correct the B o absorbance values. The % binding (B) of samples and standards is determined by B/B o and used to create the standard curve. The equation, logit(B/B o )=ln[B/B o /(1 B/B o )] was first used to linearize the data The resultant logit values were plotted versus log concentration and a linear regression was performed. The standard curve is used to calculate concentration of each sample. In Silico Sequence Analyses Promoter Analysis The proximal 2000 bp promoter region of Atp4a and Atp12a were downloaded from the NCBI website ( www.ncbi.nlm.nih.gov ). The mRNA and genomic DNA sequences for each gene were aligned using NCBI basic local alignmen t search tool (BLAST). The alignment provided the exact position of the transcription start site in the genomic DNA for each gene. This information was used to extract 2000 bp upstream of the transcription start site within the genomic DNA sequence. The pr omoter sequence was then run through two online software programs, Transcription Element Search Software (TESS, www.cbil.upenn.edu/cgi bin/tess/tess ) and Transcription Factor (TF) Search ( www.cbrc.jp/research/db/TFSEARCH.html ) that detect putative transcription factor binding sites by two different algorithms. Percent match was set at 75%. MicroRNA Target Analysis Putative microRNA bind (UTR) of Atp4a and Atp12a The sequences were extracted and binding sites determined by the software program, TargetScanMouse, www.targetscan.org Only

PAGE 77

77 conser ved sites and those with high context score percentiles were considered as potential binding sites. Statistical Analyses Origin 8 and SigmaPlot 11 were used for statistical analyses. Origin 8, Adobe Photoshop, and Paint.Net were used to create graphs and figures. All data are represented as mean standard error of the mean (SEM). Two t Test was used to compare two different groups. A one way analysis of variance (ANOVA) with or without repeated measures was used to compare three or more g roups with one effect. Two way ANOVA with or without re peated measures was performed to compare two effects such as genotype, diet, treatment, and time. If significance was found, then an appropriate post hoc test was performed. P values less than 0.05 wer e considered significant.

PAGE 78

78 Table 2 1. Primer s equences Primer n ame T m (C) Use 1 F GCCTGTCACTGACAGCAAAGAGG 64 Genotyping 1 R GGTCTTCTGTGGTGTCCGCC 64 Genotyping 2 F CTGGAATGGACAGGCTCAACG 64 Genotyping 2 R GTACCTGAAGAGCCCCTGCTG 63 Genotyping Neo CTGACTAGGGGAGGAGTAGAAGG 58 Genotyping MMG15 GTTCCTGATGCTGTGCTCAA 59 RT PCR MMG16 TCGAGCAAACACCATCTCAG 59 RT PCR MMG17 GCCATACTTGTCCTGGTCGT 59 RT PCR MMG18 CTGAAGCCAAGGAGGCTATG 59 RT PCR GAPDHF AGACACGATGGTGAAGGTCGGAGTGAAC 71 RT PCR GAPDHR GTGGCACTGTTGAAGTCGCAGGAG 68 RT PCR T m denotes melting temperature. Table 2 2. Antibodies Antibody n ame Supplier Dilution Rabbit polyclonal anti ENaC Ecelbarger 1:1000 Rabbit polyclonal anti ENaC Ecelbarger 1:1000 Rabbit polyclonal anti H + ATPase B1/B2 Santa Cruz, sc 20943 1:250 Goat polyclonal anti actin Santa Cruz, sc 1616 1:500 Anti rabbit IgG HRP conjugate USB, Rodeo ECL kit 1:5000 Donkey anti goat HRP conjugate Santa Cruz, sc 2020 1:5000

PAGE 79

79 Figure 2 1. Representative genotyping PCR gel. Triplex PCR was used to amplify genomic DNA for HK 1 ( Atp4a ) and HK 2 ( Atp12a ) from tail snips of WT, HK 1 / and HK 1,2 / mice. The WT band for HK 1 runs at 189 bp and for HK 2 runs at 117 bp. The knockout band for HK 1 runs at 310 bp and for HK 2 runs at 307 bp. NT denotes no template control.

PAGE 80

80 CHAPTER 3 EFFECT OF MINERALOCO RTICOIDS ON RENAL H + ,K + ATPASES Chronic m ineralocorticoid excess cause s hypokalemia and metabolic alkalosis. 25, 27, 223 The mechanism responsible for mineralocorticoid induced metabolic alkalosis is through increased urinary acidification particularly by the renal collecting duct 36 I t is known that m ineralocorticoids stimulate H + secretion by A type ICs of the renal collecting duc t in part through a pical H + ATPases 38, 224 Although there is not significant evidence that mineralocorticoids directly regulate renal H + ,K + ATPase s, it is possible that mineralocorticoid induced hypokalemia secondarily activates renal H + ,K + ATPase s. Since a study has shown that H + ,K + ATPase s are required for ENaC mediated Na + reabsorption in the colon, 219 it is also possible that the renal H + ,K + ATPase s are required for the mineralocorticoid stimulation of renal ENaC mediated Na + retention. I n this study, the chronic effects of mineralocorticoids on renal H + ,K + ATPase s were investigated in cell culture and animal models To induce chronic mineralocorticoid excess, we treated mice with a one time i.m. injection of DOCP an ester analog of the mineralocortic oid, desoxycorticosterone. DOCP has long lasting (~25 30 days) action resulting from esterase cleavage in muscle to desoxycorticosterone T his drug is clinically use d for t 225 227 One week past DOCP treatment, mice have been shown to display increased blood pressure and hypokalemia with slight metabolic alkalosis 118 In the present study, t he timings of DOCP induced disturbances in body weight, Na + K + and acid base homeostasis in mice were determined and correlated with renal The data contained within this chapter have been previously published. Greenlee MM, Lynch IJ, Gumz ML, Cain BD, Wingo CS: Mineralocorticoids stimulate the activity and expression of renal H + ,K + ATPases. J Am Soc Nephrol 2011

PAGE 81

81 HK In a separate experiment, we ex amined the effect of a high K + diet to abolish the effect of DOCP on blood [K + ] and HK The effect of chronic aldosterone exposure (7 days) on subunit expression was also investigated using the in vitro OMCD1 c ell line that is kno wn to possess H + ,K + ATPase activity. 222 Finally, our study compared the physiological (systemic, renal, and gastrointestinal) r esponse s of WT, 1 / and 1,2 / to DOCP treatment Results Mineralocorticoid Excess in WT Mice The first goal of these studies was to characterize the temporal changes in body weight, Na + K + and acid base homeostasis during chronic mineralocor ticoid excess in WT mice and to relate these changes to mRNA expression of renal H + ,K + ATPases. The second goal was to evaluate whether a high K + diet abolished the physiological effect of mineralocorticoids in WT mice and suppressed changes in renal H + ,K + ATPase expression. Body weight and blood chemistries were measured over an 8 days in control and DOCP treated female WT mice DOCP treatment caused a considerable increase in body weight apparent by day 4 but control mice exhibited no significant change in body weight over this time period (Table 3 1) The minor body weight gain observed in control mice is consistent with normal growth in these young animals. The extra body weight gain in DOCP treated mice is consistent with the known effect of DOCP to enhance Na + and fluid volume retention. By day 4 DOCP treatment caused a slight, but statistically significant increase in blood [Na + ] and this effect started to decline by day 8 (Table 3 2). Moreover, DOCP treatment caused a considerable reduction in blood [K + ] that was statistically significant

PAGE 82

82 at day 6 after treatment B lood [HCO 3 ] was significantly increased by day 8 after DOC P treatment The timing and magnitude of increased blood [HCO 3 ] were reflected in a reciprocal decrease in blood [Cl ] by approximately 7mM. To examine the contribution of hypokalemia to the physiological effects of DOCP body weight change and blood chemistries were compared in control and DOCP treated WT mice fed a high K + diet. A high K + diet abrogated the effect of DOCP on body weight gain (Table 3 3). The high K + fed mice did not display a reduction in blood [K + ] with DOCP treatment. Gr eater blood [HCO 3 ] and a reciprocal lower blood [Cl ] were also not apparent in DOCP treated mice fed a high K + diet Induction of Renal HK 2 Expression It is possible that up regulation of HK subunit mRNA occur s as a secondary response to DOCP induced hypokalemia. Therefore, the next experiments evaluated the effect of DOCP treatment (8 days) 1 2 mRNA expression in mice fed a normal diet and whether these effects were altered by a high K + diet or by time RT and r eal time q PCR w ere used to investigate changes in steady state mRNA levels of H + ,K + 1 2 in cortex, outer medulla, and inner medulla of control and DOCP treated (8 days) mice fed a normal diet In control mice, the relative expression of 1 2 differed between the three kidney segments (Fi gure 3 1 ) Expression for both subunits was greatest in the cortex followed by the outer then inner medulla (Figure 3 1 A and B ) 1 was more highly expressed than 2 in each segment (Figure 3 1 C ) Figures 3 2 and 3 3 and DOCP treated mice as detected by RT PCR and real time PCR, respectively

PAGE 83

83 Neither 1 nor 2 mRNA expression in the renal cortex w ere significantly changed in DOCP treated mice compared to control ( Figure 3 3 A and B ) In the outer medulla, DOCP did not affect 1 mRNA expression but increase d 2 expression ~ 2 fold. DOCP also did not significantly affect H 1 mRNA expression in the inner medulla (Figure 3 2 and 3 3 A ) In contrast DOCP dramatically stimulated 2 mRNA levels in the inner medulla by ~ 5 fold compared to control levels (Figure 3 2 and 3 3 B) main effect was to increase 2 mRNA expression in the medulla. 2 expression were secondary to DOCP 1 2 mRNA expression levels were compared in control and DOCP treated (8 days) mice fed a high K + diet (Figure 3 3 C and D respectively) T he DOCP induced stimulation of H 2 mRNA expression in the renal medulla was absent in mice fed a high K + diet (Figure 3 3 D). These results demonstrate that the stimulation of medullary H + ,K + tre atment is dependent on dietary K + intake and possibly DOCP induced hypokalemia Since b lood [HCO 3 ] was not significantly increased by day 6 after DOCP ( Table 3 1) w e hypothesized that the increased HK 2 subuni t mRNA expression observed by DOCP day 8 would be absent at day 6 after treatment Figure 3 4 shows relative mRNA expression for 1 and 2 in cortex, outer medulla, and inner medulla of control and DOCP treated mice (day 6) Medullary 1 mRNA expression was significantly increased ~1.5 fol d by day 6 after DOCP treatment (Figure 3 4 A). In contrast, DOCP did not increase m edullary 2 mRNA expression by this time point and there was actually less cortical expression than in control mice (Figure 3 4B) These results are consistent with our hypothesis that renal HK 2 expression would not be increased by

PAGE 84

84 day 6 after DOCP treatment O ur results did show that DOCP induces HK 1 mRNA expression at earlier time points and suggests that both the HK 1 and HK 2 containing H + ,K + ATPases may be involved in the physiological effects of DOCP, just at different times. Aldosterone Treatment in OMCD1 Cells The next experiments sought to determine if an in vitro collecting duct cell model replicated the effect of chronic mineralocorti coids on HK 2 expression. If so, then this model could be used to study the molecular mechanism(s) by which mineralocorticoids increase H + ,K + ATPase subunit expression and activity. OMCD1 cells, which are an immortal cell line derived from cells in the o uter medullary collecting duct, have previously been shown to possess S CH 28080 sensitive H + secretion indicative of an H + ,K + ATPase 88 PCR analysis of HK 1 mRNA expression demonstrated no significant difference between OMCD1 cells treated with vehicle (ethanol) or 1 M aldosterone for seven days (Figure 3 5) HK 2 mRNA was undetectable in OMCD1 cells. The lack of HK 2 expression in these cells does not make them a good model to study the effect of mineralocorticoids on renal H + ,K + ATPases. Mineralocorticoid Excess in HK Null Mice The final set of experiments considered the physiological function of renal H + ,K + ATPases in the response to chronic mineralocort icoid excess and specifically characterized the effect of DOCP treatment on the electrolyte and acid base 1 / and 1, 2 / mice Body weight change and blood chemistries were first compared in untreated WT and knockout mice. No significant change in body weight was observed in untreated mice of any genotype over eight days (Figure 3 6) Blood [K + ] was paradoxically greater

PAGE 85

85 1,2 / compared to WT 1 / mice (Table 3 4) Blood [Cl ] was less in 1 / compare d to either the WT 1,2 / mice. Blood [Na + ] and [HCO 3 ] w ere similar between the genotypes. DOCP induced body weight gain over 8 days was comparable in WT 1,2 / mice (Figure 3 7 A). In contrast, 1 / mice exhibited nearly twice the body w eight gain of WT mice with DOCP treatment. By day 8 after DOCP treatment, b lood [Na + ] was similar between the genotype s (Figure 3 7 B ). Although DOCP reduced blood [K + ] ~1 mM in mice from all the 1,2 / mice still exhibited greater blood [K + ] than WT 1 / mice (Figure 3 7 C). The effect of DOCP to decrease blood [Cl ] (Figure 3 7 D) and increase blood [HCO 3 ] (Figure 3 7 E) in WT mice 1,2 / mice but not in 1 / mice In order to more fully understand the mechanism for the observed differences in body weight gain and blood electrolytes between WT an volume H 2 O intake urinary Na + and urinary K + retention were compared over the time course (8 days) of DOCP treatment. Urine electrolyte (Na + or K + ) retention was calculated as dietary intake minus urinary excretion of th at electrolyte. Urine volume doubled by the end of DOCP treatment in both WT 1,2 / mice (Figure 3 8 A). However, uri ne volume did not inc rease in DOCP treated 1 / mice. Urine volume was significantly reduced from day 7 to day 8 after DOCP treatment in 1 / mice However, H 2 O intake was quite similar between the genotypes over most of the time course (Figure 3 8 B). Nevertheless, o n DOCP day 8 1 / mice exhibited a considerable reduction in H 2 O intake that correlates with their decreased urine volume.

PAGE 86

86 1,2 / retained significantly less urinary Na + than WT o 1 / mice (Figure 3 8 C ). In the comparison of day 8 of DOCP treatment to control urinary Na + 1 / mice exhibited a greater stimulation of urinary Na + retention than WT mice (Figure 3 8 D ). The greater urinary Na + retention of 1 / mice on DOCP day 8 is consistent with their decreased urine volume on that day. No significant differences in urinary K + retention between the genotypes were observed over the time course of DOCP treatment except at day 8 (Figure 3 8 E). At DOCP day 8 ur inary K + like Na + 1 / mice than either WT 1,2 / mice (Figure 3 8 F). Al though the mice were pair fed a nalysis of stool samples from WT 1 / and 1,2 / 1 / mice excreted 50% more dry stool weight than either the WT 1,2 / mice on day 8 of DOCP treatment (Figure 3 9 A). Fecal Na + excretion significantly decreased in DOCP treated WT 1,2 / mice (Figure 3 9 B). In contrast, D OCP 1 / mic e exhibited greater fecal Na + excretion than WT or 1,2 / mice. Interestingly, fecal K + 1 / 1,2 / mice under control conditions (Figure 3 9 C). Fecal K + excretion decreased in WT mice treated with DOCP but increased ~50% in DOCP treated 1 / 1,2 / mice (Figure 3 9 C). In the context of whole animal physiology, it is important to examine the overall electrolyte balance as the sum of urinary and fecal excretion subtracted from the intake of that electrolyte. Overall Na + and K + balance were compared under control conditions and on day 8 of DOCP treatment. Na + balance w as not sig nificantly different between the genotypes under contro l conditions (Figure 3 10 A ). As expected, Na + balance was

PAGE 87

87 greater in WT mice with DOCP treatment compared to control conditions A similar effect was observed in 1 / mice In contrast, Na + balance was significantly less in DOCP treated 1,2 / mice than either WT 1 / mice. Un der control conditions, WT, 1 / and mice 1,2 / mice had similar K + balance (Figure 3 10 B). DOCP treatment caused H 1 / mice to exhibit greater K + balance than WT. 1,2 / mice exhibited lower K + balance (~40% less) than WT mice with DOCP treatment (Figure 3 10 B). Discussion These studies revealed that the long acting mineralocorticoid, DOCP caused hypokalemia and metabo lic alkalosis ~ 8 days after administration to mice DOCP induced metabolic alkalosis correlated with increased renal medullary 2 mRNA expression and a high K + diet abrogated this effect. The overall deficit in K + retention and resistance to metabolic alkalosis of DOCP 1,2 / mice and the lack of th is deficit in 1 / mice suggests the importance of 2 containing H + ,K + ATPases to mediate greater K + reabsorption and H + secretion with mineralocorticoid excess. N otably the elimination of DOCP induced urinary Na + 1,2 / mice also implies that the renal 2 containing H + ,K + ATPases are important for mineralocorticoid induced Na + retention Previous transcription factor analysis of mouse Atp12a ( HK 2 ) promoter detected one potential HRE within 1500 bp of the transcription sta rt site indicating that at least the HK 2 containing H + ,K + ATPases were potential MR targets 166 In contrast a putative HRE was not detected in the rabbit Atp12a promoter. 228 Figure 3 11 depicts our own analysis of putative HREs in Atp4a (HK 1 ) and Atp12a (HK 2 ) promoters. The criteria for identification of putative HREs included detecti on by both TESS and TF Search

PAGE 88

88 software programs. Both algorithms detected two putative HRE half sites (75% match) in the Atp4a and Atp12a promoters and the position, direction, and sequence of these prospective sites are shown in Figure 3 11. The two sites in the Atp12a promoter most closely resemble the HRE half site consensus sequence (AGAACA). These sites do not possess a clear, canonical inverted palindrome (AGAACAnnnTGTTCT) that is expected for HREs. Therefore, t he HK Atp4a and Atp12a are likely not early, genomic targets of mineralocorticoid action. Consistent with this conclusion, our results have shown that DOCP requires 8 days to induce metabolic alkalosis and an increase in medullary HK 2 mRNA expression in mice T he effect of long term mineralocorticoid excess to change renal H + ,K + ATPase activity has been previously examined 41 Although no effect of the mineralocorticoid aldosterone, was observed within th at study H + ,K + ATPase activity was measured as S CH 28080 sensitive This inhibitor primarily targets 1 containing H + ,K + ATPase s and has little if any effect on 2 containing H + ,K + ATPases 229 Thus, the effect of miner alocorticoids 2 containing H + ,K + ATPases was not investigat ed in that study Our observations that DOCP treatment dramatic ally augment s 2 mRNA expression in the renal medulla of mice in a dietary K + dependent manner suggests that mineralocorticoid 2 containing H + ,K + ATPases primarily as a secondary response to alterations of blood [ K + ] I n contrast to in vivo studies, chronic mineralocorticoid treatment of in vitro cell models would not affect extracellular [K + ] This may be the reason why chronic aldosterone treatment of OMCD1 cells did not affect 2 mRNA expression Overall, these results su bstantiate the con clusion that

PAGE 89

89 mineralocorticoids secondarily 2 containing H + ,K + ATPases to mediate K + reabsorption/conservati on. The increase in renal medullary 2 subunit expression in the kidney coincided with an increase in blood [HCO 3 ] in DOCP treated WT mice. The similar time course of these two events suggests that H + ,K + ATPase mediated H + secretion is responsible for a significant portion of the increase in blood [HCO 3 ] with mineralocorticoid excess. Most importantly, in contrast to WT and 1 / mice DOCP treatment did not significantly increase blood [HCO 3 1,2 / mice. T hese data strongly support the hypothesis 2 containing H + ,K + ATPases mediate the development of mineralocorticoid induced alkalosis. Excessive body weight gain and urinary Na + retention in DOCP 1 / 1,2 / mice sugges ts that the mineralocorticoid sensitive component of urinary Na + 2 containing H + ,K + ATPases. Precedent for such a conclusion is supported by evidence from Spicer et al 219 showing that colonic ENaC activity is dependent on 2 containing H + ,K + ATPases. In that study the colons of 2 / mice exhibited reduced colonic amiloride sensitive (ENaC mediated) short circuit current comp ared to WT mice on a normal and dietary Na + restrict ed diet Therefore, i t is possible that urinary Na + loss in DOCP treated 1,2 / mice results from insufficient mineralocorticoid stimulation of renal ENaC mediated Na + reabsorption. Also, the excessive urinary K + and Na + retention observed in DOCP treated 1 / mice and its elimination in the 1,2 / mice is consistent with a compensatory up 2 containing H + ,K + ATPases in 1 / mice. This compensatory

PAGE 90

90 increase would cause greater Na + and fluid retention with mineralocorticoid excess This effect may have deleterious consequences for blood pressure regulation in 1 / mice The results of these studies provide evidence for an important role of the H + ,K + ATPases in mineralocorticoid mediated effects on K + acid base, and Na + balance. Future investigation into the mechanism(s) by which the renal H + ,K + ATPases contribute to Na + and fluid balance promises to shed important light on the pathogenesis of mineralocorticoid hypertension.

PAGE 91

91 Table 3 1. B ody w eight change (%) in c ontrol and DOCP t reated WT m ice Day 0 Day 2 Day 4 Day 6 Day 8 Control (N =7) 0 0 1.2 0.68 1.1 1.5 3.2 1.4 3.0 1.8 DOCP (N =7) 0 0 0. 1 1.2 0 2.0 1.2 5.4 1.4 a,b 6.1 1.2 a,b Data were analyzed by two way ANOVA with repeated measures. a denotes P<0.05 versus D ay 2 and b versus D ay 4 within the same treatment group Table 3 2 Blood a nalysis of DOCP t reatment in WT m ice Control (N=13 14) Day 2 (N=3 4) Day 4 (N=4) Day 6 (N=3) Day 8 (N=3) [Na + ] (mM) 148.0 0.41 150.0 1.30 153 .0 1.8 0 a 153 .0 0.80 a 150 .0 0.41 [K + ] (mM) 3.9 0.08 3.5 0.12 3.5 0.17 2.9 0.21 a 2.8 0.07 a,b [Cl ] (mM) 118.0 0.51 120.0 1.80 116 .0 0.95 117 .0 0.35 111 .0 0.82 a,b,c,d [HCO 3 ] (mM) 18.0 0.51 19.0 0.87 20 .0 1.2 0 20 .0 0.53 23 .0 2.0 0 a Data were analyzed by one way ANOVA. Day indicates number of days after DOCP treatment. a denotes P<0.05 versus C ontrol b versus D ay 2 c versus Day 4 and d versus D ay 6. Table 3 3 Physiological response to h igh K + (5%) diet and DOCP (day 8) in WT mice Control (N =4) DOCP (N =4) Body weight change (% ) 2 0 0. 42 0. 9 1.38 Blood [Na + ] (mM) 149 .0 0.99 151 .0 0.88 Blood [K + ] (mM) 4.3 0.06 4.3 0.18 Blood [Cl ] (mM) 119 .0 0.45 121 .0 1.30 Blood [HCO 3 ] (mM) 17.3 0.64 18.2 1.01 Data t test. Table 3 4 Differences in blood chemistry of WT on a normal diet WT (N=13 14) 1 / (N=5) 1,2 / (N=9) Blood [Na + ] (mM) 148 .0 0.41 149 .0 1.1 148 .0 0.58 Blood [K + ] (mM) 3.9 0.08 3.9 0.1 4.4 0.17 Blood [Cl ] (mM) 118 .0 0.51 114 .0 1.3 116 .0 0.91 Blood [HCO 3 ] (mM) 18 .0 0.51 21 .0 1.2 19 .0 0.69 Data were analyzed by one way ANOVA. denotes P<0.05 versus WT.

PAGE 92

92 Figure 3 1 1 2 differs in mouse kidney. Real time PCR was performed to quantify relative mRNA expression for A) 1 and B) 2 in cortex, outer medulla, and inner medulla of mice on a normal diet. C) 2 expression was compared to 1 expression in each kidney segment. Ex actin. Fold changes (2 Ct ) in expression were calculated and set to %, with cortical (A and B) 1 (C) expression set at 100%. Data are presented as mean SEM and analyzed by one way ANOVA. P<0.05 compared to 1 and ** compared to outer medulla ; N = 6

PAGE 93

93 Figure 3 2 DOCP stimulated medullary HK expression in mice. Reverse transcriptase PCR (37 cycles) was used to amplify cDNA transcripts 1 (282 bp) 2 (471 bp) subunits in cortex, outer medulla, and inner medulla of control and DOCP treated mice. PCR amplification of GAPDH (871 bp; 30 cycles) was used as loading control.

PAGE 94

94 Figure 3 3 DOCP induced medullary HK 2 expression in a K + dependent manner. Real time PCR was performed to quantify relative mRNA expression for A) 1 and B) 2 in cortex, outer medulla, and inner medulla of control mice and those treated with DOCP for eight days on a normal diet. Relative mRNA expression was also determined for C) 1 and D) 2 in cortex, outer medulla, and inner medulla of control and DOCP treated mice on a high K + actin. Fold changes (2 Ct ) in expression were calculated and set to %, with control set at 100%. Data are presented as mean SEM and expression with DOCP treatment was compared to con t test. P<0.05 compared to contr ol; N=7 10 for normal diet and N =4 for high K + diet.

PAGE 95

95 Figure 3 4 The effect of DOCP to alter HK subunit mRNA expression i s time dependent. Real time PCR was performed to quantify relative mRNA expression for A) 1 and B) 2 in cortex, outer medulla, and inner medulla of control and DOCP treated (day 6) mice fed a normal diet. actin. Fold changes (2 Ct ) in expression were calculated and set to %, with control set at 100%. Data are presented as mean SEM and expression with DOCP treatment was compared to control t test. P<0.05 compared to control; N = 4

PAGE 96

96 Figure 3 5 Chronic aldos terone treatment did not affect HK subunit expression in OMCD1 cells. R everse transcriptase PCR was used to amplify cDNA 1 (282 bp) 2 (471 bp) subunits in OMCD1 cells treated with vehicle (ethanol) or aldosterone ( Aldo, 1 M) daily for 7 days. designates genomic amplification.

PAGE 97

97 Figure 3 6. WT HK 1 / and HK 1,2 / mice had similar body weight gain over eight days on a normal diet. Body weight change (%) is shown as the difference from starting body weight (day zero). Dat a are shown as mean SEM and were analyzed by one way repeated measure ANOVA. N=5 7.

PAGE 98

98 Figure 3 7 Body weight and blood chemistries differ in DOCP treated WT 1 / and HK 1,2 / mice. All data shown are from the eighth day of DOCP treatment. A) Body weight change (%) is shown as the percent change in body weight from day zero. Arterial blood samples were collected from the aorta and B) blood [Na + ], C) [K + ], D) [HCO 3 ] and E) [Cl ], were measured on a clinical blood gas analyzer. Data are presented as mean SEM and were analyzed by one way ANOVA followed by post hoc Student Newman 1 / mice. N=10 11 WT and N=5 1 / and HK 1,2 / mice.

PAGE 99

99 Figure 3 8 DOCP treatment differentially altered urinary Na + and K + retention in WT mice. A) Urinary volume, B) H 2 O intake, and C D) urinary Na + and E F ) K + retention 1 / 1,2 / mice fro m the day preceding treatment (C on) and over an eigh t day period of DOCP treatment. Urinary electrolyte retention (Eq) was calculated as the urinary excretion per day subtracted from dietary intake on that day. All data were analyzed by a two way repeat ed measure ANOVA with post hoc Student Newman Keuls test and are shown as m ean SEM. a denotes P<0.05 versus WT and b versus 1 / mice on the same day c denotes P<0.05 versus WT and d versus 1 / mice over the entire time course e denotes P<0.05 versus 1 / 1,2 / N=5.

PAGE 100

100 Figure 3 8. Continued

PAGE 101

101 Figure 3 9 Control and DOCP treated WT exhibited altered fecal electrolyte excretion. A) Fecal output, B) Na + and C) K + excretion were measured in WT, 1 / 1,2 / mice on the day preceding treatment (control) and on day eight of DOCP treatment. Data are shown as mean SEM. and were analyzed by two way repeated measure ANOVA with post hoc Student Newman Keuls test. a denotes P<0.05 versus WT and b versus 1 / mi ce on the same day. e denotes P<0.05 versus control in the same genotype. WT, N=11; 1 / N=4; 1 ,2 / N=5 6.

PAGE 102

102 Figure 3 10 DOCP treatment. Overall A) Na + and B) K + balance (E q) are shown for WT 1 / 1,2 / mice on the day preceding treatment (control) and on day eight of DOCP treatment. Overall electrolyte balance was calculated as the sum of urinary and fecal excretion subtracted from dietary intake. Data are show n as mean SEM and were analyzed by two way repeated measure ANOVA with post hoc Student Newman Keuls test or one way repeated measure ANOVA with post hoc Tukey test a denotes P<0.05 versus WT and b versus 1 / mice on the same day. e denotes P< 0.05 versus control in the same genotype.. WT, N=10; 1 / N=4; 1 ,2 / N=5.

PAGE 103

103 Figure 3 1 1. Putative HRE half sites are present in Atp4a and Atp12a promoters. Two separate transcription factor binding algorithms (TESS and TF Search) were used to de tect prospective HRE half sites in the Atp4a and Atp12a promoters. Zero bp indicates the transcription start site. Blue arrows represent potential binding direction.

PAGE 104

104 CHAPTER 4 DIETARY POTASSIUM DE MICE Our previous study demonstrated that the mineralocorticoid DOCP, chronically stimulates renal HK 2 expression and a high K + diet abolishes this effect. Our observ ations also suggest that HK 2 containing H + ,K + ATPase s mediate the effects of DOCP to cause m etabolic alka losis and urinary N a + retention. Similar to the effect of DOCP, chronic low dietary K + intake causes hypokalemia and metabolic alkalosis. 230 L ow dietary K + is known to stimulate the activity of renal and colonic H + ,K + ATPase s suggesting their importance in K + conservation during this dietary challenge 133, 135, 231 2 mRNA and protein expression are specifically and dramatically increase d with dietary K + deple tion in both the kidney and colon 181, 187, 232, 233 One study has reported 1 mRNA expression also increases with dietary K + depletion 190 2 / mice exhibit severe hypokalemia with dietary K + restriction, indicating that HK 2 containing H + ,K + ATPase s are physiologically important for K + conservation 218 However, this effect of dietary K + depletion in HK 2 / mice is a result of fecal, not urinary, K + loss. Chronic low dietary K + intake also causes urinary Na + retention similar to mineralocorticoids 221, 234 It is plausible then that the renal H + ,K + ATPases are responsible for K + depletion induced urinary Na + retention However, 2 / mice do not exhibit altered urinary or fecal Na + excretion when fed a K + depleted diet 218 Nevertheless, the marked increase in urinary Na + retention observed with dietary K + depletion may well involve both the 1 a 2 containing H + ,K + ATPases T he single knockout may not be in sufficient to elicit a significant renal phenotype.

PAGE 105

105 With dietary K + depletion, the increased H + ,K + ATPase activity would not only result in K + reabsorption but also H + secretion. Therefore the renal H + ,K + ATPases may be the mechanism responsible for greater distal nephron H + secretion 235 and resultant metabolic alkalosis of dietary K + depletion 230 Renal H + ,K + ATPases may also be the mechanism responsible for the exacerbated urinary acidification and dramatic metabolic alkalosis of dietary K + restriction combined with mineralocorticoid excess 236, 237 Nonetheless 2 / mice do not display any abnormality in plasma acid base parameters when fed a low K + diet 218 Experiments performed in 2 / mice suggest that renal 2 containing H + ,K + ATPases are not alone required for urinary K + conservation, the development of metabolic alkalosis, or th e stimulation of urinary Na + retention observed with dietary K + depletion. T he remaining HK 1 subunit in the 2 / mice may maintain normal renal K + Na + and H + handling For that reason, we investigated whether 1 / or 1,2 / mice displayed dysfunctional urinary K + Na + and acid base handling with dietary K + depletion 1 / or 1,2 / mice displayed altered systemic Na + K + and acid base balance with combined dietary K + depletion and DOCP treatment Results Dietary K + Depletion in HK Null Mice Prev ious studies have demonstrated a dramatic loss of body weight in the dietary K + depleted 2 / mice 218 1 2 then 1,2 / mice would be expected to display exacerbated body weight loss with dietary K + depletion. C hanges in body weight in WT and 1,2 / fed either a normal or K + deplete d diet were followed for 8 days (Figure 4 1) No significant differences in body

PAGE 106

106 weight change were observed between WT and 1,2 / mice on a normal gel diet for 8 days. F ood intake was not significantly different between WT and HK 1,2 / mice fed the normal gel diet ( 10.2 0.69 g versus 12.3 0.66 g respectively ). Dietary K + depletion caused an ~ 5% loss in body weight in WT mice. Body weight loss was two fold greater in 1,2 / mi ce The differences in body weight loss are comparable to previous 2 / mice 218 Decreased f ood intake did not account for this drop in body weight as WT and HK 1,2 / mice dis played similar food intake ( 11.5 0.82 g and 10.9 0.68 g, respectively). To assess the effect of H + ,K + ATPase knockout on K + homeostasis, blood [K + ] was measured in WT and 1,2 / mice fed either a normal or K + deplete d diet for 8 days. Blood [K + ] wa s similar in WT and 1,2 / mice fed a normal die t (Figure 4 2 A) Although dietary K + depletion led to hypokalemia in both WT and the double knockout mice, the reduction in blood [K + ] was an additional 1mM in 1,2 / mice In a separate experiment, we examined the effect of dietary K + depletion on blood [K + ] in 1 / mice In contrast to the results from 1,2 / mice, the drop in blood [K + ] in 1 / mice was not significantly different from that of WT mice (Table 4 1) We next det ermine d if the reduced blood [K + ] observed in 1 ,2 / mice resulted from urinary or fecal K + loss. Urinary K + retention was calculated as daily dietary K + intake minus the daily urinary K + excret ion. Urinary K + retention was identical in WT and 1,2 / mice provided a normal diet (Figure 4 2 B ). By day 8 of dietary K + depletion, both the WT and 1,2 / mice reduced urinary K + excretion to almost undetectable levels when measured with ion sensitive electrodes Therefore, we also measured urine

PAGE 107

107 [K + ] by flame photometer. Surprisingly, 1,2 / mice exhibited slightly greater urinary K + retention than WT mice on day 8 of dietary K + depletion (Figure 4 2 C ). F ecal K + wasting was quite apparent in 1 ,2 / mice (Figure 4 2 D ). 1,2 / mice excreted nearly 4 times more fecal K + than WT mice on a normal diet. Fecal K + output decreased with dietary K + depletion in both genotypes (Figure 4 2 D) but was still as much as 7 times greater in 1,2 / mice than WT mice by day 8 of K + depletion. T o determine whether H + ,K + ATPases are required for increased Na + and fluid retention with dietary K + depletion, urinary Na + retention and urine volume were compared between WT 1,2 / mice on day 8 of a normal or K + depleted diet. Urinary Na + retention was calculated as dietary Na + intake minus urinary Na + excretion. Dietary K + depletion stimulated urinary Na + retention to a similar extent in both WT and 1,2 / mice (Figure 4 3 A) However, urine volume was significantly more 1,2 / mice than in WT mice fed a normal or K + depleted diet (Figure 4 3B ). 1,2 / mice displayed excess urinary K + or Na + loss during the earlier stages of dietary K + depletion, urine K + and Na + retention were compared in pair 1,2 / mice given a normal diet for 4 days then switched to a K + depleted diet for 4 days. Urinary K + 1,2 / mice over the time course (Figure 4 4 A ) U rinary Na + retention was also similar between the genotypes (Figure 4 4 B) To test the hypothesis that renal H + ,K + ATPases mediate K + depletion induced metabolic alkalosis acid base homeostasis was compared in WT and 1,2 / mice during dietary K + depletion Blood [HCO 3 ] and net urinary acid excretion were measured in WT 1,2 / mice fed either a normal or K + deplete diet for 8 days.

PAGE 108

108 Blood [HCO 3 ] was similar in WT 1,2 / m ice when fed a normal diet (Figure 4 5 A ). Under normal dietary conditions, 1,2 / mice di splayed a surprisingly more acidic urine pH than WT mice (Figure 4 5 B 1,2 / mice excreted nearly twice the urinary NH 4 + and 60 tim es more urinary titratable acid than WT mice (Figure 4 5 C and D, respectively ) Net urinary acid excretion calculated as the sum of urinary NH 4 + and titratable acid excretion, was nearly 3 fold greater in 1,2 / mice compared to WT mice fed a normal diet (Figure 4 5 E ). Dietary K + depletion did not significantly affect blood [HCO 3 ] in WT 1,2 / mice ( Figure 4 5 A ). Urine alkalinized with dietary K + 1,2 / mice but not in WT mice (Figure 4 5 B ). Urine NH 4 + excretion increased and titratable acidity decreased in mice from both genotypes fed a K + deplete d diet (Figure 4 5 C and D respectively) However, t 1,2 / mice compared to WT Overall, net urinary acid excretion was not significantly different between K + depleted WT and double knockout mice (Figure 4 5 E ). To determine if the more acidic urine pH of 1,2 / mice under normal conditions 1 2 urine pH was measured in H 1 / mice fed 1,2 / 1 / mice exhibited a more a cidic urine pH than WT mice (Figure 4 6). 1 in mice results in enhanced urine acidification. Expression of Renal Acid Base Transporters in HK Null Mice The paradoxical augmentation of urinary acid excretion in HK 1,2 / mice warranted further examination of compensatory changes in acid base transport in the kidney. Therefore, we examined the mRNA expression levels of several renal acid base transporters using real time PCR. Expression levels of the majority of ac id base

PAGE 109

109 1,2 / mi ce compared to WT mice (Table 4 2 ). However, medullary mRNA expression of AE1 was ~ 30% greater 1,2 / mice Also, c ortical expression of NHE3 w as roughly 40% less 1,2 / mice compared to WT We assume that increased AE1 expression corresponds to greater AE1 mediated HCO 3 reabsorption in 1,2 / mice and i ncreased H + ATPase activity would be expected to accompany the stimulation of AE1 activity. However, we did not observe significantly increased H + ATPase B 1 or a 4 1,2 / mice (Table 4 2) Stimulation of H + ATPase activity appears to primarily occur via post translational mechanisms including trafficking to the plasma membrane Therefore, we also examined plasma membrane protein expression of H + ATPase B1/B2 in cortex and 1 / 1,2 / mice fed normal lab chow (Figure 4 7) Alt hough it is only an N of 2, striking qualitative differences between the genot ypes were not obvious. D ietary K + D epletion and Mineralocorticoid Excess in HK Null Mice The next experiments investigated whether either or both of the renal HK 1 and HK 2 c ontaining H + ,K + ATPases were responsible for the exacerbation of metabolic alkalosis with combined dietary K + depletion and mineralocorticoid excess. WT 1 / and 1,2 / mice were fed a normal gel diet for three days then switched to a K + depleted gel diet for eight days H alf the animals in each genotype were also treate d with DOCP at the start of the K + depleted diet Body weight and food intake were compared over the entire time course Total kidney weight and blood chemistries were measured on the last day of the experiment

PAGE 110

110 Our previous results showed that 1,2 / mice lost more body weight with dietary K + depletion than WT mice. D ietary K + depletion combined with DOCP treatment caused a substantially greater loss of body weight in 1,2 / mice c ompared to dietary K + depletion alone (Figure 4 8 A). This effect wa s not observed in WT or 1 / mice Despite the body weight loss of 1,2 / mice, food intake was similar in WT and 1,2 / mice on a K + depleted diet (Figure 4 8 B) However, DOCP treated 1 / mice exhibited significantly greater food intake than DOCP treat e d WT mice over the entire time course. Significant r enal hypertrophy was observed in 1,2 / mice fed a K + depleted diet (Figure 4 8 C). This effect was e xacerbated with DOCP treatment. DOCP treatment and dietary K + depletion reduced blood [K + ] an additional 1 mM compared to dietary K + depletion alone in each genotype (Figure 4 9 A). Eight days of dietary K + depletion did not increase blood [HCO 3 ] in mice from any genotype (Figure 4 9 B). However, d ietary K + depletion and DOCP treatment caused an ~5mM increase in blood [HCO 3 ] in WT mice Surprisingly, DOCP treatment in K + depleted 1,2 / mice caused an even more severe increase in blood [HCO 3 ] of ~15mM The 1,2 / mice exhibi ted a reciprocal decrease in blood [Cl ] (Figure 4 9 C ). 1,2 / mice also displayed greater blood [Na + ] than WT or 1 / mice on a K + depleted diet (Figure 4 9 D) indicating fluid volume loss and dehydration Hematocrit was greater in both 1 / and 1,2 / mice compared to WT with dietary K + depletion alone (Figure 4 9 E) a lso indicat ing dehydration Discussion In this study, we investigated the effect of dietary K + depletion in WT 1 / and H 1,2 / mice. D ietary K + depletion caused worse hypokalemia in 1,2 / mice than WT or 1 / mice 2 containing H + ,K + ATPases are required for K +

PAGE 111

111 conservation. However, significant urinary K + loss did not occur in H 1,2 / mice. Fecal K + loss was apparent in the double kno ckouts under normal and dietary K + deplet ed conditions similar to observations in H 2 / mice. 218, 219 The data indicate that only the colonic 2 containing H + ,K + ATPases are required for K + conservation with dietary K + depletion. R enal 2 containing H + ,K + ATPases are also not required for K + depletion induced urinary Na + retention. The observation that H 1 / and H 1,2 / mice have a more acidic urine pH 1 containing H + ,K + ATPases, either in the kidney or other tissues affects urinary acid excretion. T he mechanism for this is still unclear In contrast to our expectations, DOCP treated H 1,2 / mice fed a K + deplet ed diet displayed a remarkabl y sever e metabolic alkalosis The data suggest that renal H + ,K + ATPases play completel y different roles during mineralocorticoid excess in the presence and absence of dietary K + The hypernatremia observed in DOCP treated H 1,2 / mice fed a K + depleted diet also suggests that the renal H + ,K + ATPases are i mportant in fluid volume homeostas is under this condition Considerable evidence has suggested that H + ,K + ATPases and, more 2 containing H + ,K + ATPases mediate K + reabsorption in the collecting duct and the colon 86, 87 Therefore, we expected that 1,2 / mice would display a more severe hypokalemia than WT or 1 / mice when fed a K + depleted diet The excessive fecal K + wast ing of 1,2 / 2 containing H + ,K + ATPases facilitate K + conservation under K + deplete d conditions. O ur observation that urinary K + conservation is intact in 1,2 / mice suggests that other mechanisms in the kidney, such as shutdown of K + secretion, compensate for the lack of

PAGE 112

112 H + ,K + ATPase mediated K + reabsorption or that renal H + ,K + ATPases do not contribute to net K + reabsorption in vivo under normal physiological conditions. Our previous studies show that mineraloco rticoids do not cause urinary Na + retention in 1,2 / mice. We hypothesized that the urinary Na + retention of dietary K + depletion would also be dependent on the renal H + ,K + ATPases. However, dietary K + depletion induced Na + retention was intact in 1,2 / mice The differences in the urinary Na retention of 1,2 / mice during mineralocorticoid excess and dietary K + depletion are possibly related to differences in mineralocorticoid status and the activation of ENaC mediated Na + reabsorption. In c ontrast to mineral o corticoid excess which is accepted to stimulate urinary Na + reabsorption through ENaC d ietary K + depletion induced urinary Na + retention may be independent of ENaC First, d ietary K + depletion is known to be low mineralocorticoid state 238 Second ENaC subunit plasma membrane protein abundance in the cortical collecting duct has been shown to ch ange in proportion to dietary K + intake 239 In particular, a low K + diet decreases plasma membrane abundance of ENaC subunits. T herefore, i t is plausible that the low mineralocorticoid state of low dietary K + intake shuts down H + ,K + ATPase dependent (ENaC mediated) Na + reabsorption by the collecting duct and dissociates Na + retention from the renal H + ,K + ATPases. Contrary to dieta ry K + depletion alone, d ietary K + depletion combined with DOCP treatment would be expected to increase ENaC expression and activity in the collecting duct. The hypernatremia greater blood hematocrit, and body weight loss of DOCP treated 1,2 / mice fed a K + deplet ed diet indicates an inability to retain Na + or

PAGE 113

113 H 2 O Whether this relates to altered ENaC activity and urinary Na + or H 2 O retention needs to be addressed. The striking metabolic alkalosis observed in 1,2 / mice fed a K + depleted diet and treated with DOCP is yet unexplained Whether this effect stems from a gastrointestinal or renal H + loss in the 1,2 / mice should be investigated. The metabolic alkalosis possibly results from inactivation of p endrin mediated Cl reabsorption and HCO 3 secretion 121, 122 Additional experiments are needed to clarify the involvement of renal H + ,K + ATPases in the effects of dietary K + depletion with mineralocorticoid excess. M any other acid secreting mechanisms are present in the nephron and collecting duct (reviewed by Wagner et al 36 ) that may compensate for knockout of renal H + ,K + ATPase s Our examination of mRNA expression levels for several acid base transporters in kidneys from 1,2 / mice revealed the anion exchanger 1 (AE1) as the only likely candidate. However, the change in expression of this transporter (30%) was not dramatic. Excessive activity of medullary AE1 in conjunction with an apical H + secretion mechanism could help explain, at least in part, the more acidic urine of 1 null mice. One study has shown that outer medullar y collecting ducts of 1 / mice possess ed grea ter H + ATPase mediated H + secretion and apical polarity of this transporter than WT mice 240 Using immunogold localization, we have not observed increased H + ATPase localization to the apical plasma membrane of ICs in HK 1 / compared to WT mice fed a normal diet (Verlander et al. Unpublished observations) Nevertheless, one expects compensatory stimulation of th e H + ATPase in 1 null mice to only maintain normal urinary acidification. The greater net urinary acid

PAGE 114

114 1 null mice is surprising. The potential of reduced gastric acid secr etion in the 1 null mice to affect urinary acid excretion cannot be ignored. Pancreatic HCO 3 secretion buffers gastric acid secretion in response to an acidic environment (for a review of gastrointestinal acid base transporters see reference 241 ) However, acid independent release of pancreatic HCO 3 can occur in response to g astrin releasing peptide 242 I nterestingly, HK 1 / mice display ed significantly elevated levels of gastric and serum gastrin 213 su ggesting that gastrin releasing peptide levels maybe elevated. I ncreased levels of gastrin releasing peptide in HK 1 / mice if present, would be expected to cause e xcessive pancreatic HCO 3 secretion with subsequent stool HCO 3 loss. This net alkali defi cit would lead to metabolic acidosis However, there are other renal mechanisms for excretion of the remaining acid load Therefore, t his may be one mechanism for the acidic urine of HK 1 / mice In conclusion, the role of the renal H + ,K + ATPases in urinary K + conservation and acidification with dietary K + depletion remains unclear. Tissue specific knockout mice are needed to more fully understand the role of the renal H + ,K + ATPases independent from the role of the gastrointestinal H + ,K + ATPases This is especially important to decipher the role of renal H + ,K + ATPases in urinary acid excretion under normal and K + deplete d dietary conditions

PAGE 115

115 Table 4 1. Blood chemistr ies for WT and 1 / mice on a K + depleted diet. WT ( N =4) 1 / ( N =4) [Na + ], mM 147 .0 0.48 148 .0 0.47 [K + ], mM 3. 9 0.10 3.8 0.18 [Cl ], mM 114 .0 0.96 109 .0 0.89 Calculated [HCO 3 ], mM 19.7 0.95 22.1 0.74 Data are shown for day 8 of the diet and t P<0.05 versus WT. Table 4 2. Quantitative analysis of renal acid base transporter mRNA expression profile in WT 1,2 / mice fed a normal diet. Tissue Gene Common name Function Cortex Medulla WT (N=6) 1,2 / (N=8) WT (N=6) 1,2 / (N=8) Atp6v0a4 H + ATPase a4 H + secretion 1.0 0.07 1.20 0.07 1.0 0.17 1.00 0.13 Atp6v1b1 H + ATPase B1 H + secretion 1.0 0.21 0.76 0.10 1.0 0.23 1.30 0.11 Slc4a1 AE1 Cl /HCO 3 exchange 1.0 0.22 1.10 0.30 1.0 0.06 1.30 0.12 Slc26a4 Pendrin Cl /HCO 3 exchange 1.0 0.08 0.73 0.10 NT NT Rhbg Rhbg NH 3 transport 1.0 0.16 0.69 0.12 1.0 0.09 0.94 0.09 Rhcg Rhcg NH 3 transport 1.0 0.07 0.81 0.07 1.0 0.09 0.95 0.05 Slc9a2 NHE2 Na + /H + exchange 1.0 0.10 0.93 0.11 1.0 0.15 1.00 0.14 Slc9a3 NHE3 Na + /H + exchange 1.0 0.11 0.62 0.08 1.0 0.12 0.70 0.12 Data t NT means not tested.

PAGE 116

116 Figure 4 1. 1,2 / mice lost substantial body weight with dietary K + depletion. Body weight change (%) is shown as the percent change from day 0 to day 8 Data are presented as mean SEM and were analyzed by two way ANOVA followed by a post hoc Student Newman Keuls test, i f appropriate. denotes § versus WT on same diet N=6 8

PAGE 117

117 Figure 4 2. Dietary K + depletion caused excessive fecal (not urinary) K + excretion in HK 1,2 / mice A) Blood [K + ] is shown for WT and HK 1,2 / mice fed a normal or K + depleted diet ad libitum for 8 days. B) Urinary K + retention (day 8 ) is shown and was calculated as the daily K + intake minus daily urinary K + excretion. C ) U rinary K + retention on day 8 of a K + depleted diet was measured by flame photometer also. D ) Fecal K + excretion (Eq / g stool) is shown for day 4 of the normal diet and day 4 and 8 of the K + depleted diet. Data are presented as mean SEM and were analyzed by two way ANOVA followed by a post hoc Student Newman Keuls test, if appropriate. denotes P<0.05 versus normal diet and § versus WT on same diet N=6 8

PAGE 118

118 Figure 4 3. Diet ary K + depletion caused urinary Na + retention in WT and HK 1,2 / mice A) Urinary Na + retention (day 8 ) and B) urine volume are shown for WT and HK 1,2 / mice fed a normal or K + depleted gel diet ad libitum for 8 days. Urinary Na + retention was calculated as the daily Na + intake minus daily urinary Na + excretion. Data are presented as mean SEM and were analyzed by two way ANOVA followed by a post hoc Student Newman Keuls test, if appropriate. denotes P<0.05 versus normal diet a N=6 8

PAGE 119

119 Figure 4 4. HK 1,2 / mice do not lose urinary K + or Na + at an earlier time point on a K + depleted diet. A) Urinary K + retention and B) Na + retention are shown in pair fed WT and HK 1,2 / mice who were given a normal diet for 4 days then switched to a K + depleted diet for 4 days. Data are shown as mean SEM and were analyzed by two way repeated measure ANOVA. N=4 5.

PAGE 120

120 Figure 4 5. Urinary acid excretion is abnormal in HK 1,2 / mice A) B lood [HCO 3 ] (calculated) B) urine pH, C) NH 4 + excretion, D ) titratable acidity, and E ) net acid excretion (day 8 ) were assessed in WT and HK 1,2 / mice fed a normal or K + deplete gel diet ad libitum for 8 days. Data are presented as mean SEM and were analyzed by two way ANOVA fol lowed by a post hoc Student Newman Keuls or Tukey test, if appropriate. denotes P<0.05 versus versus normal diet in same genotype, and § versus WT on the same diet. N=6 8.

PAGE 121

121 Figure 4 6. 1 / mice exhibit more acidic urine than WT mice. Urine pH was measured in WT and 1 / mice fed a normal gel diet for 4 days Data are t P<0.05 versus WT. N=3 Figure 4 7. H + ATPase p lasma membrane protein expression does not appear altered in HK 1 / or HK 1,2 / mice. Levels of H + ATPase B1/B2 (~55kDa) protein were detected by Western blot analysis of plasma membrane protein fractions (25 50 g) from renal medulla of WT and HK 1,2 / mice. actin protein (~42kDa) levels served as a loading control. N=2.

PAGE 122

122 Figure 4 8 Dietary K + depletion with DOCP treatment caused body weight loss and renal hypertrophy in HK 1,2 / mice. A) Body weight (% change from day 0 ), B) food consumption and C) kidney weight are shown for WT HK 1 / and HK 1,2 / mice fed a K + depleted diet for 8 days with or without DOCP treatment at day zero Data are shown as mean SEM and were analyzed by two way ANOVA with or without repeated measures followed by post hoc Holm Sidak test, where appropriate. a deno tes P<0.05 versus WT b versus HK 1 / mice and e versus K + depleted diet on the s ame day. denotes P<0.05 versus WT and versus K + depleted diet N=3 4.

PAGE 123

123 Figure 4 9 Combined dietary K + depletion and DOCP treatment caused metabolic alkalosis and hypernatremia in HK 1,2 / mice. A) Blood [K + ], B) [HCO 3 ] (calculated) C) [Cl ], D) [Na + ], and E) hematocrit were compared in WT HK 1 / and HK 1,2 / mice fed a K + depleted diet for 8 days Half of the mice were also treated with DOCP Data are shown as mean SEM and were analyzed by two way ANOVA followed by post hoc Holm Sidak test, where appropriate. HK 1 / mice regardless of treatment. § denotes P <0.05 versus WT and versus HK 1 / with in the same treatment group N=3 4.

PAGE 124

124 CHAPTER 5 MECHANISMS OF H + ,K + ATP ASE MEDIATED NA + TRANSPORT Our previous results reveal ed that mineralocorticoid induced urinary Na + retention require s the presence of H + ,K + ATPases In contrast renal H + ,K + ATPases are not required for dietary K + depletion induced Na + retention. Several lines of evidence indicate a similar association between Na + transport and renal or colonic H + ,K + ATPases. A low Na + diet, which induces secondary hyperaldosteronism, has been shown to double ouabain sensitive H + ,K + ATPase mediated H + secretion in rat IC s after ~ two weeks. 191 The ouabain sensitivity suggests activation of HK 2 containing H + ,K + ATPases. In this same study, Silver and colleagues also examined H + ,K + ATPase activity in collecting ducts from adrenalectomized rats replaced with a ldosterone levels similar to Na + depleted rats H + ,K + ATPase mediated H + secretion in ICs was not increased by aldosterone loading alone Those results suggest that low dietary Na + stimulates renal HK 2 containing H + ,K + ATPases independently of mineralocorticoid s Another study examin ing HK 2 protein expression in the colon and kidney of Na + depleted rats reported that dietary Na + depletion stimulated HK 2 protein expressi on only within the distal colon and not in the kidney. 192 The latter study demonstrates that dietary Na + restriction increases renal HK 2 containing H + K + ATPase activity independently of changes in expression The physiological response of H K 2 / mice to dietary Na + restriction has been investigated 219 U nder dietary Na + restricted conditions, HK 2 / mice exhibited greater fecal K + and Na + loss than WT mice. ENaC mRNA expression, detected by Northern blot, appeared decreased in both the colon and kidney of Na + restricted HK 2 / mice compared to WT mice. It was also found that HK 2 / mice fed either a normal or Na +

PAGE 125

125 restricted diet exhibited s ignificantly red uced amiloride sensitive, electrogenic Na + current withi n the colon compared to WT mice Spicer and colleagues speculated that colonic H + ,K + ATPase mediated K + recycling was required for ENaC mediated Na + reabsorption. Their model proposed that K + secreti on via apical K + channels and K + recycling and H + secretion via H + ,K + ATPases maintain electrochemical gradients necessary for electrogenic Na + reabsorption through ENaC and the Na + ,K + ATPase. In th at same study, no significant differences in u rinary Na + excretion were observed between Na + restricted WT and HK 2 / mice 219 However, r enal ENaC activity was not examined. Interestingly urinary K + excretion was reduced in Na + restricted HK 2 / mice compared to WT, suggesting activation of other K + reabsorptive me chanism s. I t is possible that the unaltered renal Na + conservation of HK 2 / mice results from coupling of the remaining HK 1 containing H + ,K + ATPase and ENaC For our study, w e hypothesized that HK 1,2 / mice would display reduced renal ENaC expression and exhibit significant urinary Na + loss with dietary Na + depletion due to the reduction in ENaC mediated Na + reabsorption. Therefore, we examine d renal ENaC mRNA and protein expression in WT and HK 1,2 / mice under normal c onditions. W e next compared the physiological response of WT and HK 1,2 / mice to dietary Na + depletion. Since w e previously observed that HK 1,2 / mice consume slightly more food than WT mice under normal conditions we also hypothesized the HK 1,2 / mice lack enough of some nutrient like Na + in their diet. Therefore, we more closely examined food and H 2 O intake in HK 1,2 / mice We also measured urinary aldosterone excretion in WT and HK 1,2 / mice fed ad libitum and pair fed to WT mice (food restr iction)

PAGE 126

126 Results ENaC Subunit Expression in HK Null Mice Real time PCR was performed to determine relative mRNA expression of male WT and HK 1,2 / mice on a normal gel diet mRNA expression of subunit s were not significantly different in the cortex and medulla of HK 1,2 / mice compared to WT mice (Figure 5 1). Using samples from the same mice used in the mRNA experiment, ENaC total protein expression was also determined in renal m edulla of WT and HK 1,2 / mice by Western blot analysis A representative Western blot is shown in Figure 5 2 A Using antibodies from Carolyn Ecelbarger, a band was detected at the expected size for full length and Medullary ENaC protein expression was clearly reduced in HK 1,2 / mice compared to WT B and densitometry revealed that HK 1,2 / mice had ~ 45 % less ENaC protein expression than WT mice (Figure 5 2 B) Dietary Na + Depletion in HK Null Mice In the next set of experiments, we investigated the physiological responses of WT and HK 1,2 / mice to dietary Na + depletion We hypothesized that dietary Na + depletion would ca use fluid volume loss and u rinary Na + wasting in HK 1,2 / mice B ody weight and blood chemistrie s were measured in WT and HK 1,2 / mice pair fed a Na + depleted gel diet for one week. WT and HK 1,2 / mice did not display signific ant differences in body weight gain by day 7 of dietary Na + depletion (Figure 5 3 A). Interestingly, Na + depleted HK 1,2 / mice displayed greater blood hematocrit than WT mice (Figure 5 3 B) suggesting volume depletion in the double knockout mice B lood [Na + ] and [K + ] w ere similar between WT (151 0.97 mM and 5.1 0.091 mM, respectively ) and HK 1,2 / mice (151 0.43 m M and 5.3 0.30 mM respectively ) Technical difficulties with urine

PAGE 127

127 collection throughout this experiment precludes the assessment of urinary Na + and K + excretion in WT and HK 1,2 / mice over the time course of dietary Na + depletion. Food Intake and Urinary Aldosterone Levels in HK mice Our previous studies showed that HK 1,2 / mice have a tendency to consume more food than WT when fed ad libitum. Therefore, we measured food and H 2 O intake in WT and HK 1,2 / mice fed a normal gel diet ad libit um for one week. U rine volume and osmolality were also measured in WT and HK 1,2 / mice. On an ad libitum diet, HK 1,2 / mice consumed significantly more food per body weight (g) than WT mice (Figure 5 4 A). H 2 O intake was not significantly different bet ween WT and HK 1,2 / mice (Figure 5 4 B) However, the double knockouts excreted a greater urine volume than WT mice (Figure 5 4 C) Since the double knockouts consume more gel food than WT mice, this probably results from greater H 2 O intake through the gel food Urine osmolality was the same between the two genotypes (Figure 5 4 D) indicating no difference in urine concentrating ability We also examined the ability of WT and HK 1,2 / mice to maintain normal body weight under ad libi tum and pair fed (food /Na + restricted) conditions. WT and HK 1,2 / mice were pair fed a normal gel diet or fed ad libitum with free access to H 2 O for one week. F eeding HK 1,2 / mice t he same amount of food as WT mice caused a considerable loss of body w eight in the knockout mice suggesting fluid volume loss (Figure 5 5 ) In contrast, both WT and HK 1,2 / mice gained a similar amount of body weight when fed ad libitum (Figure 5 5 ). Dietary Na + deficiency is known to increase plasma and urinary aldosterone levels. 243 Therefore, we expected greate r urinary aldosterone levels in HK 1,2 / mice pair fed to WT mice due to a r estriction in dietary Na + intake W e measured urinary

PAGE 128

128 aldosterone levels i n male WT and HK 1,2 / mice fed ad libitum and in HK 1,2 / mice pair fed to WT mice. Urinary aldosteron e excretion was similar between the genotypes during ad libitum intake (Figure 5 6 A). However, pair feeding caused a pronounced increase in urinary aldosterone in HK 1,2 / mice. Although not significant, pair fed female HK 1,2 / mice also exhibited a tendency for increased urinary aldosterone excretion compared to either WT or HK 1 / mice (Figure 5 7 B). More studies are needed to determine if both male and female HK 1,2 / mice respond similarly to dietary Na + restriction. Disc ussio n In this study, we investigated the mechanism and further defined the role of renal H + ,K + ATPases in urinary Na + conservation Total protein expression of ENaC was considerably reduced in the renal medulla of HK 1,2 / mice suggesting that renal H + ,K + ATPases are required for normal ENaC expression Dietary Na + depletion caused increased blood hematocrit in HK 1,2 / mice, indicating fluid volume loss. Restricting food intake of HK 1,2 / mice caused loss of body weight and great ly increased urinary aldosterone excretion in the double knockouts as well Taken together, our results further signify that renal H + ,K + ATPases play an essential part in urinary Na + conservation, at least in part through a mechanism involving ENaC T he decreased tot al protein abundance of ENaC in the medulla of HK 1,2 / mice would be expected to provide less reserve for ENaC translocation to the plasma membrane during states of Na + deprivation. Our data suggest that HK 1,2 / mice consume more food in order to inc rease dietary Na + consumption and maintain salt balance This hypothesis will need to be confirmed. However, the body weight loss and

PAGE 129

129 increased urinary aldosterone excretion of food restricted HK 1,2 / mice is consistent with this hypothesis. The reduced protein expression of ENaC in the medulla of HK 1,2 / mice may represent a mechanism for the urinary Na + loss observed in DOCP treated HK 1,2 / mice It is possible that fewer ENaC channels are available for apical plasma membrane insertion and activation during DOCP treatment in the HK 1,2 / mice. Several lines of evidence also suggest that both the HK 1 and HK 2 containing H + ,K + ATPases directly reabsorb Na + on the K + binding site. 148, 156 158 Th erefore, the disr uption of direct Na + reabsorption by the renal H + ,K + ATPases in HK 1,2 / mice may also be a mechanism for the observed urinary Na + loss in these knockouts. The lack of a similar phenotype in HK 1 / mice also implies that the requirement of renal H + ,K + AT Pases for Na + reabsorption is specific to HK 2 containing H + ,K + ATPases The unavailability of specific HK 2 containing H + ,K + ATPase inhibitors has hindered investigation into direct HK 2 mediated Na + reabsorption. However, the most immediate studies should focus on determining whether knockout of HK 2 containing H + ,K + ATPases produces a similar urinary Na + handling defect as in the HK 1,2 / mice. From that point, the mechanism, be it direct or indirect, can be more fully studied. HK 1,2 / mice disp layed reduced ability to maintain Na + balance during DOCP treatment and dietary Na + restriction. Whether these effects in the HK 1,2 / mice are related to reduced ENaC me diated Na + reabsorption or elimination of direct H + ,K + ATPase mediated Na + reabsorption in the connecting segment and renal collecting duct remains to be determined. Nonetheless the results of these studies and

PAGE 130

130 our previous ones support the hypothesis that renal H + ,K + ATPases (probably HK 2 containing) are required to maintain Na + balance.

PAGE 131

131 Figure 5 1. ENaC subunit mRNA expression is similar in WT and HK 1,2 / mice. Real time PCR was used to assess ENaC mRNA expression in kidney cortex (Ctx) and medulla (Med) from WT and HK 1,2 / mice fed a normal diet. actin. Fold changes (2 Ct ) in expression were calculated, with WT set at 1. Data are presented as mean SEM and analyzed t test. N = 6 8

PAGE 132

132 Figure 5 2. Medullary ENaC protein expres sion is reduced in HK 1,2 / mice. Western blot analysis was used to assess ENaC protein expression in total protein fractions from renal medulla of WT and HK 1,2 / mice fed a normal gel diet ad libitum A) A representative blot is shown for an ENaC protein (~85kDa) expression with actin (~42kDa) used a loading control. B) Densitometry analysis of blots for ENaC protein expression, corrected for actin levels, with WT expression set to 100%. Data are shown as mean t test. denotes P<0.05 versus WT. N=5 for ENaC and N=3 for ENaC.

PAGE 133

133 Figure 5 3 Dietary Na + depletion increased blood hematocrit in HK 1,2 / mice. A) Body weight, shown as percent change from day 0 to day 7 and B) blood hematocrit (% day 7 ) were compared in WT and HK 1,2 / mice pair fed a Na + depleted gel diet for 7 days. Data for body weight are shown in box chart with individual data points shown. Data are shown as mean SEM for hematocrit. All data were ana t N=4.

PAGE 134

134 Figure 5 4 HK 1,2 / mice display altered appetite, H 2 O intake, and urine volume on a normal diet. A) Food consumption, B) H 2 O intake, C) urine volume, and D) urine osmolality were measured in WT and HK 1,2 / mice fed a normal gel diet ad libitum for one week. Data are an average of 3 days (day 5 to 7 ) shown as t ersus WT. N=3.

PAGE 135

135 Figure 5 5 HK 1,2 / mice lost considerable body weight when pair fed. Body weight, shown as percent change from day 0, was measured in WT and HK 1,2 / mice fed ad libitum or pair fed a normal gel diet for one week. Data are shown as t test. denotes P<0.05 versus WT. N=4.

PAGE 136

136 Figure 5 6 Food restriction (pair feeding) caused HK 1,2 / mice to exhibit augmented urin ary aldosterone excr etio n. A) Urine aldosterone, shown as ng excreted per day, was measured in male WT and HK 1,2 / mice fed ad libitum or pair fed a normal gel diet. B) Urine aldosterone levels were also measured in female WT, HK 1 / and HK 1,2 / mice pair fed a normal gel diet. Data are t test or one way ANOVA with post hoc Tukey test denotes P<0.05 versus WT on the same diet N= 3 4.

PAGE 137

137 CHAPTER 6 CONCLUSIONS AND FUTU RE DIREC TIONS Our studies establish the importance of renal H + ,K + ATPases to mineralocorticoid and Na + depletion induced Na + retention in addition to their formerly recognized K + reabsorpti ve and H + secret ory action Conclusions and future directions will be discussed concerning the study of the renal H + ,K + + K + and acid base homeostasis. Hypotheses will be made concerning vasopressin and molecular regulation of renal H + ,K + ATPases Finally, the prospective functions of H + ,K + ATPase s outside the kidney will be discussed H + ,K + ATPas e mediated Na + Retention The most remarkable observation within our studies is the influence of renal H + ,K + ATPases on renal Na + handling. Specifically, o ur results demonstrate that renal H + ,K + ATPases are essential for mineralocorticoid induced urinary Na + retention. Since DOCP treated HK 1,2 / mice displayed significant urinary Na + loss compared to WT and HK 1 / mice it is probable that renal HK 2 containing H + ,K + ATPases are the isoform im portant to mineralocorticoid induced urinary Na + retention. The mechanism(s) responsible for coupling of Na + reabsorption to the H + ,K + ATPases remain s unknown Coupling to ENaC dependent Na + reabsorption appears particularly promising. T h is section d iscus ses and proposes investigation into prospective H + ,K + ATPase requiring Na + reabsorptive mechanism s and conditions. This section also discusses the plausible role of H + ,K + ATPases in blood pressure regulation. Potential Mechanism (s) of H + ,K + ATPase mediated Na + Transport In future experiments, it will first be necessary to determine whether both HK 1 and HK 2 containing H + ,K + ATPases or HK 2 containing H + ,K + ATPases alone

PAGE 138

138 are required for mineralocorticoid induced urinary Na + retention and to maintai n Na + balance with dietary Na + restriction. Examination of the physiological response of HK 2 / mice to DOCP treatment and dietary Na + depletion should answer this question. Two lines of evidence indicate that H + ,K + ATPases are important for ENaC mediated Na + reabsorption. 1) Other investigators have observed a reduction in colonic ENaC activity in HK 2 / mice. 219 2) We found that medullary ENaC subunit protein expression is dramatically reduced in HK 1,2 / mice. In the colon, ENaC and HK 2 containing H + ,K + ATPases reside in the same cell type However i n the collecting duct, ENaC and H + ,K + ATPases are primarily present in the neighboring PCs and IC s, respectively. 90, 185, 244 The location of ENaC and H + ,K + ATPases in separate cell types suggests an extracellular mechanism for altered ENaC expression in kidneys from HK 1,2 / mice Although HK 2 containing H + ,K + ATPases primarily localize to IC s, studies have show n apical plasma membrane localization in PCs 90, 185 The expression of ENaC and HK 2 containing H + ,K + ATPases in the same cell type implies that either an intracellular or autocrine mech anism of reduced ENaC protein expression may also exist in HK 1,2 / mice. Indeed, both paracrine and autocrine mechanisms may be involved. Although the signaling mechanism s have not been identified, r ecent studies have demonstrated that extracellular [ HCO 3 ] can stimulate ENaC protein expression and activity 121 Those studies showed that p endrin null mice displayed more acidic urine than WT and had reduced renal ENaC expression. 122 A cetazolamide which incre ases HCO 3 delivery to the collecting duct, correct ed ENaC expression and activity in p endrin null mice 121 An analogous mechanism may be present in HK 1,2 / mice S imilar to

PAGE 139

139 p endrin null mi ce, HK 1,2 / mice exhibit ed more acidic urine t han WT mice in our studies A n equivalent examination of ENaC expression and ENaC mediated (amiloride sensitive) Na + reabsorption in HK 1,2 / mice under normal conditions and in response to acetazolamide should be performed However, urine acidity is unlikely to be the primary basis for decreased ENaC expression in HK 1,2 / mice because a similar urine acidity is observed in HK 1 / mice. In distinction to HK 1,2 / mice, HK 1 / mice exhibit ed exacerbated Na + retention with mineralocorticoid excess, suggesting that ENaC function would be intact in the single knockouts. The discussion above is speculati ve. E xperiments are first needed to determine whether and under what conditions (such as mineralocorticoid excess) ENaC activity is reduced in collecting ducts from HK 1,2 / mice The next objectives should involve investigation of whether ENaC requires HK 1 or HK 2 containing H + ,K + ATPases by examination of ENaC activity in collecting ducts from single HK knockouts. F inally it should be determined if the lack of mineralocorticoid induced Na + retention in HK 1,2 / mice results from reduced ENaC activity, expression and plasma membrane localization The results of these proposed experiments will address the question of whether ENaC represents the mechanism for H + ,K + ATPase mediated Na + retention. It is possible that renal HK 2 containing H + ,K + ATPases are required for the Na + retaining effects of other hormonal and dietary conditions of increased Na + retention In support of this hypothesis, chronic (two weeks) dietary NaCl restriction, a diet known to stimulate ENaC expression and Na + reabsorptive activity, also activates SCH 28080 sensitive H + ,K + ATPa se mediated H + secretion in ICs 191 In addition, our

PAGE 140

140 own data demonstrating that HK 1,2 / mice show signs of fluid loss w ith di etary Na + deplet ion support the hypothesis that conditions of enhanced ENaC mediated urinary Na + retention required augmented H + ,K + ATPase activity. Examination of urinary Na + excretion and ENaC activity in collecting ducts from Na + restricted HK 1 / HK 2 / and HK 1,2 / mice is necessary to fully resolve the function of renal H + ,K + ATPases in urinary Na + retention during dietary Na + depletion. If it is found that reduced ENaC mediated Na + reabsorption is not the mechanism for urinary Na + loss in HK 1,2 / mice subjected to DOCP or dietary Na + depletion, then other studies are needed to determine whether H + ,K + ATPases directly reabsorb Na + H + ,K + ATPase mediated Na + reabsorption could be measured as amiloride and hydrochlorothiazide insensitive Na + flux. Th is relative H + ,K + ATPase mediated Na + flux should be measured and compared in collecting ducts from WT and HK null mice under normal, mineralocorticoid stimulated, and Na + deplete conditions. If direct Na + transport occurs via H + ,K + ATPases one would expect amiloride and hydrochlorothiazide insensitive Na + flux to increase with DOCP and dietary Na + deplete cond i tions in collecting ducts from WT mice and that this activity would be absent in HK 1,2 / mice under any condition. Finally, measuremen t of amiloride and hydrochlorothiazide insensitive Na + flux in HK single null mice should allow for determination of the H + ,K + ATPase isoform responsible for direct Na + reabsorption. Blood Pressure Phenotypes in HK Null Mice B ased on the reduced renal medullary ENaC abundance in HK 1,2 / mice and potential for reduction in ENaC mediated Na + retention one might expect the double knockouts to exhibit lower blood pressure than WT mice under normal conditions Recently completed experiments perform ed by Jeanette Lynch in our laboratory

PAGE 141

141 co mpar ed blood pressure phenotypes in male WT HK 1 / and HK 1,2 / mice under normal conditions Despite less medullary ENaC protein expression, HK 1,2 / mice showed similar blood pressure as WT and HK 1 / mice (WT, 11 5 2. 2 mmHg; HK 1 / 1 12 3.3 mmHg; HK 1,2 / 114 3.0 mmHg) Under normal conditions, urinary Na + retention, like blood pressure, is also similar in the three genotypes. Th ese results may suggest similar ENaC activity in WT HK 1 / and HK 1, 2 / mice under normal conditions Although blood pressure is normal in HK 1,2 / mice under normal conditions, the differences in urinary Na + excretion observed in DOCP treated knockout mice suggests blood pressure differences may exist with DOCP treatment. We found that DOCP induced greater urinary Na + retention in HK 1 / mice and less urinary Na + retention in HK 1,2 / mice These two results would be expected to cause a greater increase in blood pressure in HK 1 / mice and smaller increas e in blood pressure in HK 1,2 / mice relative to WT mice. Preliminary examination of the blood pressure response of WT HK 1 / and HK 1,2 / mice to DOCP treatment has not demonstrated significant phenotypic differences However, DOCP only increased blood pressure slight ly ( < 10mmHg) The mild increase in blood pressure of DOCP treated mice may reflect the fact that our background mouse strain, C 57BL/6J is somewhat re sistant to desoxycorticosterone mediated hypertension 245 Also, the hypertensive actions of desoxycorticosterone induced renal Na + retention have classically been studied under conditions of high dietary Na + inta ke, which was not used in our studies C haracterization of the role of renal H + ,K + ATPases in blood pressure regulation requires a more thorough examination of blood pressure responses in HK null mice particularly in response to increased or decreased die tary Na + intake and also in the

PAGE 142

142 absence or presence of mineralocorticoid excess These experiments may need to be performed in a different, more desoxycorticosterone sensitive, background mouse strain H + ,K + ATPase m ediated K + Retention and Recycling This section discusses observed and proposed roles of renal H + ,K + ATPases in K + homeostasis. To our knowledge, our studies are the first to demonstrate that HK null mice exhibit insufficient renal K + retention However, there are stark differences between the response of HK null mice to mineralocorticoids and dietary K + depletion. Since both conditions cause hypokalemia, the results indicat e that renal H + ,K + ATPases do not respond only to decreased plasma [K + ]. Our studies also imply that HK 2 containing H + ,K + ATPases primarily facilitate K + recycling in the collecting duct This has been suggested for H + ,K + ATPases present in other tissues. Finally, o ur observation that female, not male, HK 1,2 / mice have greater blood [K + ] than WT mice under normal con ditions indicate that H + ,K + ATPases regulate K + homeostasis in a sex dependent manner Role of H + ,K + ATPases in Mineralocorticoid and Dietary K + d ependent Control of K + Homeostasis With the use of HK null mice we showed that mineralocorticoids activate renal HK 2 containing H + ,K + ATPases limiting urinary K + loss. Interestingly, our results suggest that loss of HK 1 up regulates mineralocorticoid induced K + reabsorption through HK 2 c ontaining H + ,K + ATPases since the excessive urinary K + retention observ ed in DOCP treated HK 1 / mice is absent in HK 1,2 / mice. E xamination of H + ,K + ATPase mediated K + flux in collecting ducts from DOCP treated WT and HK 1 /

PAGE 143

143 mice should clarify whether HK 2 c ontaining H + ,K + ATPases are indeed the mechanism for greater K + retention in HK 1 / mice. Our results also indicate that mineralocorticoids induce HK 2 containing H + ,K + ATPases in a K + dependent manner. H igh dietary K + intake prevents the effect of mineralocorticoids t o decrease plasma [K + ] and to stimulate medullar y HK 2 subunit expression. Experiments are necessary 1) to examine whether the effects of a high K + diet indeed correspond to i nhibition of mineralocorticoid induced H + ,K + ATPase K + reabsorption in the collecting duct ; and 2) whether HK 1,2 / mice fed a high K + diet, no longer exhibit greater urinary K + loss than WT mice with mineralocorticoid excess In contrast to the role of renal H + ,K + ATPases during mineralocorticoid excess neither the renal HK 1 nor HK 2 containing H + ,K + ATPases appear to be req uired for maximal urinary K + conservation during dietary K + depletion. However, as evidenced by fecal K + loss in both HK 2 / and HK 1,2 / mice, the colonic HK 2 containing H + ,K + ATPases do mediate significant K + reabsorption during K + depletion. Importantly, t he absence of H + ,K + ATPases in the gastrointestinal system complicates interpretation of these data because mice null for HK 1 or HK 2 exhibit excessive fecal K + loss even under normal circumstances. In effect, the knockout mice a re likely primed for urinary K + conservation, probably through other transporters proximal to the collecting duct. Ultimately the generation and study of kidney specific knockouts for HK subunits is desirable for understanding the role of renal H + ,K + ATP ases in urinary K + reabsorption K + Recycling by H + ,K + ATPases T he magnitude of urinary K + loss in DOCP treated HK 1,2 / mice was small especially compared to the magnitude of urinary Na + loss. This relatively mild phenotype and the lack of renal K + loss in K + depleted HK 1,2 / mice suggest s that the

PAGE 144

144 primary function of renal HK 2 containing H + ,K + ATPases is not K + reabsorption. E vidence from the kidney 12 and stomach 246 indicate that H + ,K + ATPases in coordination with an apical K + channel can function to recycle K + Coimmunoprecipitation and immunolocalization e xperiments are needed to identify potential K + channel s associated with renal HK 2 containing H + ,K + ATPase s. Finally, studies should address whether K + recycling through the associated K + channel is inde ed the primary function of HK 2 containing H + ,K + ATPases Specifically, H + ,K + ATPase mediated H + secretion in ICs of the collecting duct should be measured in the presence and absence of pharmacological blockade of the identified K + channel using both WT and HK 2 / mice. This mode of K + recycling has been proposed as the reason w hy HK 2 containing H + ,K + ATPases are required for ENaC mediated Na + reabsorption in the colon. 219 A model for this coordinated transport mechanism within the kidney is shown in Figure 6 1 Specifically, this model proposes that H + ,K + ATPase mediated K + recycling provides the driving force (efflux of K + from PCs ) to facilitate electrogenic Na + reabsorption through ENaC. Investigation of ENaC mediated Na + flux in collecting ducts from WT and HK 2 / mice in the presence and absence of inhibitors for the a ssociated K + channel should address whether this proposed model is indeed accurate Role of H + ,K + ATPases in Sex Hormone Control of K + Homeostasis Until recently, sex hormones have not been recognized to have significant influence on K + homeostasis. New evidence from Crambert and colleagues shows that low dietary K + increased adrenal progesterone production 206 The study also showed that p rogesterone cause s urinary K + retention The mechanism appears to be through activation of renal HK 2 containing H + ,K + ATPases. Our studies showed that female

PAGE 145

145 HK 1,2 / mice in contrast to males display a slight hyperkalemia compared to WT and HK 1 / mice The results indicate that HK 2 containing H + ,K + ATPases present in the kidney or other tissues, play a yet undetermined part in the effect of sex hormones on K + homeostasis. A very informative experiment may be to assess plasma [K + ] and K + excretion in response to ovariectomy and adrenalectomy in female WT and HK 1,2 / mice The proposed studies will address whether sex ho rmones produce the slight hyperkalemia present in female HK 1,2 / mice E xperiments should also be conducted to understand the regulation of renal K + handling by other sex hormones and the potential involvement of renal H + ,K + ATPases Specifically, uri nary K + excretion could be examined in males, females, and ovariectomized females in response to progesterone, estrogen and testosterone Also, the effects of these hormones and pregnancy on H + ,K + ATPase mediated K + flux and HK subunit expression in the collecting duct could be studied The results of these studies should clarify whether progesterone is the only sex hormone that modifies K + homeostasis. It should also address whether other sex hormones and pregnancy influence K + reabsorption throu gh renal HK 2 containing H + ,K + ATPase s H + ,K + ATPase mediated H + Secretion T he importance of H + ,K + ATPases in the regulation of acid base homeostasis has been debated for many years. Nevertheless, our studies show for the first time that HK 2 containing H + ,K + ATPases mediate the majority of mineralocorticoid induced metabolic alkalosis T he role of H + ,K + ATPases to affect acid base balance during normal and dietary K + deplet ed conditions is not clear The following section will summarize and propose studies concerning the importance of H + ,K + ATPases in the kidney and gastrointestinal system to acid base homeostasis

PAGE 146

146 Effects of Mineralocorticoids and Dietary K + Depletion on Acid Base Balance Our data showing that DOCP tre atment did not cause increased plasma [HCO 3 ] in HK 1,2 / mice indicate that HK 2 containing H + ,K + ATPases mediate all of the effect of mineralocorticoids to cause metabolic alkalosis. Nevertheless, our studies did not address whether the metabolic alkalo sis results from renal or colonic HK 2 c ontaining H + ,K + ATPases Increased medullary HK 2 mRNA expression in DOCP treated mice suggest s a renal mechanism A n important contribution of the colonic HK 2 containing H + ,K + ATPase cannot be ignored. Whether the renal, colonic, or both HK 2 containing H + ,K + ATPases facilitate mineralocorticoid induced H + secretion and the resultant metabolic alkalosis needs to be investigated. Measurements of u rinary acid excretion and colonic H + ,K + ATPase mediate d H + secretion i n DOCP treated WT and HK 2 / mice should address this question. In our studies, we did not observe increased plasma [HCO 3 ] in WT mice after eight days on a K + depleted diet Similar results have been observed in mice and dogs 206, 218, 237 It is possible that a longer period of dietary K + depletion is needed to achieve metabolic alkalosis in mice W hether this relates to stimulation of H + ,K + ATPase mediate d H + secretion in the kidney or colon could be studied using HK null mice. However, it is unlikely that loss of colonic H + ,K + ATPase mediated H + secretion significantly affects acid base balance because neither HK 2 / 218 n or HK 1,2 / mice exhibit ed disturbances in blood [HCO 3 ] despite excessive fecal K + loss on a normal and K + depleted diet. Overall, we conclude that, despite their activation, renal and colonic H + ,K + ATPases do not significantly affect acid base homeostasis during low dietary K + intake alone

PAGE 147

147 Gastrointestinal Effects on Urinary Acid Excretion One completely surprising observation in our studies is that mice null for HK 1 exhibit more acidic urine than WT mice. These results are surprising because HK 1 containing H + ,K + ATPases are supposed to reside on the apical membrane of both the gastric mucosa and IC s of the collecting duct where they would secrete H + 185, 247 O ne expects the loss of these H + secreting transporter s in the kidney to cause urine alkal inization, not acidification. Compensatory stimulation of other H + secretion mechanisms in the kidney s of HK 1 null mice may represent one potential mechanism for the greater urinary acidification observed in these knockout mice. However, this c ompensation should only maintain normal net urine acid excretion in the knockouts, not stimulate more acid excretion than WT mice. It has always been assumed that loss of gastric acid secretion would not affect acid base balance because the secreted acid later st imulates pancreatic HCO 3 secretion for its neutralization. 248 However, evidence indicates that the gastric peptide hormone gastrin releasing peptide, can activate pancreatic HCO 3 secretion in the absence of gastric acid. 242 G astrin releasing peptide stimulates gastric acid secretion and is the hormone responsible for the release of gastrin in the stomach. 2 48 The fact that HK 1 / mice exhibit dramatically augmented levels of circulating and gastric gastrin suggests that gastrin releasing peptide levels are also increased in these knockout mice. 213 First, serum and gastric levels of gastrin rel easing peptide could be compared in WT and HK 1 / mice If greater in the knockouts, then pancreat ic HCO 3 secretion could be measured. It will also need to be determined whether i nhibit ion of pancreatic HCO 3 secretion corrects net urine acid excretion i n HK 1 / mice Really, tissue specific

PAGE 148

148 HK knockout mice are needed to define the separate roles of H + ,K + ATPases in the gastrointestinal system and the kidney to affect acid base homeostasis Dietary Acid Dependent Regulation of Renal H + ,K + ATPases Several lines of evidence suggest that dietary acid loading stimulates renal H + ,K + ATPase mediated H + secretion. 100, 193, 197, 198 D ietary acid loading stimulates the expression of HK 1 and HK 2 mRNA expression in a time dependent manner. 100 S tudies are needed to assess the role of each separate renal H + ,K + ATPase isoform in the acid secretory response to dietary acid loading In a preliminary study, we found that urine pH decreased in WT mice fed a 0.28 M NH 4 Cl loaded diet for 6 days (Figure 6 2 ) A similar effect was not observed in HK 1 / mice. These preliminary data suggest that renal HK 1 containing H + ,K + ATPases partici pate in the dietary acid induced urinary acidification. However, s ignificant metabolic acidosis was not observed in NH 4 Cl loaded WT mice Also, n o differences in blood [HCO 3 ] (19.9 1.3 mM in WT versus 20.5 0.082 mM in HK 1 / mice, N=3) were observed between NH 4 Cl loaded WT and HK 1 / mice F uture studies need to use an acid loading model that produces significant acidosis This will be essential to understanding the role of renal H + ,K + ATPases in the response to dietary acid challenges. HCl acid loading produces metabolic acidosis in mice. 128 The time dependent renal and systemic response of kidney specific HK 1 / and HK 2 / mice to HCl acid loading should be investigate d T he results of these proposed studies will more completely define the function of renal H + ,K + ATPases in dietary acid elimination and acid base homeostasis.

PAGE 149

149 MicroRNA Regul ation of H + ,K + ATPases New evidence indicates that microRNA regulation of gene expression is quite important to normal kidney function and pathophysiology. 249 Much investigation of microRNAs in the kidney has focused on cancer However, a recent study has shown that miR 192 regulates WNK1, an important modulator of distal tubular NCC 250 This report suggests that microRNAs are important regulatory mechanism s of elec trolyte transport. UTR either cause mRNA degradation or inhibit translation through a variety of mechanisms. 249 Our own obse rvation that renal HK 2 mRNA expression is quite low or even undetectable at HK 2 mRNA using an online software program called TargetScanMouse ( www.targetscan.org ). The program algorithm detected a potential mmu miR 505 binding site conserved within other species, including human, rat, and rabbit (Figure 6 3 ) However, analysis of miR 505 expression in the cortex and medulla of mouse kidney revealed very low expression of this microRNA (C t greater than or equal to 36) These data suggest that microRNAs are probably not a primary mechanism to control HK 2 expression. With the discovery of more microRNAs and better understanding of micro RNA mechanisms, it may be important to reevaluate microRNA regulation of HK 2 mRNA expression. Interaction between Vasopressin and Renal H + ,K + ATPases One of the most striking observations of our studies was the dramatic decline in urine volume of DOCP treated HK 1 / mice. Two other lines of data suggest involvement of H + ,K + ATPases in H 2 O balance. 1) HK 1,2 / mice exhibited polyuria

PAGE 150

150 under normal conditions. 2) HK 1,2 / mice displayed hypernatremia with combined dietary K + depletion and DOCP treatment Indeed, the anti diuretic hormone, vasopressin has been shown to activate H CO 3 reabsorption (or H + secretion ) and alter acid base transporter expression in the collecting duct 251, 252 Other studies have shown that vasopressin increases ATPase activity of the H + ATPase through V1 R dependent mechanism. 39 In the same study, vasopressin was not shown to stimulate vanadate sensitive H + ,K + ATPase activity However, the presence of ouabain to inhibit the Na + ,K + ATPase makes the data difficult to interpret because HK 2 containing H + ,K + ATPases are als o sensitive to ouabain In future studies, H + ,K + ATPase mediated H + secretion could be measured in IC s of control and vasopressin treated collecting ducts from WT and HK V1 R and V2 R antagonists could be used to define the mechanism of vasopressin action. I t is quite possible that the response of H + ,K + ATPases to vasopressin is more delayed than that of H + ATPases H + ATPases respond earlier to mineralocorticoid stimulation than H + ,K + ATPases. 39 Studies should be conducted to examine time dependen t changes in acid base homeostasis of vasopressin treated mice These changes could then be correlated to renal HK subunit expression and activity in the collecting duct. M ore experiments are needed to clarify whether the HK 1 or HK 2 containing H + ,K + ATPases participate in vasopressin stimulated H + secretion in IC s. Our own preliminary evidence is consistent with an interaction between vasopressin and H + ,K + ATPases. We found that urine o smolality and vasopressin levels were greater in HK 1 / mice than either WT or HK 1,2 / mice (Figure 6 4 ) To completely understand whether vasopressin induced H 2 O reabsorption requires renal

PAGE 151

151 H + ,K + ATPases, separate measurements of the renal response of HK null mice to vasopressin and H 2 O deprivation are required. Function of H + ,K + ATPases in Other Organ Systems H + ,K + ATPases localize to several different tissues in addition to the kidney In the stomach, the H + ,K + ATPase is most well known for its ro le in gastric acid secretion, and, in the colon, for its roles in K + reabsorption. However, t he function of H + ,K + ATPases within other organ systems remain s mostly un resolved Based on our own observations and the literature, t wo areas of particular intere st include the role of gastric H + ,K + ATPases in obesity and K = reabsorption and the role of HK 1 containing H + ,K + ATPases in bone resorption. Role of Gastric H + ,K + ATPases in Obesity and K + Reabsorption Relatively recent evidence has demonstrated that the gastric mucosa releases a peptide hormone named ghrelin which in addition to activation of gastric acid secretion also regulates energy balance. 253 Through its effects on the hypothalamic neuropeptide Y system ghrelin stimulates food intake and gastric emptying and can contribute to certain obesity phenotypes This connection between food intake and gastric acid secretion may be quite important for our own studies since we have observed greater food consumption in HK 1,2 / than WT mice. Also, longitudinal assessment of body weight change in male and female WT and HK 1 / mice from age 7 to 16 weeks has shown that HK 1 / mice gain weight at a faster rate than WT mice (Figure 6 5 ). Our previous data and the preliminary data described herein suggest that knockout of gastric acid secretion results in slight hyperphagia and obesity. We hypothe size that HK 1 null mice will exh ibit greater gastric ghrelin production as a compensatory mechanism to activate gastric acid

PAGE 152

152 secretion T his excess ghrelin may cause an orex i genic and obesity phenotype in the knockout mice. To study this, food intake, fat versus lean mean ratio and ghre lin levels need to be compared in WT and HK 1 / mice. Either way, the observation that HK 1 / mice are obese and exhibit excess adiposity, as determined by our own visual inspection, is concerning with respect to long term use of proton pump inhibitors in human patients. O ur results convey the importance of studying whether chronic proton pump inhibitor therapy increases gastric ghrelin secretion. One interesting observation of our studies is that HK 1 / mice, similar to HK 2 / 218 and HK 1,2 / mice, exhibit significant fecal K + loss under normal conditions. Traditionally, the stomach has not been recognized a s an important site for K + reabs orption. The gastric H + ,K + ATPases and apical K + channels have principally been thought to participate in K + recycling to achieve a large H + gradient contributing to a very low luminal pH. However, our data suggest that gastric HK 1 containing H + ,K + ATPase s also participate in net K + reabsorption. Measurement of luminal K + content in the small intestine of WT and HK 1 / mice should answer whether the phenotype of HK 1 / mice reflects reduced gastric K + reabsorption. In our studies, we also observed that both HK 1 / and HK 1,2 / mice display significant gastric hypertrophy compared to WT mice under K + depleted conditions (Figure 6 6). To our surprise, the HK 1,2 / mice exhibited an even more severe gastric hypertrophy than HK 1 / mice. As determined by Northern blot, HK 2 mRNA expression has not previously been detected in the stomach. 161 However, under normal conditions and with the aid of a much more sensitive method (real time PCR), HK 2 mRNA

PAGE 153

153 expression is also scarcely detectable in the kidney. Future studies should determine whether and under what conditions the stomach expresses HK 2 The presence of HK 2 in the stomach may explain the greater gastric hypertrophy of HK 1,2 / mice. Role of H + ,K + ATPases in Bon e Resorption and Ca 2+ Homeostasis Several lines of evidence suggest that HK 1 containing H + ,K + ATPases are present in bone and more specifically, osteoclasts T he H + ,K + ATPases may be involved in the acidification required for osteoclast mediated bone resorption. Some of the earliest evidence for H + ,K + ATPases in bone showed that omeprazole a gastric H + ,K + ATPase inhibitor, can inhibit bone resorption in an in vitro cell model of osteoclasts. 254 Later, physicians began to recognize that long term proton pump inhibitor therapy in humans produced a greater risk of hip fracture and decreased Ca 2+ absorption by the gut. 255, 256 N ew studies have now shown that omeprazole inhibits bone resorption in Ca 2+ phosphate cement in an in vivo model. 257 These studies all suggest that H + ,K + ATPases are present in osteoclasts and mediate osteoclast induced acidification and resorption of bone. Nevertheless a definitive examination of H + ,K + ATPase subunit expression and activity within osteoclasts has not been performed Our own preliminary assessment of HK subunit mRNA expression by real time PCR in femoral bone homogenates from WT mice demonstrated a very low expression level of HK 1 (C t equal to 35). However, measurement of HK 1 expression in isolated osteoclasts is needed to fully confirm localization to osteoclasts T hese experiments are in progress in collaboration with Shannon Holliday (University of Florida). In future experiments, H + ,K + ATPase mediated H + secretion should be measured in isolated osteoclasts from WT and HK 1 / mice and bone density measurements should be compared between the two genotypes. These

PAGE 154

154 studies will address whether HK 1 containing H + ,K + ATPases are required for appropriate bone resorption. T he proposed studies in HK 1 / mice may be complicated by the requirement of gastric acid secretion for g ut Ca 2+ absorption. In fact, it has been observed that omeprazole decreases gut Ca 2+ absorption in human paitients 255 In a preliminary study, we observed that urinary Ca 2+ excretion was considerably less in HK 1,2 / than WT mice (Figure 6 7 ) Taken together, t hese data suggest either that gastric H + ,K + ATPases are required for Ca 2+ absorption or that loss of osteoc last H + ,K + ATPase mediated bone resorption affects Ca 2+ balance. Tissue specific knockout mice of HK 1 in the bone if present, and stomach will be a useful tool to determine if disrupted Ca 2+ excretion 1 null mice results from a bone or gastric mechanism Final Conclusions Our studies support further exploration of the mechanisms by which renal H + ,K + ATPases modulate Na + balance and of their potential involvement in blood pressure control. The role of sex hormones to regulate H + ,K + ATPase mediated K + transport is another area of particular interest. Finally, it appears that H + ,K + ATPases may play hereto unforeseen but imp ortant parts in vasopressin mediated H 2 O reabsorption, obesity, and bone resorption. Much investigation is needed to understand the full importance of H + ,K + ATPases to renal physiology and in other tissues throughout the body.

PAGE 155

155 Figure 6 1 Proposed model of coupled ENaC mediated Na + reabsorption and H + ,K + ATPase mediated K + recycling in the collecting duct. In PCs, K + secretion is, in part, dependent on electrogenic Na + reabsorption through ENaC. HK 2 containing H + ,K + ATPases in PCs or ICs reabsorb the secreted K + The reabsorbed K + exits the basolateral membrane of these cells via unknown K + channels or cotransporters. The basolateral Na + ,K + ATPase of PCs uses the recycled K + to reabsorb intracellular Na + and maintain electrogenic Na + reabs orption through ENaC.

PAGE 156

156 Figure 6 2 An acid loaded diet did not further acidify urine from HK 1 / mice. Urine pH was measured in WT and HK 1 / mice pair fed a normal gel diet then switched to a 0.28M NH 4 Cl loaded diet for 6 days. Data are shown as mean SEM and were analyzed by two way repeated measure ANOVA denotes P<0.05 versus WT. § denotes P<0.05 versus normal diet in same genotype. N=3 Figure 6 3 Mmu miR UTR of the mouse Atp12a (H K 2 ) gene TargetScanMouse ( www.targetscan.org ) was used to Atp12a The transcription stop site is shown in red lettering and the putative binding site for mmu miR 505 is shown in blue lettering.

PAGE 157

157 Figure 6 4 HK 1 / mice exhibit more concentrated urine and enhanced vasopressin excretion. A) Urine osmolality and B) AVP levels were measured in urine samples from female WT HK 1 / and HK 1 ,2 / mice pair fed a normal gel diet. Data are shown as mean SEM and were analyzed by one way ANOVA with post hoc Holm Sidak test. denotes P<0.05 versus WT and versus HK 1 / mice. N=3 8.

PAGE 158

158 Figure 6 5 HK 1 / gain significantly more weight than WT over eight weeks. Body weight, shown as % change from the age of 7 weeks, was measured each week over eight weeks in A) male and B) female WT and HK 1 / mice. Data are shown as mean SEM and were analyzed by two wa y repeated measure ANOVA c denotes P<0.05 versus WT over the time course. N=5 8

PAGE 159

159 Figure 6 6. HK 1,2 / mice exhibited more severe gastric hypertrophy than HK 1 / mice. Stomach weights were measured in WT, HK 1 / and HK 1,2 / mice that were fed a K + depleted diet for 8 days. One half the mice were also treated with DOCP. Data are shown as mean SEM and were analyzed by two way ANOVA with or without repeated measures followed by post hoc Holm Sidak test, where appropriate. and 1 / mice regardless of DOCP treatment. N=3 4.

PAGE 160

160 Figure 6 7 HK 1,2 / mice excrete less urinary Ca 2+ than WT mice. Urine [Ca 2+ ] was measured in WT and HK 1,2 / mice pair fed a normal gel diet. Data are shown as mean t test. denotes P<0.05 versus WT. N=4.

PAGE 161

161 LIST OF REFERENCES 1. Giebisch G, Windhager E: Organization of the Urinary System. In: Medical Physiology, 2nd ed. edited by Boron WF, Boulpaep EL, Phila delphia, PA, Saunders Elsevier, 2009, pp 749 766 2. Giebisch G, Windhager E: Glomerular Filtration and Renal Blood Flow. In: Medical Physiology, 2nd ed. edited by Boron WF, Boulpaep EL, Philadelphia, PA, Saunders Elsevier, 2009, pp 767 781 3. Meneton P, Ic hikawa I, Inagami T, Schnermann J: Renal physiology of the mouse. Am J Physiol Renal Physiol, 278 : F339 51, 2000 4. Aronson PS, Boron WF, Boulpaep EL: Transport of Solutes and Water. In: Medical Physiology, 2nd ed. edited by Boron WF, Boulpaep EL, Philadel phia, PA, Saunders Elsevier, 2009, pp 106 146 5. Giebisch G, Windhager E: Transport of Sodium and Chloride. In: Medical Physiology, 2nd ed. edited by Boron WF, Boulpaep EL, Philadelphia, PA, Saunders Elsevier, 2009, pp 782 796 6. Giebisch G, Krapf R, Wagne r C: Renal and extrarenal regulation of potassium. Kidney Int, 72 : 397 410, 2007 7. Wingo CS: Cortical collecting tubule potassium secretion: effect of amiloride, ouabain, and luminal sodium concentration. Kidney Int, 27 : 886 91, 1985 8. Wingo CS: Potassium secretion by the cortical collecting tubule: effect of C1 gradients and ouabain. Am J Physiol, 256 : F306 13, 1989 9. Rieg T, Vallon V, Sausbier M, Sausbier U, Kaissling B, Ruth P, Osswald H: The role of the BK channel in potassium homeo stasis and flow induced renal potassium excretion. Kidney Int, 72 : 566 73, 2007 10. Pluznick JL, Wei P, Grimm PR, Sansom SC: BK {beta}1 subunit: immunolocalization in the mammalian connecting tubule and its role in the kaliuretic response to volume expansi on. Am J Physiol Renal Physiol, 288 : F846 54, 2005 11. Zhou X, Lynch IJ, Xia SL, Wingo CS: Activation of H + K + ATPase by CO(2) requires a basolateral Ba 2+ sensitive pathway during K restriction. Am J Physiol Renal Physiol, 279 : F153 60, 2000 12. Zhou X, Wi ngo CS: Stimulation of total CO2 flux by 10% CO2 in rabbit CCD: role of an apical Sch 28080 and Ba sensitive mechanism. Am J Physiol, 267 : F114 20, 1994

PAGE 162

162 13. Giebisch G, Windhager E: Transport of Potassium. In: Medical Physiology, 2nd ed. edited by Boron W F, Boulpaep EL, Philadelphia, PA, Saunders Elsevier, 2009, pp 821 834 14. Giebisch G, Windhager E: Transport of Acids and Bases. In: Medical Physiology, 2nd ed. edited by Boron WF, Boulpaep EL, Philadelphia, PA, Saunders Elsevier, 2009, pp 851 865 15. Wein er ID, Verlander JW: Role of NH 3 and NH 4 + transporters in renal acid base transport. Am J Physiol Renal Physiol, 300 : F11 23, 2011 16. Wall SM: Recent advances in our understanding of intercalated cells. Curr Opin Nephrol Hypertens, 14 : 480 4, 2005 17. Giebisch G, Windhager E: Integration of Salt and Water Balance. In: Medical Physiology, 2nd ed. edited by Boron WF, Boulpaep EL, Philadelphia, PA, Saunders Elsevier, 2009, pp 866 880 18. Spat A: Glomerulosa cell -a unique sensor of extracellular K + concent ration. Mol Cell Endocrinol, 217 : 23 6, 2004 19. Williams GH: Aldosterone biosynthesis, regulation, and classical mechanism of action. Heart Fail Rev, 10 : 7 13, 2005 20. Kim GH, Masilamani S, Turner R, Mitchell C, Wade JB, Knepper MA: The thiazide sensitiv e Na Cl cotransporter is an aldosterone induced protein. Proc Natl Acad Sci U S A, 95 : 14552 7, 1998 21. Eaton DC, Malik B, Saxena NC, Al Khalili OK, Yue G: Mechanisms of aldosterone's action on epithelial Na + transport. J Membr Biol, 184 : 313 9, 2001 22. Good DW, George T, Watts BA, 3rd: Nongenomic regulation by aldosterone of the epithelial NHE3 Na + /H + exchanger. Am J Physiol Cell Physiol, 290 : C757 63, 2006 23. Drumm K, Kress TR, Gassner B, Krug AW, Gekle M: Aldosterone stimulates activity and surface e xpression of NHE3 in human primary proximal tubule epithelial cells (RPTEC). Cell Physiol Biochem, 17 : 21 8, 2006 24. Krug AW, Papavassiliou F, Hopfer U, Ullrich KJ, Gekle M: Aldosterone stimulates surface expression of NHE3 in renal proximal brush borders Pflugers Arch, 446 : 492 6, 2003 25. Boscaro M, Ronconi V, Turchi F, Giacchetti G: Diagnosis and management of primary aldosteronism. Curr Opin Endocrinol Diabetes Obes, 15 : 332 8, 2008 26. Fuller PJ, Young MJ: Mechanisms of mineralocorticoid action. Hypertension, 46 : 1227 35, 2005

PAGE 163

163 27. Khanna A, Kurtzman NA: Metabolic alkalosis. J Nephrol, 19 Suppl 9 : S86 96, 2006 28. Field MJ, Stanton BA, Giebisch GH: Differential acute effects of aldosterone, dexamethasone, and hyperkalemia on distal tubular potassiu m secretion in the rat kidney. J Clin Invest, 74 : 1792 802, 1984 29. Wingo CS: Effect of ouabain on K secretion in cortical collecting tubules from adrenalectomized rabbits. Am J Physiol, 247 : F588 95, 1984 30. Sorensen MV, Matos JE, Sausbier M, Sausbier U Ruth P, Praetorius HA, Leipziger J: Aldosterone increases KCa1.1 (BK) channel mediated colonic K + secretion. J Physiol, 586 : 4251 64, 2008 31. Greenlee M, Wingo CS, McDonough AA, Youn JH, Kone BC: Narrative review: evolving concepts in potassium homeosta sis and hypokalemia. Ann Intern Med, 150 : 619 25, 2009 32. Wingo CS, Kokko JP, Jacobson HR: Effects of in vitro aldosterone on the rabbit cortical collecting tubule. Kidney Int, 28 : 51 7, 1985 33. Rabinowitz L: Aldosterone and potassium homeostasis. Kidney Int, 49 : 1738 42, 1996 34. Frindt G, Palmer LG: K + secretion in the rat kidney: Na + channel dependent and independent mechanisms. Am J Physiol Renal Physiol, 297 : F389 96, 2009 35. Welbourne TC, Francoeur D: Influence of aldosterone on renal ammonia prod uction. Am J Physiol, 233 : E56 60, 1977 36. Wagner CA, Devuyst O, Bourgeois S, Mohebbi N: Regulated acid base transport in the collecting duct. Pflugers Arch, 458 : 137 56, 2009 37. Dubrovsky AH, Nair RC, Byers MK, Levine DZ: Renal net acid excretion in the adrenalectomized rat. Kidney Int, 19 : 516 28, 1981 38. Winter C, Schulz N, Giebisch G, Geibel JP, Wagner CA: Nongenomic stimulation of vacuolar H + ATPases in intercalated renal tubule cells by aldosterone. Proc Natl Acad Sci U S A, 101 : 2636 41, 2004 39. Dos Santos PM, Freitas FP, Mendes J, Tararthuch AL, Fernandez R: Differential regulation of H + ATPases in MDCK C11 cells by aldosterone and vasopressin. Can J Physiol Pharmacol, 87 : 653 65, 2009 40. Gekle M, Silbernagl S, Oberleithner H: The mineralocortic oid aldosterone activates a proton conductance in cultured kidney cells. Am J Physiol, 273 : C1673 8, 1997 41. Eiam Ong S, Kurtzman NA, Sabatini S: Regulation of collecting tubule adenosine triphosphatases by aldosterone and potassium. J Clin Invest, 91 : 23 85 92, 1993

PAGE 164

164 42. Barrett EJ: Organization of Endocrine Control. In: Medical Physiology, 2nd ed. edited by Boron WF, Boulpaep EL, Philadelphia, PA, Saunders Elsevier, 2009, pp 1011 1027 43. Giebisch G, Windhager E: Urine Concentration and Dilution. In: Medic al Physiology, 2nd ed. edited by Boron WF, Boulpaep EL, Philadelphia, PA, Saunders Elsevier, 2009, pp 835 850 44. Noda Y, Sohara E, Ohta E, Sasaki S: Aquaporins in kidney pathophysiology. Nat Rev Nephrol, 6 : 168 78, 2010 45. Bugaj V, Pochynyuk O, Stockand JD: Activation of the epithelial Na + channel in the collecting duct by vasopressin contributes to water reabsorption. Am J Physiol Renal Physiol, 297 : F1411 8, 2009 46. Kohan DE: The renal medullary endothelin system in control of sodium and water excretio n and systemic blood pressure. Curr Opin Nephrol Hypertens, 15 : 34 40, 2006 47. Kohan DE: Endothelin, hypertension and chronic kidney disease: new insights. Curr Opin Nephrol Hypertens, 19 : 134 9, 2010 48. Davenport AP, Kuc RE, Maguire JJ, Harland SP: ETA receptors predominate in the human vasculature and mediate constriction. J Cardiovasc Pharmacol, 26 Suppl 3 : S265 7, 1995 49. Bugaj V, Pochynyuk O, Mironova E, Vandewalle A, Medina JL, Stockand JD: Regulation of the epithelial Na + channel by endothelin 1 i n rat collecting duct. Am J Physiol Renal Physiol, 295 : F1063 70, 2008 50. Nakano D, Pollock JS, Pollock DM: Renal medullary ETB receptors produce diuresis and natriuresis via NOS1. Am J Physiol Renal Physiol, 294 : F1205 11, 2008 51. Wesson DE: Endothelin role in kidney acidification. Semin Nephrol, 26 : 393 8, 2006 52. Wesson DE: Regulation of kidney acid excretion by endothelins. Kidney Int, 70 : 2066 73, 2006 53. Laghmani K, Preisig PA, Alpern RJ: The role of endothelin in proximal tubule proton secretion and the adaptation to a chronic metabolic acidosis. J Nephrol, 15 Suppl 5 : S75 87, 2002 54. Laghmani K, Preisig PA, Moe OW, Yanagisawa M, Alpern RJ: Endothelin 1/endothelin B receptor mediated increases in NHE3 activity in chronic metabolic acidosis. J Cli n Invest, 107 : 1563 9, 2001

PAGE 165

165 55. Laghmani K, Sakamoto A, Yanagisawa M, Preisig PA, Alpern RJ: A consensus sequence in the endothelin B receptor second intracellular loop is required for NHE3 activation by endothelin 1. Am J Physiol Renal Physiol, 288 : F732 9, 2005 56. Khanna A, Simoni J, Hacker C, Duran MJ, Wesson DE: Increased endothelin activity mediates augmented distal nephron acidification induced by dietary protein. Trans Am Clin Climatol Assoc, 116 : 239 56; discussion 257 8, 2005 57. Teng umnuay P, Ve rlander JW, Yuan W, Tisher CC, Madsen KM: Identification of distinct subpopulations of intercalated cells in the mouse collecting duct. J Am Soc Nephrol, 7 : 260 74, 1996 58. Gormley K, Dong Y, Sagnella GA: Regulation of the epithelial sodium channel by acc essory proteins. Biochem J, 371 : 1 14, 2003 59. Frindt G, Ergonul Z, Palmer LG: Na channel expression and activity in the medullary collecting duct of rat kidney. Am J Physiol Renal Physiol, 292 : F1190 6, 2007 60. Chen SY, Bhargava A, Mastroberardino L, Me ijer OC, Wang J, Buse P, Firestone GL, Verrey F, Pearce D: Epithelial sodium channel regulated by aldosterone induced protein sgk. Proc Natl Acad Sci U S A, 96 : 2514 9, 1999 61. Verrey F, Schaerer E, Zoerkler P, Paccolat MP, Geering K, Kraehenbuhl JP, Ross ier BC: Regulation by aldosterone of Na + ,K + ATPase mRNAs, protein synthesis, and sodium transport in cultured kidney cells. J Cell Biol, 104 : 1231 7, 1987 62. Verrey F, Summa V, Heitzmann D, Mordasini D, Vandewalle A, Feraille E, Zecevic M: Short term aldo sterone action on Na,K ATPase surface expression: role of aldosterone induced SGK1? Ann N Y Acad Sci, 986 : 554 61, 2003 63. Spindler B, Mastroberardino L, Custer M, Verrey F: Characterization of early aldosterone induced RNAs identified in A6 kidney epithe lia. Pflugers Arch, 434 : 323 31, 1997 64. Stow LR, Gumz ML, Lynch IJ, Greenlee MM, Rudin A, Cain BD, Wingo CS: Aldosterone modulates steroid receptor binding to the endothelin 1 gene (edn1). J Biol Chem, 284 : 30087 96, 2009 65. Pochynyuk O, Bugaj V, Stockand JD: Physiologic regulation of the epithelial sodium channel by phosphatidylinositides. Curr Opin Nephrol Hypertens, 17 : 533 40, 2008 66. Rubera I, Loffing J, Palmer LG, Frindt G, Fowler Jaeger N, Sauter D, Carroll T, McMahon A, Hummler E, Rossier BC: Collecting duct specific gene inactivation of alphaENaC in the mouse kidney does not impair sodium and potassium balance. J Clin Invest, 112 : 554 65, 2003

PAGE 166

166 67. Pradervand S, Barker PM, Wang Q, Ernst SA, Beermann F, Grubb BR, Burnie r M, Schmidt A, Bindels RJ, Gatzy JT, Rossier BC, Hummler E: Salt restriction induces pseudohypoaldosteronism type 1 in mice expressing low levels of the beta subunit of the amiloride sensitive epithelial sodium channel. Proc Natl Acad Sci U S A, 96 : 1732 7, 1999 68. Christensen BM, Perrier R, Wang Q, Zuber AM, Maillard M, Mordasini D, Malsure S, Ronzaud C, Stehle JC, Rossier BC, Hummler E: Sodium and potassium balance depends on alphaENaC expression in connecting tubule. J Am Soc Nephrol, 21 : 1942 51, 2010 69. Leviel F, Hubner CA, Houillier P, Morla L, El Moghrabi S, Brideau G, Hatim H, Parker MD, Kurth I, Kougioumtzes A, Sinning A, Pech V, Riemondy KA, Miller RL, Hummler E, Shull GE, Aronson PS, Doucet A, Wall SM, Chambrey R, Eladari D: The Na + dependent c hloride bicarbonate exchanger SLC4A8 mediates an electroneutral Na + reabsorption process in the renal cortical collecting ducts of mice. J Clin Invest, 120 : 1627 35, 2010 70. Bouley R, Lu HA, Nunes P, Da Silva N, McLaughlin M, Chen Y, Brown D: Calcitonin h as a vasopressin like effect on aquaporin 2 trafficking and urinary concentration. J Am Soc Nephrol, 22 : 59 72, 2011 71. Terada Y, Tomita K, Nonoguchi H, Yang T, Marumo F: Different localization and regulation of two types of vasopressin receptor messenger RNA in microdissected rat nephron segments using reverse transcription polymerase chain reaction. J Clin Invest, 92 : 2339 45, 1993 72. Carmosino M, Brooks HL, Cai Q, Davis LS, Opalenik S, Hao C, Breyer MD: Axial heterogeneity of vasopressin receptor subtypes along the human and mouse collecting duct. Am J Physiol Renal Physiol, 292 : F351 60, 2007 73. Memetimin H, Izumi Y, Nakayama Y, Kohd a Y, Inoue H, Nonoguchi H, Tomita K: Low pH stimulates vasopressin V2 receptor promoter activity and enhances downregulation induced by V1a receptor stimulation. Am J Physiol Renal Physiol, 297 : F620 8, 2009 74. Amlal H, Krane CM, Chen Q, Soleimani M: Earl y polyuria and urinary concentrating defect in potassium deprivation. Am J Physiol Renal Physiol, 279 : F655 63, 2000 75. Ma T, Song Y, Yang B, Gillespie A, Carlson EJ, Epstein CJ, Verkman AS: Nephrogenic diabetes insipidus in mice lacking aquaporin 3 water channels. Proc Natl Acad Sci U S A, 97 : 4386 91, 2000 76. Chou CL, Ma T, Yang B, Knepper MA, Verkman AS: Fourfold reduction of water permeability in inner medullary collecting duct of aquaporin 4 knockout mice. Am J Physiol, 274 : C549 54, 1998

PAGE 167

167 77. Wang WH Giebisch G: Regulation of potassium (K) handling in the renal collecting duct. Pflugers Arch, 458 : 157 68, 2009 78. Frindt G, Palmer LG: Ca activated K channels in apical membrane of mammalian CCT, and their role in K secretion. Am J Physiol, 252 : F458 6 7, 1987 79. Frindt G, Palmer LG: Low conductance K channels in apical membrane of rat cortical collecting tubule. Am J Physiol, 256 : F143 51, 1989 80. Frindt G, Palmer LG: Apical potassium channels in the rat connecting tubule. Am J Physiol Renal Physiol, 287 : F1030 7, 2004 81. Mennitt PA, Wade JB, Ecelbarger CA, Palmer LG, Frindt G: Localization of ROMK channels in the rat kidney. J Am Soc Nephrol, 8 : 1823 30, 1997 82. Pacha J, Frindt G, Sackin H, Palmer LG: Apical maxi K channels in intercalated cells of CCT. Am J Physiol, 261 : F696 705, 1991 83. Najjar F, Zhou H, Morimoto T, Bruns JB, Li HS, Liu W, Kleyman TR, Satlin LM: Dietary K + regulates apical membrane expression of maxi K channels in rabbit cortical collecting duct. Am J Physiol Renal Physiol, 289 : F922 32, 2005 84. Woda CB, Bragin A, Kleyman TR, Satlin LM: Flow dependent K + secretion in the cortical collecting duct is mediated by a maxi K channel. Am J Physiol Renal Physiol, 280 : F786 93, 2001 85. Wingo CS: Reversible chloride dependent potassium flux across the rabbit cortical collecting tubule. Am J Physiol, 256 : F697 704, 1989 86. Greenlee MM, Lynch IJ, Gumz ML, Cain BD, Wingo CS: The renal H,K ATPases. Curr Opin Nephrol Hypertens 2010 87. Gumz ML, Lynch IJ, Greenlee MM, Cain BD, Wingo CS: The renal H + K + ATPases: physiology, regulation, and structure. Am J Physiol Renal Physiol, 298 : F12 21, 2010 88. Lynch IJ, Greenlee MM, Gumz ML, Rudin A, Xia SL, Wingo CS: Heterogeneity of H K ATPase mediated acid secretion along the mouse collecting duct. Am J Physiol Renal Physiol, 298 : F408 15, 2010 89. Lynch IJ, Rudin A, Xia SL, Stow LR, Shull GE, Weiner ID, Cain BD, Wingo CS: Impaired acid secretion in cortical collecting duct intercalated cells from H K A TPase deficient mice: role of HKalpha isoforms. Am J Physiol Renal Physiol, 294 : F621 7, 2008 90. Verlander JW, Moudy RM, Campbell WG, Cain BD, Wingo CS: Immunohistochemical localization of H K ATPase alpha(2c) subunit in rabbit kidney. Am J Physiol Renal Physiol, 281 : F357 65, 2001

PAGE 168

168 91. Huang CL, Kuo E: Mechanisms of disease: WNK ing at the mechanism of salt sensitive hypertension. Nat Clin Pract Nephrol, 3 : 623 30, 2007 92. Lazrak A, Liu Z, Huang CL: Antagonistic regulation of ROMK by long and kidney speci fic WNK1 isoforms. Proc Natl Acad Sci U S A, 103 : 1615 20, 2006 93. Palmer LG, Frindt G: Aldosterone and potassium secretion by the cortical collecting duct. Kidney Int, 57 : 1324 8, 2000 94. Fodstad H, Gonzalez Rodriguez E, Bron S, Gaeggeler H, Guisan B, R ossier BC, Horisberger JD: Effects of mineralocorticoid and K + concentration on K + secretion and ROMK channel expression in a mouse cortical collecting duct cell line. Am J Physiol Renal Physiol, 296 : F966 75, 2009 95. Wingo CS, Seldin DW, Kokko JP, Jacobs on HR: Dietary modulation of active potassium secretion in the cortical collecting tubule of adrenalectomized rabbits. J Clin Invest, 70 : 579 86, 1982 96. Babilonia E, Li D, Wang Z, Sun P, Lin DH, Jin Y, Wang WH: Mitogen activated protein kinases inhibit t he ROMK (Kir 1.1) like small conductance K channels in the cortical collecting duct. J Am Soc Nephrol, 17 : 2687 96, 2006 97. Li D, Wang Z, Sun P, Jin Y, Lin DH, Hebert SC, Giebisch G, Wang WH: Inhibition of MAPK stimulates the Ca 2+ dependent big conductan ce K channels in cortical collecting duct. Proc Natl Acad Sci U S A, 103 : 19569 74, 2006 98. Schulz N, Dave MH, Stehberger PA, Chau T, Wagner CA: Differential localization of vacuolar H + ATPases containing a1, a2, a3, or a4 (ATP6V0A1 4) subunit isoforms al ong the nephron. Cell Physiol Biochem, 20 : 109 20, 2007 99. Smith AN, Skaug J, Choate KA, Nayir A, Bakkaloglu A, Ozen S, Hulton SA, Sanjad SA, Al Sabban EA, Lifton RP, Scherer SW, Karet FE: Mutations in ATP6N1B, encoding a new kidney vacuolar proton pump 1 16 kD subunit, cause recessive distal renal tubular acidosis with preserved hearing. Nat Genet, 26 : 71 5, 2000 100. Cheval L, Morla L, Elalouf JM, Doucet A: Kidney collecting duct acid base "regulon". Physiol Genomics, 27 : 271 81, 2006 101. Fejes Toth G, Naray Fejes Toth A: Effect of acid/base balance on H ATPase 31 kD subunit mRNA levels in collecting duct cells. Kidney Int, 48 : 1420 6, 1995 102. Narbaitz R, Murugesan S, Levine DZ: K depletion and NH 4 Cl acidosis increase apical insertion of studded membrane in type A intercalated cells. Am J Physiol, 270 : F649 56, 1996

PAGE 169

169 103. Purkerson JM, Tsuruoka S, Suter DZ, Nakamori A, Schwartz GJ: Adaptation to metabolic acidosis and its recovery are associated wit h changes in anion exchanger distribution and expression in the cortical collecting duct. Kidney Int, 78 : 993 1005, 2010 104. Tsuruoka S, Schwartz GJ: Metabolic acidosis stimulates H + secretion in the rabbit outer medullary collecting duct (inner stripe) o f the kidney. J Clin Invest, 99 : 1420 31, 1997 105. Verlander JW, Madsen KM, Cannon JK, Tisher CC: Activation of acid secreting intercalated cells in rabbit collecting duct with ammonium chloride loading. Am J Physiol, 266 : F633 45, 1994 106. Sabolic I, Br own D, Gluck SL, Alper SL: Regulation of AE1 anion exchanger and H + ATPase in rat cortex by acute metabolic acidosis and alkalosis. Kidney Int, 51 : 125 37, 1997 107. Schwartz JH, Alexander EA: Adaptation of intercalated cells along the collecting duct to s ystemic acid/base changes. Kidney Int, 78 : 949 51, 2010 108. Verlander JW, Madsen KM, Galla JH, Luke RG, Tisher CC: Response of intercalated cells to chloride depletion metabolic alkalosis. Am J Physiol, 262 : F309 19, 1992 109. Finberg KE, Wagner CA, Baile y MA, Paunescu TG, Breton S, Brown D, Giebisch G, Geibel JP, Lifton RP: The B1 subunit of the H + ATPase is required for maximal urinary acidification. Proc Natl Acad Sci U S A, 102 : 13616 21, 2005 110. Valles P, Wysocki J, Salabat MR, Cokic I, Ye M, LaPoin te MS, Batlle D: Angiotensin II increases H + ATPase B1 subunit expression in medullary collecting ducts. Hypertension, 45 : 818 23, 2005 111. Rothenberger F, Velic A, Stehberger PA, Kovacikova J, Wagner CA: Angiotensin II stimulates vacuolar H + ATPase acti vity in renal acid secretory intercalated cells from the outer medullary collecting duct. J Am Soc Nephrol, 18 : 2085 93, 2007 112. Laing CM, Toye AM, Capasso G, Unwin RJ: Renal tubular acidosis: developments in our understanding of the molecular basis. Int J Biochem Cell Biol, 37 : 1151 61, 2005 113. Stehberger PA, Shmukler BE, Stuart Tilley AK, Peters LL, Alper SL, Wagner CA: Distal renal tubular acidosis in mice lacking the AE1 (band3) Cl /HCO3 exchanger (slc4a1). J Am Soc Nephrol, 18 : 1408 18, 2007

PAGE 170

170 114 Karet FE, Gainza FJ, Gyory AZ, Unwin RJ, Wrong O, Tanner MJ, Nayir A, Alpay H, Santos F, Hulton SA, Bakkaloglu A, Ozen S, Cunningham MJ, di Pietro A, Walker WG, Lifton RP: Mutations in the chloride bicarbonate exchanger gene AE1 cause autosomal dominant but not autosomal recessive distal renal tubular acidosis. Proc Natl Acad Sci U S A, 95 : 6337 42, 1998 115. Amlal H, Petrovic S, Xu J, Wang Z, Sun X, Barone S, Soleimani M: Deletion of the anion exchanger Slc26a4 (pendrin) decreases apical Cl( )/HCO3( ) ex changer activity and impairs bicarbonate secretion in kidney collecting duct. Am J Physiol Cell Physiol, 299 : C33 41, 2010 116. Frische S, Kwon TH, Frokiaer J, Madsen KM, Nielsen S: Regulated expression of pendrin in rat kidney in response to chronic NH 4 Cl or NaHCO 3 loading. Am J Physiol Renal Physiol, 284 : F584 93, 2003 117. Quentin F, Chambrey R, Trinh Trang Tan MM, Fysekidis M, Cambillau M, Paillard M, Aronson PS, Eladari D: The Cl /HCO3 exchanger pendrin in the rat kidney is regulated in response to ch ronic alterations in chloride balance. Am J Physiol Renal Physiol, 287 : F1179 88, 2004 118. Verlander JW, Hassell KA, Royaux IE, Glapion DM, Wang ME, Everett LA, Green ED, Wall SM: Deoxycorticosterone upregulates PDS (Slc26a4) in mouse kidney: role of pendrin in mineralocorticoid induced hypertension. Hypertension, 42 : 356 62, 2003 119. Verlander JW, Kim YH, Shin W, Pham TD, Hassell KA, Beierwaltes WH, Green ED, Everett L, Matthews SW, Wall SM: Dietary Cl( ) restriction upregulates pendrin expression within the apical plasma membrane of type B intercalated cells. Am J Physiol Renal Physiol, 291 : F 833 9, 2006 120. Wall SM, Kim YH, Stanley L, Glapion DM, Everett LA, Green ED, Verlander JW: NaCl restriction upregulates renal Slc26a4 through subcellular redistribution: role in Cl conservation. Hypertension, 44 : 982 7, 2004 121. Pech V, Pham TD, Hong S Weinstein AM, Spencer KB, Duke BJ, Walp E, Kim YH, Sutliff RL, Bao HF, Eaton DC, Wall SM: Pendrin modulates ENaC function by changing luminal HCO3. J Am Soc Nephrol, 21 : 1928 41, 2010 122. Kim YH, Pech V, Spencer KB, Beierwaltes WH, Everett LA, Green ED, Shin W, Verlander JW, Sutliff RL, Wall SM: Reduced ENaC protein abundance contributes to the lower blood pressure observed in pendrin null mice. Am J Physiol Renal Physiol, 293 : F1314 24, 2007 123. Kim HY, Verlander JW, Bishop JM, Cain BD, Han KH, Igarash i P, Lee HW, Handlogten ME, Weiner ID: Basolateral expression of the ammonia transporter family member Rh C glycoprotein in the mouse kidney. Am J Physiol Renal Physiol, 296 : F543 55, 2009

PAGE 171

171 124. Verlander JW, Miller RT, Frank AE, Royaux IE, Kim YH, Weiner I D: Localization of the ammonium transporter proteins RhBG and RhCG in mouse kidney. Am J Physiol Renal Physiol, 284 : F323 37, 2003 125. Bishop JM, Verlander JW, Lee HW, Nelson RD, Weiner AJ, Handlogten ME, Weiner ID: Role of the Rhesus glycoprotein, Rh B glycoprotein, in renal ammonia excretion. Am J Physiol Renal Physiol, 299 : F1065 77, 2010 126. Lee HW, Verlander JW, Bishop JM, Nelson RD Handlogten ME, Weiner ID: Effect of intercalated cell specific Rh C glycoprotein deletion on basal and metabolic acidosis stimulated renal ammonia excretion. Am J Physiol Renal Physiol, 299 : F369 79, 2010 127. Seshadri RM, Klein JD, Kozlowski S, Sands JM Kim YH, Han KH, Handlogten ME, Verlander JW, Weiner ID: Renal expression of the ammonia transporters, Rhbg and Rhcg, in response to chronic metabolic acidosis. Am J Physiol Renal Physiol, 290 : F397 408, 2006 128. Lee HW, Verlander JW, Bishop JM, Igarashi P, Handlogten ME, Weiner ID: Collecting duct specific Rh C glycoprotein deletion alters basal and acidosis stimulated renal ammonia excretion. Am J Physiol Renal Physiol, 296 : F1364 75, 2009 129. Ganser AL, Forte JG: K + stimulated ATPase in purified mic rosomes of bullfrog oxyntic cells. Biochim Biophys Acta, 307 : 169 80, 1973 130. Sachs G, Chang HH, Rabon E, Schackman R, Lewin M, Saccomani G: A nonelectrogenic H + pump in plasma membranes of hog stomach. J Biol Chem, 251 : 7690 8, 1976 131. Gustin MC, Good man DB: Isolation of brush border membrane from the rabbit descending colon epithelium. Partial characterization of a unique K + activated ATPase. J Biol Chem, 256 : 10651 6, 1981 132. Kaunitz JD, Sachs G: Identification of a vanadate sensitive potassium dep endent proton pump from rabbit colon. J Biol Chem, 261 : 14005 10, 1986 133. Doucet A, Marsy S: Characterization of K ATPase activity in distal nephron: stimulation by potassium depletion. Am J Physiol, 253 : F418 23, 1987 134. Garg LC, Narang N: Ouabain ins ensitive K adenosine triphosphatase in distal nephron segments of the rabbit. J Clin Invest, 81 : 1204 8, 1988 135. Wingo CS: Active proton secretion and potassium absorption in the rabbit outer medullary collecting duct. Functional evidence for proton pota ssium activated adenosine triphosphatase. J Clin Invest, 84 : 361 5, 1989

PAGE 172

172 136. Rabon EC, McFall TL, Sachs G: The gastric [H,K]ATPase:H + /ATP stoichiometry. J Biol Chem, 257 : 6296 9, 1982 137. Geering K: FXYD proteins: new regulators of Na K ATPase. Am J Physiol Renal Physiol, 290 : F241 50, 2006 138. Gumz ML, Duda D, McKenna R, Wingo CS, Cain BD: Molecular modeling of the rabbit colonic (HKalpha2a) H + K + ATPase. J Mol Model, 9 : 283 9, 2003 139. Beggah AT, Beguin P, Bamberg K, Sachs G, Geering K: beta subu nit assembly is essential for the correct packing and the stable membrane insertion of the H,K ATPase alpha subunit. J Biol Chem, 274 : 8217 23, 1999 140. Vagin O, Turdikulova S, Sachs G: The H,K ATPase beta subunit as a model to study the role of N glycosy lation in membrane trafficking and apical sorting. J Biol Chem, 279 : 39026 34, 2004 141. Vagin O, Denevich S, Sachs G: Plasma membrane delivery of the gastric H,K ATPase: the role of beta subunit glycosylation. Am J Physiol Cell Physiol, 285 : C968 76, 2003 142. Codina J, Kone BC, Delmas Mata JT, DuBose TD, Jr.: Functional expression of the colonic H + ,K + ATPase alpha subunit. Pharmacologic properties and assembly with X + ,K + ATPase beta subunits. J Biol Chem, 271 : 29759 63, 1996 143. Sangan P, Thevananther S, Sangan S, Rajendran VM, Binder HJ: Colonic H K ATPase alpha and beta subunits express ouabain insensitive H K ATPase. Am J Physiol Cell Physiol, 278 : C182 9, 2000 144. Sangan P, Kolla SS, Rajendran VM, Kashgarian M, Binder HJ: Colonic H K ATPase beta sub unit: identification in apical membranes and regulation by dietary K depletion. Am J Physiol, 276 : C350 60, 1999 145. Codina J, Delmas Mata JT, DuBose TD, Jr.: The alpha subunit of the colonic H + ,K + ATPase assembles with beta1 Na + ,K + ATPase in kidney and d istal colon. J Biol Chem, 273 : 7894 9, 1998 146. Kraut JA, Hiura J, Shin JM, Smolka A, Sachs G, Scott D: The Na + K + ATPase beta 1 subunit is associated with the HK alpha 2 protein in the rat kidney. Kidney Int, 53 : 958 62, 1998 147. Shao J, Gumz ML, Cain B D, Xia SL, Shull GE, van Driel IR, Wingo CS: Pharmacological profiles of the murine gastric and colonic H,K ATPases. Biochim Biophys Acta, 1800 : 906 11, 2010 148. Buffin Meyer B, Younes Ibrahim M, Barlet Bas C, Cheval L, Marsy S, Doucet A: K depletion modi fies the properties of Sch 28080 sensitive K ATPase in rat collecting duct. Am J Physiol, 272 : F124 31, 1997

PAGE 173

173 149. Cougnon M, Planelles G, Crowson MS, Shull GE, Rossier BC, Jaisser F: The rat distal colon P ATPase alpha subunit encodes a ouabain sensitive H + K + ATPase. J Biol Chem, 271 : 7277 80, 1996 150. Del Castillo JR, Rajendran VM, Binder HJ: Apical membrane localization of ouabain sensitive K + activated ATPase activities in rat distal colon. Am J Physiol, 261 : G1005 11, 1991 151. Dherbecourt O, Cheval L, Bloch Faure M, Meneton P, Doucet A: Molecular identification of Sch28080 sensitive K ATPase activities in the mouse kidney. Pflugers Arch, 451 : 769 75, 2006 152. Abe K, Tani K, Fujiyoshi Y: Structural and functional characterizatio n of H + K + ATPase with bound fluorinated phosphate analogs. J Struct Biol, 170 : 60 8, 2010 153. Abe K, Tani K, Fujiyoshi Y: Conformational rearrangement of gastric H + ,K + ATPase induced by an acid suppressant. Nat Commun, 2 : 155, 2011 154. Abe K, Tani K, Nishizawa T, Fujiyoshi Y: Inter subunit interaction of gastric H + ,K + ATPase prevents reverse reaction of the transport cycle. Embo J, 28 : 1637 43, 2009 155. Zhou X, Wingo CS: Mechanisms of rubidium permeation by rabbit cortical collecting duct during potas sium restriction. Am J Physiol, 263 : F1134 41, 1992 156. Zhou X, Xia SL, Wingo CS: Chloride transport by the rabbit cortical collecting duct: dependence on H,K ATPase. J Am Soc Nephrol, 9 : 2194 202, 1998 157. Swarts HG, Koenderink JB, Willems PH, De Pont J J: The human non gastric H,K ATPase has a different cation specificity than the rat enzyme. Biochim Biophys Acta, 1768 : 580 9, 2007 158. Swarts HG, Klaassen CH, Schuurmans Stekhoven FM, De Pont JJ: Sodium acts as a potassium analog on gastric H,K ATPase. J Biol Chem, 270 : 7890 5, 1995 159. Codina J, Pressley TA, DuBose TD, Jr.: The colonic H + ,K + ATPase functions as a Na + dependent K + (NH 4 + ) ATPase in apical membranes from rat distal colon. J Biol Chem, 274 : 19693 8, 1999 160. Swarts HG, Koenderink JB, Willem s PH, De Pont JJ: The non gastric H,K ATPase is oligomycin sensitive and can function as an H + ,NH 4 + ATPase. J Biol Chem, 280 : 33115 22, 2005 161. Crowson MS, Shull GE: Isolation and characterization of a cDNA encoding the putative distal colon H + ,K + ATPase Similarity of deduced amino acid sequence to gastric H + ,K + ATPase and Na + ,K + ATPase and mRNA expression in distal colon, kidney, and uterus. J Biol Chem, 267 : 13740 8, 1992

PAGE 174

174 162. Shull GE: cDNA cloning of the beta subunit of the rat gastric H,K ATPase. J Biol Chem, 265 : 12123 6, 1990 163. Shull GE, Lingrel JB: Molecular cloning of the rat stomach (H + + K + ) ATPase. J Biol Chem, 261 : 16788 91, 1986 164. Muraoka A, Kaise M, Guo YJ, Yamada J, Song I, DelValle J, Todisco A, Yamada T: Canine H + K + ATPase alpha s ubunit gene promoter: studies with canine parietal cells in primary culture. Am J Physiol, 271 : G1104 13, 1996 165. Newman PR, Greeb J, Keeton TP, Reyes AA, Shull GE: Structure of the human gastric H,K ATPase gene and comparison of the 5' flanking sequence s of the human and rat genes. DNA Cell Biol, 9 : 749 62, 1990 166. Zhang W, Kuncewicz T, Higham SC, Kone BC: Structure, promoter analysis, and chromosomal localization of the murine H + /K + ATPase alpha 2 subunit gene. J Am Soc Nephrol, 12 : 2554 64, 2001 167. Sverdlov VE, Kostina MB, Modyanov NN: Genomic organization of the human ATP1AL1 gene encoding a ouabain sensitive H,K ATPase. Genomics, 32 : 317 27, 1996 168. Schar P, Fritsch O: DNA repair and the control of DNA methylation. Prog Drug Res, 67 : 51 68, 2011 169. Canfield VA, Levenson R: Structural organization and transcription of the mouse gastric H + K + ATPase beta subunit gene. Proc Natl Acad Sci U S A, 88 : 8247 51, 1991 170. Canfield VA, Okamoto CT, Chow D, Dorfman J, Gros P, Forte JG, Levenson R: Clonin g of the H,K ATPase beta subunit. Tissue specific expression, chromosomal assignment, and relationship to Na,K ATPase beta subunits. J Biol Chem, 265 : 19878 84, 1990 171. Newman PR, Shull GE: Rat gastric H,K ATPase beta subunit gene: intron/exon organizati on, identification of multiple transcription initiation sites, and analysis of the 5' flanking region. Genomics, 11 : 252 62, 1991 172. Herrmann M, Selige J, Raffael S, Sachs G, Brambilla A, Klein T: Systematic expression profiling of the gastric H + /K + ATPa se in human tissue. Scand J Gastroenterol, 42 : 1275 88, 2007 173. Shibata T, Hibino H, Doi K, Suzuki T, Hisa Y, Kurachi Y: Gastric type H + ,K + ATPase in the cochlear lateral wall is critically involved in formation of the endocochlear potential. Am J Physio l Cell Physiol, 291 : C1038 48, 2006

PAGE 175

175 174. Callaghan JM, Tan SS, Khan MA, Curran KA, Campbell WG, Smolka AJ, Toh BH, Gleeson PA, Wingo CS, Cain BD, et al.: Renal expression of the gene encoding the gastric H + K + ATPase beta subunit. Am J Physiol, 268 : F363 7 4, 1995 175. Campbell Thompson ML, Verlander JW, Curran KA, Campbell WG, Cain BD, Wingo CS, McGuigan JE: In situ hybridization of H K ATPase beta subunit mRNA in rat and rabbit kidney. Am J Physiol, 269 : F345 54, 1995 176. Pestov NB, Korneenko TV, Adams G, Tillekeratne M, Shakhparonov MI, Modyanov NN: Nongastric H K ATPase in rodent prostate: lobe specific expression and apical localization. Am J Physiol Cell Physiol, 282 : C907 16, 2002 177. Pestov NB, Korneenko TV, Radkov R Zhao H, Shakhparonov MI, Modyanov NN: Identification of the beta subunit for nongastric H K ATPase in rat anterior prostate. Am J Physiol Cell Physiol, 286 : C1229 37, 2004 178. Pestov NB, Korneenko TV, Shakhparonov MI, Shull GE, Modyanov NN: Loss of acid ification of anterior prostate fluids in Atp12a null mutant mice indicates that nongastric H K ATPase functions as proton pump in vivo. Am J Physiol Cell Physiol, 291 : C366 74, 2006 179. Pestov NB, Romanova LG, Korneenko TV, Egorov MV, Kostina MB, Sverdlov VE, Askari A, Shakhparonov MI, Modyanov NN: Ouabain sensitive H,K ATPase: tissue specific expression of the mammalian genes encoding the catalytic alpha subunit. FEBS Lett, 440 : 320 4, 1998 180. Ahn KY, Kone BC: Expression and cellular localization of mRN A encoding the "gastric" isoform of H + K + ATPase alpha subunit in rat kidney. Am J Physiol, 268 : F99 109, 1995 181. Ahn KY, Park KY, Kim KK, Kone BC: Chronic hypokalemia enhances expression of the H + K + ATPase alpha 2 subunit gene in renal medulla. Am J Physiol, 271 : F314 21, 1996 182. Bastani B: Colocalization of H ATPase and H,K ATPase immunoreactivity in the rat kidney. J Am Soc Nephrol, 5 : 1476 82, 1995 183. Fejes Toth G, Naray Fejes Toth A: Immunohistochemical localization of colonic H K ATPase to th e apical membrane of connecting tubule cells. Am J Physiol Renal Physiol, 281 : F318 25, 2001 184. Fejes Toth G, Naray Fejes Toth A, Velazquez H: Intrarenal distribution of the colonic H,K ATPase mRNA in rabbit. Kidney Int, 56 : 1029 36, 1999 185. Kraut JA, Helander KG, Helander HF, Iroezi ND, Marcus EA, Sachs G: Detection and localization of H + K + ATPase isoforms in human kidney. Am J Physiol Renal Physiol, 281 : F763 8, 2001

PAGE 176

176 186. Wingo CS, Madsen KM, Smolka A, Tisher CC: H K ATPase immunoreactivity in cortic al and outer medullary collecting duct. Kidney Int, 38 : 985 90, 1990 187. Codina J, Delmas Mata JT, DuBose TD, Jr.: Expression of HKalpha2 protein is increased selectively in renal medulla by chronic hypokalemia. Am J Physiol, 275 : F433 40, 1998 188. Fejes Toth G, Rusvai E, Longo KA, Naray Fejes Toth A: Expression of colonic H K ATPase mRNA in cortical collecting duct: regulation by acid/base balance. Am J Physiol, 269 : F551 7, 1995 189. Wingo CS, Armitage FE: Rubidium absorption and proton secretion by rab bit outer medullary collecting duct via H K ATPase. Am J Physiol, 263 : F849 57, 1992 190. Ahn KY, Turner PB, Madsen KM, Kone BC: Effects of chronic hypokalemia on renal expression of the "gastric" H + K + ATPase alpha subunit gene. Am J Physiol, 270 : F557 66 1996 191. Silver RB, Choe H, Frindt G: Low NaCl diet increases H K ATPase in intercalated cells from rat cortical collecting duct. Am J Physiol, 275 : F94 102, 1998 192. Sangan P, Rajendran VM, Mann AS, Kashgarian M, Binder HJ: Regulation of colonic H K A TPase in large intestine and kidney by dietary Na depletion and dietary K depletion. Am J Physiol, 272 : C685 96, 1997 193. Wall SM, Truong AV, DuBose TD, Jr.: H + K + ATPase mediates net acid secretion in rat terminal inner medullary collecting duct. Am J Physiol, 271 : F1037 44, 1996 194. Zhou X, Wingo CS: H K ATPase enhancement of Rb efflux by cortical collecting duct. Am J Physiol, 263 : F43 8, 1992 195. Eiam Ong S, Dafnis E, Spohn M, Kurtzman NA, Sabatini S: H K ATPase in distal renal tubular acidosis: ur inary tract obstruction, lithium, and amiloride. Am J Physiol, 265 : F875 80, 1993 196. Eiam ong S, Laski ME, Kurtzman NA, Sabatini S: Effect of respiratory acidosis and respiratory alkalosis on renal transport enzymes. Am J Physiol, 267 : F390 9, 1994 197. Silver RB, Frindt G, Mennitt P, Satlin LM: Characterization and regulation of H K ATPase in intercalated cells of rabbit cortical collecting duct. J Exp Zool, 279 : 443 55, 1997 198. Silver RB, Mennitt PA, Satlin LM: Stimulation of apical H K ATPase in inte rcalated cells of cortical collecting duct with chronic metabolic acidosis. Am J Physiol, 270 : F539 47, 1996

PAGE 177

177 199. Capurro C, Coutry N, Bonvalet JP, Escoubet B, Garty H, Farman N: Cellular localization and regulation of CHIF in kidney and colon. Am J Physio l, 271 : C753 62, 1996 200. Frank AE, Wingo CS, Andrews PM, Ageloff S, Knepper MA, Weiner ID: Mechanisms through which ammonia regulates cortical collecting duct net proton secretion. Am J Physiol Renal Physiol, 282 : F1120 8, 2002 201. Frank AE, Wingo CS, W einer ID: Effects of ammonia on bicarbonate transport in the cortical collecting duct. Am J Physiol Renal Physiol, 278 : F219 26, 2000 202. Garg LC: Respective roles of H ATPase and H K ATPase in ion transport in the kidney. J Am Soc Nephrol, 2 : 949 60, 199 1 203. Jaisser F, Escoubet B, Coutry N, Eugene E, Bonvalet JP, Farman N: Differential regulation of putative K + ATPase by low K + diet and corticosteroids in rat distal colon and kidney. Am J Physiol, 270 : C679 87, 1996 204. Tojo A, Tisher CC, Madsen KM: An giotensin II regulates H + ATPase activity in rat cortical collecting duct. Am J Physiol, 267 : F1045 51, 1994 205. El Moghrabi S, Houillier P, Picard N, Sohet F, Wootla B, Bloch Faure M, Leviel F, Cheval L, Frische S, Meneton P, Eladari D, Chambrey R: Tissu e kallikrein permits early renal adaptation to potassium load. Proc Natl Acad Sci U S A, 107 : 13526 31, 2010 206. Elabida B, Edwards A, Salhi A, Azroyan A, Fodstad H, Meneton P, Doucet A, Bloch Faure M, Crambert G: Plasma steroid profiling under ionic stre ss reveals that progesterone is required for efficient renal adaptation to chronic dietary K + restriction in male. Kidney Int 2011, In Press 207. Laroche Joubert N, Marsy S, Doucet A: Cellular origin and hormonal regulation of K + ATPase activities sensiti ve to Sch 28080 in rat collecting duct. Am J Physiol Renal Physiol, 279 : F1053 9, 2000 208. Laroche Joubert N, Marsy S, Luriau S, Imbert Teboul M, Doucet A: Mechanism of activation of ERK and H K ATPase by isoproterenol in rat cortical collecting duct. Am J Physiol Renal Physiol, 284 : F948 54, 2003 209. Laroche Joubert N, Marsy S, Michelet S, Imbert Teboul M, Doucet A: Protein kinase A independent activation of ERK and H,K ATPase by cAMP in native kidney cells: role of Epac I. J Biol Chem, 277 : 18598 604, 2002 210. Xu X, Zhang W, Kone BC: CREB trans activates the murine H + K + ATPase alpha(2) subunit gene. Am J Physiol Cell Physiol, 287 : C903 11, 2004 211. Yu Z, Li M, Zhang D, Xu W, Kone BC: Sp1 trans activates the murine H + K + ATPase alpha(2) subunit gene. Am J Physiol Renal Physiol, 297 : F63 70, 2009

PAGE 178

178 212. Zhang W, Kone BC: NF kappaB inhibits transcription of the H + K + ATPase alpha(2) subunit gene: role of histone deacetylases. Am J Physiol Renal Physiol, 283 : F904 11, 2002 213. Spicer Z, Miller ML, Andringa A, Riddle TM, Duffy JJ, Doetschman T, Shull GE: Stomachs of mice lacking the gastric H,K ATPase alpha subunit have achlorhydria, abnormal parietal cells, and ciliated metaplasia. J Biol Chem, 275 : 21555 65, 2000 214. Franic TV, Judd LM, Robinson D, Barre tt SP, Scarff KL, Gleeson PA, Samuelson LC, Van Driel IR: Regulation of gastric epithelial cell development revealed in H + /K + ATPase beta subunit and gastrin deficient mice. Am J Physiol Gastrointest Liver Physiol, 281 : G1502 11, 2001 215. Scarff KL, Judd LM, Toh BH, Gleeson PA, Van Driel IR: Gastric H + ,K + adenosine triphosphatase beta subunit is required for normal function, development, and membrane structure of mouse parietal cells. Gastroenterology, 117 : 605 18, 1999 216. Courtois Coutry N, Roush D, Ra jendran V, McCarthy JB, Geibel J, Kashgarian M, Caplan MJ: A tyrosine based signal targets H/K ATPase to a regulated compartment and is required for the cessation of gastric acid secretion. Cell, 90 : 501 10, 1997 217. Wang T, Courtois Coutry N, Giebisch G, Caplan MJ: A tyrosine based signal regulates H K ATPase mediated potassium reabsorption in the kidney. Am J Physiol, 275 : F818 26, 1998 218. Meneton P, Schultheis PJ, Greeb J, Nieman ML, Liu LH, Clarke LL, Duffy JJ, Doetschman T, Lorenz JN, Shull GE: Incr eased sensitivity to K + deprivation in colonic H,K ATPase deficient mice. J Clin Invest, 101 : 536 42, 1998 219. Spicer Z, Clarke LL, Gawenis LR, Shull GE: Colonic H + K + ATPase in K + conservation and electrogenic Na + absorption during Na + restriction. Am J Physiol Gastrointest Liver Physiol, 281 : G1369 77, 2001 220. Marney AM, Brown NJ: Aldosterone and end organ damage. Clin Sci (Lond), 113 : 267 78, 2007 221. Coruzzi P, Brambilla L, Brambilla V, Gualerzi M, Rossi M, Parati G, Di Rienzo M, Tadonio J, Novarini A: Potassium depletion and salt sensitivity in essential hypertension. J Clin Endocrinol Metab, 86 : 2857 62, 2001 222. Guntupalli J, Onuigbo M, Wall S, Alpern RJ, DuBose TD, Jr.: Adaptation to low K + media increases H + K + ATPase but not H + ATPase mediated pHi recovery in OMCD1 cells. Am J Physiol, 273 : C558 71, 1997 223. Lin SH, Halperin ML: Hypokalemia: a practical approach to diagnosis and its genetic basis. Curr Med Chem, 14 : 1551 65, 2007

PAGE 179

179 224. Kovacikova J, Winter C, Loffing Cueni D, Loffing J, Finberg KE, Lifton RP, Hummler E, Rossier B, Wagner CA: The connecting tubule is the main site of the furosemide induced urinary acidification by the vacuolar H + ATPase. Kidney Int, 70 : 1706 16, 2006 225. Kintzer PP, Peterson ME: Treatment and long term follow up of 205 dogs with hypoadrenocorticism. J Vet Intern Med, 11 : 43 9, 1997 226. Lynn RC, Feldman EC: Treatment of canine hypoadrenocorticism with microcrystalline desoxycorticosterone pivalate. Br Vet J, 147 : 478 83, 1991 227. Lynn RC, Feldman EC, Nelson RW: Efficacy of microcrystalline desoxycorticosterone pivalate for treatment of hypoadrenocorticism in dogs. DOCP Clinical Study Group. J Am Vet Med Assoc, 202 : 392 6, 1993 228. Zies DL, Gumz ML, Wingo CS, Cain BD: Characterization of the rabbit HKalpha2 gene promoter. Biochim Biophys Acta, 1759 : 443 50, 2006 229. Wallmark B, Briving C, Fryklund J, Munson K, Jackson R, Mendlein J, Rabon E, Sachs G: Inhibition of gastric H + ,K + ATPase and acid secretion by SCH 28080, a substituted pyridyl(1,2a)imidazole. J Biol C hem, 262 : 2077 84, 1987 230. Thongboonkerd V, Chutipongtanate S, Kanlaya R, Songtawee N, Sinchaikul S, Parichatikanond P, Chen ST, Malasit P: Proteomic identification of alterations in metabolic enzymes and signaling proteins in hypokalemic nephropathy. Pr oteomics, 6 : 2273 85, 2006 231. Sweiry JH, Binder HJ: Active potassium absorption in rat distal colon. J Physiol, 423 : 155 70, 1990 232. Codina J, Pressley TA, DuBose TD, Jr.: Effect of chronic hypokalemia on H + K + ATPase expression in rat colon. Am J Phys iol, 272 : F22 30, 1997 233. Kraut JA, Hiura J, Besancon M, Smolka A, Sachs G, Scott D: Effect of hypokalemia on the abundance of HK alpha 1 and HK alpha 2 protein in the rat kidney. Am J Physiol, 272 : F744 50, 1997 234. Coruzzi P, Gualerzi M, Parati G, Bra mbilla L, Brambilla V, Di Rienzo M, Novarini A: Potassium supplementation improves the natriuretic response to central volume expansion in primary aldosteronism. Metabolism, 52 : 1597 600, 2003 235. Kornandakieti C, Tannen RL: Hydrogen ion secretion by the distal nephron in the rat: effect of potassium. J Lab Clin Med, 104 : 293 303, 1984 236. Hulter HN, Licht JH, Sebastian A: K + deprivation potentiates the renal acid excretory effect of mineralocorticoid: obliteration by amiloride. Am J Physiol, 236 : F48 57, 1979

PAGE 180

180 237. Hulter HN, Sigala JF, Sebastian A: K + deprivation potentiates the renal alkalosis producing effect of mineralocorticoid. Am J Physiol, 235 : F298 309, 1978 238. Hulter HN, Sebastian A, Sigala JF, Licht JH, Glynn RD, Schambelan M, Biglieri EG: Pathogenesis of renal hyperchloremic acidosis resulting from dietary potassium restriction in the dog: role of aldosterone. Am J Physiol, 238 : F79 91, 1980 239. Frindt G, Pal mer LG: Effects of dietary K on cell surface expression of renal ion channels and transporters. Am J Physiol Renal Physiol, 299 : F890 7, 2010 240. Nakamura S: H + ATPase activity in selective disruption of H + K + ATPase alpha 1 gene of mice under normal and K depleted conditions. J Lab Clin Med, 147 : 45 51, 2006 241. Gennari FJ, Weise WJ: Acid Base Disturbances in Gastrointestinal Disease. Clin J Am Soc Nephrol, 3 : 1861 1868, 2008 242. Glad H, Svendsen P, Knuhtsen S, Olsen O, Schaffalitzky de Muckadell OB: Importance of gastrin releasing peptide on acid induced secretin release and pancreaticobiliary and duodenal bicarbonate secretion. Scand J Gastroenterol, 31 : 993 1000, 1996 243. Pimenta E, Gaddam KK, Oparil S, A ban I, Husain S, Dell'Italia LJ, Calhoun DA: Effects of dietary sodium reduction on blood pressure in subjects with resistant hypertension: results from a randomized trial. Hypertension, 54 : 475 81, 2009 244. Hager H, Kwon TH, Vinnikova AK, Masilamani S, B rooks HL, Frokiaer J, Knepper MA, Nielsen S: Immunocytochemical and immunoelectron microscopic localization of alpha beta and gamma ENaC in rat kidney. Am J Physiol Renal Physiol, 280 : F1093 106, 2001 245. Wang Q, Hummler E, Nussberger J, Clement S, Ga bbiani G, Brunner HR, Burnier M: Blood pressure, cardiac, and renal responses to salt and deoxycorticosterone acetate in mice: role of Renin genes. J Am Soc Nephrol, 13 : 1509 16, 2002 246. Rieg T, Dominguez JA: Unravelling a role for KCNQ1 in K + recycling and gastric acid secretion. J Physiol, 587 : 4149 50, 2009 247. Saccomani G, Helander HF, Crago S, Chang HH, Dailey DW, Sachs G: Characterization of gastric mucosal membranes. X. Immunological studies of gastric (H + + K + ) ATPase. J Cell Biol, 83 : 271 83, 19 79 248. Binder HJ: Organization of the Gastrointestinal System. In: Medical Physiology, 2nd ed. edited by Boron WF, Boulpaep EL, Philadelphia, PA, Saunders Elsevier, 2009, pp 883 894

PAGE 181

181 249. Bhatt K, Mi QS, Dong Z: Invited Review microRNAs in kidneys: biogen esis, regulation and pathophysiological roles. Am J Physiol Renal Physiol 2011 250. Elvira Matelot E, Zhou XO, Farman N, Beaurain G, Henrion Caude A, Hadchouel J, Jeunemaitre X: Regulation of WNK1 expression by miR 192 and aldosterone. J Am Soc Nephrol, 2 1 : 1724 31, 2010 251. Amlal H, Sheriff S, Faroqui S, Ma L, Barone S, Petrovic S, Soleimani M: Regulation of acid base transporters by vasopressin in the kidney collecting duct of Brattleboro rat. Am J Nephrol, 26 : 194 205, 2006 252. Musa Aziz R, Barreto Ch aves ML, De Mello Aires M: Peritubular AVP regulates bicarbonate reabsorption in cortical distal tubule via V(1) and V(2) receptors. Am J Physiol Renal Physiol, 282 : F256 64, 2002 253. Inui A, Asakawa A, Bowers CY, Mantovani G, Laviano A, Meguid MM, Fujimi ya M: Ghrelin, appetite, and gastric motility: the emerging role of the stomach as an endocrine organ. Faseb J, 18 : 439 56, 2004 254. Tuukkanen J, Vaananen HK: Omeprazole, a specific inhibitor of H + K + ATPase, inhibits bone resorption in vitro. Calcif Tiss ue Int, 38 : 123 5, 1986 255. O'Connell MB, Madden DM, Murray AM, Heaney RP, Kerzner LJ: Effects of proton pump inhibitors on calcium carbonate absorption in women: a randomized crossover trial. Am J Med, 118 : 778 81, 2005 256. Yang YX, Lewis JD, Epstein S, Metz DC: Long term proton pump inhibitor therapy and risk of hip fracture. Jama, 296 : 2947 53, 2006 257. Sheraly AR, Lickorish D, Sarraf F, Davies JE: Use of gastrointestinal proton pump inhibitors to regulate osteoclast mediated resorption of calcium pho sphate cements in vivo. Curr Drug Deliv, 6 : 192 8, 2009

PAGE 182

182 BIOGRAPHICAL SKETCH Megan Michelle Greenlee was born in Memphis, Tennessee. At the age of 5, Megan and her family moved to Lakeland, FL, where she spent the remainder of her childhood. She attended Rochelle School of the Arts for middle school and Harrison Arts Center for mos t of high school. Megan originally had ambitions to become an opera singer. However, after a great experience in a high school chemistry class, she changed her mind. In her senior year Megan switched to and graduated from Lakeland Senior High School in 20 03. In August 2003, she entered the University of Florida as an unde rgraduate, receiving a B.S. in i nterdisciplinary s tudies in b iochemis try and molecular b iology from the University of Florida in May 2006. In August 2006, Megan began graduate studie s in i nterdisciplinary p rogram in b iomedical r esearch at the University of Florida. At the 2009 Experimental Biology conference in New Orleans, LA, Megan won 2nd place for the Pfizer Pre doctoral Excellence in Renal Research Award. She has also authored many peer reviewed scientific reviews and manuscripts. Megan currently has one published first author research manuscript in the Journal of the American Society of Nephrology vity of renal H + ,K + Experimental Biology meeting in Anaheim, CA. After graduation with her Ph.D., Megan will begin a post doctoral fellowship at Emory University in Atlanta, Georgi a under the direction of Doug Eaton. Her husband, Jeremiah Mitzelfelt, will also graduate with his Ph.D. and start a post doctoral fellowship at Emory.