<%BANNER%>

Characterization of the Staphylococcus Aureus Nitric Oxide Synthase Gene and Its Role in Biofilm Development

Permanent Link: http://ufdc.ufl.edu/UFE0042667/00001

Material Information

Title: Characterization of the Staphylococcus Aureus Nitric Oxide Synthase Gene and Its Role in Biofilm Development
Physical Description: 1 online resource (79 p.)
Language: english
Creator: Mcneil, Erin
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: aureus, biofilm, nitric, oxide, staphylococcus, synthase
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre: Microbiology and Cell Science thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: CHARACTERIZATION OF THE STAPHYLOCOCCUS AUREUS NITRIC OXIDE SYNTHASE GENE AND ITS ROLE IN BIOFILM DEVELOPMENT Nitric oxide (NO) is emerging as a ubiquitous signaling molecule that plays a role in bacterial biofilm development. For example, in Pseudomonas aeruginosa, endogenous NO production via anaerobic respiration promotes cell death and dispersal during biofilm development. One of the potential sources of endogenous NO in Staphylococcus aureus is a bacterial NO-synthase (SaNOS). Data published by other groups have shown that purified SaNOS converts L-arginine to citrulline and NO, and a S. aureus strain defective in the NO synthase (nos) gene has been reported to have increased sensitivity to oxidative stress during planktonic growth, similar to results reported for the Bacillus subtilis nos mutant. However, the contribution of NOS to S. aureus biofilm growth is yet to be elucidated. Quantitative reverse-transcriptase PCR (qRT-PCR) analysis of RNA isolated from S. aureus UAMS-1 has demonstrated that expression of the nos gene (SAR2007 of the MRSA252 genome, NC_002952.2) is up-regulated during low-oxygen growth relative to aerobic growth, and that nos is co-transcribed with a downstream SAR2008 gene, a putative prephenate dehydratase. Furthermore, published RNA microarray data has shown that nos expression is up-regulated in the presence of hydrogen peroxide (H2O2), and these results were confirmed in this study by qRT-PCR analysis of RNA isolated from UAMS-1 cultures grown in the presence and absence of H2O2. Strain UAMS-1 and an isogenic nos polar insertion mutant displayed comparable growth in both TSB and biofilm media under planktonic growth conditions. However, when grown on a TSA plate there was increased pigmentation in the nos mutant which corresponds to an increase in nos expression as monitored by a nos promoter-GFP reporter plasmid construct. Phenotypic differences were also observed when UAMS-1 and the nos mutant were grown as static biofilms. The nos mutant had a more attached structure when compared to the UAMS-1 wild-type strain, which, when analyzed by COMSTAT software, showed an increase in biomass and average thickness in the nos mutant. Analysis also showed a decrease in biomass to surface area ratio, suggesting the nos mutant biofilm may be less adaptable to a changing environment compared to the wild-type UAMS-1. Complementation of the nos mutation resulted in reversion of the pigment production, biofilm phenotypes and qRT-PCR data back to wild-type results. Based on these results and the link between SaNOS and oxidative stress, a working model is proposed in which nos expression may be up-regulated in S. aureus biofilms in response to oxidative stress (such as in the presence of immune cell respiratory burst), which in turn enhances endogenous NO production in the biofilm which may participate in regulatory processes such as signaling cell dispersal.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Erin Mcneil.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Rice, Kelly Christine.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042667:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042667/00001

Material Information

Title: Characterization of the Staphylococcus Aureus Nitric Oxide Synthase Gene and Its Role in Biofilm Development
Physical Description: 1 online resource (79 p.)
Language: english
Creator: Mcneil, Erin
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: aureus, biofilm, nitric, oxide, staphylococcus, synthase
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre: Microbiology and Cell Science thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: CHARACTERIZATION OF THE STAPHYLOCOCCUS AUREUS NITRIC OXIDE SYNTHASE GENE AND ITS ROLE IN BIOFILM DEVELOPMENT Nitric oxide (NO) is emerging as a ubiquitous signaling molecule that plays a role in bacterial biofilm development. For example, in Pseudomonas aeruginosa, endogenous NO production via anaerobic respiration promotes cell death and dispersal during biofilm development. One of the potential sources of endogenous NO in Staphylococcus aureus is a bacterial NO-synthase (SaNOS). Data published by other groups have shown that purified SaNOS converts L-arginine to citrulline and NO, and a S. aureus strain defective in the NO synthase (nos) gene has been reported to have increased sensitivity to oxidative stress during planktonic growth, similar to results reported for the Bacillus subtilis nos mutant. However, the contribution of NOS to S. aureus biofilm growth is yet to be elucidated. Quantitative reverse-transcriptase PCR (qRT-PCR) analysis of RNA isolated from S. aureus UAMS-1 has demonstrated that expression of the nos gene (SAR2007 of the MRSA252 genome, NC_002952.2) is up-regulated during low-oxygen growth relative to aerobic growth, and that nos is co-transcribed with a downstream SAR2008 gene, a putative prephenate dehydratase. Furthermore, published RNA microarray data has shown that nos expression is up-regulated in the presence of hydrogen peroxide (H2O2), and these results were confirmed in this study by qRT-PCR analysis of RNA isolated from UAMS-1 cultures grown in the presence and absence of H2O2. Strain UAMS-1 and an isogenic nos polar insertion mutant displayed comparable growth in both TSB and biofilm media under planktonic growth conditions. However, when grown on a TSA plate there was increased pigmentation in the nos mutant which corresponds to an increase in nos expression as monitored by a nos promoter-GFP reporter plasmid construct. Phenotypic differences were also observed when UAMS-1 and the nos mutant were grown as static biofilms. The nos mutant had a more attached structure when compared to the UAMS-1 wild-type strain, which, when analyzed by COMSTAT software, showed an increase in biomass and average thickness in the nos mutant. Analysis also showed a decrease in biomass to surface area ratio, suggesting the nos mutant biofilm may be less adaptable to a changing environment compared to the wild-type UAMS-1. Complementation of the nos mutation resulted in reversion of the pigment production, biofilm phenotypes and qRT-PCR data back to wild-type results. Based on these results and the link between SaNOS and oxidative stress, a working model is proposed in which nos expression may be up-regulated in S. aureus biofilms in response to oxidative stress (such as in the presence of immune cell respiratory burst), which in turn enhances endogenous NO production in the biofilm which may participate in regulatory processes such as signaling cell dispersal.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Erin Mcneil.
Thesis: Thesis (M.S.)--University of Florida, 2010.
Local: Adviser: Rice, Kelly Christine.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042667:00001


This item has the following downloads:


Full Text

PAGE 1

1 CHARACTERIZATION OF THE STAPHYLOCOCCUS AUREUS NITRIC OXIDE SYNTHASE GENE AND ITS ROLE IN BIOFILM DEVELOPMENT By ERIN AHMO ALMAND A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DE GREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Erin Ahmo Almand

PAGE 3

3 To my husband, family, and lab mates

PAGE 4

4 ACKNOWLEDGMENTS First and foremost, I thank my parents Carey Anne and Timothy, for always supporting me, regardless of the ridiculousness of my endeavors. In addition, I thank my brother and sister in law Ryan and Amanda, for bringing me back to reality when I need ed it I thank my Professor Dr. Rice, for taking a chance and letti ng me into her lab despite knowin g basically nothing about me. The lab would have been nothing without my la b mates, which I thank for helping me to adjust to graduate student life and making it a joy to go to work every day. For sharing in my strife and those giggly nights over Woodchuck, I thank my roommate Robin, for helping me get through U niversity of F lorida and being there so I would not have to hack it alone. I thank the Air Force Institut e of T echnology for this wonderful opportunity. For their a ssistance and great ideas I thank my committee members, Dr. K.T. Shanmugam and Dr. Graciela Lorca. Furthermore, I thank my collaborators, Dr. Richardson and Dr. Bayles for their help with the project. Last, but certainly not least, I thank my husband, Aust in, for being my inspiration and providing me with the drive and motivation I needed to finish this degree.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 ABSTRACT ................................ ................................ ................................ ..................... 9 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 11 Staphylococcus aureus ................................ ................................ ........................... 11 Virulence Regulation ................................ ................................ ............................... 12 Biofilms ................................ ................................ ................................ ................... 13 Staphylococcus aureus Biofilms ................................ ................................ ............. 14 Ma turation ................................ ................................ ................................ ........ 15 Dispersal ................................ ................................ ................................ .......... 16 Immune Response ................................ ................................ ........................... 17 Nitric Oxide Sig naling ................................ ................................ .............................. 19 Nitric Oxide Synthases in Eukaryotes ................................ .............................. 19 Nitric Oxide Signaling in Bacteria ................................ ................................ ..... 21 The Role of Nitric Oxide in Biofilm ................................ ................................ .... 22 Bacterial NOS ................................ ................................ ................................ ... 23 Staphylococcus aureus nos ................................ ................................ .................... 25 2 MATERIALS AND METHODS ................................ ................................ ................ 29 Bacterial Strains and Growth Conditions ................................ ................................ 29 Creation of nos Mutant and Complement Strains ................................ ................... 29 Bioscreen C Planktonic Growth Assays ................................ ................................ .. 32 Qualitative and Quantitative Pigment Assays ................................ ......................... 33 Biofilm Assays ................................ ................................ ................................ ........ 34 RNA Isolation ................................ ................................ ................................ .......... 35 cDNA Production and Quantitative Real Time PCR (qRT PCR) ............................ 36 Co Transcription PCR ................................ ................................ ............................. 37 GFP Assays ................................ ................................ ................................ ............ 37 3 RESULTS ................................ ................................ ................................ ............... 42 nos and SAR2008 Are Co transcribed ................................ ................................ .... 42 Analysis of Planktonic Growth ................................ ................................ ................ 43 Ex pression of nos under Planktonic Growth Conditions ................................ ......... 44 Increased Pigment Production in nos Mutant ................................ ......................... 45

PAGE 6

6 nos Expression under Static Plate Conditions ................................ ........................ 46 The nos Mutant Produces a More Adherent Biofilm ................................ ............... 48 4 DISCUSSION ................................ ................................ ................................ ......... 59 Role of nos in S. aureus Oxidative Stress ................................ ............................... 59 The Contribution of nos under Biofilm Conditions ................................ ................... 61 5 CONCLUSIONS ................................ ................................ ................................ ..... 65 APPENDIX: SAMPLE CALCULATION DETERMINING qRT PCR EXPRESSION OF NOS ................................ ................................ ................................ .................. 67 LIST OF REFERENCES ................................ ................................ ............................... 68 BIOGRAPHICAL S KETCH ................................ ................................ ............................ 79

PAGE 7

7 LIST OF TABLES Table page 1 1 Examples of virulence factors responsible for Staphylococcus aureus pathogenicity. ................................ ................................ ................................ ..... 27 2 1 Strains and plasmids used in this study. ................................ ............................. 40 2 2 Primers and probes used in this study. ................................ ............................... 41 A 1 One set of qRT PCR numbers being used to calculate the expression by the 2 CT method (Livak method). ................................ ................................ ............ 67

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Biofilm development in S. aureus ................................ ................................ ...... 28 1 2 Postulated routes for NO formation and consumption in S. aureus. .................. 28 2 1 Diagram representing primer locations. ................................ .............................. 41 3 1 nos and SAR2008 are co transcribed.. ................................ ............................... 49 3 2 Growth of Wild type, mutant and complement strains under plain TSB and TSB + 20mM H 2 O 2 growth conditions. ................................ ................................ 50 3 3 UAMS 1, KR1010, KR1011 growth in 3% TSB+ 3% NaCl+ 0.5% glucose media for 48 hours. ................................ ................................ ............................. 51 3 4 qRT PCR expression of nos under (A) 2 and 6 hour low oxygen conditions, 6 hours highly aerated in addition to (B) treated and untreated with hydrogen pe roxide as previously described ................................ ................................ ..... 52 3 5 Increased pigment production in the nos mutant when grown on TSA plates.. .. 53 3 6 Pigment quantification via methanol extraction ................................ .................. 54 3 7 purH expression quantified by qRT PCR reveals a decrease in purH expression at the 6 hour time points under both aerated and low oxygen growth. ................................ ................................ ................................ ................ 55 3 8 Expression of nos GFP when grown on TSA plates under various environmental conditions. Increased nos GFP fluorescence was observed under aerobic conditions as compared to CO 2 and microaerobic conditions. ..... 56 3 9 Representative orthogonal views of 24 hour static biofilms. ............................. 57 3 10 COMSTAT analysis reveals statistically significant (Student Newman Keuls test) differences between wild type (UAMS 1) and nos mutant (KR1010), and the phenotype is complementable (KR101 1).. ................................ .................... 58 4 1 A potential model for the role of S. aureus nos gene in biofilm development.. ... 64 A 1 Sample calculation for the expression levels of nos in comparison to 70 using the 2 CT method (Livak method).. ................................ ............................ 67

PAGE 9

9 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science CHARACTERIZATION OF THE STAPHYLOCOCCUS AUREUS NITRIC OXIDE SYNTHASE GENE AND ITS ROLE IN BIOFILM DEVELOPMENT By Erin Ahmo Almand December 2010 Chair: Kelly C. Rice Major: Microbiology and Cell Science Nitric oxide (NO) is emerging as a ubiquitous signal ing molecule that plays a role in bacterial biofilm development. For example, in Pseudomonas aeruginosa endogenous NO production via anaerobic respiration promotes cell death and dispersal during biofilm development. One of the potential sources of endoge nous NO in Staphylococcus aure us is a bacterial NO synthase (S aNOS). Data published by other groups have shown that purified S aNOS converts L arginine to citrul l ine and NO and a S. aureus strain defective in the NO synthase ( nos ) gene has been reported to have increased sensitivity to oxidative stress during planktonic growth, similar to results reported for the Bacillus subtilis nos mutant However, the contribution of NOS to S. aureus biofilm growth i s yet to be elucidated. Qu antitative reverse transcriptase PCR (qRT PCR) analysis of RNA isolated from S. aureus UAMS 1 has demonstrated that expression of the nos gene (SAR2007 of the MRSA252 genome NC_002952.2 ) is up regulated during low oxygen growth relative to aerobic growth, and that nos is co transcribed with a downstream SAR2008 gene, a putative prephenate dehydratase. Furthermore, published RNA microarray data has shown that nos expression is up regulated in the presence of hydrogen peroxide ( H 2 O 2 ), and these results were

PAGE 10

10 confirmed in this study by qRT PCR analysis of RNA isolated from UAMS 1 cultures grown in the presence and absence of H 2 O 2 Strain UAMS 1 and an isogenic nos polar insertion mutant displayed comparable growth in both TSB and biofilm media under planktonic growth conditions However, when grown on a TSA plate there was increased pigmentation in the nos mutant which corresponds to an increase in nos expression as monitored by a nos promoter GFP reporter plasmid construct. Phenotypic differences were also observed when UAMS 1 and the nos mutant were grown as static biofilms. T he nos mutant had a more attached structure when co mpared to the UAMS 1 wild type strain which, when ana lyzed by COMSTAT software, showed an increase in biomass and average thickness in the nos mutant Analysis also showed a decrease in biomass to surface area ratio, suggesting the nos mutant biofilm may be less adaptable to a changing environment compared to the wild type UAMS 1. Complemen t at ion of the nos mutation result ed in rever sion of the pigment production, biofilm phenotype s and qRT PCR data back to wild type results. Based on these results and the link between SaNOS and oxidative stress a working model is proposed in which nos expression may be up regulated in S. au reus biofilms in response to oxidative stre ss (such as in the presence of immune cell respiratory burst), which in turn enhances endogenous NO production in the biofilm which may participate in regulatory processes such as signaling cell dispersal

PAGE 11

11 CHAPTER 1 INTRODUCTION Staphylococcus aureus Staphylococcus aureus is a spherical Gram positive bacterium arranged in grape like clusters [1] with a 2800 kbp chromosome supplemented with prophages, plasmids and transposons [2,3] S. aureus is a facultative anaerobe which can grow via aerobic respiration, anaerobic respiration and mixed acid fermentation, allowing its persistence under a variety of growt h conditions, including a sessile, biofilm lifestyle. The alteration of this metabolism has phenotypic effects, with the main difference being virulence. Anaerobically the TCA cycle is down regulated and transcription of virulence factors is decreased in favor of supporting the growth of the microbe [4] S. aureus also has a golden pigment resulting from carotenoid production, which act s as an antioxidant defense mec hanism and allows for protection against oxidant based clearance of host innate immune system re leased reactive oxygen species s uch as hydrogen peroxide (H 2 O 2 ) and hypochlorite [5] While carotenoid pigment may help S. aureus to some degree in terms of avoiding the immune system, it is only one of a plethora of bacterial factors which make S. aureus, and more specifically Methicillin Resistant Staphylococcus aureus ( MRSA ) the leading caus e of death by a single infec tiou s agent and the leading cause of human bacterial infections world wide [6] The i nfectious capabilities of S aureus are in part due to its transmission in a variety of ways, including crowding, skin to skin interactions with healthy or already compromised skin (wounds), contaminated surfaces or a lack of cleanliness in gen eral [6] S. aureus can cause a number of infections, in all tissues and organ systems with the more common disease s being bacteremia, endocarditis,

PAGE 12

12 sepsis, toxic shock, and n ecrotizing fasciitis [1] While the number of diseases caused by S. aureus is alarming, the main reason for its prevalence and severity of disease is a vari ety of virulence fact ors (Table 1 1 ) and its multi drug resistance capabilities, including benzyl penicillin (beta lactamase activity), methicillin ( mecA ) and even vancomycin ( vanA ) resistance [7,8,9] These multiple resistance strains fall into two categories, hospital acquired methicillin resistant S. aureus (HA MRSA) and community acquired methicillin resistant S. aureus (CA MRSA). HA MRSA infects individuals with a predisposition to infection, whether they are immunocompromised or have an implanted device suc h as a catheter or intravenous (IV) line. In contrast, CA MRSA infects seemingly healthy individuals, although there is a dispute as to whether or not there is an actual growth advantage in some strains allowing for easier colonization or, potentially, an unidentified factor in the hosts making ind ividuals more susceptible [7]. Virulence Regulation Virulence regulation is a wide area of study, especially when attempting to determine therapeutics for S. aureus. Regulation occurs through a variety of signal s in response to the host, environment, growth phase, adhesion redundancy, presence of exotoxins and the presence of proteases [10] There are two main groups of regulators, the two component syste ms and the other regulators. A widely studied example of a two component system is agrBDCA ( a ccessory g ene r egulator), which is a quorum se nsing system responsible for regulation of biofilm formation (discussed in more detail below), virulence gene expression and detachment [11] It regulates virulenc e gene expression by down regulating cell surface adhesions during stationary phase, or in response to high cell density, and simultaneously up regulating secreted virulence

PAGE 13

13 factors and toxins [12] It is made up of two primary transcripts designated RNA II and RNA III, from the promoters P2 and P3 respectively P2 makes up a four gene operon encoding the AgrBDCA proteins. AgrB is a transm embra ne protein involved in processing AgrD into an octopeptide which is then secreted as an autoinducing peptide (AIP) signal [13] Agr A and AgrC are m e mbers of a two component syst em where AgrC is the histidine kinase that binds the AIP and AgrA is its corresponding response regulator [14] Binding of AIP to AgrC induces subsequent phosphorylation of AgrA, which in turn allows binding to the P3 promoter region and up regulation of the P3 transcript. The P3 transcript en codes the effector of the agr system, RNAIII which is an untranslated regulatory RNA molecule, that determines the expression of target genes at either the transcriptional or translational level [14] The expression and re gulation of virulence genes play a large role in the interaction between S. aur eus and the immune system. Biofilms A biofilm is a microbial community enveloped by an extracellular matrix adhered to a solid surface and each other. There are multiple reasons why bacteria may choose this sessile lifestyle in lieu of a motile or plankto nic state, such as the ability to coordinate activities through intercellular signaling, a variance in metabolic activities leading to potential defense strategies, and for pathogens, to increase the persistence of infection within a host [15] There are three main stages of biofilm development: attachment, maturation and dispersal (Figure 1 1) Attachment is the initial colonization of the surface, and is affected by a variety of factors to include surface conditioning (accumulation of nutrients at the surface fluid interface [16] ), mass transport (mechanism by which bacteria are transported to the surface to colonize [17] ) surface

PAGE 14

14 charge (the charge on the cell surface compared to the charge on the colonizi ng surface [18] ) hydr ophobicity (of the surface and of the correspondin g bacterial attachment factors [19] ) and microtopography ( surface cracks and crevices which may better allow for cell attachment [20] ) [21] Maturation is the next stage which is characterized by an increase in biomass production of a protective extracellu lar polysaccharide and/or protein based biofilm matrix and the formation of various st ructures such as towers. Current research has also shown that extracellular genomic DNA (eDNA) release plays a large role in attachment as well as in biofilm maturation in a number of different bacteria [22 31] It is released by autolysis of bacterial cells and acts as an adhesive. Last is dispersal, the portion of the life cycle which allows microcolonies to detach and promote biofilm formation in previously uncolonize d areas. Dispersal is mediated by several factors such as environmental conditions, changing oxygen levels, nutrient depletion, changing nutrient composition, increased protease activity and increased concentration of quorum sensing signals [22] Staphylococcus aureus B iofilms Staphylococcus aureus biofilms are very difficult to e radicate and have a high probability of disseminating to other sites in the body [23] They have the sa me three stages of develo pment as described above ( attac hment, maturation and dispersal), with specific cell signals occurring at each stage. Regulated cell lysis and the release of eDNA is of particular importance in S. aureus biofilms [24] This eD NA is important for biofilm adhesion in vitro, especially within the first four hours of colonization [24,25] During this initial colonization period is also when S. aureus initially binds to human matrix proteins, such a s fibrinogen and fibronectin, via microbial surface components recognizing adhesive matrix molecule (MSCRAMMS) [26] These molecules have a

PAGE 15

15 exposed binding domain for interaction with the host, a cell wall spanning domain, and a domain for covalent or noncovalent attachment to bacterial surfaces [26] A recent study s uggests that s everal of these MSCRAMMS, specifically fibrinogen and fibronectin binding proteins (FnBPA and FnBPB, respectively), are important for biofilm attachment in M RSA strains, but not in MSSA strains, suggesting that the contribution of certain MSCRAMMS towards biofilm development may be strain dependent [27] Overall, initial colonization sets the stage for biofilm growth and development. Maturation After this initial adherence, polysaccharide intercellular adhesion (PIA) and the extracellular matrix are produced. This production is mediated by the icaADBC locus and is increased under anaerobic environments [4,28] IcaA is an N acetylglucoaminyltran sferase while IcaC and Ica D are membrane associated proteins which chaperone IcaA. IcaB is the enzyme responsible for deacetylation of N acetyl glucosamine. This operon is repressed by IcaR which binds upstream of the ica start codon [28] While this polysaccharide production plays a large role in biofilm formation in some S. aureus strains, t here is a large proportion of them which do not require PIA for biofilm formation [29] Dispersin B is a glycos ide hydrolase enzyme (produced by the pathogen Aggregatibacter actinomycetemcomitans ) capable of removing the biofilms which are PIA dependent [30] However, many other staphylococcal biofilms were found to be unaffected by this treatment [22,30] Rather, a mixture of prot eases and Proteinase K was effective at removing them suggesting these biofilms are largely composed of protein and teichoic acids. DNaseI was also required for eDNA removal in both ica dependent and independent biofilm s [22,31,32] Despite the differences in biofilm extracellular matrix composition during this phase of growth the biofilms begin to

PAGE 16

16 have tower structures separated by fluid filled channels allowing for nutrient dissemination and w aste removal [23] Dispersal Dispersal is the last step in the biofilm process and occurs in response to quorum sensing signals s upplied by the agr locus described above [14,2 2,32,33] The agr locus has an expression cycle which includes its repression during the initial colonization phase leading to enhanced adherence due in part to up regulated production of cell surface adhesions. When the cell density increases the accumulation of the autoinducing peptide (AIP) accumulates to a threshold level whic h activates the agr system a nd triggers dispersal [22] Although the exact me chanism is not understood, agr mediated dispersal is due, in part, to the up regulation of protease production [22,32] Agr mediated dispers al can be induced in a young biofilm through the addition of AIP to the medium [14] and regardless of the stage of biofilm development, bacterial re growth occurs in voids left by the detached cells [14] In addition to agr thermonuclease, a secreted temperature stable nuclease, may also be needed for dispersal, presumably by degrading eDNA [22,25,32] Interestingly, the agr response appears to be limited to surface exposed areas and increases biofilm detachment by up regulating the AIP effector molecule and repressing the attachment factors [33,34] Naturally occurring agr mutants have been isolated from clinical S. aureus biofilms with mutations existing in the histidine kinase and sensor domains [35] and these mutants have a thicker, more dense biofilm than the ir counterparts presumably allow ing for persistence in infection [23,34] It is postulated that these mutants may be more adept at forming long term chronic infections d ue to their increased expression of surface adhesions and repression of factors leading to detachment [36] However these

PAGE 17

17 mutants seem to arise naturally in vivo and in vitro during the extreme stationary phase of growth and biofilm development; many will even arise in samples taken from clinical settings and then cultured for several days planktonically [34] Aside from Agr signaling, little is known about other cell signaling and com munication mechanisms that occur within S. aureus biofilms. Immune Response The biofilm lifestyle adds an additional challenge to the immune system of the host, resulting in a six log decrease in bacterial susceptibility to antimicrobials when planktonic cultures are compared to biofilms [32] This decrease in susceptibility is a particular concern with S. aureus, since a great number of S. aureus infections (endocarditis, osteomyelitis, chronic wound infections, and infections of implanted medical devices) are caused by biofilms. The traditional means of interacting with a bacterium through antimicrobial peptides (AMPs) neutrophil phagocytosis and the complement system is difficult with aggregates of cells [37,38,39] Normally this response works in a complement cascade. The pathogen is labeled to facilitate phagocytic uptake via complement receptors. The phagocytes are attracted to the microbes through the production of chemoattra ctants, which leads to the direct lysing of most Gram negative cells through a membrane attack complex, and phagocytosis of other cells such as Gram positive bacteria [37] To combat the immune system, pathogenic bacteria are equipped with an arsenal of weapons which allow for interaction during all steps of the immune re sponse. Antimicrobial peptides and the complement system can be disrupted through proteolytic degradation, AMP binding and inactivation through D alanylation of teichoic acids and metalloproteases [40] Neutrophils have the ability to make extracellular traps or nets, which are degraded by bacterial extracellular

PAGE 18

18 DNAses [41] There are also a variety of extracellular proteases which have t he ability to cleave antibodies [42] S. aureus in particular has the ability to prevent destruction [43] once engulfed through its production of superoxide dismutases [44] catalase [45,46] and golden carotenoid pigment [5] In addition to being able to avoid destruction, it has the ability to lyse host leukocytes through pore forming toxin production [41,47] Within the biofilm, the ability of the immune system to reach the target and interact specifically with individual microbes is much more limited. There may be limited diffusion within the biofilm by antimicrobial peptides and the complement system in addition to possible active repulsion by the biofilm of these host defenses [48] Furthermore, the effect of singular immune cells is decreased on such a large population of cells [23] Although detailed studies of immune cell interactions with S. aureus biofilms have not been reported in the literature, t his reduced anti biofilm efficacy has been seen through the interaction of Pseudomonas aeruginosa with macrophage secretory products (MSP) [49] When P. aeruginosa was actually grown in the presence of MSPs their virulence was enhanced in a biofilm mouse model of ascending pyelonephritis [49] Rather than destroying the biofilm, the immune system appeared to actually aid P. aer uginosa in its ability to evade phagocytosis [49] Fu rthermore, n eutrophils interacting with the P. aeruginosa biofilms in vitro have been shown to become phagocyt ically engorged and immobilized. In addition, these neutrophils underwent respiratory bursts but no phagocytosis, leading to an increase in oxygen consumption within the system, yet no increase in soluble H 2 O 2 [50] This decrease in efficiency of the immune cells allows the microbes within the biofilm to

PAGE 19

19 proliferate while the neutrophils remained immobilized with a diminished oxidative burst and thus defense potential [50] Nitric Oxide Signaling Nitric o xide (NO) is a free radical gas, which easily diffuses and is highly reactive, making it a n important molecule for both cell signaling and host defense in eu karyotes. It is also produced as part of the denitrification pathway of prokaryotes when nitrate is sequentially reduced to dinitrogen via nitrite, NO and nitrous oxide. H igh levels o f NO may be toxic to the se cells, and is thus commonly reduced to nitrous oxide. In eukaryotes it is well known as an endothelial relaxing factor, cytotoxic agent, and nervous system signaling molecule [51] This versatile signaling molecule has a variety of targets, including heme/nonheme iron cofactors, iron s ulfur clusters, redox metal sites, lipids, DNA and amines [52] M ethod s for modification of proteins include S nitrosylation, the transfer of a nitric oxide group to cysteine sulfhydryls on proteins which is comparable to phosphorylation of proteins [53] and nitration a covalent post translational protein modification derived from the reaction of aromatic amino acids (primarily tyrosine or tryptophan) in proteins with NO or other reactive nitrogen species (RNS) [54] Nitric Oxide Synthas es in Eukaryotes While the targets of NO are abundant, the sources of NO production are much more limited, with one of the main sour ces being nitric oxide synthase ( NOS ) [55] Although present in eukaryotes, prokaryotes, and archaea, the most widely studied nos genes are in mammals [56,57] There are three types of nos in mammals, with two being constitutive ly expressed and one considered an inducible The constitut ively expressed NOS are common in the central nervous system, where,

PAGE 20

20 although not stored in the synaptic vesicles, it acts as a neurotransmitter [58] The second constitutive NOS was discovered in endothelial cells, where it help s maintain basal vascular tone, and is involved in platelet aggregation. Inducible NOS (iNOS) is specific to the immune response, expressed in both neutrophils and macrophages [52] The NO produced from these NOS enzymes has a variety of roles. Some of the most common roles for NO is through interactions with hem e groups and sulfhydryl groups [59] causing perturbation in certain zinc transcription factors [60] and modifications of various proteins and lipids. One of t he specific interactions observed in eukaryotes has been with guanylate cyclase which is activated by NO, causing an increase in cyclic guanosine monophosphate (cGMP) [52,61,62,63] This interaction is one of the categories of NO signaling specific to the calcium dependent constitutive NOS enzymes dependent signaling In these cases, NO interacts with a soluble guanylyl cyclase heme containing a heterodimeric NO receptor. This receptor converts guanosine triphosphate to g cyclic monophosphate which can then act on protein kinases, gated channels and phosphodiesterases [52] The other type of signaling is independent signaling [52] This type of signaling involves nitrate and nitrite being recycled in blood and tissues to form NO storage pools in the event NOS production is insufficient [52] S nitros yl ation is also cGMP independent and refers to the reaction of NO or an NO derived species with cysteine residues on target proteins This reaction regulates a variety of cellular targets from protein kinases, proteolytic enzymes and transcription factors to proteins involved with energy transduction [52]

PAGE 21

21 Nitric Oxide Signaling in Bacteria Bacteria also respond to NO, oftentimes encountered in the form of nitrosative stress during host infection NO inhibits DNA replication by mobilizing the zinc from the DNA binding proteins [60] To prevent this interaction, there are a variety of NO metallo regulato ry proteins produced by bacteria that sense and respond to elevated NO concentrations. E scherichia coli has six known NO sensors, including the non heme sensors NorR and NsrR which respond to nanomolar ranges of NO and the iron sulfur proteins SoxR and FNR which respond to both superoxide and NO [60] Although well studied in E. coli, this motif is conserved across many bacteria in a heme NO and/or oxygen binding (H NO in E. coli, the Neisseria gonorrhoea e NmlR protein is a zinc containing transcriptional regulator which responds to NO and mediates the nitrosative st ress response through 5 nitrosoglutathione reductase activity [60] In Mycobacterium tuberculosis the proteins commonly int eracting with NO may actually be oxygen sensors, and NO binding prevents oxygen binding which mimics a lo w oxygen situation, causing histidine kinase activation [52] In S. aureus the Staphylococcal Respiratory Regulator (SrrAB) and Flavohaemoglobin (Hmp) are the best studied sensors of NO, with SrrAB involved in regulating the nitrosative stress response and Hmp directly detoxifying the NO [64] SrrAB is homologous to ResDE in Bacillus subtilis, which has also been shown to act as an NO sensor in this organism. ResDE is a two component system which activates the transcription of genes required for n itrate respiration under oxygen limiting conditions [65,66] in addition to genes involved in NO detoxification such as the flavohaemoglobin gene hmp [66] Likewise, S. aureus SrrAB is also involved in regulating the expression of the S. aureus hmp gene [64,67,68,69,70,71]

PAGE 22

22 SrrAB is also involved in the S. aureus nitrosative stress response, as a srrAB mutant displayed increased sensitivity to NO [64] The Role of Nitric Oxide in Biofilm NO has also been s hown to play a crucial role in a ffecting bacterial biofilm formation. One of the few studies looking into the role of NO in S. aureus biofilms looked at inhibition of biofilm formation through acidified nitrite repression of the icaADBC gene cluster [72] This interaction with the acidified nitrite appeared to cause a stress r esponse which impaired ability to deal with oxidative and nitrosative stress (as determined by RNA microarray) as well as through decreased PIA production [72] In this same study, biofilm growth that was inhibited in the presence of acidified nitrite could be recovered through the addition of an NO scavenger, suggesting that NO was generated as a byproduct of the disproportionation of the un stable acidified nitrite, and wa s directly or indirectly responsible for the observed phenotypes [72] In P aeruginosa exogenous NO has been shown to cause biofilm dispersal aiding in the complete removal of a biofilm with the addition of an antimicrobial [15,73] Endogenous NO production, via denitrification [73] also appeared to trigger cell death and dispersal, while an added oxidative or nitrosative stress on Pseudomonas biofilm has been shown to cause bacteriophage induction and cell lysis [15,73] This interaction was c di GMP dependent and a decrease in c di GMP le d to dis persal of the biofilm, while an increase le d to increased adherence [74] This decrease in c di GMP is hypothesized to occur when NO stimulated certain pho sphodiesterases, causing c di GMP breakdown and dispersal. In Neisseria gonorrhoeae the effect of NO was tested on both early and late phases of biofilm development [74] During the early phases of biofilm development,

PAGE 23

23 high levels of exogenous NO prevented biofilm formation. However, later in biofilm formation, once anaerobic respir ation has been initiated, the addition of low levels of NO actually enhanced biofilm formation suggesting that NO may perform multiple regulatory roles during the course of biofilm development in this bacterium [74] Bacterial NOS From the evidence described above, NO appears to be an important signaling molecule in bacteria, and one of the potential sources of endogenously produced NO is the bacterial nos gene, which is mainly confined to Gram positive pathogens [75] Bacterial NOS produces NO by catalyzing a five ele ctron oxidation of a terminal guanido nitrogen of L Arg and t akes 2 moles of oxygen and 1.5 moles NADPH per mole of NO produced. This occurs through two reactions: the conversion of L arginine to N hydroxy L arginine (NOHA) and the conversion of NOHA to citrulline and NO [76,77] E ukaryotic NOS has both an o xygenase and reductase domain and the se reactions occur in a calcium dependent reaction [51,76,78,79] The prokaryotic NOS was identified via genomic sequencing, and has homology to the catalytic oxygenase domain of eukaryotic NOS [79,80,81] This homology includes the heme binding and active sites of the enzy m e with one conserved valine residu e in the eukaryotic catalytic domain that is replaced by a conserved isoleucine residue in bacteria [51,82,83] T he notable exception to prokaryotes only having the oxygenase domain is in the NOS of the Gram negative bacterium Scrangium cellulosum which also has a covalently attached reductase to the N terminal domain separated from the oxygenase domain by an area of unknown function [75] Struc turally, bacterial NOS resemble the center and a winged beta sheet and helix turn motif [84] There is a hydrophobic

PAGE 24

24 zinc binding domain restri cting the size of the cofactor [51,80,85] When unfolded, the NOS dimer interface is highly disordered, and this disarray prevents heme based oxygen reduction without the proper substrate an d cofactor [75,81,8 4] This structure, since there is no reductase dom ain, needs to accept electrons from other sources. These reductases are not as efficient as the single eukaryotic domain, and are often multiflavin containing sulfite reductases [86] Even though t here is not a specific redox partner identified for bacterial NOS, over expression of the nos gene in a bacterium which does not code for it normal ly, such as in E. coli, can compensate for the lack of a dedicated redox partner through its native enzymes [51,87] In addition to varying redo x partners, the location of nos on the chromosome changes from bacterium to bacterium, but the location may not always correlat e with the role played by NOS For example, i n Deinococcus r adiodurans the nos gene is not located near its target, the tryptophanyl tRNA synthetase (TrpRSI) whose interaction is mediated by the NOS interacting protein (TrpRSII, which has a low level of homology to typical TrpRSs) [88] TrpRSII increases nos affinity for arginine and produces 4 nitro Trp tRNA which may be used as a substrate for protein or metabolite biosynthesis [51,89,90,91] In comparison, Streptomyces turgidiscabies has nos located five genes upstream from txtABC an operon responsible for thaxtomin production [92] Thaxtomin is a phytotoxin that causes potato scab disease and its NOS is responsible for nitration of the thax tomins on a trypto phan moiety which is importa nt for the functionality of thaxtomins, stimulating the roots of infected plants to grow and increase tissue production allowing for further colonization by the bacterium [59,92,93] In B. subtilis

PAGE 25

25 and Bacillus anthracis NO S increases antibiotic tolerance through both chemical modification of antibiotics and reducing the cellular oxidative stress that ensues from the actions of many antimicrobials [94] NOS derived NO also protects these bacteri a from oxidative and nitrosative stress by activating catalase and inhibiting enzymes capable of reducing thiols, thus preventing the formation of hydroxyl radicals and DNA damage [75,95] Hydrogen peroxide toxicity and thus DNA damage occurs by way of the Fenton reaction, which occurs when hydroge n peroxide interacts with free cellular iron. To drive this reaction ferric iron must be continuously re reduced to the ferrous state through cellular reductants such as cysteine. In Bacillus, it is postulated that this reaction can be suppressed via en dogenous NO by its transient nitrosylati on of the cysteine residues of proteins and thus inhibiting cysteine reduction in the cell [96] The ability to withstand oxidative and nitrosative stress plays a role in virulence, enabling the bacteria to survive when attacked by macrophages and neutrophils. For example, w ithout the nos gene, the virulence of B. anthracis within a mouse model was greatly reduced and the ability to survive within a macrophage was also reduced [51] However, a role for nos in bacterial biofilm development has not been explored. Staphylococcus aureus nos S. aureus is another Gram positive pathogen which codes for an active NOS enzyme, which can bind large ligands and is most similar to the iNOS of the immune system [51] It has been crystallized with a nicotinamide ring of NAD bound in the cofactor site, which although not biologically relevant, has shown the structure is homologous to the eukaryotic NOS oxygenase domain and has the dimer formation [97] This NOS has also been shown in vitro to break down arginine to citrulline with NO as a byproduct [98] and provides one of three postulated routes of endogenous NO

PAGE 26

26 production in S aureus (Figur e 1 2 ). The affinity of NOS for L arginine is increased by the addition of a tetrahydrobiopterin or one of its analogs and t he enzyme can bind bulky ligands such as nitrosoalkanes and tert butylisocyanide [99] The other postulated sources of NO production in S. aureus ( disproportionation of acidified nitrite and NO directly produced by a nitrate reductase ) could also contribute to NO signaling within S. aureus (Fi gure 1 2 ) but due to its unique association with pathogenic bacteria, it is possible there is a more specific role for SaNOS In S aureus, NOS w as shown to act as a means for dealing with hydrogen peroxide stress under planktonic conditions [94] In addition a nos deficient strain of S. aureus RN4220 was reported to be more susceptible to antibiotics such as cefuroxime, acriflavine and pyocyanin [94] This nos mutant has also been reported to have increased sensitivity to oxidative stress, similar to B subtilis [96] Given that these data were generated in a chemically mutated S. aureus lab strain that is known to contain several mutations [132], it is important to fur ther investi gate a role for the S aureus nos gene during planktonic growth and biofilm development in a clinical isolate, such as UAMS 1 The refore, the purpose of this study is t w o fold: (1) T o c haracterize the phenotype of a S. aureus UAMS 1 nos mutant under both planktonic and biofilm conditions and (2) To d etermine the expression pattern of the nos gene under the se same conditions. Based on the described effect of NO on biofilm s in other bacteria we hypothesize that SaNOS contributes to S. au reus biofilm development, possibly by production of NO as a cell signaling molecule.

PAGE 27

27 Table 1 1. Examples of virulence factors responsible for Staphylococcus aureus pathogenicity. Virulence Factor Role in Virulence Example Source Secreted Toxins Cytolytic Superantigen Form pores in host cell cytoplasmic membranes, cause lysis Immune stimulatory, cause capillary leak, epithelial damage, hypotension Hemolysins, leukocidins, PVL Enterotoxins A, B, C, D, E, G, Q, TSST 1 [100,101] [100,102] Exoenzymes Beta Lactamase Protease Lipase Coagulase Inactivates penicillin, works with penicillin binding proteins Actively degrade human protease inhibitors, tissue degradation Degrade host macromolecules i.e. collagen, elastin, fibronection Scavenge host sterols for bacterial membranes Prothrombin activator, Role in virulence unclear Penicillin binding protein Serine (SspA), cysteine (SspB) Sal 1, sal 2 Coa gulase (coa) [1,100] [100] [103] [104] [100] Self Surface Adhesions MSCRAMMS Mediate microbial adhesion to host factors: fibronectin, collagen, fibrinogen, immunoglobulin, integrins fnbpA, fnbpB, CAN, CLF, Protein A, filamentous hema g glut in in [26,100]

PAGE 28

28 Figure 1 1. Biofilm development in S. aureus. 1. Cells leave the planktonic state and attach to a surface to become part of a sessile community. 2. An extracellular matrix is formed and more cells aggregate to the area. 3. Maturation occurs where the biofilm grows in biomass and structures may form. 4. Microcolonies of cells disperse to colonize new areas. Figure 1 2. Postulated routes for NO formation and consumption in S. aureus. The potential routes for NO metabolism depicted above are based on the presence of these genes in the S. aureus MRSA252 sequenced genome (a closely related strain to UAMS 1) [105] in combination with published data from S. aure us and/or other NO producing bacteria. The potential routes of endogenous NO production are depicted in blue. The gene depicted in red is not conserved throughout all published S. aureus genomes, however it is present in the UAMS 1strain used in this study, in addition to the published genome of MRSA252.

PAGE 29

29 CHAPTER 2 MATERIALS AND METHOD S Bacterial Strains and Growth Conditions The Staphylococcus aureus strains used for this study are listed along with plasmids used in Table 2 1. All planktonic S. aureu s cultures were grown either aerobically (1:10 volume to flask ratio 250 RPM ) or under low oxygen conditions (7:10 volume to flask ratio 0 RPM ) in try ptic soy broth (TSB) or in biofilm medium (TSB NaGlc: TSB supplemented with 3% (wt/vol) NaCl and 0.5% ( wt/vol) glucose) Where indicated, antibiotics were used at the following concentrations: 5 g/mL or 10 g/mL chloramphenicol (Cm) 2 g/mL or 10 g/mL erythromycin (Erm) E. coli was grown under the same aerobic conditions in Luria Bertani (LB) broth wit h 50 g/mL ampicillin (Amp) or 50 g/mL Kanamycin (Km) Glycerol stock cultures were maintained at 80C and were prepared by mixing equal volume of overnight culture with sterile 50% (vol/vol) glycerol in cryogenic tubes. For each experiment described below, a fresh S. aureus culture of each strain was streaked from its frozen stock onto tryptic soy agar (TSA) containing the appropriate selective antibiotic as indicated in Table 2 1. Creation of nos Mutant and Complement S trains Plasmid pTR27 and the nos mut ation in strains Newman and COL w ere created by Dr. Anthony Richardson (University of North Carolina at Chapel Hill), whereas the nos mutant in strain UAMS 1 was created using pTR27 by Dr. Kelly Rice (University of Flori da ). In brief, plasmid pTR27 was created as follows: The nos gene was amplified from strain COL by PCR using the primers specified in Table 2 2 and Topo cloned into pCR2.1 (Invitrogen) to generate pTR10. An internal Bgl II site was introduced in this clo ned sequence 232 bp down stream from the NOS start codon in the sequence 5'

PAGE 30

30 gttaaatgtcattgatgcaagAGATGTtactgacgaagcatcgttcttatc 3', where the capital letters are located, changing the sequence from AGATGT to AGATCT, a Bgl II restriction enzyme cut site. An Eco RI fragment harboring this modified allele was moved into the Eco RI site of pBluescript SK to generate pTR11 making the engineered Bgl II site unique. A 1.1 kb Bam HI digested fragment harboring an erythromycin ( Erm R ) cassette from Tn1545 [1 06] was then cloned into the unique Bgl II site of pTR11 to generate pTR12 ( nos ::Er m R in pBluescript SK). The Eco RI fragment of pTR12 carrying the nos:: Er m R allele was ligated into Eco RI in the temperature sensitive shutt le vector pBT2 to generate pTR27 To creat e S. aureus nos mutant s with pTR27, t his plasmid was first transformed into strain RN4220 (a chemically mutated S. aureus strain that more readily accepts foreign DNA) by electr oporation, then phage transduced into strains Newman, COL and UAMS 1 using standard methods with growth at 30 C [107,108,109] Integration of pTR27 into the nos gene on the S. aureus chromo some was achieved as follows: S. aureus COL, Newman or UAMS 1 harboring plasmid pTR27 was grown at 43 C in the presence of erythromycin (non permissive temperature for plasmid replication ), to promote integration of the plasmid into the chromosome via hom ologous recombination at the nos gene To induce a second recombination event, a single isolated colony was then used to inoculate TSB (no antibiotic) and grown at 30C for 5 days. Every 24 hours, an aliquot of the culture was diluted 1000 fold into fresh TSB (no antibiotic). On days 3 5, the culture was serially diluted and spread on TSA plates containing erythromycin, and isolated colonies were then screened for erythromycin resistant and chloramphenicol sensitive phenotypes by picking and patching onto T SA Erm 2 and

PAGE 31

31 TSA Cm 5 plates. PCR ( with the same primers used to clone the nos gene in pTR27) and Southern blotting were both used on candidate mutants and appropriate control strains to confirm that the chromosomal nos gene had been correctly replaced by t he nos ::Erm allele (data not shown) In this study, t he stability of the nos:: Erm mutation in UAMS 1 was confirmed by streaking the mutant out on TSA+ Erm 2 medium and then overnight culturing representative colonies in TSB with out antibiotic. Serial dilutions were made on these overnight cultures and the 10 7 10 9 dilution range was plated on both TSA plain and TSA+Erm 2 The colonies were then counted to ensure comparable CFU/mL on each plate, to confirm the mutation is stable. With 8.3x10 8 colonies on the TSA+Erm 2 plates and 7.5x10 8 colonies on the TSA plain plates (average of three replicates), the mutation was determined to be stable. The nos mutation in UAMS 1 was complement ed in this study using the appropriate primers specified in T able 2 2 and Thermalace enzyme (Invitrogen) were used to PCR amplify a 2.5 kb genomic fragment from UAMS 1. This PCR product encompassed 750 bp upstream (nucleotide 2,098,174 of the MRSA252 genome, Genbank accession # BX571856) of nos (annotated as SAR2007 in the MRSA252 genome) and 615 bp downstream of SAR2008 (nucleotide 2,101,429 of the MRSA252 genome ) (Figure 2 1) The PCR product was gel purified using a ZymoResearch gel purification kit and then cut with EcoR V and Pst I (natura lly occurring restriction sites upstream of nos and downstream of SAR2008, respectively) and ligated to pBT2, which was also gel purified and cut with the same enzymes. The ligated plasmid was transformed into E. coli by heat shock [110] and confirmed by

PAGE 32

32 isolating plasmid from potential clones using the Promega Wizard Miniprep kit followed by restriction enzyme digestion with EcoR V / Pst I and agarose gel electrophoresis to visualize the reactions Following confirmation, the plasmid was e lectroporated into RN4220 [109] and spread on Cm 10 plates and grown at 30C the p ermissive temperature for replication of pBT2 The re sulting colonies were then cultured overnight in TSB Cm 5 and plasmid DNA purified from these cultures was screened as described above, to confirm the correct insert size. Following confirmation the p lasmid was transduced into KR1010 the UAMS 1 nos:: Erm mutant [108] A tran sducta nt that was confirmed (as described above) to have the plasmid was then grown on TSA Cm 10 at 43C (non permissive temperature for plasmid replication) in the presence of chloramphenicol to select for cells which had integrated the plasmid into the chromoso me. In order to promote a second recombination event, a single colony was grown at 30C for five days, and each day the culture was diluted 1:1000 into fresh TSB. After the third, fourth and fifth days the culture was diluted and plated on plain TSA, and individual colonies were selected and screened for sensitivity to both erythromycin and chloramphenicol Verificatio n that the potential complement strains were correct was carried out via Southern blot analysis [111] and PCR amplification (data not shown) The complement strain was designated KR1011. Bioscreen C Planktonic Growth Assays The Growth Curv es USA Bioscreen C was used to compare planktonic growth of the wild type UAMS 1 nos:: Erm mutant and complement strains. For each replicate, a single colony from a freshly streaked plate was used to inoculate 3 mL TSB and grown at 37 C and 250 rpm for 24 hours. The OD 600 of each overnight culture was recorded and used to inoculate 0.50mL of TSB (or TSB NaGlc depending on the experiment) to

PAGE 33

33 an OD 600 =0.05. 250L of each diluted culture was added per well of the Gr owth Curves USA 100 well Bioscreen C plate in duplicate for each replicate The Bioscreen C was run on fast, continuous shaking for 72 hours at 37C and OD 600 measurements were recorded every 45 minutes For the wells treated with hydrogen peroxide (H 2 O 2 ) the initial inoculum was supplemented with 20mM (final concentration) H 2 O 2 and grown under the same settings des cribed above. Each growth curve was performed on at least n=5 biological replicates of each strain. Qualitative and Quantitative Pigment Assay s The pigment differences in the wild type UAMS 1, Newman and COL strains compared to their respective nos mutants was qualitatively assessed by growth on TSA in the absence of antibiotic selection. Each strain was initially streaked out on TSA (with selective antibiotic as necessary), and then a single colony from each was used to inoculate 3 ml TSB (no antibiotic) and incubated overnight under aerobic growth conditions. The OD 600 of each culture was taken the next day and each culture was diluted in 1mL of TSB to an OD 600 =0.50. The cultures were then plated in 10 L drops on TSA plates (no antibiotic) and left to grow at 37C for two days, to prom ote maximal pigment production [5] Plates were then photographed with a digital camera. This experiment was repeated on 3 biological replicates of each strain. Pigment production in UAMS 1, KR1010 and KR1011 was also quantified from planktonic TSB cultures (initially inoculated to OD 600 =0.05) that were grown for 24 and 48 hrs at 37 C and 250 RPM as well as from cells scraped off from TSA plate s grown for 24 and 48 hours at 37 C Each condition was assayed in biological triplicate The methanol extraction method from Morikawa et al [112] was used to isolate the pigment. 800uL of each overnight culture was diluted to an OD=3. 0, spun down and washe d with

PAGE 34

34 water before being treated with methanol at 55C for 5 minutes. The extracts were spun down again and the supernatants were brought up to a volume of 1 mL and compared against a methanol standard. Absorbance was read at 4 65 nm the maximum absorptio n wavelength for carotenoids Statistics were performed using a one way analysis of varian ce and the Student Newman Keuls method. Biofilm Assay s To determine phenotypic differences between UAMS 1, KR1010 and KR1011 with regards to biofilm development, static biofilm assays were performed in triplicate A Thermo Scientific Nunc 8 chamber glass slide was pre coated for 24 hours at 4 C with 350 L 20% (vol/vol) human plasma (Sigma) in bicarbonate buffer (Sigma Carbonate Bicarbonate capsules, 1 capsule dis solved per 100mL of water) After coatin g the plasma was removed and wells were each inoculated with 500 L fresh overnight S. aureus culture grown in TSB NaGlc (described above) and diluted to OD 600 =0.05 in the same TSB NaGl c biofilm medium Static bio films were grown for 24 hours at 37 C, culture supernatants were removed and biofilms were stained with LIVE/DEAD stain (Invitrogen) using 1.5 L/mL propidium iodide (PI) and 0.5L/mL S yto 9 prepared in 0.85% (vol/vol) NaCl Staining occurred for 30 min a t room temperature covered with aluminum foil to pres erve light sensitivity. The stain was then removed and 500 L 0.85% NaCl was added to each of the wells prior to imaging by confocal microscopy The images were acquired on a Zeiss Pascal LSM5 C onfocal Laser Scanning Axiovert 200 Microscope using an Argon laser and a 40x water immersion lens. For each biological replicate, s ix representativ e images were taken of each well for a total of 18 z stacks acquired per strain. The z stacks were taken at 0.5 m z slice intervals and a scanning speed of 8 on frame mode. The images were processed using the LSM

PAGE 35

35 Browser software (Zeiss) and biofilm characteristics were quantified using COMSTAT software for MatLab [113] RNA Isolation The RNeasy micro RNA isolation kit (Qiagen) in combination with the FASTPREP 24 and lysing matrix B (MP Biomedicals LLC) were used to obtain RNA from UAMS 1, KR1010 and KR1011 under aerated and low oxygen growth conditions in triplicate by previously described methods [114,115] The aerated RNA was harvested from cells at t=6 hours only whereas the low oxygen RNA was obtained at both t=2 and t=6 hours growth (corresponding to early exponential and late exponential growth phase, respectively) 25mL of each culture was spun down (4,500 rpm) in 50mL falcon tubes for each RNA isolation and at the t=6 time point under aerobic and low oxygen growth, the final elution was done twice for a final volume of 100 L. Following RNA isolation, Northern blotting was performed wi th the DIG system (Roche) (probe primers are listed in Table 2 2) [115] RNA was also obtained after cultures were treated with H 2 O 2 In brief, UAMS 1, KR1010 and KR1011 were cultured in TSB The cultures were grown for 11 hours and a 1:1000 dilution was made into fresh TSB The cultures were grown until the OD 600 =0.80 then a 1:100 dilution was made into fresh TSB When the culture reached an OD 600 =0.80 again, the cultures were treated for 20 minutes with 10mM H 2 O 2 Following treatment, RNA was obtained as described above This experimental design was adapted from Chang et al [116] who by RNA microarray had shown an up regulation of nos expression 20 minutes after exposure to 10mM H 2 O 2 This experiment was only per formed once for each strain

PAGE 36

36 cDNA Production and Quantitative Real Time PCR ( qRT PCR ) The iS cr ipt cDNA synthesis kit from BioR ad was used to make a cDNA pool generated with random primers as described in the manufacturers protocols f rom the RNA isolations described above In brief, each RNA sample was quan tified using a N anovue (General Electric) on the default RNA settings and then 0.750g RNA was added to each cDNA reaction. This cDNA was then used in q RT PCR to quantify the amount of nos and bifunction al purine biosynthesis protein ( purH ) ( using primers listed in Table 2 2) in the 2 and 6 hour low oxygen samples and in the 6 hour aerobic samples using the iQ SYBR green supermix (Biorad) detection method. Transcription of nos was also assessed by this method in the RNA samples isolated from the H 2 O 2 treated cultures. The qRT PCR took place in a BioR ad iQ5 the r mal cycler. The protocol wa s one cycle at 95 C for 3 minutes, followed by fort y repeats at 95 C for 15 seconds and 55 C for thirty seconds. T his is then followed by 81 repeats of 30 seconds of increasing the temperature from 55 C 95 C with the set point temperature increasing after cycle 2 by 0.5 C to generate the melting curve The genes of interest were compared against a standard, in this in stance the 70 gene which is the housekeeping sigma factor in S. aureus Due to its nature as a housekeeping gene, it should have stable transcription despite the growth phase, and thus provide an accurate standard to account for loading differences and varying PCR efficiencies [117,118] A suitable reference gene should have a standard deviation of less than 2 fold from the mean expression level of the given gene, a criterion which is satisfied by 70 [119] The Livak ( C T ) method was used to determine relative fold change (see sample calculations in Appendix 1) This method was used because the amplification efficiency for each set of primers was near 100% and each primer set amplified within 5% of each other [120]

PAGE 37

37 Co T ranscription PCR To determine whether the nos and SAR2008 gen es are co transcribed, a primer pair was designed to amplify the intergenic region between these two genes (see Figure 2 1 ). Specifically, these primers were located 718 bp upstream from the nos stop codon and 162bp downstream from the SAR2008 start codon. This region is 127bp downstream from the Erm cassette insertion in the nos mutant A PCR reaction was run using 75ng of isolated UAMS 1, KR1010, KR1011 genomic DNA, RNA and cDNA (generated with the superscript cDNA synthesis kit described above) The PCR reaction took place in a MJ Mi ni Personal Thermal Cycler (BioR ad), and the reacti on conditions were 94C for two minutes followed by 20 cycles of 94 for 30 seconds, 50 for 30 seconds then 72 for 2 minutes. After the 20 th cycle, there was an additional 72C incubation for 10 minutes. A sample of 20 L PCR product with 2 L 6x loading dye w as then loaded for each reaction and electrophoresed through a 1% agarose gel at 120V for 45min. The gel was imaged on Molecular Imager Gel Doc XR+ and used with Quantity One software. This experiment was performed twice to ensure reproducibility of the results. GFP Assays GFP reporter plasmids were made using the primers described in Table 2 2 and UAMS 1 DNA was used as template, and Thermalace (high fidelity) enzyme (Invitrogen) The Reaction ran for 94C for two minutes, followed by 30 cycles of 94C for 30 seconds, 50 for 30 seconds then 72 for 2 minutes. At the end of the cycle s there was an additional elongation step at 72 for ten minutes. The primers amplified a putative promoter region 500bp upstream from the nos start codon (Figure 2 1) The promoter fragment was initially ligated into p CRBlunt (Invitrogen) and transformed into

PAGE 38

38 E. coli. After confirmation, this plasmid was digested with Sph I and Bam HI (sites engineered in the forward and reverse primers, respectively), and the resulting fragment was gel purified using a Zymoclean Gel DNA Recovery Kit and ligated into pJB36 which was cut with the same enzymes and gel purified This ligation was transformed into E. coli DH5 cells via heat shock, with the resulting plasmid designated as p JB nos whereby the 500 bp nos promoter fragment was cloned upstream to GFP (originally amplified from plasmid pBURSA [121] and containing a 28 bp translation enhancer region [1 22] A promoterless GFP plasmid was also made by taking Sph I/Bam HI digested pJB36, performing a Klenow treatment (New England Biolabs) as described by the manufacturer, religating and transforming the plasmid into E. coli DH5 by heat shock. This prom oterless GFP plasmid was designated pJB36 Each plasmid was then electroporated into S. aureus RN4220 [109] and subsequently transduced into UAMS 1 [108] After confirmation of the plasmids, fluorescence analysis was done to compare promoter activity of pJB nos, p JB cidA (a positive control for fluorescence previously created by Dr. Rice using the cloning strategy described above ), and pJB36 (a promoterless GFP vector to serve as a negative control for background fluorescence) in UAMS 1 under planktonic growth conditions. UAMS 1 harboring each of these constructs was grown aerobically and under low oxygen conditions in TSB as described above Each culture was inoculated with a corresponding overnight culture to an OD 600 =0.1. The cultures were monitored for flu orescence at 2, 4, 6, and 8 hour s post inoculation, whereby samples of each culture were centrifuged and resuspended in 1 mL of 0.85% NaCl. This experim ent was performed in biological duplicate

PAGE 39

39 The fluorescence of each of these constructs was also measured when strains were each grown on TSA plate s (in triplicate) under the following environmental conditions: (1) aerobic at 37 C, (2) in a microaerobic (O 2 concentration 6 12%, CO 2 concentration 5 8%) pouch (Remel) at 37 C and (3) in a 5% CO 2 incubator at 37 C. The cultures ( UAMS 1 con taining either pJB 36 nos or pJB36 ) were each initially streaked out on TSA Erm from frozen stocks and then re streaked onto TSA plain. These culture s were grown for 24 hours u nder their respective condition, and then the cells were scraped off the agar surface and resuspended in 1 mL of 0.85% NaCl. For all of the fluorescence experiments, a Biotek Synergy HT plate reader was used to take readings from a 96 well plate (Costar black with clear bottom ) loaded with 200 L of each samp le per well, in duplicate. The plate reader was set to read fluorescence from the bottom of the plate. The readings were taken using the Gen5 version 1.09 which took a RFU reading with filter settings of 485/20 excitation and 516/20 emission and sensitivity of 75 for the plate experiments and 6 5 for planktonic culture studies Although the density of cells in each well were similar, a corr e sponding OD 600 reading was also taken for each well, to calculate t he RFU/OD 600 which would account for slight variations in OD

PAGE 40

40 Table 2 1 Strains and plasmids used in this study. Strain or plasmid Description Reference Escherichia coli Host strain for construction of recombinant plasmids [123] Staphylococcus aureus RN4220 UAMS 1 KR1010 KR1011 Newman AR0100 COL AR0093 Easily t ransformable restriction deficient strain Osteomyelitis c linical isolate UAMS 1 nos :: E r m insertion mutant KR1010 complement strain Lab Strain Newman nos:: E r m MRSA Lab strain COL nos:: E r m [ 124] [125] This work This work [126] Obtained from A. Richardson, UNC Chapel Hill [127] Obtained from A. Richardson, UNC Chapel Hill Plasmids p TR27 pJB36 p JB 36 cidA pCRBlunt p JB36 nos p JB36 pBT2 p BT2 nos nos:: E r m mutant allele Erm R /Cm R pCN51; P CAD promoter GFP; Erm R cid A promoter GFP E r m R Zero Blunt PCR Cloning kit ; Km R 500bp nos promoter GFP E r m R promoterless GFP Amp R /E r m R E. coli S. aureus shuttle vector with thermosensitive origin of replication for S. aureus Cm R nos complement Cm R Obtained from A. Richardson, UNC Chapel Hill [128] Obtained from K. Bayles, UNMC Obtained from K. Bayles, UNMC Invitrogen This work This work [129] This work

PAGE 41

41 Table 2 2 Primers and probes used in this study. Primer Role Forward/Reverse nos insertion mutant nosSAR2008 knock in nos qRT PCR 70 qRT PCR purH qRT PCR nosSAR2008 co transcription nos promoter region nos Northern probe SAR2008 Northern probe Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse GTTAGTTACCAAAGCATAATTGCG ATCTGCCACAATGTTGATTGTTCC CCCGCATGCATACCAAATAATTTACCCGCCCTA CCCGGATCCTTGAACGAGTGGTAACGAA TATGGTGCTAAAATGGCTTG ACGATGCTTCGTCAGTAACA CAAGCAATCACTCGTGCAAT GGTGCTGGATCTCGACCTAA CGAAATAAACCGCAGCATTT TCGTCACATCAGGGTTAGCA TGGACCTAAAATTTTCAACAA TGCAACTGACTTGATGACTT CCCGGATCCTAACAATGGTTCGTTACCAAAG CCCGGATCCACTCTTAAAAATTATGTATATGTCA AGCAAATCACTTCGGTTGGA ATTCAACAAGTGCTCGATCT GTTCGAACACCATTTCTGAT CCTGAACGAAAAATCGATAC Figure 2 1. Diagram representing primer locations for nos complementation (red), nos SAR2008 co transcription (pink), nos promoter (brown). The location of the erythromycin cassette is also indicated in the construction of nos ::Erm.

PAGE 42

42 CHAPTER 3 RESULTS nos and SA R2008 Are Co transcribed During the construction of the UAMS 1 nos mutant and complement strains, a closer inspection of the nos genomic region revealed that the nos gene and the downstream SAR2008 open reading frame, encoding a putative prephenate dehydr atase, are only separated by 20 bp, suggesting that nos and SAR2008 may be co transcribed as an operon. To investigate this further, PCR amplification with primers designed to amplify the intergenic region between nos and SAR2008 (see Table 2 2 and Figure 2 1) was performed on genomic DNA isolated from UAMS 1, KR1010 ( nos:: Erm) and KR1011 (complement strain) in addition to cDNA and RNA isolated from these strains. As demonstrated in Figure 3 1, genomic DNA amplification yielded the same PCR product in all three strains This was expected, since the forward primer is positioned downstream from the Erythromycin cassette inserted in the nos mutant strain (KR1010) In contrast, cDNA amplification with these same primers occurred in UAMS 1 and KR1011 (a slight decrease in KR1011 may be due to inefficiency during cDNA generation or PCR amplification) but this amplicon was not detected in the cDNA from KR1010. The lack of this PCR product indicates there may be a polar effect on expression of SAR2008 in the nos: : Erm mutant strain, due to the presence of a terminator hairpin at the end of the Erythromycin cassette. Using RNA template in this PCR r e action did not yield amplification in any of the strains, indicating there was no significant genomic DNA contaminatio n of the RNA samples ( Figure 3 1). Furthermore, Northern blot analysis using nos and SAR2008 probes showed co hybridization present in the wild type UAMS 1 and neither probe was detected in the

PAGE 43

43 nos mutant KR1010 (data not shown) Therefore, it is importa nt to keep in mind that the phenotypic results described below may be a function of inactivation of the nos gene alone and/or due to its polar effect on SAR2008. Analysis of Planktonic Growth To determine whether the nos mutation affects the planktonic gr owth of S. aureus UAMS 1 the wild type, nos:: Erm mutant ( KR1010 ) and complement strain ( KR1011 ) were compared when grown in a Bioscreen C system As seen in Figure 3 2 and Figure 3 3 when grown in parallel in either TSB or TSB NaGlc (biofilm media), no appreciable difference s in growth of the wild type, mutant and complement strains were observed by OD 600 measurements under these conditions. Previous work done by Gusarov and Nudler [96] suggest ed that endogenous NO production enables bacteri a to tolerat e oxidative stress, and that NOS derived NO helped B. subtilis and S. aureus becom e less susceptible to reactive oxygen species such as hydrogen peroxide [94,96] To confirm these results hold true in a clinical isolate S. aureus strains UAMS 1, KR1010 and KR1011 were grown in the presence of 20 mM hydrogen peroxide and growth was measured over a 72 hr period (Figure 3 2) In the presence of hydrogen peroxide, the wild type a nd complement strains initially displayed delayed growth b ut by 2 4 hours the OD s of the treated cultures of these two strains were close to their respective control (untreated) cultures. In contrast, nos mutant strain, KR1010, did not grow in the H 2 O 2 medium (Figure 3 2) This observation demonstrates that even though the current nos mutant was created in a clinical S. aureus strain compared to the previously published stud ies mentioned above [94,96] the UAMS 1 nos mutant also di splays increased sensitivity to oxidative stress (H 2 O 2 ) under planktonic growth

PAGE 44

44 conditions. This reinforces the idea that SaNOS play s a role in oxidative stress response in S. aureus. Expression of nos under Planktonic Growth Conditions Interestingly, whole transcriptome a nalysis done by Chang et al [116] re vealed an increase in S. aureus nos transcript ion when cultures were treated with H 2 O 2 for 20 min prior to isolating RNA. To determine whether this result holds true in the clinical isolate UAMS 1, a similar experiment was performed qRT PCR was used to measure nos expression in UAMS 1, KR1010 (no detectable transcription was observed since it is the nos mutant) and KR1011 after addition of 10mM H 2 O 2 to planktonic cultures. T here was a 2.8 fold increase in nos transcription when UAMS 1 cultures were treated with H 2 O 2 ( Figure 3 4B ). This result is in agreement with the previously published mi croarray results [124]. The growth data presented in Figure 3 2 and the increase in mRNA concentration support a positive role for S. aureus nos in responding to oxidative stress. To obtain a better appreciation for the expression patterns of nos under pla nktonic growth conditions, nos expression was also assessed by qRT PCR on RNA isolated from both aerobically grown cultures as well as cultures grown under static, low oxygen conditions. This analysis demonstrated in the wild type UAMS 1 strain nos expression was growth phase dependent, increasing 6 fold under low oxygen conditions at 6 hours (late exponential phase) relative to 2 hours growth (Figure 3 4) Furthermore, expression of nos was up regulated under low oxygen growth conditions relative to aerobic growth after 6 hours growth. As expected, t here was no detectable nos expression in the nos mutant, and nos expression levels in the complement strain were comparable to wild type levels (Figure 3 4). T hese results suggest that in addition to bein g inducible by H 2 O 2 the nos

PAGE 45

45 growth conditions in a growth phase dependent manner, and expression appears to be up regulated during low oxygen growth Increased Pigment Production in nos Mutant One mechanism that S. aureus uses to combat oxidative stress is through carotenoid pigment production which confers protective antioxidant activity [5] Qualitatively the KR1010 ( nos mutant ) displayed consistently increased pigment production relative to wild type strain when cultured on TSA plates. To follow up on this observation, pigment production in three different S. aureus wild type strains ( UAMS 1, Newman and COL ), by nos:: Erm mut ants after being incubated for two days on TSA plates (Figure 3 5 ) Qualitative differences in pigment production were not noticeable after 24 hours of growth (data not shown), but at 48 hours, pigment production was consistently higher in all three nos mutants relative to their w ild type strains (Figure 3 5 ). Interestingly, pigment production appeared to be most dramatic ally incr eased in strain COL, a lab MRSA strain and a similar observation was noted when comparing a clinical community acquired MRSA strain to its isogenic nos:: Erm mutant (data not shown). To better quantify pigment production in the UAMS 1 background, methanol extraction [112] was use d to monitor pigment production at 24 and 48 hours in planktonic TSB cultures as well as on TSA plates. There was no appreciable difference between UAMS 1 and the nos mutant at 24 hours growth under either condition. However, after two days of planktonic growth, there was about a two fold in crease in pigment production in the nos mutant compared to wild type while the complement pigment level was comparable to that of the wild type After two da ys of TSA plate growth, there was about a three fold increase in pigment in the nos mutant compared to either the wild type or the complement strains ( Figure 3 6 )

PAGE 46

46 These results were statistically significant as determined by the Student Newman Keuls test, where the p value <0.05. Interestingly, recent findings published by Lan et al [130] identified hyper pigmentation mutants in S. aureus with one of these mutants being in the purine biosynthesis gene purH. They performed an RNA microarray analysis and found that in the purH mutant there is about 5 fold less expression of no s [130] These results correlate with the observat ions in this thesis study, as there was increased pigment production in the nos mutant, which also has decreased nos expression. Therefore, qRT PCR was also performed on the RNA samples described in the previous section to detect purH transcription to see if the revers e relationship (decreased nos = decreased purH expression) ho ld s true. The results in Figure 3 7 indeed indicated that there is decreased purH expression in the nos mutant at 6 hours growth in both low oxyg en and aerated growth condition s and purH expressi on in the complement strain mimicked wild type levels. At 2 hours growth under low oxygen conditions, purH expression was low in all three strains, which had similar expression levels ( Figure 3 7 ). nos Expression under Static Plate Conditions As described above, the nos mutant displays increased pig ment production when grown on TSA plate s. Given that decreased nos expression appears to correlate with increased pigment production on TSA plates, it was hypothesized that increased nos expression may occur in S aureus UAMS 1 under these growth conditions. To test this hypothesis, a nos promoter GFP plasmid reporter construct and a promoter less GFP construct (to serve as a negative control for background fluorescence) were each moved into the wild type UAMS 1 s train, and GFP fluorescence was measured in cells grown under planktonic (aerobi c and low oxygen) and TSA medium (aerobic, 5% CO 2

PAGE 47

47 and microaerobic) growth conditions The promoter activity of cidA ( a gene studied and known in our lab to be highly expressed under low oxygen conditions) was also monitored as a positive control for fluorescence and was highly active under low oxygen conditions, suggesting any fluorescence differences observed are not due to insufficient oxygen fo r pro per GFP folding ( data not shown ). Using this method to monitor nos promoter activity, it was observed tha t a low level of fluorescence (1500 RFU above background levels under aerobic conditions, 1000 RFU above background levels under low oxygen condit ions ) was observed under both planktonic growth conditions (data not shown). These results suggest that nos is only expressed at basal levels, or alternatively, only in a subpopulation growth of UAMS 1 with the nos GFP reporter plasmid on a TSA plate showed a dramatic increase in fluorescence under normal at mospheric conditions (Figure 3 8 ), as compared to micro aerobic and 5% carbon dioxide growth. This decrease in nos expression on the micro aer obic TSA culture rel TSA culture is in contrast to the planktonic growth nos expression patterns observed by qRT PCR ( F igure 3 4 ), where the low oxygen growth showed an increase in transcription. These differences may indicate a differ ent environmental stress and/or signaling condition triggering nos expression under the agar medium growth condition. solid interface may potentially link nos to a role in a more sessile comm unity, like a biofilm. Fluorescence of the nos GFP reporter plasmid was also monitored in the biofilm growth conditions however no appreciable fluorescence was detected at the 24 hour time point tested when observed by confocal microscopy This lack of fl uorescence could be caused by a

PAGE 48

48 signal too weak to be detec ted by the confocal microscope, or, alternatively, too few cells are expressing nos under these biofilm growth conditions, making them difficult to find and visualize by microscopy (data not shown). The nos Mutant Produces a More Adherent Biofilm To begin to appreciate whether nos is involved in regulating biofilm development in S. aureus, 24 hour static biofilm growth was assessed in UAMS 1, the nos:: Erm mutant, and complement stra ins. This model of biofilm growth is primarily used to measure initial attachment and the early phases of biofilm development. The LIVE/DEAD stain (Invitrogen) utilized in this study is comprised of Syto 9 and propidium iodide nucleic acid stains that dif ferentiate between live (green) and dead (red) cells respectively. The Syto 9 stains both live and dead bacteria, however the PI penetrates only dead or damaged bacteria, with the red stain fluorescence dominating the green fluorescence Using this metho d of biofilm visualization, after 24 hours growth, the nos mutant consistently displayed qualitative differences in its overall thickness and structure compared to the wild type and complement strains, in addition to a brighter green fluorescence (p ossibly due to more cells present or a ltered uptake of the Syto 9 dye)(Figure 3 9 ). Furthermore, COMSTAT and statistical analysis showed there is a subtle yet significant difference between the nos mutant and wild type/complement strains in terms o f average thick ness (Figure 3 10A), biomass (Figure 3 10 B) and the surface area to biomass ratio, which is used as an indicator of biofilm adaptability to environ mental stresses [113] (Figure 3 10 C). Specifically, the mutant is on average thicker than the wild type strain, has a greater biomass, and a smaller surface area to biomass ratio. Collectively, these results indicate that the nos mutation affects biofilm adherence and architecture in the early phases of biofilm development.

PAGE 49

49 Figure 3 1. nos and SAR2008 are co transcribed. Two representative experiments are depicted. For each gel, Lane 1 is a 2 log ladder. PCR reactions contain either 75 ng genomic DNA template, 75 ng cDNA template or 75 ng RNA template, respectively. 10.0 kbp 3.0 kbp 1.0 kbp 0.5 kbp 10.0 kbp 3.0 kbp 1.0 kbp 0.5 kbp

PAGE 50

50 Figure 3 2. Growth of Wild type, mut ant and complement strains in TSB and TSB + 20mM H 2 O 2 growth conditions.

PAGE 51

51 Figure 3 3. UAMS 1, KR1010, KR1011 growth in 3% TSB+ 3% NaCl+ 0.5% glucose medium for 48 hours.

PAGE 52

52 Figure 3 4. E xpression of nos under (A) 2 and 6 hour low oxygen condition 6 hours highly aerated (n=3) in addition to (B) treated and untreated with hydrogen peroxide as previously described (n=1). The hydrogen peroxide are normalized to the untreated under the same condition, while the other conditions are a fold increase as compared to 2 hours. There are no bars on the KR1010 ( nos mutant) due to the absence of an amplification product. A. B.

PAGE 53

53 Figure 3 5. Increased pigment production in the nos mutant when grown on TSA plates. A) Increased pigment was observed in the nos mutant in 3 different S. aureus genetic backgrounds when cultured for 48 hours on TSA plates. B) Pigment production was increased in the nos mutant strain (KR1010) relative to UA MS 1 and was complemented back to parental phenotype in KR1011. Each picture is representative of 3 replicates Wild type Mutant Complement Wild type Isogenic nos mutant

PAGE 54

54 Figure 3 6. Total pigment concentration of S. aureus nos mutant. Asterisks represent statistically significant difference as described previously in the results. Results represent the average of 3 independent experiments.

PAGE 55

55 Figure 3 7. qRT PCR reveals a decrease in purH expression in the nos mutant at the 6 hour time point under aerated and low oxygen growth. Results represent the average of three independent experiments

PAGE 56

56 Figure 3 8. Expression of a nos GFP reporter in UAMS 1 when grown on TSA plates under various environmental conditions. = significant difference between delta and corresponding nos expres sion. ** = significant difference in respect to low oxygen. Data represent 3 independent experiments

PAGE 57

57 Figure 3 9. Representative orthogonal views of 24 hour static biofilms. The large square in each biofilm is the top down view whereas the sid e panels are orthogonal (side) views. The cells are stained with LIVE/DEAD stain where the red cells are dead or damaged and the green cells are live. A) UAMS 1, B) KR1010, C) KR1011. Images were acquire at 400x magnification by confocal microscopy, and ar e each representative of 18 random fields of view acquired in 3 independent experiments

PAGE 58

58 Figure 3 10. COMSTAT analysis reveals statistically significant (Student Newman Keuls test) differences between wild type (UAMS 1) and nos mutant (KR1010), and the phenotype is complementable (KR1011). A) Average Thickness B) Biomass C) Surface Area to Volume Ratio. P values are indicated on each graph. Data represents 18 measurements of each parameter acquired in 3 independent experiments.

PAGE 59

59 CHAPTER 4 DISCUSSION Role of nos in S. aureus Oxidative Stress SAR2008, a putative prephenate dehydratase, is located 20bp downstream from the nos gene This close proximity suggested it was probable this gene is cotranscribed with the nos gene. I n agreement with this possibility northern blotting of RNA with probes each specific for nos and SAR2008 showed no hybridization in the nos mutant, but both probes each hybridized to a transcript of the same length in the wild type strain, indicating they are co transcribed (data not shown). Furthermore, PCR with primers amplifying a region 127bp downstream from the Erm cassette and 162bp downstream from the SAR2008 start codon show amplification in both the UAMS 1 (wild type) and KR1010 (complement) cDNA, wherea s the KR1010 (mutant) cDNA showed no amplification. This result also impl ies co transcription of these two genes. Given that the nos mutation likely abrogates SAR2008 transcription, all phenotypes observed in this study are possibly due to the inac tivation of one or both of the se genes Future work will be done to create and compare phenotypes of both a non polar nos mutant and a non polar SAR2008 mutant, to determine the specific contribution of each e and biofilm development. Co transcription implies a potential working relationship between nos and SAR2008 the putative prephenate dehydratase possibly invol ved in oxidative stress relief. Prephenate dehydratase is known to be involved in aromatic amino acid biosynthesis and catalyzes the decarboxylation of prephenate to phenylpyruvate [131] Expression of t his gene has been shown to be up regulated in response to hydrogen peroxide in S. aureus presumably due to co transcri ption with nos [116] Intriguingly,

PAGE 60

60 phenylpyruvate has also been shown to have antioxidant capabilities through the nucelophilic attack of a mono protonated hydrogen peroxide ion which attacks the C 2 carbonyl group carbon center [132] Given the ge netic organization and co transcription of nos and SAR2008, it is tempting to speculate that up regulation of prephenate dehydratase expression during hydrogen peroxide stress may in itself be an anti oxidant mechanism, by up regulating production of pheny lpyruvate. Alternatively, akin to the activation of catalase of endogenously produced NO by nos in Bacillus, perhaps SaNOS is responsible for ac ti vating the SAR2008 prephenate dehydratase enzyme in response to oxidative stress. While there wa s not an obse rved difference under p lanktonic growth condition in either TSB and biofilm medium between the wild type, nos mutant and complement strains, the addition of oxidative stress by means of hydrogen peroxide revealed a n increased susceptibility of the nos mutant to H 2 O 2 that was not observed in the wild type or complement strains. This decreased tolerance suggests a potential role for SaNOS in oxidative stress relief, although it is unclear from these studies whether the specific NO dependent mechanism pre viously observed in Bacillus (i.e. activation of an catalase, or preventing the Fenton reaction [96] ) also hold s true for S. aureus nos A role for nos i n oxidative stress relief is also supported by the increased pigment production observed in the nos mutant in conjunction with the increased expression of the nos gene in the wild typ e strain under these same growth conditions These results suggest the nos mutant may be subject to additional oxidative stress compared to the wild type strain, and may be compensating for this by overproducing carotenoid pigment. Conversely, the NO produ ced by the NOS enzyme may have a role in

PAGE 61

61 signaling or regulating pigment production. Currently, our results cannot differentiate between the two possibilities. These observation s correlate to a paper by Lan et al [130] looking at pigment mutants in S. aureus, and more specifically those involved in purine bi osynthesis such as the protein P urH which catalyzes the final steps in the bio synthesis o f inosine monophosphate [133] In the study by Lan et al., a purH mutant sh owed hyperpigmentation, decreased purine biosynthesis and decreased nos expression. Interestingly, t his phenotype is in accordance with the nos mutant characterized in this study, as this mutant also displayed increased pigment production and decreased exp ression of nos and purH. These observations may suggest a mechanism in which increased oxidative stress on the cells alters S. aureus metabolism in favor of NADPH production, and pyridine nucleotides which are consumed by many antioxidant enzymatic system s [134] Although these results suggest a relationship and/or feedback mechanism between nos, purine biosynthesis and pigment production, the exact interactions ar e currently unknown and require further investigation. The Contribution of no s under Biofilm Conditions While a role for nos as an antioxidant mechanism seems likely, nos has also been sh own to be expressed either at a basal level under all growth conditions, or alternatively, is expressed by only a subpopulation of cells rendering nos expression difficult To determine if the nos expression is localized or expressed at a basal level future studies will use the nos GFP reporter and flow cytometry to determine if higher fluorescence only occurs in a subpopulation of cell s under various growth conditions Furthermore, NO can be visualized via a fluorescent stain DAF FM, which would show whether the NO is present uniformly throughout the cell population or localized to a

PAGE 62

62 more specific area Nonetheless, nos expression at b asal levels through out the bacterial population or, alternatively, by a subpopulation of cells suggests potentially an additional role of nos perhaps in terms of NO production for cell signaling as previously mentioned [15,80,81] Under static biofilm conditions the nos mutant has a more attached, robust biofilm. It is on average thicker with a lower surface area to biomass ratio when compared to the wild type and complement strains ability to adapt to surroundings and the nutrient and oxygen availability within the heterogeneous biofilm suggesting perhaps this biofilm is less responsive to environmental signals, and potentially less fit The higher biomass and thickness of the mutant biofilm shows there may be a relationship between endogenously produced nitric oxide and biofilm attachment (with less NO resulting in more attachment as previously observed in Neisseria biofilms [74] ) While the differences between the wild type, mutant and complement strains wer e subtle, this may be due to other sources of NO (disproportionation and nar ), or due to the nitric oxide reductase ( nor ) gene unique to UAMS 1 and related strains. The presence of nor in this strain may minimize the net levels of endogenous NO in the wild type strain and therefore may, in part, explain the subtle biofilm phenotype of the nos mutant. A nos/nor double mutant is currently being created to test if th ere is a more dramatic phenotypic change in the double mutant compared to each single mutant an d wild type strain Given that the biofilm experiments performed in this study focused on the attachment phase, f urther work will need to be done to establish a relationship, if any, between NO/ nos and biofilm dispersal.

PAGE 63

63 Sensitivity to hydrogen peroxide ma y also be related to biofilm development and signaling cell dispersal. In vivo, S. aureus biofilms likely encounter the innate immune system through interactions with neutrophil and macrophage respiratory bursts, which would release a combination of oxidative antimicrobials. Given that nos expression is up regulated in response to hydrogen peroxide [116] it is tempting to s peculate that NO production by nos may function to trigger cell dispersal and/or other adaptive responses Potentially, endogenously produced NO via nos is expressed at a basal level in the early stages of biofilm development, allowing for attachment. Pres umably, in the nos mutant, further decreasing NO production may have allowed for increased attachment of the biofilm relative to wild type strain. In response to a respiratory burst or accumulation of oxidative stresses in highly populated areas of the bi ofilm nos expression, already active on a basal level, could be induced, signaling cells within the biofilm to disperse and colonize new areas This model as of yet is just a model, and the NO contribution of nos (in the wild type, mutant and complement strains) as compared to other potential endogenous sources of NO ( nar and disproportionation) in addition to i nteraction s between neutrophil s and wild type UAMS 1, nos mutant and complement biofilms have yet to be tested (Figure 4 1)

PAGE 64

64 Figure 4 1. A potential model for the role of S. aureus nos gene in biofilm development.

PAGE 65

65 CHAPTER 5 CONCLUSIONS Nitric oxide is an important signaling molecule in eukaryotes, prokaryotes and archaea. While the role of nitric oxide synthases in eukaryotes and some bacteria is known, there are still numerous bacteria where the specific role of their nitric oxide synt hase has yet to be elucidated. The work present ed in this thesis has elaborated on a possible role for this enzyme in the pernicious human pathogen S. aureus one of the leading causes of bacterial infection worldwide. Under planktonic conditions the no s gene has a role in dealing with oxidative stress. It is up regulated under hydrogen peroxide stress and it is also up regulated in the later phases of growth when there is increased cell population potentially due to metabolic changes or increased cell density, suggesting a possible additional role for nos in cell signaling There is also a correlation between nos down regulation and pigment production, suggesting it s tress es the c ells and forces them to compensate by producing more of the antioxidant carotenoids Alternatively, nos is involved in the regulation of carotenoid pigment production, potentially either acting directly on the enzyme or indirectly via cell signaling It s expression is also up regulated under TSA growth condition which may re late to a role in biofilm formation given that cells are When the role of nos under static biofilm growth conditions was examined, there was a subtle but very reproducible difference in biofilm structure. The nos mutant biofilm was a more attached biofilm, but possibly with less potential for interacting with environmental signals and/or acquisition of nutrients due to a decreased biofilm to surface area ratio [113] This phenotype suggests a potential role for nitric oxide

PAGE 66

66 produced by SaNOS in regulating attachment and other unknown events during the early phases of biofilm development This nitric oxide production could be localized to certain populations of cells within the biofilm, or induced in response to stress caused by the immune system such as from the respiratory burst of immune cells While the exact target s of SaNOS are not yet known, these results, pending animal model testing, suggest a method for whi ch the already virulent S. aureus may be able to avoid immune system destruction and increase infection persistence within the host.

PAGE 67

67 APPENDIX A SAMPLE CALCULATION D ETERMINING QRT PCR EXPRESSION OF NOS Table A 1. One set of qRT PCR numbers being used to calculate the expression by the 2 CT method (Livak method). Sample C T nos (Target) C T 70 (Reference) UAMS 1 t=2 (calibrator) 20.94 20.59 UAMS 1 t=6 low oxygen (test) 18.54 20.87 Figure A 1. Sample calculation for the expression levels of nos in comparison to 70 using the 2 CT method (Livak method). For this calculation, the 70 is the reference gene and UAMS 1 t=2 expression is considered the calibrator. C T(UAMS 1 t=2) =20.94 20.59=0.35 C T(UAMS 1 t=6) =18.59 20.87= 2.33 C T = C T(UAMS 1 t=6) C T(UAMS 1 t=2) = 2.33 0.35= 2.68 2 CT =2 ( 2.68) =6.41 In this example, UAMS 1 at t=6 hours is expressing nos at a 6.41 fold higher level than UAMS 1 at t=2 hours. For all values presented in Figure 3 4 (Part A) and Figure 3 7, UAMS 1 t=2 was always used as the calibrator. For all values presented in Figure 3 4 (Part B), UAMS 1 untreated was always used as the calibrator.

PAGE 68

68 LIST OF REFERENCES 1. Wilkinson B (1997) The staphylococci in human disease; Crossley KB AG, editor. New York: Churchill Livingstone. 37 p. 2. Schaberg DR, Zervos MJ (1986) Intergeneric and interspecies gene exchange in gram positive cocci. Antimicrob Agents Chemothe r 30: 817 822. 3. Novick R (1990) Molecular biology of the staphylococci; RP N, editor. New York: VCH. 37 p. 4. Fuchs S, Pane Farre J, Kohler C, Hecker M, Engelmann S (2007) Anaerobic gene expression in Staphylococcus aureus. J Bacteriol 189: 4275 4289. 5. Liu GY, Essex A, Buchanan JT, Datta V, Hoffman HM, et al. (2005) Staphylococcus aureus golden pigment impairs neutrophil killing and promotes virulence through its antioxidant activity. J Exp Med 202: 209 215. 6. Deleo FR, Otto M, Kreiswir th BN, Chambers HF (2010) Community associated meticillin resistant Staphylococcus aureus. Lancet 375: 1557 1568. 7. Lowy FD (2003) Antimicrobial resistance: the example of Staphylococcus aureus. J Clin Invest 111: 1265 1273. 8. Gordon RJ, Lowy FD (2008) Pathogenesis of methicillin resistant Staphylococcus aureus infection. Clin Infect Dis 46 Suppl 5: S350 359. 9. Meziane Cherif D, Saul FA, Moubareck C, Weber P, Haouz A, et al. (2010) Molecular basis of vancomycin dependence in VanA type Staphyl ococcus aureus VRSA 9. J Bacteriol. 10. Cheung AL, Bayer AS, Zhang G, Gresham H, Xiong YQ (2004) Regulation of virulence determinants in vitro and in vivo in Staphylococcus aureus. FEMS Immunol Med Microbiol 40: 1 9. 11. Vuong C, Saenz HL, Gotz F, Otto M (2000) Impact of the agr quorum sensing system on adherence to polystyrene in Staphylococcus aureus. J Infect Dis 182: 1688 1693. 12. Kong KF, Vuong C, Otto M (2006) Staphylococcus quorum sensing in biofilm formation and infection. Int J Med Microbiol 296: 133 139. 13. Zhang L, Gray L, Novick RP, Ji G (2002) Transmembrane topology of AgrB, the protein involved in the post translational modification of AgrD in Staphylococcus aureus. J Biol Chem 277: 34736 34742.

PAGE 69

69 14. Yarwood JM, Bartels DJ, Volper EM Greenberg EP (2004) Quorum sensing in Staphylococcus aureus biofilms. J Bacteriol 186: 1838 1850. 15. Barraud N, Schleheck D, Klebensberger J, Webb JS, Hassett DJ, et al. (2009) Nitric oxide signaling in Pseudomonas aeruginosa biofilms mediates phospho diesterase activity, decreased cyclic di GMP levels, and enhanced dispersal. J Bacteriol 191: 7333 7342. 16. Kumar CG, Anand SK (1998) Significance of microbial biofilms in food industry: a review. Int J Food Microbiol 42: 9 27. 17. Yang J, Bos R, Beld er GF, Engel J, Busscher HJ (1999) Deposition of Oral Bacteria and Polystyrene Particles to Quartz and Dental Enamel in a Parallel Plate and Stagnation Point Flow Chamber. J Colloid Interface Sci 220: 410 418. 18. Rijnaarts HH, Norde W, Bouwer EJ, Lyklem a J, Zehnder AJ (1993) Bacterial Adhesion under Static and Dynamic Conditions. Appl Environ Microbiol 59: 3255 3265. 19. Hood SK, Zottola EA (1997) Adherence to stainless steel by foodborne microorganisms during growth in model food systems. Int J Food M icrobiol 37: 145 153. 20. Whitehead KA, Rogers D, Colligon J, Wright C, Verran J (2006) Use of the atomic force microscope to determine the effect of substratum surface topography on the ease of bacterial removal. Colloids Surf B Biointerfaces 51: 44 53. 21. Palmer J, Flint S, Brooks J (2007) Bacterial cell attachment, the beginning of a biofilm. J Ind Microbiol Biotechnol 34: 577 588. 22. Boles BR, Horswill AR (2008) Agr mediated dispersal of Staphylococcus aureus biofilms. PLoS Pathog 4: e1000052. 2 3. Otto M (2008) Staphylococcal biofilms. Curr Top Microbiol Immunol 322: 207 228. 24. Rice KC, Mann EE, Endres JL, Weiss EC, Cassat JE, et al. (2007) The cidA murein hydrolase regulator contributes to DNA release and biofilm development in Staphylococ cus aureus. Proc Natl Acad Sci U S A 104: 8113 8118. 25. Mann EE, Rice KC, Boles BR, Endres JL, Ranjit D, et al. (2009) Modulation of eDNA release and degradation affects Staphylococcus aureus biofilm maturation. PLoS One 4: e5822. 26. Patti JM, Allen BL, McGavin MJ, Hook M (1994) MSCRAMM mediated adherence of microorganisms to host tissues. Annu Rev Microbiol 48: 585 617.

PAGE 70

70 27. O'Neill E, Pozzi C, Houston P, Humphreys H, Robinson DA, et al. (2008) A novel Staphylococcus aureus biofilm phenotype mediate d by the fibronectin binding proteins, FnBPA and FnBPB. J Bacteriol 190: 3835 3850. 28. Ulrich M, Bastian M, Cramton SE, Ziegler K, Pragman AA, et al. (2007) The staphylococcal respiratory response regulator SrrAB induces ica gene transcription and polys accharide intercellular adhesin expression, protecting Staphylococcus aureus from neutrophil killing under anaerobic growth conditions. Mol Microbiol 65: 1276 1287. 29. Kogan G, Sadovskaya I, Chaignon P, Chokr A, Jabbouri S (2006) Biofilms of clinical st rains of Staphylococcus that do not contain polysaccharide intercellular adhesin. FEMS Microbiol Lett 255: 11 16. 30. Izano EA, Amarante MA, Kher WB, Kaplan JB (2008) Differential roles of poly N acetylglucosamine surface polysaccharide and extracellular DNA in Staphylococcus aureus and Staphylococcus epidermidis biofilms. Appl Environ Microbiol 74: 470 476. 31. Chaignon P, Sadovskaya I, Ragunah C, Ramasubbu N, Kaplan JB, et al. (2007) Susceptibility of staphylococcal biofilms to enzymatic treatments de pends on their chemical composition. Appl Microbiol Biotechnol 75: 125 132. 32. Lauderdale KJ, Malone CL, Boles BR, Morcuende J, Horswill AR (2010) Biofilm dispersal of community associated methicillin resistant Staphylococcus aureus on orthopedic implan t material. J Orthop Res 28: 55 61. 33. Novick RP, Ross HF, Projan SJ, Kornblum J, Kreiswirth B, et al. (1993) Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule. EMBO J 12: 3967 3975. 34. Traber KE, Lee E, Benson S, Corrigan R, Cantera M, et al. (2008) agr function in clinical Staphylococcus aureus isolates. Microbiology 154: 2265 2274. 35. Geisinger E, Muir TW, Novick RP (2009) agr receptor mutants reveal distinct modes of inhibition by staphylococcal autoinducing peptides. Proc Natl Acad Sci U S A 106: 1216 1221. 36. Yarwood JM, Paquette KM, Tikh IB, Volper EM, Greenberg EP (2007) Generation of virulence factor variants in Staphylococcus aureus biofilms. J Bacteriol 189: 7961 7967. 37. Laarman A, M ilder F, van Strijp J, Rooijakkers S (2010) Complement inhibition by gram positive pathogens: molecular mechanisms and therapeutic implications. J Mol Med 88: 115 120.

PAGE 71

71 38. Voyich JM, Braughton KR, Sturdevant DE, Whitney AR, Said Salim B, et al. (2005) Insights into mechanisms used by Staphylococcus aureus to avoid destruction by human neutrophils. J Immunol 175: 3907 3919. 39. del Pozo JL, Patel R (2007) The challenge of treating biofilm associated bacterial infections. Clin Pharmacol Ther 82: 204 209 40. Bokarewa MI, Jin T, Tarkowski A (2006) Staphylococcus aureus: Staphylokinase. Int J Biochem Cell Biol 38: 504 509. 41. Foster TJ (2005) Immune evasion by staphylococci. Nat Rev Microbiol 3: 948 958. 42. Cunnion KM, Hair PS, Buescher ES (2004) C leavage of complement C3b to iC3b on the surface of Staphylococcus aureus is mediated by serum complement factor I. Infect Immun 72: 2858 2863. 43. Cunnion KM, Buescher ES, Hair PS (2005) Serum complement factor I decreases Staphylococcus aureus phagocyt osis. J Lab Clin Med 146: 279 286. 44. Clements MO, Watson SP, Foster SJ (1999) Characterization of the major superoxide dismutase of Staphylococcus aureus and its role in starvation survival, stress resistance, and pathogenicity. J Bacteriol 181: 3898 3 903. 45. Das D, Bishayi B (2009) Staphylococcal catalase protects intracellularly survived bacteria by destroying H2O2 produced by the murine peritoneal macrophages. Microb Pathog 47: 57 67. 46. Amin VM, Olson NF (1968) Influence of catalase activity o n resistance of coagulase positive staphylococci to hydrogen peroxide. Appl Microbiol 16: 267 270. 47. Nizet V (2007) Understanding how leading bacterial pathogens subvert innate immunity to reveal novel therapeutic targets. J Allergy Clin Immunol 120: 1 3 22. 48. Otto M (2006) Bacterial evasion of antimicrobial peptides by biofilm formation. Curr Top Microbiol Immunol 306: 251 258. 49. Mittal R, Aggarwal S, Sharma S, Chhibber S, Harjai K (2009) Contribution of macrophage secretory products to urovirul ence of Pseudomonas aeruginosa. FEMS Immunol Med Microbiol 57: 156 164. 50. Jesaitis AJ, Franklin MJ, Berglund D, Sasaki M, Lord CI, et al. (2003) Compromised host defense on Pseudomonas aeruginosa biofilms: characterization of neutrophil and biofilm int eractions. J Immunol 171: 4329 4339.

PAGE 72

72 51. Crane BR, Sudhamsu J, Patel BA (2010) Bacterial nitric oxide synthases. Annu Rev Biochem 79: 445 470. 52. Bryan NS, Bian K, Murad F (2009) Discovery of the nitric oxide signaling pathway and targets for drug dev elopment. Front Biosci 14: 1 18. 53. Broillet MC (1999) S nitrosylation of proteins. Cell Mol Life Sci 55: 1036 1042. 54. Ischiropoulos H (2009) Protein tyrosine nitration -an update. Arch Biochem Biophys 484: 117 121. 55. Sessa WC (1994) The nitric oxide synthase family of proteins. J Vasc Res 31: 131 143. 56. Raman CS, Li H, Martasek P, Kral V, Masters BS, et al. (1998) Crystal structure of constitutive endothelial nitric oxide synthase: a paradigm for pterin function involving a novel metal center. Cell 95: 939 950. 57. Fischmann TO, Hruza A, Niu XD, Fossetta JD, Lunn CA, et al. (1999) Structural characterization of nitric oxide synthase isoforms reveals striking active site conservation. Nat Struct Biol 6: 233 242. 58. Bredt DS, Snyder S H (1992) Nitric oxide, a novel neuronal messenger. Neuron 8: 3 11. 59. Johnson EG, Sparks JP, Dzikovski B, Crane BR, Gibson DM, et al. (2008) Plant pathogenic Streptomyces species produce nitric oxide synthase derived nitric oxide in response to host sig nals. Chem Biol 15: 43 50. 60. Spiro S (2008) Metalloregulatory proteins and nitric oxide signalling in bacteria. Biochem Soc Trans 36: 1160 1164. 61. Kimura H, Mittal CK, Murad F (1975) Activation of guanylate cyclase from rat liver and other tissues by sodium azide. J Biol Chem 250: 8016 8022. 62. Kimura H, Murad F (1975) Two forms of guanylate cyclase in mammalian tissues and possible mechanisms for their regulation. Metabolism 24: 439 445. 63. Koesling D, Friebe A (1999) Soluble guanylyl cyclase: structure and regulation. Rev Physiol Biochem Pharmacol 135: 41 65. 64. Richardson AR, Dunman PM, Fang FC (2006) The nitrosative stress response of Staphylococcus aureus is required for resistance to innate immunity. Mol Microbiol 61: 927 939.

PAGE 73

73 6 5. Ye RW, Tao W, Bedzyk L, Young T, Chen M, et al. (2000) Global gene expression profiles of Bacillus subtilis grown under anaerobic conditions. J Bacteriol 182: 4458 4465. 66. Nakano MM (2002) Induction of ResDE dependent gene expression in Bacillus s ubtilis in response to nitric oxide and nitrosative stress. J Bacteriol 184: 1783 1787. 67. Spiro S (2007) Regulators of bacterial responses to nitric oxide. FEMS Microbiol Rev 31: 193 211. 68. Beaumont HJ, Lens SI, Reijnders WN, Westerhoff HV, van Spa nning RJ (2004) Expression of nitrite reductase in Nitrosomonas europaea involves NsrR, a novel nitrite sensitive transcription repressor. Mol Microbiol 54: 148 158. 69. Bodenmiller DM, Spiro S (2006) The yjeB (nsrR) gene of Escherichia coli encodes a ni tric oxide sensitive transcriptional regulator. J Bacteriol 188: 874 881. 70. Nakano MM, Geng H, Nakano S, Kobayashi K (2006) The nitric oxide responsive regulator NsrR controls ResDE dependent gene expression. J Bacteriol 188: 5878 5887. 71. Membrillo Hernandez J, Coopamah MD, Channa A, Hughes MN, Poole RK (1998) A novel mechanism for upregulation of the Escherichia coli K 12 hmp (flavohaemoglobin) gene by the 'NO releaser', S nitrosoglutathione: nitrosation of homocysteine and modulation of MetR bindi ng to the glyA hmp intergenic region. Mol Microbiol 29: 1101 1112. 72. Schlag S, Nerz C, Birkenstock TA, Altenberend F, Gotz F (2007) Inhibition of staphylococcal biofilm formation by nitrite. J Bacteriol 189: 7911 7919. 73. Barraud N, Hassett DJ, Hwan g SH, Rice SA, Kjelleberg S, et al. (2006) Involvement of nitric oxide in biofilm dispersal of Pseudomonas aeruginosa. J Bacteriol 188: 7344 7353. 74. Falsetta ML, McEwan AG, Jennings MP, Apicella MA (2010) Anaerobic metabolism occurs in the substratum o f gonococcal biofilms and may be sustained in part by nitric oxide. Infect Immun 78: 2320 2328. 75. Sudhamsu J, Crane BR (2009) Bacterial nitric oxide synthases: what are they good for? Trends Microbiol 17: 212 218. 76. Marletta MA (1993) Nitric oxide synthase structure and mechanism. J Biol Chem 268: 12231 12234.

PAGE 74

74 77. Marletta MA, Hurshman AR, Rusche KM (1998) Catalysis by nitric oxide synthase. Curr Opin Chem Biol 2: 656 663. 78. Stuehr DJ, Santolini J, Wang ZQ, Wei CC, Adak S (2004) Update on mechanism and catalytic regulation in the NO synthases. J Biol Chem 279: 36167 36170. 79. Griffith OW, Stuehr DJ (1995) Nitric oxide synthases: properties and catalytic mechanism. Annu Rev Physiol 57: 707 736. 80. Crane BR, Arvai AS, Gachhui R, Wu C, G hosh DK, et al. (1997) The structure of nitric oxide synthase oxygenase domain and inhibitor complexes. Science 278: 425 431. 81. Crane BR, Arvai AS, Ghosh DK, Wu C, Getzoff ED, et al. (1998) Structure of nitric oxide synthase oxygenase dimer with pterin and substrate. Science 279: 2121 2126. 82. Wang ZQ, Wei CC, Sharma M, Pant K, Crane BR, et al. (2004) A conserved Val to Ile switch near the heme pocket of animal and bacterial nitric oxide synthases helps determine their distinct catalytic profiles. J Biol Chem 279: 19018 19025. 83. Sono M, Roach MP, Coulter ED, Dawson JH (1996) Heme Containing Oxygenases. Chem Rev 96: 2841 2888. 84. Pant K, Bilwes AM, Adak S, Stuehr DJ, Crane BR (2002) Structure of a nitric oxide synthase heme protein from Bacillus subtilis. Biochemistry 41: 11071 11079. 85. Alderton WK, Cooper CE, Knowles RG (2001) Nitric oxide synthases: structure, function and inhibition. Biochem J 357: 593 615. 86. Hendriks J, Oubrie A, Castresana J, Urbani A, Gemeinhardt S, et al. (2000) Ni tric oxide reductases in bacteria. Biochim Biophys Acta 1459: 266 273. 87. Gusarov I, Starodubtseva M, Wang ZQ, McQuade L, Lippard SJ, et al. (2008) Bacterial nitric oxide synthases operate without a dedicated redox partner. J Biol Chem 283: 13140 13147. 88. Buddha MR, Keery KM, Crane BR (2004) An unusual tryptophanyl tRNA synthetase interacts with nitric oxide synthase in Deinococcus radiodurans. Proc Natl Acad Sci U S A 101: 15881 15886. 89. Adak S, Bilwes AM, Panda K, Hosfield D, Aulak KS, et al. (2002) Cloning, expression, and characterization of a nitric oxide synthase protein from Deinococcus radiodurans. Proc Natl Acad Sci U S A 99: 107 112.

PAGE 75

75 90. Reece SY, Woodward JJ, Marletta MA (2009) Synthesis of nitric oxide by the NOS like protein from d einococcus radiodurans: a direct role for tetrahydrofolate. Biochemistry 48: 5483 5491. 91. Patel BA, Moreau M, Widom J, Chen H, Yin L, et al. (2009) Endogenous nitric oxide regulates the recovery of the radiation resistant bacterium Deinococcus radiodur ans from exposure to UV light. Proc Natl Acad Sci U S A 106: 18183 18188. 92. Kers JA, Wach MJ, Krasnoff SB, Widom J, Cameron KD, et al. (2004) Nitration of a peptide phytotoxin by bacterial nitric oxide synthase. Nature 429: 79 82. 93. Hogenhout SA, L oria R (2008) Virulence mechanisms of Gram positive plant pathogenic bacteria. Curr Opin Plant Biol 11: 449 456. 94. Gusarov I, Shatalin K, Starodubtseva M, Nudler E (2009) Endogenous nitric oxide protects bacteria against a wide spectrum of antibiotics. Science 325: 1380 1384. 95. Adak S, Aulak KS, Stuehr DJ (2002) Direct evidence for nitric oxide production by a nitric oxide synthase like protein from Bacillus subtilis. J Biol Chem 277: 16167 16171. 96. Gusarov I, Nudler E (2005) NO mediated cytoprotection: instant adaptation to oxidative stress in bacteria. Proc Natl Acad Sci U S A 102: 13855 13860. 97. Bird LE, Ren J, Zhang J, Foxwell N, Hawkins AR, et al. (2002) Crystal structure of SANOS, a bacterial nitric oxide synthase oxygenase prote in from Staphylococcus aureus. Structure 10: 1687 1696. 98. Chartier FJ, Couture M (2007) Substrate specific interactions with the heme bound oxygen molecule of nitric oxide synthase. J Biol Chem 282: 20877 20886. 99. Salard I, Mercey E, Rekka E, Bouch er JL, Nioche P, et al. (2006) Analogies and surprising differences between recombinant nitric oxide synthase like proteins from Staphylococcus aureus and Bacillus anthracis in their interactions with l arginine analogs and iron ligands. J Inorg Biochem 10 0: 2024 2033. 100. Lowy FD (1998) Staphylococcus aureus infections. N Engl J Med 339: 520 532. 101. Arvand M, Bhakdi S, Dahlback B, Preissner KT (1990) Staphylococcus aureus alpha toxin attack on human platelets promotes assembly of the prothrombinase comp lex. J Biol Chem 265: 14377 14381. 102. Marrack P, Kappler J (1990) The staphylococcal enterotoxins and their relatives. Science 248: 1066.

PAGE 76

76 103. Travis J, Potempa J, Maeda H (1995) Are bacterial proteinases pathogenic factors? Trends Microbiol 3: 405 407. 104. Gotz F, Verheij HM, Rosenstein R (1998) Staphylococcal lipases: molecular characterisation, secretion, and processing. Chem Phys Lipids 93: 15 25. 105. Holden MT, Feil EJ, Lindsay JA, Peacock SJ, Day NP, et al. (2004) Complete genomes of two clinical Staphylococcus aureus strains: evidence for the rapid evolution of virulence and drug resistance. Proc Natl Acad Sci U S A 101: 9786 9791. 106. Clewell DB, Flannagan SE, Jaworski DD (1995) Unconstrained bacterial promiscuity: the Tn916 Tn1545 family of con jugative transposons. Trends Microbiol 3: 229 236. 107. Groicher KH, Firek BA, Fujimoto DF, Bayles KW (2000) The Staphylococcus aureus lrgAB operon modulates murein hydrolase activity and penicillin tolerance. J Bacteriol 182: 1794 1801. 108. Shafer WM, Ia ndolo JJ (1979) Genetics of staphylococcal enterotoxin B in methicillin resistant isolates of Staphylococcus aureus. Infect Immun 25: 902 911. 109. Schenk S, Laddaga RA (1992) Improved method for electroporation of Staphylococcus aureus. FEMS Microbiol Let t 73: 133 138. 110. Inoue H, Nojima H, Okayama H (1990) High efficiency transformation of Escherichia coli with plasmids. Gene 96: 23 28. 111. Brown T (2001) Southern blotting. Curr Protoc Protein Sci Appendix 4: Appendix 4G. 112. Morikawa K, Maruyama A, I nose Y, Higashide M, Hayashi H, et al. (2001) Overexpression of sigma factor, sigma(B), urges Staphylococcus aureus to thicken the cell wall and to resist beta lactams. Biochem Biophys Res Commun 288: 385 389. 113. Heydorn A, Nielsen AT, Hentzer M, Sternbe rg C, Givskov M, et al. (2000) Quantification of biofilm structures by the novel computer program COMSTAT. Microbiology 146 ( Pt 10): 2395 2407. 114. Yang SJ, Rice KC, Brown RJ, Patton TG, Liou LE, et al. (2005) A LysR type regulator, CidR, is required for induction of the Staphylococcus aureus cidABC operon. J Bacteriol 187: 5893 5900.

PAGE 77

77 115. Patton TG, Rice KC, Foster MK, Bayles KW (2005) The Staphylococcus aureus cidC gene encodes a pyruvate oxidase that affects acetate metabolism and cell death in station ary phase. Mol Microbiol 56: 1664 1674. 116. Chang W, Small DA, Toghrol F, Bentley WE (2006) Global transcriptome analysis of Staphylococcus aureus response to hydrogen peroxide. J Bacteriol 188: 1648 1659. 117. Gruber TM, Gross CA (2003) Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol 57: 441 466. 118. Kapanidis AN, Margeat E, Laurence TA, Doose S, Ho SO, et al. (2005) Retention of transcription initiation factor sigma70 in transcription elongation: singl e molecule analysis. Mol Cell 20: 347 356. 119. Logan J, Edwards K, Saunders N, editors (2009) Real time PCR: Current Technology and Applications. Norfolk, UK: Caister Academic Press. 120. (2006) Real Time PCR Applications Guide. In: Bio Rad Laboratories I editor. 121. Bae T, Banger AK, Wallace A, Glass EM, Aslund F, et al. (2004) Staphylococcus aureus virulence genes identified by bursa aurealis mutagenesis and nematode killing. Proc Natl Acad Sci U S A 101: 12312 12317. 122. Miller WG, Lindow SE (1997) A n improved GFP cloning cassette designed for prokaryotic transcriptional fusions. Gene 191: 149 153. 123. Hanahan D (1983) Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166: 557 580. 124. Kreiswirth BN, Lofdahl S, Betley MJ, O'Rei lly M, Schlievert PM, et al. (1983) The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305: 709 712. 125. Gillaspy AF, Hickmon SG, Skinner RA, Thomas JR, Nelson CL, et al. (1995) Role of the accessory gene regulator (agr) in pathogenesis of staphylococcal osteomyelitis. Infect Immun 63: 3373 3380. 126. Duthie ES, Lorenz LL (1952) Staphylococcal coagulase; mode of action and antigenicity. J Gen Microbiol 6: 95 107. 127. Dyke KG, Jevons MP, Parker MT (1966) P enicillinase production and intrinsic resistance to penicillins in Staphylococcus aures. Lancet 1: 835 838.

PAGE 78

78 128. Charpentier E, Anton AI, Barry P, Alfonso B, Fang Y, et al. (2004) Novel cassette based shuttle vector system for gram positive bacteria. Appl Environ Microbiol 70: 6076 6085. 129. Bruckner R (1997) Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus. FEMS Microbiol Lett 151: 1 8. 130. Lan L, Cheng A, Dunman PM, Missiakas D, He C (2010) Golden pigment production and virulence gene expression are affected by metabolisms in Staphylococcus aureus. J Bacteriol 192: 3068 3077. 131. Zhang S, Pohnert G, Kongsaeree P, Wilson DB, Clardy J, et al. (1998) Chorismate mutase prephenate dehydratase from Escherichia coli. Study of catalytic a nd regulatory domains using genetically engineered proteins. J Biol Chem 273: 6248 6253. 132. Perera A, Parkes HG, Herz H, Haycock P, Blake DR, et al. (1997) High resolution 1H NMR investigations of the reactivities of alpha keto acid anions with hydrogen peroxide. Free Radic Res 26: 145 157. 133. Zhang Y, Morar M, Ealick SE (2008) Structural biology of the purine biosynthetic pathway. Cell Mol Life Sci 65: 3699 3724. 134. Henard CA, Bourret TJ, Song M, Vazquez Torres A (2010) Control of redox balance by th e stringent response regulatory protein promotes antioxidant defenses of Salmonella. J Biol Chem.

PAGE 79

79 BIOGRAPHICAL SKETCH Erin Ahmo Almand is a Waterford, Connecticut native who graduated from Waterford High School in 2005. Upon graduation she attend ed the United States Air Force Academy where she grad uated in 2009 with a Bachelor of Science in b iology and received a commission as a Second Lieutenant in the United States Air Force. After commissioning she was picked for a scholarship to pursue a Master of Science degree by the Air Force Institute of Technology. She attended the University of Florida and in December 2010 graduat ed with a Master of Science in m icrobiology. After graduation Erin was sent to Eglin A ir F orce B ase in Fort Walton Beach, Florida where she currently resides with her husband, Austin Almand.