<%BANNER%>

The Effect of Epigallocatechin-Gallate on Adiponectin Expression and the Insulin Signaling Pathway

Permanent Link: http://ufdc.ufl.edu/UFE0042647/00001

Material Information

Title: The Effect of Epigallocatechin-Gallate on Adiponectin Expression and the Insulin Signaling Pathway
Physical Description: 1 online resource (64 p.)
Language: english
Creator: MONTERO,CINDY
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: Food Science and Human Nutrition -- Dissertations, Academic -- UF
Genre: Food Science and Human Nutrition thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Adiponectin, a hormone secreted from adipocytes, in low circulating levels has been epidemiologically associated with obesity, insulin resistance, type 2 diabetes, and cardiovascular disease; it is also thought to be the link between adipose tissue and insulin sensitivity. In 3T3-L1 adipocytes, insulin has been shown to increase adiponectin release and accumulation. Tea has been consumed by humans for thousands of years and is currently a worldwide consumed beverage, coming in second to water. Green tea constitutes of 20% of the amount of tea produced. It is rich in polyphenols, principally flavanols, which include catechins. Green tea?s most abundant catechin, (-)-Epigallocatechin-3-gallate (EGCG), accounts for 30-50% of catechins and has been shown to have an effect on factors such as the prevention of metabolic syndrome, inflammation, weight loss, fat oxidation, and glucose control. Recent studies have suggested EGCG anti-diabetic effects could be through the increase of adiponectin accumulation and release. In order to understand a possible underlying mechanism in adipocytes, we investigated the effect EGCG had on adiponectin expression in 3T3-L1 adipocytes. We hypothesized EGCG would increase intracellular and extracellular protein expression of adiponectin through enhanced insulin stimulation and phosphorylation of insulin signaling proteins. Adiponectin protein secretion was measured by enzyme-linked immunosorbent assay (ELISA). EGCG significantly increased adiponectin protein secretion when compared to control in 3T3-L1 adipocytes. Adiponectin intracellular protein expression was also significantly increased in EGCG treated cells, measured by western blot analysis. We performed qRT-PCR in order to measure adiponectin mRNA expression and also found a significant increase in the mRNA levels of EGCG treated cells. In a previous study hepatoma cells treated with EGCG showed an increase in the tyrosine phosphorylation of the insulin receptor, the insulin receptor substrate-1, and Phosphatidylinositol 3- kinase (PI3K), suggesting EGCG mimics insulin when incubated in hepatoma cells, lowering hepatic glucose production. We investigated whether the same mechanism is involved in 3T3-L1 adipocytes treatment with EGCG; therefore increasing adiponectin protein expression through the insulin signaling pathway. We measured the tyrosine phosphorylation of Insulin Receptor (IR) and found no significant changes in EGCG treated adipocytes. These results suggest that EGCG anti-diabetic role and improved glucose control effects could be through the increased accumulation and secretion of adiponectin from adipocytes. EGCG does not enhance insulin stimulation of insulin receptor phosphorylation, suggesting its mode of action might not work through the insulin signaling pathway. However, the increase in messenger RNA (mRNA) expression of EGCG treated cells could suggest EGCG is enhancing adiponectin secretion through an increase of unknown transcription factors or enhanced mRNA stability.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by CINDY MONTERO.
Thesis: Thesis (M.S.)--University of Florida, 2011.
Local: Adviser: Percival, Susan S.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-10-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0042647:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042647/00001

Material Information

Title: The Effect of Epigallocatechin-Gallate on Adiponectin Expression and the Insulin Signaling Pathway
Physical Description: 1 online resource (64 p.)
Language: english
Creator: MONTERO,CINDY
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2011

Subjects

Subjects / Keywords: Food Science and Human Nutrition -- Dissertations, Academic -- UF
Genre: Food Science and Human Nutrition thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Adiponectin, a hormone secreted from adipocytes, in low circulating levels has been epidemiologically associated with obesity, insulin resistance, type 2 diabetes, and cardiovascular disease; it is also thought to be the link between adipose tissue and insulin sensitivity. In 3T3-L1 adipocytes, insulin has been shown to increase adiponectin release and accumulation. Tea has been consumed by humans for thousands of years and is currently a worldwide consumed beverage, coming in second to water. Green tea constitutes of 20% of the amount of tea produced. It is rich in polyphenols, principally flavanols, which include catechins. Green tea?s most abundant catechin, (-)-Epigallocatechin-3-gallate (EGCG), accounts for 30-50% of catechins and has been shown to have an effect on factors such as the prevention of metabolic syndrome, inflammation, weight loss, fat oxidation, and glucose control. Recent studies have suggested EGCG anti-diabetic effects could be through the increase of adiponectin accumulation and release. In order to understand a possible underlying mechanism in adipocytes, we investigated the effect EGCG had on adiponectin expression in 3T3-L1 adipocytes. We hypothesized EGCG would increase intracellular and extracellular protein expression of adiponectin through enhanced insulin stimulation and phosphorylation of insulin signaling proteins. Adiponectin protein secretion was measured by enzyme-linked immunosorbent assay (ELISA). EGCG significantly increased adiponectin protein secretion when compared to control in 3T3-L1 adipocytes. Adiponectin intracellular protein expression was also significantly increased in EGCG treated cells, measured by western blot analysis. We performed qRT-PCR in order to measure adiponectin mRNA expression and also found a significant increase in the mRNA levels of EGCG treated cells. In a previous study hepatoma cells treated with EGCG showed an increase in the tyrosine phosphorylation of the insulin receptor, the insulin receptor substrate-1, and Phosphatidylinositol 3- kinase (PI3K), suggesting EGCG mimics insulin when incubated in hepatoma cells, lowering hepatic glucose production. We investigated whether the same mechanism is involved in 3T3-L1 adipocytes treatment with EGCG; therefore increasing adiponectin protein expression through the insulin signaling pathway. We measured the tyrosine phosphorylation of Insulin Receptor (IR) and found no significant changes in EGCG treated adipocytes. These results suggest that EGCG anti-diabetic role and improved glucose control effects could be through the increased accumulation and secretion of adiponectin from adipocytes. EGCG does not enhance insulin stimulation of insulin receptor phosphorylation, suggesting its mode of action might not work through the insulin signaling pathway. However, the increase in messenger RNA (mRNA) expression of EGCG treated cells could suggest EGCG is enhancing adiponectin secretion through an increase of unknown transcription factors or enhanced mRNA stability.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by CINDY MONTERO.
Thesis: Thesis (M.S.)--University of Florida, 2011.
Local: Adviser: Percival, Susan S.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-10-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2011
System ID: UFE0042647:00001


This item has the following downloads:


Full Text

PAGE 1

1 THE EFFECT OF EPIGALLOCATECHIN GALLATE ON ADIPONECTIN E XPRESSION AND THE INSULIN SIGNA LING PATHWAY By CINDY MONTERO A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2011

PAGE 2

2 201 1 C indy M ontero

PAGE 3

3 Para m i f amilia

PAGE 4

4 ACKNOWLEDGMENTS I would first like to acknowledge my major advisor Dr. Su san Percival, who believed in me and my work. It is because of her endless support and advice that this project was possible. I would also like to th a nk Dr. Cheryl Rowe and Meri Nantz for helping me find my way around the lab. I would like to thank Dr. Mitchell Knutson for being a great mentor and professor; it is because of your undergrad uate class that you enlightened me to pursue a graduate degree thank you. I would also like to thank Dr. Susan Frost for her collaboration in providing me with t he resources and knowledge to get this project started. I am also grateful for my lab members (Catherine Muller and Rebecca Creasy) and for Dr.Knutson lab members ( Hyeyoung Nam, Ning n ing Zhao, Chia Yu Wang and Supak Jenkitkasemwong ) for always offering their assistance, support, and knowledge. Lastly, I would like to thank my family and friends for all their love and support.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 LIST OF ABBREVIATIONS ................................ ................................ ............................. 9 ABSTRACT ................................ ................................ ................................ ................... 12 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 14 2 LITE RATURE REVIEW ................................ ................................ .......................... 16 Type 2 Diabetes ................................ ................................ ................................ ...... 16 Adiponectin ................................ ................................ ................................ ............. 17 Proposed Functions of Adiponectin ................................ ................................ .. 19 Regulation of Adiponectin ................................ ................................ ................. 21 Adiponectin Receptors ................................ ................................ ..................... 23 Adiponectin and Insulin Resistance ................................ ................................ .. 23 Epigallocatechin gallate ................................ ................................ .......................... 25 Introduction to Polyphenols ................................ ................................ .............. 26 Epigallocatechin gallate Health Benefits ................................ .......................... 27 Epigallocatechin gallate and Insulin Resistance ................................ ............... 29 Adiponectin and Epigallocatechin gallate ................................ ............................... 31 Specific Aims ................................ ................................ ................................ .......... 32 3 MATERIALS AND METHODS ................................ ................................ ................ 34 Study Design for Specific Aims I and II ................................ ................................ ... 34 Cell Culture and Treatments ................................ ................................ ................... 34 Cellular Secretion of Adiponectin Measured by ELISA ................................ ........... 35 Sample Preparation for Western Blot Analysis ................................ ....................... 36 Adiponectin Sample ................................ ................................ ......................... 36 Insulin Receptor and Phosphorylation of Insulin Receptor Sample .................. 36 Western Blotting ................................ ................................ ................................ ..... 37 Adiponectin Analysis ................................ ................................ ........................ 37 Insulin Receptor and Phosphorylation of Insulin Receptor ............................... 38 Adiponectin Gene Expression by Quantitative RT PCR Analysis ........................... 39 Oil Red O Staining ................................ ................................ ................................ .. 39 Statistical Analysis ................................ ................................ ................................ .. 40

PAGE 6

6 4 RESULTS ................................ ................................ ................................ ............... 42 EGCG Stimulates Adiponectin Secretion in 3T3 L1 Adipocytes ............................. 42 EGCG Enhances Adiponectin Protein Expression in 3T3 L1 Adipocytes ............... 43 EGCG Increases Adiponectin mRN A expression in 3T3 L1 Adipocytes ................. 44 EGCG Does Not Stimulate the Insulin Signaling Pathway in 3T3 L1 Adipocytes ... 44 5 DISCUSSION ................................ ................................ ................................ ......... 53 Specific Aim I ................................ ................................ ................................ .......... 53 Specific Aim II ................................ ................................ ................................ ......... 55 LIST OF REFERENCES ................................ ................................ ............................... 57 BIOGRAPHIC AL SKETCH ................................ ................................ ............................ 64

PAGE 7

7 LIST OF TABLES Table page 2 1 Conditions or treatments associated with changes in plasma adiponectin ......... 3 3 3 1 Cell Culture Treatments ................................ ................................ ...................... 41 3 2 Primer sequences chosen for the quantification of gene transcripts ................... 41

PAGE 8

8 LIST OF FIGURES Figure page 2 1 Structure and Nomenclature of ( ) Epigallocatechin gallate ............................. 33 4 1 Oil Red O staining of 3T3 L1 mature adipocytes ................................ ................ 46 4 2 EGCG stimulates adiponectin secretion in 3T3 L1 adipocytes ........................... 47 4 3 Time course on the inducible effect of EGCG on adiponectin secretion in 3T3 L1 adipocytes ................................ ................................ .............................. 48 4 4 EGCG increases intracellular adiponectin expression in 3T3 L1 adipocytes ...... 49 4 5 EGCG increases intracellular adiponectin expression 3T3 L1 adipocytes ......... 50 4 6 EGCG increa ses adiponectin mRNA expression ................................ ................ 51 4 7 EGCG does not stimulate tyrosine phos phorylation of insulin receptor .............. 52

PAGE 9

9 LIST OF ABBREVIATIONS ADIPOR1 Adiponectin receptor 1 ADIPOR2 Adiponectin receptor 2 AMPK Adenosine monophosphate activated protein kinase ANOVA Analysis of variance C (+) catechin COMT Catechol O methylt ransferase DAG Diaclyglycerol DMSO Dimethyl sulfoxide DMEM ELISA Enzyme linked immunosorbent assay EC ( ) Epicatechin ECG ( ) Epicatechin 3 0 gallate EGC ( ) Epigallocatechin EGCG ( ) E pigallocatechin gallate Fatty acyl CoA Fatty ac y l coenzyme FBS Fetal bovine serum FFA Free fatty acids GA Gallic acid GK Glucokinase G6Pase Glucose 6 phosphatase H H our HMW High molecular weight INS Insulin INSA Chronic insulin treatment

PAGE 10

10 INS A 5 Chronic insulin and EGCG treatment IR Insulin Receptor pIR Insulin receptor phosphorylation IRS 1 Insulin receptor substrate 1 pIRS 1 Insulin receptor substrate 1 phosphorylation IL 6 Interleukin 6 IBMX 3 Isobutyl 1 methylxanthine KO Knockout LMW Low molecular weight Microgram Microliter Micromolar MIN Min ute mRNA M essenger RNA MRP2 Multidrug resistance associated protein 2 nM Nanomolar NEFA Non esterified fatty acid NO Nitric Oxide PEPCK Phosphoenolpyruvate carboxykinase PI3K Phosphatidylinositol 3 kinase PPAR Peroxisome proliferator activated receptor PTP Protein t yrosine p hosphatase qRT PCR Quantita tive reverse transcriptase PCR ROS Reactive oxygen species SEM Standard error of measurement

PAGE 11

11 SNP Single nucleotide polymorphism SDS Sodium dodecyl sulfate SULT Phenolsulfotransferases TBS Tris buffered Saline TZD Thiazolidinedione TNF Tumor necrosis factor T2DM Type 2 diabetes mellitus UGT UDP glucuronosyltransferases WT Wild Type

PAGE 12

12 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science THE EFFECT OF EPIGALLOCATECHIN GALLATE ON ADIPONECTIN EXPRESSION AND THE INSULIN SIGNA LING PATHWAY By Cindy Montero May 201 1 Chair: Susan S. Percival Major: Food Science and Human Nutrition Adiponectin a hormone secreted from adipocytes, in low circulating levels has been epidemiologically associated with obesity, insulin resistance, type 2 diabetes and cardiovascular disease; it is also thought to be the link between adipose tissue and insulin sensitivity. In 3T3 L1 adipocytes, insulin has been shown to increase adiponectin release and accumulation Tea has been consumed by humans for thousands of years and is currently a wor ldwide consumed beve rage, coming in second to water. Green tea constitutes of 20% of the amount of tea produced. It is rich in polyphenols, principally fla v a nols, which include catechins. catechin, ( ) Epigallocatechin 3 gallate (EGCG), accounts for 30 50% of catechins and has been shown to have an e ffect on factors such as the prevention of metabolic syndrome, inflammation, weight loss, fat oxidation, and glucose cont rol. Recent studies have suggested EGCG anti diabetic effects could be through the increase of adiponectin accumulation and release. I n order to understand a possible underlying mechanism in adipocytes, we investigated the effect EGCG had on adiponectin expression in 3T3 L1 adipocytes We hypothesized EGCG would i ncrease intracellular and extracellular protein expression of

PAGE 13

13 adiponectin through enhanced insulin stimulation and phosphorylation of insulin signaling proteins Adiponectin protein secretion was measured by enzyme linked immunosorbent assay (ELISA) EGCG significantly increased adiponectin protein secretion when compared to control in 3T3 L1 adipocytes. Adiponectin intracellular protein expression was also significantly increased in EGCG treated cell s measured by western blot analysis. We performed qRT P CR in order to measure adiponectin mRNA expression and also found a significant increase in the mRNA levels of EGCG treated cells. In a previous study hepatoma cells treated with EGCG showed an increase in the tyrosine phosphorylation of the insulin receptor, the insulin receptor substrate 1, and Phosphatidylinositol 3 kinase ( PI3K ) suggesting EGCG mimics insulin when incubated in hepatoma cells, lowering hepatic gl ucose production. We investigate d whether the same mechanism is involved in 3T3 L1 adipocytes treatment with EGCG; therefore increasing adiponectin protein expression through the insulin signaling pathway W e measured the t yrosine phosphorylation of Insul in Receptor (IR) and found no significant change s in EGCG treated adipocytes. These results suggest that EGCG anti diabetic role and improved glucose control effects could be through the increased accumulation and secretion of adiponectin from adipocytes. EGCG does not enhance insulin stimulation of insulin receptor phosphorylation, suggesting its mode of action might not work through the insulin signaling pat hway. However, the increase in messenger RNA ( mRNA ) expression of EGCG treated cells could sugges t EGCG is enhancing adiponectin secretion through an increase of unknown transcription factors or enhanced mRNA stability

PAGE 14

14 CHAPTER 1 INTRODUCTION Obesity has been shown to be the primary cause of metabolic syndrome, which includes several risk factors suc h as clustering of abdominal obesity, dyslipidemia, insulin resistance, elevated blood pressure, and other co morbidities. Metabolic syndrome is associated with a five fold increased risk for type 2 diabetes mellitus (T2DM) (1). Type 2 diabetes has become an epidemic worldwide. In the past decade a huge amount of research has been focused on an insulin sensitizing hormone, adiponectin Adiponectin knockout mice exhibit severe diet induced insulin resistance, and a decrease in insulin receptor substrate 1 ( IRS 1 ) phosphorylation and glucose uptake ( 2 3 ). Adiponectin is a very abundant serum hormone secreted almost exclusively from differentiated adipocytes. It is seen in low circulating levels in obesity and type 2 diabetes ; it is also thought to be the lin k between adipose tissue and insulin sensitivity ( 4 5 ). In 3T3 L1 adipocytes, insulin has been shown to increase adiponectin accumulation and release ( 6 ). Adiponectin exerts autocrine effects in adipocytes by increasing total GLUT 4 gene expression and tr ansporters recruited in response to insulin ( 7 ). Expression of GLUT 4 in adipose tissue is as important as it is in skeletal muscle Mice with selective reduction of GLUT 4 in adipose tissue showed no change in GLUT 4 expression in skeletal muscle but st ill developed insulin resistance in skeletal muscle and liver. ( 8 ). With its many benefits involving glucose homeostasis, increased secretion of adiponectin is important in increasing insulin sensitivity. ) Epigalloca techin 3 gallate (EGCG), has been shown to have the greatest effect when compared to other catechins, on factors

PAGE 15

15 such as the prevention of metabolic syndrome, inflammation, weight loss, fat oxidation, and glucose control ( 9 ). A recent review looked at resu lts from epidemiological, cell culture, animal, and clinical studies done in the last decade, showing proposed mechanisms for the EGCG anti obesity effect and its potential role in the prevention and treatment of type 2 diabetes mellitus ( 10 ). EGCG antidia betic role was shown in animal studies, in which EGCG was injected into lean and obese Zucker rats and significantly lowered blood glucose and insulin levels ( 11 ), and where supplementation of EGCG alleviated diabetes in ZDF rats ( 12 ). In cell culture studies, a green tea extract increased glucose metabolism in adipocytes ( 13 ). Recent research has begun to investigate the effect EGCG has on adiponectin release and accumulation. In a study conducted on obese women taking capsulated 400 mg/d EGCG supplementation for 12 weeks, subjects showed an increase of circulating adiponectin when compared to the placebo group ( 14 ). Dietary supplementation of EGCG elevated circulating levels of adiponectin in Non Obese Type 2 diabetic Goto Kakizaki rats ( 15 ). ( ) Catechin a catechin also found in green tea, has shown an increase in the expres sion and secretion of adiponectin in 3T3 L1 adipocytes ( 16 ). The relationship between EGCG and its dose response on adiponectin release and accumulation needs further investigation, in order to better understand a possible underlying mechanism in adipocyte s. Therefore, the present study analyzed whether EGCG increased adiponectin cellular accumulation and release, and whether or not the underlying mechanism was through the insulin signaling pathway.

PAGE 16

16 CHAPTER 2 LITERATURE REVIEW Type 2 Diabetes T ype 2 Diabete s Mellitus (T2DM) is a rapid growing public health concern all over the world. In 2010, the prevalence of diabetes worldwide was over 284 million people and projected to grow to a total of 439 million individuals by the year 2030. This rising epidemic is also an economic burden reaching $376 billion in 2010 and is predicted to reach $490 billion in 2030 (17). Type 2 diabetes is the non insulin dependent diabetes mellitus, in which the body does not produce or properly use insulin, it accounts for 90 95% of the cases of diabetes. Both genetic and environmental factors, such as obesity and lack of exercise, can play a role in this disease. A major health complication of this metabolic disease is hyperglycemia, which can lead to long term damage, dysfunction, and failure of organs, specifically the eyes, kidneys, nerves, heart, and blood vessels. Chronic stress, depression, and trouble sleeping have been shown to be associated with T2DM, as well as an overall reduction of quality of li fe and life expectancy (18). Diabesity is defined as describing diabetes in the context of obesity (17). Obesity usually constitutes an excess of adipose tissue which has an inf luence on many different processes. Adipose tissue was once considered a lipid storage compartment, today it is considered to be an endocrine organ with unlimited growing ability (19). Adipose tissue secretes adipose tissue specific hormones called adipo kines, which help regulate carbohydrate and lipid metabolism. The balance of these adipokines is perturbed in obesity. The imbalance of these adipokines may increase fatty acids in other cells, possibly impairing insulin signaling and normal cellular func tion (20).

PAGE 17

17 skeletal muscle glucose disposal. In skeletal muscle, insulin resistance has several defective steps throughout the insulin signaling pathway including: decreases in the insulin receptor (IR), insulin receptor substrate 1 tyrosine phosphorylation (pIRS 1), and phosphatidylinositol 3 kinase (PI 3kinase) activation, leading to a decrease in GLUT4 translocation and glucose transport (21). The result of havi ng T2DM is not only an obese, insulin resistant individual, but an underlying mechanism involving pancreatic cells not being able to compensate fully for the decrease in insulin sensitivity. Insulin sensitivity fluctuates throughout a normal life cycle. The most critical factor in insulin sensitivity modulation is the release of Non esterified fatty acids (NEFAs) from adipose tissue, which induces insulin resistance and impairs cell function (23) Lifestyle changes such as increased physical acti vity, weight loss, and changes in diet can enhance insulin sensitivity by decreasing the size of adipocytes, therefore decreasing the amount of NEFAs released (23). Treatment of T2DM can also be achieved with drug therapy which may sometimes be necessary In 2007, drug expenditures for diabetes in the US were $12.7 billion As the cost for drug therapy increases, individuals are searching for more cost effective treatments (77) Researchers are studying the many mechanisms involved in T2DM in order to target specific pathways. A good deal of that research has been focused on the adipokines secreted from adipose tissue, specifically, an insulin sensitizing hormone called adiponectin ( 22 ). Adiponectin Adiponectin is a hormone produced exclusively by adi pocytes (adipokine) ; it is also referred to as ACRP 30, AdipoQ apM1, and GBP28 (24 27). Adiponectin consists

PAGE 18

18 of an amino terminal signal sequence, a variable region, and a collagenous domain. This protein has a molecular weight of 30 kDa in its mo st basic form as a homotrimer. The trimers associate through disulphide bonds within the collagenous domains of each monomer, in order to form higher order structures. These include a low molecular weight (LMW) hexamer of 180 kDa and a high molecular weight (HMW) 16 18 mer of 400 kDa. A growing amount of evidence suggest that the HMW complex is the most Adiponectin was discovered by four independen t labs in 1995 (24 27) Sc h erer et al. (24) discovered the secretory protein in adipocytes, named it Acrp30 and described it as being structurally similar to complement factor C1q In the study, adiponectin mRNA was induced by over 100 fold duri ng adipocyte differentiation, and its secretion was enhanced by the addition of insulin. This was the first study linking an insulin regulatory pathway in adipocytes (24). The second study isolated adiponectin cDNA by performing a large scale random sequen cing of the human adipose tissue cDNA library and calling it AdipoQ (25) It was observed exclusively in mature adipocytes and was found to be significantly reduced in the adipose tissues from obese mice and humans (25). The third study analyzed ran dom clones and obtained actively transcribed genes in adipose tissue referring to it as adipose most abundant gene transcript 1 (apM1) (26). The final study isolated adiponectin from human plasma, named it GBP28, and suggested its functions involved lipid catabolism or whole body metabolism (27). Although this adipose tissue specific protein was discovered in 1995 its clinical relevance remained obscure until 2001 when other labs began to suggest its potential as an anti diabetic, anti inflammatory, and antiatherosclerotic hormone ( 28).

PAGE 19

19 Proposed Functions of Adiponectin Unlike other adipokines, adiponectin mRNA and plasma levels decrease with obesity. It is also invers ely correlated with body weight, even in extremely lean individuals with conditions like anorexia nervosa who eventually suffer from hyperadiponectinemia. A study was designed using ob/ob mice that were lacking leptin, while over expres sing adiponectin. The over expression of adiponectin normalized blood glucose and insulin levels, and positively affected serum triglyceride levels. Although the ob/ob mice with an over expression of adiponectin were heavier, they were healthier. Overall while these mice showed a massive expansion of subcutaneous tissue, displayed hyperphagia, and early onset obesity metabolic parameters including hyperglycemia, hyperinsulemia, and dyslipidemia were normalized by the over expression of adiponectin (29). In skeletal muscle, adiponectin increases the tyrosine phosphorylation of the insulin receptor. It has also been reported that adiponectin is closely related to insulin sensitivity, independent of fat mass (30). This result points to a role for decreased adiponectin involvement in the development of insulin resistance and T2DM, but not necessarily only because of body fat. This, in turn, could make adiponectin a n extremely good biomarker for metabolic parameters (31). In order to further investigate adiponectin function, adiponectin knockout mice with different phenotypes were developed by three different groups (3, 32 33). Maeda et al (3) disrupted the adiponectin gene by replacing exon 2 with the neomycin resistant gene During development up to 16 weeks, there were no large differences in growth rate and food intake between wild type (WT) and knockout (KO) mice. KO mice showed a dela yed clearance of free fatty acids (FFA) in plasma, high levels of Tumor necrosis

PAGE 20

20 factor severe diet induced insulin resistance (3). Another group had different results with no s ignificant changes in insulin sensitivity when KO mice were compared to WT mice. oxidation, suggesting compensatory mechanism activation with the loss of adiponectin (32). Finally, Kubota et al. s howed impairment in FFA plasma clearance, high levels of TNF tissue and high plasma TNF shown to have an inverse relationship with adiponectin (34). An increase in fatty acid oxidati on by adiponectin decreases free fatty acid influx, which then reduces hepatic glucose output (35). Other proposed functions for adiponectin include its role in atherosclerosis (36), cancer (37), longevity (38), and metabolic flexibility (39). Recent stud ies have shown that adiponectin has anti atherogenic and anti inflammatory properties. When monocytes adhere to the vascular endothelium and differentiate into macrophages and foam cells, vascular disease develops. Hypoadiponectinemia has been associated with endothelial dysfunction. Adiponectin deficient mice display impaired endothelium vasodilation and NO (Nitric Oxide) production, therefore alleviating obesity associated endothelial function and cardiovascular disease (36). A systemic review on adiponectin and cancer discovered ad A low amount of circulating adiponectin is associated with cancer risk in obesity. Adiponectin analogues may be effective as anti cancer treatments, but more research needs to be done in this developing area (37). In a study using centenarians, their offspring, and unrelated participants, it was shown that the centenarians and their offspring had higher levels of

PAGE 21

21 circulating adiponectin. Genotyped A dipo Q variants were analyzed. Two common AdipoQ polymorphisms were associated with higher adiponectin in men. These genetic variants could contribute to the link between adiponectin and longevity (38). Adiponectin is also purported to increase metabolic flexibil ity in adipose tissue, therefore increasing its ability to maintain proper function under metabolically demanding conditions. Overall, adiponectin seems to play a major role in glucose and lipid metabolism. A summary of physiological and pathophysiologica l conditions and their association to adiponectin levels can be seen in Table 2 1. Regulation of Adiponectin Circulating levels of adiponectin in plasma are at concentrations of 2 20 g/ml, which are considered very high for an endocrine hormone. Despite its abundant presence in plasma, it is cleared rapidly, having a half life of about 75 min (40). Regulation of adiponectin may take place at either the transcriptional, translati onal, or post translational level. The mechanism of the d egradation and clearance of adiponectin is still inconclusive, which could also prove important in regulation (41). The peroxisome proliferator activated receptor (PPAR on factor thought to be a master regulator of adipocyte differentiation and multiple adipocyte genes. T hiazolidinediones (TZDs) are specific synthetic ligand activators of PPAR The administration of TZDs has been shown to increase plasma adiponectin. Subjects with PPAR adiponectin. This suggests that PPAR synthesis (42). Other adipokines may play a role in the regulation of adiponect in. TNF and Interleukin 6 (IL 6) are seen in higher levels in obese subjects. Many studies have shown that TNF down regulate s adiponectin mRNA and negative associations have

PAGE 22

22 been shown between TNF ulate each other (43). Adiponectin is depressed during lactation and late gestation; it increases during sexual maturation, as well as with a calorie restricted diet (44). In a study investigating the effects of sex hormones on the production of ad iponectin in human subjects, rodents and cultured cells, investigators found testosterone treatment reduced plasma adiponectin levels in mice and 3T3 L1 adipocytes. In human subjects, plasma adiponectin concentrations were lower in men, when c ompared to women, whereas women had higher levels of leptin. This study related the high incidence of T2DM and atherosclerosis in men to lower circulati ng levels of adiponectin (45). The fact that women had higher levels of circulating adiponectin but high er levels of body fat for a given BMI, would indicate the inv olvement of factors other than fat mass (23). Visceral fat has been shown in many studies to have an effect on metabolic syndrome, glucose intolerance, hypertension, dyslipidemia, and insulin res istance. Adiponectin mRNA and protein levels were found to be reduced when visceral to subcutaneous fat were compared (46). The results are still inconclusive as to whether adiponectin levels are the cause or the effect of visceral fat and its implications on t he metabolic state. I n 3T3 L1 adip ocytes, Phosphatidylinositol 3 kinase (PI3K) has been shown to be necessary for adiponectin secretion (76) Low levels of adiponectin have been associated with a decrease in PI3K activity and a decrease in the insulin receptor substrate 1. Insulin stimulates the secretion of adiponecti n, but is dependent on the PI3K dependent signaling pathway. A study using a PI3K inhibitor and insulin showed that an inhibition in the PI3K pathway completely inhibits the insuli n stimulated increase

PAGE 23

23 in adiponectin secretion (76). There may be other insulin dependent pathways that could affect adiponectin production and secretion, but they have yet to be discovered. Adiponectin Receptors Yamauchi et al discovered adiponectin receptors 1 and 2 ( ADIPOR1 AND ADIPOR2 ) in 2003 (47). Both receptors have been detected in many tissues with high cells: they are also found in macrophages. These two receptors interact directly with adiponectin and mediate many of its effects. Adiponectin receptor expression in the skeletal muscle of T2DM subjects has been shown to be reduced. Obesity does not only decrease adiponectin, but dec reases both of its receptors, thus decreasing adiponectin sensitivity (48). Polymorphisms in adiponectin receptor genes have been linked to insulin resistance (49). Lower levels of ADIPOR1 mRNA were found in visceral fat than in subcutaneous fat (50). Adiponectin and Insulin Resistance Insulin resistance is one of the main fact ors contributing to type 2 diabetes. Adiponectin levels have been shown to correlate with insulin resistance. Decreased plasma adiponectin has been associated with a higher incidence of diabetes. red in 2001 by three independent groups. Adiponectin was shown to reverse insulin resistance in mice receiving intraperitoneal injections of adiponectin. Yamauchi et al (51) high fat diet to induce an insulin resistant state. When the mice were injected with adiponectin the insulin resistance was significantly ameliorated, suggesting that adiponectin was acting as an insulin sensitizing hormone (51). Scherer et al (52) reported than an acute increase in circulating adiponectin triggered a transient decrease

PAGE 24

24 in basal glucose by inhibiting the expression of gluconeogenic enzymes and the rate of endogenous glucose production in wild type mice. In ob/ ob mice and streptozotocin treated WT mice, adiponectin injections abolished hyperglycemia. Administration of adiponectin in rodents has also shown increases in tyrosine phosphorylation of the insulin receptor in skeletal muscle (30, 52). Studies done in adiponectin deficient mice showed a decrease in insulin sensitivity and glucose intolerance, as noted in the previous section. Adiponectin deficient mice fed a high fat diet, developed severe insulin resistance in skeletal muscle in as little as two weeks. One poss ible mechanism underlying adiponectin insulin sensitizing effects involves the insulin signaling cascade. NEFAs are the single most critical factor affecting insulin sensitivity. Increased levels of NEFAs cause insulin resistance within h ours of being rele ased in acute amounts. Increased NEFA delivery increases fatty acid metabolites such as diaclyglycerol (DAG), fatty acyl coenzyme (f atty acyl CoA), and ceramides. In turn, these metabolites turn on the serine/threonine kinase cascade leading to the se rine/threonine p hosphorylation of IRS 1/IRS 2. This reduces the ability of IRS 1 tyrosine phosphorylation to activate PI3K and the downstream events in the cell dysfunction occurs with high levels of NEFAs. Overtime, this proce ss moves forward slowly making the onset of T2DM a slow process that usually takes many years (6, 49). Adiponectin plays a major role in the clearance of NEFAs from plasma. Full length adiponectin was found to stimulate AMPK phosphorylation and activat ion in the liver, suppressing hepatic glucose production; through AMPK phosphorylation in the liver it ability to

PAGE 25

25 decrease gluconeogenic enzymes could be the mechanism underlying t he increase in AMPK phosphorylation (30). In 3T3 L1 adipocytes, adiponectin was shown to increase the ability of insulin to stimulate glucose uptake by increasing GLUT4 gene expression and recruitment to the plasma membrane (53). The adiponectin gene is located on chromosome 3q27. One single nucleotide polymorphism (SNP) located at position 276 from the translational site has been associated with a higher risk for T2DM, insulin resistance, and lower levels of circulating adiponec tin (54). In patients with T2DM and insulin resistance, metabolic syndrome markers were closely related to adiponectin levels (55). Overall, extensive research has proven that adiponectin is an insulin sensitizing hormone involved in glucose and lipid met abolism. Epigallocatechin gallate Tea, known as a plant, leaf, or beverage originating from the perennial evergreen shrub, Camellia Sinensis has been consumed by humans for thousands of years and has now become a worldwide consumed beverage, coming in s econd only to water ( 56 ). Green tea constitutes 20% of the amount of tea produced and has been studied extensively and shown to have beneficial health effects. It is rich in polyphenols, specifically a subclass of flava n 3 ols, the catechins ( 57 ). Catechi n levels depend on the geographical area the tea was grown in, how carefully it was processed, and the age of the leaf. While the tea is being processed, manufacturers have to be very careful to preserve the catechins (58). chin ( ) Epigallocatechin 3 gallate (EGCG), accounts for 30 50% of the catechins found in green tea Green tea usually contains between 30 and 130 mg of EGCG in one cup (237 mL). EGCG has been shown to have the greatest effect when compared with other catechins on factors

PAGE 26

26 such as the prevention of metabolic syndrome, inflammation, weight loss, fat oxidation, and glucose control ( 9 ). Introduction to Polyphenols Polyphenols are characterized as chemical compounds containing more than one phenol g roup or building block molecule. The most studied group is the flavanoids whose subclass includes: flavonols, flavones, catechins, flavanones, anthocyanidins, and isoflavonoids Many of these flavonoids have been shown to exert beneficial effects in humans. Catechins represent about 70% of the polyphenolic content of green tea. The 5 major catechins isolated from in green tea are: (+) catechin (C), ( ) epicatechin (EC), ( ) epicatechin 3 0 gallate (ECG), ( ) epigallocatechin (EGC), ( ) epigall ocatechin gallate (EGCG), and gallic acid (GA). In order to understand their bioavailability, absorption, and metabolism, a number of studies have examined various aspects of these catechins. In human plasma, catechin levels reach their peak 2 to 4 h afte r ingestion; the highest concentration of catechins that has been measured is about 1 M. After ingesting a single dose of 800mg of EGCG, human plasma concentrations were found to be 0.96 M (57). EGCG has very poor bioavailability which might be due to its instability in alkaline or neutral conditions, low cellular uptake, metabolic transformations, and active efflux of polyphenolic compounds by the multidrug resistance associated protein 2 (MRP2). The same conditions are seen in cell culture mod els, in which EGCG levels peak at 2 to 4 h and where it i s less stable at a neutral pH. EGCG displayed a half life of 130 min when in the presence of cells (59). Using a pro drug approach, the use of ( ) EGCG octaacetate (ProEGCG) improved bioavailability and was more stable in a pH=8 solution (57). Metabolic transformations of green tea polyphenols have been looked at

PAGE 27

27 to understand absorption. Valerolactones have been identified as metabolites of catechins in human urine and plasma. In the liver, brain, a nd gastrointestinal tract of rats and mice, glucuronidation, sulphation, and methylation of catechins were found. A recent study using an ex vivo ileostomy model to study the microbial metabolism of green tea catechins, found that 31% of ingested green tea flavanols were absorbed in the small intestine and the rest in preceding parts of the gut (60). Catechins are thought to be metabolized rapidly. EGCG becomes degalloyated in the mouth and esophagus, and saliva has been found to have catechin esterase activity. Enzymes involved in polyphenol metabolism include catechol O methyltransferase (COMT), UDP glucuronosyltransferases (UGT) and phenolsulfotransferases (SULT) (61). This is a developing area of research and results are still not conclusive. Epigallocatechin gallate Health Benefits The health benefits of EGCG have been studied extensively. Thielecke et al. (34) reviewed a large number of in vitro animal, and human studies and found fairly conclusive evidence that EGCG underlyin g mechanism and proven benefits in obesity, type 2 diabetes, and cardiovascular factors. Almost all the human studies showed a reduction in body weight and body fat in response to EGCG supplementation suggesting a possible increase in beta oxidation (34). A study done in 3T3 L1 adipocytes used concentrations of 0, 50, 100, and 200 M of EGCG to determine whether EGCG would inhibit adipogenesis and induce apoptosis. Cell viability was not affected during the 24 h incubation period. Results indicated a dose dependent decrease in average lipid droplets and total lipid droplet number after EGCG treatment. However, when the cells were exposed to 200 M EGCG, very few mature adipocytes

PAGE 28

28 exhibited normal morphology. EGCG had an inhibitory effect on differentiation and the induction of apoptosis (62). Wolfram et al ( 63) further investigated these effects in rodents. Diets for C57BL/6J mice and Sprague Dawley rats were supplemented with EGCG The C57BL/6J mice were fed a high fat diet containing 1% EGCG (1 mg) for 5 months; obese Sprague Dawley rats were fed a high fat diet containing 1% EGCG (1 mg) for 4 weeks. The results showed that EGCG prevented diet induced obesity in C57BL/6J mice, decreased the body weight of Sprague Dawley rats reversing their diet induced obesity, and reduced mRNA expression of lipogenic enzymes in both animals. The most significant result was found in the C57BL/6J mice, which suggested that EGCG c ould be beneficial in the prevention of obesity (63). Jeukendrup et al (64) investigated fat oxidation and glucose tolerance in males consuming EGCG during moderate intensity exercises. Subjects ingested capsules containing about 360 mg of EGCG du ring the 24 h period before they began exercising. The results showed a 21% increase in fat oxidation in the subjects who were consuming EGCG versus the placebo. Testing showed that EGCG improved glucose tolerance, and that insulin sensitivity increased an average of 13%. This increase in fat oxidation could be due to an increase in lipolysis, as seen in the in vitro studies. EGCG has beneficial effects that could modulate obesity (64). EGCG also plays a role as an anti oxidant, due to its effective sc avenging of free radicals. It has the most potent anti oxidant effect when compared to the other catechins. EGCG has also been credited as being an immunomodulator, anti inflammatory, anti cancer, and anti ing

PAGE 29

29 cellular damage by mitigating metabolic production of reactive oxygen species (ROS) could play a role in aging (65). Further investigation into the mechanism of EGCG will be necessary to better understand its exact role in affecting these specific cond itions. Epigallocatechin gallate and Insulin Resistance Patients with type 2 diabetes are usually prescribed metformin as first line therapy, and then TZD, sulfonylurea, or insulin are subsequently added if specific target glucose levels are not met (66). Although these drugs ameliorate the condition, they also come with an array of side effects. Promising alternative therapies have used active phytochemicals such as resveratrol, xanthones, and catechins as antidiabetic agents (67, 68, 16). EGCG is a cate chin that has been shown to be a promising alternative therapy (57). One of the trademarks of diabetes is the inability of insulin to inhibit hepatic glucose production. Gluconeogenesis is the main reason for increases in hepatic glucose production and enzymes phosphoenolpyruvate carboxykinase (PEPCK) and glucose 6 phosphatase (G6Pase) causi ng this state. In a study using rat hepatoma cells, cells were incubated in the presence or absence of insulin and/or EGCG. Cells treated with EGCG and insulin showed an increase in the tyrosine phosphorylation of the insulin receptor, the insulin receptor substrate 1, and PI3K, suggesting that EGCG mimics insulin in hepatoma cells, by lowering hepatic glucose prod uction. EGCG also decreased PEPCK and G6Pase mRNA expression, while increasing the production of reactive oxygen species (ROS) in hepatoma cells. Although EGCG acts as an antioxidant in other cells, it appears to act as a pro oxidant in hepatoma cells. Th e increase in ROS production could be the mechanism behind EGCG inhibiting p rotein t yrosine p hosphatase (PTP), which contains an oxidizable cysteine in its active site (2).

PAGE 30

30 In an animal study using db/db (leptin receptor deficient, severely diabetic) mice and ZDF (animal model of T2DM, moderately diabetic) rats, EGCG supplementation was given along with a chow diet. EGCG supplemented db/db mice showed improved oral glucose tolerance and insulin plasma concentrations were increased, when compared to the control animals. The mRNA expression of glucokinase (GK) was also increased in the livers of these mice. Increased activity of GK leads to enhanced glycolysis and hepatic glucose uptake. EGCG could be improving pancreatic fu nction by the ZDF rats, blood glucose concentrations were again lower in EGCG supplemented animals and insulin concentrations in the plasma were increased. This st udy showed diabetic agent (12). To further investigate the effects of EGCG, a human study was done with T2DM patients who were not receiving insulin treatments. Participants ingested a green tea beverage that contained 583 mg of catechins daily for 12 weeks. Subjects consuming the catechin beverage had a reduced waist circumference, increased levels of plasma adiponectin, and an increase in insulin compared to the control subjects. These results indicate that this catechin rich beverage improved blood glucose control in these T2DM subjects (69). Many studies have been done to show the effect EGCG has on insulin resistance and glucose homeostasis. In 3T3 L1 adipocytes, EGCG, at a concentration of 5 M, was shown to enhance the expression of genes related to insulin sensitivity (70). In skeletal muscle, EGCG was shown to promote GLUT 4 translocation; GLUT 4 plays a pivotal role in insulin stimulated glucose transport (71).

PAGE 31

31 Adiponectin and Epigallocatechin gallate EGCG has been shown to suppress fatty acid synthesis and activate fatty acid oxidation in the liver and adipose tissue. EGCG has also been shown to decrease gluconeogenesis, decreasing hepatic glucose production (10). Adiponectin improves insulin resist oxidation and decreasing gluconeogenesis in the liver and by increasing glucose uptake in skeletal muscle (12) Recent research has suggested that EGCG could improve insulin resistance and lipid metabolic abnormalities by enhancing adip onectin production. A study was done using non obese Type 2 diabetic Goto Kakizaki rats and measuring plasma adiponectin levels (12) The rats were fed a normal chow diet supplemented with 0.2% EGCG for 12 weeks. Plasma adiponectin levels were significantl y increased o ver those in the control group. Plasma triacylglycerol levels of animals treated with EGCG were significantly lower when compared to controls (12). In a study conducted using obese women taking capsulated 400 mg/d EGCG supplementation for 12 weeks, subjects showed an increase of plasma adiponectin, ghrelin, and HDL cholesterol, when compared to placebo takers (14). Adiponectin secretion from adipocytes is thought to be enhanced by insulin initiating the insul in signaling cascade (6). Insulin stimulates the secretion of adiponectin, but is dependent on the PI3K dependent signaling pathway ( 76) Phosphatidylinositol 3 kinase (PI3K) activity has been shown to be necessary for adiponectin secretion ; while low levels of adiponectin can be associated with a decrease in PI3K activity and a decrease in the insulin receptor substrate 1 tyrosine phosphorylation (76). It has been suggested that EGCG might be insulin mimetic, activating the insulin signaling cascade in hepatocytes. EGCG could be mimicking insulin in adipocytes, and stimulating the

PAGE 32

32 secretion of adiponectin through the insulin signaling cascade (2). Future studies using adipocytes as a cell model will be necessary to determine whether this is the case. Specific Aims AIM I : Investigate the effect of EGCG on adiponectin protein expression and secretion in 3T3 L1 adipocytes. A study conducted in obese women taking capsulated 400 mg/d EGCG supplementation for 12 weeks, resulted in an increase of circulating adiponect in when compared to placebo (14). Another study showed dietary supplementation of EGCG elevated circulating levels of adiponectin in Non Obese Type 2 diabetic Goto Kakizaki rats ( 16 ) adiponectin in v itro using 3T3 L1 adi pocytes as a cell model. 3T3 L1 mature adi pocytes will be used in order to measure adiponectin protein and mRNA expression in response to EGCG treatment. AIM II : Investigate whether the mechanism underlying the effects of EGCG on adiponectin protein expression is through the insulin signaling pathway. EGCG antidiabetic role was shown in an animal study in which EGCG was injected into lean and obese Zucker rats and it significantly lowered blood glucose and insulin levels ( 35 ) I antidiabetic role, this study will d etermine the effect of EGCG on the phosphorylation of insulin signaling proteins such as insulin receptor (IR) and insulin receptor substrat e 1 ( IRS 1) in 3T3 L1 adipocytes.

PAGE 33

33 Figure 2 1. Structure and Nomenclature of ( )Epigallocatechin gallate Table 2 1. Conditions or treatments associated wit h changes in plasma adiponectin Increase Decrease TZDs Heart failure Renal failure Weight loss Dietary factors: Soy pr otein Oils Variation in Adiponectin Gene Obesity Insulin Resistance Type 2 Diabetes Metabolic Syndrome Dyslipidemia Cardiovascular disease Hypertension Sex hormones (androgens, testosterone) Oxidative stress Carbohydrate rich diet

PAGE 34

34 CHAPTER 3 MATERIALS AND METHOD S Study Design for Specific Aims I and II For specific aim I, 3T3 L1 adipocytes were provided by Dr. Susan C. Frost. The adipocytes were differentiated and grown to mature adipocytes (Day 9) Studies show adiponectin is secreted in higher amount s from mature adipocytes ( 30 ). On day 4 after differentiation, cells were started on different treatments showed in Table 3 1. Cells were given treatment every other day until day 9. On day 9, cells we re given last treatment for a 6 h incubation. A recent study revealed a 6 h incubation time as an ideal time for adiponectin expression in 3T3 L1 adipocytes ( 72 ). For specific aim II, adipocytes were differentiated and grown to mature adipocytes (Day 9). On day 4 after differentiation, cells were started on different treatments showed in Table 3 1. Cells were given treatment every other day until day 9. On day 9, cells were given the last treatment for 30 min Insulin phosphorylation occurs very quickly. Most studies choose a 30 min incubation as time point to visualize phosphorylation (30 ). Cell Culture and Treatments 3T3 L1 cell s a mouse embryonic fibroblast adipose like cell line ( gifts of Dr. Susan C. Frost, UF), were cultured Modi fied Eagle Media (DMEM) containing 4.5 g/L D glucose and 4 mM glutamine (GIBCO b rand, INVITROGEN, Carlsbad, CA) supplemented with Penicillin(100 U/ml ) Streptomycin ( 100g/ml ) (Sigma, St. Louis, MO), 10% c alf serum (Atlanta Biologicals, Lawrenceville, GA) a nd incubated at 37C in 7.5 % CO2 Fibroblasts were grown in 6 well plates under the same conditions for 48 h Subsequent medium changes were done every 48 h until the fibroblast had reached confluence. W hen fibroblast s were two days post confluent they

PAGE 35

35 were culture d with differentiation medium for 48 h (Day 0) Differentiation Medium contained : DMEM containing 4.5 g/L D glucose and 4 mM glutamine, 10% fetal bovine serum (FBS) (GIBCO b rand, INVITROGEN, Carlsbad, CA) 0.5 mM IBMX (3 Isobutyl 1 methy lxanthine) (Sigma) 0.2 5 M Dexamethasone (Sigma) 1g/ml (170 nM) Insulin (Sigma) After 48 h fresh media was added containing DMEM with 10% FBS and 170 nM insulin (Day 2 ) On day 2 of differentiation, cells were started on different treatments of either 0.1% Dimethyl sulfoxide (DMSO) (Fisher Scientific, Fair Lawn, NJ) 100 nM Insulin, or Epigallocatechin gallate (EGCG) (Sigma) as show in Table 3 1 Subsequent medium changes were given every 48 h (Day 4 9 ) containing DMEM, 10 % FBS and assigned treatment On day 9 cells were fully differentiated mature adipocytes Medium containing DMEM, 10% FBS, and specific treatment was added on day 9 for a 6 h incubation. Aft er 6 h, media from each well was removed and centrifuged at 10,00 0x g for 10 min, then into 80C. Cells were washed with cold phosphate buffered saline ( PBS ) 3 times and cell lysate was processed. Adipocyte induction was as described by Frost et.al ( 7 3 ). Cellular Secretion of Adiponectin Measured by ELISA 3T3 L1 cells (Day 9) were incubated with 1 M 2.5 M, 5 M, 10 M EGCG, or 100 nM insulin 100 nM chronic insulin (INSA), 100 nM chronic insulin plus 5 M EGCG (INSA5) or 0.1% DMSO for 6 h at 37C in 7.5 % CO2 Media was removed from individual wells and centri fuged at 10,000x g for 10 min. The supernatant was then removed and used for the analysis of Adiponectin secretion using a mouse Adiponectin ELISA kit (R&D systems, Minneapolis, MN) Supernatants were diluted 200 fold i n order to fit standard curve. Prot ein content of supernatants w ere determined by the

PAGE 36

36 Bradford method (Bio Rad, Hercules, CA) Three independent experiments were conducted. Sample Preparation for Western Blot Analysis After incubation, cells were washed with ice cold PBS 3 times. L ysis buffer containing 20 mM Tris buffer (Sigma) pH to 7.5 with hydrochloric acid ( HCl ) (Fisher) ,150 mM sodium chloride (NACL)(Fisher), 1% Triton X 100 (Fisher), 0.1% Sodium dodecyl sulfate (SDS) (Fisher), 2 mM Ethylenediaminetetraacetic acid ( EDTA ) (Fisher), a nd protease inhibitor cocktail (Roche, Boulder, CO) was added to cells. For lysates used in measuring insulin receptor phosphorylation, a phosphatase inhibitor cocktail (Roche) was also added. Using a cell lifter (Fisher), cells in lysis buffer were transf erred into a tube, vortexed and centrifuged at 13,000 x g for 15 min at 4C in order to pellet nuclei and cell debris. S upernatant was removed and stored in 80C until analysis. Protein concentrations were analyzed using the Bradford method (Bio Rad). Adiponectin Sample 3T3 L1 cells (Day 9) were incubated with 1 M 2.5 M, 5 M, 10 M EGCG, or 100 nM Insulin, 100 nM chronic insulin (INSA), 100 nM chronic insulin plus 5 M EGCG (INSA5) or 0.1% DMSO for 6 h at 37C in 7.5 % CO2 Followed sample preparation protocol mentioned in the sample preparation section Insulin Receptor and Phosphorylation of Insulin Receptor Sample 3T3 L1 cells (Day 9) were incubated with 1 M 2.5 M, 5 M, 10 M EGCG, or 100 nM Insulin, or 0.1% DMSO for 30 min at 37C in 7.5 % CO2 Followed sample preparation protocol mentioned in the sample preparation section

PAGE 37

37 Western Blotting Adiponectin Analysis Samples containing 45 g of protein were mixed with Laemmli buffer, heated at phorectically separated on a 15 % sodium dodecyl sulfate (SDS) polyacrylamide gel. Molecular weight standards (Precision Plus, dual color, Bio Rad) were run in parallel as well as MagicMark XP Western Protein Standard (Invitrogen) Sep a rated proteins on th e gel were then transferred to a nitrocellulose membrane (i Blot Dry Blotting System; Invitrogen). Transfer and equal loading were verified by Ponceau stain ing. Blot s w ere blocked for 1 h in blocking buffer [BB: 5% nonfat dry milk in Tris buffered saline ( TBS), pH 7.4 and 0.01% Tween20 (TBST)], pH 7.4) for 1 h at room temperature ( RT ) Blots were then incubated overnight at 4C in rabbit anti adiponectin (1:5000; Millipore, Billerica, MA ). Following primary incubation, blots were washed several times with TBST before being incubated in blocking buffer containing a 1:6 00 0 dilution of peroxidase conjugated g o at anti r abbit IgG (Pierce, Rockford, IL ) for 40 min at RT. Blot s w ere washed in TBST twice for 5 min, and then washed in TBS twice for 5 min. Immunor eactivity was visualized by using enhanced chemiluminescence (SuperSignal WestPico, Pierce) and x ray film (Fisher) To control for loading, the blot was stripped and re probed for loading control mouse monoclonal anti Actin ( ) and a 1: 8 ,000 dilution of Anti Mouse IgG ( Fc Specific) peroxidase antibody produced in goat ( Sigma ). Immunoreactivity was visualized by using enhanced chemiluminescence (SuperSignal WestPico) and x ray film.

PAGE 38

38 Insulin Receptor and Phosphorylation of Insulin Receptor Sam ples containing 45 g of protein were mixed with Laemmli buffer, heated at phorectically separated on a 7.5 % sodium dodecyl sulfate (SDS) polyacrylamide gel. Molecular weight standards (Precision Plus, dual color, Bio Rad) were run in parallel as well as MagicMark XP Western Protein Standard (Invitrogen) Separated proteins on the gel were then transferred to a nitrocellulose membrane (i Blot Dry Blotting System; Invitrogen). Transfer and equal loading were verifie d by Ponceau stain ing. Blot s w ere blocked for 1 h in blocking buffer [BB: 5% nonfat dry milk in Tris buffered saline (TBS), pH 7.4 and 0.01% Tween20 (TBST)], pH 7.4) for 1 h at room temperature (RT). Blots were then incubated overnight at 4C in rabbit anti insulin receptor ( 1:1 000; Santa Cruz Biotechnology, Santa Cruz, CA ). Following primary incubation, blots were washed several times with TBST before being incubated in blocking buffer containing a 1:6 00 0 dilution of peroxidase conjugated g o at anti r ab bit IgG (Pierce, Rockford, IL ) for 40 min at RT. Blot s w ere washed in TBST twice for 5 min, and then washed in TBS twice for 5 min. Immunoreactivity was visualized by using enhanced chemiluminescence (SuperSignal WestPico, Pierce) and x ray film (Fisher) B lot s w ere then stripped and re probed for a 1:1000 dilution of the rabbit anti insulin receptor phosphorylation (pIR) Following primary incubation, blots were washed several times with TBST before being incubated in blocking buffer containing a 1:6 00 0 dilution of peroxidase conjugated g o at anti r abbit IgG (Pierce, Rockford, IL ) for 40 min at RT. Blot s w ere washed in TBST twice for 5 min, and then washed in TBS twice for 5 min. Immunoreactivity was visualized by using enhanced chemiluminescence (SuperSignal WestPico, Pierce) and x ray film (Fisher). To control for loading, the blot was stripped and re probe d for loading control mouse monoclonal

PAGE 39

39 anti Actin ( ) and a 1: 8 ,000 dilution of a nti m ouse IgG ( Fc Specific) peroxidase antibody produced in goat ( Sigma ). Immunoreactivity was visualized by using enhanced chemiluminescence (SuperSignal WestPic o) and x ray film. Adiponectin Gene Expression by Quantitative RT PCR Analysis Specific RNA abundance was quantified by quantitative reverse transcriptase PCR (qRT PCR) analysis. RNA was isolated from cultured 3T3 L1 cells using RNABee (Tel Test, Friendsw G enomic DNA was removed from isolated RNA by treating RNA with DNase (TURBO DNA Free kit First strand cDNA was synthesized using High Capacity cDNA Archive kit (Applied Biosystems Foster City, CA ) accordi qRT PCR was performed by using Power SYBR Green PCR Master Mix (Applied Biosystems) and an Applied Biosystems 7300 real time PCR system. S tandard curves were generated by four, 10 fold serial dilutions of standard cDNA. Quantitation of mRNA was in comparison to the standard curves. Levels of mRNA were normalized to that of RPL13A The primer sequences used to measure specif ic mRNAs are shown in Table 3 2 Oil Red O Staining 3T3 L1 adipocyte cells (Day 9) were stained with Oil Red O as described by Garvey et.al (29). The cells were first fixed in 2% paraformaldehyde for 90 min. They were then washed with deionized water. Cells were incubated with a working solution of Oil Red O staining for 3 h. The staining of the lipid droplets were visualized using a phase contrast microscope at 100X magnification. Pictures were taken with a digital camera (Cannon).

PAGE 40

40 Statistical Analysis Statistical analyses were performed by using SigmaStat and SigmaPlot 11 software. All data are expressed as means SD All data we re analyzed by one way analysis of variance (ANOVA) and Student New man Keuls post hoc test. Differences with P<0.05 were considered significant.

PAGE 41

41 Table 3 1. Cell Culture Treatments Treatment Concentration DMSO INSULIN(INS) INSA INSA5 0.1 % 100 nM 100 nM (Acute) 100 nM insulin g iven every other day after and during differentiation (Chronic) 100 nM insulin + 5 m EGCG Given every 2 days after differentiation (Chronic) EGCG 1 M EGCG 2.5 M EGCG 5 M EGCG EGCG EGCG 10 M 20 M 50 M INS A=C hronic insulin treatment INS A5= C hronic insulin and EGCG treatment Table 3 2 Primer sequences chosen for the quantification of gene transcripts Gene m Adiponectin aacccctggcaggaaagg tgaacgctgagcgatacacat RPL13 A cccacccacctgaccaagt cagctcatgtgcagatctcattt m=mouse

PAGE 42

42 CHAPTER 4 RESULTS EGCG has been shown to decrease g luconeogenesis decreasing hepatic glucose production therefore possibly preventing insulin resistance ( 2 ) Adiponectin improves oxidation and decreasing g luconeogenesis in the liver and by increasing glucose uptake in skeletal muscle The mechanism by which EGCG improves insulin sensitiv ity is not well known. Recent research has suggested that EGCG could improve insulin resistance by enhancing adiponectin production. A recent study was done using Non obese Type 2 diabetic Goto Kakizaki rats fed a normal chow diet along with a 0.2% EGCG su pplementation Plasma adiponectin levels were increased significantly higher than those in the control group (1 2 ) This data suggest that EGCG could be improving insulin sensitivity by increasing the production of adiponectin in adipocytes. Adiponectin is mostly secreted by mature adipocytes. Oil red O staining of mature adipocytes can be seen in Figure 4 1. In order to investigate the effect of EGCG on the production of adiponectin we measured adiponectin extracellular secretion, intracellular expression and mRNA expression. EGCG Stimulates Adiponectin Secretion in 3T3 L1 Adipocytes We investigated EGCG effect on adiponectin secretion by ELISA. Cell media was taken from cells after a 6 h incubation with specified treatments. Insulin was used as a control. Insulin stimulates secretion of adiponectin but stimulation is dependent on the PI3K signaling pathway. Inhibition of the PI3K signaling pathway decreases insulin stimulated adiponectin secretion in 3T3 L1 adipocytes ( 46 ). An insulin resistan t state was made by adding insulin to cells every other day during and after differentiation (INSA). Cellular protein was determined by the Bradford assay and used to normalize

PAGE 43

43 adiponectin concentration. At the 6 h time point (Figure 4 2), 10 M EGCG sig nificantly increased adiponectin secretion by 50% (p<0.04) compared to control. The other EGCG treatments had no significant effect on adiponectin secretion, but showed a positive linear correlation as treatment increased to 10 M EGCG and then began to sh ow a negative linear correlation after 10 M EGCG. Insulin did not stimulate a significant increase of adiponectin secretion, but insulin resistant cells (INSA), exhibited a decrease in adiponectin secretion that was not shown to be significant. The addit ion of 5 M EGCG to insulin resistant cell (INSA5) had no effect. A time course was done using 2, 6, and 18 h time points in order to determine if the increase in adiponectin secretion was only seen at the 6 h time point (Figure 4 3). The results indicate d no significant differences among different treatments during the 2 and 18 h incubation periods. The 10 M EGCG treatment only significant ly increased adiponectin secretion after a 6 h incubation period (p<0.04) EGCG E nhances Adiponectin Protein Expression in 3T3 L1 Adipocytes In order to understand the effect of EGCG on adiponectin synthesis, intracellular adiponectin was measured by western blot analysis. Adipocytes were incubated with specified treatments for 2, 6 and 18 h. No significant chan ges were found during the 2 and 18 h incubation period ( data not shown). At the 6 h incubation period, d ensitometric quantification of immunoreactive band intensities revealed that 10 M EGCG significantly increase d intracellular adiponectin by about 50% ( p<0.05) Cell treatments including 0.1% DMSO, 100 nM chronic insulin (INSA) or 1 M 2.5 M 5 M 10 M EGCG are shown in Figure 4 4. Cell treatments including 0.1%DMSO, 100 nM Insulin, 100 nM chronic insulin (INSA), 100 nM chronic insulin plus 5 M EGCG (INSA5) or 5

PAGE 44

44 M 10 M 20 M 50 M are shown in Figure 4 5. The induction of protein expression in the cell relates to the increase in secretion of adiponectin EGCG Increase s Adiponectin mRNA expression in 3T3 L1 Adipocytes We measured adiponec tin transcript abundance in order to determine if EGCG played a role in increasing adiponectin mRNA levels. Cells were treated with DMSO, or 5 M 10 M EGCG. The rest of the treatments were no longer used due their non significant changes in intracellular and extracellular adiponectin protein expression. After a 6 h incubation; 5 M (p<0.05) and 10 M (p<0.04) EGCG treatments showed a 50% increase in transcript abundance, as measured by qRT PCR (Figure 4 6). EGCG Does Not Stimulate the Insulin Signaling Pathway in 3T3 L1 Adipocytes In a previous study, cells treated with EGCG and insulin showed an increase in the tyrosine phosphorylation of the insulin receptor, the insulin receptor substrate 1, and PI3K in hepatocyte s, suggesting EGCG mimics insulin when incubated in hepatoma cells, lowering hepatic glucose production ( 2 ). Insulin has been shown to increase adiponectin secretion in ad ipocytes. We hypothesized that EGCG was increasing adiponectin production by increa sing the tyrosine phosphorylation of the insulin receptor and insulin receptor substrate 1 therefore mimicking insulin stimulation of the insulin signaling cascade. Western blot analysis was used to measure total insulin receptor (Total IR), phosphorylat ed insulin receptor (p IR), and beta actin after a 30 min incubation with specified treatments. A 30 min time point was chosen due to the rapid speed of phosphorylation; a 10 min time point was also done but showed no significant difference from the 30 min time point (data not shown). EGCG did not increase the phosphorylation of the insulin receptor. Densitometric quantification of immunoreactive band intensities revealed a14 fold increase of the tyrosine phosphorylation of the insulin

PAGE 45

45 receptor protein wit h insulin treatment (p<0.001) EGCG does not mimic insulin in the 3T3 L1 adipocyte. Insulin receptor substrate and insulin receptor substrate phosphorylation was measured but results were not clear (data not shown).

PAGE 46

46 Figure 4 1. Oil Red O staining of 3T3 L1 mature adipocytes (Day 9). The staining of the lipid droplets were visualized using a phase contrast microscope at 100X magnification. Pictures were taken with a digital camera (Cannon).

PAGE 47

47 Figure 4 2. EGCG stimulates adiponectin secretion in 3T3 L1 adipocytes. Mature adipocytes (Day 9) Cells were incubated with 0.1% DMSO 100 nM Insulin (INS), 100 nM Insulin Continuous (INSA), 100 nM Insulin + 5 M EGCG Continuous (INSA5), o r 1 M 5 M2.5 M 5 M 10 M 20 M 50 M EGCG for 6 h. Cell media was removed and used for analysis of Adiponectin protein secretion using a mouse a diponectin ELISA kit. Protein content was determined by the Bradford method (Bio Rad, Hercules, CA). As terisks indicates a significant difference (P<0.05). Values are means SD from triplicates of 3 independent experiments.

PAGE 48

48 Figure 4 3 Time course on the inducible effect of EGCG on adiponectin secretion in 3T3 L1 a dipocytes Mature adipocytes (Day 9) Cells were incubated with 0.1% DMSO; 100 nM Insulin Continuous (INSA) or 5 M 10 M EGCG at 2 h, 6h, or 18h Cell media was removed and used for analysis of Adiponectin protein secretion using a mouse a diponectin ELIS A kit. Protein content was determined by the Bradford method (Bio Rad, Hercules, CA). Asterisks indicates a significant difference ( P<0.05) Values are means SD from triplicates of 3 independent experiments.

PAGE 49

49 A B Figure 4 4 EGCG increases intracellular adiponectin expression in 3T3 L1 a dipocytes Mature adipocytes (Day 9) Cells were incubated with 0.1% DMSO 100 nM Insulin Continuously (INSA), or 1 M 5 M2.5 M 5 M 10 M EGCG fo r 6 h r A) Western blot analysis of cell lysates. Samples containing 45 g of protein were separated on a 15% sodium dodecyl sulfate (SDS) polyacrylamide gel. The Blot was probed for anti adiponectin primary antibody, then stripped a nd re probed for loading control anti Actin. Protein concentration of lysates was determined by the B radford method. B) Data represents the densitometric analysis of the relative densities of the means SD from 3 independent experiments. Asterisks indi cates a significant difference ( P< 0.05)

PAGE 50

50 A B Figure 4 5 EGCG increases intracellular adiponectin expression 3T3 L1 a dipocytes (Continued) Mature adipocytes (Day 9) Cells were incubated with 0.1% DMSO, 100 nM Insulin, 100 nM Insulin Continuously (INSA), 100 nM Insulin Continuously + 5 M (INSA5),or 5 M 10 M 20 M 50 M EGCG for 6 h. A) Western blot analysis of cell lysates. Samples containing 45 g of protein were separated on a 15% sodium dodecyl sulfat e (SDS) polyacrylamide gel. The b lot was probed for anti adiponectin primary antibody, then stripped and re probed for loading control anti Actin. Protein concentration of lysates was determined by the Bradford method. B) Data represents the densitometric analysis of the relative densities of the means SD from 3 independent experiments. Asterisks indicates a significant difference ( P<0.05)

PAGE 51

51 Figure 4 6 EGCG increases ad iponectin mRNA expression. Mature adipocytes (Day 9) Cells were incubated with 0.1% DMSO, or 5 M 10 M EGCG for 6 h. Total RNA was isolated from cell lysate s and relative ACRP 30 m RNA levels were quantified using qRT PCR analysis Data from 3 different e xperiments are represented as means SD of the relative mRNA normalized with RPL 13A. Asterisks indicates a significant difference ( P<0.05)

PAGE 52

52 Figure 4 7 EGCG does not stimulate tyrosine phosphorylation of insulin receptor. Mature adipocytes (Day 9) Cells were incubated with 0.1% DMSO, 100 nM Insulin, or 5 M 10 M 20 M 50 M EGCG for 30 min. A) Western blot analysis of cell lysates. Samples containing 45 g of protein were separated on a 7. 5% sodium dodecyl sulfate (SDS) polyacrylamide g el. The Blot was probed for anti insulin receptor primary antibody, then stripped and re probed for anti Insulin receptor phosphorylation, then stripped and re probed for loading control anti Actin. Protein concentration of lysates was determined by the Bradford method. B) Tyrosine phosphorylation of Insulin receptor/ Total insulin receptor relative density. C) Tyrosine phosphorylation of Insulin receptor/ Actin relative density. B C ) Data represents the densitometric analysis of the relative densities of the means SD from 3 independent experiments. Asterisks indicates a significant difference ( P<0.05)

PAGE 53

53 CHAPTER 5 DISCUSSION Specific Aim I In this study, we hypothesized EGCG would inc rease adiponectin production. We observed that a 10 M concentration for a 6 h incubation was necessary in order to get a significant increase in adiponectin intracellular and extracellular protein expression EGCG at a 10 M concentration also increases adiponectin mRNA levels, possibly indicating EGCG involvement in increasing adiponectin transcription factors lik e PPAR levels of adiponectin This suggests PPAR adiponectin synthesis. The results found in A im I lead us to believe EGCG is involved in increasing the transcription of adiponectin therefore increasing adiponectin synthesis in the ER, and secreti on out of the cell. Initially, we believed a higher concentration of EGCG would increase adiponectin Previous studies exploring EGCG relationship to insulin resistance have been shown to use concentrations above 50 M. We initially began with concentr ations of 5 10, 50, 100, 200 M EGCG (data not shown). The higher concentrations seemed to down regulate the product ion of adiponectin secretion. The data shows that the 5 M concentration to not be enough to stimulate a significant change and the 20 M concentration to be toxic, therefore decreasing adiponectin production. Studies have shown that EGCG at high levels could prove toxic to the cell and possibly change the morphology of the cell. The high er concentration s of EGCG would not be physiological in humans. The highest concentration of catechins measured in human plasma is about 1 M after a single dose of 800 mg of EGCG (5 7 ). Anything above a 1 M

PAGE 54

54 concentration would not be physiologically relevant. EGCG becomes degalloyated in the mouth and es ophagus, saliva has been found to have catechin esterase activity Although 1 M concentrations are found in the plasma, higher concentrations might have been metabolized, EGCG has very poor bioavailability Many studie s have found high levels of ECG aft er EGCG ingestion (5 7 ). In our study we found a 10 M concentration to have a significant effect on adiponectin production, which could possibly be relevant in humans. Our results also indicated a 6 h incubation time was necessary in order to see a significant increase in adiponectin secretion. Several studies have shown EGCG to be very unstable in in vitro models. EGCG has been shown to have a 130 min half life in cell media and reach peak activity f rom 2 to 4 h after being in cell medium. In human plasma, catechin levels reach their peak 2 to 4 h after ingestion as well ( 59 ). The reason for the significant increase in adiponectin at the 6 h mark could be due to EGCG peak time in the cell. As seen in Figure 4 3, adiponectin rises up sharply at the 6 h incubation with a 10 M concentration of EGCG and then plateaus with the rest of the treatments. Further studies could be done to prove this concept by adding EGCG every 2 to 4 h to the me dia and measuri ng adiponectin secretion. Insulin has been shown to increase adiponectin secretion in adipocytes. In our study, insulin did not show any significant increases in adiponectin secretion. Frost et al. demonstrated a minimum concentration of 100 pM of insulin to reduce glucose transport activity by 50% and a concentration of 100 nM of insulin could decrease GLUT 4 protein expression in 3T3 L1 adipocytes (73 ) The concentration of insulin that was used in this study was 100 nM which could have ca use an insulin resistance state in

PAGE 55

55 the cell or changed the morphology of the cell. The cells that were supplemented with insulin continuously were chronically exposed with insulin. Adiponectin in these cells was shown to be secreted in lower levels, but in tracellular protein was extremely low. Adiponectin was possibly secreted all at once during the specific time point. Time points of 2 and 18 h show intracellular adiponectin with chronic insulin exposure. Another explanation could be that the cellular pro tein of the cells exposed to chronic insulin was almost 90% higher than the other treatments (data not shown); the protein concentration used in western blot analysis could have been from a lower number of cells, therefore having a lower amount of cellular adiponectin The chronic insulin treatment with the addition of EGCG did not show any significant improvements. EGCG might play a role in improving insulin sensitivity, but not improving an already insulin resistant state. Further studies should be done in order to further investigate this. Specific Aim II EGCG has been previously shown to increase the tyrosine phosphorylation of the insulin receptor, the insulin receptor substrate 1, and PI3K in hepatocytes, suggesting EGCG to be an insulin mimet ic, lowering hepatic glucose production ( 2 ) In our study we did not come to the same conclusion as that seen in hepatocytes. In our 3T3 L1 adipocyte model, EGCG does not increase the tyrosine phosphorylation of the insulin receptor, thus indicating EGCG does not stimulate the insulin signaling pathway from the phosphorylation of the insulin receptor. A major regulator in adiponectin secretion is P13 K, but it is highly dependent in insulin in order to stimulate adiponectin secretion. A recent study, obser ved a tyrosine phosphorylation of the insulin receptor and insulin receptor substrate with 100 M EGCG concentration ( 74 ). This could prove toxic to the cell and is not a physiologically relevant concentration. A recently published study has

PAGE 56

56 identified wh at they think is the EGCG receptor (also known as the 67 kD a laminin rec e ptor) in 3T3 L1 adipocytes (75) In this study it was discovered that EGCG acts by phosphorylating its own receptor and then phosphorylating downstream IRS proteins. It could be through this mechanism that EGCG bypasses the insulin receptor phosphorylation and phosphorylates IRS proteins, eventually i ncreasing the activation of PI3 K, in turn increasing adiponectin production (76) Further studies need to be done in order to under stand EGCG effect on IRS protein s and PI3K activation.

PAGE 57

57 LIST OF REFERENCES 1. Cornier MA, Dabelea D, Hernandez TL, et al. The metabolic syndrome. Endocr Rev 2008; 29:777 822. 2. Waltner Law ME, Wang XL, Law BK, Hall RK, Nawano M, Granner DK. Epiga llocatechin gallate, a constituent of green tea, represses hepatic glucose production. J Biol Chem 2002 ; 277:34933 40. 3. Maeda N, Shimomura I, Kishida K, et al. Diet induced insulin resistance in mice lacking adiponectin /ACRP30. Nat Med 2002 ; 8:731 7. 4. Brennan, A. M. & Mantzoros, C. S. (2007) Leptin and adiponectin : their role in diabetes Curr. Diab. Rep. 7: 1 2. 5. Gil Campos, M., Canete, R. R. & Gil, A. (2004) Adiponectin the missing link in insulin resistance and obesity. Clin. Nu tr. 23: 963 974. 6. Seale AP, de Jesus LA, Park MC, Kim YS. Vanadium and insulin increase adiponectin production in 3T3 L1 adipocytes. Pharmacol Res 2006 ; 54:30 8. 7. Fu, Y., Luo, N., Klein, R. L. & Garvey, W. T. (2005) Adiponectin promotes adipocyte differentiation, insulin sensitivity, and lipid accumulation. J. Lipid Res. 46: 1369 1379. 8. A bel, E. D., Peroni, O., Kim, J. K., Kim, Y. B., Boss, O., Hadro, E., Minnemann, T., Shulman, G. I. & Kahn, B. B. (2001) Adipose selective tar geting of the GLUT4 gene impairs insulin action in muscle and liver. Nature 409: 729 733. 9. Thielecke F, Boschmann M. The potential role of green tea catechins in the prevention of the metabolic syndrome a review. Phytochemistry 2009; 70:11 24 10. M oon, H. S., Lee, H. G., Choi, Y. J., Kim, T. G. & Cho, C. S. (2007) Proposed mechanisms of ( ) epigallocatechin 3 gallate for anti obesity. Chem. Biol. Interact. 167: 85 98. 11. Kao, Y. H., Hiipakka, R. A. & Liao, S. (2000) Modulation of endocrine system s and food intake by green tea epigallocatechin gallate. Endocrinology 141: 980 987. 12. Wolfram, S., Raederstorff, D., Preller, M., Wang, Y., Teixeira, S. R., Riegger, C. & Weber, P. (2006) Epigallocatechin gallate supplementation alleviates diabetes i n rodents. J. Nutr. 136: 2512 2518.

PAGE 58

58 13. Broadhurst, C. L., Polansky, M. M. & Anderson, R. A. (2000) Insulin like biological activity of culinary and medicinal plant aqueous extracts in vitro. J. Agric. Food Chem. 48: 849 852. 14. Hsu, C. H., Tsai, T. H ., Kao, Y. H., Hwang, K. C., Tseng, T. Y. & Chou, P. (2008) Effect of green tea extract on obese women: a randomized, double blind, placebo controlled clinical trial. Clin. Nutr. 27: 363 370 15. Shimada, M., Mochizuki, K., Sakurai, N. & Goda, T. (2007) Dietary supplementation with epigallocatechin gallate elevates levels of circulating adiponectin in non obese type 2 diabetic Goto Kakizaki rats. Biosci. Biotechnol. Biochem. 71: 2079 2082 16. Cho SY, Park PJ, Shin HJ, et al. ( ) Catechin s uppresses expression of Kruppe like factor 7 and increases expression and secretion of adiponectin protein in 3T3 L1 cells. Am J Physiol Endocrinol Metab 2007; 292:E1166 72 17. Farag YM, Gaballa MR. Diabesity: an overview of a rising epidemic. Nephrol Di al Transplant. 18. Report of the expert committee on the diagnosis and classification of diabetes mellitus. Diabetes Care 2003 ; 26 Suppl 1:S5 20. 19. Scherer PE. Adipose tissue: from lipid storage compartment to endocrine organ. Diabetes 2006 ; 55:1537 45. 20. Rajala MW, Scherer PE. Minireview: The adipocyte at the crossroads of energy homeostasis, inflammation, and atherosclerosis. Endocrinology 2003 ; 144:3765 73. 21. Musi N, Goodyear LJ. Insulin resistance and improvements in signal transduction. Endocrine 2006 ; 29:73 80 22. Kahn SE, Hull RL, Utzschneider KM. Mechanisms linking obesity to insulin resistance and type 2 diabetes Nature 2006 ; 444:840 6. 23. Heilbronn LK, Smith SR, Ravussin E. The insulin sensitizing role of the fat derived hormon e adiponectin Curr Pharm Des 2003 ; 9:1411 8. 2 4 Scherer PE, Williams S, Fogliano M, Baldini G, Lodish HF. A novel serum protein s imilar to C1q, produced exclusively in adipocytes. J Biol Chem 1995 ; 270:26746 9. 2 5 Hu E, Liang P, Spiegelman BM. ADIPOQ is a novel adipose specific gene dysregulated in obesity. J Biol Chem 1996 ; 271:10697 703.

PAGE 59

59 2 6 Maeda K, Okubo K, Shimomura I, Funahashi T, Matsuzawa Y, Matsubara K. cDNA cloning and expression of a novel adipose specific collagen like factor, apM1 (AdiPose Most abundant Gene transcript 1). Biochem Biophys Res Commun 1996 ; 221:286 9. 2 7 Nakano Y, Tobe T, Choi Miura NH, Mazda T, Tomita M. Isolation and characterization of GBP28, a novel gelatin binding protein purified from human plasma. J Biochem 1996 ; 120:803 12 2 8 Trujillo ME, Scherer PE. Adiponectin journey from an adipocyte secretory protein to biomarker of the metabolic syndrome. J Intern Med 2005;257:167 75. 29. Kim JY, van de Wall E, Laplante M, et al. Obesity associated improvemen ts in metabolic profile through expansion of adipose tissue. J Clin Invest 2007 ; 117:2621 37. 30. Chandran M, Phillips SA, Ciaraldi T, Henry RR. Adiponectin : more than just another fat cell hormone? Diabetes Care 2003;26:2442 50. 31. Kusminski CM, S cherer PE. The road from discovery to clinic: adiponectin as a biomarker of metabolic status. Clin Pharmacol Ther 2009;86:592 5. 32. Ma K, Cabrero A, Saha PK, et al. Increased beta oxidation but no insulin resistance or glucose intolerance in mice lacking adiponectin J Biol Chem 2002 ; 277:34658 61. 33. Yu JG, Javorschi S, Hevener AL, et al. The effect of thiazolidinediones on plasma adiponectin levels in normal, obese, and type 2 diabetic subjects. Diabetes 2002 ; 51:2968 74. 34. Fantuzzi G. Adiponectin and inflammation: consensus and controversy. J Allergy Clin Immunol 2008; 121:326 30. 35. Galic S, Oakhill JS, Steinberg GR. Adipose tissue as an endocrine organ. Mol Cell Endocrinol ; 316:129 39. 36. Wang ZV, Scherer PE. Adiponectin ca rdiovascular function, and hypertension. Hypertension 2008; 51:8 14. 37. Kelesidis I, Kelesidis T, Mantzoros CS. Adiponectin and cancer: a systematic review. Br J Cancer 2006; 94:1221 5. 38. Atzmon G, Pollin TI, Crandall J, et al. Adiponectin leve ls and genotype: a potential regulator of life span in humans. J Gerontol A Biol Sci Med Sci 2008 ; 63:447 53.

PAGE 60

60 39. Asterholm IW, Scherer PE. Enhanced metabolic flexibility associated with elevated adiponectin levels. Am J Pathol; 176:1364 76. 40. Halber g N, Schraw TD, Wang ZV, et al. Systemic fate of the adipocyte derived factor adiponectin Diabetes 2009 ; 58:1961 70. 41. Lihn AS, Pedersen SB, Richelsen B. Adiponectin : action, regulation and association to insulin sensitivity. Obes Rev 2005 ; 6:1 3 21. 42. Menzaghi C, Trischitta V, Doria A. Genetic influences of adiponectin on insulin resistance, type 2 diabetes and cardiovascular disease. Diabetes 2007; 56:1198 209 43. Rasmussen MS, Lihn AS, Pedersen SB, Bruun JM, Rasmussen M, Richelsen B. Adiponectin receptors in human adipose tissue: effects of obesity, weight loss, and fat depots. Obesity (Silver Spring) 2006; 14:28 35 44. Combs TP, Berg AH, Rajala MW, et al. Sexual differentiation, pregnancy, calorie restriction, and aging aff ect the adipocyte specific secretory protein adiponectin Diabetes 2003 ; 52:268 76. 45. Nishizawa H, Shimomura I, Kishida K, et al. Androgens decrease plasma adiponectin an insulin sensitizing adipocyte derived protein. Diabetes 2002 ; 51:2734 41 46 kinase signaling pathway leads to decreased insulin stimulated adiponectin secretion from 3T3 L1 adipocytes. Metabolism 2005; 54:1636 43. 47. Yamauchi T, Kamon J, Ito Y, et al. Clon ing of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 2003 ; 423:762 9. 48. Kadowaki T, Yamauchi T, Kubota N, Hara K, Ueki K, Tobe K. Adiponectin and adiponectin receptors in insulin resistance, diabetes and the metabolic syndr ome. J Clin Invest 2006; 116:1784 92 49. White MF. IRS proteins and the common path to diabetes Am J Physiol Endocrinol Metab 2002 ; 283:E413 22. 50. Fantuzzi G. Adipose tissue, adipokines, and inflammation. J Allergy Clin Immunol 2005 ; 115:911 9; qui z 920. 51. Yamauchi T, Kamon J, Waki H, et al. The fat derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat Med 2001 ; 7:941 6.

PAGE 61

61 52. Berg AH, Combs TP, Du X, Brownlee M, Scherer PE. The adipocyte secreted protein Acrp30 enhances hepatic insulin action. Nat Med 2001; 7:947 53. 53. Fu Y, Luo N, Klein RL, Garvey WT. Adiponectin promotes adipocyte differentiation, insulin sensitivity, and lipid accumulation. J Lipid Res 2005; 46:1369 79 54. Perez Martinez P, Lopez Miranda J, Cruz Teno C, et al. Adiponectin gene variants are associated with insulin sensitivity in response to dietary fat consumption in Caucasian men. J Nutr 2008; 138:1609 14. 55. Mojiminiyi OA, Abdella NA, Al Arouj M Ben Nakhi A. Adiponectin insulin resistance and clinical expression of the metabolic syndrome in patients with Type 2 diabetes Int J Obes (Lond) 2007; 31:213 20. 56. Butt MS, Sultan MT. Green tea: nature's defense against malignancies. Crit Rev Food S ci Nutr 2009 ; 49:463 73. 57. Higdon JV, Frei B. Tea catechins and polyphenols: health effects, metabolism, and antioxidant functions. Crit Rev Food Sci Nutr 2003 ; 43:89 143. 58. Graham HN. Green tea composition, consumption, and polyphenol chemistry. Pr ev Med 1992 ; 21:334 50 59. Hong J, Lu H, Meng X, Ryu JH, Hara Y, Yang CS. Stability, cellular uptake, biotransformation, and efflux of tea polyphenol ( ) epigallocatechin 3 gallate in HT 29 human colon adenocarcinoma cells. Cancer Res 2002 ; 62:7241 6. 60. Schantz M, Erk T, Richling E. Metabolism of green tea catechins by the human small intestine. Biotechnol J ; 5:1050 9. 61. Huo C, Wan SB, Lam WH, et al. The challenge of developing green tea polyphenols as therapeutic agents. Inflammopharmacolo gy 2008 ; 16:248 62. Lin J, Della Fera MA, Baile CA. Green tea polyphenol epigallocatechin gallate inhibits adipogenesis and induces apoptosis in 3T3 L1 adipocytes. Obes Res 2005;13:982 90. 63. Wolfram S, Raederstorff D, Wang Y, Teixeira SR, Elste V, Weber P. TEAVIGO (epigallocatechin gallate) supplementation prevents obesity in rodents by reducing adipose tissue mass. Ann Nutr Metab 2005 ; 49:54 63. 64. Venables MC, Hulston CJ, Cox HR, Jeukendrup AE. Green tea extract ingestion, fat oxidation, an d glucose tolerance in healthy humans. Am J Clin Nutr 2008 ; 87:778 84.

PAGE 62

6 2 65. Queen BL, Tollefsbol TO. Polyphenols and aging. Curr Aging Sci;3:34 42 66. Khanderia U, Pop Busui R, Eagle KA. Thiazolidinediones in type 2 diabetes : a cardiology perspective. Ann Pharmacother 2008;42:1466 74 67. Bumrungpert A, Kalpravidh RW, Chuang CC, et al. Xanthones from mangosteen inhibit inflammation in human macrophages and in human adipocytes exposed to macrophage conditioned media. J Nutr ; 140:842 7. 68. Ahn J, Lee H, Kim S, Ha T. Resveratrol inhibits TNF alpha induced changes of adipokines in 3T3 L1 adipocytes. Biochem Biophys Res Commun 2007 ; 364:972 7. 69. Nagao T, Meguro S, Hase T, et al. A catechin rich beverage improves obesity and blood glucose control in patients with type 2 diabetes Obesity (Silver Spring) 2009 ; 17:310 7. 70. Sakurai N, Mochizuki K, Kameji H, Shimada M, Goda T. ( ) Epigallocatechin gallate enhances the expression of genes related to insulin sensiti vity and adipocyte differentiation in 3T3 L1 adipocytes at an early stage of differentiation. Nutrition 2009 ; 25:1047 56. 71. Ueda M, Nishiumi S, Nagayasu H, Fukuda I, Yoshida K, Ashida H. Epigallocatechin gallate promotes GLUT4 translocation in skeletal muscle. Biochem Biophys Res Commun 2008 ; 377:286 90. 72. Xu A, Wang H, Hoo RL, et al. Selective elevation of adiponectin production by the natural compounds derived from a medicinal herb alleviates insulin resistance and glucose intolerance in obe se mice. Endocrinology 2009;150:625 33. 73. Thomson MJ, Williams MG, Frost SC. Development of insulin resistance in 3T3 L1 adipocytes. J Biol Chem 1997 ; 272:7759 64. 74. Moon, H. S., Chung, C. S., Lee, H. G., Kim, T. G., Choi, Y. J. & Cho, C. S. (2007) Inhibitory effect of ( ) epigallocatechin 3 gallate on lipid accumulation of 3T3 L1 cells. Obesity. (Silver. Spring) 15: 2571 2582. 75. Hsieh CF, Tsuei YW, Liu CW, et al. Green tea epigallocatechin gallate nhibits insulin stimulation of adipocyte glucose uptake via the 67 kilodalton laminin receptor and AMP activated protein kinase pathways. Planta Med ; 76:1694 8. 76. Blumer RM, van Roomen CP, Meijer AJ, Houben Weerts JH, Sauerwein HP, Dubbelhuis PF. Regulation of adiponectin secretion by insulin and amino acids in 3T3 L1 adipocytes. Metabolism 2008 ; 57:1655 62.

PAGE 63

63 77 Kahn R. Diabetes technology now and in the future. Lancet 2009; 373:1741 3.

PAGE 64

64 BIOGRAPHICAL SKETCH Cindy Montero was born in Lima, Peru and moved to the United States when she was just 5 years old. A first generation gradua te, Cindy completed her B.S. in n utritional s ciences at the University of Florida, becoming the first person in her entire family to gree in science. As an undergraduate, Cindy worked under Dr. Susan Percival as an undergraduate researcher. Taking great interest in her field of research of adiponectin she decide d to pursue a graduate degree. In 2008, Cindy was accepted into the M.S program in n utritional s c iences at the University of Florida. She continued working under the gui dance of Dr. Susan S. Percival. After graduation Cindy intends on pursuing a doctor of philosophy in nutritional science