<%BANNER%>

The Mu Transposons of Zea Mays and Their Use in Determining Gene Function

Permanent Link: http://ufdc.ufl.edu/UFE0042533/00001

Material Information

Title: The Mu Transposons of Zea Mays and Their Use in Determining Gene Function Cellulose Synthase-Like D Genes in Plant and Cell Development
Physical Description: 1 online resource (181 p.)
Language: english
Creator: Hunter, Charles
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: cell, cellulose, cesa, csld, csld1, csld5, cytokinesis, division, element, genetics, growth, hemicellulose, maize, mays, mu, mu10, mu12, plant, synthase, teosinte, tip, transposon, transposons, wall, zea
Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Plant Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The two-fold goal of work presented here was, first, to test hypotheses for biological roles of the enigmatic Cellulose Synthase-Like D (CslD) gene family, and second, to test key aspects of a global resource for such research by examining the extent, diversity, and evolution of the maize Mutator (Mu) transposable elements. The Mu transposons comprise one of the most active mutagenic systems in plant biology, often inserting into genic regions, where they disrupt gene function. Not only is the Mu system a powerful evolutionary force, but also a valuable tool for defining biological roles of genes. Work here reveals new aspects of Mu transposon evolution and behavior by defining positions and relatedness of Mu elements in inbreds of both maize and its wild ancestor, teosinte. Results also demonstrate the diversity within both maize and teosinte, and will aid interpretations of future genetic studies. The surprisingly diverse and numerous Mu12-like elements identified here will also aid expansion of maize functional genetic resources such as that of the UniformMu maize population, used here to investigate the CslD gene family of maize. The CslD genes comprise one of the few subfamilies of the Cellulose Synthase superfamily for which biochemical activity remains unclear. The CSLD proteins have domains characteristic of beta-linked, cell-wall polysaccharide synthases, and are expected to produce a cell-wall structural component such as cellulose or a hemicellulose backbone. Plants with Mu transposon insertions in CslD5 were deficient in root hair elongation, indicating a role in tip-growing cells. Plants with insertions in CslD1 had pleiotropic phenotypes that arose from defective cell division during leaf development. This was evident in fewer cells per leaf and defects in cell size and shape at the earliest stages of leaf development. Cell files were disrupted, cell shapes and sizes were abnormal, and cross-walls between newly-divided cells were incomplete. Collectively, these data define a previously unexpected role for a cell-wall biosynthetic gene, CslD1, in cell division, where its contribution involves some aspect of cell plate formation, a process fundamental to all of plant biology.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Charles Hunter.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Koch, Karen E.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042533:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042533/00001

Material Information

Title: The Mu Transposons of Zea Mays and Their Use in Determining Gene Function Cellulose Synthase-Like D Genes in Plant and Cell Development
Physical Description: 1 online resource (181 p.)
Language: english
Creator: Hunter, Charles
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: cell, cellulose, cesa, csld, csld1, csld5, cytokinesis, division, element, genetics, growth, hemicellulose, maize, mays, mu, mu10, mu12, plant, synthase, teosinte, tip, transposon, transposons, wall, zea
Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Plant Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The two-fold goal of work presented here was, first, to test hypotheses for biological roles of the enigmatic Cellulose Synthase-Like D (CslD) gene family, and second, to test key aspects of a global resource for such research by examining the extent, diversity, and evolution of the maize Mutator (Mu) transposable elements. The Mu transposons comprise one of the most active mutagenic systems in plant biology, often inserting into genic regions, where they disrupt gene function. Not only is the Mu system a powerful evolutionary force, but also a valuable tool for defining biological roles of genes. Work here reveals new aspects of Mu transposon evolution and behavior by defining positions and relatedness of Mu elements in inbreds of both maize and its wild ancestor, teosinte. Results also demonstrate the diversity within both maize and teosinte, and will aid interpretations of future genetic studies. The surprisingly diverse and numerous Mu12-like elements identified here will also aid expansion of maize functional genetic resources such as that of the UniformMu maize population, used here to investigate the CslD gene family of maize. The CslD genes comprise one of the few subfamilies of the Cellulose Synthase superfamily for which biochemical activity remains unclear. The CSLD proteins have domains characteristic of beta-linked, cell-wall polysaccharide synthases, and are expected to produce a cell-wall structural component such as cellulose or a hemicellulose backbone. Plants with Mu transposon insertions in CslD5 were deficient in root hair elongation, indicating a role in tip-growing cells. Plants with insertions in CslD1 had pleiotropic phenotypes that arose from defective cell division during leaf development. This was evident in fewer cells per leaf and defects in cell size and shape at the earliest stages of leaf development. Cell files were disrupted, cell shapes and sizes were abnormal, and cross-walls between newly-divided cells were incomplete. Collectively, these data define a previously unexpected role for a cell-wall biosynthetic gene, CslD1, in cell division, where its contribution involves some aspect of cell plate formation, a process fundamental to all of plant biology.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Charles Hunter.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Koch, Karen E.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042533:00001


This item has the following downloads:


Full Text

PAGE 1

1 THE MU TRANSPOSONS OF ZEA MAYS AND THE IR USE IN DETERMINING GENE FUNCTION: CELLULOSE SYNTHASELIKE D GENES IN PLANT AND CELL DEVELOPMENT By CHARLES THOMAS HUNTER III A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Charles Thomas Hunter III

PAGE 3

3 To my beautiful wife, Maggie, for her always appreciated love, support, kindness and fascinating dinner time conversations!

PAGE 4

4 ACKNOWLEDGMENTS I wholeheartedly thank my lab colleagues past and present, for advice and friendship, especially Wayne Avigne, Brent OBrien, Andrea Eveland, Li Fen Huang, Christian Restrepo, Joe Col lins, Maggie Paxson, Emeka Ibekwe, and Nana Ankumah. Additionally, I thank the founders of the UniformMu maize population, including Don McCarty, Karen Koch, Mark Settles, and Curt Hannah. I thank the members of my committee, which included John Davis, Don Huber, Karen Koch, Don McCarty, Gary Peter, and Wilfred Vermerris, all of who m have provided muchappreciated input and advice. I also acknowledge and thank the faculty and staff of the University of Florida Interdisciplinary Center for Biotechnology Research ( ICBR) including Byung Ho Kang Bill Farmerie, Karen Kelley, Kim Backer Kelley, Neal Benson, David Moraga, and Savita Sha n kir. M y fullest appreciation also goes out to my co authors including Gary Peter Don McCarty, and Anne Sylvester, with whom I look forward to continued collaborations. I acknowledge and thank Bob Meeley for providing access to the Pion eer Trait Utility System in Corn ( TUSC) maize population, as well as a wonderful opportunity to experience working at Pionner Hi Bred Internati onal. I call special recognition to work done cooperatively with Christian Restrepo and Christy Gault, who contributed greatly to the characterizations of Mu transposons presented here. I acknowledge Sue Latshaw, Andrea Eveland, and Christain Restrepo for their invaluable help in developing and assisting in the 454based sequencing experiments conducted in this work. I express my deepest appreciation for my family who have always given me their love and support, including my parents, Ruthie, Charlie, Shannon, and Wayne, my brother and his wife, David and Keri Anne, and my wonderful bride, Maggie. Finally, I

PAGE 5

5 want to thank my advisor, Karen Koch, for years of encouragement and motivation, and for being an excellent scientific mentor.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 9 LIST OF FIGURES ........................................................................................................ 10 ABSTRACT ................................................................................................................... 12 CHAPTER 1 INTRODUCTION .................................................................................................... 14 2 IDENTIFICATION AND CHARACTERIZATION OF THE MU TRANSPOSONS IN VARIOUS MAIZE INBREDS AND THEIR TEOSINTE ANCESTORS ................ 19 Introduction ............................................................................................................. 19 Results .................................................................................................................... 25 Mu Insertions Identified Bioinformatically in the B73 Genome .......................... 25 Phylogenetic Relationships between the B73 Mu Transpsons ......................... 26 The B73 Inbred Contains some MuDR like Sequences ................................... 26 Mu anchored Sequencing to Identify Mu Insert Locations in Maize and Teosinte Inbreds ........................................................................................... 27 Comparative Analysis of Mu Elements and Insert Sites in Maize and Teosinte ........................................................................................................ 29 Discussion .............................................................................................................. 29 Bioinforma tic Analysis of B73 Reveals Diversity .............................................. 29 Homomorphic Versus Heteromorphic Mu Elements ......................................... 31 Some Mu10 Elements Have Full length Put ative Transposase Sequences ..... 33 Relationships Between Zea Inbreds are Highlighted by Mu Element Mapping ........................................................................................................ 34 Methods .................................................................................................................. 36 Bioinformatic Identification of Mu Elements in the B73 Maize Genome ........... 36 Phylogenetic Analysis of B73 MuTIRs ............................................................ 37 Mu flank anchored 454 Library Construction .................................................... 37 Sequence Annotation and Alignment ............................................................... 40 Accession Numbers ......................................................................................... 41 3 ANALYSIS OF THE CELLULOSE SYNTHASELIKE D GENE FAMILY IN MAIZE ..................................................................................................................... 54 Introduction ............................................................................................................. 54 Results .................................................................................................................... 57 Bioinformatic Analyses of the CslD Genes from Maize, Rice, and Arabidopsis ................................................................................................... 57

PAGE 7

7 Express ion Profiles of the Maize CslD Genes .................................................. 61 Reverse Genetic Screens for csld Mutants ...................................................... 62 Analysis of csld5 Mutants ................................................................................. 63 Root hair Transcriptome Profiling ..................................................................... 63 Discussion .............................................................................................................. 64 The CSLD Genes are Highly co nserved Among Diverse Species ................... 64 Conservation of Developmental Roles are Indicated by Phenotypic Similarities Across Taxa ................................................................................ 65 Spe cificity of Expression Argues for Strictly defined Roles for CslD Genes ..... 66 Functional CslD5 is Required for Maize Root hair Elongation .......................... 67 Methods .................................................................................................................. 70 Bioinformatic Analyses of CslD Genes from Maize, Rice, and Arabidopsis ...... 70 Phylogenetic Analyses ..................................................................................... 70 Real Time RT PCR .......................................................................................... 71 Reverse Genetic Screening .............................................................................. 72 Growth Conditions for csld5 Mutant Analyses .................................................. 72 Fixation and Sectioning .................................................................................... 72 Scanning Electron Microscopy ......................................................................... 73 Isolation of Root Hair mRNA ............................................................................ 74 Three prime Anchored 454 Sequencing ........................................................... 75 Analysis of 454generated Sequence Data ...................................................... 76 Accession Numbers ......................................................................................... 76 4 MUTATIONS OF CELLULOSE SYNTHASELIKE D1 DISRUPT CELL DIVISION AND LEAD TO A NARROW LEAF WARTY PHENOTY PE IN MAIZE ... 85 Introduction ............................................................................................................. 85 Results .................................................................................................................... 87 An Allelic Series of csld1 Mutants in Maize Enabled Functional Analysis ........ 87 Plant Dry Weight and Organ Width are Reduced in csld1 Mutants .................. 87 Epidermal Cells Balloon into Warts on csld1 Mutants ...................................... 88 Cells of csld1 Mutant Leaves are Larger, but Fewer in Number ....................... 89 Stalks of csld1 Mut ants Contain Altered Vascular Bundle Number and Cell Wall Properties .............................................................................................. 91 Cell Wall Sugar Components were not Detectably Altered by Loss of CslD1 Function ........................................................................................................ 91 Levels of Maize CslD1 mRNA are Greatest in Regions of Active Cell Division .......................................................................................................... 92 Multiple Cell Division Defects are Evident in csld1 mutant Epidermis. ............. 93 Discussion .............................................................................................................. 94 The CSLD1 Enzyme Appears to Affect a Mechanism Other than Tipgrowth .. 94 The Maize CslD1 Gene is Essential for Normal Plant Dry Weight and Organ Width ............................................................................................................. 95 Warty Cells Represent Distinctive and Informative Features of Maize csld1 Mutants ......................................................................................................... 96 Larger, Nonwarty Epidermal Cells Suggest a Limitation in Cell Division ......... 97

PAGE 8

8 Cell Walls of the csld1 Mutant are Thinner and More Dense, but of Norm al Composition .................................................................................................. 97 Maize CslD1 has a Role in Plant Cell Division ................................................. 99 Broader Perspectives ..................................................................................... 101 Methods ................................................................................................................ 103 Identification of csld1 Mutants ........................................................................ 103 Overall Phenotypic Analyses and Size Measurements .................................. 104 Cell Volume Estimates ................................................................................... 105 Epidermal Impressions and Nonwarty Cell Size Determination .................... 105 Tissue Fixation and Sectioning ....................................................................... 105 Scanning Electron Microscopy ....................................................................... 106 Phloroglucinol Staining and Stal k Measurements .......................................... 107 High resolution X ray Micro Computed Tomography Analysis ....................... 107 Epidermal Isolation ......................................................................................... 108 Cell Wall Composition Analysis ...................................................................... 108 Real Time Quantitative RT PCR .................................................................... 109 Propidium Iodide St aining ............................................................................... 110 Flow Cytometry .............................................................................................. 110 5 CONCLUSIONS AND FUTURE DIRECTIONS .................................................... 128 APPENDIX .................................................................................................................. 131 LIST OF REFERENCES ............................................................................................. 168 BIOGRAPHICAL SKETCH .......................................................................................... 181

PAGE 9

9 LIST OF TABLES Table page 2 1 Bioinformatically identified Mu elements in B73 ................................................. 42 2 2 Classification of canonical B73 Mu insertions. .................................................... 43 2 3 Mu elements identified by Muflank sequencing in three maize inbreds ............. 44 2 4 Mu elements identified by Muflank sequencing in five teosinte inbreds ............ 45 2 5 Primers used for 454based Muflank sequencing. ............................................ 46 3 1 Three primeanchored 454sequencing transcript profiles. ................................ 77 3 2 PCR primers utilized in Chapter 3. ..................................................................... 77 4 1 Cell wall composition of wholeleaf blades and epidermal peels fro m csld1 mutant and nonmutant plants. ......................................................................... 112

PAGE 10

10 LIST OF FIGURES Figure page 2 1 E xample of a sequential mining track of the B73 genome .................................. 47 2 2 Neighbor joining tree of 299 B73 Mu Terminal Inverted Reapeats ..................... 48 2 3 Comparison between MuDR and a Mu10 (Mu4K) element from the B73 maize inbred. ...................................................................................................... 49 2 4 Estimated proportions of each Mu class in three maize inbreds and teosinte derived from the Balsas and Jalisco regions of Mexico. ..................................... 50 2 5 Approximate map sites for Mu insertions in three maize inbreds ........................ 51 2 6 Approximate map sites for Mu insert ions in five teosinte inbreds ....................... 52 2 7 Diagramatic representation of Muflank 454 s equencing library preparation. ..... 53 3 1 Cellulose synthaselike D ( CslD) genes from Arabidopsis, maize, an d rice ....... 78 3 2 Cellulose synthaselike D proteins from Arabidopsis, maize, and rice ................ 79 3 3 Protein sequence alignment and analy sis of conserved motifs .......................... 80 3 4 Comparison of mutant phenot ypes to CSLD protein phylogeny ......................... 81 3 5 Quantitative RT PCR showing mRNA levels of the maize CslD genes .............. 82 3 6 The root hair phenotype caused by mutation of CslD5 ....................................... 83 3 7 Transcri pt profiles of maize root hairs ................................................................. 84 4 1 Gene diagram of Zm CslD1 and location of each of the Mu insertions identified. .......................................................................................................... 113 4 2 Morphology and dry weight of the csld1 1 mutant. ........................................... 114 4 3 The narrow leaf phenotype of csld1 1 mutant plants. ....................................... 115 4 4 Leaf blade curling in csld1 mutants .................................................................. 116 4 5 The warty phenotype of csld1 mutant leaf blades ............................................. 117 4 6 SEM of csld1 mutant and wildtype leaves ........................................................ 118 4 7 Size estimates for epidermal cells of inter lesion regions on csld1 muta nt and nonmutant leaf blades. .................................................................................... 119

PAGE 11

11 4 8 Internal struct ure of csld1 muta nt and nonmutant leaf blades. ....................... 120 4 9 Internal structure of csld1 mutant and nonmutant stems ................................. 121 4 10 Hig h resolution X ray micro computed tomography analysis of csld1 and wildtype stalks .................................................................................................. 122 4 11 Levels of Zm CslD1 mRNA in diverse tissues from wild type plants of the W22 inbred. .............................................................................................................. 123 4 12 Mature csld1 mutant and nonmutant epidermis revealed apparent defects in cell division. ...................................................................................................... 124 4 13 Confocal images showing defects early in development of csld1 mutant leaf epidermis .......................................................................................................... 125 4 14 Nuclei of immature csld1 mutant and nonmutant epidermis ............................ 126 4 15 Is olation of maize leaf epidermis ...................................................................... 127

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE MU TRANSPOSONS OF ZEA MAYS AND THE IR USE IN DETERMINING GENE FUNCTION: CELLULOSE SYNTHASELIKE D GENES IN PLANT AND CELL DEVELOPMENT By Charles Thomas Hunter III December 2010 Chair: Karen Koch Major: Plant Molecular and Cellular Biology The t wo fold goal of work presented here was first, to test hypotheses for biological roles of the enigmatic Cellulose SynthaseLike D ( CslD) gene family and second, to test key aspects of a global resource for such research by examining the extent, diversity and evolution of the maize Mutator (Mu) transposable elements The Mu transposons comprise one of the most active mutagenic systems in plant biology, often insert ing into genic regions, where they disrupt gene function. Not only is the Mu system a powe rful evolutionary force, but also a valuable tool for defining biological roles of genes Work here reveals new aspects of Mu transposon evolution and behavior by defining p ositions and relatedness of Mu elements in inbreds of both maize a nd its wild ancestor, teosinte. Results also demonstrate the diversit y within both maize and teosinte, and will aid interpretations of future genetic studies. The s urprisingly diverse and numerous Mu12like elements identified here will also aid expansion of maize funct ional genetic resources such as that of the UniformMu maize population, used here to investigate the C sl D gene family of maize. The CslD genes comprise one

PAGE 13

13 of the few subfamilies of the Cellulose Synthase superfamily for which biochemical activity remains unclear The CSLD proteins have linked cellwall polysaccharide synthases, and are expected to produce a cell wall structural compo nent such as cellulose or a hemicellulose backbone. Plants with Mu transposon insertions in C slD5 were deficient in root hair elongation, indicating a role in tip growing cells P lants with insertions in CslD1 had pleiotropic phenotypes that ar o se from defective cell division during leaf development This was evident in fewer cells per leaf and defects in cell size and shape at the earliest stages of leaf development. Cell files were disrupted, cell shapes and sizes were abnormal, and cross walls between newly divided cells were incomplete. Collectively, these data define a previo usly unexpected role for a cell wall biosynthet ic gene, CslD1 in cell division where its contribution involves some aspect of cell plate formation a process fundamental to all of plant biology.

PAGE 14

14 CHAPTER 1 INTRODUCTION Cell walls provide protection and structural support for whole plants and indi vidual cells. It is through the modification and biosynthesis of cell wall s that plant cells grow and their ultimate shapes are determined Cell walls are also critically important for many aspects of human life, from nutrition to raw materials and indus trial feedstocks. T hey represent the most abundant renewable resource on the planet (Pauly and Keegstra, 2008) and have received much recent attention as sources of transportation fuel in the form of cellulosic ethanol (reviewed by Schubert, 2006 and Sti cklen, 2008) Despite their central importance to plant biology and human needs, the manner in which plant cell walls are synthesized and regulated remains poorly understood. In all plant cell walls, cellulose is the major loadbearing molecule. It is composed (1,4) linked Dglucan chains, and is produced at the plasma membrane via multisubunit protein complexes called rosettes (Kimura et al., 1999; Delmer, 1999). Within rosettes, Cellulose Synthase (CESA) proteins operate as processive gl ycosyl transferases that catalyze formation of individual cellulose glucan chains (Pear et al., 1996; Arioli et al., 1998). Collective action of CESA proteins as subunits of multi protein complexes (rosettes) result in large multi chain cellulose microfibrils. These cellulose microfibrils are embedded in a matrix of crosslinking hemicelluloses (noncellulosic polysaccharides composed of diverse other sugars), pectins, and cell wall proteins (McCann et al., 1990; Carpita and Gibeaut, 1993; McCann and Rober ts, 1994; Willats et al., 2001). Hemicelluloses include the glucan s, xylan s, and mannans The various forms of these polysaccharides are made up of at least fourteen different monosaccharides

PAGE 15

15 joined by diverse glycosidic bonds (Scheible and Pauly, 2004) Hemicelluloses are typically highly substituted with various sugar sidechains, potentially associated with a multitude of biological functions yet to be identified (Coutinho et al, 2003). Assembly of these hemicelluloses requires a massive host of enzy mes (Sheible and Pauly, 2004; Coutinho et al., 2003). Resulting structures indicate that any of the m could interact with cellulose via noncovalent bonds and they are thus considered likely modulators of cell wall structural properties (Carpita, 1996; Cosgrove, 2005). Hemicelluloses are normally produced in the Golgi apparatus (Delmer and Stone, 1988). In addition to their potential roles in moderating cell wall properties and growth dynamics, hemicelluloses can also serve as energy storage molecules, a nd commonly do so in developing seeds of diverse species. For example, nasturtium seeds store xyloglucan (Edwards et al., 1985) and galactomannans are common in legume seeds like guar and fenugreek (Reid, 1993; Dhugga et al., 2004). Finally, hemicelluloses, or fragments derived from them, can play major roles in intercellular signaling and in regulating responses to external stimuli (McDougall and Fry, 1990; Takeda et al., 2002; Pilling and Hfte, 2003). Cell wall composition can vary markedly among plant species and between different tissues in a single plant (Popper and Fry, 2003; Lynch and Staehelin, 1995) One major taxonomic division within flowering plants lies between the commelenoid monocots (including maize, other grasses bromeliads, and ginger s), and noncommelonoid monocots (lilies, orchids, and most others) Commelenoids have a distinctive Type II cell wall, whereas other flowering plants have Type I cell walls (Harris and Hartley, 1980; Carpita and Gibeaut, 1993). This difference is charac terized by major qualitative contrasts between the two types of primary cell wall (Carpita, 1996). In

PAGE 16

16 Type I cell walls, the major polymer that interlinks cellulose microfibrils is xyloglucan (Hayashi et al., 1989; Redgwell and Selvendran, 1986), whereas in Type II cell walls, this role is filled by feruloylated glucuronoarabinoxylans (GAX) (Gubler et al., 1985; Carpita, 1996). Also, the Type I cell walls of cereals and other grasses ( poaceae) contain abundant (1,3),(1,4) mixedlinkage -Dglucans (Carpita, 1996; Smith and Harris, 1999), hypothesized to aid wall loosening during cell elongation by interacting with and influencing properties of GAX molecules (Buckeridge et al., 2004). In addition, Type I cell wall structure includes di verse and abundant pectins (Jarvis et al., 1988; Jarvis, 1994), compared to Type II cell walls, which instead, feature prominent phenolics such as hydroxycinnamates (Harris and Hartley, 1980; Iiyama et al., 1990; Rudall and Caddick, 1994). M ajor qualitat ive differences in cell wall composition are also commonly observed between even closely related plant species. For instance, the relative proportions of cellulose, hemicelluloses, and lignin differ dramatically between rice straw and wheat straw ( Lynd et al., 1999 ; Jin and Chen, 2007; Pauly and Keegstra, 2008). Additionally, cell wall composition can change radically during growth of individual tissues In maize coleoptiles, for example, mixed linkage glucans can accumulate to high levels during elongat ion (up to a third of total hemicelluloses), then drop to less than detectable quantities as the tissue matures ( Meier and Reid, 1982; Carpita, 1984; Gibeaut and Carpita, 1993; Kim et al., 2000; Carpita et al., 2001; Derbyshire et al., 2007). Indeed, wall composition can vary around a single cell such as in trichoblast s in Arabidopsis roots where distinct cellwall microdomains lead to specific areas w ith unique properties (Freshour et al., 1996). The wide range of plant cell wall compositions, growthr ates,

PAGE 17

17 and chemical properties reveal the complex and highly regulated nature of their biosynthesis (Zhong and Ye, 2007). With major differences between diverse cell walls, more than a single model species will be needed to fully elucidate the biosynthesis and function of this important plant cell component. In addition to its position as one of the worlds most agriculturally important crop species, m aize provides an excellent model species for genetic studies Its genome is essentially diploid, its gener ation time is relatively short, the male and female flowers are easily isolated and the large seeds are amenable to long term storage. The amount of diversity represented within the various maize lines is extensive, and has been instrumental to developing the productivity and versatility of modern domesticated varieties ( Duvick, 2002; Wei et al., 2007; Gore et al., 2009; Springer et al., 2009; Schnable et al., 2009). Despite the large size of its genome (approximately 2.3 gigabases with over 32,000 genes [Schnable et al., 2009]), genetic studies in maize have proven successful ( McCarty et al., 1989; McCarty et al., 2005 ; McCarty and Meeley, 2009). T he availability of numerous genetic resources, including the large Activator populations ( Kolkman et al., 2005 ; Bai et al., 2007), the TILLING project (Targeting Induced Local Lesions IN Genomes) (Weil and Monde, 2007), the mapped recombinant inbred lines like the Intermated B73 x Mo17 ( IBM ) population (Lee et al., 2002), the Nested Association Mapping ( NAM ) lines (Yu et al., 2008), and various Mutator based insertional mutation collections (see below) make maize an attractive species for genetic studies and a good candidate for a model species in the economically important grasses

PAGE 18

18 Transposon mutagenesis in maize has been an invaluable tool for elucidating gene function, allowing roles for genes of interest to be examined individually in loss of function mutants ( Walbot, 2000; Carpita and McCann, 2002; Brutnell, 2002; McCarty et al., 2005; Settles et al., 2007) Transposable elements (TEs) are DNA sequences that can physically change positions within the genome, or replicate themselves (and other TEs), generating copies for insertion elsewhere (Chandler, 1992). All together, transposonderived sequences make u p a large portion of most eukaryotic genomes, comprising about 85% of the maize genome (Schnable et al., 2009) Transposable elements are also a major driving force of genome restructuring and evolution (Wessler, 2001). When a TE inserts into or near a r egion of DNA that codes for an RNA, the sequence disruption typically (but not always) leads to loss of that RNAs function (Chandler 1992), allowing researchers to elucidate gene functions by observing plants in which single gene disruptions have occurred (Brutnell 2002) Transposon mutagenesis provides an avenue for dissecting complex and poorly understood biological processes such as the biosynthesis and regulation of plant cell walls, on a geneby gene basis

PAGE 19

19 CHAPTER 2 IDENTIFICATION AND CHARACTERIZATION OF THE MU TRANSPOSONS IN VARIOUS MAIZE INBREDS AND THEIR TEOSINTE A NCESTORS Introduction Transposons were discovered in the 1940s by Barbara McClintock whos studies in maize first defined the concept of small genetic elements that couls physically move (or transpose) within a genome (McClintock, 1947). These transposons could excise from one location and reinsert essentially anywhere in the DNA of an organism, leading to them being coined jumping genes by the popular press. Transposons can also replicat e during transposition and often lead to natural mutations when they insert into otherwise functional genes. Following discovery of transposons, the Robertsons M utator (Mu) transposable elements were identified as a particularly interest ing system with high transposition rates that often led to unstable mutations ( Robertson 1978). Since then, Mu elements have become perhaps the most widely utilized tool for genetic studies in maize ( McCarty et al., 1989; McCarty et al., 2005; Settles et al., 2007) These elements make up a large, diverse family characterized by highly conserved, terminal inverted repeat (TIR) sequences about 215 nucleotides long positioned at each termini and oriented in opposite directions (Brutnell, 2002) The TIR s equences are critical for transposon functionality, as they contain the binding sites for the transposase enzyme that catalyzes transposition ( Raizada and Walbot, 2000; Lisch, 2002). When a Mu transposon inserts into a g i ven site, a 9 bp target site dupli cation (TSD) occurs, and when a Mu excises, it typically leaves this 9 bp TSD footprint ( Barker et al., 1984; Schnable et al., 1989 ; Creese et al., 1995).

PAGE 20

20 The transposase enzyme is coded for by genes contained in th e autonomous Mu element in maize, MuDR which, in addition to its TIRs, contains two genes, mudrA and mudrB which code for enzymes MURA and MURB thought to function together as a transposase ( Chomet et al., 1991; Lisch, 2002). This transposase is considered to be responsible for the transposition of both autonomous and nonautonomous Mu elements N onautonomous Mu elements typically far outnumber autonomous ones ( Dietrich et al., 2002; Liu et al., 2009). Nonautonomous elements contain conserved TIRs, but their internal sequences are typicall y highly diverse, nonfunctional fragments, apparently derived from captured host sequences (Lisch, 2002). The wide variety of Mu elements in maize have been grouped into 1 2 classes (Mu1 through Mu12) based on order of discovery and sequence similarity (D ietrich et al., 2002). The class originally designated as Mu9 is now known to include the autonomous MuDR element with its functional transposase encoding genes ( Hershberger et al., 1991; Walbot and Rudenko, 2002; ). Previous data indicated that Mus 19 represented the majority of transposition activity ( Dietrich et al., 2002; Liu et al., 2009) and these have c lassically been used in transposontagging studies The Mu1 9 classes also all have similar enough TIR sequences to be amenable to a single set o f molecular tools ( such as PCR prime rs), unlike the Mu10 and Mu12 classes The numbers and locations of Mu elements can vary widely among maize lines, changing with MuDR activity and genetic background. However, previous estimates have suggested around 50 100 Mu elements in stable maize inbreds (Liu et al., 2009). Mu elements have a high rate of forward mutation when an active MuDR is present and commonly occur in very high copy numbers in those lines (Brutnell, 2002) Indeed, the

PAGE 21

21 Mu transposons are th e most active of all DNA transposons currently known in plants (Alleman and Freeling, 1986; Lisch, 2002). Mu transposons exhibit a trans genetic mode of action (Lisch et al., 1995; Settles et al., 2004), unlike other T Es (such as the Ac/Ds system) which sh ow tendenc ies for transposition into linked site (Brutnell, 2002). Mutator elements do however preferentially insert into genic sequences (Cresse et al., 1995; Fernandes et al., 2004; Settles et al., 2004; Liu et al., 2009 ; Vollbrecht et al., 2010) and typically in to 5 ` regions of genes (Dietrich et al., 2002; Liu et al., 2009) The prevalence of inserts in these targets increas es the likelihood of loss of function mutations. Mutator transposons reportedly also show some degree of sequencedependent preference for insertion sites ( Creese et al., 1995; Dietrich et al., 2002) although these elements are generally regarded as having the potential to insert anywhere in the genome, regardless of their starting positions These characteristics make Mu tra nsposons ideal for genetic resources aimed at identifying a broad array of unique insertion sites Several largescale mutagenesis programs have successfully employed Mutator to identify transposon induced mutations in genes of maize. The most prominent include the Trait Utility System in Corn (TUSC) program developed at Pioneer Hi Bred International Inc (Bensen et al., 1995; Meeley and Briggs, 1995; McCarty and Meeley, 2009), the Maize Targeted Mutagenesis (MTM) effort, at Cold Spring Harbor Laboratories (May et al., 2003 ; Slotkin et al., 2003 ), the RescueMu resource developed at Stanford University (Walbot, 2000; Raizada et al., 2001), and the UniformMu population developed at the University of Florida (Yong et al., 2005; McCarty et al., 2005; Settles e t al., 2007).

PAGE 22

22 The UniformMu population (U niversity of Florida) was generated by introgressing a Mutator active line (Robertsons Mutator with acive MuDRs and a bronze1mutable [ bz1 mum9 ] color marker) into the isogenic W22 inbred line (McCarty et al., 2005). Presence of the bz1 mum9 gene results in a spotted aleurone for MuDR active seeds, providing an easily selectable marker for MuDR activity (Chomet et al., 1991). Repeated backcrosses of UniformMu plants to their W22, wildtype parents allows the popul ation to be maintained with a highly uniform background and a steady mutation frequency. This strategy also prevents build up of parental Mu insertions to an undesirable level and helps assure that new mutations comprise a significant port ion of the total Mu inserts in each generation (McCarty et al., 2005). A database of detailed pedigrees for thousands of lines also allows researchers to trace the ancestry of families of interest. Together, these result in the UniformMu population being i deal for genet ic studies, with i) a high and steady transposition rate, ii) a relatively low number of mutations per line, iii) a uniform background for phenotypic comparisons, iv) a traceable pedigree for each plant, and v) an easily selectable marker for MuDR activity Nonheritable, somatic transpositions are avoided by exclusively selecting stable, nonmutagenic seeds that lack an active MuDR transposase. These Mu off kernels are identified by their bronze kernels not displaying a spotted aleurone and are used in reverse genetic projects. R elease of the maize genome (B73 inbred) (Schnable et al., 2009), allowed the use of the highly conserved TIR sequences from Mu elements to be identified bioinformatic ally (reported here) Additionally, PCR primers were designed that anneal to the highly conserved TIR sequences and extend outward from either end of a given

PAGE 23

23 Mu element. This approach has previously been widely successful in identifying gene mutation sites via either forward genetic screens (using non specific, deg enerate primers ) (Settles et al., 2004) or reverse genetic screens (using genespecific primers ) ( Bensen et al., 1995; Meeley and Briggs, 1995; Penning et al., 2009; McCarty and Meeley, 2009) More recently, sequencing approaches have become feasible, wi th the advent of cost effective, high throughput sequencng technologies (from 454 [Margulies et al., 2005] to Illumina [ www.illumina.com ] and S olid [ Smith et al., 2010]). T ransposon insert ion sites can be sequenced (again using TIR specific and random pr im ers ) in large numbers of mutants from mutagenic populations such as UniformMu ( McCarty et al., 2005). It is now possible, by taking advantage of the properties and behavior of Mu transposons, to generate resources comparable to the highly successful T DNA insertional mutant lines f or Arabidopsis The latter have provided an invaluable resource for genetic and functional analyses in that model species (Alonso et al., 2003). D omestication of maize began approximately 10,000 years ago, and began the diver gence of this crop species from i ts wild ancestor teosinte ( reviewed by Doebley, 2004). Data indicate that t he origin of current day maize traces back to a South Central region of Mexico, the Balsas River region home of the parviglumis subspecies of teo sinte ( Matsuoka et al., 2002 ; Fukunaga et al., 2005 ). Doebley and coworkers ( Iowa State University ) have isolated varieties of teosinte parviglumis from both Balsas and Jalisco regions and used these to generate a number of teosinte inbred lines (TIL) Five of them, designated TIL 1, TIL 11, TIL 14, TIL 15, and TIL17 have been used in the

PAGE 24

24 present study. The TIL 1 TIL 15 and TIL 17 inbreds originated from the Balsas region, whereas TIL 11 and TIL14 originated from the Jalisco region. M aize breeders h ave developed elite inbreds as powerful tools to create commercial hybrids based on maximal combining ability of the parents. The resulting heterosis, or hybrid vigor, is fundamental to the yield potential achieved for maize, and for the uniformity with in crop stands ( reviewed by Lippman and Zamir, 2007; Springer and Stupar, 2007) Maize inbreds have thus been widely studied from applied to basic levels, with classic lines including B73 ( Iowa ), Mo17 (Missouri), and W22 (Wisconsin). By indentifying the Mu transposons from various maize inbreds, differences between the inbreds can be highlighted, as well as their relatedness to one another. The contribution of Mu transposons to diversity between maize inbreds and between maize and teosinte has potential to be large given their elevated activity in some lines, their high affinity for genic sequences, their capacity for gene disruption, and their abundance. Here the location and classification of the majority of Mu transposons in B73, W22, Mo17 as well as five inbred teosinte lines derived from two distinct regions of Mexico are reported. In addition to the most commonly studied canonical Mu elements (Mu1Mu9), the Mu10 Mu11, and Mu12 elements have been identified and mapped to the B73 reference ge nome. Interestingly, Mu12like elements comprised the majority of all Mu elements, and represent a diverse family of Mu transposons with a previously unrecognized variability and abundance in diverse maize and teosinte inbreds. The original convention of classifying Mu element s as Mu1 Mu12 based on sequence identity has become challenging in the face of the extensive diversity a mong

PAGE 25

25 Mu elements identified in the B73 genome. F ulllength sequences of the 179 Mu elements identified here showed that t he most of them did not match any of the previously described Mu classes, especially when considering t he Mu10, Mu11, and Mu12 groups We suggest here, based on abundance and diversity of internal sequence for these elements, that the Mu10s, Mu11s, and Mu12s each comprise entire classes of elements separate from the Mu19 group. T hese analyses thus allow Mu elements to be grouped into one of four Mu subfamilies based on their distinct TIR sequences The canonical Mus include Mu1Mu9 (and others with highly si milar TIR sequences), the Mu10 and Mu12 groups refer to elements with TIR sequences most closely match ing the previously described Mu10 and Mu12 TIRs reported by Dietrich et al.(2002), and the Mu11 group includes inserts with one TIR being similar Mu10 and the other TIR being similar to the canonicals. Results Mu I nsertions I dentified B ioinformatically in the B73 G enome To explore and capture the diverse sequences of Mu transposons in the B73 inbred, its genome (version 2, release 4a.53 ) (maizesequence.or g) was examined via sequential BLAST analyses using the terminal 150 bp of TIR sequences first from previously identified Mu elements then using the most divergent Mu sequences obtained from prior analyses (Fig. 2 1). E ach new TIR identified this way wa s used to build a MuTIR database that included genome location and Mu sequence, and which was used to select the most divergent TIRs as queries for each additional BLAST analys i s. Nov el TIR sequences continued to be identified until searches yielded no u nique results. Using this approach, 300 TIR sequences were identified in the B73 genome, corresponding to 179 unique Mu insertions (Table 1) Of these, 25 were

PAGE 26

26 canonical Mus (Mu1Mu9), 17 were classified as Mu10s, 10 were classified as Mu11s and 127 were classified as Mu12s (Table 1). T wo distinct oppositely oriented TIRs were identified for only 76.25% of these elements, suggesting either the degradation of TIR sequence through mutation (and thus some TIRs not being recognized in BLAST based searc hes) or the absence of some TIRs from the current genome due to gaps or anomalous arrangements in the B73 genom e (assembly in progess) Phylogenetic R elationships b etween the B73 Mu T ranspsons Phylogenetic analyses using 150 bp of each TIR sequence ident ified through BLAST analysis of the B73 genome revealed the diversity of Mu elements (Fig. 2 2 ). As expected, the distinct classes of Mu elements grouped into mutually exclusive groups according to their TIRs with the canonical Mus (1 9) Mu10s, and Mu12s each occupying their own positions in the phylogenetic tree (Fig. 2 2 ) and with Mu11s grouping with both the canonicals and Mu10s Often, the two arms of a single Mu insert had divergent sequences and thus grouped in different sub clades (Fig. 2 2 ) This degree of asymmetry was counter to expectations and is thought to be atypical of transposons ( Brutnell, 2002; Lisch, 2002) T hese elements with divergent TIRs have been termed heteromorphic Mu elements, of which there appear to be at least five independent groups in B73, including the Mu11s. The B73 Inbred Contains some MuDR like Sequences Being a stable inbred line, B73 is not expected to contain the autonomous MuDR transposase, and no exact matches to the published MuDR sequence were detected in our analyses (Table 22) However, some of the Mu elements in B73 have very high similar ity to MuDR and are likely MuDR derivatives. None of these MuDR like, canonical Mus appear to have retained the capacity to encode functional proteins since

PAGE 27

27 their putative mudra and mudrb coding sequences included mutations that would lead to premature stop codons or contained large deletions. Interestingly, many of the Mu10 elements identified in B73 had internal sequence very similar to MuDR, but divergent TIRs Although most of the mudra and mudrb coding sequences of the se Mu10s were disrupted, at least one appeared to be intact (Fig. 2 3). This Mu10, designated Mu 4K in these analyses, included full length sequences apparently cabable of encoding both MURA like and MURB like proteins (Fig. 2 3). Normal intronexon borders were intact and, if p rocessed would lead to translation of proteins highly similar to MURA and MURB (Fig. 2 3). These putative proteins would be 82% and 79% identical at the amino acid lev el to MURA and MURB, respectively (Fig. 23). Mu anchored Sequencing to I dentify Mu I nsert L ocations in Maize and Teosinte I nbreds Over 43,000 reads were obtained from 454based sequencing of thirty independent libraries, each constructed using anchor prim ers to one of the three classes of Mu elements (canonicals, Mu10s, and Mu12s) in one of the ten Zea mays inbreds examined (3 maize and 5 teosinte) ( Appendix A ). From the resulting reads 15,348 Mu insert sites were identified by aligning Mu flanking seque nce s with the B73 genome. Among these mapped inserts, two flanks were identified for between 2050 % for most libraries thus we estimate that these data represents an average of approximately 2560% coverage of the total Mu inserts in these inbreds. Comp lete appraisal of the Mu inserts by these methods is not currently feasible due to degeneration of TIR sequence and PCRbased variation, though deeper sequencing will provide greater coverage.

PAGE 28

28 R esults from Mu TIR anchored sequencing of the three maize inbr eds ( B73, Mo17, and W22) are summarized in Table 23 and those fr om the five teosinte lines are summarized in Table 2 4 All reads from each library were mapped to the B73 reference genome as noted above. Of the current day maize Inbred s, Mo17 contained the highest numbers of all three classes of Mu transposons (Table 23 ). F or the five teosinte inbred lines, the results were more variable, with T IL 11 having the most canonical Mus and T IL 17 having the most Mu12like elements (Table 24 ) Reads that originated from opposite arms of the same Mu insertion (one from each TIR) were determined as such by examining their proximity on the reference genome and by the presence of matching 9 bp target site duplications (TSDs). The number of inserts for which t wo flanking sequences were recovered from each library was subtracted from the number of uniquely mapping reads to obtain the total number of Mu elements identified from each library (Tables 2 3 2 4 column 4). In order to estimate the coverage from each of these libraries, the percentage of elements identified with both flanks was divided by that for which both arms were detectable in the B73 genome using bioinformatic approaches (Tables 23 2 4 ). E ach Mu class was treated separately. The rough estimate s of Mu inserts from each class in a given inbred (Tables 23 2 4 column 8) is based on BLAST analysis alone, and thus represents a general approximation Expression of these estimates as proportions of the total Mu presence from each Mu class showed remarkable consistency between inbreds (Fig. 24). With the e xcept ion of the teosinte lines derived from the Jalisco region (TIL11 and TIL14), the canonical Mu elements are estimated to make up between 12 15%, while Mu12like

PAGE 29

29 elements account for betw een 75 82% of the total Mus. Jaliscoderived teosinte lines had a higher proportion of canonical Mus at the expense of Mu12s (Fig. 24). The B73 maize inbred appears to contain a higher propotion of Mu10 elements than any other group, with around 13% of its total Mu elements being classified as Mu10like (Fig. 2 4). Comparative Analysis of Mu Elements and Insert Sites in Maize and Teosinte A number of observations can be made by diagramming each Mu insert from the three maize inbreds ( Fig. 2 5 ) and th e five teosinte lines (Fig. 26 ) onto the B73 physical map First, the Mu elements were not distributed in a completely random manner throughout the genome. D istinct areas of some chromosomes were devoid of detectable Mu elements, whereas other areas had a relative overabundance. The latter were typically near the ends of chromosomes (Fig s. 2 5 ; 2 6 ) However, patterns of Muinsert distribution vary greatly among the inbreds (Fig s. 2 5 ; 2 6 ). Additionally, there was no obvious pattern of any two of the maize inbreds sharing more Mu inserts than the other No immediate i nter relational patterns are thus indicated by these data for the three maize lines. Finally some classes of Mu elements tended to group together in some areas (Fig s. 2 5 ; 2 6 ). Impo rtantly, the large majority of Mu elements detected in this study appear to be unique to a single inbred (Fig s. 2 5 ; 2 6 ). D iscussion Bioinformatic A nalysis of B73 Reveals D iversity Previous estimates for the number of background Mu inserts in inbred maize lines were between 20 and 50 ( Liu et al., 2009 ) Until recently, such approximations were based on canonical Mus (19) alone, and even when Mus 10 12 were identified (Dietrich et al., 2002) the extent of their abundance was not recognized. Here we sh ow that the total number of Mu elements in B73 is closer to 200, and that some inbred

PAGE 30

30 teosinte lines may have closer to 500 (Tables 21, 2 3 2 4 ) The majority of Mu transposon sequences in all the maize and teosinte inbreds tested here are Mu12like elements This abundance is intrig uing when considering how little these elements have been utilized in gene tagging experiments. One possibility is that Mu12 elements could be have limited activity in current mutagenic maize lines ( such as the UniformMu population). Alternatively, their activity may have gone undetected thus far due to a lack in tools for their detection. P rimers designed based on flanking sequences from the canonical Mus would be unlikely to anneal to TIR sequences from a Mu10 or Mu12 element Several factors could contribute to the presence of Mu sequences in the maize genome that did not have two readily identifiable, oppositely oriented TIR sequences (23%) (Table 21). First, despite being close to completion, the B73 genome is not yet fully assembled ( Schnable et al., 2009). G aps remain where sections have not yet been positioned and oriented, and large sections of DNA may not yet be correctly arranged. A number of the Mu sequences examined here terminate at gap sites, providi ng the likelihood that some of the single armed Mu sequences here might actually have an unrecognized complement TIR elsewhere in the dat aset. Others will likely be completed as the genome sequence becomes more refined Actually the repetitive nature of internal Muelement sequences may complicate their arrangement during genome assembly and/or lead to gaps in the sequence, a scenario that seems likely given the disproportionate number of elements that terminate in gaps Assembly of repetitive DNA sequence has long plagued genome sequencing projects ( International Human Genome Sequencing Consortium, 2001), and Mu elements mi ght be a

PAGE 31

31 contributing factor of that in maize. Alternatively, Mu elements with a single detectable TIR might have lost all or part of one arm due to deletion or translocation events or through the accumulation of enough small mutations over time to compromise recognition by BLAST using queries of 150bp TIR sequences. Further decrease to the threshold of BLAST e value cutoffs used h ere might reveal some additional TIRs, but these would be difficult to distinguish from non Mu derived DNA sequence. Homomorphic V ersus Heteromorphic Mu E lements Heteromorphic elements (those with divergent TIRs) may reveal important clues about Mu trans poson evolution and behavior. The Mu11 elements were first described as having one TIR similar to a canonical Mu and one TIR lik e that of a Mu10 ( Dietrich et al., 2002). Ten such Mu11s were identified in the B73 genome by BLAST analyses (Table 21). Ad ditional Mus that are currently represented by onearmed sequences may also belong to this class. The mechanism by which such Mu element s might arise with two very different arms deserves some discussion It seems almost certain that for a Mu11, one arm originated from a canonical Mu while the other arose from a Mu10. One possibility is that a transposase attached to distal arm s of two, physically close, but unrelated Mu elements, starting the amplification of hybrid Mu element, the progenitor of the Mu11 class. Alternatively, the insertion of a Mu10 inside of a canonical Mu (or vice versa) could lead to the formation of a hybrid Mu11like element. A similar mechanism could possibly have given rise to some of the Mu12 elements that contain two very d istinct arms ( connected by red, dashed lines in Fig ure 2 2) However, it is also possible that one arm (or both) simply accumulated changes independently of the other, but maintained transposase recognition sites and thus activity If so, the evolving, but stillfunctional arm would continue to be amplified, and thus give rise to groups of

PAGE 32

32 elements with two different arms. Such arms would group in separate clades in phylogenetic analyses, as observed in Figure 22. Heteromorphic Mus do not necessarily lose their potential to transpose, as multiple instances of heteromorphic Mu amplification are evident by replicated inserts seen in the phylogenetic analyses ( parallel dashed lines in Fig 2 2). At least five independent groups of heteromorphic Mus hav e arisen in the Mutator system. T here were also a number of Mu elements for which both TIR sequences were essentially identical, differing by as few as 3 basepair changes (Fig. 22). T hese elements may represent relatively recent TIR duplication events, as left and right arms have not accumulate d mutations since their origination. Therefore, the extent of similarity between arms does not seem related to time since insertion of the element into its current site, but time since a single arm was replicated to make a completely homomorphic element A mechanism for doing so need not be common, but should allow a single TIR sequence to be duplicated, such that the resulting Mu element have identical left and right arms oriented in opposite directions No suc h pathway is currently known, but during replicative transposition a Mu element i s copied before its insertion elsewhere (Shapiro, 1979) During this process, one TIR might pissibly be replicated twice, creating a new Mu element with identical TIRs Nota bly, for insertions with near identic al TIRs ( such as the Mu12 insertion, Mu 9K in this analysis ) the homology between the arms is limited to the TIRs (data not shown), and does not extend int o internal sequence. This observation indicates that the TIRs i n particular are replicated to generate a new homomorphic Mu element, and not larger portions of the transposon.

PAGE 33

33 Some Mu10 E lements Have Full l ength Putative Transposase Sequences The possibility that some Mu10 elements might encode functional transposases is indicated by the high degree of predicted amino acid sequence similarity between putative coding regions of the Mu10 element, Mu 4K, and the MURA and MURB proteins of the MuDR transposase (Fig. 2 3) One possibility is that these Mu10 elements function in a similar manner and on similar targets as MuDR, but have remained undetected and uncharacterized because of differences in activity and/or sequence. Alternatively, Mu10 and MuDR elements might have diverged enough to have distinct targets, either mut ually exclusive or overlapping. The autonomous MuDR has been associated with transposition of canonical Mu elements (Mu1 9) (Chomet et al., 1991) but its effects on the more divergent Mus (10 12) have received little previous attention, and are unknown. Involvement of another transposase is possible, particularly given the presence of the Mu10s and the divergent sequence of Mu10 and Mu12 TIRs (and transposase binding sites) Either MuDRs, Mu10s, or both could be responsible for transposition of the di vergent Mu classes, including the Mu10s, Mu11s, and/or Mu12s. It is also possible that Mu10 elements may be non functional derivatives of MuDR that have not yet diverged in significant ways However, as the TIR sequences of MuDRs and Mu10s have accumulat ed many changes, but the putative coding sequences have maintained homology their being nonfunctional derivatives seems unlikely T he observation that predicted protein sequence is more similar than the nucleotide sequence between MuDR and Mu 4K suggests selection pressure to maintain protein function ( Miyata et al., 1980). Selective pressures that might favor an active transposase are hotly debated ( Kidwell and Lisch, 2000; Okamoto and Hirochika, 2001; Rebollo et al., 2010).

PAGE 34

34 Relationships B etween Zea Inbreds are Highlighted by Mu E lement M apping While the overall ratios of Mu classes were similar for the inbreds tested here (Fig. 2 4), comparisons of insert locations and overall abundance in each of the maize and teosinte inbreds demonstrated some stri king differences between them. First, the greater var ia tion between Mu insert sites in teosinte lines than between the maize inbreds is consistent with the greater diversity of teosinte overall ( Fukunaga et al., 2005 ) (compare Tables 23 and 24 ). Only about 10% of the Mu elements detected in the five teosinte inbreds were present in more than one line as opposed to around 30% for the maize lines Also, some of the teosinte lines, specifically TIL15 and TIL17 from the Balsas region, have abundant Mu s, estimated at over 600 insertions each In addition the TIL 11 teosinte line contains approximately twice the number of canonical Mu elements as any of the other maize or teosinte inbreds tested, indicating a higher activity for this particular clas s i n that line (Table 24, Fig. 2 6 ; Fig. 2 4 ) Some inbreds had areas of especially high insert abundance, such as TIL17 having 27 unique inserts on the short arm of chromosome 10 (covering 58 million nucleotides) that seem to suggest locationspecific di fferences in insert activity between lines (Fig. 26 ). It is possible that the various inbreds have different chromatin structure and/ or other DNA changes that could influence insertion frequency and insert site preference. Other patterns of Mu insert loc ation were common among all inbreds tested. Certain r egions of chromosomes 2, 5, 6, and 9 had high numbers of transposons within relatively small areas in teosinte and maize inbreds (Figs. 25 2 6 ). Also apparent was a relative abundance of Mu elements at the ends of chromosomes and their relative scarcity near centromeres in both teosinte and modernday maize inbreds. Additionally, large areas of chromosomes lacking Mu inserts, together with frequent clusters of Mu

PAGE 35

35 elements, strongly indicated that ins ertion sites were nonrandom. It is likely that physical characteristics of the DNA, like chromatin structure or DNA modification influence the likelihood of Mu transposon insertion in a particular site, with more genic regions being less tightly organiz ed and thus better candidates for Mu insertion, as has previously been suggested (Liu et al., 2009; Vollbrecht et al., 2010) This scenario is supported by data shown here, as well as observations that Mu elements target the fiveprime regions of genes ( D ietrich et al., 2002; Liu et al., 2009). This pattern seems to extend from canonical Mus to the Mu10 and Mu12 elements (Figs. 25 ; 2 6 ). Also apparent were chromosomal regions that appeared to preferentially accumulate insertions of certain classes. For instance, despite Mu10 elements being less abundant than the canonicals or Mu12s, regions on the short arms of chromosomes 2 and 5 contained multiple Mu10 elements within relatively small areas (Fig. 2 5 ). Other regions contained unusually high number s of canonical Mu elements or Mu12s possibly reflecting differences between the Mu classes in their insertionsite preferences. What the underlying causes of these differences might be remains to be determined. Many of the Mu elements identified here wer e present in both maize and teosinte (stars i n Figs. 2 5 2 6 ), and presumably represent ancient insertion events that have been propogated since before the divergence of teosinte and modern maize. Alternatively, these Mu elements could theoretically be i ndependent insertion events in the same exact location, as has been reported, albeit rarely, in other cases (Dietrich et al., 2002). We consider the former suggestion, that of their being ancient insertion events, to be more likely, as the classification of shared Mus is typically consistent (a

PAGE 36

36 Mu12 insert in teosinte matches a Mu12 insert in maize). While these elements were found throughout the genome, the dispersal pattern was uneven, with small clusters of two or more shared Mus occurring regularly (Figs. 2 5 2 6 ). In particular, regions of chromosome 2 short arm, and chromosomes 4 and 5 long arms had groups of 4 or more Mu elements that appear to be ancient in origin and to have been inherited together. Other regions, such as the short arm of chr omosome 4 and the majority of chromosomes 3, 8, and 10 have very few shared Mu elements between teosinte and maize Interestingly, the Mu elements shared between these subspecies were not over represented by a certain class of Mu. There were specific c anonicals, Mu10s, Mu11s, and Mu12s present in both modern maize and teosinte, in approximately the same ratio as their overall abundance. We had speculated that the large Mu12 class may represent more ancient insertions, but based on these data, that does not necessarily appear to be the case. Methods Bioinformatic I dentification of Mu E lements in the B73 Maize G enome As diagramed in Fig. 21 mining of the B73 reference genome (version 2, release 4a.53) (maizesequence.org) was conducted by repeated BLAST analyses, starting with a single Mu TIR from each class of M u transposons, (canonicals, Mu10s, and Mu12s) Individual returns from each BLAST output (cut off at 10e^ 6) were annotated and deposited in a database. They were named based on chromosome, then order of discovery (as in Mu1A for the first transposon identified on chromosome 1). This process was repeated, using more divergent Mu TIR sequences until no additional unique transposons were identified. Genomic sequences surrounding each Mu were then individually analyzed to match paired TIRs (opposite arms from the same element)

PAGE 37

37 based on 9bp target site duplications Matching arms were given a common name and arbitrarily designated left or right arm (as in Mu1AL for the left arm of the first transposon identified on chromosome 1). Phylogenetic A nalysis of B73 Mu TIRs For each bioinformatically identified TIR in the B73 reference genome, the terminal 150 bp were trimmed, oriented in the same 5 ` to 3 ` direction, and arranged with their terminal bases oriented 5` ( as in 5 ` GAGATAA 3 ` ). The 299 TIRs (one was omitted due to truncation by a gap in the reference genome) were aligned using ClustalW ( Larkin et al., 2007). A neighbor joining tree was created with MEGA4 ( Tamura et al., 2007) using the pai rwise deletion option and 1,000 bootstrap repetitions. Mu flank anchored 454 L ibrary C onstruction DNA from each maize and teosinte inbred (B73, Mo17, W22, TIL1, TIL 11, TIL 14, TIL15, and TIL17) was randomly sheared and ligated to biotinylated amplicon B (bioTEG0ampB) adaptors. Approximately 5 g of DNA was bound to 50 L of Strepavidin beads ( Dynal product # 653.05) and immobilized using a magnetic rack (Applied Biosystems, Lot # 0804015). Beads were washed 4 times with 100 L of washing buffer #1 (10mM Tris HCl [pH 7.5], 1 mM EDTA [pH 8.0]), and removed from the rack between each wash. The second washes were conducted at 37 C for 5 min. The final wash es were transferred to 0.2 mL PCR tubes where buffer was removed from beads immobilized on a magnetic stand 96 (Applied Biosystems, Lot # 0903014) For primer extension 1 (Fig. 2 7) the following was added for each reaction: 0.33 L of 10 pmol/ul TIR primer (TIR6 for canonical Mu elements primer 10. 1 for Mu10s, and primer 12.1 for Mu12s, see Tab le 2 5 ) (10 pmol/ul), 10 L 10X NEB ThermoPol buffer (1X = 10mM KCl, 20 mM Tris HCl [pH 8.8 at 25 C], 10 mM NH42SO4, 2 mM MgSO4,

PAGE 38

38 0.1% Triton X 100 [ Sigma Lot # MKBD6639V ]), 2 L dNTPs (10 mM), 85 L HPLC grade water, and 2 L Vent DNA Polymerase (NEB M0257S 2 u nits / L). Each reaction tube received 100 L of this master mix, and were transferred to a thermocycler The primer extension 1 reaction differed for canonicals ( 80C, 2 min; 72 C, 10 min; 1 C/min to 67 C; 67 C, 10 min; 70C, 6 min ) and Mu10s and Mu12 s ( 80 C, 2 min; 70 C, 10 min; 1C/min to 65C, 65 C, 10 min; 70C, 6 min). To stop the reaction, 1 L 0.5 M EDTA (pH 8.0) was added. Tubes were gently vortexed and beads were transferred to the original 1.5mL tubes. Beads were rinsed 4 times with washing buffer #1, with the second wash at 37C for 5 min. After the last wash was removed, 125 L of melt solution (100 mM NaCl, 125 mM NaOH) was added and tubes were incubated on a slow shaker for 10 min to elute the newly synthesized strand. Beads wer e immobilized and supernatant was transferred to acidified PBI buffer (Qiagen, 625 L PBI with 4.5 L 20% fresh aqueous acetic acid). Singlestranded DNA was concentrated and desalted using MinElute PCR purification kit columns (Qiagen Cat # 28704), befo re elution with 20 L of 55 C EB buffer. Beads (containing original DNA) were washed as before and stored at 4C. Products from primer extension 1 were then PCR amplified using a 2 step PCR protocol. The following reagents were used for a single reaction: 6 L 10X PCR Enhancer (Invitrogen Cat # 11495017 ), 2 L 10X PCR amp buffer, 1.5 L 100 mM MgSO4, 0.5 L 10 mM dNTP, 0.8 L 10 M bioTEG0 ampB primer, 0.8 L 10 M Mu primer (TIR 8 for canonicals, 10.1 for Mu10s, 12.1 for Mu12s), 0.2 L 10 units / L Taq, and 7.9 L HPLC grade water. The 2step PCR thermocycler settings were: 96C, 3

PAGE 39

39 min; [96C, 30s; 60C, 45 s; 72 C, 90 s] 9 cycles; [96 C, 30s; 54 C, 30s; 72 C, 90s] 31 cycles; 72 C, 5 min. The amplified PCR products were then optimized for the desired size as follows. Portions of the amplified libraries (85 L) were added to 59.5 L SPRI bead slurry Solutions were vortexed and incubated at 25 C for 5 min. Beads were immobilized for 15 min and liquid was removed. While tubes remained on the magnet rack, beads were washed 2 times with 200 L 70% EtOH. After the wash was removed, beads (on rack) were placed in a 37C incubator for 30 min to allow EtOH evaporat ion Size selected doublestranded DNA was eluted with 50 L 10 mM Tris (pH 7.5), 1 mM EDTA (pH 8.0). Strepavidin beads were prepared for binding by washing twice with 100 L of 1X B&W buffer (5 mM Tris HCl [pH 7.5], 0.5 mM EDTA [pH 8.0], 1 M NaCl). Buffer was then added ( 50 L of 2X B&W buffer [ 10 mM Tris HCl ( pH 7.5), 1 mM EDTA (pH 8.0) and 2 M NaCl] along with 50 L of the sizeselected PCR product. Tubes were vigorously shaken for 20 min at 25C to bind beads. The beads were then immobilized and washed twice with 1X B&W and twice with HPLC grade water. The biotinylated strands were isola ted by adding 125 L melt solution and shaking for 10 min at 25C Beads were again immobilized and the eluted strands were removed ( purified and retained for validation analyses). Beads were washed twice with 200 L HPLC grade water, twice with 100 L w ashing buffer 2 (100 mM Tris HCl [pH 7.5], 0.5 mM EDTA [pH 8.0]), and twice with washing buffer 1. The second wash was done at 37C for 5 min. Prepared strepdavidin beads were then resuspended in 50 L of washing buffer 1. For primer extension 2, beads (50 L) were transferred to 0.2mL PCR tubes, immobilized, and solution was removed. The following was added to each tube: 5 L 10

PAGE 40

40 pmol/uL sequencing primer (specific for each reaction, see Table 25 ), 10 L 10X ThermoPol Buffer (NEB), 2 L 10 mM dNTP, 81 L HPLC grade water. Tubes were transferred to a thermocylcler and subjected to the following: 80C, 2 min; 61 C, 10 min; 1 C/min to 51 C; 51 C, 30 min. Reactions were initiated by adding 5 L Vent DNA Polymerase (NEB Cat # M0257S) and mixing the soluti on by gentle pipetting. Temperature was raised to 70C for 6 min and 1 L 0.5 uM EDTA (pH 8.0) was added to stop the reaction. Tubes were gently vortexed and beads were transferred to new 1.5 mL tubes. Beads were again immobilized and rinsed 4 times w ith washing buffer 1, with the second was at 37C for 5 min. The last rinse was removed before adding 125 uL wash solution. Tubes were inclubated at 25C for 10 min while shaking. Beads were immobilized and newly synthesized DNA strands ( with A and B a daptors ) were eluted, purified, and concentrated in a final volume of 20 L using a PCR purification kit (Qiagen Cat # 28704). Singlestranded DNA templates were then sequenced on a 454 GS 20 (Roche Biosciences, Indianapolis, IN ) as per Margulies et al., (2005). Sequence A nnotation and A lignment Sequences from 454 runs were trimmed and compiled using custom, Java based programs (courtesy of Don McCarty). Each sequence was surveyed for correct 4 base keycodes to assign sub libraries of origin and to chec k for sequencing errors (bar codes included a check sum code) They were each independently used as queries against the B73 reference genome in BLAST analyses in order to map them to specific chromosomal locations. Databases for each inbred and Mu class w ere assembled based on these BLAST results R epetitive sequences were discarded. Insertions mapping within close proximity were examined for matching 9bp target site duplications and scored as single insertions for the final analys e s.

PAGE 41

41 Accession Numbers Mu1 X00913.1 ; Mu1.7, Y00603.1; Mu3, U19613.1 ; Mu4, X14224.1 ; Mu5, X14225.1 ; Mu7, X15872.1 ; Mu8, X53604.1 ; Mu9 (MuDR), M76978.1

PAGE 42

42 Table 21. Bioinformatically identified Mu elements in B73 Mu Class # TIRs detected # Mu elements % with both a rms Mu (1 9) 44 25 76% Mu 10 28 17 65% Mu 11 20 10 100% Mu 12 208 127 64% Total 300 179 76.25% Numbers of Mu elements from each class detected by BLAST searches of the B73 genome using 150 bp terminal inverted repeat (TIR) sequences. The TIRs were m anually curated to determine whether they belonged to the same Mu element based on their relative genomic locations and by matching 9 bp duplications of insert site DNA. *Note that a Mu 11 element with only one arm would be classified with either the Mu10s or the canonicals (Mu1 9) because the Mu11s have heteromorphic TIRs (one like the Mu10s and one like the canonicals).

PAGE 43

43 Table 22. Classification of canonical B73 Mu insertions. Insert Length Class % Identity e value Score Mu1 1376 Mu1 100 0.0 1990 Mu1 .7 1745 Mu1.7 100 0.0 2825 Mu3 1824 Mu3 100 0.0 2944 Mu4 2015 Mu4 100 0.0 3947 Mu5 1320 Mu5 100 0.0 2617 Mu7 2199 Mu7 100 0.0 4359 Mu8 1410 Mu8 100 0.0 2795 Mu9 (MuDR) 4942 Mu9 100 0.0 6445 1B 2018 Mu4 99.85 0.0 3905 1C 4805 Mu9 94.82 0.0 2761 2A 4864 Mu9 94.32 0.0 3406 2B 1891 Mu4 91.79 1e 071 260 2C 1890 Mu4 91.79 1e 071 260 2D 1914 Mu4 92.31 6e 074 268 3A 3578 Mu9 94.21 0.0 2072 4B 2018 Mu4 99.70 0.0 3881 5A 1498 Mu9 91.93 0.0 1292 6A 1321 Mu5 99.92 0.0 2603 7B 1134 Mu7 95.57 0.0 1047 7C 2199 Mu7 99.59 0.0 4270 8A 2037 Mu4 92.34 3e 085 305 8B 1621 Mu7 97.26 8e 110 387 9A 1955 Mu7 97.26 1e 109 387 10A 10830 Mu3 98.47 0.0 1850 UNKA 1955 Mu9 93.38 0.0 1984 UNKB 2078 Mu4 92.79 1e 087 313 T o assign the canonical Mu elements identified in the B73 genome to a specific class, each of those for which the entire sequence was available were compared to the eight previously published Mu elements in a BLAST based analysis. The upper portion of this table shows the results using the eight publ ished Mu elements, and should be referred to in comparing BLAST scores to those of the individual B73 elements below. Of the 18 full length canonical Mu elements identified in B73, the majority of them were most similar to Mu4, Mu7, and Mu9. None were mo st similar to Mu1.7 or Mu8.

PAGE 44

44 Table 23 Mu elements identified by Muflank sequencing in three maize inbreds Inbred Mu class Mapped reads # both flanks # Mus % both flanks Expected % Estimated coverage Estimated # of Mus B73 ( 1 9 ) 43 15 28 53.6% 76% 70.5% 40 B73 10 17 3 14 21.4% 65% 33.0% 42 B73 12 128 27 101 26.7% 64% 41.8% 242 Mo17 ( 1 9 ) 64 23 41 56.1% 76% 73.8% 56 Mo17 10 25 7 18 38.9% 65% 59.8% 30 Mo17 12 150 26 124 21.0% 64% 32.8% 378 W22 ( 1 9 ) 53 19 34 55.9% 76% 73.5% 46 W22 10 13 4 9 44. 4% 65% 68.4% 13 W22 12 115 22 93 23.7% 64% 37.0% 251 Mu inserts in three maize inbreds were identified through 454 based Mu flank sequencing Each inbred and Mu class combination was sequenced with a unique key code to determine their library of origin. Mapped reads were unique TIR flanking sequences that mapped to specific sites on the B73 genome. The number of these that had both flank s were determined by location on B73 the reference genome and by sequenced target site duplications. Expected percent ages with both flanks was based on bioinformatic results of BLAST analys e s on the B73 genomic sequence, and was used in calculating the estimated coverage for each library. Estimated number of Mus was calculated by dividing the number of Mus detected by the percent coverage, and refers to the total number of Mu elements of each class that would be expected by these calculations, and can be considered a rough estimate only

PAGE 45

45 Table 24 Mu elements identified by Muflank sequencing in five teosinte inbreds Inbred Mu class Mapped reads # both flanks # Mus % both flanks Expected % Estimated coverage Estimated # of Mus T IL 1 ( 1 9 ) 45 12 33 36.4 % 76% 47.8 % 69 T IL 1 10 13 5 8 62.5% 65% 96.2 % 8 TIL 1 12 86 9 77 11.7 % 64% 18.2 % 422 TIL 15 ( 1 9 ) 41 7 34 20.6 % 76% 27.1% 126 TIL 15 10 15 2 13 15.4% 65% 23.7% 55 TIL 15 12 169 25 144 17.4% 64% 27.1% 531 TIL 17 ( 1 9 ) 55 15 40 37.5% 76% 49.3% 81 TIL 17 10 33 8 25 32.0% 65% 49.2% 51 TIL 17 12 215 30 185 16.2% 64% 25.3% 730 TIL 11 ( 1 9 ) 68 21 47 44.7% 76% 58.8% 80 TIL 11 10 3 0 3 0% 65% N/A N/A TIL 11 12 61 11 50 22.0% 64% 34.4% 145 TIL 14 ( 1 9 ) 75 20 55 36.4% 76% 47.8% 115 TIL 14 10 26 10 16 62.5% 65% 96.2% 17 TIL 14 12 71 8 63 12.7% 64% 19.8% 318 Mu inserts in five teosinte inbreds were identified throug h 454 based Mu flank sequencing Each inbred and Mu class combination was sequenced with a unique key code to determine their library of origin. Mapped reads were unique TIR flanking sequences that mapped to specific sites on the B73 genome. The number of these that had both flank s were determined by location on B73 the reference genome and by sequenced target site duplications. Expected percentages with both flanks was based on bioinformatic results of BLAST analyses on the B73 genomic sequence, and was used in calculating the estimated coverage for each library. Estimated number of Mus was calculated by dividing the number of Mus detected by the percent coverage, and refers to the total number of Mu elements of each class that would be expected by th ese calculations, and can be considered a rough estimate only.

PAGE 46

46 Table 25 Primers used for 454based Mu flank sequencing. Name Primer sequence TIR6 AGAGAAGCCAACGCCAWCGCCTCYATTTCGTC TIR8 CGCCTCCATTTCGTCGAATCCCCTS, CGCCTCCATTTCGTCGAATCCSCTT, SGCCTCCATTTCGTCGAATCCCKT, CGCCTCCATTTCGTCGAATCACCTC Mu direct CBCTCTTCKTCYATAATGGCAAT 12.1 YATTTCGTYGAARCCGCAYCCGTCGTGTTTC 12 direct CCGTCGTRTTTCATAATRBCAAA 10.1 SCAACGCCTCCRWTTYDTCGAAACCGYKTCTC 10 direct CTCTBDTGTTTYATAATGGCAAT Primers TIR6, TIR8, and Mudirect were used to amplify canonical Mu elements, while 12.1 and 12direct were used to amplify Mu12 elements, and 10.1 and 10direct were used to amplify Mu10 elements. Sequencing primers included a 4base bar code unique for each library to allow assignment of each read. Code: A ( Adenine), C ( Cytosine), G ( Guanine ), T ( Thymine), R ( Purine [ A or G ] ) Y ( Pyrimidine [ C, T, or U ] ) M ( C or A ), K ( T, U, or G), W ( T, U, or A ), S ( C or G ), B (C, T, U, or G ) D ( A, T, U, or G) H ( A, T, U, or C) V ( A, C, or G ).

PAGE 47

47 Figure 21. One example of a sequential mining track, diagramed here to show progression from an initial BLAST query using a single 150bp TIR sequence to search the B73 genome. The first query typically returns multiple similar sequences, which are captur ed and cataloged in a database by genomic location. This initial query is followed by additional BLAST quer ies using 150 bp from the more divergent TIRs identified, and so on, until no new novel insertion sites are identified. This process was conducted using single initial queries from Mu9, Mu10, and Mu12 elements, and was successful in identifying 300 TIR sequences in the B73 genome. (Black = previously identified; Red = newly identified).

PAGE 48

48 Figure 22. Neighbor joining tree of 299, B73 Mu T erminal I nverted Reapeats The terminal 150 bases from each TIR of bioinformatically identified B73 Mu transposons were trimmed, oriented in the same direction, and aligned using ClustalW. The phylogenetic tree was created in MEGA4, using 1,000 bootstrap r eplicat ions with a pairwise deletion option. The canonical Mu elements are labeled based on the most closely related, previously described Mu element. Key boot strap values are shown. Units are in number of base substitutions per site. Opposite arms of heterom orphic Mu elements are connected by dashed lines.

PAGE 49

49 Figure 2 3. Comparison between MuDR and a Mu10 (Mu4K) element from the B73 maize inbred. The overall structure of MuDR and the MuDR like element are diagramed in the upper portion of the figure, with TIR sequences and putative coding regions of the mudr a and mudr b genes shown. The Mu10 element is the only apparent MuDR like sequence in the B73 genome with an intact, uninterrupted sequence. Both mudr a and mudr b genes have potential to code for functi onal proteins, since they contain no mutations that would lead to premature stop codons (unlike the other MuDR like sequences in B73). Below, protein alignments between MURA and MURB from MuDR (top) and the predicted analogous proteins from Mu10 MuDR like element (bottom) reveal high sequence similarity (82% identical for MURA, 79% identical for MURB).

PAGE 50

50 Figure 24. Estimated proportions of each Mu class in three maize inbreds and teosinte derived from the Balsas and Jalisco regions of Mexico. Estimates are based on extrapolations of 454generated Muflank sequences summarized in Tables 23 and 24. Teosinte Balsas represents pooled data from teosinte inbred lines 1, 15, and 17. Teosinte Jalisco represents pooled data from teosinte inbred lines 11 and 14

PAGE 51

51 Figure 25 Approximate map sites for Mu insertions in three maize inbreds. Insertions were identified either through bioinformatic analysis of the B73 genome (top row) or through Mu flank 454 sequencing of libraries from the three maize inbreds s hown (B73, Mo17, W2 2 respectively positioned in rows 2, 3, and 4 of each vertical band on chromosomes ) Positions on chromosomes are based on BLAST alignments of 454 flanking sequences to the B73 physical map and are approximate. Above each chromosome diagram are total chromosome lengths (in bp) Inserts shared between at least one maize and one teosinte line are starred.

PAGE 52

52 Figure 26 Approximate map sites for Mu insertions in five teosinte inbreds Insertions were identified either through Mu flank 454 sequencing of libraries from the five teosinte inbreds shown (TIL1, TIL 15, TIL 17, TIL 11, and TIL14), respectively positioned in rows 15 of each vertical band on chromosomes. Inbred lines 1,15, and 17 originated from the Balsas region (top three rows), and inbred lines 11 and 14 originated from the Jalisco region (bottom two rows). Positions on chromosomes are based on BLAST alignments of 454 flanking sequences to the B73 physical map, and are approximate. Above each chromosome diagram are total chromosome lengths (in bp). Inserts shared between at least one maize and one teosinte line are starred.

PAGE 53

53 Figure 27. Diagramatic representation of Mu flank 454sequencing library preparation. Sheared genomic DNA from inbred maize and teosinte lines was used to generate libraries with amplified canonical Mus (Mu19), Mu10s, and Mu12s, separately. TDA primer s contained library specific key codes for assignment of each read to correct sub libraries. See Table 25 for primer information.

PAGE 54

54 CHAPTER 3 ANALYSIS OF THE CELL ULOSE SYNTHASELIKE D GENE FAMILY I N MAIZE Introduction The ancient, highly conserved Cellulose SynthaseLike D ( C sl D ) genes encode enzymes required for specific cellular growth processes, yet whose biochemical and cellular functions remain elusive (Richmond and Somerville, 2000; 2001; Favery et al., 2001; Wang et al., 2001; Bernal et al., 2007; 2008; Yin et al., 2009). They form one of ten distinct subgroups in the Cellulose Synthase superfamily, defined by sequence similarity to Ce llulose Synthases (CESAs) (Richmond and Somerville, 2000; Hazen et al., 2002; Farrokhi et al., 2006; Penning et al., 2009; Fincher, 2009). All members of the superfamily share characteristics of membranebound, processive glycosyltransferases that synthes ize betalinked glycan polymers, such as those of some cell wall polysaccharides (Richmond and Somerville, 2000; 2001) and are included in glycosyltransferase family 2 (Saxena, 1995; Campbell et al.,1997; Delmer, 1999; Coutinho and Henrissat, 1999; Hollan d et al., 2000). Known products range from cellulose to hemicellulose backbones, and may include additional betalinked glycan chains (Arioli et al., 1998; Dhugga et al., 2004; Liepman et al., 2005; Burton et al., 2006; Cocuron et al., 2007; Doblin et al. 2009). Despite evidence that the CSLDs are of ancient origin extending to the earliest nonvascular land plants and possibly before (Roberts and Bushoven, 2007), their contributions to cell wall biosynthesis are yet to be defined Of the cellulose synthase like protein families CSLDs are the most closely related to the cellulose synthases ( C ES A s), leading to the suggestion that CSLDs may themselves function as cellulose synthases (Doblin et al., 2001). The CSLDs share the

PAGE 55

55 greatest amino acid seque nce similarity with CESAs (40 50% i dentity) and are of similar, though slightly larger size ( Richmond and Somerville, 2001). The CSLDs are also the only members of the cellulose synthase superfamily to have the aminoterminal RING type Zn finger like dom ain s typical of the CESAs ( Richmond and Somerville, 2000). These Znfinger domains are thought to function in proteinprotein interactions, possibly mediating complex formation o r protein turnover ( Gamsjaeger et al., 2007). T he locations and sizes of i ntron s in C sl D genes led to the suggestion that this subfamily may be ancestral to the entire Cellulose Synthase superfamily (Richmond and Somerville, 2000; 2001; Yin et al., 2009). Also C sl D genes are present in all plant genomes examined thus far, incl uding nonvascular mosses (Richomond and Somerville, 2000; 2001; Roberts and Bushoven, 2007; Yin et al., 2009). In contrast, many of the other C sl subfamilies appear in only specific taxa (Farrokhi et al., 2006; Keegstra and Walton, 2006; Vogel, 2008; Penning et al., 2009; Fincher, 2009). Of the five C sl subfamilies yet to be assigned a specific polysaccharide synthase role, only C sl D and C sl E subfamilies are found in both dicot and monocot genomes (unlike C sl B C sl G and C sl J). This broad taxonomic dist ribution of the C sl D genes indicates a conserved function throughout the plant kingdom. Clues to the biological roles of the CSLDs have been sought by defining their biochemical activity, but this has proven challenging. Heterologous expression studi es, while successful in determining the functions of CSLA ( Liepman et al., 2005 ), CSLF ( Burton et al., 2006) CSLC ( Cocuron et al., 2007) and CSLH ( Doblin et al., 2009) proteins have thus far been unsuccessful for CSLDs. However, based on the

PAGE 56

56 identifica tion of biochemical actions for CSLA, CSLC, CSLF, and CSLH enzymes the C sl D genes have been hypothesized to encode hemicellulose synthases (Sandhu et al., 2009). Other important lines of evidence have led to alternate interpretations. Analysis of cell w all polysaccharides, for example, from key cell types, cell culture treatments, or genetic perturbations have been consistent with roles for CSLDs in production of either cellulose (Manfield et al., 2004; Li et al., 2009) or hemicellulose backbones (Bernal et al., 2007; Li et al., 2009). A complicating factor is that alterations in cell wall composition are often broadly pleiotropic, making primary effects difficult to distinguish from secondary or other closely related changes (Orfila et al., 2005; Persson et al., 2007; Bernal et al., 2007; Li et all, 2009). Another valuable source of information has come from subcellular localizations of CSLD proteins. Although the majority of studies thus far have favored a Golgi apparatus localization, supporting a r ole in hemicellulose backbone synthesis (Favery et al., 2001; Bernal et al., 2007; 2008; Zeng and Keegstra, 2008; Li et al., 2009), these findings are also consistent with the possible transit of CSLD proteins through these compartments enroute to the plas ma membrane, as is the case for CESAs (Kimura et al., 1999; Crowell et al., 2009; Gutierrez et al., 2009). Indeed, r ecent studies have indicated a plasma membrane locale for CSLD proteins in rice suspension culture cells (Natera et al., 2008) and Arabidopsis root hair cells (Neilson and coworkers, unpublished data, cited with permission). More work is needed to conclusively demonstrate the subcellular localizations for active, endogenous CSLDs. Until recently, phenotypes from csld mutants in multiple sp ecies favored roles for these proteins in tip growth (Bernal et al., 2008). T he moss, Physcomitrella patens,

PAGE 57

57 where tip growth is the predominating form of cell growth, C sl D genes comprise 46% of all expressed sequence tags from the Cellulose Synthase supe rfamily ( C es A s and all C sl s) (Roberts and Bushoven, 2007). In higher plants, root hairs and pollen tubes provide classic models for cellular tip growth (Hepler et al., 2001; Cole and Fowler, 2006), but xylem fibers also elongate by intrusive tip growth (M ellerowicz et al., 2001; Samuga and Joshi, 2004). Expression of C sl D2 in developing xylem of Populus is thus consistent with its proposed influence on xylem fiber length and its role in tipgrowing cells (Samuga and Joshi, 2004). P rior to the work report ed here for maize csld1 mutants, genetic studies of C sl D genes were consistently interpreted in the context of CSLD contributions to the process of tip growth (Bernal et al., 2008). However, recent genetic studies indicate an alternate and/or additional r ole for CSLD proteins ( Chapter 4; Bernal et al., 2007; Li et al., 2009). Although C sl genes are found in fairly large gene families, and some of these genes may function in overlapping or redundant fashions, many act in a nonredundant, org anspecific, or developmentally controlled manner. Large gene families for cell wall biosynthetic enzymes may be related to the complexity and diversity of the many cell wall polysaccharides (Reiter, 2002; Coutinho et al., 2003). By characterizing individual C sl gene knockouts in key species, clues to their functions may be revealed, and our understanding of cell wall biosynthesis improved. Results Bioinformatic A nalyses of the C sl D G enes from M aize, R ice, and Arabidopsis The availability of fully sequenced genomes for m aize ( Schnable et al., 2009 ; Van Erp and Walton, 2009 ), rice (Yu et al., 2002; Goff et al., 2002 ; Hazen et al., 2002), and Arabidopsis ( Arabidopsis Genome Initiative, 2000; Richmond and Somerville, 2000)

PAGE 58

58 allowed identification of Cellulose SynthaseLike D ( C sl D ) gene families in these species (Fig. 3 1). These families were relatively small, with five to six members. Among the cellulose synthase superfamily, the C sl D subgroup stands out as having the longest coding sequences, as well as particularly small introns (70 to 110 bp) and large exons (Fig. 3 1). The C sl D genes typically have well conserved intronexon boundaries, delineating two to four exons. E xceptions included m aize C sl D 2 which has the largest intron (546 bp) of the CslDs examined. O nly thr ee other CslD genes had introns longer than 200 bp (Os CslD2 Os CslD4 and At C slD3 ) (Fig. 3 1). Also, AtC sl D1 had five introns, two more than any other CslD gene, and no introns were evident in Os CslD5 (Fig. 3 1). B oth Zm C sl D 3 and At C sl D6 had apparent five prime deletions, with the coding sequence of these genes starting at a point well within what would be the first exon of the other C sl D genes (Fig. 3 1). Translation of each full length C sl D coding sequence was predicted to produce a protein pr oduct from 10001250 amino acids (with the exception of the fiveprime truncated Zm C sl D3 and At C sl D6 ) (Fig. 3 2 ). A high degree of conservation was indicated for numbers and locations of transmembrane domains with in the CSLD proteins (predicted using TM HMM [cbs.dtu.dk/services/TMHMM]). These domains are thought to be important for protein conformation and/or localization, and thus function (Somerville, 2006). While the degree of confidence for individual transmembrane domains varied considerably, each CSLD protein sequence was predicted to contain six carboxy terminal and two aminoterminal transmembrane domains (with the exception of At CSLD5, which was predicted to contain a single aminoterminal domain) (Fig. 32). O f the six carboxy terminal domains, the fourth from that terminus showed the greatest

PAGE 59

59 range in probability scores among the CSLD proteins. A mino terminal domains showed the lowest probability scores in Zm CSLD1, At CSLD5, and Os CSLD4 (Fig. 3 2). A key feature of CSLD proteins are the RING type Znfinger like domains they are thought to share with the CESAs ( Richmond and Somerville, 2000). To test for the presence/absence of these domains, as well as their similarity to those of CESAs, protein sequences for each of the CSLDs of Arabidopsis, maize, and rice, as well as two CESAs, w e re examined using SMART ( smart.embl heidelberg.de), a domain prediction web tool ( Schultz et al., 1998; Letunic etl., 2009). While this program recognized RING type Znfinger domains in both CESA proteins wi th high confidence, o nly six of sixteen CSLD proteins contained sequences recognized by this program as having Znfinger similarity, and those at low probabilities (scored below the threshold for significance) (Fig. 3 2). Direct examination of protein seq uence alignments however, revealed a highly conserved motif with strong similarity to CESA RING type Zn finger motif s in all but four of the CSLD proteins. Exceptions were predicted to carry five prime truncations (see Fig. 3 3). Eight highly conserved cysteine residues matching those of the RING domain of the CESA proteins, and oriented in a way compatible with Zn finger organization (Fig. 33), indicate that these CSLD proteins may indeed contain functional domains, despite their not being recognized by SMART. Active site s for glycosylt ransferase family 2 processive glycosyl transferases typically include the D, D,QxxRW conserved residues (Richmond and Somerville, 2000). This motif was readily identified in all of the CSLD proteins examined from maize, Arabidopsis, and rice (Figs. 3 2,3 3). Examination of 35 amino acid residues

PAGE 60

60 surrounding this motif revealed very strong sequence conservation in each of the 16 CSLD proteins and both CESA proteins examined (Fig. 33). Alignment of the CSLD proteins from maize, Arabidopsis, and rice, along with two Arabidopsis cellulose synthases (At CESA1 and At CESA7) revealed the extent of conservation among the CSLDs and between the CESAs and the CSLDs (Fig. 33). Near perfect alignment was observed between large por tions of these proteins, including transmembrane domains (evident by conserved regions of densely packed hydrophobic residues) as well as substratebinding and catalytic sites (Fig. 33). More significant changes between CSLD proteins were observed in pr edicted RING type Znfinger motifs although near perfect alignment was observed in the cysteine residues noted above (Fig. 3 3). Phylogenetic analyses revealed three clades in the CSLD subfamily that correspond to three phenotypic classes among csld mutants described here and elsewhere (Fig. 3 4 ) In Arabidopsis, C sl D1 and C sl D4 are implicated in pollen tube growth (Bernal et al., 2008), whereas C sl D2 and C sl D3 act in root hair formation (Favery et al., 2001; Wang et al., 2001; Bernal et al., 2008), and C sl D5 disruption reduces overall plant growth (Bernal et al., 2007). Thus far, mutants of the most closely related CslD genes in rice and maize yield phenotypes that appear analogous to those of Arabidopsis. Rice CslD1 (Kim et al., 2007), and its maize ho molog, C sl D 5 (Penning et al., 2009), result in root hair deficient phenotypes. Disruption of rice CslD4 (closest homolog of Zm C sl D 1 and At C sl D5 ), confer a narrow leaf and dwarf1 ( nd1 ) phenotype (Li et al., 2009). Similar functional roles are indicated by the reduced growth phenotypes common to all three of these mutants (Chapter 4, Bernal et al., 2007; Li et

PAGE 61

61 al., 2009). Collectively, data indicate conservation of specific developmental roles for individual CSLD proteins between Arabidopsis, rice, and m aize Expression P rofiles of the M aize C sl D G enes To evaluate the likely sites of action for each of the maize C sl D genes, mRNA levels were determined by quantitative RT PCR for selected maize tissues and developmental stages (Fig. 3 5 ). Each gene showed a distinctive pattern of expression, with the exception of C sl D 3 and C sl D 4 whose patterns differed only in magnitude from one another (Fig. 3 5 ). Expression of most CslD genes was consistently low, compared to that of other genes in these tissues (data n ot shown). By far the greatest level of expression was that measured for C sl D 4 (with C sl D 3 close behind) in anthers 2 days before anthesis The broadest expression profile was observed for C sl D 2 which was expressed in most tissues examined, including above and below ground structures as well as in both vegetative and reproductive organs. In contrast, C sl D 1 expression was more specific, having most abundant transcript levels in developing leaf blades and coleoptiles with enveloped young leaves. While C sl D 5 mRNA was detectable i n diverse tissues, levels were greatest in root hair cells (Fig. 3 5). By tissue, the CslD gene with maximal expression in coleoptiles, shoot apical meristems, and developing leaves was C sl D1 (Fig. 3 5). Young and mature leaf blades were highest in C sl D 5 mRNA, whereas midribs showed relatively high levels of C sl D 2 C sl D 3 C sl D 4 and C sl D 5 expression. No C sl D gene was detected at high levels in either mature stems or primary roots The most highly expressed gene in both silks and ligules was C sl D 2 whereas root hairs had elevated levels of C sl D 5 and ovaries showed significant expression of C sl D 2 C sl D 3 and C sl D 4 Finally, anthers had very high expression of both C sl D 3 and C sl D 4 (Fig. 3 5 ).

PAGE 62

62 Reverse G enetic S creens for c sl d M utants Single gene knockout mutations were sought for individual members of the maize C sl D gene family by reverse genetic screening of around 15,000 lines from the UniformMu maize population (Yong et al., 2005; Penning et al., 2009) Mu transposon insert ions were identified in C sl D 1 (see Chapter 4) and C sl D 5 (see below ). No heritable insertions were recovered in C sl D 2 C sl D 3 or C sl D 4 Screening identified a Mu transposon in exon 2 of C sl D 5 in UniformMu Grid 1 (coordinates X 13 and Y 37) indicating prese nce of a putative knockout mutant in UniformMu family 02S 10391 5 Seeds from this family were planted, grown and tested for the presence of a Mu insertion. Results s howed a heritable insert in CslD5 with normal Mendelian segregation patterns in over 200 PCR genotyped individuals (data not shown). Plants carrying the Mu insertion were back crossed to W22 inbred progenitors for an additional three generations to establish the csld5 1 line. Aboveground characteristics of plants homozygous for this mutat ion showed no visible abnormalities in plant height, growth rate, flowering time, or accumulated biomass (data not shown). However, examination of csld5 mutant seedlings grown on germination paper revealed a near complete lack of root hairs (Fig. 3 6) Li nkage between the root hair deficient phenotype and the Mu insert in C sl D 5 was confirmed by testing for the phenotype in an Ac insertional allele with a transposon inserted upstream of the csld5 1 allele in exon 1 ( a ccession [ AC027037] was obtained from th e Ac/Ds collection at Cornell University courtesy of Tom Brutnell [ Kolkman et al., 2005] ). Mutants from this line (established as csld5 2 ) were phenotypically identical to those of the csld5 1 line (data not shown). Offspring of reciprocal crosses between

PAGE 63

63 csld5 1 and csld5 2 parents consistently showed the root hair defic iency conclusively linking disruption of C sl D 5 with the phenotype Analysis of csld5 M utants In depth examination of primary roots from seedling stage csld5 mutant and wildtype plants r evealed that in the mutants, root hairs initiated but usually fail ed to elongate (Fig. 36). Although typical wildtype root hairs grew to around 600 m, those of csld5 mutant s seldom elongated much after initiation, and in the rare instances of substantial growth, reached only around 300 m (Fig. 3 6). From SEM analyses, it is estimate d that as few as one in fifty root hairs gr e w to longer than 100 m in csld5 mutants. The majority of csld5 mutant root hair initials appeared swollen and bulging, often wi der at the base than typical wildtype root hairs (Fig. 36). Only root hairs appeared to be affected, since other root cells, including epiderm al and internal cells appeared to be normal in csld5 mutants (Fig. 3 6). Under all growing conditions tested ( from field to greenhouse and germination trays ) plus a range of stresses, csld 5 mutant plants behaved no different ly from wildtype plants as far as growth rates and flowering times A bove ground phenotype and biomass accumulation did not differ (data not shown). Root h air T ranscriptome P rofiling Specificity of the root hair phenotype in csld5 mutants raised broader questions about distinctive features of gene expression and cell wall biosynthesis in this cell type To obtain more global data on transcript s in these cells, we profiled mRNAs of root hairs from seedlings of W22 and B73 inbreds, and from their F1 hybrid progeny. We used threeprime anchored, 454 transcript sequencing which allowed quantitative measurements of relative transcript levels without alignment to a reference genome

PAGE 64

64 (each sequence read could be immediately assigned identity due to its 3` anchor) ( Eveland et al., 2008) A single titration run (1/16 plate) on a 454 GS 20 sequencer ( Roche Biosciences, Indianapolis, IN ) yielded 79,448 sequences corresponding to 10,618 unique transcripts 6,273 present as 2 or more reads Annotation of the 100 most highly expressed genes based on similarity to previously described genes, indicated that many of the most abundant mRNAs were involved in a mino acid metabolism, cell wall modification, and redox regulation ( Fig. 3 7) Maize C sl D 5 was not among the genes identified in this screen, presumably because of low expression. Discussion The CSLD G enes are H ighly c onserved A mong D iverse S pecies The cr ossspecies conservation of C sl D gene copy number, intronexon boundaries, gene size, and protein domains (Fig s. 3 1, 3 2 ) are indicative of long conserved function and stro ng selection against mutations Compared to CesA7 and other CesA s, CslDs have remarkably few introns for such large genes (Fig. 3 1). Intron number and position can be important to gene regulation in a number of instances ( Clancy and Hannah, 2002; Jeong et al., 2007; Rose et al., 2008), but whether differences between CslD s and CesA s re flect functionally significant aspects remains unclear. Either way, the similarities between C sl D genes and C es A genes are consistent with a close relationship between these two gene subfamilies and have been used to support suggestions of a similar catal ytic function ( Doblin et al., 2001 ; Richmond and Somerville, 2001). T runcations to the fiveprime regions of Zm CslD3 and At CslD6 result in loss of the RING type Znfinger like domain thought to function in proteinprotein interactions supporting the po ssibility of these genes being nonfunctional pseudogenes.

PAGE 65

65 The conservation of transmembrane domain position and number in the CSLD proteins indicates their importance for function (Fig. 32). In CESA proteins, these domains are thought to function together in form ing a channel through the plasma membrane through which the elongating glucan chain is excreted into extracellular space ( Somerville, 2006; Zhang et al., 2009). Interestingly, the three proteins with amino terminal transmembrane domains having the lowest probablility of maintaining membrane spanning capability (based on TMHMM predictions) are the same that result in the reduced growth phenotypes when disrupted (Zm CSLD1 [Chapter 4], At CSLD5 [Bernal et al., 2007], and Os CSLD4 [Li et al., 2009]) Although mutant phenotypes indicate that these three proteins have an in vivo function, they have either lost one or more transmemembrane domains, or the domain s have remained functional while diverging enough to not be recogniz ed by TMHMM T he acti ve site of the sixteen CSD proteins analyzed here is extremely well conserved. Within the 35 amino acids surrounding the active site, t here are only three amino acid differences likely to alter properties at that site (Fig. 3 3) I n contrast the Zn fing er like domain and the transmembrane domains both show ed considerably more variation between CSLD proteins (Fig. 33 and 32, respectively ) Conservation of Developmental Role s are Indicated by Phenotypic Similarities Across Taxa Comparative phylogenetic analysis combined with mutant phenotypes described here and elsewhere, indicate ancient functional divergence and highly conserved developmental roles for subgroups within the C slD gene family ( Fig. 3 4 ). When mutant phenotypes from maize, rice, and Arabi dopsis were overlaid on a neighbor joining tree,

PAGE 66

66 CSLD clades corresponded to distinct classes of phenotypes These were: (i) root hair defective, (ii) male transmission defective, or (iii) reducedgrowth (Fig. 3 4 ). Several additional aspects of this as sociation included, f irst, that all of the csld mutants identified thus far have visible phenotypes (Favery et al., 2001; Wang et al., 2001; Bernal et al., 2008, 2009; Kim et al., 2007; Li et al., 2009; Penning et al., 2009). Second, the associations shown in Figure 34 persist despite fundamental structural differences between the primary cell walls of Arabidopsis (Type I walls ) and those of rice and maize (Type II walls ) (Harris and Hartley, 1980; Carpita and Gibeaut, 1993; Carpita, 1996; Carpita et al. 2001). Roles of C sl D genes thus apparently transcend major differences in noncellulosic cell wall constituents between diverse plant species, and individual C sl D genes appear to have maintained their primary developmental roles. Third, previous result s suggested specific functions for CSLD proteins in tipgrowing cells (Bernal et al., 2008), but data here and elsewhere indicate broader developmental roles as well. Specificity of E xpression A rgues for S trictly d efined R oles for CslD G enes Quantitative RT PCR of individual maize C sl D genes revealed distinct expression patterns (except for C sl D 3 a predict ed pseudogene with a large deletion in its amino terminus ) (Figs. 3 1, 3 2 ). These expression patterns contrast with those of CesA genes, which show apparently coordinated expression among defined subsets of the gene family (Burton et al., 2004; Nairn and Haselkorn; 2005) Coordinate expression of CesA subgroups is considered consistent with the hypothes i s that the CESA proteins act together in functional rosettes. No obvious pattern of coexpression was observed between any of the CslD genes, indicating either a capacity to function alone, or at least independent ly of strictly defined partners The possibility remains that different

PAGE 67

67 combinations of C SLD and/or CESA proteins may function together in an as yet undefined manner. Nonetheless the well defined expression pattern for each of the CslD genes is consistent with proposed specificity of function (Fig. 3 5). Also, although genetic studies of csld mutants have consistently indicated a role for CSLD proteins in tip growing cells, the expression profiles of the CslD genes suggest potentially broader roles No obvious tipgrowth occurs in cell comprising many of the tissues in which relatively strong expression of one or more CslD gene was observed (Fig. 3 5). Developing leaves, silks, and ovaries, for example, have relatively abundant CslD gene expression, but few cells in these organs appear to use tip growth like mechanics. T he root hair defec tive phenotype of csld5 mutants (Fig. 3 6), is consistent with patterns of expression for the CslD5 gene. G reatest levels of CslD5 mRNA were observed in isolated root hairs (Fig. 35). In contrast, growing primary roots show little expression of CslD5 d espite containing growing root hairs. The difference between expression in root hairs alone and whole root tips indicates the specificity of expression for this gene which seems to be essentially limited to a single cell type in growing primary roots Functional CslD5 is R equired for M aize R oot h air Elongation The lack of elongated root hairs on csld5 mutants indicates a role for this gene product in the formation of new cell wall at the growing tip of these classic tipgrowing cells (Fig. 3 6 ). Intere stingly, CslD5 is not required for initiation of root hairs only their elongation (Fig. 3 6). The process through which a trichoblast cell initiates root hair formation has been extensively studied and involves intense, coordinated cell wall modification and biosynthesis ( Syzmanski and Cosgrove, 2009; Anderson et al., 2010). Wall loosening enzymes are focused at the s ite of root hair formation, and new cell wall

PAGE 68

68 biosynthesis is targeted to the site via actinmediated reorganization of the endomembrane system ( Franti ek et al., 2000). That csld5 mutants initiate root hairs indicates that CSLD5 is not essential to this process. One or more other CSLD enyzme s may contribute to the first steps of root hair formation, or perhaps there is partial redundancy with CslD5 essential only during the most rapid phase of root hair growth. In Arabidopsis csld3 mutants (homologous to maize CslD5 ) root hairs have been reported to burst at the tip, releas e cytoplasm and cease growth (Wang et al., 2001) Similar burs ting does not appear to occur in root hairs of maize csld5 mutants Indeed, SEM analyses of csld5 root hairs show them to be short, but intact (Fig. 3 6). The mutant root hairs are swollen and une ven compared to wildtype, but they do not appear ruptured (Fig. 3 6). Why some mutant root hairs undergo partial elongation (up to 250 m), while the majority terminate growth much earlier remains unclear One possibility is that another CSLD protein is able to partially compensate for loss of CSLD5, or rare in stances of root hair growth could occur without the specific polysaccharide contribution of CSLD5. In Arabidopsis, mutations in either CslD2 or CslD3 result in aberrant root hairs, indicating either coopertation of those two gene products or limited redun dancy (Favery et al., 2001; Wang et al., 2001; Bernal et al., 2008). From both the phylogenetic analysis (Zm CSLD2 is closest to At CSLD2 [Fig. 3 4]) and transcription profiles (Fig. 3 5), the most likely candidate for compensating for CSLD5 loss is CSLD2 Transcript profil es from maize root hairs reveal the complexity of genetic activity in this single cell type (Fig. 3 7 ). The failure to detect C sl D 5 transcript in this analysis is consistent with a relative scarcity of this mRNA compared to the more abundant

PAGE 69

69 transcripts. If an arbitrary abundance score is set a t detection of 10 mRNAs at least 1,210 other genes are expressed at a higher level than CslD5 in this cell type. Presence of a mutant phenotype indicates that expression of this gene at some level is important to normal root hair elongation, but apparently a very small amount of this mRNA is sufficient In either case, mRNA levels do not necessarily reflect CSLD5 protein levels which could well be higher if the protein is long lived. T he m ost highly expressed genes included many with high homology to genes of known function, and others that were not similar to any previously characterized genes (thus were annotated as hypothetical or unknown) Genes for c ellwall modification, redox regulation, and amino acid metabolism were predominant. The 50 most highly expressed mRNAs included genes for a beta expansin, an arabinogalactan protein, and t wo xyloglucan endotransglycosylases (Fig. 3 7). Also in the top 50 genes were those encoding two adenosylmethionine synthases, two methionine adenosyltransferases, multiple transporter proteins, ubiquitinrelated proteins, and redox related proteins (Fig. 3 7) Also evident in t h e root hair transcript profiles were differences in the most abundant mRNAs between the three maize lines tested (B73, W22, and their hybrid) Most genes were expressed at similar levels in all lines (based on read numbers, normalized for total per library). However, there were also multiple cases showing very different expressi on of certain genes in W22 and B73. For instance, the most highly expressed gene in B73 (described in Figure 3 7 as a hypothetical protein) was expressed at very low levels in W22 (802 transcripts sequenced for B73, compared to 3 for W22). For the hybrid, transcript levels for most genes indicated additive effects,

PAGE 70

70 being detected at levels between that of B73 and W22 (Fig. 37). In other instances, nonadditive effects were observed, with apparent expression of a given gene in the B73 W22 hybrid much hig her or lower, respectively, than in both inbreds (Fig. 3 7). The most highly expressed gene in the hybrid (ag ain a hypothetical protein) ranked much lower in the expression profiles of both inbreds. The reverse was also observed in multiple instances, where a gene not detectable in the hybrid was expressed at relatively high levels in both inbreds Methods Bioinformatic A nalyses of Csl D G enes f rom M aize, R ice, and Arabidopsis Fulllength coding sequences from each of the CSLD genes in maize, rice, and Arabidopsis were compared to genomic sequence to identify exonintron boundaries. Coding sequences were used to predict amino acid sequences, using a web tool at changbioscience.com/res/rest Each of these predicted amino acid sequences, as well as that of Arabidopsis Cellulose Synthase A 7 ( At CESA 7 ), was independently analyzed with the protein domainprediction software SMART ( smart.embl heidelberg.de) to test for presence of RING type Zinc finger like domain s. Proteins for which SMART failed to detect RING domains were manually examined after alignment with ClustalW for similar amino acid sequences. Putative t rans membrane domains were identified by TMHMM for each predicted protein ( cbs.dtu.dk/services/TMHMM) Phylogenetic A nalyses The neighbor joining tree was created using Mega 4.0 (Tamura et al., 2007; megasoftware.net) with ClustalW generated alignments of protein sequences predicted from full length cDNAs for each of the CSLD genes fr om rice, maize, and Arabidopsis. The resulting tree represents 2,000 bootstrap repetitions using the pairwise deletion

PAGE 71

71 option. Nomenclature for proteins encoded by the C sl D gene family in maize was assigned as per Van Erp and Walton (2009). Real T ime RT PCR For each sample, RNA was extracted from approximately 200 mg of tissue, initially frozen in liquid nitrogen, then homogenized in 1.0 mL Trizol (Invitrogen Cat # 15596018) using a Q BIOgene FastPrep 120 with Lysing Matrix D (MP Biomedicals Cat # 116913). Samples were incubated for 5 min at 25C, with frequent vortexing. Chloroform (200 L) was added and samples were vortexed 15 sec before and after a 1 min incubation at 25C. Phases were separated by centrifuging 10 min at 15,000 x g, followed by transfer of 200 L of the aqueous layers to 700 L of Qiagen RLT buffer (from RNeasy Plant Mini kit, Qiagen Cat # 74904). Ethanol was added (500 L, 100% EtOH) and samples were vortexed. Half of the resulting volume was used to clean and elute total RNA as per the RNeasy Plant Mini kit (Qiagen Cat # 74904). Res ulting RNA was treated with DNase1 (Ambion Cat # AM1906), and quantified using a BioRad SmartSpec 3000. The cDNA was synthesized using a SuperScript OneStep kit and protocol (Invitrogen Cat # 10928042). Levels of mRNA were quantified from selected maiz e tissues at a range of developmental stages using quantitative Real time RT PCR ( Step One Plus Real Time PCR System [ A pplied B iosystems] ). At least three biological replicates were analyzed for each tissue or time point, and for each of these replicates, reactions were performed in duplicate. A given reaction included 10 L Fast SYBR Green Master Mix (ABI Lot # 1003024), 5.0 L of cDNA sample ( diluted 10x from cDNA reaction), and 100 nM of each genespecific primer (Table 32) in a final volume of 20 L. The relative abundance of transcripts was normalized with 18S rRNA controls (Taqman Ribosomal

PAGE 72

72 RNA Control Reagents, ABI Lot # 0804133) as in Eveland et al., 2008. Primer pairs for all genes were designed using Primer Express 3.0 (ABI). Reverse G enetic S creening The UniformMu population was screened using PCR based assays to identify Mu transposon insertions in each of the maize CslD genes as per Penning et al., (2009). Close to 15,000 UniformMu lines were screened using a series of pooled DNA samples. These lines were forerunners of the sequenceindexed materials currently available at MaizeGDB (maizegdb.org; UniformMu.UF genome.org). For PCR screening, genespecific primers were used along with TIR6 a Mu specific primer (Table 32) Resulting product s were separated on 1% agarose gels, blotted onto nylon membranes, and probed with genespecific PCR product s Where positive results w e re obtained in both x and y axes (as for CslD1 and CslD5 ), seeds from the identified UniformMu family were planted, leaf tissue was harvested, and DNA was tested by PCR for segregation of homozygous mutants. Growth C onditions for csld5 M utant A nalyses Maize seeds were sterilized by soaking in 15% bleach while stirring for 10 min, then rinsed thoroughly with water. Kernel s were allowed to imbibe water overnight and pericarps were manually removed. Seeds were arranged on wet germination paper in glass trays with embryos facing up, sprayed with Captan solution ( 1 % Captan), and covered in plastic wrap. Air was pumped throug h these trays to prevent CO2Fixation and S ectioning and ethylene buildup, and seeds were allowed to germinate. One cm long pieces of primary root from 10day old seedlings were collected and fixed in FAA (10% formaldehyde [Fisher Lot # 992720], 5% acet ic acid, 50% EtOH).

PAGE 73

73 Samples were vacuum infiltrated overnight at 4C, then shaken at 4C during a dehydration series using ethanol in PBS (60 min each, progressing from 1X PBS with 30% EtOH to 40%, 50%, 60%, 70%, 85%, and finally 95% EtOH). Samples were stained overnight with eosin in 95% EtOH, followed by four, 1hr incubations in 100% EtOH and eosin at 25C. Wax imbedding was initiated by introducing CitriSolv (Fisher Cat # 22143975) into samples using a series of 1hr incubations (while shaking) in e thanol with increasing CitriSolv/EtOH content (25/75, 50/50, 75/25,100/0). Paraplast wax chips (Fisher Cat # 23021 399) (1 g wax/mL CitriSolv) were added to the 100% CitriSolv and incubated overnight at 25C. Additional wax was added, followed by a 2hr incubation at 42C. Samples were transferred to 60C for 1 hr. Wax was pouredoff and replaced eight times before samples were allowed to harden in molds. Sections (10 m, cut with a Leitz 1512 microtome) were dewaxed with three, 5min incubations in xylene (Fisher Lot # 083423), then washed twice in 100% EtOH (5 min each), and once in 95% EtOH (3 min). Slides were dried and examined under an Olympus BH2 light microscope. Scanning E lectron M icroscopy Primary roots approxim ately 5cm long from csld5 mutant and nonmutant seedlings were fixed in FAA ( 10% formaldehyde [Fisher Lot # 992720], 5% acetic acid, 50% EtOH ) dehydrated in a n ethanol series 75%, 95%, 100% and critical point dried (Bal Tec CPD030, Leic a Microsystems, Bannockburn, IL). Dried samples were mounted with carbon adhesive tabs on aluminum specimen mount s, Au/Pd sputter coated (DeskII, Denton Vacuum, Moorestown, NJ) and examined with a field emission scanning electron microscope (S 4 000, Hitachi High Technologies America, Inc. Schaum burg, IL). Digital micrographs were acquired with PCI Quartz software.

PAGE 74

74 Isolation of R oot H air mRNA Maize seedlings were grown as above. When primary roots averaged 5 cm in length ( 10 days after germination), individual seedlings were suspended in liquid n itrogen until completely frozen. Root hairs were then harvested using a metal spatula to shatter them from the root body and into a small weigh boat of liquid nitrogen. Root hairs from around 150 individual seedlings were pooled to get approximately 100 mg, which were stored at 80 C until further use. A modified RNA extraction protocol was used to recover adequate amounts of RNA from root hairs. Total root hair samples were added to 200 L of extraction buffer (50 mM TRIS [pH 8.0], 150 mM LiCl, 5 mM ED TA [pH 8.0], 1% SDS), and ground in liquid nitrogen. Samples were allowed to thaw and immediately transferred to tubes containing 200 L of 1:1 Phenol Chloroform, shaken, and placed on ice for 5 min, with periodic mixing. Samples were transferred to 2 mL P hase L ock Gel tubes (Eppendorf, cat # 2302830) and centrifuged (10 min, 10, 000 x g, 4 C) After centrifugation, 200 L of 1:1 Phenol Chloroform was added, samples were well shaken, then centrifuged (10 min, 10, 000 x g, 4 C). Next, 200 L of Chloroform was added, samples were shaken then placed on ice for 5 min, with occasional mixing for centrifuging (10 min, 10, 000 x g, 4C). The a queous layer was poured into a new PHASE LOCK tube (Eppendorf) and 1 mL of TRIZOL ( Sigma, Lot # MKBD6639V ) was added. Tubes were shaken well for 15 sec and incubated at room temperature for 5 min. After incubation 200 L Chloroform was added, tubes were shaken, and incubated at room temperature for 3 min before centrifuging (10 min, 10, 000 x g, 4 C). The a queous layer was transferred to new microfuge tubes and 500 L of Isopropanol was added. Samples were mixed and placed on ice for 10 min before centrifuging (10 min, 10, 000 x g, 4 C) to precipitate RNA. Supernatant was removed by

PAGE 75

75 pipetting, 1 mL 70% EtOH was added, and samples were centrifuged (5 min, 10, 000 x g, 4 C). Supernatant was carefully removed by pipetting, pellets were allowed to air dry, and RNA was resuspended in 30 L water. Three prime A nchored 454 S equencing Libraries for 454based sequencing were prepar ed as per Eveland et al. (2008). Total RNA (5 g) from root hairs of B73, W22, and the B73 x W22 hybrid was used for cDNA synthesis (MessageAmp II, Ambion, Cat # AM1793) by priming with 6 pmol of biot inylated (T12) B adaptor oligo (modified from Margulies et al., 2005) (Table 32). Purified cDNA (DNA clear, Ambion) was bound to M 270 Strepdavidin Dyna beads ( Invitrogen, C at # 653.05), immobilized on a magnetic tube stand (Applied Biosystems, Lot # 0804015), and digested with Msp1 (Promega) to create 2base CG overhangs for adaptor ligation. A adaptor oligos (modified from Margulies et al., 2005) included 3base multiplex keys (Table 32). Adaptor pairs (topstrand and bottom strand for each sample [Table 32]) were combined and concentrated to 1 pmol/ L i n (10 mM Tris, 1 mM EDTA, 50 mM NaCl [pH 8.0]) and annealed by gradual 1C/min decreases (95C 4 C, holding at 72C for 30 min). Adaptors (5 pmol) with the correct multiplex keys were ligated to digested samples. Unligated adaptors were removed by washing beads twice with 1 X B&W (2.5 mM Tric HCL [pH 7.5], 0.25 mM EDTA, 0.5 M Nacl) followed by two washes with water. The template strands were eluted with 100 mM NaOH, neutralized, and concentrated on a Qiagen column (from RNeasy Plant Mini kit, Qiagen Cat # 74904) Sequencing was conducted as per Margulies et al., (2005) on a 454 GS 20 instrument (Roche Biosciences, Indianapolis, IN ).

PAGE 76

76 Analysis of 454generated S equence D ata Trimmed 454 reads were filtered for valid key code sequences and ligation junction sites (CGG) at 5` ends P oly A tails were trimmed to 6As at the 3 ` end using custom java based programs (courtesy of Don McCarty ). Trimmed sequences were assembled using CAP3 (genome.cs.mtu.edu/sas). The nonredundant set of consensus cDNA sequences wer e annotated by BLASTN searches of cDNA databases for maize. These included publicly available cDNAs on maizegdb. org and IUC, a collection of cDNAs provided by an industry consortium via a users agreement (maizeseq.org). Accession Numbers Accesion numbers for each of the gene sequences are At C sl D1 :AT2G33100.1, At C sl D2 :AT5G16910.1, At C sl D3 :AT3G03050.1, At C sl D4 :AT4G38190.1, At C sl D5 :AT1G02730, At C sl D6 :AT1G32180.1, Os CslD1 :AC027037.6, Os CslD2 :Os06g0111800, Os CslD3 :AC091687.1, Os CslD4 :AK242601.1, Os CslD5 :Os06g0336500, Zm C sl D 1 :GRMZM2G015886, Zm C sl D 2 :GRMZM2G052149, Zm C sl D 3 :GRMZM2G061764, Zm C sl D 4 :GRMZM2G044269, Zm C sl D 5 :GRMZM2G436299, At C es A7 : AT5G17420.

PAGE 77

77 Table 31. Three prime anchored 454sequencing transcript profiles. B73 B73xW22 W22 Combine d Total reads 27,675 36,816 14,957 79,448 Unique transcripts 5,634 6,815 3,972 10,618 Total reads from a single 454 titration run. Each library was key coded prior to combining for sequencing. Total reads are the number of individual sequences recover ed. Unique transcripts are the number of different genes represented based on alignment to cDNA collections. Table 32. PCR primers utilized in Chapter 3 For Real Time RT PCR Gene Forward primer Reverse primer CslD1 GCCGCTCACGTCAATGG CTGGGCATCTTCA TGGAGTGT CslD2 ACGTCTCCAACTCCCTCTTCAC CGGCTTCAACAGTGTC CslD3 TCCATCGTGTGCGAGTTCTG CAGCTTTGGCATCTGATCCA CslD4 ATGAAGGCCGAGGAGCAGTA CGCGTGACGCTGTTGAAC CslD5 GGGCGCTTCATCAGCTACTC GGACGTGGTAGTCCTGGAAGTC For reverse genetic grid screening Gene Forward pr imer Reverse primer CslD1 AGTTCGTGCACTACACCGTGCACATCC TGCTACCTGTAAGGACTGAGGATGGCCTG CslD2 TCTCACTGTCCCCCGTGACCTTCTGGATG ACTCTCCCAGGCTGATCCCCGACCACTTG CslD3 GTCAAGATGGAGGACCTCGTTGACAAGCC CTCCGCCATTGCTTCGAAGGTTAGCAGC CslD4 CCAACAACAACACCGTCTTC TTCGACGGC G TCTGCACGATGAAGAAGCCCGAGAAGAG CslD5 TTGTTCCTCCCATCCCATCCAGGCTCCTC TAGCACGCAAGCTTCTCGACGGGGTAGTC TIR6 AGAGAAGCCAACGCCAWCGCCTCYATTTCGTC For Three prime anchored 454 transcript profiling B adaptor B iotin CCTATCCCCTGTGTGCCTTGCCTATCCCTGTTGCGTGTCTCAGTTTTTTTTTTT T[AGC ] B73 top CCATCTCATCCCTGCGTGTCCCATCTGTTCCCTCCCTGTCTCAG AGC B73 bot. CG GTT CTGAGACAGGGAGGGAACAGATGGGACACGCAGGGATGA W22 top CCATCTCATCCCTGCGTGTCCCATCTGTTCCCTCCCTGTCTCAG ACA W22 bot. CG ATT CTGAGACAGGGAGGGAACAGATGGGACACGCAGGGATGA BxW top CCATCTCATC CCTGCGTGTCCCATCTGTTCCCTCCCTGTCTCAG ATG BxW bot. CG CTT CTGAGACAGGGAGGGAACAGATGGGACACGCAGGGATGA For sublibrary oligos, 3 bp keys are underlined. BxW: B73xW22 hybrid. bot = bottom.

PAGE 78

78 Figure 31. Cellulose synthaselike D ( C sl D ) genes from Arabidopsis, mai ze, and rice. Each of the C sl D gene coding sequences from maize (5), Arabidopsis (6), and rice(5), as well as Arabidopsis C es A7 are diagramed with exon/intron locations and sizes drawn proportionally. Untranslated regions are not included. Exons are represented by black bars and their length is indicated above each. Intron lengths are indicated in red.

PAGE 79

79 Figure 32. Cellulose synthaselike D proteins from Arabidopsis, maize, and rice. All of the CSLD proteins are diagramed as predicted from translat ion of CSLD genes of maize (5), Arabidopsis (6), and rice(5) Protein length is indicated above each diagram. Transmembrane domain predictions were generated using TMHMM (cbs.dtu.dk/services/TMHMM). Color scale shows the probability of a transmembrane domain, based on TMHMM output. The Zn finger like domains were predicted using SMART (smart.embl heidelberg.de). E values (from SMART output) for Znfinger like domains are indicated below each diagram, nd = not detected by SMART, but apparent in direct s equence visualization (see Figure 33).

PAGE 80

80 Figure 33. Protein sequence alignment and analysis of conserved motifs. All of the CSLD amino acid sequences from maize, Arabidosis, and rice, as well as two Cellulose Synthases (At CESA1 and At CESA7) were al igned using MEGA 4.0 ( www.megasoftware.net/ ). Predicted transmembrane domains are underlined. Domains of intrest were expanded for deatailed visualization. Near complete conservation was observed at the predicted active site of all the CSLD proteins. Ami no acids that characterize the GT family 2 processive glycosyltransferase (D, QxxRW) are starred. The alignment showing the RING type Zn finger motifs was ordered by conservation of the domain, and does not include putative CSLD proteins that lacked this domain Cysteine residues (expected Znbinding sites) are starred. The only consistent difference between proteins for which SMART recognized a Znfinger like motif and those it did not, was at position 17 of the RING type domain (arrow).

PAGE 81

81 Figure 34. Comparison of mutant phenotypes to CSLD protein phylogeny Neighbor joining tree of predicted protein sequences encoded by CslD genes in maize, rice, and Arabidopsis Reported phenotypes for null alleles are shown in red (Zm CSLD5 [Penning et al., 2009] Os CSLD1 [Kim et al., 2007], At CSLD2 [Bernal et al., 2008], At CSLD3 [Favery et al., 2001; Wang et al., 2001], At CSLD5 [Bernal et al., 2007], Os CSLD4 [Li et al., 2009], AtCSLD1 and At CSLD4 [Bernal et al., 2008]). At CslD6 and Zm csld3 are predicted to be psuedogenes. The tree was created using Mega 4.0 (megasoftware.net/mega.html; Tamura et a., 2007), with 2,000 bootstrap repetitions and a pairwise deletion option. Units are in amino acid substitutions per site.

PAGE 82

82 Figure 35. Quantitative RT PCR showing mRNA levels of the maize C sl D genes in selected tissues and stages of development Error bars represent standard errors from three biological replicates. Note that the scale bar is different for each gene, and for C sl D 3 and C sl D 4 expression in anthers (2dbp). dbp = 2 days before pollination.

PAGE 83

83 Figure 36. The root hair phenotype caused by mutation of C sl D 5 Note that although the csld5 roots appear hairless, they retain a capacity to initiate, but not necessarily elongate hairs ( see hair ini tials )

PAGE 84

84 Figure 37. Transcript profiles of maize root hairs. Analysis of the 50 most highly abundant transcripts as quantified by 3 ` anchored 454 sequencing revealed genes related to cell wall modification, redox regulation, and amino acid metabolism, among others Separate libraries were generated using cDNA from root hairs of B73, W22, and their F1 hybrid. Percentage of total reads represented by each gene when the three libraries were combined is charted on the left. Abundance in individual libr aries for each gene is charted on the right, and shown as message level in proportion to each library separately.

PAGE 85

8 5 CHAPTER 4 MUTATIONS OF CELLULOSE SYNTHASELIKE D1 DISRUPT CELL DIVISIO N AND LEAD TO A NARROW LEAF WARTY PHENOTYPE IN MAIZE Introduction Plant form depends on coordination of cell division and selective cell expansion (Sylvester, 2000; Szymanski, 2009) Cell wall deposition is centrally important to both of these processes, forming cross walls de novo during cell division, and excreting n ew cell wall material and cell wall modifying enzymes during cell expansion ( Cosgrove, 2005). Despite its central importance to plant biology, very little is currently understood about cell wall formation during cell division. Investigations of maize mu tants that show aberrant cell divisions, but maintain overall leaf shape, have led to the suggestion that an as yet undefined mechanism may main tain of leaf shape (Smith, 1996; Reynolds et al., 1998; Walker and Smith, 2002). For such a mechanism to accomodate aberrantly shaped cells, some cells must develop in ways that compensate for malformed ones (Walker and Smith, 2002). T he basis for such a mechanism remains uncertain. The rigid walls of plant cells mean cytokinesis by constriction is impossible, and plants have, instead, evolved elaborate mechanism s of cell division These involve cy toskeletal based organization of cellular bodies and targeting of cell wall material to a defined division plane. In this process, Golgi and endocytosis derived vesicl es containing cell wall polysaccharides, structural proteins, and enzymes are targeted to the division plane, where they merge to form the cell plate (Samuels et al., 1995; Staehelin and Helpler, 1996; Smith 2001 ; Dhonukshe et al., 2006). As vesicles fuse with the cell plate, this structure expands radially, spreading from the inner cell to the parental walls at the cell boundaries. The position of a new wall, determined by actin -

PAGE 86

86 myosin dependent alignment of the cell plate, is defined by markers associa ted with the preprophase band (Gallagher and Smith, 1999; Chaffey and Barlow 2002; Molchan et al., 2002). Others have highlighted the similarities between cell division and the targeted cell wall deposition seen in tipgrowing cells such as root hairs (B ednarek and Flabel, 2002). C allose is thought to be among the first polysaccharides deposited at a new cell wall (Samuels et al., 1995; Hong et al., 2001) However,current unknowns include how cellulose, hemicelluloses, pectins, and structural proteins are delivered, synthesized, and meshed to for m a functional wall. Work presented here provides evidence for an unexpected, but integral role for CSLDs (see Chapter 3) in plant cell division. In csld1 mutants of maize, defects in cell division are revealed as the probable cause for pleiotropic phenotypes that include reduction in plant growth, altered leaf morphology, distinctive epidermal warts, and changes in cell wall properties of stems Analysis of leaf blade epidermis shows that cells in csld1 mutants are consistently wider and fewer in number compared to wildt ype. This result along with the close association between csld1 expression and zones of cell division in basal regions of developing maize leaves, suggest s a role for CSLD1 in cell division. Ot her evidence for cell divisionrelated defects includes aberrantly shaped epidermal cells, disruption of cell files, an abundance of meganucleate cells, and misplaced and partially formed cell walls. These data provide new insights into the function of C SLD proteins during plant growth, expanding the understanding of their roles from that of tip growth alone, to include cell division and consequent pleiotropic effects on development.

PAGE 87

87 R esults An A llelic S eries of csld1 M utants in M aize E nabled F unctional A nalysis Seven independent loss of function mutants for the maize C sl D 1 gene were identified in reverse genetic screens, including two from the UnifromMu maize population (University of Flroida) and five from the Trait Utilities System in Corn ( TUSC) line s (Pioneer Hi Bred International ) (Fig. 4 1) The two UniformMu alleles, csld1 1 and csld1 2 were examined in the greatest depth because of their uniform genetic background (McCarty et al., 2005) Phenotypes of csld1 1 and csld1 2 homozygous mutants, as well as offspring from their reciprocal F1 hybrids were indistinguishable, thus demonstrating a causal role for the dysfunctional Zm C sl D 1 gene These plants showed overall reduced growth, narrow leaves, and had a rough leaf texture due to warty protrusi ons from the mature leaf epidermis. Genotypic analysis of over 200 individuals from segregating families showed a 100% correspondence between this phenotype and homozygosity for the csld1 1 mutation, as well as Mendelian segregation ratios typical of a recessive mutation (data not shown) Finally, the five other transposon insertions in C sl D 1 (courtesy of Pioneer Hi Bred Int.) also showed reduced vegetative growth, narrow leaves, and epidermal warts, regardless of the phenotypic variation and heterologous genetic backgrounds. Plant D ry W eight and O rgan W idth are R educed in csld1 M utants Overall growth and organ size were reduced in homozygous csld1 mutants (Figs. 4 2 and 4 3 ). However, general plant shape, leaf number, and flowering time, were similar fo r csld1 mutant and wildtype progeny under field and greenhouse conditions (data not shown). Mean height of mutant plants (to auricle of the uppermost leaf) was only 11 % (p < 0.001) less at maturity (Fig. 4 2 ), but more pronounced differences were

PAGE 88

88 evident in both above and below ground dry weight (reduced 44 % [p < 0.0025 ] and 49% [p < 0.002], respectively) (Fig. 4 2 ). Proportional reductions were evident for all organs examined, including ears, tassels, stalks, roots, and leaves. Length and width of mat ure leaf blades were also decreased, but disproportionally more so for width (35% [p < 0.0003]) than length (10% [p < 0.0003]) (Fig. 4 3 ) giving a narrow leaf phenotype. The reduction was proportional in all leaves examined, indicating a consistent defec t in lateral expansion rather than an ontological effect at specific leaf positions (Fig. 4 3 ). Leaf blade curling (adaxial rolling) was also a consistent feature of csld1 mutants (Fig. 4 4 ), and affected all leaves, regardless of position. B lade rolli ng was most apparent as leaves matured, and occurred regardless of watering regime or growing conditions (field or greenhouse). The amount of leaf blade rolling was greatest where size and extent of epidermal warts (see below) on the leaf was also maximal Although leaf rolling in non mutant maize plants is a common response to water stress, this aspect of the phenotype persis ted in well watered plants. Most likely, it is the leaf epidermis itself which promot es the curling effect as t he abaxial surface of mutant leaf blades accumulate relatively more warty cell clusters, thus extending the abaxial surface and caus ing the leaf to curl in the opposite (adaxial) direction (see below) Epidermal C ells B alloon into W arts on csld1 M utants The rough texture of csld1 mutant leaves was due to irregular swelling of epidermal cells and groups of cells (Fig. 4 5 ). This phenotype was observed along the entire length of mature leaf blades and midribs (Fig. 4 5 A), but not on leaf sheaths or stalks (data not shown). Some epidermal cells in warts expanded to many times their normal size (about 75fold greater volume), and were generally arranged in linear profiles along the longitudinal axis of the leaf blade (Fig. 4 5 B). Swollen cells remained

PAGE 89

89 fluid filled until th e onset of leaf senescence (Fig. 4 5 C). Warts were present on both surfaces of mutant leaf blades, but were larger and more abundant on the abaxial face (Fig. 4 5 D). As noted above, this was likely the cause of the rolledleaf phenotype (Fig. 4 4 ). Thes e malformed cells consistently lacked chloroplasts (Fig. 4 5 C, E), indicating an epidermal origin. Also, serial sectioning of the leaf revealed that the cells in the warts originated from the epidermal layer (Fig. 4 5 F, G). Ballooned epidermal cells in csld1 mutants often had diameters over 100 m, at least five times greater than epidermal pavement cell s in leaves of wildtype plants ( Fig. 4 5 G). Topographical data from SEM analyses and epidermal impressions allowed more specific definition of the surfac e dimensions and distribution of lesions, as well as analysis of their maximal growth and advanced development. Groups of warty cells were randomly interspersed with normal appearing regions of leaf epidermis (Fig. 4 6 A). C lusters of swollen cells tended to be evenly distributed over large areas, along the entire length of the leaf blade (Fig. 4 6 A ). B oth SEM and optical microscopy of fresh, intact leaves showed that lesions continued to grow until leaves reached full expansion, and that the largest clus ters often included swol len cells that had collapsed (Fig. 4 6 B, center panel). In other instances cells remained intact, even in lesions greater than 300 m wide (Fig. 4 6 B, right panel). Individual cells in these cluster were identified at least 5 fold wider and 3fold longer than more standard epidermal cells (Fig. 4 6 B, right panel). C ells of csld1 M utant L eaves are L arger, but F ewer in N umber We initially hypothesized that epidermal pavement cells in the narrow leaf mutants might also be narrow (where not ballooning), but the opposite was observed (Fig. 4 7 ). Examination of epidermal impressions from non warty areas of mutant and

PAGE 90

90 nonmutant leaves revealed that although there was no significant difference in cell length, there was a consistent inc rease in width of mature csld1 mutant epidermal pavement cells (p < 0.0003). This 17% greater cell width, together with 35% narrower leaves indicated that mutant plants had fewer total epidermal cells across their width. This decrease in cell number translated to an estimated 40 45% reduction in epidermal cell divisions compared to wildtype. Further analyses showed that csld1 mutant leaf blades were also visibly thicker, with less distance between vascular bundles (Fig. 4 8 top three panels). Fully ex panded csld1 mutant leaf blades were on average 40% (p < 0.004) thicker than nonmutant leaf blades (Fig. 4 8 lower left ). To determine whether this increase in thickness was due to larger epidermal cells alone or nonepidermal cells as well, inter epidermal distance was measured. Sub epidermal contributions to total leaf thickness were proportional to epidermal contributions, being 43% (p < 0.002) greater for csld1 mutant leaf blades (Fig. 4 8 lower left). The csd1 phenotype is therefore not limited t o the epidermis alone. Additionally, mutant leaves showed a 12% (p < 0.03) increase in vascular bundle density (Fig. 4 8 lower right), an effect also evident from visual appraisal. These data, along with average leaf width (excluding the midrib) of 80.2 mm for nonmutant and 51.1 mm for mutant leaves (Fig. 4 2 ), were used to estimate the number of vascular bundles across the widest portion of fully expanded leaves. Resulting values were 601 and 429 vascular bundles per leaf, for nonmutants and csld1 mu tants, respectively (Fig. 4 8 lower right).

PAGE 91

91 Stalks of csld1 M utants C ontain A ltered V ascular B undle N umber and C ell W all P roperties Analysis of mutant stalks confirmed that organ width and vascular bundle number were also affected elsewhere in csld1 mu tant plants (Fig. 4 9 ). Cross sectional area of csld1 mutant stalks was reduced by 24% (p < 0.025) on average compared to nonmutant stalks (Fig. 4 9 ). As with leaf blades, total number of vascular bundles was also decreased. At the third internode from the ground, mutant plant stalks had an average of 11% (p < 0.025) fewer vascular bundles than nonmutant stalks (Fig. 4 9 ). Again as observed for mutant leaves, csld1 mutant stalks had more vascular bundles per unit area than nonmutants, with a n average of 2.0 (SE, 0.1) bundle per mm2 compared to 1.7 (SE, 0.1) bundle per mm2 To further characterize differences between mutant and nonmutant stalks, high resolution X ray micro computed tomography (micro CT ) was employed on handcut stalk sections (Fig. 4 10 ). Three dimensional reconstruc tion of these data revealed a shift in the distribution of cell wall thickness between mutant and nonmutant stalks with mutant walls in this tissue generally thinner (Fig. 4 10). Additionally, this approach allowed comparison of the density of cell wall material, which was greater for cell walls of csld1 mutant stalks ( as measured by X ray beam attenuation) compared to nonmutant stalks (Fig. 4 10 ). for nonmutants across the entire stalk (Fig. 4 9 ). This increase was partly due to the relative increase in rindto pith ratio in csld1 mutants, but even in the central pith, great er vascular bundle density was evident. Cell W all S ugar C omponents were not D etectably A ltered by L oss of C sl D 1 F unction With the goal of determi ning whether the changes in wall material properties from stem sections observed via micro CT were reflected in global changes in cell wall

PAGE 92

92 polysaccharide composition, we examined cell wall composition from mature leaf blades as well as isolated leaf epid ermis of both mutant and wildtype plants. No significant differences in alcohol insoluble cell wall composition were found between wildtype and csld1 mutants for either cellulose or sugar subunits of noncellulosic constituents (Table 4 1). Cell walls fr o m epidermal cells of both genotypes revealed distinctive composition relative to samples from wholeleaf blades. Specifically epidermal cell walls had less glucose, rhamnose, galactose, and galacturonic acid, but relatively more xylose, compared to whol e leaf blades (Table 4 1). Levels of M aize CslD 1 mRNA a re G reatest in R egions of A ctive C ell D ivision In order to view the phenotypes of csld1 mutants in context of where the wildtype gene is expressed, quantitative RT PCR was used to determine levels o f C sl D 1 mRNA across diverse tissues and stages of development (Fig. 4 1 1 ). Highest levels of C sl D 1 transcript were evident in young, preemergent leaves (inside the whorl), with lesser expression in young primary roots and bases of more mature leaves (Fig 4 1 1 A). To more clearly define the pattern of transcript accumulation during leaf development, staged samples of very young to mature leaves were analyzed. The C sl D 1 mRNA was most abundant in tissues containing actively dividing cells, highest in shoot s 6 days after germination (Fig. 4 1 1 B). Samples of more mature, single leaves showed that basal portions of blades from expanding leaves 1525 cm long had the greatest levels of C sl D 1 mRNA accumulation. By the time of cessation of cell division in fully expanded leaves, C sl D 1 mRNA dropped to un detectable levels and remained nearly undetectable in the fully differentiated portions of leaves (Fig. 4 1 1 B).

PAGE 93

93 Multiple C ell D ivision D efects are E vident in csld1 mutant E pidermis. Dark field images of singlecelllayer epidermal peels from mature leaf blades showed that t he normally highly ordered epidermal cells of maize leaves were disrupted in epidermis of csld1 mutant s (Fig. 4 1 2 ). Also striking was the extent of apparent cell division anomalies in the mut ant epidermis ( Fig. 4 1 2 ). C ell wall stubs were commonly observed in samples from mutant plants, where cells apparently failed to complete cell division (Fig. 4 1 2 ). These incomplete cell walls were observed exclusively in the longitudinal plane (Fig. 4 1 2 ). O ther frequent occurrences of altered cell shape and misaligned cell walls also implicated celldivision defects as the cause (Fig. 4 1 2 ). To determine when these cell abnormalities could first be detected, fresh, 5 10 cm immature leaves of csld1 m utant and wildtype plants were stained with propidium iodide. Confocal microscopy imaging of abaxial epidermal cells from the pre and post differentiation zones (determined by the absence/presence of stomata) reveal ed disrupted cell files and misshapen cells (Fig. 4 1 3 A, B) similar to what was observed in epidermal peels of mature leaves (Fig. 4 1 2 ). Cell wall stubs were frequently observed in both preand post differentiation epidermis (Fig. 4 1 3 ). Again, they were typically oriented in the longitud inal direction (Fig. 4 1 3 ). While many epidermal cells at these stages were approximately twice the normal width (as if they failed to undergo a single division), nearly all cells of csld1 mutants were visibly larger than wildtype (Fig. 4 1 3 A, B), support ing the findings that even nonwarty, otherwise normal looking cells, were wider in the mutant (Fig. 4 7 ). In m ultiple instances a series of large epidermal cells were located at positions normally inhabited by two distinct cell files indicat ing either failure of consecutive neighboring cells to divide or, more likely a clonal file derived from a single cell that failed to complete division, as indicated by oppositely facing cell

PAGE 94

94 wall stubs at either extreme of such cell files (Fig. 4 1 3 C). Three dimensional imaging with confocal microscopy identified a large number of gaps in cell walls that initially appeared complete (Fig. 4 1 3 D), suggesting the many more walls than at first apparent were incomplete. Because cells with large or multiple nuclei are commonly observed in cell division defective mutants ( Smith et al., 1996; Lukowitz et al., 1996; Spitzer et al., 2006), propidium iodide stained nuclei were examined in immature csld1 mutant leaves (Fig. 4 1 4 A ). Compared to wildtype epidermis of the same stage (predifferentiation zone of 510 cm leaves), csld1 mutant cells generally had larger appearing nuclei (Fig. 4 1 4 A). While significant variation in nuclear size was observed even in wildtype tissue, the range in csld1 mutants was much greater, with cells containing nuclei ranging from normal to approximately four times larger in size (Fig. 4 1 4 A). Large nuclear size was generally correlated with large cell size (Fig. 4 1 4 A ). Flow cytometry of nuclei from basal regions of immature leaves showed a sm all, but significant (p < 0.05), increase in ploidy level in csld1 mutants compared to wildtype (Fig. 4 1 4 B). Relatively more tetraploid nuclei were identified in csld1 mutants than in wildtype, while no significant differences were observed at any other ploidy level (Fig. 4 1 4 B). D iscussion The CSLD1 Enzyme A ppears to A ffect a M echanism O ther than T ip growth P revious results suggested specific functions for CSLD proteins in tipgrowing cells (Bernal et al., 2008), but data here and elsewhere indicate broader developmental roles as well Disruptions in At C sl D5 Os C slD4 and Zm C sl D 1 in particular (Bernal et al., 2007; Li et al., 2009) lead to reduced overall plant growth without visibly altering classic tip growing cells (root hairs and pollen tubes ). Among the

PAGE 95

95 reducedgrowth phenotypes, maize csld1 is unique in production of visible epidermal warts. This difference might lie in the greater growth and expansion of maize leaves. In other respects, however, commonalities between the reducedgrowth phenotypes suggest a shared function for this subgroup of CSLDs. The M aize C sl D 1 G ene is E ssential for N ormal P lant D ry W eight and O rgan W idth An underlying basis for the plei o tropic csld1 phenotype is indicated by the proportional reduction in dry mass (~45%) and size affecting all organs including leaves, shoots, roots, tassels and ears (Figs 4 2 4 3 and data not shown). A reduction in cell number was partially compensated by an increase in average cell size, and in epidermis of narrow leaves, expansion was increased only in the lateral direction. These results are broadly consistent with work on other, nonallelic warty mutants in maize that suggest a compensatory mechanism in young leaves which might regulate the balance between cell division and expansion, especially in response to defects that could alter organ shape (such as the disrupted cell divisions and epidermal lesions shown here) (Reynolds et al., 1998). While this is compatible with a primary defect in division rate or total number of c ell divisions, indirect effects at the wholeplant level could also reduce dry matter accumulation. The narrow leaves of csld1 mutants, for example, are likely to result in decreased photosynthetic capacity and the smaller root system may further reduce g rowth (Figs. 4 3, 4 4 ). Finally, the epidermis may have a prominent physical role in organ expansion and meristem geometry (Green, 1980; Moulia, 2000) providing additional potential for secondary or tertiary affects of the csld1 mutations.

PAGE 96

96 Warty C ells R epr esent D istinctive and I nformative F eatures of M aize csld1 M utants Warts created by excessive swelling of epidermal cells on csld1 mutant leaves (Figs. 4 5 4 6 ) result from apparent cell division flaws early in leaf development. The epidermal lesions wer e broadly distribut ed across leaf blades, with essentially any epidermal cell having potential to swell ( including, albeit rarely, stomata or trichomes). This lack of a discernable pattern or position dependence of wart formation is consistent with a random process for determining which epidermal cells have division defects during development (Fig. 4 5 ). Whether cell division defects alone are responsible for the entirety of epidermal wart formation remains unclear. Another possibility is that altered cell walls (missing a CSLD1 product) are weakened and less able to withstand normal turgor pressure. Swelling of weakened epidermal cells in the mutant would lead to further weakening (stretching/thinning) of the cell wall, and a still greater tendency to expand. This abnormal expansion would in turn enhance physical stress on cell walls of neighboring cells, which could account for the lateral spreading that is observed in warty lesions. The suggestion of moreeasily stretched cell walls would be consis tent with the larger size of even the nonballooned epidermal cells as well as the later development of swollen cell clusters. Possibly analogous w art like epidermal swellings were described by Burton et al., (2000) in a VIGS gene silencing experiment i n tobacco. Although a CESA gene was targeted, conceivably the highly similar CSLD genes may also have also been silenced. In any case, the transgenic tobacco had a reduced stature, chlorotic regions, and a relatively crisp or crunchy texture [with] numerous surface lumps predominately on

PAGE 97

97 the abaxial side of leaves (Burton et al., 2000). This csld1 like phenotype would be consistent with some degree of repression of the Zm C sl D1 ortholog in the tobacco experiment. Alternatively, if observed lesions did result from downregulation of CESA genes alone, then this would be consistent with a role for CSLD proteins in cellulose biosynthesis (Doblin et al., 2001). Larger, N onwarty E pidermal C ells S uggest a L imitation in C ell D ivision The combination of n arrower leaves and wider pavement cells resulted in an estimated 45% fewer epidermal cells across a mutant leaf blade (Fig. 4 7 ), supporting an early role for CSLD1 in leaf development The majority of mutant leaf epidermal cells while wider than normal do not form warts and have a standard pavement cell appearance, with typical neighbor cell boundaries suggesting a link between CSLD1 and the number of cell divisions in developing leaf epidermis Similar effects were evident in internal leaf structures, where nonepidermal cells contributed to thicker leaf blades for csld1 mutants (Fig. 4 8 ). While e xamination of cross sections suggested that leaf vascular bundle number and density was altered in mutant leaves, the size and shape of vascular bundles w ere generally unchanged (Fig. 4 8 ). Instead, the greater thickness of csld1 leaf blades was due to increased mesophyll cell size, indicating a broader role for CSLD1 than epidermal development alone. Alternatively, a less expanded epidermis might constrain internal structures (mesophyll and bundle sheath cells) into a more limited space, resulting in leaf swelling. Cell W alls of the csld1 M utant are T hinner and M ore D ense, but of N ormal C omposition While the overall quantity of cell wall material is reduced in the csld1 mutant plants by 45%, cell wall composition is largely unaffected (Table 4 1). There are several

PAGE 98

98 alternative possibilities that may account for a lack of detectable differences in cell wall composition between mutant and wildtype leaves, or in epidermal peels alone. First it is possible that the CSLD1 polysaccharide product may normally be present in only very small amounts and thus be masked by more abundant polymers. Alternatively, the CSLD1 product may be synthesized early in development, but not be abundant in mature leaves, such as those analyzed here. Levels of C sl D 1 mRNA were maximal in very young leaves and basal portions of fast growing leaves, the zone most active in cell division (Sylvester et al., 1990; Freeling, 1992), as w ell as in primary root tips (Fig. 4 1 1 ). Another interpretation could be that the CSLD1 enzyme might synthesize a limiting constituent of specialized cell walls, such that when production is limited, other cellwall polymer synthesis is similarly reduced. In this way, csld1 mutants may produce less total cell wall, but remain unchanged in relative proportions of individual cell wall constituents. In this respect, the implication that CSLD1 has an essential role in formation of new cell walls during cell division is intriguing. High resolution X ray micro CT technologies allow for detailed structural analyses of internal regions of intact tissue, including the relative density of cell wall material, based on x ray beam attenuation (Steppe et al., 2004; Dh ondt et al., 2010). Examination of csld1 mutant and nonmutant stem sections revealed increased wall density and a shift in the distribution of cell wall thickness (Fig. 4 10). These findings suggest an altered architecture for these cell walls that coul d be independent of a change in composition, and led to the hypothesis that these changes may reflect a relative increase in cellulose crystalinity, with decreased amounts of amorphous cellulose being present in the cell walls of csld1 mutant s.

PAGE 99

99 Maize C sl D 1 has a R ole in P lant C ell D ivision The primary evidence supporting a role for CSLD1 during cell division lies in the degree to which csld1 mutations disrupt the otherwise highly ordered epidermal cell files (Fig. 4 1 2 ). The appearance of incomplete cros s walls between what would normally have been two cells, indicate a failure of cells to complete division. This observation may be interpreted in several ways. First, it is possible that the polysaccharide product of the CSLD1 enzyme functions in cell pl ate formation. If this constituent is limiting, cell plates may be less likely to form correctly or completely. Alternatively, because epidermal cells in csld1 mutants are abnormally large prior to initiation of cell division (Fig. 4 1 3 ), cell plates may be unable to readily span the entire length of a cell, leading to incomplete cell wall format ion. Both could also be true. The observation that cell wall stubs were almost universally oriented in the longitudinal direction (Fig. 4 1 2 4 1 3 ) suggested a bias towards effecting longitudinal cell division defects, rather than lateral divisions. Whether this indicates separate mechanisms for these two types of cell division remains unclear. Celllevel abnormalities were evident even at the earliest stages o f leaf blade development examined (Fig. 4 1 3 A ). Uneven and disrupted cell files, large and misshapen cells, and incomplete cell walls within a cell are all indicative of defects in cell division (Fig. 4 1 3 A, B ). Even undifferentiated regions of epidermis contained some cells which occup ied a two dimensional area over 3 0 fold greater than a standard epidermal pavement cell. The presence of long files of cells being uniformly large (Fig. 4 1 3 C) suggests either the congruent failure of a string of cells to complete cell division, or clonal inheritance, where one mis divided cell gives rise to abnormally large daughter cells. Without the support of the highly ordered, brick like pattern of wildtype epidermal

PAGE 100

100 cells, the large, misshapen and unorganized epider mal cells in the csld1 mutants seem prone to excessive expansion during turgor driven growth The defects in cell division at the earliest stages of leaf development might account for the entirety of the warty phenotype of the csld1 mutants. In this way, the polysaccharide product of CSLD1 might have its direct role limited to cell division, and its presence may be essentially transitory. An interesting aspect of maize leaf epidermis shown here is the differential effect of csld1 mutations on lateral a nd longitudinal cell divisions. Only longitudinal divisions seem to be affected by mutations of C sl D 1 possibly indicating a highly specific role for CSLD1 activity. Supporting evidence includes reduced leaf width (but not length) (Fig. 4 3 ), reduced cel l width (but not length) (Fig. 4 7 ), and the exclusivity of cell wall stubs being oriented only along the longitudinal axis (Figs. 4 1 2 4 1 3 ). Additionally, the long files of uniformly undivided cells demonstrate that in csld1 mutant epidermis, lateral divisions have the capacity to reach completion across cells twotimes their normal width (Fig. 4 1 3 ). The same was not evident for divisions parallel to the leaf axis however, and consequences are consistent with the linear, clonal propagation of a singl e mis divided cell into a file of subsequently ballooning cells observed here. Largenucleate cells have been reported in studies of cell divisiondefective mutants ( Lukowitz et al., 1996) In predifferentiation zones of csld1 immature leaves, abnormally large cells were consistently observed to contain l arge r nuclei than normal (Fig. 4 1 4 A). Compared to confocal imaging, where a large number of cells (estimated at 40 50%) contained excessively large nuclei, flow cytometry showed only a modest increase i n endoreduplication (Fig. 4 1 4 B). This result fits with the interpretation that

PAGE 101

101 the large nuclei phenotype predominately affects the epidermis. Even with 50% of epidermal cells undergoing endoreduplication, the relative scarcity of these cells compared t o other leaf cells would result in partial masking of the effect when analyzing nuclei from wholeleaf tissue s. Whether the increase in endoreduplication and larger nuclei size reflects a response to larger cell size or the arrest of the cell cycle after DNA replication but before nuclear division remains unclear. The arrest of cells at the G2 phase would implicate a cell wall biosynthetic enzyme in feedback to the cell cycle, and seems unlikely. More likely, when a mis divided cell (with two nuclei) under goes later divisions, the nuclei would replicate and segregate as tetraploid nuclei, and be passed on as such in future divisions. Broader P erspectives The unique features of the csld1 phenotype observed in maize provide insights into the function of the C sl D sub family in all plants Data demonstrate a link between this putative cell wall polysaccharide synthase and cell division during early maize leaf development, as well as connections between early cell divisions and subsequent organ development. The disproportionate reduction in plant dry weight compared to plant height can be accounted for by the larger but fewer cells, as observed in leaf epidermis (Fig. 4 7 ), along with thinner cell walls, as indicated by micro CT analysis of mature stems (Fi g. 4 10 ). Together, along with narrow leaves (Fig. 4 3 ) and smaller stems (Fig. 4 9 ), these effects could account for the decrease of dry weight by 45% in mutant plants reduced in stature by only 11% (Fig. 4 3 ). In contrast to previous analyses of C sl D f amily members, our results show that maize C sl D 1 mutations have a dramatic effect at the wholeplant level and on leaf epidermis in particular. These studies contribute a new dimension to the underst anding of CSLD protein function in plants

PAGE 102

102 Some aspects of the csld1 phenotype reported here have also been observed in other mutants. Among these are the similar (but less severe) clusters of swollen, epidermal cells reported in the warty 1 maize mutant (Reynolds et al., 1998). However, the csld1 mutants described here show distinctive changes in stature, leaf width, and morphology not observed elsewhere. Also, maize tangled1 mutants show irregular cell divisions in leaves, but maintain their overall shape and plant architecture (Smith et al., 1996). Init ially, the leaf epidermal surface of these mutants may seem similar to that of csld1 but in leaves of the tangled1 mutants, aberrantly dividing cells are evident in all cell layers, as opposed to the prominent epiderm al locale in csdl1 (Smith et al., 1996; Cleary and Smith, 1998). The Tan gled1 gene encodes a microtubule binding protein (Smith et al., 2001). While at first glance it might seem surprising that a CSLD protein would be involved in the development of nontip growing cells like maize epide rmal pavement cells, upon consideration, cell division involves a strikingly similar process to that of tipgrowth. Cell plate formation during cell division has many parallels with the process of tip growth, including the delivery of cell wall material being focused to a very specific subcellular position via cytoskeletal mediated organization of the exocytic pathway machinery (reviewed in Bednarek and Falbel, 2002). O ther examples of individual proteins from common f amilies functioning in either tip gro wing cells or cytokinesis include the formins (Ingouff et al., 2005; Backues et al., 2007) and ROP GTPases (Molendijk et al., 2001; Xu and Scheres, 2005).

PAGE 103

103 Methods Identification of csld1 M utants The UniformMu population was screened using PCR based assays to identify Mu transposon inserts in Zm CslD1 as per Penning et al., (2009). Close to 15,000 UniformMu lines were screened using a series of pooled DNA samples, which were forerunners of the sequenceindexed materials currently available at MaizeGDB (m aizegdb.org; UniformMu.UF genome.org). For PCR screening, C sl D 1 specific primers (AGTTCGTGCACTACACCGTGCACATCC and TGCTACCTGTAAGGACTGAGGATGGCCTG) were used along with the Muspecific primer TIR6 (AGAGAAGCCAACGCCAWCGCCTCYATTTCGTC). Resulting products were s eparated on 1% agarose gels, blotted onto nylon membranes, and probed with a CslD1 specific PCR product ( Fig. 4 1 ). Positive probebinding samples were identified at X45:Y4 of the UniformMu Reverse Genetics Grid 6 (of 8 total) ( Fig. 4 1 ). Seeds from this UniformMu family corresponding to these coordinates (04S 1130 27) were grown, and PCR genotyped to identify individuals homozygous for an insertion in csld1 The csl d 1 1 allele was identified from this family, and a csld1 1 line established after three g enerations of successive backcross es to the W22 inbred. A second mutant allele, csld1 2 was identified during a visual screen of fieldgrown UniformMu lines. Its phenotype was indistinguishable from that of csld1 1. PCR primers (ACCAGATCCTCTTCCTCCTCGG TTTGC, ACCTTGTTCCTGAGGAAGTCCCTCTTC, GTGGTGATCACGCTGGCATCATTCAG, AGGAGGGCTGATGTAGACCCACAG,) were designed to cover nearly the entire length of the C sl D 1 gene and identified a Mu insertion in the third exon. Homozygous recessive mutants of this allele were obtained from segregating progeny from this

PAGE 104

104 family, and used to generate csld1 2 line after two successive backcrosses into the W22 inbred. Additional Muinsert alleles of csld1 were identified f rom the The Trait Utilities System in Corn (TUSC) population of Pioneer Hi bred as per McCarty and Meeley, (2009). Primers used were: ACCAGATCCTCTTCCTCCTCGGTTTGC, ACCTTGTTCCTGAGGAAGTCCCTCTTC, GTGGTGATCACGCTGGCATCATTCAG, AGGAGGGCTGATGTAGACCCACAG, which identified five additional mutant alleles designated csld1 3 t hrough csld1 7 (Fig. 4 1) Overall P henotypic A nalyses and S ize M easurements Plant height was meas ured from soil level to auricle at the base of upper most leaf blades for 55 fieldgrown, mature plants (25 mutant, 30 nonmutant). These same 55 plants w ere used to measure width (at the widest point) and length of leaves at positions three, four, and five (relative to the apex). For dry weight measurements, wholeplant samples (including released root mass) were collected three days after ear harvest and did not include mature ears. Samples were weighed after drying for 4 weeks at 38C. Below and aboveground dry weights were determined by separating root masses from the aerial portions of these plants. Leaf thickness was measured on images from csld1 m utant and non mutant sectioned leaf blade pieces (4 each) Non epidermal contributions were determined by measuring the inter epidermal space of each of these pieces Total thickness and inter epidermal space were reported as averages of 10 independent m easurements. Vascular bundles per leaf were estimated by multiplying the average vascular bundle density by the average leaf width (excluding midrib).

PAGE 105

105 For analysis of leaf blade conformation (adaxial curling), leaf blades were harvested from position three during the anthesis silking interval of mutant and nonmutant greenhousegrown plants. Samples included 1cm sections from the base, middle, and tip of each blade (Fig. 4 4 ). Excised leaf strips were allowed to assume their natural conformations, and imaged immediately. Cell V olume E stimates Extent of maximal expansion was estimated for ballooning epidermal cells of the csld1 mutant by comparing their volume to standard epidermal pavement cells of wildtype plants. Cell were considered to be roughl 2Epidermal I mpressions and N onwarty C ell S ize D etermination m), with wildtype pavement cell dimensions approximately 40 m (diameter) x 200 m (length) (Figs 4 5 4 6 ). Ballooned epidermal cells of blades from csld1 mutant plants were often as large as 200 um (diameter) x 600 m (length) (Figs 4 5 4 6 ). Fresh samples from mature leaves of greenhousegrown plants were cut into 2 cm2Tissue F ixation and S ectioning pieces and firmly pressed into Superglue on glass slides. Glue was allowed to dry completely befor e leaf tissue was removed, leaving detailed epidermal impressions. These were imaged under a light microscope ( Olympus BH2) with an RT SPOT camera (Diagnostic Instruments). Average cell length and width were determined by quantifying the total number of cells in a given distance (1.88 x 1.40 mm). Longitudinal and lateral transects were used that did not include warty protrusions. One cm squares were excised from leaves of greenhousegrown plants and fixed in FAA (10% formaldehyde [Fisher Lot # 992720], 5% acetic acid, 50% EtOH). Samples were vacuum infiltrated overnight at 4C, then shaken at 4C during a

PAGE 106

106 dehydration series using ethanol in PBS (60 min each, progressing from 1x PBS with 30% EtOH to 40%, 50%, 60%, 70%, 85%, and finally 95% EtOH). Samples were stained overnight with eosin in 95% EtOH, followed by four, 1hr incubations in 100% EtOH and eosin at 25C. Wax imbedding was initiated by introducing CitriSolv (Fisher Cat # 22143975) into samples using a seri es of 1 hr incubations (while shaking) in ethanol with increasing CitriSolv/EtOH content (25/75, 50/50, 75/25,100/0). Paraplast wax chi ps (Fisher Cat # 23021 399) (1 g wax/mL CitriSolv) were added to the 100% CitriSolv and incubated overnight at 25C. A dditional wax was added, followed by a 2hr incubation at 42C. Samples were transferred to 60C for 1 hr. Wax was poured off and replaced eight times before samples were allowed to harden in molds. Sections (10 m, cut with a Leitz 1512 microtome) were dewaxed with three, 5min incubations in xylene (Fisher Lot # 083423), then washed twice in 100% EtOH (5 min each), and once in 95% EtOH (3 min). Slides were dried and examined under a Olympus BH2 light microscope. S canning E lectron M icroscopy Mature l eaf pieces (1cm2) from csld1 mutant and nonmutant plants were fixed in FAA ( 10% formaldehyde [Fisher Lot # 992720], 5% acetic acid, 50% EtOH ) dehydrated in an ethanol series 75%, 95%, 100% and critical point dried (Bal Tec CPD030, Leica Microsystems, Bannockburn, IL ). Dried samples were mounted with carbon adhesive tabs on aluminum specimen mount s, Au/Pd sputter coated (DeskII, Denton Vacuum, Moorestown, NJ) and examined with a field emission scanning electron microscope (S 4000, Hitachi High Technologi es America, Schaumburg, IL). Digital micrographs were acquired with PCI Quartz software.

PAGE 107

107 Phloroglucinol S taining and S talk M easurements Cross sections of stalks from fieldgrown plants were examined using handcut sections (about 5 mm) from midway u p the second internode (from ground level). Tissue was stained by incubating 45 sec in Phloriglucinol (1% in 95% EtOH), then adding excess 25% HCl. Images were acquired using a RT SPOT camera (Diagnostic Instruments) attached to a Leica MZ 125 dissection microscope. Crosssectional area for these sections was determined using ImageJ software (rsbweb.nih.gov/ij/index.html). Vascular bundle density was determined by dividing the number of vascular bundles per section by the cross sectional area. High resol uti on X ray Micro Computed Tomography A nalysis Field grown plants were collected three days after harvesting ears and dried at 38C for three weeks. Sections (~0.5 cm) from mid way up the second internode of the conditioned stems (~9% moisture content) were cut using a small band saw and scanned using a Scanco Medical Ag uCT35 instrument (Brttisellen, Switzerland) Initial measurements were conducted on wholestem sections at 10 micron resolution. Regions including pith and rind (3 x 4 mm) were handcut from the edge of these sections and scanned at 3.5uM resolution over a 0.88 mm high region for quantitative measurements of cell wall and air space sizes The 232 slices from each scan were reconstructed into three dimensional images and contoured ov er whole stem s for volumetric analyses. Scans at 3.5 micron and 10.0 micron resolutions were conducted with integration times of 600 microseconds and averaging two times. Both a fixed, common threshold and an adaptive threshold were used to segment cell w all from airspace and volumetric analyses were calculated with an algorithm developed for trabeacular bone (Hildebrand and Ruegsegger, 1997). For rind only analyses, hand-

PAGE 108

108 drawn contours were used to isolate the vascular bundlerich region along the edge o f the stem prior to 3D reconstruction. Epidermal I solation Epidermal peels were manually removed from the abaxial surfaces of fully expanded leaf blades from greenhousegrown plants. Each of the peels were harvested as in Fig ure 4 15. For dark field ima ging, peels were placed on droplets of water on glass slides and allowed to dry. For cell wall composition analysis, 100 mg of peels were collected, frozen in liquid nitrogen, and stored at 80C until cell wall extraction. Cell Wall Composition Analysis Samples from leaves and epidermal peels were ground in liquid nitrogen along with 200 L of extraction buffer (50mM Tris Cl with 1% SDS at pH 7.2). Homogenate was transferred to 14mL polypropylene, roundbottom tubes (Falcon product # 352059) along wit h 9 mL of extraction buffer, incubated for 15 minutes at 80C, and centrifuged at 3 500 rpm for 5 min (~2,000 x g) in a swinging bucket rotor centrifuge (ThermoForma 1LGP). Supernatant was removed with an aspirator, and pellets (water insoluble cell wall fraction) were washed, resuspended, and repelleted three times in about 10 mL 80C water. The same process was repeated three times with 50% EtOH at 80C, followed by three washes with 80C water. Samples were transferred to 1.5mL Eppendorf tubes, alc ohol insoluble cell wall fractions were pelleted and dried, and composition was analyzed by the Complex Carbohydrate Research Center (University of Georgia; Athens, GA). For cellulose content, the alcohol insoluble cell wall fractions from wholeleaf sa mples were isolated in the same way, dried for 16 h at 60C, transferred to 14 mL

PAGE 109

109 polypropylene, roundbottom tubes and weighed. For each sample, approximately 50 mg of cell wall isolate was used, to which 3 mL 80% aqueous acetic acid and 300 L 70% nitr ic acid were added. Tubes were incubated in an oil bath at 110C and 120C for 20 min each, to hydrolyze hemicellulose and lignin (from Sun et al., 2004). Samples were allowed to cool, 1.8 mL distilled water was added, tubes were centrifuged for 5 min (~ 2,000 x g) and supernatant was removed with an aspirator. Celluose was rinsed thoroughly with water (3 times ) and 95% EtOH (3 times ), and dried for 16 h at 60C. Samples were weighed and compared for cellulose content as a fraction of alcohol insoluble cell wall isolate. Real Time Quantitative RT PCR For each sample, RNA was extracted from approximately 200 mg of tissue, initially frozen in liquid nitrogen, then homogenized in 1.0 mL Trizol (Invitrogen Cat # 15596018) using a Q BIOgene FastPrep 120 with Lysing Matrix D (MP Biomedicals Cat # 116913). Samples were incubated 5 min at 25C, with frequent vortexing. Chloroform (200 L) was added and samples were vortexed 15 sec before and after a 1min incubation at 25C. Phases were separated by centrifug ing 10 min at 15,000 x g, and 200 L of the aqueous layers were transferred to 700 L of Qiagen RLT buffer (from RNeasy Plant Mini kit, Qiagen Cat # 74904). Ethanol was added (500 L, 100% EtOH) and samples were vortexed. Half of this volume was used to clean and elute total RNA as per RNeasy Plant Mini kit (Qiagen Cat # 74904). Resulting RNA was treated with DNase 1 (Ambion Cat # AM1906), and quantified using a BioRad SmartSpec 3000. The cDNA was synthesized using SuperScript OneStep kit and protocol (Invitrogen Cat # 10928042).

PAGE 110

110 Levels of C sl D 1 mRNA were quantified in diverse maize tissues and in leaf blades at a range of developmental stages via Real time RT PCR using a Step One Plus Real Time PCR System (ABI Carlsbad, CA ). At least three biologi cal replicates were analyzed for each tissue or time point, and for each of these replicates, reactions were performed in duplicate. A given reaction included 10 L Fast SYBR Green Master Mix (ABI Lot # 1003024), 5.0 L of cDNA sample ( diluted 10x from cD NA reaction), and 100 nM of each gene specific primer (Fwd: GCCGCTCACGTCAATGG Rev: CTGGGCATCTTCATGGAGTGT ) in a final volume of 20 L. The relative abundance of transcripts was normalized with 18S rRNA controls (Taqman Ribosomal RNA Control Reagents, ABI Lot # 0804133) as in Eveland et al., 2008. Primer pairs for C sl D 1 were designed using Primer Express 3.0 (ABI). Propidium I odide S taining Immature leaves (1015 cm) were dissected from whorls of csld1 mutant and nonmutant plants. The basal portions (2 cm) of these leaves were immediately submerged in a solution of 0.1 mg/mL propidium iodide, and allowed to absorb the dye for 5 min at 25C. Samples were then rinsed thoroughly in water to remove excess stain and flattened on a glass slide. The abaxial epidermis was imaged using a Zeiss confocal microscope. For visualization of nuclei, the same process was followed, but leaf samples were first fixed in FAA (10% formaldehyde [Fisher Lot # 992720], 5% acetic acid, 50% EtOH), before staining with propidium iodide. Flow C ytometry The basal 1 cm of immature leaves (23 cm) were dissected and finely sliced (~0.5 mm) with a razor blade in icecold chopping buffer (4% MOPS [0.5 M, pH 7.2], 9% MgCl2 [0.5 M], 6% Na3Citrate [0.5 M], 0.1 % Triton X 100 [Sigma, Lot # MKBD6639V], 1

PAGE 111

111 mg RNase [Thermo Scientific, Cat # AB 0549], in water). Homogenate was filtered through 50 micron nylon mesh followed by 20 micron nylon mesh, then transferred to a 1.5 mL microcentrifuge tube. Nuclei were pelleted at 1,000 rpm for 3 min and supernatant was discarded. Pellets were resuspended in staining buffer (chopping buffer plus 1% propidium iodide [5 mg/mL]), and incubated at room temperature for 5 min. Nuclei were repelleted at 1,000 rpm for 3 min and supernatant was discarded. Pe llets were resuspended in 300 l of staining buffer and analyzed on a LSR II cytometer (BD Biosciences, San Jose, CA). Nuclei were excited using a solid state laser emitting 100 milliwatts at 488 nm. Forward light scatter and orange fluorescence (575 +/ 13 nm) were collected on up to 5, 000 particles per sample. Small particles of debris were gated out using a fluorescence vs forward light scatter dot plot. Peaks were identified on a fluorescence histogram plotted on logarithmic scale and the geometric and median fluorescence values for each peak were calculated. Software used was Diva 6.1.2 (BD Biosciences).

PAGE 112

112 Table 41. Cell wall composition of wholeleaf blades and epidermal peels from csld1 mutant and nonmutant plants Sample Ara Rha Fuc Xyl Man GalA Gal Glc GlcA Cellulose Whole leaf WT 11.43 (0.33) 0.53 (0.02) nd 81.40 (0.01) nd 1.36 (0.07) 0.85 (0.69) 4.43 (0.41) nd 26.6 (1.8) csld1 11.84 (0.18) 0.57 (0.05) nd 81.18 (1.31) nd 1.59 (.016) 0.80 (0.04) 4.03 (1.41) nd 22.9 (3.1) Epi dermal peels WT 10.66 (0.54) 0.31 (0.02) nd 85.04 (0.69) nd 0.95 (0.29) 0.65 (0.08) 2.39 (0.34) nd nt csld1 11.93 (0.63) 0.34 (0.03) nd 84.37 (0.96) nd 0.71 (0.05) 0.69 (0.08) 1.97 (0.22) nd nt Alcohol insoluble residues were prepared from both wholel eaf blade sections and isolated epidermal strips of greenhousegrown plants identified as mutant or wildtype by PCR of a segregating family. Analy sis of noncellulosic cell wall sugars was done at the CCRC at the University of Georgia using combined gas c hromotography/mass spectrometry (GC/MS) of the Tetramethylsilane (TMS) derivatives of the monosaccharide methyl glycosides produced by acidic methanolysis. Values for noncellulosic sugars are given as mole percent, with standard error in parentheses. Cellulose content was estimated based on remaining weight after hydrolysis of hemicelluloses and lignin. Cellulose content is given as weight percentage of alcohol insoluble cell wall fraction, with standard error in parentheses. None of the differences betw een csld1 mutant and wildtype samples were statistically significant at p < 0.05 (N = 4, for each sample). nd = not determined, nt = not tested.

PAGE 113

113 Figure 41. Gene diagram of Zm CslD1 and location of each of the Mu insertions identified. Large triangles represent the two UniformMu alleles ( csld1 1 and csld1 2 ) and small triangles show locations of TUSC alleles ( csld1 3 through csld1 7 ). Southern Blots are from the original hit in UniformMu Grid 6, with positive probebinding lanes being identified in X45 and Y4 for both forward and reverse primers along with TIR6 primers (as diagramed above). Right panel shows the intersect in Grid 6 corresponding to UnifromMu family 04S 113027.

PAGE 114

114 Figure 4 2. Morphology and dry weight of the csld1 1 mutant. Plant height and dry weight (aboveand below ground) were quantified for fieldgrown csld1 mutant and nonmutant plants. Non mutant plants indluded both wildtype and heterozygous individuals from segregating progeny after 3 back crosses into the W22 inbred. Heig ht was measured from the soil line to the flag leaf of each plant. Below ground dry weight was based on recovery of major roots as shown in the image above (root systems were compact in the irrigated sandy field conditions). Mutant plant height was reduc ed ( av. 9%), and total plant dry weight decreased (av. 45%). Aboveand below ground dry weights were reduced by similar amounts (av. 44% and 49%, respectively). For dry weight measurements, whole plants were sampled three days after ear maturity (40 days post pollination), and did not include mature ears. Significant difference (p < 0.05) from WT indicated by *.

PAGE 115

115 Figure 4 3. The narrow leaf phenotype of csld1 1 mutant plants. Leaf blade length and width (at widest point) were quantified for leaf positions 3 through 5 (as diagramed) for fieldgrown mutant and nonmutant plants. Nonmutant plants included both wildtype and heterozygous individuals from segregating progeny after 3 back crosses into the W22 inbred. Imaged blades were from leaves in position #3 from the apex. The left most portion of each graph shows combined data from all leaf positions measured. The leaf blade widthto length ratio was 27% less for mutant plants. Blade width and length are reduced 35% and 10% respectively, relative to those of nonmutant plants. Data are similar for csld1 2 (not shown), and visual appraisals of the five other csld1 mutants. Note: Leaf photo is from greenhousegrown plants, whereas quantifications are from fieldgrown plants. Significant difference ( p < 0.05) from WT indicated by *.

PAGE 116

116 Figure 44 Leaf blade curling in csld1 mutants. Leaf blades of csld1 mutant leaves curl adaxially compared to nonmutant leaves, which typically flex downward (abaxially). Here, 1cm sections of mutant and nonmut ant leaf blades from well watered plants were excised and imaged after adopting their natural conformations.

PAGE 117

117 Figure 45 The warty phenotype of csld1 mutant leaf blades. (A C) Fresh, intact leaves. Epidermal warts were distributed in a nonuniform, apparently random manner across the entire blade and midr ib of a mature fully expanded leaf. (D, E) Fresh sectioned leaf blades. Swollen lesions were most abundant on the abaxial leaf blade surface. (F, G) Fixed, imbedded crosssections. Leaf blade interior is less visibly affected than epidermal cells in csl d1 mutants. Some epidermal cells have twodimensional, cross sectional areas up to 25fold greater than normal (r = 100 m for swollen cell in G). Image in F is composed of overlapping composite im ages.

PAGE 118

118 Figure 46. SEM of csld1 mutant and wildtype leaves showing advanced development of epidermal lesions that continue growing after leaves reach full expansion. (A) Composite of overlapping images from of a mature, csld1 mutant leaf revealing t he complexity, dimensions, and distribution of the continually expanding epidermal lesions. Clusters of swollen cells alternate with less disturbed areas of epidermis. (B). Contrast between surfaces of wildtype (left panel) and csld1 mutant leaves showing advanced development of large globular clusters, some having lost integrity and collapsed (center panel), others remaining intact and continuing to expand (right panel, expanded from composite image).

PAGE 119

119 Figure 47. Size estimates for epidermal cells of inter lesion regions on csld1 mut ant and nonmutant leaf blades. Epidermal impressions were taken from abaxial surfaces of fully expanded leaf blades on mature, greenhousegrown plants. Non mutant plants included both wildtype and heterozygous individuals from segregating progeny after 3 back crosses into the W22 inbred. Cell numbers were quantified along longitudinal and lateral axes of defined length. Mean cellular dimensions were determined by dividing number of cells along an axis by the length of that axis. (mutant N=14; non mutant N=10; longitudinal axis 1.88 mm; lateral axis 1.40 mm). Axes used for analyses of epidermal cell size on mutant leaves did not include cells in the ballooning protrusions. Significant difference (p < 0.05) from nonmu tant indicated by *.

PAGE 120

120 Figure 4 8. Internal structure of csld1 mutant and nonmutant leaf blades. Sections of fully expanded leaves from greenhousegrown csld1 mutant and wildtype plants showing visible differences in leaf thickness, vascular bundle density, and mesophyll structure (upper three panels, top panel is a composite of overlapping images). Leaf thickness was quantified withand without epidermal layers (lower left panel) for eight sections of fully exapnded leaves labeled A H. Error bars s how SEM for 10 measurements across each leaf. Mutant leaves were a mean of 40% thicker than those of wildtype, and proportional increases were observed for internal tissues alone. Vascular bundle density was also quantified (lower right panel), and used to estimate vascular bundle number per leaf (with mean leaf width values [exluding midribs] being 80.2 mm and 51.1 mm for wildtype and csld1 mutant blades, respectively). Resulting estimates of vascular bundle number per leaf width were 29% less for csld1 mutants. Error bars indicate standard error. Significant difference between csld1 and wildtype (p < 0.05) is indicated by *.

PAGE 121

121 Figure 49. Internal structure of csld1 mutant and nonmutant stems. Stem sections from the third internode of greenhouseg rown csld1 mutant and wildtype plants (PCR genotyped). Material was stained with phloroglucinol, imaged, and cross sectional area was calculated using ImageJ. Measurements were collected for 11 WT and 8 mutant stalks. Mutant stalks were on average 24% sm aller than those of wildtype. Mutant sections had a mean of 12% fewer vascular bundles, while bundle density was increased by 14%. Error bars indicate standard error. Significant differences between mutant and wildtype (p < 0.05) are indicated by *.

PAGE 122

122 Figure 410. High resolution X ray micro computed tomography analysis of csld1 and wildtype stalks. Analysis of stem sections from the third internode of greenhousegrown csld1 mutant and wildtype plants using highresolution X ray micro CT. Hand cut sections approximately 3 x 2 x 10 mm from the edge of mutant and wildtype stems (four each) were scanned at 3.5 m resolution. Three dimensional analyses revealed significant differences in density of wall material (lower left) and distribution of wall thick ness (right). Mutant stems had more dense, but generally thinner walls even when analyses were limited to the rind only. Volumetric analyses were calculated with an algorithm developed for trabeacular bone (Hildebrand and Regsegger, 1997). Error bars r epresent standard error. Significant differences from WT are indicated, (p < 0.05)** and (p<0.1)*.

PAGE 123

123 Figure 4 11. Levels of Zm C sl D 1 mRNA in diverse tissues from wildtype plants of the W22 inbred. (A) Expression of Zm CslD1 in diverse organs. (B) Zm C sl D 1 mRNA levels in leaf blades and bladeregions at different stages of development. Levels of mRNA was quantified by CyberGreen quantitative Real Time RT PCR. Three biological replications were analyzed for or each tissue. Note abundance of C sl D 1 tra nscripts in preemergent immature leaves. Maximal expression was observed in very young shoots (including coleoptile and enfolded leaves), followed by the basal portion of intermediatestaged developing leaves.

PAGE 124

124 Figure 4 12. Mature csld1 mutant and non mutant epidermis revealed apparent defects in cell division. Comparison of isolated epidermis from non warty areas of mature csld1 mutant and nonmutant leaves using dark field microscopy revealed a number of striking defects. Mutant epidermis appeared disrupted and unorganized compared to nonmutant epidermis. There were also numerous cases of misshapen cells and cell wall stubs (arrows), indicating a failure of cells to complete cell division.

PAGE 125

125 Figure 4 13. Confocal images showing defects early in development of csld1 mutant leaf epidermis. Propidium iodidestained cell walls from fresh, immature csld1 mutant and wildtype leaves. (A) Pre differentiation zones of basal portions of wildtype leaves contrasting with the abnormal csld1 1 cell size, shape, and organization. Leaf blades were approximately 10cm long. (B) Post differentiation zones showing persistent effects of altered cell division in large, misshapen, unordered cells of the csld1 1 leaf epidermis. Again, l e af blades wer e approximately 10 cm long. (C) A typical file of large, irregular cells bounded by individuals with incomplete cell walls protruding from their outer edges, consistent with c lonal inheritance of large cell size. (D) Serial optical sections revealing i rregular gaps in cell walls (arrow) that occur frequently in epidermal cells of the csld1 mutant.

PAGE 126

126 Figure 414. Nuclei of immature csld1 mutant and nonmutant epidermis. (A) Confocal imaging of fixed cells stained with propidium iodide revealed an abu ndance of large nuclei in clsd1 mutant epidermis. Larger nuclei corresponded with the larger cell size of mutant epidermis. (B) Percent of total nuclei with 4N, 8N, and 16N. Nuclei from immature tissue from basal portions of csld1 mutant and wildtype leaves were examined using flow cytometry of isolated nuclei stained with propidium iodide. The majority of nuclei were 2N and are not displayed here. Significant difference between csld1 and wildtype (p < 0.05) are indicated by N = 5

PAGE 127

127 Figure 415. I solation of maize leaf epidermis. 1 ) Hold a piece of fresh leaf tissue, with the epidermal surface to be isolated facing inward (abaxial surface in this case). 2) Pull back on part of the leaf so that it tears along the longitudinal leaf axis. As a str ip of epidermis is revealed, angle the piece towards the main leaf body to maximize epidermal strip width. Typical epidermal strips are between 25 mm. 3) Completely remove the leaf piece containing the epidermal strip, hold against a hard surface (such as a glass slide), and slice off clean epidermis using a scalpel. Areas with nonepidermal contaminants should be visible against a white background. 4) Use forceps to transfer epidermal strip to collection tube, or leave strip on glass slide (with a s mall amount of water) for visualization under dark field microscopy.

PAGE 128

128 CHAPTER 5 CONCLUSIONS AND FUTURE DIRECTIONS Work presented here revealed a s urp r isingly large number of Mu transposable elements, with extensive divergence, and widely varying sites of insertion in maize and teosinte inbreds (Chapter 2). Results have been immediately incorporated into new attempts to harness the mutagenic power of these transposons in the UniformMu maize population ( a globally accessed community resource initiated at th e University of Florida [ McCarty et al., 2005 ] ). P reliminary results from high throughput sequencing of UniformMu DNA identified large numbers of apparently unique Mu12 elements that were not previously recognized in this population. The extent of activi ty by these Mus was unexpected due to previous reports that detected little activity of Mu10s and Mu12s (Dietrich et al., 2002; Liu et al., 2009). However, previous studies did not utilize Mu12specific primers for their Mu flanking sequence generation. Regardless, results here show these to be an abundant, diverse, and active component of the Mu system. A reappraisal of Mu10 s and Mu12s in other mutagenic maize lines may yield results similar to those shown here. We will soon be able to test the degre e to which the divergent and abundant Mu12 elements of the UniformMu population are active, and if so, a large number of insertional mutants will become available for the global community of maize geneticists and breeders Even if the UniformMu population itself does not harbor particularly active Mu12 elements, our current sequencing protocols and materials should allow identification of lines that do have highly active Mu12s. These could be bred or engineered to create future mutagenic populations. The presence of a previously unrecognized, possibly active transposase in the B73 maize genome is indicated by data shown here (Chapter 3, Figure 37) Additional

PAGE 129

129 analyses will be needed to confirm function, but a clear homology and extensive conservation was shown between Mu10 elements in the B73 genome and the known MuDR transposase. Expression of the putative transposase genes in such Mu10 elements would indicate function, although their expression could be low, highly regulated, and/or limited to specific sites or times thus not easily detectable. As of now no Mu10derived transcripts have been deposited in public maize EST collections (data not shown). A nother line of future experimentation to test hypotheses for Mu10 activity would be to compare segr egation of these (or similar elements) in wildtype and Mu active populations such as UniformMu. If Mu active lines could be identified that lack ed classical MuDR elements, but which included these Mu10 elements, then this observation would support the hypothesis that some Mu10s encode functional transposases. Evidence here revealed an unexpected role of a cell wall biosynthetic gene in plant cell division (Chapter 4), yet the specific biochemical mechanism is yet to be defined. Future work on s ubcellular localization of the maize CSLD1 protein may also provide valuable information about its specific biological role in the process of cell division. Transgenic maize lines with YFP tagged CSLD1 protein driven by the CSLD1 native promoter are currently being generated by the Maize Cell Genomics group (Mohanty et al., 2009) We hypothesize that the CSLD1 enzyme is targeted to, and functional at, the newly forming cell plate in epidermal cells of developing maize leaves If so, then the tagged protein may l ocalize to these regions near newly forming cross walls. New evidence (from Erik Neilson University of Michigan ) also supports action by CSLD proteins in synthesis of cellulose, and a specialized form of cellulose could possibly be

PAGE 130

130 required for cell wall formation at not only the tips of elongating cells such as root hairs and pollen tubes, but also at the cell plate of dividing plant cells. The increased density and thinner cell walls of the csld1 mutant stems, as revealed by highresolution micro CT ana lyses, highlight another intriguing possibility regarding the function of CSLD proteins. Estimation of the cellulose crystal linity using X ray diffraction and/or NMR spectroscopy ( Park et al., 2010) could provide important evidence for the biochemical and /or biophysical basis for roles of the CSLD1 protein. If the csld1 mutant walls contain more crystalline cellulose (as implied by results presented here), such data would provide still further resolution of whether CSLD enzymes produce contribute to formation of cellulose with a more amorphous nature.

PAGE 131

131 APPENDIX A All mapped Mu insertions in ten Zea inbreds, arranged by inbred, followed by Mu class and chromosome location. TSD: tandem site duplication. I nbred Mu chr start TSD B73 Mu1 9 chr1 215947275 G TCGGCTGG B73 Mu1 9 chr1 245365818 GTGTTAGGT B73 Mu1 9 chr1 245367837 GTGTTAGGT B73 Mu1 9 chr1 264263006 TTAGGTCGG B73 Mu1 9 chr1 264267812 TTAGGTCGG B73 Mu1 9 chr10 146901724 CTCGATTTG B73 Mu1 9 chr10 146912555 CTCGATTTG B73 Mu1 9 chr2 17647 CTCTCTT TC B73 Mu1 9 chr2 61514 GAAAGAGAG B73 Mu1 9 chr2 25300688 GAGGCTCTC B73 Mu1 9 chr2 25302603 GAGGCCCTC B73 Mu1 9 chr2 31723258 GGAGTGCGG B73 Mu1 9 chr2 135007660 GGCTGGCGG B73 Mu1 9 chr2 194078115 GCCGGGGGC B73 Mu1 9 chr2 194082980 GCCGGGGGC B73 Mu1 9 chr3 63759 CTGCATGGG B73 Mu1 9 chr3 63767 CTGCAGGGG B73 Mu1 9 chr3 170233622 GTCGCCAGC B73 Mu1 9 chr3 170235173 GTCGCCAGC B73 Mu1 9 chr3 192454287 AAATGGATG B73 Mu1 9 chr4 159505930 GCCGTGCGA B73 Mu1 9 chr4 165969433 GGGCCTAGG B73 Mu1 9 chr5 1711 1268 CAAGGTGGG B73 Mu1 9 chr5 17197656 CAAGGTGGG B73 Mu1 9 chr5 116267118 TCACCCAAG B73 Mu1 9 chr5 116268617 TCACCCGAG B73 Mu1 9 chr6 107992293 CACAAAAAA B73 Mu1 9 chr6 161765840 CTGGTAGTG B73 Mu1 9 chr6 161770900 CTGGTAGTG B73 Mu1 9 chr7 48473780 G CGGGAGAG B73 Mu1 9 chr7 48474915 GCGGGAGGG B73 Mu1 9 chr7 72528765 CTATGCGAT B73 Mu1 9 chr7 72530965 CTATGCGAT B73 Mu1 9 chr7 134022998 CTCCTTAAG B73 Mu1 9 chr8 3812868 GTTGTGCTC B73 Mu1 9 chr8 3875319 GAGCACAAC B73 Mu1 9 chr8 138633675 GTTGTATTC

PAGE 132

132 B 73 Mu1 9 chr8 151461730 CTCTCTACC B73 Mu1 9 chr8 153725735 GTTAGTTGT B73 Mu1 9 chr8 153727357 GTTAGTTGT B73 Mu1 9 chr9 40134754 GGCGCCCAG B73 Mu1 9 chrUNKNOWN 13826404 TGCAGTACA B73 Mu1 9 chrUNKNOWN 13829283 TGCAGTACA B73 Mu10 chr2 63630170 GCACAAACT B73 Mu10 chr2 76218121 TCGAGAGGG B73 Mu10 chr2 76222892 TCGAGAGGG B73 Mu10 chr3 32832334 CTCGCTGCC B73 Mu10 chr4 40201165 TCGAGCGCG B73 Mu10 chr4 170887654 GCGGGCGGA B73 Mu10 chr5 70381872 GTTTTTCGG B73 Mu10 chr5 70386843 GTTTTTCGG B73 Mu10 chr5 7 3323804 GTCGAAATC B73 Mu10 chr5 73327895 GTC A AAATC B73 Mu10 chr5 145977953 TCCCCTCCA B73 Mu10 chr6 160446766 TCCCACGAG B73 Mu10 chr6 160464150 CTCCTGGGA B73 Mu10 chr7 134021621 TTCTTTAAG B73 Mu10 chr9 11643467 TGGGTTGGG B73 Mu10 chr9 11653693 GGGCTG GGA B73 Mu10 chrUNKNOWN 5300073 ATGGGAGTG B73 Mu12 chr1 5853336 CCCGTCAGT B73 Mu12 chr1 5855090 CCCGTCAGT B73 Mu12 chr1 9045993 CTAGATTTG B73 Mu12 chr1 10975143 CTCTCCTCG B73 Mu12 chr1 19513553 CGAGAGCAG B73 Mu12 chr1 37644606 ACCGAATGT B73 Mu12 ch r1 65294475 TAACATATC B73 Mu12 chr1 65294573 CGACATATC B73 Mu12 chr1 78845541 TGGACACTA B73 Mu12 chr1 78847493 ATGGACACT B73 Mu12 chr1 148130653 TGGCCCGTG B73 Mu12 chr1 148231792 CACGGGCCA B73 Mu12 chr1 164914751 CTGCTCTAC B73 Mu12 chr1 255428941 GT TTCCCAA B73 Mu12 chr1 255431229 TTTCCTTGG B73 Mu12 chr1 259661577 CCATTTTTT B73 Mu12 chr1 297180880 GAGAGATGA B73 Mu12 chr1 297188349 GAGAGATGA B73 Mu12 chr10 4001312 CCCTCTCCT B73 Mu12 chr10 15300760 CTTGCAATG

PAGE 133

133 B73 Mu12 chr10 15308429 CTTGCAATG B73 Mu12 chr10 55963355 CCTCTAGAG B73 Mu12 chr10 97224421 TGACGAAAC B73 Mu12 chr10 97271042 TGACGAAAC B73 Mu12 chr10 99885745 TGATGGTAT B73 Mu12 chr10 116689007 GCAGGGCAG B73 Mu12 chr10 135327980 GTCAGGGCT B73 Mu12 chr10 135329008 GTCAGGGCT B73 Mu12 ch r10 138397252 TCCCAGGAT B73 Mu12 chr10 141276026 GTGGCTGAC B73 Mu12 chr10 141279103 GTGGCTGAC B73 Mu12 chr10 141729910 CTCAGAAAG B73 Mu12 chr2 9947891 CTTGGACGA B73 Mu12 chr2 24581453 TCGGTTGCG B73 Mu12 chr2 24982189 GACCTCAAA B73 Mu12 chr2 25000049 TTTGAGGTC B73 Mu12 chr2 25001836 CAAAGGGTC B73 Mu12 chr2 37869180 GGGCACGAG B73 Mu12 chr2 126547121 AGCTGCGGC B73 Mu12 chr2 149547189 TCCATATGG B73 Mu12 chr2 149548163 TCCATATGG B73 Mu12 chr2 197215143 CGCGGGGGC B73 Mu12 chr2 229531942 AGAGGGGGG B 73 Mu12 chr2 229540123 AGGAGGGGG B73 Mu12 chr3 1603146 CATGAACCC B73 Mu12 chr3 1703348 GGGTTCATG B73 Mu12 chr3 9282491 ATTTCCCGT B73 Mu12 chr3 9286569 ATTTCCCGT B73 Mu12 chr3 64925288 GATGCCGGC B73 Mu12 chr3 64927462 GATGCCGGA B73 Mu12 chr3 79376179 CCATTTTTT B73 Mu12 chr3 89795711 CTTCAGAGA B73 Mu12 chr3 121611818 GGCGTAACT B73 Mu12 chr3 121613607 GGCGTAACT B73 Mu12 chr3 121613610 GGTGTAACT B73 Mu12 chr3 156342516 GTCCCCAGC B73 Mu12 chr3 181510576 CTCCCGAAC B73 Mu12 chr3 181511716 CTCCCGAAC B73 Mu12 chr3 216632366 TACTGCAGT B73 Mu12 chr3 223787656 CCTGTAGGA B73 Mu12 chr4 25856208 TCGCAGCTG B73 Mu12 chr4 58603310 TGCGCGTGC B73 Mu12 chr4 73211942 CAATGCCGC

PAGE 134

134 B73 Mu12 chr4 96634756 GGGCTCAAT B73 Mu12 chr4 117222508 ACCGCAGAC B73 Mu12 chr4 1 17224174 ACCGCAGAC B73 Mu12 chr4 166495091 GTACATATG B73 Mu12 chr4 166547003 CATATGTAC B73 Mu12 chr4 182833406 AGTTTCAGA B73 Mu12 chr4 199244475 AGTTCGGAC B73 Mu12 chr4 208777269 CCTGGTGGA B73 Mu12 chr4 210943904 GAGAGAGAT B73 Mu12 chr4 210945539 GA GATGTCA B73 Mu12 chr4 211398529 GCGAGCGAG B73 Mu12 chr4 211400767 GCGAGCGAG B73 Mu12 chr4 231573451 GGTGTTTGA B73 Mu12 chr4 244759229 GATGAGGAG B73 Mu12 chr5 5197195 GCGTGGGCG B73 Mu12 chr5 5199460 GCGTGGGCG B73 Mu12 chr5 23237962 GACGTGCTC B73 Mu1 2 chr5 26466383 AGCCTAGGA B73 Mu12 chr5 26839718 CGCGGGCGG B73 Mu12 chr5 33848208 CGTTAGGTC B73 Mu12 chr5 33849953 CGTTAGGTC B73 Mu12 chr5 42849194 AATATGATG B73 Mu12 chr5 58608495 CCTCCTTAA B73 Mu12 chr5 65382203 AGGGGGGGG B73 Mu12 chr5 155255661 G CCTTGGGC B73 Mu12 chr5 155260687 GCCTTGGGC B73 Mu12 chr5 163935903 GATGTAGCC B73 Mu12 chr5 180873325 GTTGCGTGC B73 Mu12 chr5 180877223 CGTTGCGTG B73 Mu12 chr5 185079405 GAATGTTTT B73 Mu12 chr5 186969978 AGAGGGGGG B73 Mu12 chr5 190223449 TAAACCACC B 73 Mu12 chr5 190225195 CTAAACCAC B73 Mu12 chr5 203749481 TTCGTCGAC B73 Mu12 chr5 203763309 TTCGTCGGC B73 Mu12 chr6 2917476 TCCATGATG B73 Mu12 chr6 14213991 GTGTTCATG B73 Mu12 chr6 28306795 GCTGCAGGA B73 Mu12 chr6 92047273 ATGCAGATG B73 Mu12 chr6 921 97928 CCTTGCAAG B73 Mu12 chr6 129097781 GGAACGAAT B73 Mu12 chr7 16535034 AATGGTCCA B73 Mu12 chr7 20735964 CCAATTCGG

PAGE 135

135 B73 Mu12 chr7 50182115 GCCCGTGAG B73 Mu12 chr7 121684992 CCAAAAATG B73 Mu12 chr7 147322983 GGCGTGCTA B73 Mu12 chr7 161229569 ATCTGTCA G B73 Mu12 chr7 169729474 CCATTTCCA B73 Mu12 chr8 5414131 GCGCGCGAG B73 Mu12 chr8 5414433 CTCGCGCGC B73 Mu12 chr8 42932444 GACCTCAAA B73 Mu12 chr8 100614801 CATTGTAGG B73 Mu12 chr8 106152637 TCATTGCAA B73 Mu12 chr8 130925131 GGCTGCGGA B73 Mu12 chr8 141273174 GTAGATTGG B73 Mu12 chr8 141274171 CTGATTGGG B73 Mu12 chr8 148886228 CCTGTTTGA B73 Mu12 chr8 148887210 CCTGTTTGA B73 Mu12 chr8 148887211 CTGTTTGAA B73 Mu12 chr9 4231266 GCACGCAAC B73 Mu12 chr9 4231339 CGCACGCAA B73 Mu12 chr9 15061435 GCGAG CGTC B73 Mu12 chr9 25697019 CCTAATTTT B73 Mu12 chrUNKNOWN 12783521 AGTGGCCGG MO17 Mu1 9 chr1 152954540 ACCAATTGG MO17 Mu1 9 chr1 192534615 CCAATTGGT MO17 Mu1 9 chr1 264263006 TTAGGTCGG MO17 Mu1 9 chr1 264267812 TTAGGTCGG MO17 Mu1 9 chr1 273709444 AT CTCTGAG MO17 Mu1 9 chr10 88102930 CTTGTGAAG MO17 Mu1 9 chr10 103741428 CTTGTGAAG MO17 Mu1 9 chr10 129970873 CTGGTAATA MO17 Mu1 9 chr10 146901724 CTCGATTTG MO17 Mu1 9 chr10 146912555 CTCGATTTG MO17 Mu1 9 chr2 25300688 GAGGCTCTC MO17 Mu1 9 chr2 253026 03 GAGGCTCTC MO17 Mu1 9 chr2 31723258 GGAGTGCGG MO17 Mu1 9 chr2 31723266 GAGTGCGGG MO17 Mu1 9 chr2 135007660 GGCTGGCGG MO17 Mu1 9 chr2 135009766 GGCTGGCGG MO17 Mu1 9 chr2 142272069 CATCCAAAC MO17 Mu1 9 chr2 142324924 CCATCCAAA MO17 Mu1 9 chr2 158559 629 CTCTCTTTC MO17 Mu1 9 chr2 214951873 TTAGGTCGG MO17 Mu1 9 chr2 214951881 TTAGATCGG MO17 Mu1 9 chr2 220443225 CCAGCAGCC

PAGE 136

136 MO17 Mu1 9 chr3 219993784 CCCTTGATT MO17 Mu1 9 chr3 219993791 CCCTTGATT MO17 Mu1 9 chr3 230139824 CCCATGCAG MO17 Mu1 9 chr3 230 143403 CCCCTGCAG MO17 Mu1 9 chr4 118954521 CCTTGTGAA MO17 Mu1 9 chr4 159505930 GCCGTGCGA MO17 Mu1 9 chr4 159506805 GCCGTGCGA MO17 Mu1 9 chr4 165969433 GGGCCTAGG MO17 Mu1 9 chr5 17111268 CAAGGTGGG MO17 Mu1 9 chr5 17197656 CAAGGTGGG MO17 Mu1 9 chr5 11 6267118 TCACCCAAG MO17 Mu1 9 chr5 116268617 TCACCCGAG MO17 Mu1 9 chr5 178759106 GTTTGGAGT MO17 Mu1 9 chr5 178759114 GTTTGCAGT MO17 Mu1 9 chr5 201460195 GTCGGTCTA 6_8 Mu1 9 chr5 201460203 GTCGGTCTA MO17 Mu1 9 chr6 47652355 CCACAAATA MO17 Mu1 9 chr6 4 7652364 CACAAATAG MO17 Mu1 9 chr6 107992299 CACAAAAAA MO17 Mu1 9 chr6 167002619 CTTCACAAG MO17 Mu1 9 chr6 167003111 CTTCACAAG MO17 Mu1 9 chr6 167011925 CTTGTGAAG MO17 Mu1 9 chr8 85028236 CAAGGTGGG MO17 Mu1 9 chr8 139599679 ACAACTAAC MO17 Mu1 9 chr8 151461730 CTCTCTACC MO17 Mu1 9 chr8 151463296 CTCTCTACC MO17 Mu1 9 chr8 152812782 ATTGAAAGG MO17 Mu1 9 chr8 152814820 ATTGAAAAG MO17 Mu1 9 chr8 153725735 GTTAGTTGT MO17 Mu1 9 chr8 153727357 GTTAGTTGT MO17 Mu1 9 chr8 169907702 CTCACACAC MO17 Mu1 9 ch r8 169907706 CTCACACAC MO17 Mu1 9 chr9 12106581 TCTCCCGAG MO17 Mu1 9 chr9 26352347 CTTGTGAAG MO17 Mu1 9 chr9 26352355 CTTGTGAAG MO17 Mu1 9 chr9 106850972 CACCGGGAG MO17 Mu1 9 chr9 106850980 CACCGGGAG MO17 Mu1 9 chr9 129919432 GGCGTGCGT MO17 Mu1 9 ch r9 145681991 GAAAGAGAG MO17 Mu1 9 chrUNKNOWN 8109034 CACCAGAAA MO17 Mu1 9 chrUNKNOWN 13826404 TGCAGTACA MO17 Mu1 9 chrUNKNOWN 13829283 TGCAGTACA MO17 Mu10 chr1 17669069 GTTTGTCGC

PAGE 137

137 MO17 Mu10 chr1 17669186 GTTTGCCGC MO17 Mu10 chr1 127026395 GCCCCAGAT M O17 Mu10 chr2 76218121 TCGAGAGGG MO17 Mu10 chr2 76222892 TCGAGAGGG MO17 Mu10 chr2 79137485 GGTGGCAAC MO17 Mu10 chr2 187496817 CTCAGCGCC MO17 Mu10 chr2 187496825 CTCAGCGCC MO17 Mu10 chr2 220443225 CCAGCAGCC MO17 Mu10 chr2 220448990 CCTAGCAGC MO17 Mu1 0 chr3 32827320 CCCGCTGCC MO17 Mu10 chr3 32832334 CTCGCTGCC MO17 Mu10 chr4 40176738 TCGAGCGCG MO17 Mu10 chr4 40201165 TCGAGCGCG MO17 Mu10 chr4 158906485 AGAAGAGGG MO17 Mu10 chr4 165967845 GGGCCTAGG MO17 Mu10 chr4 199095951 TTTTGAATA MO17 Mu10 chr4 1 99095959 TTTTGAATA MO17 Mu10 chr5 17197656 CAAGGTGGG MO17 Mu10 chr5 73323804 GTCAAAATC MO17 Mu10 chr5 73327895 GTCAAAATC MO17 Mu10 chr6 82267957 GCACAGGGG MO17 Mu10 chr8 162447325 CAAATAAAC MO17 Mu10 chr9 907863 GTTTACTTG MO17 Mu10 chr9 83025615 CGC GCTCGA MO17 Mu12 chr1 5852728 CCCGTCAGT MO17 Mu12 chr1 5855090 CCCGTCAGT MO17 Mu12 chr1 10975143 CTCTCCTCG MO17 Mu12 chr1 37644610 ACCAAATGG MO17 Mu12 chr1 47209329 AAAAAAACG MO17 Mu12 chr1 55607850 TGTGGTAAG MO17 Mu12 chr1 55607855 TGTGGTAAG MO17 Mu12 chr1 114596663 CCATTTCCA MO17 Mu12 chr1 148517216 TAAAAAAAC MO17 Mu12 chr1 148517219 TAAAAAACG MO17 Mu12 chr1 168938431 GGGCACAAG MO17 Mu12 chr1 228684862 TGGAAGTGG MO17 Mu12 chr1 259661577 CCATTTTTT MO17 Mu12 chr1 297188349 GAGAGATGA MO17 Mu12 chr10 2305173 GAGGTCGGC MO17 Mu12 chr10 15300760 CTTGCAATG MO17 Mu12 chr10 15308429 CTTGCAATG MO17 Mu12 chr10 17855413 GGCCCCCAC MO17 Mu12 chr10 45432395 CATCATATT

PAGE 138

138 MO17 Mu12 chr10 49804591 TGACATCTC MO17 Mu12 chr10 55963355 CCTCTAGAG MO17 Mu12 chr1 0 71415205 CCTGTTTGA MO17 Mu12 chr10 74883501 TGGACAGGT MO17 Mu12 chr10 89755300 TTCTTGTGG MO17 Mu12 chr10 90179710 ACCTGTCAA MO17 Mu12 chr10 90179749 ACCTGTCAA MO17 Mu12 chr10 91858466 CCAGAACCC MO17 Mu12 chr10 114389638 CTCTAGTTC MO17 Mu12 chr10 1 32217391 CGTTTTTTT MO17 Mu12 chr10 135327980 GTCAGGGCT MO17 Mu12 chr10 135329008 GTCAGGGCT MO17 Mu12 chr10 135454667 CCGTCAGTG MO17 Mu12 chr10 137135412 CATATGTAC MO17 Mu12 chr10 137392165 TCAAACAGG MO17 Mu12 chr10 144196261 GAGATGAGA MO17 Mu12 chr2 1208535 CTTTGGATA MO17 Mu12 chr2 2004537 GGTGATGAG MO17 Mu12 chr2 6579102 ACTGACGGG MO17 Mu12 chr2 24982189 GACCTCAAA MO17 Mu12 chr2 25000049 TTTGAGGTC MO17 Mu12 chr2 25001836 CAAAGGGTC MO17 Mu12 chr2 32730341 CAGGGAAAC MO17 Mu12 chr2 37869180 GGGC ACGAG MO17 Mu12 chr2 90728755 GGGTTCTGG MO17 Mu12 chr2 155007653 GGGCGGTGG MO17 Mu12 chr2 207958804 GTACAGAAC MO17 Mu12 chr2 207958827 GTACAGAAC MO17 Mu12 chr3 3839648 GCTTGCCAA MO17 Mu12 chr3 3839656 GCTTGCCGA MO17 Mu12 chr3 89795711 CTTCAGAGA MO1 7 Mu12 chr3 121611818 GGCGTAACT MO17 Mu12 chr3 121613607 GGCGTAACT MO17 Mu12 chr3 156342516 GTCCCCAGC MO17 Mu12 chr3 165906824 TTGACAGGT MO17 Mu12 chr3 165906845 TTGACAGGT MO17 Mu12 chr3 216037776 GTGTGTCGG MO17 Mu12 chr3 216632366 TACTGCAGT MO17 Mu 12 chr3 223664317 TCCTACAGG MO17 Mu12 chr3 223787656 CCTGTAGGA MO17 Mu12 chr4 7227108 AAAATCAAG MO17 Mu12 chr4 25856207 CTCGCAGCT MO17 Mu12 chr4 68421868 CCCACCGCC

PAGE 139

139 MO17 Mu12 chr4 68421874 CCCACCGCC MO17 Mu12 chr4 90878858 ACCTGTCAA MO17 Mu12 chr4 90 878875 ACCTGTCAA MO17 Mu12 chr4 96634756 GGGCTCAAT MO17 Mu12 chr4 103973120 CGCCCACGC MO17 Mu12 chr4 166495091 GTACATATG MO17 Mu12 chr4 166547003 CATATGTAC MO17 Mu12 chr4 182724999 GTTTTCAGA MO17 Mu12 chr4 182813239 AGTTTCAGA MO17 Mu12 chr4 20877726 9 CCTGGTGGA MO17 Mu12 chr4 210943904 GAGAGAGAT MO17 Mu12 chr4 210945539 GAGATGTCA MO17 Mu12 chr4 211398529 GCGAGCGAG MO17 Mu12 chr4 211400767 GCGAGCGAG MO17 Mu12 chr4 217229790 GCTTGCCGA MO17 Mu12 chr5 5197195 GCGTGGGCG MO17 Mu12 chr5 5199460 GCGTGG GCG MO17 Mu12 chr5 26466383 AGCCTAGGA MO17 Mu12 chr5 42849194 AATATGATG MO17 Mu12 chr5 126213492 CTCGCGGGC MO17 Mu12 chr5 153237757 GGCATGGGG MO17 Mu12 chr5 161969989 TTGGCAAGC MO17 Mu12 chr5 180873325 GTTGCGTGC MO17 Mu12 chr5 184684568 TGGCCCCAC M O17 Mu12 chr5 185027058 CAAACATTC MO17 Mu12 chr5 185079405 GAATGTTTT MO17 Mu12 chr5 191610797 AATGCAAGG MO17 Mu12 chr6 2917476 TCCATGATG MO17 Mu12 chr6 4072269 CTGCTCTCG MO17 Mu12 chr6 19513671 CAAAAATGG MO17 Mu12 chr6 31283834 CAGTGGCCG MO17 Mu12 c hr6 59141567 TCAAACAGG MO17 Mu12 chr6 63914664 CCGTTTTTT MO17 Mu12 chr6 92197933 CTTACAAGG MO17 Mu12 chr6 95593073 TCAAACAGG MO17 Mu12 chr6 114620777 CCCACCGCC MO17 Mu12 chr6 117288224 CCAATCATC MO17 Mu12 chr6 117757951 CCTTGATTT MO17 Mu12 chr6 1217 71628 GACCTCAAA MO17 Mu12 chr6 129097781 GGAACGAAT MO17 Mu12 chr6 137479179 GGTTCGCCA MO17 Mu12 chr6 137479186 TGGTTCGCC MO17 Mu12 chr6 152474926 GATTCAAAT

PAGE 140

140 MO17 Mu12 chr6 157068221 CCTCAAGAA MO17 Mu12 chr6 157068229 CCTCAAGAA MO17 Mu12 chr6 16912926 8 CCCCCACCC MO17 Mu12 chr6 169241025 CCCCCACCC MO17 Mu12 chr7 29692026 AGTTACGCC MO17 Mu12 chr7 30913431 CCAGAACCC MO17 Mu12 chr7 50179197 GCCCGCGAG MO17 Mu12 chr7 50182115 GCCCGCGAG MO17 Mu12 chr7 144119874 GTGGGGGCC MO17 Mu12 chr7 161229569 ATCTGT CAG MO17 Mu12 chr7 169729474 CCATTTCCA MO17 Mu12 chr7 169731084 CCATTTCCA MO17 Mu12 chr8 5414433 CTCGCGCGC MO17 Mu12 chr8 100614800 CCATTGTAG MO17 Mu12 chr8 141273174 ATAGATTGG MO17 Mu12 chr8 141274171 CTGATTGGG MO17 Mu12 chr8 148886228 CCTGTTTGA M O17 Mu12 chr8 148887210 CCTGTTTGA MO17 Mu12 chr9 514440 TGAGTTGGG MO17 Mu12 chr9 532640 CCTGAGTTG MO17 Mu12 chr9 532648 CCTGAGTTG MO17 Mu12 chr9 4231258 GCACGCAAC MO17 Mu12 chr9 4231266 GCACGCAAC MO17 Mu12 chr9 7781359 CCTGAGTTG MO17 Mu12 chr9 13190 529 GGCGGTGGG MO17 Mu12 chr9 21325864 TCAAACAGG MO17 Mu12 chr9 21325869 TCAAACAGG MO17 Mu12 chr9 31200845 TGACATCTC MO17 Mu12 chr9 65599040 TTTGAGGTC MO17 Mu12 chr9 65599075 TTAGAGGTC MO17 Mu12 chr9 80678776 CGAGGAGAG MO17 Mu12 chr9 94445147 CCGTTTT TT MO17 Mu12 chr9 107612907 AAAAGACGG MO17 Mu12 chr9 120235432 CTCGTGCCC MO17 Mu12 chr9 129431052 AAAGTCAAG MO17 Mu12 chr9 136481345 TCAAACAGG MO17 Mu12 chrUNKNOWN 380784 CAGGGAAAC MO17 Mu12 chrUNKNOWN 389185 GCGAGCGAG MO17 Mu12 chrUNKNOWN 713397 GC GAGCGAG MO17 Mu12 chrUNKNOWN 2802958 ACGAATCTT MO17 Mu12 chrUNKNOWN 3605870 GGCGACGTA MO17 Mu12 chrUNKNOWN 7422090 ACCGATAAA MO17 Mu12 chrUNKNOWN 8423439 CATATGTAC

PAGE 141

141 MO17 Mu12 chrUNKNOWN 10938872 ATACATGCC MO17 Mu12 chrUNKNOWN 12783520 CAGTGGCCG W22 M u1 9 chr1 19746434 TTTGAAATG W22 Mu1 9 chr1 19746443 TTTGAAATG W22 Mu1 9 chr1 101026009 CTGTGCGAG W22 Mu1 9 chr1 101060278 CTCGCACAG W22 Mu1 9 chr1 101060286 CTCGCACAG W22 Mu1 9 chr1 264263006 TTAGGTCGG W22 Mu1 9 chr1 264267812 TTAGGTCGG W22 Mu1 9 c hr10 10267286 GAAAGAGAG W22 Mu1 9 chr10 129970865 CTGGTAATA W22 Mu1 9 chr10 129970873 CTGGTAATA W22 Mu1 9 chr10 132671325 CCCCTACGG W22 Mu1 9 chr10 132671330 CCCCTACGG W22 Mu1 9 chr10 146912555 CTCGATTTG W22 Mu1 9 chr2 1696519 GTCTCTGTG W22 Mu1 9 ch r2 1696527 GTCTCTGTG W22 Mu1 9 chr2 25300688 GAGGCTCTC W22 Mu1 9 chr2 25302603 GAGGCTCTC W22 Mu1 9 chr2 71709108 CTCTCTGAT W22 Mu1 9 chr2 71709116 CTCTCTGAT W22 Mu1 9 chr2 135007660 GGCTGGCGG W22 Mu1 9 chr2 142272069 CATCCAAAC W22 Mu1 9 chr2 1585596 29 CTCTCTTTC W22 Mu1 9 chr2 194078115 GCCGGGGGC W22 Mu1 9 chr2 194082980 GCCGGGGGC W22 Mu1 9 chr2 214951873 TTAGGTCGG W22 Mu1 9 chr3 170233622 GTCGCCAGC W22 Mu1 9 chr3 170235173 GTCGCCAGC W22 Mu1 9 chr3 230143403 CCCCTGCAG W22 Mu1 9 chr4 159505930 G CCGTGCGA W22 Mu1 9 chr4 209048525 GCTGGCGTC W22 Mu1 9 chr4 209048533 GCTGGCGTC W22 Mu1 9 chr5 13208513 GTCGCCAGC W22 Mu1 9 chr5 13215095 GTCGCCAGC W22 Mu1 9 chr5 116267118 TCACCCAAG W22 Mu1 9 chr5 116268617 TCACCCGAG W22 Mu1 9 chr5 175353387 TTTGACG GT W22 Mu1 9 chr5 175353388 TTGACGGTG W22 Mu1 9 chr5 201460195 GTCGGTCTA W22 Mu1 9 chr5 201460203 GTCGGTCTA W22 Mu1 9 chr6 107992299 CACAAAAAA W22 Mu1 9 chr6 112507608 GTTCAGAAA

PAGE 142

142 W22 Mu1 9 chr6 112507616 GTTCAGAAA W22 Mu1 9 chr8 138633675 GTTGTATTC W22 Mu1 9 chr8 153725735 GTTAGTTGT W22 Mu1 9 chr8 153727357 GTTAGTTGT W22 Mu1 9 chr9 8145105 CAAGACGTG W22 Mu1 9 chr9 8145113 CAAGACGTG W22 Mu1 9 chr9 86968542 ATCAAATCT W22 Mu1 9 chr9 86968550 ATCAAATCT W22 Mu1 9 chr9 140075456 TTCTCAGCC W22 Mu1 9 chr9 140075465 TTCTCAGCC W22 Mu1 9 chrUNKNOWN 13826404 TGCAGTACA W22 Mu1 9 chrUNKNOWN 13829283 TGCAGTACA W22 Mu10 chr2 76222892 TCGAGAGGG W22 Mu10 chr2 199398880 GTTGTGTGG W22 Mu10 chr2 199398888 GTTGTGTGG W22 Mu10 chr4 40201165 TCGAGCGCG W22 Mu10 c hr4 40201169 TCGGGCGCG W22 Mu10 chr4 133716929 TCCCCTGCG W22 Mu10 chr4 133716937 TCCCCTGCG W22 Mu10 chr4 170887654 GCGGGCGGA W22 Mu10 chr4 204351539 ATGATGTTG W22 Mu10 chr5 73323804 GTCAAAATC W22 Mu10 chr5 73327895 GTCAAAATC W22 Mu10 chr8 138633677 GCTGTATTC W22 Mu10 chr9 10256387 GATGGGGAG W22 Mu12 chr1 5855090 CCCGTCAGT W22 Mu12 chr1 9045993 CTAGATTTG W22 Mu12 chr1 37644610 ACCAAATGG W22 Mu12 chr1 46120376 CCATTTTTT W22 Mu12 chr1 65294475 TAACATATC W22 Mu12 chr1 164914751 CTGCTCTAC W22 Mu12 chr1 228684862 TGGAAATGG W22 Mu12 chr1 255428941 GTTTCCCAA W22 Mu12 chr1 255431232 TTTCCCTTG W22 Mu12 chr1 259661577 CCATTTTTT W22 Mu12 chr1 279300802 ATTTATGAC W22 Mu12 chr1 297180880 GAGAGATGA W22 Mu12 chr1 297188349 GAGAGATGA W22 Mu12 chr10 4001 312 CCCTCTCCT W22 Mu12 chr10 9786669 CCATTTTTT W22 Mu12 chr10 15300760 CTTGCAATG W22 Mu12 chr10 55963355 CCTCTAGAG W22 Mu12 chr10 106665024 CCCCATGGC

PAGE 143

143 W22 Mu12 chr10 134125091 CGCCACCGG W22 Mu12 chr10 138397252 TCCCAGGAT W22 Mu12 chr10 141276027 TGGT TGACG W22 Mu12 chr10 141279103 GTGGCTGAC W22 Mu12 chr2 1207318 CTTTGGATA W22 Mu12 chr2 4039076 CTCGTGGAG W22 Mu12 chr2 24982189 GACCTCAAA W22 Mu12 chr2 25000049 TTTGAGGTC W22 Mu12 chr2 25001836 CAAAGGGTC W22 Mu12 chr2 32730341 CAGGGAAAC W22 Mu12 ch r2 37869180 GGGCACGAG W22 Mu12 chr2 152204163 TGTAGTGCA W22 Mu12 chr2 169238501 CCCGTGTTG W22 Mu12 chr2 210074350 ACCTATTCC W22 Mu12 chr2 210074358 ACCTATTCC W22 Mu12 chr2 221528287 GGTATACAA W22 Mu12 chr2 221528295 GGTATACAA W22 Mu12 chr3 3839648 G CTTGCCGA W22 Mu12 chr3 3839656 GCTTGCCGA W22 Mu12 chr3 9282491 ATTTCCCGT W22 Mu12 chr3 9286569 ATTTCCCGT W22 Mu12 chr3 54825892 GGACTTGCG W22 Mu12 chr3 54825897 GGACTTGCG W22 Mu12 chr3 89795711 CTTCGGAGA W22 Mu12 chr3 121611818 GGCGTAACT W22 Mu12 c hr3 121613607 GGCGTAACT W22 Mu12 chr3 156342516 GTCCCCAGC W22 Mu12 chr3 192256105 CGCCGCGAC W22 Mu12 chr3 192256113 CGCCGCGAC W22 Mu12 chr3 216632366 TACTGCAGT W22 Mu12 chr3 217655664 CCGTTTTTT W22 Mu12 chr3 220339229 CTCGTGGAG W22 Mu12 chr3 2203392 37 CTCGTGGAG W22 Mu12 chr4 96634756 GGGCTCAAT W22 Mu12 chr4 110554888 CAAGATGGG W22 Mu12 chr4 117222508 ACCGCAGAC W22 Mu12 chr4 117224174 ACCGCAGAC W22 Mu12 chr4 152475445 TTCTGCGTT W22 Mu12 chr4 166495091 GTACATATG W22 Mu12 chr4 166547003 CATATGTAC W22 Mu12 chr4 182724999 GTTTTCAGA W22 Mu12 chr4 199244475 GGTTCGGAC W22 Mu12 chr4 210943904 GAGAGAGAT

PAGE 144

144 W22 Mu12 chr4 210945539 GAGATGTCA W22 Mu12 chr4 211398529 GCGAGCGAG W22 Mu12 chr4 211400767 GCGAGCGAG W22 Mu12 chr4 239406228 GTGAGTGAG W22 Mu12 chr4 239406230 GTGTGTGAG W22 Mu12 chr4 240230508 GCGATGCGG W22 Mu12 chr4 240230516 GCGATGCGG W22 Mu12 chr4 244752104 GATGAGGAG W22 Mu12 chr4 244759229 GATGAGGAG W22 Mu12 chr5 26466383 AGCCTAGGA W22 Mu12 chr5 26839718 CGCGGGCGG W22 Mu12 chr5 42849194 AATATGATG W22 Mu12 chr5 97142862 GCGATGCGG W22 Mu12 chr5 155255661 GCCTTGGGC W22 Mu12 chr5 155260687 GCCTTGGGC W22 Mu12 chr5 161969989 TCGGCAAGC W22 Mu12 chr5 185027058 CAAACATTC W22 Mu12 chr5 185079405 GAATGTTTG W22 Mu12 chr5 191610797 AATGCAAGG W22 Mu12 chr5 191610805 AATGCAAGG W22 Mu12 chr5 215629072 AAAAAACGG W22 Mu12 chr6 63914659 CGTTTTTTT W22 Mu12 chr6 92047273 ATGCAGATG W22 Mu12 chr6 93816795 CAACACGGG W22 Mu12 chr6 154460191 CTTGTTGGC W22 Mu12 chr6 158392377 TCTGGAGGC W22 Mu12 chr7 17586505 TCTAGGTTC W22 Mu12 chr7 17586511 TCTAGGTTC W22 Mu12 chr7 29692026 AGTTACGCC W22 Mu12 chr7 144119871 GTGGGAGCC W22 Mu12 chr7 159353900 AAAAAATGG W22 Mu12 chr7 161229569 ATCTGTCAG W22 Mu12 chr7 169729474 CCATTTCCA W22 Mu12 chr7 169731084 CCAT TTCCA W22 Mu12 chr8 5414433 CTCGCGCGC W22 Mu12 chr8 8045837 CCGTTTTTT W22 Mu12 chr8 11654079 AAAAAATGG W22 Mu12 chr8 31356004 CAACACGGG W22 Mu12 chr8 31356012 CAACACGGG W22 Mu12 chr8 100614801 CATTGTAGG W22 Mu12 chr8 116461829 GCTTGCCGA W22 Mu12 ch r8 141273174 GTAGATTGG W22 Mu12 chr8 141274171 CTGATTGGG

PAGE 145

145 W22 Mu12 chr8 142983538 CCCGTCCCC W22 Mu12 chr8 142983546 CCCGTCCCC W22 Mu12 chr8 174147997 GCAAGCTTG W22 Mu12 chr9 14402800 CCCGTGTTG W22 Mu12 chr9 14402808 CCCGTGTTG W22 Mu12 chr9 25697019 C TAATTTTG W22 Mu12 chr9 37587573 CGTAGTGCA W22 Mu12 chr9 49227827 CCATTTTTT W22 Mu12 chr9 89417958 CCGTTTTTT W22 Mu12 chr9 107612912 AAAAAAACG W22 Mu12 chr9 130763403 GCAAACCAA TIL 1 Mu1 9 chr1 23792400 TACTGGAGT TIL 1 Mu1 9 chr1 59123448 CATGGACAT TIL 1 Mu1 9 chr1 85714506 ATGTCCATG TIL 1 Mu1 9 chr1 192534615 CCAATTGGT TIL 1 Mu1 9 chr1 196193415 GATGGGGAT TIL 1 Mu1 9 chr1 273709444 ATCTCTGAG TIL 1 Mu1 9 chr1 273709445 GAGGTCGAA TIL 1 Mu1 9 chr1 293153277 TTGGATCTG TIL 1 Mu1 9 chr1 293153283 TT GGATCCG TIL 1 Mu1 9 chr1 293153285 TTGGATCTG TIL 1 Mu1 9 chr10 8359341 GCTGGGGAC TIL 1 Mu1 9 chr10 57817953 TTGGCAGTG TIL 1 Mu1 9 chr2 135007660 GGCTGGCGG TIL 1 Mu1 9 chr2 135009766 GGCTGGCGG TIL 1 Mu1 9 chr2 136896747 CATGGACAT TIL 1 Mu1 9 chr3 678 6961 ACTCCAGTA TIL 1 Mu1 9 chr3 192453114 AAATGGATG TIL 1 Mu1 9 chr3 192454287 AAATGGATG TIL 1 Mu1 9 chr4 127799046 ATGCTGAGG TIL 1 Mu1 9 chr4 127799053 TATGCTGAG TIL 1 Mu1 9 chr4 159505930 GCCGTGCGA TIL 1 Mu1 9 chr4 165969407 GCTTCTTCT TIL 1 Mu1 9 chr4 212799894 GTCCGGGAG TIL 1 Mu1 9 chr5 12867393 GCGTGCGTG TIL 1 Mu1 9 chr5 12867401 GCGTGCGTG TIL 1 Mu1 9 chr5 113986705 CAAGGACGC TIL 1 Mu1 9 chr5 162172428 CTACTTTTC TIL 1 Mu1 9 chr5 162172436 CTACTTTTC TIL 1 Mu1 9 chr5 163349395 TGCGCCTGG TIL 1 Mu1 9 chr5 163349403 TGCGCCTGG TIL 1 Mu1 9 chr5 199583164 CTCGACTGC TIL 1 Mu1 9 chr5 199583172 CTCGACTGC

PAGE 146

146 TIL 1 Mu1 9 chr5 215660910 CCTCCTGTA TIL 1 Mu1 9 chr5 215660918 CCTCCTGTA TIL 1 Mu1 9 chr6 61512868 GCTGGGGAC TIL 1 Mu1 9 chr6 61512872 GCTGGGG AC TIL 1 Mu1 9 chr6 88799046 GGCAGGGAG TIL 1 Mu1 9 chr6 89452091 GTCGCCGTT TIL 1 Mu1 9 chr6 89452099 GTCGCCGAC TIL 1 Mu1 9 chr6 112507608 GTTCAGAAA TIL 1 Mu1 9 chr6 112507616 GTTCAGAAA TIL 1 Mu1 9 chr7 163974760 CATGGACAT TIL 1 Mu1 9 chr9 86968542 A TCAAATCT TIL 1 Mu1 9 chr9 86968550 ATCAAATCT TIL 1 Mu1 9 chr9 148332340 CGGACAAAG TIL 1 Mu10 chr2 199398880 GTTGTGTGG TIL 1 Mu10 chr3 189105626 GTCTAGAGC TIL 1 Mu10 chr4 158906485 AGAAGAGGG TIL 1 Mu10 chr4 158906493 AGAAGAGGG TIL 1 Mu10 chr5 1469979 7 CTCCCCAGC TIL 1 Mu10 chr5 14699805 CTCCCCAGC TIL 1 Mu10 chr5 70381872 GTTTTTCGG TIL 1 Mu10 chr5 70386843 GTTTTTCGG TIL 1 Mu10 chr5 203658329 GCCTGGTGC TIL 1 Mu10 chr5 203658336 GCCTGGTGC TIL 1 Mu10 chr5 211716624 ATTTTGCGA TIL 1 Mu10 chr5 21171663 1 CATTTTGAG TIL 1 Mu10 chr7 143685343 CCGAAAAAC TIL 1 Mu12 chr1 23421157 CTCTTCGTA TIL 1 Mu12 chr1 24834111 AAAAGAGGG TIL 1 Mu12 chr1 37644610 ACCAAATGG TIL 1 Mu12 chr1 104000456 CAAAAATGG TIL 1 Mu12 chr1 115673838 CCGCGCAGA TIL 1 Mu12 chr1 14851721 9 TAAAAAACG TIL 1 Mu12 chr1 216178602 GATTTAATT TIL 1 Mu12 chr1 255862376 CTGAAAACT TIL 1 Mu12 chr1 259661577 CCATTTTTT TIL 1 Mu12 chr10 881994 CCCCTCTAG TIL 1 Mu12 chr10 998234 TAGAGGGGG TIL 1 Mu12 chr10 4001312 CCCTCTCCT TIL 1 Mu12 chr10 18130504 TAGAGGGGG TIL 1 Mu12 chr10 62286122 GGAGGAGGA TIL 1 Mu12 chr10 135327980 GTCAGGGCT TIL 1 Mu12 chr10 135329010 CAGGGCTCG TIL 1 Mu12 chr2 5681848 CTCAAAGCC

PAGE 147

147 TIL 1 Mu12 chr2 5681856 CTCAAAACC TIL 1 Mu12 chr2 9947891 CTTGGACGA TIL 1 Mu12 chr2 12840264 CC CATTTTT TIL 1 Mu12 chr2 24581452 CTCGGTTGC TIL 1 Mu12 chr2 25000049 TTTGAGGTC TIL 1 Mu12 chr2 25001836 CAAAGGGTC TIL 1 Mu12 chr2 41169226 AACGGAAGA TIL 1 Mu12 chr2 56871254 CCATTTTTT TIL 1 Mu12 chr2 92129907 TCTGCGCGG TIL 1 Mu12 chr2 152204163 TGTAG TGCA TIL 1 Mu12 chr2 166047953 CTTGTGCGC TIL 1 Mu12 chr2 197215139 CGCGGTGGC TIL 1 Mu12 chr2 229531941 TAGAGGGGG TIL 1 Mu12 chr2 229540123 AGAGGGGGG TIL 1 Mu12 chr3 3839648 GCTTGCCGA TIL 1 Mu12 chr3 3839656 GCTTGCCGA TIL 1 Mu12 chr3 44634269 GGTTTTG CA TIL 1 Mu12 chr3 44634277 GGTTTTGCA TIL 1 Mu12 chr3 198011936 GGTGGACTG TIL 1 Mu12 chr3 217655664 CCGTTTTTT TIL 1 Mu12 chr3 227274385 AAAAAATGG TIL 1 Mu12 chr4 19135427 TAGAGGGGG TIL 1 Mu12 chr4 96634756 GGGCTCAAT TIL 1 Mu12 chr4 117710460 AGCGGTG TG TIL 1 Mu12 chr4 166495091 GTACATATG TIL 1 Mu12 chr4 166547003 CATATGTAC TIL 1 Mu12 chr4 182724999 GTTTTCAGA TIL 1 Mu12 chr4 182813239 AGTTTCAGA TIL 1 Mu12 chr4 182833406 AGTTTCAGA TIL 1 Mu12 chr4 191316757 TGCACTACG TIL 1 Mu12 chr4 239406228 GTGA GTGAG TIL 1 Mu12 chr5 4143111 GTAGTTTTT TIL 1 Mu12 chr5 23237962 GCCGTGCTC TIL 1 Mu12 chr5 26466383 AGCCTAGGA TIL 1 Mu12 chr5 26838263 CGCGGGCGG TIL 1 Mu12 chr5 42851585 AATATAATG TIL 1 Mu12 chr5 75952464 AGTTTCAGA TIL 1 Mu12 chr5 185027058 CAAACATT C TIL 1 Mu12 chr5 185079405 GAATGTTTG TIL 1 Mu12 chr5 200452877 TAGAGGGGG TIL 1 Mu12 chr5 203658329 GCCTGGTGC TIL 1 Mu12 chr5 203658336 GCCTGGTGC TIL 1 Mu12 chr5 215629072 AAAAAACGG

PAGE 148

148 TIL 1 Mu12 chr6 2365424 GCAGGTCAA TIL 1 Mu12 chr6 2365432 GCAGGTCAA TIL 1 Mu12 chr6 2917476 TCCATGATG TIL 1 Mu12 chr6 92047273 ATGCAGATG TIL 1 Mu12 chr6 118306026 GGAGGAGGA TIL 1 Mu12 chr6 121061543 CTGCGATAT TIL 1 Mu12 chr6 122067770 TGTTTGGTG TIL 1 Mu12 chr6 154460191 CTTGTTGGC TIL 1 Mu12 chr6 161409603 GTGCCGGAG TIL 1 Mu12 chr6 166433210 CTTGCCATC TIL 1 Mu12 chr7 27870762 TCGTGAGGA TIL 1 Mu12 chr7 126146334 CCGTTTTTT TIL 1 Mu12 chr7 144119874 GTGGGGGCC TIL 1 Mu12 chr7 154071387 CGGAGCAGT TIL 1 Mu12 chr7 161229569 ATCTGTCAG TIL 1 Mu12 chr8 100614801 CATTGTA GG TIL 1 Mu12 chr8 141273174 GTAGATTGG TIL 1 Mu12 chr8 141551809 GTGGGAGAG TIL 1 Mu12 chr8 141551817 GTGGGAGAG TIL 1 Mu12 chr8 150001149 GTGAATATG TIL 1 Mu12 chr8 158670019 AAAAGAGAC TIL 1 Mu12 chr8 171749899 CCACTCAGA TIL 1 Mu12 chr9 15351165 AAAAA ACGG TIL 1 Mu12 chr9 37587573 CGTAGTGCA TIL 1 Mu12 chrUNKNOWN 2134830 CCCCCTCTA TIL 1 Mu12 chrUNKNOWN 12783520 CAGTGGCCG TIL 11 Mu1 9 chr1 23792400 TACTGGAGT TIL 11 Mu1 9 chr1 33903858 CGTCGCCGC TIL 11 Mu1 9 chr1 33903861 GTCGCCGCC TIL 11 Mu1 9 chr1 143267304 TCAAAGGGG TIL 11 Mu1 9 chr1 150251733 ACTAAGAGC TIL 11 Mu1 9 chr1 150251737 AATGAGAGC TIL 11 Mu1 9 chr1 182238999 CCCCGTGTC TIL 11 Mu1 9 chr1 182239008 CCCCTGTCT TIL 11 Mu1 9 chr1 223805434 GTCTCATCT TIL 11 Mu1 9 chr1 240645665 CCGCCCCAC TIL 11 Mu1 9 chr1 264263006 TTAGGTCGG TIL 11 Mu1 9 chr1 264267812 TTAGGTCGG TIL 11 Mu1 9 chr10 14553777 ATTCCCATC TIL 11 Mu1 9 chr10 14553785 ATTCCCATC TIL 11 Mu1 9 chr10 57825502 TTGGCAGTG TIL 11 Mu1 9 chr2 25300688 GAGGCTCTC TIL 11 Mu1 9 chr2 25302 603 GAGGCTCTC

PAGE 149

149 TIL 11 Mu1 9 chr2 27958817 GTTGGCTTC TIL 11 Mu1 9 chr2 68252427 GATCTGGAT TIL 11 Mu1 9 chr2 68252435 GATCTGGAT TIL 11 Mu1 9 chr2 126544550 AGCTGCGGC TIL 11 Mu1 9 chr2 133879755 CTCGAGCCG TIL 11 Mu1 9 chr2 184094928 AGGGGAGGG TIL 11 Mu1 9 chr2 184527141 GAGGAGGAG TIL 11 Mu1 9 chr2 214951873 TTAGGTCGG TIL 11 Mu1 9 chr2 214951881 TTAGGTCGG TIL 11 Mu1 9 chr2 216885329 GGAAGAGAC TIL 11 Mu1 9 chr3 56931541 GTTTGCCAT TIL 11 Mu1 9 chr3 203236481 TGGTGTTGG TIL 11 Mu1 9 chr3 205237044 CGAAG CGGT TIL 11 Mu1 9 chr3 215879987 GGGAGCGGG TIL 11 Mu1 9 chr4 241230661 GGAAAACGA TIL 11 Mu1 9 chr4 241230669 GGAAAACGA TIL 11 Mu1 9 chr5 21457756 GTCCAAGAG TIL 11 Mu1 9 chr5 21457757 GTCCAAGAG TIL 11 Mu1 9 chr5 23137992 GTTTTTTCT TIL 11 Mu1 9 chr5 2 3138000 GTTTTTTCT TIL 11 Mu1 9 chr5 54748264 GCACTGAAC TIL 11 Mu1 9 chr5 54748272 GCACTGCAC TIL 11 Mu1 9 chr5 67359338 GCAGGGAAC TIL 11 Mu1 9 chr5 86107085 GTCGACAGC TIL 11 Mu1 9 chr5 86107093 GTCGACAGC TIL 11 Mu1 9 chr5 91554460 TCCGGTATT TIL 11 Mu 1 9 chr5 91554464 TCCGGTATT TIL 11 Mu1 9 chr5 152008704 CTCAGACGT TIL 11 Mu1 9 chr5 152008713 TCAGACGTT TIL 11 Mu1 9 chr5 175353380 TTGACGGTG TIL 11 Mu1 9 chr5 211716624 ATTTTGCGA TIL 11 Mu1 9 chr5 211716631 CATTTTGAG TIL 11 Mu1 9 chr6 2365368 CAGCCT CCC TIL 11 Mu1 9 chr6 88799046 GGCAGGGAG TIL 11 Mu1 9 chr7 5548985 TCCGGTATT TIL 11 Mu1 9 chr7 48473780 GCGGGAGAG TIL 11 Mu1 9 chr7 48474915 GCGGGAGAG TIL 11 Mu1 9 chr7 101032123 TCCAAGGGG TIL 11 Mu1 9 chr7 101032131 TCCAAGGGG TIL 11 Mu1 9 chr7 1471 35016 CACGCTGTA TIL 11 Mu1 9 chr8 124888956 ACGGCAAAC TIL 11 Mu1 9 chr8 124962257 ATGGCAAAC TIL 11 Mu1 9 chr8 140344459 CTCCTCCTC

PAGE 150

150 TIL 11 Mu1 9 chr8 140606536 TTCTTGTTC TIL 11 Mu1 9 chr8 140606544 TTCTTGTTC TIL 11 Mu1 9 chr8 153725735 GTTAGTTGT TIL 1 1 Mu1 9 chr8 153727357 GTTAGTTGT TIL 11 Mu1 9 chr8 155441208 GCGGCGAGG TIL 11 Mu1 9 chr8 155441216 GCGGCGAGG TIL 11 Mu1 9 chr8 158889648 TCTGAAGGC TIL 11 Mu1 9 chr9 86968542 ATCAAATCT TIL 11 Mu10 chr1 199599908 TGTGGAAAC TIL 11 Mu10 chr3 208243138 CC GGCTTCC TIL 11 Mu10 chr7 32479319 GCCCTACAG TIL 11 Mu12 chr1 4330648 GAGAGCAGA TIL 11 Mu12 chr1 4330676 GAGAGCAGA TIL 11 Mu12 chr1 55607850 TGTGGTAAG TIL 11 Mu12 chr1 55607855 TGTGGTAAG TIL 11 Mu12 chr1 164914752 TGCTCTACT TIL 11 Mu12 chr1 228947668 CACGGAAGT TIL 11 Mu12 chr1 228947671 CACGGAAGT TIL 11 Mu12 chr1 241036345 TTCATCCAA TIL 11 Mu12 chr1 268593297 CCGCCTGGG TIL 11 Mu12 chr1 268593361 CCGCCTGGG TIL 11 Mu12 chr1 289072008 ATGGACAGG TIL 11 Mu12 chr1 289072011 ATGGACAGG TIL 11 Mu12 chr1 0 4001312 CCCTCTCCT TIL 11 Mu12 chr10 119180615 CTCCCTCGT TIL 11 Mu12 chr10 125204541 CCTCCCAGG TIL 11 Mu12 chr10 127015035 GTGGGCTTG TIL 11 Mu12 chr10 127015043 GTGGGCTTG TIL 11 Mu12 chr2 24982189 GACCTCAAA TIL 11 Mu12 chr2 25000049 TTTGAGGTC TIL 1 1 Mu12 chr2 25001836 CAAAGGGTC TIL 11 Mu12 chr2 37681711 CCTCCCAGG TIL 11 Mu12 chr2 174429588 TCCTCCACA TIL 11 Mu12 chr2 177932386 GTCTACGAC TIL 11 Mu12 chr2 219231285 ATTCGTGAA TIL 11 Mu12 chr2 221889400 CTCGCCTCC TIL 11 Mu12 chr2 221889408 CTCGCCTC C TIL 11 Mu12 chr3 121611818 GGCGTAACT TIL 11 Mu12 chr3 174677907 GTGGGTATG TIL 11 Mu12 chr3 174677915 GTGGGTATG TIL 11 Mu12 chr4 87970072 CCGCCTGGG TIL 11 Mu12 chr4 117224174 GTCTGCGGT TIL 11 Mu12 chr4 141370454 ATCTCACGG

PAGE 151

151 TIL 11 Mu12 chr4 166495091 GTACATATG TIL 11 Mu12 chr4 166547003 CATATGTAC TIL 11 Mu12 chr4 182724995 GTTTTTAGA TIL 11 Mu12 chr4 239406228 GTGAGTGAG TIL 11 Mu12 chr4 240230508 GCGATGCGG TIL 11 Mu12 chr4 244752104 GATGAGGAG TIL 11 Mu12 chr4 244759229 CTCCTCATC TIL 11 Mu12 chr5 23237960 GCCGTGCCC TIL 11 Mu12 chr5 26466383 AGCCTAGGA TIL 11 Mu12 chr5 26839718 CGCGGGCGG TIL 11 Mu12 chr5 180873325 GTTGCGTGC TIL 11 Mu12 chr5 185027058 CAAACATTC TIL 11 Mu12 chr5 185079405 GAATGTTTG TIL 11 Mu12 chr5 191610797 AATGCAAGG TIL 11 Mu 12 chr6 81338048 CCCTGCGAG TIL 11 Mu12 chr6 157068229 CCTCAAGAA TIL 11 Mu12 chr6 163973601 CTCGGTCGG TIL 11 Mu12 chr6 163973609 CTCGGTCGG TIL 11 Mu12 chr6 166433210 CTTGCCATC TIL 11 Mu12 chr7 17586505 TCTAGGTTC TIL 11 Mu12 chr7 17586511 TCTAGGTTC TI L 11 Mu12 chr7 80745292 CCGCCGTCT TIL 11 Mu12 chr7 113563243 CCCAGGCGG TIL 11 Mu12 chr8 42932444 GACCTCAAA TIL 11 Mu12 chr8 148886228 CCTGTTTGA TIL 11 Mu12 chr8 148887210 CCTGTTTGA TIL 11 Mu12 chr9 4231266 GCACGCAAC TIL 11 Mu12 chr9 79219366 CCCAGGCG G TIL 11 Mu12 chr9 79219429 CCCAGGCGG TIL 14 Mu1 9 chr1 31547006 AGTTCCAAC TIL 14 Mu1 9 chr1 36633493 GGTGGGTGT TIL 14 Mu1 9 chr1 69912636 AAGCATATA TIL 14 Mu1 9 chr1 69912643 CAAGCATAT TIL 14 Mu1 9 chr1 127706260 GCGTCTCCT TIL 14 Mu1 9 chr1 1277062 68 GCGTCTCCT TIL 14 Mu1 9 chr1 264263006 TTAGGTCGG TIL 14 Mu1 9 chr1 264267812 TTAGGTCGG TIL 14 Mu1 9 chr1 284730450 GTGTAGCGT TIL 14 Mu1 9 chr1 284730458 GTGTAGCGC TIL 14 Mu1 9 chr10 4807989 CCGGCCCAC TIL 14 Mu1 9 chr10 57817953 TTGGCAGTG TIL 14 Mu 1 9 chr10 57817961 TTGGCAGTG TIL 14 Mu1 9 chr10 57825502 TTGGCAGTG

PAGE 152

152 TIL 14 Mu1 9 chr10 73896107 GTGGGCCGG TIL 14 Mu1 9 chr10 76529660 GTGGGCCGG TIL 14 Mu1 9 chr10 84011171 GTGGGCCGG TIL 14 Mu1 9 chr10 84011179 GTGGGCCGG TIL 14 Mu1 9 chr10 95549954 CCG GCCCAC TIL 14 Mu1 9 chr10 135931825 CCGGCCCAC TIL 14 Mu1 9 chr10 135940445 CCGGCCCAC TIL 14 Mu1 9 chr10 140658702 CTTTGCTTA TIL 14 Mu1 9 chr2 11182138 GTTTGAGTT TIL 14 Mu1 9 chr2 12001220 TAAGCAAAG TIL 14 Mu1 9 chr2 12001228 TAAGCAAAG TIL 14 Mu1 9 c hr2 43144616 CCGGCCCAC TIL 14 Mu1 9 chr2 43153193 GGACCCACG TIL 14 Mu1 9 chr2 135007660 GGCTGGCGG TIL 14 Mu1 9 chr2 135009766 GGCTGGCGG TIL 14 Mu1 9 chr2 165894948 GTGGGCCGG TIL 14 Mu1 9 chr2 204497124 CCGGCCCAC TIL 14 Mu1 9 chr2 214951873 TTAGGTCGG TIL 14 Mu1 9 chr2 214951881 TTAGGTCGG TIL 14 Mu1 9 chr3 164865943 CTCCTCGGT TIL 14 Mu1 9 chr3 164865951 CTCCTCGGT TIL 14 Mu1 9 chr3 186088298 GTTTGAGTT TIL 14 Mu1 9 chr3 192453114 AAATGGATG TIL 14 Mu1 9 chr3 192454287 AAATGGATG TIL 14 Mu1 9 chr3 230 139824 CCCATGCAG TIL 14 Mu1 9 chr3 230143403 CCCCTGCAG TIL 14 Mu1 9 chr4 6946626 AACTCAAAC TIL 14 Mu1 9 chr4 7039704 GTAGGACTG TIL 14 Mu1 9 chr4 7039712 GTAGGACTG TIL 14 Mu1 9 chr4 23486359 GTTTATGCC TIL 14 Mu1 9 chr4 58929004 CGTGGGGGT TIL 14 Mu1 9 chr4 133125649 TGGGCCGGA TIL 14 Mu1 9 chr4 159505930 GCCGTGCGA TIL 14 Mu1 9 chr4 159506805 GCCGTGCGA TIL 14 Mu1 9 chr4 165969407 GCTTCTTCT TIL 14 Mu1 9 chr4 174367455 ATCTATAGG TIL 14 Mu1 9 chr4 241230661 GGAAAACGA TIL 14 Mu1 9 chr4 241230669 GGAAAA CGA TIL 14 Mu1 9 chr5 42342232 CCGGCCCAC TIL 14 Mu1 9 chr5 116267117 ATCACCCAA TIL 14 Mu1 9 chr5 116268617 TCACCCGAG TIL 14 Mu1 9 chr5 175353380 TTGACGGTG TIL 14 Mu1 9 chr5 190082484 GTTTGAGTT

PAGE 153

153 TIL 14 Mu1 9 chr6 28306795 GCTGCAGGA TIL 14 Mu1 9 chr6 1 04062636 CTGCAGAGA TIL 14 Mu1 9 chr6 112507608 GTTCAGAAA TIL 14 Mu1 9 chr6 112507616 GTTCAGAAA TIL 14 Mu1 9 chr6 159357866 CCGGCCCAC TIL 14 Mu1 9 chr7 139884887 TCCGCCTAT TIL 14 Mu1 9 chr8 4819545 CCGGCCCAC TIL 14 Mu1 9 chr8 4819553 CCGGCCCAC TIL 14 Mu1 9 chr8 71393327 CCGGCCCAC TIL 14 Mu1 9 chr8 137160125 CCCGGCCCA TIL 14 Mu1 9 chr9 78186956 GCGGCCGTG TIL 14 Mu1 9 chr9 78186964 GCGGCCGTG TIL 14 Mu1 9 chr9 86968542 ATCAAATCT TIL 14 Mu1 9 chr9 86968550 ATCAAATCT TIL 14 Mu1 9 chr9 115971623 GTGGG CCGG TIL 14 Mu1 9 chr9 143065860 ACTATAATT TIL 14 Mu1 9 chrUNKNOWN 5341590 ATCAAATCA TIL 14 Mu1 9 chrUNKNOWN 10236078 GTGGGCCGG TIL 14 Mu10 chr1 282667382 CTCGAAATG TIL 14 Mu10 chr1 282712869 CATTTCGAG TIL 14 Mu10 chr10 24764948 CTTTTTTCT TIL 14 Mu1 0 chr10 24764954 CTTTTTTCT TIL14 Mu10 chr10 149024046 AGGGCACTC TIL 14 Mu10 chr2 76218121 TCGAGAGGG TIL 14 Mu10 chr2 76222892 TCGAGATGG TIL 14 Mu10 chr2 79137485 GGTGGCAAC TIL 14 Mu10 chr2 79137493 GGTGGCAAC TIL 14 Mu10 chr2 199398880 GTTGTGTGG TIL 14 Mu10 chr2 199398888 TTGTGTGGG TIL 14 Mu10 chr3 42433628 CCCTCTACA TIL 14 Mu10 chr3 185338367 GAACTGAAG TIL 14 Mu10 chr3 185338375 GAACTGAAG TIL 14 Mu10 chr3 207584229 AGTGTGCGC TIL14 Mu10 chr3 207584238 GTGTGCGCG TIL 14 Mu10 chr4 125145002 CCACTGG CC TIL 14 Mu10 chr4 125145010 CCACTGGCC TIL 14 Mu10 chr4 134472412 ATCTGAAGG TIL 14 Mu10 chr4 134472418 ATCTGAAAG TIL 14 Mu10 chr6 82267957 GCACAGGGG TIL14 Mu10 chr6 161830878 GCTCGGTCC TIL 14 Mu10 chr9 86968542 ATCAAATCT TIL 14 Mu10 chr9 86968550 A TCAAATCT TIL 14 Mu10 chr9 133089846 CCTCCCACG

PAGE 154

154 TIL 14 Mu10 chr9 133089853 CCCTCCCAC TIL 14 Mu12 chr1 145539 ACGTGTGGT TIL 14 Mu12 chr1 145547 ACGTGTGGT TIL 14 Mu12 chr1 10975143 CTCTCCTCG TIL 14 Mu12 chr1 37631584 ACCGAATGG TIL 14 Mu12 chr1 37644606 ACCGAATGG TIL 14 Mu12 chr1 104000456 CAAAAATGG TIL 14 Mu12 chr1 148517219 TAAAAAACG TIL 14 Mu12 chr1 148517222 TTAAAAAAC TIL 14 Mu12 chr1 156777148 GTTCAACGG TIL 14 Mu12 chr1 209635428 AACACAGCC TIL 14 Mu12 chr1 259661581 CCATTTTTG TIL 14 Mu12 chr1 293105542 GAAGCAACG TIL 14 Mu12 chr1 293105549 GAAGCAACG TIL 14 Mu12 chr1 299438326 CTGCTCTCC TIL 14 Mu12 chr10 134192589 TCTTCAGCC TIL 14 Mu12 chr2 9947891 CTTGGACGA TIL 14 Mu12 chr2 25000049 TTTGAGGTC TIL 14 Mu12 chr2 25001836 CAAAGGGTC TIL 14 Mu1 2 chr2 41169226 AACGGAAGA TIL 14 Mu12 chr2 56871254 CCATTTTTG TIL 14 Mu12 chr2 166047945 CTTGTGCGC TIL 14 Mu12 chr2 166047953 CTTGTGCGC TIL 14 Mu12 chr2 172959624 CTCGGGTCG TIL 14 Mu12 chr2 172959632 CTCGGGTCG TIL 14 Mu12 chr2 197519923 CCTTTCATG TI L 14 Mu12 chr3 3069893 CGAGACAGC TIL 14 Mu12 chr3 137939804 CACTATGCC TIL 14 Mu12 chr3 174677915 GTGGGTATG TIL 14 Mu12 chr3 196793062 CCTTCTCCA TIL 14 Mu12 chr3 223787656 CCTGTAGGA TIL 14 Mu12 chr3 230017369 TTCTTCCTG TIL 14 Mu12 chr4 31533656 GATGAG GAG TIL 14 Mu12 chr4 141370454 ATCTCACGG TIL 14 Mu12 chr4 166495091 GTACATATG TIL 14 Mu12 chr4 166547003 CATATGTAC TIL 14 Mu12 chr4 191316757 TGCACTACG TIL 14 Mu12 chr4 206328918 CTGTTTTTT TIL 14 Mu12 chr4 239406228 GTGAGTGAG TIL 14 Mu12 chr4 244752 093 GATGAGGAG TIL 14 Mu12 chr4 244759229 GATGAGGAG TIL 14 Mu12 chr5 2804395 CCCTCCACG TIL 14 Mu12 chr5 3132014 TTCTTTCCG

PAGE 155

155 TIL 14 Mu12 chr5 23270351 TGCTCTGTT TIL 14 Mu12 chr5 26466383 AGCCTAGGA TIL 14 Mu12 chr5 26839718 CGCGGGCGG TIL 14 Mu12 chr5 185 027058 CAAACATTC TIL 14 Mu12 chr5 185079405 GAATGTTTG TIL 14 Mu12 chr5 191610797 AATGCAAGG TIL 14 Mu12 chr6 28306795 GCTGTAGGA TIL 14 Mu12 chr6 121061543 CTGCGATAT TIL 14 Mu12 chr6 161409603 GTGCCGGAG TIL 14 Mu12 chr7 168040500 CGTTCCGGG TIL 14 Mu12 chr8 5414433 CTCGCGCGC TIL 14 Mu12 chr8 8732207 ACGTGACTG TIL 14 Mu12 chr8 17473048 AAAAAACAG TIL 14 Mu12 chr8 56659742 TCTTGCATT TIL 14 Mu12 chr8 72198358 CAAAAATGG TIL 14 Mu12 chr8 122200807 AAAAAAACA TIL 14 Mu12 chr8 139821649 TCCTCTGGC TIL 14 M u12 chr8 148886228 CCTGTTTGA TIL 14 Mu12 chr8 148887210 CCTGTTTGA TIL 14 Mu12 chr8 153727784 AAAATTTGG TIL 14 Mu12 chr9 4231266 GCACGCAAC TIL 14 Mu12 chr9 19060011 GTTATGAGG TIL 14 Mu12 chr9 24526877 TGTTGCTTG TIL 14 Mu12 chr9 37587573 CGTAGTGCA TIL 14 Mu12 chr9 68117808 GGTGGTTGA TIL 14 Mu12 chr9 143065853 TCTATAATT TIL 14 Mu12 chr9 146958032 GGTGTGCTG TIL 14 Mu12 chr9 147020771 GCTGCAGGA TIL 14 Mu12 chrUNKNOWN 12783520 CAGTGGCCG TIL 15 Mu1 9 chr1 31627099 CTTTATACG TIL 15 Mu1 9 chr1 264168398 AAAGGCTGA TIL 15 Mu1 9 chr1 264168406 AAAGGCTGA TIL 15 Mu1 9 chr1 264263006 TTAGGTCGG TIL 15 Mu1 9 chr1 264267812 TTAGGTCGG TIL 15 Mu1 9 chr10 2695677 TCCTTTGGC TIL 15 Mu1 9 chr10 10267286 GAAAGAGAG TIL 15 Mu1 9 chr10 57817961 TTGGCAGTG TIL 15 Mu1 9 chr10 119571336 CACCGAAGA TIL 15 Mu1 9 chr10 135523518 GCTTGCGGA TIL 15 Mu1 9 chr2 158557737 CTCTCTTTC TIL 15 Mu1 9 chr2 158559629 CTCTCTTTC TIL 15 Mu1 9 chr2 214951873 TTAGGTCGG TIL 15 Mu1 9 chr3 5218885 ACTGGACAG

PAGE 156

156 TIL 15 Mu1 9 chr3 54490053 CGTAGC GGG TIL 15 Mu1 9 chr3 192454287 AAATGGATG TIL 15 Mu1 9 chr3 222184435 CCTGCTCAC TIL 15 Mu1 9 chr3 222240693 CCTGCTCAC TIL 15 Mu1 9 chr5 67359338 GCAGGGAAC TIL 15 Mu1 9 chr5 86107093 GTCGACAGC TIL 15 Mu1 9 chr5 95712447 CACCGAAGA TIL 15 Mu1 9 chr5 12 4606626 ACAGCCATT TIL 15 Mu1 9 chr5 124607034 ACAGCCATT TIL 15 Mu1 9 chr5 168593504 GTGTCCGGC TIL 15 Mu1 9 chr5 174857474 TCTTCGGTG TIL 15 Mu1 9 chr6 28306795 GCTGCAGGA TIL 15 Mu1 9 chr6 47652355 CCACAAATA TIL 15 Mu1 9 chr6 74467317 CCCTGCCAA TIL 15 Mu1 9 chr6 83826441 GCCTCTGTG TIL 15 Mu1 9 chr7 103873034 CTTCAGTAG TIL 15 Mu1 9 chr7 129500559 ATGGCCGAG TIL 15 Mu1 9 chr8 140606536 TTCTTGTTC TIL 15 Mu1 9 chr8 169630728 GTCTCCCAC TIL 15 Mu1 9 chr9 27580335 CGCTCTGTT TIL 15 Mu1 9 chr9 27580343 CAC TCTGTT TIL 15 Mu1 9 chr9 28952231 GAAAGAGAG TIL 15 Mu1 9 chr9 34725229 GACGGGAAG TIL 15 Mu1 9 chr9 86968542 ATCAAATCT TIL 15 Mu1 9 chr9 86968550 ATCAAATCT TIL 15 Mu1 9 chrUNKNOWN 13826404 TGCAGTACA TIL 15 Mu1 9 chrUNKNOWN 13829283 TGCAGTACA TIL 15 M u10 chr1 24057144 ACCAGACAC TIL 15 Mu10 chr1 24057152 ACCAGACAC TIL 15 Mu10 chr1 103305287 GCGGGGCGG TIL 15 Mu10 chr2 21965511 GTTCGCTTT TIL 15 Mu10 chr4 133716937 TCCCCTGCG TIL 15 Mu10 chr4 170882661 TCCGCCCGC TIL 15 Mu10 chr4 170887658 GCGAGCGGA T IL 15 Mu10 chr5 11407307 CTGGTGCAG TIL 15 Mu10 chr5 78496112 CGCGGGATG TIL 15 Mu10 chr5 132407180 CGCGGGATG TIL 15 Mu10 chr6 109367787 GTCTCAGCC TIL 15 Mu10 chr7 129500567 ATGGCCGAG TIL 15 Mu10 chr8 123909907 CTTTTTTCA TIL 15 Mu10 chr9 11643467 TGGGC TGGG TIL 15 Mu10 chr9 11653693 GGGCTGGGA TIL 15 Mu12 chr1 19513553 CGAGAGCAG

PAGE 157

157 TIL 15 Mu12 chr1 24057144 ACCAGACAC TIL 15 Mu12 chr1 24057152 ACCAGACAC TIL 15 Mu12 chr1 37644606 ACCGAATGA TIL 15 Mu12 chr1 48108886 TCGCATTGT TIL 15 Mu12 chr1 55607850 TG TGGTAAG TIL 15 Mu12 chr1 86595530 GTTCGTTGG TIL 15 Mu12 chr1 111562669 TCTGTTTTC TIL 15 Mu12 chr1 115673838 CCGCGCAGA TIL 15 Mu12 chr1 150964626 TCGGGGAAC TIL 15 Mu12 chr1 150964678 TCGGGGAAC TIL 15 Mu12 chr1 201020716 ATATCGAGG TIL 15 Mu12 chr1 201 421470 ATGATTAGC TIL 15 Mu12 chr1 216177818 TTCATTACT TIL 15 Mu12 chr1 239257924 CAAAAAAAC TIL 15 Mu12 chr1 259661577 CCATTTTTT TIL 15 Mu12 chr1 268593292 CCGCCTGGG TIL 15 Mu12 chr10 4001312 CCCTCTCCT TIL 15 Mu12 chr10 9345105 GTTCGTTGG TIL 15 Mu12 chr10 15300760 CTTGCAATG TIL 15 Mu12 chr10 15308429 CTTGCAATG TIL 15 Mu12 chr10 30284887 CATCATATC TIL 15 Mu12 chr10 35483010 ACGGCAGCC TIL 15 Mu12 chr10 40781053 AATATGATG TIL 15 Mu12 chr10 64912929 CCAACGAAC TIL 15 Mu12 chr10 70933873 GTTTCAAAC TI L 15 Mu12 chr10 70933881 GTTTCAAAC TIL 15 Mu12 chr10 79444984 CCAACGGAC TIL 15 Mu12 chr10 99668137 GTTCGTTGG TIL 15 Mu12 chr10 101696709 AAAAAACGG TIL 15 Mu12 chr10 102160009 GCCTCAGCC TIL 15 Mu12 chr10 102160017 ACCTCAGCC TIL 15 Mu12 chr10 102798787 CCAACGAAC TIL 15 Mu12 chr10 103073179 AAAAAAAGG TIL 15 Mu12 chr10 119180615 CTCCCTCGT TIL 15 Mu12 chr10 140369582 CCAACGAAC TIL 15 Mu12 chr10 144276123 TACTTCATC TIL 15 Mu12 chr10 144276125 GGTGATATG TIL 15 Mu12 chr10 146725851 TCTCGAGAC TIL 15 Mu1 2 chr10 146725852 CTCTCGAGA TIL 15 Mu12 chr2 9947888 CTCCCTGGA TIL 15 Mu12 chr2 14415088 CGTTTCGTT TIL 15 Mu12 chr2 19241199 CCCAAGTAT TIL 15 Mu12 chr2 19241206 CCCCAAGTA

PAGE 158

158 TIL 15 Mu12 chr2 24581452 CTCGGTTGC TIL 15 Mu12 chr2 24982189 GACCTCAAA TIL 15 Mu12 chr2 25000049 TTTGAGGTC TIL 15 Mu12 chr2 32307444 CAATGCGAA TIL 15 Mu12 chr2 37869180 GGGCACGAG TIL 15 Mu12 chr2 39450649 GGCGACGAT TIL 15 Mu12 chr2 39450657 GACGACGAT TIL 15 Mu12 chr2 44473557 CTCGCCCTC TIL 15 Mu12 chr2 92129907 TCTGCGCGG TIL 15 Mu12 chr2 138425824 ATCTGTGTG TIL 15 Mu12 chr2 152204164 CCGTAGTGC TIL 15 Mu12 chr2 164986733 GCCTGTCGT TIL 15 Mu12 chr2 176017855 GCGGTATGA TIL 15 Mu12 chr2 188598484 AAATTATTG TIL 15 Mu12 chr2 197519923 CCTTTCATG TIL 15 Mu12 chr2 197525159 CCTT TCATG TIL 15 Mu12 chr2 207958804 GTACAGAAC TIL 15 Mu12 chr2 207958827 GTACAGAAC TIL 15 Mu12 chr2 212502671 GGCCCACGC TIL 15 Mu12 chr2 212502677 GGCCCACGC TIL 15 Mu12 chr2 230681917 ATCTTCCAA TIL 15 Mu12 chr2 230681925 ATCTTCCAA TIL 15 Mu12 chr3 1396 1881 CAACGAACG TIL 15 Mu12 chr3 15862117 GGCTACAGC TIL 15 Mu12 chr3 54490053 GTAGCGGGG TIL 15 Mu12 chr3 89795711 CTTCAGAGA TIL 15 Mu12 chr3 107202921 CCAGTTCTT TIL 15 Mu12 chr3 122798122 CACCGGGTG TIL 15 Mu12 chr3 122798130 CACCGGGTG TIL 15 Mu12 chr 3 123120622 GCTCTTGCC TIL 15 Mu12 chr3 123120628 TGCTCTTGC TIL 15 Mu12 chr3 131246208 TCTCCACAC TIL 15 Mu12 chr3 131246216 TCTCCACAC TIL 15 Mu12 chr3 137939804 CACTATGCC TIL 15 Mu12 chr3 156342516 GTCCCCAGC TIL 15 Mu12 chr3 156383673 GTCCCCAGC TIL 1 5 Mu12 chr3 174677907 GTGGGTATG TIL 15 Mu12 chr3 174677915 GTGGGTATG TIL 15 Mu12 chr3 216962792 CCAACGAAC TIL 15 Mu12 chr3 217655664 CCGTTTTTT TIL 15 Mu12 chr4 30057147 ACCTGACGG TIL 15 Mu12 chr4 30057160 ACGTGACGG TIL 15 Mu12 chr4 36278332 ACTTCGCCT

PAGE 159

159 TIL 15 Mu12 chr4 43099274 CAACTTCAG TIL 15 Mu12 chr4 65877958 TAAATTATT TIL 15 Mu12 chr4 67680114 GTTTAGACT TIL 15 Mu12 chr4 67680404 GTTTAGACT TIL 15 Mu12 chr4 71147569 CCCCACACC TIL 15 Mu12 chr4 96634756 GGGCTCAAT TIL 15 Mu12 chr4 161135534 CCTCG TCGG TIL 15 Mu12 chr4 166495091 GTACATATG TIL 15 Mu12 chr4 168526010 TGGTAATGC TIL 15 Mu12 chr4 172693620 TCTACGTAG TIL 15 Mu12 chr4 182724999 GTTTTCAGA TIL 15 Mu12 chr4 191316757 TGCACTACG TIL 15 Mu12 chr4 200868608 ACGACAGCT TIL 15 Mu12 chr4 23940 6228 GTGAGTGAG TIL 15 Mu12 chr5 26466385 AACCTAGGA TIL 15 Mu12 chr5 26838263 CGCGGGCGG TIL 15 Mu12 chr5 26839718 CGCGGGCGG TIL 15 Mu12 chr5 42851585 AATATGATG TIL 15 Mu12 chr5 64749197 GTCGCACTG TIL 15 Mu12 chr5 100266817 CCAACGAAC TIL 15 Mu12 chr5 142950413 AATAATTTA TIL 15 Mu12 chr5 159638069 CGTTCGTTG TIL 15 Mu12 chr5 185027058 CAAACATTC TIL 15 Mu12 chr5 185079405 GAATGTTTG TIL 15 Mu12 chr5 191610797 AATGCAAGG TIL 15 Mu12 chr5 203749479 TTCGTCGGC TIL 15 Mu12 chr5 203763309 TTCGTCGGC TIL 15 Mu12 chr5 214442515 TTGTGGAGA TIL 15 Mu12 chr5 214578191 TCCGCCGGC TIL 15 Mu12 chr5 215629072 AAAAAACGG TIL 15 Mu12 chr6 3564348 AATAATTTA TIL 15 Mu12 chr6 22394708 CCGTTTTTT TIL 15 Mu12 chr6 22394712 CGTTTTTTA TIL 15 Mu12 chr6 28306795 GCTGCAGGA TI L 15 Mu12 chr6 55872876 TCCCCGCCC TIL 15 Mu12 chr6 59179011 GCTACGGGG TIL 15 Mu12 chr6 92842968 TGTAGTGCA TIL 15 Mu12 chr6 109240327 ATCTAAAGT TIL 15 Mu12 chr6 114703271 TGGAGAAGG TIL 15 Mu12 chr6 121061537 GCGGTATGA TIL 15 Mu12 chr6 146135776 CCAACG AAC TIL 15 Mu12 chr6 164674718 AAGCCATCG TIL 15 Mu12 chr6 164674726 ATCGGGGGC

PAGE 160

160 TIL 15 Mu12 chr6 169241024 TCCCCCACC TIL 15 Mu12 chr7 95770434 CCAACGAAC TIL 15 Mu12 chr7 113002964 CTTCGCATT TIL 15 Mu12 chr7 126146334 CCGTTTTTT TIL 15 Mu12 chr7 1262703 35 AATAATTTA TIL 15 Mu12 chr7 136322570 CGCGGAAGG TIL 15 Mu12 chr7 144119874 GTGGGGGCC TIL 15 Mu12 chr7 161229569 ATCTGTCAG TIL 15 Mu12 chr7 167493431 AACATTAGA TIL 15 Mu12 chr7 169729473 TCCATTTCC TIL 15 Mu12 chr8 5414433 CTCGCGCGC TIL 15 Mu12 chr8 8045837 CCGTTTTTT TIL 15 Mu12 chr8 17473053 AAAAAAACA TIL 15 Mu12 chr8 55561241 TAAATTATT TIL 15 Mu12 chr8 68787675 ACCAGAGAG TIL 15 Mu12 chr8 104254931 GTTCGTTGG TIL 15 Mu12 chr8 120021601 CGAGACGGC TIL 15 Mu12 chr8 141273174 GTAGATTGG TIL 15 Mu12 chr8 141274171 CTGATTGGG TIL 15 Mu12 chr8 148887210 CCTGTTTGA TIL 15 Mu12 chr8 158654007 CCAACGAAC TIL 15 Mu12 chr8 162533913 AATAATTTA TIL 15 Mu12 chr8 163197198 GGTCTGTGG TIL 15 Mu12 chr9 7199139 CTTTTCTTG TIL 15 Mu12 chr9 7509789 CATGTGAGT TIL 1 5 Mu12 chr9 7509796 ACATGTGAG TIL 15 Mu12 chr9 15061435 GCGAGCGTC TIL 15 Mu12 chr9 16219735 CTGAACAGG TIL 15 Mu12 chr9 37587573 CGTAGTGCA TIL 15 Mu12 chr9 52218933 CCAACGAAC TIL 15 Mu12 chr9 89417958 CCGTTTTTT TIL 15 Mu12 chr9 107612912 CAAAAAAAC TI L 15 Mu12 chr9 112265159 AATAATTTA TIL 15 Mu12 chr9 122725864 ACGCTCGCG TIL 15 Mu12 chrUNKNOWN 1206141 GTTCGTTGG TIL 15 Mu12 chrUNKNOWN 3949219 GTTCGTTGG TIL 15 Mu12 chrUNKNOWN 4432770 GTTCGTTGG TIL 15 Mu12 chrUNKNOWN 12783520 CAGTGGCCG TIL 15 Mu12 c hrUNKNOWN 13989818 CCAACGAAC TIL 17 Mu1 9 chr1 12908801 AGTGGTGTG TIL 17 Mu1 9 chr1 12908809 AGTGGTGTG TIL 17 Mu1 9 chr1 166720093 CTCTTTTTT TIL 17 Mu1 9 chr1 192534615 CCAATTGGT

PAGE 161

161 TIL 17 Mu1 9 chr1 215947275 GTCGGCTGG TIL 17 Mu1 9 chr1 286507980 CTTCC CGTC TIL 17 Mu1 9 chr1 286507988 CTTCCCGTC TIL 17 Mu1 9 chr10 1528766 CATACCAAA TIL 17 Mu1 9 chr10 26092417 CTAGTTTTA TIL 17 Mu1 9 chr10 95816317 CCCTTGGAT TIL 17 Mu1 9 chr2 170371447 TCATTTCGG TIL 17 Mu1 9 chr2 222626068 AACTGCATA TIL 17 Mu1 9 chr2 222626073 AACTGCATA TIL 17 Mu1 9 chr3 17667046 ATATACTGG TIL 17 Mu1 9 chr3 17667054 ATATACTGG TIL 17 Mu1 9 chr3 156476232 GACACAGGT TIL 17 Mu1 9 chr3 162086773 GTCTATGTT TIL 17 Mu1 9 chr3 186538356 GTTGGAGGA TIL 17 Mu1 9 chr3 186538364 GTTGGAGGA TI L 17 Mu1 9 chr4 204148219 CCCCTTGGA TIL 17 Mu1 9 chr4 205456456 ATCGCTAGA TIL 17 Mu1 9 chr4 245028283 TTCTAAGGC TIL 17 Mu1 9 chr4 245262746 GGCGCAGCC TIL 17 Mu1 9 chr4 245262752 GGCGCAGCC TIL 17 Mu1 9 chr5 30710208 ATCGCTAGA TIL 17 Mu1 9 chr5 7364593 5 TCCGGTGGG TIL 17 Mu1 9 chr5 124607034 ACAGCCATT TIL 17 Mu1 9 chr5 211716624 ATTTTGCGA TIL 17 Mu1 9 chr5 215710584 CCTACCGAA TIL 17 Mu1 9 chr6 89452091 GTCGCCGAT TIL 17 Mu1 9 chr6 89452099 GTCGCCGAC TIL 17 Mu1 9 chr7 4969417 CCAGCCGAC TIL 17 Mu1 9 chr7 48473780 GCGGGAGAG TIL 17 Mu1 9 chr7 48474915 GCGGGAGAG TIL 17 Mu1 9 chr7 101032123 TCCAAGGGG TIL 17 Mu1 9 chr7 101032131 TCCAAGGGG TIL 17 Mu1 9 chr7 129476513 GGAGAGAAG TIL 17 Mu1 9 chr7 129476521 GGAGAGAAG TIL 17 Mu1 9 chr7 151077094 CACGCTCGC TIL 17 Mu1 9 chr7 151077102 CACGCTCGC TIL 17 Mu1 9 chr8 13135449 TCTAGCGAT TIL 17 Mu1 9 chr8 84671868 TGTGTGTTT TIL 17 Mu1 9 chr8 140606536 TTCTTGTTC TIL 17 Mu1 9 chr8 140606544 TTCTTGTTC TIL 17 Mu1 9 chr9 1964225 AACACACAC TIL 17 Mu1 9 chr9 869685 42 ATCAAATCT TIL 17 Mu1 9 chr9 86968550 ATCAAATCT

PAGE 162

162 TIL 17 Mu1 9 chr9 98364784 CTCCATGTT TIL 17 Mu1 9 chr9 98364792 CTCCGTGTT TIL 17 Mu1 9 chr9 119937508 GCGGGACGC TIL 17 Mu1 9 chr9 119937512 GCGGGACGC TIL 17 Mu1 9 chr9 134489929 TCCAAGGGG TIL 17 Mu1 9 chr9 140075465 TTCTCAGCC TIL 17 Mu1 9 chrUNKNOWN 1099618 AGACGGGAA TIL 17 Mu1 9 chrUNKNOWN 2559941 TCTAGCGAT TIL 17 Mu10 chr1 17669190 GTTTGTCGC TIL 17 Mu10 chr1 117819615 GGCTCCCGG TIL 17 Mu10 chr1 248504111 CTGGCCGTG TIL 17 Mu10 chr1 282667382 CT CGAAATG TIL 17 Mu10 chr1 282712869 CATTTCGAG TIL 17 Mu10 chr10 24764948 CTTTTTTCT TIL 17 Mu10 chr10 24764954 CTTTTTTCT TIL 17 Mu10 chr10 26666847 GTTTATGAA TIL 17 Mu10 chr10 26666849 TTTATGAAA TIL17 Mu10 chr10 26765521 TTTATGAAA TIL 17 Mu10 chr10 14 6725798 GCTCCCTGG TIL 17 Mu10 chr2 199398880 GTTGTGTGG TIL 17 Mu10 chr2 199398888 GTTGTGTGG TIL 17 Mu10 chr3 21938454 ATCCACATC TIL 17 Mu10 chr3 21938460 ATCCACATC TIL 17 Mu10 chr4 39099270 TAGAGAGAA TIL 17 Mu10 chr4 42133990 GTACAGCAC TIL 17 Mu10 c hr4 241703022 GGGTGAGAT TIL 17 Mu10 chr5 14699797 CTCCCCAGC TIL 17 Mu10 chr5 14699805 CTCCCCAGC TIL 17 Mu10 chr5 23032174 ACCACCGGC TIL 17 Mu10 chr5 23032182 ACCACCGGC TIL 17 Mu10 chr5 100132261 CTCCCCAGC TIL 17 Mu10 chr5 211716624 ATTTTGCGA TIL 17 Mu10 chr5 211716631 CATTTTGAG TIL 17 Mu10 chr6 128755403 GTACAGCAC TIL 17 Mu10 chr7 48473773 CCGGGAGAG TIL 17 Mu10 chr7 48474915 GCGGGAGAG TIL17 Mu10 chr7 68128989 CACGGCCAG TIL 17 Mu10 chr7 115146272 GCGTGGTGG TIL 17 Mu10 chr8 38522071 TCCAGCCTC TI L 17 Mu10 chr8 86898952 AGGCGACAG TIL 17 Mu10 chr8 138362068 TTCTAGTTT TIL 17 Mu12 chr1 10975143 CTCTCCTCG TIL 17 Mu12 chr1 37644610 ACCAAATGG

PAGE 163

163 TIL 17 Mu12 chr1 55607850 TGTGGTAAG TIL 17 Mu12 chr1 55607855 TGTGGTAAG TIL 17 Mu12 chr1 92449217 CCCGTAGCC TIL 17 Mu12 chr1 153632582 GGCTACGGG TIL 17 Mu12 chr1 166720101 CTCTTTTTT TIL 17 Mu12 chr1 180238452 GGCTACGGG TIL 17 Mu12 chr1 252512309 CCCGTAGCC TIL 17 Mu12 chr1 255428941 GTTTCCCAA TIL 17 Mu12 chr1 263848328 ATCGCCTCT TIL 17 Mu12 chr1 299438326 CTGCTCTCC TIL 17 Mu12 chr10 2848 GGCTACGGG TIL 17 Mu12 chr10 1732767 GGCTACGGG TIL 17 Mu12 chr10 3931832 CCCCTCTCC TIL 17 Mu12 chr10 4001312 CCCTCTCCT TIL 17 Mu12 chr10 5757837 CCCGTAGCC TIL 17 Mu12 chr10 11711685 GGCTACGGG TIL 17 Mu12 chr10 117768 99 GGCTATGGG TIL 17 Mu12 chr10 15300760 CTTGCAATG TIL 17 Mu12 chr10 15308429 CTTGCAATG TIL 17 Mu12 chr10 16208189 CTCGTCGGT TIL 17 Mu12 chr10 17390707 CCCTTCCTC TIL 17 Mu12 chr10 17968533 GGCTACGGG TIL 17 Mu12 chr10 23393883 GGCCACGGG TIL 17 Mu12 ch r10 24948354 CCCGTAGCC TIL 17 Mu12 chr10 27092751 CCCGTAGCC TIL 17 Mu12 chr10 30556629 CCGCTGCGC TIL 17 Mu12 chr10 31269599 CTTACCACA TIL 17 Mu12 chr10 31883694 CCCCTCTCT TIL 17 Mu12 chr10 35473684 CGGCAGCCA TIL 17 Mu12 chr10 35483010 ACGGCAGCC TIL 17 Mu12 chr10 40595711 AATATGATG TIL 17 Mu12 chr10 40595719 AATATGATG TIL 17 Mu12 chr10 41262391 GGCTACGGG TIL 17 Mu12 chr10 42227109 CCAGTAGCC TIL 17 Mu12 chr10 44114838 GGAGGCGTC TIL 17 Mu12 chr10 44491043 CCCGTAGCC TIL 17 Mu12 chr10 45432395 CATCA TATT TIL 17 Mu12 chr10 57813012 GGCAGGGAT TIL 17 Mu12 chr10 59359085 GGCTACGGG TIL 17 Mu12 chr10 61467640 GAGGAATTG TIL 17 Mu12 chr10 65410065 CCCGTAGCC TIL 17 Mu12 chr10 68226252 CCCGTAGCC TIL 17 Mu12 chr10 71749471 GGCTACGGG

PAGE 164

164 TIL 17 Mu12 chr10 8819 3727 CCCGTAGCC TIL 17 Mu12 chr10 93904468 GGCTACGGG TIL 17 Mu12 chr10 98444777 CCCGTAGCC TIL 17 Mu12 chr10 109818012 CCTCCCGTC TIL 17 Mu12 chr10 116479548 CTCAGCATG TIL 17 Mu12 chr10 116479556 CTCGGCATG TIL 17 Mu12 chr10 123395285 GGCTACGGG TIL 17 M u12 chr10 133273075 CCCGTAGCC TIL 17 Mu12 chr10 146557512 GGCTACGGG TIL 17 Mu12 chr10 146557520 GGCTACGGG TIL 17 Mu12 chr10 146586003 GGCTACGGG TIL 17 Mu12 chr10 147129698 GACGGGAGG TIL 17 Mu12 chr10 147129735 GACGGGAGG TIL 17 Mu12 chr2 496212 CTCGGC ATT TIL 17 Mu12 chr2 1089430 TCCTTCCCC TIL 17 Mu12 chr2 24581453 TCGGTTGCG TIL 17 Mu12 chr2 25000044 GACCCTTTG TIL 17 Mu12 chr2 37681407 GCACTAATG TIL 17 Mu12 chr2 37869180 GGGCACGAG TIL 17 Mu12 chr2 46312927 CCCGTAGCC TIL 17 Mu12 chr2 63309331 GTGG ATCTG TIL 17 Mu12 chr2 65572626 GTCAGAGGC TIL 17 Mu12 chr2 107385876 TCCTCTTCC TIL 17 Mu12 chr2 107385884 TCCTCTTCC TIL 17 Mu12 chr2 113503509 CTCGGCATG TIL 17 Mu12 chr2 117876096 GGAAACAAG TIL 17 Mu12 chr2 149547189 TCCATATGG TIL 17 Mu12 chr2 14954 8163 TCCATATGG TIL 17 Mu12 chr2 152204163 TGTAGTGCA TIL 17 Mu12 chr2 166840850 TGCAGGGTG TIL 17 Mu12 chr2 172205740 CAGCGGAGC TIL 17 Mu12 chr2 197215141 TCGCGGGGC TIL 17 Mu12 chr2 203293320 GGCTACGGG TIL 17 Mu12 chr3 1763267 CGTGGCGTC TIL 17 Mu12 ch r3 1763275 CGTGGCGTC TIL 17 Mu12 chr3 16026824 CCCGTAGCC TIL 17 Mu12 chr3 16221042 GGCTACAGC TIL 17 Mu12 chr3 21821458 CTACCCGTA TIL 17 Mu12 chr3 36137635 GTTAAGGAG TIL 17 Mu12 chr3 161858390 ACACTAGAC TIL 17 Mu12 chr3 162086769 CGTCTATGT TIL 17 Mu1 2 chr3 162086773 GTCTATGTT TIL 17 Mu12 chr3 184864664 CTAGGCGAG

PAGE 165

165 TIL 17 Mu12 chr3 184864672 CTAGGCGAG TIL 17 Mu12 chr3 199343657 GGCTACGGG TIL 17 Mu12 chr3 210661448 CCCGTAGCC TIL 17 Mu12 chr4 11294640 GTCGAGCGG TIL 17 Mu12 chr4 64300124 CTCGGCATG TI L 17 Mu12 chr4 67680114 GTTTAGACT TIL 17 Mu12 chr4 67680404 GTTTAGACT TIL 17 Mu12 chr4 96634756 GGGCTCAAT TIL 17 Mu12 chr4 113085139 AGCCTGAAG TIL 17 Mu12 chr4 136075548 CCCCAACCC TIL 17 Mu12 chr4 136075556 CCCCAACCC TIL 17 Mu12 chr4 161135527 CTCGTC GGT TIL 17 Mu12 chr4 161135535 CTCGTCGGT TIL 17 Mu12 chr4 166495091 GTACATATG TIL 17 Mu12 chr4 166547002 CATATGTAT TIL 17 Mu12 chr4 168526003 GGTAATGCA TIL 17 Mu12 chr4 168526011 GGTAATGCA TIL 17 Mu12 chr4 182724996 CAGAAGGTC TIL 17 Mu12 chr4 182724 999 GTTTTCAGA TIL 17 Mu12 chr4 191316757 TGCACTACG TIL 17 Mu12 chr4 200868607 CACGACAGC TIL 17 Mu12 chr4 239406228 GTGAGTGAG TIL 17 Mu12 chr5 8517544 CTGCTACTC TIL 17 Mu12 chr5 26466383 AGCCTAGGA TIL 17 Mu12 chr5 26838263 CGCGGGCGG TIL 17 Mu12 chr5 42849194 AATATGATG TIL 17 Mu12 chr5 42851585 AATATGATG TIL 17 Mu12 chr5 64749197 TGTCGCACT TIL 17 Mu12 chr5 132724116 CACCCTGAC TIL 17 Mu12 chr5 167153492 CCAGAGGGA TIL 17 Mu12 chr5 185027058 CAAACATTC TIL 17 Mu12 chr5 185079405 GAATGTTTT TIL 17 Mu1 2 chr5 191610797 AATGCAAGG TIL 17 Mu12 chr5 207526903 CTATGCGGA TIL 17 Mu12 chr5 214442521 GCTCGCGGG TIL 17 Mu12 chr5 214578190 CTCCGCCGG TIL 17 Mu12 chr6 2575151 GTTTTCCAA TIL 17 Mu12 chr6 2917476 TCCATGATG TIL 17 Mu12 chr6 13851597 GGCTACGGG TIL 1 7 Mu12 chr6 13851605 GGATACGGG TIL 17 Mu12 chr6 38435508 CCCGAGGCC TIL 17 Mu12 chr6 53962988 ATGAAGACC TIL 17 Mu12 chr6 55872875 ATCCCCGCC

PAGE 166

166 TIL 17 Mu12 chr6 62418458 CATCATATT TIL 17 Mu12 chr6 74383151 CCCTCTCCT TIL 17 Mu12 chr6 77087974 AATATGATG TI L 17 Mu12 chr6 78114239 CCCGTAGCC TIL 17 Mu12 chr6 78155916 CCCGTAGCC TIL 17 Mu12 chr6 89940991 GGCTACGGG TIL 17 Mu12 chr6 92197928 CCTTGCAAG TIL 17 Mu12 chr6 92842968 CGTAGTGCA TIL 17 Mu12 chr6 99963634 GTGGATCTG TIL 17 Mu12 chr6 100137700 CAGCTCAAT TIL 17 Mu12 chr6 100137708 CAGCTCAAT TIL 17 Mu12 chr6 106449118 CCCGTAGCC TIL 17 Mu12 chr6 107182865 CCCGTAGCC TIL 17 Mu12 chr6 109240325 GTAATGTGT TIL 17 Mu12 chr6 109240327 ATCTAATGT TIL 17 Mu12 chr6 110826082 GGCTACGGG TIL 17 Mu12 chr6 143020500 GGAAGGGAT TIL 17 Mu12 chr6 149531955 GAGTAGCAG TIL 17 Mu12 chr6 157788113 CGCCCCGAT TIL 17 Mu12 chr6 158541306 ATCTGCTCA TIL 17 Mu12 chr6 166433210 CTTGCCATC TIL 17 Mu12 chr6 169129268 CCCCCACCC TIL 17 Mu12 chr6 169241025 CCCCCACCC TIL 17 Mu12 chr7 15575142 TGAACAGGA TIL 17 Mu12 chr7 15575481 TGAACAGGA TIL 17 Mu12 chr7 29508617 CTCGGCATG TIL 17 Mu12 chr7 29913742 GTCAAAGGT TIL 17 Mu12 chr7 51499769 CTCGGCATG TIL 17 Mu12 chr7 51751905 CATGCCGAG TIL 17 Mu12 chr7 51751913 CATGCCGAG TIL 17 Mu12 c hr7 136322569 CCGCGGAAG TIL 17 Mu12 chr7 144119874 GTGGGGCCA TIL 17 Mu12 chr7 151005031 ACGGCAAGA TIL 17 Mu12 chr7 161229569 ATCTGTCAG TIL 17 Mu12 chr7 167493430 CAACATTAG TIL 17 Mu12 chr7 167493438 CAACATTAG TIL 17 Mu12 chr7 169668702 CTAAAAGAG TIL 17 Mu12 chr7 169668703 ACTAAAAGA TIL 17 Mu12 chr7 169729474 CCATTTCCA TIL 17 Mu12 chr8 5414433 CTCGCGCGC TIL 17 Mu12 chr8 8995040 TCCATTTCA TIL 17 Mu12 chr8 37023109 CCCGTAGCC TIL 17 Mu12 chr8 44535993 CCCGTAGCC

PAGE 167

167 TIL 17 Mu12 chr8 66089811 CATCATATT TIL 17 Mu12 chr8 92169214 CTCGGCATG TIL 17 Mu12 chr8 109095975 GGCTACGGG TIL 17 Mu12 chr8 120021601 CGAGACGGC TIL 17 Mu12 chr9 7000884 CCCGTAGCC TIL 17 Mu12 chr9 9497336 GCTACGGGG TIL 17 Mu12 chr9 14452982 GGCTACGGG TIL 17 Mu12 chr9 16219735 TGAACAGG A TIL 17 Mu12 chr9 22666174 TCTCTCTCT TIL 17 Mu12 chr9 30376224 GACGCCACG TIL 17 Mu12 chr9 37204160 GGCTACGGG TIL 17 Mu12 chr9 37587573 CGTAGTGCA TIL 17 Mu12 chr9 40524602 CATCCCTGC TIL 17 Mu12 chr9 52945708 CTCGGCACG TIL 17 Mu12 chr9 62651198 ACTAA AAGA TIL 17 Mu12 chr9 63431838 CCGCTCGAC TIL 17 Mu12 chr9 74188523 CCGTAGCCT TIL 17 Mu12 chr9 78735749 CTCGGCATG TIL 17 Mu12 chr9 78735757 CTCGGCATG TIL 17 Mu12 chr9 80678772 TCGGGGAGA TIL 17 Mu12 chr9 85510106 CCCGTAGCC TIL 17 Mu12 chr9 95994917 CC CGTAGCC TIL 17 Mu12 chr9 98334525 GGCTACGGG TIL 17 Mu12 chr9 115623561 GGCTACGGG TIL 17 Mu12 chr9 120688928 CCCGTAGCC TIL 17 Mu12 chr9 130377493 CTCTCTCTT TIL 17 Mu12 chr9 139170075 GATCCCTGA TIL 17 Mu12 chr9 140112790 GGCTACGGG TIL 17 Mu12 chr9 146 113969 TCCTGTTCA TIL 17 Mu12 chr9 147125385 TCTCTCTCT TIL 17 Mu12 chr9 147125393 TCTCTCTCT TIL 17 Mu12 chrUNKNOWN 756223 GGCTATGGG TIL 17 Mu12 chrUNKNOWN 833180 GGCTACGGG TIL 17 Mu12 chrUNKNOWN 1239802 GGCTACGGG TIL 17 Mu12 chrUNKNOWN 3164384 GGCTACG GG TIL 17 Mu12 chrUNKNOWN 6262680 CTCGTAGCC TIL 17 Mu12 chrUNKNOWN 6656498 ATTGAGCTC TIL 17 Mu12 chrUNKNOWN 8287600 GGCTACGGG TIL 17 Mu12 chrUNKNOWN 12184565 CCCGTAGCC TIL 17 Mu12 chrUNKNOWN 12184573 CCCGTAGCC TIL 17 Mu12 chrUNKNOWN 12783520 CAGTGGCC G

PAGE 168

168 LIST OF REFERENCES Alleman M, Freeling M (1986) The Mu transposable elements of maize: evidence for transposition and copy number regulation during development. Genetics 112: 107 119 Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al. (2003) Genomewide insertional mutagenesis of Arabidopsis thaliana Science 301: 653657 Anderson CT, Carroll A, Akhmetova L, Somerville C (2010) Real time imaging of cellulose reorientation during cell wall expansion in Arabidopsis roots. Plant Physiol 152: 787 796 Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 14: 796815 Arioli T, Peng L, Betzner AS, Burn J, Wittke W, Herth W, Camiller i C, Hfte H, Plazinski J, Birch R, et al. (1998) Molecular analysis of cellulose biosynthesis in Arabidopsis Science 279: 717 720 Bacic A, Stone BA (1980) A (1 3) and (1 4) D glucan in the endosperm cell walls of wheat. Carbohydr Res 82: 372 38 7 Backues SK, Konopka CA, McMichael CM, Bednarek SY (2007) Bridging the divide between cytokinesis and cell expansion. Curr Opin Plant Biol 10: 607 615 Bai L, Singh M, Pitt L, Sweeney M, Brutnell TP (2007) Generating novel allelic variation through Activat or insertional mutagenesis in maize. Genetics 175: 981992 Barker F, Thompson DV, Talbot DR, Swanson J, Bennetzen JL (1984) Nucleotide sequence of the maize transposable element Mu1. Nucleic Acids Res 12: 59555967 Bednarek SY, Falbel TG (2002) Membrane tr afficking during plant cytokinesis. Traffic 3: 621629 Bensen RJ, Johal GS, Crane VC, Tossberg JT, Schnable PS, Meely RB, Briggs SP ( 1995) Cloning and characterization of the maize An1 gene. Plant Cell 7 : 7584 Bernal AJ, Jensen JK, Harholt J, Srensen S, Moller I, Blaukopf C, Johansen B, de Lotto R, Pauly M, Schelle HV, et al (2007) Disruption of ATCSLD5 results in reduced growth, reduced xylan and homogalacturonan synthase activity and altered xylan occurrence in Arabidopsis. Plant J 52: 791802 Bernal AJ, Yoo C M, Mutwil M, Jensen JK, Hou G, Blaukopf C, Sorensen S, Blancaflor EB, Scheller HV, Willats WGT (2008) Functional analysis of the cellulose synthaselike genes CSLD1 CSLD2 and CSLD4 in tip growing Arabidopsis cells. Plant Physiol 148 : 12381253 Bonetta DT, Facette M, Raab TK, Somerville CR ( 2002) Genetic dissection of plant cellwall biosynthesis. Biochem Soc Tran 30 : 298301 Brutnell TP (2002) Transposon tagging in maize. Funct Integr Genomics 2 : 4 12 Brutnell TP. Conrad LJ ( 2003) Transposon tag ging using Activ ator (Ac) in maize. Methods Mol Biol 23 : 157 176

PAGE 169

169 Buckeridge MS, Rayon C, Urbanowicz B, Tine MAS, Carpita N ( 2004) Mixed linkage (1 3),(1 4) D Glucans of grasses. Cereal Chem 81 : 115127 Burton RA, Gibeaut DM, Bacic A, Findlay K, Roberts K Hamilton A, Baulcombe DC, Fincher GB (2000) Virus induced silencing of a plant cellulose synthase gene. Plant Cell 12 : 691 705 Burton RA, Shirley NJ, King BJ, Harvey AJ, Fincher GB (2004) The CesA gene family of barley. Quantitative analysis of transcripts reveals two groups of coexpressed genes. Plant Physiol 134 : 224236 Burton RA, Wilson SM, Hrmova M, Harvey AJ, Shirley NJ, Medhurst A, Stone BA, Newbigin EJ, Bacic A, Fincher GB (2006) Cellulose SynthaseLike CslF genes mediate the synthesis of cell wall (1,3;1,4) D glucans. Science 311 : 19401942 Campbell JA, Davies GH, Bulone V, Henriss at B ( 1997) A classification of nucleotidediphosphosugar glycosyltransferases based on amino acid sequence similarities. Biochem. J 326 : 929939 Carpita NC (1984) Cell wall development in maize coleoptiles. Plant Physiol 76 : 202 212 Carpita NC, Gibeaut DM (1993) Structural models of primary cell walls in flowering plants: consistency of molecular structure with the physical properties of walls during growth. Plant J 3 : 1 30. Carpita NC (1996) Structure and biogenesis of the cell walls of grasses. Annu Rev Plant Mol Biol 47 : 445 476 Carpita NC, Defernez M, Findlay K, Wells B, Shoue DA Catchpole G, Wilson RH, McCann MC ( 2001) Cell wall architecture of the elongating m aize coleoptile. Plant Physiol 127 : 551 565 Carpita NC, McCann M ( 2002) The functions of cell wall polysaccharides in composition and architecture revealed through mutations. Plant Soil 247 : 71 80 Carpita NC, McCann MC (2008) Maize and sorghum: genetic res ources for the bioenergy grasses. Trends Plant Sci 13 : 415420 Chaffey N, Barlow P (2002) Myosin, microtubules, and microfilaments: cooperation between cytoskeletal components during cambial cell division and secondary vascular differentiation in trees. P lanta 214 : 526 536 Chandler VL, Hardeman KJ (1992) The Mu elements of Zea mays. Adv Genet 30 : 77122 Chomet P, Lisch D, Hardeman DJ, Chandler VL, Freeling M ( 1991 ) Identification of a regulatory transposon that controls the Mutator transposable element sys tem in maize. Genetics 129 : 261270 Clancy M, Hannah LC (2002) Splicing of the maize Sh1 first intron is essential for enhancement on gene expression, and a T rich motif increases expression without affecting splicing. Plant Physiol 130: 918 929 Cleary AL, Smith LG (1998) The Tangled1 gene is required for spatial control of cytoskeletal arrays associated with cell division during maize leaf development. Plant Cell 10 : 18751888

PAGE 170

170 Cocuron JC, Lerouxel O, Drakakaki G, Alonso AP, Leipman AH, Keegstra K, Raikhel N, Wilkerson CG (2007) A gene from the cellulose synthaselike C family 1,4 glucan synthase. Proc Natl Acad Sci USA 104 : 85508555 Cole RA, Fowler JE (2006) Polarized growth: maintaining focus on the tip. Curr Opin Plant Biol 9 : 579 588 Cosgrove DJ (2005) Grow th of the plant cell wall. Nat Rev Mol Cell Biol 6 : 850 861 Coutinho PM Henrissat B ( 1999) Carbohydrateactive enzymes server at URL: http://a fmb.cnrs mrs.fr/CAZY/index.html Coutinho PM, S tam M, Blanc E, and Henrissat B ( 2003) Why are there so many carbohydrateactive enzyme related genes in plants? Trends Plant Sci 8 : 563565 Cresse AD, Hulbert SH, Brown WE, Lucas JR, Bennetzen JL (1995) Mu1related transposable elements of maize preferentially insert into low copy number DNA. Genetics 140 : 315 324 Crowel l EF, Bischoff V, Desprez T, Rolland A, Stierhof Y D, Scumacher K, Gonneau M, Hofte H, Vernhetes S (2009) Pausing of Golgi bodies on microtubules regulates secretion of cellulose synthase complexes in Arabidopsis. Plant Cell 21 : 11411154 Deeks MJ, Cyrckov a F, Machesky LM, Mikitova V, Ketelaar T Zarsky V, Davies B Hussey PJ (2005) Arabidopsis group le formins localize to specific cell membrane domains, interact with actinbinding proteins and cause defects in cell expansion upon aberrant expression. New P hytol 168 : 529 540 Delmer DP, Stone BA (1988) Biosynthesis of plant cell walls. In: Priess J (ed) The biochemistry of plants. Academic Press Inc., New York, pp 373 421 Delmer DP (1999) Cellulose biosynthesis: exciting times for a difficult field of study. Annu Rev Plant Physiol Plant Mol Biol 50 : 245 276 Derbyshire P, Findlay K, McCann MC, Roberts K (2007) Cell elongation in Arabidopsis hypocotyls involves dynamic changes in cell wall thickness. J Exp Bot 58: 20792089 Dhont S, Vanhaeren H, Van Loo D, Cnudd e V, Inz D (2010) Plant structure visualization by highresolution X ray computed tomography. Trends Plant Sci 15 : 419422 Dhonukshe P, Balu ka F, Schlicht M, Hlavacka A, amaj J, Friml J, Gadella WJ (2006) Endocytosis of cell surface material mediates cell plate formation during plant cytokinesis. Dev Cell 10: 137 150 Dhugga KS, Barreiro R, Whitten B, Stecca K, Hazebroek J, Randhawa GS, Dolan M, Kinney AJ, Tomes D, Nichols S, Anderson P mannan synthase is a member of the cellulose synthase super gene family. Science 303 : 363366 Dietrich CR, Cui F, Packila ML, Li J, Ashlock DA, Nikolau BJ, Schnable PS ( 2002) Maize Mu transposons are targeted to the 5` untranslated regi on of the gl8 gene and sequences flanking Mu target site duplications exhibit nonrandom nucleotide composition throughout the genome. Genetics 160 : 697716

PAGE 171

171 Doblin MS, De Melis L, Newbigin E, Bacic A, Read SM ( 2001) Pollen tubes of Nicotiana alata express t wo genes from different glucan synthase families. Plant Physiol 125 : 20402052 Doblin MS, Pettolino FA, Wilson SM, Campbell R, Burton RA, Fincher GB, Newbigin E, Bacic A (2009) A barley cellulose synthaselike CSLH gene mediates (1,3;1,4) D glucan synthesis in transgenic Arab idopsis Proc Natl Acad Sci USA 106 : 5996 6001 Doebley J (2004) The genetics of maize evolution. Annu Rev Genet 38 : 37 59 Duvick DN (2005) The contribution of breeding to yield advances in maize (Zea mays L.). Adv Agron 8 6: 83145 Edwards M, Dea ICM, Bulpi n PV, Reid JSG (1985) Xyloglucan (amyloid) mobilization in the cotyledons of Topaeolum majus L seeds following germination. Planta 163: 133140 Eveland AL, McCarty DR, Koch KE (2008) Transcript profiling by 3` untranslated region sequencing resolves expres sion of gene families. Plant Physiol 146 : 3244 Farrokhi N, Burton RA, Brownfield L, Hrmova M, Wil son SM, Bacic A, Fincher GB ( 2006) Plant cell wall biosynthesis: genetic, biochemical and functional genomics approaches to the identification of key genes. P lant Biotech J 4 : 145 167 Favery B, Ryan E, Foreman J, Linstead P, Boudonck K, Steer M, Shaw P, Dolan L ( 2001) KOJAK encodes a cellulose synthaselike protein required for root hair cell morphogenesis in Arabidopsis Genes Dev 15 : 7987 Fernandes J, Dong Q F, Schneider B, Morrow DJ, Nan GL, Brendel V, Walbot V (2004) Genomewide mutagenesis of Zea mays L. using RescueMu transposons. Genome Biol 5 : R82 Fincher GB (2009) Revolutionary times in our understanding of cell wall biosynthesis and remodeling in the g rasses. Plant Physiol 149 : 27 37 Fukunaga K, Hill J, Vigouroux Y, Matsuoka Y, Sanchez JG, Liu K, Buckler ES, Doebley J (2005) Genetic diversity and population structure of teosinte. Genetics 169 : 2241 2254 Franti ek B, Salaj J, Mathur J, Braun M, Jasper F, amaj J, Chua N H, Barlow W, Volkman D (2000) Root hair formation: F actin dependent tip growth is initiated by local assembly of profiling supported F actin meshwords accumulated within expansinenriched bulges. Dev Biol 227 : 618632 Gallagher K, Smith L G (1999) Discordia mutations specifically misorient asymmetric cell divisions during development of the maize leaf epidermis. Development 126 : 46234633 Hershberger RJ, Warren CA, Walbot V (1991) Mutator activity in maize correlates with the presence and expression of the Mu transposable element Mu9. Proc Natl Acad Sci USA 88 : 1019810202

PAGE 172

172 Hildebrand T, Ruegsegger P (1997) A new method for the model independent assessment of thickness in three dimensional images. J Microsc 185 : 6775 Holland N, Holland D, He lentjaris T, Dhugga K, Xoconostle Cazares B, Delmer DP (2000) A comparative analysis of the plant cellulose synthase ( CesA ) gene family. Plant Physiol 123 : 13131323 Hong Z, Delauney AJ, Verma DPS (2001) A cell platespecific callose synthase and its inter action with phragmoplastin. Plant Cell 13 : 755768 IIyama K, Lam TBT, Stone BA ( 1990) Phenolic acid bridges between polysaccharides and lignin. Phytochemistry 29: 733 737 Ingouff M, Fitz Gerald JN, Guerin C, Robert H, Sorensen MB, Van Damme D, Geelen D, Bl anchoin L, Berger F (2005) Plant formin AtFH5 is an evolutionarily conserved actin nucleator involved in cytokinesis. Nat Cell Biol 7 : 374 380 International Human Genome Sequencing Consortium, Lander ES, Linton LM, Birren B, Nusbaum C, Zody MC, Baldwin J, Devon K, Dewar K, Doyle M, et al. (2001) Initial sequencing and analysis of the human genome. Nature 409 : 860 921 Jarvis MC, Forsyth W, Duncan HJ (1988) A survey of the pectic content of nonlignified monocot cell walls. Plant Physiol 88 : 309314 Jarvis MC (1994) Structure and properties of pectin gels in plant cell walls. Plant Cell Environ 7 : 153 164 Jeong YM, Mun JH, Kim H, Lee SY, Kim SG (2007) An upstream region in the first intron of petunia actindepolymerizing factor 1 affects tissuespecific express ion in transgeneic Arabidopsis ( Arabidopsis thaliana ). Plant J 50 : 230239 Jin SY, Chen HZ (2007) Near infrared analysis of the chemical composition of rice straw. Indust Crops Prod 26 : 207 211 Jung HG, Casler MD ( 2006) Maize stem tissues: impact of development on cell wall degradability. Crop Sci 46 : 18011809 Keegstra K, Walton J glucans brewers bane, dieticians delight. Science 311 : 18721873 Kidwell MG, Lisch DR (2000) Transposable elements and host genome evolution. Trends Ecol Evol 15 : 95 99 Kim CM, Park SH, Je BI, Park SH, Park SJ, Piao, HL, Eun MY Dolan L, Han C D (2007) OsCSLD1 a cellulose synthaselik D1 gene, is required for root hair morphogenesis in rice. Plant Physiol 143 : 12201230 Kim JB, Olek AT, Carpita NC ( 2000) Plasma membrane and cell wall exoB D glucanases in developing maize coleo ptiles. Plant Physiol. 123 : 471 485 Kimura S, Laosinchai W, Itoh T, Cui X, Linder CR, Brown RM (1999) Immunogold labeling of rosette terminal cellulosesynthesizing complexes in the vascular plant Vigna angularis. Plant Cell 11: 20752085

PAGE 173

173 Kolkman JM, Conra d LJ, Farmer PR, Hardeman K, Ahern KR, Lewis PE, Sawers RJH, Lebejko S, Chomet P, Brutnell TP (2005) Distribution of Activator ( Ac ) throughout the maize genome for use in regional mutagenesis. Genetics 169 : 981 995 Kurek I, Kawagoe Y, Jacob Wilk D, Doblin M, Delmer D (2002) Dimerization of cotton fiber cellulose synthase catalytic subunits occurs via oxidation of the zinc binding domains. Proc Natl Acad Sci USA 99 : 11109 11114 Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valen tin F, Wallace IM, Wilm A, Lopez R, et al. (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23 : 29472948 Lee M, Sharopova N, Beavis WD, Grant D, Katt M, Blair DL, Hallauer AR (2002) Expanding the genetic map of maize with the intermated B73 x Mo17 (IBM) population. Plant Mol Biol 48 : 453461 Letunic I, Doerks T, Bork P (2009) SMART 6: recent updates and new developments. Nucleic Acids Res (Database issue): D229232 Li M, Xiong G, Li R, Cui J, Tang D, Zhang B, Pauly M, Cheng Z, Zhou Y (2009) Rice cellulose synthaselike D4 is essential for normal cell wall biosynthesis and plant growth. Plant J 60 : 10551069 Liepman AH, Wilkerson C, Keegstra K (2005). Expression of cellulose synthaselike ( Csl) genes in insect cells reveals that CslA family members encode mannan synthases. Proc Natl Acad Sci USA 102: 2221 2226 Lippman ZB, Zamir D (2007) Heterosis: revisiting the magic. Trends Genet 23 : 6066 Lisch D, Chomet P, Freeling M (1995) Genetic characterization of the Mutator system in maize: behavior and regulation of Mu transposons in a minimal line. Genetics 139 : 1777 1796 Lisch D (2002) Mutator transposons. Trends Plant Sci 7 : 498 504 Liu S, Yeh C T, Ji T, Ying K, Wu H, Tan HM, Fu Y, Nettleton D, Schnable PS (2009) Mu transposon insertion sites and meioti c recombination events colocalize with epigenetic marks for open chromatin across the maize genome. PLoS Genetics (10.1371/journal.pgen.1000733) Lukowitz W, Mayer U, Jrgens G (1996) Cytokinesis in the Arabidopsis embryo involves the syntaxinrelated KNOL LE gene product. Cell 84 : 6171 Mohanty A, Luo A, DeBlasio S, Ling, X, Yang Y, Tuthill DE, Williams KE, Hill D, Zadrozny T, Chan A, Sylvester AW, Jackson D (2009) Advancing cell biology and functional genomics in maize using fluorescent proteintagged lines. Plant Physiol 149 : 601 605 Lynch MA, Staehelin LA ( 1995) Immunocytochemical localization of cell wall polysaccharides in the root tip of Avena sativa. Protoplasma 188 : 115 127 Lynd LR, Wyman CE, Gerngross TU (1999) Biocommodity engineering. Biotechnol P rog 15: 777 793

PAGE 174

174 Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, Bemben LA, Berka J, Baverman MS, Chen YJ, Chen Z, et al. (2005) Genome sequencing in microfabricated high density picolitre reactors. Nature 437 : 376 380 Matsuoka Y, Vigouroux Y, Goodma n MM, Sanchez JG, Buckler E, Doebley J (2002) A single domestication for maize shown by multilocus microsatellite genotyping. Proc Natl Acad Sci USA 99 : 6080 6084 May BP, Liu H, Vollbrecht E, Senior L, Rabinowicz PD, Roh D, Pan X, Stein L, Freeling M, Alex ander D, Mertienssen R ( 2003) Maize targeted mutagenesis: a knockout resource for maize. Proc Natl Acad Sci USA 101: 14349 14354 McCann MC, Wells B, Roberts K (1990) Direct visualization of the crosslings in the primary cell wall. J Cell Sci 96 : 323334 Mc Cann MC, Roberts K ( 1991) Architecture of the primary cell wall. In The Cytoskeletal Basis of Plant Growth and Form. C.W. Lloyd, ed. Acade mic Press: London. pgs. 109129 McCann MC, Roberts K (1994) Changes in cell wall architecture during cell elongation. J Exp Bot 45 : 16831691 Manfield IW, Orfila C, McCartney L, Harholt J, Bernal AJ, Scheller HV, Gilmartin PM, Mikkelsen JD, Knox JP, Willats WGT (2004) Novel cell wall architecture of isoxabenhabituated Arabidopsis suspensioncultured cells: global transcr ipt profiling and cellular analysis. Plant Journal 4 0: 260 275 McCarty DR, Carson CB, Stinard PS, Robertson DS (1989) Molecular analysis of viviparous 1: an abscisic acidinsensitive mutant of maize. Plant Cell 1 : 523532 McCarty DR, Settles AM, Suzuki M, Tan BC, Latshaw S, Porch T, Robin K, Baier J, Avigne W, Lai J, et al. (2005) Steady state transposon mutagenesis in inbred maize. Plant J 44 : 52 61 McCarty DR, Meeley RB (2009) Transposon Resources for forward and reverse genetics in maize. In JL Bennetzen, S Hake, eds, Handbook of Maize. Springer, New York, pp 561584 McClintock B ( 1947) Chromosome organization and gene expression. Cold Spring Harb Symp Quant Biol 16: 1347 Meeley RB, Briggs SP ( 1995) Reverse genetics for maize. Maize Genet Coop Newsl 69: 6782 Meier H, Reid JSG ( 1982) Reverse polysaccharides other than starch in higher plants. In Encyclopedia of P lant Physiology, Vol. 13. A.F.A. Loewu W Tanner, eds. Springer Verlag: Berlin. pgs. 418471 Mellerowicz EJ, Baucher M, Sundberg B, Boerjan W ( 2001) Unravelling cell wall formation in the woody dicto stem. Plant Mol Biol 47 : 239274 Miyata T, Yasunaga T, Nishida T (1980) Nucleotide sequence divergence and functional constraint in mRNA evolution. Proc Natl Acad Sci USA 77 : 73287332 Molchan TM, Va lster AH, Hepler PK (2002) Actomyosin promotes cell plate alignment and late lateral expansion in Tradescantia stamen hair cells. Planta 214 : 683 693

PAGE 175

175 Molendijk AJ, Bischoff F, Rajendrakumar CS, Friml J, Braun M, Gilroy S, Palme K (2001) Arabidopsis thaliana Rop GTPases are localized to tips of root hairs and control polar growth EMBO J 20 : 27792788 Moulia B (2000) Leaves as shell structures: double curvature, auto stresses, and minimal mechanical energy contstraints on leaf rolling in grasses. J Plant Grow th Regul 19: 1930 Mueller SC, Brown RM (1980) Evidence for an intramembrane component associated with a cellulose microfibril synthesizing complex in higher plants. JCell Biol 84 : 315326 Nairn CJ, Haselkorn T (2005) Three loblolly pine CesA genes express ed in developing xylem are orthologous to secondary cell wall CesA genes of angiosperms. New Phyto 166 : 907 915 Nam J, Mysore KS, Zheng C, Knue MK, Matthysse AG, Gelvin SB (1999) Identification of T DNA tagged Arabidopsis mutants that are resistant to tran sformation by Agrobacterium Mol Gen Genet 261 : 429438 Natera SHA, Ford KL, Cassin AM, Patterson JH, Newbigin EJ, Bacic A (2008) Analysis of the Oryza sativa plasma membrane proteome using combined protein and peptide fractionation approaches in conjunctio n with mass spectrometry. Proteome Res 7 : 1159 1187 Ne meth C, Freeman J, Jones HD, Sparks C, Pellny TK, Wilkinson MD, Dunwell J, Anderson AM, (2010) Downregulation of the CSLF6 gene results in decreased (1,3;1,4) D glucan in endosperm of wheat. Plant Physiol 152 : 12091218 Okamoto H, Hirochika H (2001) Silencing of transposable elements in plants. Trends Plant Sci 6 : 527 534 Orfila C, Sorensen SO, Harholt J, Geshi N, Crombie H, Truong HN, Reid JS, Knox JP, Scheller HV (2005) QUASIMODO1 is expressed in vascular tissue of Arabidopsis thaliana inflorescence stems, and affects homogalacturonan and xylan biosynthesis. Planta 222 : 613 622 Park S, Baker JO, Himmel ME, Parillaz PA, Johnson DK (2010) Cellulose crystallinity index: measurement techniques and their impact on interpreting cellulose performance. Biotech Biofuels 3 : 10 Pauly M, Keegstra K (2008) Cell wall carbohydrates and their modification as a resource for biofuels. Plant J 54 : 559568 Pear JR, Kawagoe Y, Schreckengost WE, Delmer DP, Stalker DM (1996) Higher plants contain homologs of the bacterial celA genes encoding the catalytic subunit of cellulose synthase. Proc Natl Acad Sci USA 93 : 1263712642 Penning BW, Hunter CT III, Tayengwa R, Eveland AL, Dugard CK, Olek AT, Vermerris W, Koch KE, McCarty DR, Davis MF, et al. (2009) G enetic resources for maize cell wall biology. Plant Physiol 151 : 1 29 Persson S, Caffall KH, Freshour G, Hilley MT, Bauer S, Poindexter P, Hahn MG, Hohnen D, Somerville C (2007) The Arabidopsis irregular xylem8 mutant is

PAGE 176

176 deficient in glucuronoxylan and hom ogalcturonan, which are essential for secondary cell wall integrity. Plant Cell 19 : 237 255 Peterson RL, Farquhar ML (1996) Root hairs: specialized tubular cells extending root surfaces. Bot Rev 62: 1 40 Pilling E, Hfte H ( 2003) Feedback from the wall. Cu rr Opin Plant Biol 6 : 611 616 Popper ZA, and Fry SC ( 2003) Primary cell wall composition of bryophytes and charophytes. Annals Botany 91 : 1 12 Raizada MN, Walbot V ( 2000) The late developmental pattern of Mu transposon excision is conferred by a cauliflower mosaic virus 35S driven MURA cDNA in transgenic maize. Plant Cel l 1 2: 5 22 Ragauskas AJ, Williams CK, Davison BH, Britovsek G, Cairney J, Eckert CA, Frederick WJ, Hallet JP, Leak DJ, Liotta CL, et al. (2006) The path forward for biofuels and biomaterials Science 311: 484 489 Rebollo R, Horard B, Hubert B, Vieira C (2010) Jumping genes and epigenetics: Towards new species. Gene 454 : 1 7 Redgwell RJ, Selvendran RR (1986) Structural features of cell wall polysaccharides in onion Allium cepa. Carbohydr Res 1 57 : 183 199 Reid JSG (1993) Seed storage polysaccharides : models for the study of cell wall matrix biosynthesis and turnover. J Cell Biochem Suppl 17 : 9 15 Reiter W D ( 2002) Biosynthesis and properties of the plant cell wall. Curr Opin Plant Biol 5 : 536 42 Reynolds JO, Eisses JF, Sylvester AW (1998) Balancing division and expansion during maize leaf morphogenesis: analysis of the mutant, warty 1. Dev 125: 259 268 Richmond T (2000) Higher plant cellulose synthases. Genome Biol 1 : reviews3001.1reviews3001.6 Richmond TA, Somerville CR (2000) The cellulose synthase superfamily. Plant Physiol 124 : 495 498 Richmond TA, Somerville CR (2001) Integrative approaches to determining Csl function. Plant Mol Biol 47 : 131 143 Roberts AW, Bushoven JT (2007) The cellulose s ynthase ( CESA) gene superfamily of the moss Physcomitrella patens Plant Mol Biol 63 : 207 219 Robertson DS (1978) Characterization of a mutator system in maize. Mut Res 51 : 21 28 Rose AB, Elfersi T, Parra G, Korf I (2008) Promoter proximal introns in Arabi dopsis thaliana are enriched in dispersed signals that elevate gene expression. Plant Cell 20: 543 551 Rudall PJ, Caddick LR (1994) Investigation of the presence of phenolic compounds in monocotyledonous cell walls, using UV fluorescence microscopy. Ann Bot 74: 483 491

PAGE 177

177 Sabba RP, Vaughn KC (1999) Herbicides that inhibit cellulose biosynthesis. Weed Sci 47: 757 763 Samuels AL, Giddings TH, Staehelin LA (1995) Cytokinesis in tobacco BY 2 and root tip cells: a new model of cell plate formation in higher plants. J Cell Biol 130 : 13451357 Samuga A, Joshi CP (2004) Cloning and characterization of cellulose synthaselike gene, PtCSLD2 from developing xylem of aspen trees. Physiol Plant 120 : 631 641 Sandhu AP, Randhawa GS, Dhugga KS (2009) Plant cell wall matrix pol ysaccharide biosynthesis. Mol Plant 2 : 840 850 Saxena IM, Brown RM, Fevre M, Geremia RA, Henrissat B ( 1995) Multidomain glycosyl transferases: implications for mechanism of action. J Bacteriol 177 : 14191424 Schnable P, Peterson PA, Saed ler H (1989) The bz rcy allele of the Cy transposable element system of Zea mays contains a Mulike element insertion. Mol Gen Genet 217: 459 463 Schnable PS, Ware D, Fulton RS, Stein JC, Wei F, Pasternak S, Liang C, Zhang J, Fulton L, Graves TA, et al. (2 009) The B73 maize genome: complexity, diversity, and dynamics. Science 326 : 11121115 Scheible W R, Pauly M ( 2004) Glycosyltransferases and cell wall biosynthesis: novel players and insights. Curr Opin Plant Biol 7 : 285 95 Schubert C (2006) Can biofuels fi nally take center stage? Nat Biotech 24: 777784 Schultz J, Milpetz F, Bork P, Ponting CP (1998) SMART, a simple modular architecture research tool: identification of signaling domains. Proc Natl Acad Sci USA 95 : 58575864 Settles AM, Latshaw S, McCarty DR (2004) Molecular analysis of highcopy insertion sites in maize. Nucleic Acids Res 32 : e54 Settles AM, Holding DR, Tan BC, Latshaw SP, Liu J, Suzuki M, Li L, OBrien BA, Fajardo DS, Wroclawska E, et al. (2007) Sequenceindexed mutations in maize using the UniformMu transposontagging population. BMC Genomics 8 : 116 Shapiro J (1979) Molecular model for the transposition and replication of bacteriophage Mu and other transposable elements. Proc Natl Acad Sci USA 76 : 19331937 Slotkin RK, Freeling M, Lisch D ( 2003) Mu killer causes the heritable inactivation of the Mutator family of transposable elements in Zea mays. Genetics 165 : 781 797 Smith AM, Heisler LE, St. Onge RP, Farias Hesson E, Wallace IM, Bodeau J, Harris AN, Perry KM, Giaever G, Pourmand N, Nislo w C (2010) Highly multiplexed barcode sequencing: an efficient method for parallel analysis of pooled samples. Nuc Acids Res 38 : e142 Smith BG, Harris PJ ( 1999) The polysaccharide composition of Poales cell walls: Poaceae cell walls are not unique. Biochem System E co l 27 : 33 53

PAGE 178

178 Smith LG, Hake S, Sylvester AW (1996) The tangled1 mutation alters cell division orientations throughout maize leaf development without altering leaf shape. Dev elopment 122: 481489 Smith LG, Gerttula SM, Han S, Levy J (2001) TANGLE D1: a microtubule binding protein required for the spatial control of cytokenesis in maize. J Cell Biol 152 : 231 236 Somerville C (2006) Cellulose synthesis in higher plants. Annu Rev Cell Dev Biol 2 2: 5378 Spitzer C, Schellmann S, Sabovljevic A, Shahriar i M, Keshavaiah C, Bechtold N, Herzog M, Mller S, Hanisch FG, Hlskamp M (2006) The Arabidopsis elch mutant reveals functions of an ESCRT component in cytokinesis. Dev elopment 133 : 46794689 Springer NM, Stupar RM (2007) Allelic variation and heterosis i n maize: How do two halves make more than a whole? Genome Res 17 : 264275 Springer NM, Ying K, Fu Y, Ji T, Yeh C T, Jia Y, Wu W, Richmond T, Kitzman J, Rosenbaum H, et al. (2009) Maize inbreds exhibit high levels of copy number variation (CNV) and presence/absence variation (PAV) in genome content. PLoS Genetics ( 10.1371/journal.pgen.1000734) Staehelin LA, Hepler PK (1996) Cytokinesis in higher plants. Cell 84 : 821824 Steppe K, Cnudde V, Girard C, Lemeur R, Cnudde J P, Jacobs P (2004) Use of X ray computed microtomography for noninvasive determination of wood anatomical characteristics. J Struct Biol 148: 11 21 Sticklen MB (2008) Plant genetic engineering for biofuel production: towards affordable cellulosic ethanol. Nat Rev Gen 9: 433 443 Sun JX, Sun XF, Zhao H, Sun RC (2004) Isolation and characterization of cellulose from sugarcane bagasse. Polymer Degradation and Stability 84: 331 339 Suzuki S, Li Laigeng L, Sun Y H, Chiang VL (2006) The cellulose synthase gene superfamily and biochemical functions of x ylem specific cellulose synthaselike genes in Populus trichocarpa. Plant Physiol 142: 12331245 Sylvester AW, Cande WZ, Freeling M (1990) Division and differentiation during normal and liguleless 1 maize leaf development. Development 110: 985 1000 Sylvest er AW (2000) Division decisions and the spatial regulation of cytokinesis. Curr Opin Plant Biol 3 : 58 66 Szymakski DB (2009) Plant cells taking shape: new insights into cytoplasmic control. Curr Opin Plant Biol 12 : 735 744 Szymanski DB, Cosgrove DJ (2009) Dynamic coordination of cytoskeletal and cell wall systems during plant cell morphogenesis. Curr Biol 19 : R800 R811 Takeda T, Furuta Y, Awano T, Mizuno K, Mitsuishi Y, Hayashi T (2002) Supresin and acceleration of cell elongation by integration of xyloglucans in pea stem segments. Proc Nat Acad Sci USA 99 : 905590660

PAGE 179

179 Tamura K Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24 : 15961599 Van Erp H, Walton JD (2009) Regulation of the cellulose synthaselike gene family by light in the maize mesocotyl. Planta 229 : 885 897 Vogel J (2008) Unique aspects of the grass cell wall. Curr Opin Plant Biol 11 : 301 307 Vollbrecht E, Duvick J, Schares JP, Ahern KR, Deewatthanawong P, Xu L, Conrad L J, Kikuchi K, Kubinec TA, Hall BD, et al. (2010) Genomewide distribution of transposed Dissociation elements in maize. Plant Cell 22 : 16671685 Walbot V (2000) Saturation mutagenesis using maize transposons. Curr Opin Plant Biol 3 : 103107 Walker KL, Smit h LG (2002) Investigation of the role of cell cell interactions in division plane determination during maize leaf development through mosaic analysis of the tangled mutation. Development 129: 32193226 Wang X, Cnops G, Vanderhaeghen R, De Block S, Van Mont agu M, Van Lijsebettens M ( 2001) AtCSLD3 a cellulose synthaselike gene important for root hair growth in Arabidopsis. Plant Physi ol 126 : 575 586 Wei F, Coe E, Nelson W, Bharti AK, Engler F, Butler E, Kim HR, Goicoechea LJ, Mingsheng C, Seunghee L, et al. (2007) Physical and genetic structure of the maize genome reflects its complex evolutionary history. PLoS Genetics ( 10.1371/journal.pgen.0030123) Weil CF, Monde R A (2007) Getting the point mutations in maize. Crop Sci 47 : S60 S67 Wessler SR (2001) Plant transposable elements: a hard act to follow. Plant Physiol 125 : 149 151 Willats WGT, McCartney L, Mackie W, Knox PJ (2001) Pectin: cell biology and prospects for functional analysis. Plant Mol Biol 47 : 9 23 Wilson SM, Burton RA, Doblin MS, Stone BA, Newbignin EJ, Fincher GB, Bacic A (2006) Temporal and spatial appearance of wall polysaccharides during cellularization of barley (Hordeum vulgare) endosperm. Planta 224: 655667 Xu J, Scheres B (2005) Cell polarity: ROPing the ends together. Curr Opin Plant B iol 8 : 613618 Yin Y, Huang J, Xu Y (2009) The cellulose synthase superfamily in fully sequenced plants and algae. BMC Plant Biol 9 : 99 Yong W, Link B, OMalley R, Tewari J, Hunter CT, Lu C A, Li X, Bleeker AB, Koch KE, McCann MC, et al. (2005) Genomics of plant cell wall biogenesis. Planta 221: 747751 Yu J, Hu S, Wang J, Wong GK S, Li S, Liu B, Deng Y, Dai L, Zhou Y, Zhang X, et al. (2002) A draft sequence of the rice genome ( Oryza sativa L. ssp. indica ). Science 296 : 79 92

PAGE 180

180 Yu JM, Holland JB, McMullen MD, Buckler ES (2008) Genetic design and statistical power of nested association mapping in maize. Genetics 178: 539 551 Zeng W, Keegstra K (2008) AtCSLD2 is an integral Golgi membrane protein with its N terminus facing the cytosol. Planta 228 : 823 838 Zhang B, Deng L, Qian Q, Xiong G, Zeng D, Li R, Guo L, Li J, Zhou Y (2009) A missense mutation in the transmembrane domain of CESA4 affects protein abundance in the plasma membrane and results in abnormal cell wall biosynthesis in rice. Plant Mol Biol 71 : 509524 Zhong R, Ye ZH (2007) Regulation of cell wall biosynthesis. Curr Opin Plant Biol 10 : 564572 Zhu YM, Nam J, Humara JM, Mysore KS, Lee LY, Cao H, Valentine L, Li J, Kaiser AD, Kopecky AL, et al. (2003) Identification of Arabidopsis rat mutants. Plant Phy siol 132 : 494 505

PAGE 181

181 BIOGRAPHICAL SKETCH Charles (Chip) Hunter grew up in Panama City, F lorida before moving to Gainesville to attend the University of Florida, as both an undergraduate and graduate student. He majored in m icrobiology and cell science and minored in plant molecular and cellular biology in the College of Agriculture and Life Sciences He graduated Cum Laude, and joined the Plant Molecular and Cellular Biology program as a doctoral student in 2004. He was awarded the prestigious American Society of Plant Biology Pioneer Hi Bred International Graduate Student Prize in 2008 for conducting the most agriculturally relevant graduate research in the United States. He has conducted research under the guidance of Dr. Karen Koch in the Department of Horticultural Sciences where his experiments have focused on establishing roles for cell wall biosynthetic enzymes in maize, identifying related maize mutants, and in testing contributions by Mu transposable elements to diversity in maize and its wild ancestor teosinte.