<%BANNER%>

The Role of Calpain, USF, and TFII-I in Beta-Globin Gene Regulation

Permanent Link: http://ufdc.ufl.edu/UFE0042457/00001

Material Information

Title: The Role of Calpain, USF, and TFII-I in Beta-Globin Gene Regulation
Physical Description: 1 online resource (160 p.)
Language: english
Creator: Lin, I-Ju
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: adult, beta, biotinylation, calcium, calpain, calpeptin, cells, differentiation, efficient, entry, erythroid, erythropoiesis, factors, gene, globin, hemoglobinopathies, high, hsp70, in, influx, inhibition, inhibitor, locus, m, mass, mel, nfkappab, pathways, primary, progenitor, proteomics, regulation, signaling, spectrometry, streptavidin, tfii, throughput, topoisomerase, transcription, usf, vivo
Genetics (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Differentiation of erythroid cells is regulated by cell signaling pathways including those that change the intracellular concentration of calcium. Calcium-dependent proteases have been shown previously to process and regulate the activity of specific transcription factors. We show here that the protein levels of upstream stimulatory factor (USF) increased during differentiation of murine erythroleukemia (MEL) cells. USF was subject to cleavage by the Ca2+-dependent protease m-calpain in undifferentiated but not in differentiated MEL cells. Treatment of MEL cells with the synthetic calpain inhibitor calpeptin increased the levels of USF and activated expression of the adult ?- and ?-globin genes. The induction of globin gene expression was associated with an increase in the association of USF and RNA polymerase II (Pol II) with regulatory elements of the ?-globin gene locus. Calpeptin also induced high level ?- and ?-globin gene expression in primary c-Kit- and CD71-positive erythroid progenitor cells. The combined data suggest that inhibition of calpain activity is related to erythroid differentiation-associated increase in globin gene expression. Transcription factor TFII-I which has been shown to repress adult ?-globin gene expression, plays a role in inhibition of calcium entry in the cytoplasm. In this study we discussed how TFII-I might regulate the activity of other transcription factors, e.g. USF, through its function relevant to calcium signaling regulation. Finally we described an efficient and high-throughput methodology utilizing in vivo biotinylation and mass spectrometry for the purification and identification of TFII-I protein complexes. Our results suggest that necross factor-kappaB (NF-?B) or heat shock protein (Hsp) 70 may interact with TFII-I in the cytoplasm presumably mediating erythroid gene regulation.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by I-Ju Lin.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Bungert, Jorg.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-06-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042457:00001

Permanent Link: http://ufdc.ufl.edu/UFE0042457/00001

Material Information

Title: The Role of Calpain, USF, and TFII-I in Beta-Globin Gene Regulation
Physical Description: 1 online resource (160 p.)
Language: english
Creator: Lin, I-Ju
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: adult, beta, biotinylation, calcium, calpain, calpeptin, cells, differentiation, efficient, entry, erythroid, erythropoiesis, factors, gene, globin, hemoglobinopathies, high, hsp70, in, influx, inhibition, inhibitor, locus, m, mass, mel, nfkappab, pathways, primary, progenitor, proteomics, regulation, signaling, spectrometry, streptavidin, tfii, throughput, topoisomerase, transcription, usf, vivo
Genetics (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Differentiation of erythroid cells is regulated by cell signaling pathways including those that change the intracellular concentration of calcium. Calcium-dependent proteases have been shown previously to process and regulate the activity of specific transcription factors. We show here that the protein levels of upstream stimulatory factor (USF) increased during differentiation of murine erythroleukemia (MEL) cells. USF was subject to cleavage by the Ca2+-dependent protease m-calpain in undifferentiated but not in differentiated MEL cells. Treatment of MEL cells with the synthetic calpain inhibitor calpeptin increased the levels of USF and activated expression of the adult ?- and ?-globin genes. The induction of globin gene expression was associated with an increase in the association of USF and RNA polymerase II (Pol II) with regulatory elements of the ?-globin gene locus. Calpeptin also induced high level ?- and ?-globin gene expression in primary c-Kit- and CD71-positive erythroid progenitor cells. The combined data suggest that inhibition of calpain activity is related to erythroid differentiation-associated increase in globin gene expression. Transcription factor TFII-I which has been shown to repress adult ?-globin gene expression, plays a role in inhibition of calcium entry in the cytoplasm. In this study we discussed how TFII-I might regulate the activity of other transcription factors, e.g. USF, through its function relevant to calcium signaling regulation. Finally we described an efficient and high-throughput methodology utilizing in vivo biotinylation and mass spectrometry for the purification and identification of TFII-I protein complexes. Our results suggest that necross factor-kappaB (NF-?B) or heat shock protein (Hsp) 70 may interact with TFII-I in the cytoplasm presumably mediating erythroid gene regulation.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by I-Ju Lin.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Bungert, Jorg.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-06-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0042457:00001


This item has the following downloads:


Full Text

PAGE 1

1 THE ROLD OF CALPAIN, UPSTREAM STIMULATORY FACTOR, AND TRANSCRIPTION FACTOR II I IN GLOBIN GENE REGULATION By I JU LIN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 I Ju Lin

PAGE 3

3 To my parents, my husband, and my children whose strong supports and love have meant everything

PAGE 4

4 ACKNOWLEDGMENTS I would first like to thank my mentor, Dr. Jrg Bungert, for taking me as his graduate student, knowing that I would need to have maternity leave as soon as I joined his lab, and for all his supports throughout my Ph.D years. Dr. Bungert is a very creative scient ist. He always pursues something novel, up to date, and even risky in his research projects. I am grateful for the intense training obtained through five completely different projects he offered during the course of my Ph.D.years, although not all of them worked which really broadened my professional knowledge and extended my experimental expertise I certainly give my utmost gratitude to him for allowing me to be productive not only in the lab but also in my family as a mother of two children. I would al so like to thank my committee members, Drs. Lei Zhou, Linda B l oom and Bryon Petersen, for their precious suggestions and useful advice for my research. Their professional specialties in dif ferent area met many needs in my different projects. I also thank Drs. Suming Huang and Qui as well as their lab members for their helpful discussions on my projects, sharing the experimental experiences, and kindly providing lab resources. In addition, I would like to thank my previous mentors Drs. Frank Y. T. Tun g and Chung Dar Lu. Their training to me during my Master period la id a firm foundation for my Ph. D. research in conducting experiments and developing new protocols. I thank Dr. Henry Baker and his technician for performing microarray experiment and statis tical analysis. I would give special thanks to Steve McClellan for training me in using flow cytometry and confocal microscope as well as his profuse professional knowledge and experimental suggestions. I thank the Interdiciplinary (IDP) program including all the faculty and staff involved for providing such a flexible and interactive learning environment and pre doctoral educational experience that train the students prepared for a wide range of careers in biomedical sciences. I

PAGE 5

5 particularly thank Dr. Way ne T. McCormack, Associate Dean for Graduate Education and IDP Director, for nominating me for the outstanding international student awards in 2008 and 2009. I also thank the International Student Center for giving me this honor. I treasure the memorial time working with my fellow lab members including all the undergraduates, lab technicians and post doctoral scholars. I thank Felicie Andersen and Valerie Crusselle Davis for experimental assistance when I just joined the lab. I thank Zhuo Zhou for her fr iendship and much help for my experiments as well as many fun conversations she shared. I wish her successful accomplishments of all her goals including her research career, green card application and family plan. I thank Shermi Liang for placing orders a nd providing EndNote for the lab. I wish her a wonderful upcoming wedding and happy marriage life. I wish Joeva Barrow all the best with her research and a new addition. I thank my undergraduate students, Kunjal Gandhi, Tihomir Dodev and Dorjan Pantic for their hard work and help with my research. Particularly I would like to give my sincere thankfulness to our new lab technician Blanca Ostmar k who has provided tremendous help for my experiments during the last semester of my Ph. D. I would like to g ive my magnificent gratitude to my husband, my parents and parents in law for all their support and strong encouragement throughout these years. Especially to my parents who came all the way from Taiwan to this foreign country of the United States in the ir old age and poor health. Their staying for one whole year to help me concentrating on my research while I have two children is love immeasurable and indescribable I would also like to thank my two little cuties for providing much distraction and r elaxation from the stress. Finally I would like to thank my heavenly family, the saints in Gainesville, for their love, care, and prayers. Last but not least, I thank my dear Lord Jesus Christ for His wise arrangements

PAGE 6

6 of all the people, matters, and thing s during my Ph. D outwardly and wonderful life supply and enlightenment inwardly to transform and co n form me into His image for His eternal purpose. the power whic h operates in us, to Him be the glory in the church and in Christ Jesus unto all the 21)

PAGE 7

7 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ............... 4 LIST OF TABLES ................................ ................................ ................................ ........................... 9 LIST OF FIGURES ................................ ................................ ................................ ....................... 10 ABSTRACT ................................ ................................ ................................ ................................ ... 12 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .................. 14 Erythropoiesis ................................ ................................ ................................ ......................... 14 Embryonic Erythropoiesis ................................ ................................ ............................... 14 Adult Erythropoiesis and Erythroblastic Island ................................ .............................. 16 Hemoglobin and Related Genetic Diseases ................................ ................................ ............ 18 Introduction t o the Inherited Hemoglobinopathies ................................ .......................... 20 Sickle Cell Anemia ................................ ................................ ................................ .......... 20 thalassaemia ................................ ................................ ................................ ................. 22 Current Treatment and Future Potential Curative Therapy ................................ ............. 24 globin Gene Locus ................................ ................................ ................................ .............. 28 Overview ................................ ................................ ................................ ......................... 28 Locus Control Region (LCR) and Its Potential Function ................................ ................ 29 Tracking model and inte rgenic transcription ................................ ............................ 32 Looping model ................................ ................................ ................................ ......... 33 Adult globin Gene Regulatory Elements ................................ ................................ ..... 34 TFII I ................................ ................................ ................................ ................................ ...... 37 Calpain ................................ ................................ ................................ ................................ .... 40 USF ................................ ................................ ................................ ................................ ......... 44 Summation ................................ ................................ ................................ .............................. 46 2 MATERIALS AND METHODS ................................ ................................ ........................... 52 Construction of Protein Expression Vectors ................................ ................................ ........... 52 pMSCV GFP TFII I and pMSCV GFP TFII I NLS ................................ ..................... 52 N terminal Flag Biotin tagged TFII ................................ ................. 53 N and C terminal Flag Biotin tagged TFII .................... 54 pTRE Bidirectional TetOff Inducible Vectors ................................ ................................ 56 Cell Culture, Transfection, and Primary Erythroid Progenitors Isolation .............................. 57 RNA Extraction, Reverse Transcription, and Real Time PCR ................................ .............. 59 Chromatin Immunoprecipit ................................ .............................. 60 Protein Isolation and Western Blotting ................................ ................................ ................... 61 Benzidine Staining ................................ ................................ ................................ .................. 61 Immunofluorescence and Confocal Microscopy ................................ ................................ .... 62

PAGE 8

8 Microarray Experiments ................................ ................................ ................................ ......... 62 Cytoplasmic and Nuclear Protei n Extraction, Protein Complex Pull Down by Streptavidin Beads and Mass Spectrometry Analysis ................................ ......................... 63 3 CALPEPTIN INCREASES THE ACTIVITY OF UPSTREAM STIMULATORY FACTOR AND ACTIVATE GLOBIN GENE EXPRE SSION IN ERYTHROID CELLS ................................ ................................ ................................ ................................ .... 66 Introduction ................................ ................................ ................................ ............................. 66 Results ................................ ................................ ................................ ................................ ..... 68 Discussio n ................................ ................................ ................................ ............................... 72 4 CHARACTERIZATION OF TFII I LOCALIZATION AND IDENTIFICATION OF TFII I ASSOCIATED PROTEINS IN ERYTHROID CELLS ................................ .............. 84 Introducti on ................................ ................................ ................................ ............................. 84 Results ................................ ................................ ................................ ................................ ..... 87 Discussion ................................ ................................ ................................ ............................... 95 5 CONCLUSIONS AND FUTURE DIRECTIO NS ................................ ............................... 110 globin Gene Regulation ................................ ................ 110 TFII I Mediated Calcium Influx Inhibition ................................ ................................ .......... 111 Efficient Identificati on of Transcription Complexes by In Vivo Biotinylation, Streptavidin Pull Down and Mass Spectrometry ................................ .............................. 112 Summation ................................ ................................ ................................ ............................ 113 APPENDIX: THE EFFECT OF TOPOISOMERASE I INHIBITION BY GLOBIN GENE LOCUS ................................ ............................ 114 LIST OF REFERENCES ................................ ................................ ................................ ............. 137 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ....... 159

PAGE 9

9 LIST OF TABLES Table page 4 1 List of protein s identified by mass stectrometry after co eluted with TFII these proteins were not present in the eluted material from BirA only control cells. ..... 108 A 1 Subfamilies of DNA topoisomerase s (248). ................................ ................................ .... 130 A 2 Primer sequences used in ChIP experiments. ................................ ................................ .. 132

PAGE 10

10 LIST OF FIGURES Figure page 1 1 globin gene loci and their gene expression in the erythropoiesis during development. ................................ ................................ ............. 49 1 2 globin locus. ................................ ............ 50 1 3 globin downstream promoter region between human, mouse, and rabbit ................................ ................................ ................................ ............... 51 3 1 USF is subject to proteolytic cleavage by the calcium sensitive protease m calpain during erythroid differentiation. ................................ ................................ ......................... 76 3 2 gl obin gene expression in differentiated MEL cells exposed to calcium ionophore ................................ ................................ ................................ ........................... 77 3 3 Calpeptin increases the levels of USF but not its mRNA level. ................................ ........ 78 3 4 Calpeptin increases globin gene expression and benzidine positive cells in MEL cells. ................................ ................................ ................................ ................................ ... 79 3 5 er in MEL cells. ................................ ................................ ................................ .......................... 80 3 6 globin gene expression and Pol II interactions with globin promoter and LCR HS2 in K562 cells. ................................ ......................... 81 3 7 Calpeptin increases expression of and maj globin genes in primary c Kit + /CD71 + erythroid progenitor cells.. ................................ ................................ ............. 82 3 8 ChIP analysis of the association of globin gene promoter in MEL cells treated with DMSO or calpeptin. ................................ ................................ ............... 83 4 1 Expression and localization analysis of GFP, GFP TFII I, and GFP TFII I overexpressed in MEL cells. ................................ ................................ .............................. 98 4 2 Real globin transcripts in MEL cells overexpressing GFP, GFP TFII I, or GFP TFII ................................ ................................ .......... 99 4 3 Localization analysis of GFP, GFP TFII I and GFP TFII MEL cells ............ 100 4 4 Real globin transcripts in MEL cells overexpressing GFP, GFP TFII I, and GFP TFII ................................ ................................ ........ 101 4 5 Localization analysis of endogenous TFII microscopy. ................................ ................................ ................................ ...................... 102

PAGE 11

11 4 6 Schematic diagram showing constructs expressing biotin TEV flag tagged TFII I, TFII BirA ................................ ................................ .............................. 103 4 7 Expression of biotinylated flag TEV biotin tagged TFII I and HA tagged BirA in stably trans fected K562 cells ................................ ................................ ........................... 104 4 8 Localization of flag TEV biotin tagged TFII I and TFII BirA in transfected K562 cells ................................ ................................ ................................ ...... 105 4 9 Efficiency of tagged TFII 106 4 10 Coomassie stained gel pictures of streptavidin pull down assay ................................ ..... 107 4 11 Schematic diagram of TetOff advanced inducible system and cloning strategy for co expression of BirA and tagged genes of interests ................................ ............................ 109 A 1 Distinct d globin locus are highly correlated and a re developmentally regulated ........................... 129 A 2 Diagram of DNA contents and cell proportion in different cell cycle stages by flow cytometric analysis ................................ ................................ ................................ ........... 131 A 3 globin locus in synchronized K562 cells. ................................ ................................ ........ 133 A 4 Quantitative PCR results of ChIP assay of RNA polymerase II (Pol II) binding to the globin locus in unsynchronized K562 cells. ................................ ................................ 134 A 5 Quantitative PCR results of ChIP assay of RNA polymerase II (Pol II) binding to the globin locus in synchronized K562 cells. ................................ ................................ ..... 135 A 6 globin gene e xpression in synchronized K562 cells before (no drug) and aft ................................ ............... 136

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Re quirements for the Degree of Doctor of Philosophy THE ROLD OF CALPAIN, UPSTREAM STIMULATORY FACTOR AND T RANSCRIPTION FACTOR II I IN GLOBIN GENE REGULATION By I Ju Lin December 2010 Chair: Jrg Bungert Major: Medical Sciences Genetics Differe ntiation of erythroid cells is regulated by cell signaling pathways including those that change the intracellular concentration of calcium. Calcium dependent proteases have been shown previously to process and regulate the activity of specific transcriptio n factors. We show here that the protein levels of upstream stimulatory factor (USF) increase d during differentiation of murine erythroleukemia (MEL) cells. USF was subject to degradation by the Ca 2+ dependent protease m calpain in undifferentiated but not in differentiated MEL cells. Treatment of MEL cells with the synthetic calpain inhibitor calpeptin increased the levels of USF and activate d globin genes. The induction of globin gene expression was associated wi th an increase in the association of USF and RNA polymerase II (Pol II) with globin gene expression in primary c Kit and CD71 positive erythroid progenitor cells. T he combined data suggest that inhibition of calpain activity is related to erythroid differentiation associated increase in globin gene expression. Transcription factor TFII I which has been shown to repress globin gene expression, plays a role in inhibition of calcium entry in the cytoplasm. In this study we discus sed how TFII I might regulate the activity of othe r transcription factors, e.g. USF, through its function relevant to calcium signaling regulation. Finally we described an

PAGE 13

13 efficient and h igh throughput methodology utilizing in vivo biotinylation and mass s p ectrometry for the purification and identification of TFII I protein complexes. Our results suggest that necross factor kappaB ( NF ) or heat shock protein (Hsp) 70 may interact with TFII I in the cytoplasm presumably mediating erythroid gene regulation.

PAGE 14

14 CHAPTER 1 INTRODUCTION Erythropoiesis E rythropoiesis is a complex and multistep process of cellular proliferation and different iation which begins when a hematopoietic multipotent progenitor undergoes erythroid unilineage commitment and ends with the production of mature erythrocytes (RBCs) which carry oxygen and circulate in the bloodstream for the supply of oxygen and removal of carbon dioxide throughout the body (231, 237) Overall, t his process is part of hematopoiesis by which all the blood cell types, including lymphoid, myeloid, and erythroid cell types, ar e produced and continuously replenished through a self renewing population of stem cells undergoing multiple differentiation steps. As this process proceeds, lineage restricted progenitors are first generated, then morphologically identifiable precursors, and finally the mature blood cells (161) Two waves of hematopoiesis, primitive and definitive, occur during development at distinct sites (237) In human, primitive or embryonic hematopoiesis which is lineage restricted initiates in th e mesoderm derived embryonic yol k sac and produce s en ucleated RBCs primarily expressing embryonic globin genes (167, 194, 237) Definitive (fetal and adult) hematopoisis which is multilineage is first established in the fetal liver and gradually shift s to the bone marrow to generate enucleated RBCs mainly expressing fetal globin and adult globin genes respectively (166, 182) All the hema topoietic sites are characterized by the presence of blood islands, the microenvironment (niche), for the survival, proliferation and differentiation of the erythroblasts (38) Embryonic Erythropoiesis E mbryonic erythropoiesis is transient yet vital in that it occurs within a restricted window a t an early stage of mammalian development for the rapid formation and generation of an

PAGE 15

15 increasing number of red blood cells to support the growth of the embryo and the fetus before the definitive adult system is established (166, 183) It has long been thought that mammalian primitive erythroid progenitors arise and expand in the blood islands of the extra embryonic yolk sac and later circulate in the blood as large, nucleated cells similar to what has been observed in non mammalian vertebrate erythrocytes. In contrast, definitive erythroid cells derived from fetal liver appear in the circulation as small, enucleated cells. The presence of both primitive and definitive erythrocytes at the same time has complicated the analysis of primitive erythropoiesis. More and more recent discoveries show ed that primitive erythrocytes also enucleate upon maturation and may harbor characteristics resembling definitive e rythrocytes during differentiation (81, 167) The group of Margaret H. Baron (81, 115, 1 16) monitored the embryonic erythroid differentiation and enucleation process at an un precedent ed resolution using GFP histon e H2B fusion protein driven by the human embryonic globin gene promoter expressed in transgenic mice. The au thors present ed several previously unrecognized features of primitive erythropoiesis: A) primitive erythroid cells are not transient instead they remain a stable population throughout gestation. B) Three niches for the expansion, differentiation and terminal maturation of primitive erythrocytes are specified. The e mbryonic yolk sac serves as the first nich e for the conver s ion of embryo nic progenitor cells to adopt the hematopoietic fate and allows the expansion and differentiation of the primitive erythroid progenitor cells The circulatory system is the second nich e for the maturation of the yolk sac derived primitive eryth r o id progenitors. During this stage of maturation, primitive erythroblasts accumulate i ncreasing amounts of h emoglobin which is approximately six times the amount of the adult erythrocytes and undergo some recognizable morphological changes, such as los s of nucleo l i, reduction in the size of the cell and nucleus, and changes of cell surface marker s (115, 166) The

PAGE 16

16 more mature primitive nucleated erythroblasts circulate in the bloodstream for a considerable time waiting for the emergence of the third nich e fo r terminal maturation. The third nich e is the fetal liver where more mature erythrocytes expressing high level of 4 1 integrin interact with macrophages expressing VCAM 1 and cause extrusion of nuclei that are then degraded by macrophages. The differen t ce llular compartments of primitive erythropoiesis are similar to and best understood in the context of adult erythropoiesis (166) Adult Erythropoiesis and Erythroblast ic Island In contrast to embryonic erythropoiesis, a dult erythropoiesis maintains a steady s tate red cell mass which is supplied by the differentiation of pluripotent hematopoietic stem cells (HSCs) The HSCs upon stimulation by external signals in the bone marrow differentiate in to m ultipotent stem cells which consist of commo n lymphoid progenitors (CLPs) or common myeloid progenitors (CMPs). The CMPs differentiate into granulocyte/monocyte precursors (GMPs) or into megakaryocyte /erythroid precursors (MEPs). MEPs further differentiate into erythroid lineage committed progenito rs BFU E (blast forming unit erythroid) and then CFU E (colony forming unit erythroid) (237) These progenitors can be assayed by thei r ability to form colonies in semisolid media supplemented with cytokines and can be defined functionally in vitro by their progeny (166, 231) The CFU E cells give ri se to morphologically recognizable erythroid precursors with different stages of maturation The differentiation of erythroid pr e cu r sors at this stage begins from pro normoblast s ( also called pro erythroblasts; normoblasts are commonly called erythroblasts), which give rise to basophilic, subsequently to polychromatic (also polychromatophilic), and eventually to orthochromatic normoblasts. These differentiating erythroblasts undergo a limited number of cell divisions and nuclear condensation, and at the

PAGE 17

17 same time accumulate hemoglobin as their size decrease (166) The nuclei of orthochromatic normoblast s are expelled before these cells differentiate in to reticulocytes which are released from the bone marrow and ci rculate in the blood and mature into bi concave shaped erythrocytes (166, 237, 254) The second stage of erythroid differentiation consists of morphologically identifiable nucleated precursors which transpires in erythroblastic islands in the bone marrow. The erythroblastic islands comprise a central macrophage that reaches a ring of surrounding erythroblasts through its cytoplasmic protrus ion s These functional units first described by Marcel Bessis 50 years ago as a cellular sociologic center for the maturation of red blood cells have been proven to be e sse ntial for the maturation of mammalian erythroblasts that are destined to enucleat e (161) The erythroblastic island s found at all sites of definitive erythropoiesis should not be confused with t he yolk sac blood islands which have been recognized as the first site for blood cell emergenc e during embryonic development. Indeed, there is no erythroblastic islands found in the avian erythropoiesis system in which the mature red blood cells do not enucleate (161) The erythroblastic islands are the microenvironment where many critical factors for the survival, proliferation, and maturation of erythroblasts are integrate d T he cell cell interaction s through cell adhesion molecules, such as erythrobla st macrophage protein s (EMP), integrin s and its counter receptor VCAM 1, which are express ed on erythroblasts and/or ma crophage s are crucial for island int egrity. The structure of the islands not only promotes the interaction of erythroblasts and ma cropha ges but also the interaction between erythroblasts, which are critical for cell differentiation (101) The positive and negative signals generated by c ell interaction s thro ugh adhesion molecules and cell surface receptors which are activated by nutrients, growth

PAGE 18

18 facto rs, and cytokines secreted by ma crophage s are essential regulatory factors for the survival and proliferation of erythroblasts. In addition, ma crophage s m ay play a role in providing iron for hemoglobin synthesis (161) It is evident that the central ma crophage s play an important role i n facilitating nuclei extrusion in erythroblast terminal differentiation by phagocytosis and breakdown of extruded nuclei (2, 120) For example, DNase II null mice showed severe anemia and died in late gest ation. DNase II is responsible for DNA digestion i n the lysosomes of m acrophages after ma crophages engulf apoptotic cells or the expelled nuclei from erythroblasts (262) The mitogen activated protein kin ase (MEK) family member c Jun N terminal kinase (JNK) and p38 have been implicated in this process. MEK kinase 1 (MEKK1) knock down murine embryos showed anemia and defective definitive erythropoiesis with accumulation of nucleated late erythroblasts This phenotype was recapitulated in Mekk1KD Jnk1 / and Mekk1KD jnk2 / m urine embryos (16) Hemoglobin and Related Genetic Disease s Hemoglobin is the metalloprotein synthesi zed by erythrocytes which is responsible for reversible binding of oxygen The protein portion of hemoglobin is a tetramer composed of two type globin chains. Each globin embraces a prosthetic heme group containing an iron atom that binds to one oxygen molecule at a time (193) In the lung, where oxygen pressure is high, each hemoglobin protein can bind oxygen t o its fullest capacity, 4 oxygen molecules. While in the tissues, the oxygen pressure is low and the pH drops, which allow s the release of the oxygen and its availability for cellular aerobic metabolism. Synthesis of hemoglobin in erythrocytes during eryt hropoiesis starts from the proerythroblast stage and ends at the reticulocyte stage (166) The rate of hemoglobin synthesis during definitive erythropoietiesis has been carefully examined in induced anemic newt and other animals (17, 30) The hemoglobin synthesis rate in a single cell was highest in the early

PAGE 19

19 differentiation stage (in basophilic erythrocytes) and significantly declined in the subsequent stages. The proportion of protein s ynthesis committed to hemoglobin production increase s during erythroid cell development due to the degradation and reduced production of non globin proteins in the cells rather than the enhanced synthesis of hemoglobin In addition, there is no t urn over of hemoglobin. Therefore, the over all proportion of hemoglobin in the erythrocytes increase s as the cell s mature Coordinated synthesis of the type globin chains is required for the normal function of hemoglobin. The type globin is derived from the globin gene locus which contains three functional genes, 1, and 2. The type globin is derived from the globin gene locus which contains five functional genes, G A and During different developmental stage s different pairs of globin genes are expressed in erythrocytes (Fig 1 1) In human, during the first six week s post conception, the chain s pair with the chain s and form embryonic hemoglobin (Hb Gower 1, 2 2 ) in the primitive erythrocytes. The other two forms of embryonic hemoglobin, Hb Gower 2 ( 2 2 ) and Hb Portland 1 ( 2 2 ) also exist due to to and to during the 6 th to 7 th week primitive erythropoiesis but these forms are present at low abundance (108, 111, 166, 194) Later in the fetal liver, the chains pair with chains and form fetal hemoglobin (HbF, 2 2 ) in the definitive erythrocytes. At the end of gestation and postna tal, the chain s pair with or and forms adult hemoglobin (HbA2, 2 2 and HbA, 2 2 ) in definitive erythrocytes derived from the bone marrow (252) In normal adult s HbF is restricted to a few red blo od cells called F cells (18) which represent less than 2% of erythroid cells in the adults These normal variants may reflect differences in oxy gen demand during development of the fetus in the womb or during adult stress erythropoiesis (63,

PAGE 20

20 108) For example, HbF facilitates the transfer of oxygen across the placenta due to its higher oxygen binding a ffinity compared to the adult hemoglobin in vivo (1) Introduc tion to the Inherited Hemoglobinopath ies I nherited hemoglobinopathies are caused by genetic defects that result in the production of reduced levels or mutant hemoglobin. Originally the hemoglobinopathies were prevalent in t he tropics and subtropics because of their protective effect against malaria but they now occur worldwide due to migration (172) It is estimated that about 7% of the world populat ion are carrier s for one of the inherited hemoglobin disorders, making them the most common monogenic disease s in the world (252) About 1.1% of couples worldwide are at risk for having children with a he moglobin disorder and the rate of affected newborns is estimated to be 2.55 per 1000. Most affected children who are born in low income countries die before the age of 5 (172) Hem oglobin disorders have therefore become a global public health problem. Hemoglobinopathies can be divided into two groups, structural hemoglobin variants and the thalassaemias, which result from imbalanced and defective synthesis of the globin chains. Ther e is a third class of disorders featured by significant production of HbF continuing into adulthood, called hereditary persistence of fetal hemoglobin (HPFP), which results from deregulation of fetal to adult globin switching (252) This condition usually is asymptomatic. Co inheritance of some forms of HPFH can alleviate the severity of hemoglobin varian t disorders or thalassaemias. Therefore, re activating the fetal hemoglob in in adults has been proposed as a therapeutic strategy for the treatment of hemoglobinopathies Sickle Cell Anemia Over 700 structural hemoglobin variants have been identified and s ickle hemoglobin (HbS) is one of the three that occur at high frequency (252) Homozygosity for the HbS mutation leads to the well know n molecular disease sickle cell anemia while the heterozygotes with t his

PAGE 21

21 characteristic (sickle cell trait) usually are asymptomatic (189) The cause of HbS is a single amino acid substitution of the hydrophilic glutamic acid by the hydrophobic valine at position 6 of the hemoglobin beta chain ( 6 valine ) due to an A to T point mutation (113) In the normal condition where oxygen supply is sufficient, t he red blood cells with HbS exhibit equal oxygen binding thermodynamics compared to that of HbA (8 6) When entering the microcirculation where the oxygen tension decreases, deoxygenated hem oglobin in the red cells change s their structure and start s to adhere momentarily with each other and form s small clusters during their collisions. When the concentration of hemoglobin is high, the chance of cluster formation increases resulting in the generation of long hemoglobin polymers As this process proceeds, the attraction of the mutant hydrophobic 6 valine on the surface of the molecule and a hydrophobic receptor in an adjacent molecule stabilizes the polymer. The same nucleation and polymerization of the new fibers occur repeatedly on the surface of the polymers, which eventually spread through the red cells radially. These fibers m ake the red blood cells become sickling and rigid and thus reduce their ability to deform while transversing the microcirculation and consequently cause vaso occlusion and ischemia. The misshaped red blood cells have a much shorter life span and are rapidly destro yed in the spleen, which results in sever e anemia especia lly when erythropoiesis is impaired (231) Sickle cell anem ia exhibits a wide variety of clinical features including several acute and chronic complications. During the early years of a patient, painful episodes, acute chest syndrome and splenomegaly are the most common symptoms. The growth and development i s delayed in affected adolescents. Sickle cell crisis such as stroke resulting from cerebrovascular damages, acute anemia episodes including acute splenic sequestration, transient erythroid aplasia due to parvovirus B19 infection, hyperhemolysis, and acute chest syndrome sometimes can lead

PAGE 22

22 to death. The adult patients usually suffer chronic tissue and organ damages including bones and joints, such as osteonecrosis, which is painful and often disabling, endocrinopathies, digestive diseases, and gallstones. D ue to the higher standards of supportive care, there are increasing numbers of older adults with sickle cell anemia. The long term chronic organ damage and failure lead s to more complications involving lung, bones as well as the renal and cardiovascular s ystems (231) thalassaemia thalassaemia is caused by defective synthesis of the globin chain due to mutations in the globin locus. Over 200 mutations in the globin locus have been identified in patients with thalassaemia. Except for some large deletions, most of them are point mutations or deletions of one or two bases. These mutations are located either in the regulatory regions or the gene body of the globin gene, which interfere s with gene expression at the transcriptional, translational or post translational level. The defective glob in chain synthesis leads to imbalanced globin production and exc essive globin chains (252) In thalassaemia patients, the excessive, unpaired globin ch ains aggregate and precipitate, forming inclusion bodies first identified by Fessas (76) These inclusion bodies are detectable in nucleated erythroid precursors in the bone marrow and throughout the erythroid maturation pathway. The precipitated globin chains cause alteration of the thalassaemia red cell membrane stru cture by interacting with the cytoskeletal proteins, abnormal red cell metabolism, and consequen tly removal of the red cells from the circulation. As a result, the premature hemolysis of red blood cells in the peripheral circulation and the destruction of the erythroid precursors in the bone marrow appear to be the pathophysiology of thalassaemia (3)

PAGE 23

23 Based on the severity of the clinical manifestations, thalassaemia is classified into three categories: thalassaemia major, i ntermediate, and minor. The most sever e form is thalassaemia major ( (49) ) which is blood transfusion dependent. Patien ts with thalassaemia major are mostly compound heterozygotes of two thalassaemia alleles with different mutations that cause severely defective globin chain production with either no output at all ( 0 ) or with reduced output ( + ) In populations having a high frequency of consanguineous marriages, homozygotes with the same mutation are usually found. The clinical features of this form manifest during the first year of life when HbF level s d ecline. Early symptoms include growth reta rdation, pallor, and anemia, which usually are accompanied by intercurrent infection s It is critical to give adequate blood transfusion at this s tage not only for life extension but also for normal development. Without adequate blood transfusion treatment, further progre ssion of the skeletal deformity due to the expansion of bone marrow in response to anemia and the hepatosplenomegaly result in the typical clinical picture of this condition The other extreme is thalassaemia minor, which is almost symptomless. Whatever conditions between the two fall into the third class, thalassaemia intermediate, which therefore has a very broad spectrum of clinical conditions. One of the useful indication s that distinguish the milder thalassaemia from the sever form is its late on set in the first year of the infant. The patients in this group at the severe end of the spectrum may need blood transfusion but not as frequent as those with thalassaemia major and the future development become s normal after treatment. At the other end of the spectrum, patients remain transfusion free in adult life but may develop complications such as splenomegaly, hepersplenism, painful arthritis, gallstones, leg ulcers and increased tendency of infection s at later times in life (80)

PAGE 24

24 Current Treatment and Future Potential Curative Therapy The current standard treatments for moderate and severe forms of thalassemia are blood transfusion and iron chelation therapy. For sickle cell anemia, there is no widely available cure. Treatment s using blood transfusion s and some medications are for symptom relief and control of complications. Patients with thalassemia major who receive hypertransfusion regimen s have shown significant improvement of their life and activities (195, 258) However, the frequent blood transfusion and the increased absorption rate of iron due to the response to ineffective erythropoiesis cause problems associated with iron overload (82, 200) Iron homeostasis in the body is mainly regulated by the absorption of dietary iron through the intestinal duodenal lumen. After entering into the plasma, iron is bound and transported by transferrin, a macromolecular glycoprotein, which retain s iron from loss in urine via kidney glomerular filtration and deliver s and recycle s iron for use in the cell s In the cell, ferritin is the main ir on sequest er ing protein There is no excretory pathway for iron Iron is lost through the shedding of epithelial cells in the intestinal and urinary tract s as well as during menstruation and intestinal bleeding (230) Excessive iron over the limitation of transferrine and ferritin will accumulate in the plasma and tissues. Non chelated iron reacts with oxygen and water under physiologica l pH leading to the generation of reactive oxygen species and hydroxyl radicals which can attack and damage almost all biomolecules (102, 199) Heart and liver are t he primary organs damaged by iron overload and cardiac failure is the leading cause of mortality in thalassemia major without the treatment of iron chelation therapy (23, 70, 25 7, 270) Parenteral desferrioxamine (DFO) has been used to treat iron overload for decades DFO is a powerful chelator which leads to the

PAGE 25

25 excretion of iron from urine and stools. However, the daily overnight subcut aneous infusions and the high cost of the approach greatly limit s its clinical benefit (67) In light of the fact that thalassemia patients with elevated HbF levels have prominent ly improved clinical manifestations globin re activation has been the focus of research in search for a globinopathies since the first observation was made (66) The pharmacological reagents 5 azacytidine and hydroxyurea have been extensiv e l y tested for the treatment of hemoglobinopathies 5 azacytidi ne is a nucleoside analog. W hen it incorporate s into DNA, the nitrogen in the 5 th position of the pyrimiding ring re sists methylation and inactivates DNA methyltransferase, which results in DNA hypomethylation Hypomethylation of CpG islan ds and some promoters have been shown to activate gene expression (75, 223) P thalassemia treated with 5 azacytidine showed increased HbF in sickle cell anemia and more effective erythropoiesis thalassemia (140 142) Increased HbF synthesis wa s accompanied by hypomethylation of total genomic DNA and of the globin gene s (37, 140) However, 5 azacytidine is toxic and carcinogenic and has been restricted to end thalassemia patients. H ydroxyurea a drug given orally is readily being absorbed and increases HbF resulting in greatl y reduce d morbidity in adults with sickle cell anemia (196) The primary effect of hydroxyure a is due to it s cytotoxicity in blocki ng DNA synthesis by inhibiting ri bonucleotide reductase in rapidly divi di ng cells which shift s the kinetic s of erythroid cell differentiation in favor o f HbF synthesizing progenitors (133, 185, 196) There is evidence that 5 azacytidine may also act by the same mechanism (185, 235) Howe ver, the effect of hydroxyurea is transient and not all patients respond to it. In addition, s ome patients may not tolerate the continual myelosuppressive

PAGE 26

26 dose of hydroxyurea. Therefore, alternative reagents, such as erythropoietin and butyrate that ai m to elevate HbF are under investigation (15, 73) To date, allogeneic bone marrow transplantation is the only available curative therapy for the blood disease s However, iden tical human leucocyte antigen matched bone marrow donors are hard to find and t ransplantation related and r ejection mortality is still high after the treatment (9, 83, 156) An a lternative therapeutic strategy that holds the promise of permanent cure for hemoglobinopathies is gene therapy It utilizes a vehicle, e.g. a virus, to deliver a th erapeutic genetic element, such as the globin gene, into autologous hemotopoietic stem cells that will reconstitute the bone marrow of the patient and generate the normal red cells after being introduced back to the patient s Using autologous stem cells will solve the graft versus host complications. There are several levels of technical barriers that need to be overcome in order for this strategy to be successful. The priority is the efficient transfer and adequate expression of the genetic material in the cells Viral vectors have been investigated intensively for this purpose since viruses are able to transfer and express their genetic information in eukaryotic cells in nature The earlier trials of genetically modified autologous hematopoietic stem cell transplantation using retrovir al vectors for immunodeficiency diseases yielded unsatisfactory success due to insertional oncogenesis (191) Furthermore, globin disorders, espec ially thal assemia major, a great pr oportion of corrected HSCs for successful bone marrow repopulation and erythroid specific transgenes that produce sufficient amount of the therapeutic protein over a sustainab le time in each stem cell are requ ired in order to have a therapeutic effect (192) Incorporation of a large upstream regulatory element for globin gene expression in the retroviral vectors was problematic due to instability of the vectors and

PAGE 27

27 frequent genomic rearrangements (152) In 2000, May et al. first demonstrated that gene transfer using lentiviral vector s could achieve therapeutic level s of gene thalassemia intermediate (165) L entiviral vector s appear to be the best candidate s for gene transfer due to their ability to transduce quiescent cells and to penetrate the nuclear membrane (139) Additionally, the l entiviral globin regulatory and coding sequences with no rearran gements could be produced with a high titer (191) Since then, multiple reports using globin lentiviral vector s for the treatment of globinopathies in murine and cell culture systems have emerged (134, 190, 198, 204) Although high level expression and transduction rate can be obtained, the expression of the transgene is still va riable due to position eff ects. In a recent clinical trial tharassemia, using severe pre transplantation conditioning, autologous HSCs transduced with self inactivating lentiviral vector encoding an anti globin gene with chromatin insulators succes sfully rec onstituted the Intriguingly, there is a dominant clone that constitutes ~ 50 % of vector bearing long term culture initiating cells with the vector insertional site i n the intron of HMGA2 gene. The expression of HMGA2 may favor the expansion of myeloid progenitors and promote the therapeutic effects, although elevated level of a trunc ated form of HMGA2 protein has been associated with some benign tumors (31, 191) tha l assemia clinical trial is encouraging b ut the risk of insertional oncogenesis and the toxicity of efficacious conditioning regimens r emain a safety concern. Future progress can be made by be tter vector design including regulatory elements that will drive su sta in able therapeutic level s of expression of the globin genes in specific tissue s but lack i ng strong viral promoter s that could over activate adjacent gene s A dditionally vector s

PAGE 28

28 which po ssess high transmitting capacity i n human HSCs are required The presence of a high proportion of vector carrying HSCs is exp ected to ease the bone marrow repopulation process so that a mild er host conditioning regimen could be used (152) globin Gene Locus Overview The h uman globin gene locus is lo cated on the short arm of chromosome 11 (11p15.15) and is flanked by olfactory receptor gene (ORG) clusters that are inactive in erythroid cells The locus comprises a far upstream regulatory element, locus control region (LCR), and five G one type genes arranged in the order of their expression globin genes is tissue specific and developmentally regula globin gene is expressed highly in the embryonic yolk sac before the first six weeks of conception, gradually suppressed between 6 8 week s and fully repressed after 8 week s (194) The globin gene is activated conversely in a balance d fashion from the 6 th to 8 th week and fully activated in the fetal liver after the completion of embryogenesis. From the fetal to perinatal period, there is gradual de repression of the globin gene and shifting of the site of erythropoiesis from the liver to the bone marrow (252) Shortly after birth, the globin gene is gradually silence d and the globin gene s are expressed in bone marrow The mouse globin gene locus is located on chromosome 7 T he overall gene organization is similar to the human locus (Figure 1 2) It also contains an upstream regulatory element preceding the four h1 maj min human locus the order of the genes does not completely reflect the expression timing during development. The embryonic h1 is the first gen e expressed in the embryonic yol k sac and as the

PAGE 29

29 erythroblasts mature in the bloodstream, the second embryonic gene is expressed and h1 is silenced gradually toward terminal differentiation (123) Moreover, i nstead of two switching events as happens in other non primate s mouse globin genes only undergo one switching from primitive embryonic genes to definitive adult genes. The adult m aj and min are expressed in fetal liver and bone marrow. Locus Control Region (LCR) and Its Potential Function Lineage specific, high level expression of each type globin gene during development is regulated by the LCR and by gene proximal cis elem ents. The LCR was discovered by assessing the status of the chromatin of the human globin locus using DNase I sensitivity assays initially developed by Weintraub and Groudine (253) In the early 1980s, Tuan et al. (239) and (80) found that a series of DNase I hypersensitive sites (HSs) are located far upstream of the glob in gene. Subsequent studies demostrated that this upstream region containing the DNase I HSs is involved in the activation of the globin gene locus (229) The naturally occurring Hispanic thalassemia identifi ed in 1989 provides further evidence that the presence of this upstream region is an important regulatory element for the expression of the downstream globin genes. In the deleted form of ( ) 0 thalasemia patient, the whole globin locus is intact exce pt for a 35kb fragment which is missing This 35kb fragment is located 60 kb upstream of the adult globin gene and includes the LCR HS sites The entire locus in cis to the mutation is in a closed chromatin conformation and the globin gene s a re inactive (64) Since the discovery of the LCR, the components and function of this region has been intensively studied in transfected cell line s transgenic mice, and hybrid cell line systems. The LCR in the human globin locus is composed of 5 DNase I hypersensitive sites (HS1 HS5) located about 6 to 22 kb upstream of the globin gene. Each HS site comprises a core region of

PAGE 30

30 200 400 bp and the HS sites are separated from each other by several kbs of flanking sequences (48, 96, 155) Unlike the gene proximal DNase I HSs located adjacent to transcriptionally active type globin globin gene) are developmentally stable, e.g. present in embryonic, fetal, and adult stages (80 239) The LCR HSs contain multiple cis regularoty elements that bind ubiquitous and erythroid specific transcription factors, including GATA motifs E box e s MARE (Maf recognition elements) and CACCC motifs (105, 181) Among the se elements GATA motifs and MARE are found in all 5 HSs. LCR HS1 to HS4 are erythroid specific while HS5 can be found in multiple lineages (145) HS2 function s as a classical enhancer ; in other words it enhances expression of a linked gene in transient t ransfected cell lines It appears that the enhancer function of HS2 is more specific for the embryonic and adult beta globin gene (240) However, the enhancer function of HS3 and HS4 can only be detected when integrated into chromatin, which implies that their enhancer activity is involved in chromatin conformation alteration s (105) HS 5 function s as a chromatin insulator (74, 144, 146) The function of HS1 is unclear. The most prominent property of the LCR is its ability to confer high level expression of linked gene s in a position independent and copy number dependent manner in transgenic assays In transgenic mice containing the human type globin gene s alone, expression can only be detected in a low percentage of mice carrying the transgene and the gene ex pression level is significantly lower than that of the endogenous mouse type globin gene, although the tissue and developmental stage specific expression pattern is correctly regulated (32, 125, 159, 236) However, when the entire LCR including HSs 1 5 is linked to the human globin gene, almost all the transgenic mice express the globin gene and the expression level is comparable to that of the endogenous mouse globin gene (97) These observations suggest that the LCR harbors

PAGE 31

31 strong enhancer and chromatin opening activity. It is important to n ote that only the entire LCR has such a function; in the cases where any HS is deleted, the expression of the linked gene appears to be integration site dependent (170, 212) In addition to the transgenic m ouse experiments, the entire human globin locus of the Hispanic thalassemia patient s is in a closed chromatin state which further supports the notion that the LCR is responsible for the open chromatin envi ronment of the downstream globin locus. However, when the endogenous mouse globin LCR is deleted by homologous recombination, the general DNase I hypersensitivity is not altered in the mouse globin locus. In contrast to what is found in m ice experim ents using the human lymphocyte/MEL (murine erythroleukemia cells which are definitive virus transformed erythroid cells arrested at the proerythroblast stage (163) and can be induced to express high level s of adult globin gene s ) hybrid cells containing human chromosome 11 from either the Hispanic thalassemia patients or from normal individuals demonstrated that the LCR is required for the formation of accessible chromatin over the entire globin gene locus (79) The contradictory results of these two experiments can be explained by the possibility that the LCR functions somewhat differently in human versus mouse. The enhancer function of the LCR is erythroid specific. How the L CR is formed during hematopoiesis and how it is active only in the erytroid lineage are interesting questions that need to be further addressed. It has been shown that the activity of the LCR can be detected in murine hematopoietic progenitor cells (118) As the hemtopoiesis progresses, the erythroid lineages re tain all the HSs while the nonerythroid lineages gradually lose the HSs of the LCR.

PAGE 32

32 Tracking model and intergenic transcription Although the high level expression of the globin gene is undoubtedly mediated by the globin gene expression is still unclear. Since the core and flanking reg ion s of the HSs of the LCR c ontain multiple binding sties for ubiquitously expressed and erythroid specific transcription factors, and many experiments show that the LCR HS sites work additively or synergistically to activate globin gene expression (24, 136, 173) it was proposed that the LCR forms a holocomplex which recruits transcription complexes that are subsequently delivered to the globin genes. The way of delivery has been proposed by several models, such as tracking, looping, facilitated tracking, and linking models (56, 143) The tracking model proposes that RNA polymerase II (Pol II) or histone modifiers, launch from the enhancer and scan along the DNA toward a promoter. The looping model requires the physical contact of enhancer and promoter bound proteins with the intervening DNA looped out. A compromise between these tw o models is the facilitated tracking model, in which the enhancer bound activators tracks along the chromatin without dissociating from the enhancer until reaching a promoter and then a stable DNA loop structure is formed. The l inking model proposes that s pecific transcription factors that bind along the locus and condense the chromatin between the LCR and the genes thus reducing the distance and allowing transcription activation. The four models are not mutually exclusive and may all operate together durin g activation of globin gene transcription Among them, the tracking and looping model s are the two that attract the most attentions. The tracking mo del is supported by the existence of intergenic transcription throughout the globin locus. It has been sh own that RNA polymerase II (Pol II) is recruited to specific HS site s in the LCR (129, 238) and initiates intergenic transcription. Intergenic transcription initiated

PAGE 33

33 globin locus has been found. This intergenic transcription is unidirectional proceeding toward the globin genes and its products are polyadenylated, spliced, but nuclear restricted, which is distinct from other transcripts (7, 151) The long range enhancer function is significantly impaired by a transcriptional blocker inserted between HS2 and a di stant cis linked promoter, providing support for the enhancer initiated transcription as one of the means for the transcription enhancing function over a long distance (150) It is possible that RNA polymerase II ( Pol II ) recruited to the LCR, scans through the globin genes and at the same time alters the chromatin structure to render it more accessible. This is a plausible model since Pol I I is known to associate with chromatin remodeling activities (43, 256) Another possibility is that the pre initiation complex (PIC) situated at the promoter region ma y require the transfer of specific activators from the LCR to be activated (tracking or facilitated tracking model) (151) This hypothesis has been supported by a recent report showing that the LCR functions mainly by enhancing transcription elongation of promoter stalled RNA polymerases (214) Recent findings of intergenic transcription patterns and epigenetic profiles that change correspondingly during development pro vide additional evidence for the operation of tracking mechanism s in the locus (93) (See Hemoglobin Switching and Chomatin Subdomains in Appendix A). Looping model It is believed that the HS sites interact with each other by protein/DNA and protein/protein interactions to generate an LCR holocomplex (24, 255) Experiments using a novel technique, chromosome conformation capture (3C), by which the chromatin conformation c an be revealed at the molecular level in vivo demonstrated that the LCR HS sites and the

PAGE 34

34 proximity forming a so called chromatin hub (CH) in erythroid cells. Interactions of globin ge nes with the chromatin hub lead to the formation of the active chromatin hub (ACH) and the transcription of genes (28, 55, 233) These results provide strong evidence for a looping model but the formation of a loop may involve a facilitated tracking process. Also, the LCR may regu l a te the nuclear positioning of genes to compartments where most of the hyperphosphorylated, elongating form of Pol II is enriched, domains known as transcription factories (33) Recent experiments have shown that several genes located on chromosome 7 and expressed in mouse erythroid cells are transcribed in close proximity to the sites globin gene transcription. These genes may share the same transcription factories in specific nuclear region s Adult globin Gene Regulatory Elements The regulatory elements in the human adult globin gene can be divided into three regions : The upstream promoter region, the region around and immediately downstream of the transcription start site (TSS) (57) The upstream promoter region includes binding sites for erythroid specific GATA 1 (initially named NF E1, nuclear fac tor erythroid 1, or GF 1) at 200 and 120 relative to the transcription start site (+1), binding site s for non erythroid specific protein s resembling the CCAAT motif at 150 and a minimal promoter region (4, 57, 205) The minimal promoter consists of the proximal CACCC box at 90 (4, 57) a CCAAT box at 70 and a non canonical TATA box (CATAAA) at 25 to 30 (60, 98) The TATA box recruits the transcription pre initiation complex (PIC) and determines the specific transcription initiation site at about 30 nucleotides downstream from the TATA box (98) Promoters lacking a TATA box but containing upstream regulatory elements produce heterogeneous RNAs with distin ct (12, 94, 95, 98) Several proteins such as GATA 1, NF Y (CBF, CP1), and members of the C/EBP

PAGE 35

35 family have been reported to bind to the CAAT box and p ositive ly regulate globin transcription in MEL but not in K562 (a human erythroleukemia cell line expressing the embryonic and fetal but no the adult globin genes) cells (58, 245) The CACCC box is recognized by Sp1 (106) and the erythroid Kr pple like factor (EKLF) which plays a role in to globin gene switching (62, 131) The upstream region preceding the minimal promoter has been shown to be required for transcription induci bility in reporter systems (57) Using the same assay, experiment s linking an LCR microlocus cassette (containing partial HSs) with the globin promoter that only the minimal promoter is required for the full level and regulated expression of the gene. Therefore the 200/ 120 and 150 region s containing the GATA 1 and NF Y binding site s can be fully replaced by the LCR under these rather artificial conditions (5) The second region contains a pyrimidine rich initiator (Inr) element which surrounds the transcription start site, an initiator overlapping an E box (Inr/E box), a +20 E box, which was imm ediately followed by a Maf recognition element ( MARE ) / activator protein 1( AP 1 ) like element, and a E box 60 bp downstream of the TSS (Figure 2) (130, 138) In a ddition to the TATA box, the Inr is another core promoter that by itself can nucleate preinitiation complex PIC formation by binding to components of the TFIID complex ( 34) Many experiments have shown that the Inr can direct accurate transcription initiation in the absence of the TATA box both in vitro and in vivo (117, 168, 227) However, when both elements are present, the TATA box is the stronger selector of the TSS (178, 263) Often the Inr is found 25 30 nucleotides downstream of the TATA box where these two elements stimulate transcription synergistically (227) and is generally associated with abundantly expressed genes (226) By using mutagenesis assay s, the Inr of the human globin promoter was characteri zed in detail and possesses all the

PAGE 36

36 characteristics stated (138) Several transcription factors, such as YY1 (219) TFII I and USF (211) have been shown to interact with the Inr. Two of the three E box es the Inr/E box and + 60 E box, are conserved among human, mouse and rabbit exhibiting the consensus sequence CANNTG. P revious studies from our laboratory demonstrate d that USF and TFII I interact with the Inr/E box mainly in human embryonic erythrol eukemia K562 cells and repr ess globin expression while USF1 and USF2 interact with the +60 E box in murine adult erythroleukemia MEL cells and activate globin expression (51, 130) Mutation of either site considerably reduces globin transcription in vitro (130) Mutation s of sequences between these two sites including the non conserv ed E box at +20 a nd the MARE/AP 1 site do not affect transcription. The data further suggest that the erythroid specific nuclear factor NF E2 interacts with the MARE/AP1 like element (119) NF E2 cooperates with USF to recruit Pol II to the globin gene promoter and activate s high level gene expression in induced MEL cells (268) Two human elements have been identified. One is located 550 800 bp downstream of the poly nhancer) and the other is located in exon 3 (11, 99) specific ex pression at low level s individually but at high level s in combination i n transgenic mice containing a re porter construct (11) Experiments using deletion mutants in transf ected erythroid cell lines show flanking enhancer is required for inducible expression during red cell maturation (4, 45) When m promoter ( 200 to flanking enhancer, some common protein binding sequences are present in these two regions (4, 57) One protein that binds to both the stream promoter and four regions of the flan k ing enhancer has been identified as GATA 1 (244) GATA 1 is an important transcription factor for the

PAGE 37

37 development of erythroid cells. GATA motif s (T/A)GATA(A/G)) are found virtually in the promoter of all erythroid exp ressed genes and are present in all of the LCR HS sites (180) TFII I TFII I was or iginally identified as a transcription factor capable of mediating transcription of a TATA less but initia tor (Inr) containing promoter through interacting with the Inr (211) Subsequent cloning and sequencing of its cDNA revealed that it is a relative ly large transcription f actor with ~110kDa. It has six direct reiterated I repeats (R1 to R6), each containing a helix loop helix ( HLH ) motif. The N termius of TFII I contains a leucine zipper (LZ) and a nuclear localization domain (NLS), which is followed by a basic region (b) p rec eding R2 The analysis of the structure and function of TFII I revealed that the first N terminal 90 amino acids containing the LZ and the basic region are important for protein protein inter action s The HLH domain also provide s contact surfaces for protein interaction s DNA binding may be mainly mediated by the basic region and the LZ is important for homo or heteromeric protein interaction s required for DNA binding (41) TFII I is expressed from a gene locus located on human chromosome 7. H aploinsufficiency associated with this genomic region causes Willia ms Beuron syndrome (WBS), a disease affecting development of the neuronal system (207, 208) Recently, the Roy and Bayarsaihan laboratories generated mice with target ed deletions of TFII I (Gtf2i) and the re lated Gtf2ird genes in mice (71) Both homozygous mutants are embryonic lethal and reveal similar defects that are consistent with thei r roles in WBS but also point to important functions of these proteins in non neuronal tissues. TFII I has different isoforms generated by alternative splicing of its gene (40) The delta isoform is the best characterized isoform of TFII I, containing 957 aa. The alpha isoform contains an additional 20 amino acids, which is encoded by exon A located between R1 and the NLS. The beta isoform contains an additional

PAGE 38

38 21 amino acids encoded by exon B, also located between R1 and NLS. The gamma isoform expresses both exons A and B. The beta isoform appears to be expressed at higher levels in murine cells compared to human cells, while the alpha isoform is non existent in murine cel ls. The gamma isoform is expressed at high levels in neuronal cells. These isoforms can form homodimers or heterodimers, which leads to their preferential nuclear localization. In addition, the NLS deleted mutant of TFII m; however, when co expressed with other isoform, this mutant is localized in the nucleus (40) Each isoform has been demonstrated to have unique activities with regards to gene regulation (104) In serum starved cells, the beta isoform was shown to associate with the c fos promoter. It may help to keep the promoter accessible but in an inactive state. After serum sti mulation, the delta isoform is tyrosine phosphorylated, enters the nucleus, and replaces the beta isoform at the c fos promoter to activate transcription. Many studies have implicated TFII I in the positive regulation of gene expression. For example, TFII I has been shown to interact with USF and to associ ate with either E box elements or with initiator to activate gene transcription (65, 211) In addition to interactin g with the initiator and gene proximal E box elements, TFII I also interacts with distal regulatory elements and cooperates with other transcription factors to modulate gene activity (207) For example, TFII I associates with the pr oteins SRF (serum response factor) and Phox1 at the serum response element (SRE) on the c fos promoter to activate the expression of c fos in response to serum stimulation (122) Also, TFII I binds to the endo plasmic reticulum stress response element (ERSE) and activates ERSE containing genes encoding for glucose regulated proteins (GRPs), which function as chaperones in the unfolded protein response (187) However, there are a number of genes that are transcriptionally suppressed by TFII I. For example, Roy and

PAGE 39

39 colleagues recently demonstrated that TFII I inhibits expression of genes that are essential for osteogenesis (128) Also, TFII I represses the transcription of the vascular endothelial growth factor ( VEGF) gene in en dothelial cells and of the glo bin gene in erythroid cells by binding to the initiator of these genes (51, 160) TFII I interacts with c Myc a t initiator elements, however, in contrast to the USF/TFII I containing complexes mentioned before, the TFII I/Myc complex inhibits transcription complex formation in vitro (209) The inhibitory effect of TFII I on tra nscription is mediated in part by its ability to recruit co repressor complexes, including histone deacetylase 3 (HDAC3) (51, 241) histone H3K4 specific demethylase L SD1 (103) and components of the polycomb repressor complex (52) The activity of TFII I is regulated by signal transduction pathways (208) TFII I is phosphorylated at tyrosine residues, which regulate s its ability to relocate to the nucleus and interact with specific proteins (177) Among the kinases that have been shown to phosphorylate TFII I and to regulate its activity are (Btk) (261) which phosphorylates TFII I in response to B cell receptor activation, and src kinases (39) which phosphorylate TFII I in response to growth factor signaling. Src mediated phosphorylation of TFII I facilitates nuclear localization and thus gene regulation It has been shown that TFII I not only acts as a transcription factor in the nucleus but also involves in signal transduction regulation by inhibiting calcium influx in the cytoplasm (27) In agonist induced calcium entry phospholipase C gamma (PLC ) interacts with transient receptor potential channel 3 (TRPC3) which stimulates its cell surface expression and allow calcium influx. The interaction is mediated by the binding of a PH domain in PLC like half domain in TRPC3. Btk mediated phosph orylation of TFII I allows TFII I to interact with PLC in the cytoplasm through its PH

PAGE 40

40 like domain in the R2 region This interaction prevents the association of PLC transient recep tor potential channel 3 (TRPC3) and thereby inhibit calcium e ntry. C alpain The c alpain family is a group of heterogenous calcium dependent cysteine protease s with a pH optimum of 7.2 8.2. The three best characteri ze d members in the calpain system are calpain, m calpain and calpastatin whose only known function i s to inhibit the two calpains (89) The activity of m calpain requires different calcium concentration s which is millimolar and micromolar in vitro respectively. cDNAs of the two calpains for different species have been cloned and sequenced Their amino acid sequences from vertebrate species are highly conserved Both m calpain are heterodimers composed of an identical 28 kDa subunit and an 80 kDa subunit t hat shares 55 65% sequence homology between the two proteases within a given species (89) The small 28 kDa subunit is encoded by a single gene on chromosome 19 in humans (179) and m calpain are on chromosomes 11 and 1in the human, respectively. T here are no known isoforms derived from alternative splicing during transcription of the calpain genes Proteolytically active m calpain has been succes sfully expressed in E. coli and baculovirus expression system s (92, 164) Calpains are ubiquitous proteins found in all vertebrate cells that have been examined; howev er, the ratio and m calpain and calpastatin varies drastically in different cell types (89) The embryonic lethal phenotype of the 28 kDa subunit knock out mice shows that the c alpain systems are essential for life; deletion of one of the ubiquitous calpain s calpain, does not cause embryonic lethal ity but a severe defect in platelet function (6, 8) Calpastatin is the only known protein inhibit or specific for the and m calpain Calpastatin does not inhibit any other proteases including the cysteine proteases, papain, and cathepsin B in addition to proteases from other class es such as trypsin, c hymotrypsin, and

PAGE 41

41 pepsin. Calpastatin is encoded from a single gene on chromosome 5 in humans. There have been at least eight different calpasta tin isoforms identified which are generated through alternative splicing mechanisms or t he use of different prom oters The physiological significance for the existence of so many different isoforms of calpastatin is un known (89) The crystallographic structure of the entire m calpa in molecule in the absence of Ca 2+ has been re solved. The structure of m calpain can be divided into six domains (I VI) with the first four domains on the 80 kDa subunit and the fifth and sixth domains on the 28 kDa small subunit (89) Domain II contains the Cys, His, and Asn residues that form a catalytic triad characteristic of cystein proteases but shares little sequence homology with the other cysteine proteases. Amino acid sequence s of domain II are highly homologous among different species. Domain III may be associated with phospholipid and interact s with cell membranes. Domain s IV and VI contain five EF hand Ca 2+ binding sequences with the fifth involved in the dimer ization of the 80 and 28 kDa subunit s; however, not all the EF hand motif s bind Ca 2+ in the calpain molecule and their binding affinities for Ca 2+ are different The conformation of EF hand sequence s at the domain II/III boundary in the crystallographic st ructure of rat or human reveal that m calpain does not seem to bind Ca 2+ (89) However, the EF hand motif in the domain II/III boundary in calpain isolated from a blood f luke did bind Ca 2+ (222) Calpains autolyze rapidly in the presence of Ca 2+ therefore it is very difficult to determine the amount and affinity of their Ca 2+ binding abili ty. It has been known that the Ca 2+ concentration requirement for proteolytic and other activities of the calpains were much higher than the 50 300 nM Ca 2+ concentration in living cells (162) Many studies have focus ed on finding the mechanism for reducing the Ca 2+ requirement for the activity of the calpains It ha s been shown that phospholipids, such as phosphatidylinositol (PI) and phosphatidylinositol 4, 5

PAGE 42

42 bisphosphate (PIP 2 ) lower the Ca 2+ concentration req uired for autolysis of m calpain by three to eigh tfold, which requires very high ra t ios of PI or PIP 2 per calpain in in vitro assay s It is possible that calpain s associate with phospholipid close to the calcium channel that spikes high Ca 2+ concentration shortly and locally and thereby activate calpains (89) Some proteins that serve as activator s to lower the requirement of Ca 2+ concentration for calpain activity have been reported. For example, a 40 kDa protein isolated from erythrocytes reduced the Ca 2+ concentration required for half and m calpain (213) It is possible that the local spikes of high level of Ca 2+ but transiently It has been shown that m calpain associates with subcellular organelles including the nuclear fraction (90) Immunolocalization stud ies and western blot ting experiments s how that low levels of m calpain are detected in the nuclear membrane and nucleoplasm (175) Despite of all these discoveries, 2+ in vivo is still a myst e ry. O ver 100 proteins have been reported to be cleaved by calpains in in vitro assays. Many of the m fall into the four categories: 1) cytoskeletal proteins, especially those involved in cytroskeletal/plasma membrane interactions; 2) kinases and phosphatases; 3) membrane associated p roteins, including some receptor s and ion channel proteins; and 4) transcription factors (89) However, these in vitro in vivo substrates because of physiological reasons, such as the locali zation of calpains, which is exclusively intracellular, the presence of adequate Ca 2+ concentration s and the presence of inhibitors. The function of the calpain system ha s been implicated in a variety of area s including proteolytic processing of molecule s in signal transduction pathway s, cleavage of cytoskeletal attachment to the plasma membrane during cell fusion and mobility, cell cycle progression control, gene expression regulation, substrate degradation in apoptotic pathway s and long term potentiation.

PAGE 43

43 C alpain s cleave proteins at a limited number of sites and the cleavage sites do not depend on the amino acid sequences but mostly on the structure, leaving large, oft en catalytically active frag ments. This indicate s that calpains have a regulatory or signaling function in cells rather than a digestive function as the lysosoma l proteases or the proteasome Although the ra t io calpain and m calpain varies widely in different cells, the high similarity of the substrate specificities between the two calpains suggest that they can perform identical physiological functions but respond to different cellular signals (89) The human erythrocytes ha ve calpain while platelets and m calpain. Mitsushi Inomata et al. (114) in 1993 di scovered that human erythr ocytes also co ntain m calpain but the amount of m calpain is much lower than calpain. Since intracellular calcium concentration play s a role in erythroid differentiation (21, 217) it would be interesting to investigate the function of the calpain system during differentiation of erythrocytes Fujiko Watt and Peter L. Molloy (251) demonstrate d that the upstream stimulatory factor, USF, is an in vitro substrate of m calpain The SDS PAGE gel analysis of truncated bacterially expre ssed USF shows that m calpain generate s multiple intermediates including three major peptides with molecular weight 18.5, 16.5, and 14.5 kDa and the 18.5 and 16.5 kDa fragments contain DNA binding activity which corresponds to the C terminus of USF In vitro transcription stu dies of the truncated USF using reporter system s with o r without USF binding site s show that the m calpain cleaved products, which can still bind to the USF binding sites have a dominant negative effect on transcription (251) T he authors further determine d that m calpain cleaves a number of transcription factors including Sp 1, Pit 1, ATF, CP1, Oct 1, in vitro translated c Fos/c Jun comple x (AP 1), AP 2 and 3, and c Myc. All the factors examined except SP 1 are subject to calpain mediate d cleavage which generates

PAGE 44

44 truncated products contain ing DNA bind ing activity These experiments suggest that m calpain may be involved in the turn over of transcription factors and the DNA binding active products may further regulate transcription in different way s USF The upstream stimula tory factors, USF1 and USF2 a re ubiquitously expressed proteins belong ing to the basic helix loop helix leucine zipper transcription factor family (50) USF1 is encoded from chromosome 1 and exhibits a molecula r weight of 43 KDa whereas USF 2 is encoded from chromosome 19 and is 44 KDa in human. These proteins usually interact with DNA as heterodimers but also form homodimers. The dimerization and DNA binding activity are mediated by the highly homologous C term inal domain of the proteins comprising of a DNA binding basic region followed by helix loop helix (HLH) and leucine zipper (LZ) motifs. An additional highly conserved domain is located right upstream of the basic region and is called USF specific region (USR). The N te r minus of USF1 and UFS2 is divergent and includes transcription activating activity. T he presence and abundance of heterodimers or of specific homodimers varies in different cell types and at the various stages of cellular differenti ation (225) This suggests that the different dimeric forms of USF could exert unique functions with respect to regulating gene expression possibly by interacting with dif ferent proteins via their N termial domains However, mice deficient for either USF1 or USF2 are viable, whereas the combined deficiency leads to early embryonic death (224) This demonstrates that homodimers are able to replace many of the vital functions of the USF heterodimer during development and differentiation. USF (refers to the USF1 and USF2 heterodimer here and i n the following text) was one of the first eukary otic transcription factors biochemically characterized in in vitro t ranscription systems with the adenovirus 2 major late promoter (Ad2MLP) (29, 216) These studies id entified

PAGE 45

45 a binding site for USF located about 60 bp upstream of the transcription start site and comprised of a classical E box element (CACGTG). USF exerted a strong stimulating activity in this system in part by assisting recruitment of the TFIID complex (215) Recent studies have shown that USF interacts with different histone modifying proteins, including the histone acetyltransferases (HATs) PCAF, SRC 1, CBP/p300, the H3K4 methyltransferase containing Set1 complex and the H4R3 specific methyltransferase Prmt1 (52, 110, 147) Both methylated H3K4 and H3 a symmetrically dimethylated at R3 are associated with permissive or actively transcribed gene loci (88, 126) In addition to interacting with these co regulatory protei n complexes, USF proteins have been shown to directly interact with DNA binding transcription factors including the ubiquitously expressed proteins TFII I (211) nuclear factor Y (NF Y), Sp1, and the AP1 like transcription factors MafB and NF E2, an erythroid/myeloid specific heterodimer composed of p45 and a small maf protein (84, 201, 267, 269) These data suggest that the gene activation function of USF is executed by recruiting chromatin remodeling complex es and transcription factors to the promoter regions and thereby facilitating the recruitment of b asal transcription factors and pre initiation complex formation Although USF is a ubiquitously expressed transcription factor, it appears to function mostly in the context of differentiated cells. Several reports have documented increased USF protein leve ls or DNA binding activity during cellular differentiation. For example, Kirito et al (124) reported that thrombopoietin, the main mediator of platelet production, induce s expression of USF1. Furthermore, increased USF levels have also been observed during differentiation of osteoclasts, sertoli cells, and mast cells (157, 259, 266) USF has been shown to regulate genes during differentiation of erythroid cells, including the HoxB4 gene, which encodes an important transcription regulator that stimulates the proliferation and differentiation of erythroid progenitor

PAGE 46

46 cells, the glyco phorin B gene, and the adult globin gene (26, 51, 85) Expression of a dominant negative mutant of USF in murine erythroleukemia (MEL) cells, or in transgenic mice, led to a reduction in gl obin gene expression (51, 148) Correspondingly, expression of USF in undifferentiated murine erythroleukemia cells increased globin gene expression (51) Furthermore, transgenic mice expressing a dominant negative form of USF reveal a defect in erythroid differentiation and down regulation of key erythroid transcription factors, including NF E2, GATA 1, EKLF and Tal1 (148) Thus, USF regulates expression of erythroid transcription factors and cooperates with these factors in the activation of erythroid spec ific genes. Recent studies have shown that USF directly interact s with the tissue restricted transcription factor NF E2 via the p45 subunit and that both proteins are required for the recruitment and activity of Pol II in the globin gene locus (267) This study also shows that USF2 interacts with Pol II in both undifferentiated and differentiated MEL cells while USF1 only interacts with Pol II in differentiated MEL cells. Therefore, USF regulate s erythroid differentiation not only by increasing the expressio n of the erythorid regulators at the transcription level but also by physically interact ing with tissue specific transcription factor s at globin cis regulatory elements. However, it should be stressed that USF is expressed in undifferentiated pr ogenitor cells as well and may be involved in marking genes or regulatory DNA elements that become active at later stages during differentiati on. Summation The homeostasis of the oxygen supply by the transport of the erythroid cells to every tissues and organs in our body is vital and crucial to our health and life quality. Understanding the mechanism s regu l a ting erythropoiesis and globin gen e regulation will provide valuable

PAGE 47

47 information for the development of more effective and painless therapeutic strategies for erythroleukemia and the globin disorders. Previous work from our laboratory has demonstrated that two basic helix loop helix pro teins TFII I and USF regulate expression of the adult globin gene antagonistical ly. In human embryonic erythroleukemia K562 cells that do not express the adult globin gene, TFII I and USF1 interact with the globin promoter and repress its expressio n by recruiting chromatin modifiers that establish or maintain a chromatin conformation inaccessible to transcription factors. However, in MEL cells express ing the adult maj globin gene USF1 and USF2 bind to the + 60 E box recruit co a ctivators and mediate high level s of maj globin gene expression (51) The goal of the present study is to further understand the function of USF and TFII I during erythroid differentiation. It has been shown that intracellular calcium concentration increases and then decreases in erythroid cells during erythropoiesis (247) A proteolytic study of transcription factors shows that USF is subject to specific cleavage of calcium dependent protease m calpain in vitro and the cleaved products show DNA binding ability but no activation activity (251) Therefore, the analysis of the proteolytic effect of calpain on USF during erythroid differentiation is the first goal of this work. Recently, a non transcription factor function of TFII I was discovered It was shown that agonist induced calcium entry was inhibited by phosphorylated TFII I located in the cytoplasm (27) Whether TFII I mediated calcium influx inhibition in the cytoplasm also play s a role in erythroid differentiation need s to be characterized and will be included in this work. Finally to obtain a more complete picture of TFII I and USF in globin gene regulation during erythroid d ifferentiation, an efficient affinity

PAGE 48

48 based purification strategy for identifying protein interaction partners will be used to achi e ve this goal.

PAGE 49

49 Figure 1 1 S globin gene loc i and their gene expression in the erythropoiesis during development (adopted from D. J. Weatherall N ature R eviews (252) ) The globin gene lo cus contains an upstream regulatory element called LCR) which comprises five DNase I hypersensitive sites (HSs) denoted by the five arrows, and of their expression timing during development (middle panel) The globin gene locus contains an upstream HS site (HS 40) and three functional genes, 1, and 2 which are also arranged according to their de velopmental expression timing globin locus globin locus

PAGE 50

50 Figure 1 2 S chematic diagram of thr globin locus. (not drawn to scale) The overall organization of genes in the globin gene locus is similar to t he human locus. It also contains an upstream regulatory element preceding the four h1 maj min locus the order of the genes does not completely reflect the expression timing during dev elopment. The embryonic h1 is the first gene expressed in the embryonic yolk sac and as the erythroblasts mature in the bloodstream, the second embryonic gene is expressed and h1 is silenced gradually toward terminal differentiation (123) M ouse globin genes only undergo one switching from primitive embryonic genes to definitive adult genes. The adult maj and min genes are expressed in fetal liver and adult bone marrow.

PAGE 51

51 Figure 1 3 S equence a li g n ment of the globin down stream promoter region between human, mouse, and rabbit. The i nitiator (open s quare on the left) encompasses the tra nscription start site (indicated by arrow), which overlap s with a conserved E box (gray box). The second E box, +20 E box, (gray box in the middle) is not conserved among species and is followed by a conserved MARE/AP1 like element (open box in the middle). The third E box (gray box on the right) is located 60 bp downstream of the transcription start site and is well conserved between human and mouse (Diagram taken from Leach et al., NAR (130) )

PAGE 52

52 CHAPTER 2 MATERIALS AND METHOD S Construction of Protein Expression Vectors pMSCV GFP TFII I and pMSCV GFP TFII I NLS A point mutati on i n the plasmid pTO TFII I was corrected using QuikChange Site Directed Mutagenesis Kit (Stratagene, cat#200519 5) according to the instruction s provided with the manual using the following GGAATTCCTTTTAGAAGGCCATCTA CTTAC r GFP TFII I construct, the coding sequences of TFII I isoform (from now on indicated as TFII I) were amplified with PCR from pTO TFII I using the following TACCGAGCTCAGCAGCCATCATCA TCATC AGTAGTCGACCCGAAAAGCTCTTCTCAACC PCR reaction s were carried out as follows: 1 5 ng of DNA plasmid, 0 MgCl 2 2U of Pfu Ultra HF DNA polymerase (Stratagene, cat# 600380 51) in total volume of using a program consisting of the following steps: followed by 28 cycles of for The vector pAcGFP1 C1 (clontech) was digested with Sac I and Sal I CIP (calf intestinal phosphatase, NEB, M 0290) treated and ligated with TFII I gel purified PCR products digested with the same enzyme s The GFP TFII I NLS mutant was generated using the QuikChange Site Directed Mutagenesis Kit with the following GATGATGATTATTCTAATGAGC TACCGCAG In order to obtai n stably transfected MEL cell clones, a retroviral transduction system was used. pMSCVneo retroviral vector (Clontech, cat# PT3301 5) was digested with EcoR I and Xho I

PAGE 53

53 restriction enzymes and ligated with a AATTCAC GCACAATGTGGCTCAATTGACCC TCGAGGGTCAATT GAGCCACATTGTGCGTG and containing a Mfe I restriction enzyme site. The pMSCV linker was digested with EcoR I blunt ended with K lenow (DNA polymerase I large fragment, NEB, M 0210S) and then dig ested with Mfe I. The GFP vector and the GFP TFII I/ NLS fusion DNA constructs were digested with Nhe I blunt ended with K lenow and then digested with Mfe I. T he digested vector s and inserts were loaded on agarose gel s and the correct size ban ds were gel purified and ligated together to produce pMSCV GFP, pMSCV GFP TFII I, and pMSCV GFP TFII I NLS protein expressing constructs. N terminal Flag Biotin tagged TFII I To generate the N terminal flag b iotin tagged TFII I, the TFII I coding sequence w as amplified using PCR condition s described above from pTRE TFII GCCGGCGGCCGCCCATATGGCCCAAGTTGC Rev: CTGATCAGCGGGTTTAAACGGG Not I and Pme I, respectiv ely. To generate TFII I NLS, TFII I NLS expression constructs, coding sequences were amplified by PCR from pGFP TFII I GCCGGCGGCCGCCCATATGGCCCAAGTTGC TAGATCCGGGTTTAAACGGGCCCGCGG enzyme sites Not I and Pme I, respectively. To generate N terminal flag biotin USF2, the USF2 coding sequence w as amplified from pTRE USF2 GATGCGGCCGCAGACATGCTGGACCCGGGTCTG CAAGTTTAAACTCACTGCCGGGTGCCCTCGCC Not I and Pme I, respectively.

PAGE 54

54 The vector AviTEVFLAG EF1a3XHA NLS BirA CMV pBUDNeo was obtained from our collaborator Dr. John Strouboulis (Alexander Fleming Institute, Greece) and digested with Not I and Pme I CIP trea ted and ligated with gel puri fied PCR products of TFII I, TFII I NLS and USF2 to generate pFlag biotin TFII I/ NLS and pFlag biotin USF2 N and C terminal Flag Biotin tagged TFII Construct For N terminal flag biotin tagged TFII retroviral constructs, pF lag biotin TFII I/ NLS was digested with Nco I, blunt ended with Klenow, and digested with Sal I to release the Flag biotin TFII I/ NLS inserts. TFII NLS coding sequences were PCR amplified from pGFP TFII NLS using previously descri bed condition s GCCGGCGGCCGCCCATATGGCCCAAGTTGC TAGATCCGGGTTTAAACGGGCCCGCGG Not I and Pme I, respectively The fragments were digested with Not I and Pme I. The pMSCV neo retroviral vector was digested with EcoR I and Xho I and ligated with linker containing Not I and Pme I restriction enzyme site s which was generated using two complementary AATTTGCGGCCGCTACTGTTTAAACTACTGAC TCGAGTCAGTAGTTTAA ACAGTAGCGGCCGCA The pMSCV linker plasmid was then digested with Not I and Pme I and ligated with gel purified TFII I NLS PCR product s to generate pMSCV TFII I NLS This vector was digested wi th Not I, blunt ended with Klenow, digested with Sal I, gel purif ied and ligated with Flag biotin TFII I/ NLS insert to generate pMSCV nflag biotin TFII I/ NLS For fast gen eration of the C terminal flag biotin tagged TFII I, the final product including the TFII I/ NLS coding sequences 6 or 8 glyci ne linker, flag biot in tag were generated using

PAGE 55

55 an assembly PCR strategy. The PCR product s of the TFII I NLS coding sequences were generated and sequenced (for N terminal tagged TFII I NLS construct) which were further G CCACCGCCACCGCCACCCCACGTGGGGTCTGGTTC The set up of the PCR reaction was: 5 ng of TFII I s 2mM MgCl 2 tal volume using the following program: followed by r 10 min for final extension T he product (called gene R) was used in the following assembly PCR reaction. Assembly PCR was performed to amplify the annealed product of the following oligonucleotides: 1) gene GGTGGCGGTGGCGGTGGCGGTGGCGACTACA AGGACGACGACGA GAAGTACAGGTTCTCTCCCTTGTCGTCGTCGTCCTTGTAGTC CAAGGGAGAGAACCTGTACTTCCAGGGAGGAGGAATGGCTGGTGGCC GGCCTCAAAGATGTCATTCAGGCCACCAGCCATTCCTCCTCCCTG TGAATGACATCTTTGAGGCCCAGAAGATCGA GTGGCATGAGTAATAG primer pairs: Fwd: TAGCGTTAACCCATATGGCCCAAGTTGC Hpa I site, CTGAGTCGACCTATTACTCATGCCACTCG containing Sal I site. The PCR reaction was set up as follows : ~5 ng of gene of oligos (#2 2 2.5 U of Pfu Ultra HF DNA polymerase in a using the following followed by The final PCR product (C terminal flag biotin tagged TFII was gel purified and digested with Hpa I and Sal I restriction enzyme and gel purified again. The retroviral vector pMSCV TFII

PAGE 56

56 I Not I, blunt ended with Klenow, digested with Sal I, CIP treated and ligated with purified final PCR produ cts of C terminal tagged TFII I pMSCV biotin TFII I was digested with Nsi I and BstB I to release the insert containing the TFII I coding sequence including the NLS This insert was ligated with the vector pMSCV TFII cflag biotin which was digested with Nsi I and Bst B I to generate the C terminal flag biotin tagged pMSCV TFII I expression construct. pTRE Bidirectional TetOff Inducible V ectors The Tet Dual Expression Systems ( Tet Advanced IRES Fluorescent Vector Sets, cat#631113 ) and pTRE tight BI (cat#631068) bidirectional vector were purchased from C lontech. In order to express both BirA biot in ligase an d the transcription factors of interest at the same time in the cells, the pTRE tight BI (pTRE BI) bidirectional vector was used. In order to monitor the expression of the construct, Tet Dual IRES mCherry fluorescence expression vector (pTRE Dual2) was use d. The vector AviTEVFLAG EF1a3XHA NLS BirA CMV pBUDNeo was digested with Hind III, blunt ended with Klenow and digested with BamH I to release BirA cDNA sequences which were gel purified. pTRE Dual2 vector containing mCherry and IRES sequences was digested with Not I, blunt ended with Klenow, digested with BamH I, CIP treated, gel purified and ligated with a BirA insert to generate the pTRE (Dual2) mCherry IRES BirA construct. This construct was further digested with BamH I blunt ended with Klenow and digest ed with EcoR I to rel ease the mCherry IRES BirA fragment which was then gel purified. To ligate the mCherry IRES BirA insert into the multiple cloning site ( MCS ) II of the pTRE BI bidirectional vector, pTRE BI was digested with Xba I, blunt ended with Kleno w, digested with EcoR I, CIP treated, gel purified, and ligated with gel purified BirA cDNA sequence to generate pTRE(BI) mCherry IRES BirA vector.

PAGE 57

57 The i nsert for N terminal flag biotin tagged TFII pFlag biotin TFII Nco I, followed Sal I restriction enzyme digestion For C terminal flag biotin tagged TFII TFII LS cflag biotin was digested with Sfo I and Sal I. The insert s were cloned into MCS I of the vector by digesting pTRE(BI) mCherry IRES BirA vector with Not I, followed by blunt end ing with Klenow and Sal I digestion to generate pTRE(BI) mCherry IRES BirA_nfl ag biotin TFII mCherry IRES BirA_cflag biotin TFII For USF2, pFlag biotin USF2 was digested with Nco I, blunt ended with Klenow, and digested with Pme I. The Flag biotin tagged USF2 cDNA fragment was isolated by gel purifi cat ion and cloned into pTRE(BI) mCherry IRES BirA vector by No t I digestion, blunt ended with Klenow and EcoRV digestion All ligated products were transformed into Stbl2 competent E.coli cells (Invitrogen, cat# 10268 019) which are recombination deficient c ells suitable for cloning of unstable inserts. The inserts of all the generated constructs were sequenced to confirm that no mutations have been generated by PCR Cell Culture Transfection, and Primary Erythroid Progenitors Isolation K562 cells were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin streptomycin. Murine erythroleukemia (MEL) cells were grown in DMEM containing 10% FBS and 1% penicillin streptomycin. Cells were grown in 5% CO 2 at 37C and maintained a t a density between 1x10 5 and 2x10 6 cells/ml. In Dimethyl su lfoxide (DMSO) induction studies, MEL cells were incubated with 2% DMSO for 48 hours. To inhibit m up to 7 days. In control experiments, MEL cells were incubated with 0 .03% or 0.04% DMSO. The starting cell density was 5x10 5 cells/ml before adding the drug.

PAGE 58

58 One day before transfection, Pheonix A packaging cells were seeded at ~4x10 5 /ml in 60 mm dish or 6 well plate. Retrovirus was generated by transfecting Pheonix A pack aging cells at 50 60% confluency with retroviral vector s pMSCV GFP, pMSCV GFP TFII nflag biotin TFII or pMSCV BirA puro and with gag pol and env plasmid s at 2:1:1 DNA radio using a lipofectamin 2000 transfection kit ( Invitrogen, cat# 11668 019 ) according to the manual. Cells were incubate d in the 5% CO 2 incubator at 32C for virus stability. 48 hrs post transfection, virus containing media was transferred to a tube and the cell debris in the media was spun down. Then the supernatant and one volume of media was added to MEL cell pell et s dir ectly in the presence of 3 g /ml polybrene and the MEL cells were resuspended by pipetting and placed in cell culture dish and incubated in the 5% CO 2 incubator at 37C. Two days after infection, half of the MEL cells were harvested for Western Blotting for protein e xpression verification; half of the cells were g/ml puromycine (for pMSCV BirA puro) selection for 14 days before freezing and downstream experiments Transfection of pFlag biotin TFII K562 cells using Amaxa Nucleofector kit ( VCO 1001N ) was performed according to the protocol provided with the kit. 5 of plasmid was used in the transfection procedure. 40 hrs after transfection, cells ation for 14 days before cells were frozen down or harvested for Western Blotting or protein purification C Kit+ CD71+ erythroid progenitors were obtained from the bone marrow of 7 to 9 week old C57BL/6J female mice (Jackson laboratory, Bar Harbor, ME). The bone marrow was obtained by flushing femurs with phosphate buffered saline (PBS) supplemented with neonatal calf serum (NCS). Cells were centrifuged at 1100 rpm for 5 min at 4 C. Pellets were resuspended by tapping and red blood cells were lysed with 0 .5ml/mouse ACK buffer (0.15 M NH4Cl, 10

PAGE 59

59 mM KHCO3, 0.1 mM Na2EDTA; pH 7.35) at room temperature for 5 min. 13.5 ml of PBS was containing 10% FBS. Phycoerythrin (P E) conjugated rat anti mouse c Kit (cat#553355) and fluorescein isothiocyanate (FITC) conjugated rat anti mouse CD71 (cat#553266) antibodies (both from BD Bioscience Pharmingen, San Diego, CA) were added at a concentration of 0.8 g/million cells. Cells we re incubated on ice for 20 min utes washed, and resuspended in PBS containing 10% FBS. FACS sorting was performed and c Kit + CD71 + erythroid progenitors were 10% FBS, 1% penicillin streptomycin, 2mM glutamine, 20 ng/ml of recombinant murine interleukin (IL) 3 (cat# 216 13) and IL 6 (cat# 216 16), and 5 0 ng/ml of recombinant murine stem cell factors (SCFs, cat# 250 03) (IL 3, IL 6, and SCFs are purchased from PeproTech, INC, Rocky Hill, NJ) for 2 days before being treated with drug. Cells were then incubated with 30 M of calpeptin or 0.03% DMSO for 4 days with a starting density of 4x10 5 to 2.5x10 5 cells/ml. RNA Extraction, Reverse Transcription, and Real Time PCR RNA w as isolated using the guanidine thyocyanate method as described previously (46, 51) Reverse transcription was carried out using the iScript cDNA synthesis kit (Bio Rad). Real time PCR was performed using the MyiQ (Bio Rad) and reactions were carried out using the iQ SYBR green supermix (Bio Rad). Real time conditions were as described previously (51) globin genes, as well as that of human actin have been described previously (51, 137, 243) In additio n, the following primer sequences were used: murine USF1 Fwd: 5' GATGAGAAACGCAGGGCTCAGCATA 3'; Rev: 5' TTAGTTGCTGTCATTCTTGATGACG CTGGGGGAAGATTGGTG GTGGGCCGCTCTAGGCACCA TGGCCTTAGGGTGCAGGGGG

PAGE 60

60 For K562 cells ChIP assays were performed as described previously (130, 243) The fol lowing antibodies were used in this study: USF1 (H 86, sc 8983), USF2 (N 18, sc 861), both purchased from Santa Cruz Biotechnology; and RNA Pol II (CTD45H8), purchased from Upstate Biotechnology, Inc. For MEL cell lines, ChIP assays were performed as desc ribed in Q 2 ChIP with some minor modifications (53) Antibody bead complexes were prepared as described except that the beads were diluted only 5 fold from the original stock in antibody beads solution in 0.5ml tubes. Antibodies used were RNA Pol II (N 20, sc 899), USF2 (C 20, sc 862), and normal rabbit IgG (sc 2027), all purchased from Santa Cruz Biotechnology. 1x10 7 cells were collected and resuspended at 1x10 6 cells per ml in phosphate buffered saline (PBS). Cells were crosslinked with 1% (vol/vol) formaldehyde in PBS for 10 minutes at room temperature. After quenching the crosslinking reaction with 0.125 M glycine, cells were washed twice with ice cold PBS, resuspended in 165 l of lysis buffer (50 mM Tris HCl, pH 8, 10 mM EDTA, 1% SDS, protease inhibitor cocktail, 1 mM phenylmethyl sulfonyl fluoride ( PMSF ) ), and incubated on ice for 8 minutes. Cells were then sonicated using power 2 setting for 4x10 seconds with 1 minute pause on ice water (Fisher scientific Model 100 sonic dismembrator) to produce 200~500 bp chromatin fragments. 20 l of the sonicated material was taken for fragment size examination and the rest was centrifuged at 13000 rpm for 10 minutes at 4C to remove cell debris. 150 l of supernatant were transferred to a new tube and then diluted 10 fold in RIPA buffer (10 mM Tris HCl, pH 7.5,1 mM EDTA, 0.5 mM EGTA, 1% Triton X 100, 0.1% SDS, 0.1% Na deoxycholate, 140 mM NaCl) with protease inhibitor cocktail and 1 mM PMS F. Aliquots of 100 l of diluted chromatin were transferred to the tube containing antibody bead complexes after removing the original solution in the tube and one aliquot was saved as Input. Antibody bead complexes in

PAGE 61

61 chromatin suspension were rotated at 4C overnight and then washed as described. At the last wash in TE buffer (10 mM Tris HCl, pH 8.0, 10 mM EDTA), the beads were transferred to a 1.5 ml tube and the TE buffer was removed. Immunoprecipitated chromatin was eluted, reverse crosslinked, protei nase K treated as described, and incubated with 100 l of elution buffer (20 mM Tris HCl, pH 7.5, 5 mM EDTA, 50 mM NaCl) containing 1% SDS, 50 g/ml proteinase K and 50 g/ml RNase. The corresponding eluates were combined and the DNA was purified using a Qiagen Miniprep kit and eluted in 100 l TE buffer (1 0 mM Tris HCL, pH 7.4, 1 mM EDTA). Real time PCR was performed using the MyiQ (Bio Rad) and the iQ SYBR green supermix (Bio Rad) with 3 l DNA template and 6 M forward and reverse primer mix in a total volume of 20 l. Human HS2 primers and human and mous globin promoter primers used in this experiment have been described previously (51, 243) Protein Isolation and Western Blotting Proteins were isolated and analyze d by western blotting as described by Leach et al. (130) A total of 20 30 6 cells were loaded onto 7.5 % Ready Gels (Bio Rad). After transfer prote ins were detected using the ECL plus system (Amersham Pharmacia). The following antibodies were used: USF2 (c 20, sc 862), NF E2/p45 (c 19, sc 291), USF1 (c 20 sc 229), GAPDH (FL 335, sc 25778), or HA (Y 11, sc 805) all purchased from Santa Cruz Biotechno logy. Flag antib ody (F3165) was purchased from S igma. Antibodies against TFII ) and TFII University School of Medicine) Benzidine Staining Cells (1x10 6 ng solution was prepared as described by Sang Hyun Song et al. (228) cell suspension. Cells were then incubated at room temperature for 3 minu tes, pelleted by

PAGE 62

62 hemacytometer. The cell numbers were counted on 4 squares. Blue cells were calculated as percent of total cells in each square. For taking photographs, cel PBS and loaded onto a glass slide. Immunofluorescence and Confocal Microscop y Cells were grown overnight on a coverslip (Fisher brand 22x22mm 12 542B) treated with poly L lysine until reaching 90% confluency The media wer e removed gently using vacuum. Cells were rinsed with 1xPBS once and fixed with 4% paraformaldehyde for 10 minutes at 4 C After washing three times with PBS, cells were incubated with 0.5% Triton X100 for 10 minutes at room temperature and rinsed with PBS Cells were blocked in 3% BSA for 30 minutes and then incubated with primary antibodies diluted in 3% BSA with 1:500 or 1:1000 ratios for 1 hour at room temperature or overnight at .4 C Cells were washed with 4% Tween 20 three times and incubated with se condary antibodies for 1 hour blocked from light. Following three washes with 4% Tween 20 and PBS once, the coverslip was loaded on to the slide with a drop of Vectashield DAPI (H 1500) mounting media. Pictures were taken with a Leica fluorescence microscop e or a Leica confocal microscope with a Z stacking setting Microarray Experiments Total RNA of c Kit + CD71 + mouse erythroid progenitor cells were extracted using Qiagen RNeasy mini kit (cat# 74104) according to the protocol provided by the company On co lumn DNase treatment was performed to eliminate the residual genomic DNA. RNA samples were run on Agilent Bioanalyzer in the Interdisciplinary Center for Biotechnology Research ( ICBR ) Gene Expression lab, Univeristy of Florida for quality verification. Onl y samples with RNA integrity over 8 (except 1 is 7) were used for the microarray experiment. Four biological replicates with

PAGE 63

63 two conditions were obtained and subjected to cDNA synthesis, labeling and hybridization on Affymetrix mouse whole Genome 430 2.0 a rrays at the same time. Cytoplasmic and Nuclear Protein Extraction Protein Complex Pull D own by Streptavidin Beads and Mass Spectrome try Analysis 1x10 8 cells were centrifuged and washed once with 1x PBS supplemented with protease inhibitor (Roche, complet e) The cell pellet was fully resuspended in approximately 1.2 ml (~4 5 fold volume of the pellet) of either NP 40 buffer (20 mM HEPES, pH 7.8, 3 mM MgCl 2 10mM NaCl, 20% glycerol, 0.25% NP 40 ) or C buffer of Mi ll ipore Compartment Protein Extraction Kit s ( cat# 2145) containing 0.25% NP 40 s upplemented with protease inhibitor and 1mM Dithiothreitol ( DTT ) by pipetting After rotation on a wheel for 10 C, c ell lysis efficiency was examined by Unna stain ( Methyl green Pyronin Y staining soluti on: 0.08% Methyl green, 0.12% Pyronin Y, 2% EtOH, 52.8 mM Sodium Acetate, 35.2 mM Acetic Acid ) with cell and staining solution at a 1 to 1 ratio. Lysis condition s showing o ver 90% of cells free of cytoplasm was desired. Cells were centrifuged at 600xg for 5 minutes and the supernatant was transferred to a new tube. The supernatant contains cytoplasmic proteins. The n uclei were washed with wash buffer ( Minipore Cell Compartment Extaction Kit cat# 2145 ) and centrifuged at 580xg for 5 minutes and the supernata nt was discarded. 1 ml of nuclear extraction buffer ( 20mM HEPES, pH 7.8, 400mM NaCl, 1.5mM MgCl 2 20% glycerol, 0.2 mM EDTA ) supplemented with protease inhibitor and 1mM DTT was carefully added to the tube containing nuclei without disturbing the pellet. T The n uclei pellet should become loose during the rotation. The n uclei were centrifuged at 13000xg for 10 nuclea r proteins. The nuclear extract was dialyzed using Slide A Lyse mini dialysis units (Pierce, cat# 66370 ) at 4C in 500 ml dialysis buffer ( 20mM HEPES, Ph 7.8, 100 mM KCl,

PAGE 64

64 3mM MgCl 2 0.2mM EDTA, 20% glycerol ) supplemented with 1mM PMSF and DTT with constant stirring for 2 hrs. This procedure was repeated once with fresh dialysis buffer. Samples were removed f rom dialysis units, and protein concentration was determined Samples were either used for the pull down experiment or were liquid nitrogen flash frozen and stored in Streptavidine magnetic beads (Invitrogen, cat# M 280) were washed three times with PBS and once with HENG buffer (10mM HEPES, pH 7.8, 1.5mM MgC l 2 20% glycerol, 0.25mM EDTA ). 1ml BSA blocking buffer ( 10mM HEPES, Ph 7.8, 1.5mM MgCl 2 0.02% BSA, 20% glycerol, 0.25mM EDTA ) was added to the washed beads and the beads were blocked for 1 hr on a wheel at 4C. Blocking buffer was removed and the cytopla smic or nuclear extract was added to the beads at 3 (10mM HEPES, pH 7.8, 1.5mM MgCl 2 100mM KCl, 20% glycerol, 0.25mM EDTA) and rotated overnight at 4C. The supernatant was transferred to a new tube for later use. The magnetic beads were washed two time shortly and three times on a wheel 5 minutes each with washing buffer ( 10mM HEPES, pH 7.8, 1.5mM MgCl 2 200mM KCl, 0.25% NP 40, 20% glycerol, 0.25mM EDTA ). The beads bound protein complex es were eluted in 1x lamminae buffer and boiled for 10 m inutes a nd loaded on to 7.5% Tris HCl gel s 25 unbound protein s of the supernantant were loaded on the gel as well. 10% of bead eluted samples and the same amount of unbound proteins were loaded separately for Western Blotting. After electrophoresis, the gels were washed three times with ddH 2 O stained with Bio S afe co om assie blue ( Bio rad, cat# 161 0786 ) overnight and then destained with ddH 2 O for more than 2 hrs. Gel picture s w ere taken using typhoon with setting: Non filter, 570 V, 623nm, and normal sensitivity. Protein bands of interest wer e cut off and

PAGE 65

65 processed in ICBR proteomics core facility for liquid chromatography ( LC ) Orbi t rap mass spectrometry analysis

PAGE 66

66 CHAPTER 3 CALPEPTIN INCREASES THE ACTIVITY OF UPST REAM STIMULATO RY FACTOR AND ACTIVATE GLOBIN GENE EXPRESSI ON IN ERYTHROID CELLS Introduction Erythropoiesis is a complex and multistep process of cellular proliferation and differentiation by which red blood cells are produced. During this process, signal transduction pathway s play an important role by converting extracellular s timul i into a specific cellular response such as proliferation, differentiation, cell cycle arrest, and apoptosis Within all the secondary messengers that spread the intracellular signals, Ca 2+ is highly versatile and regulat es many different cellular functions over a wide temporal range (14) The most prominent signal transduction pathway regulating differentiation of erythroid cells is represented by erythropoietin (Epo) induced activation of Janus kinase 2 (203) Janus kinase 2 initi ates many different pathways within the cell including activation of processes mediated by phosphatidylino sitol 3 kinase and phospholipase C. Phospholipase C catalyzes the generation of inositol 1,4,5 trisphosphate, which triggers intracellular calcium rel ease (13) Furthermore phospholipase C promotes calcium entry into the cells through stimulating the cell surface expression of transient receptor potential channels (TRPCs) such as TRPC3 (188) Many studies have implicated that Ca 2+ plays a role in erythroid growth and differentiation (21, 135, 217) For example, E po induced murine erythroid colony growth was enhanced by the calcium ionophore A23187, which increases the intracellular calcium concentration, but blocked by EGTA, a calcium chelator (171) Supporting evidence is provided by experiments using m urine erythroleukemia (MEL) cells These cells are Friend v irus transformed erythroid cells with the differentiation program arreste d at the proerythroblast stage (163) These cells have been widely used in studying terminal differentiation of erythroid cells due to their ability to differentiate upon stimulation by inducers, such as dimethyl sulfoxide (DMSO),

PAGE 67

67 hexamethylene bisacetamide (HMBA) x irradiation, or hypoxanthine which results in increase in globin mRNA levels, an early indication of erythroid different iation, and limited proliferative capacity (100) However the mechanism(s) by which these reagents induce erythroid differentiation is (are) not known. Interestingly, before the cells appear to differentiate there is a latent period of 8 12 hours after exposure to the DMSO However, when cells were pre incubat ed with A23187 shortly and followed by DMSO treatment or we re co incubated with DMSO and A23187, differentiated cells appeared right awa y with no lag phase Moreover d ifferentiation of MEL cells induced by DMSO was inhibited by EDTA and was recovered by t he addition of excess calcium (21) Intriguingly, a subsequent study showed tha t A23187 (in the presence of very low concentration of DMSO (<0.15%), which had no effect on cell growth and differentiation) can induce commitment of MEL cells; however, there is no increase in mRNA globin and Band 3, which are characteristics of differentiated cells. These experiments suggest that increase in cytosolic Ca 2+ is an early event during the commitment of MEL cells to differentiation I n contrast to this hypothesis, direct measurement shows that there is a small but significant decr ease in cytosolic calcium concentration during 0 40 hrs DMSO incubation (72) Another study measuring intracellular calcium concentration in erythroid precursor cells at various stages (proerythroblast, basophilic erythroblast, and orthochromatic erythroblast) as well as in red blood cells demonstrate s t hat c a lcium concentration increase s from 0 to 24 h our and then decrease at 48 h our until it reaches the lowest concentration in red blood cells (247) Therefore, d espite n umerous studies the precise working mechanism of the cha nge in calcium concentration in erythroid di fferentiation is still undetermined The c alpain family, a group of calcium dependent cysteine proteases, is involve d in a variety of cellular processes, such as platelet activation, signal transduction, membrane fusion,

PAGE 68

68 gene regulation, cell cycle progress cell differentiation, and apoptosis (89, 114) The p roteolytic activity of calpains is regulated by the binding of Ca 2+ to their EF hand motifs Previous studies have shown that the transcription factor USF, which has an important function during cellular differentiation, is proteolytically processed by calpain in vi tro (251) USF has been shown previously to regulate gene expression in erythroid cells. For example, USF is required for the efficient recruitment of transcription complexes to the globin gene locus (51) where it interacts with E box motifs (CANNTG) present in locus control region (LCR) element HS2 and in the adult gl obin gene promoter (20, 69, 130) We demonstrate here that USF is subject to calpain mediated proteolytic processing in undifferentiated but not differ entiated MEL cells. Treatment of DMSO induced MEL cells with calcium ionophore led to proteolytic processing of USF and a decrease in globin gene expression. We further show that treatment of MEL cells with the synthetic calpain inhibitor calpeptin dissolved in DMSO stabilized and increased the protein level of full l ength USF dramatically. Calpeptin in combination with extremely low l evel s of DMSO syn ergistically induce d globin gene expression and cell differentiation Calpeptin also increased globin gene expression in K562 cells as well as in primary c Kit and CD71 positive erythroid progenitor cells. Results The transcription factor USF regulates many genes during the process of cellular differentiation (50) The data from our laboratory previously demonstrated that USF is required for increased transcrip tion of the adult globin gene during differentiation of MEL cells (51) During the course of these experiments we noticed that the levels of full length USF increase during d ifferentiation of MEL cells. In Western blotting experiments, antibodies specific for

PAGE 69

69 USF2 detected short protein fragments (between 15 and 20 kDa) in extracts from undifferentiated MEL cells but not in those obtained from differentiated cells (Fig. 3 1A). Previous studies have shown that USF is a substrate for the calcium dependent protease m calpain (251) Treatment of protein extracts from differen tiated MEL cells with 0.1 or 1 unit of recombinant m calpain in the presence but not in the absence of 5 m M CaCl 2 and 5 m M MgCl 2 led to the generation of USF2 specific cleavage products that migrate in the range between 15 and 20 kDa (Fig. 3 1B). We obtain ed similar results for USF1 (data not shown). The results suggest that USF is subject to proteolytic processing in undifferentiated erythroid cells and protected from proteolytic cleavage in differentiated cells. Previous studies have shown that treatment of MEL cells with calcium ionophores induced differentiation but inhibited globin gene expression (109) Babak Moghimi treated DMSO induced MEL cells with the calcium ionophore A23187 which led to the appearance of USF2 specific proteolytic fragments in the molecular mass range of 15 20 kDa (Fig. 3 2A) and was associated with a decline in globin mRNA levels in a dose and time dependent manner (Fig. 3 2B). Interestingly the treatment of differentiated MEL cells with the calcium ionophore decreased maj globin gene expression to leve ls comparable to those detected in undifferentiated MEL cells. We next examined whether the specific inhibition of calpain by calpeptin is sufficient to induce globin gene expression in MEL cells. Treatment of uninduced MEL cells with the calpain specific inhibitor calpeptin increased the protein levels of USF1 radically and USF2 to a less extent (Fig. 3 3A provided by Zhuo Zhou ). The calpeptin induced increase in USF levels was not due to up regulation of transcription of USF1 (Fig. 3 3B) or USF2 (data no t shown) because the mRNA levels remained the same between untreated and treated MEL cells. The

PAGE 70

70 increase in the protein levels of USF was accompanied by a significant increase in and globin gene expression (Fig. 3 4A) consistent with previous observat ions demonstrating that USF is required for increased level of globin gene expression in MEL cells (51) There was a more than 10 fold increase in maj globin gene primary tr anscripts and an up regulation by more than 40 fold in transcripts of the globin gene after treatment of MEL cells with 40 M calpeptin for 7 days (Fig. 3 4A) and the cells became very red To confirm these results, u ntreated and calpep tin treated MEL ce lls were incubated with benzidine, which stains hemoglobin and is commonly used as an indicator of erythroid differentiation. Calpeptin treatment led to a significant increase in the number of benzidine positive cells (Fig. 3 4, B and C). More than 10% of the cells stained positive for benzidine after 7 day treatment with 40 M calpeptin. The increase in the number of hemoglobinized cells occurred in a dose and time dependent manner. The solvent for calpeptin is DMSO, and the final concentration in experim ents with 30 and 40 M calpeptin was 0.03 and 0.04%, respectively. Because 2% DMSO is an inducer of MEL cell differentiation and globin gene expression, we included control experiments in which MEL cells were incubated with DMSO only. The low concentration of DMSO alone (0.03 or 0.04%) did not significantly increase the number of benzidine positive cells (Fig. 3 4, B and C) nor did it lead to an increase in globin gene primary transcripts comparable to that seen in cells treated with calpeptin although inc rease in the control sample were noticeable (Fig. 3 4A). The low DMSO concentration also failed to increase the level of USF in MEL cells (data not shown). The increase in globin gene expression was associated with an increase in the binding of USF2 and Po l II to the adult maj globin gene (Fig. 3 5 A ). Treatment of MEL cells with 40 M calpeptin significantly increased the association of both proteins with the promoter after 7 days.

PAGE 71

71 Although it is noticeable that in 0.04% DMSO control samples the binding o f Pol II and USF2 to the maj globin gene promoter also increased compared to the untreated, the enrichments were consistently lower than the calpeptin treated samples (except USF2 day 3) The results of ChIP and the globin gene transcripts analysis sugges ted that c al peptin had an addi tive effect together with DMSO in inducing the differentiation of MEL cells because when MEL cells were treated with calpeptin dissolved in ethanol for 7 days the cells did not differentiate nor did they turn red (data not sh own) but did they grow slower I also observed an increase in the protein levels of USF1 in MEL incubated with the calpeptin dissolved in ethanol from day 4 to day 7 in my most recent Western blot experiment; however the increase was not as much as using D MSO as solvent (data not shown). This addi tive effect may be caused by the slower cell growth rate seen in the calpepetin treated samples (Fig. 3 5 B and C). To exclude the possibility that calpeptin induced changes in globin gene expression are an artifac t associa ted with the MEL cell system, we repeated the experiments using human K562 cells, an erythroid cell line expressing the embryonic globin and the fetal globin genes but not the adult globin gene (243) We treated K562 cells with the m calpain inhibitor calpeptin and observed an 8 10 fold increase in adult globin gene expression in these cel ls (Fig. 3 6 A). Expression o f the and globin genes was increased about 2 fold, whereas expression of the control actin gene was not affected by the treatment. The increase in expression of the embryonic and fetal globin genes could be attributed to increased binding of USF to LCR element HS2. Indeed cells treated with the calpain inhibitor revealed an increase in RNA Pol II and USF1 loading not only to the globin gene promoter but also to LCR element HS2 (Fig. 3 6 B). A similar increase in RNA Pol II and USF binding was not ob served in the control actin gene (data not shown). These results further support the notion that USF activity is limited for

PAGE 72

72 the activation of the adult globin gene in embryonic and undifferentiated erythroid cells and that this protein plays an import ant role in the activation of globin gene expression during development and differentiation. Next primary erythroid progenitor cells (c Kit + / CD71 + cells) were isolated from mouse bone marrow using a fluorescence activated cell sorter. The cells were cultured for 4 days in the presence or absence of 30 M calpeptin or 0.03%DMSO The data demonstrate d that calpeptin induced high level expression of both maj globin and globin genes in the primary erythroid p rogenitor cell culture (Fig. 3 7 A). Incubation with calpeptin did not significantly cha nge expression of the control actin (Fig. 3 7 B) or glyceraldehyde 3 phosphate dehydrogenase (data not shown) genes. These experiments were repeated twice independently and the results were reproducible. In contrast to MEL cells, the primary erythroid pr ogenitor cells did not increase globin gene expression in response to DMSO only, perhaps rendering the results from the primary cell culture more significant. Discussion In this study we demonstrated that the calpain inhibitor calpeptin stabilizes full le ngth USF and induces globin gene expression in erythroid cells. Our work supports and extends previous observations showing that USF is subject to calpain mediated proteolytic processing and that the differentiation dependent increase in globin gene expr ession is associated with a decrease in intracellular calcium concentration (72, 109, 247) Our data show for the first time that inhibition of m calpain, which i n vivo may be mediated by decreased availability of calcium, induces expression of the adult and globin genes in erythroid cells Previous work demonstrated that the intracellular calcium concentration of MEL cells changes during DMSO induced differen tiation and that the treatment of MEL cells with calcium

PAGE 73

73 ionophores facilitates differentiation but at the same time reduces globin gene expression (109) Our data showed that both DMSO (Fig. 3 2) and calpeptin (data not shown) mediated stimulation of globin gene expression in MEL cel ls was diminished in the presence of a calcium ionophore. Our results suggest that a decrease in calcium concentration during erythroid cell maturation lowers the activity of m calpain. The reduction in m calpain activity increases the level of full length USF and at the same time reduces the truncated products which have been shown to have dominant negative effect on transcription (251) and consequen tly enhances expression of globin genes. The protease m calpain is known to regulate many processes in the cell and cleaves a variety of proteins in the cytoplasm and in the nucleus, including other transcription factors (260) It is therefore likely that stabilization of USF alone does not account for the strong increase in globin gene expression in MEL cells treated with calpeptin. However, we note that over expression of USF in undifferentiated MEL cells was sufficient to increase expression of the adult maj globin gene, although not to the extent seen in cells treated with calpeptin (51) In fact, ChIP analysis showed that bindin g of p45, the large subunit of the erythroid specific transcription facto r NF E2, to the LCR element HS2 and to the promoter increased significantly in MEL cells treated with 0.04% of DMSO for 3 days but decreased to the untreated leve l in the following days (Fig 3 8 ). It has been known that during DMSO induced MEL differentiation, a key rate limitation step is the degradation of Bach1, which results in the disrupt ion of its associated repressor complex, and the replacement of NF E2 binding to the promoter region (19) A recent stud y shows that NF E2 is requ ired for the recruitment of USF and the co activator CREB bind protein CBP promoter in DMSO treated MEL cells (267) Therefore, it is possible that in as low as 0.03% or 0.04% of DMSO treated MEL

PAGE 74

74 cells for three days, th e replacement of repressors by activators already take s place but somehow the effect is not strong enough to fully induce differentiation After 5 days in the presence of low concentration of DMSO the binding of p45 to the globin gene promoter is reduced Indeed, MEL cells continuously exposed to 0.03% DM SO for 6 days, did not turn red. On the other hand, th e initial induced effect may be stabilized or enhanced by calpeptin, probably through increasing full length USF levels or through its cell division restricted effect as seen in the slower growth rate of calpeptin treated MEL cells Thus, the combined effect of low DMSO concentration and calpeptin may cause the differentiat globin gene transcription. This conclusion is substantiated by previous observations demonstrating that in vitro differentiation of MEL cells is synergistic ally regu lated by two independent and inducible intracellular react ions : 1) cell division inhibition and 2) transmembrane signal ing triggered by DMSO or HMBA (249, 250) The effect of calpeptin on globin gene expression was not rest ricted to MEL cells but also found in K562 (Fig. 3 5) and primary murine c Kit + /CD71 + erythroid progenitor cells (Fig. 3 6). The results obtained from the different cell systems are consistent and reveal specific increases in adult and globin gene ex pression upon treatment with calpeptin. The mild increase in expression of the and globin genes in calpeptin treated K562 cells (Fig. 4) could be due to the fact that these genes are already expressed at high levels in these cells. Whether the calpep tin induction of globin gene expression is due to a direct effect of USF acting through regulatory elements in the globin gene locus remains to be determined. USF has long been associated with high level gene expression in differentiated cell s (50) Previous studies suggest that USF may antagonize the function of c Myc (44) Expression of c Myc is associated with the proliferation of cells, whereas expression of USF is associated with

PAGE 75

75 cells undergoing differentiation. It will be interesting to examine whether other cellular systems are associated with a differentiation dependent increase in USF expression. In this respect it is interesting to note that a recent report demonstrates that USF binding activity increases during differentiation of rat Sertoli cells ( 259) TFII I is another helix loop helix protein involved in the regulation of the globin gene locus (51) It was originally identified as an initiator binding protein that recruits transcription complexes in the absence of the TATA box (210) We previously demonstrated that TFII I interacts with an initiator sequence located in the globin gene promoter and represses its expression in K562 cells (51, 130) More recently it was demonstrated that TFII I also represses expression of the vascular endothelial growth factor receptor 2 gene by interacting with the initiator (160) When phosphorylated at a specific tyrosine residue, TFII I interacts with phospholipase C in the cytoplasm, and inhibits cell surface localization of TRPC3 leading to a decrease in calcium influx (27, 122) It is tempting to speculate that TFII I is reloc ated to the cytoplasm during differentiation of erythroid cells where it inhibits the influx of calcium and as a consequence stabilizes expression of transcription factors involved in mediating erythroid cell specific gene expression patterns. Enzymatic in hibitors have long been shown to be able to induce globin gene expression (158) Well studied examples are inhibitors of histone deacetylases, which increase expression of fetal globin genes in adult erythroid cells. We show here that another such inhibitor, ca lpeptin, induced expression of the adult globin genes. However, more experiments need to be done to determine the mechanism precisely

PAGE 76

76 Figure 3 1 USF is subjec t to proteolytic cleavage by the calcium sensitive protease m calpain during erythroid differentiation. A) Western blot analysis of USF2 in uninduced MEL and DMSO (2%) induced MEL cells. Whole cell protein extracts were isolated from the cells and subjecte d to Western blot analysis using antibodies specific for USF2. B) Western blot analysis of protein extracts from DMSO (2%) induced MEL cells treated with recombinant m calpain in the presence or absence of CaCl 2 and MgCl 2 MEL cells were incubated for 2 da ys in 2% DMSO to induce differentiation. Whole cell protein extracts from differentiated MEL cells were incubated in the absence or presence of different amounts of m calpain as indicated as well as in the absence and presence of 5 mM CaCl 2 and MgCl 2 The protein extracts were subjected to Western blot analysis using a USF2 specific antibody.

PAGE 77

77 Figure 3 2 globin gene expression in differentiated MEL cells exposed to calcium ionophore. A) Treatment of DMSO induced MEL cells with the calcium ionophore A23187 leads to proteolytic cleavage of USF. DMSO treated MEL cells were blot analysis using a USF2 specific antibody. B) Treatment of DMSO induced MEL cells with t globin gene expression. MEL cells were grown in the absence (MEL/without DMSO) or in the presence (MEL/DMSO) of 2% DMSO for 48 h. MEL cells grown with DMSO were incubated hours as indicated. RNA was isolated from these cells, reverse transcribed, and subjected to quantitative PCR using primers globin gene. Error bars reflect S.D. from two independent experiments.

PAGE 78

78 Figure 3 3 Calpeptin increase s the levels of USF but not its mRNA level. A) Western blot analysis of USF1, USF2, and glyceraldehyde 3 phosphate dehydrogenase (GAPDH) expression in MEL cells incubated with 30 M calpeptin for 0, 3, 5, or 7 days. Membranes were probed with antibodies sp ecific against USF1. Membranes were stripped and re probed with USF2 antibodies and then re probed with GAPDH antibodies. B) Reverse transcription PCR analysis of USF1 mRNA levels in MEL cells treated with 0.03% DMSO only or with 30 M calpeptin, 0.03% DMS O for 0, 3, 5, and 7 days. RNA was isolated from these cells, reverse transcribed, and subjected to quantitative PCR using prim ers specific for the USF1 gene. mRNA levels of USF1 actin gene. Error bars reflect S.D. from two in dependent experiments.

PAGE 79

79 Figure 3 4 Calpeptin increases globin gene expression and benzidine positive cells in MEL cells A) Reverse transcription globin primary transcripts and globin mRN A levels in MEL cells incubated for 7 days with 0.04% DMSO (DMSO 7d) or with 40 M calpeptin, 0.04% DMSO (calpeptin 7d). RNA was isolated from the cells, reverse transcribed, and ana lyzed by real time PCR. globin primary transcripts globin mRNA levels in untreated control cells (MEL) were set at 1, actin gene serving as an internal control. B) Benzidine staining of hemoglobin in MEL cells grown for 7 days in the absence (MEL), in the pres ence of 0.04% DMSO (DMSO), or in the presence of 40 M calpeptin, 0.04% DMSO (Calpeptin). C) Relative number of benzidine positive MEL cells in cultures incubated with DMSO only (0.03 or 0.04%) or incubated with 30 M calpeptin, 0.03%DMSO or 40 M calpepti n, 0.04% DMSO for 0, 3, 5, and 7 days. Error bars represent S.D. from two independent experiments. d, days A B C

PAGE 80

80 Figure 3 5 Calpeptin increases MEL cells. A) globin gene promo ter in MEL cells incubated for 0, 3, 5, and 7 days in the absence (NonTreated ), in the presence of 0 .04% DMSO (DMSO ), or in the presence of 40 M cal peptin, 0.04% DMSO (calp ). Cells were cross linked with formaldehyde. Chromatin was isolated, fragmented, and precipitated with antibodies against USF2 and Pol II or the unspecific IgG antibody. DNA was puri fied from the precipitate and analyzed by quantitative r globin gene promoter. Bars represent the relative enrichment over the input DNA. Error bars represent S.D. from two independent experiments. B) G rowth rate of MEL cells treated with 0.03% DMSO alo ne (DMSO) or with 30 M calpeptin 0.03% DMSO (calpeptin) for 0 7 days. The cell culture media w as diluted on day 2 and changed on day 3 and day 5. C) G rowth rate of MEL cells treated with 0.04% DMSO alone (DMSO) or with 40 M calpeptin 0.04% DMSO (calpeptin) for 0 7 days. The media was changed on day 3 and 5. D, day. Error bars represent S.D. from two independent experiments. d, days. 0.000 0.001 0.002 0.003 0.004 0.005 0.006 0.007 0.008 polII USF2 IgG Fraction of Input NonTreated DMSO day3 Calp day3 DMSO day5 Calp day5 DMSO day7 Calp day7 maj globin promoter 0 5 10 15 20 25 30 35 40 D0 D2 D3 D5 D7 Cell Density x10 5 /ml 0 10 20 30 40 50 60 D0 D3 D5 D7 Cell Density x10 5 /ml DMSO Calpeptin C A B

PAGE 81

81 Figure 3 6 Inhibition of calpain increases globin gene expression and Pol II interactions with the globin promoter and LCR HS2 in K562 cells. A) Relative increase in globin mRNA levels following treatment of K562 cells with 40 M calpain inhibitor calpeptin for 7 days. RNA was isolated, rever se transcribed, and subjected to quantitative PCR analysis using primers specific for the human and globin genes as well as the actin gene. The mRNA levels are shown as fold increase in cells treated with calpeptin relative to levels in untreat ed cells. B) ChIP analysis of USF and Pol II interactions with LCR element HS2 and the globin gene promoter in K562 cells grown in the presence (plus calpeptin) or absence (control) of calpeptin. Cells were subjected to ChIP analysis using antibodies spe cific for USF1 and RNA Pol II as indicated. Precipitated DNA was analyzed by quantitative PCR using primers specific for LCR element HS2 or the globin gene promoter. Error bars reflect S.D. from two independent experiments.

PAGE 82

82 Figure 3 7 Calpeptin incre ases expression of and maj globin genes in primary c Kit + /CD71 + erythroid progenitor cells. CD71 + /c Kit + cells were isolated from mouse bone marrow, enriched by fluorescence activated cell sorting, and incubated in the presence of 0.03% DMSO or in the presence of 30 M calpeptin, 0.03% DMSO for 4 days. RNA was isolated from the cells, reverse transcribed, and subjected to quantitative PCR using primers against actin, globin, and maj globin genes. A) and maj globin mRNA levels in primary erythro id cells in the absence (Control), in the presence of 0.03% DMSO, or in the presence of 30 M calpeptin, 0.03% DMSO. Expression was normalized to that of actin. B) mRNA levels of actin in cells incubated in the absence (DMSO control) or presence of cal peptin. Error bars reflect S.D. from two experiments using different cDNA preparations.

PAGE 83

83 Figure 3 8 globin gene promoter in MEL cells treated with DMSO or calpeptin MEL cells were incubated for 0, 3, 5, and 7 days in the absence (NonTreated), in the presence of 0.04% DMSO (DMSO), or in the presence of 40 M calpeptin 0.04% DMSO (calp). Cells were cross linked with formaldehyde. Chromatin was isolated, fragmented, and precipitated with antibodies against p45 or the unspecific IgG antibody. DNA was purified from the precipitate and analyze globin gene promoter. Bars represent the relative enrichment over the input DNA. Error bars represent S.D. from two independent experiments. 0.000 0.002 0.004 0.006 0.008 0.010 0.012 p45 IgG Fraction of Input NonTreated DMSO day3 Calp day3 DMSO day5 Calp day5 DMSO day7 Calp day7

PAGE 84

84 CHAPTER 4 CHARACTERIZATION OF TFII I LOCA LIZATION AND IDENTIFICATION OF TFII I ASSOCIATED PROTEINS IN ERYTHROID CELLS Introduction TFII I is a ubiquitously expressed transcription factor that ha s been shown to be involve d in multiple cellular function s including gene regulation, cell cycle progre ss ion control, calcium signaling, and immune response (42) It belongs to the basic leucine zipper helix loop helix (bLZHLH) protein family It has six direct reiterated I repe ats (R1 to R6), each containing an HLH motif but onl y one basic region (b) prec eding R2. The N termius of TFII I contains a leucine zipper (LZ ) and a nuclear localization signal (NLS) domain The structur e/ function analysis reveals tha t the first N terminal 90 amino acids containing the LZ and basic region are important for protein protein interactions (41) The TFII I gene is localized on chromosome 7 in humans. Alternative splicing during transcription of this gene generates the f our isoforms of TFII I (40) best characterized isoform of TFII I, containing 957 a mino a cids an additional 20 amino acids, which is encoded by exon A addition al 21 amino acids encoded by exon B and B. T he alpha isoform is absent in murine cells. The beta isoform is expressed at higher levels in murine cells compared to human cells T he gamma isoform is expressed at high levels in neuronal cells. These isoforms can form homodim ers or heterodimers, which lead to their preferential nuclear localization. In addition, the NLS deleted mutant of TFII expressed in the cytoplasm; however, when co expressed with other isoforms, this mutant is found to be localized in the nucleus (40) Each isoform has been demonstrated to have unique activities with regards to gene regulation (104) In serum sta rved cells, the beta isoform is associate d with the c fos promoter. After serum stimulation, the beta isoform is translocaed to

PAGE 85

85 the cytoplasm while the delta isoform is tyrosine phosphorylat ed, enters the nucleus, and replaces the beta isoform at the c fos promoter to activate transcription In 2006 it was reporte d that TFII I not only function s as a transcription factor in the nucleus but that it is also involved in signal transduction regulation by inhibiting calcium influx in the cytoplasm (27) In agonist induced calcium entry, phospholipase C gamma (PLC interacts with a voltage independent ion chann el, transient receptor potential channel 3 (TRPC3) which stimulates its cell surface expression and allow s calcium influx. The interaction is mediated by the binding of a PH domain in PLC li ke half domain in TRPC3. Btk mediated phosphorylation of TFII I allows TFII I to interact with PLC through its PH like domain in the R2 region. This interaction prevents the association of PLC TRPC3 and thereby inhibit s calcium entry (27) It is possible that TFII I also mediate s inhibition of calcium entry in erythroid cel ls. Barbara A. Miller has shown th at erythropoietin, an important hormone regulating proliferation and differentiation of erythroid cells, increases intracellular calcium concentration through TRPC3 expressed on the pri mary human erythroid progenitors (234) In addition, the expression of TRPC3 increases during differentiaton of hem a topoietic progenitors to proerythroblasts. The increased expression of TRPC3 is associated with its interaction with PLC (27, 242) which is reversed by over expressed TFII B lymphocytes (27) It has also been shown that HMBA induced MEL cell differentiation is accompanied by an increase in the intracellular Ca 2+ concentration measured by calcium dye, which is mediated by a voltage independent ion channel (87) Previous studies from our laboratory have d emonstrated that TFII I and USF regulate adult globin gene regulation antagonistically (51) Basically, TFII I and USF interact with the

PAGE 86

86 globin promoter a nd repress its expression in embryonic erythr oid cells while in adult cells USF1 and USF2 bin d to the + 60 E box and activate globin gene expression In addition, o ur previous studies showed that USF was subject to proteoly tic cleavage by the calcium dependent protease m calpain in undifferentiated MEL cells and was stabilized after cell differentiation (149) We also showed calpeptin a calpain inhibitor, activated globin gene express ion in erythroid cells in part by stab i lizing USF protein and increasing i ts activities. Since TFII I has been shown to play a role in the inhibition of calcium entry in the cytoplasm it was tempting to specula t e that in emb ryonic or undifferentiated erythro id cells, TFII I mainly remains in the nucleus and allows USF to be cleaved by calcium activated m calpain while in adult o r differentiated cells TFII I is localized in the cytoplasm and inhibit s calcium influx w hich then decreases the activity of m calpain and therefore increases the activity of USF and adult globin gene expression. Therefore, it was of interest to exam ine the localization of TFII I in erythroid cells before and after cell differentiati on Another approach to study the function of TFII I and USF during erythroid cell differentiation is by purifying and identifying proteins they interac with M ost cellular function s are carried out by proteins and the majority of proteins work by associating with other proteins cooperatively. Therefore, the function of a protein is usually dependent on the components of protein complex es with which it is associ ated (127) Because of this characteris tic functional studies of proteins based on protein sequence homology and their 3D structure s usually yield limited information (184) In th e post genom ic era, the a vailability of the public genomic sequence database of human or some animal models as well as the advancement in biological mass spectrometry techniques h ave enable d large scale studies of proteins by proteom ics Nowadays, proteomics encompasses most functional studies of proteins including large scale

PAGE 87

87 protein purification and protein complex identification in different cellular compartments or organelles (184) The development of a simple and efficient methodology to purify protein complexes is crucial for applying high thr oughput techniques to identify protein s in these complexes (54) The high affin ity of biotin/ strep t avidin make s it a very useful system for th e purpose of protein purification Biotin (vitamin H) is an essential co factor used as a mobile carboxyl carrier by metabol ic enzyme s for cellular functions required by all organisms (36) It is covalently attached to a protein by Biotin protein ligase (usually referr ed to as holocarboxylase sy n thetase). Biotin protein ligase activates biotin by ATP and produces biotinyl AM P intermediates which are then transferred to the amino group of a unique Lys residue on the biotin accepting enzyme (197) B iotinylation occurs naturally in al l organisms and the reaction occurs with extremely high specificity. In addition, the functional interaction between biotin ligase and its substrate is highly conserved throughout all the species (36) Therefore biotinylation of a specific protein containing the target sequence for the biotin protein ligase is suitable for a wide range of applications in different cellular systems The best characterized biotin protein ligase, BirA from E coli has been used widely in in vitro and in vivo biotinylation assays (reference) In this study, BirA mediated biotinylation of TFII I allowed efficient purification of TFII I protein complexes in K562 cells and identification of proteins that interact with TFII I in the cytoplasm Results The TFII referred to as TFII I in the following text) has been shown to mediate inhibition of calciu m influx in murine neuronal PC 12 cells (27) Previously we showed that inhibition of m calpain, which in vivo may be mediated by decreased availability of calcium, induces expression of the adult and globin genes in erythroid cells during erythroid

PAGE 88

88 differentiation This effect might in part be due to stabilization of full length USF We hypothesize d that over expression of TFII I in the cytoplasm may inhibit calcium influx, which presumably would lower intracellular calcium concentration and induce adult globin gene expression. To test this hypothesis a TFII I NLS deleted form (TFII was generated which was previously shown to be localize d only in the cytoplasm of P C 12 cells (27) In order to introduce the constructs into MEL cells efficiently, which is difficult to transfect the retroviral expression system was used to generate virus es encoding GFP, which serve as a control, GFP TFII I, or GFP TFII Two days after transduction the expression of proteins w as examined by immunoblott ing using GFP specific antibodies The W estern blot results clearly showed that the three proteins were expressed in MEL cells Each b and m igrated in a way reflecting the correct size of the expressed protein s with GFP a t around 27 kDa and two GFP/ TFII I fusion proteins at around 139 kDa ( Fig 4 1A). The lower band in the GFP TFII I lane was likely a contamination from the GFP lane. F luorescen ce microscopy analysis of these stable cell lines enriched by drug selection and fluorescence activated cell sorting ( FACS ) demonstrated that GFP was distributed evenly in the whole cell GFP TFII I w as expressed in both nucleus and cy toplasm, and GFP TFII expressed only in the cytoplasm (Fig 4 1B) Next, globin gene expression was examined in the thre e stab ly transfected MEL cell lines. Real time PCR (RT PCR) analysis of reverse transcribed total RNA using primers specific for primary transcrip ts of the globin gene and for mRNA of the globin gene revealed no difference of globin gene expression between cells expressing GFP TFII either those expressing GFP TFII I or GFP only (less than 2 fold change) (Fig 4 2) The stable cell lines were induced to differentiate in the presence of 1.5% DMS O or 0.5% DMSO for three

PAGE 89

89 days. The cellular localization of the three proteins was again determin ed by fluorescence microscopy. The location of the proteins was the same as wh at was observed in uninduced cells (Fig 4 3). S imilar results concerning globin gene expression were observed between the three stable MEL cell lines after induction The RT PCR experiment in the induced cells was performed only once (Fig 4 4) The same experiment s were repeated in K562 cells but again, there was not much difference in globin gene expression (data not shown). T he protein levels of USF in the three stably transduced K562 or MEL cell lines were examined but no noticea ble di fferences were found (data not shown). Next the localization of different endogenous isoforms of TFII I was examined during differentiation. I mmunofluorescence microscopy was performed using antibodies against TFII I endog enous TFII isoform was predominantly located in the nucleus with a little portion in the cytoplasm in either un induced or induced MEL cells (Fig. 4 5 ) Compared to the TFII a higher fraction of endogenous TFII was located in the cytoplasm but the majority was still in the nucleus before and after induction (data not shown). There was no noticea ble change of t he localization of both isoforms between MEL cells before and after differentiation. The localization pattern of these two isoforms in K562 cells was found to be similar to what was seen in MEL cells ( data not shown). To exclude that there might be changes that could not be observed by eyes; I repeated the experiment s and use d confoca l microscopy with z stacking setting and qua n titated the image by software There was no significant difference i n the localization of both isoforms in MEL cells before and after DMSO induction (data not shown).

PAGE 90

90 Next we sought to characterize TFII I and USF2 associated protein complexes in erythroid cells. The identification of TFII I and USF associated proteins is expected to shed light on the function of these proteins in erythroid cells This type of study is usually carried out by antibody mediated pull down. However, this r equires large amount of antibodies with high specificity and affinity In addition, for TFII I there are no c ommercial ly available antibodies that can differentiate different isoforms of TFII I F or USF2, the commercial antibodies are not suitable for immunoprecipitation We decided to take the advantage of the high specificity and affinity of biot in and streptavidin Efficient purification of a biotinylated protein and its complex es from mammalian cells has been achi e ved (54) The strategy is to co transfect a biotin ta gged protein with E coli biotin protein ligase BirA into cells. Only when BirA and a protein with the biotin tag are co expressed in the same cells can the biotinylation of the tagged protein occur. Then the biotin tagged protein complex es can be purified by streptavidin beads. T he eluted protein s are subsequently analyzed by mass s pectrometry for protein identification. DNA constructs that express TFII I and TFII proteins together with a bio tinylatable tag, a flag tag, and a TEV protease cleavage site were generated The expression vector also harbored cDNA encoding a HA and NLS tagged BirA (Fig 4 6). The biotin tag is only 18 amino acids in length, which minimizes interference with the struc ture of tagged protein In addition it has been tested to be biotinylated by BirA wit h efficiency higher than its natural substrate (10) There are no known naturally biotinylated proteins whose sequ ences are similar to this tag as shown by protein database searches (218) The i nitial attempt to introduce these constructs into MEL cells by lipid based transfection and to select for stable clones was not succes sful due to the low integration efficiency and low plasmid rete ntion rate of MEL cells. Either the expression of the biotinylated protein was quickly

PAGE 91

91 silenced during sele c tion or the positive clones were dominated by those carrying only resistant gene s. However, expression of the biotinylated TFII I by Western blot ting probed with flag antibody or streptavidin HRP was observed in transient transfection experiment s Therefore, BirA and tagged TFII was cloned into retroviral vectors with differe nt selection markers. The experimental plan was to obtain the stable clones ex pressing one protein first and then to transduce these clones with the other protein expression vector because the percentage of co transduction of the TFII I and BirA constructs into the same cells was very low However, this approach was not successful because of seve ral reasons: 1) expression of BirA was never detected by Western blot ting using HA antibodies in transduced MEL cells due to the use of antibodies that were no longer functional 2) Over expression of TFII I in MEL cells may be toxic to the cells because the positive clones disappeared in a few days of selection and c ould no longer be detected by Western blotting with flag antibody. Therefore, K562 cells were analyzed instead even though MEL cells would be a better system because they can be induced to differentiate and protein complex es before and after differentiation can be identified and compared K562 cells were transfected with the p lasmid s containing both BirA and tagg ed TFII I or TFII I cDNA using the Nucleofector transfection kit, which resulted in high transfectio n rate s and efficient inte gratio n of the plasmid into genomic DNA. T he BirA only plasmid was tr ansfected into K562 cells as a control. As shown in Wester n blot ting experiments with flag specific antibodies t he tagged TFII I (Fig 4 7 A) and TFII (data not shown) were successfully expressed in the stable K562 c lones transfected with plasmid s containing both BirA and TFII I or TFII in cells transf ected with the BirA expressing construct only (Fig 4 7 A ) The TFII I specific band migrated higher than 110 kDa, which is the molecular

PAGE 92

92 weight of untagged TFII I suggesting that tagged TFII I was biotinylated The Western blot probed with streptavidin HRP further comfirm ed that the expressed flag tagged TFII I proteins were biotinylated (Fig 4 7 B). The lower two bands that also appeared in the BirA transfected cells were naturally biotinylated proteins, because they were also detected by streptavidin HRP in the cell extract s from the untransfected K562 cells (Fig 4 7 B) Fin ally t he HA antibodies detected the expression of BirA in K562 cells transfected with BirA only and TFII I construct s (Fig 4 7 C). The cellular localization of the TFII I proteins was analyzed by immunofluorescence TFII I was localized both in the nucleus and in the cytoplasm similar to what wa s observed for the endogenous TFII I TFII BirA was evenly distributed in the whole cells (Fig 4 8 ). N ext the cytoplasmi c proteins from K562 cells expressing tagged TFII the nuclear proteins from K562 cells expressing tagged TFII I as w ell as proteins from the BirA only expressing cells were extracted and the same amount of proteins were used in streptavidin beads pull down assay s Eluted proteins from the beads after wash ing and the unbound proteins were loaded twice on SDS PAGE gel s Half of t he g el s were then stained with coomassie blue and half were transferred for Western blotting experiments The western blotting experiments were carried out w ith flag antibodies and showed that most tagged proteins were efficiently pulled down by the beads while a little portion remained in the unbound fraction ; again the tagged TFII I were not present in lanes showing proteins from Bi rA only cells (Fig 4 9 A, TFII I: data not shown) The streptavidin HRP stain ing confirmed the biotinylation of TFII showed that most naturally biotinylated proteins wer e also pulled down since there wa s almost n o band in the unbound lanes (Fig 4 9 B) Although the protein bands from the pull down were quite faint, in some regions there were clearly differences between the BirA and the TFII

PAGE 93

93 lanes (Fig 4 10 A ) In addition, a darker band migrat ing at around the size of tagged TF II I could be observed and it was not found in the lane representing proteins from BirA only cells Therefore, this band was cut o ut, subjected to trypsin digestion and analyzed by MS. Indeed, the MS results confi rmed that this protein c orresponds to TFII I protein ( 29% sequence coverage ) For cells transfected with TFII I constructs the lower darker band was also cut off and confirmed to be TFII I (Fig 4 10 B) Although the differences between the BirA and TFII I lanes were not pronounced there were differences between the lanes corresponding to proteins purified from tagged TFII I cells compared to those purified from BirA only cells. We compared the gel patterns and cut out segments of the gel where there were differences between BirA control and TFII NLS lanes The gel pieces were processed and analyzed by liquid chromatography ta ndem mass spectrometry (LC MS /MS ) We have obtained MS results for proteins that co elut ed with the cytoplasmic TFII I These proteins are listed in Table 4 1. Most of background proteins were i so forms of Acetyl CoA carboxylase, which is a protein known to be naturally biotinylated ATP depe n dent RNA helicase, and ribosomal proteins. shock protein 70 (Hsp 70), which have been re po rted in the literatures to be involved in erythropoiesis. Interestingly, we also identify a transcription factor, myocardine like 2 (MKL 2) whose function has been implicated in GTPase induced actin assembly as a co activator of s erum response factor (SRF) It is mostly localized in the cytoplasm where it binds to actins and upon serum stimulation it is rapidly translocated into the nucleus (220) Whether th ese proteins really interact with TFII I in the cells and what their biological functions are need further experiment ation. N evertheless, our results so far showed that this biotinylation and streptav idin single step purification of protein complex es is feasible and yields important information.

PAGE 94

94 Since overexpression of USF is known to cause MEL cell differentiation and the preliminary data suggest that overexpression of TFII I reduces the survival capacity of MEL cells an inducible system for the expression of biotinylated proteins was developed. The TetOff advanced inducible system was initially developed by Gossen et al. (91) and is available from C lontech This system includ e s several expression vectors in which multiple cloning sites (MCS) follow the cytomegalovirus (CMV) promoter containin g a prokaryotic tet operon who se expression is under the tight regulation of the tTet trans cription f a c tor The binding of tTet trans activator to the tet operon is abolished in the presence of doxycyclin. Two vector s were employed pTRE Tight BI (pTRE BI for brief in the following text) and pTRE Dual2, to express biotin tagged proteins and BirA protein ligase at the same time pTR E BI contains two MCSs (M C S I and M C S II) flanking the promoter and allows bidirectional expression. pTRE Dual2 contains a n mCherry fluorescence marker followed by an internal ribosome entry site (IRES) A MC S follows the IRES enabling co expression of mCherry pr oteins and the ligated protein s HA tagged BirA was cloned into the MCS follow ing the IRES (IRES BirA) in pTER duals and sequences includin g mCherry and IRES BirA were ligated in to the M C S II of pTRE BI. The cDNAs encoding N terminal and C terminal flag TEV biotin tagged TFII I or TFII flag TEV biotin tagged USF2 were cloned into M C S I (Fig 4 11). T his strategy allows both BirA and the tagged gene of interests to be expressed at the same time. Furthermore, their expression can be monitored by the expression of mCherry, which could accelerate the selection process for positive clones I n addition, the p Tet vector contain s a green fluorescence marker following the tTet coding sequence Therefore, after transfection, green cells expressing tTet transactivator s can be enriched by FACS and these cells are then transfe cted with the pTRE BI vector containing both mCherry BirA and cDNAs for the tagged proteins growing in doxycyclin

PAGE 95

95 containing med ia. After removing doxycyclin the cells expressing bot h constructs will be yellow and these cells can be sorted quickly by FACS Gene expression in the sorted cells can be shut off again by growing the cells in media containing doxycyclin An additional advantage of this system is that the intensity of gene expression can be regulated as needed by adjusting the concentration of doxycyclin It is important to note that N terminal TFII I is known to be involved in pr otein protein interactions T herefore a C terminal tagged TFII I was included in th e se experiments ; e ven though the tag is not very long and presumably will not interfere with protein protein inte raction s Discussion Previously we showed that USF was subject to proteolytic cleavage by m calpain in undifferentiated MEL cells and was stabilized after cell differentiation In addition, the inhibition of m calpain by calpeptin led to activation of adu globin gene expression in erythroid cells in part by stab i lizing USF protein and increasing its activities (149) TFII I has been shown to play a role in th e inhibition of calcium entry in the cytoplasm (27) Therefore, based on our previous work a hypothesis was formulated We proposed that TFII I relocate s to the cyt oplasm and inhibit s calcium influx during differentiation of erythroid cells which stabilize s USF by the inhibition of m calpain and therefore increases adult globin gene expression To prove this hypothesis, we examined the localization of either endogenous TFII I or over expressed GFP TFII I fusion protein s in erythroid cells during differentiation However, a significant change in the intracellular localization of TFII I during erythroid differentiation was not observed. There was also no significant change observed in USF protein levels and in the primary transcript levels of the and globin gene s between cells over expressing TFII expressing TFII I in either K562 or MEL cells before or af ter DMSO induction

PAGE 96

96 It appears that our results so far did not support the initi al hypothesis It is possible that reduced calcium entry mediated by over express ion of TFII I in the cytopla s m could not directly inhibit m calpain thus did not stabilize USF and in crease globin gene expression Furthermore the e ndogenous TFI I I could still be involved in repress ing globin gene expression Finally, it is possible that the exogenously expressed TFII I was not phosphorylated and did not interact with PLC In this respect it is interesting to note that we did not detect PLC as a TFII I interacting protein in K562 cells after biotin/streptavidin pull down. Signal transduction pathways are very complex processes and involve many often parallel pathways within the cell. It is perhaps not surprising that simply over expressing TFII I in the cytoplasm would by itself not alter USF stability and globin gene expression. Similarities between differentiatin g B lympho id and er ythroid cells with regard to changes in calcium concentration are striking. However, wh a t is true for the differentiation of B cells must not be true for the differentiation of erythroid cells and TFII I may play a very different role in these two systems As mentioned before the experiments conducted so far were based on our previous findings that inhibition of m calpain by globin gene in part by increasing the activity of USF. Here we assumed that inhibition of m calpain by calpeptin equals to the effect of decreas e d intacellular calcium concentration on m calpain during maturation of erythroid cells The data shown in this chapter would suggest otherwise. However, it should be mentioned that we did not analyze changes in intracellular calcium concentration and we therefore can not make any assumptions about whether overexpression of TFII I in the cytoplasm changed intracellular calcium levels. It is possible that TFII I has multiple functions in the cytoplasm in addition to inhibition of calcium influx. In this study we utilized biotinylation and streptavidin mediated pull down

PAGE 97

97 coupl ed to mass spectrometry analysis to efficiently purify and identify TFII I associated proteins in the cytoplasm. Our results showed that biotinylation of tagged TFII I in vivo by BirA protein ligase was ver y efficient and that the streptavidin mediated pull down enriched proteins associated with TFII I Using liquid chromatography ( LC ) Orbit rap mass spectrometry, proteins in nanogram scale could be identified. Among the proteins identified, NF have been reported to be involved in erythropoiesis. It has been shown that several NF progenitors, BFU E (burst forming unit erythroid) at high levels and may be involv ed in the repression of erythroid specific genes, such as NF E2 (153, 265) Later during differentiation, their levels diminish and as a consequence the NF E2 levels increase contributing to the activation erythroid specific genes (153) Thus the potental interaction between NF and TFII I is interesting because both proteins are implicated in the negative regulation of erythroid specific genes. Therefore our findings here may help to elucidate the mechanisms by which the se proteins repress globin gene expression. Hsp70 is a chaperon which has been shown to protect GATA 1 from proteolytic degradation mediated by caspase during erythroid terminal dif ferentiation (202) How interactions of TFII I with Hsp70 relate to their function in erythropoiesis need to be further addressed. F uture experiments, such as co immunoprecipitation (co IP) should be perform ed to confirm the interaction s between TFII I and the two proteins. This should be followed by functional studies addressing the relationship between TFII I and these proteins

PAGE 98

98 Figure 4 1 Expression and localization analysis of GFP, GFP TFII I, and GFP TFII I overexpressed in MEL cells A) We stern blot analysis of whole cell extract s from MEL cell lines over expressing GFP, GFP TFII I, and GFP TFII I. Blot was probed wi th GFP antibodies B) Fluorescence microscopy pictures of stable MEL cell lines over expressing GFP, GFP TFII I, and GFP TF II I protein (from left to right). The top panels show GFP fluorescence image only and the bottom show overlay of GFP and nuclear DAPI staining image Cells were loaded on the slide and examined under fluorescence microscope. Lane 1 2 3 4 139 kDa 27 kDa 1: Un transduced 2: GFP 3: GFP TFII I 4: GFP TFII I NLS A B

PAGE 99

99 Figure 4 2 Real time PCR globin transcripts in MEL cells overexpressing GFP, GFP TFII I, or GFP TFII Total RNA from MEL cells was isolated, reverse transcribed, and subjected to quantitative PCR analysis using primers specific globin pr imary transcripts and globin mRNA as well as the GAPDH mRNA GAPDH served as an internal control. Error bars reflect S.D. from two independent experiments. 0.00 0.10 0.20 0.30 0.40 0.50 0.60 maj globin Normalized to GAPDH WT GFP GFP-TFII-I GFP TFII I NLS

PAGE 100

100 Figure 4 3 Localization analysis of GFP, GFP TFII I and GFP TFII cells induced with 1.5% (top panel) and 0.5% DMSO (bottom panel) Cells were loaded on the slide and cell p ictures were taken by fluorescence microscopy Green shows GFP and blue represents Dapi mediated staining of the nucleus The p ictures shown are overlay s of GFP and Dapi images

PAGE 101

101 Figure 4 4 Real globin transcripts in MEL cells overexpressing GFP, GFP TFII I, and GFP TFII NLS RNA was isolated, reverse transcribed, and globin primary transcripts and globin mRNA as well as the actin mRNA. actin served as an internal control. These experiments have been performed only once but similar data were obtained from induced MEL cells and from K562 cells. 0 50 100 150 200 250 globin/ actin 1.5%G 1.5%GT 1.5%dNLS 0.5%G 0.5%GT 0.5%dNLS globin 0 2 4 6 8 10 12 14 16 18 primary transcripts of maj globin/ actin 1.5%G 1.5%GT 1.5%dNLS 0.5%G 0.5%GT 0.5%dNLS maj globin

PAGE 102

102 Figure 4 5 L ocalization analysis of endogenous TFII isoform by immunofluorescence microscopy Cells were fixed, perme ablized, and incubat ed with primary antibodies specific f or this isoform and then with secondary antibodies conj u gated with FITC (green). Nuclei were counterst ained with Dapi (blue). Pictures were shown as overlay s of the FITC and Dapi stained images. A) Left panel: uni n duced MEL cells. Right panel: DMSO Induced MEL cells. B) K562 cells. A B

PAGE 103

103 Figure 4 6 S chematic diagram showing constructs e xpressing biotin TEV flag tagged TFII I TFII and HA BirA A) N terminal tagged TFII I and TFII terminal tagged TFII I and TFII BirA.

PAGE 104

104 Figure 4 7 Expression of b iotinylated flag TEV biotin tagged TFII I and HA tagged BirA in stably t ransfected K562 cells. Whole cell extracts from flag TEV biotin tagged TFII I or HA tagged BirA only stably transfected K562 cells were subjected to Western blotting and probed with antibodies as indicated. A) Expression o f tagged TFII I was detected in TFII I lane using antibodies against flag tag. B) Biotinylation of flag tagged TFII I was confirmed using streptavidin HRP.Natually biotinylated proteins (the lower two bands) were detected in both TFII I and BirA lanes and in lane s loaded with wild type K562 cell extracts. C) Expression of BirA was detected using antibodies specific for the HA tag in both TFII I and BirA lanes. A B C HA ab

PAGE 105

105 Figure 4 8 Localization of flag TEV biotin tagged TFII I and TFII LS and HA BirA in transfected K562 cells. Immunofluoresence was performed as described in Fig. 4.1 and pictures were taken with a Leica fluorescence microscope The flag TEV biotin tagged TFII I and TFII stably transfected K562 cells were probed with primary antibodies against flag tag. The HA BirA stably transfected K562 cells were probed with primary antibodies against HA. TR conjugated secondar y antibodies were used to detect the primary antibodies The left panel shows TR fluorescence image s only and the right panel showed the overlay image s of TR and nuclear stained Dapi images. TFII I TFII I NLS BirA

PAGE 106

106 Figure 4 9 Efficiency of tagged TFII g to the streptavidin beads. A) B iotinylated flag tagged TFII I was pulled down using streptavidin beads (bound) and compared to unbound TFII I lane (unbound) in Western blot ting exp eriments probed with flag antibodies. B) Biotinylated TFII I and naturally biotinylated proteins were efficiently pulled down by streptavidin beads and compared to unbound material as detected by streptavidin HRP. Western blot ting analysis of eluted proteins (bound) and supernatant (unbound) after streptavidin beads pull down assay Protein extracts from the cytoplasmic fraction of K562 cells over expressing tagged TFII I and BirA were incuba ted with streptavidin beads. Beads elution and supernatant were loaded onto SDS PAGE gel and transferred to a membrane. The membrane was probed with flag antibodies to detect tagged TFII The same membrane was stripped and re probed with streptav idin HRP to detect biotinylated TFII A B

PAGE 107

107 Figure 4 10 Coomassie stained gel pictures of streptavidin pull down assay. A) Streptavidin beads elution (Pull down) and supernatant after binding of t he cytoplasmi c protein extracts from K562 c ells expressing tagged TFII NLS ( and BirA) or expressing BirA only B) Streptavidin beads elution (Pull down) and supernatant after binding of n uclear extracts from K562 cells expressing flag TEV biotin tagged TFII I (and Bi rA) or expressing BirA only B eads elution and supernatant were run on SDS PAGE gel s Gels were stained with coomassie and destained with ddH 2 O. G el picture s were taken using a T ypoon imager. The bands of TFII TFII I (B) are indicated by arrows. B A 250 150 100 75 50 37 25 kDa

PAGE 108

108 Genes identified only in TFII Remarks Transcription factor involved in erythropoiesis Hsp 70 Heat shock chaperone protein involved in erythropoiesis Hsp 90 Heat shock chaperon protein MKL/myocardin like 2 Serum response factor ( SRF ) coactivator Elongation factor 2 Histon H1.3 Guanine binding protein Emerin Nuclear envelop e protein GAPDH House keeping gene ATP dependent RNA helicase A Putative uncharacterized protein, ZFR Ribosomal protei ns Table 4 1 List of proteins identified by mass stectrometry after co elut ed with TFII these proteins were not present in the eluted material from BirA only control cells

PAGE 109

109 Figure 4 11 S chematic diagram of TetOff advanced inducible system and cloning st rategy for co expression of BirA and tagged genes of interests. The TetOff advanced indu cible system is the product of C lontech which comprises tTA transactivator vector (top left panel) and pTRE expression vectors (middle right and bottom). BirA was first clone d into MCS of pTRE Dual2 and the sequences containing mCherry IRES BirA pA were then cloned into the MCS on the right of pTRE Tight BI. Protein expression constructs were cloned in to the MCS on the lef t of pTRE Tight BI. Lastly, pTet Off vector ( middle left) and the final constructs containg both BirA and the gene s of interest can be transfected into cells and yellow cells expressing both tTet and mCherry BirA and protein of interests can be FACS sorted in the absence of doxycycline. Pictures of Tet Off advanced vectors and luciferase assays were composed from the online commercial advertisement of clontech website: http://www. clontech.com/products/detail.asp?product_family_id=1419&product_gro up_id=1446&product_id=219069 and http://www.clontech.com/products/detail.asp?product_id=216244&tabno=2 (The content of these websites may change due to the update from the company).

PAGE 110

110 CHAPTER 5 CONCLUSIONS AND FUTU RE DIRECTIONS The Role of C globin Gene Regulation Research globin gene expression is mainly regulated by the interaction of transcription factors with the LCR and with gene proximal cis elements. Much effort has been made to characterize the regulatory elements and their bound trans acting factors. However, the interaction of the trans and cis element in the cell is highly dynamic and the trans acting factors are subject to various post transcriptional modificati ons and protease processing. Little is know n about how these transcription factors are regulated at the protein level. In Chapter three, we demonstrated that the ubiquitous ly expressed transcription factor globin gene expression at the adult stage, was subject to proteolytic cleavage by the calcium dependent protease m calpain in u ndifferentiated MEL cells and was stabilized after MEL cell differentiation. W e also showed that treatment of erythroid cells with calpeptin, a synthetic calpain inhibitor, led to increased full length USF and adult globin gene expression and consequently accumulation of hemoglobin Therefore we conclude that inhibition of calp ain, by calpeptin or presumably by reduced intracellular calcium concentration during maturation o globin gene expression in part by increasing USF activity. As it is shown that calpain also cleaves other transcription factors, such as NF Y (CP 1) c Fos/c Jun (AP 1) and c Myc (251) it is possible that the activity of calpain which is regulated by calcium concentration and the presence of calpastatin in vivo may be a key regulator for the activities of other transc ription factors involved in erythroid differentiation. Future experiments will be aimed at characterizing the specific mechanisms are involved in calpain mediate d regulation of transcription factor activity during erythroid differentiation

PAGE 111

111 Examining globin gene expression and the activities of transcription factors before and after i nhibition of calpain by over expression of its endogenous specific inhibitor calpastatin will clarify the specific functions of calpain s. This will be superior to using calpeptin which in addition to calpains affects the function of other proteins as well. A high throughput approach for identif ying transcription factors that are subject to calpain processing during erythroid differentiation in a single experiment is iTRAQ (isobaric tag for relative and absolute quantitation) comparison proteomics technology. TFII I Mediated Calcium Influx Inhibition It has been known that calcium signaling pathways regulate the function of transcription factors (186) T he activity of USF, which perhaps is regulated by calcium dependent protease s during erythroid differentiation could be one specific example (1 49) The recent discovery that transcription factor TFII I mediates agonist induced calcium influx inhibition discloses a new way how TFII I regulates cell physiology and development, maybe by regulating the activities of other transcription factors through calcium signaling (186) We hypothesized tha t over expression of TFII I in the cytoplasm may inhibit calcium influx and reduce intracellular calcium concentration and thereby stabilizing USF and increas ing globin gene expression A lthough our data so far did not support these hypotheses, we can not conclude anything at this moment. It would be important to monitor calcium concentration s in erythroid cells overex pressing the TFII I NLS delete d form during erythroid differentiation This experiment could be done in erythroid cells in which the endogenous TFII I is depleted by RNA interference The next step would be to examine the effect of chan ges in intracellular calcium concentration on the activity of calpains an d on calpain mediated changes in protein structure and abundanc e by iTRAQ analysis.

PAGE 112

112 Efficient Identification of Transcription C omplex es by In V ivo B iotinylation Streptavidin Pull D own and Mass S pectrometry It was demonstrated here that by in vivo biotinylation, streptavidin pull down and mass spectrometry the tagged protein complexes can be identified. The interaction between TFII I and the identified proteins have to be confirmed by Co IP experiments and should be followed by functional studies examining the relationship between TFII I and the identified proteins in the r egulation of erythroid specific genes In the course of these experiments it was discovered that the co expression of BirA and tagged protein is cru c ial for efficient in vivo biotinylation. Therefore an inducible fluorescence expression vector system was designed allowing co expression of BirA and tagged protein s in the same cell at the same time. The transfected cells can be enriched by FACS and the expression of the construct s can be adjusted as desired. The extraction of proteins from the gel for MS analysis is not optimal because some proteins may not be present in the gel or may be missed du e to other technical limitations. Therefore, another procedure called on beads trypsin digestion after beads pull down can be employed Th is method can be wi dely applied to any transcri ption factor of interest Another limitation of the streptavidin mediated enrichment of protein complexes is based on the fact that there are quite a few endogenously biotinylated proteins that increase the background in these studies. To solve this problem, a t a nd e m purification procedure us ing flag col um n purification follow ed by streptavidin pull down and TEV protease digestion will allow for the purification of proteins that are specifically associated with the t agged protein In vivo biotinylation by overexpressing tagged protein s in the cells is quite artificial because overexpressed protein s may cause change s in cellular function, which may affect the composition of protein complexes It would therefore be ideal to introduce the tag into the endogenous transcription factor ge ne by homologous recombination in murine ES cells. This

PAGE 113

113 would allow the generation of transgenic mice and the analysis of protein complexes in primary cells during cellular differentiation. Summation Both USF and TFII I are ubiquitously expressed basic le ucine zipper helix loop helix proteins and have versatile functions in gene regulation, cell differentiation and develpment and cel l cycle Therefore, to elucidate their function in a complete way requires multiple angle approach es. In this stud y it was discussed how transcription factor TFII I could regulate intracellular calcium concentration, which then regulates the activity of other transcription factors, such as USF, through the calcium dependent protease, calpain. Because calcium signali ng pathways are multifaceted, the experiments have to be carefully designed to specifically target each of the regulators one by one in the pathway in order to reveal the real consequences for correct interpretation and inference. Newly develo ped state of the art high throu ghp ut systems allow researchers to grasp most information about a biological system Here experiments were suggested that directly target calpai n with higher specificity and at the same time provide the complete profile of the prote ome that may change in response to the inactivation of calpain It is also discussed how protein biotinylation approaches can be improved to more efficiently identify protein interaction partners. These approaches will not only promote the understanding of protein function but will also contrib ute to the identification of protein networks that are the basis for changes in gene expression patterns during cellular differentiation.

PAGE 114

114 APPENDIX THE EFFECT OF TOPOIS OMERASE I INHIBITION GLOBIN GENE LOCUS The origin of the project Th is project was originally initiated by a pre vious post doc toral fellow in the laboratory who was working on topoisomerase I after she left the lab and wanted to collaborate with my globin locus by using drug camptothecin to inhibit topoisomerase I and thereby to disrupt the intergenic transcripts were proven to be unfeasible and too problematic. Therefore, this project was stopped but the data is documented here and hopefully would provide some useful inf ormation for future research focusing on the function of topoisomerase I ( Topo I ) itself. Introduction Hemoglobin switching and chromatin subdomains thalassemia an d hereditary persistence of fetal hemoglobin (HPFH) (78) thalassemia suffer sever e a globin gene expression. HPFH globin gene expression. This naturally occurring phenotype provides a potential therapeutic hemoglobinopathies. Understanding the molecular mechanisms of globin gene switching is expected to impact future therapies. It is known that the activation and high level expr ession of all the globin genes are dependent on the LCR (97) ; however, how they are activated and suppressed at specific developmental stages is unclear. Results accumulated over the last twenty years indicate that at least two non exclusive mechanisms appear to be responsible. One is the interaction o f stage specific transcription factors, such as EKLF, with the cis elements of globin gene promoters resulting in activation of

PAGE 115

115 one gene and repression of the other genes. The other is the competition for interactions with the globi n gene promoters, in which distance plays a critical role (61, 221) Recent findings of intergenic transcription patterns and epigenetic profiles that change during er ythropoiesis and development reveal another regulatory mechanism that may operate in globin locus is not in a uniform chromatin configuration; rather it is divided into thr ee differentially activated and developmentally regulated sub delineated by higher levels of intergenic transcription in G1 transcription initiation region, a 2.5 kb m inimal region of difference between the deletion forms thalassemia (25) causes cessation of intergenic transcription and loss of general sensitivity to DNase I globin gene expression in adult erythrocytes. In 2007, Miles et al. (169) analyzed intergenic transcription by RT PCR at high resolution and found similar results; in addition, the active histone modification primarily to histone 3 (H3) in the locus highly c orrelates with intergenic transcription patterns in transgenic mice as well as in human adult erythroid precursor cells (FigureA 1). globin locus showed that a number of no n coding transcripts originate from the LTR in the ORG globin locus. This long non coding transcript is only detectable in S phase, in contrast to intergenic transcripts associated with the globin gene locus, which are discontinuous and are generated mainly during G globin is receptor region (ORG) cluster region. These results strongly suggest that developmentally regulated intergenic

PAGE 116

116 transcription may alter the chromatin structure into a stable remodeled state for the activation of genes presumably by propagating active histon e markers during specific cell cycle stages. However, whether the low level long range transcription in S phase also plays a role in chromatin alteration needs to be further examined. Topoisomerase I DNA topoisomerases are enzymes that catalyze the brea king and rejoining of the DNA backbone by transesterification (154) In the transient strand breakage reaction, a tyrosyl oxygen of the enzyme attacks a DNA phosphorus, forming a covalent phosphotyrosine link with DNA, a covalent enzyme DNA intermediate, and breaking a DN A phosphodiester bond at the same time. Rejoining of the DNA strand is achieved by the reversal of the first reaction the oxygen of the DNA hydroxyl group generated in the first reaction attacks the phosphorus of the phosphotyrosine link, breaking the cova lent bond between the protein and DNA and reforming of the DNA backbone bond (248) This simple reaction solves the essential topological problems arising during replication, transcription, recombination, and other processes involving DNA. Topoisomerases play a role in all aspects of chromosome structure alterations, from nucleosome assembly and disassembly, to chro mosome condensation and segregation (176) DNA topoisomerases can be classified into two types: the type I enzymes break one strand of the DNA at a time and the type II both strands of a DNA double helix in concert. The two types can be further divided into four sub families: IA, IB, IIA, and IIB (Table A 1) (248) The structure and enzyme mechanisms in the same subfamily are s imilar but distinct in different subfamilies. Genomic sequences searches show that all organisms have at least one type IA and one type II topoisomerase. For yeast, only type II is required for viability; however, for multicellular organisms, different dem ands during developmental stages and in different tissues tend to increase the number of different DNA topoisomerases. Gene ablation studies in which

PAGE 117

117 several of the six known mouse DNA topoisomerases have been deleted shows that none of those enzymes is di spensable. Indeed, studies in which the Topo I or Topo I I encoding genes were mutated or deleted have led to the conclusion that although DNA topoisomerases are functionally redundant, each of them appears optimized to carry out its own particular set of t opological manipulations that have to be finely tuned for proper cellular function (35) Eukaryotic DNA topoisomerase I ( Topo I ) is one of the most studied topoisomerases. It consists of 765 amino acids with a molecular weight around 91 kDa (132) Topo I belongs to the type IB subfamily. When this subfamily enzyme catalyzes the transient cleavage react OH of the DNA is the leaving group and the active site tyrosyl becomes covalently linked to a phosphoryl group, which is different from the other subfamilies. Therefore, only the side of the DNA double helix that is upstream of the nick is tig htly bound to the enzyme; the side of the double strand DNA downstream of the nick is mostly ionic interaction with the enzyme, so the double strand of the nicked DNA are allowed to rotate relative to each other thereby releasing torsional stress (248) By this mechanism, Topo I is able to relax both positive and negative supercoils. Early studies have shown that Topo I is involved in transcription regulation in living cells. In Drosophila, Topo I has been shown to be preferentially associated with the actively transcribed genes by RNA polymerase (Pol) I and II (77) Inhibition of Pol I and II was observed when a Topo I specific antibodies was microinjected into the nuclei of Chironomus tentans salivary gland cells and the inhibition pattern suggested the involvement of Topo I during tra nscription elongation (68) Inactivation of both Topo I and Topo I I in a double mutant yeast strain inhibited the transcription from all rRNA loci and a fraction of mRNA coding loci (22) Inhibition of Topo I activity by camptothecin (Cpt) resul ted in sever inhibition of the 45S rRNA

PAGE 118

118 (264) It is believed that topoisomerases participate in transcription regulation by releasing the torsional stress generated during transcription elongation. The transcription bubble of unpaired bases tracking along the double strand DNA helix transiently introduces superhelical tension in the DNA. This tension can easily be resolved by the rotation of the nake d linear DNA in in vitro transcription systems therefore there is no need of topoisomerase activity. However, in eukaryotes, DNA is packaged into a nucleosome containing structure called chromatin which prevents the resolution of the superhelical tension g enerated during transcription. If the transcription apparatus cannot rotate around the helical axis of the DNA, maybe because of coupling between transcription and translation in the nucleus (112) or because of the presence of a stable protein mediated enhancer/promoter complex involved in RNA pol II transcription activation, there will be positive and negative supercoils accumulate in front and behind the transcription mac hinery, respectively, which will inhibit elongation. This model has been proven to be true. In vitro transcription experiments on chromatin assembled templates have shown that transcription is repressed on chromatin template and topoisomerases that can rel ax both positive and negative supercoils are able to stimulate transcription (174) Further experiments showed that it is the accumulation of positive supercoiling tension during elongation stabilized by nucle osomes that represses transcription since transcripts of 100 nucleotides or shorter were unaffected by the nucleosomes, whereas templates of 200 nucleotides or longer were repressed by chromatin and removal of nucleosomes recover productive transcription. (174) More recent studies show the various roles that Topo I plays in regulating transcription. Di Mauro et al. (59) reported th at Topo I controls the kinetics of promoter activation of the ADH2

PAGE 119

119 gene by mediating the topological state shift, from negative supercoiling to relaxed form, in response specifically to ethanol induction in yeast. In addition, this activity cannot be subst ituted for by E. coli topoisomerase I, which relaxes negative supercoils, or yeast topoisomerase II, suggesting this regulation is not mediated by the cleavage reaction alone but may require the interaction of Topo I specific factors. Analysis of transcrip tion and topology of several genes in response to the Topo i nhibitors camptothecin (Cpt, Topo I ), and/or adriamycin ( Topo I I), revealed alterations in gene expression, changes of chromatin conformation around the promoter by inhibition of Topo I I, and enha nced promoter clearance and downstream stalling of elongation complexes by inhibition of Topo I (47) The results imply that Topo I and Topo I I play different roles during the process of transcription. A recent exp eriment has shown that inhibition of Topo I by Cpt leads to enhanced transcription elongation, which can be reversed by the elongation inhibitor 5,6 dichloro 1 D ribofuranosylbenzimidazole ( DRB ) (121) This report also showed that the observations of inhibition of Topo I mediated changes in transcription is an earlier event before the cellular response to DNA damage caused by collision of the replication machinery with trapped DNA Cpt Topo I complex. Aside fr om its role in modulating DNA topology, Topo I can act as a transcriptional co activator by interacting directly with activators and general transcription factors through its N terminal region. In the absent of activators, Topo I represses basal transcript ion in vitro This co regulator function of Topo I is in part due to its ability to stabilize the formation of the TFIID TFIIA complex on the TATA box and not related to its DNA relaxation activity (232) Project Goal s and Experimental Plan s globin genes correlates to developmentally regula ted chromatin sub domains within the locus These domains can be precisely delineated by

PAGE 120

120 differential sensitivity to DNase I, active histone modifications primarily at histone H3, and cell cycle dependent intergenic transcript ion High sensitivity to DNase I and active histone modifications of chromatin are both hallmarks of accessible chromatin. However, the role of intergenic transcription is unclear. The high correlation between active histone markers and higher level of intergenic transcription occurrin g in non S phase cells lea d to the hypothesize that intergenic transcription may play a role in propagating active histone markers and therefore alter the chromatin structure at different cell cycle stage s to favor gene expression at specific developmental stage s To study the function of intergenic transcription in globin locus in vivo is difficult. Experiments such as using transcription terminator inserted between HS2 enhancer and a downstream promoter, replacing HS2 with a strong promoter, or deleting the intergenic transcription initiation site to elicit the function of intergenic transcription have been done (150, 246) However, the repression of the globin ge nes in these experiments may either due to the alteration of the cis acting elements or due to the competition of a foreign promoter with globin genes. Furthermore, these methods can only a ddress the role of intergenic transcription in the region that ha s been modified. Since Topo I has been shown to preferentially associate with actively transcribed genes and regulate transcription particularly at the elongation step, inhibiting Topo I activity by Cpt in the globin locus is anticipated to interfere wit h intergenic transcription and the consequences are likely to shed light on globin gene regulation. However, it should be k ept in m ind that inhibition of Topo I would cause a global effect in the cell The greatest concern for this system is that Cpt t rapped Topo I cleavable complex will cause DNA single strand or double strand breaks by collision with elongating Pol II or replicating fork if the incubation time with the drug is too long. Several adjustments can be done

PAGE 121

121 to reduce or bypass these problem s in the system we are examining. Varying the dose and incubation time to determine conditions that would prevent DNA damage but still can effectively inhibit Top o I and Pol II on the DNA template is the simplest way since the Cpt Top I cleavable complex i s highly reversible and it has been shown that the effect of Cpt on transcription is very rapid. By incubating Cpt with synchronized cells passing the replication timing of globin locus is one way to bypass the double strand break problem, assuming the d ouble strand break effect in other genomic loci will not immediately affect the regulation of the globin gene locus. Another concern is that it is very difficult to find an internal control for quantitative analysis of globin gene expression since inhi bition of Topo I is affecting the entire genome Therefore, we decided to determine whether inhibiting Topo I by Cpt for a short period of globin gene replication during S phase of cell cycle would interfere with the globin gene expression Hypothesis Since the main function of Topo I in transcription regulation is to release the torsional tension generated during elongation, inhibition of Topo I catalytic activi ty will cause the accumulation of positive supercoils in front of the elongating Pol II complexes. The accumulation of positive supercoils will slow down or stall Pol II enlongation complexes somewhere downstream of the transcription start sites According to the published data (7) the intergenic transcripti hypothesize d that inhibition of Topo I by Cpt will stall Pol II in the LCR or the up stream region genes. To examine this hypothesis, chromatin immunoprecipitation (ChIP) assays were performed using unsynchronized and synchronized human erythroleuk emia cells (K562), which

PAGE 122

122 are well established cell lines for and fetal globin genes, but not the adult globin gene. Materials and Methods Karen Vieira, a previous graduate student in our laboratory, performed ChIP on double thymidine synchronized K562 cells at several time points during early S phase and showed that globin promoter within 45 minutes, disassociated at 2 hr, and re associated at 6 hr time point after cells are released from G1/S phase border arrest. (243) In these experiments replication of the globin locus occurred around the 2 hr tim e point window when Pol II was disassociated (243) Therefore we decided to assay the double thymidine synchronized cells at 6 hr time point after cells were released from the block and treated with Cpt for 1hr Unsynchronized cells were also treated with 10 or 20 M Cpt for 1hr before subje cted to ChIP assay. Cell synchronization K562 were synchronized at the border of G1 and S phase by incubating the cells with complete medium in the presence of 2mM thymindine for 16 hrs, transferring to fresh medium without thymidine, incubating for 10 1 3 hrs, and blocking the cells in medium with 2mM for another 16 hrs. A little portion of blocked cells were fixed with 100% ethanol, digested with RNase, stained with propidium iodide, and subjected to flow cytometry to verify synchronization. The cell cyc le stage was determined by using ModFit LT statistic software (Figure A 3 ). The rest of the blocked cells were released from block by washing the cells twice with complete growth medium and allowed to grow in the medium for 5 hrs, then half of the cells we the other untreated cells. The cells were taken for flow cytometry at specific time points after release from the arrest.

PAGE 123

123 ChIP assay Cells were harvested, crosslinked, quenched, and lysed using buffers containing protease inhibitors. The cell lysate was subsequently sonicated to shear the chromatin and the chromatin was pre cleared with protein A sepharose beads (for un synchronized cells, the chromatin was pre cleared with same species non immune IgG prior to and with protein A sepharose beads due to the extremely low levels of Topo I bound to DNA). A portion of chromatin was saved as input and the rest was incubated overnight with the antibodies of choice. Blocked prot ein A sepharose beads were added the next day to collect the antibody chromatin complexes. Unbound material was washed away and the chromatin was eluted and reverse cro sslinked together with the input The chromatin was then digested with RNase and protein ase K and then subjected to column purification Real Time PCR (RT PCR) was performed using primers amplifying the LCR, the intergenic region s and globin gene promoters along the globin locus (see below) RT PR condition has been described previously (51) Antibodies used: Pol II (Upstate ) and Topo I (Santa Cluz) Primers used: primer specific for human HS2 core and the promoter region of the globin, globin gene have been described previously (243) The other primers used were listed in Table A 2. Quantitative data analysis For each measurement, five 10 fold series dilutions of the relevant input DNA were examined to generate a sta ndard curve. DNA recoveries of analyzed fragments were thus before further an alysis. Since the overall extent of different immunoprecipitations vary markedly, the relative DNA fragment recovery for each specific antibody was calculated as follows: 1) the average recoveries of each fragment (primer) for each ChIP experiment were

PAGE 124

124 cal culated; 2) the ratio of the maximum average recovery over the average recovery for each fragment between different ChIP experiments were calculated; 3) then the normalized value (relative recovery) was obtained by single recovery measurement multiplying b y the ratio and by 100. 4) the mean relative recovery and the standard deviation for each fragment among the normalized measurements of all experiments were calculated. Relative fragment recovery for non immune IgG was calculated with respect to each speci fic antibody. Single measurements were normalized relative to the maximal average recovery of each specific antibody in each experiment. Then, mean values and standard errors were calculated among all normalized measurements. Results ChIP analysis of Topo globin locus before and after drug treatment showed that Top o I binding in the globin locus increased at all the regions examined in both synchronized (Figure A 3 ) and unsynchronized (data not shown) cells, indicating the presence of Cp t trapped Top I cleavable complexes on chromatin templates throughout the globin locus, although the overall DNA recoveries of Top I bound fragments was very low. ChIP analysis of Pol II binding r esults showed that in un synchronized cells, Pol II binding increased in the HS2 core and gradually decreased in the downstream region and increased in the promoter regions of A A 4 hypothesis. However, in syn chronized cells Pol II binding decreased from HS2 core to its a fter drug treatment. (Figure A 5 ) The dramatic reduc the observation previously reported that Topo I inhibition by Cpt enhances transcriptional

PAGE 125

125 transition to elongation. (121) Interestingly, Pol II binding at the GAPDH promoter region also globin genes, increased in unsynchronized cells and decreased in synchronized cells after drug treatment This indicates that inhibition of Topo I may h ave similar effect on active ly transcribed genes and that the change s in Pol II globin locus before and after Cpt treatment may not be the result of disrupting intergenic transcription The reason why inhibition of Topo I has different effects on Pol II distribution in globin locus during different cell cycle stages is unknown. The possible explanation s fall into two categories based on previous reports : 1) In S phase the intergenic transcripts are not exclusively initiated within the LCR but also from further upstream, maybe up to the 236 LTR in the olfactory region ( ORG ) cluster as reported by Miles et al. (169) Therefore, if our hypothesis is true that inhibiting Topo I can interrupt intergenic transcription, Pol II should be stalled somewhere upstream of the LCR or within the ORG region when a Topo I cleavable complex is trapped by Cpt. In contrast, in un synchronized cells, about 30 50 % of c ells are in G1 phase in globin genes are actively transcribed in K562 cells; therefore when Topo I is inhibited, the Topo I Cpt complex should stall Pol II in the LCR region regions of expressed genes. Therefore, the upstream region of ORG cluster was examined in the sam e ChIP experiment in synchronized cells However, Pol II binding in this region also decreased after drug treatment (data not shown). T he same e xperiment was repeated but with much shorter drug incubation time (10 min) and lower concen to reduce the opportunities of Topo I Cpt complex colliding with elongating Pol II. In these experiments Pol II binding increased in the upstream region of the ORG gene cluster but did not decrease in the LCR region after drug treatment,

PAGE 126

126 wh ich was contrary to our previous results at the same cell cycle stage (data not shown). The results, however, were more similar to the results of the same drug incubation condition in the early G1 phase of the cell cycle. This indicates that the ChIP results of Pol II binding profile in the globin gene locus before and after drug treatment is not reflecting the effect of the interrupted intergenic transcription in the locus but is due to inhibition of topoisomerase by Cpt itself A globin promoter in both synchronized and un g lobin gene increased in primitive erythroid cells under the effect of Top o I inhibition. Therefore, re verse transcriptase PCR globin mRNA globin mRNAs globin mRNAs are very stable (107, 206) and Pol II globin promoter decreased in sy nchronized cells under the Cpt globin gene did increase about 1.8 fold after drug treatment and the increased fold change seems to be correspondent to t he increase in Pol II binding according to the ChI P data. (Figure A 6 ) For the un synchronized cells, according to the in the sample treated with Cpt H globin expression also increases in this condition is unclea r since GAPDH promoter region in un synchronized cells. The gene that can serve as an internal control in our experiment would be a very short gene that allows the Pol II elongation machinary to proceed and finish transcription of the gene before it is stalled by the positive supercoils built in front of it during elongation. Originally we found

PAGE 127

127 7SK RNA would be a potential gene as an internal control since it i s only 300 bp in length. However, ChIP and RNA reverse transcribed RT PCR results showed that its expression was affected mostly after drug treatment and Pol II enrichment on its promoter also changed dramatically after Cpt treatment (data not shown) Disc ussion Our preliminary results showed that different drug incubation time, e.g. 1h vs 10 minutes, would yield different Pol II binding profile s even in the same cell cycle stage. In addition, inhibition of Topo I not only affected the intergenic transcrip tion but also the transcription of coding genes globally. Therefore, the increase in globin gene expression may not necessary be due to the interruption of intergenic transcription, which could be due to changes in transcription globin gene expression Although in S phase, Pol II globin promoter increased consistently, the increased levels were still very low and of globin gene. In addition, the DNA double strand break and single strand break caused by the colli sion of Topo I Cpt complex with replicating and elongating machinaries, respectively. I t has to be addressed whether Cpt treatment leads to single or double strand DNA breaks in the globin gene locus. In order to examine whether the observed results in our experiments stem from double strand break, cells could be exposed to ionizing radiation that will cause immediate double strand break and then to analyze whether similar results concerning Pol II and factor interactions with the globin locus can be observed. To examine single s trand break s recruitment of the transcription coupled repair (TCR) complex due to stalled Pol II is more complicated Southern blot after ligation mediated PCR (LM PCR) assay with appropriate primer amplifying region of interest along the globin locus can reveal whether there are single or double strand breaks at these sites. ChIP

PAGE 128

128 experiments with antibodies against TCR or nucl eotide excision repair ( NER ) factors can examine whether these repair processes occur under the conditions studied. However, the presence of DNA repair factors does not directly prove that our observations are due to DNA repair. The better way to reveal wh ether our results are due to TCR is performing ChIP assays using two mutant erythroid cell lines generated by transfecting the siRNAs against CSB (Cockayne syndrome group B) and XPC (xeroderma pigmentosum group C) into erythroid cells. CSB null cells can p erform all the DNA repairs except TCR while XPC null cells can only perform TCR. Since we did not obtain consistant results allowing clear conclusions on the effect of inhibition of Topo I by Cpt we could not conclude that inhibition of Topo I by Cpt will interrupt globin gene expression. Besides, a lot of efforts have to be made just to clarify whether the results we obtained are due to the side effect of Cpt. T his project w as proven not feasible at all especially during 4 5 years of the Ph. D. study. Therefore, it was not continued.

PAGE 129

129 Figure A 1 Distinct domains of epigenetic profile and intergenic globin locus are highly correlated and are developmentally regulated (7)

PAGE 130

130 Table A 1 Subfamilies of DNA topoisomerases (248)

PAGE 131

131 Figure A 2 Diagram of DNA contents and cell proportion in different cell cycle stages by flow cytometric analysis. AS: unsynchronized cells. C0: synchronized cells arrested in G1/S phase (Time 0). D5: syn chronized cells analyzed 5h after released from block.

PAGE 132

132 Genetic locus region Primer sequences ( f orward primer is in the first row and reverse in the second row ) LTR upstream HBB:0 990 region (ERV 9LTR up) GGATGTTGGCAAGGCTATGT CACCCCTAGGCACATGAAAC LTR_2700 3600 (ERV 9LTR5') AGCTGCTGTGCTCAATTCCT ACAGGAGCCCATGAAGGTG HS2 downstream ggaaggcatgaaaacaggaa ccgtatgtgagcatgtgtcc HS1 downstream cctccctaccacctttagcc gcagagcccacattttcttc globin gene upstream agagagccccaggcaatact ggggtgattccctaga gagg A region TGCCTGTTTGTGTTTGTGGT GTCTTTCTTCCCACCGGATT human HS3 core AGGGCCCAGATGGGTTATAG TTCCCATGTCTGCCCTCTAC HS1d_between Alu_E TTGGGAGACAGGAGCCATAC GCCCCACCAGATCTAGGAAT Pseudo down after right Alu, before Delta GCAAC AGAAGCCCAGCTATT GTGGCATGGTTTGATTTGTG Table A 2 Primer sequences used in ChIP experiments.

PAGE 133

133 Figure A 3 Quantitative PCR results of ChIP assay of topoisomerase I (Top I) binding globin locus in synchronized K562 cells unt camptothecin (Cpt) for 1hour. Cells were cross linked with formaldehyde. Chromatin was isolated, fragmented, and precipit ated with antibodies against Pol II or the unspecific IgG antibody. DNA was purified from the precipitate and analyzed by quantitative real time PCR using primers specific for the indicated region in the LCR, intergenic region, and promoter s of globin locus Bars represent the relative enrichment over the i nput DNA. Error bars represent S.D. from two independent experiments. The insert is the zoom in of the large figure to enlarge the regions with low level s of DNA recoveries. HS2&3: LCR HS2 and ore. HS2d: HS2 downstream region. HS1d: HS1 downstream region. E up: globin gene upstream region. Ini: promoter region. Gamma ini: A A globin

PAGE 134

134 Figure A 4 Quantitative PCR results of ChIP assay of RNA polymerase II ( Pol II ) binding t o the globin locus in unsynchronized K562 cells untreated (no drug) or treated with for 1 hour Cells were cross linked with formaldehyde. Chromatin was isolated, fragmented, and precipit ated with antibodies against Pol II or t he unspecific IgG antibody. DNA was purified from the precipitate and analyzed by quantitative real time PCR using primers specific for the indicated region in the LCR, intergenic region, and promoter s of globin lo cus Bars represent the relative enrichment over the input DNA. The insert is the zoom in of the large figure to enlarge the regions with low level s of DNA recoveries. HS2&3: LCR HS2 and HS3 flanked region. HS2c: HS2 core. HS2d: HS2 downstream region. HS1d : HS1 downstream region. E up: globin gene upstream region. Ini: promoter region. Gamma ini: G globin promoter. Gamma G globin

PAGE 135

135 Figure A 5 Quantitative PCR results of ChIP ass ay of RNA polymerase II ( Pol II ) binding to the globin locus in synchronized of camptothecin (Cpt) for 1hour Cells were cross linked with formaldehyde. Chromatin was isolated, fragmented, and precipit a ted with antibodies against Pol II or the unspecific IgG antibody. DNA was purified from the precipitate and analyzed by quantitative real time PCR using primers specific for the indicated region in the LCR, intergenic region, and promoter s of globin locus Bars represent the relative enrichment over the input DNA. Error bars represent S.D. from two independent experiments. The insert is the zoom in of the large figure to enlarge the regions with low level s of DNA r ecoveries. HS2&3: LCR HS2 and HS3 flanked region. HS2c: HS2 core. HS2d: HS2 downstream region. HS1d: HS1 downstream region. E up: globin gene upstream region. Ini: promoter region. Gamma ini: A : A globin

PAGE 136

136 Figure A 6 globin gene expression in synchronized K562 cells before (no drug) and after Cpt treatment RNA from K562 cells was isolat ed, reverse transcribed, and subjected to quantitative PCR analysis using primers globin mRNA as well as the GAPDH mRNA. The same amount of RNA from untreated and treated samples was used in the reverse transcribed step and real time PCR reaction.

PAGE 137

137 LIST OF REFERENCES 1. Allen, D. W., J. Wyman, Jr., and C. A. Smith. 1953. The oxygen equilibrium of fetal and adult human hemoglobin. J Biol Chem 203: 81 7. 2. Allen, T. D., and T. M. Dexter. 1982. Ul trastructural aspects of erythropoietic differentiation in long term bone marrow culture. Differentiation 21: 86 94. 3. Angelucci, E., H. Bai, F. Centis, M. S. Bafti, G. Lucarelli, L. Ma, and S. Schrier. 2002. Enhanced macrophagic attack on beta thalassemia major erythroid precursors. Haematologica 87: 578 83. 4. Antoniou, M., E. deBoer, G. Habets, and F. Grosveld. 1988. The human beta globin gene contains multiple regulatory regions: identification of one promoter and two downstream enhancers. Embo J 7: 377 8 4. 5. Antoniou, M., and F. Grosveld. 1990. beta globin dominant control region interacts differently with distal and proximal promoter elements. Genes Dev 4: 1007 13. 6. Arthur, J. S., J. S. Elce, C. Hegadorn, K. Williams, and P. A. Greer. 2000. Disruption of the murine calpain small subunit gene, Capn4: calpain is essential for embryonic development but not for cell growth and division. Mol Cell Biol 20: 4474 81. 7. Ashe, H. L., J. Monks, M. Wijgerde, P. Fraser, and N. J. Proudfoot. 1997. Intergenic transcri ption and transinduction of the human beta globin locus. Genes Dev 11: 2494 509. 8. Azam, M., S. S. Andrabi, K. E. Sahr, L. Kamath, A. Kuliopulos, and A. H. Chishti. 2001. Disruption of the mouse mu calpain gene reveals an essential role in platelet functio n. Mol Cell Biol 21: 2213 20. 9. Barrett, A. J., G. Lucarelli, R. P. Gale, A. Sobocinski, M. Horowitz, and M. M. Bortin. 1989. Bone marrow transplantation for thalassaemia -a preliminary report from the International Bone Marrow Transplant Registry. Prog Cl in Biol Res 309: 173 85. 10. Beckett, D., E. Kovaleva, and P. J. Schatz. 1999. A minimal peptide substrate in biotin holoenzyme synthetase catalyzed biotinylation. Protein Sci 8: 921 9. 11. Behringer, R. R., R. E. Hammer, R. L. Brinster, R. D. Palmiter, and T. M. Townes. 1987. Two 3' sequences direct adult erythroid specific expression of human beta globin genes in transgenic mice. Proc Natl Acad Sci U S A 84: 7056 60. 12. Benoist, C., and P. Chambon. 1981. In vivo sequence requirements of the SV40 early promo tor region. Nature 290: 304 10. 13. Berridge, M. J. 1993. Inositol trisphosphate and calcium signalling. Nature 361: 315 25. 14. Berridge, M. J., M. D. Bootman, and H. L. Roderick. 2003. Calcium signalling: dynamics, homeostasis and remodelling. Nat Rev Mol Cell Biol 4: 517 29.

PAGE 138

138 15. Bohl, D., A. Bosch, A. Cardona, A. Salvetti, and J. M. Heard. 2000. Improvement of erythropoiesis in beta thalassemic mice by continuous erythropoietin delivery from muscle. Blood 95: 2793 8. 16. Bonnesen, B., C. Orskov, S. Rasmussen P. J. Holst, J. P. Christensen, K. W. Eriksen, K. Qvortrup, N. Odum, and T. Labuda. 2005. MEK kinase 1 activity is required for definitive erythropoiesis in the mouse fetal liver. Blood 106: 3396 404. 17. Borsook, H., D. Teigler, and A. Gunderson. 1968. S tudies on erythropoiesis. 3. Different patterns of protein and hemoglobin synthesis before and after terminal differentiation in adult rabbit marrow. Arch Biochem Biophys 125: 429 35. 18. Boyer, S. H., T. K. Belding, L. Margolet, and A. N. Noyes. 1975. Feta l hemoglobin restriction to a few erythrocytes (F cells) in normal human adults. Science 188: 361 3. 19. Brand, M., J. A. Ranish, N. T. Kummer, J. Hamilton, K. Igarashi, C. Francastel, T. H. Chi, G. R. Crabtree, R. Aebersold, and M. Groudine. 2004. Dynamic changes in transcription factor complexes during erythroid differentiation revealed by quantitative proteomics. Nat Struct Mol Biol 11: 73 80. 20. Bresnick, E. H., and G. Felsenfeld. 1993. Evidence that the transcription factor USF is a component of the hum an beta globin locus control region heteromeric protein complex. J Biol Chem 268: 18824 34. 21. Bridges, K., R. Levenson, D. Housman, and L. Cantley. 1981. Calcium regulates the commitment of murine erythroleukemia cells to terminal erythroid differentiatio n. J Cell Biol 90: 542 4. 22. Brill, S. J., S. DiNardo, K. Voelkel Meiman, and R. Sternglanz. 1987. Need for DNA topoisomerase activity as a swivel for DNA replication for transcription of ribosomal RNA. Nature 326: 414 6. 23. Brittenham, G. M., A. R. Cohen, C. E. McLaren, M. B. Martin, P. M. Griffith, A. W. Nienhuis, N. S. Young, C. J. Allen, D. E. Farrell, and J. W. Harris. 1993. Hepatic iron stores and plasma ferritin concentration in patients with sickle cell anemia and thalassemia major. Am J Hematol 42: 81 5. 24. Bungert, J., K. Tanimoto, S. Patel, Q. Liu, M. Fear, and J. D. Engel. 1999. Hypersensitive site 2 specifies a unique function within the human beta globin locus control region to stimulate globin gene transcription. Mol Cell Biol 19: 3062 72. 25. Calzolari, R., T. McMorrow, N. Yannoutsos, A. Langeveld, and F. Grosveld. 1999. Deletion of a region that is a candidate for the difference between the deletion forms of hereditary persistence of fetal hemoglobin and deltabeta thalassemia affects beta but not gamma globin gene expression. Embo J 18: 949 58.

PAGE 139

139 26. Camara Clayette, V., C. Rahuel, O. Bertrand, and J. P. Cartron. 1999. The E box of the human glycophorin B promoter is involved in the erythroid specific expression of the GPB gene. Biochem Biophys R es Commun 265: 170 6. 27. Caraveo, G., D. B. van Rossum, R. L. Patterson, S. H. Snyder, and S. Desiderio. 2006. Action of TFII I outside the nucleus as an inhibitor of agonist induced calcium entry. Science 314: 122 5. 28. Carter, D., L. Chakalova, C. S. Osb orne, Y. F. Dai, and P. Fraser. 2002. Long range chromatin regulatory interactions in vivo. Nat Genet 32: 623 6. 29. Carthew, R. W., L. A. Chodosh, and P. A. Sharp. 1985. An RNA polymerase II transcription factor binds to an upstream element in the adenovir us major late promoter. Cell 43: 439 48. 30. Casale, G. P., E. A. Khairallah, and J. A. Grasso. 1980. An analysis of hemoglobin synthesis in erythropoietic cells. Dev Biol 80: 107 19. 31. Cavazzana Calvo, M., E. Payen, O. Negre, G. Wang, K. Hehir, F. Fusil, J. Down, M. Denaro, T. Brady, K. Westerman, R. Cavallesco, B. Gillet Legrand, L. Caccavelli, R. Sgarra, L. Maouche Chretien, F. Bernaudin, R. Girot, R. Dorazio, G. J. Mulder, A. Polack, A. Bank, J. Soulier, J. Larghero, N. Kabbara, B. Dalle, B. Gourmel, G. Socie, S. Chretien, N. Cartier, P. Aubourg, A. Fischer, K. Cornetta, F. Galacteros, Y. Beuzard, E. Gluckman, F. Bushman, S. Hacein Bey Abina, and P. Leboulch. 2010. Transfusion independence and HMGA2 activation after gene therapy of human beta thalassaemi a. Nature 467: 318 22. 32. Chada, K., J. Magram, and F. Costantini. 1985. Tissue and stage specific expression of a cloned adult beta globin gene in transgenic mice. Prog Clin Biol Res 191: 305 19. 33. Chakalova, L., E. Debrand, J. A. Mitchell, C. S. Osborn e, and P. Fraser. 2005. Replication and transcription: shaping the landscape of the genome. Nat Rev Genet 6: 669 77. 34. Chalkley, G. E., and C. P. Verrijzer. 1999. DNA binding site selection by RNA polymerase II TAFs: a TAF(II)250 TAF(II)150 complex recogn izes the initiator. Embo J 18: 4835 45. 35. Champoux, J. J. 2001. DNA topoisomerases: structure, function, and mechanism. Annu Rev Biochem 70: 369 413. 36. Chapman Smith, A., and J. E. Cronan, Jr. 1999. Molecular biology of biotin attachment to proteins. J N utr 129: 477S 484S. 37. Charache, S., G. Dover, K. Smith, C. C. Talbot, Jr., M. Moyer, and S. Boyer. 1983. Treatment of sickle cell anemia with 5 azacytidine results in increased fetal hemoglobin production and is associated with nonrandom hypomethylation o f DNA around the gamma delta beta globin gene complex. Proc Natl Acad Sci U S A 80: 4842 6.

PAGE 140

140 38. Chasis, J. A., and N. Mohandas. 2008. Erythroblastic islands: niches for erythropoiesis. Blood 112: 470 8. 39. Cheriyath, V., Z. P. Desgranges, and A. L. Roy. 200 2. c Src dependent transcriptional activation of TFII I. J Biol Chem 277: 22798 805. 40. Cheriyath, V., and A. L. Roy. 2000. Alternatively spliced isoforms of TFII I. Complex formation, nuclear translocation, and differential gene regulation. J Biol Chem 27 5: 26300 8. 41. Cheriyath, V., and A. L. Roy. 2001. Structure function analysis of TFII I. Roles of the N terminal end, basic region, and I repeats. J Biol Chem 276: 8377 83. 42. Chimge, N. O., A. V. Makeyev, F. H. Ruddle, and D. Bayarsaihan. 2008. Identific ation of the TFII I family target genes in the vertebrate genome. Proc Natl Acad Sci U S A 105: 9006 10. 43. Cho, H., G. Orphanides, X. Sun, X. J. Yang, V. Ogryzko, E. Lees, Y. Nakatani, and D. Reinberg. 1998. A human RNA polymerase II complex containing fa ctors that modify chromatin structure. Mol Cell Biol 18: 5355 63. 44. Choe, C., N. Chen, and M. Sawadogo. 2005. Decreased tumorigenicity of c Myc transformed fibroblasts expressing active USF2. Exp Cell Res 302: 1 10. 45. Choi, O. R., and J. D. Engel. 1986. A 3' enhancer is required for temporal and tissue specific transcriptional activation of the chicken adult beta globin gene. Nature 323: 731 4. 46. Chomczynski, P., and N. Sacchi. 1987. Single step method of RNA isolation by acid guanidinium thiocyanate phe nol chloroform extraction. Anal Biochem 162: 156 9. 47. Collins, I., A. Weber, and D. Levens. 2001. Transcriptional consequences of topoisomerase inhibition. Mol Cell Biol 21: 8437 51. 48. Collis, P., M. Antoniou, and F. Grosveld. 1990. Definition of the min imal requirements within the human beta globin gene and the dominant control region for high level expression. Embo J 9: 233 40. 49. Cooley, T. B., Lee P. 1925. Series of cases of splenomegaly in children with anemia and peculiar bone changes. Trans Am Pedi atr Soc 37: 29. 50. Corre, S., and M. D. Galibert. 2005. Upstream stimulating factors: highly versatile stress responsive transcription factors. Pigment Cell Res 18: 337 48. 51. Crusselle Davis, V. J., K. F. Vieira, Z. Zhou, A. Anantharaman, and J. Bungert. 2006. Antagonistic regulation of beta globin gene expression by helix loop helix proteins USF and TFII I. Mol Cell Biol 26: 6832 43.

PAGE 141

141 52. Crusselle Davis, V. J., Z. Zhou, A. Anantharaman, B. Moghimi, T. Dodev, S. Huang, and J. Bungert. 2007. Recruitment of coregulator complexes to the beta globin gene locus by TFII I and upstream stimulatory factor. Febs J 274: 6065 73. 53. Dahl, J. A., and P. Collas. 2007. Q2ChIP, a quick and quantitative chromatin immunoprecipitation assay, unravels ep igenetic dynamics of developmentally regulated genes in human carcinoma cells. Stem Cells 25: 1037 46. 54. de Boer, E., P. Rodriguez, E. Bonte, J. Krijgsveld, E. Katsantoni, A. Heck, F. Grosveld, and J. Strouboulis. 2003. Efficient biotinylation and single step purification of tagged transcription factors in mammalian cells and transgenic mice. Proc Natl Acad Sci U S A 100: 7480 5. 55. de Laat, W., and F. Grosveld. 2003. Spatial organization of gene expression: the active chromatin hub. Chromosome Res 11: 447 59. 56. Dean, A. 2006. On a chromosome far, far away: LCRs and gene expression. Trends Genet 22: 38 45. 57. deBoer, E., M. Antoniou, V. Mignotte, L. Wall, and F. Grosveld. 1988. The human beta globin promoter; nuclear protein factors and erythroid specific induction of transcription. Embo J 7: 4203 12. 58. Delvoye, N. L., N. M. Destroismaisons, and L. A. Wall. 1993. Activation of the beta globin promoter by the locus control region correlates with binding of a novel factor to the CAAT box in murine erythroleu kemia cells but not in K562 cells. Mol Cell Biol 13: 6969 83. 59. Di Mauro, E., G. Camilloni, L. Verdone, and M. Caserta. 1993. DNA topoisomerase I controls the kinetics of promoter activation and DNA topology in Saccharomyces cerevisiae. Mol Cell Biol 13: 6 702 10. 60. Dierks, P., A. van Ooyen, M. D. Cochran, C. Dobkin, J. Reiser, and C. Weissmann. 1983. Three regions upstream from the cap site are required for efficient and accurate transcription of the rabbit beta globin gene in mouse 3T6 cells. Cell 32: 695 706. 61. Dillon, N., T. Trimborn, J. Strouboulis, P. Fraser, and F. Grosveld. 1997. The effect of distance on long range chromatin interactions. Mol Cell 1: 131 9. 62. Donze, D., T. M. Townes, and J. J. Bieker. 1995. Role of erythroid Kruppel like factor i n human gamma to beta globin gene switching. J Biol Chem 270: 1955 9. 63. Dover, G. J., S. H. Boyer, and W. H. Zinkham. 1979. Production of erythrocytes that contain fetal hemoglobin in anemia. Transient in vivo changes. J Clin Invest 63: 173 6. 64. Driscol l, M. C., C. S. Dobkin, and B. P. Alter. 1989. Gamma delta beta thalassemia due to a de novo mutation deleting the 5' beta globin gene activation region hypersensitive sites. Proc Natl Acad Sci U S A 86: 7470 4.

PAGE 142

142 65. Du, H., A. L. Roy, and R. G. Roeder. 1993 Human transcription factor USF stimulates transcription through the initiator elements of the HIV 1 and the Ad ML promoters. Embo J 12: 501 11. 66. Edington, G. M., and H. Lehmann. 1955. Expression of the sickle cell gene in Africa. Br Med J 1: 1308 11. 67 Editorial. 1978 Intensive iron chelation in thalassaemia. Br. Med. J. 2: 782 783. 68. Egyhazi, E., and E. Durban. 1987. Microinjection of anti topoisomerase I immunoglobulin G into nuclei of Chironomus tentans salivary gland cells leads to blockage of tra nscription elongation. Mol Cell Biol 7: 4308 16. 69. Elnitski, L., W. Miller, and R. Hardison. 1997. Conserved E boxes function as part of the enhancer in hypersensitive site 2 of the beta globin locus control region. Role of basic helix loop helix proteins J Biol Chem 272: 369 78. 70. Engle, M. A. 1964. Cardiac Involvement in Cooley's Anemia. Ann N Y Acad Sci 119: 694 702. 71. Enkhmandakh, B., A. V. Makeyev, L. Erdenechimeg, F. H. Ruddle, N. O. Chimge, M. I. Tussie Luna, A. L. Roy, and D. Bayarsaihan. 2009. Essential functions of the Williams Beuren syndrome associated TFII I genes in embryonic development. Proc Natl Acad Sci U S A 106: 181 6. 72. Faletto, D. L., and I. G. Macara. 1985. The role of Ca2+ in dimethyl sulfoxide induced differentiation of Friend e rythroleukemia cells. J Biol Chem 260: 4884 9. 73. Faller, D. V., and S. P. Perrine. 1995. Butyrate in the treatment of sickle cell disease and beta thalassemia. Curr Opin Hematol 2: 109 17. 74. Farrell, C. M., A. G. West, and G. Felsenfeld. 2002. Conserved CTCF insulator elements flank the mouse and human beta globin loci. Mol Cell Biol 22: 3820 31. 75. Felsenfeld, G., and J. McGhee. 1982. Methylation and gene control. Nature 296: 602 3. 76. Fessas, P., D. Loukopoulos, and A. Kaltsoya. 1966. Peptide analysis o f the inclusions of erythroid cells in beta thalassemia. Biochim Biophys Acta 124: 430 2. 77. Fleischmann, G., G. Pflugfelder, E. K. Steiner, K. Javaherian, G. C. Howard, J. C. Wang, and S. C. Elgin. 1984. Drosophila DNA topoisomerase I is associated with t ranscriptionally active regions of the genome. Proc Natl Acad Sci U S A 81: 6958 62. 78. Forget, B. G. 1998. Molecular basis of hereditary persistence of fetal hemoglobin. Ann N Y Acad Sci 850: 38 44. 79. Forrester, W. C., E. Epner, M. C. Driscoll, T. Enver, M. Brice, T. Papayannopoulou, and M. Groudine. 1990. A deletion of the human beta globin locus activation region

PAGE 143

143 causes a major alteration in chromatin structure and replication across the entire beta globin locus. Genes Dev 4: 1637 49. 80. Forrester, W. C ., S. Takegawa, T. Papayannopoulou, G. Stamatoyannopoulos, and M. Groudine. 1987. Evidence for a locus activation region: the formation of developmentally stable hypersensitive sites in globin expressing hybrids. Nucleic Acids Res 15: 10159 77. 81. Fraser, S. T., J. Isern, and M. H. Baron. 2007. Maturation and enucleation of primitive erythroblasts during mouse embryogenesis is accompanied by changes in cell surface antigen expression. Blood 109: 343 52. 82. Gardenghi, S., P. Ramos, A. Follenzi, N. Rao, E. A. Rachmilewitz, P. J. Giardina, R. W. Grady, and S. Rivella. 2010. Hepcidin and Hfe in iron overload in beta thalassemia. Ann N Y Acad Sci 1202: 221 5. 83. Gaziev, D., M. Galimberti, P. Polchi, E. Angelucci, C. Giardini, D. Baronciani, M. Andreani, B. Persin i, B. Erer, P. Sodani, M. Manna, G. Nicolini, G. Visani, and G. Lucarelli. 2002. Fate of chronic myeloid leukemia patients treated with allogeneic bone marrow transplantation or chemotherapy and/or interferon at a single center: long term results. Bone Mar row Transplant 29: 1 8. 84. Ge, Y., T. L. Jensen, L. H. Matherly, and J. W. Taub. 2003. Physical and functional interactions between USF and Sp1 proteins regulate human deoxycytidine kinase promoter activity. J Biol Chem 278: 49901 10. 85. Giannola, D. M., W D. Shlomchik, M. Jegathesan, D. Liebowitz, C. S. Abrams, T. Kadesch, A. Dancis, and S. G. Emerson. 2000. Hematopoietic expression of HOXB4 is regulated in normal and leukemic stem cells through transcriptional activation of the HOXB4 promoter by upstream stimulating factor (USF) 1 and USF 2. J Exp Med 192: 1479 90. 86. Gill, S. J., R. C. Benedict, L. Fall, R. Spokane, and J. Wyman. 1979. Oxygen binding to sickle cell hemoglobin. J Mol Biol 130: 175 89. 87. Gillo, B., Y. S. Ma, and A. R. Marks. 1993. Calcium influx in induced differentiation of murine erythroleukemia cells. Blood 81: 783 92. 88. Goldberg, A. D., C. D. Allis, and E. Bernstein. 2007. Epigenetics: a landscape takes shape. Cell 128: 635 8. 89. Goll, D. E., V. F. Thompson, H. Li, W. Wei, and J. Cong 2003. The calpain system. Physiol Rev 83: 731 801. 90. Gopalakrishna, R., and S. H. Barsky. 1986. Hydrophobic association of calpains with subcellular organelles. Compartmentalization of calpains and the endogenous inhibitor calpastatin in tissues. J Biol Chem 261: 13936 42.

PAGE 144

144 91. Gossen, M., S. Freundlieb, G. Bender, G. Muller, W. Hillen, and H. Bujard. 1995. Transcriptional activation by tetracyclines in mammalian cells. Science 268: 1766 9. 92. Graham Siegenthaler, K., S. Gauthier, P. L. Davies, and J. S. E lce. 1994. Active recombinant rat calpain II. Bacterially produced large and small subunits associate both in vivo and in vitro. J Biol Chem 269: 30457 60. 93. Gribnau, J., K. Diderich, S. Pruzina, R. Calzolari, and P. Fraser. 2000. Intergenic transcription and developmental remodeling of chromatin subdomains in the human beta globin locus. Mol Cell 5: 377 86. 94. Grosschedl, R., and M. L. Birnstiel. 1980. Identification of regulatory sequences in the prelude sequences of an H2A histone gene by the study of s pecific deletion mutants in vivo. Proc Natl Acad Sci U S A 77: 1432 6. 95. Grosschedl, R., and M. L. Birnstiel. 1980. Spacer DNA sequences upstream of the T A T A A A T A sequence are essential for promotion of H2A histone gene transcription in vivo. Proc N atl Acad Sci U S A 77: 7102 6. 96. Grosveld, F., D. Greaves, S. Philipsen, D. Talbot, S. Pruzina, E. deBoer, O. Hanscombe, P. Belhumeur, J. Hurst, P. Fraser, and et al. 1990. The dominant control region of the human beta globin domain. Ann N Y Acad Sci 612: 152 9. 97. Grosveld, F., G. B. van Assendelft, D. R. Greaves, and G. Kollias. 1987. Position independent, high level expression of the human beta globin gene in transgenic mice. Cell 51: 975 85. 98. Grosveld, G. C., E. de Boer, C. K. Shewmaker, and R. A. Fl avell. 1982. DNA sequences necessary for transcription of the rabbit beta globin gene in vivo. Nature 295: 120 6. 99. Groudine, M., T. Kohwi Shigematsu, R. Gelinas, G. Stamatoyannopoulos, and T. Papayannopoulou. 1983. Human fetal to adult hemoglobin switchi ng: changes in chromatin structure of the beta globin gene locus. Proc Natl Acad Sci U S A 80: 7551 5. 100. Gusella, J., R. Geller, B. Clarke, V. Weeks, and D. Housman. 1976. Commitment to erythroid differentiation by friend erythroleukemia cells: a stochas tic analysis. Cell 9: 221 9. 101. Gutierrez, L., F. Lindeboom, A. Langeveld, F. Grosveld, S. Philipsen, and D. Whyatt. 2004. Homotypic signalling regulates Gata1 activity in the erythroblastic island. Development 131: 3183 93. 102. Gutteridge, J. M., R. Rich mond, and B. Halliwell. 1979. Inhibition of the iron catalysed formation of hydroxyl radicals from superoxide and of lipid peroxidation by desferrioxamine. Biochem J 184: 469 72.

PAGE 145

145 103. Hakimi, M. A., Y. Dong, W. S. Lane, D. W. Speicher, and R. Shiekhattar. 2 003. A candidate X linked mental retardation gene is a component of a new family of histone deacetylase containing complexes. J Biol Chem 278: 7234 9. 104. Hakre, S., M. I. Tussie Luna, T. Ashworth, C. D. Novina, J. Settleman, P. A. Sharp, and A. L. Roy. 20 06. Opposing functions of TFII I spliced isoforms in growth factor induced gene expression. Mol Cell 24: 301 8. 105. Hardison, R., J. L. Slightom, D. L. Gumucio, M. Goodman, N. Stojanovic, and W. Miller. 1997. Locus control regions of mammalian beta globin gene clusters: combining phylogenetic analyses and experimental results to gain functional insights. Gene 205: 73 94. 106. Hartzog, G. A., and R. M. Myers. 1993. Discrimination among potential activators of the beta globin CACCC element by correlation of bi nding and transcriptional properties. Mol Cell Biol 13: 44 56. 107. He, Z., and J. E. Russell. 2007. Dynamic posttranscriptional regulation of epsilon globin gene expression in vivo. Blood 109: 795 801. 108. He, Z., and J. E. Russell. 2001. Expression, purif ication, and characterization of human hemoglobins Gower 1 (zeta(2)epsilon(2)), Gower 2 (alpha(2)epsilon(2)), and Portland 2 (zeta(2)beta(2)) assembled in complex transgenic knockout mice. Blood 97: 1099 105. 109. Hensold, J. O., G. Dubyak, and D. E. Housma n. 1991. Calcium ionophore, A23187, induces commitment to differentiation but inhibits the subsequent expression of erythroid genes in murine erythroleukemia cells. Blood 77: 1362 70. 110. Huang, S., X. Li, T. M. Yusufzai, Y. Qiu, and G. Felsenfeld. 2007. U SF1 recruits histone modification complexes and is critical for maintenance of a chromatin barrier. Mol Cell Biol 27: 7991 8002. 111. Huehns, E. R., F. V. Flynn, E. A. Butler, and G. H. Beaven. 1961. Two new haemoglobin variants in a very young human embryo Nature 189: 496 7. 112. Iborra, F. J., D. A. Jackson, and P. R. Cook. 2001. Coupled transcription and translation within nuclei of mammalian cells. Science 293: 1139 42. 113. Ingram, V. M. 1956. A specific chemical difference between the globins of normal human and sickle cell anaemia haemoglobin. Nature 178: 792 4. 114. Inomata, M., M. Nakamura, S. Imajoh Ohmi, and S. Kawashima. 1993. A variety of calpain/calpastatin systems in mammalian erythrocytes. Biochim Biophys Acta 1178: 207 14. 115. Isern, J., S. T. Fraser, Z. He, and M. H. Baron. 2010. Developmental niches for embryonic erythroid cells. Blood Cells Mol Dis 44: 207 8.

PAGE 146

146 116. Isern, J., S. T. Fraser, Z. He, and M. H. Baron. 2008. The fetal liver is a niche for maturation of primitive erythroid cells. Proc Natl Acad Sci U S A 105: 6662 7. 117. Javahery, R., A. Khachi, K. Lo, B. Zenzie Gregory, and S. T. Smale. 1994. DNA sequence requirements for transcriptional initiator activity in mammalian cells. Mol Cell Biol 14: 116 27. 118. Jimenez, G., S. D. Griffiths, A. M. Ford, M. F. Greaves, and T. Enver. 1992. Activation of the beta globin locus control region precedes commitment to the erythroid lineage. Proc Natl Acad Sci U S A 89: 10618 22. 119. Kang, S. H., K. Vieira, and J. Bungert. 2002. Combining chromatin im munoprecipitation and DNA footprinting: a novel method to analyze protein DNA interactions in vivo. Nucleic Acids Res 30: e44. 120. Kawane, K., H. Fukuyama, G. Kondoh, J. Takeda, Y. Ohsawa, Y. Uchiyama, and S. Nagata. 2001. Requirement of DNase II for defin itive erythropoiesis in the mouse fetal liver. Science 292: 1546 9. 121. Khobta, A., F. Ferri, L. Lotito, A. Montecucco, R. Rossi, and G. Capranico. 2006. Early effects of topoisomerase I inhibition on RNA polymerase II along transcribed genes in human cell s. J Mol Biol 357: 127 38. 122. Kim, D. W., and B. H. Cochran. 2000. Extracellular signal regulated kinase binds to TFII I and regulates its activation of the c fos promoter. Mol Cell Biol 20: 1140 8. 123. Kingsley, P. D., J. Malik, R. L. Emerson, T. P. Bush nell, K. E. McGrath, L. A. Bloedorn, M. Bulger, and J. Palis. 2006. "Maturational" globin switching in primary primitive erythroid cells. Blood 107: 1665 72. 124. Kirito, K., N. Fox, and K. Kaushansky. 2003. Thrombopoietin stimulates Hoxb4 expression: an ex planation for the favorable effects of TPO on hematopoietic stem cells. Blood 102: 3172 8. 125. Kollias, G., N. Wrighton, J. Hurst, and F. Grosveld. 1986. Regulated expression of human A gamma beta and hybrid gamma beta globin genes in transgenic mice: manipulation of the developmental expression patterns. Cell 46: 89 94. 126. Kouzarides, T. 2007. Chromatin modifications and their function. Cell 128: 693 705. 127. Lamond, A. I., and M. Mann. 1997. Cell biology and the genome projects a concerted strategy f or characterizing multiprotein complexes by using mass spectrometry. Trends Cell Biol 7: 139 42. 128. Lazebnik, M. B., M. I. Tussie Luna, P. W. Hinds, and A. L. Roy. 2009. Williams Beuren syndrome associated transcription factor TFII I regulates osteogenic marker genes. J Biol Chem 284: 36234 9.

PAGE 147

147 129. Leach, K. M., K. Nightingale, K. Igarashi, P. P. Levings, J. D. Engel, P. B. Becker, and J. Bungert. 2001. Reconstitution of human beta globin locus control region hypersensitive sites in the absence of chromatin assembly. Mol Cell Biol 21: 2629 40. 130. Leach, K. M., K. F. Vieira, S. H. Kang, A. Aslanian, M. Teichmann, R. G. Roeder, and J. Bungert. 2003. Characterization of the human beta globin downstream promoter region. Nucleic Acids Res 31: 1292 301. 131. Lee, J. S., H. Ngo, D. Kim, and J. H. Chung. 2000. Erythroid Kruppel like factor is recruited to the CACCC box in the beta globin promoter but not to the CACCC box in the gamma globin promoter: the role of the neighboring promoter elements. Proc Natl Acad Sci U S A 97: 2468 73. 132. Leppard, J. B., and J. J. Champoux. 2005. Human DNA topoisomerase I: relaxation, roles, and damage control. Chromosoma 114: 75 85. 133. Letvin, N. L., D. C. Linch, G. P. Beardsley, K. W. McIntyre, and D. G. Nathan. 1984. Augmentation o f fetal hemoglobin production in anemic monkeys by hydroxyurea. N Engl J Med 310: 869 73. 134. Levasseur, D. N., T. M. Ryan, K. M. Pawlik, and T. M. Townes. 2003. Correction of a mouse model of sickle cell disease: lentiviral/antisickling beta globin gene t ransduction of unmobilized, purified hematopoietic stem cells. Blood 102: 4312 9. 135. Levenson, R., D. Housman, and L. Cantley. 1980. Amiloride inhibits murine erythroleukemia cell differentiation: evidence for a Ca2+ requirement for commitment. Proc Natl Acad Sci U S A 77: 5948 52. 136. Levings, P. P., and J. Bungert. 2002. The human beta globin locus control region. Eur J Biochem 269: 1589 99. 137. Levings, P. P., Z. Zhou, K. F. Vieira, V. J. Crusselle Davis, and J. Bungert. 2006. Recruitment of transcripti on complexes to the beta globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells. Febs J 273: 746 55. 138. Lewis, B. A., and S. H. Orkin. 1995. A functional initiator element i n the human beta globin promoter. J Biol Chem 270: 28139 44. 139. Lewis, P. F., and M. Emerman. 1994. Passage through mitosis is required for oncoretroviruses but not for the human immunodeficiency virus. J Virol 68: 510 6. 140. Ley, T. J., N. P. Anagnou, C. T. Noguchi, A. N. Schechter, J. DeSimone, P. Heller, and A. W. Nienhuis. 1983. DNA methylation and globin gene expression in patients treated with 5 azacytidine. Prog Clin Biol Res 134: 457 74. 141. Ley, T. J., J. DeSimone, N. P. Anagnou, G. H. Keller, R. K. Humphries, P. H. Turner, N. S. Young, P. Keller, and A. W. Nienhuis. 1982. 5 azacytidine selectively

PAGE 148

148 increases gamma globin synthesis in a patient with beta+ thalassemia. N Engl J Med 307: 1469 75. 142. Ley, T. J., J. DeSimone, C. T. Noguchi, P. H. Turne r, A. N. Schechter, P. Heller, and A. W. Nienhuis. 1983. 5 Azacytidine increases gamma globin synthesis and reduces the proportion of dense cells in patients with sickle cell anemia. Blood 62: 370 80. 143. Li, Q., K. R. Peterson, X. Fang, and G. Stamatoyann opoulos. 2002. Locus control regions. Blood 100: 3077 86. 144. Li, Q., and G. Stamatoyannopoulos. 1994. Hypersensitive site 5 of the human beta locus control region functions as a chromatin insulator. Blood 84: 1399 401. 145. Li, Q., M. Zhang, Z. Duan, and G Stamatoyannopoulos. 1999. Structural analysis and mapping of DNase I hypersensitivity of HS5 of the beta globin locus control region. Genomics 61: 183 93. 146. Li, Q., M. Zhang, H. Han, A. Rohde, and G. Stamatoyannopoulos. 2002. Evidence that DNase I hype rsensitive site 5 of the human beta globin locus control region functions as a chromosomal insulator in transgenic mice. Nucleic Acids Res 30: 2484 91. 147. Li, X., X. Hu, B. Patel, Z. Zhou, S. Liang, R. Ybarra, Y. Qiu, G. Felsenfeld, J. Bungert, and S. Hua ng. H4R3 methylation facilitates beta globin transcription by regulating histone acetyltransferase binding and H3 acetylation. Blood 115: 2028 37. 148. Liang, S. Y., B. Moghimi, V. J. Crusselle Davis, I. J. Lin, M. H. Rosenberg, X. Li, J. Strouboulis, S. Hu ang, and J. Bungert. 2009. Defective erythropoiesis in transgenic mice expressing dominant negative upstream stimulatory factor. Mol Cell Biol 29: 5900 10. 149. Lin, I. J., Z. Zhou, V. J. Crusselle Davis, B. Moghimi, K. Gandhi, A. Anantharaman, D. Pantic, S Huang, G. Jayandharan, L. Zhong, A. Srivastava, and J. Bungert. 2009. Calpeptin increases the activity of upstream stimulatory factor and induces high level globin gene expression in erythroid cells. J Biol Chem 284: 20130 5. 150. Ling, J., L. Ainol, L. Z hang, X. Yu, W. Pi, and D. Tuan. 2004. HS2 enhancer function is blocked by a transcriptional terminator inserted between the enhancer and the promoter. J Biol Chem 279: 51704 13. 151. Ling, J., B. Baibakov, W. Pi, B. M. Emerson, and D. Tuan. 2005. The HS2 e nhancer of the beta globin locus control region initiates synthesis of non coding, polyadenylated RNAs independent of a cis linked globin promoter. J Mol Biol 350: 883 96. 152. Lisowski, L., and M. Sadelain. 2008. Current status of globin gene therapy for t he treatment of beta thalassaemia. Br J Haematol 141: 335 45. 153. Liu, J. J., S. C. Hou, and C. K. Shen. 2003. Erythroid gene suppression by NF kappa B. J Biol Chem 278: 19534 40.

PAGE 149

149 154. Liu, L. F., and J. C. Wang. 1979. Interaction between DNA and Escherichi a coli DNA topoisomerase I. Formation of complexes between the protein and superhelical and nonsuperhelical duplex DNAs. J Biol Chem 254: 11082 8. 155. Lowrey, C. H., D. M. Bodine, and A. W. Nienhuis. 1992. Mechanism of DNase I hypersensitive site formation within the human globin locus control region. Proc Natl Acad Sci U S A 89: 1143 7. 156. Lucarelli, G., M. Andreani, and E. Angelucci. 2002. The cure of thalassemia by bone marrow transplantation. Blood Rev 16: 81 5. 157. Ma, Z., B. Jhun, S. Y. Jung, and C. K. Oh. 2008. Binding of upstream stimulatory factor 1 to the E box regulates the 4G/5G polymorphism dependent plasminogen activator inhibitor 1 expression in mast cells. J Allergy Clin Immunol 121: 1006 1012 e2. 158. Mabaera, R., R. J. West, S. J. Conine, E R. Macari, C. D. Boyd, C. A. Engman, and C. H. Lowrey. 2008. A cell stress signaling model of fetal hemoglobin induction: what doesn't kill red blood cells may make them stronger. Exp Hematol 36: 1057 72. 159. Magram, J., K. Chada, and F. Costantini. 1985 Developmental regulation of a cloned adult beta globin gene in transgenic mice. Nature 315: 338 40. 160. Mammoto, A., K. M. Connor, T. Mammoto, C. W. Yung, D. Huh, C. M. Aderman, G. Mostoslavsky, L. E. Smith, and D. E. Ingber. 2009. A mechanosensitive tra nscriptional mechanism that controls angiogenesis. Nature 457: 1103 8. 161. Manwani, D., and J. J. Bieker. 2008. The erythroblastic island. Curr Top Dev Biol 82: 23 53. 162. Maravall, M., Z. F. Mainen, B. L. Sabatini, and K. Svoboda. 2000. Estimating intrace llular calcium concentrations and buffering without wavelength ratioing. Biophys J 78: 2655 67. 163. Marks, P. A., and R. A. Rifkind. 1978. Erythroleukemic differentiation. Annu Rev Biochem 47: 419 48. 164. Masumoto, H., T. Yoshizawa, H. Sorimachi, T. Nishin o, S. Ishiura, and K. Suzuki. 1998. Overexpression, purification, and characterization of human m calpain and its active site mutant, m C105S calpain, using a baculovirus expression system. J Biochem 124: 957 61. 165. May, C., S. Rivella, J. Callegari, G. H eller, K. M. Gaensler, L. Luzzatto, and M. Sadelain. 2000. Therapeutic haemoglobin synthesis in beta thalassaemic mice expressing lentivirus encoded human beta globin. Nature 406: 82 6. 166. McGrath, K., and J. Palis. 2008. Ontogeny of erythropoiesis in the mammalian embryo. Curr Top Dev Biol 82: 1 22.

PAGE 150

150 167. McGrath, K. E., P. D. Kingsley, A. D. Koniski, R. L. Porter, T. P. Bushnell, and J. Palis. 2008. Enucleation of primitive erythroid cells generates a transient population of "pyrenocytes" in the mammalian fetus. Blood 111: 2409 17. 168. Means, A. L., and P. J. Farnham. 1990. Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site. Mol Cell Biol 10: 653 61. 169. Miles, J., J. A. Mitchell, L. Chaka lova, B. Goyenechea, C. S. Osborne, L. O'Neill, K. Tanimoto, J. D. Engel, and P. Fraser. 2007. Intergenic transcription, cell cycle and the developmentally regulated epigenetic profile of the human beta globin locus. PLoS ONE 2: e630. 170. Milot, E., J. Str ouboulis, T. Trimborn, M. Wijgerde, E. de Boer, A. Langeveld, K. Tan Un, W. Vergeer, N. Yannoutsos, F. Grosveld, and P. Fraser. 1996. Heterochromatin effects on the frequency and duration of LCR mediated gene transcription. Cell 87: 105 14. 171. Misiti, J., and J. L. Spivak. 1979. Erythropoiesis in vitro. Role of calcium. J Clin Invest 64: 1573 9. 172. Modell, B., and M. Darlison. 2008. Global epidemiology of haemoglobin disorders and derived service indicators. Bull World Health Organ 86: 480 7. 173. Molete, J. M., H. Petrykowska, E. E. Bouhassira, Y. Q. Feng, W. Miller, and R. C. Hardison. 2001. Sequences flanking hypersensitive sites of the beta globin locus control region are required for synergistic enhancement. Mol Cell Biol 21: 2969 80. 174. Mondal, N., Y Zhang, Z. Jonsson, S. K. Dhar, M. Kannapiran, and J. D. Parvin. 2003. Elongation by RNA polymerase II on chromatin templates requires topoisomerase activity. Nucleic Acids Res 31: 5016 24. 175. Nakamura, M., M. Mori, Y. Morishita, S. Mori, and S. Kawashim a. 1992. Specific increase in calcium activated neutral protease with low calcium sensitivity (m calpain) in proerythroblastic K562 cell line cells induced to differentiation by phorbol 12 myristate 13 acetate. Exp Cell Res 200: 513 22. 176. Nitiss, J. L. 1 998. Investigating the biological functions of DNA topoisomerases in eukaryotic cells. Biochim Biophys Acta 1400: 63 81. 177. Novina, C. D., V. Cheriyath, and A. L. Roy. 1998. Regulation of TFII I activity by phosphorylation. J Biol Chem 273: 33443 8. 178. O 'Shea Greenfield, A., and S. T. Smale. 1992. Roles of TATA and initiator elements in determining the start site location and direction of RNA polymerase II transcription. J Biol Chem 267: 6450.

PAGE 151

151 179. Ohno, S., S. Minoshima, J. Kudoh, R. Fukuyama, Y. Shimizu, S. Ohmi Imajoh, N. Shimizu, and K. Suzuki. 1990. Four genes for the calpain family locate on four distinct human chromosomes. Cytogenet Cell Genet 53: 225 9. 180. Orkin, S. H. 1995. Regulation of globin gene expression in erythroid cells. Eur J Biochem 231 : 271 81. 181. Orkin, S. H. 1995. Transcription factors and hematopoietic development. J Biol Chem 270: 4955 8. 182. Orkin, S. H., and L. I. Zon. 2008. Hematopoiesis: an evolving paradigm for stem cell biology. Cell 132: 631 44. 183. Palis, J., S. Robertson, M. Kennedy, C. Wall, and G. Keller. 1999. Development of erythroid and myeloid progenitors in the yolk sac and embryo proper of the mouse. Development 126: 5073 84. 184. Pandey, A., and M. Mann. 2000. Proteomics to study genes and genomes. Nature 405: 837 46 185. Papayannopoulou, T., A. Torrealba de Ron, R. Veith, G. Knitter, and G. Stamatoyannopoulos. 1984. Arabinosylcytosine induces fetal hemoglobin in baboons by perturbing erythroid cell differentiation kinetics. Science 224: 617 9. 186. Park, C. Y., and R Dolmetsch. 2006. Cell signaling. The double life of a transcription factor takes it outside the nucleus. Science 314: 64 5. 187. Parker, R., T. Phan, P. Baumeister, B. Roy, V. Cheriyath, A. L. Roy, and A. S. Lee. 2001. Identification of TFII I as the endo plasmic reticulum stress response element binding factor ERSF: its autoregulation by stress and interaction with ATF6. Mol Cell Biol 21: 3220 33. 188. Patterson, R. L., D. B. van Rossum, D. L. Ford, K. J. Hurt, S. S. Bae, P. G. Suh, T. Kurosaki, S. H. Snyde r, and D. L. Gill. 2002. Phospholipase C gamma is required for agonist induced Ca2+ entry. Cell 111: 529 41. 189. Pauling, L., H. A. Itano, and et al. 1949. Sickle cell anemia a molecular disease. Science 110: 543 8. 190. Pawliuk, R., K. A. Westerman, M. E. Fabry, E. Payen, R. Tighe, E. E. Bouhassira, S. A. Acharya, J. Ellis, I. M. London, C. J. Eaves, R. K. Humphries, Y. Beuzard, R. L. Nagel, and P. Leboulch. 2001. Correction of sickle cell disease in transgenic mouse models by gene therapy. Science 294: 2368 71. 191. Persons, D. A. 2010. Gene therapy: Targeting beta thalassaemia. Nature 467: 277 8. 192. Perumbeti, A., and P. Malik. 2010. Therapy for beta globinopathies: a brief review and determinants for successful and safe correction. Ann N Y Acad Sci 1202: 3 6 44.

PAGE 152

152 193. Perutz, M. F., M. G. Rossmann, A. F. Cullis, H. Muirhead, G. Will, and A. C. North. 1960. Structure of haemoglobin: a three dimensional Fourier synthesis at 5.5 A. resolution, obtained by X ray analysis. Nature 185: 416 22. 194. Peschle, C., F. M avilio, A. Care, G. Migliaccio, A. R. Migliaccio, G. Salvo, P. Samoggia, S. Petti, R. Guerriero, M. Marinucci, and et al. 1985. Haemoglobin switching in human embryos: asynchrony of zeta ---alpha and epsilon ---gamma globin switches in primitive and defini te erythropoietic lineage. Nature 313: 235 8. 195. Piomelli, S., S. J. Danoff, M. H. Becker, M. J. Lipera, and S. F. Travis. 1969. Prevention of bone malformations and cardiomegaly in Cooley's anemia by early hypertransfusion regimen. Ann N Y Acad Sci 165: 4 27 36. 196. Platt, O. S. 2008. Hydroxyurea for the treatment of sickle cell anemia. N Engl J Med 358: 1362 9. 197. Pouny, Y., C. Weitzman, and H. R. Kaback. 1998. In vitro biotinylation provides quantitative recovery of highly purified active lactose permea se in a single step. Biochemistry 37: 15713 9. 198. Puthenveetil, G., J. Scholes, D. Carbonell, N. Qureshi, P. Xia, L. Zeng, S. Li, Y. Yu, A. L. Hiti, J. K. Yee, and P. Malik. 2004. Successful correction of the human beta thalassemia major phenotype using a lentiviral vector. Blood 104: 3445 53. 199. Rachmilewitz, E. A., O. Weizer Stern, K. Adamsky, N. Amariglio, G. Rechavi, L. Breda, S. Rivella, and Z. I. Cabantchik. 2005. Role of iron in inducing oxidative stress in thalassemia: Can it be prevented by inhib ition of absorption and by antioxidants? Ann N Y Acad Sci 1054: 118 23. 200. Ramos, P., L. Melchiori, S. Gardenghi, N. Van Roijen, R. W. Grady, Y. Ginzburg, and S. Rivella. 2010. Iron metabolism and ineffective erythropoiesis in beta thalassemia mouse model s. Ann N Y Acad Sci 1202: 24 30. 201. Ravasi, T., H. Suzuki, C. V. Cannistraci, S. Katayama, V. B. Bajic, K. Tan, A. Akalin, S. Schmeier, M. Kanamori Katayama, N. Bertin, P. Carninci, C. O. Daub, A. R. Forrest, J. Gough, S. Grimmond, J. H. Han, T. Hashimoto W. Hide, O. Hofmann, A. Kamburov, M. Kaur, H. Kawaji, A. Kubosaki, T. Lassmann, E. van Nimwegen, C. R. MacPherson, C. Ogawa, A. Radovanovic, A. Schwartz, R. D. Teasdale, J. Tegner, B. Lenhard, S. A. Teichmann, T. Arakawa, N. Ninomiya, K. Murakami, M. Tag ami, S. Fukuda, K. Imamura, C. Kai, R. Ishihara, Y. Kitazume, J. Kawai, D. A. Hume, T. Ideker, and Y. Hayashizaki. 2010. An atlas of combinatorial transcriptional regulation in mouse and man. Cell 140: 744 52. 202. Ribeil, J. A., Y. Zermati, J. Vandekerckho ve, S. Cathelin, J. Kersual, M. Dussiot, S. Coulon, I. C. Moura, A. Zeuner, T. Kirkegaard Sorensen, B. Varet, E. Solary, C. Garrido, and O. Hermine. 2007. Hsp70 regulates erythropoiesis by preventing caspase 3 mediated cleavage of GATA 1. Nature 445: 102 5.

PAGE 153

153 203. Richmond, T. D., M. Chohan, and D. L. Barber. 2005. Turning cells red: signal transduction mediated by erythropoietin. Trends Cell Biol 15: 146 55. 204. Rivella, S., C. May, A. Chadburn, I. Riviere, and M. Sadelain. 2003. A novel murine model of Coole y anemia and its rescue by lentiviral mediated human beta globin gene transfer. Blood 101: 2932 9. 205. Ronchi, A., M. Bellorini, N. Mongelli, and R. Mantovani. 1995. CCAAT box binding protein NF Y (CBF, CP1) recognizes the minor groove and distorts DNA. Nu cleic Acids Res 23: 4565 72. 206. Ross, J., and T. D. Sullivan. 1985. Half lives of beta and gamma globin messenger RNAs and of protein synthetic capacity in cultured human reticulocytes. Blood 66: 1149 54. 207. Roy, A. L. 2001. Biochemistry and biology of t he inducible multifunctional transcription factor TFII I. Gene 274: 1 13. 208. Roy, A. L. 2007. Signal induced functions of the transcription factor TFII I. Biochim Biophys Acta 1769: 613 21. 209. Roy, A. L., C. Carruthers, T. Gutjahr, and R. G. Roeder. 1993 Direct role for Myc in transcription initiation mediated by interactions with TFII I. Nature 365: 359 61. 210. Roy, A. L., S. Malik, M. Meisterernst, and R. G. Roeder. 1993. An alternative pathway for transcription initiation involving TFII I. Nature 365: 355 9. 211. Roy, A. L., M. Meisterernst, P. Pognonec, and R. G. Roeder. 1991. Cooperative interaction of an initiator binding transcription initiation factor and the helix loop helix activator USF. Nature 354: 245 8. 212. Ryan, T. M., R. R. Behringer, N. C. Martin, T. M. Townes, R. D. Palmiter, and R. L. Brinster. 1989. A single erythroid specific DNase I super hypersensitive site activates high levels of human beta globin gene expression in transgenic mice. Genes Dev 3: 314 23. 213. Salamino, F., R. De Tulli o, P. Mengotti, P. L. Viotti, E. Melloni, and S. Pontremoli. 1993. Site directed activation of calpain is promoted by a membrane associated natural activator protein. Biochem J 290 ( Pt 1): 191 7. 214. Sawado, T., J. Halow, M. A. Bender, and M. Groudine. 20 03. The beta globin locus control region (LCR) functions primarily by enhancing the transition from transcription initiation to elongation. Genes Dev 17: 1009 18. 215. Sawadogo, M. 1988. Multiple forms of the human gene specific transcription factor USF. I I. DNA binding properties and transcriptional activity of the purified HeLa USF. J Biol Chem 263: 11994 2001.

PAGE 154

154 216. Sawadogo, M., M. W. Van Dyke, P. D. Gregor, and R. G. Roeder. 1988. Multiple forms of the human gene specific transcription factor USF. I. Com plete purification and identification of USF from HeLa cell nuclei. J Biol Chem 263: 11985 93. 217. Sawyer, S. T., and S. B. Krantz. 1984. Erythropoietin stimulates Ca2+ uptake in Friend virus infected erythroid cells. J Biol Chem 259: 2769 74. 218. Schatz, P. J. 1993. Use of peptide libraries to map the substrate specificity of a peptide modifying enzyme: a 13 residue consensus peptide specifies biotinylation in Escherichia coli. Biotechnology (N Y) 11: 1138 43. 219. Seto, E., Y. Shi, and T. Shenk. 1991. YY1 is an initiator sequence binding protein that directs and activates transcription in vitro. Nature 354: 241 5. 220. Settleman, J. 2003. A nuclear MAL function links Rho to SRF. Mol Cell 11: 1121 3. 221. Shimotsuma, M., H. Matsuzaki, O. Tanabe, A. D. Campbell J. D. Engel, A. Fukamizu, and K. Tanimoto. 2007. Linear distance from the locus control region determines epsilon globin transcriptional activity. Mol Cell Biol 27: 5664 72. 222. Siddiqui, A. A., Y. Zhou, R. B. Podesta, S. R. Karcz, C. E. Tognon, G. H. St rejan, G. A. Dekaban, and M. W. Clarke. 1993. Characterization of Ca(2+) dependent neutral protease (calpain) from human blood flukes, Schistosoma mansoni. Biochim Biophys Acta 1181: 37 44. 223. Singal, R., R. Ferris, J. A. Little, S. Z. Wang, and G. D. Gin der. 1997. Methylation of the minimal promoter of an embryonic globin gene silences transcription in primary erythroid cells. Proc Natl Acad Sci U S A 94: 13724 9. 224. Sirito, M., Q. Lin, J. M. Deng, R. R. Behringer, and M. Sawadogo. 1998. Overlapping role s and asymmetrical cross regulation of the USF proteins in mice. Proc Natl Acad Sci U S A 95: 3758 63. 225. Sirito, M., Q. Lin, T. Maity, and M. Sawadogo. 1994. Ubiquitous expression of the 43 and 44 kDa forms of transcription factor USF in mammalian cells Nucleic Acids Res 22: 427 33. 226. Smale, S. T. 1997. Transcription initiation from TATA less promoters within eukaryotic protein coding genes. Biochim Biophys Acta 1351: 73 88. 227. Smale, S. T., and D. Baltimore. 1989. The "initiator" as a transcription control element. Cell 57: 103 13. 228. Song, S. H., C. Hou, and A. Dean. 2007. A positive role for NLI/Ldb1 in long range beta globin locus control region function. Mol Cell 28: 810 22. 229. Stamatoyannopoulos, G. 2005. Control of globin gene expression duri ng development and erythroid differentiation. Exp Hematol 33: 259 71.

PAGE 155

155 230. Stamatoyannopoulos, G. 1994. The Molecular basis of blood diseases, 2nd ed. W.B. Saunders, Philadelphia. 231. Steinberg, M. H. 2001. Disorders of hemoglobin : genetics, pathophysiolo gy, and clinical management. Cambridge University Press, New York. 232. Thomas, M. C., and C. M. Chiang. 2006. The general transcription machinery and general cofactors. Crit Rev Biochem Mol Biol 41: 105 78. 233. Tolhuis, B., R. J. Palstra, E. Splinter, F. Grosveld, and W. de Laat. 2002. Looping and interaction between hypersensitive sites in the active beta globin locus. Mol Cell 10: 1453 65. 234. Tong, Q., I. Hirschler Laszkiewicz, W. Zhang, K. Conrad, D. W. Neagley, D. L. Barber, J. Y. Cheung, and B. A. Mi ller. 2008. TRPC3 is the erythropoietin regulated calcium channel in human erythroid cells. J Biol Chem 283: 10385 95. 235. Torrealba de Ron, A. T., T. Papayannopoulou, M. S. Knapp, M. F. Fu, G. Knitter, and G. Stamatoyannopoulos. 1984. Perturbations in the erythroid marrow progenitor cell pools may play a role in the augmentation of HbF by 5 azacytidine. Blood 63: 201 10. 236. Townes, T. M., J. B. Lingrel, H. Y. Chen, R. L. Brinster, and R. D. Palmiter. 1985. Erythroid specific expression of human beta globi n genes in transgenic mice. Embo J 4: 1715 23. 237. Tsiftsoglou, A. S., I. S. Vizirianakis, and J. Strouboulis. 2009. Erythropoiesis: model systems, molecular regulators, and developmental programs. IUBMB Life 61: 800 30. 238. Tuan, D., S. Kong, and K. Hu. 1 992. Transcription of the hypersensitive site HS2 enhancer in erythroid cells. Proc Natl Acad Sci U S A 89: 11219 23. 239. Tuan, D., W. Solomon, Q. Li, and I. M. London. 1985. The "beta like globin" gene domain in human erythroid cells. Proc Natl Acad Sci U S A 82: 6384 8. 240. Tuan, D. Y., W. B. Solomon, I. M. London, and D. P. Lee. 1989. An erythroid specific, developmental stage independent enhancer far upstream of the human "beta like globin" genes. Proc Natl Acad Sci U S A 86: 2554 8. 241. Tussie Luna, M. I., D. Bayarsaihan, E. Seto, F. H. Ruddle, and A. L. Roy. 2002. Physical and functional interactions of histone deacetylase 3 with TFII I family proteins and PIASxbeta. Proc Natl Acad Sci U S A 99: 12807 12. 242. van Rossum, D. B., R. L. Patterson, S. Shar ma, R. K. Barrow, M. Kornberg, D. L. Gill, and S. H. Snyder. 2005. Phospholipase Cgamma1 controls surface expression of TRPC3 through an intermolecular PH domain. Nature 434: 99 104.

PAGE 156

156 243. Vieira, K. F., P. P. Levings, M. A. Hill, V. J. Crusselle, S. H. Kang J. D. Engel, and J. Bungert. 2004. Recruitment of transcription complexes to the beta globin gene locus in vivo and in vitro. J Biol Chem 279: 50350 7. 244. Wall, L., E. deBoer, and F. Grosveld. 1988. The human beta globin gene 3' enhancer contains multip le binding sites for an erythroid specific protein. Genes Dev 2: 1089 100. 245. Wall, L., N. Destroismaisons, N. Delvoye, and L. G. Guy. 1996. CAAT/enhancer binding proteins are involved in beta globin gene expression and are differentially expressed in mur ine erythroleukemia and K562 cells. J Biol Chem 271: 16477 84. 246. Walters, M. C., S. Fiering, J. Eidemiller, W. Magis, M. Groudine, and D. I. Martin. 1995. Enhancers increase the probability but not the level of gene expression. Proc Natl Acad Sci U S A 9 2: 7125 9. 247. Wang, J., W. Ka, D. Sun, W. Yao, Z. Wen, and S. Chien. 2006. Biochemical and biophysical studies on the precursor cells of mouse erythrocytes at different stages. Cell Biochem Biophys 45: 147 56. 248. Wang, J. C. 2002. Cellular roles of DNA t opoisomerases: a molecular perspective. Nat Rev Mol Cell Biol 3: 430 40. 249. Watanabe, T., S. Nomura, T. Kaneko, S. Yamagoe, T. Kamiya, and M. Oishi. 1988. Cytoplasmic factors involved in erythroid differentiation in mouse erythroleukemia (MEL) cells. Cell Differ Dev 25 Suppl: 105 9. 250. Watanabe, T., S. Nomura, T. Kaneko, S. Yamagoe, and M. Oishi. 1988. Intracellular factors involved in erythroid differentiation of mouse erythroleukaemia cells. IARC Sci Publ : 43 53. 251. Watt, F., and P. L. Molloy. 1993. Sp ecific cleavage of transcription factors by the thiol protease, m calpain. Nucleic Acids Res 21: 5092 100. 252. Weatherall, D. J. 2001. Phenotype genotype relationships in monogenic disease: lessons from the thalassaemias. Nat Rev Genet 2: 245 55. 253. Weint raub, H., and M. Groudine. 1976. Chromosomal subunits in active genes have an altered conformation. Science 193: 848 56. 254. Wickrema, A., and J. D. Crispino. 2007. Erythroid and megakaryocytic transformation. Oncogene 26: 6803 15. 255. Wijgerde, M., F. Gro sveld, and P. Fraser. 1995. Transcription complex stability and chromatin dynamics in vivo. Nature 377: 209 13. 256. Wittschieben, B. O., G. Otero, T. de Bizemont, J. Fellows, H. Erdjument Bromage, R. Ohba, Y. Li, C. D. Allis, P. Tempst, and J. Q. Svejstrup 1999. A novel histone

PAGE 157

157 acetyltransferase is an integral subunit of elongating RNA polymerase II holoenzyme. Mol Cell 4: 123 8. 257. Wolfe, L., N. Olivieri, D. Sallan, S. Colan, V. Rose, R. Propper, M. H. Freedman, and D. G. Nathan. 1985. Prevention of card iac disease by subcutaneous deferoxamine in patients with thalassemia major. N Engl J Med 312: 1600 3. 258. Wolman, I. J., and M. Ortolani. 1969. Some clinical features of Cooley's anemia patients as related to transfusion schedules. Ann N Y Acad Sci 165: 40 7 14. 259. Wood, M. A., and W. H. Walker. 2009. USF1/2 transcription factor DNA binding activity is induced during rat Sertoli cell differentiation. Biol Reprod 80: 24 33. 260. Yajima, Y., and S. Kawashima. 2002. Calpain function in the differentiation of m esenchymal stem cells. Biol Chem 383: 757 64. 261. Yang, W., and S. Desiderio. 1997. BAP 135, a target for Bruton's tyrosine kinase in response to B cell receptor engagement. Proc Natl Acad Sci U S A 94: 604 9. 262. Yoshida, H., Y. Okabe, K. Kawane, H. Fukuy ama, and S. Nagata. 2005. Lethal anemia caused by interferon beta produced in mouse embryos carrying undigested DNA. Nat Immunol 6: 49 56. 263. Zenzie Gregory, B., A. O'Shea Greenfield, and S. T. Smale. 1992. Similar mechanisms for transcription initiation mediated through a TATA box or an initiator element. J Biol Chem 267: 2823 30. 264. Zhang, H., J. C. Wang, and L. F. Liu. 1988. Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes. Proc Natl Acad Sci U S A 85: 1060 4. 265. Zhang, M. Y., S. C. Sun, L. Bell, and B. A. Miller. 1998. NF kappaB transcription factors are involved in normal erythropoiesis. Blood 91: 4136 44. 266. Zhang, Y., M. Q. Hassan, Z. Y. Li, J. L. Stein, J. B. Lian, A. J. van Wijnen, and G. S. Stein. 2008. Intricate gene regulatory networks of helix loop helix (HLH) proteins support regulation of bone tissue related genes during osteoblast differentiation. J Cell Biochem 105: 487 96. 267. Zhou, Z., X. Li, C. Deng, P. A. Ney, S. Huang, and J. Bungert. 2010. USF and NF E2 cooperate to regulate the recruitment and activity of RNA polymerase II in the beta globin gene locus. J Biol Chem 285: 15894 905. 268. Zhou, Z., X. Li, C. Deng, P. A. Ney, S. Huang, and J. Bungert. USF and NF E2 cooperate to regulate the recruitment and activity of RNA polymerase II in the beta globin gene locus. J Biol Chem 285: 15894 905.

PAGE 158

158 269. Zhu, J., D. M. Giannola, Y. Zhang, A. J. Rivera, and S. G. Emerson. 2003. NF Y cooperates with USF1/2 to induce the hematopoietic expression of HOXB4. Blood 102: 2 420 7. 270. Zurlo, M. G., P. De Stefano, C. Borgna Pignatti, A. Di Palma, A. Piga, C. Melevendi, F. Di Gregorio, M. G. Burattini, and S. Terzoli. 1989. Survival and causes of death in thalassaemia major. Lancet 2: 27 30.

PAGE 159

159 BIOGRAPHICAL SKETCH I Ju Lin was born in 1976. She grew up in a small and peaceful town in the vicin ity of metropolitan Taipei, Taiwan. Since little, her mother bought her a number of books in various topics including nature, science, history, and biography of well known people who have benefited the human societies through their contributions. As readin g these books, the enthusiasm to learn more about the source, the meanings of the existence, and the operating principles of the universe and to pursue a state of Utopia in the human society was developed rapidly in her young heart. In primary school she enjoyed all kinds of activities and learning the knowledge and information that leads to the understanding of this world. She was always ranked within the first three places in every exam although she never studied for exams but for satisfying her curiosities. Despite all the searching and exploring, deep inside of her, however, was still not satisfied because non of the human wisdom ever really answer her questions about the meanings of human life and the universe. Until she met a group of Chri stians in Chung Shan high school, through the revelation and enlightening of the truth in the Bible, she realized the meanings of her existence in the universe was to contain God and express God in Christ Jesus with all the believers. This made her life ch anged completely and she has been very much involved in the church life since then. In the second year of her high school, she was awarded silver in a scientific fair in c hemistry. After high school and passing the college entrance exams, i n order to obt ain the most fundamental training for scientific research, she chose to major in physics, the mother of science, in Cheng Kung University. Because of the calling of the Lord, she decided to spend two years in Bible School after getting her Bachelor of Scie nce degree in 2000. During that time, she met a friend who suffered a disease that maybe caused by genetic defect. This triggered her to pursue

PAGE 160

160 higher education in Biology in order to find cure for genetic diseases. She worked as a research assistant in Biotechnology Institute in Cheng Kung University for one year before coming to the USA. In 2004 she obtained her Master in Molecular Genetics and Biochemistry as well as Bioinformatics double concentrations in Georgia State University in Atlanta, Georgia. In 2005, she was accepted by the Interdiciplinary program in the College of Medicine, University of Florida and she earned her Ph. D. in Genetics in 2010. After acquiring all the professional knowledge and skills, she would like to apply what she lear ned in the research units in the hospital or work in the industry preferentially the therapeutic oriental biotechnology company.